U.S. patent application number 16/460848 was filed with the patent office on 2020-01-30 for methods for inducing selective apoptosis.
The applicant listed for this patent is Baylor College of Medicine. Invention is credited to Malcolm K. Brenner, Jack James.
Application Number | 20200030421 16/460848 |
Document ID | / |
Family ID | 44545869 |
Filed Date | 2020-01-30 |
![](/patent/app/20200030421/US20200030421A1-20200130-D00001.png)
![](/patent/app/20200030421/US20200030421A1-20200130-D00002.png)
![](/patent/app/20200030421/US20200030421A1-20200130-D00003.png)
![](/patent/app/20200030421/US20200030421A1-20200130-D00004.png)
![](/patent/app/20200030421/US20200030421A1-20200130-D00005.png)
![](/patent/app/20200030421/US20200030421A1-20200130-D00006.png)
![](/patent/app/20200030421/US20200030421A1-20200130-D00007.png)
![](/patent/app/20200030421/US20200030421A1-20200130-D00008.png)
![](/patent/app/20200030421/US20200030421A1-20200130-D00009.png)
![](/patent/app/20200030421/US20200030421A1-20200130-D00010.png)
![](/patent/app/20200030421/US20200030421A1-20200130-D00011.png)
View All Diagrams
United States Patent
Application |
20200030421 |
Kind Code |
A1 |
Brenner; Malcolm K. ; et
al. |
January 30, 2020 |
METHODS FOR INDUCING SELECTIVE APOPTOSIS
Abstract
Provided herein are methods for cell therapy by modifying
transfused cells to express an inducible caspase 9 protein, so that
the cells may be selectively killed if the patient experiences
dangerous side effects. Provided also within relates in part to
methods for preventing or treating Graft versus Host Disease by
modifying T cells before administration to a patient, so that they
may be selectively killed if GvHD develops in the patient.
Inventors: |
Brenner; Malcolm K.;
(Bellaire, TX) ; James; Jack; (Wilmington,
NC) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Baylor College of Medicine |
Houston |
TX |
US |
|
|
Family ID: |
44545869 |
Appl. No.: |
16/460848 |
Filed: |
July 2, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15921530 |
Mar 14, 2018 |
|
|
|
16460848 |
|
|
|
|
13786672 |
Mar 6, 2013 |
|
|
|
15921530 |
|
|
|
|
13112739 |
May 20, 2011 |
9089520 |
|
|
13786672 |
|
|
|
|
15886309 |
Feb 1, 2018 |
|
|
|
15921530 |
|
|
|
|
13786672 |
Mar 6, 2013 |
|
|
|
15886309 |
|
|
|
|
13112739 |
May 20, 2011 |
9089520 |
|
|
13786672 |
|
|
|
|
61347154 |
May 21, 2010 |
|
|
|
61347154 |
May 21, 2010 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 35/17 20130101;
C12N 5/0636 20130101; A61K 38/4873 20130101; A61P 35/00 20180101;
A61K 38/52 20130101; A61K 39/001 20130101; A61P 7/00 20180101; C12Y
304/22062 20130101; A61K 2039/5158 20130101; A61K 35/545 20130101;
A61P 37/06 20180101; C12N 2510/00 20130101; C07K 2319/00 20130101;
C12N 2501/48 20130101; A61K 35/28 20130101; C12N 5/0663 20130101;
A61K 2039/5156 20130101; C12Y 502/01008 20130101 |
International
Class: |
A61K 38/52 20060101
A61K038/52; A61K 35/28 20060101 A61K035/28; A61K 35/545 20060101
A61K035/545; A61K 39/00 20060101 A61K039/00; C12N 5/0783 20060101
C12N005/0783; C12N 5/0775 20060101 C12N005/0775; A61K 35/17
20060101 A61K035/17; A61K 38/48 20060101 A61K038/48 |
Goverment Interests
STATEMENT OF GOVERNMENT SUPPORT
[0002] This invention was made with government support under grant
number U54HL081007 awarded by the NHLBI. The government has certain
rights in the invention.
Claims
1-23. (canceled)
24. A composition consisting of AP1903 in a 25% solution of
polyethylene glycol-15-hydroxystearate.
25. The composition of claim 24 wherein said AP1903 is at a
concentration of 5 mg/ml in said 25% solution.
26. A method of preparing a composition for administration to a
human patient comprising making a 5 mg/ml solution of AP1903 in a
25% solution of polyethylene glycol-15-hydroxystearate to produce
an AP1903 solution.
27. The method of claim 26 further comprising storing the AP1903
solution under refrigeration.
28. A method of preparing an AP1903 composition for administration
to a human patient, said method comprising the following steps in
the order stated: (a) removing a refrigerated AP1903 solution from
refrigeration, said AP1903 solution consisting of AP1903 in a 25%
solution of polyethylene glycol-15-hydroxystearate; (b) storing the
AP1903 solution overnight at approximately 21 degrees .degree. C.;
and (c) producing a diluted solution by diluting an aliquot of the
AP1903 solution containing a dose of AP1903 for the human patient
in 100 ml of 0.9% normal saline.
29. The method of claim 28 further comprising administering the
diluted solution to the human patient within 30 minutes of said
producing step.
30. A method of administering AP1903 to a human patient comprising:
administering to a human patient AP1903 in solution at a dose of
0.4 mg/kg via intravenous infusion.
31. The method of claim 30, wherein said dose is diluted in 0.9%
normal saline before said administering.
32. The method of claim 31, wherein said dose is diluted in 100 ml
of 0.9% normal saline before said administering.
33. The method of claim 30, wherein the AP1903 in solution is made
by diluting a composition containing AP1903 in a 25% solution of
polyethylene glycol-15-hydroxystearate in 100 ml of 0.9% normal
saline before said administering.
34. The method of claim 33, wherein said composition consists of 5
mg/ml AP1903 in a 25% solution of polyethylene
glycol-15-hydroxystearate.
Description
RELATED PATENT APPLICATIONS
[0001] This patent application is a continuation of U.S. patent
application Ser. No. 13/786,672, filed Mar. 6, 2013, entitled
METHODS FOR INDUCING SELECTIVE APOPTOSIS, naming Malcolm K. Brenner
as inventor, and designated by attorney docket no. BEL-2006-DV,
which is a divisional application of U.S. patent application Ser.
No. 13/112,739, filed May 20, 2011, now U.S. Pat. No. 9,089,520,
entitled METHODS FOR INDUCING SELECTIVE APOPTOSIS, naming Malcolm
K. Brenner as inventor, and designated by attorney docket no.
BEL-2006-UT, which is a non-provisional patent application claiming
priority to U.S. Provisional Patent Application Ser. No.
61/347,154, filed May 21, 2010, entitled METHODS FOR INDUCING
SELECTIVE APOPTOSIS, and designated by attorney docket no.
BEL-2006-PV. This patent application also is a continuation of U.S.
patent application Ser. No. 15/886,309, filed Feb. 1, 2018,
entitled METHODS FOR INDUCING SELECTIVE APOPTOSIS, naming Malcolm
K. Brenner as inventor, and designated by attorney docket no.
BEL-2006-CT2, which is a continuation of U.S. patent application
Ser. No. 13/786,672, filed Mar. 6, 2013, entitled METHODS FOR
INDUCING SELECTIVE APOPTOSIS, naming Malcolm K. Brenner as
inventor, and designated by attorney docket no. BEL-2006-DV, which
is a divisional application of U.S. patent application Ser. No.
13/112,739, filed May 20, 2011, now U.S. Pat. No. 9,089,520,
entitled METHODS FOR INDUCING SELECTIVE APOPTOSIS, naming Malcolm
K. Brenner as inventor, and designated by attorney docket no.
BEL-2006-UT, which is a non-provisional patent application claiming
priority to U.S. Provisional Patent Application Ser. No.
61/347,154, filed May 21, 2010, entitled METHODS FOR INDUCING
SELECTIVE APOPTOSIS, and designated by attorney docket no.
BEL-2006-PV. The entire content of the foregoing applications is
incorporated herein by reference, including all text, tables and
drawings, for all purposes.
FIELD
[0003] The technology relates in part to methods for cell therapy
by modifying transfused cells to express an inducible caspase 9
protein, so that the cells may be selectively killed if the patient
experiences dangerous side effects. The technology further relates
in part to methods for preventing or treating Graft versus Host
Disease by modifying T cells before administration to a patient, so
that they may be selectively killed if GvHD develops in the
patient.
SEQUENCE LISTING
[0004] The instant application contains a Sequence Listing which
has been submitted in ASCII format via EFS-Web and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Jul. 5, 2011, is named BEL206UT.txt and is 29,927 bytes in
size.
BACKGROUND
[0005] There is an increasing use of cellular therapy in which
modified, or unmodified cells are administered to a patient. An
example of a cellular therapy is adoptive T cell transfer after
CD34+ stem cell transplantation. Administering T cells after stem
cell transfer helps to accelerate the reconstitution of an immune
system in the patient recipient. When a matched related or
unrelated donor is not available, or the disease is too aggressive
for an extensive donor search, the use of an HLA haploidentical
family donor may be effective. Such donors may be parents,
siblings, or second-degree relatives. Such infusions may enhance
immune recovery and thereby reduce virus infections and eliminate
relapsing leukemia cells. However, the coexistence of alloreactive
T cells in a donor stem cell graft may cause graft-versus-host
disease (GvHD) in which the donor cells react against the
recipient, which may progressively damage the skin, gut, liver, and
other organs of the recipient, often with fatal consequences. The
administration of more than 10.sup.5 T cells/kg recipient weight of
unmodified donor T cells has been associated with severe GvHD
(Huang, X. J., et al., (2007) Haematoligica 92:414-417; Huang, X.
J., et al., (2008) J. Clin. Immunol. 28:276-283). Although the
likelihood of GvHD may be reduced by not providing T cells to the
patient, this may lead to a high rate of post-transplant infectious
complications and a high incidence of disease relapse.
[0006] Other examples of cell therapies include using native cells
or cells genetically engineered to express a heterologous gene.
These treatments are used for many disorders, including blood
disorders, but these therapies may have negative side effects. In
another method, immature progenitor cells that can differentiate
into many types of mature cells, such as, for example, mesenchymal
stromal cells, may be used to treat disorders by replacing the
function of diseased cells. There is a need for a rapid and
effective mechanism to remove possible negative effects of donor
cells used in cellular therapy.
SUMMARY
[0007] An inducible caspase 9 system has been applied to human T
cells, which were then administered to stem cell transplantation
patients. This system does not rely on interfering with cell
division, or DNA synthesis, thus the system is not restricted to
dividing cells. Instead, the system relies on a human-derived gene,
which is likely less immunogenic than other safety switches using,
for example, a HSV-tk derived gene. Further, the system does not
involve the use of an otherwise therapeutic compound such as, for
example, gancylovir, allowing the compound to continue to be used
for therapy, such as, for example, cancer therapy. Upon exhibiting
graft versus host disease (GvHD) symptoms, caspase 9 was activated
after the administration of a multimeric ligand, which caused
dimerization of the protein and induced apoptosis of the allogeneic
activated T cells.
[0008] These features form the basis of T cell transfusion
immunotherapies, providing a safety switch following transfusion,
should a negative event occur, such as GvHD. A caspase 9 based
apoptotic safety switch has also been applied to progenitor cells,
such as mesenchymal stromal cells, before administering them to a
patient, to provide the ability to selectively kill the therapeutic
cells if the patient experiences negative side effects.
[0009] Thus, featured in some embodiments are methods of
administering donor T cells to a human patient, comprising
transfecting or transducing human donor T cells in a donor cell
culture with a nucleic acid including a promoter region and a
nucleotide sequence that encodes a chimeric protein comprising a
multimeric ligand binding region and a caspase 9 polypeptide; and
administering the transduced or transfected donor T cells to the
human patient.
[0010] Thus, also featured in some embodiments are methods of
reducing the effect of graft versus host disease in a human patient
following donor T cell transplantation, comprising transfecting or
transducing human donor T cells in a donor cell culture with a
nucleic acid including a promoter region and a nucleotide sequence
that encodes a chimeric protein comprising a multimeric ligand
binding region and a caspase 9 polypeptide; administering the
transduced or transfected donor T cells to the patient; detecting
the presence or absence of graft versus host disease in the patient
after; and administering a multimeric ligand that binds to the
multimeric ligand binding region to a patient for whom the presence
of graft versus host disease is detected.
[0011] Thus, also featured in some embodiments are methods of stem
cell transplantation, comprising administering a haploidentical
stem cell transplant to a human patient; and administering
haploidentical donor T cells to the patient, wherein the T cells
are transfected or transduced in a haploidentical donor cell
culture with a nucleic acid including a promoter region and a
nucleotide sequence that encodes a chimeric protein comprising a
multimeric ligand binding region and a caspase 9 polypeptide.
[0012] Also featured in some embodiments are methods of
administering donor T cells to a human patient, comprising
transfecting or transducing non-allodepleted human donor T cells in
a donor cell culture with a nucleic acid including a promoter
region and a nucleotide sequence that encodes a chimeric protein
comprising a multimeric ligand binding region and a caspase 9
polypeptide; and administering the transduced or transfected donor
T cells to the human patient.
[0013] Also featured in some embodiments are methods of reducing
the effect of graft versus host disease in a human patient
following donor T cell transplantation, comprising transfecting or
transducing non-allodepleted human donor T cells in a donor cell
culture with a nucleic acid including a promoter region and a
nucleotide sequence that encodes a chimeric protein comprising a
multimeric ligand binding region and a caspase 9 polypeptide;
administering the transduced or transfected donor T cells to the
patient; detecting the presence or absence of graft versus host
disease in the patient after; and administering a multimeric ligand
that binds to the multimeric ligand binding region to a patient for
whom the presence of graft versus host disease is detected.
[0014] Also featured in some embodiments are methods of stem cell
transplantation, comprising administering a haploidentical stem
cell transplant to a human patient; and administering
non-allodepleted haploidentical donor T cells to the patient,
wherein the T cells are transfected or transduced in a
haploidentical donor cell culture with a nucleic acid including a
promoter region and a nucleotide sequence that encodes a chimeric
protein comprising a multimeric ligand binding region and a caspase
9 polypeptide.
[0015] In some embodiments, the haploidentical stem cell transplant
is a CD34' haploidentical stem cell transplant. In some
embodiments, the human donor T cells are haploidentical to the
patient's T cells. In some embodiments, the patient has cancer. In
some embodiments, the patient has a solid tumor. In some
embodiments, the cancer is present in the blood or bone marrow of
the patient. In some embodiments, the patient has a blood or bone
marrow disease. In some embodiments, the patient has been diagnosed
with any condition or disorder that can be alleviated by stem cell
transplantation. In some embodiments, the patient has been
diagnosed with sickle cell anemia or metachromatic
leukodystrophy.
[0016] In some embodiments, the promoter is activated in activated
T cells. In some embodiments, the promoter comprises a 5' LTR
sequence, for example a polynucleotide in SEQ ID NO: 1, or, for
example, the nucleotide sequence of SEQ ID NO: 1. In some
embodiments, the chimeric protein further comprises a marker
polypeptide, for example, a CD19 polypeptide. In some embodiments,
the methods further comprise a selection step, wherein cells that
express the marker are selected for administration to the patient.
In some embodiments, the cells are selected by immunomagnetic
selection.
[0017] In some embodiments, the caspase 9 polypeptide is a
truncated caspase 9 polypeptide. In some embodiments, the caspase 9
polypeptide lacks the caspase recruitment domain. In some
embodiments, the caspase 9 polypeptide comprises the amino acid
sequence of SEQ ID NO: 9, or a fragment thereof, or is encoded by
the nucleotide sequence of SEQ ID NO: 8, or a fragment thereof.
[0018] In some embodiments, the donor cell culture is prepared from
a bone marrow sample. In some embodiments, the donor cell culture
is prepared from peripheral blood. In some embodiments, the donor
cell culture is prepared from donor peripheral blood mononuclear
cells. In some embodiments, the donor T cells are allodepleted from
the donor cell culture before transfection or transduction. In some
embodiments, the transduced or transfected T cells are cultured in
the presence of IL-2 before administration to the patient.
[0019] In some embodiments, the methods further comprise
administering a multimeric ligand that binds to the multimeric
ligand binding region. In some embodiments, the multimeric ligand
binding region is selected from the group consisting of FKBP,
cyclophilin receptor, steroid receptor, tetracycline receptor,
heavy chain antibody subunit, light chain antibody subunit, single
chain antibodies comprised of heavy and light chain variable
regions in tandem separated by a flexible linker domain, and
mutated sequences thereof. In some embodiments, the multimeric
ligand binding region is an FKBP12 region. In some embodiments, the
multimeric ligand is an FK506 dimer or a dimeric FK506 analog
ligand. In some embodiments, the multimeric ligand is AP1903. In
some embodiments, the multimeric ligand is administered to treat
graft versus host disease. In some embodiments, the patient
exhibits graft versus host disease symptoms before the multimeric
ligand is administered. In some embodiments, the patient exhibits
one or more Stage 0 graft versus host disease symptoms. In some
embodiments, the patient exhibits one or more Stage 1 graft versus
host disease symptoms. In some embodiments, the patient exhibits
one or more Stage 2 graft versus host disease symptoms. In some
embodiments, the patient exhibits one or more Stage 3 graft versus
host disease symptoms. In some embodiments, the patient exhibits
one or more Stage 4 graft versus host disease symptoms. In some
embodiments, more than one dose of the multimeric ligand is
administered. In some embodiments, after administration of the
multimeric ligand, the number of alloreactive T cells is reduced.
In some embodiments, the alloreactive T cells express the marker
and CD3. In some embodiments, the number of alloreactive T cells is
reduced by from about 60% to 99%, about 70% to 95%, from 80% to 90%
or about 90% or more after administration of the multimeric ligand.
In some embodiments, after administration of the multimeric ligand,
donor T cells survive in the patient that are able to expand and
are reactive to viruses and fungi. In some embodiments, after
administration of the multimeric ligand, donor T cells survive in
the patient that are able to expand and are reactive to tumor cells
in the patient.
[0020] In some embodiments, the patients have received haplo-CD34+
stem cell transplants before or at the same time as administration
of the donor T cells. In some embodiments, the donor T cells are
transduced or transfected with a retroviral vector. In some
embodiments, the retroviral vector is a murine leukemia virus
vector. In some embodiments, the retroviral vector is an SFG
vector. In some embodiments, the transfected or transduced cells
are further transfected or transduced with a gene expression
vector.
[0021] In some embodiments, the methods further comprise
determining whether to administer an additional dose or additional
doses of the multimeric ligand to the patient based upon the
appearance of graft versus host disease symptoms in the patient. In
some embodiments, the methods further comprise determining whether
to administer an additional dose or additional doses of the
multimeric ligand to the patient, wherein the determination is
based upon the amount or concentration of marker and CD3 positive T
cells in the patient.
[0022] In some embodiments, at least 1.times.10.sup.6 transduced or
transfected donor T cells are administered to the patient. In some
embodiments, at least 1.times.10' transduced or transfected donor T
cells are administered to the patient. In some embodiments, at
least 1.times.10.sup.8 transduced or transfected donor T cells are
administered to the patient.
[0023] In some embodiments, the methods further comprise
identifying the presence, absence or stage of graft versus host
disease in the patient, and administering a multimeric ligand that
binds to the multimeric ligand binding region, maintaining a
subsequent dosage of the multimeric ligand, or adjusting a
subsequent dosage of the multimeric ligand to the patient based on
the presence, absence or stage of the graft versus host disease
identified in the patient. In some embodiments, the methods further
comprise identifying the presence, absence or stage of graft versus
host disease in the patient, and determining whether a multimeric
ligand that binds to the multimeric ligand binding region should be
administered to the patient, or the dosage of the multimeric ligand
subsequently administered to the patient is adjusted based on the
presence, absence or stage of the graft versus host disease
identified in the patient. In some embodiments, the methods further
comprise receiving information comprising the presence, absence or
stage of graft versus host disease in the patient; and
administering a multimeric ligand that binds to the multimeric
ligand binding region, maintaining a subsequent dosage of the
multimeric ligand, or adjusting a subsequent dosage of the
multimeric ligand to the patient based on the presence, absence or
stage of the graft versus host disease identified in the patient.
In some embodiments, the methods further comprise identifying the
presence, absence or stage of graft versus host disease in the
patient, and transmitting the presence, absence or stage of the
graft versus host disease to a decision maker who administers a
multimeric ligand that binds to the multimeric ligand binding
region, maintains a subsequent dosage of the multimeric ligand, or
adjusts a subsequent dosage of the multimeric ligand administered
to the patient based on the presence, absence or stage of the graft
versus host disease identified in the subject. In some embodiments,
the methods further comprise identifying the presence, absence or
stage of graft versus host disease in the patient, and transmitting
an indication to administer a multimeric ligand that binds to the
multimeric binding region, maintain a subsequent dosage of the
multimeric ligand or adjust a subsequent dosage of the multimeric
ligand administered to the patient based on the presence, absence
or stage of the graft versus host disease identified in the
subject.
[0024] Featured in some embodiments are methods of controlling the
survival of transplanted therapeutic cells in a patient, comprising
preparing or obtaining therapeutic cells; transfecting or
transducing the therapeutic cells with a nucleic acid including a
promoter region and a nucleotide sequence that encodes a chimeric
protein comprising a multimeric ligand binding region and a caspase
9 polypeptide; transplanting the transduced or transfected
therapeutic cells into the patient; and after step administering a
multimeric ligand to the patient, wherein the multimeric ligand
binds to the multimeric ligand binding region, wherein transplanted
therapeutic cells that express the caspase 9 polypeptide are killed
following administration of the multimeric ligand.
[0025] Also featured in some embodiments are methods of
transplanting therapeutic cells in a human patient, comprising
preparing or obtaining cells for transplantation; transfecting or
transducing the cells with a nucleic acid including a promoter
region and a nucleotide sequence that encodes a chimeric protein
comprising a multimeric ligand binding region and a caspase 9
polypeptide; and transplanting the transduced or transfected
therapeutic cells into the human patient.
[0026] Also featured in some embodiments are methods of preparing
progenitor therapeutic cells for transplantation in a patient,
comprising preparing or obtaining cells for transplantation; and
transfecting or transducing the cells with a nucleic acid including
a promoter region and a nucleotide sequence that encodes a chimeric
protein comprising a multimeric ligand binding region and a caspase
9 polypeptide.
[0027] In some embodiments, the patient is a human patient. In some
embodiments, a multimeric ligand is administered to the patient,
wherein the multimeric ligand binds to the multimeric ligand
binding region. In some embodiments, the multimeric ligand is
administered to kill transplanted therapeutic cells. In some
embodiments, the therapeutic cells are obtained or prepared from
bone marrow. In some embodiments, the therapeutic cells are
obtained or prepared from umbilical cord blood. In some
embodiments, the therapeutic cells are obtained or prepared from
peripheral blood. In some embodiments, the therapeutic cells are
obtained or prepared from peripheral blood mononuclear cells. In
some embodiments, the therapeutic cells are progenitor cells. In
some embodiments, the therapeutic cells are hematopoietic
progenitor cells. In some embodiments, the therapeutic cells are
selected from the group consisting of mesenchymal stromal cells,
embryonic stem cells, and inducible pluripotent stem cells. In some
embodiments, the promoter is developmentally regulated and the
caspase 9 polypeptide is expressed in developmentally
differentiated cells. In some embodiments, the therapeutic cells
are modified by transfection or transduction of a heterologous
gene, in some embodiments the modified therapeutic cells are T
cells. In some embodiments, the promoter is tissue specific and the
caspase 9 polypeptide is expressed in the specific tissue. In some
embodiments, the patient has cancer. In some embodiments, the
patient has a solid tumor. In some embodiments, the cancer is
present in the blood or bone marrow of the patient. In some
embodiments, the patient has a blood or bone marrow disease. In
some embodiments, the patient has any condition or disorder that
can be alleviated by stem cell transplantation. In some
embodiments, the patient has been diagnosed with sickle cell anemia
or metachromatic leukodystrophy.
[0028] In some embodiments, the chimeric protein further comprises
a marker polypeptide. In some embodiments, the marker polypeptide
is a CD19 polypeptide. In some embodiments, the methods further
comprise a selection step, wherein cells that express the marker
are selected for administration to the patient. In some
embodiments, the cells are selected by immunomagnetic selection. In
some embodiments, the caspase 9 polypeptide is a truncated caspase
9 polypeptide. In some embodiments, the caspase 9 polypeptide lacks
the caspase recruitment domain. In some embodiments, the caspase 9
polypeptide comprises the amino acid sequence of SEQ ID NO: 9, or a
fragment thereof, or is encoded by a nucleotide sequence SEQ ID NO:
8, or a fragment thereof.
[0029] In some embodiments, the multimeric ligand binding region is
selected from the group consisting of FKBP, cyclophilin receptor,
steroid receptor, tetracycline receptor, heavy chain antibody
subunit, light chain antibody subunit, single chain antibodies
comprised of heavy and light chain variable regions in tandem
separated by a flexible linker domain, and mutated sequences
thereof. In some embodiments, the multimeric ligand binding region
is an FKBP12 region. In some embodiments, the multimeric ligand is
an FK506 dimer or a dimeric FK506 analog ligand. In some
embodiments, more than one dose of the multimeric ligand is
administered. In some embodiments, the therapeutic cells are
transduced or transfected with a retroviral vector. In some
embodiments, the retroviral vector is a murine leukemia virus
vector. In some embodiments, the retroviral vector is an SFG
vector. In some embodiments, the transfected or transduced cells
are further transfected or transduced with a gene expression
vector.
[0030] In some embodiments, the methods further comprise
identifying a presence or absence of a condition in the patient
that requires the removal of transfected or transduced therapeutic
cells from the patient; and administering a multimeric ligand that
binds to the multimeric ligand binding region, maintaining a
subsequent dosage of the multimeric ligand, or adjusting a
subsequent dosage of the multimeric ligand to the patient based on
the presence or absence of the condition identified in the patient.
In some embodiments, the methods further comprise identifying a
presence or absence of a condition in the patient that requires the
removal of transfected or transduced therapeutic cells from the
patient; and determining whether a multimeric ligand that binds to
the multimeric ligand binding region should be administered to the
patient, or the dosage of the multimeric ligand subsequently
administered to the patient is adjusted based on the presence or
absence of the condition identified in the patient. In some
embodiments, the methods further comprise receiving information
comprising presence or absence of a condition in the patient that
requires the removal of transfected or transduced therapeutic cells
from the patient; and administering a multimeric ligand that binds
to the multimeric ligand binding region, maintaining a subsequent
dosage of the multimeric ligand, or adjusting a subsequent dosage
of the multimeric ligand to the patient based on the presence or
absence of the condition identified in the patient. In some
embodiments, the methods further comprise identifying a presence or
absence of a condition in the patient that requires the removal of
transfected or transduced therapeutic cells from the patient; and
transmitting the presence, absence or stage of the condition
identified in the patient to a decision maker who administers a
multimeric ligand that binds to the multimeric ligand binding
region, maintains a subsequent dosage of the multimeric ligand, or
adjusts a subsequent dosage of the multimeric ligand administered
to the patient based on the presence, absence or stage of the
condition identified in the patient. In some embodiments, the
methods further comprise identifying a presence or absence of a
condition in the patient that requires the removal of transfected
or transduced therapeutic cells from the patient; and transmitting
an indication to administer a multimeric ligand that binds to the
multimeric ligand binding region, maintains a subsequent dosage of
the multimeric ligand, or adjusts a subsequent dosage of the
multimeric ligand administered to the patient based on the
presence, absence or stage of the condition identified in the
patient.
[0031] Also featured in some embodiments is a cell, comprising a
nucleic acid including a promoter region and a nucleotide sequence
that encodes a chimeric protein comprising a multimeric ligand
binding region and a caspase 9 polypeptide, wherein the cell is
obtained or prepared from bone marrow or umbilical cord blood.
[0032] In some embodiments, the cell is a human cell. In some
embodiments, the cell is a progenitor cell. In some embodiments,
the cell is a hematopoietic progenitor cell. In some embodiments,
the cell is selected from the group consisting of mesenchymal
stromal cells, embryonic stem cells, and inducible pluripotent stem
cells. In some embodiments, the promoter is developmentally
regulated and the caspase 9 polypeptide is expressed in
developmentally differentiated cells. In some embodiments, the
promoter is tissue-specific and the caspase 9 polypeptide is
expressed in the specific tissue. In some embodiments, the chimeric
protein further comprises a marker polypeptide.
[0033] In some embodiments, the marker polypeptide is a CD19
polypeptide. In some embodiments, the caspase 9 polypeptide is a
truncated caspase 9 polypeptide. In some embodiments, the caspase 9
polypeptide lacks the caspase recruitment domain. In some
embodiments, the caspase 9 polypeptide comprises the amino acid
sequence of SEQ ID NO: 9, or a fragment thereof, or is encoded by
the nucleotide sequence of SEQ ID NO: 8, or a fragment thereof.
[0034] In some embodiments, the multimeric ligand binding region is
selected from the group consisting of FKBP, cyclophilin receptor,
steroid receptor, tetracycline receptor, heavy chain antibody
subunit, light chain antibody subunit, single chain antibodies
comprised of heavy and light chain variable regions in tandem
separated by a flexible linker domain, and mutated sequences
thereof. In some embodiments, the multimeric ligand binding region
is an FKBP12 region. In some embodiments, the cells are transduced
or transfected with a retroviral vector. In some embodiments, the
retroviral vector is a murine leukemia virus vector. In some
embodiments, the retroviral vector is an SFG vector. In some
embodiments, the transfected or transduced cells are further
transfected or transduced with a gene expression vector.
[0035] In some embodiments, the chimeric protein comprises a
caspase polypeptide, or a truncated or modified caspase
polypeptide, wherein the caspase is caspase 1, 3, or 8.
[0036] Certain embodiments are described further in the following
description, examples, claims and drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
[0037] The drawings illustrate embodiments of the technology and
are not limiting. For clarity and ease of illustration, the
drawings are not made to scale and, in some instances, various
aspects may be shown exaggerated or enlarged to facilitate an
understanding of particular embodiments.
[0038] FIG. 1A illustrates various iCasp9 expression vectors as
discussed herein. FIG. 1A discloses "Ser-Gly-Gly-Gly-Ser" as SEQ ID
NO: 21. FIG. 1B illustrates a representative western blot of full
length and truncated caspase 9 protein produced by the expression
vectors shown in FIG. 1A.
[0039] FIGS. 2A-2B graphically present results of experiments
performed to evaluate the effect of expression of iCasp9 expression
constructs on the phenotype of cells transduced with various iCasp9
expression vectors. FIG. 2A illustrates levels of cell surface
markers in transduced and nontransduced cells. FIG. 2B illustrates
levels of secretion of Th1 and Th2 type cytokines upon antigen
stimulation in transduced and nontransduced cells. FIG. 2C
illustrates levels of cytolytic activity against autologous
EVB-transformed lymphoblastoid B-cell line (LCL), HLA-mismatched
LCL, and HSB-2 in transduced and nontransduced cells. FIG. 2D
illustrates the persistence of antigen dependence on iCasp9
transduced cell lines. Note the steady decline of T cells after
antigen stimulation is discontinued. Further discussion of
experimental conditions and results are presented in the
Examples.
[0040] FIGS. 3A-3B illustrate the results of various experiments
performed to determine the efficacy of a chemical inducer of
dimerization (CID), in cells expressing iCasp9 expression
constructs. FIG. 3A illustrates FACS plots of cells after treatment
with CID or carrier. FACS plots are presented for unselected cells
(top row of FIG. 3A) and cells selected for high GFP expression
(bottom row of FIG. 3A). FIG. 3B illustrates the results of
overnight treatment of iCasp9 transduced cells with CID. The
treated panel clearly shows cells exhibiting characteristics of
apoptosis. FIG. 3C illustrates the results of CID treated and
untreated cells stained for Annexin-V and 7-ADD. FIG. 3D shows a
dose response curve for the CID AP20187. Further discussion of
experimental conditions and results are presented in the
Examples.
[0041] FIGS. 4A-4C illustrate the results of various experiments
performed to measure the correlation between transgene expression
level and function of iCasp9. FIG. 4A show the results of cell
population selection based on GFP expression. FIG. 4B illustrates
the results of cells treated overnight with CID treated and stained
for Annexin-V and 7-ADD. FIG. 4C show the results of selected T
cells that were mixed 1:1 with non-transduced T-cells and incubated
with 10 nM CID following antigenic stimulation. Indicated is the
percentage of residual GFP-positive T-cells on day 7. Further
discussion of experimental conditions and results are presented in
the Examples. FIGS. 5A-5C illustrate the results of various
experiments comparing the functionality of iFas and iCasp9 in T
cells. FIG. 5A illustrates the results of cells transduced with an
iFas or iCasp9 expression construct and sorted according to GFP
expression. FIG. 5B illustrates the results of GFP expression
measurements after treatment with CID. FIG. 5C shows the results of
expression studies performed in the human derived cell lines Jurkat
and MT-2. The cell lines were stained with Annexin-V and 7-ADD.
Further discussion of experimental conditions and results are
presented in the Examples.
[0042] FIG. 6 graphically illustrates the function of iCasp9 when
co-expressed with 11-2.
[0043] FIG. 7 graphically illustrates the function of iCasp9 in
vivo. Further discussion of experimental conditions and results are
presented in the Examples.
[0044] FIG. 8A illustrates the structure of the iCasp9 expression
construct SFG.iCasp9.2A..quadrature.CD19.
[0045] FIG. 8A discloses "S-G-G-G-S" as SEQ ID NO: 21. FIG. 8B
illustrates the protocol used to produce the cell product
expression iCasp9 in allodepleted cells. Further discussion of
experimental conditions and results are presented in the
Examples.
[0046] FIG. 9 graphically illustrates that allodepleted cells could
be successfully expanded following transduction.
[0047] FIG. 10 shows that cells transduced with the suicide gene
construct could be enriched to high purity by CD19 immunomagnetic
selection. Further discussion of experimental conditions and
results are presented in the Examples.
[0048] FIGS. 11A-11C illustrate the results of various experiments
performed to show that gene modified allodepleted cells retain
their anti-viral repertoire and functionality. FIG. 11A shows the
interferon-.gamma. secretion in response to viral antigens as
assessed by ELISPOT. FIG. 11B shows the results of a cytotoxicity
assay after allodepleted cells were stimulated with EBV-LCLs. FIG.
11C illustrates the frequency of T cells specific for
HLA-B8-RAKFKQLL, (SEQ ID NO: 20), an epitope from an EBV lytic
antigen (BZLF1).
[0049] FIGS. 12A and 12B illustrate the results of various
experiments performed to show that regulatory T cells could be
isolated from gene modified end product cells despite initial
allodepletion using CD25 immunotoxin. FIG. 12A shows the levels of
Foxp3 expression. FIG. 12B illustrates the results of the
functional assay performed to show that addition of CD4+/CD25+ gene
modified depleted cells significantly reduced cell proliferation.
Further discussion of experimental conditions and results are
presented in the Examples.
[0050] FIGS. 13A-13CB illustrate the results of various experiments
performed to show that gene modified allodepleted cells are rapidly
and efficiently eliminated by AP20187, and that transgene
expression and killing efficiency diminished with extended culture,
and could be restored upon T cell reactivation. FIG. 13A shows
representative FACS analysis of cells stained with Annexin-V and
7-ADD. FIG. 13B graphically illustrates the results of reactivation
of T cells on killing when AP20187 is administered. FIGS. 13CA and
13CB show representative FACS plots showing the effect of extended
culture and T cell activation on suicide gene function. Further
discussion of experimental conditions and results are presented in
the Examples.
[0051] FIGS. 14A and 14B illustrate the results of various
experiments performed to show that viral-specific T cells are
partially retained after treatment of allostimulated cells with
dimerizer. FIG. 14A shows the results for EBV-specific T cells.
FIG. 14A discloses "RAKFKQLL" as SEQ ID NO: 20.
[0052] FIG. 14B shows the results for CMV-specific T cells. FIG.
14B discloses "NLVPMVATV" as SEQ ID NO: 23. Cells were quantified
by pentamer analysis before allostimulation, after allostimulation
and after treatment of allostimulated cells with dimerizer. Further
discussion of experimental conditions and results are presented in
the Examples.
[0053] FIGS. 15A and 15B illustrate an analysis of mesenchymal
stromal cells (MSCs) from healthy individuals. FIG. 15A shows the
mononuclear adherent fraction isolated from bone marrow was
homogenously positive for CD73, CD90 and CD105 and was negative for
hematopoietic markers. FIG. 15B illustrate analysis showing the
cells were able to differentiate into other cell lineages. Further
discussion of experimental conditions and results are presented in
the Examples.
[0054] FIGS. 16A and 16B illustrate the results of experiments
performed to show that human MSCs are readily transformed with
iCasp9-ACD19 and maintain their phenotype. FIG. 16A illustrates the
percentage of CD19 positive cells (e.g., an indicator of successful
transduction of iCasp9) remains substantially constant for more
than 2 weeks. FIG. 16B shows that successfully transduced and
non-transduced cells retain the characteristic MSC surface
phenotype. Further discussion of experimental conditions and
results are presented in the Examples.
[0055] FIGS. 17A and 17B illustrate the results of experiments
performed to show that human MSCs expressing iCasp9 are selectively
driven to apoptosis in vitro after exposure to the CID. FIG. 17A
shows the results of FACS analysis of cells treated with CID for 24
hours. FIG. 17B shows the results of magnetic purification of
iCasp9+/CD19+ cells. Further discussion of experimental conditions
and results are presented in the Examples.
[0056] FIG. 18 illustrates the results of experiments performed to
determine the efficacy of apoptosis and identify apoptosis
resistant populations. FIG. 19, panels A-Q illustrate human MSCs
expressing iCasp9 stained to highlight specific cell lineages,
showing that the transduced cells retain the differentiation
potential of unmodified MSCs. Further discussion of experimental
conditions and results are presented in the Examples.
[0057] FIG. 20 graphically illustrates that the differentiated
progeny of human MSCs expressing iCasp9 are killed by exposure to
CID in vitro. FIGS. 21A-21C illustrate the results of experiments
performed to show that human MSCs expressing iCasp9 are selectively
killed in vivo after exposure to CID. FIG. 21A shows the results of
whole animal imaging. FIG. 21B graphically shows a time course of
the killing of iCasp9+ cells after exposure to CID. FIG. 21C shows
the results of serial examination of animals after subcutaneous
inoculation of MSC. Further discussion of experimental conditions
and results are presented in the Examples.
[0058] FIG. 22 shows how the suicide gene product and the CID
interact to cause apoptosis. FIG. 23 illustrates an overview of the
protocol used for production of suicide gene modified allodepleted
cells.
[0059] FIG. 24 describes the use of immunomagnetic enrichment of
iCasp9 expressing allodepleted T cells.
[0060] FIG. 25 illustrates the iCasp9-ACD19 expression construct
and the method of transducing cells to harbor the expression
construct. FIG. 25 discloses "SGGGS" as SEQ ID NO: 21. Further
discussion of experimental conditions and results are presented in
the Examples.
[0061] FIG. 26 shows the effect of CID treatment on gene modified T
cells (e.g., iCasp9 expressing cells).
[0062] FIG. 27 provides graphs showing the detection of
iCasp9-transduced T cells in the peripheral blood of patients. FIG.
27A: FACS analysis for iCasp9-transduced T cells (CD3.sup.+
CD19.sup.+, CD4.sup.+ CD19.sup.+, or CD8.sup.+ CD19.sup.+) from
four patients receiving cellular therapy following
HLA-haploidentical stem cell transplantation for relapsed leukemia.
Patients 1, 2, and 4 developed skin/liver GvHD and received a
single dose of the dimerizing drug AP1903.
[0063] FIGS. 28 and 29 graphically illustrate cell lineage
expansion of transduced iCasp9 T cells, as indicated by cell
surface markers.
[0064] FIG. 30 provides a graph and photographs of the rapid
reversal of GvHD after treatment with the dimerizing drug AP1903.
(A) is a graph depicting the normalization of bilirubin
concentration in patient 1 within 24 hours post-treatment. (B)
provides photographs showing the disappearance of skin rash from
patient 2 within 24 hours post treatment.
[0065] FIGS. 31 and 32 graphically illustrate the onset of acute
liver GvHD (grade 2) after iCasp9 T cell expansion. FIG. 32 also
pictorially illustrates a patient exhibiting symptoms of GvHD.
FIGS. 33-35 show the rapid and efficient elimination of iCasp9 T
cells after AP1903 (e.g., the CID) is administered to patients.
[0066] FIG. 35 provides graphs showing the persistence of drug
sensitivity and antiviral function of CD3.sup.+ CD19.sup.+
precursors after treatment with AP1903 in vivo. (A)
CD3.sup.+CD19.sup.+ T cells remain within the CD3.sup.+ population
in the peripheral blood 5 months after treatment with AP1903
(patient 2). These CD3.sup.+ CD19.sup.+ cells retain sensitivity to
AP1903 in vitro as assessed both by reduction of
CD3.sup.+CD19.sup.+ cell number on FACS analysis and (B) by
quantitative PCR analysis of the icasp9 gene before and after
exposure to the dimerizing drug. (C) CD3.sup.+ CD19.sup.+
gene-modified T cells collected from patient 2 were responsive to
CMV peptide mixtures at 6 days prior to AP1903, but not to negative
control surviving peptide mixtures, as shown by the presence of
IFN-gamma-positive CD3.sup.+ CD19.sup.+ T cells in the
CMV-stimulated cultures. Assessment of the recovering CD3.sup.+
CD19.sup.+ population at 6 and 14 days after AP1903 infusion to
treat GvHD showed the persistence of virus-specific cells in the
absence of recurrent GvHD.
[0067] FIGS. 36-38 graphically illustrate that iCasp9 allodepleted
cells are able to expand after AP1903 treatment without signs of
GvHD. FIG. 37 shows reconstitution of naive, central memory and
effector memory T cell after AP1903 treatment. FIG. 39 graphically
illustrates iCasp9 allodepleted T cell expansion and restoration of
donor chimerism. Further discussion of experimental conditions and
results are presented in the Examples.
[0068] FIG. 40 graphically illustrates virus specific T cells pre
and post T cell infusion.
[0069] FIG. 41 graphically illustrates the levels of intracellular
IFN-g production by Pt PBMC in response to aspergillus antigen.
[0070] FIG. 42 graphically illustrates iCasp T cells expansion.
Further discussion of experimental conditions and results are
presented in the Examples.
[0071] FIG. 43 graphically illustrates the portion of the
expression construct coding for the chimeric iCaspase9 and CD19
polypeptides.
DETAILED DESCRIPTION
[0072] As used herein, the use of the word "a" or "an" when used in
conjunction with the term "comprising" in the claims and/or the
specification may mean "one," but it is also consistent with the
meaning of "one or more," "at least one," and "one or more than
one." Still further, the terms "having", "including", "containing"
and "comprising" are interchangeable and one of skill in the art is
cognizant that these terms are open ended terms.
[0073] The term "allogeneic" as used herein, refers to HLA or MHC
loci that are antigenically distinct.
[0074] Thus, cells or tissue transferred from the same species can
be antigenically distinct. Syngeneic mice can differ at one or more
loci (congenics) and allogeneic mice can have the same
background.
[0075] The term "antigen" as used herein is defined as a molecule
that provokes an immune response.
[0076] This immune response may involve either antibody production,
or the activation of specific immunologically-competent cells, or
both.
[0077] The term "cancer" as used herein is defined as a
hyperproliferation of cells whose unique trait-loss of normal
controls-results in unregulated growth, lack of differentiation,
local tissue invasion, and metastasis. Examples include but are not
limited to, melanoma, non-small cell lung, small-cell lung, lung,
hepatocarcinoma, leukemia, retinoblastoma, astrocytoma,
glioblastoma, gum, tongue, neuroblastoma, head, neck, breast,
pancreatic, prostate, renal, bone, testicular, ovarian,
mesothelioma, cervical, gastrointestinal, lymphoma, brain, colon,
sarcoma or bladder.
[0078] Donor: The term "donor" refers to a mammal, for example, a
human, that is not the patient recipient. The donor may, for
example, have HLA identity with the recipient, or may have partial
or greater HLA disparity with the recipient.
[0079] Haploidentical: The term "haploidentical" as used with
reference to cells, cell types and/or cell lineages, herein refers
to cells sharing a haplotype or cells having substantially the same
alleles at a set of closely linked genes on one chromosome. A
haploidentical donor does not have complete HLA identity with the
recipient, there is a partial HLA disparity.
[0080] Blood disease: The terms "blood disease", "blood disease"
and/or "diseases of the blood" as used herein, refers to conditions
that affect the production of blood and its components, including
but not limited to, blood cells, hemoglobin, blood proteins, the
mechanism of coagulation, production of blood, production of blood
proteins, the like and combinations thereof. Non-limiting examples
of blood diseases include anemias, leukemias, lymphomas,
hematological neoplasms, albuminemias, haemophilias and the
like.
[0081] Bone marrow disease: The term "bone marrow disease" as used
herein, refers to conditions leading to a decrease in the
production of blood cells and blood platelets. In some bone marrow
diseases, normal bone marrow architecture can be displaced by
infections (e.g., tuberculosis) or malignancies, which in turn can
lead to the decrease in production of blood cells and blood
platelets. Non-limiting examples of bone marrow diseases include
leukemias, bacterial infections (e.g., tuberculosis), radiation
sickness or poisoning, apnocytopenia, anemia, multiple myeloma and
the like.
[0082] T cells and Activated T cells (include that this means CD3+
cells): T cells (also referred to as T lymphocytes) belong to a
group of white blood cells referred to as lymphocytes. Lymphocytes
generally are involved in cell-mediated immunity. The "T" in "T
cells" refers to cells derived from or whose maturation is
influence by the thymus. T cells can be distinguished from other
lymphocytes types such as B cells and Natural Killer (NK) cells by
the presence of cell surface proteins known as T cell receptors.
The term "activated T cells" as used herein, refers to T cells that
have been stimulated to produce an immune response (e.g., clonal
expansion of activated T cells) by recognition of an antigenic
determinant presented in the context of a Class II major
histocompatibility (MHC) marker. T-cells are activated by the
presence of an antigenic determinant, cytokines and/or lymphokines
and cluster of differentiation cell surface proteins (e.g., CD3,
CD4, CD8, the like and combinations thereof). Cells that express a
cluster of differential protein often are said to be "positive" for
expression of that protein on the surface of T-cells (e.g., cells
positive for CD3 or CD 4 expression are referred to as CD3+ or
CD4+). CD3 and CD4 proteins are cell surface receptors or
co-receptors that may be directly and/or indirectly involved in
signal transduction in T cells.
[0083] Peripheral blood: The term "peripheral blood" as used
herein, refers to cellular components of blood (e.g., red blood
cells, white blood cells and platelets), which are obtained or
prepared from the circulating pool of blood and not sequestered
within the lymphatic system, spleen, liver or bone marrow.
[0084] Umbilical cord blood: Umbilical cord blood is distinct from
peripheral blood and blood sequestered within the lymphatic system,
spleen, liver or bone marrow. The terms "umbilical cord blood",
"umbilical blood" or "cord blood", which can be used
interchangeably, refers to blood that remains in the placenta and
in the attached umbilical cord after child birth. Cord blood often
contains stem cells including hematopoietic cells.
[0085] By "obtained or prepared" as, for example, in the case of
cells, is meant that the cells or cell culture are isolated,
purified, or partially purified from the source, where the source
may be, for example, umbilical cord blood, bone marrow, or
peripheral blood. The terms may also apply to the case where the
original source, or a cell culture, has been cultured and the cells
have replicated, and where the progeny cells are now derived from
the original source.
[0086] Allodepletion: The term "allodepletion" as used herein,
refers to the selective depletion of alloreactive T cells. The term
"alloreactive T cells" as used herein, refers to T cells activated
to produce an immune response in reaction to exposure to foreign
cells, such as, for example, in a transplanted allograft. The
selective depletion generally involves targeting various cell
surface expressed markers or proteins, (e.g., sometimes cluster of
differentiation proteins (CD proteins)), for removal using
immunomagnets, immunotoxins, flow sorting, induction of apoptosis,
photodepletion techniques, the like or combinations thereof. In the
present methods, the cells may be transduced or transfected with
the chimeric protein-encoding vector before or after allodepletion.
Also, the cells may be transduced or transfected with the chimeric
protein-encoding vector without an allodepletion step, and the
non-allodepleted cells may be administered to the patient. Because
of the added "safety switch" it is, for example, possible to
administer the non allodepleted T cells because an adverse event
such as, for example, graft versus host disease, may be alleviated
upon the administration of the multimeric ligand.
