U.S. patent application number 16/489265 was filed with the patent office on 2020-01-09 for means and methods for oral protein delivery.
The applicant listed for this patent is UNIVERSITEIT GENT, VIB VZW. Invention is credited to Nico Callewaert, Anna Depicker, Bram Laukens, Robin Vanluchene, Vikram Virdi.
Application Number | 20200009229 16/489265 |
Document ID | / |
Family ID | 58264383 |
Filed Date | 2020-01-09 |
View All Diagrams
United States Patent
Application |
20200009229 |
Kind Code |
A1 |
Callewaert; Nico ; et
al. |
January 9, 2020 |
MEANS AND METHODS FOR ORAL PROTEIN DELIVERY
Abstract
The present invention relates to the field of recombinant
protein production in a host cell. More specifically the invention
relates to the field of oral protein delivery. Specifically, the
invention provides oral pharmaceutical formulations comprising the
culture medium of a recombinant host secreting a recombinant
protein. The resulting oral pharmaceutical formulations are useful
for the treatment of gastro-intestinal and/or buccal disorders.
Additionally, the oral pharmaceutical formulations are useful for
prophylactic and vaccine purposes.
Inventors: |
Callewaert; Nico; (Nevele,
BE) ; Vanluchene; Robin; (Tielt, BE) ;
Laukens; Bram; (Gent, BE) ; Depicker; Anna;
(Schelderode, BE) ; Virdi; Vikram; (Gent,
BE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
VIB VZW
UNIVERSITEIT GENT |
Gent
Gent |
|
BE
BE |
|
|
Family ID: |
58264383 |
Appl. No.: |
16/489265 |
Filed: |
February 28, 2018 |
PCT Filed: |
February 28, 2018 |
PCT NO: |
PCT/EP2018/054966 |
371 Date: |
August 27, 2019 |
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 2039/505 20130101;
A23L 33/18 20160801; A61K 38/20 20130101; A61K 9/0095 20130101;
A61K 47/36 20130101; C12P 21/02 20130101; A61K 2121/00 20130101;
A61K 2300/00 20130101; A61K 9/19 20130101; C07K 2319/30 20130101;
C07K 16/1232 20130101; A23L 33/17 20160801; C12N 1/16 20130101;
A23V 2002/00 20130101; A61K 38/00 20130101; A61K 47/68 20170801;
A61P 31/04 20180101; C07K 2317/22 20130101; A61K 36/06 20130101;
C07K 14/54 20130101; A23K 20/10 20160501 |
International
Class: |
A61K 38/20 20060101
A61K038/20; A61K 9/19 20060101 A61K009/19; C07K 16/12 20060101
C07K016/12; A23L 33/18 20060101 A23L033/18; A23K 20/10 20060101
A23K020/10 |
Foreign Application Data
Date |
Code |
Application Number |
Feb 28, 2017 |
EP |
17158471.7 |
Claims
1. A dried formulation obtained by process comprising: subjecting
culture medium of a recombinant fungal host cell to a membrane
separation process or a depth filtration process; and drying the
separated or filtered medium, wherein the culture medium comprises
a polypeptide secreted into the culture medium by the recombinant
fungal host cell; and wherein the polypeptide is exogenous to the
recombinant fungal host cell.
2. The dried formulation of claim 1 wherein the recombinant
polypeptide is fused to a Fc domain.
3. The dried formulation of claim 1, wherein the polypeptide is a
prophylactic or therapeutic peptide or wherein the polypeptide is a
vaccine or forms part of a vaccine.
4. The dried formulation of claim 1, wherein an oral admissible
matrix is added to the separated or filtered medium prior to
drying.
5. The dried formulation of claim 2, wherein the Fc domain is an
IgA Fc domain.
6. The dried formulation of claim 1, wherein the drying is carried
out by spray-drying or by lyophilisation.
7. (canceled)
8. The dried formulation of claim 1, wherein the dried formulation
is a medicament.
9. The dried formulation of claim 1, wherein the dried formulation
comprises a pharmaceutical excipient.
10. The dried formulation of claim 8, wherein the medicament is a
medicament for the treatment of gastro-intestinal diseases.
11. The dried formulation of claim 8, wherein the medicament is a
medicament for the treatment of buccal diseases.
12. The dried formulation of claim 1, wherein the dried formulation
is a vaccine.
13. The dried formulation of claim 1, wherein the dried formulation
forms part of a feed product or food product.
14. The dried formulation of claim 13, wherein the food product is
a functional or medicinal food product.
15. The dried formulation of claim 1, wherein the polypeptide is
IL22.
16. (canceled)
17. (canceled)
18. The dried formulation of claim 1, wherein the polypeptide is an
immunoglobulin single variable domain.
19. A method of making a dried formulation, the method comprising:
subjecting culture medium of a recombinant fungal host cell to a
membrane separation process or a depth filtration process; and
drying the separated or filtered medium, wherein the culture medium
comprises a polypeptide secreted into the culture medium by the
recombinant fungal host cell; and wherein the polypeptide is
exogenous to the recombinant fungal host cell.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to the field of recombinant
protein production in a host cell such as yeast cells. More
specifically the invention relates to the field of oral protein
delivery. Specifically, the invention provides oral pharmaceutical
formulations comprising the culture medium of a recombinant host
secreting a recombinant polypeptide.
INTRODUCTION TO THE INVENTION
[0002] Peptides or proteins, including hormones, enzymes, ligands,
or inhibitors, including antibodies, regulate various cellular
functions. Therefore, they are useful in the clinic to treat or
prevent human disorders by modulating physiological or pathological
processes. In contrast to small-molecule drugs, the high
selectivity of peptides or proteins to their targets may reduce
side effects and toxicity to host cell. It is expected that the use
of proteins or peptides for therapeutic purposes will continue to
increase in the treatment of cancer, metabolic disorders,
gastro-intestinal diseases, buccal diseases, neurodegenerative and
infectious diseases. Currently, protein drugs are largely
manufactured using mammalian, plant, yeast or bacterial cell
culture systems. These expressed proteins must be extracted and
purified, which requires expensive and complex processes and cold
storage and transportation. Biologics are generally delivered by
intravenous or subcutaneous injection, which is effective but not
desirable for patients, particularly for chronic conditions.
Injectable forms of protein drugs often require health care
personnel for administration, resulting in frequent hospital visits
and decreased patient compliance. Other routes of delivery such as
transdermal, intranasal, inhalation and oral administration are
under investigation, but oral delivery is generally considered as
the most desired route. Despite decades of effort, oral delivery of
peptides, proteins and antibody drugs remains a major
pharmaceutical challenge, with only a handful of such proteins on
the market. This is particularly disappointing since biologics are
the fast growing segment of the pharma market, tripling in value
from 36 billion dollar to 163 billion dollar in the last 10 years.
Thus, while convenient for patients, there exist a number of
technical barriers which make this route of administration
challenging for large-molecule drugs. Certainly the most important
challenge is the enzymatic and pH-dependent degradation of drugs in
the stomach and intestines. In addition there is the low
permeability of epithelial cells that line the gastrointestinal
(GI) tract and the intrinsic instability of these compounds.
Several technologies have been developed to facilitate the oral
delivery of large molecules. Attaching molecules like polyethylene
glycol, an antibody Fc domain or human serum albumin increases
peptide stability in serum during circulation. In addition, peptide
drugs can be modified to protect from serum proteases and
peptidases. Such modifications include N-terminal acetylation,
C-terminal amidation, the use of non-natural amino acids, and
cyclization via disulfide bonds. In addition, some improvements
have been made in the development of enzyme inhibitors, the use of
absorption or permeation enhancers, the formulation of polypeptides
in capsules, the application of adhesive polymers that stick to the
gut lining and the incorporation of carrier molecules in the
formulation. Despite these technologies proteins and peptides
typically have extremely low bioavailability of less than 2% when
taken by mouth. Recently we showed that plant seed produced
antibodies survive the gastric canal and were biologically active
in the intestine (see WO2014033313 and Virdi V. et al (2013) PNAS,
110, 29, 11809-11814). Plant production systems though capable of
producing high amounts of recombinant proteins, owing to the
lengthy and expensive regulatory procedures they would not be the
best choice for producing edible vaccines. Lower eukaryotic
organisms are more desirable are capable of producing higher
amounts of recombinant proteins. It would be an advantage to use
lower eukaryotic hosts such as yeasts for the production of
therapeutic proteins which can be orally delivered. Lower
eukaryotic cells have been described for delivery of therapeutic
proteins but only as complete recombinant cells which are capable
of producing a therapeutic protein (see for example Zhang et al.
(2012) BMC Biotechnology 12:97 and WO2007039586). It would be
desirable to be able to use only the culture medium comprising the
secreted polypeptide instead of the recombinant yeast itself. Even
more desirable it would be important not having to purify the
therapeutic polypeptide from the culture medium and to use the
culture medium as such.
SUMMARY OF THE INVENTION
[0003] In the present invention we surprisingly show that a dried
formulation comprising the culture medium of a recombinant yeast,
which medium comprises a therapeutic polypeptide and which medium
has been treated by a membrane separation process to reduce the
concentration of permeate compounds, can be used as an oral
delivery formulation. It is shown that the powdered dried culture
medium (obtained via lyophilisation or via spray drying) comprising
the therapeutic polypeptide is surprisingly protected from
degradation in the gut. Furthermore it is also shown that the
powdered dried formulation also maintains its biological activity
in the gut.
[0004] In a first aspect the invention provides a dried formulation
comprising the mixture of an orally admissible matrix and the
culture medium from a recombinant host, in which culture medium the
concentration of soluble permeate compounds has been reduced in a
membrane separation process, said host producing an exogenous
polypeptide which is secreted into said culture medium.
[0005] In yet another specific aspect the invention provides a
formulation comprising the culture medium from a recombinant yeast,
said yeast producing an exogenous polypeptide which is secreted
into said culture medium.
[0006] In a second aspect the invention provides a formulation
according to aspect 1 wherein the water content of said formulation
and soluble molecules with a molecular weight lower than 5 kDa are
reduced by concentrating said culture medium in a membrane
separation process prior to preparing said formulation.
[0007] In a third aspect the invention provides a formulation
according to aspect 1 wherein the water content and soluble
molecules with a molecular weight lower than 5 kDa are reduced by
drying said culture medium prior to preparing said formulation.
[0008] In a fourth aspect the invention provides a formulation
according to aspect 1 wherein the water content of said formulation
and soluble molecules with a molecular weight lower than 5 kDa are
reduced by drying said formulation.
[0009] In a fifth aspect the invention provides a dried formulation
comprising the culture medium of a recombinant host, said host
producing an exogenous polypeptide which is secreted into said
culture medium.
[0010] In a sixth aspect the invention provides a dried formulation
according to aspect five wherein said recombinant host is a
yeast.
[0011] In a seventh aspect the invention provides a dried
formulation according to aspects 5 and 6 wherein the exogenous
polypeptide is fused to an Fc domain.
[0012] In an eight aspect the invention provides a dried
formulation according to aspect 7 wherein said Fc domain is an IgA
Fc domain.
[0013] In a ninth aspect the invention provides a dried formulation
according to any one of aspects 5 to 8 wherein said exogenous
peptide is a prophylactic or therapeutic peptide or wherein said
exogenous peptide is a vaccine or forms part of a vaccine.
[0014] In a tenth aspect the invention provides a dried formulation
comprising a polypeptide which is exogenous to a recombinant host
obtained by secretion of said polypeptide into the culture medium
of a recombinant host followed by drying of said culture
medium.
[0015] In an eleventh aspect the invention provides a dried
formulation comprising a fusion polypeptide with an Fc domain
obtained by producing said fusion polypeptide into the culture
medium of a recombinant host followed by drying of said culture
medium.
[0016] In a twelfth aspect the invention provides a dried
formulation according to aspects 10 or 11 wherein said recombinant
host is a prokaryotic host, a plant cell or a fungal cell
particularly a filamentous fungus.
[0017] In a thirteenth aspect the invention provides a dried
formulation according to aspects 10 or 11 wherein said recombinant
host is a yeast cell.
[0018] In a fourteenth aspect the invention provides a dried
formulation according to any one of aspects 5 to 13 wherein said
drying is carried out by spray-drying.
[0019] In a fifteenth aspect the invention provides a dried
formulation according to any one of aspects 5 to 13 wherein said
drying is carried out by lyophilisation.
[0020] In a sixteenth aspect the invention provides a dried
formulation according to any one of aspects 5 to 13 further
comprising yeast cells.
[0021] In a seventeenth aspect the invention provides a dried
formulation according to any one of aspects 5 to 13 further
comprising a protein rich meal.
[0022] In an eighteenth aspect the invention provides a dried
formulation according to any one of aspects 5 to 17 for use as a
medicament.
[0023] In a nineteenth aspect the invention provides a dried
formulation according to any one of aspects 5 to 17 to treat
gastro-intestinal diseases.
[0024] In a twentieth aspect the invention provides a dried
formulation according to any one of aspects 5 to 17 for use to
treat buccal diseases.
[0025] In twenty-first aspect the invention provides a dried
formulation according to any one of aspects 5 to 17 for use as a
prophylactic product.
[0026] In a twenty-second aspect the invention provides a dried
formulation according to any one of aspects 5 to 17 for use as a
vaccine.
[0027] In a twenty-third aspect the invention provides a dried
formulation according to any one of aspects 5 to 17 for use as a
functional food product.
[0028] In a twenty-third aspect the invention provides a dried
formulation according to any one of aspects 5 to 17 for use as a
medicinal food product.
[0029] In a twenty-fourth aspect the invention provides a food
product comprising a dried formulation according to any one of
aspects 5 to 17.
[0030] In a twenty-fifth aspect the invention provides a dried
formulation according to any one of aspects 5 to 17 wherein the
polypeptide is an IL22 IgAFc-fusion.
[0031] In a twenty-seventh aspect the invention provides an oral
pharmaceutical formulation comprising a dried formulation according
to any one of aspects 5 to 17 and a pharmaceutical excipient.
[0032] In a twenty-eight aspect the invention provides a dried
formulation according to any one of aspects 5 to 17 for use as a
medicament.
[0033] In a twenty-ninth aspect the invention provides an oral
pharmaceutical formulation according to aspect twenty-seven for use
as a medicament.
FIGURES
[0034] FIG. 1: Screening and selection of the high expressing
Pichia clones (A) and soybean seeds (B) via FaeG immobilised ELISA
set up. Panel `C` and `D` show a representative immunoblot of
Pichia VHH-IgAFc containing supernatant and soybean VHH-IgAFc
expressing seed extracts, respectively.
[0035] FIG. 2: A typical example of ELISA based titration to
compare functional equivalence of Pichia and seed produced
antibodies. In this representative figure the curve of Pichia
produced V2A antibody (Pichia-V2A), in dotted line, is being
compared to different concentrations of Arabidopsis produced V2A
(At-V2A), solid lines.
[0036] FIG. 3: Pichia and soybean produced VHH-IgA prevents ETEC
infection in piglets. Schematic representation of the experiment
(A); Shedding of F4-ETEC post challenge (B); Seroconversion showing
anti-F4-ETEC serum IgM (C), IgG (D) and IgA (E) titres.
[0037] FIG. 4: Panel A. Experimental set-up of example 3, Panel B.
The shedding of F4.sup.+ ETEC bacteria per gram of faeces for the 4
different groups until day 6, C. Serum titers of anti-ETEC IgG for
individual piglets belonging to the 4 different groups, D. Serum
titers of anti-ETEC IgA for individual piglets belonging to the 4
different groups.
