U.S. patent application number 16/459980 was filed with the patent office on 2020-01-23 for novel plant-derived cis-regulatory elements for the development of pathogen-responsive chimeric promotors.
This patent application is currently assigned to KWS SAAT SE. The applicant listed for this patent is KWS SAAT SE. Invention is credited to Reinhard HEHL, Jeannette KOSCHMANN, Julia NIEMEYER, Dietmar STAHL, Fridtjof WELTMEIER.
Application Number | 20200024613 16/459980 |
Document ID | / |
Family ID | 47998116 |
Filed Date | 2020-01-23 |
![](/patent/app/20200024613/US20200024613A1-20200123-D00001.png)
![](/patent/app/20200024613/US20200024613A1-20200123-D00002.png)
![](/patent/app/20200024613/US20200024613A1-20200123-D00003.png)
![](/patent/app/20200024613/US20200024613A1-20200123-D00004.png)
![](/patent/app/20200024613/US20200024613A1-20200123-D00005.png)
![](/patent/app/20200024613/US20200024613A1-20200123-D00006.png)
![](/patent/app/20200024613/US20200024613A1-20200123-D00007.png)
![](/patent/app/20200024613/US20200024613A1-20200123-D00008.png)
![](/patent/app/20200024613/US20200024613A1-20200123-D00009.png)
![](/patent/app/20200024613/US20200024613A1-20200123-D00010.png)
![](/patent/app/20200024613/US20200024613A1-20200123-D00011.png)
View All Diagrams
United States Patent
Application |
20200024613 |
Kind Code |
A1 |
STAHL; Dietmar ; et
al. |
January 23, 2020 |
NOVEL PLANT-DERIVED CIS-REGULATORY ELEMENTS FOR THE DEVELOPMENT OF
PATHOGEN-RESPONSIVE CHIMERIC PROMOTORS
Abstract
The invention relates to an isolated cis-regulatory element
imparting pathogen inducibility or elicitor inducibility, which
comprises a nucleic acid molecule, the molecule sequence of which
corresponds to one of the core sequence motifs comprising a)
vaaagtm, b) aaacca, c) scaaam, d) acrcg, e) sktgkact, f) mrtsack,
g) ccaccaa, h) tcgtctcttc (SEQ ID NO: 35), i) wwkgwc or a core
sequence motif complementary to a) to i).
Inventors: |
STAHL; Dietmar; (Einbeck,
DE) ; WELTMEIER; Fridtjof; (Einbeck, DE) ;
HEHL; Reinhard; (Braunscheig, DE) ; KOSCHMANN;
Jeannette; (Konigslutter, DE) ; NIEMEYER; Julia;
(Aerzen, DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
KWS SAAT SE |
Einbeck |
|
DE |
|
|
Assignee: |
KWS SAAT SE
Einbeck
DE
|
Family ID: |
47998116 |
Appl. No.: |
16/459980 |
Filed: |
July 2, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14367521 |
Jun 20, 2014 |
10385358 |
|
|
PCT/DE2012/001223 |
Dec 21, 2012 |
|
|
|
16459980 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/8279
20130101 |
International
Class: |
C12N 15/82 20060101
C12N015/82 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 23, 2011 |
DE |
102011122267.0 |
Claims
1.-14. (canceled)
15. A plant cell comprising a native promoter which is suitable for
effecting an expression of an operatively linked nucleic acid
molecule in a plant cell and which comprises a minimal promoter and
at least one cis-regulatory element upstream from the minimal
promoter, wherein the cis-regulatory element imparts a pathogen
inducibility or an elicitor inducibility and comprises a nucleotide
sequence selected from the group consisting of a) SEQ ID NO: 138,
b) SEQ ID NO: 139, c) SEQ ID NO: 140, d) SEQ ID NO: 141, e) SEQ ID
NO: 142, f) SEQ ID NO: 143, g) SEQ ID NO: 144, h) SEQ ID NO: 35, i)
SEQ ID NO: 145, and j) a nucleotide sequence complementary to the
sequence of a)-i); wherein the distance from the minimal promoter
to the first upstream cis-regulatory element is between 0 and 300
base pairs.
16. The plant cell of claim 15, wherein the cis-regulatory element
comprises a nucleotide sequence selected from the group consisting
of a) SEQ ID NO: 1, b) SEQ ID NO: 2, c) SEQ ID NO: 3, d) SEQ ID NO:
4, e) SEQ ID NO: 5, f) SEQ ID NO: 6, g) SEQ ID NO: 33, h) SEQ ID
NO: 34, and i) SEQ ID NO: 41.
17. The plant cell of claim 15, wherein the cis-regulatory element
comprises a nucleotide sequence selected from the group consisting
of a) SEQ ID NO: 7, b) SEQ ID NO: 8, c) SEQ ID NO: 9, d) SEQ ID NO:
10, e) SEQ ID NO: 11, f) SEQ ID NO: 12, g) SEQ ID NO: 13, h) SEQ ID
NO: 14, i) SEQ ID NO: 44, and j) SEQ ID NO: 15.
18. The plant cell of claim 15, wherein the cis-regulatory element
comprises a nucleotide sequence selected from the group consisting
of a) SEQ ID NO: 16, b) SEQ ID NO: 17, c) SEQ ID NO: 18, and d) SEQ
ID NO: 19.
19. The plant cell of claim 15, wherein the cis-regulatory element
comprises a nucleotide sequence selected from the group consisting
of a) SEQ ID NO: 20, b) SEQ ID NO: 21, c) SEQ ID NO: 22, and d) SEQ
ID NO: 23.
20. The plant cell of claim 15, wherein the cis-regulatory element
comprises a nucleotide sequence selected from the group consisting
of a) SEQ ID NO: 24, b) SEQ ID NO: 25, and c) SEQ ID NO: 26.
21. The plant cell of claim 15, wherein the cis-regulatory element
comprises a nucleotide sequence selected from the group consisting
of a) SEQ ID NO: 27 and b) SEQ ID NO: 28.
22. The plant cell of claim 15, wherein the cis-regulatory element
comprises a nucleotide sequence selected from the group consisting
of a) SEQ ID NO: 30, b) SEQ ID NO: 31, and c) SEQ ID NO: 32.
23. The plant cell of claim 15, wherein the cis-regulatory element
comprises a nucleotide sequence selected from the group consisting
of a) SEQ ID NO: 27, b) SEQ ID NO: 28, c) SEQ ID NO: 42, and d) SEQ
ID NO: 43.
24. The plant cell of claim 15, wherein the at least one
cis-regulatory element is heterologous to the minimal promoter.
25. The plant cell of claim 15, wherein the at least one
cis-regulatory element is localized in a genetic environment that
is different from that of the natural promoter of the at least one
cis-regulatory element.
26. The plant cell of claim 15, wherein the at least one
cis-regulatory element comprises at least 11 nucleotides.
27. The plant cell of claim 15, wherein the plant cell comprises at
least two cis-regulatory elements.
28. The plant cell of claim 27, wherein the distance between the
two cis-regulatory elements is 0 to 10 base pairs.
29. The plant cell of claim 15, wherein the native promoter is
integrated into the genome of the plant cell.
30. A plant cell according to claim 15, wherein the plant cell is a
cell of a plant selected from the group consisting of: corn, rice,
wheat, rye, barley, oats, sorghum, potatoes, oilseed rape,
sunflower, soybean, cotton and Beta vulgaris.
31. A plant comprising the cell of claim 30.
32. Seeds, cells, tissues or a part of a plant comprising the plant
cell of claim 30.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of application Ser. No.
14/367,521, filed Jun. 20, 2014, which is a U.S. national phase
application under 35 U.S.C. .sctn. 371 of International Patent
Application No. PCT/DE2012/001223 filed Dec. 21, 2012, and claims
benefit of priority to German Application No. 10 2011 122 267.0
filed on Dec. 23, 2011. The International Application was published
on Jun. 27, 2013 as International Publication No. WO 2013/091612
under PCT Article 21(2). The entire contents of these applications
are hereby incorporated by reference.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted in ASCII format via EFS-Web and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Jul. 2, 2019, is named 245761.000081.sequence.list.txt, and is
31,509 bytes in size.
[0003] The present invention relates to cis-regulatory elements and
chimeric promoters, which include pathogen- or elicitor-induced
activity in plants, created from said cis regulatory elements. The
present invention furthermore relates to a host cell, a transgenic
plant cell, a transgenic plant tissue, and a transgenic plant and
its seeds. The present invention moreover relates to a method for
producing a transgenic plant that in particular is resistant to a
pathogen.
[0004] Plant diseases caused by fungi, viruses, nematodes, and
bacteria cause considerable crop losses worldwide, negatively
affect the quality of crops, and necessitate an expensive use of
chemical pesticides because the natural defense mechanisms of
plants, with which they can defend themselves against the majority
of potential pathogens or delay and limit their spread, are often
insufficient. Genetic engineering approaches can be used for
generating plants that are resistant to such above-mentioned
pathogens. Such plants have increased resistance by generating an
expression of proteins (effectors) specifically at the infection
location (location of contact between pathogen and plant), which
proteins trigger a strong resistance reaction of the plant or of
molecules that are themselves toxic to pathogens or inhibit their
growth or virulence.
[0005] Effectors that trigger a strong resistance reaction of the
plant are, e.g. proteins of auto-activated resistance genes
(R-genes) or avirulence genes that lead to the activation of
endogenous resistance genes of the plant. The hypersensitive
reaction (HR), the controlled cell death of the host tissue at the
infection location, the strengthening of the plant cell wall via
lignification and callose formation, the formation of
phytoalexines, and the production of PR--(pathogenesis-related)
proteins are counted among the stronger resistance reactions.
[0006] Since said resistance reactions present a high energy
requirement and can lead to the death of plant cells (necrosis),
their triggering must be subject to stringent monitoring. The same
also applies for the expression of proteins or peptides toxic to
pathogens inasmuch as a constitutive expression of these proteins
or peptides has a disadvantageous effect on the plant or its
agronomic traits such as yield, for example. In a transgenic
approach, such control is possible by using promoters having the
desired specificity.
[0007] A pathogen-induced expression of transgenes such as
effectors can thus be achieved by using various known, natural
pathogen-inducible promoters such as of the PR1-promoter, for
example (Rushton et al., 1996). The development of the micro-array
technology in particular has led to the identification of a
multitude of pathogen-inducible promoters (WO 03/00898, WO 02/50293
or JP 2003284566).
[0008] Such natural pathogen-inducible promoters can, however,
display very unspecific activities since they can be activated by a
large number of different stimuli. Such activities are attributed
to a modular construction of the promoter from a plurality of
different cis-regulatory elements that integrate
diverse-as-possible different signals into a complex expression
profile. Natural pathogen-inducible promoters are accordingly also
characterized by undesired activities in certain tissues, for
example, or by a high degree of background activity.
[0009] Thus, for example, pathogen-inducible promoters of defensin
genes from wheat are also active during the seed development and
seed germination (Kovalchuk et al., 2010). The already-mentioned
PR1 promoter is induced not only by pathogens, but also by
senescence (Morris et al. 2000)
[0010] Other research has shown that the natural, rust-inducible
Fis1 promoter from flax was not suited after transformation to
specifically regulate the expression of auto-active forms of the L6
rust-resistance gene in Linum usitatissimum such that in addition
to the rust resistance, no negative agronomic traits such as
restricted growth arose (Howles et al., 2005).
[0011] The identification of the cis-regulatory elements
responsible for the desired induction and the construction of
chimeric promoters from said cis-regulatory elements is a
possibility for increasing the desired specificity of a promoter
(Venter, 2007). Sequence motifs for other stimuli are, on the other
hand, removed.
[0012] The promoters of many pathogen-induced genes have been more
closely examined, wherein a plurality of cis-regulatory elements
that can impart a pathogen-specific induction were identified
(Strittmatter et al., 1996; Eulgem et al., 2000; Kirsch et al.,
2000, 2001; Himmelbach et al., 2010). The cis-regulatory elements
D-box, S-box or W-box identified by the incremental mutation of
natural pathogen-inducible promoters (WO 00/29592) or the left-hand
scanning regions LS10 or LS7 (Lebel et al., 1998) are also
additional examples. The W-box in particular has been well
investigated and its core sequence TTGAC(C/T) can be used to find
additional variants of the W-box in natural pathogen-inducible
promoters.
[0013] New cis-regulatory elements can furthermore be identified
bioinformatically using programs such as MEME (Bailey and Elkan,
1994; Humphry et al., 2010) or BEST (Che et al., 2005). An
advantage of this is that a cis-regulatory element is identified
not as a short single sequence, but rather as a precisely defined
sequence motif via which even more variants of a cis-regulatory
element, that is to say many variants of a binding site of
transcription factor, are detected. Such bioinformatic approaches
are, however, also highly susceptible to yielding false-positive
sequences such that these approaches merely lead to a screening of
potential sequences or sequence motifs. Proof and verification of
the functionality as a cis-regulatory element in general, and
specifically as a cis-regulatory element that imparts
pathogen-inducibility, remain essential and obligatory. Such
experimental analyses are furthermore associated with considerable
expense.
[0014] An additional increase in the specificity of a promoter is
possible by using combinations of different cis-regulatory elements
(Rushton et al., 2002). It is not the combination itself that leads
to an increase of the activity (synergism), but rather such a
synergism occurs only with specific individual, non-predictable
combinations and must in any case be determined empirically.
Chimeric promoters having combinations from the cis-regulatory
elements D-box and S-box, for example, are known (WO 00/29592). The
number of the element repetitions modulates the promoter strength
and the background activity.
[0015] A further problem in the development of pathogen-inducible
chimeric promoters is their functionality in different plant
species. Although generally pathogen inducibility via the known
pathogen-inducible chimeric promoters can be determined in nearly
all plant varieties analyzed thus far, they still exhibit
background activity even when not under attack by a pathogen. Such
background activity varies depending on the plant species in which
the chimeric promoters are used. The same is true with the
induction rate (ratio of the promoter activity in the infected
tissue and promoter activity in uninfected tissue) and the absolute
activity of the promoters (promoter strength). Thus, for example,
when background activity is too strong in non-infected tissue, only
a slight pathogen inducibility in the infected tissue is
detected.
[0016] According to the current state of knowledge, the used
cis-regulatory elements of a promoter are responsible for the
described variations in background activity, induction rate,
promoter strength, induction kinetics, and the scope of the
promoter activation (Rushton et al., 2002, Venter, 2007). Even if
the known chimeric promoters are superior to the natural promoters,
there is still an optimization need for these chimeric promoters,
especially in regard to the cis-regulatory elements and/or to the
combinations of cis-regulatory elements. There is still a lack of
well-characterized cis-regulatory elements and of suitable
combinations of such cis-regulatory elements with which chimeric
promoters can be constructed, which ensure a highly specific and
controlled, appropriate pathogen-induced expression of transgenes
themselves and also in various plant species, wherein the
expression should occur only as a result of pathogen attack and
almost exclusively at the site of infection (Gurr & Rushton,
2005). The object of the present invention is therefore to provide
such novel cis-regulatory elements, and combinations thereof,
imparted by pathogen inducibility.
[0017] Some of the terms used in this application will be first be
explained below:
[0018] An "elicitor" in the sense of the present invention is an
inductor or messenger that induces defenses against plant pathogens
such as the synthesis of phytoalexines. Elicitors can be either
endogenous or exogenous in origin. An elicitor (exogenous)
preferably comes from a pathogen and is recognized by the plant.
The PAMPs (pathogen associated molucular pattern) such as flagelin,
PEP25, and chitin are also counted among to these elicitors.