[0087] Graft versus host disease: The terms "graft versus host
disease" or "GvHD", refer to a complication often associated with
allogeneic bone marrow transplantation and sometimes associated
with transfusions of un-irradiated blood to immunocompromised
patients. Graft versus host disease sometimes can occur when
functional immune cells in the transplanted marrow recognize the
recipient as "foreign" and mount an immunologic response. GvHD can
be divided into an acute form and a chronic form. Acute GVHD
(aGVHD) often is observed within the first 100 days following
transplant or transfusion and can affect the liver, skin, mucosa,
immune system (e.g., the hematopoietic system, bone marrow, thymus,
and the like), lungs and gastrointestinal tract. Chronic GVHD
(cGVHD) often begins 100 days or later post transplant or
transfusion and can attack the same organs as acute GvHD, but also
can affect connective tissue and exocrine glands. Acute GvHD of the
skin can result in a diffuse maculopapular rash, sometimes in a
lacy pattern.
[0088] Donor T cell: The term "donor T cell" as used here refers to
T cells that often are administered to a recipient to confer
anti-viral and/or anti-tumor immunity following allogeneic stem
cell transplantation. Donor T cells often are utilized to inhibit
marrow graft rejection and increase the success of alloengraftment,
however the same donor T cells can cause an alloaggressive response
against host antigens, which in turn can result in graft versus
host disease (GVHD). Certain activated donor T cells can cause a
higher or lower GvHD response than other activated T cells. Donor T
cells may also be reactive against recipient tumor cells, causing a
beneficial graft vs. tumor effect.
[0089] Mesenchymal stromal cell: The terms "mesenchymal stromal
cell" or "bone marrow derived mesenchymal stromal cell" as used
herein, refer to multipotent stem cells that can differentiate ex
vivo, in vitro and in vivo into adipocytes, osteoblasts and
chondroblasts, and may be further defined as a fraction of
mononuclear bone marrow cells that adhere to plastic culture dishes
in standard culture conditions, are negative for hematopoietic
lineage markers and are positive for CD73, CD90 and CD105.
[0090] Embryonic stem cell: The term "embryonic stem cell" as used
herein, refers to pluripotent stem cells derived from the inner
cell mass of the blastocyst, an early-stage embryo of between 50 to
150 cells. Embryonic stem cells are characterized by their ability
to renew themselves indefinitely and by their ability to
differentiate into derivatives of all three primary germ layers,
ectoderm, endoderm and mesoderm. Pluripotent is distinguished from
mutipotent in that pluripotent cells can generate all cell types,
while multipotent cells (e.g., adult stem cells) can only produce a
limited number of cell types.
[0091] Inducible pluripotent stem cell: The terms "inducible
pluripotent stem cell" or "induced pluripotent stem cell" as used
herein refers to adult, or differentiated cells, that are
"reprogrammed" or induced by genetic (e.g., expression of genes
that in turn activates pluripotency), biological (e.g., treatment
viruses or retroviruses) and/or chemical (e.g., small molecules,
peptides and the like) manipulation to generate cells that are
capable of differentiating into many if not all cell types, like
embryonic stem cells. Inducible pluripotent stem cells are
distinguished from embryonic stem cells in that they achieve an
intermediate or terminally differentiated state (e.g., skin cells,
bone cells, fibroblasts, and the like) and then are induced to
dedifferentiate, thereby regaining some or all of the ability to
generate multipotent or pluripotent cells.
[0092] CD34+ cell: The term "CD34+ cell" as used herein refers to a
cell expressing the CD34 protein on its cell surface. "CD34" as
used herein refers to a cell surface glycoprotein (e.g., sialomucin
protein) that often acts as a cell-cell adhesion factor and is
involved in T cell entrance into lymph nodes, and is a member of
the "cluster of differentiation" gene family. CD34 also may mediate
the attachment of stem cells to bone marrow, extracellular matrix
or directly to stromal cells. CD34+ cells often are found in the
umbilical cord and bone marrow as hematopoietic cells, a subset of
mesenchymal stem cells, endothelial progenitor cells, endothelial
cells of blood vessels but not lymphatics (except pleural
lymphatics), mast cells, a sub-population of dendritic cells (which
are factor XIIIa negative) in the interstitium and around the
adnexa of dermis of skin, as well as cells in certain soft tissue
tumors (e.g., alveolar soft part sarcoma, pre-B acute lymphoblastic
leukemia (Pre-B-ALL), acute myelogenous leukemia (AML), AML-M7,
dermatofibrosarcoma protuberans, gastrointestinal stromal tumors,
giant cell fibroblastoma, granulocytic sarcoma, Kaposi's sarcoma,
liposarcoma, malignant fibrous histiocytoma, malignant peripheral
nerve sheath tumors, mengingeal hemangiopericytomas, meningiomas,
neurofibromas, schwannomas, and papillary thyroid carcinoma).
[0093] Gene expression vector: The terms "gene expression vector",
"nucleic acid expression vector", or "expression vector" as used
herein, which can be used interchangeably throughout the document,
generally refers to a nucleic acid molecule (e.g., a plasmid,
phage, autonomously replicating sequence (ARS), artificial
chromosome, yeast artificial chromosome (e.g., YAC)) that can be
replicated in a host cell and be utilized to introduce a gene or
genes into a host cell. The genes introduced on the expression
vector can be endogenous genes (e.g., a gene normally found in the
host cell or organism) or heterologous genes (e.g., genes not
normally found in the genome or on extra-chromosomal nucleic acids
of the host cell or organism). The genes introduced into a cell by
an expression vector can be native genes or genes that have been
modified or engineered. The gene expression vector also can be
engineered to contain 5' and 3' untranslated regulatory sequences
that sometimes can function as enhancer sequences, promoter regions
and/or terminator sequences that can facilitate or enhance
efficient transcription of the gene or genes carried on the
expression vector. A gene expression vector sometimes also is
engineered for replication and/or expression functionality (e.g.,
transcription and translation) in a particular cell type, cell
location, or tissue type. Expression vectors sometimes include a
selectable marker for maintenance of the vector in the host or
recipient cell.
[0094] Developmentally regulated promoter: The term
"developmentally regulated promoter" as used herein refers to a
promoter that acts as the initial binding site for RNA polymerase
to transcribe a gene which is expressed under certain conditions
that are controlled, initiated by or influenced by a developmental
program or pathway. Developmentally regulated promoters often have
additional control regions at or near the promoter region for
binding activators or repressors of transcription that can
influence transcription of a gene that is part of a development
program or pathway. Developmentally regulated promoters sometimes
are involved in transcribing genes whose gene products influence
the developmental differentiation of cells.
[0095] Developmentally differentiated cells: The term
"developmentally differentiated cells", as used herein refers to
cells that have undergone a process, often involving expression of
specific developmentally regulated genes, by which the cell evolves
from a less specialized form to a more specialized form in order to
perform a specific function. Non-limiting examples of
developmentally differentiated cells are liver cells, lung cells,
skin cells, nerve cells, blood cells, and the like.
[0096] Changes in developmental differentiation generally involve
changes in gene expression (e.g., changes in patterns of gene
expression), genetic re-organization (e.g., remodeling or chromatin
to hide or expose genes that will be silenced or expressed,
respectively), and occasionally involve changes in DNA sequences
(e.g., immune diversity differentiation). Cellular differentiation
during development can be understood as the result of a gene
regulatory network. A regulatory gene and its cis-regulatory
modules are nodes in a gene regulatory network that receive input
(e.g., protein expressed upstream in a development pathway or
program) and create output elsewhere in the network (e.g., the
expressed gene product acts on other genes downstream in the
developmental pathway or program).
[0097] The terms "cell," "cell line," and "cell culture" as used
herein may be used interchangeably. All of these terms also include
their progeny, which are any and all subsequent generations. It is
understood that all progeny may not be identical due to deliberate
or inadvertent mutations.
[0098] As used herein, the term "icaspase 9 molecule" is defined as
an inducible caspase 9. The term "icaspase 9" embraces icaspase 9
nucleic acids, icaspase 9 polypeptides and/or icaspase 9 expression
vectors. The term also encompasses either the natural icaspase 9
nucleotide or amino acid sequence, or a truncated sequence that is
lacking the CARD domain.
[0099] As used herein, the term "icaspase 1 molecule", "icaspase 3
molecule", or "icaspase 8 molecule" is defined as an inducible
caspase 1, 3, or 8, respectively. The term icaspase 1, icaspase 3,
or icaspase 8, embraces icaspase 1, 3, or 8 nucleic acids, icaspase
1, 3, or 8 polypeptides and/or icaspase 1, 3, or 8 expression
vectors, respectively. The term also encompasses either the natural
icaspase 1, 3, or 8 nucleotide or amino acid sequence,
respectively, or a truncated sequence that is lacking the CARD
domain.
[0100] As used herein, the term "cDNA" is intended to refer to DNA
prepared using messenger RNA (mRNA) as template. The advantage of
using a cDNA, as opposed to genomic DNA or DNA polymerized from a
genomic, non- or partially-processed RNA template, is that the cDNA
primarily contains coding sequences of the corresponding protein.
There are times when the full or partial genomic sequence is used,
such as where the non-coding regions are required for optimal
expression or where non-coding regions such as introns are to be
targeted in an antisense strategy.
[0101] As used herein, the term "expression construct" or
"transgene" is defined as any type of genetic construct containing
a nucleic acid coding for gene products in which part or all of the
nucleic acid encoding sequence is capable of being transcribed can
be inserted into the vector. The transcript is translated into a
protein, but it need not be. In certain embodiments, expression
includes both transcription of a gene and translation of mRNA into
a gene product. In other embodiments, expression only includes
transcription of the nucleic acid encoding genes of interest. The
term "therapeutic construct" may also be used to refer to the
expression construct or transgene. The expression construct or
transgene may be used, for example, as a therapy to treat
hyperproliferative diseases or disorders, such as cancer, thus the
expression construct or transgene is a therapeutic construct or a
prophylactic construct.
[0102] As used herein, the term "expression vector" refers to a
vector containing a nucleic acid sequence coding for at least part
of a gene product capable of being transcribed. In some cases, RNA
molecules are then translated into a protein, polypeptide, or
peptide. In other cases, these sequences are not translated, for
example, in the production of antisense molecules or ribozymes.
Expression vectors can contain a variety of control sequences,
which refer to nucleic acid sequences necessary for the
transcription and possibly translation of an operatively linked
coding sequence in a particular host organism. In addition to
control sequences that govern transcription and translation,
vectors and expression vectors may contain nucleic acid sequences
that serve other functions as well and are discussed infra.
[0103] As used herein, the term "ex vivo" refers to "outside" the
body. The terms "ex vivo" and "in vitro" can be used
interchangeably herein.
[0104] As used herein, the term "functionally equivalent," as it
relates to caspase 9, or truncated caspase 9, for example, refers
to a caspase 9 nucleic acid fragment, variant, or analog, refers to
a nucleic acid that codes for a caspase 9 polypeptide, or a caspase
9 polypeptide, that stimulates an apoptotic response. "Functionally
equivalent" refers, for example, to a caspase 9 polypeptide that is
lacking the CARD domain, but is capable of inducing an apoptotic
cell response. When the term "functionally equivalent" is applied
to other nucleic acids or polypeptides, such as, for example, CD19,
the 5'LTR, the multimeric ligand binding region, or CD3, it refers
to fragments, variants, and the like that have the same or similar
activity as the reference polypeptides of the methods herein.
[0105] As used herein, the term "gene" is defined as a functional
protein, polypeptide, or peptide-encoding unit. As will be
understood, this functional term includes genomic sequences, cDNA
sequences, and smaller engineered gene segments that express, or
are adapted to express, proteins, polypeptides, domains, peptides,
fusion proteins, and mutants.
[0106] The term "immunogenic composition" or "immunogen" refers to
a substance that is capable of provoking an immune response.
Examples of immunogens include, e.g., antigens, autoantigens that
play a role in induction of autoimmune diseases, and
tumor-associated antigens expressed on cancer cells.
[0107] The term "immunocompromised" as used herein is defined as a
subject that has reduced or weakened immune system. The
immunocompromised condition may be due to a defect or dysfunction
of the immune system or to other factors that heighten
susceptibility to infection and/or disease. Although such a
categorization allows a conceptual basis for evaluation,
immunocompromised individuals often do not fit completely into one
group or the other. More than one defect in the body's defense
mechanisms may be affected. For example, individuals with a
specific T-lymphocyte defect caused by HIV may also have
neutropenia caused by drugs used for antiviral therapy or be
immunocompromised because of a breach of the integrity of the skin
and mucous membranes. An immunocompromised state can result from
indwelling central lines or other types of impairment due to
intravenous drug abuse; or be caused by secondary malignancy,
malnutrition, or having been infected with other infectious agents
such as tuberculosis or sexually transmitted diseases, e.g.,
syphilis or hepatitis.
[0108] As used herein, the term "pharmaceutically or
pharmacologically acceptable" refers to molecular entities and
compositions that do not produce adverse, allergic, or other
untoward reactions when administered to an animal or a human.
[0109] As used herein, "pharmaceutically acceptable carrier"
includes any and all solvents, dispersion media, coatings,
antibacterial and antifungal agents, isotonic and absorption
delaying agents and the like. The use of such media and agents for
pharmaceutically active substances is well known in the art. Except
insofar as any conventional media or agent is incompatible with the
vectors or cells presented herein, its use in therapeutic
compositions is contemplated. Supplementary active ingredients also
can be incorporated into the compositions.
[0110] As used herein, the term "polynucleotide" is defined as a
chain of nucleotides. Furthermore, nucleic acids are polymers of
nucleotides. Thus, nucleic acids and polynucleotides as used herein
are interchangeable. Nucleic acids are polynucleotides, which can
be hydrolyzed into the monomeric "nucleotides." The monomeric
nucleotides can be hydrolyzed into nucleosides. As used herein
polynucleotides include, but are not limited to, all nucleic acid
sequences which are obtained by any means available in the art,
including, without limitation, recombinant means, i.e., the cloning
of nucleic acid sequences from a recombinant library or a cell
genome, using ordinary cloning technology and PCR.TM., and the
like, and by synthetic means. Furthermore, polynucleotides include
mutations of the polynucleotides, include but are not limited to,
mutation of the nucleotides, or nucleosides by methods well known
in the art.
[0111] As used herein, the term "polypeptide" is defined as a chain
of amino acid residues, usually having a defined sequence. As used
herein the term polypeptide is interchangeable with the terms
"peptides" and "proteins".
[0112] As used herein, the term "promoter" is defined as a DNA
sequence recognized by the synthetic machinery of the cell, or
introduced synthetic machinery, required to initiate the specific
transcription of a gene.
[0113] The term "transfection" and "transduction" are
interchangeable and refer to the process by which an exogenous DNA
sequence is introduced into a eukaryotic host cell. Transfection
(or transduction) can be achieved by any one of a number of means
including electroporation, microinjection, gene gun delivery,
retroviral infection, lipofection, superfection and the like.
[0114] As used herein, the term "syngeneic" refers to cells,
tissues or animals that have genotypes that are identical or
closely related enough to allow tissue transplant, or are
immunologically compatible. For example, identical twins or animals
of the same inbred strain. Syngeneic and isogeneic can be used
interchangeably.
[0115] The terms "patient" or "subject" are interchangeable, and,
as used herein include, but are not limited to, an organism or
animal; a mammal, including, e.g., a human, non-human primate
(e.g., monkey), mouse, pig, cow, goat, rabbit, rat, guinea pig,
hamster, horse, monkey, sheep, or other non-human mammal; a
non-mammal, including, e.g., a non-mammalian vertebrate, such as a
bird (e.g., a chicken or duck) or a fish, and a non-mammalian
invertebrate.
[0116] As used herein, the term "under transcriptional control" or
"operatively linked" is defined as the promoter is in the correct
location and orientation in relation to the nucleic acid to control
RNA polymerase initiation and expression of the gene.
[0117] As used herein, the terms "treatment", "treat", "treated",
or "treating" refer to prophylaxis and/or therapy.
[0118] As used herein, the term "vaccine" refers to a formulation
that contains a composition presented herein which is in a form
that is capable of being administered to an animal. Typically, the
vaccine comprises a conventional saline or buffered aqueous
solution medium in which the composition is suspended or dissolved.
In this form, the composition can be used conveniently to prevent,
ameliorate, or otherwise treat a condition. Upon introduction into
a subject, the vaccine is able to provoke an immune response
including, but not limited to, the production of antibodies,
cytokines and/or other cellular responses.
[0119] In some embodiments, the nucleic acid is contained within a
viral vector. In certain embodiments, the viral vector is a
retroviral vector.
Hematopoietic Stem Cells and Cell Therapy
[0120] Hematopoietic stem cells include hematopoietic progenitor
cells, immature, multipotent cells that can differentiate into
mature blood cell types. These stem cells and progenitor cells may
be isolated from bone marrow and umbilical cord blood, and, in some
cases, from peripheral blood. Other stem and progenitor cells
include, for example, mesenchymal stromal cells, embryonic stem
cells, and inducible pluripotent stem cells.
[0121] Bone marrow derived mesenchymal stromal cells (MSCs) have
been defined as a fraction of mononuclear bone marrow cells that
adhere to plastic culture dishes in standard culture conditions,
are negative for hematopoietic lineage markers and positive for
CD73, CD90 and CD105, and able to differentiate in vitro into
adipocytes, osteoblasts, and chondroblasts. While one physiologic
role is presumed to be the support of hematopoiesis, several
reports have also established that MSCs are able to incorporate and
possibly proliferate in areas of active growth, such as cicatricial
and neoplastic tissues, and to home to their native
microenvironment and replace the function of diseased cells. Their
differentiation potential and homing ability make MSCs attractive
vehicles for cellular therapy, either in their native form for
regenerative applications, or through their genetic modification
for delivery of active biological agents to specific
microenvironments such as diseased bone marrow or metastatic
deposits. In addition, MSCs possess potent intrinsic
immunosuppressive activity, and to date have found their most
frequent application in the experimental treatment of
graft-versus-host disease and autoimmune disorders (Pittenger, M.
F., et al. (1999). Science 284: 143-147; Dominici, M., et al.
(2006). Cytotherapy 8: 315-317; Prockop, D. J. (1997). Science 276:
71-74; Lee, R. H., et al. (2006). Proc Natl Acad Sci USA 103:
17438-17443; Studeny, M., et al., (2002). Cancer Res 62: 3603-3608;
Studeny, M., et al. (2004). J Natl Cancer Inst 96: 1593-1603;
Horwitz, E. M., et al. (1999). Nat Med 5: 309-313; Chamberlain, G.,
et al., (2007). Stem Cells 25: 2739-2749; Phinney, D. G., and
Prockop, D. J. (2007). Stem Cells 25: 2896-2902; Horwitz, E. M., et
al. (2002). Proc Natl Acad Sci USA 99: 8932-8937; Hall, B., et al.,
(2007). Int J Hematol 86: 8-16; Nauta, A. J., and Fibbe, W. E.
(2007). Blood 110: 3499-3506; Le Blanc, K., et al. (2008). Lancet
371: 1579-1586; Tyndall, A., and Uccelli, A. (2009). Bone Marrow
Transplant).
[0122] MSCs have been infused in hundreds of patients with minimal
reported side effects. However, follow-up is limited, long term
side effects are unknown, and little is known of the consequences
that will be associated with future efforts to induce their in vivo
differentiation, for example to cartilage or bone, or to
genetically modify them to enhance their functionality. Several
animal models have raised safety concerns. For instance,
spontaneous osteosarcoma formation in culture has been observed in
murine derived MSCs. Furthermore, ectopic ossification and
calcification foci have been described in mouse and rat models of
myocardial infarction after local injection of MSC, and their
proarrhythmic potential has also been apparent in co-culture
experiments with neonatal rat ventricular myocytes. Moreover,
bilateral diffuse pulmonary ossification has been observed after
bone marrow transplant in a dog, presumably due to the transplanted
stromal components (Horwitz, E. M., et al., (2007). Biol Blood
Marrow Transplant 13: 53-57; Tolar, J., et al. (2007). Stem Cells
25: 371-379; Yoon, Y.-S., et al., (2004). Circulation 109:
3154-3157; Breitbach, M., et al. (2007). Blood 110: 1362-1369;
Chang, M. G., et al. (2006). Circulation 113: 1832-1841; Sale, G.
E., and Storb, R. (1983). Exp Hematol 11: 961-966).
[0123] In another example of cell therapy, T cells transduced with
a nucleic acid encoding a chimeric antigen receptor have been
administered to patients to treat cancer (Zhong, X.-S., (2010)
Molecular Therapy 18:413-420). For example, T cells expressing a
chimeric antigen receptor based on the humanized monoclonal
antibody Trastuzumab (Herceptin) has been used to treat cancer
patients. Adverse events are possible, however, and in at least one
reported case, the therapy had fatal consequences to the patient
(Morgan, R. A., et al., (2010) Molecular Therapy 18:843-851).
Transducing the cells with a chimeric caspase 9-based safety switch
as presented herein, would provide a safety switch that could stop
the adverse event from progressing.
[0124] In another example of cell therapy, T cells are modified so
that express a non-functional TGF-beta receptor, rendering them
resistant to TGF-beta. This allows the modified T cells to avoid
the cytotoxicity caused by TGF-beta, and allows the cells to be
used in cellular therapy (Bollard, C. J., et al., (2002) Blood
99:3179-3187; Bollard, C. M., et al., (2004) J. Exptl. Med.
200:1623-1633). However, it also could result in a T cell lymphoma,
or other adverse effect, as the modified T cells now lack part of
the normal cellular control; these therapeutic T cells could
themselves become malignant. Transducing these modified T cells
with a chimeric caspase 9-based safety switch as presented herein,
would provide a safety switch that could avoid this result.
[0125] Cells used in cellular therapy, that express a heterologous
gene, such as a modified receptor, or a chimeric receptor, may be
transduced with nucleic acid that encodes a chimeric caspase
9-based safety switch before, after, or at the same time, as the
cells are transduced with the heterologous gene.
Haploidentical Stem Cell Transplantation
[0126] While stem cell transplantation has proven an effective
means of treating a wide variety of diseases involving
hematopoietic stem cells and their progeny, a shortage of
histocompatible donors has proved a major impediment to the widest
application of the approach. The introduction of large panels of
unrelated stem cell donors and or cord blood banks has helped to
alleviate the problem, but many patients remain unsuited to either
source. Even when a matched donor can be found, the elapsed time
between commencing the search and collecting the stem cells usually
exceeds three months, a delay that may doom many of the most needy
patients. Hence there has been considerable interest in making use
of HLA haploidentical family donors. Such donors may be parents,
siblings or second-degree relatives. The problem of graft rejection
may be overcome by a combination of appropriate conditioning and
large doses of stem cells, while graft versus host disease (GvHD)
may be prevented by extensive T cell-depletion of the donor graft.
The immediate outcomes of such procedures have been gratifying,
with engraftment rate >90% and a severe GvHD rate of <10% for
both adults and children even in the absence of post transplant
immunosuppression. Unfortunately the profound immunosuppression of
the grafting procedure, coupled with the extensive T cell-depletion
and HLA mismatching between donor and recipient lead to an
extremely high rate of post-transplant infectious complications,
and contributed to high incidence of disease relapse.
[0127] Donor T cell infusion is an effective strategy for
conferring anti-viral and anti-tumor immunity following allogeneic
stem cell transplantation. Simple addback of T cells to the
patients after haploidentical transplantation, however, cannot
work; the frequency of alloreactive T cells is several orders of
magnitude higher than the frequency of, for example, virus specific
T lymphocytes. Methods are being developed to accelerate immune
reconstitution by administrating donor T cells that have first been
depleted of alloreactive cells. One method of achieving this is
stimulating donor T cells with recipient EBV-transformed B
lymphoblastoid cell lines (LCLs). Alloreactive T cells upregulate
CD25 expression, and are eliminated by a CD25 Mab immunotoxin
conjugate, RFT5-SMPT-dgA. This compound consists of a murine IgG1
anti-CD25 (IL-2 receptor alpha chain) conjugated via a
hetero-bifunctional crosslinker
[N-succinimidyloxycarbonyl-alpha-methyl-d-(2-pyridylthio) toluene]
to chemically deglycosylated ricin A chain (dgA).
[0128] Treatment with CD25 immunotoxin after LCL stimulation
depletes >90% of alloreactive cells. In a phase I clinical
study, using CD25 immunotoxin to deplete alloreactive lymphocytes
immune reconstitution after allodepleted donor T cells were infused
at 2 dose levels into recipients of T-cell-depleted haploidentical
SCT. Eight patients were treated at 104 cells/kg/dose, and 8
patients received 10.sup.5 cells/kg/dose. Patients receiving
10.sup.5 cells/kg/dose showed significantly improved T-cell
recovery at 3, 4, and 5 months after SCT compared with those
receiving 10.sup.4 cells/kg/dose (P<0.05). Accelerated T-cell
recovery occurred as a result of expansion of the effector memory
(CD45RA(-)CCR-7(-)) population (P<0.05), suggesting that
protective T-cell responses are likely to be long lived.
T-cell-receptor signal joint excision circles (TRECs) were not
detected in reconstituting T cells in dose-level 2 patients,
indicating they are likely to be derived from the infused
allodepleted cells. Spectratyping of the T cells at 4 months
demonstrated a polyclonal Vbeta repertoire. Using tetramer and
enzyme-linked immunospot (ELISPOT) assays, cytomegalovirus (CMV)-
and Epstein-Barr virus (EBV)-specific responses in 4 of 6 evaluable
patients at dose level 2 as early as 2 to 4 months after
transplantation, whereas such responses were not observed until 6
to 12 months in dose-level 1 patients. The incidence of significant
acute (2 of 16) and chronic graft-versus-host disease (GvHD; 2 of
15) was low. These data demonstrate that allodepleted donor T cells
can be safely used to improve T-cell recovery after haploidentical
SCT. The amount of cells infused was subsequently escalated to
10.sup.6 cells/kg without evidence of GvHD.
[0129] Although this approach reconstituted antiviral immunity,
relapse remained a major problem and 6 patients transplanted for
high risk leukemia relapsed and died of disease. Higher T cell
doses are therefore useful to reconstitute anti-tumor immunity and
to provide the hoped-for anti-tumor effect, since the estimated
frequency of tumor-reactive precursors is 1 to 2 logs less than
frequency of viral-reactive precursors. However, in some patients,
these doses of cells will be sufficient to trigger GvHD even after
allodepletion (Hurley C K, et al., Biol Blood Marrow Transplant
2003; 9:610-615; Dey B R, et al., Br.J Haematol. 2006; 135:423-437;
Aversa F, et al., N Engl J Med 1998; 339:1186-1193; Aversa F, et
al., J Clin.On col. 2005; 23:3447-3454; Lang P, Mol.Dis. 2004;
33:281-287; Kolb H J, et al., Blood 2004; 103:767-776; Gottschalk
S, et al., Annu.Rev.Med 2005; 56:29-44; Bleakley M, et al.,
Nat.Rev.Cancer 2004; 4:371-380; Andre-Schmutz I, et al., Lancet
2002; 360:130-137; Solomon S R, et al., Blood 2005; 106:1123-1129;
Amrolia P J, et al., Blood 2006; 108:1797-1808; Amrolia P J, et
al., Blood 2003; Ghetie V, et al., J Immunol Methods 1991;
142:223-230; Molldrem J J, et al., Cancer Res 1999; 59:2675-2681;
Rezvani K, et al., Clin.Cancer Res. 2005; 1 1:8799-8807; Rezvani K,
et al., Blood 2003; 102:2892-2900).
Graft Versus Host Disease (GvHD)
[0130] Graft versus Host Disease is a condition that sometimes
occurs after the transplantation of donor immunocompetent cells,
for example, T cells, into a recipient. The transplanted cells
recognize the recipient's cells as foreign, and attack and destroy
them. This condition can be a dangerous effect of T cell
transplantation, especially when associated with haploidentical
stem cell transplantation. Sufficient T cells should be infused to
provide the beneficial effects, such as, for example, the
reconstitution of an immune system and the graft anti-tumor effect.
But, the number of T cells that can be transplanted can be limited
by the concern that the transplant will result in severe graft
versus host disease. Graft versus Host Disease may be staged as
indicated in the following tables:
TABLE-US-00001 Staging Stage 0 Stage 1 Stage 2 Stage 3 Stage 4 Skin
No rash Rash < 25% 25-50% >50% Plus bullae and BSA
Generalized desquamation erythroderma Gut <500 mL 501-1000
1001-1500 >1500 mL/day Severe (for pediatric diarrhea/day mL/day
mL/day >15 cm.sup.3/kg/day abdominal pain patients) 5
cm.sup.3/kg-10 10 cm.sup.3/kg- and ileus cm.sup.3/kg/day 15
cm.sup.3/kg/day UGI Severe nausea/vomiting Liver Bilirubin 2.1-3
mg/di 3.1-6 mg/di 6.1-15 mg/di >15 mg/di s 2 mg/di
[0131] Acute GvHD grading may be performed by the consensus
conference criteria (Przepiorka D et al., 1994 Consensus Conference
on Acute GVHD Grading. Bone Marrow Transplant 1995;
15:825-828).
TABLE-US-00002 Grading Index of Acute GvHD Skin Liver Gut Upper GI
0 None and None and None and None I Stage 1-2 and None and None
None II Stage 3 and/or Stage 1 and/or Stage 1 and/or Stage 1 III
None-Stage 3 Stage 2-3 or Stage 2-4 N/A with IV Stage 4 or Stage 4
N/A N/A
[0132] Inducible Caspase 9 as a "Safety Switch" for Cell Therapy
and for Genetically Engineered Cell Transplantation
[0133] By reducing the effect of graft versus host disease is
meant, for example, a decrease in the GvHD symptoms so that the
patient may be assigned a lower level stage, or, for example, a
reduction of a symptom of graft versus host disease by at least
20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99%. A reduction in
the effect of graft versus host disease may also be measured by
detection of a reduction in activated T cells involved in the GvHD
reaction, such as, for example, a reduction of cells that express
the marker protein, for example CD19, and express CD3 (CD3.sup.+
CD19.sup.+ cells, for example) by at least 30%, 40%, 50%, 60%, 70%,
75%, 80%, 85%, 90%, 95%, or 99%.
[0134] Provided herein is an alternative suicide gene strategy that
is based on human proapoptotic molecules fused with an FKBP variant
that is optimized to bind a chemical inducer of dimerization (CID)
(Clackson T, et al., Proc Natl Acad Sci USA. 1998, 95:10437-10442),
m AP1903, a synthetic drug that has proven safe in healthy
volunteers (Iuliucci J D, et al., J Clin Pharmacol. 2001,
41:870-879). Administration of this small molecule results in
cross-linking and activation of the proapoptotic target molecules.
The application of this inducible system in human T lymphocytes has
been explored using Fas or the death effector domain (DED) of the
Fas-associated death domain-containing protein (FADD) as
proapoptotic molecules. Up to 90% of T cells transduced with these
inducible death molecules underwent apoptosis after administration
of CID (Thomis D C, et al., Blood. 2001, 97:1249-1257; Spencer D M,
et al., Curr Biol. 1996, 6: 839-847; Fan L, et al., Hum Gene Ther.
1999, 10: 2273-2285; Berger C, et al., Blood. 2004, 103:1261-1269;
Junker K, et al., Gene Ther. 2003, 10:1189-197). This suicide gene
strategy may be used in any appropriate cell used for cell therapy
including, for example, hematopoietic stem cells, and other
progenitor cells, including, for example, mesenchymal stromal
cells, embryonic stem cells, and inducible pluripotent stem
cells.
[0135] Therefore, this safety switch, catalyzed by caspase 9, may
be used where there is a condition in the cell therapy patient that
requires the removal of the transfected or transduced therapeutic
cells. Conditions where the cells may need to be removed include,
for example, GvHD, inappropriate differentiation of the cells into
more mature cells of the wrong tissue or cell type, and other
toxicities. To activate the caspase 9 switch in the case of
inappropriate differentiation, it is possible to use tissue
specific promoters. For example, where a progenitor cell
differentiates into bone and fat cells, and the fat cells are not
desired, the vector used to transfect or transduce the progenitor
cell may have a fat cell specific promoter that is operably linked
to the caspase 9 nucleotide sequence. In this way, should the cells
differentiate into fat cells, upon administration of the multimer
ligand, apoptosis of the inappropriately differentiated fat cells
should result.
[0136] The methods may be used, for example, for any disorder that
can be alleviated by cell therapy, including cancer, cancer in the
blood or bone marrow, other blood or bone marrow borne diseases
such as sickle cell anemia and metachromic leukodystrophy, and any
disorder that can be alleviated by a stem cell transplantation, for
example blood or bone marrow disorders such as sickle cell anemia
or metachromal leukodystrophy.
[0137] The efficacy of adoptive immunotherapy may be enhanced by
rendering the therapeutic T cells resistant to immune evasion
strategies employed by tumor cells. In vitro studies have shown
that this can be achieved by transduction with a dominant-negative
receptor or an immunomodulatory cytokine (Bollard C M, et al.,
Blood. 2002, 99:3179-3187: Wagner H J, et al., Cancer Gene Ther.
2004, 11:81-91). Moreover, transfer of antigen-specific T-cell
receptors allows for the application of T-cell therapy to a broader
range of tumors (Pule M, et al., Cytotherapy. 2003, 5:211-226;
Schumacher T N, Nat Rev Immunol. 2002, 2:512-519). A suicide system
for engineered human T cells was developed and tested to allow
their subsequent use in clinical studies. Caspase 9 has been
modified and shown to be stably expressed in human T lymphocytes
without compromising their functional and phenotypic
characteristics while demonstrating sensitivity to CID, even in T
cells that have upregulated antiapoptotic molecules. (Straathof, K.
C., et al., 2005, Blood 105:4248-54).
[0138] In genetically modified cells used for gene therapy, the
gene may be a heterologous polynucleotide sequence derived from a
source other than the cell that is being used to express the gene.
The gene is derived from a prokaryotic or eukaryotic source such as
a bacterium, a virus, yeast, a parasite, a plant, or even an
animal. The heterologous DNA also is derived from more than one
source, i.e., a multigene construct or a fusion protein. The
heterologous DNA also may include a regulatory sequence, which is
derived from one source and the gene from a different source. Or,
the heterologous DNA may include regulatory sequences that are used
to change the normal expression of a cellular endogenous gene.
Other Caspase Molecules
[0139] Caspase polypeptides other than caspase 9 that may be
encoded by the chimeric polypeptides of the current technology
include, for example, caspase 1, caspase 3, and caspase 8.
Discussions of these caspase polypeptides may be found in, for
example, MacCorkle, R. A., et al., Proc. Natl. Acad. Sci. U.S.A.
(1998) 95:3655-3660; and Fan, L., et al. (1999) Human Gene Therapy
10:2273-2285).
Engineering Expression Constructs
[0140] Expression constructs encode a multimeric ligand binding
region and a caspase 9 polypeptide, or, in certain embodiments a
multimeric ligand binding region and a caspase 9 polypeptide linked
to a marker polypeptide, all operatively linked. In general, the
term "operably linked" is meant to indicate that the promoter
sequence is functionally linked to a second sequence, wherein, for
example, the promoter sequence initiates and mediates transcription
of the DNA corresponding to the second sequence. The caspase 9
polypeptide may be full length or truncated. In certain
embodiments, the marker polypeptide is linked to the caspase 9
polypeptide. For example, the marker polypeptide may be linked to
the caspase 9 polypeptide via a polypeptide sequence, such as, for
example, a cleavable 2A-like sequence. The marker polypeptide may
be, for example, CD19.
[0141] 2A-like sequences, or "cleavable" 2A sequences, are derived
from, for example, many different viruses, including, for example,
from Thosea asigna. These sequences are sometimes also known as
"peptide skipping sequences." When this type of sequence is placed
within a cistron, between two peptides that are intended to be
separated, the ribosome appears to skip a peptide bond, in the case
of Thosea asigna sequence, the bond between the Gly and Pro amino
acids is omitted. This leaves two polypeptides, in this case the
caspase 9 polypeptide and the marker polypeptide. When this
sequence is used, the peptide that is encoded 5' of the 2A sequence
may end up with additional amino acids at the carboxy terminus,
including the Gly residue and any upstream in the 2A sequence. The
peptide that is encoded 3' of the 2A sequence may end up with
additional amino acids at the amino terminus, including the Pro
residue and any downstream in the 2A sequence.
[0142] The expression construct may be inserted into a vector, for
example a viral vector or plasmid. The steps of the methods
provided may be performed using any suitable method, these methods
include, without limitation, methods of transducing, transforming,
or otherwise providing nucleic acid to the antigen-presenting cell,
presented herein. In some embodiments, the truncated caspase 9
polypeptide is encoded by the nucleotide sequence of SEQ ID NO 8,
or a functionally equivalent fragment thereof, with or without DNA
linkers, or has the amino acid sequence of SEQ ID NO: 9, or a
functionally equivalent fragment thereof. In some embodiments, the
CD19 polypeptide is encoded by the nucleotide sequence of SEQ ID NO
14, or a functionally equivalent fragment thereof, with or without
DNA linkers, or has the amino acid sequence of SEQ ID NO: 15, or a
functionally equivalent fragment thereof. A functionally equivalent
fragment of the caspase 9 polypeptide has substantially the same
ability to induce apoptosis as the polypeptide of SEQ ID NO: 9,
with at least 50%, 60%, 70%, 80%, 90%, or 95% of the activity of
the polypeptide of SEQ ID NO: 9. A functionally equivalent fragment
of the CD19 polypeptide has substantially the same ability as the
polypeptide of SEQ ID No: 15, to act as a marker to be used to
identify and select transduced or transfected cells, with at least
50%, 60%, 70%, 80%, 90%, or 95% of the marker polypeptide being
detected when compared to the polypeptide of SEQ ID NO: 15, using
standard detection techniques.
[0143] Ligand-Binding Regions
[0144] The ligand-binding ("dimerization") domain of the expression
construct can be any convenient domain that will allow for
induction using a natural or unnatural ligand, for example, an
unnatural synthetic ligand. The ligand-binding domain can be
internal or external to the cellular membrane, depending upon the
nature of the construct and the choice of ligand. A wide variety of
ligand-binding proteins, including receptors, are known, including
ligand-binding proteins associated with the cytoplasmic regions
indicated above. As used herein the term "ligand-binding domain"
can be interchangeable with the term "receptor". Of particular
interest are ligand-binding proteins for which ligands (for
example, small organic ligands) are known or may be readily
produced. These ligand-binding domains or receptors include the
FKBPs and cyclophilin receptors, the steroid receptors, the
tetracycline receptor, the other receptors indicated above, and the
like, as well as "unnatural" receptors, which can be obtained from
antibodies, particularly the heavy or light chain subunit, mutated
sequences thereof, random amino acid sequences obtained by
stochastic procedures, combinatorial syntheses, and the like. In
certain embodiments, the ligand-binding region is selected from the
group consisting of FKBP ligand-binding region, cyclophilin
receptor ligand-binding region, steroid receptor ligand-binding
region, cyclophilin receptors ligand-binding region, and
tetracycline receptor ligand-binding region. Often, the
ligand-binding region comprises a Fv'Fvls sequence. Sometimes, the
Fv'Fvls sequence further comprises an additional Fv' sequence.
Examples include, for example, those discussed in Kopytek, S. J.,
et al., Chemistry & Biology 7:313-321 (2000) and in Gestwicki,
J. E., et al., Combinatorial Chem. & High Throughput Screening
10:667-675 (2007); Clackson T (2006) Chem Biol Drug Des 67:440-2;
Clackson, T., in Chemical Biology: From Small Molecules to Systems
Biology and Drug Design (Schreiber, s., et al., eds., Wiley,
2007)).
[0145] For the most part, the ligand-binding domains or receptor
domains will be at least about 50 amino acids, and fewer than about
350 amino acids, usually fewer than 200 amino acids, either as the
natural domain or truncated active portion thereof. The binding
domain may, for example, be small (<25 kDa, to allow efficient
transfection in viral vectors), monomeric, nonimmunogenic, have
synthetically accessible, cell permeable, nontoxic ligands that can
be configured for dimerization.
[0146] The receptor domain can be intracellular or extracellular
depending upon the design of the expression construct and the
availability of an appropriate ligand. For hydrophobic ligands, the
binding domain can be on either side of the membrane, but for
hydrophilic ligands, particularly protein ligands, the binding
domain will usually be external to the cell membrane, unless there
is a transport system for internalizing the ligand in a form in
which it is available for binding. For an intracellular receptor,
the construct can encode a signal peptide and transmembrane domain
5' or 3' of the receptor domain sequence or may have a lipid
attachment signal sequence 5' of the receptor domain sequence.
Where the receptor domain is between the signal peptide and the
transmembrane domain, the receptor domain will be
extracellular.
[0147] The portion of the expression construct encoding the
receptor can be subjected to mutagenesis for a variety of reasons.
The mutagenized protein can provide for higher binding affinity,
allow for discrimination by the ligand of the naturally occurring
receptor and the mutagenized receptor, provide opportunities to
design a receptor-ligand pair, or the like. The change in the
receptor can involve changes in amino acids known to be at the
binding site, random mutagenesis using combinatorial techniques,
where the codons for the amino acids associated with the binding
site or other amino acids associated with conformational changes
can be subject to mutagenesis by changing the codon(s) for the
particular amino acid, either with known changes or randomly,
expressing the resulting proteins in an appropriate prokaryotic
host and then screening the resulting proteins for binding.
[0148] Antibodies and antibody subunits, e.g., heavy or light
chain, particularly fragments, more particularly all or part of the
variable region, or fusions of heavy and light chain to create
high-affinity binding, can be used as the binding domain.
Antibodies that are contemplated include ones that are an
ectopically expressed human product, such as an extracellular
domain that would not trigger an immune response and generally not
expressed in the periphery (i.e., outside the CNS/brain area). Such
examples, include, but are not limited to low affinity nerve growth
factor receptor (LNGFR), and embryonic surface proteins (i.e.,
carcinoembryonic antigen). Yet further, antibodies can be prepared
against haptenic molecules, which are physiologically acceptable,
and the individual antibody subunits screened for binding affinity.
The cDNA encoding the subunits can be isolated and modified by
deletion of the constant region, portions of the variable region,
mutagenesis of the variable region, or the like, to obtain a
binding protein domain that has the appropriate affinity for the
ligand. In this way, almost any physiologically acceptable haptenic
compound can be employed as the ligand or to provide an epitope for
the ligand. Instead of antibody units, natural receptors can be
employed, where the binding domain is known and there is a useful
ligand for binding.
[0149] Oligomerization
[0150] The transduced signal will normally result from
ligand-mediated oligomerization of the chimeric protein molecules,
i.e., as a result of oligomerization following ligand-binding,
although other binding events, for example allosteric activation,
can be employed to initiate a signal. The construct of the chimeric
protein will vary as to the order of the various domains and the
number of repeats of an individual domain.
[0151] For multimerizing the receptor, the ligand for the
ligand-binding domains/receptor domains of the chimeric surface
membrane proteins will usually be multimeric in the sense that it
will have at least two binding sites, with each of the binding
sites capable of binding to the ligand receptor domain. By
"multimeric ligand binding region" is meant a ligand binding region
that binds to a multimeric ligand. The term "multimeric ligands"
include dimeric ligands. A dimeric ligand will have two binding
sites capable of binding to the ligand receptor domain. Desirably,
the subject ligands will be a dimer or higher order oligomer,
usually not greater than about tetrameric, of small synthetic
organic molecules, the individual molecules typically being at
least about 150 Da and less than about 5 kDa, usually less than
about 3 kDa. A variety of pairs of synthetic ligands and receptors
can be employed. For example, in embodiments involving natural
receptors, dimeric FK506 can be used with an FKBP12 receptor,
dimerized cyclosporin A can be used with the cyclophilin receptor,
dimerized estrogen with an estrogen receptor, dimerized
glucocorticoids with a glucocorticoid receptor, dimerized
tetracycline with the tetracycline receptor, dimerized vitamin D
with the vitamin D receptor, and the like. Alternatively higher
orders of the ligands, e.g., trimeric can be used. For embodiments
involving unnatural receptors, e.g., antibody subunits, modified
antibody subunits, single chain antibodies comprised of heavy and
light chain variable regions in tandem, separated by a flexible
linker domain, or modified receptors, and mutated sequences
thereof, and the like, any of a large variety of compounds can be
used. A significant characteristic of these ligand units is that
each binding site is able to bind the receptor with high affinity
and they are able to be dimerized chemically. Also, methods are
available to balance the hydrophobicity/hydrophilicity of the
ligands so that they are able to dissolve in serum at functional
levels, yet diffuse across plasma membranes for most
applications.
[0152] In certain embodiments, the present methods utilize the
technique of chemically induced dimerization (CID) to produce a
conditionally controlled protein or polypeptide. In addition to
this technique being inducible, it also is reversible, due to the
degradation of the labile dimerizing agent or administration of a
monomeric competitive inhibitor.
[0153] The CID system uses synthetic bivalent ligands to rapidly
crosslink signaling molecules that are fused to ligand-binding
domains. This system has been used to trigger the oligomerization
and activation of cell surface (Spencer, D. M., et al., Science,
1993. 262: p. 1019-1024; Spencer D. M. et al., Curr Biol 1996,
6:839-847; Blau, C. A. et al., Proc Natl Acad.Sci. USA 1997,
94:3076-3081), or cytosolic proteins (Luo, Z. et al., Nature 1996,
383:181-185; MacCorkle, R. A. et al., Proc Natl Acad Sci USA 1998,
95:3655-3660), the recruitment of transcription factors to DNA
elements to modulate transcription (Ho, S. N. et al., Nature 1996,
382:822-826; Rivera, V. M. et al., Nat.Med. 1996, 2:1028-1032) or
the recruitment of signaling molecules to the plasma membrane to
stimulate signaling (Spencer D. M. et al., Proc.Natl.Acad.Sci. USA
1995, 92:9805-9809; Holsinger, L. J. et al., Proc.Natl.Acad.Sci.
USA 1995, 95:9810-9814).
[0154] The CID system is based upon the notion that surface
receptor aggregation effectively activates downstream signaling
cascades. In the simplest embodiment, the CID system uses a dimeric
analog of the lipid permeable immunosuppressant drug, FK506, which
loses its normal bioactivity while gaining the ability to crosslink
molecules genetically fused to the FK506-binding protein, FKBP12.
By fusing one or more FKBPs to caspase 9, one can stimulate caspase
9 activity in a dimerizer drug-dependent, but ligand and
ectodomain-independent manner. This provides the system with
temporal control, reversibility using monomeric drug analogs, and
enhanced specificity. The high affinity of third-generation
AP20187/AP1903 CIDs for their binding domain, FKBP12, permits
specific activation of the recombinant receptor in vivo without the
induction of non-specific side effects through endogenous FKBP12.
FKBP12 variants having amino acid substitutions and deletions, such
as FKBP12V.sub.36, that bind to a dimerizer drug, may also be
used.
[0155] In addition, the synthetic ligands are resistant to protease
degradation, making them more efficient at activating receptors in
vivo than most delivered protein agents.
[0156] The ligands used are capable of binding to two or more of
the ligand-binding domains. The chimeric proteins may be able to
bind to more than one ligand when they contain more than one
ligand-binding domain. The ligand is typically a non-protein or a
chemical. Exemplary ligands include, but are not limited to FK506
(e.g., FK1012).
[0157] Other ligand binding regions may be, for example, dimeric
regions, or modified ligand binding regions with a wobble
substitution, such as, for example, FKBP12(V36): The human 12 kDa
FK506-binding protein with an F36 to V substitution, the complete
mature coding sequence (amino acids 1-107), provides a binding site
for synthetic dimerizer drug AP1903 (Jemal, A. et al., CA Cancer J.
Clinic. 58, 71-96 (2008); Scher, H. I. and Kelly, W. K., Journal of
Clinical Oncology 11, 1566-72 (1993)). Two tandem copies of the
protein may also be used in the construct so that higher-order
oligomers are induced upon cross-linking by AP1903.
[0158] F36V'-FKBP: F36V'-FKBP is a codon-wobbled version of
F36V-FKBP. It encodes the identical polypeptide sequence as
F36V-FKPB but has only 62% homology at the nucleotide level.
F36V'-FKBP was designed to reduce recombination in retroviral
vectors (Schellhammer, P. F. et al., J. Urol. 157, 1731-5 (1997)).
F36V'-FKBP was constructed by a PCR assembly procedure. The
transgene contains one copy of F36V'-FKBP linked directly to one
copy of F36V-FKBP.
