U.S. patent application number 16/435000 was filed with the patent office on 2020-01-23 for enzymatic process for the preparation of (1s,2r)-2-(difluoromethyl)-1-(propoxycarbonyl)cyclopropanecarboxylic acid.
The applicant listed for this patent is AbbVie Inc.. Invention is credited to Michael J. Abrahamson, Gareth J. Brown, Sanjay R. Chemburkar, David R. Hill, Angelica B. Kielbus, Jianzhang Mei, Stefan Mix, Rajarathnam E. Reddy, William T. Riordan, Timothy B. Towne.
Application Number | 20200024621 16/435000 |
Document ID | / |
Family ID | 66767675 |
Filed Date | 2020-01-23 |
![](/patent/app/20200024621/US20200024621A1-20200123-C00001.png)
![](/patent/app/20200024621/US20200024621A1-20200123-C00002.png)
![](/patent/app/20200024621/US20200024621A1-20200123-C00003.png)
![](/patent/app/20200024621/US20200024621A1-20200123-C00004.png)
![](/patent/app/20200024621/US20200024621A1-20200123-C00005.png)
![](/patent/app/20200024621/US20200024621A1-20200123-C00006.png)
![](/patent/app/20200024621/US20200024621A1-20200123-C00007.png)
![](/patent/app/20200024621/US20200024621A1-20200123-C00008.png)
![](/patent/app/20200024621/US20200024621A1-20200123-C00009.png)
![](/patent/app/20200024621/US20200024621A1-20200123-C00010.png)
![](/patent/app/20200024621/US20200024621A1-20200123-C00011.png)
View All Diagrams
United States Patent
Application |
20200024621 |
Kind Code |
A1 |
Abrahamson; Michael J. ; et
al. |
January 23, 2020 |
ENZYMATIC PROCESS FOR THE PREPARATION OF
(1S,2R)-2-(DIFLUOROMETHYL)-1-(PROPOXYCARBONYL)CYCLOPROPANECARBOXYLIC
ACID
Abstract
Disclosed are methods of synthesizing enantioenriched
difluoroalkylcyclopropyl amino esters and their salts, such as the
dicyclohexylamine salt of
(1S,2R)-2-(difluoromethyl)-1-(propoxycarbonyl)cyclopropane
carboxylic acid. These compounds are useful intermediates in the
synthesis of viral protease inhibitors.
Inventors: |
Abrahamson; Michael J.;
(Chicago, IL) ; Kielbus; Angelica B.; (Glenview,
IL) ; Riordan; William T.; (Libertyville, IL)
; Hill; David R.; (Gurnee, IL) ; Chemburkar;
Sanjay R.; (Gurnee, IL) ; Reddy; Rajarathnam E.;
(Gurnee, IL) ; Towne; Timothy B.; (Lindenhurst,
IL) ; Mei; Jianzhang; (Lake Forest, IL) ; Mix;
Stefan; (Belfast, GB) ; Brown; Gareth J.;
(Antrim, GB) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
AbbVie Inc. |
North Chicago |
IL |
US |
|
|
Family ID: |
66767675 |
Appl. No.: |
16/435000 |
Filed: |
June 7, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15010557 |
Jan 29, 2016 |
10316338 |
|
|
16435000 |
|
|
|
|
62109943 |
Jan 30, 2015 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12P 41/005 20130101;
C12P 7/62 20130101; C12Y 301/01003 20130101 |
International
Class: |
C12P 7/62 20060101
C12P007/62; C12P 41/00 20060101 C12P041/00 |
Claims
1-57. (canceled)
58. A method according to the following reaction scheme:
##STR00022## wherein R is alkyl; t-BuOH is tert-butyl alcohol; Boc
is tert-butoxycarbonyl; and DPPA is diphenylphosphoryl azide.
59. The method of claim 58, wherein R is ethyl, propyl, or
butyl.
60. The method of claim 59, wherein R is n-propyl.
61. The method of claim 58, wherein the starting material has the
following structure: ##STR00023##
62. The method of claim 58, wherein the hydrolysis step comprises
treatment with aqueous LiOH.
63. A compound having the following structure, or a
pharmaceutically acceptable salt thereof: ##STR00024##
64. The compound of claim 63, wherein the compound has the
following structure: ##STR00025##
65. The compound of claim 64, wherein R is ethyl, propyl, or
butyl.
66. The compound of claim 65, wherein R is n-propyl.
67. The compound of claim 64, wherein the compound has the
following structure: ##STR00026##
68. The compound of claim 64, wherein the compound has the
following structure: ##STR00027##
69. The compound of claim 68, wherein R is ethyl, propyl, or
butyl.
70. The compound of claim 69, wherein R is n-propyl.
71. A compound having the following structure, or a
pharmaceutically acceptable salt thereof: ##STR00028## wherein R is
alkyl; and Boc is tert-butoxycarbonyl.
72. The compound of claim 71, wherein R is ethyl, propyl, or
butyl.
73. The compound of claim 72, wherein R is n-propyl.
74. The compound of claim 71, wherein the compound has the
following structure: ##STR00029##
75. The compound of claim 74, wherein R is ethyl, propyl, or
butyl.
76. The compound of claim 75, wherein R is n-propyl.
77. A compound having the following structure, or a
pharmaceutically acceptable salt thereof: ##STR00030## wherein Boc
is tert-butoxycarbonyl.
78. The compound of claim 77, wherein the compound has the
following structure: ##STR00031##
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 15/010,557, filed Jan. 29, 2016, now U.S. Pat.
No. 10,316,338, which claims the benefit of priority to U.S.
Provisional Patent Application Ser. No. 62/109,943, filed Jan. 30,
2015.
BACKGROUND
[0002] Complex biologically active molecules are challenging,
expensive, and time-consuming to synthesize. Synthesizing chiral,
non-racemic compounds with good enantio- and diastereoselectivity
is even more challenging. Doing so generally involves isolating or
synthesizing an enantioenriched intermediate whose stereochemistry
can be preserved in the required subsequent synthetic
transformations.
[0003] An example of a useful intermediate in the synthesis of a
biologically active molecule is
(1R,2R)-1-((tert-butoxycarbonyl)amino)-2-(difluoromethyl)cyclopropanecarb-
oxylic acid (1, Boc-DFAA). In the past, this intermediate was
synthesized from (1R,2S)-2 using corrosive fluorination chemistry,
which is not suitable for large scale production. WO
2009/064975.
##STR00001##
[0004] There exists a need for new synthetic methods to construct
enantioenriched difluoroalkylcyclopropyl amino esters and their
precursors.
SUMMARY OF THE INVENTION
[0005] In certain embodiments, the invention relates to a method
according to reaction Scheme A:
##STR00002##
[0006] wherein R is alkyl.
[0007] In some embodiments, the invention relates to any of the
methods described herein, wherein the first solvent is preferably
an aqueous solution of sodium citrate or calcium acetate at a
concentration of from about 0.05 M to about 0.15 M.
[0008] In certain other embodiments, the invention relates to any
of the methods described herein, wherein the first enzyme is
preferably lipase from Thermomyces lanuginosus (AH-45) or
(Rhizo-)Mucor miehei (RML).
[0009] In certain embodiments, the invention relates to a method
according to reaction Scheme B:
##STR00003##
[0010] wherein R is alkyl.
[0011] In some embodiments, the invention relates to any of the
methods described herein, wherein the second solvent is preferably
an aqueous solution of sodium phosphate at a concentration of from
about 0.05 M to about 0.15 M.
[0012] In certain other embodiments, the invention relates to any
of the methods described herein, wherein the second enzyme is
preferably yvaK esterase or BsteE esterase.
[0013] In certain embodiments, the invention relates to a method
according to reaction Scheme C:
##STR00004##
[0014] wherein R is alkyl.
[0015] In some embodiments, the invention relates to any of the
methods described herein, wherein the third solvent preferably
comprises an aqueous solution of monopotassium phosphate at a
concentration of from about 0.25 M to about 0.75 M.
[0016] In certain embodiments, the invention relates to any of the
methods described herein, wherein the third solvent further
comprises tetrahydrofuran (THF), methyl tert-butyl ether, ethyl
acetate, dioxane, DMF, acetonitrile, or DMSO, preferably methyl
tert-butyl ether.
[0017] In certain other embodiments, the invention relates to any
of the methods described herein, wherein the third enzyme is
preferably yvaK esterase or BsteE esterase.
[0018] In certain embodiments, the invention relates to any of the
methods described herein, wherein R is preferably ethyl, propyl, or
butyl.
DETAILED DESCRIPTION OF THE INVENTION
I. Overview
[0019] In certain embodiments, the invention relates to a method of
synthesizing enantioenriched compounds, such as
(1S,2R)-2-(difluoromethyl)-1-(propoxycarbonyl)cyclopropane
carboxylic acid (6), by selective enzymatic hydrolysis. The
inventive methods are more efficient than known methods because (i)
they preferably do not involve synthesizing a racemate and
separating enantiomers, and (ii) enantioenriched starting materials
are not required.
[0020] In certain embodiments, the invention relates to a method of
synthesizing a Drug Substance via
(1R,2R)-1-((tert-butoxycarbonyl)amino)-2-(difluoromethyl)
cyclopropanecarboxylic acid (1) as shown in Scheme 2.
##STR00005##
[0021] In certain embodiments, the methods of the invention are
based on the enzymatic reactive resolution of (.+-.)-dipropyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate (7) followed by
enzymatic desymmetrization of the resulting unreacted (R)-diester
((R)-7) to afford (1S,2R)-2-(difluoromethyl)-1-(propoxycarbonyl)
cyclopropane carboxylic acid (6), which is isolated as its
dicyclohexylamine salt (8), as described in Scheme 3 and Scheme
4.