Elicitors can be used to imitate a pathogen infection or a contact
with a pathogen by artificially applying the elicitor in the
absence of the pathogen. In the context of the present invention,
elicitors should be used in particular to monitor the inducibility
of promoters.
[0019] A "single sequence" is a sequence of nucleotides or bases
(pairs), wherein each position in the single sequence is determined
by only one single pre-defined base (a, c, g or t). A single
sequence is isolated from a natural promoter and represents the
result of a bioinformatics analysis. A single sequence is composed
of a core sequence and flanking sequence regions. The term "single
sequence" also means a nucleic acid molecule the nucleotide- or
base (pair)-sequences of which correspond to the single
sequence.
[0020] A "core sequence" is the sequence of nucleotides or bases
(base pairs) in a certain section of a cis-regulatory element,
wherein said section is essential for the functionality of the
cis-regulatory element. The core sequence represents a part of the
single sequence. The term "core sequence" also means a nucleic acid
molecule the nucleotide- or base-(pair)-sequences of which
correspond to the core sequence.
[0021] A "promoter" means a non-translated DNA sequence, typically
upstream from a coded region, which contains the binding site for
the RNA polymerase and initiates the transcription of the DNA. A
promoter additionally often contains other elements that act as
regulators of the gene expression (e.g. cis-regulatory
elements).
[0022] A "minimal promoter" is a promoter that has only the basic
elements that are used for the transcription initiation (e.g.
TATA-box and/or initiator).
[0023] A "chimeric promoter" is a promoter composed of a plurality
of elements and that does not occur as such nature. It contains a
minimal promoter and includes, upstream from the minimal promoter,
at least one cis-regulatory element which serves as a binding site
for specific trans-acting factors (e.g. transcription factors). A
chimeric promoter is designed according to the desired requirements
and is induced or repressed by different factors. The selection of
the cis-regulatory element or a combination of cis-regulatory
elements is critical for the specificity or the activity level of a
promoter. A cis-regulatory element in a chimeric promoter is either
heterologous to the minimal promoter used, i.e. the cis-regulatory
element is derived from a different organism or from a different
species to that of the minimal promoter used (exemplarily
represented in FIG. 15A-C), or a cis-regulatory element in a
chimeric promoter is homologous to the minimal promoter used, i.e.
the cis-regulatory element and the minimal promoter also occur
combined in a natural promoter, however the cis-regulatory element
is localized itself or as an additional element within the chimeric
promoter in a genetic environment that is different from the
natural promoter. A chimeric promoter thus also means a (natural)
promoter that was altered by multimerization of at least one
cis-regulatory element (exemplarily represented in FIG. 15D).
[0024] A "complementary" nucleotide sequence in relation to a
double-stranded DNA means that the second DNA strand complementary
to the first DNA strand includes the nucleotide bases that
correspond to the bases of the first strand in accordance with
base-pairing rules and considering the orientation (e.g.:
5'-gcat-3' is complementary to 5'-atgc-3').
[0025] A "pathogen" means an organism that in interactions with a
plant leads to illness symptoms in one or more organs of the plant.
Animal, fungal, bacterial or viral organisms or oomycetes, for
example, are among these pathogens.
[0026] "Pathogen infection" is to be understood as the earliest
point in time at which the metabolism of a pathogen is prepared for
a penetration of the plant host tissue. Included thereamong in,
e.g., fungi or in oomycetes, is the maturation of hyphae or the
formation of specific infection structures such as penetration
hyphae and appressoria.
[0027] A "pathogen-/elicitor-inducibility" or
"pathogen-/elicitor-inducible" in the sense of the present
invention means the specific property of a promoter that causes,
subsequent to pathogen infection or elicitor application, an at
least two-fold stronger transcription of an operatively linked
gene. "Pathogen-/elicitor-inducibility" or
"pathogen-/elicitor-inducible" in the sense of the present
invention furthermore means the property of genes to be transcribed
at least two-fold stronger subsequent to pathogen infection or
elicitor application.
[0028] The solution of the invention to the object posed is
inventively effected by novel cis-regulatory elements imparting
pathogen- and/or elicitor-inducibility. Said cis-regulatory
elements distinguish themselves in particular within the core
sequence significantly from already-known elements and thus do not
represent a variation of the known elements. The inventive
cis-regulatory elements should accordingly serve as recognition
sites and/or binding sites for new transcription factors with the
consequence that the imparted pathogen and/or elicitor inducibility
has a novel specificity. The cis-regulatory elements according to
the invention were identified in promoters of pathogen or PAMP
(elicitor)-induced genes from Arabidopsis thaliana via
bioinformatics approaches. The isolated single sequences of the
cis-regulatory elements could be associated with eight motif groups
(motif group 1, 5, 11, 12, 18, 21, 27 and 32) pursuant to various
analysis steps. A plurality of isolated single sequences could
moreover also be associated with a 21n motif group. Grouped in one
motif group are those single sequences that demonstrate a high
degree of conservation compared to the identified motifs. Single
sequences of a motif group all correspond in a characteristic core
sequence motif. The object posed is thus achieved by an isolated
cis-regulatory element comprising a nucleic acid molecule, the
nucleotide sequence of which corresponds to one of the core
sequence motifs from
TABLE-US-00001 a) vaaagtm, b) aaacca, c) scaaam, d) acrcg, e)
sktgkact, f) mrtsack, g) ccaccaa, (SEQ ID NO: 35) h) tcgtctcttc or
i) wwkgwc.
[0029] Less strongly conserved base positions within the
characteristic core sequence motifs a) to i) are given as follows:
`r` stands for guanine (g) or adenine (a), thus a purine base, `k`
stands for guanine (g) or thymine (t)/uracil (u), `s` stands for
guanine (g) or cytosine (c), `m` stands for adenine (a) or cytosine
(c) and `w` stands for adenine (a) or thymine (t)/uracil (u). A
certain core sequence motif reflects at least one partial sequence
of the core sequence of one of each of the single sequences of the
motif group belonging to the core sequence motif, wherein the
partial sequence can constitute at least 30% of the entire core
sequence of a single sequence. For those motif groups having core
sequence motifs g) and h), the core sequence motif corresponds to
the entire core sequence of the single sequences. The invention
furthermore also includes an isolated cis-regulatory element
comprising a nucleic acid molecule the nucleotide sequence of which
corresponds to a core sequence motif complementary to a) to i). A
characteristic core sequence motif of a certain motif group can
moreover also repeatedly arise in the core sequence of a single
sequence, wherein the core sequence motifs can also appear
overlapping in the core sequence and/or respectively demonstrate a
different orientation. For example, the core sequence of the Cis09
from motif group 1 demonstrates, on the one hand, a partial
sequence that corresponds to the core sequence motif acrcg and, on
the other hand, a partial sequence overlapping by two bases, which
partial sequence corresponds to the complementary core sequence
motif of acrcg, namely cgygt. A further example is found in the
core sequence of the 21G-2_M1_S2 from motif group 11 where the core
sequence has two partial sequences that overlap by one base and
each corresponds to the complementary core sequence motif of
aaacca, namely tggttt.
[0030] A family motif, in which the characteristic core sequence
motif is embedded, could be defined for motif groups 1, 5, 11, 12,
21, 21n, and 27 based on the experimental data regarding
functionality. The family motif represents a derived distinguishing
feature for a transcription factor or a transcription factor
family. The advantage of a family motif is that it subsumes
possible variants of a recognition/binding area. A family motif of
a motif group advantageously comprises all core sequences of the
single sequences grouped in the motif group. To achieve this, the
complementary strand of the cis-regulatory element was considered
for a part of the single sequences; such complementary sequences
are from identified cis-regulatory sequences according to the
invention, and are characterized with `(inv)` in the following
inasmuch as needed for understanding. A family motif defined in
such a manner has a length of at least 15 nucleotides, preferably
of at least 13 nucleotides, especially preferred of at least 11
nucleotides. In addition to the corresponding core sequence motif,
the family motif has motif flanking sites, wherein when a
cis-regulatory element according to the invention is used in a
chimeric promoter said motif flanking sites have a substantially
quantitative influence on the properties thereof such as background
activity and expression strength. The quantitative influence of
said motif flanking site reduces with increasing distance from a
certain base of the flanking site to the core sequence in a single
sequence. Further highly conserved single bases from the flanking
sites, which highly conserved single bases go beyond the core
sequences of the single sequences and thus expand the family motif,
can also be considered in defining the family motif. The family
motifs for the motif groups 1, 5, 11, 12, 21, 21n, and 27 are shown
in column 2 of Table 1. According to the invention, an isolated
cis-regulatory element is also included that comprises a nucleic
acid molecule, the nucleotide sequence of which corresponds to
[0031] a) a family motif according to SEQ ID NO: 1, including the
core sequence motif vaaagtm [0032] b) a family motif according to
SEQ ID NO: 2, including the core sequence motif aaacca, [0033] c) a
family motif according to SEQ ID NO: 3, including the core sequence
motif scaaam, [0034] d) a family motif according to SEQ ID NO: 4,
including the core sequence motif acrcg, [0035] e) a family motif
according to SEQ ID NO: 5, including the core sequence motif
sktgkact, [0036] f) a family motif according to SEQ ID NO: 6,
including the core sequence motif mrtsack, [0037] g) a family motif
according to SEQ ID NO: 41, including the core sequence motif
wwkgwc, or the nucleotide sequence of which corresponds to one of
the family motifs complementary to a) to g).
[0038] It is also possible for a family motif to be shorter. In its
shortest form, it is defined as a minimal family motif that based
on the direction of the single sequences corresponding to the
shared core sequence motif groups represents in itself only those
base positions that are identified in the core sequences of all
single sequences of a motif group. In some cases, the minimal
family motif corresponds to the core sequence motif. Column 2,
titled Family Motif, of Table 1 shows underlined the minimal family
motifs of the motif groups 1, 5, 11, 12, 21, 21n, and 27.
TABLE-US-00002 TABLE 1 Representation of the motif groups 1, 5, 11,
12, 18, 21, 21n, 27, and 32, the core sequence motifs (1) and
family motifs (2) underlying the groups, and the single sequences
(3) associated with the motif groups; the minimal family motif is
underlined, the core sequence motif is in bold typeface within
family motif. (`n` stands for an arbitrary base; `h` stands for a,
c or t/u; `d` stands for a, g or t/u; `v` stands for a, g or c; `r`
stands for g or a, `k` stands for g or t/u, `s` stands for g or c
and `m` stands for a or c; `y` stands for t/u or c; `w` stands for
a or t/u) 1 3 Core sequence 2 Single sequence motif Family motif
identifier Motif group 27 vaaagtm nnhkdnnvaaagtmndhy (SEQ ID NO: 1)
30I-8_M1_S1 (SEQ ID NO: 7) 30I-8_M1_S2 (SEQ ID NO: 8) GG13_M1_S2
(SEQ ID NO: 9) 14S_M1_S1 (SEQ ID NO: 10) 21S_M3_S1 (SEQ ID NO: 11)
30I-8_M1_S3 (SEQ ID NO: 12) Cis02 (SEQ ID NO: 13) Cis05 (SEQ ID NO:
14) sCis05 (SEQ ID NO: 44) Cis13 (SEQ ID NO: 15) Motif group 11
aaacca ynamcnaaaccawwny (SEQ ID NO: 2) GG11_M1_S1 (SEQ ID NO: 16)
22DDD_M1_S1 (SEQ ID NO: 17) 21G-2_M1_S2 (SEQ ID NO: 18) GG6_M1_S1
(SEQ ID NO: 19) Motif group 12 scaaam wnrmscaaamsmw (SEQ ID NO: 3)
18H_M2_S1 (SEQ ID NO: 20) 18H_M2_S3 (SEQ ID NO: 21) 38M_M1_S1 (SEQ
ID NO: 22) 26LLL_M1_S2 (SEQ ID NO: 23) Motif group 1 acrcg
nnmsacrcgynwm (SEQ ID NO: 4) Cis09 (SEQ ID NO: 24) Cis12 (SEQ ID
NO: 25) 12i_M1_S1 (SEQ ID NO: 26) Motif group 21 sktgkact
asktgkactwkgwm (SEQ ID NO: 5) GG8_M1_S1 (SEQ ID NO: 27) 27G-8_M1_S1
(SEQ ID NO: 28) Motif group 21n wwkgwc snsnnnwwkgwcnnnsnm (SEQ ID
NO: 41) GG8_M1_S1 (SEQ ID NO: 27) 27G-8_M1_S1 (SEQ ID NO: 28)
26WW_M2_S1 (SEQ ID NO: 42) 27B-10_M1_S3 (SEQ ID NO: 43) Motif group
5 mrtsack knwymmrtsackwmn (SEQ ID NO: 6) 20u_M1_S1 (SEQ ID NO: 30)
20u_M1_S2 (SEQ ID NO: 31) 28M-1_M1_S1 (SEQ ID NO: 32) Motif group
18 ccaccaa 12G_M2_S1 (SEQ ID NO: 33) Motif group 32 tcgtctcttc
12r_M1_S1 (SEQ ID NO: 34) (SEQ ID NO: 35)
[0039] The invention furthermore also relates to all identified and
isolated single sequences of cis-regulatory elements according to
the invention and the core sequences thereof (Tables 1 and 2). The
object posed is thus also achieved by an isolated cis-regulatory
element, including nucleic acid molecule [0040] a) a nucleic acid
molecule having a nucleotide sequence according to SEQ ID NO: 7,
SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID
NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16,
SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID
NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25,
SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID
NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34,
SEQ ID NO: 42, SEQ ID NO: 43 or SEQ ID NO: 44, [0041] b) a nucleic
acid molecule having a nucleotide sequence according to the core
sequence from SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO:
10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ
ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO:
19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ
ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO:
28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ
ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 42, SEQ ID NO: 43 or SEQ ID
NO: 44, or [0042] c) a nucleic acid molecule having a nucleotide
sequence complementary to one of the nucleotide sequences from a)
or b).
[0043] A cis-regulatory element including a nucleic acid molecule
with a nucleotide sequence according to SEQ ID NO: 24, SEQ ID NO:
25 or SEQ ID NO: 26 is associated with the motif group 1,
cis-regulatory element with a nucleotide sequence according to SEQ
ID NO: 30, SEQ ID NO: 31 or SEQ ID NO: 32 is associated with the
motif group 5, a cis-regulatory element with a nucleotide sequence
according to SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18 or SEQ ID
NO: 19 is associated with the motif group 11, a cis-regulatory
element with a nucleotide sequence according to SEQ ID NO: 20, SEQ
ID NO: 21, SEQ ID NO: 22 or SEQ ID NO: 23 is associated with the
motif group 12, a cis-regulatory element with a nucleotide sequence
according to SEQ ID NO: 33 is associated with the motif group 18, a
cis-regulatory element with a nucleotide sequence according to SEQ
ID NO: 27 or SEQ ID NO: 28 is associated with the motif group 21, a
cis-regulatory element with a nucleotide sequence according to SEQ
ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 42 or SEQ ID NO: 43 is
associated with the motif group 21n, a cis-regulatory element with
a nucleotide sequence according to SEQ ID NO: 7, SEQ ID NO: 8, SEQ
ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO:
13, SEQ ID NO: 14, SEQ ID NO: 44 or SEQ ID NO: 15 is associated
with the motif group 27, and a cis-regulatory element with the
nucleotide sequence according to SEQ ID NO: 34 is associated with
the motif group 32.
