Methods, Systems, And Compositions For Neuronal Differentiation Of Multipotent Stromal Cells

BRODIE; Chaya ;   et al.

Patent Application Summary

U.S. patent application number 16/578893 was filed with the patent office on 2020-02-27 for methods, systems, and compositions for neuronal differentiation of multipotent stromal cells. The applicant listed for this patent is EXOSTEM BIOTEC LTD.. Invention is credited to Chaya BRODIE, Shimon SLAVIN.

Application Number20200063135 16/578893
Document ID /
Family ID43309468
Filed Date2020-02-27

United States Patent Application 20200063135
Kind Code A1
BRODIE; Chaya ;   et al. February 27, 2020

METHODS, SYSTEMS, AND COMPOSITIONS FOR NEURONAL DIFFERENTIATION OF MULTIPOTENT STROMAL CELLS

Abstract

Some embodiments of the invention comprise methods, systems, and compositions to selectively induce, whether in vitro or in vivo, the neuronal differentiation of multipotent stromal cells through the application of microRNAs, including but not limited to miRNA-124, miRNA-137 and/or miRNA-9* expression products of those miRNAs, and molecules and compositions containing functional elements of those miRNAs. Some embodiments of the invention also comprise the therapeutic administration and use of such induced cells to treat mammalian injuries and diseases, including but not limited to, nervous system injuries or diseases that may otherwise result in decreased cell or system function.


Inventors: BRODIE; Chaya; (Southfield, MI) ; SLAVIN; Shimon; (Tel-Aviv, IL)
Applicant:
Name City State Country Type

EXOSTEM BIOTEC LTD.

Tel Aviv

IL
Family ID: 43309468
Appl. No.: 16/578893
Filed: September 23, 2019

Related U.S. Patent Documents

Application Number Filing Date Patent Number
13377558 Feb 23, 2012 10421961
PCT/US2010/038168 Jun 10, 2010
16578893
61185773 Jun 10, 2009

Current U.S. Class: 1/1
Current CPC Class: C12N 2506/1353 20130101; C12N 2510/00 20130101; A61P 43/00 20180101; C12N 2330/10 20130101; A61K 31/7105 20130101; C12N 5/0619 20130101; C12N 2501/65 20130101; C12N 2310/141 20130101; C12N 2501/13 20130101; A61P 25/28 20180101; A61P 25/00 20180101; C12N 15/113 20130101
International Class: C12N 15/113 20060101 C12N015/113; A61K 31/7105 20060101 A61K031/7105; C12N 5/0793 20060101 C12N005/0793

Claims



1. A method of trans-differentiating mammalian multipotent stromal cells into neuronal stem cells, the method comprising the steps of: a) providing a population of mammalian multipotent stromal cells; and b) expressing microRNA-124 in the population of mammalian multipotent stromal cells so as to generate a population of neuronal stem cells expressing nestin, thereby trans-differentiating mammalian multipotent stromal cells into neuronal stem cells.

2. The method of claim 1, wherein the mammal is a human.

3. The method of claim 1, further comprising step (c) comprising analyzing a marker in said population of neuronal stem cells, wherein said marker comprises a neuronal morphology.

4. The method of claim 1, wherein said mammalian multipotent stromal cells are derived from a tissue selected from the group consisting of adipose tissue, umbilical cord tissue, bone marrow tissue and placenta tissue.

5. The method of claim 1, further comprising expressing in said mammalian multipotent stromal cells glial derived neurotrophic factor (GDNF).

6. The method of claim 1, further comprising expressing in said mammalian multipotent stromal cells microRNA-137, microRNA-9* or both.

7. The method of claim 1, wherein said expressing comprises transfection, overexpression of exogenous miRNA or transduction of pre-miRNA.

8. A method of treating a mammal suffering from nervous system injury or disease, comprising: a. performing the method of claim 1; and b. administering said trans-differentiated mammalian multipotent stromal cells, secreted factors therefrom or both to said mammal; thereby treating a mammal suffering from nervous system injury or disease.

9. The method of claim 8, wherein said mammal is a human.

10. The method of claim 8, further comprising expressing in said mammalian multipotent stromal cells microRNA-137, microRNA-9* or both.

11. The method of claim 8, wherein said nervous system injury is a spinal injury.

12. The method of claim 8, wherein said nervous system disease is a neurodegenerative disorder.

13. The method of claim 11, wherein said neurodegenerative disorder is selected from amyotrophic lateral sclerosis, and multiple sclerosis.

14. The method of claim 11, wherein said neurodegenerative disorder is a motor neuron disease.
Description



CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application is a Continuation of U.S. patent application Ser. No. 13/377,558, filed on Feb. 23, 2012, which is a national phase of PCT Patent Application No. PCT/US2010/038168, filed on Jun. 10, 2010, which claims the benefit of priority of U.S. Provisional Patent Application No. 61/185,773, filed on Jun. 10, 2009. The contents of the above applications are all hereby expressly incorporated by reference, in their entirety.

TECHNICAL FIELD

[0002] Without limitation, certain embodiments of the invention relate to induction and application of cell types for the treatment of mammalian nervous system injuries and diseases.

BACKGROUND

[0003] Certain nervous system injuries, autoimmune diseases affecting the central or peripheral nervous system, and neurodegenerative diseases are characterized by loss of specific cells, or abnormal functions of existing nerve cells, which cause the patient to present with different neurological signs and symptoms and potentially irreversible loss of neurological functions. As one example only, some patients suffering stroke, spinal cord injury, or other neural injury and degeneration experience loss of functioning cell types, or neurological conditions like Parkinson's disease and Alzheimer's disease which in turn results in loss of or abnormal function of system function. Currently therapeutic options for treating and restoring such cell and system functions are limited. Thus, a need remains for methods, systems, and compositions to promote additional therapies, including therapies addressed to replacement of missing or damaged nervous system cells, tissues, and functions.

BRIEF SUMMARY

[0004] Without limitation to only those embodiments described herein and without disclaimer, some embodiments of the invention comprise methods, systems, and compositions to selectively induce, whether in vitro or in vivo, the neuronal differentiation of multipotent stromal cells through the application of microRNAs, including but not limited to miRNA-124, miRNA-137 and/or miRNA-9* expression products of those miRNAs, and molecules and compositions containing functional elements of those miRNAs. Some embodiments of the invention also comprise the therapeutic administration and use of such induced cells to treat mammalian injuries and diseases, including but not limited to, nervous system injuries or diseases that may otherwise result in decreased cell or system function.

BRIEF DESCRIPTION OF THE DRAWINGS

[0005] Some embodiments of the present invention will now be described, by way of example only and without disclaimer of other embodiments, with reference to the accompanying drawings, in which:

[0006] FIG. 1 shows bright field images of MSCs treated with growth factors or transfected with control miRNA and miRNA-124 or miRNA-137 for 3, 5 and 9 days.

[0007] FIG. 2 is a data representation showing that miRNA-124, miRNA-137 and miRNA-9* induce neuronal markers in MSCs.

[0008] FIG. 3 shows Western Blot results following transfection of cells with tested miRNAs or treatment with DMEM.

[0009] FIG. 4 shows results of transfecting adipose and cord derived MSCs with control miRNA, miRNA-124, or miRNA-137.