[0038] FIG. 5: Reducing SDS-PAGE analysis of GAP promoter driven
V2IgAFc-fusion expression produced in Komagataella phaffi (formerly
known as Pichia pastoris). Panel A) C-terminally his tagged V2IgAFc
was Ni-IMAC purified and 1 .mu.g of recombinant protein was treated
(right lane) or untreated (left lane) with PNGase F; Panel B) crude
supernatant of Komagataella phaffi producing V2IgAFc was treated
(right lane) or untreated (left lane) with PNGase F. Upon PNGase F
treatment, the molecular weight is strongly reduced to
approximately 38 kDa, which corresponds to the theoretical
molecular weight of the unglycosylated molecule. Hypermannosyl
structures, present on a single N-glycosylation site add more than
30 kDa to the molecular weight of the protein.
[0039] FIG. 6: The glycosylation level is increased when the
V2IgAFc molecule is produced in Komagataella phaffi from the
constitutive GAP promoter (culture on glucose) rather than from the
methanol-inducible AOXI promoter (culture on methanol). The average
MW of the GAP-promoter produced protein is around 70 kDa, whereas
the expected MW for the non-glycosylated V2IgAFc protein would be
38.4 kDa.
DETAILED DESCRIPTION OF THE INVENTION
[0040] The present invention will be described with respect to
particular embodiments and with reference to certain drawings but
the invention is not limited thereto but only by the claims. Any
reference signs in the claims shall not be construed as limiting
the scope. Of course, it is to be understood that not necessarily
all aspects or advantages may be achieved in accordance with any
particular embodiment of the invention. Thus, for example those
skilled in the art will recognize that the invention may be
embodied or carried out in a manner that achieves or optimizes one
advantage or group of advantages as taught herein without
necessarily achieving other aspects or advantages as may be taught
or suggested herein.
[0041] The invention, both as to organization and method of
operation, together with features and advantages thereof, may best
be understood by reference to the following detailed description
when read in conjunction with the accompanying drawings. The
aspects and advantages of the invention will be apparent from and
elucidated with reference to the embodiment(s) described
hereinafter. Reference throughout this specification to "one
embodiment" or "an embodiment" means that a particular feature,
structure or characteristic described in connection with the
embodiment is included in at least one embodiment of the present
invention. Thus, appearances of the phrases "in one embodiment" or
"in an embodiment" in various places throughout this specification
are not necessarily all referring to the same embodiment, but may.
Similarly, it should be appreciated that in the description of
exemplary embodiments of the invention, various features of the
invention are sometimes grouped together in a single embodiment,
figure, or description thereof for the purpose of streamlining the
disclosure and aiding in the understanding of one or more of the
various inventive aspects. This method of disclosure, however, is
not to be interpreted as reflecting an intention that the claimed
invention requires more features than are expressly recited in each
claim. Rather, as the following claims reflect, inventive aspects
lie in less than all features of a single foregoing disclosed
embodiment.
[0042] Where an indefinite or definite article is used when
referring to a singular noun e.g. "a" or "an", "the", this includes
a plural of that noun unless something else is specifically stated.
Where the term "comprising" is used in the present description and
claims, it does not exclude other elements or steps. Furthermore,
the terms first, second, third and the like in the description and
in the claims, are used for distinguishing between similar elements
and not necessarily for describing a sequential or chronological
order. It is to be understood that the terms so used are
interchangeable under appropriate circumstances and that the
embodiments, of the invention described herein are capable of
operation in other sequences than described or illustrated herein.
The following terms or definitions are provided solely to aid in
the understanding of the invention. Unless specifically defined
herein, all terms used herein have the same meaning as they would
to one skilled in the art of the present invention. Practitioners
are particularly directed to Sambrook et al., Molecular Cloning: A
Laboratory Manual, 4.sup.th ed., Cold Spring Harbor Press,
Plainsview, New York (2012); and Ausubel et al., Current Protocols
in Molecular Biology (Supplement 114), John Wiley & Sons, New
York (2016), for definitions and terms of the art. The definitions
provided herein should not be construed to have a scope less than
understood by a person of ordinary skill in the art.
[0043] "About" as used herein when referring to a measurable value
such as an amount, a temporal duration, and the like, is meant to
encompass variations of .+-.20% or .+-.10%, more preferably .+-.5%,
even more preferably .+-.1%, and still more preferably .+-.0.1%
from the specified value, as such variations are appropriate to
perform the disclosed methods.
[0044] "Nucleotide sequence", "DNA sequence", "DNA element(s)", or
"nucleic acid molecule(s)" as used herein refers to a polymeric
form of nucleotides of any length, either ribonucleotides or
deoxyribonucleotides. This term refers only to the primary
structure of the molecule. Thus, this term includes double- and
single-stranded DNA, and RNA. It also includes known types of
modifications, for example, methylation, "caps" substitution of one
or more of the naturally occurring nucleotides with an analog.
"Coding sequence" is a nucleotide sequence, which is transcribed
into mRNA and/or translated into a polypeptide when placed under
the control of appropriate regulatory sequences. The boundaries of
the coding sequence are determined by a translation start codon at
the 5'-terminus and a translation stop codon at the 3'-terminus. A
"coding sequence" can include, but is not limited to mRNA, cDNA,
recombinant nucleotide sequences or genomic DNA, while introns may
be present as well under certain circumstances. "Orthologues" are
genes from different organisms that have originated through
speciation, and are also derived from a common ancestral gene.
[0045] The terms "regulatory element", "control sequence" and
"promoter" or "promoter region of a gene" are all used
interchangeably herein and are to be taken in a broad context to
refer to regulatory nucleic acid sequences that are a functional
DNA sequence unit capable of effecting expression of the sequences
to which they are ligated. The term "promoter" typically refers to
a nucleic acid control sequence located upstream from the
transcriptional start of a gene, or is operably linked to a coding
sequence, and when possibly placed in the appropriate inducing
conditions, is sufficient to promote transcription of said coding
sequence via recognition of its sequence and binding of RNA
polymerase and other proteins. Encompassed by the aforementioned
terms are transcriptional regulatory sequences derived from a
classical eukaryotic genomic gene (including the TATA box which is
required for accurate transcription initiation, with or without a
CCAAT box sequence) and additional regulatory elements (i.e.
upstream activating sequences, enhancers and silencers) which alter
gene expression in response to developmental and/or external
stimuli, or in a tissue-specific manner. Also included within the
term is a transcriptional regulatory sequence of a classical
prokaryotic gene, in which case it may include a -35 box sequence
and/or -10 box transcriptional regulatory sequences. The term
"regulatory element" also encompasses a synthetic fusion molecule
or derivative that confers, activates or enhances expression of a
nucleic acid molecule in a cell, tissue or organ.
[0046] The terms "protein", "polypeptide" and "peptide" are
interchangeably used further herein to refer to a polymer of amino
acid residues and to variants and synthetic analogues of the same.
Thus, these terms apply to amino acid polymers in which one or more
amino acid residues is a synthetic non-naturally occurring amino
acid, such as a chemical analogue of a corresponding naturally
occurring amino acid, as well as to naturally-occurring amino acid
polymers. This term also includes post-translational modifications
of the polypeptide, such as glycosylation, phosphorylation and
acetylation. By "recombinant polypeptide" is meant a polypeptide
made using recombinant techniques, i.e., through the expression of
a recombinant or synthetic polynucleotide. The term "expression" or
"gene expression" means the transcription of a specific gene or
specific genes or specific genetic construct. The term "expression"
or "gene expression" in particular means the transcription of a
gene or genes or genetic construct into structural RNA (rRNA, tRNA)
or mRNA with or without subsequent translation of the latter into a
protein. The process includes transcription of DNA and processing
of the resulting mRNA product. The term "recombinant host cell",
"engineered cell", "expression host cell", "expression host
system", "expression system" or simply "host cell", as used herein,
is intended to refer to a cell into which a recombinant vector
and/or chimeric gene construct has been introduced. It should be
understood that such terms are intended to refer not only to the
particular subject cell but to the progeny of such a cell. Because
certain modifications may occur in succeeding generations due to
either mutation or environmental influences, such progeny may not,
in fact, be identical to the parent cell, but are still included
within the scope of the term "host cell" as used herein. A
recombinant host cell may be an isolated cell or cell line grown in
culture, cells can be prokaryotic cells, eukaryotic cells such as
animal cells, plant cells, fungal cells such as filamentous fungi,
preferably a cell is a recombinant yeast cell.
[0047] The term "endogenous" as used herein, refers to substances
(e.g. genes) originating from within an organism, tissue, or cell.
Analogously, "exogenous" as used herein is any material originated
outside of an organism, tissue, or cell, but that is present (and
typically can become active) in that organism, tissue, or cell.
[0048] The gastrointestinal (GI) tract is a hostile environment for
polypeptides because it is evolutionarily optimized to break down
nutrients and deactivate pathogens. The highly acidic pH in the
stomach results in the protonation of proteins and their unfolding,
which exposes more motifs that are recognized by protein-degrading
enzymes. The enzymes in the stomach (pepsin), small intestine
(e.g., chymotrypsin, amino- and carboxypeptidases) and the enzymes
produced by the pancreas and bile cleave proteins into smaller
fragments and single units. Because therapeutically active
polypeptides (e.g. prophylactic, therapeutic of vaccine components)
are also affected by these processes, the fraction surviving these
degradation processes is generally low and variable, especially in
the presence of food. In addition, polypeptide drugs need to
overcome multiple barriers designed to prevent the entry of dietary
and bacterial antigens in order to reach the systemic compartment.
To access the epithelial cell layer, the polypeptide first needs to
diffuse through the mucus layer covering the intestinal epithelium.
This epithelium is another important barrier, as the tight
junctions which seal the epithelial cells restrict the paracellular
transport (i.e., the passage between cells) to small molecules and
ions smaller than 600 Da. In addition, the passage across the cell
is mediated by luminally expressed endocytotic receptors (e.g.,
vitamin B12 receptor, transferrin receptor), and therefore
necessitates conjugation to the respective ligands in order to be
exploited in drug delivery. Yet another access point to the
systemic compartment is the phagocytotic M-cells of Peyer's patches
which sample luminal antigens and can take up particular substrates
in the low micrometer range. However, the proportion of M-cells in
the gut epithelium is small and varies greatly between species,
which complicates predictions of absorption in humans based on
animal data. Given the above outlined hurdles it is not
surprisingly that only six biomacromolecules have been approved by
the Food and Drug Administration (FDA) for oral delivery: two
locally and two systemically delivered peptides, one locally
delivered non-peptidic macrocycle, and one locally delivered
protein mixture (Moroz E. et al (2016) Advanced Drug Delivery
Reviews 101, 108-121). However, several orally applied formulations
of proteins, peptides, and nucleic acids are currently under
clinical evaluation. Often, these formulations contain at least one
of the following excipients: an enteric coating and/or protease
inhibitors to prevent drug degradation and permeation enhancers to
enable paracellular transport of macromolecules. Mechanistically,
absorption enhancement can be achieved by mechanically disrupting
tight junctions or the plasma membrane, lowering mucus viscosity,
and modulating tight junction-regulating signaling pathways.
Additional strategies for the oral delivery of biomacromolecules
under clinical development include buccal delivery, utilizing
carrier-mediated transcytosis, and local delivery to GI targets.
The overwhelming majority of currently approved oral drugs and
clinical candidates exhibit a molecular weight of <1000 Da.
Above this threshold, low bioavailability, inter- and
intra-individual variability, food effects, and long-term safety
concerns of bioavailability-enhancing excipients remain important
challenges of oral delivery despite clear advances in knowledge
after nearly 90 years of trial and error.
[0049] The present invention provides clear solutions for the
shortcomings of the current oral delivery of therapeutic proteins.
In the present invention we have surprisingly found that a dried
formulation obtained by drying the culture medium comprising a
plurality of macromolecules larger than 5 kDa of recombinant yeasts
which secrete a therapeutic protein in the culture medium, can be
used for oral delivery of the dried formulation. Surprisingly this
formulation is not only protected by proteolysis and degradation in
the gastrointestinal tract but the therapeutic protein present in
the dried formulation is also surprisingly biologically active.
Without having to limit the invention to a particular mechanism or
action we believe that at least one mechanism is that the yeast
extracellular medium acts as a protected film around the
therapeutic protein which prevents (or slows down) the proteolysis
of the therapeutic protein in the gut. This is different from the
situation wherein therapeutic proteins are expressed in plant seeds
wherein the dried seed matrix protects the therapeutic protein from
degradation (see WO2014033313). Yet another possible mechanism is
that the glycosylated therapeutic protein consists of (high)
mannose sugar structures only (by nature of expressing it in a
recombinant yeast host). These bulky high-mannose structures might
also protect the therapeutic peptide from proteolytic degradation
in the gut. FIG. 5 depicts the bulky high-mannose glycosylation
present on the V2A-IgAFc fusion produced in Pichia pastoris which
recombinant protein is used in the present examples. The major
advantage of our finding is that there is no need for a
purification of the therapeutic protein meaning that a formulation
comprising the medium as such or a dried formulation comprising
multiple macromolecules larger than 5 kDa present in the culture
medium (including yeast produced own proteins) and the therapeutic
protein present in the culture medium can be used as an oral
pharmaceutical product. These advantages are outlined in the
following embodiments.
[0050] In a specific embodiment the invention provides a dried
formulation comprising the culture medium of a recombinant host
cell, said host cell producing an exogenous protein which is
secreted into the growth medium (or culture medium) of said
recombinant host cell. Recombinant host cells can be prokaryotic
hosts (e.g. Lactococcus, Bacillus and other bacterial hosts),
eukaryotic hosts such as plant cells, animal cells, fungal cells in
particular filamentous fungal cells and yeast cells. A polypeptide
can be a therapeutic peptide, a prophylactic peptide or a peptide
which can be used in a vaccine composition.
[0051] In another specific embodiment the invention provides a
dried formulation comprising the culture medium of a recombinant
yeast, said yeast producing an exogenous protein which is secreted
into the culture medium. The "culture medium" means the
fermentation broth (typically from a high density yeast
fermentation broth) without the yeast cells. The "culture medium"
is also known as the "growth medium" in the art. Several options
exist in the downstream processing to separate the yeast cells from
the fermentation broth (also known as fermentation broth
clarification techniques) such as for example centrifugation
followed by depth filtration, centrifugation followed by filter-aid
enhanced depth filtration and also microfiltration techniques. It
is clear that the fermentation broth is a very complex soup or
solution. Fundamentally, the fermentation broth is the sea of
nutrients in which the yeasts grow, reproduce and also secrete the
therapeutically relevant polypeptide. The fermentation broth
typically contains fermentation nutrient ingredients such as yeast
peptones (including yeast extracts), yeast autolysates and inactive
yeasts. The content of these products varies in B-vitamins,
nucleotides, minerals, alpha-amino nitrogen content and other
bioactive compounds.
[0052] Several membrane separation processes (with varying membrane
pore sizes) are known to the skilled person which can be used to
reduce the concentration of soluble permeate components and
increase further the concentration of retained compounds (here the
recombinant polypeptide of interest). Reverse osmosis or
hyperfiltration is a membrane separation process, driven by a
pressure gradient, in which the membrane separates the solvent from
other components of a solution. The membrane configuration is
usually cross-flow. With reverse osmosis, the membrane pore size is
very small allowing only very small amounts of very low molecular
weight solutes (e.g. 100 MW cut off) to pass through the membranes.
