U.S. patent application number 16/458843 was filed with the patent office on 2020-01-02 for treatment of inflammatory disorders in non-human mammals.
The applicant listed for this patent is THE REGENTS OF THE UNIVERSITY OF CALIFORNIA. Invention is credited to Alonso G. P. Guedes, Bruce D. Hammock, Christophe Morisseau.
Application Number | 20200000755 16/458843 |
Document ID | / |
Family ID | 49161663 |
Filed Date | 2020-01-02 |
![](/patent/app/20200000755/US20200000755A1-20200102-C00001.png)
![](/patent/app/20200000755/US20200000755A1-20200102-C00002.png)
![](/patent/app/20200000755/US20200000755A1-20200102-C00003.png)
![](/patent/app/20200000755/US20200000755A1-20200102-C00004.png)
![](/patent/app/20200000755/US20200000755A1-20200102-C00005.png)
![](/patent/app/20200000755/US20200000755A1-20200102-C00006.png)
![](/patent/app/20200000755/US20200000755A1-20200102-C00007.png)
![](/patent/app/20200000755/US20200000755A1-20200102-C00008.png)
![](/patent/app/20200000755/US20200000755A1-20200102-C00009.png)
![](/patent/app/20200000755/US20200000755A1-20200102-C00010.png)
![](/patent/app/20200000755/US20200000755A1-20200102-C00011.png)
View All Diagrams
United States Patent
Application |
20200000755 |
Kind Code |
A1 |
Guedes; Alonso G. P. ; et
al. |
January 2, 2020 |
TREATMENT OF INFLAMMATORY DISORDERS IN NON-HUMAN MAMMALS
Abstract
The present invention relates to the prevention, reduction,
inhibition and reversal of pain and inflammation in a non-human
mammal by administration of an inhibitor of soluble epoxide
hydrolase, as sole active agent or co-administered with other
active agents.
Inventors: |
Guedes; Alonso G. P.;
(Davis, CA) ; Hammock; Bruce D.; (Davis, CA)
; Morisseau; Christophe; (West Sacramento, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
THE REGENTS OF THE UNIVERSITY OF CALIFORNIA |
Oakland |
CA |
US |
|
|
Family ID: |
49161663 |
Appl. No.: |
16/458843 |
Filed: |
July 1, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14384910 |
Nov 21, 2014 |
10383835 |
|
|
PCT/US2013/029214 |
Mar 5, 2013 |
|
|
|
16458843 |
|
|
|
|
61610839 |
Mar 14, 2012 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 31/5415 20130101;
A61K 31/415 20130101; A61K 31/197 20130101; A61K 31/4152 20130101;
A61K 31/167 20130101; A61K 31/513 20130101; A61K 31/405 20130101;
A61K 31/451 20130101; A61K 31/17 20130101; A61K 45/06 20130101;
A61K 31/192 20130101; A61K 31/196 20130101; A61K 31/603 20130101;
A61K 31/17 20130101; A61K 2300/00 20130101; A61K 31/451 20130101;
A61K 2300/00 20130101; A61K 31/415 20130101; A61K 2300/00 20130101;
A61K 31/513 20130101; A61K 2300/00 20130101; A61K 31/196 20130101;
A61K 2300/00 20130101; A61K 31/167 20130101; A61K 2300/00 20130101;
A61K 31/603 20130101; A61K 2300/00 20130101; A61K 31/192 20130101;
A61K 2300/00 20130101; A61K 31/5415 20130101; A61K 2300/00
20130101; A61K 31/405 20130101; A61K 2300/00 20130101 |
International
Class: |
A61K 31/196 20060101
A61K031/196; A61K 31/167 20060101 A61K031/167; A61K 31/17 20060101
A61K031/17; A61K 31/192 20060101 A61K031/192; A61K 31/197 20060101
A61K031/197; A61K 31/405 20060101 A61K031/405; A61K 45/06 20060101
A61K045/06; A61K 31/4152 20060101 A61K031/4152; A61K 31/451
20060101 A61K031/451; A61K 31/513 20060101 A61K031/513; A61K
31/5415 20060101 A61K031/5415; A61K 31/603 20060101 A61K031/603;
A61K 31/415 20060101 A61K031/415 |
Goverment Interests
STATEMENT OF GOVERNMENTAL SUPPORT
[0002] This invention was made with government support under Grant
Nos. ES002710 and ES004699, awarded by the National Institutes of
Health. The government has certain rights in the invention.
Claims
1. A method of preventing, ameliorating, delaying the progression
and/or reversing the progression of an inflammatory condition in a
non-human mammal, comprising administering to the mammal an
inhibitor of soluble epoxide hydrolase (sEH).
2. A method of enhancing or maintaining the anti-inflammatory
efficacy and/or anti-nociceptive efficacy and reducing undesirable
side effects of a non-steroidal anti-inflammatory drug ("NSAID") in
a non-human mammal, comprising co-administering to the non-human
mammal in need thereof an inhibitor of soluble epoxide hydrolase
and the anti-inflammatory agent.
3. A method of preventing, ameliorating, delaying the progression
and/or reversing the progression of chronic pain in a non-human
mammal, comprising administering to the mammal an inhibitor of
soluble epoxide hydrolase (sEH).
4. A method of enhancing or maintaining the anti-nociceptive
efficacy on chronic or neuropathic pain and reducing undesirable
side effects of an active agent selected from the group consisting
of NSAIDs, Gamma-aminobutyric Acid (GABA) analogs,
phosphodiesterase inhibitors, N-methyl-D-aspartate receptor
antagonists, opioids and sodium channel blockers, or analogs or
pro-drugs thereof, in a non-human mammal, comprising
co-administering to the non-human mammal in need thereof an
inhibitor of soluble epoxide hydrolase and the active agent, or an
analog or pro-drug thereof.
5. The method of any one of claims 1 to 4, wherein the non-human
mammal is canine, feline, equine, bovine, ovine or porcine.
6. The method of any one of claims 1 to 5, wherein the non-human
mammal is an ungulate.
7. The method of claim 6, wherein the inflammatory condition is
laminitis.
8. The method of any one of claims 1 to 6, wherein the inflammatory
condition is selected from the group consisting of traumatic
injury, surgery, hip dysplasia, osteoarthritis and tendonitis.
9. The method of any one of claims 1 to 8, wherein the inflammatory
condition is acute.
10. The method of any one of claims 1 to 8, wherein the
inflammatory condition is chronic.
11. The method of any one of claims 1 to 10, wherein the non-human
mammal is further experiencing neuropathic and/or post-surgical
pain.
12. The method of any one of claims 1 to 11, wherein the inhibitor
of sEH comprises a primary pharmacophore selected from the group
consisting of a urea, a carbamate, and an amide.
13. The method of claim 12, wherein the inhibitor of sEH comprises
a cyclohexyl moiety, aromatic moiety, substituted aromatic moiety
or alkyl moiety attached to the pharmacophore.
14. The method of claim 12, wherein the inhibitor of sEH comprises
a cyclohexyl ether moiety attached to the pharmacophore.
15. The method of claim 12, wherein the inhibitor of sEH comprises
a phenyl ether or piperidine moiety attached to the
pharmacophore.
16. The method of any one of claims 1 to 15, wherein the inhibitor
of sEH comprises a polyether secondary pharmacophore.
17. The method of any one of claims 1 to 16, wherein the inhibitor
of sEH has an IC50 of less than about 100 .mu.M.
18. The method of any one of claims 1 to 17, wherein the inhibitor
of sEH is selected from the group consisting of: a)
3-(4-chlorophenyl)-1-(3,4-dichlorphenyl)urea or
3,4,4'-trichlorocarbanilide (TCC; compound 295); b)
12-(3-adamantan-1-yl-ureido) dodecanoic acid (AUDA; compound 700);
c) 1-adamantanyl-3-{5-[2-(2-ethoxyethoxy)ethoxy]pentyl]}urea (AEPU;
compound 950); d) 1-(1-acetylpiperidin-4-yl)-3-adamantanylurea
(APAU; compound 1153); e)
trans-4-[4-(3-Adamantan-1-yl-ureido)-cyclohexyloxy]-benzoic acid
(tAUCB; compound 1471); f)
cis-4-[4-(3-Adamantan-1-yl-ureido)-cyclohexyloxy]-benzoic acid
(cAUCB; compound 1686); g)
1-(1-methylsulfonyl-piperidin-4-yl)-3-(4-trifluoromethoxy-phenyl)-urea
(TUPS; compound 1709); h)
trans-4-{4-[3-(4-Trifluoromethoxy-phenyl)-ureido]-cyclohexyloxy}-benzoic
acid (tTUCB; compound 1728); i)
1-trifluoromethoxyphenyl-3-(1-propionylpiperidin-4-yl) urea (TPPU;
compound 1770); j)
1-(1-ethylsulfonyl-piperidin-4-yl)-3-(4-trifluoromethoxy-phenyl)-urea
(TUPSE; compound 2213) k)
1-(1-(cyclopropanecarbonyl)piperidin-4-yl)-3-(4-(trifluoromethoxy)phenyl)-
urea (CPTU; compound 2214); l)
trans-N-methyl-4-[4-(3-Adamantan-1-yl-ureido)-cyclohexyloxy]-benzamide
(tMAUCB; compound 2225) m)
trans-N-methyl-4-[4-((3-trifluoromethyl-4-chlorophenyl)-ureido)-cyclohexy-
loxy]-benzamide (tMTCUCB; compound 2226); n)
cis-N-methyl-4-{4-[3-(4-trifluoromethoxy-phenyl)-ureido]-cyclohexyloxy}-b-
enzamide (cMTUCB; compound 2228); and o)
1-cycloheptyl-3-(3-(1,5-diphenyl-1H-pyrazol-3-yl)propyl)urea
(HDP3U; compound 2247).
19. The method of any one of claims 1 to 18, wherein the inhibitor
of sEH is selected from the group consisting of: a)
3-(4-chlorophenyl)-1-(3,4-dichlorphenyl)urea or
3,4,4'-trichlorocarbanilide (TCC; compound 295); b)
12-(3-adamantan-1-yl-ureido) dodecanoic acid (AUDA; compound 700);
c) 1-adamantanyl-3-{5-[2-(2-ethoxyethoxy)ethoxy]pentyl]}urea (AEPU;
compound 950); d) 1-(1-acetylpiperidin-4-yl)-3-adamantanylurea
(APAU; compound 1153); e)
trans-4-[4-(3-Adamantan-1-yl-ureido)-cyclohexyloxy]-benzoic acid
(tAUCB; compound 1471); f)
cis-4-[4-(3-Adamantan-1-yl-ureido)-cyclohexyloxy]-benzoic acid
(cAUCB; compound 1686); g)
trans-4-{4-[3-(4-Trifluoromethoxy-phenyl)-ureido]-cyclohexyloxy}-benzoic
acid (tTUCB; compound 1728); h)
trans-N-methyl-4-[4-(3-Adamantan-1-yl-ureido)-cyclohexyloxy]-benzamide
(tMAUCB; compound 2225) i)
trans-N-methyl-4-[4-((3-trifluoromethyl-4-chlorophenyl)-ureido)-cyclohexy-
loxy]-benzamide (tMTCUCB; compound 2226); j)
cis-N-methyl-4-{4-[3-(4-trifluoromethoxy-phenyl)-ureido]-cyclohexyloxy}-b-
enzamide (cMTUCB; compound 2228); and k)
1-cycloheptyl-3-(3-(1,5-diphenyl-1H-pyrazol-3-yl)propyl)urea
(HDP3U; compound 2247).
20. The method of any one of claims 1 to 17, wherein the inhibitor
of sEH is selected from the group consisting of: a)
trans-4-[4-(3-Adamantan-1-yl-ureido)-cyclohexyloxy]-benzoic acid
(tAUCB; compound 1471); b)
4-{4-[3-(4-Trifluoromethoxy-phenyl)-ureido]-cyclohexyloxy}-benzoic
acid (tTUCB; compound 1728); c)
1-trifluoromethoxyphenyl-3-(1-propionylpiperidin-4-yl) urea (TPPU;
compound 1770); d)
trans-2-(4-(4-(3-(4-trifluoromethoxy-phenyl)-ureido)-cyclohexyloxy)-benza-
mido)-acetic acid (compound 2283); e)
N-(methylsulfonyl)-4-(trans-4-(3-(4-trifluoromethoxy-phenyl)-ureido)-cycl-
ohexyloxy)-benzamide (compound 2728); f)
1-(trans-4-(4-(1H-tetrazol-5-yl)-phenoxy)-cyclohexyl)-3-(4-(trifluorometh-
oxy)-phenyl)-urea (compound 2806); g)
4-(trans-4-(3-(2-fluorophenyl)-ureido)-cyclohexyloxy)-benzoic acid
(compound 2736); h)
4-(4-(3-(4-(trifluoromethoxy)-phenyl)-ureido)-phenoxy)-benzoic acid
(compound 2803); i)
4-(3-fluoro-4-(3-(4-(trifluoromethoxy)-phenyl)-ureido)-phenoxy)-benzoic
acid (compound 2807); j)
N-hydroxy-4-(trans-4-(3-(4-(trifluoromethoxy)-phenyl)-ureido)-cyclohexylo-
xy)-benzamide (compound 2761); k)
(5-methyl-2-oxo-1,3-dioxol-4-yl)methyl
4-((1r,4r)-4-(3-(4-(trifluoromethoxy)-phenyl)-ureido)-cyclohexyloxy)-benz-
oate (compound 2796); l)
1-(4-oxocyclohexyl)-3-(4-(trifluoromethoxy)-phenyl)-urea (compound
2809); m) methyl
4-(4-(3-(4-(trifluoromethoxy)-phenyl)-ureido)-cyclohexylamino)--
benzoate (compound 2804); n)
1-(4-(pyrimidin-2-yloxy)-cyclohexyl)-3-(4-(trifluoromethoxy)-phenyl)-urea
(compound 2810); and o)
4-(trans-4-(3-(4-(difluoromethoxy)-phenyl)-ureido)-cyclohexyloxy)-benzoic
acid (compound 2805).
21. The method of any one of claims 1 to 20, wherein a
non-steroidal anti-inflammatory drug (NSAID) was previously
administered and wherein the NSAID did not prevent, ameliorate,
delay or reverse progression of the inflammatory and/or neuropathic
pain condition.
22. The method of any one of claims 1 to 21, where the inhibitor of
sEH is co-administered with one or more NSAIDs.
23. The method of claim 22, wherein one or both of the inhibitor of
sEH and the NSAID is administered in a sub-therapeutic amount.
24. The method of any one of claims 1 to 23, wherein the NSAID
inhibits one or more enzymes selected from the group consisting of
cyclo-oxygenase ("COX")-1, COX-2, and 5-lipoxygenase ("5-LOX").
25. The method of any one of claims 1 to 24, wherein the NSAID is
selected from the group consisting of flunixin meglumine,
phenylbutazone, aspirin, acetaminophen, diclofenac potassium,
diclofenac sodium, diclofenac sodium with misoprostol, diflunisal,
dipyrone, ketorolac, etodolac, fenoprofen calcium, flurbiprofen,
ibuprofen, indomethacin, ketoprofen, vedaprofen, meclofenamate
sodium, mefenamic acid, meloxicam, carprofen, nabumetone, naproxen
sodium, piroxicam, tolmetin sodium, magnesium salicylate, choline
salicylate, salsalate, sodium salicylate, alkyl salicylate and
disalicylate.
26. The method of any one of claims 1 to 24, wherein the NSAID is a
selective inhibitor of COX-2.
27. The method of claim 26, wherein the selective inhibitor of
COX-2 is selected from the group consisting of celecoxib,
valdecoxib, lumiracoxib, etoricoxib, rofecoxib, deracoxib and
firocoxib.
28. The method of any one of claims 22 to 27, wherein one or both
of the inhibitor of sEH and the NSAID are administered in a
sub-therapeutic amount.
29. The method of any one of claims 21 to 28, wherein a dual
inhibitor of sEH and COX-2 is administered.
30. The method of any one of claims 4 to 29, wherein an active
agent selected from the group consisting of Gamma-aminobutyric Acid
(GABA) analogs, N-methyl-D-aspartate receptor antagonists,
phosphodiesterase inhibitors, opioids and sodium channel blockers,
or analogs or pro-drugs thereof, was previously administered and
wherein the active agent did not prevent, ameliorate, delay or
reverse the inflammatory and/or neuropathic pain condition.
31. The method of any one of claims 1 to 30, wherein the inhibitor
of sEH is co-administered with an active agent selected from the
group consisting of Gamma-aminobutyric Acid (GABA) analogs,
N-methyl-D-aspartate receptor antagonists, phosphodiesterase
inhibitors, opioids and sodium channel blockers, or analogs or
pro-drugs thereof.
32. The method of claim 31, wherein the GABA analog is selected
from the group consisting of gabapentin, pregabalin, and analogs or
pro-drugs thereof.
33. The method of any one of claims 1 to 31, wherein the inhibitor
of sEH is co-administered with an N-methyl-D-aspartate receptor
antagonist, or an analog or pro-drug thereof.