[0159] In some embodiments, the ligand is a small molecule. The
appropriate ligand for the selected ligand-binding region may be
selected. Often, the ligand is dimeric, sometimes, the ligand is a
dimeric FK506 or a dimeric FK506 analog. In certain embodiments,
the ligand is AP1903 (CAS Index Name: 2-Piperidinecarboxylic acid,
1-[(2S)-1-oxo-2-(3,4,5-trimethoxyphenyl)butyl]-,
1,2-ethanediylbis[imino(2-oxo-2,1-ethanediyl)oxy-3,1-phenylene[(1R)-3-(3,-
4-dimethoxyphenyl)propylidene]] ester,
[2S-[1(R*),2R*[S*[S*[1(R*),2R*]]]]]-(9Cl) CAS Registry Number:
195514-63-7; Molecular Formula: C78H98N4O20 Molecular Weight:
1411.65). In certain embodiments, the ligand is AP20187. In certain
embodiments, the ligand is an AP20187 analog, such as, for example,
AP1510. In some embodiments, certain analogs will be appropriate
for the FKBP12, and certain analogs appropriate for the wobbled
version of FKBP12. In certain embodiments, one ligand binding
region is included in the chimeric protein. In other embodiments,
two or more ligand binding regions are included. Where, for
example, the ligand binding region is FKBP12, where two of these
regions are included, one may, for example, be the wobbled
version.
[0160] Other dimerization systems contemplated include the
coumermycin/DNA gyrase B system. Coumermycin-induced dimerization
activates a modified Raf protein and stimulates the MAP kinase
cascade. See Farrar et al., 1996.
[0161] AP1903 for Injection
[0162] AP1903 API is manufactured by Alphora Research Inc. and
AP1903 Drug Product for Injection is made by Formatech Inc. It is
formulated as a 5 mg/mL solution of AP1903 in a 25% solution of the
non-ionic solubilizer Solutol HS 15 (250 mg/mL, BASF). At room
temperature, this formulation is a clear, slightly yellow solution.
Upon refrigeration, this formulation undergoes a reversible phase
transition, resulting in a milky solution. This phase transition is
reversed upon re-warming to room temperature. The fill is 2.33 mL
in a 3 mL glass vial (.about.10 mg AP1903 for Injection total per
vial).
[0163] AP1903 is removed from the refrigerator the night before the
patient is dosed and stored at a temperature of approximately
21.degree. C. overnight, so that the solution is clear prior to
dilution. The solution is prepared within 30 minutes of the start
of the infusion in glass or polyethylene bottles or non-DEHP bags
and stored at approximately 21.degree. C. prior to dosing.
[0164] All study medication is maintained at a temperature between
2 degrees C. and 8 degrees C., protected from excessive light and
heat, and stored in a locked area with restricted access.
[0165] Upon determining a need to administer AP1903 and induce the
inducible caspase 9 polypeptide, patients may be, for example,
administered a single fixed dose of AP1903 for Injection (0.4
mg/kg) via IV infusion over 2 hours, using a non-DEHP, non-ethylene
oxide sterilized infusion set. The dose of AP1903 is calculated
individually for all patients, and is not be recalculated unless
body weight fluctuates by .gtoreq.10%. The calculated dose is
diluted in 100 mL in 0.9% normal saline before infusion.
[0166] In a previous Phase I study of AP1903, 24 healthy volunteers
were treated with single doses of AP1903 for Injection at dose
levels of 0.01, 0.05, 0.1, 0.5 and 1.0 mg/kg infused IV over 2
hours. AP1903 plasma levels were directly proportional to dose,
with mean Cmax values ranging from approximately 10-1275 ng/mL over
the 0.01-1.0 mg/kg dose range. Following the initial infusion
period, blood concentrations demonstrated a rapid distribution
phase, with plasma levels reduced to approximately 18, 7, and 1% of
maximal concentration at 0.5, 2 and 10 hours post-dose,
respectively. AP1903 for Injection was shown to be safe and well
tolerated at all dose levels and demonstrated a favorable
pharmacokinetic profile. Iuliucci J D, et al., J Clin Pharmacol.
41: 870-9, 2001.
[0167] The fixed dose of AP1903 for injection used, for example,
may be 0.4 mg/kg intravenously infused over 2 hours. The amount of
AP1903 needed in vitro for effective signaling of cells is 10-100
nM (1600 Da MW). This equates to 16-160 .mu.g/L or .about.0.016-1.6
mg/kg (1.6-160 .mu.g/kg). Doses up to 1 mg/kg were well-tolerated
in the Phase I study of AP1903 described above. Therefore, 0.4
mg/kg may be a safe and effective dose of AP1903 for this Phase I
study in combination with the therapeutic cells.
[0168] Selectable Markers
[0169] In certain embodiments, the expression constructs contain
nucleic acid constructs whose expression is identified in vitro or
in vivo by including a marker in the expression construct. Such
markers would confer an identifiable change to the cell permitting
easy identification of cells containing the expression construct.
Usually the inclusion of a drug selection marker aids in cloning
and in the selection of transformants. For example, genes that
confer resistance to neomycin, puromycin, hygromycin, DHFR, GPT,
zeocin and histidinol are useful selectable markers. Alternatively,
enzymes such as herpes simplex virus thymidine kinase (tk) are
employed. Immunologic surface markers containing the extracellular,
non-signaling domains or various proteins (e.g. CD34, CD19, LNGFR)
also can be employed, permitting a straightforward method for
magnetic or fluorescence antibody-mediated sorting. The selectable
marker employed is not believed to be important, so long as it is
capable of being expressed simultaneously with the nucleic acid
encoding a gene product. Further examples of selectable markers
include, for example, reporters such as GFP, EGFP, beta-gal or
chloramphenicol acetyltransferase (CAT). In certain embodiments,
the marker protein, such as, for example, CD19, is used for
selection of the cells for transfusion, such as, for example, in
immunomagnetic selection.
[0170] Control Regions
[0171] 1. Promoters
[0172] Various promoters are available that are capable of
directing the expression of the polynucleotide in the targeted
cell. Thus, where a human cell is targeted the polynucleotide
sequence-coding region may, for example, be placed adjacent to and
under the control of a promoter that is capable of being expressed
in a human cell. Generally speaking, such a promoter might include
either a human or viral promoter.
[0173] In various embodiments, the human cytomegalovirus (CMV)
immediate early gene promoter, the SV40 early promoter, the Rous
sarcoma virus long terminal repeat, .beta.-actin, rat insulin
promoter and glyceraldehyde-3-phosphate dehydrogenase can be used
to obtain high-level expression of the coding sequence of interest.
The use of other viral or mammalian cellular or bacterial phage
promoters which are well known in the art to achieve expression of
a coding sequence of interest is contemplated as well, provided
that the levels of expression are sufficient for a given purpose.
By employing a promoter with well-known properties, the level and
pattern of expression of the protein of interest following
transfection or transformation can be optimized.
[0174] Selection of a promoter that is regulated in response to
specific physiologic or synthetic signals can permit inducible
expression of the gene product. For example in the case where
expression of a transgene, or transgenes when a multicistronic
vector is utilized, is toxic to the cells in which the vector is
produced in, it is desirable to prohibit or reduce expression of
one or more of the transgenes. Examples of transgenes that are
toxic to the producer cell line are pro-apoptotic and cytokine
genes. Several inducible promoter systems are available for
production of viral vectors where the transgene products are toxic
(add in more inducible promoters).
[0175] The ecdysone system (Invitrogen, Carlsbad, Calif.) is one
such system. This system is designed to allow regulated expression
of a gene of interest in mammalian cells. It consists of a tightly
regulated expression mechanism that allows virtually no basal level
expression of the transgene, but over 200-fold inducibility. The
system is based on the heterodimeric ecdysone receptor of
Drosophila, and when ecdysone or an analog such as muristerone A
binds to the receptor, the receptor activates a promoter to turn on
expression of the downstream transgene high levels of mRNA
transcripts are attained. In this system, both monomers of the
heterodimeric receptor are constitutively expressed from one
vector, whereas the ecdysone-responsive promoter, which drives
expression of the gene of interest, is on another plasmid.
Engineering of this type of system into the gene transfer vector of
interest would therefore be useful. Cotransfection of plasmids
containing the gene of interest and the receptor monomers in the
producer cell line would then allow for the production of the gene
transfer vector without expression of a potentially toxic
transgene. At the appropriate time, expression of the transgene
could be activated with ecdysone or muristeron A.
[0176] Another inducible system that may be useful is the
Tet-Off.TM. or Tet-On.TM. system (Clontech, Palo Alto, Calif.)
originally developed by Gossen and Bujard (Gossen and Bujard, Proc.
Natl. Acad. Sci. USA, 89:5547-5551, 1992; Gossen et al., Science,
268:1766-1769, 1995). This system also allows high levels of gene
expression to be regulated in response to tetracycline or
tetracycline derivatives such as doxycycline. In the Tet-On.TM.
system, gene expression is turned on in the presence of
doxycycline, whereas in the Tet-Off.TM. system, gene expression is
turned on in the absence of doxycycline. These systems are based on
two regulatory elements derived from the tetracycline resistance
operon of E. coli. The tetracycline operator sequence to which the
tetracycline repressor binds, and the tetracycline repressor
protein. The gene of interest is cloned into a plasmid behind a
promoter that has tetracycline-responsive elements present in it. A
second plasmid contains a regulatory element called the
tetracycline-controlled transactivator, which is composed, in the
Tet-Off.TM. system, of the VP16 domain from the herpes simplex
virus and the wild-type tertracycline repressor. Thus in the
absence of doxycycline, transcription is constitutively on. In the
Tet-On.TM. system, the tetracycline repressor is not wild type and
in the presence of doxycycline activates transcription. For gene
therapy vector production, the Tet-Off.TM. system may be used so
that the producer cells could be grown in the presence of
tetracycline or doxycycline and prevent expression of a potentially
toxic transgene, but when the vector is introduced to the patient,
the gene expression would be constitutively on.
[0177] In some circumstances, it is desirable to regulate
expression of a transgene in a gene therapy vector. For example,
different viral promoters with varying strengths of activity are
utilized depending on the level of expression desired. In mammalian
cells, the CMV immediate early promoter is often used to provide
strong transcriptional activation. The CMV promoter is reviewed in
Donnelly, J. J., et al., 1997. Annu. Rev. Immunol. 15:617-48.
Modified versions of the CMV promoter that are less potent have
also been used when reduced levels of expression of the transgene
are desired. When expression of a transgene in hematopoietic cells
is desired, retroviral promoters such as the LTRs from MLV or MMTV
are often used. Other viral promoters that are used depending on
the desired effect include SV40, RSV LTR, HIV-1 and HIV-2 LTR,
adenovirus promoters such as from the E1A, E2A, or MLP region, AAV
LTR, HSV-TK, and avian sarcoma virus.
[0178] In other examples, promoters may be selected that are
developmentally regulated and are active in particular
differentiated cells. Thus, for example, a promoter may not be
active in a pluripotent stem cell, but, for example, where the
pluripotent stem cell differentiates into a more mature cell, the
promoter may then be activated.
[0179] Similarly tissue specific promoters are used to effect
transcription in specific tissues or cells so as to reduce
potential toxicity or undesirable effects to non-targeted tissues.
These promoters may result in reduced expression compared to a
stronger promoter such as the CMV promoter, but may also result in
more limited expression, and immunogenicity (Bojak, A., et al.,
2002. Vaccine. 20:1975-79; Cazeaux., N., et al., 2002. Vaccine
20:3322-31). For example, tissue specific promoters such as the PSA
associated promoter or prostate-specific glandular kallikrein, or
the muscle creatine kinase gene may be used where appropriate.
[0180] Examples of tissue specific or differentiation specific
promoters include, but are not limited to, the following: B29 (B
cells); CD14 (monocytic cells); CD43 (leukocytes and platelets);
CD45 (hematopoietic cells); CD68 (macrophages); desmin (muscle);
elastase-1 (pancreatic acinar cells); endoglin (endothelial cells);
fibronectin (differentiating cells, healing tissues); and Fit-1
(endothelial cells); GFAP (astrocytes).
[0181] In certain indications, it is desirable to activate
transcription at specific times after administration of the gene
therapy vector. This is done with such promoters as those that are
hormone or cytokine regulatable. Cytokine and inflammatory protein
responsive promoters that can be used include K and T kininogen
(Kageyama et al., (1987) J. Biol. Chem., 262, 2345-2351), c-fos,
TNF-alpha, C-reactive protein (Arcone, et al., (1988) Nucl. Acids
Res., 16(8), 3195-3207), haptoglobin (Oliviero et al., (1987) EMBO
J., 6, 1905-1912), serum amyloid A2, C/EBP alpha, IL-1, IL-6 (Poli
and Cortese, (1989) Proc. Nat'l Acad. Sci. USA, 86, 8202-8206),
Complement C3 (Wilson et al., (1990) Mol. Cell. Biol., 6181-6191),
IL-8, alpha-1 acid glycoprotein (Prowse and Baumann, (1988) Mol
Cell Biol, 8, 42-51), alpha-1 antitrypsin, lipoprotein lipase
(Zechner et al., Mol. Cell. Biol., 2394-2401, 1988),
angiotensinogen (Ron, et al., (1991) Mol. Cell. Biol., 2887-2895),
fibrinogen, c-jun (inducible by phorbol esters, TNF-alpha, UV
radiation, retinoic acid, and hydrogen peroxide), collagenase
(induced by phorbol esters and retinoic acid), metallothionein
(heavy metal and glucocorticoid inducible), Stromelysin (inducible
by phorbol ester, interleukin-1 and EGF), alpha-2 macroglobulin and
alpha-1 anti-chymotrypsin. Other promoters include, for example,
SV40, MMTV, Human Immunodeficiency Virus (MV), Moloney virus, ALV,
Epstein Barr virus, Rous Sarcoma virus, human actin, myosin,
hemoglobin, and creatine.
[0182] It is envisioned that any of the above promoters alone or in
combination with another can be useful depending on the action
desired. Promoters, and other regulatory elements, are selected
such that they are functional in the desired cells or tissue. In
addition, this list of promoters should not be construed to be
exhaustive or limiting; other promoters that are used in
conjunction with the promoters and methods disclosed herein.
[0183] 2. Enhancers
[0184] Enhancers are genetic elements that increase transcription
from a promoter located at a distant position on the same molecule
of DNA. Early examples include the enhancers associated with
immunoglobulin and T cell receptors that both flank the coding
sequence and occur within several introns. Many viral promoters,
such as CMV, SV40, and retroviral LTRs are closely associated with
enhancer activity and are often treated like single elements.
Enhancers are organized much like promoters. That is, they are
composed of many individual elements, each of which binds to one or
more transcriptional proteins. The basic distinction between
enhancers and promoters is operational. An enhancer region as a
whole stimulates transcription at a distance and often independent
of orientation; this need not be true of a promoter region or its
component elements. On the other hand, a promoter has one or more
elements that direct initiation of RNA synthesis at a particular
site and in a particular orientation, whereas enhancers lack these
specificities. Promoters and enhancers are often overlapping and
contiguous, often seeming to have a very similar modular
organization. A subset of enhancers are locus-control regions
(LCRs) that can not only increase transcriptional activity, but
(along with insulator elements) can also help to insulate the
transcriptional element from adjacent sequences when integrated
into the genome.
[0185] Any promoter/enhancer combination (as per the Eukaryotic
Promoter Data Base EPDB) can be used to drive expression of the
gene, although many will restrict expression to a particular tissue
type or subset of tissues (reviewed in, for example, Kutzler, M.
A., and Weiner, D. B., 2008. Nature Reviews Genetics 9:776-88).
Examples include, but are not limited to, enhancers from the human
actin, myosin, hemoglobin, muscle creatine kinase, sequences, and
from viruses CMV, RSV, and EBV. Appropriate enhancers may be
selected for particular applications. Eukaryotic cells can support
cytoplasmic transcription from certain bacterial promoters if the
appropriate bacterial polymerase is provided, either as part of the
delivery complex or as an additional genetic expression
construct.
[0186] 3. Polyadenylation Signals
[0187] Where a cDNA insert is employed, one will typically desire
to include a polyadenylation signal to effect proper
polyadenylation of the gene transcript. The nature of the
polyadenylation signal is not believed to be crucial to the
successful practice of the present methods, and any such sequence
is employed such as human or bovine growth hormone and SV40
polyadenylation signals and LTR polyadenylation signals.
Non-limiting examples include the 3'LTR, and the SV40
polyadenylation signal present in the pCEP3 plasmid (Invitrogen,
Carlsbad, Calif.). Also contemplated as an element of the
expression cassette is a terminator. These elements can serve to
enhance message levels and to minimize read through from the
cassette into other sequences. Termination or poly(A) signal
sequences may be, for example, positioned about 11-30 nucleotides
downstream from a conserved sequence (AAUAAA) at the 3' end of the
mRNA (Montgomery, D. L., et al., 1993. DNA Cell Biol. 12:777-83;
Kutzler, M. A., and Weiner, D. B., 2008. Nature Rev. Gen.
9:776-88).
[0188] 4. Initiation Signals and Internal Ribosome Binding
Sites
[0189] A specific initiation signal also may be required for
efficient translation of coding sequences. These signals include
the ATG initiation codon or adjacent sequences. Exogenous
translational control signals, including the ATG initiation codon,
may need to be provided. The initiation codon is placed in-frame
with the reading frame of the desired coding sequence to ensure
translation of the entire insert. The exogenous translational
control signals and initiation codons can be either natural or
synthetic. The efficiency of expression may be enhanced by the
inclusion of appropriate transcription enhancer elements.
[0190] In certain embodiments, the use of internal ribosome entry
sites (IRES) elements is used to create multigene, or polycistronic
messages. IRES elements are able to bypass the ribosome-scanning
model of 5' methylated cap-dependent translation and begin
translation at internal sites (Pelletier and Sonenberg, Nature,
334:320-325, 1988). IRES elements from two members of the
picornavirus family (polio and encephalomyocarditis) have been
discussed (Pelletier and Sonenberg, 1988), as well an IRES from a
mammalian message (Macejak and Sarnow, Nature, 353:90-94, 1991).
IRES elements can be linked to heterologous open reading frames.
Multiple open reading frames can be transcribed together, each
separated by an IRES, creating polycistronic messages. By virtue of
the IRES element, each open reading frame is accessible to
ribosomes for efficient translation. Multiple genes can be
efficiently expressed using a single promoter/enhancer to
transcribe a single message (see U.S. Pat. Nos. 5,925,565 and
5,935,819, each herein incorporated by reference).
[0191] Sequence Optimization
[0192] Protein production may also be increased by optimizing the
codons in the transgene. Species specific codon changes may be used
to increase protein production. Also, codons may be optimized to
produce an optimized RNA, which may result in more efficient
translation. By optimizing the codons to be incorporated in the
RNA, elements such as those that result in a secondary structure
that causes instability, secondary mRNA structures that can, for
example, inhibit ribosomal binding, or cryptic sequences that can
inhibit nuclear export of mRNA can be removed (Kutzler, M. A., and
Weiner, D. B., 2008. Nature Rev. Gen. 9:776-88; Yan., J. et al.,
2007. Mol. Ther. 15:411-21; Cheung, Y. K., et al., 2004. Vaccine
23:629-38; Narum., D. L., et al., 2001. 69:7250-55; Yadava, A., and
Ockenhouse, C. F., 2003. Infect. Immun. 71:4962-69; Smith., J. M.,
et al., 2004. AIDS Res. Hum. Retroviruses 20:1335-47; Zhou, W., et
al., 2002. Vet. Microbiol. 88:127-51; Wu, X., et al., 2004.
Biochem. Biophys. Res. Commun. 313:89-96; Zhang, W., et al., 2006.
Biochem. Biophys. Res. Commun. 349:69-78; Deml, L. A., et al.,
2001. J. Virol. 75:1099-11001; Schneider, R. M., et al., 1997. J.
Virol. 71:4892-4903; Wang, S. D., et al., 2006. Vaccine 24:4531-40;
zur Megede, J., et al., 2000. J. Virol. 74:2628-2635). For example,
the FBP12, the caspase polypeptide, and the CD19 sequences may be
optimized by changes in the codons.
[0193] Leader Sequences
[0194] Leader sequences may be added to enhance the stability of
mRNA and result in more efficient translation. The leader sequence
is usually involved in targeting the mRNA to the endoplasmic
reticulum. Examples include, the signal sequence for the HIV-1
envelope glycoprotein (Env), which delays its own cleavage, and the
IgE gene leader sequence (Kutzler, M. A., and Weiner, D. B., 2008.
Nature Rev. Gen. 9:776-88; Li, V., et al., 2000. Virology
272:417-28; Xu, Z. L., et al. 2001. Gene 272:149-56; Malin, A. S.,
et al., 2000. Microbes Infect. 2:1677-85; Kutzler, M. A., et al.,
2005. J. Immunol. 175:112-125; Yang., J. S., et al., 2002. Emerg.
Infect. Dis. 8:1379-84; Kumar., S., et al., 2006. DNA Cell Biol.
25:383-92; Wang, S., et al., 2006. Vaccine 24:4531-40). The IgE
leader may be used to enhance insertion into the endoplasmic
reticulum (Tepler, I, et al. (1989) J. Biol. Chem. 264:5912).
[0195] Expression of the transgenes may be optimized and/or
controlled by the selection of appropriate methods for optimizing
expression. These methods include, for example, optimizing
promoters, delivery methods, and gene sequences, (for example, as
presented in Laddy, D. J., et al., 2008. PLoS.ONE 3 e2517; Kutzler,
M. A., and Weiner, D. B., 2008. Nature Rev. Gen. 9:776-88).
[0196] Nucleic Acids
[0197] A "nucleic acid" as used herein generally refers to a
molecule (one, two or more strands) of DNA, RNA or a derivative or
analog thereof, comprising a nucleobase. A nucleobase includes, for
example, a naturally occurring purine or pyrimidine base found in
DNA (e.g., an adenine "A," a guanine "G," a thymine "T" or a
cytosine "C") or RNA (e.g., an A, a G, an uracil "U" or a C). The
term "nucleic acid" encompasses the terms "oligonucleotide" and
"polynucleotide," each as a subgenus of the term "nucleic acid."
Nucleic acids may be, be at least, be at most, or be about 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,
41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57,
58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74,
75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91,
92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106,
107, 108, 109, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200,
210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330,
340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450,
460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580,
590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710,
720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840,
850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970,
980, 990, or 1000 nucleotides, or any range derivable therein, in
length.
[0198] Nucleic acids herein provided may have regions of identity
or complementarity to another nucleic acid. It is contemplated that
the region of complementarity or identity can be at least 5
contiguous residues, though it is specifically contemplated that
the region is, is at least, is at most, or is about 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,
45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61,
62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78,
79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95,
96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190,
200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320,
330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441,
450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570,
580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700,
710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830,
840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960,
970, 980, 990, or 1000 contiguous nucleotides.
[0199] As used herein, "hybridization", "hybridizes" or "capable of
hybridizing" is understood to mean forming a double or triple
stranded molecule or a molecule with partial double or triple
stranded nature. The term "anneal" as used herein is synonymous
with "hybridize." The term "hybridization", "hybridize(s)" or
"capable of hybridizing" encompasses the terms "stringent
condition(s)" or "high stringency" and the terms "low stringency"
or "low stringency condition(s)."
[0200] As used herein "stringent condition(s)" or "high stringency"
are those conditions that allow hybridization between or within one
or more nucleic acid strand(s) containing complementary
sequence(s), but preclude hybridization of random sequences.
Stringent conditions tolerate little, if any, mismatch between a
nucleic acid and a target strand. Such conditions are known, and
are often used for applications requiring high selectivity.
Non-limiting applications include isolating a nucleic acid, such as
a gene or a nucleic acid segment thereof, or detecting at least one
specific mRNA transcript or a nucleic acid segment thereof, and the
like.
[0201] Stringent conditions may comprise low salt and/or high
temperature conditions, such as provided by about 0.02 M to about
0.5 M NaCl at temperatures of about 42 degrees C. to about 70
degrees C. It is understood that the temperature and ionic strength
of a desired stringency are determined in part by the length of the
particular nucleic acid(s), the length and nucleobase content of
the target sequence(s), the charge composition of the nucleic
acid(s), and the presence or concentration of formamide,
tetramethylammonium chloride or other solvent(s) in a hybridization
mixture.
[0202] It is understood that these ranges, compositions and
conditions for hybridization are mentioned by way of non-limiting
examples only, and that the desired stringency for a particular
hybridization reaction is often determined empirically by
comparison to one or more positive or negative controls. Depending
on the application envisioned varying conditions of hybridization
may be employed to achieve varying degrees of selectivity of a
nucleic acid towards a target sequence. In a non-limiting example,
identification or isolation of a related target nucleic acid that
does not hybridize to a nucleic acid under stringent conditions may
be achieved by hybridization at low temperature and/or high ionic
strength. Such conditions are termed "low stringency" or "low
stringency conditions," and non-limiting examples of low stringency
include hybridization performed at about 0.15 M to about 0.9 M NaCl
at a temperature range of about 20 degrees C. to about 50 degrees
C. The low or high stringency conditions may be further modified to
suit a particular application.
Nucleic Acid Modification
[0203] Any of the modifications discussed below may be applied to a
nucleic acid. Examples of modifications include alterations to the
RNA or DNA backbone, sugar or base, and various combinations
thereof. Any suitable number of backbone linkages, sugars and/or
bases in a nucleic acid can be modified (e.g., independently about
5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%,
70%, 75%, 80%, 85%, 90%, 95%, up to 100%). An unmodified nucleoside
is any one of the bases adenine, cytosine, guanine, thymine, or
uracil joined to the 1' carbon of beta-D-ribo-furanose.
[0204] A modified base is a nucleotide base other than adenine,
guanine, cytosine and uracil at a 1' position. Non-limiting
examples of modified bases include inosine, purine, pyridin-4-one,
pyridin-2-one, phenyl, pseudouracil, 2, 4, 6-trimethoxy benzene,
3-methyl uracil, dihydrouridine, naphthyl, aminophenyl,
5-alkylcytidines (e. g., 5-methylcytidine), 5-alkyluridines (e. g.,
ribothymidine), 5-halouridine (e. g., 5-bromouridine) or
6-azapyrimidines or 6-alkylpyrimidines (e. g. 6-methyluridine),
propyne, and the like. Other non-limiting examples of modified
bases include nitropyrrolyl (e.g., 3-nitropyrrolyl), nitroindolyl
(e.g., 4-, 5-, 6-nitroindolyl), hypoxanthinyl, isoinosinyl,
2-aza-inosinyl, 7-deaza-inosinyl, nitroimidazolyl, nitropyrazolyl,
nitrobenzimidazolyl, nitroindazolyl, aminoindolyl,
pyrrolopyrimidinyl, difluorotolyl, 4-fluoro-6-methylbenzimidazole,
4-methylbenzimidazole, 3-methyl isocarbostyrilyl, 5-methyl
isocarbostyrilyl, 3-methyl-7-propynyl isocarbostyrilyl,
7-azaindolyl, 6-methyl-7-azaindolyl, imidizopyridinyl,
9-methyl-imidizopyridinyl, pyrrolopyrizinyl, isocarbostyrilyl,
7-propynyl isocarbostyrilyl, propynyl-7-azaindolyl,
2,4,5-trimethylphenyl, 4-methylindolyl, 4,6-dimethylindolyl,
phenyl, napthalenyl, anthracenyl, phenanthracenyl, pyrenyl,
stilbenyl, tetracenyl, pentacenyl and the like.
[0205] In some embodiments, for example, a nucleic acid may
comprise modified nucleic acid molecules, with phosphate backbone
modifications. Non-limiting examples of backbone modifications
include phosphorothioate, phosphorodithioate, methylphosphonate,
phosphotriester, morpholino, amidate carbamate, carboxymethyl,
acetamidate, polyamide, sulfonate, sulfonamide, sulfamate,
formacetal, thioformacetal, and/or alkylsilyl modifications. In
certain instances, a ribose sugar moiety that naturally occurs in a
nucleoside is replaced with a hexose sugar, polycyclic heteroalkyl
ring, or cyclohexenyl group. In certain instances, the hexose sugar
is an allose, altrose, glucose, mannose, gulose, idose, galactose,
talose, or a derivative thereof. The hexose may be a D-hexose,
glucose, or mannose. In certain instances, the polycyclic
heteroalkyl group may be a bicyclic ring containing one oxygen atom
in the ring. In certain instances, the polycyclic heteroalkyl group
is a bicyclo[2.2.1]heptane, a bicyclo[3.2.1]octane, or a
bicyclo[3.3.1]nonane.
[0206] Nitropyrrolyl and nitroindolyl nucleobases are members of a
class of compounds known as universal bases. Universal bases are
those compounds that can replace any of the four naturally
occurring bases without substantially affecting the melting
behavior or activity of the oligonucleotide duplex. In contrast to
the stabilizing, hydrogen-bonding interactions associated with
naturally occurring nucleobases, oligonucleotide duplexes
containing 3-nitropyrrolyl nucleobases may be stabilized solely by
stacking interactions. The absence of significant hydrogen-bonding
interactions with nitropyrrolyl nucleobases obviates the
specificity for a specific complementary base. In addition, 4-, 5-
and 6-nitroindolyl display very little specificity for the four
natural bases. Procedures for the preparation of
1-(2'-O-methyl-.beta.-D-ribofuranosyl)-5-nitroindole are discussed
in Gaubert, G.; Wengel, J. Tetrahedron Letters 2004, 45, 5629.
Other universal bases include hypoxanthinyl, isoinosinyl,
2-aza-inosinyl, 7-deaza-inosinyl, nitroimidazolyl, nitropyrazolyl,
nitrobenzimidazolyl, nitroindazolyl, aminoindolyl,
pyrrolopyrimidinyl, and structural derivatives thereof.
[0207] Difluorotolyl is a non-natural nucleobase that functions as
a universal base. Difluorotolyl is an isostere of the natural
nucleobase thymine. But unlike thymine, difluorotolyl shows no
appreciable selectivity for any of the natural bases. Other
aromatic compounds that function as universal bases are
4-fluoro-6-methylbenzimidazole and 4-methylbenzimidazole. In
addition, the relatively hydrophobic isocarbostyrilyl derivatives
3-methyl isocarbostyrilyl, 5-methyl isocarbostyrilyl, and
3-methyl-7-propynyl isocarbostyrilyl are universal bases which
cause only slight destabilization of oligonucleotide duplexes
compared to the oligonucleotide sequence containing only natural
bases. Other non-natural nucleobases include 7-azaindolyl,
6-methyl-7-azaindolyl, imidizopyridinyl, 9-methyl-imidizopyridinyl,
pyrrolopyrizinyl, isocarbostyrilyl, 7-propynyl isocarbostyrilyl,
propynyl-7-azaindolyl, 2,4,5-trimethylphenyl, 4-methylindolyl,
4,6-dimethylindolyl, phenyl, napthalenyl, anthracenyl,
phenanthracenyl, pyrenyl, stilbenyl, tetracenyl, pentacenyl, and
structural derivates thereof. For a more detailed discussion,
including synthetic procedures, of difluorotolyl,
4-fluoro-6-methylbenzimidazole, 4-methylbenzimidazole, and other
non-natural bases mentioned above, see: Schweitzer et al., J. Org.
Chem., 59:7238-7242 (1994);
[0208] In addition, chemical substituents, for example
cross-linking agents, may be used to add further stability or
irreversibility to the reaction. Non-limiting examples of
cross-linking agents include, for example,
1,1-bis(diazoacetyl)-2-phenylethane, glutaraldehyde,
N-hydroxysuccinimide esters, for example, esters with
4-azidosalicylic acid, homobifunctional imidoesters, including
disuccinimidyl esters such as
3,3'-dithiobis(succinimidylpropionate), bifunctional maleimides
such as bis-N-maleimido-1,8-octane and agents such as
methyl-3-[(p-azidophenyl) dithio]propioimidate.
[0209] A nucleotide analog may also include a "locked" nucleic
acid. Certain compositions can be used to essentially "anchor" or
"lock" an endogenous nucleic acid into a particular structure.
Anchoring sequences serve to prevent disassociation of a nucleic
acid complex, and thus not only can prevent copying but may also
enable labeling, modification, and/or cloning of the endogeneous
sequence. The locked structure may regulate gene expression (i.e.
inhibit or enhance transcription or replication), or can be used as
a stable structure that can be used to label or otherwise modify
the endogenous nucleic acid sequence, or can be used to isolate the
endogenous sequence, i.e. for cloning.
[0210] Nucleic acid molecules need not be limited to those
molecules containing only RNA or DNA, but further encompass
chemically-modified nucleotides and non-nucleotides. The percent of
non-nucleotides or modified nucleotides may be from 1% to 100%
(e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70,
75, 80, 85, 90 or 95%).
Nucleic Acid Preparation
[0211] In some embodiments, a nucleic acid is provided for use as a
control or standard in an assay, or therapeutic, for example. A
nucleic acid may be made by any technique known in the art, such as
for example, chemical synthesis, enzymatic production or biological
production. Nucleic acids may be recovered or isolated from a
biological sample. The nucleic acid may be recombinant or it may be
natural or endogenous to the cell (produced from the cell's
genome). It is contemplated that a biological sample may be treated
in a way so as to enhance the recovery of small nucleic acid
molecules. Generally, methods may involve lysing cells with a
solution having guanidinium and a detergent.
[0212] Nucleic acid synthesis may also be performed according to
standard methods. Non-limiting examples of a synthetic nucleic acid
(e.g., a synthetic oligonucleotide), include a nucleic acid made by
in vitro chemical synthesis using phosphotriester, phosphite, or
phosphoramidite chemistry and solid phase techniques or via
deoxynucleoside H-phosphonate intermediates. Various different
mechanisms of oligonucleotide synthesis have been disclosed
elsewhere.
[0213] Nucleic acids may be isolated using known techniques. In
particular embodiments, methods for isolating small nucleic acid
molecules, and/or isolating RNA molecules can be employed.
[0214] Chromatography is a process used to separate or isolate
nucleic acids from protein or from other nucleic acids. Such
methods can involve electrophoresis with a gel matrix, filter
columns, alcohol precipitation, and/or other chromatography. If a
nucleic acid from cells is to be used or evaluated, methods
generally involve lysing the cells with a chaotropic (e.g.,
guanidinium isothiocyanate) and/or detergent (e.g., N-lauroyl
sarcosine) prior to implementing processes for isolating particular
populations of RNA.
[0215] Methods may involve the use of organic solvents and/or
alcohol to isolate nucleic acids. In some embodiments, the amount
of alcohol added to a cell lysate achieves an alcohol concentration
of about 55% to 60%. While different alcohols can be employed,
ethanol works well. A solid support may be any structure, and it
includes beads, filters, and columns, which may include a mineral
or polymer support with electronegative groups. A glass fiber
filter or column is effective for such isolation procedures.
[0216] A nucleic acid isolation processes may sometimes include: a)
lysing cells in the sample with a lysing solution comprising
guanidinium, where a lysate with a concentration of at least about
1 M guanidinium is produced; b) extracting nucleic acid molecules
from the lysate with an extraction solution comprising phenol; c)
adding to the lysate an alcohol solution for form a lysate/alcohol
mixture, wherein the concentration of alcohol in the mixture is
between about 35% to about 70%; d) applying the lysate/alcohol
mixture to a solid support; e) eluting the nucleic acid molecules
from the solid support with an ionic solution; and, f) capturing
the nucleic acid molecules. The sample may be dried down and
resuspended in a liquid and volume appropriate for subsequent
manipulation.
Methods of Gene Transfer
[0217] In order to mediate the effect of the transgene expression
in a cell, it will be necessary to transfer the expression
constructs into a cell. Such transfer may employ viral or non-viral
methods of gene transfer. This section provides a discussion of
methods and compositions of gene transfer. A transformed cell
comprising an expression vector is generated by introducing into
the cell the expression vector. Suitable methods for polynucleotide
delivery for transformation of an organelle, a cell, a tissue or an
organism for use with the current methods include virtually any
method by which a polynucleotide (e.g., DNA) can be introduced into
an organelle, a cell, a tissue or an organism.
[0218] A host cell can, and has been, used as a recipient for
vectors. Host cells may be derived from prokaryotes or eukaryotes,
depending upon whether the desired result is replication of the
vector or expression of part or all of the vector-encoded
polynucleotide sequences. Numerous cell lines and cultures are
available for use as a host cell, and they can be obtained through
the American Type Culture Collection (ATCC), which is an
organization that serves as an archive for living cultures and
genetic materials.
[0219] An appropriate host may be determined. Generally this is
based on the vector backbone and the desired result. A plasmid or
cosmid, for example, can be introduced into a prokaryote host cell
for replication of many vectors. Bacterial cells used as host cells
for vector replication and/or expression include DHSalpha, JM109,
and KC8, as well as a number of commercially available bacterial
hosts such as SURE.RTM. Competent Cells and SOLOPACK Gold Cells
(STRATAGENE.RTM., La Jolla, Calif.). Alternatively, bacterial cells
such as E. coli LE392 could be used as host cells for phage
viruses. Eukaryotic cells that can be used as host cells include,
but are not limited to yeast, insects and mammals. Examples of
mammalian eukaryotic host cells for replication and/or expression
of a vector include, but are not limited to, HeLa, NIH3T3, Jurkat,
293, COS, CHO, Saos, and PC12. Examples of yeast strains include,
but are not limited to, YPH499, YPH500 and YPH501.
[0220] Nucleic acid vaccines may include, for example, non-viral
DNA vectors, "naked" DNA and RNA, and viral vectors. Methods of
transforming cells with these vaccines, and for optimizing the
expression of genes included in these vaccines are known and are
also discussed herein.
[0221] Examples of Methods of Nucleic Acid or Viral Vector
Transfer
[0222] 1. Ex Vivo Transformation
[0223] Various methods are available for transfecting vascular
cells and tissues removed from an organism in an ex vivo setting.
For example, canine endothelial cells have been genetically altered
by retroviral gene transfer in vitro and transplanted into a canine
(Wilson et al., Science, 244:1344-1346, 1989). In another example,
Yucatan minipig endothelial cells were transfected by retrovirus in
vitro and transplanted into an artery using a double-balloon
catheter (Nabel et al., Science, 244(4910):1342-1344, 1989). Thus,
it is contemplated that cells or tissues may be removed and
transfected ex vivo using the polynucleotides presented herein. In
particular aspects, the transplanted cells or tissues may be placed
into an organism.
[0224] 2. Injection
[0225] In certain embodiments, an antigen presenting cell or a
nucleic acid or viral vector may be delivered to an organelle, a
cell, a tissue or an organism via one or more injections (i.e., a
needle injection), such as, for example, subcutaneous, intradermal,
intramuscular, intravenous, intraprotatic, intratumor,
intraperitoneal, etc. Methods of injection include, foe example,
injection of a composition comprising a saline solution. Further
embodiments include the introduction of a polynucleotide by direct
microinjection. The amount of the expression vector used may vary
upon the nature of the antigen as well as the organelle, cell,
tissue or organism used.
[0226] Intradermal, intranodal, or intralymphatic injections are
some of the more commonly used methods of DC administration.
Intradermal injection is characterized by a low rate of absorption
into the bloodstream but rapid uptake into the lymphatic system.
The presence of large numbers of Langerhans dendritic cells in the
dermis will transport intact as well as processed antigen to
draining lymph nodes. Proper site preparation is necessary to
perform this correctly (i.e., hair is clipped in order to observe
proper needle placement). Intranodal injection allows for direct
delivery of antigen to lymphoid tissues. Intralymphatic injection
allows direct administration of DCs.
[0227] 3. Electroporation
[0228] In certain embodiments, a polynucleotide is introduced into
an organelle, a cell, a tissue or an organism via electroporation.
Electroporation involves the exposure of a suspension of cells and
DNA to a high-voltage electric discharge. In some variants of this
method, certain cell wall-degrading enzymes, such as
pectin-degrading enzymes, are employed to render the target
recipient cells more susceptible to transformation by
electroporation than untreated cells (U.S. Pat. No. 5,384,253,
incorporated herein by reference).
[0229] Transfection of eukaryotic cells using electroporation has
been quite successful. Mouse pre-B lymphocytes have been
transfected with human kappa-immunoglobulin genes (Potter et al.,
(1984) Proc. Nat'l Acad. Sci. USA, 81, 7161-7165), and rat
hepatocytes have been transfected with the chloramphenicol
acetyltransferase gene (Tur-Kaspa et al., (1986) Mol. Cell Biol.,
6, 716-718) in this manner.
[0230] 4. Calcium Phosphate
[0231] In other embodiments, a polynucleotide is introduced to the
cells using calcium phosphate precipitation. Human KB cells have
been transfected with adenovirus 5 DNA (Graham and van der Eb,
(1973) Virology, 52, 456-467) using this technique. Also in this
manner, mouse L(A9), mouse C127, CHO, CV-1, BHK, NIH3T3 and HeLa
cells were transfected with a neomycin marker gene (Chen and
Okayama, Mol. Cell Biol., 7(8):2745-2752, 1987), and rat
hepatocytes were transfected with a variety of marker genes (Rippe
et al., Mol. Cell Biol., 10:689-695, 1990).
[0232] 5. DEAE-Dextran
[0233] In another embodiment, a polynucleotide is delivered into a
cell using DEAE-dextran followed by polyethylene glycol. In this
manner, reporter plasmids were introduced into mouse myeloma and
erythroleukemia cells (Gopal, T. V., Mol Cell Biol. 1985 May;
5(5):1188-90).
[0234] 6. Sonication Loading
[0235] Additional embodiments include the introduction of a
polynucleotide by direct sonic loading. LTK-fibroblasts have been
transfected with the thymidine kinase gene by sonication loading
(Fechheimer et al., (1987) Proc. Nat'l Acad. Sci. USA, 84,
8463-8467).
[0236] 7. Liposome-Mediated Transfection
[0237] In a further embodiment, a polynucleotide may be entrapped
in a lipid complex such as, for example, a liposome. Liposomes are
vesicular structures characterized by a phospholipid bilayer
membrane and an inner aqueous medium. Multilamellar liposomes have
multiple lipid layers separated by aqueous medium. They form
spontaneously when phospholipids are suspended in an excess of
aqueous solution. The lipid components undergo self-rearrangement
before the formation of closed structures and entrap water and
dissolved solutes between the lipid bilayers (Ghosh and Bachhawat,
(1991) In: Liver Diseases, Targeted Diagnosis and Therapy Using
Specific Receptors and Ligands. pp. 87-104). Also contemplated is a
polynucleotide complexed with Lipofectamine (Gibco BRL) or
Superfect (Qiagen).
[0238] 8. Receptor Mediated Transfection
[0239] Still further, a polynucleotide may be delivered to a target
cell via receptor-mediated delivery vehicles. These take advantage
of the selective uptake of macromolecules by receptor-mediated
endocytosis that will be occurring in a target cell. In view of the
cell type-specific distribution of various receptors, this delivery
method adds another degree of specificity.
[0240] Certain receptor-mediated gene targeting vehicles comprise a
cell receptor-specific ligand and a polynucleotide-binding agent.
Others comprise a cell receptor-specific ligand to which the
polynucleotide to be delivered has been operatively attached.
Several ligands have been used for receptor-mediated gene transfer
(Wu and Wu, (1987) J. Biol. Chem., 262, 4429-4432; Wagner et al.,
Proc. Natl. Acad. Sci. USA, 87(9):3410-3414, 1990; Perales et al.,
Proc. Natl. Acad. Sci. USA, 91:4086-4090, 1994; Myers, EPO
0273085), which establishes the operability of the technique.
Specific delivery in the context of another mammalian cell type has
been discussed (Wu and Wu, Adv. Drug Delivery Rev., 12:159-167,
1993; incorporated herein by reference). In certain aspects, a
ligand is chosen to correspond to a receptor specifically expressed
on the target cell population.
[0241] In other embodiments, a polynucleotide delivery vehicle
component of a cell-specific polynucleotide-targeting vehicle may
comprise a specific binding ligand in combination with a liposome.
The polynucleotide(s) to be delivered are housed within the
liposome and the specific binding ligand is functionally
incorporated into the liposome membrane. The liposome will thus
specifically bind to the receptor(s) of a target cell and deliver
the contents to a cell. Such systems have been shown to be
functional using systems in which, for example, epidermal growth
factor (EGF) is used in the receptor-mediated delivery of a
polynucleotide to cells that exhibit upregulation of the EGF
receptor.
[0242] In still further embodiments, the polynucleotide delivery
vehicle component of a targeted delivery vehicle may be a liposome
itself, which may, for example, comprise one or more lipids or
glycoproteins that direct cell-specific binding. For example,
lactosyl-ceramide, a galactose-terminal asialoganglioside, have
been incorporated into liposomes and observed an increase in the
uptake of the insulin gene by hepatocytes (Nicolau et al., (1987)
Methods Enzymol., 149, 157-176). It is contemplated that the
tissue-specific transforming constructs may be specifically
delivered into a target cell in a similar manner.
[0243] 9. Microprojectile Bombardment
[0244] Microprojectile bombardment techniques can be used to
introduce a polynucleotide into at least one, organelle, cell,
tissue or organism (U.S. Pat. Nos. 5,550,318; 5,538,880; 5,610,042;
and PCT Application WO 94/09699; each of which is incorporated
herein by reference). This method depends on the ability to
accelerate DNA-coated microprojectiles to a high velocity allowing
them to pierce cell membranes and enter cells without killing them
(Klein et al., (1987) Nature, 327, 70-73). There are a wide variety
of microprojectile bombardment techniques known in the art, many of
which are applicable to the present methods. In this
microprojectile bombardment, one or more particles may be coated
with at least one polynucleotide and delivered into cells by a
propelling force. Several devices for accelerating small particles
have been developed. One such device relies on a high voltage
discharge to generate an electrical current, which in turn provides
the motive force (Yang et al., (1990) Proc. Nat'l Acad. Sci. USA,
87, 9568-9572). The microprojectiles used have consisted of
biologically inert substances such as tungsten or gold particles or
beads. Exemplary particles include those comprised of tungsten,
platinum, and, in certain examples, gold, including, for example,
nanoparticles. It is contemplated that in some instances DNA
precipitation onto metal particles would not be necessary for DNA
delivery to a recipient cell using microprojectile bombardment.
However, it is contemplated that particles may contain DNA rather
than be coated with DNA. DNA-coated particles may increase the
level of DNA delivery via particle bombardment but are not, in and
of themselves, necessary.
[0245] Examples of Methods of Viral Vector-Mediated Transfer
[0246] In certain embodiments, a transgene is incorporated into a
viral particle to mediate gene transfer to a cell. Typically, the
virus simply will be exposed to the appropriate host cell under
physiologic conditions, permitting uptake of the virus. The present
methods are advantageously employed using a variety of viral
vectors, as discussed below.
[0247] 1. Adenovirus
[0248] Adenovirus is particularly suitable for use as a gene
transfer vector because of its mid-sized DNA genome, ease of
manipulation, high titer, wide target-cell range, and high
infectivity. The roughly 36 kb viral genome is bounded by 100-200
base pair (bp) inverted terminal repeats (ITR), in which are
contained cis-acting elements necessary for viral DNA replication
and packaging. The early (E) and late (L) regions of the genome
that contain different transcription units are divided by the onset
of viral DNA replication.
[0249] The E1 region (E1A and E1B) encodes proteins responsible for
the regulation of transcription of the viral genome and a few
cellular genes. The expression of the E2 region (E2A and E2B)
results in the synthesis of the proteins for viral DNA replication.
These proteins are involved in DNA replication, late gene
expression, and host cell shut off (Renan, M. J. (1990) Radiother
Oncol., 19, 197-218). The products of the late genes (L1, L2, L3,
L4 and L5), including the majority of the viral capsid proteins,
are expressed only after significant processing of a single primary
transcript issued by the major late promoter (MLP). The MLP
(located at 16.8 map units) is particularly efficient during the
late phase of infection, and all the mRNAs issued from this
promoter possess a 5' tripartite leader (TL) sequence, which makes
them useful for translation.
[0250] In order for adenovirus to be optimized for gene therapy, it
is necessary to maximize the carrying capacity so that large
segments of DNA can be included. It also is very desirable to
reduce the toxicity and immunologic reaction associated with
certain adenoviral products. The two goals are, to an extent,
coterminous in that elimination of adenoviral genes serves both
ends. By practice of the present methods, it is possible to achieve
both these goals while retaining the ability to manipulate the
therapeutic constructs with relative ease.
[0251] The large displacement of DNA is possible because the cis
elements required for viral DNA replication all are localized in
the inverted terminal repeats (ITR) (100-200 bp) at either end of
the linear viral genome. Plasmids containing ITR's can replicate in
the presence of a non-defective adenovirus (Hay, R. T., et al., J
Mol Biol. 1984 Jun. 5; 175(4):493-510). Therefore, inclusion of
these elements in an adenoviral vector may permits replication.