Ultrafiltration is another membrane separation process, driven by a
pressure gradient, in which the membrane fractionates dissolved and
dispersed components of a liquid as a function of their solvated
size and structure. The membrane configuration is usually
cross-flow. In ultrafiltration, the membrane pore size is larger
than in the reverse osmosis process thus allowing some components
to pass through the pores with the water. It is a
separation/fractionation process using a 10,000 MW cutoff.
Diafiltration is another type of ultrafiltration which involves the
removal or separation of components (permeable molecules like
salts, small proteins, solvents etc.) of a solution based on their
molecular size by using micro-molecule permeable filters. Yet
another process which is commonly used in the course of protein
purification and fractionation is to add a concentration of high
salt to the growth medium. Proteins differ markedly in their
solubilities at high ionic strength, therefore "salting out" is a
very useful procedure to assist in the purification and
concentration of proteins present in the growth medium. Ammonium
sulfate is an inorganic salt with a high solubility that
dissociates into ammonium and sulfate in aqueous solutions.
Ammonium sulfate is especially useful as a precipitant because it
is highly soluble, stabilizes protein structure, has a relatively
low density and is relatively inexpensive.
[0053] Therefore in yet another embodiment the invention provides a
dried formulation comprising a plurality of macromolecules larger
than 5 kDa present in the culture medium of a recombinant fungus,
said fungus producing an exogenous polypeptide fused to an Fc
domain which is secreted into said culture medium.
[0054] In yet another embodiment the invention provides a dried
formulation comprising a plurality of macromolecules larger than 10
kDa present in the culture medium of a recombinant fungus, said
fungus producing an exogenous polypeptide fused to an Fc domain
which is secreted into said culture medium.
[0055] In yet another embodiment the invention provides a dried
formulation comprising a plurality of macromolecules larger than 15
kDa present in the culture medium of a recombinant fungus, said
fungus producing an exogenous polypeptide fused to an Fc domain
which is secreted into said culture medium.
[0056] In specific embodiments the Fc domain in the dried
formulations is an IgA Fc domain.
[0057] In specific embodiments the exogenous peptide in the dried
formulation is a prophylactic or therapeutic peptide or wherein
said exogenous peptide is a vaccine or forms part of a vaccine.
[0058] Since it is difficult to define the dried formulations of
the invention in terms of its technical and structural features we
believe that these formulations are more adequately defined in the
claims as "obtainable by" formulations. Therefore in another
embodiment the invention provides a dried formulation comprising a
protein which is exogenous to yeast obtained by secreting said
protein into the culture medium of a recombinant yeast followed by
drying of said culture medium. In yet another embodiment the
invention provides a dried formulation comprising a therapeutic
protein which is exogenous to yeast obtained by secreting said
therapeutic protein into the culture medium of a recombinant yeast
followed by drying of said culture medium. In yet another
embodiment the invention provides a dried formulation comprising a
prophylactic protein which is exogenous to yeast obtained by
secreting said prophylactic protein into the culture medium of a
recombinant yeast followed by drying of said culture medium. In yet
another embodiment the invention provides a dried formulation
comprising a protein which forms part of a vaccine which is
exogenous to yeast obtained by secreting said protein into the
culture medium of a recombinant yeast followed by drying of said
culture medium. In yet another embodiment the invention provides a
dried formulation obtained by adding a plurality of macromolecules
larger than 5 kDa present in the culture medium of a recombinant
fungal host, such as a filamentous fungus or a yeast cell, to an
oral admissible matrix, followed by drying the obtained mixture,
said culture medium comprising a secreted polypeptide which is
exogenous to said recombinant host. In yet another embodiment the
invention provides a dried formulation comprising the mixture of a
culture medium of a recombinant host and an orally admissible
matrix, said host producing an exogenous polypeptide which is
secreted into said culture medium.
[0059] In yet another embodiment the invention provides a dried
formulation comprising the mixture of a culture medium of a
recombinant host and an orally admissible matrix, said host
producing an exogenous polypeptide which is secreted into said
culture medium and wherein the water content of said formulation is
reduced by concentrating said culture medium prior to preparing
said formulation.
[0060] In yet another embodiment the invention provides a dried
formulation comprising the mixture of a culture medium of a
recombinant host and an orally admissible matrix, said host
producing an exogenous polypeptide which is secreted into said
culture medium and wherein the water content of said formulation is
reduced by drying said culture medium prior to preparing said
formulation.
[0061] In yet another embodiment the invention provides a dried
formulation comprising the mixture of a culture medium of a
recombinant host and an orally admissible matrix, said host
producing an exogenous polypeptide which is secreted into said
culture medium and wherein the water content of said formulation is
reduced by drying said formulation.
[0062] In yet another embodiment the invention provides a dried
formulation obtained by adding a plurality of macromolecules larger
than 5 kDa present in the culture medium of a recombinant host
comprising a secreted polypeptide which is exogenous to said
recombinant host to an orally admissible matrix, followed by drying
the obtained mixture.
[0063] In yet another embodiment the invention provides a dried
formulation obtained by adding a plurality of macromolecules larger
than 5 kDa present in the culture medium of a recombinant fungal
cell such as a recombinant filamentous host or a recombinant yeast
cell wherein said culture medium comprises a secreted polypeptide
which is exogenous to said recombinant fungal cell, to an orally
admissible matrix, followed by drying the obtained mixture.
[0064] In yet another embodiment the invention provides a dried
formulation obtained by adding a plurality of macromolecules larger
than 5 kDa present in the culture medium of a recombinant fungal
cell such as a recombinant filamentous host or a recombinant yeast
cell wherein said culture medium comprises a secreted polypeptide
which is exogenous to said recombinant fungal cell, to an oral
admissible matrix, followed by drying the obtained mixture wherein
said drying is carried out by spray-drying.
[0065] In yet another embodiment the invention provides a dried
formulation obtained by adding a plurality of macromolecules larger
than 5 kDa present in the culture medium of a recombinant fungal
cell such as a recombinant filamentous host or a recombinant yeast
cell wherein said culture medium comprises a secreted polypeptide
which is exogenous to said recombinant fungal cell, and an oral
admissible matrix, followed by drying the obtained mixture wherein
said drying is carried out by lyophilization.
[0066] An "orally admissible matrix" as defined herein is a product
which is used in the food industry as a carrier such for example
starch, maltodextrin, soy milk proteins, cellulose, pectin and guar
gum. In a particular embodiment the orally admissible matrix is an
edible matrix. In another particular embodiment the orally
admissible matrix is a soluble food-grade nutrient or a soluble
food-grade matrix or a soluble food-grade substance.
Dried Formulations
[0067] In many instances, it is advantageous to have the dry
protein in a powder format, which facilitates its conversion into
capsules, tablets, and thin films. A number of drying methods are
available in the art to convert protein solutions into dry powder
form. Most drying methods involve removal of solvent by either
sublimation such as freeze drying or evaporation such as spray
drying and fluidized bed drying or precipitation such as
supercritical fluid technology. Among these methods spray drying
and freeze drying are by far the most commonly used industrial
methods of drying of protein solutions. Lyophilization (an
equivalent term is freeze drying) is one processing method for
removing moisture from biopharmaceuticals and it can increase the
stability, temperature tolerance, and shelf life of these products.
Although lyophilization is well established within the industry, it
requires expensive equipment that takes up a great deal of space
within a production facility. Lyophilization also can take days to
complete, and manufacturers that need a powdered product must
incorporate a granulation step to the process. Thus, lyophilisation
can be used to obtain a dried formulation by lyophilizing the yeast
fermentation broth after the recombinant yeasts have been
removed.
[0068] Thus in yet another embodiment the invention provides a
method to produce a dried formulation comprising the culture medium
of a recombinant yeast wherein a protein is present in said culture
medium comprising drying said culture medium by lyophilisation.
[0069] Spray drying is an alternative technique for preserving
biopharmaceuticals and it is a process whereby a liquid formulation
is converted into a dry powder in a single step. The process is
typically performed by first atomizing the solution into fine
droplets that are then dried quickly in a large chamber by using
warm gas. The resulting dry particles are collected with a cyclone.
Spray drying exposes biopharmaceuticals to shear stress during the
atomization step, which could destabilize labile biopharmaceutical
compounds such as proteins. Complex biological molecules are more
difficult to spray dry because they are sensitive to high shear
stress. The amount of shear stress encountered depends on the type
of atomizer and the atomization pressure used. A sonic nozzle that
can operate at a relatively low pressure of less than 20 psig,
which minimizes the shear stress and allows to process complex
biopharmaceuticals is conveniently used. Spray drying has been
conducted for a wide variety of biopharmaceuticals such as
proteins, enzymes, antibodies, viruses, and bacteria. The process
removes water and restricts the biopharmaceutical's mobility, which
results in a significantly lowered degradation rate. Thus spray
drying can be used to obtain a dried formulation by spray drying
the yeast fermentation broth after the recombinant yeasts have been
removed.
[0070] Thus in yet another embodiment the invention provides a
method to produce a dried formulation comprising the culture medium
of a recombinant yeast wherein a protein is present into said
culture medium comprising drying said culture medium by spray
drying.
[0071] In particular embodiments dissacharides or surfactants are
added to the culture medium before spray drying is conducted.
Dissacharides and surfactants are described to prevent aggregation
(Broadhead J. et al (1993) J. Pharm. Pharmacol. 46 (6) 458-467) and
additionally improve the storage capacity of the protein-loaded
power (Adler M and Lee G (1999) J. Pharm. Sci. 88, 199-208).
[0072] In yet another embodiment trehalose and/or sorbitol can be
added to the culture medium before spray drying is carried out. It
is described that the presence of 30% by weight sorbitol
substantially reduces the aggregation of a pharmaceutical protein
during spray-drying and also the dry storage stability is improved
(Maury M. et al. (2005) Eur. J. of Pharmaceutics and
Biopharmaceutics 59, 251-261), similar effects are described for
trehalose.
[0073] Thus in a particular embodiment ultrasonic viscosity
reduction is applied before conducting the spray drying process.
Ultrasonic viscosity reduction allows for a higher particle loading
of the solution, which leads to a reduced volume of liquid that
must be evaporated. Ultrasonic viscosity reduction results in
reduced energy consumption and higher throughput.
[0074] Spray drying is more scalable at lower costs with regards to
equipment, facility, and utilities. Furthermore, the cycle time for
spray drying is hours instead of days, and thus operational costs
can be lower than those for lyophilization.
Food Products
[0075] In yet another embodiment the invention provides a food
product comprising a dried formulation as described herein
before.
[0076] In yet another embodiment the invention provides a food
product comprising a dried formulation as described herein before
wherein the food product is a functional food product.
[0077] In yet another embodiment the invention provides a food
product comprising a dried formulation as described herein before
wherein the food product is a medicinal food product.
[0078] Several food products may be prepared according to the
invention. A non-limiting list of food products comprise meal
replacers, soups, noodles, ice-cream, sauces, dressing, spreads,
snacks, cereals, beverages, bread, biscuits, other bakery products,
sweets, bars, chocolate, chewing gum, dairy products and dietetic
products. A discussion of the latter products and how they can be
prepared is presented in U.S. Pat. No. 8,105,592 (page 20, starting
on line 62 to page 23, line 35.
[0079] In yet another embodiment the invention provides an oral
pharmaceutical composition comprising a fungal produced IgAFc
fusion protein wherein the protein fused with the IgAFc protein is
a prophylactic or therapeutic protein or vaccine component.
[0080] In yet another embodiment the invention provides an oral
pharmaceutical composition comprising a fungal produced IgAFc
fusion protein wherein the protein fused with the IgAFc is an
immunoglobuling single variable domain.
[0081] In yet another embodiment the invention provides an oral
pharmaceutical composition comprising a fungal produced IgAFc
fusion protein wherein the protein fused with the IgAFc is a VHH
domain.
[0082] In yet another embodiment the invention provides an oral
pharmaceutical composition comprising a fungal produced IgAFc
fusion protein wherein the protein fused with the IgAFc is a VHH
domain and wherein the VHH domain contains an artificially
introduced N-glycosylation site.
[0083] In yet another embodiment the invention provides an oral
pharmaceutical composition comprising a fungal produced protein
modified with N-glycans and/or O-glycans of which at least 5%, at
least 10%, at least 20%, at least 30%, at least 40%, at least 50%,
at least 60%, at least 70%, at least 80% or more of the
glycoprotein molecular weight is contributed by said N- or
O-glycans.
[0084] In yet another embodiment the invention provides an oral
pharmaceutical composition comprising a fungal produced
IgAFc-fusion protein modified with N-glycans and/or O-glycans of
which at least 5%, at least 10%, at least 20%, at least 30%, at
least 40%, at least 50%, at least 60%, at least 70%, at least 80%
or more of the glycoprotein molecular weight is contributed by said
N- or O-glycans.
[0085] In yet another embodiment the invention provides an oral
pharmaceutical composition comprising a fungal produced
IgAFc-fusion protein modified with N-glycans and/or O-glycans of
which at least 5%, at least 10%, at least 20%, at least 30%, at
least 40%, at least 50%, at least 60%, at least 70%, at least 80%
or more of the glycoprotein molecular weight is contributed by said
N- or O-glycans and wherein the protein fused with the IgAFc is an
immunoglobulin single variable domain.
[0086] Remarkably the N-glycosylation structure mainly consisting
of hypermannosyl structures adds to more than 50% of the molecular
weight to the IgAFc-fusion protein which is recombinantly produced
in yeast. This is witnessed in FIG. 5 (see the difference between
glycosylated V2A-IgAFc fusion and the deglycosylated V2A-IgAFc
fusion protein). Also remarkably is that when the IgAFc fusion
protein is produced under control of the constitutive GAP promoter
in yeast that the hyperglycosylation is even more abundant than
when the IgAFc fusion protein is produced under control of the
methanol oxidase inducible promoter (AOX promoter) (see FIG.
6).
[0087] In yet another embodiment the invention provides a fungal
produced IgAFc fusion protein for oral administration use.
[0088] In yet another embodiment the invention provides a fungal
produced IgAFc fusion protein wherein the protein fused with the
IgAFc is an immunoglobuling single variable domain for oral
administration use.
[0089] In yet another embodiment the invention provides a fungal
produced IgAFc fusion protein wherein the protein fused with the
IgAFc is a VHH domain for oral administration use.
[0090] In yet another embodiment the invention provides a fungal
produced IgAFc fusion protein wherein the protein fused with the
IgAFc is a VHH domain and wherein the VHH domain contains an
artificially introduced N-glycosylation site for oral
administration use.
[0091] In yet another embodiment the invention provides a fungal
produced protein modified with N-glycans and/or O-glycans of which
at least 5%, at least 10%, at least 20%, at least 30%, at least
40%, at least 50%, at least 60%, at least 70%, at least 80% or more
of the glycoprotein molecular weight is contributed by said N- or
O-glycans for oral administration use.
[0092] Without limiting the invention to a particular mechanism we
believe that the hypermannosylated glycan structures as produced by
fungal cells on the recombinant (fusion) protein protect the
recombinant protein in the gut so that this hypermannosylated
recombinant proteins are suitable for oral delivery.
[0093] The term "immunoglobulin single variable domain"
(abbreviated as "ISVD"), equivalent to the term "single variable
domain", defines molecules wherein the antigen binding site is
present on, and formed by, a single immunoglobulin domain. This
sets immunoglobulin single variable domains apart from
"conventional" immunoglobulins or their fragments, wherein two
immunoglobulin domains, in particular two variable domains,
interact to form an antigen binding site. Typically, in
conventional immunoglobulins, a heavy chain variable domain (VH)
and a light chain variable domain (VL) interact to form an antigen
binding site. In this case, the complementarity determining regions
(CDRs) of both VH and VL will contribute to the antigen binding
site, i.e. a total of 6 CDRs will be involved in antigen binding
site formation.