##STR00006##
##STR00007##
[0022] In one embodiment, the (1S,2R)-mono-acid DCHA salt (8) is
converted to (1R,2R)-1-((tert-butoxycarbonyl)
amino)-2-(difluoromethyl) cyclopropanecarboxylic acid (1, Boc-DFAA)
via Curtius Rearrangement followed by hydrolysis, as in Scheme
5.
##STR00008##
[0023] In certain preferred embodiments, the methods do not involve
corrosive fluorination reagents or laborious and expensive
Simulated Moving Bed (SMB) chromatography for the separation of the
desired chiral isomer.
[0024] In certain preferred embodiments, the methods improve
processability of the isolated intermediates.
[0025] Preferably, the overall yield of
(1R,2R)-1-((tert-butoxycarbonyl)amino)-2-(difluoromethyl)cyclopropane
carboxylic acid (1) is significantly improved as compared to known
processes.
II. Definitions
[0026] Listed below are definitions of various terms used to
describe this invention. These definitions apply to the terms as
they are used throughout this specification and claims, unless
otherwise limited in specific instances, either individually or as
part of a larger group.
[0027] The number of carbon atoms in a hydrocarbyl substituent can
be indicated by the prefix "C.sub.x-C.sub.y," where x is the
minimum and y is the maximum number of carbon atoms in the
substituent.
[0028] The term "alkyl" as used herein, refers to a saturated,
straight- or branched-chain hydrocarbon radical typically
containing from 1 to 20 carbon atoms. For example, "C.sub.1-C.sub.6
alkyl" or "C.sub.1-C.sub.8 alkyl" contains from one to six, or from
one to eight, carbon atoms, respectively. Examples of alkyl
substituents include, but are not limited to, methyl, ethyl,
propyl, isopropyl, n-butyl, tert-butyl, neopentyl, n-hexyl, heptyl,
octyl substituents and the like.
[0029] The term "cycloalkyl" denotes a monovalent group derived
from a monocyclic or polycyclic saturated carbocyclic ring
compound. Examples of cycloalkyl include, but are not limited to,
cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl,
bicyclo[2.2.1]heptyl, and bicyclo[2.2.2]octyl and the like.
[0030] The term "amino-protecting group," as used herein, refers to
a labile chemical moiety that can protect an amino group against
undesired reactions during synthetic procedures. After said
synthetic procedure(s), the amino-protecting group as described
herein may be selectively removed. Suitable amino-protecting groups
are described generally in T. H. Greene and P. G. M. Wuts,
Protective Groups in Organic Synthesis, 3rd edition, John Wiley
& Sons, New York (1999). Examples of amino-protecting groups
include, but are not limited to, t-butoxycarbonyl,
9-fluorenylmethoxycarbonyl, benzyloxycarbonyl, and the like.
[0031] The term "protected amino," as used herein, refers to an
amino group protected with an amino-protecting group as defined
above.
[0032] As used herein, the term "salt" includes "pharmaceutically
acceptable salts," which are, within the scope of sound medical
judgment, suitable for use in contact with the tissues of humans
and other vertebrates, preferably mammals, without undue toxicity,
irritation, allergic response and the like, and are commensurate
with a reasonable benefit/risk ratio. Pharmaceutically acceptable
salts are well known in the art. For example, S. M. Berge, et al.
describe pharmaceutically acceptable salts in detail in J.
Pharmaceutical Sciences, 66: 1-19 (1977). Such salts can be
prepared in situ during isolation and purification of reaction
products as described herein, or separately, such as by reacting a
free base function with a suitable acid, such as an organic acid.
Examples of pharmaceutically acceptable salts include, but are not
limited to, hydrochloride, hydrobromide, phosphate, sulfate,
perchlorate, acetate, maleate, tartrate, citrate, succinate, or
malonate. Other pharmaceutically acceptable salts include, but are
not limited to, adipate, alginate, ascorbate, aspartate,
benzenesulfonate, benzoate, bisulfate, borate, butyrate,
camphorate, camphorsulfonate, cyclopentanepropionate, digluconate,
dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate,
glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate,
hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate,
laurate, lauryl sulfate, malate, methanesulfonate,
2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate,
palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate,
phosphate, picrate, pivalate, propionate, stearate, sulfate,
thiocyanate, p-toluenesulfonate, undecanoate, valerate salts, and
the like. Representative alkali or alkaline earth metal salts
include sodium, lithium, potassium, calcium, or magnesium salts,
and the like. Further pharmaceutically acceptable salts include,
when appropriate, ammonium, quaternary ammonium, and amine cations
associated with counterions such as halide, hydroxide, carboxylate,
sulfate, phosphate, nitrate, alkyl having from 1 to 6 carbon atoms,
sulfonate and aryl sulfonate.
[0033] As used herein, the term "enantioenriched" means a mixture
of enantiomers in which one of the two enantiomers is present in a
larger amount (e.g., having an enantiomeric excess (ee) greater
than about 90%, greater than about 95%, preferably greater than
about 98%, most preferably greater than 99%). This term also
encompasses an enantiomerically pure compound.
[0034] Various aspects of the invention are described in further
detail herein.
III. Exemplary Methods and Uses
[0035] The compounds and processes of the present invention will be
better understood in connection with the following illustrative
methods by which the compounds of the invention may be prepared. It
will be understood that any reaction described herein, in any of
its variations, can be combined in sequence with one or more of the
other reactions described herein, in any of their variations,
substantially in analogy with the sequence shown in the
Schemes.
[0036] In certain embodiments, the invention relates to a method
comprising a reactive resolution according to reaction Scheme
A:
##STR00009##
[0037] wherein R is alkyl.
[0038] In certain embodiments, the invention relates to any of the
methods described herein, wherein the first solvent is an aqueous
buffer, such as an aqueous solution of sodium citrate or calcium
acetate, e.g., at a concentration of from about 0.05 M to about
0.15 M, for example, about 0.05 M, about 0.06 M, about 0.07 M,
about 0.08 M, about 0.09 M, about 0.10 M, about 0.11 M, about 0.12
M, about 0.13 M, about 0.14 M, or about 0.15 M, preferably about
0.1 M.
[0039] In certain embodiments, the invention relates to any of the
methods described herein, wherein the first solvent is an aqueous
solution of sodium citrate, e.g., at a concentration of from about
0.05 M to about 0.15 M, for example, about 0.05 M, about 0.06 M,
about 0.07 M, about 0.08 M, about 0.09 M, about 0.10 M, about 0.11
M, about 0.12 M, about 0.13 M, about 0.14 M, or about 0.15 M,
preferably about 0.1 M.
[0040] In certain embodiments, the invention relates to any of the
methods described herein, wherein the first pH is from about 5 to
about 8.5, for example, about 5, about 5.25, about 5.5, about 5.75,
about 6, about 6.25, about 6.5, about 6.75, about 7.0, about 7.25,
about 7.5, about 7.75, about 8.0, about 8.25, or about 8.5,
preferably about 5.75. In certain embodiments, the pH is from about
5 to about 6.5, for example, about 5, about 5.25, about 5.5, about
5.75, about 6, about 6.25, or about 6.5, preferably about 5.75.
[0041] In certain embodiments, the invention relates to any of the
methods described herein, wherein the first enzyme is a hydrolase,
such as a lipase, preferably from Thermomyces lanuginosus (AH-45)
or (Rhizo)-Mucor miehiri (RML). In certain embodiments, the first
enzyme is a lipase from Thermomyces lanuginosus (AH-45).
[0042] In certain embodiments, the invention relates to any of the
methods described herein, wherein the loading of the first enzyme
is from about 50 wt % to about 150 wt % as compared to the starting
material, for example, about 50 wt %, about 60 wt %, about 70 wt %,
about 80 wt %, about 90 wt %, about 100 wt %, about 110 wt %, about
120 wt %, about 130 wt %, about 140 wt %, or about 150 wt %,
preferably about 100 wt % as compared to starting material.
[0043] In certain embodiments, the invention relates to any of the
methods described herein, wherein the first temperature is from
about 10.degree. C. to about 40.degree. C., for example, about
15.degree. C., about 20.degree. C., about 25.degree. C., about
30.degree. C., about 35.degree. C., or about 40.degree. C.,
preferably about 20.degree. C.
[0044] In certain embodiments, the invention relates to any of the
methods described herein, wherein the first period of time is from
about 36 h to about 100 h, for example, about 36 h, about 40 h,
about 44 h, about 48 h, about 52 h, about 56 h, about 60 h, about
64 h, about 68 h, about 72 h, about 76 h, about 80 h, about 84 h,
about 88 h, about 92 h, or about 98 h, preferably about 72 h.
[0045] In certain embodiments, the invention relates to any of the
methods described herein, further comprising crystallizing the
diester reaction product of reaction Scheme A to obtain the diester
compound in a crystalline form.
[0046] In certain embodiments, the invention relates to any of the
methods described herein, further comprising separating the
hydrolyzed reaction product of reaction Scheme A from the reaction
mixture.
[0047] In certain embodiments, the invention relates to any of the
methods described herein, further comprising isolating the diester
reaction product of reaction Scheme A from the reaction mixture,
thereby obtaining substantially pure diester reaction product of
Scheme A.
[0048] In certain embodiments, the invention relates to any of the
methods described herein, wherein the enantiomeric excess of the
diester reaction product is greater than about 90%, for example,
about 91% ee, about 92% ee, about 93% ee, about 94% ee, about 95%
ee, about 96% ee, about 97% ee, about 98% ee, about 99% ee,
preferably greater than about 94% ee.
[0049] In certain embodiments, the invention relates to a method
comprising desymmetrizing a diester according to reaction Scheme
B:
##STR00010##
[0050] wherein R is alkyl.