[0044] A cis-regulatory element according to the invention can have
a length of fewer than 50 nucleotides, preferably of fewer than 40
nucleotides, and especially preferred of fewer than 30 nucleotides.
The core sequence of a cis-regulatory element according to the
invention can have a length of fewer than 20 nucleotides,
preferably of fewer than 15 nucleotides, and especially preferably
of fewer than 10 nucleotides, while the core sequence should not be
shorter than 6 nucleotides.
[0045] In addition to having the identified novel core sequence,
some single sequences of the cis-regulatory elements according to
the invention can also have the core sequence of a known
cis-regulatory element imparting pathogen-/elicitor-inducibility,
which cis-regulatory element can also possibly influence the
specificity of the novel identified core sequence and/or of the
identified single sequence. An example is the cis-regulatory
element Cis05 (SEQ ID NO: 14) that also has a W-box core sequence
between the nucleotide positions 29 and 35 in addition to the
identified core sequence between the nucleotide positions 14 and
20. Extensive mutation analyses were conducted pertaining hereto
(see FIGS. 5A, 5B and 11).
[0046] A cis-regulatory element according to the invention can be
used in a chimeric promoter, wherein the cis-regulatory element
imparts a specific pathogen- and/or elicitor inducibility to the
chimeric promoter. The present invention thus also includes a
chimeric promoter that, when induced by a pathogen infection or a
treatment with a pathogenic elicitor, is suitable for effecting an
expression of an operatively linked nucleic acid molecule of
interest, e.g. of a heterologous DNA sequence, in a plant cell, and
which chimeric promoter also includes a minimal promoter and at
least one cis-regulatory element according to the invention. A
single cis-regulatory element according to the invention in such a
chimeric promoter by itself is in the position to impart a
significant pathogen- and/or elicitor inducibility. Thus this
single cis-regulatory element is itself sufficient for constructing
a pathogen-/elicitor-responsive chimeric promoter in combination
with a minimal promoter.
[0047] Such a chimeric promoter, containing only one or more
inventive cis-regulatory elements as cis-regulatory elements, is
preferably only pathogen- and/or elicitor-responsive, i.e. this
promoter is not or only minimally inducible by other stimuli such
as abiotic stress. After pathogen/elicitor contact, the induction
of such a chimeric promoter comprising one or more inventive
cis-regulatory elements is at least 2-fold, preferably at least
10-fold, or particularly preferably at least 25-fold greater than
the induction without pathogen/elicitor contact (background
activity).
[0048] In a preferred embodiment, the induced expression is limited
only locally to the infection site, i.e. comparably or to a lesser
extent than occurs in the controlled expression of natural PR
genes. Especially preferably the transcription activation occurs
controlled by a chimeric promoter of the present invention just in
the cells that come into contact with the pathogen or the
pathogenic elicitor. However, owing to cell-cell interactions, a
transcription activation can occur in cells surrounding the
infection site(s).
[0049] Chimeric promoters of the present invention, however, are
not limited to those that are exclusively pathogen responsive. The
induced expression can be further specified by combination with
additional regulatory elements, e.g. by combination with a
cis-regulatory element that, for example tissue specificity,
storage inducibility, cold- or heat inducibility or a specific
activity in certain stages of development. Chimeric promoters of
the invention can also comprise at least one combination of at
least two cis-regulatory elements, wherein said cis-regulatory
elements comprise at least one combination of at least one
inventive cis-regulatory element. Known cis-regulatory elements
imparting pathogen-/elicitor-inducibility, such as W-box, S-box or
D-box (see WO 00/29592), can also be used as further cis-regulatory
elements in the combination to construct a chimeric promoter.
[0050] The invention moreover also includes a chimeric promoter
that comprises one or more monomers and/or one or more multimers of
the inventive cis-regulatory elements. Dimers and tetramers are
preferred multimeric forms. Monomers separately or individual
monomers within a multimer can have different orientations, i.e.
they can have a complementary arrangement, for example. Inventive
cis-regulatory elements of a multimeric form can be functionally
linked to one another, i.e. they show in multimeric form a
synergistic or antagonistic effect on, for example, the binding
capacity of the transcription factor that distinguishes the
characteristic core sequence motif of a certain motif group, among
other things. The invention thus likewise includes a chimeric
promoter that, when induced by a pathogen infection or treatment
with a pathogenic elicitor, is suitable for effecting an expression
of an operatively linked nucleic acid molecule of interest in a
plant cell and which chimeric promoter furthermore comprises a
minimal promoter and at least two inventive cis-regulatory
elements, wherein the at least two cis-regulatory elements can be
present functionally linked in homo- and/or heteromeric form.
[0051] Subsequent to pathogen/elicitor contact, the induction of a
chimeric promoter comprising at least one multimer of the inventive
cis-regulatory elements is at least 2-fold, preferably at least
10-fold or particularly preferably at least 25-fold greater than
the induction without pathogen/elicitor contact (background
activity).
[0052] In a preferred exemplary embodiment of the chimeric
promoters of the present invention, the distance from minimal
promoter and to the first upstream inventive cis-regulatory element
is between 0 and 300 base pairs, preferably between 0 and 70 base
pairs and particularly preferably less than 10 base pairs.
Additionally or alternatively, the distance between two identical
monomers of the inventive cis-regulatory elements in a multimeric
form is preferably 0 to 10 base pairs. Preferably two separate
multimers in a chimeric promoter of the invention are separated by
approximately 0 to 50 base pairs.
[0053] In experimental analyses, specific combinations of inventive
cis-regulatory elements with other inventive cis-regulatory
elements or with other known regulatory elements or fragments such
as S-box, D-box or Gst1 showed an advantageous and surprising
effect with regard to promoter properties such as a low background
activity or an especially specific or an especially strong
inducibility (up to 183-fold 2.times.Cis13-2.times.Cis05). In this
case some combinations showed a synergistic effect with regard to a
certain promoter property such as, for example, with regard to the
induction factor (compare e.g. 2.times.Cis13-2.times.Cis05 in
parsley, FIGS. 12 and 13), while although some combinations had an
antagonistic effect with regard to the induction factor, for
example, in this case an especially low background activity
nevertheless developed (e.g. 4.times.Cis05-2.times.D in sugar
beet). The invention furthermore includes all combinations and
combination possibilities of the inventive cis-regulatory elements
with themselves and with known cis-regulatory elements that have an
advantageous synergistic or antagonistic effect on the inducibility
of the promoter. Advantageous combinations are those that can be
selected from the following group: 4.times. sCis05, 4.times.
20u_M1_S1, 4.times. 27G-8_M1_S1, 4.times. 38M_M1_S1, 4.times.
18H_M2_S3, 4.times. 18H_M2_S1, 4.times. GG13_M1_S2, 4.times.
21S_M3_S1, 4.times. 30I-8_M1_S2, 2.times. Cis02-2.times. Cis02,
2.times. Cis02-2.times. Cis05, 2.times. Cis02-2.times. Cis12,
2.times. Cis02-2.times. Cis13, 2.times. Cis02-2.times. D, 2.times.
Cis02-2.times.S, 2.times. Cis02-Gst1, 2.times. Cis02-2.times.
30I-8_M1_S2, 2.times. Cis05-2.times. Cis02, 2.times. Cis05-2.times.
Cis05, 2.times. Cis05-2.times. Cis12, 2.times. Cis05-2.times.
Cis13, 2.times. Cis05-2.times. D, 2.times. Cis05-2.times. S,
2.times. Cis05-Gst1, 2.times. Cis05-2.times. 30I-8_M1_S2, 2.times.
Cis12-2.times. Cis02, 2.times. Cis12-2.times. Cis05, 2.times.
Cis12-2.times. Cis12, 2.times. Cis12-2.times. Cis13, 2.times.
Cis12-2.times. D, 2.times. Cis12-2.times. S, 2.times. Cis12-Gst1,
2.times. Cis12-2.times. 30I-8_M1_S2, 2.times. Cis13-2.times. Cis02,
2.times. Cis13-2.times. Cis05, 2.times. Cis13-2.times. Cis12,
2.times. Cis13-2.times. Cis13, 2.times. Cis13-2.times. D, 2.times.
Cis13-2.times. S, 2.times. Cis13 - Gst1, 2.times. Cis13-2.times.
30I-8_M1_S2, 2.times. D-2.times. Cis02, 2.times. D-2.times. Cis05,
2.times. D-2.times. Cis12, 2.times. D-2.times. Cis13, 2.times.
D-2.times. 30I-8_M1_S2, 2.times. S-2.times. Cis02, 2.times.
S-2.times. Cis05, 2.times. S-2.times. Cis12, 2.times. S-2.times.
Cis13, 2.times. S-2.times. 30I-8_M1_S2, Gst1-2.times. Cis02,
Gst1-2.times. Cis05, Gst1-2.times. Cis12, Gst1-2.times. Cis13,
Gst1-2.times. 30I-8_M1_S2, 2.times. 30I-8_M1_S2-2.times. Cis02,
2.times. 30I-8_M1_S2-2.times. Cis05, 2.times. 30I-8_M1_S2-2.times.
Cis12, 2.times. 30I-8_M1_S2-2.times. Cis13, 2.times.
30I-8_M1_S2-2.times. D, 2.times. 30I-8_M1_S2-2.times. S, 2.times.
30I-8_M1_S2-Gst1 and 2.times. 30I-8_M1_S2-2.times. 30I-8_M1_S2.
[0054] Particularly advantageous combinations having surprising
effect with regard to induction factor and activity are listed in
Table 3.
[0055] The present invention additionally also relates to chimeric
promoters that comprise at least one of the above-mentioned
combinations of cis-regulatory elements.
[0056] In a preferred embodiment of the chimeric promoters of the
present invention, the minimal promoter originates, for example,
from a CaMV35S promoter, for monocotyledonous plants from, for
example, the wheat TaPal promoter (SEQ ID NO: 39), the corn
ZmUbiquitin promoter (SEQ ID NO: 40) or the rice OsGns1 promoter
(SEQ ID NO: 38), or for dicotyledonous plants from known minimal
promoters (WO 07/147395). Minimal promoters from other sources can
furthermore also be used to construct a chimeric promoter in the
sense of the present invention.
[0057] A chimeric promoter of the present invention regardless
fulfills the essential requirements placed on the stringent
expression regulation of a transgene in a genetic engineering
approach, e.g. for producing a pathogen-/disease-resistant plant.
The transgene is a nucleic acid molecule of interest, e.g. a
heterologous DNA sequence, operatively linked with the chimeric
promoter, which transgene codes, for example, for a resistance gene
(R gene), an auto-activated resistance gene, an avirulence gene, a
different effector, a protein that is toxic to at least one
pathogen, signal transduction components, or a protein which when
synthesizing phytoalexins codes a double-stranded RNA for forming
siRNAs directed against a pathogen or an antimicrobial peptide.
Moreover, numerous experiments on parsley (Petroselinum erispum),
Arabidopsis thaliana, wheat (Triticum sp.) and sugar beet (Beta
vulgaris) demonstrated that a chimeric promoter of the present
invention functions across species and can be used across species
(see, for example 4.times.Cis05 in parsley, sugar beet, and
wheat).
[0058] The definition of a family motif for each motif group 1, 5,
11, 12, 21, 21n, and 27 creates possibilities for a person skilled
in the art in the construction of chimeric promoters of the present
invention. The observed activities of the different members of the
motif groups 27 and 12 (FIG. 8) demonstrate that the flanking
sequence regions can be used for customized fine-tuning of the
desired expression level. This also applies to a species-dependent
coordination of the expression level. The family motif reproduces
the variation possibilities of individual bases in said flanking
regions and thus teaches a person skilled in the art the extent to
which the flanking regions can be modified. A person skilled in the
art moreover obtains information from the family motif about how
strongly conserved individual base positions are within the family
motif. Here it can be assumed that the modification of a strongly
conserved base has a more marked effect on the resulting properties
of the chimeric promoter than a weakly conserved base.
[0059] The invention moreover also relates to a recombinant gene
comprising a chimeric promoter of the present invention. The
recombinant gene is preferably formed such that the chimeric
promoter is operatively linked to a nucleic acid molecule, e.g. a
heterologous DNA sequence. Such a heterologous DNA sequence codes
in particular for a (poly) peptide, a cytotoxic protein (such as Bt
toxin, avirulence protein or enzymes such as glucose oxidase that
generate reactive oxygen species), an antibody, an antisense RNA, a
sense RNA, a transcription factor, a protease, a nuclease, a
lipase, an enzyme inhibitor or a measurable marker (such as
luciferase, GFP or .beta.-galactosidase). The last-mentioned marker
and other markers known from the prior art can be used in test
systems to determine the pathogen specificity of a chimeric
promoter of the present invention or to identify effectors that
promote or inhibit an induction of the chimeric promoter.
[0060] Chimeric promoters of the invention can also be used in
RNAi-based processes for "gene silencing", wherein the operatively
linked nucleic acid molecule of interest such as an anti-sense RNA,
for example, codes a sense-RNA or a double-stranded RNA (dsRNA).
The RNA molecule can then represent a short nucleotide sequence
(generally at least 10 nucleotides, preferably at least 14
nucleotides and optionally up to 100 or more nucleotides long),
which short nucleotide sequence is essentially complementary to a
specific mRNA sequence and/or to a DNA sequence of a gene of
interest. Standard methods of RNAi technology are described in the
prior art.
[0061] In principle, it is possible to modify the operatively
linked coding sequence such that the product of the translation is
localized in a desired cell compartment such as nucleus,
endoplasmic reticulum, mitochondrium, cytoplasm or vacuole or also
extracellularly (apoplastic). Suitable methods for such
modification are known to a person skilled in the art from the
prior art (Gorlich, Science 271 (1996), 1513-1518; Hicks, Plant
Physiol. 107 (1995), 1055-1058; Rachubinski, Cell 83 (1995),
525-528; Schatz, Science 271 (1996), 1519-1526; Schnell, Cell 83
(1995), 521-524; Verner, Science 241 (1988), 1307-1313; Vitale,
BioEssays 14 (1992), 151-160).
[0062] A recombinant gene of the present invention can be used both
alone and as part of a vector. The present invention thus also
relates to a vector that comprises the chimeric promoter of this
invention or the recombinant gene of the invention. The preferred
vector is a plant expression vector that furthermore also
preferably comprises a selection marker for plants. Examples of
suitable markers have already been specified above. Methods for
constructing such vectors are known from the prior art to a person
skilled in the art, e.g. described in Sambrook, Molecular Cloning A
Laboratory Manual, Cold Spring Harbor Laboratory (1989) N.Y. and
Ausubel, Current Protocols in Molecular Biology, Green Publishing
Associates and Wiley Interscience, N.V. (1989).
[0063] The present invention additionally relates to a prokaryotic
or a eukaryotic host cell that comprises a chimeric promoter, an
recombinant gene or an inventive vector, wherein the chimeric
promoter itself or as part of the recombinant gene or as part of
the vector or respectively as part of the chimeric promoter such as
a cis-regulatory element is heterologous to the prokaryotic or
eukaryotic host cell, thus for example originates from a cell or
from an organism having a different genetic background, or is
homologous to the prokaryotic or eukaryotic host cell but is
localized in a different genetic environment and thus differs from
the naturally occurring chimeric promoter or its part.
[0064] The chimeric promoter, the recombinant gene or the inventive
vector can either be integrated in the genome of the prokaryotic or
eukaryotic host cell, preferably stably integrated, or can remain
in an extrachromosomal form such as a plasmid in the cell.
