U.S. patent application number 16/551503 was filed with the patent office on 2020-03-12 for oligonucleotide compositions and methods thereof.
The applicant listed for this patent is WAVE LIFE SCIENCES LTD.. Invention is credited to Christopher J. Francis, , Susovan Mohapatra, Anna Sokolovska, Nenad Svrzikapa, Chandra Vargeese, Gregory L. Verdine.
Application Number | 20200080083 16/551503 |
Document ID | / |
Family ID | 57835219 |
Filed Date | 2020-03-12 |
![](/patent/app/20200080083/US20200080083A1-20200312-C00001.png)
![](/patent/app/20200080083/US20200080083A1-20200312-C00002.png)
![](/patent/app/20200080083/US20200080083A1-20200312-C00003.png)
![](/patent/app/20200080083/US20200080083A1-20200312-C00004.png)
![](/patent/app/20200080083/US20200080083A1-20200312-C00005.png)
![](/patent/app/20200080083/US20200080083A1-20200312-C00006.png)
![](/patent/app/20200080083/US20200080083A1-20200312-C00007.png)
![](/patent/app/20200080083/US20200080083A1-20200312-C00008.png)
![](/patent/app/20200080083/US20200080083A1-20200312-C00009.png)
![](/patent/app/20200080083/US20200080083A1-20200312-C00010.png)
![](/patent/app/20200080083/US20200080083A1-20200312-C00011.png)
View All Diagrams
United States Patent
Application |
20200080083 |
Kind Code |
A1 |
Vargeese; Chandra ; et
al. |
March 12, 2020 |
OLIGONUCLEOTIDE COMPOSITIONS AND METHODS THEREOF
Abstract
Among other things, the present disclosure relates to chirally
controlled oligonucleotides of select designs, chirally controlled
oligonucleotide compositions, and methods of making and using the
same. In some embodiments, a provided chirally controlled
oligonucleotide composition provides different cleavage patterns of
a nucleic acid polymer than a reference oligonucleotide
composition. In some embodiments, a provided chirally controlled
oligonucleotide composition provides single site cleavage within a
complementary sequence of a nucleic acid polymer. In some
embodiments, a chirally controlled oligonucleotide composition has
any sequence of bases, and/or pattern or base modifications, sugar
modifications, backbone modifications and/or stereochemistry, or
combination of these elements, described herein.
Inventors: |
Vargeese; Chandra;
(Schwenksville, PA) ; ; ; Meena; (Belmont, MA)
; Svrzikapa; Nenad; (Cambridge, MA) ; Mohapatra;
Susovan; (Belmont, MA) ; Francis; Christopher J.;
(Arlington, MA) ; Verdine; Gregory L.; (Boston,
MA) ; Sokolovska; Anna; (Somerville, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
WAVE LIFE SCIENCES LTD. |
Singapore |
|
SG |
|
|
Family ID: |
57835219 |
Appl. No.: |
16/551503 |
Filed: |
August 26, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15746220 |
Jan 19, 2018 |
10479995 |
|
|
PCT/US16/43542 |
Jul 22, 2016 |
|
|
|
16551503 |
|
|
|
|
62195779 |
Jul 22, 2015 |
|
|
|
62236847 |
Oct 2, 2015 |
|
|
|
62331960 |
May 4, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 25/28 20180101;
C12N 2310/346 20130101; C12N 15/115 20130101; A61P 25/14 20180101;
C12N 2310/315 20130101; C12N 2310/321 20130101; C12N 15/113
20130101; C12N 2310/322 20130101; C12N 2310/341 20130101; A61P
43/00 20180101; C12N 2310/322 20130101; C12N 2310/3525
20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; A61P 25/28 20060101 A61P025/28; C12N 15/115 20060101
C12N015/115 |
Claims
1-41. (canceled)
42. A method for treating Huntington's disease in a subject,
comprising administering to the subject a therapeutically effective
amount of an oligonucleotide having the structure of: mG *
SmGmCmAmC * SA * SA * SG * SG * SG * SC * SA * SC * RA * SG *
SmAmCmUmU * SmC (SEQ ID NO: 360), or a pharmaceutically acceptable
salt thereof, wherein: S represents a Sp phosphorothioate; R
represents a Rp phosphorothioate; and m represents a 2'-OMe
modification to a nucleoside.
43. The method of claim 42, wherein the oligonucleotide is in a
salt form.
44. The method of claim 42, wherein the oligonucleotide is a sodium
salt.
45. The method of claim 42, wherein the subject has an rs362307
allele which is associated with Huntington's disease and is 100%
complementary to the base sequence of the oligonucleotide.
46. The method of claim 43, wherein the subject has an rs362307
allele which is associated with Huntington's disease and is 100%
complementary to the base sequence of the oligonucleotide.
47. The method of claim 44, wherein the subject has an rs362307
allele which is associated with Huntington's disease and is 100%
complementary to the base sequence of the oligonucleotide.
48. A method for treating Huntington's disease in a subject,
comprising administering to the subject a pharmaceutical
composition which comprises a therapeutically effective amount of
an oligonucleotide and at least one pharmaceutically acceptable
inactive ingredient selected from pharmaceutically acceptable
diluents, pharmaceutically acceptable excipients, and
pharmaceutically acceptable carriers, wherein the oligonucleotide
has the structure of: mG * SmGmCmAmC * SA * SA * SG * SG * SG * SC
* SA * SC * RA * SG* SmAmCmUmU * SmC (SEQ ID NO: 360), or a
pharmaceutically acceptable salt thereof, wherein: * S represents a
Sp phosphorothioate; *R represents a Rp phosphorothioate; and m
represents a 2'-OMe modification to a nucleoside.
49. The method of claim 48, wherein the oligonucleotide is in a
salt form.
50. The method of claim 48, wherein the oligonucleotide is a sodium
salt.
51. The method of claim 48, wherein the subject has an rs362307
allele which is associated with Huntington's disease and is 100%
complementary to the base sequence of the oligonucleotide.
52. The method of claim 49, wherein the subject has an rs362307
allele which is associated with Huntington's disease and is 100%
complementary to the base sequence of the oligonucleotide.
53. The method of claim 50, wherein the subject has an rs362307
allele which is associated with Huntington's disease and is 100%
complementary to the base sequence of the oligonucleotide.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional application of U.S.
application Ser. No. 15/746,220, filed Jan. 19, 2018, issued as
U.S. Pat. No. 10,479,995, which is a U.S. National Stage
Application of International PCT Application Number
PCT/US2016/043542, filed Jul. 22, 2016, which claims priority to
United States Provisional Application Nos. 62/195,779, filed Jul.
22, 2015, 62/236,847, filed Oct. 2, 2015, and 62/331,960, filed May
4, 2016, the entirety of each of which is incorporated herein by
reference.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Nov. 25, 2019, is named SL.txt and is 420,949 bytes in size.
BACKGROUND
[0003] Oligonucleotides are useful in therapeutic, diagnostic,
research and nanomaterials applications. The use of naturally
occurring nucleic acids (e.g., unmodified DNA or RNA) for
therapeutics can be limited, for example, because of their
instability against extra- and intracellular nucleases and/or their
poor cell penetration and distribution. There is a need for new and
improved oligonucleotides and oligonucleotide compositions, such
as, e.g., new antisense and siRNA oligonucleotides and
oligonucleotide compositions.
SUMMARY
[0004] Among other things, the present disclosure encompasses the
recognition that structural elements of oligonucleotides, such as
base sequence, chemical modifications (e.g., modifications of
sugar, base, and/or internucleotidic linkages, and patterns
thereof), and/or stereochemistry (e.g., stereochemistry of backbone
chiral centers (chiral internucleotidic linkages), and/or patterns
thereof), can have significant impact on properties, e.g.,
activities, of oligonucleotides. In some embodiments, the present
disclosure demonstrates that oligonucleotide compositions
comprising oligonucleotides with controlled structural elements,
e.g., controlled chemical modification and/or controlled backbone
stereochemistry patterns, provide unexpected properties, including
but not limited to those described herein. In some embodiments, the
present disclosure demonstrates that combinations of chemical
modifications and stereochemistry can provide unexpected, greatly
improved properties (e.g., bioactivity, selectivity, etc.). In some
embodiments, the present disclosure provides an oligonucleotide
composition having a particular sequence of bases, and/or pattern
of sugar modifications (e.g., 2'-OMe, 2'-F, 2'-MOE, etc.), and/or
pattern or base modifications (e.g., 5-methylcytosine), and/or
pattern of backbone modifications (phosphate or phosphorothioate),
and/or pattern of stereochemistry of backbone modifications (e.g.,
each phosphorothioate is Sp or Rp).
[0005] In some embodiments, modifications of internucleotidic
linkages can convert phosphorus atoms in modified linkages into
chiral centers. For example, in a phosphorothioate (PS)
modification, one of the non-bridging oxygen (O) atoms bonded to a
phosphorus (P) atom is replaced with a sulfur (S) atom. A
consequence of using PS modification in oligonucleotide synthesis
is that it creates a chiral center at phosphorus, which can have
either an "Sp" or "Rp" configuration. For instance, a conventional
stereorandom PS-modified oligonucleotide composition having 19 PS
linkages [e.g., having 20 nucleotides in length, 19 PS
modifications, each with two possible stereochemistries (Sp or Rp)
at each PS modification] is a random mixture of over 500,000
(2.sup.19) stereoisomers, each having the same nucleotide sequence
(e.g., sequence of bases) but differing in the stereochemistry
along their backbones; such a composition is a "stereorandom"
oligonucleotide composition. In some embodiments, in contrast to
stereorandom compositions, a chirally controlled oligonucleotide
composition is a substantially pure preparation of a single
oligonucleotide in that a predetermined level of the
oligonucleotides in the composition have a common base sequence and
length, a common pattern of backbone linkages, and a common pattern
of backbone chiral centers. In some embodiments, some
oligonucleotide compositions are stereopure (i.e., a chirally
controlled oligonucleotide composition), wherein the
stereochemistry at each PS is defined (Sp or Rp). In some
embodiments, in a stereorandom compositions of oligonucleotides,
the various oligonucleotides can have the same base sequence, same
pattern of sugar modifications (e.g., 2'-OMe, 2'-F, 2'-OME, etc.),
same pattern of base modifications (e.g., 5-methylcytosine), and
same pattern of backbone modifications (phosphate or PS), but
different patterns of backbone chiral centers, and their levels are
random from non-stereocontrolled synthesis (not pre-determined as
through stereocontrolled synthesis as certain methods exemplified
herein using chiral auxilier). A chirally controlled
oligonucleotide composition can be selected to have greater desired
biological activity (e.g., greater activities, efficiency in RNA
interference or RNAse H-mediated pathways, etc.) and decreased
undesired activity (e.g., undesired immunogenicity, toxicity, etc.)
than a stereorandom preparation of oligonucleotides of the same
base sequence. In some embodiments, a chirally controlled
oligonucleotide composition is better able to differentiate between
a mutant (mu) and a wild-type (wt) HTT sequence (with a single nt
difference).
[0006] Among other things, the present disclosure encompasses the
recognition that stereorandom oligonucleotide preparations contain
a plurality of distinct chemical entities that differ from one
another, e.g., in the stereochemical structure of individual
backbone chiral centers within the oligonucleotide chain. Without
control of stereochemistry of backbone chiral centers, stereorandom
oligonucleotide preparations provide uncontrolled compositions
comprising undetermined levels of oligonucleotide stereoisomers.
Even though these stereoisomers may have the same base sequence,
they are different chemical entities at least due to their
different backbone stereochemistry, and they can have, as
demonstrated herein, different properties, e.g., bioactivities.
Among other things, the present disclosure provides new
compositions that are or contain particular stereoisomers of
oligonucleotides of interest. In some embodiments, a particular
stereoisomer may be defined, for example, by its base sequence, its
length, its pattern of backbone linkages, and its pattern of
backbone chiral centers. As is understood in the art, in some
embodiments, base sequence may refer to the identity and/or
modification status of nucleoside residues (e.g., of sugar and/or
base components, relative to standard naturally occurring
nucleotides such as adenine, cytosine, guanosine, thymine, and
uracil) in an oligonucleotide and/or to the hybridization character
(i.e., the ability to hybridize with particular complementary
residues) of such residues.
[0007] The present disclosure demonstrates, among other things,
that individual stereoisomers of a particular oligonucleotide can
show different stability and/or activity (e.g., functional and/or
toxicity properties) from each other. Moreover, the present
disclosure demonstrates that stability and/or activity improvements
achieved through inclusion and/or location of particular chiral
structures within an oligonucleotide can be comparable to, or even
better than those achieved through use of particular backbone
linkages, residue modifications, etc. (e.g., through use of certain
types of modified phosphates [e.g., phosphorothioate, substituted
phosphorothioate, etc.], sugar modifications [e.g.,
2'-modifications, etc.], and/or base modifications [e.g.,
methylation, etc.]).
[0008] Among other things, the present disclosure recognizes that,
in some embodiments, properties (e.g., stability and/or activities)
of an oligonucleotide can be adjusted by optimizing its pattern of
backbone chiral centers, optionally in combination with
adjustment/optimization of one or more other features (e.g.,
linkage pattern, nucleoside modification pattern, etc.) of the
oligonucleotide.
[0009] In some embodiments, the present disclosure provides
compositions of oligonucleotides, wherein the oligonucleotides have
a common pattern of backbone chiral centers which, unexpectedly,
greatly enhances the stability and/or biological activity of the
oligonucleotides. In some embodiments, a pattern of backbone chiral
centers provides increased stability. In some embodiments, a
pattern of backbone chiral centers provides surprisingly increased
activity. In some embodiments, a pattern of backbone chiral centers
provides increased stability and activity. In some embodiments,
when an oligonucleotide is utilized to cleave a nucleic acid
polymer, a pattern of backbone chiral centers, surprisingly by
itself, changes the cleavage pattern of a target nucleic acid
polymer. In some embodiments, a pattern of backbone chiral centers
effectively prevents cleavage at secondary sites. In some
embodiments, a pattern of backbone chiral centers creates new
cleavage sites. In some embodiments, a pattern of backbone chiral
centers minimizes the number of cleavage sites. In some
embodiments, a pattern of backbone chiral centers minimizes the
number of cleavage sites so that a target nucleic acid polymer is
cleaved at only one site within the sequence of the target nucleic
acid polymer that is complementary to the oligonucleotide. In some
embodiments, a pattern of backbone chiral centers enhances cleavage
efficiency at a cleavage site. In some embodiments, a pattern of
backbone chiral centers of the oligonucleotide improves cleavage of
a target nucleic acid polymer. In some embodiments, a pattern of
backbone chiral centers increases selectivity. In some embodiments,
a pattern of backbone chiral centers minimizes off-target effect.
In some embodiments, a pattern of backbone chiral centers increase
selectivity, e.g., cleavage selectivity between two target
sequences differing only by a single nucleotide polymorphism (SNP).
In some embodiments, a pattern of backbone chiral centers
comprises, comprises one or more repeats of, or is
(Sp).sub.m(Rp).sub.n, (Rp).sub.n(Sp).sub.m,
(Np).sub.t(Rp).sub.n(Sp).sub.m, or (Sp).sub.t(Rp).sub.n(Sp).sub.m.
In some embodiments described herein, m is 1-50; and n is 1-10; and
t is 1-50. In some embodiments, a pattern of backbone chiral
centers comprises or is (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or
(Sp)t(Rp)n(Sp)m. In some embodiments, a pattern of backbone chiral
centers comprises or is (Rp).sub.n(Sp).sub.m,
(Np).sub.t(Rp).sub.n(Sp).sub.m, or (Sp).sub.t(Rp).sub.n(Sp).sub.m,
wherein m>2. In some embodiments, a pattern of backbone chiral
centers is a sequence comprising at least 5, 6, 7, 8, 9, or 10 or
more consecutive (Sp) positions. In some embodiments, a pattern of
backbone chiral centers is a sequence comprising at least 5
consecutive (Sp) positions. In some embodiments, a pattern of
backbone chiral centers is a sequence comprising at least 8
consecutive (Sp) positions. In some embodiments, a pattern of
backbone chiral centers is a sequence comprising at least 10
consecutive (Sp) positions. In some embodiments, a pattern of
backbone chiral centers is a sequence consisting of all (Sp) with a
single (Rp). In some embodiments, a pattern of backbone chiral
centers is a sequence consisting of all (Sp) with a single (Rp) at
or adjacent to the position of a SNP. In some embodiments, a
pattern of backbone chiral centers is a sequence consisting of all
(Sp) with a single (Rp), wherein the molecule has a wing-core-wing
format. In some embodiments, a pattern of backbone chiral centers
is a sequence consisting of all (Sp) with a single (Rp), wherein
the molecule has a wing-core-wing format, wherein the wing on the
5' end is 1-9 nt long, the core is 1-15 nt long, and the wing on
the 3' end is 1-9 nt long. In some embodiments, a pattern of
backbone chiral centers is a sequence consisting of all (Sp) with a
single (Rp), wherein the molecule has a wing-core-wing format,
wherein the wing on the 5' end is 5 nt long, the core is 1-15 nt
long, and the wing on the 3' end is 5 nt long. In some embodiments,
a pattern of backbone chiral centers is a sequence consisting of
all (Sp) with a single (Rp), wherein the molecule has a
wing-core-wing format, wherein the wing on the 5' end is 1-9 nt
long, the core is 10 nt long, and the wing on the 3' end is 1-9 nt
long. In some embodiments, a pattern of backbone chiral centers is
a sequence consisting of all (Sp) with a single (Rp), wherein the
molecule has a wing-core-wing format, wherein the wing on the 5'
end is 5 nt long, the core is 10 nt long, and the wing on the 3'
end is 5 nt long. In some embodiments, a pattern of backbone chiral
centers is a sequence consisting of all (Sp) with a single (Rp),
wherein the molecule has a wing-core-wing format, wherein the wing
on the 5' end is 5 nt long, the core is 10 nt long, and the wing on
the 3' end is 5 nt long, and at least one wing comprises a
nucleotide with a 2'-OMe modification. In some embodiments, a
pattern of backbone chiral centers is a sequence consisting of all
(Sp) with a single (Rp), wherein the molecule has a wing-core-wing
format, wherein each wing comprises at least one nucleotide with a
2'-OMe modification. In some embodiments, a pattern of backbone
chiral centers is a sequence consisting of all (Sp) with a single
(Rp), wherein the molecule has a wing-core-wing format, wherein
each nucleotide in both wings has a 2'-OMe modification. In some
embodiments, a pattern of backbone chiral centers is a sequence
consisting of all (Sp) with a single (Rp), wherein the molecule has
a wing-core-wing format, wherein the wing on the 5' end is 5 nt
long, the core is 10 nt long, and the wing on the 3' end is 5 nt
long, and each nucleotide in each wing has a 2'-OMe modification.
In some embodiments, the oligonucleotide is single-stranded and has
a wing-core-wing format, wherein the wing on the 5' end of the
molecule comprises 4 to 8 nt, each of which has a 2'-OMe
modification and wherein the nt at the 5' end of the molecule has a
phosphorothioate in the Sp conformation; the core comprises 8 to 12
nt, each of which is DNA (2'-H), wherein each has a
phosphorothioate in the Sp position except one nt which has the
phosphorothioate in the Rp position; and wherein the wing on the 3'
end of the molecule comprises 4 to 8 nt, each of which has a 2'-OMe
modification, and wherein the nt at the 3' end of the molecule
comprises a phosphorothioate in the Sp conformation. In some
embodiments, the oligonucleotide is single-stranded and has a
wing-core-wing format, wherein the wing on the 5' end of the
molecule comprises 6 nt, each of which has a 2'-OMe modification
and wherein the nt at the 5' end of the molecule has a
phosphorothioate in the Sp conformation; the core comprises 10 nt,
each of which is DNA (2'-H), wherein each has a phosphorothioate in
the Sp position except one nt which has the phosphorothioate in the
Rp position; and wherein the wing on the 3' end of the molecule
comprises 6 nt, each of which has a 2'-OMe modification, and
wherein the nt at the 3' end of the molecule comprises a
phosphorothioate in the Sp conformation.
[0010] In some embodiments, the present disclosure recognizes that
chemical modifications, such as modifications of nucleosides and
internucleotidic linkages, can provide enhanced properties. In some
embodiments, the present disclosure demonstrates that combinations
of chemical modifications and stereochemistry can provide
unexpected, greatly improved properties (e.g., bioactivity,
selectivity, etc.). In some embodiments, chemical combinations,
such as modifications of sugars, bases, and/or internucleotidic
linkages, are combined with stereochemistry patterns, e.g.,
(Rp).sub.n(Sp).sub.m, (Np).sub.t(Rp).sub.n(Sp).sub.m, or
(Sp).sub.t(Rp).sub.n(Sp).sub.m, to provide oligonucleotides and
compositions thereof with surprisingly enhanced properties. In some
embodiments, a provided oligonucleotide composition is chirally
controlled, and comprises a combination of 2'-modification of one
or more sugar moieties, one or more natural phosphate linkages, one
or more phosphorothioate linkages, and a stereochemistry pattern of
(Rp).sub.n(Sp).sub.m, (Np).sub.t(Rp).sub.n(Sp).sub.m, or
(Sp).sub.t(Rp).sub.n(Sp).sub.m, wherein m>2.
[0011] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide composition comprising
oligonucleotides defined by having:
[0012] 1) a common base sequence and length;
[0013] 2) a common pattern of backbone linkages; and
[0014] 3) a common pattern of backbone chiral centers, which
composition is a substantially pure preparation of a single
oligonucleotide in that a predetermined level of the
oligonucleotides in the composition have the common base sequence
and length, the common pattern of backbone linkages, and the common
pattern of backbone chiral centers.
[0015] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide composition comprising
oligonucleotides of a particular oligonucleotide type characterized
by:
[0016] 1) a common base sequence and length;
[0017] 2) a common pattern of backbone linkages; and
[0018] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type.
[0019] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide composition comprising
oligonucleotides of a particular oligonucleotide type characterized
by:
[0020] 1) a common base sequence and length;
[0021] 2) a common pattern of backbone linkages; and
[0022] 3) a common pattern of backbone chiral centers, which
composition is a substantially pure preparation of a single
oligonucleotide in that at least about 10% of the oligonucleotides
in the composition have the common base sequence and length, the
common pattern of backbone linkages, and the common pattern of
backbone chiral centers.
[0023] Among other things, the present disclosure recognizes that
combinations of oligonucleotide structural elements (e.g., patterns
of chemical modifications, backbone linkages, backbone chiral
centers, and/or backbone phosphorus modifications) can provide
surprisingly improved properties such as bioactivities. In some
embodiments, the present disclosure provides an oligonucleotide
composition comprising a predetermined level of oligonucleotides
which comprise one or more wing regions and a common core region,
wherein:
[0024] each wing region independently has a length of two or more
bases, and independently and optionally comprises one or more
chiral internucleotidic linkages;
[0025] the core region independently has a length of two or more
bases, and independently comprises one or more chiral
internucleotidic linkages, and the common core region has:
[0026] 1) a common base sequence and length;
[0027] 2) a common pattern of backbone linkages; and
[0028] 3) a common pattern of backbone chiral centers.
[0029] In some embodiments, in an oligonucleotide comprising a
wing-core-wing format, a "wing" is a portion of the oligonucleotide
on the 5' or 3' end of the core, with the "core" (alternatively
designated a "gap") between the two wings. In some embodiments, an
oligonucleotide can have a single wing and a single core; in such
cases, the wing is on the 5' or the 3' end of the oligonucleotide.
A wing and core can be defined by any of several structural
elements (e.g., modifications or patterns of modifications of
sugar, base, backbone or backbone stereochemistry, etc.). In some
embodiments, a wing and core is defined by nucleoside
modifications, wherein a wing comprises a nucleoside modification
that the core region does not have. In some embodiments,
oligonucleotides in provided compositions have a wing-core
structure of nucleoside modification. In some embodiments,
oligonucleotides in provided compositions have a core-wing
structure of nucleoside modification. In some embodiments,
oligonucleotides in provided compositions have a wing-core-wing
structure of nucleoside modification. In some embodiments, a wing
and core is defined by modifications of the sugar moieties. In some
embodiments, a wing and core is defined by modifications of the
base moieties. In some embodiments, each sugar moiety in the wing
region has the same 2'-modification which is not found in the core
region. In some embodiments, each sugar moiety in the wing region
has the same 2'-modification which is different than any sugar
modifications in the core region. In some embodiments, each sugar
moiety in the wing region has the same 2'-modification, and the
core region has no 2'-modifications. In some embodiments, when two
or more wings are present, each sugar moiety in a wing region has
the same 2'-modification, yet the common 2'-modification in a first
wing region can either be the same as or different from the common
2'-modification in a second wing region.
[0030] In some embodiments, each wing comprises at least one chiral
internucleotidic linkage and at least one natural phosphate
linkage. In some embodiments, each wing comprises at least one
modified sugar moiety. In some embodiments, each wing sugar moiety
is modified. In some embodiments, a wing sugar moiety is modified
by a modification that is absent from the core region. In some
embodiments, a wing region only has modified internucleotidic
linkages at one or both of its ends. In some embodiments, a wing
region only has a modified internucleotidic linkage at its 5'-end.
In some embodiments, a wing region only has a modified
internucleotidic linkage at its 3'-end. In some embodiments, a wing
region only has modified internucleotidic linkages at its 5'- and
3'-ends. In some embodiments, a wing is to the 5'-end of a core,
and the wing only has a modified internucleotidic linkage at its
5'-end. In some embodiments, a wing is to the 5'-end of a core, and
the wing only has a modified internucleotidic linkage at its
3'-end. In some embodiments, a wing is to the 5'-end of a core, and
the wing only has modified internucleotidic linkages at both its
5'- and 3'-ends. In some embodiments, a wing is to the 3'-end of a
core, and the wing only has a modified internucleotidic linkage at
its 5'-end. In some embodiments, a wing is to the 3'-end of a core,
and the wing only has a modified internucleotidic linkage at its
3'-end. In some embodiments, a wing is to the 3'-end of a core, and
the wing only has modified internucleotidic linkages at both its
5'- and 3'-ends. In some embodiments, the modification(s) to the
sugar moiety or internucleotidic linkage or other modifications in
one wing can differ from those in another wing.
[0031] In some embodiments, each internucleotidic linkage within a
core region is modified. In some embodiments, each internucleotidic
linkage within a core region is chiral. In some embodiments, a core
region has a pattern of backbone chiral centers of
(Sp).sub.m(Rp).sub.n, (Rp).sub.n(Sp).sub.m,
(Np).sub.t(Rp).sub.n(Sp).sub.m, or (Sp).sub.t(Rp).sub.n(Sp).sub.m.
In some embodiments, a core region has a pattern of backbone chiral
centers of (Rp).sub.n(Sp).sub.m, (Np).sub.t(Rp).sub.n(Sp).sub.m, or
(Sp).sub.t(Rp).sub.n(Sp).sub.m, wherein m>2. Among other things,
the present disclosure demonstrates that, in some embodiments, such
patterns can provide or enhance controlled cleavage of a target
sequence, e.g., an RNA sequence.
[0032] In some embodiments, oligonucleotides in provided
compositions have a common pattern of backbone phosphorus
modifications. In some embodiments, a provided composition is an
oligonucleotide composition that is chirally controlled in that the
composition contains a predetermined level of oligonucleotides of
an individual oligonucleotide type, wherein an oligonucleotide type
is defined by:
[0033] 1) base sequence;
[0034] 2) pattern of backbone linkages;
[0035] 3) pattern of backbone chiral centers; and
[0036] 4) pattern of backbone phosphorus modifications.
[0037] As noted above and understood in the art, in some
embodiments, the base sequence of an oligonucleotide may refer to
the identity and/or modification status of nucleoside residues
(e.g., of sugar and/or base components, relative to standard
naturally occurring nucleotides such as adenine, cytosine,
guanosine, thymine, and uracil) in the oligonucleotide and/or to
the hybridization character (i.e., the ability to hybridize with
particular complementary residues) of such residues.
[0038] In some embodiments, a particular oligonucleotide type may
be defined by
[0039] 1A) base identity;
[0040] 1B) pattern of base modification;
[0041] 1C) pattern of sugar modification;
[0042] 2) pattern of backbone linkages;
[0043] 3) pattern of backbone chiral centers; and
[0044] 4) pattern of backbone phosphorus modifications.
Thus, in some embodiments, oligonucleotides of a particular type
may share identical bases but differ in their pattern of base
modifications and/or sugar modifications. In some embodiments,
oligonucleotides of a particular type may share identical bases and
pattern of base modifications (including, e.g., absence of base
modification), but differ in pattern of sugar modifications.
[0045] In some embodiments, oligonucleotides of a particular type
are chemically identical in that they have the same base sequence
(including length), the same pattern of chemical modifications to
sugar and base moieties, the same pattern of backbone linkages
(e.g., pattern of natural phosphate linkages, phosphorothioate
linkages, phosphorothioate triester linkages, and combinations
thereof), the same pattern of backbone chiral centers (e.g.,
pattern of stereochemistry (Rp/Sp) of chiral internucleotidic
linkages), and the same pattern of backbone phosphorus
modifications (e.g., pattern of modifications on the
internucleotidic phosphorus atom, such as --S.sup.-, and -L-R.sup.1
of formula I).
[0046] In some embodiments, the sequence of the oligonucleotide
comprises or consists of the sequence of any oligonucleotide
disclosed herein. In some embodiments, the sequence of the
oligonucleotide comprises or consists of the sequence of any
oligonucleotide selected from Tables N1, N2, N3, N4 and 8. In some
embodiments, the sequence of the oligonucleotide comprises or
consists of the sequence of any oligonucleotide selected from
Tables N1A, N2A, N3A, N4A and 8. In some embodiments, the sequence
of the oligonucleotide in a stereopure (chirally controlled)
oligonucleotide composition comprises or consists of the sequence
of WV-1092, WVE120101, WV-2603 or WV-2595. In some embodiments, a
sequence of an oligonucleotide includes any one or more of: base
sequence (including length); pattern of chemical modifications to
sugar and base moieties; pattern of backbone linkages; pattern of
natural phosphate linkages, phosphorothioate linkages,
phosphorothioate triester linkages, and combinations thereof;
pattern of backbone chiral centers; pattern of stereochemistry
(Rp/Sp) of chiral internucleotidic linkages; pattern of backbone
phosphorus modifications; pattern of modifications on the
internucleotidic phosphorus atom, such as --S.sup.-, and -L-R.sup.1
of formula I.
[0047] Among other things, the present disclosure recognizes the
challenge of stereoselective (rather than stereorandom or racemic)
preparation of oligonucleotides. Among other things, the present
disclosure provides methods and reagents for stereoselective
preparation of oligonucleotides comprising multiple (e.g., more
than 5, 6, 7, 8, 9, or 10) internucleotidic linkages, and
particularly for oligonucleotides comprising multiple (e.g., more
than 5, 6, 7, 8, 9, or 10) chiral internucleotidic linkages. In
some embodiments, in a stereorandom or racemic preparation of
oligonucleotides, at least one chiral internucleotidic linkage is
formed with less than 90:10, 95:5, 96:4, 97:3, or 98:2
diastereoselectivity. In some embodiments, for a stereoselective or
chirally controlled preparation of oligonucleotides, each chiral
internucleotidic linkage is formed with greater than 90:10, 95:5,
96:4, 97:3, or 98:2 diastereoselectivity. In some embodiments, for
a stereoselective or chirally controlled preparation of
oligonucleotides, each chiral internucleotidic linkage is formed
with greater than 95:5 diastereoselectivity. In some embodiments,
for a stereoselective or chirally controlled preparation of
oligonucleotides, each chiral internucleotidic linkage is formed
with greater than 96:4 diastereoselectivity. In some embodiments,
for a stereoselective or chirally controlled preparation of
oligonucleotides, each chiral internucleotidic linkage is formed
with greater than 97:3 diastereoselectivity. In some embodiments,
for a stereoselective or chirally controlled preparation of
oligonucleotides, each chiral internucleotidic linkage is formed
with greater than 98:2 diastereoselectivity. In some embodiments,
for a stereoselective or chirally controlled preparation of
oligonucleotides, each chiral internucleotidic linkage is formed
with greater than 99:1 diastereoselectivity. In some embodiments,
diastereoselectivity of a chiral internucleotidic linkage in an
oligonucleotide may be measured through a model reaction, e.g.
formation of a dimer under essentially the same or comparable
conditions wherein the dimer has the same internucleotidic linkage
as the chiral internucleotidic linkage, the 5'-nucleoside of the
dimer is the same as the nucleoside to the 5'-end of the chiral
internucleotidic linkage, and the 3'-nucleoside of the dimer is the
same as the nucleoside to the 3'-end of the chiral internucleotidic
linkage.
[0048] Among other things, it is surprisingly found that certain
provided oligonucleotide compositions achieve unprecedented control
of cleavage of target sequences, e.g., cleavage of target RNA by
RNase H. In some embodiments, the present disclosure demonstrates
that precise control of chemical and stereochemical attributes of
oligonucleotides achieves improved activity of oligonucleotide
preparations as compared with otherwise comparable preparations for
which stereochemical attributes are not controlled. Among other
things, the present disclosure specifically demonstrates improved
rate, degree, and or specificity of cleavage of nucleic acid
targets to which provided oligonucleotides hybridize.
[0049] In some embodiments, the present disclosure provides various
uses of oligonucleotide compositions. Among other things, the
present disclosure demonstrates that by controlling structural
elements of oligonucleotides, such as base sequence, chemical
modifications, stereochemistry, etc., properties of
oligonucleotides can be greatly improved. For example, in some
embodiments, the present disclosure provides methods for highly
selective suppression of transcripts of a target nucleic acid
sequence. In some embodiments, the present disclosure provides
methods for treating a subject by suppressing transcripts from a
disease-causing copy (e.g., a disease-causing allele). In some
embodiments, the present disclosure provides methods for designing
and preparing oligonucleotide compositions with surprisingly
enhanced activity and/or selectivity when suppressing a transcript
of a target sequence. In some embodiments, the present disclosure
provides methods for designing and/or preparing oligonucleotide
compositions which provide allele-specific suppression of a
transcript from a target nucleic acid sequence.
[0050] In some embodiments, the present disclosure provides a
method for controlled cleavage of a nucleic acid polymer, the
method comprising steps of:
[0051] contacting a nucleic acid polymer whose nucleotide sequence
comprises a target sequence with a chirally controlled
oligonucleotide composition comprising oligonucleotides of a
particular oligonucleotide type characterized by: [0052] 1) a
common base sequence and length, wherein the common base sequence
is or comprises a sequence that is complementary to a target
sequence found in the nucleic acid polymer; [0053] 2) a common
pattern of backbone linkages; and [0054] 3) a common pattern of
backbone chiral centers; which composition is chirally controlled
in that it is enriched, relative to a substantially racemic
preparation of oligonucleotides having the particular base sequence
and length, for oligonucleotides of the particular oligonucleotide
type.
[0055] In some embodiments, the present disclosure provides a
method for altering a cleavage pattern observed when a nucleic acid
polymer whose nucleotide sequence includes a target sequence is
contacted with a reference oligonucleotide composition that
comprises oligonucleotides having a particular base sequence and
length, which particular base sequence is or comprises a sequence
that is complementary to the target sequence, the method
comprising:
[0056] contacting the nucleic acid polymer with a chirally
controlled oligonucleotide composition of oligonucleotides having
the particular base sequence and length, which composition is
chirally controlled in that it is enriched, relative to a
substantially racemic preparation of oligonucleotides having the
particular base sequence and length, for oligonucleotides of a
single oligonucleotide type characterized by:
[0057] 1) the particular base sequence and length;
[0058] 2) a particular pattern of backbone linkages; and
[0059] 3) a particular pattern of backbone chiral centers.
[0060] In some embodiments, the present disclosure provides a
method for suppression of a transcript from a target nucleic acid
sequence for which one or more similar nucleic acid sequences exist
within a population, each of the target and similar sequences
contains a specific nucleotide characteristic sequence element that
defines the target sequence relative to the similar sequences, the
method comprising steps of:
[0061] contacting a sample comprising transcripts of the target
nucleic acid sequence with an oligonucleotide composition
comprising oligonucleotides having:
[0062] 1) a common base sequence and length; and
[0063] 2) a common pattern of backbone linkages;
[0064] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines the target nucleic acid sequence, the composition being
characterized in that, when it is contacted with a system
comprising transcripts of both the target nucleic acid sequence and
a similar nucleic acid sequences, transcripts of the target nucleic
acid sequence are suppressed at a greater level than a level of
suppression observed for a similar nucleic acid sequence.
[0065] In some embodiments, the present disclosure provides a
method for suppression of a transcript from a target nucleic acid
sequence for which one or more similar nucleic acid sequences exist
within a population, each of the target and similar sequences
contains a specific nucleotide characteristic sequence element that
defines the target sequence relative to the similar sequences, the
method comprising steps of:
[0066] contacting a sample comprising transcripts of the target
nucleic acid sequence with an oligonucleotide composition
comprising oligonucleotides having:
[0067] 1) a common base sequence and length; and
[0068] 2) a common pattern of backbone linkages;
[0069] 3) a common pattern of backbone chiral centers;
[0070] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines the target nucleic acid sequence, the composition being
characterized in that, when it is contacted with a system
comprising transcripts of both the target nucleic acid sequence and
a similar nucleic acid sequences, transcripts of the target nucleic
acid sequence are suppressed at a greater level than a level of
suppression observed for a similar nucleic acid sequence.
[0071] In some embodiments, transcripts of the target nucleic acid
sequence are suppressed at a greater level than a level of
suppression observed for any one of the similar nucleic acid
sequence.
[0072] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target nucleic acid sequence for which a plurality of alleles exist
within a population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target nucleic acid sequence, the method
comprising steps of:
[0073] contacting a sample comprising transcripts of the target
nucleic acid sequence with an oligonucleotide composition
comprising oligonucleotides having:
[0074] 1) a common base sequence and length; and
[0075] 2) a common pattern of backbone linkages;
[0076] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines a particular allele, the composition being characterized in
that, when it is contacted with a system comprising transcripts of
both the target allele and another allele of the same nucleic acid
sequence, transcripts of the particular allele are suppressed at a
greater level than a level of suppression observed for another
allele of the same nucleic acid sequence.
[0077] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target nucleic acid sequence for which a plurality of alleles exist
within a population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target nucleic acid sequence, the method
comprising steps of:
[0078] contacting a sample comprising transcripts of the target
nucleic acid sequence with a chirally controlled oligonucleotide
composition comprising oligonucleotides of a particular
oligonucleotide type characterized by:
[0079] 1) a common base sequence and length;
[0080] 2) a common pattern of backbone linkages;
[0081] 3) a common pattern of backbone chiral centers;
[0082] which composition is chirally controlled in that it is
enriched, relative to a substantially racemic preparation of
oligonucleotides having the same base sequence and length, for
oligonucleotides of the particular oligonucleotide type;
[0083] wherein the common base sequence for the oligonucleotides of
the particular oligonucleotide type is or comprises a sequence that
is complementary to the characteristic sequence element that
defines a particular allele, the composition being characterized in
that, when it is contacted with a system comprising transcripts of
both the target allele and another allele of the same nucleic acid
sequence, transcripts of the particular allele are suppressed at a
greater level than a level of suppression observed for another
allele of the same nucleic acid sequence.
[0084] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target gene for which a plurality of alleles exist within a
population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target gene, the method comprising steps
of:
[0085] contacting a sample comprising transcripts of the target
gene with an oligonucleotide composition comprising
oligonucleotides having:
[0086] 1) a common base sequence and length;
[0087] 2) a common pattern of backbone linkages;
[0088] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines a particular allele, the composition being characterized in
that, when it is contacted with a system comprising transcripts of
both the target allele and another allele of the same gene,
transcripts of the particular allele are suppressed at a level at
least 2 fold greater than a level of suppression observed for
another allele of the same gene.
[0089] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target gene for which a plurality of alleles exist within a
population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target gene, the method comprising steps
of:
[0090] contacting a sample comprising transcripts of the target
gene with a chirally controlled oligonucleotide composition
comprising oligonucleotides of a particular oligonucleotide type
characterized by:
[0091] 1) a common base sequence and length;
[0092] 2) a common pattern of backbone linkages;
[0093] 3) a common pattern of backbone chiral centers;
[0094] which composition is chirally controlled in that it is
enriched, relative to a substantially racemic preparation of
oligonucleotides having the same base sequence and length, for
oligonucleotides of the particular oligonucleotide type;
[0095] wherein the common base sequence for the oligonucleotides of
the particular oligonucleotide type is or comprises a sequence that
is complementary to the characteristic sequence element that
defines a particular allele, the composition being characterized in
that, when it is contacted with a system comprising transcripts of
both the target allele and another allele of the same gene,
transcripts of the particular allele are suppressed at a level at
least 2 fold greater than a level of suppression observed for
another allele of the same gene.
[0096] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target gene for which a plurality of alleles exist within a
population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target gene, the method comprising steps
of:
[0097] contacting a sample comprising transcripts of the target
gene with a chirally controlled oligonucleotide composition
comprising oligonucleotides of a particular oligonucleotide type
characterized by:
[0098] 1) a common base sequence and length;
[0099] 2) a common pattern of backbone linkages;
[0100] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type; wherein the common base
sequence for the oligonucleotides of the particular oligonucleotide
type is or comprises a sequence that is complementary to the
characteristic sequence element that defines a particular allele,
the composition being characterized in that, when it is contacted
with a system expressing transcripts of both the target allele and
another allele of the same gene, transcripts of the particular
allele are suppressed at a level at least 2 fold greater than a
level of suppression observed for another allele of the same
gene.
[0101] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target nucleic acid sequence for which a plurality of alleles exist
within a population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target nucleic acid sequence, the method
comprising steps of:
[0102] contacting a sample comprising transcripts of the target
nucleic acid sequence with an oligonucleotide composition
comprising oligonucleotides having:
[0103] 1) a common base sequence and length;
[0104] 2) a common pattern of backbone linkages;
[0105] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines a particular allele, the composition being characterized in
that, when it is contacted with a system comprising transcripts of
the same target nucleic acid sequence, it shows suppression of
transcripts of the particular allele at a level that is:
[0106] a) greater than when the composition is absent;
[0107] b) greater than a level of suppression observed for another
allele of the same nucleic acid sequence; or
[0108] c) both greater than when the composition is absent, and
greater than a level of suppression observed for another allele of
the same nucleic acid sequence.
[0109] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target nucleic acid sequence for which a plurality of alleles exist
within a population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target nucleic acid sequence, the method
comprising steps of:
[0110] contacting a sample comprising transcripts of the target
nucleic acid sequence with a chirally controlled oligonucleotide
composition comprising oligonucleotides of a particular
oligonucleotide type characterized by:
[0111] 1) a common base sequence and length;
[0112] 2) a common pattern of backbone linkages;
[0113] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type;
[0114] wherein the common base sequence for the oligonucleotides of
the particular oligonucleotide type is or comprises a sequence that
is complementary to the characteristic sequence element that
defines a particular allele, the composition being characterized in
that, when it is contacted with a system comprising transcripts of
the same target nucleic acid sequence, it shows suppression of
transcripts of the particular allele at a level that is:
[0115] a) greater than when the composition is absent;
[0116] b) greater than a level of suppression observed for another
allele of the same nucleic acid sequence; or
[0117] c) both greater than when the composition is absent, and
greater than a level of suppression observed for another allele of
the same nucleic acid sequence.
[0118] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target gene for which a plurality of alleles exist within a
population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target gene, the method comprising steps
of:
[0119] contacting a sample comprising transcripts of the target
gene with an oligonucleotide composition comprising
oligonucleotides having:
[0120] 1) a common base sequence and length; and
[0121] 2) a common pattern of backbone linkages;
[0122] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines a particular allele, the composition being characterized in
that, when it is contacted with a system expressing transcripts of
the target gene, it shows suppression of expression of transcripts
of the particular allele at a level that is:
[0123] a) at least 2 fold in that transcripts from the particular
allele are detected in amounts that are 2 fold lower when the
composition is present relative to when it is absent;
[0124] b) at least 2 fold greater than a level of suppression
observed for another allele of the same gene; or
[0125] c) both at least 2 fold in that transcripts from the
particular allele are detected in amounts that are 2 fold lower
when the composition is present relative to when it is absent, and
at least 2 fold greater than a level of suppression observed for
another allele of the same gene.
[0126] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target gene for which a plurality of alleles exist within a
population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target gene, the method comprising steps
of:
[0127] contacting a sample comprising transcripts of the target
gene with a chirally controlled oligonucleotide composition
comprising oligonucleotides of a particular oligonucleotide type
characterized by:
[0128] 1) a common base sequence and length;
[0129] 2) a common pattern of backbone linkages;
[0130] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type;
[0131] wherein the common base sequence for the oligonucleotides of
the particular oligonucleotide type is or comprises a sequence that
is complementary to the characteristic sequence element that
defines a particular allele, the composition being characterized in
that, when it is contacted with a system expressing transcripts of
the target gene, it shows suppression of expression of transcripts
of the particular allele at a level that is:
[0132] a) at least 2 fold in that transcripts from the particular
allele are detected in amounts that are 2 fold lower when the
composition is present relative to when it is absent;
[0133] b) at least 2 fold greater than a level of suppression
observed for another allele of the same gene; or
[0134] c) both at least 2 fold in that transcripts from the
particular allele are detected in amounts that are 2 fold lower
when the composition is present relative to when it is absent, and
at least 2 fold greater than a level of suppression observed for
another allele of the same gene.
[0135] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target gene for which a plurality of alleles exist within a
population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target gene, the method comprising steps
of:
[0136] contacting a sample comprising transcripts of the target
gene with an oligonucleotide composition comprising
oligonucleotides of a particular oligonucleotide type characterized
by:
[0137] 1) a common base sequence and length;
[0138] 2) a common pattern of backbone linkages;
wherein the common base sequence is or comprises a sequence that is
complementary to the characteristic sequence element that defines a
particular allele, the composition being characterized in that,
when it is contacted with a system expressing transcripts of the
target gene, it shows suppression of expression of transcripts of
the particular allele at a level that is:
[0139] a) at least 2 fold in that transcripts from the particular
allele are detected in amounts that are 2 fold lower when the
composition is present relative to when it is absent;
[0140] b) at least 2 fold greater than a level of suppression
observed for another allele of the same gene; or
[0141] c) both at least 2 fold in that transcripts from the
particular allele are detected in amounts that are 2 fold lower
when the composition is present relative to when it is absent, and
at least 2 fold greater than a level of suppression observed for
another allele of the same gene.
[0142] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target gene for which a plurality of alleles exist within a
population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target gene, the method comprising steps
of:
[0143] contacting a sample comprising transcripts of the target
gene with a chirally controlled oligonucleotide composition
comprising oligonucleotides of a particular oligonucleotide type
characterized by:
[0144] 1) a common base sequence and length;
[0145] 2) a common pattern of backbone linkages;
[0146] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type; wherein the common base
sequence for the oligonucleotides of the particular oligonucleotide
type is or comprises a sequence that is complementary to the
characteristic sequence element that defines a particular allele,
the composition being characterized in that, when it is contacted
with a system expressing transcripts of the target gene, it shows
suppression of expression of transcripts of the particular allele
at a level that is:
[0147] a) at least 2 fold in that transcripts from the particular
allele are detected in amounts that are 2 fold lower when the
composition is present relative to when it is absent;
[0148] b) at least 2 fold greater than a level of suppression
observed for another allele of the same gene; or
[0149] c) both at least 2 fold in that transcripts from the
particular allele are detected in amounts that are 2 fold lower
when the composition is present relative to when it is absent, and
at least 2 fold greater than a level of suppression observed for
another allele of the same gene.
[0150] In some embodiments, a nucleotide characteristic sequence
comprises a mutation that defines the target sequence relative to
other similar sequences. In some embodiments, a nucleotide
characteristic sequence comprises a point mutation that defines the
target sequence relative to other similar sequences. In some
embodiments, a nucleotide characteristic sequence comprises a SNP
that defines the target sequence relative to other similar
sequences.
[0151] In some embodiments, the present disclosure provides a
method for preparing an oligonucleotide composition comprising
oligonucleotides of a particular sequence, which composition
provides selective suppression of a transcript of a target
sequence, comprising providing a chirally controlled
oligonucleotide composition comprising oligonucleotides of a
particular oligonucleotide type characterized by:
[0152] 1) a common base sequence which is the same as the
particular sequence;
[0153] 2) a common pattern of backbone linkages; and
[0154] 3) a common pattern of backbone chiral centers, which
pattern comprises (Sp).sub.m(Rp).sub.n, (Rp).sub.n(Sp).sub.m,
(Np).sub.t(Rp).sub.n(Sp).sub.m, or (Sp).sub.t(Rp).sub.n(Sp).sub.m,
wherein:
[0155] m is 1-50;
[0156] n is 1-10;
[0157] t is 1-50; and
[0158] each Np is independent Rp or Sp.
[0159] In general, activities of oligonucleotide compositions as
described herein can be assessed using any appropriate assay.
Relative activities for different compositions (e.g.,
stereocontrolled vs non-stereocontrolled, and/or different
stereocontrolled compositions) are typically desirably determined
in the same assay, in some embodiments substantially simultaneously
and in some embodiments with reference to historical results.
[0160] Those of skill in the art will be aware of and/or will
readily be able to develop appropriate assays for particular
oligonucleotide compositions. The present disclosure provides
descriptions of certain particular assays, for example that may be
useful in assessing one or more features of oligonucleotide
composition behavior with respect to RNAse H cleavage of a target
sequence.
[0161] For example, certain assays that may be useful in the
assessment of one or more features (e.g., rate, extent, and/or
selectivity of cleavage) of RNase H cleavage may include an assay
as described in any assay described and/or exemplified herein
(e.g., in one or more of Examples 4, 9-10, 12, 14, 17-20,
etc.).
[0162] In some embodiments, the present disclosure recognizes that
a base sequence can impact properties of oligonucleotides. The
present disclosure demonstrates that chemical and stereochemical
modifications, combined with designed base sequences, can provide
oligonucleotide compositions with unexpectedly improved properties
(e.g., surprisingly higher activity, and/or selectivity, etc.). In
some embodiments, oligonucleotides having a common base sequence
complementary to a characteristic sequence element of a target
nucleic acid sequence provide better activity compared to another
common base sequence complementary to the characteristic sequence
element of a target nucleic acid sequence. In some embodiments,
oligonucleotides having a common base sequence complementary to a
characteristic sequence element of a target nucleic acid sequence
provide better selectivity compared to another common base sequence
complementary to the characteristic sequence element of a target
nucleic acid sequence.
[0163] In some embodiments, a composition of oligonucleotides
having a common base sequence complementary to a characteristic
sequence element of a target nucleic acid sequence, when compared
to another composition of oligonucleotides having another common
base sequence complementary to the characteristic sequence element
of the target nucleic acid sequence, provides higher cleavage rate
of a transcript from the target nucleic acid sequence, and/or a
cleavage pattern which has only one major cleavage site, and the
major cleavage site is within or close to the nucleotide
characteristic sequence. In some embodiments, a composition of
oligonucleotides having a complementary common base sequence, when
compared to another composition of oligonucleotides having another
complementary common base sequence, provide higher cleavage rate of
a transcript from the target nucleic acid sequence, and a cleavage
pattern which has only one major cleavage site, and the major
cleavage site is within or close to a nucleotide characteristic
sequence. In some embodiments, greater than 50%, 60%, 70%, 80% or
90% of cleavage occurs at the one major cleavage site, for example,
when measured by a suitable method, e.g., an RNase H assay. In some
embodiments, a composition of oligonucleotides having a
complementary common base sequence, when compared to another
composition of oligonucleotides having another complementary common
base sequence, provides higher cleavage rate of a transcript from
the target nucleic acid sequence, and a cleavage pattern which has
only one major cleavage site, and the major cleavage site is within
or close to a mutation or a SNP that defines the target sequence
relative to other similar sequences. In some embodiments, a
mutation is a point mutation. In some embodiments, a major cleavage
site is next to a mutation or a SNP that defines the target
sequence relative to other similar sequences. In some embodiments,
each common base sequence is 100% complementary to the
characteristic sequence element of the target nucleic acid
sequence. In some embodiments, a major cleavage site is within less
than 5, 4, 3, or 1 internucleotidic linkage from a mutation or a
SNP that defines the target sequence relative to other similar
sequences. In some embodiments, a major cleavage site is within
less than 5, 4, 3, or 1 internucleotidic linkage from a mutation or
a SNP that defines the target sequence relative to other similar
sequences, and is within less than 5, 4, 3, or 1 internucleotidic
linkage from a cleavage site when a stereorandom composition of
oligonucleotides having the same common sequence, and/or a
composition of DNA oligonucleotides having the same common
sequence, is used. In some embodiments, a major cleavage site is a
cleavage site when a stereorandom composition of oligonucleotides
having the same common sequence is used. In some embodiments, a
major cleavage site is a major cleavage site when a stereorandom
composition of oligonucleotides having the same common sequence is
used. In some embodiments, a major cleavage site is a cleavage site
when a composition of DNA oligonucleotides having the same common
sequence is used. In some embodiments, a major cleavage site is a
major cleavage site when a composition of DNA oligonucleotides
having the same common sequence is used.
[0164] In some embodiments, when comparing effects of a first and a
second common base sequences, a stereorandom composition of
oligonucleotides having a first common base sequence may be
compared to a stereorandom composition of oligonucleotides having a
second common base sequence. In some embodiments, a stereorandom
composition is a composition of oligonucleotides having a common
base sequence, a common pattern of nucleoside modifications, and a
common pattern of backbone linkages. In some embodiments, a
stereorandom composition is a composition of oligonucleotides
having a common base sequence, a common pattern of nucleoside
modifications, wherein each internucleotidic linkage is
phosphorothioate. In some embodiments, when comparing effects of a
first and a second common base sequences, a chirally controlled
oligonucleotide composition of oligonucleotides having a first
common base sequence may be compared to a chirally controlled
oligonucleotide composition of oligonucleotides having a second
common base sequence. In some embodiments, oligonucleotides in a
chirally controlled oligonucleotide composition have a common base
sequence, a common pattern of nucleoside modifications, a common
pattern of backbone linkages, a common pattern of backbone chiral
centers, and a common pattern of backbone phosphorus modifications.
In some embodiments, each internucleotidic linkage is
phosphorothioate.
[0165] In some embodiments, oligonucleotide compositions and
technologies described herein are particularly useful in the
treatment of Huntington's disease. For example, in some
embodiments, the present disclosure defines stereochemically
controlled oligonucleotide compositions that direct cleavage (e.g.,
RNase H-mediated cleavage) of nucleic acids associated with
Huntington's disease. In some embodiments, such compositions direct
preferential cleavage of a Huntington's disease-associated allele
of a particular target sequence, relative to one or more (e.g., all
non-Huntington's disease-associated) other alleles of the
sequence.
[0166] Huntington's disease is an inherited disease that can cause
progressive degeneration of nerve cells in the brain and affect a
subject's motor and cognitive abilities. In some embodiments,
Huntington's disease is an autosomal dominant disorder. In some
embodiments, it is caused by mutations in the Huntingtin gene.
Normal HTT gene contains 10 to 35 CAG tri-nucleotide repeats (SEQ
ID NO: 1). People with 40 or more repeats often develop the
disorder. In some embodiments, the expanded CAG segment on the
first exon of HTT gene leads to the production of an abnormally
long version of the Huntingtin protein (expanded polyglutamine
tract) which is cut into smaller, toxic fragments that bind
together and accumulate in neurons, disrupting the normal functions
of these cells. Warby et al. (Am J Hum Genet. 2009, 84(3), 351-366)
reported many SNPs that are associated with disease chromosomes and
have stronger linkage associations with CAG expansion than those
reported before. Many SNPs highly associated with CAG expansion do
not segregate independently and are in Linkage Disequilibrium with
each other. Among other things, the present disclosure recognizes
that strong association between specific SNPs and CAG expanded
chromosomes provides an attractive therapeutic opportunity for the
treatment of Huntington Disease, e.g., through antisense therapy.
Furthermore, the association of specific SNPs combined with high
rates of heterozygosity in HD patients provides suitable targets
for allele-specific knockdown of the mutant gene product. For
example references, see Liu et al. Journal of Huntington's Disease
2, 2013, 491-500; Aronin, Neil and Pfister, Edith WO 2010/118263
A1; Pfister et al. Current Biology 2009, 19, 774-778.
[0167] In some embodiments, a targeted SNP of the present
disclosure has high frequency of heterozygosity in HD and has a
particular variant associated with the mutant HTT allele. In some
embodiments, a SNP is rs362307. In some embodiments, a SNP is
rs7685686. In some embodiments, a SNP may not be linked but may
have a high heterozygous frequency. In some embodiments, a SNP is
rs362268 (3'-UTR region). In some embodiments, a SNP is rs362306
(3'-UTR region). In some embodiments, a SNP is rs2530595. In some
embodiments, a SNP is rs362331.
[0168] In some embodiments, a provided method for treating or
preventing Huntington's disease in a subject, comprising
administering to the subject a provided oligonucleotide
compositions. In some embodiments, a provided method for treating
or preventing Huntington's disease in a subject, comprising
administering to the subject a chirally controlled oligonucleotide
composition comprising oligonucleotides of a particular
oligonucleotide type characterized by:
[0169] 1) a common base sequence and length;
[0170] 2) a common pattern of backbone linkages; and
[0171] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type.
[0172] In some embodiments, a provided method ameliorates a symptom
of Huntington's disease. In some embodiments, a provided method
slows onset of Huntington's disease. In some embodiments, a
provided method slows progression of Huntington's disease.
[0173] In some embodiments, the present disclosure provides methods
for identifying patients for a given oligonucleotide composition.
In some embodiments, the present disclosure provides methods for
patient stratification. In some embodiments, a provided method
comprises identifying a mutation and/or SNP associated with a
disease-causing allele. For example, in some embodiments, a
provided method comprises identifying in a subject a SNP associated
with expanded CAG repeats that are associated with or causing
Huntington's disease.
[0174] In some embodiments, a subject has a SNP in the subject's
Huntingtin gene. In some embodiments, a subject has a SNP, wherein
one allele is mutant Huntingtin associated with expanded CAG
repeats. In some embodiments, a subject has a SNP selected from
rs362307, rs7685686, rs362268, rs2530595, rs362331, or rs362306. In
some embodiments, oligonucleotides of a provided composition have a
sequence complementary to a sequence comprising a SNP from the
disease-causing allele (mutant), and the composition selectively
suppresses expression from the diseasing-causing allele.
[0175] In some embodiments, the sequence of oligonucleotides in
provided technologies (compounds, compositions, methods, etc.)
comprises, consists of, or is the sequence of any oligonucleotide
described herein. In some embodiments, a sequence is selected from
Tables N1A, N2A, N3A, N4A or 8; or WV-1092, WVE120101, WV-2603 or
WV-2595. In some embodiments, a sequence is selected from the
sequence of WV-1092, WVE120101, WV-2603 or WV-2595. In some
embodiments, provided oligonucleotides are of the type defined by
WV-1092, WVE120101, WV-2603 or WV-2595. In some embodiments,
provided oligonucleotides are of the type defined by WV-1092. In
some embodiments, provided oligonucleotides are of the type defined
by WVE120101. In some embodiments, provided oligonucleotides are of
the type defined by WV-2603. In some embodiments, provided
oligonucleotides are of the type defined by WV-2595.
[0176] In some embodiments, provided oligonucleotide compositions
comprises a lipid and an oligonucleotide. In some embodiments, a
lipid is conjugated to an oligonucleotide.
[0177] In some embodiments, a composition comprises an
oligonucleotide and a lipid selected from the list of: lauric acid,
myristic acid, palmitic acid, stearic acid, oleic acid, linoleic
acid, alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic
acid (cis-DHA), turbinaric acid, arachidonic acid, and dilinoleyl.
In some embodiments, a composition comprises an oligonucleotide and
a lipid selected from the list of: lauric acid, myristic acid,
palmitic acid, stearic acid, oleic acid, linoleic acid,
alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid
(cis-DHA), turbinaric acid, and dilinoleyl.
[0178] In some embodiments, a composition comprises an
oligonucleotide and a lipid selected from:
##STR00001##
[0179] In some embodiments, a composition comprises an
oligonucleotide and a lipid, wherein the lipid comprises a
C.sub.10-C.sub.40 linear, saturated or partially unsaturated,
aliphatic chain, optionally substituted with one or more C.sub.1-4
aliphatic group.
[0180] In some embodiments, an oligonucleotide composition
comprises a plurality of oligonucleotides, which share:
[0181] 1) a common base sequence;
[0182] 2) a common pattern of backbone linkages; and
[0183] 3) a common pattern of backbone phosphorus
modifications;
[0184] wherein one or more oligonucleotides of the plurality are
individually conjugated to a lipid.
[0185] In some embodiments, a chirally controlled oligonucleotide
composition comprises a plurality of oligonucleotides, which
share:
[0186] 1) a common base sequence;
[0187] 2) a common pattern of backbone linkages; and
[0188] 3) a common pattern of backbone phosphorus
modifications;
[0189] wherein:
[0190] the composition is chirally controlled in that the plurality
of oligonucleotides share the same stereochemistry at one or more
chiral internucleotidic linkages;
[0191] one or more oligonucleotides of the plurality are
individually conjugated to a lipid; and one or more
oligonucleotides of the plurality are optionally and individually
conjugated to a targeting compound or moiety.
[0192] In some embodiments, a method of delivering an
oligonucleotide to a cell or tissue in a human subject,
comprises:
[0193] (a) Providing a composition of any one of the embodiments
described herein; and
[0194] (b) Administering the composition to the human subject such
that the oligonucleotide is delivered to a cell or tissue in the
subject.
[0195] In some embodiments, a method for delivering an
oligonucleotide to a cell or tissue comprises preparing a
composition according to any one of the embodiments described
herein and contacting the cell or tissue with the composition.
[0196] In some embodiments, a method of modulating the level of a
transcript or gene product of a gene in a cell, the method
comprises the step of contacting the cell with a composition
according to any one of the embodiments described herein, wherein
the oligonucleotide is capable of modulating the level of the
transcript or gene product.
[0197] In some embodiments, a method for inhibiting expression of a
gene in a cell or tissue comprises preparing a composition
according to any one of the embodiments described herein and
treating the cell or tissue with the composition.
[0198] In some embodiments, a method for inhibiting expression of a
gene in a cell or tissue in a mammal comprises preparing a
composition according to any one of the embodiments described
herein and administering the composition to the mammal.
[0199] In some embodiments, a method of treating a disease that is
caused by the over-expression of one or several proteins in a cell
or tissue in a subject, said method comprises the administration of
a composition according to any one of the embodiments described
herein to the subject.
[0200] In some embodiments, a method of treating a disease that is
caused by a reduced, suppressed or missing expression of one or
several proteins in a subject, said method comprises the
administration of a composition according to any one of the
embodiments described herein to the subject.
[0201] In some embodiments, a method for generating an immune
response in a subject, said method comprises the administration of
a composition according to any one of the embodiments described
herein to the subject, wherein the biologically active compound is
an immunomodulating nucleic acid.
[0202] In some embodiments, a method for treating a sign and/or
symptom of Huntington's Disease by providing a composition of any
one of the embodiments described herein and administering the
composition to the subject.
[0203] In some embodiments, a method of modulating the amount of
RNaseH-mediated cleavage in a cell, the method comprises the step
of contacting the cell with a composition according to any one of
the embodiments described herein, wherein the oligonucleotide is
capable of modulating the amount of RNaseH-mediated cleavage.
[0204] In some embodiments, a method of administering an
oligonucleotide to a subject in need thereof, comprises steps of
providing a composition comprises the agent a lipid, and
administering the composition to the subject, wherein the agent is
any agent disclosed herein, and wherein the lipid is any lipid
disclosed herein.
[0205] In some embodiments, a method of treating a disease in a
subject, the method comprises steps of providing a composition
comprises the agent a lipid, and administering a therapeutically
effective amount of the composition to the subject, wherein the
agent is any agent disclosed herein, and wherein the lipid is any
lipid disclosed herein, and wherein the disease is any disease
disclosed herein.
[0206] In some embodiments, a lipid comprises an optionally
substituted C.sub.10-C.sub.40 saturated or partially unsaturated
aliphatic chain.
[0207] In some embodiments, a lipid comprises an optionally
substituted C.sub.10-C.sub.40 linear, saturated or partially
unsaturated, aliphatic chain.
[0208] In some embodiments, a lipid comprises a C.sub.10-C.sub.40
linear, saturated or partially unsaturated, aliphatic chain,
optionally substituted with one or more C.sub.1-4 aliphatic
group.
[0209] In some embodiments, a lipid comprises an unsubstituted
C.sub.10-C.sub.40 linear, saturated or partially unsaturated,
aliphatic chain.
[0210] In some embodiments, a lipid comprises no more than one
optionally substituted C.sub.10-C.sub.40 linear, saturated or
partially unsaturated, aliphatic chain.
[0211] In some embodiments, a lipid comprises two or more
optionally substituted C.sub.10-C.sub.40 linear, saturated or
partially unsaturated, aliphatic chain.
[0212] In some embodiments, a lipid comprises no tricyclic or
polycyclic moiety.
[0213] In some embodiments, a lipid has the structure of
R.sup.1--COOH, wherein R.sup.1 is an optionally substituted
C.sub.10-C.sub.40 saturated or partially unsaturated aliphatic
chain.
[0214] The composition or method of any one of claim 16, wherein
the lipid is conjugated through its carboxyl group.
[0215] The composition or method according to any one of the
embodiments described herein, wherein the lipid is selected
from:
##STR00002##
[0216] In some embodiments, a lipid is conjugated to the
oligonucleotide.
[0217] In some embodiments, a lipid is directly conjugated to the
oligonucleotide.
[0218] In some embodiments, a lipid is conjugated to the
oligonucleotide via a linker.
[0219] In some embodiments, a linker is selected from: an uncharged
linker; a charged linker; a linker comprises an alkyl; a linker
comprises a phosphate; a branched linker; an unbranched linker; a
linker comprises at least one cleavage group; a linker comprises at
least one redox cleavage group; a linker comprises at least one
phosphate-based cleavage group; a linker comprises at least one
acid-cleavage group; a linker comprises at least one ester-based
cleavage group; and a linker comprises at least one peptide-based
cleavage group.
[0220] In some embodiments, each oligonucleotide of the plurality
is individually conjugated to the same lipid at the same
location.
[0221] In some embodiments, a lipid is conjugated to an
oligonucleotide through a linker.
[0222] In some embodiments, one or more oligonucleotides of the
plurality are independently conjugated to a targeting compound or
moiety.
[0223] In some embodiments, one or more oligonucleotides of the
plurality are independently conjugated to a lipid and a targeting
compound or moiety.
[0224] In some embodiments, one or more oligonucleotides of the
plurality are independently conjugated to a lipid at one end and a
targeting compound or moiety at the other.
[0225] In some embodiments, oligonucleotides of the plurality share
the same chemical modification patterns.
[0226] In some embodiments, oligonucleotides of the plurality share
the same chemical modification patterns comprises one or more base
modifications.
[0227] In some embodiments, oligonucleotides of the plurality share
the same chemical modification patterns comprises one or more sugar
modifications.
[0228] In some embodiments, a common base sequence is capable of
hybridizing with a transcript in a cell, which transcript contains
a mutation that is linked to Huntington's Disease, or whose level,
activity and/or distribution is linked to Huntington's Disease.
[0229] In some embodiments, an oligonucleotide is a nucleic
acid.
[0230] In some embodiments, an oligonucleotide is an
oligonucleotide.
[0231] In some embodiments, an oligonucleotide is an
oligonucleotide which participates in RNaseH-mediated cleavage of a
mutant Huntingtin gene mRNA.
[0232] In some embodiments, a disease or disorder is Huntington's
Disease.
[0233] In some embodiments, a lipid comprises an optionally
substituted, C.sub.10-C.sub.80 saturated or partially unsaturated
aliphatic group, wherein one or more methylene units are optionally
and independently replaced by an optionally substituted group
selected from C.sub.1-C.sub.6 alkylene, C.sub.1-C.sub.6 alkenylene,
--C.ident.--, a C.sub.1-C.sub.6 heteroaliphatic moiety,
--C(R').sub.2--, -Cy-, --O--, --S--, --S--S--, --N(R')--, --C(O)--,
--C(S)--, --C(NR')--, --C(O)N(R')--, --N(R')C(O)N(R')--,
--N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--, --S(O)--,
--S(O).sub.2--, --S(O).sub.2N(R')--, --N(R')S(O).sub.2--,
--SC(O)--, --C(O)S--, --OC(O)--, and --C(O)O--, wherein each
variable is independently as defined and described herein.
[0234] In some embodiments, a lipid comprises an optionally
substituted C.sub.10-C.sub.80 saturated or partially unsaturated,
aliphatic chain.
[0235] In some embodiments, a lipid comprises an optionally
substituted C.sub.10-C.sub.80 linear, saturated or partially
unsaturated, aliphatic chain.
[0236] In some embodiments, a lipid comprises an optionally
substituted C.sub.10-C.sub.60 saturated or partially unsaturated,
aliphatic chain.
[0237] In some embodiments, a lipid comprises an optionally
substituted C.sub.10-C.sub.60 linear, saturated or partially
unsaturated, aliphatic chain.
[0238] In some embodiments, a lipid comprises an optionally
substituted C.sub.10-C.sub.40 saturated or partially unsaturated,
aliphatic chain.
[0239] In some embodiments, a lipid comprises an optionally
substituted C.sub.10-C.sub.40 linear, saturated or partially
unsaturated, aliphatic chain.
[0240] In some embodiments, a lipid comprises an optionally
substituted, C.sub.10-C.sub.60 saturated or partially unsaturated
aliphatic group, wherein one or more methylene units are optionally
and independently replaced by an optionally substituted group
selected from C.sub.1-C.sub.6 alkylene, C.sub.1-C.sub.6 alkenylene,
--C.ident.C--, a C.sub.1-C.sub.6 heteroaliphatic moiety,
--C(R').sub.2--, -Cy-, --O--, --S--, --S--S--, --N(R')--, --C(O)--,
--C(S)--, --C(NR')--, --C(O)N(R')--, --N(R')C(O)N(R')--,
--N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--, --S(O)--,
--S(O).sub.2--, --S(O).sub.2N(R')--, --N(R')S(O).sub.2--,
--SC(O)--, --C(O)S--, --OC(O)--, and --C(O)O--, wherein each
variable is independently as defined and described herein.
[0241] In some embodiments, a lipid comprises an optionally
substituted C.sub.10-C.sub.80 saturated or partially unsaturated,
aliphatic chain.
[0242] In some embodiments, a lipid comprises an optionally
substituted C.sub.10-C.sub.60 linear, saturated or partially
unsaturated, aliphatic chain.
[0243] In some embodiments, a lipid comprises an optionally
substituted C.sub.10-C.sub.40 linear, saturated or partially
unsaturated, aliphatic chain.
[0244] In some embodiments, a lipid comprises an optionally
substituted, C.sub.10-C.sub.40 saturated or partially unsaturated
aliphatic group, wherein one or more methylene units are optionally
and independently replaced by an optionally substituted group
selected from C.sub.1-C.sub.6 alkylene, C.sub.1-C.sub.6 alkenylene,
--C.ident.--, a C.sub.1-C.sub.6 heteroaliphatic moiety,
--C(R').sub.2--, -Cy-, --O--, --S--, --S--S--, --N(R')--, --C(O)--,
--C(S)--, --C(NR')--, --C(O)N(R')--, --N(R')C(O)N(R')--,
--N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--, --S(O)--,
--S(O).sub.2--, --S(O).sub.2N(R')--, --N(R')S(O).sub.2--,
--SC(O)--, --C(O)S--, --OC(O)--, and --C(O)O--, wherein each
variable is independently as defined and described herein.
[0245] In some embodiments, a lipid comprises an optionally
substituted C.sub.10-C.sub.40 saturated or partially unsaturated,
aliphatic chain.
[0246] In some embodiments, a lipid comprises an optionally
substituted C.sub.10-C.sub.40 linear, saturated or partially
unsaturated, aliphatic chain.
[0247] In some embodiments, a composition further comprises one or
more additional components selected from: a polynucleotide,
carbonic anhydrase inhibitor, a dye, an intercalating agent, an
acridine, a cross-linker, psoralene, mitomycin C, a porphyrin,
TPPC4, texaphyrin, Sapphyrin, a polycyclic aromatic hydrocarbon
phenazine, dihydrophenazine, an artificial endonuclease, a
chelating agent, EDTA, an alkylating agent, a phosphate, an amino,
a mercapto, a PEG, PEG-40K, MPEG, [MPEG].sub.2, a polyamino, an
alkyl, a substituted alkyl, a radiolabeled marker, an enzyme, a
hapten biotin, a transport/absorption facilitator, aspirin, vitamin
E, folic acid, a synthetic ribonuclease, a protein, a glycoprotein,
a peptide, a molecule having a specific affinity for a co-ligand,
an antibody, a hormone, a hormone receptor, a non-peptidic species,
a lipid, a lectin, a carbohydrate, a vitamin, a cofactor,
selectivity agent, or a drug. In some embodiments, a composition
further comprises one or more additional components selected from:
a polynucleotide, carbonic anhydrase inhibitor, a dye, an
intercalating agent, an acridine, a cross-linker, psoralene,
mitomycin C, a porphyrin, TPPC4, texaphyrin, Sapphyrin, a
polycyclic aromatic hydrocarbon phenazine, dihydrophenazine, an
artificial endonuclease, a chelating agent, EDTA, an alkylating
agent, a phosphate, an amino, a mercapto, a PEG, PEG-40K, MPEG,
[MPEG].sub.2, a polyamino, an alkyl, a substituted alkyl, a
radiolabeled marker, an enzyme, a hapten biotin, a
transport/absorption facilitator, aspirin, vitamin E, folic acid, a
synthetic ribonuclease, a protein, a glycoprotein, a peptide, a
molecule having a specific affinity for a co-ligand, an antibody, a
hormone, a hormone receptor, a non-peptidic species, a lipid, a
lectin, a carbohydrate, a vitamin, a cofactor, or a drug.
[0248] In some embodiments, the present disclosure provides an
oligonucleotide conjugated to a selectivity agent. In some
embodiments, the present disclosure provides a composition
comprising an oligonucleotide or oligonucleotide type comprising a
selectivity agent. In some embodiments, a selectivity agent binds
specifically to one or more neurotransmitter transporters selected
from the group consisting of a dopamine transporter (DAT), a
serotonin transporter (SERT), and a norepinephrine transporter
(NET). In some embodiments, a selectivity agent is selected from
the group consisting of a dopamine reuptake inhibitor (DRI), a
selective serotonin reuptake inhibitor (SSRI), a noradrenaline
reuptake inhibitor (NRI), a norepinephrine-dopamine reuptake
inhibitor (NDRI), and a serotonin-norepinephrine-dopamine reuptake
inhibitor (SNDRI). In some embodiments, a selectivity agent is
selected from the group consisting of a triple reuptake inhibitor,
a noradrenaline dopamine double reuptake inhibitor, a serotonin
single reuptake inhibitor, a noradrenaline single reuptake
inhibitor, and a dopamine single reuptake inhibitor. In some
embodiments, a selectivity agent is selected from the group
consisting of a dopamine reuptake inhibitor (DRI), a
Norepinephrine-Dopamine Reuptake Inhibitor (NDRI) and a
serotonin-Norepinephrine-Dopamine Reuptake Inhibitor (SNDRI). In
some embodiments, a selectivity agent is selected from the
selectivity agents which are described in U.S. Pat. Nos. 9,084,825;
and 9,193,969; and WO2011131693, WO2014064258.
[0249] In some embodiments, a lipid comprises a C.sub.10-C.sub.80
linear, saturated or partially unsaturated, aliphatic chain.
[0250] In some embodiments, a composition further comprises a
linker linking the oligonucleotide and the lipid, wherein the
linker is selected from: an uncharged linker; a charged linker; a
linker comprises an alkyl; a linker comprises a phosphate; a
branched linker; an unbranched linker; a linker comprises at least
one cleavage group; a linker comprises at least one redox cleavage
group; a linker comprises at least one phosphate-based cleavage
group; a linker comprises at least one acid-cleavage group; a
linker comprises at least one ester-based cleavage group; a linker
comprises at least one peptide-based cleavage group.
[0251] In some embodiments, an oligonucleotide comprises or
consists of or is an oligonucleotide or oligonucleotide composition
or chirally controlled oligonucleotide composition.
[0252] In some embodiments, an oligonucleotide comprises or
consists of or is an oligonucleotide composition or chirally
controlled oligonucleotide composition, wherein the sequence of the
oligonucleotide comprises or consists of the sequence of any
oligonucleotide described herein.
[0253] In some embodiments, an oligonucleotide comprises or
consists of or is an oligonucleotide composition or chirally
controlled oligonucleotide composition, wherein the sequence of the
oligonucleotide comprises or consists of the sequence of any
oligonucleotide listed in Table 4.
[0254] In some embodiments, an oligonucleotide comprises or
consists of or is an oligonucleotide composition or chirally
controlled oligonucleotide composition, wherein the sequence of the
oligonucleotide comprises or consists of the sequence of a
splice-switching oligonucleotide.
[0255] The composition or method of any of the embodiments
described herein, wherein the oligonucleotide is a chirally
controlled oligonucleotide composition.
[0256] The composition or method of any of the embodiments
described herein, wherein the disease or disorder is Huntington's
Disease.
[0257] The composition or method of any of the embodiments
described herein, wherein the oligonucleotide is capable of
participating in RNaseH-mediated cleavage of a mutant Huntingtin
gene mRNA.
[0258] The composition or method of any of the embodiments
described herein, wherein the oligonucleotide comprises, consists
of or is the sequence of any oligonucleotide disclosed herein.
[0259] The composition or method of any of the embodiments
described herein, wherein the oligonucleotide is capable of
differentiating between a wild-type and a mutant Huntingtin
allele.
[0260] The composition or method of any of the embodiments
described herein, wherein the oligonucleotide is capable of
participating in RNaseH-mediated cleavage of a mutant Huntingtin
gene mRNA.
[0261] The composition or method of any of the embodiments
described herein, wherein the oligonucleotide comprises, consists
of or is the sequence of any oligonucleotide disclosed in Table
4.
[0262] In some embodiments, an oligonucleotide comprises or
consists of or is an oligonucleotide or oligonucleotide composition
or chirally controlled oligonucleotide composition, wherein the
sequence of the oligonucleotide comprises or consists of the
sequence of any of: WV-1092, WV-2595, or WV-2603.
[0263] In some embodiments, a sequence of an oligonucleotide
includes any one or more of: base sequence (including length);
pattern of chemical modifications to sugar and base moieties;
pattern of backbone linkages; pattern of natural phosphate
linkages, phosphorothioate linkages, phosphorothioate triester
linkages, and combinations thereof; pattern of backbone chiral
centers; pattern of stereochemistry (Rp/Sp) of chiral
internucleotidic linkages; pattern of backbone phosphorus
modifications; pattern of modifications on the internucleotidic
phosphorus atom, such as --S.sup.-, and -L-R.sup.1 of formula
I.
[0264] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide composition comprising
oligonucleotides of a particular oligonucleotide type characterized
by:
[0265] 1) a common base sequence and length;
[0266] 2) a common pattern of backbone linkages; and
[0267] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type, wherein the oligonucleotides
target a mutant Huntingtin gene, and the length is from about 10 to
about 50 nucleotides, wherein the backbone linkages comprise at
least one phosphorothioate, and wherein the pattern of backbone
chiral centers comprises at least one chiral center in a Rp
conformation and at least one chiral center in a Sp
conformation.
[0268] In some embodiments, the present disclosure provides a
method for cleavage of a nucleic acid having a base sequence
comprising a target sequence, the method comprising steps of:
[0269] (a) contacting a nucleic acid having a base sequence
comprising a target sequence with a chirally controlled
oligonucleotide composition comprising oligonucleotides of a
particular oligonucleotide type characterized by: [0270] 1) a
common base sequence and length, wherein the common base sequence
is or comprises a sequence that is complementary to the target
sequence in the nucleic acid; [0271] 2) a common pattern of
backbone linkages; and [0272] 3) a common pattern of backbone
chiral centers; which composition is chirally controlled in that it
is enriched, relative to a substantially racemic preparation of
oligonucleotides having the particular base sequence and length,
for oligonucleotides of the particular oligonucleotide type,
wherein the oligonucleotide targets a mutant Huntingtin gene, and
the length is from about 10 to about 50 nucleotides, wherein the
backbone linkages comprise at least one phosphorothioate, and
wherein the pattern of backbone chiral centers comprises at least
one chiral center in a Rp conformation and at least one chiral
center in a Sp conformation.
[0273] In some embodiments, the present disclosure provides a
method for cleavage of a nucleic acid having a base sequence
comprising a target sequence, the method comprising steps of:
[0274] (a) contacting a nucleic acid having a base sequence
comprising a target sequence with a chirally controlled
oligonucleotide composition comprising oligonucleotides of a
particular oligonucleotide type characterized by: [0275] 1) a
common base sequence and length, wherein the common base sequence
is or comprises a sequence that is complementary to the target
sequence in the nucleic acid; [0276] 2) a common pattern of
backbone linkages; and [0277] 3) a common pattern of backbone
chiral centers; which composition is chirally controlled in that it
is enriched, relative to a substantially racemic preparation of
oligonucleotides having the particular base sequence and length,
for oligonucleotides of the particular oligonucleotide type,
wherein the oligonucleotide targets a mutant Huntingtin gene, and
the length is from about 10 to about 50 nucleotides, wherein the
backbone linkages comprise at least one phosphorothioate, and
wherein the pattern of backbone chiral centers comprises at least
one chiral center in a Rp conformation and at least one chiral
center in a Sp conformation; and
[0278] (b) cleavage of the nucleic acid mediated by a RNAseH or RNA
interference mechanism.
[0279] In some embodiments, a provided composition further
comprises a selectivity agent selected from: the group of compounds
which binds specifically to one or more neurotransmitter
transporters selected from the group consisting of a dopamine
transporter (DAT), a serotonin transporter (SERT), and a
norepinephrine transporter (NET); the group consisting of a
dopamine reuptake inhibitor (DRI), a selective serotonin reuptake
inhibitor (SSRI), a noradrenaline reuptake inhibitor (NRI), a
norepinephrine-dopamine reuptake inhibitor (NDRI), and a
serotonin-norepinephrine-dopamine reuptake inhibitor (SNDRI); the
group consisting of a triple reuptake inhibitor, a noradrenaline
dopamine double reuptake inhibitor, a serotonin single reuptake
inhibitor, a noradrenaline single reuptake inhibitor, and a
dopamine single reuptake inhibitor; and the group consisting of a
dopamine reuptake inhibitor (DRI), a Norepinephrine-Dopamine
Reuptake Inhibitor (NDRI) and a serotonin-Norepinephrine-Dopamine
Reuptake Inhibitor (SNDRI).
[0280] In some embodiments, a provided composition comprises
oligonucleotides wherein the base sequence, pattern of backbone
linkages and/or pattern of backbone chiral centers of the
oligonucleotides comprises or consists of the base sequence,
pattern of backbone linkages and/or pattern of backbone chiral
centers of any of any oligonucleotide selected from Tables N1A,
N2A, N3A, N4A and 8; and WV-1092, WV-2595, and WV-2603.
[0281] In some embodiments, a provided composition comprises
oligonucleotides wherein the base sequence, pattern of backbone
linkages and/or pattern of backbone chiral centers of the
oligonucleotides comprises or consists of the base sequence, and
pattern of backbone linkages, and/or pattern of backbone chiral
centers of any of any oligonucleotide selected from Tables N1A,
N2A, N3A, N4A and 8; and WV-1092, WV-2595, and WV-2603.
[0282] In some embodiments, a provided composition comprises
oligonucleotides wherein the base sequence, pattern of backbone
linkages and/or pattern of backbone chiral centers of the
oligonucleotides comprises or consists of the base sequence, and
pattern of backbone linkages, and pattern of backbone chiral
centers of any of any oligonucleotide selected from Tables N1A,
N2A, N3A, N4A and 8; and WV-1092, WV-2595, and WV-2603.
Definitions
[0283] Aliphatic: The term "aliphatic" or "aliphatic group", as
used herein, means a straight-chain (i.e., unbranched) or branched,
substituted or unsubstituted hydrocarbon chain that is completely
saturated or that contains one or more units of unsaturation, or a
monocyclic hydrocarbon or bicyclic or polycyclic hydrocarbon that
is completely saturated or that contains one or more units of
unsaturation, but which is not aromatic (also referred to herein as
"carbocycle" "cycloaliphatic" or "cycloalkyl"), that has a single
point of attachment to the rest of the molecule. In some
embodiments, aliphatic groups contain 1-50 aliphatic carbon atoms.
Unless otherwise specified, aliphatic groups contain 1-10 aliphatic
carbon atoms. In some embodiments, aliphatic groups contain 1-6
aliphatic carbon atoms. In some embodiments, aliphatic groups
contain 1-5 aliphatic carbon atoms. In other embodiments, aliphatic
groups contain 1-4 aliphatic carbon atoms. In still other
embodiments, aliphatic groups contain 1-3 aliphatic carbon atoms,
and in yet other embodiments, aliphatic groups contain 1-2
aliphatic carbon atoms. In some embodiments, "cycloaliphatic" (or
"carbocycle" or "cycloalkyl") refers to a monocyclic or bicyclic
C.sub.3-C.sub.10 hydrocarbon that is completely saturated or that
contains one or more units of unsaturation, but which is not
aromatic, that has a single point of attachment to the rest of the
molecule. In some embodiments, "cycloaliphatic" (or "carbocycle" or
"cycloalkyl") refers to a monocyclic C.sub.3-C.sub.6 hydrocarbon
that is completely saturated or that contains one or more units of
unsaturation, but which is not aromatic, that has a single point of
attachment to the rest of the molecule. Suitable aliphatic groups
include, but are not limited to, linear or branched, substituted or
unsubstituted alkyl, alkenyl, alkynyl groups and hybrids thereof
such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or
(cycloalkyl)alkenyl.
[0284] Alkylene: The term "alkylene" refers to a bivalent alkyl
group. An "alkylene chain" is a polymethylene group, i.e.,
--(CH.sub.2).sub.n--, wherein n is a positive integer, preferably
from 1 to 6, from 1 to 4, from 1 to 3, from 1 to 2, or from 2 to 3.
A substituted alkylene chain is a polymethylene group in which one
or more methylene hydrogen atoms are replaced with a substituent.
Suitable substituents include those described below for a
substituted aliphatic group.
[0285] Alkenylene: The term "alkenylene" refers to a bivalent
alkenyl group. A substituted alkenylene chain is a polymethylene
group containing at least one double bond in which one or more
hydrogen atoms are replaced with a substituent. Suitable
substituents include those described below for a substituted
aliphatic group.
[0286] Animal: As used herein, the term "animal" refers to any
member of the animal kingdom. In some embodiments, "animal" refers
to humans, at any stage of development. In some embodiments,
"animal" refers to non-human animals, at any stage of development.
In certain embodiments, the non-human animal is a mammal (e.g., a
rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep,
cattle, a primate, and/or a pig). In some embodiments, animals
include, but are not limited to, mammals, birds, reptiles,
amphibians, fish, and/or worms. In some embodiments, an animal may
be a transgenic animal, a genetically-engineered animal, and/or a
clone.
[0287] Approximately: As used herein, the terms "approximately" or
"about" in reference to a number are generally taken to include
numbers that fall within a range of 5%, 10%, 15%, or 20% in either
direction (greater than or less than) of the number unless
otherwise stated or otherwise evident from the context (except
where such number would be less than 0% or exceed 100% of a
possible value). In some embodiments, use of the term "about" in
reference to dosages means.+-.5 mg/kg/day.
[0288] Aryl: The term "aryl" used alone or as part of a larger
moiety as in "aralkyl," "aralkoxy," or "aryloxyalkyl," refers to
monocyclic and bicyclic ring systems having a total of five to
fourteen ring members, wherein at least one ring in the system is
aromatic and wherein each ring in the system contains three to
seven ring members. The term "aryl" may be used interchangeably
with the term "aryl ring." In certain embodiments of the present
disclosure, "aryl" refers to an aromatic ring system which
includes, but not limited to, phenyl, biphenyl, naphthyl, anthracyl
and the like, which may bear one or more substituents. Also
included within the scope of the term "aryl," as it is used herein,
is a group in which an aromatic ring is fused to one or more
non-aromatic rings, such as indanyl, phthalimidyl, naphthimidyl,
phenanthridinyl, or tetrahydronaphthyl, and the like.
[0289] Characteristic portion: As used herein, the phrase a
"characteristic portion" of a protein or polypeptide is one that
contains a continuous stretch of amino acids, or a collection of
continuous stretches of amino acids, that together are
characteristic of a protein or polypeptide. Each such continuous
stretch generally will contain at least two amino acids.
Furthermore, those of ordinary skill in the art will appreciate
that typically at least 5, 10, 15, 20 or more amino acids are
required to be characteristic of a protein. In general, a
characteristic portion is one that, in addition to the sequence
identity specified above, shares at least one functional
characteristic with the relevant intact protein.
[0290] Characteristic sequence: A "characteristic sequence" is a
sequence that is found in all members of a family of polypeptides
or nucleic acids, and therefore can be used by those of ordinary
skill in the art to define members of the family.
[0291] Characteristic structural element: The term "characteristic
structural element" refers to a distinctive structural element
(e.g., core structure, collection of pendant moieties, sequence
element, etc) that is found in all members of a family of
polypeptides, small molecules, or nucleic acids, and therefore can
be used by those of ordinary skill in the art to define members of
the family.
[0292] Comparable: The term "comparable" is used herein to describe
two (or more) sets of conditions or circumstances that are
sufficiently similar to one another to permit comparison of results
obtained or phenomena observed. In some embodiments, comparable
sets of conditions or circumstances are characterized by a
plurality of substantially identical features and one or a small
number of varied features. Those of ordinary skill in the art will
appreciate that sets of conditions are comparable to one another
when characterized by a sufficient number and type of substantially
identical features to warrant a reasonable conclusion that
differences in results obtained or phenomena observed under the
different sets of conditions or circumstances are caused by or
indicative of the variation in those features that are varied.
[0293] Dosing regimen: As used herein, a "dosing regimen" or
"therapeutic regimen" refers to a set of unit doses (typically more
than one) that are administered individually to a subject,
typically separated by periods of time. In some embodiments, a
given therapeutic agent has a recommended dosing regimen, which may
involve one or more doses. In some embodiments, a dosing regimen
comprises a plurality of doses each of which are separated from one
another by a time period of the same length; in some embodiments, a
dosing regime comprises a plurality of doses and at least two
different time periods separating individual doses. In some
embodiments, all doses within a dosing regimen are of the same unit
dose amount. In some embodiments, different doses within a dosing
regimen are of different amounts. In some embodiments, a dosing
regimen comprises a first dose in a first dose amount, followed by
one or more additional doses in a second dose amount different from
the first dose amount. In some embodiments, a dosing regimen
comprises a first dose in a first dose amount, followed by one or
more additional doses in a second dose amount same as the first
dose amount.
[0294] Equivalent agents: Those of ordinary skill in the art,
reading the present disclosure, will appreciate that the scope of
useful agents in the context of the present disclosure is not
limited to those specifically mentioned or exemplified herein. In
particular, those skilled in the art will recognize that active
agents typically have a structure that consists of a core and
attached pendant moieties, and furthermore will appreciate that
simple variations of such core and/or pendant moieties may not
significantly alter activity of the agent. For example, in some
embodiments, substitution of one or more pendant moieties with
groups of comparable three-dimensional structure and/or chemical
reactivity characteristics may generate a substituted compound or
portion equivalent to a parent reference compound or portion. In
some embodiments, addition or removal of one or more pendant
moieties may generate a substituted compound equivalent to a parent
reference compound. In some embodiments, alteration of core
structure, for example by addition or removal of a small number of
bonds (typically not more than 5, 4, 3, 2, or 1 bonds, and often
only a single bond) may generate a substituted compound equivalent
to a parent reference compound. In many embodiments, equivalent
compounds may be prepared by methods illustrated in general
reaction schemes as, for example, described below, or by
modifications thereof, using readily available starting materials,
reagents and conventional or provided synthesis procedures. In
these reactions, it is also possible to make use of variants, which
are in themselves known, but are not mentioned here.
[0295] Equivalent Dosage: The term "equivalent dosage" is used
herein to compare dosages of different pharmaceutically active
agents that effect the same biological result. Dosages of two
different agents are considered to be "equivalent" to one another
in accordance with the present disclosure if they achieve a
comparable level or extent of the biological result. In some
embodiments, equivalent dosages of different pharmaceutical agents
for use in accordance with the present disclosure are determined
using in vitro and/or in vivo assays as described herein. In some
embodiments, one or more lysosomal activating agents for use in
accordance with the present disclosure is utilized at a dose
equivalent to a dose of a reference lysosomal activating agent; in
some such embodiments, the reference lysosomal activating agent for
such purpose is selected from the group consisting of small
molecule allosteric activators (e.g., pyrazolpyrimidines),
imminosugars (e.g., isofagomine), antioxidants (e.g.,
n-acetyl-cysteine), and regulators of cellular trafficking (e.g.,
Rab1a polypeptide).
[0296] Heteroaliphatic: The term "heteroaliphatic" refers to an
aliphatic group wherein one or more units selected from C, CH,
CH.sub.2, or CH.sub.3 are independently replaced by a heteroatom.
In some embodiments, a heteroaliphatic group is heteroalkyl. In
some embodiments, a heteroaliphatic group is heteroalkenyl.
[0297] Heteroaryl: The terms "heteroaryl" and "heteroar-," used
alone or as part of a larger moiety, e.g., "heteroaralkyl," or
"heteroaralkoxy," refer to groups having 5 to 10 ring atoms,
preferably 5, 6, or 9 ring atoms; having 6, 10, or 14.pi. electrons
shared in a cyclic array; and having, in addition to carbon atoms,
from one to five heteroatoms. The term "heteroatom" refers to
nitrogen, oxygen, or sulfur, and includes any oxidized form of
nitrogen or sulfur, and any quaternized form of a basic nitrogen.
Heteroaryl groups include, without limitation, thienyl, furanyl,
pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl,
isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl,
pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl,
naphthyridinyl, and pteridinyl. The terms "heteroaryl" and
"heteroar-," as used herein, also include groups in which a
heteroaromatic ring is fused to one or more aryl, cycloaliphatic,
or heterocyclyl rings, where the radical or point of attachment is
on the heteroaromatic ring. Nonlimiting examples include indolyl,
isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl,
benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinyl,
phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinolizinyl,
carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl,
tetrahydroquinolinyl, tetrahydroisoquinolinyl, and
pyrido[2,3-b]-1,4-oxazin-3(4H)-one. A heteroaryl group may be mono-
or bicyclic. The term "heteroaryl" may be used interchangeably with
the terms "heteroaryl ring," "heteroaryl group," or
"heteroaromatic," any of which terms include rings that are
optionally substituted. The term "heteroaralkyl" refers to an alkyl
group substituted by a heteroaryl, wherein the alkyl and heteroaryl
portions independently are optionally substituted.
[0298] Heteroatom: The term "heteroatom" means one or more of
oxygen, sulfur, nitrogen, phosphorus, boron, selenium, or silicon
(including, any oxidized form of nitrogen, boron, selenium, sulfur,
phosphorus, or silicon; the quaternized form of any basic nitrogen
or; a substitutable nitrogen of a heterocyclic ring, for example N
(as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl) or
NR.sup.+ (as in N-substituted pyrrolidinyl)).
[0299] Heterocycle: As used herein, the terms "heterocycle,"
"heterocyclyl," "heterocyclic radical," and "heterocyclic ring" are
used interchangeably and refer to a stable 3- to 7-membered
monocyclic or 7-10-membered bicyclic heterocyclic moiety that is
either saturated or partially unsaturated, and having, in addition
to carbon atoms, one or more, preferably one to four, heteroatoms,
as defined above. When used in reference to a ring atom of a
heterocycle, the term "nitrogen" includes a substituted nitrogen.
As an example, in a saturated or partially unsaturated ring having
0-3 heteroatoms selected from oxygen, sulfur or nitrogen, the
nitrogen may be N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in
pyrrolidinyl), or +NR (as in N-substituted pyrrolidinyl).
[0300] A heterocyclic ring can be attached to its pendant group at
any heteroatom or carbon atom that results in a stable structure
and any of the ring atoms can be optionally substituted. Examples
of such saturated or partially unsaturated heterocyclic radicals
include, without limitation, tetrahydrofuranyl,
tetrahydrothiophenyl pyrrolidinyl, piperidinyl, pyrrolinyl,
tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl,
oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl,
oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl. The terms
"heterocycle," "heterocyclyl," "heterocyclyl ring," "heterocyclic
group," "heterocyclic moiety," and "heterocyclic radical," are used
interchangeably herein, and also include groups in which a
heterocyclyl ring is fused to one or more aryl, heteroaryl, or
cycloaliphatic rings, such as indolinyl, 3H-indolyl, chromanyl,
phenanthridinyl, or tetrahydroquinolinyl, where the radical or
point of attachment is on the heterocyclyl ring. A heterocyclyl
group may be mono- or bicyclic. The term "heterocyclylalkyl" refers
to an alkyl group substituted by a heterocyclyl, wherein the alkyl
and heterocyclyl portions independently are optionally
substituted.
[0301] Intraperitoneal: The phrases "intraperitoneal
administration" and "administered intraperitonealy" as used herein
have their art-understood meaning referring to administration of a
compound or composition into the peritoneum of a subject.
[0302] In vitro: As used herein, the term "in vitro" refers to
events that occur in an artificial environment, e.g., in a test
tube or reaction vessel, in cell culture, etc., rather than within
an organism (e.g., animal, plant, and/or microbe).
[0303] In vivo: As used herein, the term "in vivo" refers to events
that occur within an organism (e.g., animal, plant, and/or
microbe).
[0304] Lower alkyl: The term "lower alkyl" refers to a C.sub.1-4
straight or branched alkyl group. Example lower alkyl groups are
methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and
tert-butyl.
[0305] Lower haloalkyl: The term "lower haloalkyl" refers to a
C.sub.1-4 straight or branched alkyl group that is substituted with
one or more halogen atoms.
[0306] Optionally substituted: As described herein, compounds of
the disclosure may contain "optionally substituted" moieties. In
general, the term "substituted," whether preceded by the term
"optionally" or not, means that one or more hydrogens of the
designated moiety are replaced with a suitable substituent. Unless
otherwise indicated, an "optionally substituted" group may have a
suitable substituent at each substitutable position of the group,
and when more than one position in any given structure may be
substituted with more than one substituent selected from a
specified group, the substituent may be either the same or
different at every position. Combinations of substituents
envisioned by this disclosure are preferably those that result in
the formation of stable or chemically feasible compounds. The term
"stable," as used herein, refers to compounds that are not
substantially altered when subjected to conditions to allow for
their production, detection, and, in certain embodiments, their
recovery, purification, and use for one or more of the purposes
disclosed herein.
[0307] Suitable monovalent substituents on a substitutable carbon
atom of an "optionally substituted" group are independently
halogen; --(CH.sub.2).sub.0-4R.sup..largecircle.;
--(CH.sub.2).sub.0-4OR.sup..largecircle.;
--O(CH.sub.2).sub.0-4R.sup..largecircle.,
--O--(CH.sub.2).sub.0-4C(O)OR.sup..largecircle.;
--(CH.sub.2).sub.0-4CH(OR.sup..largecircle.).sub.2;
--(CH.sub.2).sub.0-4SR.sup..largecircle.; --(CH.sub.2).sub.0-4Ph,
which may be substituted with R.sup..largecircle.;
--(CH.sub.2).sub.0-4O(CH.sub.2).sub.0-1Ph which may be substituted
with R.sup..largecircle.; --CH.dbd.CHPh, which may be substituted
with R.sup..largecircle.;
--(CH.sub.2).sub.0-4O(CH.sub.2).sub.0-1-pyridyl which may be
substituted with R.sup..largecircle.; --NO.sub.2; --CN; --N.sub.3;
--(CH.sub.2).sub.0-4N(R.sup..largecircle.).sub.2;
--(CH.sub.2).sub.0-4N(R.sup..largecircle.)C(O)R.sup..largecircle.;
--N(R.sup..largecircle.)C(S)R.sup..largecircle.;
--(CH.sub.2).sub.0-4N(R.sup..largecircle.)C(O)NR.sup..largecircle..sub.2;
--N(R.sup..largecircle.)C(S)NR.sup..largecircle..sub.2;
--(CH.sub.2).sub.0-4N(R.sup..largecircle.)C(O)OR.sup..largecircle.;
--N(R.sup..largecircle.)N(R.sup..largecircle.)C(O)R.sup..largecircle.;
--N(R.sup..largecircle.)N(R.sup..largecircle.)C(O)NR.sup..largecircle..su-
b.2;
--N(R.sup..largecircle.)N(R.sup..largecircle.)C(O)OR.sup..largecircle-
.; --(CH.sub.2).sub.0-4C(O)R.sup..largecircle.;
--C(S)R.sup..largecircle.;
--(CH.sub.2).sub.0-4C(O)OR.sup..largecircle.;
--(CH.sub.2).sub.0-4C(O)SR.sup..largecircle.;
--(CH.sub.2).sub.0-4C(O)OSiR.sup..largecircle..sub.3;
--(CH.sub.2).sub.0-4OC(O)R.sup..largecircle.;
--OC(O)(CH.sub.2).sub.0-4SR, --SC(S)SR.sup..largecircle.;
--(CH.sub.2).sub.0-4SC(O)R.sup..largecircle.;
--(CH.sub.2).sub.0-4C(O)NR.sup..largecircle..sub.2;
--C(S)NR.sup..largecircle..sub.2; --C(S)SR.sup..largecircle.;
--SC(S)SR.sup..largecircle.,
--(CH.sub.2).sub.0-4OC(O)NR.sup..largecircle..sub.2;
--C(O)N(OR.sup..largecircle.)R.sup..largecircle.;
--C(O)C(O)R.sup..largecircle.;
--C(O)CH.sub.2C(O)R.sup..largecircle.;
--C(NOR.sup..largecircle.)R.sup..largecircle.;
--(CH.sub.2).sub.0-4SSR.sup..largecircle.;
--(CH.sub.2).sub.0-4S(O).sub.2R.sup..largecircle.;
--(CH.sub.2).sub.0-4S(O).sub.2OR.sup..largecircle.;
--(CH.sub.2).sub.0-4OS(O).sub.2R.sup..largecircle.;
--S(O).sub.2NR.sup..largecircle..sub.2; --(CH.sub.2).sub.0-4
S(O)R.sup..largecircle.;
--N(R.sup..largecircle.)S(O).sub.2NR.sup..largecircle..sub.2;
--N(R.sup..largecircle.)S(O).sub.2R.sup..largecircle.;
--N(OR.sup..largecircle.)R.sup..largecircle.;
--C(NH)NR.sup..largecircle..sub.2; --P(O).sub.2R.sup..largecircle.;
--P(O)R.sup..largecircle..sub.2; --OP(O)R.sup..largecircle..sub.2;
--OP(O)(OR.sup..largecircle.).sub.2; --SiR.sup..largecircle..sub.3;
--(C.sub.1-4 straight or branched
alkylene)O--N(R.sup..largecircle.).sub.2; or --(C.sub.1-4 straight
or branched alkylene)C(O)O--N(R.sup..largecircle.).sub.2, wherein
each R.sup..largecircle. may be substituted as defined below and is
independently hydrogen, C.sub.1-6 aliphatic, --CH.sub.2Ph,
--O(CH.sub.2).sub.0-1Ph, --CH.sub.2-(5-6 membered heteroaryl ring),
or a 5-6 membered saturated, partially unsaturated, or aryl ring
having 0-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, or, notwithstanding the definition above, two
independent occurrences of R.sup..largecircle., taken together with
their intervening atom(s), form a 3-12 membered saturated,
partially unsaturated, or aryl mono- or bicyclic ring having 0-4
heteroatoms independently selected from nitrogen, oxygen, or
sulfur, which may be substituted as defined below.
[0308] Suitable monovalent substituents on R.sup..largecircle. (or
the ring formed by taking two independent occurrences of
R.sup..largecircle. together with their intervening atoms), are
independently halogen, --(CH.sub.2).sub.0-2R.sup..circle-solid.,
-(haloR.sup..circle-solid.), --(CH.sub.2).sub.0-2OH,
--(CH.sub.2).sub.0-2OR.sup..circle-solid.,
--(CH.sub.2).sub.0-2CH(OR.sup..circle-solid.).sub.2;
--O(haloR.sup..circle-solid.), --CN, --N.sub.3,
--(CH.sub.2).sub.0-2C(O)R.sup..circle-solid.,
--(CH.sub.2).sub.0-2C(O)OH,
--(CH.sub.2).sub.0-2C(O)OR.sup..circle-solid.,
--(CH.sub.2).sub.0-2SR.sup..circle-solid., --(CH.sub.2).sub.0-2SH,
--(CH.sub.2).sub.0-2NH.sub.2,
--(CH.sub.2).sub.0-2NHR.sup..circle-solid.,
--(CH.sub.2).sub.0-2NR.sup..circle-solid..sub.2, --NO.sub.2,
--SiR.sup..circle-solid..sub.3, --OSiR.sup..circle-solid..sub.3,
--C(O)SR.sup..circle-solid., --(C.sub.1-4 straight or branched
alkylene)C(O)OR.sup..circle-solid., or --SSR.sup..circle-solid.
wherein each R.sup..circle-solid. is unsubstituted or where
preceded by "halo" is substituted only with one or more halogens,
and is independently selected from C.sub.1-4 aliphatic,
--CH.sub.2Ph, --O(CH.sub.2).sub.0-1Ph, or a 5-6 membered saturated,
partially unsaturated, or aryl ring having 0-4 heteroatoms
independently selected from nitrogen, oxygen, or sulfur. Suitable
divalent substituents on a saturated carbon atom of R.sup..degree.
include .dbd.O and .dbd.S.
[0309] Suitable divalent substituents on a saturated carbon atom of
an "optionally substituted" group include the following: .dbd.O,
.dbd.S, .dbd.NNR*.sub.2, .dbd.NNHC(O)R*, .dbd.NNHC(O)OR*,
.dbd.NNHS(O).sub.2R*, .dbd.NR*, .dbd.NOR*,
--O(C(R*.sub.2)).sub.2-3O--, or --S(C(R*.sub.2)).sub.2-3S--,
wherein each independent occurrence of R* is selected from
hydrogen, C.sub.1-6 aliphatic which may be substituted as defined
below, or an unsubstituted 5-6-membered saturated, partially
unsaturated, or aryl ring having 0-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur. Suitable divalent
substituents that are bound to vicinal substitutable carbons of an
"optionally substituted" group include: --O(CR*.sub.2).sub.2-3O--,
wherein each independent occurrence of R* is selected from
hydrogen, C.sub.1-6 aliphatic which may be substituted as defined
below, or an unsubstituted 5-6-membered saturated, partially
unsaturated, or aryl ring having 0-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur.
[0310] Suitable substituents on the aliphatic group of R* include
halogen, --R.sup..circle-solid., -(haloR.sup..circle-solid.), --OH,
--OR.sup..circle-solid., --O(haloR.sup..circle-solid.), --CN,
--C(O)OH, --C(O)OR.sup..circle-solid., --NH.sub.2,
--NHR.sup..circle-solid., --NR.sup..circle-solid..sub.2, or
--NO.sub.2, wherein each R.sup..circle-solid. is unsubstituted or
where preceded by "halo" is substituted only with one or more
halogens, and is independently C.sub.1-4 aliphatic, --CH.sub.2Ph,
--O(CH.sub.2).sub.0-1Ph, or a 5-6 membered saturated, partially
unsaturated, or aryl ring having 0-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur.
[0311] Suitable substituents on a substitutable nitrogen of an
"optionally substituted" group include --R.sup..dagger.,
--NR.sup..dagger..sub.2, --C(O)R.sup..dagger.,
--C(O)OR.sup..dagger., --C(O)C(O)R.sup..dagger.,
--C(O)CH.sub.2C(O)R.sup..dagger., --S(O).sub.2R.sup..dagger.,
--S(O).sub.2NR.sup..dagger..sub.2, --C(S)NR.sup..dagger..sub.2,
--C(NH)NR.sup..dagger..sub.2, or --N(R)S(O).sub.2R.sup..dagger.;
wherein each R.sup..dagger. is independently hydrogen, C.sub.1-6
aliphatic which may be substituted as defined below, unsubstituted
--OPh, or an unsubstituted 5-6 membered saturated, partially
unsaturated, or aryl ring having 0-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or, notwithstanding the
definition above, two independent occurrences of R.sup..dagger.,
taken together with their intervening atom(s) form an unsubstituted
3-12 membered saturated, partially unsaturated, or aryl mono- or
bicyclic ring having 0-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur.
[0312] Suitable substituents on the aliphatic group of
R.sup..dagger. are independently halogen, --R.sup..circle-solid.,
-(haloR.sup..circle-solid.), --OH, --OR.sup..circle-solid.,
--O(haloR.sup..circle-solid.), --CN, --C(O)OH,
--C(O)OR.sup..circle-solid., --NH.sub.2, --NHR.sup..circle-solid.,
--NR.sup..circle-solid..sub.2, or --NO.sub.2, wherein each
R.sup..circle-solid. is unsubstituted or where preceded by "halo"
is substituted only with one or more halogens, and is independently
C.sub.1-4 aliphatic, --CH.sub.2Ph, --O(CH.sub.2).sub.0-1Ph, or a
5-6 membered saturated, partially unsaturated, or aryl ring having
0-4 heteroatoms independently selected from nitrogen, oxygen, or
sulfur.
[0313] Oral: The phrases "oral administration" and "administered
orally" as used herein have their art-understood meaning referring
to administration by mouth of a compound or composition.
[0314] Parenteral: The phrases "parenteral administration" and
"administered parenterally" as used herein have their
art-understood meaning referring to modes of administration other
than enteral and topical administration, usually by injection, and
include, without limitation, intravenous, intramuscular,
intraarterial, intrathecal, intracapsular, intraorbital,
intracardiac, intradermal, intraperitoneal, transtracheal,
subcutaneous, subcuticular, intraarticulare, subcapsular,
subarachnoid, intraspinal, and intrasternal injection and
infusion.
[0315] Partially unsaturated: As used herein, the term "partially
unsaturated" refers to a ring moiety that includes at least one
double or triple bond. The term "partially unsaturated" is intended
to encompass rings having multiple sites of unsaturation, but is
not intended to include aryl or heteroaryl moieties, as herein
defined.
[0316] Pharmaceutical composition: As used herein, the term
"pharmaceutical composition" refers to an active agent, formulated
together with one or more pharmaceutically acceptable carriers. In
some embodiments, active agent is present in unit dose amount
appropriate for administration in a therapeutic regimen that shows
a statistically significant probability of achieving a
predetermined therapeutic effect when administered to a relevant
population. In some embodiments, pharmaceutical compositions may be
specially formulated for administration in solid or liquid form,
including those adapted for the following: oral administration, for
example, drenches (aqueous or non-aqueous solutions or
suspensions), tablets, e.g., those targeted for buccal, sublingual,
and systemic absorption, boluses, powders, granules, pastes for
application to the tongue; parenteral administration, for example,
by subcutaneous, intramuscular, intravenous or epidural injection
as, for example, a sterile solution or suspension, or
sustained-release formulation; topical application, for example, as
a cream, ointment, or a controlled-release patch or spray applied
to the skin, lungs, or oral cavity; intravaginally or
intrarectally, for example, as a pessary, cream, or foam;
sublingually; ocularly; transdermally; or nasally, pulmonary, and
to other mucosal surfaces.
[0317] Pharmaceutically acceptable: As used herein, the phrase
"pharmaceutically acceptable" refers to those compounds, materials,
compositions, and/or dosage forms which are, within the scope of
sound medical judgment, suitable for use in contact with the
tissues of human beings and animals without excessive toxicity,
irritation, allergic response, or other problem or complication,
commensurate with a reasonable benefit/risk ratio.
[0318] Pharmaceutically acceptable carrier: As used herein, the
term "pharmaceutically acceptable carrier" means a
pharmaceutically-acceptable material, composition or vehicle, such
as a liquid or solid filler, diluent, excipient, or solvent
encapsulating material, involved in carrying or transporting the
subject compound from one organ, or portion of the body, to another
organ, or portion of the body. Each carrier must be "acceptable" in
the sense of being compatible with the other ingredients of the
formulation and not injurious to the patient. Some examples of
materials which can serve as pharmaceutically-acceptable carriers
include: sugars, such as lactose, glucose and sucrose; starches,
such as corn starch and potato starch; cellulose, and its
derivatives, such as sodium carboxymethyl cellulose, ethyl
cellulose and cellulose acetate; powdered tragacanth; malt;
gelatin; talc; excipients, such as cocoa butter and suppository
waxes; oils, such as peanut oil, cottonseed oil, safflower oil,
sesame oil, olive oil, corn oil and soybean oil; glycols, such as
propylene glycol; polyols, such as glycerin, sorbitol, mannitol and
polyethylene glycol; esters, such as ethyl oleate and ethyl
laurate; agar; buffering agents, such as magnesium hydroxide and
aluminum hydroxide; alginic acid; pyrogen-free water; isotonic
saline; Ringer's solution; ethyl alcohol; pH buffered solutions;
polyesters, polycarbonates and/or polyanhydrides; and other
non-toxic compatible substances employed in pharmaceutical
formulations.
[0319] Pharmaceutically acceptable salt: The term "pharmaceutically
acceptable salt", as used herein, refers to salts of such compounds
that are appropriate for use in pharmaceutical contexts, i.e.,
salts which are, within the scope of sound medical judgment,
suitable for use in contact with the tissues of humans and lower
animals without undue toxicity, irritation, allergic response and
the like, and are commensurate with a reasonable benefit/risk
ratio. Pharmaceutically acceptable salts are well known in the art.
For example, S. M. Berge, et al. describes pharmaceutically
acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19
(1977). In some embodiments, pharmaceutically acceptable salt
include, but are not limited to, nontoxic acid addition salts,
which are salts of an amino group formed with inorganic acids such
as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric
acid and perchloric acid or with organic acids such as acetic acid,
maleic acid, tartaric acid, citric acid, succinic acid or malonic
acid or by using other methods used in the art such as ion
exchange. In some embodiments, pharmaceutically acceptable salts
include, but are not limited to, adipate, alginate, ascorbate,
aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate,
camphorate, camphorsulfonate, citrate, cyclopentanepropionate,
digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate,
glucoheptonate, glycerophosphate, gluconate, hemisulfate,
heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate,
lactobionate, lactate, laurate, lauryl sulfate, malate, maleate,
malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate,
nitrate, oleate, oxalate, palmitate, pamoate, pectinate,
persulfate, 3-phenylpropionate, phosphate, picrate, pivalate,
propionate, stearate, succinate, sulfate, tartrate, thiocyanate,
p-toluenesulfonate, undecanoate, valerate salts, and the like.
Representative alkali or alkaline earth metal salts include sodium,
lithium, potassium, calcium, magnesium, and the like. In some
embodiments, pharmaceutically acceptable salts include, when
appropriate, nontoxic ammonium, quaternary ammonium, and amine
cations formed using counterions such as halide, hydroxide,
carboxylate, sulfate, phosphate, nitrate, alkyl having from 1 to 6
carbon atoms, sulfonate and aryl sulfonate.
[0320] Prodrug: A general, a "prodrug," as that term is used herein
and as is understood in the art, is an entity that, when
administered to an organism, is metabolized in the body to deliver
an active (e.g., therapeutic or diagnostic) agent of interest.
Typically, such metabolism involves removal of at least one
"prodrug moiety" so that the active agent is formed. Various forms
of "prodrugs" are known in the art. For examples of such prodrug
moieties, see: [0321] a) Design of Prodrugs, edited by H.
Bundgaard, (Elsevier, 1985) and Methods in Enzymology, 42:309-396,
edited by K. Widder, et al. (Academic Press, 1985); [0322] b)
Prodrugs and Targeted Delivery, edited by J. Rautio (Wiley, 2011);
[0323] c) Prodrugs and Targeted Delivery, edited by J. Rautio
(Wiley, 2011); [0324] d) A Textbook of Drug Design and Development,
edited by Krogsgaard-Larsen; [0325] e) Bundgaard, Chapter 5 "Design
and Application of Prodrugs", by H. Bundgaard, p. 113-191 (1991);
[0326] f) Bundgaard, Advanced Drug Delivery Reviews, 8:1-38 (1992);
[0327] g) Bundgaard, et al., Journal of Pharmaceutical Sciences,
77:285 (1988); and [0328] h) Kakeya, et al., Chem. Pharm. Bull.,
32:692 (1984).
[0329] As with other compounds described herein, prodrugs may be
provided in any of a variety of forms, e.g., crystal forms, salt
forms etc. In some embodiments, prodrugs are provided as
pharmaceutically acceptable salts thereof.
[0330] Protecting group: The term "protecting group," as used
herein, is well known in the art and includes those described in
detail in Protecting Groups in Organic Synthesis, T. W. Greene and
P. G. M. Wuts, 3.sup.rd edition, John Wiley & Sons, 1999, the
entirety of which is incorporated herein by reference. Also
included are those protecting groups specially adapted for
nucleoside and nucleotide chemistry described in Current Protocols
in Nucleic Acid Chemistry, edited by Serge L. Beaucage et al.
06/2012, the entirety of Chapter 2 is incorporated herein by
reference. Suitable amino-protecting groups include methyl
carbamate, ethyl carbamante, 9-fluorenylmethyl carbamate (Fmoc),
9-(2-sulfo)fluorenylmethyl carbamate,
9-(2,7-dibromo)fluoroenylmethyl carbamate,
2,7-di-t-butyl-[9-(10,10-dioxo-10,10,10,10-tetrahydrothioxanthyl)]methyl
carbamate (DBD-Tmoc), 4-methoxyphenacyl carbamate (Phenoc),
2,2,2-trichloroethyl carbamate (Troc), 2-trimethylsilylethyl
carbamate (Teoc), 2-phenylethyl carbamate (hZ),
1-(1-adamantyl)-1-methylethyl carbamate (Adpoc),
1,1-dimethyl-2-haloethyl carbamate, 1,1-dimethyl-2,2-dibromoethyl
carbamate (DB-t-BOC), 1,1-dimethyl-2,2,2-trichloroethyl carbamate
(TCBOC), 1-methyl-1-(4-biphenylyl)ethyl carbamate (Bpoc),
1-(3,5-di-t-butylphenyl)-1-methylethyl carbamate (t-Bumeoc), 2-(2'-
and 4'-pyridyl)ethyl carbamate (Pyoc),
2-(N,N-dicyclohexylcarboxamido)ethyl carbamate, t-butyl carbamate
(BOC), 1-adamantyl carbamate (Adoc), vinyl carbamate (Voc), allyl
carbamate (Alloc), 1-isopropylallyl carbamate (Ipaoc), cinnamyl
carbamate (Coc), 4-nitrocinnamyl carbamate (Noc), 8-quinolyl
carbamate, N-hydroxypiperidinyl carbamate, alkyldithio carbamate,
benzyl carbamate (Cbz), p-methoxybenzyl carbamate (Moz),
p-nitrobenzyl carbamate, p-bromobenzyl carbamate, p-chlorobenzyl
carbamate, 2,4-dichlorobenzyl carbamate, 4-methylsulfinylbenzyl
carbamate (Msz), 9-anthrylmethyl carbamate, diphenylmethyl
carbamate, 2-methylthioethyl carbamate, 2-methyl sulfonylethyl
carbamate, 2-(p-toluenesulfonyl)ethyl carbamate,
[2-(1,3-dithianyl)]methyl carbamate (Dmoc), 4-methylthiophenyl
carbamate (Mtpc), 2,4-dimethylthiophenyl carbamate (Bmpc),
2-phosphonioethyl carbamate (Peoc), 2-triphenylphosphonioisopropyl
carbamate (Ppoc), 1,1-dimethyl-2-cyanoethyl carbamate,
m-chloro-p-acyloxybenzyl carbamate, p-(dihydroxyboryl)benzyl
carbamate, 5-benzisoxazolylmethyl carbamate,
2-(trifluoromethyl)-6-chromonylmethyl carbamate (Tcroc),
m-nitrophenyl carbamate, 3,5-dimethoxybenzyl carbamate,
o-nitrobenzyl carbamate, 3,4-dimethoxy-6-nitrobenzyl carbamate,
phenyl(o-nitrophenyl)methyl carbamate, phenothiazinyl-(10)-carbonyl
derivative, N'-p-toluenesulfonylaminocarbonyl derivative,
N'-phenylaminothiocarbonyl derivative, t-amyl carbamate, S-benzyl
thiocarbamate, p-cyanobenzyl carbamate, cyclobutyl carbamate,
cyclohexyl carbamate, cyclopentyl carbamate, cyclopropylmethyl
carbamate, p-decyloxybenzyl carbamate, 2,2-dimethoxycarbonylvinyl
carbamate, o-(N,N-dimethylcarboxamido)benzyl carbamate,
1,1-dimethyl-3-(N,N-dimethylcarboxamido)propyl carbamate,
1,1-dimethylpropynyl carbamate, di(2-pyridyl)methyl carbamate,
2-furanylmethyl carbamate, 2-iodoethyl carbamate, isoborynl
carbamate, isobutyl carbamate, isonicotinyl carbamate,
p-(p'-methoxyphenylazo)benzyl carbamate, 1-methylcyclobutyl
carbamate, 1-methylcyclohexyl carbamate,
1-methyl-1-cyclopropylmethyl carbamate,
1-methyl-1-(3,5-dimethoxyphenyl)ethyl carbamate,
1-methyl-1-(p-phenylazophenyl)ethyl carbamate,
1-methyl-1-phenylethyl carbamate, 1-methyl-1-(4-pyridyl)ethyl
carbamate, phenyl carbamate, p-(phenylazo)benzyl carbamate,
2,4,6-tri-t-butylphenyl carbamate, 4-(trimethylammonium)benzyl
carbamate, 2,4,6-trimethylbenzyl carbamate, formamide, acetamide,
chloroacetamide, trichloroacetamide, trifluoroacetamide,
phenylacetamide, 3-phenylpropanamide, picolinamide,
3-pyridylcarboxamide, N-benzoylphenylalanyl derivative, benzamide,
p-phenylbenzamide, o-nitrophenylacetamide, o-nitrophenoxyacetamide,
acetoacetamide, (N'-dithiobenzyloxycarbonylamino)acetamide,
3-(p-hydroxyphenyl)propanamide, 3-(o-nitrophenyl)propanamide,
2-methyl-2-(o-nitrophenoxy)propanamide,
2-methyl-2-(o-phenylazophenoxy)propanamide, 4-chlorobutanamide,
3-methyl-3-nitrobutanamide, o-nitrocinnamide, N-acetylmethionine
derivative, o-nitrobenzamide, o-(benzoyloxymethyl)benzamide,
4,5-diphenyl-3-oxazolin-2-one, N-phthalimide, N-dithiasuccinimide
(Dts), N-2,3-diphenylmaleimide, N-2,5-dimethylpyrrole,
N-1,1,4,4-tetramethyldisilylazacyclopentane adduct (STABASE),
5-substituted 1,3-dimethyl-1,3,5-triazacyclohexan-2-one,
5-substituted 1,3-dibenzyl-1,3,5-triazacyclohexan-2-one,
1-substituted 3,5-dinitro-4-pyridone, N-methylamine, N-allylamine,
N-[2-(trimethylsilyl)ethoxy]methylamine (SEM),
N-3-acetoxypropylamine,
N-(1-isopropyl-4-nitro-2-oxo-3-pyroolin-3-yl)amine, quaternary
ammonium salts, N-benzylamine, N-di(4-methoxyphenyl)methylamine,
N-5-dibenzosuberylamine, N-triphenylmethylamine (Tr),
N-[(4-methoxyphenyl)diphenylmethyl]amine (MMTr),
N-9-phenylfluorenylamine (PhF),
N-2,7-dichloro-9-fluorenylmethyleneamine, N-ferrocenylmethylamino
(Fcm), N-2-picolylamino N'-oxide, N-1,1-dimethylthiomethyleneamine,
N-benzylideneamine, N-p-methoxybenzylideneamine,
N-diphenylmethyleneamine, N-[(2-pyridyl)mesityl]methyleneamine,
N--(N',N'-dimethylaminomethylene)amine, N,N'-isopropylidenediamine,
N-p-nitrobenzylideneamine, N-salicylideneamine,
N-5-chlorosalicylideneamine,
N-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine,
N-cyclohexylideneamine, N-(5,5-dimethyl-3-oxo-1-cyclohexenyl)amine,
N-borane derivative, N-diphenylborinic acid derivative,
N-[phenyl(pentacarbonylchromium- or tungsten)carbonyl]amine,
N-copper chelate, N-zinc chelate, N-nitroamine, N-nitrosoamine,
amine N-oxide, diphenylphosphinamide (Dpp),
dimethylthiophosphinamide (Mpt), diphenylthiophosphinamide (Ppt),
dialkyl phosphoramidates, dibenzyl phosphoramidate, diphenyl
phosphoramidate, benzenesulfenamide, o-nitrobenzenesulfenamide
(Nps), 2,4-dinitrobenzenesulfenamide,
pentachlorobenzenesulfenamide, 2-nitro-4-methoxybenzenesulfenamide,
triphenylmethylsulfenamide, 3-nitropyridinesulfenamide (Npys),
p-toluenesulfonamide (Ts), benzenesulfonamide,
2,3,6,-trimethyl-4-methoxybenzenesulfonamide (Mtr),
2,4,6-trimethoxybenzenesulfonamide (Mtb),
2,6-dimethyl-4-methoxybenzenesulfonamide (Pme),
2,3,5,6-tetramethyl-4-methoxybenzenesulfonamide (Mte),
4-methoxybenzenesulfonamide (Mbs),
2,4,6-trimethylbenzenesulfonamide (Mts),
2,6-dimethoxy-4-methylbenzenesulfonamide (iMds),
2,2,5,7,8-pentamethylchroman-6-sulfonamide (Pmc),
methanesulfonamide (Ms), .beta.-trimethyl silylethanesulfonamide
(SES), 9-anthracenesulfonamide,
4-(4',8'-dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS),
benzylsulfonamide, trifluoromethylsulfonamide, and
phenacylsulfonamide.
[0331] Suitably protected carboxylic acids further include, but are
not limited to, silyl-, alkyl-, alkenyl-, aryl-, and
arylalkyl-protected carboxylic acids. Examples of suitable silyl
groups include trimethylsilyl, triethylsilyl, t-butyldimethylsilyl,
t-butyldiphenylsilyl, triisopropylsilyl, and the like. Examples of
suitable alkyl groups include methyl, benzyl, p-methoxybenzyl,
3,4-dimethoxybenzyl, trityl, t-butyl, tetrahydropyran-2-yl.
Examples of suitable alkenyl groups include allyl. Examples of
suitable aryl groups include optionally substituted phenyl,
biphenyl, or naphthyl. Examples of suitable arylalkyl groups
include optionally substituted benzyl (e.g., p-methoxybenzyl (MPM),
3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl,
2,6-dichlorobenzyl, p-cyanobenzyl), and 2- and 4-picolyl.
[0332] Suitable hydroxyl protecting groups include methyl,
methoxylmethyl (MOM), methylthiomethyl (MTM), t-butylthiomethyl,
(phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM),
p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM),
guaiacolmethyl (GUM), t-butoxymethyl, 4-pentenyloxymethyl (POM),
siloxymethyl, 2-methoxyethoxymethyl (MEM),
2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl,
2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP),
3-bromotetrahydropyranyl, tetrahydrothiopyranyl,
1-methoxycyclohexyl, 4-methoxytetrahydropyranyl (MTHP),
4-methoxytetrahydrothiopyranyl, 4-methoxytetrahydrothiopyranyl
S,S-dioxide, 1-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl
(CTMP), 1,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl,
2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7-methanobenzofuran-2-yl,
1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 1-methyl-1-methoxyethyl,
1-methyl-1-benzyloxyethyl, 1-methyl-1-benzyloxy-2-fluoroethyl,
2,2,2-trichloroethyl, 2-trimethyl silylethyl,
2-(phenylselenyl)ethyl, t-butyl, allyl, p-chlorophenyl,
p-methoxyphenyl, 2,4-dinitrophenyl, benzyl, p-methoxybenzyl,
3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl,
2,6-dichlorobenzyl, p-cyanobenzyl, p-phenylbenzyl, 2-picolyl,
4-picolyl, 3-methyl-2-picolyl N-oxido, diphenylmethyl,
p,p'-dinitrobenzhydryl, 5-dibenzosuberyl, triphenylmethyl,
.alpha.-naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl,
di(p-methoxyphenyl)phenylmethyl, tri(p-methoxyphenyl)methyl,
4-(4'-bromophenacyloxyphenyl)diphenylmethyl,
4,4',4''-tris(4,5-dichlorophthalimidophenyl)methyl,
4,4',4''-tris(levulinoyloxyphenyl)methyl,
4,4',4''-tris(benzoyloxyphenyl)methyl,
3-(imidazol-1-yl)bis(4',4''-dimethoxyphenyl)methyl,
1,1-bis(4-methoxyphenyl)-1'-pyrenylmethyl, 9-anthryl,
9-(9-phenyl)xanthenyl, 9-(9-phenyl-10-oxo)anthryl,
1,3-benzodithiolan-2-yl, benzisothiazolyl S,S-dioxido,
trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl
(TIPS), dimethylisopropylsilyl (IPDMS), diethylisopropylsilyl
(DEIPS), dimethylthexylsilyl, t-butyldimethylsilyl (TBDMS),
t-butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri-p-xylylsilyl,
triphenylsilyl, diphenylmethylsilyl (DPMS),
t-butylmethoxyphenylsilyl (TBMPS), formate, benzoylformate,
acetate, chloroacetate, dichloroacetate, trichloroacetate,
trifluoroacetate, methoxyacetate, triphenylmethoxyacetate,
phenoxyacetate, p-chlorophenoxyacetate, 3-phenylpropionate,
4-oxopentanoate (levulinate), 4,4-(ethylenedithio)pentanoate
(levulinoyldithioacetal), pivaloate, adamantoate, crotonate,
4-methoxycrotonate, benzoate, p-phenylbenzoate,
2,4,6-trimethylbenzoate (mesitoate), alkyl methyl carbonate,
9-fluorenylmethyl carbonate (Fmoc), alkyl ethyl carbonate, alkyl
2,2,2-trichloroethyl carbonate (Troc), 2-(trimethylsilyl)ethyl
carbonate (TMSEC), 2-(phenylsulfonyl) ethyl carbonate (Psec),
2-(triphenylphosphonio) ethyl carbonate (Peoc), alkyl isobutyl
carbonate, alkyl vinyl carbonate alkyl allyl carbonate, alkyl
p-nitrophenyl carbonate, alkyl benzyl carbonate, alkyl
p-methoxybenzyl carbonate, alkyl 3,4-dimethoxybenzyl carbonate,
alkyl o-nitrobenzyl carbonate, alkyl p-nitrobenzyl carbonate, alkyl
S-benzyl thiocarbonate, 4-ethoxy-1-napththyl carbonate, methyl
dithiocarbonate, 2-iodobenzoate, 4-azidobutyrate,
4-nitro-4-methylpentanoate, o-(dibromomethyl)benzoate,
2-formylbenzenesulfonate, 2-(methylthiomethoxy)ethyl,
4-(methylthiomethoxy)butyrate, 2-(methylthiomethoxymethyl)benzoate,
2,6-dichloro-4-methylphenoxyacetate,
2,6-dichloro-4-(1,1,3,3-tetramethylbutyl)phenoxyacetate,
2,4-bis(1,1-dimethylpropyl)phenoxyacetate, chlorodiphenylacetate,
isobutyrate, monosuccinoate, (E)-2-methyl-2-butenoate,
o-(methoxycarbonyl)benzoate, .alpha.-naphthoate, nitrate, alkyl
N,N,N',N'-tetramethylphosphorodiamidate, alkyl N-phenylcarbamate,
borate, dimethylphosphinothioyl, alkyl 2,4-dinitrophenylsulfenate,
sulfate, methanesulfonate (mesylate), benzylsulfonate, and tosylate
(Ts). For protecting 1,2- or 1,3-diols, the protecting groups
include methylene acetal, ethylidene acetal, 1-t-butylethylidene
ketal, 1-phenylethylidene ketal, (4-methoxyphenyl)ethylidene
acetal, 2,2,2-trichloroethylidene acetal, acetonide,
cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene
ketal, benzylidene acetal, p-methoxybenzylidene acetal,
2,4-dimethoxybenzylidene ketal, 3,4-dimethoxybenzylidene acetal,
2-nitrobenzylidene acetal, methoxymethylene acetal, ethoxymethylene
acetal, dimethoxymethylene ortho ester, 1-methoxyethylidene ortho
ester, 1-ethoxyethylidine ortho ester, 1,2-dimethoxyethylidene
ortho ester, .alpha.-methoxybenzylidene ortho ester,
1-(N,N-dimethylamino)ethylidene derivative,
.alpha.-(N,N'-dimethylamino)benzylidene derivative,
2-oxacyclopentylidene ortho ester, di-t-butylsilylene group (DTBS),
1,3-(1,1,3,3-tetraisopropyldisiloxanylidene) derivative (TIPDS),
tetra-t-butoxydisiloxane-1,3-diylidene derivative (TBDS), cyclic
carbonates, cyclic boronates, ethyl boronate, and phenyl
boronate.
[0333] In some embodiments, a hydroxyl protecting group is acetyl,
t-butyl, t-butoxymethyl, methoxymethyl, tetrahydropyranyl,
1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 2-trimethyl silylethyl,
p-chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl,
p-phenylbenzoyl, 2,6-dichlorobenzyl, diphenylmethyl, p-nitrobenzyl,
triphenylmethyl (trityl), 4,4'-dimethoxytrityl, trimethylsilyl,
triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl,
triphenylsilyl, triisopropylsilyl, benzoylformate, chloroacetyl,
trichloroacetyl, trifluoroacetyl, pivaloyl, 9-fluorenylmethyl
carbonate, mesylate, tosylate, triflate, trityl, monomethoxytrityl
(MMTr), 4,4'-dimethoxytrityl, (DMTr) and 4,4',4''-trimethoxytrityl
(TMTr), 2-cyanoethyl (CE or Cne), 2-(trimethylsilyl)ethyl (TSE),
2-(2-nitrophenyl)ethyl, 2-(4-cyanophenyl)ethyl
2-(4-nitrophenyl)ethyl (NPE), 2-(4-nitrophenyl sulfonyl)ethyl,
3,5-dichlorophenyl, 2,4-dimethylphenyl, 2-nitrophenyl,
4-nitrophenyl, 2,4,6-trimethylphenyl, 2-(2-nitrophenyl)ethyl,
butylthiocarbonyl, 4,4',4''-tris(benzoyloxy)trityl,
diphenylcarbamoyl, levulinyl, 2-(dibromomethyl)benzoyl (Dbmb),
2-(isopropylthiomethoxymethyl)benzoyl (Ptmt), 9-phenylxanthen-9-yl
(pixyl) or 9-(p-methoxyphenyl)xanthine-9-yl (MOX). In some
embodiments, each of the hydroxyl protecting groups is,
independently selected from acetyl, benzyl, t-butyldimethylsilyl,
t-butyldiphenylsilyl and 4,4'-dimethoxytrityl. In some embodiments,
the hydroxyl protecting group is selected from the group consisting
of trityl, monomethoxytrityl and 4,4'-dimethoxytrityl group.
[0334] In some embodiments, a phosphorus protecting group is a
group attached to the internucleotide phosphorus linkage throughout
oligonucleotide synthesis. In some embodiments, the phosphorus
protecting group is attached to the sulfur atom of the
internucleotide phosphorothioate linkage. In some embodiments, the
phosphorus protecting group is attached to the oxygen atom of the
internucleotide phosphorothioate linkage. In some embodiments, the
phosphorus protecting group is attached to the oxygen atom of the
internucleotide phosphate linkage. In some embodiments the
phosphorus protecting group is 2-cyanoethyl (CE or Cne),
2-trimethylsilylethyl, 2-nitroethyl, 2-sulfonylethyl, methyl,
benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe),
2-phenylethyl, 3-(N-tert-butylcarboxamido)-1-propyl, 4-oxopentyl,
4-methylthio-1-butyl, 2-cyano-1,1-dimethylethyl,
4-N-methylaminobutyl, 3-(2-pyridyl)-1-propyl,
2-[N-methyl-N-(2-pyridyl)]aminoethyl,
2-(N-formyl,N-methyl)aminoethyl,
4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl.
[0335] Protein: As used herein, the term "protein" refers to a
polypeptide (i.e., a string of at least two amino acids linked to
one another by peptide bonds). In some embodiments, proteins
include only naturally-occurring amino acids. In some embodiments,
proteins include one or more non-naturally-occurring amino acids
(e.g., moieties that form one or more peptide bonds with adjacent
amino acids). In some embodiments, one or more residues in a
protein chain contain a non-amino-acid moiety (e.g., a glycan,
etc). In some embodiments, a protein includes more than one
polypeptide chain, for example linked by one or more disulfide
bonds or associated by other means. In some embodiments, proteins
contain L-amino acids, D-amino acids, or both; in some embodiments,
proteins contain one or more amino acid modifications or analogs
known in the art. Useful modifications include, e.g., terminal
acetylation, amidation, methylation, etc. The term "peptide" is
generally used to refer to a polypeptide having a length of less
than about 100 amino acids, less than about 50 amino acids, less
than 20 amino acids, or less than 10 amino acids. In some
embodiments, proteins are antibodies, antibody fragments,
biologically active portions thereof, and/or characteristic
portions thereof.
[0336] Sample: A "sample" as used herein is a specific organism or
material obtained therefrom. In some embodiments, a sample is a
biological sample obtained or derived from a source of interest, as
described herein. In some embodiments, a source of interest
comprises an organism, such as an animal or human. In some
embodiments, a biological sample comprises biological tissue or
fluid. In some embodiments, a biological sample is or comprises any
one or more of: bone marrow; blood; blood cells; ascites; tissue or
fine needle biopsy samples; cell-containing body fluids; free
floating nucleic acids; sputum; saliva; urine; cerebrospinal fluid,
peritoneal fluid; pleural fluid; feces; lymph; gynecological
fluids; skin swabs; vaginal swabs; oral swabs; nasal swabs;
washings or lavages such as a ductal lavages or broncheoalveolar
lavages; aspirates; scrapings; bone marrow specimens; tissue biopsy
specimens; surgical specimens; feces, other body fluids,
secretions, and/or excretions; and/or cells therefrom, etc. In some
embodiments, a biological sample is or comprises cells obtained
from an individual. In some embodiments, a sample is a "primary
sample" obtained directly from a source of interest by any
appropriate means. For example, in some embodiments, a primary
biological sample is obtained by methods selected from the group
consisting of biopsy (e.g., fine needle aspiration or tissue
biopsy), surgery, collection of body fluid (e.g., blood, lymph,
feces etc.), etc. In some embodiments, as will be clear from
context, the term "sample" refers to a preparation that is obtained
by processing (e.g., by removing one or more components of and/or
by adding one or more agents to) a primary sample. For example,
filtering using a semi-permeable membrane. Such a "processed
sample" may comprise, for example nucleic acids or proteins
extracted from a sample or obtained by subjecting a primary sample
to techniques such as amplification or reverse transcription of
mRNA, isolation and/or purification of certain components, etc. In
some embodiments, a sample is an organism. In some embodiments, a
sample is a plant. In some embodiments, a sample is an animal. In
some embodiments, a sample is a human. In some embodiments, a
sample is an organism other than a human.
[0337] Stereochemically isomeric forms: The phrase
"stereochemically isomeric forms," as used herein, refers to
different compounds made up of the same atoms bonded by the same
sequence of bonds but having different three-dimensional structures
which are not interchangeable. In some embodiments of the
disclosure, provided chemical compositions may be or include pure
preparations of individual stereochemically isomeric forms of a
compound; in some embodiments, provided chemical compositions may
be or include mixtures of two or more stereochemically isomeric
forms of the compound. In certain embodiments, such mixtures
contain equal amounts of different stereochemically isomeric forms;
in certain embodiments, such mixtures contain different amounts of
at least two different stereochemically isomeric forms. In some
embodiments, a chemical composition may contain all diastereomers
and/or enantiomers of the compound. In some embodiments, a chemical
composition may contain less than all diastereomers and/or
enantiomers of a compound. In some embodiments, if a particular
enantiomer of a compound of the present disclosure is desired, it
may be prepared, for example, by asymmetric synthesis, or by
derivation with a chiral auxiliary, where the resulting
diastereomeric mixture is separated and the auxiliary group cleaved
to provide the pure desired enantiomers. Alternatively, where the
molecule contains a basic functional group, such as amino,
diastereomeric salts are formed with an appropriate
optically-active acid, and resolved, for example, by fractional
crystallization.
[0338] Subject: As used herein, the term "subject" or "test
subject" refers to any organism to which a provided compound or
composition is administered in accordance with the present
disclosure e.g., for experimental, diagnostic, prophylactic, and/or
therapeutic purposes. Typical subjects include animals (e.g.,
mammals such as mice, rats, rabbits, non-human primates, and
humans; insects; worms; etc.) and plants. In some embodiments, a
subject may be suffering from, and/or susceptible to a disease,
disorder, and/or condition.
[0339] Substantially: As used herein, the term "substantially"
refers to the qualitative condition of exhibiting total or
near-total extent or degree of a characteristic or property of
interest. One of ordinary skill in the biological arts will
understand that biological and chemical phenomena rarely, if ever,
go to completion and/or proceed to completeness or achieve or avoid
an absolute result. The term "substantially" is therefore used
herein to capture the potential lack of completeness inherent in
many biological and/or chemical phenomena.
[0340] Suffering from: An individual who is "suffering from" a
disease, disorder, and/or condition has been diagnosed with and/or
displays one or more symptoms of a disease, disorder, and/or
condition.
[0341] Susceptible to: An individual who is "susceptible to" a
disease, disorder, and/or condition is one who has a higher risk of
developing the disease, disorder, and/or condition than does a
member of the general public. In some embodiments, an individual
who is susceptible to a disease, disorder and/or condition may not
have been diagnosed with the disease, disorder, and/or condition.
In some embodiments, an individual who is susceptible to a disease,
disorder, and/or condition may exhibit symptoms of the disease,
disorder, and/or condition. In some embodiments, an individual who
is susceptible to a disease, disorder, and/or condition may not
exhibit symptoms of the disease, disorder, and/or condition. In
some embodiments, an individual who is susceptible to a disease,
disorder, and/or condition will develop the disease, disorder,
and/or condition. In some embodiments, an individual who is
susceptible to a disease, disorder, and/or condition will not
develop the disease, disorder, and/or condition.
[0342] Systemic: The phrases "systemic administration,"
"administered systemically," "peripheral administration," and
"administered peripherally" as used herein have their
art-understood meaning referring to administration of a compound or
composition such that it enters the recipient's system.
[0343] Tautomeric forms: The phrase "tautomeric forms," as used
herein, is used to describe different isomeric forms of organic
compounds that are capable of facile interconversion. Tautomers may
be characterized by the formal migration of a hydrogen atom or
proton, accompanied by a switch of a single bond and adjacent
double bond. In some embodiments, tautomers may result from
prototropic tautomerism (i.e., the relocation of a proton). In some
embodiments, tautomers may result from valence tautomerism (i.e.,
the rapid reorganization of bonding electrons). All such tautomeric
forms are intended to be included within the scope of the present
disclosure. In some embodiments, tautomeric forms of a compound
exist in mobile equilibrium with each other, so that attempts to
prepare the separate substances results in the formation of a
mixture. In some embodiments, tautomeric forms of a compound are
separable and isolatable compounds. In some embodiments of the
disclosure, chemical compositions may be provided that are or
include pure preparations of a single tautomeric form of a
compound. In some embodiments of the disclosure, chemical
compositions may be provided as mixtures of two or more tautomeric
forms of a compound. In certain embodiments, such mixtures contain
equal amounts of different tautomeric forms; in certain
embodiments, such mixtures contain different amounts of at least
two different tautomeric forms of a compound. In some embodiments
of the disclosure, chemical compositions may contain all tautomeric
forms of a compound. In some embodiments of the disclosure,
chemical compositions may contain less than all tautomeric forms of
a compound. In some embodiments of the disclosure, chemical
compositions may contain one or more tautomeric forms of a compound
in amounts that vary over time as a result of interconversion. In
some embodiments of the disclosure, the tautomerism is keto-enol
tautomerism. One of skill in the chemical arts would recognize that
a keto-enol tautomer can be "trapped" (i.e., chemically modified
such that it remains in the "enol" form) using any suitable reagent
known in the chemical arts in to provide an enol derivative that
may subsequently be isolated using one or more suitable techniques
known in the art. Unless otherwise indicated, the present
disclosure encompasses all tautomeric forms of relevant compounds,
whether in pure form or in admixture with one another.
[0344] Therapeutic agent: As used herein, the phrase "therapeutic
agent" refers to any agent that, when administered to a subject,
has a therapeutic effect and/or elicits a desired biological and/or
pharmacological effect. In some embodiments, a therapeutic agent is
any substance that can be used to alleviate, ameliorate, relieve,
inhibit, prevent, delay onset of, reduce severity of, and/or reduce
incidence of one or more symptoms or features of a disease,
disorder, and/or condition.
[0345] Therapeutically effective amount: As used herein, the term
"therapeutically effective amount" means an amount of a substance
(e.g., a therapeutic agent, composition, and/or formulation) that
elicits a desired biological response when administered as part of
a therapeutic regimen. In some embodiments, a therapeutically
effective amount of a substance is an amount that is sufficient,
when administered to a subject suffering from or susceptible to a
disease, disorder, and/or condition, to treat, diagnose, prevent,
and/or delay the onset of the disease, disorder, and/or condition.
As will be appreciated by those of ordinary skill in this art, the
effective amount of a substance may vary depending on such factors
as the desired biological endpoint, the substance to be delivered,
the target cell or tissue, etc. For example, the effective amount
of compound in a formulation to treat a disease, disorder, and/or
condition is the amount that alleviates, ameliorates, relieves,
inhibits, prevents, delays onset of, reduces severity of and/or
reduces incidence of one or more symptoms or features of the
disease, disorder, and/or condition. In some embodiments, a
therapeutically effective amount is administered in a single dose;
in some embodiments, multiple unit doses are required to deliver a
therapeutically effective amount.
[0346] Treat: As used herein, the term "treat," "treatment," or
"treating" refers to any method used to partially or completely
alleviate, ameliorate, relieve, inhibit, prevent, delay onset of,
reduce severity of, and/or reduce incidence of one or more symptoms
or features of a disease, disorder, and/or condition. Treatment may
be administered to a subject who does not exhibit signs of a
disease, disorder, and/or condition. In some embodiments, treatment
may be administered to a subject who exhibits only early signs of
the disease, disorder, and/or condition, for example for the
purpose of decreasing the risk of developing pathology associated
with the disease, disorder, and/or condition.
[0347] Unsaturated: The term "unsaturated," as used herein, means
that a moiety has one or more units of unsaturation.
[0348] Unit dose: The expression "unit dose" as used herein refers
to an amount administered as a single dose and/or in a physically
discrete unit of a pharmaceutical composition. In many embodiments,
a unit dose contains a predetermined quantity of an active agent.
In some embodiments, a unit dose contains an entire single dose of
the agent. In some embodiments, more than one unit dose is
administered to achieve a total single dose. In some embodiments,
administration of multiple unit doses is required, or expected to
be required, in order to achieve an intended effect. A unit dose
may be, for example, a volume of liquid (e.g., an acceptable
carrier) containing a predetermined quantity of one or more
therapeutic agents, a predetermined amount of one or more
therapeutic agents in solid form, a sustained release formulation
or drug delivery device containing a predetermined amount of one or
more therapeutic agents, etc. It will be appreciated that a unit
dose may be present in a formulation that includes any of a variety
of components in addition to the therapeutic agent(s). For example,
acceptable carriers (e.g., pharmaceutically acceptable carriers),
diluents, stabilizers, buffers, preservatives, etc., may be
included as described infra. It will be appreciated by those
skilled in the art, in many embodiments, a total appropriate daily
dosage of a particular therapeutic agent may comprise a portion, or
a plurality, of unit doses, and may be decided, for example, by the
attending physician within the scope of sound medical judgment. In
some embodiments, the specific effective dose level for any
particular subject or organism may depend upon a variety of factors
including the disorder being treated and the severity of the
disorder; activity of specific active compound employed; specific
composition employed; age, body weight, general health, sex and
diet of the subject; time of administration, and rate of excretion
of the specific active compound employed; duration of the
treatment; drugs and/or additional therapies used in combination or
coincidental with specific compound(s) employed, and like factors
well known in the medical arts.
[0349] Wild-type: As used herein, the term "wild-type" has its
art-understood meaning that refers to an entity having a structure
and/or activity as found in nature in a "normal" (as contrasted
with mutant, diseased, altered, etc) state or context. Those of
ordinary skill in the art will appreciate that wild type genes and
polypeptides often exist in multiple different forms (e.g.,
alleles).
[0350] Nucleic acid: The term "nucleic acid" includes any
nucleotides, modified variants thereof, analogs thereof, and
polymers thereof. The term "polynucleotide" as used herein refer to
a polymeric form of nucleotides of any length, either
ribonucleotides (RNA) or deoxyribonucleotides (DNA) or modified
variants or analogs thereof. These terms refer to the primary
structure of the molecules and, thus, include double- and
single-stranded DNA, and double- and single-stranded RNA. These
terms include, as equivalents, analogs of either RNA or DNA made
from nucleotide analogs and modified polynucleotides such as,
though not limited to, methylated, protected and/or capped
nucleotides or polynucleotides. The terms encompass poly- or
oligo-ribonucleotides (RNA) and poly- or oligo-deoxyribonucleotides
(DNA); RNA or DNA derived from N-glycosides or C-glycosides of
nucleobases and/or modified nucleobases; nucleic acids derived from
sugars and/or modified sugars; and nucleic acids derived from
phosphate bridges and/or modified phosphorus-atom bridges (also
referred to herein as "internucleotide linkages"). The term
encompasses nucleic acids containing any combinations of
nucleobases, modified nucleobases, sugars, modified sugars,
phosphate bridges or modified phosphorus atom bridges. Examples
include, and are not limited to, nucleic acids containing ribose
moieties, the nucleic acids containing deoxy-ribose moieties,
nucleic acids containing both ribose and deoxyribose moieties,
nucleic acids containing ribose and modified ribose moieties. The
prefix poly-refers to a nucleic acid containing 2 to about 10,000
nucleotide monomer units and wherein the prefix oligo-refers to a
nucleic acid containing 2 to about 200 nucleotide monomer
units.
[0351] Nucleotide: The term "nucleotide" as used herein refers to a
monomeric unit of a polynucleotide that consists of a heterocyclic
base, a sugar, and one or more phosphate groups or
phosphorus-containing internucleotidic linkages. The naturally
occurring bases, (guanine, (G), adenine, (A), cytosine, (C),
thymine, (T), and uracil (U)) are derivatives of purine or
pyrimidine, though it should be understood that naturally and
non-naturally occurring base analogs are also included. The
naturally occurring sugar is the pentose (five-carbon sugar)
deoxyribose (which forms DNA) or ribose (which forms RNA), though
it should be understood that naturally and non-naturally occurring
sugar analogs are also included. Nucleotides are linked via
internucleotidic linkages to form nucleic acids, or
polynucleotides. Many internucleotidic linkages are known in the
art (such as, though not limited to, phosphate, phosphorothioates,
boranophosphates and the like). Artificial nucleic acids include
PNAs (peptide nucleic acids), phosphotriesters, phosphorothionates,
H-phosphonates, phosphoramidates, boranophosphates,
methylphosphonates, phosphonoacetates, thiophosphonoacetates and
other variants of the phosphate backbone of native nucleic acids,
such as those described herein. Other analogs (e.g., artificial
nucleic acids or components which can be incorporated into a
nucleic acid or artificial nucleic acid) include: boranophosphate
RNA, FANA, locked nucleic acids (LNA), Morpholinos, peptidic
nucleic acids (PNA), threose nucleic acid (TNA), and glycol nucleic
acid (GNA). These skilled in the art are aware of a variety of
modified nucleotides or nucleotide analogs, including, for example,
those described in any of: Gryaznov, S; Chen, J.-K. J. Am. Chem.
Soc. 1994, 116, 3143; Hendrix et al. 1997 Chem. Eur. J. 3: 110;
Hyrup et al. 1996 Bioorg. Med. Chem. 4: 5; Jepsen et al. 2004
Oligo. 14: 130-146; Jones et al. J. Org. Chem. 1993, 58, 2983;
Koizumi et al. 2003 Nuc. Acids Res. 12: 3267-3273; Koshkin et al.
1998 Tetrahedron 54: 3607-3630; Kumar et al. 1998 Bioo. Med. Chem.
Let. 8: 2219-2222; Lauritsen et al. 2002 Chem. Comm. 5: 530-531;
Lauritsen et al. 2003 Bioo. Med. Chem. Lett. 13: 253-256; Mesmaeker
et al. Angew. Chem., Int. Ed. Engl. 1994, 33, 226; Morita et al.
2001 Nucl. Acids Res. Supp. 1: 241-242; Morita et al. 2002 Bioo.
Med. Chem. Lett. 12: 73-76; Morita et al. 2003 Bioo. Med. Chem.
Lett. 2211-2226; Nielsen et al. 1997 Chem. Soc. Rev. 73; Nielsen et
al. 1997 J. Chem. Soc. Perkins Transl. 1: 3423-3433; Obika et al.
1997 Tetrahedron Lett. 38 (50): 8735-8; Obika et al. 1998
Tetrahedron Lett. 39: 5401-5404; Pallan et al. 2012 Chem. Comm. 48:
8195-8197; Petersen et al. 2003 TRENDS Biotech. 21: 74-81;
Rajwanshi et al. 1999 Chem. Commun. 1395-1396; Schultz et al. 1996
Nucleic Acids Res. 24: 2966; Seth et al. 2009 J. Med. Chem. 52:
10-13; Seth et al. 2010 J. Med. Chem. 53: 8309-8318; Seth et al.
2010 J. Org. Chem. 75: 1569-1581; Seth et al. 2012 Bioo. Med. Chem.
Lett. 22: 296-299; Seth et al. 2012 Mol. Ther-Nuc. Acids. 1, e47;
Seth, Punit P; Siwkowski, Andrew; Allerson, Charles R; Vasquez,
Guillermo; Lee, Sam; Prakash, Thazha P; Kinberger, Garth; Migawa,
Michael T; Gaus, Hans; Bhat, Balkrishen; et al. From Nucleic Acids
Symposium Series (2008), 52(1), 553-554; Singh et al. 1998 Chem.
Comm. 1247-1248; Singh et al. 1998 J. Org. Chem. 63: 10035-39;
Singh et al. 1998 J. Org. Chem. 63: 6078-6079; Sorensen 2003 Chem.
Comm. 2130-2131; Ts'o et al. Ann. N. Y. Acad. Sci. 1988, 507, 220;
Van Aerschot et al. 1995 Angew. Chem. Int. Ed. Engl. 34: 1338;
Vasseur et al. J. Am. Chem. Soc. 1992, 114, 4006; WO 20070900071;
WO 20070900071; or WO 2016/079181.
[0352] Nucleoside: The term "nucleoside" refers to a moiety wherein
a nucleobase or a modified nucleobase is covalently bound to a
sugar or modified sugar.
[0353] Sugar: The term "sugar" refers to a monosaccharide in closed
and/or open form. Sugars include, but are not limited to, ribose,
deoxyribose, pentofuranose, pentopyranose, and hexopyranose
moieties. As used herein, the term also encompasses structural
analogs used in lieu of conventional sugar molecules, such as
glycol, polymer of which forms the backbone of the nucleic acid
analog, glycol nucleic acid ("GNA").
[0354] Modified sugar: The term "modified sugar" refers to a moiety
that can replace a sugar. The modified sugar mimics the spatial
arrangement, electronic properties, or some other physicochemical
property of a sugar.
[0355] Nucleobase: The term "nucleobase" refers to the parts of
nucleic acids that are involved in the hydrogen-bonding that binds
one nucleic acid strand to another complementary strand in a
sequence specific manner. The most common naturally-occurring
nucleobases are adenine (A), guanine (G), uracil (U), cytosine (C),
and thymine (T). In some embodiments, the naturally-occurring
nucleobases are modified adenine, guanine, uracil, cytosine, or
thymine. In some embodiments, the naturally-occurring nucleobases
are methylated adenine, guanine, uracil, cytosine, or thymine. In
some embodiments, a nucleobase is a "modified nucleobase," e.g., a
nucleobase other than adenine (A), guanine (G), uracil (U),
cytosine (C), and thymine (T). In some embodiments, the modified
nucleobases are methylated adenine, guanine, uracil, cytosine, or
thymine. In some embodiments, the modified nucleobase mimics the
spatial arrangement, electronic properties, or some other
physicochemical property of the nucleobase and retains the property
of hydrogen-bonding that binds one nucleic acid strand to another
in a sequence specific manner. In some embodiments, a modified
nucleobase can pair with all of the five naturally occurring bases
(uracil, thymine, adenine, cytosine, or guanine) without
substantially affecting the melting behavior, recognition by
intracellular enzymes or activity of the oligonucleotide
duplex.
[0356] Chiral ligand: The term "chiral ligand" or "chiral
auxiliary" refers to a moiety that is chiral and can be
incorporated into a reaction so that the reaction can be carried
out with certain stereoselectivity.
[0357] Condensing reagent: In a condensation reaction, the term
"condensing reagent" refers to a reagent that activates a less
reactive site and renders it more susceptible to attack by another
reagent. In some embodiments, such another reagent is a
nucleophile.
[0358] Blocking group: The term "blocking group" refers to a group
that masks the reactivity of a functional group. The functional
group can be subsequently unmasked by removal of the blocking
group. In some embodiments, a blocking group is a protecting
group.
[0359] Moiety: The term "moiety" refers to a specific segment or
functional group of a molecule. Chemical moieties are often
recognized chemical entities embedded in or appended to a
molecule.
[0360] Solid support: The term "solid support" refers to any
support which enables synthesis of nucleic acids. In some
embodiments, the term refers to a glass or a polymer, that is
insoluble in the media employed in the reaction steps performed to
synthesize nucleic acids, and is derivatized to comprise reactive
groups. In some embodiments, the solid support is Highly
Cross-linked Polystyrene (HCP) or Controlled Pore Glass (CPG). In
some embodiments, the solid support is Controlled Pore Glass (CPG).
In some embodiments, the solid support is hybrid support of
Controlled Pore Glass (CPG) and Highly Cross-linked Polystyrene
(HCP).
[0361] Linking moiety: The term "linking moiety" refers to any
moiety optionally positioned between the terminal nucleoside and
the solid support or between the terminal nucleoside and another
nucleoside, nucleotide, or nucleic acid.
[0362] DNA molecule: A "DNA molecule" refers to the polymeric form
of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in
its either single stranded form or a double-stranded helix. This
term refers only to the primary and secondary structure of the
molecule, and does not limit it to any particular tertiary forms.
Thus, this term includes double-stranded DNA found, inter alia, in
linear DNA molecules (e.g., restriction fragments), viruses,
plasmids, and chromosomes. In discussing the structure of
particular double-stranded DNA molecules, sequences can be
described herein according to the normal convention of giving only
the sequence in the 5' to 3' direction along the non-transcribed
strand of DNA (i.e., the strand having a sequence homologous to the
mRNA).
[0363] Coding sequence: A DNA "coding sequence" or "coding region"
is a double-stranded DNA sequence which is transcribed and
translated into a polypeptide in vivo when placed under the control
of appropriate expression control sequences. The boundaries of the
coding sequence (the "open reading frame" or "ORF") are determined
by a start codon at the 5' (amino) terminus and a translation stop
codon at the 3' (carboxyl) terminus. A coding sequence can include,
but is not limited to, prokaryotic sequences, cDNA from eukaryotic
mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA,
and synthetic DNA sequences. A polyadenylation signal and
transcription termination sequence is, usually, be located 3' to
the coding sequence. The term "non-coding sequence" or "non-coding
region" refers to regions of a polynucleotide sequence that are not
translated into amino acids (e.g. 5' and 3' un-translated
regions).
[0364] Reading frame: The term "reading frame" refers to one of the
six possible reading frames, three in each direction, of the double
stranded DNA molecule. The reading frame that is used determines
which codons are used to encode amino acids within the coding
sequence of a DNA molecule.
[0365] Antisense: As used herein, an "antisense" nucleic acid
molecule comprises a nucleotide sequence which is complementary to
a "sense" nucleic acid encoding a protein, e.g., complementary to
the coding strand of a double-stranded cDNA molecule, complementary
to an mRNA sequence or complementary to the coding strand of a
gene. Accordingly, an antisense nucleic acid molecule can associate
via hydrogen bonds to a sense nucleic acid molecule. In some
embodiments, an antisense oligonucleotide is an oligonucleotide
which participates in RNaseH-mediated cleavage; for example, an
antisense oligonucleotide hybridizes in a sequence-specific manner
to a portion of a target mRNA, thus targeting the mRNA for cleavage
by RNaseH. In some embodiments, an antisense oligonucleotide is
able to differentiate between a wild-type and a mutant allele of a
target. In some embodiments, an antisense oligonucleotide
significantly participates in RNaseH-mediated cleavage of a mutant
allele but participates in RNaseH-mediated cleavage of a wild-type
allele to a much less degree (e.g., does not significantly
participate in RNaseH-mediated cleavage of the wild-type allele of
the target).
[0366] Wobble position: As used herein, a "wobble position" refers
to the third position of a codon. Mutations in a DNA molecule
within the wobble position of a codon, in some embodiments, result
in silent or conservative mutations at the amino acid level. For
example, there are four codons that encode Glycine, i.e., GGU, GGC,
GGA and GGG, thus mutation of any wobble position nucleotide, to
any other nucleotide selected from A, U, C and G, does not result
in a change at the amino acid level of the encoded protein and,
therefore, is a silent substitution.
[0367] Silent substitution: a "silent substitution" or "silent
mutation" is one in which a nucleotide within a codon is modified,
but does not result in a change in the amino acid residue encoded
by the codon. Examples include mutations in the third position of a
codon, as well in the first position of certain codons such as in
the codon "CGG" which, when mutated to AGG, still encodes Arg.
[0368] Gene: The terms "gene," "recombinant gene" and "gene
construct" as used herein, refer to a DNA molecule, or portion of a
DNA molecule, that encodes a protein or a portion thereof. The DNA
molecule can contain an open reading frame encoding the protein (as
exon sequences) and can further include intron sequences. The term
"intron" as used herein, refers to a DNA sequence present in a
given gene which is not translated into protein and is found in
some, but not all cases, between exons. It can be desirable for the
gene to be operably linked to, (or it can comprise), one or more
promoters, enhancers, repressors and/or other regulatory sequences
to modulate the activity or expression of the gene, as is well
known in the art.
[0369] Complementary DNA: As used herein, a "complementary DNA" or
"cDNA" includes recombinant polynucleotides synthesized by reverse
transcription of mRNA and from which intervening sequences
(introns) have been removed.
[0370] Homology: "Homology" or "identity" or "similarity" refers to
sequence similarity between two nucleic acid molecules. Homology
and identity can each be determined by comparing a position in each
sequence which can be aligned for purposes of comparison. When an
equivalent position in the compared sequences is occupied by the
same base, then the molecules are identical at that position; when
the equivalent site occupied by the same or a similar nucleic acid
residue (e.g., similar in steric and/or electronic nature), then
the molecules can be referred to as homologous (similar) at that
position. Expression as a percentage of homology/similarity or
identity refers to a function of the number of identical or similar
nucleic acids at positions shared by the compared sequences. A
sequence which is "unrelated" or "non-homologous" shares less than
40% identity, less than 35% identity, less than 30% identity, or
less than 25% identity with a sequence described herein. In
comparing two sequences, the absence of residues (amino acids or
nucleic acids) or presence of extra residues also decreases the
identity and homology/similarity.
[0371] In some embodiments, the term "homology" describes a
mathematically based comparison of sequence similarities which is
used to identify genes with similar functions or motifs. The
nucleic acid sequences described herein can be used as a "query
sequence" to perform a search against public databases, for
example, to identify other family members, related sequences or
homologs. In some embodiments, such searches can be performed using
the NBLAST and XBLAST programs (version 2.0) of Altschul, et al.
(1990) J. Mol. Biol. 215:403-10. In some embodiments, BLAST
nucleotide searches can be performed with the NBLAST program,
score=100, wordlength=12 to obtain nucleotide sequences homologous
to nucleic acid molecules of the disclosure. In some embodiments,
to obtain gapped alignments for comparison purposes, Gapped BLAST
can be utilized as described in Altschul et al., (1997) Nucleic
Acids Res. 25(17):3389-3402. When utilizing BLAST and Gapped BLAST
programs, the default parameters of the respective programs (e.g.,
XBLAST and BLAST) can be used (See www.ncbi.nlm.nih.gov).
[0372] Identity: As used herein, "identity" means the percentage of
identical nucleotide residues at corresponding positions in two or
more sequences when the sequences are aligned to maximize sequence
matching, i.e., taking into account gaps and insertions. Identity
can be readily calculated by known methods, including but not
limited to those described in (Computational Molecular Biology,
Lesk, A. M., ed., Oxford University Press, New York, 1988;
Biocomputing: Informatics and Genome Projects, Smith, D. W., ed.,
Academic Press, New York, 1993; Computer Analysis of Sequence Data,
Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New
Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje,
G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov,
M. and Devereux, J., eds., M Stockton Press, New York, 1991; and
Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073
(1988). Methods to determine identity are designed to give the
largest match between the sequences tested. Moreover, methods to
determine identity are codified in publicly available computer
programs. Computer program methods to determine identity between
two sequences include, but are not limited to, the GCG program
package (Devereux, J., et al., Nucleic Acids Research 12(1): 387
(1984)), BLASTP, BLASTN, and FASTA (Altschul, S. F. et al., J.
Molec. Biol. 215: 403-410 (1990) and Altschul et al. Nuc. Acids
Res. 25: 3389-3402 (1997)). The BLAST X program is publicly
available from NCBI and other sources (BLAST Manual, Altschul, S.,
et al., NCBI NLM NIH Bethesda, Md. 20894; Altschul, S., et al., J.
Mol. Biol. 215: 403-410 (1990). The well-known Smith Waterman
algorithm can also be used to determine identity.
[0373] Heterologous: A "heterologous" region of a DNA sequence is
an identifiable segment of DNA within a larger DNA sequence that is
not found in association with the larger sequence in nature. Thus,
when the heterologous region encodes a mammalian gene, the gene can
usually be flanked by DNA that does not flank the mammalian genomic
DNA in the genome of the source organism. Another example of a
heterologous coding sequence is a sequence where the coding
sequence itself is not found in nature (e.g., a cDNA where the
genomic coding sequence contains introns or synthetic sequences
having codons or motifs different than the unmodified gene).
Allelic variations or naturally-occurring mutational events do not
give rise to a heterologous region of DNA as defined herein.
[0374] Transition mutation: The term "transition mutations" refers
to base changes in a DNA sequence in which a pyrimidine (cytidine
(C) or thymidine (T) is replaced by another pyrimidine, or a purine
(adenosine (A) or guanosine (G) is replaced by another purine.
[0375] Transversion mutation: The term "transversion mutations"
refers to base changes in a DNA sequence in which a pyrimidine
(cytidine (C) or thymidine (T) is replaced by a purine (adenosine
(A) or guanosine (G), or a purine is replaced by a pyrimidine.
[0376] Oligonucleotide: the term "oligonucleotide" refers to a
polymer or oligomer of nucleotide monomers, containing any
combination of nucleobases, modified nucleobases, sugars, modified
sugars, phosphate bridges, or modified phosphorus atom bridges
(also referred to herein as "internucleotidic linkage", defined
further herein).
[0377] Oligonucleotides can be single-stranded or double-stranded.
As used herein, the term "oligonucleotide strand" encompasses a
single-stranded oligonucleotide. A single-stranded oligonucleotide
can have double-stranded regions and a double-stranded
oligonucleotide can have single-stranded regions. Example
oligonucleotides include, but are not limited to structural genes,
genes including control and termination regions, self-replicating
systems such as viral or plasmid DNA, single-stranded and
double-stranded siRNAs and other RNA interference reagents (RNAi
agents or iRNA agents), shRNA, antisense oligonucleotides,
ribozymes, microRNAs, microRNA mimics, supermirs, aptamers,
antimirs, antagomirs, Ul adaptors, triplex-forming
oligonucleotides, G-quadruplex oligonucleotides, RNA activators,
immuno-stimulatory oligonucleotides, and decoy
oligonucleotides.
[0378] Double-stranded and single-stranded oligonucleotides that
are effective in inducing RNA interference are also referred to as
siRNA, RNAi agent, or iRNA agent, herein. In some embodiments,
these RNA interference inducing oligonucleotides associate with a
cytoplasmic multi-protein complex known as RNAi-induced silencing
complex (RISC). In many embodiments, single-stranded and
double-stranded RNAi agents are sufficiently long that they can be
cleaved by an endogenous molecule, e.g., by Dicer, to produce
smaller oligonucleotides that can enter the RISC machinery and
participate in RISC mediated cleavage of a target sequence, e.g. a
target mRNA.
[0379] Oligonucleotides of the present disclosure can be of various
lengths. In particular embodiments, oligonucleotides can range from
about 2 to about 200 nucleotides in length. In various related
embodiments, oligonucleotides, single-stranded, double-stranded,
and triple-stranded, can range in length from about 4 to about 10
nucleotides, from about 10 to about 50 nucleotides, from about 20
to about 50 nucleotides, from about 15 to about 30 nucleotides,
from about 20 to about 30 nucleotides in length. In some
embodiments, the oligonucleotide is from about 9 to about 39
nucleotides in length. In some embodiments, the oligonucleotide is
at least 4 nucleotides in length. In some embodiments, the
oligonucleotide is at least 5 nucleotides in length. In some
embodiments, the oligonucleotide is at least 6 nucleotides in
length. In some embodiments, the oligonucleotide is at least 7
nucleotides in length. In some embodiments, the oligonucleotide is
at least 8 nucleotides in length. In some embodiments, the
oligonucleotide is at least 9 nucleotides in length. In some
embodiments, the oligonucleotide is at least 10 nucleotides in
length. In some embodiments, the oligonucleotide is at least 11
nucleotides in length. In some embodiments, the oligonucleotide is
at least 12 nucleotides in length. In some embodiments, the
oligonucleotide is at least 15 nucleotides in length. In some
embodiments, the oligonucleotide is at least 20 nucleotides in
length. In some embodiments, the oligonucleotide is at least 25
nucleotides in length. In some embodiments, the oligonucleotide is
at least 30 nucleotides in length. In some embodiments, the
oligonucleotide is a duplex of complementary strands of at least 18
nucleotides in length. In some embodiments, the oligonucleotide is
a duplex of complementary strands of at least 21 nucleotides in
length.
[0380] Internucleotidic linkage. As used herein, the phrase
"internucleotidic linkage" refers generally to the
phosphorus-containing linkage between nucleotide units of an
oligonucleotide, and is interchangeable with "inter-sugar linkage"
and "phosphorus atom bridge," as used above and herein. In some
embodiments, an internucleotidic linkage is a phosphodiester
linkage, as found in naturally occurring DNA and RNA molecules. In
some embodiments, an internucleotidic linkage is a "modified
internucleotidic linkage" wherein each oxygen atom of the
phosphodiester linkage is optionally and independently replaced by
an organic or inorganic moiety. In some embodiments, such an
organic or inorganic moiety is selected from but not limited to
.dbd.S, .dbd.Se, .dbd.NR', --SR', --SeR', --N(R').sub.2,
B(R').sub.3, --S--, --Se--, and --N(R')--, wherein each R' is
independently as defined and described below. In some embodiments,
an internucleotidic linkage is a phosphotriester linkage,
phosphorothioate diester linkage
##STR00003##
or modified phosphorothioate triester linkage. It is understood by
a person of ordinary skill in the art that the internucleotidic
linkage may exist as an anion or cation at a given pH due to the
existence of acid or base moieties in the linkage.
[0381] Unless otherwise specified, when used with an
oligonucleotide sequence, each of s, s1, s2, s3, s4, s5, s6 and s7
independently represents the following modified internucleotidic
linkage as illustrated in Table 1, below.
TABLE-US-00001 TABLE 1 Example Modified Internucleotidic Linkage.
Symbol Modified Internucleotidic Linkage s ##STR00004## s1
##STR00005## s2 ##STR00006## s3 ##STR00007## s4 ##STR00008## s5
##STR00009## s6 ##STR00010## s7 ##STR00011## s8 ##STR00012## s9
##STR00013## s10 ##STR00014## s11 ##STR00015## s12 ##STR00016## s13
##STR00017## s14 ##STR00018## s15 ##STR00019## s16 ##STR00020## s17
##STR00021## s18 ##STR00022##
[0382] For instance, (Rp, Sp)-ATsCs1GA has 1) a phosphorothioate
internucleotidic linkage
##STR00023##
between T and C; and 2) a phosphorothioate triester
internucleotidic linkage having the structure of
##STR00024##
between C and G. Unless otherwise specified, the Rp/Sp designations
preceding an oligonucleotide sequence describe the configurations
of chiral linkage phosphorus atoms in the internucleotidic linkages
sequentially from 5' to 3' of the oligonucleotide sequence. For
instance, in (Rp, Sp)-ATsCs1GA, the phosphorus in the "s" linkage
between T and C has Rp configuration and the phosphorus in "s1"
linkage between C and G has Sp configuration. In some embodiments,
"All-(Rp)" or "All-(Sp)" is used to indicate that all chiral
linkage phosphorus atoms in oligonucleotide have the same Rp or Sp
configuration, respectively. For instance,
All-(Rp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC (SEQ ID NO: 2)
indicates that all the chiral linkage phosphorus atoms in the
oligonucleotide have Rp configuration;
All-(Sp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC (SEQ ID NO: 3)
indicates that all the chiral linkage phosphorus atoms in the
oligonucleotide have Sp configuration.
[0383] Oligonucleotide type: As used herein, the phrase
"oligonucleotide type" is used to define an oligonucleotide that
has a particular base sequence, pattern of backbone linkages (i.e.,
pattern of internucleotidic linkage types, for example, phosphate,
phosphorothioate, etc), pattern of backbone chiral centers (i.e.
pattern of linkage phosphorus stereochemistry (Rp/Sp)), and pattern
of backbone phosphorus modifications (e.g., pattern of
"--XLR.sup.1" groups in formula I). Oligonucleotides of a common
designated "type" are structurally identical to one another.
[0384] One of skill in the art will appreciate that synthetic
methods of the present disclosure provide for a degree of control
during the synthesis of an oligonucleotide strand such that each
nucleotide unit of the oligonucleotide strand can be designed
and/or selected in advance to have a particular stereochemistry at
the linkage phosphorus and/or a particular modification at the
linkage phosphorus, and/or a particular base, and/or a particular
sugar. In some embodiments, an oligonucleotide strand is designed
and/or selected in advance to have a particular combination of
stereocenters at the linkage phosphorus. In some embodiments, an
oligonucleotide strand is designed and/or determined to have a
particular combination of modifications at the linkage phosphorus.
In some embodiments, an oligonucleotide strand is designed and/or
selected to have a particular combination of bases. In some
embodiments, an oligonucleotide strand is designed and/or selected
to have a particular combination of one or more of the above
structural characteristics. The present disclosure provides
compositions comprising or consisting of a plurality of
oligonucleotide molecules (e.g., chirally controlled
oligonucleotide compositions). In some embodiments, all such
molecules are of the same type (i.e., are structurally identical to
one another). In many embodiments, however, provided compositions
comprise a plurality of oligonucleotides of different types,
typically in pre-determined relative amounts.
[0385] Chiral control: As used herein, "chiral control" refers to
an ability to control the stereochemical designation of every
chiral linkage phosphorus within an oligonucleotide strand. The
phrase "chirally controlled oligonucleotide" refers to an
oligonucleotide which exists in a single diastereomeric form with
respect to the chiral linkage phosphorus. Chirally controlled
oligonucleotides are prepared from chirally controlled
oligonucleotide synthesis.
[0386] Chirally controlled oligonucleotide composition: As used
herein, the phrase "chirally controlled oligonucleotide
composition" refers to an oligonucleotide composition that contains
predetermined levels of individual oligonucleotide types. For
instance, in some embodiments a chirally controlled oligonucleotide
composition comprises one oligonucleotide type. In some
embodiments, a chirally controlled oligonucleotide composition
comprises more than one oligonucleotide type. In some embodiments,
a chirally controlled oligonucleotide composition comprises a
mixture of multiple oligonucleotide types. Example chirally
controlled oligonucleotide compositions are described further
herein.
[0387] Chirally pure: as used herein, the phrase "chirally pure" is
used to describe a chirally controlled oligonucleotide composition
in which all of the oligonucleotides exist in a single
diastereomeric form with respect to the linkage phosphorus.
[0388] Chirally uniform: as used herein, the phrase "chirally
uniform" is used to describe an oligonucleotide molecule or type in
which all nucleotide units have the same stereochemistry at the
linkage phosphorus. For instance, an oligonucleotide whose
nucleotide units all have Rp stereochemistry at the linkage
phosphorus is chirally uniform. Likewise, an oligonucleotide whose
nucleotide units all have Sp stereochemistry at the linkage
phosphorus is chirally uniform.
[0389] Predetermined: By predetermined is meant deliberately
selected, for example as opposed to randomly occurring or achieved.
Those of ordinary skill in the art, reading the present
specification, will appreciate that the present disclosure provides
new and surprising technologies that permit selection of particular
oligonucleotide types for preparation and/or inclusion in provided
compositions, and further permits controlled preparation of
precisely the selected particular types, optionally in selected
particular relative amounts, so that provided compositions are
prepared. Such provided compositions are "predetermined" as
described herein. Compositions that may contain certain individual
oligonucleotide types because they happen to have been generated
through a process that cannot be controlled to intentionally
generate the particular oligonucleotide types is not a
"predetermined" composition. In some embodiments, a predetermined
composition is one that can be intentionally reproduced (e.g.,
through repetition of a controlled process).
[0390] Linkage phosphorus: as defined herein, the phrase "linkage
phosphorus" is used to indicate that the particular phosphorus atom
being referred to is the phosphorus atom present in the
internucleotidic linkage, which phosphorus atom corresponds to the
phosphorus atom of a phosphodiester of an internucleotidic linkage
as occurs in naturally occurring DNA and RNA. In some embodiments,
a linkage phosphorus atom is in a modified internucleotidic
linkage, wherein each oxygen atom of a phosphodiester linkage is
optionally and independently replaced by an organic or inorganic
moiety. In some embodiments, a linkage phosphorus atom is P* of
formula I. In some embodiments, a linkage phosphorus atom is
chiral. In some embodiments, a chiral linkage phosphorus atom is P*
of formula I.
[0391] P-modification: as used herein, the term "P-modification"
refers to any modification at the linkage phosphorus other than a
stereochemical modification. In some embodiments, a P-modification
comprises addition, substitution, or removal of a pendant moiety
covalently attached to a linkage phosphorus. In some embodiments,
the "P-modification" is --X-L-R.sup.1 wherein each of X, L and
R.sup.1 is independently as defined and described herein and
below.
[0392] Blockmer: the term "blockmer," as used herein, refers to an
oligonucleotide strand whose pattern of structural features
characterizing each individual nucleotide unit is characterized by
the presence of at least two consecutive nucleotide units sharing a
common structural feature at the internucleotidic phosphorus
linkage. By common structural feature is meant common
stereochemistry at the linkage phosphorus or a common modification
at the linkage phosphorus. In some embodiments, the at least two
consecutive nucleotide units sharing a common structure feature at
the internucleotidic phosphours linkage are referred to as a
"block".
[0393] In some embodiments, a blockmer is a "stereoblockmer," e.g.,
at least two consecutive nucleotide units have the same
stereochemistry at the linkage phosphorus. Such at least two
consecutive nucleotide units form a "stereoblock." For instance,
(Sp, Sp)-ATsCs1GA is a stereoblockmer because at least two
consecutive nucleotide units, the Ts and the Cs1, have the same
stereochemistry at the linkage phosphorus (both Sp). In the same
oligonucleotide (Sp, Sp)-ATsCs1GA, TsCs1 forms a block, and it is a
stereoblock.
[0394] In some embodiments, a blockmer is a "P-modification
blockmer," e.g., at least two consecutive nucleotide units have the
same modification at the linkage phosphorus. Such at least two
consecutive nucleotide units form a "P-modification block". For
instance, (Rp, Sp)-ATsCsGA is a P-modification blockmer because at
least two consecutive nucleotide units, the Ts and the Cs, have the
same P-modification (i.e., both are a phosphorothioate diester). In
the same oligonucleotide of (Rp, Sp)-ATsCsGA, TsCs forms a block,
and it is a P-modification block.
[0395] In some embodiments, a blockmer is a "linkage blockmer,"
e.g., at least two consecutive nucleotide units have identical
stereochemistry and identical modifications at the linkage
phosphorus. At least two consecutive nucleotide units form a
"linkage block". For instance, (Rp, Rp)-ATsCsGA is a linkage
blockmer because at least two consecutive nucleotide units, the Ts
and the Cs, have the same stereochemistry (both Rp) and
P-modification (both phosphorothioate). In the same oligonucleotide
of (Rp, Rp)-ATsCsGA, TsCs forms a block, and it is a linkage
block.
[0396] In some embodiments, a blockmer comprises one or more blocks
independently selected from a stereoblock, a P-modification block
and a linkage block. In some embodiments, a blockmer is a
stereoblockmer with respect to one block, and/or a P-modification
blockmer with respect to another block, and/or a linkage blockmer
with respect to yet another block. For instance, (Rp, Rp, Rp, Rp,
Rp, Sp, Sp, Sp)-AAsTsCsGsAs1Ts1Cs1Gs1ATCG (SEQ ID NO: 4) is a
stereoblockmer with respect to the stereoblock AsTsCsGsAs1 (all Rp
at linkage phosphorus) or Ts1Cs1Gs1 (all Sp at linkage phosphorus),
a P-modification blockmer with respect to the P-modification block
AsTsCsGs (all s linkage) or As1Ts1Cs1Gs1 (all s1 linkage), or a
linkage blockmer with respect to the linkage block AsTsCsGs (all Rp
at linkage phosphorus and all s linkage) or Ts1Cs1Gs1 (all Sp at
linkage phosphorus and all s1 linkage).
[0397] Altmer: the term "altmer," as used herein, refers to an
oligonucleotide strand whose pattern of structural features
characterizing each individual nucleotide unit is characterized in
that no two consecutive nucleotide units of the oligonucleotide
strand share a particular structural feature at the
internucleotidic phosphorus linkage. In some embodiments, an altmer
is designed such that it comprises a repeating pattern. In some
embodiments, an altmer is designed such that it does not comprise a
repeating pattern.
[0398] In some embodiments, an altmer is a "stereoaltmer," e.g., no
two consecutive nucleotide units have the same stereochemistry at
the linkage phosphorus. For instance, (Rp, Sp, Rp, Sp, Rp, Sp, Rp,
Sp, Rp, Sp Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp,
Rp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC (SEQ ID NO: 5).
[0399] In some embodiments, an altmer is a "P-modification altmer"
e.g., no two consecutive nucleotide units have the same
modification at the linkage phosphorus. For instance,
All-(Sp)-CAs1GsT, in which each linkage phosphorus has a different
P-modification than the others.
[0400] In some embodiments, an altmer is a "linkage altmer," e.g.,
no two consecutive nucleotide units have identical stereochemistry
or identical modifications at the linkage phosphorus. For instance,
(Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp Rp, Sp, Rp, Sp, Rp, Sp, Rp,
Sp, Rp)-GsCs1CsTs1CsAs1GsTs1CsTs1GsCs1TsTs2CsGs3CsAs4CsC (SEQ ID
NO: 6).
[0401] Unimer: the term "unimer," as used herein, refers to an
oligonucleotide strand whose pattern of structural features
characterizing each individual nucleotide unit is such that all
nucleotide units within the strand share at least one common
structural feature at the internucleotidic phosphorus linkage. By
common structural feature is meant common stereochemistry at the
linkage phosphorus or a common modification at the linkage
phosphorus.
