U.S. patent application number 16/459689 was filed with the patent office on 2020-02-06 for fabrication of patterned arrays.
The applicant listed for this patent is Centrillion Technology Holdings Corporation. Invention is credited to Jian CAO, Filip CRNOGORAC, Glenn MCGALL, Wei ZHOU.
Application Number | 20200038831 16/459689 |
Document ID | / |
Family ID | 53274288 |
Filed Date | 2020-02-06 |
View All Diagrams
United States Patent
Application |
20200038831 |
Kind Code |
A1 |
ZHOU; Wei ; et al. |
February 6, 2020 |
FABRICATION OF PATTERNED ARRAYS
Abstract
Provided herein are methods and compositions for the fabrication
of patterned arrays, such as nucleotide arrays. The methods and
compositions are suited for the transfer and reorientation of array
components.
Inventors: |
ZHOU; Wei; (Saratoga,
CA) ; CRNOGORAC; Filip; (Redwood City, CA) ;
MCGALL; Glenn; (Palo Alto, CA) ; CAO; Jian;
(San Mateo, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Centrillion Technology Holdings Corporation |
Grand Cayman |
|
KY |
|
|
Family ID: |
53274288 |
Appl. No.: |
16/459689 |
Filed: |
July 2, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15101671 |
Jun 3, 2016 |
10391467 |
|
|
PCT/US2014/068955 |
Dec 5, 2014 |
|
|
|
16459689 |
|
|
|
|
62012238 |
Jun 13, 2014 |
|
|
|
61979448 |
Apr 14, 2014 |
|
|
|
61971542 |
Mar 28, 2014 |
|
|
|
61912559 |
Dec 6, 2013 |
|
|
|
61912027 |
Dec 5, 2013 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
B01J 2219/00709
20130101; B01J 19/0046 20130101; C12Q 1/6837 20130101; B01J
2219/00722 20130101; C12Q 1/6837 20130101; C12Q 2521/101 20130101;
C12Q 2533/101 20130101; C12Q 2565/515 20130101 |
International
Class: |
B01J 19/00 20060101
B01J019/00; C12Q 1/6837 20060101 C12Q001/6837 |
Claims
1.-41. (canceled)
42. A method for generating an array comprising: providing a
template array comprising a plurality of template oligonucleotides
coupled thereto; coupling the template array to a recipient array
comprising a plurality of oligonucleotides complementary to
portions of the plurality of template oligonucleotides; and
generating a recipient array comprising recipient oligonucleotide
products, wherein each of the recipient oligonucleotide products
comprises a member of the plurality of oligonucleotides and an
additional oligonucleotide, wherein the additional oligonucleotide
is complementary to an additional portion of a member of the
plurality of template oligonucleotides.
43. The method of claim 42, wherein at least 40% of the recipient
oligonucleotide products are complementary to a full-length
oligonucleotide from the plurality of template
oligonucleotides.
44. The method of claim 42, wherein the template array comprises at
least 100 spots.
45. The method of claim 42, wherein the directionality of the
recipient oligonucleotide products relative to the recipient array
is the same as the directionality of the template oligonucleotides
relative to the template array.
46. The method of claim 42, wherein the directionality of the
recipient oligonucleotide products relative to the recipient array
is the opposite of the directionality of the template
oligonucleotides relative to the template array.
47. The method of claim 42, wherein a plurality of recipient arrays
are generated.
48. The method of claim 42, wherein the plurality of recipient
oligonucleotide products are on average at least 99% identical
between one recipient array and another.
49. A method for generating a complementary array comprising: (a)
providing a plurality of template oligonucleotides coupled to a
first substrate, each of the plurality of template oligonucleotides
comprising an adaptor sequence, wherein the adaptor sequence is the
same for each of the plurality of template oligonucleotides; (b)
providing a plurality of recipient oligonucleotides coupled to a
second substrate, each of the plurality of recipient
oligonucleotides comprising a sequence complementary to the adaptor
sequence; (c) generating a plurality of recipient oligonucleotide
products, wherein each of the recipient oligonucleotide products
comprises the sequence complementary to the adaptor sequence and an
additional oligonucleotide, wherein the additional oligonucleotide
is complementary to a member of the plurality of template
oligonucleotides.
50. The method of claim 49, wherein each of the adaptor sequences
is located at or near the 3' end of the template
oligonucleotides.
51. The method of claim 49, wherein each of the adaptor sequences
is located at or near a 5' end of the template
oligonucleotides.
52. The method of claim 49, wherein the generating in (d) results
in generation of the plurality of recipient oligonucleotide
products at least 40% of which are full-length products on the
second substrate.
53. The method of claim 49, wherein the directionality of the
recipient oligonucleotide products relative to the second substrate
is the same as the directionality of the template oligonucleotides
relative to the first substrate.
54. The method of claim 49, wherein the directionality of the
recipient oligonucleotide products relative to the second substrate
is the opposite of the directionality of the template
oligonucleotides relative to the first substrate.
55. The method of claim 54, wherein the method is repeated to
produce at least 2 recipient arrays.
56. The method of claim 49, wherein the plurality of template
oligonucleotides are coupled to the first substrate via a first
polymerization reaction.
57. The method of claim 56, wherein reagents for the first
polymerization reaction comprise acrylamide or polyacrylamide.
58. The method of claim 49, wherein the plurality of recipient
oligonucleotide products are coupled to the second substrate via a
second polymerization reaction.
59. The method of claim 58, wherein reagents for the second
polymerization reaction comprise acrylamide or polyacrylamide
60. The method of claim 49, wherein a plurality of recipient arrays
are generated.
61. The method of claim 49, wherein the plurality of recipient
oligonucleotide products are on average at least 99% identical
between one recipient array and another.
Description
CROSS-REFERENCE
[0001] This application is a continuation of U.S. application Ser.
No. 15/101,671, filed Jun. 3, 2016, which is the National Stage
Entry of International Application No. PCT/US2014/068955, filed
Dec. 5, 2014 which claims the benefit of U.S. Provisional
Application No. 61/912,027, filed on Dec. 5, 2013, 61/912,559,
filed on Dec. 6, 2013, 61/971,542, filed on Mar. 28, 2014,
61/979,448, filed on Apr. 14, 2014, and 62/012,238 filed Jun. 13,
2014, all of which is herein incorporated by reference in its
entirety.
BACKGROUND OF THE INVENTION
[0002] Patterned arrays have many applications in genomics and
molecular diagnostics. Many array manufacturing methods, however,
create poor quality probes, partial probes, probes in wrong
orientation for extension reactions or on a surface that is not
very efficient for enzymatic reactions. This disclosure provides
methods and compositions with enzymatically-compatible surfaces,
higher-quality probes, and probes in various orientations.
SUMMARY OF THE INVENTION
[0003] Methods, compositions and systems are provided for
fabricating patterned oligonucleotide arrays that result in high
quality full length probes in desired orientations and at a low
cost. In some embodiments, patterned oligonucleotide arrays are
fabricated using enzymatic transfer wherein primers from a
recipient surface is hybridized to a template on a template surface
and polymerase drive extension reaction using the template produces
a second strand. After separation of the two surfaces, the
recipient surface contains a copied oligonucleotide pattern,
complementary to the first surface pattern. Alternatively, the
template can be hybridized with primers that contain a linker that
can be used to immobilize them to the recipient surface. The primer
can then be extended and immobilized on to the recipient surface,
such as by forming a thin layer of polymer gel on the recipient
surface. The resulting copied features can be enhanced by
amplification such as bridge amplification. Amplified probes
containing adaptor at the 3' end can be enzymatically processed to
remove the adaptor sequence.
[0004] In one aspect, provided herein is a method for generating an
array comprising: providing a template array comprising at least
1,000 different oligonucleotides coupled thereto, coupling said
template array to a recipient array having a plurality of
oligonucleotides complementary to portions of the at least 1,000
different oligonucleotides, and performing an enzymatic reaction
while the template array and the enzymatic array are coupled to one
another, thereby generating a recipient array comprising recipient
oligonucleotides, wherein at least 40% of the recipient
oligonucleotides are complementary or identical to a full-length
oligonucleotide from the at least 1,000 different oligonucleotides.
In some cases, the template array comprises at least 100 spots. In
some cases, the template array comprises spots at most about 500
.mu.m in size. In some cases, the directionality of the recipient
oligonucleotides relative to the recipient array is the same as the
directionality of the template oligonucleotides relative to the
template array. In some cases, the directionality of the recipient
oligonucleotides relative to the recipient array is the opposite of
the directionality of the template oligonucleotides relative to the
template array. In some cases, a plurality of recipient arrays are
generated. In some cases, the plurality of recipient
oligonucleotides are on average at least 99% identical between one
recipient array and another. In some cases, the recipient
oligonucleotides are at least 99% identical between one recipient
array and another.
[0005] In one aspect, provided herein is a method for generating an
array comprising: using a template array comprising template
oligonucleotides to synthesize a recipient array comprising
recipient oligonucleotides wherein the recipient array is coupled
to the template array during the synthesis. In some cases, at least
40% of the recipient oligonucleotides comprise full-length
products. In some cases, at least 50% of the recipient
oligonucleotides comprise full-length products. In some cases, at
least 60% of the recipient oligonucleotides comprise full-length
products. In some cases, the directionality of the recipient
oligonucleotides relative to the recipient array is the same as the
directionality of the template oligonucleotides relative to the
template array. In some cases, the directionality of the recipient
oligonucleotides relative to the recipient array is the opposite of
the directionality of the template oligonucleotides relative to the
template array. In some cases, a plurality of recipient arrays are
generated. In some cases, the plurality of recipient
oligonucleotides are on average at least 99% identical between one
recipient array and another. In some cases, the recipient
oligonucleotides are at least 99% identical between one recipient
array and another. In some cases, the template array is physically
separated from each of the recipient arrays after synthesis of each
of the recipient arrays. In some cases, the template array is
separated from each of the recipient arrays after synthesis of each
of the recipient arrays by increased temperature. In some cases,
the template array comprises at least 100 spots. In some cases, the
template array comprises spots at most about 500 .mu.m in size. In
one aspect, provided herein is a method for generating a
complementary array comprising: (a) providing a plurality of
template oligonucleotides coupled to a first substrate, each of
said plurality of template oligonucleotides comprising an adaptor
sequence, wherein said adaptor sequence is the same for each of
said plurality of template oligonucleotides; (b) providing a
plurality of recipient oligonucleotides coupled to a second
substrate, each of said plurality of recipient oligonucleotides
comprising sequence complementary to said adaptor sequence; (c)
hybridizing said adaptor sequence of said template oligonucleotides
and said sequence complementary to said adaptor sequence of said
recipient oligonucleotides; and (d) conducting extension reactions
on said plurality of recipient oligonucleotides using said
plurality of template oligonucleotides as templates. In some cases,
each of said adaptor sequences is located at or near the 3' end of
said template oligonucleotides. In some cases, each of said adaptor
sequences is located at or near the 5' end of said template
oligonucleotides. In some cases, either of said substrates
comprises polymer. In some cases, either of said substrates
comprises acrylamide or polyacrylamide. In some cases, the
conducting step results in generation of recipient oligonucleotides
at least 40% of which are full-length products. In some cases, the
conducting step results in generation of recipient oligonucleotides
at least 50% of which are full-length products. In some cases, the
conducting step results in generation of recipient oligonucleotides
at least 60% of which are full-length products. In some cases, the
directionality of the recipient oligonucleotides relative to the
second substrate is the same as the directionality of the template
oligonucleotides relative to the first substrate. In some cases,
the directionality of the recipient oligonucleotides relative to
the second substrate is the opposite of the directionality of the
template oligonucleotides relative to the first substrate. In some
cases, the method is repeated to produce at least 2 recipient
arrays. In some cases, the template array comprises at least 100
spots. In some cases, the template array comprises spots at most
about 500 in size.
[0006] In one aspect, provided herein is a method for transferring
an array, comprising: (a) providing a substrate comprising a
plurality of linker sites; (b) providing an array comprising a
plurality of template oligonucleotides; (c) applying reaction mix
to said array, said reaction mix comprising enzyme, dNTPs, and a
plurality of linker oligonucleotides comprising sequence
complementary to an adaptor sequence appended to each of said
plurality of template oligonucleotides and further comprising
linker molecules capable of binding to said plurality of linker
sites; (d) conducting extension reactions of said plurality of said
linker oligonucleotides using said plurality of template
oligonucleotides as templates, thereby generating a plurality of
extension products comprising said linker molecules; (e) contacting
said array with said substrate; and (f) linking said linker
molecules of said plurality of extension products to said linker
sites. In some cases, said adaptor sequence is located at or near
the 3' end of said template oligonucleotides. In some cases, said
adaptor sequence is located at or near the 5' end of said template
oligonucleotides. In some cases, said substrate comprises polymer.
In some cases, said substrate comprises acrylamide or
polyacrylamide. In some cases, the template array comprises at
least 100 spots. In some cases, the template array comprises spots
at most about 500 .mu.m in size.
INCORPORATION BY REFERENCE
[0007] All publications, patents, and patent applications mentioned
in this specification are herein incorporated by reference to the
same extent as if each individual publication, patent, or patent
application was specifically and individually indicated to be
incorporated by reference.
BRIEF DESCRIPTION OF THE DRAWINGS
[0008] The novel features of the invention are set forth with
particularity in the appended claims. A better understanding of the
features and advantages of the present invention will be obtained
by reference to the following detailed description that sets forth
illustrative embodiments, in which the principles of the invention
are utilized, and the accompanying drawings of which:
[0009] FIG. 1 illustrates examples of different shapes for the
template surface.
[0010] FIG. 2A illustrates a general schematic of enzymatic
transfer by synthesis (ETS).
[0011] FIG. 2B illustrates a schematic of enzymatic transfer
resulting in a different orientation of the nucleic acids relative
to the substrate.
[0012] FIG. 2C illustrates a schematic of enzymatic transfer
resulting in the transfer of full-length strands.
[0013] FIG. 3 illustrates a schematic of synthesis on the recipient
surface from the template surface.
[0014] FIG. 4 illustrates a schematic of a first stage of
oligonucleotide immobilization transfer (OIT).
[0015] FIG. 5 illustrates a schematic of a second stage of
oligonucleotide immobilization transfer (OIT).
[0016] FIG. 6 illustrates a schematic of probe end clipping (PEC)
to remove an adapter sequence.
[0017] FIG. 7 illustrates a schematic of probe end clipping (PEC)
at a nick site.
[0018] FIG. 8 illustrates a schematic of non-enzymatic gel
transfer.
[0019] FIG. 9 illustrates a schematic of a schematic of the first
stage of the attachment of oligonucleotides to a glass surface
after silanation using the cross-linker 1,4-Phenylene
Diisothiocyanate (PDITC).
[0020] FIG. 10 illustrates a schematic of the second stage of the
attachment of oligonucleotides to a glass surface after silanation
using PDITC.
[0021] FIG. 11 illustrates gel transfer of oligonucleotides
attached to a silanated glass surface using PDITC as illustrated in
FIGS. 9-10.
[0022] FIG. 12 illustrates template slide (left) and gel chip
(right) with clusters transferred via enzymatic extension.
[0023] FIG. 13 illustrates zoomed in image of the template (left)
and gel copy (right) from FIG. 12.
[0024] FIG. 14 illustrates a comparison in intensity of a template
(left) and gel copy (right), the latter having .about.100.times.
lower intensity than the former.
[0025] FIG. 15 illustrates enzymatic transfer to a gel copy
compared to a negative control surface with no template
present.
[0026] FIG. 16 illustrates a template array comprising
fluorescently labeled oligos attached to the surface in a
checkerboard pattern.
[0027] FIG. 17 illustrates zoomed in views of the surface in FIG.
16.
[0028] FIG. 18 illustrates a template after non-enzymatic gel
transfer, with signal from the synthesized strand (left) and the
other strand (right).
[0029] FIG. 19 illustrates a template pre- (left) and post- (right)
non-enzymatic gel transfer.
[0030] FIG. 20 illustrates copies from gel extended strand transfer
(left) and gel ripped template strand transfer (right).
[0031] FIG. 21 illustrates gel images with 10.times.2S 2 bin (left)
and 10.times.0.5 s 10 bin (right).
[0032] FIG. 22 illustrates enzymatic transfer to a gel copy (left)
compared to a negative control surface with no enzyme present
(right).
[0033] FIG. 23 illustrates a template array before (left) and after
(right) 5 enzymatic transfers using the face-to-face enzymatic gel
transfer process (e.g., enzymatic transfer by synthesis or ETS)
described herein.
[0034] FIG. 24 illustrates cluster amplification after enzymatic
transfer.
[0035] FIG. 25 illustrates an image of print (i.e., array)
generated without using PyroPhage-based linear PCR printing taken
at 20 s exposure, 10.times., 1 bin, 100-600, hybridized with
Cy3-CompSP2.