34. The method of claim 33, wherein the N-methyl-D-aspartate
receptor antagonist is selected from the group consisting of: AP5
(APV, R-2-amino-5-phosphonopentanoate); AP7
(2-amino-7-phosphonoheptanoic acid); CPPene
(3-[(R)-2-carboxypiperazin-4-yl]-prop-2-enyl-1-phosphonic acid);
Selfotel; Amantadine; Dextrallorphan; Dextromethorphan;
Dextrorphan; Dizocilpine (MK-801); Eticyclidine; Gacyclidine;
Ibogaine; Memantine; Methoxetamine; Nitrous oxide; Phencyclidine;
Rolicyclidine; Tenocyclidine; Methoxydine; Tiletamine; Xenon;
Neramexane; Eliprodil; Etoxadrol; Dexoxadrol; NEFA
((4aR,9aS)--N-Ethyl-4,4a,9,9a-tetrahydro-1H-fluoren-4a-amine);
Remacemide; Delucemine; 8a-Phenyldecahydroquinoline (8A-PDHQ);
Aptiganel (Cerestat, CNS-1102); Dexanabinol (HU-211);
Rhynchophylline; and Ketamine.
35. The method of any one of claims 1 to 31, wherein the inhibitor
of sEH is co-administered with an opioid, or an analog or pro-drug
thereof.
36. The method of claim 30, wherein the opioid is selected from the
group consisting of morphine, codeine, thebaine, heroin,
hydromorphone, hydrocodone, oxycodone, oxymorphone, desomorphine,
nicomorphine, dipropanoylmorphine, benzylmorphine, ethylmorphine,
buprenorphine, fentanyl, pethidine, methadone, tramadol and
dextropropoxyphene.
37. The method of any one of claims 1 to 31, wherein the inhibitor
of sEH is co-administered with a sodium channel blockers, or an
analog or pro-drug thereof.
38. The method of claim 37, wherein the sodium channel blocker is
selected from the group consisting of tetrodotoxin (TTX), saxitoxin
(STX), Benzocaine, Chloroprocaine, Cocaine, Cyclomethycaine,
Dimethocaine/Larocaine, Piperocaine, Propoxycaine,
Procaine/Novocaine, Proparacaine, Tetracaine/Amethocaine,
Articaine, Bupivacaine, Cinchocaine/Dibucaine, Etidocaine,
Levobupivacaine, Lidocaine/Lignocaine, Mepivacaine, Prilocaine,
Ropivacaine, Trimecaine, and Lidocaine/prilocaine (EMLA),
quinidine, procainamide, disopryamide, tocainide, mexiletine,
flecainide, propafenone, moricizine, Carbamazepine, Phenytoin,
Fosphenytoin, Oxcarbazepine, Lamotrigine, and Zonisamide.
39. The method of any one of claims 1 to 31, wherein the inhibitor
of sEH is co-administered with a phosphodiesterase inhibitor, or an
analog or pro-drug thereof.
40. The method of claim 39, wherein the phosphodiesterase inhibitor
is selected from the group consisting of rolipram, roflumilast,
cilomilast, ariflo, HT0712, ibudilast, mesembrine, cilostamide,
enoxamone, milrinone, siguazodan, BRL-50481, sildenafil, zaprinast,
tadalafil, udenafil, avanafil and vardenafil.
41. The method of any one of claims 31 to 40, wherein one or more
of the inhibitor of sEH and the active agent selected from the
group consisting of Gamma-aminobutyric Acid (GABA) analogs,
N-methyl-D-aspartate receptor antagonists, phosphodiesterase
inhibitors, opioids and sodium channel blockers, or analogs or
pro-drugs thereof, are administered in a sub-therapeutic amount.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 14/384,910, filed Nov. 21, 2014, which is a 35 USC .sctn. 371
National Stage application of International Application No.
PCT/US2013/029214, filed Mar. 5, 2013, which claims the benefit
under 35 U.S.C. .sctn. 119(e) of U.S. Provisional Appl. Ser. No.
61/610,839, filed on Mar. 14, 2012, each of which is hereby
incorporated herein by reference in its entirety for all
purposes.
REFERENCE TO A "SEQUENCE LISTING", A COMPUTER PROGRAM LISTING
APPENDIX SUBMITTED ON AS AN ASCII TEXT FILE
[0003] The instant application contains a Sequence Listing which
has been submitted electronically in ASCHII format and is hereby
incorporated by reference in its entirety. Said ASCHII copy,
created on Sep. 12, 2014, is named UCDVP080WO_SL.txt.
FIELD
[0004] The present invention relates to the prevention, reduction,
inhibition and reversal of pain and inflammation in a non-human
mammal by administration of an inhibitor of soluble epoxide
hydrolase, as sole active agent or co-administered with other
active agents.
BACKGROUND
[0005] Laminitis is an extremely painful condition of the foot in
horses. Its pathophysiology remains poorly understood, but involves
both vascular and inflammatory events within the hoof leading to
disruption of the lamellar dermo-epidermal junction, impaired
biomechanical function, pain and substantial suffering (Hood et al.
1993; Hood 1999; Sumano Lopez et al. 1999; Parks & O'Grady
2003; Driessen et al. 2010). Ischemia and inflammation in the early
stages of laminitis likely cause neuronal injury that eventually
shifts the acute inflammatory pain into a chronic syndrome with a
prominent neuropathic component (Moalem & Tracey 2006; Peroni
et al. 2006; Belknap et al. 2007; Jones et al. 2007). The precise
timing and nature of these events remain elusive. The response to
treatment can be quite unpredictable. Such complexity makes pain
management in horses with laminitis one of the biggest challenges
in equine practice. Non-steroidal anti-inflammatory drugs (NSAID)
are the mainstay analgesics for this condition. However, abridged
efficacy against neuropathic pain and risks of dose-dependent
gastrointestinal and renal adverse effects are significant
limitations of these compounds (Sumano Lopez et al. 1999; Taylor et
al. 2002; Driessen et al. 2010). These constraints often leave
euthanasia as the only humane alternative to alleviate pain and
suffering in affected horses (Driessen et al. 2010). This clearly
underscores the need for the development of more efficacious and
safer analgesics.
[0006] The oxidative metabolism of polyunsaturated fatty acids
(PUFAs) such as arachidonic acid (ARA), docosahexaenoic acid (DHA),
eicosapentaenoic acid (EPA) and linoleic acid (LNA) produces potent
inflammatory mediators. Most of the analgesic research and drug
development has focused on inhibiting ARA derivatives formed by
cyclooxygenases (COX) (Tokuyama & Nakamoto 2011). Cytochrome
P450 enzymes mediate another critical yet relatively unexplored
pathway of PUFAs metabolism. This pathway transforms PUFAs into
various biologically active compounds, including epoxy-fatty acids
(EFAs or epoxides), such as epoxy-eicosatrienoic acids (EETs), or
hydroxyl derivatives, such as hydroxy-eicosatetraenoic acids
(HETEs) (Wagner et al. 2011b). These EFAs have multiple biological
activities including the modulation of inflammation and nociceptive
signaling (Murakami 2011). The biological activity of these
epoxides is restricted as they are metabolized to the corresponding
diols by the soluble epoxide hydrolases (sEH) (Wagner et al.
2011a). This has been confirmed with the development and use of sEH
inhibitors (sEHis) (Morisseau & Hammock 2005; Hwang et al.
2007) in conditions involving several body systems and functions
(Revermann 2010). The microsomal (mEH) and soluble (sEH) epoxide
hydrolases were first thought to play a role in xenobiotic
metabolism in mammalian tissues. Even though this is largely true
for mEH, sEH has a minor role in xenobiotic metabolism. The major
function of sEH is the degradation of endogenous lipid metabolites
(Morisseau & Hammock 2008; Decker et al. 2009).
SUMMARY
[0007] In one aspect, the invention provides methods of preventing,
ameliorating, delaying the progression and/or reversing the
progression of an inflammatory condition in a non-human mammal. In
some embodiments, the methods comprise administering to the mammal
an agent that increases EETs (e.g., an inhibitor of soluble epoxide
hydrolase (sEH), an EET, an epoxygenated fatty acid, and mixtures
thereof).
[0008] In another aspect, the invention provides methods of
enhancing or maintaining the anti-inflammatory efficacy and/or anti
nociceptive efficacy and reducing undesirable side effects of a
NSAID in a non-human mammal. In some embodiments, the methods
comprise co-administering to the non-human mammal in need thereof
the NSAID and an agent that increases EETs (e.g., an inhibitor of
sEH, an EET, an epoxygenated fatty acid, and mixtures thereof) and
the anti-inflammatory agent. One or both of the NSAID and the agent
that increases EETs can be administered in a sub-therapeutic
amount.
[0009] In another aspect, the invention provides methods of
preventing, ameliorating, delaying the progression and/or reversing
the progression of chronic pain in a non-human mammal. In some
embodiments, the methods comprise administering to the mammal an
agent that increases EETs (e.g., an inhibitor of sEH, an EET, an
epoxygenated fatty acid, and mixtures thereof).
[0010] In another aspect, the invention provides methods of
enhancing or maintaining the anti-nociceptive efficacy on chronic
pain and/or neuropathic pain and reducing undesirable side effects
of an active agent selected from the group consisting of NSAIDS,
phosphodiesterase inhibitors, Gamma-aminobutyric Acid (GABA)
analogs, N-methyl-D-aspartate receptor antagonists, opioids and
sodium channel blockers, or analogs or pro-drugs thereof, in a
non-human mammal, comprising co-administering to the non-human
mammal in need thereof an inhibitor of soluble epoxide hydrolase
and the active agent, or an analog or pro-drug thereof. One or both
of the active agent and the inhibitor of soluble epoxide hydrolase
can be administered in a sub-therapeutic amount.
[0011] In some embodiments, the non-human mammal is canine, feline,
equine, bovine, ovine or porcine. In some embodiments, the
non-human mammal is canine or feline. In some embodiments, the
non-human mammal is an ungulate (e.g., equine, bovine, ovine or
porcine). In some embodiments, the non-human mammal is equine. In
some embodiments, the inflammatory condition is laminitis.
[0012] In some embodiments, the inflammatory condition is selected
from the group consisting of injury and/or recovery from injury,
surgery and/or recovery from surgery, hip dysplasia, osteoarthritis
and tendonitis. In some embodiments, the non-human mammal is
experiencing inflammatory and/or neuropathic pain, and/or any
disease state or condition (e.g., post-surgical trauma) that is
associated with inflammation and/or pain.
[0013] In another aspect, the invention provides methods for
preventing, ameliorating, delaying the progression and/or reversing
the progression of laminitis in an equine. In some embodiments, the
methods comprise administering to the mammal an agent that
increases EETs (e.g., an inhibitor of soluble epoxide hydrolase
(sEH), an EET, an epoxygenated fatty acid, and mixtures thereof).
In various embodiments, the agent that increases EETs is
co-administered with an anti-inflammatory agent (e.g., an NSAID, a
phosphodiesterase inhibitor) and/or a Gamma-aminobutyric Acid
(GABA) analog and/or a sodium channel blocker (e.g., amantadine,
gabapentin or pregabalin, lidocaine, or analogs or pro-drugs
thereof).
[0014] In some embodiments, an inhibitor of sEH is administered. In
some embodiments, the inhibitor of sEH comprises a primary
pharmacophore selected from the group consisting of a urea, a
carbamate, and an amide. In varying embodiments, the inhibitor of
sEH comprises a cyclohexyl moiety, aromatic moiety, substituted
aromatic moiety or alkyl moiety attached to the pharmacophore. In
some embodiments, the inhibitor of sEH comprises a cyclohexyl ether
moiety attached to the pharmacophore. In some embodiments, the
inhibitor of sEH comprises a phenyl ether or piperidine moiety
attached to the pharmacophore. In some embodiments, the inhibitor
of sEH comprises a polyether secondary pharmacophore. In some
embodiments, the inhibitor of sEH has an IC50 of less than about
100 .mu.M, for example, an IC.sub.50 of less than about 75 .mu.M,
50 .mu.M, 25 .mu.M, 10 .mu.M, 1 .mu.M, 100 nM, 10 nM or 1 nM. As
appropriate, the IC50 for inhibition of sEH is determined with
respect to the sEH enzyme from the same species as the non-human
mammal receiving the inhibitor of sEH (e.g., IC50 for inhibition of
sEH is determined with respect to the species subject to treatment,
e.g., with respect to the sEH enzyme from equine, bovine, ovine,
porcine, canine, feline, etc., for subjects who are equine, bovine,
ovine, porcine, canine, feline, respectively).
[0015] In some embodiments, the inhibitor of sEH is selected from
the group consisting of: [0016] a)
3-(4-chlorophenyl)-1-(3,4-dichlorphenyl)urea or
3,4,4'-trichlorocarbanilide (TCC; compound 295); [0017] b)
12-(3-adamantan-1-yl-ureido) dodecanoic acid (AUDA; compound 700);
[0018] c) 1-adamantanyl-3-{5-[2-(2-ethoxyethoxy)ethoxy]pentyl]}urea
(AEPU; compound 950); [0019] d)
1-(1-acetylpiperidin-4-yl)-3-adamantanylurea (APAU; compound 1153);
[0020] e)
trans-4-[4-(3-Adamantan-1-yl-ureido)-cyclohexyloxy]-benzoic acid
(tAUCB; compound 1471); [0021] f)
cis-4-[4-(3-Adamantan-1-yl-ureido)-cyclohexyloxy]-benzoic acid
(cAUCB; compound 1686); [0022] g)
1-(1-methylsulfonyl-piperidin-4-yl)-3-(4-trifluoromethoxy-phenyl)-urea
(TUPS; compound 1709); [0023] h)
trans-4-{4-[3-(4-Trifluoromethoxy-phenyl)-ureido]-cyclohexyloxy}-benzoic
acid (tTUCB; compound 1728); [0024] i)
1-trifluoromethoxyphenyl-3-(1-propionylpiperidin-4-yl) urea (TPPU;
compound 1770); [0025] j)
1-(1-ethylsulfonyl-piperidin-4-yl)-3-(4-trifluoromethoxy-phenyl)-urea
(TUPSE; compound 2213) [0026] k)
1-(1-(cyclopropanecarbonyl)piperidin-4-yl)-3-(4-(trifluoromethoxy)phenyl)-
urea (CPTU; compound 2214); [0027] l)
trans-N-methyl-4-[4-(3-Adamantan-1-yl-ureido)-cyclohexyloxy]-benzamide
(tMAUCB; compound 2225) [0028] m)
trans-N-methyl-4-[4-((3-trifluoromethyl-4-chlorophenyl)-ureido)-cyclohexy-
loxy]-benzamide (tMTCUCB; compound 2226); [0029] n)
cis-N-methyl-4-{4-[3-(4-trifluoromethoxy-phenyl)-ureido]-cyclohexyloxy}-b-
enzamide (cMTUCB; compound 2228); and [0030] o)
1-cycloheptyl-3-(3-(1,5-diphenyl-1H-pyrazol-3-yl)propyl)urea
(HDP3U; compound 2247).
[0031] In some embodiments, the inhibitor of sEH is selected from
the group consisting of: [0032] a)
3-(4-chlorophenyl)-1-(3,4-dichlorphenyl)urea or
3,4,4'-trichlorocarbanilide (TCC; compound 295); [0033] b)
12-(3-adamantan-1-yl-ureido) dodecanoic acid (AUDA; compound 700);
[0034] c) 1-adamantanyl-3-{5-[2-(2-ethoxyethoxy)ethoxy]pentyl]}urea
(AEPU; compound 950); [0035] d)
1-(1-acetylpiperidin-4-yl)-3-adamantanylurea (APAU; compound 1153);
[0036] e)
trans-4-[4-(3-Adamantan-1-yl-ureido)-cyclohexyloxy]-benzoic acid
(tAUCB; compound 1471); [0037] f)
cis-4-[4-(3-Adamantan-1-yl-ureido)-cyclohexyloxy]-benzoic acid
(cAUCB; compound 1686); [0038] g)
trans-4-{4-[3-(4-Trifluoromethoxy-phenyl)-ureido]-cyclohexyloxy}-benzoic
acid (tTUCB; compound 1728); [0039] h)
trans-N-methyl-4-[4-(3-Adamantan-1-yl-ureido)-cyclohexyloxy]-benzamide
(tMAUCB; compound 2225) [0040] i)
trans-N-methyl-4-[4-((3-trifluoromethyl-4-chlorophenyl)-ureido)-cyclohexy-
loxy]-benzamide (tMTCUCB; compound 2226); [0041] j)
cis-N-methyl-4-{4-[3-(4-trifluoromethoxy-phenyl)-ureido]-cyclohexyloxy}-b-
enzamide (cMTUCB; compound 2228); and [0042] k)
1-cycloheptyl-3-(3-(1,5-diphenyl-1H-pyrazol-3-yl)propyl)urea
(HDP3U; compound 2247).