[0094] In view of the above definition, the antigen-binding domain
of a conventional 4-chain antibody (such as an IgG, IgM, IgA, IgD
or IgE molecule; known in the art) or of a Fab fragment, a F(ab')2
fragment, an Fv fragment such as a disulphide linked Fv or a scFv
fragment, or a diabody (all known in the art) derived from such
conventional 4-chain antibody, would normally not be regarded as an
immunoglobulin single variable domain, as, in these cases, binding
to the respective epitope of an antigen would normally not occur by
one (single) immunoglobulin domain but by a pair of (associated)
immunoglobulin domains such as light and heavy chain variable
domains, i.e., by a VH-VL pair of immunoglobulin domains, which
jointly bind to an epitope of the respective antigen.
[0095] In contrast, immunoglobulin single variable domains are
capable of specifically binding to an epitope of the antigen
without pairing with an additional immunoglobulin variable domain.
The binding site of an immunoglobulin single variable domain is
formed by a single VH/VHH or VL domain. Hence, the antigen binding
site of an immunoglobulin single variable domain is formed by no
more than three CDRs.
[0096] As such, the single variable domain may be a light chain
variable domain sequence (e.g., a VL-sequence) or a suitable
fragment thereof; or a heavy chain variable domain sequence (e.g.,
a VH-sequence or VHH sequence) or a suitable fragment thereof; as
long as it is capable of forming a single antigen binding unit
(i.e., a functional antigen binding unit that essentially consists
of the single variable domain, such that the single antigen binding
domain does not need to interact with another variable domain to
form a functional antigen binding unit).
[0097] In one embodiment of the invention, the immunoglobulin
single variable domains are heavy chain variable domain sequences
(e.g., a VH-sequence); more specifically, the immunoglobulin single
variable domains can be heavy chain variable domain sequences that
are derived from a conventional four-chain antibody or heavy chain
variable domain sequences that are derived from a heavy chain
antibody.
[0098] For example, the immunoglobulin single variable domain may
be a (single) domain antibody (or an amino acid sequence that is
suitable for use as a (single) domain antibody), a "dAb" or dAb (or
an amino acid sequence that is suitable for use as a dAb) or a
Nanobody (as defined herein, and including but not limited to a
VHH); other single variable domains, or any suitable fragment of
any one thereof.
[0099] In particular, the immunoglobulin single variable domain may
be a Nanobody.RTM. (as defined herein) or a suitable fragment
thereof. [Note: Nanobody.RTM., Nanobodies.RTM. and Nanoclone.RTM.
are registered trademarks of Ablynx N.V.] For a general description
of Nanobodies, reference is made to the further description below,
as well as to the prior art cited herein, such as e.g. described in
WO 08/020079 (page 16).
[0100] "VHH domains", also known as VHHs, V.sub.HH domains, VHH
antibody fragments, and VHH antibodies, have originally been
described as the antigen binding immunoglobulin (variable) domain
of "heavy chain antibodies" (i.e., of "antibodies devoid of light
chains"; Hamers-Casterman et al (1993) Nature 363: 446-448). The
term "VHH domain" has been chosen in order to distinguish these
variable domains from the heavy chain variable domains that are
present in conventional 4-chain antibodies (which are referred to
herein as "V.sub.H domains" or "VH domains") and from the light
chain variable domains that are present in conventional 4-chain
antibodies (which are referred to herein as "V.sub.L domains" or
"VL domains"). For a further description of VHH's and Nanobodies,
reference is made to the review article by Muyldermans (Reviews in
Molecular Biotechnology 74: 277-302, 2001), as well as to the
following patent applications, which are mentioned as general
background art: WO 94/04678, WO 95/04079 and WO 96/34103 of the
Vrije Universiteit Brussel; WO 94/25591, WO 99/37681, WO 00/40968,
WO 00/43507, WO 00/65057, WO 01/40310, WO 01/44301, EP 1134231 and
WO 02/48193 of Unilever; WO 97/49805, WO 01/21817, WO 03/035694, WO
03/054016 and WO 03/055527 of the Vlaams Instituut voor
Biotechnologie (VIB); WO 03/050531 of Algonomics N.V. and Ablynx
N.V.; WO 01/90190 by the National Research Council of Canada; WO
03/025020 (=EP 1433793) by the Institute of Antibodies; as well as
WO 04/041867, WO 04/041862, WO 04/041865, WO 04/041863, WO
04/062551, WO 05/044858, WO 06/40153, WO 06/079372, WO 06/122786,
WO 06/122787 and WO 06/122825, by Ablynx N.V. and the further
published patent applications by Ablynx N.V. Reference is also made
to the further prior art mentioned in these applications, and in
particular to the list of references mentioned on pages 41-43 of
the International application WO 06/040153, which list and
references are incorporated herein by reference. As described in
these references, Nanobodies (in particular VHH sequences and
partially humanized Nanobodies) can in particular be characterized
by the presence of one or more "Hallmark residues" in one or more
of the framework sequences. A further description of the
Nanobodies, including humanization and/or camelization of
Nanobodies, as well as other modifications, parts or fragments,
derivatives or "Nanobody fusions", multivalent constructs
(including some non-limiting examples of linker sequences) and
different modifications to increase the half-life of the Nanobodies
and their preparations can be found e.g. in WO 08/101985 and WO
08/142164. For a further general description of Nanobodies,
reference is made to the prior art cited herein, such as e.g.,
described in WO 08/020079 (page 16).
[0101] "Domain antibodies", also known as "Dabs", "Domain
Antibodies", and "dAbs" (the terms "Domain Antibodies" and "dAbs"
being used as trademarks by the GlaxoSmithKline group of companies)
have been described in e.g., EP 0368684, Ward et al. (Nature 341:
544-546, 1989), Holt et al. (Tends in Biotechnology 21: 484-490,
2003) and WO 03/002609 as well as for example WO 04/068820, WO
06/030220, WO 06/003388 and other published patent applications of
Domantis Ltd. Domain antibodies essentially correspond to the VH or
VL domains of non-camelid mammalians, in particular human 4-chain
antibodies. In order to bind an epitope as a single antigen binding
domain, i.e., without being paired with a VL or VH domain,
respectively, specific selection for such antigen binding
properties is required, e.g. by using libraries of human single VH
or VL domain sequences. Domain antibodies have, like VHHs, a
molecular weight of approximately 13 to approximately 16 kDa and,
if derived from fully human sequences, do not require humanization
for e.g. therapeutical use in humans.
[0102] It should also be noted that single variable domains can be
derived from certain species of shark (for example, the so-called
"IgNAR domains", see for example WO 05/18629).
[0103] Thus, in the meaning of the present invention, the term
"immunoglobulin single variable domain" or "single variable domain"
comprises polypeptides which are derived from a non-human source,
preferably a camelid, preferably a camelid heavy chain antibody.
They may be humanized, as previously described. Moreover, the term
comprises polypeptides derived from non-camelid sources, e.g. mouse
or human, which have been "camelized", as e.g., described in Davies
and Riechmann (FEBS 339: 285-290, 1994; Biotechnol. 13: 475-479,
1995; Prot. Eng. 9: 531-537, 1996) and Riechmann and Muyldermans
(J. Immunol. Methods 231: 25-38, 1999).
[0104] In yet another embodiment the invention provides a method to
produce a dried formulation comprising the culture medium of a
recombinant yeast wherein a protein is present into said culture
medium comprising: [0105] i) cultivating a recombinant yeast
comprising a protein and allowing to secrete said protein into the
culture medium, [0106] ii) separating the recombinant yeast cells
from the culture medium, [0107] iii) concentrating said culture
medium in a membrane separation process, and [0108] iv) drying said
concentrated culture medium
[0109] Methods to generate recombinant yeasts are well known in the
art. Briefly, expression vectors comprising chimeric genes encoding
recombinant proteins are present in a recombinant yeast. The
expression vector can be integrated into the genome or can be
autonomously replicating in the recombinant yeast. Vectors that
integrate into the host chromosome are most widely used because of
their mitotic stability in the absence of a selection. However,
episomal expression vectors exist for some yeast systems.
Expression vectors typically contain a strong yeast
promoter/terminator and a yeast selectable marker cassette. Most
yeast vectors can be propagated and amplified in E. coli to
facilitate cloning and as such, also contain an E. coli replication
origin and ampicillin selectable marker. Finally, many yeast
expression vectors include the ability to optionally clone a gene
downstream of an efficient secretion leader (for example that of
the mating factor or the Ost1 sequence (Fitzgerald I & Glick B
S (2014) Microbial cell factories 13, 1)) that efficiently directs
a heterologous protein to become secreted from the cell. A chimeric
gene comprises a promoter operably coupled to a nucleic acid
sequence encoding for a signal sequence which is operably coupled
to a recombinant gene which encodes a useful polypeptide. A
promoter can be a constitutive promoter or an inducible
promoter.
[0110] In yet another embodiment the invention provides a method to
produce a dried formulation comprising the fermentation broth of a
recombinant yeast wherein a protein is present into said culture
medium comprising: [0111] i) cultivating a recombinant yeast
comprising a protein and allowing to secrete said therapeutic
protein into the culture medium, [0112] ii) drying said
fermentation broth (comprising the recombinant yeast and the
culture medium)
[0113] In yet another embodiment the invention provides a dried
formulation of the invention further comprising yeast cells.
[0114] In yet another embodiment the invention provides a dried
formulation of the invention further comprising non-recombinant
yeast cells.
[0115] In yet another embodiment the invention provides a method to
produce a dried formulation comprising the culture medium of a
recombinant yeast wherein an exogenous protein is present into said
culture medium and non-recombinant yeast cells comprising: [0116]
i) cultivating a recombinant yeast comprising an exogenous protein
and allowing to secrete said protein into the culture medium,
[0117] ii) separating the recombinant yeast cells from the culture
medium, [0118] iii) concentrating said culture medium in a membrane
separation process, [0119] iv) adding non-recombinant yeast cells
to the culture medium [0120] v) drying said culture medium
[0121] In yet another embodiment the invention provides a method to
produce a dried formulation comprising the culture medium of a
recombinant yeast wherein an exogenous protein is present into said
culture medium and non-recombinant yeast cells comprising: [0122]
i) cultivating a recombinant yeast comprising an exogenous protein
and allowing to secrete said exogenous protein into the culture
medium, [0123] ii) separating the recombinant yeast cells from the
culture medium, [0124] iii) drying said culture medium, [0125] iv)
adding a dried formulation of non-recombinant yeast cells to the
dried culture medium obtained in step iii).
[0126] In yet another embodiment the invention provides a dried
formulation of the invention further comprising a protein rich
formulation which is different from the proteins present in the
yeast fermentation broth.
[0127] In yet another embodiment the invention provides a method to
produce a dried formulation comprising the culture medium of a
recombinant yeast wherein an exogenous protein is present into said
culture medium and a protein rich formulation which is different
from the proteins present in the yeast fermentation broth
comprising: [0128] i) cultivating a recombinant yeast comprising an
exogenous protein and allowing to secrete said protein into the
culture medium, [0129] ii) separating the recombinant yeast cells
from the culture medium, [0130] iii) adding a protein rich
formulation to the culture medium, [0131] iv) drying said culture
medium
[0132] In yet another embodiment the invention provides a method to
produce a dried formulation comprising the culture medium of a
recombinant yeast wherein a therapeutic protein is present into
said culture medium and non-recombinant yeast cells comprising:
[0133] i) cultivating a recombinant yeast comprising a therapeutic
protein and allowing to secrete said therapeutic protein into the
culture medium, [0134] ii) separating the recombinant yeast cells
from the culture medium, [0135] iii) drying said culture medium,
[0136] iv) adding a dried formulation of a protein rich formulation
to the dried culture medium obtained in step iii).
[0137] In yet another embodiment the invention provides a dried
formulation comprising the culture medium of a recombinant yeast,
said yeast producing an exogenous Fc fusion protein which is
secreted in the culture medium.
[0138] In yet another embodiment the invention provides a dried
formulation comprising the culture medium of a recombinant yeast,
said yeast producing an exogenous Fc fusion protein which is
secreted in the culture medium and wherein said Fc domain is a IgA
Fc domain.
[0139] Because of the difficulties to structurally describe the
dried formulations of the invention in terms of its technical
features it is more appropriate to define the dried formulations in
the "obtainable by" claim format. Therefore in another embodiment
the invention provides a dried formulation comprising an exogenous
fusion protein between an Fc domain and a polypeptide obtained by
secreting said exogenous protein into the culture medium of a
recombinant yeast followed by drying of said culture medium.
Fc Fusions Proteins
[0140] A Fc region (fragment crystallisable region) is the tail
region of an immunoglobulin that interacts with cell surface
receptors called Fc receptors and some proteins of the complement
system. According to particularly envisaged embodiments, the Fc
region in the Fc fusion protein is a Fc region from an
immunoglobulin G (IgG) isotype. This can be any of the IgG
subclasses (IgG1, 2, 3, 4 in humans). For IgG, like IgA and IgD
isotypes, the Fc region is composed of two identical protein
fragments, derived from the second and third constant domains of
the antibody's two heavy chains. In another embodiment the Fc part
in the fusion protein is derived from an IgA antibody. The "Fc
fusion proteins" as used herein are fusion proteins, wherein a Fc
region is fused to a protein or peptide. A particular class of Fc
containing proteins are Fc containing proteins that can bind an
antigen. Examples are antibodies, or fusion proteins wherein a Fc
region is linked to a binding moiety (e.g. a nanobody, a Fab
region, a F(ab').sub.2 region). In addition, the invention is not
limited to human sequences. For instance, it is possible that the
Fc region is that of a mouse, or of a camelid, a rhesus monkey, a
dog, a cow, a guinea pig, a sheep, a pig, a goat, a horse, a rat, a
rabbit, a cat, or any other mammal. It is even possible that the Fc
region is from non-mammalian animals (e.g. a chicken). In specific
examples a binding moiety can be a non-antibody scaffold.
Non-antibody scaffolds broadly fall into two structural classes,
namely domain-sized compounds (at 6-20 kDa molecular weight) and
constrained peptides (2-4 kDa). Domain-sized scaffolds include
Affibodies, Affilins, Anticalins, Atrimers, DARPins, FN3 scaffolds
(e.g. Adnectins and Centyrins), Fynomers, Kunitz domains,
Pronectins and OBodies, whereas Avimers, bicyclic peptides and
Cys-knots are peptide-related (see Vazquez-Lombardi R et al (2015)
Drug Discovery Today 20, 10, 1271 for a comprehensive review).
Pharmaceutical Formulation
[0141] In a specific embodiment the dried formulations of the
invention may be encapsulated with any available soft- or hard
capsule technology to result in a solid oral pharmaceutical dosage
form which may further comprise enteric or delayed release
coatings.