[0065] The invention moreover provides a method for producing a
transgenic plant, which method includes introducing a chimeric
promoter, a recombinant gene or a vector according to the present
invention into at least one cell of the plant or said method
includes introducing a chimeric promoter, a recombinant gene or a
vector according to the present invention into at least one plant
cell in a cell culture from which the transformed or transgenic
plant is subsequently regenerated. The chimeric promoter, the
recombinant gene or the vector is preferably integrated, especially
preferred stably integrated, into the genome of the plant. The
nucleic acid molecule can be connected to additional regulatory
sequences like the 3' end to a poly-A tail for the expression of
the nucleic acid molecule of interest in plant cells under the
control of a chimeric promoter according to the present invention.
Methods for introducing genes or genetic material into a plant or
into a plant cell as well as methods for regenerating transformed
plant cells are known from the prior art, for example Agrobacterium
tumefaciens- or Agrobacterium rhizogenes-conveyed transformation of
plant cells or tissues with T-DNA, die protoplast fusion,
injection, electroporation, vacuum infiltration or biolistic
methods. Methods for preparing suitable vectors for introducing
genes or genetic material into a plant or into a plant cell are
likewise routine for a person skilled in the art (Sambrook,
Molecular Cloning A Laboratory Manual, Cold Spring Harbor
Laboratory (1989) N.Y. and Ausubel, Current Protocols in Molecular
Biology, Green Publishing Associates and Wiley Interscience, N.V.
(1989)).
[0066] In an alternative embodiment, a plant cell can be modified
such that said plant cell expresses an endogenous gene under the
control of an inventive chimeric promoter or under the control a
native promoter of the endogenous gene, which native promoter was
modified by inventive cis-regulatory elements. Introducing such a
chimeric promoter, which naturally does not regulate the expression
of a certain gene or of a certain genomic sequence, at the desired
location in the plant genome or the introduction of inventive
cis-regulatory elements into a native promoter can be effected
using known standard methods such as targeted integration (`gene
targeting`) via zinc finger-nucleases (Urnov et al., Nature Reviews
2010_Genome editing with engineered zinc finger nucleases; Townsend
et al., Nature 2009_High-frequency modification of plant genes
using engineered zinc-finger nucleases) or TAL effector nucleases
(WO 2010/079430; WO 2011/072246). The modification of a native
promoter of an endogenous gene also means the additional
introduction of an inventive cis-regulatory element into the native
promoter, which already naturally has an inventive cis-regulatory
element, and thus a multimerization of present cis-regulatory
elements. Such a modified promoter can, compared to the native
version, have changed properties with regard to specificity,
expression level or background activity, for example.
[0067] Using known methods, modified plants can be regenerated from
the modified plant cells.
[0068] The invention thus relates again to transgenic (transformed)
plants described below, which plants were transformed with a
chimeric promoter, a recombinant gene, a vector according to the
present invention, and described plants modified by introducing at
least one inventive cis-regulatory element or an inventive chimeric
promoter. Transgenic or modified plants can come from any desired
plant species. They can be monocotyledonous, dicotyledonous or
angiosperm plants, preferably belonging to plant species of
agricultural or horticultural interest, for example corn, rice,
wheat, rye, barley, oats, sorghum, potatoes, oilseed rape,
sunflower, soybean, cotton or sugar beet.
[0069] In a preferred embodiment of the invention, a transgenic or
modified plant is resistant or demonstrates an increased resistance
to one or more pathogens in comparison to a non-transgenic or
non-modified plant of the same species (wild type).
[0070] Included in the present invention are furthermore a plant
part, a plant tissue, a plant cell or a seed of the transgenic and
of the modified plant of the present invention, wherein said plant
part, plant tissue, plant cell or seed likewise has the transgene
introduced into the plant or the introduced modification.
BRIEF DESCRIPTION OF THE DRAWINGS
[0071] Embodiments of the present invention are described by way of
example with reference to the accompanying figures and
sequences:
[0072] FIG. 1: The plasmids including 2.times.Cis05 element and the
multimerized 4.times.Cis05 element are shown as an example of
cloning the single sequences as chimeric promoters. The plasmids
are derived from pBT10-GUS (Sprenger and Weisshaar (2000): The
Plant Journal 22, 1-8). The structure of the other plasmids is in
accordance therewith. Amp: ampicillin resistance; WRKY30-Cis05:
doubled single sequence Cis05. 35S-minimal: 35S-minimal promoter;
Luc-m3: luciferase reporter gene; pAnos: NOS terminator.
[0073] FIGS. 2A-2X: Species-wide pathogen-inducible single
sequences. The upper lines respectively reflect the identifier of
the single sequence, the motif group, and the single sequences
themselves. The core sequences of the motif that led to the
selection of the single sequence is written in boldface type and
underlined. Therebeneath are respectively reflected the motif logo
of the underlying bioinformatically identified motif and its
matrix. If more than one single sequence of a motif was tested,
they are summarized. FIG. 2A discloses SEQ ID NO: 26; FIG. 2B
discloses SEQ ID NO: 25; FIG. 2C discloses SEQ ID NO: 24; FIG. 2D
discloses SEQ ID NOS 30-31; FIG. 2E discloses SEQ ID NO: 32; FIG.
2F discloses SEQ ID NO: 19; FIG. 2G discloses SEQ ID NO: 16; FIG.
2H discloses SEQ ID NO: 17; FIG. 2I discloses SEQ ID NO: 18; FIG.
2J discloses SEQ ID NOS 20-21; FIG. 2K discloses SEQ ID NO: 22;
FIG. 2L discloses SEQ ID NO: 23; FIG. 2M discloses SEQ ID NO: 33;
FIG. 2N discloses SEQ ID NO: 27; FIG. 2O discloses SEQ ID NO: 28;
FIG. 2P discloses SEQ ID NOS 7-8 and 12; FIG. 2Q discloses SEQ ID
NO: 9; FIG. 2R discloses SEQ ID NO: 10; FIG. 2S discloses SEQ ID
NO: 11; FIG. 2T discloses SEQ ID NOS 13-14; FIG. 2U discloses SEQ
ID NO: 15; FIG. 2V discloses SEQ ID NO: 34; FIG. 2W discloses SEQ
ID NO: 42; and FIG. 2X discloses SEQ ID NO: 43.
[0074] FIGS. 3A-3G: Summary of all single sequences of a motif
group, which sequences tested positive, and representation of the
sequence- and family-motifs derived therefrom. The respective motif
group is specified in the top line. An alignment of all single
sequences that tested positive is shown therebeneath, which
alignment includes at least the core sequences and, if present,
additional conserved bases. The bases, from which the core sequence
motif is derived, are surrounded by a border. FIG. 3A discloses SEQ
ID NOS 89-91; FIG. 3B discloses SEQ ID NOS 92-94; FIG. 3C discloses
SEQ ID NOS 95 and 95-97; FIG. 3D discloses SEQ ID NOS 98-101; FIG.
3E discloses SEQ ID NOS 102-103; FIG. 3F discloses SEQ ID NOS
104-108, 106 and 109-111; and FIG. 3G discloses SEQ ID NOS
112-115.
[0075] FIG. 4: Phylogenetic tree of the identified motif groups.
The phylogenetic tree was generated via a cluster analysis using
the STAMP web server. The number of the motifs contained in the
motif group is surrounded by parentheses behind the number of the
motif group.
[0076] FIG. 5A) Mutagenesis of the Cis05-single sequence. The
sequence used contains both the Cis05 motif (bold-face, underlined)
and a W-box (bold-face and surrounded by a border). Mutations were
introduced in both motifs. As described, parsley assays were
conducted on induction with the tetramerized mutated derivatives
using the PAMP PEP25. The PAMP-induced activity of the chimeric
promoters was measured after 4, 8, and 24 hours (right-hand side).
Mutations in the Cis05-motif (Cis05mut1) and in the W-box
(Cis05mut2) lead to a significant decline of the induced activity.
Only when both motifs are mutated (Cis05mut1+2) is there a complete
loss of inducibility.
[0077] FIG. 5B) sCis05 is a shortened variant of Cis05 containing
only the Cis05 motif and the W-box no longer. The PEP25
inducibility of sCis05 and mutated derivatives was tested as
described in FIG. 5A. Both bars represent two biological replicates
(independent transformations). For guidance, the W-box consensus is
shown beneath the sCis05 derivatives. FIG. 5A discloses SEQ ID NOS
14 and 116-119, respectively, in order of appearance. FIG. 5B
discloses SEQ ID NOS 44 and 120-124, respectively, in order of
appearance.
[0078] FIG. 6A: Elicitor-responsive reporter gene expression of the
chimeric promoters 4.times.30I-8_M1_S2 and 4.times.18H_M2_S1 with
mutations in the single sequences. The mutated bases are
underlined. Elicitation was effected by PEP25 in parsley
protoplasts. The nucleotide sequences of the mutated derivatives of
the single sequences are shown beneath the diagrams as +, with
elicitor PEP25; -, without elicitor. 2S2D: Positive control;
MS23GUS: negative control (empty vector). FIG. 6A discloses SEQ ID
NOS 8, 125-127, 20, and 128-130, respectively, in order of
appearance. FIG. 6B discloses SEQ ID NOS 131-137, respectively, in
order of appearance.
[0079] FIG. 6B: Elicitor-responsive reporter-gene expression of the
chimeric promoters 4.times.20u_M1_S1 and 4.times.27G-8_M1_S1 with
mutations in the single sequences. The mutated bases are
underlined. Elicitation was effected by PEP25 in parsley
protoplasts. The nucleotide sequences of the mutated derivatives of
the single sequences are shown beneath the diagrams.
[0080] FIG. 7: Binary vector for the transformation of the
luciferase reporter gene under the control of the chimeric
promoters in sugar beet. The vector with the chimeric promoter
4.times.Cis05 is shown as an example. nptll: kanamycin resistance;
WRKY30-Cis05: double single sequence Cis05. 35S minimal: 35S
minimal promoter; luc-m3: luciferase reporter gene; Anos: Nos
terminator.
[0081] FIG. 8A: Cercospora beticola induced promoter activity in
stably transformed sugar beets. Of the constructs given, the
luciferase activity subsequent to C. beticola infection of in-vitro
plants was determined for a plurality of independent transformants
(4 replicas per transformant and point in time). The median was
calculated from the measured values obtained. The top diagram
summarizes the results for single sequences from the motif group
12, while the bottom diagram summarizes the results for elements
from the motif group 27. Co: Control (mock infection); inf;
infection with C. beticola; 1 d -4 d: days post inoculation
(d.p.i.). Control: Non-transgenic plants.
[0082] FIG. 8B: Cercospora beticola-induced promoter activity of
4.times.Cis05 and its derivatives in stably transformed sugar
beets. For 4.times.Cis05 and its derivatives the luciferase
activity after C. beticola infection was determined in a plurality
of independent transformants (4 replicas per transformant and point
in time). The median was calculated from the measured values
obtained. The sequence of the different derivatives is given in
FIGS. 5A and 5B. For each of the different derivatives, it is
additionally indicated under the diagram whether the derivative
contains the Cis05 motif or the W-box. Co: Control (mock
infection); inf; infection with C. beticola; 1 d -4 d: days post
inoculation (d.p.i.) non transgenic: non-transgenic control.
[0083] FIG. 9: Cercospora beticola-induced promoter activity of the
chimeric promoter 4.times.GG6_M1_S1 in stably transformed sugar
beets. The luciferase activity after C. beticola infection of
in-vitro plants was determined for 10 independent transformants
with the construct 4.times.GG6_M1_S1-luc (4 replicas per
transformant and time period). Co: Control (mock infection); inf;
infection with C. beticola; 2 d, 3 d, 4 d and 7 d: days post
inoculation (d.p.i.); 3DC4156: Non-transgenic control plants.
[0084] FIG. 10: Plasmid card of the plasmids used for the transient
tests in wheat. The plasmid with the chimeric 4.times.Cis05
promoter is shown as an example. Ruc: Renila-luciferase reporter
gene. AMP: Ampicillin resistance. WRKY30-Cis05: Double single
sequence Cis05.
[0085] FIG. 11: Test of the induction by Fusarium of the chimeric
promoter 4.times.Cis05 and its mutated derivatives with mutations
in the Cis05 motif (Cis05mut1), the W-box (Cis05mut2) or in both
motifs (Cis05mut1+2). The corresponding constructs were transiently
transformed in wheat and the luciferase activity was measured 20
hours post incubation with Fusarium. 4.times.Cis05-dam/dcm
identifies an experiment in which the plasmid DNA of a
non-methylated E. Coli strain was used to exclude an induction by
dam/dcm-methylated DNA (likewise a potential PAMP). If the core
sequence of Cis05 mutated, the inducibility is entirely lost. In
contrast, the mutation in the W-box has no effect. The sequences of
Cis05 and its mutated derivatives are reproduced on the right-hand
side. Mutated bases are highlighted in red. FIG. 11 discloses SEQ
ID NOS 116-117, respectively, in order of appearance.
[0086] FIG. 12: Induced and non-induced activity of the chimeric
combinatorial promoters after PEP25 induction in parsley. The tests
were conducted in three biological replicates; the blue line
reproduces the induction factor. In the bottom row beneath the
diagram, the elements in 5' position are given, while in the top
row the elements in 3' position are given. 30I8b is a different
identifier for the single sequence 30I-8_M1_S2.
[0087] FIG. 13: Synergistic and antagonistic interactions of single
sequences in the chimeric combinatorial promoters after PEP25
induction in parsley. The actual measured induction factor is
reproduced in violet, while the expected induction factor based on
the induction factors of the single elements is reproduced in blue.
The ratios of both values are shown by the yellow line. If the dots
of the yellow line are above the value 1, then the single elements
show a synergistic interaction.
[0088] FIG. 14: Transgenic sugar beets with a 4.times.Cis05-RFP
construct were infected with Cercospora beticola. The infection
leads to activation of the chimeric 4.times.Cis05 promoter, which
leads to the formation of the red fluorescing RFP protein. The
protein is seen as red fluorescent under the microscope. As can be
seen, the induction and thus the fluorescence are limited to the
region around the penetration site or the infection location.
[0089] FIGS. 15A-15D: Exemplary schematic representations of a
chimeric promoter in the sense of the invention. The chimeric
promoter is operatively linked with a nucleic acid molecule of
interest and includes (FIG. 15A) a heterologous cis-regulatory
element next to a minimal promoter, (FIG. 15B) a dimer/multimer of
a heterologous cis-regulatory element next to a minimal promoter or
(FIG. 15C) two dimers/multimers, each having different heterologous
cis-regulatory elements, next to a minimal promoter. Furthermore,
(FIG. 15D) shows as an exemplary chimeric promoter a natural
promoter including an endogenous minimal promoter and an endogenous
cis-regulatory element, wherein said promoter was modified through
integration of an additional homologous cis-regulatory element.
[0090] FIG. 16: Transgenic Arabidopsis plants with a tetramer of
the cis-regulatory element Cis05 in a chimeric promoter that
controls the expression of the GUS reporter gene to investigate the
pathogen-induced, wound-induced, and tissue-specific activity of
the element. Ten independent transformants were investigated for
the promoter. One respectively representative line is shown. The
image on the left-hand side (5 d.p.i. with H. arabidopsidis) shows
the activity of the promoter subsequent to infection with the
compatible pathogen Hyaloperonospora arabidopsidis, while the image
on the right-hand side (Mock control) is the corresponding control.
The promoter shows a clear induction through Hyaloperonospora
arabidopsidis (dark coloration of the plant tissue).
[0091] On the right-hand image, a leaf is additionally cut into. A
blue coloration at this cut surface would indicate a wound
inducibility of the promoter with the tetramer of the
cis-regulatory element Cis05.