DETAILED DESCRIPTION

[0010] Without limitation to only those embodiments expressly disclosed herein and without disclaiming any embodiments, some embodiments of the invention comprise methods, systems, and composition to selectively induce, whether in vitro or in vivo, the neuronal differentiation of multipotent stromal cells ("MSCs") through the application of microRNAs ("miRNA(s)" or "miR(s)"), including but not limited to, miRNA-124 and/or miRNA-137, and/or miRNA-9*, expression products of those miRNAs, and molecules and compositions containing functional elements of those miRNAs. Some embodiments of the invention also comprise the therapeutic administration and use of such induced cells to treat mammalian injuries and diseases, including but not limited to, nervous system injuries or diseases that may otherwise result in decreased cell or system function. In some embodiments, such induction of differentiated MSCs, and/or the resulting cells, may be used to treat cell, tissue, or organ damage in a patient by administering to said patient a therapeutically effective amount of an miRNA of interest, or of differentiated MSCs induced by such miRNAs.

[0011] We have discovered unexpectedly that certain miRNAs are capable of inducing long-term neuronal differentiation of MSCs for the use of cell-based therapies in subjects presenting with nervous system injury and disease, including but not limited to, neurodegenerative disorders and spinal injury. Such subjects may include mammals, including but not limited to, humans. Thus, we have discovered novel applications for such miRNAs and resulting induced MSCs which, among other possible uses, can reduce or alleviate the effects of certain nervous system injuries or diseases in mammals.

[0012] Without limitation, some embodiments of the invention comprise methods, systems, and/or compositions for inducing neuronal differentiation of MSCs through the use and expression of miRNA-124, miRNA-137, and/or miRNA-9*. MSCs are mesoderm-derived cells that typically reside in adult bone marrow, typically at very low concentration (about 1 in 10,000 nucleated cells). MSCs can differentiate to generate cells such as bone marrow stroma, blood vessels, fat, bone and cartilage. These cells may also have the potential to differentiate into neurons\ or glia-like cells depending on the environmental signals. Moreover, these cells may be further induced to express or maintained specific neuronal or glial phenotypes by incubation with different combinations of growth factors and hormones.

[0013] MSCs have been shown to exert therapeutic effects in a variety of neurological diseases and dysfunctions in experimental animal models and more recently in pilot clinical trials. Their effects have been mainly attributed to immunosuppressive and neuroprotective functions. In experimental autoimmune encephalitis ("EAE"), an animal model of multiple sclerosis ("MS"), treatment of mice with bone marrow derived MSCs resulted in significant suppression of disease manifestations. Some studies demonstrated that in addition to down regulation of autoimmunity neural differentiation of these cells increased their therapeutic effect in various instances such as the ischemic brain.

[0014] In our work, we tested the effect of three neuronal-associated miRNAs, miRNA-124, miRNA-137, and miRNA-9*, on the differentiation of human MSCs. These miRNAs are not normally expressed in MSCs. We discovered that the expression of miRNA-124, miRNA137, or miRNA-9* induced neuronal differentiation of MSCs, as indicated by the morphology of the cells and by the increased expression of .beta.III-tubulin and MAP2. miRNA-124, miRNA-137 and miRNA-9* induced an increase in tyrosine hydroxylase, suggesting differentiation of the MSCs to dopaminergic phenotype. One of the targets of pre-miRNA124 is the transcription factor REST that represses a large number of neuronal genes. Our results indicate that neuronal-associated miRNAs may induce long-term neuronal differentiation of MSCs for the use of cell-based therapy in neurodegenerative and neuroinflammatory disorders and spinal injury. One advantage of the use of miRNAs over the existing methods is that one can stably express pre-miRNAs in MSCs that will result in long-term neuronal differentiation, as compared with transient differentiation that is induced by treatment with growth factors. As such, easy access to patient's own bone marrow derived MSCs and the feasibility to enrich and expand MSCs in large numbers indicates that neuronal differentiation of such cells can serve as autologous neuronal stem cells that can be available for treatment of a large number of acquired or congenital neurological disorders associated with lack of or damaged neurons. As one example only without limitation, MSCs can be prepared from fat removed by liposuction and from cord blood or the placenta. Reduced immunogenicity of MSCs may facilitate the use of allogeneic neurons off the shelf or from matched or partially mismatched family member for treatment of conditions caused, as nonlimiting examples only, by congenital deficiencies of essential enzymes or other essential products.

[0015] Without limitation to only embodiments expressly disclosed herein, and without disclaiming any embodiments, some embodiments of the invention comprise:

[0016] 1. the neuronal differentiation of MSCs through culture or other exposure to miRNAs, including but not limited to, miRNA124 and/or miRNA 137, and/or miRNA 9*.

[0017] 2. transfection of MSCs with such miRNAs;

[0018] 3. administration of MSCs induced in vitro into neuronal differentiation to a subject suffering from nervous system injury or disease; and/or

[0019] 4. administration of MSCs transfected with such miRNAs to a subject suffering from nervous system injury or disease.

[0020] In some embodiments, without limitation, with reproducible transdifferentiation of MSCs to neurons, the therapeutic use of MSCs can be obtained and expanded, whether in vitro or in vivo, to include, as some examples only, treatment of cerebrovascular disease, spinal cord injury, treatment of neurodegenerative disorders such as amyotrophic lateral sclerosis ("ALS"), multiple sclerosis ("MS"), and related motor neuron diseases. Ongoing clinical studies already indicate that infusion of MSCs intrathecally and intravenously can improve partially the clinical manifestation of the disease in patients with MS and to a lesser extent in patients with ALS. Such clinical studies provide evidence that both intrathecal and intravenous infusions of MSCs are safe procedures since none of the treated patients has developed any severe side effect. Thus, cell therapy with MSCs represents prophetically an important approach for the treatment of a large number of neurological disorders, especially where MSCs can be induced into neurons or oligodendrocytes and/or secrete factors that can induce neurogenesis of locally residing stem cells.

Examples

[0021] The following examples of some embodiments of the invention are provided without limiting the invention to only those embodiments described herein and without disclaiming any embodiments.

[0022] microRNAs

[0023] microRNAs ("miRNAs") represent a family of endogenous, small (as some nonlimited examples, 19-23 nucleotides) non-coding RNAs that function through the RNA interference ("RNAi") pathway to effect post-transcriptional gene silencing. miRNAs target the mRNAs of specific genes based on complementarity, and mediate either mRNA cleavage (perfect complementarity) or translation repression (partial complementarity). miRNAs have been demonstrated to play important roles in development and may function as fundamental genetic regulatory elements that serve to establish or maintain specific expression profiles determining cell fate.

[0024] Manipulating neuronal differentiation of MSCs may involve regulatory pathways that orchestrate the program of gene expression during the differentiation process. Differentiation often requires shifts in the mRNA and protein constitution of cells. One class of gene regulatory molecules are the microRNAs, a subclass of small RNAs, that are thought to use the elements of the RNA-interference pathway to post transcriptionally down-regulate the expression of protein-coding genes. miRNAs may play an important role in cell differentiation since they are predicted to individually regulate hundreds of target genes simultaneously.