[0051] In certain embodiments, the invention relates to any of the
methods described herein, wherein the second solvent is an aqueous
buffer, such as an aqueous solution of sodium phosphate, e.g., at a
concentration of from about 0.05 M to about 0.15 M, for example,
about 0.05 M, about 0.06 M, about 0.07 M, about 0.08 M, about 0.09
M, about 0.10 M, about 0.11 M, about 0.12 M, about 0.13 M, about
0.14 M, or about 0.15 M, preferably about 0.1 M.
[0052] In certain embodiments, the invention relates to any of the
methods described herein, wherein the second pH is from about 7.75
to about 9.25, for example, about 8, about 8.25, about 8.5, about
8.75, or about 9, preferably about 8.5.
[0053] In certain embodiments, the invention relates to any of the
methods described herein, wherein the second enzyme is yvaK
esterase, preferably yvaK esterase from Bacillus subtilis.
[0054] In certain embodiments, the invention relates to any of the
methods described herein, wherein the second enzyme is BsteE
esterase, preferably BsteE esterase from Bacillus
stearothermophilus.
[0055] In certain embodiments, the invention relates to any of the
methods described herein, wherein the second enzyme is provided in
a whole cell, such as a freeze-dried whole cell.
[0056] In certain embodiments, the invention relates to any of the
methods described herein, wherein the loading of the freeze-dried
whole cells is from about 40 wt % to about 150 wt % as compared to
the starting material, for example, about 40 wt %, about 45 wt %,
about 50 wt %, about 55 wt %, about 60 wt %, about 65 wt %, about
70 wt %, about 75 wt %, about 80 wt %, about 85 wt %, about 90 wt
%, about 95 wt %, about 100 wt %, about 105 wt %, about 110 wt %,
about 115 wt %, about 120 wt %, about 125 wt %, about 130 wt %,
about 135 wt %, about 140 wt %, about 145 wt %, or about 150 wt %,
preferably about 85 wt % as compared to starting material.
[0057] In certain embodiments, the invention relates to any of the
methods described herein, wherein the second temperature is from
about 10.degree. C. to about 40.degree. C., for example, about
15.degree. C., about 20.degree. C., about 25.degree. C., about
30.degree. C., about 35.degree. C., or about 40.degree. C.,
preferably about 20.degree. C.
[0058] In certain embodiments, the invention relates to any of the
methods described herein, wherein the second period of time is from
about 10 h to about 30 h, for example, about 10 h, about 11 h,
about 12 h, about 13 h, about 14 h, about 15 h, about 16 h, about
17 h, about 18 h, about 19 h, about 20 h, about 21 h, about 22 h,
about 23 h, about 24 h, about 25 h, about 26 h, about 27 h, about
28 h, about 29 h, or about 30 h, preferably about 21 h.
[0059] In certain embodiments, the invention relates to any of the
methods described herein, further comprising isolating the reaction
product of reaction Scheme B from the reaction mixture, thereby
obtaining substantially pure reaction product of reaction Scheme
B.
[0060] In certain embodiments, the invention relates to any of the
methods described herein, further comprising crystallizing the
reaction product of reaction Scheme B to obtain the compound in a
crystalline form.
[0061] In certain embodiments, the invention relates to any of the
methods described herein, further comprising contacting the
reaction product of reaction Scheme B with a base to obtain a salt
of the compound, optionally in a crystalline form. In some
embodiments, the base is an amine, for example, a secondary amine,
preferably dicyclohexylamine or dibenzylamine.
[0062] In certain embodiments, the invention relates to any of the
methods described herein, wherein the enantiomeric excess of the
reaction product of reaction Scheme B is greater than about 90%,
for example, about 91% ee, about 92% ee, about 93% ee, about 94%
ee, about 95% ee, about 96% ee, about 97% ee, about 98% ee, about
99% ee, preferably greater than about 96% ee.
[0063] In certain embodiments, the invention relates to any of the
methods described herein, wherein the enantiomeric excess of the
salt of the reaction product of reaction Scheme B is greater than
about 90%, for example, about 91% ee, about 92% ee, about 93% ee,
about 94% ee, about 95% ee, about 96% ee, about 97% ee, about 98%
ee, about 99% ee, preferably greater than about 97% ee.
[0064] In certain embodiments, the invention relates to a method
comprising a desymmetrization according to reaction Scheme C:
##STR00011##
[0065] wherein R is alkyl.
[0066] In certain embodiments, the invention relates to any of the
methods described herein, wherein the third solvent comprises an
aqueous buffer, such as an aqueous solution of monopotassium
phosphate, e.g., at a concentration of from about 0.25 M to about
0.75 M, for example, about 0.25 M, about 0.3 M, about 0.35 M, about
0.4 M, about 0.45 M, about 0.5 M, about 0.55 M, about 0.6 M, about
0.65 M, about 0.7 M, or about 0.75 M, preferably about 0.5 M.
[0067] In certain embodiments, the invention relates to any of the
methods described herein, wherein the third solvent further
comprises tetrahydrofuran (THF), methyl tert-butyl ether, ethyl
acetate, dioxane, DMF, acetonitrile, or DMSO, preferably methyl
tert-butyl ether.
[0068] In certain embodiments, the invention relates to any of the
methods described herein, wherein the third solvent comprises a
mixture of an aqueous buffer and an organic solvent.
[0069] In certain embodiments, the invention relates to any of the
methods described herein, wherein the third pH is from about 6.25
to about 7.75, for example, about 6.5, about 6.75, about 7.0, about
7.25, or about 7.5, preferably about 7.0.
[0070] In certain embodiments, the invention relates to any of the
methods described herein, wherein the third enzyme is yvaK
esterase, such as yvaK esterase from Bacillus subtilis.
[0071] In certain embodiments, the invention relates to any of the
methods described herein, wherein the third enzyme is BsteE
esterase, preferably BsteE esterase from Bacillus
stearothermophilus.
[0072] In certain embodiments, the invention relates to any of the
methods described herein, wherein the loading of the third enzyme
is from about 40 wt % to about 150 wt % as compared to the starting
material, for example, about 40 wt %, about 45 wt %, about 50 wt %,
about 55 wt %, about 60 wt %, about 65 wt %, about 70 wt %, about
75 wt %, about 80 wt %, about 85 wt %, about 90 wt %, about 95 wt
%, about 100 wt %, about 105 wt %, about 110 wt %, about 115 wt %,
about 120 wt %, about 125 wt %, about 130 wt %, about 135 wt %,
about 140 wt %, about 145 wt %, or about 150 wt %, preferably about
70 wt % as compared to starting material.
[0073] In certain embodiments, the invention relates to any of the
methods described herein, wherein the third temperature is from
about 10.degree. C. to about 40.degree. C., for example, about
15.degree. C., about 20.degree. C., about 25.degree. C., about
30.degree. C., about 35.degree. C., or about 40.degree. C.,
preferably about 20.degree. C.
[0074] In certain embodiments, the invention relates to any of the
methods described herein, wherein the second period of time is from
about 50 h to about 150 h, for example, about 50 h, about 60 h,
about 70 h, about 80 h, about 90 h, about 100 h, about 110 h, about
120 h, about 130 h, about 140 h, or about 150 h, preferably about
100 h.
[0075] In certain embodiments, the invention relates to any of the
methods described herein, further comprising isolating the reaction
product of reaction Scheme C from the reaction mixture, thereby
obtaining substantially pure reaction product of reaction Scheme
C.
[0076] In certain embodiments, the invention relates to any of the
methods described herein, further comprising crystallizing the
reaction product of reaction Scheme C to obtain the compound in a
crystalline form.
[0077] In certain embodiments, the invention relates to any of the
methods described herein, further comprising contacting the
reaction product of reaction Scheme C with a base to obtain a salt
of the compound, optionally in a crystalline form. In some
embodiments, the base is an amine, for example, a secondary amine,
preferably dicyclohexylamine or dibenzylamine.
[0078] In certain embodiments, the invention relates to any of the
methods described herein, wherein the enantiomeric excess of the
reaction product of reaction Scheme C is greater than about 90%,
for example, about 91% ee, about 92% ee, about 93% ee, about 94%
ee, about 95% ee, about 96% ee, about 97% ee, about 98% ee, about
99% ee, preferably greater than about 98% ee.
[0079] In certain embodiments, the invention relates to any of the
methods described herein, wherein the enantiomeric excess of the
salt of the reaction product of reaction Scheme C is greater than
about 90%, for example, about 91% ee, about 92% ee, about 93% ee,
about 94% ee, about 95% ee, about 96% ee, about 97% ee, about 98%
ee, about 99% ee, preferably greater than about 97% ee.
[0080] In certain embodiments, the invention relates to any of the
methods described herein, wherein R is ethyl. In other embodiments,
R is propyl, such as n-propyl. In yet other embodiments, R is
butyl, such as n-butyl.
[0081] In certain embodiments, the invention relates to methods
comprising two or more of the steps described herein.
[0082] In certain embodiments, the invention relates to the use of
any of the compounds described herein in the manufacture of a
medicament.
[0083] Definitions of variables in the structures in the schemes
herein are commensurate with those of corresponding positions in
the formulae delineated herein.
[0084] The compounds described herein contain one or more
asymmetric centers and thus give rise to enantiomers,
diastereomers, and other stereoisomeric forms that may be defined,
in terms of absolute stereochemistry, as (R)- or (S)-, or as (D)-
or (L)- for amino acids. Optical isomers may be prepared from their
respective optically active precursors by the procedures described
above, or by resolving the racemic mixtures. The resolution can be
carried out in the presence of a resolving agent, by chromatography
or by repeated crystallization or by some combination of these
techniques which are known to those skilled in the art. Further
details regarding resolutions can be found in Jacques, et al.,
Enantiomers. Racemates, and Resolutions (John Wiley & Sons,
1981).
[0085] The synthesized compounds can be separated from a reaction
mixture and further purified by a method such as column
chromatography, high pressure liquid chromatography, or
recrystallization. As can be appreciated by the skilled artisan,
further methods of synthesizing the compounds of the formulae
herein will be evident to those of ordinary skill in the art.