[0036] FIG. 26 illustrates an image of print (i.e., array)
generated without using PyroPhage-based linear PCR printing taken
at 20 s exposure, 10.times., 1 bin, 100-4095, hybridized with
Cy3-CompSP2.
[0037] FIG. 27 illustrates an image of print (i.e., array)
generated using PyroPhage-based linear PCR printing with 1 hr
printing at 55 C taken at 20 s exposure, 10.times., 1 bin,
1400-4095, hybridized with Cy3-CompSP2.
[0038] FIG. 28 illustrates a comparison of images of prints
(arrays) generated using PyroPhage-based linear PCR printing from
1.sup.st->2.sup.nd surface for 1 hr, 4 hrs, or overnight. All
images taken at all images were taken with 10 s exposure,
100-2000.
[0039] FIG. 29 illustrates a comparison of images of prints
generated by Bst-based printing for 1 hr at 55 C from
1.sup.st->2.sup.nd surface for 1 hr, 2 hr, 3 hr, 4 hr, 6 hr and
overnight. 4 hr Bst-based printing from 1.sup.st->2.sup.nd
surface gave optimal print signal at 55 C. All images taken at all
images were taken with 10 s exposure, 100-2000.
[0040] FIG. 30 illustrates images of Bst-based printing from
1.sup.st->2.sup.nd surface (synthesized 5'->3') synthesized
for 1 hr at 55 C. All images were taken with 10 s exposure,
200-2000.
[0041] FIG. 31. illustrates Bst-based printing resolved at 1
micron.
[0042] FIG. 32 illustrates a Bst overnight-printed 2.sup.nd surface
used as template to do another Bst overnight printing onto Br-Ac
3.sup.rd surface a 10 s exposure, 10.times., 1 bin, 100-600,
Cy3-CompSP2.
[0043] FIG. 33 illustrates Br-Ac 3.sup.rd surface overnight-printed
from overnight-printed 2.sup.nd surface (10 s exposure, 10.times.,
1 bin, 200-1700, hybridized with Cy3-FC2).
[0044] FIG. 34 illustrates Br-Ac 3.sup.rd surface Pyrophage-printed
and amplified from overnight-printed 2.sup.nd surface. USER enzyme
was used to cut one of the strand after PCR (10 s exposure,
10.times., 1 bin, 1500-3000, Cy3-AM2).
DETAILED DESCRIPTION OF THE INVENTION
I. Overview
[0045] This disclosure provides methods and compositions for the
fabrication and transfer of patterned arrays from a template array
to a transfer array. A template array, as used herein refers to a
substrate having coupled to it a plurality of polymer molecules
such as, e.g., nucleic acids, oligonucleotides or aptamers. A
nucleic acid can be an oligonucleotide. Polymers on a template
array can be referred to as template polymers, template nucleic
acids, template oligomers, template oligonucleotides or template
aptamers, as relevant. The template polymer can be double-stranded
or can be melted to be single-stranded.
[0046] To generate copies of an array with a desired orientation
(e.g., 5' end attached to array substrate) a face-to-face gel
transfer process may be employed. The face-to-face gel transfer
process can significantly reduce the unit cost of fabrication while
simultaneously flipping the oligo orientation such that the 5' end
is immobilized, which can have assay advantages as described
herein. Moreover, the selective transfer of full length oligos and
subsequent amplification of the full length oligo can allow the
oligo arrays to contain very long oligos (50+ or more bases)
without suffering from low yield or partial length products as
described herein. The transfer can comprise generation of nucleic
acid sequences complementary to the template oligo sequences. The
transfer process can occur by enzymatic replication or by
non-enzymatic physical transfer of array components between the
surfaces. Transfer can comprise fabrication of complementary
sequences which are already attached to a recipient/transfer array.
For example, primers bound to a recipient/transfer array are
complementary to adaptors on the template array and can be extended
using the template array sequences as templates to thereby generate
a full length or partial length transfer array. Transfer can
comprise fabrication of complementary sequences from a template
array followed by attachment of the complementary sequences to a
transfer array.
[0047] Transfer can preserve the orientation of a nucleic acid
relative to its coupled array surface (e.g., the 3' end of the
template nucleic acid is bound to the template array and the 3' end
of the transferred nucleic acid complement is bound to the transfer
array). Transfer can reverse the orientation of a nucleic acid
relative to its coupled array surface (e.g., the 3' end of the
template nucleic acid is bound to the template array and the 5' end
of the transferred nucleic acid complement is bound to the transfer
array).
[0048] In some cases, the array transfer methods described herein
are useful in generating transfer or recipient arrays having an
increased or enriched amount or percentage of oligonucleotides
coupled to the transfer or recipient array surface that are 100% of
the length (i.e., a same or identical length) of the respective
oligonucleotides on the array used as a template (i.e., template
array) for the transfer procedure. The transfer procedure can be a
face-to-face enzymatic transfer as provided herein. The
face-to-face enzymatic transfer method can also be referred to as
enzymatic transfer by synthesis or ETS. Array transfer can result
in a transfer or recipient array comprising at least, at most, more
than, less than, or about 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%,
80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.9% transferred
oligonucleotides that are the same or identical or 100% of the
length of the respective oligonucleotide on a template array used
to generate the transfer or recipient array. A transferred
oligonucleotide that is 100% of the length (i.e., the same or
identical length) of a template oligonucleotide can be referred to
as full-length product (e.g., full-length product oligo). A
template array fabricated by methods known in that art (e.g.
spotting or in situ synthesis) can comprise about 20%
oligonucleotides that are a desired length (i.e., full-length
oligonucleotides) and about 80% oligonucleotides that are not a
desired length (i.e., partial-length oligonucleotides). Transfer of
the array generated by methods known in the art comprising about
20% full-length oligonucleotides and about 80% partial-length
oligonucleotides using array transfer methods as provided herein
(e.g., ETS) can result in the generation of transfer or recipient
arrays comprising at most about 20% full-length product oligos. A
transfer array comprising primers complementary to a sequence at
the unbound end of the full-length oligonucleotide on the template
array can be used to conduct transfer; Many or all of the
partial-length products on the template array comprising about 20%
full-length oligonucleotides and about 80% partial-length
oligonucleotides lack the unbound end portion of sequence used in
array transfer (e.g., ETS) as provided herein and so cannot be
transferred. In some cases, an array fabricated according to the
methods herein has a greater percentage of oligonucleotides of a
desired length (i.e., full length oligos) such that transfer of an
array fabricated according to the methods herein using array
transfer methods provided herein (i.e., ETS) results in the
generation of transfer or recipient arrays with a higher percentage
of full-length product oligos as compared to fabrication and
transfer methods known in the art. A full-length oligo on an array
(e.g., template array) fabricated using the methods provided herein
can be about, at most, or at least 10, 15, 20, 25, 30, 35, 40, 45,
50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 bases long. A full
length product oligo on a transfer or recipient array transferred
using array transfer methods provided herein (i.e., ETS) can be
about, at most, or at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55,
60, 65, 70, 75, 80, 85, 90, 95, or 100 bases long.
[0049] Array transfer as provided herein can be performed multiple
times. In some cases, a template array (e.g., oligo array) is
subjected to an array transfer process a plurality of times. A
template array can be subjected to an array transfer process at
least, at most, more than, less than or about 1, 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40,
45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250,
300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000 times. The
array transfer process can be a face-to-face enzymatic transfer
method as provided herein. A plurality of transfer or recipient
arrays can be generated from multiple array transfers using the
same template array. Each transfer or recipient array generated
from a single template array using an array transfer method as
provided herein can be at least, at most, more than, less than, or
about 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%,
96%, 97%, 98%, 99%, or 99.9% identical to the template array and/or
each other transfer or recipient array generated from the template
array. Array transfer can be performed multiple times in a series
of transfers, using the transfer array from one array transfer as
the template array for a subsequent transfer. For example, a first
transfer can be performed from a template array with oligos bound
to the array at their 3' ends to a first transfer array with
complementary oligos bound to the array at their 5' ends, and a
second transfer can be performed from the first transfer array (now
serving as a template array) to a second transfer array. In some
cases, each progressive transfer or recipient array in a series of
array transfer reactions as provided herein generate recipient or
transfer arrays with an enriched percentage of full-length product
oligos (i.e., a transferred oligonucleotide that is 100% of the
length of a template oligonucleotide) and sequences matching the
original template array.
[0050] In some cases, array transfer can be aided by the use of
adaptor sequences on the oligos on the template oligo array. Oligos
can comprise a desired final sequence with the addition of one or
more adaptor sequences. The one or more adaptor sequences can be on
the 5' or 3' end of the oligos on the template array. In some
cases, the one or more adaptor sequences are on the 3'end of the
oligos on the template array. In some cases, the one or more
adaptor sequences are on the 5'end of the oligos on the template
array. Primers on a recipient/transfer array can be complementary
to adaptor sequences, allowing hybridization between the primers
and the oligos (via hybridization to all or a portion of the
adaptor sequences) on the template array. Such hybridization can
aid in the transfer from one array to another. Some or all adaptor
sequences can be removed from transfer array oligos after transfer,
for example by enzymatic cleavage, digestion, or restriction.
[0051] In some cases, array transfer can be aided by the
flexibility or deformability of the array or of a surface coating
on the array. For example, an array comprising a polyacrylamide gel
coating with coupled oligonucleotides can be used in array
transfer. The deformability of the gel coating can allow for array
components to contact each other despite surface roughness. The
deformability can permit enzymes required in enzymatic array
transfer methods (e.g., ETS as provided herein) more effective
contact with reaction components as compared to arrays that do not
comprise a polyacrylamide gel The more effective contact can permit
a higher number of enzymatic transfers as compared to arrays that
do not comprise a polyacrylamide gel. The more effective contact
can permit the generation of a higher percentage of transfer or
recipient arrays comprising oligos that are 100% of the length of
the oligos on a template array used in the array transfer
method.
[0052] Array components can be amplified or regenerated by
enzymatic reactions. For example, bridge amplification can be
conducted on array component oligonucleotides via hybridization
between adaptor sequences on the array components and surface-bound
oligonucleotide primers, followed by enzymatic extension or
amplification. Amplification can be used to recover lost array
component density or to increase density of array components beyond
their original density.
II. Nucleic Acids and Sources Thereof
[0053] A "nucleic acid molecule" or "nucleic acid" as referred to
herein can be deoxyribonucleic acid (DNA) or ribonucleic acid (RNA)
including known analogs or a combination thereof unless otherwise
indicated. Nucleic acid molecules to be sequenced herein can be
obtained from any source of nucleic acid. The nucleic acid molecule
can be single-stranded or double-stranded. In some cases, the
nucleic acid molecule is DNA. The DNA can be obtained and purified
using standard techniques in the art and include DNA in purified or
unpurified form. The DNA can be mitochondrial DNA, cell-free DNA,
complementary DNA (cDNA), or genomic DNA. In some cases, the
nucleic acid molecule is genomic DNA (gDNA). The DNA can be plasmid
DNA, cosmid DNA, bacterial artificial chromosome (BAC), or yeast
artificial chromosome (YAC). The DNA can be derived from one or
more chromosomes. For example, if the DNA is from a human, the DNA
can derived from one or more of chromosome 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, X, or Y. The
RNA can be obtained and purified using standard techniques in the
art and include RNAs in purified or unpurified form, which include,
but are not limited to, mRNAs, tRNAs, snRNAs, rRNAs, retroviruses,
small non-coding RNAs, microRNAs, polysomal RNAs, pre-mRNAs,
intronic RNA, viral RNA, cell free RNA and fragments thereof. The
non-coding RNA, or ncRNA can include snoRNAs, microRNAs, siRNAs,
piRNAs and long nc RNAs.
[0054] The source of nucleic acid for use in the methods and
compositions described herein can be a sample comprising the
nucleic acid. The nucleic acid can be isolated from the sample and
purified by any of the methods known in the art for purifying the
nucleic acid from the sample. The sample can be derived from a
non-cellular entity comprising polynucleotides (e.g., a virus) or
from a cell-based organism (e.g., member of archaea, bacteria, or
eukarya domains). In some cases, the sample is obtained from a swab
of a surface, such as a door or bench top.
[0055] The sample can be from a subject, e.g., a plant, fungi,
eubacteria, archeabacteria, protest, or animal. The subject can be
an organism, either a single-celled or multi-cellular organism. The
subject can be cultured cells, which can be primary cells or cells
from an established cell line, among others. The sample can be
isolated initially from a multi-cellular organism in any suitable
form. The animal can be a fish, e.g., a zebrafish. The animal can
be a mammal. The mammal can be, e.g., a dog, cat, horse, cow,
mouse, rat, or pig. The mammal can be a primate, e.g., a human,
chimpanzee, orangutan, or gorilla. The human can be a male or
female. The sample can be from a human embryo or human fetus. The
human can be an infant, child, teenager, adult, or elderly person.
The female can be pregnant, suspected of being pregnant, or
planning to become pregnant. In some cases, the sample is a single
or individual cell from a subject and the polynucleotides are
derived from the single or individual cell. In some cases, the
sample is an individual micro-organism, or a population of
micro-organisms, or a mixture of micro-organisms and host cellular
or cell free nucleic acids.
[0056] The sample can be from a subject (e.g., human subject) who
is healthy. In some cases, the sample is taken from a subject
(e.g., an expectant mother) at at least 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 weeks
of gestation. In some cases, the subject is affected by a genetic
disease, a carrier for a genetic disease or at risk for developing
or passing down a genetic disease, where a genetic disease is any
disease that can be linked to a genetic variation such as
mutations, insertions, additions, deletions, translocation, point
mutation, trinucleotide repeat disorders and/or single nucleotide
polymorphisms (SNPs).
[0057] The sample can be from a subject who has a specific disease,
disorder, or condition, or is suspected of having (or at risk of
having) a specific disease, disorder or condition. For example, the
sample can be from a cancer patient, a patient suspected of having
cancer, or a patient at risk of having cancer. The cancer can be,
e.g., acute lymphoblastic leukemia (ALL), acute myeloid leukemia
(AML), adrenocortical carcinoma, Kaposi Sarcoma, anal cancer, basal
cell carcinoma, bile duct cancer, bladder cancer, bone cancer,
osteosarcoma, malignant fibrous histiocytoma, brain stem glioma,
brain cancer, craniopharyngioma, ependymoblastoma, ependymoma,
medulloblastoma, medulloeptithelioma, pineal parenchymal tumor,
breast cancer, bronchial tumor, Burkitt lymphoma, Non-Hodgkin
lymphoma, carcinoid tumor, cervical cancer, chordoma, chronic
lymphocytic leukemia (CLL), chromic myelogenous leukemia (CML),
colon cancer, colorectal cancer, cutaneous T-cell lymphoma, ductal
carcinoma in situ, endometrial cancer, esophageal cancer, Ewing
Sarcoma, eye cancer, intraocular melanoma, retinoblastoma, fibrous
histiocytoma, gallbladder cancer, gastric cancer, glioma, hairy
cell leukemia, head and neck cancer, heart cancer, hepatocellular
(liver) cancer, Hodgkin lymphoma, hypopharyngeal cancer, kidney
cancer, laryngeal cancer, lip cancer, oral cavity cancer, lung
cancer, non-small cell carcinoma, small cell carcinoma, melanoma,
mouth cancer, myelodysplastic syndromes, multiple myeloma,
medulloblastoma, nasal cavity cancer, paranasal sinus cancer,
neuroblastoma, nasopharyngeal cancer, oral cancer, oropharyngeal
cancer, osteosarcoma, ovarian cancer, pancreatic cancer,
papillomatosis, paraganglioma, parathyroid cancer, penile cancer,
pharyngeal cancer, pituitary tumor, plasma cell neoplasm, prostate
cancer, rectal cancer, renal cell cancer, rhabdomyosarcoma,
salivary gland cancer, Sezary syndrome, skin cancer, nonmelanoma,
small intestine cancer, soft tissue sarcoma, squamous cell
carcinoma, testicular cancer, throat cancer, thymoma, thyroid
cancer, urethral cancer, uterine cancer, uterine sarcoma, vaginal
cancer, vulvar cancer, Waldenstrom Macroglobulinemia, or Wilms
Tumor. The sample can be from the cancer and/or normal tissue from
the cancer patient.
[0058] The sample can be aqueous humour, vitreous humour, bile,
whole blood, blood serum, blood plasma, breast milk, cerebrospinal
fluid, cerumen, enolymph, perilymph, gastric juice, mucus,
peritoneal fluid, saliva, sebum, semen, sweat, tears, vaginal
secretion, vomit, feces, or urine. The sample can be obtained from
a hospital, laboratory, clinical or medical laboratory. The sample
can be taken from a subject.
[0059] The sample can be an environmental sample comprising medium
such as water, soil, air, and the like. The sample can be a
forensic sample (e.g., hair, blood, semen, saliva, etc.). The
sample can comprise an agent used in a bioterrorist attack (e.g.,
influenza, anthrax, smallpox).
