U.S. patent application number 16/535992 was filed with the patent office on 2020-01-16 for method for the site-specific enzymatic labelling of nucleic acids in vitro by incorporation of unnatural nucleotides.
The applicant listed for this patent is The Scripps Research Institute. Invention is credited to Thomas LAVERGNE, Lingjun LI, Zhengtao LI, Denis A. MALYSHEV, Floyd E. ROMESBERG.
Application Number | 20200017540 16/535992 |
Document ID | / |
Family ID | 52461970 |
Filed Date | 2020-01-16 |
View All Diagrams
United States Patent
Application |
20200017540 |
Kind Code |
A1 |
ROMESBERG; Floyd E. ; et
al. |
January 16, 2020 |
METHOD FOR THE SITE-SPECIFIC ENZYMATIC LABELLING OF NUCLEIC ACIDS
IN VITRO BY INCORPORATION OF UNNATURAL NUCLEOTIDES
Abstract
Provided herein are analogs of unnatural nucleotides bearing
predominantly hydrophobic nucleobase analogs that form unnatural
base pairs during DNA polymerase-mediated replication of DNA or RNA
polymerase-mediated transcription of RNA. In this manner, the
unnatural nucleobases can be introduced in a site-specific way into
oligonucleotides (single or double stranded DNA or RNA), where they
can provide for site-specific cleavage, or can provide a reactive
linker than can undergo functionalization with a cargo-bearing
reagent by means of reaction with a primary amino group or by means
of click chemistry with an alkyne group of the unnatural nucleobase
linker.
Inventors: |
ROMESBERG; Floyd E.; (La
Jolla, CA) ; MALYSHEV; Denis A.; (Solana Beach,
CA) ; LI; Lingjun; (San Diego, CA) ; LAVERGNE;
Thomas; (Le Versoud, FR) ; LI; Zhengtao;
(Pudong new district, CN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Scripps Research Institute |
La Jolla |
CA |
US |
|
|
Family ID: |
52461970 |
Appl. No.: |
16/535992 |
Filed: |
August 8, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16518715 |
Jul 22, 2019 |
|
|
|
16535992 |
|
|
|
|
14910203 |
Feb 4, 2016 |
|
|
|
PCT/US2014/050423 |
Aug 8, 2014 |
|
|
|
16518715 |
|
|
|
|
61863649 |
Aug 8, 2013 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12P 19/34 20130101;
C07H 19/24 20130101; C07H 21/00 20130101; C12N 9/22 20130101; C07H
21/04 20130101; C12Q 1/6832 20130101; C07H 19/00 20130101; C12N
15/1024 20130101; C12Q 1/6832 20130101; C12Q 2525/117 20130101 |
International
Class: |
C07H 21/04 20060101
C07H021/04; C12N 9/22 20060101 C12N009/22; C12N 15/10 20060101
C12N015/10 |
Goverment Interests
STATEMENT OF GOVERNMENT SUPPORT
[0002] This invention was made with government support under grant
number GM060005, awarded by the National Institutes of Health. The
U.S. government has certain rights in the invention.
Claims
1. A double-stranded oligonucleotide comprising a first strand and
a second strand, wherein: (a) the first strand comprises a first
compound of the formula ##STR00029## wherein R.sub.2 is selected
from the group consisting of hydrogen, alkyl, alkenyl, alkynyl,
methoxy, methanethiol, methaneseleno, halogen, cyano, and azido;
and (b) the second strand comprises a second compound selected from
the group consisting of ##STR00030## and wherein in the case of
each of (a) and (b), the wavy line indicates a bond to a
2'-deoxyribosyl moiety.
2. The double-stranded oligonucleotide of claim 1, wherein the
first compound and the second compound form a base pair in the
double-stranded oligonucleotide.
3. The double-stranded oligonucleotide of claim 2, wherein the
R.sub.2 is hydrogen or halogen.
4. The double-stranded oligonucleotide of claim 3, wherein the
R.sub.2 is hydrogen.
5. The double-stranded oligonucleotide of claim 3, wherein the
R.sub.2 is halogen.
6. The double-stranded oligonucleotide of claim 5, wherein the
halogen is a fluoro.
7. The double-stranded oligonucleotide of claim 4, wherein the
second compound is selected from the group consisting of
##STR00031##
8. The double-stranded oligonucleotide of claim 7, wherein the
second compound is selected from the group consisting of
##STR00032##
9. The double-stranded oligonucleotide of claim 8, wherein the
second compound is selected from the group consisting of
##STR00033##
10. The double-stranded oligonucleotide of claim 9, wherein the
second compound is selected from the group consisting of
##STR00034##
11. The double-stranded oligonucleotide of claim 10, wherein the
second compound is ##STR00035##
12. The double-stranded oligonucleotide of claim 10, wherein the
second compound is ##STR00036##
13. A composition comprising: (a) a 2'-deoxyribonucleic acid (DNA)
molecule comprising a first compound of the formula ##STR00037##
wherein R.sub.2 is selected from the group consisting of hydrogen,
alkyl, alkenyl, alkynyl, methoxy, methanethiol, methaneseleno,
halogen, cyano, and azido, and wherein the wavy line indicates a
bond to a 2'-deoxyribosyl moiety; and (b) a ribonucleic acid (RNA)
molecule comprising a second compound selected from the group
consisting of ##STR00038## wherein the wavy line indicates a bond
to a ribosyl moiety.
14. The composition of claim 13, wherein the first compound and the
second compound form a base pair.
15. The composition of claim 14, wherein the R.sub.2 is hydrogen or
halogen.
16. The composition of claim 15, wherein the R.sub.2 is
hydrogen.
17. The composition of claim 16, wherein the second compound is
selected from the group consisting of ##STR00039##
18. The composition of claim 17, wherein the second compound is
selected from the group consisting of ##STR00040##
19. The composition of claim 18, wherein the second compound is
selected from the group consisting of ##STR00041##
20. The composition of claim 19, wherein the second compound is
selected from the group consisting of ##STR00042##
21. The composition of claim 20, wherein the second compound is
##STR00043##
22. The composition of claim 21, wherein the second compound is
##STR00044##
23. A composition comprising: (a) a first ribonucleic acid (RNA)
molecule comprising a first compound of the formula ##STR00045##
wherein R.sub.2 is selected from the group consisting of hydrogen,
alkyl, alkenyl, alkynyl, methoxy, methanethiol, methaneseleno,
halogen, cyano, and azido; and (b) a second ribonucleic acid (RNA)
molecule comprising a second compound selected from the group
consisting of ##STR00046## and wherein in the case of each of (a)
and (b), the wavy line indicates a bond to a ribosyl moiety.
24. The composition of claim 23, wherein the first compound and the
second compound form a base pair.
25. The composition of claim 24, wherein the R.sub.2 is
hydrogen.
26. The composition of claim 25, wherein the second compound is
selected from the group consisting of ##STR00047##
27. The composition of claim 26, wherein the second compound is
selected from the group consisting of ##STR00048##
28. The composition of claim 27, wherein the second compound is
selected from the group consisting of ##STR00049##
29. The composition of claim 28, wherein the second compound is
##STR00050##
30. The composition of claim 28, wherein the second compound is
##STR00051##
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This is a continuation of U.S. patent application Ser. No.
16/518,715, filed on Jul. 22, 2019, which is a continuation of U.S.
patent application Ser. No. 14/910,203, filed Feb. 4, 2016; which
is a U.S. National Stage Entry of PCT/US2014/050423, filed Aug. 8,
2014; which claims the benefit of priority to U.S. Provisional
Patent Application No. 61/863,649, filed Aug. 8, 2013; all of which
are herein incorporated by reference in their entirety.
SEQUENCE LISTING
[0003] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Sep. 25, 2019, is named "46085703302 SL.txt" and is 5,648 bytes
in size.
BACKGROUND
[0004] Oligonucleotides and their applications have revolutionized
biotechnology. However, the oligonucleotides including both DNA and
RNA each includes only the four natural nucleotides of adenosine
(A), guanosine (G), cytosine (C), thymine (T) for DNA, and the four
natural nucleotides of adenosine (A), guanosine (G), cytosine (C),
and uridine (U) for RNA, and which significantly restricts the
potential functions and applications of the oligonucleotides.
[0005] The ability to sequence-specifically synthesize/amplify
oligonucleotides (DNA or RNA) with polymerases, for example by PCR
or isothermal amplification systems (e.g., transcription with T7
RNA polymerase), has revolutionized biotechnology. In addition to
all of the potential applications in nanotechnology, this has
enabled a diverse range of new technologies such as the in vitro
evolution via SELEX (Systematic Evolution of Ligands by Exponential
Enrichment) of RNA and DNA aptamers and enzymes. See, for example,
Oliphant A R, Brandt C J & Struhl K (1989), Defining the
sequence specificity of DNA-binding proteins by selecting binding
sites from random-sequence oligonucleotides: analysis of yeast GCN4
proteins, Mol. Cell Biol., 9:2944-2949; Tuerk C & Gold L
(1990), Systematic evolution of ligands by exponential enrichment:
RNA ligands to bacteriophage T4 DNA polymerase, Science,
249:505-510; Ellington A D & Szostak J W (1990), In vitro
selection of RNA molecules that bind specific ligands, Nature,
346:818-822.
[0006] Unfortunately, these applications are restricted by the
limited chemical/physical diversity present in the natural genetic
alphabet (the four natural nucleotides A, C, G, and T in DNA, and
the four natural nucleotides A, C, G, and U in RNA). There is
accordingly much interest in techniques that would enable the
enzymatic synthesis/amplification of oligonucleotides
site-specifically labeled with functional groups not present among
the nucleotides of the natural genetic alphabet. Currently, the
options available for site-specific nucleic acid derivatization
include solid-support based chemical synthesis, combined
chemical/enzymatic synthesis, and end-labeling procedures.
End-labeling procedures are limited to the oligonucleotide termini,
and chemical synthesis is limited to short oligonucleotides
(<200 nucleotides for DNA and <70 nucleotides for RNA).
Enzymatic functionalization is dependent upon enzymatic recognition
of the modification of interest and more problematically it is not
site-specific.
SUMMARY
[0007] The compositions and methods described herein are based on
the expansion of the genetic alphabet in vitro, and provide
site-specific incorporation of unnatural nucleotides as described
herein, bearing reactive linkers adapted to react with cargo
reagents comprising groups of complementary reactivity, or linkers
bearing cargos bonded thereto, into any position of any DNA or RNA
sequence, for example, by using standard PCR or isothermal
transcription methodologies.
[0008] In various embodiments, the linkers are attached to a cargo
at the nucleotide triphosphate stage, thus allowing for the direct
production of the desired site-specifically labeled
oligonucleotide, e.g., by automated polynucleotide synthesis
machines such as phosphoroamidite polynucleotide synthesis
machines.
[0009] The linkers, in other embodiments, include a reactive center
(e.g., primary amine, alkyne, thiol, aldehyde, or azide), providing
a reactive linker, allowing for the site-specific modification of
the DNA or RNA oligonucleotide after its synthesis. This can be
accomplished using a cargo reagent comprising a cargo (e.g.,
molecule, liposome, nanoparticle, etc.) and a group of reactivity
complementary to the reactive center of the reactive linker moiety.
In some embodiments, the reactive center of the linker moiety is
protected with a standard protecting group. Reaction of a
nucleobase disclosed herein bearing a reactive linker (after
deprotection, if required), and a cargo reagent incorporating a
cargo and a group of complementary reactivity to the reactive
linker, serves to provide a nucleobase linked to a cargo via a
coupled linker moiety.
[0010] The compositions of this disclosure, in various embodiments,
enable the expansion of the limited repertoire of functionality of
the four natural DNA nucleotides and of the four natural RNA
nucleotides to include virtually any functionality of interest,
site-specifically incorporated into a DNA or RNA oligonucleotide or
into a DNA analog or an RNA analog, such as a PNA or an LNA or the
like. The cargo optionally includes functionality to enable altered
molecular recognition (i.e. for the development of aptamers),
altered reactivity (including for catalysis), and/or probes for
visualization and/or characterization (i.e. for the development of
diagnostics).
[0011] Provided herein, in various embodiments, is a compound
comprising a nucleobase analog of any of the following formulas
.beta.8a or .beta.8b:
##STR00001##
wherein each X is independently carbon or nitrogen; wherein each
R.sub.2 is optional and when present is independently hydrogen,
alkyl, alkenyl, alkynyl, methoxy, methanethiol, methaneseleno,
halogen, cyano, azide group, a reactive linker comprising a
reactive center adapted to bond to a cargo reagent comprising a
cargo and a group of reactivity complementary to the reactive
center, or a coupled linker to which a cargo is bonded; wherein
each Y is independently sulfur, oxygen, selenium, or secondary
amine; wherein each E is independently sulfur, selenium or oxygen;
and wherein the nucleobase analog is not 4TFP or 7TFP or a
linker-derivatization thereof.
[0012] Provided herein, in various embodiments, is a compound
comprising a nucleobase analog of any of the following
formulas:
##STR00002## ##STR00003##
wherein each X is independently carbon or nitrogen; wherein each
R.sub.1 is independently hydrogen, alkyl group, a reactive linker
comprising a reactive center adapted to bond to a cargo reagent
comprising a cargo and a group of reactivity complementary to the
reactive center, or a coupled linker to which a cargo is bonded;
wherein each R.sub.2 is optional and when present, is independently
hydrogen, alkyl, alkenyl, alkynyl, methoxy, methanethiol,
methaneseleno, halogen, cyano, azide group, a reactive linker
comprising a reactive center adapted to bond to a cargo reagent
comprising a cargo and a group of reactivity complementary to the
reactive center, coupled linker to which a cargo is bonded; wherein
each Y is independently sulfur, oxygen, selenium, or secondary
amine; wherein each E is independently sulfur, selenium or oxygen;
and wherein the nucleobase analog is not FIMO, MIMO, FEMO, PrMO,
EMO, MEMO, IMO, MMO2, DMO, NMO, 5FM, 2OMe, TMO, FDMO, VMO, ZMO,
CIMO, TfMO, CNMO, NaM, or QMO.
[0013] Here and throughout, the wavy line indicates a point of
attachment to a ribosyl, deoxyribosyl, or dideoxyribosyl moiety; or
to an analog of a ribosyl, deoxyribosyl, or dideoxyribyl moiety,
such as a locked ribose analog, a peptide group, or the like. In
some embodiments, the ribosyl, deoxyribosyl, or dideoxyribosyl
moiety or analog thereof is in free form, connected to a
mono-phosphate, diphosphate, or triphosphate group; optionally
comprising an .alpha.-thiotriphosphate, .beta.-thiophosphate, or
.gamma.-thiophosphate group; or is included in an RNA or a DNA or
in an RNA analog or a DNA analog.
[0014] In some embodiments, when referring to either a ribosyl
moiety or deoxyribosyl moiety of an unnatural nucleobase provided
herein X, dX or (d)X is used, for example, dTPT3 or (d)TPT3 refers
to the TPT3 nucleobase bonded to any of the options at the position
indicated by the wavy line. Thus, the general appellation of dX
refers to compounds having ribose or deoxyribose analogs bonded
thereto as indicated by the wavy line. When specifically referring
to a ribosyl nucleoside, the prefix "d" is dropped, i.e., TPT3
refers to a ribosyl form. When incorporated into a triphosphate
polymerase substrate, (i.e. TPT3TP, dTPT3TP), the nucleotide, or
linker-derivatized variants, is considered to be incorporated into
an RNA or DNA oligonucleotide using an RNA or DNA polymerase,
respectively.
[0015] In some embodiments, a ribosyl, deoxyribosyl, or
dideoxyribosyl analog of a nucleoside analog provided (e.g.,
.beta.8a, .beta.8b, .alpha.14a, .alpha.14b, .alpha.14c, .alpha.14d,
.alpha.14e, .alpha.14f) comprises a 2' functional group. Examples
of functional groups include, without limitation, methoxy, halogen,
--O-allyl, --O-methoxyethyl, primary amine, --O-dinitrophenol,
--O-dinitrophenyl ether, alkyl, --O-alkyl, thiol,
aminoethoxymethyl, aminopropoxymethyl, aminoethyl, cyanoethyl, and
guanidinoethyl groups. In some embodiments, the ribosyl,
deoxyribosyl, or dideoxyribosyl analog comprises a 4'-thio
substitution (e.g., the oxygen of the sugar moiety is replaced with
a sulfur).
[0016] In some embodiments, an alkyl group of a nucleobase analog
includes, without limitation, a methyl, ethyl, propyl, and
isopropyl group. In some embodiments, a halogen group of a
nucleobase analog includes, without limitation, fluorine, chlorine,
bromine, and iodine.
[0017] In some embodiments, a reactive linker of a nucleobase
analog comprises a functional group including, but not limited to,
alkyl, alkenyl, alkynyl, phenyl, benzyl, halo, hydroxyl, carbonyl,
aldehyde, haloformyl, carbonate ester, carboxylate, carboxyl,
ester, methoxy, hydroperoxy, peroxy, ether, hemiacetal, hemiketal,
acetal, ketal, orthoester, methylenedioxy, orthocasrbonate ester,
carboxamide, primary amine, secondary amine, imide, azide, azo,
cyanate, isocyanate, nitrate, nitrile, isonitrile, nitrosooxy,
nitro, nitroso, pyridyl, sulfhydryl, sulfide, disulfide, sulfinyl,
sulfo, thiocyanate, isothiocyanante, carbonothioyl, phoshino,
phosphono, phosphate, borono, boronate, borino, borinate, and a
combination thereof. In some embodiments, a reactive linker of a
nucleobase analog comprises an amino group, an acetylenic group, a
thiol group, an aldehyde group, or an azide group.
[0018] In some embodiments, a ribosyl or deoxyribosyl moiety
comprises a triphosphate or an .alpha.-thiotriphosphate group
bonded to a 5'-hydroxyl thereof. In some embodiments, a ribosyl or
deoxyribosyl moiety is incorporated into a RNA or DNA
oligonucleotide chain, respectively, or the ribosyl or deoxyribosyl
moiety or analog thereof is incorporated into an RNA or a DNA
analog. The RNA analog or DNA analog, in certain embodiments, is a
peptide nucleic acid (PNA) or a locked nucleic acid (LNA). The RNA
analog or DNA analog, in certain embodiments, is a bicyclic
derivative. Bicyclic derivatives include, without limitation,
2'-O,4'-C-ethylene-bridged nucleic acid (ENA), carbocyclic locked
nucleic acid (CLNA), cyclohexene nucleic acid (CENA), and
2'-deoxy-2'-N,4'-C-ethylene-locked nucleic acid (AENA). In certain
embodiments, the RNA analog or the DNA analog is an acyclic
derivative. In certain embodiments, the RNA analog or the DNA
analog is an unlocked nucleic acid (UNA). In certain embodiments,
the RNA analog or the DNA analog comprises a pyranose ring instead
of a ribose. In certain embodiments, the RNA analog or the DNA
analog is an arabino nucleic acid (ANA) or a hexitol nucleic acid
(HNA).
[0019] In some embodiments, a ribosyl or deoxyribosyl moiety or
analog thereof is substituted with protecting and activating groups
suitable for use in an automated chemical oligonucleotide synthesis
machine. An example of an automated chemical oligonucleotide
synthesis machine is a phosphoroamidite synthesis machine.
[0020] In some embodiments, at least one R2 of a nucleobase analog
independently comprises a --C.ident.C--CH2NHR3 group, wherein R3 is
hydrogen or is an amino-protecting group. An example of an
amino-protecting group is a dichloroacetyl group. In some
embodiments, at least one R2 of a nucleobase analog independently
comprises an acetylenic group suitable for use in a click reaction
with a cargo reagent comprising a cargo and an acetylene-reactive
group. In some embodiments, at least one R2 of a nucleobase analog
independently comprises a thiol group suitable for use in a
reaction with a cargo reagent comprising a cargo and a
thiol-reactive group. In some embodiments, at least one R2 of a
nucleobase analog independently comprises an aldehyde group
suitable for use in a reaction with a cargo reagent comprising a
cargo and an aldehyde-reactive group. In some embodiments, at least
one R2 of a nucleobase analog independently comprises an azide
group suitable for use in a reaction with a cargo reagent
comprising a cargo and an azide-reactive group. In some
embodiments, at least one R2 of a nucleobase analog independently
comprises --C.ident.C--(CH2)n-C.ident.CH, wherein n is 1, 2, 3, 4,
5, or 6; or R.sub.2 is --C.ident.C--(CH2)n1-O--(CH2)n2-C.ident.CH,
wherein n1 and n2 are each independently 1, 2, or 3. In some
embodiments, at least one R2 is independently a coupled linker
bonded to a cargo by reaction of an amino group and an
amino-reactive group. An example of an amino-reactive group is an
acylating group or an alkylating group, or is an
N-hydroxysuccinimide ester. In some embodiments, at least one R2 is
independently a coupled linker bonded to a cargo by reaction of an
acetylene group and an acetylene-reactive group. An example of an
acetylene-reactive group is an azide group. In certain embodiments,
the acetylene group and the azide group are coupled with a
copper-catalyzed click reaction. In some embodiments, at least one
R2 is independently a coupled linker bonded to a cargo by reaction
of a thiol and a thiol-reactive group. In some embodiments, at
least one R2 is independently a coupled linker bonded to a cargo by
reaction of an aldehyde and an aldehyde-reactive group. In some
embodiments, at least one R2 is independently a coupled linker
bonded to a cargo by reaction of an azide and an azide-reactive
group. An example of an azide-reactive group is a terminal alkyne
or a strained cyclooctyne. In some embodiments, at least one R2 is
independently hydrogen, the compound comprising an
.alpha.-thiotriphosphate group, wherein a cargo reagent comprising
a .gamma.-bromo-.alpha.,.beta.-unsaturated carbonyl, iodo,
bromoacetyl, or aziridinylsulfonamide group is coupled thereto.
[0021] In some embodiments, a cargo of a nucleobase analog
includes, without limitation, proteins, peptides, amino acids,
oligonucleotides, small molecule drugs, aliphatic groups, compounds
comprising photoreactive groups, compounds comprising
chemically-reactive groups, compounds comprising catalytic groups,
compounds comprising chloromethylketones, lipids, biotin,
fluorescent compounds, fluorescence quenching compounds, liposomes,
and nanoparticles.
[0022] Further provided herein, in various embodiments, is the
nucleobase analog
##STR00004##
and derivatives and analogs thereof.
[0023] Further provided herein, in various embodiments, is the
nucleobase analog
##STR00005##
and derivatives and analogs thereof.
[0024] Further provided herein, in various embodiments, is the
nucleobase analog
##STR00006##
and derivatives and analogs thereof.
[0025] Further provided herein, in various embodiments, is the
nucleobase analog
##STR00007##
and derivatives and analogs thereof.
[0026] Further provided herein, in various embodiments, is the
nucleobase analog
##STR00008##
and derivatives and analogs thereof.
[0027] Further provided herein, in various embodiments, is the
nucleobase analog
##STR00009##
and derivatives and analogs thereof.
[0028] Further provided herein, in various embodiments, is the
nucleobase analog
##STR00010##
and derivatives and analogs thereof.
[0029] Provided herein, in some embodiments, are nucleobase pairs
comprising a first nucleobase analog having any of the formulas
.beta.9a or .beta.9b; and a second nucleobase analog having any of
the formulas .alpha.15a or .alpha.15b:
##STR00011##
wherein each X is independently carbon or nitrogen; wherein each
R.sub.1 is independently hydrogen, alkyl group, a reactive linker
comprising a reactive center adapted to bond to a cargo reagent
comprising a cargo and a group of reactivity complementary to the
reactive center, or a coupled linker to which a cargo is bonded;
wherein each R.sub.2 is optional and when present is independently
hydrogen, alkyl, alkenyl, alkynyl, methoxy, methanethiol,
methaneseleno, halogen, cyano, azide, nitro group, a reactive
linker comprising a reactive center adapted to bond to a cargo
reagent comprising a cargo and a group of reactivity complementary
to the reactive center, or a coupled linker to which a cargo is
bonded; wherein each Y is independently sulfur, oxygen, selenium,
or secondary amine; wherein each E is independently oxygen, sulfur
or selenium; and wherein the nucleobase pair is not dICS-dMMO2,
dICS-2OMe, dSICS-dMMO2, dSICS-d2OMe, dSNICS-dMMO2, dSNICS-d2OMe,
d4SICS-dMMO2, d4SICS-d2OMe, d5SICS-dFIMO, d5SICS-dMIMO,
d5SICS-dFEMO, d5SICS-dPrMO, d5SICS-dEMO, d5SICS-dMEMO, d5SICS-dIMO,
d5SICS-dMMO2, d5SICS-dDMO, d5SICS-dNMO, d5SICS-d5FM, d5SICS-d2OMe,
d5SICS-dTMO, d5SICS-dFDMO, d5SICS-dVMO, d5SICS-dZMO, d5SICS-dCIMO,
d5SICS-dTfMO, and d5SICS-dCNMO.
[0030] Provided herein, in some embodiments, is a nucleobase pair
comprising a first nucleobase analog having the formula .beta.9b,
and a second nucleobase analog having any of the formulas
.alpha.15a or .alpha.15b:
##STR00012##
wherein each X is independently carbon or nitrogen; wherein each
R.sub.1 is independently hydrogen, alkyl group, a reactive linker
comprising a reactive center adapted to bond to a cargo reagent
comprising a cargo and a group of reactivity complementary to the
reactive center, or a coupled linker to which a cargo is bonded;
wherein each R.sub.2 is optional and when present is independently
hydrogen, alkyl, alkenyl, alkynyl, methoxy, methanethiol,
methaneseleno, halogen, cyano, azide, nitro group, a reactive
linker comprising a reactive center adapted to bond to a cargo
reagent comprising a cargo and a group of reactivity complementary
to the reactive center, or a coupled linker to which a cargo is
bonded; wherein each Y is independently sulfur, oxygen, selenium,
or secondary amine; and wherein each E is independently oxygen,
sulfur or selenium.
[0031] Provided herein, in some embodiments, is a nucleobase pair
comprising a first nucleobase analog having any of the formulas
.beta.9a or .beta.9b, and a second nucleobase analog having any of
the formulas .alpha.16a or .alpha.16b:
##STR00013##
wherein each X is independently carbon or nitrogen; wherein each
R.sub.1 is independently hydrogen, alkyl group, a reactive linker
comprising a reactive center adapted to bond to a cargo reagent
comprising a cargo and a group of reactivity complementary to the
reactive center, or a coupled linker to which a cargo is bonded;
wherein each R.sub.2 is optional and when present is independently
hydrogen, alkyl, alkenyl, alkynyl, methoxy, methanethiol,
methaneseleno, halogen, cyano, azide, nitro group, a reactive
linker comprising a reactive center adapted to bond to a cargo
reagent comprising a cargo and a group of reactivity complementary
to the reactive center, or a coupled linker to which a cargo is
bonded; wherein each Y is independently sulfur, oxygen, selenium,
or secondary amine; wherein each E is independently oxygen, sulfur
or selenium; and wherein each E.sub.2 is independently sulfur or
selenium.
[0032] The wavy line indicates a point of attachment to a ribosyl,
deoxyribosyl, or dideoxyribosyl moiety; or to an analog of a
ribosyl, deoxyribosyl, or dideoxyribyl moiety, such as a locked
ribose analog, a peptide group, or the like. In some embodiments,
the ribosyl, deoxyribosyl, or dideoxyribosyl moiety or analog
thereof is in free form, connected to a mono-phosphate,
diphosphate, or triphosphate group; optionally comprising an
.alpha.-thiotriphosphate, .beta.-thiophosphate, or
.gamma.-thiophosphate group; or is included in an RNA or a DNA or
in an RNA analog or a DNA analog.
[0033] In some embodiments, an alkynyl group is an ethynyl or a
propynyl group. In some embodiments, an alkyl group is a methyl,
ethyl, propyl, or isopropyl group. In some embodiments, a halogen
is fluorine, chlorine, bromine, or iodine.
[0034] In some embodiments, a ribosyl, deoxyribosyl, or
dideoxyribosyl analog of the nucleobase pair comprises a 2'
functional group. Exemplary functional groups include, without
limitation, methoxy, halogen, --O-allyl, --O-methoxyethyl, primary
amine, alkyl, --O-alkyl, thiol, --O-dinitrophenol,
--O-dinitrophenyl ether, aminoethoxymethyl, aminopropoxymethyl,
aminoethyl, cyanoethyl, and guanidinoethyl groups. In some
embodiments, a ribosyl, deoxyribosyl, or dideoxyribosyl analog of
the nucleobase pair comprises a 4'-thio substitution.
[0035] In some embodiments, a nucleobase pair comprises a
nucleobase having the formula .alpha.15b. In some embodiments, a
nucleobase pair comprises a nucleobase having the formula
.alpha.15a.
[0036] In some embodiments, a nucleobase pair comprises a
nucleobase having the formula .beta.9b. In some embodiments, a
nucleobase pair comprises a nucleobase having the formula .beta.9b,
wherein each X is carbon, Y is sulfur, each R.sub.2 is hydrogen,
and E is sulfur. In some embodiments, a nucleobase pair comprises a
nucleobase having the formula .alpha.15b, wherein each X is carbon,
each R.sub.2 is hydrogen, R.sub.1 is a methyl group, and E is
oxygen. In some embodiments, a nucleobase pair comprises a first
nucleobase analog having the formula .beta.9a and a second
nucleobase analog having the formula .alpha.16a. In some
embodiments, a nucleobase pair comprises a first nucleobase analog
having the formula .beta.9a and a second nucleobase analog having
the formula .alpha.16b. In some embodiments, a nucleobase pair
comprises a first nucleobase analog having the formula .beta.9b and
a second nucleobase analog having the formula .alpha.16a. In some
embodiments, a nucleobase pair comprises a first nucleobase analog
having the formula .beta.9b and a second nucleobase analog having
the formula .alpha.16b.
[0037] Provided herein, in certain embodiments, is a nucleobase
pair comprising a first nucleobase analog having the formula
.beta.9b and a second nucleobase analog having the formula
.beta.9b:
##STR00014##
[0038] wherein each X is independently carbon or nitrogen; wherein
each R.sub.2 is optional and when present is independently
hydrogen, alkyl, alkenyl, alkynyl, methoxy, methanethiol,
methaneseleno, halogen, cyano, azide, nitro group, a reactive
linker comprising a reactive center adapted to bond to a cargo
reagent comprising a cargo and a group of reactivity complementary
to the reactive center, or a coupled linker to which a cargo is
bonded; wherein each Y is independently sulfur, oxygen, selenium,
or secondary amine; and wherein each E is independently oxygen,
sulfur or selenium. In some embodiments, the nucleobase pair is a
homo-nucleobase pair.
[0039] Provided herein, in certain embodiments, is a nucleobase
pair comprising a first nucleobase analog having the formula
.alpha.16a and a second nucleobase analog having the formula
.alpha.16a:
##STR00015##
wherein each X is independently carbon or nitrogen; wherein each
R.sub.1 is independently hydrogen, alkyl group, a reactive linker
comprising a reactive center adapted to bond to a cargo reagent
comprising a cargo and a group of reactivity complementary to the
reactive center, or a coupled linker to which a cargo is bonded;
wherein each R.sub.2 is optional and when present is independently
hydrogen, alkyl, alkenyl, alkynyl, methoxy, methanethiol,
methaneseleno, halogen, cyano, azide, nitro group, a reactive
linker comprising a reactive center adapted to bond to a cargo
reagent comprising a cargo and a group of reactivity complementary
to the reactive center, or a coupled linker to which a cargo is
bonded; and wherein each E.sub.2 is independently sulfur or
selenium. In some embodiments, the nucleobase pair is a
homo-nucleobase pair.
[0040] Provided herein, in certain embodiments, is a nucleobase
pair comprising a first nucleobase analog having the formula
.alpha.16b and a second nucleobase analog having the formula
.alpha.16b:
##STR00016##
wherein each X is independently carbon or nitrogen; wherein each
R.sub.1 is independently hydrogen, alkyl group, a reactive linker
comprising a reactive center adapted to bond to a cargo reagent
comprising a cargo and a group of reactivity complementary to the
reactive center, or a coupled linker to which a cargo is bonded;
wherein each R.sub.2 is optional and when present is independently
hydrogen, alkyl, alkenyl, alkynyl, methoxy, methanethiol,
methaneseleno, halogen, cyano, azide, nitro group, a reactive
linker comprising a reactive center adapted to bond to a cargo
reagent comprising a cargo and a group of reactivity complementary
to the reactive center, or a coupled linker to which a cargo is
bonded; and wherein each E.sub.2 is independently sulfur or
selenium. In some embodiments, the nucleobase pair is a
homo-nucleobase pair.
[0041] Provided herein, in certain embodiments, is a nucleobase
pair comprising a first nucleobase analog having any of the
formulas .beta.9a, .beta.9b, .alpha.15a, .alpha.15b, .alpha.16a, or
.alpha.16b; and a second nucleobase selected from the group
consisting of cytosine, guanine, adenine, thymine, uracil,
2-aminoadenin-9-yl, 2-aminoadenine, 2-F-adenine, 2-thiouracil,
2-thio-thymine, 2-thiocytosine, 2-propyl and alkyl derivatives of
adenine and guanine, 2-amino-adenine, 2-amino-propyl-adenine,
2-aminopyridine, 2-pyridone, 2'-deoxyuridine,
2-amino-2'-deoxyadenosine 3-deazaguanine, 3-deazaadenine,
4-thio-uracil, 4-thio-thymine, uracil-5-yl, hypoxanthin-9-yl (I),
5-methyl-cytosine, 5-hydroxymethyl cytosine, xanthine,
hypoxanthine, 5-bromo, and 5-trifiuoromethyl uracils and cytosines;
5-halouracil, 5-halocytosine, 5-propynyl-uracil, 5-propynyl
cytosine, 5-uracil, 5-substituted, 5-halo, 5-substituted
pyrimidines, 5-hydroxycytosine, 5-bromocytosine, 5-bromouracil,
5-chlorocytosine, chlorinated cytosine, cyclocytosine, cytosine
arabinoside, 5-fluorocytosine, fluoropyrimidine, fluorouracil,
5,6-dihydrocytosine, 5-iodocytosine, hydroxyurea, iodouracil,
5-nitrocytosine, 5-bromouracil, 5-chlorouracil, 5-fluorouracil, and
5-iodouracil, 6-alkyl derivatives of adenine and guanine,
6-azapyrimidines, 6-azo-uracil, 6-azo cytosine, azacytosine,
6-azo-thymine, 6-thio-guanine, 7-methylguanine, 7-methyladenine,
7-deazaguanine, 7-deazaguanosine, 7-deaza-adenine,
7-deaza-8-azaguanine, 8-azaguanine, 8-azaadenine, 8-halo, 8-amino,
8-thiol, 8-thioalkyl, and 8-hydroxyl substituted adenines and
guanines; N4-ethylcytosine, N-2 substituted purines, N-6
substituted purines, O-6 substituted purines, those that increase
the stability of duplex formation, universal nucleic acids,
hydrophobic nucleic acids, promiscuous nucleic acids, size-expanded
nucleic acids, fluorinated nucleic acids, tricyclic pyrimidines,
phenoxazine cytidine([5,4-b][1,4]benzoxazin-2(3H)-one),
phenothiazine cytidine
(1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps,
phenoxazine cytidine
(9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole
cytidine (H-pyrido [3',2':4,5]pyrrolo [2,3-d]pyrimidin-2-one),
5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil,
hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)
uracil, 5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methythio-N6-isopentenyladeninje,
uracil-5oxyacetic acid, wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxacetic acid methylester,
uracil-5-oxacetic acid, 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine and those in which the purine or pyrimidine base
is replaced with a heterocycle.