Additionally, the various synthetic steps may be performed in an
alternate sequence or order to give the desired compounds. In
addition, the solvents, temperatures, reaction durations, etc.
delineated herein are for purposes of illustration only and one of
ordinary skill in the art will recognize that variation of the
reaction conditions can produce the desired products of the present
invention. Synthetic chemistry transformations and protecting group
methodologies (protection and deprotection) useful in synthesizing
the compounds described herein are known in the art and include,
for example, those such as described in R. Larock, Comprehensive
Organic Transformations, VCH Publishers (1989); T. W. Greene and P.
G. M. Wuts, Protective Groups in Organic Synthesis, 2d. Ed., John
Wiley and Sons (1991): L. Fieser and M. Fieser, Fieser and Fieser's
Reagents for Organic Synthesis, John Wiley and Sons (1994); and L.
Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John
Wiley and Sons (1995), and subsequent editions thereof.
EXEMPLIFICATION
[0086] The present invention is further illustrated by the
following Example which should not be construed as limiting in any
way. The Examples and discoveries described herein are
representative. As such, the studies and results described in the
Examples section herein may be used as a guideline.
Example 1: Knoevenagel Condensation
##STR00012##
[0088] Magnesium chloride (5.06 g, 0.0531 mol, 0.05 equiv.)
followed by 1-propanol (600 mL, 3.0 mL/g of dipropyl malonate) were
charged to a clean/dry 1.0 L glass reactor under nitrogen, which
was set up with a mechanical stirrer and thermocouple at ambient
temperature. Agitation was started and difluoroacetaldehyde ethyl
hemiacetal (163.77 g, 1.1689 mol, 1.10 equiv., based on 90%
potency) was charged and the container was rinsed with 1-propanol
(100 mL, 0.5 mL/g of dipropyl malonate). To this mixture, dipropyl
malonate (DPM) (200.0 g, 1.0626 mol, 1.00 equiv.) was charged and
the flask was rinsed with 1-propanol (100 mL, 0.5 mL/g of dipropyl
malonate). The reaction mixture was heated at 60.degree. C. for 46
h and the reaction was deemed completion, as determined by GC
analysis of in-process sample [Residual dipropyl malonate: 3.65%,
and combined mixture of dipropyl
2-(2,2-difluoro-1-propoxyethyl)malonate (11a) and dipropyl
2-(2,2-difluoroethylidene)malonate (11b): 79.54%]. The mixture was
cooled and distilled on a rotary evaporator at NMT 60.degree. C.
under vacuum to remove 1-propanol and other volatiles (Bath temp:
60.degree. C.). To the resulting oily residue, MTBE (400 mL) was
charged and the distillation was continued under vacuum (Bath temp:
50.degree. C.). MTBE chase distillation was performed two more
times (2.times.400 mL) for a total three times (400 mL MTBE each
time) on rotary evaporator (Bath temp: 50.degree. C.). After chase
distillations were complete, the resulting oil (383.7 g, hazy
solution and contains white solids) was suspended in MTBE (600 mL),
mixed for 5 min, filtered and the solid was rinsed with MTBE (200
mL). The combined filtrate was distilled on a rotary evaporator
(Bath temp: NMT 50.degree. C.) to afford 351.6 g of dipropyl
2-(2,2-difluoro-1-propoxyethyl)malonate, as a major product, which
also contain dipropyl 2-(2,2-difluoroethylidene)malonate as minor
product. Purity of the combined mixture by GC: 88.31% and crude
product (mixture of dipropyl
2-(2,2-difluoro-1-propoxyethyl)malonate (11a), and dipropyl
2-(2,2-difluoroethylidene)malonate) (11b) used "as is" in
cyclopropanation step.
Example 2: Cylopropanation to form (.+-.)-dipropyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate (7)
##STR00013##
[0090] Potassium tert-butoxide (150.6 g, 1.2751 mol, 1.2 equiv.)
followed by 1000 mL of DMF were charged under nitrogen into a
clean/dry 4 L glass reactor, which was set up with a mechanical
stirrer, thermocouple and nitrogen inlet, and the agitation was
started. Trimethylsulfoxonium iodide (280.6 g, 1.2751 mol, 1.2
equiv.) was charged and the funnel was rinsed with 400 mL of DMF
under nitrogen. The mixture was agitated for 1 h at 20.degree. C.
temperature under nitrogen. The crude (dipropyl
2-(2,2-difluoro-1-propoxyethyl)malonate (11a) and dipropyl
2-(2,2-difluoroethylidene)malonate) (11b) was diluted with DMF (150
mL), was charged under nitrogen. The container was rinsed DMF (50
mL) and the mixture was heated at 55.degree. C. for 3 h under
nitrogen. Based on GC analysis in-process samples, the reaction was
deemed complete with 1.19% of residual dipropyl
2-(2,2-difluoroethylidene)malonate (11b) at 17.28 min and 94.33% of
(.+-.)-dipropyl 2-(difluoromethyl)cyclopropane-1,1-carboxylate (7)
at 15.29 min. The mixture was cooled to 0-5.degree. C. and the
reaction was quenched with water (2.0 L) and MTBE was charged (2.2
L). The temperature of the contents was raised to 20.degree. C. and
mixed for 15 min. The aqueous and organic phases were separated and
the aqueous phase was back extracted with MTBE two times (1.8 L and
1.0 L). The combined organic phase was washed with 20% sodium
chloride soln three times (3.times.1.25 L), dried with anhydrous
magnesium sulfate (50 g), and filtered. The filtrate was
concentrated on a rotary evaporator (Bath temp: 55.degree. C.) to
afford 278.92 g of (.+-.)-dipropyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate (7), as a
yellow/pale red oil with 94.89% (pa) purity by GC.
[0091] A portion of the crude (.+-.)-dipropyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate (7, 61.3 g) was
purified by flash chromatography (TLC: Hexanes: Rf: 0.2 (Ethyl
acetate/10:90, Permanganate strain) on CombiFlash RF system using
pre-packed RediSep Rf, Silica column (330 g) and mixture of hexanes
and ethyl acetate solvent (90:10) at flow rate of 220 mL/min. The
desired fractions were combined (A 16-30, B1-30, C1-30, and D
1-11), and the combined fractions were concentrated on rotary
evaporator (Bath temp: 60.degree. C.) and finally chase distilled
with hexanes (3.times.600 mL) on rotary evaporator (Bath temp:
60.degree. C.) to afford 47.9 g (Colorless/clear oil) of
(.+-.)-dipropyl 2-(difluoromethyl)cyclopropane-1,1-carboxylate (7)
with 97.76% (pa) purity by GC, which used for initial enzyme
screening reactions.
Example 3: One-Step Enzymatic Reactive Resolution and
Desymmetrization to Form
(1S,2R)-2-(difluoromethyl)-1-(ethoxycarbonyl)cyclopropanecarboxylic
acid (14, Free Acid)
##STR00014##
[0092] Example 3a: Screen for Enzymes Capable of Reactively
Resolving and Desymmetrizing 13
[0093] A panel of commerically-available lipases and esterases was
screened using chiral HPLC to access their utility in the
resolution and desymmetrization of (.+-.)-diethyl diester 13.
Fourteen enzymes were evaluated using the following procedure:
Enzyme solutions were created by dissolving 5 mg of lyophilized
enzyme or 5 .mu.L of liquid enzyme solution into 1 mL of 0.5 M
sodium phosphate buffer with 0.2 M sodium chloride at pH 8.0.
Diester substrate solution was prepared by combining 18 mg of
(.+-.)-diethyl diester 13 per mL of 0.5 M sodium phosphate buffer
with 0.2 M sodium chloride at pH 8.0. Reactions were initiated by
combining 800 .mu.L of the diester substrate solution with 200
.mu.L of the enzyme solution. The reactions were incubated at
30.degree. C. and 225 rpm for approximately 18 hours. Following
incubation, reactions were prepared for chiral HPLC by adding 120
mg sodium chloride and 20 .mu.L of 5 N hydrochloric acid. Two mL of
methylene chloride were added to each reaction, and each was
vortexed, and centrifuged for 10 minutes at 4000 rpm. The organic
layer was decanted and used for HPLC injection. Samples were
analyzed on a Chiralpak IC 4.6-mm ID.times.25-cm column with a
Heptane/iPrOH/TFA (98/2/0.1) mobile phase at a flow rate of 1.0
mL/min.
TABLE-US-00001 TABLE 1 Enzymatic panel chiral HPLC peak area
responses of the selective hydrolysis and desymmetrization of
(.+-.)-diethyl diester 13 to 2-(difluoromethyl)-1-(ethoxycarbonyl)
cyclopropanecarboxylic acids (14). 8.2 min 8.5 min 9.3 min 9.8 min
10.8 min 12.8 min Diester Diester Monoacid Monoacid Monoacid
Monoacid Sample # Enzyme (S)-13 (R)-13 (1R,2S)-14 (1S,2R)-14
(1S,2S)-14 (1R,2R)-14 1 Lipase - Rhizomucor miehei 73.0 N/D 22.7
<4.4 N/D N/D 2 Esterase- Bacillus stearothermophilus 69.7 5.1
6.0 10.0 4.8 4.4 3 Esterase- Rabbit liver 24.6 2.1 36.4 25.4 N/D
11.5 4 Esterase- Porcine liver 33.7 3.1 21.8 26.8 8.5 6.1 5 PLE
Isozyme 1 51.0 4.9 20.1 13.0 2.7 8.3 6 PLE Isozyme 2 41.3 3.5 25.5
17.6 2.8 9.4 7 PLE Isozyme 3 22.5 1.9 12.2 33.9 24.5 4.9 8 PLE
Isozyme 4 23.8 2.0 17.5 34.1 18.1 4.5 9 PLE Isozyme 5 23.7 2.4 18.1
38.5 17.3 N/D 10 PLE Isozyme 6 17.3 1.5 17.6 42.7 19.8 1.2 11
Esterase- Bacillus subtilis 18.2 1.6 1.8 37.7 35.9 4.6 12 Esterase-
Bacillus stearothermophilus 36.3 3.3 9.8 47.6 3.0 N/D 13 Esterase-
Paeriibacillus barcinonensis 28.6 2.6 N/D 32.7 36.2 N/D 14
Esterase- Pyrobaculum calidifontis 41.7 3.6 11.9 7.9 4.2 30.7
Chemical N/D N/D 36.1 35.9 7.2 7.7 Hydrolysis
Example 3b: Preparation of Esterase, "yvaK" Enzyme
[0094] An esterase `yvaK` enzyme from Bacillus subtilis was
envisioned for selective one step reactive resolution and
desymmetrization of (.+-.)-diethyl diester (13) or desymmetrization
of (R)-propyl diester (7) due to its high selectivity. The
following procedure describes the creation and preparation of
`yvaK` esterase for use as cell-free lysate.