[0043] In some embodiments, the inhibitor of sEH is selected from
the group consisting of: [0044] a)
trans-4-[4-(3-Adamantan-1-yl-ureido)-cyclohexyloxy]-benzoic acid
(tAUCB; compound 1471); [0045] b)
4-{4-[3-(4-Trifluoromethoxy-phenyl)-ureido]-cyclohexyloxy}-benzoic
acid (tTUCB; compound 1728); [0046] c)
1-trifluoromethoxyphenyl-3-(1-propionylpiperidin-4-yl) urea (TPPU;
compound 1770); [0047] d)
trans-2-(4-(4-(3-(4-trifluoromethoxy-phenyl)-ureido)-cyclohexyloxy)-benza-
mido)-acetic acid (compound 2283); [0048] e)
N-(methylsulfonyl)-4-(trans-4-(3-(4-trifluoromethoxy-phenyl)-ureido)-cycl-
ohexyloxy)-benzamide (compound 2728); [0049] f)
1-(trans-4-(4-(1H-tetrazol-5-yl)-phenoxy)-cyclohexyl)-3-(4-(trifluorometh-
oxy)-phenyl)-urea (compound 2806); [0050] g)
4-(trans-4-(3-(2-fluorophenyl)-ureido)-cyclohexyloxy)-benzoic acid
(compound 2736); [0051] h)
4-(4-(3-(4-(trifluoromethoxy)-phenyl)-ureido)-phenoxy)-benzoic acid
(compound 2803); [0052] i)
4-(3-fluoro-4-(3-(4-(trifluoromethoxy)-phenyl)-ureido)-phenoxy)-benzoic
acid (compound 2807); [0053] j)
N-hydroxy-4-(trans-4-(3-(4-(trifluoromethoxy)-phenyl)-ureido)-cyclohexylo-
xy)-benzamide (compound 2761); [0054] k)
(5-methyl-2-oxo-1,3-dioxol-4-yl)methyl
4-((1r,4r)-4-(3-(4-(trifluoromethoxy)-phenyl)-ureido)-cyclohexyloxy)-benz-
oate (compound 2796); [0055] l)
1-(4-oxocyclohexyl)-3-(4-(trifluoromethoxy)-phenyl)-urea (compound
2809); [0056] m) methyl
4-(4-(3-(4-(trifluoromethoxy)-phenyl)-ureido)-cyclohexylamino)-benzoate
(compound 2804); [0057] n)
1-(4-(pyrimidin-2-yloxy)-cyclohexyl)-3-(4-(trifluoromethoxy)-phenyl)-urea
(compound 2810); and [0058] o)
4-(trans-4-(3-(4-(difluoromethoxy)-phenyl)-ureido)-cyclohexyloxy)-benzoic
acid (compound 2805).
[0059] In some embodiments, a non-steroidal anti-inflammatory drug
(NSAID) was previously administered and the NSAID did not prevent,
sufficiently ameliorate, delay or reverse progression of the
inflammatory and/or neuropathic pain condition.
[0060] In some embodiments, the agent that increases EETs (e.g., an
inhibitor of sEH, an EET, an epoxygenated fatty acid, and mixtures
thereof) is co-administered with one or more NSAIDs. In some
embodiments, the NSAID inhibits one or more enzymes selected from
the group consisting of cyclo-oxygenase ("COX")-1, COX-2, and 5
lipoxygenase ("5-LOX"). In some embodiments, the NSAID is selected
from the group consisting of flunixin meglumine, phenylbutazone,
aspirin, acetaminophen, diclofenac potassium, diclofenac sodium,
diclofenac sodium with misoprostol, diflunisal, dipyrone,
ketorolac, etodolac, tepoxalin, fenoprofen calcium, flurbiprofen,
ibuprofen, indomethacin, ketoprofen, vedaprofen, meclofenamate
sodium, mefenamic acid, tolfenamic acid, meloxicam, carprofen,
nabumetone, naproxen sodium, piroxicam, tolmetin sodium, magnesium
salicylate, choline salicylate, salsalate, sodium salicylate, alkyl
salicylate and disalicylate. In some embodiments, the NSAID is a
selective inhibitor of COX-2. In some embodiments, the selective
inhibitor of COX-2 is selected from the group consisting of
celecoxib, valdecoxib, lumiracoxib, etoricoxib, rofecoxib,
robenacoxib, deracoxib and firocoxib. In some embodiments, one or
both of the inhibitor of sEH and the NSAID are administered in a
sub-therapeutic amount. In some embodiments, a dual inhibitor of
sEH and COX-2 is administered.
[0061] In some embodiments, an active agent selected from the group
consisting of phosphodiesterase inhibitors, Gamma-aminobutyric Acid
(GABA) analogs, N-methyl-D-aspartate receptor antagonists, opioids
and sodium channel blockers, or analogs or pro-drugs thereof, was
previously administered and the active agent did not prevent,
sufficiently ameliorate, delay or reverse the inflammatory and/or
neuropathic pain condition. In some embodiments, a
Gamma-aminobutyric Acid (GABA) analog (e.g., gabapentin or
pregabalin, or analogs or pro-drugs thereof) was previously
administered and the GABA analog did not prevent, ameliorate, delay
or reverse the inflammatory and/or neuropathic pain condition.
[0062] In some embodiments, the inhibitor of sEH is co-administered
with an active agent selected from the group consisting of NSAIDS,
phosphodiesterase inhibitors, Gamma-aminobutyric Acid (GABA)
analogs, N-methyl-D-aspartate receptor antagonists, opioids and
sodium channel blockers, or analogs or pro-drugs thereof. One or
both of the inhibitor of sEH and the active agent can be
administered in a sub-therapeutic amount.
[0063] In some embodiments, the inhibitor of sEH is co-administered
with a Gamma-aminobutyric Acid (GABA) analog, or analogs or
pro-drugs thereof. In some embodiments, the GABA analog is selected
from the group consisting of gabapentin, pregabalin, and analogs or
pro-drugs thereof. In some embodiments, one or both of the
inhibitor of sEH and the Gamma-aminobutyric Acid (GABA) analog
(e.g., gabapentin or pregabalin, or analogs or pro-drugs thereof),
are administered in a sub-therapeutic amount.
[0064] In some embodiments, the inhibitor of sEH is co-administered
with an N-methyl-D-aspartate receptor antagonist, or an analog or
pro-drug thereof. In some embodiments, the N-methyl-D-aspartate
receptor antagonist is selected from the group consisting of: AP5
(APV, R-2-amino-5-phosphonopentanoate); AP7
(2-amino-7-phosphonoheptanoic acid); CPPene
(3-[(R)-2-carboxypiperazin-4-yl]-prop-2-enyl-1-phosphonic acid);
Selfotel; Amantadine; Dextrallorphan; Dextromethorphan;
Dextrorphan; Dizocilpine (MK-801); Eticyclidine; Gacyclidine;
Ibogaine; Memantine; Methoxetamine; Nitrous oxide; Phencyclidine;
Rolicyclidine; Tenocyclidine; Methoxydine; Tiletamine; Xenon;
Neramexane; Eliprodil; Etoxadrol; Dexoxadrol; NEFA
((4aR,9aS)--N-Ethyl-4,4a,9,9a-tetrahydro-1H-fluoren-4a-amine);
Remacemide; Delucemine; 8a-Phenyldecahydroquinoline (8A-PDHQ);
Aptiganel (Cerestat, CNS-1102); Dexanabinol (HU-211);
Rhynchophylline; and Ketamine.
[0065] In some embodiments, the inhibitor of sEH is co-administered
with an opioid, or an analog or pro-drug thereof. In some
embodiments, the opioid is selected from the group consisting of
morphine, codeine, thebaine, heroin, hydromorphone, hydrocodone,
oxycodone, oxymorphone, desomorphine, nicomorphine,
dipropanoylmorphine, benzylmorphine, ethylmorphine, buprenorphine,
fentanyl, pethidine, methadone, tramadol and
dextropropoxyphene.
[0066] In some embodiments, the inhibitor of sEH is co-administered
with a sodium channel blockers, or an analog or pro-drug thereof.
In some embodiments, the sodium channel blocker is selected from
the group consisting of tetrodotoxin (TTX), saxitoxin (STX),
Benzocaine, Chloroprocaine, Cocaine, Cyclomethycaine,
Dimethocaine/Larocaine, Piperocaine, Propoxycaine,
Procaine/Novocaine, Proparacaine, Tetracaine/Amethocaine,
Articaine, Bupivacaine, Cinchocaine/Dibucaine, Etidocaine,
Levobupivacaine, Lidocaine/Lignocaine, Mepivacaine, Prilocaine,
Ropivacaine, Trimecaine, and Lidocaine/prilocaine (EMLA),
quinidine, procainamide, disopryamide, tocainide, mexiletine,
flecainide, propafenone, moricizine, Carbamazepine, Phenytoin,
Fosphenytoin, Oxcarbazepine, Lamotrigine, and Zonisamide.
[0067] In some embodiments, the inhibitor of sEH is co-administered
with a phosphodiesterase inhibitor, or an analog or pro-drug
thereof. In varying embodiments, the phosphodiesterase inhibitor is
selected from the group consisting of rolipram, roflumilast,
cilomilast, ariflo, HT0712, ibudilast, mesembrine, cilostamide,
enoxamone, milrinone, siguazodan, BRL-50481, sildenafil, zaprinast,
tadalafil, udenafil, avanafil and vardenafil.
[0068] In various embodiments, the one or more of the inhibitor of
sEH and the active agent selected from the group consisting of
phosphodiesterase inhibitors, Gamma-aminobutyric Acid (GABA)
analogs, N methyl-D-aspartate receptor antagonists, opioids and
sodium channel blockers, or analogs or pro-drugs thereof, are
administered in a sub-therapeutic amount.
Definitions
[0069] Units, prefixes, and symbols are denoted in their Systeme
International de Unites (SI) accepted form. Numeric ranges are
inclusive of the numbers defining the range. Unless otherwise
indicated, nucleic acids are written left to right in 5' to 3'
orientation; amino acid sequences are written left to right in
amino to carboxy orientation. The headings provided herein are not
limitations of the various aspects or embodiments, which can be had
by reference to the specification as a whole. Accordingly, the
terms defined immediately below are more fully defined by reference
to the specification in its entirety. Terms not defined herein have
their ordinary meaning as understood by a person of skill in the
art.
[0070] "cis-Epoxyeicosatrienoic acids" ("EETs") and the
corresponding epoxides of 18:2 omega-6 and omega-3 lipids such as
EPA and DHA are biomediators synthesized by cytochrome P450
epoxygenases. As discussed further in a separate section below,
while the use of unmodified EETs is the most preferred, derivatives
of EETs, such as amides and esters (both natural and synthetic),
EET analogs, and EET optical isomers can all be used in the
methods, both in pure form and as mixtures of these forms. For
convenience of reference, the term "EETs" as used herein refers to
all of these forms unless otherwise required by context.
[0071] "Epoxide hydrolases" ("EH;" EC 3.3.2.3) are enzymes in the
alpha beta hydrolase fold family that add water to 3-membered
cyclic ethers termed epoxides. The addition of water to the
epoxides results in the corresponding 1,2-diols (Hammock, B. D. et
al., in Comprehensive Toxicology: Biotransformation (Elsevier, New
York), pp. 283-305 (1997); Oesch, F. Xenobiotica 3:305-340 (1972)).
Four principal EH's are known: leukotriene epoxide hydrolase,
cholesterol epoxide hydrolase, microsomal EH ("mEH"), and soluble
EH ("sEH," EH2, previously called cytosolic EH). A mammalian gene,
message, protein and activity for EH3 has been described and a gene
for EH3. The leukotriene EH acts on leukotriene A4, whereas the
cholesterol EH hydrates compounds related to the 5,6-epoxide of
cholesterol. The microsomal epoxide hydrolase metabolizes
monosubstituted, 1,1-disubstituted, cis-1,2-disubstituted epoxides
and epoxides on cyclic systems to their corresponding diols.
Because of its broad substrate specificity, this enzyme is thought
to play a significant role in ameliorating epoxide toxicity.
Reactions of detoxification typically decrease the hydrophobicity
of a compound, resulting in a more polar and thereby excretable
substance. EH3 appears to have very tissue limited distribution but
does metabolize fatty acid epoxides.
[0072] "Soluble epoxide hydrolase" ("sEH") is an epoxide hydrolase
which in many cell types converts EETs to dihydroxy derivatives
called dihydroxyeicosatrienoic acids ("DHETs"). The cloning and
sequence of the murine sEH is set forth in Grant et al., J. Biol.
Chem. 268(23):17628-17633 (1993). The cloning, sequence, and
accession numbers of the human sEH sequence are set forth in
Beetham et al., Arch. Biochem. Biophys. 305(1):197-201 (1993). NCBI
Entrez Nucleotide accession number L05779 sets forth the nucleic
acid sequence encoding the protein, as well as the 5' untranslated
region and the 3' untranslated region. The evolution and
nomenclature of the gene is discussed in Beetham et al., DNA Cell
Biol. 14(1):61-71 (1995). Soluble epoxide hydrolase represents a
single highly conserved gene product with over 90% homology between
rodent and human (Arand et al., FEBS Lett., 338:251-256 (1994)).
Soluble EH is only very distantly related to mEH and hydrates a
wide range of epoxides not on cyclic systems. In contrast to the
role played in the degradation of potential toxic epoxides by mEH,
sEH is believed to play a role in the formation or degradation of
endogenous chemical mediators. Unless otherwise specified, as used
herein, the terms "soluble epoxide hydrolase" and "sEH" refer to
human sEH.
[0073] Unless otherwise specified, as used herein, the terms "sEH
inhibitor" (also abbreviated as "sEHi") or "inhibitor of sEH" refer
to an inhibitor of human sEH. Preferably, the inhibitor does not
also inhibit the activity of microsomal epoxide hydrolase by more
than 25% at concentrations at which the inhibitor inhibits sEH by
at least 50%, and more preferably does not inhibit mEH by more than
10% at that concentration. For convenience of reference, unless
otherwise required by context, the term "sEH inhibitor" as used
herein encompasses pro-drugs which are metabolized to active
inhibitors of sEH. Further for convenience of reference, and except
as otherwise required by context, reference herein to a compound as
an inhibitor of sEH includes reference to derivatives of that
compound (such as an ester of that compound) that retain activity
as an sEH inhibitor.
[0074] "COX" is an abbreviation for "cyclo-oxygenase." Several COX
enzymes have been identified. Two isozymes, COX-1 and COX-2, are
recognized as of clinical significance, with COX-1 considered to be
constitutively expressed and COX-2 considered to be inducible and
more prevalent at sites of inflammation. See, e.g., Hawkey, Best
Pract Res Clin Gastroenterol. 15(5):801-20 (2001).
[0075] As used herein, a "COX-1 inhibitor" denotes an agent that
inhibits COX-1 more than it inhibits COX-2, while a "COX-2
inhibitor" denotes an agent that inhibits COX-2 more than it
inhibits COX-1. All current non-steroidal anti-inflammatory drugs
(NSAIDs) inhibit both COX-1 and COX-2, but most tend to inhibit the
two isoforms to different degrees. Since both enzymes tend to be
inhibited together to some degree, one can consider an inhibitor of
either enzyme to be "COX inhibitor".
[0076] "LOX" is an abbreviation for "lipoxygenase." Several LOX
enzymes have been identified. Arachidonate 5-lipoxygenase ("5-LOX",
EC 1.13.11.34) is involved in the production of pro-inflammatory
mediators. Arachidonate 12-lipoxygenase ("12-LOX", EC 1.13.11.31)
and arachidonate 15-lipoxygenase ("15-LOX", EC 1.13.11.33) form
trihydroxytetraenes known as "lipoxins" ("lipoxygenase interaction
products") from arachidonic acid. Lipoxins act as local
anti-inflammatory agents.
[0077] "5-lipoxygenase activating protein," or "FLAP," is a protein
required before 5-LOX can become catalytically active. Inhibiting
FLAP activity reduces or prevents 5-LOX activation, decreasing the
biosynthesis of leukotrienes.
[0078] Cytochrome P450 ("CYP450") metabolism produces
cis-epoxydocosapentaenoic acids ("EpDPEs") and
cis-epoxyeicosatetraenoic acids ("EpETEs") from docosahexaenoic
acid ("DHA") and eicosapentaenoic acid ("EPA"), respectively. These
epoxides are known endothelium-derived hyperpolarizing factors
("EDHFs"). These EDHFs, and others yet unidentified, are mediators
released from vascular endothelial cells in response to
acetylcholine and bradykinin, and are distinct from the NOS-
(nitric oxide) and COX-derived (prostacyclin) vasodilators. Overall
cytochrome P450 (CYP450) metabolism of polyunsaturated fatty acids
produces epoxides, such as EETs, which are prime candidates for the
active mediator(s). 14(15)-EpETE, for example, is derived via
epoxidation of the 14,15-double bond of EPA and is the .omega.-3
homolog of 14(15)-EpETrE ("14(15)EET") derived via epoxidation of
the 14,15-double bond of arachidonic acid.
[0079] "IC.sub.50" refers to the concentration of an agent required
to inhibit enzyme activity by 50%.
[0080] By "physiological conditions" is meant an extracellular
milieu having conditions (e.g., temperature, pH, and osmolarity)
which allows for the sustenance or growth of a cell of
interest.