[0042] A base pair comprising one or more unnatural nucleobases is
exemplified by the dTPT3PA-dNaM unnatural base pair (i.e. the pair
formed between dTPT3PA and dNaM; FIGS. 1A and 1B). In addition, the
orthogonal reactivity of the different reactive centers/linkers
developed (i.e. phosphorothioates, amines, and alkynes) allows for
the selective arraying of different moieties to the same
oligonucleotide (DNA or RNA). Another composition is further
exemplified by the dTPT3PA-dMMO2pCO unnatural base pair, wherein,
in various embodiments, the alkynyl group of dMMO2pCO is used to
attach one functional group via Copper(I)-catalyzed Azide-Alkyne
Cycloaddition (CuAAC) and, after deprotection of dTPT3PA, the free
amine is used to attach a different functional group via
N-hydroxysuccinimide (NHS) coupling.
[0043] While several other unnatural base pairs have been reported
and derivatized with linkers, the linker-derivatized pairs
described here, dTPT3PA-dNaM, d5SICSCO-dNaM, dTPT3PA-dMMO2pCO (FIG.
2), are both more validated and are better replicated within DNA
and better transcribed into RNA. In particular, dTPT3PA-dNaM, is
well replicated and thus is suitable for use in practicing the
methods disclosed and claimed herein.
[0044] Provided herein are unnatural base pairs comprising dTPT3,
wherein dTPT3 in some instances, is linker-derivatized. Unnatural
base pairs comprising dTPT3 or linker-derivatized dTPT3 (e.g.,
dTPT3PA) include, without limitation, dTPT3-MMS, dTPT3-DMS,
dTPT3-FEMS, dTPT3-BrMS, dTPT3-IMS, dTPT3-dDMN, dTPT3-d4OMe,
dTPT3-dIQ, dTPT3-d2MN, dTPT3-d3OMe, dTPT3-dQL, dTPT3-d2Np,
dTPT3-dDM4, dTPT3-dDM, dTPT3-dBEN, dTPT3-d3FB, dTPT3-dMM1,
dTPT3-dMMO1, dTPT3-dDM2, dTPT3-dDM5, dTPT3-d2Py, dTPT3-d5MPy,
dTPT3-dEPy, dTPT3-d3MPy, dTPT3-d34DMPy, dTPT3-d45DMPy, dTPT3-d4MPy,
dTPT3-d35DMPy, dTPT3-dBP, dTPT3-dBTp, dTPT3-dBF, dTPT3-dIN,
dTPT3-dTp, dTPT3-dBTz, dTPT3-dMTp, dTPT3-dAM, dTPT3-dMAN,
dTPT3-dDMMAN, dTPT3-dADM, dTPT3-dMMAN, dTPT3-dTOK588,
dTPT3-dTOK576, dTPT3-dTOK587, dTPT3-dTOK586, dTPT3-dTOK580,
dTPT3-dPhMO, dTPT3-dPyMO1, dTPT3-PyMO2, dTPT3-dPMO1, dTPT3-dPMO2,
dTPT3-dPMO3, dTPT3-dFuMO1, dTPT3-dFuMO2, dTPT3-TpMO1, dTPT3-dTpMO2,
dTPT3-dFIMO, dTPT3-dIMO, dTPT3-dMIMO, dTPT3-dMEMO, dTPT3-dFEMO,
dTPT3-dPrMO, dTPT3-dMMO2, dTPT3-d2OMe, dTPT3-dDMO, dTPT3-dTMO,
dTPT3-dNMO, dTPT3-dNOPy, dTPT3-d5FM, dTPT3-dNAM, dTPT3-dAMO1,
dTPT3-dAPy, dTPT3-dAMO2, dTPT3-dMAPy, dTPT3-dAMO3, dTPT3-dDMAPy,
dTPT3-dFDMO, dTPT3-dVMO, dTPT3-dQMO, dTPT3-dZMO, dTPT3-dCIMO,
dTPT3-dTfMO, and dTPT3-CNMO, wherein the dTPT3 complementary base
is or is not linker-derivatized (e.g. dMMO2pCO). dTPT3 is
illustrated in FIG. 9 as a .beta.6 analog. An example of a
linker-derivatized dTPT3 is illustrated in FIG. 2, wherein in some
instances, R is a reactive linker comprising a reactive center
adapted to bond to a cargo reagent or R is a coupled linker to
which a cargo is bonded. Nucleobase analogs which are complementary
to dTPT3, include, without limitation, .alpha. analogs or
linker-derivatized .alpha. analogs illustrated in FIGS. 8, 10, 11
and 15. In some embodiments, dTPT3 or a linker-derivatized dTPT3 is
base paired with dTPT3 or a linker-derivatized dTPT3, to form a
homo-nucleobase pair. In some embodiments, dTPT3 or a
linker-derivatized dTPT3 is base paired with a .beta. nucleobase,
including but not limited to, any nucleobase illustrated in FIGS.
9, 12, and 13, or a derivatized nucleobase thereof. In some
embodiments, a linker moiety is protected with a protecting group,
e.g., dTPT3PA. In some embodiments, a linker moiety is not
protected with a protecting group, e.g. dTPT3A, wherein in some
instances, a protecting group was removed.
[0045] Provided herein are unnatural base pairs comprising dMMS,
wherein dMMS in some instances, is linker-derivatized. Unnatural
base pairs comprising dMMS or linker-derivatized dMMS (e.g.,
dMMSPA) include, without limitation, d7AI-dMMS, dM7AI-dMMS,
dImPy-dMMS, dP7AI-dMMS, dPPP-dMMS, d8Q-dMMS, dICS-dMMS, dPICS-dMMS,
dMICS-dMMS, d4MICS-dMMS, d5MICS-dMMS, dNICS-dMMS, dONICS-dMMS,
d7OFP-dMMS, d7OTP-dMMS, d4OTP-dMMS, dPYR-dMMS, d4MP-dMMS,
d3MP-dMMS, dPPYR-dMMS, dMOP-dMMS, d4MOP-dMMS, dSICS-dMMS,
dSNICS-dMMS, d5SICS-dMMS, d4SICS-dMMS, dTPT1-dMMS, dTPT2-dMMS,
dFPT1-dMMS, and dFTPT3-dMMS, wherein the dMMS complementary base is
or is not linker-derivatized (e.g. pFTPT3 pA). dMMS is illustrated
in FIG. 11 as an .alpha.14.alpha. analog. In some embodiments, a
linker-derivatized dMMS comprises a functional group R, wherein R
is a reactive linker comprising a reactive center adapted to bond
to a cargo reagent or R is a coupled linker to which a cargo is
bonded. Nucleobase analogs which are complementary to dMMS,
include, without limitation, .beta. analogs or linker-derivatized
.beta. analogs illustrated in FIGS. 9, 12, and 13. In some
embodiments, dMMS or a linker-derivatized dMMS is base paired with
dMMS or a linker-derivatized dMMS, to form a homo-nucleobase pair.
In some embodiments, dMMS or a linker-derivatized dMMS is base
paired with an .alpha. nucleobase, including but not limited to,
any nucleobase illustrated in FIGS. 8, 10, 11, and 15, or a
derivatized nucleobase thereof. In some embodiments, a linker
moiety is protected with a protecting group. In some embodiments, a
linker moiety is not protected with a protecting group, wherein in
some instances, a protecting group was removed.
[0046] Provided herein are unnatural base pairs comprising dDMS,
wherein dDMS in some instances, is linker-derivatized. Unnatural
base pairs comprising dDMS or linker-derivatized dDMS (e.g.,
dDMSPA) include, without limitation, d7AI-dDMS, dM7AI-dDMS,
dImPy-dDMS, dP7AI-dDMS, dPPP-dDMS, d8Q-dDMS, dICS-dDMS, dPICS-dDMS,
dMICS-dDMS, d4MICS-dDMS, d5MICS-dDMS, dNICS-dDMS, dONICS-dDMS,
d7OFP-dDMS, d7OTP-dDMS, d4OTP-dDMS, dPYR-dDMS, d4MP-dDMS,
d3MP-dDMS, dPPYR-dDMS, dMOP-dDMS, d4MOP-dDMS, dSICS-dDMS,
dSNICS-dDMS, d5SICS-dDMS, d4SICS-dDMS, dTPT1-dDMS, dTPT2-dDMS,
dFPT1-dDMS, dFTPT3-dDMS, wherein the dDMS complementary base is or
is not linker-derivatized (e.g. pFTPT3 pA). dDMS is illustrated in
FIG. 11 as an .alpha.14.alpha. analog. In some embodiments, a
linker-derivatized dDMS comprises a functional group R, wherein R
is a reactive linker comprising a reactive center adapted to bond
to a cargo reagent or R is a coupled linker to which a cargo is
bonded. Nucleobase analogs which are complementary to dDMS,
include, without limitation, .beta. analogs or linker-derivatized
.beta. analogs illustrated in FIGS. 9, 12, and 13. In some
embodiments, dDMS or a linker-derivatized dDMS is base paired with
dDMS or a linker-derivatized dDMS, to form a homo-nucleobase pair.
In some embodiments, dMMS or a linker-derivatized dMMS is base
paired with an .alpha. nucleobase, including but not limited to,
any nucleobase illustrated in FIGS. 8, 10, 11, and 15, or a
derivatized nucleobase thereof. In some embodiments, a linker
moiety is protected with a protecting group. In some embodiments, a
linker moiety is not protected with a protecting group, wherein in
some instances, a protecting group was removed.
[0047] Provided herein are unnatural base pairs comprising dFEMS,
wherein dFEMS in some instances, is linker-derivatized. Unnatural
base pairs comprising dFEMS or linker-derivatized dFEMS (e.g.,
dFEMSPA) include, without limitation, d7AI-dFEMS, dM7AI-dFEMS,
dImPy-dFEMS, dP7AI-dFEMS, dPPP-dFEMS, d8Q-dFEMS, dICS-dFEMS,
dPICS-dFEMS, dMICS-dFEMS, d4MICS-dFEMS, d5MICS-dFEMS, dNICS-dFEMS,
dONICS-dFEMS, d7OFP-dFEMS, d7OTP-dFEMS, d4OTP-dFEMS, dPYR-dFEMS,
d4MP-dFEMS, d3MP-dFEMS, dPPYR-dFEMS, dMOP-dFEMS, d4MOP-dFEMS,
dSICS-dFEMS, dSNICS-dFEMS, d5SICS-dFEMS, d4SICS-dFEMS, dTPT1-dFEMS,
dTPT2-dFEMS, dFPT1-dFEMS, dFTPT3-dFEMS, wherein the dFEMS
complementary base is or is not linker-derivatized (e.g. pFTPT3
pA). dFEMS is illustrated in FIG. 11 as an .alpha.14.alpha. analog.
In some embodiments, a linker-derivatized dFEMS comprises a
functional group R, wherein R is a reactive linker comprising a
reactive center adapted to bond to a cargo reagent or R is a
coupled linker to which a cargo is bonded. Nucleobase analogs which
are complementary to dFEMS, include, without limitation, .beta.
analogs or linker-derivatized .beta. analogs illustrated in FIGS.
9, 12, and 13. In some embodiments, dFEMS or a linker-derivatized
dFEMS is base paired with dFEMS or a linker-derivatized dFEMS, to
form a homo-nucleobase pair. In some embodiments, dFEMS or a
linker-derivatized dFEMS is base paired with an .alpha. nucleobase,
including but not limited to, any nucleobase illustrated in FIGS.
8, 10, 11, and 15, or a derivatized nucleobase thereof. In some
embodiments, a linker moiety is protected with a protecting group.
In some embodiments, a linker moiety is not protected with a
protecting group, wherein in some instances, a protecting group was
removed.
[0048] Provided herein are unnatural base pairs comprising dBrMS,
wherein dBrMS in some instances, is linker-derivatized. Unnatural
base pairs comprising dBrMS or linker-derivatized dBrMS (e.g.,
dBrMSPA) include, without limitation, d7AI-dBrMS, dM7AI-dBrMS,
dImPy-dBrMS, dP7AI-dBrMS, dPPP-dBrMS, d8Q-dBrMS, dICS-dBrMS,
dPICS-dBrMS, dMICS-dBrMS, d4MICS-dBrMS, d5MICS-dBrMS, dNICS-dBrMS,
dONICS-dBrMS, d7OFP-dBrMS, d7OTP-dBrMS, d4OTP-dBrMS, dPYR-dBrMS,
d4MP-dBrMS, d3MP-dBrMS, dPPYR-dBrMS, dMOP-dBrMS, d4MOP-dBrMS,
dSICS-dBrMS, dSNICS-dBrMS, d5SICS-dBrMS, d4SICS-dBrMS, dTPT1-dBrMS,
dTPT2-dBrMS, dFPT1-dBrMS, dFTPT3-dBrMS, wherein the dBrMS
complementary base is or is not linker-derivatized (e.g. pFTPT3
pA). dBrMS is illustrated in FIG. 11 as an .alpha.14.alpha. analog.
In some embodiments, a linker-derivatized dBrMS comprises a
functional group R, wherein R is a reactive linker comprising a
reactive center adapted to bond to a cargo reagent or R is a
coupled linker to which a cargo is bonded. Nucleobase analogs which
are complementary to dBrMS, include, without limitation, .beta.
analogs or linker-derivatized .beta. analogs illustrated in FIGS.
9, 12, and 13. In some embodiments, dBrMS or a linker-derivatized
dBrMS is base paired with dBrMS or a linker-derivatized dBrMS, to
form a homo-nucleobase pair. In some embodiments, dBrMS or a
linker-derivatized dBrMS is base paired with an .alpha. nucleobase,
including but not limited to, any nucleobase illustrated in FIGS.
8, 10, 11, and 15, or a derivatized nucleobase thereof. In some
embodiments, a linker moiety is protected with a protecting group.
In some embodiments, a linker moiety is not protected with a
protecting group, wherein in some instances, a protecting group was
removed.
[0049] Provided herein are unnatural base pairs comprising dIMS,
wherein dIMS in some instances, is linker-derivatized. Unnatural
base pairs comprising dIMS or linker-derivatized dIMS (e.g.,
dIMSPA) include, without limitation, d7AI-dIMS, dM7AI-dIMS,
dImPy-dIMS, dP7AI-dIMS, dPPP-dIMS, d8Q-dIMS, dICS-dIMS, dPICS-dIMS,
dMICS-dIMS, d4MICS-dIMS, d5MICS-dIMS, dNICS-dIMS, dONICS-dIMS,
d7OFP-dIMS, d7OTP-dIMS, d4OTP-dIMS, dPYR-dIMS, d4MP-dIMS,
d3MP-dIMS, dPPYR-dIMS, dMOP-dIMS, d4MOP-dIMS, dSICS-dIMS,
dSNICS-dIMS, d5SICS-dIMS, d4SICS-dIMS, dTPT1-dIMS, dTPT2-dIMS,
dFPT1-dIMS, dFTPT3-dIMS, wherein the dIMS complementary base is or
is not linker-derivatized (e.g. pFTPT3 pA). dIMS is illustrated in
FIG. 11 as an .alpha.14.alpha. analog. In some embodiments, a
linker-derivatized dIMS comprises a functional group R, wherein R
is a reactive linker comprising a reactive center adapted to bond
to a cargo reagent or R is a coupled linker to which a cargo is
bonded. Nucleobase analogs which are complementary to dIMS,
include, without limitation, .beta. analogs or linker-derivatized
.beta. analogs illustrated in FIGS. 9, 12, and 13. In some
embodiments, dIMS or a linker-derivatized dIMS is base paired with
dIMS or a linker-derivatized dIMS, to form a homo-nucleobase pair.
In some embodiments, dIMS or a linker-derivatized dIMS is base
paired with an .alpha. nucleobase, including but not limited to,
any nucleobase illustrated in FIGS. 8, 10, 11, and 15, or a
derivatized nucleobase thereof. In some embodiments, a linker
moiety is protected with a protecting group. In some embodiments, a
linker moiety is not protected with a protecting group, wherein in
some instances, a protecting group was removed.
[0050] Provided herein are unnatural base pairs comprising dICS,
wherein dICS in some instances, is linker-derivatized. Unnatural
base pairs comprising dICS or linker-derivatized dICS (e.g.,
dICSPA) include, without limitation, dICS-dFIMO, dICS-dMIMO,
dICS-dFEMO, dICS-dPrMO, dICS-dEMO, dICS-dMEMO, dICS-dIMO,
dICS-dDMO, dICS-dNMO, dICS-d5FM, dICS-dTMO, dICS-dFDMO, dICS-dVMO,
dICS-dZMO, dICS-dCIMO, dICS-dTfMO, dICS-dCNMO, dICS-dNAM,
dICS-dQMO, wherein the dICS complementary base is or is not
linker-derivatized (e.g. dDMOpCO, dDMOpCC). dICS is illustrated in
FIG. 9 as a .beta.2 analog. In some embodiments, a
linker-derivatized dICS comprises a functional group R, wherein R
is a reactive linker comprising a reactive center adapted to bond
to a cargo reagent or R is a coupled linker to which a cargo is
bonded. Nucleobase analogs which are complementary to dICS,
include, without limitation, .alpha. analogs or linker-derivatized
.alpha. analogs illustrated in FIGS. 8, 10, 11, and 15. In some
embodiments, dICS or a linker-derivatized dICS is base paired with
dICS or a linker-derivatized dICS, to form a homo-nucleobase pair.
In some embodiments, dICS or a linker-derivatized dICS is base
paired with a .beta. nucleobase, including but not limited to, any
nucleobase illustrated in FIGS. 9, 12, and 13, or a derivatized
nucleobase thereof. In some embodiments, a linker moiety is
protected with a protecting group. In some embodiments, a linker
moiety is not protected with a protecting group, wherein in some
instances, a protecting group was removed.
[0051] Provided herein are unnatural base pairs comprising dPICS,
wherein dPICS in some instances, is linker-derivatized. Unnatural
base pairs comprising dPICS or linker-derivatized dPICS (e.g.,
dPICSPA) include, without limitation, dPICS-dFIMO, dPICS-dMIMO,
dPICS-dFEMO, dPICS-dPrMO, dPICS-dEMO, dPICS-dMEMO, dPICS-dIMO,
dPICS-dMMO2, dPICS-dDMO, dPICS-dNMO, dPICS-d5FM, dPICS-d2OMe,
dPICS-dTMO, dPICS-dFDMO, dPICS-dVMO, dPICS-dZMO, dPICS-dCIMO,
dPICS-dTfMO, dPICS-dCNMO, dPICS-dNAM, dPICS-dQMO, wherein the dPICS
complementary base is or is not linker-derivatized (e.g. dDMOpCO,
dDMOpCC). dPICS is illustrated in FIG. 9 as a .beta.2 analog. In
some embodiments, a linker-derivatized dPICS comprises a functional
group R, wherein R is a reactive linker comprising a reactive
center adapted to bond to a cargo reagent or R is a coupled linker
to which a cargo is bonded. Nucleobase analogs which are
complementary to dPICS, include, without limitation, .alpha.
analogs or linker-derivatized .alpha. analogs illustrated in FIGS.
8, 10, 11, and 15. In some embodiments, dPICS or a
linker-derivatized dPICS is base paired with dPICS or a
linker-derivatized dPICS, to form a homo-nucleobase pair. In some
embodiments, dPICS or a linker-derivatized dPICS is base paired
with a .beta. nucleobase, including but not limited to, any
nucleobase illustrated in FIGS. 9, 12, and 13, or a derivatized
nucleobase thereof. In some embodiments, a linker moiety is
protected with a protecting group. In some embodiments, a linker
moiety is not protected with a protecting group, wherein in some
instances, a protecting group was removed.
[0052] Provided herein are unnatural base pairs comprising dMICS,
wherein dMICS in some instances, is linker-derivatized. Unnatural
base pairs comprising dMICS or linker-derivatized dMICS (e.g.,
dMICSPA) include, without limitation, dMICS-dFIMO, dMICS-dMIMO,
dMICS-dFEMO, dMICS-dPrMO, dMICS-dEMO, dMICS-dMEMO, dMICS-dIMO,
dMICS-dMMO2, dMICS-dDMO, dMICS-dNMO, dMICS-d5FM, dMICS-d2OMe,
dMICS-dTMO, dMICS-dFDMO, dMICS-dVMO, dMICS-dZMO, dMICS-dCIMO,
dMICS-dTfMO, dMICS-dCNMO, dMICS-dNAM, dMICS-dQMO, wherein the dMICS
complementary base is or is not linker-derivatized (e.g. dDMOpCO,
dDMOpCC). dMICS is illustrated in FIG. 9 as a .beta.2 analog. In
some embodiments, a linker-derivatized dMICS comprises a functional
group R, wherein R is a reactive linker comprising a reactive
center adapted to bond to a cargo reagent or R is a coupled linker
to which a cargo is bonded. Nucleobase analogs which are
complementary to dMICS, include, without limitation, .alpha.
analogs or linker-derivatized .alpha. analogs illustrated in FIGS.
8, 10, 11, and 15. In some embodiments, dMICS or a
linker-derivatized dMICS is base paired with dMICS or a
linker-derivatized dMICS, to form a homo-nucleobase pair. In some
embodiments, dMICS or a linker-derivatized dMICS is base paired
with a .beta. nucleobase, including but not limited to, any
nucleobase illustrated in FIGS. 9, 12, and 13, or a derivatized
nucleobase thereof. In some embodiments, a linker moiety is
protected with a protecting group. In some embodiments, a linker
moiety is not protected with a protecting group, wherein in some
instances, a protecting group was removed.
[0053] Provided herein are unnatural base pairs comprising d4MICS,
wherein d4MICS in some instances, is linker-derivatized. Unnatural
base pairs comprising d4MICS or linker-derivatized d4MICS (e.g.,
d4MICSPA) include, without limitation, d4MICS-dFIMO, d4MICS-dMIMO,
d4MICS-dFEMO, d4MICS-dPrMO, d4MICS-dEMO, d4MICS-dMEMO, d4MICS-dIMO,
d4MICS-dMMO2, d4MICS-dDMO, d4MICS-dNMO, d4MICS-d5FM, d4MICS-d2OMe,
d4MICS-dTMO, d4MICS-dFDMO, d4MICS-dVMO, d4MICS-dZMO, d4MICS-dCIMO,
d4MICS-dTfMO, d4MICS-dCNMO, d4MICS-dNAM, d4MICS-dQMO, wherein the
d4MICS complementary base is or is not linker-derivatized (e.g.
dDMOpCO, dDMOpCC). d4MICS is illustrated in FIG. 9 as a .beta.2
analog. In some embodiments, a linker-derivatized d4MICS comprises
a functional group R, wherein R is a reactive linker comprising a
reactive center adapted to bond to a cargo reagent or R is a
coupled linker to which a cargo is bonded. Nucleobase analogs which
are complementary to d4MICS, include, without limitation, .alpha.
analogs or linker-derivatized .alpha. analogs illustrated in FIGS.
8, 10, 11, and 15. In some embodiments, d4MICS or a
linker-derivatized d4MICS is base paired with d4MICS or a
linker-derivatized d4MICS, to form a homo-nucleobase pair. In some
embodiments, d4MICS or a linker-derivatized d4MICS is base paired
with a .beta. nucleobase, including but not limited to, any
nucleobase illustrated in FIGS. 9, 12, and 13, or a derivatized
nucleobase thereof. In some embodiments, a linker moiety is
protected with a protecting group. In some embodiments, a linker
moiety is not protected with a protecting group, wherein in some
instances, a protecting group was removed.
[0054] Provided herein are unnatural base pairs comprising d5MICS,
wherein d5MICS in some instances, is linker-derivatized. Unnatural
base pairs comprising d5MICS or linker-derivatized d5MICS (e.g.,
d5MICSPA) include, without limitation, d5MICS-dFIMO, d5MICS-dMIMO,
d5MICS-dFEMO, d5MICS-dPrMO, d5MICS-dEMO, d5MICS-dMEMO, d5MICS-dIMO,
d5MICS-dMMO2, d5MICS-dDMO, d5MICS-dNMO, d5MICS-d5FM, d5MICS-d2OMe,
d5MICS-dTMO, d5MICS-dFDMO, d5MICS-dVMO, d5MICS-dZMO, d5MICS-dCIMO,
d5MICS-dTfMO, d5MICS-dCNMO, d5MICS-dNAM, d5MICS-dQMO, wherein the
d5MICS complementary base is or is not linker-derivatized (e.g.
dDMOpCO, dDMOpCC). d5MICS is illustrated in FIG. 9 as a .beta.2
analog. In some embodiments, a linker-derivatized d5MICS comprises
a functional group R, wherein R is a reactive linker comprising a
reactive center adapted to bond to a cargo reagent or R is a
coupled linker to which a cargo is bonded. Nucleobase analogs which
are complementary to d5MICS, include, without limitation, .alpha.
analogs or linker-derivatized .alpha. analogs illustrated in FIGS.
8, 10, 11, and 15. In some embodiments, d5MICS or a
linker-derivatized d5MICS is base paired with d5MICS or a
linker-derivatized d5MICS, to form a homo-nucleobase pair. In some
embodiments, d5MICS or a linker-derivatized d5MICS is base paired
with a .beta. nucleobase, including but not limited to, any
nucleobase illustrated in FIGS. 9, 12, and 13, or a derivatized
nucleobase thereof. In some embodiments, a linker moiety is
protected with a protecting group. In some embodiments, a linker
moiety is not protected with a protecting group, wherein in some
instances, a protecting group was removed.
[0055] Provided herein are unnatural base pairs comprising dNICS,
wherein dNICS in some instances, is linker-derivatized. Unnatural
base pairs comprising dNICS or linker-derivatized dNICS (e.g.,
dNICSPA) include, without limitation, dNICS-dFIMO, dNICS-dMIMO,
dNICS-dFEMO, dNICS-dPrMO, dNICS-dEMO, dNICS-dMEMO, dNICS-dIMO,
dNICS-dDMO, dNICS-dNMO, dNICS-d5FM, dNICS-dTMO, dNICS-dFDMO,
dNICS-dVMO, dNICS-dZMO, dNICS-dCIMO, dNICS-MMO2, dNICS-2OMe,
dNICS-dTfMO, dNICS-dCNMO, dNICS-dNAM, dNICS-dQMO, wherein the dNICS
complementary base is or is not linker-derivatized (e.g. dDMOpCO,
dDMOpCC). dNICS is illustrated in FIG. 9 as a .beta.3 analog. In
some embodiments, a linker-derivatized dNICS comprises a functional
group R, wherein R is a reactive linker comprising a reactive
center adapted to bond to a cargo reagent or R is a coupled linker
to which a cargo is bonded. Nucleobase analogs which are
complementary to dNICS, include, without limitation, .alpha.
analogs or linker-derivatized .alpha. analogs illustrated in FIGS.
8, 10, 11, and 15. In some embodiments, dNICS or a
linker-derivatized dNICS is base paired with dNICS or a
linker-derivatized dNICS, to form a homo-nucleobase pair. In some
embodiments, dNICS or a linker-derivatized dNICS is base paired
with a .beta. nucleobase, including but not limited to, any
nucleobase illustrated in FIGS. 9, 12, and 13, or a derivatized
nucleobase thereof. In some embodiments, a linker moiety is
protected with a protecting group. In some embodiments, a linker
moiety is not protected with a protecting group, wherein in some
instances, a protecting group was removed.
[0056] Provided herein are unnatural base pairs comprising dONICS,
wherein dONICS in some instances, is linker-derivatized. Unnatural
base pairs comprising dONICS or linker-derivatized dONICS (e.g.,
dONICSPA) include, without limitation, dONICS-dFIMO, dONICS-dMIMO,
dONICS-dFEMO, dONICS-dPrMO, dONICS-dEMO, dONICS-dMEMO, dONICS-dIMO,
dONICS-dDMO, dONICS-dNMO, dONICS-d5FM, dONICS-dTMO, dONICS-dFDMO,
dONICS-dVMO, dONICS-dZMO, dONICS-dCIMO, dONICS-MMO2, dONICS-2OMe,
dONICS-dTfMO, dONICS-dCNMO, dONICS-dNAM, dONICS-dQMO, wherein the
dONICS complementary base is or is not linker-derivatized (e.g.
dDMOpCO, dDMOpCC). dONICS is illustrated in FIG. 9 as a .beta.3
analog. In some embodiments, a linker-derivatized dONICS comprises
a functional group R, wherein R is a reactive linker comprising a
reactive center adapted to bond to a cargo reagent or R is a
coupled linker to which a cargo is bonded. Nucleobase analogs which
are complementary to dONICS, include, without limitation, .alpha.
analogs or linker-derivatized .alpha. analogs illustrated in FIGS.
8, 10, 11, and 15. In some embodiments, dONICS or a
linker-derivatized dONICS is base paired with dONICS or a
linker-derivatized dONICS, to form a homo-nucleobase pair. In some
embodiments, dONICS or a linker-derivatized dONICS is base paired
with a .beta. nucleobase, including but not limited to, any
nucleobase illustrated in FIGS. 9, 12, and 13, or a derivatized
nucleobase thereof. In some embodiments, a linker moiety is
protected with a protecting group. In some embodiments, a linker
moiety is not protected with a protecting group, wherein in some
instances, a protecting group was removed.
[0057] Provided herein are unnatural base pairs comprising dSICS,
wherein dSICS in some instances, is linker-derivatized. Unnatural
base pairs comprising dSICS or linker-derivatized dSICS (e.g.,
dSICSPA) include, without limitation, dSICS-dFIMO, dSICS-dMIMO,
dSICS-dFEMO, dSICS-dPrMO, dSICS-dEMO, dSICS-dMEMO, dSICS-dIMO,
dSICS-dDMO, dSICS-dNMO, dSICS-d5FM, dSICS-dTMO, dSICS-dFDMO,
dSICS-dVMO, dSICS-dZMO, dSICS-dCIMO, dSICS-dTfMO, dSICS-dCNMO,
dSICS-dNAM, dSICS-dQMO, wherein the dSICS complementary base is or
is not linker-derivatized (e.g. dDMOpCO, dDMOpCC). dSICS is
illustrated in FIG. 9 as a .beta.5 analog. In some embodiments, a
linker-derivatized dSICS comprises a functional group R, wherein R
is a reactive linker comprising a reactive center adapted to bond
to a cargo reagent or R is a coupled linker to which a cargo is
bonded. Nucleobase analogs which are complementary to dSICS,
include, without limitation, .alpha. analogs or linker-derivatized
.alpha. analogs illustrated in FIGS. 8, 10, 11, and 15. In some
embodiments, dSICS or a linker-derivatized dSICS is base paired
with dSICS or a linker-derivatized dSICS, to form a homo-nucleobase
pair. In some embodiments, dSICS or a linker-derivatized dSICS is
base paired with a .beta. nucleobase, including but not limited to,
any nucleobase illustrated in FIGS. 9, 12, and 13, or a derivatized
nucleobase thereof. In some embodiments, a linker moiety is
protected with a protecting group. In some embodiments, a linker
moiety is not protected with a protecting group, wherein in some
instances, a protecting group was removed.
[0058] Provided herein are unnatural base pairs comprising dSNICS,
wherein dSNICS in some instances, is linker-derivatized. Unnatural
base pairs comprising dSNICS or linker-derivatized dSNICS (e.g.,
dSNICSPA) include, without limitation, dSNICS-dFIMO, dSNICS-dMIMO,
dSNICS-dFEMO, dSNICS-dPrMO, dSNICS-dEMO, dSNICS-dMEMO, dSNICS-dIMO,
dSNICS-dDMO, dSNICS-dNMO, dSNICS-d5FM, dSNICS-dTMO, dSNICS-dFDMO,
dSNICS-dVMO, dSNICS-dZMO, dSNICS-dCIMO, dSNICS-dTfMO, dSNICS-dCNMO,
dSNICS-dNAM, dSNICS-dQMO, wherein the dSNICS complementary base is
or is not linker-derivatized (e.g. dDMOpCO, dDMOpCC). dSNICS is
illustrated in FIG. 9 as a .beta.5 analog. In some embodiments, a
linker-derivatized dSNICS comprises a functional group R, wherein R
is a reactive linker comprising a reactive center adapted to bond
to a cargo reagent or R is a coupled linker to which a cargo is
bonded. Nucleobase analogs which are complementary to dSNICS,
include, without limitation, .alpha. analogs or linker-derivatized
.alpha. analogs illustrated in FIGS. 8, 10, 11, and 15. In some
embodiments, dSNICS or a linker-derivatized dSNICS is base paired
with dSNICS or a linker-derivatized dSNICS, to form a
homo-nucleobase pair. In some embodiments, dSNICS or a
linker-derivatized dSNICS is base paired with a .beta. nucleobase,
including but not limited to, any nucleobase illustrated in FIGS.
9, 12, and 13, or a derivatized nucleobase thereof. In some
embodiments, a linker moiety is protected with a protecting group.
In some embodiments, a linker moiety is not protected with a
protecting group, wherein in some instances, a protecting group was
removed.
[0059] Provided herein are unnatural base pairs comprising d4SICS,
wherein d4SICS in some instances, is linker-derivatized. Unnatural
base pairs comprising d4SICS or linker-derivatized d4SICS (e.g.,
d4SICSPA) include, without limitation, d4SICS-dFIMO, d4SICS-dMIMO,
d4SICS-dFEMO, d4SICS-dPrMO, d4SICS-dEMO, d4SICS-dMEMO, d4SICS-dIMO,
d4SICS-dDMO, d4SICS-dNMO, d4SICS-d5FM, d4SICS-dTMO, d4SICS-dFDMO,
d4SICS-dVMO, d4SICS-dZMO, d4SICS-dCIMO, d4SICS-dTfMO, d4SICS-dCNMO,
d4SICS-dNAM, d4SICS-dQMO, wherein the d4SICS complementary base is
or is not linker-derivatized (e.g. dDMOpCO, dDMOpCC). d4SICS is
illustrated in FIG. 9 as a .beta.5 analog. In some embodiments, a
linker-derivatized d4SICS comprises a functional group R, wherein R
is a reactive linker comprising a reactive center adapted to bond
to a cargo reagent or R is a coupled linker to which a cargo is
bonded. Nucleobase analogs which are complementary to d4SICS,
include, without limitation, a analogs or linker-derivatized
.alpha. analogs illustrated in FIGS. 8, 10, 11, and 15. In some
embodiments, d4SICS or a linker-derivatized d4SICS is base paired
with d4SICS or a linker-derivatized d4SICS, to form a
homo-nucleobase pair. In some embodiments, d4SICS or a
linker-derivatized d4SICS is base paired with a .beta. nucleobase,
including but not limited to, any nucleobase illustrated in FIGS.
9, 12, and 13, or a derivatized nucleobase thereof. In some
embodiments, a linker moiety is protected with a protecting group.
In some embodiments, a linker moiety is not protected with a
protecting group, wherein in some instances, a protecting group was
removed.
[0060] Provided herein are unnatural base pairs comprising d7OFP,
wherein d7OFP in some instances, is linker-derivatized. Unnatural
base pairs comprising d7OFP or linker-derivatized d7OFP (e.g.,
d7OFPPA) include, without limitation, d7OFP-dFIMO, d7OFP-dMIMO,
d7OFP-dFEMO, d7OFP-dPrMO, d7OFP-dEMO, d7OFP-dMEMO, d7OFP-dIMO,
d7OFP-dMMO2, d7OFP-dDMO, d7OFP-dNMO, d7OFP-d5FM, d7OFP-d2OMe,
d7OFP-dTMO, d7OFP-dFDMO, d7OFP-dVMO, d7OFP-dZMO, d7OFP-dCIMO,
d7OFP-dTfMO, d7OFP-dCNMO, d7OFP-dNAM, d7OFP-dQMO, wherein the d7OFP
complementary base is or is not linker-derivatized (e.g. dDMOpCO,
dDMOpCC). d7OFP is illustrated in FIG. 9 as a .beta.5 analog. In
some embodiments, a linker-derivatized d7OFP comprises a functional
group R, wherein R is a reactive linker comprising a reactive
center adapted to bond to a cargo reagent or R is a coupled linker
to which a cargo is bonded. Nucleobase analogs which are
complementary to d7OFP, include, without limitation, .alpha.
analogs or linker-derivatized .alpha. analogs illustrated in FIGS.