[0402] In some embodiments, a unimer is a "stereounimer," e.g., all
nucleotide units have the same stereochemistry at the linkage
phosphorus. For instance, All-(Sp)-CsAs1GsT, in which all the
linkages have Sp phosphorus.
[0403] In some embodiments, a unimer is a "P-modification unimer",
e.g., all nucleotide units have the same modification at the
linkage phosphorus. For instance, (Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp,
Rp, Sp Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp,
Rp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC (SEQ ID NO: 7), in
which all the internucleotidic linkages are phosphorothioate
diester.
[0404] In some embodiments, a unimer is a "linkage unimer," e.g.,
all nucleotide units have the same stereochemistry and the same
modifications at the linkage phosphorus. For instance,
All-(Sp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC (SEQ ID NO: 8), in
which all the internucleotidic linkages are phosphorothioate
diester having Sp linkage phosphorus.
[0405] Gapmer: as used herein, the term "gapmer" refers to an
oligonucleotide strand characterized in that at least one
internucleotidic phosphorus linkage of the oligonucleotide strand
is a phosphate diester linkage, for example such as those found in
naturally occurring DNA or RNA. In some embodiments, more than one
internucleotidic phosphorus linkage of the oligonucleotide strand
is a phosphate diester linkage such as those found in naturally
occurring DNA or RNA. For instance, All-(Sp)-CAs1GsT, in which the
internucleotidic linkage between C and A is a phosphate diester
linkage.
[0406] Skipmer: as used herein, the term "skipmer" refers to a type
of gapmer in which every other internucleotidic phosphorus linkage
of the oligonucleotide strand is a phosphate diester linkage, for
example such as those found in naturally occurring DNA or RNA, and
every other internucleotidic phosphorus linkage of the
oligonucleotide strand is a modified internucleotidic linkage. For
instance, All-(Sp)-AsTCs1GAs2TCs3G.
[0407] For purposes of this disclosure, the chemical elements are
identified in accordance with the Periodic Table of the Elements,
CAS version, Handbook of Chemistry and Physics, 67th Ed., 1986-87,
inside cover.
[0408] The methods and structures described herein relating to
compounds and compositions of the disclosure also apply to the
pharmaceutically acceptable acid or base addition salts and all
stereoisomeric forms of these compounds and compositions.
BRIEF DESCRIPTION OF THE DRAWING
[0409] FIG. 1. Reverse phase HPLCs after incubation with rat liver
homogenate. Total amounts of oligonucleotides remaining when
incubated with rat whole liver homogenate at 37.degree. C. at
different days were measured. The in-vitro metabolic stability of
ONT-154 was found to be similar to ONT-87, which has 2'-MOE wings,
while both have much better stability than 2'-MOE gapmer which is
stereorandom (ONT-41, Mipomersen). The amount of full length
oligomer remaining was measured by reverse phase HPLC where peak
area of the peak of interest was normalized with internal
standard.
[0410] FIG. 2. Degradation of various chirally pure analogues of
Mipomersen (ONT-41) in rat whole liver homogenate. Total amounts of
oligonucleotide remaining when incubated with rat whole liver
homogenate at 37.degree. C. at different days were measured. The
in-vitro metabolic stability of chirally pure diastereomers of
human ApoB sequence ONT-41 (Mipomersen) was found to increase with
increased Sp internucleotidic linkages. The amount of full length
oligomer remaining was measured by reverse phase HPLC where peak
area of the peak of interest was normalized with internal standard.
Compositions used include: ONT-41, ONT-75, ONT-77, ONT-80, ONT-81,
ONT-87, ONT-88 and ONT-89.
[0411] FIG. 3. Degradation of various chirally pure analogues of
mouse ApoB sequence (ISIS 147764, ONT-83) in rat whole liver
homogenate. Total amounts of oligonucleotide remaining when
incubated with rat whole liver homogenate at 37.degree. C. at
different days were measured. The in-vitro metabolic stability of
chirally pure diastereomers of murine ApoB sequence (ONT-83, 2'-MOE
gapmer, stereorandom phosphorothioate) was found to increase with
increased Sp internucleotidic linkages. The amount of full length
oligomer remaining was measured by reverse phase HPLC where peak
area of the peak of interest was normalized with internal standard.
Compositions used include: ONT-82 to ONT-86.
[0412] FIG. 4. Degradation of Mipomersen analogue ONT-75 in rat
whole liver homogenate over a period of 24 hrs. This figure
illustrates stability of ONT-75 in rate whole liver homogenate.
[0413] FIG. 5. Degradation of Mipomersen analogue ONT-81 in rat
whole liver homogenate over a period of 24 hrs. This figure
illustrates stability of ONT-81 in rate whole liver homogenate.
[0414] FIG. 6. Durations of knockdown for ONT-87, ONT-88, and
ONT-89. Stereoisomers can exhibit substantially different durations
of knockdown. ONT-87 results in substantially more durable
suppression than other stereoisomers. Increased duration of action
of ONT-87 in multiple in vivo studies was observed. ONT-88 showed
similar efficacy and recovery profile as ONT-41 (Mipomersen) in
certain in-vivo studies. Hu ApoB transgenic mice, n=4, were dosed
with 10 mpk IP bolus, 2.times./week for three weeks. The mice were
randomized to study groups, and dosed intraperitoneally (IP) at 10
mg/kg on Days 1, 4, 8, 11, 15, 18, and 22, based on individual
mouse body weight measured prior to dosing on each dosing day.
Blood was collected on days 0, 17, 24, 31, 38, 45 and 52 by
submandibular (cheek) bleed and at sacrifice on Day 52 by cardiac
puncture and then processed to serum. ApoB was measured by ELISA.
Highlighted: 72% vs. 35% knock-down maintained at 3 weeks
postdose.
[0415] FIG. 7. HPLC profiles exhibiting the difference in metabolic
stability determined in Human Serum for siRNA duplexes having
several Rp, Sp or stereorandom phosphorothioate linkages.
Compositions used include: ONT-114, ONT-116, ONT-109, ONT-107,
ONT-108 and ONT-106.
[0416] FIG. 8. Effect of stereochemistry on RNase H activity.
Oligonucleotides were hybridized with RNA and then incubated with
RNase H at 37.degree. C. in the presence of 1.times.RNase H buffer.
From top to bottom at 120 min: ONT-89, ONT-77, ONT-81, ONT-80,
ONT-75, ONT-41, ONT-88, ONT-154, ONT-87, with ONT-77/154 very close
to each other.
[0417] FIG. 9. Analysis of human RNase H1 cleavage of a 20-mer RNA
when hybridized with different preparations of stereoisomers of
phosphorothioate oligonucleotides targeting the same region of
human ApoB mRNA. Specific sites of cleavage are strongly influenced
by the distinct stereochemistries. Arrows represent position of
cleavage (cleavage sites). Products were analyzed by UPLC/MS. The
length of the arrow signifies the amount of products present in the
reaction mixture which was determined from the ratio of UV peak
area to theoretical extinction coefficient of that fragment (the
larger the arrow, the more the detected cleavage products). (A):
Legend for cleavage maps. (B) and (C): cleavage maps of
oligonucleotides. In the figures: (.tau.) indicates that both RNase
H1 cleavage fragments (5'-phosphate species as well as 5'-OH 3'-OH
species) were identified in reaction mixtures. (.left brkt-top.)
indicates that only 5'-phosphate species was detected and (.right
brkt-bot.) indicates that 5'-OH 3'-OH component was detected in
mass spectrometry analysis. Compositions used include: ONT-41,
ONT-75, ONT-77, ONT-80, ONT-81, ONT-87, ONT-88, ONT-89 and ONT-154
(SEQ ID NOS 397-401 and 758-761, respectively). Figure also
discloses SEQ ID NO: 1559.
[0418] FIG. 10. Cleavage maps of different oligonucleotide
compositions ((A)-(C)). These three sequences target different
regions in FOXO1 mRNA. Each sequence was studied with five
different chemistries. Cleavage maps are derived from reaction
mixtures obtained after 30 minutes of incubation of respective
duplexes with RNase H1C in the presence of 1.times.PBS buffer at
37.degree. C. Arrows indicate sites of cleavage. The length of the
arrow signifies the amount of products present in the reaction
mixture which was determined from the ratio of UV peak area to
theoretical extinction coefficient of that fragment (the larger the
arrow, the more the detectable cleavage products). Only in the
cases where 5'-OH 3'-OH was not detected in the reaction mixture,
5'-phosphate species peak was used for quantification. Cleavage
rates were determined by measuring amount of full length RNA
remaining in the reaction mixtures by reverse phase HPLC. Reactions
were quenched at fixed time points by 30 mM Na.sub.2EDTA.
Compositions used include: ONT-316, ONT-355, ONT-361, ONT-367,
ONT-373, ONT-302, ONT-352, ONT-358, ONT-364, ONT-370, ONT-315,
ONT-354, ONT-360, ONT-366, and ONT-372 (SEQ ID NOS 670-674, 676-680
and 682-686, respectively). Figure also discloses SEQ ID NO: 1560
in panel A and SEQ ID NO: 1561 in panels B and C.
[0419] FIG. 11. Cleavage maps of oligonucleotide compositions
having different common base sequences and lengths ((A)-(B)). The
maps show a comparison of stereorandom DNA compositions (top panel)
with three distinct and stereochemically pure oligonucleotide
compositions. Data compare results of chirally controlled
oligonucleotide compositions with two stereorandom phosphorothioate
oligonucleotide compositions (ONT-366 and ONT-367) targeting
different regions in FOXO1 mRNA. Each panel shows a comparison of
stereorandom DNA (top panel) with three distinct and
stereochemically pure oligonucleotide preparations. Cleavage maps
were derived from reaction mixtures obtained after 30 minutes of
incubation of respective duplexes with RNase H1C in the presence of
1.times.PBS buffer at 37.degree. C. Arrows indicate sites of
cleavage. The length of the arrow signifies the amount of
metabolite present in the reaction mixture which was determined
from the ratio of UV peak area to theoretical extinction
coefficient of that fragment (the larger the arrow, the more the
detectable cleavage products). Only in the cases where 5'-OH 3'-OH
was not detected in the reaction mixture, 5'-phosphate species peak
was used for quantification. Compositions used include: ONT-366,
ONT-389, ONT-390, ONT-391, ONT-367, ONT-392, ONT-393, and ONT-394
(SEQ ID NOS 660-663 and 665-668, respectively). Figure also
discloses SEQ ID NO: 1562 in panel A and SEQ ID NO: 1560 in panel
B.
[0420] FIG. 12. Effect of stereochemistry on RNase H activity. In
two independent experiments, antisense oligonucleotides targeting
an identical region of FOXO1 mRNA were hybridized with RNA and then
incubated with RNase H at 37.degree. C. in the presence of
1.times.RNase H buffer. Disappearance of full length RNA was
measured from its peak area at 254 nm using RP-HPLC. (A): from top
to bottom at 60 min: ONT-355, ONT-316, ONT-367, ONT-392, ONT-393
and ONT-394 (ONT-393 and ONT-394 about the same at 60 min; ONT-393
had higher % RNA substrate remaining at 5 min). (B): from top to
bottom at 60 min: ONT-315, ONT-354, ONT-366, ONT-391, ONT-389 and
ONT-390. Cleavage rates were determined by measuring amount of full
length RNA remaining in the reaction mixtures by reverse phase
HPLC. Reactions were quenched at fixed time points by 30 mM
Na.sub.2EDTA.
[0421] FIG. 13. Turnover of antisense oligonucleotides. The
duplexes were made with each DNA strand concentration equal to 6
.mu.M and RNA being 100 .mu.M. These duplexes were incubated with
0.02 .mu.M RNase H enzyme and disappearance of full length RNA was
measured from its peak area at 254 nm using RP-HPLC. Cleavage rates
were determined by measuring amount of full length RNA remaining in
the reaction mixtures by reverse phase HPLC. Reactions were
quenched at fixed time points by 30 mM Na.sub.2EDTA. From top to
bottom at 40 min: ONT-316, ONT-367 and ONT-392.
[0422] FIG. 14. Cleavage map comparing a stereorandom
phosphorothioate oligonucleotide with six distinct and
stereochemically pure oligonucleotide preparations targeting the
same FOXO1 mRNA region. Compositions used include: ONT-367,
ONT-392, ONT-393, ONT-394, ONT-400, ONT-401, and ONT-406 (SEQ ID
NOS 665-668, 729-730 and 735, respectively). Figure also discloses
SEQ ID NO: 1560.
[0423] FIG. 15. Effect of stereochemistry on RNase H activity.
Antisense oligonucleotides were hybridized with RNA and then
incubated with RNase H at 37.degree. C. in the presence of
1.times.RNase H buffer. Dependence of stereochemistry upon RNase H
activity was observed. Also evident in comparing ONT-367
(stereorandom DNA) and ONT-316 (5-10-5 2'-MOE Gapmer) is the strong
dependence of compositional chemistry upon RNase H activity. From
top to bottom at 40 min: ONT-316, ONT-421, ONT-367, ONT-392,
ONT-394, ONT-415, and ONT-422 (ONT-394/415/422 have similar levels
at 40 min; at 5 min, ONT-422>ONT-394>ONT-415 in % RNA
remaining in DNA/RNA duplex).
[0424] FIG. 16. Effect of stereochemistry on RNase H activity.
Antisense oligonucleotides targeting an identical region of FOXO1
mRNA were hybridized with RNA and then incubated with RNase H at
37.degree. C. in the presence of 1.times.RNase H buffer. Dependence
of stereochemistry upon RNase H activity was observed. Form top to
bottom at 40 min: ONT-396, ONT-409, ONT-414, ONT-408
(ONT-396/409/414/408 have similar levels at 40 min), ONT-404,
ONT-410, ONT-402 (ONT-404/410/408 have similar levels at 40 min),
ONT-403, ONT-407, ONT-405, ONT-401, ONT-406 and ONT-400
(ONT-401/405/406/400 have similar levels at 40 min).
[0425] FIG. 17. Effect of stereochemistry on RNase H activity.
Antisense oligonucleotides targeting an identical region of FOXO1
mRNA were hybridized with RNA and then incubated with RNase H at
37.degree. C. in the presence of 1.times.RNase H buffer. Dependence
of stereochemistry upon RNase H activity was observed. ONT-406 was
observed to elicit cleavage of duplexed RNA at a rate in slight
excess of that of the phosphodiester oligonucleotide ONT-415. From
top to bottom at 40 min: ONT-396, ONT-421, ONT-392, ONT-394,
ONT-415 ONT-406, and ONT-422 (ONT-394/415/406 have similar levels
at 40 min; at 5 min, ONT-394>ONT-415>ONT-406 in % RNA
remaining in DNA/RNA duplex).
[0426] FIG. 18. Example UV chromatograms of RNA cleavage products
obtained when RNA (ONT-388) was duplexed with stereorandom DNA,
ONT-367 (top) and stereopure DNA with repeat triplet
motif-3'-SSR-5', ONT-394 (bottom). ). 2.35 min: 7mer; 3.16 min:
8mer and p-6mer; 4.48 min: P-7mer; 5.83 min: P-8mer; 6.88 min:
12mer; 9.32 min: 13mer; 10.13 min: P-11mer; 11.0 min: P-12mer and
14mer; 11.93 min: P-13mer; 13.13 min: P-14mer. ONT-394 (on the
bottom) peak assignment: 4.55 min: p-7mer; 4.97 min: 10mer; 9.53
min: 13mer.
[0427] FIG. 19. Electrospray Ionization Spectrum of RNA cleavage
products. RNA fragments obtained from the duplex ONT-387,
RNA/ONT-354, (7-6-7, DNA-2'-OMe-DNA) on the top and ONT-387,
RNA/ONT-315, (5-10-5,2'-MOE Gapmer) at the bottom when these
duplexes were incubated with RNase H for 30 min in the presence of
1.times.RNase H buffer.
[0428] FIG. 20. UV Chromatogram and TIC of ONT-406 and ONT-388
duplex after 30 minutes of incubation with RNase H.
[0429] FIG. 21. An example proposed cleavage. Provided chirally
controlled oligonucleotide compositions are capable of cleaving
targets as depicted.
[0430] FIG. 22. Example allele specific cleavage targeting mutant
Huntingtin mRNA. (A) and (B): example oligonucleotides. (C)-(E):
cleavage maps. (F)-(H): RNA cleavage. Stereorandom and chirally
controlled oligonucleotide compositions were prepared to target
single nucleotide polymorphisms for allele selective suppression of
mutant Huntingtin. ONT-450 (stereorandom) targeting ONT-453 (muHTT)
and ONT-454 (wtHTT) showed marginal differentiation in RNA cleavage
and their cleavage maps. Chirally controlled ONT-451 with selective
placement of 3'-SSR-5' motif in RNase H recognition site targeting
ONT-453 (muHTT) and ONT-454 (wtHTT) showed large differentiation in
RNA cleavage rate. From the cleavage map, it is notable that
3'-SSR-5' motif is placed to direct the cleavage between positions
8 and 9 which is after the mismatch if read from 5'-end of RNA.
ONT-452 with selective placement of 3'-SSR-5' motif in RNase H
recognition site targeting ONT-453 (muHTT) and ONT-454 (wtHTT)
showed moderate differentiation in RNA cleavage rate. 3'-SSR-5'
motif was placed to direct the cleavage at positions 7 and 8 which
is before the mismatch if read from 5'-end of RNA. Example data
illustrate significance of position in placement of 3'-SSR-5' motif
to achieve enhanced discrimination for allele specific cleavage.
All cleavage maps are derived from the reaction mixtures obtained
after 5 minutes of incubation of respective duplexes with RNase H1C
in the presence of 1.times.PBS buffer at 37.degree. C. Arrows
indicate sites of cleavage. The length of the arrow signifies the
amount of metabolite present in the reaction mixture which was
determined from the ratio of UV peak area to theoretical extinction
coefficient of that fragment. Only in the cases where 5'-OH 3'-OH
was not detected in the reaction mixture, 5'-phosphate species peak
was used for quantification. Compositions used include: ONT-450 to
ONT-454 (SEQ ID NOS 380, 267, 268, 799 and 718, respectively).
Figure also discloses SEQ ID NOS 1563-1565 in panels C-E,
respectively, in order of appearance.
[0431] FIG. 23. (A)-(C): example allele specific cleavage targeting
FOXO1 mRNA (SEQ ID NOS 669, 731, 715, 731, 699, 729, 715, 729, 699,
735, 716 and 735, respectively, in order of appearance).
[0432] FIG. 24. In vitro dose response silencing of ApoB mRNA after
treatment with ApoB oligonucleotides. Stereochemically pure
diastereomers with and without 2'-MOE wings show similar efficacy
as ONT-41 (Mipomersen). Compositions used include: ONT-87, ONT-41,
and ONT-154.
[0433] FIG. 25. Comparison of RNase H cleavage maps (A) and RNA
cleavage rates (B) for stereorandom composition (ONT-367 (SEQ ID
NO: 769)) and chirally controlled oligonucleotide compositions
(ONT-421 (SEQ ID NO: 772), all Sp and ONT-455 (SEQ ID NO: 767), all
Rp) and DNA (ONT-415 (SEQ ID NO: 770)). These sequences target the
same region in FOXO1 mRNA. Cleavage maps were derived from the
reaction mixtures obtained after 5 minutes of incubation of
respective duplexes with RNase H1C in the presence of 1.times.PBS
buffer at 37.degree. C. Arrows indicate sites of cleavage. The
length of the arrow signifies the amount of metabolite present in
the reaction mixture which was determined from the ratio of UV peak
area to theoretical extinction coefficient of that fragment. Only
in the cases where 5'-OH 3'-OH was not detected in the reaction
mixture, 5'-phosphate species peak was used for quantification.
Cleavage rates were determined by measuring amount of full length
RNA remaining in the reaction mixtures by reverse phase HPLC.
Reactions are quenched at fixed time points by 30 mM Na.sub.2EDTA.
Figure also discloses SEQ ID NO: 1560.
[0434] FIG. 26. Comparison of cleavage maps of sequences containing
one Rp with change of position starting from 3'-end of DNA.
Compositions used include: ONT-396 to ONT-414 (SEQ ID NOS 725-743,
respectively). These sequences target the same region in FOXO1
mRNA. Cleavage maps are derived from the reaction mixtures obtained
after 5 minutes of incubation of respective duplexes with RNase H1C
in the presence of 1.times.RNase H buffer at 37.degree. C. Arrows
indicate sites of cleavage. The length of the arrow signifies the
amount of metabolite present in the reaction mixture which was
determined from the ratio of UV peak area to theoretical extinction
coefficient of that fragment. Only in the cases where 5'-OH 3'-OH
was not detected in the reaction mixture, 5'-phosphate species peak
was used for quantification. Figure also discloses SEQ ID NO: 1560
in panels A-D.
[0435] FIG. 27. (A) Comparison of RNase H cleavage rates for
stereopure oligonucleotides (ONT-406), (ONT-401), (ONT-404) and
(ONT-408). All four sequences are stereopure phosphorothioates with
one Rp linkage. These sequences target the same region in FOXO1
mRNA. All duplexes were incubation with RNase H1C in the presence
of 1.times.RNase H buffer at 37.degree. C. Reactions were quenched
at fixed time points by 30 mM Na.sub.2EDTA. Cleavage rates were
determined by measuring amount of full length RNA remaining in the
reaction mixtures by reverse phase HPLC. ONT-406 and ONT-401 were
found to have superior cleavage rates. (B) Correlation between %
RNA cleaved in RNase H assay (10 .mu.M oligonucleotide) and % mRNA
knockdown in in vitro assay (20 nM oligonucleotide). All sequences
target the same region of mRNA in the FOXO1 target. The quantity of
RNA remaining is determined by UV peak area for RNA when normalized
to DNA in the same reaction mixture. All of the above maps are
derived from the reaction mixture obtained after 5 minutes of
incubation of respective duplexes with RNase H1C in the presence of
1.times.PBS buffer at 37.degree. C. All sequences from ONT-396 to
ONT-414 have one Rp phosphorothioate and they vary in the position
of Rp. ONT-421 (All Sp) phosphorothioate was inactive in-vitro
assay. It relates poor cleavage rate of RNA in RNase H assay when
ONT-421 is duplexed with complementary RNA.
[0436] FIG. 28. Serum stability assay of single Rp walk PS DNA
(ONT-396-ONT-414), stereorandom PS DNA(ONT-367), all-Sp PS DNA
(ONT-421) and all-Rp PS DNA (ONT-455) in rat serum for 2 days. Note
ONT-396 and ONT-455 decomposed at tested time point. Compositions
used include: ONT-396 to ONT-414, ONT-367, ONT-421, and
ONT-455.
[0437] FIG. 29. Example oligonucleotides including hemimers. (A):
cleavage maps. (B): RNA cleavage assay. (C): FOXO1 mRNA knockdown.
ONT-440 (SEQ ID NO: 765), ONT-441 (SEQ ID NO: 766), and ONT-367
(SEQ ID NO: 769) are used. In some embodiments, introduction of
2'-modifications on 5'-end of the sequences increases stability for
binding to target RNA while maintaining RNase H activity. ONT-367
(stereorandom phosphorothioate DNA) and ONT-440 (5-15, 2'-F-DNA)
have similar cleavage maps and similar rate of RNA cleavage in
RNase H assay (10 LM oligonucleotide). In some embodiments, ONT-440
(5-11, 2'-F-DNA) sequence can have better cell penetration
properties. In some embodiments, asymmetric 2'-modifications
provide Tm advantage while maintaining RNase H activity.
Introduction of RSS motifs can further enhance RNase H efficiency
in the hemimers. Cleavage maps are derived from the reaction
mixtures obtained after 5 minutes of incubation of respective
duplexes with RNase H1C in the presence of 1.times.RNase H buffer
at 37.degree. C. Arrows indicate sites of cleavage. (.tau.)
indicates that both fragments, 5'-phosphate species as well as
5'-OH 3'-OH species were identified in reaction mixtures. (.left
brkt-top.) indicates that only 5'-phosphate species was detected
and (.right brkt-bot.) indicates that 5'-OH 3'-OH component was
detected in mass spectrometry analysis. The length of the arrow
signifies the amount of metabolite present in the reaction mixture
which was determined from the ratio of UV peak area to theoretical
extinction coefficient of that fragment. Only in the cases where
5'-OH 3'-OH was not detected in the reaction mixture, 5'-phosphate
species peak was used for quantification. Figure also discloses SEQ
ID NO: 1560 in panel A.
[0438] FIG. 30. Example mass spectrometry data of cleavage assay.
Top: data for ONT-367: 2.35 min: 7 mer; 3.16 min: 8 mer and P-6
mer; 4.58 min: P-7 mer; 5.91 min: P-8 mer; 7.19 min: 12 mer; 9.55
min: 13 mer; 10.13 min: P-11 mer; 11.14 min: P-12 mer and 14 mer;
12.11 min: P-13 mer; 13.29 min: P-14 mer; 14.80 min: full length
RNA (ONT-388) and 18.33 min: stereorandom DNA (ONT-367). Bottom:
data for ONT-406: 4.72 min: p-rArUrGrGrCrUrA, 5'-phosphorylated 7
mer RNA; 9.46 min: 5'-rGrUrGrArGrCrArGrCrUrGrCrA (SEQ ID NO: 9),
5'-OH 3'-OH 13 mer RNA; 16.45 min: full length RNA (ONT-388); 19.48
and 19.49 min: stereopure DNA (ONT-406).
[0439] FIG. 31. Example RNA cleavage rates. Duplexes were incubated
with RNase H1C in the presence of 1.times.RNase H buffer at
37.degree. C. Reactions were quenched at fixed time points by
addition of 30 mM Na.sub.2EDTA. Cleavage rates were determined by
measuring amount of full length RNA remaining in the reaction
mixtures. Compositions used include: WV-944 (SEQ ID NO: 791),
WV-945 (SEQ ID NO: 792), WV-936 (SEQ ID NO: 162), WV-904 (SEQ ID
NO: 130), WV-937 (SEQ ID NO: 163), WV-905 (SEQ ID NO: 131), WV-938
(SEQ ID NO: 164), WV-906 (SEQ ID NO: 132), WV-939 (SEQ ID NO: 165),
WV-907 (SEQ ID NO: 133), WV-940 (SEQ ID NO: 166), WV-908 (SEQ ID
NO: 34), WV-941 (SEQ ID NO: 167), and WV-909 (SEQ ID NO: 135).
[0440] FIG. 32. A-N: RNA cleavage rates in RNase H assay for
certain compositions targeting rs362307. Some of these compositions
are stereorandom and some chirally controlled. Compositions used
include: WV-1085, WV-1086, WV-1087, WV-1088, WV-1089, WV-1090,
WV-1091, WV-1092, WV-905, WV-944, WV-945, WV-911, WV-917, WV-931,
WV-937, and WV-1497.
[0441] FIG. 33. A: Example cleavage maps. Cleavage maps were
derived from reaction mixtures obtained after 5 minutes of
incubation of respective duplexes with RNase H1C in the presence of
1.times.RNaseH buffer at 37.degree. C. B: Legend. Arrows indicate
sites of cleavage. (.tau.) indicates that both fragments,
5'-phosphate species as well as 3'-OH species were identified.
(.left brkt-top.) indicates that only 5'-OH 3'-OH species was
detected and (.right brkt-bot.) indicates that 5'-Phosphate
component was detected. Length of an arrow signifies the amount of
fragment present in the reaction mixture which was determined from
the ratio of UV peak area to theoretical extinction coefficient of
that fragment. Only in the cases where 5'-OH 3'-OH fragments were
not detected in the reaction mixture, the 5'-phosphate species peak
was used for quantification. Compositions used include: WV-944 (SEQ
ID NO: 791), WV-945 (SEQ ID NO: 792), WV-904 (SEQ ID NO: 130),
WV-905 (SEQ ID NO: 131), WV-906 (SEQ ID NO: 132), WV-907 (SEQ ID
NO: 133), WV-908 (SEQ ID NO: 134), and WV-909 (SEQ ID NO: 135).
[0442] FIG. 34. Example cleavage maps. Example cleavage maps.
Cleavage maps were derived from reaction mixtures obtained after 30
minutes of incubation of respective duplexes with RNase H1C in the
presence of 1.times.RNase H buffer at 37.degree. C. For legend, see
FIG. 33. Compositions used include: WV-944 (SEQ ID NO: 791), WV-945
(SEQ ID NO: 792), WV-936 (SEQ ID NO: 162), WV-937 (SEQ ID NO: 163),
WV-938 (SEQ ID NO: 164), WV-939 (SEQ ID NO: 165), WV-940 (SEQ ID
NO: 166), WV-941 (SEQ ID NO: 167), WV-1085 (SEQ ID NO: 168),
WV-1086 (SEQ ID NO: 169), WV-1087 (SEQ ID NO: 170), WV-1088 (SEQ ID
NO: 171), WV-1089 (SEQ ID NO: 172), WV-1090 (SEQ ID NO: 173),
WV-1091 (SEQ ID NO: 174), and WV-1092 (SEQ ID NO: 175).
[0443] FIG. 35. Example cleavage maps. For legend, see FIG. 33.
Compositions used include: WV-944 (SEQ ID NO: 791), WV-945 (SEQ ID
NO: 792), WV-905 (SEQ ID NO: 131), WV-911 (SEQ ID NO: 137), WV-917
(SEQ ID NO: 143), WV-931 (SEQ ID NO: 157), and WV-937 (SEQ ID NO:
163).
[0444] FIG. 36. Total ion chromatogram of RNase H cleavage reaction
for WV-937 when duplexed with WT HTT RNA (WV-944, upper panel) or
mu HTT RNA (WV-945, lower panel). Following quenching of the
enzymatic reaction with disodium EDTA after 30 minutes, the RNase H
cleavage products were chromatographically resolved and analyzed
using an Agilent 1290 UPLC coupled with an Agilent 6230 MS-TOF mass
spectrometer. The high mass accuracy high resolution MS spectra for
each identified peak was extracted and deconvoluted. Identification
of the metabolites which led to determination of position of
cleavage was done by comparing the deconvoluted average masses to
masses of predicted RNA metabolites.
[0445] FIG. 37. Illustration of the Luciferase Reporter-based
screening.
[0446] FIGS. 38A-38I. FIGS. 38A-38I and 39A-39G show the activity
of various HTT oligonucleotides. Dose-response curves for HTT
silencing in reporter-based assay in COS7 cells after transfection
of ASOs targeting rs362331_T or rs2530595_T SNPs. ASO specificity
is increased with no significant loss of potency by addition of
stereopure design (calculated IC50s specified). Data are
representative of 2 independent experiments. Lines indicate fit
curves, error bars indicate standard deviations. In the figures,
the location of the SNP is indicated. Compositions tested in FIG.
38 include: WV-2067, WV-2416, WV-2069, WV-2417, WV-2072, WV-2418,
WV-2076, WV-2419, WV-2605, WV-2589, WV-2606, WV-2590, WV-2607,
WV-2591, WV-2608, WV-2592, WV-2609, WV-2593, WV-2610, WV-2594,
WV-2611, WV-2595, WV-2612, WV-2596, WV-2611, WV-2595, WV-2671,
WV-2672, WV-2673, WV-2675, WV-2674, WV-2613, WV-2597, WV-2614,
WV-2598, WV-2615, WV-2599, WV-2616, WV-2600, WV-2617, WV-2601,
WV-2618, WV-2602, WV-2619, WV-2603, WV-2620, and WV-2604. FIG. 38F
discloses SEQ ID NOS 1475, 1459 and 1487-1491, respectively, in
order of appearance.
[0447] FIGS. 39A-39G. Dose-response curves for HTT silencing in
reporter-based assay in COS7 cells after transfection of ASOs.
Compositions tested include: WVE120101, WV-1092, WV-1497, WV-2619,
WV-2603, WV-2611, and WV-2595. IC.sub.50 data is also shown. FIG.
39A discloses SEQ ID NOS 1483 and 1467, respectively, in order of
appearance. FIG. 39B discloses SEQ ID NOS 1483 and 1467,
respectively, in order of appearance. FIG. 39C discloses SEQ ID NOS
1483 and 1467, respectively, in order of appearance. FIG. 39E
discloses SEQ ID NOS 1483 and 1467, respectively, in order of
appearance. FIG. 39F discloses SEQ ID NOS 1475 and 1459,
respectively, in order of appearance. FIG. 39G discloses SEQ ID NOS
1483 and 1467, respectively, in order of appearance.
[0448] FIGS. 40A-40D. FIGS. 40A-40D shows liquid chromatograph and
mass spectra data for oligonucleotides: WV1092.22 (WV-1092),
WV2595.01 (WV-2595) and WV2603.01 (WV-2603). The suffices (01),
(02), 0.01, 0.02, 0.22, etc., as used herein, indicate batch
numbers.
[0449] FIG. 41. FIG. 41 shows liquid chromatograph and mass spectra
data for oligonucleotides: WV-1510, WV-2378 and WV-2380.
[0450] FIG. 42. Example tested sequences (SEQ ID NOS 775-782,
respectively, in order of appearance).
DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS
[0451] Synthetic oligonucleotides provide useful molecular tools in
a wide variety of applications. For example, oligonucleotides are
useful in therapeutic, diagnostic, research, and new nanomaterials
applications. The use of naturally occurring nucleic acids (e.g.,
unmodified DNA or RNA) is limited, for example, by their
susceptibility to endo- and exo-nucleases. As such, various
synthetic counterparts have been developed to circumvent these
shortcomings. These include synthetic oligonucleotides that contain
backbone modifications, which render these molecules less
susceptible to degradation. From a structural point of view, such
modifications to internucleotide phosphate linkages introduce
chirality. It has become clear that certain properties of
oligonucleotides may be affected by the configurations of the
phosphorus atoms that form the backbone of the oligonucleotides.
For example, in vitro studies have shown that the properties of
antisense nucleotides such as binding affinity, sequence specific
binding to the complementary RNA, stability to nucleases are
affected by, inter alia, chirality of the backbone (e.g., the
configurations of the phosphorus atoms).
[0452] Among other things, the present disclosure encompasses the
recognition that structural elements of oligonucleotides, such as
base sequence, chemical modifications (e.g., modifications of
sugar, base, and/or internucleotidic linkages, and patterns
thereof), and/or stereochemistry (e.g., stereochemistry of backbone
chiral centers (chiral internucleotidic linkages), and/or patterns
thereof), can have significant impact on properties, e.g.,
activities, of oligonucleotides. In some embodiments, the present
disclosure demonstrates that oligonucleotide compositions
comprising oligonucleotides with controlled structural elements,
e.g., controlled chemical modification and/or controlled backbone
stereochemistry patterns, provide unexpected properties, including
but not limited to those described herein. In some embodiments, the
present disclosure provide an oligonucleotide composition comprises
a predetermined level of oligonucleotides of an individual
oligonucleotide type which are chemically identical, e.g., they
have the same base sequence, the same pattern of nucleoside
modifications (modifications to sugar and base moieties, if any),
the same pattern of backbone chiral centers, and the same pattern
of backbone phosphorus modifications.
[0453] Among other things, the present disclosure encompasses the
recognition that stereorandom oligonucleotide preparations contain
a plurality of distinct chemical entities that differ from one
another, e.g., in the stereochemical structure of individual
backbone chiral centers within the oligonucleotide chain. Without
control of stereochemistry of backbone chiral centers, stereorandom
oligonucleotide preparations provide uncontrolled compositions
comprising undetermined levels of oligonucleotide stereoisomers.
Even though these stereoisomers may have the same base sequence,
they are different chemical entities at least due to their
different backbone stereochemistry, and they can have, as
demonstrated herein, different properties, e.g., bioactivities. A
stereopure (or "chirally controlled") oligonucleotide composition
or preparation can have improved bioactivity compared to a
stereorandom oligonucleotide preparation which is otherwise
identical (e.g., both the stereopure and stereorandom versions have
the same base sequence, pattern of base and sugar modifications,
etc.). For example, stereorandom oligonucleotide WV-1497
composition and a stereopure oligonucleotide WV-1092 composition
both have the same sequence of bases and identical patterns of
sugar modifications and backbone linkages, differing only in
stereochemistry. However, at higher concentrations, there was a
marked difference in the ability of the stereopure WV-1092
composition and the stereorandom WV-1497 composition to
differentiate between wt and mutant HTT (which differ in only one
nt). At the high concentration, both knocked down the mutant HTT to
a great degree, which is desirable; but stereopure WV-1092 showed
only a small knock down of wildtype HTT, while WV-1497 showed
significantly more knock down of wt HTT, which is less desirable in
some instances.
[0454] Chirally controlled oligonucleotide compositions of both
WVE120101 and WV-1092 were able to differentiate between wt and
mutant versions of SNP rs362307, which differ by one nt; both
WVE120101 and WV-1092 significantly knocked down the mutant allele
but not the wt, while the stereorandom version, WV-1497, was not
able to significantly differentiate between the wt and mutant
alleles (see FIG. 39D). The modified sequences of WVE120101 and
WV-1092 are identical.
[0455] A chirally controlled oligonucleotide composition of WV-2595
was able to differentiate between the C and T alleles at SNP
rs2530595, which also differ at only the one nt. Stereopure WV-2595
significantly knocked down the T allele but not the C allele,
unlike the stereorandom oligonucleotide composition of WV-2611,
which was not able to significantly differentiate the alleles (see
FIG. 39F). The sequence of WV-2595 is
5'-mG*mGmGmUmCC*T*C*C*C*C*A*C*A*G*mAmGmGmG*mA-3' (SEQ ID NO: 10) or
5'-mG* SmGmGmUmC*SC*ST*SC* SC*SC*SC*SA*SC*RA* SG*SmAmGmGmG* SmA-3'
(SEQ ID NO: 11) with certain stereochemistry information.
[0456] A stereopure oligonucleotide composition of WV-2603 was able
to differentiate between the C and T alleles of SNP rs362331, which
also differ at only the one nt. Stereopure WV-2603 significantly
knocked down the T allele but not the C allele, unlike the
stereorandom oligonucleotide composition of WV-2619, which was not
able to significantly differentiate between the alleles (see FIGS.
39A, 39B, 39C and 39E). The sequence of WV-2603 is
5'-mG*mUmGmCmA*C*A*C*A*G*T*A*G*A*T*mGmAmGmG*mG-3' (SEQ ID NO: 12)
or 5'-mG* SmUmGmCmA*SC*SA*SC* SA*SG*ST*SA*SG*RA* ST*SmGmAmGmG*
SmG-3' (SEQ ID NO: 13) with certain stereochemistry
information.
[0457] In some embodiments, the sequence of the oligonucleotide in
a stereopure (chirally controlled) oligonucleotide composition
comprises or consists of the sequence of any oligonucleotide
disclosed herein. In some embodiments, the sequence of the
oligonucleotide in a stereopure (chirally controlled)
oligonucleotide composition comprises or consists of the sequence
of any oligonucleotide selected from Tables N1, N2, N3, N4 and 8.
In some embodiments, the sequence of the oligonucleotide in a
stereopure (chirally controlled) oligonucleotide composition
comprises or consists of the sequence of any oligonucleotide
selected from Tables N1A, N2A, N3A, N4A and 8. In some embodiments,
the sequence of the oligonucleotide in a stereopure (chirally
controlled) oligonucleotide composition comprises or consists of
the sequence of WV-1092, WVE120101, WV-2603 or WV-2595.
[0458] Each oligonucleotide described herein comprising a HTT
sequence represents an HTT oligonucleotide which was designed,
constructed and tested in various assays, in some embodiments, one
or more in vitro assays. Each HTT oligonucleotide listed in any of
Tables N1A, N2A, N3A, N4A and 8, or described elsewhere herein, was
designed, constructed and tested in various assays, in some
embodiments, one or more in vitro assays. For example, HTT
oligonucleotides described herein were tested in a dual luciferase
reporter assay. In some embodiments, HTT oligonucleotides were
tested in one or more other assays described in this disclosure
and/or in the art in accordance with the present disclosure. In
some embodiments, HTT oligonucleotides which were found to be
particularly efficacious in the dual luciferase assay were tested
in further in vitro and in vivo assays in accordance with the
present disclosure.
[0459] In some embodiments, a sequence of an oligonucleotide in a
stereopure (chirally controlled) oligonucleotide composition
includes any one or more of: base sequence (including length);
pattern of chemical modifications to sugar and base moieties;
pattern of backbone linkages; pattern of natural phosphate
linkages, phosphorothioate linkages, phosphorothioate triester
linkages, and combinations thereof, pattern of backbone chiral
centers; pattern of stereochemistry (Rp/Sp) of chiral
internucleotidic linkages; pattern of backbone phosphorus
modifications; pattern of modifications on the internucleotidic
phosphorus atom, such as --S.sup.-, and -L-R.sup.1 of formula
I.
[0460] Among other things, the present disclosure provides new
compositions that are or contain particular stereoisomers of
oligonucleotides of interest. In some embodiments, a particular
stereoisomer may be defined, for example, by its base sequence, its
length, its pattern of backbone linkages, and its pattern of
backbone chiral centers. As is understood in the art, in some
embodiments, base sequence may refer to the identity and/or
modification status of nucleoside residues (e.g., of sugar and/or
base components, relative to standard naturally occurring
nucleotides such as adenine, cytosine, guanosine, thymine, and
uracil) in an oligonucleotide and/or to the hybridization character
(i.e., the ability to hybridize with particular complementary
residues) of such residues. In some embodiments, oligonucleotides
in provided compositions comprise sugar modifications, e.g.,
2'-modifications, at e.g., a wing region. In some embodiments,
oligonucleotides in provided compositions comprise a region in the
middle, e.g., a core region, that has no sugar modifications.
[0461] The present disclosure demonstrates, among other things,
that individual stereoisomers of a particular oligonucleotide can
show different stability and/or activity (e.g., functional and/or
toxicity properties) from each other. Moreover, the present
disclosure demonstrates that stability and/or activity improvements
achieved through inclusion and/or location of particular chiral
structures within an oligonucleotide can be comparable to, or even
better than those achieved through use of particular backbone
linkages, residue modifications, etc. (e.g., through use of certain
types of modified phosphates [e.g., phosphorothioate, substituted
phosphorothioate, etc.], sugar modifications [e.g.,
2'-modifications, etc.], and/or base modifications [e.g.,
methylation, etc.]).
[0462] Among other things, the present disclosure recognizes that,
in some embodiments, properties (e.g., stability and/or activities)
of an oligonucleotide can be adjusted by optimizing its pattern of
backbone chiral centers, optionally in combination with
adjustment/optimization of one or more other features (e.g.,
linkage pattern, nucleoside modification pattern, etc.) of the
oligonucleotide. In some embodiments, the present disclosure
provides oligonucleotide compositions wherein the oligonucleotides
comprise nucleoside modifications, chiral internucleotidic linkages
and natural phosphate linkages. For example, WV-1092 comprises
2'-OMe modifications, phosphate linkages in its 5'- and 3'-wing
regions, and phosphorothioate linkages in its core regions.
[0463] In some embodiments, the present disclosure demonstrates
that stability improvements achieved through inclusion and/or
location of particular chiral structures within an oligonucleotide
can be comparable to, or even better than those achieved through
use of modified backbone linkages, bases, and/or sugars (e.g.,
through use of certain types of modified phosphates,
2'-modifications, base modifications, etc.). The present
disclosure, in some embodiments, also demonstrates that activity
improvements achieved through inclusion and/or location of
particular chiral structures within an oligonucleotide can be
comparable to, or even better than those achieved through use of
modified backbone linkages, bases, and/or sugars (e.g., through use
of certain types of modified phosphates, 2'-modifications, base
modifications, etc.).
[0464] In some embodiments, inclusion and/or location of particular
chiral linkages within an oligonucleotide can surprisingly change
the cleavage pattern of a nucleic acid polymer when such an
oligonucleotide is utilized for cleaving said nucleic acid polymer.
For example, in some embodiments, a pattern of backbone chiral
centers provides unexpectedly high cleavage efficiency of a target
nucleic acid polymer. In some embodiments, a pattern of backbone
chiral centers provides new cleavage sites. In some embodiments, a
pattern of backbone chiral centers provides fewer cleavage sites,
for example, by blocking certain existing cleavage sites. Even more
unexpectedly, in some embodiments, a pattern of backbone chiral
centers provides cleavage at only one site of a target nucleic acid
polymer within the sequence that is complementary to an
oligonucleotide utilized for cleavage. In some embodiments, higher
cleavage efficiency is achieved by selecting a pattern of backbone
chiral centers to minimize the number of cleavage sites.
[0465] In some embodiments, the present disclosure provides
compositions of oligonucleotides, wherein the oligonucleotides have
a common pattern of backbone chiral centers which, unexpectedly,
greatly enhances the stability and/or biological activity of the
oligonucleotides. In some embodiments, a pattern of backbone chiral
centers provides increased stability. In some embodiments, a
pattern of backbone chiral centers provides surprisingly increased
activity. In some embodiments, a pattern of backbone chiral centers
provides increased stability and activity. In some embodiments,
when an oligonucleotide is utilized to cleave a nucleic acid
polymer, a pattern of backbone chiral centers, surprisingly by
itself, changes the cleavage pattern of a target nucleic acid
polymer. In some embodiments, a pattern of backbone chiral centers
effectively prevents cleavage at secondary sites. In some
embodiments, a pattern of backbone chiral centers creates new
cleavage sites. In some embodiments, a pattern of backbone chiral
centers minimizes the number of cleavage sites. In some
embodiments, a pattern of backbone chiral centers minimizes the
number of cleavage sites so that a target nucleic acid polymer is
cleaved at only one site within the sequence of the target nucleic
acid polymer that is complementary to the oligonucleotide (e.g.,
cleavage at other sites cannot be readily detected by a certain
method; in some embodiments, greater than 85%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98% or 99% cleavage occurs at such a site). In
some embodiments, a pattern of backbone chiral centers enhances
cleavage efficiency at a cleavage site. In some embodiments, a
pattern of backbone chiral centers of the oligonucleotide improves
cleavage of a target nucleic acid polymer. In some embodiments, a
pattern of backbone chiral centers increases selectivity. In some
embodiments, a pattern of backbone chiral centers minimizes
off-target effect. In some embodiments, a pattern of backbone
chiral centers increase selectivity, e.g., cleavage selectivity
between two target sequences differing only by a single nucleotide
polymorphism (SNP). In some embodiments, a pattern of backbone
chiral centers increase cleavage at a cleavage site of a
stereorandom or DNA oligonucleotide composition. In some
embodiments, a pattern of backbone chiral centers increase cleavage
at a major cleavage site of a stereorandom or DNA oligonucleotide
composition. In some embodiments, such a site is a major cleavage
site of oligonucleotides having the pattern of backbone chiral
centers. In some embodiments, a site is considered a major site if
it is a site having the most, or the second, third, fourth or fifth
most cleavage, or a site where greater than 5%, 10%, 15%, 20%, 25%,
30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%,
95%, 96%, 97%, 98% or 99% of cleavage occurs. In some embodiments,
a pattern of backbone chiral centers comprises or is
(Sp).sub.m(Rp).sub.n, (Rp).sub.n(Sp).sub.m,
(Np).sub.t(Rp).sub.n(Sp).sub.m, or (Sp).sub.t(Rp).sub.n(Sp).sub.m.
In some embodiments, a pattern of backbone chiral centers comprises
or is (Rp).sub.n(Sp).sub.m, (Np).sub.t(Rp).sub.n(Sp).sub.m, or
(Sp).sub.t(Rp).sub.n(Sp).sub.m, wherein m>2. In some
embodiments, a pattern of backbone chiral centers comprises or is
(Rp).sub.n(Sp).sub.m, (Np).sub.t(Rp).sub.n(Sp).sub.m, or
(Sp).sub.t(Rp).sub.n(Sp).sub.m, wherein n is 1, t>1, and m>2.
In some embodiments, m>3. In some embodiments, m>4.
[0466] In some embodiments, the present disclosure recognizes that
chemical modifications, such as modifications of nucleosides and
internucleotidic linkages, can provide enhanced properties. In some
embodiments, the present disclosure demonstrates that combinations
of chemical modifications and stereochemistry can provide
unexpected, greatly improved properties (e.g., bioactivity,
selectivity, etc.). In some embodiments, chemical combinations,
such as modifications of sugars, bases, and/or internucleotidic
linkages, are combined with stereochemistry patterns, e.g.,
(Rp).sub.n(Sp).sub.m, (Np).sub.t(Rp).sub.n(Sp).sub.m, or
(Sp).sub.t(Rp).sub.n(Sp).sub.m, to provide oligonucleotides and
compositions thereof with surprisingly enhanced properties. In some
embodiments, a provided oligonucleotide composition is chirally
controlled, and comprises a combination of 2'-modification of one
or more sugar moieties, one or more natural phosphate linkages, one
or more phosphorothioate linkages, and a stereochemistry pattern of
(Rp).sub.n(Sp).sub.m, (Np).sub.t(Rp).sub.n(Sp).sub.m, or
(Sp).sub.t(Rp).sub.n(Sp).sub.m, wherein m>2. In some
embodiments, n is 1, t>1, and m>2. In some embodiments,
m>3. In some embodiments, m>4.
[0467] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide composition comprising
oligonucleotides defined by having:
[0468] 1) a common base sequence and length;
[0469] 2) a common pattern of backbone linkages; and
[0470] 3) a common pattern of backbone chiral centers, which
composition is a substantially pure preparation of a single
oligonucleotide in that a predetermined level of the
oligonucleotides in the composition have the common base sequence
and length, the common pattern of backbone linkages, and the common
pattern of backbone chiral centers.
[0471] In some embodiments, a common base sequence and length may
be referred to as a common base sequence. In some embodiments,
oligonucleotides having a common base sequence may have the same
pattern of nucleoside modifications, e.g., sugar modifications,
base modifications, etc. In some embodiments, a pattern of
nucleoside modifications may be represented by a combination of
locations and modifications. For example, for WV-1092, the pattern
of nucleoside modifications is 5.times.2'-OMe (2'-OMe modification
on sugar moieties)-DNA (no 2'-modifications on the sugar
moiety)-5.times.2'-OMe from the 5'-end to the 3'-end. In some
embodiments, a pattern of backbone linkages comprises locations and
types (e.g., phosphate, phosphorothioate, substituted
phosphorothioate, etc.) of each internucleotidic linkages. In some
embodiments, an oligonucleotide can have a specified pattern of
backbone linkages. In some embodiments, an oligonucleotide has a
pattern of backbone linkages of
.sub.nPS-.sub.nPO-.sub.nPS-.sub.nPO-.sub.nPS, wherein PO is
phosphate (phosphorodiester), PS is phosphorothioate, and n is
1-15, and each occurrence of n can be the same or different. In
some embodiments, at least one n is greater than 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In some
embodiments, at least one n for PS is greater than 2, 3, 4, 5, 6,
7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In some
embodiments, the n for the PS between the two PO is greater than 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.
In some embodiments, n is greater than 5. In some embodiments, n is
greater than 6. In some embodiments, n is greater than 7. In some
embodiments, n is greater than 8. In some embodiments, n is greater
than 9. In some embodiments, n is greater than 10. In some
embodiments, n is greater than 11. In some embodiments, n is
greater than 12. In some embodiments, n is greater than 13. In some
embodiments, n is greater than 14. In some embodiments, n is
greater than 15. In some embodiments, an oligonucleotide has a
pattern of backbone linkages of 1-5PS-1-7PO-5-15PS-1-7 PO-1-5PS
(meaning 1 to 5 phosphorothioates, 1 to 7 phosphates, 5 to 15
phosphorothioates, 1 to 7 phosphates, and 1 to 5
phosphorothioates). In some embodiments, the oligonucleotide has a
pattern of backbone linkages, from 5' to 3', of
1PS-3PO-11PS-3PO-1PS (meaning 1 phosphorothioate, 3 phosphates, 11
phosphorothioates, 3 phosphates, and 1 phosphorothioate, and which
can alternatively be represented as
PS.sub.1PO.sub.3PS.sub.11PO.sub.3PS.sub.1). For example, for
WV-1092, the pattern of backbone linkages is 1PS-3PO-11PS-3PO-1PS
from the 5'-end to the 3'-end. In some embodiments, an
oligonucleotide has a pattern of backbone linkages of
1-5PS-1-7PO-5-15PS-1-7PO-1-5PS, wherein each PS is Sp except for
one Rp. In some embodiments, the oligonucleotide has a pattern of
backbone linkages of 1-5PS-1-7PO-5-15PS-1-7PO-1-5PS, wherein each
PS is Sp except one PS at any position from the 5.sup.th to
15.sup.th PS is Rp. In some embodiments, the oligonucleotide has a
pattern of backbone linkages of 1-5PS-1-7PO-5-15PS-1-7PO-1-5PS,
wherein each PS is Sp except that the 10.sup.th PS counting from
the 5' end is Rp. In some embodiments, the oligonucleotide has a
pattern of backbone linkages of 1-5PS-1-7PO-5-15PS-1-7PO-1-5PS,
wherein each PS is Sp except that the 9.sup.th counting from the 5'
end PS is Rp. In some embodiments, the oligonucleotide has a
pattern of backbone linkages of 1-5PS-1-7PO-5-15PS-1-7PO-1-5PS,
wherein each PS is Sp except that the 11.sup.th PS counting from
the 5' end is Rp. A pattern of backbone chiral centers of an
oligonucleotide can be designated by a combination of linkage
phosphorus stereochemistry (Rp/Sp) from 5' to 3'. For example,
WV-1092 has a pattern of 1S-3PO (phosphate)-8S-1R-2S-3PO-1S, and
WV-937 has a pattern of 12S-1R-6S. In some embodiments, all
non-chiral linkages (e.g., PO) may be omitted when describing a
pattern of backbone chiral centers. As exemplified above, locations
of non-chiral linkages may be obtained, for example, from pattern
of backbone linkages. Any sequence disclosed herein can be combined
with any patterns of backbone linkages and/or any patterns of
backbone chiral centers disclosed herein. Base sequences, patterns
of backbone linkages, patterns of stereochemistry (e.g., Rp or Sp),
patterns of base modifications, patterns of backbone chiral
centers, etc. are presented in 5' to 3' direction unless otherwise
indicated.
[0472] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide composition comprising
oligonucleotides of a particular oligonucleotide type characterized
by:
[0473] 1) a common base sequence and length;
[0474] 2) a common pattern of backbone linkages; and
[0475] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type.
[0476] An example substantially racemic preparation of
oligonucleotides is the preparation of phosphorothioate
oligonucleotides through sulfurizing phosphite triesters from
commonly used phosphoramidite oligonucleotide synthesis with either
tetraethylthiuram disulfide or (TETD) or 3H-1, 2-bensodithiol-3-one
1, 1-dioxide (BDTD), a well-known process in the art. In some
embodiments, substantially racemic preparation of oligonucleotides
provides substantially racemic oligonucleotide compositions (or
chirally uncontrolled oligonucleotide compositions).
[0477] As understood by a person having ordinary skill in the art,
a stereorandom or racemic preparation of oligonucleotides is
prepared by non-stereoselective and/or low-stereoselective coupling
of nucleotide monomers, typically without using any chiral
auxiliaries, chiral modification reagents, and/or chiral catalysts.
In some embodiments, in a substantially racemic (or chirally
uncontrolled) preparation of oligonucleotides, all or most coupling
steps are not chirally controlled in that the coupling steps are
not specifically conducted to provide enhanced stereoselectivity.
An example substantially racemic preparation of oligonucleotides is
the preparation of phosphorothioate oligonucleotides through
sulfurizing phosphite triesters from commonly used phosphoramidite
oligonucleotide synthesis with either tetraethylthiuram disulfide
or (TETD) or 3H-1, 2-bensodithiol-3-one 1, 1-dioxide (BDTD), a
well-known process in the art. In some embodiments, substantially
racemic preparation of oligonucleotides provides substantially
racemic oligonucleotide compositions (or chirally uncontrolled
oligonucleotide compositions). In some embodiments, at least one
coupling of a nucleotide monomer has a diastereoselectivity lower
than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3,
98:2, or 99:1. In some embodiments, at least two couplings of a
nucleotide monomer have a diastereoselectivity lower than about
60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1.
In some embodiments, at least three couplings of a nucleotide
monomer have a diastereoselectivity lower than about 60:40, 70:30,
80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1. In some
embodiments, at least four couplings of a nucleotide monomer have a
diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15,
90:10, 91:9, 92:8, 97:3, 98:2, or 99:1. In some embodiments, at
least five couplings of a nucleotide monomer have a
diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15,
90:10, 91:9, 92:8, 97:3, 98:2, or 99:1. In some embodiments, in a
stereorandom or racemic preparations, at least one internucleotidic
linkage has a diastereoselectivity lower than about 60:40, 70:30,
80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1. In some
embodiments, at least two internucleotidic linkages have a
diastereoselectivity lower than about 60:40, 70:30, 80:20, 85:15,
90:10, 91:9, 92:8, 97:3, 98:2, or 99:1. In some embodiments, at
least three internucleotidic linkages have a diastereoselectivity
lower than about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8,
97:3, 98:2, or 99:1. In some embodiments, at least four
internucleotidic linkages have a diastereoselectivity lower than
about 60:40, 70:30, 80:20, 85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or
99:1. In some embodiments, at least five internucleotidic linkages
have a diastereoselectivity lower than about 60:40, 70:30, 80:20,
85:15, 90:10, 91:9, 92:8, 97:3, 98:2, or 99:1. In some embodiments,
a diastereoselectivity is lower than about 60:40. In some
embodiments, a diastereoselectivity is lower than about 70:30. In
some embodiments, a diastereoselectivity is lower than about 80:20.
In some embodiments, a diastereoselectivity is lower than about
90:10. In some embodiments, a diastereoselectivity is lower than
about 91:9. In some embodiments, a diastereoselectivity is lower
than about 92:8. In some embodiments, a diastereoselectivity is
lower than about 93:7. In some embodiments, a diastereoselectivity
is lower than about 94:6. In some embodiments, a
diastereoselectivity is lower than about 95:5. In some embodiments,
a diastereoselectivity is lower than about 96:4. In some
embodiments, a diastereoselectivity is lower than about 97:3. In
some embodiments, a diastereoselectivity is lower than about 98:2.
In some embodiments, a diastereoselectivity is lower than about
99:1. In some embodiments, at least one coupling has a
diastereoselectivity lower than about 90:10. In some embodiments,
at least two couplings have a diastereoselectivity lower than about
90:10. In some embodiments, at least three couplings have a
diastereoselectivity lower than about 90:10. In some embodiments,
at least four couplings have a diastereoselectivity lower than
about 90:10. In some embodiments, at least five couplings have a
diastereoselectivity lower than about 90:10. In some embodiments,
at least one internucleotidic linkage has a diastereoselectivity
lower than about 90:10. In some embodiments, at least two
internucleotidic linkages have a diastereoselectivity lower than
about 90:10. In some embodiments, at least three internucleotidic
linkages have a diastereoselectivity lower than about 90:10. In
some embodiments, at least four internucleotidic linkages have a
diastereoselectivity lower than about 90:10. In some embodiments,
at least five internucleotidic linkages have a diastereoselectivity
lower than about 90:10.
[0478] As understood by a person having ordinary skill in the art,
in some embodiments, diastereoselectivity of a coupling or a
linkage can be assessed through the diastereoselectivity of a dimer
formation under the same or comparable conditions, wherein the
dimer has the same 5'- and 3'-nucleosides and internucleotidic
linkage. For example, diastereoselectivity of the underlined
coupling or linkage in WV-1092 mG*SmGmCmAmC*SA*SA*SG*SG*S
G*SC*SA*SC*RA*SG*SmAmCmUmU*SmC (SEQ ID NO: 14) can be assessed from
coupling two G moieties under the same or comparable conditions,
e.g., monomers, chiral auxiliaries, solvents, activators,
temperatures, etc.
[0479] In some embodiments, the present disclosure provides
chirally controlled (and/or stereochemically pure) oligonucleotide
compositions comprising oligonucleotides defined by having:
[0480] 1) a common base sequence and length;
[0481] 2) a common pattern of backbone linkages; and
[0482] 3) a common pattern of backbone chiral centers, which
composition is a substantially pure preparation of a single
oligonucleotide in that at least about 10% of the oligonucleotides
in the composition have the common base sequence and length, the
common pattern of backbone linkages, and the common pattern of
backbone chiral centers.
[0483] In some embodiments, the present disclosure provides
chirally controlled oligonucleotide composition of oligonucleotides
in that the composition is enriched, relative to a substantially
racemic preparation of the same oligonucleotides, for
oligonucleotides of a single oligonucleotide type. In some
embodiments, the present disclosure provides chirally controlled
oligonucleotide composition of oligonucleotides in that the
composition is enriched, relative to a substantially racemic
preparation of the same oligonucleotides, for oligonucleotides of a
single oligonucleotide type that share:
[0484] 1) a common base sequence and length;
[0485] 2) a common pattern of backbone linkages; and
[0486] 3) a common pattern of backbone chiral centers.
[0487] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide composition comprising
oligonucleotides of a particular oligonucleotide type characterized
by:
[0488] 1) a common base sequence and length;
[0489] 2) a common pattern of backbone linkages; and
[0490] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type.
[0491] In some embodiments, oligonucleotides having a common base
sequence and length, a common pattern of backbone linkages, and a
common pattern of backbone chiral centers have a common pattern of
backbone phosphorus modifications and a common pattern of base
modifications. In some embodiments, oligonucleotides having a
common base sequence and length, a common pattern of backbone
linkages, and a common pattern of backbone chiral centers have a
common pattern of backbone phosphorus modifications and a common
pattern of nucleoside modifications. In some embodiments,
oligonucleotides having a common base sequence and length, a common
pattern of backbone linkages, and a common pattern of backbone
chiral centers have identical structures.
[0492] In some embodiments, oligonucleotides of an oligonucleotide
type have a common pattern of backbone phosphorus modifications and
a common pattern of sugar modifications. In some embodiments,
oligonucleotides of an oligonucleotide type have a common pattern
of backbone phosphorus modifications and a common pattern of base
modifications. In some embodiments, oligonucleotides of an
oligonucleotide type have a common pattern of backbone phosphorus
modifications and a common pattern of nucleoside modifications. In
some embodiments, oligonucleotides of an oligonucleotide type are
identical.
[0493] In some embodiments, a chirally controlled oligonucleotide
composition is a substantially pure preparation of an
oligonucleotide type in that oligonucleotides in the composition
that are not of the oligonucleotide type are impurities form the
preparation process of said oligonucleotide type, in some case,
after certain purification procedures.
[0494] In some embodiments, at least about 20% of the
oligonucleotides in the composition have a common base sequence and
length, a common pattern of backbone linkages, and a common pattern
of backbone chiral centers. In some embodiments, at least about 25%
of the oligonucleotides in the composition have a common base
sequence and length, a common pattern of backbone linkages, and a
common pattern of backbone chiral centers. In some embodiments, at
least about 30% of the oligonucleotides in the composition have a
common base sequence and length, a common pattern of backbone
linkages, and a common pattern of backbone chiral centers. In some
embodiments, at least about 35% of the oligonucleotides in the
composition have a common base sequence and length, a common
pattern of backbone linkages, and a common pattern of backbone
chiral centers. In some embodiments, at least about 40% of the
oligonucleotides in the composition have a common base sequence and
length, a common pattern of backbone linkages, and a common pattern
of backbone chiral centers. In some embodiments, at least about 45%
of the oligonucleotides in the composition have a common base
sequence and length, a common pattern of backbone linkages, and a
common pattern of backbone chiral centers. In some embodiments, at
least about 50% of the oligonucleotides in the composition have a
common base sequence and length, a common pattern of backbone
linkages, and a common pattern of backbone chiral centers. In some
embodiments, at least about 55% of the oligonucleotides in the
composition have a common base sequence and length, a common
pattern of backbone linkages, and a common pattern of backbone
chiral centers. In some embodiments, at least about 60% of the
oligonucleotides in the composition have a common base sequence and
length, a common pattern of backbone linkages, and a common pattern
of backbone chiral centers. In some embodiments, at least about 65%
of the oligonucleotides in the composition have a common base
sequence and length, a common pattern of backbone linkages, and a
common pattern of backbone chiral centers. In some embodiments, at
least about 70% of the oligonucleotides in the composition have a
common base sequence and length, a common pattern of backbone
linkages, and a common pattern of backbone chiral centers. In some
embodiments, at least about 75% of the oligonucleotides in the
composition have a common base sequence and length, a common
pattern of backbone linkages, and a common pattern of backbone
chiral centers. In some embodiments, at least about 80% of the
oligonucleotides in the composition have a common base sequence and
length, a common pattern of backbone linkages, and a common pattern
of backbone chiral centers. In some embodiments, at least about 85%
of the oligonucleotides in the composition have a common base
sequence and length, a common pattern of backbone linkages, and a
common pattern of backbone chiral centers. In some embodiments, at
least about 90% of the oligonucleotides in the composition have a
common base sequence and length, a common pattern of backbone
linkages, and a common pattern of backbone chiral centers. In some
embodiments, at least about 92% of the oligonucleotides in the
composition have a common base sequence and length, a common
pattern of backbone linkages, and a common pattern of backbone
chiral centers. In some embodiments, at least about 94% of the
oligonucleotides in the composition have a common base sequence and
length, a common pattern of backbone linkages, and a common pattern
of backbone chiral centers. In some embodiments, at least about 95%
of the oligonucleotides in the composition have a common base
sequence and length, a common pattern of backbone linkages, and a
common pattern of backbone chiral centers. In some embodiments, at
least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the
oligonucleotides in the composition have a common base sequence and
length, a common pattern of backbone linkages, and a common pattern
of backbone chiral centers. In some embodiments, greater than about
99% of the oligonucleotides in the composition have a common base
sequence and length, a common pattern of backbone linkages, and a
common pattern of backbone chiral centers. In some embodiments,
purity of a chirally controlled oligonucleotide composition of an
oligonucleotide can be expressed as the percentage of
oligonucleotides in the composition that have a common base
sequence and length, a common pattern of backbone linkages, and a
common pattern of backbone chiral centers.
[0495] In some embodiments, oligonucleotides having a common base
sequence and length, a common pattern of backbone linkages, and a
common pattern of backbone chiral centers have a common pattern of
backbone phosphorus modifications. In some embodiments,
oligonucleotides having a common base sequence and length, a common
pattern of backbone linkages, and a common pattern of backbone
chiral centers have a common pattern of backbone phosphorus
modifications and a common pattern of nucleoside modifications. In
some embodiments, oligonucleotides having a common base sequence
and length, a common pattern of backbone linkages, and a common
pattern of backbone chiral centers have a common pattern of
backbone phosphorus modifications and a common pattern of sugar
modifications. In some embodiments, oligonucleotides having a
common base sequence and length, a common pattern of backbone
linkages, and a common pattern of backbone chiral centers have a
common pattern of backbone phosphorus modifications and a common
pattern of base modifications. In some embodiments,
oligonucleotides having a common base sequence and length, a common
pattern of backbone linkages, and a common pattern of backbone
chiral centers have a common pattern of backbone phosphorus
modifications and a common pattern of nucleoside modifications. In
some embodiments, oligonucleotides having a common base sequence
and length, a common pattern of backbone linkages, and a common
pattern of backbone chiral centers are identical.
[0496] In some embodiments, oligonucleotides in provided
compositions have a common pattern of backbone phosphorus
modifications. In some embodiments, a common base sequence is a
base sequence of an oligonucleotide type. In some embodiments, a
provided composition is an oligonucleotide composition that is
chirally controlled in that the composition contains a
predetermined level of oligonucleotides of an individual
oligonucleotide type, wherein an oligonucleotide type is defined
by:
[0497] 1) base sequence;
[0498] 2) pattern of backbone linkages;
[0499] 3) pattern of backbone chiral centers; and
[0500] 4) pattern of backbone phosphorus modifications.
[0501] As noted above and understood in the art, in some
embodiments, base sequence of an oligonucleotide may refer to the
identity and/or modification status of nucleoside residues (e.g.,
of sugar and/or base components, relative to standard naturally
occurring nucleotides such as adenine, cytosine, guanosine,
thymine, and uracil) in the oligonucleotide and/or to the
hybridization character (i.e., the ability to hybridize with
particular complementary residues) of such residues.
[0502] In some embodiments, a particular oligonucleotide type may
be defined by
[0503] 1A) base identity;
[0504] 1B) pattern of base modification;
[0505] 1C) pattern of sugar modification;
[0506] 2) pattern of backbone linkages;
[0507] 3) pattern of backbone chiral centers; and
[0508] 4) pattern of backbone phosphorus modifications.
Thus, in some embodiments, oligonucleotides of a particular type
may share identical bases but differ in their pattern of base
modifications and/or sugar modifications. In some embodiments,
oligonucleotides of a particular type may share identical bases and
pattern of base modifications (including, e.g., absence of base
modification), but differ in pattern of sugar modifications.
[0509] In some embodiments, oligonucleotides of a particular type
are identical in that they have the same base sequence (including
length), the same pattern of chemical modifications to sugar and
base moieties, the same pattern of backbone linkages (e.g., pattern
of natural phosphate linkages, phosphorothioate linkages,
phosphorothioate triester linkages, and combinations thereof), the
same pattern of backbone chiral centers (e.g., pattern of
stereochemistry (Rp/Sp) of chiral internucleotidic linkages), and
the same pattern of backbone phosphorus modifications (e.g.,
pattern of modifications on the internucleotidic phosphorus atom,
such as --S.sup.-, and -L-R.sup.1 of formula I).
[0510] In some embodiments, purity of a chirally controlled
oligonucleotide composition of an oligonucleotide type is expressed
as the percentage of oligonucleotides in the composition that are
of the oligonucleotide type. In some embodiments, at least about
10% of the oligonucleotides in a chirally controlled
oligonucleotide composition are of the same oligonucleotide type.
In some embodiments, at least about 20% of the oligonucleotides in
a chirally controlled oligonucleotide composition are of the same
oligonucleotide type. In some embodiments, at least about 30% of
the oligonucleotides in a chirally controlled oligonucleotide
composition are of the same oligonucleotide type. In some
embodiments, at least about 40% of the oligonucleotides in a
chirally controlled oligonucleotide composition are of the same
oligonucleotide type. In some embodiments, at least about 50% of
the oligonucleotides in a chirally controlled oligonucleotide
composition are of the same oligonucleotide type. In some
embodiments, at least about 60% of the oligonucleotides in a
chirally controlled oligonucleotide composition are of the same
oligonucleotide type. In some embodiments, at least about 70% of
the oligonucleotides in a chirally controlled oligonucleotide
composition are of the same oligonucleotide type. In some
embodiments, at least about 80% of the oligonucleotides in a
chirally controlled oligonucleotide composition are of the same
oligonucleotide type. In some embodiments, at least about 90% of
the oligonucleotides in a chirally controlled oligonucleotide
composition are of the same oligonucleotide type. In some
embodiments, at least about 92% of the oligonucleotides in a
chirally controlled oligonucleotide composition are of the same
oligonucleotide type. In some embodiments, at least about 94% of
the oligonucleotides in a chirally controlled oligonucleotide
composition are of the same oligonucleotide type. In some
embodiments, at least about 95% of the oligonucleotides in a
chirally controlled oligonucleotide composition are of the same
oligonucleotide type. In some embodiments, at least about 96% of
the oligonucleotides in a chirally controlled oligonucleotide
composition are of the same oligonucleotide type. In some
embodiments, at least about 97% of the oligonucleotides in a
chirally controlled oligonucleotide composition are of the same
oligonucleotide type. In some embodiments, at least about 98% of
the oligonucleotides in a chirally controlled oligonucleotide
composition are of the same oligonucleotide type. In some
embodiments, at least about 99% of the oligonucleotides in a
chirally controlled oligonucleotide composition are of the same
oligonucleotide type.
[0511] In some embodiments, purity of a chirally controlled
oligonucleotide composition can be controlled by stereoselectivity
of each coupling step in its preparation process. In some
embodiments, a coupling step has a stereoselectivity (e.g.,
diastereoselectivity) of 60% (60% of the new internucleotidic
linkage formed from the coupling step has the intended
stereochemistry). After such a coupling step, the new
internucleotidic linkage formed may be referred to have a 60%
purity. In some embodiments, each coupling step has a
stereoselectivity of at least 60%. In some embodiments, each
coupling step has a stereoselectivity of at least 70%. In some
embodiments, each coupling step has a stereoselectivity of at least
80%. In some embodiments, each coupling step has a
stereoselectivity of at least 85%. In some embodiments, each
coupling step has a stereoselectivity of at least 90%. In some
embodiments, each coupling step has a stereoselectivity of at least
91%. In some embodiments, each coupling step has a
stereoselectivity of at least 92%. In some embodiments, each
coupling step has a stereoselectivity of at least 93%. In some
embodiments, each coupling step has a stereoselectivity of at least
94%. In some embodiments, each coupling step has a
stereoselectivity of at least 95%. In some embodiments, each
coupling step has a stereoselectivity of at least 96%. In some
embodiments, each coupling step has a stereoselectivity of at least
97%. In some embodiments, each coupling step has a
stereoselectivity of at least 98%. In some embodiments, each
coupling step has a stereoselectivity of at least 99%. In some
embodiments, each coupling step has a stereoselectivity of at least
99.5%. In some embodiments, each coupling step has a
stereoselectivity of virtually 100%. In some embodiments, a
coupling step has a stereoselectivity of virtually 100% in that all
detectable product from the coupling step by an analytical method
(e.g., NMR, HPLC, etc) has the intended stereoselectivity.
[0512] Among other things, the present disclosure recognizes that
combinations of oligonucleotide structural elements (e.g., patterns
of chemical modifications, backbone linkages, backbone chiral
centers, and/or backbone phosphorus modifications) can provide
surprisingly improved properties such as bioactivities.
[0513] In some embodiments, the present disclosure provides an
oligonucleotide composition comprising a predetermined level of
oligonucleotides which comprise one or more wing regions and a
common core region, wherein:
[0514] each wing region independently has a length of two or more
bases, and independently and optionally comprises one or more
chiral internucleotidic linkages;
[0515] the core region independently has a length of two or more
bases, and independently comprises one or more chiral
internucleotidic linkages, and the common core region has:
[0516] 1) a common base sequence and length;
[0517] 2) a common pattern of backbone linkages; and
[0518] 3) a common pattern of backbone chiral centers.
[0519] In some embodiments, a wing region comprises a structural
feature that is not in a core region. In some embodiments, a wing
and core can be defined by any structural elements, e.g., base
modifications (e.g., methylated/non-methylated, methylation at
position 1/methylation at position 2, etc.), sugar modifications
(e.g., modified/non-modified, 2'-modification/another type of
modification, one type of 2'-modification/another type of
2'-modification, etc.), backbone linkage types (e.g.,
phosphate/phosphorothioate, phosphorothioate/substituted
phosphorothioate, etc.), backbone chiral center stereochemistry
(e.g., all Sp/all Rp, (SpRp) repeats/all Rp, etc.), backbone
phosphorus modification types (e.g., s1/s2, s1/s3, etc.), etc.
[0520] In some embodiments, a wing and core is defined by
nucleoside modifications, wherein a wing comprises a nucleoside
modification that the core region does not have. In some
embodiments, a wing and core is defined by sugar modifications,
wherein a wing comprises a sugar modification that the core region
does not have. In some embodiments, a sugar modification is a
2'-modification. In some embodiments, a sugar modification is
2'-OR.sup.1. In some embodiments, a sugar modification is 2'-MOE.
In some embodiments, a sugar modification is 2'-OMe. Additionally
example sugar modifications are described in the present
disclosure.
[0521] In some embodiments, oligonucleotides in provided
compositions have a wing-core structure (hemimer). In some
embodiments, oligonucleotides in provided compositions have a
wing-core structure of nucleoside modifications. In some
embodiments, oligonucleotides in provided compositions have a
core-wing structure (another type of hemimer). In some embodiments,
oligonucleotides in provided compositions have a core-wing
structure of nucleoside modifications. In some embodiments,
oligonucleotides in provided compositions have a wing-core-wing
structure (gapmer). In some embodiments, oligonucleotides in
provided compositions have a wing-core-wing structure of nucleoside
modifications. In some embodiments, a wing and core is defined by
modifications of the sugar moieties. In some embodiments, a wing
and core is defined by modifications of the base moieties. In some
embodiments, each sugar moiety in the wing region has the same
2'-modification which is not found in the core region. In some
embodiments, each sugar moiety in the wing region has the same
2'-modification which is different than any sugar modifications in
the core region. In some embodiments, a core region has no sugar
modification. In some embodiments, each sugar moiety in the wing
region has the same 2'-modification, and the core region has no
2'-modifications. In some embodiments, when two or more wings are
present, each wing is defined by its own modifications. In some
embodiments, each wing has its own characteristic sugar
modification. In some embodiments, each wing has the same
characteristic sugar modification differentiating it from a core.
In some embodiments, each wing sugar moiety has the same
modification. In some embodiments, each wing sugar moiety has the
same 2'-modification. In some embodiments, each sugar moiety in a
wing region has the same 2'-modification, yet the common
2'-modification in a first wing region can either be the same as or
different from the common 2'-modification in a second wing region.
In some embodiments, each sugar moiety in a wing region has the
same 2'-modification, and the common 2'-modification in a first
wing region is the same as the common 2'-modification in a second
wing region. In some embodiments, each sugar moiety in a wing
region has the same 2'-modification, and the common 2'-modification
in a first wing region is different from the common 2'-modification
in a second wing region.
[0522] In some embodiments, provided chirally controlled (and/or
stereochemically pure) preparations are antisense oligonucleotides
(e.g., chiromersen). In some embodiments, provided chirally
controlled (and/or stereochemically pure) preparations are siRNA
oligonucleotides. In some embodiments, a provided chirally
controlled oligonucleotide composition is of oligonucleotides that
can be antisense oligonucleotide, antagomir, microRNA,
pre-microRNs, antimir, supermir, ribozyme, Ul adaptor, RNA
activator, RNAi agent, decoy oligonucleotide, triplex forming
oligonucleotide, aptamer or adjuvant. In some embodiments, a
chirally controlled oligonucleotide composition is of antisense
oligonucleotides. In some embodiments, a chirally controlled
oligonucleotide composition is of antagomir oligonucleotides. In
some embodiments, a chirally controlled oligonucleotide composition
is of microRNA oligonucleotides. In some embodiments, a chirally
controlled oligonucleotide composition is of pre-microRNA
oligonucleotides. In some embodiments, a chirally controlled
oligonucleotide composition is of antimir oligonucleotides. In some
embodiments, a chirally controlled oligonucleotide composition is
of supermir oligonucleotides. In some embodiments, a chirally
controlled oligonucleotide composition is of ribozyme
oligonucleotides. In some embodiments, a chirally controlled
oligonucleotide composition is of Ul adaptor oligonucleotides. In
some embodiments, a chirally controlled oligonucleotide composition
is of RNA activator oligonucleotides. In some embodiments, a
chirally controlled oligonucleotide composition is of RNAi agent
oligonucleotides. In some embodiments, a chirally controlled
oligonucleotide composition is of decoy oligonucleotides. In some
embodiments, a chirally controlled oligonucleotide composition is
of triplex forming oligonucleotides. In some embodiments, a
chirally controlled oligonucleotide composition is of aptamer
oligonucleotides. In some embodiments, a chirally controlled
oligonucleotide composition is of adjuvant oligonucleotides.
[0523] In some embodiments, provided chirally controlled (and/or
stereochemically pure) preparations are of oligonucleotides that
include one or more modified backbone linkages, bases, and/or
sugars.
[0524] In some embodiments, a provided oligonucleotide comprises
one or more chiral, modified phosphate linkages. In some
embodiments, a provided oligonucleotide comprises two or more
chiral, modified phosphate linkages. In some embodiments, a
provided oligonucleotide comprises three or more chiral, modified
phosphate linkages. In some embodiments, a provided oligonucleotide
comprises four or more chiral, modified phosphate linkages. In some
embodiments, a provided oligonucleotide comprises five or more
chiral, modified phosphate linkages. In some embodiments, a
provided oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8,9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25
chiral, modified phosphate linkages. In some embodiments, a
provided oligonucleotide type comprises 5 or more chiral, modified
phosphate linkages. In some embodiments, a provided oligonucleotide
type comprises 6 or more chiral, modified phosphate linkages. In
some embodiments, a provided oligonucleotide type comprises 7 or
more chiral, modified phosphate linkages. In some embodiments, a
provided oligonucleotide type comprises 8 or more chiral, modified
phosphate linkages. In some embodiments, a provided oligonucleotide
type comprises 9 or more chiral, modified phosphate linkages. In
some embodiments, a provided oligonucleotide type comprises 10 or
more chiral, modified phosphate linkages. In some embodiments, a
provided oligonucleotide type comprises 11 or more chiral, modified
phosphate linkages. In some embodiments, a provided oligonucleotide
type comprises 12 or more chiral, modified phosphate linkages. In
some embodiments, a provided oligonucleotide type comprises 13 or
more chiral, modified phosphate linkages. In some embodiments, a
provided oligonucleotide type comprises 14 or more chiral, modified
phosphate linkages. In some embodiments, a provided oligonucleotide
type comprises 15 or more chiral, modified phosphate linkages. In
some embodiments, a provided oligonucleotide type comprises 16 or
more chiral, modified phosphate linkages. In some embodiments, a
provided oligonucleotide type comprises 17 or more chiral, modified
phosphate linkages. In some embodiments, a provided oligonucleotide
type comprises 18 or more chiral, modified phosphate linkages. In
some embodiments, a provided oligonucleotide type comprises 19 or
more chiral, modified phosphate linkages. In some embodiments, a
provided oligonucleotide type comprises 20 or more chiral, modified
phosphate linkages. In some embodiments, a provided oligonucleotide
type comprises 21 or more chiral, modified phosphate linkages. In
some embodiments, a provided oligonucleotide type comprises 22 or
more chiral, modified phosphate linkages. In some embodiments, a
provided oligonucleotide type comprises 23 or more chiral, modified
phosphate linkages. In some embodiments, a provided oligonucleotide
type comprises 24 or more chiral, modified phosphate linkages. In
some embodiments, a provided oligonucleotide type comprises 25 or
more chiral, modified phosphate linkages.
[0525] In some embodiments, a provided oligonucleotide comprises at
least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%,
65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% chiral, modified
phosphate linkages. Example such chiral, modified phosphate
linkages are described above and herein. In some embodiments, a
provided oligonucleotide comprises at least 5%, 10%, 15%, 20%, 25%,
30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%,
95%, or 100% chiral, modified phosphate linkages in the Sp
configuration.
[0526] In some embodiments, provided chirally controlled (and/or
stereochemically pure) preparations are of a stereochemical purity
of greater than about 80%. In some embodiments, provided chirally
controlled (and/or stereochemically pure) preparations are of a
stereochemical purity of greater than about 85%. In some
embodiments, provided chirally controlled (and/or stereochemically
pure) preparations are of a stereochemical purity of greater than
about 90%. In some embodiments, provided chirally controlled
(and/or stereochemically pure) preparations are of a stereochemical
purity of greater than about 91%. In some embodiments, provided
chirally controlled (and/or stereochemically pure) preparations are
of a stereochemical purity of greater than about 92%. In some
embodiments, provided chirally controlled (and/or stereochemically
pure) preparations are of a stereochemical purity of greater than
about 93%. In some embodiments, provided chirally controlled
(and/or stereochemically pure) preparations are of a stereochemical
purity of greater than about 94%. In some embodiments, provided
chirally controlled (and/or stereochemically pure) preparations are
of a stereochemical purity of greater than about 95%. In some
embodiments, provided chirally controlled (and/or stereochemically
pure) preparations are of a stereochemical purity of greater than
about 96%. In some embodiments, provided chirally controlled
(and/or stereochemically pure) preparations are of a stereochemical
purity of greater than about 97%. In some embodiments, provided
chirally controlled (and/or stereochemically pure) preparations are
of a stereochemical purity of greater than about 98%. In some
embodiments, provided chirally controlled (and/or stereochemically
pure) preparations are of a stereochemical purity of greater than
about 99%.
[0527] In some embodiments, a chiral, modified phosphate linkage is
a chiral phosphorothioate linkage, i.e., phosphorothioate
internucleotidic linkage. In some embodiments, a provided
oligonucleotide comprises at least 5%, 10%, 15%, 20%, 25%, 30%,
35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or
100% chiral phosphorothioate internucleotidic linkages. In some
embodiments, all chiral, modified phosphate linkages are chiral
phosphorothioate internucleotidic linkages. In some embodiments, at
least about 10, 20, 30, 40, 50, 60, 70, 80, or 90% chiral
phosphorothioate internucleotidic linkages of a provided
oligonucleotide are of the Sp conformation. In some embodiments, at
least about 10% chiral phosphorothioate internucleotidic linkages
of a provided oligonucleotide are of the Sp conformation. In some
embodiments, at least about 20% chiral phosphorothioate
internucleotidic linkages of a provided oligonucleotide are of the
Sp conformation. In some embodiments, at least about 30% chiral
phosphorothioate internucleotidic linkages of a provided
oligonucleotide are of the Sp conformation. In some embodiments, at
least about 40% chiral phosphorothioate internucleotidic linkages
of a provided oligonucleotide are of the Sp conformation. In some
embodiments, at least about 50% chiral phosphorothioate
internucleotidic linkages of a provided oligonucleotide are of the
Sp conformation. In some embodiments, at least about 60% chiral
phosphorothioate internucleotidic linkages of a provided
oligonucleotide are of the Sp conformation. In some embodiments, at
least about 70% chiral phosphorothioate internucleotidic linkages
of a provided oligonucleotide are of the Sp conformation. In some
embodiments, at least about 80% chiral phosphorothioate
internucleotidic linkages of a provided oligonucleotide are of the
Sp conformation. In some embodiments, at least about 90% chiral
phosphorothioate internucleotidic linkages of a provided
oligonucleotide are of the Sp conformation. In some embodiments, at
least about 95% chiral phosphorothioate internucleotidic linkages
of a provided oligonucleotide are of the Sp conformation. In some
embodiments, at least about 10, 20, 30, 40, 50, 60, 70, 80, or 90%
chiral phosphorothioate internucleotidic linkages of a provided
oligonucleotide are of the Rp conformation. In some embodiments, at
least about 10% chiral phosphorothioate internucleotidic linkages
of a provided oligonucleotide are of the Rp conformation. In some
embodiments, at least about 20% chiral phosphorothioate
internucleotidic linkages of a provided oligonucleotide are of the
Rp conformation. In some embodiments, at least about 30% chiral
phosphorothioate internucleotidic linkages of a provided
oligonucleotide are of the Rp conformation. In some embodiments, at
least about 40% chiral phosphorothioate internucleotidic linkages
of a provided oligonucleotide are of the Rp conformation. In some
embodiments, at least about 50% chiral phosphorothioate
internucleotidic linkages of a provided oligonucleotide are of the
Rp conformation. In some embodiments, at least about 60% chiral
phosphorothioate internucleotidic linkages of a provided
oligonucleotide are of the Rp conformation. In some embodiments, at
least about 70% chiral phosphorothioate internucleotidic linkages
of a provided oligonucleotide are of the Rp conformation. In some
embodiments, at least about 80% chiral phosphorothioate
internucleotidic linkages of a provided oligonucleotide are of the
Rp conformation. In some embodiments, at least about 90% chiral
phosphorothioate internucleotidic linkages of a provided
oligonucleotide are of the Rp conformation. In some embodiments, at
least about 95% chiral phosphorothioate internucleotidic linkages
of a provided oligonucleotide are of the Rp conformation. In some
embodiments, less than about 10, 20, 30, 40, 50, 60, 70, 80, or 90%
chiral phosphorothioate internucleotidic linkages of a provided
oligonucleotide are of the Rp conformation. In some embodiments,
less than about 10% chiral phosphorothioate internucleotidic
linkages of a provided oligonucleotide are of the Rp conformation.
In some embodiments, less than about 20% chiral phosphorothioate
internucleotidic linkages of a provided oligonucleotide are of the
Rp conformation. In some embodiments, less than about 30% chiral
phosphorothioate internucleotidic linkages of a provided
oligonucleotide are of the Rp conformation. In some embodiments,
less than about 40% chiral phosphorothioate internucleotidic
linkages of a provided oligonucleotide are of the Rp conformation.
In some embodiments, less than about 50% chiral phosphorothioate
internucleotidic linkages of a provided oligonucleotide are of the
Rp conformation. In some embodiments, less than about 60% chiral
phosphorothioate internucleotidic linkages of a provided
oligonucleotide are of the Rp conformation. In some embodiments,
less than about 70% chiral phosphorothioate internucleotidic
linkages of a provided oligonucleotide are of the Rp conformation.
In some embodiments, less than about 80% chiral phosphorothioate
internucleotidic linkages of a provided oligonucleotide are of the
Rp conformation. In some embodiments, less than about 90% chiral
phosphorothioate internucleotidic linkages of a provided
oligonucleotide are of the Rp conformation. In some embodiments,
less than about 95% chiral phosphorothioate internucleotidic
linkages of a provided oligonucleotide are of the Rp conformation.
In some embodiments, a provided oligonucleotide has only one Rp
chiral phosphorothioate internucleotidic linkages. In some
embodiments, a provided oligonucleotide has only one Rp chiral
phosphorothioate internucleotidic linkages, wherein all
internucleotide linkages are chiral phosphorothioate
internucleotidic linkages. In some embodiments, a chiral
phosphorothioate internucleotidic linkage is a chiral
phosphorothioate diester linkage. In some embodiments, each chiral
phosphorothioate internucleotidic linkage is independently a chiral
phosphorothioate diester linkage. In some embodiments, each
internucleotidic linkage is independently a chiral phosphorothioate
diester linkage. In some embodiments, each internucleotidic linkage
is independently a chiral phosphorothioate diester linkage, and
only one is Rp.
[0528] In some embodiments, provided chirally controlled (and/or
stereochemically pure) preparations are of oligonucleotides that
contain one or more modified bases. In some embodiments, provided
chirally controlled (and/or stereochemically pure) preparations are
of oligonucleotides that contain no modified bases. Example such
modified bases are described above and herein.
[0529] In some embodiments, oligonucleotides of provided
compositions comprise at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 natural
phosphate linkages. In some embodiments, oligonucleotides of
provided compositions comprise at least one natural phosphate
linkage. In some embodiments, oligonucleotides of provided
compositions comprise at least two natural phosphate linkages. In
some embodiments, oligonucleotides of provided compositions
comprise at least three natural phosphate linkages. In some
embodiments, oligonucleotides of provided compositions comprise at
least four natural phosphate linkages. In some embodiments,
oligonucleotides of provided compositions comprise at least five
natural phosphate linkages. In some embodiments, oligonucleotides
of provided compositions comprise at least six natural phosphate
linkages. In some embodiments, oligonucleotides of provided
compositions comprise at least seven natural phosphate linkages. In
some embodiments, oligonucleotides of provided compositions
comprise at least eight natural phosphate linkages. In some
embodiments, oligonucleotides of provided compositions comprise at
least nine natural phosphate linkages. In some embodiments,
oligonucleotides of provided compositions comprise at least ten
natural phosphate linkages.
[0530] In some embodiments, oligonucleotides of provided
compositions comprise 2, 3, 4, 5, 6, 7, 8, 9 or 10 natural
phosphate linkages. In some embodiments, oligonucleotides of
provided compositions comprise one natural phosphate linkage. In
some embodiments, oligonucleotides of provided compositions
comprise two natural phosphate linkages. In some embodiments,
oligonucleotides of provided compositions comprise three natural
phosphate linkages. In some embodiments, oligonucleotides of
provided compositions comprise four natural phosphate linkages. In
some embodiments, oligonucleotides of provided compositions
comprise five natural phosphate linkages. In some embodiments,
oligonucleotides of provided compositions comprise six natural
phosphate linkages. In some embodiments, oligonucleotides of
provided compositions comprise seven natural phosphate linkages. In
some embodiments, oligonucleotides of provided compositions
comprise eight natural phosphate linkages. In some embodiments,
oligonucleotides of provided compositions comprise nine natural
phosphate linkages. In some embodiments, oligonucleotides of
provided compositions comprise ten natural phosphate linkages.
[0531] In some embodiments, oligonucleotides of provided
compositions comprise at least 2, 3, 4, 5, 6, 7, 8, 9 or 10
consecutive natural phosphate linkages. In some embodiments,
oligonucleotides of provided compositions comprise at least two
consecutive natural phosphate linkages. In some embodiments,
oligonucleotides of provided compositions comprise at least three
consecutive natural phosphate linkages. In some embodiments,
oligonucleotides of provided compositions comprise at least four
consecutive natural phosphate linkages. In some embodiments,
oligonucleotides of provided compositions comprise at least five
consecutive natural phosphate linkages. In some embodiments,
oligonucleotides of provided compositions comprise at least six
consecutive natural phosphate linkages. In some embodiments,
oligonucleotides of provided compositions comprise at least seven
consecutive natural phosphate linkages. In some embodiments,
oligonucleotides of provided compositions comprise at least eight
consecutive natural phosphate linkages. In some embodiments,
oligonucleotides of provided compositions comprise at least nine
consecutive natural phosphate linkages. In some embodiments,
oligonucleotides of provided compositions comprise at least ten
consecutive natural phosphate linkages.
[0532] In some embodiments, oligonucleotides of provided
compositions comprise 2, 3, 4, 5, 6, 7, 8, 9 or 10 consecutive
natural phosphate linkages. In some embodiments, oligonucleotides
of provided compositions comprise two consecutive natural phosphate
linkages. In some embodiments, oligonucleotides of provided
compositions comprise three consecutive natural phosphate linkages.
In some embodiments, oligonucleotides of provided compositions
comprise four consecutive natural phosphate linkages. In some
embodiments, oligonucleotides of provided compositions comprise
five consecutive natural phosphate linkages. In some embodiments,
oligonucleotides of provided compositions comprise six consecutive
natural phosphate linkages. In some embodiments, oligonucleotides
of provided compositions comprise seven consecutive natural
phosphate linkages. In some embodiments, oligonucleotides of
provided compositions comprise eight consecutive natural phosphate
linkages. In some embodiments, oligonucleotides of provided
compositions comprise nine consecutive natural phosphate linkages.
In some embodiments, oligonucleotides of provided compositions
comprise ten consecutive natural phosphate linkages.
[0533] In some embodiments, provided chirally controlled (and/or
stereochemically pure) preparations are of oligonucleotides having
a common base sequence of at least 8 bases. In some embodiments,
provided chirally controlled (and/or stereochemically pure)
preparations are of oligonucleotides having a common base sequence
of at least 9 bases. In some embodiments, provided chirally
controlled (and/or stereochemically pure) preparations are of
oligonucleotides having a common base sequence of at least 10
bases. In some embodiments, provided chirally controlled (and/or
stereochemically pure) preparations are of oligonucleotides having
a common base sequence of at least 11 bases. In some embodiments,
provided chirally controlled (and/or stereochemically pure)
preparations are of oligonucleotides having a common base sequence
of at least 12 bases. In some embodiments, provided chirally
controlled (and/or stereochemically pure) preparations are of
oligonucleotides having a common base sequence of at least 13
bases. In some embodiments, provided chirally controlled (and/or
stereochemically pure) preparations are of oligonucleotides having
a common base sequence of at least 14 bases. In some embodiments,
provided chirally controlled (and/or stereochemically pure)
preparations are of oligonucleotides having a common base sequence
of at least 15 bases. In some embodiments, provided chirally
controlled (and/or stereochemically pure) preparations are of
oligonucleotides having a common base sequence of at least 16
bases. In some embodiments, provided chirally controlled (and/or
stereochemically pure) preparations are of oligonucleotides having
a common base sequence of at least 17 bases. In some embodiments,
provided chirally controlled (and/or stereochemically pure)
preparations are of oligonucleotides having a common base sequence
of at least 18 bases. In some embodiments, provided chirally
controlled (and/or stereochemically pure) preparations are of
oligonucleotides having a common base sequence of at least 19
bases. In some embodiments, provided chirally controlled (and/or
stereochemically pure) preparations are of oligonucleotides having
a common base sequence of at least 20 bases. In some embodiments,
provided chirally controlled (and/or stereochemically pure)
preparations are of oligonucleotides having a common base sequence
of at least 21 bases. In some embodiments, provided chirally
controlled (and/or stereochemically pure) preparations are of
oligonucleotides having a common base sequence of at least 22
bases. In some embodiments, provided chirally controlled (and/or
stereochemically pure) preparations are of oligonucleotides having
a common base sequence of at least 23 bases. In some embodiments,
provided chirally controlled (and/or stereochemically pure)
preparations are of oligonucleotides having a common base sequence
of at least 24 bases. In some embodiments, provided chirally
controlled (and/or stereochemically pure) preparations are of
oligonucleotides having a common base sequence of at least 25
bases. In some embodiments, provided chirally controlled (and/or
stereochemically pure) preparations are of oligonucleotides having
a common base sequence of at least 30, 35, 40, 45, 50, 55, 60, 65,
70, or 75 bases.
[0534] In some embodiments, provided chirally controlled (and/or
stereochemically pure) preparations comprise oligonucleotides
containing one or more residues which are modified at the sugar
moiety. In some embodiments, provided chirally controlled (and/or
stereochemically pure) preparations comprise oligonucleotides
containing one or more residues which are modified at the 2'
position of the sugar moiety (referred to herein as a
"2'-modification"). Examples of such modifications are described
above and herein and include, but are not limited to, 2'-OMe,
2'-MOE, 2'-LNA, 2'-F, FRNA, FANA, S-cEt, etc. In some embodiments,
provided chirally controlled (and/or stereochemically pure)
preparations comprise oligonucleotides containing one or more
residues which are 2'-modified. For example, in some embodiments,
provided oligonucleotides contain one or more residues which are
2'-O-methoxyethyl (2'-MOE)-modified residues. In some embodiments,
provided chirally controlled (and/or stereochemically pure)
preparations comprise oligonucleotides which do not contain any
2'-modifications. In some embodiments, provided chirally controlled
(and/or stereochemically pure) preparations are oligonucleotides
which do not contain any 2'-MOE residues. That is, in some
embodiments, provided oligonucleotides are not MOE-modified.
Additional example sugar modifications are described in the present
disclosure.
[0535] In some embodiments, provided oligonucleotides are of a
general motif of wing-core or core-wing (hemimer, also represented
herein generally as X--Y or Y--X, respectively). In some
embodiments, provided oligonucleotides are of a general motif of
wing-core-wing (gapmer, also represented herein generically as
X--Y--X). In some embodiments, each wing independently contains one
or more residues having a particular modification, which
modification is absent from the core "Y" portion. In some
embodiments, each wing independently contains one or more residues
having a particular nucleoside modification, which modification is
absent from the core "Y" portion. In some embodiments, each wing
independently contains one or more residues having a particular
base modification, which modification is absent from the core "Y"
portion. In some embodiments, each wing independently contains one
or more residues having a particular sugar modification, which
modification is absent from the core "Y" portion. Example sugar
modifications are widely known in the art. In some embodiments, a
sugar modification is a modification selected from those
modifications described in U.S. Pat. No. 9,006,198, which sugar
modifications are incorporated herein by references. Additional
example sugar modifications are described in the present
disclosure. In some embodiment, each wing contains one or more
residues having a 2' modification that is not present in the core
portion. In some embodiments, a 2'-modification is 2'-OR.sup.1,
wherein R.sup.1 is as defined and described in the present
disclosure.
[0536] In some embodiments, provided oligonucleotides have a
wing-core motif represented as X--Y, or a core-wing motif
represented as Y--X, wherein the residues at the "X" portion are
sugar modified residues of a particular type and the residues in
the core "Y" portion are not sugar modified residues of the same
particular type. In some embodiments, provided oligonucleotides
have a wing-core-wing motif represented as X--Y--X, wherein the
residues at each "X" portion are sugar modified residues of a
particular type and the residues in the core "Y" portion are not
sugar modified residues of the same particular type. In some
embodiments, provided oligonucleotides have a wing-core motif
represented as X--Y, or a core-wing motif represented as Y--X,
wherein the residues at the "X" portion are 2'-modified residues of
a particular type and the residues in the core "Y" portion are not
2'-modified residues of the same particular type. In some
embodiments, provided oligonucleotides have a wing-core motif
represented as X--Y, wherein the residues at the "X" portion are
2'-modified residues of a particular type and the residues in the
core "Y" portion are not 2'-modified residues of the same
particular type. In some embodiments, provided oligonucleotides
have a core-wing motif represented as Y--X, wherein the residues at
the "X" portion are 2'-modified residues of a particular type and
the residues in the core "Y" portion are not 2'-modified residues
of the same particular type. In some embodiments, provided
oligonucleotides have a wing-core-wing motif represented as
X--Y--X, wherein the residues at each "X" portion are 2'-modified
residues of a particular type and the residues in the core "Y"
portion are not 2'-modified residues of the same particular type.
In some embodiments, provided oligonucleotides have a wing-core
motif represented as X--Y, wherein the residues at the "X" portion
are 2'-modified residues of a particular type and the residues in
the core "Y" portion are 2'-deoxyribonucleoside. In some
embodiments, provided oligonucleotides have a core-wing motif
represented as Y--X, wherein the residues at the "X" portion are
2'-modified residues of a particular type and the residues in the
core "Y" portion are 2'-deoxyribonucleoside. In some embodiments,
provided oligonucleotides have a wing-core-wing motif represented
as X--Y--X, wherein the residues at each "X" portion are
2'-modified residues of a particular type and the residues in the
core "Y" portion are 2'-deoxyribonucleoside. In some embodiments,
provided oligonucleotides have a wing-core-wing motif represented
as X--Y--X, wherein the residues at each "X" portion are
2'-modified residues of a particular type and the residues in the
core "Y" portion are 2'-deoxyribonucleoside. For instance, in some
embodiments, provided oligonucleotides have a wing-core-wing motif
represented as X--Y--X, wherein the residues at each "X" portion
are 2'-MOE-modified residues and the residues in the core "Y"
portion are not 2'-MOE-modified residues. In some embodiments,
provided oligonucleotides have a wing-core-wing motif represented
as X--Y--X, wherein the residues at each "X" portion are
2'-MOE-modified residues and the residues in the core "Y" portion
are 2'-deoxyribonucleoside. One of skill in the relevant arts will
recognize that all such 2'-modifications described above and herein
are contemplated in the context of such X--Y, Y--X and/or X--Y--X
motifs.
[0537] In some embodiments, a wing has a length of one or more
bases. In some embodiments, a wing has a length of two or more
bases. In some embodiments, a wing has a length of three or more
bases. In some embodiments, a wing has a length of four or more
bases. In some embodiments, a wing has a length of five or more
bases. In some embodiments, a wing has a length of six or more
bases. In some embodiments, a wing has a length of seven or more
bases. In some embodiments, a wing has a length of eight or more
bases. In some embodiments, a wing has a length of nine or more
bases. In some embodiments, a wing has a length of ten or more
bases. In some embodiments, a wing has a length of 11 or more
bases. In some embodiments, a wing has a length of 12 or more
bases. In some embodiments, a wing has a length of 13 or more
bases. In some embodiments, a wing has a length of 14 or more
bases. In some embodiments, a wing has a length of 15 or more
bases. In some embodiments, a wing has a length of 16 or more
bases. In some embodiments, a wing has a length of 17 or more
bases. In some embodiments, a wing has a length of 18 or more
bases. In some embodiments, a wing has a length of 19 or more
bases. In some embodiments, a wing has a length often or more
bases.
[0538] In some embodiments, a wing has a length of one base. In
some embodiments, a wing has a length of two bases. In some
embodiments, a wing has a length of three bases. In some
embodiments, a wing has a length of four bases. In some
embodiments, a wing has a length of five bases. In some
embodiments, a wing has a length of six bases. In some embodiments,
a wing has a length of seven bases. In some embodiments, a wing has
a length of eight bases. In some embodiments, a wing has a length
of nine bases. In some embodiments, a wing has a length of ten
bases. In some embodiments, a wing has a length of 11 bases. In
some embodiments, a wing has a length of 12 bases. In some
embodiments, a wing has a length of 13 bases. In some embodiments,
a wing has a length of 14 bases. In some embodiments, a wing has a
length of 15 bases. In some embodiments, a wing has a length of 16
bases. In some embodiments, a wing has a length of 17 bases. In
some embodiments, a wing has a length of 18 bases. In some
embodiments, a wing has a length of 19 bases. In some embodiments,
a wing has a length of ten bases.
[0539] In some embodiments, a wing comprises one or more chiral
internucleotidic linkages. In some embodiments, a wing comprises
one or more natural phosphate linkages. In some embodiments, a wing
comprises one or more chiral internucleotidic linkages and one or
more natural phosphate linkages. In some embodiments, a wing
comprises one or more chiral internucleotidic linkages and two or
more natural phosphate linkages. In some embodiments, a wing
comprises one or more chiral internucleotidic linkages and two or
more natural phosphate linkages, wherein two or more natural
phosphate linkages are consecutive. In some embodiments, a wing
comprises no chiral internucleotidic linkages. In some embodiments,
each wing linkage is a natural phosphate linkage. In some
embodiments, a wing comprises no phosphate linkages. In some
embodiments, each wing is independently a chiral internucleotidic
linkage.
[0540] In some embodiments, each wing independently comprises one
or more chiral internucleotidic linkages. In some embodiments, each
wing independently comprises one or more natural phosphate
linkages. In some embodiments, each wing independently comprises
one or more chiral internucleotidic linkages and one or more
natural phosphate linkages. In some embodiments, each wing
independently comprises one or more chiral internucleotidic
linkages and two or more natural phosphate linkages. In some
embodiments, each wing independently comprises one or more chiral
internucleotidic linkages and two or more natural phosphate
linkages, wherein two or more natural phosphate linkages are
consecutive.
[0541] In some embodiments, each wing independently comprises at
least one chiral internucleotidic linkage. In some embodiments,
each wing independently comprises at least two chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least three chiral internucleotidic
linkages. In some embodiments, each wing independently comprises at
least four chiral internucleotidic linkages. In some embodiments,
each wing independently comprises at least five chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least six chiral internucleotidic
linkages. In some embodiments, each wing independently comprises at
least seven chiral internucleotidic linkages. In some embodiments,
each wing independently comprises at least eight chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least nine chiral internucleotidic
linkages. In some embodiments, each wing independently comprises at
least ten chiral internucleotidic linkages. In some embodiments,
each wing independently comprises at least 11 chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least 12 chiral internucleotidic
linkages. In some embodiments, each wing independently comprises at
least 13 chiral internucleotidic linkages. In some embodiments,
each wing independently comprises at least 14 chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least 15 chiral internucleotidic
linkages. In some embodiments, each wing independently comprises at
least 16 chiral internucleotidic linkages. In some embodiments,
each wing independently comprises at least 17 chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least 18 chiral internucleotidic
linkages. In some embodiments, each wing independently comprises at
least 19 chiral internucleotidic linkages. In some embodiments,
each wing independently comprises at least 20 chiral
internucleotidic linkages.
[0542] In some embodiments, each wing independently comprises one
chiral internucleotidic linkage. In some embodiments, each wing
independently comprises two chiral internucleotidic linkages. In
some embodiments, each wing independently comprises three chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises four chiral internucleotidic linkages. In
some embodiments, each wing independently comprises five chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises six chiral internucleotidic linkages. In
some embodiments, each wing independently comprises seven chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises eight chiral internucleotidic linkages. In
some embodiments, each wing independently comprises nine chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises ten chiral internucleotidic linkages. In
some embodiments, each wing independently comprises 11 chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises 12 chiral internucleotidic linkages. In
some embodiments, each wing independently comprises 13 chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises 14 chiral internucleotidic linkages. In
some embodiments, each wing independently comprises 15 chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises 16 chiral internucleotidic linkages. In
some embodiments, each wing independently comprises 17 chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises 18 chiral internucleotidic linkages. In
some embodiments, each wing independently comprises 19 chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises 20 chiral internucleotidic linkages.
[0543] In some embodiments, each wing independently comprises at
least one consecutive natural phosphate linkage. In some
embodiments, each wing independently comprises at least two
consecutive chiral internucleotidic linkages. In some embodiments,
each wing independently comprises at least three consecutive chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least four consecutive chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least five consecutive chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least six consecutive chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least seven consecutive chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least eight consecutive chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least nine consecutive chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least ten consecutive chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least 11 consecutive chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least 12 consecutive chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least 13 consecutive chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least 14 consecutive chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least 15 consecutive chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least 16 consecutive chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least 17 consecutive chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least 18 consecutive chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least 19 consecutive chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises at least 20 consecutive chiral
internucleotidic linkages.
[0544] In some embodiments, each wing independently comprises one
consecutive natural phosphate linkage. In some embodiments, each
wing independently comprises two consecutive chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises three consecutive chiral internucleotidic
linkages. In some embodiments, each wing independently comprises
four consecutive chiral internucleotidic linkages. In some
embodiments, each wing independently comprises five consecutive
chiral internucleotidic linkages. In some embodiments, each wing
independently comprises six consecutive chiral internucleotidic
linkages. In some embodiments, each wing independently comprises
seven consecutive chiral internucleotidic linkages. In some
embodiments, each wing independently comprises eight consecutive
chiral internucleotidic linkages. In some embodiments, each wing
independently comprises nine consecutive chiral internucleotidic
linkages. In some embodiments, each wing independently comprises
ten consecutive chiral internucleotidic linkages. In some
embodiments, each wing independently comprises 11 consecutive
chiral internucleotidic linkages. In some embodiments, each wing
independently comprises 12 consecutive chiral internucleotidic
linkages. In some embodiments, each wing independently comprises 13
consecutive chiral internucleotidic linkages. In some embodiments,
each wing independently comprises 14 consecutive chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises 15 consecutive chiral internucleotidic
linkages. In some embodiments, each wing independently comprises 16
consecutive chiral internucleotidic linkages. In some embodiments,
each wing independently comprises 17 consecutive chiral
internucleotidic linkages. In some embodiments, each wing
independently comprises 18 consecutive chiral internucleotidic
linkages. In some embodiments, each wing independently comprises 19
consecutive chiral internucleotidic linkages. In some embodiments,
each wing independently comprises 20 consecutive chiral
internucleotidic linkages.
[0545] In some embodiments, each wing independently comprises at
least one natural phosphate linkage. In some embodiments, each wing
independently comprises at least two natural phosphate linkages. In
some embodiments, each wing independently comprises at least three
natural phosphate linkages. In some embodiments, each wing
independently comprises at least four natural phosphate linkages.
In some embodiments, each wing independently comprises at least
five natural phosphate linkages. In some embodiments, each wing
independently comprises at least six natural phosphate linkages. In
some embodiments, each wing independently comprises at least seven
natural phosphate linkages. In some embodiments, each wing
independently comprises at least eight natural phosphate linkages.
In some embodiments, each wing independently comprises at least
nine natural phosphate linkages. In some embodiments, each wing
independently comprises at least ten natural phosphate linkages. In
some embodiments, each wing independently comprises at least 11
natural phosphate linkages. In some embodiments, each wing
independently comprises at least 12 natural phosphate linkages. In
some embodiments, each wing independently comprises at least 13
natural phosphate linkages. In some embodiments, each wing
independently comprises at least 14 natural phosphate linkages. In
some embodiments, each wing independently comprises at least 15
natural phosphate linkages. In some embodiments, each wing
independently comprises at least 16 natural phosphate linkages. In
some embodiments, each wing independently comprises at least 17
natural phosphate linkages. In some embodiments, each wing
independently comprises at least 18 natural phosphate linkages. In
some embodiments, each wing independently comprises at least 19
natural phosphate linkages. In some embodiments, each wing
independently comprises at least 20 natural phosphate linkages.
[0546] In some embodiments, each wing independently comprises one
natural phosphate linkage. In some embodiments, each wing
independently comprises two natural phosphate linkages. In some
embodiments, each wing independently comprises three natural
phosphate linkages. In some embodiments, each wing independently
comprises four natural phosphate linkages. In some embodiments,
each wing independently comprises five natural phosphate linkages.
In some embodiments, each wing independently comprises six natural
phosphate linkages. In some embodiments, each wing independently
comprises seven natural phosphate linkages. In some embodiments,
each wing independently comprises eight natural phosphate linkages.
In some embodiments, each wing independently comprises nine natural
phosphate linkages. In some embodiments, each wing independently
comprises ten natural phosphate linkages. In some embodiments, each
wing independently comprises 11 natural phosphate linkages. In some
embodiments, each wing independently comprises 12 natural phosphate
linkages. In some embodiments, each wing independently comprises 13
natural phosphate linkages. In some embodiments, each wing
independently comprises 14 natural phosphate linkages. In some
embodiments, each wing independently comprises 15 natural phosphate
linkages. In some embodiments, each wing independently comprises 16
natural phosphate linkages. In some embodiments, each wing
independently comprises 17 natural phosphate linkages. In some
embodiments, each wing independently comprises 18 natural phosphate
linkages. In some embodiments, each wing independently comprises 19
natural phosphate linkages. In some embodiments, each wing
independently comprises 20 natural phosphate linkages.
[0547] In some embodiments, each wing independently comprises at
least one consecutive natural phosphate linkage. In some
embodiments, each wing independently comprises at least two
consecutive natural phosphate linkages. In some embodiments, each
wing independently comprises at least three consecutive natural
phosphate linkages. In some embodiments, each wing independently
comprises at least four consecutive natural phosphate linkages. In
some embodiments, each wing independently comprises at least five
consecutive natural phosphate linkages. In some embodiments, each
wing independently comprises at least six consecutive natural
phosphate linkages. In some embodiments, each wing independently
comprises at least seven consecutive natural phosphate linkages. In
some embodiments, each wing independently comprises at least eight
consecutive natural phosphate linkages. In some embodiments, each
wing independently comprises at least nine consecutive natural
phosphate linkages. In some embodiments, each wing independently
comprises at least ten consecutive natural phosphate linkages. In
some embodiments, each wing independently comprises at least 11
consecutive natural phosphate linkages. In some embodiments, each
wing independently comprises at least 12 consecutive natural
phosphate linkages. In some embodiments, each wing independently
comprises at least 13 consecutive natural phosphate linkages. In
some embodiments, each wing independently comprises at least 14
consecutive natural phosphate linkages. In some embodiments, each
wing independently comprises at least 15 consecutive natural
phosphate linkages. In some embodiments, each wing independently
comprises at least 16 consecutive natural phosphate linkages. In
some embodiments, each wing independently comprises at least 17
consecutive natural phosphate linkages. In some embodiments, each
wing independently comprises at least 18 consecutive natural
phosphate linkages. In some embodiments, each wing independently
comprises at least 19 consecutive natural phosphate linkages. In
some embodiments, each wing independently comprises at least 20
consecutive natural phosphate linkages.
[0548] In some embodiments, each wing independently comprises one
consecutive natural phosphate linkage. In some embodiments, each
wing independently comprises two consecutive natural phosphate
linkages. In some embodiments, each wing independently comprises
three consecutive natural phosphate linkages. In some embodiments,
each wing independently comprises four consecutive natural
phosphate linkages. In some embodiments, each wing independently
comprises five consecutive natural phosphate linkages. In some
embodiments, each wing independently comprises six consecutive
natural phosphate linkages. In some embodiments, each wing
independently comprises seven consecutive natural phosphate
linkages. In some embodiments, each wing independently comprises
eight consecutive natural phosphate linkages. In some embodiments,
each wing independently comprises nine consecutive natural
phosphate linkages. In some embodiments, each wing independently
comprises ten consecutive natural phosphate linkages. In some
embodiments, each wing independently comprises 11 consecutive
natural phosphate linkages. In some embodiments, each wing
independently comprises 12 consecutive natural phosphate linkages.
In some embodiments, each wing independently comprises 13
consecutive natural phosphate linkages. In some embodiments, each
wing independently comprises 14 consecutive natural phosphate
linkages. In some embodiments, each wing independently comprises 15
consecutive natural phosphate linkages. In some embodiments, each
wing independently comprises 16 consecutive natural phosphate
linkages. In some embodiments, each wing independently comprises 17
consecutive natural phosphate linkages. In some embodiments, each
wing independently comprises 18 consecutive natural phosphate
linkages. In some embodiments, each wing independently comprises 19
consecutive natural phosphate linkages. In some embodiments, each
wing independently comprises 20 consecutive natural phosphate
linkages.
[0549] In some embodiments, a wing comprises only one chiral
internucleotidic linkage. In some embodiments, a 5'-end wing
comprises only one chiral internucleotidic linkage. In some
embodiments, a 5'-end wing comprises only one chiral
internucleotidic linkage at the 5'-end of the wing. In some
embodiments, a 5'-end wing comprises only one chiral
internucleotidic linkage at the 5'-end of the wing, and the chiral
internucleotidic linkage is Rp. In some embodiments, a 5'-end wing
comprises only one chiral internucleotidic linkage at the 5'-end of
the wing, and the chiral internucleotidic linkage is Sp. In some
embodiments, a 3'-end wing comprises only one chiral
internucleotidic linkage at the 3'-end of the wing. In some
embodiments, a 3'-end wing comprises only one chiral
internucleotidic linkage at the 3'-end of the wing, and the chiral
internucleotidic linkage is Rp. In some embodiments, a 3'-end wing
comprises only one chiral internucleotidic linkage at the 3'-end of
the wing, and the chiral internucleotidic linkage is Sp.
[0550] In some embodiments, a wing comprises two or more natural
phosphate linkages. In some embodiments, all phosphate linkages
within a wing are consecutive, and there are no non-phosphate
linkages between any two phosphate linkages within a wing.
[0551] In some embodiments, a linkage connecting a wing and a core
is considered part of the core when describing linkages, e.g.,
linkage chemistry, linkage stereochemistry, etc. For example, in
WV-1092, mG* SmGmCmAmC*SA* SA*SG*SG*SG*SC S
A*SC*RA*SG*SmAmCmUmU*SmC (SEQ ID NO: 15), the underlined linkages
may be considered as part of the core (bold), its 5'-wing (having
2'-OMe on sugar moieties) has one single Sp phosphorothioate
linkages at its 5'-end, its 3'-wing (having 2'-OMe on sugar
moieties) has one Sp phosphorothioate linkage at its 3'-end, and
its core has no 2'-modifications on sugar).
[0552] In some embodiments, a 5'-internucleotidic linkage connected
to a sugar moiety without a 2'-modification is a modified linkage.
In some embodiments, a 5'-internucleotidic linkage connected to a
sugar moiety without a 2'-modification is a linkage having the
structure of formula I. In some embodiments, a 5'-internucleotidic
linkage connected to a sugar moiety without a 2'-modification is
phosphorothioate linkage. In some embodiments, a
5'-internucleotidic linkage connected to a sugar moiety without a
2'-modification is a substituted phosphorothioate linkage. In some
embodiments, a 5'-internucleotidic linkage connected to a sugar
moiety without a 2'-modification is a phosphorothioate triester
linkage. In some embodiments, each 5'-internucleotidic linkage
connected to a sugar moiety without a 2'-modification is a modified
linkage. In some embodiments, each 5'-internucleotidic linkage
connected to a sugar moiety without a 2'-modification is a linkage
having the structure of formula I. In some embodiments, each
5'-internucleotidic linkage connected to a sugar moiety without a
2'-modification is phosphorothioate linkage. In some embodiments,
each 5'-internucleotidic linkage connected to a sugar moiety
without a 2'-modification is a substituted phosphorothioate
linkage. In some embodiments, each 5'-internucleotidic linkage
connected to a sugar moiety without a 2'-modification is a
phosphorothioate triester linkage.
[0553] In some embodiments, a 3'-internucleotidic linkage connected
to a sugar moiety without a 2'-modification is a modified linkage.
In some embodiments, a 3'-internucleotidic linkage connected to a
sugar moiety without a 2'-modification is a linkage having the
structure of formula I. In some embodiments, a 3'-internucleotidic
linkage connected to a sugar moiety without a 2'-modification is
phosphorothioate linkage. In some embodiments, a
3'-internucleotidic linkage connected to a sugar moiety without a
2'-modification is a substituted phosphorothioate linkage. In some
embodiments, a 3'-internucleotidic linkage connected to a sugar
moiety without a 2'-modification is a phosphorothioate triester
linkage. In some embodiments, each 3'-internucleotidic linkage
connected to a sugar moiety without a 2'-modification is a modified
linkage. In some embodiments, each 3'-internucleotidic linkage
connected to a sugar moiety without a 2'-modification is a linkage
having the structure of formula I. In some embodiments, each
3'-internucleotidic linkage connected to a sugar moiety without a
2'-modification is phosphorothioate linkage. In some embodiments,
each 3'-internucleotidic linkage connected to a sugar moiety
without a 2'-modification is a substituted phosphorothioate
linkage. In some embodiments, each 3'-internucleotidic linkage
connected to a sugar moiety without a 2'-modification is a
phosphorothioate triester linkage.
[0554] In some embodiments, both internucleotidic linkages
connected to a sugar moiety without a 2'-modification are modified
linkages. In some embodiments, both internucleotidic linkages
connected to a sugar moiety without a 2'-modification are linkage
having the structure of formula I. In some embodiments, both
internucleotidic linkages connected to a sugar moiety without a
2'-modification are phosphorothioate linkages. In some embodiments,
both internucleotidic linkages connected to a sugar moiety without
a 2'-modification are substituted phosphorothioate linkages. In
some embodiments, both internucleotidic linkages connected to a
sugar moiety without a 2'-modification are phosphorothioate
triester linkages. In some embodiments, each internucleotidic
linkage connected to a sugar moiety without a 2'-modification is a
modified linkage. In some embodiments, each internucleotidic
linkage connected to a sugar moiety without a 2'-modification is a
linkage having the structure of formula I. In some embodiments,
each internucleotidic linkage connected to a sugar moiety without a
2'-modification is phosphorothioate linkage. In some embodiments,
each internucleotidic linkage connected to a sugar moiety without a
2'-modification is a substituted phosphorothioate linkage. In some
embodiments, each internucleotidic linkage connected to a sugar
moiety without a 2'-modification is a phosphorothioate triester
linkage.
[0555] In some embodiments, a sugar moiety without a
2'-modification is a sugar moiety found in a natural DNA
nucleoside.
[0556] In some embodiments, for a wing-core-wing structure, the
5'-end wing comprises only one chiral internucleotidic linkage. In
some embodiments, for a wing-core-wing structure, the 5'-end wing
comprises only one chiral internucleotidic linkage at the 5'-end of
the wing. In some embodiments, for a wing-core-wing structure, the
3'-end wing comprises only one chiral internucleotidic linkage. In
some embodiments, for a wing-core-wing structure, the 3'-end wing
comprises only one chiral internucleotidic linkage at the 3'-end of
the wing. In some embodiments, for a wing-core-wing structure, each
wing comprises only one chiral internucleotidic linkage. In some
embodiments, for a wing-core-wing structure, each wing comprises
only one chiral internucleotidic linkage, wherein the 5'-end wing
comprises only one chiral internucleotidic linkage at its 5'-end;
and the 3'-end wing comprises only one chiral internucleotidic
linkage at its 3'-end. In some embodiments, the only chiral
internucleotidic linkage in the 5'-wing is Rp. In some embodiments,
the only chiral internucleotidic linkage in the 5'-wing is Sp. In
some embodiments, the only chiral internucleotidic linkage in the
3'-wing is Rp. In some embodiments, the only chiral
internucleotidic linkage in the 3'-wing is Sp. In some embodiments,
the only chiral internucleotidic linkage in both the 5'- and the
3'-wings are Sp. In some embodiments, the only chiral
internucleotidic linkage in both the 5'- and the 3'-wings are Rp.
In some embodiments, the only chiral internucleotidic linkage in
the 5'-wing is Sp, and the only chiral internucleotidic linkage in
the 3'-wing is Rp. In some embodiments, the only chiral
internucleotidic linkage in the 5'-wing is Rp, and the only chiral
internucleotidic linkage in the 3'-wing is Sp.
[0557] In some embodiments, a wing comprises two chiral
internucleotidic linkages. In some embodiments, a wing comprises
only two chiral internucleotidic linkages, and one or more natural
phosphate linkages. In some embodiments, a wing comprises only two
chiral internucleotidic linkages, and two or more natural phosphate
linkages. In some embodiments, a wing comprises only two chiral
internucleotidic linkages, and two or more consecutive natural
phosphate linkages. In some embodiments, a wing comprises only two
chiral internucleotidic linkages, and two consecutive natural
phosphate linkages. In some embodiments, a wing comprises only two
chiral internucleotidic linkages, and three consecutive natural
phosphate linkages. In some embodiments, a 5'-wing (to a core)
comprises only two chiral internucleotidic linkages, one at its
5'-end and the other at its 3'-end, with one or more natural
phosphate linkages in between. In some embodiments, a 5'-wing (to a
core) comprises only two chiral internucleotidic linkages, one at
its 5'-end and the other at its 3'-end, with two or more natural
phosphate linkages in between. In some embodiments, a 3'-wing (to a
core) comprises only two chiral internucleotidic linkages, one at
its 3'-end and the other at its 3'-end, with one or more natural
phosphate linkages in between. In some embodiments, a 3'-wing (to a
core) comprises only two chiral internucleotidic linkages, one at
its 3'-end and the other at its 3'-end, with two or more natural
phosphate linkages in between.
[0558] In some embodiments, a 5'-wing comprises only two chiral
internucleotidic linkages, one at its 5'-end and the other at its
3'-end, with one or more natural phosphate linkages in between, and
the 3'-wing comprise only one internucleotidic linkage at its
3'-end. In some embodiments, a 5'-wing (to a core) comprises only
two chiral internucleotidic linkages, one at its 5'-end and the
other at its 3'-end, with two or more natural phosphate linkages in
between, and the 3'-wing comprise only one internucleotidic linkage
at its 3'-end. In some embodiments, each chiral internucleotidic
linkage independently has its own stereochemistry. In some
embodiments, both chiral internucleotidic linkages in the 5'-wing
have the same stereochemistry. In some embodiments, both chiral
internucleotidic linkages in the 5'-wing have different
stereochemistry. In some embodiments, both chiral internucleotidic
linkages in the 5'-wing are Rp. In some embodiments, both chiral
internucleotidic linkages in the 5'-wing are Sp. In some
embodiments, chiral internucleotidic linkages in the 5'- and
3'-wings have the same stereochemistry. In some embodiments, chiral
internucleotidic linkages in the 5'- and 3'-wings are Rp. In some
embodiments, chiral internucleotidic linkages in the 5'- and
3'-wings are Sp. In some embodiments, chiral internucleotidic
linkages in the 5'- and 3'-wings have different
stereochemistry.
[0559] In some embodiments, a core region has a length of one or
more bases. In some embodiments, a core region has a length of two
or more bases. In some embodiments, a core region has a length of
three or more bases. In some embodiments, a core region has a
length of four or more bases. In some embodiments, a core region
has a length of five or more bases. In some embodiments, a core
region has a length of six or more bases. In some embodiments, a
core region has a length of seven or more bases. In some
embodiments, a core region has a length of eight or more bases. In
some embodiments, a core region has a length of nine or more bases.
In some embodiments, a core region has a length of ten or more
bases. In some embodiments, a core region has a length of 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 25, or more bases. In certain
embodiments, a core region has a length of 11 or more bases. In
certain embodiments, a core region has a length of 12 or more
bases. In certain embodiments, a core region has a length of 13 or
more bases. In certain embodiments, a core region has a length of
14 or more bases. In certain embodiments, a core region has a
length of 15 or more bases. In certain embodiments, a core region
has a length of 16 or more bases. In certain embodiments, a core
region has a length of 17 or more bases. In certain embodiments, a
core region has a length of 18 or more bases. In certain
embodiments, a core region has a length of 19 or more bases. In
certain embodiments, a core region has a length of 20 or more
bases. In certain embodiments, a core region has a length of more
than 20 bases. In certain embodiments, a core region has a length
of 2 bases. In certain embodiments, a core region has a length of 3
bases. In certain embodiments, a core region has a length of 4
bases. In certain embodiments, a core region has a length of 5
bases. In certain embodiments, a core region has a length of 6
bases. In certain embodiments, a core region has a length of 7
bases. In certain embodiments, a core region has a length of 8
bases. In certain embodiments, a core region has a length of 9
bases. In certain embodiments, a core region has a length of 10
bases. In certain embodiments, a core region has a length of 11
bases. In certain embodiments, a core region has a length of 12
bases. In certain embodiments, a core region has a length of 13
bases. In certain embodiments, a core region has a length of 14
bases. In certain embodiments, a core region has a length of 15
bases. In certain embodiments, a core region has a length of 16
bases. In certain embodiments, a core region has a length of 17
bases. In certain embodiments, a core region has a length of 18
bases. In certain embodiments, a core region has a length of 19
bases. In certain embodiments, a core region has a length of 20
bases.
[0560] In some embodiments, a core comprises one or more chiral
internucleotidic linkages. In some embodiments, a core comprises
one or more natural phosphate linkages. In some embodiments, a core
independently comprises one or more chiral internucleotidic
linkages and one or more natural phosphate linkages. In some
embodiments, a core comprises no phosphate linkages. In some
embodiments, each core linkage is a chiral internucleotidic
linkage.
[0561] In some embodiments, a core comprises at least one natural
phosphate linkage. In some embodiments, a core comprises at least
two chiral internucleotidic linkages. In some embodiments, a core
comprises at least three chiral internucleotidic linkages. In some
embodiments, a core comprises at least four chiral internucleotidic
linkages. In some embodiments, a core comprises at least five
chiral internucleotidic linkages. In some embodiments, a core
comprises at least six chiral internucleotidic linkages. In some
embodiments, a core comprises at least seven chiral
internucleotidic linkages. In some embodiments, a core comprises at
least eight chiral internucleotidic linkages. In some embodiments,
a core comprises at least nine chiral internucleotidic linkages. In
some embodiments, a core comprises at least ten chiral
internucleotidic linkages. In some embodiments, a core comprises at
least 11 chiral internucleotidic linkages. In some embodiments, a
core comprises at least 12 chiral internucleotidic linkages. In
some embodiments, a core comprises at least 13 chiral
internucleotidic linkages. In some embodiments, a core comprises at
least 14 chiral internucleotidic linkages. In some embodiments, a
core comprises at least 15 chiral internucleotidic linkages. In
some embodiments, a core comprises at least 16 chiral
internucleotidic linkages. In some embodiments, a core comprises at
least 17 chiral internucleotidic linkages. In some embodiments, a
core comprises at least 18 chiral internucleotidic linkages. In
some embodiments, a core comprises at least 19 chiral
internucleotidic linkages. In some embodiments, a core comprises at
least 20 chiral internucleotidic linkages.
[0562] In some embodiments, a core comprises one natural phosphate
linkage. In some embodiments, a core comprises two chiral
internucleotidic linkages. In some embodiments, a core comprises
three chiral internucleotidic linkages. In some embodiments, a core
comprises four chiral internucleotidic linkages. In some
embodiments, a core comprises five chiral internucleotidic
linkages. In some embodiments, a core comprises six chiral
internucleotidic linkages. In some embodiments, a core comprises
seven chiral internucleotidic linkages. In some embodiments, a core
comprises eight chiral internucleotidic linkages. In some
embodiments, a core comprises nine chiral internucleotidic
linkages. In some embodiments, a core comprises ten chiral
internucleotidic linkages. In some embodiments, a core comprises 11
chiral internucleotidic linkages. In some embodiments, a core
comprises 12 chiral internucleotidic linkages. In some embodiments,
a core comprises 13 chiral internucleotidic linkages. In some
embodiments, a core comprises 14 chiral internucleotidic linkages.
In some embodiments, a core comprises 15 chiral internucleotidic
linkages. In some embodiments, a core comprises 16 chiral
internucleotidic linkages. In some embodiments, a core comprises 17
chiral internucleotidic linkages. In some embodiments, a core
comprises 18 chiral internucleotidic linkages. In some embodiments,
a core comprises 19 chiral internucleotidic linkages. In some
embodiments, a core comprises 20 chiral internucleotidic
linkages.
[0563] In some embodiments, a core region has a pattern of backbone
chiral centers comprising (Sp).sub.m(Rp).sub.n,
(Rp).sub.n(Sp).sub.m, (Np).sub.t(Rp).sub.n(Sp).sub.m, or
(Sp).sub.t(Rp).sub.n(Sp).sub.m, wherein each of m, n, t and Np is
independently as defined and described in the present disclosure.
In some embodiments, a core region has a pattern of backbone chiral
centers comprising (Sp).sub.m(Rp).sub.n, (Rp).sub.n(Sp).sub.m,
(Np).sub.t(Rp).sub.n(Sp).sub.m, or (Sp).sub.t(Rp).sub.n(Sp).sub.m.
In some embodiments, a core region has a pattern of backbone chiral
centers comprising (Sp).sub.m(Rp).sub.n. In some embodiments, a
core region has a pattern of backbone chiral centers comprising
(Sp).sub.m(Rp).sub.n, wherein m>2 and n is 1. In some
embodiments, a core region has a pattern of backbone chiral centers
comprising (Rp).sub.n(Sp).sub.m. In some embodiments, a core region
has a pattern of backbone chiral centers comprising
(Rp).sub.n(Sp).sub.m, wherein m>2 and n is 1. In some
embodiments, a core region has a pattern of backbone chiral centers
comprising (Np).sub.t(Rp).sub.n(Sp).sub.m. In some embodiments, a
core region has a pattern of backbone chiral centers comprising
(Np).sub.t(Rp).sub.n(Sp).sub.m, wherein m>2 and n is 1. In some
embodiments, a core region has a pattern of backbone chiral centers
comprising (Np).sub.t(Rp).sub.n(Sp).sub.m, wherein t>2, m>2
and n is 1. In some embodiments, a core region has a pattern of
backbone chiral centers comprising (Sp).sub.t(Rp).sub.n(Sp).sub.m.
In some embodiments, a core region has a pattern of backbone chiral
centers comprising (Sp).sub.t(Rp).sub.n(Sp).sub.m, wherein m>2
and n is 1. In some embodiments, a core region has a pattern of
backbone chiral centers comprising (Sp).sub.t(Rp).sub.n(Sp).sub.m,
wherein t>2, m>2 and n is 1. Among other things, the present
disclosure demonstrates that, in some embodiments, such patterns
can provide and/or enhance controlled cleavage, improved cleavage
rate, selectivity, etc., of a target sequence, e.g., an RNA
sequence. Example patterns of backbone chiral centers are described
in the present disclosure.
[0564] In some embodiments, at least 60% of the chiral
internucleotidic linkages in the core region are Sp. In some
embodiments, at least 65% of the chiral internucleotidic linkages
in the core region are Sp. In some embodiments, at least 66% of the
chiral internucleotidic linkages in the core region are Sp. In some
embodiments, at least 67% of the chiral internucleotidic linkages
in the core region are Sp. In some embodiments, at least 70% of the
chiral internucleotidic linkages in the core region are Sp. In some
embodiments, at least 75% of the chiral internucleotidic linkages
in the core region are Sp. In some embodiments, at least 80% of the
chiral internucleotidic linkages in the core region are Sp. In some
embodiments, at least 85% of the chiral internucleotidic linkages
in the core region are Sp. In some embodiments, at least 90% of the
chiral internucleotidic linkages in the core region are Sp. In some
embodiments, at least 95% of the chiral internucleotidic linkages
in the core region are Sp.
[0565] In some embodiments, a wing-core-wing (i.e., X--Y--X) motif
is represented numerically as, e.g., 5-10-4, meaning the wing to
the 5'-end of the core is 5 bases in length, the core region is 10
bases in length, and the wing region to the 3'-end of the core is
4-bases in length. In some embodiments, a wing-core-wing motif is
any of, e.g. 2-16-2, 3-14-3, 4-12-4, 5-10-5, 2-9-6, 3-9-3, 3-9-4,
3-9-5, 4-7-4, 4-9-3, 4-9-4, 4-9-5, 4-10-5, 4-11-4, 4-11-5, 5- 7-5,
5-8-6, 8-7-5, 7-7-6, 5-9-3, 5-9-5, 5-10-4, 5-10-5, 6-7-6, 6-8-5,
and 6-9-2, etc. In certain embodiments, a wing-core-wing motif is
5-10-5. In certain embodiments, a wing-core-wing motif is 7-7-6. In
certain embodiments, a wing-core-wing motif is 8-7-5.
[0566] In some embodiments, a wing-core motif is 5-15, 6-14, 7-13,
8-12, 9-12, etc. In some embodiments, a core-wing motif is 5-15,
6-14, 7-13, 8-12, 9-12, etc.
[0567] In some embodiments, the internucleosidic linkages of
provided oligonucleotides of such wing-core-wing (i.e., X--Y--X)
motifs are all chiral, modified phosphate linkages. In some
embodiments, the internucleosidic linkages of provided
oligonucleotides of such wing-core-wing (i.e., X--Y--X) motifs are
all chiral phosphorothioate internucleotidic linkages. In some
embodiments, chiral internucleotidic linkages of provided
oligonucleotides of such wing-core-wing motifs are at least about
10, 20, 30, 40, 50, 50, 70, 80, or 90% chiral, modified phosphate
internucleotidic linkages. In some embodiments, chiral
internucleotidic linkages of provided oligonucleotides of such
wing-core-wing motifs are at least about 10, 20, 30, 40, 50, 60,
70, 80, or 90% chiral phosphorothioate internucleotidic linkages.
In some embodiments, chiral internucleotidic linkages of provided
oligonucleotides of such wing-core-wing motifs are at least about
10, 20, 30, 40, 50, 50, 70, 80, or 90% chiral phosphorothioate
internucleotidic linkages of the Sp conformation.
[0568] In some embodiments, each wing region of a wing-core-wing
motif optionally contains chiral, modified phosphate
internucleotidic linkages. In some embodiments, each wing region of
a wing-core-wing motif optionally contains chiral phosphorothioate
internucleotidic linkages. In some embodiments, each wing region of
a wing-core-wing motif contains chiral phosphorothioate
internucleotidic linkages. In some embodiments, the two wing
regions of a wing-core-wing motif have the same internucleotidic
linkage stereochemistry. In some embodiments, the two wing regions
have different internucleotidic linkage stereochemistry. In some
embodiments, each internucleotidic linkage in the wings is
independently a chiral internucleotidic linkage.
[0569] In some embodiments, the core region of a wing-core-wing
motif optionally contains chiral, modified phosphate
internucleotidic linkages. In some embodiments, the core region of
a wing-core-wing motif optionally contains chiral phosphorothioate
internucleotidic linkages. In some embodiments, the core region of
a wing-core-wing motif comprises a repeating pattern of
internucleotidic linkage stereochemistry. In some embodiments, the
core region of a wing-core-wing motif has a repeating pattern of
internucleotidic linkage stereochemistry. In some embodiments, the
core region of a wing-core-wing motif comprises repeating pattern
of internucleotidic linkage stereochemistry, wherein the repeating
pattern is (Sp).sub.mRp or Rp(Sp).sub.m, wherein m is 1-50. In some
embodiments, the core region of a wing-core-wing motif comprises
repeating pattern of internucleotidic linkage stereochemistry,
wherein the repeating pattern is (Sp).sub.mRp or Rp(Sp).sub.m,
wherein m is 1-50. In some embodiments, the core region of a
wing-core-wing motif comprises repeating pattern of
internucleotidic linkage stereochemistry, wherein the repeating
pattern is (Sp).sub.mRp, wherein m is 1-50. In some embodiments,
the core region of a wing-core-wing motif comprises repeating
pattern of internucleotidic linkage stereochemistry, wherein the
repeating pattern is Rp(Sp).sub.m, wherein m is 1-50. In some
embodiments, the core region of a wing-core-wing motif has
repeating pattern of internucleotidic linkage stereochemistry,
wherein the repeating pattern is (Sp).sub.mRp or Rp(Sp).sub.m,
wherein m is 1-50. In some embodiments, the core region of a
wing-core-wing motif has repeating pattern of internucleotidic
linkage stereochemistry, wherein the repeating pattern is
(Sp).sub.mRp, wherein m is 1-50. In some embodiments, the core
region of a wing-core-wing motif has repeating pattern of
internucleotidic linkage stereochemistry, wherein the repeating
pattern is Rp(Sp).sub.m, wherein m is 1-50. In some embodiments,
the core region of a wing-core-wing motif has repeating pattern of
internucleotidic linkage stereochemistry, wherein the repeating
pattern is a motif comprising at least 33% of internucleotidic
linkage in the S conformation. In some embodiments, the core region
of a wing-core-wing motif has repeating pattern of internucleotidic
linkage stereochemistry, wherein the repeating pattern is a motif
comprising at least 50% of internucleotidic linkage in the S
conformation. In some embodiments, the core region of a
wing-core-wing motif has repeating pattern of internucleotidic
linkage stereochemistry, wherein the repeating pattern is a motif
comprising at least 66% of internucleotidic linkage in the S
conformation. In some embodiments, the core region of a
wing-core-wing motif has repeating pattern of internucleotidic
linkage stereochemistry, wherein the repeating pattern is a
repeating triplet motif selected from RpRpSp and SpSpRp. In some
embodiments, the core region of a wing-core-wing motif has
repeating pattern of internucleotidic linkage stereochemistry,
wherein the repeating pattern is a repeating RpRpSp. In some
embodiments, the core region of a wing-core-wing motif has
repeating pattern of internucleotidic linkage stereochemistry,
wherein the repeating pattern is a repeating SpSpRp.
[0570] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide composition of an
oligonucleotide type whose pattern of backbone chiral centers in
the core region comprises (Sp).sub.mRp or Rp(Sp).sub.m. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide composition of an oligonucleotide type whose
pattern of backbone chiral centers in the core region comprises
Rp(Sp).sub.m. In some embodiments, the present disclosure provides
a chirally controlled oligonucleotide composition of an
oligonucleotide type whose pattern of backbone chiral centers in
the core region comprises (Sp).sub.mRp. In some embodiments, m is
2. In some embodiments, the present disclosure provides a chirally
controlled oligonucleotide composition of an oligonucleotide type
whose pattern of backbone chiral centers in the core region
comprises Rp(Sp).sub.2. In some embodiments, the present disclosure
provides a chirally controlled oligonucleotide composition of an
oligonucleotide type whose pattern of backbone chiral centers in
the core region comprises (Sp).sub.2Rp(Sp).sub.2. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide composition of an oligonucleotide type whose
pattern of backbone chiral centers in the core region comprises
(Rp).sub.2Rp(Sp).sub.2. In some embodiments, the present disclosure
provides a chirally controlled oligonucleotide composition of an
oligonucleotide type whose pattern of backbone chiral centers in
the core region comprises RpSpRp(Sp).sub.2. In some embodiments,
the present disclosure provides a chirally controlled
oligonucleotide composition of an oligonucleotide type whose
pattern of backbone chiral centers in the core region comprises
SpRpRp(Sp).sub.2. In some embodiments, the present disclosure
provides a chirally controlled oligonucleotide composition of an
oligonucleotide type whose pattern of backbone chiral centers in
the core region comprises (Sp).sub.2Rp.
[0571] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide composition of an
oligonucleotide type whose pattern of backbone chiral centers
comprises (Sp).sub.mRp or Rp(Sp).sub.m. In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
composition of an oligonucleotide type whose pattern of backbone
chiral centers comprises Rp(Sp).sub.m. In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
composition of an oligonucleotide type whose pattern of backbone
chiral centers comprises (Sp).sub.mRp. In some embodiments, m is 2.
In some embodiments, the present disclosure provides a chirally
controlled oligonucleotide composition of an oligonucleotide type
whose pattern of backbone chiral centers comprises Rp(Sp).sub.2. In
some embodiments, the present disclosure provides a chirally
controlled oligonucleotide composition of an oligonucleotide type
whose pattern of backbone chiral centers comprises
(Sp).sub.2Rp(Sp).sub.2. In some embodiments, the present disclosure
provides a chirally controlled oligonucleotide composition of an
oligonucleotide type whose pattern of backbone chiral centers
comprises (Rp).sub.2Rp(Sp).sub.2. In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide
composition of an oligonucleotide type whose pattern of backbone
chiral centers comprises RpSpRp(Sp).sub.2. In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
composition of an oligonucleotide type whose pattern of backbone
chiral centers comprises SpRpRp(Sp).sub.2. In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
composition of an oligonucleotide type whose pattern of backbone
chiral centers comprises (Sp).sub.2Rp.
[0572] As defined herein, m is 1-50. In some embodiments, m is 1.
In some embodiments, m is 2-50. In some embodiments, m is 2, 3, 4,
5, 6, 7 or 8. In some embodiments, m is 3, 4, 5, 6, 7 or 8. In some
embodiments, m is 4, 5, 6, 7 or 8. In some embodiments, m is 5, 6,
7 or 8. In some embodiments, m is 6, 7 or 8. In some embodiments, m
is 7 or 8. In some embodiments, m is 2. In some embodiments, m is
3. In some embodiments, m is 4. In some embodiments, m is 5. In
some embodiments, m is 6. In some embodiments, m is 7. In some
embodiments, m is 8. In some embodiments, m is 9. In some
embodiments, m is 10. In some embodiments, m is 11. In some
embodiments, m is 12. In some embodiments, m is 13. In some
embodiments, m is 14. In some embodiments, m is 15. In some
embodiments, m is 16. In some embodiments, m is 17. In some
embodiments, m is 18. In some embodiments, m is 19. In some
embodiments, m is 20. In some embodiments, m is 21. In some
embodiments, m is 22. In some embodiments, m is 23. In some
embodiments, m is 24. In some embodiments, m is 25. In some
embodiments, m is greater than 25.
[0573] In some embodiments, a repeating pattern is
(Sp).sub.m(Rp).sub.n, wherein n is 1-10, and m is independently as
defined above and described herein. In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
composition of an oligonucleotide type whose pattern of backbone
chiral centers comprises (Sp).sub.m(Rp).sub.n. In some embodiments,
the present disclosure provides a chirally controlled
oligonucleotide composition of an oligonucleotide type whose
pattern of backbone chiral centers in the core region comprises
(Sp).sub.m(Rp).sub.n. In some embodiments, a repeating pattern is
(Rp).sub.n(Sp).sub.m, wherein n is 1-10, and m is independently as
defined above and described herein. In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
composition of an oligonucleotide type whose pattern of backbone
chiral centers comprises (Rp).sub.n(Sp).sub.m. In some embodiments,
the present disclosure provides a chirally controlled
oligonucleotide composition of an oligonucleotide type whose
pattern of backbone chiral centers in the core region comprises
(Rp).sub.n(Sp).sub.m. In some embodiments, (Rp).sub.n(Sp).sub.m is
(Rp)(Sp).sub.2. In some embodiments, (Sp).sub.n(Rp).sub.m is
(Sp).sub.2(Rp).
[0574] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide composition of an
oligonucleotide type whose pattern of backbone chiral centers
comprises (Sp).sub.m(Rp).sub.n(Sp).sub.t. In some embodiments, a
repeating pattern is (Sp).sub.m(Rp).sub.n(Sp).sub.t, wherein n is
1-10, t is 1-50, and m is as defined above and described herein. In
some embodiments, the present disclosure provides a chirally
controlled oligonucleotide composition of an oligonucleotide type
whose pattern of backbone chiral centers in the core region
comprises (Sp).sub.m(Rp).sub.n(Sp).sub.t. In some embodiments, a
repeating pattern is (Sp).sub.t(Rp).sub.n(Sp).sub.m, wherein n is
1-10, t is 1-50, and m is as defined above and described herein. In
some embodiments, the present disclosure provides a chirally
controlled oligonucleotide composition of an oligonucleotide type
whose pattern of backbone chiral centers comprises
(Sp).sub.t(Rp).sub.n(Sp).sub.m. In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide
composition of an oligonucleotide type whose pattern of backbone
chiral centers in the core region comprises
(Sp).sub.t(Rp).sub.n(Sp).sub.m.
[0575] In some embodiments, a repeating pattern is
(Np).sub.t(Rp).sub.n(Sp).sub.m, wherein n is 1-10, t is 1-50, Np is
independently Rp or Sp, and m is as defined above and described
herein. In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide composition of an
oligonucleotide type whose pattern of backbone chiral centers
comprises (Np).sub.t(Rp).sub.n(Sp).sub.m. In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
composition of an oligonucleotide type whose pattern of backbone
chiral centers in the core region comprises
(Np).sub.t(Rp).sub.n(Sp).sub.m. In some embodiments, a repeating
pattern is (Np).sub.m(Rp).sub.n(Sp).sub.t, wherein n is 1-10, t is
1-50, Np is independently Rp or Sp, and m is as defined above and
described herein. In some embodiments, the present disclosure
provides a chirally controlled oligonucleotide composition of an
oligonucleotide type whose pattern of backbone chiral centers
comprises (Np).sub.m(Rp).sub.n(Sp).sub.t. In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
composition of an oligonucleotide type whose pattern of backbone
chiral centers in the core region comprises
(Np).sub.m(Rp).sub.n(Sp).sub.t. In some embodiments, Np is Rp. In
some embodiments, Np is Sp. In some embodiments, all Np are the
same. In some embodiments, all Np are Sp. In some embodiments, at
least one Np is different from the other Np. In some embodiments, t
is 2.
[0576] As defined herein, n is 1-10. In some embodiments, n is 1,
2, 3, 4, 5, 6, 7 or 8. In some embodiments, n is 1. In some
embodiments, n is 2, 3, 4, 5, 6, 7 or 8. In some embodiments, n is
3, 4, 5, 6, 7 or 8. In some embodiments, n is 4, 5, 6, 7 or 8. In
some embodiments, n is 5, 6, 7 or 8. In some embodiments, n is 6, 7
or 8. In some embodiments, n is 7 or 8. In some embodiments, n is
1. In some embodiments, n is 2. In some embodiments, n is 3. In
some embodiments, n is 4. In some embodiments, n is 5. In some
embodiments, n is 6. In some embodiments, n is 7. In some
embodiments, n is 8. In some embodiments, n is 9. In some
embodiments, n is 10.
[0577] As defined herein, t is 1-50. In some embodiments, t is 1.
In some embodiments, t is 2-50. In some embodiments, t is 2, 3, 4,
5, 6, 7 or 8. In some embodiments, t is 3, 4, 5, 6, 7 or 8. In some
embodiments, t is 4, 5, 6, 7 or 8. In some embodiments, t is 5, 6,
7 or 8. In some embodiments, t is 6, 7 or 8. In some embodiments, t
is 7 or 8. In some embodiments, t is 2. In some embodiments, t is
3. In some embodiments, t is 4. In some embodiments, t is 5. In
some embodiments, t is 6. In some embodiments, t is 7. In some
embodiments, t is 8. In some embodiments, t is 9. In some
embodiments, t is 10. In some embodiments, t is 11. In some
embodiments, t is 12. In some embodiments, t is 13. In some
embodiments, t is 14. In some embodiments, t is 15. In some
embodiments, t is 16. In some embodiments, t is 17. In some
embodiments, t is 18. In some embodiments, t is 19. In some
embodiments, t is 20. In some embodiments, t is 21. In some
embodiments, t is 22. In some embodiments, t is 23. In some
embodiments, t is 24. In some embodiments, t is 25. In some
embodiments, t is greater than 25.
[0578] In some embodiments, at least one of m and t is greater than
2. In some embodiments, at least one of m and t is greater than 3.
In some embodiments, at least one of m and t is greater than 4. In
some embodiments, at least one of m and t is greater than 5. In
some embodiments, at least one of m and t is greater than 6. In
some embodiments, at least one of m and t is greater than 7. In
some embodiments, at least one of m and t is greater than 8. In
some embodiments, at least one of m and t is greater than 9. In
some embodiments, at least one of m and t is greater than 10. In
some embodiments, at least one of m and t is greater than 11. In
some embodiments, at least one of m and t is greater than 12. In
some embodiments, at least one of m and t is greater than 13. In
some embodiments, at least one of m and t is greater than 14. In
some embodiments, at least one of m and t is greater than 15. In
some embodiments, at least one of m and t is greater than 16. In
some embodiments, at least one of m and t is greater than 17. In
some embodiments, at least one of m and t is greater than 18. In
some embodiments, at least one of m and t is greater than 19. In
some embodiments, at least one of m and t is greater than 20. In
some embodiments, at least one of m and t is greater than 21. In
some embodiments, at least one of m and t is greater than 22. In
some embodiments, at least one of m and t is greater than 23. In
some embodiments, at least one of m and t is greater than 24. In
some embodiments, at least one of m and t is greater than 25.
[0579] In some embodiments, each one of m and t is greater than 2.
In some embodiments, each one of m and t is greater than 3. In some
embodiments, each one of m and t is greater than 4. In some
embodiments, each one of m and t is greater than 5. In some
embodiments, each one of m and t is greater than 6. In some
embodiments, each one of m and t is greater than 7. In some
embodiments, each one of m and t is greater than 8. In some
embodiments, each one of m and t is greater than 9. In some
embodiments, each one of m and t is greater than 10. In some
embodiments, each one of m and t is greater than 11. In some
embodiments, each one of m and t is greater than 12. In some
embodiments, each one of m and t is greater than 13. In some
embodiments, each one of m and t is greater than 14. In some
embodiments, each one of m and t is greater than 15. In some
embodiments, each one of m and t is greater than 16. In some
embodiments, each one of m and t is greater than 17. In some
embodiments, each one of m and t is greater than 18. In some
embodiments, each one of m and t is greater than 19. In some
embodiments, each one of m and t is greater than 20.
[0580] In some embodiments, the sum of m and t is greater than 3.
In some embodiments, the sum of m and t is greater than 4. In some
embodiments, the sum of m and t is greater than 5. In some
embodiments, the sum of m and t is greater than 6. In some
embodiments, the sum of m and t is greater than 7. In some
embodiments, the sum of m and t is greater than 8. In some
embodiments, the sum of m and t is greater than 9. In some
embodiments, the sum of m and t is greater than 10. In some
embodiments, the sum of m and t is greater than 11. In some
embodiments, the sum of m and t is greater than 12. In some
embodiments, the sum of m and t is greater than 13. In some
embodiments, the sum of m and t is greater than 14. In some
embodiments, the sum of m and t is greater than 15. In some
embodiments, the sum of m and t is greater than 16. In some
embodiments, the sum of m and t is greater than 17. In some
embodiments, the sum of m and t is greater than 18. In some
embodiments, the sum of m and t is greater than 19. In some
embodiments, the sum of m and t is greater than 20. In some
embodiments, the sum of m and t is greater than 21. In some
embodiments, the sum of m and t is greater than 22. In some
embodiments, the sum of m and t is greater than 23. In some
embodiments, the sum of m and t is greater than 24. In some
embodiments, the sum of m and t is greater than 25.
[0581] In some embodiments, n is 1, and at least one of m and t is
greater than 1. In some embodiments, n is 1 and each of m and t is
independently greater than 1. In some embodiments, m>n and
t>n. In some embodiments, (Sp).sub.m(Rp).sub.n(Sp).sub.t is
(Sp).sub.2Rp(Sp).sub.2. In some embodiments,
(Sp).sub.t(Rp).sub.n(Sp).sub.m is (Sp).sub.2Rp(Sp).sub.2. In some
embodiments, (Sp).sub.t(Rp).sub.n(Sp).sub.m is SpRp(Sp).sub.2. In
some embodiments, (Np).sub.t(Rp).sub.n(Sp).sub.m is
(Np).sub.tRp(Sp).sub.m. In some embodiments,
(Np).sub.t(Rp).sub.n(Sp).sub.m is (Np).sub.2Rp(Sp).sub.m. In some
embodiments, (Np).sub.t(Rp).sub.n(Sp).sub.m is
(Rp).sub.2Rp(Sp).sub.m. In some embodiments,
(Np).sub.t(Rp).sub.n(Sp).sub.m is (Sp).sub.2Rp(Sp).sub.m. In some
embodiments, (Np).sub.t(Rp).sub.n(Sp).sub.m is RpSpRp(Sp).sub.m. In
some embodiments, (Np).sub.t(Rp).sub.n(Sp).sub.m is
SpRpRp(Sp).sub.m.
[0582] In some embodiments, (Sp).sub.t(Rp).sub.n(Sp).sub.m is
SpRpSpSp. In some embodiments, (Sp).sub.t(Rp).sub.n(Sp).sub.m is
(Sp).sub.2Rp(Sp).sub.2. In some embodiments,
(Sp).sub.t(Rp).sub.n(Sp).sub.m is (Sp).sub.3Rp(Sp).sub.3. In some
embodiments, (Sp).sub.t(Rp).sub.n(Sp).sub.m is
(Sp).sub.4Rp(Sp).sub.4. In some embodiments,
(Sp).sub.t(Rp).sub.n(Sp).sub.m is (Sp).sub.tRp(Sp).sub.5. In some
embodiments, (Sp).sub.t(Rp).sub.n(Sp).sub.m is SpRp(Sp).sub.5. In
some embodiments, (Sp).sub.t(Rp).sub.n(Sp).sub.m is
(Sp).sub.2Rp(Sp).sub.5. In some embodiments,
(Sp).sub.t(Rp).sub.n(Sp).sub.m is (Sp).sub.3Rp(Sp).sub.5. In some
embodiments, (Sp).sub.t(Rp).sub.n(Sp).sub.m is
(Sp).sub.4Rp(Sp).sub.5. In some embodiments,
(Sp).sub.t(Rp).sub.n(Sp).sub.m is (Sp).sub.5Rp(Sp).sub.5.
[0583] In some embodiments, (Sp).sub.m(Rp).sub.n(Sp).sub.t is
(Sp).sub.2Rp(Sp).sub.2. In some embodiments,
(Sp).sub.m(Rp).sub.n(Sp).sub.t is (Sp).sub.3Rp(Sp).sub.3. In some
embodiments, (Sp).sub.m(Rp).sub.n(Sp).sub.t is
(Sp).sub.4Rp(Sp).sub.4. In some embodiments,
(Sp).sub.m(Rp).sub.n(Sp).sub.t is (Sp).sub.mRp(Sp).sub.5. In some
embodiments, (Sp).sub.m(Rp).sub.n(Sp).sub.t is
(Sp).sub.2Rp(Sp).sub.5. In some embodiments,
(Sp).sub.m(Rp).sub.n(Sp).sub.t is (Sp).sub.3Rp(Sp).sub.5. In some
embodiments, (Sp).sub.m(Rp).sub.n(Sp).sub.t is
(Sp).sub.4Rp(Sp).sub.5. In some embodiments,
(Sp).sub.m(Rp).sub.n(Sp).sub.t is (Sp).sub.5Rp(Sp).sub.5.
[0584] In some embodiments, the core region comprises at least one
Rp internucleotidic linkage. In some embodiments, the core region
of a wing-core-wing motif comprises at least one Rp
internucleotidic linkage. In some embodiments, a core region
comprises at least one Rp phosphorothioate internucleotidic
linkage. In some embodiments, the core region of a wing-core-wing
motif comprises at least one Rp phosphorothioate internucleotidic
linkage. In some embodiments, the core region of a wing-core-wing
motif comprises only one Rp phosphorothioate internucleotidic
linkage. In some embodiments, a core region motif comprises at
least two Rp internucleotidic linkages. In some embodiments, the
core region of a wing-core-wing motif comprises at least two Rp
internucleotidic linkages. In some embodiments, the core region of
a wing-core-wing motif comprises at least two Rp phosphorothioate
internucleotidic linkages. In some embodiments, a core region
comprises at least three Rp internucleotidic linkages. In some
embodiments, the core region of a wing-core-wing motif comprises at
least three Rp internucleotidic linkages. In some embodiments, the
core region comprises at least three Rp phosphorothioate
internucleotidic linkages. In some embodiments, the core region of
a wing-core-wing motif comprises at least three Rp phosphorothioate
internucleotidic linkages. In some embodiments, a core region
comprises at least 4, 5, 6, 7, 8, 9, or 10 Rp internucleotidic
linkages. In some embodiments, the core region of a wing-core-wing
motif comprises at least 4, 5, 6, 7, 8, 9, or 10 Rp
internucleotidic linkages. In some embodiments, a core region
comprises at least 4, 5, 6, 7, 8, 9, or 10 Rp phosphorothioate
internucleotidic linkages. In some embodiments, the core region of
a wing-core-wing motif comprises at least 4, 5, 6, 7, 8, 9, or 10
Rp phosphorothioate internucleotidic linkages.
[0585] In certain embodiments, a wing-core-wing motif is a 5-10-5
motif wherein the residues at each wing region are 2'-modified
residues. In certain embodiments, a wing-core-wing motif is a
5-10-5 motif wherein the residues at each wing region are
2'-OR-modified residues. In certain embodiments, a wing-core-wing
motif is a 5-10-5 motif wherein the residues at each wing region
are 2'-MOE-modified residues. In certain embodiments, a
wing-core-wing motif is a 5-10-5 motif wherein the residues at each
wing region are 2'-OMe-modified residues. In certain embodiments, a
wing-core-wing motif is a 5-10-5 motif wherein the residues in the
core region are 2'-deoxyribonucleoside residues. In certain
embodiments, a wing-core-wing motif is a 5-10-5 motif, wherein all
internucleotidic linkages are phosphorothioate linkages. In certain
embodiments, a wing-core-wing motif is a 5-10-5 motif, wherein all
internucleotidic linkages are chiral phosphorothioate linkages. In
certain embodiments, a wing-core-wing motif is a 5-10-5 motif
wherein the residues at each wing region are 2'-modified residues,
the residues in the core region are 2'-deoxyribonucleoside
residues, and all internucleotidic linkages in the core region are
chiral phosphorothioate linkages. In certain embodiments, a
wing-core-wing motif is a 5-10-5 motif wherein the residues at each
wing region are 2'-OR-modified residues, the residues in the core
region are 2'-deoxyribonucleoside residues, and all
internucleotidic linkages in the core region are chiral
phosphorothioate linkages. In certain embodiments, a wing-core-wing
motif is a 5-10-5 motif wherein the residues at each wing region
are 2'-MOE-modified residues, the residues in the core region are
2'-deoxyribonucleoside residues, and all internucleotidic linkages
in the core region are chiral phosphorothioate linkages. In certain
embodiments, a wing-core-wing motif is a 5-10-5 motif wherein the
residues at each wing region are 2'-OMe-modified residues, the
residues in the core region are 2'-deoxyribonucleoside residues,
and all internucleotidic linkages in the core region are chiral
phosphorothioate linkages.
[0586] In some embodiments, residues at the "X" wing region are not
2'-MOE-modified residues. In certain embodiments, a wing-core motif
is a motif wherein the residues at the "X" wing region are not
2'-MOE-modified residues. In certain embodiments, a core-wing motif
is a motif wherein the residues at the "X" wing region are not
2'-MOE-modified residues. In certain embodiments, a wing-core-wing
motif is a motif wherein the residues at each "X" wing region are
not 2'-MOE-modified residues. In certain embodiments, a
wing-core-wing motif is a 5-10-5 motif wherein the residues at each
"X" wing region are not 2'-MOE-modified residues. In certain
embodiments, a wing-core-wing motif is a 5-10-5 motif wherein the
residues in the core "Y" region are 2'-deoxyribonucleoside
residues. In certain embodiments, a wing-core-wing motif is a
5-10-5 motif, wherein all internucleotidic linkages are
phosphorothioate internucleotidic linkages. In certain embodiments,
a wing-core-wing motif is a 5-10-5 motif, wherein all
internucleotidic linkages are chiral phosphorothioate
internucleotidic linkages. In certain embodiments, a wing-core-wing
motif is a 5-10-5 motif wherein the residues at each "X" wing
region are not 2'-MOE-modified residues, the residues in the core
"Y" region are 2'-deoxyribonucleoside, and all internucleotidic
linkages are chiral phosphorothioate internucleotidic linkages.
[0587] As understood by a person having ordinary skill in the art,
provided oligonucleotides and compositions, among other things, can
target a great number of nucleic acid polymers. For instance, in
some embodiments, provided oligonucleotides and compositions may
target a transcript of a nucleic acid sequence, wherein a common
base sequence of oligonucleotides (e.g., a base sequence of an
oligonucleotide type) comprises or is a sequence complementary to a
sequence of the transcript. In some embodiments, a common base
sequence comprises a sequence complimentary to a sequence of a
target. In some embodiments, a common base sequence is a sequence
complimentary to a sequence of a target. In some embodiments, a
common base sequence comprises or is a sequence 100% complimentary
to a sequence of a target. In some embodiments, a common base
sequence comprises a sequence 100% complimentary to a sequence of a
target. In some embodiments, a common base sequence is a sequence
100% complimentary to a sequence of a target. In some embodiments,
a common base sequence in a core comprises or is a sequence
complimentary to a sequence of a target. In some embodiments, a
common base sequence in a core comprises a sequence complimentary
to a sequence of a target. In some embodiments, a common base
sequence in a core is a sequence % complimentary to a sequence of a
target. In some embodiments, a common base sequence in a core
comprises or is a sequence 100% complimentary to a sequence of a
target. In some embodiments, a common base sequence in a core
comprises a sequence 100% complimentary to a sequence of a target.
In some embodiments, a common base sequence in a core is a sequence
100% complimentary to a sequence of a target.
[0588] In some embodiments, as described in this disclosure,
provided oligonucleotides and compositions may provide new cleavage
patterns, higher cleavage rate, higher cleavage degree, higher
cleavage selectivity, etc. In some embodiments, provided
compositions can selectively suppress (e.g., cleave) a transcript
from a target nucleic acid sequence which has one or more similar
sequences exist within a subject or a population, each of the
target and its similar sequences contains a specific nucleotidic
characteristic sequence element that defines the target sequence
relative to the similar sequences. In some embodiments, for
example, a target sequence is a wild-type allele or copy of a gene,
and a similar sequence is a sequence has very similar base
sequence, e.g., a sequence having SNP, mutations, etc.; In some
embodiments, a characteristic sequence element defines that target
sequence relative to the similar sequence: for example, when a
target sequence is a Huntington's disease-associated allele with T
at rs362307 (U in the corresponding RNA; C for the
non-disease-associated allele), a characteristic sequence comprises
this SNP.
[0589] In some embodiments, a similar sequence has greater than
60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98% or 99% sequence homology with a target sequence. In some
embodiments, a target sequence is a disease-causing copy of a
nucleic acid sequence comprising one or more mutations and/or SNPs,
and a similar sequence is a copy not causing the disease (wild
type). In some embodiments, a target sequence comprises a mutation,
wherein a similar sequence is the corresponding wild-type sequence.
In some embodiments, a target sequence is a mutant allele, while a
similar sequence is a wild-type allele. In some embodiments, a
target sequence comprises a SNP that is associated with a
disease-causing allele, while a similar sequence comprises the same
SNP that is not associated with the disease-causing allele. In some
embodiments, the region of a target sequence that is complementary
to a common base sequence of a provided oligonucleotide composition
has greater than 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98% or 99% sequence homology with the
corresponding region of a similar sequence. In some embodiments,
the region of a target sequence that is complementary to a common
base sequence of a provided oligonucleotide composition differs
from the corresponding region of a similar sequence at less than 5,
less than 4, less than 3, less than 2, or only 1 base pairs. In
some embodiments, the region of a target sequence that is
complementary to a common base sequence of a provided
oligonucleotide composition differs from the corresponding region
of a similar sequence only at a mutation site or SNP site. In some
embodiments, the region of a target sequence that is complementary
to a common base sequence of a provided oligonucleotide composition
differs from the corresponding region of a similar sequence only at
a mutation site. In some embodiments, the region of a target
sequence that is complementary to a common base sequence of a
provided oligonucleotide composition differs from the corresponding
region of a similar sequence only at a SNP site.
[0590] In some embodiments, a common base sequence comprises or is
a sequence complementary to a characteristic sequence element. In
some embodiments, a common base sequence comprises a sequence
complementary to a characteristic sequence element. In some
embodiments, a common base sequence is a sequence complementary to
a characteristic sequence element. In some embodiments, a common
base sequence comprises or is a sequence 100% complementary to a
characteristic sequence element. In some embodiments, a common base
sequence comprises a sequence 100% complementary to a
characteristic sequence element. In some embodiments, a common base
sequence is a sequence 100% complementary to a characteristic
sequence element. In some embodiments, a common base sequence in a
core comprises or is a sequence complementary to a characteristic
sequence element. In some embodiments, a common base sequence in a
core comprises a sequence complementary to a characteristic
sequence element. In some embodiments, a common base sequence in a
core is a sequence complementary to a characteristic sequence
element. In some embodiments, a common base sequence in a core
comprises or is a sequence 100% complementary to a characteristic
sequence element. In some embodiments, a common base sequence in a
core comprises a sequence 100% complementary to a characteristic
sequence element. In some embodiments, a common base sequence in a
core is a sequence 100% complementary to a characteristic sequence
element.
[0591] In some embodiments, a characteristic sequence element
comprises or is a mutation. In some embodiments, a characteristic
sequence element comprises a mutation. In some embodiments, a
characteristic sequence element is a mutation. In some embodiments,
a characteristic sequence element comprises or is a point mutation.
In some embodiments, a characteristic sequence element comprises a
point mutation. In some embodiments, a characteristic sequence
element is a point mutation. In some embodiments, a characteristic
sequence element comprises or is a SNP. In some embodiments, a
characteristic sequence element comprises a SNP. In some
embodiments, a characteristic sequence element is a SNP.
[0592] In some embodiments, a common base sequence 100% matches a
target sequence, which it does not 100% match a similar sequence of
the target sequence. For example, in some embodiments, a common
base sequence matches a mutation in the disease-causing copy or
allele of a target nucleic acid sequence, but does not match a
non-disease-causing copy or allele at the mutation site; in some
other embodiments, a common base sequence matches a SNP in the
disease-causing allele of a target nucleic acid sequence, but does
not match a non-disease-causing allele at the corresponding site.
In some embodiments, a common base sequence in a core 100% matches
a target sequence, which it does not 100% match a similar sequence
of the target sequence. For example, in WV-1092, its common base
sequence (and its common base sequence in its core) matches the
disease-associated U, but not the non-disease-associated
(wild-type) C at rs362307.
[0593] Among other things, the present disclosure recognizes that a
base sequence may have impact on oligonucleotide properties. In
some embodiments, a base sequence may have impact on cleavage
pattern of a target when oligonucleotides having the base sequence
are utilized for suppressing a target, e.g., through a pathway
involving RNase H: for example, FIG. 33 demonstrates that
structurally similar (all phosphorothioate linkages, all
stereorandom) oligonucleotides have different sequences may have
different cleavage patterns. In some embodiments, a common base
sequence of a non-stereorandom oligonucleotide compositions (e.g.,
certain oligonucleotide compositions provided in the present
disclosure) is a base sequence that when applied to a DNA
oligonucleotide composition (e.g., ONT-415) or a stereorandom
all-phosphorothioate oligonucleotide composition (e.g., WV-905),
cleavage pattern of the DNA (DNA cleavage pattern) and/or the
stereorandom all-phosphorothioate (stereorandom cleavage pattern)
composition has a cleavage site within or in the vicinity of a
characteristic sequence element. In some embodiments, a cleavage
site within or in the vicinity is within a sequence complementary
to a core region of a common sequence. In some embodiments, a
cleavage site within or in the vicinity is within a sequence 100%
complementary to a core region of a common sequence.
[0594] In some embodiments, a common base sequence is a base
sequence that has a cleavage site within or in the vicinity of a
characteristic sequence element in its DNA cleavage pattern. In
some embodiments, a common base sequence is a base sequence that
has a cleavage site within a characteristic sequence element in its
DNA cleavage pattern. In some embodiments, a common base sequence
is a base sequence that has a cleavage site in the vicinity of a
characteristic sequence element in its DNA cleavage pattern. In
some embodiments, a common base sequence is a base sequence that
has a cleavage site in the vicinity of a mutation or SNP of a
characteristic sequence element in its DNA cleavage pattern. In
some embodiments, a common base sequence is a base sequence that
has a cleavage site in the vicinity of a mutation in its DNA
cleavage pattern. In some embodiments, a common base sequence is a
base sequence that has a cleavage site in the vicinity of a SNP in
its DNA cleavage pattern.
[0595] In some embodiments, a common base sequence is a base
sequence that has a cleavage site within or in the vicinity of a
characteristic sequence element in its stereorandom cleavage
pattern. In some embodiments, a common base sequence is a base
sequence that has a cleavage site within a characteristic sequence
element in its stereorandom cleavage pattern. In some embodiments,
a common base sequence is a base sequence that has a cleavage site
in the vicinity of a characteristic sequence element in its
stereorandom cleavage pattern. In some embodiments, a common base
sequence is a base sequence that has a cleavage site in the
vicinity of a mutation or SNP of a characteristic sequence element
in its stereorandom cleavage pattern. In some embodiments, a common
base sequence is a base sequence that has a cleavage site in the
vicinity of a mutation in its stereorandom cleavage pattern. In
some embodiments, a common base sequence is a base sequence that
has a cleavage site in the vicinity of a SNP in its stereorandom
cleavage pattern.
[0596] In some embodiments, a common base sequence is a base
sequence that has a cleavage site in the vicinity of a mutation of
a characteristic sequence element in its DNA and/or stereorandom
cleavage pattern. In some embodiments, a common base sequence is a
base sequence that has a cleavage site in the vicinity of a
mutation in its DNA and/or stereorandom cleavage pattern. In some
embodiments, a common base sequence is a base sequence that has a
cleavage site in the vicinity of a mutation in its DNA cleavage
pattern. In some embodiments, a cleavage site in the vicinity of a
mutation is at a mutation, i.e., a cleavage site is at the
internucleotidic linkage of a mutated nucleotide (e.g., if a
mutation is at A in the target sequence of GGGACGTCTT (SEQ ID NO:
16), the cleavage is between A and C). In some embodiments, a
cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, 4, 5,
6, 7, 8, 9, or 10 internucleotidic linkages away from a mutation,
where 0 means cleavage at the mutation site (e.g., if a mutation is
at A in the target sequence of GGGACGTCTT (SEQ ID NO: 16), the
cleavage is between A and C for 0 internucleotidic linkage away; a
cleavage site 1 internucleotidic linkage away from the mutation is
between G and A to the 5' from the mutation or between C and G to
the 3' from the mutation). In some embodiments, a cleavage site in
the vicinity is a cleavage site 0, 1, 2, 3, 4, or 5
internucleotidic linkages away from a mutation. In some
embodiments, a cleavage site in the vicinity is a cleavage site 0,
1, 2, 3, 4, or 5 internucleotidic linkages away to the 5' from a
mutation. In some embodiments, a cleavage site in the vicinity is a
cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic linkages away to
the 3' from a mutation. In some embodiments, a cleavage site in the
vicinity is a cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic
linkages away from a mutation. In some embodiments, a cleavage site
in the vicinity is a cleavage site 0, 1, 2, 3, 4, or 5
internucleotidic linkages away to the 5' from a mutation. In some
embodiments, a cleavage site in the vicinity is a cleavage site 0,
1, 2, 3, 4, or 5 internucleotidic linkages away to the 3' from a
mutation. In some embodiments, a cleavage site in the vicinity is a
cleavage site 0, 1, 2, 3, or 4 internucleotidic linkages away from
a mutation. In some embodiments, a cleavage site in the vicinity is
a cleavage site 0, 1, 2, 3, or 4 internucleotidic linkages away to
the 5' from a mutation. In some embodiments, a cleavage site in the
vicinity is a cleavage site 0, 1, 2, 3, or 4 internucleotidic
linkages away to the 3' from a mutation. In some embodiments, a
cleavage site in the vicinity is a cleavage site 0, 1, 2, or 3
internucleotidic linkages away from a mutation. In some
embodiments, a cleavage site in the vicinity is a cleavage site 0,
1, 2, or 3 internucleotidic linkages away to the 5' from a
mutation. In some embodiments, a cleavage site in the vicinity is a
cleavage site 0, 1, 2, or 3 internucleotidic linkages away to the
3' from a mutation. In some embodiments, a cleavage site in the
vicinity is a cleavage site 0, 1, or 2 internucleotidic linkages
away from a mutation. In some embodiments, a cleavage site in the
vicinity is a cleavage site 0, 1, or 2 internucleotidic linkages
away to the 5' from a mutation. In some embodiments, a cleavage
site in the vicinity is a cleavage site 0, 1, or 2 internucleotidic
linkages away to the 3' from a mutation. In some embodiments, a
cleavage site in the vicinity is a cleavage site 0 or 1
internucleotidic linkage away from a mutation. In some embodiments,
a cleavage site in the vicinity is a cleavage site 0 or 1
internucleotidic linkage away to the 5' from a mutation. In some
embodiments, a cleavage site in the vicinity is a cleavage site 0
or 1 internucleotidic linkage away to the 3' from a mutation. In
some embodiments, a cleavage site in the vicinity is a cleavage
site 0 internucleotidic linkage away from a mutation. In some
embodiments, a cleavage site in the vicinity is a cleavage site one
internucleotidic linkage away from a mutation. In some embodiments,
a cleavage site in the vicinity is a cleavage site one
internucleotidic linkage away to the 5' from a mutation. In some
embodiments, a cleavage site in the vicinity is a cleavage site one
internucleotidic linkage away to the 3' from a mutation. In some
embodiments, a cleavage site in the vicinity is a cleavage site two
internucleotidic linkages away from a mutation. In some
embodiments, a cleavage site in the vicinity is a cleavage site two
internucleotidic linkages away to the 5' from a mutation. In some
embodiments, a cleavage site in the vicinity is a cleavage site two
internucleotidic linkages away to the 3' from a mutation. In some
embodiments, a cleavage site in the vicinity is a cleavage site
three internucleotidic linkages away from a mutation. In some
embodiments, a cleavage site in the vicinity is a cleavage site
three internucleotidic linkages away to the 5' from a mutation. In
some embodiments, a cleavage site in the vicinity is a cleavage
site three internucleotidic linkages away to the 3' from a
mutation. In some embodiments, a cleavage site in the vicinity is a
cleavage site four internucleotidic linkages away from a mutation.
In some embodiments, a cleavage site in the vicinity is a cleavage
site four internucleotidic linkages away to the 5' from a mutation.
In some embodiments, a cleavage site in the vicinity is a cleavage
site four internucleotidic linkages away to the 3' from a mutation.
In some embodiments, a cleavage site in the vicinity is a cleavage
site five internucleotidic linkages away from a mutation. In some
embodiments, a cleavage site in the vicinity is a cleavage site
five internucleotidic linkages away to the 5' from a mutation. In
some embodiments, a cleavage site in the vicinity is a cleavage
site five internucleotidic linkages away to the 3' from a
mutation.
[0597] In some embodiments, a common base sequence is a base
sequence that has a cleavage site in the vicinity of a SNP of a
characteristic sequence element in its DNA and/or stereorandom
cleavage pattern. In some embodiments, a common base sequence is a
base sequence that has a cleavage site in the vicinity of a SNP in
its DNA and/or stereorandom cleavage pattern. In some embodiments,
a common base sequence is a base sequence that has a cleavage site
in the vicinity of a SNP in its DNA cleavage pattern. In some
embodiments, a cleavage site in the vicinity of a SNP is at a SNP,
i.e., a cleavage site is at the internucleotidic linkage of a
nucleotide at a SNP (e.g., for the target of WV-905,
G*G*C*A*C*A*A*G*G*G*C*A*C*A*G*A*C*T*T*C (SEQ ID NO: 17), which
comprises rUrUrUrGrGrArArGrUrCrUrGrUrGrCrCrCrUrUrGrUrGrCrCrC (SEQ
ID NO: 18) (rs362307 bolded), the cleavage is between the bolded rU
and the underlined rG immediately after it). In some embodiments, a
cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, 4, 5,
6, 7, 8, 9, or 10 internucleotidic linkages away from a SNP, where
0 means cleavage at a SNP (e.g., for the target of WV-905,
G*G*C*A*C*A*A*G*G*G*C*A*C*A*G*A*C*T*T*C (SEQ ID NO: 17), which
comprises rUrUrUrGrGrArArGrUrCrUrGrUrGrCrCrCrUrUrGrUrGrCrCrC (SEQ
ID NO: 18) (rs362307 bolded), the cleavage is between the bolded rU
and the underlined rG immediately after it for 0 internucleotidic
linkage away; a cleavage site 1 internucleotidic linkage away from
a SNP is between the rG and rU to the 5' from the SNP (underlined:
rUrUrUrGrGrArArGrUrCrUrGrUrUrGrCrCrCrUrUrGrUrGrCrCrC (SEQ ID NO:
18)), or between rG and rC to the 3'-end of the SNP (underlined:
rUrUrUrGrGrArArGrUrCrUrGrUrGrCrCrCrUrUrGrUrGrCrCrC (SEQ ID NO:
18))). In some embodiments, a cleavage site in the vicinity is a
cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic linkages away
from a SNP. In some embodiments, a cleavage site in the vicinity is
a cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic linkages away
to the 5' from a SNP. In some embodiments, a cleavage site in the
vicinity is a cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic
linkages away to the 3' from a SNP. In some embodiments, a cleavage
site in the vicinity is a cleavage site 0, 1, 2, 3, 4, or 5
internucleotidic linkages away from a SNP. In some embodiments, a
cleavage site in the vicinity is a cleavage site 0, 1, 2, 3, 4, or
5 internucleotidic linkages away to the 5' from a SNP. In some
embodiments, a cleavage site in the vicinity is a cleavage site 0,
1, 2, 3, 4, or 5 internucleotidic linkages away to the 3' from a
SNP. In some embodiments, a cleavage site in the vicinity is a
cleavage site 0, 1, 2, 3, or 4 internucleotidic linkages away from
a SNP. In some embodiments, a cleavage site in the vicinity is a
cleavage site 0, 1, 2, 3, or 4 internucleotidic linkages away to
the 5' from a SNP. In some embodiments, a cleavage site in the
vicinity is a cleavage site 0, 1, 2, 3, or 4 internucleotidic
linkages away to the 3' from a SNP. In some embodiments, a cleavage
site in the vicinity is a cleavage site 0, 1, 2, or 3
internucleotidic linkages away from a SNP. In some embodiments, a
cleavage site in the vicinity is a cleavage site 0, 1, 2, or 3
internucleotidic linkages away to the 5' from a SNP. In some
embodiments, a cleavage site in the vicinity is a cleavage site 0,
1, 2, or 3 internucleotidic linkages away to the 3' from a SNP. In
some embodiments, a cleavage site in the vicinity is a cleavage
site 0, 1, or 2 internucleotidic linkages away from a SNP. In some
embodiments, a cleavage site in the vicinity is a cleavage site 0,
1, or 2 internucleotidic linkages away to the 5' from a SNP. In
some embodiments, a cleavage site in the vicinity is a cleavage
site 0, 1, or 2 internucleotidic linkages away to the 3' from a
SNP. In some embodiments, a cleavage site in the vicinity is a
cleavage site 0 or 1 internucleotidic linkage away from a SNP. In
some embodiments, a cleavage site in the vicinity is a cleavage
site 0 or 1 internucleotidic linkage away to the 5' from a SNP. In
some embodiments, a cleavage site in the vicinity is a cleavage
site 0 or 1 internucleotidic linkage away to the 3' from a SNP. In
some embodiments, a cleavage site in the vicinity is a cleavage
site 0 internucleotidic linkage away from a SNP. In some
embodiments, a cleavage site in the vicinity is a cleavage site one
internucleotidic linkage away from a SNP. In some embodiments, a
cleavage site in the vicinity is a cleavage site one
internucleotidic linkage away to the 5' from a SNP. In some
embodiments, a cleavage site in the vicinity is a cleavage site one
internucleotidic linkage away to the 3' from a SNP. In some
embodiments, a cleavage site in the vicinity is a cleavage site two
internucleotidic linkages away from a SNP. In some embodiments, a
cleavage site in the vicinity is a cleavage site two
internucleotidic linkages away to the 5' from a SNP. In some
embodiments, a cleavage site in the vicinity is a cleavage site two
internucleotidic linkages away to the 3' from a SNP. In some
embodiments, a cleavage site in the vicinity is a cleavage site
three internucleotidic linkages away from a SNP. In some
embodiments, a cleavage site in the vicinity is a cleavage site
three internucleotidic linkages away to the 5' from a SNP. In some
embodiments, a cleavage site in the vicinity is a cleavage site
three internucleotidic linkages away to the 3' from a SNP. In some
embodiments, a cleavage site in the vicinity is a cleavage site
four internucleotidic linkages away from a SNP. In some
embodiments, a cleavage site in the vicinity is a cleavage site
four internucleotidic linkages away to the 5' from a SNP. In some
embodiments, a cleavage site in the vicinity is a cleavage site
four internucleotidic linkages away to the 3' from a SNP. In some
embodiments, a cleavage site in the vicinity is a cleavage site
five internucleotidic linkages away from a SNP. In some
embodiments, a cleavage site in the vicinity is a cleavage site
five internucleotidic linkages away to the 5' from a SNP. In some
embodiments, a cleavage site in the vicinity is a cleavage site
five internucleotidic linkages away to the 3' from a SNP. For
example, FIG. 33 demonstrates that stereorandom cleavage pattern of
the WV-905 sequence has cleavage sites at the SNP (between CUGU and
GCCC), two internucleotidic linkages away (between GUCU and GUGC,
and between GUGC and CCUU), three internucleotidic linkages away
(between UGCC and CUUG); four internucleotidic linkages away
(between GCCC and UUGU, and AAGU and CUGU), and five
internucleotidic linkages away (between CCCU and UGUG).