[0252] In addition, the packaging signal for viral encapsulation is
localized between 194-385 bp (0.5-1.1 map units) at the left end of
the viral genome (Hearing et al., J. (1987) Virol., 67, 2555-2558).
This signal mimics the protein recognition site in bacteriophage
lambda DNA where a specific sequence close to the left end, but
outside the cohesive end sequence, mediates the binding to proteins
that are required for insertion of the DNA into the head structure.
E1 substitution vectors of Ad have demonstrated that a 450 bp
(0-1.25 map units) fragment at the left end of the viral genome
could direct packaging in 293 cells (Levrero et al., Gene,
101:195-202, 1991).
[0253] Previously, it has been shown that certain regions of the
adenoviral genome can be incorporated into the genome of mammalian
cells and the genes encoded thereby expressed. These cell lines are
capable of supporting the replication of an adenoviral vector that
is deficient in the adenoviral function encoded by the cell line.
There also have been reports of complementation of replication
deficient adenoviral vectors by "helping" vectors, e.g., wild-type
virus or conditionally defective mutants.
[0254] Replication-deficient adenoviral vectors can be
complemented, in trans, by helper virus. This observation alone
does not permit isolation of the replication-deficient vectors,
however, since the presence of helper virus, needed to provide
replicative functions, would contaminate any preparation. Thus, an
additional element was needed that would add specificity to the
replication and/or packaging of the replication-deficient vector.
That element derives from the packaging function of adenovirus.
[0255] It has been shown that a packaging signal for adenovirus
exists in the left end of the conventional adenovirus map (Tibbetts
et. al. (1977) Cell, 12, 243-249). Later studies showed that a
mutant with a deletion in the E1A (194-358 bp) region of the genome
grew poorly even in a cell line that complemented the early (E1A)
function (Hearing and Shenk, (1983) J. Mol. Biol. 167, 809-822).
When a compensating adenoviral DNA (0-353 bp) was recombined into
the right end of the mutant, the virus was packaged normally.
Further mutational analysis identified a short, repeated,
position-dependent element in the left end of the Ad5 genome. One
copy of the repeat was found to be sufficient for efficient
packaging if present at either end of the genome, but not when
moved toward the interior of the Ad5 DNA molecule (Hearing et al.,
J. (1987) Virol., 67, 2555-2558).
[0256] By using mutated versions of the packaging signal, it is
possible to create helper viruses that are packaged with varying
efficiencies. Typically, the mutations are point mutations or
deletions. When helper viruses with low efficiency packaging are
grown in helper cells, the virus is packaged, albeit at reduced
rates compared to wild-type virus, thereby permitting propagation
of the helper. When these helper viruses are grown in cells along
with virus that contains wild-type packaging signals, however, the
wild-type packaging signals are recognized preferentially over the
mutated versions. Given a limiting amount of packaging factor, the
virus containing the wild-type signals is packaged selectively when
compared to the helpers. If the preference is great enough, stocks
approaching homogeneity may be achieved.
[0257] To improve the tropism of ADV constructs for particular
tissues or species, the receptor-binding fiber sequences can often
be substituted between adenoviral isolates. For example the
Coxsackie-adenovirus receptor (CAR) ligand found in adenovirus 5
can be substituted for the CD46-binding fiber sequence from
adenovirus 35, making a virus with greatly improved binding
affinity for human hematopoietic cells. The resulting "pseudotyped"
virus, Ad5f35, has been the basis for several clinically developed
viral isolates. Moreover, various biochemical methods exist to
modify the fiber to allow re-targeting of the virus to target
cells. Methods include use of bifunctional antibodies (with one end
binding the CAR ligand and one end binding the target sequence),
and metabolic biotinylation of the fiber to permit association with
customized avidin-based chimeric ligands. Alternatively, one could
attach ligands (e.g. anti-CD205 by heterobifunctional linkers (e.g.
PEG-containing), to the adenovirus particle.
[0258] 2. Retrovirus
[0259] The retroviruses are a group of single-stranded RNA viruses
characterized by an ability to convert their RNA to double-stranded
DNA in infected cells by a process of reverse-transcription
(Coffin, (1990) In: Virology, ed., New York: Raven Press, pp.
1437-1500). The resulting DNA then stably integrates into cellular
chromosomes as a provirus and directs synthesis of viral proteins.
The integration results in the retention of the viral gene
sequences in the recipient cell and its descendants. The retroviral
genome contains three genes--gag, pol and env--that code for capsid
proteins, polymerase enzyme, and envelope components, respectively.
A sequence found upstream from the gag gene, termed psi, functions
as a signal for packaging of the genome into virions. Two long
terminal repeat (LTR) sequences are present at the 5' and 3' ends
of the viral genome. These contain strong promoter and enhancer
sequences and also are required for integration in the host cell
genome (Coffin, 1990).
[0260] In order to construct a retroviral vector, a nucleic acid
encoding a promoter is inserted into the viral genome in the place
of certain viral sequences to produce a virus that is
replication-defective. In order to produce virions, a packaging
cell line containing the gag, pol and env genes but without the LTR
and psi components is constructed (Mann et al., (1983) Cell, 33,
153-159). When a recombinant plasmid containing a human cDNA,
together with the retroviral LTR and psi sequences is introduced
into this cell line (by calcium phosphate precipitation for
example), the psi sequence allows the RNA transcript of the
recombinant plasmid to be packaged into viral particles, which are
then secreted into the culture media (Nicolas, J. F., and
Rubenstein, J. L. R., (1988) In: Vectors: a Survey of Molecular
Cloning Vectors and Their Uses, Rodriquez and Denhardt, Eds.).
Nicolas and Rubenstein; Temin et al., (1986) In: Gene Transfer,
Kucherlapati (ed.), New York: Plenum Press, pp. 149-188; Mann et
al., 1983). The media containing the recombinant retroviruses is
collected, optionally concentrated, and used for gene transfer.
Retroviral vectors are able to infect a broad variety of cell
types. However, integration and stable expression of many types of
retroviruses require the division of host cells (Paskind et al.,
(1975) Virology, 67, 242-248). An approach designed to allow
specific targeting of retrovirus vectors recently was developed
based on the chemical modification of a retrovirus by the chemical
addition of galactose residues to the viral envelope. This
modification could permit the specific infection of cells such as
hepatocytes via asialoglycoprotein receptors, may this be
desired.
[0261] A different approach to targeting of recombinant
retroviruses was designed in which biotinylated antibodies against
a retroviral envelope protein and against a specific cell receptor
were used. The antibodies were coupled via the biotin components by
using streptavidin (Roux et al., (1989) Proc. Nat'l Acad. Sci. USA,
86, 9079-9083). Using antibodies against major histocompatibility
complex class I and class II antigens, the infection of a variety
of human cells that bore those surface antigens was demonstrated
with an ecotropic virus in vitro (Roux et al., 1989).
[0262] 3. Adeno-Associated Virus
[0263] AAV utilizes a linear, single-stranded DNA of about 4700
base pairs. Inverted terminal repeats flank the genome. Two genes
are present within the genome, giving rise to a number of distinct
gene products. The first, the cap gene, produces three different
virion proteins (VP), designated VP-1, VP-2 and VP-3. The second,
the rep gene, encodes four non-structural proteins (NS). One or
more of these rep gene products is responsible for transactivating
AAV transcription. The three promoters in AAV are designated by
their location, in map units, in the genome. These are, from left
to right, p5, p19 and p40. Transcription gives rise to six
transcripts, two initiated at each of three promoters, with one of
each pair being spliced. The splice site, derived from map units
42-46, is the same for each transcript. The four non-structural
proteins apparently are derived from the longer of the transcripts,
and three virion proteins all arise from the smallest
transcript.
[0264] AAV is not associated with any pathologic state in humans.
Interestingly, for efficient replication, AAV requires "helping"
functions from viruses such as herpes simplex virus I and II,
cytomegalovirus, pseudorabies virus and, of course, adenovirus. The
best characterized of the helpers is adenovirus, and many "early"
functions for this virus have been shown to assist with AAV
replication. Low-level expression of AAV rep proteins is believed
to hold AAV structural expression in check, and helper virus
infection is thought to remove this block.
[0265] The terminal repeats of the AAV vector can be obtained by
restriction endonuclease digestion of AAV or a plasmid such as
p201, which contains a modified AAV genome (Samulski et al., J.
Virol., 61:3096-3101 (1987)), or by other methods, including but
not limited to chemical or enzymatic synthesis of the terminal
repeats based upon the published sequence of AAV. It can be
determined, for example, by deletion analysis, the minimum sequence
or part of the AAV ITRs which is required to allow function, i.e.,
stable and site-specific integration. It can also be determined
which minor modifications of the sequence can be tolerated while
maintaining the ability of the terminal repeats to direct stable,
site-specific integration.
[0266] AAV-based vectors have proven to be safe and effective
vehicles for gene delivery in vitro, and these vectors are being
developed and tested in pre-clinical and clinical stages for a wide
range of applications in potential gene therapy, both ex vivo and
in vivo (Carter and Flotte, (1995) Ann. N.Y. Acad. Sci., 770;
79-90; Chatteijee, et al., (1995) Ann. N.Y. Acad. Sci., 770, 79-90;
Ferrari et al., (1996) J. Virol., 70, 3227-3234; Fisher et al.,
(1996) J. Virol., 70, 520-532; Flotte et al., Proc. Nat'l Acad.
Sci. USA, 90, 10613-10617, (1993); Goodman et al. (1994), Blood,
84, 1492-1500; Kaplitt et al., (1994) Nat'l Genet., 8, 148-153;
Kaplitt, M. G., et al., Ann Thorac Surg. 1996 December;
62(6):1669-76; Kessler et al., (1996) Proc. Nat'l Acad. Sci. USA,
93, 14082-14087; Koeberl et al., (1997) Proc. Nat'l Acad. Sci. USA,
94, 1426-1431; Mizukami et al., (1996) Virology, 217, 124-130).
[0267] AAV-mediated efficient gene transfer and expression in the
lung has led to clinical trials for the treatment of cystic
fibrosis (Carter and Flotte, 1995; Flotte et al., Proc. Nat'l Acad.
Sci. USA, 90, 10613-10617, (1993)). Similarly, the prospects for
treatment of muscular dystrophy by AAV-mediated gene delivery of
the dystrophin gene to skeletal muscle, of Parkinson's disease by
tyrosine hydroxylase gene delivery to the brain, of hemophilia B by
Factor IX gene delivery to the liver, and potentially of myocardial
infarction by vascular endothelial growth factor gene to the heart,
appear promising since AAV-mediated transgene expression in these
organs has recently been shown to be highly efficient (Fisher et
al., (1996) J. Virol., 70, 520-532; Flotte et al., 1993; Kaplitt et
al., 1994; 1996; Koeberl et al., 1997; McCown et al., (1996) Brain
Res., 713, 99-107; Ping et al., (1996) Microcirculation, 3,
225-228; Xiao et al., (1996) J. Virol., 70, 8098-8108).
[0268] 4. Other Viral Vectors
[0269] Other viral vectors are employed as expression constructs in
the present methods and compositions. Vectors derived from viruses
such as vaccinia virus (Ridgeway, (1988) In: Vectors: A survey of
molecular cloning vectors and their uses, pp. 467-492; Baichwal and
Sugden, (1986) In, Gene Transfer, pp. 117-148; Coupar et al., Gene,
68:1-10, 1988) canary poxvirus, and herpes viruses are employed.
These viruses offer several features for use in gene transfer into
various mammalian cells.
[0270] Once the construct has been delivered into the cell, the
nucleic acid encoding the transgene are positioned and expressed at
different sites. In certain embodiments, the nucleic acid encoding
the transgene is stably integrated into the genome of the cell.
This integration is in the cognate location and orientation via
homologous recombination (gene replacement) or it is integrated in
a random, non-specific location (gene augmentation). In yet further
embodiments, the nucleic acid is stably maintained in the cell as a
separate, episomal segment of DNA. Such nucleic acid segments or
"episomes" encode sequences sufficient to permit maintenance and
replication independent of or in synchronization with the host cell
cycle. How the expression construct is delivered to a cell and
where in the cell the nucleic acid remains is dependent on the type
of expression construct employed.
Methods for Treating a Disease
[0271] The present methods also encompass methods of treatment or
prevention of a disease where administration of cells by, for
example, infusion, may be beneficial.
[0272] Cells, such as, for example, progenitor cells, such as, for
example, mesenchymal stromal cells, stem cells, pluripotent stem
cells, and embryonic stem cells may be used for cell therapy. The
cells may be from a donor, or may be cells obtained from the
patient. The cells may, for example, be used in regeneration, for
example, to replace the function of diseased cells. The cells may
also be modified to express a heterologous gene so that biological
agents may be delivered to specific microenvironments such as, for
example, diseased bone marrow or metastatic deposits. Mesenchymal
stromal cells have also, for example, been used to provide
immunosuppressive activity, and may be used in the treatment of
graft versus host disease and autoimmune disorders. The cells
provided in the present application contain a safety switch that
may be valuable in a situation where following cell therapy, the
cells need to be removed. For example, where progenitor cells are
provided to the patient, in some situations there may be an adverse
event, such as inappropriate differentiation of the cell into a
more mature cell type, or an undesired invitation into another
tissue, for example, where it is necessary to remove the
therapeutic cells. In such cases, where the cells have a negative
effect, the present methods may be used to remove the therapeutic
cells through selective apoptosis.
[0273] In other examples, T cells are used to treat various
diseases and conditions, and as a part of stem cell
transplantation. An adverse event that may occur after
haploidentical T cell transplantation is graft versus host disease.
The likelihood of GvHD occurring increases with the increased
number of T cells that are transplanted. This limits the number of
T cells that may be infused. By having the ability to selectively
remove the infused T cells in the event of GvHD in the patient, a
greater number of T cells may be infused, increasing the number to
greater than 10.sup.6, greater than 10.sup.7, greater than
10.sup.8, or greater than 10.sup.9 cells. The number of T cells/kg
body weight that may be administered may be, for example, from
about 1.times.10.sup.4 T cells/kg body weight to about
9.times.10.sup.7 T cells/kg body weight, for example about 1, 2, 3,
4, 5, 6, 7, 8, or 9.times.10.sup.4; about 1, 2, 3, 4, 5, 6, 7, 8,
or 9.times.10.sup.6; about 1, 2, 3, 4, 5, 6, 7, 8, or
9.times.10.sup.6; or about 1, 2, 3, 4, 5, 6, 7, 8, or
9.times.10.sup.7 T cells/kg body weight.
[0274] The term "unit dose" as it pertains to the inoculum refers
to physically discrete units suitable as unitary dosages for
mammals, each unit containing a predetermined quantity of
pharmaceutical composition calculated to produce the desired
immunogenic effect in association with the required diluent. The
specifications for the unit dose of an inoculum are dictated by and
are dependent upon the unique characteristics of the pharmaceutical
composition and the particular immunologic effect to be
achieved.
[0275] An effective amount of the pharmaceutical composition, such
as the multimeric ligand presented herein, would be the amount that
achieves this selected result of selectively removing the cells
that include the caspase 9 vector, such that over 60%, 70%, 80%,
85%, 90%, 95%, or 97% of the caspase 9 expressing cells are killed.
The term is also synonymous with "sufficient amount."
[0276] The effective amount for any particular application can vary
depending on such factors as the disease or condition being
treated, the particular composition being administered, the size of
the subject, and/or the severity of the disease or condition. One
can empirically determine the effective amount of a particular
composition presented herein without necessitating undue
experimentation.
[0277] The terms "contacted" and "exposed," when applied to a cell,
tissue or organism, are used herein to describe the process by
which the pharmaceutical composition and/or another agent, such as
for example a chemotherapeutic or radiotherapeutic agent, are
delivered to a target cell, tissue or organism or are placed in
direct juxtaposition with the target cell, tissue or organism. To
achieve cell killing or stasis, the pharmaceutical composition
and/or additional agent(s) are delivered to one or more cells in a
combined amount effective to kill the cell(s) or prevent them from
dividing. The administration of the pharmaceutical composition may
precede, be co-current with and/or follow the other agent(s) by
intervals ranging from minutes to weeks. In embodiments where the
pharmaceutical composition and other agent(s) are applied
separately to a cell, tissue or organism, one would generally
ensure that a significant period of time did not expire between the
times of each delivery, such that the pharmaceutical composition
and agent(s) would still be able to exert an advantageously
combined effect on the cell, tissue or organism. For example, in
such instances, it is contemplated that one may contact the cell,
tissue or organism with two, three, four or more modalities
substantially simultaneously (i.e., within less than about a
minute) with the pharmaceutical composition. In other aspects, one
or more agents may be administered within of from substantially
simultaneously, about 1 minute, to about 24 hours to about 7 days
to about 1 to about 8 weeks or more, and any range derivable
therein, prior to and/or after administering the expression vector.
Yet further, various combination regimens of the pharmaceutical
composition presented herein and one or more agents may be
employed.
Optimized and Personalized Therapeutic Treatment
[0278] The induction of apoptosis after administration of the
dimer, may be optimized by determining the stage of graft versus
host disease, or the number of undesired therapeutic cells that
remain in the patient.
[0279] For example, determining that a patient has GvHD, and the
stage of the GvHD, provides an indication to a clinician that it
may be necessary to induce caspase 9 associated apoptosis by
administering the multimeric ligand. In another example,
determining that a patient has a reduced level of GvHD after
treatment with the multimeric ligand may indicate to the clinician
that no additional dose of the multimeric ligand is needed.
Similarly, after treatment with the multimeric ligand, determining
that the patient continues to exhibit GvHD symptoms, or suffers a
relapse of GvHD may indicate to the clinician that it may be
necessary to administer at least one additional dose of multimeric
ligand. The term "dosage" is meant to include both the amount of
the dose and the frequency of administration, such as, for example,
the timing of the next dose
[0280] An indication of adjusting or maintaining a subsequent drug
dose, such as, for example, a subsequence dose of the multimeric
ligand, and/or the subsequent drug dosage, can be provided in any
convenient manner. An indication may be provided in tabular form
(e.g., in a physical or electronic medium) in some embodiments. For
example, the graft versus host disease observed symptoms may be
provided in a table, and a clinician may compare the symptoms with
a list or table of stages of the disease. The clinician then can
identify from the table an indication for subsequent drug dose. In
certain embodiments, an indication can be presented (e.g.,
displayed) by a computer, after the symptoms or the GvHD stage is
provided to the computer (e.g., entered into memory on the
computer). For example, this information can be provided to a
computer (e.g., entered into computer memory by a user or
transmitted to a computer via a remote device in a computer
network), and software in the computer can generate an indication
for adjusting or maintaining a subsequent drug dose, and/or provide
the subsequent drug dose amount.
[0281] Once a subsequent dose is determined based on the
indication, a clinician may administer the subsequent dose or
provide instructions to adjust the dose to another person or
entity. The term "clinician" as used herein refers to a decision
maker, and a clinician is a medical professional in certain
embodiments. A decision maker can be a computer or a displayed
computer program output in some embodiments, and a health service
provider may act on the indication or subsequent drug dose
displayed by the computer. A decision maker may administer the
subsequent dose directly (e.g., infuse the subsequent dose into the
subject) or remotely (e.g., pump parameters may be changed remotely
by a decision maker).
[0282] Methods as presented herein include without limitation the
delivery of an effective amount of an activated cell, a nucleic
acid. or an expression construct encoding the same. An "effective
amount" of the pharmaceutical composition, generally, is defined as
that amount sufficient to detectably and repeatedly to achieve the
stated desired result, for example, to ameliorate, reduce, minimize
or limit the extent of the disease or its symptoms. Other more
rigorous definitions may apply, including elimination, eradication
or cure of disease. In some embodiments there may be a step of
monitoring the biomarkers to evaluate the effectiveness of
treatment and to control toxicity.
Formulations and Routes for Administration to Patients
[0283] Where clinical applications are contemplated, it will be
necessary to prepare pharmaceutical compositions-expression
constructs, expression vectors, fused proteins, transfected or
transduced cells, in a form appropriate for the intended
application. Generally, this will entail preparing compositions
that are essentially free of pyrogens, as well as other impurities
that could be harmful to humans or animals.
[0284] The multimeric ligand, such as, for example, AP1903, may be
delivered, for example at doses of about 0.1 to 10 mg/kg subject
weight, of about 0.1 to 5 mg/kg subject weight, of about 0.2 to 4
mg/kg subject weight, of about 0.3 to 3 mg/kg subject weight, of
about 0.3 to 2 mg/kg subject weight, or about 0.3 to 1 mg/kg
subject weight, for example, about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6,
0.7, 0.8, 0.9, 1.0, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, or
10 mg/kg subject weight. In some embodiments, the ligand is
provided at 0.4 mg/Kg per dose, for example at a concentration of 5
mg/mL. Vials or other containers may be provided containing the
ligand at, for example, a volume per vial of about 0.25 ml to about
10 ml, for example, about 0.25, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4,
4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 ml, for example,
about 2 ml.
[0285] One may generally desire to employ appropriate salts and
buffers when recombinant cells are introduced into a patient. The
phrase "pharmaceutically or pharmacologically acceptable" refers to
molecular entities and compositions that do not produce adverse,
allergic, or other untoward reactions when administered to an
animal or a human. A pharmaceutically acceptable carrier includes
any and all solvents, dispersion media, coatings, antibacterial and
antifungal agents, isotonic and absorption delaying agents and the
like. The use of such media and agents for pharmaceutically active
substances is known. Except insofar as any conventional media or
agent is incompatible with the vectors or cells, its use in
therapeutic compositions is contemplated. Supplementary active
ingredients also can be incorporated into the compositions.
[0286] The active compositions may include classic pharmaceutical
preparations. Administration of these compositions will be via any
common route so long as the target tissue is available via that
route. This includes, for example, oral, nasal, buccal, rectal,
vaginal or topical. Alternatively, administration may be by
orthotopic, intradermal, subcutaneous, intramuscular,
intraperitoneal or intravenous injection. Such compositions would
normally be administered as pharmaceutically acceptable
compositions, discussed herein.
[0287] The pharmaceutical forms suitable for injectable use include
sterile aqueous solutions or dispersions and sterile powders for
the extemporaneous preparation of sterile injectable solutions or
dispersions. In all cases the form is sterile and is be fluid to
the extent that easy syringability exists. It is stable under the
conditions of manufacture and storage and is preserved against the
contaminating action of microorganisms, such as bacteria and fungi.
The carrier can be a solvent or dispersion medium containing, for
example, water, ethanol, polyol (for example, glycerol, propylene
glycol, and liquid polyethylene glycol, and the like), suitable
mixtures thereof, and vegetable oils. The proper fluidity can be
maintained, for example, by the use of a coating, such as lecithin,
by the maintenance of the required particle size in the case of
dispersion and by the use of surfactants. The prevention of the
action of microorganisms can be brought about by various
antibacterial an antifungal agents, for example, parabens,
chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In
certain examples, isotonic agents, for example, sugars or sodium
chloride may be included. Prolonged absorption of the injectable
compositions can be brought about by the use in the compositions of
agents delaying absorption, for example, aluminum monostearate and
gelatin.
[0288] For oral administration, the compositions may be
incorporated with excipients and used in the form of non-ingestible
mouthwashes and dentifrices. A mouthwash may be prepared
incorporating the active ingredient in the required amount in an
appropriate solvent, such as a sodium borate solution (Dobell's
Solution). Alternatively, the active ingredient may be incorporated
into an antiseptic wash containing sodium borate, glycerin and
potassium bicarbonate. The active ingredient also may be dispersed
in dentifrices, including, for example: gels, pastes, powders and
slurries. The active ingredient may be added in a therapeutically
effective amount to a paste dentifrice that may include, for
example, water, binders, abrasives, flavoring agents, foaming
agents, and humectants.
[0289] The compositions may be formulated in a neutral or salt
form. Pharmaceutically-acceptable salts include, for example, the
acid addition salts (formed with the free amino groups of the
protein) and which are formed with inorganic acids such as, for
example, hydrochloric or phosphoric acids, or such organic acids as
acetic, oxalic, tartaric, mandelic, and the like. Salts formed with
the free carboxyl groups can also be derived from inorganic bases
such as, for example, sodium, potassium, ammonium, calcium, or
ferric hydroxides, and such organic bases as isopropylamine,
trimethylamine, histidine, procaine and the like.
[0290] Upon formulation, solutions will be administered in a manner
compatible with the dosage formulation and in such amount as is
therapeutically effective. The formulations are easily administered
in a variety of dosage forms such as injectable solutions, drug
release capsules and the like. For parenteral administration in an
aqueous solution, for example, the solution may be suitably
buffered if necessary and the liquid diluent first rendered
isotonic with sufficient saline or glucose. These particular
aqueous solutions are especially suitable for intravenous,
intramuscular, subcutaneous and intraperitoneal administration. In
this connection, sterile aqueous media can be employed. For
example, one dosage could be dissolved in 1 ml of isotonic NaCl
solution and either added to 1000 ml of hypodermoclysis fluid or
injected at the proposed site of infusion, (see for example,
"Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038
and 1570-1580). Some variation in dosage will necessarily occur
depending on the condition of the subject being treated. The person
responsible for administration will, in any event, determine the
appropriate dose for the individual subject. Moreover, for human
administration, preparations may meet sterility, pyrogenicity, and
general safety and purity standards as required by FDA Office of
Biologics standards.
Examples
[0291] The examples set forth below illustrate certain embodiments
and do not limit the technology.
[0292] Mechanisms for selectively ablating the donor cells have
been studied as safety switches for cellular therapies, but there
have been complications. Some experience with safety-switch genes
to date has been in T lymphocytes since immunotherapy with these
cells has proved efficacious as treatment for viral infections and
malignancies (Walter, E. A., et al., N. Engl. J. Med. 1995,
333:1038-44; Rooney, C. M., et al., Blood. 1998, 92:1549-55;
Dudley, M. E., et al., Science 2002, 298:850-54; Marjit, W. A., et
al., Proc. Natl. Acad. Sci. USA 2003, 100:2742-47). The herpes
simplex virus I-derived thymidine kinase (HSVTK) gene has been used
as an in vivo suicide switch in donor T-cell infusions to treat
recurrent malignancy and Epstein Barr virus (EBV)
lymphoproliferation after hematopoietic stem cell transplantation
(Bonini C, et al., Science. 1997, 276:1719-1724; Tiberghien P, et
al., Blood. 2001, 97:63-72). However, destruction of T cells
causing graft-versus-host disease was incomplete, and the use of
gancyclovir (or analogs) as a pro-drug to activate HSV-TK precludes
administration of gancyclovir as an antiviral drug for
cytomegalovirus infections. This mechanism of action also requires
interference with DNA synthesis, relying on cell division, so that
cell killing may be protracted over several days and incomplete,
producing a lengthy delay in clinical benefit (Ciceri, F., et al.,
Lancet Oncol. 2009, 262:1019-24). Moreover, HSV-TK-directed immune
responses have resulted in elimination of HSV-TK-transduced cells,
even in immunosuppressed human immunodeficiency virus and bone
marrow transplant patients, compromising the persistence and hence
efficacy of the infused T cells. HSV-TK is also virus-derived, and
therefore potentially immunogenic (Bonini C, et al., Science. 1997,
276:1719-1724; Riddell S R, et al., Nat Med. 1996, 2:216-23). The E
coli-derived cytosine deaminase gene has also been used clinically
(Freytag S O, et al., Cancer Res. 2002, 62:4968-4976), but as a
xenoantigen it may be immunogenic and thus incompatible with
T-cell-based therapies that require long-term persistence.
Transgenic human CD20, which can be activated by a monoclonal
chimeric anti-CD20 antibody, has been proposed as a nonimmunogenic
safety system (Introna M, et al., Hum Gene Ther. 2000, 11:
611-620).
[0293] The following section provides examples of method of
providing a safety switch in cells used for cellular therapy, using
a caspase 9 chimeric protein.
Example 1: Construction and Evaluation of Caspase 9 Suicide Switch
Expression Vectors
[0294] Vector Construction and Confirmation of Expression
[0295] A safety switch that can be stably and efficiently expressed
in human T cells is presented herein. The system includes human
gene products with low potential immunogenicity that have been
modified to interact with a small molecule dimerizer drug that is
capable of causing the selective elimination of transduced T cells
expressing the modified gene. Additionally the inducible caspase 9
maintains function in T cells overexpressing antiapoptotic
molecules.
[0296] Expression vectors suitable for use as a therapeutic agent
were constructed that included a modified human caspase 9 activity
fused to a human FK506 binding protein (FKBP). The caspase 9/FK506
hybrid activity can be dimerized using a small molecule
pharmaceutical. Full length, truncated, and modified versions of
the caspase 9 activity were fused to FK506, and inserted into the
retroviral vector MSCV.IRES.GRP, which also allows expression of
the fluorescent marker, GFP. FIG. 1A illustrates the full length,
truncated and modified caspase 9 expression vectors constructed and
evaluated as a suicide switch for induction of apoptosis.
[0297] The full-length inducible caspase 9 molecule (F'-F--C-Casp9)
includes 2 FK506 binding proteins (FKBPs) linked with a
Ser-Gly-Gly-Gly-Ser linker (SEQ ID NO: 21) to the small and large
subunit of the caspase molecule (see FIG. 1A). Full-length
inducible caspase 9 (F'F--C-Casp9.I.GFP) has a full-length caspase
9, also includes a caspase recruitment domain (CARD; GenBank NM001
229) linked to 2 12-kDa human FK506 binding proteins (FKBP12;
GenBank AH002 818) that contain an F36V mutation (FIG. 1A). The
amino acid sequence of one of the FKBPs (F') was codon-wobbled
(e.g., the 3.sup.rd nucleotide of each amino acid codon was altered
by a silent mutation that maintained the originally encoded amino
acid) to prevent homologous recombination when expressed in a
retrovirus. F'F--C-Casp9C3S includes a cysteine to serine mutation
at position 287 that disrupts its activation site. In constructs
F'F-Casp9, F--C-Casp9, and F'-Casp9, either the caspase activation
domain (CARD), one FKBP, or both, were deleted, respectively. All
constructs were cloned into MSCV.IRES.GFP as EcoRI-XhoI
fragments.
[0298] 293T cells were transfected with each of these constructs
and 48 hours after transduction expression of the marker gene GFP
was analyzed by flow cytometry. In addition, 24 hours after
transfection, 293T cells were incubated overnight with 100 nM CID
and subsequently stained with the apoptosis marker annexin V. The
mean and standard deviation of transgene expression level (mean
GFP) and number of apoptotic cells before and after exposure to the
chemical inducer of dimerization (CID) (% annexin V within
GFP.about. cells) from 4 separate experiments are shown in the
second through fifth columns of the table in FIG. 1A. In addition
to the level of GFP expression and staining for annexin V, the
expressed gene products of the full length, truncated and modified
caspase 9 were also analyzed by western blot to confirm the caspase
9 genes were being expressed and the expressed product was the
expected size. The results of the western blot are presented in
FIG. 1B.
[0299] Coexpression of the inducible caspase 9 constructs of the
expected size with the marker gene GFP in transfected 293T cells
was demonstrated by Western blot using a caspase 9 antibody
specific for amino acid residues 299-318, present both in the
full-length and truncated caspase molecules as well as a
GFP-specific antibody. Western blots were performed as presented
herein.
[0300] Transfected 293T cells were resuspended in lysis buffer (50%
Tris/Gly, 10% sodium dodecyl sulfate [SDS], 4%
beta-mercaptoethanol, 10% glycerol, 12% water, 4% bromophenol blue
at 0.5%) containing aprotinin, leupeptin, and phenylmethylsulfonyl
fluoride (Boehringer, Ingelheim, Germany) and incubated for 30
minutes on ice. After a 30-minute centrifugation, supernatant was
harvested, mixed 1:2 with Laemmli buffer (Bio-Rad, Hercules,
Calif.), boiled and loaded on a 10% SDS-polyacrylamide gel. The
membrane was probed with rabbit anti-caspase 9 (amino acid residues
299-3 18) immunoglobulin G (IgG; Affinity BioReagents, Golden,
Colo.; 1:500 dilution) and with mouse anti-GFP IgG (Covance,
Berkeley, Calif.; 1:25,000 dilution). Blots were then exposed to
appropriate peroxidase-coupled secondary antibodies and protein
expression was detected with enhanced chemiluminescence (ECL;
Amersham, Arlington Heights, Ill.). The membrane was then stripped
and reprobed with goat polyclonal antiactin (Santa Cruz
Biotechnology; 1:500 dilution) to check equality of loading.
[0301] Additional smaller size bands, seem in FIG. 1B, likely
represent degradation products. Degradation products for the
F'F--C-Casp9 and F'F-Casp9 constructs may not be detected due to a
lower expression level of these constructs as a result of their
basal activity. Equal loading of each sample was confirmed by the
substantially equal amounts of actin shown at the bottom of each
lane of the western blot, indicating substantially similar amounts
of protein were loaded in each lane.
[0302] Evaluation of caspase 9 suicide switch expression
constructs.
[0303] Cell Lines
[0304] B 95-8 EBV transformed B-cell lines (LCLs), Jurkat, and MT-2
cells (kindly provided by Dr S. Marriott, Baylor College of
Medicine, Houston, Tex.) were cultured in RPMI 1640 (Hyclone,
Logan, Utah) containing 10% fetal bovine serum (FBS; Hyclone).
Polyclonal EBV-specific T-cell lines were cultured in 45% RPMI/45%
Clicks (Irvine Scientific, Santa Ana, Calif.)/10% FBS and generated
as previously reported. Briefly, peripheral blood mononuclear cells
(2.times.10.sup.6 per well of a 24-well plate) were stimulated with
autologous LCLs irradiated at 4000 rads at a
responder-to-stimulator (R/S) ratio of 40:1. After 9 to 12 days,
viable cells were restimulated with irradiated LCLs at an R/S ratio
of 4:1. Subsequently, cytotoxic T cells (CTLs) were expanded by
weekly restimulation with LCLs in the presence of 40 U/mL to 100
U/mL recombinant human interleukin-2 (rhIL-2; Proleukin; Chiron,
Emeryville, Calif.).
[0305] Retrovirus Transduction
[0306] For the transient production of retrovirus, 293T cells were
transfected with iCasp9/iFas constructs, along with plasmids
encoding gag-pol and RD 114 envelope using GeneJuice transfection
reagent (Novagen, Madison, Wis.). Virus was harvested 48 to 72
hours after transfection, snap frozen, and stored at
.about.80.degree. C. until use. A stable FLYRD 18-derived
retroviral producer line was generated by multiple transductions
with VSV-G pseudotyped transient retroviral supernatant. FLYRD18
cells with highest transgene expression were single-cell sorted,
and the clone that produced the highest virus titer was expanded
and used to produce virus for lymphocyte transduction. The
transgene expression, function, and retroviral titer of this clone
was maintained during continuous culture for more than 8 weeks. For
transduction of human lymphocytes, a non-tissue-culture-treated
24-well plate (Becton Dickinson, San Jose, Calif.) was coated with
recombinant fibronectin fragment (FN CH-296; Retronectin; Takara
Shuzo, Otsu, Japan; 4 .mu.g/mL in PBS, overnight at 4.degree. C.)
and incubated twice with 0.5 mL retrovirus per well for 30 minutes
at 37.degree. C. Subsequently, 3.times.10.sup.5 to 5.times.10.sup.5
T cells per well were transduced for 48 to 72 hours using 1 mL
virus per well in the presence of 100 U/mL IL-2. Transduction
efficiency was determined by analysis of expression of the
coexpressed marker gene green fluorescent protein (GFP) on a
FACScan flow cytometer (Becton Dickinson). For functional studies,
transduced CTLs were either non-selected or segregated into
populations with low, intermediate, or high GFP expression using a
MoFlo cytometer (Dako Cytomation, Ft Collins, Colo.) as
indicated.
[0307] Induction and Analysis of Apoptosis
[0308] CID (AP20187; ARIAD Pharmaceuticals) at indicated
concentrations was added to transfected 293T cells or transduced
CTLs. Adherent and nonadherent cells were harvested and washed with
annexin binding buffer (BD Pharmingen, San Jose, Calif.). Cells
were stained with annexin-V and 7-amino-actinomycin D (7-AAD) for
15 minutes according to the manufacturer's instructions (BD
Pharmingen). Within 1 hour after staining, cells were analyzed by
flow cytometry using CellQuest software (Becton Dickinson).
[0309] Cytotoxicity Assay
[0310] The cytotoxic activity of each CTL line was evaluated in a
standard 4-hour .sup.51Cr release assay, as previously presented.
Target cells included autologous LCLs, human leukocyte antigen
(HLA) class I-mismatched LCLs and the lymphokine-activated killer
cell-sensitive T-cell lymphoma line HSB-2. Target cells incubated
in complete medium or 1% Triton X-100 (Sigma, St Louis, Mo.) were
used to determine spontaneous and maximum .sup.51Cr release,
respectively. The mean percentage of specific lysis of triplicate
wells was calculated as 100.times.(experimental release-spontaneous
release)/(maximal release-spontaneous release).
[0311] Phenotyping
[0312] Cell-surface phenotype was investigated using the following
monoclonal antibodies: CD3, CD4, CD8 (Becton Dickinson) and CD56
and TCR-.alpha./.beta. (Immunotech, Miami, Fla.). .DELTA.NGFR-iFas
was detected using anti-NGFR antibody (Chromaprobe, Aptos, Calif.).
Appropriate matched isotype controls (Becton Dickinson) were used
in each experiment. Cells were analyzed with a FACSscan flow
cytometer (Becton Dickinson).
[0313] Analysis of Cytokine Production
[0314] The concentration of interferon-.gamma. (IFN-.gamma.), IL-2,
IL-4, IL-5, IL-10, and tumor necrosis factor-.alpha. (TNF.alpha.)
in CTL culture supernatants was measured using the Human Th1/Th2
cytokine cytometric Bead Array (BD Pharmingen) and the
concentration of IL-12 in the culture supernatants was measured by
enzyme-linked immunosorbent assay (ELISA; R&D Systems,
Minneapolis, Minn.) according to the instructions of the
manufacturer.
[0315] In Vivo Experiments
[0316] Non-obese diabetic severe combined immunodeficient
(NOD/SCID) mice, 6 to 8 weeks of age, were irradiated (250 rad) and
injected subcutaneously in the right flank with 10.times.10.sup.6
to 15.times.10.sup.6 LCLs resuspended in Matrigel (BD Bioscience).
Two weeks later mice bearing tumors that were approximately 0.5 cm
in diameter were injected into the tail vein with a 1:1 mixture of
nontransduced and iCasp9.I.GFPhigh-transduced EBV CTLs (total
15.times.10.sup.6). At 4 to 6 hours prior and 3 days after CTL
infusion, mice were injected intraperitoneally with recombinant
hIL-2 (2000 U; Proleukin; Chiron). On day 4, the mice were randomly
segregated in 2 groups: 1 group received CID (50 .mu.g AP20187,
intraperitoneally) and 1 group received carrier only (16.7%
propanediol, 22.5% PEG400, and 1.25% Tween 80, intraperitoneally).
On day 7, all mice were killed. Tumors were homoge-nized and
stained with antihuman CD3 (BD Pharmingen). By FACS analysis, the
number of GFP+ cells within the gated CD3+ population was
evaluated. Tumors from a control group of mice that received only
nontransduced CTLs (total 15.times.10.sup.6) were used as a
negative control in the analysis of CD3+/GFP+ cells.
[0317] Optimization of Expression and Function of Inducible Caspase
9
[0318] Caspases 3, 7, and 9 were screened for their suitability as
inducible safety-switch molecules both in transfected 293T cells
and in transduced human T cells. Only inducible caspase 9 (iCasp9)
was expressed at levels sufficient to confer sensitivity to the
chosen CID (e.g., chemical inducer of dimerization). An initial
screen indicated that the full length iCasp9 could not be
maintained stably at high levels in T cells, possibly due to
transduced cells being eliminated by the basal activity of the
transgene. The CARD domain is involved in physiologic dimerization
of caspase 9 molecules, by a cytochrome C and adenosine
triphosphate (ATP)-driven interaction with apoptotic
protease-activating factor 1 (Apaf-1). Because of the use of a CID
to induce dimerization and activation of the suicide switch, the
function of the CARD domain is superfluous in this context and
removal of the CARD domain was investigated as a method of reducing
basal activity. Given that only dimerization rather than
multimerization is required for activation of caspase 9, a single
FKBP domain also was investigated as a method to effect
activation.
[0319] The activity of the resultant truncated and/or modified
forms of caspase 9 (e.g., the CARD domain, or one of the 2 FKBP
domains, or both, are removed) were compared. A construct with a
disrupted activation site, F'F--C-Casp9.sub.c->s, provided a
nonfunctional control (see FIG. 1A). All constructs were cloned
into the retroviral vector MSCV.sup.26 in which retroviral long
terminal repeats (LTRs) direct transgene expression and enhanced
GFP is coexpressed from the same mRNA by use of an internal
ribosomal entry site (IRES). In transfected 293T cells, expression
of all inducible caspase 9 constructs at the expected size as well
as coexpression of GFP was demonstrated by Western blot (see FIG.
1B). Protein expression (estimated by mean fluorescence of GFP and
visualized on Western blot) was highest in the nonfunctional
construct F'F--C-Casp9.sub.c->s and greatly diminished in the
full-length construct F'F--C-Casp9. Removal of the CARD
(F'F-Casp9), one FKBP (F--C-Casp9), or both (F-Casp9) resulted in
progressively higher expression of both inducible caspase 9 and
GFP, and correspondingly enhanced sensitivity to CID (see FIG. 1A).
Based on these results, the F-Casp9 construct (henceforth referred
to as iCasp9.sub.M) was used for further study in human T
lymphocytes.
[0320] Stable Expression of iCasp9.sub.M in Human T Lymphocytes
[0321] The long-term stability of suicide gene expression is of
utmost importance, since suicide genes must be expressed for as
long as the genetically engineered cells persist. For T-cell
transduction, a FLYRD18-derived retroviral producer clone that
produces high-titer RD114-pseudotyped virus was generated to
facilitate the transduction of T cells. iCasp9.sub.M expression in
EBV-specific CTL lines (EBV-CTL) was evaluated since EBV-specific
CTL lines have well-characterized function and specificity and are
already being used as in vivo therapy for prevention and treatment
of EBV-associated malignancies. Consistent transduction
efficiencies of EBV-CTLs of more than 70% (mean, 75.3%; range,
71.4%-83.0% in 5 different donors) were obtained after a single
transduction with retrovirus. The expression of iCasp9.sub.M in
EBV-CTLs was stable for at least 4 weeks after transduction without
selection or loss of transgene function.
[0322] iCasp9.sub.M does not Alter Transduced T-Cell
Characteristics
[0323] To ensure that expression of iCasp9.sub.M did not alter
T-cell characteristics, the phenotype, antigen-specificity,
proliferative potential, and function of nontransduced or
nonfunctional iCasp9.sub.c->s-transduced EBV-CTLs was compared
with that of iCasp9.sub.M-transduced EBV-CTLs. In 4 separate
donors, transduced and nontransduced CTLs consisted of equal
numbers of CD4+, CD8+, CD56+, and TCR .alpha./.beta.+ cells (see
FIG. 2A). Similarly, production of cytokines including IFN-.gamma.,
TNF.alpha., IL-10, IL-4, IL-5, and IL-2 was unaltered by
iCasp9.sub.M expression (see FIG. 2B). iCasp9.sub.M-transduced
EBV--CTLs specifically lysed autologous LCLs comparable to
nontransduced and control-transduced CTLs (see FIG. 2C). Expression
of iCasp9M did not affect the growth characteristics of
exponentially growing CTLs, and importantly, dependence on antigen
and IL-2 for proliferation was preserved (see FIG. 2D). FIGS. 2A
and 2B graphically phenotypic and secretion data of type TH1 and
TH2 cytokines upon antigen stimulation. FIG. 2C graphically
illustrates the level of cytotoxic activity against autologous
EBV-transformed lymphoblastoid B-cell line (LCL), HLA-mismatched
LCL, and HSB-2 (a LAK cell target) were compared in nontransduced
(white bars), F-Casp9.sub.M-transduced (black bars), and
F'F--C-Casp9.sub.c->s-transduced (stipled bars) EBV-specific
CTLs (EBV-CTLs) on day 15 to day 18 after transduction (2 antigenic
stimulations after transduction). The mean and standard deviation
of triplicate wells are shown. Examples of experiments using
EBV-CTLs from 4 different donors are shown. FIG. 2D graphically
illustrates the antigen dependence of iCasp9.sub.M-transduced CTLs.
On day 21 after transduction the normal weekly antigenic
stimulation with autologous LCLs and IL-2 was continued (black
diamonds) or discontinued (black squares). Discontinuation of
antigen stimulation resulted in a steady decline of T cells.
[0324] Elimination of More than 99% of T Lymphocytes Selected for
High Transgene Expression In Vitro
[0325] Inducible iCasp9.sub.M proficiency in CTLs was tested by
monitoring loss of GFP-expressing cells after administration of
CID; 91.3% (range, 89.5%-92.6% in 5 different donors) of GFP+ cells
were eliminated after a single 10-nM dose of CID (see FIG. 3A).
Similar results were obtained regardless of exposure time to CID
(range, 1 hour-continuous). In all experiments, CTLs that survived
CID treatment had low transgene expression with a 70% (range,
55%-82%) reduction in mean fluorescence intensity of GFP after CID.
No further elimination of the surviving GFP+ T cells could be
obtained by an antigenic stimulation followed by a second 10-nM
dose of CID. Therefore, the non-responding CTLs most likely
expressed insufficient iCasp9.sub.M for functional activation by
CID.
[0326] To investigate the correlation between low levels of
expression and CTL non-response to CID, CTLs were sorted for low,
intermediate, and high expression of the linked marker gene GFP and
mixed 1:1 with nontransduced CTLs from the same donor to allow for
an accurate quantitation of the number of transduced T cells
responding to CID-induced apoptosis.
[0327] The number of transduced T cells eliminated increased with
the level of GFP transgene expression (see FIGS. 4A, 4B and 4C). To
determine the correlation between transgene expression and function
of iCasp9.sub.M, iCasp9.sub.M IRES.GFP-transduced EBV-CTL were
selected for low (mean 21), intermediate (mean 80) and high (mean
189) GFP expression (see FIG. 4A). Selected T-cells were incubated
overnight with 10 nM CID and subsequently stained with Annexin V
and 7-AAD. Indicated are the percentages of Annexin V+/7-AAD- and
Annexin V+/7-AAD+ T-cells (see FIG. 4B). Selected T-cells were
mixed 1:1 with non-transduced T-cells and incubated with 10 nM CID
following antigenic stimulation. Indicated is the percentage of
residual GFP-positive T-cells on day 7 (see FIG. 4C).
[0328] For GFP.sub.high-Selected cells, 10 nM CID led to deletion
of 99.1% (range, 98.7%-99.4%) of transduced cells (see FIG. 3A). On
the day of antigen stimulation, F-Casp9.sub.M.I.GFP-transduced CTLs
were either untreated or treated with 10 nM CID. Seven days later,
the response to CID was measured by flow cytometry for GFP. The
percentage of transduced T cells was adjusted to 50% to allow for
an accurate measurement of residual GFP+ cells after CID treatment.
The responses to CID in unselected (top row of FIG. 3A) and
GFP.sub.high-Selected CTLs (bottom row of FIG. 3A) was compared.
The percentage of residual GFP+ cells is indicated (see FIG.
3A).
[0329] Rapid induction of apoptosis in the GFP.sub.high-Selected
cells is demonstrated by apoptotic characteristics such as cell
shrinkage and fragmentation within 14 hours of CID administration
(see FIG. 3B). After overnight incubation with 10 nM CID,
F-Casp9.sub.M.I.GFP.sub.high-transduced T cells had apoptotic
characteristics such as cell shrinkage and fragmentation by
microscopic evaluation. Of the T cells selected for high
expression, 64% (range, 59%-69%) had an apoptotic
(annexin-V+/7-AAD-) and 30% (range, 26%-32%) had a necrotic
(annexinV+/7-AAD+) phenotype (see FIG. 3C). Staining with markers
of apoptosis showed that 64% of T cells had an apoptotic phenotype
(annexin V+, 7-AAD-, lower right quadrant) and 32% a necrotic
phenotype (annexin V+, 7-AAD+, upper right quadrant). A
representative example of 3 separate experiments is shown.
[0330] In contrast, the induction of apoptosis was significantly
lower in T cells selected for intermediate or low GFP expression
(see FIGS. 4A, 4B and 4C). For clinical applications therefore,
versions of the expression constructs with selectable markers that
allow selection for high copy number, high levels of expression, or
both high copy number and high levels of expression may be
desirable. CID-induced apoptosis was inhibited by the pancaspase
inhibitor zVAD-fmk (100 .mu.M for 1 hour prior to adding CID.