[0095] Construction of yvaK Expression Plasmid and Cell Stocks
[0096] The following nucleotide sequence was synthesized in pUC57
for use in the subsequent expression of the desired yvaK esterase.
Restriction endonuclease sequences of NdeI and BamHI were placed on
the respective 5' and 3' ends of the gene sequence for use in
ligation to a pET21a expression vector. Alternatively, the
restriction digested yvaK gene can be ligated into the pET28a-c
expression plasmid using the same procedure. Upon successful
ligation into the multiple cloning site of pET21a/pET28a-c at sites
NdeI and BamHI, the plasmid was transformed in E. coli strain
BL21(DE3) competent cells for expression. During the
transformation, 2 .mu.L of the plasmid prep was added to competent
E. coli cells and incubated on ice for 30 min, followed by heat
shock at 42.degree. C. for 1 min and back on ice for 2 min. 200
.mu.L of SOC media was added to the transformation mix and
incubated at 37.degree. C. for 1 hr. This was plated on pre-warmed
LB agar plate containing appropriate antibiotics. The plate was
then incubated overnight at 37.degree. C. to allow colonies to
form. These colonies were used to inoculate cultures for the
subsequent production of cell stocks. Cell stocks were created by
mixing equal parts of an overnight (37.degree. C.) culture with
pre-sterilized 50:50 H.sub.20:Glycerol and stored at -80.degree. C.
until use.
[0097] The yvaK esterase gene was restriction digested from the
pUC57 vector and ligated into pEt28a using the above procedure and
confirmed by colony PCR.
[0098] Bacillus subtilis BS2, yvaK Esterase DNA with Restriction
Sites NdeI and BamHI
[0099] Restriction sites: NdeI, BamHI
[0100] Name: BS2_Esterase, aka yvaK Gene/insert size: 750 bp
[0101] Protein: 246 amino acids, .about.32 kDa Gene ID:
BSU33620
[0102] Species: Bacillus subtilis subsp. subtilis str. 168
TABLE-US-00002 CATatgaaagttgtgacaccaaaaccatttacatttaaaggcggagaca
aagcggtgcttttgctgcatggctttacaggaaatacagcggatgtaag
gatgctgggacgatatttgaatgaacgcggctatacgtgccacgcgcct
caatatgaaggacatggcgtcccgcctgaagaacttgtacatacggggc
ccgaagactggtggaaaaacgtaatggatggctatgaatatttaaaatc
tgaaggttatgagagcattgctgcctgcggactgtcgcttggeggggtt
ttttcgctgaaattgggttacactgtacccataaagggaattgtcccaa
tgtgcgcaccgatgcatattaagagtgaagaggtcatgtatcaaggcgt
tctttcatacgctcgcaattacaaaaagtttgaggggaaaagcccggag
caaattgaagaggaaatgaaagaattcgaaaaaacgccgatgaataccc
tcaaggcgctgcaagacttaattgctgatgtgcggaataatgtcgatat
gatttattcaccgacatttgtggtgcaggcccgtcatgaccacatgatt
aataccgaaagcgccaatattatttacaacgaagtggaaactgatgata
aacagctgaaatggtacgaggaatcagggcatgtcattacactcgacaa
agaacgtgacctcgtccatcaggatgtgtatgaatttttagagaagctc
gattggtaaGGATCC.
[0103] Lab-Scale Expression Protocol:
[0104] Step 1:
[0105] Seed inoculum (10 mL) was grow from the yvaK pET21a
BL21(DE3) cell stocks overnight in sterilized Luria Broth (LB)
media containing 50 .mu.g/mL ampicillin at 37.degree. C.
temperature.
[0106] Step 2:
[0107] Prepare a sterilized, baffled 2 L flask containing 500 mL of
LB media with 50 .mu.g/mL ampicillin. Inoculate the flask at 1:200
ratio of overnight seed culture to fermentation broth volume (2.5
mL seed culture per 500 mL fermentation broth)
[0108] Step 3:
[0109] Incubate the fermentation flask at 37.degree. C. and 225
rpm. During this fermentation, periodically monitor the optical
density at 600 nm (OD.sub.600) to determine when the culture has
reached the proper growth for induction. It should require
approximately 4 hours of incubation to reach the desired OD.sub.600
of 0.5-0.8 AU. Upon reaching the desired OD.sub.600, induce the
culture by addition of IPTG to a final culture concentration of 0.1
mM.
[0110] Step 4:
[0111] Following induction, adjust the incubation temperature down
to 30.degree. C. and 225 rpm, and incubate the culture for 16
hours.
[0112] Step 5:
[0113] Harvest cells by centrifugation for 30 minutes at 3750 rpm
and 4.degree. C. Decant and use the resulting cell pellet in
preparation of cell-free lysate.
[0114] Cell-Free Lysate Preparation:
[0115] Step 1:
[0116] Resuspend cell pellet by vortexing in 0.5 M K.sub.2HPO.sub.4
buffer pH 7.0 at a ratio of 1:10 resuspension buffer to original
culture volume (50 mL of buffer for a 500 mL-culture pellet).
[0117] Step 2:
[0118] Sonicate the resulting slurry on ice, 3 times for 30 seconds
allowing 1 minute intervals in between to cool the culture.
[0119] Step 3:
[0120] Centrifuge lysed cell slurry at 7500 rpm, 4.degree. C. for
20 minutes to remove insoluble cell debris. Decant soluble fraction
for use a cell-free lysate.
[0121] Fermentation of Esterase Enzyme, yvaK:
[0122] A 25 mL starter culture of the esterase enzyme, yvaK, was
grown up in LB broth on a shaker at 37.degree. C., 180 RPM in the
presence of kanamycin (50 .mu.g mL.sup.-1) for 7 hrs. Fermentation
media was prepared in the 2 L fermenter (working volume 1.5 L) by
adding 100 mL of 10.times. M9 salts (below), 1 mL of autoclaved
trace elements (below, autoclave separately), 1 mL of autoclaved
magnesium sulfate (1 M, filter sterilized), 1 mL of autoclaved
antifoam (propylene glycol) and 1 mL of autoclaved yeast extract (1
g in 10 mL). These components were then added to 30 g of glucose in
100 mL of H.sub.2O, which was autoclaved separately.
[0123] 10.times. M9 Salts:
TABLE-US-00003 Material Wt Sodium phosphate monobasic, >99% 40 g
Potassium phosphate dibasic, ACS reagent, 98% 146 g Ammonium
chloride 5 g Ammonium sulfate >99% 25 g Citric acid, 99% 10 g
Sodium sulfate 20 g 1 L of water is added to the above ingredients
and the mixture is heat sterilized in situ in the fermenter by
autoclaving at 121.degree. C. for 30 minutes
[0124] Trace Metals:
TABLE-US-00004 Material Wt CaCl.sub.2.cndot.6 H.sub.2O 0.74 g
ZnSO.sub.4.cndot.7 H.sub.2O 0.18 g MnSO.sub.4.cndot.H.sub.2O, 99%
0.1 g Citric acid, 99% 20.1 g FeCl.sub.3.cndot.6 H.sub.2O 16.7 g
CuSO.sub.4.cndot.5 H.sub.2O 0.1 g CoCl.sub.2.cndot.6 H.sub.2O, 98%
ACS reagent 0.104 g 1 L of water is added to the above ingredients
and the mixture is heat sterilized in situ in the fermenter by
autoclaving at 121.degree. C. for 30 minutes
[0125] The 25 mL starter culture of yvaK was then added to the
fermenter. The fermenter was allowed to run at 37.degree. C., with
continuous stirring (1200 RPM) with a constant supply of
filter-sterilized air from an air pump (initial rate 2 vessel
volumes min.sup.-1). The pH was maintained at pH 7 by addition of
35% v/v solutions of ammonium hydroxide and phosphoric acid, as
necessary. After 36 hours, the measured OD.sub.600 at 36 hours was
17. The glycerol feed was initiated to provide extra nutrients to
the growing cells. The components of the glycerol fed are listed
below.
[0126] Glycerol Feed:
TABLE-US-00005 Material Amount (mL) Glycerol, 99% 60 mL 10 .times.
M9 salts 60 mL Magnesium sulfate 1 mL of 1M solution Trace Metals 1
mL (Autoclaved separately) Yeast extract, 100 g L.sup.-1 1 mL 380
mL of water is added to the above ingredients and the mixture is
heat sterilized in situ in the fermenter by autoclaving at
121.degree. C. for 30 minutes. The glycerol was autoclaved
separately.