Bioinformatic Identification of the Inventive Cis-Regulatory
Elements:
[0092] Publicly available microarray-expression data are the basis
for the bioinformatic identification of the novel cis-regulatory
elements. Said expression data are deposited in databases such as
TAIR, NASCArrays, Geo or ArrayExpress or can be obtained directly
from corresponding publications of microarray experiments (e.g.
Rhee et al., 2003; Craigon et al., 2004; Barret and Edgar, 2006;
Brazma et al., 2006, Zipfel et al., 2004, 2006; Bulow et al., 2007;
Wan et al., 2008). For the bioinformatic identification of novel
cis-regulatory elements, initially the publicly available
microarray-expression data were used to define groups of genes of
the Arabidopsis thaliana plant, the expression of which is induced
by pathogens such as P. syringae or B. cinerea or PAMPs like flg22
or chitin. Then the sequences of the promoters of these gene groups
were extracted from the genome sequence of Arabidopsis thaliana
(TAIR; http://www.arabidopsis.org). Using different known
algorithms (MEME, Bioprospector, Alignace, BEST and the like the
promoter sequences were examined for concentrated motifs.
Database Queries
[0093] A software tool was written for the database queries for
identifying co-regulated genes, which tool permits identification
of genes that are upregulated or induced together by up to six
different stimuli. More than 700 database queries for identifying
co-regulated genes were performed. This query process delivered
more than 400 groups of genes induced together that are suitable
for an identification of shared cis-regulatory motifs with the BEST
software package (Che et al., 2005). By raising the necessary
induction factor, the number of shared regulated genes in 77 groups
was reduced to 120 genes. The total number of gene groups of
co-regulated genes (2-120) was 510 thereafter.
[0094] Of these 510 gene groups, 500-bp or 1000-bp long promoter
sequences upstream from the transcription start [SITE--what "TSS"
stands for)] (TSS) of the co-regulated genes were extracted of
which the TSS was known. The promoter sequences of the co-regulated
gene groups were examined in accordance with conserved sequence
motifs by the BEST, Cismodule, MD-Scan, BioProspector or MEME
programs. Motif lengths of 5-10 nt, 10-15 nt and 15-20 nt were
selected. Approximately 500.times.3 (motif lengths)=1500 queries
were performed. In most cases, by lengthening the motif lengths, no
further motifs were identified that did not already occur in the
shorter motif lengths. In the BEST analyses, a motif was always
classified when it was found by at least two of the four total BEST
programs.
[0095] Given certain different stimuli, the same co-regulated
genes, and therefore also the same motifs, were obtained. A summary
of the identical motifs of redundant gene groups (GG) to novel
motifs (gene groups table) followed, so that only unique motifs
were compared in the comparative, systematizing analysis of all
motifs among themselves.
[0096] A catalog was created that contains all identified motifs
plus evaluation dataset and the sequence logos of the individual
motifs. The sequence logos (Crooks et al., 2004), created under
http://weblogo.berkeley.edu/, reflect the conservation of the
nucleotide at the individual positions of the motif. The matrix was
created from the sequences forming the motif, the sequences and the
related genes thereof likewise being reflected.
[0097] The STAMP program (Mahony and Benos, 2007) that can be
invoked from the Internet address
http://www.benoslab.pitt.edu/stamp was used to compare the
identified motifs to already known cis-regulatory elements (PLACE,
Agris, Athamap). With the STAMP web server, similar motifs can
furthermore be grouped into a motif group. The program issues a
phylogenetic tree in which the similarities of the motif groups are
shown as an overview (FIG. 4).
Proof of Pathogen Inducibility of the Identified Cis-Regulatory
Elements
[0098] Since bioinformatoric approaches are prone to identifying
false-positive sequences, the pathogen inducibility must be
experimentally confirmed. For said experimental confirmation, the
bioinformatically-identified sequences were cloned as a tetramer in
front of a luciferase reporter gene using standard DNA cloning
procedures and tested for their inducibility in a transient
expression system in parsley by the PAMP PEP25.
[0099] Elements were selected for the experimental test that are
novel and show no similarity to known cis-regulatory elements of
the pathogen-conveyed induction. The single sequences given in
Table 2 were synthesized in vitro and cloned into the plasmid MS23
with SpeI and XbaI or with SpeI and SalI linkers. MS23 carries
either a .beta.-glucuronidase (GUS)-reporter gene or a luciferase
reporter gene with a 35S minimal promoter. All elements were
tetramerized and sequenced for testing. The plasmids including
2.times.Cis05 element and the multimerized 4.times.Cis05 element
are shown in FIG. 1 as an example of cloning the single sequences
as chimeric promoters.
TABLE-US-00003 TABLE 2 Examined Single Sequences. The table lists
the novel identifiers and sequences of the examined potentially
cis-regulatory elements. The bioinformatically identified core
sequences are emphasized (bold-face type and underlined). The
result of the PEP25/parsley test is reproduced in the last column
(-: no induction; +: inducible). Single- sequence Motif SEQ
identifier group AGI Single sequence Inducibility ID NO: 12i_M1_S1
1 At5g04340 TCTCATCTCTCGACACGCAACTTCC + 26 Cis09 1 At1g27730
TGCACACACACACACGTGTACTAGGTCAAACCAAACGT + 24 Cis12 1 At2g33580
CAAAAAGTCAACACATACGACGCGTTTCCATTGACTAAATA + 25 12c_M1_S1 4
At1g21100 TCTACTAGAGGCCCATTAGGACCGGCAT - 45 20u_M1_S1 5 At1g13990
TGTTGAGTCGTTTACGTCACGTCGAGAATTTTCTC + 30 20u_M1_S2 5 At4g05020
TGTCATTATTAATACGTGACGAAACTGTAGCTCTG + 31 28M-1_M1_S1 5 At1g09080
TTACGTGTCAAGAAGTGATTGGAGAGGACACTCTAC + 32 28M-1_M1_S2 5 At4g17500
AAGACAAGTTGAGAGAGACGAGACCAATCACAACA - 46 28M-8_M1_S1 6 At3g21520
ATCCAACATCTCGGACCGGATCAATGATTTATCAT - 47 24F_M1_S1 7 At2g40750
TCATCAATGTGACATAAGCAAAGCT - 48 3C_M1_S1 11 At3g51440
TTTGATACGGTTACGGTTAATTAACG - 49 GG6_M1_S1 11 At2g40140
GACTTTTGACCTAAACCATTTCCAT + 19 GG11_M1_S1 11 At2g40140
GTTTTGACTTTTGACCTAAACCATTTCCATGTAGAA + 16 GG6_M1_S2 11 At5g59820
AAGATTCTCATCCAACCGAAACGACTCTTTCGTTTT - 50 GG11_M1_S2 11 At5g59820
AGATTCTCATCCAACCGAAACGACTCTTTCGTTTTT - 51 GG11_M1_S3 11 At1g27730
TCTTCTTCATTTTACCAACACCACTTGCACACACAC - 52 22DDD_M1_S1 11 At3g14990
CCGTCTTAGTTTACCGAAACCAAAGTGGCTTTTTCT + 17 21G-2_M1_S1 11 At1g01560
AGTTGAATTAGTTCGGTTCGGTTCGGTTGATATTG - 53 21G-2_M1_S2 11 At3g55470
CGTAATAATGGTTTGGTTTGGTTTGATCAAGTCTT + 18 37E_M1_S1 12 At2g39200
CGATAAACTTGCGAAACCCTAAAA - 54 18H_M2_S1 12 At1g70170
CAACACAAAACGCAAACGCAGACCTC + 20 18H_M2_S2 12 At2g35980
TATTGGAAGTTTGGGGCAACATCAC - 55 16MM_M1_S1 12 At5g05340
TTCAACCCTATAAACCAAAACAAATAACAGAATGC - 56 38M_M1_S1 12 At4g23810
AAATAATTATTTATGGTTTGGTCATTTGGTCAAAT + 22 3I_M3_S1 12 At1g26390
CGCCTCAATCATGAAAACGAATCCTCTGTAGTAGTG - 57 18H_M2_S3 12 At1g70170
AATTGACAAAAGACACGCAAACGATTCCAACGACC + 21 26LLL_M1_S1 12 At1g67920
TTACCGACACGTAACCAAAACTCACCGAACACCGT - 58 38M_M1_S2 12 At2g29460
GTTTCGAACGGGAACCAAACCATAATATGCGATGC - 59 38M_M1_S3 12 At3g54960
ACACTATTGGTCTTGGTTTGGTTTATATGCACGAC - 60 23LLL_M1_S1 12 At2g30770
GAAAACGATGGGTTCCAAAACTGTCGCTAATAAACT - 61 37D_M1_S1 12 At1g32940
TCTCCACTCGTTGTGATTTGGTCTGCAAGAAAACTA - 62 23LLL_M1_S2 12 At1g01480
ACGTTTTGAAATATTGTTTTGGATGGAGATTTTTTC - 63 34G-4_M1_S1 12 At3g28740
ATTTTTCATTTCGCCCAAAACAATTATCCTAACGTT - 64 26LLL_M1_S2 12 At4g01700
AGTCAAAACGTAGACCAAAACAAAAACATGTAACT + 23 27H-8_M1_S1 12 At4g18430
TTTTATAACACTACCAAAACCAATAAGCCCTTTCGT - 65 26KKK_M1_S1 12 At2g43510
TCATCAAACCAATCGGTTTGGTCCTAAAGATAATT - 66 19Q_M1_S1 13 At4g35180
GTCAATATACACAGCCACCGAACAAATTACTCTAT - 67 21S_M1_S1 14 At2g14610
AAGCGATGTTTACGAACCCCAAAATC - 68 28H-9_M1_S1 14 At1g19020
AGATTTGTTCGAGAACCTTGAGAAA - 69 28H-9_M1_S2 14 At4g37370
TTGCTACTTCGAGAACATTGGTCAA - 70 20a_M1_S1 15 At5g04340
TTAGAAGTGGCTCGAGTGTTCTACTT - 71 20a_M1_S2 15 At5g20230
AAGAAAGACAATCGAGCCTAGAAATT - 72 12G_M2_S1 18 At1g61800
CCATACAATATAAACCACCAAACCATAACCACAAA + 33 30_M1_S1 18 At4g39950
AATAATGTTCAACGTTGGTGGTGGTACTCAAGATGG - 73 41J_M1_S1 19 At3g09940
TCAAATACAGGCAACCAAGACTCGAGATCCTCATCG - 74 37C_M1_S1 20 At3g51440
AGAAAAATATTGGGCCTACTGGGAA - 75 3M_M3_S1 20 At3g02800
AGATTCCTGAAGTGAGGTCCACCCTAAAATCCATTT - 76 GG8_M1_S1 21/21n
At1g27730 CACACACGTGTACTAGGTCAAACCA + 27 27G-8_M1_S1 21/21n
At2g38860 AGGACTTTTCACCAGTTGGACTTTGAAGCCACCAA + 28 27G-8_M1_S2 21
At1g72060 GGTTTAGTCAAAGTAAACAAGACTTTGACTGTTCA - 77 27B-10_M1_S1 21
At1g22890 TGAACTTAATCACTGTCATTGTTTTCGTAACAATTT - 78 26WW_M2_S1 21n
At4g02380 CTCAAAGGCCAGAATTGACGCAGCCGTTT + 42 27B-10_M1_S3 21n
At1g21120 CCTTGGCCCAGTCCTTGGTCGTCGTATC + 43 GG4_M2_S1 22 At3g14990
GAAAAATGTGTGTGTTTGTGTTAATT - 79 GG4_M2_S2 22 At5g59820
ATAGTTCCCAAACGGACACGAACACA - 80 30A-8_M1_S1 24 At3g49620
GCAAACTAACGCCGGCGGCCGTCTTG - 81 30I-8_M1_S1 27 At5g12930
ACAACAGACGACTTTTCATAATTCA + 7 30I-8_M1_S2 27 At1g26390
CTATATGACAAAAGTCAAACATAAA + 8 GG13_M1_S2 27 At3g26830
TGTTCACTTTGAAAAGTATTCTTTGAG + 9 30H-8_M1_S1 27 At1g35230
TAGCTGTTGAAATTTCCAAGAAAAT - 82 14S_M1_S1 27 At1g76960
CGATCAGACTTTTCTACGCAAGAGAA + 10 21S_M3_S1 27 At1g76960
TAATTTCTCTTGCGTAGAAAAGTCTGATCGGGAAG + 11 30I-8_M1_S3 27 At5g24110
TCGTTCTTCAGTCAAAAAGTCAAACTATCTCTCTC + 12 Cis02 27 At5g64905
GAGCGTGAATTGACTTTGACCAAAACCAAA + 13 Cis05 27 At5g24110
GGTCAGCATGTTGGACTTTCCAAATTCATTGACCAAAG + 14 Cis13 27 At1g26380
AAAATAAACAGCTACTTGACGAAAAGTCAAACCAAATTC + 15 22AAA_M1_S1 31
At2g40000 TTTTTCTCGTCCCCATCCTCTATCC - 83 12r_M1_S1 32 At1g73480
CAATCTACTCGTCTCTTCTCTTACAT + 34 GG3_M1_S1 32 At5g44420
TAGGTTCCTGCCCTCTCCGTTCCTCC - 84 GG3_M1_S2 32 At4g39980
TCGAAACCAACCCTCTCCCTTATAAA - 85 20EE_M1_S1 32 At4g39980
GAAACCAACCCTCTCCCTTATAAATA - 86 24P_M1_S1 32 At1g30135
TGTTTTGTTTCCACCGTCTCTCCCGTGTCCTCTCTC - 87
[0100] The tetramerized single sequences in transiently transformed
parsley cells from a cell culture were tested in the following for
their inducibility by the PAMP PEP25. In addition to a general
validation, it should be ensured that the elements in different
plant species can be induced and by different elicitors.
[0101] For the test in parsley, protoplasts were isolated from a
five-day-old parsley cell culture. 35 ml cell culture were removed
by centrifugation and resuspended in 90 ml of a sterile-filtered
solution with 0.5% cellulase, 0.2% macerozyme R-10, and 0.24 M
CaCl.sub.2 and incubated with stirring overnight at 26.degree. C.
Thereafter, the released protoplasts were pelletized though
centrifugation, washed with 40 ml 0.24 M CaCl.sub.2 and
subsequently resuspended in 50 ml P5 medium (1 bag prepared media
Gamborgs B-5, 1 mg 2.4 D, 96.9 g saccharose, pH 5.7 with 1M KOH,
sterile filtered). After centrifugation, the protoplasts float on
the surface of the P5 medium and can be removed. The purification
with P5 medium was repeated 2.times..
[0102] For the transformation, 5 .mu.g of the promoter construct to
be tested, 2.5 .mu.g of a constitutive renilla
luciferase-expressing normalizing vector, and 200 .mu.l PEG in 10
ml were put in screw-cap test tubes. 200 .mu.l protoplasts were
added, after which the mixture was carefully stirred and incubated
for 20 min in the dark at room temperature. The reaction was
subsequently stopped by the addition of 5 ml 0.275M CaNO.sub.3-Lsg.
The transformed protoplasts were removed by centrifugation, held in
6 ml P5 medium and divided into 2 aliquots. One aliquot was
elicited with Pep25 (final concentration: 300 ng/ml; sequence:
VTAGAEVWNQPVRGFKVYEQTEMT) (SEQ ID NO: 88)) and the other served as
control. After overnight incubation, the protoplasts were retrieved
through centrifugation. The luciferase activity was determined with
the Dual Luciferase Kit (Promega, Mannheim, Germany) in a Sirius
Luminometer (Berthold Detection System GmbH, Pforzheim, Germany).