Titration of CID showed that 1 nM CID was sufficient to obtain the
maximal deletion effect (FIG. 3D). A dose-response curve using the
indicated amounts of CID (AP20187) shows the sensitivity of
F-Casp9.sub.M.I.GFP.sub.high to CID. Survival of GFP+ cells is
measured on day 7 after administration of the indicated amount of
CID. The mean and standard deviation for each point are given.
Similar results were obtained using another chemical inducer of
dimerization (CID), AP1903, which was clinically shown to have
substantially no adverse effects when administered to healthy
volunteers. The dose response remained unchanged for at least 4
weeks after transduction.
[0331] iCasp9.sub.M is Functional in Malignant Cells that Express
Antiapoptotic Molecules
[0332] Caspase 9 was selected as an inducible proapoptotic molecule
for clinical use rather than previously presented iFas and iFADD,
because caspase 9 acts relatively late in apoptosis signaling and
therefore is expected to be less susceptible to inhibition by
apoptosis inhibitors. Thus, suicide function should be preserved
not only in malignant, transformed T-cell lines that express
antiapoptotic molecules, but also in subpopulations of normal T
cells that express elevated antiapoptotic molecules as part of the
process to ensure long-term preservation of memory cells. To
further investigate the hypothesis, the function of iCasp9.sub.M
and iFas was first compared in EBV-CTLs. To eliminate any potential
vector based difference, inducible Fas also was expressed in the
MSCV.IRES.GFP vector, like iCasp9. For these experiments both
.DELTA.NGFR.iFas.I.GFP and iCasp9.sub.M.I.GFP-transduced CTLs were
sorted for GFP.sub.high expression and mixed with nontransduced
CTLs at a 1:1 ratio to obtain cell populations that expressed
either iFas or iCasp9.sub.M at equal proportions and at similar
levels (see FIG. 5A). EBV-CTLs transduced with
.DELTA.NGFR-iFas.I.GFP are shown in the left panel of FIG. 5A.
EBV-CTLs transduced with iCasp9.sub.M.I.GFP are shown in the right
panel of FIG. 5A. The EBV-CTLs were sorted for high GFP expression
and mixed 1:1 with nontransduced CTLs as presented. The percentages
of .DELTA.NGFR+/GFP+ and GFP+ T cells are indicated.
[0333] Elimination of GFP+ cells after administration of 10 nM CID
was more rapid and more efficient in iCasp9.sub.M than in
iFas-transduced CTLs (99.2%+/-0.14% of iCasp9.sub.M-transduced
cells compared with 89.3%+/-4.9% of iFas-transduced cells at day 7
after CID; P<0.05; see FIG. 5B). On the day of LCL stimulation,
10 nM CID was administered, and GFP was measured at the time points
indicated to determine the response to CID. Black diamonds
represent data for .DELTA.NGFR-iFas.I.GFP; black squares represent
data for iCasp9.sub.M.I.GFP. Mean and standard deviation of 3
experiments are shown.
[0334] The function of iCasp9M and iFas was also compared in 2
malignant T-cell lines: Jurkat, an apoptosis-sensitive T-cell
leukemia line, and MT-2, an apoptosis-resistant T-cell line, due to
c-FLIP and bcl-xL expression. Jurkat cells and MT-2 cells were
transduced with iFas and iCasp9.sub.M with similar efficiencies
(92% vs 84% in Jurkat, 76% vs 70% in MT-2) and were cultured in the
presence of 10 nM CID for 8 hours. Annexin-V staining showed that
although iFas and iCasp9.sub.M induced apoptosis in an equivalent
number of Jurkat cells (56.4%+/-15.6% and 57.2%+/-18.9%,
respectively), only activation of iCasp9.sub.M resulted in
apoptosis of MT-2 cells (19.3%+/-8.4% and 57.9%+/-11.9% for iFas
and iCasp9.sub.M, respectively; see FIG. 5C).
[0335] The human T-cell lines Jurkat (left) and MT-2 (right) were
transduced with .DELTA.NGFR-iFas.I.GFP (top row of FIG. 5C) or
iCasp9.sub.M.I.GFP (bottom row of FIG. 5C). An equal percentage of
T cells were transduced with each of the suicide genes: 92% for
.DELTA.NGFR-iFas.I.GFP versus 84% for iCasp9.sub.M.I.GFP in Jurkat,
and 76% for .DELTA.NGFR-iFas.I.GFP versus 70% for
iCasp9.sub.M.I.GFP in MT-2. T cells were either nontreated or
incubated with 10 nM CID. Eight hours after exposure to CID,
apoptosis was measured by staining for annexin V and 7-AAD.
Representative example of 3 experiments is shown. PE indicates
phycoerythrin. These results demonstrate that in T cells
overexpressing apoptosis-inhibiting molecules, the function of iFas
can be blocked, while iCasp9.sub.M can still effectively induce
apoptosis.
[0336] iCasp9M-Mediated Elimination of T Cells Expressing an
Immunomodulatory Transgene
[0337] To determine whether iCasp9M could effectively destroy cells
genetically modified to express an active transgene product, the
ability of iCasp9.sub.M to eliminate EBV-CTLs stably expressing
IL-12 was measured. While IL-12 was undetectable in the supernatant
of nontransduced and iCasp9.sub.M.IRES.GFP-transduced CTLs, the
supernatant of iCasp9.sub.M.IRES.IL-12-transduced cells contained
324 pg/mL to 762 pg/mL IL-12. After administration of 10 nM CID,
however, the IL-12 in the supernatant fell to undetectable levels
(<7.8 pg/mL). Thus, even without prior sorting for high
transgene expressing cells, activation of iCasp9.sub.M is
sufficient to completely eliminate all T cells producing
biologically relevant levels of IL-12 (FIG. 6). The function of
iCasp9M when coexpressed with IL-12 is graphically represented by
bar graphs in FIG. 6. The marker gene GFP in the iCasp9.sub.M.I.GFP
constructs was replaced by flexi IL-12, encoding the p40 and p35
subunits of human IL-12. iCasp9.sub.M.I.GFP- and
iCasp9.sub.M.I.IL-12-transduced EBV-CTLs were stimulated with LCLs,
and then left untreated or exposed to 10 nM CID. Three days after a
second antigenic stimulation, the levels of IL-12 in the culture
supernatant were measured by IL-12 ELISA (detection limit of this
assay is 7.8 pg/mL). The mean and standard deviation of triplicate
wells are indicated. Results of 1 of 2 experiments with CTLs from 2
different donors are shown.
[0338] Elimination of More than 99% of T Cells Selected for High
Transgene Expression In Vivo
[0339] The function of iCasp9.sub.M also was evaluated in
transduced EBV-CTLs in vivo. A SCID mouse-human xenograft model was
used for adoptive immunotherapy. After intravenous infusion of a
1:1 mixture of nontransduced and
iCasp9.sub.M.IRES.GFP.sub.high-transduced CTLs into SCID mice
bearing an autologous LCL xenograft, mice were treated either with
a single dose of CID or carrier only. Three days after CID/carrier
administration, tumors were analyzed for human CD3+/GFP+ cells.
Detection of the nontransduced component of the infusion product,
using human anti-CD3 antibodies, confirmed the success of the
tail-vein infusion in mice that received CID. In mice treated with
CID, there was more than a 99% reduction in the number of human
CD3+/GFP+ T cells, compared with infused mice treated with carrier
alone, demonstrating equally high sensitivity of
iCasp9.sub.M-transduced T cells in vivo and in vitro (see FIG.
7).
[0340] The function of iCasp9.sub.M in vivo, is graphically
illustrated in FIG. 7. NOD/SCID mice were irradiated and injected
subcutaneously with 10.times.10.sup.6 to 15.times.10.sup.6 LCLs.
After 14 days, mice bearing tumors of 0.5 cm in diameter received a
total of 15.times.10.sup.6 EBV-CTLs (50% of these cells were
nontransduced and 50% were transduced with iCasp9.sub.M.I.GFP and
sorted for high GFP expression). On day 3 after CTL administration,
mice received either CID (50 .mu.g AP20187; (black diamonds, n=6)
or carrier only (black squares, n=5) and on day 6 the presence of
human CD3+/GFP+ T cells in the tumors was analyzed. Human CD3+ T
cells isolated from the tumors of a control group of mice that
received only nontransduced CTLs (15.times.10.sup.6 CTLs; n=4) were
used as a negative control for the analysis of CD3+/GFP+ T cells
within the tumors.
Discussion
[0341] Presented herein are expression vectors expressing suicide
genes suitable for eliminating gene-modified T cells in vivo, in
some embodiments. Suicide gene expression vectors presented herein
have certain non-limiting advantageous features including stable
coexpression in all cells carrying the modifying gene, expression
at levels high enough to elicit cell death, low basal activity,
high specific activity, and minimal susceptibility to endogenous
antiapoptotic molecules. Presented herein, in certain embodiments,
is an inducible caspase 9, iCasp9.sub.M, which has low basal
activity allowing stable expression for more than 4 weeks in human
T cells. A single 10-nM dose of a small molecule chemical inducer
of dimerization (CID) is sufficient to kill more than 99% of
iCasp9.sub.M-transduced cells selected for high transgene
expression both in vitro and in vivo. Moreover, when coexpressed
with Th1 cytokine IL-12, activation of iCasp9.sub.M eliminated all
detectable IL-12-producing cells, even without selection for high
transgene expression. Caspase 9 acts downstream of most
antiapoptotic molecules, therefore a high sensitivity to CID is
preserved regardless of the presence of increased levels of
antiapoptotic molecules of the bcl-2 family. Thus, iCasp9.sub.M
also may prove useful for inducing destruction even of transformed
T cells and memory T cells that are relatively resistant to
apoptosis.
[0342] Unlike other caspase molecules, proteolysis does not appear
sufficient for activation of caspase 9. Crystallographic and
functional data indicate that dimerization of inactive caspase 9
monomers leads to conformational change-induced activation. The
concentration of pro-caspase 9, in a physiologic setting, is in the
range of about 20 nM, well below the threshold needed for
dimerization.
[0343] Without being limited by theory, it is believed the
energetic barrier to dimerization can be overcome by homophilic
interactions between the CARD domains of Apaf-1 and caspase 9,
driven by cytochrome C and ATP. Overexpression of caspase 9 joined
to 2 FKBPs may allow spontaneous dimerization to occur and can
account for the observed toxicity of the initial full length
caspase 9 construct. A decrease in toxicity and an increase in gene
expression was observed following removal of one FKBP, most likely
due to a reduction in toxicity associated with spontaneous
dimerization. While multimerization often is involved in activation
of surface death receptors, dimerization of caspase 9 should be
sufficient to mediate activation. Data presented herein indicates
that iCasp9 constructs with a single FKBP function as effectively
as those with 2 FKBPs. Increased sensitivity to CID by removal of
the CARD domain may represent a reduction in the energetic
threshold of dimerization upon CID binding.
[0344] The persistence and function of virus- or bacteria-derived
lethal genes, such as HSV-TK and cytosine deaminase, can be
impaired by unwanted immune responses against cells expressing the
virus or bacteria derived lethal genes. The FKBPs and proapoptotic
molecules that form the components of iCasp9.sub.M are
human-derived molecules and are therefore less likely to induce an
immune response. Although the linker between FKBP and caspase 9 and
the single point mutation in the FKBP domain introduce novel amino
acid sequences, the sequences were not immunologically recognized
by macaque recipients of iFas-transduced T cells. Additionally,
because the components of iCasp9.sub.M are human-derived molecules,
no memory T cells specific for the junction sequences should be
present in a recipient, unlike virus-derived proteins such as
HSV-TK, thereby reducing the risk of immune response-mediated
elimination of iCasp9.sub.M-transduced T cells.
[0345] Previous studies using inducible Fas or the death effector
domains (DED) of Fas associated death domain proteins (FADD) showed
that approximately 10% of transduced cells were unresponsive to
activation of the destructive gene. As observed in experiments
presented here, a possible explanation for unresponsiveness to CID
is low expression of the transgene. The iCasp9.sub.M-transduced T
cells in our study and iFas-transduced T cells in studies by others
that survived after CID administration had low levels of transgene
expression. In an attempt to overcome a perceived retroviral
"positional effect", increased levels of homogeneous expression of
the transgene were achieved by flanking retroviral integrants with
the chicken beta-globin chromatin insulator. Addition of the
chromatin insulator dramatically increased the homogeneity of
expression in transduced 293T cells, but had no significant effect
in transduced primary T cell. Selection of T cells with high
expression levels minimized variability of response to the
dimerizer. Over 99% of transduced T cells sorted for high GFP
expression were eliminated after a single 10-nM CID dose. This
demonstration supports the hypothesis that cells expressing high
levels of suicide gene can be isolated using a selectable
marker.
[0346] A very small number of resistant residual cells may cause a
resurgence of toxicity, a deletion efficiency of up to 2 logs will
significantly decrease this possibility. For clinical use,
coexpression with a nonimmunogenic selectable marker such as
truncated human NGFR, CD20, or CD34 (e.g., instead of GFP) will
allow for selection of high transgene-expressing T cells.
Coexpression of the suicide switch (e.g., iCASP9.sub.M) and a
suitable selectable marker (e.g., truncated human NGFR, CD20, CD34,
the like and combinations thereof) can be obtained using either an
internal ribosome entry site (IRES) or posttranslational
modification of a fusion protein containing a self-cleaving
sequence (eg, 2A). In contrast, in situations where the sole safety
concern is the transgene-mediated toxicity (eg, artificial T-cell
receptors, cytokines, the like or combinations thereof), this
selection step may be unnecessary, as tight linkage between
iCasp9.sub.M and transgene expression enables elimination of
substantially all cells expressing biologically relevant levels of
the therapeutic transgene. This was demonstrated by coexpressing
iCasp9.sub.M with IL-12. Activation of iCasp9.sub.M substantially
eliminated any measurable IL-12 production. The success of
transgene expression and subsequent activation of the "suicide
switch" may depend on the function and the activity of the
transgene.
[0347] Another possible explanation for unresponsiveness to CID is
that high levels of apoptosis inhibitors may attenuate CID-mediated
apoptosis. Examples of apoptosis inhibitors include c-FLIP, bcl-2
family members and inhibitors of apoptosis proteins (IAPs), which
normally regulate the balance between apoptosis and survival. For
instance, upregulation of c-FLIP and bcl-2 render a subpopulation
of T cells, destined to establish the memory pool, resistant to
activation-induced cell death in response to cognate target or
antigen-presenting cells. In several T-lymphoid tumors, the
physiologic balance between apoptosis and survival is disrupted in
favor of cell survival. A suicide gene should delete substantially
all transduced T cells including memory and malignantly transformed
cells. Therefore, the chosen inducible suicide gene should retain a
significant portion if not substantially all of its activity in the
presence of increased levels of antiapoptotic molecules.
[0348] The apical location of iFas (or iFADD) in the apoptosis
signaling pathway may leave it especially vulnerable to inhibitors
of apoptosis, thus making these molecules less well suited to being
the key component of an apoptotic safety switch. Caspase 3 or 7
would seem well suited as terminal effector molecules, however
neither could be expressed at functional levels in primary human T
cells. Therefore caspase 9, was chosen as the suicide gene, because
capsase 9 functions late enough in the apoptosis pathway that it
bypasses the inhibitory effects of c-FLIP and antiapoptotic bcl-2
family members, and capsase 9 also could be expressed stably at
functional levels. Although X-linked inhibitor of apoptosis (XIAP)
could in theory reduce spontaneous caspase 9 activation, the high
affinity of AP20187 (or AP1903) for FKBP.sub.v36 may displace this
noncovalently associated XIAP. In contrast to iFas, iCasp9.sub.M
remained functional in a transformed T-cell line that overexpresses
antiapoptotic molecules, including bcl-xL.
[0349] Presented herein is an inducible safety switch, designed
specifically for expression from an oncoretroviral vector by human
T cells. iCasp9.sub.M can be activated by AP1903 (or analogs), a
small chemical inducer of dimerization that has proven safe at the
required dose for optimum deletional effect, and unlike ganciclovir
or rituximab has no other biologic effects in vivo. Therefore,
expression of this suicide gene in T cells for adoptive transfer
can increase safety and also may broaden the scope of clinical
applications.
Example 2: Using the iCasp9 Suicide Gene to Improve the Safety of
Allodepleted T Cells after Haploidentical Stem Cell
Transplantation
[0350] Presented in this example are expression constructs and
methods of using the expression constructs to improve the safety of
allodepleted T cells after haploidentical stem cell
transplantation. A retroviral vector encoding iCasp9 and a
selectable marker (truncated CD19) was generated as a safety switch
for donor T cells. Even after allodepletion (using anti-CD25
immunotoxin), donor T cells could be efficiently transduced,
expanded, and subsequently enriched by CD19 immunomagnetic
selection to >90% purity. The engineered cells retained
anti-viral specificity and functionality, and contained a subset
with regulatory phenotype and function. Activating iCasp9 with a
small-molecule dimerizer rapidly produced >90% apoptosis.
Although transgene expression was downregulated in quiescent T
cells, iCasp9 remained an efficient suicide gene, as expression was
rapidly upregulated in activated (alloreactive) T cells.
[0351] Materials and Methods
[0352] Generation of Allodepleted T Cells
[0353] Allodepleted cells were generated from healthy volunteers as
previously presented. Briefly, peripheral blood mononuclear cells
(PBMCs) from healthy donors were co-cultured with irradiated
recipient Epstein Barr virus (EBV)-transformed lymphoblastoid cell
lines (LCL) at responder-to-stimulator ratio of 40:1 in serum-free
medium (AIM V; Invitrogen, Carlsbad, Calif.). After 72 hours,
activated T cells that expressed CD25 were depleted from the
co-culture by overnight incubation in RFT5-SMPT-dgA immunotoxin.
Allodepletion was considered adequate if the residual CD3+CD25
population was <1% and residual proliferation by 3H-thymidine
incorporation was <10%.
Plasmid and Retrovirus
[0354] SFG.iCasp9.2A.CD19 consists of inducible caspase 9 (iCasp9)
linked, via a cleavable 2A-like sequence, to truncated human CD19
(CD19; see FIG. 8A). iCasp9 consists of a human FK5 06-binding
protein (FKBP12; GenBank AH002 818) with an F36V mutation,
connected via a Ser-Gly-Gly-Gly-Ser (SEQ ID NO: 21) linker to human
caspase 9 (CASP9; GenBank NM 001229). The F36V mutation increases
the binding affinity of FKBP12 to the synthetic homodimerizer,
AP20187 or AP1903. The caspase recruitment domain (CARD) has been
deleted from the human caspase 9 sequence because its physiological
function has been replaced by FKBP12, and its removal increases
transgene expression and function. The 2A-like sequence encodes an
20 amino acid peptide from Thosea asigna insect virus, which
mediates >99% cleavage between a glycine and terminal proline
residue, resulting in 19 extra amino acids in the C terminus of
iCasp9, and one extra proline residue in the N terminus of CD19.
CD19 consists of full-length CD19 (GenBank NM 001770) truncated at
amino acid 333 (TDPTRRF) (SEQ ID NO: 22), which shortens the
intracytoplasmic domain from 242 to 19 amino acids, and removes all
conserved tyrosine residues that are potential sites for
phosphorylation.
[0355] A stable PG13 clone producing Gibbon ape leukemia virus
(Gal-V) pseudotyped retrovirus was made by transiently transfecting
Phoenix Eco cell line (ATCC product # SD3444; ATCC, Manassas, Va.)
with SFG.iCasp9.2A.CD19. This produced Eco-pseudotyped retrovirus.
The PG13 packaging cell line (ATCC) was transduced three times with
Eco-pseudotyped retrovirus to generate a producer line that
contained multiple SFG.iCasp9.2A.CD19 proviral integrants per cell.
Single cell cloning was performed, and the PG13 clone that produced
the highest titer was expanded and used for vector production.
[0356] Retroviral Transduction
[0357] Culture medium for T cell activation and expansion consisted
of 45% RPMI 1640 (Hyclone, Logan, Utah), 45% Clicks (Irvine
Scientific, Santa Ana, Calif.) and 10% fetal bovine serum (FBS;
Hyclone). Allodepleted cells were activated by immobilized anti-CD3
(OKT3; Ortho Biotech, Bridgewater, N.J.) for 48 hours before
transduction with retroviral vector (see FIG. 8B). FIG. 8B presents
an overview of the process for production of the "final cell
product" that express the transduced transgene. Selective
allodepletion was performed by co-culturing donor PBMC with
recipient EBV-LCL to activate alloreactive cells: activated cells
expressed CD25 and were subsequently eliminated by anti-CD25
immunotoxin. The allodepleted cells were activated by OKT3 and
transduced with the retroviral vector 48 hours later.
Immunomagnetic selection was performed on day 4 of transduction;
the positive fraction was expanded for a further 4 days and
cryopreserved.
[0358] In small-scale experiments, non-tissue culture-treated
24-well plates (Becton Dickinson, San Jose, Calif.) were coated
with OKT3 1 g/ml for 2 to 4 hours at 37.degree. C. Allodepleted
cells were added at 1.times.10.sup.6 cells per well. At 24 hours,
100 U/ml of recombinant human interleukin-2 (IL-2) (Proleukin;
Chiron, Emeryville, Calif.) was added. Retroviral transduction was
performed 48 hours after activation. Non-tissue culture-treated
24-well plates were coated with 3.5 .mu.g/cm.sup.2 recombinant
fibronectin fragment (CH-296; Retronectin; Takara Mirus Bio,
Madison, Wis.) and the wells loaded twice with retroviral
vector-containing supernatant at 0.5 ml per well for 30 minutes at
37.degree. C., following which OKT3-activated cells were plated at
5.times.10.sup.5 cells per well in fresh retroviral
vector-containing supernatant and T cell culture medium at a ratio
of 3:1, supplemented with 100 U/ml IL-2. Cells were harvested after
2 to 3 days and expanded in the presence of 50 U/ml IL-2.
[0359] Scaling-Up Production of Gene-Modified Allodepleted
Cells
[0360] Scale-up of the transduction process for clinical
application used non-tissue culture-treated T75 flasks (Nunc,
Rochester, N.Y.), which were coated with 10 ml of OKT3 1 .mu.g/ml
or 10 ml of fibronectin 7 .mu.g/ml at 4.degree. C. overnight.
Fluorinated ethylene propylene bags corona-treated for increased
cell adherence (2PF-0072AC, American Fluoroseal Corporation,
Gaithersburg, Md.) were also used. Allodepleted cells were seeded
in OKT3-coated flasks at 1.times.10.sup.6 cells/ml. 100 U/ml IL-2
was added the next day. For retroviral transduction,
retronectin-coated flasks or bags were loaded once with 10 ml of
retrovirus-containing supernatant for 2 to 3 hours. OKT3-activated
T cells were seeded at 1.times.10.sup.6 cells/ml in fresh
retroviral vector-containing medium and T cell culture medium at a
ratio of 3:1, supplemented with 100 U/ml IL-2. Cells were harvested
the following morning and expanded in tissue-culture treated T75 or
T175 flasks in culture medium supplemented with between about 50 to
100 U/ml IL-2 at a seeding density of between about 5.times.10
cells/ml to 8.times.10.sup.5 cells/ml.
[0361] CD 19 Immunomagnetic Selection
[0362] Immunomagnetic selection for CD19 was performed 4 days after
transduction. Cells were labeled with paramagnetic microbeads
conjugated to monoclonal mouse anti-human CD19 antibodies (Miltenyi
Biotech, Auburn, Calif.) and selected on MS or LS columns in small
scale experiments and on a CliniMacs Plus automated selection
device in large scale experiments. CD19-selected cells were
expanded for a further 4 days and cryopreserved on day 8 post
transduction. These cells were referred to as "gene-modified
allodepleted cells".
[0363] Immunophenotyping and Pentamer Analysis
[0364] Flow cytometric analysis (FACSCalibur and CellQuest
software; Becton Dickinson) was performed using the following
antibodies: CD3, CD4, CD8, CD19, CD25, CD27, CD28, CD45RA, CD45RO,
CD56 and CD62L. CD19-PE (Clone 4G7; Becton Dickinson) was found to
give optimum staining and was used in all subsequent analysis. A
Non-transduced control was used to set the negative gate for CD19.
An HLA-pentamer, HLA-B8-RAKFKQLL (SEQ ID NO: 20) (Proimmune,
Springfield, Va.) was used to detect T cells recognizing an epitope
from EBV lytic antigen (BZLF1). HLA-A2-NLVPMVATV pentamer (SEQ ID
NO: 23) was used to detect T cells recognizing an epitope from
CMV-pp65 antigen.
[0365] Interferon--ELISPOT Assay for Anti-Viral Response
[0366] Interferon--ELISPOT for assessment of responses to EBV, CMV
and adenovirus antigens was performed using known methods.
Gene-modified allodepleted cells cryopreserved at 8 days post
transduction were thawed and rested overnight in complete medium
without IL-2 prior to use as responder cells. Cryopreserved PBMCs
from the same donor were used as comparators. Responder cells were
plated in duplicate or triplicate in serial dilutions of
2.times.10.sup.5, 1.times.10.sup.5, 5.times.10.sup.4 and
2.5.times.10.sup.4 cells per well. Stimulator cells were plated at
1.times.10.sup.5 per well. For response to EBV, donor-derived
EBV-LCLs irradiated at 40 Gy were used as stimulators. For response
to adenovirus, donor-derived activated monocytes infected with
Ad5f35 adenovirus were used.
[0367] Briefly, donor PBMCs were plated in X-Vivo 15 (Cambrex,
Walkersville, Md.) in 24-well plates overnight, harvested the next
morning, infected with Ad5f35 at a multiplicity of infection (MOI)
of 200 for 2 hours, washed, irradiated at 30 Gy, and used as
stimulators. For anti-CMV response, a similar process using Ad5f35
adenovirus encoding the CMV pp65 transgene (Ad5f35-pp65) at an MOI
of 5000 was used. Specific spot-forming units (SFU) were calculated
by subtracting SFU from responder-alone and stimulator-alone wells
from test wells. Response to CMV was the difference in SFU between
Ad5f35-pp65 and Ad5f35 wells.
[0368] EB V-Specific Cytotoxicity
[0369] Gene-modified allodepleted cells were stimulated with 40
Gy-irradiated donor-derived EBVLCL at a responder: stimulator ratio
of 40:1. After 9 days, the cultures were restimulated at a
responder: stimulator ratio of 4:1. Restimulation was performed
weekly as indicated. After two or three rounds of stimulation,
cytotoxicity was measured in a 4-hour 51 Cr-release assay, using
donor EBV-LCL as target cells and donor OKT3 blasts as autologous
controls. NK activity was inhibited by adding 30-fold excess of
cold K562 cells.
[0370] Induction of Apoptosis with Chemical Inducer of
Dimerization, AP20187
[0371] Suicide gene functionality was assessed by adding a small
molecule synthetic homodimerizer, AP20187 (Ariad Pharmaceuticals;
Cambridge, Mass.), at 10 nM final concentration the day following
CD19 immunomagnetic selection. Cells were stained with annexin V
and 7-amino-actinomycin (7-AAD)(BD Pharmingen) at 24 hours and
analyzed by flow cytometry. Cells negative for both Annexin V and
7-AAD were considered viable, cells that were annexin V positive
were apoptotic, and cells that were both annexin V and 7-AAD
positive were necrotic. The percentage killing induced by
dimerization was corrected for baseline viability as follows:
Percentage killing=100%-(% Viability in AP20187-treated cells/%
Viability in nontreated cells).
[0372] Assessment of Transgene Expression Following Extended
Culture and Reactivation
[0373] Cells were maintained in T cell medium containing 50 U/ml
IL-2 until 22 days after transduction. A portion of cells was
reactivated on 24-well plates coated with 1 g/ml OKT3 and 1
.mu.g/ml anti-CD28 (Clone CD28.2, BD Pharmingen, San Jose, Calif.)
for 48 to 72 hours. CD19 expression and suicide gene function in
both reactivated and non-reactivated cells were measured on day 24
or 25 post transduction.
[0374] In some experiments, cells also were cultured for 3 weeks
post transduction and stimulated with 30G-irradiated allogeneic
PBMC at a responder:stimulator ratio of 1:1. After 4 days of
co-culture, a portion of cells was treated with 10 nM AP20187.
Killing was measured by annexin V/7-AAD staining at 24 hours, and
the effect of dimerizer on bystander virus-specific T cells was
assessed by pentamer analysis on AP20187-treated and untreated
cells.
[0375] Regulatory T Cells
[0376] CD4, CD25 and Foxp3 expression was analyzed in gene-modified
allodepleted cells using flow cytometry. For human Foxp3 staining,
the eBioscience (San Diego, Calif.) staining set was used with an
appropriate rat IgG2a isotype control. These cells were co-stained
with surface CD25-FITC and CD4-PE. Functional analysis was
performed by co-culturing CD4.sup.+25.sup.+ cells selected after
allodepletion and gene modification with carboxyfluorescein
diacetate N-succinimidyl ester (CFSE)-labeled autologous PBMC.
CD4.sup.+25.sup.+ selection was performed by first depleting
CD8.sup.+ cells using anti-CD 8 microbeads (Miltenyi Biotec,
Auburn, Calif.), followed by positive selection using anti-CD25
microbeads (Miltenyi Biotec, Auburn, Calif.). CFSE-labeling was
performed by incubating autologous PBMC at 2.times.10.sup.7/ml in
phosphate buffered saline containing 1.5 .mu.M CFSE for 10 minutes.
The reaction was stopped by adding an equivalent volume of FBS and
incubating for 10 minutes at 37.degree. C. Cells were washed twice
before use. CFSE-labeled PBMCs were stimulated with OKT3 500 ng/ml
and 40G-irradiated allogeneic PBMC feeders at a PBMC: allogeneic
feeder ratio of 5:1. The cells were then cultured with or without
an equal number of autologous CD4.sup.+25.sup.+ gene-modified
allodepleted cells. After 5 days of culture, cell division was
analyzed by flow cytometry; CD19 was used to gate out
non-CFSE-labeled CD4.sup.+CD25.sup.+ gene-modified T cells.
[0377] Statistical Analysis
[0378] Paired, 2-tailed Student's t test was used to determine the
statistical significance of differences between samples. All data
are represented as mean.+-.1 standard deviation.
[0379] Results
[0380] Selectively Allodepleted T Cells can be Efficiently
Transduced with iCasp9 and Expanded
[0381] Selective allodepletion was performed in accordance with
clinical protocol procedures. Briefly, 3/6 to 5/6 HLA-mismatched
PBMC and lymphoblastoid cell lines (LCL) were co-cultured.
RFT5-SMPT-dgA immunotoxin was applied after 72 hours of co-culture
and reliably produced allodepleted cells with <10% residual
proliferation (mean 4.5.+-.2.8%; range 0.74 to 9.1%; 10
experiments) and containing <1% residual CD3+CD25' cells (mean
0.23.+-.0.20%; range 0.06 to 0.73%; 10 experiments), thereby
fulfilling the release criteria for selective allodepletion, and
serving as starting materials for subsequent manipulation.
[0382] Allodepleted cells activated on immobilized OKT3 for 48
hours could be efficiently transduced with Gal-V pseudotyped
retrovirus vector encoding SFG.iCasp9.2A.CD19. Transduction
efficiency assessed by FACS analysis for CD19 expression 2 to 4
days after transduction was about 53%.+-.8%, with comparable
results for small-scale (24-well plates) and large-scale (T75
flasks) transduction (about 55.+-.8% versus about 50%.+-.10% in 6
and 4 experiments, respectively). Cell numbers contracted in the
first 2 days following OKT3 activation such that only about
61%.+-.12% (range of about 45% to 80%) of allodepleted cells were
recovered on the day of transduction (see FIG. 9). Illustrated in
FIG. 9 are graphical results of experiments performed to determine
if allodepleted cells could be successfully expanded following
transduction. Black diamonds denote large scale experiments
performed in flasks and bags. Open circles denote small-scale
experiments performed in 24 well plates. Thereafter, the cells
showed significant expansion, with a mean expansion in the range of
about 94.+-.46-fold (range of about 40 to about 153) over the
subsequent 8 days, resulting in a net 58.+-.33-fold expansion. Cell
expansion in both small- and large-scale experiments was similar,
with net expansion of about 45.+-.29 fold (range of about 25 to
about 90) in 5 small-scale experiments and about 79.+-.34 fold
(range of about 50 to about 116) in 3 large-scale experiments.
[0383] .DELTA.CD19 Enables Efficient and Selective Enrichment of
Transduced Cells on Immunomagnetic Columns
[0384] The efficiency of suicide gene activation sometimes depends
on the functionality of the suicide gene itself, and sometimes on
the selection system used to enrich for gene-modified cells. The
use of CD19 as a selectable marker was investigated to determine if
CD19 selection enabled the selection of gene-modified cells with
sufficient purity and yield, and whether selection had any
deleterious effects on subsequent cell growth. Small-scale
selection was performed according to manufacturer's instruction;
however, it was determined that large-scale selection was optimum
when 101 of CD19 microbeads was used per 1.3.times.10.sup.7 cells.
FACS analysis was performed at 24 hours after immunomagnetic
selection to minimize interference from anti-CD19 microbeads. The
purity of the cells after immunomagnetic selection was consistently
greater than 90%: mean percentage of CD19+ cells was in the range
of about 98.3%.+-.0.5% (n=5) in small-scale selections and in the
range of about 97.4%.+-.0.9% (n=3) in large-scale CliniMacs
selections (see FIG. 10). Shown in FIG. 10 are representative FACS
analysis traces of the immunomagnetic selection performed 2 days
post-transduction.
[0385] The absolute yield of small- and large-scale selections were
about 31%.+-.11% and about 28%.+-.6%, respectively; after
correction for transduction efficiency. The mean recovery of
transduced cells was about 54%.+-.14% in small-scale and about
72%.+-.18% in large-scale selections. The selection process did not
have any discernable deleterious effect on subsequent cell
expansion. In 4 experiments, the mean cell expansion over 3 days
following CD19 immunomagnetic selection was about 3.5 fold for the
CD19 positive fraction versus about 4.1 fold for non-selected
transduced cells (p=0.34) and about 3.7 fold for non-transduced
cells (p=0.75).
[0386] Immunophenotype of Gene-Modified Allodepleted Cells
[0387] The final cell product (gene-modified allodepleted cells
that had been cryopreserved 8 days after transduction) was
immunophenotyped and was found to contain both CD4 and CD8 cells,
with CD8 cells predominant, at 62%.+-.11% CD8.sup.+ versus
23%.+-.8% CD4.sup.+, as shown in the table below. NS=not
significant, SD=standard deviation.
TABLE-US-00003 Unmanipulated Gene-modified PBMC allodepleted cells
(mean % .+-. SD) (mean % .+-. SD) T cells: Total CD3.sup.+ 82 .+-.
6 95 .+-. 6 NS CD3+ 4+ 54 .+-. 5 23 .+-. 8 p < 0.01 CD3+ 8+ 26
.+-. 9 62 .+-. 11 p < 0.001 NK cells: CD3.sup.- 56+ 6 .+-. 3 2
.+-. 1 NS Memory phenotype CD45RA.sup.+ 66 .+-. 3 10 .+-. 5 p <
0.001 CD45RO.sup.+ 26 .+-. 2 78 .+-. 7 p < 0.001 CD45RA.sup.-
CD62L.sup.+ 19 .+-. 1 24 .+-. 7 NS CD45RA.sup.- CD62L.sup.- 9 .+-.
1 64 .+-. 7 p < 0.001 CD27.sup.+ CD28.sup.+ 67 .+-. 7 19 .+-. 9
p < 0.001 CD27.sup.+ CD28.sup.- 7 .+-. 3 9 .+-. 4 NS CD27.sup.-
CD28.sup.+ 4 .+-. 1 19 .+-. 8 p < 0.05 CD27.sup.- CD28.sup.- 22
.+-. 8 53 .+-. 18 p < 0.05
[0388] The majority of cells were CD45RO.sup.+ and had the surface
immunophenotype of effector memory T cells. Expression of memory
markers, including CD62L, CD27 and CD28, was heterogeneous.
Approximately 24% of cells expressed CD62L, a lymph node-homing
molecule predominantly expressed on central memory cells.
[0389] Gene-Modified Allodepleted Cells Retained Antiviral
Repertoire and Functionality
[0390] The ability of end-product cells to mediate antiviral
immunity was assessed by interferon-ELISPOT, cytotoxicity assay,
and pentamer analysis. The cryopreserved gene-modified allodepleted
cells were used in all analyses, since they were representative of
the product currently being evaluated for use in a clinical study.
Interferon-.gamma. secretion in response to adenovirus, CMV or EBV
antigens presented by donor cells was preserved although there was
a trend towards reduced anti-EBV response in gene-modified
allodepleted cells versus unmanipulated PBMC (see FIG. 11A).
Illustrated in FIG. 11A are the results of the interferon secretion
studies. The response to viral antigens was assessed by ELISPOT in
4 pairs of unmanipulated PBMC and gene-modified allodepleted cells
(GMAC). Adenovirus and CMV antigens were presented by donor-derived
activated monocytes through infection with Ad5f35 null vector and
Ad5f35-pp65 vector, respectively. EBV antigens were presented by
donor EBV-LCL. The number of spot-forming units (SFU) were
corrected for stimulator- and responder-alone wells. Only three of
four donors were evaluable for CMV response, one seronegative donor
was excluded. In FIG. 11A the horizontal bars represent the
median.
[0391] Cytotoxicity was assessed using donor-derived EBV-LCL as
targets. Gene-modified allodepleted cells that had undergone 2 or 3
rounds of stimulation with donor-derived EBV-LCL could efficiently
lyse virus-infected autologous target cells (see FIG. 11B).
Presented in FIG. 11B are the results of the cytotoxicity assay.
Gene-modified allodepleted cells were stimulated with donor EBV-LCL
for 2 or 3 cycles. .sup.51Cr release assay was performed using
donor-derived EBV-LCL and donor OKT3 blasts as targets. NK activity
was blocked with 30-fold excess cold K562. The left panel shows
results from 5 independent experiments using totally or partially
mismatched donor-recipient pairs. The right panel shows results
from 3 experiments using unrelated HLA haploidentical
donor-recipient pairs. Error bars indicate standard deviation.
[0392] EBV-LCLs were used as antigen-presenting cells during
selective allodepletion, therefore it was possible that
EBV-specific T cells could be significantly depleted when the donor
and recipient were haploidentical. To investigate this hypothesis,
three experiments using unrelated HLA-haploidentical
donor-recipient pairs were included, and the results showed that
cytotoxicity against donor-derived EBV-LCL was retained. The
results were corroborated by pentamer analysis for T cells
recognizing HLA-B8-RAKFKQLL (SEQ ID NO: 20), an EBV lytic antigen
(BZLF1) epitope, in two informative donors following allodepletion
against HLA-B8 negative haploidentical recipients (see FIG. 11C).
FIG. 11C illustrates the frequency of T cells specific for the
BZLF1 epitope. Unmanipulated PBMC were used as comparators. The
RAK-pentamer positive population was retained in gene-modified
allodepleted cells and could be expanded following several rounds
of in vitro stimulation with donor-derived EBV-LCL. The percentages
shown in graph presented in FIG. 11C indicate percentage of
pentamer positive cells within the CD8 population. Together, these
results indicate that gene-modified allodepleted cells retained
significant anti-viral functionality.
[0393] Regulatory T Cells in the Gene-Modified Allodepleted Cell
Population
[0394] Flow cytometry and functional analysis were used to
determine whether regulatory T cells were retained in our
allodepleted, gene modified, T cell product. A Foxp3+CD4+25+
population was found, as shown in FIG. 12A. Following
immunomagnetic separation, the CD4+CD25 enriched fraction
demonstrated suppressor function when co-cultured with CFSE-labeled
autologous PBMC in the presence of OKT3 and allogeneic feeders (see
FIG. 12B). FIG. 12B illustrates the results of a CD4+CD25
functional assay. Donor-derived PBMC was labeled with CFSE and
stimulated with OKT3 and allogeneic feeders. CD4+CD25+ cells were
immunomagnetically selected from the gene-modified cell population
and added at 1:1 ratio to test wells. Flow cytometry was performed
after 5 days. Gene-modified T cells were gated out by CD19
expression. The addition of CD4+CD25+ gene-modified cells (bottom
panel) significantly reduced cell proliferation. Thus, allodepleted
T cells may reacquire regulatory phenotype even after exposure to a
CD25 depleting immunotoxin.
[0395] Gene-Modified Allodepleted Cells were Efficiently and
Rapidly Eliminated by Addition of Chemical Inducer of
Dimerization
[0396] The day following immunomagnetic selection, 10 nM of the
chemical inducer of dimerization, AP20187, was added to induce
apoptosis, which appeared within 24 hours. FACS analysis with
annexin V and 7-AAD staining at 24 hours showed that only about
5.5%.+-.2.5% of AP20187-treated cells remained viable, whereas
about 81.0%.+-.9.0% of untreated cells were viable (see FIG. 13A).
Killing efficiency after correction for baseline viability was
about 92.9%.+-.3.8%. Large-scale CD19 selection produced cells that
were killed with similar efficiency as small-scale selection: mean
viability with and without AP20187, and percentage killing, in
large and small scale were about 3.9%, about 84.0%, about 95.4%
(n=3) and about 6.6%, about 79.3%, about 91.4% (n=5) respectively.
AP20187 was non-toxic to non-transduced cells: viability with and
without AP20187 was about 86%.+-.9% and 87%.+-.8% respectively
(n=6).
[0397] Transgene Expression and Function Decreased with Extended
Culture but were Restored Upon Cell Reactivation
[0398] To assess the stability of transgene expression and
function, cells were maintained in T cell culture medium and low
dose IL-2 (50 U/ml) until 24 days after transduction. A portion of
cells was then reactivated with OKT3/anti-CD28. CD19 expression was
analyzed by flow cytometry 48 to 72 hours later, and suicide gene
function was assessed by treatment with 10 nM AP20187. The results
shown in FIG. 13B are for cells from day 5 post transduction (ie, 1
day after CD 19 selection) and day 24 post transduction, with or
without 48-72 hours of reactivation (5 experiments). In 2
experiments, CD25 selection was performed after OKT3/aCD28
activation to further enrich activated cells. Error bars represent
standard deviation. * indicates p<0.05 when compared to cells
from day 5 post transduction. By day 24, surface CD19 expression
fell from about 98%.+-.1% to about 88%.+-.4% (p<0.05) with a
parallel decrease in mean fluorescence intensity (MFI) from
793.+-.128 to 478.+-.107 (p<0.05) (see FIG. 13B). Similarly,
there was a significant reduction in suicide gene function:
residual viability was 19.6.+-.5.6% following treatment with
AP20187; after correction for baseline viability of 54.8.+-.20.9%,
this equated to killing efficiency of only 63.1.+-.6.2%.
[0399] To determine whether the decrease in transgene expression
with time was due to reduced transcription following T cell
quiescence or to elimination of transduced cells, a portion of
cells were reactivated on day 22 post transduction with OKT3 and
anti-CD28 antibody. At 48 to 72 hours (day 24 or 25 post
transduction), OKT3/aCD28-reactivated cells had significantly
higher transgene expression than non-reactivated cells. CD19
expression increased from about 88%.+-.4% to about 93%.+-.4%
(p<0.01) and CD19 MFI increased from 478.+-.107 to 643.+-.174
(p<0.01). Additionally, suicide gene function also increased
significantly from about a 63.1%.+-.6.2% killing efficiency to
about a 84.6%.+-.8.0% (p<0.01) killing efficiency. Furthermore,
killing efficiency was completely restored if the cells were
immunomagnetically sorted for the activation marker CD25: killing
efficiency of CD25 positive cells was about 93%.2.+-.1.2%, which
was the same as killing efficiency on day 5 post transduction
(93.1.+-.3.5%) (see FIGS. 13CA and 13CB). Killing of the CD25
negative fraction was 78.6.+-.9.1%. Illustrated in FIGS. 13CA and
13CB are representative FACS plots showing the effect of extended
culture and T cell activation on suicide gene function.
[0400] An observation of note was that many virus-specific T cells
were spared when dimerizer was used to deplete gene-modified cells
that have been re-activated with allogeneic PBMC, rather than by
non-specific mitogenic stimuli. After 4 days reactivation with
allogeneic cells, as shown in FIGS. 14A and 14B, treatment with
AP20187 spares (and thereby enriches) viral reactive
subpopulations, as measured by the proportion of T cells reactive
with HLA pentamers specific for peptides derived from EBV and CMV.
Gene-modified allodepleted cells were maintained in culture for 3
weeks post-transduction to allow transgene down-modulation. Cells
were stimulated with allogeneic PBMC for 4 days, following which a
portion was treated with 10 nM AP20187. The frequency of
EBV-specific T cells (see FIG. 14A) and CMV-specific T cells (see
FIG. 14B) were quantified by pentamer analysis before
allostimulation, after allostimulation, and after treatment of
allostimulated cells with dimerizer. The percentage of
virus-specific T cells decreased after allostimulation. Following
treatment with dimerizer, virus-specific T cells were partially and
preferentially retained.
[0401] Discussion
[0402] The feasibility of engineering allogeneic T cells with two
distinct safety mechanisms, selective allodepletion and suicide
gene-modification has been demonstrated herein. In combination,
these modifications can enhance and/or enable addback of
substantial numbers of T cells with anti-viral and anti-tumor
activity, even after haploidentical transplantation. The data
presented herein show that the suicide gene, iCasp9, functions
efficiently (>90% apoptosis after treatment with dimerizer) and
that down-modulation of transgene expression that occurred with
time was rapidly reversed upon T cell activation, as would occur
when alloreactive T cells encountered their targets. Data presented
herein also show that CD19 is a suitable selectable marker that
enabled efficient and selective enrichment of transduced cells to
>90% purity. Furthermore the data presented herein indicate that
these manipulations had no discernable effects on the immunological
competence of the engineered T cells with retention of antiviral
activity, and regeneration of a CD4.sup.+CD25Foxp3 population with
Treg activity.
[0403] Given that the overall functionality of suicide genes
depends on both the suicide gene itself and the marker used to
select the transduced cells, translation into clinical use requires
optimization of both components, and of the method used to couple
expression of the two genes. The two most widely used selectable
markers, currently in clinical practice, each have drawbacks.
Neomycin phosphotransferase (neo) encodes a potentially immunogenic
foreign protein and requires a 7-day culture in selection medium,
which not only increases the complexity of the system, but is also
potentially damaging to virus-specific T cells. A widely used
surface selection marker, LNGFR, has recently had concerns raised,
regarding its ocogenic potential and potential correlation with
leukemia, in a mouse model, despite its apparent clinical safety.
Furthermore, LNGFR selection is not widely available, because it is
used almost exclusively in gene therapy. A number of alternative
selectable markers have been suggested. CD34 has been well-studied
in vitro, but the steps required to optimize a system configured
primarily for selection of rare hematopoietic progenitors, and more
critically, the potential for altered in vivo T cell homing, make
CD34 sub-optimal for use as a selectable marker for a suicide
switch expression construct. CD19 was chosen as an alternative
selectable marker, since clinical grade CD19 selection is readily
available as a method for B-cell depletion of stem cell autografts.
The results presented herein demonstrated that CD19 enrichment
could be performed with high purity and yield and, furthermore, the
selection process had no discernable effect on subsequent cell
growth and functionality.
[0404] The effectiveness of suicide gene activation in
CD19-selected iCasp9 cells compared very favorably to that of neo-
or LNGFR-selected cells transduced to express the HSVtk gene. The
earlier generations of HSVtk constructs provided 80-90% suppression
of .sup.3H-thymidine uptake and showed similar reduction in killing
efficiency upon extended in vitro culture, but were nonetheless
clinically efficacious. Complete resolution of both acute and
chronic GVHD has been reported with as little as 80% in vivo
reduction in circulating gene-modified cells. These data support
the hypothesis that transgene down-modulation seen in vitro is
unlikely to be an issue because activated T cells responsible for
GVHD will upregulate suicide gene expression and will therefore be
selectively eliminated in vivo. Whether this effect is sufficient
to allow retention of virus- and leukemia-specific T cells in vivo
will be tested in a clinical setting. By combining in vitro
selective allodepletion prior to suicide gene modification, the
need to activate the suicide gene mechanism may be significantly
reduced, thereby maximizing the benefits of addback T cell based
therapies.