[0025] Methods

[0026] To determine the effect of miRNA-124, miRNA-137, and miRNA-9* on the differentiation of MSCs, we employed three different preparations of these cells in passages 4-12. MSC cells were plated in DMEM+10% FCS for 24 hr and were then transfected with double-stranded RNA oligonucleotides of the mature sequence of the three miRNAs and with a negative control oligonucleotide. The miRNAs used were as follows:

TABLE-US-00001 Dharmacon mimic products: MI0000443/MIMAT0000422-Human Selected Precursor/Mature Mature: hsa-miR-124 [MIMAT0000422] Precursor: hsa-miR-124-1 [MI0000443] Organism: Human Mature Sequence: (SEQ ID NO. 1) UAAGGCACGCGGUGAAUGCC MI0000454/MIMAT0000429-Human Selected Precursor/Mature Mature: hsa-miR-137 [MIMAT0000429] Precursor: hsa-miR-137 [MI0000454] Organism: Human Mature Sequence: (SEQ ID NO. 2) UUAUUGCUUAAGAAUACGCGUAG miRNA 9* sequence: (SEQ ID NO. 3) AUAAAGCUAGAUAACCGAAAGU miRNA 9 mimic: (SEQ ID NO. 4) UCUUUGGUUAUCUAGCUGUAUGA

[0027] Following 3 days, cells were transferred to Neurobasal Medium (NB) supplemented with B27. Cell morphology was monitored every 24 hr and analysis of neuronal markers by either immunofluorescence staining, Western blot analysis or real-time PCR was performed following 5, 7 and 9 days post-transfection. As a positive control for the induction of neuronal differentiation, we used cells stimulated with combination of Shh, FGF8 and bFGF.

[0028] Results

[0029] miRNA-124, miRNA-137, and miRNA-9* promote neuronal differentiation of MSCs. The pictures of FIG. 1 are representative of six separate experiments that gave similar results. As presented in FIG. 1, transfection of the cells with miRNA-137, miRNA-124 or miRNA-9* decreased cell proliferation and induced morphological differentiation in the cells already after 72 hr of transfection. Transfection of the MSCs with miRNA-137 induced rapid and robust morphological changes and the cells acquired a typical neuronal phenotype with compact cell bodies and elongated processes with varicosities. miRNA-124-transfected cells exhibited a strong decrease in cell proliferation followed by the generation of a number of cell types; elongated cells with long processes, small cells with multiple shorter processes and flat star-like cells. Cells transfected with the control miRNA resembled the control untreated cells. Interestingly, the effect of miRNA-137 was more rapid and stronger than that of the GF. About 90% of the miRNA-137 transfected cells exhibited neuronal morphology.

[0030] miRNA-124, miRNA-137, and miRNA-9* increase the expression of neuronal markers in MSCs. To further examine the effect of miRNA-124, miRNA-137 and miRNA-9* on neuronal differentiation, we examined the expression of the neural stem cell marker, nestin, the astrocytic marker GFAP and the neuronal markers beta III-tubulin and tyrosine hydroxylase. Cells were transfected with the appropriate miRNA or treated with DMEM or with neurobasal medium+B27. Following 5 days, the expression of nestin mRNA was determined using real-time PCR and the expression of nestin, GFAP, beta III-tubulin and tyrosine hydroxylase was examined after 9 days of treatment by Western blot analysis. The results represent five different experiments that gave similar results. FIG. 2 shows that after 5 days of transfection, there was a large increase in nestin mRNA as determined by real-time PCR. In contrast, after 9 days of transfection with the different miRNAs we found an increase in the expression of beta III-tubulin, whereas no expression of nestin or GFAP was observed. In addition, we found that miRNA-137 and miRNA-9* induced a large increase in the expression of tyrosine hydroxylase, whereas a smaller increase was observed in miRNA-124 transfected cells. The expression of all these markers in the control miRNA transfected cells was absent or negligible.

[0031] miR-9* induced the dopaminergic marker, tyrosine hydroxylase, in MSCs. FIG. 3 shows Western Blot results following MSC transfection with the appropriate miRNAs or treatment with DMEM. Following 9 days, the expression tyrosine hydroxylase was examined by Western blot analysis. The results represent five different experiments that gave similar results. miRNA-9* induced the dopaminergic marker, tyrosine hydroxylase, in MSCs.

[0032] Our results demonstrate that miRNA-124, miRNA-137 and miRNA-9* induce neuronal differentiation of MSCs, albeit to respectively different degrees in our test model. miRNA-137 induces a more rapid and robust effect resulting in a homogenous population of neuronal cells. The high level of tyrosine hydroxylase expressed in these cells suggests that these cells display a dopaminergic phenotype.

[0033] miRNA-124 also induces neuronal differentiation as determined by the high level of .beta.III-tubulin compared to the control miRNA-treated cells. In our work, this treatment resulted in a mixed population of cells which expressed lower level of tyrosine hydroxylase. None of the treatments induced astrocytic differentiation as determined by the lack of GFAP expression.

[0034] Moreover, following 5 days of treatment, both miRNAs induced a large transient increase in nestin expression, indicating generation of neural stem cell-like or neuronal progenitor-like cells. A controlled differentiation of MSCs to NSC or NPC-like cells may be further exploited to differentiate these cells to different neuronal lineages or to neurons with different phenotypes using specific transcription factors or specific combination of growth factors.

[0035] miRNA-124 and miRNA-9* have been reported to be involved in neuronal differentiation and neurite outgrowth. Similarly, there is one report demonstrating the effect of miRNA137 on neuronal differentiation of glioma stem cells and NSCs. However, no effects of miRNAs have been reported on the neuronal differentiation of MSCs and no effect of miRNA124 and miRNA137 has been shown on the generation of neurons with a specific phenotype. Moreover, none of these miRNAs has been reported to induce cells with a NSC/NPC phenotype.

[0036] miRNA-124 and miRNA-137 induced neuronal differentiation in the Adipose and cord derived MSCs. Adipose and cord derived MSCs were transfected with control miRNA, miRNA-124 and miRNA-137 similar to the bone marrow MSCs (FIG. 4).

[0037] Preparation of adipose-derived MSCs: Adipose-derived MSCs were obtained from liposuction from the thighs or abdominal walls. 100-200 ml aspirates were processed in a special designed Cytori separator that separates the MSCs from the fats cells and debris. The cells were further processed and maintained as described for the bone-marrow derived MSCs.

[0038] Preparation of human umbilical (cord) MSCs: Fresh human umbilical cords were obtained after birth (with parental consent) and collected in DMEM at 4.degree. C. The umbilical cord vessels were removed and the mesenchymal tissue (Wharton's jelly) was minced into small pieces. Following centrifugation, at 250.times.g for 5 min the tissue was washed with serum-free DMEM was treated with collagenase at 37.degree. C. for 18 h followed by digestion with 2.5% trypsin at 37.degree. C. for 30 min. The dissociated MSCs were further dispersed and maintained in conditions similar to those described for bone marrow-derived MSCs.

[0039] After 12 days, mRNA was extracted and the levels of b3-tubulin and the house keeping gene S12 were determined using real-time PCR.