[0060] The sample can comprise nucleic acid. The sample can
comprise cell-free nucleic acid. The sample can be a cell line,
genomic DNA, cell-free plasma, formalin fixed paraffin embedded
(FFPE) sample, or flash frozen sample. A formalin fixed paraffin
embedded sample can be deparaffinized before nucleic acid is
extracted. The sample can be from an organ, e.g., heart, skin,
liver, lung, breast, stomach, pancreas, bladder, colon, gall
bladder, brain, etc. Nucleic acids can be extracted from a sample
by means available to one of ordinary skill in the art.
[0061] The sample can be processed to render it competent for
fragmentation, ligation, denaturation, amplification, stretching,
and/or sequencing or any of the methods provided herein. Exemplary
sample processing can include lysing cells of the sample to release
nucleic acid, purifying the sample (e.g., to isolate nucleic acid
from other sample components, which can inhibit enzymatic
reactions), diluting/concentrating the sample, and/or combining the
sample with reagents for further nucleic acid processing. In some
examples, the sample can be combined with a restriction enzyme,
reverse transcriptase, or any other enzyme of nucleic acid
processing.
[0062] The methods described herein can be used for sequencing one
or more target nucleic acids or polynucleotides. A polynucleotide
described herein can contain phosphodiester bonds, although in some
cases, as outlined below (for example in the construction of
primers and probes such as label probes), nucleic acid analogs are
included that can have alternate backbones, comprising, for
example, phosphoramide (Beaucage et al., Tetrahedron 49(10):1925
(1993) and references therein; Letsinger, J. Org. Chem. 35:3800
(1970); Sprinzl et al., Eur. J. Biochem. 81:579 (1977); Letsinger
et al., Nucl. Acids Res. 14:3487 (1986); Sawai et al, Chem. Lett.
805 (1984), Letsinger et al., J. Am. Chem. Soc. 110:4470 (1988);
and Pauwels et al., Chemica Scripta 26:141 91986)),
phosphorothioate (Mag et al., Nucleic Acids Res. 19:1437 (1991);
and U.S. Pat. No. 5,644,048), phosphorodithioate (Briu et al., J.
Am. Chem. Soc. 111:2321 (1989), O-methylphosphoroamidite linkages
(see Eckstein, Oligonucleotides and Analogues: A Practical
Approach, Oxford University Press), and peptide nucleic acid (also
referred to herein as "PNA") backbones and linkages (see Egholm, J.
Am. Chem. Soc. 114:1895 (1992); Meier et al., Chem. Int. Ed. Engl.
31:1008 (1992); Nielsen, Nature, 365:566 (1993); Carlsson et al.,
Nature 380:207 (1996), all of which are incorporated by reference).
Other analog nucleic acids include those with bicyclic structures
including locked nucleic acids (also referred to herein as "LNA"),
Koshkin et al., J. Am. Chem. Soc. 120.13252 3 (1998); positive
backbones (Denpcy et al., Proc. Natl. Acad. Sci. USA 92:6097
(1995); non-ionic backbones (U.S. Pat. Nos. 5,386,023, 5,637,684,
5,602,240, 5,216,141 and 4,469,863; Kiedrowshi et al., Angew. Chem.
Intl. Ed. English 30:423 (1991); Letsinger et al., J. Am. Chem.
Soc. 110:4470 (1988); Letsinger et al., Nucleoside & Nucleotide
13:1597 (1994); Chapters 2 and 3, ASC Symposium Series 580,
"Carbohydrate Modifications in Antisense Research", Ed. Y. S.
Sanghui and P. Dan Cook; Mesmaeker et al., Bioorganic &
Medicinal Chem. Lett. 4:395 (1994); Jeffs et al., J. Biomolecular
NMR 34:17 (1994); Tetrahedron Lett. 37:743 (1996)) and non-ribose
backbones, including those described in U.S. Pat. Nos. 5,235,033
and 5,034,506, and Chapters 6 and 7, ASC Symposium Series 580,
"Carbohydrate Modifications in Antisense Research", Ed. Y. S.
Sanghui and P. Dan Cook. Nucleic acids containing one or more
carbocyclic sugars are also included within the definition of
nucleic acids (see Jenkins et al., Chem. Soc. Rev. (1995) pp 169
176). Several nucleic acid analogs are described in Rawls, C &
E News Jun. 2, 1997 page 35. "Locked nucleic acids" are also
included within the definition of nucleic acid analogs. LNAs are a
class of nucleic acid analogues in which the ribose ring is
"locked" by a methylene bridge connecting the 2'-0 atom with the
4'-C atom. All of these references are hereby expressly
incorporated by reference. These modifications of the
ribose-phosphate backbone can be done to increase the stability and
half-life of such molecules in physiological environments. For
example, PNA:DNA and LNA-DNA hybrids can exhibit higher stability
and thus can be used in some cases. The nucleic acids can be single
stranded or double stranded, as specified, or contain portions of
both double stranded or single stranded sequence. Depending on the
application, the nucleic acids can be DNA (including, e.g., genomic
DNA, mitochondrial DNA, and cDNA), RNA (including, e.g., mRNA and
rRNA) or a hybrid, where the nucleic acid contains any combination
of deoxyribo- and ribo-nucleotides, and any combination of bases,
including uracil, adenine, thymine, cytosine, guanine, inosine,
xathanine hypoxathanine, isocytosine, isoguanine, etc.
[0063] A "nucleic acid molecule" or "nucleic acid" as referred to
herein can be an "oligonucleotide" "aptamer" or a "polynucleotide".
The term "oligonucleotide" can refer to a nucleotide chain,
typically less than 200 residues long, e.g., between 15 and 100
nucleotides long. The oligonucleotide can comprise at least or
about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or
50 bases. The oligonucleotides can be from about 3 to about 5
bases, from about 1 to about 50 bases, from about 8 to about 12
bases, from about 15 to about 25 bases, from about 25 to about 35
bases, from about 35 to about 45 bases, or from about 45 to about
55 bases. The oligonucleotide (also referred to as "oligo") can be
any type of oligo (e.g., primer). In some cases, the oligos are
5'-acrydite-modified oligos. The oligos can be coupled to the
polymer coatings as provided herein on surfaces as provided herein.
The oligonucleotides can comprise cleavable linkages. Cleavable
linkages can be enzymatically cleavable. Oligonucleotides can be
single-or double-stranded. The terms "primer" and "oligonucleotide
primer" can refer to an oligonucleotide capable of hybridizing to a
complementary nucleotide sequence. The term "oligonucleotide" can
be used interchangeably with the terms "primer," "adapter," and
"probe." The term "polynucleotide" can refer to a nucleotide chain
typically greater than 200 residues long. Polynucleotides can be
single-or double-stranded.
[0064] The term "hybridization"! "hybridizing" and "annealing" can
be used interchangeably and can refer to the pairing of
complementary nucleic acids.
[0065] The term "primer" can refer to an oligonucleotide, generally
with a free 3' hydroxyl group, that is capable of hybridizing with
a template nucleic acid or nucleic acid molecule (such as a target
polynucleotide, target DNA, target RNA or a primer extension
product) and is also capable of promoting polymerization of a
polynucleotide complementary to the template. A primer can contain
a non-hybridizing sequence that constitutes a tail of the primer. A
primer can still be hybridizing to a target even though its
sequences may not be fully complementary to the target.
[0066] Primers can be oligonucleotides that can be employed in an
extension reaction by a polymerase along a polynucleotide template,
such as in PCR or cDNA synthesis, for example. The oligonucleotide
primer can be a synthetic polynucleotide that is single stranded,
containing a sequence at its 3'-end that is capable of hybridizing
with a sequence of the target polynucleotide. Normally, the 3'
region of the primer that hybridizes with the target nucleic acid
has at least 80%, 90%, 95%, or 100%, complementarity to a sequence
or primer binding site.
[0067] Primers can be designed according to known parameters for
avoiding secondary structures and self-hybridization. Different
primer pairs can anneal and melt at about the same temperatures,
for example, within about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.degree.
C. of another primer pair. In some cases, greater than about 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200,
500, 1000, 5000, 10,000 or more primers are initially used. Such
primers may be able to hybridize to the genetic targets described
herein. In some cases, about 2 to about 10,000, about 2 to about
5,000, about 2 to about 2,500, about 2 to about 1,000, about 2 to
about 500, about 2 to about 100, about 2 to about 50, about 2 to
about 20, about 2 to about 10, or about 2 to about 6 primers are
used.
[0068] Primers can be prepared by a variety of methods including
but not limited to cloning of appropriate sequences and direct
chemical synthesis using methods well known in the art (Narang et
al., Methods Enzymol. 68:90 (1979); Brown et al., Methods Enzymol.
68:109 (1979)). Primers can also be obtained from commercial
sources such as Integrated DNA Technologies, Operon Technologies,
Amersham Pharmacia Biotech, Sigma, and Life Technologies. The
primers can have an identical melting temperature. The melting
temperature of a primer can be about, more than, less than, or at
least 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,
45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61,
62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78,
79, 81, 82, 83, 84, or 85.degree. C. In some cases, the melting
temperature of the primer is about 30 to about 85.degree. C., about
30 to about 80.degree. C., about 30 to about 75.degree. C., about
30 to about 70.degree. C., about 30 to about 65.degree. C., about
30 to about 60.degree. C., about 30 to about 55.degree. C., about
30 to about 50.degree. C., about 40 to about 85.degree. C., about
40 to about 80.degree. C., about 40 to about 75.degree. C., about
40 to about 70.degree. C., about 40 to about 65.degree. C., about
40 to about 60.degree. C., about 40 to about 55.degree. C., about
40 to about 50.degree. C., about 50 to about 85.degree. C., about
50 to about 80.degree. C., about 50 to about 75.degree. C., about
50 to about 70.degree. C., about 50 to about 65.degree. C., about
50 to about 60.degree. C., about 50 to about 55.degree. C., about
52 to about 60.degree. C., about 52 to about 58.degree. C., about
52 to about 56.degree. C., or about 52 to about 54.degree. C.
[0069] The lengths of the primers can be extended or shortened at
the 5' end or the 3' end to produce primers with desired melting
temperatures. One of the primers of a primer pair can be longer
than the other primer. The 3' annealing lengths of the primers,
within a primer pair, can differ. Also, the annealing position of
each primer pair can be designed such that the sequence and length
of the primer pairs yield the desired melting temperature. An
equation for determining the melting temperature of primers smaller
than 25 base pairs is the Wallace Rule (Td=2(A+T)+4(G+C)). Computer
programs can also be used to design primers, including but not
limited to Array Designer Software (Arrayit Inc.), Oligonucleotide
Probe Sequence Design Software for Genetic Analysis (Olympus
Optical Co.), NetPrimer, and DNAsis from Hitachi Software
Engineering. The T.sub.M (melting or annealing temperature) of each
primer can be calculated using software programs such as Net Primer
(free web based program at
http://www.premierbiosoft.com/netprimer/index.html). The annealing
temperature of the primers can be recalculated and increased after
any cycle of amplification, including but not limited to about
cycle 1, 2, 3, 4, 5, about cycle 6 to about cycle 10, about cycle
10 to about cycle 15, about cycle 15 to about cycle 20, about cycle
20 to about cycle 25, about cycle 25 to about cycle 30, about cycle
30 to about cycle 35, or about cycle 35 to about cycle 40. After
the initial cycles of amplification, the 5' half of the primers can
be incorporated into the products from each loci of interest; thus
the T.sub.M can be recalculated based on both the sequences of the
5' half and the 3' half of each primer.
[0070] The annealing temperature of the primers can be recalculated
and increased after any cycle of amplification, including but not
limited to about cycle 1, 2, 3, 4, 5, about cycle 6 to about cycle
10, about cycle 10 to about cycle 15, about cycle 15 to about cycle
20, about cycle 20 to about cycle 25, about cycle 25 to about cycle
30, about cycle 30 to about 35, or about cycle 35 to about cycle
40. After the initial cycles of amplification, the 5' half of the
primers can be incorporated into the products from each loci of
interest, thus the TM can be recalculated based on both the
sequences of the 5' half and the 3' half of each primer.
[0071] "Complementary" can refer to complementarity to all or only
to a portion of a sequence (e.g., template nucleic acid). The
number of nucleotides in the hybridizable sequence of a specific
oligonucleotide primer should be such that stringency conditions
used to hybridize the oligonucleotide primer will prevent excessive
random non-specific hybridization. Usually, the number of
nucleotides in the hybridizing portion of the oligonucleotide
primer will be at least as great as the defined sequence on the
target polynucleotide (e.g., template nucleic acid) that the
oligonucleotide primer hybridizes to, namely, at least 5, at least
6, at least 7, at least 8, at least 9, at least 10, at least 11, at
least 12, at least 13, at least 14, at least 15, at least about 20,
and generally from about 6 to about 10 or 6 to about 12 of 12 to
about 200 nucleotides, usually about 10 to about 50 nucleotides. A
target polynucleotide can be larger than an oligonucleotide primer
or primers as described previously.
[0072] The term "about" or "nearly" as used herein refers to within
+/-10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the designated
amount. For example, "nearly identical" can mean at least a 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.
[0073] In some cases, a set of barcodes is provided. The term
"barcode" can refer to a known nucleic acid sequence that allows
some feature of a nucleic acid (e.g., oligo) with which the barcode
is associated to be identified. In some cases, the feature of the
nucleic acid to be identified is the spatial position of each
nucleic acid (e.g., oligo) on an array or chip. The barcodes can be
designed for precision sequence performance, e.g., GC content
between 40% and 60%, no homo-polymer runs longer than two, no
self-complementary stretches longer than 3, and be comprised of
sequences not present in a human genome reference. A barcode
sequence can be at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, or 35 bases. A barcode sequence can be at most 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, 30, 31, 32, 33, 34, or 35 bases. A barcode sequence can
be about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35
bases. An oligonucleotide (e.g., primer or adapter) can comprise
about, more than, less than, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9,
or 10 different barcodes. Barcodes can be of sufficient length and
comprise sequences that can be sufficiently different to allow the
identification of the spatial position of each nucleic acid (e.g.,
oligo) based on barcode(s) with which each nucleic acid is
associated. In some cases, each barcode is, for example, four
deletions or insertions or substitutions away from any other
barcode in an array. The oligos in each array spot on the barcoded
oligo array can comprise the same barcode sequence and oligos in
different array spots can comprise different barcode sequences. The
barcode sequence used in one array spot can be different from the
barcode sequence in any other array spot. Alternatively, the
barcode sequence used in one array spot can be the same as the
barcode sequence used in another array spot, as long as the two
array spots are not adjacent. Barcode sequences corresponding to
particular array spots can be known from the controlled synthesis
of the array. Alternatively, barcode sequences corresponding to
particular array spots can be known by retrieving and sequencing
material from particular array spots. A candidate set of barcodes
containing 1.5 million 18 base barcodes was designed as an
example.
III. Enzymes
[0074] RNA-dependent DNA polymerases for use in the methods and
compositions provided herein can be capable of effecting extension
of a primer according to the methods provided herein. Accordingly,
an RNA-dependent DNA polymerase can be one that is capable of
extending a nucleic acid primer along a nucleic acid template that
is comprised at least predominantly of ribonucleotides. Suitable
RNA-dependent DNA polymerases for use in the methods, compositions,
and kits provided herein include reverse transcriptases (RTs). RTs
are well known in the art. Examples of RTs include, but are not
limited to, Moloney murine leukemia virus (M-MLV) reverse
transcriptase, human immunodeficiency virus (HIV) reverse
transcriptase, rous sarcoma virus (RSV) reverse transcriptase,
avian myeloblastosis virus (AMV) reverse transcriptase, rous
associated virus (RAV) reverse transcriptase, and myeloblastosis
associated virus (MAV) reverse transcriptase or other avian
sarcoma-leukosis virus (ASLV) reverse transcriptases, and modified
RTs derived therefrom. See e.g. U.S. Pat. No. 7,056,716. Many
reverse transcriptases, such as those from avian myeoloblastosis
virus (AMV-RT), and Moloney murine leukemia virus (MMLV-RT)
comprise more than one activity (for example, polymerase activity
and ribonuclease activity) and can function in the formation of the
double stranded cDNA molecules. However, in some instances, it is
preferable to employ a RT which lacks or has substantially reduced
RNase H activity. RTs devoid of RNase H activity are known in the
art, including those comprising a mutation of the wild type reverse
transcriptase where the mutation eliminates the RNase H activity.
Examples of RTs having reduced RNase H activity are described in
US20100203597. In these cases, the addition of an RNase H from
other sources, such as that isolated from E. coli, can be employed
for the degradation of the starting RNA sample and the formation of
the double stranded cDNA. Combinations of RTs can also
contemplated, including combinations of different non-mutant RTs,
combinations of different mutant RTs, and combinations of one or
more non-mutant RT with one or more mutant RT.