[0081] "Micro-RNA" ("miRNA") refers to small, noncoding RNAs of
18-25 nt in length that negatively regulate their complementary
mRNAs at the posttranscriptional level in many eukaryotic
organisms. See, e.g., Kurihara and Watanabe, Proc Natl Acad Sci USA
101(34):12753-12758 (2004). Micro-RNA's were first discovered in
the roundworm C. elegans in the early 1990s and are now known in
many species, including humans. As used herein, it refers to
exogenously administered miRNA unless specifically noted or
otherwise required by context.
[0082] The term "therapeutically effective amount" refers to that
amount of the compound being administered sufficient to prevent or
decrease the development of one or more of the symptoms of the
disease, condition or disorder being treated (e.g., pain and/or
inflammation).
[0083] The terms "prophylactically effective amount" and "amount
that is effective to prevent" refer to that amount of drug that
will prevent or reduce the risk of occurrence of the biological or
medical event that is sought to be prevented. In many instances,
the prophylactically effective amount is the same as the
therapeutically effective amount.
[0084] "Sub-therapeutic dose" refers to a dose of a
pharmacologically active agent(s), either as an administered dose
of pharmacologically active agent, or actual level of
pharmacologically active agent in a subject that functionally is
insufficient to elicit the intended pharmacological effect in
itself (e.g., to obtain analgesic and/or anti-inflammatory
effects), or that quantitatively is less than the established
therapeutic dose for that particular pharmacological agent (e.g.,
as published in a reference consulted by a person of skill, for
example, doses for a pharmacological agent published in the
Physicians' Desk Reference, 65th Ed., 2011, Thomson Healthcare or
Brunton, et al., Goodman & Gilman's The Pharmacological Basis
of Therapeutics, 12th edition, 2010, McGraw-Hill Professional). A
"sub-therapeutic dose" can be defined in relative terms (i.e., as a
percentage amount (less than 100%) of the amount of
pharmacologically active agent conventionally administered). For
example, a sub-therapeutic dose amount can be about 1% to about 75%
of the amount of pharmacologically active agent conventionally
administered. In some embodiments, a sub-therapeutic dose can be
about 75%, 50%, 30%, 25%, 20%, 10% or less, than the amount of
pharmacologically active agent conventionally administered.
[0085] The term "analgesic amount" refers to that amount of the
compound being administered sufficient to prevent or decrease pain
in a subject under treatment.
[0086] The terms "controlled release," "sustained release,"
"extended release," and "timed release" are intended to refer
interchangeably to any drug-containing formulation in which release
of the drug is not immediate, i.e., with a "controlled release"
formulation, oral administration does not result in immediate
release of the drug into an absorption pool. The terms are used
interchangeably with "nonimmediate release" as defined in
Remington: The Science and Practice of Pharmacy, University of the
Sciences in Philadelphia, Eds., 21.sup.st Ed., Lippencott Williams
& Wilkins (2005).
[0087] The terms "sustained release" and "extended release" are
used in their conventional sense to refer to a drug formulation
that provides for gradual release of a drug over an extended period
of time, for example, 12 hours or more, and that preferably,
although not necessarily, results in substantially steady-state
blood levels of a drug over an extended time period.
[0088] As used herein, the term "delayed release" refers to a
pharmaceutical preparation that passes through the stomach intact
and dissolves in the small intestine.
[0089] As used herein, "synergy" or "synergistic" interchangeably
refer to the combined effects of two active agents that are greater
than their additive effects. Synergy can also be achieved by
producing an efficacious effect with combined inefficacious doses
of two active agents. The measure of synergy is independent of
statistical significance.
[0090] The terms "systemic administration" and "systemically
administered" refer to a method of administering agent (e.g., an
agent that increases EETs (e.g., an inhibitor of sEH, an EET, an
epoxygenated fatty acid, and mixtures thereof), optionally with an
anti-inflammatory agent and/or an analgesic agent) to a mammal so
that the agent is delivered to sites in the body, including the
targeted site of pharmaceutical action, via the circulatory system.
Systemic administration includes, but is not limited to, oral,
intranasal, rectal and parenteral (i.e., other than through the
alimentary tract, such as intramuscular, intravenous,
intra-arterial, transdermal and subcutaneous) administration.
[0091] The term "co-administration" refers to the presence of both
active agents in the blood at the same time. Active agents that are
co-administered can be delivered concurrently (i.e., at the same
time) or sequentially.
[0092] The terms "patient," "subject" or "individual"
interchangeably refers to a non-human mammal, including primates
(e.g., macaque, pan troglodyte, pongo), a domesticated mammal
(e.g., felines, canines), an agricultural mammal (e.g., bovine,
ovine, porcine, equine) and a laboratory mammal or rodent (e.g.,
rattus, murine, lagomorpha, hamster).
[0093] The terms "inhibiting," "reducing," "decreasing" refers to
inhibiting the pain and/or inflammation in a non-human mammalian
subject by a measurable amount using any method known in the art.
For example, inflammation is inhibited, reduced or decreased if an
indicator of inflammation, e.g., swelling, blood levels of
prostaglandin PGE2, is at least about 10%, 20%, 30%, 50%, 80%, or
100% reduced, e.g., in comparison to the same inflammatory
indicator prior to administration of an agent that increases EETs
(e.g., an inhibitor of sEH, an EET, an epoxygenated fatty acid, and
mixtures thereof). In some embodiments, the pain and/or
inflammation is inhibited, reduced or decreased by at least about
1-fold, 2-fold, 3-fold, 4-fold, or more in comparison to the pain
and/or inflammation prior to administration of the agent that
increases EETs (e.g., an inhibitor of sEH, an EET, an epoxygenated
fatty acid, and mixtures thereof). Indicators of pain and/or
inflammation can also be qualitative. For example, pain may be
indicated by a reflexive retraction in response to touch and/or an
unwillingness or inability to bear weight, e.g., by a limb bearing
a painful or inflamed lesion.
[0094] As used herein, the phrase "consisting essentially of"
refers to the genera or species of active pharmaceutical agents
included in a method or composition, as well as any excipients
inactive for the intended purpose of the methods or compositions.
In some embodiments, the phrase "consisting essentially of"
expressly excludes the inclusion of one or more additional active
agents other than the listed active agents, e.g., an agent that
increases EETs (e.g., an inhibitor of sEH, an EET, an epoxygenated
fatty acid, and mixtures thereof) and/or an anti-inflammatory
agent.
[0095] As used herein, the term "alkyl" refers to a saturated
hydrocarbon radical which may be straight-chain or branched-chain
(for example, ethyl, isopropyl, t-amyl, or 2,5-dimethylhexyl). This
definition applies both when the term is used alone and when it is
used as part of a compound term, such as "hydroxyalkyl,"
"haloalkyl," "arylalkyl," "alkylamino" and similar terms. In some
embodiments, alkyl groups are those containing 1 to 24 carbon
atoms. All numerical ranges in this specification and claims are
intended to be inclusive of their upper and lower limits.
Additionally, the alkyl and heteroalkyl groups may be attached to
other moieties at any position on the alkyl or heteroalkyl radical
which would otherwise be occupied by a hydrogen atom (such as, for
example, 2-pentyl, 2-methylpent-1-yl and 2-propyloxy). Divalent
alkyl groups may be referred to as "alkylene," and divalent
heteroalkyl groups may be referred to as "heteroalkylene," such as
those groups used as linkers in the present invention. The alkyl,
alkylene, and heteroalkylene moieties may also be optionally
substituted with halogen atoms, or other groups such as oxo, cyano,
nitro, alkyl, alkylamino, carboxyl, hydroxyl, alkoxy, aryloxy, and
the like.
[0096] As used herein, the term "haloalkyl" refers to alkyl as
defined above where some or all of the hydrogen atoms are
substituted with halogen atoms. Halogen (halo) preferably
represents chloro or fluoro, but may also be bromo or iodo. For
example, haloalkyl includes trifluoromethyl, fluoromethyl,
1,2,3,4,5-pentafluoro-phenyl, etc. The term "perfluoro" defines a
compound or radical which has at least two available hydrogens
substituted with fluorine. For example, perfluorophenyl refers to
1,2,3,4,5-pentafluorophenyl, perfluoromethane refers to
1,1,1-trifluoromethyl, and perfluoromethoxy refers to
1,1,1-trifluoromethoxy.
[0097] The terms "cycloalkyl" and "cycloalkylene" refer to a
saturated hydrocarbon ring and includes bicyclic and polycyclic
rings. Similarly, cycloalkyl and cycloalkylene groups having a
heteroatom (e.g. N, O or S) in place of a carbon ring atom may be
referred to as "heterocycloalkyl" and "heterocycloalkylene,"
respectively. Examples of cycloalkyl and heterocycloalkyl groups
are, for example, cyclohexyl, norbornyl, adamantyl, morpholinyl,
thiomorpholinyl, dioxothiomorpholinyl, and the like. The cycloalkyl
and heterocycloalkyl moieties may also be optionally substituted
with halogen atoms, or other groups such as nitro, alkyl,
alkylamino, carboxyl, alkoxy, aryloxy and the like. In some
embodiments, cycloalkyl and cycloalkylene moieties are those having
3 to 12 carbon atoms in the ring (e.g., cyclohexyl, cyclooctyl,
norbornyl, adamantyl, and the like). In some embodiments,
heterocycloalkyl and heterocycloalkylene moieties are those having
1 to 3 hetero atoms in the ring (e.g., morpholinyl,
thiomorpholinyl, dioxothiomorpholinyl, piperidinyl and the like).
Additionally, the term "(cycloalkyl)alkyl" refers to a group having
a cycloalkyl moiety attached to an alkyl moiety. Examples are
cyclohexylmethyl, cyclohexylethyl and cyclopentylpropyl.
[0098] The term "alkenyl" as used herein refers to an alkyl group
as described above which contains one or more sites of unsaturation
that is a double bond. Similarly, the term "alkynyl" as used herein
refers to an alkyl group as described above which contains one or
more sites of unsaturation that is a triple bond.
[0099] The term "alkoxy" refers to an alkyl radical as described
above which also bears an oxygen substituent which is capable of
covalent attachment to another hydrocarbon radical (such as, for
example, methoxy, ethoxy and t-butoxy).
[0100] The term "aryl" refers to an aromatic carbocyclic
substituent which may be a single ring or multiple rings which are
fused together, linked covalently or linked to a common group such
as an ethylene or methylene moiety. Similarly, aryl groups having a
heteroatom (e.g. N, O or S) in place of a carbon ring atom are
referred to as "heteroaryl". Examples of aryl and heteroaryl groups
are, for example, phenyl, naphthyl, biphenyl, diphenylmethyl,
thienyl, pyridyl and quinoxalyl. The aryl and heteroaryl moieties
may also be optionally substituted with halogen atoms, or other
groups such as nitro, alkyl, alkylamino, carboxyl, alkoxy, phenoxy
and the like. Additionally, the aryl and heteroaryl groups may be
attached to other moieties at any position on the aryl or
heteroaryl radical which would otherwise be occupied by a hydrogen
atom (such as, for example, 2-pyridyl, 3-pyridyl and 4-pyridyl).
Divalent aryl groups are "arylene", and divalent heteroaryl groups
are referred to as "heteroarylene" such as those groups used as
linkers in the present invention.
[0101] The terms "arylalkyl" and "alkylaryl", "refer to an aryl
radical attached directly to an alkyl group. Likewise, the terms
"arylalkenyl" and "aryloxyalkyl" refer to an alkenyl group, or an
oxygen which is attached to an alkyl group, respectively. For
brevity, aryl as part of a combined term as above, is meant to
include heteroaryl as well. The term "aryloxy" refers to an aryl
radical as described above which also bears an oxygen substituent
which is capable of covalent attachment to another radical (such
as, for example, phenoxy, naphthyloxy, and pyridyloxy).
[0102] The terms "halo" or "halogen," by themselves or as part of
another substituent, mean, unless otherwise stated, a fluorine,
chlorine, bromine, or iodine atom. Additionally, terms such as
"haloalkyl," and "haloalkoxy" are meant to include
monohaloalkyl(oxy) and polyhaloalkyl(oxy). For example, the term
"C.sub.1-C.sub.6 haloalkyl" is mean to include trifluoromethyl,
2,2,2-trifluoroethyl, 4-chlorobutyl, 3-bromopropyl, and the
like.
[0103] The term "hetero" as used in a "heteroatom-containing alkyl
group" (a "heteroalkyl" group) or a "heteroatom-containing aryl
group" (a "heteroaryl" group) refers to a molecule, linkage or
substituent in which one or more carbon atoms are replaced with an
atom other than carbon, e.g., nitrogen, oxygen, sulfur, phosphorus
or silicon, typically nitrogen, oxygen or sulfur or more than one
non-carbon atom (e.g., sulfonamide). Similarly, the term
"heteroalkyl" refers to an alkyl substituent that is
heteroatom-containing, the terms "heterocyclic" "heterocycle" or
"heterocyclyl" refer to a cyclic substituent or group that is
heteroatom-containing and is either aromatic or non-aromatic. The
terms "heteroaryl" and "heteroaromatic" respectively refer to
"aryl" and "aromatic" substituents that are heteroatom-containing,
and the like. The terms "heterocyclic" and "heterocyclyl" include
the terms "heteroaryl" and "heteroaromatic". In some embodiments,
heterocyclic moieties are those having 1 to 3 hetero atoms in the
ring. Examples of heteroalkyl groups include alkoxy, alkoxyaryl,
alkylsulfanyl-substituted alkyl, N-alkylated amino alkyl, and the
like. Examples of heteroaryl substituents include pyrrolyl,
pyrrolidinyl, pyridinyl, quinolinyl, indolyl, pyrimidinyl,
imidazolyl, 1,2,4-triazolyl, tetrazolyl, etc., and examples of
heteroatom-containing cyclic nonaromatic groups are morpholinyl,
piperazinyl, piperidinyl, etc.
[0104] The term "substituted" refers to the replacement of an atom
or a group of atoms of a compound with another atom or group of
atoms. For example, an atom or a group of atoms may be substituted
with one or more of the following substituents or groups: halo,
nitro, C.sub.1-C.sub.8alkyl, C.sub.1-C.sub.8alkylamino,
hydroxyC.sub.1-C.sub.8alkyl, haloC.sub.1-C.sub.8alkyl, carboxyl,
hydroxyl, C.sub.1-C.sub.8alkoxy,
C.sub.1-C.sub.8alkoxyC.sub.1-C.sub.8alkoxy,
thioC.sub.1-C.sub.8alkyl, aryl, aryloxy, C.sub.3-C.sub.8cycloalkyl,
C.sub.3-C.sub.8cycloalkyl C.sub.1-C.sub.8alkyl, heteroaryl,
arylC.sub.1-C.sub.8alkyl, heteroarylC.sub.1-C.sub.8alkyl,
C.sub.2-C.sub.8alkenyl containing 1 to 2 double bonds,
C.sub.2-C.sub.8alkynyl containing 1 to 2 triple bonds,
C.sub.4-C.sub.8alk(en)(yn)yl groups, cyano, formyl,
C.sub.1-C.sub.8alkylcarbonyl, arylcarbonyl, heteroarylcarbonyl,
C.sub.1-C.sub.8alkoxycarbonyl, aryloxycarbonyl, aminocarbonyl,
C.sub.1-C.sub.8alkylaminocarbonyl,
C.sub.1-C.sub.8dialkylaminocarbonyl, aryl aminocarbonyl,
diarylaminocarbonyl, arylC.sub.1-C.sub.8alkylaminocarbonyl,
haloC.sub.1-C.sub.8alkoxy, C.sub.2-C.sub.8alkenyloxy,
C.sub.2-C.sub.8alkynyloxy, arylC.sub.1-C.sub.8alkoxy,
aminoC.sub.1-C.sub.8alkyl,
C.sub.1-C.sub.8alkylaminoC.sub.1-C.sub.8alkyl,
C.sub.1-C.sub.8dialkylaminoC.sub.1-C.sub.8alkyl,
arylaminoC.sub.1-C.sub.8alkyl, amino, C.sub.1-C.sub.8dialkylamino,
arylamino, arylC.sub.1-C.sub.8alkylamino,
C.sub.1-C.sub.8alkylcarbonylamino, arylcarbonylamino, azido,
mercapto, C.sub.1-C.sub.8alkylthio, arylthio,
haloC.sub.1-C.sub.8alkylthio, thiocyano, isothiocyano,
C.sub.1-C.sub.8alkylsulfinyl, C.sub.1-C.sub.8alkylsulfonyl,
arylsulfinyl, arylsulfonyl, aminosulfonyl,
C.sub.1-C.sub.8alkylaminosulfonyl,
C.sub.1-C.sub.8dialkylaminosulfonyl and arylaminosulfonyl. When the
term "substituted" appears prior to a list of possible substituted
groups, it is intended that the term apply to every member of that
group.
[0105] The term "unsubstituted" refers to a native compound that
lacks replacement of an atom or a group of atoms.
BRIEF DESCRIPTION OF THE DRAWINGS
[0106] FIG. 1 illustrates daily visual analog pain scores (A),
systemic arterial blood pressure and heart rate (B) in one horse
with pain due to laminitis, which was treated with multimodal
analgesic therapy that included an investigational new drug
inhibitor of soluble epoxide hydrolases (t-TUCB). The time frame of
drug administration, along with doses, frequency and route of
administration is presented above panel A. VAS=visual analog scale
(0=no pain, 10=worst pain possible); SAP=systolic arterial
pressure; MAP=mean arterial pressure; DAP=diastolic arterial
pressure; HR=heart rate. BID=twice daily; SID=once daily;
PO=orally; IV=intravenously.