[0040] Our results (FIG. 4) demonstrate that miRNA-124 and miRNA-137 induce neuronal differentiation not only in bone-marrow derived MSCs but also in adipose-tissue and cord blood-derived cells. The neuronal marker beta III tubulin was induced in these cells following miRNA treatment. Each of these cell sources has its own advantages. Bone-marrow derived MSCs are very well characterized and have been used for over 20 years successfully with no oncogenic potential. Adipose-derived MSCs are less characterized but can be obtained in larger numbers and cord blood cells can be easily obtained in a non-invasive manner they do not require complete genetic compatibility between the donor and the patient and therefore are more accessible.

[0041] Construction of a plasmid containing pre-miRNA and GDNF. Since GDNF has been implicated in the survival of dopaminergic neurons, we constructed plasmids that co-express pre-miRNA-124 or pre-miRNA-137 together with GDNF under separate promoters.

[0042] Without limitation to only embodiments described herein, and without disclaiming any embodiments, steps for sequence and procedure of cloning the pre-miRNA GDNF vectors and that of the miRNAs are described with respect to step by step cloning of GDNF into premir vectors (CD-511_1 or PCDH-CMV-MCS-EF1-copGFP from System Biosciences).

[0043] cDNA of Homo sapiens glial cell derived neurotrophic factor ("GDNF") template was obtained from Origene. For cloning GDNF into premir 124 and 137 vectors (System Biosciences), primers with Xho1 and Sal1 restriction enzyme digestion sites for GDNF ORF were designed as follows:

TABLE-US-00002 Forward: (SEQ ID NO. 5) cacc ctcgag(XhoI) atg aag tta tgg gat gtc gtg gct gtc tgc Reverse: (SEQ ID NO. 6) aaa gtcgac(SalI) tca gat aca tcc aca cct ttt agc gga atg

[0044] After PCR, the GDNF DNA product was cleaned, then digested with Xho1 and Sal1, and the DNA was cleaned again, resulting in DNA of GDNF now ready for cloning.

[0045] Xho1 restriction site was added into the vector of premir 124 and premir 137 by using primers:

TABLE-US-00003 Forward: (SEQ ID NO. 7) gac gcc acc atg gag agc ctc gag (XhoI) agc ggc ctg ccc gcc Reverse: (SEQ ID NO. 8) ggc ggg cag gcc gct ctc gag (XhoI) gct ctc cat ggt ggc gtc

[0046] The GFP gene was removed from premir 124 and 137 vector by using restriction enzymes Xho1 and Sal1, then the vector was cleaned.

[0047] Ligation of GDNF and premir 124 and 137 vectors. The ligated plasmids were transformed into One shot Top10 chemical competent cell. Plasmids with premir 124 and 137 were selected by culturing the clones, following by processing with mini prep.

[0048] The plasmids were digested by using Xho1 and Sal1 to detect the insert of GDNF. The plasmids were then sequenced. The sequence of miR-124 and 137 and the backbone of the premir vector:

TABLE-US-00004 MiR-124: (SEQ ID NO. 9) GAACAAAGAGCCTTTGGAAGACGTCGCTGTTATCTCATTGTCTGTG TGATTGGGGGAGCTGCGGCGGGGAGGATGCTGTGGTCCCTTCCTCCGGCG TTCCCCACCCCCATCCCTCTCCCCGCTGTCAGTGCGCACGCACACGCGCC GCTTTTTATTTCTTTTTCCTGGTTTTCTTATTCCATCTTCTACCCACCCC TCTTCCTTTCTTTCACCTTTCCTTCCTTCCTTCCTCCTTTCCTTCCTCAG GAGAAAGGCCTCTCTCTCCGTGTTCACAGCGGACCTTGATTTAAATGTCC ATACAATTAAGGCACGCGGTGAATGCCAAGAATGGGGCTGGCTGAGCACC GTGGGTCGGCGAGGGCCCGCCAAGGAAGGAGCGACCGACCGAGCCAGGCG CCCTCCGCAGACCTCCGCGCAGCGGCCGCGGGCGCGAGGGGAGGGGTCTG GAGCTCCCTCCGGCTGCCTGTCCCGCACCGGAGCCCGTGGGGTGGGGAGG TGTGCAGCCTGTGACAGACAGGGGCTTAGAGATGC MiR-137: (SEQ ID NO. 10) CAGCACTCTTCTGTGTTAAGTATTTGATTTTGTGATTTGTCTTTCAG AATTGGAAATAGAGCGGCCATTTGGATTTGGGCAGGAAGCAGCCGAGCAC AGCTTTGGATCCTTCTTTAGGGAAATCGAGTTATGGATTTATGGTCCCGG TCAAGCTCAGCCCATCCCCAGGCAGGGGCGGGCTCAGCGAGCAGCAAGAG TTCTGGTGGCGGCGGCGGCGGCAGTAGCAGCGGCAGCGGTAGCAGCGGCA GCGGTAGCAGCGGCAGCGGCAGCTTGGTCCTCTGACTCTCTTCGGTGACG GGTATTCTTGGGTGGATAATACGGATTACGTTGTTATTGCTTAAGAATAC GCGTAGTCGAGGAGAGTACCAGCGGCAGGGGGGCAGCGGCCGCCCTCCCC AGCCCACCAGCTGGCCACTAAACGCCCGTGGTTGCCAAGGTAGCACTTTC TTGTTCTTTTCATTTCCTCGGGTGTTTTCGCACTGGTTCCACCGGAAAGG CTGTGCGCTGCGCCTCTGGTGACCAGGACTGGA

[0049] The sequence of backbone vector (CD-511_1) was attached:

[0050] LOCUS CD511B_1_pCDH_CMV_7544 bp ds-DNA circular 16 Dec. 2008:

TABLE-US-00005 DEFINITION ACCESSION VERSION SOURCE ORGANISM COMMENT COMMENT ApEinfo:methylated:1 FEATURES Location/Qualifiers misc_feature 2315..2764 /label=EF1 promoter /ApEinfo_fwdcolor=cyan /ApEinfo_revcolor=green misc_feature 2765..2789 /label=EF1 promoter(1) /ApEinfo_label=EF1 promoter /ApEinfo_fwdcolor=cyan /ApEinfo_revcolor=green misc_feature 2874..3629 /label=copGFP /ApEinfo_fwdcolor=#00ff00 /ApEinfo_revcolor=green misc_feature 3639..4229 /label=WPRE /ApEinfo_fwdcolor=cyan /ApEinfo_revcolor=green misc_feature 2790..2860 /label=EF1 promoter(2) /ApEinfo_label=EF1 promoter /ApEinfo_fwdcolor=cyan /ApEinfo_revcolor=green misc_feature 2765..2789 /label=EFfwd primer /ApEinfo_fwdcolor=#ff80ff /ApEinfo_revcolor=green misc_feature 1922..2183 /label=CMV /ApEinfo_fwdcolor=#ff80ff /ApEinfo_revcolor=green misc_feature 2272..2314 /label=MCS /ApEinfo_fwdcolor=#80ff00 /ApEinfo_revcolor=green misc_feature 2205..2271 /label=CMV(1) /ApEinfo_label=CMV /ApEinfo_fwdcolor=#ff80ff /ApEinfo_revcolor=green misc_feature 2184..2204 /label=DAB 90 primer forward /ApEinfo_fwdcolor=cyan /ApEinfo_revcolor=green ORIGIN 1 acgcgtgtag tcttatgcaa tactcttgta gtcttgcaac atggtaacga tgagttagca 61 acatgcctta caaggagaga aaaagcaccg tgcatgccga ttggtggaag taaggtggta 121 cgatcgtgcc ttattaggaa ggcaacagac gggtctgaca tggattggac gaaccactga 181 attgccgcat tgcagagata ttgtatttaa gtgcctagct cgatacaata aacgggtctc 241 tctggttaga ccagatctga gcctgggagc tctctggcta actagggaac ccactgctta 301 agcctcaata aagcttgcct tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact 361 ctggtaacta gagatccctc agaccctttt agtcagtgtg gaaaatctct agcagtggcg 421 cccgaacagg gacctgaaag cgaaagggaa accagagctc tctcgacgca ggactcggct 481 tgctgaagcg cgcacggcaa gaggcgaggg gcggcgactg gtgagtacgc caaaaatttt 541 gactagcgga ggctagaagg agagagatgg gtgcgagagc gtcagtatta agcgggggag 601 aattagatcg cgatgggaaa aaattcggtt aaggccaggg ggaaagaaaa aatataaatt 661 aaaacatata gtatgggcaa gcagggagct agaacgattc gcagttaatc ctggcctgtt 721 agaaacatca gaaggctgta gacaaatact gggacagcta caaccatccc ttcagacagg 781 atcagaagaa cttagatcat tatataatac agtagcaacc ctctattgtg tgcatcaaag 841 gatagagata aaagacacca aggaagcttt agacaagata gaggaagagc aaaacaaaag 901 taagaccacc gcacagcaag cggccactga tcttcagacc tggaggagga gatatgaggg 961 acaattggag aagtgaatta tataaatata aagtagtaaa aattgaacca ttaggagtag 1021 cacccaccaa ggcaaagaga agagtggtgc agagagaaaa aagagcagtg ggaataggag 1081 ctttgttcct tgggttcttg ggagcagcag gaagcactat gggcgcagcc tcaatgacgc 1141 tgacggtaca ggccagacaa ttattgtctg gtatagtgca gcagcagaac aatttgctga 1201 gggctattga ggcgcaacag catctgttgc aactcacagt ctggggcatc aagcagctcc 1261 aggcaagaat cctggctgtg gaaagatacc taaaggatca acagctcctg gggatttggg 1321 gttgctctgg aaaactcatt tgcaccactg ctgtgccttg gaatgctagt tggagtaata 1381 aatctctgga acagattgga atcacacgac ctggatggag tgggacagag aaattaacaa 1441 ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga 1501 acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa 1561 ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat 1621 agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt 1681 tcagacccac ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg 1741 tggagagaga gacagagaca gatccattcg attagtgaac ggatctcgac ggttaacttt 1801 taaaagaaaa ggggggattg gggggtacag tgcaggggaa agaatagtag acataatagc 1861 aacagacata caaactaaag aattacaaaa acaaattaca aaaattcaaa attttatcga 1921 tactagtatt atgcccagta catgacctta tgggactttc ctacttggca gtacatctac 1981 gtattagtca tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga 2041 tagcggtttg actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg 2101 ttttggcacc aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg 2161 caaatgggcg gtaggcgtgt acggtgggag gtctatataa gcagagctcg tttagtgaac 2221 cgtcagatcg cctggagacg ccatccacgc tgttttgacc tccatagaag attctagagc 2281 tagcgaattc gaatttaaat ggatccgcgg ccgcaaggat ctgcgatcgc tccggtgccc 2341 gtcagtgggc agagcgcaca tcgcccacag tccccgagaa gttgggggga ggggtcggca 2401 attgaacggg tgcctagaga aggtggcgcg gggtaaactg ggaaagtgat gtcgtgtact 2461 ggctccgcct ttttcccgag ggtgggggag aaccgtatat aagtgcagta gtcgccgtga 2521 acgttctttt tcgcaacggg tttgccgcca gaacacagct gaagcttcga ggggctcgca 2581 tctctccttc acgcgcccgc cgccctacct gaggccgcca tccacgccgg ttgagtcgcg 2641 ttctgccgcc tcccgcctgt ggtgcctcct gaactgcgtc cgccgtctag gtaagtttaa 2701 agctcaggtc gagaccgggc ctttgtccgg cgctcccttg gagcctacct agactcagcc 2761 ggctctccac gctttgcctg accctgcttg ctcaactcta cgtctttgtt tcgttttctg 2821 ttctgcgccg ttacagatcc aagctgtgac cggcgcctac gctagacgcc accatggaga 2881 gcgacgagag cggcctgccc gccatggaga tcgagtgccg catcaccggc accctgaacg 2941 gcgtggagtt cgagctggtg ggcggcggag agggcacccc caagcagggc cgcatgacca 3001 acaagatgaa gagcaccaaa ggcgccctga ccttcagccc ctacctgctg agccacgtga 3061 tgggctacgg cttctaccac ttcggcacct accccagcgg ctacgagaac cccttcctgc 3121 acgccatcaa caacggcggc tacaccaaca cccgcatcga gaagtacgag gacggcggcg 3181 tgctgcacgt gagcttcagc taccgctacg aggccggccg cgtgatcggc gacttcaagg 3241 tggtgggcac cggcttcccc gaggacagcg tgatcttcac cgacaagatc atccgcagca 3301 acgccaccgt ggagcacctg caccccatgg gcgataacgt gctggtgggc agcttcgccc 3361 gcaccttcag cctgcgcgac ggcggctact acagcttcgt ggtggacagc cacatgcact 3421 tcaagagcgc catccacccc agcatcctgc agaacggggg ccccatgttc gccttccgcc 3481 gcgtggagga gctgcacagc aacaccgagc tgggcatcgt ggagtaccag cacgccttca 3541 agacccccat cgccttcgcc agatcccgcg ctcagtcgtc caattctgcc gtggacggca 3601 ccgccggacc cggctccacc ggatctcgct aagtcgacaa tcaacctctg gattacaaaa 3661 tttgtgaaag attgactggt attcttaact atgttgctcc ttttacgcta tgtggatacg 3721 ctgctttaat gcctttgtat catgctattg cttcccgtat ggctttcatt ttctcctcct 3781 tgtataaatc ctggttgctg tctctttatg aggagttgtg gcccgttgtc aggcaacgtg 3841 gcgtggtgtg cactgtgttt gctgacgcaa cccccactgg ttggggcatt gccaccacct 3901 gtcagctcct ttccgggact ttcgctttcc ccctccctat tgccacggcg gaactcatcg 3961 ccgcctgcct tgcccgctgc tggacagggg ctcggctgtt gggcactgac aattccgtgg 4021 tgttgtcggg gaaatcatcg tcctttcctt ggctgctcgc ctgtgttgcc acctggattc 4081 tgcgcgggac gtccttctgc tacgtccctt cggccctcaa tccagcggac cttccttccc 4141 gcggcctgct gccggctctg cggcctcttc cgcgtcttcg ccttcgccct cagacgagtc 4201 ggatctccct ttgggccgcc tccccgcctg gtacctttaa gaccaatgac ttacaaggca 4261 gctgtagatc ttagccactt tttaaaagaa aaggggggac tggaagggct aattcactcc 4321 caacgaaaat aagatctgct ttttgcttgt actgggtctc tctggttaga ccagatctga 4381 gcctgggagc tctctggcta actagggaac ccactgctta agcctcaata aagcttgcct 4441 tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact ctggtaacta gagatccctc 4501 agaccctttt agtcagtgtg gaaaatctct agcagtagta gttcatgtca tcttattatt 4561 cagtatttat aacttgcaaa gaaatgaata tcagagagtg agaggaactt gtttattgca 4621 gcttataatg gttacaaata aagcaatagc atcacaaatt tcacaaataa agcatttttt 4681 tcactgcatt ctagttgtgg tttgtccaaa ctcatcaatg tatcttatca tgtctggctc 4741 tagctatccc gcccctaact ccgcccagtt ccgcccattc tccgccccat ggctgactaa 4801 ttttttttat ttatgcagag gccgaggccg cctcggcctc tgagctattc cagaagtagt 4861 gaggaggctt ttttggaggc ctagactttt gcagagacgg cccaaattcg taatcatggt 4921 catagctgtt tcctgtgtga aattgttatc cgctcacaat tccacacaac atacgagccg 4981 gaagcataaa gtgtaaagcc tggggtgcct aatgagtgag ctaactcaca ttaattgcgt 5041 tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat taatgaatcg 5101 gccaacgcgc ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc tcgctcactg 5161 actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca aaggcggtaa 5221 tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca aaaggccagc 5281 aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc 5341 ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat

5401 aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc 5461 cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcatagct 5521 cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg 5581 aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc 5641 cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga 5701 ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa 5761 ggacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta 5821 gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc 5881 agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg 5941 acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta tcaaaaagga 6001 tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatatg 6061 agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct 6121 gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg 6181 agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc tcaccggctc 6241 cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa 6301 ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc 6361 cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg tcacgctcgt 6421 cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt acatgatccc 6481 ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt 6541 tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt actgtcatgc 6601 catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt 6661 gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc gcgccacata 6721 gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa ctctcaagga 6781 tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac tgatcttcag 6841 catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa 6901 aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt tttcaatatt 6961 attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa tgtatttaga 7021 aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct gacgtctaag 7081 aaaccattat tatcatgaca ttaacctata aaaataggcg tatcacgagg ccctttcgtc 7141 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 7201 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 7261 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 7321 accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 7381 attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 7441 tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 7501 tttcccagtc acgacgttgt aaaacgacgg ccagtgccaa gctg (SEQ ID NO. 11)

[0051] We found that MSCs transfected with these plasmids secrete GDNF and express the respective miRNAs. Thus, the GDNF secreted by the differentiated dopaminergic neurons is expected to provide survival signals to the differentiated cells and to endogenous dopaminergic neurons.

[0052] Construction of inducible miRNAs. Implanted MSCs have been reported to migrate to damaged tissues in the central nervous systems and to exert neurotrophic and immunomodulatory effects. Specifically, in Parkinson's animal models, implanted MSCs have been shown to engraft in the lesioned striatum. In some embodiments, without limitation, inducible pre-miRNA expression vectors might be used that will allow the induction of the specific pre-miRNA expression at desired time points. Thus, MSCs would be transfected with the specific pre-miRNA and its expression would be induced at different time points prior or following the engraftment of the MSCs in the lesioned striatum. For such studies we have employed the inducible miRNA and living color, fluorescent protein reporters using the Tet-on system (Clontech). This system allows the induction of the specific miRNA by the addition of a promoter, as one example, only, by doxycyline, and the identification of cells in which the miRNA is produced.

[0053] In summary, we have demonstrated the ability of miRNA124, miRNA137 and miRNA-9* to induce transdifferentiation of MSCs to NSC/NPC and neurons with a specific neuronal phenotype (miRNA137). Additional neuronal miRNAs such as miRNA-9 and miR218 may also effect transdifferentiation of MSCs and induce neuronal differentiation.

[0054] An advantage of using miRNAs over the existing methods is that one can stably express pre-miRNAs in the MSCs which will result in long-term neuronal differentiation as compared with transient differentiation that is induced by treatment with growth factors.

[0055] Our work indicates that neuronal-associated miRNAs may be employed to induce long-term neuronal differentiation of MSCs for the use of cell-based therapy in neurodegenerative disorders and spinal injury, as some examples only, as shown by:

[0056] 1. Neuronal differentiation of MSCs by microRNAs (miRNA-124, miRNA-137, miRNA-9*);

[0057] 2. Specific dopaminergic differentiation of MSCs by miRNA-137, miRNA-124 and miRNA-9*; and

[0058] 3. Induction by microRNAs of transient differentiation of MSCs to neural stem cell like- or neural progenitor-like cells. Transfection with the miRNAs provides a window of opportunity where cells can be differentiated to the different lineages of the central nervous system (neurons, astrocytes and oligodendrocytes) or to a specific neuronal phenotype using transcription factors or a specific combination of growth factors. This window can be controlled by level of miRNA expression or by a specific time point post-transfection.

[0059] The ability of miRNAs to transdifferentiate MSCs to uncommitted progenitor cells and to different neuronal cell subsets makes it possible to use these cells for treatment of a large variety of neurological diseases, including spinal cord and peripheral nerve injuries, damage to the central nervous system caused by hemorrhage or obstructive lesions ("CVA") or to traumatic central or peripheral nerve injury. In addition, transdifferentiated MSCs may be employed in the case of neurodegenerative diseases caused by idiopathic autoimmune diseases ("EAE") or diseases such as Parkinson's disease or Alzheimer/s disease or diseases with unknown etiology such as ALS. Moreover, improvement of neurological functions by transdifferentiated MSCs may also be used in various degenerative disorders caused by drug-induced neuronal damage and/or toxicity.

[0060] Thus, in our work, miRNA-124, miRNA-137 and miRNA-9* promote neural differentiation of MSC's, with accompanying morphological changes and expression of phenotypic markers.

[0061] The inducing miRNA(s) of some embodiments would be administered and dosed in accordance with good medical practice, taking into account the techniques of use to accomplish the desired effect of target MSCs, the clinical condition of the individual patient, the site and method of administration, scheduling of administration, patient age, sex, body weight and other factors known to medical practitioners. The "pharmaceutically effective amount" for purposes herein is thus determined by such considerations as are known in the art. The amount must be effective to achieve improvement, including but not limited to, the desired differentiation of MSCs in vivo and/or in vitro, decreased damage or injury, or improvement or elimination of symptoms and other indicators as are selected as appropriate measures by those skilled in the art.

[0062] Embodiments of the invention may expand the therapeutic window for treatment of nervous system injury and diseases and could be applied to treatment of a large patient population which suffers such injury and diseases each year in the United States. Thus, in some embodiments, the invention comprises novel methods to prevent, control, or alleviate mammalian nervous system injury and disease, including without limitation, brain damage, neural degeneration, or spinal cord injury, through the selective application of inducing miRNAs comprising embodiments of the invention. In accordance with some embodiments, without limitation, one may effect such therapeutic intervention through the use and/or administration of one or more such miRNAs to induce differentiation in target cells in vivo or in vitro for use in treatment to limit the effects of such injury or disease. Thus, without limitation and without disclaimer of subject matter, some embodiments comprise novel compositions and methods to prevent, control, or alleviate mammalian injury, including without limitation, brain damage, through the selective application and/or induction of transdifferentiated MSCs.