[0405] The high efficiency of iCasp9-mediated suicide seen in vitro
has been replicated in vivo. In a SCID mouse-human xenograft model,
more than 99% of iCasp9-modified T cells were eliminated after a
single dose of dimerizer. AP1903, which has extremely close
functional and chemical equivalence to AP20187, and currently is
proposed for use in a clinical application, has been safety tested
on healthy human volunteers and shown to be safe. Maximal plasma
level of between about 10 ng/ml to about 1275 ng/ml AP1903
(equivalent to between about 7 nM to about 892 nM) was attained
over a 0.01 mg/kg to 1.0 mg/kg dose range administered as a 2-hour
intravenous infusion. There were substantially no significant
adverse effects. After allowing for rapid plasma redistribution,
the concentration of dimerizer used in vitro remains readily
achievable in vivo.
[0406] Optimal culture conditions for maintaining the immunological
competence of suicide gene-modified T cells must be determined and
defined for each combination of safety switch, selectable marker
and cell type, since phenotype, repertoire and functionality can
all be affected by the stimulation used for polyclonal T cell
activation, the method for selection of transduced cells, and
duration of culture. The addition of CD28 co-stimulation and the
use of cell-sized paramagnetic beads to generate gene
modified-cells that more closely resemble unmanipulated PBMC in
terms of CD4:CD8 ratio, and expression of memory subset markers
including lymph node homing molecules CD62L and CCR7, may improve
the in vivo functionality of gene-modified T cells. CD28
co-stimulation also may increase the efficiency of retroviral
transduction and expansion. Interestingly however, the addition of
CD28 co-stimulation was found to have no impact on transduction of
allodepleted cells, and the degree of cell expansion demonstrated
was higher when compared to the anti-CD3 alone arm in other
studies. Furthermore, iCasp9-modified allodepleted cells retained
significant anti-viral functionality, and approximately one fourth
retained CD62L expression. Regeneration of
CD4.sup.+CD25.sup.+Foxp3.sup.+ regulatory T cells, was also seen.
The allodepleted cells used as the starting material for T cell
activation and transduction may have been less sensitive to the
addition of anti-CD28 antibody as co-stimulation. CD25-depleted
PBMC/EBV-LCL co-cultures contained T cells and B cells that already
express CD86 at significantly higher level than unmanipulated PBMC
and may themselves provide co-stimulation. Depletion of CD25
regulatory T cells prior to polyclonal T cell activation with
anti-CD3 has been reported to enhance the immunological competence
of the final T cell product. In order to minimize the effect of in
vitro culture and expansion on functional competence, a relatively
brief culture period was used in some experiments presented herein,
whereby cells were expanded for a total of 8 days post-transduction
with CD19-selection being performed on day 4.
[0407] Finally, scaled up production was demonstrated such that
sufficient cell product can be produced to treat adult patients at
doses of up to 10' cells/kg: allodepleted cells can be activated
and transduced at 4.times.10.sup.7 cells per flask, and a minimum
of 8-fold return of CD19-selected final cell product can be
obtained on day 8 post-transduction, to produce at least
3.times.10.sup.8 allodepleted gene-modified cells per original
flask. The increased culture volume is readily accomodated in
additional flasks or bags.
[0408] The allodepletion and iCasp9-modification presented herein
may significantly improve the safety of adding back T cells,
particularly after haploidentical stem cell allografts. This should
in turn enable greater dose-escalation, with a higher chance of
producing an anti-leukemia effect.
Example 3: CASPALLO--Phase I Clinical Trial of Allodepleted T Cells
Transduced with Inducible Caspase 9 Suicide Gene after
Haploidentical Stem Cell Transplantation
[0409] This example presents results of a phase 1 clinical trial
using the alternative suicide gene strategy illustrated in FIG. 22.
Briefly, donor peripheral blood mononuclear cells were co-cultured
with recipient irradiated EBV-transformed lymphoblastoid cells
(40:1) for 72 hrs, allodepleted with a CD25 immunotoxin and then
transduced with a retroviral supernatant carrying the iCasp9
suicide gene and a selection marker (.DELTA.CD19); .DELTA.CD19
allowed enrichment to >90% purity via immunomagnetic selection.,
as illustrated in FIG. 23.
[0410] A detailed protocol for generation of the cell therapy
product is provided herein.
[0411] Source Material
[0412] Up to 240 ml (in 2 collections) of peripheral blood was
obtained from the transplant donor according to established
protocols. In some cases, dependent on the size of donor and
recipient, a leukopheresis was performed to isolate sufficient T
cells. 10 cc-30 cc of blood also was drawn from the recipient and
was used to generate the Epstein Barr virus (EBV)-transformed
lymphoblastoid cell line used as stimulator cells. In some cases,
dependent on the medical history and/or indication of a low B cell
count, the LCLs were generated using appropriate 1st degree
relative (e.g., parent, sibling, or offspring) peripheral blood
mononuclear cells.
[0413] Generation of Allodepleted Cells
[0414] Allodepleted cells were generated from the transplant donors
as presented herein. Peripheral blood mononuclear cells (PBMCs)
from healthy donors were co-cultured with irradiated recipient
Epstein Barr virus (EBV)-transformed lymphoblastoid cell lines
(LCL) at responder-to-stimulator ratio of 40:1 in serum-free medium
(AIM V; Invitrogen, Carlsbad, Calif.). After 72 hours, activated T
cells that express CD25 were depleted from the co-culture by
overnight incubation in RFT5-SMPT-dgA immunotoxin. Allodepletion is
considered adequate if the residual CD3+CD25 population was <1%
and residual proliferation by .sup.3H-thymidine incorporation was
<10%.
[0415] Retroviral Production
[0416] A retroviral producer line clone was generated for the
iCasp9-CD19 construct. A master cell-bank of the producer also was
generated. Testing of the master-cell bank was performed to exclude
generation of replication competent retrovirus and infection by
Mycoplasma, HIV, HBV, HCV and the like. The producer line was grown
to confluency, supernatant harvested, filtered, aliquoted and
rapidly frozen and stored at -80C. Additional testing was performed
on all batches of retroviral supernatant to exclude Replication
Competent Retrovirus (RCR) and issued with a certificate of
analysis, as per protocol.
[0417] Transduction of Allodepleted Cells
[0418] Allodepleted T-lymphocytes were transduced using
Fibronectin. Plates or bags were coated with recombinant
Fibronectin fragment CH-296 (Retronectin.TM., Takara Shuzo, Otsu,
Japan). Virus was attached to retronectin by incubating producer
supernatant in coated plates or bags. Cells were then transferred
to virus coated plates or bags. After transduction allodepleted T
cells were expanded, feeding them with IL-2 twice a week to reach
the sufficient number of cells as per protocol.
[0419] CD19 Immunomagnetic Selection
[0420] Immunomagnetic selection for CD19 was performed 4 days after
transduction. Cells are labeled with paramagnetic microbeads
conjugated to monoclonal mouse anti-human CD19 antibodies (Miltenyi
Biotech, Auburn, Calif.) and selected on a CliniMacs Plus automated
selection device (see FIG. 24). Depending upon the number of cells
required for clinical infusion cells were either cryopreserved
after the CliniMacs selection or further expanded with IL-2 and
cryopreserved on day 6 or day 8 post transduction.
[0421] Freezing
[0422] Aliquots of cells were removed for testing of transduction
efficiency, identity, phenotype and microbiological culture as
required for final release testing by the FDA. The cells were
cryopreserved prior to administration according to protocol.
[0423] Study Drugs
[0424] RFT5-SMPT-dgA
[0425] RFT5-SMPT-dgA is a murine IgG1 anti-CD25 (IL-2 receptor
alpha chain) conjugated via a hetero-bifunctional crosslinker
[N-succinimidyloxycarbonyl-alpha-methyl-d-(2-pyridylthio)
toluene](SMPT) to chemically deglycosylated ricin A chain (dgA).
RFT5-SMPT-dgA is formulated as a sterile solution at 0.5 mg/ml.
[0426] Synthetic Homodimerizer, AP1903
[0427] Mechanism of Action: AP1903-inducible cell death is achieved
by expressing a chimeric protein comprising the intracellular
portion of the human (Caspase 9 protein) receptor, which signals
apoptotic cell death, fused to a drug-binding domain derived from
humanFK506-binding protein (FKBP). This chimeric protein remains
quiescent inside cells until administration of AP1903, which
cross-links the FKBP domains, initiating Caspase signaling and
apoptosis.
[0428] Toxicology: AP1903 has been evaluated as an Investigational
New Drug (IND) by the FDA and has successfully completed a phase I
clinical safety study. No significant adverse effects were noted
when API 903 was administered over a 0.01 mg/kg to 1.0 mglkg dose
range.
[0429] Pharmacology/Pharmacokinetics: Patients received 0.4 mg/kg
of AP1903 as a 2 h infusion-based on published Pk data which show
plasma concentrations of 10 ng/mL-1275 ng/mL over the 0.01 mg/kg to
1.0 mg/kg dose range with plasma levels falling to 18% and 7% of
maximum at 0.5 and 2 hrs post dose.
[0430] Side Effect Profile in Humans: No serious adverse events
occurred during the Phase 1 study in volunteers. The incidence of
adverse events was very low following each treatment, with all
adverse events being mild in severity. Only one adverse event was
considered possibly related to AP1903. This was an episode of
vasodilatation, presented as "facial flushing" for 1 volunteer at
the 1.0 mg/kg AP1903 dosage. This event occurred at 3 minutes after
the start of infusion and resolved after 32 minutes duration. All
other adverse events reported during the study were considered by
the investigator to be unrelated or to have improbable relationship
to the study drug. These events included chest pain, flu syndrome,
halitosis, headache, injection site pain, vasodilatation, increased
cough, rhinitis, rash, gum hemorrhage, and ecchymosis.
[0431] Patients developing grade 1 GVHD were treated with 0.4 mglkg
AP1903 as a 2-hour infusion. Protocols for administration of AP1903
to patients grade 1 GVHD were established as follows. Patients
developing GvHD after infusion of allodepleted T cells are biopsied
to confirm the diagnosis and receive 0.4 mg/kg of AP1903 as a 2 h
infusion. Patients with Grade I GVHD received no other therapy
initially, however if they showed progression of GvHD conventional
GvHD therapy was administered as per institutional guidelines.
Patients developing grades 2-4 GVHD were administered standard
systemic immunosuppressive therapy per institutional guidelines, in
addition to the AP1903 dimerizer drug.
[0432] Instructions for preparation and infusion: AP1903 for
injection is obtained as a concentrated solution of 2.33 ml in a 3
ml vial, at a concentration of 5 mg/mi, (i.e., 10.66 mg per vial).
Prior to administration, the calculated dose was diluted to 100 mL
in 0.9% normal saline for infusion. AP1903 for injection (0.4
mg/kg) in a volume of 100 ml was administered via IV infusion over
2 hours, using a non-DEHP, non-ethylene oxide sterilized infusion
set and infusion pump.
[0433] The iCasp9 suicide gene expression construct (e.g.,
SFG.iCasp9.2A.ACD19), shown in FIG. 25, consists of inducible
caspase 9 (iCasp9) linked, via a cleavable 2A-like sequence, to
truncated human CD19 (ACD19). iCasp9 includes a human FK506-binding
protein (FKBP12; GenBank AH002 818) with an F36V mutation,
connected via a Ser-Gly-Gly-Gly-Ser linker (SEQ ID NO: 21) to human
caspase 9 (CASP9; GenBank NM 001229). The F36V mutation may
increase the binding affinity of FKBP12 to the synthetic
homodimerizer, AP20187 or API903. The caspase recruitment domain
(CARD) has been deleted from the human caspase 9 sequence and its
physiological function has been replaced by FKBP12. The replacement
of CARD with FKBP12 increases transgene expression and function.
The 2A-like sequence encodes an 18 amino acid peptide from Thosea
Asigna insect virus, which mediates >99% cleavage between a
glycine and terminal proline residue, resulting in 17 extra amino
acids in the C terminus of iCasp9, and one extra proline residue in
the N terminus of CD19. .DELTA.CD19 consists of full length CD19
(GenBank NM 001770) truncated at amino acid 333 (TDPTRRF) (SEQ ID
NO: 22), which shortens the intracytoplasmic domain from 242 to 19
amino acids, and removes all conserved tyrosine residues that are
potential sites for phosphorylation. Illustrated in FIG. 26 is the
result of iCasp9 and AP1903 in eliminating gene modified T cells
carrying the iCasp9 suicide switch.
[0434] In Vivo Studies
[0435] Three patients received iCasp9+ T cells after haplo-CD34+
stem cell transplantation (SCT), at dose levels between about
1.times.10.sup.6 to about 3.times.10.sup.6 cells/kg.
[0436] Characteristics of the Patients and Clinical Outcome.
TABLE-US-00004 Disease Days from Number of Sex status at SCT to
T-cell cells infused Acute Clinical Patient # (age (yr)) Diagnosis
SCT infusion per kg GvHD outcome P1 M(3) MDS/AML CR2 63 1 .times.
10.sup.6 Grade1/2 Alive in (skin, liver) CR > 12 months No GvHD
P2 F(17) B-ALL CR2 80 and 112 (1 .times. 10.sup.6)2 Grade 1 Alive
in (skin) CR > 12 months No GvHD P3 M(8) T-ALL PIF/CR1 93 3
.times. 10.sup.6 None Alive in CR > 12 No GvHD P4 F(4) T-ALL
Active 30 3 .times. 10.sup.6 Grade 1 Alive in disease (skin) CR
> 12 No GvHD
[0437] Infused T cells were detected in vivo by flow cytometry
(CD3+.DELTA.CD19+) or qPCR as early as day 7 after infusion, with a
maximum fold expansion of 170.+-.5 (day 29.+-.9 after infusion), as
illustrated in FIGS. 27, 28, and 29. Two patients developed grade
I/II aGVHD (see FIGS. 31-32) and AP1903 administration caused
>90% ablation of CD3+.DELTA.CD19+ cells, within 30 minutes of
infusion (see FIGS. 30, 33, and 34), with a further log reduction
within 24 hours, and resolution of skin and liver aGvHD within 24
hrs (see FIG. 35), showing that iCasp9 transgene was functional in
vivo.
Patients with GvHD (Dose Level 1)
TABLE-US-00005 SCT T cells to GvHD Patient to GvHD (days) GvHD
(days) (grade/site) 1 77 14 2 (liver, skin) 2 124 45/13 2
(skin)
[0438] Ex vivo experiments confirmed this data. Furthermore, the
residual allodepleted T cells were able to expand and were reactive
to viruses (CMV) and fungi (Aspergillus fumigatus) (IFN-.gamma.
production), as shown in FIGS. 36-42. These in vivo studies found
that a single dose of dimerizer drug can reduce or eliminate the
subpopulation of T cells causing GvHD, but can spare virus specific
CTLs, which can then re-expand.
[0439] Immune Reconstitution
[0440] Depending on availability of patient cells and reagents,
immune reconstitution studies (Immunophenotyping, T and B cell
function) may be obtained at serial intervals after transplant.
Several parameters measuring immune reconstitution resulting from
iCaspase transduced allodepleted T cells will be analyzed. The
analysis includes repeated measurements of total lymphocyte counts,
T and CD19 B cell numbers, and FACS analysis of T cell subsets
(CD3, CD4, CD8, CD16, CD19, CD27, CD28, CD44, CD62L, CCR7, CD56,
CD45RA, CD45RO, alpha/beta and gamma/delta T cell receptors).
Depending on the availability of a patients T cells T regulatory
cell markers such as CD41CD251FoxP3 also are analyzed.
Approximately 10-60 ml of patient blood is taken, when possible, 4
hours after infusion, weekly for 1 month, monthly.times.9 months,
and then at 1 and 2 years. The amount of blood taken is dependent
on the size of the recipient and does not exceed 1-2 cc/kg in total
(allowing for blood taken for clinical care and study evaluation)
at any one blood draw.
[0441] Persistence and Safety of Transduced Allodepleted T
Cells
[0442] The following analysis also was performed on the peripheral
blood samples o monitor function, persistence and safety of
transduced T-cells at time-points indicated in the study calendar.
[0443] Phenotype to detect the presence of transgenic cells [0444]
RCR testing by PCR. [0445] Quantitative real-time PCR for detecting
retroviral integrants.
[0446] RCR testing by PCR is performed pre study, at 3, 6, and 12
months, and then yearly for a total of 15 years. Tissue, cell, and
serum samples are archived for use in future studies for RCR as
required by the FDA.
[0447] Statistical Analysis and Stopping rules.
[0448] The MTD is defined to be the dose which causes grade III/IV
acute GVHD in at most 25% of eligible cases. The determination is
based on a modified continual reassessment method (CRM) using a
logistic model with a cohort of size 2. Three dose groups are being
evaluated namely, 1.times.10.sup.6, 3.times.10.sup.6,
1.times.10.sup.7 with prior probabilities of toxicity estimated at
10%, 15%, and 30%, respectively. The proposed CRM design, employs
modifications to the original CRM by accruing more than one subject
in each cohort, limiting dose escalation to no more than one dose
level, and starting patient enrollment at the lowest dose level
shown to be safe for non-transduced cells. Toxicity outcome in the
lowest dose cohort is used to update the dose-toxicity curve. The
next patient cohort is assigned to the dose level with an
associated probability of toxicity closest to the target
probability of 25%. This process continues until at least 10
patients have been accrued into this dose-escalation study.
Depending on patient availability, at most 18 patients may be
enrolled into the Phase I trial or until 6 patients have been
treated at the current MTD. The final MTD will be the dose with
probability closest to the target toxicity rate at these
termination points.
[0449] Simulations were performed to determine the operating
characteristics of the proposed design and compared this with a
standard 3+3 dose-escalation design. The proposed design delivers
better estimates of the MTD based on a higher probability of
declaring the appropriate dose level as the MTD, afforded smaller
number of patients accrued at lower and likely ineffective dose
levels, and maintained a lower average total number of patients
required for the trial. A shallow dose-toxicity curve is expected
over the range of doses proposed herein and therefore accelerated
dose-escalations can be conducted without comprising patient
safety. The simulations performed indicate that the modified CRM
design does not incur a larger average number of total toxicities
when compared to the standard design (total toxicities equal to 1.9
and 2.1, respectively).
[0450] Grade III/IV GVHD that occurs within 45 days after initial
infusion of allodepleted T cells will be factored into the CRM
calculations to determine the recommended dose for the subsequent
cohort. Real-time monitoring of patient toxicity outcome is
performed during the study in order to implement estimation of the
dose-toxicity curve and determine dose level for the next patient
cohort using one of the pre-specified dose levels.
[0451] Treatment limiting toxicities will include
a) grade 4 reactions related to infusion, b) graft failure (defined
as a subsequent decline in the ANC to <5001 mm.sup.3 for three
consecutive measurements on different days, unresponsive to growth
factor therapy that persists for at least 14 days.) occurring
within 30 days after infusion of TC-T c) grade 4 nonhematologic and
noninfectious adverse events, occurring within 30 days after
infusion d) grades 3-4 acute GVHD by 45 days after infusion of TC-T
e) treatment-related death occurring within 30 days after
infusion
[0452] GVHD rates are summarized using descriptive statistics along
with other measures of safety and toxicity. Likewise, descriptive
statistics will be calculated to summarize the clinical and
biologic response in patients who receive AP1903 due to great than
Grade 1 GVHD.
[0453] Several parameters measuring immune reconstitution resulting
from iCaspase transduced allodepleted T cells will be analyzed.
These include repeated measurements of total lymphocyte counts, T
and CD19 B cell numbers, and FACS analysis of T cell subsets (CD3,
CD4, CDS, CD16, CD19, CD27, CD44, CD62L, CCR7, CD56, CD45RA,
CD45RO, alpha/beta and gamma/delta T cell receptors). If sufficient
T cells remain for analysis, T regulatory cell markers such as
CD4/CD25/FoxP3 will also be analyzed. Each subject will be measured
pre-infusion and at multiple time points post-infusion as presented
above.
[0454] Descriptive summaries of these parameters in the overall
patient group and by dose group as well as by time of measurement
will be presented. Growth curves representing measurements over
time within a patient will be generated to visualize general
patterns of immune reconstitution. The proportion of iCasp9
positive cells will also be summarized at each time point. Pairwise
comparisons of changes in these endpoints over time compared to
pre-infusion will be implemented using paired t-tests or Wilcoxon
signed-ranks test.
[0455] Longitudinal analysis of each repeatedly-measured immune
reconstitution parameter using the random coefficients model, will
be performed. Longitudinal analysis allows construction of model
patterns of immune reconstitution per patient while allowing for
varying intercepts and slopes within a patient. Dose level as an
independent variable in the model to account for the different dose
levels received by the patients will also be used. Testing whether
there is a significant improvement in immune function over time and
estimates of the magnitude of these improvements based on estimates
of slopes and its standard error will be possible using the model
presented herein. Evaluation of any indication of differences in
rates of immune reconstitution across different dose levels of CTLs
will also be performed. The normal distribution with an identity
link will be utilized in these models and implemented using SAS
MIXED procedure. The normality assumption of the immune
reconstitution parameters will be assessed and transformations
(e.g. log, square root) can be performed, if necessary to achieve
normality.
[0456] A strategy similar to the one presented above can be
employed to assess kinetics of T cell survival, expansion and
persistence. The ratio of the absolute T cell numbers with the
number of marker gene positive cells will be determined and modeled
longitudinally over time. A positive estimate of the slope will
indicate increasing contribution of T cells for immune recovery.
Virus-specific immunity of the iCasp9 T cells will be evaluated by
analysis of the number of T cells releasing IFN gamma based on
ex-vivo stimulation virus-specific CTLs using longitudinal models.
Separate models will be generated for analysis of EBV, CMV and
adenovirus evaluations of immunity.
[0457] Finally, overall and disease-free survival in the entire
patient cohort will be summarized using the Kaplan-Meier
product-limit method. The proportion of patients surviving and who
are disease-free at 100 days and 1 year post transplant can be
estimated from the Kaplan-Meier curves.
[0458] In conclusion, addback of iCasp9+ allodepleted T cells after
haplo CD34+ SCT allows a significant expansion of functional donor
lymphocytes in vivo and a rapid clearance of alloreactive T cells
with resolution of aGvHD.
Example 4: In Vivo T Cell Allodepletion
[0459] The protocols provided in Examples 1-3 may also be modified
to provide for in vivo T cell allodepletion. To extend the approach
to a larger group of subjects who might benefit from immune
reconstitution without acute GvHD, the protocol may be simplified,
by providing for an in vivo method of T cell depletion. In the
pre-treatment allodepletion method, as discussed herein,
EBV-transformed lymphoblastoid cell lines are first prepared from
the recipient, which then act as alloantigen presenting cells. This
procedure can take up to 8 weeks, and may fail in extensively
pre-treated subjects with malignancy, particularly if they have
received rituximab as a component of their initial therapy.
Subsequently, the donor T cells are co-cultured with recipient
EBV-LCL, and the alloreactive T cells (which express the activation
antigen CD25) are then treated with CD25-ricin conjugated
monoclonal antibody. This procedure may take many additional days
of laboratory work for each subject.
[0460] The process may be simplified by using an in vivo method of
allodepletion, building on the observed rapid in vivo depletion of
alloreactive T cells by dimerizer drug and the sparing of
unstimulated but virus/fungus reactive T cells.
[0461] If there is development of Grade I or greater acute GvHD, a
single dose of dimerizer drug is administered, for example at a
dose of 0.4 mg/kg of AP1903 as a 2 hour intravenous infusion. Up to
3 additional doses of dimerizer drug may be administered at 48 hour
intervals if acute GvHD persists. In subjects with Grade II or
greater acute GvHD, these additional doses of dimerizer drug may be
combined with steroids. For patients with persistent GVHD who
cannot receive additional doses of the dimerizer due to a Grade III
or IV reaction to the dimerizer, the patient may be treated with
steroids alone, after either 0 or 1 doses of the dimerizer.
[0462] Generation of Therapeutic T Cells
[0463] Up to 240 ml (in 2 collections) of peripheral blood is
obtained from the transplant donor according to the procurement
consent. If necessary, a leukapheresis is used to obtain sufficient
T cells; (either prior to stem cell mobilization or seven days
after the last dose of G-CSF). An extra 10-30 mis of blood may also
be collected to test for infectious diseases such as hepatitis and
HIV.
[0464] Peripheral blood mononuclear cells are be activated using
anti-human CD3 antibody (e.g. from Orthotech or Miltenyi) on day 0
and expanded in the presence of recombinant human interleukin-2
(rhIL-2) on day 2. CD3 antibody-activated T cells are transduced by
the iCaspase 9 retroviral vector on flasks or plates coated with
recombinant Fibronectin fragment CH-296 (Retronectin.TM., Takara
Shuzo, Otsu, Japan). Virus is attached to retronectin by incubating
producer supernatant in retronectin coated plates or flasks. Cells
are then transferred to virus coated tissue culture devices. After
transduction T cells are expanded by feeding them with rhIL-2 twice
a week to reach the sufficient number of cells as per protocol.
[0465] To ensure that the majority of infused T cells carry the
suicide gene, a selectable marker, truncated human CD19
(.DELTA.CD19) and a commercial selection device, may be used to
select the transduced cells to >90% purity. Immunomagnetic
selection for CD19 may be performed 4 days after transduction.
Cells are labeled with paramagnetic microbeads conjugated to
monoclonal mouse anti-human CD19 antibodies (Miltenyi Biotech,
Auburn, Calif.) and selected on a CliniMacs Plus automated
selection device. Depending upon the number of cells required for
clinical infusion cells might either be cryopreserved after the
CliniMacs selection or further expanded with IL-2 and cryopreserved
as soon as sufficient cells have expanded (up to day 14 from
product initiation).
[0466] Aliquots of cells may be removed for testing of transduction
efficiency, identity, phenotype, autonomous growth and
microbiological examination as required for final release testing
by the FDA. The cells are be cryopreserved prior to
administration.
[0467] Administration of T Cells
[0468] The transduced T cells are administered to patients from,
for example, between 30 and 120 days following stem cell
transplantation. The cryopreserved T cells are thawed and infused
through a catheter line with normal saline. For children,
premedications are dosed by weight. Doses of cells may range from,
for example, from about 1.times.10.sup.4 cells/Kg to
1.times.10.sup.8 cells/Kg, for example from about 1.times.10.sup.6
cells/Kg to 1.times.10.sup.7 cells/Kg, from about 1.times.10.sup.6
cells/Kg to 5.times.10.sup.6 cells/Kg, from about 1.times.10.sup.4
cells/Kg to 5.times.10.sup.6 cells/Kg, for example, about
1.times.10.sup.4, about 1.times.10.sup.6, about 2.times.10.sup.6,
about 3.times.10.sup.6, about 5.times.10.sup.6, 6.times.10.sup.6,
about 7.times.10.sup.6, about 8.times.10.sup.6, about
9.times.10.sup.6, about 1.times.10.sup.6, about 2.times.10.sup.6,
about 3.times.10.sup.6, about 4.times.10.sup.6, or about
5.times.10.sup.6 cells/Kg.
[0469] Treatment of GvHD
[0470] Patients who develop grade .gtoreq.1 acute GVHD are treated
with 0.4 mg/kg AP1903 as a 2-hour infusion. AP1903 for injection
may be provided, for example, as a concentrated solution of 2.33 ml
in a 3 ml vial, at a concentration of 5 mg/ml, (i.e 10.66 mg per
vial). Prior to administration, the calculated dose will be diluted
to 100 mL in 0.9% normal saline for infusion. AP1903 for Injection
(0.4 mg/kg) in a volume of 100 ml may be administered via IV
infusion over 2 hours, using a non-DEHP, non-ethylene oxide
sterilized infusion set and an infusion pump.
[0471] Sample Treatment Schedule
TABLE-US-00006 Time Donor Recipient Pre-transplant Obtain up to 240
of blood or unstimulated leukapheresis from bone marrow transplant
donor. Prepare T cells and donor LCLs for later immune
reconstitution studies. Day 0 Anti-CD3 activation of PBMC Day 2
IL-2 feed Day 3 Transduction Day 4 Expansion Day 6 CD19 selection.
Cryopreservation (*if required dose is met) Day 8 Assess
transduction efficiency and iCaspase9 transgene functionality by
phenotype. Cryopreservation (*if not yet performed) Day 10 or Day
Cryopreservation (if not yet 12 to Day 14 performed) From 30 to
Thaw and infuse T cells 120 days post 30 to 120 days post
transplant stem cell infusion.
[0472] Other methods may be followed for clinical therapy and
assessment as provided in, for example, Examples 1-3 herein.
Example 5: Using the iCasp9 Suicide Gene to Improve the Safety of
Mesenchymal Stromal Cell Therapies
[0473] Mesenchymal stromal cells (MSCs) have been infused into
hundreds of patients to date with minimal reported deleterious side
effects. The long term side effects are not known due to limited
follow-up and a relatively short time since MSCs have been used in
treatment of disease. Several animal models have indicated that
there exists the potential for side effects, and therefore a system
allowing control over the growth and survival of MSCs used
therapeutically is desirable. The inducible caspase 9 suicide
switch expression vector construct presented herein was
investigated as a method of eliminating MSC's in vivo and in
vitro.
[0474] Materials and Methods
[0475] MSC Isolation
[0476] MSCs were isolated from healthy donors. Briefly,
post-infusion discarded healthy donor bone marrow collection bags
and filters were washed with RPMI 1640 (HyClone, Logan, Utah) and
plated on tissue culture flasks in DMEM (Invitrogen, Carlsbad,
Calif.) with 10% fetal bovine serum (FBS), 2 mM alanyl-glutamine
(Glutamax, Invitrogen), 100 units/mL penicillin and 100 .mu.g/mL
streptomycin (Invitrogen). After 48 hours, the supernatant was
discarded and the cells were cultured in complete culture medium
(CCM): .alpha.-MEM (Invitrogen) with 16.5% FBS, 2 mM
alanyl-glutamine, 100 units/mL penicillin and 100 .mu.g/mL
streptomycin. Cells were grown to less then 80% confluence and
replated at lower densities as appropriate.
[0477] Immunophenotyping
[0478] Phycoerythrin (PE), fluorescein isothiocyanate (FITC),
peridinin chlorophyll protein (PerCP) or allophycocyanin
(APC)-conjugated CD14, CD34, CD45, CD73, CD90, CD105 and CD133
monoclonal antibodies were used to stain MSCs. All antibodies were
from Becton Dickinson-Pharmingen (San Diego, Calif.), except where
indicated. Control samples labeled with an appropriate
isotype-matched antibody were included in each experiment. Cells
were analyzed by fluorescence-activated cell sorting FACScan
(Becton Dickinson) equipped with a filter set for 4 fluorescence
signals.
[0479] Differentiation Studies In Vitro
[0480] Adipocytic differentiation. MSCs (7.5.times.10.sup.4 cells)
were plated in wells of 6-well plates in NH AdipoDiff Medium
(Miltenyi Biotech, Auburn, Calif.). Medium was changed every third
day for 21 days. Cells were stained with Oil Red O solution
(obtained by diluting 0.5% w/v Oil Red O in isopropanol with water
at a 3:2 ratio), after fixation with 4% formaldehyde in phosphate
buffered saline (PBS).
[0481] Osteogenic differentiation. MSCs (4.5.times.10.sup.4 cells)
were plated in 6-well plates in NH OsteoDiff Medium (Miltenyi
Biotech). Medium was changed every third day for 10 days. Cells
were stained for alkaline phosphatase activity using Sigma Fast
BCIP/NBT substrate (Sigma-Aldrich, St. Louis, Mo.) as per
manufacturer instructions, after fixation with cold methanol.
[0482] Chondroblastic differentiation. MSC pellets containing
2.5.times.10.sup.5 to 5.times.10.sup.5 cells were obtained by
centrifugation in 15 mL or 1.5 mL polypropylene conical tubes and
cultured in NH ChondroDiff Medium (Miltenyi Biotech). Medium was
changed every third day for a total of 24 days. Cell pellets were
fixed in 4% formalin in PBS and processed for routine paraffin
sectioning. Sections were stained with alcian blue or using
indirect immunofluorescence for type II collagen (mouse
anti-collagen type II monoclonal antibody MAB8887, Millipore,
Billerica, Mass.) after antigen retrieval with pepsin (Thermo
Scientific, Fremont, Calif.).
[0483] iCasp9-.DELTA.CD19 Retrovirus Production and Transduction of
MSCs
[0484] The SFG.iCasp9.2A..DELTA.CD19 (iCasp-.DELTA.CD19) retrovirus
consists of iCasp9 linked, via a cleavable 2A-like sequence, to
truncated human CD19 (.DELTA.CD19). As noted above, iCasp9 is a
human FK506-binding protein (FKBP12) with an F36V mutation, which
increases the binding affinity of the protein to a synthetic
homodimerizer (AP20187 or AP1903), connected via a
Ser-Gly-Gly-Gly-Ser linker (SEQ ID NO: 21) to human caspase 9,
whose recruitment domain (CARD) has been deleted, its function
replaced by FKBP12.
[0485] The 2A-like sequence encodes a 20 amino acid peptide from
Thosea Asigna insect virus, which mediates more than 99% cleavage
between a glycine and terminal proline residue, to ensure
separation of iCasp9 and .DELTA.CD19 upon translation. .DELTA.CD19
consists of human CD19 truncated at amino acid 333, which removes
all conserved intracytoplasmic tyrosine residues that are potential
sites for phosphorylation. A stable PG13 clone producing Gibbon ape
leukemia virus (Gal-V) pseudotyped retrovirus was made by
transiently transfecting Phoenix Eco cell line (ATCC product #
SD3444; ATCC, Manassas, Va.) with SFG.iCasp9.2A..DELTA.CD19, which
yielded Eco-pseudotyped retrovirus. The PG13 packaging cell line
(ATCC) was transduced 3 times with Eco-pseudotyped retrovirus to
generate a producer line that contained multiple
SFG.iCasp9.2A..DELTA.CD19 proviral integrants per cell. Single-cell
cloning was performed, and the PG13 clone that produced the highest
titer was expanded and used for vector production. Retroviral
supernatant was obtained via culture of the producer cell lines in
IMDM (Invitrogen) with 10% FBS, 2 mM alanyl-glutamine, 100 units/mL
penicillin and 100 .mu.g/mL streptomycin. Supernatant containing
the retrovirus was collected 48 and 72 hours after initial culture.
For transduction, approximately 2.times.10.sup.4 MSCs/cm.sup.2 were
plated in CM in 6-well plates, T75 or T175 flasks. After 24 hours,
medium was replaced by viral supernatant diluted 10-fold together
with polybrene (final concentration 5 .mu.g/mL) and the cells were
incubated at 37.degree. C. in 5% CO2 for 48 hours, after which
cells were maintained in complete medium.
[0486] Cell Enrichment
[0487] For inducible iCasp9-.DELTA.CD19-positive MSC selection for
in vitro experiments, retrovirally transduced MSC were enriched for
CD19-positive cells using magnetic beads (Miltenyi Biotec)
conjugated with anti-CD19 (clone 4G7), per manufacturer
instructions. Cell samples were stained with PE- or APC-conjugated
CD19 (clone SJ25C1) antibody to assess the purity of the cellular
fractions.
[0488] Apoptosis Studies In Vitro
[0489] Undifferentiated MSCs. The chemical inducer of dimerization
(CID) (AP20187; ARIAD Pharmaceuticals, Cambridge, Mass.) was added
at 50 nM to iCasp9-transduced MSCs cultures in complete medium.
Apoptosis was evaluated 24 hours later by FACS analysis, after cell
harvest and staining with annexin V-PE and 7-AAD in annexin V
binding buffer (BD Biosciences, San Diego, Calif.). Control
iCasp9-transduced MSCs were maintained in culture without exposure
to CID.
[0490] Differentiated MSCs. Transduced MSCs were differentiated as
presented above. At the end of the differentiation period, CID was
added to the differentiation media at 50 nM. Cells were stained
appropriately for the tissue being studied, as presented above, and
a contrast stain (methylene azur or methylene blue) was used to
evaluate the nuclear and cytoplasmic morphology. In parallel,
tissues were processed for terminal deoxynucleotidyl-transferase
dUTP nick end labeling (TUNEL) assay as per manufacturer
instructions (In Situ Cell Death Detection Kit, Roche Diagnostics,
Mannheim, Germany). For each time point, four random fields were
photographed at a final magnification of 40.times. and the images
were analyzed with ImageJ software version 1.43o (NIH, Bethesda,
Md.). Cell density was calculated as the number of nuclei (DAPI
positivity) per unit of surface area (in mm.sup.2). The percentage
of apoptotic cells was determined as the ratio of the number of
nuclei with positive TUNEL signal (FITC positivity) to the total
number of nuclei. Controls were maintained in culture without
CID.
[0491] In Vivo Killing Studies in Murine Model
[0492] All mouse experiments were performed in accordance with the
Baylor College of Medicine animal husbandry guidelines. To assess
the persistence of modified MSCs in vivo, a SCID mouse model was
used in conjunction with an in vivo imaging system. MSCs were
transduced with retroviruses coding for the enhanced green
fluorescent protein-firefly luciferase (eGFP-FFLuc) gene alone or
together with the iCasp9-.DELTA.CD19 gene. Cells were sorted for
eGFP positivity by fluorescence activated cell sorting using a
MoFlo flow cytometer (Beckman Coulter, Fullerton, Calif.). Doubly
transduced cells were also stained with PE-conjugated anti-CD19 and
sorted for PE-positivity. SCID mice (8-10 weeks old) were injected
subcutaneously with 5.times.10.sup.5 MSCs with and without
iCasp9-.DELTA.CD19 in opposite flanks. Mice received two
intraperitoneal injections of 50 .mu.g of CID 24 hours apart
starting a week later. For in vivo imaging of MSCs expressing
eGFP-FFLuc, mice were injected intraperitoneally with D-luciferin
(150 mg/kg) and analyzed using the Xenogen-IVIS Imaging System.
Total luminescence (a measurement proportional to the total labeled
MSCs deposited) at each time point was calculated by automatically
defining regions-of-interest (ROIs) over the MSC implantation
sites. These ROIs included all areas with luminescence signals at
least 5% above background. Total photon counts were integrated for
each ROI and an average value calculated. Results were normalized
so that time zero would correspond to 100% signal.
[0493] In a second set of experiments, a mixture of
2.5.times.10.sup.6 eGFP-FFLuc-labeled MSCs and 2.5.times.10.sup.6
eGFP-FFLuc-labeled, iCasp9-.DELTA.CD19-transduced MSCs was injected
subcutaneously in the right flank, and the mice received two
intraperitoneal injections of 50 .mu.g of CID 24 h apart starting 7
days later. At several time points after CID injection, the
subcutaneous pellet of MSCs was harvested using tissue luminescence
to identify and collect the whole human specimen and to minimize
mouse tissue contamination. Genomic DNA was then isolated using
QIAmp.RTM. DNA Mini (Qiagen, Valencia, Calif.). Aliquots of 100 ng
of DNA were used in a quantitative PCR (qPCR) to determine the
number of copies of each transgene using specific primers and
probes (for the eGFP-FFLuc construct: forward primer
5'-TCCGCCCTGAGCAAAGAC-3' (SEQ ID NO: 24), reverse
5'-ACGAACTCCAGCAGGACCAT-3' (SEQ ID NO: 25), probe 5' FAM,
6-carboxyfluorescein-ACGAGAAGCGCGATC-3' (SEQ ID NO: 26) MGBNFQ,
minor groove binding non-fluorescent quencher; iCasp9-.DELTA.CD19:
forward 5'-CTGGAATCTGGCGGTGGAT-3' (SEQ ID NO: 27), reverse
5'-CAAACTCTCAAGAGCACCGACAT-3' (SEQ ID NO: 28), probe 5'
FAM-CGGAGTCGACGGATT-3' MGBNFQ (SEQ ID NO: 29)). Known numbers of
plasmids containing single copies of each transgene were used to
establish standard curves. It was determined that approximately 100
ng of DNA isolated from "pure" populations of singly eGFP-FFLuc- or
doubly eGFP-FFLuc- and iCasp9-transduced MSCs had similar numbers
of eGFP-FFLuc gene copies (approximately 3.0.times.10.sup.4), as
well as zero and 1.7.times.10.sup.3 of iCasp9-.DELTA.CD19 gene
copies, respectively.
[0494] Untransduced human cells and mouse tissues had zero copies
of either gene in 100 ng of genomic DNA. Because the copy number of
the eGFP gene is the same on identical amounts of DNA isolated from
either population of MSCs (iCasp9-negative or positive), the copy
number of this gene in DNA isolated from any mixture of cells will
be proportional to the total number of eGFP-FFLuc-positive cells
(iCasp9-positive plus negative MSCs). Moreover, because
iCasp9-negative tissues do not contribute to the iCasp9 copy
number, the copy number of the iCasp9 gene in any DNA sample will
be proportional to the total number of iCasp9-positive cells.
Therefore, if G is the total number of GFP-positive and
iCasp9-negative cells and C the total number of GFP-positive and
iCasp9-positive cells, for any DNA sample then N.sub.eGFP=g(C+G)
and N.sub.iCasp9=k-C, where N represents gene copy number and g and
k are constants relating copy number and cell number for the eGFP
and iCasp9 genes, respectively. Thus
N.sub.iCasp9/N.sub.eGFP=(k/g)[C/(C+G)], i.e., the ratio between
iCasp9 copy number and eGFP copy number is proportional to the
fraction of doubly transduced (iCasp9-positive) cells among all
eGFP positive cells. Although the absolute values of N.sub.iCasp9
and N.sub.eGFP will decrease with increasing contamination by
murine cells in each MSC explant, for each time point the ratio
will be constant regardless of the amount of murine tissue
included, since both types of human cells are physically mixed.
Assuming similar rates of spontaneous apoptosis in both populations
(as documented by in vitro culture) the quotient between
N.sub.iCasp9/N.sub.eGFP at any time point and that at time zero
will represent the percentage of surviving iCasp9-positive cells
after exposure to CID. All copy number determinations were done in
triplicate.
[0495] Statistical Analysis
[0496] Paired 2-tailed Student's t-test was used to determine the
statistical significance of differences between samples. All
numerical data are represented as mean.+-.1 standard deviation.
[0497] Results
[0498] MSCs are Readily Transduced with iCasp9-.DELTA.CD19 and
Maintain their Basic Phenotype
[0499] Flow cytometric analysis of MSCs from 3 healthy donors
showed they were uniformly positive for CD73, CD90 and CD105 and
negative for the hematopoietic markers CD45, CD14, CD133 (FIG. 15A)
and CD34. The mononuclear adherent fraction isolated from bone
marrow was homogenously positive for CD73, CD90 and CD105 and
negative for hematopoietic markers. The differentiation potential,
of isolated MSCs, into adipocytes, osteoblasts and chondroblasts
was confirmed in specific assays (see FIG. 15B), demonstrating that
these cells are bona fide MSCs. FIG. 15B illustrates the results of
differentiation studies, the isolated MSCs were able to
differentiate into adipocytes (left, oil red and methylene blue),
osteoblasts (center, alkaline phosphatase-bromochloroindolyl
phosphate/nitroblue tetrazolium and methylene blue) and
chondroblasts (right, anti-type II collagen antibody-Texas red and
DAPI) when cultured in appropriate media.
[0500] Early passage MSCs were transduced with an
iCasp9-.DELTA.CD19 retroviral vector, encoding an inducible form of
caspase 9. Under optimal single transduction conditions, 47.+-.6%
of the cells expressed CD19, a truncated form of which is
transcribed in cis with iCasp9, serving as a surrogate for
successful transduction and allowing selection of transduced cells.
The percentage of cells positive for CD19 was stable for more than
two weeks in culture, suggesting no deleterious or growth
advantageous effects of the construct on MSCs, as shown in FIG.
16A. FIG. 9A illustrates the results of MSCs that underwent a
single round of transduction with iCasp9-.DELTA.CD19 retrovirus.
The percentage of CD19-positive cells, a surrogate for successful
transduction with iCasp9, remains constant for more than 2 weeks.
To further address the stability of the construct, a population of
iCasp9-positive cells purified by a fluorescence activated cell
sorter (FACS) was maintained in culture: no significant difference
in the percentage of CD19-positive cells was observed over six
weeks (96.5.+-.1.1% at baseline versus 97.4.+-.0.8% after 43 days,
P=0.46). The phenotype of the iCasp9-CD19-positive cells was
otherwise substantially identical to that of untransduced cells,
with virtually all cells positive for CD73, CD90 and CD105 and
negative for hematopoietic markers, as illustrated in FIG. 16B),
confirming that the genetic manipulation of MSCs did not modify
their basic characteristics.
[0501] iCasp9-.DELTA.CD19 Transduced MSCs Undergo Selective
Apoptosis after Exposure to CID In Vitro
[0502] The proapoptotic gene product iCasp9 can activated by a
small chemical inducer of dimerization (CID), AP20187, an analogue
of tacrolimus that binds the FK506-binding domain present in the
iCasp9 product. Non-transduced MSCs have a spontaneous rate of
apoptosis in culture of approximately 18% (.+-.7%) as do
iCasp9-positive cells at baseline (15.+-.6%, P=0.47). Addition of
CID (50 nM) to MSC cultures after transduction with
iCasp9-.DELTA.CD19 results in the apoptotic death of more than 90%
of iCasp9-positive cells within 24 hrs (93.+-.1%, P<0.0001),
while iCasp9-negative cells retain an apoptosis index similar to
that of non-transduced controls (20.+-.7%, P=0.99 and P=0.69 vs.
non-transduced controls with or without CID respectively) (see
FIGS. 17A and 70B). After transduction of MSCs with iCasp9, the
chemical inducer of dimerization (CID) was added at 50 nM to
cultures in complete medium. Apoptosis was evaluated 24 hours later
by FACS analysis, after cell harvest and staining with annexin V-PE
and 7-AAD. Ninety-three percent of the iCasp9-CD19-positive cells
(iCasp pos/CID) became annexin positive versus only 19% of the
negative population (iCasp neg/CID), a proportion comparable to
non-transduced control MSC exposed to the same compound
(Control/CID, 15%) and to iCasp9-CD19-positive cells unexposed to
CID (iCasp pos/no CID, 13%), and similar to the baseline apoptotic
rate of non-transduced MSCs (Control/no CID, 16%). Magnetic
immunoselection of iCap9-CD19-positive cells can be achieved to
high degree of purity. More than 95% of the selected cells become
apoptotic after exposure to CID.
[0503] Analysis of a highly purified iCasp9-positive population at
later time points after a single exposure to CID shows that the
small fraction of iCasp9-negative cells expands and that a
population of iCasp9-positive cells remains, but that the latter
can be killed by re-exposure to CID. Thus, no iCasp9-positive
population resistant to further killing by CID was detected (see
FIG. 18). A population of iCasp9-CD19-negative MSCs emerges as
early as 24 hours after CID introduction. A population of
iCasp9-CD19-negative MSCs is expected since achieving a population
with 100% purity is unrealistic and because the MSCs are being
cultured in conditions that favor their rapid expansion in vitro. A
fraction of iCasp9-CD19-positive population persists, as predicted
by the fact that killing is not 100% efficient (assuming, for
example, 99% killing of a 99% pure population, the resulting
population would have 49.7% iCasp9-positive and 50.3%
iCasp9-negative cells). The surviving cells, however, can be killed
at later time points by re-exposure to CID.
[0504] iCasp9-.DELTA.CD19 Transduced MSCs Maintain the
Differentiation Potential of Unmodified MSCs and their Progeny is
Killed by Exposure to CID
[0505] To determine if the CID can selectively kill the
differentiated progeny of iCasp9-positive MSCs, immunomagnetic
selection for CD19 was used to increase the purity of the modified
population (>90% after one round of selection, see FIG. 16B).
The iCasp9-positive cells thus selected were able to differentiate
in vivo into all connective tissue lineages studied (see FIGS.
19A-19Q). Human MSCs were immunomagnetically selected for CD19
(thus iCasp9) expression, with a purity greater than 91%. After
culture in specific differentiation media, iCasp9-positive cells
were able to give rise to adipocytic (A, oil red and methylene
azur), osteoblastic (B, alkaline phosphatase-BCIP/NBT and methylene
blue) and chondroblastic lineages (C, alcian blue and nuclear red)
lineages. These differentiated tissues are driven to apoptosis by
exposure to 50 nM CID (D-N). Note numerous apoptotic bodies
(arrows), cytoplasmic membrane blebbing (inset) and loss of
cellular architecture (D and E); widespread TUNEL positivity in
chondrocytic nodules (F-H), and adipogenic (I-K) and osteogenic
(L-N) cultures, in contrast to that seen in untreated
iCasp9-transduced controls (adipogenic condition shown, O-Q) (F, I,
L, O, DAPI; G, J, M, P,TUNEL-FITC; H, K, N, Q, overlay).