[0598] In some embodiments, a cleavage site within or in the
vicinity of a characteristic sequence element, e.g., in the
vicinity of a mutation, a SNP, etc., is a major cleavage site of a
DNA and/or stereorandom cleavage pattern. In some embodiments, a
cleavage site within or in the vicinity of a characteristic
sequence element is a major cleavage site of a DNA cleavage
pattern. In some embodiments, a cleavage site within or in the
vicinity of a characteristic sequence element is a major cleavage
site of a stereorandom cleavage pattern. In some embodiments, a
cleavage site in the vicinity of a mutation is a major cleavage
site of a DNA cleavage pattern. In some embodiments, a cleavage
site in the vicinity of a mutation is a major cleavage site of a
stereorandom cleavage pattern. In some embodiments, a cleavage site
in the vicinity of a SNP is a major cleavage site of a DNA cleavage
pattern. In some embodiments, a cleavage site in the vicinity of a
SNP is a major cleavage site of a stereorandom cleavage pattern. In
some embodiments, a major cleavage site is within a sequence
complementary to a core region of a common sequence. In some
embodiments, a major cleavage site is within a sequence 100%
complementary to a core region of a common sequence.
[0599] In some embodiments, a major cleavage site is a site having
the most, or the second, third, fourth or fifth most cleavage. In
some embodiments, a major cleavage site is a site having the most,
or the second, third, or fourth most cleavage. In some embodiments,
a major cleavage site is a site having the most, or the second, or
third most cleavage. In some embodiments, a major cleavage site is
a site having the most or the second most cleavage. In some
embodiments, a major cleavage site is a site having the most
cleavage. In some embodiments, a major cleavage site is a site
having the second most cleavage. In some embodiments, a major
cleavage site is a site having the third most cleavage. In some
embodiments, a major cleavage site is a site having the fourth most
cleavage. In some embodiments, a major cleavage site is a site
having the fifth most cleavage.
[0600] In some embodiments, a major cleavage site is a site wherein
greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of
cleavage occurs. In some embodiments, a major cleavage site is a
site wherein greater than 5% of cleavage occurs. In some
embodiments, a major cleavage site is a site wherein greater than
10% of cleavage occurs. In some embodiments, a major cleavage site
is a site wherein greater than 15% of cleavage occurs. In some
embodiments, a major cleavage site is a site wherein greater than
20% of cleavage occurs. In some embodiments, a major cleavage site
is a site wherein greater than 25% of cleavage occurs. In some
embodiments, a major cleavage site is a site wherein greater than
30% of cleavage occurs. In some embodiments, a major cleavage site
is a site wherein greater than 35% of cleavage occurs. In some
embodiments, a major cleavage site is a site wherein greater than
40% of cleavage occurs. In some embodiments, a major cleavage site
is a site wherein greater than 45% of cleavage occurs. In some
embodiments, a major cleavage site is a site wherein greater than
50% of cleavage occurs. In some embodiments, a major cleavage site
is a site wherein greater than 55% of cleavage occurs. In some
embodiments, a major cleavage site is a site wherein greater than
60% of cleavage occurs. In some embodiments, a major cleavage site
is a site wherein greater than 65% of cleavage occurs. In some
embodiments, a major cleavage site is a site wherein greater than
70% of cleavage occurs. In some embodiments, a major cleavage site
is a site wherein greater than 75% of cleavage occurs. In some
embodiments, a major cleavage site is a site wherein greater than
80% of cleavage occurs. In some embodiments, a major cleavage site
is a site wherein greater than 85% of cleavage occurs. In some
embodiments, a major cleavage site is a site wherein greater than
90% of cleavage occurs. In some embodiments, a major cleavage site
is a site wherein greater than 91% of cleavage occurs. In some
embodiments, a major cleavage site is a site wherein greater than
92% of cleavage occurs. In some embodiments, a major cleavage site
is a site wherein greater than 93% of cleavage occurs. In some
embodiments, a major cleavage site is a site wherein greater than
94% of cleavage occurs. In some embodiments, a major cleavage site
is a site wherein greater than 95% of cleavage occurs. In some
embodiments, a major cleavage site is a site wherein greater than
96% of cleavage occurs. In some embodiments, a major cleavage site
is a site wherein greater than 97% of cleavage occurs. In some
embodiments, a major cleavage site is a site wherein greater than
98% of cleavage occurs. In some embodiments, a major cleavage site
is a site wherein greater than 99% of cleavage occurs. In some
embodiments, a major cleavage site is a site wherein 100% of
cleavage occurs.
[0601] In some embodiments, a major cleavage site is a site wherein
greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of a
target is cleaved. In some embodiments, a major cleavage site is a
site wherein greater than 5% of a target is cleaved. In some
embodiments, a major cleavage site is a site wherein greater than
10% of a target is cleaved. In some embodiments, a major cleavage
site is a site wherein greater than 15% of a target is cleaved. In
some embodiments, a major cleavage site is a site wherein greater
than 20% of a target is cleaved. In some embodiments, a major
cleavage site is a site wherein greater than 25% of a target is
cleaved. In some embodiments, a major cleavage site is a site
wherein greater than 30% of a target is cleaved. In some
embodiments, a major cleavage site is a site wherein greater than
35% of a target is cleaved. In some embodiments, a major cleavage
site is a site wherein greater than 40% of a target is cleaved. In
some embodiments, a major cleavage site is a site wherein greater
than 45% of a target is cleaved. In some embodiments, a major
cleavage site is a site wherein greater than 50% of a target is
cleaved. In some embodiments, a major cleavage site is a site
wherein greater than 55% of a target is cleaved. In some
embodiments, a major cleavage site is a site wherein greater than
60% of a target is cleaved. In some embodiments, a major cleavage
site is a site wherein greater than 65% of a target is cleaved. In
some embodiments, a major cleavage site is a site wherein greater
than 70% of a target is cleaved. In some embodiments, a major
cleavage site is a site wherein greater than 75% of a target is
cleaved. In some embodiments, a major cleavage site is a site
wherein greater than 80% of a target is cleaved. In some
embodiments, a major cleavage site is a site wherein greater than
85% of a target is cleaved. In some embodiments, a major cleavage
site is a site wherein greater than 90% of a target is cleaved. In
some embodiments, a major cleavage site is a site wherein greater
than 91% of a target is cleaved. In some embodiments, a major
cleavage site is a site wherein greater than 92% of a target is
cleaved. In some embodiments, a major cleavage site is a site
wherein greater than 93% of a target is cleaved. In some
embodiments, a major cleavage site is a site wherein greater than
94% of a target is cleaved. In some embodiments, a major cleavage
site is a site wherein greater than 95% of a target is cleaved. In
some embodiments, a major cleavage site is a site wherein greater
than 96% of a target is cleaved. In some embodiments, a major
cleavage site is a site wherein greater than 97% of a target is
cleaved. In some embodiments, a major cleavage site is a site
wherein greater than 98% of a target is cleaved. In some
embodiments, a major cleavage site is a site wherein greater than
99% of a target is cleaved. In some embodiments, a major cleavage
site is a site wherein 100% of a target is cleaved. In some
embodiments, a cleavage pattern may not have a major cleavage site
as no site reaches an absolute cleavage threshold level.
[0602] As a person having ordinary skill in the art understands,
various methods may be useful for generating cleavage patterns
and/or identify cleavage sites, including major cleavage site. In
some embodiments, an example of such an assay is an RNase cleavage
assay as described herein; for example results, see FIG. 33, FIG.
34, etc.
[0603] In some embodiments, the present disclosure recognizes
location effects of a sequence motif complementary to a
characteristic sequence element. In some embodiments, the present
disclosure recognizes location effects of a sequence motif
complementary to a mutation. In some embodiments, the present
disclosure recognizes location effects of a sequence motif
complementary to a SNP.
[0604] In some embodiments, position 11, 12 or 13 of a sequence as
counted from its 5'-terminus aligns with a characteristic sequence
element. In some embodiments, position 11 of a sequence as counted
from its 5'-terminus aligns with a characteristic sequence element.
In some embodiments, position 12 of a sequence as counted from its
5'-terminus aligns with a characteristic sequence element. In some
embodiments, position 13 of a sequence as counted from its
5'-terminus aligns with a characteristic sequence element. In some
embodiments, position 8, 9 or 10 of a sequence as counted from its
3'-terminus aligns with a characteristic sequence element. In some
embodiments, position 8 of a sequence as counted from its
3'-terminus aligns with a characteristic sequence element. In some
embodiments, position 9 of a sequence as counted from its
3'-terminus aligns with a characteristic sequence element. In some
embodiments, position 10 of a sequence as counted from its
3'-terminus aligns with a characteristic sequence element. In some
embodiments, position 6, 7, or 8 of a core region as counted from
the 5'-terminus of the core region aligns with a characteristic
sequence element. In some embodiments, position 6 of a core region
as counted from the 5'-terminus of the core region aligns with a
characteristic sequence element. In some embodiments, position 7 of
a core region as counted from the 5'-terminus of the core region
aligns with a characteristic sequence element. In some embodiments,
position 8 of a core region as counted from the 5'-terminus of the
core region aligns with a characteristic sequence element. In some
embodiments, position 3, 4, or 5 of a core region as counted from
the 3'-terminus of the core region aligns with a characteristic
sequence element. In some embodiments, position 3 of a core region
as counted from the 3'-terminus of the core region aligns with a
characteristic sequence element. In some embodiments, position 4 of
a core region as counted from the 3'-terminus of the core region
aligns with a characteristic sequence element. In some embodiments,
position 5 of a core region as counted from the 3'-terminus of the
core region aligns with a characteristic sequence element.
[0605] In some embodiments, position 11, 12 or 13 of a sequence as
counted from its 5'-terminus aligns with a mutation. In some
embodiments, position 11 of a sequence as counted from its
5'-terminus aligns with a mutation. In some embodiments, position
12 of a sequence as counted from its 5'-terminus aligns with a
mutation. In some embodiments, position 13 of a sequence as counted
from its 5'-terminus aligns with a mutation. In some embodiments,
position 8, 9 or 10 of a sequence as counted from its 3'-terminus
aligns with a mutation. In some embodiments, position 8 of a
sequence as counted from its 3'-terminus aligns with a mutation. In
some embodiments, position 9 of a sequence as counted from its
3'-terminus aligns with a mutation. In some embodiments, position
10 of a sequence as counted from its 3'-terminus aligns with a
mutation. In some embodiments, position 6, 7, or 8 of a core region
as counted from the 5'-terminus of the core region aligns with a
mutation. In some embodiments, position 6 of a core region as
counted from the 5'-terminus of the core region aligns with a
mutation. In some embodiments, position 7 of a core region as
counted from the 5'-terminus of the core region aligns with a
mutation. In some embodiments, position 8 of a core region as
counted from the 5'-terminus of the core region aligns with a
mutation. In some embodiments, position 3, 4, or 5 of a core region
as counted from the 3'-terminus of the core region aligns with a
mutation. In some embodiments, position 3 of a core region as
counted from the 3'-terminus of the core region aligns with a
mutation. In some embodiments, position 4 of a core region as
counted from the 3'-terminus of the core region aligns with a
mutation. In some embodiments, position 5 of a core region as
counted from the 3'-terminus of the core region aligns with a
mutation.
[0606] In some embodiments, position 11, 12 or 13 of a sequence as
counted from its 5'-terminus aligns with a SNP. In some
embodiments, position 11 of a sequence as counted from its
5'-terminus aligns with a SNP. In some embodiments, position 12 of
a sequence as counted from its 5'-terminus aligns with a SNP. In
some embodiments, position 13 of a sequence as counted from its
5'-terminus aligns with a SNP. In some embodiments, position 8, 9
or 10 of a sequence as counted from its 3'-terminus aligns with a
SNP. In some embodiments, position 8 of a sequence as counted from
its 3'-terminus aligns with a SNP. In some embodiments, position 9
of a sequence as counted from its 3'-terminus aligns with a SNP. In
some embodiments, position 10 of a sequence as counted from its
3'-terminus aligns with a SNP. In some embodiments, position 6, 7,
or 8 of a core region as counted from the 5'-terminus of the core
region aligns with a SNP. In some embodiments, position 6 of a core
region as counted from the 5'-terminus of the core region aligns
with a SNP. In some embodiments, position 7 of a core region as
counted from the 5'-terminus of the core region aligns with a SNP.
In some embodiments, position 8 of a core region as counted from
the 5'-terminus of the core region aligns with a SNP. In some
embodiments, position 3, 4, or 5 of a core region as counted from
the 3'-terminus of the core region aligns with a SNP. In some
embodiments, position 3 of a core region as counted from the
3'-terminus of the core region aligns with a SNP. In some
embodiments, position 4 of a core region as counted from the
3'-terminus of the core region aligns with a SNP. In some
embodiments, position 5 of a core region as counted from the
3'-terminus of the core region aligns with a SNP.
[0607] In some embodiments, a common base sequence comprises or is
a sequence complementary to a nucleic acid sequence. In some
embodiments, a common base sequence comprises or is a sequence 100%
complementary to a nucleic acid sequence. In some embodiments, a
common base sequence comprises or is a sequence complementary to a
disease-causing nucleic acid sequence. In some embodiments, a
common base sequence comprises or is a sequence 100% complementary
to a disease-causing nucleic acid sequence. In some embodiments, a
common base sequence comprises or is a sequence complementary to a
characteristic sequence element of disease-causing nucleic acid
sequence, which characteristic sequences differentiate a
disease-causing nucleic acid sequence from a non-diseasing-causing
nucleic acid sequence. In some embodiments, a common base sequence
comprises or is a sequence 100% complementary to a characteristic
sequence element of disease-causing nucleic acid sequence, which
characteristic sequences differentiate a disease-causing nucleic
acid sequence from a non-diseasing-causing nucleic acid sequence.
In some embodiments, a common base sequence comprises or is a
sequence complementary to a disease-associated nucleic acid
sequence. In some embodiments, a common base sequence comprises or
is a sequence 100% complementary to a disease-associated nucleic
acid sequence. In some embodiments, a common base sequence
comprises or is a sequence complementary to a characteristic
sequence element of disease-associated nucleic acid sequence, which
characteristic sequences differentiate a disease-associated nucleic
acid sequence from a non-diseasing-associated nucleic acid
sequence. In some embodiments, a common base sequence comprises or
is a sequence 100% complementary to a characteristic sequence
element of disease-associated nucleic acid sequence, which
characteristic sequences differentiate a disease-associated nucleic
acid sequence from a non-diseasing-associated nucleic acid
sequence.
[0608] In some embodiments, a common base sequence comprises or is
a sequence complementary to a gene. In some embodiments, a common
base sequence comprises or is a sequence 100% complementary to a
gene. In some embodiments, a common base sequence comprises or is a
sequence complementary to a characteristic sequence element of a
gene, which characteristic sequences differentiate the gene from a
similar sequence sharing homology with the gene. In some
embodiments, a common base sequence comprises or is a sequence 100%
complementary to a characteristic sequence element of a gene, which
characteristic sequences differentiate the gene from a similar
sequence sharing homology with the gene. In some embodiments, a
common base sequence comprises or is a sequence complementary to
characteristic sequence element of a target gene, which
characteristic sequences comprises a mutation that is not found in
other copies of the gene, e.g., the wild-type copy of the gene,
another mutant copy the gene, etc. In some embodiments, a common
base sequence comprises or is a sequence 100% complementary to
characteristic sequence element of a target gene, which
characteristic sequences comprises a mutation that is not found in
other copies of the gene, e.g., the wild-type copy of the gene,
another mutant copy the gene, etc.
[0609] In some embodiments, a common base sequence comprises or is
a sequence complementary to a sequence comprising a SNP. In some
embodiments, a common base sequence comprises or is a sequence
complementary to a sequence comprising a SNP, and the common base
sequence is 100% complementary to the SNP that is associated with a
disease. For example, in some embodiments, a common base sequence
is 100% complementary to a SNP associated with a Huntington's
disease-associated (or -causing) allele. In some embodiments, a
common base sequence is that of WV-1092, which is 100%
complementary to the disease-associated allele in many Huntington's
disease patients at rs362307. In some embodiments, a SNP is
rs362307. In some embodiments, a SNP is rs7685686. In some
embodiments, a SNP is rs362268. In some embodiments, a SNP is
rs362306. In some embodiments, a SNP is rs362331. In some
embodiments, a SNP is rs2530595. In some embodiments, other example
SNP site may be any of the Huntingtin site disclosed in the present
disclosure.
[0610] In some embodiments, a common base sequence comprises a
sequence found in GCCTCAGTCTGCTTCGCACC (SEQ ID NO: 19). In some
embodiments, a common base sequence comprises a sequence found in
GCCTCAGTCTGCTTCGCACC (SEQ ID NO: 19), wherein the sequence found in
GCCTCAGTCTGCTTCGCACC (SEQ ID NO: 19) comprises at least 15
nucleotides. In some embodiments, a common base sequence is
GCCTCAGTCTGCTTCGCACC (SEQ ID NO: 19).
[0611] In some embodiments, a common base sequence comprises a
sequence found in GAGCAGCTGCAACCTGGCAA (SEQ ID NO: 20). In some
embodiments, a common base sequence comprises a sequence found in
GAGCAGCTGCAACCTGGCAA (SEQ ID NO: 20), wherein the sequence found in
GAGCAGCTGCAACCTGGCAA (SEQ ID NO: 20) comprises at least 15
nucleotides. In some embodiments, a common base sequence is
GAGCAGCTGCAACCTGGCAA (SEQ ID NO: 20). In some embodiments, a common
base sequence is GGGCACAAGGGCACAGACTT (SEQ ID NO: 21). In some
embodiments, a common base sequence is GAGCAGCTGCAACCTGGCAA (SEQ ID
NO: 20). In some embodiments, a common base sequence is
GCACAAGGGCACAGACTTCC (SEQ ID NO: 22). In some embodiments, a common
base sequence is CACAAGGGCACAGACTTCCA (SEQ ID NO: 23). In some
embodiments, a common base sequence is ACAAGGGCACAGACTTCCAA (SEQ ID
NO: 24). In some embodiments, a common base sequence is
CAAGGGCACAGACTTCCAAA (SEQ ID NO: 25). In some embodiments, a common
base sequence comprises a sequence found in GAGCAGCTGCAACCTGGCAA
(SEQ ID NO: 20). In some embodiments, a common base sequence
comprises a sequence found in GAGCAGCTGCAACCTGGCAA (SEQ ID NO: 20),
wherein the sequence found in GAGCAGCTGCAACCTGGCAA (SEQ ID NO: 20)
comprises at least 15 nucleotides. In some embodiments, a common
base sequence is GAGCAGCTGCAACCTGGCAA (SEQ ID NO: 20). In some
embodiments, a common base sequence is GAGCAGCTGCAACCTGGCAA (SEQ ID
NO: 20). In some embodiments, a common base sequence is
AGCAGCTGCAACCTGGCAAC (SEQ ID NO: 26). In some embodiments, a common
base sequence is GCAGCTGCAACCTGGCAACA (SEQ ID NO: 27). In some
embodiments, a common base sequence is CAGCTGCAACCTGGCAACAA (SEQ ID
NO: 28). In some embodiments, a common base sequence is
AGCTGCAACCTGGCAACAAC (SEQ ID NO: 29). In some embodiments, a common
base sequence is GCTGCAACCTGGCAACAACC (SEQ ID NO: 30). In some
embodiments, a common base sequence comprises a sequence found in
GGGCCAACAGCCAGCCTGCA (SEQ ID NO: 31). In some embodiments, a common
base sequence comprises a sequence found in GGGCCAACAGCCAGCCTGCA
(SEQ ID NO: 31), wherein the sequence found in GGGCCAACAGCCAGCCTGCA
(SEQ ID NO: 31) comprises at least 15 nucleotides. In some
embodiments, a common base sequence is GGGCCAACAGCCAGCCTGCA (SEQ ID
NO: 31). In some embodiments, a common base sequence is
GGGCCAACAGCCAGCCTGCA (SEQ ID NO: 31). In some embodiments, a common
base sequence is GGCCAACAGCCAGCCTGCAG (SEQ ID NO: 32). In some
embodiments, a common base sequence is GCCAACAGCCAGCCTGCAGG (SEQ ID
NO: 33). In some embodiments, a common base sequence is
CCAACAGCCAGCCTGCAGGA (SEQ ID NO: 34). In some embodiments, a common
base sequence is CAACAGCCAGCCTGCAGGAG (SEQ ID NO: 35). In some
embodiments, a common base sequence is AACAGCCAGCCTGCAGGAGG (SEQ ID
NO: 36). In some embodiments, a common base sequence comprises a
sequence found in ATTAATAAATTGTCATCACC (SEQ ID NO: 37). In some
embodiments, a common base sequence comprises a sequence found in
ATTAATAAATTGTCATCACC (SEQ ID NO: 37), wherein the sequence found in
ATTAATAAATTGTCATCACC (SEQ ID NO: 37) comprises at least 15
nucleotides. In some embodiments, a common base sequence is
ATTAATAAATTGTCATCACC (SEQ ID NO: 37). In some embodiments, a common
base sequence is ATTAATAAATTGTCATCACC (SEQ ID NO: 37).
[0612] In some embodiments, the present disclosure provides
stereochemical design parameters for oligonucleotides. That is,
among other things, the present disclosure demonstrates impact of
stereochemical structure at different positions along an
oligonucleotide chain, for example on stability and/or activity of
the oligonucleotide, including on interaction of the
oligonucleotide with a cognate ligand and/or with a processing
enzyme. The present disclosure specifically provides
oligonucleotides whose structure incorporates or reflects the
design parameters. Such oligonucleotides are new chemical entities
relative to stereorandom preparations having the same base sequence
and length.
[0613] In some embodiments, the present disclosure provides
stereochemical design parameters for antisense oligonucleotides. In
some embodiments, the present disclosure specifically provides
design parameter for oligonucleotides that may be bound and/or
cleaved by RNaseH. In one embodiments, the present disclosure
provides stereochemical design parameters for siRNA
oligonucleotides. In some embodiments, the present disclosure
specifically provides design parameters for oligonucleotides that
may be bound and/or cleaved by, e.g., DICER, Argonaute proteins
(e.g., Argonaute-1 and Argonaute-2), etc.
[0614] In some embodiments, a single oligonucleotide of a provided
composition comprises a region in which at least one of the first,
second, third, fifth, seventh, eighth, ninth, eighteenth,
nineteenth and twentieth internucleotidic linkages is chiral. In
some embodiments, at least two of the first, second, third, fifth,
seventh, eighth, ninth, eighteenth, nineteenth and twentieth
internucleotidic linkages are chiral. In some embodiments, at least
three of the first, second, third, fifth, seventh, eighth, ninth,
eighteenth, nineteenth and twentieth internucleotidic linkages are
chiral. In some embodiments, at least four of the first, second,
third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and
twentieth internucleotidic linkages are chiral. In some
embodiments, at least five of the first, second, third, fifth,
seventh, eighth, ninth, eighteenth, nineteenth and twentieth
internucleotidic linkages are chiral. In some embodiments, at least
six of the first, second, third, fifth, seventh, eighth, ninth,
eighteenth, nineteenth and twentieth internucleotidic linkages are
chiral. In some embodiments, at least seven of the first, second,
third, fifth, seventh, eighth, ninth, eighteenth, nineteenth and
twentieth internucleotidic linkages are chiral. In some
embodiments, at least eight of the first, second, third, fifth,
seventh, eighth, ninth, eighteenth, nineteenth and twentieth
internucleotidic linkages are chiral. In some embodiments, at least
nine of the first, second, third, fifth, seventh, eighth, ninth,
eighteenth, nineteenth and twentieth internucleotidic linkages are
chiral. In some embodiments, one of the first, second, third,
fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth
internucleotidic linkages is chiral. In some embodiments, two of
the first, second, third, fifth, seventh, eighth, ninth,
eighteenth, nineteenth and twentieth internucleotidic linkages are
chiral. In some embodiments, three of the first, second, third,
fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth
internucleotidic linkages are chiral. In some embodiments, four of
the first, second, third, fifth, seventh, eighth, ninth,
eighteenth, nineteenth and twentieth internucleotidic linkages are
chiral. In some embodiments, five of the first, second, third,
fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth
internucleotidic linkages are chiral. In some embodiments, six of
the first, second, third, fifth, seventh, eighth, ninth,
eighteenth, nineteenth and twentieth internucleotidic linkages are
chiral. In some embodiments, seven of the first, second, third,
fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth
internucleotidic linkages are chiral. In some embodiments, eight of
the first, second, third, fifth, seventh, eighth, ninth,
eighteenth, nineteenth and twentieth internucleotidic linkages are
chiral. In some embodiments, nine of the first, second, third,
fifth, seventh, eighth, ninth, eighteenth, nineteenth and twentieth
internucleotidic linkages are chiral. In some embodiments, ten of
the first, second, third, fifth, seventh, eighth, ninth,
eighteenth, nineteenth and twentieth internucleotidic linkages are
chiral.
[0615] In some embodiments, a single oligonucleotide of a provided
composition comprises a region in which at least one of the first,
second, third, fifth, seventh, eighteenth, nineteenth and twentieth
internucleotidic linkages is chiral. In some embodiments, at least
two of the first, second, third, fifth, seventh, eighteenth,
nineteenth and twentieth internucleotidic linkages are chiral. In
some embodiments, at least three of the first, second, third,
fifth, seventh, eighteenth, nineteenth and twentieth
internucleotidic linkages are chiral. In some embodiments, at least
four of the first, second, third, fifth, seventh, eighteenth,
nineteenth and twentieth internucleotidic linkages are chiral. In
some embodiments, at least five of the first, second, third, fifth,
seventh, eighteenth, nineteenth and twentieth internucleotidic
linkages are chiral. In some embodiments, at least six of the
first, second, third, fifth, seventh, eighteenth, nineteenth and
twentieth internucleotidic linkages are chiral. In some
embodiments, at least seven of the first, second, third, fifth,
seventh, eighteenth, nineteenth and twentieth internucleotidic
linkages are chiral. In some embodiments, one of the first, second,
third, fifth, seventh, eighteenth, nineteenth and twentieth
internucleotidic linkages is chiral. In some embodiments, two of
the first, second, third, fifth, seventh, eighteenth, nineteenth
and twentieth internucleotidic linkages are chiral. In some
embodiments, three of the first, second, third, fifth, seventh,
eighteenth, nineteenth and twentieth internucleotidic linkages are
chiral. In some embodiments, four of the first, second, third,
fifth, seventh, eighteenth, nineteenth and twentieth
internucleotidic linkages are chiral. In some embodiments, five of
the first, second, third, fifth, seventh, eighteenth, nineteenth
and twentieth internucleotidic linkages are chiral. In some
embodiments, six of the first, second, third, fifth, seventh,
eighteenth, nineteenth and twentieth internucleotidic linkages are
chiral. In some embodiments, seven of the first, second, third,
fifth, seventh, eighteenth, nineteenth and twentieth
internucleotidic linkages are chiral. In some embodiments, eight of
the first, second, third, fifth, seventh, eighteenth, nineteenth
and twentieth internucleotidic linkages are chiral.
[0616] In some embodiments, a single oligonucleotide of a provided
composition comprises a region in which at least one of the first,
second, third, fifth, seventh, eighth, ninth, eighteenth,
nineteenth and twentieth internucleotidic linkages is chiral, and
at least one internucleotidic linkage is achiral. In some
embodiments, a single oligonucleotide of a provided composition
comprises a region in which at least one of the first, second,
third, fifth, seventh, eighteenth, nineteenth and twentieth
internucleotidic linkages is chiral, and at least one
internucleotidic linkage is achiral. In some embodiments, at least
two internucleotidic linkages are achiral. In some embodiments, at
least three internucleotidic linkages are achiral. In some
embodiments, at least four internucleotidic linkages are achiral.
In some embodiments, at least five internucleotidic linkages are
achiral. In some embodiments, at least six internucleotidic
linkages are achiral. In some embodiments, at least seven
internucleotidic linkages are achiral. In some embodiments, at
least eight internucleotidic linkages are achiral. In some
embodiments, at least nine internucleotidic linkages are achiral.
In some embodiments, at least 10 internucleotidic linkages are
achiral. In some embodiments, at least 11 internucleotidic linkages
are achiral. In some embodiments, at least 12 internucleotidic
linkages are achiral. In some embodiments, at least 13
internucleotidic linkages are achiral. In some embodiments, at
least 14 internucleotidic linkages are achiral. In some
embodiments, at least 15 internucleotidic linkages are achiral. In
some embodiments, at least 16 internucleotidic linkages are
achiral. In some embodiments, at least 17 internucleotidic linkages
are achiral. In some embodiments, at least 18 internucleotidic
linkages are achiral. In some embodiments, at least 19
internucleotidic linkages are achiral. In some embodiments, at
least 20 internucleotidic linkages are achiral. In some
embodiments, one internucleotidic linkage is achiral. In some
embodiments, two internucleotidic linkages are achiral. In some
embodiments, three internucleotidic linkages are achiral. In some
embodiments, four internucleotidic linkages are achiral. In some
embodiments, five internucleotidic linkages are achiral. In some
embodiments, six internucleotidic linkages are achiral. In some
embodiments, seven internucleotidic linkages are achiral. In some
embodiments, eight internucleotidic linkages are achiral. In some
embodiments, nine internucleotidic linkages are achiral. In some
embodiments, 10 internucleotidic linkages are achiral. In some
embodiments, 11 internucleotidic linkages are achiral. In some
embodiments, 12 internucleotidic linkages are achiral. In some
embodiments, 13 internucleotidic linkages are achiral. In some
embodiments, 14 internucleotidic linkages are achiral. In some
embodiments, 15 internucleotidic linkages are achiral. In some
embodiments, 16 internucleotidic linkages are achiral. In some
embodiments, 17 internucleotidic linkages are achiral. In some
embodiments, 18 internucleotidic linkages are achiral. In some
embodiments, 19 internucleotidic linkages are achiral. In some
embodiments, 20 internucleotidic linkages are achiral. In some
embodiments, a single oligonucleotide of a provided composition
comprises a region in which all internucleotidic linkages, except
the at least one of the first, second, third, fifth, seventh,
eighth, ninth, eighteenth, nineteenth and twentieth
internucleotidic linkages which is chiral, are achiral.
[0617] In some embodiments, a single oligonucleotide of a provided
composition comprises a region in which at least one of the first,
second, third, fifth, seventh, eighth, ninth, eighteenth,
nineteenth and twentieth internucleotidic linkages is chiral, and
at least one internucleotidic linkage is phosphate. In some
embodiments, a single oligonucleotide of a provided composition
comprises a region in which at least one of the first, second,
third, fifth, seventh, eighteenth, nineteenth and twentieth
internucleotidic linkages is chiral, and at least one
internucleotidic linkage is phosphate. In some embodiments, at
least two internucleotidic linkages are phosphate. In some
embodiments, at least three internucleotidic linkages are
phosphate. In some embodiments, at least four internucleotidic
linkages are phosphate. In some embodiments, at least five
internucleotidic linkages are phosphate. In some embodiments, at
least six internucleotidic linkages are phosphate. In some
embodiments, at least seven internucleotidic linkages are
phosphate. In some embodiments, at least eight internucleotidic
linkages are phosphate. In some embodiments, at least nine
internucleotidic linkages are phosphate. In some embodiments, at
least 10 internucleotidic linkages are phosphate. In some
embodiments, at least 11 internucleotidic linkages are phosphate.
In some embodiments, at least 12 internucleotidic linkages are
phosphate. In some embodiments, at least 13 internucleotidic
linkages are phosphate. In some embodiments, at least 14
internucleotidic linkages are phosphate. In some embodiments, at
least 15 internucleotidic linkages are phosphate. In some
embodiments, at least 16 internucleotidic linkages are phosphate.
In some embodiments, at least 17 internucleotidic linkages are
phosphate. In some embodiments, at least 18 internucleotidic
linkages are phosphate. In some embodiments, at least 19
internucleotidic linkages are phosphate. In some embodiments, at
least 20 internucleotidic linkages are phosphate. In some
embodiments, one internucleotidic linkage is phosphate. In some
embodiments, two internucleotidic linkages are phosphate. In some
embodiments, three internucleotidic linkages are phosphate. In some
embodiments, four internucleotidic linkages are phosphate. In some
embodiments, five internucleotidic linkages are phosphate. In some
embodiments, six internucleotidic linkages are phosphate. In some
embodiments, seven internucleotidic linkages are phosphate. In some
embodiments, eight internucleotidic linkages are phosphate. In some
embodiments, nine internucleotidic linkages are phosphate. In some
embodiments, 10 internucleotidic linkages are phosphate. In some
embodiments, 11 internucleotidic linkages are phosphate. In some
embodiments, 12 internucleotidic linkages are phosphate. In some
embodiments, 13 internucleotidic linkages are phosphate. In some
embodiments, 14 internucleotidic linkages are phosphate. In some
embodiments, 15 internucleotidic linkages are phosphate. In some
embodiments, 16 internucleotidic linkages are phosphate. In some
embodiments, 17 internucleotidic linkages are phosphate. In some
embodiments, 18 internucleotidic linkages are phosphate. In some
embodiments, 19 internucleotidic linkages are phosphate. In some
embodiments, 20 internucleotidic linkages are phosphate. In some
embodiments, a single oligonucleotide of a provided composition
comprises a region in which all internucleotidic linkages, except
the at least one of the first, second, third, fifth, seventh,
eighth, ninth, eighteenth, nineteenth and twentieth
internucleotidic linkages which is chiral, are phosphate.
[0618] In some embodiments, a single oligonucleotide of a provided
composition comprises a region in which at least one of the first,
second, third, fifth, seventh, eighth, ninth, eighteenth,
nineteenth and twentieth internucleotidic linkages are chiral, and
at least 10% of all the internucleotidic linkages in the region is
achiral. In some embodiments, a single oligonucleotide of a
provided composition comprises a region in which at least one of
the first, second, third, fifth, seventh, eighteenth, nineteenth
and twentieth internucleotidic linkages is chiral, and at least 10%
of all the internucleotidic linkages in the region are achiral. In
some embodiments, at least 20% of all the internucleotidic linkages
in the region are achiral. In some embodiments, at least 30% of all
the internucleotidic linkages in the region are achiral. In some
embodiments, at least 40% of all the internucleotidic linkages in
the region are achiral. In some embodiments, at least 50% of all
the internucleotidic linkages in the region are achiral. In some
embodiments, at least 60% of all the internucleotidic linkages in
the region are achiral. In some embodiments, at least 70% of all
the internucleotidic linkages in the region are achiral. In some
embodiments, at least 80% of all the internucleotidic linkages in
the region are achiral. In some embodiments, at least 90% of all
the internucleotidic linkages in the region are achiral. In some
embodiments, at least 50% of all the internucleotidic linkages in
the region are achiral. In some embodiments, an achiral
internucleotidic linkage is a phosphate linkage. In some
embodiments, each achiral internucleotidic linkage in a phosphate
linkage.
[0619] In some embodiments, the first internucleotidic linkage of
the region is an Sp modified internucleotidic linkage. In some
embodiments, the first internucleotidic linkage of the region is an
Rp modified internucleotidic linkage. In some embodiments, the
second internucleotidic linkage of the region is an Sp modified
internucleotidic linkage. In some embodiments, the second
internucleotidic linkage of the region is an Rp modified
internucleotidic linkage. In some embodiments, the third
internucleotidic linkage of the region is an Sp modified
internucleotidic linkage. In some embodiments, the third
internucleotidic linkage of the region is an Rp modified
internucleotidic linkage. In some embodiments, the fifth
internucleotidic linkage of the region is an Sp modified
internucleotidic linkage. In some embodiments, the fifth
internucleotidic linkage of the region is an Rp modified
internucleotidic linkage. In some embodiments, the seventh
internucleotidic linkage of the region is an Sp modified
internucleotidic linkage. In some embodiments, the seventh
internucleotidic linkage of the region is an Rp modified
internucleotidic linkage. In some embodiments, the eighth
internucleotidic linkage of the region is an Sp modified
internucleotidic linkage. In some embodiments, the eighth
internucleotidic linkage of the region is an Rp modified
internucleotidic linkage. In some embodiments, the ninth
internucleotidic linkage of the region is an Sp modified
internucleotidic linkage. In some embodiments, the ninth
internucleotidic linkage of the region is an Rp modified
internucleotidic linkage. In some embodiments, the eighteenth
internucleotidic linkage of the region is an Sp modified
internucleotidic linkage. In some embodiments, the eighteenth
internucleotidic linkage of the region is an Rp modified
internucleotidic linkage. In some embodiments, the nineteenth
internucleotidic linkage of the region is an Sp modified
internucleotidic linkage. In some embodiments, the nineteenth
internucleotidic linkage of the region is an Rp modified
internucleotidic linkage. In some embodiments, the twentieth
internucleotidic linkage of the region is an Sp modified
internucleotidic linkage. In some embodiments, the twentieth
internucleotidic linkage of the region is an Rp modified
internucleotidic linkage.
[0620] In some embodiments, the region has a length of at least 21
bases. In some embodiments, the region has a length of 21 bases. In
some embodiments, a single oligonucleotide in a provided
composition has a length of at least 21 bases. In some embodiments,
a single oligonucleotide in a provided composition has a length of
21 bases.
[0621] In some embodiments, a chiral internucleotidic linkage has
the structure of formula I. In some embodiments, a chiral
internucleotidic linkage is phosphorothioate. In some embodiments,
each chiral internucleotidic linkage in a single oligonucleotide of
a provided composition independently has the structure of formula
I. In some embodiments, each chiral internucleotidic linkage in a
single oligonucleotide of a provided composition is a
phosphorothioate.
[0622] In some embodiments, oligonucleotides of the present
disclosure comprise one or more modified sugar moieties. In some
embodiments, oligonucleotides of the present disclosure comprise
one or more modified base moieties. As known by a person of
ordinary skill in the art and described in the disclosure, various
modifications can be introduced to a sugar and/or moiety. For
example, in some embodiments, a modification is a modification
described in U.S. Pat. No. 9,006,198 and WO2014/012081, the sugar
and base modifications of each of which are incorporated herein by
reference.
[0623] In some embodiments, a sugar modification is a
2'-modification. Commonly used 2'-modifications include but are not
limited to 2'-OR.sup.1, wherein R.sup.1 is not hydrogen. In some
embodiments, a modification is 2'-OR, wherein R is optionally
substituted aliphatic. In some embodiments, a modification is
2'-OMe. In some embodiments, a modification is 2'-MOE. In some
embodiments, the present disclosure demonstrates that inclusion
and/or location of particular chirally pure internucleotidic
linkages can provide stability improvements comparable to or better
than those achieved through use of modified backbone linkages,
bases, and/or sugars. In some embodiments, a provided single
oligonucleotide of a provided composition has no modifications on
the sugars. In some embodiments, a provided single oligonucleotide
of a provided composition has no modifications on 2'-positions of
the sugars (i.e., the two groups at the 2'-position are either
--H/--H or --H/--OH). In some embodiments, a provided single
oligonucleotide of a provided composition does not have any 2'-MOE
modifications.
[0624] In some embodiments, a 2'-modification is --O-L- or -L-
which connects the 2'-carbon of a sugar moiety to another carbon of
a sugar moiety. In some embodiments, a 2'-modification is --O-L- or
-L- which connects the 2'-carbon of a sugar moiety to the 4'-carbon
of a sugar moiety. In some embodiments, a 2'-modification is S-cEt.
In some embodiments, a modified sugar moiety is an LNA moiety.
[0625] In some embodiments, a 2'-modification is --F. In some
embodiments, a 2'-modification is FANA. In some embodiments, a
2'-modification is FRNA.
[0626] In some embodiments, a sugar modification is a
5'-modification, e.g., R-5'-Me, S-5'-Me, etc.
[0627] In some embodiments, a sugar modification changes the size
of the sugar ring. In some embodiments, a sugar modification is the
sugar moiety in FHNA.
[0628] In some embodiments, a single oligonucleotide in a provided
composition is a better substrate for Argonaute proteins (e.g.,
hAgo-1 and hAgo-2) compared to stereorandom oligonucleotide
compositions. Selection and/or location of chirally pure linkages
as described in the present closure are useful design parameters
for oligonucleotides that interacting with such proteins, such as
siRNA.
[0629] In some embodiments, a single oligonucleotide in a provided
composition has at least about 25% of its internucleotidic linkages
in Sp configuration. In some embodiments, a single oligonucleotide
in a provided composition has at least about 30% of its
internucleotidic linkages in Sp configuration. In some embodiments,
a single oligonucleotide in a provided composition has at least
about 35% of its internucleotidic linkages in Sp configuration. In
some embodiments, a single oligonucleotide in a provided
composition has at least about 40% of its internucleotidic linkages
in Sp configuration. In some embodiments, a single oligonucleotide
in a provided composition has at least about 45% of its
internucleotidic linkages in Sp configuration. In some embodiments,
a single oligonucleotide in a provided composition has at least
about 50% of its internucleotidic linkages in Sp configuration. In
some embodiments, a single oligonucleotide in a provided
composition has at least about 55% of its internucleotidic linkages
in Sp configuration. In some embodiments, a single oligonucleotide
in a provided composition has at least about 60% of its
internucleotidic linkages in Sp configuration. In some embodiments,
a single oligonucleotide in a provided composition has at least
about 65% of its internucleotidic linkages in Sp configuration. In
some embodiments, a single oligonucleotide in a provided
composition has at least about 70% of its internucleotidic linkages
in Sp configuration. In some embodiments, a single oligonucleotide
in a provided composition has at least about 75% of its
internucleotidic linkages in Sp configuration. In some embodiments,
a single oligonucleotide in a provided composition has at least
about 80% of its internucleotidic linkages in Sp configuration. In
some embodiments, a single oligonucleotide in a provided
composition has at least about 85% of its internucleotidic linkages
in Sp configuration. In some embodiments, a single oligonucleotide
in a provided composition has at least about 90% of its
internucleotidic linkages in Sp configuration.
[0630] In some embodiments, oligonucleotides in a provided
composition is not an oligonucleotide selected from:
T.sub.kT.sub.k.sup.mC.sub.kAGT.sup.mCATGA.sup.mCT.sub.kT.sup.mC.sub.k.sup-
.mC.sub.k (SEQ ID NO: 38), wherein each nucleoside followed by a
subscript `k` indicates a (S)-cEt modification, R is Rp
phosphorothioate linkage, S is Sp phosphorothioate linkage, each
.sup.mC is a 5-methylcytosine modified nucleoside, and all
internucleoside linkages are phosphorothioates (PS) with
stereochemistry patterns selected from RSSSRSRRRS, RSSSSSSSSS,
SRRSRSSSSR, SRSRSSRSSR, RRRSSSRSSS, RRRSRSSRSR, RRSSSRSRSR,
SRSSSRSSSS, SSRRSSRSRS, SSSSSSSSRRSS, RRRSSRRRSR, RRRRSSSSRS,
SRRSRRRRRR, RSSRSSRRRR, RSRRSRRSRR, RRSRSSRSRS, SSRRRRRSRR,
RSRRSRSSSR, RRSSRSRRRR, RRSRSRRSSS, RRSRSSSRRR, RSRRRRSRSR,
SSRSSSRRRS, RSSRSRSRSR, RSRSRSSRSS, RRRSSRRSRS, SRRSSRRSRS,
RRRRSRSRRR, SSSSRRRRSR, RRRRRRRRRR and SSSSSSSSSS.
[0631] In some embodiments, a single oligonucleotide in a provided
composition is not an oligonucleotide selected from:
T.sub.kT.sub.k.sup.mC.sub.kAGT.sup.mCATGA.sup.mCTT.sub.k.sup.mC.sub.k.sup-
.mC.sub.k (SEQ ID NO: 39), wherein each nucleoside followed by a
subscript `k` indicates a (S)-cEt modification, R is Rp
phosphorothioate linkage, S is Sp phosphorothioate linkage, each
.sup.mC is a 5-methylcytosine modified nucleoside and all core
internucleoside linkages are phosphorothioates (PS) with
stereochemistry patterns selected from: RSSSRSRRRS, RSSSSSSSSS,
SRRSRSSSSR, SRSRSSRSSR, RRRSSSRSSS, RRRSRSSRSR, RRSSSRSRSR,
SRSSSRSSSS, SSRRSSRSRS, SSSSSSSSRRSS, RRRSSRRRSR, RRRRSSSSRS,
SRRSRRRRRR, RSSRSSRRRR, RSRRSRRSRR, RRSRSSRSRS, SSRRRRRSRR,
RSRRSRSSSR, RRSSRSRRRR, RRSRSRRSSS, RRSRSSSRRR, RSRRRRSRSR,
SSRSSSRRRS, RSSRSRSRSR, RSRSRSSRSS, RRRSSRRSRS, SRRSSRRSRS,
RRRRSRSRRR, SSSSRRRRSR, RRRRRRRRRR and SSSSSSSSSS.
Chirally Controlled Oligonucleotides and Chirally Controlled
Oligonucleotide Compositions
[0632] The present disclosure provides chirally controlled
oligonucleotides, and chirally controlled oligonucleotide
compositions which are of high crude purity and of high
diastereomeric purity. In some embodiments, the present disclosure
provides chirally controlled oligonucleotides, and chirally
controlled oligonucleotide compositions which are of high crude
purity. In some embodiments, the present disclosure provides
chirally controlled oligonucleotides, and chirally controlled
oligonucleotide compositions which are of high diastereomeric
purity.
[0633] In some embodiments, a chirally controlled oligonucleotide
composition is a substantially pure preparation of an
oligonucleotide type in that oligonucleotides in the composition
that are not of the oligonucleotide type are impurities form the
preparation process of said oligonucleotide type, in some case,
after certain purification procedures.
[0634] In some embodiments, the present disclosure provides
oligonucleotides comprising one or more diastereomerically pure
internucleotidic linkages with respect to the chiral linkage
phosphorus. In some embodiments, the present disclosure provides
oligonucleotides comprising one or more diastereomerically pure
internucleotidic linkages having the structure of formula I. In
some embodiments, the present disclosure provides oligonucleotides
comprising one or more diastereomerically pure internucleotidic
linkages with respect to the chiral linkage phosphorus, and one or
more phosphate diester linkages. In some embodiments, the present
disclosure provides oligonucleotides comprising one or more
diastereomerically pure internucleotidic linkages having the
structure of formula I, and one or more phosphate diester linkages.
In some embodiments, the present disclosure provides
oligonucleotides comprising one or more diastereomerically pure
internucleotidic linkages having the structure of formula I-c, and
one or more phosphate diester linkages. In some embodiments, such
oligonucleotides are prepared by using stereoselective
oligonucleotide synthesis, as described in this application, to
form pre-designed diastereomerically pure internucleotidic linkages
with respect to the chiral linkage phosphorus. For instance, in one
example oligonucleotide of (Rp/Sp, Rp/Sp, Rp/Sp, Rp, Rp, Sp, Sp,
Sp, Sp, Sp Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp,
Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGs1Cs1As1CsC] (SEQ ID NO: 40),
the first three internucleotidic linkages are constructed using
traditional oligonucleotide synthesis method, and the
diastereomerically pure internucleotidic linkages are constructed
with stereochemical control as described in this application.
Example internucleotidic linkages, including those having
structures of formula I, are further described below.
[0635] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide, wherein at least two of the
individual internucleotidic linkages within the oligonucleotide
have different stereochemistry and/or different P-modifications
relative to one another. In certain embodiments, the present
disclosure provides a chirally controlled oligonucleotide, wherein
at least two individual internucleotidic linkages within the
oligonucleotide have different P-modifications relative to one
another. In certain embodiments, the present disclosure provides a
chirally controlled oligonucleotide, wherein at least two of the
individual internucleotidic linkages within the oligonucleotide
have different P-modifications relative to one another, and wherein
the chirally controlled oligonucleotide comprises at least one
phosphate diester internucleotidic linkage. In certain embodiments,
the present disclosure provides a chirally controlled
oligonucleotide, wherein at least two of the individual
internucleotidic linkages within the oligonucleotide have different
P-modifications relative to one another, and wherein the chirally
controlled oligonucleotide comprises at least one phosphate diester
internucleotidic linkage and at least one phosphorothioate diester
internucleotidic linkage. In certain embodiments, the present
disclosure provides a chirally controlled oligonucleotide, wherein
at least two of the individual internucleotidic linkages within the
oligonucleotide have different P-modifications relative to one
another, and wherein the chirally controlled oligonucleotide
comprises at least one phosphorothioate triester internucleotidic
linkage. In certain embodiments, the present disclosure provides a
chirally controlled oligonucleotide, wherein at least two of the
individual internucleotidic linkages within the oligonucleotide
have different P-modifications relative to one another, and wherein
the chirally controlled oligonucleotide comprises at least one
phosphate diester internucleotidic linkage and at least one
phosphorothioate triester internucleotidic linkage.
[0636] In certain embodiments, a modified internucleotidic linkages
has the structure of formula I:
##STR00025##
wherein each variable is as defined and described below. In some
embodiments, a linkage of formula I is chiral. In some embodiments,
the present disclosure provides a chirally controlled
oligonucleotide comprising one or more modified internucleotidic
linkages of formula I. In some embodiments, the present disclosure
provides a chirally controlled oligonucleotide comprising one or
more modified internucleotidic linkages of formula I, and wherein
individual internucleotidic linkages of formula I within the
oligonucleotide have different P-modifications relative to one
another. In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide comprising one or more modified
internucleotidic linkages of formula I, and wherein individual
internucleotidic linkages of formula I within the oligonucleotide
have different --X-L-R.sup.1 relative to one another. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide comprising one or more modified internucleotidic
linkages of formula I, and wherein individual internucleotidic
linkages of formula I within the oligonucleotide have different X
relative to one another. In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide
comprising one or more modified internucleotidic linkages of
formula I, and wherein individual internucleotidic linkages of
formula I within the oligonucleotide have different -L-R.sup.1
relative to one another. In some embodiments, a chirally controlled
oligonucleotide is an oligonucleotide in a provided composition
that is of the particular oligonucleotide type. In some
embodiments, a chirally controlled oligonucleotide is an
oligonucleotide in a provided composition that has the common base
sequence and length, the common pattern of backbone linkages, and
the common pattern of backbone chiral centers.
[0637] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide, wherein at least two of the
individual internucleotidic linkages within the oligonucleotide
have different stereochemistry and/or different P-modifications
relative to one another. In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide, wherein
at least two of the individual internucleotidic linkages within the
oligonucleotide have different stereochemistry relative to one
another, and wherein at least a portion of the structure of the
chirally controlled oligonucleotide is characterized by a repeating
pattern of alternating stereochemistry.
[0638] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide, wherein at least two of the
individual internucleotidic linkages within the oligonucleotide
have different P-modifications relative to one another, in that
they have different X atoms in their --XLR.sup.1 moieties, and/or
in that they have different L groups in their --XLR moieties,
and/or that they have different R.sup.1 atoms in their --XLR.sup.1
moieties.
[0639] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide, wherein at least two of the
individual internucleotidic linkages within the oligonucleotide
have different stereochemistry and/or different P-modifications
relative to one another and the oligonucleotide has a structure
represented by the following formula:
[S.sup.Bn1R.sup.Bn2S.sup.Bn3R.sup.Bn4 . . . S.sup.BnxR.sup.Bny]
wherein: each R.sup.B independently represents a block of
nucleotide units having the R configuration at the linkage
phosphorus; each S.sup.B independently represents a block of
nucleotide units having the S configuration at the linkage
phosphorus; each of n1-ny is zero or an integer, with the
requirement that at least one odd n and at least one even n must be
non-zero so that the oligonucleotide includes at least two
individual internucleotidic linkages with different stereochemistry
relative to one another; and wherein the sum of n1-ny is between 2
and 200, and in some embodiments is between a lower limit selected
from the group consisting of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more and an
upper limit selected from the group consisting of 5, 10, 15, 20,
25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100,
110, 120, 130, 140, 150, 160, 170, 180, 190, and 200, the upper
limit being larger than the lower limit.
[0640] In some such embodiments, each n has the same value; in some
embodiments, each even n has the same value as each other even n;
in some embodiments, each odd n has the same value each other odd
n; in some embodiments, at least two even ns have different values
from one another; in some embodiments, at least two odd ns have
different values from one another.
[0641] In some embodiments, at least two adjacent ns are equal to
one another, so that a provided oligonucleotide includes adjacent
blocks of S stereochemistry linkages and R stereochemistry linkages
of equal lengths. In some embodiments, provided oligonucleotides
include repeating blocks of S and R stereochemistry linkages of
equal lengths. In some embodiments, provided oligonucleotides
include repeating blocks of S and R stereochemistry linkages, where
at least two such blocks are of different lengths from one another;
in some such embodiments each S stereochemistry block is of the
same length, and is of a different length from each R
stereochemistry length, which may optionally be of the same length
as one another.
[0642] In some embodiments, at least two skip-adjacent ns are equal
to one another, so that a provided oligonucleotide includes at
least two blocks of linkages of a first stereochemistry that are
equal in length to one another and are separated by a block of
linkages of the other stereochemistry, which separating block may
be of the same length or a different length from the blocks of
first stereochemistry.
[0643] In some embodiments, ns associated with linkage blocks at
the ends of a provided oligonucleotide are of the same length. In
some embodiments, provided oligonucleotides have terminal blocks of
the same linkage stereochemistry. In some such embodiments, the
terminal blocks are separated from one another by a middle block of
the other linkage stereochemistry.
[0644] In some embodiments, a provided oligonucleotide of formula
[S.sup.Bn1R.sup.Bn2S.sup.Bn3R.sup.Bn4 . . . S.sup.BnxR.sup.Bny] is
a stereoblockmer. In some embodiments, a provided oligonucleotide
of formula [S.sup.Bn1R.sup.Bn2S.sup.Bn3R.sup.Bn4 . . .
S.sup.BnxR.sup.Bny] is a stereoskipmer. In some embodiments, a
provided oligonucleotide of formula
[S.sup.Bn1R.sup.Bn2S.sup.Bn3R.sup.Bn4 . . . S.sup.BnxR.sup.Bny] is
a stereoaltmer. In some embodiments, a provided oligonucleotide of
formula [S.sup.Bn1R.sup.Bn2S.sup.Bn3R.sup.Bn4 . . .
S.sup.BnxR.sup.Bny] is a gapmer.
[0645] In some embodiments, a provided oligonucleotide of formula
[S.sup.Bn1R.sup.Bn2S.sup.Bn3R.sup.Bn4 . . . S.sup.BnxR.sup.Bny] is
of any of the above described patterns and further comprises
patterns of P-modifications. For instance, in some embodiments, a
provided oligonucleotide of formula
[S.sup.Bn1R.sup.Bn2S.sup.Bn3R.sup.Bn4 . . . S.sup.BnxR.sup.Bny] and
is a stereoskipmer and P-modification skipmer. In some embodiments,
a provided oligonucleotide of formula
[S.sup.Bn1R.sup.Bn2S.sup.Bn3R.sup.Bn4 . . . S.sup.BnxR.sup.Bny] and
is a stereoblockmer and P-modification altmer. In some embodiments,
a provided oligonucleotide of formula
[S.sup.Bn1R.sup.Bn2S.sup.Bn3R.sup.Bn4 . . . S.sup.BnxR.sup.Bny] and
is a stereoaltmer and P-modification blockmer.
[0646] In some embodiments, a provided oligonucleotide of formula
[S.sup.Bn1R.sup.Bn2S.sup.Bn3R.sup.Bn4 . . . S.sup.BnxR.sup.Bny] is
a chirally controlled oligonucleotide comprising one or more
modified internuceotidic linkages independently having the
structure of formula I:
##STR00026##
wherein: [0647] P* is an asymmetric phosphorus atom and is either
Rp or Sp; [0648] W is O, S or Se; [0649] each of X, Y and Z is
independently --O--, --S--, --N(-L-R.sup.1)--, or L; [0650] L is a
covalent bond or an optionally substituted, linear or branched
C.sub.1-C.sub.10 alkylene, wherein one or more methylene units of L
are optionally and independently replaced by an optionally
substituted group selected from C.sub.1-C.sub.6 alkylene,
C.sub.1-C.sub.6 alkenylene, --C.ident.--, a C.sub.1-C.sub.6
heteroaliphatic moiety, --C(R').sub.2--, -Cy-, --O--, --S--,
--S--S--, --N(R')--, --C(O)--, --C(S)--, --C(NR')--, --C(O)N(R')--,
--N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--,
--S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--,
--N(R')S(O).sub.2--SC(O)--, --C(O)S--, --OC(O)--, and --C(O)O--;
[0651] R.sup.1 is halogen, R, or an optionally substituted
C.sub.1-C.sub.50 aliphatic wherein one or more methylene units are
optionally and independently replaced by an optionally substituted
group selected from C.sub.1-C.sub.6 alkylene, C.sub.1-C.sub.6
alkenylene, --C.ident.C--, a C.sub.1-C.sub.6 heteroaliphatic
moiety, --C(R').sub.2--, -Cy-, --O--, --S--, --S--S--, --N(R')--,
--C(O)--, --C(S)--, --C(NR')--, --C(O)N(R')--, --N(R')C(O)N(R')--,
--N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--, --S(O)--,
--S(O).sub.2--, --S(O).sub.2N(R')--, --N(R')S(O).sub.2--SC(O)--,
--C(O)S--, --OC(O)--, and --C(O)O-- [0652] each R' is independently
--R, --C(O)R, --CO.sub.2R, or --SO.sub.2R, or: [0653] two R' are
taken together with their intervening atoms to form an optionally
substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring;
[0654] -Cy- is an optionally substituted bivalent ring selected
from phenylene, carbocyclylene, arylene, heteroarylene, and
heterocyclylene; [0655] each R is independently hydrogen, or an
optionally substituted group selected from C.sub.1-C.sub.6
aliphatic, carbocyclyl, aryl, heteroaryl, and heterocyclyl; and
[0656] each
[0656] ##STR00027## independently represents a connection to a
nucleoside.
[0657] In some embodiments, L is a covalent bond or an optionally
substituted, linear or branched C.sub.1-C.sub.10 alkylene, wherein
one or more methylene units of L are optionally and independently
replaced by an optionally substituted C.sub.1-C.sub.6 alkylene,
C.sub.1-C.sub.6 alkenylene, --C.ident.C--, --C(R').sub.2--, -Cy-,
--O--, --S--, --S--S--, --N(R')--, --C(O)--, --C(S)--, --C(NR')--,
--C(O)N(R')--, --N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--,
--OC(O)N(R')--, --S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--,
--N(R')S(O).sub.2--, --SC(O)--, --C(O)S--, --OC(O)--, or --C(O)O--;
[0658] R.sup.1 is halogen, R, or an optionally substituted
C.sub.1-C.sub.50 aliphatic wherein one or more methylene units are
optionally and independently replaced by an optionally substituted
C.sub.1-C.sub.6 alkylene, C.sub.1-C.sub.6 alkenylene,
--C.ident.C--, --C(R').sub.2--, -Cy-, --O--, --S--, --S--S--,
--N(R')--, --C(O)--, --C(S)--, --C(NR')--, --C(O)N(R')--,
--N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--,
--S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--, --N(R')S(O).sub.2--,
--SC(O)--, --C(O)S--, --OC(O)--, or --C(O)O--; each R' is
independently --R, --C(O)R, --CO.sub.2R, or --SO.sub.2R, or: [0659]
two R' on the same nitrogen are taken together with their
intervening atoms to form an optionally substituted heterocyclic or
heteroaryl ring, or [0660] two R' on the same carbon are taken
together with their intervening atoms to form an optionally
substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring;
[0661] -Cy- is an optionally substituted bivalent ring selected
from phenylene, carbocyclylene, arylene, heteroarylene, or
heterocyclylene; [0662] each R is independently hydrogen, or an
optionally substituted group selected from C.sub.1-C.sub.6
aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl;
and [0663] each
[0663] ##STR00028## independently represents a connection to a
nucleoside.
[0664] In some embodiments, a chirally controlled oligonucleotide
comprises one or more modified internucleotidic phosphorus
linkages. In some embodiments, a chirally controlled
oligonucleotide comprises, e.g., a phosphorothioate or a
phosphorothioate triester linkage. In some embodiments, a chirally
controlled oligonucleotide comprises a phosphorothioate triester
linkage. In some embodiments, a chirally controlled oligonucleotide
comprises at least two phosphorothioate triester linkages. In some
embodiments, a chirally controlled oligonucleotide comprises at
least three phosphorothioate triester linkages. In some
embodiments, a chirally controlled oligonucleotide comprises at
least four phosphorothioate triester linkages. In some embodiments,
a chirally controlled oligonucleotide comprises at least five
phosphorothioate triester linkages. Examples of such modified
internucleotidic phosphorus linkages are described further
herein.
[0665] In some embodiments, a chirally controlled oligonucleotide
comprises different internucleotidic phosphorus linkages. In some
embodiments, a chirally controlled oligonucleotide comprises at
least one phosphate diester internucleotidic linkage and at least
one modified internucleotidic linkage. In some embodiments, a
chirally controlled oligonucleotide comprises at least one
phosphate diester internucleotidic linkage and at least one
phosphorothioate triester linkage. In some embodiments, a chirally
controlled oligonucleotide comprises at least one phosphate diester
internucleotidic linkage and at least two phosphorothioate triester
linkages. In some embodiments, a chirally controlled
oligonucleotide comprises at least one phosphate diester
internucleotidic linkage and at least three phosphorothioate
triester linkages. In some embodiments, a chirally controlled
oligonucleotide comprises at least one phosphate diester
internucleotidic linkage and at least four phosphorothioate
triester linkages. In some embodiments, a chirally controlled
oligonucleotide comprises at least one phosphate diester
internucleotidic linkage and at least five phosphorothioate
triester linkages. Examples of such modified internucleotidic
phosphorus linkages are described further herein.
[0666] In some embodiments, a phosphorothioate triester linkage
comprises a chiral auxiliary, which, for example, is used to
control the stereoselectivity of a reaction. In some embodiments, a
phosphorothioate triester linkage does not comprise a chiral
auxiliary. In some embodiments, a phosphorothioate triester linkage
is intentionally maintained until and/or during the administration
to a subject.
[0667] In some embodiments, a chirally controlled oligonucleotide
is linked to a solid support. In some embodiments, a chirally
controlled oligonucleotide is cleaved from a solid support.
[0668] In some embodiments, a chirally controlled oligonucleotide
comprises at least one phosphate diester internucleotidic linkage
and at least two consecutive modified internucleotidic linkages. In
some embodiments, a chirally controlled oligonucleotide comprises
at least one phosphate diester internucleotidic linkage and at
least two consecutive phosphorothioate triester internucleotidic
linkages.
[0669] In some embodiments, a chirally controlled oligonucleotide
is a blockmer. In some embodiments, a chirally controlled
oligonucleotide is a stereoblockmer. In some embodiments, a
chirally controlled oligonucleotide is a P-modification blockmer.
In some embodiments, a chirally controlled oligonucleotide is a
linkage blockmer.
[0670] In some embodiments, a chirally controlled oligonucleotide
is an altmer. In some embodiments, a chirally controlled
oligonucleotide is a stereoaltmer. In some embodiments, a chirally
controlled oligonucleotide is a P-modification altmer. In some
embodiments, a chirally controlled oligonucleotide is a linkage
altmer.
[0671] In some embodiments, a chirally controlled oligonucleotide
is a unimer. In some embodiments, a chirally controlled
oligonucleotide is a stereounimer. In some embodiments, a chirally
controlled oligonucleotide is a P-modification unimer. In some
embodiments, a chirally controlled oligonucleotide is a linkage
unimer.
[0672] In some embodiments, a chirally controlled oligonucleotide
is a gapmer.
[0673] In some embodiments, a chirally controlled oligonucleotide
is a skipmer.
[0674] In some embodiments, the present disclosure provides
oligonucleotides comprising one or more modified internucleotidic
linkages independently having the structure of formula I:
##STR00029##
wherein: [0675] P* is an asymmetric phosphorus atom and is either
Rp or Sp; [0676] W is O, S or Se; [0677] each of X, Y and Z is
independently --O--, --S--, --N(-L-R.sup.1)--, or L; [0678] L is a
covalent bond or an optionally substituted, linear or branched
C.sub.1-C.sub.10 alkylene, wherein one or more methylene units of L
are optionally and independently replaced by an optionally
substituted group selected from C.sub.1-C.sub.6 alkylene,
C.sub.1-C.sub.6 alkenylene, --C.ident.--, a C.sub.1-C.sub.6
heteroaliphatic moiety, --C(R').sub.2--, -Cy-, --O--, --S--,
--S--S--, --N(R')--, --C(O)--, --C(S)--, --C(NR')--, --C(O)N(R')--,
--N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--,
--S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--,
--N(R')S(O).sub.2--SC(O)--, --C(O)S--, --OC(O)--, and --C(O)O--;
[0679] R.sup.1 is halogen, R, or an optionally substituted
C.sub.1-C.sub.50 aliphatic wherein one or more methylene units are
optionally and independently replaced by an optionally substituted
group selected from C.sub.1-C.sub.6 alkylene, C.sub.1-C.sub.6
alkenylene, --C.ident.C--, a C.sub.1-C.sub.6 heteroaliphatic
moiety, --C(R').sub.2--, -Cy-, --O--, --S--, --S--S--, --N(R')--,
--C(O)--, --C(S)--, --C(NR')--, --C(O)N(R')--, --N(R')C(O)N(R')--,
--N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--, --S(O)--,
--S(O).sub.2--, --S(O).sub.2N(R')--, --N(R')S(O).sub.2--SC(O)--,
--C(O)S--, --OC(O)--, and --C(O)O-- [0680] each R' is independently
--R, --C(O)R, --CO.sub.2R, or --SO.sub.2R, or: [0681] two R' are
taken together with their intervening atoms to form an optionally
substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring;
[0682] -Cy- is an optionally substituted bivalent ring selected
from phenylene, carbocyclylene, arylene, heteroarylene, and
heterocyclylene; [0683] each R is independently hydrogen, or an
optionally substituted group selected from C.sub.1-C.sub.6
aliphatic, carbocyclyl, aryl, heteroaryl, and heterocyclyl; and
[0684] each
[0684] ##STR00030## independently represents a connection to a
nucleoside.
[0685] In some embodiments, L is a covalent bond or an optionally
substituted, linear or branched C.sub.1-C.sub.10 alkylene, wherein
one or more methylene units of L are optionally and independently
replaced by an optionally substituted C.sub.1-C.sub.6 alkylene,
C.sub.1-C.sub.6 alkenylene, --C.ident.C--, --C(R').sub.2--, -Cy-,
--O--, --S--, --S--S--, --N(R')--, --C(O)--, --C(S)--, --C(NR')--,
--C(O)N(R')--, --N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--,
--OC(O)N(R')--, --S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--,
--N(R')S(O).sub.2--, --SC(O)--, --C(O)S--, --OC(O)--, or --C(O)O--;
[0686] R.sup.1 is halogen, R, or an optionally substituted
C.sub.1-C.sub.50 aliphatic wherein one or more methylene units are
optionally and independently replaced by an optionally substituted
C.sub.1-C.sub.6 alkylene, C.sub.1-C.sub.6 alkenylene,
--C.ident.C--, --C(R').sub.2--, -Cy-, --O--, --S--, --S--S--,
--N(R')--, --C(O)--, --C(S)--, --C(NR')--, --C(O)N(R')--,
--N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--,
--S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--, --N(R')S(O).sub.2--,
--SC(O)--, --C(O)S--, --OC(O)--, or --C(O)O--; [0687] each R' is
independently --R, --C(O)R, --CO.sub.2R, or --SO.sub.2R, or: [0688]
two R' on the same nitrogen are taken together with their
intervening atoms to form an optionally substituted heterocyclic or
heteroaryl ring, or [0689] two R' on the same carbon are taken
together with their intervening atoms to form an optionally
substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring;
[0690] -Cy- is an optionally substituted bivalent ring selected
from phenylene, carbocyclylene, arylene, heteroarylene, or
heterocyclylene; [0691] each R is independently hydrogen, or an
optionally substituted group selected from C.sub.1-C.sub.6
aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl;
and [0692] each
[0692] ##STR00031## independently represents a connection to a
nucleoside.
[0693] In some embodiments, P* is an asymmetric phosphorus atom and
is either Rp or Sp. In some embodiments, P* is Rp. In other
embodiments, P* is Sp. In some embodiments, an oligonucleotide
comprises one or more internucleotidic linkages of formula I
wherein each P* is independently Rp or Sp. In some embodiments, an
oligonucleotide comprises one or more internucleotidic linkages of
formula I wherein each P* is Rp. In some embodiments, an
oligonucleotide comprises one or more internucleotidic linkages of
formula I wherein each P* is Sp. In some embodiments, an
oligonucleotide comprises at least one internucleotidic linkage of
formula I wherein P* is Rp. In some embodiments, an oligonucleotide
comprises at least one internucleotidic linkage of formula I
wherein P* is Sp. In some embodiments, an oligonucleotide comprises
at least one internucleotidic linkage of formula I wherein P* is
Rp, and at least one internucleotidic linkage of formula I wherein
P* is Sp.
[0694] In some embodiments, W is O, S, or Se. In some embodiments,
W is O. In some embodiments, W is S. In some embodiments, W is Se.
In some embodiments, an oligonucleotide comprises at least one
internucleotidic linkage of formula I wherein W is O. In some
embodiments, an oligonucleotide comprises at least one
internucleotidic linkage of formula I wherein W is S. In some
embodiments, an oligonucleotide comprises at least one
internucleotidic linkage of formula I wherein W is Se.
[0695] In some embodiments, each R is independently hydrogen, or an
optionally substituted group selected from C.sub.1-C.sub.6
aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or
heterocyclyl.
[0696] In some embodiments, R is hydrogen. In some embodiments, R
is an optionally substituted group selected from C.sub.1-C.sub.6
aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or
heterocyclyl.
[0697] In some embodiments, R is an optionally substituted
C.sub.1-C.sub.6 aliphatic. In some embodiments, R is an optionally
substituted C.sub.1-C.sub.6 alkyl. In some embodiments, R is
optionally substituted, linear or branched hexyl. In some
embodiments, R is optionally substituted, linear or branched
pentyl. In some embodiments, R is optionally substituted, linear or
branched butyl. In some embodiments, R is optionally substituted,
linear or branched propyl. In some embodiments, R is optionally
substituted ethyl. In some embodiments, R is optionally substituted
methyl.
[0698] In some embodiments, R is optionally substituted phenyl. In
some embodiments, R is substituted phenyl. In some embodiments, R
is phenyl.
[0699] In some embodiments, R is optionally substituted
carbocyclyl. In some embodiments, R is optionally substituted
C.sub.3-C.sub.10 carbocyclyl. In some embodiments, R is optionally
substituted monocyclic carbocyclyl. In some embodiments, R is
optionally substituted cycloheptyl. In some embodiments, R is
optionally substituted cyclohexyl. In some embodiments, R is
optionally substituted cyclopentyl. In some embodiments, R is
optionally substituted cyclobutyl. In some embodiments, R is an
optionally substituted cyclopropyl. In some embodiments, R is
optionally substituted bicyclic carbocyclyl.
[0700] In some embodiments, R is an optionally substituted aryl. In
some embodiments, R is an optionally substituted bicyclic aryl
ring.
[0701] In some embodiments, R is an optionally substituted
heteroaryl. In some embodiments, R is an optionally substituted 5-6
membered monocyclic heteroaryl ring having 1-3 heteroatoms
independently selected from nitrogen, sulfur, or oxygen. In some
embodiments, R is a substituted 5-6 membered monocyclic heteroaryl
ring having 1-3 heteroatoms independently selected from nitrogen,
oxygen, or sulfur. In some embodiments, R is an unsubstituted 5-6
membered monocyclic heteroaryl ring having 1-3 heteroatoms
independently selected from nitrogen, sulfur, or oxygen.
[0702] In some embodiments, R is an optionally substituted 5
membered monocyclic heteroaryl ring having 1-3 heteroatoms
independently selected from nitrogen, oxygen or sulfur. In some
embodiments, R is an optionally substituted 6 membered monocyclic
heteroaryl ring having 1-3 heteroatoms independently selected from
nitrogen, oxygen, or sulfur.
[0703] In some embodiments, R is an optionally substituted
5-membered monocyclic heteroaryl ring having 1 heteroatom selected
from nitrogen, oxygen, or sulfur. In some embodiments, R is
selected from pyrrolyl, furanyl, or thienyl.
[0704] In some embodiments, R is an optionally substituted
5-membered heteroaryl ring having 2 heteroatoms independently
selected from nitrogen, oxygen, or sulfur. In certain embodiments,
R is an optionally substituted 5-membered heteroaryl ring having 1
nitrogen atom, and an additional heteroatom selected from sulfur or
oxygen. Example R groups include optionally substituted pyrazolyl,
imidazolyl, thiazolyl, isothiazolyl, oxazolyl or isoxazolyl.
[0705] In some embodiments, R is a 6-membered heteroaryl ring
having 1-3 nitrogen atoms. In other embodiments, R is an optionally
substituted 6-membered heteroaryl ring having 1-2 nitrogen atoms.
In some embodiments, R is an optionally substituted 6-membered
heteroaryl ring having 2 nitrogen atoms. In certain embodiments, R
is an optionally substituted 6-membered heteroaryl ring having 1
nitrogen. Example R groups include optionally substituted
pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, triazinyl, or
tetrazinyl.
[0706] In certain embodiments, R is an optionally substituted 8-10
membered bicyclic heteroaryl ring having 1-4 heteroatoms
independently selected from nitrogen, oxygen, or sulfur. In some
embodiments, R is an optionally substituted 5,6-fused heteroaryl
ring having 1-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur. In other embodiments, R is an optionally
substituted 5,6-fused heteroaryl ring having 1-2 heteroatoms
independently selected from nitrogen, oxygen, or sulfur. In certain
embodiments, R is an optionally substituted 5,6-fused heteroaryl
ring having 1 heteroatom independently selected from nitrogen,
oxygen, or sulfur. In some embodiments, R is an optionally
substituted indolyl. In some embodiments, R is an optionally
substituted azabicyclo[3.2.1]octanyl. In certain embodiments, R is
an optionally substituted 5,6-fused heteroaryl ring having 2
heteroatoms independently selected from nitrogen, oxygen, or
sulfur. In some embodiments, R is an optionally substituted
azaindolyl. In some embodiments, R is an optionally substituted
benzimidazolyl. In some embodiments, R is an optionally substituted
benzothiazolyl. In some embodiments, R is an optionally substituted
benzoxazolyl. In some embodiments, R is an optionally substituted
indazolyl. In certain embodiments, R is an optionally substituted
5,6-fused heteroaryl ring having 3 heteroatoms independently
selected from nitrogen, oxygen, or sulfur.
[0707] In certain embodiments, R is an optionally substituted
6,6-fused heteroaryl ring having 1-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur. In some embodiments, R
is an optionally substituted 6,6-fused heteroaryl ring having 1-2
heteroatoms independently selected from nitrogen, oxygen, or
sulfur. In other embodiments, R is an optionally substituted
6,6-fused heteroaryl ring having 1 heteroatom independently
selected from nitrogen, oxygen, or sulfur. In some embodiments, R
is an optionally substituted quinolinyl. In some embodiments, R is
an optionally substituted isoquinolinyl. According to one aspect, R
is an optionally substituted 6,6-fused heteroaryl ring having 2
heteroatoms independently selected from nitrogen, oxygen, or
sulfur. In some embodiments, R is a quinazoline or a
quinoxaline.
[0708] In some embodiments, R is an optionally substituted
heterocyclyl. In some embodiments, R is an optionally substituted
3-7 membered saturated or partially unsaturated heterocyclic ring
having 1-2 heteroatoms independently selected from nitrogen,
oxygen, or sulfur. In some embodiments, R is a substituted 3-7
membered saturated or partially unsaturated heterocyclic ring
having 1-2 heteroatoms independently selected from nitrogen,
oxygen, or sulfur. In some embodiments, R is an unsubstituted 3-7
membered saturated or partially unsaturated heterocyclic ring
having 1-2 heteroatoms independently selected from nitrogen,
oxygen, or sulfur.
[0709] In some embodiments, R is an optionally substituted
heterocyclyl. In some embodiments, R is an optionally substituted 6
membered saturated or partially unsaturated heterocyclic ring
having 1-2 heteroatoms independently selected from nitrogen,
oxygen, or sulfur. In some embodiments, R is an optionally
substituted 6 membered partially unsaturated heterocyclic ring
having 2 heteroatoms independently selected from nitrogen, oxygen,
or sulfur. In some embodiments, R is an optionally substituted 6
membered partially unsaturated heterocyclic ring having 2 oxygen
atom.
[0710] In certain embodiments, R is a 3-7 membered saturated or
partially unsaturated heterocyclic ring having 1-2 heteroatoms
independently selected from nitrogen, oxygen, or sulfur. In certain
embodiments, R is oxiranyl, oxetanyl, tetrahydrofuranyl,
tetrahydropyranyl, oxepaneyl, aziridineyl, azetidineyl,
pyrrolidinyl, piperidinyl, azepanyl, thiiranyl, thietanyl,
tetrahydrothiophenyl, tetrahydrothiopyranyl, thiepanyl, dioxolanyl,
oxathiolanyl, oxazolidinyl, imidazolidinyl, thiazolidinyl,
dithiolanyl, dioxanyl, morpholinyl, oxathianyl, piperazinyl,
thiomorpholinyl, dithianyl, dioxepanyl, oxazepanyl, oxathiepanyl,
dithiepanyl, diazepanyl, dihydrofuranonyl, tetrahydropyranonyl,
oxepanonyl, pyrolidinonyl, piperidinonyl, azepanonyl,
dihydrothiophenonyl, tetrahydrothiopyranonyl, thiepanonyl,
oxazolidinonyl, oxazinanonyl, oxazepanonyl, dioxolanonyl,
dioxanonyl, dioxepanonyl, oxathiolinonyl, oxathianonyl,
oxathiepanonyl, thiazolidinonyl, thiazinanonyl, thiazepanonyl,
imidazolidinonyl, tetrahydropyrimidinonyl, diazepanonyl,
imidazolidinedionyl, oxazolidinedionyl, thiazolidinedionyl,
dioxolanedionyl, oxathiolanedionyl, piperazinedionyl,
morpholinedionyl, thiomorpholinedionyl, tetrahydropyranyl,
tetrahydrofuranyl, morpholinyl, thiomorpholinyl, piperidinyl,
piperazinyl, pyrrolidinyl, tetrahydrothiophenyl, or
tetrahydrothiopyranyl. In some embodiments, R is an optionally
substituted 5 membered saturated or partially unsaturated
heterocyclic ring having 1-2 heteroatoms independently selected
from nitrogen, oxygen, or sulfur.
[0711] In certain embodiments, R is an optionally substituted 5-6
membered partially unsaturated monocyclic ring having 1-2
heteroatoms independently selected from nitrogen, oxygen, or
sulfur. In certain embodiments, R is an optionally substituted
tetrahydropyridinyl, dihydrothiazolyl, dihydrooxazolyl, or
oxazolinyl group.
[0712] In some embodiments, R is an optionally substituted 8-10
membered bicyclic saturated or partially unsaturated heterocyclic
ring having 1-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur. In some embodiments, R is an optionally
substituted indolinyl. In some embodiments, R is an optionally
substituted isoindolinyl. In some embodiments, R is an optionally
substituted 1, 2, 3, 4-tetrahydroquinoline. In some embodiments, R
is an optionally substituted 1, 2, 3, 4-tetrahydroisoquinoline.
[0713] In some embodiments, each R' is independently --R, --C(O)R,
--CO.sub.2R, or --SO.sub.2R, or: [0714] two R' on the same nitrogen
are taken together with their intervening atoms to form an
optionally substituted heterocyclic or heteroaryl ring, or [0715]
two R' on the same carbon are taken together with their intervening
atoms to form an optionally substituted aryl, carbocyclic,
heterocyclic, or heteroaryl ring.
[0716] In some embodiments, R' is --R, --C(O)R, --CO.sub.2R, or
--SO.sub.2R, wherein R is as defined above and described
herein.
[0717] In some embodiments, R' is --R, wherein R is as defined and
described above and herein. In some embodiments, R' is
hydrogen.
[0718] In some embodiments, R' is --C(O)R, wherein R is as defined
above and described herein. In some embodiments, R' is --CO.sub.2R,
wherein R is as defined above and described herein. In some
embodiments, R' is --SO.sub.2R, wherein R is as defined above and
described herein.
[0719] In some embodiments, two R' on the same nitrogen are taken
together with their intervening atoms to form an optionally
substituted heterocyclic or heteroaryl ring. In some embodiments,
two R' on the same carbon are taken together with their intervening
atoms to form an optionally substituted aryl, carbocyclic,
heterocyclic, or heteroaryl ring.
[0720] In some embodiments, -Cy- is an optionally substituted
bivalent ring selected from phenylene, carbocyclylene, arylene,
heteroarylene, or heterocyclylene.
[0721] In some embodiments, -Cy- is optionally substituted
phenylene. In some embodiments, -Cy- is optionally substituted
carbocyclylene. In some embodiments, -Cy- is optionally substituted
arylene. In some embodiments, -Cy- is optionally substituted
heteroarylene. In some embodiments, -Cy- is optionally substituted
heterocyclylene.
[0722] In some embodiments, each of X, Y and Z is independently
--O--, --S--, --N(-L-R.sup.1)--, or L, wherein each of L and
R.sup.1 is independently as defined above and described below.
[0723] In some embodiments, X is --O--. In some embodiments, X is
--S--. In some embodiments, X is --O-- or --S--. In some
embodiments, an oligonucleotide comprises at least one
internucleotidic linkage of formula I wherein X is --O--. In some
embodiments, an oligonucleotide comprises at least one
internucleotidic linkage of formula I wherein X is --S--. In some
embodiments, an oligonucleotide comprises at least one
internucleotidic linkage of formula I wherein X is --O--, and at
least one internucleotidic linkage of formula I wherein X is --S--.
In some embodiments, an oligonucleotide comprises at least one
internucleotidic linkage of formula I wherein X is --O--, and at
least one internucleotidic linkage of formula I wherein X is --S--,
and at least one internucleotidic linkage of formula I wherein L is
an optionally substituted, linear or branched C.sub.1-C.sub.10
alkylene, wherein one or more methylene units of L are optionally
and independently replaced by an optionally substituted
C.sub.1-C.sub.6 alkylene, C.sub.1-C.sub.6 alkenylene,
--C.ident.C--, --C(R').sub.2--, -Cy-, --O--, --S--, --S--S--,
--N(R')--, --C(O)--, --C(S)--, --C(NR')--, --C(O)N(R')--,
--N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--,
--S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--, --N(R')S(O).sub.2--,
--SC(O)--, --C(O)S--, --OC(O)--, or --C(O)O--.
[0724] In some embodiments, X is --N(-L-R.sup.1)--. In some
embodiments, X is --N(R.sup.1)--. In some embodiments, X is
--N(R')--. In some embodiments, X is --N(R)--. In some embodiments,
X is --NH--.
[0725] In some embodiments, X is L. In some embodiments, X is a
covalent bond. In some embodiments, X is or an optionally
substituted, linear or branched C.sub.1-C.sub.10 alkylene, wherein
one or more methylene units of L are optionally and independently
replaced by an optionally substituted C.sub.1-C.sub.6 alkylene,
C.sub.1-C.sub.6 alkenylene, --C.ident.C--, --C(R').sub.2--, -Cy-,
--O--, --S--, --S--S--, --N(R')--, --C(O)--, --C(S)--, --C(NR')--,
--C(O)N(R')--, --N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--,
--OC(O)N(R')--, --S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--,
--N(R')S(O).sub.2--, --SC(O)--, --C(O)S--, --OC(O)--, or --C(O)O--.
In some embodiments, X is an optionally substituted
C.sub.1-C.sub.10 alkylene or C.sub.1-C.sub.10 alkenylene. In some
embodiments, X is methylene.
[0726] In some embodiments, Y is --O--. In some embodiments, Y is
--S--.
[0727] In some embodiments, Y is --N(-L-R.sup.1)--. In some
embodiments, Y is --N(R.sup.1)--. In some embodiments, Y is
--N(R')--. In some embodiments, Y is --N(R)--. In some embodiments,
Y is --NH--.
[0728] In some embodiments, Y is L. In some embodiments, Y is a
covalent bond. In some embodiments, Y is or an optionally
substituted, linear or branched C.sub.1-C.sub.10 alkylene, wherein
one or more methylene units of L are optionally and independently
replaced by an optionally substituted C.sub.1-C.sub.6 alkylene,
C.sub.1-C.sub.6 alkenylene, --C.ident.C--, --C(R').sub.2--, -Cy-,
--O--, --S--, --S--S--, --N(R')--, --C(O)--, --C(S)--, --C(NR')--,
--C(O)N(R')--, --N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--,
--OC(O)N(R')--, --S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--,
--N(R')S(O).sub.2--, --SC(O)--, --C(O)S--, --OC(O)--, or --C(O)O--.
In some embodiments, Y is an optionally substituted
C.sub.1-C.sub.10 alkylene or C.sub.1-C.sub.10 alkenylene. In some
embodiments, Y is methylene.
[0729] In some embodiments, Z is --O--. In some embodiments, Z is
--S--.
[0730] In some embodiments, Z is --N(-L-R.sup.1)--. In some
embodiments, Z is --N(R.sup.1)--. In some embodiments, Z is
--N(R')--. In some embodiments, Z is --N(R)--. In some embodiments,
Z is --NH--.
[0731] In some embodiments, Z is L. In some embodiments, Z is a
covalent bond. In some embodiments, Z is or an optionally
substituted, linear or branched C.sub.1-C.sub.10 alkylene, wherein
one or more methylene units of L are optionally and independently
replaced by an optionally substituted C.sub.1-C.sub.6 alkylene,
C.sub.1-C.sub.6 alkenylene, --C.ident.C--, --C(R').sub.2--, -Cy-,
--O--, --S--, --S--S--, --N(R')--, --C(O)--, --C(S)--, --C(NR')--,
--C(O)N(R')--, --N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--,
--OC(O)N(R')--, --S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--,
--N(R')S(O).sub.2--, --SC(O)--, --C(O)S--, --OC(O)--, or --C(O)O--.
In some embodiments, Z is an optionally substituted
C.sub.1-C.sub.10 alkylene or C.sub.1-C.sub.10 alkenylene. In some
embodiments, Z is methylene.
[0732] In some embodiments, L is a covalent bond or an optionally
substituted, linear or branched C.sub.1-C.sub.10 alkylene, wherein
one or more methylene units of L are optionally and independently
replaced by an optionally substituted C.sub.1-C.sub.6 alkylene,
C.sub.1-C.sub.6 alkenylene, --C.ident.C--, --C(R').sub.2--, -Cy-,
--O--, --S--, --S--S--, --N(R')--, --C(O)--, --C(S)--, --C(NR')--,
--C(O)N(R')--, --N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--,
--OC(O)N(R')--, --S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--,
--N(R')S(O).sub.2--, --SC(O)--, --C(O)S--, --OC(O)--, or
--C(O)O--.
[0733] In some embodiments, L is a covalent bond. In some
embodiments, L is an optionally substituted, linear or branched
C.sub.1-C.sub.10 alkylene, wherein one or more methylene units of L
are optionally and independently replaced by an optionally
substituted C.sub.1-C.sub.6 alkylene, C.sub.1-C.sub.6 alkenylene,
--C.ident.C--, --C(R').sub.2--, -Cy-, --O--, --S--, --S--S--,
--N(R')--, --C(O)--, --C(S)--, --C(NR')--, --C(O)N(R')--,
--N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--,
--S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--, --N(R')S(O).sub.2--,
--SC(O)--, --C(O)S--, --OC(O)--, or --C(O)O--.
[0734] In some embodiments, L has the structure of -L.sup.1-V--,
wherein: L.sup.1 is an optionally substituted group selected
from
##STR00032##
C.sub.1-C.sub.6 alkylene, C.sub.1-C.sub.6 alkenylene,
carbocyclylene, arylene, C.sub.1-C.sub.6 heteroalkylene,
heterocyclylene, and heteroarylene; V is selected from --O--,
--S--, --NR'--, C(R').sub.2, --S--S--, --B--S--S--C--,
##STR00033##
or an optionally substituted group selected from C.sub.1-C.sub.6
alkylene, arylene, C.sub.1-C.sub.6 heteroalkylene, heterocyclylene,
and heteroarylene;
A is .dbd.O, .dbd.S, .dbd.NR', or .dbd.C(R').sub.2;
[0735] each of B and C is independently --O--, --S--, --NR'--,
--C(R').sub.2--, or an optionally substituted group selected from
C.sub.1-C.sub.6 alkylene, carbocyclylene, arylene, heterocyclylene,
or heteroarylene; and each R' is independently as defined above and
described herein.
[0736] In some embodiments, L.sup.1 is
##STR00034##
[0737] In some embodiments, L.sup.1 is
##STR00035##
wherein Ring Cy' is an optionally substituted arylene,
carbocyclylene, heteroarylene, or heterocyclylene. In some
embodiments, L.sup.1 is optionally substituted
##STR00036##
In some embodiments, L.sup.1 is
##STR00037##
[0738] In some embodiments, L.sup.1 is connected to X. In some
embodiments, L.sup.1 is an optionally substituted group selected
from
##STR00038##
and the sulfur atom is connect to V. In some embodiments, L.sup.1
is an optionally substituted group selected from
##STR00039##
and the carbon atom is connect to X.
[0739] In some embodiments, L has the structure of:
##STR00040##
wherein: [0740] E is --O--, --S--, --NR'-- or --C(R').sub.2--;
[0741] is a single or double bond; the two R.sup.L1 are taken
together with the two carbon atoms to which they are bound to form
an optionally substituted aryl, carbocyclic, heteroaryl or
heterocyclic ring; and each R' is independently as defined above
and described herein.
[0742] In some embodiments, L has the structure of:
##STR00041##
wherein: [0743] G is --O--, --S--, or --NR'; [0744] is a single or
double bond; and the two R.sup.L1 are taken together with the two
carbon atoms to which they are bound to form an optionally
substituted aryl, C.sub.3-C.sub.10 carbocyclic, heteroaryl or
heterocyclic ring.
[0745] In some embodiments, L has the structure of:
##STR00042## [0746] wherein: [0747] E is --O--, --S--, --NR'-- or
--C(R').sub.2--; [0748] D is .dbd.N--, .dbd.C(F)--, .dbd.C(Cl)--,
.dbd.C(Br)--, .dbd.C(I)--, .dbd.C(CN)--, .dbd.C(NO.sub.2)--,
.dbd.C(CO.sub.2--(C.sub.1-C.sub.6 aliphatic))-, or
.dbd.C(CF.sub.3)--; and [0749] each R' is independently as defined
above and described herein.
[0750] In some embodiments, L has the structure of:
##STR00043##
wherein: [0751] G is --O--, --S--, or --NR'; [0752] D is .dbd.N--,
.dbd.C(F)--, .dbd.C(Cl)--, .dbd.C(Br)--, .dbd.C(I)--, .dbd.C(CN)--,
.dbd.C(NO.sub.2)--, .dbd.C(CO.sub.2--(C.sub.1-C.sub.6 aliphatic))-,
or .dbd.C(CF.sub.3)--.
[0753] In some embodiments, L has the structure of:
##STR00044##
wherein: [0754] E is --O--, --S--, --NR'-- or --C(R').sub.2--;
[0755] D is .dbd.N--, .dbd.C(F)--, .dbd.C(Cl)--, .dbd.C(Br)--,
.dbd.C(I)--, .dbd.C(CN)--, .dbd.C(NO.sub.2)--,
.dbd.C(CO.sub.2--(C.sub.1-C.sub.6 aliphatic))-, or
.dbd.C(CF.sub.3)--; and [0756] each R' is independently as defined
above and described herein.
[0757] In some embodiments, L has the structure of:
##STR00045##
wherein: [0758] G is --O--, --S--, or --NR'; [0759] D is .dbd.N--,
.dbd.C(F)--, .dbd.C(Cl)--, .dbd.C(Br)--, .dbd.C(I)--, .dbd.C(CN)--,
.dbd.C(NO.sub.2)--, .dbd.C(CO.sub.2--(C.sub.1-C.sub.6 aliphatic))-,
or .dbd.C(CF.sub.3)--.
[0760] In some embodiments, L has the structure of:
##STR00046##
wherein: [0761] E is --O--, --S--, --NR'-- or --C(R').sub.2--;
[0762] is a single or double bond; the two R.sup.L1 are taken
together with the two carbon atoms to which they are bound to form
an optionally substituted aryl, C.sub.3-C.sub.10 carbocyclic,
heteroaryl or heterocyclic ring; and each R' is independently as
defined above and described herein.
[0763] In some embodiments, L has the structure of:
##STR00047##
wherein: [0764] G is --O--, --S--, or --NR'; [0765] is a single or
double bond; the two R.sup.L1 are taken together with the two
carbon atoms to which they are bound to form an optionally
substituted aryl, C.sub.3-C.sub.10 carbocyclic, heteroaryl or
heterocyclic ring; and each R' is independently as defined above
and described herein.
[0766] In some embodiments, L has the structure of:
##STR00048##
wherein: [0767] E is --O--, --S--, --NR'-- or --C(R').sub.2--;
[0768] D is .dbd.N--, .dbd.C(F)--, .dbd.C(Cl)--, .dbd.C(Br)--,
.dbd.C(I)--, .dbd.C(CN)--, .dbd.C(NO.sub.2)--,
.dbd.C(CO.sub.2--(C.sub.1-C.sub.6 aliphatic))-, or
.dbd.C(CF.sub.3)--; and [0769] each R' is independently as defined
above and described herein.
[0770] In some embodiments, L has the structure of:
##STR00049##
wherein: [0771] G is --O--, --S--, or --NR'; [0772] D is .dbd.N--,
.dbd.C(F)--, .dbd.C(Cl)--, .dbd.C(Br)--, .dbd.C(I)--, .dbd.C(CN)--,
.dbd.C(NO.sub.2)--, .dbd.C(CO.sub.2--(C.sub.1-C.sub.6 aliphatic))-,
or .dbd.C(CF.sub.3)--; and [0773] each R' is independently as
defined above and described herein.
[0774] In some embodiments, L has the structure of:
##STR00050##
wherein: [0775] E is --O--, --S--, --NR'-- or --C(R').sub.2--;
[0776] D is .dbd.N--, .dbd.C(F)--, .dbd.C(Cl)--, .dbd.C(Br)--,
.dbd.C(I)--, .dbd.C(CN)--, .dbd.C(NO.sub.2)--,
.dbd.C(CO.sub.2--(C.sub.1-C.sub.6 aliphatic))-, or
.dbd.C(CF.sub.3)--; and [0777] each R' is independently as defined
above and described herein.
[0778] In some embodiments, L has the structure of:
##STR00051##
wherein: [0779] G is --O--, --S--, or --NR'; [0780] D is .dbd.N--,
.dbd.C(F)--, .dbd.C(Cl)--, .dbd.C(Br)--, .dbd.C(I)--, .dbd.C(CN)--,
.dbd.C(NO.sub.2)--, .dbd.C(CO.sub.2--(C.sub.1-C.sub.6 aliphatic))-,
or .dbd.C(CF.sub.3)--; and [0781] each R' is independently as
defined above and described herein.
[0782] In some embodiments, L has the structure of:
##STR00052##
wherein: [0783] E is --O--, --S--, --NR'-- or --C(R').sub.2--;
[0784] is a single or double bond; the two R.sup.L1 are taken
together with the two carbon atoms to which they are bound to form
an optionally substituted aryl, C.sub.3-C.sub.10 carbocyclic,
heteroaryl or heterocyclic ring; and each R' is independently as
defined above and described herein.
[0785] In some embodiments, L has the structure of:
##STR00053##
wherein: [0786] G is --O--, --S--, or --NR'; [0787] is a single or
double bond; the two R.sup.L1 are taken together with the two
carbon atoms to which they are bound to form an optionally
substituted aryl, C.sub.3-C.sub.10 carbocyclic, heteroaryl or
heterocyclic ring; and each R' is independently as defined above
and described herein.
[0788] In some embodiments, L has the structure of:
##STR00054##
wherein: [0789] E is --O--, --S--, --NR'-- or --C(R').sub.2--;
[0790] D is .dbd.N--, .dbd.C(F)--, .dbd.C(Cl)--, .dbd.C(Br)--,
.dbd.C(I)--, .dbd.C(CN)--, .dbd.C(NO.sub.2)--,
.dbd.C(CO.sub.2--(C.sub.1-C.sub.6 aliphatic))-, or
.dbd.C(CF.sub.3)--; and [0791] each R' is independently as defined
above and described herein.
[0792] In some embodiments, L has the structure of:
##STR00055##
wherein: [0793] G is --O--, --S--, or --NR'; [0794] D is .dbd.N--,
.dbd.C(F)--, .dbd.C(Cl)--, .dbd.C(Br)--, .dbd.C(I)--, .dbd.C(CN)--,
.dbd.C(NO.sub.2)--, .dbd.C(CO.sub.2--(C.sub.1-C.sub.6 aliphatic))-,
or .dbd.C(CF.sub.3)--; and [0795] R' is as defined above and
described herein.
[0796] In some embodiments, L has the structure of:
##STR00056##
wherein: [0797] E is --O--, --S--, --NR'-- or --C(R').sub.2--;
[0798] D is .dbd.N--, .dbd.C(F)--, .dbd.C(Cl)--, .dbd.C(Br)--,
.dbd.C(I)--, .dbd.C(CN)--, .dbd.C(NO.sub.2)--,
.dbd.C(CO.sub.2--(C.sub.1-C.sub.6 aliphatic))-, or
.dbd.C(CF.sub.3)--; and [0799] each R' is independently as defined
above and described herein.
[0800] In some embodiments, L has the structure of:
##STR00057##
wherein: [0801] G is --O--, --S--, or --NR'; [0802] D is .dbd.N--,
.dbd.C(F)--, .dbd.C(Cl)--, .dbd.C(Br)--, .dbd.C(I)--, .dbd.C(CN)--,
.dbd.C(NO.sub.2)--, .dbd.C(CO.sub.2--(C.sub.1-C.sub.6 aliphatic))-,
or .dbd.C(CF.sub.3)--; and [0803] R' is as defined above and
described herein.
[0804] In some embodiments, L has the structure of:
##STR00058##
wherein the phenyl ring is optionally substituted. In some
embodiments, the phenyl ring is not substituted. In some
embodiments, the phenyl ring is substituted.
[0805] In some embodiments, L has the structure of:
##STR00059##
wherein the phenyl ring is optionally substituted. In some
embodiments, the phenyl ring is not substituted. In some
embodiments, the phenyl ring is substituted.
[0806] In some embodiments, L has the structure of:
##STR00060##
wherein: [0807] is a single or double bond; and [0808] the two
R.sup.L1 are taken together with the two carbon atoms to which they
are bound to form an optionally substituted aryl, C.sub.3-C.sub.10
carbocyclic, heteroaryl or heterocyclic ring.
[0809] In some embodiments, L has the structure of:
##STR00061##
wherein: [0810] G is --O--, --S--, or --NR'; [0811] is a single or
double bond; and [0812] the two R.sup.L1 are taken together with
the two carbon atoms to which they are bound to form an optionally
substituted aryl, C.sub.3-C.sub.10 carbocyclic, heteroaryl or
heterocyclic ring.
[0813] In some embodiments, E is --O--, --S--, --NR'-- or
--C(R').sub.2--, wherein each R' independently as defined above and
described herein. In some embodiments, E is --O--, --S--, or
--NR'--. In some embodiments, E is --O--, --S--, or --NH--. In some
embodiments, E is --O--. In some embodiments, E is --S--. In some
embodiments, E is --NH--.
[0814] In some embodiments, G is --O--, --S--, or --NR', wherein
each R' independently as defined above and described herein. In
some embodiments, G is --O--, --S--, or --NH--. In some
embodiments, G is --O--. In some embodiments, G is --S--. In some
embodiments, G is --NH--.
[0815] In some embodiments, L is -L.sup.3-G-, wherein: [0816]
L.sup.3 is an optionally substituted C.sub.1-C.sub.5 alkylene or
alkenylene, wherein one or more methylene units are optionally and
independently replaced by --O--, --S--, --N(R')--, --C(O)--,
--C(S)--, --C(NR')--, --S(O)--, --S(O).sub.2--, or
[0816] ##STR00062## and wherein each of G, R' and Ring Cy' is
independently as defined above and described herein.
[0817] In some embodiments, L is -L.sup.3-S--, wherein L.sup.3 is
as defined above and described herein. In some embodiments, L is
-L.sup.3-O--, wherein L.sup.3 is as defined above and described
herein. In some embodiments, L is -L.sup.3-N(R')--, wherein each of
L.sup.3 and R' is independently as defined above and described
herein. In some embodiments, L is -L.sup.3-NH--, wherein each of
L.sup.3 and R' is independently as defined above and described
herein.
[0818] In some embodiments, L.sup.3 is an optionally substituted Cs
alkylene or alkenylene, wherein one or more methylene units are
optionally and independently replaced by --O--, --S--, --N(R')--,
--C(O)--, --C(S)--, --C(NR')--, --S(O)--, --S(O).sub.2--, or
##STR00063##
and each of R' and Ring Cy' is independently as defined above and
described herein. In some embodiments, L.sup.3 is an optionally
substituted C.sub.5 alkylene. In some embodiments, -L.sup.3-G-
is
##STR00064##
[0819] In some embodiments, L.sup.3 is an optionally substituted
C.sub.4 alkylene or alkenylene, wherein one or more methylene units
are optionally and independently replaced by --O--, --S--,
--N(R')--, --C(O)--, --C(S)--, --C(NR')--, --S(O)--,
--S(O).sub.2--, or
##STR00065##
and each of R' and Cy' is independently as defined above and
described herein.
[0820] In some embodiments, -L.sup.3-G- is
##STR00066##
[0821] In some embodiments, L.sup.3 is an optionally substituted
C.sub.3 alkylene or alkenylene, wherein one or more methylene units
are optionally and independently replaced by --O--, --S--,
--N(R')--, --C(O)--, --C(S)--, --C(NR')--, --S(O)--,
--S(O).sub.2--, or
##STR00067##
and each of R' and Cy' is independently as defined above and
described herein.
[0822] In some embodiments, -L.sup.3-G- is
##STR00068##
[0823] In some embodiments, L is
##STR00069##
In some embodiments, L is
##STR00070##
In some embodiments, L is
##STR00071##
[0824] In some embodiments, L.sup.3 is an optionally substituted
C.sub.2 alkylene or alkenylene, wherein one or more methylene units
are optionally and independently replaced by --O--, --S--,
--N(R')--, --C(O)--, --C(S)--, --C(NR')--, --S(O)--,
--S(O).sub.2--, or
##STR00072##
and each of R' and Cy' is independently as defined above and
described herein.
[0825] In some embodiments, -L.sup.3-G- is
##STR00073##
wherein each of G and Cy' is independently as defined above and
described herein. In some embodiments, L is
##STR00074##
[0826] In some embodiments, L is -L.sup.4-G-, wherein L.sup.4 is an
optionally substituted C.sub.1-C.sub.2 alkylene; and G is as
defined above and described herein. In some embodiments, L is
-L.sup.4-G-, wherein L.sup.4 is an optionally substituted
C.sub.1-C.sub.2 alkylene; G is as defined above and described
herein; and G is connected to R.sup.1. In some embodiments, L is
-L.sup.4-G-, wherein L.sup.4 is an optionally substituted
methylene; G is as defined above and described herein; and G is
connected to R.sup.1. In some embodiments, L is -L.sup.4-G-,
wherein L.sup.4 is methylene; G is as defined above and described
herein; and G is connected to R.sup.1. In some embodiments, L is
-L.sup.4-G-, wherein L.sup.4 is an optionally substituted
--(CH.sub.2).sub.2--; G is as defined above and described herein;
and G is connected to R.sup.1. In some embodiments, L is
-L.sup.4-G-, wherein L.sup.4 is --(CH.sub.2).sub.2--; G is as
defined above and described herein; and G is connected to
R.sup.1.
In some embodiments, L is
##STR00075##
wherein G is as defined above and described herein, and G is
connected to R.sup.1. In some embodiments, L is
##STR00076##
wherein G is as defined above and described herein, and G is
connected to R.sup.1. In some embodiments, L is
##STR00077##
wherein G is as defined above and described herein, and G is
connected to R.sup.1. In some embodiments, L is
##STR00078##
wherein the sulfur atom is connected to R.sup.1. In some
embodiments, L is
##STR00079##
wherein the oxygen atom is connected to R.sup.1.
[0827] In some embodiments, L is
##STR00080##
wherein G is as defined above and described herein.
[0828] In some embodiments, L is --S--R.sup.L3-- or
--S--C(O)--R.sup.L3--, wherein R.sup.L3 is an optionally
substituted, linear or branched, C.sub.1-C.sub.9 alkylene, wherein
one or more methylene units are optionally and independently
replaced by an optionally substituted C.sub.1-C.sub.6 alkylene,
C.sub.1-C.sub.6 alkenylene, --C.ident.C--, --C(R').sub.2--, -Cy-,
--O--, --S--, --S--S--, --N(R')--, --C(O)--, --C(S)--, --C(NR')--,
--C(O)N(R')--, --N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--,
--OC(O)N(R')--, --S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--,
--N(R')S(O).sub.2--, --SC(O)--, --C(O)S--, --OC(O)--, or --C(O)O--,
wherein each of R' and -Cy- is independently as defined above and
described herein. In some embodiments, L is --S--R.sup.L3-- or
--S--C(O)--R.sup.L3--, wherein R.sup.L3 is an optionally
substituted C.sub.1-C.sub.6 alkylene. In some embodiments, L is
--S--R.sup.L3-- or --S--C(O)--R.sup.L3--, wherein R.sup.L3 is an
optionally substituted C.sub.1-C.sub.6 alkenylene. In some
embodiments, L is --S--R.sup.L3-- or --S--C(O)--R.sup.L3--, wherein
R.sup.L3 is an optionally substituted C.sub.1-C.sub.6 alkylene
wherein one or more methylene units are optionally and
independently replaced by an optionally substituted C.sub.1-C.sub.6
alkenylene, arylene, or heteroarylene. In some embodiments, In some
embodiments, R.sup.L3 is an optionally substituted
--S--(C.sub.1-C.sub.6 alkenylene)-, --S--(C.sub.1-C.sub.6
alkylene)-, --S--(C.sub.1-C.sub.6
alkylene)-arylene-(C.sub.1-C.sub.6 alkylene)-,
--S--CO-arylene-(C.sub.1-C.sub.6 alkylene)-, or
--S--CO--(C.sub.1-C.sub.6 alkylene)-arylene-(C.sub.1-C.sub.6
alkylene)-.
[0829] In some embodiments, L is
##STR00081##
[0830] In some embodiments, L is
##STR00082##
In some embodiments, L is
##STR00083##
In some embodiments,
##STR00084##
[0831] In some embodiments, the sulfur atom in the L embodiments
described above and herein is connected to X. In some embodiments,
the sulfur atom in the L embodiments described above and herein is
connected to R.sup.1.
[0832] In some embodiments, R.sup.1 is halogen, R, or an optionally
substituted C.sub.1-C.sub.50 aliphatic wherein one or more
methylene units are optionally and independently replaced by an
optionally substituted C.sub.1-C.sub.6 alkylene, C.sub.1-C.sub.6
alkenylene, --C.ident.C--, --C(R').sub.2--, -Cy-, --O--, --S--,
--S--S--, --N(R')--, --C(O)--, --C(S)--, --C(NR')--, --C(O)N(R')--,
--N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--,
--S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--, --N(R')S(O).sub.2--,
--SC(O)--, --C(O)S--, --OC(O)--, or --C(O)O--, wherein each
variable is independently as defined above and described herein. In
some embodiments, R.sup.1 is halogen, R, or an optionally
substituted C.sub.1-C.sub.10 aliphatic wherein one or more
methylene units are optionally and independently replaced by an
optionally substituted C.sub.1-C.sub.6 alkylene, C.sub.1-C.sub.6
alkenylene, --C.ident.C--, --C(R').sub.2--, -Cy-, --O--, --S--,
--S--S--, --N(R')--, --C(O)--, --C(S)--, --C(NR')--, --C(O)N(R')--,
--N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--,
--S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--, --N(R')S(O).sub.2--,
--SC(O)--, --C(O)S--, --OC(O)--, or --C(O)O--, wherein each
variable is independently as defined above and described
herein.
[0833] In some embodiments, R.sup.1 is hydrogen. In some
embodiments, R.sup.1 is halogen. In some embodiments, R.sup.1 is
--F. In some embodiments, R.sup.1 is --Cl. In some embodiments,
R.sup.1 is --Br. In some embodiments, R.sup.1 is --I.
[0834] In some embodiments, R.sup.1 is R wherein R is as defined
above and described herein.
[0835] In some embodiments, R.sup.1 is hydrogen. In some
embodiments, R.sup.1 is an optionally substituted group selected
from C.sub.1-C.sub.50 aliphatic, phenyl, carbocyclyl, aryl,
heteroaryl, or heterocyclyl.
[0836] In some embodiments, R.sup.1 is an optionally substituted
C.sub.1-C.sub.50 aliphatic. In some embodiments, R.sup.1 is an
optionally substituted C.sub.1-C.sub.10 aliphatic. In some
embodiments, R.sup.1 is an optionally substituted C.sub.1-C.sub.6
aliphatic. In some embodiments, R.sup.1 is an optionally
substituted C.sub.1-C.sub.6 alkyl. In some embodiments, R.sup.1 is
optionally substituted, linear or branched hexyl. In some
embodiments, R.sup.1 is optionally substituted, linear or branched
pentyl. In some embodiments, R.sup.1 is optionally substituted,
linear or branched butyl. In some embodiments, R.sup.1 is
optionally substituted, linear or branched propyl. In some
embodiments, R.sup.1 is optionally substituted ethyl. In some
embodiments, R.sup.1 is optionally substituted methyl.
[0837] In some embodiments, R.sup.1 is optionally substituted
phenyl. In some embodiments, R.sup.1 is substituted phenyl. In some
embodiments, R.sup.1 is phenyl.
[0838] In some embodiments, R.sup.1 is optionally substituted
carbocyclyl. In some embodiments, R.sup.1 is optionally substituted
C.sub.3-C.sub.10 carbocyclyl. In some embodiments, R.sup.1 is
optionally substituted monocyclic carbocyclyl. In some embodiments,
R.sup.1 is optionally substituted cycloheptyl. In some embodiments,
R.sup.1 is optionally substituted cyclohexyl. In some embodiments,
R.sup.1 is optionally substituted cyclopentyl. In some embodiments,
R.sup.1 is optionally substituted cyclobutyl. In some embodiments,
R.sup.1 is an optionally substituted cyclopropyl. In some
embodiments, R.sup.1 is optionally substituted bicyclic
carbocyclyl.
[0839] In some embodiments, R.sup.1 is an optionally substituted
C.sub.1-C.sub.50 polycyclic hydrocarbon. In some embodiments,
R.sup.1 is an optionally substituted C.sub.1-C.sub.50 polycyclic
hydrocarbon wherein one or more methylene units are optionally and
independently replaced by an optionally substituted C.sub.1-C.sub.6
alkylene, C.sub.1-C.sub.6 alkenylene, --C.ident.C--,
--C(R').sub.2--, -Cy-, --O--, --S--, --S--S--, --N(R')--, --C(O)--,
--C(S)--, --C(NR')--, --C(O)N(R')--, --N(R')C(O)N(R')--,
--N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--, --S(O)--,
--S(O).sub.2--, --S(O).sub.2N(R')--, --N(R')S(O).sub.2--,
--SC(O)--, --C(O)S--, --OC(O)--, or --C(O)O--, wherein each
variable is independently as defined above and described herein. In
some embodiments, R.sup.1 is optionally substituted
##STR00085##
In some embodiments, R.sup.1 is
##STR00086##
In some embodiments, R.sup.1 is optionally substituted
##STR00087##
[0840] In some embodiments, R.sup.1 is an optionally substituted
C.sub.1-C.sub.50 aliphatic comprising one or more optionally
substituted polycyclic hydrocarbon moieties. In some embodiments,
R.sup.1 is an optionally substituted C.sub.1-C.sub.50 aliphatic
comprising one or more optionally substituted polycyclic
hydrocarbon moieties, wherein one or more methylene units are
optionally and independently replaced by an optionally substituted
C.sub.1-C.sub.6 alkylene, C.sub.1-C.sub.6 alkenylene,
--C.ident.C--, --C(R').sub.2--, -Cy-, --O--, --S--, --S--S--,
--N(R')--, --C(O)--, --C(S)--, --C(NR')--, --C(O)N(R')--,
--N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--,
--S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--, --N(R')S(O).sub.2--,
--SC(O)--, --C(O)S--, --OC(O)--, or --C(O)O--, wherein each
variable is independently as defined above and described herein. In
some embodiments, R.sup.1 is an optionally substituted
C.sub.1-C.sub.50 aliphatic comprising one or more optionally
substituted
##STR00088##
In some embodiments, R.sup.1 is
##STR00089##
In some embodiments, R.sup.1 is
##STR00090##
In some embodiments, R.sup.1 is
##STR00091##
In some embodiments, R.sup.1 is
##STR00092##
In some embodiments, R.sup.1 is
##STR00093##
[0841] In some embodiments, R.sup.1 is an optionally substituted
aryl. In some embodiments, R.sup.1 is an optionally substituted
bicyclic aryl ring.
[0842] In some embodiments, R.sup.1 is an optionally substituted
heteroaryl. In some embodiments, R.sup.1 is an optionally
substituted 5-6 membered monocyclic heteroaryl ring having 1-3
heteroatoms independently selected from nitrogen, sulfur, or
oxygen. In some embodiments, R.sup.1 is a substituted 5-6 membered
monocyclic heteroaryl ring having 1-3 heteroatoms independently
selected from nitrogen, oxygen, or sulfur. In some embodiments,
R.sup.1 is an unsubstituted 5-6 membered monocyclic heteroaryl ring
having 1-3 heteroatoms independently selected from nitrogen,
sulfur, or oxygen.
[0843] In some embodiments, R.sup.1 is an optionally substituted 5
membered monocyclic heteroaryl ring having 1-3 heteroatoms
independently selected from nitrogen, oxygen or sulfur. In some
embodiments, R.sup.1 is an optionally substituted 6 membered
monocyclic heteroaryl ring having 1-3 heteroatoms independently
selected from nitrogen, oxygen, or sulfur.
[0844] In some embodiments, R.sup.1 is an optionally substituted
5-membered monocyclic heteroaryl ring having 1 heteroatom selected
from nitrogen, oxygen, or sulfur. In some embodiments, R.sup.1 is
selected from pyrrolyl, furanyl, or thienyl.
[0845] In some embodiments, R.sup.1 is an optionally substituted
5-membered heteroaryl ring having 2 heteroatoms independently
selected from nitrogen, oxygen, or sulfur. In certain embodiments,
R.sup.1 is an optionally substituted 5-membered heteroaryl ring
having 1 nitrogen atom, and an additional heteroatom selected from
sulfur or oxygen. Example R.sup.1 groups include optionally
substituted pyrazolyl, imidazolyl, thiazolyl, isothiazolyl,
oxazolyl or isoxazolyl.
[0846] In some embodiments, R.sup.1 is a 6-membered heteroaryl ring
having 1-3 nitrogen atoms. In other embodiments, R.sup.1 is an
optionally substituted 6-membered heteroaryl ring having 1-2
nitrogen atoms. In some embodiments, R.sup.1 is an optionally
substituted 6-membered heteroaryl ring having 2 nitrogen atoms. In
certain embodiments, R.sup.1 is an optionally substituted
6-membered heteroaryl ring having 1 nitrogen. Example R.sup.1
groups include optionally substituted pyridinyl, pyrimidinyl,
pyrazinyl, pyridazinyl, triazinyl, or tetrazinyl.
[0847] In certain embodiments, R.sup.1 is an optionally substituted
8-10 membered bicyclic heteroaryl ring having 1-4 heteroatoms
independently selected from nitrogen, oxygen, or sulfur. In some
embodiments, R.sup.1 is an optionally substituted 5,6-fused
heteroaryl ring having 1-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur. In other embodiments, R.sup.1 is an
optionally substituted 5,6-fused heteroaryl ring having 1-2
heteroatoms independently selected from nitrogen, oxygen, or
sulfur. In certain embodiments, R.sup.1 is an optionally
substituted 5,6-fused heteroaryl ring having 1 heteroatom
independently selected from nitrogen, oxygen, or sulfur. In some
embodiments, R.sup.1 is an optionally substituted indolyl. In some
embodiments, R.sup.1 is an optionally substituted
azabicyclo[3.2.1]octanyl. In certain embodiments, R.sup.1 is an
optionally substituted 5,6-fused heteroaryl ring having 2
heteroatoms independently selected from nitrogen, oxygen, or
sulfur. In some embodiments, R.sup.1 is an optionally substituted
azaindolyl. In some embodiments, R.sup.1 is an optionally
substituted benzimidazolyl. In some embodiments, R.sup.1 is an
optionally substituted benzothiazolyl. In some embodiments, R.sup.1
is an optionally substituted benzoxazolyl. In some embodiments,
R.sup.1 is an optionally substituted indazolyl. In certain
embodiments, R.sup.1 is an optionally substituted 5,6-fused
heteroaryl ring having 3 heteroatoms independently selected from
nitrogen, oxygen, or sulfur.
[0848] In certain embodiments, R.sup.1 is an optionally substituted
6,6-fused heteroaryl ring having 1-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur. In some embodiments,
R.sup.1 is an optionally substituted 6,6-fused heteroaryl ring
having 1-2 heteroatoms independently selected from nitrogen,
oxygen, or sulfur. In other embodiments, R.sup.1 is an optionally
substituted 6,6-fused heteroaryl ring having 1 heteroatom
independently selected from nitrogen, oxygen, or sulfur. In some
embodiments, R.sup.1 is an optionally substituted quinolinyl. In
some embodiments, R.sup.1 is an optionally substituted
isoquinolinyl. According to one aspect, R.sup.1 is an optionally
substituted 6,6-fused heteroaryl ring having 2 heteroatoms
independently selected from nitrogen, oxygen, or sulfur. In some
embodiments, R.sup.1 is a quinazoline or a quinoxaline.
[0849] In some embodiments, R.sup.1 is an optionally substituted
heterocyclyl. In some embodiments, R.sup.1 is an optionally
substituted 3-7 membered saturated or partially unsaturated
heterocyclic ring having 1-2 heteroatoms independently selected
from nitrogen, oxygen, or sulfur. In some embodiments, R.sup.1 is a
substituted 3-7 membered saturated or partially unsaturated
heterocyclic ring having 1-2 heteroatoms independently selected
from nitrogen, oxygen, or sulfur. In some embodiments, R.sup.1 is
an unsubstituted 3-7 membered saturated or partially unsaturated
heterocyclic ring having 1-2 heteroatoms independently selected
from nitrogen, oxygen, or sulfur.
[0850] In some embodiments, R.sup.1 is an optionally substituted
heterocyclyl. In some embodiments, R.sup.1 is an optionally
substituted 6 membered saturated or partially unsaturated
heterocyclic ring having 1-2 heteroatoms independently selected
from nitrogen, oxygen, or sulfur. In some embodiments, R.sup.1 is
an optionally substituted 6 membered partially unsaturated
heterocyclic ring having 2 heteroatoms independently selected from
nitrogen, oxygen, or sulfur. In some embodiments, R.sup.1 is an
optionally substituted 6 membered partially unsaturated
heterocyclic ring having 2 oxygen atoms.
[0851] In certain embodiments, R.sup.1 is a 3-7 membered saturated
or partially unsaturated heterocyclic ring having 1-2 heteroatoms
independently selected from nitrogen, oxygen, or sulfur. In certain
embodiments, R.sup.1 is oxiranyl, oxetanyl, tetrahydrofuranyl,
tetrahydropyranyl, oxepaneyl, aziridineyl, azetidineyl,
pyrrolidinyl, piperidinyl, azepanyl, thiiranyl, thietanyl,
tetrahydrothiophenyl, tetrahydrothiopyranyl, thiepanyl, dioxolanyl,
oxathiolanyl, oxazolidinyl, imidazolidinyl, thiazolidinyl,
dithiolanyl, dioxanyl, morpholinyl, oxathianyl, piperazinyl,
thiomorpholinyl, dithianyl, dioxepanyl, oxazepanyl, oxathiepanyl,
dithiepanyl, diazepanyl, dihydrofuranonyl, tetrahydropyranonyl,
oxepanonyl, pyrolidinonyl, piperidinonyl, azepanonyl,
dihydrothiophenonyl, tetrahydrothiopyranonyl, thiepanonyl,
oxazolidinonyl, oxazinanonyl, oxazepanonyl, dioxolanonyl,
dioxanonyl, dioxepanonyl, oxathiolinonyl, oxathianonyl,
oxathiepanonyl, thiazolidinonyl, thiazinanonyl, thiazepanonyl,
imidazolidinonyl, tetrahydropyrimidinonyl, diazepanonyl,
imidazolidinedionyl, oxazolidinedionyl, thiazolidinedionyl,
dioxolanedionyl, oxathiolanedionyl, piperazinedionyl,
morpholinedionyl, thiomorpholinedionyl, tetrahydropyranyl,
tetrahydrofuranyl, morpholinyl, thiomorpholinyl, piperidinyl,
piperazinyl, pyrrolidinyl, tetrahydrothiophenyl, or
tetrahydrothiopyranyl. In some embodiments, R.sup.1 is an
optionally substituted 5 membered saturated or partially
unsaturated heterocyclic ring having 1-2 heteroatoms independently
selected from nitrogen, oxygen, or sulfur.
[0852] In certain embodiments, R.sup.1 is an optionally substituted
5-6 membered partially unsaturated monocyclic ring having 1-2
heteroatoms independently selected from nitrogen, oxygen, or
sulfur. In certain embodiments, R.sup.1 is an optionally
substituted tetrahydropyridinyl, dihydrothiazolyl, dihydrooxazolyl,
or oxazolinyl group.
[0853] In some embodiments, R.sup.1 is an optionally substituted
8-10 membered bicyclic saturated or partially unsaturated
heterocyclic ring having 1-4 heteroatoms independently selected
from nitrogen, oxygen, or sulfur. In some embodiments, R.sup.1 is
an optionally substituted indolinyl. In some embodiments, R.sup.1
is an optionally substituted isoindolinyl. In some embodiments,
R.sup.1 is an optionally substituted 1, 2, 3,
4-tetrahydroquinoline. In some embodiments, R.sup.1 is an
optionally substituted 1, 2, 3, 4-tetrahydroisoquinoline.
[0854] In some embodiments, R.sup.1 is an optionally substituted
C.sub.1-C.sub.10 aliphatic wherein one or more methylene units are
optionally and independently replaced by an optionally substituted
C.sub.1-C.sub.6 alkylene, C.sub.1-C.sub.6 alkenylene,
--C.ident.C--, --C(R').sub.2--, -Cy-, --O--, --S--, --S--S--,
--N(R')--, --C(O)--, --C(S)--, --C(NR')--, --C(O)N(R')--,
--N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--,
--S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--, --N(R')S(O).sub.2--,
--SC(O)--, --C(O)S--, --OC(O)--, or --C(O)O--, wherein each
variable is independently as defined above and described herein. In
some embodiments, R.sup.1 is an optionally substituted
C.sub.1-C.sub.10 aliphatic wherein one or more methylene units are
optionally and independently replaced by an optionally-Cy-, --O--,
--S--, --S--S--, --N(R')--, --C(O)--, --C(S)--, --C(NR')--,
--C(O)N(R')--, --N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--,
--OC(O)N(R')--, --S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--,
--N(R')S(O).sub.2--, --OC(O)--, or --C(O)O--, wherein each R' is
independently as defined above and described herein. In some
embodiments, R.sup.1 is an optionally substituted C.sub.1-C.sub.10
aliphatic wherein one or more methylene units are optionally and
independently replaced by an optionally-Cy-, --O--, --S--,
--S--S--, --N(R')--, --C(O)--, --OC(O)--, or --C(O)O--, wherein
each R' is independently as defined above and described herein.
[0855] In some embodiments, R.sup.1 is
##STR00094## ##STR00095## ##STR00096##
[0856] In some embodiments, R.sup.1 is CH.sub.3--,
##STR00097##
[0857] In some embodiments, R.sup.1 comprises a terminal optionally
substituted --(CH.sub.2).sub.2-- moiety which is connected to L.
Examples of such R.sup.1 groups are depicted below:
##STR00098##
[0858] In some embodiments, R.sup.1 comprises a terminal optionally
substituted --(CH.sub.2)-- moiety which is connected to L. Example
such R.sup.1 groups are depicted below:
##STR00099##
[0859] In some embodiments, R.sup.1 is --S--R.sup.L2, wherein
R.sup.L2 is an optionally substituted C.sub.1-C.sub.9 aliphatic
wherein one or more methylene units are optionally and
independently replaced by an optionally substituted C.sub.1-C.sub.6
alkylene, C.sub.1-C.sub.6 alkenylene, --C.ident.C--,
--C(R').sub.2--, -Cy-, --O--, --S--, --S--S--, --N(R')--, --C(O)--,
--C(S)--, --C(NR')--, --C(O)N(R')--, --N(R')C(O)N(R')--,
--N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--, --S(O)--,
--S(O).sub.2--, --S(O).sub.2N(R')--, --N(R')S(O).sub.2--,
--SC(O)--, --C(O)S--, --OC(O)--, or --C(O)O--, and each of R' and
-Cy- is independently as defined above and described herein. In
some embodiments, R.sup.1 is --S--R.sup.L2, wherein the sulfur atom
is connected with the sulfur atom in L group.
[0860] In some embodiments, R.sup.1 is --C(O)--R.sup.L2, wherein
R.sup.L2 is an optionally substituted C.sub.1-C.sub.9 aliphatic
wherein one or more methylene units are optionally and
independently replaced by an optionally substituted C.sub.1-C.sub.6
alkylene, C.sub.1-C.sub.6 alkenylene, --C.ident.C--,
--C(R').sub.2--, -Cy-, --O--, --S--, --S--S--, --N(R')--, --C(O)--,
--C(S)--, --C(NR')--, --C(O)N(R')--, --N(R')C(O)N(R')--,
--N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--, --S(O)--,
--S(O).sub.2--, --S(O).sub.2N(R')--, --N(R')S(O).sub.2--,
--SC(O)--, --C(O)S--, --OC(O)--, or --C(O)O--, and each of R' and
-Cy- is independently as defined above and described herein. In
some embodiments, R.sup.1 is --C(O)--R.sup.L2, wherein the carbonyl
group is connected with G in L group. In some embodiments, R.sup.1
is --C(O)--R.sup.L2, wherein the carbonyl group is connected with
the sulfur atom in L group.
[0861] In some embodiments, R.sup.L2 is optionally substituted
C.sub.1-C.sub.9 aliphatic. In some embodiments, R.sup.L2 is
optionally substituted C.sub.1-C.sub.9 alkyl. In some embodiments,
R.sup.L2 is optionally substituted C.sub.1-C.sub.9 alkenyl. In some
embodiments, R.sup.L2 is optionally substituted C.sub.1-C.sub.9
alkynyl. In some embodiments, R.sup.L2 is an optionally substituted
C.sub.1-C.sub.9 aliphatic wherein one or more methylene units are
optionally and independently replaced by -Cy- or --C(O)--. In some
embodiments, R.sup.L2 is an optionally substituted C.sub.1-C.sub.9
aliphatic wherein one or more methylene units are optionally and
independently replaced by -Cy-. In some embodiments, R.sup.L2 is an
optionally substituted C.sub.1-C.sub.9 aliphatic wherein one or
more methylene units are optionally and independently replaced by
an optionally substituted heterocycylene. In some embodiments,
R.sup.L2 is an optionally substituted C.sub.1-C.sub.9 aliphatic
wherein one or more methylene units are optionally and
independently replaced by an optionally substituted arylene. In
some embodiments, R.sup.L2 is an optionally substituted
C.sub.1-C.sub.9 aliphatic wherein one or more methylene units are
optionally and independently replaced by an optionally substituted
heteroarylene. In some embodiments, R.sup.L2 is an optionally
substituted C.sub.1-C.sub.9 aliphatic wherein one or more methylene
units are optionally and independently replaced by an optionally
substituted C.sub.3-C.sub.10 carbocyclylene. In some embodiments,
R.sup.L2 is an optionally substituted C.sub.1-C.sub.9 aliphatic
wherein two methylene units are optionally and independently
replaced by -Cy- or --C(O)--. In some embodiments, R.sup.L2 is an
optionally substituted C.sub.1-C.sub.9 aliphatic wherein two
methylene units are optionally and independently replaced by -Cy-
or --C(O)--. Example R.sup.L2 groups are depicted below:
##STR00100##
[0862] In some embodiments, R.sup.1 is hydrogen, or an optionally
substituted group selected from
##STR00101##
--S--(C.sub.1-C.sub.10 aliphatic), C.sub.1-C.sub.10 aliphatic,
aryl, C.sub.1-C.sub.6 heteroalkyl, heteroaryl and heterocyclyl. In
some embodiments, R.sup.1 is
##STR00102##
or --S--(C.sub.1-C.sub.10 aliphatic). In some embodiments, R.sup.1
is
##STR00103##
[0863] In some embodiments, R.sup.1 is an optionally substituted
group selected from --S--(C.sub.1-C.sub.6 aliphatic),
C.sub.1-C.sub.10 aliphatic, C.sub.1-C.sub.6 heteroaliphatic, aryl,
heterocyclyl and heteroaryl.
[0864] In some embodiments, R.sup.1 is
##STR00104##
[0865] In some embodiments, the sulfur atom in the R.sup.1
embodiments described above and herein is connected with the sulfur
atom, G, E, or --C(O)-- moiety in the L embodiments described above
and herein. In some embodiments, the --C(O)-- moiety in the R.sup.1
embodiments described above and herein is connected with the sulfur
atom, G, E, or --C(O)-- moiety in the L embodiments described above
and herein.
[0866] In some embodiments, -L-R.sup.1 is any combination of the L
embodiments and R.sup.1 embodiments described above and herein.
[0867] In some embodiments, -L-R.sup.1 is -L.sup.3-G-R.sup.1
wherein each variable is independently as defined above and
described herein.
[0868] In some embodiments, -L-R.sup.1 is -L.sup.4-G-R.sup.1
wherein each variable is independently as defined above and
described herein.
[0869] In some embodiments, -L-R.sup.1 is -L.sup.3-G-S--R.sup.L2,
wherein each variable is independently as defined above and
described herein.
[0870] In some embodiments, -L-R.sup.1 is
-L.sup.3-G-C(O)--R.sup.L2, wherein each variable is independently
as defined above and described herein.
[0871] In some embodiments, -L-R.sup.1 is
##STR00105##
wherein R.sup.L2 is an optionally substituted C.sub.1-C.sub.9
aliphatic wherein one or more methylene units are optionally and
independently replaced by an optionally substituted C.sub.1-C.sub.6
alkylene, C.sub.1-C.sub.6 alkenylene, --C.ident.C--,
--C(R').sub.2--, -Cy-, --O--, --S--, --S--S--, --N(R')--, --C(O)--,
--C(S)--, --C(NR')--, --C(O)N(R')--, --N(R')C(O)N(R')--,
--N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--, --S(O)--,
--S(O).sub.2--, --S(O).sub.2N(R')--, --N(R')S(O).sub.2--,
--SC(O)--, --C(O)S--, --OC(O)--, or --C(O)O--, and each G is
independently as defined above and described herein.
[0872] In some embodiments, -L-R.sup.1 is
--R.sup.L3--S--S--R.sup.L2, wherein each variable is independently
as defined above and described herein. In some embodiments,
-L-R.sup.1 is --R.sup.L3--C(O)--S--S--R.sup.L2, wherein each
variable is independently as defined above and described
herein.
[0873] In some embodiments, -L-R.sup.1 has the structure of:
##STR00106##
wherein each variable is independently as defined above and
described herein.
[0874] In some embodiments, -L-R.sup.1 has the structure of:
##STR00107##
wherein each variable is independently as defined above and
described herein.
[0875] In some embodiments, -L-R.sup.1 has the structure of:
##STR00108##
wherein each variable is independently as defined above and
described herein.
[0876] In some embodiments, -L-R.sup.1 has the structure of:
##STR00109##
wherein each variable is independently as defined above and
described herein.
[0877] In some embodiments, -L-R.sup.1 has the structure of:
##STR00110##
wherein each variable is independently as defined above and
described herein.
[0878] In some embodiments, -L-R.sup.1 has the structure of:
##STR00111##
wherein each variable is independently as defined above and
described herein.
[0879] In some embodiments, -L-R.sup.1 has the structure of:
##STR00112##
wherein each variable is independently as defined above and
described herein.
[0880] In some embodiments, -L-R.sup.1 has the structure of:
##STR00113##
wherein each variable is independently as defined above and
described herein.
[0881] In some embodiments, -L-R.sup.1 has the structure of:
##STR00114##
wherein each variable is independently as defined above and
described herein.
[0882] In some embodiments, -L-R.sup.1 has the structure of:
##STR00115##
wherein each variable is independently as defined above and
described herein.
[0883] In some embodiments, -L-R.sup.1 has the structure of:
##STR00116##
wherein each variable is independently as defined above and
described herein.
[0884] In some embodiments, -L-R.sup.1 has the structure of:
##STR00117##
wherein each variable is independently as defined above and
described herein.
[0885] In some embodiments, -L-R.sup.1 has the structure of:
##STR00118##
wherein each variable is independently as defined above and
described herein.
[0886] In some embodiments, -L-R.sup.1 has the structure of:
##STR00119##
wherein each variable is independently as defined above and
described herein.
[0887] In some embodiments -L-R.sup.1 has the structure of:
##STR00120##
wherein each variable is independently as defined above and
described herein.
[0888] In some embodiments, -L-R.sup.1 has the structure of:
##STR00121##
wherein each variable is independently as defined above and
described herein.
[0889] In some embodiments, -L-R.sup.1 has the structure of:
##STR00122##
wherein each variable is independently as defined above and
described herein.
[0890] In some embodiments, -L-R.sup.1 has the structure of:
##STR00123##
wherein each variable is independently as defined above and
described herein.
[0891] In some embodiments, -L-R.sup.1 has the structure of:
##STR00124##
wherein each variable is independently as defined above and
described herein.
[0892] In some embodiments, -L-R.sup.1 has the structure of:
##STR00125##
wherein each variable is independently as defined above and
described herein.
[0893] In some embodiments, -L-R.sup.1 has the structure of:
##STR00126##
wherein each variable is independently as defined above and
described herein.
[0894] In some embodiments, L has the structure of:
##STR00127##
wherein each variable is independently as defined above and
described herein.
[0895] In some embodiments, --X-L-R.sup.1 has the structure of:
##STR00128##
wherein: the phenyl ring is optionally substituted, and each of
R.sup.1 and X is independently as defined above and described
herein.
[0896] In some embodiments, -L-R.sup.1 is
##STR00129## ##STR00130## ##STR00131##
[0897] In some embodiments, -L-R.sup.1 is:
##STR00132##
[0898] In some embodiments, -L-R.sup.1 is CH.sub.3--,
##STR00133##
In some embodiments, -L-R.sup.1 is
##STR00134##
[0899] In some embodiments, -L-R.sup.1 comprises a terminal
optionally substituted --(CH.sub.2).sub.2-- moiety which is
connected to X. In some embodiments, -L-R.sup.1 comprises a
terminal --(CH.sub.2).sub.2-- moiety which is connected to X.
Examples of such -L-R.sup.1 moieties are depicted below:
##STR00135##
[0900] In some embodiments, -L-R.sup.1 comprises a terminal
optionally substituted --(CH.sub.2)-- moiety which is connected to
X. In some embodiments, -L-R.sup.1 comprises a terminal
--(CH.sub.2)-- moiety which is connected to X. Examples of such
-L-R.sup.1 moieties are depicted below:
##STR00136##
[0901] In some embodiments, -L-R.sup.1 is
##STR00137##
[0902] In some embodiments, -L-R.sup.1 is CH.sub.3--,
##STR00138##
and X is --S--.
[0903] In some embodiments, -L-R.sup.1 is CH.sub.3--,
##STR00139##
X is --S--, W is O, Y is --O--, and Z is --O--.
[0904] In some embodiments, R.sup.1 is
##STR00140##
or --S--(C.sub.1-C.sub.10 aliphatic).
[0905] In some embodiments, R.sup.1 is
##STR00141##
[0906] In some embodiments, X is --O-- or --S--, and R.sup.1 is
##STR00142##
or --S--(C.sub.1-C.sub.10 aliphatic).
[0907] In some embodiments, X is --O-- or --S--, and R.sup.1 is
##STR00143##
--S--(C.sub.1-C.sub.10 aliphatic) or --S--(C.sub.1-C.sub.50
aliphatic).
[0908] In some embodiments, L is a covalent bond and -L-R.sup.1 is
R.sup.1.
[0909] In some embodiments, -L-R.sup.1 is not hydrogen.
[0910] In some embodiments, --X-L-R.sup.1 is R.sup.1 is
##STR00144##
--S--(C.sub.1-C.sub.10 aliphatic) or --S--(C.sub.1-C.sub.50
aliphatic).
[0911] In some embodiments, --X-L-R.sup.1 has the structure of
##STR00145##
wherein the
##STR00146##
moiety is optionally substituted. In some embodiments,
--X-L-R.sup.1 is
##STR00147##
In some embodiments, --X-L-R.sup.1 is
##STR00148##
In some embodiments, --X-L-R.sup.1 is
##STR00149##
In some embodiments, --X-L-R.sup.1 has the structure of
##STR00150##
wherein X' is O or S, Y' is --O--, --S-- or --NR'--, and the
##STR00151##
moiety is optionally substituted. In some embodiments, Y' is --O--,
--S-- or --NH--. In some embodiments,
##STR00152##
In some embodiments,
##STR00153##
In some embodiments,
##STR00154##
In some embodiments, --X-L-R.sup.1 has the structure of
##STR00155##
wherein X' is O or S, and the
##STR00156##
moiety is optionally substituted. In some embodiments,
##STR00157##
In some embodiments, --X-L-R.sup.1 is
##STR00158##
wherein the
##STR00159##
is optionally substituted. In some embodiments, --X-L-R.sup.1
is
##STR00160##
wherein the
##STR00161##
is substituted. In some embodiments, --X-L-R.sup.1 is
##STR00162##
wherein the
##STR00163##
is unsubstituted.
[0912] In some embodiments, --X-L-R.sup.1 is
R.sup.1--C(O)--S-L.sup.x-S--, wherein L.sup.x is an optionally
substituted group selected from
##STR00164##
In some embodiments, L.sup.x is
##STR00165##
In some embodiments, --X-L-R.sup.1 is
(CH.sub.3).sub.3C--S--S-L.sup.x-S--. In some embodiments,
--X-L-R.sup.1 is R'--C(.dbd.X')--Y'--C(R).sub.2--S-L.sup.x-S--. In
some embodiments, --X-L-R.sup.1 is
R--C(.dbd.X')--Y'--CH.sub.2--S-L.sup.x-S--. In some embodiments,
--X-L-R.sup.1 is
##STR00166##
[0913] As will be appreciated by a person skilled in the art, many
of the --X-L-R.sup.1 groups described herein are cleavable and can
be converted to --X.sup.- after administration to a subject. In
some embodiments, --X-L-R.sup.1 is cleavable. In some embodiments,
--X-L-R.sup.1 is --S-L-R.sup.1, and is converted to --S.sup.- after
administration to a subject. In some embodiments, the conversion is
promoted by an enzyme of a subject. As appreciated by a person
skilled in the art, methods of determining whether the
--S-L-R.sup.1 group is converted to --S.sup.- after administration
is widely known and practiced in the art, including those used for
studying drug metabolism and pharmacokinetics.
[0914] In some embodiments, the internucleotidic linkage having the
structure of formula I is
##STR00167##
[0915] In some embodiments, the internucleotidic linkage of formula
I has the structure of formula I-a:
##STR00168##
wherein each variable is independently as defined above and
described herein.
[0916] In some embodiments, the internucleotidic linkage of formula
I has the structure of formula I-b:
##STR00169##
wherein each variable is independently as defined above and
described herein.
[0917] In some embodiments, the internucleotidic linkage of formula
I is an phosphorothioate triester linkage having the structure of
formula I-c:
##STR00170##
wherein: [0918] P* is an asymmetric phosphorus atom and is either
Rp or Sp; [0919] L is a covalent bond or an optionally substituted,
linear or branched C.sub.1-C.sub.10 alkylene, wherein one or more
methylene units of L are optionally and independently replaced by
an optionally substituted C.sub.1-C.sub.6 alkylene, C.sub.1-C.sub.6
alkenylene, --C.ident.C--, --C(R').sub.2--, -Cy-, --O--, --S--,
--S--S--, --N(R')--, --C(O)--, --C(S)--, --C(NR')--, --C(O)N(R')--,
--N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--,
--S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--, --N(R')S(O).sub.2--,
--SC(O)--, --C(O)S--, --OC(O)--, or --C(O)O--; [0920] R.sup.1 is
halogen, R, or an optionally substituted C.sub.1-C.sub.50 aliphatic
wherein one or more methylene units are optionally and
independently replaced by an optionally substituted C.sub.1-C.sub.6
alkylene, C.sub.1-C.sub.6 alkenylene, --C.ident.C--,
--C(R').sub.2--, -Cy-, --O--, --S--, --S--S--, --N(R')--, --C(O)--,
--C(S)--, --C(NR')--, --C(O)N(R')--, --N(R')C(O)N(R')--,
--N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--, --S(O)--,
--S(O).sub.2--, --S(O).sub.2N(R')--, --N(R')S(O).sub.2--,
--SC(O)--, --C(O)S--, --OC(O)--, or --C(O)O--; [0921] each R' is
independently --R, --C(O)R, --CO.sub.2R, or --SO.sub.2R, or: [0922]
two R' on the same nitrogen are taken together with their
intervening atoms to form an optionally substituted heterocyclic or
heteroaryl ring, or [0923] two R' on the same carbon are taken
together with their intervening atoms to form an optionally
substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring;
[0924] -Cy- is an optionally substituted bivalent ring selected
from phenylene, carbocyclylene, arylene, heteroarylene, or
heterocyclylene; [0925] each R is independently hydrogen, or an
optionally substituted group selected from C.sub.1-C.sub.6
aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl;
[0926] each
[0926] ##STR00171## independently represents a connection to a
nucleoside; and [0927] R.sup.1 is not --H when L is a covalent
bond.
[0928] In some embodiments, the internucleotidic linkage having the
structure of formula I is
##STR00172## ##STR00173## ##STR00174##
[0929] In some embodiments, the internucleotidic linkage having the
structure of formula I-c is
##STR00175## ##STR00176## ##STR00177##
[0930] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide comprising one or more
phosphate diester linkages, and one or more modified
internucleotide linkages having the formula of I-a, I-b, or
I-c.
[0931] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide comprising at least one
phosphate diester internucleotidic linkage and at least one
phosphorothioate triester linkage having the structure of formula
I-c. In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide comprising at least one
phosphate diester internucleotidic linkage and at least two
phosphorothioate triester linkages having the structure of formula
I-c. In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide comprising at least one
phosphate diester internucleotidic linkage and at least three
phosphorothioate triester linkages having the structure of formula
I-c. In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide comprising at least one
phosphate diester internucleotidic linkage and at least four
phosphorothioate triester linkages having the structure of formula
I-c. In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide comprising at least one
phosphate diester internucleotidic linkage and at least five
phosphorothioate triester linkages having the structure of formula
I-c.
[0932] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide comprising a sequence found in
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41). In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO:
41), wherein the said sequence has over 50% identity with
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41). In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO:
41), wherein the said sequence has over 60% identity with
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41). In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO:
41), wherein the said sequence has over 70% identity with
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41). In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO:
41), wherein the said sequence has over 80% identity with
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41). In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO:
41), wherein the said sequence has over 90% identity with
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41). In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO:
41), wherein the said sequence has over 95% identity with
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41). In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
comprising the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41). In
some embodiments, the present disclosure provides a chirally
controlled oligonucleotide having the sequence of
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41).
[0933] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide comprising a sequence found in
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one
internucleotidic linkage has a chiral linkage phosphorus. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide comprising a sequence found in GGCACAAGGGCACAGACTTC
(SEQ ID NO: 41), wherein at least one internucleotidic linkage has
the structure of formula I. In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide
comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO:
41), wherein each internucleotidic linkage has the structure of
formula I. In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide comprising a sequence found in
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one
internucleotidic linkage has the structure of formula I-c. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide comprising a sequence found in GGCACAAGGGCACAGACTTC
(SEQ ID NO: 41), wherein each internucleotidic linkage has the
structure of formula I-c. In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide
comprising a sequence found in GGCACAAGGGCACAGACTTC (SEQ ID NO:
41), wherein at least one internucleotidic linkage is
##STR00178##
In some embodiments, the present disclosure provides a chirally
controlled oligonucleotide comprising a sequence found in
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each internucleotidic
linkage is
##STR00179##
In some embodiments the present disclosure provides a chirally
controlled oligonucleotide comprising a sequence found in
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one
internucleotidic linkage is
##STR00180##
In some embodiments, the present disclosure provides a chirally
controlled oligonucleotide comprising a sequence found in
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each internucleotidic
linkage is
##STR00181##
[0934] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide comprising the sequence of
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one
internucleotidic linkage has a chiral linkage phosphorus. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide comprising the sequence of GGCACAAGGGCACAGACTTC
(SEQ ID NO: 41), wherein at least one internucleotidic linkage has
the structure of formula I. In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide
comprising the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41),
wherein each internucleotidic linkage has the structure of formula
I. In some embodiments, the present disclosure provides a chirally
controlled oligonucleotide comprising the sequence of
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one
internucleotidic linkage has the structure of formula I-c. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide comprising the sequence of GGCACAAGGGCACAGACTTC
(SEQ ID NO: 41), wherein each internucleotidic linkage has the
structure of formula I-c. In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide
comprising the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41),
wherein at least one internucleotidic linkage is
##STR00182##
In some embodiments, the present disclosure provides a chirally
controlled oligonucleotide comprising the sequence of
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each internucleotidic
linkage is
##STR00183##
In some embodiments, the present disclosure provides a chirally
controlled oligonucleotide comprising the sequence of
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one
internucleotidic linkage is
##STR00184##
In some embodiments, the present disclosure provides a chirally
controlled oligonucleotide comprising the sequence of
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each internucleotidic
linkage is
##STR00185##
[0935] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide having the sequence of
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one
internucleotidic linkage has a chiral linkage phosphorus. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID
NO: 41), wherein at least one internucleotidic linkage has the
structure of formula I. In some embodiments, the present disclosure
provides a chirally controlled oligonucleotide having the sequence
of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each
internucleotidic linkage has the structure of formula I. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID
NO: 41), wherein at least one internucleotidic linkage has the
structure of formula I-c. In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide having
the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each
internucleotidic linkage has the structure of formula I-c. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID
NO: 41), wherein at least one internucleotidic linkage is
##STR00186##
In some embodiments, the present disclosure provides a chirally
controlled oligonucleotide having the sequence of
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each internucleotidic
linkage is
##STR00187##
In some embodiments, the present disclosure provides a chirally
controlled oligonucleotide having the sequence of
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one
internucleotidic linkage is
##STR00188##
In some embodiments, the present disclosure provides a chirally
controlled oligonucleotide having the sequence of
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each internucleotidic
linkage is
##STR00189##
[0936] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide having the sequence of
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at least one linkage
phosphorus is Rp. It is understood by a person of ordinary skill in
the art that in certain embodiments wherein the chirally controlled
oligonucleotide comprises an RNA sequence, each T is independently
and optionally replaced with U. In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide having
the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each
linkage phosphorus is Rp. In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide having
the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein at
least one linkage phosphorus is Sp. In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41),
wherein each linkage phosphorus is Sp. In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41),
wherein the oligonucleotide is a blockmer. In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41),
wherein the oligonucleotide is a stereoblockmer. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID
NO: 41), wherein the oligonucleotide is a P-modification blockmer.
In some embodiments, the present disclosure provides a chirally
controlled oligonucleotide having the sequence of
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the oligonucleotide
is a linkage blockmer. In some embodiments, the present disclosure
provides a chirally controlled oligonucleotide having the sequence
of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the
oligonucleotide is an altmer. In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide having
the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the
oligonucleotide is a stereoaltmer. In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide having
the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the
oligonucleotide is a P-modification altmer. In some embodiments,
the present disclosure provides a chirally controlled
oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID
NO: 41), wherein the oligonucleotide is a linkage altmer. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID
NO: 41), wherein the oligonucleotide is a unimer. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID
NO: 41), wherein the oligonucleotide is a stereounimer. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID
NO: 41), wherein the oligonucleotide is a P-modification unimer. In
some embodiments, the present disclosure provides a chirally
controlled oligonucleotide having the sequence of
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the oligonucleotide
is a linkage unimer. In some embodiments, the present disclosure
provides a chirally controlled oligonucleotide having the sequence
of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the
oligonucleotide is a gapmer. In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide having
the sequence of GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein the
oligonucleotide is a skipmer.
[0937] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide having the sequence of
GGCACAAGGGCACAGACTTC (SEQ ID NO: 41), wherein each cytosine is
optionally and independently replaced by 5-methylcytosine. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID
NO: 41), wherein at least one cytosine is optionally and
independently replaced by 5-methylcytosine. In some embodiments,
the present disclosure provides a chirally controlled
oligonucleotide having the sequence of GGCACAAGGGCACAGACTTC (SEQ ID
NO: 41), wherein each cytosine is optionally and independently
replaced by 5-methylcytosine.
[0938] In some embodiments, a chirally controlled oligonucleotide
is designed such that one or more nucleotides comprise a phosphorus
modification prone to "autorelease" under certain conditions. That
is, under certain conditions, a particular phosphorus modification
is designed such that it self-cleaves from the oligonucleotide to
provide, e.g., a phosphate diester such as those found in naturally
occurring DNA and RNA. In some embodiments, such a phosphorus
modification has a structure of --O-L-R.sup.1, wherein each of L
and R.sup.1 is independently as defined above and described herein.
In some embodiments, an autorelease group comprises a morpholino
group. In some embodiments, an autorelease group is characterized
by the ability to deliver an agent to the internucleotidic
phosphorus linker, which agent facilitates further modification of
the phosphorus atom such as, e.g., desulfurization. In some
embodiments, the agent is water and the further modification is
hydrolysis to form a phosphate diester as is found in naturally
occurring DNA and RNA.
[0939] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide comprising any sequence
disclosed herein (including, as non-limiting examples, any sequence
disclosed in any Table). In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide
comprising a sequence having over 50% identity with any sequence
disclosed herein. In some embodiments, the present disclosure
provides a chirally controlled oligonucleotide comprising a
sequence having over 60% identity with any sequence disclosed
herein. In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide comprising a sequence having
over 70% identity with any sequence disclosed herein. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide comprising a sequence having over 80% identity with
any sequence disclosed herein. In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide
comprising a sequence having over 90% identity with any sequence
disclosed herein. In some embodiments, the present disclosure
provides a chirally controlled oligonucleotide comprising a
sequence having over 95% identity with any sequence disclosed
herein. In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide comprising any sequence
disclosed herein. In some embodiments, the present disclosure
provides a chirally controlled oligonucleotide having any sequence
disclosed herein.
[0940] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide comprising any sequence
disclosed herein, wherein at least one internucleotidic linkage has
a chiral linkage phosphorus. In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide
comprising any sequence disclosed herein, wherein at least one
internucleotidic linkage has the structure of formula I. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide comprising any sequence disclosed herein, wherein
each internucleotidic linkage has the structure of formula I. In
some embodiments, the present disclosure provides a chirally
controlled oligonucleotide comprising any sequence disclosed
herein, wherein at least one internucleotidic linkage has the
structure of formula I-c. In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide
comprising any sequence disclosed herein, wherein each
internucleotidic linkage has the structure of formula I-c. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide comprising any sequence disclosed herein, wherein
at least one internucleotidic linkage is
##STR00190##
In some embodiments, the present disclosure provides a chirally
controlled oligonucleotide comprising any sequence disclosed
herein, wherein each internucleotidic linkage is
##STR00191##
In some embodiments, the present disclosure provides a chirally
controlled oligonucleotide comprising any sequence disclosed
herein, wherein at least one internucleotidic linkage is
##STR00192##
In some embodiments, the present disclosure provides a chirally
controlled oligonucleotide comprising any sequence disclosed
herein, wherein each internucleotidic linkage is
##STR00193##
[0941] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide comprising any sequence
disclosed herein, wherein at least one internucleotidic linkage has
a chiral linkage phosphorus. In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide
comprising any sequence disclosed herein, wherein at least one
internucleotidic linkage has the structure of formula I. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide comprising any sequence disclosed herein, wherein
each internucleotidic linkage has the structure of formula I. In
some embodiments, the present disclosure provides a chirally
controlled oligonucleotide comprising any sequence disclosed
herein, wherein at least one internucleotidic linkage has the
structure of formula I-c. In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide
comprising any sequence disclosed herein, wherein each
internucleotidic linkage has the structure of formula I-c. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide comprising any sequence disclosed herein, wherein
at least one internucleotidic linkage is
##STR00194##
In some embodiments, the present disclosure provides a chirally
controlled oligonucleotide comprising any sequence disclosed
herein, wherein each internucleotidic linkage is
##STR00195##
In some embodiments, the present disclosure provides a chirally
controlled oligonucleotide comprising any sequence disclosed
herein, wherein at least one internucleotidic linkage is
##STR00196##
In some embodiments, the present disclosure provides a chirally
controlled oligonucleotide comprising any sequence disclosed
herein, wherein each internucleotidic linkage is
##STR00197##
[0942] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide having any sequence disclosed
herein, wherein at least one internucleotidic linkage has a chiral
linkage phosphorus. In some embodiments, the present disclosure
provides a chirally controlled oligonucleotide having any sequence
disclosed herein, wherein at least one internucleotidic linkage has
the structure of formula I. In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide having
any sequence disclosed herein, wherein each internucleotidic
linkage has the structure of formula I. In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
having any sequence disclosed herein, wherein at least one
internucleotidic linkage has the structure of formula I-c. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide having any sequence disclosed herein, wherein each
internucleotidic linkage has the structure of formula I-c. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide having any sequence disclosed herein, wherein at
least one internucleotidic linkage is
##STR00198##
In some embodiments, the present disclosure provides a chirally
controlled oligonucleotide having any sequence disclosed herein,
wherein each internucleotidic linkage is
##STR00199##
In some embodiments, the present disclosure provides a chirally
controlled oligonucleotide having any sequence disclosed herein,
wherein at least one internucleotidic linkage is
##STR00200##
In some embodiments, the present disclosure provides a chirally
controlled oligonucleotide having any sequence disclosed herein,
wherein each internucleotidic linkage is
##STR00201##
[0943] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide having any sequence disclosed
herein, wherein at least one linkage phosphorus is Rp. It is
understood by a person of ordinary skill in the art that in certain
embodiments wherein the chirally controlled oligonucleotide
comprises an RNA sequence, each T is independently and optionally
replaced with U. In some embodiments, the present disclosure
provides a chirally controlled oligonucleotide having any sequence
disclosed herein, wherein each linkage phosphorus is Rp. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide having any sequence disclosed herein, wherein at
least one linkage phosphorus is Sp. In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
having any sequence disclosed herein, wherein each linkage
phosphorus is Sp. In some embodiments, the present disclosure
provides a chirally controlled oligonucleotide having any sequence
disclosed herein, wherein the oligonucleotide is a blockmer. In
some embodiments, the present disclosure provides a chirally
controlled oligonucleotide having any sequence disclosed herein,
wherein the oligonucleotide is a stereoblockmer. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide having any sequence disclosed herein, wherein the
oligonucleotide is a P-modification blockmer. In some embodiments,
the present disclosure provides a chirally controlled
oligonucleotide having any sequence disclosed herein, wherein the
oligonucleotide is a linkage blockmer. In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
having any sequence disclosed herein, wherein the oligonucleotide
is an altmer. In some embodiments, the present disclosure provides
a chirally controlled oligonucleotide having any sequence disclosed
herein, wherein the oligonucleotide is a stereoaltmer. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide having any sequence disclosed herein, wherein the
oligonucleotide is a P-modification altmer. In some embodiments,
the present disclosure provides a chirally controlled
oligonucleotide having any sequence disclosed herein, wherein the
oligonucleotide is a linkage altmer. In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
having any sequence disclosed herein, wherein the oligonucleotide
is a unimer. In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide having any sequence disclosed
herein, wherein the oligonucleotide is a stereounimer. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide having any sequence disclosed herein, wherein the
oligonucleotide is a P-modification unimer. In some embodiments,
the present disclosure provides a chirally controlled
oligonucleotide having any sequence disclosed herein, wherein the
oligonucleotide is a linkage unimer. In some embodiments, the
present disclosure provides a chirally controlled oligonucleotide
having any sequence disclosed herein, wherein the oligonucleotide
is a gapmer. In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide having any sequence disclosed
herein, wherein the oligonucleotide is a skipmer.
[0944] In some embodiments, the present disclosure provides a
chirally controlled oligonucleotide having any sequence disclosed
herein, wherein each cytosine is optionally and independently
replaced by 5-methylcytosine. In some embodiments, the present
disclosure provides a chirally controlled oligonucleotide having
any sequence disclosed herein, wherein at least one cytosine is
optionally and independently replaced by 5-methylcytosine. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide having any sequence disclosed herein, wherein each
cytosine is optionally and independently replaced by
5-methylcytosine.
[0945] In various embodiments, any sequence disclosed herein can be
combined with one or more of the following as disclosed herein or
known in the art: pattern of backbone linkages; pattern of backbone
chiral centers; and pattern of backbone P-modifications; pattern of
base modification; pattern of sugar modification; pattern of
backbone linkages; pattern of backbone chiral centers; and pattern
of backbone P-modifications.
[0946] In some embodiments, a chirally controlled oligonucleotide
is designed such that the resulting pharmaceutical properties are
improved through one or more particular modifications at
phosphorus. It is well documented in the art that certain
oligonucleotides are rapidly degraded by nucleases and exhibit poor
cellular uptake through the cytoplasmic cell membrane
[Poijarvi-Virta et al., Curr. Med. Chem. (2006), 13(28); 3441-65;
Wagner et al., Med. Res. Rev. (2000), 20(6):417-51; Peyrottes et
al., Mini Rev. Med. Chem. (2004), 4(4):395-408; Gosselin et al.,
(1996), 43(1):196-208; Bologna et al., (2002), Antisense &
Nucleic Acid Drug Development 12:33-41]. For instance, Vives et
al., Nucleic Acids Research (1999), 27(20):4071-76, found that
tert-butyl SATE pro-oligonucleotides displayed markedly increased
cellular penetration compared to the parent oligonucleotide.
[0947] In some embodiments, a modification at a linkage phosphorus
is characterized by its ability to be transformed to a phosphate
diester, such as those present in naturally occurring DNA and RNA,
by one or more esterases, nucleases, and/or cytochrome P450
enzymes, including but not limited to, those listed in Table 1A,
below.
TABLE-US-00002 TABLE 1A Example enzymes. Family Gene CYP1 CYP1A1,
CYP1A2, CYP1B1 CYP2 CYP2A6, CYP2A7, CYP2A13, CYP2B6, CYP2C8,
CYP2C9, CYP2C18, CYP2C19, CYP2D6, CYP2E1, CYP2F1, CYP2J2, CYP2R1,
CYP2S1, CYP2U1, CYP2W1 CYP3 CYP3A4, CYP3A5, CYP3A7, CYP3A43 CYP4
CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12,
CYP4F22, CYP4V2, CYP4X1, CYP4Z1 CYP5 CYP5A1 CYP7 CYP7A1, CYP7B1
CYP8 CYP8A1 (prostacyclin synthase), CYP8B1 (bile acid
biosynthesis) CYP11 CYP11A1, CYP11B1, CYP11B2 CYP17 CYP17A1 CYP19
CYP19A1 CYP20 CYP20A1 CYP21 CYP21A2 CYP24 CYP24A1 CYP26 CYP26A1,
CYP26B1, CYP26C1 CYP27 CYP27A1 (bile acid biosynthesis), CYP27B1
(vitamin D3 1-alpha hydroxylase, activates vitamin D3), CYP27C1
(unknown function) CYP39 CYP39A1 CYP46 CYP46A1 CYP51 CYP51A1
(lanosterol 14-alpha demethylase)
[0948] In some embodiments, a modification at phosphorus results in
a P-modification moiety characterized in that it acts as a
pro-drug, e.g., the P-modification moiety facilitates delivery of
an oligonucleotide to a desired location prior to removal. For
instance, in some embodiments, a P-modification moiety results from
PEGylation at the linkage phosphorus. One of skill in the relevant
arts will appreciate that various PEG chain lengths are useful and
that the selection of chain length will be determined in part by
the result that is sought to be achieved by PEGylation. For
instance, in some embodiments, PEGylation is effected in order to
reduce RES uptake and extend in vivo circulation lifetime of an
oligonucleotide.
[0949] In some embodiments, a PEGylation reagent for use in
accordance with the present disclosure is of a molecular weight of
about 300 g/mol to about 100,000 g/mol. In some embodiments, a
PEGylation reagent is of a molecular weight of about 300 g/mol to
about 10,000 g/mol. In some embodiments, a PEGylation reagent is of
a molecular weight of about 300 g/mol to about 5,000 g/mol. In some
embodiments, a PEGylation reagent is of a molecular weight of about
500 g/mol. In some embodiments, a PEGylation reagent of a molecular
weight of about 1000 g/mol. In some embodiments, a PEGylation
reagent is of a molecular weight of about 3000 g/mol. In some
embodiments, a PEGylation reagent is of a molecular weight of about
5000 g/mol.
[0950] In certain embodiments, a PEGylation reagent is PEG500. In
certain embodiments, a PEGylation reagent is PEG1000. In certain
embodiments, a PEGylation reagent is PEG3000. In certain
embodiments, a PEGylation reagent is PEG5000.
[0951] In some embodiments, a P-modification moiety is
characterized in that it acts as a PK enhancer, e.g., lipids,
PEGylated lipids, etc.
[0952] In some embodiments, a P-modification moiety is
characterized in that it acts as an agent which promotes cell entry
and/or endosomal escape, such as a membrane-disruptive lipid or
peptide.
[0953] In some embodiments, a P-modification moiety is
characterized in that it acts as a targeting agent. In some
embodiments, a P-modification moiety is or comprises a targeting
agent. The phrase "targeting agent," as used herein, is an entity
that is associates with a payload of interest (e.g., with an
oligonucleotide or oligonucleotide composition) and also interacts
with a target site of interest so that the payload of interest is
targeted to the target site of interest when associated with the
targeting agent to a materially greater extent than is observed
under otherwise comparable conditions when the payload of interest
is not associated with the targeting agent. A targeting agent may
be, or comprise, any of a variety of chemical moieties, including,
for example, small molecule moieties, nucleic acids, polypeptides,
carbohydrates, etc. Targeting agents are described further by
Adarsh et al., "Organelle Specific Targeted Drug Delivery--A
Review," International Journal of Research in Pharmaceutical and
Biomedical Sciences, 2011, p. 895.
[0954] Examples of such targeting agents include, but are not
limited to, proteins (e.g. Transferrin), oligopeptides (e.g.,
cyclic and acrylic RGD-containing oligopeptides), antibodies
(monoclonal and polyclonal antibodies, e.g. IgG, IgA, IgM, IgD, IgE
antibodies), sugars/carbohydrates (e.g., monosaccharides and/or
oligosaccharides (mannose, mannose-6-phosphate, galactose, and the
like)), vitamins (e.g., folate), or other small biomolecules. In
some embodiments, a targeting moiety is a steroid molecule (e.g.,
bile acids including cholic acid, deoxycholic acid, dehydrocholic
acid; cortisone; digoxigenin; testosterone; cholesterol; cationic
steroids such as cortisone having a trimethylaminomethyl hydrazide
group attached via a double bond at the 3-position of the cortisone
ring, etc.). In some embodiments, a targeting moiety is a
lipophilic molecule (e.g., alicyclic hydrocarbons, saturated and
unsaturated fatty acids, waxes, terpenes, and polyalicyclic
hydrocarbons such as adamantine and buckminsterfullerenes). In some
embodiments, a lipophilic molecule is a terpenoid such as vitamin
A, retinoic acid, retinal, or dehydroretinal. In some embodiments,
a targeting moiety is a peptide.
[0955] In some embodiments, a P-modification moiety is a targeting
agent of formula --X-L-R.sup.1 wherein each of X, L, and R.sup.1
are as defined in Formula I above.
[0956] In some embodiments, a P-modification moiety is
characterized in that it facilitates cell specific delivery.
[0957] In some embodiments, a P-modification moiety is
characterized in that it falls into one or more of the
above-described categories. For instance, in some embodiments, a
P-modification moiety acts as a PK enhancer and a targeting ligand.
In some embodiments, a P-modification moiety acts as a pro-drug and
an endosomal escape agent. One of skill in the relevant arts would
recognize that numerous other such combinations are possible and
are contemplated by the present disclosure.
Nucleobases
[0958] In some embodiments, a nucleobase present in a provided
oligonucleotide is a natural nucleobase or a modified nucleobase
derived from a natural nucleobase. Examples include, but are not
limited to, uracil, thymine, adenine, cytosine, and guanine having
their respective amino groups protected by acyl protecting groups,
2-fluorouracil, 2-fluorocytosine, 5-bromouracil, 5-iodouracil,
2,6-diaminopurine, azacytosine, pyrimidine analogs such as
pseudoisocytosine and pseudouracil and other modified nucleobases
such as 8-substituted purines, xanthine, or hypoxanthine (the
latter two being the natural degradation products). Example
modified nucleobases are disclosed in Chiu and Rana, RNA, 2003, 9,
1034-1048, Limbach et al. Nucleic Acids Research, 1994, 22,
2183-2196 and Revankar and Rao, Comprehensive Natural Products
Chemistry, vol. 7, 313.
[0959] Compounds represented by the following general formulae are
also contemplated as modified nucleobases:
##STR00202##
wherein R.sup.8 is an optionally substituted, linear or branched
group selected from aliphatic, aryl, aralkyl, aryloxylalkyl,
carbocyclyl, heterocyclyl or heteroaryl group having 1 to 15 carbon
atoms, including, by way of example only, a methyl, isopropyl,
phenyl, benzyl, or phenoxymethyl group; and each of R.sup.9 and
R.sup.10 is independently an optionally substituted group selected
from linear or branched aliphatic, carbocyclyl, aryl, heterocyclyl
and heteroaryl.
[0960] Modified nucleobases also include expanded-size nucleobases
in which one or more aryl rings, such as phenyl rings, have been
added. Nucleic base replacements described in the Glen Research
catalog (www.glenresearch.com); Krueger A T et al, Acc. Chem. Res.,
2007, 40, 141-150; Kool, E T, Acc. Chem. Res., 2002, 35, 936-943;
Benner S. A., et al., Nat. Rev. Genet., 2005, 6, 553-543;
Romesberg, F. E., et al., Curr. Opin. Chem. Biol., 2003, 7,
723-733; Hirao, I., Curr. Opin. Chem. Biol., 2006, 10, 622-627, are
contemplated as useful for the synthesis of the nucleic acids
described herein. Some examples of these expanded-size nucleobases
are shown below:
##STR00203##
[0961] Herein, modified nucleobases also encompass structures that
are not considered nucleobases but are other moieties such as, but
not limited to, corrin- or porphyrin-derived rings.
Porphyrin-derived base replacements have been described in
Morales-Rojas, H and Kool, E T, Org. Lett., 2002, 4, 4377-4380.
Shown below is an example of a porphyrin-derived ring which can be
used as a base replacement:
##STR00204##
[0962] In some embodiments, modified nucleobases are of any one of
the following structures, optionally substituted:
##STR00205##
[0963] In some embodiments, a modified nucleobase is fluorescent.
Examples of such fluorescent modified nucleobases include
phenanthrene, pyrene, stillbene, isoxanthine, isozanthopterin,
terphenyl, terthiophene, benzoterthiophene, coumarin, lumazine,
tethered stillbene, benzo-uracil, and naphtho-uracil, as shown
below:
##STR00206##
[0964] In some embodiments, a modified nucleobase is unsubstituted.
In some embodiments, a modified nucleobase is substituted. In some
embodiments, a modified nucleobase is substituted such that it
contains, e.g., heteroatoms, alkyl groups, or linking moieties
connected to fluorescent moieties, biotin or avidin moieties, or
other protein or peptides. In some embodiments, a modified
nucleobase is a "universal base" that is not a nucleobase in the
most classical sense, but that functions similarly to a nucleobase.
One representative example of such a universal base is
3-nitropyrrole.
[0965] In some embodiments, other nucleosides can also be used in
the process disclosed herein and include nucleosides that
incorporate modified nucleobases, or nucleobases covalently bound
to modified sugars. Some examples of nucleosides that incorporate
modified nucleobases include 4-acetylcytidine;
5-(carboxyhydroxylmethyl)uridine; 2'-O-methylcytidine;
5-carboxymethylaminomethyl-2-thiouridine;
5-carboxymethylaminomethyluridine; dihydrouridine;
2'-O-methylpseudouridine; beta,D-galactosylqueosine;
2'-O-methylguanosine; N.sup.6-isopentenyladenosine;
1-methyladenosine; 1-methylpseudouridine; 1-methylguanosine;
1-methylinosine; 2,2-dimethylguanosine; 2-methyladenosine;
2-methylguanosine; N.sup.7-methylguanosine; 3-methyl-cytidine;
5-methylcytidine; 5-hydroxymethylcytidine; 5-formylcytosine;
5-carboxylcytosine; N.sup.6-methyladenosine; 7-methylguanosine;
5-methylaminoethyluridine; 5-methoxyaminomethyl-2-thiouridine;
beta,D-mannosylqueosine; 5-methoxycarbonylmethyluridine;
5-methoxyuridine; 2-methylthio-N.sup.6-isopentenyladenosine;
N-((9-beta,D-ribofuranosyl-2-methylthiopurine-6-yl)carbamoyl)threonine;
N-((9-beta,D-ribofuranosylpurine-6-yl)-N-methylcarbamoyl)threonine;
uridine-5-oxyacetic acid methylester; uridine-5-oxyacetic acid (v);
pseudouridine; queosine; 2-thiocytidine; 5-methyl-2-thiouridine;
2-thiouridine; 4-thiouridine; 5-methyluridine;
2'-O-methyl-5-methyluridine; and 2'-O-methyluridine.
[0966] In some embodiments, nucleosides include 6'-modified
bicyclic nucleoside analogs that have either (R) or (S)-chirality
at the 6'-position and include the analogs described in U.S. Pat.
No. 7,399,845. In other embodiments, nucleosides include
5'-modified bicyclic nucleoside analogs that have either (R) or
(S)-chirality at the 5'-position and include the analogs described
in US Patent Application Publication No. 20070287831.
[0967] In some embodiments, a nucleobase or modified nucleobase
comprises one or more biomolecule binding moieties such as e.g.,
antibodies, antibody fragments, biotin, avidin, streptavidin,
receptor ligands, or chelating moieties. In other embodiments, a
nucleobase or modified nucleobase is 5-bromouracil, 5-iodouracil,
or 2,6-diaminopurine. In some embodiments, a nucleobase or modified
nucleobase is modified by substitution with a fluorescent or
biomolecule binding moiety. In some embodiments, the substituent on
a nucleobase or modified nucleobase is a fluorescent moiety. In
some embodiments, the substituent on a nucleobase or modified
nucleobase is biotin or avidin.
[0968] Representative U.S. patents that teach the preparation of
certain of the above noted modified nucleobases as well as other
modified nucleobases include, but are not limited to, the above
noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205;
5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187;
5,457,191; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 5,750,692;
6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368;
6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and
7,495,088, each of which is herein incorporated by reference in its
entirety.
[0969] In some embodiments, a base is optionally substituted A, T,
C, G or U, wherein one or more --NH.sub.2 are independently and
optionally replaced with --C(-L-R.sup.1).sub.3, one or more --NH--
are independently and optionally replaced with
--C(-L-R.sup.1).sub.2--, one or more .dbd.N-- are independently and
optionally replaced with --C(-L-R.sup.1)--, one or more .dbd.CH--
are independently and optionally replaced with .dbd.N--, and one or
more .dbd.O are independently and optionally replaced with .dbd.S,
.dbd.N(-L-R.sup.1), or .dbd.C(-L-R.sup.1).sub.2, wherein two or
more -L-R.sup.1 are optionally taken together with their
intervening atoms to form a 3-30 membered bicyclic or polycyclic
ring having 0-10 heteroatom ring atoms. In some embodiments, a
modified base is optionally substituted A, T, C, G or U, wherein
one or more --NH.sub.2 are independently and optionally replaced
with --C(-L-R.sup.1).sub.3, one or more --NH-- are independently
and optionally replaced with --C(-L-R.sup.1).sub.2--, one or more
.dbd.N-- are independently and optionally replaced with
--C(-L-R.sup.1)--, one or more .dbd.CH-- are independently and
optionally replaced with .dbd.N--, and one or more .dbd.O are
independently and optionally replaced with .dbd.S,
.dbd.N(-L-R.sup.1), or .dbd.C(-L-R.sup.1).sub.2, wherein two or
more -L-R.sup.1 are optionally taken together with their
intervening atoms to form a 3-30 membered bicyclic or polycyclic
ring having 0-10 heteroatom ring atoms, wherein the modified base
is different than the natural A, T, C, G and U. In some
embodiments, a base is optionally substituted A, T, C, G or U. In
some embodiments, a modified base is substituted A, T, C, G or U,
wherein the modified base is different than the natural A, T, C, G
and U.
[0970] In some embodiments, a modified nucleotide or nucleotide
analog is any modified nucleotide or nucleotide analog described in
any of: Gryaznov, S; Chen, J.-K. J. Am. Chem. Soc. 1994, 116, 3143;
Hendrix et al. 1997 Chem. Eur. J. 3: 110; Hyrup et al. 1996 Bioorg.
Med. Chem. 4: 5; Jepsen et al. 2004 Oligo. 14: 130-146; Jones et
al. J. Org. Chem. 1993, 58, 2983; Koizumi et al. 2003 Nuc. Acids
Res. 12: 3267-3273; Koshkin et al. 1998 Tetrahedron 54: 3607-3630;
Kumar et al. 1998 Bioo. Med. Chem. Let. 8: 2219-2222; Lauritsen et
al. 2002 Chem. Comm. 5: 530-531; Lauritsen et al. 2003 Bioo. Med.
Chem. Lett. 13: 253-256; Mesmaeker et al. Angew. Chem., Int. Ed.
Engl. 1994, 33, 226; Morita et al. 2001 Nucl. Acids Res. Supp. 1:
241-242; Morita et al. 2002 Bioo. Med. Chem. Lett. 12: 73-76;
Morita et al. 2003 Bioo. Med. Chem. Lett. 2211-2226; Nielsen et al.
1997 Chem. Soc. Rev. 73; Nielsen et al. 1997 J. Chem. Soc. Perkins
Transl. 1: 3423-3433; Obika et al. 1997 Tetrahedron Lett. 38 (50):
8735-8; Obika et al. 1998 Tetrahedron Lett. 39: 5401-5404; Pallan
et al. 2012 Chem. Comm. 48: 8195-8197; Petersen et al. 2003 TRENDS
Biotech. 21: 74-81; Rajwanshi et al. 1999 Chem. Commun. 1395-1396;
Schultz et al. 1996 Nucleic Acids Res. 24: 2966; Seth et al. 2009
J. Med. Chem. 52: 10-13; Seth et al. 2010 J. Med. Chem. 53:
8309-8318; Seth et al. 2010 J. Org. Chem. 75: 1569-1581; Seth et
al. 2012 Bioo. Med. Chem. Lett. 22: 296-299; Seth et al. 2012 Mol.
Ther-Nuc. Acids. 1, e47; Seth, Punit P; Siwkowski, Andrew;
Allerson, Charles R; Vasquez, Guillermo; Lee, Sam; Prakash, Thazha
P; Kinberger, Garth; Migawa, Michael T; Gaus, Hans; Bhat,
Balkrishen; et al. From Nucleic Acids Symposium Series (2008),
52(1), 553-554; Singh et al. 1998 Chem. Comm. 1247-1248; Singh et
al. 1998 J. Org. Chem. 63: 10035-39; Singh et al. 1998 J. Org.
Chem. 63: 6078-6079; Sorensen 2003 Chem. Comm. 2130-2131; Ts'o et
al. Ann. N. Y. Acad. Sci. 1988, 507, 220; Van Aerschot et al. 1995
Angew. Chem. Int. Ed. Engl. 34: 1338; Vasseur et al. J. Am. Chem.
Soc. 1992, 114, 4006; WO 20070900071; WO 20070900071; or WO
2016/079181.
Sugars
[0971] In some embodiments, provided oligonucleotides comprise one
or more modified sugar moieties beside the natural sugar
moieties.
[0972] The most common naturally occurring nucleotides are
comprised of ribose sugars linked to the nucleobases adenosine (A),
cytosine (C), guanine (G), and thymine (T) or uracil (U). Also
contemplated are modified nucleotides wherein a phosphate group or
linkage phosphorus in the nucleotides can be linked to various
positions of a sugar or modified sugar. As non-limiting examples,
the phosphate group or linkage phosphorus can be linked to the 2',
3', 4' or 5' hydroxyl moiety of a sugar or modified sugar.
Nucleotides that incorporate modified nucleobases as described
herein are also contemplated in this context. In some embodiments,
nucleotides or modified nucleotides comprising an unprotected --OH
moiety are used in accordance with methods of the present
disclosure.
[0973] Other modified sugars can also be incorporated within a
provided oligonucleotide. In some embodiments, a modified sugar
contains one or more substituents at the 2' position including one
of the following: --F; --CF.sub.3, --CN, --N.sub.3, --NO,
--NO.sub.2, --OR', --SR', or --N(R').sub.2, wherein each R' is
independently as defined above and described herein;
--O--(C.sub.1-C.sub.10 alkyl), --S--(C.sub.1-C.sub.10 alkyl),
--NH--(C.sub.1-C.sub.10 alkyl), or --N(C.sub.1-C.sub.10
alkyl).sub.2; --O--(C.sub.2-C.sub.10 alkenyl),
--S--(C.sub.2-C.sub.10 alkenyl), --NH--(C.sub.2-C.sub.10 alkenyl),
or --N(C.sub.2-C.sub.10 alkenyl).sub.2; --O--(C.sub.2-C.sub.10
alkynyl), --S--(C.sub.2-C.sub.10 alkynyl), --NH--(C.sub.2-C.sub.10
alkynyl), or --N(C.sub.2-C.sub.10 alkynyl).sub.2; or
--O--(C.sub.1-C.sub.10 alkylene)-O--(C.sub.1-C.sub.10 alkyl),
--O--(C.sub.1-C.sub.10 alkylene)-NH--(C.sub.1-C.sub.10 alkyl) or
--O--(C.sub.1-C.sub.10 alkylene)-NH(C.sub.1-C.sub.10 alkyl).sub.2,
--NH--(C.sub.1-C.sub.10 alkylene)-O--(C.sub.1-C.sub.10 alkyl), or
--N(C.sub.1-C.sub.10 alkyl)-(C.sub.1-C.sub.10
alkylene)-O--(C.sub.1-C.sub.10 alkyl), wherein the alkyl, alkylene,
alkenyl and alkynyl may be substituted or unsubstituted. Examples
of substituents include, and are not limited to,
--O(CH.sub.2).sub.nOCH.sub.3, and --O(CH.sub.2).sub.nNH.sub.2,
wherein n is from 1 to about 10, MOE, DMAOE, DMAEOE. Also
contemplated herein are modified sugars described in WO
2001/088198; and Martin et al., Helv. Chim. Acta, 1995, 78,
486-504. In some embodiments, a modified sugar comprises one or
more groups selected from a substituted silyl group, an RNA
cleaving group, a reporter group, a fluorescent label, an
intercalator, a group for improving the pharmacokinetic properties
of a nucleic acid, a group for improving the pharmacodynamic
properties of a nucleic acid, or other substituents having similar
properties. In some embodiments, modifications are made at one or
more of the the 2', 3', 4', 5', or 6' positions of the sugar or
modified sugar, including the 3' position of the sugar on the
3'-terminal nucleotide or in the 5' position of the 5'-terminal
nucleotide.
[0974] In some embodiments, the 2'-OH of a ribose is replaced with
a substituent including one of the following: --H, --F; --CF.sub.3,
--CN, --N.sub.3, --NO, --NO.sub.2, --OR', --SR', or --N(R').sub.2,
wherein each R' is independently as defined above and described
herein; --O--(C.sub.1-C.sub.10 alkyl), --S--(C.sub.1-C.sub.10
alkyl), --NH--(C.sub.1-C.sub.10 alkyl), or --N(C.sub.1-C.sub.10
alkyl).sub.2; --O--(C.sub.2-C.sub.10 alkenyl),
--S--(C.sub.2-C.sub.10 alkenyl), --NH--(C.sub.2-C.sub.10 alkenyl),
or --N(C.sub.2-C.sub.10 alkenyl).sub.2; --O--(C.sub.2-C.sub.10
alkynyl), --S--(C.sub.2-C.sub.10 alkynyl), --NH--(C.sub.2-C.sub.10
alkynyl), or --N(C.sub.2-C.sub.10 alkynyl).sub.2; or
--O--(C.sub.1-C.sub.10 alkylene)-O--(C.sub.1-C.sub.10 alkyl),
--O--(C.sub.1-C.sub.10 alkylene)-NH--(C.sub.1-C.sub.10 alkyl) or
--O--(C.sub.1-C.sub.10 alkylene)-NH(C.sub.1-C.sub.10 alkyl).sub.2,
--NH--(C.sub.1-C.sub.10 alkylene)-O--(C.sub.1-C.sub.10 alkyl), or
--N(C.sub.1-C.sub.10 alkyl)-(C.sub.1-C.sub.10
alkylene)-O--(C.sub.1-C.sub.10 alkyl), wherein the alkyl, alkylene,
alkenyl and alkynyl may be substituted or unsubstituted. In some
embodiments, the 2'-OH is replaced with --H (deoxyribose). In some
embodiments, the 2'-OH is replaced with --F. In some embodiments,
the 2'-OH is replaced with --OR'. In some embodiments, the 2'-OH is
replaced with --OMe. In some embodiments, the 2'-OH is replaced
with --OCH.sub.2CH.sub.2OMe.
[0975] Modified sugars also include locked nucleic acids (LNAs). In
some embodiments, two substituents on sugar carbon atoms are taken
together to form a bivalent moiety. In some embodiments, two
substituents are on two different sugar carbon atoms. In some
embodiments, a formed bivalent moiety has the structure of -L- as
defined herein. In some embodiments, -L- is --O--CH.sub.2--,
wherein --CH.sub.2-- is optionally substituted. In some
embodiments, -L- is --O--CH.sub.2--. In some embodiments, -L- is
--O--CH(Et)-. In some embodiments, -L- is between C2 and C4 of a
sugar moiety. In some embodiments, a locked nucleic acid has the
structure indicated below. A locked nucleic acid of the structure
below is indicated, wherein Ba represents a nucleobase or modified
nucleobase as described herein, and wherein R.sup.2s is
--OCH.sub.2C4'-.
##STR00207##
[0976] In some embodiments, a modified sugar is an ENA such as
those described in, e.g., Seth et al., J Am Chem Soc. 2010 Oct. 27;
132(42): 14942-14950. In some embodiments, a modified sugar is any
of those found in an XNA (xenonucleic acid), for instance,
arabinose, anhydrohexitol, threose, 2'fluoroarabinose, or
cyclohexene.