[0063] This application may reference various publications by author, citation, and/or by patent number, including without limitation, articles, presentations, and United States patents. The disclosures of each of any such references in their entireties are hereby incorporated by reference into this application.

[0064] While the present invention has been particularly shown and described with reference to the foregoing preferred and alternative embodiments, it should be understood by those skilled in the art that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention without departing from the spirit and scope of the invention as defined in the following claims. It is intended that the following claims define the scope of the invention and that the method and apparatus within the scope of these claims and their equivalents be covered thereby. This description of the invention should be understood to include all novel and non-obvious combinations of elements described herein, and claims may be presented in this or a later application to any novel and non-obvious combination of these elements. The foregoing embodiments are illustrative, and no single feature or element is essential to all possible combinations that may be claimed in this or a later application. Where the claims recite "a" or "a first" element of the equivalent thereof, such claims should be understood to include incorporation of one or more such elements, neither requiring nor excluding two or more such elements.

Sequence CWU 1

1

11120RNAHomo sapiens 1uaaggcacgc ggugaaugcc 20223RNAHomo sapiens 2uuauugcuua agaauacgcg uag 23322RNAHomo sapiens 3auaaagcuag auaaccgaaa gu 22423RNAArtificial sequencemiRNA 9 mimic 4ucuuugguua ucuagcugua uga 23540DNAArtificial sequencePCR primermisc_feature(5)..(10)Xho1 restriction site 5caccctcgag atgaagttat gggatgtcgt ggctgtctgc 40640DNAArtificial sequencePCR primermisc_feature(4)..(9)Sal1 restriction site 6aaagtcgaca tcagatacat ccacaccttt tagcggaatg 40739DNAArtificial sequencePCR primermisc_feature(19)..(24)Xho1 restriction site 7gacgccacca tggagagcct cgagagcggc ctgcccgcc 39839DNAArtificial sequencePCR primermisc_feature(16)..(21)Xho1 restriction site 8ggcgggcagg ccgctctcga ggctctccat ggtggcgtc 399531DNAArtificial sequenceRecombinant miR-124 9gaacaaagag cctttggaag acgtcgctgt tatctcattg tctgtgtgat tgggggagct 60gcggcgggga ggatgctgtg gtcccttcct ccggcgttcc ccacccccat ccctctcccc 120gctgtcagtg cgcacgcaca cgcgccgctt tttatttctt tttcctggtt ttcttattcc 180atcttctacc cacccctctt cctttctttc acctttcctt ccttccttcc tcctttcctt 240cctcaggaga aaggcctctc tctccgtgtt cacagcggac cttgatttaa atgtccatac 300aattaaggca cgcggtgaat gccaagaatg gggctggctg agcaccgtgg gtcggcgagg 360gcccgccaag gaaggagcga ccgaccgagc caggcgccct ccgcagacct ccgcgcagcg 420gccgcgggcg cgaggggagg ggtctggagc tccctccggc tgcctgtccc gcaccggagc 480ccgtggggtg gggaggtgtg cagcctgtga cagacagggg cttagagatg c 53110530DNAArtificial sequenceRecombinant miR-137 10cagcactctt ctgtgttaag tatttgattt tgtgatttgt ctttcagaat tggaaataga 60gcggccattt ggatttgggc aggaagcagc cgagcacagc tttggatcct tctttaggga 120aatcgagtta tggatttatg gtcccggtca agctcagccc atccccaggc aggggcgggc 180tcagcgagca gcaagagttc tggtggcggc ggcggcggca gtagcagcgg cagcggtagc 240agcggcagcg gtagcagcgg cagcggcagc ttggtcctct gactctcttc ggtgacgggt 300attcttgggt ggataatacg gattacgttg ttattgctta agaatacgcg tagtcgagga 360gagtaccagc ggcagggggg cagcggccgc cctccccagc ccaccagctg gccactaaac 420gcccgtggtt gccaaggtag cactttcttg ttcttttcat ttcctcgggt gttttcgcac 480tggttccacc ggaaaggctg tgcgctgcgc ctctggtgac caggactgga 530117544DNAArtificial sequenceCD-511_1 vector DNA 11acgcgtgtag tcttatgcaa tactcttgta gtcttgcaac atggtaacga tgagttagca 60acatgcctta caaggagaga aaaagcaccg tgcatgccga ttggtggaag taaggtggta 120cgatcgtgcc ttattaggaa ggcaacagac gggtctgaca tggattggac gaaccactga 180attgccgcat tgcagagata ttgtatttaa gtgcctagct cgatacaata aacgggtctc 240tctggttaga ccagatctga gcctgggagc tctctggcta actagggaac ccactgctta 300agcctcaata aagcttgcct tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact 360ctggtaacta gagatccctc agaccctttt agtcagtgtg gaaaatctct agcagtggcg 420cccgaacagg gacctgaaag cgaaagggaa accagagctc tctcgacgca ggactcggct 480tgctgaagcg cgcacggcaa gaggcgaggg gcggcgactg gtgagtacgc caaaaatttt 540gactagcgga ggctagaagg agagagatgg gtgcgagagc gtcagtatta agcgggggag 600aattagatcg cgatgggaaa aaattcggtt aaggccaggg ggaaagaaaa aatataaatt 660aaaacatata gtatgggcaa gcagggagct agaacgattc gcagttaatc ctggcctgtt 720agaaacatca gaaggctgta gacaaatact gggacagcta caaccatccc ttcagacagg 780atcagaagaa cttagatcat tatataatac agtagcaacc ctctattgtg tgcatcaaag 840gatagagata aaagacacca aggaagcttt agacaagata gaggaagagc aaaacaaaag 900taagaccacc gcacagcaag cggccactga tcttcagacc tggaggagga gatatgaggg 960acaattggag aagtgaatta tataaatata aagtagtaaa aattgaacca ttaggagtag 1020cacccaccaa ggcaaagaga agagtggtgc agagagaaaa aagagcagtg ggaataggag 1080ctttgttcct tgggttcttg ggagcagcag gaagcactat gggcgcagcc tcaatgacgc 1140tgacggtaca ggccagacaa ttattgtctg gtatagtgca gcagcagaac aatttgctga 1200gggctattga ggcgcaacag catctgttgc aactcacagt ctggggcatc aagcagctcc 1260aggcaagaat cctggctgtg gaaagatacc taaaggatca acagctcctg gggatttggg 1320gttgctctgg aaaactcatt tgcaccactg ctgtgccttg gaatgctagt tggagtaata 1380aatctctgga acagattgga atcacacgac ctggatggag tgggacagag aaattaacaa 1440ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga 1500acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa 1560ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat 1620agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt 1680tcagacccac ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg 1740tggagagaga gacagagaca gatccattcg attagtgaac ggatctcgac ggttaacttt 1800taaaagaaaa ggggggattg gggggtacag tgcaggggaa agaatagtag acataatagc 1860aacagacata caaactaaag aattacaaaa acaaattaca aaaattcaaa attttatcga 1920tactagtatt atgcccagta catgacctta tgggactttc ctacttggca gtacatctac 1980gtattagtca tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga 2040tagcggtttg actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg 2100ttttggcacc aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg 2160caaatgggcg gtaggcgtgt acggtgggag gtctatataa gcagagctcg tttagtgaac 2220cgtcagatcg cctggagacg ccatccacgc tgttttgacc tccatagaag attctagagc 2280tagcgaattc gaatttaaat ggatccgcgg ccgcaaggat ctgcgatcgc tccggtgccc 2340gtcagtgggc agagcgcaca tcgcccacag tccccgagaa gttgggggga ggggtcggca 2400attgaacggg tgcctagaga aggtggcgcg gggtaaactg ggaaagtgat gtcgtgtact 2460ggctccgcct ttttcccgag ggtgggggag aaccgtatat aagtgcagta gtcgccgtga 2520acgttctttt tcgcaacggg tttgccgcca gaacacagct gaagcttcga ggggctcgca 2580tctctccttc acgcgcccgc cgccctacct gaggccgcca tccacgccgg ttgagtcgcg 2640ttctgccgcc tcccgcctgt ggtgcctcct gaactgcgtc cgccgtctag