[0107] FIG. 2 illustrates plasma concentrations of the experimental
drug inhibitor of soluble epoxide hydrolases t-TUCB (0.1 mg/kg SID,
IV), phenylbutazone (3-4 mg/kg BID, PO) and gabapentin (20 mg/kg
BID, PO) in one horse with pain due to laminitis.
[0108] FIG. 3 illustrates the 4-year old, 500 kg Thoroughbred
female horse diagnosed with severely painful bilateral forelimb
laminitis and cellulitis on the left forelimb that was refractory
to non-steroidal anti-inflammatory therapy before she received
administration of the inhibitor of sEH,
trans-4-{4-[3-(4-Trifluoromethoxy-phenyl)-ureido]-cyclohexyloxy}-benzoic
acid (t-TUCB) (compound 1728). She was lying down most of the day
and was reluctant to stand and to walk.
[0109] FIG. 4 illustrates the 4-year old, 500 kg Thoroughbred
female horse during her course of treatment receiving t-TUCB
(compound 1728). The medication was administered once daily. Her
pain level, movement, blood pressure, heart rate, respiratory rate,
and intestinal function were monitored throughout the day.
Furthermore, bloodwork was performed to monitor for adverse
effects. t-TUCB (compound 1728) was administered early in the
morning of day 8 and the patient spent most of that day standing on
her feet instead of lying down. Her pain level decreased throughout
the day, although was still high. In the next few days, the pain
level subsided progressively (see daily pain scores in FIG. 1A) and
the high blood pressure improved towards normal (see daily blood
pressure measurements in FIG. 1B). At the same time, her stance
pattern was more natural, and she was often resting one of the hind
feet as is common in healthy horses. Horses with laminitis and pain
in the front limbs assume a typical stance aimed at reducing weight
in the front limbs. To accomplish this, the animal assumes a
posture where the hind feet are moved forward, the head and neck
are elevated and the front limbs are extended forward. Basically,
the center of gravity is moved back and more weight is placed in
the hind feet. The patient had this posture before administration
of Compound 1728. This posture improved steadily after
administration of t-TUCB (compound 1728). Once moving in the stall,
she was progressively less and less reluctant to take steps.
[0110] FIG. 5 illustrates the 4-year old, 500 kg Thoroughbred
female horse 30 days after receiving t-TUCB (compound 1728). t-TUCB
(compound 1728) was administered for a total of 5 days (days 8 to
12) and, given the sustained improvement, it was discontinued after
day 12. The patient continued to do well and had a full clinical
recovery. No signs of adverse effects were observed both from
clinical exams and evaluation of blood work.
[0111] FIG. 6 illustrates the 4-year old, 500 kg Thoroughbred
female horse 90 days after receiving t-TUCB (compound 1728).
DETAILED DESCRIPTION
[0112] 1. Introduction
[0113] The present invention is based, in part, on the discovery
that inhibitors of soluble epoxide hydrolase ("sEH") are
efficacious in alleviating, reducing, inhibiting and preventing
pain and/or inflammation in non-human mammals, particularly painful
and inflammatory conditions that could not be effectively treated
using currently employed medications (e.g., non-steroidal
anti-inflammatory drugs and/or analgesics were inefficacious),
and/or in non-human mammals (e.g., felines, canines) in whom
currently employed medications (e.g., non-steroidal
anti-inflammatory drugs and/or analgesics) are toxic.
[0114] It has been proposed that sEHi-mediated anti-hyperalgesia in
inflammatory and neuropathic pain occurs via two distinct
mechanisms. One mechanism involves direct anti-inflammatory action
of epoxides including down-regulation of induced cyclooxygenase
(COX)-2 expression, possibly through a nuclear factor-kappa B
(NF-.kappa.B)-dependent pathway. Such mechanism mimics the
analgesia by non-steroidal anti-inflammatory drugs (NSAIDs) but as
transcriptional regulators instead of direct enzyme inhibitors. The
second mechanism involves epoxide-mediated up-regulation in
steroid/neurosteroid synthesis in the presence of elevated cAMP
levels, which then results in analgesia via GABA channels (Inceoglu
et al. 2008). Collectively, the multimodal mechanism of action and
the favorable interactions with NSAIDs in the ARA cascade suggest
that sEH and COX inhibitors combinations may produce significant
pain relief while minimizing the risks of NSAID-associated side
effects.
[0115] The invention finds support in the successful treatment of
laminitis in an equine who could not be efficaciously treated using
currently available anti-inflammatory and analgesic medications. A
4-year old, 500 kg Thoroughbred female horse diagnosed with
bilateral forelimb laminitis and cellulitis on the left forelimb
became severely painful and refractory to non-steroidal
anti-inflammatory therapy (flunixin meglumine on days 1, 2, 3 and
4; and phenylbutazone on days 5, 6 and 7) alone or in combination
with gabapentin (days 6 and 7). Pain scores assessed independently
by three individuals with a visual analog scale (VAS; 0=no pain and
10=worst possible pain) were 8.5 on day 6, and it increased to 9.5
on day 7. Non-invasive blood pressure monitoring revealed severe
hypertension. As euthanasia was being considered for humane reasons
as well as technical and financial constraints, a decision was made
to add an experimental new drug,
trans-4-{4-[3-(4-Trifluoromethoxy-phenyl)-ureido]-cyclohexyloxy}-benzoic
acid (t-TUCB), which is an inhibitor of soluble epoxide hydrolase
(sEH), to the treatment protocol. Dose and frequency of
administration were selected to produce plasma concentrations
within the range of 2.5 .mu.M and 30 nM based on the drug potency
against equine sEH. Pain scores decreased sharply and remarkably
following t-TUCB administration and blood pressure progressively
decreased to physiologic normal values. Plasma concentrations of
t-TUCB, measured daily, were within the expected range, whereas
phenylbutazone and gabapentin plasma levels were below the
suggested efficacious concentrations. No adverse effects were
detected on clinical and laboratory examinations during and after
t-TUCB administration. The mare did not get any episode of
laminitis in the three months following the treatment.
[0116] 2. Subjects Who May Benefit
[0117] The present methods find use in preventing, reducing,
inhibiting and/or reversing pain and/or inflammation in a non-human
mammal. In various embodiments, the non-human mammal is an
ungulate, e.g., equine, bovine, ovine or porcine. In some
embodiments, the non-human mammal is canine or feline.
[0118] Illustrative non-human mammals who can benefit from the
present methods include, e.g., Equidae (e.g., horse, ass, zebra),
Bovidae (e.g., cattle, bison, sheep, goat, yak, impala, antelope,
hartebeest, wildebeest, gnu, gazelle, water buffalo, duiker),
Cervidae (e.g., deer, elk, moose, reindeer, pudu, bororo, brocket,
guemal, muntjac), Suidae (e.g., pig, hog, boar), Canidae
(domesticated dog, wolf, fox, coyote, jackel), Felidae (e.g.,
domesticated cat, cheetah, ocelot, lynx, bobcat, mountain lion,
leopard, puma, lion, jaguar, tiger), Rodentia (e.g., mouse, rat,
guinea pig, chinchilla, agouti, porcupine, beaver, gopher),
Lagomorpha (e.g., rabbit, jackrabbit, hare, pika), Camelidae (e.g.,
camel, llama, alpaca, guanaco, vicugna), Ursidae (e.g., bear,
panda), Procyonidae (e.g., raccoon, coati, olingo), Mustelidae
(polecat, weasel, ferret, mink, fisher, badger, otter, wolverine,
marten, sable, ermine), Elephantidae (e.g., elephant), rhinoceros,
hippopotamus and non-human primates (e.g., chimpanzee, bonobo,
macaque, ape).
[0119] 3. Conditions Subject to Prevention and Treatment
[0120] In various embodiments, the methods find use in providing
relief from pain and/or inflammation in non-human mammals who have
received an inefficacious course of treatment for a painful and/or
inflamed lesion (e.g., administration of a regime of non-steroidal
anti-inflammatory drugs (NSAIDS) or another currently used
medication was inefficacious). Inflammatory conditions in non-human
animals that can be prevented, reduced, alleviated and/or mitigated
by administration of an inhibitor of sEH include without limitation
injury or trauma, osteopathic conditions (joint inflammation,
panosteitis, osteoarthritis, hip dysplasia), allergic reactions,
blockages in the lymphatic system, high blood pressure, heart
failure, thyroid disease, liver disease, inflammatory bowel
disease, pancreatic inflammation, and chronic kidney disease. The
inflammation may be acute or chronic.
[0121] In various embodiments, the methods find use in providing
relief from pain and/or inflammation for non-human mammals who
cannot tolerate therapeutically effective doses of NSAIDS or other
active agents other than an inhibitor of sEH for the treatment of
pain and/or inflammation (e.g., due to toxicity and/or an inability
to metabolize currently available medications). For example, in
some embodiments, the non-human mammal received a course of
treatment of one or more NSAIDs, as sole active agent or in
combination with another active agent other than an inhibitor of
sEH, and the course of treatment of one or more NSAIDs did not
result in the prevention, reduction, inhibition or reversal of the
inflammatory and/or neuropathic pain condition. In some
embodiments, an effective regime of one or more NSAIDs cannot be
administered to the non-human animal (e.g., would be toxic), and
other active agents (that are not a NSAID and are not an inhibitor
of sEH) are ineffective in providing the non-human mammal with
relief from the painful and/or inflammatory condition. In some
embodiments, the non-human mammal has a painful and/or inflammatory
condition that could not be effectively prevented, reduced,
inhibited and/or reversed by administration of a NSAID
co-administered with a Gamma-aminobutyric Acid (GABA) analog (e.g.,
gabapentin or pregabalin, or analogs or pro-drugs thereof).
[0122] In some embodiments, the non-human mammal suffers from
tendonitis or arthritis. In some embodiments, the non-human mammal
suffers from a chronic inflammatory condition with a neuropathic
pain component. Inflammatory pain that has not been treated
successfully can evolve into a more chronic pain condition which
remains even if the inflammation is resolved. Such chronic or
neuropathic pain cannot be effectively reduced, inhibited or
reversed by administration of NSAIDS but can be effectively
reduced, inhibited or reversed by administration of an inhibitor of
sEH as sole active agent, or co-administered with another
anti-inflammatory and/or analgesic agent (e.g., a therapeutic or
sub-therapeutic amount of an NSAID and/or a Gamma-aminobutyric Acid
(GABA) analog (e.g., gabapentin or pregabalin, or analogs or
pro-drugs thereof).
[0123] In some embodiments, the non-human mammal is an ungulate and
suffers from laminitis. Laminitis is a severely debilitating,
excruciatingly painful, and life-threatening disease of the soft
tissues of the foot of an ungulate, particularly the foot of an
equine. Although laminitis has traditionally been viewed as an
inflammatory disease, the disorder is far more complex than a
simple inflammatory process. The equine foot, complex in both
anatomy and physiology, integrates multiple organ systems,
including the musculoskeletal, integumentary, nervous, immune,
gastrointestinal and cardiovascular systems. Thus, the similarities
that are often encountered between animal and human diseases do not
occur with equine laminitis. The mode of weight bearing in horses,
for example, is fundamentally different from that which occurs in
the plantigrade foot. Equines are also unique among ungulates
(i.e., cattle, sheep, goats, pigs, etc.) regarding the
susceptibility to laminitis. Notwithstanding having structurally
similar digit as equines, other ungulates are either not
susceptible to laminitis or it occurs to a much lesser degree. Not
surprisingly, the precise mechanism underlying laminitic pain
remains unclear yet pain control is the single most important task
in the clinical management of laminitic horses. Approximately 75%
of horses afflicted with laminitis are euthanized due to the
seriousness of the disease coupled with lack of efficacious
therapies, especially currently available analgesics. Consequently,
laminitis is widely considered as one of the most important
diseases of horses and a global welfare problem.
[0124] Inhibitors of soluble epoxide hydrolase (sEHis), have
analgesic and anti-inflammatory effects therapeutically relevant
for preventing, reducing, inhibiting and/or reversing equine
laminitis. These compounds have been extensively investigated in
classic yet simple rodent models of inflammatory and neuropathic
pain with very positive results. However, these compounds have not
been tested in animals or humans regarding their analgesic effects
in naturally occurring diseases. Naturally occurring diseases are
typically more complex than animal models, and data obtained in
models of disease do not always corroborate with findings in real
patients. Here we report the successful use of sEHi for pain
management of a horse with naturally occurring laminitis. That sEHi
was efficacious in treating pain associated with such a complex
disease as laminitis is a remarkable finding. It was more
remarkable in that the pain was refractory to therapy with maximum
clinically recommended doses of non-steroidal anti-inflammatory
drugs and gabapentin. Systematic physical examinations and repeated
laboratory analyzes of complete blood cell counts and serum
biochemistry revealed no signs of toxicity, demonstrating that
sEHis are safe in horses and potentially in other animals. These
extraordinary findings represent a notable leap in the field of
pain medicine. In this case, we were treating a complex disease
involving severe inflammation in a poorly vascularized area and
inflammatory pain that likely had evolved into a chronic
neuropathic pain condition. The horse was suffering as well from
severe hypertension, which could be secondary to the severe
pain.
[0125] In some embodiments, the non-human mammal suffers from
tendonitis or osteoarthritis. Other painful inflammatory diseases
such as osteoarthritis (OA) are highly prevalent in domestic animal
species (e.g., horses, cats, dogs) and humans. The non-steroidal
anti-inflammatory drugs (NSAIDs) are currently the most important
class of systemic analgesics to treat OA pain in humans. However,
NSAIDs have a relatively narrow safety margin and may have severe
toxic side effects when recommended dosages are exceeded and/or
prolonged use and/or in susceptible non-human mammals. These
adverse effects include gastrointestinal ulceration, renal
papillary necrosis, hepatocellular injury, and thrombosis, and are
potentially lethal. Among animals, cats are exquisitely sensitive
to the toxic effects of NSAIDs. With no approved drugs of this
class in the United States for long-term use in cats, management of
OA pain in cats is immensely difficult. Inhibitors of sEH have good
safety profile in rodents, dogs and non-human primates.
Furthermore, no signs of toxicity were detected in a laminitic
horse and in preliminary studies in cats. Thus, sEHis find use to
fill this gap in the pharmacologic options to treat long-term pain
in cats. On the basis of studies in rodent pain models,
co-administration of sEHis with low doses of NSAIDs in both horses
and dogs with OA pain reduces or minimizes the risks of
NSAID-related adverse effects while maintaining analgesic
efficacy.
[0126] 4. Agents that Increase Cis-Epoxyeicosatrienoic Acids
("EETs")
[0127] Agents that increase EETs include inhibitors of sEH, EETs,
and epoxygenated fatty acids.
[0128] a. Inhibitors of sEH
[0129] Scores of sEH inhibitors are known, of a variety of chemical
structures.
[0130] Derivatives in which the urea, carbamate or amide
pharmacophore are particularly useful as sEH inhibitors. As used
herein, "pharmacophore" refers to the section of the structure of a
ligand that binds to the sEH. In various embodiments, the urea,
carbamate or amide pharmacophore is covalently bound to both an
adamantane and to a 12 carbon chain dodecane. Derivatives that are
metabolically stable are preferred, as they are expected to have
greater activity in vivo. Selective and competitive inhibition of
sEH in vitro by a variety of urea, carbamate, and amide derivatives
is taught, for example, by Morisseau et al., Proc. Natl. Acad. Sci.
U.S.A, 96:8849-8854 (1999), which provides substantial guidance on
designing urea derivatives that inhibit the enzyme.
[0131] Derivatives of urea are transition state mimetics that form
a preferred group of sEH inhibitors. Within this group, N,
N'-dodecyl-cyclohexyl urea (DCU), is preferred as an inhibitor,
while N-cyclohexyl-N'-dodecylurea (CDU) is particularly preferred.
Some compounds, such as dicyclohexylcarbodiimide (a lipophilic
diimide), can decompose to an active urea inhibitor such as DCU.
Any particular urea derivative or other compound can be easily
tested for its ability to inhibit sEH by standard assays, such as
those discussed herein. The production and testing of urea and
carbamate derivatives as sEH inhibitors is set forth in detail in,
for example, Morisseau et al., Proc Natl Acad Sci (USA)
96:8849-8854 (1999).