[0977] Modified sugars include sugar mimetics such as cyclobutyl or
cyclopentyl moieties in place of the pentofuranosyl sugar.
Representative United States patents that teach the preparation of
such modified sugar structures include, but are not limited to,
U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; and 5,359,044. Some
modified sugars that are contemplated include sugars in which the
oxygen atom within the ribose ring is replaced by nitrogen, sulfur,
selenium, or carbon. In some embodiments, a modified sugar is a
modified ribose wherein the oxygen atom within the ribose ring is
replaced with nitrogen, and wherein the nitrogen is optionally
substituted with an alkyl group (e.g., methyl, ethyl, isopropyl,
etc).
[0978] Non-limiting examples of modified sugars include glycerol,
which form glycerol nucleic acid (GNA) analogues. One example of a
GNA analogue is shown below and is described in Zhang, R et al., J.
Am. Chem. Soc., 2008, 130, 5846-5847; Zhang L, et al., J. Am. Chem.
Soc., 2005, 127, 4174-4175 and Tsai C H et al., PNAS, 2007,
14598-14603 (X.dbd.O.sup.-):
##STR00208##
[0979] Another example of a GNA derived analogue, flexible nucleic
acid (FNA) based on the mixed acetal aminal of formyl glycerol, is
described in Joyce G F et al., PNAS, 1987, 84, 4398-4402 and
Heuberger B D and Switzer C, J. Am. Chem. Soc., 2008, 130, 412-413,
and is shown below:
##STR00209##
[0980] Additional non-limiting examples of modified sugars include
hexopyranosyl (6' to 4'), pentopyranosyl (4' to 2'), pentopyranosyl
(4' to 3'), or tetrofuranosyl (3' to 2') sugars. In some
embodiments, a hexopyranosyl (6' to 4') sugar is of any one in the
following formulae:
##STR00210##
wherein X.sup.s corresponds to the P-modification group
"--XLR.sup.1" described herein and Ba is as defined herein.
[0981] In some embodiments, a pentopyranosyl (4' to 2') sugar is of
any one in the following formulae:
##STR00211##
wherein X.sup.s corresponds to the P-modification group
"--XLR.sup.1" described herein and Ba is as defined herein.
[0982] In some embodiments, a pentopyranosyl (4' to 3') sugar is of
any one in the following formulae:
##STR00212##
wherein X.sup.s corresponds to the P-modification group
"--XLR.sup.1" described herein and Ba is as defined herein.
[0983] In some embodiments, a tetrofuranosyl (3' to 2') sugar is of
either in the following formulae:
##STR00213##
wherein X.sup.s corresponds to the P-modification group
"--XLR.sup.1" described herein and Ba is as defined herein.
[0984] In some embodiments, a modified sugar is of any one in the
following formulae:
##STR00214##
wherein X.sup.s corresponds to the P-modification group
"--XLR.sup.1" described herein and Ba is as defined herein.
[0985] In some embodiments, one or more hydroxyl group in a sugar
moiety is optionally and independently replaced with halogen,
R'--N(R').sub.2, --OR', or --SR', wherein each R' is independently
as defined above and described herein.
[0986] In some embodiments, a sugar mimetic is as illustrated
below, wherein X.sup.s corresponds to the P-modification group
"--XLR.sup.1" described herein, Ba is as defined herein, and
X.sup.1 is selected from --S--, --Se--, --CH.sub.2--, --NMe-,
--NEt- or --NiPr--.
##STR00215## ##STR00216## ##STR00217##
[0987] In some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%,
8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%,
22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%,
35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43% 44%, 45%, 46%, 47%,
48%, 49%, 50% or more (e.g., 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, 95% or more), inclusive, of the sugars in a chirally
controlled oligonucleotide composition are modified. In some
embodiments, only purine residues are modified (e.g., about 1%, 2%,
3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%,
18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%,
31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%,
44%, 45%, 46%, 47%, 48%, 49%, 50% or more [e.g., 55%, 60%, 65%,
70%, 75%, 80%, 85%, 90%, 95% or more] of the purine residues are
modified). In some embodiments, only pyrimidine residues are
modified (e.g., about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%,
12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%,
25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%,
38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50% or
more [e.g., 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more] of
the pyridimine residues are modified). In some embodiments, both
purine and pyrimidine residues are modified.
[0988] Modified sugars and sugar mimetics can be prepared by
methods known in the art, including, but not limited to: A.
Eschenmoser, Science (1999), 284:2118; M. Bohringer et al, Helv.
Chim. Acta (1992), 75:1416-1477; M. Egli et al, J. Am. Chem. Soc.
(2006), 128(33):10847-56; A. Eschenmoser in Chemical Synthesis:
Gnosis to Prognosis, C. Chatgilialoglu and V. Sniekus, Ed., (Kluwer
Academic, Netherlands, 1996), p. 293; K.-U. Schoning et al, Science
(2000), 290:1347-1351; A. Eschenmoser et al, Helv. Chim. Acta
(1992), 75:218; J. Hunziker et al, Helv. Chim. Acta (1993), 76:259;
G. Otting et al, Helv. Chim. Acta (1993), 76:2701; K. Groebke et
al, Helv. Chim. Acta (1998), 81:375; and A. Eschenmoser, Science
(1999), 284:2118. Modifications to the 2' modifications can be
found in Verma, S. et al. Annu. Rev. Biochem. 1998, 67, 99-134 and
all references therein. Specific modifications to the ribose can be
found in the following references: 2'-fluoro (Kawasaki et. al., J.
Med. Chem., 1993, 36, 831-841), 2'-MOE (Martin, P. Helv. Chim. Acta
1996, 79, 1930-1938), "LNA" (Wengel, J. Acc. Chem. Res. 1999, 32,
301-310). In some embodiments, a modified sugar is any of those
described in PCT Publication No. WO2012/030683, incorporated herein
by reference, and depicted in the FIGS. 26-30 of the present
application. In some embodiments, a modified sugar is any modified
sugar described in any of: Gryaznov, S; Chen, J.-K. J. Am. Chem.
Soc. 1994, 116, 3143; Hendrix et al. 1997 Chem. Eur. J. 3: 110;
Hyrup et al. 1996 Bioorg. Med. Chem. 4: 5; Jepsen et al. 2004
Oligo. 14: 130-146; Jones et al. J. Org. Chem. 1993, 58, 2983;
Koizumi et al. 2003 Nuc. Acids Res. 12: 3267-3273; Koshkin et al.
1998 Tetrahedron 54: 3607-3630; Kumar et al. 1998 Bioo. Med. Chem.
Let. 8: 2219-2222; Lauritsen et al. 2002 Chem. Comm. 5: 530-531;
Lauritsen et al. 2003 Bioo. Med. Chem. Lett. 13: 253-256; Mesmaeker
et al. Angew. Chem., Int. Ed. Engl. 1994, 33, 226; Morita et al.
2001 Nucl. Acids Res. Supp. 1: 241-242; Morita et al. 2002 Bioo.
Med. Chem. Lett. 12: 73-76; Morita et al. 2003 Bioo. Med. Chem.
Lett. 2211-2226; Nielsen et al. 1997 Chem. Soc. Rev. 73; Nielsen et
al. 1997 J. Chem. Soc. Perkins Transl. 1: 3423-3433; Obika et al.
1997 Tetrahedron Lett. 38 (50): 8735-8; Obika et al. 1998
Tetrahedron Lett. 39: 5401-5404; Pallan et al. 2012 Chem. Comm. 48:
8195-8197; Petersen et al. 2003 TRENDS Biotech. 21: 74-81;
Rajwanshi et al. 1999 Chem. Commun. 1395-1396; Schultz et al. 1996
Nucleic Acids Res. 24: 2966; Seth et al. 2009 J. Med. Chem. 52:
10-13; Seth et al. 2010 J. Med. Chem. 53: 8309-8318; Seth et al.
2010 J. Org. Chem. 75: 1569-1581; Seth et al. 2012 Bioo. Med. Chem.
Lett. 22: 296-299; Seth et al. 2012 Mol. Ther-Nuc. Acids. 1, e47;
Seth, Punit P; Siwkowski, Andrew; Allerson, Charles R; Vasquez,
Guillermo; Lee, Sam; Prakash, Thazha P; Kinberger, Garth; Migawa,
Michael T; Gaus, Hans; Bhat, Balkrishen; et al. From Nucleic Acids
Symposium Series (2008), 52(1), 553-554; Singh et al. 1998 Chem.
Comm. 1247-1248; Singh et al. 1998 J. Org. Chem. 63: 10035-39;
Singh et al. 1998 J. Org. Chem. 63: 6078-6079; Sorensen 2003 Chem.
Comm. 2130-2131; Ts'o et al. Ann. N. Y. Acad. Sci. 1988, 507, 220;
Van Aerschot et al. 1995 Angew. Chem. Int. Ed. Engl. 34: 1338;
Vasseur et al. J. Am. Chem. Soc. 1992, 114, 4006; WO 20070900071;
WO 20070900071; or WO 2016/079181.
[0989] In some embodiments, a modified sugar moiety is an
optionally substituted pentose or hexose moiety. In some
embodiments, a modified sugar moiety is an optionally substituted
pentose moiety. In some embodiments, a modified sugar moiety is an
optionally substituted hexose moiety. In some embodiments, a
modified sugar moiety is an optionally substituted ribose or
hexitol moiety. In some embodiments, a modified sugar moiety is an
optionally substituted ribose moiety. In some embodiments, a
modified sugar moiety is an optionally substituted hexitol
moiety.
[0990] In some embodiments, an example modified internucleotidic
linkage and/or sugar is selected from:
##STR00218## ##STR00219## ##STR00220## ##STR00221##
In some embodiments, R.sup.1 is R as defined and described. In some
embodiments, R.sup.2 is R. In some embodiments, R.sup.e is R. In
some embodiments, R.sup.e is H, CH.sub.3, Bn, COCF.sub.3, benzoyl,
benzyl, pyren-1-ylcarbonyl, pyren-1-ylmethyl, 2-aminoethyl. In some
embodiments, an example modified internucleotidic linkage and/or
sugar is selected from those described in Ts'o et al. Ann. N. Y.
Acad. Sci. 1988, 507, 220; Gryaznov, S.; Chen, J.-K. J. Am. Chem.
Soc. 1994, 116, 3143; Mesmaeker et al. Angew. Chem., Int. Ed. Engl.
1994, 33, 226; Jones et al. J. Org. Chem. 1993, 58, 2983; Vasseur
et al. J. Am. Chem. Soc. 1992, 114, 4006; Van Aerschot et al. 1995
Angew. Chem. Int. Ed. Engl. 34: 1338; Hendrix et al. 1997 Chem.
Eur. J. 3: 110; Koshkin et al. 1998 Tetrahedron 54: 3607-3630;
Hyrup et al. 1996 Bioorg. Med. Chem. 4: 5; Nielsen et al. 1997
Chem. Soc. Rev. 73; Schultz et al. 1996 Nucleic Acids Res. 24:
2966; Obika et al. 1997 Tetrahedron Lett. 38 (50): 8735-8; Obika et
al. 1998 Tetrahedron Lett. 39: 5401-5404; Singh et al. 1998 Chem.
Comm. 1247-1248; Kumar et al. 1998 Bioo. Med. Chem. Let. 8:
2219-2222; Nielsen et al. 1997 J. Chem. Soc. Perkins Transl. 1:
3423-3433; Singh et al. 1998 J. Org. Chem. 63: 6078-6079; Seth et
al. 2010 J. Org. Chem. 75: 1569-1581; Singh et al. 1998 J. Org.
Chem. 63: 10035-39; Sorensen 2003 Chem. Comm. 2130-2131; Petersen
et al. 2003 TRENDS Biotech. 21: 74-81; Rajwanshi et al. 1999 Chem.
Commun. 1395-1396; Jepsen et al. 2004 Oligo. 14: 130-146; Morita et
al. 2001 Nucl. Acids Res. Supp. 1: 241-242; Morita et al. 2002
Bioo. Med. Chem. Lett. 12: 73-76; Morita et al. 2003 Bioo. Med.
Chem. Lett. 2211-2226; Koizumi et al. 2003 Nuc. Acids Res. 12:
3267-3273; Lauritsen et al. 2002 Chem. Comm. 5: 530-531; Lauritsen
et al. 2003 Bioo. Med. Chem. Lett. 13: 253-256; WO 20070900071;
Seth et al., Nucleic Acids Symposium Series (2008), 52(1), 553-554;
Seth et al. 2009 J. Med. Chem. 52: 10-13; Seth et al. 2012 Mol.
Ther-Nuc. Acids. 1, e47; Pallan et al. 2012 Chem. Comm. 48:
8195-8197; Seth et al. 2010 J. Med. Chem. 53: 8309-8318; Seth et
al. 2012 Bioo. Med. Chem. Lett. 22: 296-299; WO 2016/079181; U.S.
Pat. Nos. 6,326,199; 6,066,500; and 6,440,739, the base and sugar
modifications of each of which is herein incorporated by
reference.
Oligonucleotides
[0991] In some embodiments, the present disclosure provides
oligonucleotides and oligonucleotide compositions that are chirally
controlled. For instance, in some embodiments, a provided
composition contains predetermined levels of one or more individual
oligonucleotide types, wherein an oligonucleotide type is defined
by: 1) base sequence; 2) pattern of backbone linkages; 3) pattern
of backbone chiral centers; and 4) pattern of backbone
P-modifications. In some embodiments, a particular oligonucleotide
type may be defined by 1A) base identity; 1B) pattern of base
modification; 1C) pattern of sugar modification; 2) pattern of
backbone linkages; 3) pattern of backbone chiral centers; and 4)
pattern of backbone P-modifications. In some embodiments,
oligonucleotides of the same oligonucleotide type are
identical.
[0992] As described herein, the present disclosure provides various
oligonucleotides. In some embodiments, the present disclosure
provides oligonucleotides comprising a sequence that shares greater
than about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% identity with a
sequence found in a provided example oligonucleotide, such as those
listed in various tables. In some embodiments, a provided
oligonucleotide is WV-1092. In some embodiments, a provided
oligonucleotide is WV-2595. In some embodiments, a provided
oligonucleotide is WV-2603. In some embodiments, the present
disclosure provides oligonucleotides comprising or consisting of a
sequence found in a provided example oligonucleotide. In some
embodiments, the present disclosure provides oligonucleotides
comprising or consisting of a sequence found in WV-1092. In some
embodiments, the present disclosure provides oligonucleotides
comprising or consisting of a sequence found in WV-2595. In some
embodiments, the present disclosure provides oligonucleotides
comprising or consisting of a sequence found in WV-2603. In some
embodiments, a provided oligonucleotide further comprises one or
more natural phosphate linkages and one or more modified
internucleotidic linkages. In some embodiments, a provided
oligonucleotide comprises two or more natural phosphate linkages.
In some embodiments, a provided oligonucleotide comprises two or
more consecutive natural phosphate linkages. In some embodiments, a
provided oligonucleotide comprises two or more modified
internucleotidic linkages. In some embodiments, a provided
oligonucleotide comprises two or more consecutive modified
internucleotidic linkages. In some embodiments, a provided
oligonucleotide comprises 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20 or more consecutive modified
internucleotidic linkages. In some embodiments, a provided
oligonucleotide comprises 5 or more consecutive modified
internucleotidic linkages. In some embodiments, a provided
oligonucleotide comprises 5 or more consecutive modified
internucleotidic linkages. In some embodiments, a provided
oligonucleotide comprises 6 or more consecutive modified
internucleotidic linkages. In some embodiments, a provided
oligonucleotide comprises 7 or more consecutive modified
internucleotidic linkages. In some embodiments, a provided
oligonucleotide comprises 8 or more consecutive modified
internucleotidic linkages. In some embodiments, a provided
oligonucleotide comprises 9 or more consecutive modified
internucleotidic linkages. In some embodiments, a provided
oligonucleotide comprises 10 or more consecutive modified
internucleotidic linkages. In some embodiments, at least one of the
modified internucleotidic linkages is a chirally controlled
internucleotidic linkage in that oligonucleotides having the same
sequence and chemical modifications within a composition share the
same configuration, either Rp or Sp, at the chiral phosphorus atom
of the modified internucleotidic linkage. In some embodiments, at
least two modified internucleotidic linkages are chirally
controlled. In some embodiments, at least one modified
internucleotidic linkage within a consecutive modified
internucleotidic linkage region is chirally controlled. In some
embodiments, at least two modified internucleotidic linkages within
a consecutive modified internucleotidic linkage region are chirally
controlled. In some embodiments, each modified internucleotidic
linkage within a consecutive modified internucleotidic linkage
region is chirally controlled. In some embodiments, each modified
internucleotidic linkage is chirally controlled. In some
embodiments, a provided oligonucleotide comprises a (Sp)xRp(Sp)y
pattern, wherein each of x and y is independently 1-20, and the sum
of x and y is 1-50. In some embodiments, each of x and y is
independently 2-20. In some embodiments, at least one of x and y is
greater than 5, 6, 7, 8, 9, or 10. In some embodiments, the sum of
x and y is greater than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19 or 20. In some embodiments, a provided oligonucleotide
comprises one or more chemical modifications as presented in a
provided example oligonucleotide. In some embodiments, a provided
oligonucleotide comprises one or more base modifications as
presented in a provided example oligonucleotide. In some
embodiments, a provided oligonucleotide comprises one or more sugar
modifications as presented in a provided example oligonucleotide.
In some embodiments, a sugar modification is a 2'-modification. In
some embodiments, a sugar modification is LNA. In some embodiments,
a sugar modification is ENA. In some embodiments, a provided
oligonucleotide is a chirally controlled oligonucleotide. In some
embodiments, the present disclosure provides an oligonucleotide
composition comprising a provided oligonucleotide. In some
embodiments, a provided oligonucleotide composition is a chirally
controlled oligonucleotide composition.
[0993] In some embodiments, a provided oligonucleotide is a unimer.
In some embodiments, a provided oligonucleotide is a P-modification
unimer. In some embodiments, a provided oligonucleotide is a
stereounimer. In some embodiments, a provided oligonucleotide is a
stereounimer of configuration Rp. In some embodiments, a provided
oligonucleotide is a stereounimer of configuration Sp.
[0994] In some embodiments, a provided oligonucleotide is an
altmer. In some embodiments, a provided oligonucleotide is a
P-modification altmer. In some embodiments, a provided
oligonucleotide is a stereoaltmer.
[0995] In some embodiments, a provided oligonucleotide is a
blockmer. In some embodiments, a provided oligonucleotide is a
P-modification blockmer. In some embodiments, a provided
oligonucleotide is a stereoblockmer.
[0996] In some embodiments, a provided oligonucleotide is a
gapmer.
[0997] In some embodiments, a provided oligonucleotide is a
skipmer.
[0998] In some embodiments, a provided oligonucleotide is a
hemimer. In some embodiments, a hemimer is an oligonucleotide
wherein the 5'-end or the 3'-end has a sequence that possesses a
structure feature that the rest of the oligonucleotide does not
have. In some embodiments, the 5'-end or the 3'-end has or
comprises 2 to 20 nucleotides. In some embodiments, a structural
feature is a base modification. In some embodiments, a structural
feature is a sugar modification. In some embodiments, a structural
feature is a P-modification. In some embodiments, a structural
feature is stereochemistry of the chiral internucleotidic linkage.
In some embodiments, a structural feature is or comprises a base
modification, a sugar modification, a P-modification, or
stereochemistry of the chiral internucleotidic linkage, or
combinations thereof. In some embodiments, a hemimer is an
oligonucleotide in which each sugar moiety of the 5'-end sequence
shares a common modification. In some embodiments, a hemimer is an
oligonucleotide in which each sugar moiety of the 3'-end sequence
shares a common modification. In some embodiments, a common sugar
modification of the 5' or 3' end sequence is not shared by any
other sugar moieties in the oligonucleotide. In some embodiments,
an example hemimer is an oligonucleotide comprising a sequence of
substituted or unsubstituted 2'-O-alkyl sugar modified nucleosides,
bicyclic sugar modified nucleosides, .beta.-D-ribonucleosides or
.beta.-D-deoxyribonucleosides (for example 2'-MOE modified
nucleosides, and LNA.TM. or ENA.TM. bicyclic sugar modified
nucleosides) at one terminus and a sequence of nucleosides with a
different sugar moiety (such as a substituted or unsubstituted
2'-O-alkyl sugar modified nucleosides, bicyclic sugar modified
nucleosides or natural ones) at the other terminus. In some
embodiments, a provided oligonucleotide is a combination of one or
more of unimer, altmer, blockmer, gapmer, hemimer and skipmer. In
some embodiments, a provided oligonucleotide is a combination of
one or more of unimer, altmer, blockmer, gapmer, and skipmer. For
instance, in some embodiments, a provided oligonucleotide is both
an altmer and a gapmer. In some embodiments, a provided nucleotide
is both a gapmer and a skipmer. One of skill in the chemical and
synthetic arts will recognize that numerous other combinations of
patterns are available and are limited only by the commercial
availability and/or synthetic accessibility of constituent parts
required to synthesize a provided oligonucleotide in accordance
with methods of the present disclosure. In some embodiments, a
hemimer structure provides advantageous benefits, as exemplified by
FIG. 29. In some embodiments, provided oligonucleotides are
5'-hemmimers that comprises modified sugar moieties in a 5'-end
sequence. In some embodiments, provided oligonucleotides are
5'-hemmimers that comprises modified 2'-sugar moieties in a 5'-end
sequence.
[0999] In some embodiments, a provided oligonucleotide comprises
one or more optionally substituted nucleotides. In some
embodiments, a provided oligonucleotide comprises one or more
modified nucleotides. In some embodiments, a provided
oligonucleotide comprises one or more optionally substituted
nucleosides. In some embodiments, a provided oligonucleotide
comprises one or more modified nucleosides. In some embodiments, a
provided oligonucleotide comprises one or more optionally
substituted LNAs.
[1000] In some embodiments, a provided oligonucleotide comprises
one or more optionally substituted nucleobases. In some
embodiments, a provided oligonucleotide comprises one or more
optionally substituted natural nucleobases. In some embodiments, a
provided oligonucleotide comprises one or more optionally
substituted modified nucleobases. In some embodiments, a provided
oligonucleotide comprises one or more 5-methylcytidine;
5-hydroxymethylcytidine, 5-formylcytosine, or 5-carboxylcytosine.
In some embodiments, a provided oligonucleotide comprises one or
more 5-methylcytidine.
[1001] In some embodiments, a provided oligonucleotide comprises
one or more optionally substituted sugars. In some embodiments, a
provided oligonucleotide comprises one or more optionally
substituted sugars found in naturally occurring DNA and RNA. In
some embodiments, a provided oligonucleotide comprises one or more
optionally substituted ribose or deoxyribose. In some embodiments,
a provided oligonucleotide comprises one or more optionally
substituted ribose or deoxyribose, wherein one or more hydroxyl
groups of the ribose or deoxyribose moiety is optionally and
independently replaced by halogen, R', --N(R').sub.2, --OR', or
--SR', wherein each R' is independently as defined above and
described herein. In some embodiments, a provided oligonucleotide
comprises one or more optionally substituted deoxyribose, wherein
the 2' position of the deoxyribose is optionally and independently
substituted with halogen, R', --N(R').sub.2, --OR', or --SR',
wherein each R' is independently as defined above and described
herein. In some embodiments, a provided oligonucleotide comprises
one or more optionally substituted deoxyribose, wherein the 2'
position of the deoxyribose is optionally and independently
substituted with halogen. In some embodiments, a provided
oligonucleotide comprises one or more optionally substituted
deoxyribose, wherein the 2' position of the deoxyribose is
optionally and independently substituted with one or more --F.
halogen. In some embodiments, a provided oligonucleotide comprises
one or more optionally substituted deoxyribose, wherein the 2'
position of the deoxyribose is optionally and independently
substituted with --OR', wherein each R' is independently as defined
above and described herein. In some embodiments, a provided
oligonucleotide comprises one or more optionally substituted
deoxyribose, wherein the 2' position of the deoxyribose is
optionally and independently substituted with --OR', wherein each
R' is independently an optionally substituted C.sub.1-C.sub.6
aliphatic. In some embodiments, a provided oligonucleotide
comprises one or more optionally substituted deoxyribose, wherein
the 2' position of the deoxyribose is optionally and independently
substituted with --OR', wherein each R' is independently an
optionally substituted C.sub.1-C.sub.6 alkyl. In some embodiments,
a provided oligonucleotide comprises one or more optionally
substituted deoxyribose, wherein the 2' position of the deoxyribose
is optionally and independently substituted with --OMe. In some
embodiments, a provided oligonucleotide comprises one or more
optionally substituted deoxyribose, wherein the 2' position of the
deoxyribose is optionally and independently substituted with
--O-methoxyethyl.
[1002] In some embodiments, a provided oligonucleotide is
single-stranded oligonucleotide.
[1003] In some embodiments, a provided oligonucleotide is a
hybridized oligonucleotide strand. In certain embodiments, a
provided oligonucleotide is a partially hybridized oligonucleotide
strand. In certain embodiments, a provided oligonucleotide is a
completely hybridized oligonucleotide strand. In certain
embodiments, a provided oligonucleotide is a double-stranded
oligonucleotide. In certain embodiments, a provided oligonucleotide
is a triple-stranded oligonucleotide (e.g., a triplex).
[1004] In some embodiments, a provided oligonucleotide is chimeric.
For example, in some embodiments, a provided oligonucleotide is
DNA-RNA chimera, DNA-LNA chimera, etc.
[1005] In some embodiments, any one of the structures comprising an
oligonucleotide depicted in WO2012/030683 can be modified in
accordance with methods of the present disclosure to provide
chirally controlled variants thereof. For example, in some
embodiments the chirally controlled variants comprise a
stereochemical modification at any one or more of the linkage
phosphorus and/or a P-modification at any one or more of the
linkage phosphorus. For example, in some embodiments, a particular
nucleotide unit of an oligonucleotide of WO2012/030683 is
preselected to be stereochemically modified at the linkage
phosphorus of that nucleotide unit and/or P-modified at the linkage
phosphorus of that nucleotide unit. In some embodiments, a chirally
controlled oligonucleotide is of any one of the structures depicted
in FIGS. 26-30. In some embodiments, a chirally controlled
oligonucleotide is a variant (e.g., modified version) of any one of
the structures depicted in FIGS. 26-30. The disclosure of
WO2012/030683 is herein incorporated by reference in its
entirety.
[1006] In some embodiments, a provided oligonucleotide is a
therapeutic agent.
[1007] In some embodiments, a provided oligonucleotide is an
antisense oligonucleotide.
[1008] In some embodiments, a provided oligonucleotide is an
antigene oligonucleotide.
[1009] In some embodiments, a provided oligonucleotide is a decoy
oligonucleotide.
[1010] In some embodiments, a provided oligonucleotide is part of a
DNA vaccine.
[1011] In some embodiments, a provided oligonucleotide is an
immunomodulatory oligonucleotide, e.g., immunostimulatory
oligonucleotide and immunoinhibitory oligonucleotide.
[1012] In some embodiments, a provided oligonucleotide is an
adjuvant.
[1013] In some embodiments, a provided oligonucleotide is an
aptamer.
[1014] In some embodiments, a provided oligonucleotide is a
ribozyme.
[1015] In some embodiments, a provided oligonucleotide is a
deoxyribozyme (DNAzymes or DNA enzymes).
[1016] In some embodiments, a provided oligonucleotide is an
siRNA.
[1017] In some embodiments, a provided oligonucleotide is a
microRNA, or miRNA.
[1018] In some embodiments, a provided oligonucleotide is a ncRNA
(non-coding RNAs), including a long non-coding RNA (lncRNA) and a
small non-coding RNA, such as piwi-interacting RNA (piRNA).
[1019] In some embodiments, a provided oligonucleotide is
complementary to a structural RNA, e.g., tRNA.
[1020] In some embodiments, a provided oligonucleotide is a nucleic
acid analog, e.g., GNA, LNA, PNA, TNA, GNA, ANA, FANA, CeNA, HNA,
UNA, ZNA, or Morpholino.
[1021] In some embodiments, a provided oligonucleotide is a
P-modified prodrug.
[1022] In some embodiments, a provided oligonucleotide is a primer.
In some embodiments, a primers is for use in polymerase-based chain
reactions (i.e., PCR) to amplify nucleic acids. In some
embodiments, a primer is for use in any known variations of PCR,
such as reverse transcription PCR (RT-PCR) and real-time PCR.
[1023] In some embodiments, a provided oligonucleotide is
characterized as having the ability to modulate RNase H activation.
For example, in some embodiments, RNase H activation is modulated
by the presence of stereocontrolled phosphorothioate nucleic acid
analogs, with natural DNA/RNA being more or equally susceptible
than the Rp stereoisomer, which in turn is more susceptible than
the corresponding Sp stereoisomer.
[1024] In some embodiments, a provided oligonucleotide is
characterized as having the ability to indirectly or directly
increase or decrease activity of a protein or inhibition or
promotion of the expression of a protein. In some embodiments, a
provided oligonucleotide is characterized in that it is useful in
the control of cell proliferation, viral replication, and/or any
other cell signaling process.
[1025] In some embodiments, a provided oligonucleotide is from
about 2 to about 200 nucleotide units in length. In some
embodiments, a provided oligonucleotide is from about 2 to about
180 nucleotide units in length. In some embodiments, a provided
oligonucleotide is from about 2 to about 160 nucleotide units in
length. In some embodiments, a provided oligonucleotide is from
about 2 to about 140 nucleotide units in length. In some
embodiments, a provided oligonucleotide is from about 2 to about
120 nucleotide units in length. In some embodiments, a provided
oligonucleotide is from about 2 to about 100 nucleotide units in
length. In some embodiments, a provided oligonucleotide is from
about 2 to about 90 nucleotide units in length. In some
embodiments, a provided oligonucleotide is from about 2 to about 80
nucleotide units in length. In some embodiments, a provided
oligonucleotide is from about 2 to about 70 nucleotide units in
length. In some embodiments, a provided oligonucleotide is from
about 2 to about 60 nucleotide units in length. In some
embodiments, a provided oligonucleotide is from about 2 to about 50
nucleotide units in length. In some embodiments, a provided
oligonucleotide is from about 2 to about 40 nucleotide units in
length. In some embodiments, a provided oligonucleotide is from
about 2 to about 30 nucleotide units in length. In some
embodiments, a provided oligonucleotide is from about 2 to about 29
nucleotide units in length. In some embodiments, a provided
oligonucleotide is from about 2 to about 28 nucleotide units in
length. In some embodiments, a provided oligonucleotide is from
about 2 to about 27 nucleotide units in length. In some
embodiments, a provided oligonucleotide is from about 2 to about 26
nucleotide units in length. In some embodiments, a provided
oligonucleotide is from about 2 to about 25 nucleotide units in
length. In some embodiments, a provided oligonucleotide is from
about 2 to about 24 nucleotide units in length. In some
embodiments, a provided oligonucleotide is from about 2 to about 23
nucleotide units in length. In some embodiments, a provided
oligonucleotide is from about 2 to about 22 nucleotide units in
length. In some embodiments, a provided oligonucleotide is from
about 2 to about 21 nucleotide units in length. In some
embodiments, a provided oligonucleotide is from about 2 to about 20
nucleotide units in length.
[1026] In some embodiments, a provided oligonucleotide is from
about 4 to about 200 nucleotide units in length. In some
embodiments, a provided oligonucleotide is from about 4 to about
180 nucleotide units in length. In some embodiments, a provided
oligonucleotide is from about 4 to about 160 nucleotide units in
length. In some embodiments, a provided oligonucleotide is from
about 4 to about 140 nucleotide units in length. In some
embodiments, a provided oligonucleotide is from about 4 to about
120 nucleotide units in length. In some embodiments, a provided
oligonucleotide is from about 4 to about 100 nucleotide units in
length. In some embodiments, a provided oligonucleotide is from
about 4 to about 90 nucleotide units in length. In some
embodiments, a provided oligonucleotide is from about 4 to about 80
nucleotide units in length. In some embodiments, a provided
oligonucleotide is from about 4 to about 70 nucleotide units in
length. In some embodiments, a provided oligonucleotide is from
about 4 to about 60 nucleotide units in length. In some
embodiments, a provided oligonucleotide is from about 4 to about 50
nucleotide units in length. In some embodiments, a provided
oligonucleotide is from about 4 to about 40 nucleotide units in
length. In some embodiments, a provided oligonucleotide is from
about 4 to about 30 nucleotide units in length. In some
embodiments, a provided oligonucleotide is from about 4 to about 29
nucleotide units in length. In some embodiments, a provided
oligonucleotide is from about 4 to about 28 nucleotide units in
length. In some embodiments, a provided oligonucleotide is from
about 4 to about 27 nucleotide units in length. In some
embodiments, a provided oligonucleotide is from about 4 to about 26
nucleotide units in length. In some embodiments, a provided
oligonucleotide is from about 4 to about 25 nucleotide units in
length. In some embodiments, a provided oligonucleotide is from
about 4 to about 24 nucleotide units in length. In some
embodiments, a provided oligonucleotide is from about 4 to about 23
nucleotide units in length. In some embodiments, a provided
oligonucleotide is from about 4 to about 22 nucleotide units in
length. In some embodiments, a provided oligonucleotide is from
about 4 to about 21 nucleotide units in length. In some
embodiments, a provided oligonucleotide is from about 4 to about 20
nucleotide units in length.
[1027] In some embodiments, a provided oligonucleotide is from
about 5 to about 10 nucleotide units in length. In some
embodiments, a provided oligonucleotide is from about 10 to about
30 nucleotide units in length. In some embodiments, a provided
oligonucleotide is from about 15 to about 25 nucleotide units in
length. In some embodiments, a provided oligonucleotide is from
about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, or 25 nucleotide units in length.
[1028] In some embodiments, an oligonucleotide is at least 2
nucleotide units in length. In some embodiments, an oligonucleotide
is at least 3 nucleotide units in length. In some embodiments, an
oligonucleotide is at least 4 nucleotide units in length. In some
embodiments, an oligonucleotide is at least 5 nucleotide units in
length. In some embodiments, an oligonucleotide is at least 6
nucleotide units in length. In some embodiments, an oligonucleotide
is at least 7 nucleotide units in length. In some embodiments, an
oligonucleotide is at least 8 nucleotide units in length. In some
embodiments, an oligonucleotide is at least 9 nucleotide units in
length. In some embodiments, an oligonucleotide is at least 10
nucleotide units in length. In some embodiments, an oligonucleotide
is at least 11 nucleotide units in length. In some embodiments, an
oligonucleotide is at least 12 nucleotide units in length. In some
embodiments, an oligonucleotide is at least 13 nucleotide units in
length. In some embodiments, an oligonucleotide is at least 14
nucleotide units in length. In some embodiments, an oligonucleotide
is at least 15 nucleotide units in length. In some embodiments, an
oligonucleotide is at least 16 nucleotide units in length. In some
embodiments, an oligonucleotide is at least 17 nucleotide units in
length. In some embodiments, an oligonucleotide is at least 18
nucleotide units in length. In some embodiments, an oligonucleotide
is at least 19 nucleotide units in length. In some embodiments, an
oligonucleotide is at least 20 nucleotide units in length. In some
embodiments, an oligonucleotide is at least 21 nucleotide units in
length. In some embodiments, an oligonucleotide is at least 22
nucleotide units in length. In some embodiments, an oligonucleotide
is at least 23 nucleotide units in length. In some embodiments, an
oligonucleotide is at least 24 nucleotide units in length. In some
embodiments, an oligonucleotide is at least 25 nucleotide units in
length. In some other embodiments, an oligonucleotide is at least
30 nucleotide units in length. In some other embodiments, an
oligonucleotide is a duplex of complementary strands of at least 18
nucleotide units in length. In some other embodiments, an
oligonucleotide is a duplex of complementary strands of at least 21
nucleotide units in length.
[1029] In some embodiments, the 5'-end and/or the 3'-end of a
provided oligonucleotide is modified. In some embodiments, the
5'-end and/or the 3'-end of a provided oligonucleotide is modified
with a terminal cap moiety. Examples of such modifications,
including terminal cap moieties are extensively described herein
and in the art, for example but not limited to those described in
US Patent Application Publication US 2009/0023675A1.
[1030] In some embodiments, oligonucleotides of an oligonucleotide
type characterized by 1) a common base sequence and length, 2) a
common pattern of backbone linkages, and 3) a common pattern of
backbone chiral centers, have the same chemical structure. For
example, they have the same base sequence, the same pattern of
nucleoside modifications, the same pattern of backbone linkages
(i.e., pattern of internucleotidic linkage types, for example,
phosphate, phosphorothioate, etc), the same pattern of backbone
chiral centers (i.e. pattern of linkage phosphorus stereochemistry
(Rp/Sp)), and the same pattern of backbone phosphorus modifications
(e.g., pattern of "--XLR.sup.1" groups in formula I). Example
Oligonucleotides and Compositions
[1031] In some embodiments, a provided chirally controlled
oligonucleotide comprises the sequence of, or part of the sequence
of mipomersen. Mipomersen is based on the following base sequence
GCCT/UCAGT/UCT/UGCT/UT/UCGCACC (SEQ ID NO: 42). In some
embodiments, one or more of any of the nucleotide or linkages may
be modified in accordance of the present disclosure. In some
embodiments, the present disclosure provides a chirally controlled
oligonucleotide having the sequence of
G*-C*-C*-U*-C*-dA-dG-dT-dC-dT-dG-dmC-dT-dT-dmC-G*-C*-A*-C*-C* (SEQ
ID NO: 43) [d=2'-deoxy, *=2'-O-(2-methoxyethyl)] with 3'.fwdarw.5'
phosphorothioate linkages. Example modified mipomersen sequences
are described throughout the application, including but not limited
to those in Table 2.
[1032] In certain embodiments, a provided oligonucleotide is a
mipomersen unimer. In certain embodiments, a provided
oligonucleotide is a mipomersen unimer of configuration Rp. In
certain embodiments, a provided oligonucleotide is a mipomersen
unimer of configuration Sp.
[1033] Exemplary chirally controlled oligonucleotides comprising
the sequence of, or part of the sequence of mipomersen is depicted
in Table 2, below.
TABLE-US-00003 TABLE 2 Example oligonucleotides. SEQ ID Oligo
Stereochemistry/Sequence Description NO: 101
All-(Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] All-R 44 102
All-(Sp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] All-S 45 103
(Rp, Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Rp,
Rp, Rp, 5R-9S-5R 46 Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC]
104 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp,
Sp, Sp, 5S-9R-5S 47 Sp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC]
105 (Sp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Rp, Rp,
Rp, 1S-17R-1S 48 Rp, Sp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC]
106 (Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp Sp, Sp, Sp, Sp, Sp, Sp,
Sp, Sp, 1R-17S-1R 49 Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC]
107 (Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp Rp, Sp, Rp, Sp, Rp, Sp,
Rp, Sp, (R/S).sub.9R 50
Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] 108 (Sp, Rp, Sp, Rp,
Sp, Rp, Sp, Rp, Sp, Rp Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, (S/R).sub.9S
51 Sp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] 109 (Sp, Sp, Sp,
Rp, Rp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Rp, Rp, Sp, Sp,
3S-13R-3S 52 Sp)d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] 110 (Rp,
Rp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp Sp, Sp, Sp, Sp, Sp, Sp, Rp, Rp,
3R-13S-3R 53 Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] 111
(Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp Sp, Sp, Sp, Sp, Sp, Sp, Sp,
Sp, 18S/R.sup.19 54 Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC]
112 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp Sp, Sp, Sp, Sp, Sp, Sp,
Sp, Sp, 18S/R.sup.9 55
Sp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] 113 (Sp, Rp, Sp, Sp,
Sp, Sp, Sp, Sp, Sp, Sp Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 18S/R.sup.2
56 Sp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] 114 (Rp, Rp, Sp,
Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp,
(RRS).sub.6-R 57 Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] 115
(Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp,
Rp, S-(RRS).sub.6 58 Sp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC]
116 (Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp,
Sp, Rp RS- 59 Rp)d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC]
(RRS).sub.5-RR 122 All-(Rp)- All-R 60
d[Gs1Cs1Cs1Ts1Cs1As1Gs1Ts1Cs1Ts1Gs1Cs1Ts1Ts1Cs1Gs1Cs1 As1Cs1C] 123
(Sp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Rp, Rp, Rp,
1S-17R-1S 61 Rp, Sp)-d[Gs1Cs1Cs1Ts1Cs1As1Gs1Ts1Cs1
Ts1Gs1Cs1Ts1Ts1Cs1Gs1Cs1As1Cs1C] 124
All-(Sp)-d[Gs1Cs1Cs1Ts1Cs1As1Gs1Ts1Cs1Ts1 All-S 62
Gs1Cs1Ts1Ts1Cs1Gs1Cs1As1Cs1C] 126 All-(Rp)-d[Cs2As2Gs2T] All-R 127
All-(Rp)-d[Cs3As3Gs3T] All-R 128 All-(Sp)-d[Cs4As4Gs4T] All-S 129
All-(Sp)-d[Cs5As5Gs5T] All-S 130 All-(Sp)-d[Cs6As6Gs6T] All-S 131
All-(Rp)-d[Gs7Cs7Cs7Ts7Cs7As7Gs7Ts7Cs7Ts7Gs7 All-R 63
Cs7Ts7Ts7Cs7Gs7Cs7As7Cs7C] 132
All-(Sp)-d[Gs7Cs7Cs7Ts7Cs7As7Gs7Ts7Cs7Ts7Gs7 All-S 64
Cs7Ts7Ts7Cs7Gs7Cs7As7Cs7C] 133 (Rp, Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp,
Sp Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, 5R-9S-5R 65
Rp)-d[Gs15mCs15mCs1Ts15mCs1As1Gs1Ts15mCs1Ts1
Gs15mCs1Ts1Ts15mCs1Gs15mCs1As15mCs15mC] 134 (Sp, Sp, Sp, Sp, Sp,
Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp, 5S-9R-5S 66
Sp)-d[Gs15mCs15mCs1Ts15mCs1As1Gs1Ts15mCs1Ts1
Gs15mCs1Ts1Ts15mCs1Gs15mCs1As15mCs15mC] 135
All-(Rp)-d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] All-R 67 136
All-(Sp)-d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] All-S 68 137
(Sp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Sp)- 1S-9R-1S 69
d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] 138 (Sp, Sp, Rp, Rp,
Rp, Rp, Rp, Rp, Rp, Sp, Sp)- 2S-7R-2S 70
d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] 139 (Rp, Sp, Sp, Sp,
Sp, Sp, Sp, Sp, Sp, Sp, Rp)- 1R-9S-1R 71
d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] 140 (Rp, Rp, Sp, Sp,
Sp, Sp, Sp, Sp, Sp, Rp, Rp)- 2R-7S-2R 72
d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] 141 (Sp, Sp, Sp, Rp,
Rp, Rp, Rp, Rp, Sp, Sp, Sp)- 3S-5R-3S 73
d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] 142 (Rp, Rp, Rp, Sp,
Sp, Sp, Sp, Sp, Rp, Rp, Rp)- 3R-5S-3R 74
d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] 143 (Sp, Sp, Rp, Sp,
Sp, Rp, Sp, Sp, Rp, Sp, Sp)- (SSR).sub.3-SS 75
d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] 144 (Rp, Rp, Sp, Rp,
Rp, Sp, Rp, Rp, Sp, Rp, Rp)- (RRS).sub.3-RR 76
d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] 145 All-(Rp)- All-R
77 d[5mCs1Ts15mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1 Gs15mC] 146
All-(Rp)-d[Gs15mCs1Ts1G] All-R 147 All-(Rp)-d[5mCs1As1Gs1T] All-R
148 All-(Rp)-d[5mCs2As2Gs2Ts25mCs2Ts2Gs25mCs2Ts2Ts25mCs2G] All-R 78
149 All-(Rp)-d[5mCs4As4Gs4Ts45mCs4Ts4Gs45mCs4Ts4Ts45mCs4G] All-R 79
151 All-(Sp)-d[Cs1AsGs1T] All-S 152 All-(Sp)-d[Cs1AGs1T] All-S 153
All-(Sp)-d[CAs1GsT] All-S 157 All-(Sp)-d[5mCs1As1Gs1T] All-S 158
(Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp,
Sp)- 5S-9R-4S 80 d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCs1GsCsACsC] 159
(Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp,
Sp, 5S-9R-5S 81
Sp)-d[Gs1Cs1Cs1Ts1CsAsGsTsCsTsGsCsTsTsCs1GsCs2As2Cs2C] 160
All-(Rp)- All-R 82
(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs]
(Gs5mCsAs5mCs5mC).sub.MOE 161 All-(Sp)- All-S 83
(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs]
(Gs5mCsAs5mCs5mC).sub.MOE 162 (Rp, Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp,
Sp Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, 5R-9S-5R 84 Rp)-
(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs]
(Gs5mCsAs5mCs5mC).sub.MOE 163 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp,
Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp, 5S-9R-5S 85
Sp)-(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs]
(Gs5mCsAs5mCs5mC).sub.MOE 164 (Sp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp,
Rp Rp, Rp, Rp, Rp, Rp, Rp, Rp, 1S-17R-1S 86 Rp, Sp)-
(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs]
(Gs5mCsAs5mCs5mC).sub.MOE 165 (Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp,
Sp Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 1R-17S-1R 87 Rp)-
(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs]
(Gs5mCsAs5mCs5mC).sub.MOE 166 (Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp,
Sp Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, (R/S).sub.9R 88 Rp)-
(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs]
(Gs5mCsAs5mCs5mC).sub.MOE 167 (Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp,
Rp Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, (S/R).sub.9S 89
Sp)-(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs]
(Gs5mCsAs5mCs5mC).sub.MOE 168 (Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp, Rp,
Rp Rp, Rp, Rp, Rp, Rp, Rp, Sp, Sp, 3S-13R-3S 90
Sp)(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs]
(Gs5mCsAs5mCs5mC).sub.MOE 169 (Rp, Rp, Rp, Sp, Sp, Sp, Sp, Sp, Sp,
Sp Sp, Sp, Sp, Sp, Sp, Sp, Rp, Rp, 3R-13S-3R 91 Rp)-
(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs]
(Gs5mCsAs5mCs5mC).sub.MOE 170 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp,
Sp Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 18S/R.sup.19 92 Rp)-
(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs]
(Gs5mCsAs5mCs5mC).sub.MOE 171 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp,
Sp Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 18S/R.sup.9 93
Sp)-(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs]
(Gs5mCsAs5mCs5mC).sub.MOE 172 (Sp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp,
Sp Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 18S/R.sup.2 94
Sp)-(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs]
(Gs5mCsAs5mCs5mC).sub.MOE 173 (Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp,
Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, (RRS).sub.6-R 95 Rp)-
(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs]
(Gs5mCsAs5mCs5mC).sub.MOE 174 (Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp,
Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, S-(RRS).sub.6 96
Sp)-(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs]
(Gs5mCsAs5mCs5mC).sub.MOE 175 (Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp
Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 97
Rp)(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs]
(RRS).sub.5-RR (Gs5mCsAs5mCs5mC).sub.MOE 176 (Rp, Sp, Rp, Rp, Sp,
Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 98
Rp)(Gs15mCs15mCs1Ts15mCs1).sub.MOEd[As1Gs1Ts15mCs1Ts1Gs15m
(RRS).sub.5-RR
Cs1Ts1Ts15mCs1] (Gs15mCs1As15mCs15mC).sub.MOE 177 (Rp, Sp, Rp, Rp,
Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 99
Rp)(Gs15mCs15mCs1Ts15mCs1).sub.MOEd[AGT5mCTG5mCTT5mC]
(RRS).sub.5-RR (Gs25mCs2As25mCs25mC).sub.MOE 178 (Sp, Rp, Rp, Sp,
Rp, Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp,
S-(RRS).sub.6 100
Sp)-(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs]
(Gs5mCsAs5mCs5mC).sub.F (F: 2-fluorodeoxyribose) 179 (Rp, Sp, Rp,
Rp, Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 101
Rp)d[Gs8Cs8Cs8Ts8Cs8As8Gs8Ts8Cs8Ts8Gs8Cs8Ts8Ts8Cs8Gs8Cs
(RRS).sub.5-RR 8As8Cs8C] 180 (Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp
Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 102
Rp)d[Gs9Cs9Cs9Ts9Cs9As9Gs9Ts9Cs9Ts9Gs9Cs9Ts9Ts9Cs9Gs9Cs
(RRS).sub.5-RR 9As9Cs9C] 181 (Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp
Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 103
Rp)d[Gs10Cs10Cs10Ts10Cs10As10Gs10Ts10Cs10Ts10Gs10Cs10Ts
(RRS).sub.5-RR 10Ts10Cs10Gs10Cs10As10Cs10C] 182 (Rp, Sp, Rp, Rp,
Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 104
Rp)d[Gs11Cs11Cs11Ts11Cs11As11Gs11Ts11Cs11Ts11Gs11Cs11Ts
(RRS).sub.5-RR 11Ts11Cs11Gs11Cs11As11Cs11C] 183 (Rp, Sp, Rp, Rp,
Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 105
Rp)d[Gs12Cs12Cs12Ts12Cs12As12Gs12Ts12Cs12Ts12Gs12Cs12Ts
(RRS).sub.5-RR 12Ts12Cs12Gs12Cs12As12Cs12C] 184 (Rp, Sp, Rp, Rp,
Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 106
Rp)d[Gs13Cs13Cs13Ts13Cs13As13Gs13Ts13Cs13Ts13Gs13Cs13Ts
(RRS).sub.5-RR 13Ts13Cs13Gs13Cs13As13Cs13C] 185 (Rp, Sp, Rp, Rp,
Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 107
Rp)d[Gs14Cs14Cs14Ts14Cs14As14Gs14Ts14Cs14Ts14Gs14Cs14Ts
(RRS).sub.5-RR 14Ts14Cs14Gs14Cs14As14Cs14C] 186 (Rp, Sp, Rp, Rp,
Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 108
Rp)d[Gs15Cs15Cs15Ts15Cs15As15Gs15Ts15Cs15Ts15Gs15Cs15Ts
(RRS).sub.5-RR 15Ts15Cs15Gs15Cs15As15Cs15C] 187 (Rp, Sp, Rp, Rp,
Sp, Rp, Rp, Sp, Rp Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp RS- 109
Rp)d[GsCsCs1TsCsAs]GsUs2CsUsGsd[CsTs3TsCsGs]CsAs4CsC (RRS).sub.5-RR
188 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp,
Sp, Sp)- 5S-9R-4S 110 d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsACsC] 189
(Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp,
Sp)- 5S-9R-4S 111
d[Gs1Cs1Cs1Ts1Cs1As1Gs1Ts1Cs1Ts1Gs1Cs1Ts1Ts1Cs1Gs1CsAC s1C] 190
(Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp,
Sp)- 5S-9R-4S 112
d[Gs8Cs8Cs8Ts8Cs8As8Gs8Ts8Cs8Ts8Gs8Cs8Ts8Ts8Cs8Gs8Cs1A Cs8C] 191
(Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp,
Sp)- 5S-9R-4S 113
d[Gs9Cs9Cs9Ts9Cs9As9Gs9Ts9Cs9Ts9Gs9Cs9Ts9Ts9Cs9Gs9Cs1A Cs9C] 192
(Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp,
Sp)- 5S-9R-4S 114
d[Gs10Cs10Cs10Ts10Cs10As10Gs10Ts10Cs10Ts10Gs10Cs10Ts10T
s10Cs10Gs10Cs1ACs10C] 193 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp
Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 115
d[Gs11Cs11Cs11Ts11Cs11As11Gs11Ts11Cs11Ts11Gs11Cs11Ts11T
s11Cs11Gs11Cs1ACs11C] 194 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp
Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 116
d[Gs12Cs12Cs12Ts12Cs12As12Gs12Ts12Cs12Ts12Gs12Cs12Ts12T
s12Cs12Gs12Cs1ACs12C] 195 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp
Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 117
d[Gs13Cs13Cs13Ts13Cs13As13Gs13Ts13Cs13Ts13Gs13Cs13Ts13T
s13Cs13Gs13Cs1ACs13C] 196 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp
Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 118
d[Gs14Cs14Cs14Ts14Cs14As14Gs14Ts14Cs14Ts14Gs14Cs14Ts14T
s14Cs14Gs14Cs1ACs14C] 197 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp
Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 119
d[Gs15Cs15Cs15Ts15Cs15As15Gs15Ts15Cs15Ts15Gs15Cs15Ts15T
s15Cs15Gs15Cs1ACs15C] 198 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp
Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 120
GsCsCsUsCsAsGsUsCsUsGsCsUsUsCsGsCsACsC 199 (Sp, Sp, Sp, Sp, Sp, Rp,
Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 121
Gs1Cs1Cs1Us1Cs1As1Gs1Us1Cs1Us1Gs1Cs1Us1Us1Cs1Gs1CsACs 1C 200 (Sp,
Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)-
5S-9R-4S 122 Gs8Cs8Cs8Us8Cs8As8Gs8Us8Cs8Us8Gs8Cs8Us8Us8Cs8Gs8Cs1AC
s8C 201 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp,
Sp, Sp, Sp)- 5S-9R-4S 123
Gs9Cs9Cs9Us9Cs9As9Gs9Us9Cs9Us9Gs9Cs9Us9Us9Cs9Gs9Cs1AC s9C 202 (Sp,
Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp)-
5S-9R-4S 124 Gs10Cs10Cs10Us10Cs10As10Gs10Us10Cs10Us10Gs10Cs10Us10Us
10Cs10Gs10Cs1ACs10C 203 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp,
Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 125
Gs11Cs11Cs11Us11Cs11As11Gs11Us11Cs11Us11Gs11Cs11Us11Us
11Cs11Gs11Cs1ACs11C 204 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp,
Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 126
Gs12Cs12Cs12Us12Cs12As12Gs12Us12Cs12Us12Gs12Cs12Us12Us
12Cs12Gs12Cs1ACs12C 205 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp,
Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 127
Gs13Cs13Cs13Us13Cs13As13Gs13Us13Cs13Us13Gs13Cs13Us13Us
13Cs13Gs13Cs1ACs13C 206 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp,
Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 128
Gs14Cs14Cs14Us14Cs14As14Gs14Us14Cs14Us14Gs14Cs14Us14Us
14Cs14Gs14Cs1ACs14C 207 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp Rp,
Rp, Rp, Rp, Sp, Sp, Sp, Sp)- 5S-9R-4S 129
Gs15Cs15Cs15Us15Cs15As15Gs15Us15Cs15Us15Gs15Cs15Us15Us
15Cs15Gs15Cs1ACs15C
[1034] In some embodiments, the present disclosure provides
oligonucleotides and/or oligonucleotide compositions that are
useful for treating Huntington's disease, for example, selected
from:
TABLE-US-00004 TABLE N1 Example sequences targeting rs362307 SEQ ID
NO: WV-904 G*G*G*C*A*C*A*A*G*G*G*C*A*C*A*G*A*C*T*T rs362307 P13 130
WV-905 G*G*C*A*C*A*A*G*G*G*C*A*C*A*G*A*C*T*T*C rs362307 P12 131
WV-906 G*C*A*C*A*A*G*G*G*C*A*C*A*G*A*C*T*T*C*C rs362307 P11 132
WV-907 C*A*C*A*A*G*G*G*C*A*C*A*G*A*C*T*T*C*C*A rs362307 P10 133
WV-908 A*C*A*A*G*G*G*C*A*C*A*G*A*C*T*T*C*C*A*A rs362307 P9 134
WV-909 C*A*A*G*G*G*C*A*C*A*G*A*C*T*T*C*C*A*A*A rs362307 P8 135
WV-910 mG*mG*mG*mC*mA*C*A*A*G*G*G*C*A*C*A*G*A*C*T*T rs362307 P13
136 WV-911 mG*mG*mC*mA*mC*A*A*G*G*G*C*A*C*A*G*A*C*T*T*C rs362307
P12 137 WV-912 mG*mC*mA*mC*mA*A*G*G*G*C*A*C*A*G*A*C*T*T*C*C
rs362307 P11 138 WV-913
mC*mA*mC*mA*mA*G*G*G*C*A*C*A*G*A*C*T*T*C*C*A rs362307 P10 139
WV-914 mA*mC*mA*mA*mG*G*G*C*A*C*A*G*A*C*T*T*C*C*A*A rs362307 P9 140
WV-915 mC*mA*mA*mG*mG*G*C*A*C*A*G*A*C*T*T*C*C*A*A*A rs362307 P8 141
WV-916 mG*mG*mG*mC*mA*C*A*A*G*G*G*C*A*C*A*mG*mA*mC*mU*mU rs362307
P13 142 WV-917 mG*mG*mC*mA*mC*A*A*G*G*G*C*A*C*A*G*mA*mC*mU*mU*mC
rs362307 P12 143 WV-918
mG*mC*mA*mC*mA*A*G*G*G*C*A*C*A*G*A*mC*mU*mU*mC*mC rs362307 P11 144
WV-919 mC*mA*mC*mA*mA*G*G*G*C*A*C*A*G*A*C*mU*mU*mC*mC*mA rs362307
P10 145 WV-920 mA*mC*mA*mA*mG*G*G*C*A*C*A*G*A*C*T*mU*mC*mC*mA*mA
rs362307 P9 146 WV-921
mC*mA*mA*mG*mG*G*C*A*C*A*G*A*C*T*T*mC*mC*mA*mA*mA rs362307 P8 147
WV-922 mG*mC*mA*mC*mA*mA*mG*mG*G*C*A*C*A*G*A*mC*mU*mU*mC*mC
rs362307 P11 148 WV-923
mC*mA*mC*mA*mA*mG*mG*G*C*A*C*A*G*A*mC*mU*mU*mC*mC*mA rs362307 P10
149 WV-924 mA*mC*mA*mA*mG*mG*G*C*A*C*A*G*A*mC*mU*mU*mC*mC*mA*mA
rs362307 P9 150 WV-925
mC*mA*mA*mG*mG*G*C*A*C*A*G*A*mC*mU*mU*mC*mC*mA*mA*mA rs362307 P8
151 WV-926 mGmCmAmCmAmAmGmG*G*C*A*C*A*G*A*mCmUmUmCmC rs362307 P11
152 WV-927 mCmAmCmAmAmGmG*G*C*A*C*A*G*A*mCmUmUmCmCmA rs362307 P10
153 WV-928 mAmCmAmAmGmG*G*C*A*C*A*G*A*mCmUmUmCmCmAmA rs362307 P9
154 WV-929 mCmAmAmGmG*G*C*A*C*A*G*A*mCmUmUmCmCmAmAmA rs362307 P8
155 WV-930 mGmGmGmCmA*C*A*A*G*G*G*C*A*C*A*mGmAmCmUmU rs362307 P13
156 WV-931 mGmGmCmAmC*A*A*G*G*G*C*A*C*A*G*mAmCmUmUmC rs362307 P12
157 WV-932 mGmCmAmCmA*A*G*G*G*C*A*C*A*G*A*mCmUmUmCmC rs362307 P11
158 WV-933 mCmAmCmAmA*G*G*G*C*A*C*A*G*A*C*mUmUmCmCmA rs362307 P10
159 WV-934 mAmCmAmAmG*G*G*C*A*C*A*G*A*C*T*mUmCmCmAmA rs362307 P9
160 WV-935 mCmAmAmGmG*G*C*A*C*A*G*A*C*T*T*mCmCmAmAmA rs362307 P8
161 WV-936
G*SG*SG*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST rs362307
P13 162 WV-937
G*SG*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC rs362307
P12 163 WV-938
G*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*SC rs362307
P11 164 WV-939
C*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*SC*SA rs362307
P10 165 WV-940
A*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*SC*SA*SA rs362307
P9 166 WV-941
C*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*SC*SA*SA*SA rs362307
P8 167 WV-1085
mG*SmG*SmC*SmA*SmC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SmA*SmC* rs362307
P12 168 SmU*SmU*SmC WV-1086
mG*RmG*RmC*RmA*RmC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SmA*RmC rs362307
P12 169 *RmU*RmU*RmC WV-1087
mGmGmCmAmC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SmAmCmUmUmC rs362307 P12
170 WV-1088
mG*SmG*SmC*SmA*SmC*SmA*SmA*SmG*SG*SG*SC*SA*SC*RA*SG*SA*S rs362307
P12 171 C*ST*ST*SC WV-1089
mG*RmG*RmC*RmA*RmC*RmA*RmA*RmG*SG*SG*SC*SA*SC*RA*SG*SA* rs362307
P12 172 SC*ST*ST*SC WV-1090
mGmGmCmAmCmAmAmG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC rs362307 P12
173 WV-1091 mG*RmGmCmAmC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SmAmCmUmU*R
rs362307 P12 174 mC WV-1092
mG*SmGmCmAmC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SmAmCmUmU*S rs362307 P12
175 mC WV-982
G*SC*SA*SG*SG*SG*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA rs362307
P16 176 WV-983
C*SA*SG*SG*SG*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC rs362307
P15 177 WV-984
A*SG*SG*SG*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST rs362307
P14 178 WV-985
A*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*SC*SA*SA*SA*SG rs362307
P7 179 WV-986
A*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*SC*SA*SA*SA*SG*SG rs362307
P6 180 WV-987
G*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*SC*SA*SA*SA*SG*SG*SC rs362307
P5 181 WV-1234 mG*mG*mC*mA*mC*A*A*G*G*G*C*A*C*A*G*mA*mC*mU*BrdU*mC
rs362307 P12 182 WV-1235
mG*mG*mC*mA*mC*A*A*G*G*G*C*A*C*A*G*mA*mC*BrdU*BrdU*mC rs362307 P12
183 WV-1067 G*G*G*C*A*C*A*A*G*G*G*C*d2AP*C*A*G*A*C*T*T rs362307 P13
184 WV-1068 G*G*C*A*C*A*A*G*G*G*C*d2AP*C*A*G*A*C*T*T*C rs362307 P12
185 WV-1069 G*C*A*C*A*A*G*G*G*C*d2AP*C*A*G*A*C*T*T*C*C rs362307 P11
186 WV-1070 G*G*G*C*A*C*A*A*G*G*G*C*dDAP*C*A*G*A*C*T*T rs362307 P13
187 WV-1071 G*G*C*A*C*A*A*G*G*G*C*dDAP*C*A*G*A*C*T*T*C rs362307 P12
188 WV-1072 G*C*A*C*A*A*G*G*G*C*dDAP*C*A*G*A*C*T*T*C*C rs362307 P11
189 WV-1510 G*SmGmCmAmC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SmAmCmUmU*SC
rs362307 P12 190 WV-1511 G*mGmCmAmC*A*A*G*G*G*C*A*C*A*G*mAmCmUmU*C
rs362307 P12 191 WV-1497
mG*mGmCmAmC*A*A*G*G*G*C*A*C*A*G*mAmCmUmU*mC rs362307 P12 192
WV-1655
Geo*Geom5CeoAeom5Ceo*A*A*G*G*G*C*A*C*A*G*Aeom5CeoTeoTeo*m5Ceo
rs362307 P12 193
TABLE-US-00005 TABLE N2 Example sequences targeting rs362306
WV-1001 G*A*G*C*A*G*C*T*G*C*A*A*C*C*T*G*G*C*A*A rs362306 P10 194
WV-1002 A*G*C*A*G*C*T*G*C*A*A*C*C*T*G*G*C*A*A*C rs362306 P9 195
WV-1003 G*C*A*G*C*T*G*C*A*A*C*C*T*G*G*C*A*A*C*A rs362306 P8 196
WV-1004 C*A*G*C*T*G*C*A*A*C*C*T*G*G*C*A*A*C*A*A rs362306 P7 197
WV-1005 A*G*C*T*G*C*A*A*C*C*T*G*G*C*A*A*C*A*A*C rs362306 P6 198
WV-1006 G*C*T*G*C*A*A*C*C*T*G*G*C*A*A*C*A*A*C*C rs362306 P5 199
WV-1007 mG*mA*mG*mC*mA*G*C*T*G*C*A*A*C*C*T*G*G*C*A*A rs362306 P10
200 WV-1008 mA*mG*mC*mA*mG*C*T*G*C*A*A*C*C*T*G*G*C*A*A*C rs362306
P9 201 WV-1009 mG*mC*mA*mG*mC*T*G*C*A*A*C*C*T*G*G*C*A*A*C*A
rs362306 P8 202 WV-1010
mC*mA*mG*mC*mU*G*C*A*A*C*C*T*G*G*C*A*A*C*A*A rs362306 P7 203
WV-1011 mA*mG*mC*mU*mG*C*A*A*C*C*T*G*G*C*A*A*C*A*A*C rs362306 P6
204 WV-1012 mG*mC*mU*mG*mC*A*A*C*C*T*G*G*C*A*A*C*A*A*C*C rs362306
P5 205 WV-1013 mG*mA*mG*mC*mA*G*C*T*G*C*A*A*C*C*T*mG*mG*mC*mA*mA
rs362306 P10 206 WV-1014
mA*mG*mC*mA*mG*C*T*G*C*A*A*C*C*T*G*mG*mC*mA*mA*mC rs362306 P9 207
WV-1015 mG*mC*mA*mG*mC*T*G*C*A*A*C*C*T*G*G*mC*mA*mA*mC*mA rs362306
P8 208 WV-1016 mC*mA*mG*mC*mU*G*C*A*A*C*C*T*G*G*C*mA*mA*mC*mA*mA
rs362306 P7 209 WV-1017
mA*mG*mC*mU*mG*C*A*A*C*C*T*G*G*C*A*mA*mC*mA*mA*mC rs362306 P6 210
WV-1018 mG*mC*mU*mG*mC*A*A*C*C*T*G*G*C*A*A*mC*mA*mA*mC*mC rs362306
P5 211 WV-1019 mG*mA*mG*mC*mA*mG*mC*T*G*C*A*A*C*C*mU*mG*mG*mC*mA*mA
rs362306 P10 212 WV-1020 mGmAmGmCmAmGmC*T*G*C*A*A*C*C*mUmGmGmCmAmA
rs362306 P10 213 WV-1021
mA*mG*mC*mA*mG*mC*T*G*C*A*A*C*C*T*G*mG*mC*mA*mA*mC rs362306 P9 214
WV-1022 mAmGmCmAmGmC*T*G*C*A*A*C*C*T*G*mGmCmAmAmC rs362306 P9 215
WV-1023 mG*mC*mA*mG*mC*T*G*C*A*A*C*C*mU*mG*mG*mC*mA*mA*mC*mA
rs362306 P8 216 WV-1024 mGmCmAmGmC*T*G*C*A*A*C*C*mUmGmGmCmAmAmCmA
rs362306 P8 217 WV-1025 mGmAmGmCmA*G*C*T*G*C*A*A*C*C*T*mGmGmCmAmA
rs362306 P10 218 WV-1026 mAmGmCmAmG*C*T*G*C*A*A*C*C*T*G*mGmCmAmAmC
rs362306 P9 219 WV-1027 mGmCmAmGmC*T*G*C*A*A*C*C*T*G*G*mCmAmAmCmA
rs362306 P8 220 WV-1028 mCmAmGmCmU*G*C*A*A*C*C*T*G*G*C*mAmAmCmAmA
rs362306 P7 221 WV-1029 mAmGmCmUmG*C*A*A*C*C*T*G*G*C*A*mAmCmAmAmC
rs362306 P6 222 WV-1030 mGmCmUmGmC*A*A*C*C*T*G*G*C*A*A*mCmAmAmCmC
rs362306 P5 223 WV-952
G*SA*SG*SC*SA*SG*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*SC*SA*SA rs362306
P10 224 WV-953
A*SG*SC*SA*SG*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*SC*SA*SA*SC rs362306
P9 225 WV-954
G*SC*SA*SG*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*SC*SA*SA*SC*SA rs362306
P8 226 WV-955
C*SA*SG*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*SC*SA*SA*SC*SA*SA rs362306
P7 227 WV-956
A*SG*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*SC*SA*SA*SC*SA*SA*SC rs362306
P6 228 WV-957
G*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*SC*SA*SA*SC*SA*SA*SC*SC rs362306
P5 229
TABLE-US-00006 TABLE N3 Example sequences targeting rs362268
WV-1031 G*G*G*C*C*A*A*C*A*G*C*C*A*G*C*C*T*G*C*A rs362268 P10 230
WV-1032 G*G*C*C*A*A*C*A*G*C*C*A*G*C*C*T*G*C*A*G rs362268 P9 231
WV-1033 G*C*C*A*A*C*A*G*C*C*A*G*C*C*T*G*C*A*G*G rs362268 P8 232
WV-1034 C*C*A*A*C*A*G*C*C*A*G*C*C*T*G*C*A*G*G*A rs362268 P7 233
WV-1035 C*A*A*C*A*G*C*C*A*G*C*C*T*G*C*A*G*G*A*G rs362268 P6 234
WV-1036 A*A*C*A*G*C*C*A*G*C*C*T*G*C*A*G*G*A*G*G rs362268 P5 235
WV-1037 mG*mG*mG*mC*mC*A*A*C*A*G*C*C*A*G*C*C*T*G*C*A rs362268 P10
236 WV-1038 mG*mG*mC*mC*mA*A*C*A*G*C*C*A*G*C*C*T*G*C*A*G rs362268
P9 237 WV-1039 mG*mC*mC*mA*mA*C*A*G*C*C*A*G*C*C*T*G*C*A*G*G
rs362268 P8 238 WV-1040
mC*mC*mA*mA*mC*A*G*C*C*A*G*C*C*T*G*C*A*G*G*A rs362268 P7 239
WV-1041 mC*mA*mA*mC*mA*G*C*C*A*G*C*C*T*G*C*A*G*G*A*G rs362268 P6
240 WV-1042 mA*mA*mC*mA*mG*C*C*A*G*C*C*T*G*C*A*G*G*A*G*G rs362268
P5 241 WV-1043 mG*mG*mG*mC*mC*A*A*C*A*G*C*C*A*G*C*mC*mU*mG*mC*mA
rs362268 P10 242 WV-1044
mG*mG*mC*mC*mA*A*C*A*G*C*C*A*G*C*C*mU*mG*mC*mA*mG rs362268 P9 243
WV-1045 mG*mC*mC*mA*mA*C*A*G*C*C*A*G*C*C*T*mG*mC*mA*mG*mG rs362268
P8 244 WV-1046 mC*mC*mA*mA*mC*A*G*C*C*A*G*C*C*T*G*mC*mA*mG*mG*mA
rs362268 P7 245 WV-1047
mC*mA*mA*mC*mA*G*C*C*A*G*C*C*T*G*C*mA*mG*mG*mA*mG rs362268 P6 246
WV-1048 mA*mA*mC*mA*mG*C*C*A*G*C*C*T*G*C*A*mG*mG*mA*mG*mG rs362268
P5 247 WV-1049 mG*mG*mG*mC*mC*mA*mA*C*A*G*C*C*A*G*mC*mC*mU*mG*mC*mA
rs362268 P10 248 WV-1050 mGmGmGmCmCmAmA*C*A*G*C*C*A*G*mCmCmUmGmCmA
rs362268 P10 249 WV-1051
mG*mG*mC*mC*mA*mA*C*A*G*C*C*A*G*C*C*mU*mG*mC*mA*mG rs362268 P9 250
WV-1052 mGmGmCmCmAmA*C*A*G*C*C*A*G*C*C*mUmGmCmAmG rs362268 P9 251
WV-1053 mG*mC*mC*mA*mA*C*A*G*C*C*A*G*mC*mC*mU*mG*mC*mA*mG*mG
rs362268 P8 252 WV-1054 mGmCmCmAmA*C*A*G*C*C*A*G*mCmCmUmGmCmAmGmG
rs362268 P8 253 WV-1055 mGmGmGmCmC*A*A*C*A*G*C*C*A*G*C*mCmUmGmCmA
rs362268 P10 254 WV-1056 mGmGmCmCmA*A*C*A*G*C*C*A*G*C*C*mUmGmCmAmG
rs362268 P9 255 WV-1057 mGmCmCmAmA*C*A*G*C*C*A*G*C*C*T*mGmCmAmGmG
rs362268 P8 256 WV-1058 mCmCmAmAmC*A*G*C*C*A*G*C*C*T*G*mCmAmGmGmA
rs362268 P7 257 WV-1059 mCmAmAmCmA*G*C*C*A*G*C*C*T*G*C*mAmGmGmAmG
rs362268 P6 258 WV-1060 mAmAmCmAmG*C*C*A*G*C*C*T*G*C*A*mGmGmAmGmG
rs362268 P5 259 WV-960
G*SG*SG*SC*SC*SA*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*SG*SC*SA rs362268
P10 260 WV-961
G*SG*SC*SC*SA*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*SG*SC*SA*SG rs362268
P9 261 WV-962
G*SC*SC*SA*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*SG*SC*SA*SG*SG rs362268
P8 262 WV-963
C*SC*SA*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*SG*SC*SA*SG*SG*SA rs362268
P7 263 WV-964
C*SA*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*SG*SC*SA*SG*SG*SA*SG rs362268
P6 264 WV-965
A*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*SG*SC*SA*SG*SG*SA*SG*SG rs362268
P5 265
TABLE-US-00007 TABLE N4 Example sequences targeting rs7685686
ONT-450 A*T*T*A*A*T*A*A*A*T*T*G*T*C*A*T*C*A*C*C rs7685686 P13 266
ONT-451 A*ST*ST*SA*SA*ST*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*SC*SA*SC*SC
rs7685686 P13 267 ONT-452
A*ST*ST*SA*SA*ST*SA*SA*SA*ST*ST*SG*ST*SC*SA*RT*SC*SA*SC*SC
rs7685686 P13 268 WV-1077
mA*SmU*SmU*SmA*SmA*SmU*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*SmC* rs7685686
P13 269 SmA*SmC*SmC WV-1078
mA*RmU*RmU*RmA*RmA*RmU*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*SmC rs7685686
P13 270 *RmA*RmC*RmC WV-1079
mA*SmU*SmU*SmA*SmA*SmU*SmA*SmA*SA*ST*ST*SG*ST*SC*RA*ST*SC rs7685686
P13 271 *SA*SC*SC WV-1080
mA*RmU*RmU*RmA*RmA*RmU*RmA*RmA*SA*ST*ST*SG*ST*SC*RA*ST* rs7685686
P13 272 SC*SA*SC*SC WV-1081
mAmUmUmAmAmUmAmA*SA*ST*ST*SG*ST*SC*RA*ST*SC*SA*SC*SC rs7685686 P13
273 WV-1082 mAmUmUmAmAmU*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*SmCmAmCmC
rs7685686 P13 274 WV-1083
mA*SmUmUmAmAmU*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*SmCmAmC*SmC rs7685686
P13 275 WV-1084
mA*RmUmUmAmAmU*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*SmCmAmC*RmC rs7685686
P13 276 WV-1508
A*SmUmUmAmAmU*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*SmCmAmC*SC rs7685686
P13 277 WV-1509 A*mUmUmAmAmU*A*A*A*T*T*G*T*C*A*T*mCmAmC*C rs7685686
P13 278 WV-2023 T*G*T*C*A*T*C*A*C*C*A*G*A*A*A*mA*mA*mG*mU*mC
rs7685686 P3 279 WV-2024
mU*T*G*T*C*A*T*C*A*C*C*A*G*A*A*mA*mA*mA*mG*mU rs7685686 P4 280
WV-2025 T*T*G*T*C*A*T*C*A*C*C*A*G*A*A*mA*mA*mA*mG*mU rs7685686 P4
281 WV-2026 mA*mU*T*G*T*C*A*T*C*A*C*C*A*G*A*mA*mA*mA*mA*mG
rs7685686 P5 282 WV-2027
mA*T*T*G*T*C*A*T*C*A*C*C*A*G*A*mA*mA*mA*mA*mG rs7685686 P5 283
WV-2028 mA*mA*mU*T*G*T*C*A*T*C*A*C*C*A*G*mA*mA*mA*mA*mA rs7685686
P6 284 WV-2029 mA*mA*T*T*G*T*C*A*T*C*A*C*C*A*G*mA*mA*mA*mA*mA
rs7685686 P6 285 WV-2030
mA*mA*mA*T*T*G*T*C*A*T*C*A*C*C*A*mG*mA*mA*mA*mA rs7685686 P7 286
WV-2031 mA*mA*mA*mU*T*G*T*C*A*T*C*A*C*C*A*mG*mA*mA*mA*mA rs7685686
P7 287 WV-2032 mU*mA*mA*mA*mU*T*G*T*C*A*T*C*A*C*C*A*mG*mA*mA*mA
rs7685686 P8 288 WV-2033
mU*mA*mA*mA*mU*T*G*T*C*A*T*C*A*C*C*mA*mG*mA*mA*mA rs7685686 P8 289
WV-2034 mA*mU*mA*mA*mA*T*T*G*T*C*A*T*C*A*C*C*mA*mG*mA*mA rs7685686
P9 290 WV-2035 mA*mU*mA*mA*mA*T*T*G*T*C*A*T*C*A*C*mC*mA*mG*mA*mA
rs7685686 P9 291 WV-2036
mA*mA*mU*mA*mA*A*T*T*G*T*C*A*T*C*A*C*C*mA*mG*mA rs7685686 P10 292
WV-2037 mA*mA*mU*mA*mA*A*T*T*G*T*C*A*T*C*A*C*mC*mA*mG*mA rs7685686
P10 293 WV-2038 mA*mA*mU*mA*mA*A*T*T*G*T*C*A*T*C*A*mC*mC*mA*mG*mA
rs7685686 P10 294 WV-2039
mU*mA*mA*mU*mA*A*A*T*T*G*T*C*A*T*C*A*C*C*mA*mG rs7685686 P11 295
WV-2040 mU*mA*mA*mU*mA*A*A*T*T*G*T*C*A*T*C*A*C*mC*mA*mG rs7685686
P11 296 WV-2041 mU*mA*mA*mU*mA*A*A*T*T*G*T*C*A*T*C*A*mC*mC*mA*mG
rs7685686 P11 297 WV-2042
mU*mA*mA*mU*mA*A*A*T*T*G*T*C*A*T*C*mA*mC*mC*mA*mG rs7685686 P11 298
WV-2043 mU*mU*mA*mA*mU*A*A*A*T*T*G*T*C*A*T*C*A*C*C*mA rs7685686 P12
299 WV-2044 mU*mU*mA*mA*mU*A*A*A*T*T*G*T*C*A*T*C*A*C*mC*mA
rs7685686 P12 300 WV-2045
mU*mU*mA*mA*mU*A*A*A*T*T*G*T*C*A*T*C*A*mC*mC*mA rs7685686 P12 301
WV-2046 mU*mU*mA*mA*mU*A*A*A*T*T*G*T*C*A*T*C*mA*mC*mC*mA rs7685686
P12 302 WV-2047 mA*mU*mU*mA*mA*T*A*A*A*T*T*G*T*C*A*T*C*A*C*C
rs7685686 P13 303 WV-2048
mA*mU*mU*mA*mA*T*A*A*A*T*T*G*T*C*A*T*C*A*C*mC rs7685686 P13 304
WV-2049 mA*mU*mU*mA*mA*T*A*A*A*T*T*G*T*C*A*T*C*A*mC*mC rs7685686
P13 305 WV-2050 mA*mU*mU*mA*mA*T*A*A*A*T*T*G*T*C*A*T*C*mA*mC*mC
rs7685686 P13 306 WV-2051
mU*mA*mU*mU*mA*A*T*A*A*A*T*T*G*T*C*A*T*C*A*C rs7685686 P14 307
WV-2052 mU*mA*mU*mU*mA*A*T*A*A*A*T*T*G*T*C*A*T*C*A*mC rs7685686 P14
308 WV-2053 mU*mA*mU*mU*mA*A*T*A*A*A*T*T*G*T*C*A*T*C*mA*mC
rs7685686 P14 309 WV-2054
mC*mU*mA*mU*mU*A*A*T*A*A*A*T*T*G*T*C*A*T*C*A rs7685686 P15 310
WV-2055 mC*mU*mA*mU*mU*A*A*T*A*A*A*T*T*G*T*C*A*T*C*mA rs7685686 P15
311 WV-2056 mA*mC*mU*mA*mU*T*A*A*T*A*A*A*T*T*G*T*C*A*T*C rs7685686
P16 312 WV-2057 T*G*T*C*A*T*C*A*C*C*A*G*A*A*A*mAmAmGmU*mC rs7685686
P3 313 WV-2058 mU*T*G*T*C*A*T*C*A*C*C*A*G*A*A*mAmAmAmG*mU rs7685686
P4 314 WV-2059 T*T*G*T*C*A*T*C*A*C*C*A*G*A*A*mAmAmAmG*mU rs7685686
P4 315 WV-2060 mA*mU*T*G*T*C*A*T*C*A*C*C*A*G*A*mAmAmAmA*mG
rs7685686 P5 316 WV-2061 mA*T*T*G*T*C*A*T*C*A*C*C*A*G*A*mAmAmAmA*mG
rs7685686 P5 317 WV-2062
mA*mAmU*T*G*T*C*A*T*C*A*C*C*A*G*mAmAmAmA*mA rs7685686 P6 318
WV-2063 mA*mA*T*T*G*T*C*A*T*C*A*C*C*A*G*mAmAmAmA*mA rs7685686 P6
319 WV-2064 mA*mAmA*T*T*G*T*C*A*T*C*A*C*C*A*mGmAmAmA*mA rs7685686
P7 320 WV-2065 mA*mAmAmU*T*G*T*C*A*T*C*A*C*C*A*mGmAmAmA*mA
rs7685686 P7 321 WV-2066
mU*mAmAmAmU*T*G*T*C*A*T*C*A*C*C*A*mGmAmA*mA rs7685686 P8 322
WV-2067 mU*mAmAmAmU*T*G*T*C*A*T*C*A*C*C*mAmGmAmA*mA rs7685686 P8
323 WV-2068 mA*mUmAmAmA*T*T*G*T*C*A*T*C*A*C*C*mAmGmA*mA rs7685686
P9 324 WV-2069 mA*mUmAmAmA*T*T*G*T*C*A*T*C*A*C*mCmAmGmA*mA
rs7685686 P9 325 WV-2070
mA*mAmUmAmA*A*T*T*G*T*C*A*T*C*A*C*C*mAmG*mA rs7685686 P10 326
WV-2071 mA*mAmUmAmA*A*T*T*G*T*C*A*T*C*A*C*mCmAmG*mA rs7685686 P10
327 WV-2072 mA*mAmUmAmA*A*T*T*G*T*C*A*T*C*A*mCmCmAmG*mA rs7685686
P10 328 WV-2073 mU*mAmAmUmA*A*A*T*T*G*T*C*A*T*C*A*C*C*mA*mG
rs7685686 P11 329 WV-2074
mU*mAmAmUmA*A*A*T*T*G*T*C*A*T*C*A*C*mCmA*mG rs7685686 P11 330
WV-2075 mU*mAmAmUmA*A*A*T*T*G*T*C*A*T*C*A*mCmCmA*mG rs7685686 P11
331 WV-2076 mU*mAmAmUmA*A*A*T*T*G*T*C*A*T*C*mAmCmCmA*mG rs7685686
P11 332 WV-2077 mU*mUmAmAmU*A*A*A*T*T*G*T*C*A*T*C*A*C*C*mA
rs7685686 P12 333 WV-2078
mU*mUmAmAmU*A*A*A*T*T*G*T*C*A*T*C*A*C*mC*mA rs7685686 P12 334
WV-2079 mU*mUmAmAmU*A*A*A*T*T*G*T*C*A*T*C*A*mCmC*mA rs7685686 P12
335 WV-2080 mU*mUmAmAmU*A*A*A*T*T*G*T*C*A*T*C*mAmCmC*mA rs7685686
P12 336 WV-2081 mA*mUmUmAmA*T*A*A*A*T*T*G*T*C*A*T*C*A*C*C rs7685686
P13 337 WV-2082 mA*mUmUmAmA*T*A*A*A*T*T*G*T*C*A*T*C*A*C*mC
rs7685686 P13 338 WV-2083
mA*mUmUmAmA*T*A*A*A*T*T*G*T*C*A*T*C*A*mC*mC rs7685686 P13 339
WV-2084 mA*mUmUmAmA*T*A*A*A*T*T*G*T*C*A*T*C*mAmC*mC rs7685686 P13
340 WV-2085 mU*mAmUmUmA*A*T*A*A*A*T*T*G*T*C*A*T*C*A*C rs7685686 P14
341 WV-2086 mU*mAmUmUmA*A*T*A*A*A*T*T*G*T*C*A*T*C*A*mC rs7685686
P14 342 WV-2087 mU*mAmUmUmA*A*T*A*A*A*T*T*G*T*C*A*T*C*mA*mC
rs7685686 P14 343 WV-2088 mC*mUmAmUmU*A*A*T*A*A*A*T*T*G*T*C*A*T*C*A
rs7685686 P15 344 WV-2089
mC*mUmAmUmU*A*A*T*A*A*A*T*T*G*T*C*A*T*C*mA rs7685686 P15 345
WV-2090 mA*mCmUmAmU*T*A*A*T*A*A*A*T*T*G*T*C*A*T*C rs7685686 P16
346
TABLE-US-00008 TABLE N1 Example sequences targeting rs362307 -
continued (certain features) WV-904 All DNA, stereorandom PS
rs362307 P13 WV-905 All DNA, stereorandom PS rs362307 P12 WV-906
All DNA, stereorandom PS rs362307 P11 WV-907 All DNA, stereorandom
PS rs362307 P10 WV-908 All DNA, stereorandom PS rs362307 P9 WV-909
All DNA, stereorandom PS rs362307 P8 WV-910 5-15 (2'-OMe-DNA),
stereorandom PS rs362307 P13 WV-911 5-15 (2'-OMe-DNA), stereorandom
PS rs362307 P12 WV-912 5-15 (2'-OMe-DNA), stereorandom PS rs362307
P11 WV-913 5-15 (2'-OMe-DNA), stereorandom PS rs362307 P10 WV-914
5-15 (2'-OMe-DNA), stereorandom PS rs362307 P9 WV-915 5-15
(2'-OMe-DNA), stereorandom PS rs362307 P8 WV-916 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362307 P13 WV-917 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362307 P12 WV-918 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362307 P11 WV-919 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362307 P10 WV-920 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362307 P9 WV-921 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362307 P8 WV-922 8-7-5
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362307 P11 WV-923 7-7-6
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362307 P10 WV-924 6-7-5
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362307 P9 WV-925 5-7-8
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362307 P8 WV-926 8-7-5
(2'-OMe-DNA-2'-OMe), stereorandom PS, PO in the wings rs362307 P11
WV-927 7-7-6 (2'-OMe-DNA-2'-OMe), stereorandom PS, PO in the wings
rs362307 P10 WV-928 6-7-5 (2'-OMe-DNA-2'-OMe), stereorandom PS, PO
in the wings rs362307 P9 WV-929 5-7-8 (2'-OMe-DNA-2'-OMe),
stereorandom PS, PO in the wings rs362307 P8 WV-930 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS, PO in the wings rs362307 P13
WV-931 5-10-5 (2'-OMe-DNA-2'-OMe), stereorandom PS, PO in the wings
rs362307 P12 WV-932 5-10-5 (2'-OMe-DNA-2'-OMe), stereorandom PS, PO
in the wings rs362307 P11 WV-933 5-10-5 (2'-OMe-DNA-2'-OMe),
stereorandom PS, PO in the wings rs362307 P10 WV-934 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS, PO in the wings rs362307 P9
WV-935 5-10-5 (2'-OMe-DNA-2'-OMe), stereorandom PS, PO in the wings
rs362307 P8 WV-936 All DNA, stereopure, One Rp rs362307 P13 WV-937
All DNA, stereopure, One Rp rs362307 P12 WV-938 All DNA,
stereopure, One Rp rs362307 P11 WV-939 All DNA, stereopure, One Rp
rs362307 P10 WV-940 All DNA, stereopure, One Rp rs362307 P9 WV-941
All DNA, stereopure, One Rp rs362307 P8 WV-1085 5-10-5
(2'-OMe-DNA-2'-OMe) Gapmer, Stereopure, One Rp in DNA rs362307 P12
WV-1086 5-10-5 (2'-OMe-DNA-2'-OMe) Gapmer, Stereopure, One Rp in
DNA and Rp wings rs362307 P12 WV-1087 5-10-5 (2'-OMe-DNA-2'-OMe)
Gapmer, Stereopure, One Rp in DNA, PO wings rs362307 P12 WV-1088
8-12 (2'-OMe-DNA) hemimer, Stereopure, One Rp in DNA, Sp wing
rs362307 P12 WV-1089 8-12 (2'-OMe-DNA) hemimer, Stereopure, One Rp
in DNA and Rp wing rs362307 P12 WV-1090 8-12 (2'-OMe-DNA) hemimer,
Srereopure, One Rp in DNA and PO wing rs362307 P12 WV-1091 5-10-5
(2'-OMe-DNA-2'-OMe) gapmer, Stereopure, One Rp in DNA, rs362307 P12
First and last PS as Rp and rest PO wing WV-1092 5-10-5
(2'-OMe-DNA-2'-OMe) gapmer, Stereopure, One Rp in DNA, rs362307 P12
First and last PS as Sp and rest PO wing WV-982 All DNA,
stereopure, One Rp rs362307 P16 WV-983 All DNA, stereopure, One Rp
rs362307 P15 WV-984 All DNA, stereopure, One Rp rs362307 P14 WV-985
All DNA, stereopure, One Rp rs362307 P7 WV-986 All DNA, stereopure,
One Rp rs362307 P6 WV-987 All DNA, stereopure, One Rp rs362307 P5
WV-1234 5-10-5 (2'-OMe-DNA-2'-OMe) Gapmer, Stereorandom, One Br-dU
rs362307 P12 WV-1235 5-10-5 (2'-OMe-DNA-2'-OMe) Gapmer,
Stereorandom, Two Br-dU rs362307 P12 WV-1067 All DNA, stereorandom
PS, one 2-amino purine rs362307 P13 WV-1068 All DNA, stereorandom
PS, one 2-amino purine rs362307 P12 WV-1069 All DNA, stereorandom
PS, one 2-amino purine rs362307 P11 WV-1070 All DNA, stereorandom
PS, one 2,6-diamino purine rs362307 P13 WV-1071 All DNA,
stereorandom PS, one 2,6-diamino purine rs362307 P12 WV-1072 All
DNA, stereorandom PS, one 2,6-diamino purine rs362307 P11 WV-1510
1-4-10-4-1 (DNA/2'-OMe) gapmer, Stereopure, one Rp in the DNA,
rs362307 P12 first and last nucletotide is DNA and first and last
PS are Sp WV-1511 1-4-10-4-1 (DNA/2'-OMe) gapmer, Stereorandom, 1st
and last PS, rs362307 P12 rest of the wing is PO WV-1497 5-10-5
(2'-OMe-DNA-2'-OMe) gapmer, Stereorandom, First and rs362307 P12
last PS and rest PO wing WV-1655 5-10-5 (2'-MOE-DNA-2'-MOE) Gapmer,
Stereorandom, PO wings rs362307 P12 with One PS on each end
TABLE-US-00009 TABLE N2 Example sequences targeting rs362306 -
continued (certain features) WV-1001 All DNA, stereorandom PS
rs362306 P10 WV-1002 All DNA, stereorandom PS rs362306 P9 WV-1003
All DNA, stereorandom PS rs362306 P8 WV-1004 All DNA, stereorandom
PS rs362306 P7 WV-1005 All DNA, stereorandom PS rs362306 P6 WV-1006
All DNA, stereorandom PS rs362306 P5 WV-1007 5-15 (2'-OMe-DNA),
stereorandom PS rs362306 P10 WV-1008 5-15 (2'-OMe-DNA),
stereorandom PS rs362306 P9 WV-1009 5-15 (2'-OMe-DNA), stereorandom
PS rs362306 P8 WV-1010 5-15 (2'-OMe-DNA), stereorandom PS rs362306
P7 WV-1011 5-15 (2'-OMe-DNA), stereorandom PS rs362306 P6 WV-1012
5-15 (2'-OMe-DNA), stereorandom PS rs362306 P5 WV-1013 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362306 P10 WV-1014 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362306 P9 WV-1015 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362306 P8 WV-1016 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362306 P7 WV-1017 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362306 P6 WV-1018 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362306 P5 WV-1019 7-7-6
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362306 P10 WV-1020 7-7-6
(2'-OMe-DNA-2'-OMe), stereorandom PS, PO in wings rs362306 P10
WV-1021 6-7-5 (2'-OMe-DNA-2'-OMe), stereorandom PS rs362306 P9
WV-1022 6-7-5 (2'-OMe-DNA-2'-OMe), stereorandom PS, PO in the wings
rs362306 P9 WV-1023 5-7-8 (2'-OMe-DNA-2'-OMe), stereorandom PS
rs362306 P8 WV-1024 5-7-8 (2'-OMe-DNA-2'-OMe), stereorandom PS, PO
in the wings rs362306 P8 WV-1025 5-10-5 (2'-OMe-DNA-2'-OMe),
stereorandom PS, PO in the wings rs362306 P10 WV-1026 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS, PO in the wings rs362306 P9
WV-1027 5-10-5 (2'-OMe-DNA-2'-OMe), stereorandom PS, PO in the
wings rs362306 P8 WV-1028 5-10-5 (2'-OMe-DNA-2'-OMe), stereorandom
PS, PO in the wings rs362306 P7 WV-1029 5-10-5 (2'-OMe-DNA-2'-OMe),
stereorandom PS, PO in the wings rs362306 P6 WV-1030 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS, PO in the wings rs362306 P5
WV-952 All DNA, stereopure, One Rp rs362306 P10 WV-953 All DNA,
stereopure, One Rp rs362306 P9 WV-954 All DNA, stereopure, One Rp
rs362306 P8 WV-955 All DNA, stereopure, One Rp rs362306 P7 WV-956
All DNA, stereopure, One Rp rs362306 P6 WV-957 All DNA, stereopure,
One Rp rs362306 P5
TABLE-US-00010 TABLE N3 Example sequences targeting rs362268 -
continued (certain features) WV-1031 All DNA, stereorandom PS
rs362268 P10 WV-1032 All DNA, stereorandom PS rs362268 P9 WV-1033
All DNA, stereorandom PS rs362268 P8 WV-1034 All DNA, stereorandom
PS rs362268 P7 WV-1035 All DNA, stereorandom PS rs362268 P6 WV-1036
All DNA, stereorandom PS rs362268 P5 WV-1037 5-15 (2'-OMe-DNA),
stereorandom PS rs362268 P10 WV-1038 5-15 (2'-OMe-DNA),
stereorandom PS rs362268 P9 WV-1039 5-15 (2'-OMe-DNA), stereorandom
PS rs362268 P8 WV-1040 5-15 (2'-OMe-DNA), stereorandom PS rs362268
P7 WV-1041 5-15 (2'-OMe-DNA), stereorandom PS rs362268 P6 WV-1042
5-15 (2'-OMe-DNA), stereorandom PS rs362268 P5 WV-1043 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362268 P10 WV-1044 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362268 P9 WV-1045 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362268 P8 WV-1046 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362268 P7 WV-1047 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362268 P6 WV-1048 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362268 P5 WV-1049 7-7-6
(2'-OMe-DNA-2'-OMe), stereorandom PS rs362268 P10 WV-1050 7-7-6
(2'-OMe-DNA-2'-OMe), stereorandom PS, PO in wings rs362268 P10
WV-1051 6-7-5 (2'-OMe-DNA-2'-OMe), stereorandom PS rs362268 P9
WV-1052 6-7-5 (2'-OMe-DNA-2'-OMe), stereorandom PS, PO in the wings
rs362268 P9 WV-1053 5-7-8 (2'-OMe-DNA-2'-OMe), stereorandom PS
rs362268 P8 WV-1054 5-7-8 (2'-OMe-DNA-2'-OMe), stereorandom PS, PO
in the wings rs362268 P8 WV-1055 5-10-5 (2'-OMe-DNA-2'-OMe),
stereorandom PS, PO in the wings rs362268 P10 WV-1056 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS, PO in the wings rs362268 P9
WV-1057 5-10-5 (2'-OMe-DNA-2'-OMe), stereorandom PS, PO in the
wings rs362268 P8 WV-1058 5-10-5 (2'-OMe-DNA-2'-OMe), stereorandom
PS, PO in the wings rs362268 P7 WV-1059 5-10-5 (2'-OMe-DNA-2'-OMe),
stereorandom PS, PO in the wings rs362268 P6 WV-1060 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS, PO in the wings rs362268 P5
WV-960 All DNA, stereopure, One Rp rs362268 P10 WV-961 All DNA,
stereopure, One Rp rs362268 P9 WV-962 All DNA, stereopure, One Rp
rs362268 P8 WV-963 All DNA, stereopure, One Rp rs362268 P7 WV-964
All DNA, stereopure, One Rp rs362268 P6 WV-965 All DNA, stereopure,
One Rp rs362268 P5
TABLE-US-00011 TABLE N4 Example sequences targeting rs7685686 -
continued (certain features) ONT-450 All DNA, stereorandom PS
rs7685686 P13 ONT-451 All DNA, stereopure, One Rp in DNA between
position 14 and 15 rs7685686 P13 ONT-452 All DNA, stereopure, One
Rp in DNA between position 15 and 16 rs7685686 P13 WV-1077 6-10-4
(2'-OMe-DNA-2'-OMe) Gapmer, stereopure with one rs7685686 P13 Rp in
DNA between position 14 and 15 WV-1078 6-10-4 (2'-OMe-DNA-2'-OMe)
Gapmer, stereopure with one rs7685686 P13 Rp in DNA between
position 14 and 15 and Rp wings WV-1079 8-12 (2'-OMe-DNA) Hemimer,
stereopure with one Rp in DNA rs7685686 P13 between position 14 and
15 and Sp wing WV-1080 8-12 (2'-OMe-DNA) Hemimer, stereopure with
one Rp in DNA rs7685686 P13 between position 14 and 15 and Rp wing
WV-1081 8-12 (2'-OMe-DNA) Hemimer, stereopure with one Rp in DNA
rs7685686 P13 between position 14 and 15 and PO wing WV-1082 6-10-4
(2'-OMe-DNA-2'-OMe), stereopure with one Rp in rs7685686 P13 DNA
between position 14 and 15 and PO wings WV-1083 6-10-4
(2'-OMe-DNA-2'-OMe), stereopure with one Rp in rs7685686 P13 DNA
between position 14 and 15, first and last PS Sp and rest PO wing
WV-1084 6-10-4 (2'-OMe-DNA-2'-OMe), stereopure with one Rp in
rs7685686 P13 DNA between position 14 and 15, first and last PS Rp
and rest PO wing WV-1508 1-5-10-3-1 (DNA/2'-OMe) Gapmer,
Stereopure, one Rp in the rs7685686 P13 core, first and last PS is
Sp, rest is PO in the wing WV-1509 1-5-10-3-1 (DNA/2'-OMe) Gapmer,
Stereorandom, first and last PS, rs7685686 P13 rest is PO in the
wing
[1035] In Table N1-N4, * only represents a stereorandom
phosphorothioate linkage; *S represents an Sp phosphorothioate
linkage, *R represents an Rp phosphorothioate linkage, all
non-labeled linkage is a natural phosphate linkage, m preceding a
base represents 2'-OMe, d2AP represents a 2-amino purine, and dDAP
represents a 2,6-diamino purine.
[1036] In some embodiments, the present disclosure provides
oligonucleotides and/or oligonucleotide compositions that are
useful for treating Huntington's disease, for example, selected
from:
TABLE-US-00012 TABLE N1A Example sequences targeting rs362307 SEQ
ID NO: WV-936 G*SG*SG*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*S 347
A*SC*ST*ST WV-937 G*SG*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*S
348 C*ST*ST*SC WV-938
G*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*S 349 T*ST*SC*SC
WV-939 C*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*S 350
T*SC*SC*SA WV-940 A*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*S
351 C*SC*SA*SA WV-941
C*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*S 352 C*SA*SA*SA
WV-1085 mG*SmG*SmC*SmA*SmC*SA*SA*SG*SG*SG*SC*SA*SC*RA* 353
SG*SmA*SmC*SmU*SmU*SmC WV-1086
mG*RmG*RmC*RmA*RmC*SA*SA*SG*SG*SG*SC*SA*SC*RA* 354
SG*SmA*RmC*RmU*RmU*RmC WV-1087
mGmGmCmAmC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SmAm 355 CmUmUmC WV-1088
mG*SmG*SmC*SmA*SmC*SmA*SmA*SmG*SG*SG*SC*SA*SC* 356
RA*SG*SA*SC*ST*ST*SC WV-1089
mG*RmG*RmC*RmA*RmC*RmA*RmA*RmG*SG*SG*SC*SA*S 357
C*RA*SG*SA*SC*ST*ST*SC WV-1090
mGmGmCmAmCmAmAmG*SG*SG*SC*SA*SC*RA*SG*SA*SC* 358 ST*ST*SC WV-1091
mG*RmGmCmAmC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*Sm 359 AmCmUmU*RmC
WV-1092 mG*SmGmCmAmC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*Sm 360
AmCmUmU*SmC WV-982 G*SC*SA*SG*SG*SG*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*S
361 C*RA*SG*SA WV-983
C*SA*SG*SG*SG*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*R 362 A*SG*SA*SC
WV-984 A*SG*SG*SG*SC*SA*SC*SA*SA*SG*SG*SG*SC*SA*SC*RA*S 363
G*SA*SC*ST WV-985 A*SA*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*SC*S
364 A*SA*SA*SG WV-986
A*SG*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*SC*SA*S 365 A*SA*SG*SG
WV-987 G*SG*SG*SC*SA*SC*RA*SG*SA*SC*ST*ST*SC*SC*SA*SA*S 366
A*SG*SG*SC WV-1510 G*SmGmCmAmC*SA*SA*SG*SG*SG*SC*SA*SC*RA*SG*SmA
367 mCmUmU*SC
TABLE-US-00013 TABLE N2A Example sequences targeting rs362306
WV-952 G*SA*SG*SC*SA*SG*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*S 368
G*SC*SA*SA WV-953 A*SG*SC*SA*SG*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*S
369 C*SA*SA*SC WV-954
G*SC*SA*SG*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*SC*S 370 A*SA*SC*SA
WV-955 C*SA*SG*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*SC*SA*S 371
A*SC*SA*SA WV-956 A*SG*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*SC*SA*SA*S
372 C*SA*SA*SC WV-957
G*SC*ST*SG*SC*SA*RA*SC*SC*ST*SG*SG*SC*SA*SA*SC*S 373 A*SA*SC*SC
TABLE-US-00014 TABLE N3A Example sequences targeting rs362268
WV-960 G*SG*SG*SC*SC*SA*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*S 374
T*SG*SC*SA WV-961 G*SG*SC*SC*SA*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*S
375 G*SC*SA*SG WV-962
G*SC*SC*SA*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*SG*S 376 C*SA*SG*SG
WV-963 C*SC*SA*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*SG*SC*S 377
A*SG*SG*SA WV-964 C*SA*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*SG*SC*SA*S
378 G*SG*SA*SG WV-965
A*SA*SC*SA*SG*SC*RC*SA*SG*SC*SC*ST*SG*SC*SA*SG*S 379 G*SA*SG*SG
TABLE-US-00015 TABLE N4A Example sequences targeting rs7685686
ONT-450 A*T*T*A*A*T*A*A*A*T*T*G*T*C*A*T*C*A*C*C 380 ONT-451
A*ST*ST*SA*SA*ST*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*SC 381 *SA*SC*SC
ONT-452 A*ST*ST*SA*SA*ST*SA*SA*SA*ST*ST*SG*ST*SC*SA*RT*SC 382
*SA*SC*SC WV-1077 mA*SmU*SmU*SmA*SmA*SmU*SA*SA*SA*ST*ST*SG*ST*SC*
383 RA*ST*SmC*SmA*SmC*SmC WV-1078
mA*RmU*RmU*RmA*RmA*RmU*SA*SA*SA*ST*ST*SG*ST*S 384
C*RA*ST*SmC*RmA*RmC*RmC WV-1079
mA*SmU*SmU*SmA*SmA*SmU*SmA*SmA*SA*ST*ST*SG*ST* 385
SC*RA*ST*SC*SA*SC*SC WV-1080
mA*RmU*RmU*RmA*RmA*RmU*RmA*RmA*SA*ST*ST*SG*S 386
T*SC*RA*ST*SC*SA*SC*SC WV-1081
mAmUmUmAmAmUmAmA*SA*ST*ST*SG*ST*SC*RA*ST*SC*S 387 A*SC*SC WV-1082
mAmUmUmAmAmU*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*Sm 388 CmAmCmC WV-1083
mA*SmUmUmAmAmU*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*S 389 mCmAmC*SmC
WV-1084 mA*RmUmUmAmAmU*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*S 390
mCmAmC*RmC WV-1508 A*SmUmUmAmAmU*SA*SA*SA*ST*ST*SG*ST*SC*RA*ST*Sm
391 CmAmC*SC
TABLE-US-00016 TABLE N1A Example sequences targeting rs362307 -
continued WV-936 All DNA, stereopure, One Rp WV-937 All DNA,
stereopure, One Rp WV-938 All DNA, stereopure, One Rp WV-939 All
DNA, stereopure, One Rp WV-940 All DNA, stereopure, One Rp WV-941
All DNA, stereopure, One Rp WV-1085 5-10-5 (2'-OMe-DNA-2'-OMe)
Gapmer, Stereopure, One Rp in DNA WV-1086 5-10-5
(2'-OMe-DNA-2'-OMe) Gapmer, Stereopure, One Rp in DNA and Rp wings
WV-1087 5-10-5 (2'-OMe-DNA-2'-OMe) Gapmer, Stereopure, One Rp in
DNA, PO wings WV-1088 8-12 (2'-OMe-DNA) hemimer, Stereopure, One Rp
in DNA, Sp wing WV-1089 8-12 (2'-OMe-DNA) hemimer, Stereopure, One
Rp in DNA and Rp wing WV-1090 8-12 (2'-OMe-DNA) hemimer,
Srereopure, One Rp in DNA and PO wing WV-1091 5-10-5
(2'-OMe-DNA-2'-OMe) gapmer, Stereopure, One Rp in DNA, First and
last PS as Rp and rest PO wing WV-1092 5-10-5 (2'-OMe-DNA-2'-OMe)
gapmer, Stereopure, One Rp in DNA, First and last PS as Sp and rest
PO wing WV-982 All DNA, stereopure, One Rp WV-983 All DNA,
stereopure, One Rp WV-984 All DNA, stereopure, One Rp WV-985 All
DNA, stereopure, One Rp WV-986 All DNA, stereopure, One Rp WV-987
All DNA, stereopure, One Rp WV-1510 1-4-10-4-1 (DNA/2'-OMe) gapmer,
Stereopure, one Rp in the DNA, first and last nucletotide is DNA
and first and last PS are Sp
TABLE-US-00017 TABLE N2A Example sequences targeting rs362306 -
continued WV-952 All DNA, stereopure, One Rp WV-953 All DNA,
stereopure, One Rp WV-954 All DNA, stereopure, One Rp WV-955 All
DNA, stereopure, One Rp WV-956 All DNA, stereopure, One Rp WV-957
All DNA, stereopure, One Rp
TABLE-US-00018 TABLE N3A Example sequences targeting rs362268 -
continued WV-960 All DNA, stereopure, One Rp WV-961 All DNA,
stereopure, One Rp WV-962 All DNA, stereopure, One Rp WV-963 All
DNA, stereopure, One Rp WV-964 All DNA, stereopure, One Rp WV-965
All DNA, stereopure, One Rp
TABLE-US-00019 TABLE N4A Example sequences targeting rs7685686 -
continued ONT-451 All DNA, stereopure, One Rp in DNA between
position 14 and 15 ONT-452 All DNA, stereopure, One Rp in DNA
between position 15 and 16 WV-1077 6-10-4 (2'-OMe-DNA-2'-OMe)
Gapmer, stereopure with one Rp in DNA between position 14 and 15
WV-1078 6-10-4 (2'-OMe-DNA-2'-OMe) Gapmer, stereopure with one Rp
in DNA between position 14 and 15 and Rp wings WV-1079 8-12
(2'-OMe-DNA) Hemimer, stereopure with one Rp in DNA between
position 14 and 15 and Sp wing WV-1080 8-12 (2'-OMe-DNA) Hemimer,
stereopure with one Rp in DNA between position 14 and 15 and Rp
wing WV-1081 8-12 (2'-OMe-DNA) Hemimer, stereopure with one Rp in
DNA between position 14 and 15 and PO wing WV-1082 6-10-4
(2'-OMe-DNA-2'-OMe), stereopure with one Rp in DNA between position
14 and 15 and PO wings WV-1083 6-10-4 (2'-OMe-DNA-2'-OMe),
stereopure with one Rp in DNA between position 14 and 15, first and
last PS Sp and rest PO wing WV-1084 6-10-4 (2'-OMe-DNA-2'-OMe),
stereopure with one Rp in DNA between position 14 and 15, first and
last PS Rp and rest PO wing WV-1508 1-5-10-3-1 (DNA/2'-OMe) Gapmer,
Stereopure, one Rp in the core, first and last PS is Sp, rest is PO
in the wing
In Table N1A-N4A, * only represents a stereorandom phosphorothioate
linkage; *S represents an Sp phosphorothioate linkage, *R
represents an Rp phosphorothioate linkage, all non-labeled linkage
is a natural phosphate linkage, m preceding a base represents
2'-OMe, d2AP represents a 2-amino purine, and dDAP represents a
2,6-diamino purine.
[1037] In some embodiments, a provided oligonucleotide composition
is a chirally controlled oligonucleotide composition of an
oligonucleotide type listed in Table N1A, Table N2A, Table N3A, and
Table N4A. In some embodiments, a provided composition is of
WV-1092. Each oligonucleotide described herein comprising a HTT
sequence represents an HTT oligonucleotide which was designed,
constructed and tested in various assays, for example, in vitro
assays, in accordance with the present disclosure. For example,
each HTT oligonucleotide listed in any of Tables N1A, N2A, N3A, N4A
and 8, or described elsewhere herein were designed, constructed and
tested in vitro in accordance with the present disclosure. Among
others, every HTT oligonucleotide described herein was tested in a
dual luciferase reporter assay. In some embodiments, HTT
oligonucleotides which were found to be particularly efficacious in
the dual luciferase assay were tested in further in vitro and in
vivo. In some embodiments, a provided composition is selected from:
WVE120101; WV-2603; WV-2595; WV-1510; WV-2378; and WV-2380; each of
which was found to be highly efficacious, for example, as
demonstrated in vitro in the dual luciferase reporter assay in
accordance with the present disclosure. In some embodiments, a
provided composition is selected from: WV-1092; WV-1497; WV-1085;
WV-1086; ONT-905; and WV-2623; each of which was found to be highly
efficacious, for example, as demonstrated in vitro in the dual
luciferase reporter assay in accordance with the present
disclosure. Various additional HTT oligonucleotides were also shown
to be particularly efficacious. In some embodiments, a provided
composition is of WV-1092. In some embodiments, a provided
composition is of WV-1497. In some embodiments, a provided
composition is of WV-1085. In some embodiments, a provided
composition is of WV-1086. In some embodiments, a provided
composition is of ONT-905. In some embodiments, a provided
composition is of WV-2623.
[1038] The present disclosure provides compositions comprising or
consisting of a plurality of provided oligonucleotides (e.g.,
chirally controlled oligonucleotide compositions). In some
embodiments, all such provided oligonucleotides are of the same
type, i.e., all have the same base sequence, pattern of backbone
linkages (i.e., pattern of internucleotidic linkage types, for
example, phosphate, phosphorothioate, etc), pattern of backbone
chiral centers (i.e. pattern of linkage phosphorus stereochemistry
(Rp/Sp)), and pattern of backbone phosphorus modifications (e.g.,
pattern of "--XLR.sup.1" groups in formula I). In some embodiments,
all oligonucleotides of the same type are identical. In many
embodiments, however, provided compositions comprise a plurality of
oligonucleotides types, typically in pre-determined relative
amounts.
[1039] In some embodiments, a provided composition comprises a
predetermined level of an oligonucleotide selected from a Table. In
some embodiments, a provided composition comprises a predetermined
level of an oligonucleotide selected from Tables N1-N4. In some
embodiments, a provided composition comprises a predetermined level
of WV-1092. In some embodiments, a provided composition comprises a
predetermined level of WV-2595. In some embodiments, a provided
composition comprises a predetermined level of WV-2603. In some
embodiments, a provided composition comprises a predetermined level
of mG* SmGmCmAmC* SA* SA* SG* SG* SG* SC* SA* SC*RA* SG* SmAmCmUmU*
SmC (SEQ ID NO: 1554), wherein the oligonucleotide has a free 5'-OH
and 3'-OH, m preceding a base represents 2'-OMe modification in the
nucleoside containing the base, *S represents an Sp
phosphorothioate linkage, *R represents an Rp phosphorothioate
linkage, and all non-labeled linkage is a natural phosphate
linkage. In some embodiments, a provided composition comprises a
predetermined level of mG*SmGmGmUmC*SC*ST*SC*SC*SC*SC*
SC*RA*SG*SmAmGmGmG*S mA (SEQ ID NO: 11), wherein the
oligonucleotide has a free 5'-OH and 3'-OH, m preceding a base
represents 2'-OMe modification in the nucleoside containing the
base, *S represents an Sp phosphorothioate linkage, *R represents
an Rp phosphorothioate linkage, and all non-labeled linkage is a
natural phosphate linkage. In some embodiments, a provided
composition comprises a predetermined level of
mG*SmUmGmCmA*SC*SA*SC*SA*SG*ST*SA*SG*RA*ST*SmGmAmGmG*S mG (SEQ ID
NO: 13), wherein the oligonucleotide has a free 5'-OH and 3'-OH, m
preceding a base represents 2'-OMe modification in the nucleoside
containing the base, *S represents an Sp phosphorothioate linkage,
*R represents an Rp phosphorothioate linkage, and all non-labeled
linkage is a natural phosphate linkage.
[1040] In some embodiments, a provided chirally controlled
oligonucleotide composition is a chirally pure mipomersen
composition. That is to say, in some embodiments, a provided
chirally controlled oligonucleotide composition provides mipomersen
as a single diastereomer with respect to the configuration of the
linkage phosphorus. In some embodiments, a provided chirally
controlled oligonucleotide composition is a chirally uniform
mipomersen composition. That is to say, in some embodiments, every
linkage phosphorus of mipomersen is in the Rp configuration or
every linkage phosphorus of mipomersen is in the Sp
configuration.
[1041] In some embodiments, a provided chirally controlled
oligonucleotide composition comprises a combination of one or more
provided oligonucleotide types. One of skill in the chemical and
medicinal arts will recognize that the selection and amount of each
of the one or more types of provided oligonucleotides in a provided
composition will depend on the intended use of that composition.
That is to say, one of skill in the relevant arts would design a
provided chirally controlled oligonucleotide composition such that
the amounts and types of provided oligonucleotides contained
therein cause the composition as a whole to have certain desirable
characteristics (e.g., biologically desirable, therapeutically
desirable, etc.).
[1042] In some embodiments, a provided chirally controlled
oligonucleotide composition comprises a combination of two or more
provided oligonucleotide types. In some embodiments, a provided
chirally controlled oligonucleotide composition comprises a
combination of three or more provided oligonucleotide types. In
some embodiments, a provided chirally controlled oligonucleotide
composition comprises a combination of four or more provided
oligonucleotide types. In some embodiments, a provided chirally
controlled oligonucleotide composition comprises a combination of
five or more provided oligonucleotide types. In some embodiments, a
provided chirally controlled oligonucleotide composition comprises
a combination of six or more provided oligonucleotide types. In
some embodiments, a provided chirally controlled oligonucleotide
composition comprises a combination of seven or more provided
oligonucleotide types. In some embodiments, a provided chirally
controlled oligonucleotide composition comprises a combination of
eight or more provided oligonucleotide types. In some embodiments,
a provided chirally controlled oligonucleotide composition
comprises a combination of nine or more provided oligonucleotide
types. In some embodiments, a provided chirally controlled
oligonucleotide composition comprises a combination of ten or more
provided oligonucleotide types. In some embodiments, a provided
chirally controlled oligonucleotide composition comprises a
combination of fifteen or more provided oligonucleotide types.
[1043] In some embodiments, a provided chirally controlled
oligonucleotide composition is a combination of an amount of
chirally uniform mipomersen of the Rp configuration and an amount
of chirally uniform mipomersen of the Sp configuration.
[1044] In some embodiments, a provided chirally controlled
oligonucleotide composition is a combination of an amount of
chirally uniform mipomersen of the Rp configuration, an amount of
chirally uniform mipomersen of the Sp configuration, and an amount
of one or more chirally pure mipomersen of a desired diastereomeric
form.
[1045] In some embodiments, a provided oligonucleotide type is
selected from those described in PCT/US2013/050407, which is
incorporated herein by reference. In some embodiments, a provided
chirally controlled oligonucleotide composition comprises
oligonucleotides of an oligonucleotide type selected from those
described in PCT/US2013/050407.
Example Methods for Preparing Oligonucleotides and Compositions
[1046] The present disclosure provides methods for making chirally
controlled oligonucleotides and chirally controlled compositions
comprising one or more specific nucleotide types. In some
embodiments, the phrase "oligonucleotide type," as used herein,
defines an oligonucleotide that has a particular base sequence,
pattern of backbone linkages, pattern of backbone chiral centers,
and pattern of backbone phosphorus modifications (e.g.,
"--XLR.sup.1" groups). Oligonucleotides of a common designated
"type" are structurally identical to one another with respect to
base sequence, pattern of backbone linkages, pattern of backbone
chiral centers, and pattern of backbone phosphorus modifications.
In some embodiments, oligonucleotides of an oligonucleotide type
are identical.
[1047] In some embodiments, a provided chirally controlled
oligonucleotide in the disclosure has properties different from
those of the corresponding stereorandom oligonucleotide mixture. In
some embodiments, a chirally controlled oligonucleotide has
lipophilicity different from that of the stereorandom
oligonucleotide mixture. In some embodiments, a chirally controlled
oligonucleotide has different retention time on HPLC. In some
embodiments, a chirally controlled oligonucleotide may have a peak
retention time significantly different from that of the
corresponding stereorandom oligonucleotide mixture. During
oligonucleotide purification using HPLC as generally practiced in
the art, certain chirally controlled oligonucleotides will be
largely if not totally lost. During oligonucleotide purification
using HPLC as generally practiced in the art, certain chirally
controlled oligonucleotides will be largely if not totally lost.
One of the consequences is that certain diastereomers of a
stereorandom oligonucleotide mixture (certain chirally controlled
oligonucleotides) are not tested in assays. Another consequence is
that from batches to batches, due to the inevitable instrumental
and human errors, the supposedly "pure" stereorandom
oligonucleotide will have inconsistent compositions in that
diastereomers in the composition, and their relative and absolute
amounts, are different from batches to batches. The chirally
controlled oligonucleotide and chirally controlled oligonucleotide
composition provided in this disclosure overcome such problems, as
a chirally controlled oligonucleotide is synthesized in a chirally
controlled fashion as a single diastereomer, and a chirally
controlled oligonucleotide composition comprise predetermined
levels of one or more individual oligonucleotide types.
[1048] One of skill in the chemical and synthetic arts will
appreciate that synthetic methods of the present disclosure provide
for a degree of control during each step of the synthesis of a
provided oligonucleotide such that each nucleotide unit of the
oligonucleotide can be designed and/or selected in advance to have
a particular stereochemistry at the linkage phosphorus and/or a
particular modification at the linkage phosphorus, and/or a
particular base, and/or a particular sugar. In some embodiments, a
provided oligonucleotide is designed and/or selected in advance to
have a particular combination of stereocenters at the linkage
phosphorus of the internucleotidic linkage.
[1049] In some embodiments, a provided oligonucleotide made using
methods of the present disclosure is designed and/or determined to
have a particular combination of linkage phosphorus modifications.
In some embodiments, a provided oligonucleotide made using methods
of the present disclosure is designed and/or determined to have a
particular combination of bases. In some embodiments, a provided
oligonucleotide made using methods of the present disclosure is
designed and/or determined to have a particular combination of
sugars. In some embodiments, a provided oligonucleotide made using
methods of the present disclosure is designed and/or determined to
have a particular combination of one or more of the above
structural characteristics.
[1050] Methods of the present disclosure exhibit a high degree of
chiral control. For instance, methods of the present disclosure
facilitate control of the stereochemical configuration of every
single linkage phosphorus within a provided oligonucleotide. In
some embodiments, methods of the present disclosure provide an
oligonucleotide comprising one or more modified internucleotidic
linkages independently having the structure of formula I.
[1051] In some embodiments, methods of the present disclosure
provide an oligonucleotide which is a mipomersen unimer. In some
embodiments, methods of the present disclosure provide an
oligonucleotide which is a mipomersen unimer of configuration Rp.
In some embodiments, methods of the present disclosure provide an
oligonucleotide which is a mipomersen unimer of configuration
Sp.
[1052] In some embodiments, methods of the present disclosure
provide a chirally controlled oligonucleotide composition, i.e., an
oligonucleotide composition that contains predetermined levels of
individual oligonucleotide types. In some embodiments a chirally
controlled oligonucleotide composition comprises one
oligonucleotide type. In some embodiments, a chirally controlled
oligonucleotide composition comprises more than one oligonucleotide
type. In some embodiments, a chirally controlled oligonucleotide
composition comprises a plurality of oligonucleotide types. Example
chirally controlled oligonucleotide compositions made in accordance
with the present disclosure are described herein.
[1053] In some embodiments, methods of the present disclosure
provide chirally pure mipomersen compositions with respect to the
configuration of the linkage phosphorus. That is to say, in some
embodiments, methods of the present disclosure provide compositions
of mipomersen wherein mipomersen exists in the composition in the
form of a single diastereomer with respect to the configuration of
the linkage phosphorus.
[1054] In some embodiments, methods of the present disclosure
provide chirally uniform mipomersen compositions with respect to
the configuration of the linkage phosphorus. That is to say, in
some embodiments, methods of the present disclosure provide
compositions of mipomersen in which all nucleotide units therein
have the same stereochemistry with respect to the configuration of
the linkage phosphorus, e.g., all nucleotide units are of the Rp
configuration at the linkage phosphorus or all nucleotide units are
of the Sp configuration at the linkage phosphorus.
[1055] In some embodiments, a provided chirally controlled
oligonucleotide is over 50% pure. In some embodiments, a provided
chirally controlled oligonucleotide is over about 55% pure. In some
embodiments, a provided chirally controlled oligonucleotide is over
about 60% pure. In some embodiments, a provided chirally controlled
oligonucleotide is over about 65% pure. In some embodiments, a
provided chirally controlled oligonucleotide is over about 70%
pure. In some embodiments, a provided chirally controlled
oligonucleotide is over about 75% pure. In some embodiments, a
provided chirally controlled oligonucleotide is over about 80%
pure. In some embodiments, a provided chirally controlled
oligonucleotide is over about 85% pure. In some embodiments, a
provided chirally controlled oligonucleotide is over about 90%
pure. In some embodiments, a provided chirally controlled
oligonucleotide is over about 91% pure. In some embodiments, a
provided chirally controlled oligonucleotide is over about 92%
pure. In some embodiments, a provided chirally controlled
oligonucleotide is over about 93% pure. In some embodiments, a
provided chirally controlled oligonucleotide is over about 94%
pure. In some embodiments, a provided chirally controlled
oligonucleotide is over about 95% pure. In some embodiments, a
provided chirally controlled oligonucleotide is over about 96%
pure. In some embodiments, a provided chirally controlled
oligonucleotide is over about 97% pure. In some embodiments, a
provided chirally controlled oligonucleotide is over about 98%
pure. In some embodiments, a provided chirally controlled
oligonucleotide is over about 99% pure. In some embodiments, a
provided chirally controlled oligonucleotide is over about 99.5%
pure. In some embodiments, a provided chirally controlled
oligonucleotide is over about 99.6% pure. In some embodiments, a
provided chirally controlled oligonucleotide is over about 99.7%
pure. In some embodiments, a provided chirally controlled
oligonucleotide is over about 99.8% pure. In some embodiments, a
provided chirally controlled oligonucleotide is over about 99.9%
pure. In some embodiments, a provided chirally controlled
oligonucleotide is over at least about 99% pure.
[1056] In some embodiments, a chirally controlled oligonucleotide
composition is a composition designed to comprise a single
oligonucleotide type. In certain embodiments, such compositions are
about 50% diastereomerically pure. In some embodiments, such
compositions are about 50% diastereomerically pure. In some
embodiments, such compositions are about 50% diastereomerically
pure. In some embodiments, such compositions are about 55%
diastereomerically pure. In some embodiments, such compositions are
about 60% diastereomerically pure. In some embodiments, such
compositions are about 65% diastereomerically pure. In some
embodiments, such compositions are about 70% diastereomerically
pure. In some embodiments, such compositions are about 75%
diastereomerically pure. In some embodiments, such compositions are
about 80% diastereomerically pure. In some embodiments, such
compositions are about 85% diastereomerically pure. In some
embodiments, such compositions are about 90% diastereomerically
pure. In some embodiments, such compositions are about 91%
diastereomerically pure. In some embodiments, such compositions are
about 92% diastereomerically pure. In some embodiments, such
compositions are about 93% diastereomerically pure. In some
embodiments, such compositions are about 94% diastereomerically
pure. In some embodiments, such compositions are about 95%
diastereomerically pure. In some embodiments, such compositions are
about 96% diastereomerically pure. In some embodiments, such
compositions are about 97% diastereomerically pure. In some
embodiments, such compositions are about 98% diastereomerically
pure. In some embodiments, such compositions are about 99%
diastereomerically pure. In some embodiments, such compositions are
about 99.5% diastereomerically pure. In some embodiments, such
compositions are about 99.6% diastereomerically pure. In some
embodiments, such compositions are about 99.7% diastereomerically
pure. In some embodiments, such compositions are about 99.8%
diastereomerically pure. In some embodiments, such compositions are
about 99.9% diastereomerically pure. In some embodiments, such
compositions are at least about 99% diastereomerically pure.
[1057] Among other things, the present disclosure recognizes the
challenge of stereoselective (rather than stereorandom or racemic)
preparation of oligonucleotides. Among other things, the present
disclosure provides methods and reagents for stereoselective
preparation of oligonucleotides comprising multiple (e.g., more
than 5, 6, 7, 8, 9, or 10) internucleotidic linkages, and
particularly for oligonucleotides comprising multiple (e.g., more
than 5, 6, 7, 8, 9, or 10) chiral internucleotidic linkages. In
some embodiments, in a stereorandom or racemic preparation of
oligonucleotides, at least one chiral internucleotidic linkage is
formed with less than 90:10, 95:5, 96:4, 97:3, or 98:2
diastereoselectivity. In some embodiments, for a stereoselective or
chirally controlled preparation of oligonucleotides, each chiral
internucleotidic linkage is formed with greater than 90:10, 95:5,
96:4, 97:3, or 98:2 diastereoselectivity. In some embodiments, for
a stereoselective or chirally controlled preparation of
oligonucleotides, each chiral internucleotidic linkage is formed
with greater than 95:5 diastereoselectivity. In some embodiments,
for a stereoselective or chirally controlled preparation of
oligonucleotides, each chiral internucleotidic linkage is formed
with greater than 96:4 diastereoselectivity. In some embodiments,
for a stereoselective or chirally controlled preparation of
oligonucleotides, each chiral internucleotidic linkage is formed
with greater than 97:3 diastereoselectivity. In some embodiments,
for a stereoselective or chirally controlled preparation of
oligonucleotides, each chiral internucleotidic linkage is formed
with greater than 98:2 diastereoselectivity. In some embodiments,
for a stereoselective or chirally controlled preparation of
oligonucleotides, each chiral internucleotidic linkage is formed
with greater than 99:1 diastereoselectivity. In some embodiments,
diastereoselectivity of a chiral internucleotidic linkage in an
oligonucleotide may be measured through a model reaction, e.g.
formation of a dimer under essentially the same or comparable
conditions wherein the dimer has the same internucleotidic linkage
as the chiral internucleotidic linkage, the 5'-nucleoside of the
dimer is the same as the nucleoside to the 5'-end of the chiral
internucleotidic linkage, and the 3'-nucleoside of the dimer is the
same as the nucleoside to the 3'-end of the chiral internucleotidic
linkage.
[1058] In some embodiments, a chirally controlled oligonucleotide
composition is a composition designed to comprise multiple
oligonucleotide types. In some embodiments, methods of the present
disclosure allow for the generation of a library of chirally
controlled oligonucleotides such that a pre-selected amount of any
one or more chirally controlled oligonucleotide types can be mixed
with any one or more other chirally controlled oligonucleotide
types to create a chirally controlled oligonucleotide composition.
In some embodiments, the pre-selected amount of an oligonucleotide
type is a composition having any one of the above-described
diastereomeric purities.
[1059] In some embodiments, the present disclosure provides methods
for making a chirally controlled oligonucleotide comprising steps
of:
[1060] (1) coupling;
[1061] (2) capping;
[1062] (3) modifying;
[1063] (4) deblocking; and
[1064] (5) repeating steps (1)-(4) until a desired length is
achieved.
[1065] When describing the provided methods, the word "cycle" has
its ordinary meaning as understood by a person of ordinary skill in
the art. In some embodiments, one round of steps (1)-(4) is
referred to as a cycle.
[1066] In some embodiments, the present disclosure provides methods
for making chirally controlled oligonucleotide compositions,
comprising steps of:
[1067] (a) providing an amount of a first chirally controlled
oligonucleotide; and
[1068] (b) optionally providing an amount of one or more additional
chirally controlled oligonucleotides.
[1069] In some embodiments, a first chirally controlled
oligonucleotide is an oligonucleotide type, as described herein. In
some embodiments, a one or more additional chirally controlled
oligonucleotide is a one or more oligonucleotide type, as described
herein.
[1070] One of skill in the relevant chemical and synthetic arts
will recognize the degree of versatility and control over
structural variation and stereochemical configuration of a provided
oligonucleotide when synthesized using methods of the present
disclosure. For instance, after a first cycle is complete, a
subsequent cycle can be performed using a nucleotide unit
individually selected for that subsequent cycle which, in some
embodiments, comprises a nucleobase and/or a sugar that is
different from the first cycle nucleobase and/or sugar. Likewise,
the chiral auxiliary used in the coupling step of the subsequent
cycle can be different from the chiral auxiliary used in the first
cycle, such that the second cycle generates a phosphorus linkage of
a different stereochemical configuration. In some embodiments, the
stereochemistry of the linkage phosphorus in the newly formed
internucleotidic linkage is controlled by using stereochemically
pure phosphoramidites. Additionally, the modification reagent used
in the modifying step of a subsequent cycle can be different from
the modification reagent used in the first or former cycle. The
cumulative effect of this iterative assembly approach is such that
each component of a provided oligonucleotide can be structurally
and configurationally tailored to a high degree. An additional
advantage to this approach is that the step of capping minimizes
the formation of "n-1" impurities that would otherwise make
isolation of a provided oligonucleotide extremely challenging, and
especially oligonucleotides of longer lengths.
[1071] In some embodiments, an example cycle of the method for
making chirally controlled oligonucleotides is illustrated in
example schemes described in the present disclosure. In some
embodiments, an example cycle of the method for making chirally
controlled oligonucleotides is illustrated in Scheme I. In some
embodiments,
##STR00222##
represents the solid support, and optionally a portion of the
growing chirally controlled oligonucleotide attached to the solid
support. The chiral auxiliary exemplified has the structure of
formula 3-I:
##STR00223##
which is further described below. "Cap" is any chemical moiety
introduced to the nitrogen atom by the capping step, and in some
embodiments, is an amino protecting group. One of ordinary skill in
the art understands that in the first cycle, there may be only one
nucleoside attached to the solid support when started, and cycle
exit can be performed optionally before deblocking. As understood
by a person of skill in the art, B.sup.PRO is a protected base used
in oligonucleotide synthesis. Each step of the above-depicted cycle
of Scheme I is described further below.
##STR00224##
Synthesis on Solid Support
[1072] In some embodiments, the synthesis of a provided
oligonucleotide is performed on solid phase. In some embodiments,
reactive groups present on a solid support are protected. In some
embodiments, reactive groups present on a solid support are
unprotected. During oligonucleotide synthesis a solid support is
treated with various reagents in several synthesis cycles to
achieve the stepwise elongation of a growing oligonucleotide chain
with individual nucleotide units. The nucleoside unit at the end of
the chain which is directly linked to the solid support is termed
"the first nucleoside" as used herein. A first nucleoside is bound
to a solid support via a linker moiety, i.e. a diradical with
covalent bonds between either of a CPG, a polymer or other solid
support and a nucleoside. The linker stays intact during the
synthesis cycles performed to assemble the oligonucleotide chain
and is cleaved after the chain assembly to liberate the
oligonucleotide from the support.
[1073] Solid supports for solid-phase nucleic acid synthesis
include the supports described in, e.g., U.S. Pat. Nos. 4,659,774,
5,141,813, 4,458,066; Caruthers U.S. Pat. Nos. 4,415,732,
4,458,066, 4,500,707, 4,668,777, 4,973,679, and 5,132,418; Andrus
et al. U.S. Pat. Nos. 5,047,524, 5,262,530; and Koster U.S. Pat.
No. 4,725,677 (reissued as RE34,069). In some embodiments, a solid
phase is an organic polymer support. In some embodiments, a solid
phase is an inorganic polymer support. In some embodiments, an
organic polymer support is polystyrene, aminomethyl polystyrene, a
polyethylene glycol-polystyrene graft copolymer, polyacrylamide,
polymethacrylate, polyvinylalcohol, highly cross-linked polymer
(HCP), or other synthetic polymers, carbohydrates such as cellulose
and starch or other polymeric carbohydrates, or other organic
polymers and any copolymers, composite materials or combination of
the above inorganic or organic materials. In some embodiments, an
inorganic polymer support is silica, alumina, controlled polyglass
(CPG), which is a silica-gel support, or aminopropyl CPG. Other
useful solid supports include fluorous solid supports (see e.g.,
WO/2005/070859), long chain alkylamine (LCAA) controlled pore glass
(CPG) solid supports (see e.g., S. P. Adams, K. S. Kavka, E. J.
Wykes, S. B. Holder and G. R. Galluppi, J. Am. Chem. Soc., 1983,
105, 661-663; G. R. Gough, M. J. Bruden and P. T. Gilham,
Tetrahedron Lett., 1981, 22, 4177-4180). Membrane supports and
polymeric membranes (see e.g. Innovation and Perspectives in Solid
Phase Synthesis, Peptides, Proteins and Nucleic Acids, ch 21 pp
157-162, 1994, Ed. Roger Epton and U.S. Pat. No. 4,923,901) are
also useful for the synthesis of nucleic acids. Once formed, a
membrane can be chemically functionalized for use in nucleic acid
synthesis. In addition to the attachment of a functional group to
the membrane, the use of a linker or spacer group attached to the
membrane is also used in some embodiments to minimize steric
hindrance between the membrane and the synthesized chain.
[1074] Other suitable solid supports include those generally known
in the art to be suitable for use in solid phase methodologies,
including, for example, glass sold as Primer.TM. 200 support,
controlled pore glass (CPG), oxalyl-controlled pore glass (see,
e.g., Alul, et al., Nucleic Acids Research, 1991, 19, 1527),
TentaGel Support--an aminopolyethyleneglycol derivatized support
(see, e.g., Wright, et al., Tetrahedron Lett., 1993, 34, 3373), and
Poros-a copolymer of polystyrene/divinylbenzene.
[1075] Surface activated polymers have been demonstrated for use in
synthesis of natural and modified nucleic acids and proteins on
several solid supports mediums. A solid support material can be any
polymer suitably uniform in porosity, having sufficient amine
content, and sufficient flexibility to undergo any attendant
manipulations without losing integrity. Examples of suitable
selected materials include nylon, polypropylene, polyester,
polytetrafluoroethylene, polystyrene, polycarbonate, and
nitrocellulose. Other materials can serve as a solid support,
depending on the design of the investigator. In consideration of
some designs, for example, a coated metal, in particular gold or
platinum can be selected (see e.g., US publication No.
20010055761). In one embodiment of oligonucleotide synthesis, for
example, a nucleoside is anchored to a solid support which is
functionalized with hydroxyl or amino residues. Alternatively, a
solid support is derivatized to provide an acid labile
trialkoxytrityl group, such as a trimethoxytrityl group (TMT).
Without being bound by theory, it is expected that the presence of
a trialkoxytrityl protecting group will permit initial
detritylation under conditions commonly used on DNA synthesizers.
For a faster release of oligonucleotide material in solution with
aqueous ammonia, a diglycoate linker is optionally introduced onto
the support.
[1076] In some embodiments, a provided oligonucleotide
alternatively is synthesized from the 5' to 3' direction. In some
embodiments, a nucleic acid is attached to a solid support through
its 5' end of the growing nucleic acid, thereby presenting its 3'
group for reaction, i.e. using 5'-nucleoside phosphoramidites or in
enzymatic reaction (e.g. ligation and polymerization using
nucleoside 5'-triphosphates). When considering the 5' to 3'
synthesis the iterative steps of the present disclosure remain
unchanged (i.e. capping and modification on the chiral
phosphorus).
Linking Moiety
[1077] A linking moiety or linker is optionally used to connect a
solid support to a compound comprising a free nucleophilic moiety.
Suitable linkers are known such as short molecules which serve to
connect a solid support to functional groups (e.g., hydroxyl
groups) of initial nucleosides molecules in solid phase synthetic
techniques. In some embodiments, the linking moiety is a succinamic
acid linker, or a succinate linker
(--CO--CH.sub.2--CH.sub.2--CO--), or an oxalyl linker (--CO--CO--).
In some embodiments, the linking moiety and the nucleoside are
bonded together through an ester bond. In some embodiments, a
linking moiety and a nucleoside are bonded together through an
amide bond. In some embodiments, a linking moiety connects a
nucleoside to another nucleotide or nucleic acid. Suitable linkers
are disclosed in, for example, Oligonucleotides And Analogues A
Practical Approach, Ekstein, F. Ed., IRL Press, N.Y., 1991, Chapter
1 and Solid-Phase Supports for Oligonucleotide Synthesis, Pon, R.
T., Curr. Prot. Nucleic Acid Chem., 2000, 3.1.1-3.1.28.
[1078] A linker moiety is used to connect a compound comprising a
free nucleophilic moiety to another nucleoside, nucleotide, or
nucleic acid. In some embodiments, a linking moiety is a
phosphodiester linkage. In some embodiments, a linking moiety is an
H-phosphonate moiety. In some embodiments, a linking moiety is a
modified phosphorus linkage as described herein. In some
embodiments, a universal linker (UnyLinker) is used to attached the
oligonucleotide to the solid support (Ravikumar et al., Org.
Process Res. Dev., 2008, 12 (3), 399-410). In some embodiments,
other universal linkers are used (Pon, R. T., Curr. Prot. Nucleic
Acid Chem., 2000, 3.1.1-3.1.28). In some embodiments, various
orthogonal linkers (such as disulfide linkers) are used (Pon, R.
T., Curr. Prot. Nucleic Acid Chem., 2000, 3.1.1-3.1.28).
[1079] Among other things, the present disclosure recognizes that a
linker can be chosen or designed to be compatible with a set of
reaction conditions employed in oligonucleotide synthesis. In some
embodiments, to avoid degradation of oligonucleotides and to avoid
desulfurization, auxiliary groups are selectively removed before
de-protection. In some embodiments, DPSE group can selectively be
removed by F.sup.- ions. In some embodiments, the present
disclosure provides linkers that are stable under a DPSE
de-protection condition, e.g., 0.1M TBAF in MeCN, 0.5M HF-Et.sub.3N
in THF or MeCN, etc. In some embodiments, a provided linker is the
SP linker. In some embodiments, the present disclosure demonstrates
that the SP linker is stable under a DPSE de-protection condition,
e.g., 0.1M TBAF in MeCN, 0.5M HF-Et.sub.3N in THF or MeCN, etc.;
they are also stable, e.g., under anhydrous basic conditions, such
as om1M DBU in MeCN.
##STR00225##
In some embodiments, an example linker is:
##STR00226##
In some embodiments, the succinyl linker, Q-linker or oxalyl linker
is not stable to one or more DPSE-deprotection conditions using
F.sup.-.
General Conditions--Solvents for Synthesis
[1080] Syntheses of provided oligonucleotides are generally
performed in aprotic organic solvents. In some embodiments, a
solvent is a nitrile solvent such as, e.g., acetonitrile. In some
embodiments, a solvent is a basic amine solvent such as, e.g.,
pyridine. In some embodiments, a solvent is an ethereal solvent
such as, e.g., tetrahydrofuran. In some embodiments, a solvent is a
halogenated hydrocarbon such as, e.g., dichloromethane. In some
embodiments, a mixture of solvents is used. In certain embodiments
a solvent is a mixture of any one or more of the above-described
classes of solvents.
[1081] In some embodiments, when an aprotic organic solvent is not
basic, a base is present in the reacting step. In some embodiments
where a base is present, the base is an amine base such as, e.g.,
pyridine, quinoline, or N,N-dimethylaniline. Examples of other
amine bases include pyrrolidine, piperidine, N-methyl pyrrolidine,
pyridine, quinoline, N,N-dimethylaminopyridine (DMAP), or
N,N-dimethylaniline.
[1082] In some embodiments, a base is other than an amine base.
[1083] In some embodiments, an aprotic organic solvent is
anhydrous. In some embodiments, an anhydrous aprotic organic
solvent is freshly distilled. In some embodiments, a freshly
distilled anhydrous aprotic organic solvent is a basic amine
solvent such as, e.g., pyridine. In some embodiments, a freshly
distilled anhydrous aprotic organic solvent is an ethereal solvent
such as, e.g., tetrahydrofuran. In some embodiments, a freshly
distilled anhydrous aprotic organic solvent is a nitrile solvent
such as, e.g., acetonitrile.
Chiral Reagent/Chiral Auxiliary
[1084] In some embodiments, chiral reagents are used to confer
stereoselectivity in the production of chirally controlled
olignucleotides. Many different chiral reagents, also referred to
by those of skill in the art and herein as chiral auxiliaries, may
be used in accordance with methods of the present disclosure.
Examples of such chiral reagents are described herein and in Wada
I, II and III, referenced above. In certain embodiments, a chiral
reagent is as described by Wada I. In some embodiments, a chiral
reagent for use in accordance with the methods of the present
disclosure are of Formula 3-I, below:
##STR00227##
wherein W.sup.1 and W.sup.2 are any of --O--, --S--, or
--NG.sup.5-, U.sub.1 and U.sub.3 are carbon atoms which are bonded
to U.sub.2 if present, or to each other if r is 0, via a single,
double or triple bond. U.sub.2 is --C--, --CG.sup.8-,
--CG.sup.8G.sup.8-, --NG.sup.8-, --N--, --O--, or --S-- where r is
an integer of 0 to 5 and no more than two heteroatoms are adjacent.
When any one of U.sub.2 is C, a triple bond must be formed between
a second instance of U.sub.2, which is C, or to one of U.sub.1 or
U.sub.3. Similarly, when any one of U.sub.2 is CG.sup.8, a double
bond is formed between a second instance of U.sub.2 which is
--CG.sup.8- or --N--, or to one of U.sub.1 or U.sub.3.
[1085] In some embodiments,
--U.sub.1(G.sub.3G.sub.4)-(U.sub.2).sub.r--U.sub.3(G.sub.1G.sub.2)-
is -CG.sup.3G.sup.4-CG.sup.1G.sup.2-. In some embodiments,
--U.sub.1--(U.sub.2).sub.r--U.sub.3-- is --CG.sup.3=CG.sup.1-. In
some embodiments, --U.sub.1--(U.sub.2).sub.r--U.sub.3-- is
--C.ident.C--. In some embodiments,
--U.sub.1--(U.sub.2).sub.r--U.sub.3-- is
--CG.sup.3=CG-CG.sup.1G.sup.2-. In some embodiments,
--U.sub.1--(U.sub.2).sub.r--U.sub.3-- is
--CG.sup.3G.sup.4-O-CG.sup.1G.sup.2-. In some embodiments,
--U.sub.1--(U.sub.2).sub.r--U.sub.3-- is
--CG.sup.3G.sup.4-NG-CG.sup.1G.sup.2-. In some embodiments,
--U.sub.1--(U.sub.2).sub.r--U.sub.3-- is
--CG.sup.3G.sup.4-N-CG.sup.2-. In some embodiments,
--U.sub.1--(U.sub.2).sub.r--U.sub.3-- is --CG.sup.3G.sup.4-N.dbd.C
G.sup.8-CG.sup.1G.sup.2-.
[1086] As defined herein, G.sup.1, G.sup.2, G.sup.3, G.sup.4,
G.sup.5, and G.sup.8 are independently hydrogen, or an optionally
substituted group selected from alkyl, aralkyl, cycloalkyl,
cycloalkylalkyl, heterocyclyl, heteroaryl, and aryl; or two of
G.sup.1, G.sup.2, G.sup.3, G.sup.4, and G.sup.5 are G.sup.6 (taken
together to form an optionally substituted, saturated, partially
unsaturated or unsaturated carbocyclic or heteroatom-containing
ring of up to about 20 ring atoms which is monocyclic or
polycyclic, and is fused or unfused). In some embodiments, a ring
so formed is substituted by oxo, thioxo, alkyl, alkenyl, alkynyl,
heteroaryl, or aryl moieties. In some embodiments, when a ring
formed by taking two G.sup.6 together is substituted, it is
substituted by a moiety which is bulky enough to confer
stereoselectivity during the reaction.
[1087] In some embodiments, a ring formed by taking two of G.sup.6
together is optionally substituted cyclopentyl, pyrrolyl,
cyclopropyl, cyclohexenyl, cyclopentenyl, tetrahydropyranyl, or
piperazinyl. In some embodiments, a ring formed by taking two of
G.sup.6 together is optionally substituted cyclopentyl, pyrrolyl,
cyclopropyl, cyclohexenyl, cyclopentenyl, tetrahydropyranyl,
pyrrolidinyl, or piperazinyl.
[1088] In some embodiments, G.sup.1 is optionally substituted
phenyl. In some embodiments, G.sup.1 is phenyl. In some
embodiments, G.sup.2 is methyl or hydrogen. In some embodiments,
G.sup.1 is optionally substituted phenyl and G.sup.2 is methyl. In
some embodiments, G.sup.1 is phenyl and G.sup.2 is methyl.
[1089] In some embodiments, r is 0.
[1090] In some embodiments, W.sup.1 is --NG.sup.5-. In some
embodiments, one of G.sup.3 and G.sup.4 is taken together with
G.sup.5 to form an optionally substituted pyrrolidinyl ring. In
some embodiments, one of G.sup.3 and G.sup.4 is taken together with
G.sup.5 to form a pyrrolidinyl ring.
[1091] In some embodiments, W.sup.2 is --O--.
[1092] In some embodiments, a chiral reagent is a compound of
Formula 3-AA:
##STR00228##
wherein each variable is independently as defined above and
described herein.
[1093] In some embodiments of Formula 3AA, W.sup.1 and W.sup.2 are
independently --NG.sup.5-, --O--, or --S--; G.sup.1, G.sup.2,
G.sup.3, G.sup.4, and G.sup.5 are independently hydrogen, or an
optionally substituted group selected from alkyl, aralkyl,
cycloalkyl, cycloalkylalkyl, heterocyclyl, heteroaryl, or aryl; or
two of G.sup.1, G.sup.2, G.sup.3, G.sup.4, and G.sup.5 are G.sup.6
(taken together to form an optionally substituted saturated,
partially unsaturated or unsaturated carbocyclic or
heteroatom-containing ring of up to about 20 ring atoms which is
monocyclic or polycyclic, fused or unfused), and no more than four
of G.sup.1, G.sup.2, G.sup.3, G.sup.4, and G.sup.5 are G.sup.6.
Similarly to the compounds of Formula 3-I, any of G.sup.1, G.sup.2,
G.sup.3, G.sup.4, or G.sup.5 are optionally substituted by oxo,
thioxo, alkyl, alkenyl, alkynyl, heteroaryl, or aryl moieties. In
some embodiments, such substitution induces stereoselectivity in
chirally controlled oligonucleotide production.
[1094] In some embodiments, a provided chiral reagent has the
structure of
##STR00229##
In some embodiments, a provided chiral reagent has the structure
of
##STR00230##
In some embodiments, a provided chiral reagent has the structure
of
##STR00231##
In some embodiments, a provided chiral reagent has the structure
of
##STR00232##
In some embodiments, a provided chiral reagent has the structure
of
##STR00233##
In some embodiments, a provided chiral reagent has the structure
of
##STR00234##
In some embodiments, a provided chiral reagent has the structure
of
##STR00235##
In some embodiments, a provided chiral reagent has the structure
of
##STR00236##
[1095] In some embodiments, W.sup.1 is --NG.sup.5, W.sup.2 is O,
each of G.sup.1 and G.sup.3 is independently hydrogen or an
optionally substituted group selected from C.sub.1-10 aliphatic,
heterocyclyl, heteroaryl and aryl, G.sup.2 is
--C(R).sub.2Si(R).sub.3, and G.sup.4 and G.sup.5 are taken together
to form an optionally substituted saturated, partially unsaturated
or unsaturated heteroatom-containing ring of up to about 20 ring
atoms which is monocyclic or polycyclic, fused or unfused. In some
embodiments, each R is independently hydrogen, or an optionally
substituted group selected from C.sub.1-C.sub.6 aliphatic,
carbocyclyl, aryl, heteroaryl, and heterocyclyl. In some
embodiments, G.sup.2 is --C(R).sub.2Si(R).sub.3, wherein
--C(R).sub.2-- is optionally substituted --CH.sub.2--, and each R
of --Si(R).sub.3 is independently an optionally substituted group
selected from C.sub.1-10 aliphatic, heterocyclyl, heteroaryl and
aryl. In some embodiments, at least one R of --Si(R).sub.3 is
independently optionally substituted C.sub.1-10 alkyl. In some
embodiments, at least one R of --Si(R).sub.3 is independently
optionally substituted phenyl. In some embodiments, one R of
--Si(R).sub.3 is independently optionally substituted phenyl, and
each of the other two R is independently optionally substituted
C.sub.1-10 alkyl. In some embodiments, one R of --Si(R).sub.3 is
independently optionally substituted C.sub.1-10 alkyl, and each of
the other two R is independently optionally substituted phenyl. In
some embodiments, G.sup.2 is optionally substituted
--CH.sub.2Si(Ph)(Me).sub.2. In some embodiments, G.sup.2 is
optionally substituted --CH.sub.2Si(Me)(Ph).sub.2. In some
embodiments, G.sup.2 is --CH.sub.2Si(Me)(Ph).sub.2. In some
embodiments, G.sup.4 and G.sup.5 are taken together to form an
optionally substituted saturated 5-6 membered ring containing one
nitrogen atom (to which G.sup.5 is attached). In some embodiments,
G.sup.4 and G.sup.5 are taken together to form an optionally
substituted saturated 5-membered ring containing one nitrogen atom.
In some embodiments, G.sup.1 is hydrogen. In some embodiments,
G.sup.3 is hydrogen. In some embodiments, both G.sup.1 and G.sup.3
are hydrogen.
[1096] In some embodiments, a chiral reagent has one of the
following formulae:
##STR00237##
[1097] In some embodiments, a chiral reagent is an aminoalcohol. In
some embodiments, a chiral reagent is an aminothiol. In some
embodiments, a chiral reagent is an aminophenol. In some
embodiments, a chiral reagent is (S)- and
(R)-2-methylamino-1-phenylethanol, (1R,2S)-ephedrine, or
(1R,2S)-2-methylamino-1,2-diphenylethanol.
[1098] In some embodiments of the disclosure, a chiral reagent is a
compound of one of the following formulae:
##STR00238##
[1099] As demonstrated herein, when used for preparing a chiral
internucleotidic linkage, to obtain stereoselectivity generally
stereochemically pure chiral reagents are utilized. Among other
things, the present disclosure provides stereochemically pure
chiral reagents, including those having structures described.
[1100] The choice of chiral reagent, for example, the isomer
represented by Formula Q or its stereoisomer, Formula R, permits
specific control of chirality at a linkage phosphorus. Thus, either
an Rp or Sp configuration can be selected in each synthetic cycle,
permitting control of the overall three dimensional structure of a
chirally controlled oligonucleotide. In some embodiments, a
chirally controlled oligonucleotide has all Rp stereocenters. In
some embodiments of the disclosure, a chirally controlled
oligonucleotide has all Sp stereocenters. In some embodiments of
the disclosure, each linkage phosphorus in the chirally controlled
oligonucleotide is independently Rp or Sp. In some embodiments of
the disclosure, each linkage phosphorus in the chirally controlled
oligonucleotide is independently Rp or Sp, and at least one is Rp
and at least one is Sp. In some embodiments, the selection of Rp
and Sp centers is made to confer a specific three dimensional
superstructure to a chirally controlled oligonucleotide. Examples
of such selections are described in further detail herein.
[1101] In some embodiments, a chiral reagent for use in accordance
with the present disclosure is selected for its ability to be
removed at a particular step in the above-depicted cycle. For
example, in some embodiments it is desirable to remove a chiral
reagent during the step of modifying the linkage phosphorus. In
some embodiments, it is desirable to remove a chiral reagent before
the step of modifying the linkage phosphorus. In some embodiments,
it is desirable to remove a chiral reagent after the step of
modifying the linkage phosphorus. In some embodiments, it is
desirable to remove a chiral reagent after a first coupling step
has occurred but before a second coupling step has occurred, such
that a chiral reagent is not present on the growing oligonucleotide
during the second coupling (and likewise for additional subsequent
coupling steps). In some embodiments, a chiral reagent is removed
during the "deblock" reaction that occurs after modification of the
linkage phosphorus but before a subsequent cycle begins. Example
methods and reagents for removal are described herein.
[1102] In some embodiments, removal of chiral auxiliary is achieved
when performing the modification and/or deblocking step, as
illustrated in Scheme I. It can be beneficial to combine chiral
auxiliary removal together with other transformations, such as
modification and deblocking. A person of ordinary skill in the art
would appreciate that the saved steps/transformation could improve
the overall efficiency of synthesis, for instance, with respect to
yield and product purity, especially for longer oligonucleotides.
One example wherein the chiral auxiliary is removed during
modification and/or deblocking is illustrated in Scheme I.
[1103] In some embodiments, a chiral reagent for use in accordance
with methods of the present disclosure is characterized in that it
is removable under certain conditions. For instance, in some
embodiments, a chiral reagent is selected for its ability to be
removed under acidic conditions. In certain embodiments, a chiral
reagent is selected for its ability to be removed under mildly
acidic conditions. In certain embodiments, a chiral reagent is
selected for its ability to be removed by way of an E1 elimination
reaction (e.g., removal occurs due to the formation of a cation
intermediate on the chiral reagent under acidic conditions, causing
the chiral reagent to cleave from the oligonucleotide). In some
embodiments, a chiral reagent is characterized in that it has a
structure recognized as being able to accommodate or facilitate an
E1 elimination reaction. One of skill in the relevant arts will
appreciate which structures would be envisaged as being prone
toward undergoing such elimination reactions.
[1104] In some embodiments, a chiral reagent is selected for its
ability to be removed with a nucleophile. In some embodiments, a
chiral reagent is selected for its ability to be removed with an
amine nucleophile. In some embodiments, a chiral reagent is
selected for its ability to be removed with a nucleophile other
than an amine.
[1105] In some embodiments, a chiral reagent is selected for its
ability to be removed with a base. In some embodiments, a chiral
reagent is selected for its ability to be removed with an amine. In
some embodiments, a chiral reagent is selected for its ability to
be removed with a base other than an amine.
[1106] Additional chiral auxiliaries and their use can be found in
e.g., Wada I (JP4348077; WO2005/014609; WO2005/092909), Wada II
(WO2010/064146), Wada III (WO2012/039448), Chiral Control
(WO2010/064146), etc.
Activation
[1107] An achiral H-phosphonate moiety is treated with the first
activating reagent to form the first intermediate. In one
embodiment, the first activating reagent is added to the reaction
mixture during the condensation step. Use of the first activating
reagent is dependent on reaction conditions such as solvents that
are used for the reaction. Examples of the first activating reagent
are phosgene, trichloromethyl chloroformate,
bis(trichloromethyl)carbonate (BTC), oxalyl chloride,
Ph.sub.3PCl.sub.2, (PhO).sub.3PCl.sub.2,
N,N'-bis(2-oxo-3-oxazolidinyl)phosphinic chloride (BopCl),
1,3-dimethyl-2-(3-nitro-1,2,4-triazol-1-yl)-2-pyrrolidin-1-yl-1,3,2-diaza-
phospholidinium hexafluorophosphate (MNTP), or
3-nitro-1,2,4-triazol-1-yl-tris(pyrrolidin-1-yl)phosphonium
hexafluorophosphate (PyNTP).
[1108] The example of achiral H-phosphonate moiety is a compound
shown in the above Scheme. DBU represents
1,8-diazabicyclo[5.4.0]undec-7-ene. H.sup.+DBU may be, for example,
ammonium ion, alkylammonium ion, heteroaromatic iminium ion, or
heterocyclic iminium ion, any of which is primary, secondary,
tertiary or quaternary, or a monovalent metal ion.
Reacting with Chiral Reagent
[1109] After the first activation step, the activated achiral
H-phosphonate moiety reacts with a chiral reagent, which is
represented by formula (Z-I) or (Z-I'), to form a chiral
intermediate of formula (Z-Va), (Z-Vb), (Z-Va'), or (Z-Vb').
Stereospecific Condensation Step
[1110] A chiral intermediate of Formula Z-Va ((Z-Vb), (Z-Va'), or
(Z-Vb')) is treated with the second activating reagent and a
nucleoside to form a condensed intermediate. The nucleoside may be
on solid support. Examples of the second activating reagent are
4,5-dicyanoimidazole (DCI), 4,5-dichloroimidazole,
1-phenylimidazolium triflate (PhIMT), benzimidazolium triflate
(BIT), benztriazole, 3-nitro-1,2,4-triazole (NT), tetrazole,
5-ethylthiotetrazole (ETT), 5-benzylthiotetrazole (BTT),
5-(4-nitrophenyl)tetrazole, N-cyanomethylpyrrolidinium triflate
(CMPT), N-cyanomethylpiperidinium triflate,
N-cyanomethyldimethylammonium triflate. A chiral intermediate of
Formula Z-Va ((Z-Vb), (Z-Va'), or (Z-Vb')) may be isolated as a
monomer. Usually, the chiral intermediate of Z-Va ((Z-Vb), (Z-Va'),
or (Z-Vb')) is not isolated and undergoes a reaction in the same
pot with a nucleoside or modified nucleoside to provide a chiral
phosphite compound, a condensed intermediate. In other embodiments,
when the method is performed via solid phase synthesis, the solid
support comprising the compound is filtered away from side
products, impurities, and/or reagents.
Capping Step
[1111] If the final nucleic acid is larger than a dimer, the
unreacted --OH moiety is capped with a blocking group and the
chiral auxiliary in the compound may also be capped with a blocking
group to form a capped condensed intermediate. If the final nucleic
acid is a dimer, then the capping step is not necessary.
Modifying Step
[1112] The compound is modified by reaction with an electrophile.
The capped condensed intermediate may be executed modifying step.
In some embodiments, the modifying step is performed using a sulfur
electrophile, a selenium electrophile or a boronating agent.
Examples of modifying steps are step of oxidation and
sulfurization.
[1113] In some embodiments of the method, the sulfur electrophile
is a compound having one of the following formulas:
Z.sup.z1--S--S--Z.sup.z2, or Z.sup.z1--S--V.sup.z--Z.sup.z2;
S.sub.8 (Formula Z-B),
wherein Z.sup.z1 and Z.sup.z2 are independently alkyl, aminoalkyl,
cycloalkyl, heterocyclic, cycloalkylalkyl, heterocycloalkyl, aryl,
heteroaryl, alkyloxy, aryloxy, heteroaryloxy, acyl, amide, imide,
or thiocarbonyl, or Z.sup.z1 and Z.sup.z2 are taken together to
form a 3 to 8 membered alicyclic or heterocyclic ring, which may be
substituted or unsubstituted; V.sup.z is SO.sub.2, O, or NR.sup.f;
and R.sup.f is hydrogen, alkyl, alkenyl, alkynyl, or aryl.
[1114] In some embodiments of the method, the sulfur electrophile
is a compound of following Formulae Z-A, Z-B, Z-C, Z-D, Z-E, or
Z-F:
##STR00239##
[1115] In some embodiments, a sulfurization reagent is
3-phenyl-1,2,4-dithiazolin-5-one.
[1116] In some embodiments, the selenium electrophile is a compound
having one of the following formulae:
Z.sup.z3--Se--Se--Z.sup.z4, or Z.sup.z3--Se--V.sup.z--Z.sup.z4; Se
(Formula Z-G),
wherein Z.sup.z3 and Z.sup.z4 are independently alkyl, aminoalkyl,
cycloalkyl, heterocyclic, cycloalkylalkyl, heterocycloalkyl, aryl,
heteroaryl, alkyloxy, aryloxy, heteroaryloxy, acyl, amide, imide,
or thiocarbonyl, or Z.sup.z3 and Z.sup.z4 are taken together to
form a 3 to 8 membered alicyclic or heterocyclic ring, which may be
substituted or unsubstituted; V.sup.z is SO.sub.2, S, O, or
NR.sup.f; and R.sup.f is hydrogen, alkyl, alkenyl, alkynyl, or
aryl.
[1117] In some embodiments, the selenium electrophile is a compound
of Formula Z-G, Z-H, Z-I, Z-J, Z-K, or Z-L.
##STR00240##
[1118] In some embodiments, the boronating agent is
borane-N,N-diisopropylethylamine (BH.sub.3DIPEA), borane-pyridine
(BH.sub.3Py), borane-2-chloropyridine (BH.sub.3CPy), borane-aniline
(BH.sub.3An), borane-tetrahydrofurane (BH.sub.3THF), or
borane-dimethylsulfide (BH.sub.3Me.sub.2S).
[1119] In some embodiments, after the modifying step, a chiral
auxiliary group falls off from the growing oligonucleotide chain.
In some embodiments, after the modifying step, a chiral auxiliary
group remains connected to the internucleotidic phosphorus
atom.
[1120] In some embodiments of the method, the modifying step is an
oxidation step. In some embodiments of the method, the modifying
step is an oxidation step using similar conditions as described
above in this application. In some embodiments, an oxidation step
is as disclosed in, e.g., JP 2010-265304 A and WO2010/064146.
Chain Elongation Cycle and De-Protection Step
[1121] The capped condensed intermediate is deblocked to remove the
blocking group at the 5'-end of the growing nucleic acid chain to
provide a compound. The compound is optionally allowed to re-enter
the chain elongation cycle to form a condensed intermediate, a
capped condensed intermediate, a modified capped condensed
intermediate, and a 5'-deprotected modified capped intermediate.
Following at least one round of chain elongation cycle, the
5'-deprotected modified capped intermediate is further deblocked by
removal of the chiral auxiliary ligand and other protecting groups
for, e.g., nucleobase, modified nucleobase, sugar and modified
sugar protecting groups, to provide a nucleic acid. In other
embodiments, the nucleoside comprising a 5'-OH moiety is an
intermediate from a previous chain elongation cycle as described
herein. In yet other embodiments, the nucleoside comprising a 5'-OH
moiety is an intermediate obtained from another known nucleic acid
synthetic method. In embodiments where a solid support is used, the
phosphorus-atom modified nucleic acid is then cleaved from the
solid support. In certain embodiments, the nucleic acids is left
attached on the solid support for purification purposes and then
cleaved from the solid support following purification.
[1122] In yet other embodiments, the nucleoside comprising a 5'-OH
moiety is an intermediate obtained from another known nucleic acid
synthetic method. In yet other embodiments, the nucleoside
comprising a 5'-OH moiety is an intermediate obtained from another
known nucleic acid synthetic method as described in this
application. In yet other embodiments, the nucleoside comprising a
5'-OH moiety is an intermediate obtained from another known nucleic
acid synthetic method comprising one or more cycles illustrated in
Scheme I. In yet other embodiments, the nucleoside comprising a
5'-OH moiety is an intermediate obtained from another known nucleic
acid synthetic method comprising one or more cycles illustrated in
Scheme I-b, I-c or I-d.
[1123] In some embodiments, the present disclosure provides
oligonucleotide synthesis methods that use stable and commercially
available materials as starting materials. In some embodiments, the
present disclosure provides oligonucleotide synthesis methods to
produce stereocontrolled phosphorus atom-modified oligonucleotide
derivatives using an achiral starting material.
[1124] In some embodiments, the method of the present disclosure
does not cause degradations under the de-protection steps. Further
the method does not require special capping agents to produce
phosphorus atom-modified oligonucleotide derivatives.
Condensing Reagent
[1125] Condensing reagents (C.sub.R) useful in accordance with
methods of the present disclosure are of any one of the following
general formulae:
##STR00241##
wherein Z.sup.1, Z.sup.2, Z.sup.3, Z.sup.4, Z.sup.5, Z.sup.6,
Z.sup.7, Z.sup.8, and Z.sup.9 are independently optionally
substituted group selected from alkyl, aminoalkyl, cycloalkyl,
heterocyclic, cycloalkylalkyl, heterocycloalkyl, aryl, heteroaryl,
alkyloxy, aryloxy, or heteroaryloxy, or wherein any of Z.sup.2 and
Z.sup.3, Z.sup.5 and Z.sup.6, Z.sup.7 and Z.sup.8, Z.sup.8 and
Z.sup.9, Z.sup.9 and Z.sup.7, or Z.sup.7 and Z.sup.8 and Z.sup.9
are taken together to form a 3 to 20 membered alicyclic or
heterocyclic ring; Q.sup.- is a counter anion; and LG is a leaving
group.
[1126] In some embodiments, a counter ion of a condensing reagent
C.sub.R is Cl.sup.-, Br.sup.-, BF.sub.4.sup.-, PF.sub.6.sup.-,
TfO.sup.-, Tf.sub.2N.sup.-, AsF.sub.6.sup.-, ClO.sub.4.sup.-, or
SbF.sub.6.sup.-, wherein Tf is CF.sub.3SO.sub.2. In some
embodiments, a leaving group of a condensing reagent C.sub.R is F,
Cl, Br, I, 3-nitro-1,2,4-triazole, imidazole, alkyltriazole,
tetrazole, pentafluorobenzene, or 1-hydroxybenzotriazole.
[1127] Examples of condensing reagents used in accordance with
methods of the present disclosure include, but are not limited to,
pentafluorobenzoyl chloride, carbonyldiimidazole (CDI),
1-mesitylenesulfonyl-3-nitrotriazole (MSNT),
1-ethyl-3-(3'-dimethylaminopropyl)carbodiimide hydrochloride
(EDCI-HCl), benzotriazole-1-yloxytris(dimethylamino)phosphonium
hexafluorophosphate (PyBOP),
N,N'-bis(2-oxo-3-oxazolidinyl)phosphinic chloride (BopCl),
2-(1H-7-azabenzotriazol-1-yl)-1,1,3,3-tetramethyluronium
hexafluorophosphate (HATU), and
O-benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate
(HBTU), DIPCDI; N,N'-bis(2-oxo-3-oxazolidinyl)phosphinic bromide
(BopBr),
1,3-dimethyl-2-(3-nitro-1,2,4-triazol-1-yl)-2-pyrrolidin-1-yl-1,3,2-diaza-
phospholidinium hexafluorophosphate (MNTP),
3-nitro-1,2,4-triazol-1-yl-tris(pyrrolidin-1-yl)phosphonium
hexafluorophosphate (PyNTP), bromotripyrrolidinophosphonium
hexafluorophosphate (PyBrOP);
O--(benzotriazol-1-yl)-N,N,N',N'-tetramethyluronium
tetrafluoroborate (TBTU); and tetramethylfluoroformamidinium
hexafluorophosphate (TFFH). In certain embodiments, a counter ion
of the condensing reagent C.sub.R is Cl.sup.-, Br.sup.-,
BF.sub.4.sup.-, PF.sub.6.sup.-, TfO.sup.-, Tf.sub.2N.sup.-,
AsF.sub.6.sup.-, ClO.sub.4.sup.-, or SbF.sub.6.sup.-, wherein Tf is
CF.sub.3SO.sub.2.
[1128] In some embodiments, a condensing reagent is 1-(2,4,6-trii
sopropylbenzenesulfonyl)-5-(pyridin-2-yl) tetrazolide, pivaloyl
chloride, bromotrispyrrolidinophosphonium hexafluorophosphate,
N,N'-bis(2-oxo-3-oxazolidinyl) phosphinic chloride (BopCl), or
2-chloro-5,5-dimethyl-2-oxo-1,3,2-dioxaphosphinane. In some
embodiment, a condensing reagent is
N,N'-bis(2-oxo-3-oxazolidinyl)phosphinic chloride (BopCl). In some
embodiments, a condensing reagent is selected from those described
in WO/2006/066260).
[1129] In some embodiments, a condensing reagent is
1,3-dimethyl-2-(3-nitro-1,2,4-triazol-1-yl)-2-pyrrolidin-1-yl-1,3,2-diaza-
phospholidinium hexafluorophosphate (MNTP), or
3-nitro-1,2,4-triazol-1-yl-tris(pyrrolidin-1-yl)phosphonium
hexafluorophosphate (PyNTP):
##STR00242##
Selection of Base and Sugar of Nucleoside Coupling Partner
[1130] As described herein, nucleoside coupling partners for use in
accordance with methods of the present disclosure can be the same
as one another or can be different from one another. In some
embodiments, nucleoside coupling partners for use in the synthesis
of a provided oligonucleotide are of the same structure and/or
stereochemical configuration as one another. In some embodiments,
each nucleoside coupling partner for use in the synthesis of a
provided oligonucleotide is not of the same structure and/or
stereochemical configuration as certain other nucleoside coupling
partners of the oligonucleotide. Example nucleobases and sugars for
use in accordance with methods of the present disclosure are
described herein. One of skill in the relevant chemical and
synthetic arts will recognize that any combination of nucleobases
and sugars described herein are contemplated for use in accordance
with methods of the present disclosure.
Coupling Step
[1131] Example coupling procedures and chiral reagents and
condensing reagents for use in accordance with the present
disclosure are outlined in, inter alia, Wada I (JP4348077;
WO2005/014609; WO2005/092909), Wada II (WO2010/064146), Wada III
(WO2012/039448), and Chiral Control (WO2010/064146). Chiral
nucleoside coupling partners for use in accordance with the present
disclosure are also referred to herein as "Wada amidites." In some
embodiments, a coupling partner has the structure of
##STR00243##
wherein B.sup.PRO is a protected nucleobase. In some embodiments, a
coupling partner has the structure of
##STR00244##
wherein B.sup.PRO is a protected nucleobase. In some embodiments, a
coupling partner has the structure of
##STR00245##
wherein B.sup.PRO is a protected nucleobase, and R.sup.1 is as
defined and described herein. In some embodiments, a coupling
partner has the structure of
##STR00246##
wherein B.sup.PRO is a protected nucleobase, and R.sup.1 is as
defined and described herein. In some embodiments, R.sup.1 is
optionally substituted C.sub.1-6 alkyl. In some embodiments,
R.sup.1 is Me.
[1132] Example chiral phosphoramidites as coupling partner are
depicted below:
##STR00247## ##STR00248##
Additional examples are described in Chiral Control
(WO2010/064146).
[1133] One of the methods used for synthesizing the coupling
partner is depicted in Scheme II, below.
##STR00249##
[1134] In some embodiments, the step of coupling comprises reacting
a free hydroxyl group of a nucleotide unit of an oligonucleotide
with a nucleoside coupling partner under suitable conditions to
effect the coupling. In some embodiments, the step of coupling is
preceded by a step of deblocking. For instance, in some
embodiments, the 5' hydroxyl group of the growing oligonucleotide
is blocked (i.e., protected) and must be deblocked in order to
subsequently react with a nucleoside coupling partner.
[1135] Once the appropriate hydroxyl group of the growing
oligonucleotide has been deblocked, the support is washed and dried
in preparation for delivery of a solution comprising a chiral
reagent and a solution comprising an activator. In some
embodiments, a chiral reagent and an activator are delivered
simultaneously. In some embodiments, co-delivery comprises
delivering an amount of a chiral reagent in solution (e.g., a
phosphoramidite solution) and an amount of activator in a solution
(e.g., a CMPT solution) in a polar aprotic solvent such as a
nitrile solvent (e.g., acetonitrile).
[1136] In some embodiments, the step of coupling provides a crude
product composition in which the chiral phosphite product is
present in a diastereomeric excess of >95%. In some embodiments,
the chiral phosphite product is present in a diastereomeric excess
of >96%. In some embodiments, the chiral phosphite product is
present in a diastereomeric excess of >97%. In some embodiments,
the chiral phosphite product is present in a diastereomeric excess
of >98%. In some embodiments, the chiral phosphite product is
present in a diastereomeric excess of >99%.
Capping Step:
[1137] Provided methods for making chirally controlled
oligonucleotides comprise a step of capping. In some embodiments, a
step of capping is a single step. In some embodiments, a step of
capping is two steps. In some embodiments, a step of capping is
more than two steps.
[1138] In some embodiments, a step of capping comprises steps of
capping the free amine of the chiral auxiliary and capping any
residual unreacted 5' hydroxyl groups. In some embodiments, the
free amine of the chiral auxiliary and the unreacted 5' hydroxyl
groups are capped with the same capping group. In some embodiments,
the free amine of the chiral auxiliary and the unreacted 5'
hydroxyl groups are capped with different capping groups. In
certain embodiments, capping with different capping groups allows
for selective removal of one capping group over the other during
synthesis of the oligonucleotide. In some embodiments, the capping
of both groups occurs simultaneously. In some embodiments, the
capping of both groups occurs iteratively.
[1139] In certain embodiments, capping occurs iteratively and
comprises a first step of capping the free amine followed by a
second step of capping the free 5' hydroxyl group, wherein both the
free amine and the 5' hydroxyl group are capped with the same
capping group. For instance, in some embodiments, the free amine of
the chiral auxiliary is capped using an anhydride (e.g.,
phenoxyacetic anhydride, i.e., Pac.sub.2O) prior to capping of the
5' hydroxyl group with the same anhydride. In certain embodiments,
the capping of the 5' hydroxyl group with the same anhydride occurs
under different conditions (e.g., in the presence of one or more
additional reagents). In some embodiments, capping of the 5'
hydroxyl group occurs in the presence of an amine base in an
etherial solvent (e.g., NMI (N-methylimidazole) in THF). The phrase
"capping group" is used interchangeably herein with the phrases
"protecting group" and "blocking group".
[1140] In some embodiments, an amine capping group is characterized
in that it effectively caps the amine such that it prevents
rearrangement and/or decomposition of the intermediate phosphite
species. In some embodiments, a capping group is selected for its
ability to protect the amine of the chiral auxiliary in order to
prevent intramolecular cleavage of the internucleotide linkage
phosphorus.
[1141] In some embodiments, a 5' hydroxyl group capping group is
characterized in that it effectively caps the hydroxyl group such
that it prevents the occurrence of "shortmers," e.g., "n-m" (m and
n are integers and m<n; n is the number of bases in the targeted
oligonucleotide) impurities that occur from the reaction of an
oligonucleotide chain that fails to react in a first cycle but then
reacts in one or more subsequent cycles. The presence of such
shortmers, especially "n-1", has a deleterious effect upon the
purity of the crude oligonucleotide and makes final purification of
the oligonucleotide tedious and generally low-yielding.
[1142] In some embodiments, a particular cap is selected based on
its tendency to facilitate a particular type of reaction under
particular conditions. For instance, in some embodiments, a capping
group is selected for its ability to facilitate an E1 elimination
reaction, which reaction cleaves the cap and/or auxiliary from the
growing oligonucleotide. In some embodiments, a capping group is
selected for its ability to facilitate an E2 elimination reaction,
which reaction cleaves the cap and/or auxiliary from the growing
oligonucleotide. In some embodiments, a capping group is selected
for its ability to facilitate a .beta.-elimination reaction, which
reaction cleaves the cap and/or auxiliary from the growing
oligonucleotide.
Modifying Step:
[1143] As used herein, the phrase "modifying step", "modification
step" and "P-modification step" are used interchangeably and refer
generally to any one or more steps used to install a modified
internucleotidic linkage. In some embodiments, the modified
internucleotidic linkage having the structure of formula I. A
P-modification step of the present disclosure occurs during
assembly of a provided oligonucleotide rather than after assembly
of a provided oligonucleotide is complete. Thus, each nucleotide
unit of a provided oligonucleotide can be individually modified at
the linkage phosphorus during the cycle within which the nucleotide
unit is installed.
[1144] In some embodiments, a suitable P-modification reagent is a
sulfur electrophile, selenium electrophile, oxygen electrophile,
boronating reagent, or an azide reagent.
[1145] For instance, in some embodiments, a selemium reagent is
elemental selenium, a selenium salt, or a substituted diselenide.
In some embodiments, an oxygen electrophile is elemental oxygen,
peroxide, or a substituted peroxide. In some embodiments, a
boronating reagent is a borane-amine (e.g.,
N,N-diisopropylethylamine (BH.sub.3.DIPEA), borane-pyridine
(BH.sub.3.Py), borane-2-chloropyridine (BH.sub.3.CPy),
borane-aniline (BH.sub.3.An)), a borane-ether reagent (e.g.,
borane-tetrahydrofuran (BH.sub.3-THF)), a borane-dialkylsulfide
reagent (e.g., BH.sub.3.Me.sub.2S), aniline-cyanoborane, or a
triphenylphosphine-carboalkoxyborane. In some embodiments, an azide
reagent is comprises an azide group capable of undergoing
subsequent reduction to provide an amine group.
[1146] In some embodiments, a P-modification reagent is a
sulfurization reagent as described herein. In some embodiments, a
step of modifying comprises sulfurization of phosphorus to provide
a phosphorothioate linkage or phosphorothioate triester linkage. In
some embodiments, a step of modifying provides an oligonucleotide
having an internucleotidic linkage of formula I.
[1147] In some embodiments, the present disclosure provides
sulfurizing reagents, and methods of making, and use of the
same.
[1148] In some embodiments, such sulfurizing reagents are
thiosulfonate reagents. In some embodiments, a thiosulfonate
reagent has a structure of formula S-I:
##STR00250##
wherein:
R.sup.s1 is R; and
[1149] each of R, L and R.sup.1 is independently as defined and
described above and herein.
[1150] In some embodiments, the sulfurizing reagent is a
bis(thiosulfonate) reagent. In some embodiments, the
bis(thiosulfonate) reagent has the structure of formula S-II:
##STR00251##
wherein each of R.sup.s1 and L is independently as defined and
described above and herein.
[1151] As defined generally above, R.sup.s1 is R, wherein R is as
defined and described above and herein. In some embodiments,
R.sup.s1 is optionally substituted aliphatic, aryl, heterocyclyl or
heteroaryl. In some embodiments, R.sup.s1 is optionally substituted
alkyl. In some embodiments, R.sup.s1 is optionally substituted
alkyl. In some embodiments, R.sup.s1 is methyl. In some
embodiments, R.sup.s1 is cyanomethyl. In some embodiments, R.sup.s1
is nitromethyl. In some embodiments, R.sup.s1 is optionally
substituted aryl. In some embodiments, R.sup.s1 is optionally
substituted phenyl. In some embodiments, R.sup.s1 is phenyl. In
some embodiments, R.sup.s1 is p-nitrophenyl. In some embodiments,
R.sup.s1 is p-methylphenyl. In some embodiments, R.sup.s1 is
p-chlorophenyl. In some embodiments, R.sup.s1 is o-chlorophenyl. In
some embodiments, R.sup.s1 is 2,4,6-trichlorophenyl. In some
embodiments, R.sup.s1 is pentafluorophenyl. In some embodiments,
R.sup.s1 is optionally substituted heterocyclyl. In some
embodiments, R.sup.s1 is optionally substituted heteroaryl.
[1152] In some embodiments, R.sup.s1--S(O).sub.2S-- is
##STR00252##
In some embodiments, R.sup.s1--S(O).sub.2S-- is
##STR00253##
In some embodiments, R.sup.s1--S(O).sub.2S-- is
##STR00254##
In some embodiments, R.sup.s1--S(O).sub.2S-- is
##STR00255##
In some embodiments, R.sup.s1--S(O).sub.2S-- is
##STR00256##
In some embodiments, R.sup.s1--S(O).sub.2S-- is
##STR00257##
In some embodiments,
##STR00258##
In some embodiments, R.sup.s1--S(O).sub.2S-- is
##STR00259##
In some embodiments, R.sup.s1--S(O).sub.2S-- is
##STR00260##
In some embodiments, R.sup.s1--S(O).sub.2S-- is
##STR00261##
In some embodiments, R.sup.s1--S(O).sub.2S-- is
##STR00262##
In some embodiments, R.sup.s1--S(O).sub.2S-- is
##STR00263##
In some embodiments, R.sup.s1--S(O).sub.2S-- is
##STR00264##
In some embodiments, R.sup.s1--S(O).sub.2S-- is
##STR00265##
[1153] In some embodiments, the sulfurizing reagent has the
structure of S-I or S-II, wherein L is --S--R.sup.L3-- or
--S--C(O)--R.sup.L3--. In some embodiments, L is --S--R.sup.L3-- or
--S--C(O)--R.sup.L3--, wherein R.sup.L3 is an optionally
substituted C.sub.1-C.sub.6 alkylene. In some embodiments, L is
--S--R.sup.L3-- or --S--C(O)--R.sup.L3--, wherein R.sup.L3 is an
optionally substituted C.sub.1-C.sub.6 alkenylene. In some
embodiments, L is --S--R.sup.L3-- or --S--C(O)--R.sup.L3--, wherein
R.sup.L3 is an optionally substituted C.sub.1-C.sub.6 alkylene
wherein one or more methylene units are optionally and
independently replaced by an optionally substituted C.sub.1-C.sub.6
alkenylene, arylene, or heteroarylene. In some embodiments, In some
embodiments, R.sup.L3 is an optionally substituted
--S--(C.sub.1-C.sub.6 alkenylene)-, --S--(C.sub.1-C.sub.6
alkylene)-, --S--(C.sub.1-C.sub.6
alkylene)-arylene-(C.sub.1-C.sub.6 alkylene)-,
--S--CO-arylene-(C.sub.1-C.sub.6 alkylene)-, or
--S--CO--(C.sub.1-C.sub.6 alkylene)-arylene-(C.sub.1-C.sub.6
alkylene)-. In some embodiments, the sulfurizing reagent has the
structure of S-I or S-II, wherein L is --S--R.sup.L3-- or
--S--C(O)--R.sup.L3--, and the sulfur atom is connected to
R.sup.1.
[1154] In some embodiments, the sulfurizing reagent has the
structure of S-I or S-II, wherein L is alkylene, alkenylene,
arylene or heteroarylene.
[1155] In some embodiments, the sulfurizing reagent has the
structure of S-I or S-II, wherein L is
##STR00266##
In some embodiments, L is
##STR00267##
wherein the sulfur atom is connected to R.sup.1.
[1156] In some embodiments, the sulfurizing reagent has the
structure of S-I or S-II, wherein R.sup.1 is
##STR00268##
In some embodiments, R.sup.1 is
##STR00269##
wherein the sulfur atom is connected to L.
[1157] In some embodiments, the sulfurizing reagent has the
structure of S-I or S-II, wherein L is
##STR00270##
wherein the sulfur atom is connected to R.sup.1; and R.sup.1 is
##STR00271##
wherein the sulfur atom is connected to L.
[1158] In some embodiments, the sulfurizing reagent has the
structure of S-I or S-II, wherein R.sup.1 is --S--R.sup.L2, wherein
R.sup.L2 is as defined and described above and herein. In some
embodiments, R.sup.L2 is an optionally substituted group selected
from --S--(C.sub.1-C.sub.6 alkylene)-heterocyclyl,
--S--(C.sub.1-C.sub.6 alkenylene)-heterocyclyl,
--S--(C.sub.1-C.sub.6 alkylene)-N(R').sub.2, --S--(C.sub.1-C.sub.6
alkylene)-N(R').sub.3, wherein each R' is as defined above and
described herein.
[1159] In some embodiments, -L-R.sup.1 is
--R.sup.L3--S--S--R.sup.L2, wherein each variable is independently
as defined above and described herein. In some embodiments,
-L-R.sup.1 is --R.sup.L3--C(O)--S--S--R.sup.L2, wherein each
variable is independently as defined above and described
herein.