The parsley cells were pelletized through centrifugation and lysed
for 20 minutes at 4.degree. C. in 150 .mu.l PLB buffer (Passive
Lysis Buffer; Promega, Mannheim, Germany). The cell residues were
removed by centrifugation for 20 minutes at 13,000 rpm and
4.degree. C. in a bench centrifuge.
[0103] Various procedures were applied with the lysate depending on
whether the luciferase reporter gene or the GUS reporter gene were
used. If the luciferase reporter gene was used, a 5 .mu.l sample of
the supernatant with the released luciferase is mixed with 50 .mu.l
LARII buffer (Promega, Mannheim, Germany) in 5 ml test tubes
(Sarstedt, item no. 55.476). The buffer contains the substrate of
the luciferase so that the activity of the enzyme and thus of the
promoter can be measured with the Luminometer. The measurement
occurs with 2 seconds pre-measurement time and 10 seconds
luciferase-measurement time. Thereafter, 50 .mu.l Stop & Glo
buffer (Promega, Mannheim, Germany) is added and carefully mixed by
drawing up. This buffer stops the luciferase activity and renders
measurable the constitutive renilla-luciferase activity of the
normalizing vector. This measured value is used for normalizing the
different transformation efficiencies. The measurement occurs with
2 seconds premeasurement time and 10 seconds luciferase-measurement
time.
[0104] If the .beta.-glucuronidase (GUS) reporter gene from E. coli
was used (Jefferson et al., 1987), the proof is effected by an
enzyme reaction in which the Substrate MUG is hydrolized into 4-MU.
Then 4-MU is proven and quantified by its fluorescence. Using these
methods, the activity with and without the PAMP PEP25 was measured
for all single sequences examined.
[0105] Table 2 lists all tested single sequences. It additionally
lists whether they were inducible by the PAMP PEP25 in parsley. The
cis-regulatory elements (single sequences) identified as
pathogen-inducible and the motifs thereof are summarized in FIG.
2.
Mutation Analyses of the Identified Core Sequences
[0106] Mutation analyses were conducted for selected single
sequences to prove that the respective identified core sequence is
responsible for the PAMP- and pathogen-inducibility of the single
sequences. Mutated derivatives of the single sequences were created
therefore. The mutated single sequences were synthesized as
oligonucleotides. The cloning of the plasmids was conducted
corresponding to the constructs with chimeric promoters without
mutations. Thereafter, the constructs were tested, as previously
described above, for their PEP25 inducibility in parsley. The
results of the mutation analyses are reproduced in FIG. 5A, FIG.
5B, FIG. 6A, and FIG. 6B. It could be shown for all five elements
examined that the identified core sequence is responsible for the
inducibility.
[0107] This is especially significant for single sequences Cis05
and 30I-8 M1 S2 of the group 27. The core sequence of 30I-8_M1_S2
partially overlaps with a sequence (GTCAA) complementary to the
W-box (TTGAC; Rushton et al., 1996). An overlapping W-box sequence
was also found in the single sequences 30I-8_M1_S3, Cis02, and
Cis13.
[0108] However, it could be shown through the mutation analyses, in
particular through the variants 30I-8_M1_S2_mut2, that bases
outside the W-box are vital for the PAMP inducibility (FIG. 6A).
Other members of the group 27 show no overlapping W-box sequence.
Correspondingly, the mandatory core sequence TGAC for the W-box is
not part of the sequence- or family motif of the group 27 (FIG.
3F). Thus the motifs or the single sequences of the group 27 do not
involve variants of the W-box.
[0109] A W-box sequence is found outside the core sequence in the
single sequence Cis05. The mutation analyses could show here that
this W-box does indeed convey PAMP inducibility. However, the
mutation leads only the Cis05 core sequence or only the W-box to a
reduction in the inducibility and only mutation of both elements
leads to a complete loss of the inducibility. Thus a single
sequence with two functional, PAMP- and pathogen-inducible
cis-regulatory elements, the known W-box, and the novel Cis05-Motiv
(FIG. 2T) are concerned. The combination of both elements shows a
considerably higher activity than the single elements alone.
[0110] To isolate the sequence region of the element Cis05 motif
(FIG. 2T) that conveys the inducibility, said element was
tetramerized separately from the W-box (sCis05) and four additional
mutated derivatives of the Cis05 motif were created. The
derivatives were tested for their inducibility through the PAMP
PEP25 in parsley as described above (FIG. 5B). It could be shown
that in addition to the critical importance of the core sequence
for the inducibility, both bases in 5'-direction prior to the core
sequence are also essential for the inducibility of Cis05, which
further confirms that it is not a W-box variant.
[0111] The core sequences of the elements 20u_M1_S1 and 27G-8_M1_S1
could also be confirmed through additional mutation analyses. The
tests were conducted as already described above. The results of
these mutation analyses are reproduced in FIG. 6B (on top:
20u_M1_S1; on the bottom: 27G-8_M1_S1).
Derivation of Family Motifs
[0112] Because the cis-regulatory elements identified in
Arabidopsis promoters were tested in parsley, a biological
functionality, which spans all plant species, of the identified
cis-regulatory elements was ensured. The experiments showed, as
expected, that not all of the bioinformatically identified
sequences are functional. Roughly one third of the tested DNA
sequences were inducible by PEP25 in parsley. The other sequences
were false-positive sequences from the bioinformatic analysis or
did not exhibit the desired species-spanning biological
functionality. These important results could be used to identify
the family motifs of the motif groups 1, 5, 11, 12, 21, 21n and 27
as well as the corresponding strongly conserved, characteristic
core sequences (FIG. 3) on the basis of the functionally effective
single sequences. To this end, all functionally effective single
sequences belonging to a motif group were summarized and a
consensus and a motif were derived therefrom. First the region was
that is part of the core sequence in all underlying single
sequences was defined as a characteristic core sequence motif of
the family motif.
[0113] The core sequence of motif group 27 is also in the sequence
LS10 (Lebel et al., 1998). In said latter sequence, a mutation
including ten bases was generated in the native PR-1 promoter in
that sequence region, which mutation led to a sharp decline of a
SA- or INA-inducibility of the native promoter. The results shown
there, however, do not enable the derivation of a motif or of a
core sequence. Furthermore, the usability of LS10 for chimeric
promotes is not shown. Moreover, the family motif of the motif
group 27 differentiates the motif group from the LS10 sequence. The
family motif excludes a C on the position 5, while in LS10 a C is
present at said position. Furthermore, it excludes a G from
position 17, while in LS10 a G is present as said position. Finally
it necessitates a T or C at position 18, while an A is present in
LS10 at this position.
Proof of the Inducibility by the Pathogenic Fungus Cercospora
beticola in Stably Transformed Sugar Beets
[0114] The novel cis-regulatory elements should distinguish
themselves in that they can be induced in different plant species
by different PAMPs and pathogens. To demonstrate the inducibility
in an agronomically important plant by an agronomically important
pathogen, the single sequences that tested positive in parsley were
stably transformed in sugar beets. To this end, the chimeric
promoters were recloned with the tetramerized single sequences
including the luc gene at the ascI- and sacI-interfaces in the
binary vector 1.times.W1-luc-kan, a plasmid based on the binary
vector pGPTV. In FIG. 7, the vector 4.times.Cis05-luc-kan is shown
as an example. Corresponding vectors were created for all tested
elements. The plasmid DNA of the binary vectors was isolated from
E. Coli and transformed into the Agrobacterium tumefaciens strain
GV3101 by a Gene Pulser.RTM. II. Electroporation System at a
setting of 25 mF and 2.5 kV. The selection of recombinant A.
tumefaciens-{2)clones occurred by using the antibiotic kanamycin
(50 mg/l). The transformation of the sugar beets was effected
according to Lindsey et al. (1991) with the use of the antibiotic
kanamycin.
[0115] The transgenesis of the plants was tested by PCR. The use of
the primers GTGGAGAGGCTATTCGGTA (SEQ ID NO: 36) and
CCACCATGATATTCGGCAAG (SEQ ID NO: 37) led to the amplification of a
553-bp-sized DNA fragment from the nptlI-gene. The PCR was
conducted using 10 ng genomic DNA, a primer concentration of 0.2
.mu.M at an annealing temperature of 55.degree. C. in a multicycler
PTC-200 (MJ Research, Watertown, USA).
[0116] Ten to twenty independent transgenic lines were clonally
increased in in vitro culture and infected with Cercospora beticola
(Ahlburg isolate). After one, two, three, and four days, four
plants/line were harvested and their luciferase activity was
measured with the Promega Luciferase Assay System, 100 assays, cat.
no. E1500 (LAR). The samples were housed in four volumes CCLR
buffer (Cell Culture Lysis Reagent, 5.times.) and processed using a
Heidolph (RZR 2020). The plant residue was removed by
centrifugation for ten min at 4.degree. C. and 14000 rpm and the
supernatant was used for the luciferase measurement. A 10-.mu.l
sample was pipetted into a 5 ml test tube (Sarstedt, item no.
55.476) for measurement and 100 .mu.l Luciferase Assay Reagent
(LAR; Promega, Mannheim, Germany) was added. After careful mixing,
the luciferase activity was determined in a Sirius Luminometer
(Berthold Detection System GmbH, Pforzheim, Germany).
[0117] Novel elements from groups 12 and 27 (see FIGS. 3D and F for
group classification) were tested, among other things. The median
was calculated of the measured luciferase activities of the
approximately 10 to 20 independent transgenic lines with a chimeric
promoter. The tests of the different promoters are summarized
according to groups from which the elements originated. The results
are shown in FIG. 8A. The direct comparison shows that the single
sequences of a motif group have significantly differing activities
despite the high homology of the motifs they contain. The
nucleotides of the family motifs that border the core sequence can
thus heavily influence the promoter strength and the background
activity. The different sequences of a motif group are thus not
identical in their function, but rather permit the development of
chimeric promoters with quantitative differences in the regulation
of the gene expression.
[0118] To test a further motif group, the element GG6_M1 (single
sequence GG6_M1_S1) was stably transformed in sugar beet as
specified above and tested for inducibility by Cercospora. Ten to
twenty independent transgenic lines were clonally increased in
vitro culture and infected with Cercospora beticola (Ahlburg
isolate). After two, three, four, and seven days, four plants/line
were harvested and their luciferase activity was measured with the
Promega Luciferase Assay System, 100 assays, cat. no. E1500 (LAR).
The results are shown in FIG. 9 and demonstrate a clear
inducibility of the single sequence GG6_M1_S1 in sugar beet by
Cercospora beticola. Furthermore, a histochemical analysis showed
that the induction largely occurred in vascular tissue.
[0119] To investigate the influence of the W-box sequence in the
single sequence Cis05 in stably transformed plants, the mutated
derivatives Cis05mut1 and Cis05mut2 and the shortened single
sequence sCis05 from the parsley tests were stably transformed in
sugar beet. Construct creation and transformation were conducted as
described above. Eighteen independent transgenic lines were
clonally propagated in vitro and infected with Cercospora beticola
(Ahlburg isolate). After one, two, three, and four days, four
plants/line were harvested and their luciferase activity was
measured as described above (FIG. 8B).
[0120] The mutation analysis in stably transformed plants shows
that this W-box alone, i. e. with mutated Cis05 motif, conveys only
a weak pathogen inducibility by Cercospora. The Cis05 motif alone
(mutated W-box or shortened element without W-box) is, on the other
hand, significantly inducible. The complete Cis05 single sequence
with W-box is likewise inducible, but demonstrates an increased
background activity relative to the derivatives without W-box. Thus
the Cis05 motif alone in stably transformed sugar beet is
equivalent or even superior to the combination with the W-box.
[0121] Another important feature of the inventive chimeric
promoters is that the pathogen-induced activity is limited to the
region of the infection site. This is shown in FIG. 14 using the
example of the inventive promoter 4.times.Cis05. Said promoter was
merged with the red fluorescing reporter gene and the construct
thereby obtained stably transformed in sugar beet. The activity can
be observed as red fluorescence under the laser scanning
microscope. In FIG. 14 shows the local induction of the
4.times.Cis05 promoter around the penetration site of a Cercospora
hyphae.
Enlarged Species-Wide Pathogen Inducibility
[0122] As a further example for broad applicability of the
cis-regulatory elements in different plant species, the
inducibility was demonstrated for Cis05 in transient experiments in
the monocotyledonous plant wheat through the fungus Fusarium
culmorum. Since the 35S minimal promoter in wheat conveys
insufficient activity, the Cis05 elements had to be recloned. To
that end, they were excised from the plasmids used for the parsley
tests with the enzymes Eco31I and XbaI and cloned in the vector
pubiTATARucII opened with Eco31I and BcuI (FIG. 10). Corresponding
constructs were generated for Cis05 as well as for the mutated
Cis05 single sequences Cis05mut1 and Cis05mut2 in which either the
Cis05 motif or the W-box is mutated. These constructs were
biolistically transformed in the primary leaves of the wheat
variety "taifun", which leaves were infected with Fusarium
graminearum, as well as in non-infected control leaves.
[0123] For the infection, Fusarium graminearum mycel with a
specimen slide covered in fungal plate was scraped off, briefly
ground in 200 ml water with an Ultraturrax, and suspended.
Thereafter, 200 .mu.l 2% triton was added and the wheat primary
leaves were stirred in the suspension for one minute. Subsequent
thereto, the infected leaf pieces and non-infected control leaf
pieces were placed on H.sub.2O agar plates and transiently
transformed with a Bio-Rad particle gun according to manufacturer's
instruction using 1100 psi rupture disks. A constitutive
luciferase-expressing vector was used as a normalizing vector.
[0124] The wheat leaves were then incubated over night at
25.degree. C. To determine the luciferase activities, each of the
leaves was ground up in a mortar in 1 ml PLB buffer with sea sand.
After 20 minutes of centrifugation at 4.degree. C., the a 5 .mu.l
sample of the supernatant with the released luciferase is mixed in
5 ml test tubes (Sarstedt, item no. 55.476) with 50 .mu.l LARII
buffer (Promega, Mannheim, Germany). The buffer contains the
substrate of the luciferase so that the activity of the normalizing
vectors can be measured. This measured value is used for
normalizing the different transformation efficiencies. The
measurement is effected with two seconds pre-measurement time and
ten seconds luciferase measurement time. Subsequent thereto, 50
.mu.l Stop & Glo buffer (Promega, Mannheim, Germany) is added
and carefully mixed by drawing up. This buffer stops the luciferase
activity and renders measurable the renilla-luciferase activity
that corresponds to the activity of the Cis05 promoters. The
measurement likewise occurs with two seconds pre-measurement time
and ten seconds luciferase-measurement time.
[0125] The induced or non-induced activities of the 4.times.Cis05
promoter and of its mutated derivatives were measured in five
biological repetitions (FIG. 11). Thereafter, the complete
experiment was repeated once again. Both repetitions demonstrate
that in wheat, the pathogen-induced activity stems from the Cis05
motif, while the W-box motif does not convey any activity induced
by Fusarium graminearum.
[0126] Analysis of the pathogen- or wound-induced and
tissue-specific activity of the elements Cis02, Cis05, Cis09, Cis12
or Cis13 in Arabidopsis.