[0075] DNA-dependent DNA polymerases for use in the methods and
compositions provided herein can be capable of effecting extension
of a primer according to the methods provided herein. Accordingly,
a DNA-dependent DNA polymerase can be one that is capable of
extending a nucleic acid primer along a first strand cDNA in the
presence of the RNA template or after selective removal of the RNA
template. Exemplary DNA dependent DNA polymerases suitable for the
methods provided herein include but are not limited to Klenow
polymerase, with or without 3'-exonuclease, Bst DNA polymerase, Bca
polymerase, .phi.29 DNA polymerase, Vent polymerase, Deep Vent
polymerase, Taq polymerase, T4 polymerase, and E. coli DNA
polymerase 1, derivatives thereof, or mixture of polymerases. In
some cases, the polymerase does not comprise a 5'-exonuclease
activity. In other cases, the polymerase comprises 5' exonuclease
activity. In some cases, the primer extension can be performed
using a polymerase comprising strong strand displacement activity
such as for example Bst polymerase. In other cases, the primer
extension can be performed using a polymerase comprising weak or no
strand displacement activity. One skilled in the art can recognize
the advantages and disadvantages of the use of strand displacement
activity during the primer extension step, and which polymerases
can be expected to provide strand displacement activity (see e.g.,
New England Biolabs Polymerases). For example, strand displacement
activity can be useful in ensuring whole transcriptome coverage
during the random priming and extension step. Strand displacement
activity can further be useful in the generation of double stranded
amplification products during the priming and extension step.
Alternatively, a polymerase which comprises weak or no strand
displacement activity can be useful in the generation of single
stranded nucleic acid products during primer hybridization and
extension that can be hybridized to the template nucleic acid.
[0076] In some cases, any double stranded product generated by the
methods described herein can be end repaired to produce blunt ends
for the adapter ligation applications described herein. Generation
of the blunt ends on the double stranded products can be generated
by the use of a single strand specific DNA exonuclease such as for
example exonuclease 1, exonuclease 7 or a combination thereof to
degrade overhanging single stranded ends of the double stranded
products. Alternatively, any double stranded products generated by
methods provided herein can be blunt ended by the use of a single
stranded specific DNA endonuclease for example but not limited to
mung bean endonuclease or S1 endonuclease. Alternatively, any
double stranded products generated by methods provided herein can
be blunt ended by the use of a polymerase that comprises single
stranded exonuclease activity such as for example T4 DNA
polymerase, any other polymerase comprising single stranded
exonuclease activity or a combination thereof to degrade the
overhanging single stranded ends of the double stranded products.
In some cases, the polymerase comprising single stranded
exonuclease activity can be incubated in a reaction mixture that
does or does not comprise one or more dNTPs. In other cases, a
combination of single stranded nucleic acid specific exonucleases
and one or more polymerases can be used to blunt end the double
stranded products of the primer extension reaction. In still other
cases, the products of the extension reaction can be made blunt
ended by filling in the overhanging single stranded ends of the
double stranded products. For example, the fragments can be
incubated with a polymerase such as T4 DNA polymerase or Klenow
polymerase or a combination thereof in the presence of one or more
dNTPs to fill in the single stranded portions of the double
stranded products. Alternatively, any double stranded products
generated by methods provided herein can be made blunt by a
combination of a single stranded overhang degradation reaction
using exonucleases and/or polymerases, and a fill-in reaction using
one or more polymerases in the presence of one or more dNTPs.
[0077] In another embodiment, the adapter ligation applications
described herein can leave a gap between a non-ligation strand of
the adapters and a strand of the double stranded product. In these
instances, a gap repair or fill-in reaction can be used to append
the double stranded product with the sequence complementary to the
ligation strand of the adapter. Gap repair can be performed with
any number of DNA dependent DNA polymerase described herein. In
some cases, gap repair can be performed with a DNA dependent DNA
polymerase with strand displacement activity. In some cases, gap
repair can be performed using a DNA dependent DNA polymerase with
weak or no strand displacement activity. In some cases, the
ligation strand of the adapter can serve as the template for the
gap repair or fill-in reaction. In some cases, gap repair can be
performed using Taq DNA polymerase.
[0078] Various ligation processes and reagents are known in the art
and can be useful for carrying out the methods provided herein. For
example, blunt ligation can be employed. Similarly, a single dA
nucleotide can be added to the 3'-end of the double-stranded DNA
product, by a polymerase lacking 3'-exonuclease activity and can
anneal to an adapter comprising a dT overhang (or the reverse).
This design allows the hybridized components to be subsequently
ligated (e.g., by T4 DNA ligase). Other ligation strategies and the
corresponding reagents and known in the art and kits and reagents
for carrying out efficient ligation reactions are commercially
available (e.g, from New England Biolabs, Roche).
[0079] The terms "joining," "appending" and "ligation" as used
herein, with respect to two polynucleotides, such as a stem-loop
adaptor/primer oligonucleotide and a target polynucleotide, refers
to the covalent attachment of two separate polynucleotides to
produce a single larger polynucleotide with a contiguous backbone.
Methods for joining two polynucleotides are known in the art, and
include without limitation, enzymatic and non-enzymatic (e.g.
chemical) methods. Examples of ligation reactions that are
non-enzymatic include the non-enzymatic ligation techniques
described in U.S. Pat. Nos. 5,780,613 and 5,476,930, which are
herein incorporated by reference. In some embodiments, an adaptor
oligonucleotide is joined to a target polynucleotide by a ligase,
for example a DNA ligase or RNA ligase. Multiple ligases, each
having characterized reaction conditions, are known in the art, and
include, without limitation NADtdependent ligases including tRNA
ligase, Taq DNA ligase, Thermus filiformis DNA ligase, Escherichia
coli DNA ligase, Tth DNA ligase, Thermus scotoductus DNA ligase (I
and II), thermostable ligase, Ampligase thermostable DNA ligase,
VanC-type ligase, 9.degree. N DNA Ligase, Tsp DNA ligase, and novel
ligases discovered by bioprospecting; ATP-dependent ligases
including T4 RNA ligase, T4 DNA ligase, T3 DNA ligase, T7 DNA
ligase, Pfu DNA ligase, DNA ligase 1, DNA ligase III, DNA ligase
IV, and novel ligases discovered by bioprospecting; and wild-type,
mutant isoforms, and genetically engineered variants thereof.
Ligation can be between polynucleotides having hybridizable
sequences, such as complementary overhangs. Ligation can also be
between two blunt ends. Generally, a 5' phosphate is utilized in a
ligation reaction. The 5' phosphate can be provided by the target
polynucleotide, the adaptor oligonucleotide, or both. 5' phosphates
can be added to or removed from polynucleotides to be joined, as
needed. Methods for the addition or removal of 5' phosphates are
known in the art, and include without limitation enzymatic and
chemical processes. Enzymes useful in the addition and/or removal
of 5' phosphates include kinases, phosphatases, and
polymerases.
IV. Methods of Amplification
[0080] The methods, compositions and kits described herein can be
useful to generate amplification-ready products for downstream
applications such as massively parallel sequencing (i.e. next
generation sequencing methods) or hybridization platforms. Methods
of amplification are well known in the art. Examples of PCR
techniques that can be used include, but are not limited to,
quantitative PCR, quantitative fluorescent PCR (QF-PCR), multiplex
fluorescent PCR (MF-PCR), real time PCR(RT-PCR), single cell PCR,
restriction fragment length polymorphism PCR(PCR-RFLP),
PCR-RFLP/RT-PCR-RFLP, hot start PCR, nested PCR, in situ polony
PCR, in situ rolling circle amplification (RCA), bridge PCR,
picotiter PCR, digital PCR, droplet digital PCR, and emulsion PCR.
Other suitable amplification methods include the ligase chain
reaction (LCR), transcription amplification, molecular inversion
probe (MIP) PCR, self-sustained sequence replication, selective
amplification of target polynucleotide sequences, consensus
sequence primed polymerase chain reaction (CP-PCR), arbitrarily
primed polymerase chain reaction (AP-PCR), degenerate
oligonucleotide-primed PCR (DOP-PCR) and nucleic acid based
sequence amplification (NABSA), single primer isothermal
amplification (SPIA, see e.g. U.S. Pat. No. 6,251,639), Ribo-SPIA,
or a combination thereof. Other amplification methods that can be
used herein include those described in U.S. Pat. Nos. 5,242,794;
5,494,810; 4,988,617; and 6,582,938. Amplification of target
nucleic acids can occur on a bead. In other embodiments,
amplification does not occur on a bead. Amplification can be by
isothermal amplification, e.g., isothermal linear amplification. A
hot start PCR can be performed wherein the reaction is heated to
95.degree. C. for two minutes prior to addition of the polymerase
or the polymerase can be kept inactive until the first heating step
in cycle 1. Hot start PCR can be used to minimize nonspecific
amplification. Other strategies for and aspects of amplification
are described in U.S. Patent Application Publication No.
2010/0173394 A1, published Jul. 8, 2010, which is incorporated
herein by reference. In some cases, the amplification methods can
be performed under limiting conditions such that only a few rounds
of amplification (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30
etc.), such as for example as is commonly done for cDNA generation.
The number of rounds of amplification can be about 1-30, 1-20,
1-15, 1-10, 5-30, 10-30, 15-30, 20-30, 10-30, 15-30, 20-30, or
25-30.
[0081] Techniques for amplification of target and reference
sequences are known in the art and include the methods described in
U.S. Pat. No. 7,048,481. Briefly, the techniques can include
methods and compositions that separate samples into small droplets,
in some instances with each containing on average less than about
5, 4, 3, 2, or one target nucleic acid molecule (polynucleotide)
per droplet, amplifying the nucleic acid sequence in each droplet
and detecting the presence of a target nucleic acid sequence. In
some cases, the sequence that is amplified is present on a probe to
the genomic DNA, rather than the genomic DNA itself. In some cases,
at least 200, 175, 150, 125, 100, 90, 80, 70, 60, 50, 40, 30, 20,
10, or 0 droplets have zero copies of a target nucleic acid.
[0082] PCR can involve in vitro amplification based on repeated
cycles of denaturation, oligonucleotide primer annealing, and
primer extension by thermophilic template dependent polynucleotide
polymerase, which can result in the exponential increase in copies
of the desired sequence of the polynucleotide analyte flanked by
the primers. In some cases, two different PCR primers, which anneal
to opposite strands of the DNA, can be positioned so that the
polymerase catalyzed extension product of one primer can serve as a
template strand for the other, leading to the accumulation of a
discrete double stranded fragment whose length is defined by the
distance between the 5' ends of the oligonucleotide primers.
[0083] LCR uses a ligase enzyme to join pairs of preformed nucleic
acid probes. The probes can hybridize with each complementary
strand of the nucleic acid analyte, if present, and ligase can be
employed to bind each pair of probes together resulting in two
templates that can serve in the next cycle to reiterate the
particular nucleic acid sequence.
[0084] SDA (Westin et al 2000, Nature Biotechnology, 18, 199-202;
Walker et al 1992, Nucleic Acids Research, 20, 7, 1691-1696), can
involve isothermal amplification based upon the ability of a
restriction endonuclease such as HincII or BsoBI to nick the
unmodified strand of a hemiphosphorothioate form of its recognition
site, and the ability of an exonuclease deficient DNA polymerase
such as Klenow exo minus polymerase, or Bst polymerase, to extend
the 3'-end at the nick and displace the downstream DNA strand.
Exponential amplification results from coupling sense and antisense
reactions in which strands displaced from a sense reaction serve as
targets for an antisense reaction and vice versa.
[0085] In some cases, the amplification is exponential, e.g. in the
enzymatic amplification of specific double stranded sequences of
DNA by a polymerase chain reaction (PCR).
V. Oligonucleotide Arrays
[0086] In some cases, a surface for use in the methods provided
herein comprises an oligonucleotides. In some cases, the surfaces
are arrays. In some cases, the arrays comprise aptamers. In some
cases, the arrays comprise oligonucleotides such that they are
oligonucleotide arrays. In some cases, the oligonucleotide or oligo
arrays are generated on surfaces comprising polymer coatings as
provided herein. The oligo arrays can be high density
oligonucleotide arrays. The oligo array can comprise at least 10,
20, 50, 100, 200, 500, 1,000, 2,000, 5,000, 10,000, 20,000, 50,000,
100,000, 200,000, 500,000, 1,000,000, 2,000,000, 5,000,000,
10,000,000, 20,000,000, 100,000,000, 200,000,000, 500,000,000 or
1,000,000,000 oligos coupled to a surface as provided herein. The
oligo array can comprise at most 10, 20, 50, 100, 200, 500, 1,000,
2,000, 5,000, 10,000, 20,000, 50,000, 100,000, 200,000, 500,000,
1,000,000, 2,000,000, 5,000,000, 10,000,000, 20,000,000,
100,000,000, 200,000,000, 500,000,000 or 1,000,000,000 oligos
coupled to a surface as provided herein. The oligo array can
comprise about 10, 20, 50, 100, 200, 500, 1,000, 2,000, 5,000,
10,000, 20,000, 50,000, 100,000, 200,000, 500,000, 1,000,000,
2,000,000, 5,000,000, 10,000,000, 20,000,000, 100,000,000,
200,000,000, 500,000,000 or 1,000,000,000 oligos coupled to a
surface as provided herein. An oligo array as provided herein can
have oligos arranged on it at a density of at least 10, 20, 50,
100, 200, 500, 1,000, 2,000, 5,000, 10,000, 20,000, 50,000,
100,000, 200,000, 500,000, 1,000,000, 2,000,000, 5,000,000,
10,000,000, 20,000,000, 100,000,000, 200,000,000, 500,000,000 or
1,000,000,000 oligos per square micrometer. The oligos on an oligo
array as provided herein can be organized into spots (features),
regions, or pixels. Oligos in each spot (feature) or region can be
identical to each other or related to each other (e.g., all or
substantially all include a consensus or common sequence). Oligos
in each spot or region can be greater than 55, 60, 65, 70, 75, 80,
85, 90, 95, 99, or 99.9% identical to each other. An oligo array as
provided herein can comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 100, 1000, 10,000, 50,000, 100,000, 200,000, 500,000,
1,000,000, 2,000,000, 5,000,000, 10,000,000, 20,000,000,
100,000,000, 200,000,000, 500,000,000 or 1,000,000,000 spots
(features) or regions. Each spot or region can have a size of at
most about 1 cm, 1 mm, 500 .mu.m, 200 .mu.m, 100 .mu.m, 10 .mu.m, 9
.mu.m, 8 .mu.m, 7 .mu.m, 6 .mu.m, 5 .mu.m, 4 .mu.m, 3 .mu.m, 2
.mu.m, 1 .mu.m, 800 nm, 500 nm, 300 nm, 100 nm, 50 nm, or 10 nm. In
some cases, the oligos are coupled to the polymer coating as
provided herein on the surface. The polymer coating can be a
polyacrylamide coating as provided herein. In some cases, a
composition as provided herein comprises a surface, a
polyacrylamide coating covalently bound to said surface; and at
least one oligonucleotide coupled to said polyacrylamide
coating.
[0087] Oligonucleotides (oligos) can be arranged on the array
(template and/or recipient array) surface in 5' to 3' orientation
or in 3' to 5' orientation. Individual array spots or regions can
have dimensions of up to about 15 .mu.m, up to about 14 .mu.m, up
to about 13 .mu.m, up to about 12 .mu.m, up to about 11 .mu.m, up
to about 10 .mu.m, up to about 5 .mu.m, up to about 3 .mu.m, up to
about 1 .mu.m, up to about 0.3 .mu.m, or up to about 0.1 .mu.m. The
primer regions can be arranged on the substrate at a density of at
least 100, 1,000, 10,000, 100,000, 500,000, 1,000,000, 2,000,000,
5,000,000, 10,000,000, 20,000,000, 50,000,000, 100,000,000,
200,000,000, or 500,000,000 regions per cm.sup.2.
[0088] In some cases, the oligos are incorporated into the polymer
coatings (e.g., polyacrylamide coating) during the polymerization
process. For example, 5'-acrydite-modified oligonucleotides chains
can be added during the acrylamide polymerization process to allow
the incorporation of the oligonucleotides into the polymerizing
polyacrylamide structure. In some cases, the oligonucleotides are
coupled to the polymer coating (e.g., polyacrylamide coating) at
the 5' end. In some cases, the oligonucleotides are coupled to the
polymer coating (e.g., polyacrylamide coating) at the 3' end. In
some cases, some oligonucleotides are coupled to the polymer
coating (e.g., polyacrylamide coating) at the 3' end and some
oligonucleotides are coupled to the polymer coating (e.g.,
polyacrylamide coating) at the 5' end.
[0089] In some cases, the oligos are incorporated into the polymer
coatings (e.g., polyacrylamide coating) after the polymerization
process. For example, reactive sites can be added to the polymer
(e.g., polyacrylamide) structure during the polymerization process.
Oligos can then be incorporated at the reactive sites subsequent to
the polymerization of the polymer (e.g., polyacrylamide). The
reactive sites can comprise bromoacetyl site, azide sites, or sites
that are compatible with azide-alkyne Huisgen cycloaddition. In
some cases, the reactive sites comprise bromoacetyl sites. In some
cases, the reactive sites comprise azides. In some cases, the
reactive sites comprise sites compatible with azide-alkyne Huisgen
cycloaddition.