[0142] In yet another aspect the dried formulation can be dissolved
in a liquid to obtain an emulsion (see Moreira T C et at (2016)
Colloids Surf B. Biointerface 143: 399-405). Thus in a particular
aspect the pharmaceutical formulation is a liquid. In one aspect
the pharmaceutical formulation according to the present invention
is a liquid and comprises less than 10% (w/w) water. In one aspect
the pharmaceutical formulation according to the present invention
is a liquid and comprises less than 9% (w/w) water. In one aspect
the pharmaceutical formulation according to the present invention
is a liquid and comprises less than 8% (w/w) water. In one aspect
the pharmaceutical formulation according to the present invention
is a liquid and comprises less than 7% (w/w) water. In one aspect
the pharmaceutical formulation according to the present invention
is a liquid and comprises less than 6% (w/w) water. In one aspect
the pharmaceutical formulation according to the present invention
is a liquid and comprises less than 5% (w/w) water. In one aspect
the pharmaceutical formulation according to the present invention
is a liquid and comprises less than 4% (w/w) water. In one aspect
the pharmaceutical formulation according to the present invention
is a liquid and comprises less than 3% (w/w) water. In one aspect
the pharmaceutical formulation according to the present invention
is a liquid and comprises less than 2% (w/w) water. In one aspect
the pharmaceutical formulation according to the present invention
is a liquid and comprises less than 1% (w/w) water. In one aspect
the pharmaceutical formulation according to the present invention
is a liquid and comprises less than 0% (w/w) water.
[0143] In certain aspects of the present invention, the
pharmaceutical formulation may comprise additional excipients
commonly found in pharmaceutical formulations, examples of such
excipients include, but are not limited to, antioxidants,
antimicrobial agents, enzyme inhibitors, stabilizers,
preservatives, flavors, sweeteners and other components as
described in Handbook of Pharmaceutical Excipients, Rowe et al.,
Eds., 7th Edition, Pharmaceutical Press (2012), which is hereby
incorporated by reference.
[0144] These additional excipients may be in an amount from about
0.05-5% by weight of the total pharmaceutical formulation.
Antioxidants, anti-microbial agents, enzyme inhibitors, stabilizers
or preservatives typically provide up to about 0.05-1% by weight of
the total pharmaceutical formulation. Sweetening or flavouring
agents typically provide up to about 2.5% or 5% by weight of the
total pharmaceutical formulation.
[0145] Oral pharmaceutical formulations according to this invention
may be formulated as solid dosage forms.
[0146] Oral pharmaceutical formulations according to this invention
may be formulated as solid dosage forms and may be selected from
the group consisting of capsules, tablets, dragees, pills,
lozenges, powders and granules.
[0147] Oral pharmaceutical formulations according to this invention
may be formulated as 5 multiparticulate dosage forms.
[0148] Oral pharmaceutical formulations according to this invention
may be formulated as multiparticulate dosage forms and may be
selected from the group consisting of pellets, microparticles,
nanoparticles, liquid or semisolid fill formulations in soft- or
hard capsules, enteric coated soft-hard capsules.
[0149] In one aspect the oral pharmaceutical formulations may be
prepared with one or more coatings such as enteric coatings or be
formulated as delayed release formulations according to methods
well known in the art.
[0150] In one aspect, the pharmaceutical formulation according to
the invention is used for the preparation of a medicament.
[0151] The term "surfactant" as used herein refers to any
substance, in particular a detergent, that can adsorb at surfaces
and interfaces, such as but not limited to liquid to air, liquid to
liquid, liquid to container or liquid to any solid.
[0152] The term "drug", "therapeutic", "medicament" or "medicine"
when used herein refer to an active ingredient used in a
pharmaceutical formulation, which may be used in for prophylactic,
therapeutic or vaccine applications and thus also refer to what was
defined as "macromolecular therapeutic" or "therapeutic
macromolecule" or "prophylactic macromolecule" or "vaccine
macromolecule" in the present patent application.
Prophylactic/Treatment/Vaccines
[0153] The dried formulations of the invention comprising a
polypeptide can be used for a variety of diseases, obviously
depending on the nature of the peptide. For example when the
peptide is a therapeutic peptide then several diseases include--but
are not limited to--neurodegenerative disorders, cancer,
haematological disorders, immunological disorders, cardiac
disorders, liver disorders, respiratory disorders, malabsorption
disorders, diabetes, viral infections, fungal infections, bacterial
infections, ocular diseases, rare metabolic disorders and
hypertension.
[0154] In a specific embodiment the invention provides dried
formulations of the invention for use in the treatment of
gastrointestinal disorders. Non-limiting examples of
gastrointestinal disorders comprise irritable bowel syndrome,
constipation, haemorrhoids (e.g. internal haemorrhoids), anal
fissures, diverticular disease, colon polyps, colon cancer,
infectious colitis, ulcerative colitis, Crohn's disease, ischemic
colitis, radiation colitis and intestinal mucositis.
[0155] In yet another specific embodiment the invention provides
dried formulations of the invention for use in the treatment of
buccal (or mouth) disorders such as cold sores, canker sores,
thrush, leukoplakia, dry mouth, gum, bad breath, dental caries,
periodontal diseases (e.g. gingivitis), oral Candidiasis, oral
Herpex Simplex virus infections, oral human papillomavirus
infections, recurrent apthous ulcers, oral and pharyngeal cancers
and oral mucositis.
[0156] Therapeutic proteins present in the dried formulations of
the invention comprise monoclonal antibodies, growth factors,
interleukins and the like. In another aspect the exogenous
polypeptides can be used for vaccine purposes. In particular the
exogenous polypeptides can be used alone as a vaccine or can form
part of a vaccine composition.
Recombinant Yeasts
[0157] In a specific embodiment the recombinant yeasts used to
prepare the dried formulations of the invention are yeast species
which have acquired the GRAS status. GRAS stands for Generally
Regarded as Safe. Yeast which have the GRAS status include yeasts
such as Saccharomyces cerevisiae, Pichia pastoris, Hansenula
polymorpha, Yarrowia lipolytica and Kluyveromyces lactis. The
production of therapeutic proteins in recombinant yeasts is well
known to the person skilled in the art. For the yeast Pichia
pastoris there is for example the review of Julien C (2006)
BioProcess International, January, p. 22-31, for Saccharomyces
cerevisiae there is for example the review of Nielsen J (2013)
Bioengineered 4:4, 207-211, for Hansenula polymorpha there is the
review of Cox H. et al (2000) Yeast, Volume 16, 13, pp. 1191-1203,
for Kluyveromyces lactis there is the review of van Ooyen A J J et
al (2006) FEM Yeast Res 6, 381-392 and for Yarrowia lipolytica
there is the review of Madzak C et al (2004) J. Biotechnol.
109(1-2):63-81.
[0158] It is to be understood that although particular embodiments,
specific configurations as well as materials and/or molecules, have
been discussed herein for engineered recombinant yeast cells and
methods according to the present invention, various changes or
modifications in form and detail may be made without departing from
the scope and spirit of this invention. The following examples are
provided to better illustrate particular embodiments, and they
should not be considered limiting the application. The application
is limited only by the claims.
EXAMPLES
1. Orally Delivered Pichia Produced Monomeric VHH-IgAFc Fusions are
Efficacious in Preventing F4-ETEC Infection in Piglets
[0159] The monomeric VHH-IgAFc-fusions, designated as V2A and V3A,
which were previously generated and evaluated in Arabidopsis seeds
(see Virdi et al (2013) 110, 29, 11809-11814), were now also
produced in the yeast Pichia pastoris and in soybean seeds.
Briefly, llama heavy chain-only antibodies (VHHs) were generated
against F4.sup.+ ETEC fimbriae. Selected F.sup.4+ ETEC VHHs were
grafted on the codon-optimized part of the porcine IgA.sup.b. The
resultant VHH-IgAFc fusions are designated as V2A and V3A. The
expression levels of the functional VHH-IgAFc fusions were
evaluated using ELISA with the F4-ETEC tip adhesion antigen-FaeG
coated wells, and detected with anti-pig IgA conjugated to
horseradish peroxidase. FIG. 1 shows a typical example of screening
of a Pichia clone (see FIG. 1A) or soybean seed stocks (see FIG.
1B). Twenty individual colonies were screened for each of the
Pichia produced antibodies V2A and V3A. Similarly, 10-12 seeds were
screened from each of the transformed soybean events. 5 such events
were screened for V2A and V3A each. The high expressing seed stocks
were retained, and a part of which was also used for raising T3
homozygous seed stocks. The expression level of soybean produced
V2A and V3A was calculated to be about 0.2% of seed weight, which
was similar to the expression level in Arabidopsis seeds. The
expression level of the secreted Pichia V2A and V3A was as high as
100 mg/L (analysed on SDS-PAGE gels stained with Coomassie blue).
However, the ELISA based functional analysis showed that 1 ml of
Pichia supernatant was equivalent to 1 ml soybean or Arabidopsis
seeds extract (5 mg of seed) (see FIG. 2). It is likely that the
quantification of the Pichia produced VHH-IgAFc was hampered due to
the shielding via the Pichia glycans, in this ELISA set up. Indeed,
the immunoblot analysis of Pichia supernatant (see FIG. 2C) and
soybean seed extracts (see FIG. 1D) shows clear hallmarks of
differential glycosylation. Pichia VHH-IgAFc migrates higher than
50 k Da (.about.52 k Da) while soybean produced VHH-IgAFc are less
than 50 kDa (.about.48 kDa) (see FIG. 1, C-D)
Pichia and Soybean Produced VHH-IgAFc Fusions Prevents ETEC
Infection in Piglets
[0160] The in vivo efficacy of Pichia and soybean seed produced
VHH-IgAFc antibody cocktail of V2A and V3A (dose 5 mg/pig/day), was
evaluated in the piglet feed-challenge experiment. The previously
generated Arabidopsis produced monomeric VHH-IgAFc (see Virdi et
al., 2013) PNAS 110, 29, 11809-11814) served as a reference
(Arabidopsis-group), while feed containing no antibodies (Flax
feed, FIG. 3A) served as negative control. The six F4-ETEC
seronegative and F4-receptor (F4R) genotype positive piglets
present in each of the groups received the experimental feed for a
period of 10 days. On the third day all the piglets were challenged
with 10.sup.10 F4-ETEC bacteria for two consecutive days (day 0 and
day 1) and the resultant effect of the infection was monitored via
analysing the daily shedding of the challenge strain until day 14
(FIG. 3B). The piglets were euthanized on day 14, at which point
the F4-ETEC bacteria in the contents of jejunum, ileum and caecum
were also determined (Table 1).
TABLE-US-00001 TABLE 1 Shedding of the F4-ETEC in faeces
(Log.sub.10) per gram of faeces for each piglet Day Day Day Day Day
Day Day Day Day Day Day Day Day Day Day Day 14- 14- Day 14- 0 1 2 3
4 5 6 7 8 9 10 11 12 14 jejunum ileum caecum Soybean Pig 1 -- 2.00
3.24 -- 3.60 -- -- -- -- -- -- -- -- -- -- -- -- Pig 2 -- -- 2.00
-- -- -- -- -- -- -- -- -- -- -- -- -- -- Pig 3 -- 4.74 4.33 3.71
4.19 4.37 5.43 4.64 3.67 2.48 2.30 -- -- -- -- -- -- Pig 4 -- --
5.38 2.60 4.04 -- 2.00 2.60 -- -- -- -- -- -- -- -- -- Pig 5 --
4.89 4.93 4.00 3.85 2.00 3.08 3.49 3.90 2.48 2.00 -- -- -- -- -- --
Pig 6 -- 4.72 7.43 4.00 3.00 3.52 3.00 -- -- -- 2.00 -- -- -- -- --
-- Pichia Pig 7 -- 2.30 -- -- -- -- -- -- 2.00 -- -- -- -- -- -- --
-- Pig 8 -- 2.78 -- -- -- -- -- -- -- -- 3.61 4.37 3.24 2.78 -- --
2.78 Pig 9 -- -- 4.92 3.85 2.48 -- -- -- -- -- -- -- -- -- -- -- --
Pig 10 -- -- 5.62 3.00 -- -- -- -- -- -- -- -- -- -- -- -- -- Pig
11 -- 2.74 4.26 -- -- -- -- -- -- -- -- -- -- -- -- -- -- Pig 12 --
-- 3.60 2.00 3.00 2.00 3.48 2.30 2.00 3.00 2.00 -- -- -- -- -- --
Arabidopsis Pig 13 -- -- -- 3.34 -- 3.18 3.51 6.00 5.69 6.38 5.65
4.15 2.48 -- -- -- -- Pig 14 -- -- -- 5.85 3.60 4.04 4.43 3.15 2.30
2.00 2.00 -- -- -- -- -- -- Pig 15 -- 3.58 4.73 2.00 -- 3.70 --
2.48 -- -- 2.81 -- 3.50 2.60 -- -- 4.32 Pig 16 -- 7.05 6.95 4.65
3.00 -- -- -- -- -- -- 2.00 2.00 -- -- -- -- Pig 17 -- -- 6.90 3.54
4.06 -- 2.88 2.00 -- -- 2.48 -- 2.00 -- -- -- 2.00 Pig 18 -- -- --
-- -- -- -- -- -- -- -- 2.00 2.30 -- 3.51 3.04 3.24 Control Pig 19
-- -- 2.00 6.26 7.79 6.83 6.67 6.37 3.90 -- -- -- -- -- -- -- --
Pig 20 -- 3.98 4.62 6.20 7.52 6.91 7.08 5.92 3.30 -- -- -- -- -- --
-- -- Pig 21 -- 3.93 6.24 8.09 7.88 7.56 7.24 7.38 3.78 2.30 --
2.00 2.00 -- -- -- -- Pig 22 -- no 3.98 5.64 5.69 4.76 5.98 4.87
2.48 -- -- -- -- -- -- -- -- fae- ces Pig 23 -- 5.09 6.99 5.84 6.34
5.64 5.38 5.35 4.63 -- 3.02 -- -- -- -- -- -- Pig 24 -- 5.26 4.95
6.98 6.79 6.47 5.85 3.30 2.00 -- -- -- -- -- -- -- --
[0161] Off note: the post mortem observation revealed that the
piglet-18 of the Arabidopsis-group, had umbilical-hernia with
extreme strangulation of the small intestine resulting in
obstructive passage. Hence the data for piglet-18 is not included
in the shedding graph (FIG. 3B) or in the statistical analysis (the
data is reported in table 1).
[0162] Also after euthanasia, the F4-ETEC adhesion assay performed
using the intestinal villous enterocytes showed 41 to 85 bacteria
bound per 250 .mu.m of the cell surface, dually confirming the
phenotypic expression of a high number of F4-receptors (F4R). Hence
except the piglet-18, data from all the piglets was used to
evaluate the efficacy of monomeric VHH-IgAFc.
[0163] The shedding data revealed that the 5 mg/pig per day dose of
monomeric VHH-IgAFc V2A and V3A cocktail, produced in Pichia,
Arabidopsis seeds or soybean seeds successfully prevented the ETEC
infection. The VHH-IgAFc receiving groups had a significantly lower
shedding (see FIG. 3B, Table 1). The highest average shedding in
these three groups was recorded on day 2 with 4.5 (log.sub.10), 3.7
(log.sub.10) and 4 (log.sub.10) bacteria per gram of faeces for
soybean, Pichia and Arabidopsis groups, respectively. The shedding
declined in these three groups the subsequent day by a log.
Reaching average shedding on day 5 to 2.6 (log.sub.10), 2
(log.sub.10) and 2,7 (log.sub.10) bacteria per gram of faeces in
soybean, Pichia and Arabidopsis groups, respectively. The shedding
in these groups remained low thereafter, often below detectable
levels (2 (log.sub.10) bacteria per gram of faeces) for some of the
piglets of these three groups (see Table 1). In contrast, the
piglets of the group receiving no antibodies (control-group) in
feed had prolonged shedding of high titres of the challenged
bacteria, on an average higher than 6.3 (Log.sub.10) bacteria per
gram faeces from day 3 until day 6; and declined thereafter on day
7 (5.3 (log.sub.10) bacteria per gram faeces) and day 8 (3.3
(log.sub.10) bacteria per gram faeces) to below detection levels by
day 9. The high and prolonged shedding indicates that the
challenged strain could effectively establish the infection and
successful colonise the small intestine in the control group.