[0127] After 44 hours and a measured OD.sub.600 of 23, the
temperature of the fermentation was reduced to 25.degree. C. for
protein overexpression. At 45 hours and a measured OD.sub.600 of
27, the temperature had stabilized at 25.degree. C. Overexpression
of the recombinant yvaK enzyme was started by addition of filter
sterilized Isopropyl-.beta.-D-1-thiogalactopyranoside (IPTG) to a
final concentration of 1 mM. The cells were allowed to continue
growing under these conditions overnight for a total fermentation
time of 56 hours. At the end of the fermentation, indicated by a
rise in dissolved oxygen (DO), the wet cell pellet was collected by
centrifugation at 8000 RPM for 10 minutes. A total yield of 51.2 g
L.sup.-1 of wet cell pellet was obtained from the fermentation.
Example 3c: One-Step Enzymatic Reactive Resolution of
(.+-.)-diethyl 2-(difluoromethyl)cyclopropane-1,1-carboxylate
(13)
[0128] In this reaction, yvaK enzyme was prepared as described to
yield cell-free lysate of the enzyme. Into an 500 mL Erlenmeyer
flask, 210 mL of sodium phosphate buffer was added (0.5 M, pH 6.9),
and combined with 15 mL of yvaK cell-free lysate solution. The
racemic (.+-.)-diethyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate (13, 750 mg) was
added to the flask and set at 30.degree. C. and 125 RPM in a shaker
incubator. The reaction was allowed to proceed for 144 hours, and
reaction progress was monitored by chiral HPLC. The remaining
unreacted diester was removed by twice extracting into 60 mL of
methyl tert-butyl ether (MTBE). The remaining aqueous phase was pH
adjusted to 3 by the addition of 17 mL of 5 N hydrochloric acid.
The monoacid reaction product was recovered by subsequent
extraction using three 60 mL fractions of MTBE. The organic
fractions were combined and filtered through Celite.
[0129] The reaction resulted in 97% conversion of the desired
(R)-diester (13) to monoacid isomers
(1R,2S)-14:(1S,2R)-14:(1S,2S)-14:(1R,2R)-14 with ratio of with a
ratio of isomers 1:2.7:1.25:0 as determined by chiral HPLC,
respectively (HPLC elution order: Isomer 1, (1R,2S)-14; Isomer 2
(1S,2R)-14; Isomer 3 (1S,2S)-14; Isomer 4 (1R,2R)-14). From this
enzymatic reaction, 81.8% of all monoacid isomers (14) were
isolated as a mixture by extraction with MTBE solvent and
concentration on a rotary evaporator.
Example 4: Two Step Enzymatic Reactive Resolution and
Desymmetrization of (.+-.)-diethyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate (13)
##STR00015##
[0130] Example 4a: Enzymatic Reactive Resolution of (.+-.)-diethyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate (13)
[0131] To a solution of RML (lipase from Rhizomucor miehei) (50
mL/g, 27.5 mL) in 0.5 M NaH.sub.2PO.sub.4 buffer (3.3 g/L total aq.
volume, 125 mL) was added a solution of (.+-.)-diethyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate (13, 2.328 mmol,
0.55 g) in DMF (10% v/v, 15 mL). The resulting solution was shaken
in an Erlenmeyer flask at 150 rpm at 30.degree. C. for 95 h. The
reaction was monitored by chiral HPLC [Regis (S,S)-Whelk O1 5/100
Kromasil 4.6.times.25 cm, Heptane/i-PrOH/TFA (98/2/0.1], Detector:
UV 230 nm] for consumption of (S)-enantiomer of diester (13). The
reaction was quenched with brine (50 mL) and saturated NaHCO.sub.3
solution and the pH was adjusted to 9. The aqueous reaction
solution was extracted with MTBE (3.times.150 mL); washed combined
organic layers with saturated NaHCO.sub.3 solution (1.times.100 mL)
and brine (2.times.100 mL). The undesired
(1R,2S)-2-(difluoromethyl)-1-(ethoxycarbonyl)
cyclopropanecarboxylic acid (14) remained in aqueous phase and
removed. The combined organic layers were dried over excess
MgSO.sub.4, filtered, and concentrated on a rotary evaporator under
vacuum to give the resolved (R)-diethyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate (13) as a pale
yellow oil (0.168 g, 97.4% e.e., 64.4% yield).
Example 4b: Enzymatic Desymmetrization of (R)-diethyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate (13)
[0132] To a solution of yvaK in 0.5 M NaH.sub.2PO.sub.4 buffer (5:1
culture vol resuspension, 45 mL) was added (R)-diethyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate (13, 0.635 mmol,
0.15 g). The resulting solution was shaken in an Erlenmeyer flask
at 150 rpm at 30.degree. C. for 68 h. The reaction was monitored by
chiral HPLC (Regis (S,S)-Whelk O1 5/100 Kromasil 4.6.times.25 cm,
Heptane/iPrOH/TFA [98/2/0.1], UV 230 nm) for consumption of
(R)-enantiomer of diester (13). The reaction was quenched with 5N
HCl (pH adjust to 2). The aqueous reaction solution was extracted
with MTBE (3.times.60 mL), with centrifugation following each
extraction (10 min at 2500 rpm). The combined organic layers were
washed with brine (2.times.50 mL), then dried over excess
MgSO.sub.4, filtered, and concentrated in vacuo to give
(1S,2R)-2-(difluoromethyl)-1-(ethoxycarbonyl)cyclopropanecarboxylic
acid (14) as an amber oil (0.109 g, 99.4% e.e., 84.2% yield).
Comparative Example 4a: Separation of (.+-.)-diethyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate (13) enantiomers
##STR00016##
[0134] (.+-.)-Diethyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate (13) was dissolved
in Heptane/i-PrOH/TFA (98:2:0.1) and made a stock solution with
concentration of 40 mg/mL for purification/separation of both
enantiomers of 13 by preparative HPLC system (Column: ChiralPak IC,
5.mu. 21.times.250 mm; Mobile Phase: Heptane/i-PrOH/TFA (98/2/0.1),
Solvent system: Isocratic; Detector: UV 215 nm, Column temperature:
Ambient, 19-23.degree. C.; Injection Volume: 2 mL, Run time: 20
min). Both (R) and (S)-enantiomers of 13 were collected in two
fractions and the combined fractions concentrated on a rotary
evaporator under vacuum to afford 0.94 g of Isomer 1, (S)-diethyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate ((S)-13, Isomer 1)
in >99.5% e.e., and 0.89 g of Isomer 2, (R)-diethyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate ((R)-13, Isomer 2)
in >99.5% e.e.
Example 5: Enzymatic Reactive Resolution Screening of
(.+-.)-dimethyl 2-(difluoromethyl)cyclopropane-1,1-carboxylate
(15), (.+-.)-dipropyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate (7) and
(.+-.)-dibutyl 2-(difluoromethyl)cyclopropane-1,1-carboxylate
(17)
##STR00017##
[0136] A range of esters were synthesized as alternatives to the
ethyl diester (13) (Example 4) to ascertain if increases in
selectivity could be achieved. Racemic methyl (15), propyl (7) and
butyl (17) diesters were synthesized for evaluation in the
hydrolysis reaction of racemic diester. Several enzymes; AH-45,
AH-46, and DSM PLE 444 showed improvements in selectivity during
preliminary screening were evaluated for their applicability.
Example 5a: Methyl Diester (15)
[0137] Screening of methyl diester (15) yielded a number of
potential enzymes which were screened for their selectivity in
diester hydrolysis. The results of this optimization are detailed
in the following section.
[0138] DSM PLE 444 Mediated Desymmetrization of Methyl Diester
(15)
[0139] DSM PLE 444 was identified as a potential enzyme to deliver
the required (1S,2R)-monoacid product directly. Reactions were
carried out over a range of pH's to determine if the E-value could
be improved sufficiently to make this a viable option. The reaction
at pH 6 gave the highest selectivity toward the desired monoacid by
the following procedure.
[0140] To a 3-neck 50 mL round bottomed flask, KH.sub.2PO.sub.4
buffer (0.1 M, 20 mL) was charged. Enzyme DSM PLE 444 was charged
followed by addition of substrate (100 mg). The reactions were
stirred at 1000 rpm with magnetic fleas. The reactions were allowed
to run overnight and worked up for analysis. The pH was adjusted to
1.85 by addition of 2 M HCl. The aqueous was extracted with MTBE
(2.times.10 mL). The combined organics were concentrated in vacuo,
taken up in 95/5 heptane/EtOH, filtered through MgSO.sub.4 and
concentrated.
[0141] AH-45 Mediated Resolution of Methyl Diester (15)
[0142] To a COC vial, 0.1 M KH.sub.2PO.sub.4 buffer (pH 6, 10 mL)
was charged. Enzyme AH-45 (50 .mu.L) was charged followed by
addition of dimethyl ester substrate (15, 50 mg). The reactions
were shaken at 200 RPM for 20 hours, and then worked up by
adjusting the pH to 1.85 by addition of 2 M HCl. The aqueous was
extracted with MTBE (2.times.10 mL). The emulsion was filtered
through Celite, which was washed with MTBE. The combined organics
were concentrated in vacuo, taken up in 95/5 hep/EtOH, filtered
through MgSO.sub.4 and concentrated.
Example 5b: Propyl Diester (7)
[0143] Screening of propyl diester (7) yielded a number of
potential enzymes which were screened for their selectivity in
diester hydrolysis. The results of this optimization are detailed
in the following section.
[0144] AH-45 Mediated Resolution of Propyl Diester (7)
[0145] To a COC vial, 0.1 M KH.sub.2PO.sub.4 buffer (pH 7, 10 mL)
was charged. Enzyme AH-45 (50 .mu.L) was charged followed by
addition of dipropyl ester substrate (7, 50 mg). The reactions were
shaken at 200 RPM for 20 hours, and then worked up by adjusting the
pH to 1.85 by addition of 2 M HCl. The aqueous was extracted with
MTBE (2.times.10 mL). The emulsion was filtered through Celite,
which was washed with MTBE. The combined organics were concentrated
in vacuo, taken up in 95/5 hep/EtOH, filtered through MgSO.sub.4
and concentrated. This reaction was carried out in the
Ca(OAc).sub.2 buffer and the rate of reaction was improved
significantly.