8, 10, 11, and 15. In some embodiments, d7OFP or a
linker-derivatized d7OFP is base paired with d7OFP or a
linker-derivatized d7OFP, to form a homo-nucleobase pair. In some
embodiments, d7OFP or a linker-derivatized d7OFP is base paired
with a .beta. nucleobase, including but not limited to, any
nucleobase illustrated in FIGS. 9, 12, and 13, or a derivatized
nucleobase thereof. In some embodiments, a linker moiety is
protected with a protecting group. In some embodiments, a linker
moiety is not protected with a protecting group, wherein in some
instances, a protecting group was removed.
[0061] Provided herein are unnatural base pairs comprising d7OTP,
wherein d7OTP in some instances, is linker-derivatized. Unnatural
base pairs comprising d7OTP or linker-derivatized d7OTP (e.g.,
d7OTPPA) include, without limitation, d7OTP-dFIMO, d7OTP-dMIMO,
d7OTP-dFEMO, d7OTP-dPrMO, d7OTP-dEMO, d7OTP-dMEMO, d7OTP-dIMO,
d7OTP-dMMO2, d7OTP-dDMO, d7OTP-dNMO, d7OTP-d5FM, d7OTP-d2OMe,
d7OTP-dTMO, d7OTP-dFDMO, d7OTP-dVMO, d7OTP-dZMO, d7OTP-dCIMO,
d7OTP-dTfMO, d7OTP-dCNMO, d7OTP-dNAM, d7OTP-dQMO, wherein the d7OTP
complementary base is or is not linker-derivatized (e.g. dDMOpCO,
dDMOpCC). d7OTP is illustrated in FIG. 9 as a .beta.5 analog. In
some embodiments, a linker-derivatized d7OTP comprises a functional
group R, wherein R is a reactive linker comprising a reactive
center adapted to bond to a cargo reagent or R is a coupled linker
to which a cargo is bonded. Nucleobase analogs which are
complementary to d7OTP, include, without limitation, .alpha.
analogs or linker-derivatized .alpha. analogs illustrated in FIGS.
8, 10, 11, and 15. In some embodiments, d7OTP or a
linker-derivatized d7OTP is base paired with d7OTP or a
linker-derivatized d7OTP, to form a homo-nucleobase pair. In some
embodiments, d7OTP or a linker-derivatized d7OTP is base paired
with a .beta. nucleobase, including but not limited to, any
nucleobase illustrated in FIGS. 9, 12, and 13, or a derivatized
nucleobase thereof. In some embodiments, a linker moiety is
protected with a protecting group. In some embodiments, a linker
moiety is not protected with a protecting group, wherein in some
instances, a protecting group was removed.
[0062] Further provided herein, in various embodiments, is a
nucleobase pair comprising a first nucleobase TPT3 and a second
nucleobase MMS. Further provided herein, in various embodiments, is
a nucleobase pair comprising a first nucleobase TPT3 and a second
nucleobase DMS. Further provided herein, in various embodiments, is
a nucleobase pair comprising a first nucleobase TPT3 and a second
nucleobase FEMS. Further provided herein, in various embodiments,
is a nucleobase pair comprising a first nucleobase TPT3 and a
second nucleobase BrMS. Further provided herein, in various
embodiments, is a nucleobase pair comprising a first nucleobase
TPT3 and a second nucleobase IMS.
[0063] Further provided herein, in various embodiments, is a
nucleobase pair comprising a first nucleobase FTPT3 and a second
nucleobase MMS. Further provided herein, in various embodiments, is
a nucleobase pair comprising a first nucleobase FTPT3 and a second
nucleobase DMS. Further provided herein, in various embodiments, is
a nucleobase pair comprising a first nucleobase FTPT3 and a second
nucleobase FEMS. Further provided herein, in various embodiments,
is a nucleobase pair comprising a first nucleobase FTPT3 and a
second nucleobase BrMS. Further provided herein, in various
embodiments, is a nucleobase pair comprising a first nucleobase
FTPT3 and a second nucleobase IMS.
[0064] Further provided herein, in various embodiments, is a
nucleobase pair comprising a first nucleobase 5SICS and a second
nucleobase MMS. Further provided herein, in various embodiments, is
a nucleobase pair comprising a first nucleobase 5SICS and a second
nucleobase DMS. Further provided herein, in various embodiments, is
a nucleobase pair comprising a first nucleobase 5SICS and a second
nucleobase FEMS. Further provided herein, in various embodiments,
is a nucleobase pair comprising a first nucleobase 5SICS and a
second nucleobase BrMS. Further provided herein, in various
embodiments, is a nucleobase pair comprising a first nucleobase
5SICS and a second nucleobase IMS.
[0065] Further provided herein, in various embodiments, is a
nucleobase pair comprising a first nucleobase SICS and a second
nucleobase MMS. Further provided herein, in various embodiments, is
a nucleobase pair comprising a first nucleobase SICS and a second
nucleobase DMS. Further provided herein, in various embodiments, is
a nucleobase pair comprising a first nucleobase SICS and a second
nucleobase FEMS. Further provided herein, in various embodiments,
is a nucleobase pair comprising a first nucleobase SICS and a
second nucleobase BrMS. Further provided herein, in various
embodiments, is a nucleobase pair comprising a first nucleobase
SICS and a second nucleobase IMS.
[0066] Further provided herein, in various embodiments, is a double
stranded oligonucleotide duplex wherein a first oligonucleotide
strand includes an unnatural nucleobase (e.g., nucleobase analog)
disclosed herein, and a second complementary oligonucleotide strand
comprising a complementary base-pairing nucleobase in a
complementary base-pairing site thereof. For instance, for dTPT3, a
second complementary oligonucleotide strand comprises dNaM, dDMO,
or dMMO2, or a linker-derivatized analog thereof, in a
complementary base-pairing site. In this way, the pairing
interaction between the first oligonucleotide strand and the second
oligonucleotide strand includes a specific nucleobase-pairing
interaction between an unnatural nucleobase moiety provided herein
and a complementary nucleobase, which can be a natural or an
unnatural nucleobase.
[0067] Provided herein, in some embodiments, is a double stranded
oligonucleotide duplex wherein a first oligonucleotide strand
comprises a compound having the formula .beta.8a or .beta.8b, and a
second complementary oligonucleotide strand comprises a
complementary base-pairing nucleobase in a complementary
base-pairing site thereof. In some embodiments, the complementary
base-pairing nucleobase is a compound having the formula
.alpha.14a, .alpha.14b, .alpha.14c, .alpha.14d, .alpha.14e, or
.alpha.14f. In some embodiments, the complementary base-pairing
nucleobase includes, without limitation, cytosine, guanine,
adenine, thymine, uracil, 2-aminoadenin-9-yl, 2-aminoadenine,
2-F-adenine, 2-thiouracil, 2-thio-thymine, 2-thiocytosine, 2-propyl
and alkyl derivatives of adenine and guanine, 2-amino-adenine,
2-amino-propyl-adenine, 2-aminopyridine, 2-pyridone,
2'-deoxyuridine, 2-amino-2'-deoxyadenosine 3-deazaguanine,
3-deazaadenine, 4-thio-uracil, 4-thio-thymine, uracil-5-yl,
hypoxanthin-9-yl (I), 5-methyl-cytosine, 5-hydroxymethyl cytosine,
xanthine, hypoxanthine, 5-bromo, and 5-trifiuoromethyl uracils and
cytosines; 5-halouracil, 5-halocytosine, 5-propynyl-uracil,
5-propynyl cytosine, 5-uracil, 5-substituted, 5-halo, 5-substituted
pyrimidines, 5-hydroxycytosine, 5-bromocytosine, 5-bromouracil,
5-chlorocytosine, chlorinated cytosine, cyclocytosine, cytosine
arabinoside, 5-fluorocytosine, fluoropyrimidine, fluorouracil,
5,6-dihydrocytosine, 5-iodocytosine, hydroxyurea, iodouracil,
5-nitrocytosine, 5-bromouracil, 5-chlorouracil, 5-fluorouracil, and
5-iodouracil, 6-alkyl derivatives of adenine and guanine,
6-azapyrimidines, 6-azo-uracil, 6-azo cytosine, azacytosine,
6-azo-thymine, 6-thio-guanine, 7-methylguanine, 7-methyladenine,
7-deazaguanine, 7-deazaguanosine, 7-deaza-adenine,
7-deaza-8-azaguanine, 8-azaguanine, 8-azaadenine, 8-halo, 8-amino,
8-thiol, 8-thioalkyl, and 8-hydroxyl substituted adenines and
guanines; N4-ethylcytosine, N-2 substituted purines, N-6
substituted purines, O-6 substituted purines, those that increase
the stability of duplex formation, universal nucleic acids,
hydrophobic nucleic acids, promiscuous nucleic acids, size-expanded
nucleic acids, fluorinated nucleic acids, tricyclic pyrimidines,
phenoxazine cytidine([5,4-b][1,4]benzoxazin-2(3H)-one),
phenothiazine cytidine
(1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps,
phenoxazine cytidine
(9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole
cytidine (H-pyrido [3',2':4,5]pyrrolo [2,3-d]pyrimidin-2-one),
5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil,
hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)
uracil, 5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methythio-N6-isopentenyladeninje,
uracil-5oxyacetic acid, wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxacetic acid methylester,
uracil-5-oxacetic acid, 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine and those in which the purine or pyrimidine base
is replaced with a heterocycle.
[0068] Provided herein, in some embodiments, is a double stranded
oligonucleotide duplex wherein a first oligonucleotide strand
comprises a compound having the formula .alpha.14a, .beta.14b,
.beta.14c, .beta.14d, .alpha.14e, or .beta.14f, and a second
complementary oligonucleotide strand comprises a complementary
base-pairing nucleobase in a complementary base-pairing site
thereof. In some embodiments, the complementary base-pairing
nucleobase is a compound having the formula .beta.8a or .beta.8b.
In some embodiments, the complementary base-pairing nucleobase
includes, without limitation, cytosine, guanine, adenine, thymine,
uracil, 2-aminoadenin-9-yl, 2-aminoadenine, 2-F-adenine,
2-thiouracil, 2-thio-thymine, 2-thiocytosine, 2-propyl and alkyl
derivatives of adenine and guanine, 2-amino-adenine,
2-amino-propyl-adenine, 2-aminopyridine, 2-pyridone,
2'-deoxyuridine, 2-amino-2'-deoxyadenosine 3-deazaguanine,
3-deazaadenine, 4-thio-uracil, 4-thio-thymine, uracil-5-yl,
hypoxanthin-9-yl (I), 5-methyl-cytosine, 5-hydroxymethyl cytosine,
xanthine, hypoxanthine, 5-bromo, and 5-trifiuoromethyl uracils and
cytosines; 5-halouracil, 5-halocytosine, 5-propynyl-uracil,
5-propynyl cytosine, 5-uracil, 5-substituted, 5-halo, 5-substituted
pyrimidines, 5-hydroxycytosine, 5-bromocytosine, 5-bromouracil,
5-chlorocytosine, chlorinated cytosine, cyclocytosine, cytosine
arabinoside, 5-fluorocytosine, fluoropyrimidine, fluorouracil,
5,6-dihydrocytosine, 5-iodocytosine, hydroxyurea, iodouracil,
5-nitrocytosine, 5-bromouracil, 5-chlorouracil, 5-fluorouracil, and
5-iodouracil, 6-alkyl derivatives of adenine and guanine,
6-azapyrimidines, 6-azo-uracil, 6-azo cytosine, azacytosine,
6-azo-thymine, 6-thio-guanine, 7-methylguanine, 7-methyladenine,
7-deazaguanine, 7-deazaguanosine, 7-deaza-adenine,
7-deaza-8-azaguanine, 8-azaguanine, 8-azaadenine, 8-halo, 8-amino,
8-thiol, 8-thioalkyl, and 8-hydroxyl substituted adenines and
guanines; N4-ethylcytosine, N-2 substituted purines, N-6
substituted purines, O-6 substituted purines, those that increase
the stability of duplex formation, universal nucleic acids,
hydrophobic nucleic acids, promiscuous nucleic acids, size-expanded
nucleic acids, fluorinated nucleic acids, tricyclic pyrimidines,
phenoxazine cytidine([5,4-b][1,4]benzoxazin-2(3H)-one),
phenothiazine cytidine
(1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps,
phenoxazine cytidine
(9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole
cytidine (H-pyrido [3',2':4,5]pyrrolo [2,3-d]pyrimidin-2-one),
5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil,
hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)
uracil, 5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methythio-N6-isopentenyladeninje,
uracil-5oxyacetic acid, wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxacetic acid methylester,
uracil-5-oxacetic acid, 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine and those in which the purine or pyrimidine base
is replaced with a heterocycle.
[0069] In some embodiments, at least one R2 of a nucleobase in a
double stranded oligonucleotide duplex is a coupled linker bonded
with a cargo. In some embodiments, the cargo is a reporter group,
protein, or compound comprising catalytic functionality.
[0070] In some embodiments, a first oligonucleotide strand
comprising a nucleobase analog disclosed herein is prepared by
synthesis with a nucleobase comprising a reactive linker, followed
by coupling of the cargo reagent with the first oligonucleotide
strand, or wherein the first oligonucleotide strand is prepared by
synthesis with a nucleobase comprising a coupled linker bonded to a
cargo.
[0071] In some embodiments, a double stranded oligonucleotide
duplex has a first strand comprising dTPT3 or a derivative thereof,
and a second strand comprising dNaM, dDMO, or dMMO2 or a derivative
thereof in a complementary base-pairing site thereof.
[0072] Further provided herein, in various embodiments, is a method
of carrying out a site-specific functionalization of a double
stranded oligonucleotide duplex, comprising: incorporating an
unnatural nucleobase comprising a reactive linker comprising a
reactive center, the nucleobase having any of the following
formulas .alpha.14a, .alpha.14b, .alpha.14c, .beta.14d, .beta.14e,
.beta.14f, .beta.8a, .beta.8b, .beta.9a, .beta.9b, .alpha.15a,
.alpha.15b, .alpha.16a, or .alpha.16b, into a first oligonucleotide
strand; then, synthesizing a second strand complementary to the
first strand, the second strand comprising a nucleobase
complementary to the unnatural nucleobase at a site-specific
complementary position therein, under conditions such that the
first strand and the second strand form a double stranded
oligonucleotide duplex; then,
[0073] contacting the double stranded oligonucleotide duplex
incorporating the unnatural nucleobase comprising the reactive
linker moiety with a cargo reagent comprising a cargo and a group
of complementary reactivity, under conditions suitable for reaction
of the reactive linker and the group of complementary reactivity to
occur to yield a coupled linker; to provide the functionalized
double stranded oligonucleotide duplex with the cargo bonded
thereto via a coupled linker.
[0074] Further provided herein, in various embodiments, is a method
of carrying out a site-specific functionalization of a double
stranded oligonucleotide duplex, comprising: incorporating an
unnatural nucleobase comprising a reactive linker comprising a
reactive center, the nucleobase being selected from the group
consisting of d5SICSCO, d5SICSCC, dDMOCO, dDMOCC, dMMO2pCO,
dMMO2pCC, dTPT3, dTPT3A, dTPT3PA, dTPT3CO, and dTPT3CC, into a
first oligonucleotide strand; then, synthesizing a second strand
complementary to the first strand, the second strand comprising a
nucleobase complementary to the unnatural nucleobase at a
site-specific complementary position therein, under conditions such
that the first strand and the second strand form a double stranded
oligonucleotide duplex; then, contacting the double stranded
oligonucleotide duplex incorporating the unnatural nucleobase
comprising the reactive linker moiety with a cargo reagent
comprising a cargo and a group of complementary reactivity, under
conditions suitable for reaction of the reactive linker and the
group of complementary reactivity to occur to yield a coupled
linker; to provide the functionalized double stranded
oligonucleotide duplex with the cargo bonded thereto via a coupled
linker.
[0075] In an embodiment, the linker is bonded with a cargo after
the corresponding 5' triphosphate is incorporated into a DNA or RNA
oligonucleotide using a DNA or RNA polymerase (after deprotection,
if required). In another embodiment, a second oligonucleotide is
synthesized that is complementary to the first strand, the second
strand containing an unnatural nucleotide at a position
complementary to the unnatural nucleotide of the first strand;
then, reacting the resulting double stranded oligonucleotide with a
cargo-bearing reagent that reacts selectively with the reactive
center of the reactive linker provides a functionalized double
stranded oligonucleotide (e.g. DNA/DNA, DNA/RNA, or RNA/RNA)
bearing a cargo.
[0076] Further provided herein, in various embodiments, are
structures comprising the formula: N1-Zx-N2, wherein N1 is a
nucleotide or analog thereof, or terminal phosphate group; wherein
N2 is a nucleotide or analog thereof, or terminal hydroxyl group;
wherein Z is a compound of having any of the formulas .alpha.14a,
.alpha.14b, .alpha.14c, .alpha.14d, .alpha.14e, .alpha.14f,
.beta.8a, .beta.8b, .beta.9a, .beta.9b, .alpha.15a, .alpha.15b,
.alpha.16a, or .alpha.16b; and wherein x is an integer from 1 to
20. In some embodiments, the structure is an oligonucleotide. In
some embodiments, the oligonucleotide is a ribonucleic acid or a
deoxyribonucleic acid. In some embodiments, the oligonucleotide is
an aptamer or nucleic acid based sensor. In some embodiments, the
oligonucleotide is a molecular beacon. In some embodiments, the
oligonucleotide is an RNA analog or DNA analog.
[0077] Further provided herein, in various embodiments, is a method
for identifying a nucleic acid aptamer comprising at least one
compound provided herein (e.g. .alpha.14a, .alpha.14b, .alpha.14c,
.alpha.14d, .alpha.14e, .alpha.14f, .beta.8a, .beta.8b, .beta.9a,
.beta.9b, .alpha.15a, .alpha.15b, .alpha.16a, .alpha.16b), as
having an enhanced desired property with respect to a target
molecule, the method comprising: a) preparing a candidate mixture
of single-stranded nucleic acid aptamers, wherein each nucleic acid
aptamer of the candidate mixture of aptamers comprises at least one
compound provided herein (e.g. .alpha.14a, .alpha.14b, .alpha.14c,
.beta.14d, .alpha.14e, .alpha.14f, .beta.8a, .beta.8b, .beta.9a,
.beta.9b, .alpha.15a, .alpha.15b, .alpha.16a, .alpha.16b); then, b)
contacting the candidate mixture with the target molecule under
conditions suitable for binding to the target molecule to occur;
then, c) partitioning the one or more nucleic acid aptamer having
the desired property with respect to the target molecule from among
the aptamers of the candidate mixture; and then, d) amplifying the
one or more nucleic acid aptamer with the desired property, in
vitro, to yield the one or more nucleic acid aptamers, having an
enhanced desired property with respect to the target molecule. In
some embodiments, the method further comprises step e) repeating
steps c) and d). In some embodiments, the single-stranded nucleic
acids aptamers are selected from the group consisting of
single-stranded DNA and single-stranded RNA. In some embodiments,
the desired property is a binding affinity for a target. In some
embodiments, the desired property is a target binding induced
activity. In some embodiments, the desired property is a catalytic
activity. In some embodiments, the desired property is an
inhibition activity, an activation activity, or a modification of
an inhibition activity or an activation activity. In some
embodiments, the desired property is a structure switching activity
or a modification of a structure switching activity. In some
embodiments, the desired property is a cooperative activity. In
some embodiments, the desired activity is an enhanced cellular
update efficacy.
[0078] Further provided herein, in certain embodiments, is an
aptamer comprising a compound having any of the following formulas:
.alpha.14a, .alpha.14b, .alpha.14c, .alpha.14d, .alpha.14e,
.alpha.14f, .beta.8a, .beta.8b, .beta.9a, .beta.9b, .alpha.15a,
.alpha.15b, .alpha.16a, .alpha.16b.
BRIEF DESCRIPTION OF THE FIGURES
[0079] FIG. 1 illustrates the pairing of dTPT3-dNaM, d5SICS-dNaM,
d5SICS-dMMO2, d5SICS-dDMO in DNA or RNA.
[0080] FIG. 2 illustrates the linker-derivatized nucleotides
dTPT3R, d5SICSR, dMMO2R, dMMO2pR, dDMOR, dNaMpR, dNaMpR, dFEMO and
dEMO, where R=3-aminopropyn-1-yl (denoted as A, e.g. dTPT3A);
R=dichloroacetyl-3-aminopropyn-1-yl (denoted as PA);
R=4-oxahepta-1,6-diyn-1-yl (denoted as CO); R=hepta-1,6-diyn-1-yl
(denoted as CC).
[0081] FIG. 3 shows an overview of the phosphorothioate-based
post-synthesis site-specific labeling strategy.
[0082] FIG. 4 shows an overview of the amino-based post-synthesis
site-specific labeling strategy. The linker-modified nucleotides
can also be directly incorporated into the template DNA using
standard solid phase synthesis of oligonucleotides and the
corresponding phosphoroamidites.
[0083] FIG. 5 shows an overview of the click chemistry-based
post-synthesis site-specific labeling strategy. The linker-modified
nucleotides can also be directly incorporated into the template DNA
using standard solid phase synthesis of oligonucleotides and the
corresponding phosphoroamidites.
[0084] FIG. 6 shows representative data illustrating the
post-amplification labeling of DNA analyzed via streptavidin (SA)
gel shift. The faster migrating band corresponds to dsDNA, while
the slower migrating band corresponds to the 1:1 complex between
dsDNA and streptavidin. (A) The labeling efficiency is 72% with
d5SICSPA-dNaM and 80% with dTPT3PA-dNaM. (B) The labeling
efficiency is 6%, 84%, and 56% with d5SICSPA-dNaM at the first
(primer 1: unnatural base pair at position 1), ninth (primer 2:
unnatural base pair at position eleven), and eleventh (primer 3:
unnatural base pair at position nine) position. The corresponding
labeling efficiencies with dTPT3PA-dNaM are 72%, 94%, and 81%.
[0085] FIG. 7 shows gel electrophoresis data confirming the
full-length transcription of RNA containing linker-derivatized
analogs of 5SICS or MMO2. Sequences disclosed as SEQ ID NOS: 14-16,
respectively, in order of appearance.
[0086] FIG. 8 illustrates 12 groupings of .alpha. nucleobase
analogs, .alpha.1-.alpha.12.
[0087] FIG. 9 illustrates 6 groupings of .beta. nucleobase analogs,
.beta.1-.beta.6.
[0088] FIG. 10 illustrates 2 groupings of .alpha. nucleobase
analogs, .alpha.13 and .alpha.14; wherein each X is independently
carbon or nitrogen; wherein each R1 is independently hydrogen,
alkyl group, a reactive linker comprising a reactive center adapted
to bond to a cargo reagent comprising a cargo and a group of
reactivity complementary to the reactive center, or a coupled
linker to which a cargo is bonded; wherein each R2 is optional and
when present, is independently hydrogen, alkyl, alkenyl, alkynyl,
methoxy, methanethiol, methaneseleno, halogen, cyano, azide group,
a reactive linker comprising a reactive center adapted to bond to a
cargo reagent comprising a cargo and a group of reactivity
complementary to the reactive center, coupled linker to which a
cargo is bonded; wherein each R is optional and when present, is
independently hydrogen, alkyl, alkenyl, alkynyl, methoxy,
methanethiol, methaneseleno, halogen, cyano, azide group, a
reactive linker comprising a reactive center adapted to bond to a
cargo reagent comprising a cargo and a group of reactivity
complementary to the reactive center, coupled linker to which a
cargo is bonded; wherein each Y is independently sulfur, oxygen,
selenium, or secondary amine; wherein each E is independently
sulfur, selenium or oxygen.
[0089] FIG. 11 illustrates examples of .alpha.14a nucleobase
analogs, including linker-derivatized nucleobase analogs, MMSpCO
and MMSPA.
[0090] FIG. 12 illustrates 2 groupings of .beta. nucleobase
analogs, .beta.7 and .beta.8; wherein each X is independently
carbon or nitrogen; wherein each R.sub.2 is optional and when
present is independently hydrogen, alkyl, alkenyl, alkynyl,
methoxy, methanethiol, methaneseleno, halogen, cyano, azide group,
a reactive linker comprising a reactive center adapted to bond to a
cargo reagent comprising a cargo and a group of reactivity
complementary to the reactive center, or a coupled linker to which
a cargo is bonded; wherein each Y is independently sulfur, oxygen,
selenium, or secondary amine; wherein each E is independently
sulfur, selenium or oxygen; and wherein R is optional and when
present, is independently hydrogen, alkyl, alkenyl, alkynyl,
methoxy, methanethiol, methaneseleno, halogen, cyano, azide group,
a reactive linker comprising a reactive center adapted to bond to a
cargo reagent comprising a cargo and a group of reactivity
complementary to the reactive center, coupled linker to which a
cargo is bonded.
[0091] FIG. 13 illustrates examples of .beta.8 linker-derivatized
nucleobase analogs.
[0092] FIG. 14 shows percentages of unnatural base pairs retained
in DNA after amplification during 6 rounds of screenings.
[0093] FIG. 15 illustrates .alpha. nucleobase analogs, .alpha.15a,
.alpha.15b, .alpha.16a, and .alpha.16b; wherein each X is
independently carbon or nitrogen; wherein each R1 is independently
hydrogen, alkyl group, a reactive linker comprising a reactive
center adapted to bond to a cargo reagent comprising a cargo and a
group of reactivity complementary to the reactive center, or a
coupled linker to which a cargo is bonded; wherein each R2 is
optional and when present is independently hydrogen, alkyl,
alkenyl, alkynyl, methoxy, methanethiol, methaneseleno, halogen,
cyano, azide, nitro group, a reactive linker comprising a reactive
center adapted to bond to a cargo reagent comprising a cargo and a
group of reactivity complementary to the reactive center, or a
coupled linker to which a cargo is bonded; wherein each Y is
independently sulfur, oxygen, selenium, or secondary amine; wherein
each E is independently oxygen, sulfur or selenium; and wherein
each E2 is independently sulfur or selenium.
[0094] FIG. 16 illustrates .beta. nucleobase analogs, .beta.9a and
.beta.9b; and wherein each X is independently carbon or nitrogen;
wherein each R1 is independently hydrogen, alkyl group, a reactive
linker comprising a reactive center adapted to bond to a cargo
reagent comprising a cargo and a group of reactivity complementary
to the reactive center, or a coupled linker to which a cargo is
bonded; wherein each R2 is optional and when present is
independently hydrogen, alkyl, alkenyl, alkynyl, methoxy,
methanethiol, methaneseleno, halogen, cyano, azide, nitro group, a
reactive linker comprising a reactive center adapted to bond to a
cargo reagent comprising a cargo and a group of reactivity
complementary to the reactive center, or a coupled linker to which
a cargo is bonded; wherein each Y is independently sulfur, oxygen,
selenium, or secondary amine; wherein each E is independently
oxygen, sulfur or selenium.
DETAILED DESCRIPTION
[0095] Phrases such as "under conditions suitable to provide" or
"under conditions sufficient to yield" or the like, in the context
of methods of synthesis, as used herein refers to reaction
conditions, such as time, temperature, solvent, reactant
concentrations, and the like, that are within ordinary skill for an
experimenter to vary, that provide a useful quantity or yield of a
reaction product. It is not necessary that the desired reaction
product be the only reaction product or that the starting materials
be entirely consumed, provided the desired reaction product can be
isolated or otherwise further used.
[0096] By "chemically feasible" is meant a bonding arrangement or a
compound where the generally understood rules of organic structure
are not violated; for example a structure within a definition of a
claim that would contain in certain situations a pentavalent carbon
atom that would not exist in nature would be understood to not be
within the claim. The structures disclosed herein, in all of their
embodiments are intended to include only "chemically feasible"
structures, and any recited structures that are not chemically
feasible, for example in a structure shown with variable atoms or
groups, are not intended to be disclosed or claimed herein.
[0097] An "analog" of a chemical structure, as the term is used
herein, refers to a chemical structure that preserves substantial
similarity with the parent structure, although it may not be
readily derived synthetically from the parent structure. In some
embodiments, a nucleotide analog is an unnatural nucleotide. In
some embodiments, a nucleoside analog is an unnatural nucleoside. A
related chemical structure that is readily derived synthetically
from a parent chemical structure is referred to as a
"derivative."
[0098] Accordingly, a "DNA analog" or an "RNA analog", as the terms
are used herein, refer to DNA or RNA-like polymers such as peptide
nucleic acids (PNA), locked nucleic acids (LNA), phosphorothioates,
and the like, which are well-known in the art. DNA and RNA analogs,
as well as DNA and RNA, can be synthesized in automated
synthesizers, e.g., using phosphoroamidite chemistry or other
chemical approaches adapted for synthesizer use.
[0099] DNA includes, but is not limited to, cDNA and genomic DNA.
DNA may be attached, by covalent or non-covalent means, to another
biomolecule, including, but not limited to, RNA and peptide. RNA
includes coding RNA, e.g. messenger RNA (mRNA). In some
embodiments, RNA is rRNA, RNAi, snoRNA, microRNA, siRNA, snRNA,
exRNA, piRNA, long ncRNA, or any combination or hybrid thereof. In
some instances, RNA is a component of a ribozyme. DNA and RNA can
be in any form, including, but not limited to, linear, circular,
supercoiled, single-stranded, and double-stranded.
[0100] The term "amino protecting group" or "amino-protected" as
used herein refers to those groups intended to protect an amino
group against undesirable reactions during synthetic procedures and
which can later be removed to reveal the amine. Commonly used amino
protecting groups are disclosed in Protective Groups in Organic
Synthesis, Greene, T. W.; Wuts, P. G. M., John Wiley & Sons,
New York, N.Y., (3rd Edition, 1999). Amino protecting groups
include acyl groups such as formyl, acetyl, propionyl, pivaloyl,
t-butylacetyl, 2-chloroacetyl, 2-bromoacetyl, trifluoroacetyl,
trichloroacetyl, o-nitrophenoxyacetyl, .alpha.-chlorobutyryl,
benzoyl, 4-chlorobenzoyl, 4-bromobenzoyl, 4-nitrobenzoyl, and the
like; sulfonyl groups such as benzenesulfonyl, p-toluenesulfonyl
and the like; alkoxy- or aryloxy-carbonyl groups (which form
urethanes with the protected amine) such as benzyloxycarbonyl
(Cbz), p-chlorobenzyloxycarbonyl, p-methoxybenzyloxy carbonyl,
p-nitrobenzyloxycarbonyl, 2-nitrobenzyloxycarbonyl,
p-bromobenzyloxycarbonyl, 3,4-dimethoxybenzyloxycarbonyl,
3,5-dimethoxybenzyloxy carbonyl, 2,4-dimethoxybenzyloxycarbonyl,
4-methoxybenzyloxycarbonyl, 2-nitro-4,5-dimethoxybenzyloxycarbonyl,
3,4,5-trimethoxybenzyloxycarbonyl,
1-(p-biphenylyl)-1-methylethoxycarbonyl,
.alpha.,.alpha.-dimethyl-3,5-dimethoxybenzyloxycarbonyl,
benzhydryloxycarbonyl, t-butyloxycarbonyl (Boc),
diisopropylmethoxycarbonyl, isopropyloxycarbonyl, ethoxycarbonyl,
methoxycarbonyl, allyloxycarbonyl (Alloc),
2,2,2-trichloroethoxycarbonyl, 2-trimethylsilylethyloxycarbonyl
(Teoc), phenoxycarbonyl, 4-nitrophenoxycarbonyl,
fluorenyl-9-methoxycarbonyl (Fmoc), cyclopentyloxycarbonyl,
adamantyloxycarbonyl, cyclohexyloxycarbonyl, phenylthiocarbonyl and
the like; aralkyl groups such as benzyl, triphenylmethyl,
benzyloxymethyl and the like; and silyl groups such as
trimethylsilyl and the like. Amine protecting groups also include
cyclic amino protecting groups such as phthaloyl and
dithiosuccinimidyl, which incorporate the amino nitrogen into a
heterocycle. Typically, amino protecting groups include formyl,
acetyl, benzoyl, pivaloyl, t-butylacetyl, phenylsulfonyl, Alloc,
Teoc, benzyl, Fmoc, Boc and Cbz. Protecting groups also include
methyl carbamate, 9-fluorenylmethyl carbamate, 2,2,2-trichloroethyl
carbamate, t-butyl carbamate, 2-(trimethylsilyl)ethyl carbamate,
allyl carbamate, benzyl carbamate, m-nitrophenyl carbamate,
trifluoroacetamide, benzylamine, allylamine, and tritylamine.
Protecting groups also include, formamides, acetamides,
trifluoroacetamides, p-toluenesulfonyl, trifluoromethanesulfonyl,
trimethylsilylethanesulfonamide, and tert-butylfulfonyl. It is well
within the skill of the ordinary artisan to select and use the
appropriate amino protecting group for the synthetic task at
hand.
[0101] DNA and RNA analogs include PNA (peptide nucleic acid) and
LNA (locked nucleic acid) analogs.
[0102] A peptide nucleic acid (PNA) is a synthetic DNA/RNA analog
wherein a peptide-like backbone replaces the sugar-phosphate
backbone of DNA or RNA. PNA oligomers show higher binding strength
and greater specificity in binding to complementary DNAs, with a
PNA/DNA base mismatch being more destabilizing than a similar
mismatch in a DNA/DNA duplex. This binding strength and specificity
also applies to PNA/RNA duplexes. PNAs are not easily recognized by
either nucleases or proteases, making them resistant to enzyme
degradation. PNAs are also stable over a wide pH range. See also
Nielsen P E, Egholm M, Berg R H, Buchardt O (December 1991).
"Sequence-selective recognition of DNA by strand displacement with
a thymine-substituted polyamide", Science 254 (5037): 1497-500.
doi:10.1126/science.1962210. PMID 1962210; and, Egholm M, Buchardt
O, Christensen L, Behrens C, Freier S M, Driver D A, Berg R H, Kim
S K, Norden B, and Nielsen P E (1993), "PNA Hybridizes to
Complementary Oligonucleotides Obeying the Watson-Crick Hydrogen
Bonding Rules". Nature 365 (6446): 566-8. doi:10.1038/365566a0.
PMID 7692304
[0103] A locked nucleic acid (LNA) is a modified RNA nucleotide,
wherein the ribose moiety of an LNA nucleotide is modified with an
extra bridge connecting the 2' oxygen and 4' carbon. The bridge
"locks" the ribose in the 3'-endo (North) conformation, which is
often found in the A-form duplexes. LNA nucleotides can be mixed
with DNA or RNA residues in the oligonucleotide whenever desired.
Such oligomers can be synthesized chemically and are commercially
available. The locked ribose conformation enhances base stacking
and backbone pre-organization. See, for example, Kaur, H; Arora, A;
Wengel, J; Maiti, S (2006), "Thermodynamic, Counterion, and
Hydration Effects for the Incorporation of Locked Nucleic Acid
Nucleotides into DNA Duplexes", Biochemistry 45 (23): 7347-55.
doi:10.1021/bi060307w. PMID 16752924; Owczarzy R.; You Y., Groth C.
L., Tataurov A. V. (2011), "Stability and mismatch discrimination
of locked nucleic acid-DNA duplexes.", Biochem. 50 (43): 9352-9367.
doi:10.1021/bi200904e. PMC 3201676. PMID 21928795; Alexei A.
Koshkin; Sanjay K. Singh, Poul Nielsen, Vivek K. Rajwanshi,
Ravindra Kumar, Michael Meldgaard, Carl Erik Olsen, Jesper Wengel
(1998), "LNA (Locked Nucleic Acids): Synthesis of the adenine,
cytosine, guanine, 5-methylcytosine, thymine and uracil
bicyclonucleoside monomers, oligomerisation, and unprecedented
nucleic acid recognition", Tetrahedron 54 (14): 3607-30.
doi:10.1016/S0040-4020(98)00094-5; and, Satoshi Obika; Daishu
Nanbu, Yoshiyuki Hari, Ken-ichiro Morio, Yasuko In, Toshimasa
Ishida, Takeshi Imanishi (1997), "Synthesis of
2'-O,4'-C-methyleneuridine and -cytidine. Novel bicyclic
nucleosides having a fixed C3'-endo sugar puckering", Tetrahedron
Lett. 38 (50): 8735-8. doi:10.1016/S0040-4039(97)10322-7.