[0132] N-Adamantyl-N'-dodecyl urea ("ADU") is both metabolically
stable and has particularly high activity on sEH. (Both the 1- and
the 2-adamantyl ureas have been tested and have about the same high
activity as an inhibitor of sEH. Thus, isomers of adamantyl dodecyl
urea are preferred inhibitors. It is further expected that N,
N'-dodecyl-cyclohexyl urea (DCU), and other inhibitors of sEH, and
particularly dodecanoic acid ester derivatives of urea, are
suitable for use in the methods. Preferred inhibitors include:
[0133] 12-(3-Adamantan-1-yl-ureido)dodecanoic acid (AUDA),
##STR00001##
[0134] 12-(3-Adamantan-1-yl-ureido)dodecanoic acid butyl ester
(AUDA-BE),
##STR00002##
[0135] Adamantan-1-yl-3-{5-[2-(2-ethoxyethoxy)ethoxy]pentyl}urea
(compound 950, also referred to herein as "AEPU"), and
##STR00003##
[0136] Another preferred group of inhibitors are piperidines. The
following Tables sets forth some exemplar inhibitors of sEH and
their ability to inhibit sEH activity of the human enzyme and sEH
from equine, ovine, porcine, feline and canine, expressed as the
amount needed to reduce the activity of the enzyme by 50%
(expressed as "IC.sub.50").
TABLE-US-00001 TABLE 1 IC.sub.50 values for selected
alkylpiperidine-based sEH inhibitors against human sEH n = 0 n = 1
##STR00004## Compound IC.sub.50 (.mu.M).sup.a Compound IC.sub.50
(.mu.M).sup.a R: H I 0.30 II 4.2 ##STR00005## 3a 3.8 4.a 3.9
##STR00006## 3b 0.81 4b 2.6 ##STR00007## 3c 1.2 4c 0.61
##STR00008## 3d 0.01 4d 0.11 .sup.aAs determined via a kinetic
fluorescent assay.
TABLE-US-00002 TABLE 2 sEH Inhibitor Screen Of Domestic Animals
IC.sub.50 (nM) Horse Sheep Pig Cat Dog Structure Name sEHi #
sEH.sup.b sEH.sup.b sEH.sup.a sEH.sup.b sEH.sup.b ##STR00009##
3-(4- chlorophenyl)- 1-(3,4- dichlorphenyl) urea or 3,4,4'-
trichloro- 295 (TCC) 267 56 61 680 5,200 carbanilide ##STR00010##
12-(3- adamantan-1- yl-ureido) dodecanoic acid 700 (AUDA) 21 3 11 3
3 ##STR00011## 1-adamantanyl- 3-{5-[2-(2- ethoxyethoxy) ethoxy]
pentyl]}urea 950 (AEPU) 23 3 6 27 86 ##STR00012## 1-(1-
acetypiperidin- 4-yl)-3- adamantanylurea 1153 (APAU) 121 67 13 450
500 ##STR00013## trans-4-[4-(3- Adamantan-1-yl- ureido)-
cyclohexyloxy]- benzoic acid 1471 (tAUCB) 10 5 8 6 1 ##STR00014##
1- trifluoro- methoxyphenyl- 3-(1- acetylpiperidin- 4-yl)urea 1555
(TPAU) >10,000 >10,000 201 480 9300 ##STR00015## cis-4-[4-(3-
Adamantan-1-yl- ureido)- cyclohexyloxy]- benzoic acid 1686 (cAUCB)
3 1 12 5 4 ##STR00016## 1-(1- methylsulfonyl- piperidin-4-
yl)-3-(4- trifluoromethoxy- phenyl)- urea 1709 (TUPS) 59 30 60 565
3200 ##STR00017## trans-4- {4-[3-(4- Trifluoro- methoxy- phenyl)-
ureido]- cyclohexyloxy}- 1728 (tTUCB) 29 6 1 benzoic acid
##STR00018## 1-trifluoro- methoxyphenyl- 3-(1- propionyl-
piperidin- 4-yl) urea 1770 (TPPU) 68 44 400 ##STR00019## 1-(1-
ethylsulfonyl- piperidin-4-yl)- 3-(4-trifluoro- methoxy- phenyl)-
urea 2213 (TUPSE) 39 33 ##STR00020## 1-(1- (cyclopropane- carbonyl)
piperidin- 4-yl)-3-(4- (trifluoromethoxy) phenyl)urea 2214 (CPTU)
28 18 190 ##STR00021## trans-N-methyl- 4-[4-(3- Adamantan-1-yl-
ureido)- cyclohexyloxy]- benzamide 2225 (tMAUCB) 1 1 1 ##STR00022##
trans-N-methyl- 4-[4-((3- trifluoromethyl- 4-chlorophenyl)-
ureido)- 2226 (tMTCUCB) 6 1 4 cyclohexyloxy]- benzamide
##STR00023## cis-N-methyl- 4-{4-[3-(4- trifluoromethoxy-
phenyl)-ureido]- cyclohexyloxy}- 2228 (cMTUCB) 1 1 2 benzamide
##STR00024## 1-cycloheptyl-3- (3-(1,5-diphenyl- 1H-pyrazol-3-
yl)propyl)urea 2247 (HDP3U) 1 2 .sup.ameasured with MNPC on
recombinant enzyme. .sup.bmeasured with radioactive assay and liver
cytosolic preparation.
TABLE-US-00003 TABLE 3 sEH Inhibitor Screen of Canine sEH
Inhibition % for [I] = IC.sub.50 Structure Name sEHI# 100 nM (nM)
##STR00025## trans-4-[4-(3- Adamantan-1- yl-ureido)-
cyclohexyloxy]- benzoic acid 1471 97 <1 ##STR00026## 4-{4-[3-(4-
Trifluoromethoxy- phenyl)- ureido]- cyclohexyloxy}- benzoic acid
1728 92 14 ##STR00027## 1-trifluoro- methoxyphenyl-3-(1-
propionylpiperidin- 4-yl)urea 1770 58 ##STR00028##
trans-2-(4-(4-(3- (4-trifluoromethoxy- phenyl)-ureido)-
cyclohexyloxy)- benzamido)-acetic acid 2283 64 ##STR00029##
N-(methylsulfonyl)- 4-(trans-4-(3-(4- trifluoromethoxy-
phenyl)-ureido)- cyclohexyloxy)- benzamide 2728 84 100 ##STR00030##
1-(trans-4-(4-(1H- tetrazol-5-yl)- phenoxy)- cyclohexyl)-3-(4-
(trifluoromethoxy)- phenyl)-urea 2806 99 <1 ##STR00031##
4-(trans-4-(3-(2- fluorophenyl)-ureido)- cyclohexyloxy)- benzoic
acid 2736 80 39 ##STR00032## 4-(4-(3-(4- (trifluoromethoxy)-
phenyl)-ureido)- phenoxy)-benzoic acid 2803 82 42 ##STR00033##
4-(3-fluoro-4-(3- (4-(trifluoromethoxy)- phenyl)-ureido)-
phenoxy)-benzoic acid 2807 95 14 ##STR00034## N-hydroxy-4-
(trans-4-(3-(4- (trifluoromethoxy)- phenyl)-ureido)-
cyclohexyloxy)- benzamide 2761 72 ##STR00035## (5-methyl-2-oxo-1,3-
dioxol-4-yl)methyl 4-((1r,4r)-4-(3-(4- (trifluoromethoxy)-
phenyl)-ureido)- 2796 84 38 cyclohexyloxy)- benzoate ##STR00036##
1-(4- oxocyclohexyl)-3-(4- (trifluoromethoxy)- phenyl)-urea 2809 51
##STR00037## methyl 4-(4-(3-(4- (trifluoromethoxy)-
phenyl)-ureido)- cyclohexylamino)- benzoate 2804 49 ##STR00038##
1-(4-(pyrimidin-2- yloxy)-cyclohexyl)- 3-(4-(trifluoromethoxy)-
phenyl)-urea 2810 52 ##STR00039## 4-(trans-4-(3-(4-
(difluoromethoxy)- phenyl)-ureido)- cyclohexyloxy)- benzoic acid
2805 95 19
[0137] A number of other sEH inhibitors which can be used in the
methods and compositions are set forth in co-owned applications
PCT/US2012/025074, PCT/US2011/064474, PCT/US2011/022901,
PCT/US2008/072199, PCT/US2007/006412, PCT/US2005/038282,
PCT/US2005/08765, PCT/US2004/010298 and U.S. Published Patent
Application Publication 2005/0026844, each of which is hereby
incorporated herein by reference in its entirety for all
purposes.
[0138] U.S. Pat. No. 5,955,496 (the '496 patent) also sets forth a
number of sEH inhibitors which can be used in the methods. One
category of these inhibitors comprises inhibitors that mimic the
substrate for the enzyme. The lipid alkoxides (e.g., the
9-methoxide of stearic acid) are an exemplar of this group of
inhibitors. In addition to the inhibitors discussed in the '496
patent, a dozen or more lipid alkoxides have been tested as sEH
inhibitors, including the methyl, ethyl, and propyl alkoxides of
oleic acid (also known as stearic acid alkoxides), linoleic acid,
and arachidonic acid, and all have been found to act as inhibitors
of sEH.
[0139] In another group of embodiments, the '496 patent sets forth
sEH inhibitors that provide alternate substrates for the enzyme
that are turned over slowly. Exemplars of this category of
inhibitors are phenyl glycidols (e.g., S, S-4-nitrophenylglycidyl),
and chalcone oxides. The '496 patent notes that suitable chalcone
oxides include 4-phenylchalcone oxide and 4-fluorochalcone oxide.
The phenyl glycidols and chalcone oxides are believed to form
stable acyl enzymes.
[0140] Additional inhibitors of sEH suitable for use in the methods
are set forth in U.S. Pat. No. 6,150,415 (the '415 patent) and U.S.
Pat. No. 6,531,506 (the '506 patent). Two preferred classes of sEH
inhibitors are compounds of Formulas 1 and 2, as described in the
'415 and '506 patents. Means for preparing such compounds and
assaying desired compounds for the ability to inhibit epoxide
hydrolases are also described. The '506 patent, in particular,
teaches scores of inhibitors of Formula 1 and some twenty sEH
inhibitors of Formula 2, which were shown to inhibit human sEH at
concentrations as low as 0.1 .mu.M. Any particular sEH inhibitor
can readily be tested to determine whether it will work in the
methods by standard assays. Esters and salts of the various
compounds discussed above or in the cited patents, for example, can
be readily tested by these assays for their use in the methods.
[0141] As noted above, chalcone oxides can serve as an alternate
substrate for the enzyme. While chalcone oxides have half-lives
which depend in part on the particular structure, as a group the
chalcone oxides tend to have relatively short half-lives (a drug's
half-life is usually defined as the time for the concentration of
the drug to drop to half its original value. See, e.g., Thomas, G.,
Medicinal Chemistry: an introduction, John Wiley & Sons Ltd.
(West Sussex, England, 2000)). Since the various uses contemplate
inhibition of sEH over differing periods of time which can be
measured in days, weeks, or months, chalcone oxides, and other
inhibitors which have a half-life whose duration is shorter than
the practitioner deems desirable, are preferably administered in a
manner which provides the agent over a period of time. For example,
the inhibitor can be provided in materials that release the
inhibitor slowly. Methods of administration that permit high local
concentrations of an inhibitor over a period of time are known, and
are not limited to use with inhibitors which have short half-lives
although, for inhibitors with a relatively short half-life, they
are a preferred method of administration.
[0142] In addition to the compounds in Formula 1 of the '506
patent, which interact with the enzyme in a reversible fashion
based on the inhibitor mimicking an enzyme-substrate transition
state or reaction intermediate, one can have compounds that are
irreversible inhibitors of the enzyme. The active structures such
as those in the Tables or Formula 1 of the '506 patent can direct
the inhibitor to the enzyme where a reactive functionality in the
enzyme catalytic site can form a covalent bond with the inhibitor.
One group of molecules which could interact like this would have a
leaving group such as a halogen or tosylate which could be attacked
in an SN2 manner with a lysine or histidine. Alternatively, the
reactive functionality could be an epoxide or Michael acceptor such
as an .alpha./.beta.-unsaturated ester, aldehyde, ketone, ester, or
nitrile.
[0143] Further, in addition to the Formula 1 compounds, active
derivatives can be designed for practicing the invention. For
example, dicyclohexyl thio urea can be oxidized to
dicyclohexylcarbodiimide which, with enzyme or aqueous acid
(physiological saline), will form an active dicyclohexylurea.
Alternatively, the acidic protons on carbamates or ureas can be
replaced with a variety of substituents which, upon oxidation,
hydrolysis or attack by a nucleophile such as glutathione, will
yield the corresponding parent structure. These materials are known
as pro-drugs or protoxins (Gilman et al., The Pharmacological Basis
of Therapeutics, 7th Edition, MacMillan Publishing Company, New
York, p. 16 (1985)) Esters, for example, are common pro-drugs which
are released to give the corresponding alcohols and acids
enzymatically (Yoshigae et al., Chirality, 9:661-666 (1997)). The
drugs and pro-drugs can be chiral for greater specificity. These
derivatives have been extensively used in medicinal and
agricultural chemistry to alter the pharmacological properties of
the compounds such as enhancing water solubility, improving
formulation chemistry, altering tissue targeting, altering volume
of distribution, and altering penetration. They also have been used
to alter toxicology profiles.
[0144] There are many pro-drugs possible, but replacement of one or
both of the two active hydrogens in the ureas described here or the
single active hydrogen present in carbamates is particularly
attractive. Such derivatives have been extensively described by
Fukuto and associates. These derivatives have been extensively
described and are commonly used in agricultural and medicinal
chemistry to alter the pharmacological properties of the compounds.
(Black et al., Journal of Agricultural and Food Chemistry,
21(5):747-751 (1973); Fahmy et al, Journal of Agricultural and Food
Chemistry, 26(3):550-556 (1978); Jojima et al., Journal of
Agricultural and Food Chemistry, 31(3):613-620 (1983); and Fahmy et
al., Journal of Agricultural and Food Chemistry, 29(3):567-572
(1981).)
[0145] Such active proinhibitor derivatives are within the scope of
the present invention, and the just-cited references are
incorporated herein by reference. Without being bound by theory, it
is believed that suitable inhibitors mimic the enzyme transition
state so that there is a stable interaction with the enzyme
catalytic site. The inhibitors appear to form hydrogen bonds with
the nucleophilic carboxylic acid and a polarizing tyrosine of the
catalytic site.
[0146] In some embodiments, the sEH inhibitor used in the methods
taught herein is a "soft drug." Soft drugs are compounds of
biological activity that are rapidly inactivated by enzymes as they
move from a chosen target site. EETs and simple biodegradable
derivatives administered to an area of interest may be considered
to be soft drugs in that they are likely to be enzymatically
degraded by sEH as they diffuse away from the site of interest
following administration. Some sEHi, however, may diffuse or be
transported following administration to regions where their
activity in inhibiting sEH may not be desired. Thus, multiple soft
drugs for treatment have been prepared. These include but are not
limited to carbamates, esters, carbonates and amides placed in the
sEHi, approximately 7.5 angstroms from the carbonyl of the central
pharmacophore. These are highly active sEHi that yield biologically
inactive metabolites by the action of esterase and/or amidase.
Groups such as amides and carbamates on the central pharmacophores
can also be used to increase solubility for applications in which
that is desirable in forming a soft drug. Similarly, easily
metabolized ethers may contribute soft drug properties and also
increase the solubility.
[0147] In some embodiments, sEH inhibition can include the
reduction of the amount of sEH. As used herein, therefore, sEH
inhibitors can therefore encompass nucleic acids that inhibit
expression of a gene encoding sEH. Many methods of reducing the
expression of genes, such as reduction of transcription and siRNA,
are known, and are discussed in more detail below.
[0148] In various embodiments, a compound with combined
functionality to concurrently inhibit sEH and COX-2 is
administered. Urea-containing pyrazoles that function as dual
inhibitors of cyclooxygenase-2 and soluble epoxide hydrolase are
described, e.g., in Hwang, et al., J Med Chem. (2011) 28;
54(8):3037-50.
[0149] Preferably, the inhibitor inhibits sEH without also
significantly inhibiting microsomal epoxide hydrolase ("mEH").
Preferably, at concentrations of 100 .mu.M, the inhibitor inhibits
sEH activity by at least 50% while not inhibiting mEH activity by
more than 10%. Preferred compounds have an IC.sub.50 (inhibition
potency or, by definition, the concentration of inhibitor which
reduces enzyme activity by 50%) of less than about 100 .mu.M.
Inhibitors with IC.sub.50s of less than 100 .mu.M are preferred,
with IC.sub.50s of less than 75 .mu.M being more preferred and, in
order of increasing preference, an IC.sub.50 of 50 .mu.M, 40 .mu.M,
30 .mu.M, 25 .mu.M, 20 .mu.M, 15 .mu.M, 10 .mu.M, 5 .mu.M, 3 .mu.M,
2 .mu.M, 1 .mu.M, 100 nM, 10 nM, 1.0 nM, or even less, being still
more preferred. Assays for determining sEH activity are known in
the art and described elsewhere herein. The IC.sub.50 determination
of the inhibitor can be made with respect to an sEH enzyme from the
species subject to treatment (e.g., the subject receiving the
inhibitor of sEH).
[0150] b. Cis-Epoxyeicosatrienoic Acids ("EETs")
[0151] EETs, which are epoxides of arachidonic acid, are known to
be effectors of blood pressure, regulators of inflammation, and
modulators of vascular permeability. Hydrolysis of the epoxides by
sEH diminishes this activity. Inhibition of sEH raises the level of
EETs since the rate at which the EETs are hydrolyzed into
dihydroxyeicosatrienoic acids ("DHETs") is reduced.