Whereas, the in-feed VHH-IgAFc antibody receiving piglets in the
Arabidopsis-group, Pichia-group and the soybean-group, all showed a
quick decline in the F4-ETEC immediately after challenge. This
shows that the monomeric VHH-IgAFc in these feeds prevented the
F4-ETEC from attaching to the enterocytes, colonising and
establishing an infection. This is further corroborated by the
anti-F4-ETEC seroconversion (see FIG. 3C). Most of the piglets of
the Pichia, soybean and Arabidopsis groups mounted a lower immune
response due to limited exposure of the F4-ETEC pathogen to the
immune system, while the average titre of anti-F4-ETEC serum IgG,
IgM and IgA levels of the control group steadily increased by day 7
and continued to rise by day 14.
[0164] The shedding and seroconversion results clearly demonstrate
that the in-feed delivery of 5 mg dose of monomeric VHH-IgAFc
formulation against F4-ETEC, composed of equal proportions of
VHH-IgAFc antibodies--V2A and V3A, either produced in Arabidopsis,
soybean or Pichia is efficacious. Furthermore, in case of Pichia
produced antibodies, the in vivo efficacy results duly confirm that
the processing and formulation of the medium bearing secreted
VHH-IgAFcs is suitable to stably incorporate and orally deliver
feed-based Pichia produced molecules for gastric indications.
Materials and Methods to Example 1
Expression of VHH-IgAFc
Arabidopsis:
[0165] Previously published Arabidopsis lines expressing monomeric
V2A-IgAFc and V3A-IgAFc fusions (Virdi et al. (2013) PNAS 110, 29,
11809-11814) were scaled up in the greenhouse, to raise .about.100
gram of V2A-IgAFc and V3A-IgAFc producing seeds, to formulate the
antibody containing feed for the Arabidopsis-group in the challenge
experiment.
Soybean:
[0166] The plasmid pEV2A and pEV3A (Virdi et al. (2013) PNAS 110,
29, 11809-11814) bearing the VHH-IgAFc fusion gene for antibody V2A
and V3A, respectively were recombined into the pGW43 multisite
gateway cassette (Karimi et al. (2002) Trends Plant Sci 7, 193-195)
bearing the gene conferring phosphinothricin resistance for the
selection of transformant using the herbicide Basta@, as per the
Gateway@ cloning instruction manual (Invitrogen). The resulting
expression vectors were named pMXV2A and pMXV3A, were then
introduced in to Agrobacterium strain EHA101 for transformation of
the soybean plants (cultivar Williams 82) using cotyledons as
explants according the method described by Paz M M et al. (2006)
Plant Cell Rep. 25, 206-213) by the Plant Transformation Facility
of Iowa State University. The expression of VHH-IgAFc antibodies
was evaluated in the T2 seeds of the transformed events, via ELISA
with antigen-FaeGac (the tip adhesion of F4-ETEC) coated wells
(Virdi et al (2013) PNAS 110, 29, 11809-11814), and detected with
polyclonal anti-pig IgA conjugated to horseradish peroxidase (AbD
Serotech; AA140P). Ten to twenty seeds from events expressing high
amounts of antibody were retained for growing T2 plants while the
remaining seeds were used to formulate the soybean produced
VHH-IgAFc bearing-diet for the piglet feed-challenge
evaluation.
Pichia:
[0167] The VHH-IgAFc fusion gene for VHH-IgAFc V2A and V3A was
PCR-amplified using the primer set Alfa-V2
(CTCTCTCTCGAGAAGAGAGAGGCCGAAGCTCAGGTGCAGCTGC) and IgA-NotI
(CCTCTTGAGCGGCCGCCCTTTAGTAGCATATGCCTTCTG), as previously described
for VHH-IgG by De Meyer T. et al. (2015) Plant Biotechnol J 13,
938-947) these primers bear the restriction site AvaI and NotI, by
means of which the antibody gene was cloned in frame with the
alpha-mating factor within the pPpT4_Alpha_S expression vector
(Naatsaari L. et al., (2012) PLoS ONE 7, e39720). The respective
expression vectors were linearized using the enzyme PmeI and
introduced into Pichia pastoris via electroporation (Jacobs P P et
al. (2009) Nat Protoc. 4, 58-70). The positive Pichia colonies were
selected on YPD agar plated with 100 .mu.g/ml of Zeocin.RTM. and
300 .mu.g/ml of blasticidin. The expression of 20 individual
colonies was analysed in the 24-well system, in 2 ml BMGY (1% yeast
extract, 2% peptone, 100 mM potassium phosphate, 1.34% YNB, 1%
glycerol, pH 6.0) liquid culture. Wherein post 48 hrs of growth,
the liquid medium was replaced with BMMY (1% yeast extract, 2%
peptone, 100 mM potassium phosphate, 1.34% YNB, pH 5.7) and spiked
with 1% methanol every .about.12 hrs. The medium containing the
secreted VHH-IgAFc antibodies was typically harvested post 48 hrs
of induction in BMMY medium. The expression level was evaluated via
ELISA with FaeG coated wells. Clones with high expression were
identified and the glycerol-stock was generated.
Piglet Challenge Experiment
[0168] The piglet challenge experiments were performed in
accordance to the Belgian legislations for animal welfare, upon the
approval of Animal Care and Ethics Committee of the Faculty of
Veterinary Medicine at Ghent University, Belgium (ethical dossier
number EC2015/47). For the experiment with Pichia and soybean
produced monomeric-IgA the piglets (Belgian landrace.times.English
landrace) were bought from farms of the Institute for Agricultural
and Fisheries Research (ILVO), Melle, Belgium, from unvaccinated
sows. Blood samples were collected from 2-3 week old piglets to
monitor levels of anti-ETEC antibodies in serum (approved by the
institutional ethical board of ILVO, dossier number--2016/267).
Piglets seronegative for F4-ETEC, and positive for the MUC-13 gene
(homozygous and heterozygous dominant), determined via MUC-13 PCR
(Goetstouwers et al (2014) PLoS One 9, e105013), which correlates
with the presence of F4-ETEC receptors (F4R) were selected. Each
experimental group consisted of six piglets. After weaning piglets
were brought to the faculty stables and properly randomized over
the feeding groups based on their litter, genotype and weight. The
average starting weight of each group was 7.2 kg. The challenge was
performed as previously described (Virdi et al (2013) Proc Nat Acad
Sci USA. 110, 29, 11809-11814). Briefly, the piglets were
challenged on consecutive days with 10.sup.10 F4-ETEC bacteria
(strain--GIS26R.sup.strep), via intragastric intubation under
sedation, post neutralisation of gastric pH with bicarbonate buffer
for 30 minutes. The first day of challenge is accounted as day 0 in
the timeline. The feed containing antibodies was administered for a
period of 10 days, starting three days before the challenge (FIG.
3, A). Faecal samples were collected from the day of challenge
until day 12 and on the day euthanasia, to monitor the shedding of
the F4-ETEC challenged strain GIS26R.sup.strep, on blood agar
plates with streptomycin selection (1 mg/ml). Blood samples were
taken to monitor the F4-ETEC specific IgG, IgA and IgM titres on
day -1, day 7 and day 14. Specific modification, sample collection
and manipulations with the animals are schematically represented in
FIG. 3A.
Feed Preparation:
[0169] For the seed produced antibodies, the precisely weighed
respective seeds (soybean or Arabidopsis) were crushed and then
mixed with basic pig feed in two steps to ensure thorough
homogeneity; first in a small volume resulting in a concentrated
premix which was subsequently diluted with more pig feed to prepare
the experimental feed (Table 2). The seeds were grinded using the
knife-mill (Retsch Grindomix GM200) prior to which the seeds and
the grinding chamber were chilled using dry ice. To maintain
proportional nutrition in all groups throughout each experiment,
flax seeds were used to replace Arabidopsis seeds (Table 2).
Similarly, to account for the additional soybean proteins,
wild-type soybean seeds were added to group other than soybean-IgA
group at equal proportion to IgA-producing soybean seeds (Table
2).
TABLE-US-00002 TABLE 2 Feed formulation. Star (*) refers to the
total weight of pooled dried Pichia mix, from four batches of
freeze drying slurry, (made from filtered, buffer exchanged Pichia
media and piglet feed) of each production batch. The inclusion
percentage within the total feed is indicated in parenthesis.
Mixing step I Mixing step II Premix composition experimental
Antibody Soybean feed bearing seeds/ wild type pig total feed total
material Flax seeds seeds feed premix matrix feed Kg Kg Kg Kg Kg Kg
Kg Arabidopsis- 0.15 0 0.15 1.7 2 16 18 IgA (0.83%) (0.83%)
Soybean- 0 0.15 0.15 1.7 2 16 18 IgA (0.83%) (0.83%) Pichia-IgA
5.368* 0.15 0.15 0.337 6 12 18 (0.83%) (0.83%) Flax-soy 0 2.49 2.49
1.02 6 294 300 feed (0.83%) (0.83%)
Pichia:
[0170] As per the ELISA-based equivalence test (FIG. 2), 1 ml of
Pichia extract was equivalent to 5 mg of VHH-IgAFc-producing
Arabidopsis seed powder solubilised in an ml of extraction buffer.
Based on this proportion, to dose 5 mg Pichia produced VHH-IgAFcs
for 6 piglets, for 10 days, the necessary amount of 30 L of Pichia
medium was produced. The 30 L of Pichia culture was made in 4
batches of 7.5 L weekly run, as per the standard expression
protocol as above (48 hrs growth in BMGY medium followed by
induction for 48 hrs in BMMY medium). At the end of each run, the
culture medium was harvested by centrifugation, the cell free
supernatant was concentrated via diafilteration to 2-1.5 L and
subsequently buffer exchanged with sodium-phosphate buffer (pH 6)
with 18.75 mM NaCl, using Centramate.TM. 500 S tangential flow
filtration system (Pall Life Science) fitted with 5 kDa Omega.TM.
centramate filter cassette. To the resultant .about.2-1.5 L protein
solution containing Pichia produced VHH-IgAFc, obtained at the end
of each of the four batches, an equal weight of commercial pig feed
was added and mixed with a hand-held paddle to avoid any foaming,
and the slurry was lyophilised using freeze drying (Epsilon 2-10 D
LSC-Martin-Christ, Germany) for 47 hours. The resultant dried
powder, termed Pichia premix, of the 4 batches in total was 5.368
Kg, which was then mixed with of pig feed to result in 18 Kg of
final Pichia produced VHH-IgAFc bearing feed (Table 2).
Statistical Analysis:
[0171] A linear mixed model was used to model the log 10
transformed bacterial counts measured daily from day 1 till day 10
using the mixed procedure from SAS (Version 9.4 of the SAS System
for windows 7 64 bit. Copyright .COPYRGT. 2002-2012 SAS Institute
Inc. Cary, N.C., USA, www.sas.com). Since the detection limit for
determining bacterial shedding was 2 (Log.sub.10) per gram of
faeces, missing data was imputed with a value of 1.9 (log 10) when
no bacteria were detected. Several structures for the
variance-covariance matrix of the residuals were tested based on a
saturated mean model (i.e. considering all independent variables as
categorical variables and including all interaction effects).
Several structures were tested: unstructured, compound symmetry,
autoregressive, and banded toeplitz. The best structure was chosen
based on AIC values. The fixed effects part of the model contained
the main effect of feed group and day and their interaction term.
The Kenward-Roger approximation for computing the denominator
degrees of freedom for the tests of fixed effects was applied as
implemented in SAS. Partial F-test were calculated at each day
using the plm procedure. At those days where the partial F-test was
significant at the 5% significance level, pairwise comparisons were
made. Statistical significances were calculated with Wald tests and
adjusted for multiple comparisons using Tukey's method at each day.
Residual diagnostics were carefully examined.
2. Evaluation of IgAFc Fusions with Human IL-22 Produced in Pichia
pastoris
Materials:
[0172] Recombinant Murine TNF (mTNF) was produced in-house in E.
coli and had a specific activity of 9.46.times.107 IU/mg).
Animals:
[0173] The A20 conditional knockout mice (A20.sup.IEC-KO) were
obtained from Prof Geert van Loo. The A20.sup.IEC-KO mice are
deficient for A20 in intestinal epithelial cells (IECs) (Vereecke,
L. et al. (2010) J. of Experimental Medicine 207, 1513-1523). For
experimentation, only female 8-12 week old mice were used. Mice
were housed in individually ventilated cages at the VIB
Inflammation Research Center (IRC) in a specific pathogen-free
facility. All experiments on mice were conducted according to
institutional, national, and European animal regulations. Animal
protocols were approved by the ethics committee of Ghent
University.
Feed:
[0174] A standard powdered mouse feed (Ssniff.RTM.R/M-H Complete
feed--Maintenance) was purchased from Bio-Service (The
Netherlands). To prepare the IL-22 containing feed, the culture
supernatant containing each respective IL-22 format was
concentrated via diafilteration and subsequently buffer exchanged
with sodium-phosphate buffer (pH 6) with 18.75 mM NaCl, using
Centramate.TM. 500 S tangential flow filtration system (Pall Life
Science) fitted with 5 kDa Omega.TM. centramate filter cassette.
For each format, the bio-activity was determined in the concentrate
and the volume of each format was set to obtain an equal amount of
bioactivity per ml of concentrate. To mix with the feed, an equal
weight of the standard powdered rodent feed was added to the IL-22
containing concentrate and mixed. Subsequently, the slurry was
lyophilised by freeze drying (Epsilon 2-10 D LSC-Martin-Christ,
Germany) for 47 hours. The resultant dried powder is then referred
to as Pichia rodent premix.
In Vitro Testing:
[0175] To test the bioactivity of the different IL-22 formats in
the production medium, the medium was sampled and the medium was
diluted in sterile PBS prior to performing the bio-assay. To test
the retention of the bioactivity of the different IL-22 formats in
the dried feed, the feed was dissolved 1:1 (v/v) in PBS. The slurry
was then centrifuged at 13.000 g. The upper aqueous phase was
transferred to a fresh tube and filter sterilized using low-protein
binding 0.22 .mu.m syringe filters (Millipore). The filtrate was
then diluted in sterile PBS prior to performing the bio-assay.
[0176] Human Colo-205 colon carcinoma cells were ordered from the
American Type Culture Collection (ATCC) and cultured according to
the guidelines provided in the datasheet. Briefly, the cell line
was cultured as semi-adherent cells in RPM11640 (Gibco)
supplemented with 10% Fetal Bovine Serum (FBS) at 37.degree. C. 5%
CO.sub.2. For passaging, cells growing in suspension were collected
and the adherent cells were trypsinized following standard tissue
culture procedures.
[0177] To determine bioactivity of IL-22 using the Colo-205 assay,
cells were seeded in 96-well U-bottom plates at 3.0.times.10.sup.5
cells/mL (100 .mu.l/well). Cells were allowed to adapt for 24 hours
prior to stimulating the cells with a dilution series of the IL-22
containing fraction. All stimulations were allowed to proceed
overnight. As control, a dilution series of commercially available
recombinant hIL-22 (carrier-free) produced E. coli (BioLegend) was
used. The next day, the plates were centrifuged at 400 g, 10
minutes at 4.degree. C. and the supernatant was collected. The
supernatant was assayed for IL-10 using the hIL-10 DuoSet ELISA
(R&D systems). The data was analyzed in GraphPad Prism 6.