[0090] In some cases, the oligos are incorporated into the polymer
coatings (e.g., polyacrylamide coating) in a controlled manner,
with particular oligos located at particular regions of the polymer
coatings (e.g., polyacrylamide coating). Oligos can be incorporated
into the polymer coatings (e.g., polyacrylamide coating) at random,
with particular oligos randomly distributed throughout the polymer
coatings (e.g., polyacrylamide coating).
[0091] The oligo array for use as a template array for the methods
provided herein can be fabricated by any appropriate method,
including but, not limited to, spotting and in situ synthesis. The
methods can include, but are not limited to, in situ synthesis
(e.g., photo-directed synthesis), printing (e.g., ink jet
printing), spotting, transfer, bridge amplification, or recombinase
polymerase amplification. The substrate of the template array and
of the transfer array can be any appropriate material, including
but not limited to glass, silicon, and polymers such as
polyacrylamide, polystyrene, polymethylmethacrylate (PMMA), and
polydimethylsiloxane (PDMS). The substrate of the template array
and of the transfer array can be the same or can be different.
[0092] In some cases, oligo arrays (i.e., template arrays) for use
in the methods provided herein are synthesized by spotting.
Spotting can be as described in Gao et al., 2004, Biopolymers,
73(5):579-596, the disclosure of which is herein incorporated by
reference in its entirety. Noncontact or contact printing methods
(e.g., robotic pins, piezoelectric ink-jet printers) can be used to
deposit pre-synthesized oligos onto oligo or primer regions of the
array. Oligos can then be linked or immobilized to the surface, for
example by chemical attachment via a functional group. In some
cases, the functional group can be bound to the 5' end of the
oligo, resulting in oligos with 3' ends away from the surface.
[0093] In some cases, oligo arrays (i.e., template arrays) are
generated using bridge amplification or recombinase polymerase
amplification, for example as described herein as well as in U.S.
Provisional Application Nos. 61/979,448 or 62/012,238, the
disclosure of each of which is herein incorporated by reference in
its entirety. A substrate for the oligo array (i.e., template
array) can comprise bound adaptors or oligos capable of binding to
a region on a separate oligo, permitting bridge amplification or
recombinase polymerase amplification of the separate oligo on the
substrate. The substrate can be seeded with oligos (i.e., primers)
with known barcode sequences, followed by amplification to generate
oligo regions. Alternatively, the oligo substrate (i.e., template
array substrate) can be seeded with oligos with random or unknown
barcode sequences, followed by amplification to generate oligo
regions and sequencing of oligos from each oligo region to
determine the barcode sequence corresponding to each oligo region.
The substrate can be prepared for the generation of oligo arrays as
provided herein.
VI. Transfer Techniques
[0094] The present disclosure provides methods and compositions for
transfer of template polymers. Transfer of the template polymer
array to a second surface can occur via an array transfer step.
[0095] The methods herein can also be used to generate oligo arrays
with a desired orientation. In some cases, the methods for
generating oligo arrays as provided herein on surfaces as provided
herein are used to generate oligo arrays that are used as templates
(i.e., template arrays) for the generation of one or more oligo
arrays comprising oligos coupled thereto that are complementary to
oligos on the template array. The oligo arrays comprising oligos
coupled thereto that are complementary to a template array can be
referred to as a recipient array (or alternatively, transfer
array). The transfer or recipient oligo arrays can comprise oligos
with a desired orientation. The transfer or recipient arrays can be
generated from the template array using an array transfer process.
In some cases, template oligo arrays with a desired feature
("spot") density (e.g., feature or spot size of about 1 .mu.m) are
subjected to an array transfer process as provided herein in order
to generate transfer or recipient oligo arrays with a desired
orientation. The desired orientation can be a transfer or
recipientoligo array that comprises oligos with the 5' end of each
oligo of the array attached to the array substrate. A template
oligo array for generating the transfer or recipient oligo array
with oligos in a desired orientation (i.e., 5' end of each oligo of
the array attached to the array substrate) can have the 3' end of
each oligo of the template array attached to the substrate. The
array transfer process can be a face-to-face transfer process. In
some cases, the face-to-face transfer process occurs by enzymatic
transfer or enzymatic transfer by synthesis (ETS). ETS is generally
depicted in FIGS. 2A-C and 3. In some cases, the face-to-face
transfer process occurs by a non-enzymatic transfer process. The
non-enzymatic transfer process can be oligonucleotide
immobilization transfer (OIT). OIT is generally depicted in FIGS. 4
and 5.
[0096] The face-to-face gel transfer process (e.g., ETS or OIT) can
significantly reduce the unit cost of fabrication while
simultaneously flipping the oligo orientation (5' immobilized)
which can have assay advantages such as allowing for the enzymatic
extension of the 3' ends of the array bound oligos. Moreover, ETS
or OIT can result in the transfer of a greater number or higher
percentage of oligos of a desired or defined length (i.e.,
full-length oligo) from the template array to the recipient array.
Subsequent amplification (e.g., amplification feature regeneration
or AFR as provided herein) of the transferred full length product
oligos on the recipient oligo arrays can allow the recipient oligo
arrays to contain oligos comprising greater than 50 nucleotide
bases without suffering from low yield or partial length
products.
[0097] In some cases, a template and/or recipient array comprises
polymers. The polymers can be aptamers or oligos. In some cases, a
template or recipient array comprises oligos. A template or
recipient array can have coupled to it at least 10, 20, 50, 100,
200, 500, 1,000, 2,000, 5,000, 10,000, 20,000, 50,000 or 100,000,
200,000, 500,000, 1,000,000, 2,000,000, 5,000,000, 10,000,000,
20,000,000, 100,000,000, 200,000,000, 500,000,000, or 1 billion
template polymers (e.g., oligos). A template array can have
template polymers arranged on it at a density of at least 10, 20,
50, 100, 200, 500, 1,000, 2,000, 5,000, 10,000, 20,000, 50,000 or
100,000 polymers (e.g., oligos) per square millimeter. The polymers
(e.g., oligos) on a template or recipient array can be organized
into spots, regions, or pixels. Polymers (e.g., oligos) in each
spot or region can be identical to each other or related to each
other (e.g., all or substantially all include a consensus or common
sequence). Polymers (e.g., oligos) in each spot or region can be
greater than 55, 60, 65, 70, 75, 80, 85, 90, 95, 99, or 99.9%
identical to each other. The template or recipient array can
comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 100, 1000, 10,000,
100,000, 1,000,000, or 10,000,000 spots or regions. Each spot or
region can have a size of at most about 1 cm, 1 mm, 500 .mu.m, 200
.mu.m, 100 .mu.m, 10 .mu.m, 9 .mu.m, 8 .mu.m, 7 .mu.m, 6 .mu.m, 5
.mu.m, 4 .mu.m, 3 .mu.m, 2 .mu.m, 1 .mu.m, 800 nm, 500 nm, 300 nm,
100 nm, 50 nm, or 10 nm.
[0098] A recipient or transfer array generated as provided herein
can comprise oligos that are either fully complementary, fully
identical, partially complementary, or partially identical in their
sequence and/or number to oligos on the template array from which
the recipient array was transferred. Partially complementary can
refer to recipient arrays that have at least 40%, 45%, 50%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or
99.9% sequence complementarity. Partially identical can refer to
recipient arrays that have at least 40%, 45%, 50%, 55%, 60%, 65%,
70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.9% sequence
identity. A recipient array can have the same number of
oligonucleotides as a template array and/or at least 40%, 45%, 50%,
55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or
99.9% of the number of oligos as the template array from which the
recipient array was transferred.
[0099] Array fabrication methods as provided herein can result in
arrays having polymers (e.g. oligos) of the designed, desired, or
intended length, which can be called full-length products. For
example, a fabrication method intended to generate oligos with 10
bases can generate full-length oligos with 10 bases coupled to an
array. Array fabrication processes can result in polymers (e.g.
oligos) of less than the designed, desired, or intended length,
which can be called partial-length products. The presence of
partial-length oligos can be within a given feature (spot) or
between features (spots). For example, a fabrication method
intended to generate oligos with 10 bases can generate
partial-length oligos with only 8 bases coupled to an array. That
is, a synthesized oligo array can comprise many nucleic acids which
are homologous or nearly homologous along their length, but which
may vary in length from each other. Of these homologous or nearly
homologous nucleic acids, those with the longest length can be
considered full-length products. Nucleic acids with length shorter
than the longest length can be considered partial-length products.
Array fabrication methods provided herein can result in some
full-length products (e.g., oligos) and some partial-length
products (e.g., oligos) coupled to an array in a given feature
(spot). Partial-length products coupled to a particular array or
within a given feature can vary in length. Complementary nucleic
acids generated from full-length products can also be considered
full-length products. Complementary nucleic acids generated from
partial-length products can also be considered partial-length
products.
[0100] A transfer method as provided herein (e.g., ETS or OIT) can
be used to increase or enrich the amount or percentage of
full-length products (e.g., oligo) coupled to a recipient array
surface. Array transfer (e.g., ETS or OIT) can result in a transfer
or recipient array comprising at least, at most, more than, less
than, or about 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, 95%, 96%, 97%, 98%, 99%, or 99.9% transferred oligonucleotides
that are 100% of the length of the respective oligonucleotide on a
template array used to generate the transfer or recipient array. A
transferred oligonucleotide that is 100% of the length (i.e., the
same or identical length) of a template oligonucleotide can be
referred to as full-length product (e.g., full-length product
oligo). A template array fabricated by methods known in that art
(e.g. spotting or in situ synthesis) can comprise about 20%
oligonucleotides that are a desired length (i.e., full-length
oligonucleotides) and about 80% oligonucleotides that are not a
desired length (i.e., partial-length oligonucleotides). Transfer of
the array generated by methods known in the art comprising about
20% full-length oligonucleotides and about 80% partial-length
oligonucleotides using array transfer methods as provided herein
can result in the generation of transfer or recipient arrays
comprising at most about 20% full-length product oligos. In some
cases, an array fabricated according to the methods herein has a
greater percentage of oligonucleotides of a desired length (i.e.,
full length oligos) such that transfer of an array fabricated
according to the methods herein using array transfer methods
provided herein results in the generation of transfer or recipient
arrays with a higher percentage of full-length product oligos as
compared to fabrication and transfer methods known in the art.
[0101] In some cases, a transfer method provided herein (e.g., ETS
or OIT) comprises generation of nucleic acid (e.g., oligo)
sequences complementary to the template sequences. The transfer can
occur by enzymatic replication (e.g., ETS) or by non-enzymatic
physical transfer (e.g., OIT) of array components between array
surfaces. The array surfaces can be any array surface as provided
herein. The substrate of the template array and of the recipient
array can be the same or can be different. The transfer can
comprise fabrication of complementary sequences which are already
attached to a recipient array; for example, primers bound to a
recipient array, and are complementary to adaptors on the template
array, can be extended using the template array sequences as
templates to thereby generate a full length or partial length
recipient array. Transfer can comprise fabrication of complementary
sequences from a template array followed by attachment of the
complementary sequences to a recipient array.
[0102] A transfer method as provided herein (e.g., ETS or OIT) can
generate a recipient array such that the orientation of a template
nucleic acid (e.g., oligo) relative to its coupled recipient array
surface is preserved (e.g., the 3' end of the template nucleic acid
(e.g., oligo) is bound to the template array and the 3' end of the
transferred nucleic acid (e.g., oligo) complement is bound to the
recipient array). Transfer can reverse the orientation of a nucleic
acid relative to its coupled array surface (e.g., the 3' end of the
template nucleic acid is bound to the template array and the 5' end
of the transferred nucleic acid complement is bound to the
recipient array).
[0103] Array transfer can be performed multiple times. Array
transfer can be performed multiple times using the same template
array. A template array of template polymers bound to a template
substrate can be used for the production of at least 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 500, 1,000,
5,000, 10,000, 50,000, or 100,000 recipient arrays. Array transfer
can be performed multiple times in a series of transfers, using the
transfer array from one array transfer as the template array for a
subsequent transfer. For example, a first transfer can be performed
from a template array with oligonucleotides bound to the array at
their 3' ends to a first transfer array with complementary
oligonucleotides bound to the array at their 5' ends, and a second
transfer can be performed from the first transfer array (now
serving as a template array) to a second transfer array with a
higher percentage of full-length products and sequences matching
the original template array than in recipient arrays generated
using transfer techniques commonly used in the art while preserving
the 5'-surface bound orientation. In some cases, the full-length
product oligos on a recipient array generated using the array
transfer methods provided herein (e.g., ETS or OIT) are further
enriched through amplification of the full-length product oligos on
the recipient array. Amplification can be conducted using the
methods provided herein. The array transfer method can be a
face-to-face enzymatic transfer method (e.g., ETS) or non-enzymatic
(e.g., OIT) as provided herein.
[0104] In some cases, array transfer by ETS or OIT can be aided by
the use of adaptor sequences on the template polymers (e.g.,
oligos). Polymers (e.g., oligos) can comprise a desired final
sequence with the addition of one or more adaptor sequences. For
example, a template oligonucleotide can comprise, in order, a 3'
end with a first adaptor sequence, a 5' end with a second adaptor
sequence, and a desired final sequence in the middle. The first and
second adaptor sequences can be the same or can be different. In
some cases, oligonucleotides in the same array spot comprise
identical first and second adaptor sequences and final sequences,
and oligonucleotides in different array spots comprise identical
first and second adaptor sequences but different final sequences.
Primers on a transfer/recipient array can be complementary to
adaptor sequences, allowing hybridization between the primers and
the template polymers (e.g., oligos). Such hybridization can aid in
the transfer from one array to another.
[0105] Some or all adaptor sequences can be removed from
transfer/recipient array polymers (e.g. transferred
oligonucleotides) after transfer, for example by enzymatic
cleavage, digestion, or restriction. Some or all adaptor sequences
can be removed from transfer/recipient array polymers (e.g.
transferred oligonucleotides) after transfer, for example by
enzymatic cleavage, digestion, or restriction. For example,
oligonucleotide array components can have adaptors removed via
probe end clipping (PEC) by double-strand DNAse. Oligonucleotides
complementary to the adaptor sequence can be added and hybridized
to the array components. DNAse specific to double-stranded DNA can
then be used to digest the oligonucleotides (see FIG. 6).
Alternatively, one or more cleavable base, such as a dU, can be
incorporated into the primer of the strand to be removed. The
primer can then be nicked at the position next to the 3'-most base
of the probe, and the nick site can be cut by an appropriate
enzyme, such as Mung bean S1 or P1 nuclease (see FIG. 7). Many
restriction enzymes and their associated restriction sites can also
be used, including but not limited to EcoRI, EcoRII, BamHI,
HindIII, TaqI, NotI, HinFI, Sau3AI, PvuII, SmaI, HaeIII, HgaI,
AluI, EcoRV, EcoP151, KpnI, PstI, SacI, SalI, ScaI, SpeI, SphI,
StuI, and XbaI. In some cases, the transfer process described above
is repeated from the second surface (recipient surface) to a new,
third surface containing primers (e.g., oligo) complementary to the
top adaptor. Because only the full length oligos can have a
complete top adaptor, only these can be copied onto the third array
surface (i.e., new or third recipient or transfer array). The
process can purify or enrich the full length oligos from the
partial products, thus creating a high feature density, high
quality full length oligo array. Purification or enrichment can
mean the generation of a recipient array such that said recipient
array has a greater percentage or number of oligos of a desired
length (i.e. full-length) than the array used as a template for the
generation of said recipient array. The full-length oligos can be
oligos that contain all the desired features (e.g., adaptor(s),
barcode(s), target nucleic acid or complement thereof, and/or
universal sequence(s), etc.).
[0106] In some instances, transfer occurs by an enzymatic transfer
or an enzymatic transfer by synthesis (ETS). A transfer array, or a
recipient array, surface can comprise surface immobilized
oligomers, nucleotides, or primers that are complementary, at least
in part, to template nucleic acids or oligonucleotides. In some
instances, a transfer array, or recipient array, comprises
oligomers that selectively hybridize or bind to aptamers on a
template array. Immobilized oligomers, nucleotides, or primers can
be complementary to adaptor regions on template polymers.
[0107] In some cases, array transfer can be aided by the
flexibility or deformability of the array (e.g., template array) or
of a surface coating on the array (e.g., template array). For
example, an array (e.g., template array) comprising a
polyacrylamide gel coating with coupled oligonucleotides can be
used in array transfer (e.g., ETS, OIT). The deformability of the
gel coating can allow for array components (oligos, reagents (e.g.,
enyzmes)) to contact each other despite surface roughness. Surface
roughness can be variability in the topography of the surface.