[0104] A molecular beacon or molecular beacon probe is an
oligonucleotide hybridization probe that can detect the presence of
a specific nucleic acid sequence in a homogenous solution.
Molecular beacons are hairpin shaped molecules with an internally
quenched fluorophore whose fluorescence is restored when they bind
to a target nucleic acid sequence. See, for example, Tyagi S,
Kramer F R (1996), "Molecular beacons: probes that fluoresce upon
hybridization", Nat Biotechnol. 14 (3): 303-8. PMID 9630890; Tapp
I, Malmberg L, Rennel E, Wik M, Syvanen A C (2000 April),
"Homogeneous scoring of single-nucleotide polymorphisms: comparison
of the 5'-nuclease TaqMan assay and Molecular Beacon probes",
Biotechniques 28 (4): 732-8. PMID 10769752; and, Akimitsu Okamoto
(2011), "ECHO probes: a concept of fluorescence control for
practical nucleic acid sensing", Chem. Soc. Rev. 40: 5815-5828.
[0105] In some embodiments, a nucleobase is generally the
heterocyclic base portion of a nucleoside. Nucleobases may be
naturally occurring, may be modified, may bear no similarity to
natural bases, and may be synthesized, e.g., by organic synthesis.
In certain embodiments, a nucleobase comprises any atom or group of
atoms capable of interacting with a base of another nucleic acid
with or without the use of hydrogen bonds. In certain embodiments,
an unnatural nucleobase is not derived from a natural nucleobase.
It should be noted that unnatural nucleobases do not necessarily
possess basic properties, however, are referred to as nucleobases
for simplicity. In some embodiments, when referring to a
nucleobase, a "(d)" indicates that the nucleobase can be attached
to a deoxyribose or a ribose.
[0106] In some embodiments, a nucleoside is a compound comprising a
nucleobase moiety and a sugar moiety. Nucleosides include, but are
not limited to, naturally occurring nucleosides (as found in DNA
and RNA), abasic nucleosides, modified nucleosides, and nucleosides
having mimetic bases and/or sugar groups. Nucleosides include
nucleosides comprising any variety of substituents. A nucleoside
can be a glycoside compound formed through glycosidic linking
between a nucleic acid base and a reducing group of a sugar.
[0107] In some embodiments, a nucleotide is a compound in which the
sugar moiety of a nucleoside forms an ester with phosphoric acid,
more preferably a mono-, di- or tri-phosphate ester. The sugar
moiety of such a nucleoside or nucleotide may be ribofuranosyl,
2'-deoxyribofuranosyl, or 2'-substituted ribofuranosyl having a
substituent at the 2'-position. Likewise, the phosphoric acid
moiety may be thiophosphoric acid. Namely, the sugar and phosphoric
acid moieties may be in the same form as found in known
nucleosides, nucleotides, or derivatives thereof. A ribonucleotide
whose sugar moiety is ribofuranosyl can be used as a member
constituting RNA. A deoxyribonucleotide whose sugar moiety is
deoxyribofuranosyl can be used as a member constituting DNA. A
nucleotide can be a nucleoside further comprising a phosphate
linking group. Nucleotides may include nucleosides containing a
phosphate moiety.
[0108] A class of unnatural base pairs, exemplified by d5SICS-dNaM
and d5SICS-dMMO2 (FIG. 1), has been developed and shown by us to be
replicated (including via PCR) and transcribed by a wide range of
natural polymerases with efficiencies and fidelities approaching
those of a natural base pair (See Malyshev, D. A.; Seo, Y. J.;
Ordoukhanian, P.; Romesberg, F. E., PCR with an Expanded Genetic
Alphabet. J. Am. Chem. Soc. 2009.131 (41), 14620-14621; Seo, Y. J.;
Matsuda, S.; Romesberg, F. E., Transcription of an Expanded Genetic
Alphabet. J. Am. Chem. Soc. 2009, 131 (14), 5046-5047; Lavergne T.;
Degardin M.; Malyshev D. A.; Quach H. T.; Dhami K.; Ordoukhanian
P.; Romesberg, F. E.; Expanding the scope of replicable unnatural
DNA: Stepwise optimization of a predominantly hydrophobic base
pair. J. Am. Chem. Soc. 2013, 135, 5408-5419; Seo, Y. J., Malyshev
D. A., Lavergne T., Ordoukhanian P., and Romesberg, F. E., J. Am.
Chem. Soc. 2011, 133, 19878.). These unnatural base pairs are
formed between nucleotide analogs bearing unnatural, predominantly
hydrophobic nucleobases. The base pairs are shown in FIG. 1, with
each unnatural nucleotide being incorporated into oligonucleotides
at complementary (i.e. paring) positions; the nucleobases are
understood to be bonded at the position indicated by the wavy line
to the 1'-position of a ribosyl or 2'-deoxyribosyl moiety, which is
itself incorporated into RNA or DNA by phosphate or
phosphorothioate groups bonding the 3' and 5' hydroxyl groups of
the ribosyl or deoxyribosyl groups, respectively, as it is in the
case with fully natural nucleic acids. The base pairing thus takes
place as part of a complementary base paired structure as is
well-known in the formation of oligonucleotide duplex structures.
Provided herein, in various embodiments, is an unnatural nucleobase
dTPT3 and its linker-derivatized variants, which are thought to
pair with unnatural nucleobases dNaM, dMMO2, and dDMO (or their
linker-derivatized variants) in a similar fashion.
[0109] We have demonstrated that the unnatural nucleotides dTPT3
and dTPT3.sup.PA are efficiently incorporated into DNA by DNA
polymerases opposite dNaM (FIG. 2). Both dTPT3 and dTPT3.sup.PA
(PA=dichloroacetyl-3-aminopropyn-1-yl) as well as other
linker-derivatized variants of dTPT3 (FIG. 3) including, when
R=3-aminopropyn-1-yl (dTPT3.sup.A), R=4-oxahepat-1,6-diyn-1-yl
(dTPT.sup.CO), or R=hepta-1,6-diyn-1-yl (dTPT.sup.CC)) are also
expected to pair with dNaM, dDMO or dMMO2, or linker-derivatized
analogs thereof. Incorporation rates of dTPT3 and
linker-derivatized variants thereof, opposite dNAM approach those
of a natural base pair. Additional unnatural base pairs identified
with efficient incorporation rates include dTPT3-dFEMO,
dTPT3-dFIMO, dTPT3-dIMO, dFTPT3-dNaM, dFTPT3-dFEMO, dFTPT3-dFIMO,
and dFTPT3-dIMO.
[0110] Further provided herein, in various embodiments, are
unnatural nucleotides with nucleobase analogs including, .alpha.
analogs (e.g., any one of FIGS. 8, 10, 11, 15 and derivatives
thereof); .beta. analogs (e.g., any one of FIGS. 9, 12, 13, 16 and
derivatives thereof); d5SICS.sup.CO, d5SICS.sup.CC, dDMO.sup.CO,
dDMO.sup.CC, dMMO2.sup.pCO, dMMO2.sup.pCC, dTPT3, dTPT3.sup.PA,
dTPT3.sup.A, dTPT3.sup.CO, dTPT3.sup.CC, and ribosyl forms thereof,
and analogs thereof (See FIG. 2); in the form of nucleosides,
nucleoside 5' triphosphates, and analogs thereof (e.g., ribosyl and
2'-deoxyribosyl), nucleotides and analogs thereof (e.g., ribosyl
and 2'-deoxyribosyl, phosphate and phosphorothioate), including
nucleotide reagents derived there from for use in RNA/DNA synthesis
(DMT-protected phosphoramidites) and for use in enzymatic
incorporation into oligonucleotides as by PCR or T7 RNA
polymerase-mediate transcription, and incorporated into nucleic
acids (oligonucleotides) such as DNA and RNA. The compounds
comprising the unnatural nucleobase analogs can also be
incorporated into DNA analogs or into RNA analogs, such as PNA,
LNA, and other like polynucleotide-analogous polymers. Exemplary
nucleobase analogs provided herein include .beta.8 analogs
comprising the formulas .beta.8a and .beta.8b, as shown in FIG. 12,
wherein each X is independently carbon or nitrogen; wherein each
R.sub.2 is optional and when present is independently hydrogen,
alkyl, alkenyl, alkynyl, methoxy, methanethiol, methaneseleno,
halogen, cyano, azide group, a reactive linker comprising a
reactive center adapted to bond to a cargo reagent comprising a
cargo and a group of reactivity complementary to the reactive
center, or a coupled linker to which a cargo is bonded; wherein
each Y is independently sulfur, oxygen, selenium, or secondary
amine; wherein each E is independently sulfur, selenium or oxygen;
and wherein R is optional and when present, is independently
hydrogen, alkyl, alkenyl, alkynyl, methoxy, methanethiol,
methaneseleno, halogen, cyano, azide group, a reactive linker
comprising a reactive center adapted to bond to a cargo reagent
comprising a cargo and a group of reactivity complementary to the
reactive center, coupled linker to which a cargo is bonded.
Examples of .beta.8 analogs include dTPT3 and linker-derivatized
analogs thereof. Exemplary nucleobase analogs provided herein
include .alpha.14 analogs comprising the formulas
.alpha.14a-.alpha.14f, as shown in FIG. 10, wherein each X is
independently carbon or nitrogen; wherein each R.sub.1 is
independently hydrogen, alkyl group, a reactive linker comprising a
reactive center adapted to bond to a cargo reagent comprising a
cargo and a group of reactivity complementary to the reactive
center, or a coupled linker to which a cargo is bonded; wherein
each R.sub.2 is optional and when present, is independently
hydrogen, alkyl, alkenyl, alkynyl, methoxy, methanethiol,
methaneseleno, halogen, cyano, azide group, a reactive linker
comprising a reactive center adapted to bond to a cargo reagent
comprising a cargo and a group of reactivity complementary to the
reactive center, coupled linker to which a cargo is bonded; wherein
each R is optional and when present, is independently hydrogen,
alkyl, alkenyl, alkynyl, methoxy, methanethiol, methaneseleno,
halogen, cyano, azide group, a reactive linker comprising a
reactive center adapted to bond to a cargo reagent comprising a
cargo and a group of reactivity complementary to the reactive
center, coupled linker to which a cargo is bonded; wherein each Y
is independently sulfur, oxygen, selenium, or secondary amine;
wherein each E is independently sulfur, selenium or oxygen.
Examples of .alpha.14 analogs include dMMS, dDMS, dFEMS, dBrMS,
dIMS, and linker-derivatized analogs thereof.
[0111] Further provided herein, in various embodiments, are
unnatural base pairs comprising any one .alpha. analog or
derivative thereof disclosed herein, and any one .beta. analog or
derivative thereof disclosed herein. Derivatives include, but are
not limited to, atom substitutions and additions of linker
moieties. Linker moieties may be attached to the analogs during
synthesis or after nucleobase incorporation into a nucleic acid.
Exemplary unnatural base pairs include, but are not limited to,
dTPT3-dNaM, dTPT3-dFEMO, dTPT3-dFIMO, dTPT3-dIMO, dFTPT3-dNaM,
dFTPT3-dFEMO, dFTPT3-dFIMO, dFTPT3-dIMO. Unnatural base pairs
include, but are not limited to, dTPT3-MMS, dTPT3-DMS, dTPT3-FEMS,
dTPT3-BrMS, dTPT3-IMS, dTPT3-dDMN, dTPT3-d4OMe, dTPT3-dIQ,
dTPT3-d2MN, dTPT3-d3OMe, dTPT3-dQL, dTPT3-d2Np, dTPT3-dDM4,
dTPT3-dDM, dTPT3-dBEN, dTPT3-d3FB, dTPT3-dMM1, dTPT3-dMMO1,
dTPT3-dDM2, dTPT3-dDM5, dTPT3-d2Py, dTPT3-d5MPy, dTPT3-dEPy,
dTPT3-d3MPy, dTPT3-d34DMPy, dTPT3-d45DMPy, dTPT3-d4MPy,
dTPT3-d35DMPy, dTPT3-dBP, dTPT3-dBTp, dTPT3-dBF, dTPT3-dIN,
dTPT3-dTp, dTPT3-dBTz, dTPT3-dMTp, dTPT3-dAM, dTPT3-dMAN,
dTPT3-dDMMAN, dTPT3-dADM, dTPT3-dMMAN, dTPT3-dTOK588,
dTPT3-dTOK576, dTPT3-dTOK587, dTPT3-dTOK586, dTPT3-dTOK580,
dTPT3-dPhMO, dTPT3-dPyMO1, dTPT3-PyMO2, dTPT3-dPMO1, dTPT3-dPMO2,
dTPT3-dPMO3, dTPT3-dFuMO1, dTPT3-dFuMO2, dTPT3-TpMO1, dTPT3-dTpMO2,
dTPT3-dFIMO, dTPT3-dIMO, dTPT3-dMIMO, dTPT3-dMEMO, dTPT3-dFEMO,
dTPT3-dPrMO, dTPT3-dMMO2, dTPT3-d2OMe, dTPT3-dDMO, dTPT3-dTMO,
dTPT3-dNMO, dTPT3-dNOPy, dTPT3-d5FM, dTPT3-dNAM, dTPT3-dAMO1,
dTPT3-dAPy, dTPT3-dAMO2, dTPT3-dMAPy, dTPT3-dAMO3, dTPT3-dDMAPy,
dTPT3-dFDMO, dTPT3-dVMO, dTPT3-dQMO, dTPT3-dZMO, dTPT3-dCIMO,
dTPT3-dTfMO, dTPT3-CNMO, d7AI-dMMS, dM7AI-dMMS, dImPy-dMMS,
dP7AI-dMMS, dPPP-dMMS, d8Q-dMMS, dICS-dMMS, dPICS-dMMS, dMICS-dMMS,
d4MICS-dMMS, d5MICS-dMMS, dNICS-dMMS, dONICS-dMMS, d7OFP-dMMS,
d7OTP-dMMS, d4OTP-dMMS, dPYR-dMMS, d4MP-dMMS, d3MP-dMMS,
dPPYR-dMMS, dMOP-dMMS, d4MOP-dMMS, dSICS-dMMS, dSNICS-dMMS,
d5SICS-dMMS, d4SICS-dMMS, dTPT1-dMMS, dTPT2-dMMS, dFPT1-dMMS,
dFTPT3-dMMS, d7AI-dDMS, dM7AI-dDMS, dImPy-dDMS, dP7AI-dDMS,
dPPP-dDMS, d8Q-dDMS, dICS-dDMS, dPICS-dDMS, dMICS-dDMS,
d4MICS-dDMS, d5MICS-dDMS, dNICS-dDMS, dONICS-dDMS, d7OFP-dDMS,
d7OTP-dDMS, d4OTP-dDMS, dPYR-dDMS, d4MP-dDMS, d3MP-dDMS,
dPPYR-dDMS, dMOP-dDMS, d4MOP-dDMS, dSICS-dDMS, dSNICS-dDMS,
d5SICS-dDMS, d4SICS-dDMS, dTPT1-dDMS, dTPT2-dDMS, dFPT1-dDMS,
dFTPT3-dDMS, d7AI-dFEMS, dM7AI-dFEMS, dImPy-dFEMS, dP7AI-dFEMS,
dPPP-dFEMS, d8Q-dFEMS, dICS-dFEMS, dPICS-dFEMS, dMICS-dFEMS,
d4MICS-dFEMS, d5MICS-dFEMS, dNICS-dFEMS, dONICS-dFEMS, d7OFP-dFEMS,
d7OTP-dFEMS, d4OTP-dFEMS, dPYR-dFEMS, d4MP-dFEMS, d3MP-dFEMS,
dPPYR-dFEMS, dMOP-dFEMS, d4MOP-dFEMS, dSICS-dFEMS, dSNICS-dFEMS,
d5SICS-dFEMS, d4SICS-dFEMS, dTPT1-dFEMS, dTPT2-dFEMS, dFPT1-dFEMS,
dFTPT3-dFEMS, d7AI-dBrMS, dM7AI-dBrMS, dImPy-dBrMS, dP7AI-dBrMS,
dPPP-dBrMS, d8Q-dBrMS, dICS-dBrMS, dPICS-dBrMS, dMICS-dBrMS,
d4MICS-dBrMS, d5MICS-dBrMS, dNICS-dBrMS, dONICS-dBrMS, d7OFP-dBrMS,
d7OTP-dBrMS, d4OTP-dBrMS, dPYR-dBrMS, d4MP-dBrMS, d3MP-dBrMS,
dPPYR-dBrMS, dMOP-dBrMS, d4MOP-dBrMS, dSICS-dBrMS, dSNICS-dBrMS,
d5SICS-dBrMS, d4SICS-dBrMS, dTPT1-dBrMS, dTPT2-dBrMS, dFPT1-dBrMS,
dFTPT3-dBrMS, d7AI-dIMS, dM7AI-dIMS, dImPy-dIMS, dP7AI-dIMS,
dPPP-dIMS, d8Q-dIMS, dICS-dIMS, dPICS-dIMS, dMICS-dIMS,
d4MICS-dIMS, d5MICS-dIMS, dNICS-dIMS, dONICS-dIMS, d7OFP-dIMS,
d7OTP-dIMS, d4OTP-dIMS, dPYR-dIMS, d4MP-dIMS, d3MP-dIMS,
dPPYR-dIMS, dMOP-dIMS, d4MOP-dIMS, dSICS-dIMS, dSNICS-dIMS,
d5SICS-dIMS, d4SICS-dIMS, dTPT1-dIMS, dTPT2-dIMS, dFPT1-dIMS, and
dFTPT3-dIMS; wherein one or two unnatural nucleobases of the
unnatural base pair may be derivatized with a linker. Exemplary
unnatural base pairs of this disclosure further include any pair
described in Example 1. Exemplary .beta. analogs include those
which are presented in FIGS. 9, 12, and 13. Exemplary .beta.
nucleobase analogs include .beta.8 analogs comprising the formulas
.beta.8a and .beta.8b, as shown in FIG. 12, wherein each X is
independently carbon or nitrogen; wherein each R.sub.2 is optional
and when present is independently hydrogen, alkyl, alkenyl,
alkynyl, methoxy, methanethiol, methaneseleno, halogen, cyano,
azide group, a reactive linker comprising a reactive center adapted
to bond to a cargo reagent comprising a cargo and a group of
reactivity complementary to the reactive center, or a coupled
linker to which a cargo is bonded; wherein each Y is independently
sulfur, oxygen, selenium, or secondary amine; wherein each E is
independently sulfur, selenium or oxygen; and wherein R is optional
and when present, is independently hydrogen, alkyl, alkenyl,
alkynyl, methoxy, methanethiol, methaneseleno, halogen, cyano,
azide group, a reactive linker comprising a reactive center adapted
to bond to a cargo reagent comprising a cargo and a group of
reactivity complementary to the reactive center, coupled linker to
which a cargo is bonded. Examples of .beta. analogs include dTPT3,
d5SICS, dFTPT3 and derivatives or analogs thereof. Exemplary
.alpha. analogs include those which are presented in FIGS. 8, 10,
and 11. Exemplary .alpha. analogs include .alpha.14 analogs
comprising the formulas .alpha.14a-.alpha.14f, as shown in FIG. 10,
wherein each X is independently carbon or nitrogen; wherein each
R.sub.1 is independently hydrogen, alkyl group, a reactive linker
comprising a reactive center adapted to bond to a cargo reagent
comprising a cargo and a group of reactivity complementary to the
reactive center, or a coupled linker to which a cargo is bonded;
wherein each R.sub.2 is optional and when present, is independently
hydrogen, alkyl, alkenyl, alkynyl, methoxy, methanethiol,
methaneseleno, halogen, cyano, azide group, a reactive linker
comprising a reactive center adapted to bond to a cargo reagent
comprising a cargo and a group of reactivity complementary to the
reactive center, coupled linker to which a cargo is bonded; wherein
each R is optional and when present, is independently hydrogen,
alkyl, alkenyl, alkynyl, methoxy, methanethiol, methaneseleno,
halogen, cyano, azide group, a reactive linker comprising a
reactive center adapted to bond to a cargo reagent comprising a
cargo and a group of reactivity complementary to the reactive
center, coupled linker to which a cargo is bonded; wherein each Y
is independently sulfur, oxygen, selenium, or secondary amine;
wherein each E is independently sulfur, selenium or oxygen.
Examples of .alpha. analogs include dMMS, dDMS, dBrMS, dIMS, dFEMS,
dNAM, dMMO2, dDMO, dEMO, dFEMO, and derivatives or analogs thereof.
In some embodiments, an unnatural base pair includes an .alpha.
analog and a natural base. In some embodiments, an unnatural base
pair includes a .beta. analog and a natural base. Further provided
herein, in some aspects, are unnatural base pairs comprising the
same two unnatural nucleoside analogs or derivatives thereof.
[0112] An unnatural base pair, in various aspects, comprises one
unnatural nucleobase disclosed herein (e.g. .alpha. analog or
derivative thereof, .beta. analog or derivative thereof) and
another unnatural nucleobase including, but not limited to,
2-aminoadenin-9-yl, 2-aminoadenine, 2-F-adenine, 2-thiouracil,
2-thio-thymine, 2-thiocytosine, 2-propyl and alkyl derivatives of
adenine and guanine, 2-amino-adenine, 2-amino-propyl-adenine,
2-aminopyridine, 2-pyridone, 2'-deoxyuridine,
2-amino-2'-deoxyadenosine 3-deazaguanine, 3-deazaadenine,
4-thio-uracil, 4-thio-thymine, uracil-5-yl, hypoxanthin-9-yl (I),
5-methyl-cytosine, 5-hydroxymethyl cytosine, xanthine,
hypoxanthine, 5-bromo, and 5-trifiuoromethyl uracils and cytosines;
5-halouracil, 5-halocytosine, 5-propynyl-uracil, 5-propynyl
cytosine, 5-uracil, 5-substituted, 5-halo, 5-substituted
pyrimidines, 5-hydroxycytosine, 5-bromocytosine, 5-bromouracil,
5-chlorocytosine, chlorinated cytosine, cyclocytosine, cytosine
arabinoside, 5-fluorocytosine, fluoropyrimidine, fluorouracil,
5,6-dihydrocytosine, 5-iodocytosine, hydroxyurea, iodouracil,
5-nitrocytosine, 5-bromouracil, 5-chlorouracil, 5-fluorouracil, and
5-iodouracil, 6-alkyl derivatives of adenine and guanine,
6-azapyrimidines, 6-azo-uracil, 6-azo cytosine, azacytosine,
6-azo-thymine, 6-thio-guanine, 7-methylguanine, 7-methyladenine,
7-deazaguanine, 7-deazaguanosine, 7-deaza-adenine,
7-deaza-8-azaguanine, 8-azaguanine, 8-azaadenine, 8-halo, 8-amino,
8-thiol, 8-thioalkyl, and 8-hydroxyl substituted adenines and
guanines; N4-ethylcytosine, N-2 substituted purines, N-6
substituted purines, O-6 substituted purines, those that increase
the stability of duplex formation, universal nucleic acids,
hydrophobic nucleic acids, promiscuous nucleic acids, size-expanded
nucleic acids, fluorinated nucleic acids, tricyclic pyrimidines,
phenoxazine cytidine([5,4-b][1,4]benzoxazin-2(3H)-one),
phenothiazine cytidine
(1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps,
phenoxazine cytidine
(9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole
cytidine (H-pyrido [3',2':4,5]pyrrolo [2,3-d]pyrimidin-2-one),
5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil,
hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)
uracil, 5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methythio-N6-isopentenyladeninje,
uracil-5oxyacetic acid, wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxacetic acid methylester,
uracil-5-oxacetic acid, 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine and those in which the purine or pyrimidine base
is replaced with a heterocycle. The .alpha. analogs of the
unnatural base pair include, without limitation, dMMS, dDMS, dBrMS,
dIMS, dFEMS, dNAM, dMMO2, dDMO, dEMO, dFEMO, and derivatives or
analogs thereof. The .beta. analogs of the unnatural base pair
include, without limitation, dTPT3, d5SICS, and dFTPT3.
[0113] In some embodiments, the unnatural nucleobases and unnatural
base pairs disclosed herein have efficient incorporation and
extension with natural polymerases. In some embodiments, the
unnatural nucleobases and unnatural base pairs disclosed herein
have efficient incorporation and extension with modified
polymerases. The effect of an unnatural nucleobase or unnatural
nucleobase derivative on polymerase recognition is assessed, in
exemplary embodiments, by determining the steady-state efficiency
(e.g., second order rate constant k.sub.cat/K.sub.M) with which the
polymerase synthesizes an unnatural base pair, by insertion of the
unnatural nucleotide opposite its complementary base in a template,
and extends the resulting unnatural primer terminus, by insertion
of the next correct natural nucleotide. Corresponding rates of
synthesis and extension for mispairs with natural nucleotides may
also be measured to determine fidelity. In some embodiments,
polymerases do not need to be modified to improve incorporation or
extension rates. The embodiments and examples disclosed herein may
be performed with any known polymerase. Polymerases include
naturally-occurring polymerases and any modified variations
thereof, including, but not limited to, mutants, recombinants,
fusions, genetic modifications, chemical modifications, synthetics,
and analogs. Naturally-occurring polymerases and modified
variations thereof are not limited to polymerases which retain the
ability to catalyze a polymerization reaction. In some instances,
the naturally-occurring and/or modified variations thereof retain
the ability to catalyze a polymerization reaction. Mutant
polymerases include polymerases wherein one or more amino acids are
replaced with other amino acids (naturally or non-naturally
occurring), and polymerases having one or more amino acid
insertions or deletions. In some embodiments a polymerase refers to
fusion proteins comprising at least two portions linked to each
other, for example, where one portion comprises a peptide that can
catalyze the polymerization of nucleotides into a nucleic acid
strand is linked to another portion that comprises a second moiety,
such as, a reporter enzyme or a processivity-modifying domain. One
exemplary embodiment of such a polymerase is T7 DNA polymerase,
which comprises a nucleic acid polymerizing domain and a
thioredoxin binding domain, wherein thioredoxin binding enhances
the processivity of the polymerase. Absent the thioredoxin binding,
T7 DNA polymerase is a distributive polymerase with processivity of
only one to a few bases. DNA polymerases include, but are not
limited to, bacterial DNA polymerases, eukaryotic DNA polymerases,
archaeal DNA polymerases, viral DNA polymerases and phage DNA
polymerases. Bacterial DNA polymerases include E. coli DNA
polymerases I, II and III, IV and V, the Klenow fragment of E. coli
DNA polymerase, Clostridium stercorarium (Cst) DNA polymerase,
Clostridium thermocellum (Cth) DNA polymerase and Sulfolobus
solfataricus (Sso) DNA polymerase. Eukaryotic DNA polymerases
include DNA polymerases .alpha., .beta., .gamma., .delta.,
.di-elect cons., .eta., .zeta., .sigma., .lamda., .mu., .tau. and
.kappa., as well as the Revl polymerase (terminal deoxycytidyl
transferase) and terminal deoxynucleotidyl transferase (TdT). Viral
DNA polymerases include T4 DNA polymerase, phi-29 DNA polymerase,
GA-1, phi-29-like DNA polymerases, PZA DNA polymerase, phi-15 DNA
polymerase, Cp1 DNA polymerase, Cp1 DNA polymerase, T7 DNA
polymerase, and T4 polymerase. Archaeal DNA polymerases include
thermostable and/or thermophilic DNA polymerases such as DNA
polymerases isolated from Thermus aquaticus (Tag) DNA polymerase,
Thermus filiformis (Tfi) DNA polymerase, Thermococcus zilligi (Tzi)
DNA polymerase, Thermus thermophilus (Tth) DNA polymerase, Thermus
flavusu (Tfl) DNA polymerase, Pyrococcus woesei (Pwo) DNA
polymerase, Pyrococcus furiosus (Pfu) DNA polymerase and Turbo Pfu
DNA polymerase, Thermococcus litoralis (Tli) DNA polymerase,
Pyrococcus sp. GB-D polymerase, Thermotoga maritima (Tma) DNA
polymerase, Bacillus stearothermophilus (Bst) DNA polymerase,
Pyrococcus Kodakaraensis (KOD) DNA polymerase, Pfx DNA polymerase,
Thermococcus sp. JDF-3 (JDF-3) DNA polymerase, Thermococcus
gorgonarius (Tgo) DNA polymerase, Thermococcus acidophilium DNA
polymerase; Sulfolobus acidocaldarius DNA polymerase; Thermococcus
sp. 9.degree. N-7 DNA polymerase; Pyrodictium occultum DNA
polymerase; Methanococcus voltae DNA polymerase; Methanococcus
thermoautotrophicum DNA polymerase; Methanococcus jannaschii DNA
polymerase; Desulfurococcus strain TOK DNA polymerase (D. Tok Pol);
Pyrococcus abyssi DNA polymerase; Pyrococcus horikoshii DNA
polymerase; Pyrococcus islandicum DNA polymerase; Thermococcus
fumicolans DNA polymerase; Aeropyrum pernix DNA polymerase; and the
heterodimeric DNA polymerase DP1/DP2. RNA polymerases include, but
are not limited to, viral RNA polymerases such as T7 RNA
polymerase, T3 polymerase, SP6 polymerase, and K11 polymerase;
Eukaryotic RNA polymerases such as RNA polymerase I, RNA polymerase
II, RNA polymerase III, RNA polymerase IV, and RNA polymerase V;
and Archaea RNA polymerase.
[0114] In some embodiments, a polymerase has a specificity for an
unnatural nucleotide comprising an .alpha. or .beta. nucleobase
analog that is at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%,
80%, 90%, 95%, 97%, 98%, 99%, 99.5%, 99.99% of the specificity of
the polymerase toward a natural nucleotide. In some embodiments, a
polymerase has a specificity for an unnatural nucleotide comprising
an .alpha. or .beta. nucleobase analog and a modified sugar that is
at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%,
97%, 98%, 99%, 99.5%, 99.99% of the specificity of the polymerase
toward a natural nucleotide and/or the unnatural nucleotide without
the modified sugar. In some embodiments, a polymerase has a
specificity for an unnatural nucleotide comprising a
linker-derivatized .alpha. or .beta. nucleobase analog that is at
least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%,
98%, 99%, 99.5%, 99.99% the specificity of the polymerase toward a
natural nucleotide and/or the unnatural nucleotide without the
linker. In some embodiments, the unnatural nucleobase is dTPT3. In
some embodiments, the unnatural nucleobase is dMMS. In some
embodiments, the unnatural nucleobase is dDMS. In some embodiments,
the unnatural nucleobase is dBrMS. In some embodiments, the
unnatural nucleobase is IMS. In some embodiments, the unnatural
nucleobase is dFEMS. In some embodiments, the unnatural nucleobase
is MMS.sup.pCO. In some embodiments, the unnatural nucleobase is
dMMS.sup.PA. In some embodiments, the unnatural nucleobase is
dFTPT3. In some embodiments, the unnatural nucleobase is
dTPT.sup.PA. In some embodiments, the unnatural nucleobase is
dTPT3.sup.CO. In some embodiments, the unnatural nucleobase
comprises the formula .alpha.14a or a derivative or analog thereof.
In some embodiments, the unnatural nucleobase comprises the formula
.alpha.14b or a derivative or analog thereof. In some embodiments,
the unnatural nucleobase comprises the formula .alpha.14c or a
derivative or analog thereof. In some embodiments, the unnatural
nucleobase comprises the formula .alpha.14d or a derivative or
analog thereof. In some embodiments, the unnatural nucleobase
comprises the formula .alpha.14e or a derivative or analog thereof.
In some embodiments, the unnatural nucleobase comprises the formula
.alpha.14f or a derivative or analog thereof. In some embodiments,
the unnatural nucleobase comprises the formula .beta.8a or a
derivative or analog thereof. In some embodiments, the unnatural
nucleobase comprises the formula .beta.8b or a derivative or analog
thereof.
[0115] Polymerases can be characterized according to their fidelity
when used with a particular natural and/or unnatural nucleotide or
collections of natural and/or unnatural nucleotides, wherein the
unnatural nucleotide comprises an .alpha. or .beta. nucleobase
analog disclosed herein. In various embodiments, fidelity generally
refers to the accuracy with which a polymerase incorporates correct
nucleotides into a growing oligonucleotide when making a copy of an
oligonucleotide template. Polymerase fidelity can be measured as
the ratio of correct to incorrect natural and unnatural nucleotide
incorporations when the natural and unnatural nucleotides are
present, e.g., at equal concentrations, to compete for strand
synthesis at the same site in the polymerase-strand-template
nucleic acid binary complex. DNA polymerase fidelity can be
calculated as the ratio of (k.sub.cat/K.sub.M) for the natural and
unnatural nucleotide and (k.sub.cat/K.sub.M) for the incorrect
natural and unnatural nucleotide; where k.sub.cat and K.sub.M are
Michaelis-Menten parameters in steady state enzyme kinetics. In
some embodiments, a polymerase has a fidelity value of at least
about 100, 1000, 10,000, 100,000, or 1.times.10.sup.6, with or
without a proofreading activity. In some embodiments, a polymerase
has a fidelity value of at least about 100, 1000, 10,000, 100,000,
or 1.times.10.sup.6 for unnatural nucleotide incorporation. In some
embodiments, the unnatural nucleotide is dTPT3TP or a derivative
thereof, and its corresponding nucleobase on the template
oligonucleotide is dNAM or a derivative thereof. In some
embodiments, the unnatural nucleotide is dNaMTP or a derivative
thereof, and its corresponding nucleobase on the template
oligonucleotide is dTPT3 or a derivative thereof. In some
embodiments, the unnatural nucleotide comprises .beta.8a or a
derivative thereof, and its corresponding nucleobase on the
template oligonucleotide comprises .alpha.14a or a derivative
thereof. In some embodiments, the unnatural nucleotide comprises
.beta.8a or a derivative thereof, and its corresponding nucleobase
on the template oligonucleotide comprises .alpha.14b or a
derivative thereof. In some embodiments, the unnatural nucleotide
comprises .beta.8a or a derivative thereof, and its corresponding
nucleobase on the template oligonucleotide comprises .alpha.14c or
a derivative thereof. In some embodiments, the unnatural nucleotide
comprises .beta.8a or a derivative thereof, and its corresponding
nucleobase on the template oligonucleotide comprises .alpha.14d or
a derivative thereof. In some embodiments, the unnatural nucleotide
comprises .beta.8a or a derivative thereof, and its corresponding
nucleobase on the template oligonucleotide comprises .alpha.14e or
a derivative thereof. In some embodiments, the unnatural nucleotide
comprises .beta.8a or a derivative thereof, and its corresponding
nucleobase on the template oligonucleotide comprises .alpha.14f or
a derivative thereof. In some embodiments, the unnatural nucleotide
comprises .beta.8b or a derivative thereof, and its corresponding
nucleobase on the template oligonucleotide comprises .alpha.14a or
a derivative thereof. In some embodiments, the unnatural nucleotide
comprises .beta.8b or a derivative thereof, and its corresponding
nucleobase on the template oligonucleotide comprises .alpha.14b or
a derivative thereof. In some embodiments, the unnatural nucleotide
comprises .beta.8b or a derivative thereof, and its corresponding
nucleobase on the template oligonucleotide comprises .alpha.14c or
a derivative thereof. In some embodiments, the unnatural nucleotide
comprises .beta.8b or a derivative thereof, and its corresponding
nucleobase on the template oligonucleotide comprises .alpha.14d or
a derivative thereof. In some embodiments, the unnatural nucleotide
comprises .beta.8e or a derivative thereof, and its corresponding
nucleobase on the template oligonucleotide comprises .alpha.14e or
a derivative thereof. In some embodiments, the unnatural nucleotide
comprises .beta.8f or a derivative thereof, and its corresponding
nucleobase on the template oligonucleotide comprises .alpha.14f or
a derivative thereof.