Specific activity was determined based the dose-response curve that
was used to determine the EC.sub.50.
Experimental Model:
[0178] To test the protective effect of IL-22, C57BL/6
A20.sup.IEC-KO mice (n=8 per group) were gavaged with 10 ml/kg
liquid diet (equivalent to 200 .mu.l) containing an equivalent of
20-, 10-, 5-, 1 .mu.g of each IL-22 format or the equivalent feed
without IL-22 as control.
[0179] To induce experimental colitis, 1 hour after gavage mice
were administered a sublethal dose of 250 .mu.g/kg mTNF
intraperitoneally (i.p.). Control mice (Mock) were injected with an
equivalent volume of 0.9% NaCl i.p. Body temperature and survival
were monitored every hour. In a parallel experiment, mice were
euthanized after 4 hours for histological analysis and caspase
activity assays.
Histology:
[0180] Postmortem, the entire colon was removed from cecum to anus,
and the colon length was measured as a marker for inflammation.
After measuring, parts from the intestine were removed and fixed in
4% Paraformaldehyde (PFA). After paraffin embedding and sectioning,
the tissue was stained with hematoxylin/eosin for histological
examination. Apoptosis was analyzed by fluorescence microscopy
using an in situ cell death detection kit (Roche) for TUNEL
staining,
Serum Analysis:
[0181] Serum pro-inflammatory cytokines IL-6 and MCP-1 were
determined in the serum using the Mouse IL-6 DuoSet ELISA kit
(R&D Systems) and Mouse CCL2/JE/MCP-1 DuoSet ELISA kit (R&D
Systems) respectively. Alanine aminotransferase activity (ALT) and
aspartate aminotransferase activity (AST) were analyzed by routine
photometric test on a Hitachi 747 analyzer (Diagnostica, Boehringer
Mannheim).
Results:
[0182] The mock treated A20.sup.IEC-KO mice do not show any
phenotypical signs of distress. In contrast, mice that receive
TNF-injection show clear symptoms of TNF toxicity, including
hypothermia and severe diarrhea as soon as 2 hours after injection.
In addition, between 5- and 9 hours after injection of TNF, mice
start dying. Mice that receive the intra-gastric treatment with the
IL-22 containing feed (IL-22 IgAFc or IL-22) only show a mild
decrease in body temperature and do not develop diarrhea. Moreover,
none of the mice that are treated with any of the IL-22 formats
succumb after the TNF-challenge.
[0183] Histologically, mice that are only treated with TNF but do
not receive IL-22 have a severe damage to the ileum and jejunum,
characterized by extensive epithelial damage and the near complete
loss of the crypt-villus structure. In contrast, mice receiving any
of the IL-22 formats do not show any signs of damage, clearly
maintaining barrier integrity. At the cellular level, TUNEL
staining is absent after IL-22 treatment, whereas in mice treated
with TNF-only, apoptotic cells are highly abundant in the
epithelial lining of the villi in addition to cells that already
detached and are found in the intestinal lumen.
[0184] We further assess the systemic effects by measuring the
pro-inflammatory cytokines IL-6 and MCP-1. The levels of both are
comparable for control mice and mice receiving the IL-22 formats,
whereas mice treated with TNF-only but that did not receive IL-22
have increased 11-6 and MCP-1 levels. In addition, we also assess
liver transaminase levels (AST and ALT) as it has been reported
that TNF also affects liver physiology. Indeed, mice treated with
TNF have increased levels of AST and ALT in the serum whereas IL-22
treated mice do not show this.
Materials and Methods for Example 2
Strains, Media and Reagents
[0185] Escherichia coli (E. coli) MC1061 or DH5.alpha. were used
for standard molecular biology manipulations. For plasmid
propagation, E. coli were cultured in LB broth (0.5% yeast extract,
1% tryptone, and 0.5% NaCl) supplemented with the appropriate
antibiotics: 50 .mu.g/mL carbenicillin (Duchefa Biochemie), 50
.mu.g/mL kanamycin (Sigma Aldrich), 50 .mu.g/mL hygromycin B
(Duchefa Biochemie) or 50 .mu.g/mL Zeocin.RTM. (Life Technologies).
All PCR reactions were performed using Phusion high-fidelity
polymerase (NEB). PCR reagents such as dNTPs and primers were
ordered from Promega and IDT respectively.
[0186] The Pichia pastoris NRRL-Y 11430 strain (syn. Komagataella
phaffi) was provided by A. Glieder (Technische Universitat Graz,
Austria). This strain is referred to as wild-type. Yeast cultures
were grown in liquid YPD (1% yeast extract, 2% peptone, 1%
D-glucose) or on solid YPD-agar (1% yeast extract, 2% peptone, 1%
D-glucose, 2% agar) and selected for by using the appropriate
antibiotics: 100 .mu.g/mL Zeocin.RTM., 500 .mu.g/mL geneticin/G418
(Life Technologies) or 300 .mu.g/mL hygromycin B. Bacto yeast
extract, Bacto tryptone, Bacto peptone, Bacto agar and Yeast
Nitrogen Base (YNB) were purchased from Difco (Beckton
Dickinson).
[0187] For protein expression, cultures were grown in a shaking
incubator (28.degree. C., 225 rpm) in BMGY (1% yeast extract, 2%
peptone, 100 mM KH.sub.2PO.sub.4/K.sub.2HPO.sub.4, 1.34% YNB, 1%
glycerol, pH 5.5). For induction of protein expression, the cells
were switched to BMMY (1% yeast extract, 2% peptone, 100 mM
KH.sub.2PO.sub.4/K.sub.2HPO.sub.4, 1.34% YNB, pH 5.5) containing 1%
MeOH. To maintain induction and to compensate for evaporation,
cultures were spiked with 1% MeOH every 8-12 hours. At the end of
induction, cultures were harvested by centrifugation (1.500 g,
4.degree. C. for 10 minutes). The samples were analyzed immediately
or snap-frozen in liquid nitrogen prior to storage at -20.degree.
C.
Construction of hIL-22 Expression Vectors
[0188] The open reading frame of mature human interleukin-22
(hIL-22, UniProtKB accession Q9GZX6, residue 34-179) was codon
optimized for expression in P. pastoris using Genscript's
proprietary algorithm and ordered synthetically. The hIL-22 coding
sequence was cloned in-frame with the S. cerevisiae .alpha.-mating
factor in the pKai61EA-yEGFP expression vector, but without
including the EA-repeats (Schoonooghe S et al (2009) BMC
Biotechnology 9, 70). The final expression vector pKai-hIL22
contains the hIL-22 transgene under control of the strong
methanol-inducible AOX1 promoter and has a Zeocin.RTM. resistance
marker for selection in both bacteria and yeast. As an alternative
secretion signal, the S. cerevisiae Ost1 sequence (Fitzgerald I and
Glick B S (2014) Microbial cell factories 13, 1) was PCR amplified
from S. cerevisiae genomic DNA using primers Ost1SaccharopAOX1Fw
and Ost1SaccharoRv.
Construction of hIL-22-hIgA Fc-6.times.his Expression Vectors
[0189] All constructs were cloned using a modular cloning strategy
(MoClo) was employed. This system was developed for S. cerevisiae
(Lee M E et al (2015) ACS Synth Biol 4, 975-986) but was adapted
in-house for use in Pichia. In brief, the MoClo system makes use of
standardized entry vectors to subclone the respective `parts` of a
desired construct. Each part within these vectors are flanked by
distinct type-II restriction enzyme sites. By pooling the entry
vectors in a single reaction and performing consecutive restriction
enzyme digestion and T4 ligation reactions, parts that have
compatible ends are allowed to assemble and ligate into a circular
plasmid to yield the final expression vector. All entry vectors
were generated by pooling equimolar amounts (.about.20 femtomoles)
of both the amplified fragment and the MoClo entry vector pYTK001
or the synthetic but identical vector pPTK081. The standard Modular
Cloning ("MoClo") protocols were used and feature the addition of
the Type II restriction enzyme BsmBI (1 U;NEB), the T4 ligase (1
U;NEB) and a 10.times. T4 ligase buffer (NEB) to the pooled
sequences. Twenty-four cycles of 42.degree. C. for 2 min and
16.degree. C. for 5 min were performed in a PCR cycler, followed by
a final digestion step at 50.degree. C. for 10 min and a heat
denaturation step at 80.degree. C. for another 10 min, before
holding at 12.degree. C. indefinitely. The resulting vectors were
introduced into E. coli MC1061 competent cells which were then
plated on LB chloramphenicol medium. As the pYTK001/pPTK081
recipient entry vector features a GFP dropout cassette, green-white
screening allowed to distinguish colonies that contain the
(correct) plasmid from the green false positive clones. Plasmids
were isolated and the sequences of interest were verified by Sanger
sequencing, using primers PP001 and PP002.
[0190] To engineer a hIL-22 fusion construct with the invariable
domains of IgA (P.sub.AOX1-hIL-22-hIgA_Fc-6.times.His), the
.alpha.-MF/Ost1/pre-hIL-22 sequences were amplified by PCR with
primers that are compatible with the MoClo system. To make a
N-terminal fusion of the hIL-22 sequence to the hIgA sequence, the
full .alpha.-MF-hIL-22 CDS, Ost1-hIL-22 CDS and pre-hIL-22 CDS were
considered as a N-terminal tag or 3a part within the MoClo system.
Analogously, the invariable domains of IgA (human, mouse and pig)
were considered a Gene of Interest or 3b part.
[0191] The MoClo entry vectors carrying the .alpha.-MF-hIL-22,
Ost1-hIL-22 or pre-hIL-22 were all generated by an initial PCR
amplification, using the above mentioned pPpT4_Alpha_S expression
vectors as template. Both the .alpha.-MF-hIL-22 and pre-hIL-22
sequences were amplified with primers IL-22forentryfw and
IL-22forentryrv while the Ost1-hIL-22 sequence was amplified with
primers IL-22ostlforentryfw and IL-22forentryrv. The PCR fragments
were then introduced by BsmBI restriction digestion and T4 ligation
into the pYTK001/pPTK081.
[0192] The sequence of the Fc region of human IgA (Homo sapiens,
UniproKB: P01877) and mouse IgA (Mus musculus, UniprotKB: P01878)
was codon optimized for expression in P. pastoris and ordered
synthetically as gBlocks at IDT. The human and mouse IgA gBlocks
were then amplified with the primers IgAforentryfw and
IgAforentryrv or IgAmouseforentryfw and IgAmouseforentryrv, to
allow modular cloning. The Fc region of the pig IgA (Sus scrofa,
UniprotKB: K7ZRK0) was amplified from the EV2Avector which was
previously generated ((Virdi V et al (2013) PNAS 110, 11809) with
primers IgApigforentryfwcorrect and IgApigforentryrvnew. All IgA
sequences were cloned into the pYTK001/pPTK081 vector as a `part
3b` in the MoClo system.
[0193] The entry vectors were then used to generate expression
vectors using the MoClo system. Each expression vector was
generated by pooling equimolar amounts (.about.20 femtomoles) of
the following parts (available or will be available at
Addgene):
TABLE-US-00003 Part 1 Assembly connector: CONLS Part 2 Promoter:
P.sub.AOX1/P.sub.CAT1 Part 3a N-terminal tag:
.alpha.-MF-prepro/.alpha.-MF-pre/Ost1 - hIL-22 Part 3b Gene of
Interest: hlgA/mlgA/plgA Part 4a C-terminal tag: 6xHis/6xHis-HDEL
Part 4b Terminator: AOX1TT Part 5 Assembly Connector CONRE Part 6
Yeast marker Stuffer (as zeocin resistance works in both bacteria
and fungi) Part 7 Miscellaneous Stuffer Part 8 E. coli marker + ORI
ZeoR + ColE1
[0194] Primers used in example 2:
TABLE-US-00004 Name Sequence pYTK_IL22Fw GCATCGTCTCATCGGTCTCATATGAG
ATTCCCATCTATTTTCACCGCT pYTK_IL22Rv ATGCCGTCTCAGGTCTCAAGAACCAA
TACAAGCGTTACGCAGAGACA pYTK_hlgAFw GCATCGTCTCATCGGTCTCATTCTGT
CGCGTGCCCGGTGCCG pYTK_hlgARv ATGCCGTCTCAGGTCTCAGGATCCAT
AGCAGGTGCCATCCACTTCCGCCA IL-22rvHDELnew ATGCGGCCGCTTATCACAACTCGTCG
TGAATACAAGCGTTACGCAGAGACAT Ost1SaccharopAOX1Fw
ACAACTAATTATTGAAAGAATTCCGA AACGATGAGGCAGGTTTGGTTCTC Ost1SaccharoRv
ATCCAGACGACAATGAGAAGAAATTG GAGCAGCAGAAGACACGTTGAAAAAA C
pPpT4ASpAOX1Rv CGTTTCGGAATTCTTTCAATAATTAG T pPpT4ASIL22noprofw
Phos-GCTCCAATTTCTTCTCATTGT CGT pPpT4ASIL22noprorv
Phos-AGCCAATGCAGAGGAGGC IgAforentryfw GCATCGTCTCATCGGTCTCATTCTgt
gccgtgcccggtgccg IgAforentryrv ATGCCGTCTCAGGTCTCAGGATCCat
agcaggtgccatccacttccgcca IL-22forentryfw GCATCGTCTCATCGGTCTCATATGAG
ATTCCCATCTATTTTCACCGCT IL-22forentryrv ATGCCGTCTCAGGTCTCAAGAACCAA
TACAAGCGTTACGCAGAGACA IL-22ost1forentryfw
GCATCGTCTCATCGGTCTCATATGAG GCAGGTTTGGTTCTCTTGG IgAmouseforentryfw
GCATCGTCTCATCGGTCTCATTCTTG TTCTGGTCCAACACCACCACCACC
IgAmouseforentryrv ATGCCGTCTCAGGTCTCAGGATCCAT
AGCAAATACCGTCGCCCTCACTCATA ATCACAGA IgApigfw
CTCAGATCCATGTCCTCAGTGCT IgApigrvnew GAGGCAGAAGGCATATGCTAC
IgApigforentryrvnew ATGCCGTCTCAGGTCTCAGGATCCGT AGCATATGCCTTCTGCCTC
IgApigforentryfwcorrect GCATCGTCTCATCGGTCTCATTCTGA
TCCATGTCCTCAGTGCTGC
3. In Vivo Efficacy Comparison of Edible Formulations from
Different Drying Processes of Pichia Produced VHH-IgA-Fc Fusion
[0195] Oral and gastric stability is paramount for the
biotherapeutics like VHH-IgAFcs to be efficacious in the
gastrointestinal tract. The matrix surrounding the antibodies (at
the molecular level) and the process of drying very likely plays an
important role in protecting VHH-IgAFc antibodies from being
digested and rendering ineffective in the gut. Here we set out to
evaluate the effect on in vivo efficacy of differentially dried
Pichia produced VHH-IgAFcs in clearing the F4-ETEC infection, which
were--freeze dried together with feed matrix (see example 1) or
freeze dried without feed matrix. In addition, we also evaluate
spray drying process, which is based on an alternative principle
involving heat; wherein matodextrin was used as a matrix/carrier.