[1160] Example bis(thiosulfonate) reagents of formula S--II are
depicted below:
##STR00272##
[1161] In some embodiments, the sulfurization reagent is a compound
having one of the following formulae:
R.sup.s2--S--S--R.sup.s3, or R.sup.s2--S--X.sup.s--R.sup.s3,
S.sub.8,
wherein: [1162] each of R.sup.s2 and R.sup.s3 is independently an
optionally substituted group selected from aliphatic, aminoalkyl,
carbocyclyl, heterocyclyl, heterocycloalkyl, aryl, heteroaryl,
alkyloxy, aryloxy, heteroaryloxy, acyl, amide, imide, or
thiocarbonyl; or [1163] R.sup.s2 and R.sup.s3 are taken together
with the atoms to which they are bound to form an optionally
substituted heterocyclic or heteroaryl ring; [1164] X.sup.s is
--S(O).sub.2--, --O--, or --N(R')--; and [1165] R' is as defined
and described above and herein.
[1166] In some embodiments, the sulfurization reagent is
S.sub.8,
##STR00273##
In some embodiments, the sulfurization reagent is S.sub.8,
##STR00274##
In some embodiments, the sulfurization reagent is
##STR00275##
[1167] Example sulfuring reagents are depicted in Table 5
below.
TABLE-US-00020 TABLE 5 Example sulfurization reagents. ##STR00276##
##STR00277## ##STR00278## ##STR00279## ##STR00280## ##STR00281##
##STR00282## ##STR00283## ##STR00284## ##STR00285## ##STR00286##
##STR00287## ##STR00288## ##STR00289## ##STR00290## ##STR00291##
##STR00292## ##STR00293## ##STR00294## ##STR00295## ##STR00296##
##STR00297## ##STR00298## ##STR00299## ##STR00300## ##STR00301##
##STR00302## ##STR00303## ##STR00304## S.sub.8 ##STR00305##
##STR00306## ##STR00307## ##STR00308## ##STR00309## ##STR00310##
##STR00311## ##STR00312## ##STR00313## ##STR00314## ##STR00315##
##STR00316## ##STR00317## ##STR00318## ##STR00319## ##STR00320##
##STR00321## ##STR00322## ##STR00323## ##STR00324## ##STR00325##
POS
[1168] In some embodiments, a provided sulfurization reagent is
used to modify an H-phosphonate. For instance, in some embodiments,
an H-phosphonate oligonucleotide is synthesized using, e.g., a
method of Wada I or Wada II, and is modified using a sulfurization
reagent of formula S-I or S-II:
##STR00326##
wherein each of R.sup.S1, L, and R.sup.1 are as described and
defined above and herein.
[1169] In some embodiments, the present disclosure provides a
process for synthesizing a phosphorothioate triester, comprising
steps of:
[1170] i) reacting an H-phosphonate of structure:
##STR00327##
[1171] wherein each of W, Y, and Z are as described and defined
above and herein, with a silylating reagent to provide a
silyloxyphosphonate; and
[1172] ii) reacting the silyloxyphosphonate with a sulfurization
reagent of structure S-I or S-II:
##STR00328##
[1173] to provide a phosphorothiotriester.
[1174] In some embodiments, a selenium electrophile is used instead
of a sulfurizing reagent to introduce modification to the
internucleotidic linkage. In some embodiments, a selenium
electrophile is a compound having one of the following
formulae:
R.sup.s2--Se--Se--R.sup.s3, or R.sup.s2--Se--X.sup.s--R.sup.s3,
Se,
wherein: [1175] each of R.sup.s2 and R.sup.s3 is independently an
optionally substituted group selected from aliphatic, aminoalkyl,
carbocyclyl, heterocyclyl, heterocycloalkyl, aryl, heteroaryl,
alkyloxy, aryloxy, heteroaryloxy, acyl, amide, imide, or
thiocarbonyl; or [1176] R.sup.s2 and R.sup.s3 are taken together
with the atoms to which they are bound to form an optionally
substituted heterocyclic or heteroaryl ring; [1177] X.sup.s is
--S(O).sub.2--, --O--, or --N(R')--; and [1178] R' is as defined
and described above and herein.
[1179] In other embodiments, the selenium electrophile is a
compound of Se, KSeCN,
##STR00329##
In some embodiments, the selenium electrophile is Se or
##STR00330##
[1180] In some embodiments, a sulfurization reagent for use in
accordance with the present disclosure is characterized in that the
moiety transferred to phosphorus during sulfurization is a
substituted sulfur (e.g., --SR) as opposed to a single sulfur atom
(e.g., --S-- or .dbd.S).
[1181] In some embodiments, a sulfurization reagent for use in
accordance with the present disclosure is characterized in that the
activity of the reagent is tunable by modifying the reagent with a
certain electron withdrawing or donating group.
[1182] In some embodiments, a sulfurization reagent for use in
accordance with the present disclosure is characterized in that it
is crystalline. In some embodiments, a sulfurization reagent for
use in accordance with the present disclosure is characterized in
that it has a high degree of crystallinity. In certain embodiments,
a sulfurization reagent for use in accordance with the present
disclosure is characterized by ease of purification of the reagent
via, e.g., recrystallization. In certain embodiments, a
sulfurization reagent for use in accordance with the present
disclosure is characterized in that it is substantially free from
sulfur-containing impurities. In some embodiments, sulfurization
reagents which are substantially free from sulfur-containing
impurities show increased efficiency.
[1183] In some embodiments, the provided chirally controlled
oligonucleotide comprises one or more phosphate diester linkages.
To synthesize such chirally controlled oligonucleotides, one or
more modifying steps are optionally replaced with an oxidation step
to install the corresponding phosphate diester linkages. In some
embodiments, the oxidation step is performed in a fashion similar
to ordinary oligonucleotide synthesis. In some embodiments, an
oxidation step comprises the use of 12. In some embodiments, an
oxidation step comprises the use of 12 and pyridine. In some
embodiments, an oxidation step comprises the use of 0.02 M 12 in a
THF/pyridine/water (70:20:10--v/v/v) co-solvent system. An example
cycle is depicted in Scheme I-c.
[1184] In some embodiments, a phosphorothioate is directly formed
through sulfurization by a sulfurization reagents, e.g.,
3-phenyl-1,2,4-dithiazolin-5-one. In some embodiments, after a
direct installation of a phosphorothioate, a chiral auxiliary group
remains attached to the internucleotidic phosphorus atom. In some
embodiments, an additional de-protecting step is required to remove
the chiral auxiliary (e.g., for DPSE-type chiral auxiliary, using
TBAF, HF-Et.sub.3N, etc.).
[1185] In some embodiments, a phosphorothioate precursor is used to
synthesize chirally controlled oligonucleotides comprising
phosphorothioate linkages. In some embodiments, such a
phosphorothioate precursor is
##STR00331##
In some embodiments,
##STR00332##
is converted into phosphorothioate diester linkages during standard
deprotection/release procedure after cycle exit. Examples are
further depicted below.
[1186] In some embodiments, the provided chirally controlled
oligonucleotide comprises one or more phosphate diester linkages
and one or more phosphorothioate diester linkages. In some
embodiments, the provided chirally controlled oligonucleotide
comprises one or more phosphate diester linkages and one or more
phosphorothioate diester linkages, wherein at least one phosphate
diester linkage is installed after all the phosphorothioate diester
linkages when synthesized from 3' to 5'. To synthesize such
chirally controlled oligonucleotides, in some embodiments, one or
more modifying steps are optionally replaced with an oxidation step
to install the corresponding phosphate diester linkages, and a
phosphorothioate precursor is installed for each of the
phosphorothioate diester linkages. In some embodiments, a
phosphorothioate precursor is converted to a phosphorothioate
diester linkage after the desired oligonucleotide length is
achieved. In some embodiments, the deprotection/release step during
or after cycle exit converts the phosphorothioate precursors into
phosphorothioate diester linkages. In some embodiments, a
phosphorothioate precursor is characterized in that it has the
ability to be removed by a beta-elimination pathway. In some
embodiments, a phosphorothioate precursor is
##STR00333##
As understood by one of ordinary skill in the art, one of the
benefits of using a phosphorothioate precursor, for instance,
##STR00334##
during synthesis is that
##STR00335##
is more stable than phosphorothioate in certain conditions.
[1187] In some embodiments, a phosphorothioate precursor is a
phosphorus protecting group as described herein, e.g., 2-cyanoethyl
(CE or Cne), 2-trimethylsilylethyl, 2-nitroethyl, 2-sulfonylethyl,
methyl, benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe),
2-phenylethyl, 3-(N-tert-butylcarboxamido)-1-propyl, 4-oxopentyl,
4-methylthio-1-butyl, 2-cyano-1,1-dimethylethyl,
4-N-methylaminobutyl, 3-(2-pyridyl)-1-propyl,
2-[N-methyl-N-(2-pyridyl)]aminoethyl,
2-(N-formyl,N-methyl)aminoethyl,
4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl. Examples are
further depicted below.
[1188] Methods for synthesizing a desired sulfurization reagent are
described herein and in the examples section.
[1189] As noted above, in some embodiments, sulfurization occurs
under conditions which cleave the chiral reagent from the growing
oligonucleotide. In some embodiments, sulfurization occurs under
conditions which do not cleave the chiral reagent from the growing
oligonucleotide.
[1190] In some embodiments, a sulfurization reagent is dissolved in
a suitable solvent and delivered to the column. In certain
embodiments, the solvent is a polar aprotic solvent such as a
nitrile solvent. In some embodiments, the solvent is acetonitrile.
In some embodiments, a solution of sulfurization reagent is
prepared by mixing a sulfurization reagent (e.g., a thiosulfonate
derivative as described herein) with BSTFA
(N,O-bis-trimethylsilyl-trifluoroacetamide) in a nitrile solvent
(e.g., acetonitrile). In some embodiments, BSTFA is not included.
For example, the present inventors have found that relatively more
reactive sulfurization reagents of general formula
R.sup.s2--S--S(O).sub.2--R.sup.s3 can often successfully
participate in sulfurization reactions in the absence of BSTFA. To
give but one example, the inventors have demonstrated that where
R.sup.s2 is p-nitrophenyl and R.sup.s3 is methyl then no BSTFA is
required. In light of this disclosure, those skilled in the art
will readily be able to determine other situations and/or
sulfurization reagents that do not require BSTFA.
[1191] In some embodiments, the sulfurization step is performed at
room temperature. In some embodiments, the sulfurization step is
performed at lower temperatures such as about 0.degree. C., about
5.degree. C., about 10.degree. C., or about 15.degree. C. In some
embodiments, the sulfurization step is performed at elevated
temperatures of greater than about 20.degree. C.
[1192] In some embodiments, a sulfurization reaction is run for
about 1 minute to about 120 minutes. In some embodiments, a
sulfurization reaction is run for about 1 minute to about 90
minutes. In some embodiments, a sulfurization reaction is run for
about 1 minute to about 60 minutes. In some embodiments, a
sulfurization reaction is run for about 1 minute to about 30
minutes. In some embodiments, a sulfurization reaction is run for
about 1 minute to about 25 minutes. In some embodiments, a
sulfurization reaction is run for about 1 minute to about 20
minutes. In some embodiments, a sulfurization reaction is run for
about 1 minute to about 15 minutes. In some embodiments, a
sulfurization reaction is run for about 1 minute to about 10
minutes. In some embodiments, a sulfurization reaction is run for
about 5 minute to about 60 minutes.
[1193] In some embodiments, a sulfurization reaction is run for
about 5 minutes. In some embodiments, a sulfurization reaction is
run for about 10 minutes. In some embodiments, a sulfurization
reaction is run for about 15 minutes. In some embodiments, a
sulfurization reaction is run for about 20 minutes. In some
embodiments, a sulfurization reaction is run for about 25 minutes.
In some embodiments, a sulfurization reaction is run for about 30
minutes. In some embodiments, a sulfurization reaction is run for
about 35 minutes. In some embodiments, a sulfurization reaction is
run for about 40 minutes. In some embodiments, a sulfurization
reaction is run for about 45 minutes. In some embodiments, a
sulfurization reaction is run for about 50 minutes. In some
embodiments, a sulfurization reaction is run for about 55 minutes.
In some embodiments, a sulfurization reaction is run for about 60
minutes.
[1194] It was unexpectedly found that certain of the sulfurization
modification products made in accordance with methods of the
present disclosure are unexpectedly stable. In some embodiments, it
the unexpectedly stable products are phosphorothioate triesters. In
some embodiments, the unexpectedly stable products are chirally
controlled oligonucleotides comprising one or more internucleotidic
linkages having the structure of formula I-c.
[1195] One of skill in the relevant arts will recognize that
sulfurization methods described herein and sulfurization reagents
described herein are also useful in the context of modifying
H-phosphonate oligonucleotides such as those described in Wada II
(WO2010/064146).
[1196] In some embodiments, the sulfurization reaction has a
stepwise sulfurization efficiency that is at least about 80%, 85%,
90%, 95%, 96%, 97%, or 98%. In some embodiments, the sulfurization
reaction provides a crude dinucleotide product composition that is
at least 98% pure. In some embodiments, the sulfurization reaction
provides a crude tetranucleotide product composition that is at
least 90% pure. In some embodiments, the sulfurization reaction
provides a crude dodecanucleotide product composition that is at
least 70% pure. In some embodiments, the sulfurization reaction
provides a crude icosanucleotide product composition that is at
least 50% pure.
[1197] Once the step of modifying the linkage phosphorus is
complete, the oligonucleotide undergoes another deblock step in
preparation for re-entering the cycle. In some embodiments, a
chiral auxiliary remains intact after sulfurization and is
deblocked during the subsequent deblock step, which necessarily
occurs prior to re-entering the cycle. The process of deblocking,
coupling, capping, and modifying, are repeated until the growing
oligonucleotide reaches a desired length, at which point the
oligonucleotide can either be immediately cleaved from the solid
support or left attached to the support for purification purposes
and later cleaved. In some embodiments, one or more protecting
groups are present on one or more of the nucleotide bases, and
cleaveage of the oligonucleotide from the support and deprotection
of the bases occurs in a single step. In some embodiments, one or
more protecting groups are present on one or more of the nucleotide
bases, and cleaveage of the oligonucleotide from the support and
deprotection of the bases occurs in more than one step. In some
embodiments, deprotection and cleavage from the support occurs
under basic conditions using, e.g., one or more amine bases. In
certain embodiments, the one or more amine bases comprise propyl
amine. In certain embodiments, the one or more amine bases comprise
pyridine.
[1198] In some embodiments, cleavage from the support and/or
deprotection occurs at elevated temperatures of about 30.degree. C.
to about 90.degree. C. In some embodiments, cleavage from the
support and/or deprotection occurs at elevated temperatures of
about 40.degree. C. to about 80.degree. C. In some embodiments,
cleavage from the support and/or deprotection occurs at elevated
temperatures of about 50.degree. C. to about 70.degree. C. In some
embodiments, cleavage from the support and/or deprotection occurs
at elevated temperatures of about 60.degree. C. In some
embodiments, cleavage from the support and/or deprotection occurs
at ambient temperatures.
[1199] Example purification procedures are described herein and/or
are known generally in the relevant arts.
[1200] Noteworthy is that the removal of the chiral auxiliary from
the growing oligonucleotide during each cycle is beneficial for at
least the reasons that (1) the auxiliary will not have to be
removed in a separate step at the end of the oligonucleotide
synthesis when potentially sensitive functional groups are
installed on phosphorus; and (2) unstable phosphorus-auxiliary
intermediates prone to undergoing side reactions and/or interfering
with subsequent chemistry are avoided. Thus, removal of the chiral
auxiliary during each cycle makes the overall synthesis more
efficient.
[1201] While the step of deblocking in the context of the cycle is
described above, additional general methods are included below.
Deblocking Step
[1202] In some embodiments, the step of coupling is preceded by a
step of deblocking. For instance, in some embodiments, the 5'
hydroxyl group of the growing oligonucleotide is blocked (i.e.,
protected) and must be deblocked in order to subsequently react
with a nucleoside coupling partner.
[1203] In some embodiments, acidification is used to remove a
blocking group. In some embodiments, the acid is a Bronsted acid or
Lewis acid. Useful Bronsted acids are carboxylic acids,
alkylsulfonic acids, arylsulfonic acids, phosphoric acid and its
derivatives, phosphonic acid and its derivatives, alkylphosphonic
acids and their derivatives, arylphosphonic acids and their
derivatives, phosphinic acid, dialkylphosphinic acids, and
diarylphosphinic acids which have a pKa (25.degree. C. in water)
value of -0.6 (trifluoroacetic acid) to 4.76 (acetic acid) in an
organic solvent or water (in the case of 80% acetic acid). The
concentration of the acid (1 to 80%) used in the acidification step
depends on the acidity of the acid. Consideration to the acid
strength must be taken into account as strong acid conditions will
result in depurination/depyrimidination, wherein purinyl or
pyrimidinyl bases are cleaved from ribose ring and or other sugar
ring. In some embodiments, an acid is selected from R.sup.a1COOH,
R.sup.a1SO.sub.3H, R.sup.a3SO.sub.3H,
##STR00336##
wherein each of R.sup.a1 and R.sup.a2 is independently hydrogen or
an optionally substituted alkyl or aryl, and R.sup.a3 is an
optionally substituted alkyl or aryl.
[1204] In some embodiments, acidification is accomplished by a
Lewis acid in an organic solvent. Examples of such useful Lewis
acids are Zn(X.sup.a).sub.2 wherein X.sup.a is Cl, Br, I, or
CF.sub.3SO.sub.3.
[1205] In some embodiments, the step of acidifying comprises adding
an amount of a Bronsted or Lewis acid effective to remove a
blocking group without removing purine moieties from the condensed
intermediate.
[1206] Acids that are useful in the acidifying step also include,
but are not limited to 10% phosphoric acid in an organic solvent,
10% hydrochloric acid in an organic solvent, 1% trifluoroacetic
acid in an organic solvent, 3% dichloroacetic acid or
trichloroacetic acid in an organic solvent or 80% acetic acid in
water. The concentration of any Bronsted or Lewis acid used in this
step is selected such that the concentration of the acid does not
exceed a concentration that causes cleavage of a nucleobase from a
sugar moiety.
[1207] In some embodiments, acidification comprises adding 1%
trifluoroacetic acid in an organic solvent. In some embodiments,
acidification comprises adding about 0.1% to about 8%
trifluoroacetic acid in an organic solvent. In some embodiments,
acidification comprises adding 3% dichloroacetic acid or
trichloroacetic acid in an organic solvent. In some embodiments,
acidification comprises adding about 0.1% to about 10%
dichloroacetic acid or trichloroacetic acid in an organic solvent.
In some embodiments, acidification comprises adding 3%
trichloroacetic acid in an organic solvent. In some embodiments,
acidification comprises adding about 0.1% to about 10%
trichloroacetic acid in an organic solvent. In some embodiments,
acidification comprises adding 80% acetic acid in water. In some
embodiments, acidification comprises adding about 50% to about 90%,
or about 50% to about 80%, about 50% to about 70%, about 50% to
about 60%, about 70% to about 90% acetic acid in water. In some
embodiments, the acidification comprises the further addition of
cation scavengers to an acidic solvent. In certain embodiments, the
cation scavengers can be triethylsilane or triisopropylsilane. In
some embodiments, a blocking group is deblocked by acidification,
which comprises adding 1% trifluoroacetic acid in an organic
solvent. In some embodiments, a blocking group is deblocked by
acidification, which comprises adding 3% dichloroacetic acid in an
organic solvent. In some embodiments, a blocking group is deblocked
by acidification, which comprises adding 3% trichloroacetic acid in
an organic solvent. In some embodiments, a blocking group is
deblocked by acidification, which comprises adding 3%
trichloroacetic acid in dichloromethane.
[1208] In certain embodiments, methods of the present disclosure
are completed on a synthesizer and the step of deblocking the
hydroxyl group of the growing oligonucleotide comprises delivering
an amount solvent to the synthesizer column, which column contains
a solid support to which the oligonucleotide is attached. In some
embodiments, the solvent is a halogenated solvent (e.g.,
dichloromethane). In certain embodiments, the solvent comprises an
amount of an acid. In some embodiments, the solvent comprises an
amount of an organic acid such as, for instance, trichloroacetic
acid. In certain embodiments, the acid is present in an amount of
about 1% to about 20% w/v. In certain embodiments, the acid is
present in an amount of about 1% to about 10% w/v. In certain
embodiments, the acid is present in an amount of about 1% to about
5% w/v. In certain embodiments, the acid is present in an amount of
about 1 to about 3% w/v. In certain embodiments, the acid is
present in an amount of about 3% w/v. Methods for deblocking a
hydroxyl group are described further herein. In some embodiments,
the acid is present in 3% w/v is dichloromethane.
[1209] In some embodiments, the chiral auxiliary is removed before
the deblocking step. In some embodiments, the chiral auxiliary is
removed during the deblocking step.
[1210] In some embodiments, cycle exit is performed before the
deblocking step. In some embodiments, cycle exit is preformed after
the deblocking step.
General Conditions for Blocking Group/Protecting Group Removal
[1211] Functional groups such as hydroxyl or amino moieties which
are located on nucleobases or sugar moieties are routinely blocked
with blocking (protecting) groups (moieties) during synthesis and
subsequently deblocked. In general, a blocking group renders a
chemical functionality of a molecule inert to specific reaction
conditions and can later be removed from such functionality in a
molecule without substantially damaging the remainder of the
molecule (see e.g., Green and Wuts, Protective Groups in Organic
Synthesis, 2nd Ed., John Wiley & Sons, New York, 1991). For
example, amino groups can be blocked with nitrogen blocking groups
such as phthalimido, 9-fluorenylmethoxycarbonyl (FMOC),
triphenylmethylsulfenyl, t-BOC, 4,4'-dimethoxytrityl (DMTr),
4-methoxytrityl (MMTr), 9-phenylxanthin-9-yl (Pixyl), trityl (Tr),
or 9-(p-methoxyphenyl)xanthin-9-yl (MOX). Carboxyl groups can be
protected as acetyl groups. Hydroxy groups can be protected such as
tetrahydropyranyl (THP), t-butyldimethylsilyl (TBDMS),
1-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl (Ctmp),
1-(2-fluorophenyl)-4-methoxypiperidin-4-yl (Fpmp),
1-(2-chloroethoxy)ethyl, 3-methoxy-1,5-dicarbomethoxypentan-3-yl
(MDP), bis(2-acetoxyethoxy)methyl (ACE), triisopropylsilyloxymethyl
(TOM), 1-(2-cyanoethoxy)ethyl (CEE), 2-cyanoethoxymethyl (CEM),
[4-(N-dichloroacetyl-N-methylamino)benzyloxy]methyl, 2-cyanoethyl
(CN), pivaloyloxymethyl (PivOM), levunyloxymethyl (ALE). Other
representative hydroxyl blocking groups have been described (see
e.g., Beaucage et al., Tetrahedron, 1992, 46, 2223). In some
embodiments, hydroxyl blocking groups are acid-labile groups, such
as the trityl, monomethoxytrityl, dimethoxytrityl,
trimethoxytrityl, 9-phenylxanthin-9-yl (Pixyl) and
9-(p-methoxyphenyl)xanthin-9-yl (MOX). Chemical functional groups
can also be blocked by including them in a precursor form. Thus an
azido group can be considered a blocked form of an amine as the
azido group is easily converted to the amine. Further
representative protecting groups utilized in nucleic acid synthesis
are known (see e.g. Agrawal et al., Protocols for Oligonucleotide
Conjugates, Eds., Humana Press, New Jersey, 1994, Vol. 26, pp.
1-72).
[1212] Various methods are known and used for removal of blocking
groups from nucleic acids. In some embodiments, all blocking groups
are removed. In some embodiments, a portion of blocking groups are
removed. In some embodiments, reaction conditions can be adjusted
to selectively remove certain blocking groups.
[1213] In some embodiments, nucleobase blocking groups, if present,
are cleavable with an acidic reagent after the assembly of a
provided oligonucleotide. In some embodiment, nucleobase blocking
groups, if present, are cleavable under neither acidic nor basic
conditions, e.g. cleavable with fluoride salts or hydrofluoric acid
complexes. In some embodiments, nucleobase blocking groups, if
present, are cleavable in the presence of base or a basic solvent
after the assembly of a provided oligonucleotide. In certain
embodiments, one or more of the nucleobase blocking groups are
characterized in that they are cleavable in the presence of base or
a basic solvent after the assembly of a provided oligonucleotide
but are stable to the particular conditions of one or more earlier
deprotection steps occurring during the assembly of the provided
oligonucleotide.
[1214] In some embodiments, blocking groups for nucleobases are not
required. In some embodiments, blocking groups for nucleobases are
required. In some embodiments, certain nucleobases require one or
more blocking groups while other nucleobases do not require one or
more blocking groups.
[1215] In some embodiments, the oligonucleotide is cleaved from the
solid support after synthesis. In some embodiments, cleavage from
the solid support comprises the use of propylamine. In some
embodiments, cleavage from the solid support comprises the use of
propylamine in pyridine. In some embodiments, cleavage from the
solid support comprises the use of 20% propylamine in pyridine. In
some embodiments, cleavage from the solid support comprises the use
of propylamine in anhydrous pyridine. In some embodiments, cleavage
from the solid support comprises the use of 20% propylamine in
anhydrous pyridine. In some embodiments, cleavage from the solid
support comprises use of a polar aprotic solvent such as
acetonitrile, NMP, DMSO, sulfone, and/or lutidine. In some
embodiments, cleavage from the solid support comprises use of
solvent, e.g., a polar aprotic solvent, and one or more primary
amines (e.g., a C.sub.1-10 amine), and/or one or more of
methoxylamine, hydrazine, and pure anhydrous ammonia.
[1216] In some embodiments, deprotection of oligonucleotide
comprises the use of propylamine. In some embodiments, deprotection
of oligonucleotide comprises the use of propylamine in pyridine. In
some embodiments, deprotection of oligonucleotide comprises the use
of 20% propylamine in pyridine. In some embodiments deprotection of
oligonucleotide comprises the use of propylamine in anhydrous
pyridine. In some embodiments, deprotection of oligonucleotide
comprises the use of 20% propylamine in anhydrous pyridine.
[1217] In some embodiments, the oligonucleotide is deprotected
during cleavage.
[1218] In some embodiments, cleavage of oligonucleotide from solid
support, or deprotection of oligonucleotide, is performed at about
room temperature. In some embodiments, cleavage of oligonucleotide
from solid support, or deprotection of oligonucleotide, is
performed at elevated temperature. In some embodiments, cleavage of
oligonucleotide from solid support, or deprotection of
oligonucleotide, is performed at above about 30.degree. C.,
40.degree. C., 50.degree. C., 60.degree. C., 70.degree. C.,
80.degree. C. 90.degree. C. or 100.degree. C. In some embodiments,
cleavage of oligonucleotide from solid support, or deprotection of
oligonucleotide, is performed at about 30.degree. C., 40.degree.
C., 50.degree. C., 60.degree. C., 70.degree. C., 80.degree. C.
90.degree. C. or 100.degree. C. In some embodiments, cleavage of
oligonucleotide from solid support, or deprotection of
oligonucleotide, is performed at about 40-80.degree. C. In some
embodiments, cleavage of oligonucleotide from solid support, or
deprotection of oligonucleotide, is performed at about
50-70.degree. C. In some embodiments, cleavage of oligonucleotide
from solid support, or deprotection of oligonucleotide, is
performed at about 60.degree. C.
[1219] In some embodiments, cleavage of oligonucleotide from solid
support, or deprotection of oligonucleotide, is performed for more
than 0.1 hr, 1 hr, 2 hrs, 5 hrs, 10 hrs, 15 hrs, 20 hrs, 24 hrs, 30
hrs, or 40 hrs. In some embodiments, cleavage of oligonucleotide
from solid support, or deprotection of oligonucleotide, is
performed for about 0.1-5 hrs. In some embodiments, cleavage of
oligonucleotide from solid support, or deprotection of
oligonucleotide, is performed for about 3-10 hrs. In some
embodiments, cleavage of oligonucleotide from solid support, or
deprotection of oligonucleotide, is performed for about 5-15 hrs.
In some embodiments, cleavage of oligonucleotide from solid
support, or deprotection of oligonucleotide, is performed for about
10-20 hrs. In some embodiments, cleavage of oligonucleotide from
solid support, or deprotection of oligonucleotide, is performed for
about 15-25 hrs. In some embodiments, cleavage of oligonucleotide
from solid support, or deprotection of oligonucleotide, is
performed for about 20-40 hrs. In some embodiments, cleavage of
oligonucleotide from solid support, or deprotection of
oligonucleotide, is performed for about 2 hrs. In some embodiments,
cleavage of oligonucleotide from solid support, or deprotection of
oligonucleotide, is performed for about 5 hrs. In some embodiments,
cleavage of oligonucleotide from solid support, or deprotection of
oligonucleotide, is performed for about 10 hrs. In some
embodiments, cleavage of oligonucleotide from solid support, or
deprotection of oligonucleotide, is performed for about 15 hrs. In
some embodiments, cleavage of oligonucleotide from solid support,
or deprotection of oligonucleotide, is performed for about 18 hrs.
In some embodiments, cleavage of oligonucleotide from solid
support, or deprotection of oligonucleotide, is performed for about
24 hrs.
[1220] In some embodiments, cleavage of oligonucleotide from solid
support, or deprotection of oligonucleotide, is performed at room
temperature for more than 0.1 hr, 1 hr, 2 hrs, 5 hrs, 10 hrs, 15
hrs, 20 hrs, 24 hrs, 30 hrs, or 40 hrs. In some embodiments,
cleavage of oligonucleotide from solid support, or deprotection of
oligonucleotide, is performed at room temperature for about 5-48
hrs. In some embodiments, cleavage of oligonucleotide from solid
support, or deprotection of oligonucleotide, is performed at room
temperature for about 10-24 hrs. In some embodiments, cleavage of
oligonucleotide from solid support, or deprotection of
oligonucleotide, is performed at room temperature for about 18 hrs.
In some embodiments, cleavage of oligonucleotide from solid
support, or deprotection of oligonucleotide, is performed at
elevated temperature for more than 0.1 hr, 1 hr, 2 hrs, 5 hrs, 10
hrs, 15 hrs, 20 hrs, 24 hrs, 30 hrs, or 40 hrs. In some
embodiments, cleavage of oligonucleotide from solid support, or
deprotection of oligonucleotide, is performed at elevated
temperature for about 0.5-5 hrs. In some embodiments, cleavage of
oligonucleotide from solid support, or deprotection of
oligonucleotide, is performed at about 60.degree. C. for about
0.5-5 hrs. In some embodiments, cleavage of oligonucleotide from
solid support, or deprotection of oligonucleotide, is performed at
about 60.degree. C. for about 2 hrs.
[1221] In some embodiments, cleavage of oligonucleotide from solid
support, or deprotection of oligonucleotide comprises the use of
propylamine and is performed at room temperature or elevated
temperature for more than 0.1 hr, 1 hr, 2 hrs, 5 hrs, 10 hrs, 15
hrs, 20 hrs, 24 hrs, 30 hrs, or 40 hrs. Example conditions are 20%
propylamine in pyridine at room temperature for about 18 hrs, and
20% propylamine in pyridine at 60.degree. C. for about 18 hrs,
[1222] In some embodiments, prior to cleavage from solid support, a
step is performed to remove a chiral auxiliary group, if one is
still attached to an internucleotidic phosphorus atom. In some
embodiments, for example, one or more DPSE type chiral auxiliary
groups remain attached to internucleotidic phosphorus atoms during
the oligonucleotide synthesis cycle. Suitable conditions for
removing remaining chiral auxiliary groups are widely known in the
art, e.g., those described in Wada I, Wada II, Wada III, Chiral
Control, etc. In some embodiments, a condition for removing DPSE
type chiral auxiliary is TBAF or HF-Et.sub.3N, e.g., 0.1M TBAF in
MeCN, 0.5M HF-Et.sub.3N in THF or MeCN, etc. In some embodiments,
the present disclosure recognizes that a linker may be cleaved
during the process of removing a chiral auxiliary group. In some
embodiments, the present disclosure provides linkers, such as the
SP linker, that provides better stability during chiral auxiliary
group removal. Among other things, certain linkers provided by the
present disclosure provided improved yield and/or purity.
[1223] In some embodiments, an activator is a "Wada" activator,
i.e., the activator is from any one of Wada I, II, or III documents
cited above.
[1224] Example activating groups are depicted below:
##STR00337##
In some embodiments, an activating reagent is selected from
##STR00338##
[1225] In some embodiments, an example cycle is depicted in Scheme
I-b.
##STR00339##
[1226] In some embodiments, an example cycle is illustrated in
Scheme I-c.
##STR00340##
[1227] In Scheme I-c, oligonucleotide (or nucleotide, or
oligonucleotide with modified internucleotidic linkage) on solid
support (C-1) is coupled with phosphoramidite C-2. After coupling
and capping, an oxidation step is performed. After deblocking, a
phosphate diester linkage is formed. The cycle product C-3 can
either re-enter cycle C to install more phosphate diester linkage,
or enter other cycles to install other types of internucleotidic
linkages, or go to cycle exit.
[1228] In some embodiments, non-chirally pure phosphoramidite can
be used instead of C-2 in Scheme I-c. In some embodiments,
.beta.-cyanoethylphosphoramidites protected with DMTr is used. In
some embodiments, the phosphoramidite being used has the structure
of
##STR00341##
[1229] In some embodiments, the use of a phosphorothioate diester
precursor increases the stability of oligonucleotide during
synthesis. In some embodiments, the use of a phosphorothioate
diester precursor improves the efficiency of chirally controlled
oligonucleotide synthesis. In some embodiments, the use of a
phosphorothioate diester precursor improves the yield of chirally
controlled oligonucleotide synthesis. In some embodiments, the use
of a phosphorothioate diester precursor improves the product purity
of chirally controlled oligonucleotide synthesis.
[1230] In some embodiments, the phosphorothioate diester precursor
in the above-mentioned methods is
##STR00342##
In some embodiments,
##STR00343##
is converted to a phosphorothioate diester linkage during
deprotection/release. In some embodiments, an example cycle is
depicted in Scheme I-d. More examples are depicted below.
##STR00344##
[1231] As illustrated in Scheme I-d, both phosphorothioate and
phosphate diester linkages can be incorporated into the same
chirally controlled oligonucleotide. As understood by a person of
ordinary skill in the art, the provided methods do not require that
the phosphorothioate diester and the phosphate diester to be
consecutive--other internucleotidic linkages can form between them
using a cycle as described above. In Scheme I-d, phosphorothioate
diester precursors,
##STR00345##
are installed in place of the phosphorothioate diester linkages. In
some embodiments, such replacement provided increased synthesis
efficiency during certain steps, for instance, the oxidation step.
In some embodiments, the use of phosphorothioate diester precursors
generally improve the stability of chirally controlled
oligonucleotides during synthesis and/or storage. After cycle exit,
during deprotection/release, the phosphorothioate diester precursor
is converted to phosphorothioate diester linkage. In some
embodiments, it is beneficial to use phosphorothioate diester
precursor even when no phosphate diester linkage is present in the
chirally controlled oligonucleotide, or no oxidation step is
required during synthesis.
[1232] As in Scheme I-c, in some embodiments, non-chirally pure
phosphoramidite can be used for cycles comprising oxidation steps.
In some embodiments, .beta.-cyanoethylphosphoramidites protected
with DMTr is used. In some embodiments, the phosphoramidite being
used has the structure of
##STR00346##
[1233] In some embodiments, methods of the present disclosure
provide chirally controlled oligonucleotide compositions that are
enriched in a particular oligonucleotide type.
[1234] In some embodiments, at least about 10% of a provided crude
composition is of a particular oligonucleotide type. In some
embodiments, at least about 20% of a provided crude composition is
of a particular oligonucleotide type. In some embodiments, at least
about 30% of a provided crude composition is of a particular
oligonucleotide type. In some embodiments, at least about 40% of a
provided crude composition is of a particular oligonucleotide type.
In some embodiments, at least about 50% of a provided crude
composition is of a particular oligonucleotide type. In some
embodiments, at least about 60% of a provided crude composition is
of a particular oligonucleotide type. In some embodiments, at least
about 70% of a provided crude composition is of a particular
oligonucleotide type. In some embodiments, at least about 80% of a
provided crude composition is of a particular oligonucleotide type.
In some embodiments, at least about 90% of a provided crude
composition is of a particular oligonucleotide type. In some
embodiments, at least about 95% of a provided crude composition is
of a particular oligonucleotide type.
[1235] In some embodiments, at least about 1% of a provided
composition is of a particular oligonucleotide type. In some
embodiments, at least about 2% of a provided composition is of a
particular oligonucleotide type. In some embodiments, at least
about 3% of a provided composition is of a particular
oligonucleotide type. In some embodiments, at least about 4% of a
provided composition is of a particular oligonucleotide type. In
some embodiments, at least about 5% of a provided composition is of
a particular oligonucleotide type. In some embodiments, at least
about 10% of a provided composition is of a particular
oligonucleotide type. In some embodiments, at least about 20% of a
provided composition is of a particular oligonucleotide type. In
some embodiments, at least about 30% of a provided composition is
of a particular oligonucleotide type. In some embodiments, at least
about 40% of a provided composition is of a particular
oligonucleotide type. In some embodiments, at least about 50% of a
provided composition is of a particular oligonucleotide type. In
some embodiments, at least about 60% of a provided composition is
of a particular oligonucleotide type. In some embodiments, at least
about 70% of a provided composition is of a particular
oligonucleotide type. In some embodiments, at least about 80% of a
provided composition is of a particular oligonucleotide type. In
some embodiments, at least about 90% of a provided composition is
of a particular oligonucleotide type. In some embodiments, at least
about 95% of a provided composition is of a particular
oligonucleotide type.
[1236] In some embodiments, an example cycle is depicted in Scheme
I-e, below.
##STR00347##
[1237] In some embodiments, X is H or a 2'-modification. In some
embodiments, X is H or --OR.sup.1, wherein R.sup.1 is not hydrogen.
In some embodiments, X is H or --OR.sup.1, wherein R.sup.1 is
optionally substituted C.sub.1-6 alkyl. In some embodiments, X is
H. In some embodiments, X is --OMe. In some embodiments, X is
--OCH.sub.2CH.sub.2OCH.sub.3. In some embodiments, X is --F.
[1238] In some embodiments, an example cycle is depicted in Scheme
I-f.
##STR00348##
[1239] In some embodiments, X is H or a 2'-modification. In some
embodiments, X is H or --OR.sup.1, wherein R.sup.1 is not hydrogen.
In some embodiments, X is H or --OR.sup.1, wherein R.sup.1 is
optionally substituted C.sub.1-6 alkyl. In some embodiments, X is
H. In some embodiments, X is --OMe. In some embodiments, X is
--OCH.sub.2CH.sub.2OCH.sub.3. In some embodiments, X is --F.
[1240] It is understood by a person having ordinary skill in the
art that different types of cycles may be combined to provide
complete control of the chemical modifications and stereochemistry
of oligonucleotides. In some embodiments, for example, an
oligonucleotide synthesis process may contain one or more Cycles
A-F. In some embodiments, a provided method comprises at least one
cycle using a DPSE-type chiral auxiliary.
[1241] In some embodiments, the present disclosure provides methods
for preparing provided oligonucleotide and oligonucleotide
compositions. In some embodiments, a provide methods comprising
providing a provided chiral reagent having the structure of
##STR00349##
wherein W.sup.1 is --NG.sup.5, W.sup.2 is O, each of G.sup.1 and
G.sup.3 is independently hydrogen or an optionally substituted
group selected from C.sub.1-10 aliphatic, heterocyclyl, heteroaryl
and aryl, G.sup.2 is --C(R).sub.2Si(R).sub.3, and G.sup.4 and
G.sup.5 are taken together to form an optionally substituted
saturated, partially unsaturated or unsaturated
heteroatom-containing ring of up to about 20 ring atoms which is
monocyclic or polycyclic, fused or unfused, wherein each R is
independently hydrogen, or an optionally substituted group selected
from C.sub.1-C.sub.6 aliphatic, carbocyclyl, aryl, heteroaryl, and
heterocyclyl. In some embodiments, a provided chiral reagent has
the structure of
##STR00350##
In some embodiments, a provided methods comprises providing a
phosphoramidite comprising a moiety from a chiral reagent having
the structure of
##STR00351##
wherein --W.sup.1H and --W.sup.2H, or the hydroxyl and amino
groups, form bonds with the phosphorus atom of the phosphoramidite.
In some embodiments, --W.sup.1H and --W.sup.2H, or the hydroxyl and
amino groups, form bonds with the phosphorus atom of the
phosphoramidite, e.g., in
##STR00352##
In some embodiments, a phosphoramidite has the structure of
##STR00353## ##STR00354## ##STR00355## ##STR00356##
In some embodiments, R is a protection group. In some embodiments,
R is DMTr. In some embodiments, G.sup.2 is --C(R).sub.2Si(R).sub.3,
wherein --C(R).sub.2-- is optionally substituted --CH.sub.2--, and
each R of --Si(R).sub.3 is independently an optionally substituted
group selected from C.sub.1-10 aliphatic, heterocyclyl, heteroaryl
and aryl. In some embodiments, at least one R of --Si(R).sub.3 is
independently optionally substituted C.sub.1-10 alkyl. In some
embodiments, at least one R of --Si(R).sub.3 is independently
optionally substituted phenyl. In some embodiments, one R of
--Si(R).sub.3 is independently optionally substituted phenyl, and
each of the other two R is independently optionally substituted
C.sub.1-10 alkyl. In some embodiments, one R of --Si(R).sub.3 is
independently optionally substituted C.sub.1-10 alkyl, and each of
the other two R is independently optionally substituted phenyl. In
some embodiments, G.sup.2 is optionally substituted
--CH.sub.2Si(Ph)(Me).sub.2. In some embodiments, G.sup.2 is
optionally substituted --CH.sub.2Si(Me)(Ph).sub.2. In some
embodiments, G.sup.2 is --CH.sub.2Si(Me)(Ph).sub.2. In some
embodiments, G.sup.4 and G.sup.5 are taken together to form an
optionally substituted saturated 5-6 membered ring containing one
nitrogen atom (to which G.sup.5 is attached). In some embodiments,
G.sup.4 and G.sup.5 are taken together to form an optionally
substituted saturated 5-membered ring containing one nitrogen atom.
In some embodiments, G.sup.1 is hydrogen. In some embodiments,
G.sup.3 is hydrogen. In some embodiments, both G.sup.1 and G.sup.3
are hydrogen. In some embodiments, both G.sup.1 and G.sup.3 are
hydrogen, G.sup.2 is --C(R).sub.2Si(R).sub.3, wherein
--C(R).sub.2-- is optionally substituted --CH.sub.2--, and each R
of --Si(R).sub.3 is independently an optionally substituted group
selected from C.sub.1-10 aliphatic, heterocyclyl, heteroaryl and
aryl, and G.sup.4 and G.sup.5 are taken together to form an
optionally substituted saturated 5-membered ring containing one
nitrogen atom. In some embodiments, a provided method further
comprises providing a fluoro-containing reagent. In some
embodiments, a provided fluoro-containing reagent removes a chiral
reagent, or a product formed from a chiral reagent, from
oligonucleotides after synthesis. Various known fluoro-containing
reagents, including those F sources for removing --SiR.sub.3
groups, can be utilized in accordance with the present disclosure,
for example, TBAF, HF.sub.3-Et.sub.3N etc. In some embodiments, a
fluoro-containing reagent provides better results, for example,
shorter treatment time, lower temperature, less desulfurization,
etc, compared to traditional methods, such as concentrated ammonia.
In some embodiments, for certain fluoro-containing reagent, the
present disclosure provides linkers for improved results, for
example, less cleavage of oligonucleotides from support during
removal of chiral reagent (or product formed therefrom during
oligonucleotide synthesis). In some embodiments, a provided linker
is an SP linker. In some embodiments, the present disclosure
demonstrated that a HF-base complex can be utilized, such as
HF--NR.sub.3, to control cleavage during removal of chiral reagent
(or product formed therefrom during oligonucleotide synthesis). In
some embodiments, HF--NR.sub.3 is HF--NEt.sub.3. In some
embodiments, HF--NR.sub.3 enables use of traditional linkers, e.g.,
succinyl linker.
Biological Applications and Example of Use
[1242] Among other things, the present disclosure recognizes that
properties and activities of an oligonucleotide can be adjusted by
optimizing its pattern of backbone chiral centers through the use
of provided chirally controlled oligonucleotide compositions. In
some embodiments, the present disclosure provides chirally
controlled oligonucleotide compositions, wherein the
oligonucleotides have a common pattern of backbone chiral centers
which enhances their stability and/or biological activity. In some
embodiments, a pattern of backbone chiral centers provides
unexpectedly increased stability. In some embodiments, a pattern of
backbone chiral centers, surprisingly, provides greatly increased
activity. In some embodiments, a pattern of backbone chiral centers
provides both increased stability and activity. In some
embodiments, when an oligonucleotide is utilized to cleave a
nucleic acid polymer, a pattern of backbone chiral centers of the
oligonucleotide, surprisingly by itself, changes the cleavage
pattern of a target nucleic acid polymer. In some embodiments, a
pattern of backbone chiral centers effectively prevents cleavage at
secondary sites. In some embodiments, a pattern of backbone chiral
centers creates new cleavage sites. In some embodiments, a pattern
of backbone chiral centers minimizes the number of cleavage sites.
In some embodiments, a pattern of backbone chiral centers minimizes
the number of cleavage sites so that a target nucleic acid polymer
is cleaved at only one site within the sequence of the target
nucleic acid polymer that is complementary to the oligonucleotide.
In some embodiments, a pattern of backbone chiral centers enhances
cleavage efficiency at a cleavage site. In some embodiments, a
pattern of backbone chiral centers of the oligonucleotide improves
cleavage of a target nucleic acid polymer. In some embodiments, a
pattern of backbone chiral centers increases selectivity. In some
embodiments, a pattern of backbone chiral centers minimizes
off-target effect. In some embodiments, a pattern of backbone
chiral centers increase selectivity, e.g., cleavage selectivity
among target sequences differing by point mutations or single
nucleotide polymorphisms (SNPs). In some embodiments, a pattern of
backbone chiral centers increase selectivity, e.g., cleavage
selectivity among target sequences differing by only one point
mutation or single nucleotide polymorphism (SNP).
[1243] Among other things, it is surprisingly found that certain
provided oligonucleotide compositions achieve unprecedented control
of cleavage of target sequences, e.g., cleavage of target RNA by
RNase H. In some embodiments, the present disclosure demonstrates
that precise control of chemical and stereochemical attributes of
oligonucleotides achieves improved activity of oligonucleotide
preparations as compared with otherwise comparable preparations for
which stereochemical attributes are not controlled. Among other
things, the present disclosure specifically demonstrates improved
rate, degree, and or specificity of cleavage of nucleic acid
targets to which provided oligonucleotides hybridize.
[1244] In some embodiments, the present disclosure provides various
uses of oligonucleotide compositions. Among other things, the
present disclosure demonstrates that by controlling structural
elements of oligonucleotides, such as base sequence, chemical
modifications, stereochemistry, etc., properties of
oligonucleotides can be greatly improved. For example, in some
embodiments, the present disclosure provides methods for highly
selective suppression of transcripts of a target nucleic acid
sequence. In some embodiments, the present disclosure provides
methods for treating a subject by suppressing transcripts from a
diseasing-causing copy (e.g., a disease-causing allele). In some
embodiments, the present disclosure provides methods for designing
and preparing oligonucleotide compositions with surprisingly
enhanced activity and/or selectivity when suppressing a transcript
of a target sequence. In some embodiments, the present disclosure
provides methods for designing and/or preparing oligonucleotide
compositions which provide allele-specific suppression of a
transcript from a target nucleic acid sequence.
[1245] In some embodiments, the present disclosure provides a
method for controlled cleavage of a nucleic acid polymer, the
method comprising steps of:
[1246] contacting a nucleic acid polymer whose nucleotide sequence
comprises a target sequence with a chirally controlled
oligonucleotide composition comprising oligonucleotides of a
particular oligonucleotide type characterized by: [1247] 1) a
common base sequence and length, wherein the common base sequence
is or comprises a sequence that is complementary to a target
sequence found in the nucleic acid polymer; [1248] 2) a common
pattern of backbone linkages; and [1249] 3) a common pattern of
backbone chiral centers; which composition is chirally controlled
in that it is enriched, relative to a substantially racemic
preparation of oligonucleotides having the particular base sequence
and length, for oligonucleotides of the particular oligonucleotide
type.
[1250] In some embodiments, the present disclosure provides a
method for altering a cleavage pattern observed when a nucleic acid
polymer whose nucleotide sequence includes a target sequence is
contacted with a reference oligonucleotide composition that
comprises oligonucleotides having a particular base sequence and
length, which particular base sequence is or comprises a sequence
that is complementary to the target sequence, the method
comprising:
[1251] contacting the nucleic acid polymer with a chirally
controlled oligonucleotide composition of oligonucleotides having
the particular base sequence and length, which composition is
chirally controlled in that it is enriched, relative to a
substantially racemic preparation of oligonucleotides having the
particular base sequence and length, for oligonucleotides of a
single oligonucleotide type characterized by: [1252] 1) the
particular base sequence and length; [1253] 2) a particular pattern
of backbone linkages; and [1254] 3) a particular pattern of
backbone chiral centers.
[1255] In some embodiments, the present disclosure provides a
method for controlled cleavage of a nucleic acid polymer,
comprising providing a chirally controlled oligonucleotide
composition comprising oligonucleotides defined by having: [1256]
1) a common base sequence and length, wherein the common base
sequence is or comprises a sequence that is complementary to a
sequence found in the nucleic acid polymer; [1257] 2) a common
pattern of backbone linkages; [1258] 3) a common pattern of
backbone chiral centers, which composition is a substantially pure
preparation of a single oligonucleotide in that at least about 10%
of the oligonucleotides in the composition have the common base
sequence and length, the common pattern of backbone linkages, and
the common pattern of backbone chiral centers; and wherein the
nucleic acid polymer is cleaved in a cleavage pattern that is
different than the cleavage pattern when chirally uncontrolled
oligonucleotide composition is provided.
[1259] As used herein, a cleavage pattern of a nucleic acid polymer
is defined by the number of cleavage sites, the locations of the
cleavage sites, and the percentage of cleavage at each sites. In
some embodiments, a cleavage pattern has multiple cleavage sites,
and the percentage of cleavage at each site is different. In some
embodiments, a cleavage pattern has multiple cleavage sites, and
the percentage of cleavage at each site is the same. In some
embodiments, a cleavage pattern has only one cleavage site. In some
embodiments, cleavage patterns differ from each other in that they
have different numbers of cleavage sites. In some embodiments,
cleavage patterns differ from each other in that at least one
cleavage location is different. In some embodiments, cleavage
patterns differ from each other in that the percentage of cleavage
at least one common cleavage site is different. In some
embodiments, cleavage patterns differ from each other in that they
have different numbers of cleavage sites, and/or at least one
cleavage location is different, and/or the percentage of cleavage
at least one common cleavage site is different.
[1260] In some embodiments, the present disclosure provides a
method for controlled cleavage of a nucleic acid polymer, the
method comprising steps of:
[1261] contacting a nucleic acid polymer whose nucleotide sequence
comprises a target sequence with a chirally controlled
oligonucleotide composition comprising oligonucleotides of a
particular oligonucleotide type characterized by: [1262] 1) a
common base sequence and length, wherein the common base sequence
is or comprises a sequence that is complementary to a target
sequence found in the nucleic acid polymer; [1263] 2) a common
pattern of backbone linkages; and [1264] 3) a common pattern of
backbone chiral centers; which composition is chirally controlled
in that it is enriched, relative to a substantially racemic
preparation of oligonucleotides having the particular base sequence
and length, for oligonucleotides of the particular oligonucleotide
type, the contacting being performed under conditions so that
cleavage of the nucleic acid polymer occurs.
[1265] In some embodiments, the present disclosure provides a
method for changing a first cleavage pattern of a nucleic acid
polymer resulted from using a first oligonucleotide composition,
comprising providing a second chirally controlled oligonucleotide
composition comprising oligonucleotides defined by having: [1266]
1) a common base sequence and length, wherein the common base
sequence is or comprises a sequence that is complementary to a
sequence found in the nucleic acid polymer; [1267] 2) a common
pattern of backbone linkages; [1268] 3) a common pattern of
backbone chiral centers, which composition is a substantially pure
preparation of a single oligonucleotide in that at least about 10%
of the oligonucleotides in the composition have the common base
sequence and length, the common pattern of backbone linkages, and
the common pattern of backbone chiral centers; and wherein the
nucleic acid polymer is cleaved in a cleavage pattern that is
different than the first cleavage pattern.
[1269] In some embodiments, the present disclosure provides a
method for altering a cleavage pattern observed when a nucleic acid
polymer whose nucleotide sequence includes a target sequence is
contacted with a reference oligonucleotide composition that
comprises oligonucleotides having a particular base sequence and
length, which particular base sequence is or comprises a sequence
that is complementary to the target sequence, the method
comprising:
[1270] contacting the nucleic acid polymer with a chirally
controlled oligonucleotide composition of oligonucleotides having
the particular base sequence and length, which composition is
chirally controlled in that it is enriched, relative to a
substantially racemic preparation of oligonucleotides having the
particular base sequence and length, for oligonucleotides of a
single oligonucleotide type characterized by:
[1271] 1) the particular base sequence and length;
[1272] 2) a particular pattern of backbone linkages; and
[1273] 3) a particular pattern of backbone chiral centers,
the contacting being performed under conditions so that cleavage of
the nucleic acid polymer occurs.
[1274] In some embodiments, a provided chirally controlled
oligonucleotide composition reduces the number of cleavage sites
within the target sequence. In some embodiments, a provided
chirally controlled oligonucleotide composition provides
single-site cleavage within the target sequence. In some
embodiments, a chirally controlled oligonucleotide composition
provides enhanced cleavage rate at a cleavage site within the
target sequence. In some embodiments, a chirally controlled
oligonucleotide composition provides enhanced efficiency at a
cleavage site within the target sequence. In some embodiments, a
chirally controlled oligonucleotide composition provides increased
turn-over in cleaving a target nucleic acid polymer. In some
embodiments, a chirally controlled oligonucleotide composition
increase percentage of cleavage at a site within or in the vicinity
of a characteristic sequence element. In some embodiments, a
chirally controlled oligonucleotide composition increase percentage
of cleavage at a site in the vicinity of a mutation. In some
embodiments, a chirally controlled oligonucleotide composition
increase percentage of cleavage at a site in the vicinity of a SNP.
Example embodiments of a site within or in the vicinity of a
characteristic sequence element, in the vicinity of a mutation, in
the vicinity of a SNP, are described in the present disclosure. For
example, in some embodiments, a cleavage site in the vicinity is a
cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic linkages away
from a mutation; in some other embodiments, a cleavage site in the
vicinity is a cleavage site 0, 1, 2, 3, 4, or 5 internucleotidic
linkages away from a SNP.
[1275] In some embodiments, cleavage occurs with a cleavage pattern
differs from a reference cleavage pattern. In some embodiments, a
reference cleavage pattern is one observed when a nucleic acid
polymer is contacted under comparable conditions with a reference
oligonucleotide composition. In some embodiments, a reference
oligonucleotide composition is a chirally uncontrolled (e.g.,
stereorandom) oligonucleotide composition of oligonucleotides that
share the common base sequence and length of a chirally controlled
oligonucleotide composition. In some embodiments, a reference
oligonucleotide composition is a substantially racemic preparation
of oligonucleotides that share the common sequence and length.
[1276] In some embodiments, a nucleic acid polymer is RNA. In some
embodiments, a nucleic acid polymer is an oligonucleotide. In some
embodiments, a nucleic acid polymer is an RNA oligonucleotide. In
some embodiments, a nucleic acid polymer is a transcript. In some
embodiments, oligonucleotides of a provided chirally controlled
oligonucleotide composition form duplexes with a nucleic acid
polymer to be cleaved.
[1277] In some embodiments, a nucleic acid polymer is cleaved by an
enzyme. In some embodiments, an enzyme cleaves a duplex formed by a
nucleic acid polymer. In some embodiments, an enzyme is RNase H. In
some embodiments, an enzyme is Dicer. In some embodiments, an
enzyme is an Argonaute protein. In some embodiments, an enzyme is
Ago2. In some embodiments, an enzyme is within a protein complex.
An example protein complex is RNA-induced silencing complex
(RISC).
[1278] In some embodiments, a provided chirally controlled
oligonucleotide composition comprising oligonucleotides with a
common pattern of backbone chiral centers provides unexpectedly
high selectivity so that nucleic acid polymers that have only small
sequence variations within a target region can be selectively
targeted. In some embodiments, a nucleic acid polymer is a
transcript from an allele. In some embodiments, transcripts from
different alleles can be selectively targeted by provided chirally
controlled oligonucleotide compositions.
[1279] In some embodiments, provided chirally controlled
oligonucleotide compositions and methods thereof enables precise
control of cleavage sites within a target sequence. In some
embodiments, a cleavage site is around a sequence of RpSpSp
backbone chiral centers. In some embodiments, a cleavage site is
upstream of and near a sequence of RpSpSp backbone chiral centers.
In some embodiments, a cleavage site is within 5 base pairs
upstream of a sequence of RpSpSp backbone chiral centers. In some
embodiments, a cleavage site is within 4 base pairs upstream of a
sequence of RpSpSp backbone chiral centers. In some embodiments, a
cleavage site is within 3 base pairs upstream of a sequence of
RpSpSp backbone chiral centers. In some embodiments, a cleavage
site is within 2 base pairs upstream of a sequence of RpSpSp
backbone chiral centers. In some embodiments, a cleavage site is
within 1 base pair upstream of a sequence of RpSpSp backbone chiral
centers. In some embodiments, a cleavage site is downstream of and
near a sequence of RpSpSp backbone chiral centers. In some
embodiments, a cleavage site is within 5 base pairs downstream of a
sequence of RpSpSp backbone chiral centers. In some embodiments, a
cleavage site is within 4 base pairs downstream of a sequence of
RpSpSp backbone chiral centers. In some embodiments, a cleavage
site is within 3 base pairs downstream of a sequence of RpSpSp
backbone chiral centers. In some embodiments, a cleavage site is
within 2 base pairs downstream of a sequence of RpSpSp backbone
chiral centers. In some embodiments, a cleavage site is within 1
base pair downstream of a sequence of RpSpSp backbone chiral
centers. Among other things, the present disclosure therefore
provides control of cleavage sites with in a target sequence. In
some embodiments, an example cleavage is depicted in FIG. 21. In
some embodiments, cleavage depicted in FIG. 21 is designated as
cleavage at a site two base pairs downstream a sequence of RpSpSp
backbone chiral centers. As extensively described in the present
disclosure, a sequence of RpSpSp backbone chiral centers can be
found in a single or repeating units of
(Np).sub.m(Rp).sub.n(Sp).sub.t, (Np).sub.t(Rp).sub.n(Sp).sub.m,
(Sp).sub.m(Rp).sub.n(Sp).sub.t, (Sp).sub.t(Rp).sub.n(Sp).sub.m,
(Rp).sub.n(Sp).sub.m, (Rp).sub.m(Sp).sub.n, (Sp).sub.mRp and/or
Rp(Sp).sub.m, each of which is independently as defined above and
described herein. In some embodiments, a provided chirally
controlled oligonucleotide composition creates a new cleavage site
2 base pairs downstream of RpSpSp backbone chiral centers in a
target molecule (e.g., see FIG. 21), wherein said new cleavage site
does not exist if a reference (e.g., chirally uncontrolled)
oligonucleotide composition is used (cannot be detected). In some
embodiments, a provided chirally controlled oligonucleotide
composition enhances cleavage at a cleavage site 2 base pairs
downstream of RpSpSp backbone chiral centers in a target molecule
(e.g., see FIG. 21), wherein cleavage at such a site occurs at a
higher percentage than when a reference (e.g., chirally
uncontrolled) oligonucleotide composition is used. In some
embodiments, cleavage at such a site by a provided chirally
controlled oligonucleotide composition is at least 2, 3, 4, 5, 6,
7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 500 or 1000
fold of that by a reference oligonucleotide composition (for
example, when measured by percentage of cleavage at a site). In
some embodiments, a provided chirally controlled oligonucleotide
composition provides accelerated cleavage at a cleavage site 2 base
pairs downstream of RpSpSp backbone chiral centers in a target
molecule (e.g., see FIG. 21), compared to when a reference (e.g.,
chirally uncontrolled) oligonucleotide composition is used. In some
embodiments, cleavage by a provided chirally controlled
oligonucleotide composition is at least 2, 3, 4, 5, 6, 7, 8, 9, 10,
20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 500 or 1000 fold faster
than that by a reference oligonucleotide composition. In some
embodiments, a cleavage site of a provided chirally controlled
oligonucleotide composition 2 base pairs downstream of RpSpSp
backbone chiral centers in a target molecule (e.g., see FIG. 21) is
a cleavage site when a reference (e.g., chirally uncontrolled)
oligonucleotide composition is used. In some embodiments, a
cleavage site of a provided chirally controlled oligonucleotide
composition 2 base pairs downstream of RpSpSp backbone chiral
centers in a target molecule (e.g., see FIG. 21) is within one base
pair of a cleavage site when a reference (e.g., chirally
uncontrolled) oligonucleotide composition is used. In some
embodiments, a cleavage site of a provided chirally controlled
oligonucleotide composition 2 base pairs downstream of RpSpSp
backbone chiral centers in a target molecule (e.g., see FIG. 21) is
within 2 base pairs of a cleavage site when a reference (e.g.,
chirally uncontrolled) oligonucleotide composition is used. In some
embodiments, it is within 3 base pairs. In some embodiments, it is
within 4 base pairs. In some embodiments, it is within 5 base
pairs. In some embodiments, a cleavage site of a provided chirally
controlled oligonucleotide composition 2 base pairs downstream of
RpSpSp backbone chiral centers in a target molecule is one of the
major cleavage sites when a reference (e.g., chirally uncontrolled)
oligonucleotide composition is used. In some embodiments, such a
site is the cleavage site with the highest cleavage percentage when
a reference (e.g., chirally uncontrolled) oligonucleotide
composition is used. In some embodiments, a cleavage site of a
provided chirally controlled oligonucleotide composition 2 base
pairs downstream of RpSpSp backbone chiral centers in a target
molecule is one of the cleavage sites with higher cleavage rate
when a reference (e.g., chirally uncontrolled) oligonucleotide
composition is used. In some embodiments, such a site is the
cleavage site with the highest cleavage rate when a reference
(e.g., chirally uncontrolled) oligonucleotide composition is
used.
[1280] In some embodiments, a provided chirally controlled
oligonucleotide composition enhances cleavage at one or more sites,
e.g., relative to a reference (e.g., chirally
uncontrolled/stereorandom) oligonucleotide composition. In some
embodiments, a provided chirally controlled oligonucleotide
composition selectively enhances cleavage at a single site relative
to a reference (e.g., chirally uncontrolled/stereorandom)
composition. In some embodiments, a chirally controlled
oligonucleotide composition enhances cleavage at a site by
providing a higher cleavage rate. In some embodiments, a chirally
controlled oligonucleotide composition enhances cleavage at a site
by providing a higher percentage of cleavage at said site.
Percentage of cleavage at a site can be determined by various
methods widely known and practiced in the art. In some embodiments,
percentage of cleavage at a site is determined by analysis of
cleavage products, for example, as by HPLC-MS as illustrated in
FIG. 18, FIG. 19 and FIG. 30; see also example cleavage maps such
as FIG. 9, FIG. 10, FIG. 11, FIG. 14, FIG. 22, FIG. 25 and FIG. 26.
In some embodiments, enhancement is relative to a reference
oligonucleotide composition. In some embodiments, enhancement is
relative to another cleavage site. In some embodiments, a provided
chirally controlled oligonucleotide composition enhances cleavage
at a site that is a preferred cleavage site of a reference
oligonucleotide composition. In some embodiments, a preferred
cleavage site, or a group of preferred cleavage sites, is a site or
sites that have relatively higher percentage of cleavage compared
to one or more other cleavage sites. In some embodiments, preferred
cleavage sites can indicate preference of an enzyme. For example,
for RNase H, when a DNA oligonucleotide is used, resulting cleavage
sites may indicate preference of RNase H. In some embodiments, a
provided chirally controlled oligonucleotide composition enhances
cleavage at a site that is a preferred cleavage site of an enzyme.
In some embodiments, a provided chirally controlled oligonucleotide
composition enhances cleavage at a site that is not a preferred
cleavage site of a reference oligonucleotide composition. In some
embodiments, a provided chirally controlled oligonucleotide
composition enhances cleavage at a site that is not a cleavage site
of a reference oligonucleotide composition, effectively creating a
new cleavage site which does not exist when a reference
oligonucleotide composition is used. In some embodiments, a
provided chirally controlled oligonucleotide composition enhances
cleavage at a site within 5 base pairs from a targeted mutation or
SNP, thereby increasing selective cleavage of the undesired target
oligonucleotide. In some embodiments, a provided chirally
controlled oligonucleotide composition enhances cleavage at a site
within 4 base pairs from a targeted mutation or SNP, thereby
increasing selective cleavage of the undesired target
oligonucleotide. In some embodiments, a provided chirally
controlled oligonucleotide composition enhances cleavage at a site
within 3 base pairs from a targeted mutation or SNP, thereby
increasing selective cleavage of the undesired target
oligonucleotide. In some embodiments, a provided chirally
controlled oligonucleotide composition enhances cleavage at a site
within 2 base pairs from a targeted mutation or SNP, thereby
increasing selective cleavage of the undesired target
oligonucleotide. In some embodiments, a provided chirally
controlled oligonucleotide composition enhances cleavage at a site
immediately upstream or downstream targeted mutation or SNP,
thereby increasing selective cleavage of the undesired target
oligonucleotide (e.g., FIG. 22, Panel D, muRNA).
[1281] In some embodiments, a provided chirally controlled
oligonucleotide composition suppresses cleavage at one or more
sites, e.g., relative to a reference (e.g., chirally
uncontrolled/stereorandom) oligonucleotide composition. In some
embodiments, a provided chirally controlled oligonucleotide
composition selectively suppresses cleavage at a single site
relative to a reference (e.g., chirally uncontrolled/stereorandom)
composition. In some embodiments, a chirally controlled
oligonucleotide composition suppresses cleavage at a site by
providing a lower cleavage rate. In some embodiments, a chirally
controlled oligonucleotide composition suppresses cleavage at a
site by providing a lower percentage of cleavage at said site. In
some embodiments, suppression is relative to a reference
oligonucleotide composition. In some embodiments, suppression is
relative to another cleavage site. In some embodiments, a provided
chirally controlled oligonucleotide composition suppresses cleavage
at a site that is a preferred cleavage site of a reference
oligonucleotide composition. In some embodiments, a preferred
cleavage site, or a group of preferred cleavage sites, is a site or
sites that have relatively higher percentage of cleavage compared
to one or more other cleavage sites. In some embodiments, preferred
cleavage sites can indicate preference of an enzyme. For example,
for RNase H, when a DNA oligonucleotide is used, resulting cleavage
sites may indicate preference of RNase H. In some embodiments, a
provided chirally controlled oligonucleotide composition suppresses
cleavage at a site that is a preferred cleavage site of an enzyme.
In some embodiments, a provided chirally controlled oligonucleotide
composition suppresses cleavage at a site that is not a preferred
cleavage site of a reference oligonucleotide composition. In some
embodiments, a provided chirally controlled oligonucleotide
composition suppresses all cleavage sites of a reference
oligonucleotide composition. In some embodiments, a provided
chirally controlled oligonucleotide composition generally enhances
cleavage of target oligonucleotides. In some embodiments, a
provided chirally controlled oligonucleotide composition generally
suppresses cleavage of non-target oligonucleotides. In some
embodiments, a provided chirally controlled oligonucleotide
composition enhances cleavage of target oligonucleotides and
suppresses cleavage of non-target oligonucleotides. Using FIG. 22,
Panel D, as an example, a target oligonucleotide for cleavage is
muRNA, while a non-target oligonucleotide is wtRNA. In a subject
comprising a diseased tissue comprising a mutation or SNP, a target
oligonucleotide for cleavage can be transcripts with a mutation or
SNP, while a non-target oligonucleotide can be normal transcripts
without a mutation or SNP, such as those expressed in healthy
tissues.
[1282] In some embodiments, a reference oligonucleotide composition
is a stereorandom oligonucleotide composition. In some embodiments,
a reference oligonucleotide composition is a stereorandom
composition of oligonucleotides of which all internucleotidic
linkages are phosphorothioate. In some embodiments, a reference
oligonucleotide composition is a DNA oligonucleotide composition
with all phosphate linkages.
[1283] In some embodiments, besides patterns of backbone chiral
centers described herein, provided oligonucleotides optionally
comprises modified bases, modified sugars, modified backbone
linkages and any combinations thereof. In some embodiments, a
provided oligonucleotide is a unimer, altmer, blockmer, gapmer,
hemimer and skipmer. In some embodiments, a provided
oligonucleotide comprises one or more unimer, altmer, blockmer,
gapmer, hemimer or skipmer moieties, or any combinations thereof.
In some embodiments, besides patterns of backbone chiral centers
herein, a provided oligonucleotide is a hemimer. In some
embodiments, besides patterns of backbone chiral centers herein, a
provided oligonucleotide is a 5'-hemimer with modified sugar
moieties. In some embodiments, a provided oligonucleotide is
5'-hemimer with 2'-modified sugar moieties. Suitable modifications
are widely known in the art, e.g., those described in the present
application. In some embodiments, a modification is 2'-F. In some
embodiments, a modification is 2'-MOE. In some embodiments, a
modification is s-cEt.
[1284] In some embodiments, the present disclosure provides a
method for suppression of a transcript from a target nucleic acid
sequence for which one or more similar nucleic acid sequences exist
within a population, each of the target and similar sequences
contains a specific nucleotide characteristic sequence element that
defines the target sequence relative to the similar sequences, the
method comprising steps of:
[1285] contacting a sample comprising transcripts of the target
nucleic acid sequence with an oligonucleotide composition
comprising oligonucleotides having:
[1286] 1) a common base sequence and length; and
[1287] 2) a common pattern of backbone linkages;
[1288] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines the target nucleic acid sequence, the composition being
characterized in that, when it is contacted with a system
comprising transcripts of both the target nucleic acid sequence and
a similar nucleic acid sequences, transcripts of the target nucleic
acid sequence are suppressed at a greater level than a level of
suppression observed for a similar nucleic acid sequence.
[1289] In some embodiments, the present disclosure provides a
method for suppression of a transcript from a target nucleic acid
sequence for which one or more similar nucleic acid sequences exist
within a population, each of the target and similar sequences
contains a specific nucleotide characteristic sequence element that
defines the target sequence relative to the similar sequences, the
method comprising steps of:
[1290] contacting a sample comprising transcripts of the target
nucleic acid sequence with an oligonucleotide composition
comprising oligonucleotides having:
[1291] 1) a common base sequence and length; and
[1292] 2) a common pattern of backbone linkages;
[1293] 3) a common pattern of backbone chiral centers;
[1294] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines the target nucleic acid sequence, the composition being
characterized in that, when it is contacted with a system
comprising transcripts of both the target nucleic acid sequence and
a similar nucleic acid sequences, transcripts of the target nucleic
acid sequence are suppressed at a greater level than a level of
suppression observed for a similar nucleic acid sequence.
[1295] In some embodiments, a common base sequence is or comprises
a sequence that is 100% complementary to the characteristic
sequence elements. In some embodiments, suppression can be assessed
through various suitable assays as known by a person having
ordinary skill in the art. In some embodiments, an assay is a RNase
H assay as described in the present disclosure, which can assess
suppression by evaluating cleavage of a sequence found in a
transcript of a target nucleic acid sequence comprising the
characteristic sequence element and cleavage of a sequence found in
a transcript of a similar sequence. In some embodiments,
transcripts of the target nucleic acid sequence are suppressed at a
greater level than a level of suppression observed for any one of
the similar nucleic acid sequence. In some embodiments, example
target and similar sequences are described in the present
disclosure.
[1296] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target nucleic acid sequence for which a plurality of alleles exist
within a population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target nucleic acid sequence, the method
comprising steps of:
[1297] contacting a sample comprising transcripts of the target
nucleic acid sequence with an oligonucleotide composition
comprising oligonucleotides having:
[1298] 1) a common base sequence and length; and
[1299] 2) a common pattern of backbone linkages;
[1300] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines a particular allele, the composition being characterized in
that, when it is contacted with a system comprising transcripts of
both the target allele and another allele of the same nucleic acid
sequence, transcripts of the particular allele are suppressed at a
greater level than a level of suppression observed for another
allele of the same nucleic acid sequence.
[1301] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target nucleic acid sequence for which a plurality of alleles exist
within a population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target nucleic acid sequence, the method
comprising steps of:
[1302] contacting a sample comprising transcripts of the target
nucleic acid sequence with a chirally controlled oligonucleotide
composition comprising oligonucleotides of a particular
oligonucleotide type characterized by:
[1303] 1) a common base sequence and length;
[1304] 2) a common pattern of backbone linkages;
[1305] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type; wherein the common base
sequence for the oligonucleotides of the particular oligonucleotide
type is or comprises a sequence that is complementary to the
characteristic sequence element that defines a particular allele,
the composition being characterized in that, when it is contacted
with a system comprising transcripts of both the target allele and
another allele of the same nucleic acid sequence, transcripts of
the particular allele are suppressed at a greater level than a
level of suppression observed for another allele of the same
nucleic acid sequence.
[1306] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target nucleic acid sequence for which a plurality of alleles exist
within a population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target nucleic acid sequence, the method
comprising steps of:
[1307] contacting a sample comprising transcripts of the target
nucleic acid sequence with a chirally controlled oligonucleotide
composition comprising oligonucleotides of a particular
oligonucleotide type characterized by:
[1308] 1) a common base sequence and length;
[1309] 2) a common pattern of backbone linkages;
[1310] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type; wherein the common base
sequence for the oligonucleotides of the particular oligonucleotide
type is or comprises a sequence that is complementary to the
characteristic sequence element that defines a particular allele,
the composition being characterized in that, when it is contacted
with a system comprising transcripts of both the target allele and
another allele of the same nucleic acid sequence, transcripts of
the particular allele are suppressed at a greater level than a
level of suppression observed for another allele of the same
nucleic acid sequence, the contacting being performed under
conditions determined to permit the composition to suppress
transcripts of the particular allele.
[1311] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target nucleic acid sequence for which a plurality of alleles exist
within a population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target nucleic acid sequence, the method
comprising steps of:
[1312] contacting a sample comprising transcripts of the target
nucleic acid sequence with an oligonucleotide composition
comprising oligonucleotides having:
[1313] 1) a common base sequence and length;
[1314] 2) a common pattern of backbone linkages;
[1315] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines a particular allele, the composition being characterized in
that, when it is contacted with a system comprising transcripts of
the same target nucleic acid sequence, it shows suppression of
transcripts of the particular allele at a level that is:
[1316] a) greater than when the composition is absent;
[1317] b) greater than a level of suppression observed for another
allele of the same nucleic acid sequence; or
[1318] c) both greater than when the composition is absent, and
greater than a level of suppression observed for another allele of
the same nucleic acid sequence.
[1319] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target nucleic acid sequence for which a plurality of alleles exist
within a population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target nucleic acid sequence, the method
comprising steps of:
[1320] contacting a sample comprising transcripts of the target
nucleic acid sequence with a chirally controlled oligonucleotide
composition comprising oligonucleotides of a particular
oligonucleotide type characterized by:
[1321] 1) a common base sequence and length;
[1322] 2) a common pattern of backbone linkages;
[1323] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type; wherein the common base
sequence for the oligonucleotides of the particular oligonucleotide
type is or comprises a sequence that is complementary to the
characteristic sequence element that defines a particular allele,
the composition being characterized in that, when it is contacted
with a system comprising transcripts of the same target nucleic
acid sequence, it shows suppression of transcripts of the
particular allele at a level that is:
[1324] a) greater than when the composition is absent;
[1325] b) greater than a level of suppression observed for another
allele of the same nucleic acid sequence; or
[1326] c) both greater than when the composition is absent, and
greater than a level of suppression observed for another allele of
the same nucleic acid sequence.
[1327] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target nucleic acid sequence for which a plurality of alleles exist
within a population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target nucleic acid sequence, the method
comprising steps of:
[1328] contacting a sample comprising transcripts of the target
nucleic acid sequence with a chirally controlled oligonucleotide
composition comprising oligonucleotides of a particular
oligonucleotide type characterized by:
[1329] 1) a common base sequence and length;
[1330] 2) a common pattern of backbone linkages;
[1331] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type; wherein the common base
sequence for the oligonucleotides of the particular oligonucleotide
type is or comprises a sequence that is complementary to the
characteristic sequence element that defines a particular allele,
the composition being characterized in that, when it is contacted
with a system comprising transcripts of the same target nucleic
acid sequence, it shows suppression of transcripts of the
particular allele at a level that is:
[1332] a) greater than when the composition is absent;
[1333] b) greater than a level of suppression observed for another
allele of the same nucleic acid sequence; or
[1334] c) both greater than when the composition is absent, and
greater than a level of suppression observed for another allele of
the same nucleic acid sequence,
the contacting being performed under conditions determined to
permit the composition to suppress transcripts of the particular
allele.
[1335] In some embodiments, a transcript is suppressed by cleavage
of said transcript. In some embodiments, a specific nucleotide
characteristic sequence element is in an intron. In some
embodiments, a specific nucleotide characteristic sequence element
is in an exon. In some embodiments, a specific nucleotide
characteristic sequence element is partially in an exon and
partially in an intron. In some embodiments, a specific nucleotide
characteristic sequence element comprises a mutation that
differentiates an allele from other alleles. In some embodiments, a
mutation is a deletion. In some embodiments, a mutation is an
insertion. In some embodiments, a mutation is a point mutation. In
some embodiments, a specific nucleotide characteristic sequence
element comprises at least one single nucleotide polymorphism (SNP)
that differentiates an allele from other alleles.
[1336] In some embodiments, a target nucleic acid sequence is a
target gene.
[1337] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a gene whose sequence
comprises at least one single nucleotide polymorphism (SNP),
comprising providing a chirally controlled oligonucleotide
composition comprising oligonucleotides defined by having: [1338]
1) a common base sequence and length, wherein the common base
sequence is or comprises a sequence that is completely
complementary to a sequence found in a transcript from the first
allele but not to the corresponding sequence found in a transcript
from the second allele, wherein the sequence found in the
transcripts comprises a SNP site; [1339] 2) a common pattern of
backbone linkages; [1340] 3) a common pattern of backbone chiral
centers, which composition is a substantially pure preparation of a
single oligonucleotide in that at least about 10% of the
oligonucleotides in the composition have the common base sequence
and length, the common pattern of backbone linkages, and the common
pattern of backbone chiral centers; wherein the transcript from the
first allele is suppressed at least five folds more than that from
the second allele.
[1341] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target gene for which a plurality of alleles exist within a
population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target gene, the method comprising steps
of:
[1342] contacting a sample comprising transcripts of the target
gene with an oligonucleotide composition comprising
oligonucleotides having:
[1343] 1) a common base sequence and length;
[1344] 2) a common pattern of backbone linkages;
[1345] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines a particular allele, the composition being characterized in
that, when it is contacted with a system comprising transcripts of
both the target allele and another allele of the same gene,
transcripts of the particular allele are suppressed at a level at
least 2 fold greater than a level of suppression observed for
another allele of the same gene.
[1346] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target gene for which a plurality of alleles exist within a
population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target gene, the method comprising steps
of:
[1347] contacting a sample comprising transcripts of the target
gene with a chirally controlled oligonucleotide composition
comprising oligonucleotides of a particular oligonucleotide type
characterized by:
[1348] 1) a common base sequence and length;
[1349] 2) a common pattern of backbone linkages;
[1350] 3) a common pattern of backbone chiral centers;
[1351] which composition is chirally controlled in that it is
enriched, relative to a substantially racemic preparation of
oligonucleotides having the same base sequence and length, for
oligonucleotides of the particular oligonucleotide type;
[1352] wherein the common base sequence for the oligonucleotides of
the particular oligonucleotide type is or comprises a sequence that
is complementary to the characteristic sequence element that
defines a particular allele, the composition being characterized in
that, when it is contacted with a system comprising transcripts of
both the target allele and another allele of the same gene,
transcripts of the particular allele are suppressed at a level at
least 2 fold greater than a level of suppression observed for
another allele of the same gene.
[1353] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target gene for which a plurality of alleles exist within a
population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target gene, the method comprising steps
of:
[1354] contacting a sample comprising transcripts of the target
gene with a chirally controlled oligonucleotide composition
comprising oligonucleotides of a particular oligonucleotide type
characterized by:
[1355] 1) a common base sequence and length;
[1356] 2) a common pattern of backbone linkages;
[1357] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type; wherein the common base
sequence for the oligonucleotides of the particular oligonucleotide
type is or comprises a sequence that is complementary to the
characteristic sequence element that defines a particular allele,
the composition being characterized in that, when it is contacted
with a system comprising transcripts of both the target allele and
another allele of the same gene, transcripts of the particular
allele are suppressed at a level at least 2 fold greater than a
level of suppression observed for another allele of the same gene,
the contacting being performed under conditions determined to
permit the composition to suppress transcripts of the particular
allele.
[1358] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target gene for which a plurality of alleles exist within a
population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target gene, the method comprising steps
of:
[1359] contacting a sample comprising transcripts of the target
gene with a chirally controlled oligonucleotide composition
comprising oligonucleotides of a particular oligonucleotide type
characterized by:
[1360] 1) a common base sequence and length;
[1361] 2) a common pattern of backbone linkages;
[1362] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type; wherein the common base
sequence for the oligonucleotides of the particular oligonucleotide
type is or comprises a sequence that is complementary to the
characteristic sequence element that defines a particular allele,
the composition being characterized in that, when it is contacted
with a system expressing transcripts of both the target allele and
another allele of the same gene, transcripts of the particular
allele are suppressed at a level at least 2 fold greater than a
level of suppression observed for another allele of the same gene,
the contacting being performed under conditions determined to
permit the composition to suppress expression of the particular
allele.
[1363] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target gene for which a plurality of alleles exist within a
population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target gene, the method comprising steps
of:
[1364] contacting a sample comprising transcripts of the target
gene with an oligonucleotide composition comprising
oligonucleotides having:
[1365] 1) a common base sequence and length; and
[1366] 2) a common pattern of backbone linkages;
[1367] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines a particular allele, the composition being characterized in
that, when it is contacted with a system expressing transcripts of
the target gene, it shows suppression of expression of transcripts
of the particular allele at a level that is:
[1368] a) at least 2 fold in that transcripts from the particular
allele are detected in amounts that are 2 fold lower when the
composition is present relative to when it is absent;
[1369] b) at least 2 fold greater than a level of suppression
observed for another allele of the same gene; or
[1370] c) both at least 2 fold in that transcripts from the
particular allele are detected in amounts that are 2 fold lower
when the composition is present relative to when it is absent, and
at least 2 fold greater than a level of suppression observed for
another allele of the same gene.
[1371] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target gene for which a plurality of alleles exist within a
population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target gene, the method comprising steps
of:
[1372] contacting a sample comprising transcripts of the target
gene with a chirally controlled oligonucleotide composition
comprising oligonucleotides of a particular oligonucleotide type
characterized by:
[1373] 1) a common base sequence and length;
[1374] 2) a common pattern of backbone linkages;
[1375] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type; wherein the common base
sequence for the oligonucleotides of the particular oligonucleotide
type is or comprises a sequence that is complementary to the
characteristic sequence element that defines a particular allele,
the composition being characterized in that, when it is contacted
with a system expressing transcripts of the target gene, it shows
suppression of expression of transcripts of the particular allele
at a level that is:
[1376] a) at least 2 fold in that transcripts from the particular
allele are detected in amounts that are 2 fold lower when the
composition is present relative to when it is absent;
[1377] b) at least 2 fold greater than a level of suppression
observed for another allele of the same gene; or
[1378] c) both at least 2 fold in that transcripts from the
particular allele are detected in amounts that are 2 fold lower
when the composition is present relative to when it is absent, and
at least 2 fold greater than a level of suppression observed for
another allele of the same gene.
[1379] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target gene for which a plurality of alleles exist within a
population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target gene, the method comprising steps
of:
[1380] contacting a sample comprising transcripts of the target
gene with a chirally controlled oligonucleotide composition
comprising oligonucleotides of a particular oligonucleotide type
characterized by:
[1381] 1) a common base sequence and length;
[1382] 2) a common pattern of backbone linkages;
[1383] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type; wherein the common base
sequence for the oligonucleotides of the particular oligonucleotide
type is or comprises a sequence that is complementary to the
characteristic sequence element that defines a particular allele,
the composition being characterized in that, when it is contacted
with a system expressing transcripts of the target gene, it shows
suppression of expression of transcripts of the particular allele
at a level that is:
[1384] a) at least 2 fold in that transcripts from the particular
allele are detected in amounts that are 2 fold lower when the
composition is present relative to when it is absent;
[1385] b) at least 2 fold greater than a level of suppression
observed for another allele of the same gene; or
[1386] c) both at least 2 fold in that transcripts from the
particular allele are detected in amounts that are 2 fold lower
when the composition is present relative to when it is absent, and
at least 2 fold greater than a level of suppression observed for
another allele of the same gene,
the contacting being performed under conditions determined to
permit the composition to suppress transcripts of the particular
allele.
[1387] In some embodiments, the present disclosure provides a
method for allele-specific suppression of a transcript from a
target gene for which a plurality of alleles exist within a
population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target gene, the method comprising steps
of:
[1388] contacting a sample comprising transcripts of the target
gene with a chirally controlled oligonucleotide composition
comprising oligonucleotides of a particular oligonucleotide type
characterized by:
[1389] 1) a common base sequence and length;
[1390] 2) a common pattern of backbone linkages;
[1391] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type; wherein the common base
sequence for the oligonucleotides of the particular oligonucleotide
type is or comprises a sequence that is complementary to the
characteristic sequence element that defines a particular allele,
the composition being characterized in that, when it is contacted
with a system expressing transcripts of the target gene, it shows
suppression of expression of transcripts of the particular allele
at a level that is:
[1392] a) at least 2 fold in that transcripts from the particular
allele are detected in amounts that are 2 fold lower when the
composition is present relative to when it is absent;
[1393] b) at least 2 fold greater than a level of suppression
observed for another allele of the same gene; or
[1394] c) both at least 2 fold in that transcripts from the
particular allele are detected in amounts that are 2 fold lower
when the composition is present relative to when it is absent, and
at least 2 fold greater than a level of suppression observed for
another allele of the same gene,
the contacting being performed under conditions determined to
permit the composition to suppress expression of the particular
allele.
[1395] As described herein, in some embodiments, in a provided
method contacting is performed under conditions determined to
permit a composition to suppress transcripts of a particular
allele. In some embodiments, contacting is performed under
conditions determined to permit a composition to suppress
expression of a particular allele.
[1396] In some embodiments, suppression of transcripts of a
particular allele is at a level that is greater than when the
composition is absent. In some embodiments, suppression of
transcripts of a particular allele is at a level that is at least
1.1 fold relative to when the composition is absent, in that
transcripts from the particular allele are detected in amounts that
are at least 1.1 fold lower when the composition is present
relative to when it is absent. In some embodiments, a level is at
least 1.2 fold. In some embodiments, a level is at least 1.3 fold.
In some embodiments, a level is at least 1.4 fold. In some
embodiments, a level is at least 1.5 fold. In some embodiments, a
level is at least 1.6 fold. In some embodiments, a level is at
least 1.7 fold. In some embodiments, a level is at least 1.8 fold.
In some embodiments, a level is at least 1.9 fold. In some
embodiments, a level is at least 2 fold. In some embodiments, a
level is at least 3 fold. In some embodiments, a level is at least
4 fold. In some embodiments, a level is at least 5 fold. In some
embodiments, a level is at least 6 fold. In some embodiments, a
level is at least 7 fold. In some embodiments, a level is at least
8 fold. In some embodiments, a level is at least 9 fold. In some
embodiments, a level is at least 10 fold. In some embodiments, a
level is at least 11 fold. In some embodiments, a level is at least
12 fold. In some embodiments, a level is at least 13 fold. In some
embodiments, a level is at least 14 fold. In some embodiments, a
level is at least 15 fold. In some embodiments, a level is at least
20 fold. In some embodiments, a level is at least 30 fold. In some
embodiments, a level is at least 40 fold. In some embodiments, a
level is at least 50 fold. In some embodiments, a level is at least
75 fold. In some embodiments, a level is at least 100 fold. In some
embodiments, a level is at least 150 fold. In some embodiments, a
level is at least 200 fold. In some embodiments, a level is at
least 300 fold. In some embodiments, a level is at least 400 fold.
In some embodiments, a level is at least 500 fold. In some
embodiments, a level is at least 750 fold. In some embodiments, a
level is at least 1000 fold. In some embodiments, a level is at
least 5000 fold.
[1397] In some embodiments, suppression of transcripts of a
particular allele is at a level that is greater than a level of
suppression observed for another allele of the same nucleic acid
sequence. In some embodiments, suppression of transcripts of a
particular allele is at a level that is at least 1.1 fold greater
than a level of suppression observed for another allele of the same
nucleic acid sequence. In some embodiments, a level is at least 1.2
fold. In some embodiments, a level is at least 1.3 fold. In some
embodiments, a level is at least 1.4 fold. In some embodiments, a
level is at least 1.5 fold. In some embodiments, a level is at
least 1.6 fold. In some embodiments, a level is at least 1.7 fold.
In some embodiments, a level is at least 1.8 fold. In some
embodiments, a level is at least 1.9 fold. In some embodiments, a
level is at least 2 fold. In some embodiments, a level is at least
3 fold. In some embodiments, a level is at least 4 fold. In some
embodiments, a level is at least 5 fold. In some embodiments, a
level is at least 6 fold. In some embodiments, a level is at least
7 fold. In some embodiments, a level is at least 8 fold. In some
embodiments, a level is at least 9 fold. In some embodiments, a
level is at least 10 fold. In some embodiments, a level is at least
11 fold. In some embodiments, a level is at least 12 fold. In some
embodiments, a level is at least 13 fold. In some embodiments, a
level is at least 14 fold. In some embodiments, a level is at least
15 fold. In some embodiments, a level is at least 20 fold. In some
embodiments, a level is at least 30 fold. In some embodiments, a
level is at least 40 fold. In some embodiments, a level is at least
50 fold. In some embodiments, a level is at least 75 fold. In some
embodiments, a level is at least 100 fold. In some embodiments, a
level is at least 150 fold. In some embodiments, a level is at
least 200 fold. In some embodiments, a level is at least 300 fold.
In some embodiments, a level is at least 400 fold. In some
embodiments, a level is at least 500 fold. In some embodiments, a
level is at least 750 fold. In some embodiments, a level is at
least 1000 fold. In some embodiments, a level is at least 5000
fold.
[1398] In some embodiments, suppression of transcripts of a
particular allele is at a level that is greater than when the
composition is absent, and at a level that is greater than a level
of suppression observed for another allele of the same nucleic acid
sequence. In some embodiments, suppression of transcripts of a
particular allele is at a level that is at least 1.1 fold relative
to when the composition is absent, and at least 1.1 fold greater
than a level of suppression observed for another allele of the same
nucleic acid sequence. In some embodiments, each fold is
independently as described above.
[1399] In some embodiments, a system is a composition comprising a
transcript. In some embodiments, a system is a composition
comprising transcripts from different alleles. In some embodiments,
a system can be in vivo or in vitro, and in either way can comprise
one or more cells, tissues, organs or organisms. In some
embodiments, a system comprises one or more cells. In some
embodiments, a system comprises one or more tissues. In some
embodiments, a system comprises one or more organs. In some
embodiments, a system comprises one or more organisms. In some
embodiments, a system is a subject.
[1400] In some embodiments, suppression of a transcript, or
suppression of expression of an allele from which a transcript is
transcribed, can be measured in in vitro assay. In some
embodiments, a sequence from a transcript and comprising a specific
nucleotide characteristic sequence element is used in assays
instead of the full-length transcript. In some embodiments, an
assay is a biochemical assay. In some embodiments, an assay is a
biochemical assay wherein a nucleic acid polymer, for example, a
transcript or a sequence from a transcript and comprising a
specific nucleotide characteristic sequence element, is tested for
cleavage by an enzyme in the presence of a chirally controlled
oligonucleotide composition.
[1401] In some embodiments, a provided chirally controlled
oligonucleotide composition is administered to a subject. In some
embodiments, a subject is an animal. In some embodiments, a subject
is a plant. In some embodiments, a subject is a human.
[1402] In some embodiments, for allele-specific suppression of
transcripts from a particular allele, transcripts are cleaved at a
site near a sequence difference, for example a mutation, within a
specific nucleotide characteristic sequence element, which sequence
difference differentiates transcripts from a particular allele from
transcripts from the other alleles. In some embodiments,
transcripts are selectively cleaved at a site near such a sequence
difference. In some embodiments, transcripts are cleaved at a
higher percentage at a site near such a sequence difference that
when a chirally uncontrolled oligonucleotide composition is used.
In some embodiments, transcripts are cleaved at the site of a
sequence difference. In some embodiments, transcripts are cleaved
only at the site of a sequence difference within a specific
nucleotide characteristic sequence element. In some embodiments,
transcripts are cleaved at a site within 5 base pairs downstream or
upstream a sequence difference. In some embodiments, transcripts
are cleaved at a site within 4 base pairs downstream or upstream a
sequence difference. In some embodiments, transcripts are cleaved
at a site within 3 base pairs downstream or upstream a sequence
difference. In some embodiments, transcripts are cleaved at a site
within 2 base pairs downstream or upstream a sequence difference.
In some embodiments, transcripts are cleaved at a site within 1
base pair downstream or upstream a sequence difference. In some
embodiments, transcripts are cleaved at a site within 5 base pairs
downstream a sequence difference. In some embodiments, transcripts
are cleaved at a site within 4 base pairs downstream a sequence
difference. In some embodiments, transcripts are cleaved at a site
within 3 base pairs downstream a sequence difference. In some
embodiments, transcripts are cleaved at a site within 2 base pairs
downstream a sequence difference. In some embodiments, transcripts
are cleaved at a site within 1 base pair downstream a sequence
difference. In some embodiments, transcripts are cleaved at a site
within 5 base pairs upstream a sequence difference. In some
embodiments, transcripts are cleaved at a site within 4 base pairs
upstream a sequence difference. In some embodiments, transcripts
are cleaved at a site within 3 base pairs upstream a sequence
difference. In some embodiments, transcripts are cleaved at a site
within 2 base pairs upstream a sequence difference. In some
embodiments, transcripts are cleaved at a site within 1 base pair
upstream a sequence difference. Such precise control of cleavage
patterns, and the resulting highly selective suppression of
transcripts from a particular allele, would not be possible without
chirally controlled oligonucleotide compositions and methods
thereof provided by Applicant in this disclosure.
[1403] In some embodiments, the present disclosure provides methods
for treating a subject, or preventing a disease in a subject, by
specifically suppress transcripts from a particular allele, for
example, an allele that causes or may cause a disease. In some
embodiments, the present disclosure provides methods for treating a
subject suffering from a disease, comprising administering to the
subject a pharmaceutical composition comprising a chirally
controlled oligonucleotide composition, wherein transcripts from an
allele that causes or contributes to the disease is selectively
suppressed. In some embodiments, the present disclosure provides
methods for treating a subject suffering from a disease, comprising
administering to the subject a pharmaceutical composition
comprising a chirally controlled oligonucleotide composition,
wherein transcripts from an allele that causes the disease is
selectively suppressed. In some embodiments, the present disclosure
provides methods for treating a subject suffering from a disease,
comprising administering to the subject a pharmaceutical
composition comprising a chirally controlled oligonucleotide
composition, wherein transcripts from an allele that contributes to
the disease is selectively suppressed. In some embodiments, the
present disclosure provides methods for treating a subject
suffering from a disease, comprising administering to the subject a
pharmaceutical composition comprising a chirally controlled
oligonucleotide composition, wherein transcripts from an allele
that is related to the disease is selectively suppressed. In some
embodiments, the present disclosure provides methods for preventing
a disease in a subject, by specifically suppress transcripts from a
particular allele that may cause a disease. In some embodiments,
the present disclosure provides methods for preventing a disease in
a subject, by specifically suppress transcripts from a particular
allele that increases risk of a disease in the subject. In some
embodiments, a provided method comprises administering to the
subject a pharmaceutical composition comprising a chirally
controlled oligonucleotide composition. In some embodiments, a
pharmaceutical composition further comprises a pharmaceutical
carrier.
[1404] In some embodiments, a nucleotide characteristic sequence
comprises a mutation that defines the target sequence relative to
other similar sequences. In some embodiments, a nucleotide
characteristic sequence comprises a point mutation that defines the
target sequence relative to other similar sequences. In some
embodiments, a nucleotide characteristic sequence comprises a SNP
that defines the target sequence relative to other similar
sequences.
[1405] In some embodiments, the present disclosure provides a
method for preparing an oligonucleotide composition for selective
suppression of a transcript of a target nucleic acid sequence,
comprising providing an oligonucleotide composition comprising a
predetermined level of oligonucleotides of a particular
oligonucleotide type characterized by:
[1406] 1) a common base sequence;
[1407] 2) a common pattern of backbone linkages; and
[1408] 3) a common pattern of backbone chiral centers, which
pattern comprises (Sp).sub.m(Rp).sub.n, (Rp).sub.n(Sp).sub.m,
(Np).sub.t(Rp).sub.n(Sp).sub.m, or (Sp).sub.t(Rp).sub.n(Sp).sub.m,
wherein each of m, n, t, Np is independently as defined and
described herein;
[1409] wherein the target nucleic acid sequence comprises a
characteristic sequence element that defines the target nucleic
acid sequence relative to a similar nucleic acid sequence;
[1410] wherein the common base sequence is a sequence whose DNA
cleavage pattern and/or stereorandom cleavage pattern has a
cleavage site within or in the vicinity of the characteristic
sequence element.
[1411] In some embodiments, the present disclosure provides a
method for preparing an oligonucleotide composition for selective
suppression of a transcript of a target nucleic acid sequence,
comprising providing an oligonucleotide composition comprising a
predetermined level of oligonucleotides of a particular
oligonucleotide type characterized by:
[1412] 1) a common base sequence;
[1413] 2) a common pattern of backbone linkages; and
[1414] 3) a common pattern of backbone chiral centers, which
pattern comprises (Sp).sub.m(Rp).sub.n, (Rp).sub.n(Sp).sub.m,
(Np).sub.t(Rp).sub.n(Sp).sub.m, or (Sp).sub.t(Rp).sub.n(Sp).sub.m,
wherein each of m, n, t, Np is independently as defined and
described herein;
[1415] wherein the target nucleic acid sequence comprises a
characteristic sequence element that defines the target nucleic
acid sequence relative to a similar nucleic acid sequence;
[1416] wherein the common base sequence is a sequence whose DNA
cleavage pattern and/or stereorandom cleavage pattern has a major
cleavage site within or in the vicinity of characteristic sequence
element.
[1417] In some embodiments, a common pattern of backbone chiral
centers comprises (Sp).sub.m(Rp).sub.n, (Rp).sub.n(Sp).sub.m,
(Np).sub.t(Rp).sub.n(Sp).sub.m, or (Sp).sub.t(Rp).sub.n(Sp).sub.m
as described above. In some embodiments, a common pattern of
backbone chiral centers comprises (Sp).sub.m(Rp).sub.n as described
above. In some embodiments, a common pattern of backbone chiral
centers comprises (Rp).sub.n(Sp).sub.m as described above. In some
embodiments, a common pattern of backbone chiral centers comprises
(Np).sub.t(Rp).sub.n(Sp).sub.m as described above. In some
embodiments, a common pattern of backbone chiral centers comprises
(Sp).sub.t(Rp).sub.n(Sp).sub.m as described above. In some
embodiments, n is 1. In some embodiments, m>2. In some
embodiments, n is 1 and m>2. In some embodiments, t>2. In
some embodiments, n is 1, m>2, and t>2.
[1418] In some embodiments, oligonucleotides of the particular
oligonucleotide type have a wing-core structure. In some
embodiments, oligonucleotides of the particular oligonucleotide
type have a core-wing structure. In some embodiments,
oligonucleotides of the particular oligonucleotide type have a
wing-core-wing structure. In some embodiments, each sugar moieties
in the wing regions has a sugar modification. In some embodiments,
each sugar moiety in the wing regions has a 2'-modification. In
some embodiments, each sugar moieties in the wing regions has a
2'-modification, wherein the 2'-modification is 2'-OR.sup.1,
wherein R.sup.1 is optionally substituted C.sub.1-6 alkyl. In some
embodiments, each sugar moiety in the wing regions has 2'-OMe. In
some embodiments, each wing independently comprises a chiral
internucleotidic linkage and a natural phosphate linkage. In some
embodiments, a chiral internucleotidic linkage is phosphorothioate.
In some embodiments, for a wing-core-wing structure, like in
WV-1092, the 5'-wing has an Sp internucleotidic linkage at each of
its 5'- and 3'-end, and phosphate linkages in between, and 3'-wing
has an Sp internucleotidic linkage at its 3'-end, and the rest of
its internucleotidic linkages are phosphate. Additional embodiments
for the wing and/or core, e.g., sugar modification,
stereochemistry, etc., are described in the present disclosure.
[1419] Common base sequences which are sequences whose DNA cleavage
patterns and/or stereorandom cleavage patterns have cleavage sites
within or in the vicinity of the target nucleic acid sequence are
extensively described in the present disclose. In some embodiments,
a cleavage site within or in the vicinity of the target nucleic
acid sequence is a cleavage site in the vicinity of a mutation
which defines the target sequence from its similar sequences. In
some embodiments, a cleavage site within or in the vicinity of the
target nucleic acid sequence is a cleavage site in the vicinity of
a SNP which defines the target sequence from its similar sequences.
In some embodiments, as described above, in the vicinity of a
mutation or a SNP is 0, 1, 2, 3, 4, 5 internucleotidic linkages
away from the mutation or SNP. Additional embodiments are described
above in the present disclosure.
[1420] In some embodiments, a common base sequence is a sequence
whose DNA cleavage pattern and/or stereorandom cleavage pattern has
a major cleavage site within or in the vicinity of the target
nucleic acid sequence. In some embodiments, a major cleavage site
is defined by absolute cleavage at that site (% of cleavage at that
site over total target sequence). Additional example embodiments of
a major cleavage site are described in the present disclosure. In
some embodiments, as exemplified by FIG. 33, a common base sequence
(P12) may be identified by comparing cleavage maps of different
sequences complementary to the characteristic sequence element.
[1421] In some embodiments, the present disclosure provides a
method for preparing an oligonucleotide composition comprising
oligonucleotides of a particular sequence, which composition
provides selective suppression of a transcript of a target
sequence, comprising providing a chirally controlled
oligonucleotide composition comprising oligonucleotides of a
particular oligonucleotide type characterized by:
[1422] 1) a common base sequence which is the same as the
particular sequence;
[1423] 2) a common pattern of backbone linkages; and
[1424] 3) a common pattern of backbone chiral centers, which
pattern comprises (Sp).sub.m(Rp).sub.n, (Rp).sub.n(Sp).sub.m,
(Np).sub.t(Rp).sub.n(Sp).sub.m, or (Sp).sub.t(Rp).sub.n(Sp).sub.m,
wherein:
[1425] each n and t is independently 1, 2, 3, 4, 5, 6, 7 or 8;
[1426] m is 2, 3, 4, 5, 6, 7 or 8, and
[1427] each Np is independent Rp or Sp.
[1428] Diseases that involves disease-causing alleles are widely
known in the art, including but not limited to those described in
Hohjoh, Pharmaceuticals 2013, 6, 522-535; US patent application
publication US 2013/0197061; Ostergaard et al., Nucleic Acids
Research 2013, 41(21), 9634-9650; and Jiang et al., Science 2013,
342, 111-114. In some embodiments, a disease is Huntington's
disease. In some embodiments, a disease is human hypertrophic
cardiomyopathy (HCM). In some embodiments, a disease is dilated
cardiomyopathy. In some embodiments, a disease-causing allele is an
allele of myosin heavy chains (MHC). In some embodiments, an
example disease is selected from:
TABLE-US-00021 Disease Target gene Target variation Familial
Alzheimer's Amyloid K670N-M671L disease precursor protein (Swedish
mutant) (APP) Amyloid K670N-M671L precursor protein (Swedish
mutant) (APP) Amyloid V717F precursor protein (London mutant) (APP)
Amyloid V717I precursor protein (London mutant) (APP) Preseniline 1
L392V (PSEN1) Amyotrophic lateral Superoxide G93A sclerosis (ALS)
dismutase (SOD1) Superoxide G85R dismutase (SOD1) Slow channel
Acetylcholine aS226F congenital receptor (AChR) myasthenic syndrome
(SCCMS) Frontotemporal Microtubule- V337M dementia with associated
protein parkinsonism TAU (MAPT) linked to chromosome 17 (FTDP-17)
Ehlers-Danlos Procollagen type III G252V syndrome (COL3A1) (vEDS)
Sickle cell Hemoglobin-beta E6V anemia locus (HBB) Familial
Transthyretin (TTR) V30M amyloidotic polyneuropathy (FAP)
Fibrodysplasia Activin A receptor R206H, G356D ossificans type I
(ACVR1) progressiva Activin A receptor R206H (FOP) type I (ACVR1)
Tumors Phosphoinositide-3- 1633G -> A kinase, catalytic, alpha
3140A -> G polypeptide (PIK3CA) Spinocerebellar Ataxin-1 (ATXN1)
flanking ataxia type 1 region of (SCA1) expanded CAG repeat
Machado-Joseph ATAXIN3/MJD1 SNPs linked disease/ to expanded
spinocerebellar CAG repeat ataxia type 3 (MJD/SCA3) Spinocerebellar
Ataxin-7 (ATXN7) SNP linked ataxia type 7 to expanded (SCA7) CAG
repeat Parkinson's Leucine-rich repeat R1441G, R1441C disease
kinase 2 (LRRK2) Leucine-rich repeat G20195S kinase 2 (LRRK2)
alpha-synuclein A30P Huntington Huntingtin (HTT) SNPs linked
disease to expanded CAG repeat Hypertrophic MYH7 R403Q
cardiomyopathy
[1429] In some embodiments, example targets of, and diseases that
can be treated by, provided chirally controlled oligonucleotide
compositions and methods, comprises:
TABLE-US-00022 Disease Target gene Target variation Familial
Alzheimer's Amyloid K670N-M671L disease precursor protein (Swedish
mutant) (APP) Amyloid K670N-M671L precursor protein (Swedish
mutant) (APP) Amyloid V717F precursor protein (London mutant) (APP)
Amyloid V717I precursor protein (London mutant) (APP) Preseniline 1
L392V (PSEN1) Amyotrophic lateral Superoxide G93A sclerosis (ALS)
dismutase (SOD1) Superoxide G85R dismutase (SOD1) Slow channel
Acetylcholine aS226F, aT254I, congenital receptor (AChR) aS269I
myasthenic syndrome (SCCMS) Frontotemporal Microtubule- V337M
dementia with associated protein parkinsonism TAU (MAPT) linked to
chromosome 17 (FTDP-17) Ehlers-Danlos Procollagen type III G252V
syndrome (COL3A1) (vEDS) Sickle cell Hemoglobin-beta E6V anemia
locus (HBB) Familial Transthyretin (TTR) V30M amyloidotic
polyneuropathy (FAP) Fibrodysplasia Activin A receptor R206H, G356D
ossificans type I (ACVR1) progressiva Activin A receptor R206H
(FOP) type I (ACVR1) Tumors KRAS G12V, G12D, G13D Tumors
Phosphoinositide-3- G1633A, A3140G kinase, catalytic, alpha
polypeptide (PIK3CA) Spinocerebellar Ataxin-1 (ATXN1) SNPs linked
ataxia type 1 to expanded (SCA1) CAG repeat Spinocerebellar
Ataxin-7 (ATXN7) SNPs linked ataxia type 7 to expanded (SCA7) CAG
repeat Spinocerebellar Ataxin-3 (ATXN3) SNPs linked Ataxia Type to
expanded 3 (SCA3)/Machado- CAG repeat Joseph Disease Parkinson's
Leucine-rich repeat R1441G, R1441C disease kinase 2 (LRRK2)
Leucine-rich repeat G20195S kinase 2 (LRRK2) Alpha-synuclein (SNCA)
A30P, A53T, E46K Huntington's Huntingtin (HTT) SNPs linked disease
to expanded CAG repeat Huntington's JPH3 SNPs linked disease-like 2
to expanded CTG repeat Friedreich's FXN SNPs linked ataxia to
expanded GAA repeat Fragile X mental FMR1 SNPs linked retardation
to expanded syndrome/fragile CGG repeat X tremor ataxia syndrome
Myotonic DMPK SNPs linked Dystophy (DM1) to expanded CTG repeat
Myotonic ZNF9 SNPs linked Dystophy (DM2) to expanded CTG repeat
Spinal-Bulbar AR SNPs linked Muscular Atrophy to expanded CAG
repeat Hypertrophic MHY7 R403Q cardiomyopathy
[1430] In some embodiments, oligonucleotide compositions and
technologies described herein are particularly useful in the
treatment of Huntington's disease. For example, in some
embodiments, the present disclosure defines stereochemically
controlled oligonucleotide compositions that direct cleavage (e.g.,
RNAse H-mediated cleavage) of nucleic acids associated with
Huntington's disease. In some embodiments, such compositions direct
preferential cleavage of a Huntington's disease-associated allele
of a particular target sequence, relative to one or more (e.g., all
non-Huntington's disease-associated) other alleles of the
sequence.
[1431] In some embodiments, a provided method for treating or
preventing Huntington's disease in a subject, comprising
administering to the subject a chirally controlled oligonucleotide
composition comprising oligonucleotides of a particular
oligonucleotide type characterized by:
[1432] 1) a common base sequence and length;
[1433] 2) a common pattern of backbone linkages; and
[1434] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type. In some embodiments,
oligonucleotides of a particular oligonucleotide type are
identical. In some embodiments, a provided composition is a
chirally controlled oligonucleotide composition.
[1435] SNPs related to Huntington's disease are widely known in the
art. In some embodiments, a common base sequence is complementary
to a nucleic acid sequence comprising a SNP related to Huntington's
disease. In some embodiments, a provided composition selectively
suppresses transcripts from the disease-causing allele. In some
embodiments, a provided composition selectively cleaves transcripts
from the disease-causing allele. Example SNPs that can be targeted
by a provided composition (target Huntingtin sites) are described
herein.
[1436] In some embodiments, a target Huntingtin site is selected
from rs9993542_C, rs362310_C, rs362303_C, rs10488840_G, rs363125_C,
rs363072_A, rs7694687_C, rs363064_C, rs363099_C, rs363088_A,
rs34315806_C, rs2298967_T, rs362272 G, rs362275_C, rs362306_G,
rs3775061_A, rs1006798_A, rs16843804_C, rs3121419_C, rs362271_G,
rs362273_A, rs7659144_C, rs3129322_T, rs3121417_G, rs3095074_G,
rs362296_C, rs108850_C, rs2024115_A, rs916171_C, rs7685686_A,
rs6844859_T, rs4690073_G, rs2285086_A, rs362331_T, rs363092_C,
rs3856973_G, rs4690072_T, rs7691627_G, rs2298969_A, rs2857936_C,
rs6446723_T, rs762855_A, rs1263309_T, rs2798296G_, rs363096_T,
rs10015979_G, rs11731237_T, rs363080_C, rs2798235_G and rs362307_T.
In some embodiments, a target Huntingtin site is selected from
rs34315806_C, rs362273_A, rs362331_T, rs363099_C, rs7685686_A,
rs362306_G, rs363064_C, rs363075_G, rs2276881_G, rs362271_G,
rs362303_C, rs362322_A, rs363088_A, rs6844859_T, rs3025838_C,
rs363081_G, rs3025849_A, rs3121419_C, rs2298967_T, rs2298969_A,
rs16843804_C, rs4690072_T, rs362310_C, rs3856973_G, rs2530595_C,
rs2530595_T, and rs2285086_A. In some embodiments, a target
Huntingtin site is selected from rs34315806_C, rs362273_A,
rs362331_T, rs363099_C, rs7685686_A, rs362306_G, rs363064_C,
rs363075_G, rs2276881_G, rs362271_G, rs362303_C, rs362322_A,
rs363088_A, rs6844859_T, rs3025838_C, rs363081_G, rs3025849_A,
rs3121419_C, rs2298967_T, rs2298969_A, rs16843804_C, rs4690072_T,
rs362310_C, rs3856973_G, and rs2285086_A. In some embodiments, a
target Huntingtin site is selected from rs362331_T, rs7685686_A,
rs6844859_T, rs2298969_A, rs4690072_T, rs2024115_A, rs3856973_G,
rs2285086_A, rs363092_C, rs7691627_G, rs10015979_G, rs916171_C,
rs6446723_T, rs11731237_T, rs362272_G, rs4690073_G, and rs363096_T.
In some embodiments, a target Huntingtin site is selected from
rs362267, rs6844859, rs1065746, rs7685686, rs362331, rs362336,
rs2024115, rs362275, rs362273, rs362272, rs3025805, rs3025806,
rs35892913, rs363125, rs17781557, rs4690072, rs4690074, rs1557210,
rs363088, rs362268, rs362308, rs362307, rs362306, rs362305,
rs362304, rs362303, rs362302, rs363075, rs2530595, and rs2298969.
In some embodiments, a target Huntingtin site is selected from
rs362267, rs6844859, rs1065746, rs7685686, rs362331, rs362336,
rs2024115, rs362275, rs362273, rs362272, rs3025805, rs3025806,
rs35892913, rs363125, rs17781557, rs4690072, rs4690074, rs1557210,
rs363088, rs362268, rs362308, rs362307, rs362306, rs362305,
rs362304, rs362303, rs362302, rs363075 and rs2298969. In some
embodiments, a target Huntingtin site is selected from:
TABLE-US-00023 Frequency of Heterozygosity for 24 SNP Sites in the
Huntingtin mRNA Location in mRNA Reference Percent Heterozygosity
(Position, nt) Number Controls HD Patients ORF, exon 20 rs363075
G/A, 10.3% (G/G, G/A, 12.8% (G/G, (2822) 89.7%) 86.2%; A/A, 0.9%)
ORF, exon 25 rs35892913 G/A, 10.3% (G/G, G/A, 13.0% (G/G, (3335)
89.7%) 86.1%; A/A, 0.9%) ORF, exon 25 rs1065746 G/C, 0% (G/G, G/C,
0.9% (G/G, (3389) 100%) 99.1%) ORF, exon 25 rs17781557 T/G, 12.9%
(T/T, T/G, 1.9% (T/T, (3418) 87.1%) 98.1%) ORF, exon 29 rs4690074
C/T, 37.9% (C/C, C/T, 35.8% (C/C, (3946) 50.9%; T/T, 11.2) 59.6%;
T/T, 4.6%) ORF, exon 39 rs363125 C/A, 17.5% (C/C, C/A, 11.0% (C/C,
(5304) 79.0%; A/A, 3.5%) 87.2%; A/A, 1.8%) ORF, exon 44 exon 44
G/A, 0% (G/G, G/A, 2.8% (G/G, (6150) 100%) 97.2%) ORF, exon 48
rs362336 G/A, 38.7% (G/G, G/A, 37.4% (G/G, (6736) 49.6%; A/A,
11.7%) 57.9%; A/A, 4.7%) ORF, exon 50 rs362331 T/C, 45.7% (T/T,
T/C, 39.4% (T/T, (7070) 31.0%; C/C, 23.3%) 49.5%; C/C, 11.0%) ORF,
exon 57 rs362273 A/G, 40.3% (A/A, A/G, 35.2% (A/A, (7942) 48.2%;
G/G, 11.4%) 60.2%; G/G, 4.6%) ORF, exon 61 rs362272 G/A, 37.1%
(G/G, G/A, 36.1% (G/G, (8501) 51.7%; A/A, 11.2%) 59.3%; A/A, 4.6%)
ORF, exon 65 rs3025806 A/T, 0% (C/C, A/T, 0% (C/C, (9053) 100%)
100%) ORF, exon 65 exon 65 G/A, 2.3% (G/G, G/A, 0% (G/G, (9175)
97.7%) 100%) ORF, exon 67 rs362308 T/C, 0% (T/T, T/C, 0% (T/T,
(9523) 100%) 100%) 3'UTR, exon rs362307 C/T, 13.0% (C/C, C/T, 48.6%
(C/C, 67 (9633) 87.0%) 49.5%; T/T, 1.9%) 3'UTR, exon rs362306 G/A,
36.0% (G/G, G/A, 35.8% (G/G, 67 (9888) 52.6%; A/A, 11.4%) 59.6%;
A/A, 4.6%) 3'UTR, exon rs362268 C/G, 36.8% (C/C, C/G, 35.8% (C/C,
67 (9936) 50.0%; G/G 13.2%) 59.6%; G/G, 4.6%) 3'UTR, exon rs362305
C/G, 20.2% (C/C, C/G, 11.9% (C/C, 67 (9948) 78.1%; G/G 1.8%) 85.3%;
G/G, 2.8%) 3'UTR, exon rs362304 C/A, 22.8% (C/C, C/A, 11.9% (C/C,
67 (10060) 73.7%; A/A, 3.5%) 85.3%; AA, 2.8%) 3'UTR, exon rs362303
C/T, 18.4% (C/C, C/A, 11.9% (C/C, 67 (10095) 79.8%; T/T, 1.8%)
85.3%; T/T, 2.8%) 3'UTR, exon rs1557210 C/T, 0% (C/C, C/T, 0% (C/C,
67 (10704) 100%) 100%) 3'UTR, exon rs362302 C/T, 4.3% (C/C, C/T, 0%
(C/C, 67 (10708) 95.7%) 100%) 3'UTR, exon rs3025805 G/T, 0% (G/G,
G/T, 0% (G/G, 67 (10796) 100%) 100%) 3'UTR, exon rs362267 C/T,
36.2% (C/C, C/T, 35.5% (C/C, 67 (11006) 52.6%; T/T, 11.2%) 59.8%;
T/T, 4.7%)
[1437] In some embodiments, a chirally controlled oligonucleotide
composition targets two or more sites. In some embodiments,
targeted two or more sites are selected from sited listed herein.
In some embodiments, a targeted SNP is rs362307, rs7685686,
rs362268, rs2530595, rs362331, or rs362306. In some embodiments, a
targeted SNP is rs362307, rs7685686, rs362268 or rs362306. In some
embodiments, a targeted SNP is rs362307. In some embodiments, a
targeted SNP is rs7685686. In some embodiments, a targeted SNP is
not rs7685686. In some embodiments, a targeted SNP is rs362268. In
some embodiments, a targeted SNP is rs362306.
[1438] In some embodiments, a chirally controlled oligonucleotide
composition is able to differentiate between two alleles of a
particular SNP.
[1439] A chirally controlled oligonucleotide compositions of both
WVE120101 and WV-1092 were able to differentiate between wt and
mutant versions of SNP rs362307, which differ by one nt; both
WVE120101 and WV-1092 chirally controlled oligonucleotide
compositions significantly knocked down the mutant allele but not
the wt, while the stereorandom oligonucleotide composition,
WV-1497, was not able to significantly differentiate between the wt
and mutant alleles (see FIG. 39D).
[1440] A chirally controlled oligonucleotide composition of WV-2595
was also able to differentiate between the C and T alleles at SNP
rs2530595, which also differ at only the one nt. A chirally
controlled WV-2595 oligonucleotide composition significantly
knocked down the T allele but not the C allele, unlike the
stereorandom oligonucleotide composition of WV-2611, which was not
able to significantly differentiate the alleles (see FIG. 39F).
[1441] A chirally controlled oligonucleotide composition of WV-2603
was able to differentiate between the C and T alleles of SNP
rs362331, which also differ at only the one nt. A chirally
controlled WV-2603 oligonucleotide composition significantly
knocked down the T allele but not the C allele, unlike the
stereorandom oligonucleotide composition of WV-2619, which was not
able to significantly differentiate between the alleles (see FIGS.
39A, 39B, 39C and 39E).
[1442] In some embodiments, a provided composition for treating
Huntington's disease is selected from Tables N1, N2, N3 or N4. In
some embodiments, a provided composition for treating Huntington's
disease is selected from Table N1. In some embodiments, a provided
composition for treating Huntington's disease is selected from
Table N2. In some embodiments, a provided composition for treating
Huntington's disease is selected from Table N3. In some
embodiments, a provided composition for treating Huntington's
disease is selected from Table N4. In some embodiments, a provided
composition for treating Huntington's disease is selected from
Tables N1A, N2A, N3A or N4A. In some embodiments, a provided
composition for treating Huntington's disease is selected from
Table N1A. In some embodiments, a provided composition for treating
Huntington's disease is selected from Table N2A. In some
embodiments, a provided composition for treating Huntington's
disease is selected from Table N3A. In some embodiments, a provided
composition for treating Huntington's disease is selected from
Table N4A. In some embodiments, a provided composition is WV-1092.
In some embodiments, a provided composition is selected from: an
oligonucleotide having a sequence of WVE120101; WV-2603; WV-2595;
WV-1510; WV-2378; and WV-2380; each of these was constructed and
found to be very effective, for example, as demonstrated in vitro
in the dual luciferase reporter assay. In some embodiments, a
provided composition is a chirally controlled oligonucleotide
composition of WVE120101, WV-2603, WV-2595, WV-1510, WV-2378, or
WV-2380. In some embodiments, a provided composition is a chirally
controlled oligonucleotide composition of WV-937. In some
embodiments, a provided composition is a chirally controlled
oligonucleotide composition of WV-1087. In some embodiments, a
provided composition is a chirally controlled oligonucleotide
composition of WV-1090. In some embodiments, a provided composition
is a chirally controlled oligonucleotide composition of WV-1091. In
some embodiments, a provided composition is a chirally controlled
oligonucleotide composition of WV-1092. In some embodiments, a
provided composition is a chirally controlled oligonucleotide
composition of WV-1510. In some embodiments, a provided composition
is a chirally controlled oligonucleotide composition of WV-2378. In
some embodiments, a provided composition is a chirally controlled
oligonucleotide composition of WV-2380. In some embodiments, a
provided composition is a chirally controlled oligonucleotide
composition of WV-2595. In some embodiments, a provided composition
is a chirally controlled oligonucleotide composition of WV-2603. In
some embodiments, provided oligonucleotides comprise base sequence,
pattern of backbone linkages, pattern or backbone chiral centers,
and/or pattern of chemical modifications (e.g., base modifications,
sugar modifications, etc.) of any oligonucleotide disclosed
herein.
[1443] In some embodiments, a provided composition is not a
composition of ONT-451, ONT-452 or ONT-450. In some embodiments, a
provided composition is not a composition of ONT-451. In some
embodiments, a provided composition is not a composition of
ONT-452. In some embodiments, a provided composition is not a
composition of ONT-450. In some embodiments, a composition does not
contain a pre-determined level of ONT-451 or ONT-452. In some
embodiments, a composition does not contain a pre-determined level
of ONT-451. In some embodiments, a composition does not contain a
pre-determined level of ONT-452. In some embodiments, an
oligonucleotide type is not ONT-451 or ONT-452. In some
embodiments, an oligonucleotide type is not ONT-451. In some
embodiments, an oligonucleotide type is not ONT-452. In some
embodiments, a composition is not a chirally controlled
oligonucleotide composition of ONT-451 or ONT-452. In some
embodiments, a composition is not a chirally controlled
oligonucleotide composition of ONT-451. In some embodiments, a
composition is not a chirally controlled oligonucleotide
composition of ONT-452.
[1444] In some embodiments, a provided method ameliorates a symptom
of Huntington's disease. In some embodiments, a provided method
slows onset of Huntington's disease. In some embodiments, a
provided method slows progression of Huntington's disease. In some
embodiments, a provided method stops progression of Huntington's
disease. In some embodiments, a provided method cures Huntington's
disease according to a clinical standard.
[1445] In some embodiments, the present disclosure provides methods
for identifying patients for a given oligonucleotide composition.
In some embodiments, the present disclosure provides methods for
patient stratification. In some embodiments, a provided method
comprises identifying a mutation and/or SNP associated with a
disease-causing allele. For example, in some embodiments, a
provided method comprises identifying in a subject a SNP associated
with expanded CAG repeats that are associated with or causing
Huntington's disease. In some embodiments, a provided method
comprises identifying in a subject a SNP associated with more than
35 CAG repeats in Huntingtin. In some embodiments, a provided
method comprises identifying in a subject a SNP associated with
more than 36 CAG repeats in Huntingtin. In some embodiments, a
provided method comprises identifying in a subject a SNP associated
with more than 37 CAG repeats in Huntingtin. In some embodiments, a
provided method comprises identifying in a subject a SNP associated
with more than 38 CAG repeats in Huntingtin. In some embodiments, a
provided method comprises identifying in a subject a SNP associated
with more than 39 CAG repeats in Huntingtin. In some embodiments, a
provided method comprises identifying in a subject a SNP associated
with more than 40 CAG repeats in Huntingtin.
[1446] In some embodiments, a subject has a SNP in the subject's
Huntingtin gene. In some embodiments, a subject has a SNP, wherein
one allele is mutant Huntingtin associated with expanded CAG
repeats. In some embodiments, a subject has a SNP as described
herein. In some embodiments, a subject has a SNP selected from
rs362307, rs7685686, rs362268, rs2530595, rs362331, or rs362306. In
some embodiments, a subject has a SNP selected from rs362307,
rs7685686, rs362268, or rs362306. In some embodiments, a subject
has a SNP selected from rs362307. In some embodiments, a subject
has a SNP selected from rs7685686. In some embodiments, a subject
has a SNP selected from rs362268. In some embodiments, a subject
has a SNP selected from rs362306.
[1447] In some embodiments, oligonucleotides of a provided
composition have a sequence complementary to a sequence comprising
a SNP from the disease-causing allele (mutant), and the composition
selectively suppresses expression from the diseasing-causing
allele. In some embodiments, a SNP is rs362307, rs7685686,
rs362268, rs2530595, rs362331, or rs362306. In some embodiments, a
SNP is rs362307, rs7685686, rs362268, or rs362306. In some
embodiments, a SNP is rs362307. In some embodiments, a SNP is
rs7685686. In some embodiments, a SNP is rs362268. In some
embodiments, a SNP is rs362306. In some embodiments, a SNP is
rs2530595. In some embodiments, a SNP is rs362331.
[1448] As understood by a person having ordinary skill in the art,
various methods may be used to monitor a treatment process. In some
embodiments, mutant HTT (mHTT) may be assessed from cerebrospinal
fluid (Wild et al., Quantification of mutant Huntingtin protein in
cerebrospinal fluid from Huntington's disease patients, J Clin
Invest. 2015; 125 (5): 1979-86), and may be used to monitor a
treatment. In some embodiments, this approach may be used to
determined and/or optimize a regimen, monitor pharmacodynamic
endpoints, and/or determine dosage and frequency for
administration, etc.
[1449] It is understood by a person having ordinary skill in the
art that provided methods apply to any similar targets containing a
mismatch. In some embodiments, a mismatch is between a maternal and
paternal gene. Additional example targets for suppression and/or
knockdown, including allele-specific suppression and/or knockdown,
can be any genetic abnormalities, e.g., mutations, related to any
diseases. In some embodiments, a target, or a set of targets, is
selected from genetic determinants of diseases, e.g., as disclosed
in Xiong, et al., The human splicing code reveals new insights into
the genetic determinants of disease. Science Vol. 347 no. 6218 DOI:
10.1126/science.1254806. In some embodiments, a mismatch is between
a mutant and a wild type.
[1450] In some embodiments, provided chirally controlled
oligonucleotide compositions and methods are used to selectively
suppress oligonucleotides with a mutation in a disease. In some
embodiments, a disease is cancer. In some embodiments, provided
chirally controlled oligonucleotide compositions and methods are
used to selectively suppress transcripts with mutations in cancer.
In some embodiments, provided chirally controlled oligonucleotide
compositions and methods are used to suppress transcripts of KRAS.
Example target KRAS sites comprises G12V=GGU->GUU Position 227
G->U, G12D=GGU->GAU Position 227 G->A and G13D=GGC->GAC
Position 230 G->A.
[1451] In some embodiments, provided chirally controlled
oligonucleotide compositions and methods provide allele-specific
suppression of a transcript in an organism. In some embodiments, an
organism comprises a target gene for which two or more alleles
exist. For example, a subject has a wild type gene in its normal
tissues, while the same gene is mutated in diseased tissues such as
in a tumor. In some embodiments, the present disclosure provides
chirally controlled oligonucleotide compositions and methods that
selectively suppress one allele, for example, one with a mutation
or SNP. In some embodiments, the present disclosure provides
treatment with higher efficacy and/or low toxicity, and/or other
benefits as described in the application.
[1452] In some embodiments, provided chirally controlled
oligonucleotide compositions comprises oligonucleotides of one
oligonucleotide type. In some embodiments, provided chirally
controlled oligonucleotide compositions comprises oligonucleotides
of only one oligonucleotide type. In some embodiments, provided
chirally controlled oligonucleotide compositions has
oligonucleotides of only one oligonucleotide type. In some
embodiments, provided chirally controlled oligonucleotide
compositions comprises oligonucleotides of two or more
oligonucleotide types. In some embodiments, using such
compositions, provided methods can target more than one target. In
some embodiments, a chirally controlled oligonucleotide composition
comprising two or more oligonucleotide types targets two or more
targets. In some embodiments, a chirally controlled oligonucleotide
composition comprising two or more oligonucleotide types targets
two or more mismatches. In some embodiments, a single
oligonucleotide type targets two or more targets, e.g., mutations.
In some embodiments, a target region of oligonucleotides of one
oligonucleotide type comprises two or more "target sites" such as
two mutations or SNPs.
[1453] In some embodiments, oligonucleotides in a provided chirally
controlled oligonucleotide composition optionally comprise modified
bases or sugars. In some embodiments, a provided chirally
controlled oligonucleotide composition does not have any modified
bases or sugars. In some embodiments, a provided chirally
controlled oligonucleotide composition does not have any modified
bases. In some embodiments, oligonucleotides in a provided chirally
controlled oligonucleotide composition comprise modified bases and
sugars. In some embodiments, oligonucleotides in a provided
chirally controlled oligonucleotide composition comprise a modified
base. In some embodiments, oligonucleotides in a provided chirally
controlled oligonucleotide composition comprise a modified sugar.
Modified bases and sugars for oligonucleotides are widely known in
the art, including but not limited in those described in the
present disclosure. In some embodiments, a modified base is 5-mC.
In some embodiments, a modified sugar is a 2'-modified sugar.
Suitable 2'-modification of oligonucleotide sugars are widely known
by a person having ordinary skill in the art. In some embodiments,
2'-modifications include but are not limited to 2'-OR.sup.1,
wherein R.sup.1 is not hydrogen. In some embodiments, a
2'-modification is 2'-OR, wherein R.sup.1 is optionally substituted
C.sub.1-6 aliphatic. In some embodiments, a 2'-modification is
2'-MOE. In some embodiments, a modification is 2'-halogen. In some
embodiments, a modification is 2'-F. In some embodiments, modified
bases or sugars may further enhance activity, stability and/or
selectivity of a chirally controlled oligonucleotide composition,
whose common pattern of backbone chiral centers provides unexpected
activity, stability and/or selectivity.
[1454] In some embodiments, a provided chirally controlled
oligonucleotide composition does not have any modified sugars. In
some embodiments, a provided chirally controlled oligonucleotide
composition does not have any 2'-modified sugars. In some
embodiments, the present disclosure surprisingly found that by
using chirally controlled oligonucleotide compositions, modified
sugars are not needed for stability, activity, and/or control of
cleavage patterns. Furthermore, in some embodiments, the present
disclosure surprisingly found that chirally controlled
oligonucleotide compositions of oligonucleotides without modified
sugars deliver better properties in terms of stability, activity,
turn-over and/or control of cleavage patterns. For example, in some
embodiments, it is surprisingly found that chirally controlled
oligonucleotide compositions of oligonucleotides having no modified
sugars dissociates much faster from cleavage products and provide
significantly increased turn-over than compositions of
oligonucleotides with modified sugars.
[1455] In some embodiments, oligonucleotides of provided chirally
controlled oligonucleotide compositions useful for provided methods
have structures as extensively described in the present disclosure.
In some embodiments, an oligonucleotide has a wing-core-wing
structure as described. In some embodiments, the common pattern of
backbone chiral centers of a provided chirally controlled
oligonucleotide composition comprises (Sp).sub.mRp as described. In
some embodiments, the common pattern of backbone chiral centers of
a provided chirally controlled oligonucleotide composition
comprises (Sp).sub.2Rp. In some embodiments, the common pattern of
backbone chiral centers of a provided chirally controlled
oligonucleotide composition comprises (Sp).sub.m(Rp).sub.n as
described. In some embodiments, the common pattern of backbone
chiral centers of a provided chirally controlled oligonucleotide
composition comprises (Rp).sub.n(Sp).sub.m as described. In some
embodiments, the common pattern of backbone chiral centers of a
provided chirally controlled oligonucleotide composition comprises
Rp(Sp).sub.m as described. In some embodiments, the common pattern
of backbone chiral centers of a provided chirally controlled
oligonucleotide composition comprises Rp(Sp).sub.2. In some
embodiments, the common pattern of backbone chiral centers of a
provided chirally controlled oligonucleotide composition comprises
(Sp).sub.m(Rp).sub.n(Sp).sub.t as described. In some embodiments,
the common pattern of backbone chiral centers of a provided
chirally controlled oligonucleotide composition comprises
(Sp).sub.mRp(Sp).sub.t as described. In some embodiments, the
common pattern of backbone chiral centers of a provided chirally
controlled oligonucleotide composition comprises
(Sp).sub.t(Rp).sub.n(Sp).sub.m as described. In some embodiments,
the common pattern of backbone chiral centers of a provided
chirally controlled oligonucleotide composition comprises
(Sp).sub.tRp(Sp).sub.m as described. In some embodiments, the
common pattern of backbone chiral centers of a provided chirally
controlled oligonucleotide composition comprises SpRpSpSp. In some
embodiments, the common pattern of backbone chiral centers of a
provided chirally controlled oligonucleotide composition comprises
(Sp).sub.2Rp(Sp).sub.2. In some embodiments, the common pattern of
backbone chiral centers of a provided chirally controlled
oligonucleotide composition comprises (Sp).sub.3Rp(Sp).sub.3. In
some embodiments, the common pattern of backbone chiral centers of
a provided chirally controlled oligonucleotide composition
comprises (Sp).sub.4Rp(Sp).sub.4. In some embodiments, the common
pattern of backbone chiral centers of a provided chirally
controlled oligonucleotide composition comprises
(Sp).sub.tRp(Sp).sub.5. In some embodiments, the common pattern of
backbone chiral centers of a provided chirally controlled
oligonucleotide composition comprises SpRp(Sp).sub.5. In some
embodiments, the common pattern of backbone chiral centers of a
provided chirally controlled oligonucleotide composition comprises
(Sp).sub.2Rp(Sp).sub.5. In some embodiments, the common pattern of
backbone chiral centers of a provided chirally controlled
oligonucleotide composition comprises (Sp).sub.3Rp(Sp).sub.5. In
some embodiments, the common pattern of backbone chiral centers of
a provided chirally controlled oligonucleotide composition
comprises (Sp).sub.4Rp(Sp).sub.5. In some embodiments, the common
pattern of backbone chiral centers of a provided chirally
controlled oligonucleotide composition comprises
(Sp).sub.5Rp(Sp).sub.5. In some embodiments, a common pattern of
backbone chiral centers has only one Rp, and each of the other
internucleotidic linkages is Sp. In some embodiments, a common base
length is greater than 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 32, 35, 40, 45 or 50 as
described in the present disclosure. In some embodiments, a common
base length is greater than 10. In some embodiments, a common base
length is greater than 11. In some embodiments, a common base
length is greater than 12. In some embodiments, a common base
length is greater than 13. In some embodiments, a common base
length is greater than 14. In some embodiments, a common base
length is greater than 15. In some embodiments, a common base
length is greater than 16. In some embodiments, a common base
length is greater than 17. In some embodiments, a common base
length is greater than 18. In some embodiments, a common base
length is greater than 19. In some embodiments, a common base
length is greater than 20. In some embodiments, a common base
length is greater than 21. In some embodiments, a common base
length is greater than 22. In some embodiments, a common base
length is greater than 23. In some embodiments, a common base
length is greater than 24. In some embodiments, a common base
length is greater than 25. In some embodiments, a common base
length is greater than 26. In some embodiments, a common base
length is greater than 27. In some embodiments, a common base
length is greater than 28. In some embodiments, a common base
length is greater than 29. In some embodiments, a common base
length is greater than 30. In some embodiments, a common base
length is greater than 31. In some embodiments, a common base
length is greater than 32. In some embodiments, a common base
length is greater than 33. In some embodiments, a common base
length is greater than 34. In some embodiments, a common base
length is greater than 35.
[1456] In some embodiments, a provided chirally controlled
oligonucleotide composition provides higher turn-over. In some
embodiments, cleavage products from a nucleic acid polymer
dissociate from oligonucleotides of a provided chirally controlled
oligonucleotide composition at a faster rate than from
oligonucleotides of a reference oligonucleotide composition, for
example, a chirally uncontrolled oligonucleotide composition. In
some embodiments, a provided chirally controlled oligonucleotide
composition can be administered in lower unit dosage, and/or total
dosage, and/or fewer doses than chirally uncontrolled
oligonucleotide composition.
[1457] In some embodiments, a chirally controlled oligonucleotide
composition provides fewer cleavage sites in the sequence of a
nucleic acid polymer that is complementary to its common base
sequence or a sequence within its common base sequence when
compared to a reference oligonucleotide composition. In some
embodiments, a chirally controlled oligonucleotide composition
provides fewer cleavage sites in the sequence of a nucleic acid
polymer that is complementary to its common base sequence. In some
embodiments, a nucleic acid polymer is selectively cleaved at a
single site within the sequence that is complementary to the common
base sequence, or a sequence within the common base sequence, of a
chirally controlled oligonucleotide composition. In some
embodiments, a chirally controlled oligonucleotide composition
provides higher cleavage percentage at a cleavage site within the
sequence that is complementary to the common base sequence, or a
sequence within the common base sequence, of the chirally
controlled oligonucleotide composition. In some embodiments, a
chirally controlled oligonucleotide composition provides higher
cleavage percentage at a cleavage site within the sequence that is
complementary to the common base sequence of the chirally
controlled oligonucleotide composition. In some embodiments, a site
having a higher cleavage percentage is a cleavage site when a
reference oligonucleotide composition is used. In some embodiments,
a site having a higher cleavage percentage is a cleavage site that
is not present when a reference oligonucleotide composition is
used.
[1458] It is surprisingly found that with reduced number of
cleavage sites in the complementary sequence, cleavage rate can be
unexpectedly increased and/or higher cleavage percentage can be
achieved. As demonstrated in the examples of this disclosure,
provided chirally controlled oligonucleotide compositions that
produce fewer cleavage sites, especially those that provide
single-site cleavage, within the complementary sequences of target
nucleic acid polymers provide much higher cleavage rates and much
lower levels of remaining un-cleaved nucleic acid polymers. Such
results are in sharp contrast to general teachings in the art in
which more cleavage sites have been pursued in order to increase
the cleavage rate.
[1459] In some embodiments, a chirally controlled oligonucleotide
composition increases cleavage rate by 1.5 fold compared to a
reference oligonucleotide composition. In some embodiments,
cleavage rate is increased by at least 2 fold. In some embodiments,
cleavage rate is increased by at least 3 fold. In some embodiments,
cleavage rate is increased by at least 4 fold. In some embodiments,
cleavage rate is increased by at least 5 fold. In some embodiments,
cleavage rate is increased by at least 6 fold. In some embodiments,
cleavage rate is increased by at least 7 fold. In some embodiments,
cleavage rate is increased by at least 8 fold. In some embodiments,
cleavage rate is increased by at least 9 fold. In some embodiments,
cleavage rate is increased by at least 10 fold. In some
embodiments, cleavage rate is increased by at least 11 fold. In
some embodiments, cleavage rate is increased by at least 12 fold.
In some embodiments, cleavage rate is increased by at least 13
fold. In some embodiments, cleavage rate is increased by at least
14 fold. In some embodiments, cleavage rate is increased by at
least 15 fold. In some embodiments, cleavage rate is increased by
at least 20 fold. In some embodiments, cleavage rate is increased
by at least 30 fold. In some embodiments, cleavage rate is
increased by at least 40 fold. In some embodiments, cleavage rate
is increased by at least 50 fold. In some embodiments, cleavage
rate is increased by at least 60 fold. In some embodiments,
cleavage rate is increased by at least 70 fold. In some
embodiments, cleavage rate is increased by at least 80 fold. In
some embodiments, cleavage rate is increased by at least 90 fold.
In some embodiments, cleavage rate is increased by at least 100
fold. In some embodiments, cleavage rate is increased by at least
200 fold. In some embodiments, cleavage rate is increased by at
least 300 fold. In some embodiments, cleavage rate is increased by
at least 400 fold. In some embodiments, cleavage rate is increased
by at least 500 fold. In some embodiments, cleavage rate is
increased by at least more than 500 fold.
[1460] In some embodiments, a chirally controlled oligonucleotide
composition provides a lower level of remaining, un-cleaved target
nucleic acid polymer compared to a reference oligonucleotide
composition. In some embodiments, it is 1.5 fold lower. In some
embodiments, it is at least 2 fold lower. In some embodiments, it
is at least 3 fold lower. In some embodiments, it is at least 4
fold lower. In some embodiments, it is at least 5 fold lower. In
some embodiments, it is at least 6 fold lower. In some embodiments,
it is at least 7 fold lower. In some embodiments, it is at least 8
fold lower. In some embodiments, it is at least 9 fold lower. In
some embodiments, it is at least 10 fold lower. In some
embodiments, it is at least 11 fold lower. In some embodiments, it
is at least 12 fold lower. In some embodiments, it is at least 13
fold lower. In some embodiments, it is at least 14 fold lower. In
some embodiments, it is at least 15 fold lower. In some
embodiments, it is at least 20 fold lower. In some embodiments, it
is at least 30 fold lower. In some embodiments, it is at least 40
fold lower. In some embodiments, it is at least 50 fold lower. In
some embodiments, it is at least 60 fold lower. In some
embodiments, it is at least 70 fold lower. In some embodiments, it
is at least 80 fold lower. In some embodiments, it is at least 90
fold lower. In some embodiments, it is at least 100 fold lower. In
some embodiments, it is at least 200 fold lower. In some
embodiments, it is at least 300 fold lower. In some embodiments, it
is at least 400 fold lower. In some embodiments, it is at least 500
fold lower. In some embodiments, it is at least 1000 fold
lower.
[1461] As discussed in detail herein, the present disclosure
provides, among other things, a chirally controlled oligonucleotide
composition, meaning that the composition contains a plurality of
oligonucleotides of at least one type. Each oligonucleotide
molecule of a particular "type" is comprised of preselected (e.g.,
predetermined) structural elements with respect to: (1) base
sequence; (2) pattern of backbone linkages; (3) pattern of backbone
chiral centers; and (4) pattern of backbone P-modification
moieties. In some embodiments, provided oligonucleotide
compositions contain oligonucleotides that are prepared in a single
synthesis process. In some embodiments, provided compositions
contain oligonucleotides having more than one chiral configuration
within a single oligonucleotide molecule (e.g., where different
residues along the oligonucleotide have different stereochemistry);
in some such embodiments, such oligonucleotides may be obtained in
a single synthesis process, without the need for secondary
conjugation steps to generate individual oligonucleotide molecules
with more than one chiral configuration.
[1462] Oligonucleotide compositions as provided herein can be used
as agents for modulating a number of cellular processes and
machineries, including but not limited to, transcription,
translation, immune responses, epigenetics, etc. In addition,
oligonucleotide compositions as provided herein can be used as
reagents for research and/or diagnostic purposes. One of ordinary
skill in the art will readily recognize that the present disclosure
herein is not limited to particular use but is applicable to any
situations where the use of synthetic oligonucleotides is
desirable. Among other things, provided compositions are useful in
a variety of therapeutic, diagnostic, agricultural, and/or research
applications.
[1463] In some embodiments, provided oligonucleotide compositions
comprise oligonucleotides and/or residues thereof that include one
or more structural modifications as described in detail herein. In
some embodiments, provided oligonucleotide compositions comprise
oligonucleoties that contain one or more nucleic acid analogs. In
some embodiments, provided oligonucleotide compositions comprise
oligonucleotides that contain one or more artificial nucleic acids
or residues (e.g., a nucleotide analog), including but not limited
to: a peptide nucleic acid (PNA), locked nucleic acid (LNA),
morpholino, threose nucleic acid (TNA), glycol nucleic acid (GNA),
arabinose nucleic acid (ANA), 2'-fluoroarabinose nucleic acid
(FANA), cyclohexene nucleic acid (CeNA), anhydrohexitol nucleic
acid (HNA), and/or unlocked nucleic acid (UNA), threose nucleic
acids (TNA), and/or Xeno nucleic acids (XNA), and any combination
thereof.
[1464] In any of the embodiments, the disclosure is useful for
oligonucleotide-based modulation of gene expression, immune
response, etc. Accordingly, stereodefined, oligonucleotide
compositions of the disclosure, which contain oligonucleotides of
predetermined type (i.e., which are chirally controlled, and
optionally chirally pure), can be used in lieu of conventional
stereo-random or chirally impure counterparts. In some embodiments,
provided compositions show enhanced intended effects and/or reduced
unwanted side effects. Certain embodiments of biological and
clinical/therapeutic applications of the disclosure are discussed
explicitly below.
[1465] Various dosing regimens can be utilized to administer
provided chirally controlled oligonucleotide compositions. In some
embodiments, multiple unit doses are administered, separated by
periods of time. In some embodiments, a given composition has a
recommended dosing regimen, which may involve one or more doses. In
some embodiments, a dosing regimen comprises a plurality of doses
each of which are separated from one another by a time period of
the same length; in some embodiments, a dosing regimen comprises a
plurality of doses and at least two different time periods
separating individual doses. In some embodiments, all doses within
a dosing regimen are of the same unit dose amount. In some
embodiments, different doses within a dosing regimen are of
different amounts. In some embodiments, a dosing regimen comprises
a first dose in a first dose amount, followed by one or more
additional doses in a second dose amount different from the first
dose amount. In some embodiments, a dosing regimen comprises a
first dose in a first dose amount, followed by one or more
additional doses in a second (or subsequent) dose amount that is
same as or different from the first dose (or another prior dose)
amount. In some embodiments, a dosing regimen comprises
administering at least one unit dose for at least one day. In some
embodiments, a dosing regimen comprises administering more than one
dose over a time period of at least one day, and sometimes more
than one day. In some embodiments, a dosing regimen comprises
administering multiple doses over a time period of at least week.
In some embodiments, the time period is at least 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 24,
25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or
more (e.g., about 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100
or more) weeks. In some embodiments, a dosing regimen comprises
administering one dose per week for more than one week. In some
embodiments, a dosing regimen comprises administering one dose per
week for 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40 or more (e.g., about 45, 50, 55, 60, 65, 70,
75, 80, 85, 90, 95, 100 or more) weeks. In some embodiments, a
dosing regimen comprises administering one dose every two weeks for
more than two week period. In some embodiments, a dosing regimen
comprises administering one dose every two weeks over a time period
of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
37, 38, 39, 40 or more (e.g., about 45, 50, 55, 60, 65, 70, 75, 80,
85, 90, 95, 100 or more) weeks. In some embodiments, a dosing
regimen comprises administering one dose per month for one month.
In some embodiments, a dosing regimen comprises administering one
dose per month for more than one month. In some embodiments, a
dosing regimen comprises administering one dose per month for 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, or more months. In some embodiments,
a dosing regimen comprises administering one dose per week for
about 10 weeks. In some embodiments, a dosing regimen comprises
administering one dose per week for about 20 weeks. In some
embodiments, a dosing regimen comprises administering one dose per
week for about 30 weeks. In some embodiments, a dosing regimen
comprises administering one dose per week for 26 weeks. In some
embodiments, a chirally controlled oligonucleotide composition is
administered according to a dosing regimen that differs from that
utilized for a chirally uncontrolled (e.g., stereorandom)
oligonucleotide composition of the same sequence, and/or of a
different chirally controlled oligonucleotide composition of the
same sequence. In some embodiments, a chirally controlled
oligonucleotide composition is administered according to a dosing
regimen that is reduced as compared with that of a chirally
uncontrolled (e.g., stereorandom) oligonucleotide composition of
the same sequence in that it achieves a lower level of total
exposure over a given unit of time, involves one or more lower unit
doses, and/or includes a smaller number of doses over a given unit
of time. In some embodiments, a chirally controlled oligonucleotide
composition is administered according to a dosing regimen that
extends for a longer period of time than does that of a chirally
uncontrolled (e.g., stereorandom) oligonucleotide composition of
the same sequence Without wishing to be limited by theory,
Applicant notes that in some embodiments, the shorter dosing
regimen, and/or longer time periods between doses, may be due to
the improved stability, bioavailability, and/or efficacy of a
chirally controlled oligonucleotide composition. In some
embodiments, a chirally controlled oligonucleotide composition has
a longer dosing regimen compared to the corresponding chirally
uncontrolled oligonucleotide composition. In some embodiments, a
chirally controlled oligonucleotide composition has a shorter time
period between at least two doses compared to the corresponding
chirally uncontrolled oligonucleotide composition. Without wishing
to be limited by theory, Applicant notes that in some embodiments
longer dosing regimen, and/or shorter time periods between doses,
may be due to the improved safety of a chirally controlled
oligonucleotide composition.
[1466] A single dose can contain various amounts of a type of
chirally controlled oligonucleotide, as desired suitable by the
application. In some embodiments, a single dose contains about 1,
5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140,
150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270,
280, 290, 300 or more (e.g., about 350, 400, 450, 500, 550, 600,
650, 700, 750, 800, 850, 900, 950, 1000 or more) mg of a type of
chirally controlled oligonucleotide. In some embodiments, a single
dose contains about 1 mg of a type of chirally controlled
oligonucleotide. In some embodiments, a single dose contains about
5 mg of a type of chirally controlled oligonucleotide. In some
embodiments, a single dose contains about 10 mg of a type of
chirally controlled oligonucleotide. In some embodiments, a single
dose contains about 15 mg of a type of chirally controlled
oligonucleotide. In some embodiments, a single dose contains about
20 mg of a type of chirally controlled oligonucleotide. In some
embodiments, a single dose contains about 50 mg of a type of
chirally controlled oligonucleotide. In some embodiments, a single
dose contains about 100 mg of a type of chirally controlled
oligonucleotide. In some embodiments, a single dose contains about
150 mg of a type of chirally controlled oligonucleotide. In some
embodiments, a single dose contains about 200 mg of a type of
chirally controlled oligonucleotide. In some embodiments, a single
dose contains about 250 mg of a type of chirally controlled
oligonucleotide. In some embodiments, a single dose contains about
300 mg of a type of chirally controlled oligonucleotide. In some
embodiments, a chirally controlled oligonucleotide is administered
at a lower amount in a single dose, and/or in total dose, than a
chirally uncontrolled oligonucleotide. In some embodiments, a
chirally controlled oligonucleotide is administered at a lower
amount in a single dose, and/or in total dose, than a chirally
uncontrolled oligonucleotide due to improved efficacy. In some
embodiments, a chirally controlled oligonucleotide is administered
at a higher amount in a single dose, and/or in total dose, than a
chirally uncontrolled oligonucleotide. In some embodiments, a
chirally controlled oligonucleotide is administered at a higher
amount in a single dose, and/or in total dose, than a chirally
uncontrolled oligonucleotide due to improved safety.
Biologically Active Oligonucleotides
[1467] A provided oligonucleotide composition as used herein may
comprise single stranded and/or multiply stranded oligonucleotides.
In some embodiments, single-stranded oligonucleotides contain
self-complementary portions that may hybridize under relevant
conditions so that, as used, even single-stranded oligonucleotides
may have at least partially double-stranded character. In some
embodiments, an oligonucleotide included in a provided composition
is single-stranded, double-stranded, or triple-stranded. In some
embodiments, an oligonucleotide included in a provided composition
comprises a single-stranded portion and a multiple-stranded portion
within the oligonucleotide. In some embodiments, as noted above,
individual single-stranded oligonucleotides can have
double-stranded regions and single-stranded regions.
[1468] In some embodiments, provided compositions include one or
more oligonucleotides fully or partially complementary to strand
of: structural genes, genes control and/or termination regions,
and/or self-replicating systems such as viral or plasmid DNA. In
some embodiments, provided compositions include one or more
oligonucleotides that are or act as siRNAs or other RNA
interference reagents (RNAi agents or iRNA agents), shRNA,
antisense oligonucleotides, self-cleaving RNAs, ribozymes, fragment
thereof and/or variants thereof (such as Peptidyl transferase 23S
rRNA, RNase P, Group I and Group II introns, GIR1 branching
ribozymes, Leadzyme, Hairpin ribozymes, Hammerhead ribozymes, HDV
ribozymes, Mammalian CPEB3 ribozyme, VS ribozymes, glmS ribozymes,
CoTC ribozyme, etc.), microRNAs, microRNA mimics, supermirs,
aptamers, antimirs, antagomirs, Ul adaptors, triplex-forming
oligonucleotides, RNA activators, long non-coding RNAs, short
non-coding RNAs (e.g., piRNAs), immunomodulatory oligonucleotides
(such as immunostimulatory oligonucleotides, immunoinhibitory
oligonucleotides), GNA, LNA, ENA, PNA, TNA, HNA, TNA, XNA, HeNA,
CeNA, morpholinos, G-quadruplex (RNA and DNA), antiviral
oligonucleotides, and decoy oligonucleotides.
[1469] In some embodiments, provided compositions include one or
more hybrid (e.g., chimeric) oligonucleotides. In the context of
the present disclosure, the term "hybrid" broadly refers to mixed
structural components of oligonucleotides. Hybrid oligonucleotides
may refer to, for example, (1) an oligonucleotide molecule having
mixed classes of nucleotides, e.g., part DNA and part RNA within
the single molecule (e.g., DNA-RNA); (2) complementary pairs of
nucleic acids of different classes, such that DNA:RNA base pairing
occurs either intramolecularly or intermolecularly; or both; (3) an
oligonucleotide with two or more kinds of the backbone or
internucleotide linkages.
[1470] In some embodiments, provided compositions include one or
more oligonucleotide that comprises more than one classes of
nucleic acid residues within a single molecule. For example, in any
of the embodiments described herein, an oligonucleotide may
comprise a DNA portion and an RNA portion. In some embodiments, an
oligonucleotide may comprise a unmodified portion and modified
portion.
[1471] Provided oligonucleotide compositions can include
oligonucleotides containing any of a variety of modifications, for
example as described herein. In some embodiments, particular
modifications are selected, for example, in light of intended use.
In some embodiments, it is desirable to modify one or both strands
of a double-stranded oligonucleotide (or a double-stranded portion
of a single-stranded oligonucleotide). In some embodiments, the two
strands (or portions) include different modifications. In some
embodiments, the two strands include the same modifications. One of
skill in the art will appreciate that the degree and type of
modifications enabled by methods of the present disclosure allow
for numerous permutations of modifications to be made. Examples of
such modifications are described herein and are not meant to be
limiting.
[1472] The phrase "antisense strand" as used herein, refers to an
oligonucleotide that is substantially or 100% complementary to a
target sequence of interest. The phrase "antisense strand" includes
the antisense region of both oligonucleotides that are formed from
two separate strands, as well as unimolecular oligonucleotides that
are capable of forming hairpin or dumbbell type structures. The
terms "antisense strand" and "guide strand" are used
interchangeably herein.
[1473] The phrase "sense strand" refers to an oligonucleotide that
has the same nucleoside sequence, in whole or in part, as a target
sequence such as a messenger RNA or a sequence of DNA. The terms
"sense strand" and "passenger strand" are used interchangeably
herein.
[1474] By "target sequence" is meant any nucleic acid sequence
whose expression or activity is to be modulated. The target nucleic
acid can be DNA or RNA, such as endogenous DNA or RNA, viral DNA or
viral RNA, or other RNA encoded by a gene, virus, bacteria, fungus,
mammal, or plant. In some embodiments, a target sequence is
associated with a disease or disorder. In some embodiments, a
target sequence is or comprises a portion of the Huntingtin gene.
In some embodiments, a target sequence is or comprises a portion of
the Huntingtin gene comprising a SNP.
[1475] By "specifically hybridizable" and "complementary" is meant
that a nucleic acid can form hydrogen bond(s) with another nucleic
acid sequence by either traditional Watson-Crick or other
non-traditional types. In reference to the nucleic molecules of the
present disclosure, the binding free energy for a nucleic acid
molecule with its complementary sequence is sufficient to allow the
relevant function of the nucleic acid to proceed, e.g., RNAi
activity. Determination of binding free energies for nucleic acid
molecules is well known in the art (see, e.g., Turner et al, 1987,
CSH Symp. Quant. Biol. LIT pp. 123-133; Frier et al., 1986, Proc.
Nat. Acad. Sci. USA 83:9373-9377; Turner et al., 1987, /. Ain.
Chem. Soc. 109:3783-3785)
[1476] A percent complementarity indicates the percentage of
contiguous residues in a nucleic acid molecule that can form
hydrogen bonds (e.g., Watson-Crick base pairing) with a second
nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%,
60%, 70%, 80%, 90%, and 100% complementary). "Perfectly
complementary" or 100% complementarity means that all the
contiguous residues of a nucleic acid sequence will hydrogen bond
with the same number of contiguous residues in a second nucleic
acid sequence. Less than perfect complementarity refers to the
situation in which some, but not all, nucleoside units of two
strands can hydrogen bond with each other. "Substantial
complementarity" refers to polynucleotide strands exhibiting 90% or
greater complementarity, excluding regions of the polynucleotide
strands, such as overhangs, that are selected so as to be
noncomplementary. Specific binding requires a sufficient degree of
complementarity to avoid non-specific binding of the oligomeric
compound to non-target sequences under conditions in which specific
binding is desired, e.g., under physiological conditions in the
case of in vivo assays or therapeutic treatment, or in the case of
in vitro assays, under conditions in which the assays are
performed. In some embodiments, non-target sequences differ from
corresponding target sequences by at least 5 nucleotides.
[1477] When used as therapeutics, a provided oligonucleotide is
administered as a pharmaceutical composition. In some embodiments,
the pharmaceutical composition comprises a therapeutically
effective amount of a provided oligonucleotide comprising, or a
pharmaceutically acceptable salt thereof, and at least one
pharmaceutically acceptable inactive ingredient selected from
pharmaceutically acceptable diluents, pharmaceutically acceptable
excipients, and pharmaceutically acceptable carriers. In another
embodiment, the pharmaceutical composition is formulated for
intravenous injection, oral administration, buccal administration,
inhalation, nasal administration, topical administration,
ophthalmic administration, intrathecal administration, or otic
administration. In another embodiment, the pharmaceutical
composition is formulated for intravenous injection, oral
administration, buccal administration, inhalation, nasal
administration, topical administration, ophthalmic administration
or otic administration. In further embodiments, the pharmaceutical
composition is a tablet, a pill, a capsule, a liquid, an inhalant,
a nasal spray solution, a suppository, a suspension, a gel, a
colloid, a dispersion, a suspension, a solution, an emulsion, an
ointment, a lotion, an eye drop, an ear drop, or a preparation
comprising artificial cerebrospinal fluid. In further embodiments,
the pharmaceutical composition is a tablet, a pill, a capsule, a
liquid, an inhalant, a nasal spray solution, a suppository, a
suspension, a gel, a colloid, a dispersion, a suspension, a
solution, an emulsion, an ointment, a lotion, an eye drop or an ear
drop. In some embodiments, a pharmaceutical composition comprises
cerebrospinal fluid. In some embodiments, a pharmaceutical
composition comprises artificial cerebrospinal fluid. In some
embodiments, a pharmaceutical composition comprises an
oligonucleotide, wherein the sequence of the oligonucleotide
comprises a sequence which targets a portion of the Huntingtin
gene. In some embodiments, the sequence targets a portion of the
Huntingtin gene comprising a SNP. In some embodiments, the base
sequence, pattern of backbone linkages, pattern of backbone chiral
centers, and/or pattern of sugar modifications of the
oligonucleotide is or comprises the base sequence, pattern of
backbone linkages, pattern of backbone chiral centers, and/or
pattern of sugar modifications of any oligonucleotide disclosed
herein, and the oligonucleotide is comprised in a pharmaceutical
composition comprising any component of a pharmaceutical
composition disclosed herein. In some embodiments, the
oligonucleotide targets the Huntingtin gene (as a non-limiting
example, a SNP in the Huntingtin gene), and the base sequence,
pattern of backbone linkages, pattern of backbone chiral centers,
and/or pattern of sugar modifications of the oligonucleotide is or
comprises the base sequence, pattern of backbone linkages, pattern
of backbone chiral centers, and/or pattern of sugar modifications
of any oligonucleotide disclosed herein, and the oligonucleotide is
comprised in a pharmaceutical composition comprising artificial
cerebrospinal fluid, and the pharmaceutical composition is
administered via intrathecal administration.
Pharmaceutical Compositions
[1478] When used as therapeutics, a provided oligonucleotide or
oligonucleotide composition described herein is administered as a
pharmaceutical composition. In some embodiments, the pharmaceutical
composition comprises a therapeutically effective amount of a
provided oligonucleotides, or a pharmaceutically acceptable salt
thereof, and at least one pharmaceutically acceptable inactive
ingredient selected from pharmaceutically acceptable diluents,
pharmaceutically acceptable excipients, and pharmaceutically
acceptable carriers. In some embodiments, the pharmaceutical
composition is formulated for intravenous injection, oral
administration, buccal administration, inhalation, nasal
administration, topical administration, ophthalmic administration,
intrathecal administration, or otic administration. In some
embodiments, the pharmaceutical composition is formulated for
intravenous injection, oral administration, buccal administration,
inhalation, nasal administration, topical administration,
ophthalmic administration or otic administration. In some
embodiments, the pharmaceutical composition is a tablet, a pill, a
capsule, a liquid, an inhalant, a nasal spray solution, a
suppository, a suspension, a gel, a colloid, a dispersion, a
suspension, a solution, an emulsion, an ointment, a lotion, an eye
drop, an ear drop, or a preparation comprising artificial
cerebrospinal fluid. In some embodiments, the pharmaceutical
composition is a tablet, a pill, a capsule, a liquid, an inhalant,
a nasal spray solution, a suppository, a suspension, a gel, a
colloid, a dispersion, a suspension, a solution, an emulsion, an
ointment, a lotion, an eye drop or an ear drop. In some
embodiments, a provided composition comprises cerebrospinal fluid.
In some embodiments, a provided composition comprises artificial
cerebrospinal fluid.
[1479] In some embodiments, the present disclosure provides a
pharmaceutical composition comprising chirally controlled
oligonucleotide, or composition thereof, in admixture with a
pharmaceutically acceptable excipient. One of skill in the art will
recognize that the pharmaceutical compositions include the
pharmaceutically acceptable salts of the chirally controlled
oligonucleotide, or composition thereof, described above.
[1480] A variety of supramolecular nanocarriers can be used to
deliver nucleic acids. Example nanocarriers include, but are not
limited to liposomes, cationic polymer complexes and various
polymeric. Complexation of nucleic acids with various polycations
is another approach for intracellular delivery; this includes use
of PEGlyated polycations, polyethyleneamine (PEI) complexes,
cationic block co-polymers, and dendrimers. Several cationic
nanocarriers, including PEI and polyamidoamine dendrimers help to
release contents from endosomes. Other approaches include use of
polymeric nanoparticles, polymer micelles, quantum dots and
lipoplexes.
[1481] Additional nucleic acid delivery strategies are known in
addition to the example delivery strategies described herein.
[1482] In therapeutic and/or diagnostic applications, the compounds
of the disclosure can be formulated for a variety of modes of
administration, including systemic and topical or localized
administration. Techniques and formulations generally may be found
in Remington, The Science and Practice of Pharmacy, (20th ed.
2000).
[1483] Provided oligonucleotides, and compositions thereof, are
effective over a wide dosage range. For example, in the treatment
of adult humans, dosages from about 0.01 to about 1000 mg, from
about 0.5 to about 100 mg, from about 1 to about 50 mg per day, and
from about 5 to about 100 mg per day are examples of dosages that
may be used. The exact dosage will depend upon the route of
administration, the form in which the compound is administered, the
subject to be treated, the body weight of the subject to be
treated, and the preference and experience of the attending
physician.
[1484] Pharmaceutically acceptable salts are generally well known
to those of ordinary skill in the art, and may include, by way of
example but not limitation, acetate, benzenesulfonate, besylate,
benzoate, bicarbonate, bitartrate, bromide, calcium edetate,
carnsylate, carbonate, citrate, edetate, edisylate, estolate,
esylate, fumarate, gluceptate, gluconate, glutamate,
glycollylarsanilate, hexylresorcinate, hydrabamine, hydrobromide,
hydrochloride, hydroxynaphthoate, iodide, isethionate, lactate,
lactobionate, malate, maleate, mandelate, mesylate, mucate,
napsylate, nitrate, pamoate (embonate), pantothenate,
phosphate/diphosphate, polygalacturonate, salicylate, stearate,
subacetate, succinate, sulfate, tannate, tartrate, or teoclate.
Other pharmaceutically acceptable salts may be found in, for
example, Remington, The Science and Practice of Pharmacy (20th ed.
2000). Preferred pharmaceutically acceptable salts include, for
example, acetate, benzoate, bromide, carbonate, citrate, gluconate,
hydrobromide, hydrochloride, maleate, mesylate, napsylate, pamoate
(embonate), phosphate, salicylate, succinate, sulfate, or
tartrate.
[1485] Depending on the specific conditions being treated, such
agents may be formulated into liquid or solid dosage forms and
administered systemically or locally. The agents may be delivered,
for example, in a timed- or sustained-low release form as is known
to those skilled in the art. Techniques for formulation and
administration may be found in Remington, The Science and Practice
of Pharmacy (20th ed. 2000). Suitable routes may include oral,
buccal, by inhalation spray, sublingual, rectal, transdermal,
vaginal, transmucosal, nasal or intestinal administration;
parenteral delivery, including intramuscular, subcutaneous,
intramedullary injections, as well as intrathecal, direct
intraventricular, intravenous, intra-articullar, intra-sternal,
intra-synovial, intra-hepatic, intralesional, intracranial,
intraperitoneal, intranasal, or intraocular injections or other
modes of delivery.
[1486] In some embodiments of a method or composition of the
present disclosure, a composition comprising an oligonucleotide is
administered via intrathecal administration. In some embodiments of
a method or composition of the present disclosure, a composition
comprising an oligonucleotide comprises artificial cerebrospinal
fluid and is administered via intrathecal administration. In some
embodiments of a method or composition of the present disclosure, a
composition comprising an oligonucleotide comprises one or more
components of artificial cerebrospinal fluid (for example, NaCl,
NaHCO.sub.3, KCl, NaH.sub.2PO.sub.4, MgCl.sub.2 and glucose) and is
administered via intrathecal administration. In some embodiments of
a method or composition of the present disclosure, a composition
comprising an oligonucleotide comprises one or more components of
artificial cerebrospinal fluid (for example, NaCl, NaHCO.sub.3,
KCl, NaH.sub.2PO.sub.4, MgCl.sub.2 and glucose) and is administered
via intrathecal administration, wherein the sequence of the
oligonucleotide comprises a sequence which targets a portion of the
Huntingtin gene. In some embodiments of a method or composition of
the present disclosure, a composition comprising an oligonucleotide
comprises two or more components of artificial cerebrospinal fluid
(for example, NaCl, NaHCO.sub.3, KCl, NaH.sub.2PO.sub.4, MgCl.sub.2
and glucose) and is administered via intrathecal administration,
wherein the sequence of the oligonucleotide comprises a sequence
which targets a portion of the Huntingtin gene. In some embodiments
of a method or composition of the present disclosure, a composition
comprising an oligonucleotide comprises three or more components of
artificial cerebrospinal fluid (for example, NaCl, NaHCO.sub.3,
KCl, NaH.sub.2PO.sub.4, MgCl.sub.2 and glucose) and is administered
via intrathecal administration, wherein the sequence of the
oligonucleotide comprises a sequence which targets a portion of the
Huntingtin gene. In some embodiments, provided oligonucleotides
comprise base sequence, pattern of backbone linkages, pattern or
backbone chiral centers, and/or pattern of chemical modifications
(e.g., base modifications, sugar modifications, etc.) of any
oligonucleotide disclosed herein. In some embodiments, the sequence
targets a portion of the Huntingtin gene comprising a SNP.
[1487] For injection, the agents of the disclosure may be
formulated and diluted in aqueous solutions, such as in
physiologically compatible buffers such as Hank's solution,
Ringer's solution, or physiological saline buffer. For such
transmucosal administration, penetrants appropriate to the barrier
to be permeated are used in the formulation. Such penetrants are
generally known in the art.
[1488] Use of pharmaceutically acceptable inert carriers to
formulate the compounds herein disclosed for the practice of the
disclosure into dosages suitable for systemic administration is
within the scope of the disclosure. With proper choice of carrier
and suitable manufacturing practice, the compositions of the
present disclosure, in particular, those formulated as solutions,
may be administered parenterally, such as by intravenous
injection.
[1489] The compounds can be formulated readily using
pharmaceutically acceptable carriers well known in the art into
dosages suitable for oral administration. Such carriers enable the
compounds of the disclosure to be formulated as tablets, pills,
capsules, liquids, gels, syrups, slurries, suspensions and the
like, for oral ingestion by a subject (e.g., patient) to be
treated.
[1490] For nasal or inhalation delivery, the agents of the
disclosure may also be formulated by methods known to those of
skill in the art, and may include, for example, but not limited to,
examples of solubilizing, diluting, or dispersing substances such
as, saline, preservatives, such as benzyl alcohol, absorption
promoters, and fluorocarbons.
[1491] In certain embodiments, oligonucleotides and compositions
are delivered to the CNS. In certain embodiments, oligonucleotides
and compositions are delivered to the cerebrospinal fluid. In
certain embodiments, oligonucleotides and compositions are
administered to the brain parenchyma. In certain embodiments,
oligonucleotides and compositions are delivered to an
animal/subject by intrathecal administration, or
intracerebroventricular administration. Broad distribution of
oligonucleotides and compositions, described herein, within the
central nervous system may be achieved with intraparenchymal
administration, intrathecal administration, or
intracerebroventricular administration.
[1492] In certain embodiments, parenteral administration is by
injection, by, e.g., a syringe, a pump, etc. In certain
embodiments, the injection is a bolus injection. In certain
embodiments, the injection is administered directly to a tissue,
such as striatum, caudate, cortex, hippocampus and cerebellum.
[1493] In certain embodiments, methods of specifically localizing a
pharmaceutical agent, such as by bolus injection, decreases median
effective concentration (EC50) by a factor of 20, 25, 30, 35, 40,
45 or 50. In certain embodiments, the pharmaceutical agent in an
antisense compound as further described herein. In certain
embodiments, the targeted tissue is brain tissue. In certain
embodiments the targeted tissue is striatal tissue. In certain
embodiments, decreasing EC50 is desirable because it reduces the
dose required to achieve a pharmacological result in a patient in
need thereof.
[1494] In certain embodiments, an antisense oligonucleotide is
delivered by injection or infusion once every month, every two
months, every 90 days, every 3 months, every 6 months, twice a year
or once a year.
[1495] Pharmaceutical compositions suitable for use in the present
disclosure include compositions wherein the active ingredients are
contained in an effective amount to achieve its intended purpose.
Determination of the effective amounts is well within the
capability of those skilled in the art, especially in light of the
detailed disclosure provided herein.
[1496] In addition to the active ingredients, these pharmaceutical
compositions may contain suitable pharmaceutically acceptable
carriers comprising excipients and auxiliaries which facilitate
processing of the active compounds into preparations which can be
used pharmaceutically. The preparations formulated for oral
administration may be in the form of tablets, dragees, capsules, or
solutions.
[1497] Pharmaceutical preparations for oral use can be obtained by
combining the active compounds with solid excipients, optionally
grinding a resulting mixture, and processing the mixture of
granules, after adding suitable auxiliaries, if desired, to obtain
tablets or dragee cores. Suitable excipients are, in particular,
fillers such as sugars, including lactose, sucrose, mannitol, or
sorbitol; cellulose preparations, for example, maize starch, wheat
starch, rice starch, potato starch, gelatin, gum tragacanth, methyl
cellulose, hydroxypropylmethyl-cellulose, sodium
carboxymethyl-cellulose (CMC), and/or polyvinylpyrrolidone (PVP:
povidone). If desired, disintegrating agents may be added, such as
the cross-linked polyvinylpyrrolidone, agar, or alginic acid or a
salt thereof such as sodium alginate.
[1498] Dragee cores are provided with suitable coatings. For this
purpose, concentrated sugar solutions may be used, which may
optionally contain gum arabic, talc, polyvinylpyrrolidone, carbopol
gel, polyethylene glycol (PEG), and/or titanium dioxide, lacquer
solutions, and suitable organic solvents or solvent mixtures.
Dye-stuffs or pigments may be added to the tablets or dragee
coatings for identification or to characterize different
combinations of active compound doses.
[1499] Pharmaceutical preparations that can be used orally include
push-fit capsules made of gelatin, as well as soft, sealed capsules
made of gelatin, and a plasticizer, such as glycerol or sorbitol.
The push-fit capsules can contain the active ingredients in
admixture with filler such as lactose, binders such as starches,
and/or lubricants such as talc or magnesium stearate and,
optionally, stabilizers. In soft capsules, the active compounds may
be dissolved or suspended in suitable liquids, such as fatty oils,
liquid paraffin, or liquid polyethylene glycols (PEGs). In
addition, stabilizers may be added.
[1500] Depending upon the particular condition, or disease state,
to be treated or prevented, additional therapeutic agents, which
are normally administered to treat or prevent that condition, may
be administered together with oligonucleotides of this disclosure.
For example, chemotherapeutic agents or other anti-proliferative
agents may be combined with the oligonucleotides of this disclosure
to treat proliferative diseases and cancer. Examples of known
chemotherapeutic agents include, but are not limited to,
adriamycin, dexamethasone, vincristine, cyclophosphamide,
fluorouracil, topotecan, taxol, interferons, and platinum
derivatives.
[1501] The function and advantage of these and other embodiments of
the present disclosure will be more fully understood from the
examples described below. The following examples are intended to
illustrate the benefits of the present disclosure, but do not
exemplify the full scope of the disclosure.
Lipids
[1502] In some embodiments, provided oligonucleotide compositions
further comprise one or more lipids. In some embodiments, the
lipids are conjugated to provided oligonucleotides in the
compositions. In some embodiments, two or more same or different
lipids can be conjugated to one oligonucleotide, through either the
same or differently chemistry and/or locations. In some
embodiments, a composition can comprise an oligonucleotide
disclosed herein (as non-limiting examples, a chirally controlled
oligonucleotide composition, or a chirally controlled
oligonucleotide composition wherein the sequence of the
oligonucleotide comprises, consists of or is the sequence of any
oligonucleotide disclosed herein, or a chirally controlled
oligonucleotide composition wherein the sequence of the
oligonucleotide comprises, consists of or is the sequence of any
oligonucleotide disclosed in Table 8 or any other Table herein,
etc.) and a lipid. In some embodiments, a provided oligonucleotide
comprises base sequence, pattern of backbone linkages, pattern or
backbone chiral centers, and/or pattern of chemical modifications
(e.g., base modifications, sugar modifications, etc.) of any
oligonucleotide disclosed herein, and is conjugated to a lipid. In
some embodiments, a provided composition comprises an
oligonucleotide disclosed herein and a lipid, wherein the lipid is
conjugated to the oligonucleotide.
[1503] In some embodiments, the present disclosure provides a
composition comprising an oligonucleotide amd a lipid. Many lipids
can be utilized in provided technologies in accordance with the
present disclosure.
[1504] In some embodiments, a lipid comprises an R.sup.LD group,
wherein R.sup.LD is an optionally substituted, C.sub.10-C.sub.80
saturated or partially unsaturated aliphatic group, wherein one or
more methylene units are optionally and independently replaced by
an optionally substituted group selected from C.sub.1-C.sub.6
alkylene, C.sub.1-C.sub.6 alkenylene, --C.ident.--, a
C.sub.1-C.sub.6 heteroaliphatic moiety, --C(R').sub.2--, -Cy-,
--O--, --S--, --S--S--, --N(R')--, --C(O)--, --C(S)--, --C(NR')--,
--C(O)N(R')--, --N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--,
--OC(O)N(R')--, --S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--,
--N(R')S(O).sub.2--SC(O)--, --C(O)S--, --OC(O)--, and --C(O)O--,
wherein: [1505] each R' is independently --R, --C(O)R, --CO.sub.2R,
or --SO.sub.2R, or: [1506] two R' are taken together with their
intervening atoms to form an optionally substituted aryl,
carbocyclic, heterocyclic, or heteroaryl ring; [1507] -Cy- is an
optionally substituted bivalent ring selected from carbocyclylene,
arylene, heteroarylene, and heterocyclylene; and [1508] each R is
independently hydrogen, or an optionally substituted group selected
from C.sub.1-C.sub.6 aliphatic, phenyl, carbocyclyl, aryl,
heteroaryl, or heterocyclyl.
[1509] In some embodiments, a lipid comprises an R.sup.LD group,
wherein R.sup.LD is an optionally substituted, C.sub.10-C.sub.60
saturated or partially unsaturated aliphatic group, wherein one or
more methylene units are optionally and independently replaced by
an optionally substituted group selected from C.sub.1-C.sub.6
alkylene, C.sub.1-C.sub.6 alkenylene, --C.ident.C--, a
C.sub.1-C.sub.6 heteroaliphatic moiety, --C(R').sub.2--, -Cy-,
--O--, --S--, --S--S--, --N(R')--, --C(O)--, --C(S)--, --C(NR')--,
--C(O)N(R')--, --N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--,
--OC(O)N(R')--, --S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--,
--N(R')S(O).sub.2--SC(O)--, --C(O)S--, --OC(O)--, and --C(O)O--,
wherein: [1510] each R' is independently --R, --C(O)R, --CO.sub.2R,
or --SO.sub.2R, or: [1511] two R' are taken together with their
intervening atoms to form an optionally substituted aryl,
carbocyclic, heterocyclic, or heteroaryl ring; [1512] -Cy- is an
optionally substituted bivalent ring selected from carbocyclylene,
arylene, heteroarylene, and heterocyclylene; and [1513] each R is
independently hydrogen, or an optionally substituted group selected
from C.sub.1-C.sub.6 aliphatic, phenyl, carbocyclyl, aryl,
heteroaryl, or heterocyclyl.
[1514] In some embodiments, a lipid comprises an R.sup.LD group,
wherein R.sup.LD is an optionally substituted, C.sub.10-C.sub.40
saturated or partially unsaturated aliphatic group, wherein one or
more methylene units are optionally and independently replaced by
an optionally substituted group selected from C.sub.1-C.sub.6
alkylene, C.sub.1-C.sub.6 alkenylene, --C.ident.C--, a
C.sub.1-C.sub.6 heteroaliphatic moiety, --C(R').sub.2--, -Cy-,
--O--, --S--, --S--S--, --N(R')--, --C(O)--, --C(S)--, --C(NR')--,
--C(O)N(R')--, --N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--,
--OC(O)N(R')--, --S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--,
--N(R')S(O).sub.2--SC(O)--, --C(O)S--, --OC(O)--, and --C(O)O--,
wherein: [1515] each R' is independently --R, --C(O)R, --CO.sub.2R,
or --SO.sub.2R, or: [1516] two R' are taken together with their
intervening atoms to form an optionally substituted aryl,
carbocyclic, heterocyclic, or heteroaryl ring; [1517] -Cy- is an
optionally substituted bivalent ring selected from carbocyclylene,
arylene, heteroarylene, and heterocyclylene; and [1518] each R is
independently hydrogen, or an optionally substituted group selected
from C.sub.1-C.sub.6 aliphatic, phenyl, carbocyclyl, aryl,
heteroaryl, or heterocyclyl.
[1519] In some embodiments, R.sup.LD is an optionally substituted,
C.sub.10-C.sub.80 saturated or partially unsaturated aliphatic
group, wherein one or more methylene units are optionally and
independently replaced by an optionally substituted group selected
from C.sub.1-C.sub.6 alkylene, C.sub.1-C.sub.6 alkenylene,
--C.ident.C--, a C.sub.1-C.sub.6 heteroaliphatic moiety,
--C(R').sub.2--, and -Cy-. In some embodiments, R.sup.LD is an
optionally substituted, C.sub.10-C.sub.60 saturated or partially
unsaturated aliphatic group, wherein one or more methylene units
are optionally and independently replaced by an optionally
substituted group selected from C.sub.1-C.sub.6 alkylene,
C.sub.1-C.sub.6 alkenylene, --C.ident.C--, a C.sub.1-C.sub.6
heteroaliphatic moiety, --C(R').sub.2--, and -Cy-. In some
embodiments, R.sup.LD is a hydrocarbon group consisting carbon and
hydrogen atoms.
[1520] In some embodiments, R.sup.LD is an optionally substituted,
C.sub.10-C.sub.60 saturated or partially unsaturated aliphatic
group, wherein one or more methylene units are optionally and
independently replaced by an optionally substituted group selected
from C.sub.1-C.sub.6 alkylene, C.sub.1-C.sub.6 alkenylene,
--C.ident.C--, a C.sub.1-C.sub.6 heteroaliphatic moiety,
--C(R').sub.2--, and -Cy-. In some embodiments, R.sup.LD is an
optionally substituted, C.sub.10-C.sub.60 saturated or partially
unsaturated aliphatic group, wherein one or more methylene units
are optionally and independently replaced by an optionally
substituted group selected from C.sub.1-C.sub.6 alkylene,
C.sub.1-C.sub.6 alkenylene, --C.ident.--, a C.sub.1-C.sub.6
heteroaliphatic moiety, --C(R').sub.2--, and -Cy-. In some
embodiments, R.sup.LD is a hydrocarbon group consisting carbon and
hydrogen atoms.
[1521] In some embodiments, R.sup.LD is an optionally substituted,
C.sub.10-C.sub.40 saturated or partially unsaturated aliphatic
group, wherein one or more methylene units are optionally and
independently replaced by an optionally substituted group selected
from C.sub.1-C.sub.6 alkylene, C.sub.1-C.sub.6 alkenylene,
--C.ident.C--, a C.sub.1-C.sub.6 heteroaliphatic moiety,
--C(R').sub.2--, and -Cy-. In some embodiments, R.sup.LD is an
optionally substituted, C.sub.10-C.sub.60 saturated or partially
unsaturated aliphatic group, wherein one or more methylene units
are optionally and independently replaced by an optionally
substituted group selected from C.sub.1-C.sub.6 alkylene,
C.sub.1-C.sub.6 alkenylene, --C.ident.C--, a C.sub.1-C.sub.6
heteroaliphatic moiety, --C(R').sub.2--, and -Cy-. In some
embodiments, R.sup.LD is a hydrocarbon group consisting carbon and
hydrogen atoms.
[1522] The aliphatic group of R.sup.LD can be a variety of suitable
length. In some embodiments, it is C.sub.10-C.sub.80. In some
embodiments, it is C.sub.10-C.sub.75. In some embodiments, it is
C.sub.10-C.sub.70. In some embodiments, it is C.sub.10-C.sub.65. In
some embodiments, it is C.sub.10-C.sub.60. In some embodiments, it
is C.sub.10-C.sub.50. In some embodiments, it is C.sub.10-C.sub.40.
In some embodiments, it is C.sub.10-C.sub.35. In some embodiments,
it is C.sub.10-C.sub.30. In some embodiments, it is
C.sub.10-C.sub.25. In some embodiments, it is C.sub.10-C.sub.24. In
some embodiments, it is C.sub.10-C.sub.23. In some embodiments, it
is C.sub.10-C.sub.22. In some embodiments, it is C.sub.10-C.sub.21.