[0152] It has long been believed that EETs administered
systemically would be hydrolyzed too quickly by endogenous sEH to
be helpful. For example, in one prior report of EETs
administration, EETs were administered by catheters inserted into
mouse aortas. The EETs were infused continuously during the course
of the experiment because of concerns over the short half-life of
the EETs. See, Liao and Zeldin, International Publication WO
01/10438 (hereafter "Liao and Zeldin"). It also was not known
whether endogenous sEH could be inhibited sufficiently in body
tissues to permit administration of exogenous EET to result in
increased levels of EETs over those normally present. Further, it
was thought that EETs, as epoxides, would be too labile to survive
the storage and handling necessary for therapeutic use.
[0153] Studies from the laboratory of the present inventors,
however, showed that systemic administration of EETs in conjunction
with inhibitors of sEH had better results than did administration
of sEH inhibitors alone. EETs were not administered by themselves
in these studies since it was anticipated they would be degraded
too quickly to have a useful effect. Additional studies from the
laboratory of the present inventors have since shown, however, that
administration of EETs by themselves has had therapeutic effect.
Without wishing to be bound by theory, it is surmised that the
exogenous EET overwhelms endogenous sEH, and allows EETs levels to
be increased for a sufficient period of time to have therapeutic
effect. Thus, EETs can be administered without also administering
an sEHi to provide a therapeutic effect. Moreover, EETs, if not
exposed to acidic conditions or to sEH are stable and can withstand
reasonable storage, handling and administration.
[0154] In short, sEHi, EETs, or co-administration of sEHis and of
EETs, can be used in the methods of the present invention. In some
embodiments, one or more EETs are administered to the patient
without also administering an sEHi. In some embodiments, one or
more EETs are administered shortly before or concurrently with
administration of an sEH inhibitor to slow hydrolysis of the EET or
EETs. In some embodiments, one or more EETs are administered after
administration of an sEH inhibitor, but before the level of the
sEHi has diminished below a level effective to slow the hydrolysis
of the EETs.
[0155] EETs useful in the methods of the present invention include
14,15-EET, 8,9-EET and 11,12-EET, and 5,6 EETs. Preferably, the
EETs are administered as the methyl ester, which is more stable.
Persons of skill will recognize that the EETs are regioisomers,
such as 8S,9R- and 14R,15S-EET. 8,9-EET, 11,12-EET, and
14R,15S-EET, are commercially available from, for example,
Sigma-Aldrich (catalog nos. E5516, E5641, and E5766, respectively,
Sigma-Aldrich Corp., St. Louis, Mo.).
[0156] If desired, EETs, analogs, or derivatives that retain
activity can be used in place of or in combination with unmodified
EETs. Liao and Zeldin, supra, define EET analogs as compounds with
structural substitutions or alterations in an EET, and include
structural analogs in which one or more EET olefins are removed or
replaced with acetylene or cyclopropane groups, analogs in which
the epoxide moiety is replaced with oxitane or furan rings and
heteroatom analogs. In other analogs, the epoxide moiety is
replaced with ether, alkoxides, urea, amide, carbamate,
difluorocycloprane, or carbonyl, while in others, the carboxylic
acid moiety is stabilized by blocking beta oxidation or is replaced
with a commonly used mimic, such as a nitrogen heterocycle, a
sulfonamide, or another polar functionality. In preferred forms,
the analogs or derivatives are relatively stable as compared to an
unmodified EET because they are more resistant than an unmodified
EET to sEH and to chemical breakdown. "Relatively stable" means the
rate of hydrolysis by sEH is at least 25% less than the hydrolysis
of the unmodified EET in a hydrolysis assay, and more preferably
50% or more lower than the rate of hydrolysis of an unmodified EET.
Liao and Zeldin show, for example, episulfide and sulfonamide EETs
derivatives. Amide and ester derivatives of EETs and that are
relatively stable are preferred embodiments. Whether or not a
particular EET analog or derivative has the biological activity of
the unmodified EET can be readily determined by using it in
standard assays, such as radio-ligand competition assays to measure
binding to the relevant receptor. As mentioned in the Definition
section, above, for convenience of reference, the term "EETs" as
used herein refers to unmodified EETs, and EETs analogs and
derivatives unless otherwise required by context.
[0157] In some embodiments, the EET or EETs are embedded or
otherwise placed in a material that releases the EET over time.
Materials suitable for promoting the slow release of compositions
such as EETs are known in the art. Optionally, one or more sEH
inhibitors may also be placed in the slow release material.
[0158] Conveniently, the EET or EETs can be administered orally.
Since EETs are subject to degradation under acidic conditions, EETs
intended for oral administration can be coated with a coating
resistant to dissolving under acidic conditions, but which dissolve
under the mildly basic conditions present in the intestines.
Suitable coatings, commonly known as "enteric coatings" are widely
used for products, such as aspirin, which cause gastric distress or
which would undergo degradation upon exposure to gastric acid. By
using coatings with an appropriate dissolution profile, the coated
substance can be released in a chosen section of the intestinal
tract. For example, a substance to be released in the colon is
coated with a substance that dissolves at pH 6.5-7, while
substances to be released in the duodenum can be coated with a
coating that dissolves at pH values over 5.5. Such coatings are
commercially available from, for example, Rohm Specialty Acrylics
(Rohm America LLC, Piscataway, N.J.) under the trade name
"Eudragit.RTM.". The choice of the particular enteric coating is
not critical to the practice.
[0159] c. Assays for Epoxide Hydrolase Activity
[0160] Any of a number of standard assays for determining epoxide
hydrolase activity can be used to determine inhibition of sEH. For
example, suitable assays are described in Gill, et al., Anal
Biochem 131:273-282 (1983); and Borhan, et al., Analytical
Biochemistry 231:188-200 (1995)). Suitable in vitro assays are
described in Zeldin et al., J Biol. Chem. 268:6402-6407 (1993).
Suitable in vivo assays are described in Zeldin et al., Arch
Biochem Biophys 330:87-96 (1996). Assays for epoxide hydrolase
using both putative natural substrates and surrogate substrates
have been reviewed (see, Hammock, et al. In: Methods in Enzymology,
Volume III, Steroids and Isoprenoids, Part B, (Law, J. H. and H. C.
Rilling, eds. 1985), Academic Press, Orlando, Fla., pp. 303-311 and
Wixtrom et al., In: Biochemical Pharmacology and Toxicology, Vol.
1: Methodological Aspects of Drug Metabolizing Enzymes, (Zakim, D.
and D. A. Vessey, eds. 1985), John Wiley & Sons, Inc., New
York, pp. 1-93. Several spectral based assays exist based on the
reactivity or tendency of the resulting diol product to hydrogen
bond (see, e.g., Wixtrom, supra, and Hammock. Anal. Biochem.
174:291-299 (1985) and Dietze, et al. Anal. Biochem. 216:176-187
(1994)).
[0161] The enzyme also can be detected based on the binding of
specific ligands to the catalytic site which either immobilize the
enzyme or label it with a probe such as dansyl, fluorecein,
luciferase, green fluorescent protein or other reagent. The enzyme
can be assayed by its hydration of EETs, its hydrolysis of an
epoxide to give a colored product as described by Dietze et al.,
1994, supra, or its hydrolysis of a radioactive surrogate substrate
(Borhan et al., 1995, supra). The enzyme also can be detected based
on the generation of fluorescent products following the hydrolysis
of the epoxide. Numerous methods of epoxide hydrolase detection
have been described (see, e.g., Wixtrom, supra).
[0162] The assays are normally carried out with a recombinant
enzyme following affinity purification. They can be carried out in
crude tissue homogenates, cell culture or even in vivo, as known in
the art and described in the references cited above.
[0163] d. Other Means of Inhibiting sEH Activity
[0164] Other means of inhibiting sEH activity or gene expression
can also be used in the methods herein. For example, a nucleic acid
molecule complementary to at least a portion of the human sEH gene
can be used to inhibit sEH gene expression. Means for inhibiting
gene expression using short RNA molecules, for example, are known.
Among these are short interfering RNA (siRNA), small temporal RNAs
(stRNAs), and micro-RNAs (miRNAs). Short interfering RNAs silence
genes through a mRNA degradation pathway, while stRNAs and miRNAs
are approximately 21 or 22 nt RNAs that are processed from
endogenously encoded hairpin-structured precursors, and function to
silence genes via translational repression. See, e.g., McManus et
al., RNA, 8(6):842-50 (2002); Morris et al., Science,
305(5688):1289-92 (2004); He and Hannon, Nat Rev Genet. 5(7):522-31
(2004).
[0165] "RNA interference," a form of post-transcriptional gene
silencing ("PTGS"), describes effects that result from the
introduction of double-stranded RNA into cells (reviewed in Fire,
A. Trends Genet 15:358-363 (1999); Sharp, P. Genes Dev 13:139-141
(1999); Hunter, C. Curr Biol 9:R440-R442 (1999); Baulcombe. D. Curr
Biol 9:R599-R601 (1999); Vaucheret et al. Plant J 16: 651-659
(1998)). RNA interference, commonly referred to as RNAi, offers a
way of specifically inactivating a cloned gene, and is a powerful
tool for investigating gene function.
[0166] The active agent in RNAi is a long double-stranded
(antiparallel duplex) RNA, with one of the strands corresponding or
complementary to the RNA which is to be inhibited. The inhibited
RNA is the target RNA. The long double stranded RNA is chopped into
smaller duplexes of approximately 20 to 25 nucleotide pairs, after
which the mechanism by which the smaller RNAs inhibit expression of
the target is largely unknown at this time. While RNAi was shown
initially to work well in lower eukaryotes, for mammalian cells, it
was thought that RNAi might be suitable only for studies on the
oocyte and the preimplantation embryo.
[0167] In mammalian cells other than these, however, longer RNA
duplexes provoked a response known as "sequence non-specific RNA
interference," characterized by the non-specific inhibition of
protein synthesis.
[0168] Further studies showed this effect to be induced by dsRNA of
greater than about 30 base pairs, apparently due to an interferon
response. It is thought that dsRNA of greater than about 30 base
pairs binds and activates the protein PKR and 2',5'-oligonucleotide
synthetase (2',5'-AS). Activated PKR stalls translation by
phosphorylation of the translation initiation factors eIF2.alpha.,
and activated 2',5'-AS causes mRNA degradation by
2',5'-oligonucleotide-activated ribonuclease L. These responses are
intrinsically sequence-nonspecific to the inducing dsRNA; they also
frequently result in apoptosis, or cell death. Thus, most somatic
mammalian cells undergo apoptosis when exposed to the
concentrations of dsRNA that induce RNAi in lower eukaryotic
cells.
[0169] More recently, it was shown that RNAi would work in human
cells if the RNA strands were provided as pre-sized duplexes of
about 19 nucleotide pairs, and RNAi worked particularly well with
small unpaired 3' extensions on the end of each strand (Elbashir et
al. Nature 411: 494-498 (2001)). In this report, siRNA were applied
to cultured cells by transfection in oligofectamine micelles. These
RNA duplexes were too short to elicit sequence-nonspecific
responses like apoptosis, yet they efficiently initiated RNAi. Many
laboratories then tested the use of siRNA to knock out target genes
in mammalian cells. The results demonstrated that siRNA works quite
well in most instances.
[0170] For purposes of reducing the activity of sEH, siRNAs to the
gene encoding sEH can be specifically designed using computer
programs. The cloning, sequence, and accession numbers of the human
sEH sequence are set forth in Beetham et al., Arch. Biochem.
Biophys. 305(1):197-201 (1993). An exemplary amino acid sequence of
human sEH (GenBank Accession No. L05779; SEQ ID NO:1) and an
exemplary nucleotide sequence encoding that amino acid sequence
(GenBank Accession No. AAA02756; SEQ ID NO:2) are set forth in U.S.
Pat. No. 5,445,956. The nucleic acid sequence of human sEH is also
published as GenBank Accession No. NM_001979.4; the amino acid
sequence of human sEH is also published as GenBank Accession No.
NP_001970.2.
[0171] A program, siDESIGN from Dharmacon, Inc. (Lafayette, Colo.),
permits predicting siRNAs for any nucleic acid sequence, and is
available on the World Wide Web at dharmacon.com. Programs for
designing siRNAs are also available from others, including
Genscript (available on the Web at genscript.com/ssl-bin/app/rnai)
and, to academic and non-profit researchers, from the Whitehead
Institute for Biomedical Research found on the worldwide web at
"jura.wi.mit.edu/pubint/http://iona.wi.mit.edu/siRNAext/."
[0172] For example, using the program available from the Whitehead
Institute, the following sEH target sequences and siRNA sequences
can be generated:
TABLE-US-00004 1) Target: (SEQ ID NO: 3) CAGTGTTCATTGGCCATGACTGG
Sense-siRNA: (SEQ ID NO: 4) 5'-GUGUUCAUUGGCCAUGACUTT-3'
Antisense-siRNA: (SEQ ID NO: 5) 5'-AGUCAUGGCCAAUGAACACTT-3' 2)
Target: (SEQ ID NO: 6) GAAAGGCTATGGAGAGTCATCTG Sense-siRNA: (SEQ ID
NO: 7) 5'-AAGGCUAUGGAGAGUCAUCTT-3' Antisense-siRNA: (SEQ ID NO: 8)
5'-GAUGACUCUCCAUAGCCUUTT-3' 3) Target: (SEQ ID NO: 9)
AAAGGCTATGGAGAGTCATCTGC Sense-siRNA: (SEQ ID NO: 10)
5'-AGGCUAUGGAGAGUCAUCUTT-3' Antisense-siRNA: (SEQ ID NO: 11)
5'-AGAUGACUCUCCAUAGCCUTT-3' 4) Target: (SEQ ID NO: 12)
CAAGCAGTGTTCATTGGCCATGA Sense-siRNA: (SEQ ID NO: 13)
5'-AGCAGUGUUCAUUGGCCAUTT-3' Antisense-siRNA: (SEQ ID NO: 14)
5'-AUGGCCAAUGAACACUGCUTT-3' 5) Target: (SEQ ID NO: 15)
CAGCACATGGAGGACTGGATTCC Sense-siRNA: (SEQ ID NO: 16)
5'-GCACAUGGAGGACUGGAUUTT-3' Antisense-siRNA: (SEQ ID NO: 17)
5'-AAUCCAGUCCUCCAUGUGCTT-3'
[0173] Alternatively, siRNA can be generated using kits which
generate siRNA from the gene. For example, the "Dicer siRNA
Generation" kit (catalog number T510001, Gene Therapy Systems,
Inc., San Diego, Calif.) uses the recombinant human enzyme "dicer"
in vitro to cleave long double stranded RNA into 22 bp siRNAs. By
having a mixture of siRNAs, the kit permits a high degree of
success in generating siRNAs that will reduce expression of the
target gene. Similarly, the Silencer.TM. siRNA Cocktail Kit (RNase
III) (catalog no. 1625, Ambion, Inc., Austin, Tex.) generates a
mixture of siRNAs from dsRNA using RNase III instead of dicer. Like
dicer, RNase III cleaves dsRNA into 12-30 bp dsRNA fragments with 2
to 3 nucleotide 3' overhangs, and 5'-phosphate and 3'-hydroxyl
termini. According to the manufacturer, dsRNA is produced using T7
RNA polymerase, and reaction and purification components included
in the kit. The dsRNA is then digested by RNase III to create a
population of siRNAs. The kit includes reagents to synthesize long
dsRNAs by in vitro transcription and to digest those dsRNAs into
siRNA-like molecules using RNase III. The manufacturer indicates
that the user need only supply a DNA template with opposing T7
phage polymerase promoters or two separate templates with promoters
on opposite ends of the region to be transcribed.
[0174] The siRNAs can also be expressed from vectors. Typically,
such vectors are administered in conjunction with a second vector
encoding the corresponding complementary strand. Once expressed,
the two strands anneal to each other and form the functional double
stranded siRNA. One exemplar vector suitable for use in the
invention is pSuper, available from OligoEngine, Inc. (Seattle,
Wash.). In some embodiments, the vector contains two promoters, one
positioned downstream of the first and in antiparallel orientation.
The first promoter is transcribed in one direction, and the second
in the direction antiparallel to the first, resulting in expression
of the complementary strands. In yet another set of embodiments,
the promoter is followed by a first segment encoding the first
strand, and a second segment encoding the second strand. The second
strand is complementary to the palindrome of the first strand.
Between the first and the second strands is a section of RNA
serving as a linker (sometimes called a "spacer") to permit the
second strand to bend around and anneal to the first strand, in a
configuration known as a "hairpin."
[0175] The formation of hairpin RNAs, including use of linker
sections, is well known in the art. Typically, an siRNA expression
cassette is employed, using a Polymerase III promoter such as human
U6, mouse U6, or human H1. The coding sequence is typically a
19-nucleotide sense siRNA sequence linked to its reverse
complementary antisense siRNA sequence by a short spacer.
Nine-nucleotide spacers are typical, although other spacers can be
designed. For example, the Ambion website indicates that its
scientists have had success with the spacer TTCAAGAGA (SEQ ID
NO:18). Further, 5-6 T's are often added to the 3' end of the
oligonucleotide to serve as a termination site for Polymerase III.