[0127] The novel cis-regulatory elements should thereby distinguish
themselves in that they can be induced in different plant species
by different PAMPs and pathogens. Six promoters with tetramerized
single sequences were stably transformed in Arabidopsis as an
additional control for the activity of the chimeric promoters. The
tetramerized elements Cis02, Cis05, Cis09, Cis12 or Cis13 were
additionally cloned with 35S minimal promoter prior to the GUS
reporter gene in the transformation vector pBIN-GUS. The final
construct was transformed in agrobacteria. A floral-dip
transformation (Clough and Bent, 1998) of Arabidopsis plants was
conducted in the following to stably integrate the promoter-GUS
constructs in the plant genome. The selection of transgenic plants
was made using the kanamycin antibiotic.
[0128] Ten independent transformants were investigated for each
element.
[0129] The activity of the GUS reporter gene and of the promoters
can be made visible with the use of a GUS dye (Jefferson et al.,
1987). The activation of the respective chimeric promoters leads to
the expression of an enzyme (GUS) that creates a blue dye. The
coloration thus shows the activity of the respective chimeric
promoters.
[0130] To test the pathogen inducibility of the promoters, the
transgenic Arabidopsis plants were infected with the compatible
pathogen Hyaloperonospora arabidopsidis. Five days after infection,
the activity of the promoters was proven by a GUS dye. Individual
leaves were additionally wounded by cutting with scissors to test
the wound inducibility of the promoters (FIG. 16).
[0131] The element Cis02 demonstrated favorable pathogen
inducibility and only a minimal wound inducibility. The element
Cis05 demonstrated a generally strong activity and is likewise
strongly induced by H. Arabidopsidis. The element Cis09
demonstrated a favorable induction of the promoter subsequent to
infection and hardly any undesired activity after wounding. Like
element Cis09, the element Cis12 demonstrated in all examined lines
hardly any undesired activity after wounding, while an obvious
induction through the pathogen H. arabidopsidis was observed. The
elements Cis12 and Cis09 share a common family motif. The element
Cis13 is also heavily induced through infection with H.
arabidopsidis. An obvious wound inducibility is not, however,
observed. FIG. 16 shows the exemplary GUS dyeing of transgenic A.
thaliana plants that express the GUS reporter gene under the
control of a chimeric promoter with 4.times. Cis05.
Combinatorials of the Cis-Regulatory Elements
[0132] Chimeric combinatorial promoters that are composed of
different cis-regulatory elements can demonstrate a greater
specificity and/or activity than the single elements present
therein through a synergistic interaction or through integration of
different signaling pathways (a promoter would be conceivable that
would have to perceive and integrate signals "EF-Tu" AND "flg22" in
order to be activated) (Rushton et al., 2002). To identify optimal
combinations of the novel cis-regulatory elements for chimeric
combinatorial promoters, chimeric combinatorial promoters,
including all possible 2.times.2 combinations of the
herein-described cis-regulatory elements Cis02, Cis05, Cis12, Cis13
and 30I-8_M1_S2 and the already published elements D-box (Rushton
et al., 2002), S-box (Kirsch et al., 2000) and Gst1-box
(Strittmatter et al., 1996), were generated using standard DNA
cloning procedures. The approach taken followed that for the
tetramerization of the single sequences described, only not the two
identical dimers (e.g. 2.times.30I-8_M1_S2 and
2.times.30I-8_M1_S2), but rather two different dimers (e.g.
2.times.Cis05 and 2.times.30I-8_M1_S2) are cloned together. The
thus-resulting chimeric combinatorial promoters were tested in the
transient expression systems in parsley for their inducibility
through the PAMP PEP25. The results (absolute non-induced and
induced activity of the chimeric combinatorial promoters and the
induction factor) are reproduced in FIG. 12. Chimeric combinatorial
promoters with especially stronger and more specific inducibility
could be identified, the induction factor of and activity of which
are greater than in chimeric promoters that are constructed from
only repetitions of the individual cis-regulatory elements (FIG.
13). The chimeric combinatorial promoters having the greatest
induction factors and the strongest activities are summarized in
Table 3.
TABLE-US-00004 TABLE 3 Combinations of pathogen-inducible single
sequences having the greatest induction factors and induced
activities. Standard Coefficient Average deviation of variation
Induction Combinations with the greatest induction factor
2xCis05-2xCis05 - 3.23 2.06 0.64 149.58 2xCis05-2xCis05 + 482.53
398.05 0.82 2xCis05-2xS - 2.00 1.51 0.76 115.63 2xCis05-2xS +
231.82 48.39 0.21 2xCis05-2x30I8b - 2.47 1.42 0.58 123.16
2xCis05-2x30I8b + 304.21 45.38 0.15 2xCis13-2xCis02 - 2.50 0.50
0.20 124.53 2xCis13-2xCis02 + 311.48 37.76 0.12 2xCis13-2xCis05 -
2.33 0.41 0.18 182.59 2xCis13-2xCis05 + 425.23 258.29 0.61
2xCis13-2xS - 4.55 0.65 0.14 139.85 2xCis13-2xS + 636.85 364.80
0.57 2xS-2xCis02 - 5.28 3.36 0.64 106.32 2xS-2xCis02 + 561.76
440.81 0.78 2xS-2xS - 2.76 0.49 0.18 138.80 2xS-2xS + 382.69 92.20
0.24 Gst1-2xS - 2.41 0.87 0.36 258.83 Gst1-2xS + 624.18 274.19 0.44
2x30I8b-2xCis05 - 0.90 0.30 0.34 135.12 2x30I8b-2xCis05 + 121.20
88.90 0.73 Combinations with the greatest induction factor
(induced) 2xD-2xCis05 - 84.57 49.56 0.59 17.88 2xD-2xCis05 +
1511.90 580.33 0.38 2xD-2xS - 23.96 17.66 0.74 57.72 2xD-2xS +
1382.94 1180.84 0.85 2xD-Gst1 - 19.25 20.18 1.05 62.10 2xD-Gst1 +
1195.21 486.92 0.41 2xS-2xCis12 - 36.84 19.34 0.53 29.05
2xS-2xCis12 + 1070.08 1043.46 0.98 2xS-2xD - 22.13 23.38 1.06 65.56
2xS-2xD + 1450.50 1085.69 0.75
REFERENCES
[0133] Bailey, T. L., C. Elkan (1994). "Fitting a mixture model by
expectation maximization to discover motifs in biopolymers." Proc
Int Conf Intell Syst Mol Biol. 2: 28-36. [0134] Bulow, L., M.
Schindler, et al. (2007). "PathoPlant: a platform for microarray
expression data to analyze co-regulated genes involved in plant
defense responses." Nucleic Acids Res 35(Database issue): D841-845.
[0135] Che, D., S. Jensen, et al. (2005). "BEST: binding-site
estimation suite of tools." Bioinformatics 21(12): 2909-2911.
[0136] Clough, S. J. and Bent, A. F. (1998). " Floral dip: a
simplified method for Agrobacterium-mediated transformation of
Arabidopsis thaliana." Plant J. 16(6):735-43. [0137] Eulgem, T., P.
J. Rushton, et al. (2000). "The WRKY superfamily of plant
transcription factors." Trends Plant Sci 5(5): 199-206. [0138]
Gorlich, D. and I. W. Mattaj (1996). "Nucleocytoplasmic transport."
Science 271(5255): 1513-1518. [0139] Gurr, S. J. and P. J. Rushton
(2005). "Engineering plants with increased disease resistance: how
are we going to express it?" Trends Biotechnol 23(6): 283-290.
[0140] Hahlbrock, K., D. Scheel, et al. (1995). "Oligopeptide
elicitor-mediated defense gene activation in cultured parsley
cells." Proc Natl Acad Sci USA 92(10): 4150-4157. [0141] Hicks, G.
R., H. M. Smith, et al. (1995). "Three classes of nuclear import
signals bind to plant nuclei." Plant Physiol 107(4): 1055-1058.
[0142] Himmelbach, A., L. Liu et al. (2010). "Promoters of the
Barley Germin-Like GER4 Gene Cluster Enable Strong Transgene
Expression in Response to Pathogen Attack" The Plant Cell 22(3):
937-952. [0143] Howles, P., G. Lawrence, et al. (2005). "Autoactive
Alleles of the Flax L6 Rust Resistance Gene Induce
Non-Race-Specific Rust Resistance Associated with the
Hypersensitive Response." Molecular Plant-Microbe Interactions
18(6): 570-582. [0144] Humphry, M., P. Bednarek, et al. (2010). "A
regulon conserved in monocot and dicot plants defines a functional
module in antifungal plant immunity." Proc Natl Acad Sci USA
107(50): 21896-21901. [0145] Jefferson, R. A., Kavanagh, T. A &
Bevan, M. W. (1987). "GUS fusions, 8-glucuronidase as a sensitive
and versatile gene fusion marker in higher plants." EMBO J 6(13):
3901-3907. [0146] Kirsch, C., M. Takamiya-Wik, et al. (2000) "A
novel regulatory element involved in rapid activation of parsley
ELI7 gene family members by fungal elicitor or pathogen infection."
Mol Plant Pathol. 1(4): 243-51. [0147] Kirsch, C., E. Logemann, et
al. (2001) "A highly specific pathogen-responsive promoter element
from the immediate-early activated CMPG1 gene in Petroselinum
crispum." Plant J. 26(2): 217-27. [0148] Kovalchuk, N., M. Li, et
al. (2010). "Defensin promoters as potential tools for engineering
disease resistance in cereal grains." Plant Biotechnol J 8(1):
47-64. [0149] Lebel, E., P. Heifetz, et al. (1998). "Functional
analysis of regulatory sequences controlling PR-1 gene expression
in Arabidopsis." Plant J 16(2): 223-233. [0150] Liu, X., D. L.
Brutlag, et al. (2001). "BioProspector: discovering conserved DNA
motifs in upstream regulatory regions of co-expressed genes." Pac
Symp Biocomput: 127-138. [0151] Morris, K., S. A. MacKerness, et
al. (2000). "Salicylic acid has a role in regulating gene
expression during leaf senescence." Plant J 23(5): 677-685. [0152]
Rushton, P. J., A. Reinstadler, et al. (2002). "Synthetic plant
promoters containing defined regulatory elements provide novel
insights into pathogen- and wound-induced signaling." Plant Cell
14(4): 749-762. [0153] Rushton, P. J., J. T. Torres, et al. (1996).
"Interaction of elicitor-induced DNA-binding proteins with elicitor
response elements in the promoters of parsley PR1 genes." EMBO J
15(20): 5690-5700. [0154] Schatz, G. and B. Dobberstein (1996).
"Common principles of protein translocation across membranes."
Science 271(5255): 1519-1526. [0155] Schumacher, S. B., O. Van den
Hauwe, et al. (2003). "Development of a dual luciferase reporter
screening assay for the detection of synthetic glucocorticoids in
animal tissues." Analyst 128(12): 1406-1412. [0156] Strittmatter,
G., G. Gheysen, et al. (1996). "Infections with various types of
organisms stimulate transcription from a short promoter fragment of
the potato gst1 gene." Mol Plant Microbe Interact 9(1): 68-73.
[0157] Venter, M. (2007). "Synthetic promoters: genetic control
through cis engineering." Trends Plant Sci 12(3): 118-124. [0158]
Verner, K. and G. Schatz (1988). "Protein translocation across
membranes." Science 241(4871): 1307-1313. [0159] Wan, J., X. C.
Zhang, et al. (2008). "A LysM receptor-like kinase plays a critical
role in chitin signaling and fungal resistance in Arabidopsis."
Plant Cell 20(2): 471-481. [0160] Zipfel, C., G. Kunze, et al.
(2006). "Perception of the bacterial PAMP EF-Tu by the receptor EFR
restricts Agrobacterium-mediated transformation." Cell 125(4):
749-760. [0161] Zipfel, C., S. Robatzek, et al. (2004). "Bacterial
disease resistance in Arabidopsis through flagellin perception."
Nature 428(6984): 764-767. [0162] WO 00/29592
(Max-Planck-Gesellschaft zur Forderung der Wissenschaften e.V.).
Chimeric promoters capable of mediating gene expression in plants
upon pathogen infection and uses thereof. [0163] WO 02/50293
(Max-Planck-Gesellschaft zur Forderung der Wissenschaften e.V.).
Pflanzen mit verbesserter Widerstandskraft. [0164] WO 03/00898
(Syngenta Participations AG). Plant genes involved in defense
against pathogens. [0165] WO 07/147395 (KWS SAAT AG). Pathogen
induzierbarer synthetischer Promotor [0166] WO 10/079430 (U. Bonas
et al.). Modular DNA-binding domains and methods of use. [0167] WO
11/072246 (Regents of the University of Minnesota; Iowa State
University Research Foundation Inc.). TAL effector-mediated DNA
modification.