In some embodiments, it is C.sub.12-C.sub.22. In some embodiments,
it is C.sub.13-C.sub.22. In some embodiments, it is
C.sub.14-C.sub.22. In some embodiments, it is C.sub.15-C.sub.22. In
some embodiments, it is C.sub.16-C.sub.22. In some embodiments, it
is C.sub.17-C.sub.22. In some embodiments, it is C.sub.18-C.sub.22.
In some embodiments, it is C.sub.10-C.sub.20. In some embodiments,
the lower end of the range is C.sub.10, C.sub.11, C.sub.12,
C.sub.13, C.sub.14, C.sub.15, C.sub.16, C.sub.17, or C.sub.18. In
some embodiments, the higher end of the range is Cis, C.sub.19,
C.sub.20, C.sub.21, C.sub.22, C.sub.23, C.sub.24, C.sub.25,
C.sub.26, C.sub.27, C.sub.28, C.sub.29, C.sub.30, C.sub.35,
C.sub.40, C.sub.45, C.sub.50, C.sub.55, or C.sub.60. In some
embodiments, it is C.sub.10. In some embodiments, it is C.sub.11.
In some embodiments, it is C.sub.12. In some embodiments, it is
C.sub.13. In some embodiments, it is C.sub.14. some embodiments, it
is Cis. In some embodiments, it is C.sub.16. In some embodiments,
it is C.sub.17. In some embodiments, it is Cis. In some
embodiments, it is C.sub.19. In some embodiments, it is C.sub.20.
In some embodiments, it is C.sub.21. In some embodiments, it is
C.sub.22. In some embodiments, it is C.sub.23. In some embodiments,
it is C.sub.24. In some embodiments, it is C.sub.25. In some
embodiments, it is C.sub.30. In some embodiments, it is C.sub.35.
In some embodiments, it is C.sub.40. In some embodiments, it is
C.sub.45. In some embodiments, it is C.sub.50. In some embodiments,
it is C.sub.55. In some embodiments, it is C.sub.60.
[1523] In some embodiments, a lipid comprises no more than one
R.sup.LD group. In some embodiments, a lipid comprises two or more
R.sup.LD groups.
[1524] In some embodiments, a lipid is conjugated to a biologically
active agent, optionally through a linker, as a moiety comprising
an R.sup.LD group. In some embodiments, a lipid is conjugated to a
biologically active agent, optionally through a linker, as a moiety
comprising no more than one R.sup.LD group. In some embodiments, a
lipid is conjugated to a biologically active agent, optionally
through a linker, as an R.sup.LD group. In some embodiments, a
lipid is conjugated to a biologically active agent, optionally
through a linker, as a moiety comprising two or more R.sup.LD
groups.
[1525] In some embodiments, R.sup.LD is an optionally substituted,
C.sub.10-C.sub.40 saturated or partially unsaturated, aliphatic
chain. In some embodiments, a lipid comprises an optionally
substituted C.sub.10-C.sub.40 saturated or partially unsaturated,
aliphatic chain.
[1526] In some embodiments, R.sup.LD is an optionally substituted
C.sub.10-C.sub.40 linear, saturated or partially unsaturated,
aliphatic chain. In some embodiments, a lipid comprises an
optionally substituted C.sub.10-C.sub.40 linear, saturated or
partially unsaturated, aliphatic chain.
[1527] In some embodiments, R.sup.LD is a C.sub.10-C.sub.40 linear,
saturated or partially unsaturated, aliphatic chain, optionally
substituted with one or more C.sub.1-4 aliphatic groups. In some
embodiments, a lipid comprises a C.sub.10-C.sub.40 linear,
saturated or partially unsaturated, aliphatic chain, optionally
substituted with one or more C.sub.1-4 aliphatic groups. In some
embodiments, R.sup.LD is a C.sub.10-C.sub.40 linear, saturated or
partially unsaturated, aliphatic chain, optionally substituted with
one or more C.sub.1-2 aliphatic groups. In some embodiments, a
lipid comprises a C.sub.10-C.sub.40 linear, saturated or partially
unsaturated, aliphatic chain, optionally substituted with one or
more C.sub.1-2 aliphatic groups. In some embodiments, R.sup.LD is a
C.sub.10-C.sub.40 linear, saturated or partially unsaturated,
aliphatic chain, optionally substituted with one or more methyl
groups. In some embodiments, a lipid comprises a C.sub.10-C.sub.40
linear, saturated or partially unsaturated, aliphatic chain,
optionally substituted with one or more methyl groups.
[1528] In some embodiments, R.sup.LD is an unsubstituted
C.sub.10-C.sub.40 linear, saturated or partially unsaturated,
aliphatic chain. In some embodiments, a lipid comprises an
unsubstituted C.sub.10-C.sub.40 linear, saturated or partially
unsaturated, aliphatic chain.
[1529] In some embodiments, a lipid comprises no more than one
optionally substituted C.sub.10-C.sub.40 linear, saturated or
partially unsaturated, aliphatic chain. In some embodiments, a
lipid comprises two or more optionally substituted
C.sub.10-C.sub.40 linear, saturated or partially unsaturated,
aliphatic chain.
[1530] In some embodiments, R.sup.LD is an optionally substituted,
C.sub.10-C.sub.60 saturated or partially unsaturated, aliphatic
chain. In some embodiments, a lipid comprises an optionally
substituted C.sub.10-C.sub.60 saturated or partially unsaturated,
aliphatic chain.
[1531] In some embodiments, R.sup.LD is an optionally substituted
C.sub.10-C.sub.60 linear, saturated or partially unsaturated,
aliphatic chain. In some embodiments, a lipid comprises an
optionally substituted C.sub.10-C.sub.60 linear, saturated or
partially unsaturated, aliphatic chain.
[1532] In some embodiments, R.sup.LD is a C.sub.10-C.sub.60 linear,
saturated or partially unsaturated, aliphatic chain, optionally
substituted with one or more C.sub.1-4 aliphatic groups. In some
embodiments, a lipid comprises a C.sub.10-C.sub.60 linear,
saturated or partially unsaturated, aliphatic chain, optionally
substituted with one or more C.sub.1-4 aliphatic groups. In some
embodiments, R.sup.LD is a C.sub.10-C.sub.60 linear, saturated or
partially unsaturated, aliphatic chain, optionally substituted with
one or more C.sub.1-2 aliphatic groups. In some embodiments, a
lipid comprises a C.sub.10-C.sub.60 linear, saturated or partially
unsaturated, aliphatic chain, optionally substituted with one or
more C.sub.1-2 aliphatic groups. In some embodiments, R.sup.LD is a
C.sub.10-C.sub.60 linear, saturated or partially unsaturated,
aliphatic chain, optionally substituted with one or more methyl
groups. In some embodiments, a lipid comprises a C.sub.10-C.sub.60
linear, saturated or partially unsaturated, aliphatic chain,
optionally substituted with one or more methyl groups.
[1533] In some embodiments, R.sup.LD is an unsubstituted
C.sub.10-C.sub.60 linear, saturated or partially unsaturated,
aliphatic chain. In some embodiments, a lipid comprises an
unsubstituted C.sub.10-C.sub.60 linear, saturated or partially
unsaturated, aliphatic chain.
[1534] In some embodiments, a lipid comprises no more than one
optionally substituted C.sub.10-C.sub.60 linear, saturated or
partially unsaturated, aliphatic chain. In some embodiments, a
lipid comprises two or more optionally substituted
C.sub.10-C.sub.60 linear, saturated or partially unsaturated,
aliphatic chain.
[1535] In some embodiments, R.sup.LD is an optionally substituted,
C.sub.10-C.sub.80 saturated or partially unsaturated, aliphatic
chain. In some embodiments, a lipid comprises an optionally
substituted C.sub.10-C.sub.80 saturated or partially unsaturated,
aliphatic chain.
[1536] In some embodiments, R.sup.LD is an optionally substituted
C.sub.10-C.sub.80 linear, saturated or partially unsaturated,
aliphatic chain. In some embodiments, a lipid comprises an
optionally substituted C.sub.10-C.sub.80 linear, saturated or
partially unsaturated, aliphatic chain.
[1537] In some embodiments, R.sup.LD is a C.sub.10-C.sub.80 linear,
saturated or partially unsaturated, aliphatic chain, optionally
substituted with one or more C.sub.1-4 aliphatic groups. In some
embodiments, a lipid comprises a C.sub.10-C.sub.80 linear,
saturated or partially unsaturated, aliphatic chain, optionally
substituted with one or more C.sub.1-4 aliphatic groups. In some
embodiments, R.sup.LD is a C.sub.10-C.sub.80 linear, saturated or
partially unsaturated, aliphatic chain, optionally substituted with
one or more C.sub.1-2 aliphatic groups. In some embodiments, a
lipid comprises a C.sub.10-C.sub.80 linear, saturated or partially
unsaturated, aliphatic chain, optionally substituted with one or
more C.sub.1-2 aliphatic groups. In some embodiments, R.sup.LD is a
C.sub.10-C.sub.80 linear, saturated or partially unsaturated,
aliphatic chain, optionally substituted with one or more methyl
groups. In some embodiments, a lipid comprises a C.sub.10-C.sub.80
linear, saturated or partially unsaturated, aliphatic chain,
optionally substituted with one or more methyl groups.
[1538] In some embodiments, R.sup.LD is an unsubstituted
C.sub.10-C.sub.80 linear, saturated or partially unsaturated,
aliphatic chain. In some embodiments, a lipid comprises an
unsubstituted C.sub.10-C.sub.80 linear, saturated or partially
unsaturated, aliphatic chain.
[1539] In some embodiments, a lipid comprises no more than one
optionally substituted C.sub.10-C.sub.80 linear, saturated or
partially unsaturated, aliphatic chain. In some embodiments, a
lipid comprises two or more optionally substituted
C.sub.10-C.sub.80 linear, saturated or partially unsaturated,
aliphatic chain.
[1540] In some embodiments, R.sup.LD is or comprises a C.sub.10
saturated linear aliphatic chain. In some embodiments, R.sup.LD is
or comprises a C.sub.10 partially unsaturated linear aliphatic
chain. In some embodiments, R.sup.LD is or comprises a C.sub.11
saturated linear aliphatic chain. In some embodiments, R.sup.LD is
or comprises a C.sub.11 partially unsaturated linear aliphatic
chain. In some embodiments, R.sup.LD is or comprises a C.sub.12
saturated linear aliphatic chain. In some embodiments, R.sup.LD is
or comprises a C.sub.12 partially unsaturated linear aliphatic
chain. In some embodiments, R.sup.LD is or comprises a C.sub.13
saturated linear aliphatic chain. In some embodiments, R.sup.LD is
or comprises a C.sub.13 partially unsaturated linear aliphatic
chain. In some embodiments, R.sup.LD is or comprises a C.sub.14
saturated linear aliphatic chain. In some embodiments, R.sup.LD is
or comprises a C.sub.14 partially unsaturated linear aliphatic
chain. In some embodiments, R.sup.LD is or comprises a C.sub.15
saturated linear aliphatic chain. In some embodiments, R.sup.LD is
or comprises a C.sub.15 partially unsaturated linear aliphatic
chain. In some embodiments, R.sup.LD is or comprises a C.sub.16
saturated linear aliphatic chain. In some embodiments, R.sup.LD is
or comprises a C.sub.16 partially unsaturated linear aliphatic
chain. In some embodiments, R.sup.LD is or comprises a C.sub.17
saturated linear aliphatic chain. In some embodiments, R.sup.LD is
or comprises a C.sub.17 partially unsaturated linear aliphatic
chain. In some embodiments, R.sup.LD is or comprises a Cis
saturated linear aliphatic chain. In some embodiments, R.sup.LD is
or comprises a Cis partially unsaturated linear aliphatic chain. In
some embodiments, R.sup.LD is or comprises a C.sub.19 saturated
linear aliphatic chain. In some embodiments, R.sup.LD is or
comprises a C.sub.19 partially unsaturated linear aliphatic chain.
In some embodiments, R.sup.LD is or comprises a C.sub.20 saturated
linear aliphatic chain. In some embodiments, R.sup.LD is or
comprises a C.sub.20 partially unsaturated linear aliphatic chain.
In some embodiments, R.sup.LD is or comprises a C.sub.21 saturated
linear aliphatic chain. In some embodiments, R.sup.LD is or
comprises a C.sub.21 partially unsaturated linear aliphatic chain.
In some embodiments, R.sup.LD is or comprises a C.sub.22 saturated
linear aliphatic chain. In some embodiments, R.sup.LD is or
comprises a C.sub.22 partially unsaturated linear aliphatic chain.
In some embodiments, R.sup.LD is or comprises a C.sub.23 saturated
linear aliphatic chain. In some embodiments, R.sup.LD is or
comprises a C.sub.23 partially unsaturated linear aliphatic chain.
In some embodiments, R.sup.LD is or comprises a C.sub.24 saturated
linear aliphatic chain. In some embodiments, R.sup.LD is or
comprises a C.sub.24 partially unsaturated linear aliphatic chain.
In some embodiments, R.sup.LD is or comprises a C.sub.25 saturated
linear aliphatic chain. In some embodiments, R.sup.LD is or
comprises a C.sub.25 partially unsaturated linear aliphatic chain.
In some embodiments, R.sup.LD is or comprises a C.sub.26 saturated
linear aliphatic chain. In some embodiments, R.sup.LD is or
comprises a C.sub.26 partially unsaturated linear aliphatic chain.
In some embodiments, R.sup.LD is or comprises a C.sub.27 saturated
linear aliphatic chain. In some embodiments, R.sup.LD is or
comprises a C.sub.27 partially unsaturated linear aliphatic chain.
In some embodiments, R.sup.LD is or comprises a C.sub.28 saturated
linear aliphatic chain. In some embodiments, R.sup.LD is or
comprises a C.sub.28 partially unsaturated linear aliphatic chain.
In some embodiments, R.sup.LD is or comprises a C.sub.29 saturated
linear aliphatic chain. In some embodiments, R.sup.LD is or
comprises a C.sub.29 partially unsaturated linear aliphatic chain.
In some embodiments, R.sup.LD is or comprises a C.sub.30 saturated
linear aliphatic chain. In some embodiments, R.sup.LD is or
comprises a C.sub.30 partially unsaturated linear aliphatic
chain.
[1541] In some embodiments, a lipid has the structure of
R.sup.LD--OH. In some embodiments, a lipid has the structure of
R.sup.LD--C(O)OH. In some embodiments, R.sup.LD is
##STR00357##
[1542] In some embodiments, a lipid is lauric acid, myristic acid,
palmitic acid, stearic acid, oleic acid, linoleic acid,
alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid
(DHA or cis-DHA), turbinaric acid, arachidonic acid, and
dilinoleyl. In some embodiments, a lipid is lauric acid, myristic
acid, palmitic acid, stearic acid, oleic acid, linoleic acid,
alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid
(DHA or cis-DHA), turbinaric acid, and dilinoleyl. In some
embodiments, a lipid has a structure of:
##STR00358##
[1543] In some embodiments, a lipid is, comprises or consists of
any of: an at least partially hydrophobic or amphiphilic molecule,
a phospholipid, a triglyceride, a diglyceride, a monoglyceride, a
fat-soluble vitamin, a sterol, a fat and a wax. In some
embodiments, a lipid is any of: a fatty acid, glycerolipid,
glycerophospholipid, sphingolipid, sterol lipid, prenol lipid,
saccharolipid, polyketide, and other molecule.
[1544] Lipids can be incorporated into provided technologies
through many types of methods in accordance with the present
disclosure. In some embodiments, lipids are physically mixed with
provided oligonucleotides to form provided compositions. In some
embodiments, lipids are chemically conjugated with
oligonucleotides.
[1545] In some embodiments, provided compositions comprise two or
more lipids. In some embodiments, provided oligonucleotides
comprise two or more conjugated lipids. In some embodiments, the
two or more conjugated lipids are the same. In some embodiments,
the two or more conjugated lipids are different. In some
embodiments, provided oligonucleotides comprise no more than one
lipid. In some embodiments, oligonucleotides of a provided
composition comprise different types of conjugated lipids. In some
embodiments, oligonucleotides of a provided composition comprise
the same type of lipids.
[1546] Lipids can be conjugated to oligonucleotides optionally
through linkers. Various types of linkers in the art can be
utilized in accordance of the present disclosure. In some
embodiments, a linker comprise a phosphate group, which can, for
example, be used for conjugating lipids through chemistry similar
to those employed in oligonucleotide synthesis. In some
embodiments, a linker comprises an amide, ester, or ether group. In
some embodiments, a linker has the structure of -L-. In some
embodiments, after conjugation to oligonucleotides, a lipid forms a
moiety having the structure of -L-R.sup.LD, wherein each of L and
R.sup.LD is independently as defined and described herein.
[1547] In some embodiments, -L- comprises a bivalent aliphatic
chain. In some embodiments, -L- comprises a phosphate group. In
some embodiments, -L- comprises a phosphorothioate group. In some
embodiments, -L- has the structure of
--C(O)NH--(CH.sub.2).sub.6--OP(.dbd.O)(S.sup.-)--.
[1548] Lipids, optionally through linkers, can be conjugated to
oligonucleotides at various suitable locations. In some
embodiments, lipids are conjugated through the 5'-OH group. In some
embodiments, lipids are conjugated through the 3'-OH group. In some
embodiments, lipids are conjugated through one or more sugar
moieties. In some embodiments, lipids are conjugated through one or
more bases. In some embodiments, lipids are incorporated through
one or more internucleotidic linkages. In some embodiments, an
oligonucleotide may contain multiple conjugated lipids which are
independently conjugated through its 5'-OH, 3'-OH, sugar moieties,
base moieties and/or internucleotidic linkages.
[1549] In some embodiments, a lipid is conjugated to an
oligonucleotide optionally through a linker moiety. A person having
ordinary skill in the art appreciates that various technologies can
be utilized to conjugate lipids to an oligonucleotide in accordance
with the present disclosure. For example, for lipids comprising
carboxyl groups, such lipids can be conjugated through the carboxyl
groups. In some embodiments, a lipid is conjugated through a linker
having the structure of -L-, wherein L is as defined and described
in formula I. In some embodiments, L comprises a phosphate diester
or modified phosphate diester moiety. In some embodiments, a
compound formed by lipid conjugation has the structure of
(R.sup.LD-L-).sub.x-(oligonucleotide), wherein x is 1 or an integer
greater than 1, and each of R.sup.LD and L is independently as
defined and described herein. In some embodiments, x is 1. In some
embodiments, x is greater than 1. In some embodiments, an
oligonucleotide is an oligonucleotide. For example, in some
embodiments, a conjugate has the following structures:
##STR00359##
[1550] In some embodiments, a linker is selected from: an uncharged
linker; a charged linker; a linker comprising an alkyl; a linker
comprising a phosphate; a branched linker; an unbranched linker; a
linker comprising at least one cleavage group; a linker comprising
at least one redox cleavage group; a linker comprising at least one
phosphate-based cleavage group; a linker comprising at least one
acid-cleavage group; a linker comprising at least one ester-based
cleavage group; and a linker comprising at least one peptide-based
cleavage group.
[1551] In some embodiments, a lipid is not conjugated to an
oligonucleotide.
[1552] In some embodiments, the present disclosure pertains to
compositions and methods related to a composition comprising an
oligonucleotide and a lipid comprising a C.sub.10-C.sub.40 linear,
saturated or partially unsaturated, aliphatic chain, wherein the
lipid is conjugated to the biologically active agent. In some
embodiments, the present disclosure pertains to compositions and
methods related to a composition comprising an oligonucleotide and
a lipid comprising a C.sub.10-C.sub.40 linear, saturated or
partially unsaturated, aliphatic chain, optionally substituted with
one or more C.sub.1-4 aliphatic group, wherein the lipid is
conjugated to the biologically active agent.
[1553] In some embodiments, the present disclosure pertains to
compositions and methods related to a composition comprising an
oligonucleotide and a lipid comprising a C.sub.10-C.sub.40 linear,
saturated or partially unsaturated, aliphatic chain, wherein the
lipid is not conjugated to the biologically active agent. In some
embodiments, the present disclosure pertains to compositions and
methods related to a composition comprising an oligonucleotide and
a lipid comprising a C.sub.10-C.sub.40 linear, saturated or
partially unsaturated, aliphatic chain, optionally substituted with
one or more C.sub.1-4 aliphatic group, wherein the lipid is not
conjugated to the biologically active agent.
[1554] In some embodiments, a composition comprises an
oligonucleotide and a lipid selected from: lauric acid, myristic
acid, palmitic acid, stearic acid, oleic acid, linoleic acid,
alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid
(cis-DHA), turbinaric acid, arachidonic acid, and dilinoleyl,
wherein the lipid is not conjugated to the biologically active
agent. In some embodiments, a composition comprises an
oligonucleotide and a lipid selected from: lauric acid, myristic
acid, palmitic acid, stearic acid, oleic acid, linoleic acid,
alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid
(cis-DHA), turbinaric acid, and dilinoleyl, wherein the lipid is
not conjugated to the biologically active agent.
[1555] In some embodiments, a composition comprises an
oligonucleotide and a lipid selected from: lauric acid, myristic
acid, palmitic acid, stearic acid, oleic acid, linoleic acid,
alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid
(cis-DHA), turbinaric acid, arachidonic acid, and dilinoleyl,
wherein the lipid is conjugated to the biologically active agent.
In some embodiments, a composition comprises an oligonucleotide and
a lipid selected from: lauric acid, myristic acid, palmitic acid,
stearic acid, oleic acid, linoleic acid, alpha-linolenic acid,
gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric
acid, and dilinoleyl, wherein the lipid is conjugated to the
biologically active agent.
[1556] In some embodiments, a composition comprises an
oligonucleotide and a lipid selected from: lauric acid, myristic
acid, palmitic acid, stearic acid, oleic acid, linoleic acid,
alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid
(cis-DHA), turbinaric acid, arachidonic acid, and dilinoleyl,
wherein the lipid is directly conjugated to the biologically active
agent (without a linker interposed between the lipid and the
biologically active agent). In some embodiments, a composition
comprises an oligonucleotide and a lipid selected from: lauric
acid, myristic acid, palmitic acid, stearic acid, oleic acid,
linoleic acid, alpha-linolenic acid, gamma-linolenic acid,
docosahexaenoic acid (cis-DHA), turbinaric acid, and dilinoleyl,
wherein the lipid is directly conjugated to the biologically active
agent (without a linker interposed between the lipid and the
biologically active agent).
[1557] In some embodiments, a composition comprises an
oligonucleotide and a lipid selected from: lauric acid, myristic
acid, palmitic acid, stearic acid, oleic acid, linoleic acid,
alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid
(cis-DHA), turbinaric acid, arachidonic acid, and dilinoleyl,
wherein the lipid is indirectly conjugated to the biologically
active agent (with a linker interposed between the lipid and the
biologically active agent). In some embodiments, a composition
comprises an oligonucleotide and a lipid selected from: lauric
acid, myristic acid, palmitic acid, stearic acid, oleic acid,
linoleic acid, alpha-linolenic acid, gamma-linolenic acid,
docosahexaenoic acid (cis-DHA), turbinaric acid, and dilinoleyl,
wherein the lipid is indirectly conjugated to the biologically
active agent (with a linker interposed between the lipid and the
biologically active agent).
[1558] A linker is a moiety that connects two parts of a
composition; as a non-limiting example, a linker physically
connects an oligonucleotide to a lipid.
[1559] Non-limiting examples of suitable linkers include: an
uncharged linker; a charged linker; a linker comprising an alkyl; a
linker comprising a phosphate; a branched linker; an unbranched
linker; a linker comprising at least one cleavage group; a linker
comprising at least one redox cleavage group; a linker comprising
at least one phosphate-based cleavage group; a linker comprising at
least one acid-cleavage group; a linker comprising at least one
ester-based cleavage group; a linker comprising at least one
peptide-based cleavage group.
[1560] In some embodiments, a linker comprises an uncharged linker
or a charged linker.
[1561] In some embodiments, a linker comprises an alkyl.
[1562] In some embodiments, a linker comprises a phosphate. In
various embodiments, a phosphate can also be modified by
replacement of bridging oxygen, (i.e. oxygen that links the
phosphate to the nucleoside), with nitrogen (bridged
phosphoroamidates), sulfur (bridged phosphorothioates) and carbon
(bridged methylenephosphonates). The replacement can occur at the
either linking oxygen or at both the linking oxygens. When the
bridging oxygen is the 3'-oxygen of a nucleoside, replacement with
carbon can be done. When the bridging oxygen is the 5'-oxygen of a
nucleoside, replacement with nitrogen can be done. In various
embodiments, the linker comprising a phosphate comprises any one or
more of: a phosphorodithioate, phosphoramidate, boranophosphonoate,
or a compound of formula (I):
##STR00360##
where R.sup.3 is selected from OH, SH, NH.sub.2, BH.sub.3,
CH.sub.3, C.sub.1-6 alkyl, C.sub.6-10 aryl, C.sub.1-6 alkoxy and
C.sub.6-io aryloxy, wherein C.sub.1-6 alkyl and C.sub.6-io aryl are
unsubstituted or optionally independently substituted with 1 to 3
groups independently selected from halo, hydroxyl and NH.sub.2; and
R.sup.4 is selected from O, S, NH, or CH.sub.2.
[1563] In some embodiments, a linker comprises a direct bond or an
atom such as oxygen or sulfur, a unit such as NR.sup.1, C(O),
C(O)NH, SO, SO.sub.2, SO.sub.2NH or a chain of atoms, such as
substituted or unsubstituted alkyl, substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, arylalkyl,
arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl,
heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl,
heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl,
cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl,
alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl,
alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl,
alkylheteroarylalkyl, alkylheteroarylalkenyl,
alkylheteroarylalkynyl, alkenylheteroarylalkyl,
alkenylheteroarylalkenyl, alkenylheteroarylalkynyl,
alkynylheteroarylalkyl, alkynylheteroarylalkenyl,
alkynylheteroarylalkynyl, alkylheterocyclylalkyl,
alkylheterocyclylalkenyl, alkylhererocyclylalkynyl,
alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl,
alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl,
alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl,
alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl,
alkynylhereroaryl, where one or more methylenes can be interrupted
or terminated by O, S, S(O), SO.sub.2, N(R.sub.1).sub.2, C(O),
cleavable linking group, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, substituted or
unsubstituted heterocyclic; where R.sup.1 is hydrogen, acyl,
aliphatic or substituted aliphatic.
[1564] In some embodiments, a linker is a branched linker. In some
embodiments, a branchpoint of the branched linker may be at least
trivalent, but may be a tetravalent, pentavalent or hexavalent
atom, or a group presenting such multiple valencies. In some
embodiments, a branchpoint is --N, --N(Q)-C, --O--C, --S--C,
--SS--C, --C(O)N(Q)-C, --OC(O)N(Q)-C, --N(Q)C(O)--C, or
--N(Q)C(O)O--C; wherein Q is independently for each occurrence H or
optionally substituted alkyl. In other embodiment, the branchpoint
is glycerol or glycerol derivative.
[1565] In one embodiment, a linker comprises at least one cleavable
linking group.
[1566] As a non-limiting example, a cleavable linking group can be
sufficiently stable outside the cell, but which upon entry into a
target cell is cleaved to release the two parts the linker is
holding together. As a non-limiting example, a cleavable linking
group is cleaved at least 10 times or more, at least 100 times
faster in the target cell or under a first reference condition
(which can, e.g., be selected to mimic or represent intracellular
conditions) than in the blood of a subject, or under a second
reference condition (which can, e.g., be selected to mimic or
represent conditions found in the blood or serum). Cleavable
linking groups are susceptible to cleavage agents, e.g., pH, redox
potential or the presence of degradative molecules. Generally,
cleavage agents are more prevalent or found at higher levels or
activities inside cells than in serum or blood. Examples of such
degradative agents include: redox agents which are selected for
particular substrates or which have no substrate specificity,
including, e.g., oxidative or reductive enzymes or reductive agents
such as mercaptans, present in cells, that can degrade a redox
cleavable linking group by reduction; esterases; endosomes or
agents that can create an acidic environment, e.g., those that
result in a pH of five or lower; enzymes that can hydrolyze or
degrade an acid cleavable linking group by acting as a general
acid, peptidases (which can be substrate specific), and
phosphatases.
[1567] As a non-limiting example, a cleavable linkage group, such
as a disulfide bond can be susceptible to pH. The pH of human serum
is 7.4, while the average intracellular pH is slightly lower,
ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the
range of 5.5-6.0, and lysosomes have an even more acidic pH at
around 5.0. Some linkers will have a cleavable linking group that
is cleaved at a desired pH, thereby releasing the cationic lipid
from the ligand inside the cell, or into the desired compartment of
the cell.
[1568] As a non-limiting example, a linker can include a cleavable
linking group that is cleavable by a particular enzyme. The type of
cleavable linking group incorporated into a linker can depend on
the cell to be targeted. For example, liver targeting ligands can
be linked to the cationic lipids through a linker that includes an
ester group. Liver cells are rich in esterases, and therefore the
linker will be cleaved more efficiently in liver cells than in cell
types that are not esterase-rich. Other cell-types rich in
esterases include cells of the lung, renal cortex, and testis.
[1569] As a non-limiting example, a linker can contain a peptide
bond, which can be used when targeting cell types rich in
peptidases, such as liver cells and synoviocytes.
[1570] As a non-limiting example, suitability of a candidate
cleavable linking group can be evaluated by testing the ability of
a degradative agent (or condition) to cleave the candidate linking
group. It will also be desirable to also test the candidate
cleavable linking group for the ability to resist cleavage in the
blood or when in contact with other non-target tissue. Thus one can
determine the relative susceptibility to cleavage between a first
and a second condition, where the first is selected to be
indicative of cleavage in a target cell and the second is selected
to be indicative of cleavage in other tissues or biological fluids,
e.g., blood or serum. The evaluations can be carried out in cell
free systems, in cells, in cell culture, in organ or tissue
culture, or in whole animals. It may be useful to make initial
evaluations in cell-free or culture conditions and to confirm by
further evaluations in whole animals. As a non-limiting example,
useful candidate compounds are cleaved at least 2, 4, 10 or 100
times faster in the cell (or under in vitro conditions selected to
mimic intracellular conditions) as compared to blood or serum (or
under in vitro conditions selected to mimic extracellular
conditions).
[1571] In some embodiments, a linker comprises a redox cleavable
linking group. As a non-limiting example, one class of cleavable
linking groups are redox cleavable linking groups that are cleaved
upon reduction or oxidation. A non-limiting example of reductively
cleavable linking group is a disulphide linking group (--S--S--).
To determine if a candidate cleavable linking group is a suitable
"reductively cleavable linking group," or for example is suitable
for use with a particular iRNA moiety and particular targeting
agent one can look to methods described herein. As a non-limiting
example, a candidate can be evaluated by incubation with
dithiothreitol (DTT), or other reducing agent using reagents know
in the art, which mimic the rate of cleavage which would be
observed in a cell, e.g., a target cell. The candidates can also be
evaluated under conditions which are selected to mimic blood or
serum conditions. As a non-limiting example, candidate compounds
are cleaved by at most 10% in the blood. As a non-limiting example,
useful candidate compounds are degraded at least 2, 4, 10 or 100
times faster in the cell (or under in vitro conditions selected to
mimic intracellular conditions) as compared to blood (or under in
vitro conditions selected to mimic extracellular conditions). The
rate of cleavage of candidate compounds can be determined using
standard enzyme kinetics assays under conditions chosen to mimic
intracellular media and compared to conditions chosen to mimic
extracellular media.
[1572] In some embodiments, a linker comprises a phosphate-based
cleavable linking groups are cleaved by agents that degrade or
hydrolyze the phosphate group. An example of an agent that cleaves
phosphate groups in cells are enzymes such as phosphatases in
cells. Examples of phosphate-based linking groups are
--O--P(O)(ORk)-O--, --O--P(S)(ORk)-O--, --O--P(S)(SRk)-O--,
--S--P(O)(ORk)-O--, --O--P(O)(ORk)-S--, --S--P(O)(ORk)-S--,
--O--P(S)(ORk)-S--, --S--P(S)(ORk)-O--, --O--P(O)(Rk)-O--,
--O--P(S)(Rk)-O--, --S--P(O)(Rk)-O--, --S--P(S)(Rk)-O--,
--S--P(O)(Rk)-S--, --O--P(S)(Rk)-S--. Additional non-limiting
examples are --O--P(O)(OH)--O--, --O--P(S)(OH)--O--,
--O--P(S)(SH)--O--, --S--P(O)(OH)--O--, --O--P(O)(OH)--S--,
--S--P(O)(OH)--S--, --O--P(S)(OH)--S--, --S--P(S)(OH)--O--,
--O--P(O)(H)--O--, --O--P(S)(H)--O--, --S--P(O)(H)--O--,
--S--P(S)(H)--O--, --S--P(O)(H)--S--, --O--P(S)(H)--S--. An
additional non-limiting examples is --O--P(O)(OH)--O--.
[1573] In some embodiments, a linker comprises an acid cleavable
linking groups are linking groups that are cleaved under acidic
conditions. As a non-limiting example, acid cleavable linking
groups are cleaved in an acidic environment with a pH of about 6.5
or lower (e.g., about 6.0, 5.5, 5.0, or lower), or by agents such
as enzymes that can act as a general acid. In a cell, specific low
pH organelles, such as endosomes and lysosomes can provide a
cleaving environment for acid cleavable linking groups. Examples of
acid cleavable linking groups include but are not limited to
hydrazones, esters, and esters of amino acids. Acid cleavable
groups can have the general formula --C.dbd.NN--, C(O)O, or
--OC(O). In an additional non-limiting example, when the carbon
attached to the oxygen of the ester (the alkoxy group) is an aryl
group, substituted alkyl group, or tertiary alkyl group such as
dimethyl pentyl or t-butyl.
[1574] In some embodiments, a linker comprises an ester-based
linking groups. As a non-limiting example, ester-based cleavable
linking groups are cleaved by enzymes such as esterases and
amidases in cells. Examples of ester-based cleavable linking groups
include but are not limited to esters of alkylene, alkenylene and
alkynylene groups. Ester cleavable linking groups have the general
formula --C(O)O--, or --OC(O)--. These candidates can be evaluated
using methods analogous to those described above.
[1575] In some embodiments, a linker comprises a peptide-based
cleaving group. Peptide-based cleavable linking groups are cleaved
by enzymes such as peptidases and proteases in cells. Peptide-based
cleavable linking groups are peptide bonds formed between amino
acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.)
and polypeptides. As a non-limiting example, peptide-based
cleavable groups do not include the amide group (--C(O)NH--). The
amide group can be formed between any alkylene, alkenylene or
alkynylene. A peptide bond is a special type of amide bond formed
between amino acids to yield peptides and proteins. As a
non-limiting example, a peptide based cleavage group can be limited
to the peptide bond (i.e., the amide bond) formed between amino
acids yielding peptides and proteins and does not include the
entire amide functional group. As a non-limiting example, a
peptide-based cleavable linking groups can have the general formula
--NHCHR.sup.AC(O)NHCHR.sup.BC(O)--, where R.sup.A and R.sup.B are
the R groups of the two adjacent amino acids. These candidates can
be evaluated using methods analogous to those described above.
[1576] Any linker reported in the art can be used, including, as
non-limiting examples, those described in: U.S. Pat. App. No.
20150265708.
[1577] A non-limiting example of a method of conjugating a lipid
and an oligonucleotide is presented in Example 1.
[1578] A non-limiting example of a linker is a C6 amino linker.
Target Components
[1579] In some embodiments, a provided composition further
comprises a targeting component (targeting compound or moiety). A
target component can be either conjugated or not conjugated to a
lipid or a biologically active agent. In some embodiments, a target
component is conjugated to a biologically active agent. In some
embodiments, a biologically active agent is conjugated to both a
lipid and a targeting component. As described in here, in some
embodiments, a biologically active agent is a provided
oligonucleotide. Thus, in some embodiments, a provided
oligonucleotide composition further comprises, besides a lipid and
oligonucleotides, a target elements. Various targeting components
can be used in accordance with the present disclosure, e.g.,
lipids, antibodies, peptides, carbohydrates, etc.
[1580] Target components can be incorporated into provided
technologies through many types of methods in accordance with the
present disclosure. In some embodiments, target components are
physically mixed with provided oligonucleotides to form provided
compositions. In some embodiments, target components are chemically
conjugated with oligonucleotides.
[1581] In some embodiments, provided compositions comprise two or
more target components. In some embodiments, provided
oligonucleotides comprise two or more conjugated target components.
In some embodiments, the two or more conjugated target components
are the same. In some embodiments, the two or more conjugated
target components are different. In some embodiments, provided
oligonucleotides comprise no more than one target component. In
some embodiments, oligonucleotides of a provided composition
comprise different types of conjugated target components. In some
embodiments, oligonucleotides of a provided composition comprise
the same type of target components.
[1582] Target components can be conjugated to oligonucleotides
optionally through linkers. Various types of linkers in the art can
be utilized in accordance of the present disclosure. In some
embodiments, a linker comprise a phosphate group, which can, for
example, be used for conjugating target components through
chemistry similar to those employed in oligonucleotide synthesis.
In some embodiments, a linker comprises an amide, ester, or ether
group. In some embodiments, a linker has the structure of -L-.
Target components can be conjugated through either the same or
different linkers compared to lipids.
[1583] Target components, optionally through linkers, can be
conjugated to oligonucleotides at various suitable locations. In
some embodiments, target components are conjugated through the
5'-OH group. In some embodiments, target components are conjugated
through the 3'-OH group. In some embodiments, target components are
conjugated through one or more sugar moieties. In some embodiments,
target components are conjugated through one or more bases. In some
embodiments, target components are incorporated through one or more
internucleotidic linkages. In some embodiments, an oligonucleotide
may contain multiple conjugated target components which are
independently conjugated through its 5'-OH, 3'-OH, sugar moieties,
base moieties and/or internucleotidic linkages. Target components
and lipids can be conjugated either at the same, neighboring and/or
separated locations. In some embodiments, a target component is
conjugated at one end of an oligonucleotide, and a lipid is
conjugated at the other end.
[1584] In some embodiments, the oligonucleotide or oligonucleotides
in a chirally controlled oligonucleotide composition is or are
antisense oligonucleotide or oligonucleotides. In some embodiments,
the sequence of the oligonucleotide(s) comprises or consists of the
sequence of any oligonucleotide disclosed herein. In some
embodiments, provided oligonucleotides comprise base sequence,
pattern of backbone linkages, pattern or backbone chiral centers,
and/or pattern of chemical modifications (e.g., base modifications,
sugar modifications, etc.) of any oligonucleotide disclosed herein.
In some embodiments, the sequence of the oligonucleotide(s)
comprises or consists of the sequence of any oligonucleotide
disclosed in Table 8.
[1585] In some embodiments, an antisense oligonucleotide is an
oligonucleotide which participates in RNaseH-mediated cleavage; for
example, an antisense oligonucleotide hybridizes in a
sequence-specific manner to a portion of a target mRNA, thus
targeting the mRNA for cleavage by RNaseH. In some embodiments, an
antisense oligonucleotide is able to differentiate between
different alleles of the same gene or target. In some embodiments,
an antisense oligonucleotide is able to differentiate between a
wild-type and a mutant allele of a target. In some embodiments, an
antisense oligonucleotide significantly participates in
RNaseH-mediated cleavage of a mutant allele but participates in
RNaseH-mediated cleavage of a wild-type allele to a much less
degree (e.g., does not significantly participate in RNaseH-mediated
cleavage of the wild-type allele of the target). In some
embodiments, an antisense oligonucleotide is capable of
participating in RNAseH-mediated cleavage of a nucleic acid
comprising a mutation. In some embodiments, an antisense
oligonucleotide targets a mutant allele. In some embodiments, an
antisense oligonucleotide targets a mutant allele of the Huntingtin
gene.
[1586] In some embodiments, an antisense oligonucleotide is able to
differentiate between a wild-type and a mutant allele of a target
in the Huntingtin gene.
[1587] In some embodiments, the present disclosure pertains to:
[1588] A method for inhibiting expression of a mutant Huntingtin
gene in a mammal comprising preparing a composition comprising a
lipid and an oligonucleotide (as a non-limiting example, an
antisense oligonucleotide that targets a mutant allele of the
Huntingtin gene) and administering the composition to the
mammal.
[1589] A method of treating a disease that is caused by the
over-expression of a mutant Huntingtin gene in a subject, said
method comprising the administration of a composition comprising a
lipid and an oligonucleotide (as a non-limiting example, an
antisense oligonucleotide that targets a mutant allele of the
Huntingtin gene).
[1590] A method of treating Huntington's Disease, said method
comprising the administration of a composition comprising a lipid
and an oligonucleotide (as a non-limiting example, an antisense
oligonucleotide that targets a mutant allele of the Huntingtin
gene).
[1591] A method for treating a sign and/or symptom of Huntington's
Disease in a subject by providing a composition comprising a lipid
and an oligonucleotide (as a non-limiting example, an antisense
oligonucleotide that targets a mutant allele of the Huntingtin
gene) and administering a therapeutically effective amount of the
composition to the subject.
[1592] A method of administering an oligonucleotide to a subject in
need thereof, comprising steps of providing a composition
comprising an oligonucleotide and a lipid, and administering the
composition to the subject, wherein the biologically active
compound is an oligonucleotide (as a non-limiting example, an
antisense oligonucleotide that targets a mutant allele of the
Huntingtin gene), and wherein the lipid is any lipid disclosed
herein.
[1593] A method of treating a disease in a subject, the method
comprising steps of providing a composition comprising an
oligonucleotide and a lipid, and administering a therapeutically
effective amount of the composition to the subject, wherein the
biologically active compound is an oligonucleotide (as a
non-limiting example, an antisense oligonucleotide that targets a
mutant allele of the Huntingtin gene), and wherein the lipid is any
lipid disclosed herein, and wherein the disease is any disease
disclosed herein.
[1594] A method for inhibiting expression of a mutant Huntingtin
gene in a mammal, the method comprising steps of preparing a
composition comprising a lipid and an oligonucleotide (as a
non-limiting example, an antisense oligonucleotide that targets a
mutant allele of the Huntingtin gene) and administering the
composition to the mammal.
[1595] A method of administering a biologically active agent to a
subject in need thereof, comprising steps of providing a
composition comprising a biologically active agent and a lipid, and
administering the composition to the subject, wherein the
biologically active compound is an oligonucleotide (as a
non-limiting example, an antisense oligonucleotide that targets a
mutant allele of the Huntingtin gene), and wherein the lipid is any
lipid disclosed herein.
[1596] A method of treating Huntington's Disease in a subject, the
method comprising steps of providing a composition comprising a
biologically active agent and a lipid, and administering a
therapeutically effective amount of the composition to the subject,
wherein the biologically active compound is an oligonucleotide (as
a non-limiting example, an antisense oligonucleotide that targets a
mutant allele of the Huntingtin gene), and wherein the lipid is any
lipid disclosed herein.
[1597] A method for mediating RNAseH-mediated cleavage of a nucleic
acid comprising a mutant Huntingtin gene in a mammal, the method
comprising steps of preparing a composition comprising a lipid and
an antisense oligonucleotide and administering the composition to
the mammal.
[1598] A method of treating a disease that is caused by a mutation
in a Huntingtin gene, said method comprising the administration of
a composition comprising a lipid and an antisense oligonucleotide,
wherein the oligonucleotide is capable of participating in
RNaseH-mediated cleavage of a nucleic acid comprising the
mutation.
[1599] A method for treating a sign and/or symptom of Huntington's
Disease in a subject by providing a composition comprising a lipid
and an oligonucleotide (as a non-limiting example, an antisense
oligonucleotide that targets a mutant allele of the Huntingtin
gene) and administering a therapeutically effective amount of the
composition to the subject.
[1600] A method of administering an oligonucleotide to a subject in
need thereof, comprising steps of providing a composition
comprising an oligonucleotide and a lipid, and administering the
composition to the subject, wherein the oligonucleotide is capable
of participating in RNaseH-mediated cleavage of a nucleic acid
comprising a mutation, and wherein the lipid is any lipid disclosed
herein.
[1601] A method of treating Huntington's Disease in a subject,
wherein the disease or disorder is related to a mutation in a gene,
the method comprising steps of providing a composition comprising
an oligonucleotide and a lipid, and administering a therapeutically
effective amount of the composition to the subject, wherein the
oligonucleotide is capable of participating in RNaseH-mediated
cleavage of a nucleic acid comprising the mutation, and wherein the
lipid is any lipid disclosed herein.
[1602] A method for mediating RNAseH-mediated cleavage of a nucleic
acid comprising a mutant Huntingtin gene in a mammal, the method
comprising steps of preparing a composition comprising a lipid and
an antisense oligonucleotide and administering the composition to
the mammal.
[1603] A method of treating a disease related to a mutation in the
Huntingtin gene, said method comprising the administration of a
composition comprising a lipid and an antisense oligonucleotide,
wherein the antisense oligonucleotide is capable of participating
in RNaseH-mediated cleavage of a nucleic acid comprising the
mutation.
[1604] A method of treating a disease that is caused by a mutation
in the Huntingtin gene, said method comprising the administration
of a composition comprising a lipid and an oligonucleotide, wherein
the oligonucleotide is capable of participating in RNaseH-mediated
cleavage of a nucleic acid comprising the mutation.
[1605] A method for treating a sign and/or symptom of Huntington's
Disease in a subject by providing a composition comprising a lipid
and an oligonucleotide (as a non-limiting example, an antisense
oligonucleotide that targets a mutant allele of the Huntingtin
gene) and administering a therapeutically effective amount of the
composition to the subject.
[1606] A method of administering an oligonucleotide to a subject in
need thereof, comprising steps of providing a composition
comprising an oligonucleotide and a lipid, and administering the
composition to the subject, wherein the oligonucleotide is capable
of participating in RNaseH-mediated cleavage of a nucleic acid
comprising the mutation, and wherein the lipid is any lipid
disclosed herein.
[1607] A method of treating Huntington's Disease in a subject,
wherein the Huntington's Disease is related to a mutation in the
Huntingtin gene, the method comprising steps of providing a
composition comprising an oligonucleotide and a lipid, and
administering a therapeutically effective amount of the composition
to the subject, wherein the oligonucleotide is capable of
participating in RNaseH-mediated cleavage of a nucleic acid
comprising the mutation, and wherein the lipid is any lipid
disclosed herein.
[1608] A method for mediating RNAseH-mediated cleavage of a nucleic
acid comprising a mutant Huntingtin gene in a mammal, the method
comprising steps of preparing a composition comprising a lipid and
an antisense oligonucleotide and administering the composition to
the mammal, wherein the lipid is any lipid disclosed herein, and
wherein the sequence of the antisense oligonucleotide comprises or
consists of the sequence of any antisense oligonucleotide disclosed
herein (e.g., in Table 8). In some embodiments, provided
oligonucleotides comprise base sequence, pattern of backbone
linkages, pattern or backbone chiral centers, and/or pattern of
chemical modifications (e.g., base modifications, sugar
modifications, etc.) of any oligonucleotide disclosed herein (e.g.,
in Table 8).
[1609] A method of treating a disease related to a mutation in the
Huntingtin gene, said method comprising the administration of a
composition comprising a lipid and an antisense oligonucleotide,
wherein the antisense oligonucleotide is capable of participating
in RNaseH-mediated cleavage of a nucleic acid comprising the
mutation, wherein the lipid is any lipid disclosed herein, and
wherein the sequence of the antisense oligonucleotide comprises or
consists of the sequence of any antisense oligonucleotide disclosed
herein (e.g., in Table 8).
[1610] A method of treating a disease that is caused by a mutation
in the Huntingtin gene, said method comprising the administration
of a composition comprising a lipid and an oligonucleotide, wherein
the oligonucleotide is capable of participating in RNaseH-mediated
cleavage of a nucleic acid comprising the mutation, wherein the
lipid is any lipid disclosed herein, and wherein the
oligonucleotide comprises or consists of the sequence of any
antisense oligonucleotide disclosed herein (e.g., in Table 8).
[1611] A method for treating a sign and/or symptom of Huntington's
Disease in a subject by providing a composition comprising a lipid
and an oligonucleotide (as a non-limiting example, an antisense
oligonucleotide that targets a mutant allele of the Huntingtin
gene) and administering a therapeutically effective amount of the
composition to the subject, wherein the lipid is any lipid
disclosed herein, and wherein the sequence of the oligonucleotide
comprises or consists of the sequence of any antisense
oligonucleotide disclosed herein (e.g., in Table 8).
[1612] A method of administering an oligonucleotide to a subject in
need thereof, comprising steps of providing a composition
comprising an oligonucleotide and a lipid, and administering the
composition to the subject, wherein the oligonucleotide is capable
of participating in RNaseH-mediated cleavage of a nucleic acid
comprising the mutation, and wherein the lipid is any lipid
disclosed herein, wherein the lipid is any lipid disclosed herein,
and wherein the sequence of the oligonucleotide comprises or
consists of the sequence of any antisense oligonucleotide disclosed
herein (e.g., in Table 8).
[1613] A method of treating Huntington's Disease in a subject,
wherein the Huntington's Disease is related to a mutation in the
Huntingtin gene, the method comprising steps of providing a
composition comprising an oligonucleotide and a lipid, and
administering a therapeutically effective amount of the composition
to the subject, wherein the oligonucleotide is capable of
participating in RNaseH-mediated cleavage of a nucleic acid
comprising the mutation, and wherein the lipid is any lipid
disclosed herein, and wherein the oligonucleotide comprises or
consists of the sequence of any antisense oligonucleotide disclosed
herein (e.g., in Table 8).
[1614] In some embodiments, provided oligonucleotides comprise base
sequence, pattern of backbone linkages, pattern or backbone chiral
centers, and/or pattern of chemical modifications (e.g., base
modifications, sugar modifications, etc.) of any oligonucleotide
disclosed herein.
[1615] In some embodiments, an oligonucleotide composition
comprises a plurality of oligonucleotides, which share:
[1616] 1) a common base sequence;
[1617] 2) a common pattern of backbone linkages; and
[1618] 3) a common pattern of backbone phosphorus
modifications;
[1619] wherein one or more oligonucleotides of the plurality are
individually conjugated to a lipid.
[1620] In some embodiments, a chirally controlled oligonucleotide
composition comprises a plurality of oligonucleotides, which
share:
[1621] 1) a common base sequence;
[1622] 2) a common pattern of backbone linkages; and
[1623] 3) a common pattern of backbone phosphorus
modifications;
[1624] wherein:
[1625] the composition is chirally controlled in that the plurality
of oligonucleotides share the same stereochemistry at one or more
chiral internucleotidic linkages;
[1626] one or more oligonucleotides of the plurality are
individually conjugated to a lipid; and
[1627] one or more oligonucleotides of the plurality are optionally
and individually conjugated to a targeting compound or moiety.
[1628] In some embodiments, an antisense oligonucleotide is in a
chirally controlled oligonucleotide composition. In some
embodiments, an oligonucleotide is in a chirally controlled
oligonucleotide composition.
[1629] Various oligonucleotides are listed in Table 8. Many of
these are capable of participating in RNaseH-mediated cleavage of
the human Huntingtin gene, as shown in data presented in U.S. Pat.
Application No. 62/195,779, filed Jul. 22, 2015, and U.S. Pat.
Application No. 62/331,960, filed May 4, 2016, which are
incorporated by reference in its entirety; and in data shown
here.
[1630] Various oligonucleotides particularly capable of
participating in RNaseH-mediated cleavage of human Huntingtin gene
target or a mutant variant thereof include: WV-1092, WVE120101,
WV-2603 or WV-2595, or any other nucleic acid disclosed herein
(including, but not limited to, those listed in Table 8).
[1631] Any oligonucleotide or chirally controlled oligonucleotide
composition can be used in combination with any method or
composition (e.g., any pharmaceutical composition, modification,
and/or method of use and/or manufacture) disclosed herein.
[1632] In some embodiments, the present disclosure provides the
following embodiments:
1. A chirally controlled oligonucleotide composition comprising
oligonucleotides defined by having:
[1633] 1) a common base sequence and length;
[1634] 2) a common pattern of backbone linkages; and
[1635] 3) a common pattern of backbone chiral centers, which
composition is a substantially pure preparation of a single
oligonucleotide in that a predetermined level of the
oligonucleotides in the composition have the common base sequence
and length, the common pattern of backbone linkages, and the common
pattern of backbone chiral centers.
2. A chirally controlled oligonucleotide composition comprising
oligonucleotides of a particular oligonucleotide type characterized
by:
[1636] 1) a common base sequence and length;
[1637] 2) a common pattern of backbone linkages; and
[1638] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type. 2a. A chirally controlled
oligonucleotide composition comprising oligonucleotides of a
particular oligonucleotide type characterized by:
[1639] 1) a common base sequence and length;
[1640] 2) a common pattern of backbone linkages; and
[1641] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type, wherein the oligonucleotides
target a mutant Huntingtin gene, and the length is from about 10 to
about 50 nucleotides, wherein the backbone linkages comprise at
least one phosphorothioate, and wherein the pattern of backbone
chiral centers comprises at least one chiral center in a Rp
conformation and at least one chiral center in a Sp conformation.
3. A chirally controlled oligonucleotide composition comprising
oligonucleotides defined by having:
[1642] 1) a common base sequence and length;
[1643] 2) a common pattern of backbone linkages; and
[1644] 3) a common pattern of backbone chiral centers, which
composition is a substantially pure preparation of a single
oligonucleotide in that at least about 10% of the oligonucleotides
in the composition have the common base sequence and length, the
common pattern of backbone linkages, and the common pattern of
backbone chiral centers.
4. A composition of any one of the preceding embodiments, wherein
the oligonucleotides comprise one or more wing regions and a common
core region, wherein:
[1645] each wing region independently has a length of two or more
bases, and independently and optionally comprises one or more
chiral internucleotidic linkages; and
[1646] the core region independently has a length of two or more
bases and independently comprises one or more chiral
internucleotidic linkages.
5. An oligonucleotide composition comprising a predetermined level
of oligonucleotides which comprise one or more wing regions and a
common core region, wherein:
[1647] each wing region independently has a length of two or more
bases, and independently and optionally comprises one or more
chiral internucleotidic linkages;
[1648] the core region independently has a length of two or more
bases, and independently comprises one or more chiral
internucleotidic linkages, and the common core region has:
[1649] 1) a common base sequence and length;
[1650] 2) a common pattern of backbone linkages; and
[1651] 3) a common pattern of backbone chiral centers.
6. An oligonucleotide composition comprising a predetermined level
of oligonucleotides which comprise one or more wing regions and a
common core region, wherein:
[1652] each wing region independently has a length of two or more
bases, and independently and optionally comprises one or more
chiral internucleotidic linkages;
[1653] the core region independently has a length of two or more
bases, and independently comprises one or more chiral
internucleotidic linkages, and the core region has:
[1654] 1) a common base sequence;
[1655] 2) a common pattern of backbone linkages;
[1656] 3) a common pattern of backbone chiral centers; and
[1657] 4) a common pattern of backbone phosphorus
modifications.
6a. A composition of any one of the preceding embodiments, wherein
oligonucleotides of the oligonucleotide type comprises at least one
wing region and a core region, wherein:
[1658] each wing region independently has a length of two or more
bases, and independently and optionally comprises one or more
chiral internucleotidic linkages;
[1659] the core region independently has a length of two or more
bases, and independently comprises one or more chiral
internucleotidic linkages; and
[1660] wherein at least one nucleotide in a wing region differs
from at least one nucleotide of the core region, wherein the
difference is in one or more of:
[1661] 1) backbone linkage;
[1662] 2) pattern of backbone chiral centers;
[1663] 3) sugar modification.
7. A composition of any one of the preceding embodiments, wherein
the oligonucleotides are defined by having a common pattern of
backbone phosphorus modifications. 8. A composition of any one of
the preceding embodiments, wherein the composition contains a
predetermined level of oligonucleotides of an individual
oligonucleotide type, wherein an oligonucleotide type is defined
by:
[1664] 1) base sequence;
[1665] 2) pattern of backbone linkages;
[1666] 3) pattern of backbone chiral centers; and
[1667] 4) pattern of backbone phosphorus modifications.
9. A composition of any one of the preceding embodiments, wherein
oligonucleotides having a common base sequence is of the same
oligonucleotide type characterized by base sequence, pattern of
backbone linkages, pattern of backbone chiral centers, and pattern
of backbone phosphorus modifications. 10. A composition of any one
of the preceding embodiments, wherein the composition contains
predetermined levels of oligonucleotides of two or more individual
oligonucleotide types, wherein an oligonucleotide type is defined
by:
[1668] 1) base sequence;
[1669] 2) pattern of backbone linkages;
[1670] 3) pattern of backbone chiral centers; and
[1671] 4) pattern of backbone phosphorus modifications.
11. An oligonucleotide composition that is chirally controlled in
that the composition contains a predetermined level of
oligonucleotides of an individual oligonucleotide type, wherein an
oligonucleotide type is defined by:
[1672] 1) base sequence;
[1673] 2) pattern of backbone linkages;
[1674] 3) pattern of backbone chiral centers; and
[1675] 4) pattern of backbone phosphorus modifications.
12. A composition of any one of the preceding embodiments, wherein
the composition comprises two or more individual oligonucleotide
types. 13. A composition of any one of the preceding embodiments,
wherein an oligonucleotide type is defined by base identity,
pattern of base modification, pattern of sugar modification,
pattern of backbone linkages, pattern of backbone chiral centers,
and pattern of backbone phosphorus modifications. 14. A composition
of any one of the preceding embodiments, wherein oligonucleotides
having a common sequence have identical structure. 15. A
composition of any one of the preceding embodiments, wherein
oligonucleotides of the same oligonucleotide type have identical
structure. 16. A composition of any one of the preceding
embodiments, wherein the oligonucleotides have one wing. 17. A
composition of any one of the preceding embodiments, wherein the
oligonucleotides are hemimers having the structure of wing-core.
18. A composition of any one of the preceding embodiments, wherein
the oligonucleotides are hemimers having the structure of
core-wing. 19. A composition of any one of embodiments 1-15,
wherein the oligonucleotides have two wings. 20. A composition of
any one of embodiments 1-15, wherein the oligonucleotides are
gapmers having the structure of wing-core-wing. 21. A composition
of any one of the preceding embodiments, wherein a wing comprises a
chiral internucleotidic linkage. 22. A composition of any one of
the preceding embodiments, wherein each wing independently
comprises a chiral internucleotidic linkage. 23. A composition of
any one of embodiments 1-17 and 19-22, wherein a wing to the 5'-end
of the core comprises a chiral internucleotidic linkage at the
5'-end of the wing. 24. A composition of any one of embodiments
1-16 and 18-22, wherein a wing to the 3'-end of the core comprises
a chiral internucleotidic linkage at the 3'-end of the wing. 25. A
composition of any one the preceding embodiments, wherein a wing
has only one chiral internucleotidic linkage, and each of the other
internucleotidic linkages of the wing is a natural phosphate
linkage
##STR00361##
26. A composition of any one of the preceding embodiments, wherein
the chiral internucleotidic linkage has the structure of formula I.
27. A composition of any one of the preceding embodiments, wherein
a chiral internucleotidic linkage has the structure of formula I,
and wherein X is S, and Y and Z are O. 28. A composition of any one
of the preceding embodiments, wherein a chiral internucleotidic
linkage is a phosphorothioate linkage. 29. A composition of any one
of the preceding embodiments, wherein a chiral internucleotidic
linkage is Sp. 30. A composition of any one of the preceding
embodiments, wherein each chiral internucleotidic linkage is Sp.
31. A composition of any one of embodiments 1-29, wherein a chiral
internucleotidic linkage is Rp. 32. A composition of any one of
embodiments 1-28, wherein each chiral internucleotidic linkage is
Rp. 33. A composition of any one of embodiments 1-31, wherein a
wing comprises an Sp phosphorothioate linkage. 34. A composition of
any one of embodiments 1-31, wherein each wing independently
comprises an Sp phosphorothioate linkage. 35. A composition of any
one of embodiments 1-17, 19-31, and 33-34, wherein a wing is to the
5'-end of the core, and the wing has an Sp phosphorothioate
linkage. 36. A composition of any one of embodiments 1-17, 19-31,
and 33-35, wherein a wing is to the 5'-end of the core, and the
wing has an Sp phosphorothioate linkage at the 5'-end of the wing.
37. A composition of any one of embodiments 1-17, 19-31, and 33-36,
wherein a wing is to the 5'-end of the core, the wing has an Sp
phosphorothioate linkage at the 5'-end of the wing, and each of the
other internucleotidic linkages of the wing is a natural phosphate
linkage
##STR00362##
38. A composition of any one of embodiments 1-16, 18-31 and 33-34,
wherein a wing is to the 3'-end of the core, and the wing has an Sp
phosphorothioate linkage at the 3'-end of the wing. 39. A
composition of any one of embodiments 1-16, 18-31, 33-34 and 38,
wherein a wing is to the 3'-end of the core, and the wing has an Sp
phosphorothioate linkage at the 3'-end of the wing. 40. A
composition of any one of embodiments 1-16, 18-31, 33-34 and 38-39,
wherein one wing is to the 3'-end of the common core, the wing has
an Sp phosphorothioate linkage at the 3'-end of the wing, and each
of the other internucleotidic linkages of the wing is a natural
phosphate linkage
##STR00363##
41. A composition of any one of embodiments 1-29 and 31-40, wherein
a wing comprises an Rp phosphorothioate linkage. 42. A composition
of any one of embodiments 1-29 and 31-40, wherein each wing
independently comprises an Rp phosphorothioate linkage. 43. A
composition of any one of embodiments 1-17, 19-29 and 31-42,
wherein a wing is to the 5'-end of the core, and the wing has an Rp
phosphorothioate linkage. 44. A composition of any one of
embodiments 1-17, 19-29 and 31-43, wherein a wing is to the 5'-end
of the core, and the wing has an Rp phosphorothioate linkage at the
5'-end of the wing. 45. A composition of any one of embodiments
1-17, 19-29 and 31-44, wherein a wing is to the 5'-end of the core,
the wing has an Rp phosphorothioate linkage at the 5'-end of the
wing, and each of the other internucleotidic linkages of the wing
is a natural phosphate linkage
##STR00364##
46. A composition of any one of embodiments 1-16, 18-29 and 31-42,
wherein a wing is to the 3'-end of the core, and the wing has an Rp
phosphorothioate. 47. A composition of any one of embodiments 1-16,
18-29 and 31-42, wherein a wing is to the 3'-end of the core, and
the wing has an Rp phosphorothioate linkage at the 3'-end of the
wing. 48. A composition of any one of embodiments 1-16, 18-29 and
31-42, wherein one wing is to the 3'-end of the common core, the
wing has an Rp phosphorothioate linkage at the 3'-end of the wing,
and each of the other internucleotidic linkages of the wing is a
natural phosphate linkage
##STR00365##
49. A composition of any one of embodiments 1-28, wherein a wing is
to the 5'-end of a core, and its 5'-end internucleotidic linkage is
a chiral internucleotidic linkage. 50. A composition of any one of
embodiments 1-28, wherein a wing is to the 5'-end of a core, and
its 5'-end internucleotidic linkage is an Sp chiral
internucleotidic linkage. 51. A composition of any one of
embodiments 1-28, wherein a wing is to the 5'-end of a core, and
its 5'-end internucleotidic linkage is an Rp chiral
internucleotidic linkage. 52. A composition of any one of
embodiments 1-28 and 49-51, wherein a wing is to the 3'-end of a
core, and its 3'-end internucleotidic linkage is a chiral
internucleotidic linkage. 53. A composition of any one of
embodiments 1-28 and 49-51, wherein a wing is to the 3'-end of a
core, and its 3'-end internucleotidic linkage is an Sp chiral
internucleotidic linkage. 54. A composition of any one of
embodiments 1-28 and 49-51, wherein a wing is to the 3'-end of a
core, and its 3'-end internucleotidic linkage is an Rp chiral
internucleotidic linkage. 55. A composition of any one of the
preceding embodiments, wherein each wing independently comprises a
natural phosphate linkage
##STR00366##
56. A composition of any one of the preceding embodiments, wherein
each wing independently comprises two or more natural phosphate
linkages
##STR00367##
57. A composition of any one of the preceding embodiments, wherein
each wing independently comprises two or more natural phosphate
linkages, and all natural phosphate linkages are consecutive. 58. A
composition of any one of the preceding embodiments, wherein a wing
has a length of three or more bases. 59. A composition of any one
of the preceding embodiments, wherein one wing has a length of four
or more bases. 60. A composition of any one of the preceding
embodiments, wherein one wing has a length of five or more bases.
61. A composition of any one of the preceding embodiments, wherein
one wing has a length of six or more bases. 62. A composition of
any one of the preceding embodiments, wherein one wing has a length
of seven or more bases. 63. A composition of any one of the
preceding embodiments, wherein one wing has a length of eight or
more bases. 64. A composition of any one of the preceding
embodiments, wherein one wing has a length of nine or more bases.
65. A composition of any one of the preceding embodiments, wherein
one wing has a length of ten or more bases. 66. A composition of
any one of the preceding embodiments, wherein each wing
independently has a length of three or more bases. 67. A
composition of any one of the preceding embodiments, wherein each
wing independently has a length of four or more bases. 68. A
composition of any one of the preceding embodiments, wherein each
wing independently has a length of five or more bases. 69. A
composition of any one of the preceding embodiments, wherein each
wing independently has a length of six or more bases. 70. A
composition of any one of the preceding embodiments, wherein each
wing independently has a length of seven or more bases. 71. A
composition of any one of the preceding embodiments, wherein each
wing independently has a length of eight or more bases. 72. A
composition of any one of the preceding embodiments, wherein each
wing independently has a length of nine or more bases. 73. A
composition of any one of the preceding embodiments, wherein each
wing independently has a length of ten or more bases. 74. A
composition of any one of embodiments 1-57, wherein a wing has a
length of two bases. 75. A composition of any one of embodiments
1-57, wherein a wing has a length of three bases. 76. A composition
of any one of embodiments 1-57, wherein a wing has a length of four
bases. 77. A composition of any one of embodiments 1-57, wherein a
wing has a length of five bases. 78. A composition of any one of
embodiments 1-57, wherein a wing has a length of six bases. 79. A
composition of any one of embodiments 1-57, wherein a wing has a
length of seven bases. 80. A composition of any one of embodiments
1-57, wherein a wing has a length of eight bases. 81. A composition
of any one of embodiments 1-57, wherein a wing has a length of nine
bases. 82. A composition of any one of embodiments 1-57, wherein a
wing has a length of ten bases. 83. A composition of any one of
embodiments 1-57, wherein a wing has a length of 11 bases. 84. A
composition of any one of embodiments 1-57, wherein a wing has a
length of 12 bases. 85. A composition of any one of embodiments
1-57, wherein a wing has a length of 13 bases. 86. A composition of
any one of embodiments 1-57, wherein a wing has a length of 14
bases. 87. A composition of any one of embodiments 1-57, wherein a
wing has a length of 15 bases. 88. A composition of any one of
embodiments 1-11 and 15-76, wherein each wing has the same length.
89. A composition of any one of the preceding embodiments, wherein
a wing is defined by sugar modifications relative to a core. 90. A
composition of any one of the preceding embodiments, wherein each
wing independently comprises a modified sugar moiety. 91. A
composition of any one of the preceding embodiments, wherein each
wing sugar moiety is independently a modified sugar moiety. 92. A
composition of any one of the preceding embodiments, wherein a
modified sugar moiety comprises a high-affinity sugar modification.
93. A composition of any one of the preceding embodiments, wherein
a modified sugar moiety has a 2'-modification. 94. A composition of
any one of the preceding embodiments, wherein a modified sugar
moiety comprises a bicyclic sugar modification. 95. A composition
of any one of the preceding embodiments, wherein a modified sugar
moiety comprises a bicyclic sugar modification having a -L- or
--O-L- bridge connecting two ring carbon atoms. 96. A composition
of any one of the preceding embodiments, wherein a modified sugar
moiety comprises a bicyclic sugar modification having a
4'-CH(CH.sub.3)--O-2' bridge. 97. A composition of any one of
embodiments 1-93, wherein a modified sugar moiety comprises a
2'-modification, wherein a 2'-modification is 2'-OR.sup.1. 98. A
composition of any one of embodiments 1-93, wherein a modified
sugar moiety comprises a 2'-modification, wherein a 2'-modification
is 2'-OR.sup.1, wherein R.sup.1 is optionally substituted C.sub.1-6
alkyl. 99. A composition of any one of embodiments 1-93, wherein a
modified sugar moiety comprises a 2'-modification, wherein a
2'-modification is 2'-MOE. 100. A composition of any one of
embodiments 1-93, wherein a modified sugar moiety comprises a
2'-modification, wherein a 2'-modification is 2'-OMe. 101. A
composition of any one of embodiments 1-96, wherein a modified
sugar moiety comprises a 2'-modification, wherein the
2'-modification is S-cEt. 102. A composition of any one of
embodiments 1-93, wherein a modified sugar moiety comprises a
2'-modification, wherein the 2'-modification is FANA. 103. A
composition of any one of embodiments 1-93, wherein a modified
sugar moiety comprises a 2'-modification, wherein the
2'-modification is FRNA. 104. A composition of any one of
embodiments 1-92, wherein a modified sugar moiety has a
5'-modification. 105. A composition of any one of embodiments 1-92,
wherein a modified sugar moiety is R-5'-Me-DNA. 106. A composition
of any one of embodiments 1-92, wherein a modified sugar moiety is
S-5'-Me-DNA. 107. A composition of any one of embodiments 1-92,
wherein a modified sugar moiety is FHNA. 108. A composition of any
one of the preceding embodiments, wherein each wing sugar moiety is
modified. 109. A composition of any one of the preceding
embodiments, wherein all modified wing sugar moieties within a wing
have the same modification. 110. A composition of any one of the
preceding embodiments, wherein all modified wing sugar moieties
have the same modification. 111. A composition of any one of
embodiments 1-108, wherein at least one modified wing sugar moiety
is different than another modified wing sugar moiety. 112. A
composition of any one of the preceding embodiments, wherein a wing
comprises a modified base. 113. A composition of any one of the
preceding embodiments, wherein a wing comprises a 2S-dT. 114. A
composition of any one of the preceding embodiments, wherein the
core region has a length of five or more bases. 115. A composition
of any one of the preceding embodiments, wherein the core region
has a length of six or more bases. 116. A composition of any one of
the preceding embodiments, wherein the core region has a length of
seven or more bases. 117. A composition of any one of the preceding
embodiments, wherein the core region has a length of eight or more
bases. 118. A composition of any one of the preceding embodiments,
wherein the core region has a length of nine or more bases. 119. A
composition of any one of the preceding embodiments, wherein the
core region has a length of ten or more bases. 120. A composition
of any one of the preceding embodiments, wherein the core region
has a length of 11 or more bases. 121. A composition of any one of
the preceding embodiments, wherein the core region has a length of
12 or more bases. 122. A composition of any one of the preceding
embodiments, wherein the core region has a length of 13 or more
bases. 123. A composition of any one of the preceding embodiments,
wherein the core region has a length of 14 or more bases. 124. A
composition of any one of the preceding embodiments, wherein the
core region has a length of 15 or more bases. 125. A composition of
any one of 1-113, wherein the core region has a length of five
bases. 126. A composition of any one of 1-113, wherein the core
region has a length of six bases. 127. A composition of any one of
1-113, wherein the core region has a length of seven bases. 128. A
composition of any one of 1-113, wherein the core region has a
length of eight bases. 129. A composition of any one of 1-113,
wherein the core region has a length of nine bases. 130. A
composition of any one of 1-113, wherein the core region has a
length of ten bases. 131. A composition of any one of 1-113,
wherein the core region has a length of 11 bases. 132. A
composition of any one of 1-113, wherein the core region has a
length of 12 bases. 133. A composition of any one of 1-113, wherein
the core region has a length of 13 bases. 134. A composition of any
one of 1-113, wherein the core region has a length of 14 bases.
135. A composition of any one of 1-113, wherein the core region has
a length of 15 bases. 136. A composition of any one of the
preceding embodiments, wherein the core region does not have any
2'-modification. 137. A composition of any one of the preceding
embodiments, wherein each core sugar moiety is not modified. 138. A
composition of any one of the preceding embodiments, wherein each
sugar moiety of the core region is the natural DNA sugar moiety.
139. A composition of any one of the preceding embodiments, wherein
the core region comprises a chiral internucleotidic linkage. 140. A
composition of any one of the preceding embodiments, wherein each
internucleotidic linkage of the core region is a chiral
internucleotidic linkage. 141. A composition of any one of the
preceding embodiments, wherein each internucleotidic linkage of the
core region is a chiral internucleotidic linkage having the
structure of formula I. 142. A composition of any one of the
preceding embodiments, wherein each internucleotidic linkage of the
core region is a chiral internucleotidic linkage having the
structure of formula I, and wherein X is S, and Y and Z are O. 143.
A composition of any one of the preceding embodiments, wherein each
internucleotidic linkage of the core region is a chiral
internucleotidic linkage having the structure of formula I, and
wherein one -L-R.sup.1 is not --H. 144. A composition of any one of
embodiments 1-142, wherein each internucleotidic linkage of the
core region is a phosphorothioate linkage. 145. A composition of
any one of the preceding embodiments, wherein the core region has a
pattern of backbone chiral center comprises (Sp).sub.m(Rp).sub.n,
wherein m is 1-50, and n is 1-10. 146. A composition of any one of
the preceding embodiments, wherein the core region has a pattern of
backbone chiral center comprises (Sp).sub.m(Rp).sub.n, wherein m is
1-50, n is 1-10, and m>n. 147. A composition of any one of the
preceding embodiments, wherein the core region has a pattern of
backbone chiral center comprises (Sp).sub.m(Rp).sub.n, wherein m is
2, 3, 4, 5, 6, 7 or 8, and n is 1. 148. A composition of any one of
embodiments 1-144, wherein the core region has a pattern of
backbone chiral centers comprising (Rp).sub.n(Sp).sub.m, wherein m
is 1-50 and n is 1-10. 149. A composition of any one of embodiments
1-144 and 148, wherein the core region has a pattern of backbone
chiral centers comprising Rp(Sp).sub.m, wherein m is 2, 3, 4, 5, 6,
7 or 8. 150. A composition of any one of embodiments 1-144 and
148-149, wherein the core region has a pattern of backbone chiral
centers comprising Rp(Sp).sub.2. 151. A composition of any one of
embodiments 1-144, wherein the core region has a pattern of
backbone chiral centers comprising (Np).sub.t(Rp).sub.n(Sp).sub.m,
wherein t is 1-10, n is 1-10, m is 1-50, and each Np is independent
Rp or Sp. 152. A composition of any one of embodiments 1-144 and
151, wherein the core region has a pattern of backbone chiral
centers comprising (Sp).sub.t(Rp).sub.n(Sp).sub.m, wherein t is
1-10, n is 1-10, m is 1-50. 153. A composition of any one of
embodiments 1-144 and 151-152, wherein n is 1. 154. A composition
of any one of embodiments 1-144 and 151-153, wherein t is 2, 3, 4,
5, 6, 7 or 8. 155. A composition of any one of embodiments 1-144
and 151-154, wherein m is 2, 3, 4, 5, 6, 7 or 8. 156. A composition
of any one of embodiments 1-144 and 151-155, wherein at least one
of t and m is greater than 5. 157. A composition of any one of the
preceding embodiments, wherein the core region has a pattern of
backbone chiral centers comprising SpSpRpSpSp. 158. A composition
of any one of the preceding embodiments, wherein 50% or more of the
chiral internucleotidic linkages in the core region have Sp
configuration. 159. A composition of any one of the preceding
embodiments, wherein 60% or more of the chiral internucleotidic
linkages in the core region have Sp configuration. 160. A
composition of any one of the preceding embodiments, wherein 70% or
more of the chiral internucleotidic linkages in the core region
have Sp configuration. 161. A composition of any one of the
preceding embodiments, wherein 80% or more of the chiral
internucleotidic linkages in the core region have Sp configuration.
162. A composition of any one of the preceding embodiments, wherein
90% or more of the chiral internucleotidic linkages in the core
region have Sp configuration. 163. A composition of any one of the
preceding embodiments, wherein each internucleotidic linkage in the
core region is chiral, the core region has only one Rp, and each of
the other internucleotidic linkages in the core region is Sp. 164.
A composition of any one of the preceding embodiments, wherein each
base moiety in the core is not modified. 165. A composition of any
one of embodiments 1-163, wherein the core region comprises a
modified base. 166. A composition of any one of embodiments 1-163,
wherein the core region comprises a modified base, wherein a
modified base is substituted A, T, C or G. 167. A composition of
any one of embodiments 1-164, wherein each base moiety in the core
region is independently selected from A, T, C and G. 168. A
composition of any one of embodiments 1-163, wherein the core
region is a DNA sequence whose phosphate linkages are independently
replaced with phosphorothioate linkages. 169. A composition of any
one of the preceding embodiments, wherein the oligonucleotides are
single stranded. 170. A composition of any one of the preceding
embodiments, wherein the oligonucleotides are antisense
oligonucleotide, antagomir, microRNA, pre-microRNs, antimir,
supermir, ribozyme, Ul adaptor, RNA activator, RNAi agent, decoy
oligonucleotide, triplex forming oligonucleotide, aptamer or
adjuvant. 171. A composition of any one of the preceding
embodiments, wherein the oligonucleotides are antisense
oligonucleotides. 172. A composition of any one of embodiments
1-171, wherein the oligonucleotides have a length of greater than
10 bases. 173. A composition of any one of embodiments 1-171,
wherein the oligonucleotides have a length of greater than 11
bases. 174. A composition of any one of embodiments 1-171, wherein
the oligonucleotides have a length of greater than 12 bases. 175. A
composition of any one of embodiments 1-171, wherein the
oligonucleotides have a length of greater than 13 bases. 176. A
composition of any one of embodiments 1-171, wherein the
oligonucleotides have a length of greater than 14 bases. 177. A
composition of any one of embodiments 1-171, wherein the
oligonucleotides have a length of greater than 15 bases. 178. A
composition of any one of embodiments 1-171, wherein the
oligonucleotides have a length of greater than 16 bases. 179. A
composition of any one of embodiments 1-171, wherein the
oligonucleotides have a length of greater than 17 bases. 180. A
composition of any one of embodiments 1-171, wherein the
oligonucleotides have a length of greater than 18 bases. 181. A
composition of any one of embodiments 1-171, wherein the
oligonucleotides have a length of greater than 19 bases. 182. A
composition of any one of embodiments 1-171, wherein the
oligonucleotides have a length of greater than 20 bases. 183. A
composition of any one of embodiments 1-171, wherein the
oligonucleotides have a length of greater than 21 bases. 184. A
composition of any one of embodiments 1-171, wherein the
oligonucleotides have a length of greater than 22 bases. 185. A
composition of any one of embodiments 1-171, wherein the
oligonucleotides have a length of greater than 23 bases. 186. A
composition of any one of embodiments 1-171, wherein the
oligonucleotides have a length of greater than 24 bases. 187. A
composition of any one of embodiments 1-171, wherein the
oligonucleotides have a length of greater than 25 bases. 188. A
composition of any one of the preceding embodiments, wherein the
oligonucleotides have a length of less than about 200 bases. 189. A
composition of any one of the preceding embodiments, wherein the
oligonucleotides have a length of less than about 150 bases. 190. A
composition of any one of the preceding embodiments, wherein the
oligonucleotides have a length of less than about 100 bases. 191. A
composition of any one of the preceding embodiments, wherein the
oligonucleotides have a length of less than about 50 bases. 192. A
composition of any one of the preceding embodiments, wherein
the
oligonucleotides have a length of less than about 40 bases. 193. A
composition of any one of the preceding embodiments, wherein the
oligonucleotides have a length of less than about 30 bases. 194. A
composition of any one of embodiments 1-171, wherein the
oligonucleotides have a length of 10 bases. 195. A composition of
any one of embodiments 1-171, wherein the oligonucleotides have a
length of 11 bases. 196. A composition of any one of embodiments
1-171, wherein the oligonucleotides have a length of 12 bases. 197.
A composition of any one of embodiments 1-171, wherein the
oligonucleotides have a length of 13 bases. 198. A composition of
any one of embodiments 1-171, wherein the oligonucleotides have a
length of 14 bases. 199. A composition of any one of embodiments
1-171, wherein the oligonucleotides have a length of 15 bases. 200.
A composition of any one of embodiments 1-171, wherein the
oligonucleotides have a length of 16 bases. 201. A composition of
any one of embodiments 1-171, wherein the oligonucleotides have a
length of 17 bases. 202. A composition of any one of embodiments
1-171, wherein the oligonucleotides have a length of 18 bases. 203.
A composition of any one of embodiments 1-171, wherein the
oligonucleotides have a length of 19 bases. 204. A composition of
any one of embodiments 1-171, wherein the oligonucleotides have a
length of 20 bases. 205. A composition of any one of embodiments
1-171, wherein the oligonucleotides have a length of 21 bases. 206.
A composition of any one of embodiments 1-171, wherein the
oligonucleotides have a length of 22 bases. 207. A composition of
any one of embodiments 1-171, wherein the oligonucleotides have a
length of 23 bases. 208. A composition of any one of embodiments
1-171, wherein the oligonucleotides have a length of 24 bases. 209.
A composition of any one of embodiments 1-171, wherein the
oligonucleotides have a length of 25 bases. 210. A composition of
any one of the preceding embodiments, wherein the oligonucleotide
type is not (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp,
Sp)-d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] (SEQ ID NO: 1505)
or (Rp, Rp, Rp, Rp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Rp, Rp,
Rp, Rp,
Rp)-Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsTs5mCsGs5mCsAs5mCs5mC
(5R-(SSR)3-5R) (SEQ ID NO: 1506), wherein in the underlined
nucleotide are 2'-MOE modified. 211. A composition of any one of
the preceding embodiments, wherein the oligonucleotide is not an
oligonucleotide selected from: (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp,
Sp, Sp)-d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] (SEQ ID NO:
1505) or (Rp, Rp, Rp, Rp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp,
Rp, Rp, Rp, Rp,
Rp)-Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsTs5mCsGs5mCsAs5mCs5mC
(5R-(SSR)3-5R) (SEQ ID NO: 1506), wherein in the underlined
nucleotide are 2'-MOE modified. 212. A composition of any one of
the preceding embodiments, wherein the oligonucleotide is not an
oligonucleotide selected from:
TABLE-US-00024 ONT-106 (SEQ ID NO: 1507) PCSK9 sense
(Rp)-uucuAGAccuGuuuuGcuudTsdT ONT-107 (SEQ ID NO: 1508) PCSK9 sense
(Sp)-uucuAGAccuGuuuuGcuudTsdT ONT-108 (SEQ ID NO: 1509) PCSK9
antisense (Rp)-AAGcAAAAcAGGUCuAGAAdTsdT ONT-109 (SEQ ID NO: 1510)
PCSK9 antisense (Sp)-AAGcAAAAcAGGUCuAGAAdTsdT ONT-110 (SEQ ID NO:
1511) PCSK9 antisense (Rp, Rp)-asAGcAAAAcAGGUCuAGAAdTsdT ONT-111
(SEQ ID NO: 1512) PCSK9 antisense (Sp, Rp)-asGcAAAAcAGGUCuAGAAdTsdT
ONT-112 (SEQ ID NO: 1513) PCSK9 antisense (Sp,
Sp)-asGcAAAAcAGGUCuAGAAdTsdT ONT-113 (SEQ ID NO: 1514) PCSK9
antisense (Rp, Sp)-asGcAAAAcAGGUCuAGAAdTsdT
wherein lower case letters represent 2'OMe RNA residues; capital
letters represent 2'OH RNA residues; and bolded and "s" indicates a
phosphorothioate moiety; and
TABLE-US-00025 PCSK9 (1) (SEQ ID NO: 1515) (All
(Sp))-ususcsusAsGsAscscsusGsususususGscsususd TsdT PCSK9 (2) (SEQ
ID NO: 1516) (All (Rp))-ususcsusAsGsAscscsusGsususususGscsususd
TsdT PCSK9 (3) (SEQ ID NO: 1517) (All
(Sp))-usucuAsGsAsccuGsuuuuGscuusdTsdT PCSK9 (4) (SEQ ID NO: 1518)
(All (Rp))-usucuAsGsAsccuGsuuuuGscuusdTsdT PCSK9 (5) (SEQ ID NO:
1519) (Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp,
Sp, Rp, Sp, Rp, Sp)-ususcsusAsGsAscscs usGsususususGscsususdTsdT
PCSK9 (6) (SEQ ID NO: 1520) (Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp,
Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp)-ususcsusAsGsAscscs
usGsususususGscsususdTsdT
wherein lower case letters represent 2'-OMe RNA residues; capital
letters represent RNA residues; d=2'-deoxy residues; and "s"
indicates a phosphorothioate moiety; and
TABLE-US-00026 PCSK9 (7) (SEQ ID NO: 1521) (All
(Rp))-AsAsGscsAsAsAsAscsAsGsGsUsCsusAsGsAsAsd TsdT PCSK9 (8) (SEQ
ID NO: 1522) (All (Sp))-AsAsGscsAsAsAsAscsAsGsGsUsCsusAsGsAsAsd
TsdT PCSK9 (9) (SEQ ID NO: 1523) (All
(Rp))-AsAGcAAAAcsAsGsGsUsCsusAsGsAsAsdTsdT PCSK9 (10) (SEQ ID NO:
1524) (All (Sp))-AsAGcAAAAcsAsGsGsUsCsusAsGsAsAsdTsdT PCSK9 (11)
(SEQ ID NO: 1525) (All (Rp))-AAsGscsAsAsAsAscAGGUCuAGAAdTsdT PCSK9
(12) (SEQ ID NO: 1526) (All (Sp))-AAsGscsAsAsAsAscAGGUCuAGAAdTsdT
PCSK9 (13) (SEQ ID NO: 1527) (All
(Rp))-AsAsGscAsAsAsAscAsGsGsUsCsuAsGsAsAsdTsd T PCSK9 (14) (SEQ ID
NO: 1528) (All (Sp))-AsAsGscAsAsAsAscAsGsGsUsCsuAsGsAsAsdTsd T
PCSK9 (15) (SEQ ID NO: 1529) (All
(Rp))-AsAGcAAAsAscAsGsGsUsCsusAsGsAsAsdTsdT PCSK9 (16) (SEQ ID NO:
1530) (All (Sp))-AsAGcAAAsAscAsGsGsUsCsusAsGsAsAsdTsdT PCSK9 (17)
(SEQ ID NO: 1531) (Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp,
Rp, Sp)-AsAGcAAAsAscAsGsGsUsCsusAsGsAsAsdTsdT PCSK9 (18) (SEQ ID
NO: 1532) (Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp,
Rp)-AsAGcAAAsAscAsGsGsUsCsusAsGsAsAsdTsdT
wherein lower case letters represent 2'-OMe RNA residues; capital
letters represent RNA residues; d=2'-deoxy residues; "s" indicates
a phosphorothioate moiety; and
TABLE-US-00027 PCSK9 (19) (SEQ ID NO: 1533) (All
(Rp))-UfsusCfsusAfsgsAfscsCfsusGfsusUfsusUfsg sCfsusUfsdTsdT PCSK9
(20) (SEQ ID NO: 1534) (All
(Sp))-UfsusCfsusAfsgsAfscsCfsusGfsusUfsusUfsg sCfsusUfsdTsdT PCSK9
(21) (SEQ ID NO: 1535) (All
(Rp))-UfsuCfsuAfsgAfscCfsuGfsuUfsuUfsgCfsuUfs dTsdT PCSK9 (22) (SEQ
ID NO: 1536) (All (Sp))-UfsuCfsuAfsgAfscCfsuGfsuUfsuUfsgCfsuUfs
dTsdT PCSK9 (23) (SEQ ID NO: 1537) (Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp,
Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp)-UfsusCfsusAfsgsAfs
csCfsusGfsusUfsusUfsgsCfsusUfsdTsdT PCSK9 (24) (SEQ ID NO: 1538)
(Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp,
Sp, Rp, Sp, Rp)-UfsusCfsusAfsgsAfs
csCfsusGfsusUfsusUfsgsCfsusUfsdTsdT
wherein lower case letters represent 2'-OMe RNA residues; capital
letters represent 2'-F RNA residues; d=2'-deoxy residues; and "s"
indicates a phosphorothioate moiety; and
TABLE-US-00028 PCSK9 (25) (SEQ ID NO: 1539) (All
(Rp))-asAfsgsCfsasAfsasAfscsAfsgsGfsusCfsusAf sgsAfsasdTsdT PCSK9
(26) (SEQ ID NO: 1540) (All
(Sp))-asAfsgsCfsasAfsasAfscsAfsgsGfsusCfsusAf sgsAfsasdTsdT PCSK9
(27) (SEQ ID NO: 1541) (All
(Rp))-asAfgCfaAfaAfcsAfsgsGfsusCfsusAfsgsAfsa sdTsdT PCSK9 (28)
(SEQ ID NO: 1542) (All
(Sp))-asAfgCfaAfaAfcsAfsgsGfsusCfsusAfsgsAfsa sdTsdT PCSK9 (29)
(SEQ ID NO: 1543) (All
(Rp))-asAfsgCfsaAfsaAfscAfsgGfsuCfsuAfsgAfsad TsdT PCSK9 (30) (SEQ
ID NO: 1544) (All (Sp))-asAfsgCfsaAfsaAfscAfsgGfsuCfsuAfsgAfsad
TsdT PCSK9 (31) (SEQ ID NO: 1544) (Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp,
Rp, Sp, Rp, Sp, Rp, Sp)-asAfgCfaAfasAfscAfsgsGfsusCfsusAfsgsAfsasd
TsdT PCSK9 (32) (SEQ ID NO: 1546) (Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp,
Sp, Rp, Sp, Rp, Sp, Rp)-asAfgCfaAfasAfscAfsgsGfsusCfsusAfsgsAfsasd
TsdT
213. A composition of any one of the preceding embodiments, wherein
the oligonucleotide is not an oligonucleotide selected from:
d[A.sub.RC.sub.SA.sub.RC.sub.SA.sub.RC.sub.SA.sub.RC.sub.SA.sub.RC]
(SEQ ID NO: 1555),
d[C.sub.SC.sub.SC.sub.SC.sub.RC.sub.RC.sub.SC.sub.SC.sub.SC.sub.SC]
(SEQ ID NO: 1556),
d[C.sub.SC.sub.SC.sub.SC.sub.SC.sub.SC.sub.SC.sub.RC.sub.RC.sub.SC]
(SEQ ID NO: 1557) and
d[C.sub.SC.sub.SC.sub.SC.sub.SC.sub.SC.sub.RC.sub.RC.sub.SC.sub.SC]
(SEQ ID NO: 1558), wherein R is Rp phosphorothioate linkage, and S
is Sp phosphorothioate linkage. 214. A composition of any one of
the preceding embodiments, wherein the oligonucleotide is not an
oligonucleotide selected from:
GGA.sub.RT.sub.SG.sub.RT.sub.ST.sub.R.sup.mC.sub.STCGA (SEQ ID NO:
1547), GGA.sub.RT.sub.RG.sub.ST.sub.ST.sub.R.sup.mC.sub.RTCGA (SEQ
ID NO: 1548),
GGA.sub.ST.sub.SG.sub.RT.sub.RT.sub.S.sup.mC.sub.STCGA (SEQ ID NO:
1549), wherein R is Rp phosphorothioate linkage, S is Sp
phosphorothioate linkage, all other linkages are PO, and each
.sup.mC is a 5-methylcytosine modified nucleoside. 215. A
composition of any one of the preceding embodiments, wherein the
oligonucleotide is not an oligonucleotide selected from:
T.sub.kT.sub.k.sup.mC.sub.kAGT.sup.mCATGA.sup.mCT.sub.kT.sup.mC.sub.k.sup-
.mC.sub.k (SEQ ID NO: 1550), wherein each nucleoside followed by a
subscript `k` indicates a (S)-cEt modification, R is Rp
phosphorothioate linkage, S is Sp phosphorothioate linkage, each
.sup.mC is a 5-methylcytosine modified nucleoside, and all
internucleoside linkages are phosphorothioates (PS) with
stereochemistry patterns selected from RSSSRSRRRS, RSSSSSSSSS,
SRRSRSSSSR, SRSRSSRSSR, RRRSSSRSSS, RRRSRSSRSR, RRSSSRSRSR,
SRSSSRSSSS, SSRRSSRSRS, SSSSSSSSRRSS, RRRSSRRRSR, RRRRSSSSRS,
SRRSRRRRRR, RSSRSSRRRR, RSRRSRRSRR, RRSRSSRSRS, SSRRRRRSRR,
RSRRSRSSSR, RRSSRSRRRR, RRSRSRRSSS, RRSRSSSRRR, RSRRRRSRSR,
SSRSSSRRRS, RSSRSRSRSR, RSRSRSSRSS, RRRSSRRSRS, SRRSSRRSRS,
RRRRSRSRRR, SSSSRRRRSR, RRRRRRRRRR and SSSSSSSSSS. 215a. A
composition of any one of the preceding embodiments, wherein the
common pattern of backbone chiral centers comprises SSR, RSS,
SSRSS, SSRSSR, RSSSRSRRRS, RSSSSSSSSS, SRRSRSSSSR, SRSRSSRSSR,
RRRSSSRSSS, RRRSRSSRSR, RRSSSRSRSR, SRSSSRSSSS, SSRRSSRSRS,
SSSSSSRRSS, RRRSSRRRSR, RRRRSSSSRS, SRRSRRRRRR, RSSRSSRRRR,
RSRRSRRSRR, RRSRSSRSRS, SSRRRRRSRR, RSRRSRSSSR, RRSSRSRRRR,
RRSRSRRSSS, RRSRSSSRRR, RSRRRRSRSR, SSRSSSRRRS, RSSRSRSRSR,
RSRSRSSRSS, RRRSSRRSRS, SRRSSRRSRS, RRRRSRSRRR, or SSSSRRRRSR.
215b. A composition of any one of the preceding embodiments,
wherein the common pattern of backbone chiral centers comprises
SSRSS, SSRSSR, RSSSRSRRRS, RSSSSSSSSS, SRRSRSSSSR, SRSRSSRSSR,
RRRSSSRSSS, RRRSRSSRSR, RRSSSRSRSR, SRSSSRSSSS, SSRRSSRSRS,
SSSSSSRRSS, RRRSSRRRSR, RRRRSSSSRS, SRRSRRRRRR, RSSRSSRRRR,
RSRRSRRSRR, RRSRSSRSRS, SSRRRRRSRR, RSRRSRSSSR, RRSSRSRRRR,
RRSRSRRSSS, RRSRSSSRRR, RSRRRRSRSR, SSRSSSRRRS, RSSRSRSRSR,
RSRSRSSRSS, RRRSSRRSRS, SRRSSRRSRS, RRRRSRSRRR, or SSSSRRRRSR.
215c. A composition of any one of the preceding embodiments,
wherein the common pattern of backbone chiral centers comprises
RSSSRSRRRS, RSSSSSSSSS, SRRSRSSSSR, SRSRSSRSSR, RRRSSSRSSS,
RRRSRSSRSR, RRSSSRSRSR, SRSSSRSSSS, SSRRSSRSRS, SSSSSSSSRRSS,
RRRSSRRRSR, RRRRSSSSRS, SRRSRRRRRR, RSSRSSRRRR, RSRRSRRSRR,
RRSRSSRSRS, SSRRRRRSRR, RSRRSRSSSR, RRSSRSRRRR, RRSRSRRSSS,
RRSRSSSRRR, RSRRRRSRSR, SSRSSSRRRS, RSSRSRSRSR, RSRSRSSRSS,
RRRSSRRSRS, SRRSSRRSRS, RRRRSRSRRR, or SSSSRRRRSR. 216. A
composition of any one of the preceding embodiments, wherein the
oligonucleotide is not an oligonucleotide selected from:
T.sub.kT.sub.k.sup.mC.sub.kAGT.sup.mCATGA.sup.mCTT.sub.k.sup.mC.sub.k.sup-
.mC.sub.k (SEQ ID NO: 1551), wherein each nucleoside followed by a
subscript `k` indicates a (S)-cEt modification, R is Rp
phosphorothioate linkage, S is Sp phosphorothioate linkage, each
.sup.mC is a 5-methylcytosine modified nucleoside and all
internucleoside linkages in the underlined core are
phosphorothioates (PS) with stereochemistry patterns selected from:
RSSSRSRRRS, RSSSSSSSSS, SRRSRSSSSR, SRSRSSR SRSSRSS, RRRSRSSRSR,
RRSSSRSRSR, SRSSSRSSSS, SSRRSSRSRS, SSSSSSRRSS, RRRSSRRRSR,
RRRRSSSSRS, SRRSRRRRRR, RSSRSSRRRR, RSRRSRRSRR, RRSRSSRSRS,
SSRRRRRSRR, RSRRSRSSSR, RRSSRSRRRR, RRSRSRRSSS, RRSRSSSRRR,
RSRRRRSRSR, SSRSSSRRRS, RSSRSRSRSR, RSRSRSSRSS, RSRRSSRRSRS,
RRRRSRSRRR, SSSSRRRRSR, RRRRRRRRRR and SSSSSSSSSS. 217. A
composition of embodiment 215 or 216, wherein each phosphorothioate
moiety of each nucleotide comprising (S)-cEt modification is
stereorandom. 218. A composition of any one of the preceding
embodiments, wherein the base sequence is or comprises a sequence
that is complementary to a target sequence, wherein when contacted
with a nucleic acid polymer comprising the target sequence, the
composition provides an altered cleavage pattern than a reference
cleavage pattern from a reference oligonucleotide composition. 219.
A composition of any one of the preceding embodiments, wherein the
nucleic acid polymer is RNA, and a reference oligonucleotide
composition is a substantially racemic preparation of
oligonucleotides that share the common sequence and length. 220. A
composition of any one of the preceding embodiments, wherein the
nucleic acid polymer is RNA, and a reference oligonucleotide
composition is a chirally uncontrolled oligonucleotide composition
of oligonucleotides that share the common sequence and length. 221.
A composition of any one of the preceding embodiments, wherein the
altered cleavage pattern has fewer cleavage sites than the
reference cleavage pattern. 222. A composition of any one of the
preceding embodiments, wherein the altered cleavage pattern has
only one cleavage site within the target sequence, and the
reference cleavage pattern has two or more cleavage sites within
the target sequence. 223. A composition of any one of the preceding
embodiments, wherein the base sequence for the oligonucleotides is
or comprises a sequence that is complementary to a characteristic
sequence element that defines a particular allele of a target gene
relative to other alleles of the same target gene that exist in a
population, the composition being characterized in that, when it is
contacted with a system expressing transcripts of both the target
allele and another allele of the same gene, transcripts of the
particular allele are suppressed at a level at least 2 fold greater
than a level of suppression observed for another allele of the same
gene. 224. A composition of any one of the preceding embodiments,
wherein the base sequence for the oligonucleotides is or comprises
a sequence that is complementary to a characteristic sequence
element that defines a particular allele of a target gene relative
to other alleles of the same target gene that exist in a
population, the composition being characterized in that, when it is
contacted with a system expressing transcripts of the target gene,
it shows suppression of expression of transcripts of the particular
allele at a level that is:
[1676] a) at least 2 fold in that transcripts from the particular
allele are detected in amounts that are 2 fold lower when the
composition is present relative to when it is absent;
[1677] b) at least 2 fold greater than a level of suppression
observed for another allele of the same gene; or
[1678] c) both at least 2 fold in that transcripts from the
particular allele are detected in amounts that are 2 fold lower
when the composition is present relative to when it is absent, and
at least 2 fold greater than a level of suppression observed for
another allele of the same gene.
225. A composition of any one of the preceding embodiments, wherein
the base sequence comprises a sequence that is complementary to a
characteristic sequence element of a target, wherein a
characteristic sequence element defines that target sequence
relative to a similar sequence. 226. A composition of any one of
the preceding embodiments, wherein the base sequence of a core
region comprises a sequence that is complementary to a
characteristic sequence element of a target, wherein a
characteristic sequence element defines that target sequence
relative to a similar sequence. 227. A composition of any one of
the preceding embodiments, wherein a target sequence is a sequence
comprising a mutation, and a similar sequence is the wild-type
sequence. 228. A composition of any one of the preceding
embodiments, wherein a characteristic sequence element defines a
particular allele of a target sequence relative to other alleles of
the same target sequence. 229. A composition of any one of the
preceding embodiments, wherein a characteristic sequence element
defines a particular allele of a target gene relative to other
alleles of the same target gene. 230. A composition of any one of
the preceding embodiments, wherein the sequence is 100%
complementary to a characteristic sequence element. 231. A
composition of any one of the preceding embodiments, wherein
position 11, 12, or 13 of the oligonucleotides as counted from the
5'-terminus of the oligonucleotides aligns with a characteristic
sequence element. 232. A composition of any one of embodiments
1-230, wherein position 11 of the oligonucleotides as counted from
the 5'-terminus of the oligonucleotides aligns with a
characteristic sequence element. 233. A composition of any one of
embodiments 1-230, wherein position 12 of the oligonucleotides as
counted from the 5'-terminus of the oligonucleotides aligns with a
characteristic sequence element. 234. A composition of any one of
embodiments 1-230, wherein position 13 of the oligonucleotides as
counted from the 5'-terminus of the oligonucleotides aligns with a
characteristic sequence element. 235. A composition of any one of
embodiments 1-230, wherein position 8, 9 or 10 of the
oligonucleotides as counted from the 3'-terminus of the
oligonucleotides aligns with a characteristic sequence element.
236. A composition of any one of embodiments 1-230, wherein
position 8 of the oligonucleotides as counted from the 3'-terminus
of the oligonucleotides aligns with a characteristic sequence
element. 237. A composition of any one of embodiments 1-230,
wherein position 9 of the oligonucleotides as counted from the
3'-terminus of the oligonucleotides aligns with a characteristic
sequence element. 238. A composition of any one of embodiments
1-230, wherein position 10 of the oligonucleotides as counted from
the 3'-terminus of the oligonucleotides aligns with a
characteristic sequence element. 239. A composition of any one of
embodiments 1-230, wherein position 6, 7 or 8 of the core region as
counted from the 5'-terminus of the core region aligns with a
characteristic sequence element. 240. A composition of any one of
embodiments 1-230, wherein position 6 of the core region as counted
from the 5'-terminus of the core region aligns with a
characteristic sequence element. 241. A composition of any one of
embodiments 1-230, wherein position 7 of the core region as counted
from the 5'-terminus of the core region aligns with a
characteristic sequence element. 242. A composition of any one of
embodiments 1-230, wherein position 8 of the core region as counted
from the 5'-terminus of the core region aligns with a
characteristic sequence element. 243. A composition of any one of
embodiments 1-230, wherein position 3, 4 or 5 of the core region as
counted from the 3'-terminus of the core region aligns with a
characteristic sequence element. 244. A composition of any one of
embodiments 1-230, wherein position 3 of the core region as counted
from the 3'-terminus of the core region aligns with a
characteristic sequence element. 245. A composition of any one of
embodiments 1-230, wherein position 4 of the core region as counted
from the 3'-terminus of the core region aligns with a
characteristic sequence element. 246. A composition of any one of
embodiments 1-230, wherein position 5 of the core region as counted
from the 3'-terminus of the core region aligns with a
characteristic sequence element. 247. A composition of any one of
the preceding embodiments, wherein a common base sequence or a base
sequence of an oligonucleotide type is a sequence whose DNA
cleavage pattern has a cleavage site within or in the vicinity of a
characteristic sequence element of a target nucleic acid sequence.
248. A composition of any one of the preceding embodiments, wherein
the DNA cleavage pattern is the cleavage pattern of an
oligonucleotide composition of DNA oligonucleotides having the
sequence, wherein each oligonucleotide in the composition has the
same structure. 249. A composition of any one of the preceding
embodiments, wherein a common base sequence or a base sequence of
an oligonucleotide type is a sequence whose stereorandom cleavage
pattern has a cleavage site within or in the vicinity of a
characteristic sequence element of a target nucleic acid sequence.
250. A composition of any one of the preceding embodiments, wherein
the stereorandom cleavage pattern is the cleavage pattern of a
stereorandom composition of oligonucleotides having the sequence,
wherein each internucleotidic linkage is phosphorothioate. 251. A
composition of any one of the preceding embodiments, wherein the
cleavage site with or in the vicinity of a characteristic sequence
element of a target nucleic acid sequence is in a core region. 252.
A composition of any one of the preceding embodiments, wherein the
cleavage site is in the vicinity of a characteristic sequence
element of a target nucleic acid sequence. 253. A composition of
any one of the preceding embodiments, wherein a cleavage site in
the vicinity is a cleavage site 0, 1, 2, 3, 4, or 5
internucleotidic linkages away from the characteristic sequence
element. 254. A composition of any one of the preceding
embodiments, wherein a cleavage site in the vicinity is a cleavage
site 0 internucleotidic linkages away from the characteristic
sequence element. 255. A composition of any one of the preceding
embodiments, wherein a cleavage site in the vicinity is a cleavage
site 1 internucleotidic linkage away from the characteristic
sequence element. 256. A composition of any one of the preceding
embodiments, wherein a cleavage site in the vicinity is a cleavage
site 2 internucleotidic linkages away from the characteristic
sequence element. 257. A composition of any one of the preceding
embodiments, wherein a cleavage site in the vicinity is a cleavage
site 3 internucleotidic linkages away from the characteristic
sequence element. 258. A composition of any one of the preceding
embodiments, wherein a cleavage site in the vicinity is a cleavage
site 4 internucleotidic linkages away from the characteristic
sequence element. 259. A composition of any one of the preceding
embodiments, wherein a cleavage site in the vicinity is a cleavage
site 5 internucleotidic linkages away from the characteristic
sequence element. 260. A composition of any one of the preceding
embodiments, wherein a cleavage site in the vicinity is a cleavage
site is 5' to the cleavage site. 261. A composition of any one of
the preceding embodiments, wherein a cleavage site in the vicinity
is a cleavage site is 3' to the cleavage site. 261a. A composition
of any one of the preceding embodiments, wherein a cleavage site
within or in the vicinity of a characteristic sequence element is a
major cleavage site. 262. A composition of any one of the preceding
embodiments, wherein a cleavage site within or in the vicinity of a
characteristic sequence element is a relative major cleavage site.
263. A composition of any one of the preceding embodiments, wherein
a cleavage site within or in the vicinity of a characteristic
sequence element is a relative major cleavage site, wherein greater
than 40% of total cleavage occurs at the site. 264. A composition
of any one of the preceding embodiments, wherein a cleavage site
within or in the vicinity of a characteristic sequence element is a
relative major cleavage site, wherein greater than 50% of total
cleavage occurs at the site. 265. A composition of any one of the
preceding embodiments, wherein a cleavage site within or in the
vicinity of a characteristic sequence element is a relative major
cleavage site, wherein greater than 60% of total cleavage occurs at
the site. 266. A composition of any one of the preceding
embodiments, wherein a cleavage site within or in the vicinity of a
characteristic sequence element is a relative major cleavage site,
wherein greater than 70% of total cleavage occurs at the site. 267.
A composition of any one of the preceding embodiments, wherein a
cleavage site within or in the vicinity of a characteristic
sequence element is a relative major cleavage site, wherein greater
than 80% of total cleavage occurs at the site. 268. A composition
of any one of the preceding embodiments, wherein a cleavage site
within or in the vicinity of a characteristic sequence element is a
relative major cleavage site, wherein greater than 90% of total
cleavage occurs at the site. 269. A composition of any one of the
preceding embodiments, wherein a cleavage site within or in the
vicinity of a characteristic sequence element is a relative major
cleavage site, wherein greater than 95% of total cleavage occurs at
the site. 270. A composition of any one of the preceding
embodiments, wherein a cleavage site within or in the vicinity of a
characteristic sequence element is a relative major cleavage site,
wherein greater than 100% of total cleavage occurs at the site.
271. A composition of any one of the preceding embodiments, wherein
a cleavage site within or in the vicinity of a characteristic
sequence element is an absolute major cleavage site, wherein
greater than 5% of total target is cleaved at the site. 272. A
composition of any one of the preceding embodiments, wherein a
cleavage site within or in the vicinity of a characteristic
sequence element is an absolute major cleavage site, wherein
greater than 10% of total target is cleaved at the site. 273. A
composition of any one of the preceding embodiments, wherein a
cleavage site within or in the vicinity of a characteristic
sequence element is an absolute major cleavage site, wherein
greater than 15% of total target is cleaved at the site. 274. A
composition of any one of the preceding embodiments, wherein a
cleavage site within or in the vicinity of a characteristic
sequence element is an absolute major cleavage site, wherein
greater than 20% of total target is cleaved at the site. 275. A
composition of any one of the preceding embodiments, wherein a
cleavage site within or in the vicinity of a characteristic
sequence element is an absolute major cleavage site, wherein
greater than 25% of total target is cleaved at the site. 276. A
composition of any one of the preceding embodiments, wherein a
cleavage site within or in the vicinity of a characteristic
sequence element is an absolute major cleavage site, wherein
greater than 30% of total target is cleaved at the site. 277. A
composition of any one of the preceding embodiments, wherein a
cleavage site within or in the vicinity of a characteristic
sequence element is an absolute major cleavage site, wherein
greater than 35% of total target is cleaved at the site. 278. A
composition of any one of the preceding embodiments, wherein a
cleavage site within or in the vicinity of a characteristic
sequence element is an absolute major cleavage site, wherein
greater than 40% of total target is cleaved at the site. 279. A
composition of any one of the preceding embodiments, wherein a
cleavage site within or in the vicinity of a characteristic
sequence element is an absolute major cleavage site, wherein
greater than 45% of total target is cleaved at the site. 280. A
composition of any one of the preceding embodiments, wherein a
cleavage site within or in the vicinity of a characteristic
sequence element is an absolute major cleavage site, wherein
greater than 50% of total target is cleaved at the site. 281. A
composition of any one of the preceding embodiments, wherein a
cleavage site within or in the vicinity of a characteristic
sequence element is an absolute major cleavage site, wherein
greater than 60% of total target is cleaved at the site. 282. A
composition of any one of the preceding embodiments, wherein a
cleavage site within or in the vicinity of a characteristic
sequence element is an absolute major cleavage site, wherein
greater than 70% of total target is cleaved at the site. 283. A
composition of any one of the preceding embodiments, wherein a
cleavage site within or in the vicinity of a characteristic
sequence element is an absolute major cleavage site, wherein
greater than 80% of total target is cleaved at the site. 284. A
composition of any one of the preceding embodiments, wherein a
cleavage site within or in the vicinity of a characteristic
sequence element is an absolute major cleavage site, wherein
greater than 90% of total target is cleaved at the site. 285. A
composition of any one the preceding embodiments, wherein a
relative or absolute major cleavage site is determined by RNase H
assay. 286. A composition of any one of the preceding embodiments,
wherein the characteristic sequence element comprises a single
nucleotide polymorphism (SNP) or a mutation. 287. A composition of
any one of the preceding embodiments, wherein the characteristic
sequence element comprises a single nucleotide polymorphism. 288. A
composition of any one of the preceding embodiments, wherein the
characteristic sequence element is a single nucleotide
polymorphism. 289. A composition of any one of the preceding
embodiments, wherein the single nucleotide polymorphism is a single
nucleotide polymorphism associated with Huntington's disease. 290.
A composition of any one of the preceding embodiments, wherein the
single nucleotide polymorphism is a single nucleotide polymorphism
found in the Huntingtin gene. 291. A composition of any one of the
preceding embodiments, wherein the single nucleotide polymorphism
is selected from rs362307, rs7685686, rs362268, rs2530595,
rs362331, or rs362306. 291a. A composition of any one of the
preceding embodiments, wherein the single nucleotide polymorphism
is selected from rs362307, rs7685686, rs362268, or rs362306. 292. A
composition of any one of the preceding embodiments, wherein the
single nucleotide polymorphism is rs362307. 293. A composition of
any one of the preceding embodiments, wherein the single nucleotide
polymorphism is rs7685686. 294. A composition of any one of the
preceding embodiments, wherein the single nucleotide polymorphism
is rs362268. 295. A composition of any one of the preceding
embodiments, wherein the single nucleotide polymorphism is
rs362306. 295a. A composition of any one of the preceding
embodiments, wherein the single nucleotide polymorphism is
rs2530595. 295b. A composition of any one of the preceding
embodiments, wherein the single nucleotide polymorphism is
rs362331. 296. A composition of any one of embodiments 1-290,
wherein the single nucleotide polymorphism is in an exon. 297. A
composition of any one of embodiments 1-290, wherein the single
nucleotide polymorphism is in an intron. 298. A composition of any
one of embodiments 1-290, wherein the composition is selected from
Tables N1, N2, N3, N4 and 8. 298a. A composition of any one of
embodiments 1-290, wherein the composition is selected from Tables
N1, N2, N3 and N4. 299. A composition of any one of embodiments
1-290, wherein the composition is selected from Tables N1A, N2A,
N3A, N4A and 8; and WV-1092, WVE120101, WV-2603 and WV-2595. 299a.
A composition of any one of embodiments 1-290, wherein the
composition is selected from Tables N1A, N2A, N3A and N4A. 300. A
composition of any one of embodiments 1-290, wherein the
composition is WV-1092. 300a. A composition of any one of
embodiments 1-290, wherein the composition is WVE120101. 300b. A
composition of any one of embodiments 1-290, wherein the
composition is WV-2603. 300c. A composition of any one of
embodiments 1-290, wherein the composition is WV-2595. 301. A
composition of any one of embodiments 1-290, wherein the
composition is not ONT-450, ONT-451, or ONT-452. 302. A composition
of any one of the preceding embodiments, wherein the characteristic
sequence element comprises a mutation. 303. A composition of any
one of the preceding embodiments, wherein the characteristic
sequence element is a mutation. 304. A composition of any one of
the preceding embodiments, wherein the oligonucleotides are at
least 95% complementary to a mutant allele. 305. A composition of
any one of the preceding embodiments, wherein the oligonucleotides
are 100% complementary to a mutant allele. 306. A composition of
any one of the preceding embodiments, wherein the oligonucleotides
are at least 95% complementary to a target sequence comprising a
SNP, wherein the SNP is associated with a disease. 307. A
composition of any one of the preceding embodiments, wherein the
oligonucleotides are 100% complementary to a target sequence
comprising a SNP, wherein the SNP is associated with a disease.
307a. A composition of any one of the preceding embodiments,
wherein the oligonucleotides selectively reduce RNA level of a
mutant
allele. 308. A pharmaceutical composition, comprising a composition
of any one of the preceding embodiments, and a pharmaceutical
carrier. 308a. A composition of any one of the preceding
embodiments, further comprising cerebrospinal fluid. 309. A
composition of any one of the preceding embodiments, further
comprising artificial cerebrospinal fluid. 310. A method for
controlled cleavage of a nucleic acid polymer, the method
comprising steps of:
[1679] contacting a nucleic acid polymer whose nucleotide sequence
comprises a target sequence with a chirally controlled
oligonucleotide composition comprising oligonucleotides of a
particular oligonucleotide type characterized by: [1680] 1) a
common base sequence and length, wherein the common base sequence
is or comprises a sequence that is complementary to a target
sequence found in the nucleic acid polymer; [1681] 2) a common
pattern of backbone linkages; and [1682] 3) a common pattern of
backbone chiral centers; which composition is chirally controlled
in that it is enriched, relative to a substantially racemic
preparation of oligonucleotides having the particular base sequence
and length, for oligonucleotides of the particular oligonucleotide
type. 310a. A method for cleavage of a nucleic acid having a base
sequence comprising a target sequence, the method comprising steps
of:
[1683] (a) contacting a nucleic acid having a base sequence
comprising a target sequence with a chirally controlled
oligonucleotide composition comprising oligonucleotides of a
particular oligonucleotide type characterized by: [1684] 1) a
common base sequence and length, wherein the common base sequence
is or comprises a sequence that is complementary to the target
sequence in the nucleic acid; [1685] 2) a common pattern of
backbone linkages; and [1686] 3) a common pattern of backbone
chiral centers; which composition is chirally controlled in that it
is enriched, relative to a substantially racemic preparation of
oligonucleotides having the particular base sequence and length,
for oligonucleotides of the particular oligonucleotide type,
wherein the oligonucleotide targets a mutant Huntingtin gene, and
the length is from about 10 to about 50 nucleotides, wherein the
backbone linkages comprise at least one phosphorothioate, and
wherein the pattern of backbone chiral centers comprises at least
one chiral center in a Rp conformation and at least one chiral
center in a Sp conformation. 310b. A method for cleavage of a
nucleic acid having a base sequence comprising a target sequence,
the method comprising steps of:
[1687] (a) contacting a nucleic acid having a base sequence
comprising a target sequence with a chirally controlled
oligonucleotide composition comprising oligonucleotides of a
particular oligonucleotide type characterized by: [1688] 1) a
common base sequence and length, wherein the common base sequence
is or comprises a sequence that is complementary to the target
sequence in the nucleic acid; [1689] 2) a common pattern of
backbone linkages; and [1690] 3) a common pattern of backbone
chiral centers; which composition is chirally controlled in that it
is enriched, relative to a substantially racemic preparation of
oligonucleotides having the particular base sequence and length,
for oligonucleotides of the particular oligonucleotide type,
wherein the oligonucleotide targets a mutant Huntingtin gene, and
the length is from about 10 to about 50 nucleotides, wherein the
backbone linkages comprise at least one phosphorothioate, and
wherein the pattern of backbone chiral centers comprises at least
one chiral center in a Rp conformation and at least one chiral
center in a Sp conformation; and
[1691] (b) cleavage of the nucleic acid mediated by a RNAseH or RNA
interference mechanism.
311. A method of embodiment 310, wherein the contacting being
performed under conditions so that cleavage of the nucleic acid
polymer occurs. 312. A method of any one of embodiments 310-311,
wherein the cleavage occurs with a cleavage pattern that differs
from a reference cleavage pattern observed when the nucleic acid
polymer is contacted under comparable conditions with a reference
oligonucleotide composition. 313. A method for altering a cleavage
pattern observed when a nucleic acid polymer whose nucleotide
sequence includes a target sequence is contacted with a reference
oligonucleotide composition that comprises oligonucleotides having
a particular base sequence and length, which particular base
sequence is or comprises a sequence that is complementary to the
target sequence, the method comprising:
[1692] contacting the nucleic acid polymer with a chirally
controlled oligonucleotide composition of oligonucleotides having
the particular base sequence and length, which composition is
chirally controlled in that it is enriched, relative to a
substantially racemic preparation of oligonucleotides having the
particular base sequence and length, for oligonucleotides of a
single oligonucleotide type characterized by:
[1693] 1) the particular base sequence and length;
[1694] 2) a particular pattern of backbone linkages; and
[1695] 3) a particular pattern of backbone chiral centers.
314. A method of embodiment 313, wherein the contacting being
performed under conditions so that cleavage of the nucleic acid
polymer occurs. 315. A method of any one of embodiments 312-314,
wherein the reference oligonucleotide composition is a
substantially racemic preparation of oligonucleotides that share
the common sequence and length. 316. A method of any one of
embodiments 312-314, wherein the reference oligonucleotide
composition is a chirally uncontrolled oligonucleotide composition
of oligonucleotides that share the common sequence and length. 317.
A method of any one of embodiments 312-316, wherein the cleavage
pattern provided by the chirally controlled oligonucleotide
composition differs from a reference cleavage pattern in that it
has fewer cleavage sites within the target sequence found in the
nucleic acid polymer than the reference cleavage pattern. 318. A
method of embodiment 317, wherein the cleavage pattern provided by
the chirally controlled oligonucleotide composition has a single
cleavage site within the target sequence found in the nucleic acid
polymer than the reference cleavage pattern. 319. A method of
embodiment 318, wherein the single cleavage site is a cleavage site
in the reference cleavage pattern. 320. A method of embodiment 318,
wherein the single cleavage site is a cleavage site not in the
reference cleavage pattern. 321. A method of any one of embodiments
312-316, wherein the cleavage pattern provided by the chirally
controlled oligonucleotide composition differs from a reference
cleavage pattern in that it increases cleavage percentage at a
cleavage site. 322. A method of embodiment 321, wherein the
cleavage site with increased cleavage percentage is a cleavage site
in the reference cleavage pattern. 323. A method of embodiment 321,
wherein the cleavage site with increased cleavage percentage is a
cleavage site not in the reference cleavage pattern. 324. A method
of any one of embodiments 310-323, wherein the chirally controlled
oligonucleotide composition provides a higher cleavage rate of the
target nucleic acid polymer than a reference oligonucleotide
composition. 325. A method of any one of embodiments 310-324, where
the cleavage rate is at least 5 fold higher. 326. A method of any
one of embodiments 310-325, wherein the chirally controlled
oligonucleotide composition provides a lower level of remaining
un-cleaved target nucleic acid polymer than a reference
oligonucleotide composition. 327. A method of any one of
embodiments 310-326, wherein the remaining un-cleaved target
nucleic acid polymer is at least 5 fold lower. 328. A methods of
any one of embodiments 310-327, wherein the cleavage products from
the nucleic acid polymer dissociate from oligonucleotides of the
particular oligonucleotide type in the chirally controlled
oligonucleotide composition at a faster rate than from
oligonucleotides of the reference oligonucleotide composition. 329.
A method for suppression of a transcript from a target nucleic acid
sequence for which one or more similar nucleic acid sequences exist
within a population, each of the target and similar sequences
contains a specific nucleotide characteristic sequence element that
defines the target sequence relative to the similar sequences, the
method comprising steps of:
[1696] contacting a sample comprising transcripts of the target
nucleic acid sequence with an oligonucleotide composition
comprising oligonucleotides having:
[1697] 1) a common base sequence and length; and
[1698] 2) a common pattern of backbone linkages;
[1699] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines the target nucleic acid sequence, the composition being
characterized in that, when it is contacted with a system
comprising transcripts of both the target nucleic acid sequence and
a similar nucleic acid sequences, transcripts of the target nucleic
acid sequence are suppressed at a greater level than a level of
suppression observed for a similar nucleic acid sequence.
330. A method for suppression of a transcript from a target nucleic
acid sequence for which one or more similar nucleic acid sequences
exist within a population, each of the target and similar sequences
contains a specific nucleotide characteristic sequence element that
defines the target sequence relative to the similar sequences, the
method comprising steps of:
[1700] contacting a sample comprising transcripts of the target
nucleic acid sequence with an oligonucleotide composition
comprising oligonucleotides having:
[1701] 1) a common base sequence and length; and
[1702] 2) a common pattern of backbone linkages;
[1703] 3) a common pattern of backbone chiral centers;
[1704] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines the target nucleic acid sequence, the composition being
characterized in that, when it is contacted with a system
comprising transcripts of both the target nucleic acid sequence and
a similar nucleic acid sequences, transcripts of the target nucleic
acid sequence are suppressed at a greater level than a level of
suppression observed for a similar nucleic acid sequence.
331. A method for suppression of a transcript from a target nucleic
acid sequence for which one or more similar nucleic acid sequences
exist within a population, each of the target and similar sequences
contains a specific nucleotide characteristic sequence element that
defines the target sequence relative to the similar sequences, the
method comprising steps of:
[1705] contacting a sample comprising transcripts of the target
nucleic acid sequence with an oligonucleotide composition
comprising oligonucleotides having:
[1706] 1) a common base sequence and length; and
[1707] 2) a common pattern of backbone linkages;
[1708] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines a particular target sequence relative to its similar
sequences, the composition being characterized in that, when it is
contacted with a system comprising transcripts of both the target
allele and another allele of the same gene, transcripts of the
particular allele are suppressed at a level at least 2 fold greater
than a level of suppression observed for another allele of the same
gene.
332. A method for suppression of a transcript from a target nucleic
acid sequence for which one or more similar nucleic acid sequences
exist within a population, each of the target and similar sequences
contains a specific nucleotide characteristic sequence element that
defines the target sequence relative to the similar sequences, the
method comprising steps of:
[1709] contacting a sample comprising transcripts of the target
nucleic acid sequence with an oligonucleotide composition
comprising oligonucleotides having:
[1710] 1) a common base sequence and length; and
[1711] 2) a common pattern of backbone linkages;
[1712] 3) a common pattern of backbone chiral centers;
[1713] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines a particular target sequence relative to its similar
sequences, the composition being characterized in that, when it is
contacted with a system comprising transcripts of both the target
allele and another allele of the same gene, transcripts of the
particular allele are suppressed at a level at least 2 fold greater
than a level of suppression observed for another allele of the same
gene.
333. A method for suppression of a transcript from a target nucleic
acid sequence for which one or more similar nucleic acid sequences
exist within a population, each of the target and similar sequences
contains a specific nucleotide characteristic sequence element that
defines the target sequence relative to the similar sequences, the
method comprising steps of:
[1714] contacting a sample comprising transcripts of the target
nucleic acid sequence with an oligonucleotide composition
comprising oligonucleotides having:
[1715] 1) a common base sequence and length;
[1716] 2) a common pattern of backbone linkages;
[1717] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines a particular target sequence relative to its similar
sequences, the composition being characterized in that, when it is
contacted with a system comprising transcripts of the same target
nucleic acid sequence, it shows suppression of transcripts of the
particular target sequence at a level that is:
[1718] a) greater than when the composition is absent;
[1719] b) greater than a level of suppression observed for a
similar; or
[1720] c) both greater than when the composition is absent, and
greater than a level of suppression observed for a similar
sequence.
334. A method for suppression of a transcript from a target nucleic
acid sequence for which one or more similar nucleic acid sequences
exist within a population, each of the target and similar sequences
contains a specific nucleotide characteristic sequence element that
defines the target sequence relative to the similar sequences, the
method comprising steps of:
[1721] contacting a sample comprising transcripts of the target
nucleic acid sequence with an oligonucleotide composition
comprising oligonucleotides having:
[1722] 1) a common base sequence and length;
[1723] 2) a common pattern of backbone linkages;
[1724] 3) a common pattern of backbone chiral centers;
[1725] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines a particular target sequence relative to its similar
sequences, the composition being characterized in that, when it is
contacted with a system comprising transcripts of the same target
nucleic acid sequence, it shows suppression of transcripts of the
particular target sequence at a level that is:
[1726] a) greater than when the composition is absent;
[1727] b) greater than a level of suppression observed for a
similar; or
[1728] c) both greater than when the composition is absent, and
greater than a level of suppression observed for a similar
sequence.
335. A method for suppression of a transcript from a target nucleic
acid sequence for which one or more similar nucleic acid sequences
exist within a population, each of the target and similar sequences
contains a specific nucleotide characteristic sequence element that
defines the target sequence relative to the similar sequences, the
method comprising steps of: contacting a sample comprising
transcripts of the target gene with an oligonucleotide composition
comprising oligonucleotides having:
[1729] 1) a common base sequence and length; and
[1730] 2) a common pattern of backbone linkages;
[1731] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines a particular target nucleic acid sequence, the composition
being characterized in that, when it is contacted with a system
expressing transcripts of the target nucleic acid sequence, it
shows suppression of expression of transcripts of the particular
target nucleic acid sequence at a level that is:
[1732] a) at least 2 fold in that transcripts from the particular
target nucleic acid sequence are detected in amounts that are 2
fold lower when the composition is present relative to when it is
absent;
[1733] b) at least 2 fold greater than a level of suppression
observed for a similar sequence; or
[1734] c) both at least 2 fold in that transcripts from the
particular target nucleic acid sequence are detected in amounts
that are 2 fold lower when the composition is present relative to
when it is absent, and at least 2 fold greater than a level of
suppression observed for a similar sequence.
336. A method for suppression of a transcript from a target nucleic
acid sequence for which one or more similar nucleic acid sequences
exist within a population, each of the target and similar sequences
contains a specific nucleotide characteristic sequence element that
defines the target sequence relative to the similar sequences, the
method comprising steps of: contacting a sample comprising
transcripts of the target gene with an oligonucleotide composition
comprising oligonucleotides having:
[1735] 1) a common base sequence and length; and
[1736] 2) a common pattern of backbone linkages;
[1737] 3) a common pattern of backbone chiral centers;
[1738] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines a particular target nucleic acid sequence, the composition
being characterized in that, when it is contacted with a system
expressing transcripts of the target nucleic acid sequence, it
shows suppression of expression of transcripts of the particular
target nucleic acid sequence at a level that is:
[1739] a) at least 2 fold in that transcripts from the particular
target nucleic acid sequence are detected in amounts that are 2
fold lower when the composition is present relative to when it is
absent;
[1740] b) at least 2 fold greater than a level of suppression
observed for a similar sequence; or
[1741] c) both at least 2 fold in that transcripts from the
particular target nucleic acid sequence are detected in amounts
that are 2 fold lower when the composition is present relative to
when it is absent, and at least 2 fold greater than a level of
suppression observed for a similar sequence.
337. A method of any one of the preceding embodiments, wherein a
target sequence is a sequence comprising a mutation, and a similar
sequence is the wild-type sequence. 338. A method of any one of the
preceding embodiments, wherein a characteristic sequence element
defines a particular allele of a target sequence relative to other
alleles of the same target sequence. 339. A method of any one of
the preceding embodiments, wherein a characteristic sequence
element defines a particular allele of a target gene relative to
other alleles of the same target gene. 340. A method for
allele-specific suppression of a transcript from a target nucleic
acid sequence for which a plurality of alleles exist within a
population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target nucleic acid sequence, the method
comprising steps of:
[1742] contacting a sample comprising transcripts of the target
nucleic acid sequence with an oligonucleotide composition
comprising oligonucleotides having:
[1743] 1) a common base sequence and length; and
[1744] 2) a common pattern of backbone linkages;
[1745] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines a particular allele, the composition being characterized in
that, when it is contacted with a system comprising transcripts of
both the target allele and another allele of the same nucleic acid
sequence, transcripts of the particular allele are suppressed at a
greater level than a level of suppression observed for another
allele of the same nucleic acid sequence.
341. A method for allele-specific suppression of a transcript from
a target nucleic acid sequence for which a plurality of alleles
exist within a population, each of which contains a specific
nucleotide characteristic sequence element that defines the allele
relative to other alleles of the same target nucleic acid sequence,
the method comprising steps of:
[1746] contacting a sample comprising transcripts of the target
nucleic acid sequence with a chirally controlled oligonucleotide
composition comprising oligonucleotides of a particular
oligonucleotide type characterized by:
[1747] 1) a common base sequence and length;
[1748] 2) a common pattern of backbone linkages;
[1749] 3) a common pattern of backbone chiral centers;
[1750] which composition is chirally controlled in that it is
enriched, relative to a substantially racemic preparation of
oligonucleotides having the same base sequence and length, for
oligonucleotides of the particular oligonucleotide type;
[1751] wherein the common base sequence for the oligonucleotides of
the particular oligonucleotide type is or comprises a sequence that
is complementary to the characteristic sequence element that
defines a particular allele, the composition being characterized in
that, when it is contacted with a system comprising transcripts of
both the target allele and another allele of the same nucleic acid
sequence, transcripts of the particular allele are suppressed at a
greater level than a level of suppression observed for another
allele of the same nucleic acid sequence.
342. A method for allele-specific suppression of a transcript from
a target gene for which a plurality of alleles exist within a
population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target gene, the method comprising steps
of:
[1752] contacting a sample comprising transcripts of the target
gene with an oligonucleotide composition comprising
oligonucleotides having:
[1753] 1) a common base sequence and length;
[1754] 2) a common pattern of backbone linkages;
[1755] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines a particular allele, the composition being characterized in
that, when it is contacted with a system comprising transcripts of
both the target allele and another allele of the same gene,
transcripts of the particular allele are suppressed at a level at
least 2 fold greater than a level of suppression observed for
another allele of the same gene.
343. A method for allele-specific suppression of a transcript from
a target gene for which a plurality of alleles exist within a
population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target gene, the method comprising steps
of:
[1756] contacting a sample comprising transcripts of the target
gene with a chirally controlled oligonucleotide composition
comprising oligonucleotides of a particular oligonucleotide type
characterized by:
[1757] 1) a common base sequence and length;
[1758] 2) a common pattern of backbone linkages;
[1759] 3) a common pattern of backbone chiral centers;
[1760] which composition is chirally controlled in that it is
enriched, relative to a substantially racemic preparation of
oligonucleotides having the same base sequence and length, for
oligonucleotides of the particular oligonucleotide type;
[1761] wherein the common base sequence for the oligonucleotides of
the particular oligonucleotide type is or comprises a sequence that
is complementary to the characteristic sequence element that
defines a particular allele, the composition being characterized in
that, when it is contacted with a system comprising transcripts of
both the target allele and another allele of the same gene,
transcripts of the particular allele are suppressed at a level at
least 2 fold greater than a level of suppression observed for
another allele of the same gene.
344. A method of embodiment 340 or 342, the contacting being
performed under conditions determined to permit the composition to
suppress transcripts of the particular allele. 345. A method for
allele-specific suppression of a transcript from a target gene for
which a plurality of alleles exist within a population, each of
which contains a specific nucleotide characteristic sequence
element that defines the allele relative to other alleles of the
same target gene, the method comprising steps of:
[1762] contacting a sample comprising transcripts of the target
gene with a chirally controlled oligonucleotide composition
comprising oligonucleotides of a particular oligonucleotide type
characterized by:
[1763] 1) a common base sequence and length;
[1764] 2) a common pattern of backbone linkages;
[1765] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type; wherein the common base
sequence for the oligonucleotides of the particular oligonucleotide
type is or comprises a sequence that is complementary to the
characteristic sequence element that defines a particular allele,
the composition being characterized in that, when it is contacted
with a system expressing transcripts of both the target allele and
another allele of the same gene, transcripts of the particular
allele are suppressed at a level at least 2 fold greater than a
level of suppression observed for another allele of the same gene.
346. A method of embodiment 345, wherein the contacting being
performed under conditions determined to permit the composition to
suppress expression of the particular allele. 347. A method of any
one of embodiments 340-346, wherein transcripts of the particular
allele are suppressed at a level at least 5, 10, 20, 50, 100, 200
or 500 fold greater than a level of suppression observed for
another allele of the same gene. 348. A method for allele-specific
suppression of a transcript from a target nucleic acid sequence for
which a plurality of alleles exist within a population, each of
which contains a specific nucleotide characteristic sequence
element that defines the allele relative to other alleles of the
same target nucleic acid sequence, the method comprising steps
of:
[1766] contacting a sample comprising transcripts of the target
nucleic acid sequence with an oligonucleotide composition
comprising oligonucleotides having:
[1767] 1) a common base sequence and length;
[1768] 2) a common pattern of backbone linkages;
[1769] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines a particular allele, the composition being characterized in
that, when it is contacted with a system comprising transcripts of
the same target nucleic acid sequence, it shows suppression of
transcripts of the particular allele at a level that is:
[1770] a) greater than when the composition is absent;
[1771] b) greater than a level of suppression observed for another
allele of the same nucleic acid sequence; or
[1772] c) both greater than when the composition is absent, and
greater than a level of suppression observed for another allele of
the same nucleic acid sequence.
349. A method for allele-specific suppression of a transcript from
a target nucleic acid sequence for which a plurality of alleles
exist within a population, each of which contains a specific
nucleotide characteristic sequence element that defines the allele
relative to other alleles of the same target nucleic acid sequence,
the method comprising steps of:
[1773] contacting a sample comprising transcripts of the target
nucleic acid sequence with a chirally controlled oligonucleotide
composition comprising oligonucleotides of a particular
oligonucleotide type characterized by:
[1774] 1) a common base sequence and length;
[1775] 2) a common pattern of backbone linkages;
[1776] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type;
[1777] wherein the common base sequence for the oligonucleotides of
the particular oligonucleotide type is or comprises a sequence that
is complementary to the characteristic sequence element that
defines a particular allele, the composition being characterized in
that, when it is contacted with a system comprising transcripts of
the same target nucleic acid sequence, it shows suppression of
transcripts of the particular allele at a level that is:
[1778] a) greater than when the composition is absent;
[1779] b) greater than a level of suppression observed for another
allele of the same nucleic acid sequence; or
[1780] c) both greater than when the composition is absent, and
greater than a level of suppression observed for another allele of
the same nucleic acid sequence.
350. A method for controlled cleavage of a nucleic acid polymer,
the method comprising contacting a nucleic acid polymer whose
nucleotide sequence comprises a target sequence with an
oligonucleotide or an oligonucleotide composition of any one of
embodiments 540-574. 351. A method for suppression of a transcript
from a target nucleic acid sequence for which one or more similar
nucleic acid sequences exist within a population, each of the
target and similar sequences contains a specific nucleotide
characteristic sequence element that defines the target sequence
relative to the similar sequences, the method comprising contacting
a sample comprising transcripts of the target nucleic acid sequence
with an oligonucleotide or an oligonucleotide composition of any
one of embodiments 540-574, wherein the base sequence of the
oligonucleotide is or comprises a sequence that is complementary to
the characteristic sequence element that defines the target nucleic
acid sequence. 352. A method for allele-specific suppression of a
transcript from a target nucleic acid sequence for which a
plurality of alleles exist within a population, each of which
contains a specific nucleotide characteristic sequence element that
defines the allele relative to other alleles of the same target
nucleic acid sequence, the method comprising contacting a sample
comprising transcripts of the target nucleic acid sequence with an
oligonucleotide or an oligonucleotide composition of any one of
embodiments 540-574, wherein the base sequence of the
oligonucleotide is or comprises a sequence that is complementary to
the characteristic sequence element that defines a particular
allele. 353. A method for allele-specific suppression of a
transcript from a target nucleic acid sequence for which a
plurality of alleles exist within a population, each of which
contains a specific nucleotide characteristic sequence element that
defines the allele relative to other alleles of the same target
nucleic acid sequence, the method comprising contacting a sample
comprising transcripts of the target nucleic acid sequence with an
oligonucleotide or an oligonucleotide composition of any one of
embodiments 540-574, wherein the base sequence of the
oligonucleotide is or comprises a sequence that is complementary to
the characteristic sequence element that defines a particular
allele, the oligonucleotide or oligonucleotide composition being
characterized in that, when it is contacted with a system
comprising transcripts of both the target allele and another allele
of the same gene, transcripts of the particular allele are
suppressed at a level at least 2 fold greater than a level of
suppression observed for another allele of the same gene. 354. A
method for allele-specific suppression of a transcript from a
target nucleic acid sequence for which a plurality of alleles exist
within a population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target nucleic acid sequence, the method
comprising contacting a sample comprising transcripts of the target
nucleic acid sequence with an oligonucleotide or an oligonucleotide
composition of any one of embodiments 540-574, wherein the base
sequence of the oligonucleotide is or comprises a sequence that is
complementary to the characteristic sequence element that defines a
particular allele, the oligonucleotide or oligonucleotide
composition being characterized in that, when it is contacted with
a system expressing transcripts of both the target allele and
another allele of the same gene, transcripts of the particular
allele are suppressed at a level at least 2 fold greater than a
level of suppression observed for another allele of the same gene.
355. A method for allele-specific suppression of a transcript from
a target nucleic acid sequence for which a plurality of alleles
exist within a population, each of which contains a specific
nucleotide characteristic sequence element that defines the allele
relative to other alleles of the same target nucleic acid sequence,
the method comprising contacting a sample comprising transcripts of
the target nucleic acid sequence with an oligonucleotide or an
oligonucleotide composition of any one of embodiments 540-574,
wherein the base sequence of the oligonucleotide is or comprises a
sequence that is complementary to the characteristic sequence
element that defines a particular allele, the oligonucleotide or
oligonucleotide composition being characterized in that, when it is
contacted with a system comprising transcripts of the same target
nucleic acid sequence, it shows suppression of transcripts of the
particular allele at a level that is:
[1781] a) greater than when the composition is absent;
[1782] b) greater than a level of suppression observed for another
allele of the same nucleic acid sequence; or
[1783] c) both greater than when the composition is absent, and
greater than a level of suppression observed for another allele of
the same nucleic acid sequence.
356. A method for allele-specific suppression of a transcript from
a target nucleic acid sequence for which a plurality of alleles
exist within a population, each of which contains a specific
nucleotide characteristic sequence element that defines the allele
relative to other alleles of the same target nucleic acid sequence,
the method comprising contacting a sample comprising transcripts of
the target nucleic acid sequence with an oligonucleotide or an
oligonucleotide composition of any one of embodiments 540-574,
wherein the base sequence of the oligonucleotide is or comprises a
sequence that is complementary to the characteristic sequence
element that defines a particular allele, the oligonucleotide or
oligonucleotide composition being characterized in that, when it is
contacted with a system expressing transcripts of the same target
nucleic acid sequence, it shows suppression of transcripts of the
particular allele at a level that is:
[1784] a) greater than when the composition is absent;
[1785] b) greater than a level of suppression observed for another
allele of the same nucleic acid sequence; or
[1786] c) both greater than when the composition is absent, and
greater than a level of suppression observed for another allele of
the same nucleic acid sequence.
357. A method for allele-specific suppression of a transcript from
a target gene for which a plurality of alleles exist within a
population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target gene, the method comprising steps
of:
[1787] contacting a sample comprising transcripts of the target
gene with an oligonucleotide composition comprising
oligonucleotides having:
[1788] 1) a common base sequence and length; and
[1789] 2) a common pattern of backbone linkages;
[1790] wherein the common base sequence is or comprises a sequence
that is complementary to the characteristic sequence element that
defines a particular allele, the composition being characterized in
that, when it is contacted with a system expressing transcripts of
the target gene, it shows suppression of expression of transcripts
of the particular allele at a level that is:
[1791] a) at least 2 fold in that transcripts from the particular
allele are detected in amounts that are 2 fold lower when the
composition is present relative to when it is absent;
[1792] b) at least 2 fold greater than a level of suppression
observed for another allele of the same gene; or
[1793] c) both at least 2 fold in that transcripts from the
particular allele are detected in amounts that are 2 fold lower
when the composition is present relative to when it is absent, and
at least 2 fold greater than a level of suppression observed for
another allele of the same gene.
358. A method for allele-specific suppression of a transcript from
a target gene for which a plurality of alleles exist within a
population, each of which contains a specific nucleotide
characteristic sequence element that defines the allele relative to
other alleles of the same target gene, the method comprising steps
of:
[1794] contacting a sample comprising transcripts of the target
gene with a chirally controlled oligonucleotide composition
comprising oligonucleotides of a particular oligonucleotide type
characterized by:
[1795] 1) a common base sequence and length;
[1796] 2) a common pattern of backbone linkages;
[1797] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type;
[1798] wherein the common base sequence for the oligonucleotides of
the particular oligonucleotide type is or comprises a sequence that
is complementary to the characteristic sequence element that
defines a particular allele, the composition being characterized in
that, when it is contacted with a system expressing transcripts of
the target gene, it shows suppression of expression of transcripts
of the particular allele at a level that is:
[1799] a) at least 2 fold in that transcripts from the particular
allele are detected in amounts that are 2 fold lower when the
composition is present relative to when it is absent;
[1800] b) at least 2 fold greater than a level of suppression
observed for another allele of the same gene; or
[1801] c) both at least 2 fold in that transcripts from the
particular allele are detected in amounts that are 2 fold lower
when the composition is present relative to when it is absent, and
at least 2 fold greater than a level of suppression observed for
another allele of the same gene.
359. A method of any one of the preceding embodiments, wherein
transcripts from the particular allele are detected in amounts that
are 2 fold or more when the composition is absent relative to when
it is present. 360. A method of any one of the preceding
embodiments, wherein the level of transcripts of another allele of
the same gene is at least 2 fold greater than the level of
transcripts of the particular allele. 361. A method of any one of
the preceding embodiments, wherein transcripts from the particular
allele are detected in amounts that are 2 fold or more when the
composition is absent relative to when it is present, and the level
of transcripts of another allele of the same gene is at least 2
fold greater than the level of transcripts of the particular
allele. 362. A method of any one of the preceding embodiments, the
contacting being performed under conditions determined to permit
the composition to suppress transcripts of the particular allele.
363. A method of any one of the preceding embodiments, wherein the
contacting being performed under conditions determined to permit
the composition to suppress expression of the particular allele.
364. A method of any one of the preceding embodiments, wherein
transcripts of the particular allele are suppressed at a level that
is at least 5, 10, 20, 50, 100, 200 or 500 fold in that transcripts
from the particular allele are detected in amounts that are 2 fold
lower when the composition is present relative to when it is
absent. 365. A method of any one of the preceding embodiments,
wherein transcripts of the particular allele are suppressed at a
level that is at least 5, 10, 20, 50, 100, 200 or 500 fold greater
than a level of suppression observed for another allele of the same
gene. 366. A method of any one of the preceding embodiments,
wherein the system is an in vitro or in vivo system. 366a A method
of any one of the preceding embodiments, wherein the method is
performed in vitro or in vivo. 367. A method of any one of the
preceding embodiments, wherein the system comprises one or more
cells, tissues or organs. 368. A method of any one of the preceding
embodiments, wherein the system comprises one or more organisms.
369. A method of any one of the preceding embodiments, wherein the
system comprises one or more subjects. 370. A method of any one of
the preceding embodiments, wherein transcripts of the particular
allele are cleaved. 371. A method of any one of the preceding
embodiments, wherein the specific nucleotide characteristic
sequence element is present within an intron of the target nucleic
acid sequence or gene. 372. A method of any one of the preceding
embodiments, wherein the specific nucleotide characteristic
sequence element is present within an exon of the target nucleic
acid sequence or gene. 373. A method of any one of the preceding
embodiments, wherein the specific nucleotide characteristic
sequence element spans an exon and an intron of the target nucleic
acid sequence or gene. 374. A method of any one of the preceding
embodiments, wherein the specific nucleotide characteristic
sequence element comprises a mutation. 375. A method of any one of
the preceding embodiments, wherein the specific nucleotide
characteristic sequence element is a mutation. 376. A method of any
one of the preceding embodiments, wherein the specific nucleotide
characteristic sequence element comprises a SNP. 377. A method of
any one of the preceding embodiments, wherein the specific
nucleotide characteristic sequence element is a SNP. 378. A method
of any one of the preceding embodiments, wherein the
oligonucleotide composition is administered to a subject. 379. A
method of any one of the preceding embodiments, wherein the target
nucleic acid polymer or transcripts are oligonucleotides. 380. A
method of any one of the preceding embodiments, wherein the target
nucleic acid polymer or transcripts are RNA. 381. A method of any
one of the preceding embodiments, wherein the target nucleic acid
polymer or transcripts are newly transcribed RNA. 382. A method of
any one of the preceding embodiments, wherein oligonucleotides of
the particular oligonucleotide type in the chirally controlled
oligonucleotide composition form duplexes with the nucleic acid
polymer or transcripts. 383. A method of any one of the preceding
embodiments, wherein the nucleic acid polymer or transcripts are
cleaved by an enzyme. 384. A method of any one of the preceding
embodiments, wherein the enzyme is RNase H. 385. A method of any
one of the preceding embodiments, wherein the SNP is a SNP related
to Huntington's disease. 386. A method of any one of the preceding
embodiments, wherein the SNP is a SNP found in the Huntingtin gene.
387. A method of any one of the preceding embodiments, wherein the
SNP is selected from rs362307, rs7685686, rs362268, or rs362306.
388. A method of embodiments 310-387, wherein the SNP is rs362307.
389. A method of embodiments 310-387, wherein the single nucleotide
polymorphism is rs7685686. 390. A method of embodiments 310-387,
wherein the single nucleotide polymorphism is rs362268. 391. A
method of embodiments 310-387, wherein the single nucleotide
polymorphism is rs362306. 392. A method of embodiments 310-391,
wherein position 11 of the oligonucleotides as counted from the
5'-terminus of the oligonucleotides aligns with a single nucleotide
polymorphism. 393. A method of embodiments 310-391, wherein
position 12 of the oligonucleotides as counted from the 5'-terminus
of the oligonucleotides aligns with a single nucleotide
polymorphism. 394. A method of embodiments 310-391, wherein
position 13 of the oligonucleotides as counted from the 5'-terminus
of the oligonucleotides aligns with a single nucleotide
polymorphism. 395. A method of embodiments 310-391, wherein
position 8 of the oligonucleotides as counted from the 3'-terminus
of the oligonucleotides aligns with a single nucleotide
polymorphism. 396. A method of embodiments 310-391, wherein
position 9 of the oligonucleotides as counted from the 3'-terminus
of the oligonucleotides aligns with a single nucleotide
polymorphism. 397. A method of embodiments 310-391, wherein
position 10 of the oligonucleotides as counted from the 3'-terminus
of the oligonucleotides aligns with a single nucleotide
polymorphism. 398. A method of any one of the preceding
embodiments, wherein the oligonucleotides comprise one or more wing
regions and a common core region, wherein:
[1802] each wing region independently has a length of two or more
bases, and independently and optionally comprises one or more
chiral internucleotidic linkages; and
[1803] the core region independently has a length of two or more
bases and independently comprises one or more chiral
internucleotidic linkages.
399. A method of any one of embodiments 310-398, wherein position 6
of the core region as counted from the 5'-terminus of the core
region aligns with a single nucleotide polymorphism. 400. A method
of any one of embodiments 310-398, wherein position 7 of the core
region as counted from the 5'-terminus of the core region aligns
with a single nucleotide polymorphism. 401. A method of any one of
embodiments 310-398, wherein position 8 of the core region as
counted from the 5'-terminus of the core region aligns with a
single nucleotide polymorphism. 402. A method of any one of
embodiments 310-398, wherein position 3 of the core region as
counted from the 3'-terminus of the core region aligns with a
single nucleotide polymorphism. 403. A method of any one of
embodiments 310-398, wherein position 4 of the core region as
counted from the 3'-terminus of the core region aligns with a
single nucleotide polymorphism. 404. A method of any one of
embodiments 310-398, wherein position 5 of the core region as
counted from the 3'-terminus of the core region aligns with a
single nucleotide polymorphism. 405. A method of any one of the
preceding embodiments, wherein:
[1804] each wing region independently has a length of two or more
bases, and independently comprises one or more chiral
internucleotidic linkages and one or more natural phosphate
linkage; and
[1805] the core region independently has a length of two or more
bases, wherein each internucleotidic linkage in the core region is
chiral, only one of internucleotidic linkage in the core region is
Rp, and each of the other internucleotidic linkages in the core
region is Sp.
406. A method of any one of the preceding embodiments, wherein the
oligonucleotides are hemimers having the structure of wing-core.
407. A method of any one of embodiments 310-405, wherein the
oligonucleotides are hemimers having the structure of core-wing.
408. A method of any one of embodiments 310-405, wherein the
oligonucleotides are gapmers having the structure of
wing-core-wing. 409. A method of any one of the preceding
embodiments, wherein level of transcripts from a disease-causing
allele is selectively suppressed. 410. A method of any one of the
preceding embodiments, wherein level of a protein translated from
transcripts from a disease-causing allele are suppressed. 411. A
method for treating or preventing Huntington's Disease in a
subject, comprising administering to the subject an oligonucleotide
composition comprising oligonucleotides having:
[1806] 1) a common base sequence and length; and
[1807] 2) a common pattern of backbone linkages.
412. A method for treating or preventing Huntington's Disease in a
subject, comprising administering to the subject a chirally
controlled oligonucleotide composition comprising oligonucleotides
of a particular oligonucleotide type characterized by:
[1808] 1) a common base sequence and length;
[1809] 2) a common pattern of backbone linkages; and
[1810] 3) a common pattern of backbone chiral centers;
which composition is chirally controlled in that it is enriched,
relative to a substantially racemic preparation of oligonucleotides
having the same base sequence and length, for oligonucleotides of
the particular oligonucleotide type. 413. A method of embodiment
411 or 412, wherein the oligonucleotides comprise one or more wing
regions and a common core region, wherein:
[1811] each wing region independently has a length of two or more
bases, and independently and optionally comprises one or more
chiral internucleotidic linkages; and
[1812] the core region independently has a length of two or more
bases and independently comprises one or more chiral
internucleotidic linkages.
414. A method of any one of embodiments 411-4113, wherein:
[1813] each wing region independently has a length of two or more
bases, and independently comprises one or more chiral
internucleotidic linkages and one or more natural phosphate
linkage; and
[1814] the core region independently has a length of two or more
bases, wherein each internucleotidic linkage in the core region is
chiral, only one of internucleotidic linkage in the core region is
Rp, and each of the other internucleotidic linkages in the core
region is Sp.
415. A method of any one of embodiments 411-414, wherein the
oligonucleotides are hemimers having the structure of wing-core.
416. A method of any one of embodiments 411-414, wherein the
oligonucleotides are hemimers having the structure of core-wing.
417. A method of any one of embodiments 411-414, wherein the
oligonucleotides are gapmers having the structure of
wing-core-wing. 418. A method of any one of embodiments 411-417,
wherein position 11 of the oligonucleotides as counted from the
5'-terminus of the oligonucleotides aligns with a single nucleotide
polymorphism. 419. A method of any one of embodiments 411-417,
wherein position 12 of the oligonucleotides as counted from the
5'-terminus of the oligonucleotides aligns with a single nucleotide
polymorphism. 420. A method of any one of embodiments 411-417,
wherein position 13 of the oligonucleotides as counted from the
5'-terminus of the oligonucleotides aligns with a single nucleotide
polymorphism. 421. A method of any one of embodiments 411-417,
wherein position 8 of the oligonucleotides as counted from the
3'-terminus of the oligonucleotides aligns with a single nucleotide
polymorphism. 422. A method of any one of embodiments 411-417,
wherein position 9 of the oligonucleotides as counted from the
3'-terminus of the oligonucleotides aligns with a single nucleotide
polymorphism. 423. A method of any one of embodiments 411-417,
wherein position 10 of the oligonucleotides as counted from the
3'-terminus of the oligonucleotides aligns with a single nucleotide
polymorphism. 424. A method of any one of embodiments 411-417,
wherein position 6 of the core region as counted from the
5'-terminus of the core region aligns with a single nucleotide
polymorphism. 425. A method of any one of embodiments 411-417,
wherein position 7 of the core region as counted from the
5'-terminus of the core region aligns with a single nucleotide
polymorphism. 426. A method of any one of embodiments 411-417,
wherein position 8 of the core region as counted from the
5'-terminus of the core region aligns with a single nucleotide
polymorphism. 427. A method of any one of embodiments 411-417,
wherein position 3 of the core region as counted from the
3'-terminus of the core region aligns with a single nucleotide
polymorphism. 428. A method of any one of embodiments 411-417,
wherein position 4 of the core region as counted from the
3'-terminus of the core region aligns with a single nucleotide
polymorphism. 429. A method of any one of embodiments 411-417,
wherein position 5 of the core region as counted from the
3'-terminus of the core region aligns with a single nucleotide
polymorphism. 430. A method of any one of embodiments 411-429,
wherein the method ameliorating a symptom of Huntington's Disease.
431. A method of any one of embodiments 411-429, wherein the method
slowing onset of Huntington's Disease. 432. A method of any one of
embodiments 411-429, wherein the method slowing progression of
Huntington's Disease. 433. A method of any one of embodiments
411-432, wherein the subject has a SNP related to Huntington's
Disease. 434. A method of any one of embodiments 411-433, wherein
the subject has a SNP in the subject's Huntingtin gene. 435. A
method of any one of embodiments 411-434, wherein the subject has a
SNP, wherein one allele is mutant Huntingtin associated with
expanded CAG repeats. 436. A method of any one of embodiments
411-435, wherein the subject has a SNP selected from rs362307,
rs7685686, rs362268, rs2530595, rs362331, or rs362306. 436a. A
method of any one of embodiments 411-435, wherein the subject has a
SNP selected from rs362307, rs7685686, rs362268, or rs362306. 437.
A method of any one of embodiments 411-436, wherein the subject has
the SNP rs362307. 438. A method of any one of embodiments 411-436,
wherein the subject has the SNP rs7685686. 439. A method of any one
of embodiments 411-436, wherein the subject has the SNP rs362268.
440. A method of any one of embodiments 411-436, wherein the
subject has the SNP rs362306. 440a. A method of any one of
embodiments 411-436, wherein the subject has the SNP rs2530595.
440b. A method of any one of embodiments 411-436, wherein the
subject has the SNP rs362331. 441. A composition of any of
embodiments 1-309, wherein a substantially racemic preparation of
oligonucleotides is prepared by non-stereoselective preparation.
442. A composition of any one of embodiments 1-309 and 441, wherein
a substantially racemic preparation of oligonucleotides is prepared
by non-stereoselective preparation, wherein a chiral auxiliary is
not used for formation of a chiral internucleotidic linkage. 443. A
composition of any one of embodiments 1-309 and 441-442, wherein a
substantially racemic preparation of oligonucleotides is prepared
by non-stereoselective preparation, wherein at least one chiral
internucleotidic linkage is formed with less than 80:20
diastereomeric selectivity. 444. A composition of any one of
embodiments 1-309 and 441-443, wherein a substantially racemic
preparation of oligonucleotides is prepared by non-stereoselective
preparation, wherein at least one chiral internucleotidic linkage
is formed with less than 90:10 diastereomeric selectivity. 445. A
composition of any one of embodiments 1-309 and 441-444, wherein a
substantially racemic preparation of oligonucleotides is prepared
by non-stereoselective preparation, wherein at least one chiral
internucleotidic linkage is formed with less than 95:5
diastereomeric selectivity. 446. A composition of any one of
embodiments 1-309 and 441-445, wherein a substantially racemic
preparation of oligonucleotides is prepared by non-stereoselective
preparation, wherein at least one chiral internucleotidic linkage
is formed with less than 97:3 diastereomeric selectivity. 447. A
composition of any one of embodiments 1-309, wherein each chiral
internucleotidic linkage is formed with greater than 90:10
diastereomeric selectivity. 448. A composition of any one of
embodiments 1-309, wherein each chiral internucleotidic linkage is
formed with greater than 95:5 diastereomeric selectivity. 449. A
composition of any one of embodiments 1-309, wherein each chiral
internucleotidic linkage is formed with greater than 96:4
diastereomeric selectivity. 450. A composition of any one of
embodiments 1-309, wherein each chiral internucleotidic linkage is
formed with greater than 97:3 diastereomeric selectivity. 451. A
composition of any one of embodiments 1-309, wherein each chiral
internucleotidic linkage is formed with greater than 98:2
diastereomeric selectivity. 452. A composition of any one of
embodiments 1-309, wherein each chiral internucleotidic linkage is
formed with greater than 98:2 diastereomeric selectivity. 453. A
composition of any one of embodiments 443-452, wherein the
diastereomeric selectivity for forming a chiral internucleotidic
linkage is measured by forming a dimeric oligonucleotide comprising
the chiral internucleotidic linkage and the nucleosides to both
sides of the chiral internucleotidic linkage under the same or
comparable reaction conditions. 454. A method for preparing an
oligonucleotide composition for selective suppression of a
transcript of a target nucleic acid sequence, comprising providing
an oligonucleotide composition comprising a predetermined level of
oligonucleotides of a particular oligonucleotide type characterized
by:
[1815] 1) a common base sequence;
[1816] 2) a common pattern of backbone linkages; and
[1817] 3) a common pattern of backbone chiral centers, which
pattern comprises (Sp).sub.m(Rp).sub.n, (Rp).sub.n(Sp).sub.m,
(Np).sub.t(Rp).sub.n(Sp).sub.m, or (Sp).sub.t(Rp).sub.n(Sp).sub.m,
wherein:
[1818] m is 1-50;
[1819] n is 1-10;
[1820] t is 1-50;
[1821] each Np is independently Rp or Sp;
[1822] wherein the target nucleic acid sequence comprises a
characteristic sequence element that defines the target nucleic
acid sequence from a similar nucleic acid sequence;
[1823] wherein the common base sequence is a sequence whose DNA
cleavage pattern and/or stereorandom cleavage pattern has a
cleavage site within or in the vicinity of the target nucleic acid
sequence.
455. A method of embodiment 454, wherein the pattern comprises
(Sp).sub.m(Rp).sub.n. 456. A method of embodiment 454, wherein the
pattern comprises (Rp).sub.n(Sp).sub.m. 457. A method of embodiment
454, wherein the pattern comprises (Np).sub.t(Rp).sub.n(Sp).sub.m.
458. A method of embodiment 454, wherein the pattern comprises
(Sp).sub.t(Rp).sub.n(Sp).sub.m. 459. A method of embodiment 454,
wherein the pattern is a pattern in any one of embodiments 145-157.
460. A method of any one of embodiments 454-458, wherein a cleavage
site is in any one of embodiments 247-285. 461. A method of any one
of the preceding embodiments, wherein the oligonucleotide
composition is a composition of any one of embodiments 1-309 and
441-453. 462. A composition or method of any one of the preceding
embodiments, wherein the sequence of the oligonucleotide in a
chirally controlled oligonucleotide composition comprises, consists
of, or is the sequence of any oligonucleotide described herein, or
selected from Tables N1A, N2A, N3A, N4A or 8; or WV-1092,
WVE120101, WV-2603 or WV-2595. 463. A composition comprising a
lipid and an oligonucleotide. 463a. The composition of any one of
the preceding embodiments, wherein the composition comprises one or
more lipids conjugated with one or more oligonucleotides in the
composition. 464. A composition comprising an oligonucleotide and a
lipid selected from the list of: lauric acid, myristic acid,
palmitic acid, stearic acid, oleic acid, linoleic acid,
alpha-linolenic acid, gamma-linolenic acid, docosahexaenoic acid
(cis-DHA), turbinaric acid, arachidonic acid, and dilinoleyl. 464a.
A composition comprising an oligonucleotide and a lipid selected
from the list of: lauric acid, myristic acid, palmitic acid,
stearic acid, oleic acid, linoleic acid, alpha-linolenic acid,
gamma-linolenic acid, docosahexaenoic acid (cis-DHA), turbinaric
acid, and dilinoleyl. 465. A composition comprising an
oligonucleotide and a lipid selected from:
##STR00368##
466. A composition comprising an oligonucleotide and a lipid,
wherein the lipid comprises a C.sub.10-C.sub.40 linear, saturated
or partially unsaturated, aliphatic chain, optionally substituted
with one or more C.sub.1-4 aliphatic group. 467. An oligonucleotide
composition comprising a plurality of oligonucleotides, which
share: 1) a common base sequence; 2) a common pattern of backbone
linkages; and 3) a common pattern of backbone phosphorus
modifications; wherein one or more oligonucleotides of the
plurality are individually conjugated to a lipid. 468. A chirally
controlled oligonucleotide composition comprising a plurality of
oligonucleotides, which share: 1) a common base sequence; 2) a
common pattern of backbone linkages; and 3) a common pattern of
backbone phosphorus modifications; wherein: the composition is
chirally controlled in that the plurality of oligonucleotides share
the same stereochemistry at one or more chiral internucleotidic
linkages; one or more oligonucleotides of the plurality are
individually conjugated to a lipid; and one or more
oligonucleotides of the plurality are optionally and individually
conjugated to a targeting compound or moiety. 469. A method of
delivering an oligonucleotide to a cell or tissue in a human
subject, comprising: (a) providing a composition of any one of the
preceding embodiments; and (b) Administering the composition to the
human subject such that the oligonucleotide is delivered to a cell
or tissue in the subject. 470. A method for delivering an
oligonucleotide to a cell or tissue comprising preparing a
composition according to any one of the preceding embodiments and
treating [contacting] the cell or tissue with the composition. 471.
A method of modulating the level of a transcript or gene product of
a gene in a cell, the method comprising the step of contacting the
cell with a composition according to any one of the preceding
embodiments, wherein the oligonucleotide is capable of modulating
the level of the transcript or gene product. 472. A method for
inhibiting expression of a gene in a cell or tissue comprising
preparing a composition according to any one of the preceding
embodiments and treating the cell or tissue with the composition.
473. A method for inhibiting expression of a gene in a cell or
tissue in a mammal comprising preparing a composition according to
any one of the preceding embodiments and administering the
composition to the mammal. 474. A method of treating a disease that
is caused by the over-expression of one or several proteins in a
cell or tissue in a subject, said method comprising the
administration of a composition according to any one of the
preceding embodiments to the subject. 475. A method of treating a
disease that is caused by a reduced, suppressed or missing
expression of one or several proteins in a subject, said method
comprising the administration of a composition according to any one
of the preceding embodiments to the subject. 476. A method for
generating an immune response in a subject, said method comprising
the administration of a composition according to any one of the
preceding embodiments to the subject, wherein the biologically
active compound is an immunomodulating nucleic acid. 477. A method
for treating a sign and/or symptom of Huntington's Disease by
providing a composition of any one of the preceding embodiments and
administering the composition to the subject. 478. A method of
modulating the amount of RNaseH-mediated cleavage in a cell, the
method comprising the step of contacting the cell with a
composition according to any one of the preceding embodiments,
wherein the oligonucleotide is capable of modulating the amount of
RNaseH-mediated cleavage. 479. A method of administering an
oligonucleotide to a subject in need thereof, comprising steps of
providing a composition comprising the agent a lipid, and
administering the composition to the subject, wherein the agent is
any agent disclosed herein, and wherein the lipid is any lipid
disclosed herein. 480. A method of treating a disease in a subject,
the method comprising steps of providing a composition comprising
the agent a lipid, and administering a therapeutically effective
amount of the composition to the subject, wherein the agent is any
agent disclosed herein, and wherein the lipid is any lipid
disclosed herein, and wherein the disease is any disease disclosed
herein. 481. The composition or method of any one of the preceding
embodiments, wherein a lipid comprises an optionally substituted
C.sub.10-C.sub.40 saturated or partially unsaturated aliphatic
chain. 482. The composition or method of any one of the preceding
embodiments, wherein a lipid comprises an optionally substituted
C.sub.10-C.sub.40 linear, saturated or partially unsaturated,
aliphatic chain. 483. The composition or method of any one of the
preceding embodiments, wherein a lipid comprises a
C.sub.10-C.sub.40 linear, saturated or partially unsaturated,
aliphatic chain, optionally substituted with one or more C.sub.1-4
aliphatic group. 484. The composition or method of any one of the
preceding embodiments, wherein a lipid comprises an unsubstituted
C.sub.10-C.sub.40 linear, saturated or partially unsaturated,
aliphatic chain. 485. The composition or method of any one of the
preceding embodiments, wherein a lipid comprises no more than one
optionally substituted C.sub.10-C.sub.40 linear, saturated or
partially unsaturated, aliphatic chain. 486. The composition or
method of any one of the preceding embodiments, wherein a lipid
comprises two or more optionally substituted C.sub.10-C.sub.40
linear, saturated or partially unsaturated, aliphatic chain. 487.
The composition or method of any one of the preceding embodiments,
wherein a lipid comprises no tricyclic or polycyclic moiety. 488.
The composition or method of any one of the preceding embodiments,
wherein a lipid has the structure of R.sup.1--COOH, wherein R.sup.1
is an optionally substituted C.sub.10-C.sub.40 saturated or
partially unsaturated aliphatic chain. 489. The composition or
method of any one of embodiment 16, wherein the lipid is conjugated
through its carboxyl group. 490. The composition or method
according to any one of the preceding embodiments, wherein the
lipid is selected from:
##STR00369##
491. The composition or method of any one of the preceding
embodiments, wherein the lipid is conjugated to the
oligonucleotide. 492. The composition or method of any one of the
preceding embodiments, wherein the lipid is directly conjugated to
the oligonucleotide. 493. The composition or method of any one of
the preceding embodiments, wherein the lipid is conjugated to the
oligonucleotide via a linker. 494. The composition or method of any
one of the preceding embodiments, wherein the linker is selected
from: an uncharged linker; a charged linker; a linker comprising an
alkyl; a linker comprising a phosphate; a branched linker; an
unbranched linker; a linker comprising at least one cleavage group;
a linker comprising at least one redox cleavage group; a linker
comprising at least one phosphate-based cleavage group; a linker
comprising at least one acid-cleavage group; a linker comprising at
least one ester-based cleavage group; and a linker comprising at
least one peptide-based cleavage group. 495. The composition or
method of any one of the preceding embodiments, wherein each
oligonucleotide of the plurality is individually conjugated to the
same lipid at the same location. 496. The composition or method of
any one of the preceding embodiments, wherein a lipid is conjugated
to an oligonucleotide through a linker. 497. The composition or
method of any one of the preceding embodiments, wherein one or more
oligonucleotides of the plurality are independently conjugated to a
targeting compound or moiety. 498. The composition or method of any
one of the preceding embodiments, wherein one or more
oligonucleotides of the plurality are independently conjugated to a
lipid and a targeting compound or moiety. 499. The composition or
method of any one of the preceding embodiments, wherein one or more
oligonucleotides of the plurality are independently conjugated to a
lipid at one end and a targeting compound or moiety at the other.
500. The composition or method of any one of the preceding
embodiments, wherein oligonucleotides of the plurality share the
same chemical modification patterns. 501. The composition or method
of any one of the preceding embodiments, wherein oligonucleotides
of the plurality share the same chemical modification patterns
comprising one or more base modifications. 502. The composition or
method of any one of the preceding embodiments, wherein
oligonucleotides of the plurality share the same chemical
modification patterns comprising one or more sugar modifications.
503. The composition or method of any one of the preceding
embodiments, wherein the common base sequence is capable of
hybridizing with a transcript in a cell, which transcript contains
a mutation that is linked to a muscle disease, or whose level,
activity and/or distribution is linked to a muscle disease. 504.
The composition or method of any one of the preceding embodiments,
wherein the oligonucleotide is a nucleic acid. 505. The composition
or method of any one of the preceding embodiments, wherein the
oligonucleotide is an oligonucleotide. 506. The composition or
method of any one of the preceding embodiments, wherein the
oligonucleotide is an oligonucleotide which mediates exon skipping.
507. The composition or method of any one of the preceding
embodiments, wherein the oligonucleotide is a stereodefined
oligonucleotide which mediates exon skipping. 508. The composition
or method of any one of the preceding embodiments, wherein the
disease or disorder is a muscle-related disease or disorder. 509.
The composition or method of any one of the preceding embodiments,
wherein the lipid comprises an optionally substituted,
C.sub.10-C.sub.80 saturated or partially unsaturated aliphatic
group, wherein one or more methylene units are optionally and
independently replaced by an optionally substituted group selected
from C.sub.1-C.sub.6 alkylene, C.sub.1-C.sub.6 alkenylene,
--C.ident.--, a C.sub.1-C.sub.6 heteroaliphatic moiety,
--C(R').sub.2--, -Cy-, --O--, --S--, --S--S--, --N(R')--, --C(O)--,
--C(S)--, --C(NR')--, --C(O)N(R')--, --N(R')C(O)N(R')--,
--N(R')C(O)--, --N(R')C(O)O--, --OC(O)N(R')--, --S(O)--,
--S(O).sub.2--, --S(O).sub.2N(R')--, --N(R')S(O).sub.2--,
--SC(O)--, --C(O)S--, --OC(O)--, and --C(O)O--, wherein each
variable is independently as defined and described herein. 510. The
composition or method of any one of the preceding embodiments,
wherein the lipid comprises an optionally substituted
C.sub.10-C.sub.80 saturated or partially unsaturated, aliphatic
chain. 511. The composition or method of any one of the preceding
embodiments, wherein the lipid comprises an optionally substituted
C.sub.10-C.sub.80 linear, saturated or partially unsaturated,
aliphatic chain. 512. The composition or method of any one of the
preceding embodiments, wherein the lipid comprises an optionally
substituted C.sub.10-C.sub.60 saturated or partially unsaturated,
aliphatic chain. 513. The composition or method of any one of the
preceding embodiments, wherein the lipid comprises an optionally
substituted C.sub.10-C.sub.60 linear, saturated or partially
unsaturated, aliphatic chain. 514. The composition or method of any
one of the preceding embodiments, wherein the lipid comprises an
optionally substituted C.sub.10-C.sub.40 saturated or partially
unsaturated, aliphatic chain. 515. The composition or method of any
one of the preceding embodiments, wherein the lipid comprises an
optionally substituted C.sub.10-C.sub.40 linear, saturated or
partially unsaturated, aliphatic chain. 516. The composition or
method of any one of the preceding embodiments, wherein the lipid
comprises an optionally substituted, C.sub.10-C.sub.60 saturated or
partially unsaturated aliphatic group, wherein one or more
methylene units are optionally and independently replaced by an
optionally substituted group selected from C.sub.1-C.sub.6
alkylene, C.sub.1-C.sub.6 alkenylene, --C.ident.C--, a
C.sub.1-C.sub.6 heteroaliphatic moiety, --C(R').sub.2--, -Cy-,
--O--, --S--, --S--S--, --N(R')--, --C(O)--, --C(S)--, --C(NR')--,
--C(O)N(R')--, --N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--,
--OC(O)N(R')--, --S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--,
--N(R')S(O).sub.2--, --SC(O)--, --C(O)S--, --OC(O)--, and
--C(O)O--, wherein each variable is independently as defined and
described herein. 517. The composition or method of any one of the
preceding embodiments, wherein the lipid comprises an optionally
substituted C.sub.10-C.sub.80 saturated or partially unsaturated,
aliphatic chain. 518. The composition or method of any one of the
preceding embodiments, wherein the lipid comprises an optionally
substituted C.sub.10-C.sub.60 linear, saturated or partially
unsaturated, aliphatic chain. 519. The composition or method of any
one of the preceding embodiments, wherein the lipid comprises an
optionally substituted C.sub.10-C.sub.40 linear, saturated or
partially unsaturated, aliphatic chain. 520. The composition or
method of any one of the preceding embodiments, wherein the lipid
comprises an optionally substituted, C.sub.10-C.sub.40 saturated or
partially unsaturated aliphatic group, wherein one or more
methylene units are optionally and independently replaced by an
optionally substituted group selected from C.sub.1-C.sub.6
alkylene, C.sub.1-C.sub.6 alkenylene, --C.ident.C--, a
C.sub.1-C.sub.6 heteroaliphatic moiety, --C(R').sub.2--, -Cy-,
--O--, --S--, --S--S--, --N(R')--, --C(O)--, --C(S)--, --C(NR')--,
--C(O)N(R')--, --N(R')C(O)N(R')--, --N(R')C(O)--, --N(R')C(O)O--,
--OC(O)N(R')--, --S(O)--, --S(O).sub.2--, --S(O).sub.2N(R')--,
--N(R')S(O).sub.2--, --SC(O)--, --C(O)S--, --OC(O)--, and
--C(O)O--, wherein each variable is independently as defined and
described herein. 521. The composition or method of any one of the
preceding embodiments, wherein the lipid comprises an optionally
substituted C.sub.10-C.sub.40 saturated or partially unsaturated,
aliphatic chain. 522. The composition or method of any one of the
preceding embodiments, wherein the lipid comprises an optionally
substituted C.sub.10-C.sub.40 linear, saturated or partially
unsaturated, aliphatic chain. 523. The composition or method of any
one of the preceding embodiments, wherein the composition further
comprises one or more additional components selected from: a
polynucleotide, carbonic anhydrase inhibitor, a dye, an
intercalating agent, an acridine, a cross-linker, psoralene,
mitomycin C, a porphyrin, TPPC4, texaphyrin, Sapphyrin, a
polycyclic aromatic hydrocarbon phenazine, dihydrophenazine, an
artificial endonuclease, a chelating agent, EDTA, an alkylating
agent, a phosphate, an amino, a mercapto, a PEG, PEG-40K, MPEG,
[MPEG].sub.2, a polyamino, an alkyl, a substituted alkyl, a
radiolabeled marker, an enzyme, a hapten biotin, a
transport/absorption facilitator, aspirin, vitamin E, folic acid, a
synthetic ribonuclease, a protein, a glycoprotein, a peptide, a
molecule having a specific affinity for a co-ligand, an antibody, a
hormone, a hormone receptor, a non-peptidic species, a lipid, a
lectin, a carbohydrate, a vitamin, a cofactor, or a drug. 524. The
composition or method of any one of the preceding embodiments,
wherein the lipid comprises a C.sub.10-C.sub.80 linear, saturated
or partially unsaturated, aliphatic chain. 525. The composition or
method of any one of the preceding embodiments, wherein the
composition further comprises a linker linking the oligonucleotide
and the lipid, wherein the linker is selected from: an uncharged
linker; a charged linker; a linker comprising an alkyl; a linker
comprising a phosphate; a branched linker; an unbranched linker; a
linker comprising at least one cleavage group; a linker comprising
at least one redox cleavage group; a linker comprising at least one
phosphate-based cleavage group; a linker comprising at least one
acid-cleavage group; a linker comprising at least one ester-based
cleavage group; a linker comprising at least one peptide-based
cleavage group. 526. The composition or method of any one of the
preceding embodiments, wherein the oligonucleotide comprises or
consists of or is an oligonucleotide or oligonucleotide composition
or chirally controlled oligonucleotide composition. 527. The
composition or method of any one of the preceding embodiments,
wherein the oligonucleotide comprises or consists of or is an
oligonucleotide or oligonucleotide composition or chirally
controlled oligonucleotide composition, wherein the sequence of the
oligonucleotide comprises or consists of the sequence of any
oligonucleotide described herein. 528. The composition or method of
any one of the preceding embodiments, wherein the oligonucleotide
comprises or consists of or is an oligonucleotide or
oligonucleotide composition or chirally controlled oligonucleotide
composition, wherein the sequence of the oligonucleotide comprises
or consists of the sequence of any oligonucleotide listed in Table
4. 529. The composition or method of any one of the preceding
embodiments, wherein the oligonucleotide comprises or consists of
or is an oligonucleotide or oligonucleotide composition or chirally
controlled oligonucleotide composition, wherein the sequence of the
oligonucleotide comprises or consists of the sequence of a
splice-switching oligonucleotide. 530. The composition or method of
any one of the preceding embodiments, wherein the oligonucleotide
comprises or consists of or is an oligonucleotide or
oligonucleotide composition or chirally controlled oligonucleotide
composition, wherein the sequence of the oligonucleotide comprises
or consists of the sequence of an oligonucleotide capable of
skipping or mediating skipping of an exon in the dystrophin gene.
531. The composition or method of any of the preceding embodiments,
wherein the oligonucleotide is a chirally controlled
oligonucleotide composition. 532. The composition or method of any
of the preceding embodiments, wherein the disease or disorder is
Huntington's Disease. 533. The composition or method of any of the
preceding embodiments, wherein the oligonucleotide is capable of
participating in RNaseH-mediated cleavage of a mutant Huntingtin
gene mRNA. 534. The composition or method of any of the preceding
embodiments, wherein the oligonucleotide comprises, consists of or
is the sequence of any oligonucleotide disclosed herein. 535. The
composition or method of any of the preceding embodiments, wherein
the oligonucleotide is capable of differentiating between a
wild-type and a mutant Huntingtin allele. 536. The composition or
method of any of the preceding embodiments, wherein the
oligonucleotide is capable of participating in RNaseH-mediated
cleavage of a mutant Huntingtin gene mRNA. 537. The composition or
method of any of the preceding embodiments, wherein the
oligonucleotide comprises, consists of or is the sequence of any
oligonucleotide disclosed in Table 4. 538. The composition or
method of any one of the preceding embodiments, wherein the
oligonucleotide comprises or consists of or is an oligonucleotide
or oligonucleotide composition or chirally controlled
oligonucleotide composition, wherein the sequence of the
oligonucleotide comprises or consists of the sequence of any of:
WV-1092, WV-2595, or WV-2603. 539. The composition or method of any
one of the preceding embodiments, wherein the sequence of an
oligonucleotide includes any one or more of: base sequence
(including length); pattern of chemical modifications to sugar and
base moieties; pattern of backbone linkages; pattern of natural
phosphate linkages, phosphorothioate linkages, phosphorothioate
triester linkages, and combinations thereof; pattern of backbone
chiral centers; pattern of stereochemistry (Rp/Sp) of chiral
internucleotidic linkages; pattern of backbone phosphorus
modifications; pattern of modifications on the internucleotidic
phosphorus atom, such as --S--, and -L-R.sup.1 of formula I. 540.
An oligonucleotide comprising a sequence that shares greater than
about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% identity with a
sequence found in a provided example oligonucleotide. 540a. The
oligonucleotide of embodiment 540, wherein the sequence of the
oligonucleotide is the sequence of a provided example
oligonucleotide. 540b. The oligonucleotide of embodiment 540 or
540a, wherein the provided example oligonucleotide is an
oligonucleotide selected from Table N1A, N2A, N3A, N4A or 8. 541.
The oligonucleotide of embodiment 540, wherein the provided example
oligonucleotide is WV-1092. 542. The oligonucleotide of embodiment
540, wherein the provided example oligonucleotide is WV-2595. 543.
The oligonucleotide of embodiment 540, wherein the provided example
oligonucleotide is WV-2603 544. The oligonucleotide of any one of
the preceding embodiments, wherein the oligonucleotide comprises
the sequence found in the provided example oligonucleotide. 545.
The oligonucleotide of any one of the preceding embodiments,
wherein the oligonucleotide consists of the sequence found in the
provided example oligonucleotide. 546. An oligonucleotide of any
one of the preceding embodiments, wherein the oligonucleotide
comprises one or more natural phosphate linkages and one or more
modified internucleotidic linkages. 547. The oligonucleotide of
embodiment 546, wherein the oligonucleotide is an oligonucleotide
of any one of embodiments 540-545. 548. The oligonucleotide of any
one of the preceding embodiments, wherein the oligonucleotide
comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, or more natural phosphate
linkages. 549. The oligonucleotide of any one of the preceding
embodiments, wherein the oligonucleotide comprises one or more
modified internucleotidic linkages. 550. The oligonucleotide of any
one of the preceding embodiments, wherein the oligonucleotide
comprises two or more modified internucleotidic linkages. 551. The
oligonucleotide of any one of the preceding embodiments, wherein
the oligonucleotide comprises 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20 or more modified internucleotidic
linkages. 552. The oligonucleotide of any one of the preceding
embodiments, wherein the oligonucleotide comprises 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more modified
internucleotidic linkages. 553. The oligonucleotide of any one of
the preceding embodiments, wherein the oligonucleotide comprises 10
or more modified internucleotidic linkages. 554. The
oligonucleotide of any one of the preceding embodiments, wherein at
least one of the modified internucleotidic linkages is a chirally
controlled internucleotidic linkage in that oligonucleotides having
the same sequence and chemical modifications within a composition
share the same configuration, either Rp or Sp, at the chiral
phosphorus atom of the modified internucleotidic linkage. 555. The
oligonucleotide of any one of the preceding embodiments, wherein at
least two modified internucleotidic linkages are chirally
controlled. 556. The oligonucleotide of any one of the preceding
embodiments, wherein at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20 modified internucleotidic linkages are
chirally controlled. 557. The oligonucleotide of any one of the
preceding embodiments, wherein at least one modified
internucleotidic linkage within a consecutive modified
internucleotidic linkage region is chirally controlled. 558. The
oligonucleotide of any one of the preceding embodiments, wherein at
least two modified internucleotidic linkages within a consecutive
modified internucleotidic linkage region are
chirally controlled. 559. The oligonucleotide of any one of the
preceding embodiments, wherein at least 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20 modified internucleotidic
linkages within a consecutive modified internucleotidic linkage
region are chirally controlled. 560. The oligonucleotide of any one
of the preceding embodiments, wherein each modified
internucleotidic linkage within a consecutive modified
internucleotidic linkage region is chirally controlled. 561. The
oligonucleotide of any one of the preceding embodiments, wherein
each modified internucleotidic linkage is chirally controlled. 562.
The oligonucleotide of any one of the preceding embodiments,
wherein a provided oligonucleotide comprises a (Sp)xRp(Sp)y
pattern, wherein each of x and y is independently 1-20, and the sum
of x and y is 1-50. 563. The oligonucleotide of any one of the
preceding embodiments, wherein each of x and y is independently
2-20. 564. The oligonucleotide of any one of the preceding
embodiments, wherein at least one of x and y is greater than 5, 6,
7, 8, 9, or 10. 565. The oligonucleotide of any one of the
preceding embodiments, wherein the sum of x and y is greater than
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20. 566.
The oligonucleotide of any one of the preceding embodiments,
wherein a provided oligonucleotide comprises one or more chemical
modifications. 567. The oligonucleotide of any one of the preceding
embodiments, wherein a provided oligonucleotide comprises one or
more base modifications. 568. The oligonucleotide of any one of the
preceding embodiments, wherein a provided oligonucleotide comprises
one or more sugar modifications. 569. The oligonucleotide of any
one of the preceding embodiments, wherein a sugar modification is a
2'-modification. 570. The oligonucleotide of any one of the
preceding embodiments, wherein a sugar modification is LNA. 571.