[0108] Array components can be amplified or regenerated by
enzymatic reactions termed as amplification feature regeneration
(AFR). AFR can be performed on template arrays and/or recipient
arrays. AFR can be used to regenerate full-length oligos on an
array (e.g., template and/or recipient) in order to ensure that
each oligo in a feature (spot) on an array (e.g., template and/or
recipient array) comprises desired components (e.g., adaptor(s),
barcode(s), target nucleic acid or complement thereof, and/or
universal sequence(s), etc.). AFR can be conducted on oligos
comprising adaptor and/or primer binding sites (PBS) such that the
oligos each comprise a first adaptor (or first PBS), probe
sequence, and second adaptor (or second PBS). Preferably, the
oligos in each feature on an array (e.g., template and/or recipient
array) comprise two or more primer binding sites (or adaptor
sequence). AFR can be performed used nucleic amplification
techniques known in the art. The amplification techniques can
include, but are not limited to, isothermal bridge amplification or
PCR. For example, bridge amplification can be conducted on array
(e.g., template and/or recipient array) component oligonucleotides
via hybridization between adaptor sequences on the array (e.g.,
template and/or recipient array) components and surface-bound
oligonucleotide primers, followed by enzymatic extension or
amplification. Amplification can be used to recover lost array
(e.g., template and/or recipient array) component density or to
increase density of array (e.g., template and/or recipient array)
components beyond their original density.
[0109] Immobilized oligos, nucleotides, or primers on an array as
provided herein (e.g., template and/or recipient array) can be
equal in length to each other or can have varying lengths.
Immobilized oligos, nucleotides, or primers can comprise at least
about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51,
52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68,
69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85,
86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 105,
110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170,
175, 180, 185, 190, 195, or 200 bases. In some cases, immobilized
oligos, nucleotides, or primers are 71 bases long (71-mer).
[0110] The recipient surface of the transfer array can be brought
into close proximity or contact with the template surface of the
template array. In some cases, contact between the template array
and the transfer array can be aided by the presence of a deformable
coating, such as a polymer gel (e.g., polyacrylamide). The
deformability of the coating can allow coupled polymers (e.g.
oligonucleotides or primers) to come into close enough contact for
hybridization to occur. The deformability of the coating can help
overcome gaps due to surface roughness (e.g., surface topography
variability) or other features that would otherwise prevent close
enough contact for hybridization. One or both of the arrays can
comprise a substrate with a gel coating with polymer molecules
coupled to it. For example, the transfer array can comprise a
substrate coupled to a polyacrylamide gel with oligonucleotide
primers coupled to the gel. Surfaces and coatings are further
discussed elsewhere in this disclosure.
[0111] Enzymatic Transfer by Synthesis (ETS)
[0112] ETS can comprise a face-to-face polymerase extension
reaction as depicted in FIGS. 2A-C and 3 to copy one or more
template oligos (e.g., DNA oligo) from a template oligo array onto
a second surface (e.g., recipient array). A second surface (e.g.,
recipient array) with uniform coverage of immobilized primers
complimentary to sequence on an oligo in the template oligo array
(e.g., the bottom adaptor sequence in oligo arrays comprising
adaptor sequence) can be pressed into contact with the template
oligo (e.g., DNA oligo) array. A recipient array surface can
comprise surface immobilized oligomers (oligos), nucleotides, or
primers that are complementary, at least in part, to template
nucleic acids or oligos on the template oligo array. In some cases,
a transfer or recipient array comprises oligos that selectively
hybridize or bind to aptamers on a template array. Immobilized
oligos, nucleotides, or primers on a transfer or recipient array
can be complementary to adaptor regions on template polymers (e.g.
oligos).
[0113] An Example of an ETS array transfer process as provided
herein is illustrated in FIGS. 2A-C. The template nucleic acids
(oligos) can hybridize with the immobilized primers or probes on
the recipient surface, also called recipient primers or probes or
transfer primers or probes. The hybridized complex (e.g., duplex)
can be extended enzymatically (see FIG. 2A) such as, e.g., by DNA
polymerase including but not limited to PolI, PolII, PolIII,
Klenow, T4 DNA Pol, modified T7 DNA Pol, mutated modified T7 DNA
Pol, TdT, Bst, Taq, Tth, Pfu, Pow, Vent, Pab, pyrophage.
[0114] The transfer process can preserve the orientation of the
oligonucleotides, i.e. if the 5' end is bound to the template
surface, the 5' end of the synthesized oligonucleotide will be
bound to the recipient surface, or vice versa. As shown in FIG. 2A,
transfer primers bound at their 5' ends can bind to the template
nucleic acids at their 3' ends, followed by enzymatic extension to
produce nucleic acids complementary to the template oligos and
bound to the recipient array surface at their 5' ends.
[0115] In some cases, only full-length template nucleic acid
products are used to generate complements on the recipient array.
FIG. 2C shows an example of enzymatic transfer (i.e., ETS) using
only full-length template nucleic acid products, which comprise a
first adaptor region A, a middle region B, and a second adaptor
region C. In FIG. 2C, the recipient array surface comprises primers
that are complementary to the second adaptor sequence C at the end
of the template nucleic acid. Full-length products on the template
array comprise the whole sequence (i.e., first adaptor A-middle
region B-second adaptor C) and partial-length products do not
(i.e., first adaptor A-middle region B). In FIG. 8C, partial-length
products on the template array are not transferred because they
lack the second adaptor C and thus cannot be bound by the primer
(oligo) on the recipient array that comprises sequence
complementary to second adaptor C. In some cases, at least 30%,
40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9% or
100% of template nucleic acid oligos on the template array are
full-length products (oligos). In some cases, at least 30%, 40%,
50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9% or 100% of
transfer or recipient nucleic acid products (oligos) generated on
the recipient array are full-length products. The generation of
partial-length products on the recipient array during ETS can be
due to incomplete extension of full-length template oligos during
polymerase-driven synthesis. The generation of full-length products
on the recipient arrays can be accomplished using AFR as provided
herein.
[0116] In some cases, the recipient array includes on it primers
that hybridize a portion of the template polymers (e.g., oligos)
such that extension reactions occur until all of the template
polymers (e.g., oligos) are used as templates for synthesis of a
complementary recipient oligos on a complementary array (or
recipient array). In some instances, synthesis of the recipient
array occurs such that on average at least 100, 99, 98, 97, 96, 95,
94, 93, 92, 91, 90, 89, 88, 87, 86, 85, 84, 83, 82, 81, 80, 79, 78,
77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 64, 63, 62, 61,
60, 59, 58, 57, 56, 55, 54, 53, 52, 51, or 50% of the template
polymers (e.g., oligos) are used to generate complementary
sequences on the recipient array. Stated differently, a recipient
array, post-transfer, can comprise recipient nucleotides (e.g.,
oligos) synthesized using at least 100, 99, 98, 97, 96, 95, 94, 93,
92, 91, 90, 89, 88, 87, 86, 85, 84, 83, 82, 81, 80, 79, 78, 77, 76,
75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 64, 63, 62, 61, 60, 59,
58, 57, 56, 55, 54, 53, 52, 51, or 50% of the template
oligonucleotides as templates.
[0117] The array transfer process (e.g., ETS) can invert the
orientation of the template nucleic acids (see FIG. 2B, FIG. 3).
That is, if the 5' end is bound to the template surface, the 3' end
of the synthesized oligonucleotide will be bound to the recipient
surface, or vice versa. For example, FIG. 2B shows an enzymatic
transfer (i.e., ETS) of template nucleic acids (e.g., oligos) on
the surface of a template array which can comprise some or all of a
first adaptor region A, a middle region B, and a second adaptor
region C. In FIG. 2B recipient surface primers (A') that are
complementary to an adaptor sequence located at the substrate end
of the template nucleic acids and is designated A are used to
conduct enzymatic transfer. In this case, both partial-length and
full-length complementary products (oligos) are transferred, and
their orientation relative to the substrate surface of the template
array is reversed.
[0118] As shown in FIG. 3, template nucleic acids (e.g., oligos)
bound to the template array surface (template surface) at their 3'
ends can hybridize to transfer primers on the recipient array bound
to the recipient array surface at their 5' ends. Enzymatic
extension of the transfer primers produces nucleic acids (e.g.,
oligos) complementary to the template nucleic acids (e.g., oligos)
and bound to the recipient array surface at their 5' ends. The same
process can be conducted for template nucleic acids bound to the
template surface at their 5' ends when transfer primers are bound
to the recipient array surface at their 3' ends. Extension of these
transfer primers results in nucleic acids (e.g., oligos)
complementary to the template nucleic acids (e.g., oligos) and
bound to the recipient array surface at their 3' ends. In some
cases, partial-length oligos in a feature (spot) of the template
array) are utilized to generate complementary partial length oligos
on a recipient array. In some cases, full-length oligos in a
feature (spot) of the template array are utilized to generate
complementary full-length oligos on a recipient array.
[0119] The template and recipient surfaces can be biocompatible,
such as polyacrylamide gels, modified polyacrylamide gels, PDMS, or
any other biocompatible surfaces (e.g., silica, silicon, COC, and
metals such as gold or chrome). If the surface comprises a polymer
gel layer, the thickness can affect its deformability or
flexibility. The deformability or flexibility of a gel layer can
make it useful in maintaining contact between surfaces despite
surface roughness. Details of the surfaces are further discussed
herein.
[0120] Reagents and other compounds including enzymes, buffers, and
nucleotides can be placed on the surface or embedded in a
compatible gel layer. The enzymes can be polymerases, nucleases,
phosphatases, kinases, helicases, ligases, recombinases,
transcriptases, or reverse transcriptases. In some cases, the
enzymes on the surface or embedded in a compatible gel layer
comprise a polymerase. Polymerases can include, but are not limited
to, PolI, PolII, PolIII, Klenow, T4 DNA Pol, modified T7 DNA Pol,
mutated modified T7 DNA Pol, TdT, Bst, Taq, Tth, Pfu, Pow, Vent,
Pab, Phusion, pyrophage, and others. Details of the surfaces are
further discussed herein. In some cases, the enzymes on the surface
or embedded in a compatible gel layer comprise a ligase. Ligases
can include, but are not limited to, E. coli ligase, T4 ligase,
mammalian ligases (e.g., DNA ligase I, DNA ligase II, DNA ligase
III, DNA ligase IV), thermostable ligases, and fast ligases.
[0121] A template surface and a post-transfer recipient surface
generated by enzymatic extension are shown in FIGS. 12, 13, and 14.
The surface of the recipient array can be a gel formed on top of
the template array. FIG. 15 shows an example of an enzymatic
extension reaction as described herein from a template array
surface to a recipient surface (i.e., Gel Copy (with template)) in
the presence of a reaction mixture (e.g., primers, enzymes, buffers
as outlined herein) and template as well as a negative control
where a template array is subjected to an enzymatic extension
reaction as described herein to a recipient surface (Gel Copy (NO
template)) in the presence of a reaction mixture (e.g., primers,
enzymes, buffers as outlined herein) but no template nucleic acids.
The lack of fluorescence in the negative control (i.e., Gel Copy
(NO template)) demonstrates a lack of product generated in the
absence of template nucleic acids. FIG. 22 shows results from an
additional control experiment, wherein a template array surface
(left) was contacted with a recipient transfer surface in the
presence of a reaction mixture (i.e., primers, buffers) (right) but
in the absence of enzyme. The lack of fluorescence on the recipient
array (right) in FIG. 22 demonstrates a lack of transfer. The
reaction mixture can be placed on the surface of the recipient
array or embedded in a recipient surface. In some cases, the
reaction mixture is placed on the surface of the recipient array.
In some cases, the reaction mixture is embedded in the recipient
surface. The recipient surface can be a compatible gel layer. The
reaction mixture can comprise any reagent necessary to conduct
enzymatic transfer by synthesis (ETS). The reagents can comprise
Enzymatic transfer of a template array by ETS can be conducted as
follows: 1.) enzyme mix is prepared (e.g., 37 .mu.L H.sub.2O, 5
.mu.L 10.times. Thermopol buffer, 5 .mu.L of 10 mg/mL BSA, 1 .mu.L
of 10 mM dNTPs, and 2 .mu.L of 8 U/.mu.L Bst enzyme); 2.) enzyme
mix is applied to a recipient array (e.g., an acrylamide gel coated
glass slide with coupled oligonucleotide primers prepared as
described elsewhere in this disclosure); 3.) a template array is
placed face-to-face with the and allowed to react (e.g., clamped
together in a humidity chamber for 2 hours at 55.degree. C.); 4.)
the template and recipient arrays are separated (e.g., loosened by
application of 4.times.SSC buffer and pulled apart with the aid of
a razor blade); 5.) the template array is rinsed (e.g., in DI
water) and dried (e.g., with N.sub.2); and 6.) the recipient array
is rinsed (e.g., with 4.times.SSC buffer and 2.times.SSC buffer).
In some cases, the oligos on the template array comprise adaptors,
such that a bottom adaptor is located proximal to the template
array surface, while a top adaptor is located distal from the
template array surface. While the sandwich is heated to 55.degree.
C., Bst polymerase in Thermopol PCR buffer can extend the primers
from the recipient array hybridized to the bottom adaptor of the
template array, which can create a dsDNA molecular bridge between
the template and recipient array surfaces. Upon physical
separation, the second surface (i.e., recipient array) can contain
the complementary ssDNA barcode array with the 5' end of the oligos
attached to the surface and the 3' end available for polymerase
extension. Since both the uniformly dispersed primer on the
template array and the barcode oligos on the recipient array can be
tethered to their respective surfaces, the relative locations of
the transferred features can be maintained (in mirror image). To
achieve intimate contact and thus uniform transfer over the full
chip area, a broad range of surface materials (PDMS,
Polyacrylamide), thicknesses, and process conditions can be
used.
[0122] Oligonucleotide Immobilization Transfer (OIT)
[0123] In some instances, the generation of a recipient array is
performed by non-enzymatic transfer. One form of non-enzymatic
transfer is oligonucleotide immobilization transfer (OIT). In OIT,
the template nucleic acids (e.g., oligo) on a template array can be
single-stranded. Primers comprising sequence complementary to a
portion of the template oligos can hybridize to the template oligos
and be extended by primer extension in order to generate and can be
made double-stranded template oligos on the template array. The
primers used for primer extension can be in solution. Many
polymerases can be used for OIT, including PolI, PolII, PolIII,
Klenow, T4 DNA Pol, modified T7 DNA Pol, mutated modified T7 DNA
Pol, TdT, Bst, Taq, Tth, Pfu, Pow, Vent, Pab, Phusion and others.
In some cases, the primers used for primer extension comprise
linkers that are used to immobilize or bind strand of the
double-stranded template oligo generated by primer extension (see
FIG. 4) on a surface of a recipient array. The recipient array
surface can be a planar surface, a bead, or a gel as provided
herein. In some cases, the recipient array surface is a
polyacrylamide gel formed during OIT (as shown in FIG. 5). In some
cases, subsequent to extension, the linkers can be bound to a
recipient array surface. The recipient array surface can be any
array surface as provided herein such as a polymer gel or modified
glass surface. In OIT, the template and recipient array surfaces
can be then be separated. The DNA (i.e., double-stranded template
oligos) can be melted prior to separation.
[0124] In some cases, the primers used in OIT are 5'-acrydite
modified primers. The 5'-acrydite modified primers can be capable
of incorporation into a polymer gel (e.g., polyacrylamide) during
polymerization as provided herein. Extension products from the
template nucleic acids (e.g., oligos) can then be generated with
the acrydite primers, contacted with a substrate with a binding
treatment (e.g., unpolymerized polyacrylamide coating precursor),
incorporated during polymerization, and separated (see FIG. 8 for
an illustration). The primers can be 5'-hexynyl-polyT-DNA. In some
cases, primer extension products from the template nucleic acids
are generated via binding and extension of complementary
5'-hexynyl-polyT-DNA primers. Following extension, the
5'hexynyl-polyT-DNA primers can be: 1.) contacted with a substrate
with a binding treatment (such as glass treated with silane), 2.)
linked to a cross-linker such as, for example, a homobifunctional
linker such as 1,4-Phenylene Diisothiocyanate (PDITC), 3.) linked
to an N3 bonding group with a PEG linker, (e.g., FIG. 9), 4.)
bonded to the substrate at the N3 group (e.g., FIG. 10), and 5.)
separated during a second stage of OIT (FIG. 11). Examples of
PDITC-N3 attachment of nucleic acids are shown in FIGS. 9 and 10.
The surfaces can be any of the surfaces as discussed herein. Other
cross-linkers that can be used in place of PDITC can include
dimethyl suberimidate (DMS), disuccimidyl carbonate (DSC) and/or
disuccimidyl oxylate (DSO). This process can preserve the
orientation of the oligonucleotides, i.e. if the 5' end is bound to
the template array surface, the 5' end of the synthesized
oligonucleotide will be bound to the recipient array surface, or
vice versa. While enzymatic extension can be used prior to the
transfer, the transfer itself can be conducted without enzymatic
reactions.