[0506] After 24 hours of exposure to 50 nM of CID, microscopic
evidence of apoptosis was observed with membrane blebbing, cell
shrinkage and detachment, and presence of apoptotic bodies
throughout the adipogenic and osteogenic cultures. A TUNEL assay
showed widespread positivity in adipogenic and osteogenic cultures
and the chondrocytic nodules (see FIGS. 19A-19Q), which increased
over time (see FIG. 20). After culture in adipocytic
differentiation media, iCasp9-positive cells gave rise to
adipocytes. After exposure to 50 nM CID, progressive apoptosis was
observed as evidenced by an increasing proportion of TUNEL-positive
cells. After 24 hours, there was a significant decrease in cell
density (from 584 cells/mm2 to <14 cells/mm2), with almost all
apoptotic cells having detached from the slides, precluding further
reliable calculation of the proportion of apoptotic cells. Thus,
iCasp9 remained functional even after MSC differentiation, and its
activation results in the death of the differentiated progeny.
[0507] iCasp9-.DELTA.CD19 Transduced MSCs Undergo Selective
Apoptosis after In Vivo Exposure to CID
[0508] Although intravenously injected MSC already appear to have a
short in vivo survival time, cells injected locally may survive
longer and produce correspondingly more profound adverse effects.
To assess the in vivo functionality of the iCasp9 suicide system in
such a setting, SCID mice were subcutaneously injected with MSCs.
MSCs were doubly transduced with the eGFP-FFLuc (previously
presented) and iCasp9-.DELTA.CD19 genes. MSCs were also singly
transduced with eGFP-FFLuc. The eGFP-positive (and CD19-positive,
where applicable) fractions were isolated by fluorescence activated
cell sorting, with a purity >95%. Each animal was injected
subcutaneously with iCasp9-positive and control MSCs (both
eGFP-FFLuc-positive) in opposite flanks. Localization of the MSCs
was evaluated using the Xenogen-IVIS Imaging System. In another set
of experiments, a 1:1 mixture of singly and doubly transduced MSCs
was injected subcutaneously in the right flank and the mice
received CID as above. The subcutaneous pellet of MSCs was
harvested at different time points, genomic DNA was isolated and
qPCR was used to determine copy numbers of the eGFP-FFLuc and
iCasp9-.DELTA.CD19 genes. Under these conditions, the ratio of the
iCasp9 to eGFP gene copy numbers is proportional to the fraction of
iCasp9-positive cells among total human cells (see Methods above
for details). The ratios were normalized so that time zero
corresponds to 100% of iCasp9-positive cells. Serial examination of
animals after subcutaneous inoculation of MSCs (prior to CID
injection) shows evidence of spontaneous apoptosis in both cell
populations (as demonstrated by a fall in the overall luminescence
signal to .about.20% of the baseline). This has been previously
observed after systemic and local delivery of MSCs in xenogeneic
models.
[0509] The luminescence data showed a substantial loss of human
MSCs over the first 96 h (see FIG. 21C) after local delivery of
MSCs, even before administration of CID, with only approximately
20% cells surviving after one week. From that time point onward,
however, there were significant differences between the survival of
icasp9-positive MSCs with and without dimerizer drug. Seven days
after MSC implantation, animals were given two injections of 50
.mu.g of CID, 24 hours apart. As illustrated in FIG. 21A, the MSCs
transduced with iCasp9 were quickly killed by the drug, as
demonstrated by the disappearance of their luminescence signal.
Cells negative for iCasp9 were not affected by the drug. Animals
not injected with the drug showed persistence of signal in both
populations up to a month after MSC implantation. To further
quantify cell killing, qPCR assays were developed to measure copy
numbers of the eGFP-FFLuc and iCasp9-.DELTA.CD19 genes. Mice were
injected subcutaneously with a 1:1 mixture of doubly and singly
transduced MSCs and administered CID as above, one week after MSC
implantation. MSCs explants were collected at several time points,
genomic DNA isolated from the samples and qPCR assays performed on
substantially identical amounts of DNA. Under these conditions (see
Methods), at any time point, the ratio of iCasp9-.DELTA.CD19 to
eGFP-FFLuc copy numbers is proportional to the fraction of viable
iCasp9-positive cells. Progressive killing of iCasp9-positive cells
was observed (>99%) so that the proportion of surviving
iCasp9-positive cells was reduced to 0.7% of the original
population after one week (see FIG. 21B). Therefore, MSCs
transduced with iCasp9 can be selectively killed in vivo after
exposure to CID, but otherwise persist.
[0510] Discussion
[0511] The feasibility of engineering human MSCs to express a
safety mechanism using an inducible suicide protein is demonstrated
herein. The date presented herein show that MSC can be readily
transduced with the suicide gene iCasp9 coupled to the selectable
surface maker CD19. Expression of the co-transduced genes is stable
both in MSCs and their differentiated progeny, and does not
evidently alter their phenotype or potential for differentiation.
These transduced cells can be killed in vitro and in vivo when
exposed to the appropriate small molecule chemical inducer of
dimerization that binds to the iCasp9.
[0512] For a cell based therapy to be successful, transplanted
cells must survive the period between their harvest and their
ultimate in vivo clinical application. Additionally, a safe cell
based therapy also should include the ability to control the
unwanted growth and activity of successfully transplanted cells.
Although MSCs have been administered to many patients without
notable side effects, recent reports indicate additional
protections, such as the safety switch presented herein, may offer
additional methods of control over cell based therapies as the
potential of transplanted MSC to be genetically and epigenetically
modified to enhance their functionality, and to differentiate into
lineages including bone and cartilage is further investigated and
exploited. Subjects receiving MSCs that have been genetically
modified to release biologically active proteins might particularly
benefit from the added safety provided by a suicide gene.
[0513] The suicide system presented herein offers several potential
advantages over other known suicide systems. Strategies involving
nucleoside analogues, such as those combining Herpes Simplex Virus
thymidine kinase (HSV-tk) with gancyclovir (GCV) and bacterial or
yeast cytosine deaminase (CD) with 5-fluoro-cytosine (5-FC), are
cell-cycle dependent and are unlikely to be effective in the
post-mitotic tissues that may be formed during the application of
MSCs to regenerative medicine. Moreover, even in proliferating
tissues the mitotic fraction does not comprise all cells, and a
significant portion of the graft may survive and remain
dysfunctional. In some instance, the prodrugs required for suicide
may themselves have therapeutic uses that are therefore excluded
(e.g. GCV), or may be toxic (e.g. 5-FC), either as a result of
their metabolism by non-target organs (e.g., many cytochrome P450
substrates), or due to diffusion to neighboring tissues after
activation by target cells (e.g. CB1954, a substrate for bacterial
nitroreductase).
[0514] In contrast, the small molecule chemical inducers of
dimerization presented herein have shown no evidence of toxicities
even at doses ten fold higher than those required to activate the
iCasp9. Additionally, nonhuman enzymatic systems, such as HSV-tk
and DC, carry a high risk of destructive immune responses against
transduced cells. Both the iCasp9 suicide gene and the selection
marker CD19, are of human origin, and thus should be less likely to
induce unwanted immune responses. Although linkage of expression of
the selectable marker to the suicide gene by a 2A-like cleavable
peptide of nonhuman origin could pose problems, the 2A-like linker
is 20 amino acids long, and is likely less immunogenic than a
nonhuman protein. Finally, the effectiveness of suicide gene
activation in iCasp9-positive cells compares favorably to killing
of cells expressing other suicide systems, with 90% or more of
iCasp9-modified T cells eliminated after a single dose of
dimerizer, a level that is likely to be clinically efficacious.
[0515] The iCasp9 system presented herein also may avoid additional
limitations seen with other cell based and/or suicide switch based
therapies. Loss of expression due to silencing of the transduced
construct is frequently observed after retroviral transduction of
mammalian cells. The expression constructs presented herein showed
no evidence of such an effect. No decrease in expression or induced
death was evident, even after one month in culture.
[0516] Another potential problem sometimes observed in other cell
based and/or suicide switch based therapies, is the development of
resistance in cells that have upregulated anti-apoptotic genes.
This effect has been observed in other suicide systems involving
different elements of the programmed cell death pathways such as
Fas. iCasp9 was chosen as the suicide gene for the expression
constructs presented herein because it was less likely to have this
limitation. Compared to other members of the apoptotic cascade,
activation of caspase 9 occurs late in the apoptotic pathway and
therefore should bypass the effects of many if not all
anti-apoptotic regulators, such as c-FLIP and bcl-2 family
members.
[0517] A potential limitation specific to the system presented
herein may be spontaneous dimerization of iCasp9, which in turn
could cause unwanted cell death and poor persistence. This effect
has been observed in certain other inducible systems that utilize
Fas. The observation of low spontaneous death rate in transduced
cells and long term persistence of transgenic cells in vivo
indicate this possibility is not a significant consideration when
using iCasp9 based expression constructs.
[0518] Integration events deriving from retroviral transduction of
MSCs may potentially drive deleterious mutagenesis, especially when
there are multiple insertions of the retroviral vector, causing
unwanted copy number effects and/or other undesirable effects.
These unwanted effects could offset the benefit of a retrovirally
transduced suicide system. These effects often can be minimized
using clinical grade retroviral supernatant obtained from stable
producer cell lines and similar culture conditions to transduce T
lymphocytes. The T cells transduced and evaluated herein contain in
the range of about 1 to 3 integrants (the supernatant containing in
the range of about 1.times.10.sup.6 viral particles/mL). The
substitution of lentiviral for retroviral vectors could further
reduce the risk of genotoxicity, especially in cells with high
self-renewal and differentiation potential.
[0519] While a small proportion of iCasp9-positive MSCs persists
after a single exposure to CID, these surviving cells can
subsequently be killed following re-exposure to CID. In vivo, there
is >99% depletion with two doses, but it is likely that repeated
doses of CID will be needed for maximal depletion in the clinical
setting. Additional non-limiting methods of providing extra safety
when using an inducible suicide switch system include additional
rounds of cell sorting to further increase the purity of the cell
populations administered and the use of more than one suicide gene
system to enhance the efficiency of killing.
[0520] The CD19 molecule, which is physiologically expressed by B
lymphocytes, was chosen as the selectable marker for transduced
cells, because of its potential advantages over other available
selection systems, such as neomycin phosphotransferase (neo) and
truncated low affinity nerve growth factor receptor (.DELTA.LNGFR).
neo encodes a potentially immunogenic foreign protein and requires
a 7-day culture in selection medium, increasing the complexity of
the system and potentially damaging the selected cells.
.DELTA.LNGFR expression should allow for isolation strategies
similar to other surface markers, but these are not widely
available for clinical use and a lingering concern remains about
the oncogenic potential of .DELTA.LNGFR. In contrast, magnetic
selection of iCasp9-positive cells by CD19 expression using a
clinical grade device is readily available and has shown no notable
effects on subsequent cell growth or differentiation.
[0521] The procedure used for preparation and administration of
mesenchymal stromal cells comprising the caspase 9 safety switch
may also be used for the preparation of embryonic stem cells and
inducible pluripotent stem cells. Thus for the procedures outlined
in the present example, either embryonic stem cells or inducible
pluripotent stem cells may be substituted for the mesenchymal
stromal cells provided in the example. In these cells, retroviral
and lentiviral vectors may be used, with, for example, CMV
promoters, or the ronin promoter.
Example 6: Examples of Particular Nucleic Acid and Amino Acid
Sequences
[0522] FIG. 43 presents an example of a construct that may be used
for expression of the chimeric protein and CD19 marker. The figure
presents the SFG.iC9.2A..sup.2CD19.gcs construct
TABLE-US-00007 nucleotide sequence of 5'LTR sequence SEQ ID NO: 1
TGAAAGACCCCACCTGTAGGTTTGGCAAGCTAGCTTAAGTAACGCCATTTTGCAAGGCATGGA
AAAATACATAACTGAGAATAGAAAAGTTCAGATCAAGGTCAGGAACAGATGGAACAGCTGAAT
ATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGAT
GGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGG
GCCAAGAACAGATGGTCCCCAGATGCGGTCCAGCCCTCAGCAGTTTCTAGAGAACCATCAGA
TGTTTCCAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGT
TCGCTTCTCGCTTCTGTTCGCGCGCTTATGCTCCCCGAGCTCAATAAAAGAGCCCACAACCCC
TCACTCGGGGCGCCAGTCCTCCGATTGACTGAGTCGCCCGGGTACCCGTGTATCCAATAAAC
CCTCTTGCAGTTGCATCCGACTTGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGAT
TGACTACCCGTCAGCGGGGGTCTTTCA nucleotide sequence of Fv (human
FKBP12v36) SEQ ID NO: 2
GGAGTGCAGGTGGAAACCATCTCCCCAGGAGACGGGCGCACCTTCCCCAAGCGCGGCCAGA
CCTGCGTGGTGCACTACACCGGGATGCTTGAAGATGGAAAGAAAGTTGATTCCTCCCGGGAC
AGAAACAAGCCCTTTAAGTTTATGCTAGGCAAGCAGGAGGTGATCCGAGGCTGGGAAGAAGG
GGTTGCCCAGATGAGTGTGGGTCAGAGAGCCAAACTGACTATATCTCCAGATTATGCCTATGG
TGCCACTGGGCACCCAGGCATCATCCCACCACATGCCACTCTCGTCTTCGATGTGGAGCTTC
TAAAACTGGAA amino acid sequence of Fv (human FKBP12v36) SEQ ID NO:
3 G V Q V E T I S P G D G R T F P K R G Q T C V V H Y T G M L E D G
K K V D S S R D R N K P F K F M L G K Q E V I R G W E E G V A Q M S
V G Q R A K L T I S P D Y A Y G A T G H P G I I P P H A T L V F D V
E L L K L E GS linker nucleotide sequence SEQ ID NO: 4
TCTGGCGGTGGATCCGGA GS linker amino acid sequence SEQ ID NO: 5 S G G
G S G linker nucleotide sequence (between GS linker and Casp 9) SEQ
ID NO: 6 GTCGAC linker amino acid sequence (between GS linker and
Casp 9) SEQ ID NO: 7 VD Casp 9 (truncated) nucleotide sequence SEQ
ID NO: 8
GGATTTGGTGATGTCGGTGCTCTTGAGAGTTTGAGGGGAAATGCAGATTTGGCTTACATCCTG
AGCATGGAGCCCTGTGGCCACTGCCTCATTATCAACAATGTGAACTTCTGCCGTGAGTCCGG
GCTCCGCACCCGCACTGGCTCCAACATCGACTGTGAGAAGTTGCGGCGTCGCTTCTCCTCGC
TGCATTTCATGGTGGAGGTGAAGGGCGACCTGACTGCCAAGAAAATGGTGCTGGCTTTGCTG
GAGCTGGCGCAGCAGGACCACGGTGCTCTGGACTGCTGCGTGGTGGTCATTCTCTCTCACG
GCTGTCAGGCCAGCCACCTGCAGTTCCCAGGGGCTGTCTACGGCACAGATGGATGCCCTGT
GTCGGTCGAGAAGATTGTGAACATCTTCAATGGGACCAGCTGCCCCAGCCTGGGAGGGAAG
CCCAAGCTCTTTTTCATCCAGGCCTGTGGTGGGGAGCAGAAAGACCATGGGTTTGAGGTGGC
CTCCACTTCCCCTGAAGACGAGTCCCCTGGCAGTAACCCCGAGCCAGATGCCACCCCGTTCC
AGGAAGGTTTGAGGACCTTCGACCAGCTGGACGCCATATCTAGTTTGCCCACACCCAGTGAC
ATCTTTGTGTCCTACTCTACTTTCCCAGGTTTTGTTTCCTGGAGGGACCCCAAGAGTGGCTCC
TGGTACGTTGAGACCCTGGACGACATCTTTGAGCAGTGGGCTCACTCTGAAGACCTGCAGTC
CCTCCTGCTTAGGGTCGCTAATGCTGTTTCGGTGAAAGGGATTTATAAACAGATGCCTGGTTG
CTTTAATTTCCTCCGGAAAAAACTTTTCTTTAAAACATCA Caspase 9 (truncated)
amino acid sequence-CARD domain deleted SEQ ID NO: 9 G F G D V G A
L E S L R G N A D L A Y I L S M E P C G H C L I I N N V N F C R E S
G L R T R T G S N I D C E K L R R R F S S L H F M V E V K G D L T A
K K M V L A L L E L A Q Q D H G A L D C C V V V I L S H G C Q A S H
L Q F P G A V Y G T D G C P V S V E K I V N I F N G T S C P S L G G
K P K L F F I Q A C G G E Q K D H G F E V A S T S P E D E S P G S N
P E P D A T P F Q E G L R T F D Q L D A I S S L P T P S D I F V S Y
S T F P G F V S W R D P K S G S W Y V E T L D D I F E Q W A H S E D
L Q S L L L R V A N A V S V K G I Y K Q M P G C F N F L R K K L F F
K T S linker nucleotide sequence (between caspase 9 and 2A) SEQ ID
NO: 10 GCTAGCAGA linker amino acid sequence (between caspase 9 and
2A) SEQ ID NO: 11 ASR Thosea asigna virus-2A from capsid protein
precursor nucleotide sequence SEQ ID NO: 12
GCCGAGGGCAGGGGAAGTCTTCTAACATGCGGGGACGTGGAGGAAAATCCCGGGCCC Thosea
asigna virus-2A from capsid protein precursor amino acid sequence
SEQ ID NO: 13 A E G R G S L L T C G D V E E N P G P human CD19
(.DELTA. cytoplasmic domain) nucleotide sequence (transmembrane
domain in bold) SEQ ID NO: 14
ATGCCACCTCCTCGCCTCCTCTTCTTCCTCCTCTTCCTCACCCCCATGGAAGTCAGGCCCGAG
GAACCTCTAGTGGTGAAGGTGGAAGAGGGAGATAACGCTGTGCTGCAGTGCCTCAAGGGGA
CCTCAGATGGCCCCACTCAGCAGCTGACCTGGTCTCGGGAGTCCCCGCTTAAACCCTTCTTA
AAACTCAGCCTGGGGCTGCCAGGCCTGGGAATCCACATGAGGCCCCTGGCCATCTGGCTTTT
CATCTTCAACGTCTCTCAACAGATGGGGGGCTTCTACCTGTGCCAGCCGGGGCCCCCCTCTG
AGAAGGCCTGGCAGCCTGGCTGGACAGTCAATGTGGAGGGCAGCGGGGAGCTGTTCCGGTG
GAATGTTTCGGACCTAGGTGGCCTGGGCTGTGGCCTGAAGAACAGGTCCTCAGAGGGCCCC
AGCTCCCCTTCCGGGAAGCTCATGAGCCCCAAGCTGTATGTGTGGGCCAAAGACCGCCCTGA
GATCTGGGAGGGAGAGCCTCCGTGTCTCCCACCGAGGGACAGCCTGAACCAGAGCCTCAGC
CAGGACCTCACCATGGCCCCTGGCTCCACACTCTGGCTGTCCTGTGGGGTACCCCCTGACTC
TGTGTCCAGGGGCCCCCTCTCCTGGACCCATGTGCACCCCAAGGGGCCTAAGTCATTGCTGA
GCCTAGAGCTGAAGGACGATCGCCCGGCCAGAGATATGTGGGTAATGGAGACGGGTCTGTT
GTTGCCCCGGGCCACAGCTCAAGACGCTGGAAAGTATTATTGTCACCGTGGCAACCTGACCA
TGTCATTCCACCTGGAGATCACTGCTCGGCCAGTACTATGGCACTGGCTGCTGAGGACTGGT
GGCTGGAAGGTCTCAGCTGTGACTTTGGCTTATCTGATCTTCTGCCTGTGTTCCCTTGTGGG
CATTCTTCATCTTCAAAGAGCCCTGGTCCTGAGGAGGAAAAGAAAGCGAATGACTGACCCCA
CCAGGAGATTC human CD19 (.DELTA. cytoplasmic domain) amino acid
sequence SEQ ID NO: 15 M P P P R L L F F L L F L T P M E V R P E E
P L V V K V E E G D N A V L Q C L K G T S D G P T Q Q L T W S R E S
P L K P F L K L S L G L P G L G I H M R P L A I W L F I F N V S Q Q
M G G F Y L C Q P G P P S E K A W Q P G W T V N V E G S G E L F R W
N V S D L G G L G C G L K N R S S E G P S S P S G K L M S P K L Y V
W A K D R P E I W E G E P P C L P P R D S L N Q S L S Q D L T M A P
G S T L W L S C G V P P D S V S R G P L S W T H V H P K G P K S L L
S L E L K D D R P A R D M W V M E T G L L L P R A T A Q D A G K Y Y
C H R G N L T M S F H L E I T A R P V L W H W L L R T G G W K V S A
V T L A Y L I F C L C S L V G I L H L Q R A L V L R R K R K R M T D
P T R R F 3'LTR nucleotide sequence SEQ ID NO: 16
TGAAAGACCCCACCTGTAGGTTTGGCAAGCTAGCTTAAGTAACGCCATTTTGCAAGGCATGGA
AAAATACATAACTGAGAATAGAGAAGTTCAGATCAAGGTCAGGAACAGATGGAACAGCTGAAT
ATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGAT
GGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGG
GCCAAGAACAGATGGTCCCCAGATGCGGTCCAGCCCTCAGCAGTTTCTAGAGAACCATCAGA
TGTTTCCAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGT
TCGCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCACAACCCC
TCACTCGGGGCGCCAGTCCTCCGATTGACTGAGTCGCCCGGGTACCCGTGTATCCAATAAAC
CCTCTTGCAGTTGCATCCGACTTGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGAT
TGACTACCCGTCAGCGGGGGTCTTTCA Expression vector construct nucleotide
sequence-nucleotide sequence coding for the chimeric protein and 5'
and 3' LTR sequences, and additional vector sequence. SEQ ID NO: 17
TGAAAGACCCCACCTGTAGGTTTGGCAAGCTAGCTTAAGTAACGCCATTTTGCAAGGCATGGA
AAAATACATAACTGAGAATAGAAAAGTTCAGATCAAGGTCAGGAACAGATGGAACAGCTGAAT
ATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGAT
GGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGG
GCCAAGAACAGATGGTCCCCAGATGCGGTCCAGCCCTCAGCAGTTTCTAGAGAACCATCAGA
TGTTTCCAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGT
TCGCTTCTCGCTTCTGTTCGCGCGCTTATGCTCCCCGAGCTCAATAAAAGAGCCCACAACCCC
TCACTCGGGGCGCCAGTCCTCCGATTGACTGAGTCGCCCGGGTACCCGTGTATCCAATAAAC
CCTCTTGCAGTTGCATCCGACTTGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGAT
TGACTACCCGTCAGCGGGGGTCTTTCATTTGGGGGCTCGTCCGGGATCGGGAGACCCCTGC
CCAGGGACCACCGACCCACCACCGGGAGGTAAGCTGGCCAGCAACTTATCTGTGTCTGTCC
GATTGTCTAGTGTCTATGACTGATTTTATGCGCCTGCGTCGGTACTAGTTAGCTAACTAGCTCT
GTATCTGGCGGACCCGTGGTGGAACTGACGAGTTCGGAACACCCGGCCGCAACCCTGGGAG
ACGTCCCAGGGACTTCGGGGGCCGTTTTTGTGGCCCGACCTGAGTCCTAAAATCCCGATCGT
TTAGGACTCTTTGGTGCACCCCCCTTAGAGGAGGGATATGTGGTTCTGGTAGGAGACGAGAA
CCTAAAACAGTTCCCGCCTCCGTCTGAATTTTTGCTTTCGGTTTGGGACCGAAGCCGCGCCG
CGCGTCTTGTCTGCTGCAGCATCGTTCTGTGTTGTCTCTGTCTGACTGTGTTTCTGTATTTGTC
TGAAAATATGGGCCCGGGCTAGCCTGTTACCACTCCCTTAAGTTTGACCTTAGGTCACTGGAA
AGATGTCGAGCGGATCGCTCACAACCAGTCGGTAGATGTCAAGAAGAGACGTTGGGTTACCT
TCTGCTCTGCAGAATGGCCAACCTTTAACGTCGGATGGCCGCGAGACGGCACCTTTAACCGA
GACCTCATCACCCAGGTTAAGATCAAGGTCTTTTCACCTGGCCCGCATGGACACCCAGACCA
GGTGGGGTACATCGTGACCTGGGAAGCCTTGGCTTTTGACCCCCCTCCCTGGGTCAAGCCCT
TTGTACACCCTAAGCCTCCGCCTCCTCTTCCTCCATCCGCCCCGTCTCTCCCCCTTGAACCTC
CTCGTTCGACCCCGCCTCGATCCTCCCTTTATCCAGCCCTCACTCCTTCTCTAGGCGCCCCCA
TATGGCCATATGAGATCTTATATGGGGCACCCCCGCCCCTTGTAAACTTCCCTGACCCTGACA
TGACAAGAGTTACTAACAGCCCCTCTCTCCAAGCTCACTTACAGGCTCTCTACTTAGTCCAGC
ACGAAGTCTGGAGACCTCTGGCGGCAGCCTACCAAGAACAACTGGACCGACCGGTGGTACC
TCACCCTTACCGAGTCGGCGACACAGTGTGGGTCCGCCGACACCAGACTAAGAACCTAGAAC
CTCGCTGGAAAGGACCTTACACAGTCCTGCTGACCACCCCCACCGCCCTCAAAGTAGACGGC
ATCGCAGCTTGGATACACGCCGCCCACGTGAAGGCTGCCGACCCCGGGGGTGGACCATCCT
CTAGACTGCCATGCTCGAGGGAGTGCAGGTGGAAACCATCTCCCCAGGAGACGGGCGCACC
TTCCCCAAGCGCGGCCAGACCTGCGTGGTGCACTACACCGGGATGCTTGAAGATGGAAAGAA
AGTTGATTCCTCCCGGGACAGAAACAAGCCCTTTAAGTTTATGCTAGGCAAGCAGGAGGTGAT
CCGAGGCTGGGAAGAAGGGGTTGCCCAGATGAGTGTGGGTCAGAGAGCCAAACTGACTATA
TCTCCAGATTATGCCTATGGTGCCACTGGGCACCCAGGCATCATCCCACCACATGCCACTCTC
GTCTTCGATGTGGAGCTTCTAAAACTGGAATCTGGCGGTGGATCCGGAGTCGACGGATTTGG
TGATGTCGGTGCTCTTGAGAGTTTGAGGGGAAATGCAGATTTGGCTTACATCCTGAGCATGGA
GCCCTGTGGCCACTGCCTCATTATCAACAATGTGAACTTCTGCCGTGAGTCCGGGCTCCGCA
CCCGCACTGGCTCCAACATCGACTGTGAGAAGTTGCGGCGTCGCTTCTCCTCGCTGCATTTC
ATGGTGGAGGTGAAGGGCGACCTGACTGCCAAGAAAATGGTGCTGGCTTTGCTGGAGCTGG
CGCAGCAGGACCACGGTGCTCTGGACTGCTGCGTGGTGGTCATTCTCTCTCACGGCTGTCAG
GCCAGCCACCTGCAGTTCCCAGGGGCTGTCTACGGCACAGATGGATGCCCTGTGTCGGTCG
AGAAGATTGTGAACATCTTCAATGGGACCAGCTGCCCCAGCCTGGGAGGGAAGCCCAAGCTC
TTTTTCATCCAGGCCTGTGGTGGGGAGCAGAAAGACCATGGGTTTGAGGTGGCCTCCACTTC
CCCTGAAGACGAGTCCCCTGGCAGTAACCCCGAGCCAGATGCCACCCCGTTCCAGGAAGGT
TTGAGGACCTTCGACCAGCTGGACGCCATATCTAGTTTGCCCACACCCAGTGACATCTTTGTG
TCCTACTCTACTTTCCCAGGTTTTGTTTCCTGGAGGGACCCCAAGAGTGGCTCCTGGTACGTT
GAGACCCTGGACGACATCTTTGAGCAGTGGGCTCACTCTGAAGACCTGCAGTCCCTCCTGCT
TAGGGTCGCTAATGCTGTTTCGGTGAAAGGGATTTATAAACAGATGCCTGGTTGCTTTAATTTC
CTCCGGAAAAAACTTTTCTTTAAAACATCAGCTAGCAGAGCCGAGGGCAGGGGAAGTCTTCTA
ACATGCGGGGACGTGGAGGAAAATCCCGGGCCCATGCCACCTCCTCGCCTCCTCTTCTTCCT
CCTCTTCCTCACCCCCATGGAAGTCAGGCCCGAGGAACCTCTAGTGGTGAAGGTGGAAGAGG
GAGATAACGCTGTGCTGCAGTGCCTCAAGGGGACCTCAGATGGCCCCACTCAGCAGCTGAC
CTGGTCTCGGGAGTCCCCGCTTAAACCCTTCTTAAAACTCAGCCTGGGGCTGCCAGGCCTGG
GAATCCACATGAGGCCCCTGGCCATCTGGCTTTTCATCTTCAACGTCTCTCAACAGATGGGGG
GCTTCTACCTGTGCCAGCCGGGGCCCCCCTCTGAGAAGGCCTGGCAGCCTGGCTGGACAGT
CAATGTGGAGGGCAGCGGGGAGCTGTTCCGGTGGAATGTTTCGGACCTAGGTGGCCTGGGC
TGTGGCCTGAAGAACAGGTCCTCAGAGGGCCCCAGCTCCCCTTCCGGGAAGCTCATGAGCC
CCAAGCTGTATGTGTGGGCCAAAGACCGCCCTGAGATCTGGGAGGGAGAGCCTCCGTGTCT
CCCACCGAGGGACAGCCTGAACCAGAGCCTCAGCCAGGACCTCACCATGGCCCCTGGCTCC
ACACTCTGGCTGTCCTGTGGGGTACCCCCTGACTCTGTGTCCAGGGGCCCCCTCTCCTGGAC
CCATGTGCACCCCAAGGGGCCTAAGTCATTGCTGAGCCTAGAGCTGAAGGACGATCGCCCG
GCCAGAGATATGTGGGTAATGGAGACGGGTCTGTTGTTGCCCCGGGCCACAGCTCAAGACG
CTGGAAAGTATTATTGTCACCGTGGCAACCTGACCATGTCATTCCACCTGGAGATCACTGCTC
GGCCAGTACTATGGCACTGGCTGCTGAGGACTGGTGGCTGGAAGGTCTCAGCTGTGACTTTG
GCTTATCTGATCTTCTGCCTGTGTTCCCTTGTGGGCATTCTTCATCTTCAAAGAGCCCTGGTCC
TGAGGAGGAAAAGAAAGCGAATGACTGACCCCACCAGGAGATTCTAACGCGTCATCATCGAT
CCGGATTAGTCCAATTTGTTAAAGACAGGATATCAGTGGTCCAGGCTCTAGTTTTGACTCAAC
AATATCACCAGCTGAAGCCTATAGAGTACGAGCCATAGATAAAATAAAAGATTTTATTTAGTCT
CCAGAAAAAGGGGGGAATGAAAGACCCCACCTGTAGGTTTGGCAAGCTAGCTTAAGTAACGC
CATTTTGCAAGGCATGGAAAAATACATAACTGAGAATAGAGAAGTTCAGATCAAGGTCAGGAA
CAGATGGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGC
TCAGGGCCAAGAACAGATGGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAG
TTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGTCCCCAGATGCGGTCCAGCCCTCAGCAG
TTTCTAGAGAACCATCAGATGTTTCCAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTA
TTTGAACTAACCAATCAGTTCGCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAA
TAAAAGAGCCCACAACCCCTCACTCGGGGCGCCAGTCCTCCGATTGACTGAGTCGCCCGGGT
ACCCGTGTATCCAATAAACCCTCTTGCAGTTGCATCCGACTTGTGGTCTCGCTGTTCCTTGGG
AGGGTCTCCTCTGAGTGATTGACTACCCGTCAGCGGGGGTCTTTCACACATGCAGCATGTAT
CAAAATTAATTTGGTTTTTTTTCTTAAGTATTTACATTAAATGGCCATAGTACTTAAAGTTACATT
GGCTTCCTTGAAATAAACATGGAGTATTCAGAATGTGTCATAAATATTTCTAATTTTAAGATAGT
ATCTCCATTGGCTTTCTACTTTTTCTTTTATTTTTTTTTGTCCTCTGTCTTCCATTTGTTGTTGTT
GTTGTTTGTTTGTTTGTTTGTTGGTTGGTTGGTTAATTTTTTTTTAAAGATCCTACACTATAGTTC
AAGCTAGACTATTAGCTACTCTGTAACCCAGGGTGACCTTGAAGTCATGGGTAGCCTGCTGTT
TTAGCCTTCCCACATCTAAGATTACAGGTATGAGCTATCATTTTTGGTATATTGATTGATTGATT
GATTGATGTGTGTGTGTGTGATTGTGTTTGTGTGTGTGACTGTGAAAATGTGTGTATGGGTGT
GTGTGAATGTGTGTATGTATGTGTGTGTGTGAGTGTGTGTGTGTGTGTGTGCATGTGTGTGTG
TGTGACTGTGTCTATGTGTATGACTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
GTGTGTGTTGTGAAAAAATATTCTATGGTAGTGAGAGCCAACGCTCCGGCTCAGGTGTCAGGT
TGGTTTTTGAGACAGAGTCTTTCACTTAGCTTGGAATTCACTGGCCGTCGTTTTACAACGTCGT
GACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAG
CTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATG
GCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATAT
GGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCA
ACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGT
GACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGATGA
CGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGA
CGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACA
TTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGG
AAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTC
CTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCAC
GAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAA
GAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTG
ACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTAC
TCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCC
ATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGA
GCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGA
GCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAA
CGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACT
GGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTT
ATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCC
AGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATG
AACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACC
AAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGA
AGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTC
AGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGC
TTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACT
CTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAG
CCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATC
CTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACG
ATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGC
TTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCAC
GCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGA
GCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCC
ACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAAC
GCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTT
CCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCT
CGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCA
ATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTT
TCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGG
CACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAAC
AATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTTTGCTCTTAGGAGTTTCCTAA
TACATCCCAAACTCAAATATATAAAGCATTTGACTTGTTCTATGCCCTAGGGGGCGGGGGGAA
GCTAAGCCAGCTTTTTTTAACATTTAAAATGTTAATTCCATTTTAAATGCACAGATGTTTTTATTT
CATAAGGGTTTCAATGTGCATGAATGCTGCAATATTCCTGTTACCAAAGCTAGTATAAATAAAA
ATAGATAAACGTGGAAATTACTTAGAGTTTCTGTCATTAACGTTTCCTTCCTCAGTTGACAACAT
AAATGCGCTGCTGAGCAAGCCAGTTTGCATCTGTCAGGATCAATTTCCCATTATGCCAGTCAT
ATTAATTACTAGTCAATTAGTTGATTTTTATTTTTGACATATACATGTGAA (nucleotide
sequence of Fv'Fvls with XhoI/SalI linkers, (wobbled codons
lowercase in Fv')) SEQ ID NO: 18
ctcgagGGcGTcCAaGTcGAaACcATtagtCCcGGcGAtGGcaGaACaTTtCCtAAaaGgGGaCAaACaTGt
GTcGTcCAtTAtACaGGcATGtTgGAgGAcGGcAAaAAgGTgGAcagtagtaGaGAtcGcAAtAAaCCtTTc
AAaTTcATGtTgGGaAAaCAaGAaGTcATtaGgGGaTGGGAgGAgGGcGTgGCtCAaATGtccGTcGGc
CAacGcGCtAAgCTcACcATcagcCCcGAcTAcGCaTAcGGcGCtACcGGaCAtCCcGGaATtATtCCcC
CtCAcGCtACctTgGTgTTtGAcGTcGAaCTgtTgAAgCTcGAagtcgagggagtgcaggtggaaaccatctcc-
ccag
gagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcactacaccgggatgcttgaagatggaaag-
aaagttgattcctc
ccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgaggctgggaagaaggggttg-
cccagatgagtgtg
ggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggcatcatcccacc-
acatgccactctcgtctt
cgatgtggagcttctaaaactggaatctggcggtggatccggagtcgag (FV'FVLS amino
acid sequence) SEQ ID NO: 19
GlyValGlnValGluThrIleSerProGlyAspGlyArgThrPheProLysArgGlyGlnThrCysValValHi-
sTyrThrGlyMet
LeuGluAspGlyLysLysValAspSerSerArgAspArgAsnLysProPheLysPheMetLeuGlyLysGlnGl-
uValIleArg
GlyTrpGluGluGlyValAlaGlnMetSerValGlyGlnArgAlaLysLeuThrIleSerProAspTyrAlaTy-
rGlyAlaThrGly
HisProGlyIleIleProProHisAlaThrLeuValPheAspValGluLeuLeuLysLeuGlu(ValGlu)
GlyValGlnValGluThrIleSerProGlyAspGlyArgThrPheProLysArgGlyGlnThrCysValValHi-
sTyrThrGlyMet
LeuGluAspGlyLysLysValAspSerSerArgAspArgAsnLysProPheLysPheMetLeuGlyLysGlnGl-
uValIleArg
GlyTrpGluGluGlyValAlaGlnMetSerValGlyGlnArgAlaLysLeuThrIleSerProAspTyrAlaTy-
rGlyAlaThrGly
HisProGlyIleIleProProHisAlaThrLeuValPheAspValGluLeuLeuLysLeuGluSerGlyGlyGl-
ySerGly
Example 7: Representative Embodiments
[0523] Provided hereafter are examples of certain embodiments of
the technology.
[0524] A1. A method of administering donor T cells to a human
patient, comprising [0525] a) transfecting or transducing human
donor T cells in a donor cell culture with a nucleic acid including
a promoter region and a nucleotide sequence that encodes a chimeric
protein comprising a multimeric ligand binding region and a caspase
9 polypeptide; and [0526] b) administering the transduced or
transfected donor T cells to the human patient.
[0527] A2. A method of reducing the effect of graft versus host
disease in a human patient following donor T cell transplantation,
comprising [0528] a) transfecting or transducing human donor T
cells in a donor cell culture with a nucleic acid including a
promoter region and a nucleotide sequence that encodes a chimeric
protein comprising a multimeric ligand binding region and a caspase
9 polypeptide; [0529] b) administering the transduced or
transfected donor T cells to the patient; [0530] c) detecting the
presence or absence of graft versus host disease in the patient
after (b); and [0531] d) administering a multimeric ligand that
binds to the multimeric ligand binding region to a patient for whom
the presence of graft versus host disease is detected.
[0532] A3. A method of stem cell transplantation, comprising [0533]
a) administering a haploidentical stem cell transplant to a human
patient; and [0534] b) administering haploidentical donor T cells
to the patient, wherein the T cells are transfected or transduced
in a haploidentical donor cell culture with a nucleic acid
including a promoter region and a nucleotide sequence that encodes
a chimeric protein comprising a multimeric ligand binding region
and a caspase 9 polypeptide.
[0535] A4. The method of embodiment A3, wherein the haploidentical
stem cell transplant is a CD34.sup.+ haploidentical stem cell
transplant.
[0536] A5. The method of any of embodiments A1-A4 wherein the human
donor T cells are haploidentical to the patient's T cells.
[0537] A6 The method of any of embodiments A1-A5, or A59, wherein
the patient has cancer.
[0538] A7 The method of any of embodiments A1-A6, or A58, wherein
the patient has a solid tumor.
[0539] A8 The method of embodiments A8, or A59, wherein the cancer
is present in the blood or bone marrow of the patient.
[0540] A9 The method of any of embodiments A1-A8, or A59, wherein
the patient has a blood or bone marrow disease.
[0541] A10 The method of any of embodiments A1-9, or A59, wherein
the patient has been diagnosed with any condition or disorder that
can be alleviated by stem cell transplantation.
[0542] A11 The method of any of embodiments A1-A10, or A59, wherein
the patient has been diagnosed with sickle cell anemia or
metachromatic leukodystrophy.
[0543] A12 The method of any of embodiments A1-A11, wherein the
promoter is activated in activated T cells.
[0544] A13. The method of any of embodiments A1-A12, wherein the
promoter comprises a 5' LTR sequence.
[0545] A14. The method of any of embodiments A1-A13, or A59,
wherein the chimeric protein further comprises a marker
polypeptide.
[0546] A15. The method of embodiment A14, wherein the marker
polypeptide is a CD19 polypeptide.
[0547] A16. The method of embodiment A14, further comprising a
selection step, wherein cells that express the marker are selected
for administration to the patient.
[0548] A17. The method of embodiment A14, wherein the cells are
selected by immunomagnetic selection.
[0549] A18. The method of any of embodiments A1-A17, or A59,
wherein the caspase 9 polypeptide is a truncated caspase 9
polypeptide.
[0550] A19. The method of embodiment A18, wherein the caspase 9
polypeptide lacks the caspase recruitment domain.
[0551] A20. The method of embodiment A18, wherein the caspase 9
polypeptide comprises the amino acid sequence of SEQ ID NO: 9, or a
fragment thereof, or is encoded by the nucleotide sequence of SEQ
ID NO: 8, or a fragment thereof.
[0552] A21. The method of any of embodiments A1-A20, wherein the
donor cell culture is prepared from a bone marrow sample.
[0553] A22 The method of any of embodiments A1-A20, wherein the
donor cell culture is prepared from peripheral blood.
[0554] A23. The method of embodiment A22, wherein the donor cell
culture is prepared from donor peripheral blood mononuclear
cells.
[0555] A24. The method of any of embodiments A1-A23, wherein the
donor T cells are allodepleted from the donor cell culture before
transfection or transduction.
[0556] A25. The method of any of embodiments A1-A24, wherein the
transduced or transfected T cells are cultured in the presence of
IL-2 before administration to the patient.
[0557] A26. The method of any of embodiments A1-A25, further
comprising administering a multimeric ligand that binds to the
multimeric ligand binding region.
[0558] A27. The method of any of embodiments A1-A26, or A59,
wherein the multimeric ligand binding region is selected from the
group consisting of FKBP, cyclophilin receptor, steroid receptor,
tetracycline receptor, heavy chain antibody subunit, light chain
antibody subunit, single chain antibodies comprised of heavy and
light chain variable regions in tandem separated by a flexible
linker domain, and mutated sequences thereof.
[0559] A28. The method of any of embodiments A1-A27, or A59,
wherein the multimeric ligand binding region is an FKBP12
region.
[0560] A29. The method of embodiments A26 or A59, wherein the
multimeric ligand is an FK506 dimer or a dimeric FK506 analog
ligand.
[0561] A30. The method of embodiments A26 or A59, wherein the
multimeric ligand is AP1903.
[0562] A31. The method of embodiments A26 or A59, wherein the
multimeric ligand is administered to treat graft versus host
disease.
[0563] A32. The method of any of embodiments A1-A31, wherein the
patient exhibits graft versus host disease symptoms before the
multimeric ligand is administered.
[0564] A33. The method of embodiments A32 or A59, wherein the
patient exhibits one or more Stage 0 graft versus host disease
symptoms.
[0565] A34 The method of embodiments A32 or A59, wherein the
patient exhibits one or more Stage 1 graft versus host disease
symptoms.
[0566] A35 The method of embodiments A32 or A59, wherein the
patient exhibits one or more Stage 2 graft versus host disease
symptoms.
[0567] A36 The method of embodiments A32 or A59, wherein the
patient exhibits one or more Stage 3 graft versus host disease
symptoms.
[0568] A37 The method of embodiments A32 or A59, wherein the
patient exhibits one or more Stage 4 graft versus host disease
symptoms.
[0569] A38. The method of embodiment A32 or A59, wherein more than
one dose of the multimeric ligand is administered.
[0570] A39. The method of embodiment A32, wherein after
administration of the multimeric ligand, the number of alloreactive
T cells is reduced.
[0571] A40. The method of any of embodiments A31-A39, wherein the
alloreactive T cells express the marker and CD3.
[0572] A41. The method of any of embodiments A31-A40, wherein the
number of alloreactive T cells is reduced by about 90% or more
after administration of the multimeric ligand.
[0573] A42. The method of any of embodiments A31-A41, wherein after
administration of the multimeric ligand, donor T cells survive in
the patient that are able to expand and are reactive to viruses and
fungi.
[0574] A43. The method of any of embodiments A31-A42, wherein after
administration of the multimeric ligand, donor T cells survive in
the patient that are able to expand and are reactive to tumor cells
in the patient.
[0575] A44. The method of any of embodiments A1-A43, wherein the
patients have received haplo-CD34+ stem cell transplants before or
at the same time as administration of the donor T cells.
[0576] A45. The method of any of embodiments A1-A44, wherein the
donor T cells are transduced or transfected with a retroviral
vector.
[0577] A46. The method of embodiment A45, wherein the retroviral
vector is a murine leukemia virus vector.
[0578] A47. The method of embodiment A45, wherein the retroviral
vector is an SFG vector.
[0579] A48 The method of any of embodiments A1-A47, wherein the
transfected or transduced cells are further transfected or
transduced with a gene expression vector.
[0580] A49. The method of any of embodiments A31-A48, or A59,
further comprising determining whether to administer an additional
dose or additional doses of the multimeric ligand to the patient
based upon the appearance of graft versus host disease symptoms in
the patient.
[0581] A50. The method of any of embodiments A31-A48, or A59,
further comprising determining whether to administer an additional
dose or additional doses of the multimeric ligand to the patient,
wherein the determination is based upon the amount or concentration
of marker and CD3 positive T cells in the patient.
[0582] A51. The method of any of embodiments A1-A50, wherein at
least 1.times.10.sup.6 transduced or transfected donor T cells are
administered to the patient.
[0583] A52. The method of any of embodiments A1-A50, wherein at
least 1.times.10.sup.7 transduced or transfected donor T cells are
administered to the patient.
[0584] A53. The method of any of embodiments A1-A50, wherein at
least 1.times.10.sup.8 transduced or transfected donor T cells are
administered to the patient.
[0585] A54. The method of any of embodiments A1-A53, further
comprising [0586] identifying the presence, absence or stage of
graft versus host disease in the patient, and [0587] administering
a multimeric ligand that binds to the multimeric ligand binding
region, maintaining a subsequent dosage of the multimeric ligand,
or adjusting a subsequent dosage of the multimeric ligand to the
patient based on the presence, absence or stage of the graft versus
host disease identified in the patient.
[0588] A55. The method of any of embodiments A1-A53, further
comprising [0589] identifying the presence, absence or stage of
graft versus host disease in the patient, and [0590] determining
whether a multimeric ligand that binds to the multimeric ligand
binding region should be administered to the patient, or the dosage
of the multimeric ligand subsequently administered to the patient
is adjusted based on the presence, absence or stage of the graft
versus host disease identified in the patient.
[0591] A56. The method of any of embodiments A1-A53, or A59,
further comprising [0592] receiving information comprising the
presence, absence or stage of graft versus host disease in the
patient; and [0593] administering a multimeric ligand that binds to
the multimeric ligand binding region, maintaining a subsequent
dosage of the multimeric ligand, or adjusting a subsequent dosage
of the multimeric ligand to the patient based on the presence,
absence or stage of the graft versus host disease identified in the
patient.
[0594] A57. The method of any of embodiments A1-A53, or A59,
further comprising [0595] identifying the presence, absence or
stage of graft versus host disease in the patient, and [0596]
transmitting the presence, absence or stage of the graft versus
host disease to a decision maker who administers a multimeric
ligand that binds to the multimeric ligand binding region,
maintains a subsequent dosage of the multimeric ligand, or adjusts
a subsequent dosage of the multimeric ligand administered to the
patient based on the presence, absence or stage of the graft versus
host disease identified in the subject.
[0597] A58. The method of any of embodiments A1-A53, or A59,
further comprising [0598] identifying the presence, absence or
stage of graft versus host disease in the patient, and [0599]
transmitting an indication to administer a multimeric ligand that
binds to the multimeric binding region, maintain a subsequent
dosage of the multimeric ligand or adjust a subsequent dosage of
the multimeric ligand administered to the patient based on the
presence, absence or stage of the graft versus host disease
identified in the subject.
[0600] A59. A method of treating graft versus host disease in a
patient who has undergone cell therapy, wherein one or more of the
cells introduced for the therapy expresses a chimeric protein,
wherein the chimeric protein comprises a multimeric ligand binding
region and a caspase 9 polypeptide, comprising administering a
multimeric ligand that binds to the multimeric ligand binding
region to the patient.
[0601] A60. The method of any of embodiments A1-A59, wherein after
administration of the multimeric ligand that binds to the
multimeric binding region, the number of alloreactive T cells is
reduced.
[0602] A61. The method of embodiment A60, wherein alloreactive T
cells that are not undergoing cell division are ablated.
[0603] A62. The method of embodiment A60, wherein within 2 hours of
administration of the multimeric ligand, at least 90% of
CD3+.DELTA.CD19+ cells are ablated.