[0116] The unnatural base pairs exemplified herein, in some
embodiments, are synthesized/amplified with natural base pair-like
efficiency and fidelity. Unnatural base pairs comprise, in various
embodiments, any .alpha. nucleobase analog or derivative thereof,
and/or any .beta. nucleobase analog or derivative thereof. Examples
of .beta. analogs include dTPT3, d5SICS, dFTPT3 and derivatives or
analogs thereof. Examples of .alpha. analogs include dMMS, dDMS,
dBrMS, dIMS, dFEMS, dNAM, dMMO2, dDMO, dEMO, dFEMO, and derivatives
or analogs thereof. In some embodiments, an unnatural base pair is
efficiently amplified in a variety of different sequence contexts,
including GC- and AT-rich sequences, randomized sequences, and
sequences comprising multiple unnatural nucleobase pairs, with
greater than 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97%, 98%, 99%,
99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.85, 99.9 or
higher fidelity per doubling. For example, an unnatural nucleobase
pair comprising one or more unnatural nucleobases has a synthesis
efficiency and/or fidelity that is at least 60%, 65%, 70%, 75%, 80%
85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98%, or 99% similar to an amplification efficiency and/or fidelity
of a natural base pair. As another example, an unnatural nucleobase
pair comprising one or more unnatural nucleobases has a synthesis
efficiency and/or fidelity that is at most 15%, 14%, 13%, 12%, 11%,
10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or 0.5% less efficient
and/or accurate than that of a natural base pair. In some
embodiments, an unnatural nucleobase pair is transcribed with good
efficiency and selectivity in both strand contexts (e.g., dX must
template YTP insertion and dY must template XTP insertion). In some
embodiments, relative to the rate at which a fully natural sequence
is transcribed, the incorporation of an unnatural nucleotide does
not reduce the rate of full-length transcription. In some
embodiments, relative to the rate at which a fully natural sequence
is transcribed, the incorporation of an unnatural nucleotide
reduces the rate of full-length transcription by a factor less than
2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
25, 30, 35, or 40. In some embodiments, the unnatural base pair
comprises dTPT3 or a derivative or analog thereof, and dNaM or a
derivative or analog thereof. In some embodiments, the unnatural
base pair comprises dTPT3 or a derivative or analog thereof, and
dNaM or a derivative or analog thereof. In some embodiments, the
unnatural base pair comprises dTPT3 or a derivative or analog
thereof, and dNaM or a derivative or analog thereof. In some
embodiments, the unnatural base pair comprises dTPT3 or a
derivative or analog thereof, and dNaM or a derivative or analog
thereof. In some embodiments, the unnatural base pair comprises
dTPT3 or a derivative or analog thereof, and dNaM or a derivative
or analog thereof. In some embodiments, the unnatural base pair
comprises .beta.8a or a derivative or analog thereof, and
.alpha.14a or a derivative or analog thereof. In some embodiments,
the unnatural base pair comprises .beta.8a or a derivative or
analog thereof, and .alpha.14b or a derivative or analog thereof.
In some embodiments, the unnatural base pair comprises .beta.8a or
a derivative or analog thereof, and .beta.14c or a derivative or
analog thereof. In some embodiments, the unnatural base pair
comprises .beta.8a or a derivative or analog thereof, and
.alpha.14d or a derivative or analog thereof. In some embodiments,
the unnatural base pair comprises .beta.8a or a derivative or
analog thereof, and .alpha.14e or a derivative or analog thereof.
In some embodiments, the unnatural base pair comprises .beta.8a or
a derivative or analog thereof, and .alpha.14f or a derivative or
analog thereof. In some embodiments, the unnatural base pair
comprises .beta.8b or a derivative or analog thereof, and
.alpha.14a or a derivative or analog thereof. In some embodiments,
the unnatural base pair comprises .beta.8b or a derivative or
analog thereof, and .alpha.14b or a derivative or analog thereof.
In some embodiments, the unnatural base pair comprises .beta.8b or
a derivative or analog thereof, and .alpha.14c or a derivative or
analog thereof. In some embodiments, the unnatural base pair
comprises .beta.8b or a derivative or analog thereof, and
.alpha.14d or a derivative or analog thereof. In some embodiments,
the unnatural base pair comprises .beta.8b or a derivative or
analog thereof, and .alpha.14e or a derivative or analog thereof.
In some embodiments, the unnatural base pair comprises .beta.8b or
a derivative or analog thereof, and .alpha.14f or a derivative or
analog thereof.
[0117] Further provided herein, in various embodiments, are
unnatural base pairs comprising one or more unnatural nucleobases
(e.g. .alpha. nucleobase, .beta. nucleobase, or .alpha. nucleobase
and .beta. nucleobase), wherein one or two nucleobases comprise a
linker. A linker comprises a reactive center. Exemplary reactive
centers include, but are not limited to, alkyl, alkenyl, alkynyl,
phenyl, benzyl, halo, hydroxyl, carbonyl, aldehyde, haloformyl,
carbonate ester, carboxylate, carboxyl, ester, methoxy,
hydroperoxy, peroxy, ether, hemiacetal, hemiketal, acetal, ketal,
orthoester, methylenedioxy, orthocasrbonate ester, carboxamide,
primary amine, secondary amine, imide, azide, azo, cyanate,
isocyanate, nitrate, nitrile, isonitrile, nitrosooxy, nitro,
nitroso, pyridyl, sulfhydryl, sulfide, disulfide, sulfinyl, sulfo,
thiocyanate, isothiocyanante, carbonothioyl, phoshino, phosphono,
phosphate, borono, boronate, borino, borinate, and a combination
thereof. An example of a linker-derivatized nucleobase is
TPT3.sup.R shown in FIG. 2, wherein the superscript R indicates the
linker. In some embodiments, a linker is modified with a protecting
group, for example, TPT3.sup.PA, where the linker is a protected
propargyl linker.
[0118] In some embodiments, a nucleobase analog provided herein
comprises an amino-functional linker or a protected
amino-functional linker (e.g., dX.sup.PA). In certain embodiments,
the amino-functional linker is 3-aminopropyn-1-yl. In some
embodiments, a nucleobase analog provided herein comprises an
alkyne-azide ether linker for derivatization via click chemistry or
a protected alkyne-azide ether linker for derivatization via click
chemistry. In certain embodiments, the alkyne-azide ether linker is
4-oxahepat-1,6-diyn-1-yl. In some embodiments, a nucleobase analog
provided herein comprises an alkyne-azide trimethylene linker for
derivatization via click chemistry or a protected alkyne-azide
trimethylene linker for derivatization via click chemistry. In
certain embodiments, the alkyne-azide trimethylene linker is
hepta-1,6-diyn-1-yl. In some embodiments, X is a .beta. nucleoside
analog having any of the formulas from FIGS. 9, 12, 13, and 16. In
some embodiments, X is ICS, PICS, MICS, 4MICS, 5MICS, NICS, ONICS,
SICS, SNICS, 5SICS, 4SICS, 7OFP, 7OTP, TPT2, TPT3, or FTPT3. In
some embodiments, X is an .alpha. nucleoside analog having any of
the formulas from FIGS. 8, 10, 11, and 15. In some embodiments, X
is FIMO, MIMO, FEMO, PrMO, EMO, MEMO, IMO, MMO2, DMO, NMO, 5FM,
2OMe, TMO, FDMO, VMO, ZMO, CIMO, TfMO, CNMO, MMS, DMS, BrMS, IMS,
FEMS, NAM, or QMO.
[0119] In some embodiments, a linker is a propinyl linker, such as
those used with natural nucleotides. These linkers comprise
propargyl amines, with the amine serving as a reactive site to
attach other functionalities.
[0120] In various embodiments, a linker-derivatized nucleobase
comprises a spacer. An exemplary spacer is acetamidohexanamide. A
spacer may be hydrophilic. A spacer may connect a linker to a
functional group. Spacers include, but are not limited to, Spacer
C3 (3-carbon spacer), Spacer C6 (6-carbon spacer), photo-cleavable
spacer, hexanediol spacer, Spacer 9 (triethylene glycol spacer),
Spacer C12 (12-carbon spacer), Spacer 18 (18-atom
hexa-ethyleneglycol spacer), and 1',2'-Dideoxyribose spacer.
[0121] An unnatural nucleobase pair comprising one or two
linker-derivatized nucleobases, in some instances, is amplified
with an efficiency and fidelity that is similar to that of a
natural base pair or a non-linker derivatized unnatural base pair.
For example, an unnatural nucleobase pair comprising one or two
linker-derivatized unnatural nucleobases has a synthesis efficiency
and/or fidelity that has at least 60%, 65%, 70%, 75%, 80% 85%, 86%,
87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%
similar to a synthesis efficiency and/or fidelity of a natural base
pair or a non-linker derivatized unnatural base pair. As another
example, an unnatural nucleobase pair comprising one or two
linker-derivatized unnatural nucleobases has a synthesis efficiency
and/or fidelity that is at most 15%, 14%, 13%, 12%, 11%, 10%, 9%,
8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or 0.5% less efficient and/or
accurate than that of a natural base pair or a non-linker
derivatized unnatural base pair. In some embodiments, an unnatural
nucleobase pair comprises dTPT3.sup.PA. In some embodiments, an
unnatural nucleobase pair comprises dTPT3.sup.CO. In some
embodiments, an unnatural nucleobase pair comprises dMMS.sup.pCO.
In some embodiments, an unnatural nucleobase pair comprises
dMMS.sup.PA. In some embodiments, an unnatural nucleobase pair
comprises dNaM.sup.R. In some embodiments, an unnatural nucleobase
pair comprises dMMO2.sup.R. In some embodiments, an unnatural
nucleobase pair comprises dDMO.sup.R. In some embodiments, an
unnatural nucleobase pair comprises d5SICS.sup.R. In some
embodiments, an unnatural nucleobase pair comprises dMMS.sup.R. In
some embodiments, an unnatural nucleobase pair comprises
dDMS.sup.R. In some embodiments, an unnatural nucleobase pair
comprises dFEMS.sup.R. In some embodiments, an unnatural nucleobase
pair comprises dBrMS.sup.R. In some embodiments, an unnatural
nucleobase pair comprises dIMS.sup.R.
[0122] In some embodiments, a linker-derivatized unnatural
nucleobase has an increased insertion efficiency during
oligonucleotide synthesis, as compared to the same unnatural
nucleobase which does not comprise a linker. In some embodiments, a
linker-derivatized unnatural nucleobase has a decreased insertion
efficiency during oligonucleotide synthesis, as compared to the
same unnatural nucleobase which does not comprise a linker. In some
instances, a linker-derivatized unnatural nucleobase has about the
same insertion efficiency during oligonucleotide synthesis, as
compared to the same unnatural nucleobase which does not comprise a
linker. In some embodiments, a protected linker-derivatized
unnatural nucleobase has an increased insertion efficiency during
oligonucleotide synthesis, as compared to the same unnatural
nucleobase which does not comprise a protected linker. In some
embodiments, a protected linker-derivatized unnatural nucleobase
has a decreased insertion efficiency during oligonucleotide
synthesis, as compared to the same unnatural nucleobase which does
not comprise a protected linker. In some instances, a protected
linker-derivatized unnatural nucleobase has about the same
efficiency during oligonucleotide synthesis, as compared to the
same unnatural nucleobase which does not comprise a protected
linker.
[0123] Exemplary methods for analyzing unnatural base pair
synthesis efficiency (insertion of an unnatural nucleobase opposite
its partner in a template) and extension (continued primer
elongation) are provided herein. One or both of the nucleobases in
an unnatural base pair, in various embodiments, may be a
linker-derivatized unnatural nucleobase. One method uses a
presteady-state assay. The assay is based on determining, under a
fixed set of conditions, the amount of a primer (e.g. 23-mer) that
is extended by addition of the unnatural nucleotide opposite its
complementary nucleotide in a template (e.g., 45-mer) by a
polymerase (e.g., the Klenow fragment of E. coli DNA polymerase I).
In this assay, the efficiency of unnatural base pair synthesis is
characterized by measuring the percent incorporation (% inc) at a
given concentration of the unnatural and next correct triphosphate,
for example using a ratio such as
[24-mer+25-mer]/[23-mer+24-mer+25-mer]. In this assay, the
efficiency of extension is characterized by measuring the percent
extension (% ext) at a given concentration of the next correct
nucleotide and saturating concentrations of unnatural nucleotide,
for example using a ratio [25-mer]/[24-mer+25-mer]. Results from an
exemplary presteady-state assay are shown in Table 1, wherein the
unnatural triphosphate is 5SICS, FPT1, TPT1, TPT2, TPT3, FTPT3,
TPT3.sup.PA, or 5SICS.sup.PA. In some embodiments, the percent
incorporation of an unnatural nucleobase is at least 60%, 65%, 70%,
71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%,
84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, or 99%. In some embodiments, the percent extension of a
next correct nucleotide following insertion of an unnatural
nucleobase is at least 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%,
39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 90% or greater. In some embodiments,
synthesis efficiency is increased by derivatizing the unnatural
nucleobase. For example, by the addition of a linker, a protected
linker, and/or a linker conjugated to a cargo molecule. As another
example, derivatization includes atom substitutions, additions, or
deletions. In some embodiments, percent extension is increased by
derivatizing the unnatural nucleobase. Derivatization of an
unnatural nucleobase, in some instances, increases by at least 1-2
orders of magnitude the efficiency of insertion of the nucleotide
complementary to the base pair in the template. This increase in
efficiency may be due to an increase k.sub.cat and a decreased
K.sub.M.
TABLE-US-00001 TABLE 1 Presteady-state kinetics. dXTP %
Incorporation.sup.a % Extension.sup.b 5SICS 57.0 .+-. 0.2 15.1 .+-.
1.1 FPT1 7.2 .+-. 0.2 32.0 .+-. 1.5 TPT1 28.7 .+-. 0.5 8.8 .+-. 0.2
TPT2 65.7 .+-. 0.5 34.5 .+-. 0.5 TPT3 72.3 .+-. 0.5 49.8 .+-. 1.3
FTPT3 66.3 .+-. 0.5 33.8 .+-. 0.2 TPT3.sup.PA 68.3 .+-. 0.4 31.5
.+-. 0.7 5SICS.sup.PA 7.0 .+-. 0.2 5.5 .+-. 0.1 .sup.aIncorporation
assay conditions: 40 nM unnatural triphosphate, 2 .mu.M dCTP, 10 s.
.sup.bExtension assay conditions: 10 .mu.M unnatural triphosphate,
2 .mu.M dCTP, 10 s. dXTPs are paired with dNaM.
[0124] Further provided herein are replication evaluation methods.
In one method, a template nucleic acid duplex comprising an
unnatural base pair (e.g., dTPT3-dNaM or analogs thereof), is
amplified by PCR. In one example, a set of PCR reactions employs 48
cycles with OneTaq polymerase. In another example, a set of PCR
reactions employs 20 cycles of amplification with
exonuclease-negative Taq. Efficiency is determined by monitoring
the amplification level. Fidelity, generally defined as unnatural
base pair extension per doubling, is determined from the percentage
of the amplified DNA that retains the unnatural base pair. The
percentage of amplified DNA that retains the unnatural base pair
may be determined from the relative peak intensities of a
sequencing chromatogram. In some embodiments, the fidelity of
unnatural base pair replication is at least 98%, 98.1%, 98.2%,
98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%,
99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.91%, 99.92%,
99.93%, 99.94%, 99.95%, 99.96%, 99.97%, 99.98% or 99.99%.
Replication of an unnatural base pair may proceed with little or no
sequence bias, wherein little sequence bias indicates that an
unfavorable sequence decreases fidelity by less than 1%. Exemplary
fidelities are described in Example 1 and shown in Tables 4, 5, and
6.
[0125] Further provided herein, in various embodiments, are
oligonucleotides, including single-stranded and double-stranded
(e.g., duplex) DNA and/or RNA, comprising one or more unnatural
nucleobases described herein (e.g, any .alpha. nucleobase or analog
or derivative thereof and/or any .beta. nucleobase or analog or
derivative thereof). The nucleobase may be any .alpha. nucleobase
or .beta. nucleobase described herein, including those in FIGS. 2,
8, 9, 10, 11, 12, 13, 15, and 16. A double-stranded oligonucleotide
includes a DNA-DNA duplex, DNA-RNA hybrid duplex, and RNA-RNA
duplex. In some embodiments, the oligonucleotide comprises a
linker-derivatized nucleobase.
[0126] In some embodiments, an oligonucleotide comprises 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45,
50 or more unnatural nucleobases. In some embodiments, the
percentage of unnatural nucleobases in an oligonucleotide is
between about 0% and about 1%, between about 0% and about 2%,
between about 0% and about 3%, between about 0% and about 4%,
between about 0% and about 5%, between about 0% and about 10%,
between about 1% and about 10%, between about 1% and about 15%,
between about 1% and about 20%, between about 5% and about 10%,
between about 5% and about 20%, between about 10% and about 30%,
between about 1% and about 50%, or between about 1% and about
100%.
[0127] Examples of oligonucleotides comprising one or more
unnatural nucleobases include, but are not limited to, DNA aptamers
and RNA aptamers. DNA and RNA aptamers include, but are not limited
to, primers and molecular beacons. A DNA aptamer may include a
barcode.
[0128] In some embodiments, an oligonucleotide comprises dTPT3 or a
derivative or analog thereof. In some embodiments, an
oligonucleotide comprises d5SICS or a derivative or analog thereof.
In some embodiments, an oligonucleotide comprises dNaM or a
derivative or analog thereof. In some embodiments, an
oligonucleotide comprises dMMS or a derivative or analog thereof.
In some embodiments, an oligonucleotide comprises dDMS or a
derivative or analog thereof. In some embodiments, an
oligonucleotide comprises dFEMS or a derivative or analog thereof.
In some embodiments, an oligonucleotide comprises dBrMS or a
derivative or analog thereof. In some embodiments, an
oligonucleotide comprises dIMS or a derivative or analog thereof.
In some embodiments, an oligonucleotide comprises .beta.8a or a
derivative or analog thereof. In some embodiments, an
oligonucleotide comprises .beta.8b or a derivative or analog
thereof. In some embodiments, an oligonucleotide comprises
.alpha.14a or a derivative or analog thereof. In some embodiments,
an oligonucleotide comprises .alpha.14b or a derivative or analog
thereof. In some embodiments, an oligonucleotide comprises
.alpha.14c or a derivative or analog thereof. In some embodiments,
an oligonucleotide comprises .alpha.14d or a derivative or analog
thereof. In some embodiments, an oligonucleotide comprises
.alpha.14e or a derivative or analog thereof. In some embodiments,
an oligonucleotide comprises .alpha.14f or a derivative or analog
thereof.
[0129] In some embodiments, an oligonucleotide comprises dTPT3 or a
derivative or analog thereof, and dNaM or a derivative or analog
thereof. In some embodiments, an oligonucleotide comprises a
dTPT3-dNaM base pair. In some embodiments, an oligonucleotide
comprises one or more base pairs selected from dTPT3-dFEMO,
dTPT3-dFIMO, dTPT3-dIMO, dFTPT3-dNaM, dFTPT3-dFEMO, dFTPT3-dFIMO,
and dFTPT3-dIMO. In some embodiments, an oligonucleotide comprises
one or more base pairs selected from dTPT3-MMS, dTPT3-DMS,
dTPT3-FEMS, dTPT3-BrMS, dTPT3-IMS, dTPT3-dDMN, dTPT3-d4OMe,
dTPT3-dIQ, dTPT3-d2MN, dTPT3-d3OMe, dTPT3-dQL, dTPT3-d2Np,
dTPT3-dDM4, dTPT3-dDM, dTPT3-dBEN, dTPT3-d3FB, dTPT3-dMM1,
dTPT3-dMMO1, dTPT3-dDM2, dTPT3-dDM5, dTPT3-d2Py, dTPT3-d5MPy,
dTPT3-dEPy, dTPT3-d3MPy, dTPT3-d34DMPy, dTPT3-d45DMPy, dTPT3-d4MPy,
dTPT3-d35DMPy, dTPT3-dBP, dTPT3-dBTp, dTPT3-dBF, dTPT3-dIN,
dTPT3-dTp, dTPT3-dBTz, dTPT3-dMTp, dTPT3-dAM, dTPT3-dMAN,
dTPT3-dDMMAN, dTPT3-dADM, dTPT3-dMMAN, dTPT3-dTOK588,
dTPT3-dTOK576, dTPT3-dTOK587, dTPT3-dTOK586, dTPT3-dTOK580,
dTPT3-dPhMO, dTPT3-dPyMO1, dTPT3-PyMO2, dTPT3-dPMO1, dTPT3-dPMO2,
dTPT3-dPMO3, dTPT3-dFuMO1, dTPT3-dFuMO2, dTPT3-TpMO1, dTPT3-dTpMO2,
dTPT3-dFIMO, dTPT3-dIMO, dTPT3-dMIMO, dTPT3-dMEMO, dTPT3-dFEMO,
dTPT3-dPrMO, dTPT3-dMMO2, dTPT3-d2OMe, dTPT3-dDMO, dTPT3-dTMO,
dTPT3-dNMO, dTPT3-dNOPy, dTPT3-d5FM, dTPT3-dNAM, dTPT3-dAMO1,
dTPT3-dAPy, dTPT3-dAMO2, dTPT3-dMAPy, dTPT3-dAMO3, dTPT3-dDMAPy,
dTPT3-dFDMO, dTPT3-dVMO, dTPT3-dQMO, dTPT3-dZMO, dTPT3-dCIMO,
dTPT3-dTfMO, dTPT3-CNMO, d7AI-dMMS, dM7AI-dMMS, dImPy-dMMS,
dP7AI-dMMS, dPPP-dMMS, d8Q-dMMS, dICS-dMMS, dPICS-dMMS, dMICS-dMMS,
d4MICS-dMMS, d5MICS-dMMS, dNICS-dMMS, dONICS-dMMS, d7OFP-dMMS,
d7OTP-dMMS, d4OTP-dMMS, dPYR-dMMS, d4MP-dMMS, d3MP-dMMS,
dPPYR-dMMS, dMOP-dMMS, d4MOP-dMMS, dSICS-dMMS, dSNICS-dMMS,
d5SICS-dMMS, d4SICS-dMMS, dTPT1-dMMS, dTPT2-dMMS, dFPT1-dMMS,
dFTPT3-dMMS, d7AI-dDMS, dM7AI-dDMS, dImPy-dDMS, dP7AI-dDMS,
dPPP-dDMS, d8Q-dDMS, dICS-dDMS, dPICS-dDMS, dMICS-dDMS,
d4MICS-dDMS, d5MICS-dDMS, dNICS-dDMS, dONICS-dDMS, d7OFP-dDMS,
d7OTP-dDMS, d4OTP-dDMS, dPYR-dDMS, d4MP-dDMS, d3MP-dDMS,
dPPYR-dDMS, dMOP-dDMS, d4MOP-dDMS, dSICS-dDMS, dSNICS-dDMS,
d5SICS-dDMS, d4SICS-dDMS, dTPT1-dDMS, dTPT2-dDMS, dFPT1-dDMS,
dFTPT3-dDMS, d7AI-dFEMS, dM7AI-dFEMS, dImPy-dFEMS, dP7AI-dFEMS,
dPPP-dFEMS, d8Q-dFEMS, dICS-dFEMS, dPICS-dFEMS, dMICS-dFEMS,
d4MICS-dFEMS, d5MICS-dFEMS, dNICS-dFEMS, dONICS-dFEMS, d7OFP-dFEMS,
d7OTP-dFEMS, d4OTP-dFEMS, dPYR-dFEMS, d4MP-dFEMS, d3MP-dFEMS,
dPPYR-dFEMS, dMOP-dFEMS, d4MOP-dFEMS, dSICS-dFEMS, dSNICS-dFEMS,
d5SICS-dFEMS, d4SICS-dFEMS, dTPT1-dFEMS, dTPT2-dFEMS, dFPT1-dFEMS,
dFTPT3-dFEMS, d7AI-dBrMS, dM7AI-dBrMS, dImPy-dBrMS, dP7AI-dBrMS,
dPPP-dBrMS, d8Q-dBrMS, dICS-dBrMS, dPICS-dBrMS, dMICS-dBrMS,
d4MICS-dBrMS, d5MICS-dBrMS, dNICS-dBrMS, dONICS-dBrMS, d7OFP-dBrMS,
d7OTP-dBrMS, d4OTP-dBrMS, dPYR-dBrMS, d4MP-dBrMS, d3MP-dBrMS,
dPPYR-dBrMS, dMOP-dBrMS, d4MOP-dBrMS, dSICS-dBrMS, dSNICS-dBrMS,
d5SICS-dBrMS, d4SICS-dBrMS, dTPT1-dBrMS, dTPT2-dBrMS, dFPT1-dBrMS,
dFTPT3-dBrMS, d7AI-dIMS, dM7AI-dIMS, dImPy-dIMS, dP7AI-dIMS,
dPPP-dIMS, d8Q-dIMS, dICS-dIMS, dPICS-dIMS, dMICS-dIMS,
d4MICS-dIMS, d5MICS-dIMS, dNICS-dIMS, dONICS-dIMS, d7OFP-dIMS,
d7OTP-dIMS, d4OTP-dIMS, dPYR-dIMS, d4MP-dIMS, d3MP-dIMS,
dPPYR-dIMS, dMOP-dIMS, d4MOP-dIMS, dSICS-dIMS, dSNICS-dIMS,
d5SICS-dIMS, d4SICS-dIMS, dTPT1-dIMS, dTPT2-dIMS, dFPT1-dIMS,
dFTPT3-dIMS; wherein one or two unnatural nucleobases of the
unnatural base pair may be derivatized with a linker.
[0130] An oligonucleotide comprising an unnatural nucleobase
disclosed herein may further comprise one or more additional
unnatural bases, including, but not limited to, 2-aminoadenin-9-yl,
2-aminoadenine, 2-F-adenine, 2-thiouracil, 2-thio-thymine,
2-thiocytosine, 2-propyl and alkyl derivatives of adenine and
guanine, 2-amino-adenine, 2-amino-propyl-adenine, 2-aminopyridine,
2-pyridone, 2'-deoxyuridine, 2-amino-2'-deoxyadenosine
3-deazaguanine, 3-deazaadenine, 4-thio-uracil, 4-thio-thymine,
uracil-5-yl, hypoxanthin-9-yl (I), 5-methyl-cytosine,
5-hydroxymethyl cytosine, xanthine, hypoxanthine, 5-bromo, and
5-trifiuoromethyl uracils and cytosines; 5-halouracil,
5-halocytosine, 5-propynyl-uracil, 5-propynyl cytosine, 5-uracil,
5-substituted, 5-halo, 5-substituted pyrimidines,
5-hydroxycytosine, 5-bromocytosine, 5-bromouracil,
5-chlorocytosine, chlorinated cytosine, cyclocytosine, cytosine
arabinoside, 5-fluorocytosine, fluoropyrimidine, fluorouracil,
5,6-dihydrocytosine, 5-iodocytosine, hydroxyurea, iodouracil,
5-nitrocytosine, 5-bromouracil, 5-chlorouracil, 5-fluorouracil, and
5-iodouracil, 6-alkyl derivatives of adenine and guanine,
6-azapyrimidines, 6-azo-uracil, 6-azo cytosine, azacytosine,
6-azo-thymine, 6-thio-guanine, 7-methylguanine, 7-methyladenine,
7-deazaguanine, 7-deazaguanosine, 7-deaza-adenine,
7-deaza-8-azaguanine, 8-azaguanine, 8-azaadenine, 8-halo, 8-amino,
8-thiol, 8-thioalkyl, and 8-hydroxyl substituted adenines and
guanines; N4-ethylcytosine, N-2 substituted purines, N-6
substituted purines, O-6 substituted purines, those that increase
the stability of duplex formation, universal nucleic acids,
hydrophobic nucleic acids, promiscuous nucleic acids, size-expanded
nucleic acids, fluorinated nucleic acids, tricyclic pyrimidines,
phenoxazine cytidine([5,4-b][1,4]benzoxazin-2(3H)-one),
phenothiazine cytidine
(1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps,
phenoxazine cytidine
(9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole
cytidine (H-pyrido [3',2':4,5]pyrrolo [2,3-d]pyrimidin-2-one),
5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil,
hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)
uracil, 5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methythio-N6-isopentenyladeninje,
uracil-5oxyacetic acid, wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxacetic acid methylester,
uracil-5-oxacetic acid, 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine and those in which the purine or pyrimidine base
is replaced with a heterocycle.
[0131] An oligonucleotide comprising an unnatural nucleobase
disclosed herein, may further comprise an unnatural sugar moiety,
including, but not limited to, a modification at the 2' position:
OH; substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or
O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2 CH3,
ONO2, NO2, N3, NH2F; O-alkyl, S-alkyl, N-alkyl; O-alkenyl,
S-alkenyl, N-alkenyl; O-alkynyl, S-alkynyl, N-alkynyl;
O-alkyl-O-alkyl, 2'-F, 2'-OCH3,2'-O(CH2)2OCH3 wherein the alkyl,
alkenyl and alkynyl may be substituted or substituted C1-C10,
alkyl, C2-C10 alkenyl, C2-C10 alkynyl, --O[(CH2)nO]mCH3,
--O(CH2)nOCH3, --O(CH2)n NH2, --O(CH2)n CH3, --O(CH2)n-ONH2, and
--O(CH2)nON[(CH2)n CH3)]2, where n and m are from 1 to about 10;
and/or a modification at the 5' position: 5'-vinyl, 5'-methyl (R or
S), a modification at the 4' position, 4'-S, heterocycloalkyl,
heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted
silyl, an RNA cleaving group, a reporter group, an intercalator, a
group for improving the pharmacokinetic properties of an
oligonucleotide, or a group for improving the pharmacodynamic
properties of an oligonucleotide, and any combination thereof.
[0132] In some embodiments, the oligonucleotide comprising an
unnatural nucleobase disclosed herein, further comprises an
unnatural backbone. An unnatural backbone includes, but is not
limited to, phosphorothioate, chiral phosphorothioate,
phosphorodithioate, phosphotriester, aminoalkylphosphotriester,
C1-C10 phosphonates, 3'-alkylene phosphonate, chiral phosphonates,
phosphinates, phosphoramidates, 3'-amino phosphoramidate,
aminoalkylphosphoramidates, thionophosphoramidates,
thionoalkylphosphonates, thionoalkylphosphotriesters, and
boranophosphates.
[0133] Methods for determining the stability of oligonucleotide
duplexes comprising unnatural base pairs (with or without linkers)
include thermodynamic analysis by circular dichroism (CD)
measurements and UV melting experiments. In some embodiments, DNA
duplex stability studies are employed to facilitate the selection
of a suitable unnatural nucleotide base pair, unnatural nucleobase,
or unnatural nucleobase derivatives or substitutions. Suitably
selected unnatural base pairs include those which increase
oligonucleotide hybridization fidelity at other positions within
the duplex. Suitably selected unnatural base pairs include those
which increase oligonucleotide duplex stability. Suitably selected
nucleobases may be used to optimize oligonucleotides for
biotechnological or therapeutic applications where high fidelity
hybridization and discrimination is critical. In some instances, an
unnatural base pair is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, 99% or more, as stable as a natural base pair in an
oligonucleotide duplex. In some instances, the Tm of a duplex
comprising one or more unnatural base pairs is less than 10.degree.
C., 9.degree. C., 8.degree. C., 7.degree. C., 6.degree. C.,
5.degree. C., 4.5.degree. C., 4.degree. C., 3.5.degree. C.,
3.degree. C., 2.9.degree. C., 2.8.degree. C., 2.7.degree. C.,
2.6.degree. C., 2.5.degree. C., 2.4.degree. C., 2.3.degree. C.,
2.2.degree. C., 2.1.degree. C., 2.degree. C., 1.9.degree. C.,
1.8.degree. C., 1.7.degree. C., 1.6.degree. C., 1.5.degree. C.,
1.4.degree. C., 1.3.degree. C., 1.2.degree. C., 1.1.degree. C.,
1.degree. C., 0.9.degree. C., 0.8.degree. C., 0.7.degree. C.,
0.6.degree. C., 0.5.degree. C., 0.4.degree. C., 0.3.degree. C.,
0.2.degree. C., 0.1.degree. C. below the Tm of the same duplex
wherein the one or more unnatural nucleobases are replaced with one
or more natural nucleobases. In some embodiments, the presence of
an unnatural base pair in an oligonucleotide duplex does not
significantly perturb duplex structure.
[0134] In some embodiments, an oligonucleotide comprising a
linker-derivatized nucleobase allows for the site-specific
modification of that DNA or RNA during or after enzymatic
synthesis. An unnatural nucleotide disclosed herein (e.g. a
nucleotide comprising an unnatural a or .beta. nucleobase analog),
in some instances, is modified with a linker that enables the
attachment of different functional groups (e.g., cargo) without
ablating polymerase recognition. Site specific functionalities
include, but are not limited to fluorophores, NMR handles for
characterization (e.g., F19), IR probes (e.g., azido and cyano
groups), biotin (e.g. to facilitate identification and/or
purification), affinity tags, liposomes, and nanoparticles. In one
embodiment, a linker provides bioconjugation via cross-coupling
(e.g., iodo group). In one embodiment, a linker provides a handle
for bioconjugation via click chemistry (e.g., azido and alkyne
substituents). In one embodiment, an oligonucleotide comprising a
linker-derivatized nucleobase is useful as a primer and/or
molecular beacon.
[0135] Further provided herein, in various embodiments, is the use
of any nucleoside analogs disclosed herein (.alpha. or .beta.), or
analogs or derivatives thereof, in site-specific cleavage or
functionalization of an oligonucleotide. In some embodiments, a
nucleoside analog comprises one or more linkers configured for
site-specific modification. Examples of nucleotide analogs
comprising a linker moiety include, but are not limited to,
d5SICSCO, d5SICSCC, dDMOCO, dDMOCC, dMMO2pCO, dMMO2pCC, dTPT3,
dTPT3A, dTPT3PA, dTPT3CO, dMMSpCO, dMMSPA, and dTPT3CC, or ribosyl
forms thereof, or analogs thereof. Provided herein, in various
embodiments, are compositions of matter per se of the
functionalized oligonucleotides, methods of preparation of the
functionalized oligonucleotides, and methods of use of the
functionalized oligonucleotides. Various embodiments provide dTPT3,
dTPT3PA, dTPT3A, dTPT3CO, and dTPT3CC, or other linker-derivatized
analogs of dTPT3, incorporated into oligonucleotides and the
further reaction or derivatization of these unnatural nucleobase
analogs incorporated in a oligonucleotide with various reagents for
selective reaction with the unnatural nucleobase analogs in a
oligonucleotide wherein the naturally occurring nucleobases (A, T,
G, C, U) do not react with these reagents to any appreciable
extent. The dTPT3-based family of linker-bearing unnatural
nucleotides is especially central, as we have found that they are
more efficiently replicated by DNA polymerases than are base pairs
that include d5SICS or its linker-derivatized variants, which will
significantly facilitate many of the potential applications. In
some embodiments, the percent incorporation of an unnatural
nucleotide comprising a linker into an oligonucleotide is at least
60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%,
81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the percent
extension of a next correct nucleotide into an oligonucleotide,
wherein the next correct nucleotide follows incorporation of an
unnatural nucleotide comprising a linker, is at least 30%, 31%,
32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%,
45%, 46%, 47%, 48%, 49%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90% or greater. In some embodiments, the addition of a
site-specific functionality decreases the percent incorporation of
an unnatural nucleotide into an oligonucleotide by at most about
50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 14%, 13%, 12%, 11%, 10%,
9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1%. In some embodiments, the
fidelity of a linker-derivatized unnatural nucleotide is at least
98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%,
99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%,
99.91%, 99.92%, 99.93%, 99.94%, 99.95%, 99.96%, 99.97%, 99.98% or
99.99%.
[0136] Accordingly, in various embodiments, provided herein are
methods for using the linker-derivatized unnatural nucleotides to
produce DNA or RNA that is site-specifically modified with another
molecule of interest. In some embodiments, site-specific inclusion
of different functionalities occurs either pre- or
post-amplification. In some embodiments, site-specific
functionalization is employed for SELEX applications.