[0125] FIG. 16 shows a picture of a fluorescently labeled template
array, with template molecules having the structure 5'
CAGAAGACGGCATACGAGAT_GACTGGAGTTCAGACGTGTGCTCTTCC
GTGTAGATCTCGGTGGTCGCCGTA-3'T*-(HEG).sub.2-(substrate surface) Prior
to imaging, the array was allowed to hybridize with 500 nM of QC
FC2-Cy3 in 4.times.SSC buffer at 55.degree. C. for 60 minutes. FIG.
17 shows zoomed in views of regions of the same template array.
FIG. 18 shows the same template array as well as a recipient
transfer array after a non-enzymatic transfer. The template nucleic
acids were hybridized with Acr-FC1 primers and extended with Bst
polymerase, then incorporated into a polymer gel on a recipient
transfer array substrate and separated from the template array. The
template array shows no appreciable decrease in signal
post-transfer, while the transfer array shows a small signal under
10.times. exposure. FIG. 19 shows a side-by-side comparison of a
template array pre- and post-transfer. As can be seen, the template
array shows no appreciable decrease in signal post-transfer. FIG.
20 shows a comparison between non-enzymatic transfer with gel
extension strand transfer and non-enzymatic transfer with gel
ripped template strand transfer FIG. 21 shows a comparison in
exposure settings between gel images, one with 10.times.2S 2 bin
and one with 10.times.0.5 s 10 bin.
[0126] In some cases, an oligo array with 5' to 3' orientation can
be generated without enzymatic transfer. For example, the unbound
end of the synthesized nucleic acid sequences on a template oligo
array can comprise a linker sequence complementary to a sequence at
or near the array-bound end of the oligo, allowing the oligo to
circularize. The oligo can further comprise a restriction sequence
at the same end. Digestion of the restriction sequence on
circularized oligos serve to flip the full-length oligos containing
the linker sequence and cut loose any partial-length oligo products
on the array which lack the linker sequence. Many restriction
enzymes and their associated restriction sites can be used,
including but not limited to EcoRI, EcoRII, BamHI, HindIII, TaqI,
NotI, HinFI, Sau3AI, PvuII, SmaI, HaeIII, HgaI, AluI, EcoRV,
EcoP151, KpnI, PstI, SacI, SalI, ScaI, SpeI, SphI, StuI, and
XbaI.
VII. Surfaces
[0127] The surfaces used for the transfer methods as provided
herein (e.g., template surface and/or the recipient surface) can
comprise a range of possible materials. In some cases, the surface
comprises a polymer gel or coating on a substrate, such as a
polyacrylamide gel or a PDMS gel. In some cases, the surface
comprises a gel without a substrate support. In some cases, the
surface comprises a thin coating on a substrate, such as sub-200 nm
coatings of polymer. In some cases, the surface comprises an
uncoated substrate, such as glass or silicon. The polymer coatings
can form polymer brush thin-films. The polymer coatings can include
some cross-linking. The polymer coatings can form a graft
structure. The polymer coatings can form a network structure. The
polymer coatings can form a branched structure. The polymers can
comprise homogenous polymers. The polymers can comprise block
copolymers. The polymers can comprise gradient copolymers. The
polymers can comprise periodic copolymers. The polymers can
comprise statistical copolymers.
[0128] The polymer coating can have a range of thicknesses or
widths. The polymer coating can have a thickness or width of about
0.0001, 0.00025, 0.0005, 0.001, 0.005, 0.01, 0.025, 0.05, 0.1, 0.2,
0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50,
55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, or 200 mm.
The polymer coating can have a thickness or width of less than
0.0001, 0.00025, 0.0005, 0.001, 0.005, 0.01, 0.025, 0.05, 0.1, 0.2,
0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50,
55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, or 200 mm.
The polymer coating can have a thickness or width of more than
0.0001, 0.00025, 0.0005, 0.001, 0.005, 0.01, 0.025, 0.05, 0.1, 0.2,
0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50,
55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, or 200 mm.
The polymer coating can have a thickness or width of at least
0.0001, 0.00025, 0.0005, 0.001, 0.005, 0.01, 0.025, 0.05, 0.1, 0.2,
0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50,
55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, or 200 mm.
The polymer coating can have a thickness or width of at most
0.0001, 0.00025, 0.0005, 0.001, 0.005, 0.01, 0.025, 0.05, 0.1, 0.2,
0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50,
55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, or 200 mm.
The polymer coating can have a thickness or width of between 0.0001
and 200 mm, between 0.01 and 20 mm, between 0.1 and 2 mm, or
between 1 and 10 mm. The polymer coating can have a thickness or
width of from about 0.0001 to about 200 mm, about 0.01 to about 20
mm, about 0.1 to about 2 mm, or about 1 to about 10 mm. In some
cases, the polymer coating comprises a width or thickness of about
10 microns. The polymer coating can be at least 1 .mu.m, 2 .mu.m, 3
.mu.m, 4 .mu.m, 5 .mu.m, 7 .mu.m, 8 .mu.m, 9 .mu.m, 10 .mu.m, 15
.mu.m, 20 .mu.m, 25 .mu.m, 30 .mu.m, 40 .mu.m thick. The polymer
coating may be at least 50 .mu.m thick. The polymer coating may be
at least 75 .mu.m thick. The polymer coating may be at least 100
.mu.m thick. The polymer coating may be at least 150 .mu.m thick.
The polymer coating may be at least 200 .mu.m thick. The polymer
coating may be at least 300 .mu.m thick. The polymer coating may be
at least 400 .mu.m thick. The polymer coating may be at least 500
.mu.m thick. The polymer coating may be between about 1 .mu.m and
about 10 .mu.m thick. The polymer coating may be between about 5
.mu.m and about 15 .mu.m thick. The polymer coating may be between
about 10 .mu.m and about 20 .mu.m thick. The polymer coating may be
between about 30 .mu.m and about 50 .mu.m thick. The polymer
coating may be between about 10 .mu.m and about 50 .mu.m thick. The
polymer coating may be between about 10 .mu.m and about 100 .mu.m
thick. The polymer coating may be between about 50 .mu.m and about
100 .mu.m thick. The polymer coating may be between about 50 .mu.m
and about 200 .mu.m thick. The polymer coating may be between about
100 .mu.m and about 30 .mu.m thick. The polymer coating may be
between about 100 .mu.m and about 500 .mu.m thick.
[0129] Gels and coatings can additionally comprise components to
modify their physicochemical properties, for example,
hydrophobicity. For example, a polyacrylamide gel or coating can
comprise modified acrylamide monomers in its polymer structure such
as ethoxylated acrylamide monomers, phosphorylcholine acrylamide
monomers, and/or betaine acrylamide monomers. The coating can be
hydrophobic or hydrophilic. The coating can comprise a polymer
coating or polymer brush, such as polyacrylamide or modified
polyacrylamide. The coating can comprise a gel, such as a
polyacrylamide gel or modified polyacrylamide gel. The coating can
comprise metal, such as patterned electrodes or circuitry. The
coating or functionalization can comprise a binding agent, such as
streptavidin, avidin, antibodies, antibody fragments, or aptamers.
The coating or functionalization can comprise multiple elements,
for example a polymer or gel coating and a binding agent.
[0130] Gels and coatings can additionally comprise markers or
reactive sites to allow incorporation of markers. Markers can
comprise oligonucleotides. For example, 5'-acrydite-modified
oligonucleotides can be added during the polymerization process of
a polyacrylamide gel or coating. Reactive sites for incorporation
of markers can comprise bromoacetyl sites, azides, sites compatible
with azide-alkyne Huisgen cycloaddition, or other reactive sites.
Markers can be incorporated into the polymer coatings in a
controlled manner, with particular markers located at particular
regions of the polymer coatings. Markers can be incorporated into
the polymer coatings at random, whereby particular markers can be
randomly distributed throughout the polymer coatings.
[0131] In some cases, physiochemical properties of the polymer
coatings herein are modified. The modification can be achieved by
incorporating modified acrylamide monomers during the
polymerization process. In some cases, ethoxylated acrylamide
monomers are incorporated during the polymerization process. The
ethoxylated acrylamide monomers can comprise monomers of the form
CH.sub.2.dbd.CH--CO--NH(--CH.sub.2--CH2-O--).sub.nH. The
ethoxylated acrylamide monomers can comprise hydroxyethyl
acrylamide monomers. The ethoxylated acrylamide monomers can
comprise ethylene glycol acrylamide monomers. The ethoxylated
acrylamide monomers can comprise hydroxyethylmethacrylate (HEMA).
The incorporation of ethoxylated acrylamide monomers can result in
a more hydrophobic polyacrylamide surface coating. In some cases,
phosphorylcholine acrylamide monomers are incorporated during the
polymerization process. The phosphorylcholine acrylamide monomers
can comprise other phosphorylcholine acrylamide monomers. In some
cases, betaine acrylamide monomers are incorporated during the
polymerization process. The betaine acrylamide monomers can
comprise other betaine acrylamide monomers.
[0132] In some cases, a surface with a gel coating can be prepared
as follows: glass slides are cleaned (e.g., with NanoStrip
solution), rinsed (e.g. with DI water), and dried (e.g. with
N.sub.2); the glass slide surface is functionalized with acrylamide
monomers; a silanation solution is prepared (e.g., 5% by volume
(3-acrylamidopropyl)trimethoxysilane in ethanol and water); the
glass slide is submerged in the silanation solution (e.g. for 5
hours at room temperature), rinsed (e.g., with DI water), and dried
(e.g. with N.sub.2); a 12% acrylamide gel mix is prepared (e.g., 5
mL H.sub.2O, 1 mg gelatin, 600 mg acrylamide, 32 mg
bis-acrylamide); a 6% acrylamide gel mix is prepared (e.g., 50
.mu.L 12% acrylamide gel mix, 45 .mu.L DI water, 5 .mu.L
5'-acrydite modified oligonucleotide primers (1 mM) vortexed to
mix); 6% acrylamide gel mix is activated (e.g., 1.3 .mu.L of 5%
ammonium persulfate and 1.3 .mu.L of 5% TEMED are each added per
100 .mu.L of gel mix and vortexed); gel mix is applied to a surface
(e.g. silanized functionalized glass slide surface), evenly spread
(e.g. by pressing with a cover slip or by spin coating), and
allowed to polymerize (e.g., 20 minutes at room temperature).
VIII. Array Amplification and Regeneration
[0133] The number of array components (e.g., nucleic acids,
oligomers) in each array section can be amplified or regenerated.
Amplification can be desirable for the template array if the array
components on the template array have become depleted, for example
from loss during transfers. Amplification can be desirable for the
transfer array if the number of array components on the transfer
array is low, for example due to a transfer from a template array
with low density or a low number of array components. For example,
FIG. 24 shows a template array used in enzymatic transfer and
subsequently amplified with 50-70 cycles of amplification.
[0134] Amplification can be aided by the use of adaptor sequences
on the template polymers. Polymers can comprise a desired final
sequence in addition to one or more adaptor sequences. For example,
a template oligonucleotide can comprise, in order, a 3' end with a
first adaptor sequence, a 5' end with a second adaptor sequence,
and a desired final sequence in the middle. The first and second
adaptor sequences can be the same or can be different. In some
cases, oligonucleotides in the same array spot comprise identical
first and second adaptor sequences and final sequences, and
oligonucleotides in different array spots comprise identical first
and second adaptor sequences but different final sequences. Primers
on a transfer array can be complementary to adaptor sequences,
which can allow hybridization between the primers and the template
polymers. Such hybridization can aid in amplification or
regeneration of the array. Primers coupled to an array can be
generic e.g., universal or random primers, or target-specific
primers.
[0135] Amplification of array components can occur enzymatically
(e.g., bridge amplification or RPA). For example, if the array
components comprise oligonucleotides, amplification can occur by
nucleic acid amplification reactions such as polymerase chain
reaction (PCR), bridge amplification, bridge PCR, isothermal PCR,
isothermal bridge amplification, isothermal bridge PCR, continuous
flow PCR, recombinase polymerization amplification (RPA), or other
reactions. The enzymes used can comprise a variety of enzymes, such
as PolI, PolII, PolIII, Klenow, T4 DNA Pol, modified T7 DNA Pol,
mutated modified T7 DNA Pol, TdT, Bst, Taq, Tth, Pfu, Pow, Vent,
Pab or other polymerase enzymes; helicase; recombinase; or other
enzymes.
[0136] The intensity or density of coupled polymers (e.g., nucleic
acids) on an array can be recovered by amplification. The intensity
or density of coupled polymers (e.g., nucleic acids) on an array
can be increased beyond its initial value by amplification. Array
spots can grow during amplification. For example, bridge
amplification or bridge PCR can lead to growth or walking of
nucleic acid molecules by 50-100 nm during 28 cycles of
amplification.
[0137] Array surfaces can comprise barriers to prevent
amplification of array components beyond their individual feature
borders. Barriers can comprise physical borders, reaction borders,
or other borders. Borders can be fabricated by laser ablation of
surface-coupled features (e.g. nucleic acids or other polymers).
Borders can be fabricated by light-activated protective groups; for
example, light-activated protective groups can be coupled to
nucleic acids across an entire array, and then only desired areas
can be deprotected.
IX. Applications and Advantages
[0138] The compositions and methods described in this disclosure
can be used for a range of applications. For example, a template
array can be generated by standard means, and a plurality of
recipient transfer arrays can be generated as complement or
recipient arrays from the template. This can result in reduced
fabrication costs. In some instances, at least 5, 10, 20, 50, 100,
200, 500, 1,000, 2,000, 5,000, 10,000, 20,000, 100,000, 200,000,
500,000 complement arrays or recipient arrays can be generated from
each template array. For example, FIG. 23 shows images of a
template array pre-transfer (left) and after five transfers
(right). Each of the complement arrays can result in
oligonucleotide probes that are complementary to at least 50, 60,
70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 99.5% of the
template molecules on the template array.
[0139] Recipient transfer arrays can comprise more
enzymatically-favorable environments than arrays fabricated by
standard means, thus allowing a wider range of reactions to be
conducted on or near the array surface. For example, a recipient
transfer array can comprise a polymer gel or coating, such as
polyacrylamide, which is more favorable to enzyme activity than an
uncoated surface such as glass or silicon.
[0140] Recipient transfer arrays can be fabricated comprising
oligonucleotides with 3' ends up. This can provide reduced steric
hindrance for hybridization. This can also provide oligonucleotides
in a configuration useful for further extension, including
sequencing by synthesis or genotyping (e.g. SNP detection).
[0141] Recipient transfer arrays can be generated with very long
oligonucleotides. While synthesis of very long oligonucleotides can
result in very few full-length oligonucleotide products, the
compositions and methods described in this disclosure can generate
recipient transfer arrays comprising mostly or only full-length
oligonucleotides.
[0142] In some cases, the compositions and methods described in
this disclosure can provide arrays with fine resolution, defined
(i.e. not random) sequences in 5' to 3' orientation, and on an
enzymatically compatible surface.
[0143] For enzymatic transfer methods, the immobilization of the
oligonucleotides can reduce cross-contamination between array
features. Furthermore, for a single-strand template the need to
make a complementary strand before transfer can be eliminated.
Examples
Example 1--Enzymatic Transfer of Template Via Single Extension
Silanation of Gel-Chip Surfaces
[0144] Glass slides were cleaned overnight in NanoStrip solution,
rinsed with deionized (DI) water, and dried with N.sub.2. The
surface was then functionalized with acrylamide monomers which will
bind a polyacrylamide gel to the surface. A silanation solution was
prepared with 475 mL ethanol, 25 mL deionized water, and 26 mL
(3-acrylamidopropyl) trimethoxysilane, for a 5% v/v final
concentration of silane. A rack of cleaned and dried glass slides
were submerged in the silanation solution and agitated gently at
room temperature for 5 hours. Slides were subsequently placed in a
fresh ethanol bath, repeated five times. Slides were then rinsed in
a deionized water bath and dried with N.sub.2. Slides were stored
in a desiccated chamber until further use.
Preparation of Acrylamide Gel Mix
[0145] A 12% acrylamide gel mix was prepared with 5.00 mL of
H.sub.2O, 1.00 mg gelatin, 600.00 mg acrylamide, and 32.00 mg
bis-acrylamide. The components were dissolved and mixed together
for a final concentration of 12% acrylamide gel mix. For a 6% gel
chip, 50 .mu.L of 12% acrylamide gel mix, 45 .mu.L of deionized
water, and .mu.L of 5'-acrydite-FC1 (1 mM concentration)
functionalized oligonucleotides were combined for a total volume of
50 .mu.L and vortexed.
Polymerization of Thin Gels
[0146] To the mix for a 6% gel chip prepared above, 1.3 .mu.L of 5%
ammonium persulfate per 100 .mu.L reaction mix and 1.3 .mu.L of 5%
TEMED per 100 .mu.L reaction mix were added as activators, for a
final activator concentration of 0.065% each. The mixture was then
vortexed. 15 .mu.L of the gel mix was pipetted onto a clean flat
surface, for example a glass slide or a silicon wafer. The gel mix
on the surface was covered with a gel-chip glass slide surface as
prepared in above, face down. The glass chip was pressed down to
achieve a more uniform spread of the gel mix. The gel was allowed
to polymerize at room temperature for 20 minutes. The gel was bound
to the chips and the gel-chip substrates were removed from the
clean flat surface, with the aid of a razor blade or other
implement if necessary. Gel chips were rinsed in deionized water
and excess gel from the chip edges was removed. Gel chips can be
used immediately or stored in 4.times. saline-sodium citrate (SSC)
buffer.