The oligonucleotide of any one of the preceding embodiments,
wherein a provided oligonucleotide is a chirally controlled
oligonucleotide. 572. The oligonucleotide of any one of the
preceding embodiments, wherein the oligonucleotide is conjugated to
a targeting component. 573. A oligonucleotide composition,
comprising an oligonucleotide of any one of the preceding
embodiments. 573a. The composition of embodiment 573, wherein the
composition is a chirally controlled oligonucleotide composition
comprising a predetermined level of the oligonucleotide. 574. The
composition of any one of the preceding embodiments, or the
composition in the method of any one of the preceding embodiments,
further comprising a selectivity agent selected from: the group of
compounds which binds specifically to one or more neurotransmitter
transporters selected from the group consisting of a dopamine
transporter (DAT), a serotonin transporter (SERT), and a
norepinephrine transporter (NET); the group consisting of a
dopamine reuptake inhibitor (DRI), a selective serotonin reuptake
inhibitor (SSRI), a noradrenaline reuptake inhibitor (NRI), a
norepinephrine-dopamine reuptake inhibitor (NDRI), and a
serotonin-norepinephrine-dopamine reuptake inhibitor (SNDRI); the
group consisting of a triple reuptake inhibitor, a noradrenaline
dopamine double reuptake inhibitor, a serotonin single reuptake
inhibitor, a noradrenaline single reuptake inhibitor, and a
dopamine single reuptake inhibitor; and the group consisting of a
dopamine reuptake inhibitor (DRI), a Norepinephrine-Dopamine
Reuptake Inhibitor (NDRI) and a serotonin-Norepinephrine-Dopamine
Reuptake Inhibitor (SNDRI). 575. A method for treating or
preventing Huntington's Disease in a subject, comprising
administering to the subject an oligonucleotide or a composition of
any one of the preceding embodiments. 575a. A method of any one of
the preceding embodiments, wherein the oligonucleotide or
composition is administered via intrathecal administration. 576. A
method for preparing an oligonucleotide, comprising providing a
chiral reagent having the structure of Formula 3-AA. 577. A method
for preparing an oligonucleotide, comprising providing a chiral
reagent having the structure of
##STR00370##
578. The method of any one of the preceding embodiments, wherein
the chiral reagent is chirally pure. 579. A method for preparing an
oligonucleotide, comprising providing a compound comprising a
moiety from a chiral reagent having the structure of any one of the
preceding embodiments, wherein --W.sup.1H and --W.sup.2H, or the
hydroxyl and amino groups, form bonds with the phosphorus atom of
the phosphoramidite. 580. The method of embodiment 579, wherein the
compound has the structure of
##STR00371## ##STR00372## ##STR00373## ##STR00374##
581. The method of embodiment 580, wherein R connected to the 5'-O
is a hydroxyl protecting group. 582. The method of embodiment 581,
wherein the hydroxyl protecting group is DMTr. 583. The method of
embodiment 582, wherein B.sup.PRO is a protected nucleobase. 584.
The method of embodiment 583, wherein the nucleobase is an
optionally substituted nucleobase selected from A, T, C and G. 585.
The method of any one of the preceding embodiments, wherein W.sup.1
is --NG.sup.5, W.sup.2 is O. 586. The method of any one of the
preceding embodiments, wherein each of G.sup.1 and G.sup.3 is
independently hydrogen or an optionally substituted group selected
from C.sub.1-10 aliphatic, heterocyclyl, heteroaryl and aryl,
G.sup.2 is --C(R).sub.2Si(R).sub.3, and G.sup.4 and G.sup.5 are
taken together to form an optionally substituted saturated,
partially unsaturated or unsaturated heteroatom-containing ring of
up to about 20 ring atoms which is monocyclic or polycyclic, fused
or unfused. 587. The method of any one of the preceding
embodiments, wherein each R is independently hydrogen, or an
optionally substituted group selected from C.sub.1-C.sub.6
aliphatic, carbocyclyl, aryl, heteroaryl, and heterocyclyl. 588.
The method of any one of the preceding embodiments, wherein G.sup.1
is hydrogen. 589. The method of any one of the preceding
embodiments, wherein G.sup.2 is --C(R).sub.2Si(R).sub.3, wherein
--C(R).sub.2-- is optionally substituted --CH.sub.2--, and each R
of --Si(R).sub.3 is independently an optionally substituted group
selected from C.sub.1-10 aliphatic, heterocyclyl, heteroaryl and
aryl. 590. The method of any one of the preceding embodiments,
wherein at least one R of --Si(R).sub.3 is independently optionally
substituted C.sub.1-10 alkyl. 591. The method of any one of the
preceding embodiments, wherein at least one R of --Si(R).sub.3 is
independently optionally substituted phenyl. 592. The method of any
one of the preceding embodiments, wherein one R of --Si(R).sub.3 is
independently optionally substituted C.sub.1-10 alkyl, and each of
the other two R is independently optionally substituted phenyl.
593. The method of any one of the preceding embodiments, wherein
G.sup.2 is optionally substituted --CH.sub.2Si(Me)(Ph).sub.2. 594.
The method of any one of the preceding embodiments, wherein G.sup.2
is --CH.sub.2Si(Me)(Ph).sub.2. 595. The method of any one of the
preceding embodiments, wherein G.sup.3 is hydrogen. 596. The method
of any one of the preceding embodiments, wherein G.sup.4 and
G.sup.5 are taken together to form an optionally substituted
saturated 5-6 membered ring containing one nitrogen atom. 597. The
method of any one of the preceding embodiments, wherein G.sup.4 and
G.sup.5 are taken together to form an optionally substituted
saturated 5-membered ring containing one nitrogen atom. 598. The
method of any one of the preceding embodiments, wherein the chiral
reagent is
##STR00375##
599. The method of any one of the preceding embodiments, comprising
providing a fluoro-containing reagent. 600. The method of any one
of the preceding embodiments, wherein the fluoro-containing reagent
is TBAF. 601. The method of any one of the preceding embodiments,
comprising using a linker that is stable to a TBAF condition for
removing the chiral reagent. 602. The method of any one of the
preceding embodiments, wherein the linker is an SP linker. 603. The
method of any one of embodiments 576-599, wherein the
fluoro-containing reagent is HF--NR.sub.3. 604. The method of
embodiment 603, wherein the fluoro-containing reagent is
HF-NEt.sub.3. 605. The method of embodiment 603 or 604, comprising
using a linker that is stable to a HF--NR.sub.3 condition for
removing the chiral reagent. 606. The method of any one of
embodiments 603-605, wherein the linker is a succinyl linker.
EXAMPLES
[1824] The foregoing has been a description of certain non-limiting
embodiments of the disclosure. Accordingly, it is to be understood
that the embodiments of the disclosure herein described are merely
illustrative of the application of the principles of the
disclosure. Reference herein to details of the illustrated
embodiments is not intended to limit the scope of the claims.
Example 1. In Vitro Metabolic Stabilities of Human Chiromersens in
Preincubated Rat Whole Liver Homogenates
[1825] The present Example describes comparisons of in vitro whole
rat liver homogenate stability of Mipomersen (stereochemical
mixture) with chirally controlled oligonucleotide compositions of
Mipomersen ("chiromersens"). The method, among other things, is
useful in screening compounds to predict in vivo half lives.
[1826] As is known in the art, Mipomersen (previously ISIS 301012,
sold under the trade name Kynamro) is a 20mer oligonucleotide whose
base sequence is antisense to a portion of the apolipoprotein B
gene. Mipomersen inhibits apolipoprotein B gene expression,
presumably by targeting mRNA. Mipomersen has the following
structure:
TABLE-US-00029 (SEQ ID NO: 43)
G*-C*-C*-U*-C*-dA-dG-dT-dC-dT-dG-dmC-dT-dT-dmC-G*- C*-A*-C*-C* [d =
2'-deoxy, *= 2'-O-(2-methoxyethyl)]
with 3'.fwdarw.5' phosphorothioate linkages. Thus, Mipomersen has
2'-O-methoxyethyl-modified ribose residues at both ends, and
deoxyribose residues in the middle.
[1827] Tested chirally pure Mipomersen analogs described in this
Example included 3'.fwdarw.5' phosphorothioate linkages. In some
embodiments, tested analogs include one or more
2'-O-(2-methoxyethyl)-modified residues; in some embodiments,
tested analogs include only 2'-deoxy residues. Particular tested
analogs had the structures set forth below in Tables 3 and 4.
[1828] Protocol:
[1829] We used the protocol reported by Geary et al.
(Oligonucleotides, Volume 20, Number 6, 2010) with some
modifications.
[1830] Test System:
[1831] Six male Sprague-Dawley rats (Rattus norvegicus) were
supplied by Charles River Laboratories, Inc., (Hollister, Calif.),
and were received at SNBL USA.
[1832] Tissue Collection:
[1833] Animals were acclimated to the study room for two days prior
to tissue collection. At the time of tissue collection, animals
were anesthetized with an intraperitoneal (IP) injection of sodium
pentobarbital solution. Liver perfusion was performed using 500 mL
of chilled saline/animal, administered via the hepatic portal vein.
After perfusion, the livers were dissected and maintained on ice.
Livers were minced into small pieces then weighed.
[1834] Liver Homogenate Preparation:
[1835] The minced pieces of liver tissues were transferred to tared
50 mL centrifuge tubes and weighed. Chilled homogenization buffer
(100 mM Tris pH 8.0, 1 mM magnesium acetate, with
antibiotic-antimycotic agents) was added to each tube, such that
the tube(s) contained 5 mL of buffer per gram of tissue. Using a
QIAGEN TissueRuptor tissue homogenizer, the liver/buffer mixture
was homogenized while maintaining the tube on ice. The protein
concentration of the liver homogenate pool was determined using a
Pierce BCA protein assay. Liver homogenates were divided into 5 mL
aliquots, transferred to appropriately sized labeled cryovials and
stored at -60.degree. C.
[1836] Incubation Conditions:
[1837] 5 ml aliquots of frozen liver homogenate (protein
concentration=22.48 mg/ml) were thawed and incubated at 37.degree.
C. for 24 hrs. Six eppendorf tubes (2 ml) were taken for each
oligomer in table land 450 ul of homogenate was added in each tube.
50 ul ASO (200 uM) was added to each tube. Immediately after
mixing, 125 ul of (5.times.) stop buffer (2.5% IGEPAL, 0.5M NaCl, 5
mM EDTA, 50 mM Tris, pH=8.0) and 12.5 ul of 20 mg/ml Proteinase K
(Ambion, # AM2546) was added to one tube for 0 hour time point. The
remaining reaction mixtures were incubated at 37.degree. C. with
shaking at 400 rpm on VWR Incubating Microplate shaker. After
incubation for a designated period (1, 2, 3, 4, and 5 days), each
mixture was treated with 125 ul of (5.times.) stop buffer (2.5%
IGEPAL, 0.5M NaCl, 5 mM EDTA, 50 mM Tris, pH=8.0) and 12.5 ul of 20
mg/ml Proteinase K (Ambion, # AM2546).
[1838] Work up and Bioanalysis: ISIS 355868 (5'-GCGTTT {square root
over (GCTCTT)}CTTCTTGCGTTTTTT-3' (SEQ ID NO: 392)), a 27-mer
oligonucleotide (underlined bases are MOE modified) was used as the
internal standard for quantitation of chiromersens. 50 ul of
internal standard (200 uM) was added to each tube followed by
addition of 250 ul of 30% ammonium hydroxide, 800 ul of Phenol:
Chloroform: isoamyl alcohol (25:24:1). After mixing and
centrifugation at 600 rpg, the aqueous layer was evaporated on
speed vac to 100 ul and loaded on Sep Pak column (C18, 1 g, WAT
036905). All the aqueous washings (2.times.20 ml) of Sep pak column
were tested with quick Ion Exchange method to ensure that no
product was found there. 50% ACN (3.5 ml) was used to elute the
oligonucleotide and metabolites and the column was further washed
with 70% CAN (3.5) ensure that there was nothing left on the
column. Five fractions were collected for each sequence. Water wash
1, 2, 3, ACN1 and 2 using Visiprep system (Sigma, part number:
57031-U).
[1839] Ion Exchange Method
TABLE-US-00030 Time Flow (ml/min) % A % B Curve Time 1.0 95 5 1 2
1.0 95 5 1 2 3 1.0 75 25 6 3 10 1.0 35 65 6 4 10.1 1.0 95 5 6 5
12.5 1.0 95 5 1
Buffer A=10 mM Tris HCl, 50% ACN, pH=8.0
Buffer B=A+800 mM NaClO4
Column=DNA pac 100
Column Temperature 60.degree. C.
[1840] Wash method was used after each run (Described in M9-Exp21)
using the same buffers as above and 50:50 (methanol:water) in
buffer line C.
TABLE-US-00031 Time Flow (ml/min) % A % B % C Curve Time 1.0 0 0
100 1 5.5 1.0 0 0 100 1 2 5.6 1.0 100 0 0 6 3 7.5 1.0 100 0 0 6 4
7.6 1.0 95 5 0 6 5 12.5 1.0 95 5 0 1
Acetonitrile eluate was concentrated to dryness and dissolved in
100 ul water to be analyzed using RPHPIPC. Eluant A=10 mM
Tributylammonium acetate, pH=7.0 Eluant B=ACN (HPLC grade, B&
J) Column: XTerra MS C18, 3.5 um, 4.6.times.50 mm, Part number:
186000432 Guard column from Phenomenex, part number: KJ0-4282
Column Temperature=60.degree. C.
[1841] HPLC Gradient:
TABLE-US-00032 Time Flow (ml/min) % A % B Curve 1 1.0 65 35 2 5.0
1.0 65 35 1 3 30.0 1.0 40 60 6 4 35.0 1.0 5 90 6 5 36.0 1.0 65 35 6
6 40.0 1.0 65 35 1
For Analytical RP HPLC, 10 ul of this stock solution was added to
40 ul water and 40 ul was injected.
TABLE-US-00033 TABLE 3 S.NO. Sequence Description ONT- Gs5mCs5mCs
Ts5mCsAs GsTs5mCs TsGs5mCs TsTs5mCs Gs5mCsAs 5mCs5mC Mipomersen 41
(SEQ ID NO: 393) ONT-
Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsTs5mCsGs5mCsAs5mCs5mC MOE-wing-
87 (SEQ ID NO: 394) core-wing design - (human) RNAse H substrate 1
5R-(SSR).sub.3-5R ONT-
Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsTs5mCsGs5mCsAs5mCs5mC All
deoxy, (5S- 154 (SEQ ID NO: 395) (SSR).sub.3-5S) ONT-
Gs5mCsGsTsTsTsGs5mCsTs5mCsTsTs5mCsTsTs5mCsTsTsGs5mCGsTsTsTsTsTsT
ISIS 355868 70 (SEQ ID NO: 396) internal standard for quantitation
of Mipomersen
[1842] Discussion:
[1843] 2' modifications in antisense and siRNAs are predicted to
stabilize these molecules and increase their the persistence in
plasma and tissues compared with wild-type DNAs and siRNAs.
[1844] 2'-MOE Wing-Core-Wing Design in Mipomersen.
[1845] The first generation antisense oligonucleotides employed in
the first antisense clinical trials had 2'-deoxy ribonucleotide
residues and phosphorothioate internucleoside linkages.
Subsequently, second generation antisense oligonucleotides were
developed, which were typically of what is referred to herein as
"5-10-5 2'-MOE wing-core-wing design", in that five (5) residues at
each end were 2'-O-methoxyethyl (2'-MOE)-modified residues and ten
(10) residues in the middle were 2'-deoxy ribonucleotides; the
internucleotide linkages of such oligonucleotides were
phosphorothioates. Such "5-10-5 2'-MOE wing-core-wing"
oligonucleotides exhibited marked improvement in potency over first
generation (PCT/US2005/033837). Similar wing-core-wing motifs like
2-16-2, 3-14-3, 4-12-4, or 5-10-5 were designed to improve the
stability of oligonucleotides to nucleases, while at the same time
maintaining enough DNA structure for RNase activity.
[1846] Chirally pure oligonucleotides. The present disclosure
provides chirally pure oligonucleotides and demonstrates, among
other things, that selection of stereochemistry in and of itself
can improve oligonucleotide stability (i.e., independent of residue
modification such as 2'MOE modification). Indeed, the present
disclosure demonstrates that chirally pure phosphorothioate
oligonucleotides can provide same or better stability than
corresponding 2'-modified stereorandom phosphorothioate
compounds.
[1847] In some embodiments, tested chirally pure oligonucleotides
are of the general structure X--Y--X with respect to
stereochemistry in that they contain wing "X" regions (typically
about 1-10 residues long) where all residues have the same
stereochemistry flanking a core "Y" region in which stereochemistry
varies. In many embodiments, about 20-50% of the nucleotide analogs
in tested such oligonucleotides are not substrates for RNase H. The
ability to control the stereochemistry of phosphorothioates in DNA
enables us to protect the oligomers from degradation by nucleases
while maintaining the RNase active sites. One of these designs is
ONT-154 where wings of the oligonucleotide have been stabilized by
Sp phosphorothioate chemistry with retention of few Rp
phosphorothioates which are better substrates for RNase H
(Molecular Cell, 2007). The crystal structure of human RNase H
complexed with DNA/RNA duplex shows that the Phosphate-binding
pocket of the enzyme makes contacts with four contiguous phosphates
of DNA. The first three contacts seem stronger than fourth one and
they prefer Pro-R/Pro-R/Pro-S oxygen atoms of each of these three
phosphates. Combining the stability advantage coming from Sp
stereochemistry with RNase H active sites, several sequences can be
designed to compete with/or improve upon 2'-modifications. From rat
whole liver homogenate stability experiment comparing Mipomersen
(ONT-41) with our rational (chiral control) design with and without
2'-modifications (ONT-87 and ONT-154) (Table 1 and FIG. 1), it is
evident that through removal of the 2'-modifications and careful
chiral control with Rp and Sp phosphorothioates, we can improve the
stability of these oligonucleotides which later affect the efficacy
in vivo.
TABLE-US-00034 TABLE 4 Hu chiromersens studied for rat whole live
homogenate stability SEQ ID Sequence Description Target Tm
(.degree. C.) NO: ONT-41 Gs5mCs5mCs Ts5mCsAs GsTs5mCs TsGs5mCs Hu
ApoB 80.7 397 TsTs5mCs Gs5mCsAs 5mCs5mC ONT-75
Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTs Hu ApoB 85.0 398
Ts5mCsGs5mCsAs5mCs5mC ONT-77 Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTs
Hu ApoB 79.9 399 Ts5mCsGs5mCsAs5mCs5mC ONT-80
Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsT Hu ApoB 75.8 400
s5mCsGs5mCsAs5mCs5mC ONT-81 Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsT
Hu ApoB 80.7 401 s5mCsGs5mCsAs5mCs5mC ONT-87
Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsT Hu ApoB 82.4 402
s5mCsGs5mCsAs5mCs5mC ONT-88 Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsT
Hu ApoB 78.9 403 s5mCsGs5mCsAs5mCs5mC ONT-89
Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsT Hu ApoB 80.9 404
s5mCsGs5mCsAs5mCs5mC ONT-70 Gs5mCsGsTsTsTsGs5mCsTs5mCsTsTs5mCsTsTs
ISIS 405 5mCsTsTsGs5mCGsTsTsTsTsTsT 355868 internal standard
TABLE-US-00035 TABLE 5 Mouse chiromersens studied for rat whole
live homogenate stability SEQ ID Sequence Description Target NO:
ONT-83 GsTs5mCs5mCs5mCsTsGsAsAsGsAsTsGsTs5mCsAsAsTsGs5mC Mouse 406
ApoB ONT-82 GsTs5mCs5mCs5mCsTsGsAsAsGsAsTsGsTs5mCsAsAsTsGs5mC Mouse
407 ApoB ONT-84 GsTs5mCs5mCs5mCsTsGsAsAsGsAsTsGsTs5mCsAsAsTsGs5mC
Mouse 408 ApoB ONT-85
GsTs5mCs5mCs5mCsTsGsAsAsGsAsTsGsTs5mCsAsAsTsGs5mC Mouse 409 ApoB
ONT-86 GsTs5mCs5mCs5mCsTsGsAsAsGsAsTsGsTs5mCsAsAsTsGs5mC Mouse 410
ApoB
Example 2. Example Chirally Controlled siRNA Molecules
TABLE-US-00036 [1848] TABLE 1 Summary of Phosphodiester Polar
interactions with h-Ago-2 and h-Ago-1 Science 2012 hAgo-2
Phosphate* Residue Length/.ANG. Config 2 Asn551 2.7 Pro(S) Gln548
2.9 Pro(S) 3 Lys566 3.1 Pro(R) Arg792 3.4 Pro(R) 4 Tyr790 2.6
Pro(R) Arg792 3.0 Pro(R) 2.8 Pro(R) 3.4 Pro(S) 5 Ser798 2.7 Pro(R)
2.9 Pro(R) Tyr804 2.8 Pro(S) 6 Lys709 3.0 Pro(S) Arg761 2.9 Pro(R)
His753 2.8 Pro(R) 7 Arg714 2.9 Pro(R) 3.0 Pro(R) Arg761 3.0 Pro(S)
*Phosphate No. from 5'-end Cell 2012 hAgo-2 Phosphate Residue
Length/.ANG. Config 2 Asn551 2.7 Pro(S) Gln548 3.1 Pro(S) Gln548
2.9 Pro(R) 3 Lys566 2.9 Pro(R) Arg792 3.3 Pro(R) 4 Tyr790 2.8
Pro(R) Arg792 2.8 Pro(R) 5 Ser798 2.6 Pro(R) 2.9 Pro(R) Tyr804 2.5
Pro(S) 6 Lys709 3.2 Pro(S) Arg761 2.8 Pro(R) His753 3.0 Pro(R) 7
Arg714 2.8 Pro(R) 3.1 Pro(R) Arg761 2.8 Pro(S) 8 Arg761 2.4 Pro(S)
Ala221 3.5 Pro(R) 9 Arg351 2.2 Pro(R) 10 Arg710 2.5 Pro(R) 18 No
contacts 19 Tyr311 3.1 Pro(R) Arg315 2.8 Pro(R) 20 His271 3.1
Pro(R) His319 3.4 Pro(S) Tyr311 2.2 Pro(S) Cell Rep 2013,
h-Ago-1.sup..dagger. Phosphate Residue Length/.ANG. Config 2 Asn549
2.7 Pro(S) Gln546 2.9 Pro(S) 2.8 Pro(R) 2 Lys564 2.9 Pro(R) Arg790
3.4 Pro(R) 3.3 Pro(R) 4 Try788 2.7 Pro(R) Arg790 3.3 Pro(R) 5
Ser796 2.5 Pro(R) 2.8 Pro(R) Tyr802 2.6 Pro(S) 6 Lys707 2.8 Pro(S)
Arg759 2.7 Pro(R) His751 3.0 Pro(R) 7 Arg712 3.1 Pro(S) 3.3 Pro(S)
Arg373 3.4 Pro(R) Thr757 2.9 Pro(R) 8 Arg759 2.2 Pro(S) His710 3.4
Pro(R) Ser218 2.7 Pro(R) 9 Arg349 3.5 Pro(R) Arg708 2.9 Pro(S) 10
Arg708 3.2 Pro(R) 2.9 Pro(R) 21 Tyr309 2.6 Pro(S) Tyr314 2.6 Pro(S)
His269 3.0 Pro(R) .sup..dagger.Complexed with h-let-7 22mer
[1849] The present disclosure, despite teachings in the art to the
contrary, recognizes that stereochemistry of internucleotidic
linkages can be utilized to increase stability and activity of
oligonucleotides through chirally controlled oligonucleotide
compositions. Such chirally controlled oligonucleotide compositions
can provide much better results than chirally uncontrolled
oligonucleotide compositions as demonstrated in this
disclosure.
[1850] There are two reported crystal structures of RNA complexed
with human Argonaute-2 protein (hAgo2): The Crystal Structure of
Human Argonaute-2, Science, 2012 (PDB-4ei3); and The Structure of
Human Argonaute-2 in Complex with miR-20a Cell, 2012 PDB-4f3t). In
addition, there is one reported crystal structure of Let-7 RNA
complexed with human Argonaute-1 protein (hAgo-1): The Making of a
Slicer: Activation of Human Argonaute-1, Cell Rep. 2013
(PDB-4krf).
[1851] Based upon the information contained in these publications,
it was anticipated that some judgments could be made about
advantageous preferences for stereochemistry at the
internucleotidic phosphate linkage if the phosphodiester bonds were
to be replaced by phosphorothioate diester bonds. These advantages
could relate to significantly improved potency, stability and other
pharmacological properties. With this in mind, the computer program
Pymol was used to locate all polar interactions between the protein
and the internucleotidic phosphodiester linkage of the crystallized
RNA for all three structures. Polar interactions at a distance of
more than 3.5 A were ignored.
[1852] The results of this analysis are summarized in Table 1. A
particular phosphorus atom from the phosphodiester backbone on the
RNA was assigned a Pro(R) or a Pro(S) configuration based upon the
assumption that in the phosphorothioate diester analog the quite
similar bond would be made between the polar group on an amino acid
residue and the respectful phosphate oxygen atom. The sulfur
substitution, instead of non-bridging oxygen would therefore confer
a unique stereochemistry (either (Sp) or (Rp) absolute
configuration) on the phosphorus atom within that motif.
[1853] Of note is the extraordinarily good agreement between the
two structures of hAgo-2 in complex with RNA. Also, there is an
excellent agreement between the structures of hAgo-1 and hAgo-2 in
complex with RNA, indicating that the conformation that the RNA
molecule adopts is highly conserved between these two proteins. Any
conclusions or rules which are formed based upon the results of
this analysis are likely, therefore, to be valid for both protein
molecules.
[1854] As can be seen, there is usually more than one polar
interaction at any one phosphodiester group, with the exception of
those between the phosphodiesters at phosphate positions 9 and 10
and hAgo-2 (Cell 2012) which adopt exclusively Pro(Rp) preference
through bonding with Arg351 and Arg710 respectively.
[1855] However, shorter distances (corresponding to stronger
interactions) as well as the number of bonds per oxygen can suggest
a predominant interaction for the Pro(Rp) or the Pro(Sp) oxygens:
hence resulting in several interactions which are predominantly of
one stereochemical type or the other. Within this group are the
interactions between the phosphodiesters at phosphate positions 2
(Sp), 3 (Rp), 4 (Rp), 6 (Rp), 8 (Sp), 19 (Rp), 20 (Sp) and 21
(Sp).
[1856] Of the remaining interactions, there does not appear to be a
preference for one particular stereochemistry to be adopted over
the other, so the preferred stereochemistry could be either (Sp) or
(Rp).
[1857] Within this category are the interactions formed between the
phosphodiesters at phosphate positions 5 (Rp or Sp) and 7 (Rp or
Sp).
[1858] For interactions at the other phosphate backbone, there is
no crystal structure information, so stereochemistry at these
positions can similarly be either (Rp) or (Sp) until empirical data
shows otherwise.
[1859] To this end, Table 6 contains several non-limiting example
siRNA general constructs which can be conceived to take advantage
of this preference for stereochemistry at individual
phosphorothioate diester motifs.
TABLE-US-00037 TABLE 6 Example general siRNA constructs PS*
Chirally Controlled Antisense Strand Construct 2 (Sp) (Rp) (Sp)
(Rp) (Sp) (Rp) 3 (Rp) (Sp) (Rp) (Sp) (Rp) (Sp) 4 (Rp) (Sp) PO PO
(Rp) (Sp) 5 (Rp) or (Sp) (Sp) or (Rp) PO PO PO PO 6 (Rp) (Sp) PO PO
(Rp) (Sp) 7 (Rp) or (Sp) (Sp) or (Rp) PO PO PO PO 8 (Sp) (Rp) PO PO
(Sp) (Rp) 9 (Rp) (Sp) PO PO (Rp) (Sp) 10 (Rp) (Sp) PO PO (Rp) (Sp)
11 (Rp) or (Sp) (Sp) or (Rp) PO PO PO PO 12 (Rp) or (Sp) (Sp) or
(Rp) PO PO PO PO 13 (Rp) or (Sp) (Sp) or (Rp) PO PO PO PO 14 (Rp)
or (Sp) (Sp) or (Rp) PO PO PO PO 15 (Rp) or (Sp) (Sp) or (Rp) PO PO
PO PO 16 (Rp) or (Sp) (Sp) or (Rp) PO PO PO PO 17 (Rp) or (Sp) (Sp)
or (Rp) PO PO PO PO 18 (Rp) or (Sp) (Sp) or (Rp) PO PO PO PO 19
(Rp) (Sp) PO PO (Rp) (Sp) 20 (Sp) (Rp) (Sp) (Rp) (Sp) (Rp) 21 (Sp)
(Rp) (Sp) (Rp) (Sp) (Rp) *The number indicates the phosphate
position from the 5' end of the antisense strand of the siRNA,
(e.g. #2 is located between nucleotides 1 and 2 and #21 is located
between nucleotides 20 and 21). (Sp) and (Rp) designates
stereochemistry of phosphorus atom on phosphorothioate (PS) diester
internucleotidic linkage at the indicated position. PO designates a
phosphodiester internucleotidic linkage at the indicated
position.
[1860] Example siRNAs include but are not limited to siRNAs having
a Sp configuration for a chiral phosphorothioate at the 3'end and
at the 5'end of the antisense strand of the siRNA duplex, which
confers unprecedentedly increased stability in human serum or
biological fluids. That same Sp configuration for the chiral
phosphorothioate at the 3'end and at the 5'end of the antisense
strand of the siRNA duplex confers unprecedentedly increased
biological potency caused by increased affinity to the Ago2 protein
leading to increased activity within the RISC RNAi silencing
complex.
[1861] In one embodiment, a single chiral phosphorothioate motif is
introduced independently at each position along the antisense or
sense strand of the siRNA molecule. For a 21mer, this provides 80
unique sequences, with either an (Sp) or an (Rp) chirally
controlled phosphorothioate group. When duplexed independently,
1600 unique combinations of siRNAs are prepared.
siRNA Transfection of Chiral siRNA Molecules
[1862] Hep3B, or HeLa cells are reverse transfected at a density of
2.0.times.10.sup.4 cells/well in 96-well plates. Transfection of
siRNA is carried out with lipofectamine RNAiMax (Life Technologies,
cat. No. 13778-150) using the manufacturer's protocol, except with
a decreased amount of Lipofectamine RNAiMax of 0.2 ul per well.
Twelve, 1:3 siRNA duplex dilutions are created starting at 1 uM. 10
ul of 10.times.siRNA duplex is then lipoplexed with a prepared
mixture of 9.8 ul of serum-free medium and 0.2 ul of Lipofectamine
RNAiMax per well. After a 10-15 minute incubation,
2.0.times.10.sup.4 cells in 80 ul of EMEM cell growing media (ATCC,
30-2003) is added to bring the final volume to 100 ul per well. Two
separate transfection events are performed for each dose.
[1863] 24 hours after transfection Hep3B or HeLa cells are lysed
and mRNA against which the siRNA is targeted is purified using
MagMAX.TM.-96 Total RNA Isolation Kit (Life Technologies, AM1830);
15 ul of cDNA is synthesized with High Capacity cDNA Reverse
Transcription Kit with RNase Inhibitor (Life Technologies,
4374967). Gene expression is evaluated by Real-Time PCR on a
Lightcycler 480(Roche) using a Probes Master Mix (Roche, 04 707 494
001) according to manufacturer's protocol.
IC50s and Data Analysis
[1864] Delta Ct method is used to calculate values. Samples are
normalized to hGAPDH and calibrated to mock transfected and
untreated samples. A stereo-random molecule is used as a control.
The data is represented as a mean of 2 biological replicates using
Graphpad Prism. A four-parameter linear regression curve is fitted
to the data and the bottom and top are constrained to a 0 and 100
constants respectively in order to calculate a relative IC50.
[1865] The present Example demonstrates successful inhibition of
target gene expression using siRNA agents comprised of chirally
controlled oligonucleotides as described herein. Specifically, this
Example describes hybridization of individual oligonucleotide
strands prepared through chirally controlled synthesis as described
herein, so that double-stranded chirally controlled siRNA
oligonucleotide compositions are provided. This Example further
demonstrates successful transfection of cells with such agents and,
moreover, successful inhibition of target gene expression.
In Vitro Metabolic Stabilities of Human PCSK9 siRNA Duplexes Having
Stereocontrolled Phosphorothioate Diester Linkages in Human
Serum.
[1866] 10 .mu.M siRNA duplexes were incubated in 90% human serum
(50 .mu.L, Sigma, H4522) at 37.degree. C. for 24 hours. A 0 min
time point (50 .mu.L) was prepared as well as a PBS control
incubation time point (50 .mu.L), where the 10 .mu.M siRNA duplex
was incubated in 90% 1.times.PBS (50 .mu.L at 37.degree. C. for 24
hours. After completion of the incubation, to each time point, were
added 10 .mu.L of Stop-Solution (0.5 M NaCl, 50 mM TRIS, 5 mM EDTA,
2.5% IGEPAL), followed by 3.2 .mu.L of Proteinase K (20 mg/mL,
Ambion). The samples were incubated at 60.degree. C. for 20 min,
and then centrifuged at 2000 rpm for 15 min. The final reaction
mixtures were directly analyzed in denaturing IEX HPLC (injection
volume 50 .mu.L). The ratio of integrated area at 24 h and 0 min
was used to determine the % of degradation for each siRNA.
[1867] It was observed that the stereochemistry configuration of
the single phosphorothioate at position 21 (3'end) of both the
antisense strand and the sense strand of the siRNA had a crucial
impact on the stability of the duplex upon incubation in Human
Serum (FIG. 1). As illustrated in the FIG. 1 and as determined
following the integration ratio of the degradation pattern, an (Rp,
Rp) siRNA duplex exhibited a significant 55.0% degradation after 24
h. The stereorandom mixture of phosphorothioates in the
stereorandom siRNA showed 25.2% degradation after 24 h. The (Sp/Sp)
siRNA showed only minor 7.3% degradation after 24 h. This
illustrates the drastic impact that phosphorothioate
stereochemistry confers to therapeutic siRNAs. Additional example
data were presented in FIG. 2, FIG. 3, FIG. 4 and FIG. 5.
[1868] It is observed that each of the stereopure constructs show
different potency (IC.sub.50 values) dependent on the position of
the phosphorothioate motif along the backbone. It is also
observered that different IC.sub.50 values are obtained dependent
upon whether the phosphorothioate motif at any single position is
(Sp) or (Rp). The impact of stereochemistry upon stability is
likewise clear and differentiating, using either Human Serum
described above, or Human Hepatic Cytosol extract or Snake Venom
Phosphodiesterase, or isolated endonuclease or isolated
exonuclease.
[1869] Certain design rules may be formulated based upon data
obtained in the above example. These design information can be
applied for the introduction of multiple chiral phosphorothioate
linkages within the antisense and/or sense strand of the siRNA as
exemplified below. The present disclosure recognizes that an
increased amount of chiral phosphorothioate within the antisense
and/or sense strand of the siRNA, introduced at the right positions
and having the right stereochemistry configuration leads to greatly
improved siRNA constructs in terms of potency and metabolic
stability in vitro--translating into greatly pharmacologically
enhanced therapeutic siRNAs.
Example Chirally Controlled siRNA Oligonucleotides Targeting
PCSK9
[1870] Proprotein convertase subtilisin/kexin type 9 (PCSK9), is an
enzyme involved in cholesterol metabolism. PCSK9 binds to the
receptor for low density lipoprotein (LDL), triggering its
destruction. Although LDL associated with the receptor is also
eliminated when the receptor is destroyed, the net effect of PCSK9
binding in fact increases LDL levels, as the receptor would
otherwise cycle back to the cell surface and remove more
cholesterol.
[1871] Several companies are developing therapeutic agents that
target PCSK9. Of particular relevance to the present disclosure,
each of Isis Pharmaceuticals, Santaris Pharma, and Alnylam
Pharmaceuticals is developing a nucleic acid agent that inhibits
PCSK9. The Isis Pharmaceuticals product, an antisense
oligonucleotide, has been shown to increase expression of the LDLR
and decrease circulating total cholesterol levels in mice (Graham
et al "Antisense inhibition of proprotein convertase
subtilisin/kexin type 9 reduces serum LDL in hyperlipidemic mice".
J. Lipid Res. 48 (4): 763-7, April 2007). Initial clinical trials
with the Alnylam Pharmaceuticals product, ALN-PCS, reveal that RNA
interference offers an effective mechanism for inhibiting PCSK9
(Frank-Kamenetsky et al "Therapeutic RNAi targeting PCSK9 acutely
lowers plasma cholesterol in rodents and LDL cholesterol in
nonhuman primates". Proc. Natl. Acad. Sci. U.S.A. 105 (33):
11915-20, August 2008).
[1872] In some embodiments, despite known results to the contrary,
the present disclosure recognizes that phosphorothioate motifs of
one stereochemical conformation or another can be rationally
designed to take advantage of increased potency, stability and
other pharmacological qualities through chirally controlled
oligonucleotide compositions. To reinforce this concept, table 3
contains example stereochemically pure constructs based on an siRNA
sequence which targets PCSK9 messenger RNA.
[1873] In this example embodiment, a single chiral phosphorothioate
motif is introduced independently at each position along the
antisense or sense strand of the siRNA molecule. For a 21mer, this
provides 80 unique sequences, with either an (Sp) or an (Rp)
chirally controlled phosphorothioate group. When duplexed
independently, 1600 unique combinations of siRNAs are prepared.
[1874] In other example embodiments, a single chiral
phosphorothioate motif is introduced independently at each position
along the antisense or sense strand of the siRNA molecule, while a
3'-(Sp) phosphorothioate linkage is conserved. For a 21mer, this
provides another additional 80 unique sequences, with either an
(Sp) or an (Rp) chirally controlled phosphorothioate group. When
duplexed independently, 1600 unique combinations of siRNAs are
prepared.
[1875] In other example embodiments, multiple chiral
phosphorothioate motifs are introduced independently at several
positions along the antisense or sense strand of the siRNA
molecule, following the codes described in Table 7, while a 3'-(Sp)
phosphorothioate linkage is conserved.
TABLE-US-00038 TABLE 7 Example of PCSK-9 Sense and Antisense RNAs
SEQ PCSK9 siRNA Sense Strands ID NO: PCSK9 (1)
(Rp)-uucuAGAccuGuuuuGcuudTsdT 411 PCSK9 (2)
(Sp)-uucuAGAccuGuuuuGcuudTsdT 412 PCSK9 (3)
(Rp)-uucuAGAccuGuuuuGcuusdTdT 413 PCSK9 (4)
(Sp)-uucuAGAccuGuuuuGcuusdTdT 414 PCSK9 (5)
(Rp)-uucuAGAccuGuuuuGcusudTdT 415 PCSK9 (6)
(Sp)-uucuAGAccuGuuuuGcusudTdT 416 PCSK9 (7)
(Rp)-uucuAGAccuGuuuuGcsuudTdT 417 PCSK9 (8)
(Sp)-uucuAGAccuGuuuuGcsuudTdT 418 PCSK9 (9)
(Rp)-uucuAGAccuGuuuuGscuudTdT 419 PCSK9 (10)
(Sp)-uucuAGAccuGuuuuGscuudTdT 420 PCSK9 (11)
(Rp)-uucuAGAccuGuuuusGcuudTdT 421 PCSK9 (12)
(Sp)-uucuAGAccuGuuuusGcuudTdT 422 PCSK9 (13)
(Rp)-uucuAGAccuGuuusuGcuudTdT 423 PCSK9 (14)
(Sp)-uucuAGAccuGuuusuGcuudTdT 424 PCSK9 (15)
(Rp)-uucuAGAccuGuusuuGcuudTdT 425 PCSK9 (16)
(Sp)-uucuAGAccuGuusuuGcuudTdT 426 PCSK9 (17)
(Rp)-uucuAGAccuGusuuuGcuudTdT 427 PCSK9 (18)
(Sp)-uucuAGAccuGusuuuGcuudTdT 428 PCSK9 (19)
(Rp)-uucuAGAccuGsuuuuGcuudTdT 429 PCSK9 (20)
(Sp)-uucuAGAccuGsuuuuGcuudTdT 430 PCSK9 (21)
(Rp)-uucuAGAccusGuuuuGcuudTdT 431 PCSK9 (22)
(Sp)-uucuAGAccusGuuuuGcuudTdT 432 PCSK9 (23)
(Rp)-uucuAGAccsuGuuuuGcuudTdT 433 PCSK9 (24)
(Sp)-uucuAGAccsuGuuuuGcuudTdT 434 PCSK9 (25)
(Rp)-uucuAGAcscuGuuuuGcuudTdT 435 PCSK9 (26)
(Sp)-uucuAGAcscuGuuuuGcuudTdT 436 PCSK9 (27)
(Rp)-uucuAGAsccuGuuuuGcuudTdT 437 PCSK9 (28)
(Sp)-uucuAGAsccuGuuuuGcuudTdT 438 PCSK9 (29)
(Rp)-uucuAGsAccuGuuuuGcuudTdT 439 PCSK9 (30)
(Sp)-uucuAGsAccuGuuuuGcuudTdT 440 PCSK9 (31)
(Rp)-uucuAsGAccuGuuuuGcuudTdT 441 PCSK9 (32)
(Sp)-uucuAsGAccuGuuuuGcuudTdT 442 PCSK9 (33)
(Rp)-uucusAGAccuGuuuuGcuudTdT 443 PCSK9 (34)
(Sp)-uucusAGAccuGuuuuGcuudTdT 444 PCSK9 (35)
(Rp)-uucsuAGAccuGuuuuGcuudTdT 445 PCSK9 (36)
(Sp)-uucsuAGAccuGuuuuGcuudTdT 446 PCSK9 (37)
(Rp)-uuscuAGAccuGuuuuGcuudTdT 447 PCSK9 (38)
(Sp)-uuscuAGAccuGuuuuGcuudTdT 448 PCSK9 (38)
(Rp)-usucuAGAccuGuuuuGcuudTdT 449 PCSK9 (40)
(Sp)-usucuAGAccuGuuuuGcuudTdT 450 NOTE: lower case letters
represent 2'-OMe RNA residues; capital letters represent RNA
residues; d = 2'-deoxy residues; and "s" indicates a
phosphorothioate moiety.
[1876] Synthesis examples for Human PCSK9 siRNA Antisense Strands
having several chiral phosphorothioate internucleotide linkages and
full chiral phosphorothioate internucleotide linkages.
TABLE-US-00039 Human PCSK9 siRNA Antisense Strands SEQ ID NO: PCSK9
(41) (Rp)-AAGcAAAAcAGGUCuAGAAdTsdT 451 PCSK9 (42)
(Sp)-AAGcAAAAcAGGUCuAGAAdTsdT 452 PCSK9 (43)
(Rp)-AAGcAAAAcAGGUCuAGAAsdTdT 453 PCSK9 (44)
(Sp)-AAGcAAAAcAGGUCuAGAAsdTdT 454 PCSK9 (45)
(Rp)-AAGcAAAAcAGGUCuAGAsAdTdT 455 PCSK9 (46)
(Sp)-AAGcAAAAcAGGUCuAGAsAdTdT 456 PCSK9 (47)
(Rp)-AAGcAAAAcAGGUCuAGsAAdTdT 457 PCSK9 (48)
(Sp)-AAGcAAAAcAGGUCuAGsAAdTdT 458 PCSK9 (49)
(Rp)-AAGcAAAAcAGGUCuAsGAAdTdT 459 PCSK9 (50)
(Sp)-AAGcAAAAcAGGUCuAsGAAdTdT 460 PCSK9 (51)
(Rp)-AAGcAAAAcAGGUCusAGAAdTdT 461 PCSK9 (52)
(Sp)-AAGcAAAAcAGGUCusAGAAdTdT 462 PCSK9 (53)
(Rp)-AAGcAAAAcAGGUCsuAGAAdTdT 463 PCSK9 (54)
(Sp)-AAGcAAAAcAGGUCsuAGAAdTdT 464 PCSK9 (55)
(Rp)-AAGcAAAAcAGGUsCuAGAAdTdT 465 PCSK9 (56)
(Sp)-AAGcAAAAcAGGUsCuAGAAdTdT 466 PCSK9 (57)
(Rp)-AAGcAAAAcAGGsUCuAGAAdTdT 467 PCSK9 (58)
(Sp)-AAGcAAAAcAGGsUCuAGAAdTdT 468 PCSK9 (59)
(Rp)-AAGcAAAAcAGsGUCuAGAAdTdT 469 PCSK9 (60)
(Sp)-AAGcAAAAcAGsGUCuAGAAdTdT 470 PCSK9 (61)
(Rp)-AAGcAAAAcAsGGUCuAGAAdTdT 471 PCSK9 (62)
(Sp)-AAGcAAAAcAsGGUCuAGAAdTdT 472 PCSK9 (63)
(Rp)-AAGcAAAAcsAGGUCuAGAAdTdT 473 PCSK9 (64)
(Sp)-AAGcAAAAcsAGGUCuAGAAdTdT 474 PCSK9 (65)
(Rp)-AAGcAAAAscAGGUCuAGAAdTdT 475 PCSK9 (66)
(Sp)-AAGcAAAAscAGGUCuAGAAdTdT 476 PCSK9 (67)
(Rp)-AAGcAAAsAcAGGUCuAGAAdTdT 477 PCSK9 (68)
(Sp)-AAGcAAAsAcAGGUCuAGAAdTdT 478 PCSK9 (69)
(Rp)-AAGcAAsAAcAGGUCuAGAAdTdT 479 PCSK9 (70)
(Sp)-AAGcAAsAAcAGGUCuAGAAdTdT 480 PCSK9 (71)
(Rp)-AAGcAsAAAcAGGUCuAGAAdTdT 481 PCSK9 (72)
(Sp)-AAGcAsAAAcAGGUCuAGAAdTdT 482 PCSK9 (73)
(Rp)-AAGcsAAAAcAGGUCuAGAAdTdT 483 PCSK9 (74)
(Sp)-AAGcsAAAAcAGGUCuAGAAdTdT 484 PCSK9 (75)
(Rp)-AAGscAAAAcAGGUCuAGAAdTdT 485 PCSK9 (76)
(Sp)-AAGscAAAAcAGGUCuAGAAdTdT 486 PCSK9 (77)
(Rp)-AAsGcAAAAcAGGUCuAGAAdTdT 487 PCSK9 (78)
(Sp)-AAsGcAAAAcAGGUCuAGAAdTdT 488 PCSK9 (77)
(Rp)-AsAGcAAAAcAGGUCuAGAAdTdT 489 PCSK9 (78)
(Sp)-AsAGcAAAAcAGGUCuAGAAdTdT 490 PCSK9 (79) (Rp,
Sp)-AAGcAAAAcAGGUCuAGAAsdTsdT 491 PCSK9 (80) (Sp,
Sp)-AAGcAAAAcAGGUCuAGAAsdTsdT 492 PCSK9 (81) (Rp,
Sp)-AAGcAAAAcAGGUCuAGAsAdTsdT 493 PCSK9 (82) (Sp,
Sp)-AAGcAAAAcAGGUCuAGAsAdTsdT 494 PCSK9 (83) (Rp,
Sp)-AAGcAAAAcAGGUCuAGsAAdTsdT 495 PCSK9 (84) (Sp,
Sp)-AAGcAAAAcAGGUCuAGsAAdTsdT 496 PCSK9 (85) (Rp,
Sp)-AAGcAAAAcAGGUCuAsGAAdTsdT 497 PCSK9 (86) (Sp,
Sp)-AAGcAAAAcAGGUCuAsGAAdTsdT 498 PCSK9 (87) (Rp,
Sp)-AAGcAAAAcAGGUCusAGAAdTsdT 499 PCSK9 (88) (Sp,
Sp)-AAGcAAAAcAGGUCusAGAAdTsdT 500 PCSK9 (89) (Rp,
Sp)-AAGcAAAAcAGGUCsuAGAAdTsdT 501 PCSK9 (90) (Sp,
Sp)-AAGcAAAAcAGGUCsuAGAAdTsdT 502 PCSK9 (91) (Rp,
Sp)-AAGcAAAAcAGGUsCuAGAAdTsdT 503 PCSK9 (92) (Sp,
Sp)-AAGcAAAAcAGGUsCuAGAAdTsdT 504 PCSK9 (93) (Rp,
Sp)-AAGcAAAAcAGGsUCuAGAAdTsdT 505 PCSK9 (94) (Sp,
Sp)-AAGcAAAAcAGGsUCuAGAAdTsdT 506 PCSK9 (95) (Rp,
Sp)-AAGcAAAAcAGsGUCuAGAAdTsdT 507 PCSK9 (96) (Sp,
Sp)-AAGcAAAAcAGsGUCuAGAAdTsdT 508 PCSK9 (97) (Rp,
Sp)-AAGcAAAAcAsGGUCuAGAAdTsdT 509 PCSK9 (98) (Sp,
Sp)-AAGcAAAAcAsGGUCuAGAAdTsdT 510 PCSK9 (99) (Rp,
Sp)-AAGcAAAAcsAGGUCuAGAAdTsdT 511 PCSK9 (100) (Sp,
Sp)-AAGcAAAAcsAGGUCuAGAAdTsdT 512 PCSK9 (101) (Rp,
Sp)-AAGcAAAAscAGGUCuAGAAdTsdT 513 PCSK9 (102) (Sp,
Sp)-AAGcAAAAscAGGUCuAGAAdTsdT 514 PCSK9 (103) (Rp,
Sp)-AAGcAAAsAcAGGUCuAGAAdTsdT 515 PCSK9 (104) (Sp,
Sp)-AAGcAAAsAcAGGUCuAGAAdTsdT 516 PCSK9 (105) (Rp,
Sp)-AAGcAAsAAcAGGUCuAGAAdTsdT 517 PCSK9 (106) (Sp,
Sp)-AAGcAAsAAcAGGUCuAGAAdTsdT 518 PCSK9 (107) (Rp,
Sp)-AAGcAsAAAcAGGUCuAGAAdTsdT 519 PCSK9 (108) (Sp,
Sp)-AAGcAsAAAcAGGUCuAGAAdTsdT 520 PCSK9 (109) (Rp,
Sp)-AAGcsAAAAcAGGUCuAGAAdTsdT 521 PCSK9 (110) (Sp,
Sp)-AAGcsAAAAcAGGUCuAGAAdTsdT 522 PCSK9 (111) (Rp,
Sp)-AAGscAAAAcAGGUCuAGAAdTsdT 523 PCSK9 (112) (Sp,
Sp)-AAGscAAAAcAGGUCuAGAAdTsdT 524 PCSK9 (113) (Rp,
Sp)-AAsGcAAAAcAGGUCuAGAAdTsdT 525 PCSK9 (114) (Sp,
Sp)-AAsGcAAAAcAGGUCuAGAAdTsdT 526 PCSK9 (115) (Rp,
Sp)-AsAGcAAAAcAGGUCuAGAAdTsdT 527 PCSK9 (116) (Sp,
Sp)-AsAGcAAAAcAGGUCuAGAAdTsdT 528 PCSK9 (117) (Rp, Sp, Sp, Sp, Rp,
Sp, Sp, Sp, Rp, Rp)- 529 AsAsGscAsAAsAscsAGGUCuAGAsAsdTsdT PCSK9
(118) (Sp, Rp, Rp, Rp, Sp, Rp, Rp, Rp, Sp, Sp)- 530
AsAsGscAsAAsAscsAGGUCuAGAsAsdTsdT NOTE: lower case letters
represent 2'-OMe RNA residues; capital letters represent RNA
residues; d = 2'-deoxy residues; and "s" indicates a
phosphorothioate moiety.
Example 3. Stereopure FOXO--1 Antisense Analogs
Rational Design--Chirally Controlled Antisense Oligonucleotide
Compositions
[1877] The unprecedented nuclease stability determined in vivo and
in a whole rat liver homogenate model of the Sp-chiral
phosphorothioate internucleotide linkage is applied in the novel
design of new types of RNaseH substrate gapmers, whereby the
external flanks are composed of unmodified DNA and the internal gap
core is modified with 2' chemical modifications (2'OMe, 2'MOE,
2'LNA, 2'F, etc). Eventually this design is extended to fully
unmodified DNA therapeutic oligonucleotides wherein careful chiral
control of the phosphorothioate backbone confers the desired
pharmacological properties of the RNaseH therapeutic
oligonucleotide.
[1878] The application of the triplet-phosphate repeating motif
designed after studying the crystal structure of human RNaseH has
been employed as well. The crystal structure of RNaseH has been
previously published (Structure of Human RNase H1 Complexed with an
RNA/DNA Hybrid: Insight into HIV Reverse Transcription, Nowotny et
al., Molecular Cell, Volume 28, Issue 2, 264-276, 2007, pdb file: 2
qkb). Among other things, the present disclosure recognizes the
importance of internucleotidic linkage stereochemistry of
oligonucleotides, for example, in settings herein. Upon performing
in silico analysis upon this structure using the program Pymol,
Applicant found that the phosphate-binding pocket of Human RNase H1
makes polar contacts with three contiguous phosphates of the
complexed DNA, and interacts preferentially with the
Pro-R/Pro-R/Pro-S(or with the Pro-S/Pro-S/Pro-R) respective oxygen
atoms of each of these three phosphates. Based on this observation
we designed two chiral architectures with repeating (RRS) and (SSR)
triplet phosphorothioates motifs as designed RNase H substrates.
Applicant also designed other internucleotidic linkage
stereochemical patterns. As demonstrated by example results provide
herein, provided chirally controlled oligonucleotide compositions
of oligonucleotide types that comprises certain backbone
internucleotidic linkage patterns (patterns backbone chiral
centers) provides significantly increased activity and/or kinetics.
Among others, a sequence of 5'-RSS-3' backbone chiral centers is
particularly useful and delivers unexpected results as described in
the present disclosure.
[1879] The combination of increased Sp chiral backbone (for
enzymatic stability and other pharmacologically advantageous
properties) and (RRS) or (SSR) repeating triplet chiral backbone
motifs (for enhancing the property as RNase H substrate) are also
utilized in the novel designs.; "S" represents Sp-phosphorothioate
linkage and "R" represents Rp-phosphorothioate linkage.
[1880] Another alternative design is based on the increased amount
of Sp chiral phosphorothioate backbone in extended repeating motifs
such as: (SSSR).sub.n, SR(SSSR).sub.n, SSR(SSSR).sub.n,
SSR(SSSR).sub.n; (SSSSR).sub.n, SR(SSSSR).sub.n, SSR(SSSSR).sub.n,
SSR(SSSSR).sub.n, SSSR(SSSSR).sub.n; (SSSSSR).sub.n;
SR(SSSSSR).sub.n, SSR(SSSSSR).sub.n, SSR(SSSSSR).sub.n,
SSSR(SSSSSR).sub.n, SSSSR(SSSSSR).sub.n; etc., where n=0-50,
depending on the number of respective internucleotide linkages.;
"S" represents Sp-phosphorothioate linkage and "R" represents
Rp-phosphorothioate linkage. In some embodiments, n is 0. In some
embodiments, R is 1-50. In some embodiments, R is 1. In some
embodiments, a common pattern of backbone chiral centers of a
provided chirally controlled oligonucleotide composition comprises
a motif described herein. In some embodiments, a motif is in the
core region. In some embodiments, n is 0. In some embodiments, R is
1-50. In some embodiments, R is 1. In some embodiments, n is 2. In
some embodiments, n is 3. In some embodiments, n is 4. In some
embodiments, n is 5.
[1881] Another alternative design is based on the "invert"
architecture design of the stereo backbone ("stereo invert-mers").
These result from positioning the stereochemistry of the chiral
phosphorothioate in a inverting manner, exposing some Sp-rich
motifs at the 5' and 3' end extremities of the oligonucleotide as
well as the middle portion of the oligonucleotide and having the
repeating stereochemistry motifs positioned in a invert image
manner on both sides, such as:
SS(SSR).sub.n(SSS)(RSS).sub.nSS; SS(SSR).sub.n(SRS)(RSS).sub.nSS;
SS(SSR).sub.n(SSR)(RSS).sub.nSS; SS(SSR).sub.n(RSS)(RSS).sub.nSS;
SS(RSS).sub.n(SSS)(SSR).sub.nSS; SS(RSS).sub.n(SRS)(SSR).sub.nSS;
SS(RSS).sub.n(SSR)(SSR).sub.nSS; SS(RSS).sub.n(RSS)(SSR).sub.nSS;
etc., where n=0-50, depending on the number of respective
internucleotide linkages. "S" represents Sp-phosphorothioate
linkage and "R" represents Rp-phosphorothioate linkage. In some
embodiments, a common pattern of backbone chiral centers of a
provided chirally controlled oligonucleotide composition comprises
a motif described herein. In some embodiments, a motif is in the
core region. In some embodiments, n is 0. In some embodiments, n is
1. In some embodiments, n is 1-50. In some embodiments, n is 2. In
some embodiments, n is 3. In some embodiments, n is 4. In some
embodiments, n is 5.
Initial Screen
Synthesis: Summary for Oligonucleotide Synthesis on a DNA/RNA
Synthesizer MerMade-12 (2'-Deoxy and 2'-OMe Cycle)
TABLE-US-00040 [1882] delivery step reaction reagent volume (mL)
wait time (sec) 1 detritylation 3% TCA in DCM 4 .times. 1 .sup.
N.A. 2 coupling 0.15M 2 .times. 0.5 mL 60 + 60 (DNA),
phosphoramidite 300 + 300 (2'- in ACN + 0.45M OMe RNA) ETT in ACN 3
capping 5% Pac.sub.2O in 1 60 THF/2,6- lutidine + 16% NMI in THF 4
oxidation 0.02 Iodine in 1 240 water/pyridine
Stereorandom PS Oligonucleotides Having DNA-2'-OMe-DNA (7-6-7)
Design
TABLE-US-00041 [1883] ONT-141 (SEQ ID NO: 531)
d(CsCsCsTsCsTsGs)gsaststsgsasd(GsCsAsTsCsCsA) ONT-142 (SEQ ID NO:
532) d(AsAsGsCsTsTsTs)gsgststsgsgsd(GsCsAsAsCsAsC) ONT-143 (SEQ ID
NO: 533) d(AsGsTsCsAsCsTs)tsgsgsgsasgsd(CsTsTsCsTsCsC) ONT-144 (SEQ
ID NO: 534) d(CsAsCsTsTsGsGs)gsasgscststsd(CsTsCsCsTsGsG) ONT-145
(SEQ ID NO: 535) d(AsTsAsGsCsCsAs)tstsgscsasgsd(CsTsGsCsTsCsA)
ONT-146 (SEQ ID NO: 536)
d(TsGsGsAsTsTsGs)asgscsastscsd(CsAsCsCsAsAsG) ONT-147 (SEQ ID NO:
537) d(CsCsAsTsAsGsCs)csaststsgscsd(AsGsCsTsGsCsT) ONT-148 (SEQ ID
NO: 538) d(GsTsCsAsCsTsTs)gsgsgsasgscsd(TsTsCsTsCsCsT) ONT-149 (SEQ
ID NO: 539) d(CsCsAsGsGsGsCs)ascstscsastsd(CsTsGsCsAsTsG) ONT-150
(SEQ ID NO: 540) d(GsCsCsAsTsCsCs)asasgstscsasd(CsTsTsGsGsGsA)
ONT-151 (SEQ ID NO: 541)
d(GsAsAsGsCsTsTs)tsgsgststsgsd(GsGsCsAsAsCsA) ONT-152 (SEQ ID NO:
542) d(CsTsGsGsAsTsTs)gsasgscsastsd(CsCsAsCsCsAsA) ONT-183 (SEQ ID
NO: 543) d(CsAsAsGsTsCsAs)cststsgsgsgsd(AsGsCsTsTsCsT) ONT-184 (SEQ
ID NO: 544) d(AsTsGsCsCsAsTs)cscsasasgstsd(CsAsCsTsTsGsG) ONT-185
(SEQ ID NO: 545) d(AsTsGsAsGsAsTs)gscscstsgsgsd(CsTsGsCsCsAsT)
ONT-186 (SEQ ID NO: 546)
d(TsTsGsGsGsAsGs)cststscstscsd(CsTsGsGsTsGsG) ONT-187 (SEQ ID NO:
547) d(TsGsGsGsAsGsCs)tstscstscscsd(TsGsGsTsGsGsA) ONT-188 (SEQ ID
NO: 548) d(TsTsAsTsGsAsGs)astsgscscstsd(GsGsCsTsGsCsC) ONT-189 (SEQ
ID NO: 549) d(GsTsTsAsTsGsAs)gsastsgscscsd(TsGsGsCsTsGsC) ONT-190
(SEQ ID NO: 550) d(CsCsAsAsGsTsCs)ascststsgsgsd(GsAsGsCsTsTsC)
ONT-191 (SEQ ID NO: 551)
d(AsGsCsTsTsTsGs)gststsgsgsgsd(CsAsAsCsAsCsA) ONT-192 (SEQ ID NO:
552) d(TsAsTsGsAsGsAs)tsgscscstsgsd(GsCsTsGsCsCsA) ONT-193 (SEQ ID
NO: 553) d(TsGsTsTsAsTsGs)asgsastsgscsd(CsTsGsGsCsTsG) ONT-194 (SEQ
ID NO: 554) d(AsTsCsCsAsAsGs)tscsascststsd(GsGsGsAsGsCsT) ONT-195
(SEQ ID NO: 555) d(GsGsGsAsAsGsCs)tststsgsgstsd(TsGsGsGsCsAsA)
ONT-196 (SEQ ID NO: 556)
d(CsTsCsCsAsTsCs)csastsgsasgsd(GsTsCsAsTsTsC) ONT-197 (SEQ ID NO:
557) d(AsAsGsTsCsAsCs)tstsgsgsgsasd(GsCsTsTsCsTsC) ONT-198 (SEQ ID
NO: 558) d(CsCsAsTsCsCsAs)asgstscsascsd(TsTsGsGsGsAsG) ONT-199 (SEQ
ID NO: 559) d(TsCsCsAsAsGsTs)csascststsgsd(GsGsAsGsCsTsT) ONT-200
(SEQ ID NO: 560) d(CsCsTsCsTsGsGs)aststsgsasgsd(CsAsTsCsCsAsC)
ONT-201 (SEQ ID NO: 561)
d(AsCsTsTsGsGsGs)asgscststscsd(TsCsCsTsGsGsT) ONT-202 (SEQ ID NO:
562) d(CsTsTsGsGsGsAs)gscststscstsd(CsCsTsGsGsTsG) ONT-203 (SEQ ID
NO: 563) d(CsAsTsGsCsCsAs)tscscsasasgsd(TsCsAsCsTsTsG) ONT-204 (SEQ
ID NO: 564) d(TsGsCsCsAsTsCs)csasasgstscsd(AsCsTsTsGsGsG) ONT-205
(SEQ ID NO: 565) d(TsCsCsAsTsCsCs)astsgsasgsgsd(TsCsAsTsTsCsC)
ONT-206 (SEQ ID NO: 566)
d(AsGsGsGsCsAsCs)tscsastscstsd(GsCsAsTsGsGsG) ONT-207 (SEQ ID NO:
567) d(CsCsAsGsTsTsCs)cststscsastsd(TsCsTsGsCsAsC) ONT-208 (SEQ ID
NO: 568) d(CsAsTsAsGsCsCs)aststsgscsasd(GsCsTsGsCsTsC) ONT-209 (SEQ
ID NO: 569) d(TsCsTsGsGsAsTs)tsgsasgscsasd(TsCsCsAsCsCsA) ONT-210
(SEQ ID NO: 570) d(GsGsAsTsTsGsAs)gscsastscscsd(AsCsCsAsAsGsA)
Biology In Vitro Data in HepG2 Cells for the Initial DNA-2'-OMe-DNA
(7-6-7) Design: (d Upper Case)=DNA; Lower Case=2'-OMe;
s=Phosphorothioate
TABLE-US-00042 [1884] FOXO1 Levels at 20 nM (%) SD ONT-141 89 6
ONT-142 45 1 ONT-143 98 2 ONT-144 89 1 ONT-145 46 5 ONT-146 99 1
ONT-147 66 6 ONT-148 101 2 ONT-149 95 6 ONT-150 58 4 ONT-151 41 5
ONT-152 84 5 ONT-183 95 2 ONT-184 58 4 ONT-185 42 2 ONT-186 96 4
ONT-187 92 3 ONT-188 47 5 ONT-189 63 5 ONT-190 83 2 ONT-191 58 4
ONT-192 46 2 ONT-193 58 2 ONT-194 76 1 ONT-195 66 0 ONT-196 77 2
ONT-197 90 6 ONT-198 42 4 ONT-199 68 1 ONT-200 89 6 ONT-201 91 2
ONT-202 94 2 ONT-203 86 1 ONT-204 58 2 ONT-205 75 3 ONT-206 94 5
ONT-207 96 0 ONT-208 54 0 ONT-209 87 4 ONT-210 92 4 Levels at 200
nM (%) SD ONT-141 37 4 ONT-142 45 4 ONT-143 46 2 ONT-144 42 5
ONT-145 53 4 ONT-146 31 2 ONT-147 28 8 ONT-148 45 4 ONT-149 29 5
ONT-150 32 6 ONT-151 38 4 ONT-152 30 5 ONT-183 60 5 ONT-184 34 2
ONT-185 50 2 ONT-186 86 3 ONT-187 76 6 ONT-188 50 5 ONT-189 38 2
ONT-190 51 1 ONT-191 43 5 ONT-192 54 7 ONT-193 41 6 ONT-194 50 1
ONT-195 43 6 ONT-196 33 7 ONT-197 57 4 ONT-198 40 5 ONT-199 50 5
ONT-200 28 9 ONT-201 46 6 ONT-202 57 9 ONT-203 27 7 ONT-204 36 6
ONT-205 29 5 ONT-206 81 0 ONT-207 37 4 ONT-208 43 3 ONT-209 35 4
ONT-210 40 4
Stereorandom PS Oligonucleotides Having 2'-OMe-DNA-2'OMe (3-14-3)
Design: (d Upper Case)=DNA; Lower Case=2'-OMe;
s=Phosphorothioate
TABLE-US-00043 [1885] ONT-129 (SEQ ID NO: 571)
cscscsd(TsCsTsGsGsAsTsTsGsAsGsCsAsTs)cscsa ONT-130 (SEQ ID NO: 572)
asasgsd(CsTsTsTsGsGsTsTsGsGsGsCsAsAs)csasc ONT-131 (SEQ ID NO: 573)
asgstsd(CsAsCsTsTsGsGsGsAsGsCsTsTsCs)tscsc ONT-132 (SEQ ID NO: 574)
csascsd(TsTsGsGsGsAsGsCsTsTsCsTsCsCs)tsgsg ONT-133 (SEQ ID NO: 575)
astsasd(GsCsCsAsTsTsGsCsAsGsCsTsGsCs)tscsa ONT-134 (SEQ ID NO: 576)
tsgsgsd(AsTsTsGsAsGsCsAsTsCsCsAsCsCs)asasg ONT-135 (SEQ ID NO: 577)
cscsasd(TsAsGsCsCsAsTsTsGsCsAsGsCsTs)gscst ONT-136 (SEQ ID NO: 578)
gstscsd(AsCsTsTsGsGsGsAsGsCsTsTsCsTs)cscst ONT-137 (SEQ ID NO: 579)
cscsasd(GsGsGsCsAsCsTsCsAsTsCsTsGsCs)astsg ONT-138 (SEQ ID NO: 580)
gscscsd(AsTsCsCsAsAsGsTsCsAsCsTsTsGs)gsgsa ONT-139 (SEQ ID NO: 581)
gsasasd(GsCsTsTsTsGsGsTsTsGsGsGsCsAs)ascsa ONT-140 (SEQ ID NO: 582)
cstsgsd(GsAsTsTsGsAsGsCsAsTsCsCsAsCs)csasa ONT-155 (SEQ ID NO: 583)
csasasd(GsTsCsAsCsTsTsGsGsGsAsGsCsTs)tscst ONT-156 (SEQ ID NO: 584)
astsgsd(CsCsAsTsCsCsAsAsGsTsCsAsCsTs)tsgsg ONT-157 (SEQ ID NO: 585)
astsgsd(AsGsAsTsGsCsCsTsGsGsCsTsGsCs)csast ONT-158 (SEQ ID NO: 586)
tstsgsd(GsGsAsGsCsTsTsCsTsCsCsTsGsGs)tsgsg ONT-159 (SEQ ID NO: 587)
tsgsgsd(GsAsGsCsTsTsCsTsCsCsTsGsGsTs)gsgsa ONT-160 (SEQ ID NO: 588)
tstsasd(TsGsAsGsAsTsGsCsCsTsGsGsCsTs)gscsc ONT-161 (SEQ ID NO: 589)
gststsd(AsTsGsAsGsAsTsGsCsCsTsGsGsCs)tsgsc ONT-162 (SEQ ID NO: 590)
cscsasd(AsGsTsCsAsCsTsTsGsGsGsAsGsCs)tstsc ONT-163 (SEQ ID NO: 591)
asgscsd(TsTsTsGsGsTsTsGsGsGsCsAsAsCs)ascsa ONT-164 (SEQ ID NO: 592)
tsastsd(GsAsGsAsTsGsCsCsTsGsGsCsTsGs)cscsa ONT-165 (SEQ ID NO: 593)
tsgstsd(TsAsTsGsAsGsAsTsGsCsCsTsGsGs)cstsg ONT-166 (SEQ ID NO: 594)
astscsd(CsAsAsGsTsCsAsCsTsTsGsGsGsAs)gscst ONT-167 (SEQ ID NO: 595)
gsgsgsd(AsAsGsCsTsTsTsGsGsTsTsGsGsGs)csasa ONT-168 (SEQ ID NO: 596)
cstscsd(CsAsTsCsCsAsTsGsAsGsGsTsCsAs)tstsc ONT-169 (SEQ ID NO: 597)
asasgsd(TsCsAsCsTsTsGsGsGsAsGsCsTsTs)cstsc ONT-170 (SEQ ID NO: 598)
cscsasd(TsCsCsAsAsGsTsCsAsCsTsTsGsGs)gsasg ONT-171 (SEQ ID NO: 599)
tscscsd(AsAsGsTsCsAsCsTsTsGsGsGsAsGs)cstst ONT-172 (SEQ ID NO: 600)
cscstsd(CsTsGsGsAsTsTsGsAsGsCsAsTsCs)csasc ONT-173 (SEQ ID NO: 601)
ascstsd(TsGsGsGsAsGsCsTsTsCsTsCsCsTs)gsgst ONT-174 (SEQ ID NO: 602)
cststsd(GsGsGsAsGsCsTsTsCsTsCsCsTsGs)gstsg ONT-175 (SEQ ID NO: 603)
csastsd(GsCsCsAsTsCsCsAsAsGsTsCsAsCs)tstsg ONT-176 (SEQ ID NO: 604)
tsgscsd(CsAsTsCsCsAsAsGsTsCsAsCsTsTs)gsgsg ONT-177 (SEQ ID NO: 605)
tscscsd(AsTsCsCsAsTsGsAsGsGsTsCsAsTs)tscsc ONT-178 (SEQ ID NO: 606)
asgsgsd(GsCsAsCsTsCsAsTsCsTsGsCsAsTs)gsgsg ONT-179 (SEQ ID NO: 607)
cscsasd(GsTsTsCsCsTsTsCsAsTsTsCsTsGs)csasc ONT-180 (SEQ ID NO: 608)
csastsd(AsGsCsCsAsTsTsGsCsAsGsCsTsGs)cstsc ONT-181 (SEQ ID NO: 609)
tscstsd(GsGsAsTsTsGsAsGsCsAsTsCsCsAs)cscsa ONT-182 (SEQ ID NO: 610)
gsgsasd(TsTsGsAsGsCsAsTsCsCsAsCsCsAs)asgsa
Biology In Vitro Data in HepG2 Cells for the 2'-OMe-DNA-2'-OMe
(3-14-3) Design
TABLE-US-00044 [1886] FOXO1 Levels at 20 nM (%) SD ONT-129 82 5
ONT-130 49 4 ONT-131 92 3 ONT-132 91 2 ONT-133 58 3 ONT-134 73 2
ONT-135 65 5 ONT-136 92 2 ONT-137 94 2 ONT-138 78 1 ONT-139 61 1
ONT-140 82 4 ONT-155 95 2 ONT-156 74 1 ONT-157 56 2 ONT-158 93 1
ONT-159 94 1 ONT-160 71 1 ONT-161 67 1 ONT-162 89 1 ONT-163 55 7
ONT-164 68 4 ONT-165 70 1 ONT-166 89 4 ONT-167 81 0 ONT-168 81 0
ONT-169 94 0 ONT-170 88 1 ONT-171 92 4 ONT-172 86 2 ONT-173 90 1
ONT-174 93 2 ONT-175 84 1 ONT-176 80 2 ONT-177 83 2 ONT-178 95 2
ONT-179 93 8 ONT-180 68 7 ONT-181 85 5 ONT-182 80 5 Levels at 200
nM (%) SD ONT-129 27 1 ONT-130 46 4 ONT-131 53 9 ONT-132 53 2
ONT-133 48 6 ONT-134 35 9 ONT-135 45 15 ONT-136 40 7 ONT-137 50 4
ONT-138 80 3 ONT-139 40 3 ONT-140 33 13 ONT-155 52 2 ONT-156 35 4
ONT-157 39 2 ONT-158 87 6 ONT-159 89 5 ONT-160 33 10 ONT-161 40 11
ONT-162 60 7 ONT-163 42 8 ONT-164 34 10 ONT-165 38 1 ONT-166 62 9
ONT-167 64 1 ONT-168 38 2 ONT-169 67 3 ONT-170 74 8 ONT-171 65 5
ONT-172 33 18 ONT-173 72 15 ONT-174 65 15 ONT-175 38 21 ONT-176 48
8 ONT-177 28 5 ONT-178 97 11 ONT-179 47 6 ONT-180 56 12 ONT-181 45
26 ONT-182 33 17
Hit Selection:
TABLE-US-00045 [1887] ONT-151 (SEQ ID NO: 611)
d(GsAsAsGsCsTsTs)tsgsgststsgsd(GsGsCsAsAsCsA) ONT-198 (SEQ ID NO:
612) d(CsCsAsTsCsCsAs)asgstscsascsd(TsTsGsGsGsAsG) ONT-185 (SEQ ID
NO: 613) d(AsTsGsAsGsAsTs)gscscstsgsgsd(CsTsGsCsCsAsT) ONT-142 (SEQ
ID NO: 614) d(AsAsGsCsTsTsTs)gsgststsgsgsd(GsCsAsAsCsAsC) ONT-145
(SEQ ID NO: 615) d(AsTsAsGsCsCsAs)tstsgscsasgsd(CsTsGsCsTsCsA)
ONT-192 (SEQ ID NO: 616)
d(TsAsTsGsAsGsAs)tsgscscstsgsd(GsCsTsGsCsCsA) ONT-188 (SEQ ID NO:
617) d(TsTsAsTsGsAsGs)astsgscscstsd(GsGsCsTsGsCsC)
Secondary Screen. Chemistry and Stereochemistry Screen
Summary for Oligonucleotide Synthesis on a DNA/RNA Synthesizer
MerMade-12 (Stereodefined Phosphorothioate 2'-Deoxy and 2'-OMe
Cycle)
TABLE-US-00046 [1888] delivery wait time step reaction reagent vol
(mL) (sec) 1 detritylation 3% TCA in DCM 4 .times. 1 N.A. 2
coupling 0.15 M chiral 2 .times. 0.5 2 .times. 450 phosphoramidite
in (2'-OMe ACN + 2 M CMPT in RNA) ACN 2 .times. 300 (DNA) 3 capping
1 5% Pac20 in THF/2,6- 1 60 lutidine 4 capping 2 5% Pac20 in
THF/2,6- 1 60 lutidine + 16% NMI in THF 5 sulfurization 0.3 M
S-(2-cyanoethyl) 1 600 methylthiosulfonate ##STR00376## in
ACN/BSTFA
Examples Applied on the FOXO1 Hit Sequences:
Examples Include but are not Limited to:
TABLE-US-00047 [1889] (SEQ ID NO: 618) (Sp, Sp, Sp, Sp, Sp, Sp, Sp,
Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Sp,
Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 619) (Sp,
Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp,
Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 620) (Sp,
Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp,
Sp)d[GsAsAsGsCsTsTsTsGsGsTsTsGsGsGsCsAsAsCsA] (SEQ ID NO: 621) (Sp,
Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp,
Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 622) (Sp,
Sp, Sp, Sp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Sp, Sp, Sp, Sp,
Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 623) (Sp,
Sp, Sp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Sp, Sp,
Sp) d[GsAsAsGsCsTsTsTsGsGsTsTsGsGsGsCsAsAsCsA] (SEQ ID NO: 624)
(Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp,
Sp, Sp, Sp)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT] (SEQ ID NO:
625) (Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp,
Sp, Sp, Sp, Sp)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT] (SEQ ID
NO: 626) (Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp,
Sp, Rp, Sp, Sp, Sp)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT] (SEQ
ID NO: 627) (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp,
Sp, Rp, Sp, Sp, Rp, Sp)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT]
(SEQ ID NO: 628) (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp,
Rp, Sp, Sp, Sp, Sp, Sp, Sp)
d[GsAsAsGsCsTsTsTsGsGsTsTsGsGsGsCsAsAsCsA] (SEQ ID NO: 629) (Sp,
Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp,
Sp)d[CsCsAsTsCsCsAs](AsGsTsCsAsCs).sub.OMed[TsTsGsGsGsAsG] (SEQ ID
NO: 630) (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp, Sp, Rp,
Sp, Sp, Rp, Sp,
Sp)d[AsTsGsAsGsAsTs](GsCsCsTsGsGs).sub.OMed[CsTsGsCsCsAsT] (SEQ ID
NO: 631) (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp, Sp, Rp,
Sp, Sp, Rp, Sp,
Sp)d[CsCsAsTsCsCsAs](AsGsTsCsAsCs).sub.LNAd[TsTsGsGsGsAsG] (SEQ ID
NO: 632) (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp, Sp, Rp,
Sp, Sp, Rp, Sp,
Sp)d[AsTsGsAsGsAsTs](GsCsCsTsGsGs).sub.LNAd[CsTsGsCsCsAsT] (SEQ ID
NO: 633) (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp, Sp, Rp,
Sp, Sp, Rp, Sp,
Sp)d[CsCsAsTsCsCsAs](AsGsTsCsAsCs).sub.MOEd[TsTsGsGsGsAsG] (SEQ ID
NO: 634) (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp, Sp, Rp,
Sp, Sp, Rp, Sp,
Sp)d[AsTsGsAsGsAsTs](GsCsCsTsGsGs).sub.MOEd[CsTsGsCsCsAsT] (SEQ ID
NO: 635) (Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp,
Rp, Sp, Rp, Sp,
Sp)(CsCsAs).sub.OMed[TsCsCsAsAsGsTsCsAsCsTsTsGsGs](GsAsG).sub.OMe
(SEQ ID NO: 636) (Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp,
Sp, Sp, Rp, Sp, Rp, Sp,
Sp)(AsTsGs).sub.MOEd[AsGsAsTsGsCsCsTsGsGsCsTsGsCs](CsAsT).sub.MOE
(SEQ ID NO: 637) (Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp,
Sp, Sp, Rp, Sp, Sp, Sp,
Sp)(CsCsAs).sub.LNAd[TsCsCsAsAsGsTsCsAsCsTsTsGsGs](GsAsG).sub.LNA
(SEQ ID NO: 638) (Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp,
Sp, Sp, Rp, Sp, Sp, Sp,
Sp)(AsTsGs).sub.OMed[AsGsAsTsGsCsCsTsGsGsCsTsGsCs](CsAsT).sub.OMe
(SEQ ID NO: 639) (Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp,
Sp, Sp, Sp, Rp, Sp, Sp,
Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 640) (Sp,
Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp,
Sp)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT] (SEQ ID NO: 641) (Sp,
Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp,
Sp) d[GsAsAsGsCsTsTsTsGsGsTsTsGsGsGsCsAsAsCsA] (SEQ ID NO: 642)
(Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp,
Sp, Rp, Sp)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT] (SEQ ID NO:
643) (Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Rp,
Sp, Sp, Sp, Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID
NO: 644) (Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Rp,
Sp, Sp, Sp, Sp, Sp)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT] (SEQ
ID NO: 645) (Sp, Sp, Rp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Rp,
Sp, Sp, Sp, Sp, Rp, Sp) d[GsAsAsGsCsTsTsTsGsGsTsTsGsGsGsCsAsAsCsA]
(SEQ ID NO: 646) (Sp, Rp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Rp,
Sp, Sp, Sp, Sp, Rp, Sp,
Sp)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT] (SEQ ID NO: 647) (Sp,
Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Rp,
Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 648) (Sp,
Sp, Rp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp,
Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 649) (Sp,
Rp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp,
Sp)d[AsTsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsT] (SEQ ID NO: 650) (Sp,
Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp,
Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 651) (Sp,
Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp,
Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 652) (Sp,
Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp,
Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 653) (Sp,
Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp,
Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 654) (Sp,
Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp,
Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 655) (Sp,
Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp,
Sp)d[CsCsAsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGsAsG] (SEQ ID NO: 656) (Sp,
Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp,
Sp)(CsCs).sub.OMed[AsTsCsCsAsAs](GsTsCs).sub.OMed[AsCsTsTsGsGsGs](AsG).sub-
.OMe (SEQ ID NO: 657) (Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Rp, Sp,
Rp, Sp, Sp, Rp, Sp, Sp, Sp, Sp)
(CsCs).sub.LNAd[AsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGs](AsG).sub.LNA (SEQ
ID NO: 658) (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Rp, Sp, Sp, Sp,
Rp, Sp, Sp, Rp, Sp, Sp)
(CsCs).sub.MOEd[AsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGs](AsG).sub.MOE (SEQ
ID NO: 659) (Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp,
Rp, Sp, Sp, Rp, Sp, Sp)
(CsCs).sub.OMed[AsTsCsCsAsAsGsTsCsAsCsTsTsGsGsGs](AsG).sub.OMe
Example 4. Suppression of Nucleic Acid Polymer
[1890] Among other things, the present disclosure provides chirally
controlled oligonucleotide compositions and methods thereof that
deliver unexpected results when, e.g., used for suppressing nucleic
acid polymers through, in some cases, cleavage of such nucleic acid
polymers. Examples include but are not limited to those presented
herein.
[1891] RNase H Assay
[1892] Cleavage rate of nucleic acid polymers by nucleases, for
example, RNA by RNase H, is important with respect to the use of
oligonucleotides in therapeutic technologies such as antisense
technology. Using our assay, we investigated the cleavage rates and
analyzed the metabolites for chirally controlled oligonucleotide
compositions of particular oligonucleotide types (P-diastereomers)
when oligonucleotides of the particular oligonucleotide types are
bound to complementary RNA. Results below also illustrate the
importance of cleavage patterns recognized by the present
disclosure.
[1893] RNase H used herein is a ubiquitously expressed endonuclease
that hydrolyses the RNA strand of a RNA/DNA hybrid. It plays an
important role in the mode of action of antisense oligonucleotides.
In some embodiments, RNase H cleavage rate is significantly reduced
when the RNA substrate is structured (Lima, W. F., Venkatraman, M.,
Crooke, S. T. The Influence of Antisense Oligonucleotide-induced
RNA Structure on Escherichia coli RNase H1 Activity The Journal Of
Biological Chemistry 272, No. 29, 18191-18199, (1997)).
Furthermore, the 2'-MOE gapmer designs (5-10-5) offer higher
affinities for RNA targets leading to minimal turnover of the
antisense strand. Presence of 2'-MOE modifications in the wings
also reduce the number of RNase H cleavage sites.
[1894] To study the RNA cleavage rate, the present disclosure
provides a simple assay to quantify the length of RNA remaining
after incubation with RNase H. The provided method, among other
things, provides the relative rates of RNase H cleavage for
stereorandom 2'-modified gapmers, stereorandom DNA oligonucleotide
compositions and chirally pure P-diastereomers (chirally controlled
oligonucleotide compositions of a corresponding oligonucleotide
type) for various oligomers for different targets. Changing the
stereochemistry at 2'-modified regions and the DNA core provides
information with respect to how stereochemistry in these regions
affects the interaction of RNase H to its substrates. RNase H
reaction mixtures at different time points were analyzed by LCMS to
determine the cleavage pattern. The present disclosure, among other
things, provides nucleic acid polymer, for example RNA, cleavage
rates and cleavage patterns (maps) that are critical to design
stereochemical nucleic acid architectures for optimal activity,
e.g., antisense activity.
[1895] Equipment:
[1896] Alliance HPLC, 2489--TUV, 2695E--Equipped with
autosampler
[1897] Caryl00 (Agilent Technologies)
[1898] Methods:
[1899] DNA/RNA Duplex Preparation:
[1900] Oligonucleotide concentrations were determined by measuring
the absorbance in water at 260 nm. DNA/RNA duplexes were prepared
by mixing equimolar solutions oligonucleotides with each strand
concentration of 10 uM. The mixtures were heated at 90.degree. C.
for 2 minutes in water bath and were cooled down slowly over
several hours.
[1901] Human RNase H Protein Expression and Purification:
[1902] Human RNase HC clone was obtained from Prof Wei Yang's
laboratory at NIH Bethesda. The protocol for obtaining this human
RNase HC (residues 136-286) has been described (Nowotny, M. et al.
Structure of Human RNase H1 Complexed with an RNA/DNA Hybrid:
Insight into HIV Reverse Transcription. Molecular Cell 28, 264-276,
(2007). The protein expression was carried out by following
reported protocol with the exception that the resulting protein had
an N-terminal His6 tag (SEQ ID NO: 1552). BL21(DE3) E. coli cells
in LB medium were used for protein expression. Cells were grown at
37.degree. C. till OD600 reached around 0.7. The cultures were then
cooled and 0.4 mM IPTG was added to induce protein expression
overnight at 16.degree. C. E. coli extract was prepared by
sonication in buffer A (40 mM NaH.sub.2PO.sub.4 (pH 7.0), 1 M NaCl,
5% glycerol, 2.8 mM .beta.-mercaptoethanol and 10 mM imidazole)
with the addition of protease inhibitors (Sigma-Aldrich). The
extract was purified by Ni affinity column using buffer A plus 60
mM imidazole. The protein was eluted with a linear gradient of 60
to 300 mM imidazole. The protein peak was collected and was further
purified on a Mono S column (GE Healthcare) with a 100 mM-500 mM
gradient of NaCl in buffer B. Fractions containing RNase HC were
concentrated to 0.3 mg/ml in the storage buffer (20 mM HEPES (pH
7.0), 100 mM NaCl, 5% glycerol, 0.5 mM EDTA, 2 mM DTT) and stored
at -20.degree. C. 0.3 mg/ml enzyme concentration corresponds to
17.4 uM based on its reported extinction coefficient (32095
cm.sup.-1 M.sup.-1) and MW (18963.3 Da units).
[1903] RNase H Assay:
[1904] In a 96-well plate, to 25 .mu.L DNA/RNA duplex (10 .mu.M)
was added 5 .mu.L of 10.times.RNase H buffer followed by 15 .mu.L
water. The mixture was incubated at 37.degree. C. for a few minutes
and then 5 .mu.L of 0.1 .mu.M stock solution of enzyme was added to
give total volume of 50 .mu.L with final substrate/enzyme
concentration 5 .mu.M/0.01 .mu.M (500:1) and was further incubated
at 37.degree. C. Various ratios of the DNA/RNA duplex: RNase H
protein were studied using these conditions to find an optimal
ratio to study the kinetics. The reactions were quenched at
different time points using 10 .mu.L of 500 mM EDTA disodium
solution in water. For zero min time point, EDTA was added to the
reaction mixture before the addition of enzyme. Controls were run
to ensure that EDTA was able to successfully inhibit the enzyme
activity completely. After all the reactions were quenched 10 .mu.L
of each reaction mixture was injected on to analytical HPLC column
(XBridge C18, 3.5 um, 4.6.times.150 mm, Waters Part #186003034).
Kcat/Km can be measured by a number of methods, such as FRET
(Fluorescence Resonance Energy Transfer) dependent RNase H assay
using dual labeled RNA and monitored by SpectraMax.
[1905] Solid Phase Extraction Protocol for Sample Preparation for
LCMS:
[1906] 96 well plate (Waters part #186002321) was used to clean the
RNase H reaction mixture before running LCMS. 500 .mu.L of
acetonitrile followed by water was used to equilibrate the plate
under mild vacuum with the help of manifold (Millipore part # MSV
MHTS00). Precaution was taken not to let the plate dry. About
50-100 .mu.L of RNase H reaction mixture was loaded in each well
followed by water washings (2 mL) under mild vacuum. 2.times.500
.mu.L of 70% ACN/Water was used to recover the sample. The
recovered samples were transferred to 2 mL centrifuge tubes and
were concentrated to dryness in speed vac. Each dry sample was
reconstituted in 100 .mu.L water and 10 .mu.L was injected on
Acquity UPLC@OST C18 1.7 um, 2.1.times.50 mm (part #186003949) for
LCMS analysis.
[1907] For mass spectrometry analysis, the reaction mixtures after
quenching were cleaned using Cis 96 well plate (Waters). The
oligomers were eluted in 70% Acetonitrile/Water. The Acetonitrile
was evaporated using speedvac and the resulting residue was
reconstituted in water for injection.
Eluent A=50 mM Triethyl ammonium acetate
Eluent B=Acetonitrile
Column Temperature=60.degree. C.
[1908] UV was recorded at 254 nm and 280 nm
RP-HPLC Gradient Method
TABLE-US-00048 [1909] Time (min) Flow (ml/min) % A % B Curve 1 0.0
1.00 95.0 5.0 2 2.00 1.00 95.0 5.0 1 3 22.00 1.00 80.0 20.0 6 4
25.00 1.00 5.0 95.0 6 5 25.5 1.00 95.0 5.0 1 6 30 1.00 95.0 5.0
1
[1910] On HPLC chromatograms, peak areas corresponding to full
length RNA oligomer (ONT-28) were integrated, normalized using the
DNA peak and were plotted against time (FIG. 8). ONT-87
demonstrated superior cleavage for complementary RNA when in duplex
form, in comparison to the other product candidates and Mipomersen.
Since all the diastereomers in this panel have 2'-MOE modified
wings that do not activate RNase H enzyme, without the intention to
be limited by theory, Applicant notes that activity is likely
dictated by the stereochemistry in the DNA core. Heteroduplexes
with ONT-77 to ONT-81 including Mipomersen in the antisense strand
show very similar RNA cleavage rates. ONT-89 with alternating Sp/Rp
stereochemistry showed the least activity in the tested time frame
under the tested conditions. Among the tested oligonucleotides with
MOE modifications, ONT-87 and ONT-88 units in the antisense strand
exhibited increased in activity in comparison to the rest of the
heteroduplexes. Particularly, ONT-87 provided surprisingly high
cleavage rate and unexpected low level of remaining target RNA.
Additional example data were illustrated in FIG. 6 and FIG. 24.
[1911] In Vitro Oligonucleotide Transfection Assay:
[1912] Transfection assays are widely known and practiced by
persons having ordinary skill in the art. An example protocol is
described herein. Hep3B cells are reverse transfected with
Lipofectamine 2000 (Life Technologies, Cat. No. 11668-019) at
18.times.10.sup.3 cells/well density in 96-well plates using the
manufacturer's protocol. For dose response curves eight 1/3 serial
dilutions are used starting from 60-100 nM. 25 .mu.L of 6.times.
oligonucleotide concentration is mixed with a prepared mixture of
0.4 .mu.L Lipofectamine 2000 with 25 .mu.L of serum-free medium
Opti-MEM medium (Gibco, Cat. No. 31985-062) per well. After a 20
min minute incubation, 100 .mu.L of 180.times.10.sup.3 cells/ml
suspended in 10% FBS in DMEM cell culture media (Gibco, Cat. No.
11965-092) is added to bring the final volume to 150 .mu.L per
well. 24-48 hours post transfection Hep3B cells are lysed by adding
75 .mu.L of Lysis Mixture with 0.5 mg/ml Proteinase K using
QuantiGene Sample Processing Kit for Cultured Cells (Affymetrix,
Cat. No. QS0103). The Target mRNA and GAPDH mRNA expression levels
in cell lysates are measured using Affymetrix QuantiGene 2.0 Assay
Kit (Cat. No. QS0011) according to the manufacturer's protocol. The
Target mRNA expression is normalized to GAPDH mRNA expression from
the same sample; and relative Target/GAPDH levels are compared to
transfections using Lipofectamine 2000 only (no oligonucleotide)
control. Dose response curves are generated by GraphPad Prism 6
using nonlinear regression log (inhibitor) vs. response curve fit
with variable slope (4 parameters). For example results, see FIG.
24, FIG. 27 and FIG. 29.
Example 5. Provided Compositions and Methods Provide Control of
Cleavage Patterns
[1913] The present disclosure surprisingly found that
internucleotidic linkage stereochemistry pattern has unexpected
impact on cleavage patterns of nucleic acid polymers. By changing
common patterns of backbone chiral centers of chirally controlled
oligonucleotide compositions, numbers of cleavage sites, cleavage
percentage at a cleavage site, and/or locations of cleavage sits
can be surprisingly altered, both independently and in combination.
As described in the example herein, provided compositions and
methods can provide control over cleavage patterns of nucleic acid
polymers.
[1914] Using similar assay conditions, various chirally controlled
oligonucleotide compositions of different oligonucleotide types
were tested. Example cleavage patterns of the target RNA sequence
is presented in FIG. 9. Certain pattern of backbone chiral centers,
such as that in ONT-87 and ONT-154, surprisingly produces only one
cleavage site in the target sequence. Moreover, it is surprisingly
found that oligonucleotides providing single cleavage site, such as
ONT-87 and ONT-154, provide unexpectedly high cleavage rate and low
level of remaining target nucleic acid polymer. See also FIG. 8,
FIG. 10 and FIG. 11.
Example 6. Example Cleavage of FOXO1 mRNA
[1915] Oligonucleotide compositions targeting different regions of
FOXO1 mRNA were tested in cleavage assays as described above. In
each case, chirally controlled oligonucleotide compositions were
shown to be capable of providing altered cleavage patterns relative
to reference cleavage patterns from chirally uncontrolled
oligonucleotide compositions sharing the same common base sequence
and length. For example results, see FIG. 10 and FIG. 11. As shown
in FIG. 12, example chirally controlled oligonucleotide
compositions provide both significantly faster cleavage rates and
unexpectedly low levels of remaining substrates when compared to
reference chirally uncontrolled oligonucleotide compositions. In
some embodiments, as shown in FIG. 11, the cleavage sites are
associated with RpSpSp backbone chiral center sequence. In some
embodiments, cleavage sites are two base pairs upstream of
RpSpSp.
[1916] Example oligonucleotide compositions are listed below.
TABLE-US-00049 Tm SEQ Oligo Sequence Description (.degree. C.) ID
NO: ONT-366 dTsdGsdAsdGsdAsdTsdGsdCsdCsdTsdGsdGsdCsdTsd All DNA
66.5 660 GsdCsdCsdAsdTsdA ONT-389
dTsdGsdAsdGsdAsdTsdGsdCsdCsdTsdGsdGsdCsdTsd S.sub.7RSSRSSR 64.3 661
GsdCsdCsdAsdTsdA S.sub.5 ONT-390
dTsdGsdAsdGsdAsdTsdGsdCsdCsdTsdGsdGsdCsdTsd S.sub.6RSSRSSR 64.6 662
GsdCsdCsdAsdTsdA S.sub.6 ONT-391
dTsdGsdAsdGsdAsdTsdGsdCsdCsdTsdGsdGsdCsdTsd S.sub.5RSSRSSR 64.3 663
GsdCsdCsdAsdTsdA S.sub.7 ONT-387
rUrArUrGrGrCrArGrCrCrArGrGrCrArUrCrUrCrA complementary 664 RNA
ONT-367 dTsdAsdGsdCsdCsdAsdTsdTsdGsdCsdAsdGsdCsdTsd All DNA 62.9
665 GsdCsdTsdCsdAsdC ONT-392
dTsdAsdGsdCsdCsdAsdTsdTsdGsdCsdAsdGsdCsdTsd S.sub.7RSSRSSR 59.5 666
GsdCsdTsdCsdAsdC S.sub.5 ONT-393
dTsdAsdGsdCsdCsdAsdTsdTsdGsdCsdAsdGsdCsdTsd S.sub.6RSSRSSR 60 667
GsdCsdTsdCsdAsdC S.sub.6 ONT-394
dTsdAsdGsdCsdCsdAsdTsdTsdGsdCsdAsdGsdCsdTsd S.sub.5RSSRSSR 59.5 668
GsdCsdTsdCsdAsdC S.sub.7 ONT-388
rGrUrGrArGrCrArGrCrUrGrCrArArUrGrGrCrUrA complementary 669 RNA
Example 7. Example Chirally Controlled Oligonucleotide Compositions
Provide Higher Turn-Over
[1917] In cases where the Tm of cleaved nucleic acid polymer
fragments, for example RNA fragments, to oligonucleotides is
greater than a physiological temperature, product dissociation may
be inhibited and oligonucleotides may not be able to dissociate and
find other target strands to form duplexes and cause the target
strands to be cleaved. The Tm of ONT-316 (5-10-5 2'-MOE Gapmer) to
complementary RNA is 76.degree. C. After a cut or a few cuts in the
RNA sequence complementary to the oligonucleotides, the 2'-MOE
fragments may remain bound to RNA and thus cannot cause the other
target molecules to be cleaved. Thermal melting temperatures of DNA
strands generally are much lower when duplexed to RNA, for example,
ONT-367 (63.degree. C.) and ONT-392 60.degree. C.). Additionally,
thermal stability in DNA sequences is often relatively uniformly
distributed compared to 2'-MOE modified oligonucleotides. In some
embodiments, oligonucleotides in provided chirally controlled
oligonucleotide compositions do not contain 2'-modifications such
as 2'-MOE. In some embodiments, oligonucleotides in provided
chirally controlled oligonucleotide compositions, which do not
contain 2'-modifications such as 2'-MOE, more easily dissociate
from nucleic acid polymer cleavage fragments, and have higher
turn-over than oligonucleotides having 2'-modifications such as
2'-MOE. In some embodiments, the present disclosure provides an all
DNA designs, in which oligonucleotides do not have
2'-modifications. In some embodiments, chirally controlled
oligonucleotide compositions wherein oligonucleotides having no
2'-modification provides higher turn-over of a nuclease such as
RNase H. In some embodiments, after cleavage RNase H dissociates
more easily from duplex formed by RNA and oligonucleotides of
provided chirally controlled oligonucleotide compositions. Using
similar protocols as described above, turn-over of two example
chirally controlled oligonucleotide compositions of oligonucleotide
type ONT-367 and ONT-392 indeed showed higher turn-over rate than
reference chirally uncontrolled oligonucleotide compositions (see
FIG. 13).
Example 8. Example Cleavage of FOXO1 mRNA
[1918] As exemplified in FIG. 14, chirally controlled
oligonucleotide compositions and methods thereof in the present
disclosure can provide controlled cleavage of nucleic acid
polymers. In some embodiments, chirally controlled oligonucleotide
compositions of the present disclosure produces altered cleavage
pattern in terms of number of cleavage sites, location of cleavage
sites, and/or relative cleavage percentage of cleavage sites. In
some embodiments, as exemplified by ONT-401 and ONT-406, chirally
controlled oligonucleotide compositions provide single site
cleavage.
[1919] In some embodiments, only one component from RNA cleavage
was detected. Without the intention to be limited by theory,
Applicant notes that such observation could be due to the
processive nature of RNase H enzyme which could make multiple cuts
on the same duplex resulting in much shorter 5'-OH 3'-OH
fragments.
[1920] Additional chirally controlled oligonucleotide compositions
were further tested. As described above, provided chirally
controlled oligonucleotide compositions provides unexpected
results, for example, in terms of cleavage rate and % RNA remaining
in DNA/RNA duplex. See FIGS. 15-17. Example analytical data were
presented in FIGS. 18-20. Without the intention to be limited by
theory, Applicant notes that in some embodiments, cleavage may
happen as depicted in FIG. 21. In FIG. 17, it is noted ONT-406 was
observed to elicit cleavage of duplexed RNA at a rate in slight
excess of that of the natural DNA oligonucleotide ONT-415 having
the same base sequence and length. Applicant notes that chirally
controlled oligonucleotide compositions of ONT-406, and other
chirally controlled oligonucleotide compositions provided in this
disclosure, have other preferred properties that an ONT-415
composition does not have, for example, better stability profiles
in vitro and/or in vivo. Additional example data were presented in
FIG. 25. Also, as will be appreciated by those skilled in the art,
example data illustrated in FIG. 26 and FIG. 27 confirm that
provided example chirally controlled oligonucleotide compositions,
especially when so designed to control the cleavage patterns
through patterns of backbone chiral centers, produced much better
results than reference oligonucleotide compositions, e.g., a
stereorandom oligonucleotide composition. As exemplified in FIG.
26, controlled patterns of backbone chiral centers, among other
things, can selectively increase and/or decrease cleavage at
existing cleavage site when a DNA oligonucleotide is used, or
creates entirely new cleavage sites that do not exist when a DNA
oligonucleotide is used (see FIG. 25, ONT-415). In some
embodiments, cleavage sites from a DNA oligonucleotide indicate
endogenous cleavage preference of RNase H. As confirmed by FIG. 27,
provided chirally controlled oligonucleotide compositions are
capable of modulating target cleavage rate. In some embodiments,
approximately 75% of the variance in cellular activity is accounted
for by differences in cleavage rate which can be controlled through
patterns of backbone chiral centers. As provided in this
Application, further structural features such as base modifications
and their patterns, sugar modification and their patterns,
internucleotidic linkage modifications and their patterns, and/or
any combinations thereof, can be combined with patterns of backbone
chiral centers to provide desired oligonucleotide properties.
Example 9. Example Allele-Specific Suppression of mHTT
[1921] In some embodiments, the present disclosure provides
chirally controlled oligonucleotide compositions and methods
thereof for allele-specific suppression of transcripts from one
particular allele with selectivity over the others. In some
embodiments, the present disclosure provides allele-specific
suppression of mHTT.
[1922] FIG. 22 illustrates example chirally controlled
oligonucleotide compositions that specifically suppress transcripts
from one allele but not the others. Oligonucleotides 451 and 452
were tested with transcripts from both exemplified alleles using
biochemical assays described above. Allele-specific suppression is
also tested in cells and animal models using similar procedures as
described in Hohjoh, Pharmaceuticals 2013, 6, 522-535; US patent
application publication US 2013/0197061; and Ostergaard et al.,
Nucleic Acids Research, 2013, 41(21), 9634-9650. In all cases,
transcripts from the target allele are selectively suppressed over
those from the other alleles. As will be appreciated by those
skilled in the art, example data illustrated in FIG. 22 confirm
that provided example chirally controlled oligonucleotide
compositions, especially when so designed to control the cleavage
patterns through stereochemistry, produced much better results than
reference oligonucleotide compositions, in this case, a
stereorandom oligonucleotide composition. As confirmed by FIG. 22,
patterns of backbone chiral centers can dramatically change
cleavage patterns (FIG. 22 C-E), and stereochemistry patterns can
be employed to position cleavage site at the mismatch site(FIG. 22
C-E), and/or can dramatically improve selectivity between the
mutant and wild type (FIG. 22 G-H). In some embodiments, chirally
controlled oligonucleotide compositions are incubated with wtRNA
and muRNA of a target and both the duplexes are incubated with
RNase H.
[1923] Huntingtin Allele Tm
TABLE-US-00050 Mutant Huntingtin Allele ONT-453/ONT-451
38.8.degree. C. Wild Type Huntingtin Allele ONT-454/ONT-451
37.3.degree. C. Mutant Huntingtin Allele ONT-453/ONT-452
38.8.degree. C. Wild Type Huntingtin Allele ONT-454/ONT-452
36.5.degree. C. Mutant Huntingtin Allele ONT-453/ONT-450
40.3.degree. C. Wild Type Huntingtin Allele ONT-454/ONT-450
38.8.degree. C.
Example 10. Example Allele-Specific Suppression of FOXO1
[1924] In some embodiments, the present disclosure provides
allele-specific suppression of FOXO1.
[1925] FIG. 23 illustrates example chirally controlled
oligonucleotide compositions that specifically suppress transcripts
from one allele but not the others. Oligonucleotides ONT-400,
ONT-402 and ONT-406 were tested with transcripts from both
exemplified alleles using biochemical assays described above.
Allele-specific suppression is also tested in cells and animal
models using similar procedures as described in Hohjoh,
Pharmaceuticals 2013, 6, 522-535; US patent application publication
US 2013/0197061; Ostergaard et al., Nucleic Acids Research 2013,
41(21), 9634-9650; and Jiang et al., Science 2013, 342, 111-114.
Transcripts from the target allele are selectively suppressed over
those from the other alleles. In some cases, two RNAs with mismatch
ONT-442 (A/G, position 7th) and ONT-443 (A/G, position 13.sup.th)
from ONT-388 are synthesized and are duplexed with ONT-396 to
ONT-414. RNase H assay are performed to obtain cleavage rates and
cleavage maps.
Example 11. Certain Example Oligonucleotides and Oligonucleotide
Compositions
[1926] Stereorandom oligonucleotides with different 2' substitution
chemistries targeting three distinct regions of FOXO1 mRNA with the
thermal melting temperatures when duplexed with complementary RNA.
The concentration of each strand was 1 uM in 1.times.PBS
buffer.
TABLE-US-00051 SEQ Oligo Sequence Description Tm (.degree. C.) ID
NO: ONT-316 TeosAeosGeos5mCeos5mCeosdAsdTsdTsdGs5md 5-10-5 (2'-MOE
76.7 670 CsdAsdGs5mdCsdTsdGs5mCeosTeos5mCeosAeos Gapmer) 5mCeo
ONT-355 dTsdAsdGsdCsdCsdAsdTstsgscsasgscsdTsdGsdCs 7-6-7 (DNA-2'-
71.2 671 dTsdCsdAsdC OMe-DNA) Gapmer ONT-361
tsasgsdCsdCsdAsdTsdTsdGsdCsdAsdGsdCsdTsdG 3-14-3 (2'-OMe- 65.8 672
sdCsdTscsascs DNA-2'-OMe) Gapmer ONT-367
dTsdAsdGsdCsdCsdAsdTsdTsdGsdCsdAsdGsdCsd All DNA 62.9 673
TsdGsdCsdTsdCsdAsdC ONT-373
tsasgscscsdAsdTsdTsdGsdCsdAsdGsdCsdTsdGscst 5-10-5 (2'-OMe 71.8 674
scsasc Gapmer) ONT-388 rGrUrGrArGrCrArGrCrUrGrCrArArUrGrGrCrUrA
Complementary 675 RNA ONT-302
Teos5mCeos5mCeosAeosGeosdTsdTs5mdCs5mdC 5-10-5 (2'-MOE 72.5 676
sdTsdTs5mdCsdAsdTsdTs5mCeosTeosGeos5mCe Gapmer) osAeo ONT-352
dTsdCsdCsdAsdGsdTsdTscscststscsasdTsdTsdCsd 7-6-7 (DNA-2'- 65.4 677
TsdGsdCsdA OMe-DNA) Gapmer ONT-358
tscscsdAsdGsdTsdTsdCsdCsdTsdTsdCsdAsdTsdTs 3-14-3 (2'-OMe- 62.6 678
dCsdTsgscsas DNA-2'-OMe) Gapmer ONT-364
dTsdCsdCsdAsdGsdTsdTsdCsdCsdTsdTsdCsdAsd All DNA 58.4 679
TsdTsdCsdTsdGsdCsdA ONT-370
tscscsasgsdTsdTsdCsdCsdTsdTsdCsdAsdTsdTscsts 5-10-5 (2'-OMe 68 680
gscsa Gapmer) ONT-386 rUrGrCrArGrArArUrGrArArGrGrArArCrUrGrGrA
Complementary 681 RNA ONT-315
TeosGeosAeosGeosAeosdTsdGs5mdCs5mdCsdTs 5-10-5 (2'-MOE 77.5 682
dGsdGs5mdCsdTsdGs5mCeos5mCeosAeosTeosAeo Gapmer) ONT-354
dTsdGsdAsdGsdAsdTsdGscscstsgsgscsdTsdGsdCs 7-6-7 (DNA-2'- 75.5 683
dCsdAsdTsdA OMe-DNA) Gapmer ONT-360
tsgsasdGsdAsdTsdGsdCsdCsdTsdGsdGsdCsdTsdG 3-14-3 (2'-OMe- 69 684
sdCsdCsastsas DNA-2'-OMe) Gapmer ONT-366
dTsdGsdAsdGsdAsdTsdGsdCsdCsdTsdGsdGsdCs All DNA 66.5 685
dTsdGsdCsdCsdAsdTsdA ONT-372
tsgsasgsasdTsdGsdCsdCsdTsdGsdGsdCsdTsdGscs 5-10-5 (2'-OMe 74.4 686
csastsa Gapmer) ONT-387 rUrArUrGrGrCrArGrCrCrArGrGrCrArUrCrUrCrA
Complementary 687 RNA
[1927] Additional example stereorandom oligonucleotide compositions
are listed below.
TABLE-US-00052 SEQ ID Oligo Sequence (5' to 3') NO: ONT-41
(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCsTsTs5mCs](Gs 688
5mCsAs5mCs5mC).sub.MOE ONT-70
(Gs5mCs).sub.MOEd[GsTsTsTsGs5mCsTs5mCsTsTs5mCsTsTs](5mCsTsT 689
sGs5mCGs).sub.MOEd[TsTsTsTs](TsT).sub.MOE ONT-83
(GsTs5mCs5mCs5mCs).sub.MOEd(TsGsAsAsGsAsTsGsTs5mCs](AsAsTs 690
Gs5mC).sub.MOE ONT-302
(Ts5mCs5mCsAsGs).sub.MOEd[TsTs5mCs5mCsTsTs5mCsAsTsTs](5mCs 691
TsGs5mCsA).sub.MOE ONT-315
(TsGsAsGsAs).sub.MOEd[TsGs5mCs5mCsTsGsGs5mCsTsGs](5mCs5mCs 692
AsTsA).sub.MOE ONT-316
(TsAsGs5mCs5mCs).sub.MOEd[AsTsTsGs5mCsAsGs5mCsTsGs5m] 693
(CsTs5mCsAs5mC).sub.MOE ONT-352
[TsCsCsAsGsTsTs](cscststscsas).sub.OMed[TsTsCsTsGsCsA] 694 ONT-354
[TsGsAsGsAsTsGs](CsCsTsGsGsCs).sub.OMed[TsGsCsCsAsTsA] 695 ONT-355
[TsAsGsCsCsAsTs](TsGsCsAsGsCs).sub.OMed[TsGsCsTsCsAsC] 696 ONT-358
(TsCsCs).sub.OMed[AsGsTsTsCsCsTsTsCsAsTsTsCsTs](GsCsA).sub.OMe 697
ONT-360
(TsGsAs).sub.OMed[GsAsTsGsCsCsTsGsGsCsTsGsCsCs](AsTsA).sub.OMe 698
ONT-361
(TsAsGs).sub.OMed[CsCsAsTsTsGsCsAsGsCsTsGsCsTs](CsAsC).sub.OMe 699
ONT-364 [TsCsCsAsGsTsTsCsCsTsTsCsAsTsTsCsTsGsCsA] 700 ONT-366
[TsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsTsA] 701 ONT-367
[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] 702 ONT-370
(TsCsCsAsGs).sub.OMed[TsTsCsCsTsTsCsAsTsTs](CsTsGsCsA).sub.OMe 703
ONT-372
(TsGsAsGsAs).sub.OMed[TsGsCsCsTsGsGsCsTsGs](CsCsAsTsA).sub.OMe 704
ONT-373
(TsAsGsCsCs).sub.OMed[AsTsTsGsCsAsGsCsTsGs](CsTsCsAsC).sub.OMe 705
ONT-440 (UsAsGsCsCs).sub.Fd[AsTsTsGsCsAsGsCsTsGsCsTsCsAsC] 706
ONT-441 (UsAsGsCsCs).sub.Fd[AsTsTsGsCsAsGsCsTsGsC] 707 ONT-460
(TsAsGsCsCs).sub.OMed[AsTsTsGsCsAsGsCsTsGsCsTsCsAsC] 708 ONT-450
[AsTsTsAsAsTsAsAsAsTsTsGsTsCsAsTsCsAsCsC] 709
[1928] Example RNA and DNA oligonucleotides are listed below.
TABLE-US-00053 SEQ ID Oligo Sequence (5' to 3') NO: ONT-28
rGrGrUrGrCrGrArArGrCrArGrArCrUrGrAr 710 GrGrC ONT-386
rUrGrCrArGrArArUrGrArArGrGrArArCrUr 711 GrGrA ONT-
rUrArUrGrGrCrArGrCrCrArGrGrCrArUrCr 712 387 UrCrA ONT-
rGrUrGrArGrCrArGrCrUrGrCrArArUrGrGr 713 388 CrUrA ONT-
d[TAGCCATTGCAGCTGCTCAC] 714 415 ONT-
rGrUrGrArGrCrGrGrCrUrGrCrArArUrGrGr 715 442 CrUrA ONT-
rGrUrGrArGrCrArGrCrUrGrCrGrArUrGrGr 716 443 CrUrA ONT-
rGrGrUrGrArUrGrArCrArArUrUrUrArUrUr 717 453 ArArU ONT-
rGrGrUrGrArUrGrGrCrArArUrUrUrArUrUr 718 454 ArArU
[1929] Example chirally pure oligonucleotides are presented below.
In some embodiments, the present disclosure provides corresponding
chirally controlled oligonucleotide compositions of each of the
following example oligonucleotides.
TABLE-US-00054 SEQ Oligo Stereochemistry/Sequence (5' to 3')
Description ID NO: ONT-389 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp,
Rp, Sp, Sp, 7S-(RSS).sub.3- 719 Rp, Sp, Sp, Sp, Sp, Sp)- 3S
d[TsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsTsA] ONT-390 (Sp, Sp, Sp, Sp,
Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, 6S-(RSS).sub.3- 720 Sp, Sp, Sp,
Sp, Sp, Sp)- 4S d[TsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsTsA] ONT-391
(Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp,
5S-(RSS).sub.3- 721 Sp, Sp, Sp, Sp, Sp, Sp)- 5S
d[TsGsAsGsAsTsGsCsCsTsGsGsCsTsGsCsCsAsTsA] ONT-392 (Sp, Sp, Sp, Sp,
Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, 7S-(RSS).sub.3- 722 Rp, Sp, Sp,
Sp, Sp, Sp)- 3S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-393
(Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp,
6S-(RSS).sub.3- 723 Sp, Sp, Sp, Sp, Sp, Sp)- 4S
d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-394 (Sp, Sp, Sp, Sp,
Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, 5S-(RSS).sub.3- 724 Sp, Sp, Sp,
Sp, Sp, Sp)- 5S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-396
(Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 18S-1R 725 Sp,
Sp, Sp, Sp, Sp, Rp)- d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC]
ONT-397 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 17S-RS
726 Sp, Sp, Sp, Sp, Rp, Sp)-
d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-398 (Sp, Sp, Sp, Sp,
Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 16S-(RSS) 727 Sp, Sp, Sp, Rp,
Sp, Sp)- d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-399 (Sp,
Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 15S-(RSS)- 728 Sp,
Sp, Rp, Sp, Sp, Sp)- 1S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC]
ONT-400 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp,
14S-(RSS)- 729 Sp, Rp, Sp, Sp, Sp, Sp)- 2S
d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-401 (Sp, Sp, Sp, Sp,
Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 13S-(RSS)- 730 Rp, Sp, Sp, Sp,
Sp, Sp)- 3S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-402 (Sp,
Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, 12S-(RSS)- 731 Sp,
Sp, Sp, Sp, Sp, Sp)- 4S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC]
ONT-403 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp,
11S-(RSS)- 732 Sp, Sp, Sp, Sp, Sp, Sp)- 5S
d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-404 (Sp, Sp, Sp, Sp,
Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, 10S-(RSS)- 733 Sp, Sp, Sp, Sp,
Sp, Sp)- 6S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-405 (Sp,
Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, 9S-(RSS)- 734 Sp,
Sp, Sp, Sp, Sp, Sp)- 7S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC]
ONT-406 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp,
8S-(RSS)- 735 Sp, Sp, Sp, Sp, Sp, Sp)- 8S
d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-407 (Sp, Sp, Sp, Sp,
Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, 7S-(RSS)- 736 Sp, Sp, Sp, Sp,
Sp, Sp)- 9S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-408 (Sp,
Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, 6S-(RSS)- 737 Sp,
Sp, Sp, Sp, Sp, Sp)- 10S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC]
ONT-409 (Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp,
5S-(RSS)- 738 Sp, Sp, Sp, Sp, Sp, Sp)- 11S
d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-410 (Sp, Sp, Sp, Sp,
Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 4S-(RSS)- 739 Sp, Sp, Sp, Sp,
Sp, Sp)- 12S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-411
(Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 3S-(RSS)- 740
Sp, Sp, Sp, Sp, Sp, Sp)- 13S
d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-412 (Sp, Sp, Rp, Sp,
Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 2S-(RSS)- 741 Sp, Sp, Sp, Sp,
Sp, Sp)- 14S d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-413
(Sp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, S-(RSS)- 742
Sp, Sp, Sp, Sp, Sp, Sp)- 15S
d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-414 (Rp, Sp, Sp, Sp,
Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, (RSS)-16S 743 Sp, Sp, Sp, Sp,
Sp, Sp)- d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-421
All-(Sp)- All S 744 d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC]
ONT-422 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp,
8S-(RSS)- 745 Sp, Rp, Sp, Sp, Sp, Sp)-C6-amino- 3S-(RSS)-
d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] 2S ONT-455 All-(Rp)- All
R 746 d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-451 (Sp, Sp,
Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 13S-(RSS)- 747 Rp, Sp,
Sp, Sp, Sp, Sp)- 3S d[AsTsTsAsAsTsAsAsAsTsTsGsTsCsAsTsCsAsCsC]
ONT-452 (Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp,
14S-(RSS)- 748 Sp, Rp, Sp, Sp, Sp, Sp)- 2S
d[AsTsTsAsAsTsAsAsAsTsTsGsTsCsAsTsCsAsCsC] ONT-75 All-(Rp)- All R
749 (Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs
5mCsTsTs5mCs](Gs5mCsAs5mCs5mC).sub.MOE ONT-76 (Sp, Rp, Rp, Sp, Rp,
Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, SRRSR- 750 Sp, Rp, Sp, Rp)-
11S-RSR (Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCs
TsTs5mCs](Gs5mCsAs5mCs5mC).sub.MOE ONT-77 (Rp, Rp, Rp, Rp, Rp, Sp,
Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, 5R-10S-4R 751 Sp, Rp, Rp, Rp, Rp)-
(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCsTs
Ts5mCs](Gs5mCsAs5mCs5mC).sub.MOE ONT-80 All-(Sp)- All S 752
(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCsTs
Ts5mCs](Gs5mCsAs5mCs5mC).sub.MOE ONT-81 (Sp, Sp, Sp, Sp, Sp, Rp,
Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, 5S-10R-4S 753 Rp, Sp, Sp, Sp, Sp)-
(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCs
TsTs5mCs](Gs5mCsAs5mCs5mC).sub.MOE ONT-82 All-(Rp)- All R 754
(GsTs5mCs5mCs5mCs).sub.MOEd[TsGsAsAsGsAsTsGsTs
5mCs](AsAsTsGs5mC).sub.MOE ONT-84 All-(Sp)- All S 755
(GsTs5mCs5mCs5mCs).sub.MOEd[TsGsAsAsGsAsTsGsTs
5mCs](AsAsTsGs5mC).sub.MOE ONT-85 (Rp, Rp, Rp, Rp, Rp, Sp, Sp, Sp,
Sp, Sp, Sp, Sp, Sp, Sp, 5R-10S-4R 756 Sp, Rp, Rp, Rp, Rp)-
(GsTs5mCs5mCs5mCs).sub.MOEd[TsGsAsAsGsAsTsGsTs
5mCs](AsAsTsGs5mC).sub.MOE ONT-86 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp,
Rp, Rp, Rp, Rp, Rp, Rp, 5S-10R-4S 757 Rp, Sp, Sp, Sp, Sp)-
(GsTs5mCs5mCs5mCs).sub.MOEd[TsGsAsAsGsAsTsGsTs
5mCs](AsAsTsGs5mC).sub.MOE ONT-87 (Rp, Rp, Rp, Rp, Rp, Sp, Sp, Rp,
Sp, Sp, Rp, Sp, Sp, Rp, 5R-2S- 758 Rp, Rp, Rp, Rp, Rp)-
(RSS).sub.2-6R (Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCs
TsTs5mCs](Gs5mCsAs5mCs5mC).sub.MOE ONT-88 (Sp, Sp, Sp, Sp, Sp, Rp,
Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, 5S-(RRS).sub.3- 759 Sp, Sp, Sp, Sp,
Sp)- 5S (Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCsTs
Ts5mCs](Gs5mCsAs5mCs5mC).sub.MOE ONT-89 (Sp, Rp, Sp, Rp, Sp, Rp,
Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, (SR).sub.9S 760 Sp, Rp, Sp, Rp,
Sp)- (Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCs
TsTs5mCs](Gs5mCsAs5mCs5mC).sub.MOE ONT-154 (Sp, Sp, Sp, Sp, Sp, Sp,
Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, 7S-(RSS).sub.3- 761 Sp, Sp, Sp,
Sp)- 3S d[Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsTs
5mCsGs5mCsAs5mCs5mC] ONT-75 All-(Rp)- All-R 762
(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCs TsTs5mCs]
(Gs5mCsAs5mCs5mC).sub.MOE ONT-80 All-(Sp)- All-S 763
(Gs5mCs5mCsTs5mCs).sub.MOEd[AsGsTs5mCsTsGs5mCs TsTs5mCs]
(Gs5mCsAs5mCs5mC).sub.MOE
[1930] Additional example oligonucleotides targeting FOXO1 with Tm
are presented below. In some embodiments, the present disclosure
provides corresponding chirally controlled oligonucleotide
compositions of each of the following example oligonucleotides.
TABLE-US-00055 SEQ ID Oligo Sequence (5' to 3') Tm (.degree. C.)
NO: ONT-439 [UsAsGs].sub.Fd[CsCsAsTsTsGsCsAsGsCsTsGsCsTs][CsAs 68.3
764 C].sub.F ONT-440
[UsAsGsCsCs].sub.Fd[AsTsTsGsCsAsGsCsTsGsCsTsCsAsC] 70.0 765 ONT-441
[UsAsGsCsCs].sub.Fd[AsTsTsGsCsAsGsCsTsGsC] 65.5 766 ONT-455
All-(Rp)- 66.8 767 d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC]
ONT-316 [TsAsGs5mCs5mCs].sub.MOEd[AsTsTsGs5mCsAsGs5mCsTs 76.9 768
Gs][5mCsTs5mCsAs5mC].sub.MOE ONT-367
d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] 62.8 769 ONT-415
d[TAGCCATTGCAGCTGCTCAC] 72.6 770 ONT-416
[TsAsGsCsCsAsTsTsGsCsAsGsCs].sub.OMed[TsGsCsTsCsAs 78.4 771 C]
ONT-421 All-(Sp)- 59.2 772
d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-394 (Sp, Sp, Sp, Sp,
Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, 60.0 773 Sp, Sp, Sp, Sp, Sp,
Sp)- d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC] ONT-406 (Sp, Sp,
Sp, Sp, Sp, Sp, Sp, Sp, Rp, Sp, Sp, Sp, Sp, 58.5 774 Sp, Sp, Sp,
Sp, Sp, Sp)- d[TsAsGsCsCsAsTsTsGsCsAsGsCsTsGsCsTsCsAsC]
Example 12. Example Additional Controlled Cleavage by Provided
Chirally Controlled Oligonucleotide Compositions
[1931] As will be appreciated by those skilled in the art, example
data illustrated in FIG. 26 confirm that provided chirally
controlled oligonucleotide compositions and methods thereof
provided unexpected results compared to reference compositions,
such as stereorandom oligonucleotide compositions. Among other
things, chirally controlled oligonucleotide compositions can
produce controlled cleavage patterns, including but not limited to
controlling of positions of cleavage sites, numbers of cleavage
sites, and relative cleavage percentage of cleavage sites. See also
example data presented in FIG. 27.
Example 13. Stability of Chirally Controlled Oligonucleotide
Compositions
[1932] As will be appreciated by those skilled in the art, example
data illustrated in FIG. 26 confirm that stability of provided
chirally controlled oligonucleotide compositions can be adjusted by
varying patterns of backbone chiral centers. For example data, see
FIG. 7 and FIG. 28. An example protocol for performing serum
stability experiment is described below.
[1933] Protocol:
[1934] P-stereochemically pure PS DNA (ONT-396-ONT-414 (single Rp
walk from 3'end to 5'end)), stereorandom PS DNA (ONT-367), all-Sp
PS DNA (ONT-421) and all-Rp PS DNA (ONT-455) were incubated in Rat
serum (Sigma, R9759) (0 h and 48 h) and analyzed by IEX-HPLC.
[1935] Incubation Method:
[1936] 5 .mu.L of 250 .mu.M of each DNA solutions and 45 .mu.L of
Rat serum were mixed and incubated at 37.degree. C. for each time
points (0 h and 48 h). At each time points, reaction was stopped by
adding 25 .mu.L of 150 mM EDTA solution, 30 .mu.L of Lysis buffer
(erpicentre, MTC096H) and 3 .mu.L of Proteinase K solution (20
mg/mL). The mixture was incubated at 60.degree. C. for 20 min then
20 .mu.L of the mixture was injected to IEX-HPLC and analyzed.
[1937] Incubation Control Sample:
[1938] Mixture of 5 .mu.L of 250 .mu.M of each DNA solutions and
103 .mu.L of 1.times.PBS buffer were prepared and 20 .mu.L of the
mixture was analyzed by IEX-HPLC as controls in order to check the
absolute quantification.
[1939] Example Analytical Method:
IEx-HPLC
A: 10 mM TrisHCl, 50% ACN (pH 8.0)
B: 10 mM TrisHCl, 800 mM NaCl, 50% ACN (pH 8.0)
[1940] C: Water-ACN (1:1, v/v)
Temp: 60.degree. C.
Column: DIONEX DNAPac PA-100, 250.times.4 mm
Gradient:
TABLE-US-00056 [1941] Time Flow % A % B % C % D Curve 1 0.00 1.00
95.0 5.0 0.0 0.0 6 2 1.00 1.00 95.0 5.0 0.0 0.0 1 3 2.00 1.00 75.0
25.0 0.0 0.0 6 4 10.00 1.00 5.0 95.0 0.0 0.0 6 5 10.10 1.00 95.0
5.0 0.0 0.0 6 6 12.50 1.00 95.0 5.0 0.0 0.0 1
Washing:
TABLE-US-00057 [1942] Time Flow % A % B % C % D Curve 1 0.01 1.00
0.0 0.0 100.0 0.0 6 2 5.50 1.00 0.0 0.0 100.0 0.0 1 3 5.60 1.00 0.0
100.0 0.0 0.0 6 4 7.50 1.00 0.0 100.0 0.0 0.0 1 5 7.60 1.00 95.0
5.0 0.0 0.0 6 6 12.50 1.00 95.0 5.0 0.0 0.0 1
Column Temperature: 60.degree. C.
[1943] Washing was performed every after the sample run. Percentage
of remained PS DNA was calculated by the analysis of the ratio from
the 0 h to 48 h using the area of integration of HPLC
chromatogram.
Example 14. Example Analytical Results (FIG. 19)
[1944] Peak Assignments for FIG. 19 (Top Panel, M12-Exp11 B10,
ONT-354, 30 Min)
TABLE-US-00058 Retention time (minutes) (M-2).sup.2- (M-3).sup.3-
(M-4).sup.4- (M-5).sup.5- (M-6).sup.6- 2.34 1100.6 733.7 11.91
1390.6 1042.6 13.07 1500.08 1125.5 750.73 1805.29 1354.19 13.58
1603.39 1202.2 961.35 801.15 14.80 1589.9 1271.4 1059.5 18.59
1653.3 1323.3 1101.6 Retention Assignment based on mass match time
Observed 5'-p-RNA 3'-OH and 5'-OH, (minutes) MW fragment RNA DNA
2.34 2203.2 7mer 11.91 4176 13mer 13.07 4505.7 14mer 5418.87 17mer
13.58 4812.8 15mer 14.80 6362.5 20mer, ONT-387 18.59 6615.4
ONT-354
[1945] Peak Assignments for FIG. 19 (Bottom Panel, M12-Exp11 A10,
ONT-315, 30 Min)
TABLE-US-00059 Retention time (minutes) (M-2).sup.2- (M-3).sup.3-
(M-4).sup.4- (M-5).sup.5- (M-6).sup.6- 4.01 1425.33 950.15 4.4
1100.83 733.69 4.94 1578.34 1051.54 6.21 1741.91 1161.89 870.37
1445.42 963.31 722.97 8.48 1610 1073.3 9.15 1391.2 1043.1 9.93
1763.4 1174.7 11.8 1602.3 1201.7 14.82 20.73 1809.94 1447.82 1205.9
Retention Assignment based on mass match time Observed 5'-p-RNA
3'-OH and 5'-OH, (minutes) MW fragment RNA DNA 4.01 2853.45 9mer
4.4 2203.66 7mer 4.94 3158.47 10mer 6.21 3487.52 11mer 2892.84 9mer
8.48 3220.94 10mer 9.15 4177 13mer 9.93 3528.88 11mer 11.8 4810
15mer 14.82 20mer, ONT-387 20.73 7244.3 ONT-315
Example 15. Example Analytical Results (FIG. 30)
[1946] Peak Assignments for FIG. 30 (Top Panel, M12-Exp11 D2,
ONT-367, 30 Min)
TABLE-US-00060 Retention time (minutes) (M-2).sup.2- (M-3).sup.3-
(M-4).sup.4- (M-5).sup.5- (M-6).sup.6- 2.36 1120.28 746.25 3.15
1292.41 861.32 4.04 975.92 4.49 1140.6 759.78 5.83 1305.21 869.65
652.31 6.88 1923.23 1281.69 961.28 9.32 1390.76 1043.29 833.72 9.96
1783.85 1187.98 891.6 712.94 11.01 1936.14 1289.93 1501.52 1125.4
899.89 11.93 1405.25 1053.78 842.84 13.15 1514.72 1135.72 14.81
1609.95 1287.53 1072.58 18.33 1587.9 1270.2 1058.3 Retention
Assignment based on mass match time Observed 5'-p-RNA 3'-OH and
5'-OH, (minutes) MW fragment RNA DNA 2.36 2242.56 7mer 3.15 2586.82
8mer 4.04 1953.84 6mer 4.49 2283.2 7mer 5.83 2612.42 8mer 6.88
3849.14 12mer 9.32 4175.28 13mer 9.96 3569.7 11mer 11.01 3874.28
12mer 4507.56 14mer 11.93 4218.75 13mer 13.15 4547.16 14mer 14.81
6441.8 20mer, ONT-388 18.33 6355.6 ONT-367
[1947] Peak Assignments for FIG. 30 (Bottom Panel, M12-Exp21 NM
Plate1 (Pool) F11 ONT-406 30 Min
TABLE-US-00061 Retention time (minutes) (M-2).sup.2- (M-3).sup.3-
(M-4).sup.4- (M-5).sup.5- (M-6).sup.6- 4.72 1140.6 759.78 9.46
1390.76 1043.29 833.72 16.45 1609.95 1287.53 1072.58 19.48 1588.1
1270.4 1058.4 Retention Assignment based on mass match time
Observed 5'-p-RNA 3'-OH and 5'-OH, (minutes) MW fragment RNA DNA
4.72 2203.2 2283.2 7mer 9.46 4176 4175.28 13mer 16.45 6362.5 6441.8
20mer, ONT-388 19.48 6615.4 6355.9
Example 16. Example Preparation of Linkers
[1948] In some embodiments, the SP linker was prepared following
the scheme below:
##STR00377##
Example 17. Example Designs of Base Sequence
[1949] As described in the present disclosure, the present
disclosure recognizes the importance of base sequence, e.g., for
provided chirally controlled oligonucleotide composition. In some
embodiments, the present disclosure, as exemplified herein,
provides methods for designing base sequence for oligonucleotides,
such as antisense oligonucleotides.
[1950] In some embodiments, among other things, bioinformatics is
used to design a sequence for a target, e.g., a disease-associated
mutant allele of Huntington's disease. The present example
describes example steps that may be used for design antisense
oligonucleotides for, e.g., rs362268, rs362306, rs2530595,
rs362331, rs362307, etc. In some embodiments, a provided methods
comprising a step of examining sequence features for off-target,
binding affinity with target, contiguous Gs, and paliandromic
moieties. In some embodiments, a provided methods comprising a step
of examining off-target effects in the presence of mismatches. In
some embodiments, a sequence found in a target comprising a
characteristic sequence element, e.g., a mutation, a SNP, etc., and
having a length of about 10-1000, e.g., about 10, about 20, about
30, about 40, about 50, about 60, about 70, about 80, about 90,
about 100, about 110, about 120, about 130, about 140, about 150,
about 200, about 250, about 300, about 400, about 500, about 600,
about 700, about 800, about 900, about 1000, about 2000, about
3000, about 4000, about 5000, etc., nucleotides are used in assays,
e.g., RNase H assay, reporter assay, etc. In some embodiments, as
in the present example, 40-bp flanking sequences for a SNP, e.g.,
rs362268, rs362306, rs2530595, rs362331, rs362307, etc., were used.
A number of such sequences, for example 6 to 12, could be readily
assessed by provided methods. Example tested sequences are listed
in FIG. 42.
[1951] As described in the present disclosure and understood by a
person having ordinary skill in the art, in some embodiments,
assays, for example, RNase cleavage assay described herein, are
useful in the assessment of one or more features (e.g., rate,
extent, and/or selectivity of cleavage). In some embodiments, an
RNase cleavage assay provides a cleavage pattern of an
oligonucleotide composition. In some embodiments, a composition of
DNA oligonucleotides having the same sequence is used, an RNase H
assay may provide a DNA cleavage pattern of the sequence. In some
embodiments, for generating a DNA cleavage pattern, all DNA
oligonucleotides in the composition are identical. In some
embodiments, when a stereorandom composition of
all-phosphorothioate oligonucleotides having the same sequence is
used, an RNase H assay may provide a stereorandom cleavage pattern
of the sequence. In some embodiments, for generating stereorandom
cleavage pattern, all oligonucleotides in the stereorandom
composition are identical. In some embodiments, when a chirally
controlled oligonucleotide composition is used, an RNase H assay
may provide a stereorandom cleavage pattern of the chirally
controlled oligonucleotide composition. In some embodiments, for
generating cleavage pattern of a chirally controlled
oligonucleotide composition, all oligonucleotides in the chirally
controlled oligonucleotide composition are identical. In some
embodiments, an RNase H assay provides cleavage rate information.
In some embodiments, an RNase H assay provides relative cleavage
extent, e.g., (cleavage at a site)/(all cleavage). In some
embodiments, an RNase H assay provides absolute cleavage extent,
(cleaved target at a site)/(all target both cleaved and
non-cleaved). In some embodiments, an RNase H assay provides
selectivity. In some embodiments, an RNase H assay provides
suppression level information.
[1952] In some embodiments, as exemplified herein, an RNase H assay
provides cleavage rates. For example results, see FIG. 31. P
represents position of mismatch in oligonucleotides from the
5'-end.
[1953] Analysis of human RNase H1 cleavage of a 25-mer RNA when
hybridized with different phosphorothioate oligonucleotides
targeting rs362307 SNP was performed. WV-944 and WV-945 are 25mer
RNAs which include WT and mutant variant of rs362307, respectively.
WV-936 to WV-941 are stereopure DNAs while WV-904 to WV-909 are all
stereorandom DNAs. All duplexes were incubated with RNase H1C in
the presence of 1.times.RNase H buffer at 37.degree. C. Reactions
were quenched at fixed time points by 30 mM Na.sub.2EDTA. One tenth
of this reaction mixture was injected on Reverse Phase HPLC and
peak areas were measured for full length RNA remaining in the
reaction mixtures at different time points. Cleavage rates were
determined by plotting these peak areas with respective time
points. In some embodiments, differentiation between rates of
cleavage of WT RNA vs. mu RNA was observed.
[1954] In some embodiments, as shown in FIG. 31, when position 11,
12 or 13 of a sequence as counted from its 5'-terminus aligns with
a SNP, or position 8, 9 or 10 of a sequence as counted from its
3'-terminus aligns with a SNP, better cleavage selectivity was
observed.
Example 18. Example Wing, Core, Wing-Core, Core-Wing and
Wing-Core-Wing Designs
[1955] Among other things, the present disclosure provides various
embodiments of wing, core, wing-core, core-wing, and wing-core-wing
structures. In some embodiments, it was surprisingly found that
oligonucleotides with wings comprising phosphate linkages and cores
comprising phosphorothioate linkages provided unexpectedly
increased cleavage efficiency and selectivity. For example, see
FIG. 32 C, F, G, H, etc.
[1956] Analysis of human RNase H1 cleavage of a 25-mer RNA when
hybridized with different chirally controlled oligonucleotide
compositions targeting rs362307 SNP. WV-944 and WV-945 are 25mer
RNAs which include WT and mutant variant of rs362307, respectively.
WV-1085 to WV-1092 are all stereopure 2'-OMe/DNAs with mixed PO/PS
backbone. All duplexes were incubated with RNase H1C in the
presence of 1.times.RNase H buffer at 37.degree. C. Reactions were
quenched at fixed time points by 30 mM Na.sub.2EDTA. One tenth of
this reaction mixture was injected on Reverse Phase HPLC and peak
areas were measured for full length RNA remaining in the reaction
mixtures at different time points. Cleavage rates were determined
by plotting these peak areas with respective time points.
[1957] In some embodiments, 2'-OMe phosphate wings change cleavage
rate and/or selectivity. In some embodiments, 2'-OMe phosphate
wings change cleavage rate and selectivity. In some embodiments,
2'-OMe phosphate wings change cleavage rate or selectivity. In some
embodiments, 2'-OMe phosphate wing change cleavage rate. In some
embodiments, 2'-OMe phosphate wing change cleavage rates of both
the mutant and the wild-type allele. In some embodiments, 2'-OMe
phosphate wing change cleavage selectivity. In some embodiments,
2'-OMe phosphate wing change cleavage pattern.
[1958] In some embodiments, incorporation of a phosphate
internucleotidic linkage surprisingly improves cleavage rate and/or
selectivity. In some embodiments, incorporation of a phosphate
internucleotidic linkage surprisingly improves cleavage rate and
selectivity. In some embodiments, incorporation of a phosphate
internucleotidic linkage surprisingly improves cleavage rate or
selectivity. In some embodiments, incorporation of a phosphate
internucleotidic linkage surprisingly improves cleavage rate. In
some embodiments, a phosphate internucleotidic linkage improves
cleavage rates of both the mutant and the wild-type allele, but at
a greater level for the mutant than for the wild-type allele. In
some embodiments, incorporation of a phosphate internucleotidic
linkage surprisingly improves cleavage selectivity.
[1959] In some embodiments, as demonstrated by data exemplified
herein, stereopure oligonucleotide compositions provided
surprisingly high cleavage rate and/or selectivity compared to
corresponding stereorandom compositions; for examples, see
stereopure WV-1497/stereorandom WV-1092, 905/937, 931/1087,
etc.
Example 19. Example Cleavage Maps
[1960] As described herein, in some embodiments, an assay, such as
RNase H assay, provides cleavage maps for stereorandom or chirally
controlled oligonucleotide compositions. Example cleavage maps are
illustrated in FIG. 33, which exemplifies stereorandom cleavage
patterns of multiple base sequences. Additional cleavage maps are
presented in FIG. 35, which exemplifies, among other things,
stereorandom cleavage patterns of base sequence having no
nucleoside modifications (WV-905), as well as base sequence having
nucleoside modifications.
[1961] Example cleavage patterns of chirally controlled stereopure
oligonucleotide compositions are presented in FIG. 34. As described
in the present disclosure, major cleavage sites may be identified
through assays such RNase H assay from cleavage patterns. For
example, for WV-937, the relative major cleavage site, as assessed
by (cleavage at the site/total cleavage) and reflected by the
lengths of the arrows, are between GCGC and CCUU for the wild-type
(2 internucleotidic linkages away from the SNP), and between CUGU
and GCCC for the mutant (at the SNP site, 0 internucleotidic
linkage away from the SNP). In some embodiments, a relative major
cleavage site is not necessarily an absolute major cleavage site,
which requires certain percentage of the total target, in this
case, RNA, is cleaved at the site. For example, in some
embodiments, the site between GCGC and CCUU for WV-937/wild type is
not a major cleavage site if over 20% of total target needs to be
cleaved at a site for a site to qualify as a major cleavage site
(see FIG. 32, M); the site between CUGU and GCCC for WV-937/mutant
remains a major cleavage site if the threshold for a major site is
20% of total target being cleaved at that site.
[1962] In some embodiments, different oligonucleotide compositions
have different cleave rates. In some embodiments, cleavage maps are
generated at different time points. For example, for an
oligonucleotide composition having a faster cleavage rate, its
cleavage map can be generated at an earlier time point (e.g., 5
minutes, 10 minutes, 15 minutes, etc.) than an oligonucleotide
composition having a slower cleavage rate (e.g., 30 minutes, 45
minutes, 60 minutes, etc.).
[1963] In some embodiments, when cleavage products at only one site
can be identified by an analytical methods, e.g., HPLC, HPLC-MS,
etc., the corresponding cleavage pattern is considered to have a
single cleavage site. In some embodiments, when greater than about
90%, greater than about 91%, greater than about 92%, greater than
about 93%, greater than about 94%, greater than about 95%, greater
than about 96%, greater than about 97%, greater than about 98%,
greater than about 99%, or greater than about 99.5% of total
cleavage occurs at a site, the corresponding cleavage pattern may
be considered to have a single cleavage site. In some embodiments,
as understood by a person having ordinary skill in the art,
selectivity in e.g., cells, tissues, organs, subjects, etc., may be
higher than that observed in an RNase H assay. In some embodiments,
a site having greater than about 90%, greater than about 91%,
greater than about 92%, greater than about 93%, greater than about
94%, greater than about 95%, greater than about 96%, greater than
about 97%, greater than about 98%, greater than about 99%, or
greater than about 99.5% of total cleavage in an RNase H assay may
have higher selectivity in cells, tissues, organs, or subjects. In
some embodiments, a site having greater than about 90% of total
cleavage in an RNase H assay may be the only cleavage site (e.g.,
greater than about 99%, greater than about 99.5%, 100%, etc.) in
cells, tissues, organs, or subjects.
[1964] In some embodiments, selectivity may be assessed by
comparing absolute values of remaining transcripts (or
representative sequences thereof, such as RNA sequences used in
examples described herein) of a target sequence and a similar
sequence, e.g., RNA, or representative synthetic sequences, of a
mutant allele as a target, and a wild-type allele as a similar
sequence. In some embodiments, selectivity may be assessed by
comparing absolute amounts of remaining transcripts (or
representative sequences thereof, such as RNA sequences used in
examples described herein) of a target sequence and a similar
sequence, when the starting amounts are the same. In some
embodiments, selectivity may be assessed by percentages of cleavage
of transcripts (or representative sequences thereof, such as RNA
sequences used in examples described herein) of a target sequence
and a similar sequence. In some embodiments, selectivity may be
assessed by comparing ratios of cleaved and non-cleaved transcripts
(or representative sequences thereof, such as RNA sequences used in
examples described herein).
[1965] In some embodiments, selectivity can be assessed by one or
more assays exemplified herein. In some embodiments, selectivity
can be measured by an RNase H cleavage assay. For example,
selective cleavage of a target (e.g., RNA from a mutant allele) can
be measured by a biochemical RNase H cleavage assay, wherein
cleavage of a mutant target sequence is compared to that of a
wild-type RNA sequence, and the selectivity can be represented by
either the rate of cleavage, ratio of cleaved mutant RNA and
wild-type RNA at a time point, or ratio of remaining mutant RNA and
wild-type RNA at a time point, or combinations thereof. In some
embodiments, a time point is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50,
55, 60 or more minutes. In some embodiments, a time point is 10
minutes. In some embodiments, a time point is 15 minutes. In some
embodiments, a time point is 20 minutes. In some embodiments, a
time point is 25 minutes. In some embodiments, a time point is 30
minutes. In some embodiments, a time point is 35 minutes. In some
embodiments, a time point is 40 minutes. In some embodiments, a
time point is 45 minutes. In some embodiments, a time point is 50
minutes. In some embodiments, a time point is 55 minutes. In some
embodiments, a time point is 60 minutes. In some embodiments, a
time point is 60 or minutes. A person having ordinary skill in the
art understands how to choose a time point, for example, for
cleavage shown in FIG. 32, one or more time points of 5, 10, 15,
20, 20, 45 and 60 minutes can be chosen to assess selectivity. In
some embodiments, selectivity can be measured by ratios of
IC.sub.50 for target (e.g., mutant) and non-target (e.g, wild-type)
sequences, e.g., from cell-based assays or animal models.
[1966] Example HPLC-MS traces are presented in FIG. 36. In some
embodiments, example RNase H assay conditions were described
below.
[1967] DNA/RNA Duplex Preparation: Oligonucleotide concentrations
were determined by measuring the absorbance in water at 260 nm.
DNA/RNA duplexes were prepared by mixing equimolar solutions
oligonucleotides with each strand concentration of 20 .mu.M. The
mixtures were heated at 90.degree. C. for 2 minutes in water bath
and were cooled down slowly over several hours.
[1968] Human RNase H Protein Expression and Purification: Human
RNase HC clone was obtained from Prof. Wei Yang's laboratory at NIH
Bethesda. The protocol for obtaining this human RNase HC (residues
136-286) has been described (Nowotny, M. et al. Structure of Human
RNase H1 Complexed with an RNA/DNA Hybrid: Insight into HIV Reverse
Transcription. Molecular Cell 28, 264-276, (2007)). The protein
expression was carried out by following reported protocol with the
exception that the resulting protein had an N-terminal His6 tag
(SEQ ID NO: 1552). BL21(DE3) E. coli cells in LB medium were used
for protein expression. Cells were grown at 37.degree. C. till
OD.sub.600nm reached around 0.7. The cultures were then cooled and
0.4 mM IPTG was added to induce protein expression overnight at
16.degree. C. E. coli extract was prepared by sonication in buffer
A (40 mM NaH.sub.2PO.sub.4 (pH 7.0), 1 M NaCl, 5% glycerol, 2.8 mM
.beta.-mercaptoethanol and 10 mM imidazole) with the addition of
protease inhibitors (Sigma-Aldrich). The extract was purified by Ni
affinity column using buffer A plus 60 mM imidazole. The protein
was eluted with a linear gradient of 60 to 300 mM imidazole. The
protein peak was collected and was further purified on a Mono S
column (GE Healthcare) with a 100 mM-500 mM gradient of NaCl in
buffer B. Fractions containing RNase HC were concentrated to 0.3
mg/mL in the storage buffer (20 mM HEPES (pH 7.0), 100 mM NaCl, 5%
glycerol, 0.5 mM EDTA, 2 mM DTT) and stored at -20.degree. C. 0.3
mg/mL enzyme concentration corresponds to 17.4 .mu.M based on its
reported extinction coefficient (32095 cm.sup.-1 M.sup.-1) and MW
(18963.3 Da units).
[1969] In a 96-well plate, to 50 .mu.L DNA/RNA duplex (20 .mu.M)
was added 10 .mu.L of 10.times.RNase H buffer followed by 30 .mu.L
water. The mixture was incubated at 37.degree. C. for a few minutes
and then 10 .mu.L of 0.2 .mu.M stock solution of enzyme was added
to give a total volume of 100 .mu.L with final substrate/enzyme
concentration 10 .mu.M/0.02 .mu.M (500:1) and was further incubated
at 37.degree. C. Various ratios of the DNA/RNA duplex to RNase H
protein were previously studied using these conditions to find this
optimal ratio (500:1) to study the kinetics. The reactions were
quenched at different time points using 7 .mu.L of 500 mM EDTA
disodium solution in water. For zero min time point, EDTA was added
to the reaction mixture before the addition of enzyme. Controls
were run to ensure that EDTA was able to inhibit the enzyme
activity completely. After all the reactions were quenched 10 .mu.L
or 20 .mu.L of each reaction mixture was injected on to LCMS-TOF
using analytical column (Agilent Poroshell 120 EC-C18 2.7 micron,
2.1.times.150 mm, Part #699775-902). Ratio of peak area of
remaining full length RNA to DNA in each reaction mixture was
normalized against this ratio at zero point reaction to obtain the
% of full length RNA remaining.
[1970] In some embodiments, an example HPLC condition is:
Eluant A=8 mM TEA, 200 mM HFIP in Water
Eluant B=50:50 (Eluant A: Methanol)
Column Temperature=50.degree. C.
[1971] Auto sampler temperature=4.degree. C. UV was recorded at 254
nm and 280 nm
LC Gradient Method
TABLE-US-00062 [1972] Time (min) Flow (mL/min) % A % B 1 0.0 0.2 90
10 2 15.0 0.2 65 35 3 22.0 0.2 40 60 4 25.0 0.2 5.0 95.0 5 25.5 0.2
90 10 6 30 0.2 90 10
Example 20. Example Assays for Assessing Oligonucleotides
[1973] In some embodiments, the present disclosure provides
reporter assays for assessing properties of provided
oligonucleotides and compositions. In some embodiments, a provided
reporter assay is a dual-luciferase assay, e.g., as described
below.
[1974] Determination of mRNA inhibition by oligonucleotides using
Dual Glo Luciferase System: The psiCheck2 vector system from
Promega is a commercially available vector which encodes both
Photinus pyralis and Renilla Reniformis luciferase genes on a
single plasmid with a multiple cloning site in the 3' UTR of
Renilla luciferase for insertion of oligonucleotides encoding the
miRNA target sites (or other cloned regulatory sequences, such as
target 3'UTRs). A 250 base pairs fragment containing the targeting
region of interest and its reverse complement and having
appropriate overhanging bases corresponding to the restriction
enzyme(s) used to digest the psiCheck vector was cloned into the
psiCHECK-2 vector (Promega, C8021) between NotI and XhoI
restriction enzyme sites. The vector containing the insert was
sequenced to confirm correct orientation of insert, expanded and
purified. Multiple vectors were generated using above design for
SNPs of interest. In a typical co-transfection experiment, after
the cells were at the correct density (30 to 40% confluency),
oligonucleotides and vector were reverse-transfected using
Lipofectamine 2000 (Life Technologies). Effects of oligonucleotides
on target mRNA can be seen as early as 24 h post-transfection and
were still present after 48 h. 24 hour or 48 hours after
transfection of psiCheck vectors, cells were assayed for luciferase
activity. Briefly, cells are washed with PBS, lysed in passive
lysis buffer, luciferin reagents were added, and samples were read
on a Spectramax M5 instrument (Molecular Devices). Measurements
were taken at vector concentrations of 20 ng per well of a 96-well
plate. The experiments were performed at various oligonucleotide
concentrations (30, 10 and 3.3 nM) and two time points (24 and 48
hours). The relative levels of Renilla luciferase vs. Firefly were
measured for untreated cells and cells which were treated with
oligonucleotides targeting Renilla (WV-975) to measure the maximum
Renilla knockdown. Control oligonucleotides (e.g., WV-437, WV-993,
etc.) were chosen to normalize the R/F levels. In some embodiments,
dual luciferase reporter assay was used to assess oligonucleotides
in Cos7 cell line. In some embodiments, the cell line was
cotransfected for 24 hrs with oligonucleotides and either of the
psiCHECK2 plasmids, including rs362307 (T) or rs362307 (C) SNP. In
some embodiments, rs362307 (T) and rs362307 (C) are referred as mu
and wt.
[1975] Various chirally controlled and stereorandom oligonucleotide
compositions were tested at 30 nM using the dual-luciferase assay.
For oligonucleotides with mismatch at the same position (e.g.,
positions 8, 9, 10, 11, 12 and 13 relative to the 5'-end), chirally
controlled compositions maintained high levels of wide-type
measurements.
[1976] In some embodiments, when tested at 30 nM, WV-1092
selectively suppressed expression of the mutant sequence at 24
and/or 48 hours as shown by the dual luciferase reporter assay. In
some embodiments, the observed selectivity for WV-1092 at 30 nM 24
hours and/or 48 hours was several fold more than other
oligonucleotide compositions, e.g., WV-917, WV-1497, certain P12
stereopure oligonucleotides, etc. In some embodiments, at 30 nM, 48
hours, WV-1092 maintained over 90% wild-type, and decreased the
mutant to about 30%, while WV-917 decreased the wild-type to about
60%, and mutant to about 30%. Oligonucleotides are tested at
multiple conditions (e.g., concentrations, time points, etc.), and
show improved properties, e.g., activity, selectivity, etc.
[1977] As understood by a person having ordinary skill in the art,
oligonucleotide properties, e.g., activity, selectivity, etc., may
be assessed by many other assays, such as cell-based assays, animal
models, etc. In some embodiments, allele-specific suppression may
be tested in cells and animal models using similar procedures as
described in Hohjoh, Pharmaceuticals 2013, 6, 522-535; US patent
application publication US 2013/0197061; Ostergaard et al., Nucleic
Acids Research 2013, 41(21), 9634-9650; Jiang et al., Science 2013,
342, 111-114; and U.S. Pat. No. 9,006,198. In some embodiments,
selectivity can be assessed by IC.sub.50 values for the wild-type
and the mutant allele. Provided compositions, including those
targeting SNPs associated with Huntington's disease, suppress
disease-associated alleles selectively over wild type alleles.
Example 21. Example Methods for Preparing Oligonucleotides and
Compositions
Abbreviations
[1978] AMA: conc. NH.sub.3--40% MeNH.sub.2 in H.sub.2O (1:1, v/v)
CMIMT: N-cyanomethylimidazolium triflate DBU:
1,8-diazabicyclo[5.4.0]undec-7-ene DCA: dichloroacetic acid DCM:
dichloromethane, CH.sub.2Cl.sub.2 DMTr: 4,4'-dimethoxytrityl DVB:
divinylbenzene HCP: highly cross-linked polystyrene (contains 50%
DVB, non-swelling polystyrene)
MeIm: N-methylimidazole
[1979] MQ: water obtained from "Milli-Q Reference" PhIMT:
N-phenylimidazolium triflate POS: 3-phenyl-1,2,4-dithiazolin-5-one
PS200: primer support 200, commercially available from GE
Healthcare PS5G: primer support 5G, commercially available from GE
Healthcare TBAF: tetrabutylammonium fluoride TBHP:
tert-butylhydroperoxide TEAA: triethylammonium aceate
[1980] Solid support: Various types of solid support (varied
nucleosides loading) were tested. In some embodiments,
HCP>PS5G.apprxeq.PS200.gtoreq.CPG. In some embodiments, a solid
support is HCP. In some embodiments, a solid support is PS5G. In
some embodiments, a solid support is PS200. In some embodiments, a
solid support is CPG. For nucleosides loading, various range
(30-300 .mu.mol/g) were tested. In some embodiments, 70-80
.mu.mol/g loading performed than others. In some embodiments,
nucleoside loading is 70-80 .mu.mol/g. CPG was purchased from
various suppliers (GlenReseach, LinkTechnologies, ChemGenes,
PrimeSynthesis, and 3-Prime).
[1981] Various linkers were tested and can be used. In some
embodiments, during preparation of chirally controlled
oligonucleotide compositions by using DPSE-type chemistry,
SP-linker was used.
[1982] Various activators were prepared and/or purchased, and
evaluated. In some embodiments, for DPSE-type chemistry, CMIMT was
used.
[1983] Example Analytical conditions:
[1984] 1) RP-UPLC-MS [1985] System: Waters, Acquity UPLC I-Class,
Xevo G2-Tof [1986] Column: Waters, BEH C18, 1.7 m, 2.1.times.150 mm
[1987] Temp. & Flow rate: 55.degree. C., 0.3 mL/min [1988]
Buffer: A: 0.1M TEAA; B: MeCN [1989] Gradient: % B: 1-30%/30
min
[1990] 2) AEX-HPLC [1991] System: Waters, Alliance e2695 [1992]
Column: Thermo, DNAPac PA-200, 4.times.250 mm [1993] Temp. &
Flow rate: 50.degree. C., 1 mL/min [1994] Buffer: A: 20 mM NaOH; B:
A+1M NaClO.sub.4 [1995] Gradient: % B: 10-50%/30 min
[1996] Example procedure for the synthesis of chrial-oligos (1
.mu.mol scale):
[1997] Automated solid-phase synthesis of chiral-oligos was
performed according to example cycles shown herein. After the
synthesis cycles, the resin was treated with 0.1M TBAF in MeCN (1
mL) for 2 h (30 min usually enough) at room temperature, washed
with MeCN, dried, and add AMA (1 mL) for 30 min at 45.degree. C.
The mixture was cooled to room temperature and the resin was
removed by membrane filtration. The filtrate was concentrated under
reduced pressure to about 1 mL. The residue was diluted with 1 mL
of H.sub.2O and analyzed by AEX-HPLC and RP-UPLC-MS (example
conditions: refer to the analytical conditions).
TABLE-US-00063 waiting step operation reagents and solvent volume
time 1 detritylation 3% DCA in toluene 10 mL 65 s 2 coupling 0.15M
monomer in .sup.iPrCN + 0.5 mL 5 min 0.5M CMIMT in MeCN 3 capping
20% Ac.sub.2O, 30% 2,6- 1.2 mL 60 s lutidine in MeCN + 20% MeIm in
MeCN 4 oxidation or 1.1M TBHP in DCM- 1.0 mL 300 s sulfurization
decane or 0.1M POS in MeCN
[1998] As described, TBAF treatment can provide better results, for
example, less desulfurization. In some embodiments, SP linker
provided better yields and/or purity through, without the intention
to be limited by theory, better stability during chiral auxiliary
removal as described. In some embodiments, fluoro-containing
reagents such as HF--NR.sub.3 (e.g., HF-TEA (triethylamine)),
provided better yields and/or purity when succinyl linker was used
by, without the intention to be limited by theory, less cleavage
during chiral auxiliary removal. In some embodiments, after
synthesis, the resin was treated with 1M TEA-HF in DMF-H.sub.2O
(3:1, v/v; 1 mL) for 2 h at 50.degree. C. PS5G support was washed
with MeCN, H.sub.2O, and add AMA (conc. NH.sub.3--40% MeNH.sub.2
(1:1, v/v)) (1 mL) for 45 min at 50.degree. C. The mixture was
cooled to room temperature and the resin was removed by membrane
filtration (washed with H.sub.2O for 2 mL). The filtrate was
concentrated under reduced pressure until it becomes about 1 mL.
The residue was diluted with 1 mL of H.sub.2O and analyzed by
AEX-HPLC and RP-UPLC-MS (conditions: refer to the analytical
conditions section).
[1999] Example procedure for the purification of chrial-oligos (1
.mu.mol scale): in some embodiments, crude oligos were purified by
AEX-MPLC according to the following example conditions: [2000]
System: AKTA Purifier-10 [2001] Column: TOHSOH, DNA STAT,
4.6.times.100 mm [2002] Temp. & Flow rate: 60.degree. C., 0.5
mL/min [2003] Buffer: A: 20 mM Tris-HCl (pH 9.0)+20% MeCN, B:
A+1.5M NaCl [2004] Gradient: % B: 20-70%/25 CV (2%/CV)
[2005] All fractions were analyzed by analytical AEX-HPLC, and
fractions containing chiral oligo more than 80% purity were
corrected and desalted by Sep-Pak Plus tC18 (WAT036800) using
example conditions below:
[2006] 1. Conditioning Sep-Pak Plus with 15 mL of MeCN.
[2007] 2. Rinse cartridge with 15 mL of 50% MeCN/MQ.
[2008] 3. Equilibrate cartridge with 30 mL of MQ.
[2009] 4. Load sample, and wash with 40 mL of MQ.
[2010] 5. Elute chiral oligos with 10 mL of 50% MeCN/MQ.
[2011] Eluted sample were evaporated under reduced pressure to
remove MeCN, and lyophilized. The product were dissolved in MQ (1
mL), filtered by 0.2 .mu.m mesh syringe filter, and analyzed. After
yield calculation by UV absorbance, the preparation was lyophilized
again.
[2012] Example methods, conditions and reagents were described in,
e.g., JP 2002-33436, WO2005/092909, WO2010/064146, WO2012/039448,
WO2011/108682, WO2014/010250, WO2014/010780, WO2014/012081, etc.,
and may be useful for preparing provided oligonucleotides and/or
compositions.
[2013] Additional example oligonucleotides are listed below. In
some embodiments, one or more of the oligonucleotides below are
used as controls. In some embodiments, one or more of the
oligonucleotides below are RNA sequences as cleavage targets in one
or more assays.
TABLE-US-00064 TABLE 5N Example Control Oligonucleotides. WV-975
G*T*A*G*G*A*G*T*A*G*T*G*A*A*A*G*G*C*C*A (SEQ ID NO: 783) WV-1061
mG*mU*mA*mG*mG*A*G*T*A*G*T*G*A*A*A*mG*mG*mC *mC*mA (SEQ ID NO: 784)
WV-1062 mGmUmAmGmG*A*G*T*A*G*T*G*A*A*A*mGmGmCmCmA (SEQ ID NO: 785)
WV-1063 mG*mU*mA*mG*mG*A*G*T*A*G*T*G*A*A*A*G*G*C*C* A (SEQ ID NO:
786) WV-1064 mC*mU*mC*mU*mU*A*C*T*G*T*G*C*T*G*T*mG*mG*mA *mC*mA
(SEQ ID NO: 787) WV-1065 mCmUmCmUmU*A*C*T*G*T*G*C*T*G*T*mGmGmAmCmA
(SEQ ID NO: 788) WV-1066
mC*mU*mC*mU*mU*A*C*T*G*T*G*C*T*G*T*G*G*A*C*A (SEQ ID NO: 789)
WV-993 mC*mC*mU*mU*mC*C*C*T*G*A*A*G*G*T*T*mC*mC*mU *mC*mC (SEQ ID
NO: 790) WV-975 All DNA, Stereorandom PS, positive control for
Renilla luciferase in psiCHECK2 plasmid WV-1061 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS, +ve Luciferase control for
psiCHECK2 WV-1062 5-10-5 (2'-OMe-DNA-2'-OMe), stereorandom PS, PO
in the wings: +ve Luciferase control for psiCHECK2 WV-1063 5-15
(2'-OMe-DNA), stereorandom PS, +ve Luciferase control for psiCHECK2
WV-1064 5-10-5 (2'-OMe-DNA-2'-OMe), stereorandom PS, Negative
Luciferase control for psiCHECK2 WV-1065 5-10-5
(2'-OMe-DNA-2'-OMe), stereorandom PS, PO in the wings: Negative
Luciferase control for psiCHECK2 WV-1066 5-15 (2'-OMe-DNA),
stereorandom PS, Negative Luciferase control for psiCHECK2 WV-993
5-10-5 (2'-OMe-DNA-2'-OMe), stereorandom PS, Negative Luciferase
control for psiCHECK2
TABLE-US-00065 TABLE 6N Example RNA Sequences. WV-944
rUrUrUrGrGrArArGrUrCrUrGrCrGrCrCrCrUrUrGrUrGrCrCrC (SEQ ID NO: 791)
WV-945 rUrUrUrGrGrArArGrUrCrUrGrUrGrCrCrCrUrUrGrUrGrCrCrC (SEQ ID
NO: 792) WV-1073
rGrArGrCrCrUrUrUrGrGrArArGrUrCrUrGrCrGrCrCrCrUrUrGrUr
GrCrCrCrUrGrCrCrU (SEQ ID NO: 793) WV-1074
rGrArGrCrCrUrUrUrGrGrArArGrUrCrUrGrUrGrCrCrCrUrUrGrUr
GrCrCrCrUrGrCrCrU (SEQ ID NO: 794) WV-950
rGrGrUrUrGrUrUrGrCrCrArGrGrUrUrArCrArGrCrUrGrCrUrC (SEQ ID NO: 795)
WV-951 rGrGrUrUrGrUrUrGrCrCrArGrGrUrUrGrCrArGrCrUrGrCrUrC (SEQ ID
NO: 796) WV-958 rCrCrUrCrCrUrGrCrArGrGrCrUrGrGrGrUrGrUrUrGrGrCrCrC
(SEQ ID NO: 797) WV-959
rCrCrUrCrCrUrGrCrArGrGrCrUrGrGrCrUrGrUrUrGrGrCrCrC (SEQ ID NO: 798)
ONT-453 rGrGrUrGrArUrGrArCrArArUrUrUrArUrUrArArU (SEQ ID NO: 799)
ONT-454 rGrGrUrGrArUrGrGrCrArArUrUrUrArUrUrArArU (SEQ ID NO: 800)
WV-944 rs362307 WT WV-945 rs362307 mu WV-1073 rs362307 WT WV-1074
rs362307 mu WV-950 rs362306 WT WV-951 rs362306 mu WV-958 rs362268
WT WV-959 rs362268 mu ONT-453 rs7685686 WT ONT-454 rs7685686 mu
Example 22. Example Oligonucleotides
[2014] Additional example oligonucleotides are listed below in
Table 8.