gtaagtttaa 2700agctcaggtc gagaccgggc ctttgtccgg cgctcccttg gagcctacct agactcagcc 2760ggctctccac gctttgcctg accctgcttg ctcaactcta cgtctttgtt tcgttttctg 2820ttctgcgccg ttacagatcc aagctgtgac cggcgcctac gctagacgcc accatggaga 2880gcgacgagag cggcctgccc gccatggaga tcgagtgccg catcaccggc accctgaacg 2940gcgtggagtt cgagctggtg ggcggcggag agggcacccc caagcagggc cgcatgacca 3000acaagatgaa gagcaccaaa ggcgccctga ccttcagccc ctacctgctg agccacgtga 3060tgggctacgg cttctaccac ttcggcacct accccagcgg ctacgagaac cccttcctgc 3120acgccatcaa caacggcggc tacaccaaca cccgcatcga gaagtacgag gacggcggcg 3180tgctgcacgt gagcttcagc taccgctacg aggccggccg cgtgatcggc gacttcaagg 3240tggtgggcac cggcttcccc gaggacagcg tgatcttcac cgacaagatc atccgcagca 3300acgccaccgt ggagcacctg caccccatgg gcgataacgt gctggtgggc agcttcgccc 3360gcaccttcag cctgcgcgac ggcggctact acagcttcgt ggtggacagc cacatgcact 3420tcaagagcgc catccacccc agcatcctgc agaacggggg ccccatgttc gccttccgcc 3480gcgtggagga gctgcacagc aacaccgagc tgggcatcgt ggagtaccag cacgccttca 3540agacccccat cgccttcgcc agatcccgcg ctcagtcgtc caattctgcc gtggacggca 3600ccgccggacc cggctccacc ggatctcgct aagtcgacaa tcaacctctg gattacaaaa 3660tttgtgaaag attgactggt attcttaact atgttgctcc ttttacgcta tgtggatacg 3720ctgctttaat gcctttgtat catgctattg cttcccgtat ggctttcatt ttctcctcct 3780tgtataaatc ctggttgctg tctctttatg aggagttgtg gcccgttgtc aggcaacgtg 3840gcgtggtgtg cactgtgttt gctgacgcaa cccccactgg ttggggcatt gccaccacct 3900gtcagctcct ttccgggact ttcgctttcc ccctccctat tgccacggcg gaactcatcg 3960ccgcctgcct tgcccgctgc tggacagggg ctcggctgtt gggcactgac aattccgtgg 4020tgttgtcggg gaaatcatcg tcctttcctt ggctgctcgc ctgtgttgcc acctggattc 4080tgcgcgggac gtccttctgc tacgtccctt cggccctcaa tccagcggac cttccttccc 4140gcggcctgct gccggctctg cggcctcttc cgcgtcttcg ccttcgccct cagacgagtc 4200ggatctccct ttgggccgcc tccccgcctg gtacctttaa gaccaatgac ttacaaggca 4260gctgtagatc ttagccactt tttaaaagaa aaggggggac tggaagggct aattcactcc 4320caacgaaaat aagatctgct ttttgcttgt actgggtctc tctggttaga ccagatctga 4380gcctgggagc tctctggcta actagggaac ccactgctta agcctcaata aagcttgcct 4440tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact ctggtaacta gagatccctc 4500agaccctttt agtcagtgtg gaaaatctct agcagtagta gttcatgtca tcttattatt 4560cagtatttat aacttgcaaa gaaatgaata tcagagagtg agaggaactt gtttattgca 4620gcttataatg gttacaaata aagcaatagc atcacaaatt tcacaaataa agcatttttt 4680tcactgcatt ctagttgtgg tttgtccaaa ctcatcaatg tatcttatca tgtctggctc 4740tagctatccc gcccctaact ccgcccagtt ccgcccattc tccgccccat ggctgactaa 4800ttttttttat ttatgcagag gccgaggccg cctcggcctc tgagctattc cagaagtagt 4860gaggaggctt ttttggaggc ctagactttt gcagagacgg cccaaattcg taatcatggt 4920catagctgtt tcctgtgtga aattgttatc cgctcacaat tccacacaac atacgagccg 4980gaagcataaa gtgtaaagcc tggggtgcct aatgagtgag ctaactcaca ttaattgcgt 5040tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat taatgaatcg 5100gccaacgcgc ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc tcgctcactg 5160actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca aaggcggtaa 5220tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca aaaggccagc 5280aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc 5340ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat 5400aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc 5460cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcatagct 5520cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg 5580aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc 5640cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga 5700ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa 5760ggacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta 5820gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc 5880agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg 5940acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta tcaaaaagga 6000tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatatg 6060agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct 6120gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg 6180agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc tcaccggctc 6240cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa 6300ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc 6360cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg tcacgctcgt 6420cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt acatgatccc 6480ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt 6540tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt actgtcatgc 6600catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt 6660gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc gcgccacata 6720gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa ctctcaagga 6780tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac tgatcttcag 6840catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa 6900aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt tttcaatatt 6960attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa tgtatttaga 7020aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct gacgtctaag 7080aaaccattat tatcatgaca ttaacctata aaaataggcg tatcacgagg ccctttcgtc 7140tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 7200cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 7260ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 7320accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 7380attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 7440tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 7500tttcccagtc acgacgttgt aaaacgacgg ccagtgccaa gctg 7544

* * * * *

Patent Diagrams and Documents
D00001
D00002
D00003
D00004
S00001
XML
US20200063135A1 – US 20200063135 A1

uspto.report is an independent third-party trademark research tool that is not affiliated, endorsed, or sponsored by the United States Patent and Trademark Office (USPTO) or any other governmental organization. The information provided by uspto.report is based on publicly available data at the time of writing and is intended for informational purposes only.

While we strive to provide accurate and up-to-date information, we do not guarantee the accuracy, completeness, reliability, or suitability of the information displayed on this site. The use of this site is at your own risk. Any reliance you place on such information is therefore strictly at your own risk.

All official trademark data, including owner information, should be verified by visiting the official USPTO website at www.uspto.gov. This site is not intended to replace professional legal advice and should not be used as a substitute for consulting with a legal professional who is knowledgeable about trademark law.

© 2024 USPTO.report | Privacy Policy | Resources | RSS Feed of Trademarks | Trademark Filings Twitter Feed