Preparation of Enzyme Mix
[0147] Enzyme mix was prepared with 37 .mu.L of H.sub.2O, 5 .mu.L
of 10.times. Thermopol buffer, 5 of BSA (10 mg/mL), 1 .mu.L of
dNTPs (10 mM), and 2 .mu.L Bst DNA polymerase enzyme (8
U/.mu.L).
Enzymatic Transfer of Template Via Single Extension
[0148] 18 .mu.L of enzyme mix as prepared above was placed on top
of the prepared gel chip. The enzyme mix solution was allowed to
permeate into the gel for 30 seconds. The gel chip was then placed
face down onto a template chip. A piece of PDMS was placed on top
of the two chips as a compliant layer, and the chip stack was
placed into a clamp, such as an aluminum clamp. The chip stack was
incubated at 55.degree. C. for 2 hours in a humidity chamber. Then,
extra 4.times. saline-sodium citrate (SSC) buffer was added around
the edges of the chip stack and allowed to soak in to loosen the
gel chip. The gel chip surface and template chip surface were then
pulled apart, with the aid of a razor blade or other implement if
necessary. The gel remained bound to the gel chip, with transferred
oligonucleotides. The template chip was washed in deionized water
and dried with N.sub.2. The gel chip was washed three times with
4.times.SSC buffer and three times with 2.times.SSC buffer.
Imaging of the Transferred Pattern
[0149] FC2QC-Cy3 oligonucleotides were hybridized for 35 minutes at
55.degree. C. to a template chip as used in above. After
hybridization, the template chip was rinsed and imaged. SP2-Cy3
oligonucleotides were hybridized for 30 minutes at 55.degree. C. to
a gel chip with transferred oligonucleotides as prepared in above.
The gel chip was then rinsed twice with 4.times.SSC buffer and
twice with 2.times.SSC buffer, and let to soak in 4.times.SSC
buffer for 3 hours to reduce background signal. Rather than soaking
for 3 hours, the gel chip could alternatively have been shaken for
20 minutes in 4.times.SSC buffer. The gel chip was then imaged
under an epi-fluorescence microscope at desired magnifications,
such as 10.times. and 40.times.. The gel chip was then stripped and
hybridized with FC2QC-Cy3 oligonucleotides as for the template
chip. The gel chip was then reimaged, and signal indicating
physical transfer of template molecules was observed.
Preparation of Reaction Buffer for Template Amplification by
Ingredient Volume
[0150] Reaction buffer was prepared with 1.5 mL of 10.times. Taq
buffer, 750 .mu.L of 100% DMSO, 3 mL of 5 M Betaine, 120 .mu.L of
25 mM dNTPs, 75 .mu.L of 5000 U/mL Taq polymerase, and 9.555 mL
nuclease-free H.sub.2O.
Preparation of Reaction Buffer for Template Amplification by Final
Concentration
[0151] Reaction buffer was prepared with a final concentration of
1.times. Taq buffer, 5% DMSO, 1 M Betaine, 0.2 mM dNTPs, 25 U/mL
Taq polymerase, in nuclease-free H.sub.2O.
Template Amplification Via Thermal Cycling
[0152] A gel chip with oligonucleotides was washed with
0.3.times.SSC buffer with 0.1% Tween-20 added. The gel chip then
underwent 50 cycles of immersion into solution baths as follows: a)
45 seconds in 0.3.times.SSC buffer with 0.1% Tween-20 at 94.degree.
C., b) 2 minutes in 5.times.SSC buffer with 0.1% Tween-20 at
60.degree. C., and c) 1 minute in reaction buffer, prepared as per
above, at 72.degree. C. The template on the gel chip was
amplified.
Probe Hybridization on a Chip
[0153] A chip to be imaged with double stranded DNA (dsDNA) was
placed in 0.1 N NaOH solution for 3 minutes to denature the DNA.
After washing, the chip was washed with 4.times.SSC buffer. The
chip was then incubated for 40 minutes at 55.degree. C. with 20 mL
of 100 nM fluorescently-labeled hybridizing probe solution on a
nutator. After the incubation, the chip was washed twice with
4.times.SSC buffer and twice with 2.times.SSC buffer for 20 minutes
per wash step. The chip was then imaged.
Example 2--from Photo-Directed 3'-5' Array to 5'-3' Full Length
Array
[0154] Via standard photo-directed synthesis, a template microarray
is fabricated with 3'-5' oligonucleotide features, with the
oligonucleotides containing an adaptor 1 sequence, a probe sequence
that varies between features, and an adaptor 2 sequence. The
oligonucleotides are hybridized with a primer complementary to
adaptor 1 which also contains an immobilizable linker. Primer
extension reactions are conducted with polymerase. A first
recipient array surface is brought into contact with the template
array and the linkers are bound to its surface. The two surfaces
are separated, and the recipient array contains both partial length
and full length products in 5'-3' orientation. The oligonucleotides
are hybridized with a primer complementary to adaptor 2 which also
contains an immobilizable linker. Primer extension reactions are
conducted with polymerase. A second recipient array surface is
brought into contact with the template array and the linkers are
bound to its surface. The two surfaces are separated, and the
second recipient array contains mostly full length products in
5'-3' orientation.
Example 3--Array Transfer Protocol (Bio3D)
[0155] Polyacrylamide Gel Casting (2.sup.nd Surface)
[0156] Preparation and Filtration of the Following Solutions:
[0157] a. 6% acrylamide gel mix with 50 .mu.M Acryd-FC2 (2.sup.nd
surface)
TABLE-US-00001 [0157] TABLE 1 Acrylamide Mix Bulk solution (6% gel
mix with 50 .mu.M Acryd-FC2) Milli-Q H.sub.2O 160 .mu.L 1 mM
Acrydite-FC2 10 .mu.L 40% Acrylamide & Bis-acrylamide (29:1) 30
.mu.L Total 200 .mu.L
[0158] b. 2.6% ammonium persulfate (APS, w/v): 13 mg of APS into
500 .mu.L Milli-Q water. [0159] c. 2.6% TEMED (v/v): 7.8 .mu.L of
TEMED into 292.2 .mu.L of Milli-Q water.
[0160] Activation of Acrylamide Gel (Final Concentration 0.13%),
and Cast onto Acryl-Silanized Solid Surfaces Such as Glass and
Fused Silica. [0161] a. Take out a pre-diced 1.times.1 inches
silanzied fused-silica, blow the surface with nitrogen gas. [0162]
b. Take a fresh 1.5 mL Eppendorf tube, add the solutions in the
following order: 9 .mu.L of 6% gel mix, 0.5 .mu.L of 2.6% APS, and
0.5 .mu.L of 2.6% TEMED. Vortex thoroughly and quick spin the
solution to the bottom. [0163] c. Add 9 .mu.L of activated gel mix
solution onto the silanized glass surface in one drop, immediately
take out a new coverslip (circle, 18 mm diameter), blow the
surfaces of coverslip with nitrogen gas, and carefully lay down the
coverslip on top of the gel mix. The gel mix will spread and fill
the whole area between coverslip and silanized glass surface.
[0164] d. After 30 minutes of acrylamide gel polymerization, add
Milli-Q water to rinse the edges of coverslip. Use razor blade to
carefully lift up the coverslip from one side. Rinse the gel with
Milli-Q water. Now the gel is ready for printing.
[0165] Gel Print (1.sup.st>2.sup.nd Surface)
[0166] Preparation of Print Solution (100 .mu.L Per Printing):
TABLE-US-00002 TABLE 2 Print Solution Formulation Bst (8 U/uL):
final 0.32 U/.mu.L 4 .mu.L dNTPs (10 mM): final 0.2 mM 2 .mu.L 10x
Thermopol 10 .mu.L Nuclease-free H.sub.2O 84 .mu.L Total 100
.mu.L
[0167] Bst, dNTPs, BSA, and 10.times. Thermopol are all prepared in
small aliquots kept at -20 C.
[0168] Presoak the Gel with 50 .mu.L of Print Solution for 10
Minutes.
[0169] Setup of the Print Cassette:
[0170] From bottom to top: 1.times.1 inches acrylic, 1.times.1
inches PDMS, acrylamide gel on 1.times.1 inches silanzied
fused-silica, print solution (addition of 504, print solution onto
the gel), template chip (glued to 1.times.1 inches acrylic through
double-stick tape).
[0171] Incubation for 4 Hrs in a Humidity Chamber at 55 C.
[0172] Heat Denaturation:
[0173] Dissociate the print cassette and leave the template and gel
(still together) in low salt solution (0.3.times.SSC with 0.1%
Tween-20, heated in an 80 C water bath) for 10 minutes. Carefully
detach the gel from the template afterwards. Leave the gel in
4.times.SSC.
[0174] Gel Print (2.sup.nd->3.sup.rd Surface)
[0175] Dideoxynucleotide Capping of 3' End of Oligos on the
2.sup.nd Surface
[0176] Treat the 2.sup.nd surface with Terminal transferase (TdT):
0.5 .mu.L TdT, 0.4 .mu.L of 25 mM ddCTP (or any ddNTP), 5 uL of
10.times. TdT buffer, 44 uL of water. 37 C for 30 minutes.
Afterwards, TdT will be inactivated at 70 C for 10 minutes.
[0177] Preparation of Print Solution (100 .mu.L Per Printing):
TABLE-US-00003 TABLE 3 Print Solution Formulation Bst (8 U/uL):
final 0.32 U/.mu.L 4 .mu.L dNTPs (10 mM): final 0.2 mM 2 .mu.L 10x
Thermopol 10 .mu.L Nuclease-free H.sub.2O 84 .mu.L Total 100
.mu.L
[0178] Bst, dNTPs, BSA, and 10.times. Thermopol are all prepared in
small aliquots kept at -20 C.
[0179] Presoak the 2.sup.nd Surface with 50 .mu.L of Print Solution
for 10 Minutes.
[0180] Setup of the Print Cassette
[0181] From bottom to top: 1.times.1 inches acrylic, 1.times.1
inches PDMS, acrylamide gel on 1.times.1 inches silanzied
fused-silica, print solution (addition of 50 .mu.L print solution
onto the gel), 3rd surface (1.times.1 cm.sup.2 glued to 1.times.1
inches acrylic through double-stick tape).
[0182] Note: 3.sup.rd surface is currently prepared by Meng.
Basically, fused-silica in size of 1.times.1 cm.sup.2 is used for
acrylamide gel casting (acrylamide: Bromoacetyl-acrylamide=40:1).
200 .mu.M of Phosphothiorate-CompSP2 is seeded onto gel surface
overnight at room temperature.
[0183] Incubation for 4 Hrs in a Humidity Chamber at 55 C. (the
Exact Optimal for 2.sup.nd-3.sup.rd Surface Print is to be
Determined)
[0184] Heat Denaturation.
[0185] Dissociate the print cassette and leave the template and gel
(still together) in low salt solution (0.3.times.SSC with 0.1%
Tween-20, heated in an 80 C water bath) for 10 minutes. Carefully
detach the gel from the template afterwards. Leave the gels in
4.times.SSC.
Example 4: Printing from Synthesized Chip onto Polyacrylamide
2.sup.nd Surface
[0186] PyroPhage-based linear PCR printing can effectively increase
the print signal: 10.times. signal increase with 30 cycles of PCR,
compared with 1 hr Bst-print. A stamping hold through the printing
process is critical in maintaining the printing resolution.
[0187] Longer printing time greatly improve the print signal (up to
18 fold), either using Bst or Pyrophage, either with 3'->5' or
5'->3' synthesized chip. 4 hr is optimal for Bst-based printing.
FIG. 25 illustrates an image of print generated without using
PyroPhage-based linear PCR printing taken at 20 s exposure,
10.times., 1 bin, 100-600, hybridized with Cy3-CompSP2) and shows
some signal, while FIG. 26 illustrates an image of print generated
without using PyroPhage-based linear PCR printing taken at 20 s
exposure, 10.times., 1 bin, 100-4095, hybridized with Cy3-CompSP2
and shows virtually no signal. In contrast, FIG. 27 illustrates an
image of print generated using PyroPhage-based linear PCR printing
with 1 hr printing at 55 C taken at 20 s exposure, 10.times., 1
bin, 1400-4095, hybridized with Cy3-CompSP2. FIG. 28 illustrates a
comparison of images of prints (arrays) generated using
PyroPhage-based linear PCR printing from 1.sup.st->2.sup.nd
surface for 1 hr, 4 hrs, or overnight. All images taken at all
images were taken with 10 s exposure, 100-2000. FIG. 28 shows that
longer Pyrophage-based printing from 1.sup.st->2.sup.nd surface
also greatly improve the signal at a constant exposure time. FIG.
29 illustrates a comparison of images from Bst-based printing
generated at 55 C from 1.sup.st->2.sup.nd surface for 1 hr, 2
hr, 3 hr, 4 hr, 6 hr and overnight. 4 hr Bst-based printing from
1.sup.st->2.sup.nd surface gave optimal print signal at 55 C.
All images taken at all images were taken with 10 s exposure,
100-2000. FIG. 30 illustrates images of Bst-based printing from
1.sup.st->2.sup.nd surface (synthesized 5'->3') synthesized
for 1 hr at 55 C. FIG. 30 shows that longer Bst-based printing from
1.sup.st->2.sup.nd surface (synthesized 5'->3') also greatly
improve the print signal compared with 1 hr printing at 55 C. All
images were taken with 10 s exposure, 200-2000
[0188] In conclusion, print signal compared with 1 hr printing at
55 C and print signal was also greatly improved the print signal
compared with 1 hr printing at 55 C taken at 20 s exposure,
10.times., 1 bin, 1400-4095, hybridized with Cy3-CompSP2.
[0189] The intensity of full-length features on the 2.sup.nd
surface (4 hr-printed) is .about.10% of that on the 1.sup.st
surface. By comparing the hybridization signals between crosslinked
primers in the gel and the full-length extended oligos, it was
estimated that 14.3% of primers were used in 4 hr prints to
generate full-length product. If the full-length product is 35.8%
of total synthesized oligos (given the efficiency of each step of
photosynthesis is .about.95%, 20 bases in total) and there are
equal chances for full length and partial length oligos to anneal
to the primers, then 40.1% of total primers were used/extended
during the 4 hr period. 1 micron feature can be reliably resolved
on the printed 2.sup.nd surface as shown in FIG. 31.
Example 5: Printing from Polyacrylamide 2.sup.nd Surface onto Br-Ac
3.sup.rd Surface
[0190] Bst overnight-printed 2.sup.nd surface was used as template
to do another Bst overnight printing onto Br-Ac 3.sup.rd surface.
After background signal subtraction, the intensity of full-length
features on the 2.sup.nd surface (overnight-printed, FIG. 32) and
3.sup.rd surface are 5%-10% and 2%-3% of those on the 1.sup.st
surface, respectively. FIG. 32 shows a 10 s exposure, 10.times., 1
bin, 100-600, Cy3-CompSP2. As an alternative way to do overnight
printing, Br-Ac 3.sup.rd surface was printed and amplified from
overnight-printed 2.sup.nd surface through PCR (see FIG. 33). FIG.
33 shows Br-Ac 3.sup.rd surface overnight-printed from
overnight-printed 2.sup.nd surface (10 s exposure, 10.times., 1
bin, 200-1700, hybridized with Cy3-FC2). In this method, the
printed and amplified full-length oligos have a density 5%-7% of
those on the 1.sup.st surface. Uneven printed signal was seen in
some cases of the two 2.sup.nd->3.sup.rd printing methods, which
could be from uneven primer seeding and/or damages during printing
and separation. FIG. 34 illustrates Br-Ac 3.sup.rd surface
Pyrophage-printed and amplified from overnight-printed 2.sup.nd
surface. USER enzyme was used to cut one of the strand after PCR.
(10 s exposure, 10.times., 1 bin, 1500-3000, Cy3-AM2).
[0191] While preferred embodiments of the present invention have
been shown and described herein, it will be obvious to those
skilled in the art that such embodiments are provided by way of
example only. Numerous variations, changes, and substitutions will
now occur to those skilled in the art without departing from the
invention. It should be understood that various alternatives to the
embodiments of the invention described herein can be employed in
practicing the invention. It is intended that the following claims
define the scope of the invention and that methods and structures
within the scope of these claims and their equivalents be covered
thereby.
Sequence CWU 1
1
1172DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotidemodified_base(72)..(72)3' Inverted T
1cagaagacgg catacgagat gactggagtt cagacgtgtg ctcttccgtg tagatctcgg
60tggtcgccgt at 72
* * * * *
References