TABLE-US-00066 TABLE 8 HTT Oligonucleotides. SEQ SEQ SEQ Naked ID
ID ID Sequence NO: Modified Sequence NO: Stereochemistry Comment 1
Comment 2 ONT- ATTAATA 801 A * T * T * A * A * T * A * A * 1153
XXXXXXXXX Stereorandom Htt Htt SNP 450 AATTGTC A * T * T * G * T *
C * A * T * XXXXXXXXX sequence rs7685686 ATCACC C * A * C * C X
ONT- ATTAATA 802 A * ST * ST * SA * SA * ST * 1154 SSSSSSSSSSS
Stereopure Htt Htt SNP 451 AATTGTC SA * SA * SA * ST * ST * SG *
SSRSSSSS sequence I rs7685686 ATCACC ST * SC * RA * ST * SC * SA *
SC * SC ONT- ATTAATA 803 A * ST * ST * SA * SA * ST * 1155
SSSSSSSSSSS Stereopure Htt Htt SNP 452 AATTGTC SA * SA * SA * ST *
ST * SG * SSSRSSSS sequence II rs7685686 ATCACC ST * SC * SA * RT *
SC * SA * SC * SC ONT- GGUGAUG 804 rGrGrUrGrArUrGrArCrArArUr 1156
OOOOOOOOO RNA against Htt Htt SNP 453 ACAAUUU UrUrArUrUrArArU
OOOOOOOOO sequence Mutant rs7685686 AUUAAU O ONT- GGUGAUG 805
rGrGrUrGrArUrGrGrCrArArUr 1157 OOOOOOOOO RNA against Htt Htt SNP
454 GCAAUUU UrUrArUrUrArArU OOOOOOOOO sequence Wild rs7685686
AUUAAU O Type WV- UUUGGAA 806 rUrUrUrGrGrArArGrUrCrUrGr 1158
OOOOOOOOO wtRNA muHTT 902 GUCUGCG CrGrCrCrCrUrUrGrUrGrCrCrC
OOOOOOOOO SNP CCCUUGU OOOOOO 362307 GCCC WV- UUUGGAA 807
rUrUrUrGrGrArArGrUrCrUrGr 1159 OOOOOOOOO mRNA muHTT 903 GUCUGUG
UrGrCrCrCrUrUrGrUrGrCrCrC OOOOOOOOO SNP CCCUUGU OOOOOO 362307 GCCC
WV- GGGCACA 808 G * G * G * C * A * C * A * A * 1160 XXXXXXXXX ASO1
All DNA; muHTT 904 AGGGCAC G * G * G * C * A * C * A * G *
XXXXXXXXX stereorandom PS SNP AGACTT A * C * T * T X 362307 WV-
GGCACAA 809 G * G * C * A * C * A * A * G * 1161 XXXXXXXXX ASO2 All
DNA; muHTT 905 GGGCACA G * G * C * A * C * A * G * A * XXXXXXXXX
stereorandom PS SNP GACTTC C * T * T * C X 362307 WV- GCACAAG 810 G
* C * A * C * A * A * G * G * 1162 XXXXXXXXX ASO3 All DNA; muHTT
906 GGCACAG G * C * A * C * A * G * A * C * XXXXXXXXX stereorandom
PS SNP ACTTCC T * T * C * C X 362307 WV- CACAAGG 811 C * A * C * A
* A * G * G * G * 1163 XXXXXXXXX ASO4 All DNA; muHTT 907 GCACAGA C
* A * C * A * G * A * C * T * XXXXXXXXX stereorandom PS SNP CTTCCA
T * C * C * A X 362307 WV- ACAAGGG 812 A * C * A * A * G * G * G *
C * 1164 XXXXXXXXX ASO5 All DNA; muHTT 908 CACAGAC A * C * A * G *
A * C * T * T * XXXXXXXXX stereorandom PS SNP TTCCAA C * C * A * A
X 362307 WV- CAAGGGC 813 C * A * A * G * G * G * C * A * 1165
XXXXXXXXX ASO6 All DNA; muHTT 909 ACAGACT C * A * G * A * C * T * T
* C * XXXXXXXXX stereorandom PS SNP TCCAAA C * A * A * A X 362307
WV- GGGCACA 814 mG * mG * mG * mC * mA * C 1166 XXXXXXXXX ASO7 5-15
(2'- muHTT 910 AGGGCAC * A * A * G * G * G * C * A * C XXXXXXXXX
OMe-DNA); SNP AGACTT * A * G * A * C * T * T X stereorandom PS
362307 WV- GGCACAA 815 mG * mG * mC * mA * mC * A 1167 XXXXXXXXX
ASO8 5-15 (2'- muHTT 911 GGGCACA * A * G * G * G * C * A * C * A
XXXXXXXXX OMe-DNA); SNP GACTTC * G * A * C * T * T * C X
stereorandom PS 362307 WV- GCACAAG 816 mG * mC * mA * mC * mA * A
1168 XXXXXXXXX ASO9 5-15 (2'- muHTT 912 GGCACAG * G * G * G * C * A
* C * A * G XXXXXXXXX OMe-DNA); SNP ACTTCC * A * C * T * T * C * C
X stereorandom PS 362307 WV- CACAAGG 817 mC * mA * mC * mA * mA * G
1169 XXXXXXXXX ASO10 5-15 (2'- muHTT 913 GCACAGA * G * G * C * A *
C * A * G * A XXXXXXXXX OMe-DNA); SNP CTTCCA * C * T * T * C * C *
A X stereorandom PS 362307 WV- ACAAGGG 818 mA * mC * mA * mA * mG *
G 1170 XXXXXXXXX ASO11 5-15 (2'- muHTT 914 CACAGAC * G * C * A * C
* A * G * A * C XXXXXXXXX OMe-DNA); SNP TTCCAA * T * T * C * C * A
* A X stereorandom PS 362307 WV- CAAGGGC 819 mC * mA * mA * mG * mG
* G 1171 XXXXXXXXX ASO12 5-15 (2'- muHTT 915 ACAGACT * C * A * C *
A * G * A * C * T XXXXXXXXX OMe-DNA); SNP TCCAAA * T * C * C * A *
A * A X stereorandom PS 362307 WV- GGGCACA 820 mG * mG * mG * mC *
mA * C 1172 XXXXXXXXX ASO13 5-10-5 (2'- muHTT 916 AGGGCAC * A * A *
G * G * G * C * A * C XXXXXXXXX OMe-DNA-2'- SNP AGACUU * A * mG *
mA * mC * mU * X OMe); 362307 mU stereorandom PS WV- GGCACAA 821 mG
* mG * mC * mA * mC * A 1173 XXXXXXXXX ASO14 5-10-5 (2'- muHTT 917
GGGCACA * A * G * G * G * C * A * C * A XXXXXXXXX OMe-DNA-2'- SNP
GACUUC * G * mA * mC * mU * mU * X OMe); 362307 mC stereorandom PS
WV- GCACAAG 822 mG * mC * mA * mC * mA * A 1174 XXXXXXXXX ASO15
5-10-5 (2'- muHTT 918 GGCACAG * G * G * G * C * A * C * A * G
XXXXXXXXX OMe-DNA-2'- SNP ACUUCC * A * mC * mU * mU * mC * X OMe);
362307 mC stereorandom PS WV- CACAAGG 823 mC * mA * mC * mA * mA *
G 1175 XXXXXXXXX ASO16 5-10-5 (2'- muHTT 919 GCACAGA * G * G * C *
A * C * A * G * A XXXXXXXXX OMe-DNA-2'- SNP CUUCCA * C * mU * mU *
mC * mC * X OMe); 362307 mA stereorandom PS WV- ACAAGGG 824 mA * mC
* mA * mA * mG * G 1176 XXXXXXXXX ASO17 5-10-5 (2'- muHTT 920
CACAGAC * G * C * A * C * A * G * A * C XXXXXXXXX OMe-DNA-2'- SNP
TUCCAA * T * mU * mC * mC * mA * X OMe); 362307 mA stereorandom PS
WV- CAAGGGC 825 mC * mA * mA * mG * mG * G 1177 XXXXXXXXX ASO18
5-10-5 (2'- muHTT 921 ACAGACT * C * A * C * A * G * A * C * T
XXXXXXXXX OMe-DNA-2'- SNP TCCAAA * T * mC * mC * mA * mA * X OMe);
362307 mA stereorandom PS WV- GCACAAG 826 mG * mC * mA * mC * mA *
1178 XXXXXXXXX ASO19 8-7-5 (2'- muHTT 922 GGCACAG * mA * mG * mG *
G * C * A * C XXXXXXXXX OMe-DNA-2'- SNP ACUUCC * A * G * A * mC *
mU * mU * X OMe); 362307 mC * mC stereorandom PS WV- CACAAGG 827 mC
* mA * mC * mA * mA * 1179 XXXXXXXXX ASO20 7-7-6 (2'- muHTT 923
GCACAGA mG * mG * G * C * A * C * A * XXXXXXXXX OMe-DNA-2'- SNP
CUUCCA G * A * mC * mU * mU * mC * X OMe); 362307 mC * mA
stereorandom PS WV- ACAAGGG 828 mA * mC * mA * mA * mG * 1180
XXXXXXXXX ASO21 6-7-5 (2'- muHTT 924 CACAGAC mG * G * C * A * C * A
* G * A XXXXXXXXX OMe-DNA-2'- SNP UUCCAA * mC * mU * mU * mC * mC *
X OMe); 362307 mA * mA stereorandom PS; PO in the wings WV- CAAGGGC
829 mC * mA * mA * mG * mG * G 1181 XXXXXXXXX ASO22 5-7-8 (2'-
muHTT 925 ACAGACU * C * A * C * A * G * A * mC * XXXXXXXXX
OMe-DNA-2'- SNP UCCAAA mU * mU * mC * mC * mA * X OMe); 362307 mA *
mA stereorandom PS; PO in the wings WV- GCACAAG 830
mGmCmAmCmAmAmGmG * 1182 OOOOOOOXX ASO23 8-7-5 (2'- muHTT 926
GGCACAG G * C * A * C * A * G * A * XXXXXXOOO OMe-DNA-2'- SNP
ACUUCC mCmUmUmCmC O OMe); 362307 stereorandom PS; PO in the wings
WV- CACAAGG 831 mCmAmCmAmAmGmG * G * 1183 OOOOOOXXX ASO24 7-7-6
(2'- muHTT 927 GCACAGA C * A * C * A * G * A * XXXXXOOOO
OMe-DNA-2'- SNP CUUCCA mCmUmUmCmCmA O OMe); 362307 stereorandom PS;
PO in the wings WV- ACAAGGG 832 mAmCmAmAmGmG * G * C * 1184
OOOOOXXXX ASO25 6-7-5 (2'- muHTT 928 CACAGAC A * C * A * G * A *
XXXXOOOOO OMe-DNA-2'- SNP UUCCAA mCmUmUmCmCmAmA O OMe); 362307
stereorandom PS; PO in the wings WV- CAAGGGC 833 mCmAmAmGmG * G * C
* A * 1185 OOOOXXXXX ASO26 5-7-8 (2'- muHTT 929 ACAGACU C * A * G *
A * XXXOOOOOO OMe-DNA-2'- SNP UCCAAA mCmUmUmCmCmAmAmA O OMe);
362307 stereorandom PS; PO in the wings WV- GGGCACA 834 mGmGmGmCmA
* C * A * A * 1186 OOOOXXXXX ASO27 5-10-5 (2'- muHTT 930 AGGGCAC G
* G * G * C * A * C * A * XXXXXXOOO OMe-DNA-2'- SNP AGACUU
mGmAmCmUmU O OMe); 362307 stereorandom PS; PO in the wings WV-
GGCACAA 835 mGmGmCmAmC * A * A * G * 1187 OOOOXXXXX ASO28 5-10-5
(2'- muHTT 931 GGGCACA G * G * C * A * C * A * G * XXXXXXOOO
OMe-DNA-2'- SNP GACUUC mAmCmUmUmC O OMe); 362307 stereorandom PS;
PO in the wings WV- GCACAAG 836 mGmCmAmCmA * A * G * G * 1188
OOOOXXXXX ASO29 5-10-5 (2'- muHTT 932 GGCACAG G * C * A * C * A * G
* A * XXXXXXOOO OMe-DNA-2'- SNP ACUUCC mCmUmUmCmC O OMe); 362307
stereorandom PS; PO in the wings WV- CACAAGG 837 mCmAmCmAmA * G * G
* G * 1189 OOOOXXXXX ASO30 5-10-5 (2'- muHTT 933 GCACAGA C * A * C
* A * G * A * C * XXXXXXOOO OMe-DNA-2'- SNP CUUCCA mUmUmCmCmA O
OMe); 362307 stereorandom PS; PO in the wings WV- ACAAGGG 838
mAmCmAmAmG * G * G * C * 1190 OOOOXXXXX ASO31 5-10-5 (2'- muHTT 934
CACAGAC A * C * A * G * A * C * T * XXXXXXOOO OMe-DNA-2'- SNP
TUCCAA mUmCmCmAmA O OMe); 362307 stereorandom PS; PO in the wings
WV- CAAGGGC 839 mCmAmAmGmG * G * C * A * 1191 OOOOXXXXX ASO32
5-10-5 (2'- muHTT 935 ACAGACT C * A * G * A * C * T * T * XXXXXXOOO
OMe-DNA-2'- SNP TCCAAA mCmCmAmAmA O OMe); 362307 stereorandom PS;
PO in the wings WV- GGGCACA 840 G * SG * SG * SC * SA * SC * 1192
SSSSSSSSSSS ASO33 Stereopure muHTT 936 AGGGCAC SA * SA * SG * SG *
SG * SC * SSRSSSSS DNA; One Rp; SNP AGACTT SA * SC * RA * SG * SA *
SC * position 14 362307 ST * ST WV- GGCACAA 841 G * SG * SC * SA *
SC * SA * 1193 SSSSSSSSSSS ASO34
Stereopure muHTT 937 GGGCACA SA * SG * SG * SG * SC * SA * SRSSSSSS
DNA; One Rp; SNP GACTTC SC * RA * SG * SA * SC * ST * position 13
362307 ST * SC WV- GCACAAG 842 G * SC * SA * SC * SA * SA * 1194
SSSSSSSSSSS ASO35 Stereopure muHTT 938 GGCACAG SG * SG * SG * SC *
SA * SC * RSSSSSSS DNA; One Rp; SNP ACTTCC RA * SG * SA * SC * ST *
ST * position 12 362307 SC * SC WV- CACAAGG 843 C * SA * SC * SA *
SA * SG * 1195 SSSSSSSSSSR ASO36 Stereopure muHTT 939 GCACAGA SG *
SG * SC * SA * SC * RA * SSSSSSSS DNA; One Rp; SNP CTTCCA SG * SA *
SC * ST * ST * SC * position 11 362307 SC * SA WV- ACAAGGG 844 A *
SC * SA * SA * SG * SG * 1196 SSSSSSSSSRS ASO37 Stereopure muHTT
940 CACAGAC SG * SC * SA * SC * RA * SG * SSSSSSSS DNA; One Rp; SNP
TTCCAA SA * SC * ST * ST * SC * SC * position 10 362307 SA * SA WV-
CAAGGGC 845 C * SA * SA * SG * SG * SG * 1197 SSSSSSSSRSS ASO38
Stereopure muHTT 941 ACAGACT SC * SA * SC * RA * SG * SA * SSSSSSSS
DNA; One Rp; SNP TCCAAA SC * ST * ST * SC * SC * SA * position 9
362307 SA * SA WV- UUUGGAA 846 rUrUrUrGrGrArArGrUrCrUrGr 1198
OOOOOOOOO HTT-rs362307 Huntington 944 GUCUGCG
CrGrCrCrCrUrUrGrUrGrCrCrC OOOOOOOOO human CCCUUGU OOOOOO GCCC WV-
UUUGGAA 847 rUrUrUrGrGrArArGrUrCrUrGr 1199 OOOOOOOOO HTT-rs362307
Huntington 945 GUCUGUG UrGrCrCrCrUrUrGrUrGrCrCrC OOOOOOOOO human
CCCUUGU OOOOOO GCCC WV- GAGCAGC 848 G * A * G * C * A * G * C * T *
1200 XXXXXXXXX HTT-rs362306 HTT- 948 TGCAACC G * C * A * A * C * C
* T * G * XXXXXXXXX rs362306 TGGCAA G * C * A * A X WV- GGGCCAA 849
G * G * G * C * C * A * A * C * 1201 XXXXXXXXX HTT-rs362268 HTT-
949 CAGCCAG A * G * C * C * A * G * C * C * XXXXXXXXX rs362268
CCTGCA T * G * C * A X WV- GGUUGUU 850 rGrGrUrUrGrUrUrGrCrCrArGr
1202 OOOOOOOOO HTT- 950 GCCAGGU GrUrUrArCrArGrCrUrGrCrUrC OOOOOOOOO
rs362306 UACAGCU OOOOOO GCUC WV- GGUUGUU 851
rGrGrUrUrGrUrUrGrCrCrArGr 1203 OOOOOOOOO HTT- 951 GCCAGGU
GrUrUrGrCrArGrCrUrGrCrUrC OOOOOOOOO rs362306 UGCAGCU OOOOOO GCUC
WV- GAGCAGC 852 G * SA * SG * SC * SA * SG * 1204 SSSSSSSSSSR
Stereopure PS HTT- 952 TGCAACC SC * ST * SG * SC * SA * RA *
SSSSSSSS DNA; One Rp at rs362306 TGGCAA SC * SC * ST * SG * SG * SC
* position 11 SA * SA WV- AGCAGCT 853 A * SG * SC * SA * SG * SC *
1205 SSSSSSSSSRS Stereopure PS HTT- 953 GCAACCT ST * SG * SC * SA *
RA * SC * SSSSSSSS DNA; One Rp at rs362306 GGCAAC SC * ST * SG * SG
* SC * SA * position 10 SA * SC WV- GCAGCTG 854 G * SC * SA * SG *
SC * ST * 1206 SSSSSSSSRSS Stereopure PS HTT- 954 CAACCTG SG * SC *
SA * RA * SC * SC * SSSSSSSS DNA; One Rp at rs362306 GCAACA ST * SG
* SG * SC * SA * SA * position 9 SC * SA WV- CAGCTGC 855 C * SA *
SG * SC * ST * SG * 1207 SSSSSSSRSSS Stereopure PS HTT- 955 AACCTGG
SC * SA * RA * SC * SC * ST * SSSSSSSS DNA; One Rp at rs362306
CAACAA SG * SG * SC * SA * SA * SC * position 8 SA * SA WV- AGCTGCA
856 A * SG * SC * ST * SG * SC * 1208 SSSSSSRSSSS Stereopure PS
HTT- 956 ACCTGGC SA * RA * SC * SC * ST * SG * SSSSSSSS DNA; One Rp
at rs362306 AACAAC SG * SC * SA * SA * SC * SA * position 7 SA * SC
WV- GCTGCAA 857 G * SC * ST * SG * SC * SA * 1209 SSSSSRSSSSS
Stereopure PS HTT- 957 CCTGGCA RA * SC * SC * ST * SG * SG *
SSSSSSSS DNA; One Rp at rs362306 ACAACC SC * SA * SA * SC * SA * SA
* position 6 SC * SC WV- CCUCCUG 858 rCrCrUrCrCrUrGrCrArGrGrCrU
1210 OOOOOOOOO HTT- 958 CAGGCUG rGrGrGrUrGrUrUrGrGrCrCrC OOOOOOOOO
rs362268 GGUGUUG OOOOOO GCCC WV- CCUCCUG 859
rCrCrUrCrCrUrGrCrArGrGrCrU 1211 OOOOOOOOO HTT- 959 CAGGCUG
rGrGrCrUrGrUrUrGrGrCrCrC OOOOOOOOO rs362268 GCUGUUG OOOOOO GCCC WV-
GGGCCAA 860 G * SG * SG * SC * SC * SA * 1212 SSSSSSSSSSR
Stereopure PS HTT- 960 CAGCCAG SA * SC * SA * SG * SC * RC *
SSSSSSSS DNA; One Rp at rs362268 CCTGCA SA * SG * SC * SC * ST * SG
* position 11 SC * SA WV- GGCCAAC 861 G * SG * SC * SC * SA * SA *
1213 SSSSSSSSSRS Stereopure PS HTT- 961 AGCCAGC SC * SA * SG * SC *
RC * SA * SSSSSSSS DNA; One Rp at rs362268 CTGCAG SG * SC * SC * ST
* SG * SC * position 10 SA * SG WV- GCCAACA 862 G * SC * SC * SA *
SA * SC * 1214 SSSSSSSSRSS Stereopure PS HTT- 962 GCCAGCC SA * SG *
SC * RC * SA * SG * SSSSSSSS DNA; One Rp at rs362268 TGCAGG SC * SC
* ST * SG * SC * SA * position 9 SG * SG WV- CCAACAG 863 C * SC *
SA * SA * SC * SA * 1215 SSSSSSSRSSS Stereopure PS HTT- 963 CCAGCCT
SG * SC * RC * SA * SG * SC * SSSSSSSS DNA; One Rp at rs362268
GCAGGA SC * ST * SG * SC * SA * SG * position 8 SG * SA WV- CAACAGC
864 C * SA * SA * SC * SA * SG * 1216 SSSSSSRSSSS Stereopure PS
HTT- 964 CAGCCTG SC * RC * SA * SG * SC * SC * SSSSSSSS DNA; One Rp
at rs362268 CAGGAG ST * SG * SC * SA * SG * SG * position 7 SA * SG
WV- AACAGCC 865 A * SA * SC * SA * SG * SC * 1217 SSSSSRSSSSS
Stereopure PS HTT- 965 AGCCTGC RC * SA * SG * SC * SC * ST *
SSSSSSSS DNA; One Rp at rs362268 AGGAGG SG * SC * SA * SG * SG * SA
* position 6 SG * SG WV- GGCCUUU 866 rGrGrCrCrUrUrUrCrArCrUrArC
1218 OOOOOOOOO siRNA (+control Htt 973 CACUACU rUrCrCrUrArCTT
OOOOOOOOO for Renilla CCUACTT OO luciferase in psiCHECK2 plasmid)
antisense strand WV- GUAGGAG 867 rGrUrArGrGrArGrUrArGrUrGr 1219
OOOOOOOOO siRNA (+control Htt SNP 974 UAGUGAA ArArArGrGrCrCTT
OOOOOOOOO for Renilla rs362268 AGGCCTT OO luciferase in psiCHECK2
plasmid) sense strand WV- GTAGGAG 868 G * T * A * G * G * A * G * T
* 1220 XXXXXXXXX ASO (+control for Htt SNP 975 TAGTGAA A * G * T *
G * A * A * A * G * XXXXXXXXX Renilla luciferase in rs362268 AGGCCA
G * C * C * A X psiCHECK2 plasmid) WV- GCAGGGC 869 G * SC * SA * SG
* SG * SG * 1221 SSSSSSSSSSS Htt seq 307 Htt 982 ACAAGGG SC * SA *
SC * SA * SA * SG * SSSSSRSS expanding 3 nt rs362307 CACAGA SG * SG
* SC * SA * SC * RA * towards 3' example 3 SG * SA WV- CAGGGCA 870
C * SA * SG * SG * SG * SC * 1222 SSSSSSSSSSS Htt seq 307 Htt 983
CAAGGGC SA * SC * SA * SA * SG * SG * SSSSRSSS expanding 3 nt
rs362307 ACAGAC SG * SC * SA * SC * RA * SG * towards 3' example 2
SA * SC WV- AGGGCAC 871 A * SG * SG * SG * SC * SA * 1223
SSSSSSSSSSS Htt seq 307 Htt 984 AAGGGCA SC * SA * SA * SG * SG * SG
* SSSRSSSS expanding 3 nt rs362307 CAGACT SC * SA * SC * RA * SG *
SA * towards 3' example 1 SC * ST WV- AAGGGCA 872 A * SA * SG * SG
* SG * SC * 1224 SSSSSSSRSSS Htt seq 307 Htt 985 CAGACTT SA * SC *
RA * SG * SA * SC * SSSSSSSS expanding 3 nt rs362307 CCAAAG ST * ST
* SC * SC * SA * SA * towards 5' example 1 SA * SG WV- AGGGCAC 873
A * SG * SG * SG * SC * SA * 1225 SSSSSSRSSSS Htt seq 307 Htt 986
AGACTTC SC * RA * SG * SA * SC * ST * SSSSSSSS expanding 3 nt
rs362307 CAAAGG ST * SC * SC * SA * SA * SA * towards 5' example 2
SG * SG WV- GGGCACA 874 G * SG * SG * SC * SA * SC * 1226
SSSSSRSSSSS Htt seq 307 Htt 987 GACTTCC RA * SG * SA * SC * ST * ST
* SSSSSSSS expanding 3 nt rs362307 AAAGGC SC * SC * SA * SA * SA *
SG * towards 5' example 3 SG * SC WV- GAGCAGC 875 G * A * G * C * A
* G * C * T * 1227 XXXXXXXXX All DNA; HTT- 1001 TGCAACC G * C * A *
A * C * C * T * G * XXXXXXXXX stereorandom PS rs362306 TGGCAA G * C
* A * A X WV- AGCAGCT 876 A * G * C * A * G * C * T * G * 1228
XXXXXXXXX All DNA; HTT- 1002 GCAACCT C * A * A * C * C * T * G * G
* XXXXXXXXX stereorandom PS rs362306 GGCAAC C * A * A * C X WV-
GCAGCTG 877 G * C * A * G * C * T * G * C * 1229 XXXXXXXXX All DNA;
HTT- 1003 CAACCTG A * A * C * C * T * G * G * C * XXXXXXXXX
stereorandom PS rs362306 GCAACA A * A * C * A X WV- CAGCTGC 878 C *
A * G * C * T * G * C * A * 1230 XXXXXXXXX All DNA; HTT- 1004
AACCTGG A * C * C * T * G * G * C * A * XXXXXXXXX stereorandom PS
rs362306 CAACAA A * C * A * A X WV- AGCTGCA 879 A * G * C * T * G *
C * A * A * 1231 XXXXXXXXX All DNA; HTT- 1005 ACCTGGC C * C * T * G
* G * C * A * A * XXXXXXXXX stereorandom PS rs362306 AACAAC C * A *
A * C X WV- GCTGCAA 880 G * C * T * G * C * A * A * C * 1232
XXXXXXXXX All DNA;
HTT- 1006 CCTGGCA C * T * G * G * C * A * A * C * XXXXXXXXX
stereorandom PS rs362306 ACAACC A * A * C * C X WV- GAGCAGC 881 mG
* mA * mG * mC * mA * G 1233 XXXXXXXXX 5-15 (2'-OMe- HTT- 1007
TGCAACC * C * T * G * C * A * A * C * C XXXXXXXXX DNA); rs362306
TGGCAA * T * G * G * C * A * A X stereorandom PS WV- AGCAGCT 882 mA
* mG * mC * mA * mG * C 1234 XXXXXXXXX 5-15 (2'-OMe- HTT- 1008
GCAACCT * T * G * C * A * A * C * C * T XXXXXXXXX DNA); rs362306
GGCAAC * G * G * C * A * A * C X stereorandom PS WV- GCAGCTG 883 mG
* mC * mA * mG * mC * T 1235 XXXXXXXXX 5-15 (2'-OMe- HTT- 1009
CAACCTG * G * C * A * A * C * C * T * G XXXXXXXXX DNA); rs362306
GCAACA * G * C * A * A * C * A X stereorandom PS WV- CAGCUGC 884 mC
* mA * mG * mC * mU * G 1236 XXXXXXXXX 5-15 (2'-OMe- HTT- 1010
AACCTGG * C * A * A * C * C * T * G * G XXXXXXXXX DNA); rs362306
CAACAA * C * A * A * C * A * A X stereorandom PS WV- AGCUGCA 885 mA
* mG * mC * mU * mG * C 1237 XXXXXXXXX 5-15 (2'-OMe- HTT- 1011
ACCTGGC * A * A * C * C * T * G * G * C XXXXXXXXX DNA); rs362306
AACAAC * A * A * C * A * A * C X stereorandom PS WV- GCUGCAA 886 mG
* mC * mU * mG * mC * A 1238 XXXXXXXXX 5-15 (2'-OMe- HTT- 1012
CCTGGCA * A * C * C * T * G * G * C * A XXXXXXXXX DNA); rs362306
ACAACC * A * C * A * A * C * C X stereorandom PS WV- GAGCAGC 887 mG
* mA * mG * mC * mA * G 1239 XXXXXXXXX 5-10-5 (2'-OMe- HTT- 1013
TGCAACC * C * T * G * C * A * A * C * C XXXXXXXXX DNA-2'-OMe);
rs362306 TGGCAA * T * mG * mG * mC * mA * X stereorandom PS mA WV-
AGCAGCT 888 mA * mG * mC * mA * mG * C 1240 XXXXXXXXX 5-10-5
(2'-OMe- HTT- 1014 GCAACCT * T * G * C * A * A * C * C * T
XXXXXXXXX DNA-2'-OMe); rs362306 GGCAAC * G * mG * mC * mA * mA * X
stereorandom PS mC WV- GCAGCTG 889 mG * mC * mA * mG * mC * T 1241
XXXXXXXXX 5-10-5 (2'-OMe- HTT- 1015 CAACCTG * G * C * A * A * C * C
* T * G XXXXXXXXX DNA-2'-OMe); rs362306 GCAACA * G * mC * mA * mA *
mC * X stereorandom PS mA WV- CAGCUGC 890 mC * mA * mG * mC * mU *
G 1242 XXXXXXXXX 5-10-5 (2'-OMe- HTT- 1016 AACCTGG * C * A * A * C
* C * T * G * G XXXXXXXXX DNA-2'-OMe); rs362306 CAACAA * C * mA *
mA * mC * mA * X stereorandom PS mA WV- AGCUGCA 891 mA * mG * mC *
mU * mG * C 1243 XXXXXXXXX 5-10-5 (2'-OMe- HTT- 1017 ACCTGGC * A *
A * C * C * T * G * G * C XXXXXXXXX DNA-2'-OMe); rs362306 AACAAC *
A * mA * mC * mA * mA * X stereorandom PS mC WV- GCUGCAA 892 mG *
mC * mU * mG * mC * A 1244 XXXXXXXXX 5-10-5 (2'-OMe- HTT- 1018
CCTGGCA * A * C * C * T * G * G * C * A XXXXXXXXX DNA-2'-OMe);
rs362306 ACAACC * A * mC * mA * mA * mC * X stereorandom PS mC WV-
GAGCAGC 893 mG * mA * mG * mC * mA * 1245 XXXXXXXXX 7-7-6 (2'-OMe-
HTT- 1019 TGCAACC mG * mC * T * G * C * A * A * XXXXXXXXX
DNA-2'-OMe); rs362306 UGGCAA C * C * mU * mG * mG * mC * X
stereorandom PS mA * mA WV- GAGCAGC 894 mGmAmGmCmAmGmC * T * 1246
OOOOOOXXX 7-7-6 (2'-OMe- HTT- 1020 TGCAACC G * C * A * A * C * C *
XXXXXOOOO DNA-2'-OMe); rs362306 UGGCAA mUmGmGmCmAmA O stereorandom
PS; PO in wings WV- AGCAGCT 895 mA * mG * mC * mA * mG * 1247
XXXXXXXXX 6-7-5 (2'-OMe- HTT- 1021 GCAACCT mC * T * G * C * A * A *
C * C XXXXXXXXX DNA-2'-OMe); rs362306 GGCAAC * T * G * mG * mC * mA
* mA X stereorandom PS * mC WV- AGCAGCT 896 mAmGmCmAmGmC * T * G *
1248 OOOOOXXXX 6-7-5 (2'-OMe- HTT- 1022 GCAACCT C * A * A * C * C *
T * G * XXXXXXOOO DNA-2'-OMe); rs362306 GGCAAC mGmCmAmAmC O
stereorandom PS; PO in the wings WV- GCAGCTG 897 mG * mC * mA * mG
* mC * T 1249 XXXXXXXXX 5-7-8 (2'-OMe- HTT- 1023 CAACCUG * G * C *
A * A * C * C * mU * XXXXXXXXX DNA-2'-OMe); rs362306 GCAACA mG * mG
* mC * mA * mA * X stereorandom PS mC * mA WV- GCAGCTG 898
mGmCmAmGmC * T * G * C * 1250 OOOOXXXXX 5-7-8 (2'-OMe- HTT- 1024
CAACCUG A * A * C * C * XXXOOOOOO DNA-2'-OMe); rs362306 GCAACA
mUmGmGmCmAmAmCmA O stereorandom PS; PO in the wings WV- GAGCAGC 899
mGmAmGmCmA * G * C * T * 1251 OOOOXXXXX 5-10-5 (2'-OMe- HTT- 1025
TGCAACC G * C * A * A * C * C * T * XXXXXXOOO DNA-2'-OMe); rs362306
TGGCAA mGmGmCmAmA O stereorandom PS; PO in the wings WV- AGCAGCT
900 mAmGmCmAmG * C * T * G * 1252 OOOOXXXXX 5-10-5 (2'-OMe- HTT-
1026 GCAACCT C * A * A * C * C * T * G * XXXXXXOOO DNA-2'-OMe);
rs362306 GGCAAC mGmCmAmAmC O stereorandom PS; PO in the wings WV-
GCAGCTG 901 mGmCmAmGmCT * G * C * A 1253 OOOOOXXXX 5-10-5 (2'-OMe-
HTT- 1027 CAACCTG * A * C * C * T * G * G * XXXXXXOOO DNA-2'-OMe);
rs362306 GCAACA mCmAmAmCmA O stereorandom PS; PO in the wings WV-
CAGCUGC 902 mCmAmGmCmU * G * C * A * 1254 OOOOXXXXX 5-10-5 (2'-OMe-
HTT- 1028 AACCTGG A * C * C * T * G * G * C * XXXXXXOOO
DNA-2'-OMe); rs362306 CAACAA mAmAmCmAmA O stereorandom PS; PO in
the wings WV- AGCUGCA 903 mAmGmCmUmG * C * A * A * 1255 OOOOXXXXX
5-10-5 (2'-OMe- HTT- 1029 ACCTGGC C * C * T * G * G * C * A *
XXXXXXOOO DNA-2'-OMe); rs362306 AACAAC mAmCmAmAmC O stereorandom
PS; PO in the wings WV- GCUGCAA 904 mGmCmUmGmC * A * A * C * 1256
OOOOXXXXX 5-10-5 (2'-OMe- HTT- 1030 CCTGGCA C * T * G * G * C * A *
A * XXXXXXOOO DNA-2'-OMe); rs362306 ACAACC mCmAmAmCmC O
stereorandom PS; PO in the wings WV- GGGCCAA 905 G * G * G * C * C
* A * A * C * 1257 XXXXXXXXX All DNA; HTT- 1031 CAGCCAG A * G * C *
C * A * G * C * C * XXXXXXXXX stereorandom PS rs362268 CCTGCA T * G
* C * A X WV- GGCCAAC 906 G * G * C * C * A * A * C * A * 1258
XXXXXXXXX All DNA; HTT- 1032 AGCCAGC G * C * C * A * G * C * C * T
* XXXXXXXXX stereorandom PS rs362268 CTGCAG G * C * A * G X WV-
GCCAACA 907 G * C * C * A * A * C * A * G * 1259 XXXXXXXXX All DNA;
HTT- 1033 GCCAGCC C * C * A * G * C * C * T * G * XXXXXXXXX
stereorandom PS rs362268 TGCAGG C * A * G * G X WV- CCAACAG 908 C *
C * A * A * C * A * G * C * 1260 XXXXXXXXX All DNA; HTT- 1034
CCAGCCT C * A * G * C * C * T * G * C * XXXXXXXXX stereorandom PS
rs362268 GCAGGA A * G * G * A X WV- CAACAGC 909 C * A * A * C * A *
G * C * C * 1261 XXXXXXXXX All DNA; HTT- 1035 CAGCCTG A * G * C * C
* T * G * C * A * XXXXXXXXX stereorandom PS rs362268 CAGGAG G * G *
A * G X WV- AACAGCC 910 A * A * C * A * G * C * C * A * 1262
XXXXXXXXX All DNA; HTT- 1036 AGCCTGC G * C * C * T * G * C * A * G
* XXXXXXXXX stereorandom PS rs362268 AGGAGG G * A * G * G X WV-
GGGCCAA 911 mG * mG * mG * mC * mC * A 1263 XXXXXXXXX 5-15 (2'-OMe-
HTT- 1037 CAGCCAG * A * C * A * G * C * C * A * G XXXXXXXXX DNA);
rs362268 CCTGCA * C * C * T * G * C * A X stereorandom PS WV-
GGCCAAC 912 mG * mG * mC * mC * mA * A 1264 XXXXXXXXX 5-15 (2'-OMe-
HTT- 1038 AGCCAGC * C * A * G * C * C * A * G * C XXXXXXXXX DNA);
rs362268 CTGCAG * C * T * G * C * A * G X stereorandom PS WV-
GCCAACA 913 mG * mC * mC * mA * mA * C 1265 XXXXXXXXX 5-15 (2'-OMe-
HTT- 1039 GCCAGCC * A * G * C * C * A * G * C * C XXXXXXXXX DNA);
rs362268 TGCAGG * T * G * C * A * G * G X stereorandom PS WV-
CCAACAG 914 mC * mC * mA * mA * mC * A 1266 XXXXXXXXX 5-15 (2'-OMe-
HTT- 1040 CCAGCCT * G * C * C * A * G * C * C * T XXXXXXXXX DNA);
rs362268 GCAGGA * G * C * A * G * G * A X stereorandom PS WV-
CAACAGC 915 mC * mA * mA * mC * mA * G 1267 XXXXXXXXX 5-15 (2'-OMe-
HTT- 1041 CAGCCTG * C * C * A * G * C * C * T * G XXXXXXXXX DNA);
rs362268 CAGGAG * C * A * G * G * A * G X stereorandom PS WV-
AACAGCC 916 mA * mA * mC * mA * mG * C 1268 XXXXXXXXX 5-15 (2'-OMe-
HTT- 1042 AGCCTGC * C * A * G * C * C * T * G * C XXXXXXXXX DNA);
rs362268 AGGAGG * A * G * G * A * G * G X stereorandom PS WV-
GGGCCAA 917 mG * mG * mG * mC * mC * A 1269 XXXXXXXXX 5-10-5
(2'-OMe- HTT- 1043 CAGCCAG * A * C * A * G * C * C * A * G
XXXXXXXXX DNA-2'-OMe); rs362268 CCUGCA * C * mC * mU * mG * mC * X
stereorandom PS mA WV- GGCCAAC 918 mG * mG * mC * mC * mA * A 1270
XXXXXXXXX 5-10-5 (2'-OMe- HTT- 1044 AGCCAGC * C * A * G * C * C * A
* G * C XXXXXXXXX DNA-2'-OMe); rs362268 CUGCAG * C * mU * mG * mC *
mA * X stereorandom PS mG WV- GCCAACA 919 mG * mC * mC * mA * mA *
C 1271 XXXXXXXXX 5-10-5 (2'-OMe- HTT- 1045 GCCAGCC * A * G * C * C
* A * G * C * C XXXXXXXXX DNA-2'-OMe); rs362268 TGCAGG * T * mG *
mC * mA * mG * X stereorandom PS mG WV- CCAACAG 920 mC * mC * mA *
mA * mC * A 1272 XXXXXXXXX 5-10-5 (2'-OMe- HTT- 1046 CCAGCCT * G *
C * C * A * G * C * C * T XXXXXXXXX DNA-2'-OMe); rs362268 GCAGGA *
G * mC * mA * mG * mG * X stereorandom PS mA WV- CAACAGC 921 mC *
mA * mA * mC * mA * G 1273 XXXXXXXXX 5-10-5 (2'-OMe-
HTT- 1047 CAGCCTG * C * C * A * G * C * C * T * G XXXXXXXXX
DNA-2'-OMe); rs362268 CAGGAG * C * mA * mG * mG * mA * X
stereorandom PS mG WV- AACAGCC 922 mA * mA * mC * mA * mG * C 1274
XXXXXXXXX 5-10-5 (2'-OMe- HTT- 1048 AGCCTGC * C * A * G * C * C * T
* G * C XXXXXXXXX DNA-2'-OMe); rs362268 AGGAGG * A * mG * mG * mA *
mG * X stereorandom PS mG WV- GGGCCAA 923 mG * mG * mG * mC * mC *
1275 XXXXXXXXX 7-7-6 (2'-OMe- HTT- 1049 CAGCCAG mA * mA * C * A * G
* C * C * XXXXXXXXX DNA-2'-OMe); rs362268 CCUGCA A * G * mC * mC *
mU * mG * X stereorandom PS mC * mA WV- GGGCCAA 924 mGmGmGmCmCmAmA
* C * 1276 OOOOOOXXX 7-7-6 (2'-OMe- HTT- 1050 CAGCCAG A * G * C * C
* A * G * XXXXXOOOO DNA-2'-OMe); rs362268 CCUGCA mCmCmUmGmCmA O
stereorandom PS; PO in wings WV- GGCCAAC 925 mG * mG * mC * mC * mA
* 1277 XXXXXXXXX 6-7-5 (2'-OMe- HTT- 1051 AGCCAGC mA * C * A * G *
C * C * A * G XXXXXXXXX DNA-2'-OMe); rs362268 CUGCAG * C * C * mU *
mG * mC * mA X stereorandom PS * mG WV- GGCCAAC 926 mGmGmCmCmAmA *
C * A * 1278 OOOOOXXXX 6-7-5 (2'-OMe- HTT- 1052 AGCCAGC G * C * C *
A * G * C * C * XXXXXXOOO DNA-2'-OMe); rs362268 CUGCAG mUmGmCmAmG O
stereorandom PS; PO in the wings WV- GCCAACA 927 mG * mC * mC * mA
* mA * C 1279 XXXXXXXXX 5-7-8 (2'-OMe- HTT- 1053 GCCAGCC * A * G *
C * C * A * G * mC * XXXXXXXXX DNA-2'-OMe); rs362268 UGCAGG mC * mU
* mG * mC * mA * X stereorandom PS mG * mG WV- GCCAACA 928
mGmCmCmAmA * C * A * G * 1280 OOOOXXXXX 5-7-8 (2'-OMe- HTT- 1054
GCCAGCC C * C * A * G * XXXOOOOOO DNA-2'-OMe); rs362268 UGCAGG
mCmCmUmGmCmAmGmG O stereorandom PS; PO in the wings WV- GGGCCAA 929
mGmGmGmCmC * A * A * C * 1281 OOOOXXXXX 5-10-5 (2'-OMe- HTT- 1055
CAGCCAG A * G * C * C * A * G * C * XXXXXXOOO DNA-2'-OMe); rs362268
CCUGCA mCmUmGmCmA O stereorandom PS; PO in the wings WV- GGCCAAC
930 mGmGmCmCmA * A * C * A * 1282 OOOOXXXXX 5-10-5 (2'-OMe- HTT-
1056 AGCCAGC G * C * C * A * G * C * C * XXXXXXOOO DNA-2'-OMe);
rs362268 CUGCAG mUmGmCmAmG O stereorandom PS; PO in the wings WV-
GCCAACA 931 mGmCmCmAmA * C * A * G * 1283 OOOOXXXXX 5-10-5 (2'-OMe-
HTT- 1057 GCCAGCC C * C * A * G * C * C * T * XXXXXXOOO
DNA-2'-OMe); rs362268 TGCAGG mGmCmAmGmG O stereorandom PS; PO in
the wings WV- CCAACAG 932 mCmCmAmAmC * A * G * C * 1284 OOOOXXXXX
5-10-5 (2'-OMe- HTT- 1058 CCAGCCT C * A * G * C * C * T * G *
XXXXXXOOO DNA-2'-OMe); rs362268 GCAGGA mCmAmGmGmA O stereorandom
PS; PO in the wings WV- CAACAGC 933 mCmAmAmCmA * G * C * C * 1285
OOOOXXXXX 5-10-5 (2'-OMe- HTT- 1059 CAGCCTG A * G * C * C * T * G *
C * XXXXXXOOO DNA-2'-OMe); rs362268 CAGGAG mAmGmGmAmG O
stereorandom PS; PO in the wings WV- AACAGCC 934 mAmAmCmAmG * C * C
* A * 1286 OOOOXXXXX 5-10-5 (2'-OMe- HTT- 1060 AGCCTGC G * C * C *
T * G * C * A * XXXXXXOOO DNA-2'-OMe); rs362268 AGGAGG mGmGmAmGmG O
stereorandom PS; PO in the wings: HTT-rs362268 WV- GUAGGAG 935 mG *
mU * mA * mG * mG * A * 1287 XXXXXXXXX 5-10-5 (2'-OMe- HTT- 1061
TAGTGAA * G * T * A * G * T * G * A * A XXXXXXXXX DNA-2'-OMe);
rs362268 AGGCCA * A * mG * mG * mC * mC * X stereorandom PS: mA +ve
Luciferase control for psiCHECK2; WV- 975 analogue WV- GUAGGAG 936
mGmUmAmGmG * A * G * T * 1288 OOOOXXXXX 5-10-5 (2'-OMe- HTT- 1062
TAGTGAA A * G * T * G * A * A * A * XXXXXXOOO DNA-2'-OMe); control
AGGCCA mGmGmCmCmA O stereorandom PS; PO in the wings: +ve
Luciferase control for psiCHECK2; WV- 975 analogue WV- GUAGGAG 937
mG * mU * mA * mG * mG * A 1289 XXXXXXXXX 5-15 (2'-OMe- HTT- 1063
TAGTGAA * G * T * A * G * T * G * A * A XXXXXXXXX DNA); control
AGGCCA * A * G * G * C * C * A X stereorandom PS: +ve Luciferase
control for psiCHECK2; WV- 975 analogue WV- CUCUUAC 938 mC * mU *
mC * mU * mU * A 1290 XXXXXXXXX 5-10-5 (2'-OMe- HTT- 1064 TGTGCTG *
C * T * G * T * G * C * T * G XXXXXXXXX DNA-2'-OMe); control TGGACA
* T * mG * mG * mA * mC * X stereorandom PS: mA Negative Luciferase
control for psiCHECK2; ONT- 67 analogue WV- CUCUUAC 939 mCmUmCmUmU
* A * C * T * 1291 OOOOXXXXX 5-10-5 (2'-OMe- HTT- 1065 TGTGCTG G *
T * G * C * T * G * T * XXXXXXOOO DNA-2'-OMe); control TGGACA
mGmGmAmCmA O stereorandom PS; PO in the wings: Negative Luciferase
control for psiCHECK2; ONT- 67 analogue WV- CUCUUAC 940 mC * mU *
mC * mU * mU * A 1292 XXXXXXXXX 5-15 (2'-OMe- HTT- 1066 TGTGCTG * C
* T * G * T * G * C * T * G XXXXXXXXX DNA); control TGGACA * T * G
* G * A * C * A X stereorandom PS: Negative Luciferase control for
psiCHECK2; ONT- 67 analogue WV- GGGCACA 941 G * G * G * C * A * C *
A * A * 1293 XXXXXXXXX All DNA HTT- 1067 AGGGCAC G * G * G * C *
d2AP * C * A * XXXXXXXXX stereorandom; P13 control AGACTT G * A * C
* T * T X (2-aminopurine): rs362307; WV-904 analogue WV- GGCACAA
942 G * G * C * A * C * A * A * G * 1294 XXXXXXXXX All DNA rs362307
1068 GGGCACA G * G * C * d2AP * C * A * G * XXXXXXXXX stereorandom;
P12 GACTTC A * C * T * T * C X (2-aminopurine): rs362307; WV-905
analogue WV- GCACAAG 943 G * C * A * C * A * A * G * G * 1295
XXXXXXXXX All DNA rs362307 1069 GGCACAG G * C * d2AP * C * A * G *
A * XXXXXXXXX stereorandom; P11 ACTTCC C * T * T * C * C X
(2-aminopurine): rs362307; WV-906 analogue WV- GGGCACA 944 G * G *
G * C * A * C * A * A * 1296 XXXXXXXXX All DNA rs362307 1070
AGGGCAC G * G * G * C * dDAP * C * A * XXXXXXXXX stereorandom; P13
AGACTT G * A * C * T * T X (2;6- diaminopurine): rs362307; WV-904
analogue WV- GGCACAA 945 G * G * C * A * C * A * A * G * 1297
XXXXXXXXX All DNA rs362307 1071 GGGCACA G * G * C * dDAP * C * A *
G * XXXXXXXXX stereorandom; P12 GACTTC A * C * T * T * C X (2;6-
diaminopurine): rs362307; WV-905 analogue WV- GCACAAG 946 G * C * A
* C * A * A * G * G * 1298 XXXXXXXXX All DNA rs362307 1072 GGCACAG
G * C * dDAP * C * A * G * A * XXXXXXXXX stereorandom; P12 ACTTCC C
* T * T * C * C X (2;6- diaminopurine): rs362307; WV-906 analogue
WV- GAGCCUU 947 rGrArGrCrCrUrUrUrGrGrArAr 1299 OOOOOOOOO wtRNA
rs362307 1073 UGGAAGU GrUrCrUrGrCrGrCrCrCrUrUrGr OOOOOOOOO CUGCGCC
UrGrCrCrCrUrGrCrCrU OOOOOOOOO CUUGUGC OOOOOOO CCUGCCU WV- GAGCCUU
948 rGrArGrCrCrUrUrUrGrGrArAr 1300 OOOOOOOOO muRNA rs362307 1074
UGGAAGU GrUrCrUrGrUrGrCrCrCrUrUrGr OOOOOOOOO CUGUGCC
UrGrCrCrCrUrGrCrCrU OOOOOOOOO CUUGUGC OOOOOOO CCUGCCU WV- CACACGG
949 rCrArCrArCrGrGrGrCrArCrArG 1301 OOOOOOOOO Antisense strand:
rs362307 1075 GCACAGA rArCrUrUrCrCrArA OOOOOOOOO Positive control;
CUUCCAA OO Curr. Bio. Vol 19 No 9; 776 WV- GGAAGUC 950
rGrGrArArGrUrCrUrGrUrGrCr 1302 OOOOOOOOO Sense strand: rs362307
1076 UGUGCCC CrCrGrUrGrUrGrCrC OOOOOOOOO Positive control; GUGUGCC
OO Curr. Bio. Vol 19 No 9; 777: Note: incorrectly added as
rGrGrArArGrUrCr UrGrUrGrCrCrCrG rUrGrUrUrCrC (SEQ ID NO: 1553) in
earlier versions of databse WV- AUUAAUA 951 mA * SmU * SmU * SmA *
1303 SSSSSSSSSSS 6-10-4 (2'-OMe- HTT 1077 AATTGTC SmA * SmU * SA *
SA * SA * SSRSSSSS DNA-2'-OMe) rs7685686 ATCACC ST * ST * SG * ST *
SC * RA * Gapmer: Analogue ST * SmC * SmA * SmC * SmC of WV-451 WV-
AUUAAUA 952 mA * RmU * RmU * RmA * 1304 RRRRRSSSSS 6-10-4 (2'-OMe-
HTT 1078 AATTGTC RmA * RmU * SA * SA * SA * SSSRSSRRR DNA-2'-OMe)
rs7685686 ATCACC ST * ST * SG * ST * SC * RA * Gapmer: Analogue ST
* SmC * RmA * RmC * of WV-451 RmC WV- AUUAAUA 953 mA * SmU * SmU *
SmA * 1305 SSSSSSSSSSS 8-12 (2'-OMe- HTT 1079 AATTGTC SmA * SmU *
SmA * SmA * SSRSSSSS DNA) hemimer: rs7685686 ATCACC SA * ST * ST *
SG * ST * SC * Analogue of WV- RA * ST * SC * SA * SC * SC 451
WV- AUUAAUA 954 mA * RmU * RmU * RmA * 1306 RRRRRRRSSS 8-12
(2'-OMe- HTT 1080 AATTGTC RmA * RmU * RmA * RmA * SSSRSSSSS DNA)
hemimer: rs7685686 ATCACC SA * ST * ST * SG * ST * SC * Analogue of
WV- RA * ST * SC * SA * SC * SC 451 WV- AUUAAUA 955
mAmUmUmAmAmUmAmA * 1307 OOOOOOOSS 8-12 (2'-OMe- HTT 1081 AATTGTC SA
* ST * ST * SG * ST * SC * SSSSRSSSSS DNA) hemimer; rs7685686
ATCACC RA * ST * SC * SA * SC * SC PO wing: Analogue of WV-451 WV-
AUUAAUA 956 mAmUmUmAmAmU * SA * 1308 OOOOOSSSSS 6-10-4 (2'-OMe- HTT
1082 AATTGTC SA * SA * ST * ST * SG * ST * SSSRSSOOO DNA-2'-OMe);
PO rs7685686 ATCACC SC * RA * ST * SmCmAmCmC wings: Analogue of
WV-451 WV- AUUAAUA 957 mA * SmUmUmAmAmU * SA 1309 SOOOOSSSSS 6-10-4
(2'-OMe- HTT 1083 AATTGTC * SA * SA * ST * ST * SG * ST SSSRSSOOS
DNA-2'-OMe) rs7685686 ATCACC * SC * RA * ST * SmCmAmC * Gapmer:
Analogue SmC of WV-451 WV- AUUAAUA 958 mA * RmUmUmAmAmU * SA 1310
ROOOOSSSSS 6-10-4 (2'-OMe- HTT 1084 AATTGTC * SA * SA * ST * ST *
SG * ST SSSRSSOOR DNA-2'-OMe) rs7685686 ATCACC * SC * RA * ST *
SmCmAmC * Gapmer: Analogue RmC of WV-451 WV- GGCACAA 959 mG * SmG *
SmC * SmA * 1311 SSSSSSSSSSS 5-10-5 (2'-OMe- HTT 1085 GGGCACA SmC *
SA * SA * SG * SG * SG SRSSSSSS DNA-2'-OMe) rs362307 GACUUC * SC *
SA * SC * RA * SG * Gapmer: Analogue SmA * SmC * SmU * SmU * of
WV-905 and SmC WV-937 WV- GGCACAA 960 mG * RmG * RmC * RmA * 1312
RRRRSSSSSSS 5-10-5 (2'-OMe- HTT 1086 GGGCACA RmC * SA * SA * SG *
SG * SRSSRRRR DNA-2'-OMe) rs362307 GACUUC SG * SC * SA * SC * RA *
SG * Gapmer: Analogue SmA * RmC * RmU * RmU * of WV-905 and RmC
WV-937 WV- GGCACAA 961 mGmGmCmAmC * SA * SA * 1313 OOOOSSSSSS
5-10-5 (2'-OMe- HTT 1087 GGGCACA SG * SG * SG * SC * SA * SC *
SSRSSOOOO DNA-2'-OMe); PO rs362307 GACUUC RA * SG * SmAmCmUmUmC
wings: Analogue of WV-905 and WV- 937 WV- GGCACAA 962 mG * SmG *
SmC * SmA * 1314 SSSSSSSSSSS 8-12 (2'-OMe- HTT 1088 GGGCACA SmC *
SmA * SmA * SmG * SG SRSSSSSS DNA) hemimer: rs362307 GACTTC * SG *
SC * SA * SC * RA * SG Analogue of WV- * SA * SC * ST * ST * SC 905
and WV-937 WV- GGCACAA 963 mG * RmG * RmC * RmA * 1315 RRRRRRRSSS
8-12 (2'-OMe- HTT 1089 GGGCACA RmC * RmA * RmA * RmG * SSRSSSSSS
DNA) hemimer: rs362307 GACTTC SG * SG * SC * SA * SC * RA *
Analogue of WV- SG * SA * SC * ST * ST * SC 905 and WV-937 WV-
GGCACAA 964 mGmGmCmAmCmAmAmG * 1316 OOOOOOOSS 8-12 (2'-OMe- HTT
1090 GGGCACA SG * SG * SC * SA * SC * RA * SSSRSSSSSS DNA) hemimer;
rs362307 GACTTC SG * SA * SC * ST * ST * SC PO wing: Analogue of
WV-905 and WV-937 WV- GGCACAA 965 mG * RmGmCmAmC * SA * 1317
ROOOSSSSSS 8-12 (2'-OMe- HTT 1091 GGGCACA SA * SG * SG * SG * SC *
SA * SSRSSOOOR DNA) gapmer PO rs362307 GACUUC SC * RA * SG *
SmAmCmUmU wing: Analogue of * RmC WV-905 and WV- 937: incorrectly
added as gsSgcacsSdAsSdAs SdGsSdGsSdGsSd CsSdAsSdCsRdAs
SdGsSacuusSc in earlier version of database WV- GGCACAA 966 mG *
SmGmCmAmC * SA * 1318 SOOOSSSSSS 8-12 (2'-OMe- HTT 1092 GGGCACA SA
* SG * SG * SG * SC * SA * SSRSSOOOS DNA) gapmer PO rs362307 GACUUC
SC * RA * SG * SmAmCmUmU wing: Analogue of * SmC WV-905 and WV- 937
WV- GCAGGGC 967 G * C * A * G * G * G * C * A * 1319 XXXXXXXXX
Phosphorothioate Huntington 1183 ACAAGGG C * A * A * G * G * G * C
* A * XXXXXXXXX DNA; rs362307 CACAGA C * A * G * A X Stereorandom
WV- GCAGGGC 968 mG * mC * mA * mG * mG * G 1320 XXXXXXXXX 5-15
(2'-OMe- Huntington 1184 ACAAGGG * C * A * C * A * A * G * G * G
XXXXXXXXX DNA) Hemimer rs362307 CACAGA * C * A * C * A * G * A X
WV- GCAGGGC 969 mGmCmAmGmG * G * C * A * 1321 OOOOXXXXX 5-15
(2'-OMe- Huntington 1185 ACAAGGG C * A * A * G * G * G * C * A *
XXXXXXXXX DNA) Hemimer; rs362307 CACAGA C * A * G * A X PO wing WV-
GCAGGGC 970 mG * mC * mA * mG * mG * 1322 XXXXXXXXX 7-13 (2'-OMe-
Huntington 1186 ACAAGGG mG * mC * A * C * A * A * G * XXXXXXXXX
DNA) Hemimer rs362307 CACAGA G * G * C * A * C * A * G * A X WV-
GCAGGGC 971 mGmCmAmGmGmGmC * A * 1323 OOOOOOXXX 7-13 (2'-OMe-
Huntington 1187 ACAAGGG C * A * A * G * G * G * C * A * XXXXXXXXX
DNA) Hemimer; rs362307 CACAGA C * A * G * A X PO wing WV- CAGGGCA
972 C * A * G * G * G * C * A * C * 1324 XXXXXXXXX Phosphorothioate
Huntington 1188 CAAGGGC A * A * G * G * G * C * A * C * XXXXXXXXX
DNA; rs362307 ACAGAC A * G * A * C X Stereorandom WV- CAGGGCA 973
mC * mA * mG * mG * mG * C 1325 XXXXXXXXX 5-15 (2'-OMe- Huntington
1189 CAAGGGC * A * C * A * A * G * G * G * C XXXXXXXXX DNA) Hemimer
rs362307 ACAGAC * A * C * A * G * A * C X WV- CAGGGCA 974
mCmAmGmGmG * C * A * C * 1326 OOOOXXXXX 5-15 (2'-OMe- Huntington
1190 CAAGGGC A * A * G * G * G * C * A * C * XXXXXXXXX DNA)
Hemimer; rs362307 ACAGAC A * G * A * C X PO wing WV- CAGGGCA 975 mC
* mA * mG * mG * mG * 1327 XXXXXXXXX 7-13 (2'-OMe- Huntington 1191
CAAGGGC mC * mA * C * A * A * G * G * XXXXXXXXX DNA) Hemimer
rs362307 ACAGAC G * C * A * mC * mA * mG * X mA * mC WV- CAGGGCA
976 mCmAmGmGmGmCmA * C * 1328 OOOOOOXXX 7-13 (2'-OMe- Huntington
1192 CAAGGGC A * A * G * G * G * C * A * XXXXXXOOO DNA) Hemimer;
rs362307 ACAGAC mCmAmGmAmC O PO wing WV- AGGGCAC 977 A * G * G * G
* C * A * C * A * 1329 XXXXXXXXX Phosphorothioate Huntington 1193
AAGGGCA A * G * G * G * C * A * C * A * XXXXXXXXX DNA; rs362307
CAGACT G * A * C * T X Stereorandom WV- AGGGCAC 978 mA * mG * mG *
mG * mC * A 1330 XXXXXXXXX 5-15 (2'-OMe- Huntington 1194 AAGGGCA *
C * A * A * G * G * G * C * A XXXXXXXXX DNA) Hemimer rs362307
CAGACT * C * A * G * A * C * T X WV- AGGGCAC 979 mAmGmGmGmC * A * C
* A * 1331 OOOOXXXXX 5-15 (2'-OMe- Huntington 1195 AAGGGCA A * G *
G * G * C * A * C * A * XXXXXXXXX DNA) Hemimer; rs362307 CAGACT G *
A * C * T X PO wing WV- AGGGCAC 980 mA * mG * mG * mG * mC * 1332
XXXXXXXXX 7-12-1 (2'-OMe- Huntington 1196 AAGGGCA mA * mC * A * A *
G * G * G * XXXXXXXXX DNA-2'-DNA) rs362307 CAGACU C * A * C * A * G
* A * C * mU X Gapmer WV- AGGGCAC 981 mAmGmGmGmCmAmC * A * 1333
OOOOOOXXX 7-12-1 (2'-OMe- Huntington 1197 AAGGGCA A * G * G * G * C
* A * C * A * XXXXXXXXX DNA-2'-DNA) rs362307 CAGACU G * A * C * mU
X Gapmer; PO wings WV- AAGGGCA 982 A * A * G * G * G * C * A * C *
1334 XXXXXXXXX Phosphorothioate Huntington 1198 CAGACTT A * G * A *
C * T * T * C * C * XXXXXXXXX DNA; rs362307 CCAAAG A * A * A * G X
Stereorandom WV- AAGGGCA 983 mA * mA * mG * mG * mG * C 1335
XXXXXXXXX 5-15 (2'-OMe- Huntington 1199 CAGACTT * A * C * A * G * A
* C * T * T XXXXXXXXX DNA) Hemimer rs362307 CCAAAG * C * C * A * A
* A * G X WV- AAGGGCA 984 mAmAmGmGmG * C * A * C * 1336 OOOOXXXXX
5-15 (2'-OMe- Huntington 1200 CAGACTT A * G * A * C * T * T * C * C
* XXXXXXXXX DNA) Hemimer; rs362307 CCAAAG A * A * A * G X PO wing
WV- AAGGGCA 985 mA * mA * mG * mG * mG * C 1337 XXXXXXXXX 5-10-5
(2'-OMe- Huntington 1201 CAGACTT * A * C * A * G * A * C * T * T
XXXXXXXXX DNA-2'-DNA) rs362307 CCAAAG * C * mC * mA * mA * mA * X
Gapmer mG WV- AAGGGCA 986 mAmAmGmGmG * C * A * C * 1338 OOOOXXXXX
5-10-5 (2'-OMe- Huntington 1202 CAGACTT A * G * A * C * T * T * C *
XXXXXXOOO DNA-2'-DNA) rs362307 CCAAAG mCmAmAmAmG O Gapmer; PO wings
WV- AAGGGCA 987 mA * mA * mG * mG * G * C * 1339 XXXXXXXXX 4-10-6
(2'-OMe- Huntington 1203 CAGACTT A * C * A * G * A * C * T * T *
XXXXXXXXX DNA-2'-DNA) rs362307 CCAAAG mC * mC * mA * mA * mA * X
Gapmer mG WV- AAGGGCA 988 mAmAmGmGG * C * A * C * 1340 OOOOXXXXX
4-10-6 (2'-OMe- Huntington 1204 CAGACTT A * G * A * C * T * T *
XXXXXOOOO DNA-2'-DNA) rs362307 CCAAAG mCmCmAmAmAmG O Gapmer; PO
wings WV- AGGGCAC 989 A * G * G * G * C * A * C * A * 1341
XXXXXXXXX Phosphorothioate Huntington 1205 AGACTTC G * A * C * T *
T * C * C * A * XXXXXXXXX DNA; rs362307 CAAAGG A * A * G * G X
Stereorandom WV- AGGGCAC 990 mA * mG * mG * mG * mC * A 1342
XXXXXXXXX 5-15 (2'-OMe- Huntington 1206 AGACTTC * C * A * G * A * C
* T * T * C XXXXXXXXX DNA) Hemimer rs362307 CAAAGG * C * A * A * A
* G * G X WV- AGGGCAC 991 mAmGmGmGmC * A * C * A * 1343 OOOOXXXXX
5-15 (2'-OMe- Huntington 1207 AGACTTC G * A * C * T * T * C * C * A
* XXXXXXXXX DNA) Hemimer; rs362307 CAAAGG A * A * G * G X PO wing
WV- AGGGCAC 992 mA * mG * mG * mG * mC * A 1344 XXXXXXXXX 5-10-5
(2'-OMe- Huntington 1208 AGACTTC * C * A * G * A * C * T * T * C
XXXXXXXXX DNA-2'-DNA) rs362307 CAAAGG * C * mA * mA * mA * mG * X
Gapmer mG WV- AGGGCAC 993 mAmGmGmGmC * A * C * A * 1345 OOOOXXXXX
5-10-5 (2'-OMe- Huntington 1209 AGACTTC G * A * C * T * T * C * C *
XXXXXXOOO DNA-2'-DNA) rs362307 CAAAGG mAmAmAmGmG O Gapmer; PO wings
WV- AGGGCAC 994 mA * mG * mG * mG * C * A * 1346 XXXXXXXXX 4-10-6
(2'-OMe- Huntington 1210 AGACTTC C * A * G * A * C * T * T * C *
XXXXXXXXX DNA-2'-DNA)
rs362307 CAAAGG mC * mA * mA * mA * mG * X Gapmer mG WV- AGGGCAC
995 mAmGmGmG * C * A * C * A 1347 OOOXXXXXX 4-10-6 (2'-OMe-
Huntington 1211 AGACTTC * G * A * C * T * T * C * XXXXXOOOO
DNA-2'-DNA) rs362307 CAAAGG mCmAmAmAmGmG O Gapmer; PO wings WV-
GGGCACA 996 G * G * G * C * A * C * A * G * 1348 XXXXXXXXX
Phosphorothioate Huntington 1212 GACTTCC A * C * T * T * C * C * A
* A * XXXXXXXXX DNA; rs362307 AAAGGC A * G * G * C X Stereorandom
WV- GGGCACA 997 mG * mG * mG * mC * mA * C 1349 XXXXXXXXX 4-16
(2'-OMe- Huntington 1213 GACTTCC * A * G * A * C * T * T * C * C
XXXXXXXXX DNA) Hemimer rs362307 AAAGGC * A * A * A * G * G * C X
WV- GGGCACA 998 mGmGmGmCmA * C * A * G * 1350 OOOOXXXXX 4-16
(2'-OMe- Huntington 1214 GACTTCC A * C * T * T * C * C * A * A *
XXXXXXXXX DNA) Hemimer; rs362307 AAAGGC A * G * G * C X PO wing WV-
GGGCACA 999 mG * mG * mG * mC * mA * C 1351 XXXXXXXXX 4-10-6
(2'-OMe- Huntington 1215 GACTTCC * A * G * A * C * T * T * C * C
XXXXXXXXX DNA-2'-DNA) rs362307 AAAGGC * A * mA * mA * mG * mG * X
Gapmer mC WV- GGGCACA 1000 mGmGmGmCmA * C * A * G * 1352 OOOOXXXXX
4-10-6 (2'-OMe- Huntington 1216 GACTTCC A * C * T * T * C * C * A *
XXXXXXOOO DNA-2'-DNA) rs362307 AAAGGC mAmAmGmGmC O Gapmer; PO wings
WV- GGCACAA 1001 mG * mG * mC * mA * mC * A 1353 XXXXXXXXX 5-10-5
(2'-OMe- HTT- 1234 GGGCACA * A * G * G * G * C * A * C * A
XXXXXXXXX DNA-2'-OMe) rs362307 GACUTC * G * mA * mC * mU * BrdU * X
Gapmer; One Br- mC dU WV- GGCACAA 1002 mG * mG * mC * mA * mC * A
1354 XXXXXXXXX 5-10-5 (2'-OMe- HTT- 1235 GGGCACA * A * G * G * G *
C * A * C * A XXXXXXXXX DNA-2'-OMe) rs362307 GACTTC * G * mA * mC *
BrdU * BrdU X Gapmer; two Br-dU * mC WV- GGCACAA 1003 mG * mGmCmAmC
* A * A * 1355 XOOOXXXXX stereo random HTT 1497 GGGCACA G * G * G *
C * A * C * A * G * XXXXXXOOO version of WV- rs362307 GACUUC
mAmCmUmU * mC X 1092 WV- AUUAAUA 1004 A * SmUmUmAmAmU * SA * 1356
SOOOOSSSSS 1-5-10-3-1 HTT 1508 AATTGTC SA * SA * ST * ST * SG * ST
* SSSRSSOOS (DNA/2'-OMe) rs7685686 ATCACC SC * RA * ST * SmCmAmC *
Gapmer: : SC Analogue of WV- 1083 WV- AUUAAUA 1005 A * mUmUmAmAmU *
A * A * 1357 XOOOOXXXX 1-5-10-3-1 HTT 1509 AATTGTC A * T * T * G *
T * C * A * T * XXXXXXXOO (DNA/2'-OMe) rs7685686 ATCACC mCmAmC * C
X Gapmer; 1st and last PS: : Analogue of WV-1083 WV- GGCACAA 1006 G
* SmGmCmAmC * SA * SA * 1358 SOOOSSSSSS 1-4-10-4-1 HTT 1510 GGGCACA
SG * SG * SG * SC * SA * SC * SSRSSOOOS (DNA/2'-OMe) rs362307
GACUUC RA * SG * SmAmCmUmU * SC gapmer: : Analogue of WV-1092 WV-
GGCACAA 1007 G * mGmCmAmC * A * A * G 1359 XOOOXXXXX 1-4-10-4-1 HTT
1511 GGGCACA * G * G * C * A * C * A * G * XXXXXXOOO (DNA/2'-OMe)
rs362307 GACUUC mAmCmUmU * C X gapmer; 1st and last PS: : Analogue
of WV-1092 WV- GGCACAA 1008 Geo * Geo * m5Ceo * Aeo * 1360
XXXXXXXXX 5-10-5; 2'-OMOE HTT 1654 GGGCACA m5Ceo * A * A * G * G *
G * C XXXXXXXXX gapmer; All PS rs362307 GACTTC * A * C * A * G *
Aeo * m5Ceo X * Teo * Teo * m5Ceo WV- GGCACAA 1009 Geo *
Geom5CeoAeom5Ceo * A 1361 XOOOXXXXX 5-10-5; 2'-OMOE HTT 1655
GGGCACA * A * G * G * G * C * A * C * A XXXXXXOOO gapmer; 1st and
last rs362307 GACTTC * G * Aeom5CeoTeoTeo * X PS in the wing; rest
m5Ceo of the wing is PO WV- CTCAGTA 1010 m5Ceo * Teo * m5Ceo * Aeo
* 1362 XXXXXXXXX 5-10-5; 2'-OMOE Huntington 1656 ACATTGA Geo * T *
A * A * C * A * T * T XXXXXXXXX gapmer; All PS CACCAC * G * A * C *
Aeo * m5Ceo * X m5Ceo * Aeo * m5Ceo WV- CUCAGTA 1011 mC * mU * mC *
mA * mG * T 1363 XXXXXXXXX 5-10-5; 2'-OMe Huntington 1657 ACATTGA *
A * A * C * A * T * T * G * A XXXXXXXXX gapmer; All PS CACCAC * C *
mA * mC * mC * mA * X mC WV- GGCACAA 1012 mG * mGmCmAmC * A * A *
1364 XOOOXXXXX 5/10/5 2'Ome HTT 1788 GGGCACA G * G * G * C * A * C
* A * G * XXXXXXOOX Gapmer BrdU PO GACUTC mAmCmU * BrdU * mC X
wings WV- CTCAGTA 1013 mC * BrdU * mC * mA * mG * 1365 XXXXXXXXX
5/10/5 2'Ome HTT 1789 ACATTGA T * A * A * C * A * T * T * G *
XXXXXXXXX Gapmer BrdU CACCAC A * C * mA * mC * mC * mA * X mC WV-
CTCAGTA 1014 mC * BrdU * mCmAmG * T * A 1366 XXOOXXXXX 5/10/5 2'Ome
HTT 1790 ACATTGA * A * C * A * T * T * G * A * C XXXXXXOOO Gapmer
BrdU PO CACCAC * mAmCmCmA * mC X wings WV- GAAGUCU 1015
rGrArArGrUrCrUrGrUrGrCrCrC 1367 OOOOOOOOO RNA HTT 1799 GUGCCCU
rUrUrGrUrGrCrC OOOOOOOOO complementary to UGUGCC O WV1092 WV-
GGCACAA 1016 mG * SmGmCmAmC * SA * 1368 SOOOSSSSSS BrdU version of
HTT 2022 GGGCACA SA * SG * SG * SG * SC * SA * SSRSSOOSS WV-1092
rs362307 GACUTC SC * RA * SG * SmAmCmU * SBrdU * SmC WV- TGTCATC
1017 T * G * T * C * A * T * C * A * 1369 XXXXXXXXX 15-5 hemimer
full rs7685686 2023 ACCAGAA C * C * A * G * A * A * A * mA
XXXXXXXXX PS (A/G) AAAGUC * mA * mG * mU * mC X WV- UTGTCAT 1018 mU
* T * G * T * C * A * T * C 1370 XXXXXXXXX 1-14-5 gapmer full
rs7685686 2024 CACCAGA * A * C * C * A * G * A * A * XXXXXXXXX PS
(A/G) AAAAGU mA * mA * mA * mG * mU X WV- TTGTCAT 1019 T * T * G *
T * C * A * T * C * 1371 XXXXXXXXX 15-5 hemimer full rs7685686 2025
CACCAGA A * C * C * A * G * A * A * mA XXXXXXXXX PS (A/G) AAAAGU *
mA * mA * mG * mU X WV- AUTGTCA 1020 mA * mU * T * G * T * C * A *
1372 XXXXXXXXX 2-13-5 gapmer full rs7685686 2026 TCACCAG T * C * A
* C * C * A * G * A * XXXXXXXXX PS (A/G) AAAAAG mA * mA * mA * mA *
mG X WV- ATTGTCA 1021 mA * T * T * G * T * C * A * T 1373 XXXXXXXXX
1-14-5 gapmer full rs7685686 2027 TCACCAG * C * A * C * C * A * G *
A * XXXXXXXXX PS (A/G) AAAAAG mA * mA * mA * mA * mG X WV- AAUTGTC
1022 mA * mA * mU * T * G * T * C 1374 XXXXXXXXX 3-12-5 gapmer full
rs7685686 2028 ATCACCA * A * T * C * A * C * C * A * G XXXXXXXXX PS
(A/G) GAAAAA * mA * mA * mA * mA * mA X WV- AATTGTC 1023 mA * mA *
T * T * G * T * C * 1375 XXXXXXXXX 2-13-5 gapmer full rs7685686
2029 ATCACCA A * T * C * A * C * C * A * G * XXXXXXXXX PS (A/G)
GAAAAA mA * mA * mA * mA * mA X WV- AAATTGT 1024 mA * mA * mA * T *
T * G * T 1376 XXXXXXXXX 3-12-5 gapmer full rs7685686 2030 CATCACC
* C * A * T * C * A * C * C * A XXXXXXXXX PS (A/G) AGAAAA * mG * mA
* mA * mA * mA X WV- AAAUTGT 1025 mA * mA * mA * mU * T * G * 1377
XXXXXXXXX 4-11-5 gapmer full rs7685686 2031 CATCACC T * C * A * T *
C * A * C * C * XXXXXXXXX PS (A/G) AGAAAA A * mG * mA * mA * mA *
mA X WV- UAAAUTG 1026 mU * mA * mA * mA * mU * T 1378 XXXXXXXXX
5-11-4 gapmer full rs7685686 2032 TCATCAC * G * T * C * A * T * C *
A * C XXXXXXXXX PS (A/G) CAGAAA * C * A * mG * mA * mA * mA X WV-
UAAAUTG 1027 mU * mA * mA * mA * mU * T 1379 XXXXXXXXX 5-10-5
gapmer full rs7685686 2033 TCATCAC * G * T * C * A * T * C * A * C
XXXXXXXXX PS (A/G) CAGAAA * C * mA * mG * mA * mA * X mA WV-
AUAAATT 1028 mA * mU * mA * mA * mA * T 1380 XXXXXXXXX 5-11-4
gapmer full rs7685686 2034 GTCATCA * T * G * T * C * A * T * C * A
XXXXXXXXX PS (A/G) CCAGAA * C * C * mA * mG * mA * mA X WV- AUAAATT
1029 mA * mU * mA * mA * mA * T 1381 XXXXXXXXX 5-10-5 gapmer full
rs7685686 2035 GTCATCA * T * G * T * C * A * T * C * A XXXXXXXXX PS
(A/G) CCAGAA * C * mC * mA * mG * mA * X mA WV- AAUAAAT 1030 mA *
mA * mU * mA * mA * A 1382 XXXXXXXXX 5-12-3 gapmer full rs7685686
2036 TGTCATC * T * T * G * T * C * A * T * C XXXXXXXXX PS (A/G)
ACCAGA * A * C * C * mA * mG * mA X WV- AAUAAAT 1031 mA * mA * mU *
mA * mA * A 1383 XXXXXXXXX 5-11-4 gapmer full rs7685686 2037
TGTCATC * T * T * G * T * C * A * T * C XXXXXXXXX PS (A/G) ACCAGA *
A * C * mC * mA * mG * mA X WV- AAUAAAT 1032 mA * mA * mU * mA * mA
* A 1384 XXXXXXXXX 5-10-5 gapmer full rs7685686 2038 TGTCATC * T *
T * G * T * C * A * T * C XXXXXXXXX PS (A/G) ACCAGA * A * mC * mC *
mA * mG * X mA WV- UAAUAAA 1033 mU * mA * mA * mU * mA * A 1385
XXXXXXXXX 5-13-2 gapmer full rs7685686 2039 TTGTCAT * A * T * T * G
* T * C * A * T XXXXXXXXX PS (A/G) CACCAG * C * A * C * C * mA * mG
X WV- UAAUAAA 1034 mU * mA * mA * mU * mA * A 1386 XXXXXXXXX 5-12-3
gapmer full rs7685686 2040 TTGTCAT * A * T * T * G * T * C * A * T
XXXXXXXXX PS (A/G) CACCAG * C * A * C * mC * mA * mG X WV- UAAUAAA
1035 mU * mA * mA * mU * mA * A 1387 XXXXXXXXX 5-11-4 gapmer full
rs7685686 2041 TTGTCAT * A * T * T * G * T * C * A * T XXXXXXXXX PS
(A/G) CACCAG * C * A * mC * mC * mA * mG X WV- UAAUAAA 1036 mU * mA
* mA * mU * mA * A 1388 XXXXXXXXX 5-10-5 gapmer full rs7685686 2042
TTGTCAT * A * T * T * G * T * C * A * T XXXXXXXXX PS (A/G) CACCAG *
C * mA * mC * mC * mA * X mG WV- UUAAUAA 1037 mU * mU * mA * mA *
mU * A 1389 XXXXXXXXX 5-14-1 gapmer full rs7685686 2043 ATTGTCA * A
* A * T * T * G * T * C * A XXXXXXXXX PS (A/G) TCACCA * T * C * A *
C * C * mA X WV- UUAAUAA 1038 mU * mU * mA * mA * mU * A 1390
XXXXXXXXX 5-13-2 gapmer full rs7685686 2044 ATTGTCA * A * A * T * T
* G * T * C * A XXXXXXXXX PS (A/G) TCACCA * T * C * A * C * mC * mA
X WV- UUAAUAA 1039 mU * mU * mA * mA * mU * A 1391 XXXXXXXXX 5-12-3
gapmer full rs7685686
2045 ATTGTCA * A * A * T * T * G * T * C * A XXXXXXXXX PS (A/G)
TCACCA * T * C * A * mC * mC * mA X WV- UUAAUAA 1040 mU * mU * mA *
mA * mU * A 1392 XXXXXXXXX 5-11-4 gapmer full rs7685686 2046
ATTGTCA * A * A * T * T * G * T * C * A XXXXXXXXX PS (A/G) TCACCA *
T * C * mA * mC * mC * mA X WV- AUUAATA 1041 mA * mU * mU * mA * mA
* T 1393 XXXXXXXXX 5-15 hemimer full rs7685686 2047 AATTGTC * A * A
* A * T * T * G * T * C XXXXXXXXX PS (A/G) ATCACC * A * T * C * A *
C * C X WV- AUUAATA 1042 mA * mU * mU * mA * mA * T 1394 XXXXXXXXX
5-14-1 gapmer full rs7685686 2048 AATTGTC * A * A * A * T * T * G *
T * C XXXXXXXXX PS (A/G) ATCACC * A * T * C * A * C * mC X WV-
AUUAATA 1043 mA * mU * mU * mA * mA * T 1395 XXXXXXXXX 5-13-2
gapmer full rs7685686 2049 AATTGTC * A * A * A * T * T * G * T * C
XXXXXXXXX PS (A/G) ATCACC * A * T * C * A * mC * mC X WV- AUUAATA
1044 mA * mU * mU * mA * mA * T 1396 XXXXXXXXX 5-12-3 gapmer full
rs7685686 2050 AATTGTC * A * A * A * T * T * G * T * C XXXXXXXXX PS
(A/G) ATCACC * A * T * C * mA * mC * mC X WV- UAUUAAT 1045 mU * mA
* mU * mU * mA * A 1397 XXXXXXXXX 5-15 hemimer full rs7685686 2051
AAATTGT * T * A * A * A * T * T * G * T XXXXXXXXX PS (A/G) CATCAC *
C * A * T * C * A * C X WV- UAUUAAT 1046 mU * mA * mU * mU * mA * A
1398 XXXXXXXXX 5-14-1 gapmer full rs7685686 2052 AAATTGT * T * A *
A * A * T * T * G * T XXXXXXXXX PS (A/G) CATCAC * C * A * T * C * A
* mC X WV- UAUUAAT 1047 mU * mA * mU * mU * mA * A 1399 XXXXXXXXX
5-13-2 gapmer full rs7685686 2053 AAATTGT * T * A * A * A * T * T *
G * T XXXXXXXXX PS (A/G) CATCAC * C * A * T * C * mA * mC X WV-
CUAUUAA 1048 mC * mU * mA * mU * mU * A 1400 XXXXXXXXX 5-15 hemimer
full rs7685686 2054 TAAATTG * A * T * A * A * A * T * T * G
XXXXXXXXX PS (A/G) TCATCA * T * C * A * T * C * A X WV- CUAUUAA
1049 mC * mU * mA * mU * mU * A 1401 XXXXXXXXX 5-14-1 gapmer full
rs7685686 2055 TAAATTG * A * T * A * A * A * T * T * G XXXXXXXXX PS
(A/G) TCATCA * T * C * A * T * C * mA X WV- ACUAUTA 1050 mA * mC *
mU * mA * mU * T 1402 XXXXXXXXX 5-15 hemimer full rs7685686 2056
ATAAATT * A * A * T * A * A * A * T * T XXXXXXXXX PS (A/G) GTCATC *
G * T * C * A * T * C X WV- TGTCATC 1051 T * G * T * C * A * T * C
* A * 1403 XXXXXXXXX 15-5 hemimer 1 PS rs7685686 2057 ACCAGAA C * C
* A * G * A * A * A * XXXXXXOOO on each end and (A/G) AAAGUC
mAmAmGmU * mC X between dN-mN and dN-dN WV- UTGTCAT 1052 mU * T * G
* T * C * A * T * C 1404 XXXXXXXXX 1-14-5 gapmer 1 rs7685686 2058
CACCAGA * A * C * C * A * G * A * A * XXXXXXOOO PS on each end and
(A/G) AAAAGU mAmAmAmG * mU X between dN-mN and dN-dN WV- TTGTCAT
1053 T * T * G * T * C * A * T * C * 1405 XXXXXXXXX 15-5 hemimer 1
PS rs7685686 2059 CACCAGA A * C * C * A * G * A * A * XXXXXXOOO on
each end and (A/G) AAAAGU mAmAmAmG * mU X between dN-mN and dN-dN
WV- AUTGTCA 1054 mA * mU * T * G * T * C * A * 1406 XXXXXXXXX
2-13-5 gapmer 1 rs7685686 2060 TCACCAG T * C * A * C * C * A * G *
A * XXXXXXOOO PS on each end and (A/G) AAAAAG mAmAmAmA * mG X
between dN-mN and dN-dN WV- ATTGTCA 1055 mA * T * T * G * T * C * A
* T 1407 XXXXXXXXX 1-14-5 gapmer 1 rs7685686 2061 TCACCAG * C * A *
C * C * A * G * A * XXXXXXOOO PS on each end and (A/G) AAAAAG
mAmAmAmA * mG X between dN-mN and dN-dN WV- AAUTGTC 1056 mA * mAmU
* T * G * T * C * 1408 XOXXXXXXX 3-12-5 gapmer 1 rs7685686 2062
ATCACCA A * T * C * A * C * C * A * G * XXXXXXOOO PS on each end
and (A/G) GAAAAA mAmAmAmA * mA X between dN-mN and dN-dN WV-
AATTGTC 1057 mA * mA * T * T * G * T * C * 1409 XXXXXXXXX 2-13-5
gapmer 1 rs7685686 2063 ATCACCA A * T * C * A * C * C * A * G *
XXXXXXOOO PS on each end and (A/G) GAAAAA mAmAmAmA * mA X between
dN-mN and dN-dN WV- AAATTGT 1058 mA * mAmA * T * T * G * T * 1410
XOXXXXXXX 3-12-5 gapmer 1 rs7685686 2064 CATCACC C * A * T * C * A
* C * C * A * XXXXXXOOO PS on each end and (A/G) AGAAAA mGmAmAmA *
mA X between dN-mN and dN-dN WV- AAAUTGT 1059 mA * mAmAmU * T * G *
T * 1411 XOOXXXXXX 4-11-5 gapmer 1 rs7685686 2065 CATCACC C * A * T
* C * A * C * C * A * XXXXXXOOO PS on each end and (A/G) AGAAAA
mGmAmAmA * mA X between dN-mN and dN-dN WV- UAAAUTG 1060 mU *
mAmAmAmU * T * G * T 1412 XOOOXXXXX 5-11-4 gapmer 1 rs7685686 2066
TCATCAC * C * A * T * C * A * C * C * A XXXXXXXOO PS on each end
and (A/G) CAGAAA * mGmAmA * mA X between dN-mN and dN-dN WV-
UAAAUTG 1061 mU * mAmAmAmU * T * G * T 1413 XOOOXXXXX 5-10-5 gapmer
1 rs7685686 2067 TCATCAC * C * A * T * C * A * C * C * XXXXXXOOO PS
on each end and (A/G) CAGAAA mAmGmAmA * mA X between dN-mN and
dN-dN WV- AUAAATT 1062 mA * mUmAmAmA * T * T * G 1414 XOOOXXXXX
5-11-4 gapmer 1 rs7685686 2068 GTCATCA * T * C * A * T * C * A * C
* C XXXXXXXOO PS on each end and (A/G) CCAGAA * mAmGmA * mA X
between dN-mN and dN-dN WV- AUAAATT 1063 mA * mUmAmAmA * T * T * G
1415 XOOOXXXXX 5-10-5 gapmer 1 rs7685686 2069 GTCATCA * T * C * A *
T * C * A * C * XXXXXXOOO PS on each end and (A/G) CCAGAA mCmAmGmA
* mA X between dN-mN and dN-dN WV- AAUAAAT 1064 mA * mAmUmAmA * A *
T * T 1416 XOOOXXXXX 5-12-3 gapmer 1 rs7685686 2070 TGTCATC * G * T
* C * A * T * C * A * C XXXXXXXXO PS on each end and (A/G) ACCAGA *
C * mAmG * mA X between dN-mN and dN-dN WV- AAUAAAT 1065 mA *
mAmUmAmA * A * T * T 1417 XOOOXXXXX 5-11-4 gapmer 1 rs7685686 2071
TGTCATC * G * T * C * A * T * C * A * C XXXXXXXOO PS on each end
and (A/G) ACCAGA * mCmAmG * mA X between dN-mN and dN-dN WV-
AAUAAAT 1066 mA * mAmUmAmA * A * T * T 1418 XOOOXXXXX 5-10-5 gapmer
1 rs7685686 2072 TGTCATC * G * T * C * A * T * C * A * XXXXXXOOO PS
on each end and (A/G) ACCAGA mCmCmAmG * mA X between dN-mN and
dN-dN WV- UAAUAAA 1067 mU * mAmAmUmA * A * A * 1419 XOOOXXXXX
5-13-2 gapmer 1 rs7685686 2073 TTGTCAT T * T * G * T * C * A * T *
C * XXXXXXXXX PS on each end and (A/G) CACCAG A * C * C * mA * mG X
between dN-mN and dN-dN WV- UAAUAAA 1068 mU * mAmAmUmA * A * A *
1420 XOOOXXXXX 5-12-3 gapmer 1 rs7685686 2074 TTGTCAT T * T * G * T
* C * A * T * C * XXXXXXXXO PS on each end and (A/G) CACCAG A * C *
mCmA * mG X between dN-mN and dN-dN WV- UAAUAAA 1069 mU * mAmAmUmA
* A * A * 1421 XOOOXXXXX 5-11-4 gapmer 1 rs7685686 2075 TTGTCAT T *
T * G * T * C * A * T * C * XXXXXXXOO PS on each end and (A/G)
CACCAG A * mCmCmA * mG X between dN-mN and dN-dN WV- UAAUAAA 1070
mU * mAmAmUmA * A * A * 1422 XOOOXXXXX 5-10-5 gapmer 1 rs7685686
2076 TTGTCAT T * T * G * T * C * A * T * C * XXXXXXOOO PS on each
end and (A/G) CACCAG mAmCmCmA * mG X between dN-mN and dN-dN WV-
UUAAUAA 1071 mU * mUmAmAmU * A * A * 1423 XOOOXXXXX 5-14-1 gapmer 1
rs7685686 2077 ATTGTCA A * T * T * G * T * C * A * T * XXXXXXXXX PS
on each end and (A/G) TCACCA C * A * C * C * mA X between dN-mN and
dN-dN WV- UUAAUAA 1072 mU * mUmAmAmU * A * A * 1424 XOOOXXXXX
5-13-2 gapmer 1 rs7685686 2078 ATTGTCA A * T * T * G * T * C * A *
T * XXXXXXXXX PS on each end and (A/G) TCACCA C * A * C * mC * mA X
between dN-mN and dN-dN WV- UUAAUAA 1073 mU * mUmAmAmU * A * A *
1425 XOOOXXXXX 5-12-3 gapmer 1 rs7685686 2079 ATTGTCA A * T * T * G
* T * C * A * T * XXXXXXXXO PS on each end and (A/G) TCACCA C * A *
mCmC * mA X between dN-mN and dN-dN WV- UUAAUAA 1074 mU * mUmAmAmU
* A * A * 1426 XOOOXXXXX 5-11-4 gapmer 1 rs7685686 2080 ATTGTCA A *
T * T * G * T * C * A * T * XXXXXXXOO PS on each end and (A/G)
TCACCA C * mAmCmC * mA X between dN-mN and dN-dN WV- AUUAATA 1075
mA * mUmUmAmA * T * A * 1427 XOOOXXXXX 5-15 hemimer 1 PS rs7685686
2081 AATTGTC A * A * T * T * G * T * C * A * XXXXXXXXX on each end
and (A/G) ATCACC T * C * A * C * C X between dN-mN and dN-dN WV-
AUUAATA 1076 mA * mUmUmAmA * T * A * 1428 XOOOXXXXX 5-14-1 gapmer 1
rs7685686 2082 AATTGTC A * A * T * T * G * T * C * A * XXXXXXXXX PS
on each end and (A/G) ATCACC T * C * A * C * mC X between dN-mN and
dN-dN WV- AUUAATA 1077 mA * mUmUmAmA * T * A * 1429 XOOOXXXXX
5-13-2 gapmer 1 rs7685686 2083 AATTGTC A * A * T * T * G * T * C *
A * XXXXXXXXX PS on each end and (A/G) ATCACC T * C * A * mC * mC X
between dN-mN and dN-dN WV- AUUAATA 1078 mA * mUmUmAmA * T * A *
1430 XOOOXXXXX 5-12-3 gapmer 1 rs7685686 2084 AATTGTC A * A * T * T
* G * T * C * A * XXXXXXXXO PS on each end and (A/G)
ATCACC T * C * mAmC * mC X between dN-mN and dN-dN WV- UAUUAAT 1079
mU * mAmUmUmA * A * T * 1431 XOOOXXXXX 5-15 hemimer 1 PS rs7685686
2085 AAATTGT A * A * A * T * T * G * T * C * XXXXXXXXX on each end
and (A/G) CATCAC A * T * C * A * C X between dN-mN and dN-dN WV-
UAUUAAT 1080 mU * mAmUmUmA * A * T * 1432 XOOOXXXXX 5-14-1 gapmer 1
rs7685686 2086 AAATTGT A * A * A * T * T * G * T * C * XXXXXXXXX PS
on each end and (A/G) CATCAC A * T * C * A * mC X between dN-mN and
dN-dN WV- UAUUAAT 1081 mU * mAmUmUmA * A * T * 1433 XOOOXXXXX
5-13-2 gapmer 1 rs7685686 2087 AAATTGT A * A * A * T * T * G * T *
C * XXXXXXXXX PS on each end and (A/G) CATCAC A * T * C * mA * mC X
between dN-mN and dN-dN WV- CUAUUAA 1082 mC * mUmAmUmU * A * A * T
1434 XOOOXXXXX 5-15 hemimer 1 PS rs7685686 2088 TAAATTG * A * A * A
* T * T * G * T * C XXXXXXXXX on each end and (A/G) TCATCA * A * T
* C * A X between dN-mN and dN-dN WV- CUAUUAA 1083 mC * mUmAmUmU *
A * A * T 1435 XOOOXXXXX 5-14-1 gapmer 1 rs7685686 2089 TAAATTG * A
* A * A * T * T * G * T * C XXXXXXXXX PS on each end and (A/G)
TCATCA * A * T * C * mA X between dN-mN and dN-dN WV- ACUAUTA 1084
mA * mCmUmAmU * T * A * A 1436 XOOOXXXXX 5-15 hemimer 1 PS
rs7685686 2090 ATAAATT * T * A * A * A * T * T * G * T XXXXXXXXX on
each end and (A/G) GTCATC * C * A * T * C X between dN-mN and dN-dN
WV- GACUUUU 1085 rGrArCrUrUrUrUrUrCrUrGrGr 1437 OOOOOOOOO HTT
rs7685686 HTT 2163 UCUGGUG UrGrArUrGrGrCrArArUrUrUrA OOOOOOOOO
rs7685686 AUGGCAA rUrUrArArUrArG OOOOOOOOO UUUAUUA OOOO AUAG WV-
GACUUUU 1086 rGrArCrUrUrUrUrUrCrUrGrGr 1438 OOOOOOOOO HTT rs7685686
HTT 2164 UCUGGUG UrGrArUrGrArCrArArUrUrUrA OOOOOOOOO rs7685686
AUGACAA rUrUrArArUrArG OOOOOOOOO UUUAUUA OOOO AUAG WV- UAAAUTG 1087
mU * SmAmAmAmU * ST * 1439 SOOOSSSSSR 5-10-5 2' OMe- HTT 2269
TCATCAC SG * ST * SC * SA * RT * SC * SSSSSOOOS DNA-2'-OMe
rs7685686 CAGAAA SA * SC * SC * SmAmGmAmA Gapmer 1-3-11-3-1 * SmA
(PS/PO) WV- AUAAATT 1088 mA * SmUmAmAmA * ST * ST 1440 SOOOSSSSSS
5-10-5 2' OMe- HTT 2270 GTCATCA * SG * ST * SC * SA * RT * SC
RSSSSOOOS DNA-2'-OMe rs7685686 CCAGAA * SA * SC * SmCmAmGmA *
Gapmer 1-3-11-3-1 SmA (PS/PO) WV- AAUAAAT 1089 mA * SmAmUmAmA * SA
* 1441 SOOOSSSSSS 5-10-5 2' OMe- HTT 2271 TGTCATC ST * ST * SG * ST
* SC * SA * SRSSSOOOS DNA-2'-OMe rs7685686 ACCAGA RT * SC * SA *
SmCmCmAmG Gapmer 1-3-11-3-1 * SmA (PS/PO) WV- UAAUAAA 1090 mU *
SmAmAmUmA * SA * 1442 SOOOSSSSSS 5-10-5 2' OMe- HTT 2272 TTGTCAT SA
* ST * ST * SG * ST * SC * SSRSSOOOS DNA-2'-OMe rs7685686 CACCAG SA
* RT * SC * SmAmCmCmA Gapmer 1-3-11-3-1 * SmG (PS/PO) WV- AAUAAAT
1091 mA * SmAmUmAmA * SA * 1443 SOOOSSSSSS P10 stereopure HTT 2374
TGTCATC ST * ST * SG * ST * SC * SA * SRSSSSOOS analogue of WV-
rs7685686 ACCAGA RT * SC * SA * SC * 2071 5-11-4 2'- SmCmAmG * SmA
OMe-DNA-2'-OMe Gapmer 1-3-12-2-1 (PS/PO) WV- UAAUAAA 1092 mU *
SmAmAmUmA * SA * 1444 SOOOSSSSSS P11 stereopure HTT 2375 TTGTCAT SA
* ST * ST * SG * ST * SC * SSRSSSOOS analogue of WV- rs7685686
CACCAG SA * RT * SC * SA * 20755-11-4 2'- SmCmCmA * SmG
OMe-DNA-2'-OMe Gapmer 1-3-12-2-1 (PS/PO) WV- GCACAAG 1093 mG *
mCmAmCmA * A * G * 1445 XOOOXXXXX P11 stereorandom HTT 2377 GGCACAG
G * G * C * A * C * A * G * A * XXXXXXOOO analogue of WV- rs362307
ACUUCC mCmUmUmC * mC X 932 5-10-5 2'- OMe-DNA-2'-OMe Gapmer and
1-3- 11-3-1 (PS/PO) WV- GCACAAG 1094 mG * SmCmAmCmA * SA * 1446
SOOOSSSSSS P11 stereorandom HTT 2378 GGCACAG SG * SG * SG * SC * SA
* SC * SRSSSOOOS analogue of WV- rs362307 ACUUCC RA * SG * SA *
SmCmUmUmC 932 5-10-5 2'- * SmC OMe-DNA-2'-OMe Gapmer and 1-3-
11-3-1 (PS/PO) WV- CACAAGG 1095 mC * mAmCmAmA * G * G * 1447
XOOOXXXXX P10 sereorandom HTT 2379 GCACAGA G * C * A * C * A * G *
A * C * XXXXXXOOO analogue of WV- rs362307 CUUCCA mUmUmCmC * mA X
933 5-10-5 2'- OMe-DNA-2'-OMe Gapmer and 1-3- 11-3-1 (PS/PO) WV-
CACAAGG 1096 mC * SmAmCmAmA * SG * 1448 SOOOSSSSSS P10 stereopure
HTT 2380 GCACAGA SG * SG * SC * SA * SC * RA * RSSSSOOOS analogue
of WV- rs362307 CUUCCA SG * SA * SC * SmUmUmCmC 933 5-10-5 2'- *
SmA OMe-DNA-2'-OMe Gapmer and 1-3- 11-3-1 (PS/PO) WV- UAAAUTG 1097
mU * SmAmAmAmU * ST * 1449 SOOOSSSSRS P8 5-10-5 2' HTT 2416 TCATCAC
SG * ST * SC * RA * ST * SC * SSSSSOOOS OMe-DNA-2'-OMe rs7685686
CAGAAA SA * SC * SC * SmAmGmAmA Gapmer 1-3-11-3-1 * SmA (PS/PO) WV-
AUAAATT 1098 mA * SmUmAmAmA * ST * ST 1450 SOOOSSSSSR P9 5-10-5 2'
HTT 2417 GTCATCA * SG * ST * SC * RA * ST * SC SSSSSOOOS
OMe-DNA-2'-OMe rs7685686 CCAGAA * SA * SC * SmCmAmGmA * Gapmer
1-3-11-3-1 SmA (PS/PO) WV- AAUAAAT 1099 mA * SmAmUmAmA * SA * 1451
SOOOSSSSSS P10 5-10-5 2' HTT 2418 TGTCATC ST * ST * SG * ST * SC *
RA * RSSSSOOOS OMe-DNA-2'-OMe rs7685686 ACCAGA ST * SC * SA *
SmCmCmAmG Gapmer 1-3-11-3-1 * SmA (PS/PO) WV- UAAUAAA 1100 mU *
SmAmAmUmA * SA * 1452 SOOOSSSSSS P11 5-10-5 2' HTT 2419 TTGTCAT SA
* ST * ST * SG * ST * SC * SRSSSOOOS OMe-DNA-2'-OMe rs7685686
CACCAG RA * ST * SC * SmAmCmCmA Gapmer 1-3-11-3-1 * SmG (PS/PO) WV-
UCCCCAC 1101 mU * SmCmCmCmC * SA * SC 1453 SOOOSSRSSS P6 5-10-5
(2'- HTT 2589 AGAGGGA * RA * SG * SA * SG * SG * SSSSSOOOS
OMe-DNA-2'- rs2530595 GGAAGC SG * SA * SG * SmGmAmAmG OMe)
1-3-11-3-1 (C/T) * SmC (PS/PO) Gapmer WV- CUCCCCA 1102 mC *
SmUmCmCmC * SC * SA 1454 SOOOSSSRSS P7 5-10-5 (2'- HTT 2590 CAGAGGG
* SC * RA * SG * SA * SG * SG SSSSSOOOS OMe-DNA-2'- rs2530595
AGGAAG * SG * SA * SmGmGmAmA * OMe) 1-3-11-3-1 (C/T) SmG (PS/PO)
Gapmer WV- CCUCCCC 1103 mC * SmCmUmCmC * SC * SC 1455 SOOOSSSSRS P8
5-10-5 (2'- HTT 2591 ACAGAGG * SA * SC * RA * SG * SA * SG
SSSSSOOOS OMe-DNA-2'- rs2530595 GAGGAA * SG * SG * SmAmGmGmA * OMe)
1-3-11-3-1 (C/T) SmA (PS/PO) Gapmer WV- UCCUCCC 1104 mU * SmCmCmUmC
* SC * SC 1456 SOOOSSSSSR P9 5-10-5 (2'- HTT 2592 CACAGAG * SC * SA
* SC * RA * SG * SA SSSSSOOOS OMe-DNA-2'- rs2530595 GGAGGA * SG *
SG * SmGmAmGmG * OMe) 1-3-11-3-1 (C/T) SmA (PS/PO) Gapmer WV-
GUCCUCC 1105 mG * SmUmCmCmU * SC * SC 1457 SOOOSSSSSS P10 5-10-5
(2'- HTT 2593 CCACAGA * SC * SC * SA * SC * RA * SG RSSSSOOOS
OMe-DNA-2'- rs2530595 GGGAGG * SA * SG * SmGmGmAmG * OMe)
1-3-11-3-1 (C/T) SmG (PS/PO) Gapmer WV- GGUCCTC 1106 mG * SmGmUmCmC
* ST * SC 1458 SOOOSSSSSS P11 5-10-5 (2'- HTT 2594 CCCACAG * SC *
SC * SC * SA * SC * RA SRSSSOOOS OMe-DNA-2'- rs2530595 AGGGAG * SG
* SA * SmGmGmGmA * OMe) 1-3-11-3-1 (C/T) SmG (PS/PO) Gapmer WV-
GGGUCCT 1107 mG * SmGmGmUmC * SC * ST 1459 SOOOSSSSSS P12 5-10-5
(2'- HTT 2595 CCCCACA * SC * SC * SC * SC * SA * SC SSRSSOOOS
OMe-DNA-2'- rs2530595 GAGGGA * RA * SG * SmAmGmGmG * OMe)
1-3-11-3-1 (C/T) SmA (PS/PO) Gapmer WV- CGGGUCC 1108 mC * SmGmGmGmU
* SC * SC 1460 SOOOSSSSSS P13 5-10-5 (2'- HTT 2596 TCCCCAC * ST *
SC * SC * SC * SC * SA SSSRSOOOS OMe-DNA-2'- rs2530595 AGAGGG * SC
* RA * SmGmAmGmG * OMe) 1-3-11-3-1 (C/T) SmG (PS/PO) Gapmer WV-
ACAGUAG 1109 mA * SmCmAmGmU * SA * 1461 SOOOSSRSSS P6 5-10-5 (2'-
HTT 2597 ATGAGGG SG * RA * ST * SG * SA * SG * SSSSSOOOS
OMe-DNA-2'- (rs362331) AGCAGG SG * SG * SA * SmGmCmAmG OMe)
1-3-11-3-1 (C/T) * SmG (PS/PO) Gapmer WV- CACAGTA 1110 mC *
SmAmCmAmG * ST * SA 1462 SOOOSSSRSS P7 5-10-5 (2'- HTT 2598 GATGAGG
* SG * RA * ST * SG * SA * SG SSSSSOOOS OMe-DNA-2'- (rs362331)
GAGCAG * SG * SG * SmAmGmCmA * OMe) 1-3-11-3-1 (C/T) SmG (PS/PO)
Gapmer WV- ACACAGT 1111 mA * SmCmAmCmA * SG * ST 1463 SOOOSSSSRS P8
5-10-5 (2'- HTT 2599 AGATGAG * SA * SG * RA * ST * SG * SA
SSSSSOOOS OMe-DNA-2'- (rs362331) GGAGCA * SG * SG * SmGmAmGmC *
OMe) 1-3-11-3-1 (C/T) SmA (PS/PO) Gapmer WV- CACACAG 1112 mC *
SmAmCmAmC * SA * SG 1464 SOOOSSSSSR P9 5-10-5 (2'- HTT 2600 TAGATGA
* ST * SA * SG * RA * ST * SG SSSSSOOOS OMe-DNA-2'- (rs362331)
GGGAGC * SA * SG * SmGmGmAmG * OMe) 1-3-11-3-1 (C/T) SmC (PS/PO)
Gapmer WV- GCACACA 1113 mG * SmCmAmCmA * SC * SA 1465 SOOOSSSSSS
P10 5-10-5 (2'- HTT 2601 GTAGATG * SG * ST * SA * SG * RA * ST
RSSSSOOOS OMe-DNA-2'- (rs362331) AGGGAG * SG * SA * SmGmGmGmA *
OMe) 1-3-11-3-1 (C/T) SmG (PS/PO) Gapmer WV- UGCACAC 1114 mU *
SmGmCmAmC * SA * SC 1466 SOOOSSSSSS P11 5-10-5 (2'- HTT
2602 AGTAGAT * SA * SG * ST * SA * SG * RA SRSSSOOOS OMe-DNA-2'-
(rs362331) GAGGGA * ST * SG * SmAmGmGmG * OMe) 1-3-11-3-1 (C/T) SmA
(PS/PO) Gapmer WV- GUGCACA 1115 mG * SmUmGmCmA * SC * 1467
SOOOSSSSSS P12 5-10-5 (2'- HTT 2603 CAGTAGA SA * SC * SA * SG * ST
* SA * SSRSSOOOS OMe-DNA-2'- (rs362331) TGAGGG SG * RA * ST *
SmGmAmGmG OMe) 1-3-11-3-1 (C/T) * SmG (PS/PO) Gapmer WV- AGUGCAC
1116 mA * SmGmUmGmC * SA * 1468 SOOOSSSSSS P13 5-10-5 (2'- HTT 2604
ACAGTAG SC * SA * SC * SA * SG * ST * SSSRSOOOS OMe-DNA-2'-
(rs362331) AUGAGG SA * SG * RA * OMe) 1-3-11-3-1 (C/T) SmUmGmAmG *
SmG (PS/PO) Gapmer WV- UCCCCAC 1117 mU * mCmCmCmC * A * C * A 1469
XOOOXXXXX P6 5-10-5 (2'- HTT 2605 AGAGGGA * G * A * G * G * G * A *
G * XXXXXXOOO OMe-DNA-2'- r2530595 GGAAGC mGmAmAmG * mC X OMe)
1-3-11-3-1 (C/T) (P/PO) Gapmer WV- CUCCCCA 1118 mC * mUmCmCmC * C *
A * C 1470 XOOOXXXXX P7 5-10-5 (2'- HTT 2606 CAGAGGG * A * G * A *
G * G * G * A * XXXXXXOOO OMe-DNA-2'- r2530595 AGGAAG mGmGmAmA * mG
X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV- CCUCCCC 1119 mC *
mCmUmCmC * C * C * A 1471 XOOOXXXXX P8 5-10-5 (2'- HTT 2607 ACAGAGG
* C * A * G * A * G * G * G * XXXXXXOOO OMe-DNA-2'- r2530595 GAGGAA
mAmGmGmA * mA X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV- UCCUCCC
1120 mU * mCmCmUmC * C * C * C 1472 XOOOXXXXX P9 5-10-5 (2'- HTT
2608 CACAGAG * A * C * A * G * A * G * G * XXXXXXOOO OMe-DNA-2'-
r2530595 GGAGGA mGmAmGmG * mA X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer
WV- GUCCUCC 1121 mG * mUmCmCmU * C * C * C 1473 XOOOXXXXX P10
5-10-5 (2'- HTT 2609 CCACAGA * C * A * C * A * G * A * G *
XXXXXXOOO OMe-DNA-2'- r2530595 GGGAGG mGmGmAmG * mG X OMe)
1-3-11-3-1 (C/T) (P/PO) Gapmer WV- GGUCCTC 1122 mG * mGmUmCmC * T *
C * C 1474 XOOOXXXXX P11 5-10-5 (2'- HTT 2610 CCCACAG * C * C * A *
C * A * G * A * XXXXXXOOO OMe-DNA-2'- r2530595 AGGGAG mGmGmGmA * mG
X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV- GGGUCCT 1123 mG *
mGmGmUmC * C * T * C 1475 XOOOXXXXX P12 5-10-5 (2'- HTT 2611
CCCCACA * C * C * C * A * C * A * G * XXXXXXOOO OMe-DNA-2'-
r2530595 GAGGGA mAmGmGmG * mA X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer
WV- CGGGUCC 1124 mC * mGmGmGmU * C * C * T 1476 XOOOXXXXX P13
5-10-5 (2'- HTT 2612 TCCCCAC * C * C * C * C * A * C * A *
XXXXXXOOO OMe-DNA-2'- r2530595 AGAGGG mGmAmGmG * mG X OMe)
1-3-11-3-1 (C/T) (P/PO) Gapmer WV- ACAGUAG 1125 mA * mCmAmGmU * A *
G * 1477 XOOOXXXXX P6 5-10-5 (2'- HTT 2613 ATGAGGG A * T * G * A *
G * G * G * A * XXXXXXOOO OMe-DNA-2'- (r362331) AGCAGG mGmCmAmG *
mG X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV- CACAGTA 1126 mC *
mAmCmAmG * T * A * G 1478 XOOOXXXXX P7 5-10-5 (2'- HTT 2614 GATGAGG
* A * T * G * A * G * G * G * XXXXXXOOO OMe-DNA-2'- (r362331)
GAGCAG mAmGmCmA * mG X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV-
ACACAGT 1127 mA * mCmAmCmA * G * T * A 1479 XOOOXXXXX P8 5-10-5
(2'- HTT 2615 AGATGAG * G * A * T * G * A * G * G * XXXXXXOOO
OMe-DNA-2'- (r362331) GGAGCA mGmAmGmC * mA X OMe) 1-3-11-3-1 (C/T)
(P/PO) Gapmer WV- CACACAG 1128 mC * mAmCmAmC * A * G * T 1480
XOOOXXXXX P9 5-10-5 (2'- HTT 2616 TAGATGA * A * G * A * T * G * A *
G * XXXXXXOOO OMe-DNA-2'- (r362331) GGGAGC mGmGmAmG * mC X OMe)
1-3-11-3-1 (C/T) (P/PO) Gapmer WV- GCACACA 1129 mG * mCmAmCmA * C *
A * 1481 XOOOXXXXX P10 5-10-5 (2'- HTT 2617 GTAGATG G * T * A * G *
A * T * G * A * XXXXXXOOO OMe-DNA-2'- (r362331) AGGGAG mGmGmGmA *
mG X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV- UGCACAC 1130 mU *
mGmCmAmC * A * C * 1482 XOOOXXXXX P11 5-10-5 (2'- HTT 2618 AGTAGAT
A * G * T * A * G * A * T * G * XXXXXXOOO OMe-DNA-2'- (r362331)
GAGGGA mAmGmGmG * mA X OMe) 1-3-11-3-1 (C/T) (P/PO) Gapmer WV-
GUGCACA 1131 mG * mUmGmCmA * C * A * 1483 XOOOXXXXX P12 5-10-5 (2'-
HTT 2619 CAGTAGA C * A * G * T * A * G * A * T * XXXXXXOOO
OMe-DNA-2'- (r362331) TGAGGG mGmAmGmG * mG X OMe) 1-3-11-3-1 (C/T)
(P/PO) Gapmer WV- AGUGCAC 1132 mA * mGmUmGmC * A * C * 1484
XOOOXXXXX P13 5-10-5 (2'- HTT 2620 ACAGTAG A * C * A * G * T * A *
G * A * XXXXXXOOO OMe-DNA-2'- (r362331) AUGAGG mUmGmAmG * mG X OMe)
1-3-11-3-1 (C/T) (P/PO) Gapmer WV- GGCACAA 1133
GGCACAAGGGCACAGACTTC 1485 OOOOOOOOO DNA version of HTT 2623 GGGCACA
OOOOOOOOO WV-1092 rs362307 GACTTC O (C/T) WV- GGCACAA 1134 mG *
SmGmCmAmC * SA * 1486 SOOOSSSSSS WV-1092 analogue rs362307 2659
GGGCACA SA * SG * SG * SG * SC * SA * SSSSSOOOS with All Sp Human
GACUUC SC * SA * SG * SmAmCmUmU stereochemistry HTT * SmC WV-
GGGUCCT 1135 mG * SmG * SmGmUmC * SC 1487 SSOOSSSSSSS P12 5-10-5
(2'- HTT 2671 CCCCACA * ST * SC * SC * SC * SC * SA SRSSOOSS
OMe-DNA-2'- rs2530595 GAGGGA * SC * RA * SG * SmAmGmG * OMe)
2-2-11-2-2 (C/T) SmG * SmA (PS/PO) Gapmer with Sp wings WV- GGGUCCT
1136 mG * RmG * RmGmUmC * SC 1488 RROOSSSSSS P12 5-10-5 (2'- HTT
2672 CCCCACA * ST * SC * SC * SC * SC * SA SSRSSOORR OMe-DNA-2'-
rs2530595 GAGGGA * SC * RA * SG * SmAmGmG * OMe) 4-11-4 (C/T) RmG *
RmA (PS/PO) Gapmer with Rp wings WV- GGGUCCT 1137 mG * SmG * SmG *
SmU * 1489 SSSSSSSSSSS P12 5-10-5 (2'- HTT 2673 CCCCACA SmC * SC *
ST * SC * SC * SC SRSSSSSS OMe-DNA-2'- rs2530595 GAGGGA * SC * SA *
SC * RA * SG * OMe) 2-2-11-2-2 (C/T) SmA * SmG * SmG * SmG *
(PS/PO) Gapmer SmA with Sp wings WV- GGGUCCT 1138 mG * RmG * RmG *
RmU * 1490 RRRRSSSSSSS P12 5-10-5 (2'- HTT 2674 CCCCACA RmC * SC *
ST * SC * SC * SC SRSSRRRR OMe-DNA-2'- rs2530595 GAGGGA * SC * SA *
SC * RA * SG * OMe) 2-2-11-2-2 (C/T) SmA * RmG * RmG * RmG *
(PS/PO) Gapmer RmA with Rp wings WV- GGGUUCT 1139 mG * SmGmGmUmU *
SC * ST 1491 SOOOSSSSSS P12 analogue of HTT 2675 CCCCACA * SC * SC
* SC * SC * SA * SC SSRSSOOOS WV-2595 with G:U rs2530595 GAGGGA *
RA * SG * SmAmGmGmG * mismatch at (C/T) SmA position 5 WV- GGCACAA
1140 mG * RmGmCmAmC * SA * 1492 ROOOSSSSSS WV-1092 analogue
rs362307 2676 GGGCACA SA * SG * SG * SG * SC * SA * SSSSSOOOS for
CMC Human GACUUC SC * SA * SG * SmAmCmUmU HTT * SmC WV- GGCACAA
1141 mG * SmGmCmAmC * RA * 1493 SOOORSSSSS WV-1092 analogue
rs362307 2682 GGGCACA SA * SG * SG * SG * SC * SA * SSSSSOOOS for
CMC Human GACUUC SC * SA * SG * SmAmCmUmU HTT * SmC WV- GGCACAA
1142 mG * SmGmCmAmC * SA * 1494 SOOOSRSSSS WV-1092 analogue
rs362307 2683 GGGCACA RA * SG * SG * SG * SC * SA * SSSSSOOOS for
CMC Human SC * SA * SG * SmAmCmUmU HTT GACUUC * SmC WV- GGCACAA
1143 mG * SmGmCmAmC * SA * 1495 SOOOSSRSSS WV-1092 analogue
rs362307 2684 GGGCACA SA * RG * SG * SG * SC * SA * SSSSSOOOS for
CMC Human GACUUC SC * SA * SG * SmAmCmUmU HTT * SmC WV- GGCACAA
1144 mG * SmGmCmAmC * SA * 1496 SOOOSSSRSS WV-1092 analogue
rs362307 2685 GGGCACA SA * SG * RG * SG * SC * SA * SSSSSOOOS for
CMC Human GACUUC SC * SA * SG * SmAmCmUmU HTT * SmC WV- GGCACAA
1145 mG * SmGmCmAmC * SA * 1497 SOOOSSSSRS WV-1092 analogue
rs362307 2686 GGGCACA SA * SG * SG * RG * SC * SA * SSSSSOOOS for
CMC Human GACUUC SC * SA * SG * SmAmCmUmU HTT * SmC WV- GGCACAA
1146 mG * SmGmCmAmC * SA * 1498 SOOOSSSSSR WV-1092 analogue
rs362307 2687 GGGCACA SA * SG * SG * SG * RC * SA * SSSSSOOOS for
CMC Human GACUUC SC * SA * SG * SmAmCmUmU HTT * SmC WV- GGCACAA
1147 mG * SmGmCmAmC * SA * 1499 SOOOSSSSSS WV-1092 analogue
rs362307 2688 GGGCACA SA * SG * SG * SG * SC * RA * RSSSSOOOS for
CMC Human GACUUC SC * SA * SG * SmAmCmUmU HTT * SmC WV- GGCACAA
1148 mG * SmGmCmAmC * SA * 1500 SOOOSSSSSS WV-1092 analogue
rs362307 2689 GGGCACA SA * SG * SG * SG * SC * SA * SRSSSOOOS for
CMC Human GACUUC RC * SA * SG * SmAmCmUmU HTT * SmC WV- GGCACAA
1149 mG * SmGmCmAmC * SA * 1501 SOOOSSSSSS WV-1092 analogue
rs362307 2690 GGGCACA SA * SG * SG * SG * SC * SA * SSSRSOOOS for
CMC Human GACUUC SC * SA * RG * SmAmCmUmU HTT * SmC WV- GGCACAA
1150 mG * SmGmCmAmC * SA * 1502 SOOOSSSSSS WV-1092 analogue
rs362307 2691 GGGCACA SA * SG * SG * SG * SC * SA * SSSSROOOS for
CMC Human GACUUC SC * SA * SG * RmAmCmUmU HTT * SmC WV- GGCACAA
1151 mG * SmGmCmAmC * SA * 1503 SOOOSSSSSS WV-1092 analogue
rs362307 2692 GGGCACA SA * SG * SG * SG * SC * SA * SSSSSOOOR for
CMC Human GACUUC SC * SA * SG * SmAmCmUmU HTT * RmC
WV- GGCAC mG * SmGmCmAmC SOOO WV-1092 fragment rs362307 2728 for
CMC Human HTT WV- GGCAC mG * RmGmCmAmC ROOO WV-1092 fragment
rs362307 2729 for CMC Human HTT WV- ACUUC mAmCmUmU * SmC OOOS
WV-1092 fragment rs362307 2730 for CMC Human HTT WV- ACUUC mAmCmUmU
* RmC OOOR WV-1092 fragment rs362307 2731 for CMC Human HTT WV-
GGCACAA 1152 mG * SmGmCmAmC * SA * 1504 SOOOSSSSSS WV-1092 for CM
rs362307 2732 GGGCACA SA * SG * SG * SG * SC * RA * RSRSSOOOS Human
GACUUC SC * RA * SG * SmAmCmUmU HTT * SmC Abbreviations: 2\': 2'
3\': 3' 5\': 5' 307: SNP rs362307 C6: C6 amino linker F, f: 2'-F
Htt, HTT: Huntingtin gene or Huntington's Disease Laurie, Myristic,
Palmitic, Stearic, Oleic, Linoleic, alpha-Linoleic, gamma-Linoleic,
DHA, Turbinaric, Dilinoleic: Laurie acid, Myristic acid, Palmitic
acid, Stearic acid, Oleic acid, Linoleic acid, alpha-Linoleic acid,
gamma-Linoleic acid, docosahexaenoic acid, Turbinaric acid,
Dilinoreic acid, respectively. muHtt or muHTT: mutant Huntingtin
gene or gene product OMe: 2'-OMe O, PO: phoshodiester (phosphate)
*, PS: Phosphorothioate R, Rp: Phosphorothioate in Rp conformation
S, Sp: Phosphorothioate in Sp conformation WV: WV- WV-: WV X:
Phosphorothioate, stereorandom
EQUIVALENTS
[2015] Having described some illustrative embodiments of the
disclosure, it should be apparent to those skilled in the art that
the foregoing is merely illustrative and not limiting, having been
presented by way of example only. Numerous modifications and other
illustrative embodiments are within the scope of one of ordinary
skill in the art and are contemplated as falling within the scope
of the disclosure. In particular, although many of the examples
presented herein involve specific combinations of method acts or
system elements, it should be understood that those acts and those
elements may be combined in other ways to accomplish the same
objectives. Acts, elements, and features discussed only in
connection with one embodiment are not intended to be excluded from
a similar role in other embodiments. Further, for the one or more
means-plus-function limitations recited in the following claims,
the means are not intended to be limited to the means disclosed
herein for performing the recited function, but are intended to
cover in scope any means, known now or later developed, for
performing the recited function.
[2016] Use of ordinal terms such as "first", "second", "third",
etc., in the claims to modify a claim element does not by itself
connote any priority, precedence, or order of one claim element
over another or the temporal order in which acts of a method are
performed, but are used merely as labels to distinguish one claim
element having a certain name from another element having a same
name (but for use of the ordinal term) to distinguish the claim
elements. Similarly, use of a), b), etc., or i), ii), etc. does not
by itself connote any priority, precedence, or order of steps in
the claims. Similarly, the use of these terms in the specification
does not by itself connote any required priority, precedence, or
order.
[2017] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
disclosure. The present disclosure is not to be limited in scope by
examples provided, since the examples are intended as a single
illustration of one aspect of the disclosure and other functionally
equivalent embodiments are within the scope of the disclosure.
Various modifications of the disclosure in addition to those shown
and described herein will become apparent to those skilled in the
art from the foregoing description and fall within the scope of the
appended claims. The advantages and objects of the disclosure are
not necessarily encompassed by each embodiment of the disclosure.
Sequence CWU 1
1
15651105DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotidemisc_feature(1)..(105)This sequence may
encompass 10-35 "cag" repeating units, wherein some positions may
be absent 1cagcagcagc agcagcagca gcagcagcag cagcagcagc agcagcagca
gcagcagcag 60cagcagcagc agcagcagca gcagcagcag cagcagcagc agcag
105220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 2gcctcagtct gcttcgcacc 20320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 3gcctcagtct gcttcgcacc 20413DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 4aatcgatcga tcg 13520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 5gcctcagtct gcttcgcacc 20620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 6gcctcagtct gcttcgcacc 20720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 7gcctcagtct gcttcgcacc 20820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 8gcctcagtct gcttcgcacc 20913RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 9gugagcagcu gca 131020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 10gggucctccc cacagaggga 201120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 11gggucctccc cacagaggga 201220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 12gugcacacag tagatgaggg 201320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 13gugcacacag tagatgaggg 201420RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 14ggcacaaggg cacagacuuc 201520RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 15ggcacaaggg cacagacuuc 201610DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 16gggacgtctt 101720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 17ggcacaaggg cacagacttc 201825RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 18uuuggaaguc ugugcccuug ugccc 251920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 19gcctcagtct gcttcgcacc 202020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 20gagcagctgc aacctggcaa 202120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 21gggcacaagg gcacagactt 202220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 22gcacaagggc acagacttcc 202320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 23cacaagggca cagacttcca 202420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 24acaagggcac agacttccaa 202520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 25caagggcaca gacttccaaa 202620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 26agcagctgca acctggcaac 202720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 27gcagctgcaa cctggcaaca 202820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 28cagctgcaac ctggcaacaa 202920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 29agctgcaacc tggcaacaac 203020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 30gctgcaacct ggcaacaacc 203120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 31gggccaacag ccagcctgca 203220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 32ggccaacagc cagcctgcag 203320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 33gccaacagcc agcctgcagg 203420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 34ccaacagcca gcctgcagga 203520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 35caacagccag cctgcaggag 203620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 36aacagccagc ctgcaggagg 203720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 37attaataaat tgtcatcacc 203816DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 38ttcagtcatg acttcc 163916DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 39ttcagtcatg acttcc 164020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 40gcctcagtct gcttcgcacc 204120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 41ggcacaaggg cacagacttc 204220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotidemodified_base(4)..(4)t or umodified_base(8)..(8)t or
umodified_base(10)..(10)t or umodified_base(13)..(14)t or u
42gccncagncn gcnncgcacc 204320DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotideDescription of
Combined DNA/RNA Molecule Synthetic oligonucleotide 43gccucagtct
gcttcgcacc 204420DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 44gcctcagtct gcttcgcacc
204520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 45gcctcagtct gcttcgcacc
204620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 46gcctcagtct gcttcgcacc
204720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 47gcctcagtct gcttcgcacc
204820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 48gcctcagtct gcttcgcacc
204920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 49gcctcagtct gcttcgcacc
205020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 50gcctcagtct gcttcgcacc
205120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 51gcctcagtct gcttcgcacc
205220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 52gcctcagtct gcttcgcacc
205320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 53gcctcagtct gcttcgcacc
205420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 54gcctcagtct gcttcgcacc
205520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 55gcctcagtct gcttcgcacc
205620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 56gcctcagtct gcttcgcacc
205720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 57gcctcagtct gcttcgcacc
205820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 58gcctcagtct gcttcgcacc
205920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 59gcctcagtct gcttcgcacc
206020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 60gcctcagtct gcttcgcacc
206120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 61gcctcagtct gcttcgcacc
206220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 62gcctcagtct gcttcgcacc
206320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 63gcctcagtct gcttcgcacc
206420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 64gcctcagtct gcttcgcacc
206520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 65gcctcagtct gcttcgcacc
206620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 66gcctcagtct gcttcgcacc
206712DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 67cagtctgctt cg 126812DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 68cagtctgctt cg 126912DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 69cagtctgctt cg 127012DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 70cagtctgctt cg 127112DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 71cagtctgctt cg 127212DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 72cagtctgctt cg 127312DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 73cagtctgctt cg 127412DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 74cagtctgctt cg 127512DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 75cagtctgctt cg 127612DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 76cagtctgctt cg 127715DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 77ctcagtctgc ttcgc 157812DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 78cagtctgctt cg 127912DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 79cagtctgctt cg 128020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 80gcctcagtct gcttcgcacc 208120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 81gcctcagtct gcttcgcacc 208220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 82gcctcagtct gcttcgcacc 208320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 83gcctcagtct gcttcgcacc 208420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 84gcctcagtct gcttcgcacc 208520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 85gcctcagtct gcttcgcacc 208620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 86gcctcagtct gcttcgcacc 208720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 87gcctcagtct gcttcgcacc 208820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 88gcctcagtct gcttcgcacc 208920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 89gcctcagtct gcttcgcacc 209020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 90gcctcagtct gcttcgcacc 209120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 91gcctcagtct gcttcgcacc 209220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 92gcctcagtct gcttcgcacc 209320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 93gcctcagtct gcttcgcacc 209420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 94gcctcagtct gcttcgcacc 209520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 95gcctcagtct gcttcgcacc 209620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 96gcctcagtct gcttcgcacc 209720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 97gcctcagtct gcttcgcacc 209820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 98gcctcagtct gcttcgcacc 209920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 99gcctcagtct gcttcgcacc 2010020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 100gcctcagtct gcttcgcacc 2010120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 101gcctcagtct gcttcgcacc 2010220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 102gcctcagtct gcttcgcacc 2010320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 103gcctcagtct
gcttcgcacc 2010420DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 104gcctcagtct gcttcgcacc
2010520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 105gcctcagtct gcttcgcacc
2010620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 106gcctcagtct gcttcgcacc
2010720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 107gcctcagtct gcttcgcacc
2010820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 108gcctcagtct gcttcgcacc
2010920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 109gcctcagucu gcttcgcacc
2011020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 110gcctcagtct gcttcgcacc
2011120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 111gcctcagtct gcttcgcacc
2011220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 112gcctcagtct gcttcgcacc
2011320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 113gcctcagtct gcttcgcacc
2011420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 114gcctcagtct gcttcgcacc
2011520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 115gcctcagtct gcttcgcacc
2011620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 116gcctcagtct gcttcgcacc
2011720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 117gcctcagtct gcttcgcacc
2011820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 118gcctcagtct gcttcgcacc
2011920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 119gcctcagtct gcttcgcacc
2012020RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 120gccucagucu gcuucgcacc
2012120RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 121gccucagucu gcuucgcacc
2012220RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 122gccucagucu gcuucgcacc
2012320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 123gccucagucu gcuucgcacc
2012420RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 124gccucagucu gcuucgcacc
2012520RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 125gccucagucu gcuucgcacc
2012620RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 126gccucagucu gcuucgcacc
2012720RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 127gccucagucu gcuucgcacc
2012820RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 128gccucagucu gcuucgcacc
2012920RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 129gccucagucu gcuucgcacc
2013020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 130gggcacaagg gcacagactt
2013120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 131ggcacaaggg cacagacttc
2013220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 132gcacaagggc acagacttcc
2013320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 133cacaagggca cagacttcca
2013420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 134acaagggcac agacttccaa
2013520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 135caagggcaca gacttccaaa
2013620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 136gggcacaagg gcacagactt
2013720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 137ggcacaaggg cacagacttc
2013820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 138gcacaagggc acagacttcc
2013920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 139cacaagggca cagacttcca
2014020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 140acaagggcac agacttccaa
2014120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 141caagggcaca gacttccaaa
2014220RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 142gggcacaagg gcacagacuu
2014320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 143ggcacaaggg cacagacuuc
2014420RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 144gcacaagggc acagacuucc
2014520RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 145cacaagggca cagacuucca
2014620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 146acaagggcac agactuccaa
2014720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 147caagggcaca gacttccaaa
2014820RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 148gcacaagggc acagacuucc
2014920RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 149cacaagggca cagacuucca
2015020RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 150acaagggcac agacuuccaa
2015120RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 151caagggcaca gacuuccaaa
2015220RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 152gcacaagggc acagacuucc
2015320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 153cacaagggca cagacuucca
2015420RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 154acaagggcac agacuuccaa
2015520RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 155caagggcaca gacuuccaaa
2015620RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 156gggcacaagg gcacagacuu
2015720RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 157ggcacaaggg cacagacuuc
2015820RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 158gcacaagggc acagacuucc
2015920RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 159cacaagggca cagacuucca
2016020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 160acaagggcac agactuccaa
2016120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 161caagggcaca gacttccaaa
2016220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 162gggcacaagg gcacagactt
2016320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 163ggcacaaggg cacagacttc
2016420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 164gcacaagggc acagacttcc
2016520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 165cacaagggca cagacttcca
2016620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 166acaagggcac agacttccaa
2016720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 167caagggcaca gacttccaaa
2016820RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 168ggcacaaggg cacagacuuc
2016920RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 169ggcacaaggg cacagacuuc
2017020RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 170ggcacaaggg cacagacuuc
2017120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 171ggcacaaggg cacagacttc
2017220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 172ggcacaaggg cacagacttc
2017320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 173ggcacaaggg cacagacttc
2017420RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 174ggcacaaggg cacagacuuc
2017520RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 175ggcacaaggg cacagacuuc
2017620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 176gcagggcaca agggcacaga
2017720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 177cagggcacaa gggcacagac
2017820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 178agggcacaag ggcacagact
2017920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 179aagggcacag acttccaaag
2018020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 180agggcacaga cttccaaagg
2018120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 181gggcacagac ttccaaaggc
2018220RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 182ggcacaaggg cacagacuuc
2018320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 183ggcacaaggg cacagacuuc
2018420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 184gggcacaagg gcacagactt
2018520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 185ggcacaaggg cacagacttc
2018620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 186gcacaagggc acagacttcc
2018720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 187gggcacaagg gcacagactt
2018820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 188ggcacaaggg cacagacttc
2018920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 189gcacaagggc acagacttcc
2019020RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 190ggcacaaggg cacagacuuc
2019120RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 191ggcacaaggg cacagacuuc
2019220RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 192ggcacaaggg cacagacuuc
2019320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 193ggcacaaggg cacagacttc
2019420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 194gagcagctgc aacctggcaa
2019520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 195agcagctgca acctggcaac
2019620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 196gcagctgcaa cctggcaaca
2019720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 197cagctgcaac ctggcaacaa
2019820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 198agctgcaacc tggcaacaac
2019920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 199gctgcaacct ggcaacaacc
2020020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 200gagcagctgc aacctggcaa
2020120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 201agcagctgca acctggcaac
2020220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 202gcagctgcaa cctggcaaca
2020320DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotideDescription of
Combined DNA/RNA Molecule Synthetic oligonucleotide 203cagcugcaac
ctggcaacaa 2020420DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotideDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 204agcugcaacc tggcaacaac
2020520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 205gcugcaacct ggcaacaacc
2020620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 206gagcagctgc aacctggcaa
2020720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 207agcagctgca acctggcaac
2020820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 208gcagctgcaa cctggcaaca
2020920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 209cagcugcaac ctggcaacaa
2021020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 210agcugcaacc tggcaacaac
2021120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 211gcugcaacct ggcaacaacc
2021220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 212gagcagctgc aaccuggcaa
2021320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 213gagcagctgc aaccuggcaa
2021420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 214agcagctgca acctggcaac
2021520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 215agcagctgca acctggcaac
2021620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 216gcagctgcaa ccuggcaaca
2021720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 217gcagctgcaa ccuggcaaca
2021820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 218gagcagctgc aacctggcaa
2021920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 219agcagctgca acctggcaac
2022020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 220gcagctgcaa cctggcaaca
2022120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 221cagcugcaac ctggcaacaa
2022220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 222agcugcaacc tggcaacaac
2022320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 223gcugcaacct ggcaacaacc
2022420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 224gagcagctgc aacctggcaa
2022520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 225agcagctgca acctggcaac
2022620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 226gcagctgcaa cctggcaaca
2022720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 227cagctgcaac ctggcaacaa
2022820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 228agctgcaacc tggcaacaac
2022920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 229gctgcaacct ggcaacaacc
2023020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 230gggccaacag ccagcctgca
2023120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 231ggccaacagc cagcctgcag
2023220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 232gccaacagcc agcctgcagg
2023320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 233ccaacagcca gcctgcagga
2023420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 234caacagccag cctgcaggag
2023520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 235aacagccagc ctgcaggagg
2023620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 236gggccaacag ccagcctgca
2023720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 237ggccaacagc cagcctgcag
2023820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 238gccaacagcc agcctgcagg
2023920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 239ccaacagcca gcctgcagga
2024020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 240caacagccag cctgcaggag
2024120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 241aacagccagc ctgcaggagg
2024220RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 242gggccaacag ccagccugca
2024320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 243ggccaacagc cagccugcag
2024420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 244gccaacagcc agcctgcagg
2024520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 245ccaacagcca gcctgcagga
2024620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 246caacagccag cctgcaggag
2024720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 247aacagccagc ctgcaggagg
2024820RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 248gggccaacag ccagccugca
2024920RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 249gggccaacag ccagccugca
2025020RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 250ggccaacagc cagccugcag
2025120RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 251ggccaacagc cagccugcag
2025220RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 252gccaacagcc agccugcagg
2025320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 253gccaacagcc agccugcagg
2025420RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 254gggccaacag ccagccugca
2025520RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 255ggccaacagc cagccugcag
2025620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 256gccaacagcc agcctgcagg
2025720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 257ccaacagcca gcctgcagga
2025820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 258caacagccag cctgcaggag
2025920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 259aacagccagc ctgcaggagg
2026020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 260gggccaacag ccagcctgca
2026120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 261ggccaacagc cagcctgcag
2026220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 262gccaacagcc agcctgcagg
2026320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 263ccaacagcca gcctgcagga
2026420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 264caacagccag cctgcaggag
2026520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 265aacagccagc ctgcaggagg
2026620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 266attaataaat tgtcatcacc
2026720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 267attaataaat tgtcatcacc
2026820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 268attaataaat tgtcatcacc
2026920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 269auuaauaaat tgtcatcacc
2027020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 270auuaauaaat tgtcatcacc
2027120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 271auuaauaaat tgtcatcacc
2027220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 272auuaauaaat tgtcatcacc
2027320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 273auuaauaaat tgtcatcacc
2027420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 274auuaauaaat tgtcatcacc
2027520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 275auuaauaaat tgtcatcacc
2027620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 276auuaauaaat tgtcatcacc
2027720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 277auuaauaaat tgtcatcacc
2027820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 278auuaauaaat tgtcatcacc
2027920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 279tgtcatcacc agaaaaaguc
2028020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 280utgtcatcac cagaaaaagu
2028120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 281ttgtcatcac cagaaaaagu
2028220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 282autgtcatca ccagaaaaag
2028320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 283attgtcatca ccagaaaaag
2028420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 284aautgtcatc accagaaaaa
2028520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 285aattgtcatc accagaaaaa
2028620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 286aaattgtcat caccagaaaa
2028720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 287aaautgtcat caccagaaaa
2028820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 288uaaautgtca tcaccagaaa
2028920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 289uaaautgtca tcaccagaaa
2029020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 290auaaattgtc atcaccagaa
2029120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic
oligonucleotide 291auaaattgtc atcaccagaa 2029220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 292aauaaattgt catcaccaga 2029320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 293aauaaattgt catcaccaga 2029420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 294aauaaattgt catcaccaga 2029520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 295uaauaaattg tcatcaccag 2029620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 296uaauaaattg tcatcaccag 2029720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 297uaauaaattg tcatcaccag 2029820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 298uaauaaattg tcatcaccag 2029920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 299uuaauaaatt gtcatcacca 2030020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 300uuaauaaatt gtcatcacca 2030120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 301uuaauaaatt gtcatcacca 2030220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 302uuaauaaatt gtcatcacca 2030320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 303auuaataaat tgtcatcacc 2030420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 304auuaataaat tgtcatcacc 2030520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 305auuaataaat tgtcatcacc 2030620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 306auuaataaat tgtcatcacc 2030720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 307uauuaataaa ttgtcatcac 2030820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 308uauuaataaa ttgtcatcac 2030920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 309uauuaataaa ttgtcatcac 2031020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 310cuauuaataa attgtcatca 2031120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 311cuauuaataa attgtcatca 2031220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 312acuautaata aattgtcatc 2031320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 313tgtcatcacc agaaaaaguc 2031420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 314utgtcatcac cagaaaaagu 2031520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 315ttgtcatcac cagaaaaagu 2031620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 316autgtcatca ccagaaaaag 2031720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 317attgtcatca ccagaaaaag 2031820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 318aautgtcatc accagaaaaa 2031920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 319aattgtcatc accagaaaaa 2032020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 320aaattgtcat caccagaaaa 2032120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 321aaautgtcat caccagaaaa 2032220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 322uaaautgtca tcaccagaaa 2032320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 323uaaautgtca tcaccagaaa 2032420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 324auaaattgtc atcaccagaa 2032520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 325auaaattgtc atcaccagaa 2032620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 326aauaaattgt catcaccaga 2032720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 327aauaaattgt catcaccaga 2032820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 328aauaaattgt catcaccaga 2032920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 329uaauaaattg tcatcaccag 2033020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 330uaauaaattg tcatcaccag 2033120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 331uaauaaattg tcatcaccag 2033220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 332uaauaaattg tcatcaccag 2033320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 333uuaauaaatt gtcatcacca 2033420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 334uuaauaaatt gtcatcacca 2033520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 335uuaauaaatt gtcatcacca 2033620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 336uuaauaaatt gtcatcacca 2033720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 337auuaataaat tgtcatcacc 2033820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 338auuaataaat tgtcatcacc 2033920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 339auuaataaat tgtcatcacc 2034020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 340auuaataaat tgtcatcacc 2034120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 341uauuaataaa ttgtcatcac 2034220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 342uauuaataaa ttgtcatcac 2034320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 343uauuaataaa ttgtcatcac 2034420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 344cuauuaataa attgtcatca 2034520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 345cuauuaataa attgtcatca 2034620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 346acuautaata aattgtcatc 2034720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 347gggcacaagg gcacagactt 2034820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 348ggcacaaggg cacagacttc 2034920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 349gcacaagggc acagacttcc 2035020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 350cacaagggca cagacttcca 2035120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 351acaagggcac agacttccaa 2035220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 352caagggcaca gacttccaaa 2035320RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 353ggcacaaggg cacagacuuc 2035420RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 354ggcacaaggg cacagacuuc 2035520RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 355ggcacaaggg cacagacuuc 2035620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 356ggcacaaggg cacagacttc 2035720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 357ggcacaaggg cacagacttc 2035820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 358ggcacaaggg cacagacttc 2035920RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 359ggcacaaggg cacagacuuc 2036020RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 360ggcacaaggg cacagacuuc 2036120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 361gcagggcaca agggcacaga 2036220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 362cagggcacaa gggcacagac 2036320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 363agggcacaag ggcacagact 2036420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 364aagggcacag acttccaaag 2036520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 365agggcacaga cttccaaagg 2036620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 366gggcacagac ttccaaaggc 2036720RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 367ggcacaaggg cacagacuuc 2036820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 368gagcagctgc aacctggcaa 2036920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 369agcagctgca acctggcaac 2037020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 370gcagctgcaa cctggcaaca 2037120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 371cagctgcaac ctggcaacaa 2037220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 372agctgcaacc tggcaacaac 2037320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 373gctgcaacct ggcaacaacc 2037420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 374gggccaacag ccagcctgca 2037520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 375ggccaacagc cagcctgcag 2037620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 376gccaacagcc agcctgcagg 2037720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 377ccaacagcca gcctgcagga 2037820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 378caacagccag cctgcaggag 2037920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 379aacagccagc ctgcaggagg 2038020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 380attaataaat tgtcatcacc 2038120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 381attaataaat tgtcatcacc 2038220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 382attaataaat tgtcatcacc 2038320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 383auuaauaaat tgtcatcacc 2038420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 384auuaauaaat tgtcatcacc 2038520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 385auuaauaaat tgtcatcacc 2038620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 386auuaauaaat tgtcatcacc 2038720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 387auuaauaaat tgtcatcacc 2038820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 388auuaauaaat tgtcatcacc 2038920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 389auuaauaaat tgtcatcacc 2039020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 390auuaauaaat tgtcatcacc 2039120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 391auuaauaaat tgtcatcacc 2039227DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 392gcgtttgctc ttcttcttgc gtttttt
2739320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 393gcctcagtct gcttcgcacc
2039420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 394gcctcagtct gcttcgcacc
2039520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 395gcctcagtct gcttcgcacc
2039627DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 396gcgtttgctc ttcttcttgc gtttttt
2739720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 397gcctcagtct gcttcgcacc
2039820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 398gcctcagtct gcttcgcacc
2039920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 399gcctcagtct gcttcgcacc
2040020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 400gcctcagtct gcttcgcacc
2040120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 401gcctcagtct gcttcgcacc
2040220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 402gcctcagtct gcttcgcacc
2040320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 403gcctcagtct gcttcgcacc
2040420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 404gcctcagtct gcttcgcacc
2040527DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 405gcgtttgctc ttcttcttgc gtttttt
2740620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 406gtccctgaag atgtcaatgc
2040720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 407gtccctgaag atgtcaatgc
2040820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 408gtccctgaag atgtcaatgc
2040920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 409gtccctgaag atgtcaatgc
2041020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 410gtccctgaag atgtcaatgc
2041121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 411uucuagaccu guuuugcuut t
2141221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 412uucuagaccu guuuugcuut t
2141321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 413uucuagaccu guuuugcuut t
2141421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 414uucuagaccu guuuugcuut t
2141521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 415uucuagaccu guuuugcuut t
2141621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 416uucuagaccu guuuugcuut t
2141721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 417uucuagaccu guuuugcuut t
2141821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 418uucuagaccu guuuugcuut t
2141921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 419uucuagaccu guuuugcuut t
2142021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 420uucuagaccu guuuugcuut t
2142121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 421uucuagaccu guuuugcuut t
2142221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 422uucuagaccu guuuugcuut t
2142321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 423uucuagaccu guuuugcuut t
2142421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 424uucuagaccu guuuugcuut t
2142521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 425uucuagaccu guuuugcuut t
2142621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 426uucuagaccu guuuugcuut t
2142721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 427uucuagaccu guuuugcuut t
2142821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 428uucuagaccu guuuugcuut t
2142921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 429uucuagaccu guuuugcuut t
2143021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 430uucuagaccu guuuugcuut t
2143121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 431uucuagaccu guuuugcuut t
2143221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 432uucuagaccu guuuugcuut t
2143321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 433uucuagaccu guuuugcuut t
2143421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 434uucuagaccu guuuugcuut t
2143521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 435uucuagaccu guuuugcuut t
2143621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 436uucuagaccu guuuugcuut t
2143721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 437uucuagaccu guuuugcuut t
2143821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 438uucuagaccu guuuugcuut t
2143921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 439uucuagaccu guuuugcuut t
2144021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 440uucuagaccu guuuugcuut t
2144121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 441uucuagaccu guuuugcuut t
2144221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 442uucuagaccu guuuugcuut t
2144321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 443uucuagaccu guuuugcuut t
2144421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 444uucuagaccu guuuugcuut t
2144521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 445uucuagaccu guuuugcuut t
2144621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 446uucuagaccu guuuugcuut t
2144721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 447uucuagaccu guuuugcuut t
2144821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 448uucuagaccu guuuugcuut t
2144921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 449uucuagaccu guuuugcuut t
2145021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 450uucuagaccu guuuugcuut t
2145121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 451aagcaaaaca ggucuagaat t
2145221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 452aagcaaaaca ggucuagaat t 2145321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 453aagcaaaaca ggucuagaat t 2145421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 454aagcaaaaca ggucuagaat t 2145521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 455aagcaaaaca ggucuagaat t 2145621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 456aagcaaaaca ggucuagaat t 2145721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 457aagcaaaaca ggucuagaat t 2145821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 458aagcaaaaca ggucuagaat t 2145921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 459aagcaaaaca ggucuagaat t 2146021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 460aagcaaaaca ggucuagaat t 2146121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 461aagcaaaaca ggucuagaat t 2146221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 462aagcaaaaca ggucuagaat t 2146321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 463aagcaaaaca ggucuagaat t 2146421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 464aagcaaaaca ggucuagaat t 2146521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 465aagcaaaaca ggucuagaat t 2146621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 466aagcaaaaca ggucuagaat t 2146721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 467aagcaaaaca ggucuagaat t 2146821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 468aagcaaaaca ggucuagaat t 2146921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 469aagcaaaaca ggucuagaat t 2147021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 470aagcaaaaca ggucuagaat t 2147121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 471aagcaaaaca ggucuagaat t 2147221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 472aagcaaaaca ggucuagaat t 2147321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 473aagcaaaaca ggucuagaat t 2147421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 474aagcaaaaca ggucuagaat t 2147521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 475aagcaaaaca ggucuagaat t 2147621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 476aagcaaaaca ggucuagaat t 2147721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 477aagcaaaaca ggucuagaat t 2147821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 478aagcaaaaca ggucuagaat t 2147921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 479aagcaaaaca ggucuagaat t 2148021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 480aagcaaaaca ggucuagaat t 2148121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 481aagcaaaaca ggucuagaat t 2148221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 482aagcaaaaca ggucuagaat t 2148321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 483aagcaaaaca ggucuagaat t 2148421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 484aagcaaaaca ggucuagaat t 2148521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 485aagcaaaaca ggucuagaat t 2148621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 486aagcaaaaca ggucuagaat t 2148721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 487aagcaaaaca ggucuagaat t 2148821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 488aagcaaaaca ggucuagaat t 2148921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 489aagcaaaaca ggucuagaat t 2149021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 490aagcaaaaca ggucuagaat t 2149121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 491aagcaaaaca ggucuagaat t 2149221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 492aagcaaaaca ggucuagaat t 2149321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 493aagcaaaaca ggucuagaat t 2149421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 494aagcaaaaca ggucuagaat t 2149521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 495aagcaaaaca ggucuagaat t 2149621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 496aagcaaaaca ggucuagaat t 2149721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 497aagcaaaaca ggucuagaat t 2149821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 498aagcaaaaca ggucuagaat t 2149921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 499aagcaaaaca ggucuagaat t 2150021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 500aagcaaaaca ggucuagaat t 2150121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 501aagcaaaaca ggucuagaat t 2150221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 502aagcaaaaca ggucuagaat t 2150321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 503aagcaaaaca ggucuagaat t 2150421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 504aagcaaaaca ggucuagaat t 2150521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 505aagcaaaaca ggucuagaat t 2150621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 506aagcaaaaca ggucuagaat t 2150721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 507aagcaaaaca ggucuagaat t 2150821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 508aagcaaaaca ggucuagaat t 2150921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 509aagcaaaaca ggucuagaat t 2151021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 510aagcaaaaca ggucuagaat t 2151121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 511aagcaaaaca ggucuagaat t 2151221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 512aagcaaaaca ggucuagaat t 2151321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 513aagcaaaaca ggucuagaat t 2151421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 514aagcaaaaca ggucuagaat t 2151521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 515aagcaaaaca ggucuagaat t 2151621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 516aagcaaaaca ggucuagaat t 2151721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 517aagcaaaaca ggucuagaat t 2151821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 518aagcaaaaca ggucuagaat t 2151921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 519aagcaaaaca ggucuagaat t 2152021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 520aagcaaaaca ggucuagaat t 2152121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 521aagcaaaaca ggucuagaat t 2152221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 522aagcaaaaca ggucuagaat t 2152321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 523aagcaaaaca ggucuagaat t
2152421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 524aagcaaaaca ggucuagaat t
2152521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 525aagcaaaaca ggucuagaat t
2152621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 526aagcaaaaca ggucuagaat t
2152721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 527aagcaaaaca ggucuagaat t
2152821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 528aagcaaaaca ggucuagaat t
2152921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 529aagcaaaaca ggucuagaat t
2153021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 530aagcaaaaca ggucuagaat t
2153120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 531ccctctggat tgagcatcca
2053220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 532aagctttggt tgggcaacac
2053320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 533agtcacttgg gagcttctcc
2053420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 534cacttgggag cttctcctgg
2053520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 535atagccattg cagctgctca
2053620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 536tggattgagc atccaccaag
2053720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 537ccatagccat tgcagctgct
2053820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 538gtcacttggg agcttctcct
2053920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 539ccagggcact catctgcatg
2054020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 540gccatccaag tcacttggga
2054120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 541gaagctttgg ttgggcaaca
2054220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 542ctggattgag catccaccaa
2054320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 543caagtcactt gggagcttct
2054420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 544atgccatcca agtcacttgg
2054520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 545atgagatgcc tggctgccat
2054620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 546ttgggagctt ctcctggtgg
2054720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 547tgggagcttc tcctggtgga
2054820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 548ttatgagatg cctggctgcc
2054920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 549gttatgagat gcctggctgc
2055020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 550ccaagtcact tgggagcttc
2055120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 551agctttggtt gggcaacaca
2055220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 552tatgagatgc ctggctgcca
2055320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 553tgttatgaga tgcctggctg
2055420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 554atccaagtca cttgggagct
2055520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 555gggaagcttt ggttgggcaa
2055620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 556ctccatccat gaggtcattc
2055720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 557aagtcacttg ggagcttctc
2055820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 558ccatccaagt cacttgggag
2055920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 559tccaagtcac ttgggagctt
2056020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 560cctctggatt gagcatccac
2056120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 561acttgggagc ttctcctggt
2056220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 562cttgggagct tctcctggtg
2056320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 563catgccatcc aagtcacttg
2056420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 564tgccatccaa gtcacttggg
2056520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 565tccatccatg aggtcattcc
2056620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 566agggcactca tctgcatggg
2056720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 567ccagttcctt cattctgcac
2056820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 568catagccatt gcagctgctc
2056920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 569tctggattga gcatccacca
2057020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 570ggattgagca tccaccaaga
2057120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 571ccctctggat tgagcatcca
2057220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 572aagctttggt tgggcaacac
2057320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 573agtcacttgg gagcttctcc
2057420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 574cacttgggag cttctcctgg
2057520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 575atagccattg cagctgctca
2057620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 576tggattgagc atccaccaag
2057720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 577ccatagccat tgcagctgct
2057820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 578gtcacttggg agcttctcct
2057920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 579ccagggcact catctgcatg
2058020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 580gccatccaag tcacttggga
2058120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 581gaagctttgg ttgggcaaca
2058220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 582ctggattgag catccaccaa
2058320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 583caagtcactt gggagcttct
2058420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 584atgccatcca agtcacttgg
2058520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 585atgagatgcc tggctgccat
2058620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 586ttgggagctt ctcctggtgg
2058720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 587tgggagcttc tcctggtgga
2058820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 588ttatgagatg cctggctgcc
2058920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 589gttatgagat gcctggctgc
2059020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 590ccaagtcact tgggagcttc
2059120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 591agctttggtt gggcaacaca
2059220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 592tatgagatgc ctggctgcca
2059320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 593tgttatgaga tgcctggctg
2059420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 594atccaagtca cttgggagct
2059520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 595gggaagcttt ggttgggcaa
2059620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 596ctccatccat gaggtcattc
2059720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 597aagtcacttg ggagcttctc
2059820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 598ccatccaagt cacttgggag
2059920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 599tccaagtcac ttgggagctt
2060020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 600cctctggatt gagcatccac
2060120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 601acttgggagc ttctcctggt
2060220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 602cttgggagct tctcctggtg
2060320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 603catgccatcc aagtcacttg
2060420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 604tgccatccaa gtcacttggg
2060520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 605tccatccatg aggtcattcc
2060620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 606agggcactca tctgcatggg
2060720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 607ccagttcctt cattctgcac
2060820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 608catagccatt gcagctgctc
2060920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 609tctggattga gcatccacca
2061020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 610ggattgagca tccaccaaga
2061120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 611gaagctttgg ttgggcaaca
2061220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 612ccatccaagt cacttgggag
2061320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 613atgagatgcc tggctgccat
2061420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 614aagctttggt tgggcaacac
2061520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 615atagccattg cagctgctca
2061620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 616tatgagatgc ctggctgcca
2061720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 617ttatgagatg cctggctgcc
2061820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 618ccatccaagt cacttgggag
2061920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 619ccatccaagt cacttgggag
2062020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 620gaagctttgg ttgggcaaca
2062120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic
oligonucleotide 621ccatccaagt cacttgggag 2062220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 622ccatccaagt cacttgggag 2062320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 623gaagctttgg ttgggcaaca 2062420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 624atgagatgcc tggctgccat 2062520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 625atgagatgcc tggctgccat 2062620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 626atgagatgcc tggctgccat 2062720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 627atgagatgcc tggctgccat 2062820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 628gaagctttgg ttgggcaaca 2062920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 629ccatccaagt cacttgggag 2063020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 630atgagatgcc tggctgccat 2063120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 631ccatccaagt cacttgggag 2063220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 632atgagatgcc tggctgccat 2063320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 633ccatccaagt cacttgggag 2063420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 634atgagatgcc tggctgccat 2063520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 635ccatccaagt cacttgggag 2063620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 636atgagatgcc tggctgccat 2063720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 637ccatccaagt cacttgggag 2063820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 638atgagatgcc tggctgccat 2063920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 639ccatccaagt cacttgggag 2064020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 640atgagatgcc tggctgccat 2064120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 641gaagctttgg ttgggcaaca 2064220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 642atgagatgcc tggctgccat 2064320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 643ccatccaagt cacttgggag 2064420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 644atgagatgcc tggctgccat 2064520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 645gaagctttgg ttgggcaaca 2064620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 646atgagatgcc tggctgccat 2064720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 647ccatccaagt cacttgggag 2064820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 648ccatccaagt cacttgggag 2064920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 649atgagatgcc tggctgccat 2065020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 650ccatccaagt cacttgggag 2065120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 651ccatccaagt cacttgggag 2065220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 652ccatccaagt cacttgggag 2065320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 653ccatccaagt cacttgggag 2065420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 654ccatccaagt cacttgggag 2065520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 655ccatccaagt cacttgggag 2065620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 656ccatccaagt cacttgggag 2065720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 657ccatccaagt cacttgggag 2065820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 658ccatccaagt cacttgggag 2065920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 659ccatccaagt cacttgggag 2066020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 660tgagatgcct ggctgccata 2066120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 661tgagatgcct ggctgccata 2066220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 662tgagatgcct ggctgccata 2066320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 663tgagatgcct ggctgccata 2066420RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 664uauggcagcc aggcaucuca 2066520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 665tagccattgc agctgctcac 2066620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 666tagccattgc agctgctcac 2066720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 667tagccattgc agctgctcac 2066820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 668tagccattgc agctgctcac 2066920RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 669gugagcagcu gcaauggcua 2067020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 670tagccattgc agctgctcac 2067120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 671tagccattgc agctgctcac 2067220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 672tagccattgc agctgctcac 2067320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 673tagccattgc agctgctcac 2067420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 674tagccattgc agctgctcac 2067520RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 675gugagcagcu gcaauggcua 2067620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 676tccagttcct tcattctgca 2067720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 677tccagttcct tcattctgca 2067820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 678tccagttcct tcattctgca 2067920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 679tccagttcct tcattctgca 2068020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 680tccagttcct tcattctgca 2068120RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 681ugcagaauga aggaacugga 2068220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 682tgagatgcct ggctgccata 2068320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 683tgagatgcct ggctgccata 2068420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 684tgagatgcct ggctgccata 2068520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 685tgagatgcct ggctgccata 2068620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 686tgagatgcct ggctgccata 2068720RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 687uauggcagcc aggcaucuca 2068820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 688gcctcagtct gcttcgcacc 2068927DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 689gcgtttgctc ttcttcttgc gtttttt
2769020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 690gtccctgaag atgtcaatgc
2069120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 691tccagttcct tcattctgca
2069220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 692tgagatgcct ggctgccata
2069320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 693tagccattgc agctgctcac
2069420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 694tccagttcct tcattctgca
2069520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 695tgagatgcct ggctgccata
2069620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 696tagccattgc agctgctcac
2069720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 697tccagttcct tcattctgca
2069820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 698tgagatgcct ggctgccata
2069920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 699tagccattgc agctgctcac
2070020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 700tccagttcct tcattctgca
2070120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 701tgagatgcct ggctgccata
2070220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 702tagccattgc agctgctcac
2070320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 703tccagttcct tcattctgca
2070420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 704tgagatgcct ggctgccata
2070520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 705tagccattgc agctgctcac
2070620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 706uagccattgc agctgctcac
2070716DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 707uagccattgc agctgc 1670820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 708tagccattgc agctgctcac 2070920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 709attaataaat tgtcatcacc 2071020RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 710ggugcgaagc agacugaggc 2071120RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 711ugcagaauga aggaacugga 2071220RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 712uauggcagcc aggcaucuca 2071320RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 713gugagcagcu gcaauggcua 2071420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 714tagccattgc agctgctcac 2071520RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 715gugagcggcu gcaauggcua 2071620RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 716gugagcagcu gcgauggcua 2071720RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 717ggugaugaca auuuauuaau 2071820RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 718ggugauggca auuuauuaau 2071920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 719tgagatgcct ggctgccata 2072020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 720tgagatgcct ggctgccata 2072120DNAArtificial
SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 721tgagatgcct
ggctgccata 2072220DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 722tagccattgc agctgctcac
2072320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 723tagccattgc agctgctcac
2072420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 724tagccattgc agctgctcac
2072520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 725tagccattgc agctgctcac
2072620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 726tagccattgc agctgctcac
2072720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 727tagccattgc agctgctcac
2072820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 728tagccattgc agctgctcac
2072920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 729tagccattgc agctgctcac
2073020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 730tagccattgc agctgctcac
2073120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 731tagccattgc agctgctcac
2073220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 732tagccattgc agctgctcac
2073320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 733tagccattgc agctgctcac
2073420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 734tagccattgc agctgctcac
2073520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 735tagccattgc agctgctcac
2073620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 736tagccattgc agctgctcac
2073720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 737tagccattgc agctgctcac
2073820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 738tagccattgc agctgctcac
2073920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 739tagccattgc agctgctcac
2074020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 740tagccattgc agctgctcac
2074120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 741tagccattgc agctgctcac
2074220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 742tagccattgc agctgctcac
2074320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 743tagccattgc agctgctcac
2074420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 744tagccattgc agctgctcac
2074520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 745tagccattgc agctgctcac
2074620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 746tagccattgc agctgctcac
2074720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 747attaataaat tgtcatcacc
2074820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 748attaataaat tgtcatcacc
2074920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 749gcctcagtct gcttcgcacc
2075020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 750gcctcagtct gcttcgcacc
2075120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 751gcctcagtct gcttcgcacc
2075220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 752gcctcagtct gcttcgcacc
2075320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 753gcctcagtct gcttcgcacc
2075420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 754gtccctgaag atgtcaatgc
2075520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 755gtccctgaag atgtcaatgc
2075620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 756gtccctgaag atgtcaatgc
2075720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 757gtccctgaag atgtcaatgc
2075820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 758gcctcagtct gcttcgcacc
2075920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 759gcctcagtct gcttcgcacc
2076020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 760gcctcagtct gcttcgcacc
2076120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 761gcctcagtct gcttcgcacc
2076220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 762gcctcagtct gcttcgcacc
2076320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 763gcctcagtct gcttcgcacc
2076420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 764uagccattgc agctgctcac
2076520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 765uagccattgc agctgctcac
2076616DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 766uagccattgc agctgc 1676720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 767tagccattgc agctgctcac 2076820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 768tagccattgc agctgctcac 2076920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 769tagccattgc agctgctcac 2077020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 770tagccattgc agctgctcac 2077120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 771tagccattgc agctgctcac 2077220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 772tagccattgc agctgctcac 2077320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 773tagccattgc agctgctcac 2077420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 774tagccattgc agctgctcac 2077525RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 775uuuggaaguc ugcgcccuug ugccc 2577625RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 776uuuggaaguc ugugcccuug ugccc 2577720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 777gggcacaagg gcacagactt 2077820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 778ggcacaaggg cacagacttc 2077920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 779gcacaagggc acagacttcc 2078020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 780cacaagggca cagacttcca 2078120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 781acaagggcac agacttccaa 2078220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 782caagggcaca gacttccaaa 2078320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 783gtaggagtag tgaaaggcca 2078420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 784guaggagtag tgaaaggcca 2078520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 785guaggagtag tgaaaggcca 2078620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 786guaggagtag tgaaaggcca 2078720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 787cucuuactgt gctgtggaca 2078820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 788cucuuactgt gctgtggaca 2078920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 789cucuuactgt gctgtggaca 2079020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 790ccuuccctga aggttccucc 2079125RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 791uuuggaaguc ugcgcccuug ugccc 2579225RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 792uuuggaaguc ugugcccuug ugccc 2579335RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 793gagccuuugg aagucugcgc ccuugugccc ugccu
3579435RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 794gagccuuugg aagucugugc ccuugugccc ugccu
3579525RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 795gguuguugcc agguuacagc ugcuc
2579625RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 796gguuguugcc agguugcagc ugcuc
2579725RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 797ccuccugcag gcuggguguu ggccc
2579825RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 798ccuccugcag gcuggcuguu ggccc
2579920RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 799ggugaugaca auuuauuaau
2080020RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 800ggugauggca auuuauuaau
2080120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 801attaataaat tgtcatcacc
2080220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 802attaataaat tgtcatcacc
2080320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 803attaataaat tgtcatcacc
2080420RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 804ggugaugaca auuuauuaau
2080520RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 805ggugauggca auuuauuaau
2080625RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 806uuuggaaguc ugcgcccuug ugccc
2580725RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 807uuuggaaguc ugugcccuug ugccc
2580820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 808gggcacaagg gcacagactt
2080920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 809ggcacaaggg cacagacttc
2081020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 810gcacaagggc acagacttcc
2081120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 811cacaagggca cagacttcca
2081220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 812acaagggcac agacttccaa
2081320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 813caagggcaca gacttccaaa
2081420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 814gggcacaagg gcacagactt
2081520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 815ggcacaaggg cacagacttc
2081620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 816gcacaagggc acagacttcc
2081720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 817cacaagggca cagacttcca
2081820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 818acaagggcac agacttccaa
2081920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 819caagggcaca gacttccaaa
2082020RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 820gggcacaagg gcacagacuu
2082120RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 821ggcacaaggg cacagacuuc
2082220RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 822gcacaagggc acagacuucc
2082320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 823cacaagggca cagacuucca
2082420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 824acaagggcac agactuccaa
2082520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 825caagggcaca gacttccaaa
2082620RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 826gcacaagggc acagacuucc
2082720RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 827cacaagggca cagacuucca
2082820RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 828acaagggcac agacuuccaa
2082920RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 829caagggcaca gacuuccaaa
2083020RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 830gcacaagggc acagacuucc
2083120RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 831cacaagggca cagacuucca
2083220RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 832acaagggcac agacuuccaa
2083320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 833caagggcaca gacuuccaaa
2083420RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 834gggcacaagg gcacagacuu
2083520RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 835ggcacaaggg cacagacuuc
2083620RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 836gcacaagggc acagacuucc
2083720RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 837cacaagggca cagacuucca
2083820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 838acaagggcac agactuccaa
2083920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 839caagggcaca gacttccaaa
2084020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 840gggcacaagg gcacagactt
2084120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 841ggcacaaggg cacagacttc
2084220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 842gcacaagggc acagacttcc
2084320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 843cacaagggca cagacttcca
2084420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 844acaagggcac agacttccaa
2084520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 845caagggcaca gacttccaaa
2084625RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 846uuuggaaguc ugcgcccuug ugccc
2584725RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 847uuuggaaguc ugugcccuug ugccc
2584820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 848gagcagctgc aacctggcaa
2084920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 849gggccaacag ccagcctgca
2085025RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 850gguuguugcc agguuacagc ugcuc
2585125RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 851gguuguugcc agguugcagc ugcuc
2585220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 852gagcagctgc aacctggcaa
2085320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 853agcagctgca acctggcaac
2085420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 854gcagctgcaa cctggcaaca
2085520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 855cagctgcaac ctggcaacaa
2085620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 856agctgcaacc tggcaacaac
2085720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 857gctgcaacct ggcaacaacc
2085825RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 858ccuccugcag gcuggguguu ggccc
2585925RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 859ccuccugcag gcuggcuguu ggccc
2586020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 860gggccaacag ccagcctgca
2086120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 861ggccaacagc cagcctgcag
2086220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 862gccaacagcc agcctgcagg
2086320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 863ccaacagcca gcctgcagga
2086420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 864caacagccag cctgcaggag
2086520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 865aacagccagc ctgcaggagg
2086621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 866ggccuuucac uacuccuact t
2186721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 867guaggaguag ugaaaggcct t
2186820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 868gtaggagtag tgaaaggcca
2086920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 869gcagggcaca agggcacaga
2087020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 870cagggcacaa gggcacagac
2087120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 871agggcacaag ggcacagact
2087220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 872aagggcacag acttccaaag
2087320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 873agggcacaga cttccaaagg
2087420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 874gggcacagac ttccaaaggc
2087520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 875gagcagctgc aacctggcaa
2087620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 876agcagctgca acctggcaac
2087720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 877gcagctgcaa cctggcaaca
2087820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 878cagctgcaac ctggcaacaa
2087920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 879agctgcaacc tggcaacaac
2088020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 880gctgcaacct ggcaacaacc
2088120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 881gagcagctgc aacctggcaa
2088220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 882agcagctgca acctggcaac
2088320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 883gcagctgcaa cctggcaaca
2088420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 884cagcugcaac ctggcaacaa
2088520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 885agcugcaacc tggcaacaac
2088620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 886gcugcaacct ggcaacaacc
2088720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 887gagcagctgc aacctggcaa
2088820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 888agcagctgca acctggcaac
2088920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 889gcagctgcaa cctggcaaca
2089020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 890cagcugcaac ctggcaacaa
2089120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 891agcugcaacc tggcaacaac
2089220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 892gcugcaacct ggcaacaacc
2089320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 893gagcagctgc aaccuggcaa
2089420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 894gagcagctgc aaccuggcaa
2089520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 895agcagctgca acctggcaac
2089620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 896agcagctgca acctggcaac
2089720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 897gcagctgcaa ccuggcaaca
2089820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 898gcagctgcaa ccuggcaaca
2089920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 899gagcagctgc aacctggcaa
2090020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 900agcagctgca acctggcaac
2090120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 901gcagctgcaa cctggcaaca
2090220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 902cagcugcaac ctggcaacaa
2090320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 903agcugcaacc tggcaacaac
2090420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 904gcugcaacct ggcaacaacc
2090520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 905gggccaacag ccagcctgca
2090620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 906ggccaacagc cagcctgcag
2090720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 907gccaacagcc agcctgcagg
2090820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 908ccaacagcca gcctgcagga
2090920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 909caacagccag cctgcaggag
2091020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 910aacagccagc ctgcaggagg
2091120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 911gggccaacag ccagcctgca
2091220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 912ggccaacagc cagcctgcag
2091320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 913gccaacagcc agcctgcagg
2091420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 914ccaacagcca gcctgcagga
2091520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 915caacagccag cctgcaggag
2091620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 916aacagccagc ctgcaggagg
2091720RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 917gggccaacag ccagccugca
2091820RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 918ggccaacagc cagccugcag
2091920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 919gccaacagcc agcctgcagg
2092020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 920ccaacagcca gcctgcagga
2092120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 921caacagccag cctgcaggag
2092220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 922aacagccagc ctgcaggagg
2092320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 923gggccaacag ccagccugca
2092420RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 924gggccaacag ccagccugca
2092520RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 925ggccaacagc cagccugcag
2092620RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 926ggccaacagc cagccugcag
2092720RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 927gccaacagcc agccugcagg
2092820RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 928gccaacagcc agccugcagg
2092920RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 929gggccaacag ccagccugca
2093020RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 930ggccaacagc cagccugcag
2093120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 931gccaacagcc agcctgcagg
2093220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 932ccaacagcca gcctgcagga
2093320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 933caacagccag cctgcaggag
2093420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 934aacagccagc ctgcaggagg
2093520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 935guaggagtag tgaaaggcca
2093620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 936guaggagtag tgaaaggcca
2093720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 937guaggagtag tgaaaggcca
2093820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 938cucuuactgt gctgtggaca
2093920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 939cucuuactgt gctgtggaca
2094020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 940cucuuactgt gctgtggaca
2094120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 941gggcacaagg gcacagactt
2094220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 942ggcacaaggg cacagacttc
2094320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 943gcacaagggc acagacttcc
2094420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 944gggcacaagg gcacagactt
2094520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 945ggcacaaggg cacagacttc
2094620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 946gcacaagggc acagacttcc
2094735RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 947gagccuuugg aagucugcgc ccuugugccc ugccu
3594835RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 948gagccuuugg aagucugugc ccuugugccc ugccu
3594921RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 949cacacgggca cagacuucca a
2195021RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 950ggaagucugu gcccgugugc c
2195120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 951auuaauaaat tgtcatcacc
2095220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 952auuaauaaat tgtcatcacc
2095320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 953auuaauaaat tgtcatcacc
2095420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 954auuaauaaat tgtcatcacc
2095520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 955auuaauaaat tgtcatcacc
2095620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 956auuaauaaat tgtcatcacc
2095720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 957auuaauaaat tgtcatcacc
2095820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 958auuaauaaat tgtcatcacc
2095920RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 959ggcacaaggg cacagacuuc
2096020RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 960ggcacaaggg cacagacuuc
2096120RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 961ggcacaaggg cacagacuuc
2096220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 962ggcacaaggg cacagacttc
2096320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 963ggcacaaggg cacagacttc
2096420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 964ggcacaaggg cacagacttc
2096520RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 965ggcacaaggg cacagacuuc
2096620RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 966ggcacaaggg cacagacuuc
2096720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 967gcagggcaca agggcacaga
2096820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 968gcagggcaca agggcacaga
2096920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 969gcagggcaca agggcacaga
2097020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 970gcagggcaca agggcacaga
2097120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 971gcagggcaca agggcacaga
2097220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 972cagggcacaa gggcacagac
2097320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 973cagggcacaa gggcacagac
2097420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 974cagggcacaa gggcacagac
2097520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 975cagggcacaa gggcacagac
2097620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 976cagggcacaa gggcacagac
2097720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 977agggcacaag ggcacagact
2097820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 978agggcacaag ggcacagact
2097920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 979agggcacaag ggcacagact
2098020RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 980agggcacaag ggcacagacu
2098120RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 981agggcacaag ggcacagacu
2098220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 982aagggcacag acttccaaag
2098320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 983aagggcacag acttccaaag
2098420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 984aagggcacag acttccaaag
2098520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 985aagggcacag acttccaaag
2098620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 986aagggcacag acttccaaag
2098720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 987aagggcacag acttccaaag
2098820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 988aagggcacag acttccaaag
2098920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 989agggcacaga cttccaaagg
2099020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 990agggcacaga cttccaaagg
2099120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 991agggcacaga cttccaaagg
2099220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 992agggcacaga cttccaaagg
2099320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 993agggcacaga cttccaaagg
2099420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 994agggcacaga cttccaaagg
2099520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 995agggcacaga cttccaaagg
2099620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 996gggcacagac ttccaaaggc
2099720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 997gggcacagac ttccaaaggc
2099820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 998gggcacagac ttccaaaggc
2099920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 999gggcacagac ttccaaaggc
20100020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1000gggcacagac ttccaaaggc
20100120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1001ggcacaaggg cacagacutc
20100220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1002ggcacaaggg cacagacttc
20100320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1003ggcacaaggg cacagacuuc
20100420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1004auuaauaaat tgtcatcacc
20100520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1005auuaauaaat tgtcatcacc
20100620RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1006ggcacaaggg cacagacuuc
20100720RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1007ggcacaaggg cacagacuuc
20100820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1008ggcacaaggg cacagacttc
20100920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1009ggcacaaggg cacagacttc
20101020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1010ctcagtaaca ttgacaccac
20101120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1011cucagtaaca ttgacaccac
20101220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1012ggcacaaggg cacagacutc
20101320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1013ctcagtaaca ttgacaccac
20101420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1014ctcagtaaca ttgacaccac
20101520RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1015gaagucugug cccuugugcc
20101620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1016ggcacaaggg cacagacutc
20101720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1017tgtcatcacc agaaaaaguc
20101820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1018utgtcatcac cagaaaaagu
20101920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1019ttgtcatcac cagaaaaagu
20102020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1020autgtcatca ccagaaaaag
20102120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1021attgtcatca ccagaaaaag
20102220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1022aautgtcatc accagaaaaa
20102320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1023aattgtcatc accagaaaaa
20102420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1024aaattgtcat caccagaaaa
20102520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1025aaautgtcat caccagaaaa
20102620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1026uaaautgtca tcaccagaaa
20102720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1027uaaautgtca tcaccagaaa
20102820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1028auaaattgtc atcaccagaa
20102920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1029auaaattgtc atcaccagaa
20103020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1030aauaaattgt catcaccaga
20103120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1031aauaaattgt catcaccaga
20103220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1032aauaaattgt catcaccaga
20103320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1033uaauaaattg tcatcaccag
20103420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1034uaauaaattg tcatcaccag
20103520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1035uaauaaattg tcatcaccag
20103620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1036uaauaaattg tcatcaccag
20103720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1037uuaauaaatt gtcatcacca
20103820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1038uuaauaaatt gtcatcacca
20103920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1039uuaauaaatt gtcatcacca
20104020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1040uuaauaaatt gtcatcacca
20104120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1041auuaataaat tgtcatcacc
20104220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1042auuaataaat tgtcatcacc
20104320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1043auuaataaat tgtcatcacc
20104420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1044auuaataaat tgtcatcacc
20104520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1045uauuaataaa ttgtcatcac
20104620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1046uauuaataaa ttgtcatcac
20104720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1047uauuaataaa ttgtcatcac
20104820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1048cuauuaataa attgtcatca
20104920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1049cuauuaataa attgtcatca
20105020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1050acuautaata aattgtcatc
20105120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1051tgtcatcacc agaaaaaguc
20105220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1052utgtcatcac cagaaaaagu
20105320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1053ttgtcatcac cagaaaaagu
20105420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1054autgtcatca ccagaaaaag
20105520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1055attgtcatca ccagaaaaag
20105620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1056aautgtcatc accagaaaaa
20105720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1057aattgtcatc accagaaaaa
20105820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1058aaattgtcat caccagaaaa
20105920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1059aaautgtcat caccagaaaa
20106020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1060uaaautgtca tcaccagaaa
20106120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1061uaaautgtca tcaccagaaa
20106220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1062auaaattgtc atcaccagaa
20106320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1063auaaattgtc atcaccagaa
20106420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1064aauaaattgt catcaccaga
20106520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1065aauaaattgt catcaccaga
20106620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1066aauaaattgt catcaccaga
20106720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1067uaauaaattg tcatcaccag
20106820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1068uaauaaattg tcatcaccag
20106920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1069uaauaaattg tcatcaccag
20107020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1070uaauaaattg tcatcaccag
20107120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1071uuaauaaatt gtcatcacca
20107220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1072uuaauaaatt gtcatcacca
20107320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1073uuaauaaatt gtcatcacca
20107420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1074uuaauaaatt gtcatcacca
20107520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1075auuaataaat tgtcatcacc
20107620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1076auuaataaat tgtcatcacc
20107720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1077auuaataaat tgtcatcacc
20107820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1078auuaataaat tgtcatcacc
20107920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1079uauuaataaa ttgtcatcac
20108020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1080uauuaataaa ttgtcatcac
20108120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1081uauuaataaa ttgtcatcac
20108220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of
Combined DNA/RNA Molecule Synthetic oligonucleotide 1082cuauuaataa
attgtcatca 20108320DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotideDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 1083cuauuaataa attgtcatca
20108420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1084acuautaata aattgtcatc
20108532RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1085gacuuuuucu ggugauggca auuuauuaau ag
32108632RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1086gacuuuuucu ggugaugaca auuuauuaau ag
32108720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1087uaaautgtca tcaccagaaa
20108820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1088auaaattgtc atcaccagaa
20108920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1089aauaaattgt catcaccaga
20109020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1090uaauaaattg tcatcaccag
20109120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1091aauaaattgt catcaccaga
20109220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1092uaauaaattg tcatcaccag
20109320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1093gcacaagggc acagacuucc
20109420RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1094gcacaagggc acagacuucc
20109520RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1095cacaagggca cagacuucca
20109620RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1096cacaagggca cagacuucca
20109720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1097uaaautgtca tcaccagaaa
20109820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1098auaaattgtc atcaccagaa
20109920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1099aauaaattgt catcaccaga
20110020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1100uaauaaattg tcatcaccag
20110120RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1101uccccacaga gggaggaagc
20110220RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1102cuccccacag agggaggaag
20110320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1103ccuccccaca gagggaggaa
20110420RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1104uccuccccac agagggagga
20110520RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1105guccucccca cagagggagg
20110620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1106ggucctcccc acagagggag
20110720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1107gggucctccc cacagaggga
20110820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1108cgggucctcc ccacagaggg
20110920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1109acaguagatg agggagcagg
20111020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1110cacagtagat gagggagcag
20111120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1111acacagtaga tgagggagca
20111220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1112cacacagtag atgagggagc
20111320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1113gcacacagta gatgagggag
20111420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1114ugcacacagt agatgaggga
20111520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1115gugcacacag tagatgaggg
20111620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1116agugcacaca gtagaugagg
20111720RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1117uccccacaga gggaggaagc
20111820RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1118cuccccacag agggaggaag
20111920RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1119ccuccccaca gagggaggaa
20112020RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1120uccuccccac agagggagga
20112120RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1121guccucccca cagagggagg
20112220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1122ggucctcccc acagagggag
20112320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1123gggucctccc cacagaggga
20112420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1124cgggucctcc ccacagaggg
20112520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1125acaguagatg agggagcagg
20112620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1126cacagtagat gagggagcag
20112720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1127acacagtaga tgagggagca
20112820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1128cacacagtag atgagggagc
20112920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1129gcacacagta gatgagggag
20113020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1130ugcacacagt agatgaggga
20113120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1131gugcacacag tagatgaggg
20113220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1132agugcacaca gtagaugagg
20113320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1133ggcacaaggg cacagacttc
20113420RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1134ggcacaaggg cacagacuuc
20113520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1135gggucctccc cacagaggga
20113620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1136gggucctccc cacagaggga
20113720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1137gggucctccc cacagaggga
20113820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1138gggucctccc cacagaggga
20113920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1139ggguuctccc cacagaggga
20114020RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1140ggcacaaggg cacagacuuc
20114120RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1141ggcacaaggg cacagacuuc
20114220RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1142ggcacaaggg cacagacuuc
20114320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1143ggcacaaggg cacagacuuc
20114420RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1144ggcacaaggg cacagacuuc
20114520RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1145ggcacaaggg cacagacuuc
20114620RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1146ggcacaaggg cacagacuuc
20114720RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1147ggcacaaggg cacagacuuc
20114820RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1148ggcacaaggg cacagacuuc
20114920RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1149ggcacaaggg cacagacuuc
20115020RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1150ggcacaaggg cacagacuuc
20115120RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1151ggcacaaggg cacagacuuc
20115220RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1152ggcacaaggg cacagacuuc
20115320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1153attaataaat tgtcatcacc
20115420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1154attaataaat tgtcatcacc
20115520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1155attaataaat tgtcatcacc
20115620RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1156ggugaugaca auuuauuaau
20115720RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1157ggugauggca auuuauuaau
20115825RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1158uuuggaaguc ugcgcccuug ugccc
25115925RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1159uuuggaaguc ugugcccuug ugccc
25116020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1160gggcacaagg gcacagactt
20116120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1161ggcacaaggg cacagacttc
20116220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1162gcacaagggc acagacttcc
20116320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1163cacaagggca cagacttcca
20116420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1164acaagggcac agacttccaa
20116520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1165caagggcaca gacttccaaa
20116620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1166gggcacaagg gcacagactt
20116720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1167ggcacaaggg cacagacttc
20116820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1168gcacaagggc acagacttcc
20116920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1169cacaagggca cagacttcca
20117020DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 1170acaagggcac
agacttccaa 20117120DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 1171caagggcaca gacttccaaa
20117220RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1172gggcacaagg gcacagacuu
20117320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1173ggcacaaggg cacagacuuc
20117420RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1174gcacaagggc acagacuucc
20117520RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1175cacaagggca cagacuucca
20117620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1176acaagggcac agactuccaa
20117720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1177caagggcaca gacttccaaa
20117820RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1178gcacaagggc acagacuucc
20117920RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1179cacaagggca cagacuucca
20118020RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1180acaagggcac agacuuccaa
20118120RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1181caagggcaca gacuuccaaa
20118220RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1182gcacaagggc acagacuucc
20118320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1183cacaagggca cagacuucca
20118420RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1184acaagggcac agacuuccaa
20118520RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1185caagggcaca gacuuccaaa
20118620RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1186gggcacaagg gcacagacuu
20118720RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1187ggcacaaggg cacagacuuc
20118820RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1188gcacaagggc acagacuucc
20118920RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1189cacaagggca cagacuucca
20119020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1190acaagggcac agactuccaa
20119120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1191caagggcaca gacttccaaa
20119220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1192gggcacaagg gcacagactt
20119320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1193ggcacaaggg cacagacttc
20119420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1194gcacaagggc acagacttcc
20119520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1195cacaagggca cagacttcca
20119620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1196acaagggcac agacttccaa
20119720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1197caagggcaca gacttccaaa
20119825RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1198uuuggaaguc ugcgcccuug ugccc
25119925RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1199uuuggaaguc ugugcccuug ugccc
25120020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1200gagcagctgc aacctggcaa
20120120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1201gggccaacag ccagcctgca
20120225RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1202gguuguugcc agguuacagc ugcuc
25120325RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1203gguuguugcc agguugcagc ugcuc
25120420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1204gagcagctgc aacctggcaa
20120520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1205agcagctgca acctggcaac
20120620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1206gcagctgcaa cctggcaaca
20120720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1207cagctgcaac ctggcaacaa
20120820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1208agctgcaacc tggcaacaac
20120920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1209gctgcaacct ggcaacaacc
20121025RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1210ccuccugcag gcuggguguu ggccc
25121125RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1211ccuccugcag gcuggcuguu ggccc
25121220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1212gggccaacag ccagcctgca
20121320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1213ggccaacagc cagcctgcag
20121420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1214gccaacagcc agcctgcagg
20121520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1215ccaacagcca gcctgcagga
20121620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1216caacagccag cctgcaggag
20121720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1217aacagccagc ctgcaggagg
20121821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1218ggccuuucac uacuccuact t
21121921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1219guaggaguag ugaaaggcct t
21122020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1220gtaggagtag tgaaaggcca
20122120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1221gcagggcaca agggcacaga
20122220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1222cagggcacaa gggcacagac
20122320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1223agggcacaag ggcacagact
20122420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1224aagggcacag acttccaaag
20122520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1225agggcacaga cttccaaagg
20122620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1226gggcacagac ttccaaaggc
20122720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1227gagcagctgc aacctggcaa
20122820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1228agcagctgca acctggcaac
20122920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1229gcagctgcaa cctggcaaca
20123020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1230cagctgcaac ctggcaacaa
20123120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1231agctgcaacc tggcaacaac
20123220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1232gctgcaacct ggcaacaacc
20123320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1233gagcagctgc aacctggcaa
20123420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1234agcagctgca acctggcaac
20123520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1235gcagctgcaa cctggcaaca
20123620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1236cagcugcaac ctggcaacaa
20123720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1237agcugcaacc tggcaacaac
20123820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1238gcugcaacct ggcaacaacc
20123920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1239gagcagctgc aacctggcaa
20124020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1240agcagctgca acctggcaac
20124120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1241gcagctgcaa cctggcaaca
20124220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1242cagcugcaac ctggcaacaa
20124320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1243agcugcaacc tggcaacaac
20124420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1244gcugcaacct ggcaacaacc
20124520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1245gagcagctgc aaccuggcaa
20124620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1246gagcagctgc aaccuggcaa
20124720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1247agcagctgca acctggcaac
20124820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1248agcagctgca acctggcaac
20124920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1249gcagctgcaa ccuggcaaca
20125020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1250gcagctgcaa ccuggcaaca
20125120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1251gagcagctgc aacctggcaa
20125220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1252agcagctgca acctggcaac
20125320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1253gcagctgcaa cctggcaaca
20125420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1254cagcugcaac ctggcaacaa
20125520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1255agcugcaacc tggcaacaac
20125620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1256gcugcaacct ggcaacaacc
20125720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1257gggccaacag ccagcctgca
20125820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1258ggccaacagc cagcctgcag
20125920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1259gccaacagcc agcctgcagg
20126020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1260ccaacagcca gcctgcagga
20126120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1261caacagccag cctgcaggag
20126220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1262aacagccagc ctgcaggagg
20126320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1263gggccaacag ccagcctgca
20126420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1264ggccaacagc cagcctgcag
20126520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1265gccaacagcc agcctgcagg
20126620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1266ccaacagcca gcctgcagga
20126720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1267caacagccag cctgcaggag
20126820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1268aacagccagc ctgcaggagg
20126920RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1269gggccaacag ccagccugca
20127020RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1270ggccaacagc cagccugcag
20127120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1271gccaacagcc agcctgcagg
20127220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1272ccaacagcca gcctgcagga
20127320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1273caacagccag cctgcaggag
20127420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1274aacagccagc ctgcaggagg
20127520RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1275gggccaacag ccagccugca
20127620RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1276gggccaacag ccagccugca
20127720RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1277ggccaacagc cagccugcag
20127820RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1278ggccaacagc cagccugcag
20127920RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1279gccaacagcc agccugcagg
20128020RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1280gccaacagcc agccugcagg
20128120RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1281gggccaacag ccagccugca
20128220RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1282ggccaacagc cagccugcag
20128320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1283gccaacagcc agcctgcagg
20128420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1284ccaacagcca gcctgcagga
20128520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1285caacagccag cctgcaggag
20128620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1286aacagccagc ctgcaggagg
20128720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1287guaggagtag tgaaaggcca
20128820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1288guaggagtag tgaaaggcca
20128920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1289guaggagtag tgaaaggcca
20129020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1290cucuuactgt gctgtggaca
20129120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1291cucuuactgt gctgtggaca
20129220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1292cucuuactgt gctgtggaca
20129320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1293gggcacaagg gcacagactt
20129420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1294ggcacaaggg cacagacttc
20129520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1295gcacaagggc acagacttcc
20129620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1296gggcacaagg gcacagactt
20129720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1297ggcacaaggg cacagacttc
20129820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1298gcacaagggc acagacttcc
20129935RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1299gagccuuugg aagucugcgc ccuugugccc
ugccu 35130035RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 1300gagccuuugg aagucugugc
ccuugugccc ugccu 35130121RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 1301cacacgggca
cagacuucca a 21130221RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 1302ggaagucugu
gcccgugugc c 21130320DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotideDescription of
Combined DNA/RNA Molecule Synthetic oligonucleotide 1303auuaauaaat
tgtcatcacc 20130420DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotideDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 1304auuaauaaat tgtcatcacc
20130520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1305auuaauaaat tgtcatcacc
20130620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1306auuaauaaat tgtcatcacc
20130720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1307auuaauaaat tgtcatcacc
20130820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1308auuaauaaat tgtcatcacc
20130920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1309auuaauaaat tgtcatcacc
20131020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1310auuaauaaat tgtcatcacc
20131120RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1311ggcacaaggg cacagacuuc
20131220RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1312ggcacaaggg cacagacuuc
20131320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1313ggcacaaggg cacagacuuc
20131420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1314ggcacaaggg cacagacttc
20131520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1315ggcacaaggg cacagacttc
20131620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1316ggcacaaggg cacagacttc
20131720RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1317ggcacaaggg cacagacuuc
20131820RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1318ggcacaaggg cacagacuuc
20131920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1319gcagggcaca agggcacaga
20132020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1320gcagggcaca agggcacaga
20132120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1321gcagggcaca agggcacaga
20132220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1322gcagggcaca agggcacaga
20132320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1323gcagggcaca agggcacaga
20132420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1324cagggcacaa gggcacagac
20132520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1325cagggcacaa gggcacagac
20132620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1326cagggcacaa gggcacagac
20132720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1327cagggcacaa gggcacagac
20132820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1328cagggcacaa gggcacagac
20132920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1329agggcacaag ggcacagact
20133020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1330agggcacaag ggcacagact
20133120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1331agggcacaag ggcacagact
20133220RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1332agggcacaag ggcacagacu
20133320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1333agggcacaag ggcacagacu
20133420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1334aagggcacag acttccaaag
20133520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1335aagggcacag acttccaaag
20133620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1336aagggcacag acttccaaag
20133720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1337aagggcacag acttccaaag
20133820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1338aagggcacag acttccaaag
20133920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1339aagggcacag acttccaaag
20134020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1340aagggcacag acttccaaag
20134120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1341agggcacaga cttccaaagg
20134220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1342agggcacaga cttccaaagg
20134320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1343agggcacaga cttccaaagg
20134420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1344agggcacaga cttccaaagg
20134520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1345agggcacaga cttccaaagg
20134620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1346agggcacaga cttccaaagg
20134720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1347agggcacaga cttccaaagg
20134820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1348gggcacagac ttccaaaggc
20134920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1349gggcacagac ttccaaaggc
20135020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1350gggcacagac ttccaaaggc
20135120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1351gggcacagac ttccaaaggc
20135220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1352gggcacagac ttccaaaggc
20135320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1353ggcacaaggg cacagacuuc
20135420RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1354ggcacaaggg cacagacuuc
20135520RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1355ggcacaaggg cacagacuuc
20135620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1356auuaauaaat tgtcatcacc
20135720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1357auuaauaaat tgtcatcacc
20135820RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1358ggcacaaggg cacagacuuc
20135920RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1359ggcacaaggg cacagacuuc
20136020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1360ggcacaaggg cacagacttc
20136120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1361ggcacaaggg cacagacttc
20136220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1362ctcagtaaca ttgacaccac
20136320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1363cucagtaaca ttgacaccac
20136420RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1364ggcacaaggg cacagacuuc
20136520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1365cucagtaaca ttgacaccac
20136620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1366cucagtaaca ttgacaccac
20136720RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1367gaagucugug cccuugugcc
20136820RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1368ggcacaaggg cacagacuuc
20136920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1369tgtcatcacc agaaaaaguc
20137020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1370utgtcatcac cagaaaaagu
20137120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1371ttgtcatcac cagaaaaagu
20137220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1372autgtcatca ccagaaaaag
20137320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1373attgtcatca ccagaaaaag
20137420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1374aautgtcatc accagaaaaa
20137520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1375aattgtcatc accagaaaaa
20137620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1376aaattgtcat caccagaaaa
20137720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1377aaautgtcat caccagaaaa
20137820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1378uaaautgtca tcaccagaaa
20137920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1379uaaautgtca tcaccagaaa
20138020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1380auaaattgtc atcaccagaa
20138120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1381auaaattgtc atcaccagaa
20138220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1382aauaaattgt catcaccaga
20138320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1383aauaaattgt catcaccaga
20138420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1384aauaaattgt catcaccaga
20138520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1385uaauaaattg tcatcaccag
20138620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1386uaauaaattg tcatcaccag
20138720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1387uaauaaattg tcatcaccag
20138820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1388uaauaaattg tcatcaccag
20138920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1389uuaauaaatt gtcatcacca
20139020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1390uuaauaaatt gtcatcacca
20139120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1391uuaauaaatt gtcatcacca
20139220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1392uuaauaaatt gtcatcacca
20139320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1393auuaataaat tgtcatcacc
20139420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1394auuaataaat tgtcatcacc
20139520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1395auuaataaat tgtcatcacc
20139620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1396auuaataaat tgtcatcacc
20139720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1397uauuaataaa ttgtcatcac
20139820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1398uauuaataaa ttgtcatcac
20139920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1399uauuaataaa ttgtcatcac
20140020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1400cuauuaataa attgtcatca
20140120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1401cuauuaataa attgtcatca
20140220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1402acuautaata aattgtcatc
20140320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1403tgtcatcacc agaaaaaguc
20140420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1404utgtcatcac cagaaaaagu
20140520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1405ttgtcatcac cagaaaaagu
20140620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1406autgtcatca ccagaaaaag
20140720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1407attgtcatca ccagaaaaag
20140820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1408aautgtcatc accagaaaaa
20140920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1409aattgtcatc accagaaaaa
20141020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1410aaattgtcat caccagaaaa
20141120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1411aaautgtcat caccagaaaa
20141220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1412uaaautgtca tcaccagaaa
20141320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1413uaaautgtca tcaccagaaa
20141420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1414auaaattgtc atcaccagaa
20141520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1415auaaattgtc atcaccagaa
20141620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1416aauaaattgt catcaccaga
20141720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1417aauaaattgt catcaccaga
20141820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1418aauaaattgt catcaccaga
20141920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1419uaauaaattg tcatcaccag
20142020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1420uaauaaattg tcatcaccag
20142120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1421uaauaaattg tcatcaccag
20142220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1422uaauaaattg tcatcaccag
20142320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1423uuaauaaatt gtcatcacca
20142420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1424uuaauaaatt gtcatcacca
20142520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1425uuaauaaatt gtcatcacca
20142620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1426uuaauaaatt gtcatcacca
20142720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1427auuaataaat tgtcatcacc
20142820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1428auuaataaat tgtcatcacc
20142920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1429auuaataaat tgtcatcacc
20143020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1430auuaataaat tgtcatcacc
20143120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1431uauuaataaa ttgtcatcac
20143220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1432uauuaataaa ttgtcatcac
20143320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA
Molecule
Synthetic oligonucleotide 1433uauuaataaa ttgtcatcac
20143420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1434cuauuaataa attgtcatca
20143520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1435cuauuaataa attgtcatca
20143620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1436acuautaata aattgtcatc
20143732RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1437gacuuuuucu ggugauggca auuuauuaau ag
32143832RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1438gacuuuuucu ggugaugaca auuuauuaau ag
32143920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1439uaaautgtca tcaccagaaa
20144020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1440auaaattgtc atcaccagaa
20144120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1441aauaaattgt catcaccaga
20144220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1442uaauaaattg tcatcaccag
20144320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1443aauaaattgt catcaccaga
20144420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1444uaauaaattg tcatcaccag
20144520RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1445gcacaagggc acagacuucc
20144620RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1446gcacaagggc acagacuucc
20144720RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1447cacaagggca cagacuucca
20144820RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1448cacaagggca cagacuucca
20144920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1449uaaautgtca tcaccagaaa
20145020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1450auaaattgtc atcaccagaa
20145120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1451aauaaattgt catcaccaga
20145220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1452uaauaaattg tcatcaccag
20145320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1453uccccacaga gggaggaagc
20145420RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1454cuccccacag agggaggaag
20145520RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1455ccuccccaca gagggaggaa
20145620RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1456uccuccccac agagggagga
20145720RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1457guccucccca cagagggagg
20145820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1458ggucctcccc acagagggag
20145920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1459gggucctccc cacagaggga
20146020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1460cgggucctcc ccacagaggg
20146120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1461acaguagatg agggagcagg
20146220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1462cacagtagat gagggagcag
20146320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1463acacagtaga tgagggagca
20146420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1464cacacagtag atgagggagc
20146520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1465gcacacagta gatgagggag
20146620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1466ugcacacagt agatgaggga
20146720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1467gugcacacag tagatgaggg
20146820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1468agugcacaca gtagaugagg
20146920RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1469uccccacaga gggaggaagc
20147020RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1470cuccccacag agggaggaag
20147120RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1471ccuccccaca gagggaggaa
20147220RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1472uccuccccac agagggagga
20147320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1473guccucccca cagagggagg
20147420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1474ggucctcccc acagagggag
20147520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1475gggucctccc cacagaggga
20147620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1476cgggucctcc ccacagaggg
20147720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1477acaguagatg agggagcagg
20147820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1478cacagtagat gagggagcag
20147920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1479acacagtaga tgagggagca
20148020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1480cacacagtag atgagggagc
20148120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1481gcacacagta gatgagggag
20148220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1482ugcacacagt agatgaggga
20148320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1483gugcacacag tagatgaggg
20148420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1484agugcacaca gtagaugagg
20148520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1485ggcacaaggg cacagacttc
20148620RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1486ggcacaaggg cacagacuuc
20148720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1487gggucctccc cacagaggga
20148820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1488gggucctccc cacagaggga
20148920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1489gggucctccc cacagaggga
20149020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1490gggucctccc cacagaggga
20149120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1491ggguuctccc cacagaggga
20149220RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1492ggcacaaggg cacagacuuc
20149320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1493ggcacaaggg cacagacuuc
20149420RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1494ggcacaaggg cacagacuuc
20149520RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1495ggcacaaggg cacagacuuc
20149620RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1496ggcacaaggg cacagacuuc
20149720RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1497ggcacaaggg cacagacuuc
20149820RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1498ggcacaaggg cacagacuuc
20149920RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1499ggcacaaggg cacagacuuc
20150020RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1500ggcacaaggg cacagacuuc
20150120RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1501ggcacaaggg cacagacuuc
20150220RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1502ggcacaaggg cacagacuuc
20150320RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1503ggcacaaggg cacagacuuc
20150420RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1504ggcacaaggg cacagacuuc
20150512DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1505cagtctgctt cg 12150620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 1506gcctcagtct gcttcgcacc 20150721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 1507uucuagaccu guuuugcuut t 21150821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 1508uucuagaccu guuuugcuut t 21150921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 1509aagcaaaaca ggucuagaat t 21151021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 1510aagcaaaaca ggucuagaat t 21151121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 1511aagcaaaaca ggucuagaat t 21151220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 1512agcaaaacag gucuagaatt 20151320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 1513agcaaaacag gucuagaatt 20151420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 1514agcaaaacag gucuagaatt 20151521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 1515uucuagaccu guuuugcuut t 21151621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideDescription of Combined DNA/RNA Molecule Synthetic
oligonucleotide 1516uucuagaccu guuuugcuut t
21151721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1517uucuagaccu guuuugcuut t
21151821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1518uucuagaccu guuuugcuut t
21151921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1519uucuagaccu guuuugcuut t
21152021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1520uucuagaccu guuuugcuut t
21152121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1521aagcaaaaca ggucuagaat t
21152221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1522aagcaaaaca ggucuagaat t
21152321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1523aagcaaaaca ggucuagaat t
21152421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1524aagcaaaaca ggucuagaat t
21152521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1525aagcaaaaca ggucuagaat t
21152621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1526aagcaaaaca ggucuagaat t
21152721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1527aagcaaaaca ggucuagaat t
21152821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1528aagcaaaaca ggucuagaat t
21152921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1529aagcaaaaca ggucuagaat t
21153021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1530aagcaaaaca ggucuagaat t
21153121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1531aagcaaaaca ggucuagaat t
21153221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1532aagcaaaaca ggucuagaat t
21153321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1533uucuagaccu guuuugcuut t
21153421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1534uucuagaccu guuuugcuut t
21153521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1535uucuagaccu guuuugcuut t
21153621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1536uucuagaccu guuuugcuut t
21153721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1537uucuagaccu guuuugcuut t
21153821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1538uucuagaccu guuuugcuut t
21153921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1539aagcaaaaca ggucuagaat t
21154021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1540aagcaaaaca ggucuagaat t
21154121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1541aagcaaaaca ggucuagaat t
21154221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1542aagcaaaaca ggucuagaat t
21154321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1543aagcaaaaca ggucuagaat t
21154421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1544aagcaaaaca ggucuagaat t
21154521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1545aagcaaaaca ggucuagaat t
21154621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotideDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 1546aagcaaaaca ggucuagaat t
21154712DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1547ggatgttctc ga 12154812DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 1548ggatgttctc ga 12154912DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 1549ggatgttctc ga 12155016DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 1550ttcagtcatg acttcc 16155116DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 1551ttcagtcatg acttcc 1615526PRTArtificial
SequenceDescription of Artificial Sequence Synthetic 6xHis tag
1552His His His His His His1 5155321RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 1553ggaagucugu gcccguguuc c 21155420RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 1554ggcacaaggg cacagacuuc 20155510DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 1555acacacacac 10155610DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 1556cccccccccc 10155710DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 1557cccccccccc 10155810DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 1558cccccccccc 10155920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 1559gcctcagtct gcttcgcacc 20156020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 1560tagccattgc agctgctcac 20156120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 1561tccagttcct tcattctgca 20156220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 1562tgagatgcct ggctgccata 20156320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 1563attaataaat tgtcatcacc 20156420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 1564attaataaat tgacatcacc 20156520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 1565attaataaat tggcatcacc 20
* * * * *
References