[0146] AH-46 Mediated Resolution of Propyl Diester (7)
[0147] To a COC vial, 0.1 M KH.sub.2PO.sub.4 buffer (pH 7, 10 mL)
was charged. Enzyme AH-46 (50 .mu.L) was charged followed by
addition of dipropyl ester substrate (7, 50 mg). The reactions were
shaken at 200 RPM for 20 hours, and then worked up by adjusting the
pH to 1.85 by addition of 2 M HCl. The aqueous was extracted with
MTBE (2.times.10 mL). The emulsion was filtered through Celite,
which was washed with MTBE. The combined organics were concentrated
in vacuo, taken up in 95/5 hep/EtOH, filtered through MgSO.sub.4
and analyzed by HPLC.
Example 5c: Butyl Diester (17)
[0148] Screening of butyl diester (17) yielded a number of
potential enzymes which were screened for their selectivity in
diester hydrolysis. The results of this optimization are detailed
in the following section.
[0149] AH-45 Mediated Resolution of Butyl Diester (17)
[0150] To a COC vial, 0.1 M KH.sub.2PO.sub.4 buffer (pH 7, 10 mL)
was charged. Enzyme AH-45 (50 .mu.L) was charged followed by
addition of dibutyl ester substrate (17, 50 mg). The reactions were
shaken at 200 RPM for 20 hours, and then worked up by adjusting the
pH to 1.85 by addition of 2 M HCl. The aqueous was extracted with
MTBE (2.times.10 mL). The emulsion was filtered through Celite,
which was washed with MTBE. The combined organics were concentrated
in vacuo, taken up in 95/5 hep/EtOH, filtered through MgSO.sub.4
and concentrated
[0151] AH-46 Mediated Resolution of Butyl Diester (17)
[0152] To a COC vial, 0.1 M KH.sub.2PO.sub.4 buffer (pH 8, 10 mL)
was charged. Enzyme AH-46 (50 .mu.L) was charged followed by
addition of dibutyl ester substrate (17, 50 mg). The reactions were
shaken at 200 RPM for 20 hours, and then worked up by adjusting the
pH to 1.85 by addition of 2 M HCl. The aqueous was extracted with
MTBE (2.times.10 mL). The emulsion was filtered through Celite,
which was washed with MTBE. The combined organics were concentrated
in vacuo, taken up in 95/5 hep/EtOH, filtered through MgSO.sub.4
and concentrated.
Example 6: Enzymatic Reactive Resolution and Desymmetrization to
Form
(1S,2R)-2-(difluoromethyl)-1-(propoxycarbonyl)cyclopropanecarboxylic
acid dicyclohexylamine salt (8)
##STR00018##
[0153] Example 6a: Enzymatic Reactive Resolution of (.+-.)-dipropyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate (7) Via AH-45
[0154] 0.1 M sodium citrate buffer, pH 5.75 (800 mL, 40 vol) was
charged to a 3-neck 2-L RBF equipped with a calibrated pH probe, pH
stat addition line, baffle and a mechanical stirrer. The reaction
mixture was warmed to 20.degree. C. before AH-45 (20 g, 100 wt %
wrt substrate) was added. Crude (.+-.)-dipropyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate (7) (20 g) was
subsequently added and the reaction was stirred at 400 rpm.
[0155] Samples (2 mL) were removed, adjusted to acidic pH by
addition of 10 drops of 2 M HCl, then extracted with MTBE (2 mL).
The organic layer was concentrated in vacuo, then the residue was
taken up in 95/5 (v/v) Hex/EtOH (1 mL) which was dried over
Na.sub.2SO.sub.4 and analyzed on HPLC.
[0156] After 72 h the reaction had reached 94% diester ee and was
worked up. The reaction pH was adjusted to pH 8.4 by addition of
15% (w/w) Na.sub.2CO.sub.3 solution. The reaction mixture was
extracted with MTBE (2.times.100 mL). The emulsified organic layers
were transferred to falcon tubes and centrifuged at 10000 g for 10
mins. The MTBE layers were decanted off, combined, washed with sat.
bicarb (40 mL) and water (40 mL). The organic layer was then
concentrated in vacuo to give 7 as a yellow oil (7.58 g, 94.8%
e.e., 96% wt/wt by 1H NMR assay). Expected yield=9.4 g,
Recovered=7.27 g (corrected for assay), % yield=77.
Example 6b(i): Desymmetrization of (R)-dipropyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate ((R)-7) Via yvaK
[0157] 0.1 M sodium phosphate buffer, pH 8.5 (290 mL) was charged
to a 3-neck 1-L RBF equipped with a calibrated pH probe, pH stat
addition line, baffle and a mechanical stirrer. The reaction
mixture was warmed to 20.degree. C. before yvaK freeze dried whole
cells (6.3 g, 86 wt % wrt substrate) was added. The pH was then
re-adjusted to 8.5. (R)-cyclopropyl diester 7 (7.58 g, 94.8% e.e.,
96% purity by 1H NMR assay) in MTBE (7.6 mL) was subsequently added
and the reaction was stirred at 400 rpm.
[0158] Samples were taken periodically to check reaction progress.
The analysis was performed using the achiral method. A sample of
the reaction mixture (0.5 mL) was diluted with EtOH (0.5 mL) and
THF (0.25 mL). The sample was then centrifuged at 13200 rpm for 2
mins. The supernatant was removed and filtered through a 0.2 Lm
filter. The sample was then analyzed directly on HPLC.
[0159] After 21 h reaction was deemed complete. The pH was adjusted
to 1.5 by addition of 20% HCl solution. Toluene (40 mL) was added
followed by Celite (6.3 g) and the reaction mixture stirred for 30
mins. The suspension was then filtered on a sintered funnel
(filtration slow, Celite resembled chewing gum). The filtrate was
transferred to separating funnel, and the toluene layer was
separated off. The Celite was rinsed with toluene (40 mL) which was
then used for 2nd extraction of the aqueous layer. The Celite cake
was then transferred to a flask and slurried overnight with MTBE
(100 mL). Concentration of MTBE layer yielded a red oil (2.4
g).
[0160] Following on from the DCHA salt screening reactions it was
deemed that salt formation would be carried out in MTBE/Heptane as
solvent/antisolvent. The toluene layer was combined with the
residue from the MTBE layer and concentrated in vacuo. The residue
was azeodried from toluene (2.times.150 mL), then the residue was
taken up in MTBE (50 mL), filtered to remove solid particles and
concentrated to afford (1S,2R)-7 as a reddish oil (4.04 g, 96.8%
e.e., 89% purity by .sup.1H NMR assay).
Example 6b(ii): Desymmetrization of (R)-dipropyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate ((R)-7)
[0161] In the following procedure, a one-step resolution of
enriched (R)-dipropyl ester (7) was performed to yield
(1S,2R)-monoacid as the major product species. In this reaction, a
500 mL culture pellet of yvaK enzyme was resuspended in 25 mL of
KH.sub.2PO.sub.4 buffer (0.5 M pH 7.0). The resuspension was
sonicated 3 times in 30 second intervals over ice. The lysate
solution was then centrifuged at 7500 RPM, 4.degree. C. for 15
minutes, and the supernate was retained as the cell-free lysate
solution. To this solution of yvaK in 0.5M KH.sub.2PO.sub.4 buffer
(0.035 g [71% wt/wt], 13.4 mL) was added a solution of enriched
(R)-dipropyl ester (9, 0.189 mmol, 0.050 g) in MTBE (3.33 mL/g,
0.17 mL). The resulting opaque solution stirred vigorously at room
temperature (22.degree. C.) for 98 h. Reaction mixture was quenched
with 5N HCl (pH adjust to <2), then extracted with MTBE
(2.times.10 mL), with centrifugation following each extraction (10
min at 2500 RPM). The combined organic layers were dried over
excess MgSO.sub.4, filtered, and concentrated in vacuo (35.degree.
C. water bath) to give (1S,2R)-monoacid ((1S,2R)-6, 0.0422 g) as an
amber oil [crude](98.8% e.e., 97% wt/wt by .sup.1H-NMR, 97%
recovery).
Example 6c: Formation of
(1S,2R)-2-(difluoromethyl)-1-(propoxycarbonyl)-cyclopropanecarboxylic
acid dicyclohexylamine salt (8)
[0162] Monoacid (1S,2R)-6 (4.04 g, 96.8% e.e., 89% assay by NMR),
prepared as described in Example 6b(i), was dissolved in MTBE (3.6
mL, 1 vol) with stirring. DCHA (3.00 g, 1 eq) was added in slowly
to the solution. As heptane (22 mL) was about to be added, the DCHA
salt spontaneously crystallised from solution to give a solid mass.
Heptane was added and the solid broken up and stirred for 1 h. The
solid was filtered; however the solid contained fine white solid
and brown coloured lumps. The solid was transferred to a flask and
slurried in MTBE (10 mL) for 1 h, then filtered to leave a white
solid which was dried on the filter (3.3 g). Yield too low. The
solids and filtrates were combined and concentrated, then the solid
was taken up in MTBE (3.6 mL) and heated to 40.degree. C. to give a
mobile slurry. Heptane (22 mL) warmed to 40.degree. C. was then
added to the suspension and was stirred for 2 h. The suspension was
allowed to cool to room temperature overnight. The suspension was
then filtered and dried on the filter to afford (1S,2R)-8 as a
white solid (4.0 g, 98.0% e.e.).