The three differentially processed feed formulation of Pichia
produced anti-F4-ETEC VHH-IgAFc (V2A and V3A) composed of the same
dose; equivalent of 0.5 L of the fermentate per piglet per day or 5
mg VHH-IgAFcs/day/piglet. The forth group received no VHH-IgAFc
antibodies in feed, and served as negative control. Twenty-four
F4-ETEC seronegative and muc-13 gene test positive piglets, which
correlate to susceptibility to F4-ETEC infection, were selected,
weaned and housed into 4 groups of 6 piglets each. These piglets
were allowed to acclimatise to solid food, after which they were
introduced to the group specific experimental feed (see FIG. 4A).
The experimental feed was provided for 10 days, on the third day of
which all the piglets were challenged with 10 F4-ETEC bacteria for
two consecutive days (day 0 and day 1). The resultant effect of the
infection, in response to the feed formulations was monitored via
analyzing the colony forming units (CFU) of the challenge strain
shed daily until day 12 (see FIG. 4B and Table 3) in the
faeces.
[0196] Table 3: The daily shedding of the F4-ETEC (Log 10) CFU per
gram of faeces for each piglet
TABLE-US-00005 Day Day 0 Day 1 Day 2 Day 3 Day 4 Day 5 Day 6 Day 7
Day 8 Day 9 Day 10 Day 11 12 Spray dried Piglet 1 -- -- -- -- 2.48
2.30 -- -- -- -- -- -- -- Piglet 2 Dead -- -- -- -- -- -- -- Piglet
3 -- -- 2.76 -- -- -- -- -- -- -- -- -- -- Piglet 4 -- -- 2.60 --
-- -- -- -- -- -- -- -- 2.60 Piglet 5 -- -- 3.48 3.00 2.00 -- -- --
-- 2.00 -- -- -- Piglet 6 -- -- -- -- -- -- -- -- -- -- -- -- --
Control Piglet 7 -- -- 6.68 5.07 -- -- -- -- -- -- -- -- -- Piglet
8 -- 3.95 5.90 -- -- -- -- -- -- -- -- -- -- Piglet 9 -- 2.48 dead
-- -- -- -- -- -- Piglet 10 -- 5.68 5.00 -- -- -- -- -- -- -- -- --
-- Piglet 11 -- 3.48 5.16 3.00 2.48 -- -- -- -- -- -- -- -- Piglet
12 -- 4.28 3.78 2.48 -- -- -- -- -- -- -- -- -- Freeze dry Piglet
13 -- 3.30 4.16 -- -- -- -- -- -- -- -- -- -- without matrix Piglet
14 -- -- -- 3.07 -- -- -- -- -- -- -- -- -- Piglet 15 -- -- -- --
-- -- -- -- -- -- -- -- -- Piglet 16 -- 3.48 -- -- -- -- -- -- --
-- -- -- -- Piglet 17 -- 5.47 3.18 -- -- -- -- -- -- -- -- -- --
Piglet 18 -- 4.00 7.04 4.99 3.85 3.43 2.48 2 -- -- -- -- -- freeze
dry Piglet 19 -- -- 3.48 -- -- -- -- -- -- -- -- -- -- with matrix
Piglet 20 -- -- -- -- -- -- -- -- -- -- -- -- -- Piglet 21 -- 3.06
4.04 -- -- -- -- -- -- -- -- -- -- Piglet 22 -- 3.43 4.53 -- -- --
-- -- -- -- -- -- -- Piglet 23 -- 2.78 -- -- -- -- -- -- -- -- --
-- -- Piglet 24 -- -- -- -- -- -- -- -- -- -- -- -- -- Note: The
log (10) CFU detection limit is 2, the dash (--) denotes no
bacteria was detected Note: Piglet 2 and piglet 9 died on day -5
and day 2, respectively; due to large gastric ulcers discovered
during post-mortem investigation.
[0197] All the piglets of the negative control group shed high CFUs
of the F4-ETEC, on day 1 and day 2, and the shedding was maintained
at least in half of the piglets till day 3. The overall shedding in
the antibody receiving groups was low. FIG. 4B shows the mean
shedding in each group and the standard error of the mean (SEM)
until day 6, which reflects the efficacious trend of the three
Pichia produced and differentially processed VHH-IgA-Fc fusions
containing diets in preventing the F4-ETEC infection. These data
show that the matrix--either as pig feed in freeze drying process,
or maltodextrin in spray drying, attributes to a higher efficacy in
vivo. The serum anti-ETEC IgG (see FIG. 4C) and IgA (see FIG. 4D)
levels were lowest in that group received freeze-dry on feed matrix
formulation, which corroborates the shedding results. Overall,
variation is individual piglets were observed within the groups
showing seroconversion, (error bars in FIGS. 4C and 4D represent
standard error of the mean).
Material and Methods for Example 3
Pichia Produced VHH-IgA-Fc Based Feed Formulation
[0198] The efficacious dose of the anti-ETEC VHH-IgAFc as applied
in Example 1, challenge experiment, was about 5 mg VHH-IgAFc or
more appropriately, feed formulation bearing dried product from 0.5
L of the shake flask grown culture per piglet per day. This dose
was composed of equal parts of the two anti-F4-ETEC VHH-IgAFcs viz.
V2A and V3A (see Virdi et al (2013) 110, 29, 11809-11814). To
prepare similar dose for 18 piglets, (six animals in each of the
three groups) receiving the Pichia produced VHH-IgAFcs; 45 L of
each V2A and V3A (total 90 L) expressing Pichia culture was grown
in shake-flasks. This was produced in six batches (in a five day
long process, as in Example 1, 48 hrs growth in BMGY medium
followed by induction for 48 hrs in BMMY medium) as summarised in
Table 5 below. Thus weekly 15 L culture batch was produced. At the
end of each run, the culture medium was harvested by
centrifugation, the cell free supernatant was concentrated via
diafilteration to 1 L and subsequently buffer exchanged with
sodium-phosphatebuffer (20 mM Na.sub.2HPO.sub.4, 18.75 mM NaCl, pH
6), using Centramate.TM.500 S tangential flow filtration system
(Pall Life Science) fitted with 5 kDa Omega.TM. centramate filter
cassette. The resultant 1 L retentate protein solution containing
Pichia produced VHH-IgAFc-termed retentate, obtained at the end of
each of the six batches (Table 4), was dried in three specific
manners as below.
TABLE-US-00006 TABLE 4 The drying process of each batch of Pichia
produced VHH- IgA-Fc, to formulate the respective experimental feed
Anti-ETEC Batch VHH-IgAFc number antibody Drying process Feed
formulation 1 V2A 1 L retentate and pool of dried powder ~2 1 Kg
pig feed slurry Kg + 16 Kg of freeze-drying commercial piglet feed
2 V3A 1 L retentate and 1 Kg pig feed slurry freeze-drying 3 V2A 1
L retentate freeze- pool of dried V2A and drying (Without any V3A
powder ~60 g + solid matrix) 17.94 Kg of 4 V3A 1 L retentate
freeze- commercial piglet feed drying (Without any solid matrix) 5
V3A 1 L retentate bearing Spray dried powder 6 V2A V3A (batch 5)
mixed bearing pool of with 1 L retentate V2A and V3A ~2.3 bearing
V2A (batch 6) Kg + 15.7 Kg of feed together with 10% maltodextrin
was spray-drying
[0199] Manner 1: Freeze-dried with matrix (similar to Example 1):
one liter of retentate, either bearing VHH-IgAFc V2A (batch 1,
Table 5) or V3A (batch 2, Table 4) was mixed with one kilogram of
commercial piglet feed (supplier: Van Huffel, 9850 Poesele (Nevele)
Belgium) with a hand held paddle to avoid any foaming, and the
slurry was lyophilised using freeze dryer (Epsilon 2-10 D
LSC-Martin-Christ, Germany) for 47 hours. The resultant dried
powder, of the 2 freeze-drying batches (approximately 1 Kg each),
containing VHH-IgA-Fc V2A and V3A, respectively, were then mixed
with of pig feed to result in 18 Kg of final Pichia produced
freeze-dried on matrix VHH-IgAFc bearing feed (Table 4).
[0200] Manner 2: Freeze-dried without matrix: one liter of
retentate, either bearing VHH-IgAFc V2A (batch 3) or V3A (batch 4)
was lyophilised using freeze dryer (Epsilon 2-10 D
LSC-Martin-Christ, Germany) for 47 hours. The resultant dried
powder, of the 2 freeze-drying batches (.about.30 grams each)
containing VHH-IgAFc V2A and V3A, respectively, were then mixed
together with of pig feed to result in 18 Kg of final Pichia
produced freeze-dried-without-matrix VHH-IgAFc bearing feed (Table
4).
[0201] Manner 3: Spray-dried: one liter retentate bearing VHH-IgAFc
V3A (batch 5, Table 4) and another liter of retentate bearing
VHH-IgAFc V2A (batch 6, Table 5), were mixed together with 23 L
sodium-phosphate buffer (20 mM Na.sub.2HPO.sub.4, 18.75 mM NaCl, pH
6) containing 2.5 Kg of maltodextrin. The total 25 L liquid was
mixture thoroughly using industrial blender for 5-7 minutes and
then fed into the spray-drier, with parameters set to 45.degree. C.
preheating of the feeding liquid, and 170.degree. C. inlet air
temperature. During the drying process, the average outlet air
temperature was about 80.degree. C., and a constant liquid pumping
speed was maintained. Approximately 2.3 kg of dried V2A and V3A
bearing powder was recovered, which was mixed together with of pig
feed to result in 18 Kg of final Pichia produced spray-dried
VHH-IgAFc bearing feed (Table 4).
[0202] The dried VHH-IgAFcs from each of the differential drying
process run (see Table 5), being freeze-dried on feed (V2A batch 1,
V3A--batch 2), freeze dried without matrix (V2A-batch 3, V3A
batch-4) and spray-dried with maltodextrin (V3A+V2A, batch 5 and
batch 6 combined) when solubilized in phosphate buffer saline and
evaluated in ELISA were observed to be functionally active as
binding to the immobilized F4-FaeG antigen.
[0203] The control feed included 18 kg of basic feed without any
antibody. Each of the 18 Kg feed formulations were divided into 10
bags of 1.8 Kg each, as daily feed allowance per group, which was
provided in the feeding vat for the piglets from day -3 till day 7
(FIG. 4A).
Piglet Challenge Experiment:
[0204] The piglet challenge experiments were performed in
accordance to the Belgian legislations for animal welfare, upon the
approval of Animal Care and Ethics Committee of the Faculty of
Veterinary Medicine at Ghent University, Belgium (ethical dossier
number EC2017/122). The piglets (breed: hybrid) were bought from
farms of the Institute for Agricultural and Fisheries Research
(ILVO), Melle, Belgium (ethical dossier no 2017/306). Five
primiparous sows were abstained from the booster vaccine against
F4-ETEC to ensure low lactogenic immunity. The piglets born to
these sows, were administered antibiotic (Duphamox 0.1 ml/piglet)
three times, on every other day after birth to protect from the
F4-ETEC infection. Further, blood was sampled from these piglets on
the 15.sup.th day of birth, for evaluating the anti-F4-ETEC serum
titres and the MUC13 genotyping assay (Goetstouwers et al (2014)
PLoS One 9, e105013), which correlates with the presence of F4-ETEC
receptors. Twenty four seronegative and homozygous for the MUC13
F4-ETEC susceptible genotype were selected, weaned and transported
to the stables of veterinary faculty of Gent University for the
challenge-experiment. The piglets were properly randomized over the
feeding groups based on their litter, genotype and weight. The
average starting weight of each group was 8.5 Kg. The piglets were
administered intramuscular antibiotic-Duphamox (0.6 ml/piglet) on
day -12 and day -11; while Baytril (0.25 ml/piglet) was
administered on day -8, day -7 and day -6 to prevent the
contingency of bacterial infections post transportation. The
challenge was performed as previously described (Virdi et al (2013)
Proc Nat Acad Sci USA. 110, 29, 11809-11814). Briefly, the piglets
were challenged on consecutive days with 10.sup.10 F4-ETEC bacteria
(strain--GIS26R.sup.strep), via intragastric intubation under
sedation (1 ml azaperone, Stressnill.RTM. Janssen Animal Health),
post neutralisation of gastric pH with 60 ml bicarbonate buffer
(1.4% NaHCO.sub.3 w/v in distilled water). The first day of
challenge is accounted as day 0 in the timeline (FIG. 4A). The feed
containing antibodies was administered for a period of 10 days,
starting three days before the challenge (FIG. 4A). Faecal samples
were collected from the day of challenge until day 12 to monitor
the shedding of the F4-ETEC challenged strain GIS26R.sup.strep, on
blood agar plates with streptomycin selection (1 mg/ml). Blood
samples were taken to monitor the F4-ETEC specific IgG, and IgA
titres on day -15 (day of weaning), day -4, day 7. Specific sample
collection and manipulations with the animals are schematically
represented in FIG. 4A.
Sequence CWU 1
1
23141DNAArtificial SequencePrimer 1ctctctcgag aagagagagg ccgaagctca
ggtgcagctg c 41239DNAArtificial SequencePrimer 2cctcttgagc
ggccgccctt tagtagcata tgccttctg 39348DNAArtificial SequencePrimer
3gcatcgtctc atcggtctca tatgagattc ccatctattt tcaccgct
48447DNAArtificial SequencePrimer 4atgccgtctc aggtctcaag aaccaataca
agcgttacgc agagaca 47542DNAArtificial SequencePrimer 5gcatcgtctc
atcggtctca ttctgtgccg tgcccggtgc cg 42650DNAArtificial
SequencePrimer 6atgccgtctc aggtctcagg atccatagca ggtgccatcc
acttccgcca 50752DNAArtificial SequencePrimer 7atgcggccgc ttatcacaac
tcgtcgtgaa tacaagcgtt acgcagagac at 52850DNAArtificial
SequencePrimer 8acaactaatt attgaaagaa ttccgaaacg atgaggcagg
tttggttctc 50953DNAArtificial SequencePrimer 9atccagacga caatgagaag
aaattggagc agcagaagac acgttgaaaa aac 531027DNAArtificial
SequencePrimer 10cgtttcggaa ttctttcaat aattagt 271124DNAArtificial
SequencePrimer 11gctccaattt cttctcattg tcgt 241218DNAArtificial
SequencePrimer 12agccaatgca gaggaggc 181342DNAArtificial
SequencePrimer 13gcatcgtctc atcggtctca ttctgtgccg tgcccggtgc cg
421450DNAArtificial SequencePrimer 14atgccgtctc aggtctcagg
atccatagca ggtgccatcc acttccgcca 501548DNAArtificial SequencePrimer
15gcatcgtctc atcggtctca tatgagattc ccatctattt tcaccgct
481647DNAArtificial SequencePrimer 16atgccgtctc aggtctcaag
aaccaataca agcgttacgc agagaca 471745DNAArtificial SequencePrimer
17gcatcgtctc atcggtctca tatgaggcag gtttggttct cttgg
451850DNAArtificial SequencePrimer 18gcatcgtctc atcggtctca
ttcttgttct ggtccaacac caccaccacc 501960DNAArtificial SequencePrimer
19atgccgtctc aggtctcagg atccatagca aataccgtcg ccctcactca taatcacaga
602023DNAArtificial SequencePrimer 20ctcagatcca tgtcctcagt gct
232121DNAArtificial SequencePrimer 21gaggcagaag gcatatgcta c
212245DNAArtificial SequencePrimer 22atgccgtctc aggtctcagg
atccgtagca tatgccttct gcctc 452345DNAArtificial SequencePrimer
23gcatcgtctc atcggtctca ttctgatcca tgtcctcagt gctgc 45
* * * * *
References