Sequence CWU 1
1
145118DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotidemodified_base(1)..(2)a, c, t or
gmisc_feature(1)..(2)n is a, c, g, or tmodified_base(6)..(7)a, c, t
or gmisc_feature(6)..(7)n is a, c, g, or tmisc_feature(9)..(14)Core
sequence motifmodified_base(15)..(15)a, c, t or
gmisc_feature(15)..(15)n is a, c, g, or t 1nnhkdnnvaa agtmndhy
18216DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotidemodified_base(2)..(2)a, c, t or
gmisc_feature(2)..(2)n is a, c, g, or tmodified_base(6)..(6)a, c, t
or gmisc_feature(6)..(6)n is a, c, g, or tmisc_feature(7)..(12)Core
sequence motifmodified_base(15)..(15)a, c, t or
gmisc_feature(15)..(15)n is a, c, g, or t 2ynamcnaaac cawwny
16313DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotidemodified_base(2)..(2)a, c, t or
gmisc_feature(2)..(2)n is a, c, g, or tmisc_feature(5)..(10)Core
sequence motif 3wnrmscaaam smw 13413DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotidemodified_base(1)..(2)a, c, t or
gmisc_feature(1)..(2)n is a, c, g, or tmisc_feature(5)..(9)Core
sequence motifmodified_base(11)..(11)a, c, t or
gmisc_feature(11)..(11)n is a, c, g, or t 4nnmsacrcgy nwm
13514DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotidemisc_feature(2)..(9)Core sequence motif
5asktgkactw kgwm 14615DNAArtificial SequenceDescription of
Artificial Sequence Synthetic
oligonucleotidemodified_base(2)..(2)a, c, t or
gmisc_feature(2)..(2)n is a, c, g, or tmisc_feature(6)..(12)Core
sequence motifmodified_base(15)..(15)a, c, t or
gmisc_feature(15)..(15)n is a, c, g, or t 6knwymmrtsa ckwmn
15725DNAArabidopsis thalianamisc_feature(10)..(16)Core sequence
7acaacagacg acttttcata attca 25825DNAArabidopsis
thalianamisc_feature(10)..(16)Core sequence 8ctatatgaca aaagtcaaac
ataaa 25927DNAArabidopsis thalianamisc_feature(7)..(21)Core
sequence 9tgttcacttt gaaaagtatt ctttgag 271026DNAArabidopsis
thalianamisc_feature(7)..(20)Core sequence 10cgatcagact tttctacgca
agagaa 261135DNAArabidopsis thalianamisc_feature(12)..(24)Core
sequence 11taatttctct tgcgtagaaa agtctgatcg ggaag
351235DNAArabidopsis thalianamisc_feature(15)..(21)Core sequence
12tcgttcttca gtcaaaaagt caaactatct ctctc 351330DNAArabidopsis
thalianamisc_feature(12)..(18)Core sequence 13gagcgtgaat tgactttgac
caaaaccaaa 301438DNAArabidopsis thalianamisc_feature(14)..(20)Core
sequence 14ggtcagcatg ttggactttc caaattcatt gaccaaag
381539DNAArabidopsis thalianamisc_feature(20)..(29)Core sequence
15aaaataaaca gctacttgac gaaaagtcaa accaaattc 391636DNAArabidopsis
thalianamisc_feature(14)..(23)Core sequence 16gttttgactt ttgacctaaa
ccatttccat gtagaa 361736DNAArabidopsis
thalianamisc_feature(13)..(24)Core sequence 17ccgtcttagt ttaccgaaac
caaagtggct ttttct 361835DNAArabidopsis
thalianamisc_feature(11)..(25)Core sequence 18cgtaataatg gtttggtttg
gtttgatcaa gtctt 351925DNAArabidopsis
thalianamisc_feature(8)..(18)Core sequence 19gacttttgac ctaaaccatt
tccat 252026DNAArabidopsis thalianamisc_feature(9)..(17)Core
sequence 20caacacaaaa cgcaaacgca gacctc 262135DNAArabidopsis
thalianamisc_feature(14)..(22)Core sequence 21aattgacaaa agacacgcaa
acgattccaa cgacc 352235DNAArabidopsis
thalianamisc_feature(14)..(22)Core sequence 22aaataattat ttatggtttg
gtcatttggt caaat 352335DNAArabidopsis
thalianamisc_feature(15)..(21)Core sequence 23agtcaaaacg tagaccaaaa
caaaaacatg taact 352438DNAArabidopsis
thalianamisc_feature(12)..(19)Core sequence 24tgcacacaca cacacgtgta
ctaggtcaaa ccaaacgt 382541DNAArabidopsis
thalianamisc_feature(20)..(25)Core sequence 25caaaaagtca acacatacga
cgcgtttcca ttgactaaat a 412625DNAArabidopsis
thalianamisc_feature(9)..(17)Core sequence 26tctcatctct cgacacgcaa
cttcc 252725DNAArabidopsis thalianamisc_feature(7)..(19)Core
sequence 27cacacacgtg tactaggtca aacca 252835DNAArabidopsis
thalianamisc_feature(14)..(22)Core sequence 28aggacttttc accagttgga
ctttgaagcc accaa 352934DNAArabidopsis
thalianamisc_feature(11)..(19)Core sequence 29aagtctaaat ctttgacccc
aaaaaagaga gcaa 343035DNAArabidopsis
thalianamisc_feature(15)..(21)Core sequence 30tgttgagtcg tttacgtcac
gtcgagaatt ttctc 353135DNAArabidopsis
thalianamisc_feature(15)..(21)Core sequence 31tgtcattatt aatacgtgac
gaaactgtag ctctg 353236DNAArabidopsis
thalianamisc_feature(11)..(25)Core sequence 32ttacgtgtca agaagtgatt
ggagaggaca ctctac 363335DNAArabidopsis
thalianamisc_feature(15)..(21)Core sequence 33ccatacaata taaaccacca
aaccataacc acaaa 353426DNAArabidopsis
thalianamisc_feature(9)..(18)Core sequence 34caatctactc gtctcttctc
ttacat 263510DNAArabidopsis thaliana 35tcgtctcttc
103619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 36gtggagaggc tattcggta 193720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
37ccaccatgat attcggcaag 2038182DNAOryza sativa 38tcctctctac
tcctcagcat ctatataagg gccttgcagg cagtggctct cacaccaacg 60aaacaaggag
agactcagag aggaggcgtg ttggttagct cattggcagc agcacacaca
120aaccacatct cctatatata gctcattttt agcttttgga attgagagag
gttttgagag 180aa 18239149DNATriticum aestivum 39atctgcaggc
gctgcctatt taatcccttc ccctccctcc attcccctcc aagaagagcc 60acagcttcat
ctgcagctac agctcctctt cgtcttcgac acacaagtat tttttcagga
120caaagatcaa tccagataca catacacct 149401133DNAZea
maysIntron(129)..(1133) 40cttcctcgcc cgccgtaata aatagacacc
ccctccacac cctctttccc caacctcgtg 60ttgttcggag cgcacacaca cacaaccaga
tctcccccaa atccacccgt cggcacctcc 120gcttcaaggt acgccgctcg
tcctcccccc ccctctctac cttctctaga tcggcgttcc 180ggtccatggt
tagggcccgg tagttctact tctgttcatg tttgtgttag atccgtgttt
240gtgttagatc cgtgctgcta gcgttcgtac acggatgcga cctgtacgtc
agacacgttc 300tgattgctaa cttgccagtg tttctctttg gggaatcctg
ggatggctct agccgttccg 360cagacgggat cgatttcatg attttttttg
tttcgttgca tagggtttgg tttgcccttt 420tcctttattt caatatatgc
cgtgcacttg tttgtcgggt catcttttca tgcttttttt 480tgtcttggtt
gtgatgatgt ggtctggttg ggcggtcgtt ctagatcgga gtagaattct
540gtttcaaact acctggtgga tttattaatt ttggatctgt atgtgtgtgc
catacatatt 600catagttacg aattgaagat gatggatgga aatatcgatc
taggataggt atacatgttg 660atgcgggttt tactgatgca tatacagaga
tgcttttgtt cgcttggttg tgatgatgtg 720gtgtggttgg gcggtcgttc
attcgttcta gatcggagta gaatactgtt tcaaactacc 780tggtgtattt
attaattttg gaactgtatg tgtgtgtcat acatcttcat agttacgagt
840ttaagatgga tggaaatatc gatctaggat aggtatacat gttgatgtgg
gttttactga 900tgcatataca tgatggcata tgcagcatct attcatatgc
tctaaccttg agtacctatc 960tattataata aacaagtatg ttttataatt
attttgatct tgatatactt ggatgatggc 1020atatgcagca gctatatgtg
gattttttta gccctgcctt catacgctat ttatttgctt 1080ggtactgttt
cttttgtcga tgctcaccct gttgtttggt gttacttctg cag
11334118DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotidemodified_base(2)..(2)a, c, t or
gmisc_feature(2)..(2)n is a, c, g, or tmodified_base(4)..(6)a, c, t
or gmisc_feature(4)..(6)n is a, c, g, or tmisc_feature(7)..(12)Core
sequence motifmodified_base(13)..(15)a, c, t or
gmisc_feature(13)..(15)n is a, c, g, or tmodified_base(17)..(17)a,
c, t or gmisc_feature(17)..(17)n is a, c, g, or t 41snsnnnwwkg
wcnnnsnm 184229DNAArabidopsis thalianamisc_feature(5)..(25)Core
sequence motif 42ctcaaaggcc agaattgacg cagccgttt
294328DNAArabidopsis thalianamisc_feature(7)..(22)Core sequence
motif 43ccttggccca gtccttggtc gtcgtatc 284411DNAArabidopsis
thalianamisc_feature(5)..(11)Core sequence motif 44gttggacttt c
114528DNAArabidopsis thaliana 45tctactagag gcccattagg accggcat
284635DNAArabidopsis thaliana 46aagacaagtt gagagagacg agaccaatca
caaca 354735DNAArabidopsis thaliana 47atccaacatc tcggaccgga
tcaatgattt atcat 354825DNAArabidopsis thaliana 48tcatcaatgt
gacataagca aagct 254926DNAArabidopsis thaliana 49tttgatacgg
ttacggttaa ttaacg 265036DNAArabidopsis thaliana 50aagattctca
tccaaccgaa acgactcttt cgtttt 365136DNAArabidopsis thaliana
51agattctcat ccaaccgaaa cgactctttc gttttt 365236DNAArabidopsis
thaliana 52tcttcttcat tttaccaaca ccacttgcac acacac
365335DNAArabidopsis thaliana 53agttgaatta gttcggttcg gttcggttga
tattg 355424DNAArabidopsis thaliana 54cgataaactt gcgaaaccct aaaa
245525DNAArabidopsis thaliana 55tattggaagt ttggggcaac atcac
255635DNAArabidopsis thaliana 56ttcaacccta taaaccaaaa caaataacag
aatgc 355736DNAArabidopsis thaliana 57cgcctcaatc atgaaaacga
atcctctgta gtagtg 365835DNAArabidopsis thaliana 58ttaccgacac
gtaaccaaaa ctcaccgaac accgt 355935DNAArabidopsis thaliana
59gtttcgaacg ggaaccaaac cataatatgc gatgc 356035DNAArabidopsis
thaliana 60acactattgg tcttggtttg gtttatatgc acgac
356136DNAArabidopsis thaliana 61gaaaacgatg ggttccaaaa ctgtcgctaa
taaact 366236DNAArabidopsis thaliana 62tctccactcg ttgtgatttg
gtctgcaaga aaacta 366336DNAArabidopsis thaliana 63acgttttgaa
atattgtttt ggatggagat tttttc 366436DNAArabidopsis thaliana
64atttttcatt tcgcccaaaa caattatcct aacgtt 366536DNAArabidopsis
thaliana 65ttttataaca ctaccaaaac caataagccc tttcgt
366635DNAArabidopsis thaliana 66tcatcaaacc aatcggtttg gtcctaaaga
taatt 356735DNAArabidopsis thaliana 67gtcaatatac acagccaccg
aacaaattac tctat 356826DNAArabidopsis thaliana 68aagcgatgtt
tacgaacccc aaaatc 266925DNAArabidopsis thaliana 69agatttgttc
gagaaccttg agaaa 257025DNAArabidopsis thaliana 70ttgctacttc
gagaacattg gtcaa 257126DNAArabidopsis thaliana 71ttagaagtgg
ctcgagtgtt ctactt 267226DNAArabidopsis thaliana 72aagaaagaca
atcgagccta gaaatt 267336DNAArabidopsis thaliana 73aataatgttc
aacgttggtg gtggtactca agatgg 367436DNAArabidopsis thaliana
74tcaaatacag gcaaccaaga ctcgagatcc tcatcg 367525DNAArabidopsis
thaliana 75agaaaaatat tgggcctact gggaa 257636DNAArabidopsis
thaliana 76agattcctga agtgaggtcc accctaaaat ccattt
367735DNAArabidopsis thaliana 77ggtttagtca aagtaaacaa gactttgact
gttca 357836DNAArabidopsis thaliana 78tgaacttaat cactgtcatt
gttttcgtaa caattt 367926DNAArabidopsis thaliana 79gaaaaatgtg
tgtgtttgtg ttaatt 268026DNAArabidopsis thaliana 80atagttccca
aacggacacg aacaca 268126DNAArabidopsis thaliana 81gcaaactaac
gccggcggcc gtcttg 268225DNAArabidopsis thaliana 82tagctgttga
aatttccaag aaaat 258325DNAArabidopsis thaliana 83tttttctcgt
ccccatcctc tatcc 258426DNAArabidopsis thaliana 84taggttcctg
ccctctccgt tcctcc 268526DNAArabidopsis thaliana 85tcgaaaccaa
ccctctccct tataaa 268626DNAArabidopsis thaliana 86gaaaccaacc
ctctccctta taaata 268736DNAArabidopsis thaliana 87tgttttgttt
ccaccgtctc tcccgtgtcc tctctc 368824PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 88Val
Thr Ala Gly Ala Glu Val Trp Asn Gln Pro Val Arg Gly Phe Lys1 5 10
15Val Tyr Glu Gln Thr Glu Met Thr 208913DNAArabidopsis thaliana
89ctcgacacgc aac 139013DNAArabidopsis thaliana 90acacacacgt gta
139113DNAArabidopsis thaliana 91tacgacgcgt ttc 139215DNAArabidopsis
thaliana 92gtttacgtca cgtcg 159315DNAArabidopsis thaliana
93taatacgtga cgaaa 159415DNAArabidopsis thaliana 94tctccaatca cttct
159516DNAArabidopsis thaliana 95tgacctaaac catttc
169616DNAArabidopsis thaliana 96ttaccgaaac caaagt
169716DNAArabidopsis thaliana 97caaaccaaac caaacc
169813DNAArabidopsis thaliana 98aaacgcaaac gca 139913DNAArabidopsis
thaliana 99acacgcaaac gat 1310013DNAArabidopsis thaliana
100tagaccaaaa caa 1310113DNAArabidopsis thaliana 101atgaccaaac cat
1310214DNAArabidopsis thaliana 102acgtgtacta ggtc
1410314DNAArabidopsis thaliana 103agttggactt tgaa
1410418DNAArabidopsis thaliana 104aattatgaaa agtcgtct
1810518DNAArabidopsis thaliana 105atatgacaaa agtcaaac
1810618DNAArabidopsis thaliana 106tgcgtagaaa agtctgat
1810718DNAArabidopsis thaliana 107cactttgaaa agtattct
1810818DNAArabidopsis thaliana 108tcagtcaaaa agtcaaac
1810918DNAArabidopsis thaliana 109cttgacgaaa agtcaaac
1811018DNAArabidopsis thaliana 110ttttggtcaa agtcaatt
1811118DNAArabidopsis thaliana 111gaatttggaa agtccaac
1811221DNAArabidopsis thaliana 112cacgtgtact aggtcaaacc a
2111321DNAArabidopsis thaliana 113tttcaccagt tggactttga a
2111421DNAArabidopsis thaliana 114aaggccagaa ttgacgcagc c
2111521DNAArabidopsis thaliana 115gcccagtcct tggtcgtcgt a
2111644DNAArabidopsis thaliana 116aactggtcag catgttggac tttccaaatt
cattgaccaa agac 4411744DNAArabidopsis thaliana 117aactggtcag
catgttggtc gttccaaatt cattgaccaa agac 4411844DNAArabidopsis
thaliana 118aactggtcag catgttggac tttccaaatt catttcccaa agac
4411944DNAArabidopsis thaliana 119aactggtcag catgttggtc gttccaaatt
catttcccaa agac 4412011DNAArabidopsis thaliana 120gttggtcgtt c
1112111DNAArabidopsis thaliana 121gttcgacttt c
1112211DNAArabidopsis thaliana 122gtcggacttt c
1112311DNAArabidopsis thaliana
123gttggactgc c 1112411DNAArabidopsis thaliana 124gttggacttt a
1112525DNAArabidopsis thaliana 125ctatatgaca aaagagaaac ataaa
2512625DNAArabidopsis thaliana 126ctatatgaca ttagtcaaac ataaa
2512725DNAArabidopsis thaliana 127ctatatctca aaagtcaaac ataaa
2512826DNAArabidopsis thaliana 128caacacaaaa cgctttcgca gacctc
2612926DNAArabidopsis thaliana 129caacacaaat gccaaacgca gacctc
2613026DNAArabidopsis thaliana 130caacacaaaa cgcaaaccgt gacctc
2613129DNAArabidopsis thaliana 131tgagtcgttt acgtcacgtc gagaatttt
2913229DNAArabidopsis thaliana 132tgagtcgttt acgctgtgtc gagaatttt
2913329DNAArabidopsis thaliana 133tgagtcgttg ccgtcacgtc gagaatttt
2913429DNAArabidopsis thaliana 134tgagtcgttt acgtcacggt gagaatttt
2913529DNAArabidopsis thaliana 135acttttcacc agttggactt tgaagccac
2913629DNAArabidopsis thaliana 136acttttcacc agtcaggtct tgaagccac
2913729DNAArabidopsis thaliana 137acttttcacc ggttggactt taaagccac
291387DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 138vaaagtm 71396DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 139aaacca 61406DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 140scaaam
61415DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 141acrcg 51428DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 142sktgkact 81437DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 143mrtsack
71447DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 144ccaccaa 71456DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 145wwkgwc 6
* * * * *
References