Example 6d: Enzymatic Reactive Resolution of (.+-.)-dipropyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate (7) Via AH-45
[0163] 0.1 M calcium acetate buffer, pH 7.5 (265 mL, 10.6 vol) was
charged to a 500-mL RBF equipped with a calibrated pH probe, pH
stat addition line, temperature probe and mechanical stirrer. To
the buffer solution were charged AH-45 (12.5 g, 50 wt %) and crude
(.+-.)-dipropyl 2-(difluoromethyl)cyclopropane-1,1-carboxylate
((.+-.)-7, 25 g). The reaction was stirred at 300 rpm, controlled
at 19-24.degree. C., and monitored by chiral HPLC [Phenomenex Lux 3
[m Cellulose-2, 250.times.4.6 mm, Heptane/i-PrOH/TFA
(98.5/1.5/0.1], Detector: UV 210 nm].
[0164] After 90 h, the reaction had reached 99.8% diester e.e. and
was adjusted to pH 1.5 by addition of 20% (w/w) HCl solution.
Celite (6.7 g, 25 wt %) was added to the reaction mixture and
stirred, followed by MTBE (50 mL, 2 vol) and stirred. The biphasic
mixture was filtered and the filter cake was rinsed with MTBE
(3.times.50 mL). The resulting organic filtrate was used to extract
the aqueous. The organic phases were combined and washed with 5%
(w/w) sodium bicarbonate solution (3.times.50 mL), dried over
MgSO.sub.4, filtered, and concentrated in vacuo to give (R)-7 as a
dark yellow oil (9.50 g, 99.6% e.e., 93.3 wt % by qNMR assay).
Expected yield=10.95 g, Recovered=8.86 g (corrected for assay), %
yield=82.
Example 6e: Desymmetrization of (R)-dipropyl
2-(difluoromethyl)cyclopropane-1,1-carboxylate ((R)-7) Via
BsteE
[0165] 0.1 M sodium phosphate buffer, pH 8.3 (117 mL, 14 vol) was
charged to a 500 mL RBF equipped with a pH probe, pH stat addition
line, temperature probe and mechanical stirrer. The solution was
controlled at 45-50.degree. C. before charging BsteE pretreated
cell lysate solution (30 mL, 3.57 vol) followed by (R)-cyclopropyl
diester (R)-7 (8.4 g crude, 7.8 g assay adjusted, 99.6% e.e.),
prepared as described in example 6d. The reaction was stirred at
400 rpm, controlled at 45-50.degree. C., and monitored by chiral
HPLC.
[0166] After 24 h, the reaction had reached >99 PA % monoacid
(wrt diester) and was cooled to 19-24.degree. C., pH was adjusted
to 1.5 by addition of 20% (w/w) HCl solution, and diluted with MTBE
(50 mL, 6 vol). The biphasic mixture was filtered and the filter
cake was rinsed with MTBE (2.times.50 mL). The resulting organic
filtrate was used to extract the aqueous. The organic phases were
combined and washed with purified water (50 mL), dried over
MgSO.sub.4, filtered, and concentrated in vacuo to give (1S,2R)-6
as a dark yellow oil (6.79 g, 99.3% e.e., 93.7 wt % by qNMR assay).
Expected yield=6.59 g, Recovered=6.36 g (corrected for assay), %
yield=97.
Example 6f: Formation of
(1S,2R)-2-(difluoromethyl)-1-(propoxycarbonyl)-cyclopropanecarboxylic
acid dicyclohexylamine salt (8)
[0167] Monoacid (1S,2R)-6 (1.09 g crude, 1.02 g assay adjusted,
99.3% e.e.), prepared as described in Example 6e, was charged to a
25 mL flask equipped with stir bar, followed by MTBE (1.1 mL, 1
vol) and n-heptane (6.6 mL, 6 vol). The mixture was heated to
40-45.degree. C. and mixed until (1S,2R)-6 dissolved completely.
Dicyclohexylamine (0.96 mL, 1 eq) was added slowly dropwise to the
reaction solution. The reaction slurry was held at temperature and
mixed for 1 h, then cooled to ambient temperature (19-24.degree.
C.) and mixed for 16 h. The reaction slurry was subsequently cooled
to 5-10.degree. C. and held at temperature for 6 h, then filtered.
The filter cake was washed with a 6:1 n-heptane:MTBE solution
(2.times.1 mL), then dried in a vacuum oven (35-40.degree. C.,
35-65 torr) for 16 h, to afford (1S,2R)-8 as a white solid (1.42 g,
99.9% e.e., 98.2 wt % by qNMR assay). Expected yield=1.77 g,
Recovered=1.39 g (corrected for assay), % yield=79.
Example 7: Curtius Rearrangement to form (1R,2R)-propyl
1-((tert-butoxycarbonyl)
amino)-2-(difluoromethyl)cyclopropanecarboxylate (12)
##STR00019##
[0168] Example 7a: Salt Break
[0169] A 100-mL round bottom flask, equipped with a Teflon coated
magnetic stir bar, was charged with the above dicyclohexylamine
salt (1S,2R)-8 (4.0 g, 9.91 mmol) and MTBE (30 mL). To this
suspension was added a 15% H.sub.3PO.sub.4 solution (w/w, 18 mL)
and the resulting mixture was stirred at room temperature for 15
min. The resulting solution was poured into a 125-mL separatory
funnel and the layers were cut. The top organic layer was washed
with an additional 2.5 mL 15% H.sub.3PO.sub.4 and the layers cut.
The organic layer was then washed with sat. aq. NaCl, the layers
cut, and the organics dried over MgSO.sub.4. After filtration of
the MgSO.sub.4, the solvent was removed in vacuo to give 2.54 g
free acid (1S,2R)-6 as a clear oil.
##STR00020##
Example 7b: Curtius Rearrangement
[0170] A separate 100-mL three-necked flask equipped with a
mechanical stirrer and pressure equalizing addition funnel, was
charged with t-BuOH (16.6 mL), free acid (1S,2R)-6 (2.54 g, 11.43
mmol), triethylamine (5.26 g, 7.25 mL, 52.02 mmol). The mixture was
then heated to 80-84.degree. C. (bath temperature). DPPA (2.43 g,
1.9 mL, 8.82 mmol) was added slowly using a syringe pump, and the
mixture was allowed to stir for an additional NLT 6 hours after
complete addition. The solvent removed under reduced pressure and
the crude oil was dissolved in 60 mL MTBE and added to a separatory
funnel. The organic phase was first washed with 5% citric acid
(2.times.30 mL) and the layers cut. The organic phase was then
washed with sat. aq. NaHCO.sub.3 (2.times.30 mL) and the layers
cut. The organics were then washed with H.sub.2O (2.times.30 mL)
and the layers cut. The organic phase was dried over
Na.sub.2SO.sub.4, filtered, and concentrated to provide 2.45 g of
(1R,2R)-propyl
1-((tert-butoxycarbonyl)amino)-2-(difluoromethyl)cyclopropanecarboxylate
(12) as a yellow-orange oil, which was used as is in next step.
Example 8: Hydrolysis to form
(1R,2R)-1-((tert-butoxycarbonyl)amino)-2-(difluoromethyl)cyclopropane
carboxylic acid (1)
##STR00021##
[0172] A solution of (1R,2R)-propyl
1-((tert-butoxycarbonyl)amino)-2-(difluoromethyl)cyclopropanecarboxylate
(12) (2.43 g, 8.28 mmol), prepared as described above, in
acetonitrile (13 mL) was cooled to 5.degree. C., then treated with
a solution of LiOH (0.60 g, 24.85 mmol, 3.0 equiv) in water (13
mL), added over 7 minutes. The mixture was stirred at ambient
temperature overnight. Upon reaction completion, 15% aqueous citric
acid was added to achieve a pH of 4-4.5. The mixture was
concentrated under vacuum to remove the acetonitrile, and solid
NaCl was added to make a saturated solution. The resulting slurry
was mixed overnight at ambient temperature, filtered and washed
with 2 mL water to afford 7.5 g of wet cake, which was crystallized
from water and dried in a vacuum oven to afford 1.1 g of
(1R,2R)-1-((tert-butoxycarbonyl)amino)-2-(difluoromethyl)cyclopropanecarb-
oxylic acid (1).
INCORPORATION BY REFERENCE
[0173] The contents of all references (including literature
references, issued patents, published patent applications, and
co-pending patent applications) cited throughout this application
are hereby expressly incorporated herein in their entireties by
reference. Unless otherwise defined, all technical and scientific
terms used herein are accorded the meaning commonly known to one
with ordinary skill in the art.
EQUIVALENTS
[0174] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims. The contents of all references, patents, and
published patent applications, and patent applications cited
throughout this application are incorporated herein by reference.
Sequence CWU 1
1
11750DNABacillus subtilis 1catatgaaag ttgtgacacc aaaaccattt
acatttaaag gcggagacaa agcggtgctt 60ttgctgcatg gctttacagg aaatacagcg
gatgtaagga tgctgggacg atatttgaat 120gaacgcggct atacgtgcca
cgcgcctcaa tatgaaggac atggcgtccc gcctgaagaa 180cttgtacata
cggggcccga agactggtgg aaaaacgtaa tggatggcta tgaatattta
240aaatctgaag gttatgagag cattgctgcc tgcggactgt cgcttggcgg
ggttttttcg 300ctgaaattgg gttacactgt acccataaag ggaattgtcc
caatgtgcgc accgatgcat 360attaagagtg aagaggtcat gtatcaaggc
gttctttcat acgctcgcaa ttacaaaaag 420tttgagggga aaagcccgga
gcaaattgaa gaggaaatga aagaattcga aaaaacgccg 480atgaataccc
tcaaggcgct gcaagactta attgctgatg tgcggaataa tgtcgatatg
540atttattcac cgacatttgt ggtgcaggcc cgtcatgacc acatgattaa
taccgaaagc 600gccaatatta tttacaacga agtggaaact gatgataaac
agctgaaatg gtacgaggaa 660tcagggcatg tcattacact cgacaaagaa
cgtgacctcg tccatcagga tgtgtatgaa 720tttttagaga agctcgattg
gtaaggatcc 750
* * * * *