[0137] An exemplary strategy to produce DNA or RNA that is
site-specifically modified with another molecule of interest is
referred to as the phosphorothioate strategy (FIG. 3), which relies
on the site-specific incorporation of a phosphorothioate group into
an DNA or RNA via a ribo or deoxyribo .alpha.-thiotriphosphate of
one of the unnatural nucleosides from FIG. 1 or 2. After
incorporation into DNA or RNA, the phosphorothioate may be used to
couple reagents that bear .gamma.-bromo-.alpha.,.beta.-unsaturated
carbonyl-, iodo (or bromo)acetyl-, or aziridinylsulfonamide
moieties to produce site-specifically functionalized DNA or RNA.
Alternatively, after incorporation into DNA or RNA, the
phosphorothioate may be used to site-specifically cleave the DNA or
RNA using iodine in an alkaline solution or iodoethanol,
respectively. Thus, the phosphorothioate strategy provides
site-specific modification of the nucleic acid backbone, and
provides for a method of site-specific cleavage of the
oligonucleotide chain.
[0138] Another strategy to produce DNA or RNA that is
site-specifically modified with another molecule or interest,
referred to as the linker strategy (FIGS. 4 and 5), makes use of
the derivatization of an unnatural nucleobases with a linker (FIG.
2) that may be used to attach functional groups of interest, either
before polymerization (via PCR or T7 RNA polymerase-mediated
transcription using an appropriate functionalized nucleobase
triphosphate reagent that is incorporated into the DNA or RNA chain
being synthesized), or by reaction of the linker of the unnatural
nucleobase after incorporation into the oligonucleotide chain with
an appropriate functionalization reagent, e.g., an NHS containing
reagent also comprising the desired functional group, wherein the
NHS reacts with the free amino group of an amino-functionalized
unnatural nucleobase such as d5SICS.sup.A, dMMO2.sup.A, or
dTPT3.sup.A. FIG. 4 also shows the amino functionalization linker
strategy using d5SICS.sup.A and dMMO2.sup.PA that allows
site-specific double labeling of duplex DNA.
[0139] For example, functionalization can be accomplished after
incorporation into the oligonucleotide of the unnatural nucleobase
with the linker bearing a primary amino group (e.g., dTPT3A). More
specifically, the functionalization can be carried out via reaction
of the primary amino (e.g., propargylamino group) and a
cargo-bearing reagent including an N-hydroxysuccinimide (NHS) ester
(FIG. 4). The analogs developed for this application include
d5SICS.sup.A, d5SICS.sup.PA, dMMO2.sup.A, dMMO2.sup.PA,
dTPT3.sup.PA, and dTPT3.sup.A (recall that "A" refers to the
nucleotide with a propargyl amine and "PA" refers to the same
linker with a protecting group, see FIG. 2 and its caption). The
use of dTPT3.sup.PA, bearing a protected primary propargylamino
group, and dTPT3A, bearing the primary propargylamino group, for
sequence-specific functionalization of oligonucleotides, is
disclosed and claimed herein.
[0140] The site-specific functionalization of a oligonucleotide can
also be accomplished using the Copper(I)-catalyzed Azide-Alkyne
Cycloaddition (CuAAC) (i.e. "Click chemistry" linker strategy; FIG.
5), and for these applications d5SICS.sup.CO, d5SICS.sup.CC,
dDMO.sup.CO, dDMO.sup.CC, dMMO2.sup.pCO, dMMO2.sup.pCC,
dTPT3.sup.CO and dTPT3.sup.CC (FIG. 2), may be used. In each case,
the ribosyltriphosphates of the unnatural nucleobases can be
employed for transcription to produce site-specifically labeled
RNA, and the deoxyribosyltriphosphates of the unnatural nucleobases
can be used, e.g., in PCR, to produce site-specifically labeled
DNA. The unnatural nucleobases comprising an acetylenic (alkynyl)
linker group suitable for use in CuAAC conjugation, d5SICS.sup.CO,
d5SICS.sup.CC, dDMO.sup.CO, dDMO.sup.CC, dMMO2.sup.pCO,
dMMO2.sup.pCC, dTPT3.sup.CO and dTPT3.sup.CC, methods of their
preparation, and methods of their use in preparing such
site-specifically labeled oligonucleotides, are disclosed and
claimed herein.
[0141] Demonstration of General Phosphorothioate Strategy (FIG.
3).
[0142] To demonstrate the feasibility of our system, we have
prepared the .alpha.-thiotriphosphate of the unnatural nucleotide,
d5SICS (d5SICS-aS), and incorporated it into DNA opposite its
cognate unnatural nucleotide dNaM, using standard PCR. The
amplification efficiency and fidelity of incorporation of
d(5SICS-aS)TP is greater than 99% and virtually identical to
results obtained with d5SICS. To functionalize this unnatural base
pair, we reacted the site-specifically incorporated
phosphorothioate bond with iodoacetyl-PEG.sub.2-biotin to label the
DNA duplex with the biotin functionality..sup.8 To characterize
this site-specific adduct, we incubated it in the presence of
streptavidin and then quantified the functionalization by gel shift
assay. We were able to convert 60-70% of the phosphorothioate bond
to the functionalized derivative, which is a standard efficiency
(70%) for labeling protocols previously reported in literature (See
Fidanza, J. A.; Ozaki, H.; McLaughlin, L. W., Site-specific
labeling of DNA sequences containing phosphorothioate diesters. J.
Am. Chem. Soc. 2002, 114 (14), 5509-5517.). These conjugated
derivatives show high stability under conditions typical for heat
denaturation of DNA duplexes, i.e. at 50.degree. C. overnight
within the range of pH 6.0-8.3 (<10% decomposition), as well as
for at 95.degree. C. for 3 minutes at pH 8.3 (<5%
decomposition). We envision that the phosphorothioate strategy can
be equally well employed with other unnatural base pairs, including
d5SICS-dMMO2 and d5SICS-dNaM.
[0143] Provided herein, in various embodiments, is a
phosphorothioate strategy using an unnatural base pair dTPT3-dNaM,
dTPT3-dMMO2, or dTPT3-dDMO, and linker-derivatized variants
thereof.
[0144] The phosphorothioate and linker-based strategies are not
mutually exclusive and when combined should allow for a given site
to be simultaneously modified with up to three different functional
groups, one attached to a first nucleobase of a nucleobase pair, a
second attached to a second nucleobase of a nucleobase pair, and a
third attached to the backbone immediately 5' to an unnatural
nucleotide.
[0145] Demonstration of Linker Strategy with Primary Amine (FIG.
4).
[0146] To further demonstrate the feasibility of our system, we
have synthesized and characterized the amino- and protected
amino-linker derivatized variants of d5SICS and dMMO2 (FIG. 2).
When paired in DNA opposite their cognate unnatural partners, we
showed that each was well amplified by PCR and transcribed into
RNA. Coupling of DNA containing dMMO2A or d5SICS.sup.A prepared by
PCR amplification with NHS-ester biotin proceeds with 55% and 70%
efficiency, respectively.
[0147] We have shown that the ribonucleotide triphosphates of
5SICS.sup.PA, 5SICS.sup.A, MMO2.sup.PA or MMO2.sup.A, are
transcribed into RNA by T7 RNA polymerase with high efficiency and
fidelity (FIG. 7).
[0148] Provided herein, in various embodiments, is the
site-specific modification of DNA or RNA using dTPT3.sup.L-dNaM,
dTPT3.sup.L-dMMO2, or dTPT3.sup.L-(d)DMO (where R is a linker, e.g.
R=H for dTPT3, R=3-aminopropyn-1-yl for dTPT3.sup.A,
R=dichloroacetyl-3-aminopropyn-1-yl for dTPT3.sup.PA,
R=4-oxahepat-1,6-diyn-1-yl for dTPT3.sup.CO, R=hepta-1,6-diyn-1-yl
for dTPT3.sup.CC).
[0149] Demonstration of General Linker Strategy with Alkynes (FIG.
5).
[0150] To further demonstrate the feasibility of our system, we
have synthesized and characterized the alkynyl functionalized
variants of d5SICS, dDMO, and dMMO2, including d5SICS.sup.co,
d5SICS.sup.CC, dDMO.sup.CO, dDMO.sup.CC, dMMO2.sup.pCO,
dMMO2.sup.pCC (FIG. 2) each of these alkyne-functionalized
unnatural nucleotide should be efficiently PCR amplified when
present in DNA. Once amplified, the DNA containing, for example,
the d5SICS.sup.CO-dNaM base pair, may be efficiently
site-specifically modified with small molecules or one or more
proteins possessing azide groups using Click chemistry, e.g.,
copper-catalyzed click reactions. We have also demonstrated the
utility of dEMO, and dFEMO (FIG. 2) for incorporation into
oligonucleotides and the use of these functionalized
oligonucleotides in click chemistry reactions with azides to
functionalize the oligonucleotides in a site-specific manner.
[0151] Demonstration of Linker Strategy with dTPT3.sup.PA (FIG.
6).
[0152] Addition of a linker to the d5SICS and dMMO2 scaffolds
significantly reduces the efficiency with which the unnatural
nucleotides are enzymatically incorporated in DNA, which is
expected to limit their practical applications. However, we have
found that the dTPT3 scaffold is much more tolerant to linker
addition (FIG. 6). For example, dTPT3.sup.PATP is incorporated into
a primer opposite dNaM in a temple by DNA polymerases with
virtually the same efficiency and fidelity as a natural base pair.
Accordingly, provided herein, in various embodiments, is the use of
unnatural nucleobases based on the dTPT3 scaffold, including
dTPT3.sup.PA (protected amino-functional linker), dTPT3.sup.A
(amino-functional linker), and dTPT3.sup.CO (alkyne-azide ether
linker for derivatization via click chemistry), and dTPT3.sup.CC
(alkyne-azide trimethylene linker for derivatization via click
chemistry) in the synthesis of site-specific functionalized
oligonucleotides.
[0153] Scheme 1 illustrates examples of dTPT3 with different
linkers that could be used to site-specifically modify DNA or
RNA.
##STR00017## ##STR00018##
[0154] For clarity only the dTPT3 scaffold nucleobase moieties are
shown, but it is understood that they are used as nucleotides. The
functionalization reactions can be carried out either prior to or
after incorporation of the unnatural nucleobases into a
oligonucleotide. Scheme 1, top reaction, illustrates the use of
dTPT3.sup.A comprising a primary amine-bearing linker that is
acylated using an activated ester to form an amide, wherein the R
group comprises the cargo. The middle reaction of Scheme 1
illustrates the use of dTPT3.sup.CO (dTPT3.sup.CC could also be
used) comprising an alkynyl-bearing linker reacted with an azide to
yield a triazole via Click chemistry, wherein the R group of the
triazole that is formed comprises the cargo. The bottom reaction
illustrates the most general case for a dTPT3 scaffold derivative
bearing a linker group R.sub.1 with a reactive moiety that can
selectively form a covalent bond with a R.sub.2 group that includes
a reactive moiety complementary to the reactive moiety of the
linker, for example, thiol-maleimide, hydrazine-aldehyde, etc.
[0155] In one embodiment, a linker comprising an azide reactive
group is useful for attaching an alkyne comprising cargo through a
click reaction. In one embodiment, a linker comprising a thiol
group can form reversible disulfide bonds or irreversible bonds
with a variety of cargo accepting groups, including, but not
limited to, maleimide, bromide, iodide, sulphonyl derivatives,
active esters and isothiocyanate derivatives. In one embodiment, a
linker comprising an azide group is reactive with a cargo molecule
comprising a phosphine group.
[0156] In one embodiment, an oligonucleotide comprising one or more
linker-derivatized unnatural nucleobases is configured for use as a
molecular beacon. The fluorophore of the molecular beacon is a
cargo molecule attached to a reactive center of the
linker-derivatized unnatural nucleobase. Exemplary fluorophore
cargo molecules include, but are not limited to, 6-FAM,
Fluorescein, Cy3.TM., JOE
(6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein), Cy5', TAMRA,
MAX, TET.TM., ROX (carboxy-X-rhodamine), TYE.TM. 563,
Hexachlorofluorescein, TEX 615, TYE.TM. 665, TYE 705, Alexa
Fluor.RTM. 488, Alexa Fluor.RTM. 532, Alexa Fluor.RTM. 546, Alexa
Fluor.RTM. 594, Alexa Fluor.RTM. 647, Alexa Fluor.RTM. 660, Alexa
Fluor.RTM. 750, IRDye.RTM. 800CW, ATTO.TM. 488, ATTO.TM. 532,
ATTO.TM. 550, ATTO.TM. 565, ATTO.TM. Rho101, ATTO.TM. 590, ATTO.TM.
633, ATTO.TM. 647N, Rhodamine Green.TM.-X, Rhodamine Red.TM.-X,
5-TAMRA.TM., Texas Red.RTM.-X, Lightcycler.RTM. 640, and Dy
750.
[0157] An unnatural base pair, in some embodiments, allows for the
site-specific inclusion of different functionalities into DNA for
Systematic Evolution of Ligands by Exponential Enrichment (SELEX)
applications, including the generation of DNA and/or RNA aptamers.
DNA and RNA aptamers have a variety of targets, including nucleic
acids, small molecules, peptides, carbohydrates, and cells. SELEX
includes the creation of a library of nucleic acid molecules,
contacting the library with target molecules to select nucleic acid
molecules which bind to the target molecules, and amplifying
library members which bound to target molecules. Additional rounds
of selection and amplification continue until sufficient aptamers
are recovered. An aptamer, in one aspect, includes any unnatural
base disclosed herein. In some embodiments, a SELEX experiment,
wherein library components comprise unnatural nucleobases,
generates an aptamer affinity against a target molecule in 1, 2, 3,
4, 5, 6, 7, 8, 9, 10 or fewer rounds of selection than a library
which does not comprise unnatural nucleobases. In some embodiments,
an aptamer comprising one or more unnatural nucleobases has a
greater affinity for a target molecule than an aptamer containing
only natural nucleobases. The addition of one or more unnatural
nucleobases in a SELEX library increases the chemical and
structural diversity of the resulting DNA or RNA aptamers. In some
embodiments, an unnatural aptamer has at least a nanomolar affinity
against its target molecule. In some embodiments, an unnatural
aptamer has at least a picomolar affinity against its target
molecule. For example, an unnatural aptamer has an affinity for its
target molecule which is between 1 and 1,000 pM. In some
embodiments, an unnatural aptamer has at least a femtomolar
affinity for its target molecule. For example, an unnatural aptamer
has an affinity for its target molecule which is between 1 and
1,000 fM. An unnatural aptamer selected using SELEX may comprise 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or more unnatural nucleobases.
In some embodiments, an unnatural aptamer comprises dTPT3 or a
derivative or analog thereof. In some embodiments, an unnatural
aptamer comprises a nucleobase having the formula .alpha.14a or a
derivative or analog thereof. In some embodiments, an unnatural
aptamer comprises a nucleobase having the formula .alpha.14b or a
derivative or analog thereof. In some embodiments, an unnatural
aptamer comprises a nucleobase having the formula .beta.14c or a
derivative or analog thereof. In some embodiments, an unnatural
aptamer comprises a nucleobase having the formula .alpha.14d or a
derivative or analog thereof. In some embodiments, an unnatural
aptamer comprises a nucleobase having the formula .alpha.14e or a
derivative or analog thereof. In some embodiments, an unnatural
aptamer comprises a nucleobase having the formula .beta.14f or a
derivative or analog thereof. In some embodiments, an unnatural
aptamer comprises a nucleobase having the formula .beta.8a or a
derivative or analog thereof. In some embodiments, an unnatural
aptamer comprises a nucleobase having the formula .beta.8b or a
derivative or analog thereof.
[0158] Various combinations of the components set forth above in
regard to exemplary reaction mixtures and reaction methods can be
provided in a kit form. Such a kit can include individual
components that are separated from each other, for example, being
carried in separate vessels or packages. A kit can include one or
more sub-combinations of the components set forth herein, the one
or more sub-combinations being separated from other components of
the kit. The sub-combinations can be combinable to create a
reaction mixture set forth herein (or combined to perform a
reaction set forth herein). In particular embodiments, a
sub-combination of components that is present in an individual
vessel or package is insufficient to perform a reaction set forth
herein.
[0159] However, the kit as a whole can include a collection of
vessels or packages the contents of which can be combined to
perform a reaction set forth herein.
[0160] A kit can include a suitable packaging material to house the
contents of the kit. The packaging material can be constructed by
well-known methods, preferably to provide a sterile,
contaminant-free environment. The packaging materials employed
herein can include, for example, those customarily utilized in
commercial kits sold for use with nucleic acid sequencing systems.
Exemplary packaging materials include, without limitation, glass,
plastic, paper, foil, and the like, capable of holding within fixed
limits a component set forth herein.
[0161] The packaging material can include a label which indicates a
particular use for the components. The use for the kit that is
indicated by the label can be one or more of the methods set forth
herein as appropriate for the particular combination of components
present in the kit. For example, a label can indicate that the kit
is useful for a method of conjugating a cargo molecule to a linker
moiety of an unnatural nucleobase in an oligonucleotide.
[0162] Instructions for use of the packaged reagents or components
can also be included in a kit. The instructions will typically
include a tangible expression describing reaction parameters, such
as the relative amounts of kit components and sample to be admixed,
maintenance time periods for reagent/sample admixtures,
temperature, buffer conditions, and the like.
[0163] It will be understood that not all components necessary for
a particular reaction need be present in a particular kit. Rather
one or more additional components can be provided from other
sources. The instructions provided with a kit can identify the
additional component(s) that are to be provided and where they can
be obtained.
[0164] In one embodiment, a kit provides one or more unnatural
nucleobases or derivatives thereof and reagents configured for
performing site-specific functionalization using the one or more
unnatural nucleobases or derivatives thereof.
EXAMPLES
[0165] Currently, the free nucleosides and phosphoramidites of
d5SICS and dNaM are commercially available from Berry and
Associates (Dexter, Mich.).
Example 1. PCR-Based Screen to Identify Unnatural Base Pairs
[0166] The triphosphates of the .alpha.6 group were prepared from
the previously reported nucleosides (Kubelka, T., Slavetinska, L.,
Eigner, V. and Hocek, M. Synthesis of 2,6-disubstituted
pyridin-3-yl C-2'-deoxyribonucleosides through chemoselective
transformations of bromo-chloropyridine C-nucleosides. Org. Biomol.
Chem., 11, 4702-4718) according to Ludwig, J. and Eckstein, F.
Rapid and efficient synthesis of nucleoside
5'-0-(1-thiotriphosphates), 5'-triphosphates and
2',3'-cyclophosphorothioates using
2-chloro-4H-1,3,2-benzodioxaphosphorin-4-one. J. Org. Chem., 54,
631-635. The purity of all other triphosphates was confirmed by
MALDI-TOF and UV-VIS. Taq and OneTaq DNA polymerases were purchased
from New England Biolabs (Ipswich, Mass.). A mixture of dNTPs was
purchased from Fermentas (Glen Burnie, Md.). SYBR Green I Nucleic
Acid Gel Stain (10,000.times.) was purchased from Life Technologies
(Carlsbad, Calif.). The synthesis of the DNA templates, D8
(Malyshev, D. A., Dhami, K., Quach, H. T., Lavergne, T.,
Ordoukhanian, P., Torkamani, A. and Romesberg, F. E. Efficient and
sequence-independent replication of DNA containing a third base
pair establishes a functional six-letter genetic alphabet. Proc.
Natl. Acad. Sci. USA, 109, 12005-12010), used for screening rounds
1-5, and D6 (Malyshev, D. A., Seo, Y. J., Ordoukhanian, P. and
Romesberg, F. E. PCR with an expanded genetic alphabet. J. Am.
Chem. Soc., 131, 14620-14621), used for all other amplifications,
was described previously. Sanger sequencing was carried out as
described previously (Malyshev, D. A., Dhami, K., Quach, H. T.,
Lavergne, T., Ordoukhanian, P., Torkamani, A. and Romesberg, F. E.
Efficient and sequence-independent replication of DNA containing a
third base pair establishes a functional six-letter genetic
alphabet. Proc. Natl. Acad. Sci. USA, 109, 12005-12010). Raw Sanger
sequencing traces were used to determine the percent retention of
the unnatural base pairs, which was converted to fidelity per
doubling, as described (Malyshev, D. A., Dhami, K., Quach, H. T.,
Lavergne, T., Ordoukhanian, P., Torkamani, A. and Romesberg, F. E.
Efficient and sequence-independent replication of DNA containing a
third base pair establishes a functional six-letter genetic
alphabet. Proc. Natl. Acad. Sci. USA, 109, 12005-12010; Malyshev,
D. A., Seo, Y. J., Ordoukhanian, P. and Romesberg, F. E. PCR with
an expanded genetic alphabet. J. Am. Chem. Soc., 131,
14620-14621).
[0167] All PCR amplifications were performed in a CFX Connect
Real-Time PCR Detection System (Bio-Rad), in a total volume of 25
.mu.L using the following conditions: 1.times. OneTaq reaction
buffer, 0.5.times. Sybr Green I, MgSO4 adjusted to 4.0 mM, 0.2 mM
of each dNTP, 50 .mu.M of each unnatural triphosphate, 1 mM of
Primer1 and Primer2 (See Table 2), and 0.02 U/.mu.l of the DNA
polymerase. Other conditions specific for each round of screening
are described in Table 3. Amplified products were purified using
DNA Clean and Concentrator-5 spin columns from Zymo Research
(Irvine, Calif.). After purification, the PCR products were
sequenced on a 3730 DNA Analyzer (Applied Biosystems) to determine
the retention of the unnatural base pair as described below.
Fidelity was characterized from unnatural base pair (UBP) retention
as determined by sequencing with Primer1 on a 3730 DNA Analyzer
(Applied Biosystems).
TABLE-US-00002 TABLE 2 DNA sequences. Name Sequence (5' to 3')
Remarks Primer1 CACACAGGAAACAGCTATGAC (SEQ ID Primers NO: 1) for
PCR Primer2 GAAATTAATACGACTCACTATAGG (SEQ ID NO: 2) Primer1-
TTTTTTTTTTTTTTTTTTTTTTTTTTTTT Primers poly-dT
TTTTTTTTTTTTTTTTTTTTTTTTTTTTT for Sanger TCACACAGGAAACAGCTATGAC
sequencing (SEQ ID NO: 3) Primer2- TTTTTTTTTTTTTTTTTTTTTTTTTTTTT
poly-dT TTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTGAAATTAATACGACTCACTATAGG
(SEQ ID NO: 4) D8 CACACAGGAAACAGCTATGACCCGGGTTA
TTACATGCGCTAGCACTTGGAATTCACAA TACT NaM TCTTTAAGGAAACCATAGTA
AATCTCCTTCTTAAAGTTAAGCTTAACCC TATAGTGAGTCGTATTAATTTC (SEQ ID NO: 5)
D6 CACACAGGAAACAGCTATGACCCGGGTTA N = TTACATGCGCTAGCACTTGGAATTCACCA
randomized GACGNNN NaM NNNCGGGACCCATAGTA natural
AATCTCCTTCTTAAAGTTAAGCTTAACCC nucleotide TATAGTGAGTCGTATTAATTTC
(SEQ ID NO: 6)
TABLE-US-00003 TABLE 3 PCR conditions for each consecutive round of
the PCR screen. Reaction Components Rounds 1-4 Round 5 Round 6
Final PCR characterization Buffer 1 .times. OneTaq 1 .times. OneTaq
1 .times. OneTaq 1 .times. OneTaq 1 .times. OneTaq Enzyme OneTaq
Taq OneTaq or Taq OneTaq Taq Template D8.sup.a (0.1 ng) D8.sup.a
(0.1 ng) D6.sup.a (0.01 ng) D6.sup.a (0.01 ng) D6.sup.a (0.01 ng)
Thermal conditions Initial 96.degree. C., 60 s 96.degree. C., 60 s
96.degree. C., 60 s 96.degree. C., 60 s 96.degree. C., 60 s
denaturing Denaturing 96.degree. C., 10 s 96.degree. C., 10 s
96.degree. C., 5 s 96.degree. C., 5 s 96.degree. C., 10 s Annealing
60.degree. C., 15 s 60.degree. C., 15 s 60.degree. C., 5 s
60.degree. C., 5 s 60.degree. C., 5 s Extension 68.degree. C., 60 s
68.degree. C., 60 s 68.degree. C., 10 s 68.degree. C., 10 s
68.degree. C., 30 s # of cycles 16 16 24 16 + 16 + 20.sup.b 16 + 16
+ 20.sup.b .sup.aSee Table 2 for sequences of the templates and
primers. .sup.bInitial amount of template was 0.01 ng. PCR mixture
was amplified over 16 cycles, diluted 40,000-fold and amplified
over another 16 cycles. The dilution/amplification step was
repeated resulting in 52 total cycles of amplification.
[0168] Specific PCR assay conditions. PCR with the most promising
UBPs was carried out with the conditions as described in Table 3.
PCR products were further purified on 2% agarose gels, followed by
single band excision and subsequent clean up using the Zymo
Research Zymoclean Gel DNA Recovery Kit. After elution with 20
.mu.l of water, the DNA concentration was measured using
fluorescent dye binding (Quant-iT dsDNA HS Assay kit, Life
Technologies), and purified amplicons were sequenced in triplicate
with both Primer1 and Primer2 to determine UBP retention and thus
amplification fidelity. Amplification of DNA containing the pairs
involving analogs of group .alpha.6 was performed with OneTaq
polymerase under the following thermal cycling conditions: initial
denaturation at 96.degree. C. for 1 min; 16 cycles of 96.degree. C.
for 10 s, 60.degree. C. for 15 s, 68.degree. C. for 1 min. Fidelity
was determined by sequencing amplicons in the Primer1 direction in
triplicate. Amplification of DNA containing the UBPs formed between
dTPT3 and d2MN or dDM2 was performed using OneTaq or Taq
polymerases for 16 cycles under the following thermal cycling
conditions: 1) OneTaq: initial denaturation at 96.degree. C. for 1
min, 96.degree. C. for 10 s, 60.degree. C. for 15 s, 68.degree. C.
for 1 min; or 2) Taq: initial denaturation at 96.degree. C. for 1
min, 96.degree. C. for 5 s, 60.degree. C. for 5 s, 68.degree. C.
for 10 s. Fidelity was determined by sequencing amplicons in the
Primer1 direction in triplicate.
[0169] Results. To screen for well replicated UBPs, unnatural
deoxynucleoside triphosphates were grouped for analysis into either
dMMO2/dNaM- or d5SICS/dTPT3-like analogs, although the distinction
is not completely clear in all cases. In total, 80 dMMO2/dNaM
analogs were grouped into twelve "a groups" (.alpha.1-.alpha.12;
FIG. 8), and 31 d5SICS/dTPT3 analogs were grouped into six ".beta.
groups" (.beta.1-.beta.6; FIG. 9). Note that the group designations
used here should not be confused with anomer designation (all
analogs examined are .beta. glycosides). In addition, to increase
the structure-activity relationship (SAR) content of the screen,
seven previously reported nucleoside analogs (dTOK576-dTOK588) with
substituted pyridyl nucleobases (Kubelka, T., Slavetinska, L.,
Eigner, V. and Hocekm M. Synthesis of 2,6-disubstituted
pyridin-3-yl C-2'-deoxyribonucleosides through chemoselective
transformations of bromo-chloropyridine C-nucleosides. Org. Biomol.
Chem., 11, 4702-4718.) were phosphorylated and included as group
.alpha.6. For screening, a 134-mer single-stranded DNA template
containing a centrally located dNaM (referred to as D8) was PCR
amplified in the presence of the natural triphosphates (200 .mu.M
each), all pairwise combinations of an .alpha. and a .beta.
triphosphate group shown in FIGS. 8 and 9 (50 .mu.M each), and 0.02
U/.mu.L DNA polymerase. During the first round of PCR, dNaM
templates the incorporation of an .alpha. analog and is then
replaced by a .beta. analog when the original strand is copied in
the second round, with the resulting UBP amplified in subsequent
rounds. The amplification product of each reaction was analyzed by
Sanger sequencing. The presence of an unnatural nucleotide results
in the abrupt termination of the sequencing chromatogram, allowing
the level of UBP retention to be quantified by the amount of read
through. The percentage of UBP retained in the DNA after
amplification during each round of screening is shown in FIG.
14.
[0170] The first round of screening employed 0.1 ng of template and
16 cycles of amplification under relatively permissive conditions
that included OneTaq polymerase and a 1 min extension time. For
this example, OneTaq is considered permissive because it is a
mixture of Taq (a family A polymerase) and Deep Vent (a family B
polymerase), with the latter possessing exonucleotidic proofreading
that allows for the excision of an incorrectly incorporated
triphosphate. Under these conditions, only the pairs involving
group .beta.5 or .beta.6 showed high retention.
[0171] The combinations of .beta.5 or .beta.6 and the .alpha.
groups that showed the highest retention were progressed to a
second round of screening, wherein they were divided into smaller
groups (denoted by a, b, or c; FIGS. 8 and 9). High retention
(.gtoreq.97%) was observed with .beta.5a and .alpha.2c, .alpha.9a,
.alpha.9c, .alpha.10a, .alpha.10c, .alpha.12b, or .alpha.12c; with
.beta.5b and .alpha.9a, .alpha.9b, .alpha.10c, or .alpha.12b; and
with .beta.6b and .alpha.10c. Moderate retention (84-96%) was
observed with .beta.5a and .alpha.1a, .alpha.1b, .alpha.6a,
.alpha.9b, .alpha.10b, or .alpha.12a; .beta.5b and .alpha.1a,
.alpha.1b, .alpha.2c, .alpha.6a, .alpha.9c, .alpha.10a, .alpha.12a,
or .alpha.12c; .beta.6a and a1b or .alpha.10c; and .beta.6b and
.alpha.1a, .alpha.6a, .alpha.9a-c, .alpha.10a, .alpha.10b, or
.alpha.12a-c.
[0172] For a third round of screening, .alpha. analogs were
analyzed in groups of only one to three compounds, and group
.beta.6a was subdivided into its two constituent triphosphates,
dTPT1TP and dFPT1TP. The highest retention (.gtoreq.90%) was
observed with .beta.5a and ala, .alpha.2cII, .alpha.9a-c,
.alpha.10aI, .alpha.10aII, .alpha.10c, .alpha.12b, or dTfMOTP;
.beta.5b and .alpha.9a, .alpha.9c, or .alpha.10c; dFPT1TP and
.alpha.10aI; and .beta.6b and ala, .alpha.9a-c, .alpha.10aI,
.alpha.10aII, .alpha.10c, .alpha.12b, dNMOTP, dTfMOTP, or dCNMOTP.
Only slightly less retention (80-89%) was seen with .beta.5a and
.alpha.2cI, .alpha.12a, dNMOTP, dQMOTP, or dTOK587TP; .beta.5b and
ala, .alpha.2cII, .alpha.10aI, .alpha.10aII, .alpha.12b, or
dTOK587TP; dFPT1TP and .alpha.10c; and .beta.6b and .alpha.12a,
dQMOTP, dFuMO1TP, or dTOK587TP.
[0173] For a fourth round of screening, all of the .alpha.
derivatives from FIG. 9 were analyzed as individual triphosphates,
with the exception of .alpha.9b and .alpha.9c, which remained
grouped. The highest retention (.gtoreq.91%) was observed with
.beta.5a and .alpha.9b, .alpha.9c, dFIMOTP, dIMOTP, dFEMOTP,
dMMO2TP, d2OMeTP, dDMOTP, d5FMTP, dNaMTP, dVMOTP, dZMOTP, dClMOTP,
dTfMOTP, dQMOTP, d2MNTP, dDM2TP, or dTOK587TP; .beta.5b and
.alpha.9b, .alpha.9c, dFIMOTP, dIMOTP, dFEMOTP, dNaMTP, dZMOTP,
dClMOTP, dQMOTP, dMM1TP, dDM2TP, or dTOK587TP; .beta.6 analog
dFPT1TP and .alpha. analogs d2OMeTP or dNaMTP; and .beta.6b and
.alpha.9b, .alpha.9c, dFIMOTP, dIMOTP, dFEMOTP, dMMO2TP, dDMOTP,
dTMOTP, dNMOTP, d5FMTP, dNaMTP, dVMOTP, dZMOTP, dClMOTP, dTfMOTP,
dQMOTP, dCNMOTP, d2MNTP, dTOK587TP, or dFuMO2TP.
[0174] To increase the stringency of the screen, a fifth round was
performed with Taq polymerase instead of OneTaq, as it lacks
exonuclease proofreading activity and thus increases the
sensitivity to mispair synthesis. This round also separated all
remaining .alpha. and .beta. groups into individual triphosphates.
The highest retention (.gtoreq.90%) was seen with dSICSTP and
dNaMTP; dSNICSTP and dNaMTP; dTPT2TP and dFDMOTP; dTPT3TP and
dFIMOTP, dIMOTP, or dNaMTP; and dFTPT3TP and dFIMOTP, dIMOTP,
dFEMOTP, dNMOTP, dNaMTP, dClMOTP, dTfMOTP, or dCNMOTP.
[0175] To better differentiate between the UBPs, we progressed the
sixty-two most promising candidate UBPs to a sixth round of
screening in which the template concentration was decreased 10-fold
(to 10 pg) to allow for greater amplification, and thereby afford
greater discrimination, and the template was changed to D6
(Malyshev, D. A., Seo, Y. J., Ordoukhanian, P. and Romesberg, F. E.
PCR with an expanded genetic alphabet. J. Am. Chem. Soc., 131,
14620-14621), where the three flanking nucleotides on either side
of the unnatural nucleotide are randomized among the natural
nucleotides. Moreover, the denaturation and annealing steps were
decreased to 5 s each, and the extension time was decreased to 10
s. Under these conditions, we explored amplification either with
OneTaq or with Taq alone. The results with OneTaq showed the
highest retention (>95%) with dSICSTP and dNaMTP; dSNICSTP and
dFEMOTP; dTPT3TP and dFIMOTP, dIMOTP, dFEMOTP, dZMOTP, or dNaMTP;
and dFTPT3TP and dIMOTP or dFEMOTP. Moderate retention (86%-94%)
was observed with dSICSTP and dFEMOTP or dDM2TP; d5SICSTP and
dNaMTP; dSNICSTP or dIMOTP; dTPT2TP and dNaMTP; dTPT3TP and dNMOTP,
dClMOTP, dQMOTP, dCNMOTP or d2MNTP; and dFTPT3TP and dFIMOTP,
dNaMTP, dZMOTP, dClMOTP, dTfMOTP, or dCNMOTP. While retention
during Taq-mediated amplification was in general reduced relative
to that with OneTaq, the general trends were similar. The highest
retention (>96%) was observed with dTPT3TP and dFIMOTP or
dIMOTP, and with dFTPT3TP and dFIMOTP. Only slightly lower
retention (89%-94%) was observed with dTPT3TP and dFEMOTP, dNaMTP,
or dCNMOTP; and dFTPT3TP and dIMOTP, dFEMOTP, dNaMTP, dClMOTP,
dCNMOTP, or d2MNTP.
[0176] Amplification with the most promising combinations of
triphosphates, dTPT3TP or dFTPT3TP and dFIMOTP, dIMOTP, dFEMOTP, or
dNaMTP, was then performed over 52 cycles with Taq and a 10 s
extension time, to explore particularly stringent conditions, or
with OneTaq and a 30 s extension time, to explore more practical
conditions (Table 4). Both amplified strands were sequenced in
triplicate to determine UBP retention with high accuracy. With Taq,
dTPT3-dNaM, dTPT3-dFIMO, dFTPT3-dNaM, and dFTPT3-dFIMO showed the
highest retention, while the pairs involving dIMO and dFEMO showed
somewhat less retention. With OneTaq, dTPT3-dNaM and dFTPT3-dNaM
showed the highest retention, followed closely by dFTPT3-dFIMO and
dTPT3-dFIMO.
TABLE-US-00004 TABLE 4 Fidelity per d.beta.TP d.alpha.TP
Amplification, .times.10.sup.12 Retention, % Doubling, % Taq, 10 s
Extension TPT3 FIMO 8.5 84 .+-. 3 99.60 .+-. 0.09 IMO 6.3 81 .+-. 5
99.50 .+-. 0.15 FEMO 5.0 79 .+-. 3 99.44 .+-. 0.09 NaM 5.8 86.5
.+-. 0.5 99.66 .+-. 0.01 FTPT3 FIMO 4.8 84 .+-. 3 99.60 .+-. 0.09
IMO 5.6 82 .+-. 5 99.54 .+-. 0.13 FEMO 5.7 81 .+-. 4 99.51 .+-.