[0604] A63. The method of embodiment A60, wherein within 1 hour of
administration of the multimeric ligand, at least 90% of
CD3+.DELTA.CD19+ cells are ablated.
[0605] A64. The method of embodiment A60, wherein within 30 minutes
of administration of the multimeric ligand, at least 90% of
CD3+.DELTA.CD19+ cells are ablated.
[0606] A65. The method of any of embodiments A62-A64, wherein
within 24 hours of administration of the multimeric ligand, there
is a further log reduction of CD3+.DELTA.CD19+ cells compared to
the amount of CD3+.DELTA.CD19+ cells at 30 minutes after
administration of the multimeric ligand.
[0607] A66. The method of any of embodiments A62-A65, further
comprising a resolution of skin and liver GvHD within 24 hours
after administration of the multimeric ligand.
[0608] B1. A method of controlling the survival of transplanted
therapeutic cells in a patient, comprising [0609] a) preparing or
obtaining therapeutic cells; [0610] b) transfecting or transducing
the therapeutic cells with a nucleic acid including a promoter
region and a nucleotide sequence that encodes a chimeric protein
comprising a multimeric ligand binding region and a caspase 9
polypeptide; [0611] c) transplanting the transduced or transfected
therapeutic cells into the patient; and [0612] d) after step c),
administering a multimeric ligand to the patient, wherein the
multimeric ligand binds to the multimeric ligand binding region
wherein transplanted therapeutic cells that express the caspase 9
polypeptide are killed following administration of the multimeric
ligand.
[0613] B2. A method of transplanting therapeutic cells in a human
patient, comprising [0614] a) preparing or obtaining cells for
transplantation; [0615] b) transfecting or transducing the cells
with a nucleic acid including a promoter region and a nucleotide
sequence that encodes a chimeric protein comprising a multimeric
ligand binding region and a caspase 9 polypeptide; and [0616] c)
transplanting the transduced or transfected therapeutic cells into
the human patient.
[0617] B3. A method of preparing progenitor therapeutic cells for
transplantation in a patient, comprising [0618] a) preparing or
obtaining cells for transplantation; and [0619] b) transfecting or
transducing the cells with a nucleic acid including a promoter
region and a nucleotide sequence that encodes a chimeric protein
comprising a multimeric ligand binding region and a caspase 9
polypeptide.
[0620] B4. The method of embodiment B1 or B3, wherein the patient
is a human patient.
[0621] B5. The method of embodiment B2, wherein a multimeric ligand
is administered to the patient, wherein the multimeric ligand binds
to the multimeric ligand binding region.
[0622] B6. The method of embodiment B1 or B3, wherein the
multimeric ligand is administered to kill transplanted therapeutic
cells.
[0623] B7. The method of any of embodiments B1-B6, wherein the
therapeutic cells are obtained or prepared from bone marrow.
[0624] B8. The method of any of embodiments B1-B6, wherein the
therapeutic cells are obtained or prepared from umbilical cord
blood.
[0625] B9. The method of any of embodiments B1-B2, wherein the
therapeutic cells are obtained or prepared from peripheral
blood.
[0626] B10. The method of embodiment B9, wherein the therapeutic
cells are obtained or prepared from peripheral blood mononuclear
cells.
[0627] B11. The method of any of embodiments B1-B10, wherein the
therapeutic cells are progenitor cells.
[0628] B12. The method of any of embodiments B1-B11, wherein the
therapeutic cells are hematopoietic progenitor cells.
[0629] B13. The method of any of embodiments B1-B12, wherein the
therapeutic cells are selected from the group consisting of
mesenchymal stromal cells, embryonic stem cells, and inducible
pluripotent stem cells.
[0630] B14. The method of any of embodiments B1-B13, wherein the
promoter is developmentally regulated and the caspase 9 polypeptide
is expressed in developmentally differentiated cells.
[0631] B15. The method of any of embodiments B1-B13, wherein the
promoter is tissue specific and the caspase 9 polypeptide is
expressed in the specific tissue.
[0632] B16 The method of any of embodiments B1-B15, wherein the
patient has cancer.
[0633] B17 The method of any of embodiments B1-B16, wherein the
patient has a solid tumor.
[0634] B18 The method of any of embodiments B1-B17, wherein the
cancer is present in the blood or bone marrow of the patient.
[0635] B19 The method of any of embodiments B1-B18, wherein the
patient has a blood or bone marrow disease.
[0636] B20 The method of any of embodiments B1-B19, wherein the
patient has any condition or disorder that can be alleviated by
stem cell transplantation.
[0637] B21 The method of any of embodiments B1-B19, wherein the
patient has been diagnosed with sickle cell anemia or metachromatic
leukodystrophy.
[0638] B22. The method of any of embodiments B1-B21, wherein the
chimeric protein further comprises a marker polypeptide.
[0639] B23. The method of any of embodiments B1-B22, wherein the
marker polypeptide is a CD19 polypeptide.
[0640] B24. The method of any of embodiments B1-B23, further
comprising a selection step, wherein cells that express the marker
are selected for administration to the patient.
[0641] B25. The method of any of embodiments B1-B24, wherein the
cells are selected by immunomagnetic selection.
[0642] B26. The method of any of embodiments B1-B25, wherein the
caspase 9 polypeptide is a truncated caspase 9 polypeptide.
[0643] B27. The method of embodiment B26, wherein the caspase 9
polypeptide lacks the caspase recruitment domain.
[0644] B28. The method of embodiment B26, wherein the caspase 9
polypeptide comprises the amino acid sequence of SEQ ID NO: 9, or a
fragment thereof, or is encoded by the nucleotide sequence of SEQ
ID NO: 8, or a fragment thereof.
[0645] B29. The method of any of embodiments B1-B28, wherein the
multimeric ligand binding region is selected from the group
consisting of FKBP, cyclophilin receptor, steroid receptor,
tetracycline receptor, heavy chain antibody subunit, light chain
antibody subunit, single chain antibodies comprised of heavy and
light chain variable regions in tandem separated by a flexible
linker domain, and mutated sequences thereof.
[0646] B30. The method of any of embodiments B1-B29, wherein the
multimeric ligand binding region is an FKBP12 region.
[0647] B31. The method of embodiment B1 or B5, wherein the
multimeric ligand is an FK506 dimer or a dimeric FK506 analog
ligand.
[0648] B32. The method of embodiment B1 or B5, wherein the
multimeric ligand is AP1903.
[0649] B33. The method of embodiment B1 or B5, wherein more than
one dose of the multimeric ligand is administered.
[0650] B34. The method of any of embodiments B1-B33, wherein the
therapeutic cells are transduced or transfected with a retroviral
vector.
[0651] B35. The method of embodiment B34, wherein the retroviral
vector is a murine leukemia virus vector.
[0652] B36. The method of embodiment B34, wherein the retroviral
vector is an SFG vector.
[0653] B37. The method of any of embodiments B1-B36, wherein the
transfected or transduced cells are further transfected or
transduced with a gene expression vector.
[0654] B38. The method of any of embodiments B1 or B2, further
comprising [0655] identifying a presence or absence of a condition
in the patient that requires the removal of transfected or
transduced therapeutic cells from the patient; and [0656]
administering a multimeric ligand that binds to the multimeric
ligand binding region, maintaining a subsequent dosage of the
multimeric ligand, or adjusting a subsequent dosage of the
multimeric ligand to the patient based on the presence or absence
of the condition identified in the patient.
[0657] B39. The method of any of embodiments B1 or B2 further
comprising [0658] identifying a presence or absence of a condition
in the patient that requires the removal of transfected or
transduced therapeutic cells from the patient; and [0659]
determining whether a multimeric ligand that binds to the
multimeric ligand binding region should be administered to the
patient, or the dosage of the multimeric ligand subsequently
administered to the patient is adjusted based on the presence or
absence of the condition identified in the patient.
[0660] B40. The method of any of embodiments B1 or B2, further
comprising [0661] receiving information comprising presence or
absence of a condition in the patient that requires the removal of
transfected or transduced therapeutic cells from the patient; and
[0662] administering a multimeric ligand that binds to the
multimeric ligand binding region, maintaining a subsequent dosage
of the multimeric ligand, or adjusting a subsequent dosage of the
multimeric ligand to the patient based on the presence or absence
of the condition identified in the patient.
[0663] B41. The method of any of embodiments B1 or B2, further
comprising [0664] identifying a presence or absence of a condition
in the patient that requires the removal of transfected or
transduced therapeutic cells from the patient; and [0665]
transmitting the presence, absence or stage of the condition
identified in the patient to a decision maker who administers a
multimeric ligand that binds to the multimeric ligand binding
region, maintains a subsequent dosage of the multimeric ligand, or
adjusts a subsequent dosage of the multimeric ligand administered
to the patient based on the presence, absence or stage of the
condition identified in the patient.
[0666] B42. The method of any of embodiments B1 or B2, further
comprising [0667] identifying a presence or absence of a condition
in the patient that requires the removal of transfected or
transduced therapeutic cells from the patient; and [0668]
transmitting an indication to administer a multimeric ligand that
binds to the multimeric ligand binding region, maintains a
subsequent dosage of the multimeric ligand, or adjusts a subsequent
dosage of the multimeric ligand administered to the patient based
on the presence, absence or stage of the condition identified in
the patient.
[0669] B43. The method of any of embodiments B1-42, wherein the
therapeutic cells are transduced or transfected with a second
nucleic acid that encodes a second heterologous protein.
[0670] B44. The method of any of embodiments B1-42, wherein the
therapeutic cells are transduced with a heterologous gene that
expresses a chimeric antigen receptor.
[0671] B45. The method of any of embodiments B1-B42, wherein the
therapeutic cells are transduced with a heterologous gene that
expresses a modified TGF-beta receptor.
[0672] B46. The method of embodiments B43, B44, or B45, wherein the
therapeutic cells are transduced with the heterologous gene before,
at the same time as, or after being transduced with the nucleic
acid encoding the chimeric protein comprising a multimeric ligand
binding region and a caspase 9 polypeptide;
[0673] C1. A cell, comprising a nucleic acid including a promoter
region and a nucleotide sequence that encodes a chimeric protein
comprising a multimeric ligand binding region and a caspase 9
polypeptide, wherein the cell is obtained or prepared from bone
marrow or umbilical cord blood.
[0674] C2. The cell of embodiment C1, wherein the cell is a human
cell.
[0675] C3. The cell of any of embodiments C1-C2, wherein cell is a
progenitor cell.
[0676] C4. The cell of any of embodiments C1-C2, wherein the cell
is a hematopoietic progenitor cell.
[0677] C5. The cell of any of embodiments C1-C4, wherein the cell
is selected from the group consisting of mesenchymal stromal cells,
embryonic stem cells, and inducible pluripotent stem cells.
[0678] C6. The cell of any of embodiments C1-C5, wherein the
promoter is developmentally regulated and the caspase 9 polypeptide
is expressed in developmentally differentiated cells.
[0679] C7. The cell of any of embodiments C1-C5, wherein the
promoter is tissue-specific and the caspase 9 polypeptide is
expressed in the specific tissue.
[0680] C8. The cell of any of embodiments C1-C7, wherein the
chimeric protein further comprises a marker polypeptide.
[0681] C9. The cell of embodiment C8, wherein the marker
polypeptide is a CD19 polypeptide.
[0682] C10. The cell of any of embodiments C1-C9, wherein the
caspase 9 polypeptide is a truncated caspase 9 polypeptide.
[0683] C11. The cell of embodiment C10, wherein the caspase 9
polypeptide lacks the caspase recruitment domain.
[0684] C12. The cell of embodiment C11, wherein the caspase 9
polypeptide comprises the amino acid sequence of SEQ ID NO: 9, or a
fragment thereof, or is encoded by the nucleotide sequence of SEQ
ID NO: 8, or a fragment thereof.
[0685] C13. The cell of any of embodiments C1-C12, wherein the
multimeric ligand binding region is selected from the group
consisting of FKBP, cyclophilin receptor, steroid receptor,
tetracycline receptor, heavy chain antibody subunit, light chain
antibody subunit, single chain antibodies comprised of heavy and
light chain variable regions in tandem separated by a flexible
linker domain, and mutated sequences thereof.
[0686] C14. The cell of any of embodiments C1-C13, wherein the
multimeric ligand binding region is an FKBP12 region.
[0687] C15. The cell of any of embodiments C1-C14, wherein the
cells are transduced or transfected with a retroviral vector.
[0688] C16. The cell of embodiment C15, wherein the retroviral
vector is a murine leukemia virus vector.
[0689] C17. The cell of embodiment C16, wherein the retroviral
vector is an SFG vector.
[0690] C18. The cell of any of embodiments C1-C17, wherein the
transfected or transduced cells are further transfected or
transduced with a gene expression vector.
[0691] D1. A method of administering donor T cells to a human
patient, comprising [0692] a) transfecting or transducing
non-allodepleted human donor T cells in a donor cell culture with a
nucleic acid including a promoter region and a nucleotide sequence
that encodes a chimeric protein comprising a multimeric ligand
binding region and a caspase 9 polypeptide; and [0693] b)
administering the transduced or transfected donor T cells to the
human patient.
[0694] D2. A method of reducing the effect of graft versus host
disease in a human patient following donor T cell transplantation,
comprising [0695] a) transfecting or transducing non-allodepleted
human donor T cells in a donor cell culture with a nucleic acid
including a promoter region and a nucleotide sequence that encodes
a chimeric protein comprising a multimeric ligand binding region
and a caspase 9 polypeptide; [0696] b) administering the transduced
or transfected donor T cells to the patient; [0697] c) detecting
the presence or absence of graft versus host disease in the patient
after (b); and [0698] d) administering a multimeric ligand that
binds to the multimeric ligand binding region to a patient for whom
the presence of graft versus host disease is detected.
[0699] D3. A method of stem cell transplantation, comprising [0700]
a) administering a haploidentical stem cell transplant to a human
patient; and [0701] b) administering non-allodepleted
haploidentical donor T cells to the patient, wherein the T cells
are transfected or transduced in a haploidentical donor cell
culture with a nucleic acid including a promoter region and a
nucleotide sequence that encodes a chimeric protein comprising a
multimeric ligand binding region and a caspase 9 polypeptide.
[0702] D4. The method of any of embodiments D1-D3, wherein at least
1.times.10.sup.6 cells/Kg body weight are administered to the
patient.
[0703] D5. The method of any of embodiments D1-D3, wherein at least
3.times.10.sup.6 cells/Kg body weight are administered to the
patient.
[0704] D6. The method of any of embodiments D1-D3, wherein at least
5.times.10.sup.6 cells/Kg body weight are administered to the
patient.
[0705] D7. The method of any of embodiments D1-D3, wherein at least
7.times.10.sup.6 cells/Kg body weight are administered to the
patient.
[0706] D8. The method of any of embodiments D1-D3, wherein at least
9.times.10.sup.6 cells/Kg body weight are administered to the
patient.
[0707] E1. The method of any of embodiments A1-A66, B1-B46, or
D1-D8, wherein the chimeric protein comprises a caspase 1, caspase
3, or caspase 8 polypeptide and not a caspase 9 polypeptide.
[0708] E2. The method of embodiment E1, wherein the caspase 1,
caspase 3 or caspase 8 polypeptide is truncated.
[0709] E3. The method of embodiment E2, wherein the caspase 1,
caspase 3, or caspase 8 polypeptide lacks the caspase recruitment
domain.
[0710] E4. The cell of any of embodiments C1-C18, wherein the
chimeric protein comprises a caspase 1, caspase 3, or caspase 8
polypeptide and not a caspase 9 polypeptide.
[0711] E5. The cell of embodiment E4, wherein the caspase 1,
caspase 3 pr caspase 8 polypeptide is truncated.
[0712] E6. The cell of embodiment E5, wherein the caspase 1,
caspase 3, or caspase 8 polypeptide lacks the caspase recruitment
domain.
[0713] The entirety of each patent, patent application, publication
and document referenced herein hereby is incorporated by reference.
Citation of the above patents, patent applications, publications
and documents is not an admission that any of the foregoing is
pertinent prior art, nor does it constitute any admission as to the
contents or date of these publications or documents.
[0714] Modifications may be made to the foregoing without departing
from the basic aspects of the technology. Although the technology
has been described in substantial detail with reference to one or
more specific embodiments, those of ordinary skill in the art will
recognize that changes may be made to the embodiments specifically
disclosed in this application, yet these modifications and
improvements are within the scope and spirit of the technology.
[0715] The technology illustratively described herein suitably may
be practiced in the absence of any element(s) not specifically
disclosed herein. Thus, for example, in each instance herein any of
the terms "comprising," "consisting essentially of," and
"consisting of" may be replaced with either of the other two terms.
The terms and expressions which have been employed are used as
terms of description and not of limitation, and use of such terms
and expressions do not exclude any equivalents of the features
shown and described or portions thereof, and various modifications
are possible within the scope of the technology claimed. The term
"a" or "an" can refer to one of or a plurality of the elements it
modifies (e.g., "a reagent" can mean one or more reagents) unless
it is contextually clear either one of the elements or more than
one of the elements is described. The term "about" as used herein
refers to a value within 10% of the underlying parameter (i.e.,
plus or minus 10%), and use of the term "about" at the beginning of
a string of values modifies each of the values (i.e., "about 1, 2
and 3" refers to about 1, about 2 and about 3). For example, a
weight of "about 100 grams" can include weights between 90 grams
and 110 grams. Further, when a listing of values is described
herein (e.g., about 50%, 60%, 70%, 80%, 85% or 86%) the listing
includes all intermediate and fractional values thereof (e.g., 54%,
85.4%). Thus, it should be understood that although the present
technology has been specifically disclosed by representative
embodiments and optional features, modification and variation of
the concepts herein disclosed may be resorted to by those skilled
in the art, and such modifications and variations are considered
within the scope of this technology.
[0716] Certain embodiments of the technology are set forth in the
claim(s) that follow(s).
Sequence CWU 1
1
291590DNAUnknownDescription of Unknown 5' Long terminal repeat
viral genomic polynucleotide 1tgaaagaccc cacctgtagg tttggcaagc
tagcttaagt aacgccattt tgcaaggcat 60ggaaaaatac ataactgaga atagaaaagt
tcagatcaag gtcaggaaca gatggaacag 120ctgaatatgg gccaaacagg
atatctgtgg taagcagttc ctgccccggc tcagggccaa 180gaacagatgg
aacagctgaa tatgggccaa acaggatatc tgtggtaagc agttcctgcc
240ccggctcagg gccaagaaca gatggtcccc agatgcggtc cagccctcag
cagtttctag 300agaaccatca gatgtttcca gggtgcccca aggacctgaa
atgaccctgt gccttatttg 360aactaaccaa tcagttcgct tctcgcttct
gttcgcgcgc ttatgctccc cgagctcaat 420aaaagagccc acaacccctc
actcggggcg ccagtcctcc gattgactga gtcgcccggg 480tacccgtgta
tccaataaac cctcttgcag ttgcatccga cttgtggtct cgctgttcct
540tgggagggtc tcctctgagt gattgactac ccgtcagcgg gggtctttca
5902321DNAHomo sapiens 2ggagtgcagg tggaaaccat ctccccagga gacgggcgca
ccttccccaa gcgcggccag 60acctgcgtgg tgcactacac cgggatgctt gaagatggaa
agaaagttga ttcctcccgg 120gacagaaaca agccctttaa gtttatgcta
ggcaagcagg aggtgatccg aggctgggaa 180gaaggggttg cccagatgag
tgtgggtcag agagccaaac tgactatatc tccagattat 240gcctatggtg
ccactgggca cccaggcatc atcccaccac atgccactct cgtcttcgat
300gtggagcttc taaaactgga a 3213107PRTHomo sapiens 3Gly Val Gln Val
Glu Thr Ile Ser Pro Gly Asp Gly Arg Thr Phe Pro1 5 10 15Lys Arg Gly
Gln Thr Cys Val Val His Tyr Thr Gly Met Leu Glu Asp 20 25 30Gly Lys
Lys Val Asp Ser Ser Arg Asp Arg Asn Lys Pro Phe Lys Phe 35 40 45Met
Leu Gly Lys Gln Glu Val Ile Arg Gly Trp Glu Glu Gly Val Ala 50 55
60Gln Met Ser Val Gly Gln Arg Ala Lys Leu Thr Ile Ser Pro Asp Tyr65
70 75 80Ala Tyr Gly Ala Thr Gly His Pro Gly Ile Ile Pro Pro His Ala
Thr 85 90 95Leu Val Phe Asp Val Glu Leu Leu Lys Leu Glu 100
105418DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 4tctggcggtg gatccgga 1856PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 5Ser
Gly Gly Gly Ser Gly1 566DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 6gtcgac
672PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 7Val Asp18846DNAHomo sapiens 8ggatttggtg
atgtcggtgc tcttgagagt ttgaggggaa atgcagattt ggcttacatc 60ctgagcatgg
agccctgtgg ccactgcctc attatcaaca atgtgaactt ctgccgtgag
120tccgggctcc gcacccgcac tggctccaac atcgactgtg agaagttgcg
gcgtcgcttc 180tcctcgctgc atttcatggt ggaggtgaag ggcgacctga
ctgccaagaa aatggtgctg 240gctttgctgg agctggcgca gcaggaccac
ggtgctctgg actgctgcgt ggtggtcatt 300ctctctcacg gctgtcaggc
cagccacctg cagttcccag gggctgtcta cggcacagat 360ggatgccctg
tgtcggtcga gaagattgtg aacatcttca atgggaccag ctgccccagc
420ctgggaggga agcccaagct ctttttcatc caggcctgtg gtggggagca
gaaagaccat 480gggtttgagg tggcctccac ttcccctgaa gacgagtccc
ctggcagtaa ccccgagcca 540gatgccaccc cgttccagga aggtttgagg
accttcgacc agctggacgc catatctagt 600ttgcccacac ccagtgacat
ctttgtgtcc tactctactt tcccaggttt tgtttcctgg 660agggacccca
agagtggctc ctggtacgtt gagaccctgg acgacatctt tgagcagtgg
720gctcactctg aagacctgca gtccctcctg cttagggtcg ctaatgctgt
ttcggtgaaa 780gggatttata aacagatgcc tggttgcttt aatttcctcc
ggaaaaaact tttctttaaa 840acatca 8469282PRTHomo sapiens 9Gly Phe Gly
Asp Val Gly Ala Leu Glu Ser Leu Arg Gly Asn Ala Asp1 5 10 15Leu Ala
Tyr Ile Leu Ser Met Glu Pro Cys Gly His Cys Leu Ile Ile 20 25 30Asn
Asn Val Asn Phe Cys Arg Glu Ser Gly Leu Arg Thr Arg Thr Gly 35 40
45Ser Asn Ile Asp Cys Glu Lys Leu Arg Arg Arg Phe Ser Ser Leu His
50 55 60Phe Met Val Glu Val Lys Gly Asp Leu Thr Ala Lys Lys Met Val
Leu65 70 75 80Ala Leu Leu Glu Leu Ala Gln Gln Asp His Gly Ala Leu
Asp Cys Cys 85 90 95Val Val Val Ile Leu Ser His Gly Cys Gln Ala Ser
His Leu Gln Phe 100 105 110Pro Gly Ala Val Tyr Gly Thr Asp Gly Cys
Pro Val Ser Val Glu Lys 115 120 125Ile Val Asn Ile Phe Asn Gly Thr
Ser Cys Pro Ser Leu Gly Gly Lys 130 135 140Pro Lys Leu Phe Phe Ile
Gln Ala Cys Gly Gly Glu Gln Lys Asp His145 150 155 160Gly Phe Glu
Val Ala Ser Thr Ser Pro Glu Asp Glu Ser Pro Gly Ser 165 170 175Asn
Pro Glu Pro Asp Ala Thr Pro Phe Gln Glu Gly Leu Arg Thr Phe 180 185
190Asp Gln Leu Asp Ala Ile Ser Ser Leu Pro Thr Pro Ser Asp Ile Phe
195 200 205Val Ser Tyr Ser Thr Phe Pro Gly Phe Val Ser Trp Arg Asp
Pro Lys 210 215 220Ser Gly Ser Trp Tyr Val Glu Thr Leu Asp Asp Ile
Phe Glu Gln Trp225 230 235 240Ala His Ser Glu Asp Leu Gln Ser Leu
Leu Leu Arg Val Ala Asn Ala 245 250 255Val Ser Val Lys Gly Ile Tyr
Lys Gln Met Pro Gly Cys Phe Asn Phe 260 265 270Leu Arg Lys Lys Leu
Phe Phe Lys Thr Ser 275 280109DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 10gctagcaga
9113PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 11Ala Ser Arg11257DNAThosea asigna virus
12gccgagggca ggggaagtct tctaacatgc ggggacgtgg aggaaaatcc cgggccc
571319PRTThosea asigna virus 13Ala Glu Gly Arg Gly Ser Leu Leu Thr
Cys Gly Asp Val Glu Glu Asn1 5 10 15Pro Gly Pro14999DNAHomo sapiens
14atgccacctc ctcgcctcct cttcttcctc ctcttcctca cccccatgga agtcaggccc
60gaggaacctc tagtggtgaa ggtggaagag ggagataacg ctgtgctgca gtgcctcaag
120gggacctcag atggccccac tcagcagctg acctggtctc gggagtcccc
gcttaaaccc 180ttcttaaaac tcagcctggg gctgccaggc ctgggaatcc
acatgaggcc cctggccatc 240tggcttttca tcttcaacgt ctctcaacag
atggggggct tctacctgtg ccagccgggg 300cccccctctg agaaggcctg
gcagcctggc tggacagtca atgtggaggg cagcggggag 360ctgttccggt
ggaatgtttc ggacctaggt ggcctgggct gtggcctgaa gaacaggtcc
420tcagagggcc ccagctcccc ttccgggaag ctcatgagcc ccaagctgta
tgtgtgggcc 480aaagaccgcc ctgagatctg ggagggagag cctccgtgtc
tcccaccgag ggacagcctg 540aaccagagcc tcagccagga cctcaccatg
gcccctggct ccacactctg gctgtcctgt 600ggggtacccc ctgactctgt
gtccaggggc cccctctcct ggacccatgt gcaccccaag 660gggcctaagt
cattgctgag cctagagctg aaggacgatc gcccggccag agatatgtgg
720gtaatggaga cgggtctgtt gttgccccgg gccacagctc aagacgctgg
aaagtattat 780tgtcaccgtg gcaacctgac catgtcattc cacctggaga
tcactgctcg gccagtacta 840tggcactggc tgctgaggac tggtggctgg
aaggtctcag ctgtgacttt ggcttatctg 900atcttctgcc tgtgttccct
tgtgggcatt cttcatcttc aaagagccct ggtcctgagg 960aggaaaagaa
agcgaatgac tgaccccacc aggagattc 99915333PRTHomo sapiens 15Met Pro
Pro Pro Arg Leu Leu Phe Phe Leu Leu Phe Leu Thr Pro Met1 5 10 15Glu
Val Arg Pro Glu Glu Pro Leu Val Val Lys Val Glu Glu Gly Asp 20 25
30Asn Ala Val Leu Gln Cys Leu Lys Gly Thr Ser Asp Gly Pro Thr Gln
35 40 45Gln Leu Thr Trp Ser Arg Glu Ser Pro Leu Lys Pro Phe Leu Lys
Leu 50 55 60Ser Leu Gly Leu Pro Gly Leu Gly Ile His Met Arg Pro Leu
Ala Ile65 70 75 80Trp Leu Phe Ile Phe Asn Val Ser Gln Gln Met Gly
Gly Phe Tyr Leu 85 90 95Cys Gln Pro Gly Pro Pro Ser Glu Lys Ala Trp
Gln Pro Gly Trp Thr 100 105 110Val Asn Val Glu Gly Ser Gly Glu Leu
Phe Arg Trp Asn Val Ser Asp 115 120 125Leu Gly Gly Leu Gly Cys Gly
Leu Lys Asn Arg Ser Ser Glu Gly Pro 130 135 140Ser Ser Pro Ser Gly
Lys Leu Met Ser Pro Lys Leu Tyr Val Trp Ala145 150 155 160Lys Asp
Arg Pro Glu Ile Trp Glu Gly Glu Pro Pro Cys Leu Pro Pro 165 170
175Arg Asp Ser Leu Asn Gln Ser Leu Ser Gln Asp Leu Thr Met Ala Pro
180 185 190Gly Ser Thr Leu Trp Leu Ser Cys Gly Val Pro Pro Asp Ser
Val Ser 195 200 205Arg Gly Pro Leu Ser Trp Thr His Val His Pro Lys
Gly Pro Lys Ser 210 215 220Leu Leu Ser Leu Glu Leu Lys Asp Asp Arg
Pro Ala Arg Asp Met Trp225 230 235 240Val Met Glu Thr Gly Leu Leu
Leu Pro Arg Ala Thr Ala Gln Asp Ala 245 250 255Gly Lys Tyr Tyr Cys
His Arg Gly Asn Leu Thr Met Ser Phe His Leu 260 265 270Glu Ile Thr
Ala Arg Pro Val Leu Trp His Trp Leu Leu Arg Thr Gly 275 280 285Gly
Trp Lys Val Ser Ala Val Thr Leu Ala Tyr Leu Ile Phe Cys Leu 290 295
300Cys Ser Leu Val Gly Ile Leu His Leu Gln Arg Ala Leu Val Leu
Arg305 310 315 320Arg Lys Arg Lys Arg Met Thr Asp Pro Thr Arg Arg
Phe 325 33016590DNAUnknownDescription of Unknown 3' Long terminal
repeat viral genomic polynucleotide 16tgaaagaccc cacctgtagg
tttggcaagc tagcttaagt aacgccattt tgcaaggcat 60ggaaaaatac ataactgaga
atagagaagt tcagatcaag gtcaggaaca gatggaacag 120ctgaatatgg
gccaaacagg atatctgtgg taagcagttc ctgccccggc tcagggccaa
180gaacagatgg aacagctgaa tatgggccaa acaggatatc tgtggtaagc
agttcctgcc 240ccggctcagg gccaagaaca gatggtcccc agatgcggtc
cagccctcag cagtttctag 300agaaccatca gatgtttcca gggtgcccca
aggacctgaa atgaccctgt gccttatttg 360aactaaccaa tcagttcgct
tctcgcttct gttcgcgcgc ttctgctccc cgagctcaat 420aaaagagccc
acaacccctc actcggggcg ccagtcctcc gattgactga gtcgcccggg
480tacccgtgta tccaataaac cctcttgcag ttgcatccga cttgtggtct
cgctgttcct 540tgggagggtc tcctctgagt gattgactac ccgtcagcgg
gggtctttca 590178622DNAArtificial SequenceDescription of Artificial
Sequence Synthetic polynucleotide 17tgaaagaccc cacctgtagg
tttggcaagc tagcttaagt aacgccattt tgcaaggcat 60ggaaaaatac ataactgaga
atagaaaagt tcagatcaag gtcaggaaca gatggaacag 120ctgaatatgg
gccaaacagg atatctgtgg taagcagttc ctgccccggc tcagggccaa
180gaacagatgg aacagctgaa tatgggccaa acaggatatc tgtggtaagc
agttcctgcc 240ccggctcagg gccaagaaca gatggtcccc agatgcggtc
cagccctcag cagtttctag 300agaaccatca gatgtttcca gggtgcccca
aggacctgaa atgaccctgt gccttatttg 360aactaaccaa tcagttcgct
tctcgcttct gttcgcgcgc ttatgctccc cgagctcaat 420aaaagagccc
acaacccctc actcggggcg ccagtcctcc gattgactga gtcgcccggg
480tacccgtgta tccaataaac cctcttgcag ttgcatccga cttgtggtct
cgctgttcct 540tgggagggtc tcctctgagt gattgactac ccgtcagcgg
gggtctttca tttgggggct 600cgtccgggat cgggagaccc ctgcccaggg
accaccgacc caccaccggg aggtaagctg 660gccagcaact tatctgtgtc
tgtccgattg tctagtgtct atgactgatt ttatgcgcct 720gcgtcggtac
tagttagcta actagctctg tatctggcgg acccgtggtg gaactgacga
780gttcggaaca cccggccgca accctgggag acgtcccagg gacttcgggg
gccgtttttg 840tggcccgacc tgagtcctaa aatcccgatc gtttaggact
ctttggtgca ccccccttag 900aggagggata tgtggttctg gtaggagacg
agaacctaaa acagttcccg cctccgtctg 960aatttttgct ttcggtttgg
gaccgaagcc gcgccgcgcg tcttgtctgc tgcagcatcg 1020ttctgtgttg
tctctgtctg actgtgtttc tgtatttgtc tgaaaatatg ggcccgggct
1080agcctgttac cactccctta agtttgacct taggtcactg gaaagatgtc
gagcggatcg 1140ctcacaacca gtcggtagat gtcaagaaga gacgttgggt
taccttctgc tctgcagaat 1200ggccaacctt taacgtcgga tggccgcgag
acggcacctt taaccgagac ctcatcaccc 1260aggttaagat caaggtcttt
tcacctggcc cgcatggaca cccagaccag gtggggtaca 1320tcgtgacctg
ggaagccttg gcttttgacc cccctccctg ggtcaagccc tttgtacacc
1380ctaagcctcc gcctcctctt cctccatccg ccccgtctct cccccttgaa
cctcctcgtt 1440cgaccccgcc tcgatcctcc ctttatccag ccctcactcc
ttctctaggc gcccccatat 1500ggccatatga gatcttatat ggggcacccc
cgccccttgt aaacttccct gaccctgaca 1560tgacaagagt tactaacagc
ccctctctcc aagctcactt acaggctctc tacttagtcc 1620agcacgaagt
ctggagacct ctggcggcag cctaccaaga acaactggac cgaccggtgg
1680tacctcaccc ttaccgagtc ggcgacacag tgtgggtccg ccgacaccag
actaagaacc 1740tagaacctcg ctggaaagga ccttacacag tcctgctgac
cacccccacc gccctcaaag 1800tagacggcat cgcagcttgg atacacgccg
cccacgtgaa ggctgccgac cccgggggtg 1860gaccatcctc tagactgcca
tgctcgaggg agtgcaggtg gaaaccatct ccccaggaga 1920cgggcgcacc
ttccccaagc gcggccagac ctgcgtggtg cactacaccg ggatgcttga
1980agatggaaag aaagttgatt cctcccggga cagaaacaag ccctttaagt
ttatgctagg 2040caagcaggag gtgatccgag gctgggaaga aggggttgcc
cagatgagtg tgggtcagag 2100agccaaactg actatatctc cagattatgc
ctatggtgcc actgggcacc caggcatcat 2160cccaccacat gccactctcg
tcttcgatgt ggagcttcta aaactggaat ctggcggtgg 2220atccggagtc
gacggatttg gtgatgtcgg tgctcttgag agtttgaggg gaaatgcaga
2280tttggcttac atcctgagca tggagccctg tggccactgc ctcattatca
acaatgtgaa 2340cttctgccgt gagtccgggc tccgcacccg cactggctcc
aacatcgact gtgagaagtt 2400gcggcgtcgc ttctcctcgc tgcatttcat
ggtggaggtg aagggcgacc tgactgccaa 2460gaaaatggtg ctggctttgc
tggagctggc gcagcaggac cacggtgctc tggactgctg 2520cgtggtggtc
attctctctc acggctgtca ggccagccac ctgcagttcc caggggctgt
2580ctacggcaca gatggatgcc ctgtgtcggt cgagaagatt gtgaacatct
tcaatgggac 2640cagctgcccc agcctgggag ggaagcccaa gctctttttc
atccaggcct gtggtgggga 2700gcagaaagac catgggtttg aggtggcctc
cacttcccct gaagacgagt cccctggcag 2760taaccccgag ccagatgcca
ccccgttcca ggaaggtttg aggaccttcg accagctgga 2820cgccatatct
agtttgccca cacccagtga catctttgtg tcctactcta ctttcccagg
2880ttttgtttcc tggagggacc ccaagagtgg ctcctggtac gttgagaccc
tggacgacat 2940ctttgagcag tgggctcact ctgaagacct gcagtccctc
ctgcttaggg tcgctaatgc 3000tgtttcggtg aaagggattt ataaacagat
gcctggttgc tttaatttcc tccggaaaaa 3060acttttcttt aaaacatcag
ctagcagagc cgagggcagg ggaagtcttc taacatgcgg 3120ggacgtggag
gaaaatcccg ggcccatgcc acctcctcgc ctcctcttct tcctcctctt
3180cctcaccccc atggaagtca ggcccgagga acctctagtg gtgaaggtgg
aagagggaga 3240taacgctgtg ctgcagtgcc tcaaggggac ctcagatggc
cccactcagc agctgacctg 3300gtctcgggag tccccgctta aacccttctt
aaaactcagc ctggggctgc caggcctggg 3360aatccacatg aggcccctgg
ccatctggct tttcatcttc aacgtctctc aacagatggg 3420gggcttctac
ctgtgccagc cggggccccc ctctgagaag gcctggcagc ctggctggac
3480agtcaatgtg gagggcagcg gggagctgtt ccggtggaat gtttcggacc
taggtggcct 3540gggctgtggc ctgaagaaca ggtcctcaga gggccccagc
tccccttccg ggaagctcat 3600gagccccaag ctgtatgtgt gggccaaaga
ccgccctgag atctgggagg gagagcctcc 3660gtgtctccca ccgagggaca
gcctgaacca gagcctcagc caggacctca ccatggcccc 3720tggctccaca
ctctggctgt cctgtggggt accccctgac tctgtgtcca ggggccccct
3780ctcctggacc catgtgcacc ccaaggggcc taagtcattg ctgagcctag
agctgaagga 3840cgatcgcccg gccagagata tgtgggtaat ggagacgggt
ctgttgttgc cccgggccac 3900agctcaagac gctggaaagt attattgtca
ccgtggcaac ctgaccatgt cattccacct 3960ggagatcact gctcggccag
tactatggca ctggctgctg aggactggtg gctggaaggt 4020ctcagctgtg
actttggctt atctgatctt ctgcctgtgt tcccttgtgg gcattcttca
4080tcttcaaaga gccctggtcc tgaggaggaa aagaaagcga atgactgacc
ccaccaggag 4140attctaacgc gtcatcatcg atccggatta gtccaatttg
ttaaagacag gatatcagtg 4200gtccaggctc tagttttgac tcaacaatat
caccagctga agcctataga gtacgagcca 4260tagataaaat aaaagatttt
atttagtctc cagaaaaagg ggggaatgaa agaccccacc 4320tgtaggtttg
gcaagctagc ttaagtaacg ccattttgca aggcatggaa aaatacataa
4380ctgagaatag agaagttcag atcaaggtca ggaacagatg gaacagctga
atatgggcca 4440aacaggatat ctgtggtaag cagttcctgc cccggctcag
ggccaagaac agatggaaca 4500gctgaatatg ggccaaacag gatatctgtg
gtaagcagtt cctgccccgg ctcagggcca 4560agaacagatg gtccccagat
gcggtccagc cctcagcagt ttctagagaa ccatcagatg 4620tttccagggt
gccccaagga cctgaaatga ccctgtgcct tatttgaact aaccaatcag
4680ttcgcttctc gcttctgttc gcgcgcttct gctccccgag ctcaataaaa
gagcccacaa 4740cccctcactc ggggcgccag tcctccgatt gactgagtcg
cccgggtacc cgtgtatcca 4800ataaaccctc ttgcagttgc atccgacttg
tggtctcgct gttccttggg agggtctcct 4860ctgagtgatt gactacccgt
cagcgggggt ctttcacaca tgcagcatgt atcaaaatta 4920atttggtttt
ttttcttaag tatttacatt aaatggccat agtacttaaa gttacattgg
4980cttccttgaa ataaacatgg agtattcaga atgtgtcata aatatttcta
attttaagat 5040agtatctcca ttggctttct actttttctt ttattttttt
ttgtcctctg tcttccattt 5100gttgttgttg ttgtttgttt gtttgtttgt
tggttggttg gttaattttt ttttaaagat 5160cctacactat agttcaagct
agactattag ctactctgta acccagggtg accttgaagt 5220catgggtagc
ctgctgtttt agccttccca catctaagat tacaggtatg agctatcatt
5280tttggtatat tgattgattg attgattgat gtgtgtgtgt gtgattgtgt
ttgtgtgtgt 5340gactgtgaaa atgtgtgtat gggtgtgtgt gaatgtgtgt
atgtatgtgt gtgtgtgagt 5400gtgtgtgtgt gtgtgtgcat gtgtgtgtgt
gtgactgtgt ctatgtgtat gactgtgtgt 5460gtgtgtgtgt gtgtgtgtgt
gtgtgtgtgt gtgtgtgtgt tgtgaaaaaa tattctatgg 5520tagtgagagc
caacgctccg gctcaggtgt caggttggtt tttgagacag agtctttcac
5580ttagcttgga attcactggc cgtcgtttta caacgtcgtg actgggaaaa
ccctggcgtt 5640acccaactta atcgccttgc agcacatccc cctttcgcca
gctggcgtaa tagcgaagag 5700gcccgcaccg atcgcccttc ccaacagttg
cgcagcctga atggcgaatg gcgcctgatg 5760cggtattttc tccttacgca
tctgtgcggt atttcacacc gcatatggtg cactctcagt 5820acaatctgct
ctgatgccgc atagttaagc cagccccgac acccgccaac acccgctgac
5880gcgccctgac gggcttgtct gctcccggca tccgcttaca gacaagctgt
gaccgtctcc
5940gggagctgca tgtgtcagag gttttcaccg tcatcaccga aacgcgcgat
gacgaaaggg 6000cctcgtgata cgcctatttt tataggttaa tgtcatgata
ataatggttt cttagacgtc 6060aggtggcact tttcggggaa atgtgcgcgg
aacccctatt tgtttatttt tctaaataca 6120ttcaaatatg tatccgctca
tgagacaata accctgataa atgcttcaat aatattgaaa 6180aaggaagagt
atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt
6240ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg
ctgaagatca 6300gttgggtgca cgagtgggtt acatcgaact ggatctcaac
agcggtaaga tccttgagag 6360ttttcgcccc gaagaacgtt ttccaatgat
gagcactttt aaagttctgc tatgtggcgc 6420ggtattatcc cgtattgacg
ccgggcaaga gcaactcggt cgccgcatac actattctca 6480gaatgacttg
gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt
6540aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca
acttacttct 6600gacaacgatc ggaggaccga aggagctaac cgcttttttg
cacaacatgg gggatcatgt 6660aactcgcctt gatcgttggg aaccggagct
gaatgaagcc ataccaaacg acgagcgtga 6720caccacgatg cctgtagcaa
tggcaacaac gttgcgcaaa ctattaactg gcgaactact 6780tactctagct
tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc
6840acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg
gagccggtga 6900gcgtgggtct cgcggtatca ttgcagcact ggggccagat
ggtaagccct cccgtatcgt 6960agttatctac acgacgggga gtcaggcaac
tatggatgaa cgaaatagac agatcgctga 7020gataggtgcc tcactgatta
agcattggta actgtcagac caagtttact catatatact 7080ttagattgat
ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga
7140taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt
cagaccccgt 7200agaaaagatc aaaggatctt cttgagatcc tttttttctg
cgcgtaatct gctgcttgca 7260aacaaaaaaa ccaccgctac cagcggtggt
ttgtttgccg gatcaagagc taccaactct 7320ttttccgaag gtaactggct
tcagcagagc gcagatacca aatactgtcc ttctagtgta 7380gccgtagtta
ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct
7440aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg
ggttggactc 7500aagacgatag ttaccggata aggcgcagcg gtcgggctga
acggggggtt cgtgcacaca 7560gcccagcttg gagcgaacga cctacaccga
actgagatac ctacagcgtg agcattgaga 7620aagcgccacg cttcccgaag
ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg 7680aacaggagag
cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt
7740cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag
gggggcggag 7800cctatggaaa aacgccagca acgcggcctt tttacggttc
ctggcctttt gctggccttt 7860tgctcacatg ttctttcctg cgttatcccc
tgattctgtg gataaccgta ttaccgcctt 7920tgagtgagct gataccgctc
gccgcagccg aacgaccgag cgcagcgagt cagtgagcga 7980ggaagcggaa
gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta
8040atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca
acgcaattaa 8100tgtgagttag ctcactcatt aggcacccca ggctttacac
tttatgcttc cggctcgtat 8160gttgtgtgga attgtgagcg gataacaatt
tcacacagga aacagctatg accatgatta 8220cgccaagctt tgctcttagg
agtttcctaa tacatcccaa actcaaatat ataaagcatt 8280tgacttgttc
tatgccctag ggggcggggg gaagctaagc cagctttttt taacatttaa
8340aatgttaatt ccattttaaa tgcacagatg tttttatttc ataagggttt
caatgtgcat 8400gaatgctgca atattcctgt taccaaagct agtataaata
aaaatagata aacgtggaaa 8460ttacttagag tttctgtcat taacgtttcc
ttcctcagtt gacaacataa atgcgctgct 8520gagcaagcca gtttgcatct
gtcaggatca atttcccatt atgccagtca tattaattac 8580tagtcaatta
gttgattttt atttttgaca tatacatgtg aa 862218678DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
18ctcgagggcg tccaagtcga aaccattagt cccggcgatg gcagaacatt tcctaaaagg
60ggacaaacat gtgtcgtcca ttatacaggc atgttggagg acggcaaaaa ggtggacagt
120agtagagatc gcaataaacc tttcaaattc atgttgggaa aacaagaagt
cattagggga 180tgggaggagg gcgtggctca aatgtccgtc ggccaacgcg
ctaagctcac catcagcccc 240gactacgcat acggcgctac cggacatccc
ggaattattc cccctcacgc taccttggtg 300tttgacgtcg aactgttgaa
gctcgaagtc gagggagtgc aggtggaaac catctcccca 360ggagacgggc
gcaccttccc caagcgcggc cagacctgcg tggtgcacta caccgggatg
420cttgaagatg gaaagaaagt tgattcctcc cgggacagaa acaagccctt
taagtttatg 480ctaggcaagc aggaggtgat ccgaggctgg gaagaagggg
ttgcccagat gagtgtgggt 540cagagagcca aactgactat atctccagat
tatgcctatg gtgccactgg gcacccaggc 600atcatcccac cacatgccac
tctcgtcttc gatgtggagc ttctaaaact ggaatctggc 660ggtggatccg gagtcgag
67819222PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 19Gly Val Gln Val Glu Thr Ile Ser Pro Gly Asp
Gly Arg Thr Phe Pro1 5 10 15Lys Arg Gly Gln Thr Cys Val Val His Tyr
Thr Gly Met Leu Glu Asp 20 25 30Gly Lys Lys Val Asp Ser Ser Arg Asp
Arg Asn Lys Pro Phe Lys Phe 35 40 45Met Leu Gly Lys Gln Glu Val Ile
Arg Gly Trp Glu Glu Gly Val Ala 50 55 60Gln Met Ser Val Gly Gln Arg
Ala Lys Leu Thr Ile Ser Pro Asp Tyr65 70 75 80Ala Tyr Gly Ala Thr
Gly His Pro Gly Ile Ile Pro Pro His Ala Thr 85 90 95Leu Val Phe Asp
Val Glu Leu Leu Lys Leu Glu Val Glu Gly Val Gln 100 105 110Val Glu
Thr Ile Ser Pro Gly Asp Gly Arg Thr Phe Pro Lys Arg Gly 115 120
125Gln Thr Cys Val Val His Tyr Thr Gly Met Leu Glu Asp Gly Lys Lys
130 135 140Val Asp Ser Ser Arg Asp Arg Asn Lys Pro Phe Lys Phe Met
Leu Gly145 150 155 160Lys Gln Glu Val Ile Arg Gly Trp Glu Glu Gly
Val Ala Gln Met Ser 165 170 175Val Gly Gln Arg Ala Lys Leu Thr Ile
Ser Pro Asp Tyr Ala Tyr Gly 180 185 190Ala Thr Gly His Pro Gly Ile
Ile Pro Pro His Ala Thr Leu Val Phe 195 200 205Asp Val Glu Leu Leu
Lys Leu Glu Ser Gly Gly Gly Ser Gly 210 215 220208PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 20Arg
Ala Lys Phe Lys Gln Leu Leu1 5215PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 21Ser Gly Gly Gly Ser1
5227PRTHomo sapiens 22Thr Asp Pro Thr Arg Arg Phe1
5239PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 23Asn Leu Val Pro Met Val Ala Thr Val1
52418DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 24tccgccctga gcaaagac 182520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
25acgaactcca gcaggaccat 202615DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 26acgagaagcg cgatc
152719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 27ctggaatctg gcggtggat 192823DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
28caaactctca agagcaccga cat 232915DNAArtificial SequenceDescription
of Artificial Sequence Synthetic probe 29cggagtcgac ggatt 15
* * * * *