0.11 NaM 3.7 91 .+-. 6 99.76 .+-. 0.15 5SICS NaM 9.3 <50.sup.b
<85.sup.b OneTaq, 1 min Extension TPT3 FIMO 8.7 84.7 .+-. 1.1
99.61 .+-. 0.03 IMO 9.4 82.9 .+-. 1.7 99.56 .+-. 0.05 FEMO 10.4
82.2 .+-. 1.0 99.55 .+-. 0.03 NaM 8.3 91.2 .+-. 1.3 99.79 .+-. 0.03
FTPT3 FIMO 8.2 86 .+-. 3 99.65 .+-. 0.08 IMO 7.1 76.8 .+-. 1.6
99.38 .+-. 0.05 FEMO 6.3 72.4 .+-. 1.4 99.24 .+-. 0.04 NaM 7.0 90
.+-. 2 99.76 .+-. 0.06 5SICS NaM 8.1 77.1 .+-. 0.7 99.00 .+-. 0.02
.sup.aRetention and fidelity determined as described in Example 1.
.sup.bUBP retention below 50%, and fidelity is thus estimated to be
< 85%.
[0177] The screening data suggest that several pairs formed between
dTPT3 and the previously unexamined pyridine-based derivatives of
.alpha.6 were reasonably well replicated. Thus, we examined in
triplicate the amplification of DNA containing these UBPs using
OneTaq and 16 amplification cycles with 1 min extension times
(Table 5). The pairs formed between dTPT3 and dTOK580, dTOK582, or
dTOK586 were poorly replicated. However, the pairs formed between
dTPT3 and dTOK588, dTOK581, dTOK576, and dTOK587 were amplified
with a retention of 62%, 65%, 85%, and 94%, respectively.
TABLE-US-00005 TABLE 5 Amplification and fidelity data of dTPT3
against pyridine-based derivatives from group .alpha.6; DM5, MMO2,
DMO, and NaM were also characterized for scaffold comparison.
d.beta.TP d.alpha.TP Amplification Retention, % Fidelity, % TPT3
TOK576 780 85.20 .+-. 1.12 98.35 .+-. 0.14 TPT3 TOK580 1056
<50.sup.b <85.sup.b TPT3 TOK581 1034 65.07 .+-. 0.15 95.80
.+-. 0.02 TPT3 TOK582 1240 <50.sup.b <85.sup.b TPT3 TOK586
948 <50.sup.b <85.sup.b TPT3 TOK587 818 93.81 .+-. 1.35 99.34
.+-. 0.15 TPT3 TOK588 666 61.98 .+-. 7.09 94.99 .+-. 1.13 TPT3 DM5
--.sup.a --.sup.a --.sup.a TPT3 MMO2 1096 90.95 .+-. 3.63 99.06
.+-. 0.40 TPT3 DMO 864 84.02 .+-. 1.92 98.23 .+-. 0.23 TPT3 NaM
1004 99.23 .+-. 1.12 99.92 .+-. 0.11 .sup.aNo amplification was
detected for this sample. .sup.bUnnatural base pair retention was
below 50% and fidelity is thus estimated less than 85%.
[0178] Finally, the screening data suggested that the pairs formed
between dTPT3 and d2MN or dDM2 are reasonably well replicated,
despite neither d2MN nor dDM2 possessing a putatively essential
ortho H-bond acceptor. Thus, these pairs were further examined via
16 cycles of amplification with OneTaq or Taq alone, and with
extension times of either 1 min or 10 s (Table 6). With Taq alone,
only poor retention was observed. However, with OneTaq, retention
was better for both pairs. Retention of the dTPT3-dDM2 pair is 58%
and 69% with 1 min and 10 s extension times, respectively.
Remarkably, dTPT3-d2MN is amplified with retentions of 96% and 94%
with 1 min and 10 s extension times, respectively.
TABLE-US-00006 TABLE 6 Amplification and fidelity data of dTPT3
against either d2MN or dDM2, .alpha. analogs without an ortho
H-bond acceptor. Am- Fidelity Extension plifi- Retention, per Dou-
Enzyme d.beta.TP d.alpha.TP Time cation % bling, % OneTaq TPT3 2MN
1 min 880 95.54 .+-. 1.55 99.53 .+-. 0.17 10 s 224 93.53 .+-. 1.42
99.15 .+-. 0.20 TPT3 DM2 1 min 1420 57.92 .+-. 6.02 94.89 .+-. 0.94
10 s 376 68.46 .+-. 4.34 95.65 .+-. 0.72 Taq TPT3 2MN 1 min
--.sup.a -- -- 10 s --.sup.a -- -- TPT3 DM2 1 min 334 <50.sup.b
<85.sup.b 10 s 266 <50.sup.b <85.sup.b .sup.aNo
amplification was detected for these samples. .sup.bUnnatural base
pair retention was below 50% and fidelity is thus estimated less
than 85%.
[0179] Discussion A PCR-based screen to identify the most promising
UBPs was performed herein. To increase the SAR content of the
screen, seven novel a derivatives that are based on a pyridyl
scaffold with different substituents at the positions ortho and
para to the glycosidic linkage were included.
[0180] Structure-activity relationship data. Even under permissive
conditions, where exonucleotidic proofreading activity was present
and extension times were 1 min, only mixed groupings of .alpha.
analogs with .beta. analogs showed significant levels of retention,
demonstrating that efficient replication requires the pairing of an
.alpha. scaffold with a .beta. scaffold. However, the only d.beta.
groups that showed high retention were .beta.5 and .beta.6. This
reveals the privileged status of the d5SICS/dTPT3-like scaffold
relative to all of the others examined. The dominant contribution
to the high retention with group .beta.5 proved to result not from
pairs involving d5SICS, but rather from pairs involving dSICS, and
to a lesser extent dSNICS. For example, under all conditions,
dSICS-dNaM was better replicated than d5SICS-dNaM. d5SICS resulted
from the optimization of dSICS for pairing with dMMO2; apparently,
the increased bulk of dNaM makes the added methyl group
deleterious. Furthermore, dSNICS-dNaM is replicated nearly as well
(with OneTaq) or better (with Taq) than d5SICS-dNaM, suggesting
that a 6-aza substituent optimizes UBP synthesis by facilitating
insertion of the unnatural triphosphate opposite dNaM or by
increasing the efficiency with which the unnatural nucleotide
templates the insertion of dNaMTP. Finally, dSNICS-dFEMO is also
better replicated than d5SICS-dNaM, but only in the presence of
proofreading, suggesting that while triphosphate insertion may be
less efficient, increased efficiency of extension results in an
overall increase in fidelity. The dominant contribution to high
fidelity retention with group .beta.6 was provided by dTPT3 and
dFTPT3. In general, both paired well with dNaM, dFEMO, dFIMO, or
dIMO. dTPT3 paired especially well with dFIMO and dIMO, suggesting
that the para iodo substituent mediates favorable interactions, and
it also paired well with dFEMO and especially dNaM when exonuclease
activity was present. dFTPT3 paired well with either dIMO or dFEMO
in the presence of exonuclease activity, as well as with dFIMO and
dNaM in its absence.
[0181] While the nitrogen substituent of the pyridine-based .alpha.
analogs (group .alpha.6) was generally detrimental for replication,
a more detailed analysis of the UBPs formed with dTPT3 revealed
several trends. A methyl, chloro, or amino substituent at the
position ortho to the C-glycosidic linkage resulted in poorly
replicated pairs, presumably due to poor extension after
incorporation of the unnatural triphosphate. The ortho methoxy
substituent of dTOK581 resulted in better replication, presumably
due to its ability to both hydrophobically pack with the template
during UBP synthesis and accept an H-bond with a polymerase-based
H-bond donor during extension. The data also revealed that the
methylsulfanyl ortho substituent of dTOK588, dTOK576, and
especially dTOK587 results in better replication. This improvement
is likely due to more optimized compromise between the ability to
hydrophobically pack and the ability to accept an H-bond from the
polymerase at the primer terminus. In addition, the para
substituent in this series of derivatives can contribute to
efficient replication, with a bromo substituent being the best,
followed by a second methylsulfanyl group, and then finally a
simple methyl group. When dTOK587, with its combination of the
ortho methylsulfanyl and para bromo substituents, was paired with
dTPT3, the resulting UBP was replicated by OneTaq and 1 min
extension times with a fidelity (calculated from retention level)
of 99.3%, which is slightly better than d5SICS-dMMO2 under similar
conditions. Clearly, similar ortho methylsulfanyl and para bromo
substituents should be examined with the more efficiently
replicated .alpha.-like scaffolds, such as dFIMO and dNaM.
[0182] The replication of the pairs formed between dTPT3 and d2MN
or dDM2 also merits discussion. DNA containing these pairs is not
amplified by Taq alone, but is well amplified by OneTaq. This
result was unexpected because neither d2MN nor dDM2 possesses the
ortho H-bond acceptor that has been postulated to be essential for
extension of the nascent (natural or unnatural) primer terminus.
Specifically, when a nucleotide is positioned at the growing primer
terminus, the H-bond acceptor is disposed into the developing minor
groove where it accepts an H-bond from the polymerase, and this
H-bond is thought to be required for proper terminus alignment.
When amplified with OneTaq and a 1 min extension time, dTPT3-d2MN
is replicated with a fidelity of 99.5%, which only drops to 99.1%
when the extension time is reduced to 10 s. The absence of
amplification in the absence of proofreading, coupled with the only
small decrease observed in the presence of proofreading when
extension times were reduced, implies that the surprisingly high
fidelity amplification of DNA containing dTPT3-d2MN results from
selective extension of the UBP relative to mispairs. This suggests
that the absence of an ortho H-bond acceptor is more deleterious
for the extension of a mispair than for the extension of the
UBPs.
[0183] Efforts toward the expansion of the genetic alphabet.
Overall, the data confirms that dTPT3-dNaM is the most promising
UBP of those tested. However, the pairs formed between dTPT3 and
dFEMO, dFIMO, or dIMO, or between dFTPT3 and dNaM, dFEMO, dFIMO, or
dIMO, are also promising. In addition to the most promising UBPs
noted above, it is noteworthy that a remarkable number of
additional novel pairs are replicated with only a moderately
reduced fidelity, or are replicated with a high fidelity when the
amplification is performed under less stringent conditions (Table
7). Along with the most efficiently replicated UBPs, these pairs
provide a wide range of scaffolds with diverse physicochemical
properties for further optimization efforts, where different
physicochemical properties are expected to bestow the constituent
nucleotides with different pharmacokinetic-like properties.
TABLE-US-00007 TABLE 7 d.beta.TP d.alpha.TP Retention (%) SICS NaM
99.sup.a SICS FEMO 92.sup.b SNICS NaM 90.sup.a SNICS FEMO 95.sup.b
SNICS IMO 88.sup.b TPT3 NMO 89.sup.b TPT3 ZMO 86.sup.b TPT3 ClMO
90.sup.b TPT3 QMO 90.sup.b TPT3 CNMO 91.sup.b FTPT3 NMO 94.sup.a
FTPT3 ZMO 88.sup.a FTPT3 ClMO 97.sup.a FTPT3 QMO 87.sup.a FTPT3
CNMO 94.sup.a .sup.aPCR Conditions: 100 pg D8 template amplified
for 16 cycles with Taq polymerase under thermocycling conditions:
initial denaturation at 96.degree. C. for 1 min, 96.degree. C. for
30 s, 60.degree. C. for 15 s, 68.degree. C. for 60 s. .sup.bPCR
Conditions: 10 pg D6 template amplified for 24 cycles with OneTaq
polymerase under thermocycling conditions: initial denaturation at
96.degree. C. for 1 min, 96.degree. C. for 5 s, 60.degree. C. for 5
s, 68.degree. C. for 10 s.
Example 2. General Procedure for Triphosphate Synthesis
[0184] Proton sponge (1.3 equiv) and the free nucleoside derivative
(1.0 equiv) were dissolved in dry trimethyl phosphate (40 equiv)
and cooled to -15.degree. C. under nitrogen atmosphere. Freshly
distilled POCl3 (1.3 equiv) was added dropwise and the resulting
mixture was stirred at -10.degree. C. for 2 h. Tributylamine (6.0
equiv) and a solution of tributylammonium pyrophosphate (5.0 eq.)
in dimethylformamide (0.5 M) were added. Over 30 min, the reaction
was allowed to warm slowly to 0.degree. C. and then was quenched by
addition of 0.5 M aqueous Et3NH2CO3 (TEAB) pH 7.5 (2 vol-equiv.).
The mixture was diluted two-fold with H.sub.2O and the product was
isolated on a DEAE Sephadex column (GE Healthcare) with an elution
gradient of 0 to 1.2 M TEAB, evaporated, and co-distilled with
H.sub.2O (3.times.). Additional purification by reverse-phase (C18)
HPLC (0-35% CH3CN in 0.1 M TEAB, pH 7.5) was performed, (10%-31%
yield).
##STR00019## ##STR00020##
[0185] The nucleobase analogs 4a, 4b, 4c and 4d were synthesized
based on literature methodsl,2 as shown in Scheme S1. Briefly,
condensation of the aldehyde (1a-d) with malonic acid at
100.degree. C. in pyridine as a solvent and piperidine as a
catalyst for 12 h, followed by a reflux for 1 h, yielded the
corresponding acrylic acid intermediates (2a-d). Chlorination of
these acids with thionyl chloride in chloroform in the presence of
DMF afforded the acyl chlorides, which were not purified but could
be used directly in the preparation of the azides (3a-d). Compounds
3a-d were prepared in a biphasic mixture of 1,4-dioxane and water
at 5.degree. C. with sodium azide. Crude mixtures of 3a-d in CHCl3
solutions were added portion-wise to diphenyl ether and heated to
230.degree. C. to give the isocyanates that underwent subsequent
intramolecular cyclization to the fused 6-5 bicyclic systems
4a-d.
##STR00021##
[0186] Compound 5a. To a solution of 4a (54 mg, 0.33 mmol) in
CH2Cl2 (8 mL) at room temperature under nitrogen atmosphere was
added bis(trimethylsilyl)acetamide (83 mg, 0.39 mmol). After
stirring for 40 min, 3,5-bis(toluoyl)-2-deoxyribosyl chloride (196
mg, 0.39 mmol) was added. The reaction mixture was cooled to
0.degree. C. and SnCl4 was added dropwise (1.0 M in CH2Cl2, 160
.mu.L, 0.16 mmol). The solution was stirred for 2 h at room
temperature. The reaction mixture was diluted with EtOAc, quenched
with saturated aqueous NaHCO.sub.3, extracted with EtOAc, dried,
filtered and evaporated. The crude product was subjected to silica
gel column chromatography (Hexane/EtOAc) to afford compound 5a as
white foam (77 mg, 0.15 mmol, 45%). 1H NMR (500 MHz, CDCl3) .delta.
7.97-6.82 (m, 11H, Ar--H), 6.44 (d, J=7.5 Hz, 1H, H-1'), 5.63 (d,
J=6.5 Hz, 1H, H-3'), 4.76-4.68 (m, 2H, H-5'a, 5'b), 4.59 (d, J=2.5
Hz, H-4'), 2.89 (dd, J=1.5, 0.5 Hz, 1H, H-2'a), 2.59 (s, 3H,
Ar--CH3), 2.43 (s, 3H, Ar--CH3), 2.43 (s, 3H, Ar--CH3), 2.36-2.30
(m, 1H, H-2'b). 13C NMR (125 MHz, CDCl3) .delta. 166.6, 166.5,
158.5, 147.2, 144.8, 144.6, 140.0, 131.1, 130.3, 130.0, 129.9,
129.7, 127.1, 126.9, 125.6, 122.8, 102.7, 85.9, 83.3, 75.6, 64.8,
39.6, 22.1, 16.1. HRMS (ESI+) m/z calcd for C29H28NO6S (M+H+)
518.1632, found 518.1621.
[0187] Compound 6a. Compound 5a (27 mg, 0.052 mmol) was dried by 3
co-evaporations with anhydrous toluene. The residue was dissolved
in anhydrous toluene (1 mL). Lawesson's reagent (41.5 mg, 0.10
mmol) was added and the mixture was heated overnight at reflux.
After filtration on cotton, the filtrate was concentrated and the
crude product was subjected to a silica gel column chromatography
(Hexane/EtOAc) to afford compound 6a as a yellow foam (16 mg, 0.03
mmol, 58%). 1H NMR (500 MHz, CDCl3) .delta. 8.00-7.89 (m, 4H,
Ar--H), 7.71 (m, 1H, Ar--H), 7.49-7.48 (m, 1H, H-1'), 7.29-7.21 (m,
4H, Ar--H), 7.65-7.62 (m, 1H, Ar--H), 6.90 (d, J=7.5 Hz, 1H,
Ar--H), 5.64-5.62 (m, 1H, H-4'), 4.85-4.74 (m, 2H, H-5'a),
4.68-4.67 (m, 1H, H-5'b), 3.38-3.34 (m, 1H, H-3'), 2.26 (s, 3H),
2.44 (s, 3H), 2.41 (s, 3H), 2.28-2.22 (m, 1H). 13C NMR (125 MHz,
CDCl3) .delta. 174.6, 166.6, 144.9, 144.8, 142.9, 142.7, 142.3,
130.3, 130.0, 129.7, 127.9, 127.0, 126.9, 126.8, 108.3, 100.0,
91.4, 84.0, 74.9, 64.5, 39.3, 22.2, 22.1, 16.3. HRMS (ESI+) m/z
calcd for C29H28NO5S2 (M+H+) 534.1403, found 534.1404.
[0188] Compound 7a. To a solution of 6a (20 mg, 0.037 mmol) in
methanol (1.0 mL) was added dropwise 30% NaOMe (8.66 mg, 0.16
mmol). The reaction mixture was stirred for 1 h at room temperature
and monitored by TLC. The reaction mixture was then concentrated
and the crude product was subjected to silica gel column
chromatography (MeOH/CH2Cl2) to afford compound 7a as yellow foam
(9.2 mg, 0.031 mmol, 85%). 1H NMR (500 MHz, CD3OD) o 8.36 (d, J=4
Hz, 1H, Ar--H), 7.58 (d, J=1 Hz, 1H, Ar--H), 7.35 (t, J=4 Hz, 1H,
H-1'), 7.22 (d, J=8 Hz, 1H, Ar--H), 4.07-4.06 (m, 1H, H-4'), 4.07
(d, J=4 Hz, 1H, H-3'), 3.80 (dd, J=24, 4 Hz, 2H, H-5'a, b),
2.79-2.76 (m, 1H, H-2'a), 2.13-2.08 (m, 1H, H-2'b). 13C NMR (125
MHz, CD3OD) 173.60, 143.29, 142.26, 142.23, 129.35, 126.11, 108.01,
91.14, 88.44, 70.37, 61.35, 41.59, 14.81. HRMS (ESI+) m/z calcd for
C13H16NO3S2 (M+H+) 298.0566, found 298.0569.
[0189] Compound 8a (dTPT1TP). Compound 8a (11.2 mg, 20.8 .mu.mol,
31%) was synthesized using the General Procedure for Triphosphate
Synthesis described above starting from 7a (20 mg, 67.3 .mu.mop.
31P NMR (162 MHz, D2O) o -10.3 (d, J=19.8 Hz, y-P), -10.9 (d,
J=20.1 Hz, a-P), -22.8 (t, J=19.4 Hz, f3-P). MS (MALDI-TOF-,
matrix: 9-aminoacridine) (m/z): [M-H]- calcd for C13H17NO12P3S2,
536.3, found, 536.7.
##STR00022##
[0190] Compound 5b. To a solution of 4b (100 mg, 0.67 mmol) in
CH2Cl2 (8 mL) at room temperature under nitrogen atmosphere was
added bis(trimethylsilyl)acetamide (165 mg, 0.81 mmol). After
stirring for 40 min, 3,5-bis(toluoyl)-2-deoxyribosyl chloride (292
mg, 0.81 mmol) was added. The reaction mixture was cooled to
0.degree. C. and SnCl4 was added dropwise (1.0 M in CH2Cl2, 200
.mu.L, 0.2 mmol). The solution was stirred for 2 h at room
temperature. The reaction mixture was diluted with EtOAc, quenched
with saturated aqueous NaHCO.sub.3, extracted with EtOAc, dried,
filtered and evaporated. The crude product was subjected to silica
gel column chromatography (Hexane/EtOAc) to afford compound 5b as
white foam (137 mg, 0.27 mmol, 41%). 1H NMR (500 MHz, CDCl3) o 7.99
(d, J=8.1 Hz, 2H, Ar--H), 7.93 (d, J=8.1 Hz, 2H, Ar--H), 7.55 (d,
J=7.7 Hz, 1H, Ar--H), 7.33-7.28 (m, 2H, Ar--H), 7.27-7.20 (m, 2H,
Ar--H), 6.82 (dd, J=8.3, 5.6 Hz, 1H, Ar--H), 6.57 (d, J=0.9 Hz, 1H,
Ar--H), 6.41 (d, J=7.7 Hz, 1H, H-1'), 5.68-5.61 (m, 1H, H-4'), 4.75
(dd, J=12.1, 3.4 Hz, 2H, H-5'a, b), 4.62 (q, J=3.1 Hz, 1H, H 3'),
2.94 (ddd, J=14.3, 5.6, 1.7 Hz, 1H, H-2'a), 2.48-2.39 (s,
3.times.3H, Ar--CH3), 2.36-2.26 (m, 1H, H-2'b). 13C NMR (125 MHz,
CDCl3) o 166.6, 166.5, 159.2, 159.1, 154.5, 144.8, 144.6, 130.2,
130.0, 129.7, 127.5, 127.1, 126.9, 117.5, 103.3, 96.6, 86.0, 83.2,
75.5, 64.7, 39.8, 22.1, 14.1. HRMS (ESI+) m/z calcd for C29H28NO7
(M+H+) 502.1860, found 502.1885.
[0191] Compound 6b. Compound 5b (29 mg, 0.056 mmol) was dried by 3
co-evaporations with anhydrous toluene. The residue was dissolved
in anhydrous toluene (1 mL). Lawesson's reagent (41.5 mg, 0.10
mmol) was added and the mixture was heated overnight at reflux.
After filtration on cotton, the filtrate was concentrated and the
crude product was subjected to a silica gel column chromatography
(Hexane/EtOAc) to afford compound 6b as a yellow foam (15 mg, 0.029
mmol, 52%). 1H NMR (500 MHz, CDCl3) o 8.10-7.89 (m, 5H, Ar--H),
7.52-7.48 (m, 1H, H 1'),7.29-7.22 (m, 4H, Ar--H), 6.8 (d, J=1 Hz,
1H, Ar--H), 6.73 (d, J=7.5 Hz, 1H, Ar--H), 5.65-5.62 (m, 1H, H-4'),
4.84-4.74 (m, 2H, H-5'a, b), 4.67-4.65 (m, 1H, H-3'), 3.36-3.32 (m,
1H, H-2'a), 2.44 (s, 3H, Ar--CH3), 2.43 (s, 3H, s, 3H, Ar--CH3),
2.41 (s, 3H, s, 3H, Ar--CH3), 2.27-2.21 (m, 1H, H-2'b). 13C NMR
(125 MHz, CDCl3) o 166.6, 156.9, 153.9, 144.8, 130.3, 130.0, 129.8,
129.7, 127.9, 106.4, 96.0, 83.9, 56.6, 39.5, 22.1, 12.6. HRMS
(ESI+) m/z calcd for C29H28NO6S (M+H+) 518.1632, found
518.1638.
[0192] Compound 7b. To a solution of 6b (20 mg, 0.039 mmol) in
methanol (1.0 mL) was added dropwise 30% NaOMe (8.66 mg, 0.16
mmol). The reaction mixture was stirred for 1 h at room temperature
and monitored by TLC. The reaction mixture was then concentrated
and the crude product was subjected to silica gel column
chromatography (MeOH/CH2Cl2) to afford compound 7b as yellow foam
(9.3 mg, 0.033 mmol, 85%). 1H NMR (500 MHz, CD3OD) o 8.57 (d, J=5
Hz, 1H, Ar--H), 7.42 (t, J=4 Hz, 1H, H-1'), 7.13 (d, J=7.5 Hz, 1H,
Ar--H), 6.80 (s, 1H, Ar--H), 4.50-4.47 (m, 1H, H-4'), 4.12 (d,
J=3.5 Hz, 1H, H-3'), 3.95 (dd, J=30, 3 Hz, 2H, H-5'a, b), 2.81-2.77
(m, 1H, H-2'a), 2.50 (s, 3H, Ar--CH3), 2.18-2.14 (m, 1H, H-2'b).
13C NMR (125 MHz, CD3OD) o 172.9, 157.2, 154.5, 132.7, 131.3,
105.4, 100.8, 90.9, 88.5, 70.3, 61.3, 41.8, 12.7. HRMS (ESI+) m/z
calcd for C13H16NO4S (M+H+) 282.0795, found 282.0790.
[0193] Compound 8b (dFPT1TP). Compound 8b (3.7 mg, 7.1 .mu.mol,
10%) was synthesized using the General Procedure for Triphosphate
Synthesis described above starting from 7b (20 mg, 71.2 .mu.mol).
31P NMR (162 MHz, D2O) o -10.4 (d, J=20.0 Hz, y-P), -10.9 (d,
J=19.4 Hz, a-P), -22.8 (t, J=20.0 Hz, f3-P). MS (MALDI-TOF-,
matrix: 9-aminoacridine) (m/z): [M-H]- calcd for C13H17NO13P3S.
520.3. found. 520.1.
##STR00023##
[0194] Compound 5c. To a solution of 4c (46 mg, 0.28 mmol) in
CH2Cl2 (8 mL) at room temperature under nitrogen atmosphere was
added bis(trimethylsilyl)acetamide (66 mg, 0.33 mmol). After
stirring for 40 min, 3,5-bis(toluoyl)-2-deoxyribosyl chloride (120
mg, 0.33 mmol) was added. The reaction mixture was cooled to
0.degree. C. and SnCl4 was added dropwise (1.0 M in CH2Cl2, 140
.mu.L, 0.14 mmol). The solution was stirred for 2 h at room
temperature. The reaction mixture was diluted with EtOAc, quenched
with saturated aqueous NaHCO.sub.3, extracted with EtOAc, dried,
filtered and evaporated. The crude product was subjected to silica
gel column chromatography (Hexane/EtOAc) to afford compound 5c as
white foam (58 mg, 0.11 mmol, 40%). 1H NMR (500 MHz, CDCl3) o
7.98-7.90 (m, 4H, Ar--H), 7.53 (d, J=7.4 Hz, 1H, Ar--H), 7.27-7.21
(m, 4H, Ar--H), 6.83-6.82 (m, 2H, Ar--H), 6.44 (d, J=7.5 Hz, 1H,
H-1'), 5.63 (d, J=6.5 Hz, 1H, H-4'), 4.76-4.60 (m, 2H, H-5'a, b),
4.59 (d, J=2.5 Hz, 1H, H-3'), 2.89 (dd, J=13, 5.5 Hz, H-2'a), 2.59
(s, 3H, Ar--CH3), 2.43 (s, 3H, Ar--CH3), 2.40 (s, 3H, Ar--CH3),
2.37-2.30 (m, 1H, H-2'b). 13C NMR (125 MHz, CDCl3) o 166.5, 158.0,
149.9, 146.3, 144.8, 144.6, 130.3, 130.0, 129.7, 128.8, 127.3,
122.8, 103.7, 100.0, 85.8, 83.2, 75.5, 64.8, 39.5, 22.1, 16.7. HRMS
(ESI+) m/z calcd for C29H28NO6S (M+H+) 518.1632, found
518.1631.
[0195] Compound 6c. Compound 5c (50 mg, 0.097 mmol) was dried by 3
co-evaporations with anhydrous toluene. The residue was dissolved
in anhydrous toluene (1.5 mL). Lawesson's reagent (83 mg, 0.20
mmol) was added and the mixture was heated overnight at reflux.
After filtration on cotton, the filtrate was concentrated and the
crude product was subjected to a silica gel column chromatography
(Hexane/EtOAc) to afford compound 6c as a yellow foam (16 mg, 0.03
mmol, 31%). 1H NMR (500 MHz, CDCl3) o 8.13-7.97 (m, 5H, Ar--H),
7.52-7.49 (m, 1H, H-1'), 7.37-7.29 (m, 4H, Ar--H), 6.99 (d, J=1 Hz,
1H, Ar--H), 6.91 (d, J=7.5 Hz, 1H, Ar--H), 5.73-5.71 (m, 1H, H-4'),
4.91-4.82 (m, 2H, H-5'a, b), 4.76-4.74 (m, 1H, H-3'), 3.41-3.37 (m,
1H, H-2'a), 2.68 (s, 3H, Ar--CH3), 2.52 (s, 3H, Ar--CH3), 2.49 (s,
3H, Ar--CH3), 2.39-2.34 (m, 1H, H-2'b). 13C NMR (125 MHz, CDCl3) o
172.1, 166.6, 154.0, 144.9, 144.7, 140.4, 130.3, 130.0, 129.7,
129.6, 127.0, 126.8, 122.7, 109.0, 91.2, 83.9, 75.0, 64.5, 39.4,
22.2, 22.1, 17.0. HRMS (ESI+) m/z calcd for C29H28NO5S2 (M+H+)
534.1403, found 534.1406.
[0196] Compound 7c. To a solution of 6c (20 mg, 0.037 mmol) in
methanol (1.0 mL) was added dropwise 30% NaOMe (8.66 mg, 0.16
mmol). The reaction mixture was stirred for 1 h at room temperature
and monitored by TLC. The reaction mixture was then concentrated
and the crude product was subjected to silica gel column
chromatography (MeOH/CH2Cl2) to afford compound 7c as yellow foam
(8.9 mg, 0.03 mmol, 81%). 1H NMR (500 MHz, CD3OD) o 8.48, (d, J=7.5
Hz, 1H, Ar--H), 7.42 (t, J=5 Hz, 1H, H-1'), 7.20 (d, J=5 Hz, 1H,
Ar--H), 7.12 (s, 1H, Ar--H), 4.51-4.48 (m, 1H, H-4'), 4.13 (d, J=5
Hz, 1H, H-3'), 3.95 (dd, J=30, 5 Hz, 2H, H-5'a, b), 2.81-2.78 (m,
1H, H-2'a), 2.67 (s, 3H, Ar--CH3), 2.21-2.16 (m, 1H, H-2'b). 13C
NMR (125 MHz, CD3OD) o 171.1, 154.0, 144.1. 141.1, 131.1, 122.7,
108.8, 90.9, 88.5, 70.5, 61.4, 41.7, 15.4. HRMS (ESI+) m/z calcd
for C13H16NO3S2 (M+H+) 298.0566, found 298.0566.
[0197] Compound 8c. Compound 8c (10.8 mg, 20.2 .mu.mol, 30%) was
synthesized using the General Procedure for Triphosphate Synthesis
described above starting from 7c (20 mg, 67.3 .mu.mol). 31P NMR
(162 MHz, D2O) o -10.8 (d, J=19.8 Hz, y-P), -11.5 (d, J=20.1 Hz,
a-P), -23.3 (t, J=20.1 Hz, f3-P). MS (MALDI-TOF-, matrix:
9-aminoacridine) (m/z): [M-H]- calcd for C13H17NO12P3S2, 536.3,
found, 536.1.
##STR00024##
[0198] Compound 5d. To a solution of 4d (200 mg, 1.32 mmol) in
CH2Cl2 (8 mL) at room temperature under nitrogen atmosphere was
added bis(trimethylsilyl)acetamide (298 mg, 1.46 mmol). After
stirring for 40 min, 3,5-bis(toluoyl)-2-deoxyribosyl chloride (563
mg, 1.46 mmol) was added. The reaction mixture was cooled to
0.degree. C. and SnCl4 was added dropwise (1.0 M in CH2Cl2, 660
.mu.L, 0.66 mmol). The solution was stirred for 2 h at room
temperature. The reaction mixture was diluted with EtOAc, quenched
with saturated aqueous NaHCO.sub.3, extracted with EtOAc, dried,
filtered and evaporated. The crude product was subjected to silica
gel column chromatography (Hexane/EtOAc) to afford compound 5d as a
white foam (260 mg, 0.52 mmol, 39%). 1H NMR (500 MHz, CDCl3) o
7.98-7.90 (m, 4H, Ar--H), 7.70 (d, J=6 Hz, 1H, Ar--H), 7.55 (d,
J=9.5 Hz, 1H, Ar--H), 7.28-7.16 (m, 5H, Ar--H), 6.84-6.85 (m, 1H,
Ar--H), 6.57 (d, J=9.5 Hz, H-1'), 5.66-5.64 (m, 1H, H-4'),
4.75-4.72 (m, 2H, H-5'a, b), 4.61 (m, 1H, H-3'), 2.95-2.90 (m, 1H,
H-2'a), 2.43 (s, 3H, Ar--CH3), 2.40 (s, 3H, Ar--CH3), 2.39-2.31 (m,
1H, H-2'b). 13C NMR (125 MHz, CDCl3) o 166.2, 166.1, 158.1, 145.1,
144.4, 144.2, 133.8, 129.9, 129.6, 129.3, 129.1, 126.9, 126.5,
124.2, 103.5, 85.5, 82.9, 75.1, 64.4, 39.2, 21.7. HRMS (ESI+) m/z
calcd for C20H20C12N205S (M+H+) 504.1475, found 504.1480.
[0199] Compound 6d. Compound 5d (50 mg, 0.1 mmol) was dried by 3
co-evaporations with anhydrous toluene. The residue was dissolved
in anhydrous toluene (1 mL). Lawesson's reagent (48 mg, 0.12 mmol)
was added and the mixture was heated overnight at reflux. After
filtration on cotton, the filtrate was concentrated, and the crude
product was subjected to a silica gel column chromatography
(Hexane/EtOAc) to afford compound 6d as a yellow foam (17 mg, 0.033
mmol, 33%). 1H NMR (500 MHz, CDCl3) o 8.14-7.82 (m, 7H, Ar--H),
7.51 (dd, J=7.5, 6.0 Hz, 1H, H-1'), 7.32-7.23 (m, 5H, Ar--H), 6.99
(d, J=7.2 Hz, 1H, Ar--H), 74-5.73 (m, 1H, H-4'), 4.92-4.83 (m, 2H,
H-5'a, b), 4.78-4.77 (m, 1H, H-3'), 3.43-3.40 (m, 1H, H-2'a), 2.51
(s, 3H, Ar--CH3), 2.48 (s, 3H, Ar--CH3), 2.39-2.36 (m, 1H, H-2'b).
13C NMR (125 MHz, CDCl3) o 173.5, 166.6, 144.9, 144.8, 139.5,
138.0, 134.5, 130.3, 130.0, 129.7, 129.5, 126.8, 124.7, 109.5,
91.4, 84.0, 75.0, 64.5, 39.4, 22.2, 22.1. HRMS (ESI+) m/z calcd for
C28H26NO5S2 (M+H+) 520.1247, found 520.1241.
[0200] Compound 7d. To a solution of 6d (20 mg, 0.039 mmol) in
methanol (1.0 mL) was added dropwise 30% NaOMe (8.66 mg, 0.16
mmol). The reaction mixture was stirred for 1 h at room temperature
and monitored by TLC. The reaction mixture was then concentrated
and the crude product was subjected to silica gel column
chromatography (MeOH/CH2Cl2) to afford compound 7d as yellow foam
(9.0 mg, 0.032 mmol, 82%). 1H NMR (500 MHz, CD3OD) o 8.48 (d, J=5
Hz, 1H, Ar--H), 8.01 (d, J=5 Hz, 1H, Ar--H), 7.40-7.38 (m, 2H,
Ar--H), 7.29 (d, J=10 Hz, 1H, H-1'), 4.47-4.46 (m, 1H, H-4'), 4.10
(m, 1H, H-3'), 3.94-3.88 (m, 2H, H-5'a,b), 2.77-2.76 (m, 1H,
H-2'a), 2.19-2.14 (m, 1H, H-2'b). 13C NMR (125 MHz, CD3OD) o 171.2,
144.7, 139.6, 137.6, 130.5, 124.2, 108.8, 90.7, 88.2, 70.1, 61.0,
41.3. HRMS (ESI+) m/z calcd for C12H14NO3S2 (M+H+) 284.041, found
284.0410.
[0201] Compound 8d (dTPT3TP). Compound 8d (5.7 mg, 10.9 .mu.mol,
31%) was synthesized using the General Procedure for Triphosphate
Synthesis described above starting from 7d (10 mg, 35.3 .mu.mol).
31P NMR (162 MHz, D2O) o -9.3 (d, J=19.5 Hz, y-P), -10.8 (d, J=19.8
Hz, a-P), -22.4 (t, J=20.0 Hz, f3-P). MS (MALDI-TOF-, matrix:
9-aminoacridine) (m/z): [M-H]- calcd for C12H15NO12P3S2-, 521.9,
found, 521.9.
##STR00025##
[0202] Compound 9. Compound 5d (55 mg, 0.11 mmol) was dissolved in
1.0 mL MeOH--CH3CN (1:1 v/v), Selectfluor (42 mg, 0.12 mmol) was
added and the mixture was heated at reflux for 3 h, then the
solvent was evaporated, the residue was dissolved in EtOAc (20 mL),
the organic phase was washed with water three times. Then the
organic solvent was evaporated, and the solid residue was dried by
3 co-evaporations with anhydrous toluene. The residue was dissolved
in 1 mL TfOH--CH2Cl2 (1:1 v/v) and the mixture was stirred at room
temperature for 1 h, then the mixture was concentrated, and the
crude product was subjected to a silica gel column chromatography
(hexane/EtOAc) to afford compound 9 as a white solid (49 mg, 0.093
mmol, 85%). 1H NMR (500 MHz, CDCl3) o 7.98-7.92 (m, 4H, Ar--H),
7.75 (d, J=5 Hz, 1H, Ar--H), 7.52 (d, J=7.5 Hz, 1H, Ar--H),
7.32-7.21 (m, 5H, Ar--H), 6.82-6.78 (m, 1H, H-1'), 5.64-5.61 (m,
1H, H-4'), 4.80-4.59 (m, 2H, H-5'a, b), 4.62-4.59 (m, 1H, H-3'),
2.93-2.87 (m, 1H, H-2'a), 2.43 (s, 3H, Ar--CH3), 2.39 (s, 3H,
Ar--CH3), 2.34-2.27 (m, 1H, H-2'b). 13C NMR (125 MHz, CDCl3) o
166.2, 166.1, 156.4, 144.5, 144.3, 137.7, 137.5, 134.6, 129.9,
129.6, 129.3, 126.6, 126.4, 120.2, 112.1, 111.7, 85.5, 83.1, 75.0,
64.2, 39.1, 21.8, 21.7. 19F NMR (376 MHz, CDCl3) o -151.5. HRMS
(ESI+) m/z calcd for C28H25FNO6S (M+H+) 522.1381, found
522.1380.
[0203] Compound 10. Compound 9 (20 mg, 0.038 mmol) was dried by 3
co-evaporations with anhydrous toluene. The residue was dissolved
in anhydrous toluene (1 mL). Lawesson's reagent (18.5 mg, 0.046
mmol) was added and the mixture was heated overnight at reflux.
After filtration on cotton, the filtrate was concentrated and the
crude product was subjected to a silica gel column chromatography
(Hexane/EtOAc) to afford compound 10 as a yellow foam (6.5 mg,
0.012 mmol, 32%). 1H NMR (500 MHz, CDCl3) o 8.11-7.85 (m, 6H,
Ar--H), 7.40-7.39 (m, 2H, Ar--H, H-1'), 7.28-7.21 (m, 4H, Ar--H),
5.64-5.63 (m, 1H, H-4'), 4.83 (m, 2H, H-5'a, b), 4.69 (m, 1H,
H-3'), 3.34-3.29 (m, 1H, H-2'a), 2.44 (s, 1H, Ar--CH3), 2.40 (s,
3H, Ar--CH3), 2.30-2.26 (m, 1H, H-2'b). 13C NMR (125 MHz, CDCl3) o
170.9, 166.6, 166.5, 144.9, 144.8, 138.6, 130.3, 130.0, 129.9,
129.7, 129.7, 126.9, 126.7, 120.5, 116.3, 116.0, 100.0, 91.6, 84.3,
74.7, 64.3, 39.2, 22.2, 22.1. 19F NMR (376 MHz, CDCl3) o -142.9.
HRMS (ESI+) m/z calcd for C28H25FNO5S2 (M+H+) 538.1153, found
538.1155.
[0204] Compound 11. To a solution of 10 (10 mg, 0.019 mmol) in
methanol (1.5 mL) was added dropwise 30% NaOMe (4.33 mg, 0.08
mmol). The reaction mixture was stirred for 1 h at room temperature
and monitored by TLC. The reaction mixture was then concentrated
and the crude product was subjected to silica gel column
chromatography (MeOH/CH2Cl2) to afford compound 11 as yellow foam
(4.9 mg, 0.016 mmol, 85%). 1H NMR (500 MHz, CD3OD) o 8.68 (d, J=5
Hz, 1H, Ar--H), 8.12 (d, J=5 Hz, 1H, Ar--H), 7.52 (d, J=5 Hz, 1H,
Ar--H), 7.28 (t, J=6.5 Hz, 1H, H-1'), 4.48 (m, 1H, H-4'), 4.10 (m,
1H, H-3'), 3.94 (dd, J=35, 3 Hz, 2H, H-5'a, b), 2.78-2.75 (m, 1H,
H-2'a), 2.24-2.19 (m, 1H, H-2'b). 13C NMR (125 MHz, CD3OD) o 170.2,
150.2, 148.3, 139.0, 131.7, 131.6, 119.8, 117.8, 117.4, 91.5, 88.7,
70.1, 61.0, 41.5. 19F NMR (376 MHz, CD3OD) o -145.3. HRMS (ESI+)
m/z calcd for C12H13FNO3S2 (M+H+) 302.0315, found 302.0314.
[0205] Compound 12 (dFTPT3TP). Compound 12 (2.0 mg, 3.7 .mu.mol,
22%) was synthesized using the General Procedure for Triphosphate
Synthesis described above starting from 11 (5 mg, 16.6 .mu.mol).
31P NMR (162 MHz, D2O) o -10.9 (d, J=20.0 Hz, y-P), -11.6 (d,
J=21.1 Hz, a-P), -23.3 (t, J=23.1 Hz, f3-P). 19F NMR (376 MHz, D2O)
o -138.5 (s). MS (MALDI-TOF-, matrix: 9-aminoacridine) (m/z):
[M-H]- calcd for C12H14FNO12P3S2-, 539.9, found, 540.1.
##STR00026## ##STR00027##
[0206] Compound 13. To a solution of 5d (73 mg, 0.145 mmol) in
CH2Cl2 (1 mL) at 0.degree. C. under nitrogen atmosphere was added
dropwise iodine monochloride (1.0 M in CH2Cl2, 0.15 ml, 0.15 mmol).
The resulting mixture was stirred at room temperature overnight.
The reaction mixture was quenched with saturated aqueous
NaHCO.sub.3and saturated aqueous Na2S2O3, extracted with CH2Cl2,
dried, filtered and evaporated. The crude product was subjected to
silica gel column chromatography (Hexane/EtOAc) to afford compound
13 as white foam (57 mg, 0.091 mmol, 63%). 1H NMR (500 MHz, CDCl3)
.delta. 7.98-7.93 (m, 4H, Ar--H), 7.83 (s, 1H, Ar--H), 7.72 (d, J=5
Hz, 1H, Ar--H), 7.28-7.17 (m, 5H, Ar--H), 6.78-6.75 (m, 1H, H-1'),
5.65-5.63 (m, 1H, H-4'), 4.76 (m, 2H, H-5'a, b), 4.63-4.62 (m, 1H,
H-3'), 2.95-2.91 (m, 1H, H-2'a), 2.43 (s, 3H, Ar--CH3), 2.35 (s,
3H, Ar--CH3), 2.34-2.29 (m, 1H, H-2'b). 13C NMR (125 MHz, CDCl3)
.delta. 166.6, 166.5, 157.6, 147.4, 144.9, 144.6, 133.7, 132.7,
130.3, 130.1, 129.8, 129.7, 129.4, 128.5, 127.0, 126.8, 86.1, 83.8,
75.7, 64.7, 39.9, 22.2, 22.1. HRMS (ESI+) m/z calcd for C28H25INO5S
(M+H+) 630.0442, found 630.0440.
[0207] Compound 14. Compound 13 (30 mg, 0.048 mmol) was dried by 3
co-evaporations with anhydrous toluene. The residue was dissolved
in anhydrous toluene (1 mL), Lawesson's reagent (23 mg, 0.057 mmol)
was added and the mixture was heated overnight at reflux. After
filtration on cotton, the filtrate was concentrated and the crude
product was subjected to a silica gel column chromatography
(Hexane/EtOAc) to afford compound 14 as a yellow foam (8.4 mg,
0.013 mmol, 27%). 1H NMR (500 MHz, CDCl3) .delta. 8.31 (s, 1H,
Ar--H), 7.99-7.82 (m, 5H, Ar--H), 7.39-7.36 (m, 1H, H-1'),
7.29-7.20 (m, 5H, Ar--H), 5.65-5.64 (m, 1H, H-4'), 4.83-4.81 (m,
2H, H-5'a, b), 4.71-4.70 (m, 1H, H-3'), 3.35 (dd, J=15, 5.5 Hz, 1H,
H-2'a), 2.44 (s, 3H, Ar--CH3), 2.39 (s, 3H, Ar--CH3), 2.27-2.21 (m,
1H, H-2'b). 13C NMR (125 MHz, CDCl3) .delta. 172.9, 166.6, 144.9,
144.7, 144.6, 141.8, 137.8, 135.0, 130.3, 130.2, 129.8, 129.7,
128.6, 126.9, 126.7, 91.7, 84.5, 75.3, 64.6, 39.5, 22.2, 22.1. HRMS
(ESI+) m/z calcd for C28H25INO5S2 (M+H+) 646.0213, found
646.0219.
[0208] Compound 15. To a solution of 14 (10 mg, 0.015 mmol) in DMF
(2 mL) under nitrogen atmosphere was added (PPh3)4Pd (1.7 mg,
0.0015 mmol), CuI (0.57 mg, 0.011 mmol) and Et3N (5 .mu.L, 0.030
mmol). The reaction mixture was degassed and a solution of
C12CHCONHCH2CCH (3.8 mg, 0.0225 mmol) in DMF (0.5 mL) was added.
The reaction mixture was stirred overnight at room temperature and
monitored by TLC. The reaction mixture was diluted with EtOAc,
quenched with saturated aqueous NaHCO.sub.3, extracted with EtOAc,
dried, filtered and evaporated. The crude product was subjected to
silica gel column chromatography (MeOH/CH2Cl2) to afford compound
15 as yellow foam (9.2 mg, 0.0135 mmol, 91%). 1H NMR (500 MHz,
CDCl3) .delta. 8.26 (s, 1H, Ar--H), 7.99-7.82 (m, 5H, Ar--H),
7.40-7.37 (m, 2H, Ar--H, H-1'), 7.29-7.21 (m, 4H, Ar--H), 6.71 (br,
1H, NH),6.95 (s, 1H, CHCl2), 5.65-5.64 (m, 1H, H-4'), 4.85-4.79 (m,
2H, H-5'a, b), 4.73 (m, 1H, H-3'), 4.26-4.11 (m, 2H, NHCH2),
3.38-3.34 (m, 1H, H-2'a), 2.44 (s, 3H, Ar--CH3), 2.40 (s, 3H,
Ar--CH3), 2.31-2.25 (m, 1H, H-2'b). 13C NMR (125 MHz, CDCl3) o
173.3, 166.6, 164.1, 144.8, 139.0, 138.3, 133.4, 130.3, 130.1,
129.8, 129.7, 126.9, 124.3, 104.8, 91.8, 88.3, 84.5, 78.8, 75.2,
66.4, 64.7, 39.6, 31.3, 22.2. 22.1. HRMS (ESI+) m/z calcd for
C33H29C12N206S2 (M+H+) 683.0839, found 683.0854.
[0209] Compound 16. To a solution of 15 (9.2 mg, 0.0135 mmol) in
methanol (1.0 ml) was added dropwise 30% NaOMe (2.92 mg, 0.32
mmol). The reaction mixture was stirred for 1 h at room temperature
and monitored by TLC. The reaction mixture was concentrated and the
crude product was subjected to silica gel column chromatography
(MeOH/CH2Cl2) to afford compound 16 as yellow foam (4.5 mg, 0.01
mmol, 74%). 1H NMR (500 MHz, CD3OD) o 8.69 (s, 1H, Ar--H), 8.06 (d,
J=5 Hz, 1H, Ar--H), 7.53 (d, J=5 Hz, 1H, Ar--H), 7.30 (t, J=5 Hz,
1H, H-1'), 6.33 (s, 1H, CHCl2), 4.47-4.46 (m, 1H, H-4'), 4.36 (s,
2H, NHCH2), 4.11-4.08 (m, 1H, H-3'), 3.97 (dd, J=12, 3 Hz, 2H,
H-5'a, b), 2.79-2.74 (m, 1H, H-2'a), 2.21-2.16 (m, 1H, H-2'b). 13C
NMR (125 MHz, CD3OD) o 172.9, 138.4, 134.3, 123.9-122.8, 104.7,
100.0, 91.2, 88.6, 77.1, 70.3, 66.4, 61.1, 41.7, 30.2. HRMS (ESI+)
m/z calcd for C17H17C12N204S2 (M+H+) 447.0001, found 447.0020.
[0210] Compound 17 (dTPT3.sup.PATP). Compound 17 (2.2 mg, 3.1
.mu.mol, 28%) was synthesized using the General Procedure for
Triphosphate Synthesis described above starting from 16 (5 mg, 11.2
.mu.mol). 31P NMR (162 MHz, D2O) o -10.85 (d, J=19.9 Hz, y-P),
-11.63 (d, J=20.0 Hz, a-P), -23.07 (s), -23.26 (t, J=19.7 Hz,
f3-P). MS (MALDI-TOF-, matrix: 9-aminoacridine) (m/z): [M-H]- calcd
for C17H18C12N2013P3S2-, 684.9, found, 685.0.
Example 3. General Procedure for PCR Amplification Assay to
Determine Fidelity
[0211] Materials. Taq and OneTaq DNA polymerases were purchased
from New England Biolabs (Ipswich, Mass.). A mixture of dNTPs was
purchased from Fermentas (Glen Burnie, Md.). SYBR Green I Nucleic
Acid Gel Stain (10,000.times.) was purchased from Life Technologies
(Carlsbad, Calif.).
[0212] DNA oligonucleotides. Complete oligonucleotide sequences are
provided in Table 8. Fully natural primers were purchased from
Intergrated DNA Technologies (Coralville, Iowa). Reagents and
solvents for synthesis of unnatural primers 1-3 were obtained from
Glen Research (Sterling, Va.) and/or Applied Biosystems (Foster
City, Calif.). The oligonucleotides were prepared using standard
automated DNA synthesis with ultra-mild natural phosphoramidites
(Glen Research) and dNaM phosphoramidite (Berry & Associates,
Inc., Dexter, Mich.) on controlled pore glass supports (0.20
.mu.mol, 1000 .ANG., Glen Research) and an ABI Expedite 8905
synthesizer. After automated synthesis, the oligonucleotides were
cleaved from the support, deprotected by incubation in conc.
aqueous ammonia overnight at room temperature, purified by DMT
purification (Glen-pak.TM. cartridge, Glen Research), and desalted
over Sephadex G-25 (NAP-25 Columns, GE Healthcare). The
concentration of single stranded oligonucleotides was determined by
UV absorption at 260 nm.
[0213] PCR assay. PCR amplifications were performed in a total
volume of 25 .mu.L and with conditions specific for each assay as
described in Table 9. After amplification, a 5 .mu.L aliquot was
analyzed on a 6% non-denaturing PAGE gel ran along with 50 bp
ladder (Life Technologies) to confirm amplicon size. The remaining
solution was purified by spin-column (DNA Clean and Concentrator-5;
Zymo Research, Irvine, Calif.), followed by 4% agarose gel,
recovered with Zymoclean Gel DNA Recovery Kit (Zymo Research),
quantified by fluorescent dye binding (Quant-iT dsDNA HS Assay kit,
Life Technologies), and sequenced on a 3730 DNA Analyzer (Applied
Biosystems). Fidelity was determined as the average % retention of
the unnatural base pair per doubling as described below.
[0214] Determination of fidelity. The percent retention of an
unnatural base pair (F) was measured using raw sequencing data and
normalized to fidelities per doubling. Briefly, the presence of an
unnatural nucleotide leads to a sharp termination of the sequencing
profile, while mutation to a natural nucleotide results in
"readthrough". The extent of the "read-through" is thus inversely
correlated with the retention of the unnatural base pair. To use
the sequencing data as a quantitative measurement of PCR fidelity,
we performed calibration experiments in the range of 50-100%
retention of the unnatural base pair. Therefore, low retention
(<50%) and high "read-through" make the quantification
inaccurate.
[0215] Quantification of the high retention (>50%) was performed
by adjusting the start and stop points for the Sequencing Analysis
software (Applied Biosystems) and then determining the average
signal intensity individually for each channel (A, C, G and T) for
peaks within those defined points (35-45 nucleotides in length)
before (section L) and S36 after (section R) the unnatural
nucleotide. The R/L ratio was normalized using sequencing
calibration plots to account for both noise in the sequencing
chromatograms and the read-through in the control samples. The R/L
ratio of after normalization (R/Lnorm) corresponds to the
percentage of the natural sequences in the pool. Finally, F was
calculated as 1-(R/L)norm and the retention of the unnatural base
pair per doubling (fidelity, f) was calculated as 1/(F.sup.log 2A),
where A is an amplification and log 2A is the number of doublings.
Each sample before and PCR amplification was sequenced in
triplicate in each direction to minimize sequencing error.
Corresponding data is provided in Table 10. Under standard PCR
conditions, DNA containing dTPT3-dNaM was amplified by OneTaq with
an efficiency that is only 4-fold lower than that of DNA containing
just the natural base pairs, and with a fidelity in excess of
99.98%. This fidelity corresponds to an error rate of 10.sup.-4 per
nucleotide, which overlaps with the 10.sup.-4 to 10.sup.-7 error
rate of fully natural DNA with commonly used PCR systems. With Taq
polymerase, the efficiency is only 2.5-fold lower than that of a
natural base pair, and the fidelity is 99.7%. This fidelity
corresponds to an error rate of 10.sup.-3, which is similar to that
observed with the Taq-medicated amplification of natural DNA.
TABLE-US-00008 TABLE 8 DNA sequences. Sequence (5' to 3') Name
Primer regions underlined Remarks Fend1 CACACAGGAAACAGCTATGAC (SEQ
ID Primers NO: 1) for PCR (templates Fend2 GAAATTAATACGACTCACTATAGG
(SEQ D6 and ID NO: 2) 134mer) Fend1- TTTTTTTTTTTTTTTTTTTTTTTTTTTTT
Primers poly-dT TTTTTTTTTTTTTTTTTTTTTTTTTTTTT for Sanger
TCACACAGGAAACAGCTATGAC (SEQ sequencing ID NO: 3) (templates D6 and
Fend2- TTTTTTTTTTTTTTTTTTTTTTTTTTTTT 134mer) poly-dT
TTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTGAAATTAATACGACTCACTATAGG (SEQ ID
NO: 4) D6 CACACAGGAAACAGCTATGACCCGGGTTA N =
TTACATGCGCTAGCACTTGGAATTCACCA randomized GACGNNN NaM
NNNCGGGACCCATAGTA natural AATCTCCTTCTTAAAGTTAAGCTTAACCC nucleotide
TATAGTGAGTCGTATTAATTTC (SEQ ID NO: 6) 134mer
CACACAGGAAACAGCTATGACCCGGGTTA TTACATGCGCTAGCACTTGGAATTCACAA TACT
NaM TCTTTAAGGAAACCATAGTA AATCTCCTTCTTAAAGTTAAGCTTAACCC
TATAGTGAGTCGTATTAATTTC (SEQ ID NO: 5) Primer1 NaM
CCTGCGTCAATGTAATGTTC (SEQ Primers ID NO: 7) for PCR with Primer2
TTCACGGT NaM AGCACGCATAGG Temp1-3 (SEQ ID NO: 8) Primer3 CCAATGTACC
NaM TGCGTATGTTC (SEQ ID NO: 9) Primer- CCCTGCGTTTATCTGCTCTC (SEQ ID
rev NO: 10) Temp1 CCCTGCGTTTATCTGCTCTCTCGGTCGTT The
CGGCTGCGGCGGAACATTACATTGACGCA nucleotides GG (SEQ ID NO: 11) shown
in bold Temp2 CCCTGCGTTTATCTGCTCTCTCGGTCGTT form a
CGGCTGCGCGCCTATGCGTGCTTACCGTG mispair AA (SEQ ID NO: 12) with dNaM
in the Temp3 CCCTGCGTTTATCTGCTCTCTCGGTCGTT first
CGGCTGCCGGAACATACGCATGGTACATT round of GG (SEQ ID NO: 13) PCR
TABLE-US-00009 TABLE 9 PCR Conditions. PCR for biotin PCR for
biotin labeling labeling (unnatural (unnatural base base pair pair
centrally positioned at 1, 9, OneTaq Taq located) 11 positions)
Buffer 1 .times. OneTaq 1 .times. Taq 1 .times. OneTaq 1 .times.
OneTaq Enzyme, U/.mu.L OneTaq, 0.02 Taq, 0.02 OneTaq, 0.02 OneTaq,
0.02 Template D6 (0.01 ng) D6 (0.01 ng) 134mer (0.5 ng) 60mer (0.5
ng) dNTPs, .mu.M 200 200 200 200 dNaMTP, .mu.M 100 100 100 100
dXTP, .mu.M 100 100 100 of 100 of d5SICS.sup.PATP or
d5SICS.sup.PATP or dTPT31.sup.PATP dTPT3.sup.PATP Mg.sup.2+, mm 3 3
3 3 Primers, .mu.M 1 1 1 1 SYBR Green I 0.5x 0.5x 0.5x 0.5x Thermal
conditions Initial -- -- 96.degree. C., 1 min 96.degree. C., 1 min
denaturing Denaturing 96.degree. C., 10 s 96.degree. C., 10 s
96.degree. C., 15 s 96.degree. C., 15 s Annealing 60.degree. C., 15
s 60.degree. C., 15 s 60.degree. C., 30 s 64.degree. C., 30 s
Extension 68.degree. C., 60 s 68.degree. C., 15 s 68.degree. C., 2
min 68.degree. C., 2 min # cycles 16 + 16 + 16 20 12 12
TABLE-US-00010 TABLE 10 OneTaq PCR (48 cycles) Taq PCR (20 cycles)
dXTP amplification .times.10.sup.12 retention, % fidelity, %
amplification .times.10.sup.13 retention, % fidelity, % 5SICS 9.4
96.3 .+-. 1.7 99.91 .+-. 0.04 7.7 86.7 .+-. 1.0 98.90 .+-. 0.01
TPT3 12.9 >99 >99.98 11.7 95.6 .+-. 1.7 99.66 .+-. 0.13
TPT3.sup.PA 4.7 98.6 .+-. 1.2 99.97 .+-. 0.03 3.5 85 .+-. 4 98.7
.+-. 0.4 5SICS.sup.PA 9.2 45 .+-. 2 98.16 .+-. 0.12 6.4
.sub.--.sup.a .sub.--.sup.a .sup.aUnnatural base pair lost during
amplification
Example 4: Site-Specific Labeling of TPT3: Analysis Via
Streptavidin Gel Shift Assay
[0216] A 134-mer DNA comprising a centrally positioned
dTPT3.sup.PA-dNaM or d5SICS.sup.PA-dNaM was synthesized. DNA
templates were amplified by PCR under the conditions described in
Table 9. Upon completion, NaOH (1 M, 12.5 .mu.L) was added directly
to PCR samples to a final concentration of 0.2 M and incubated for
5 hr at room temperature. After the addition of NaOAc (3 M, pH 5.5,
7.5 .mu.L) and 200 .mu.L of cold ethanol, the samples were mixed,
incubated on ice overnight, and DNA was precipitated by
centrifugation at 10,000 rfu for 30 min at 4.degree. C. The
supernatant was removed and the pellets were carefully washed with
80% ethanol. The samples were resuspended in 50 .mu.L of the
annealing buffer (50 mM Na phosphate, pH 7.5, 100 mM NaCl, 1 mM
EDTA), heated to 95.degree. C. and cooled to room temperature over
30 min. NHS-PEG.sub.4-biotin (Thermo Scientific) solution in the
annealing buffer (40 mM, 50 .mu.L) was mixed with the DNA samples
and incubated overnight at room temperature. The samples were
purified by spin-column (DNA Clean and Concentrator-5, Zymo
Research) and eluted in 10 .mu.L of elution buffer. Half of the
sample (5 .mu.L) was mixed with 1 .mu.g of streptavidin (Promega)
in annealing buffer, incubated for 30 min at 37.degree. C., mixed
with 5.times. non-denaturing loading buffer (Qiagen), and loaded on
6% non-denaturing PAGE. The remaining half was mixed with 5.times.
non-denaturing loading buffer, and loaded directly on the gel as a
control. After running the gel at 110 V for 30 min, the gel was
soaked in 1.times. Sybr Gold Nucleic Acid Stain (Life Technologies)
for 30 min and visualized using a Molecular Imager Gel Doc XR+
equipped with 520DF30 filter (Bio-Rad). A schematic of the labeling
strategy described is shown below.
##STR00028##
Example 5. General Procedure for Transcription of an Unnatural Base
Pair
[0217] To characterize the transcription of the unnatural base
pairs formed by dTPT3 and dNaM, or analogs or derivatives thereof
(wherein derivatives include linker moieties), ribonucleotides and
deoxynucleotides are synthesized and converted to the corresponding
triphosphates or deoxyphosphoramidites, and the
deoxyphosphoramidites are incorporated into DNA templates using
automated DNA synthesis. Transcription experiments are conducted
with 100 nM DNA substrate, 1.times. Takara buffer (40 mM Tris-HCl,
pH 8.0, 8 mM MgCl.sub.2, 2 mM spermidine), DEPC-treated and
nuclease-free sterilized water (Fisher), T7 polymerase (50 units),
20 .mu.M each natural NTP, .alpha.-.sup.32P-ATP (2.5 .mu.Ci, MP
Biomedicals), and either 5 .mu.M TPT3TP or 5 .mu.M NamTP. After
incubation for 2 hr at 37.degree. C., the reaction is quenched by
the addition of 10 .mu.L of gel loading solution (10 M urea, 0.05%
bromophenol blue), and the reaction mixture is loaded onto a 20%
polyacrylamide-7 M urea gel, subjected to electrophoresis, and
analyzed by phosphorimaging. Transcription efficiency is examined
by measuring (at low percent conversion) the amount of full-length
product formed as a function of time.
Example 6. General Procedure for Thermodynamic Analysis of a DNA
Duplex Comprising an Unnatural Base Pair
[0218] UV melting experiments are carried out using a Cary 300 Bio
UV-visible spectrophotometer. The absorbance of a sample (3 .mu.L
oligonucleotide comprising an unnatural base pair, 10 mM PIPES
buffer, pH 7.0, 100 mM NaCl, 10 mM MgCl2) is monitored at 260 nm
from 21.degree. C. to 80.degree. C. at a heating rate of
0.5.degree. C. per min. Melting temperatures are determined via the
derivative method using the Cary Win UV thermal application
software.
[0219] Thermodynamic parameters are determined by van't Hoff
analysis
T.sub.m.sup.-1=R[ln([C.sub.T]/4)].DELTA.H+.DELTA.S.degree./.DELTA.H.degre-
e., where .DELTA.H.degree. and .DELTA.S.degree. are the standard
enthalpy and entropy changes determined from UV experiments,
respectively, R is the universal gas constant and [C.sub.T] is the
total oligonucleotide strand concentration. The changes in the
number of water molecules associated with the melting process,
.DELTA.n.sub.w, are obtained from the dependence of T.sub.m on
water activity (a.sub.w) according to the equation
.DELTA.n.sub.w=(-.DELTA.H/R)[.delta.(T.sub.m.sup.-1)/.delta.(ln
a.sub.w)]. The slope of the plot of reciprocal temperature
(K.sup.-1) of melting versus the logarithm of water activity at
different concentrations (0, 2, 5, 7, 10, 12 and 15% wt %) of
ethylene glycol is taken as the value of
.delta.(T.sub.m.sup.-1)/.delta.(ln a.sub.w).
[0220] CD experiments are performed with an Aviv model 61 DS
spectropolarimeter equipped with a Peltier thermoelectric
temperature control unit (3 .mu.M oligonucleotide concentration, 10
mM PIPES buffer, pH 7.0, 100 mM NaCl, 10 mM MgCl2). The data are
collected using a 1 cm path length quartz cuvette with scanning
from 360 to 220 nm, a time constant of 3 s and a wavelength step
size of 0.5 nm at 25.degree. C.
Example 7. In Vitro Selection with Unnatural Nucleobases
[0221] An oligonucleotide library comprising unnatural nucleic
acids is generated. A sample of the library is subjected to
sequential binding and elution from a target molecule, for example,
a protein. The pool of binding nucleic acids are amplified by PCR
and subjected to another round of selection for binding to the
target molecule. This selection process is repeated a number of
times. To increase selection pressure, in the last few rounds of
selection, the concentration of target molecule and/or incubation
time is reduced. Surviving nucleic acids are sequenced as potential
aptamers. The binding affinities of potential aptamers are
determined using flow-cytometry.
Example 8. General Procedure for DNA Click Reaction
[0222] To a DNA solution (0.2 pmol) in 14 .mu.l DMSO was added 1
.mu.L azide-PEG(3+3)-S-S-Biotin(20 mM in H2O), followed by 2 .mu.L
of ligand (BimC.sub.4A).sub.3(4 mM in H2O), 1 .mu.L of sodium
ascorbate (100 mM in H2O), and 1 .mu.L of PBS buffer (5.times.),
the mixture was then vortexed and as the last component, 1 .mu.L of
a freshly prepared CuSO.sub.4 solution (4 mM in H.sub.2O) was
added. The solution was shaken for 2 h at 37.degree. C., and then
the resulting product DNA was purified (DNA Clean &
Concentrator-5 kit, Zymo Research Corp.). The purified samples were
used directly for gel mobility assays (see below).
Example 9. General Procedures for Post-Amplification DNA Labeling
(from Seo et al., JACS 2011, 133, 19878)
[0223] For post-enzymatic synthesis labeling, dsDNA with a free
amino group was incubated with 10 mM EZ-Link sulfo-NHS-SS-biotin or
EZ-Link NHS-PEG.sub.4-biotin (Thermo Scientific) for 1 h at rt in
phosphate labeling buffer (50 mM sodium phosphate, pH 7.5, 150 mM
NaCl, 1 mM EDTA), and then purified using the Qiagen PCR
purification kit. With either dichloroacetyl protected amine
derivatives such as dTPT3.sup.PA or d5SICS.sup.PA, the amine first
required deprotection, which was accomplished by overnight
incubation in a concentrated aqueous ammonia solution at rt.
Ammonia was removed via a SpeedVac concentrator (water aspirator
followed by oil vacuum pump). To cleave the disulfide containing
linkers (i.e. SS-biotin or SS-PEG.sub.4-biotin), dsDNA was treated
with DTT (final concentration of 30 mM) for 1 hour at 37.degree. C.
For backbone labeling, dsDNA with a backbone phosophorothioate was
incubated with 25 mM EZ-Link iodoacetyl-PEG.sub.2-biotin (Thermo
Scientific) in phosphate labeling buffer overnight at 50.degree.
C., and products were purified with Qiagen PCR Purification Kit.
All reactions manipulating attached biotin moieties were quantified
by streptavidin gel-shift assays.
[0224] Gel Mobility Assays. DNA samples (10-50 ng) were mixed with
1 .mu.g of streptavidin (Promega) in phosphate labeling buffer (50
mM sodium phosphate, pH 7.5, 150 mM NaCl, 1 mM EDTA), incubated for
30 min at 37.degree. C., mixed with 5.times. nondenaturing loading
buffer (Qiagen), and loaded on 6% nondenaturing PAGE. The gel was
run at 150 V for 25-40 min, then stained with 1.times. Sybr Gold
Nucleic Acid Stain (Life Technologies) in TBE for 30 min and
visualized using a Molecular Imager Gel Doc XR+ equipped with
520DF30 filter (Bio-Rad). Strong bands corresponding to dsDNA (at
.about.150 bp) and the 1:1 complex between dsDNA and streptavidin
(at .about.400 bp) were apparent. Faint bands corresponding to
higher order (slower migrating) complexes of DNA and streptavidin
or from unbiotinylated, single-stranded DNA resulting from
incomplete annealing after PCR in some cases were also
apparent.
[0225] All patents and publications referred to herein are
incorporated by reference herein to the same extent as if each
individual publication was specifically and individually indicated
to be incorporated by reference in its entirety.
[0226] The terms and expressions which have been employed are used
as terms of description and not of limitation, and there is no
intention that in the use of such terms and expressions of
excluding any equivalents of the features shown and described or
portions thereof, but it is recognized that various modifications
are possible within the scope of the embodiments claimed. Thus, it
should be understood that although the present embodiments have
been specifically disclosed by preferred embodiments and optional
features, modification and variation of the concepts herein
disclosed may be resorted to by those skilled in the art, and that
such modifications and variations are considered to be within the
scope of this disclosure as defined by the appended claims.
Sequence CWU 1
1
16121DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 1cacacaggaa acagctatga c
21224DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 2gaaattaata cgactcacta tagg
24380DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 3tttttttttt tttttttttt tttttttttt
tttttttttt tttttttttt tttttttttc 60acacaggaaa cagctatgac
80485DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 4tttttttttt tttttttttt tttttttttt
tttttttttt tttttttttt tttttttttt 60tgaaattaat acgactcact atagg
855134DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic polynucleotide"modified_base(63)..(63)Unnatural
base 5cacacaggaa acagctatga cccgggttat tacatgcgct agcacttgga
attcacaata 60ctntctttaa ggaaaccata gtaaatctcc ttcttaaagt taagcttaac
cctatagtga 120gtcgtattaa tttc 1346134DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
polynucleotide"modified_base(63)..(65)a, c, t, g, unknown or
othermodified_base(66)..(66)Unnatural basemodified_base(67)..(69)a,
c, t, g, unknown or other 6cacacaggaa acagctatga cccgggttat
tacatgcgct agcacttgga attcaccaga 60cgnnnnnnnc gggacccata gtaaatctcc
ttcttaaagt taagcttaac cctatagtga 120gtcgtattaa tttc
134721DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer"modified_base(1)..(1)Unnatural base
7ncctgcgtca atgtaatgtt c 21821DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer"modified_base(9)..(9)Unnatural base 8ttcacggtna gcacgcatag g
21922DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer"modified_base(11)..(11)Unnatural base
9ccaatgtacc ntgcgtatgt tc 221020DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 10ccctgcgttt atctgctctc 201160DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 11ccctgcgttt atctgctctc tcggtcgttc ggctgcggcg
gaacattaca ttgacgcagg 601260DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 12ccctgcgttt atctgctctc tcggtcgttc ggctgcgcgc
ctatgcgtgc ttaccgtgaa 601360DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 13ccctgcgttt atctgctctc tcggtcgttc ggctgccgga
acatacgcat ggtacattgg 601421DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 14ataatacgac tcactatagg g 211535DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide"modified_base(5)..(5)Unnatural base 15cactnctcgg
gattccctat agtgagtcgt attat 351617RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide"modified_base(13)..(13)Unnatural base 16gggaaucccg
agnagug 17
* * * * *