See also, Yu et al., Mol Ther 7(2):228-36 (2003); Matsukura et al.,
Nucleic Acids Res 31(15):e77 (2003).
[0176] As an example, the siRNA targets identified above can be
targeted by hairpin siRNA as follows. To attack the same targets by
short hairpin RNAs, produced by a vector (permanent RNAi effect),
sense and antisense strand can be put in a row with a loop forming
sequence in between and suitable sequences for an adequate
expression vector to both ends of the sequence. The following are
non-limiting examples of hairpin sequences that can be cloned into
the pSuper vector:
TABLE-US-00005 1) Target: (SEQ ID NO: 19) CAGTGTTCATTGGCCATGACTGG
Sense strand: (SEQ ID NO: 20)
5'-GATCCCCGTGTTCATTGGCCATGACTTTCAAGAGAAGTCATGGCC AATGAACACTTTTT-3'
Antisense strand: (SEQ ID NO: 21)
5'-AGCTAAAAAGTGTTCATTGGCCATGACTTCTCTTGAAAGTCATGG CCAATGAACACGGG-3'
2) Target: (SEQ ID NO: 22) GAAAGGCTATGGAGAGTCATCTG Sense strand:
(SEQ ID NO: 23) 5'-GATCCCCAAGGCTATGGAGAGTCATCTTCAAGAGAGATGACTCTC
CATAGCCTTTTTTT-3' Antisense strand: (SEQ ID NO: 24)
5'-AGCTAAAAAAAGGCTATGGAGAGTCATCTCTCTTGAAGATGACTC TCCATAGCCTTGGG-3'
3) Target: (SEQ ID NO: 25) AAAGGCTATGGAGAGTCATCTGC Sense strand:
(SEQ ID NO: 26) 5'-GATCCCCAGGCTATGGAGAGTCATCTTTCAAGAGAAGATGACTCT
CCATAGCCTTTTTT-3' Antisense strand: (SEQ ID NO: 27)
5'-AGCTAAAAAAGGCTATGGAGAGTCATCATCTCTTGAAAGATGACT CTCCATAGCCTGGG-3'
4) Target: (SEQ ID NO: 28) CAAGCAGTGTTCATTGGCCATGA Sense strand:
(SEQ ID NO: 29) 5'-GATCCCCAGCAGTGTTCATTGGCCATTTCAAGAGAATGGCCAATG
AACACTGCTTTTTT-3' Antisense strand: (SEQ ID NO: 30)
5'-AGCTAAAAAAGCAGTGTTCATTGGCCATTCTCTTGAAATGGCCAA TGAACACTGCTGGG-3'
5) Target: (SEQ ID NO: 31) CAGCACATGGAGGACTGGATTCC Sense strand:
(SEQ ID NO: 32) 5'-GATCCCCGCACATGGAGGACTGGATTTTCAAGAGAAATCCAGTCC
TCCATGTGCTTTTT-3' Antisense strand: (SEQ ID NO: 33)
5'-AGCTAAAAAGCACATGGAGGACTGGATTTCTCTTGAAAATCCAGT
CTCCATGTGCGGG-3'
[0177] In addition to siRNAs, other means are known in the art for
inhibiting the expression of antisense molecules, ribozymes, and
the like are well known to those of skill in the art. The nucleic
acid molecule can be a DNA probe, a riboprobe, a peptide nucleic
acid probe, a phosphorothioate probe, or a 2'-O methyl probe.
[0178] Generally, to assure specific hybridization, the antisense
sequence is substantially complementary to the target sequence. In
certain embodiments, the antisense sequence is exactly
complementary to the target sequence. The antisense polynucleotides
may also include, however, nucleotide substitutions, additions,
deletions, transitions, transpositions, or modifications, or other
nucleic acid sequences or non-nucleic acid moieties so long as
specific binding to the relevant target sequence corresponding to
the sEH gene is retained as a functional property of the
polynucleotide. In one embodiment, the antisense molecules form a
triple helix-containing, or "triplex" nucleic acid. Triple helix
formation results in inhibition of gene expression by, for example,
preventing transcription of the target gene (see, e.g., Cheng et
al., 1988, J. Biol. Chem. 263:15110; Ferrin and Camerini-Otero,
1991, Science 354:1494; Ramdas et al., 1989, J. Biol. Chem.
264:17395; Strobel et al., 1991, Science 254:1639; and Rigas et
al., 1986, Proc. Natl. Acad. Sci. U.S.A. 83:9591)
[0179] Antisense molecules can be designed by methods known in the
art. For example, Integrated DNA Technologies (Coralville, Iowa)
makes available a program found on the worldwide web
"biotools.idtdna.com/antisense/AntiSense.aspx", which will provide
appropriate antisense sequences for nucleic acid sequences up to
10,000 nucleotides in length. Using this program with the sEH gene
provides the following exemplar sequences:
TABLE-US-00006 (SEQ ID NO: 34) 1) UGUCCAGUGCCCACAGUCCU (SEQ ID NO:
35) 2) UUCCCACCUGACACGACUCU (SEQ ID NO: 36) 3) GUUCAGCCUCAGCCACUCCU
(SEQ ID NO: 37) 4) AGUCCUCCCGCUUCACAGA (SEQ ID NO: 38) 5)
GCCCACUUCCAGUUCCUUUCC
[0180] In another embodiment, ribozymes can be designed to cleave
the mRNA at a desired position. (See, e.g., Cech, 1995,
Biotechnology 13:323; and Edgington, 1992, Biotechnology 10:256 and
Hu et al., PCT Publication WO 94/03596).
[0181] The antisense nucleic acids (DNA, RNA, modified, analogues,
and the like) can be made using any suitable method for producing a
nucleic acid, such as the chemical synthesis and recombinant
methods disclosed herein and known to one of skill in the art. In
one embodiment, for example, antisense RNA molecules may be
prepared by de novo chemical synthesis or by cloning. For example,
an antisense RNA can be made by inserting (ligating) a sEH gene
sequence in reverse orientation operably linked to a promoter in a
vector (e.g., plasmid). Provided that the promoter and, preferably
termination and polyadenylation signals, are properly positioned,
the strand of the inserted sequence corresponding to the noncoding
strand will be transcribed and act as an antisense
oligonucleotide.
[0182] It will be appreciated that the oligonucleotides can be made
using nonstandard bases (e.g., other than adenine, cytidine,
guanine, thymine, and uridine) or nonstandard backbone structures
to provides desirable properties (e.g., increased
nuclease-resistance, tighter-binding, stability or a desired Tm).
Techniques for rendering oligonucleotides nuclease-resistant
include those described in PCT Publication WO 94/12633. A wide
variety of useful modified oligonucleotides may be produced,
including oligonucleotides having a peptide-nucleic acid (PNA)
backbone (Nielsen et al., 1991, Science 254:1497) or incorporating
2'-O-methyl ribonucleotides, phosphorothioate nucleotides, methyl
phosphonate nucleotides, phosphotriester nucleotides,
phosphorothioate nucleotides, phosphoramidates.
[0183] Proteins have been described that have the ability to
translocate desired nucleic acids across a cell membrane.
Typically, such proteins have amphiphilic or hydrophobic
subsequences that have the ability to act as membrane-translocating
carriers. For example, homeodomain proteins have the ability to
translocate across cell membranes. The shortest internalizable
peptide of a homeodomain protein, Antennapedia, was found to be the
third helix of the protein, from amino acid position 43 to 58 (see,
e.g., Prochiantz, Current Opinion in Neurobiology 6:629-634 (1996).
Another subsequence, the h (hydrophobic) domain of signal peptides,
was found to have similar cell membrane translocation
characteristics (see, e.g., Lin et al., J. Biol. Chem.
270:14255-14258 (1995)). Such subsequences can be used to
translocate oligonucleotides across a cell membrane.
Oligonucleotides can be conveniently derivatized with such
sequences. For example, a linker can be used to link the
oligonucleotides and the translocation sequence. Any suitable
linker can be used, e.g., a peptide linker or any other suitable
chemical linker.
[0184] More recently, it has been discovered that siRNAs can be
introduced into mammals without eliciting an immune response by
encapsulating them in nanoparticles of cyclodextrin. Information on
this method can be found on the worldwide web at "nature.
com/news/2005/050418/full/050418-6.html."
[0185] In another method, the nucleic acid is introduced directly
into superficial layers of the skin or into muscle cells by a jet
of compressed gas or the like. Methods for administering naked
polynucleotides are well known and are taught, for example, in U.S.
Pat. No. 5,830,877 and International Publication Nos. WO 99/52483
and 94/21797. Devices for accelerating particles into body tissues
using compressed gases are described in, for example, U.S. Pat.
Nos. 6,592,545, 6,475,181, and 6,328,714. The nucleic acid may be
lyophilized and may be complexed, for example, with polysaccharides
to form a particle of appropriate size and mass for acceleration
into tissue. Conveniently, the nucleic acid can be placed on a gold
bead or other particle which provides suitable mass or other
characteristics. Use of gold beads to carry nucleic acids into body
tissues is taught in, for example, U.S. Pat. Nos. 4,945,050 and
6,194,389.
[0186] The nucleic acid can also be introduced into the body in a
virus modified to serve as a vehicle without causing pathogenicity.
The virus can be, for example, adenovirus, fowlpox virus or
vaccinia virus.
[0187] miRNAs and siRNAs differ in several ways: miRNA derive from
points in the genome different from previously recognized genes,
while siRNAs derive from mRNA, viruses or transposons, miRNA
derives from hairpin structures, while siRNA derives from longer
duplexed RNA, miRNA is conserved among related organisms, while
siRNA usually is not, and miRNA silences loci other than that from
which it derives, while siRNA silences the loci from which it
arises. Interestingly, miRNAs tend not to exhibit perfect
complementarity to the mRNA whose expression they inhibit. See,
McManus et al., supra. See also, Cheng et al., Nucleic Acids Res.
33(4):1290-7 (2005); Robins and Padgett, Proc Natl Acad Sci USA.
102(11):4006-9 (2005); Brennecke et al., PLoS Biol. 3(3):e85
(2005). Methods of designing miRNAs are known. See, e.g., Zeng et
al., Methods Enzymol. 392:371-80 (2005); Krol et al., J Biol Chem.
279(40):42230-9 (2004); Ying and Lin, Biochem Biophys Res Commun.
326(3):515-20 (2005).
[0188] 5. Epoxygenated Fatty Acids
[0189] In some embodiments, an epoxygenated fatty acid is
administered as an agent that increases EETs. Illustrative
epoxygenated fatty acids include epoxides of linoleic acid,
eicosapentaenoic acid ("EPA") and docosahexaenoic acid ("DHA").
[0190] The fatty acids eicosapentaenoic acid ("EPA") and
docosahexaenoic acid ("DHA") have recently become recognized as
having beneficial effects, and fish oil tablets, which are a good
source of these fatty acids, are widely sold as supplements. In
2003, it was reported that these fatty acids reduced pain and
inflammation. Sethi, S. et al., Blood 100: 1340-1346 (2002). The
paper did not identify the mechanism of action, nor the agents
responsible for this relief.
[0191] Cytochrome P450 ("CYP450") metabolism produces
cis-epoxydocosapentaenoic acids ("EpDPEs") and
cis-epoxyeicosatetraenoic acids ("EpETEs") from docosahexaenoic
acid ("DHA") and eicosapentaenoic acid ("EPA"), respectively. These
epoxides are known endothelium-derived hyperpolarizing factors
("EDHFs"). These EDHFs, and others yet unidentified, are mediators
released from vascular endothelial cells in response to
acetylcholine and bradykinin, and are distinct from the NOS-
(nitric oxide) and COX-derived (prostacyclin) vasodilators. Overall
cytochrome P450 (CYP450) metabolism of polyunsaturated fatty acids
produces epoxides, such as EETs, which are prime candidates for the
active mediator(s). 14(15)-EpETE, for example, is derived via
epoxidation of the 14,15-double bond of EPA and is the .omega.-3
homolog of 14(15)-EpETrE ("14(15)EET") derived via epoxidation of
the 14,15-double bond of arachidonic acid.
[0192] As mentioned, it is beneficial to elevate the levels of
EETs, which are epoxides of the fatty acid arachidonic acid. Our
studies of the effects of EETs has led us to realization that the
anti-inflammatory effect of EPA and DHA are likely due to
increasing the levels of the epoxides of these two fatty acids.
Thus, increasing the levels of epoxides of EPA, of DHA, or of both,
will act to reduce pain and inflammation, and symptoms associated
with diabetes and metabolic syndromes, in mammals in need thereof.
This beneficial effect of the epoxides of these fatty acids has not
been previously recognized. Moreover, these epoxides have not
previously been administered as agents, in part because, as noted
above, epoxides have generally been considered too labile to be
administered.
[0193] Like EETs, the epoxides of EPA and DHA are substrates for
sEH. The epoxides of EPA and DHA are produced in the body at low
levels by the action of cytochrome P450s. Endogenous levels of
these epoxides can be maintained or increased by the administration
of sEHi. However, the endogenous production of these epoxides is
low and usually occurs in relatively special circumstances, such as
the resolution of inflammation. Our expectation is that
administering these epoxides from exogenous sources will aid in the
resolution of inflammation and in reducing pain, as well as with
symptoms of diabetes and metabolic syndromes. It is further
beneficial with pain or inflammation to inhibit sEH with sEHi to
reduce hydrolysis of these epoxides, thereby maintaining them at
relatively high levels.
[0194] EPA has five unsaturated bonds, and thus five positions at
which epoxides can be formed, while DHA has six. The epoxides of
EPA are typically abbreviated and referred to generically as
"EpETEs", while the epoxides of DHA are typically abbreviated and
referred to generically as "EpDPEs". The specific regioisomers of
the epoxides of each fatty acid are set forth in the following
Table:
TABLE-US-00007 TABLE A Regioisomers of Eicosapentaenoic acid
("EPA") epoxides: 1. Formal name:
(.+-.)5(6)-epoxy-8Z,11Z,14Z,17Z-eicosatetraenoic acid, Synonym
5(6)-epoxy Eicosatetraenoic acid Abbreviation 5(6)-EpETE 2. Formal
name: (.+-.)8(9)-epoxy-5Z,11Z,14Z,17Z-eicosatetraenoic acid,
Synonym 8(9)-epoxy Eicosatetraenoic acid Abbreviation 8(9)-EpETE 3.
Formal name: (.+-.)11(12)-epoxy-5Z,8Z,14Z,17Z-eicosatetraenoic
acid, Synonym 11(12)-epoxy Eicosatetraenoic acid Abbreviation
11(12)-EpETE 4. Formal name:
(.+-.)14(15)-epoxy-5Z,8Z,11Z,17Z-eicosatetraenoic acid, Synonym
14(15)-epoxy Eicosatetraenoic acid Abbreviation 14(15)-EpETE 5.
Formal name: (.+-.)17(18)-epoxy-5Z,8Z,11Z,14Z-eicosatetraenoic
acid, Synonym 17(18)-epoxy Eicosatetraenoic acid Abbreviation
17(18)-EpETE Regioisomers of Docosahexaenoic acid ("DHA") epoxides:
1. Formal name: (.+-.) 4(5)-epoxy-7Z,10Z,13Z,16Z,19Z-
docosapentaenoic acid, Synonym 4(5)-epoxy Docosapentaenoic acid
Abbreviation 4(5)-EpDPE 2. Formal name: (.+-.)
7(8)-epoxy-4Z,10Z,13Z,16Z,19Z- docosapentaenoic acid, Synonym
7(8)-epoxy Docosapentaenoic acid Abbreviation 7(8)-EpDPE 3. Formal
name: (.+-.)10(11)-epoxy-4Z,7Z,13Z,16Z,19Z- docosapentaenoic acid,
Synonym 10(11)-epoxy Docosapentaenoic acid Abbreviation
10(11)-EpDPE 4. Formal name: (.+-.)13(14)-epoxy-4Z,7Z,10Z,16Z,19Z-
docosapentaenoic acid, Synonym 13(14)-epoxy Docosapentaenoic acid
Abbreviation 13(14)-EpDPE 5. Formal name: (.+-.)
16(17)-epoxy-4Z,7Z,10Z,13Z,19Z- docosapentaenoic acid, Synonym
16(17)-epoxy Docosapentaenoic acid Abbreviation 16(17)-EpDPE 6.
Formal name: (.+-.) 19(20)-epoxy-4Z,7Z,10Z,13Z,16Z-
docosapentaenoic acid, Synonym 19(20)-epoxy Docosapentaenoic acid
Abbreviation 19(20)-EpDPE
[0195] Any of these epoxides, or combinations of any of these, can
be administered in the compositions and methods.
[0196] 6. Co-Administration with Anti-Inflammatory and/or Analgesic
Agents
[0197] In various embodiments, the agent that increases EETs (e.g.,
inhibitor of sEH, EET, epoxygenated fatty acid, and mixtures
thereof) is co-administered with an anti-inflammatory and/or
analgesic agent. One or both of the agent that increases EETs and
the anti-inflammatory and/or analgesic agent can be administered in
a sub-therapeutic amount.
[0198] a. Inhibitors of COX-1 and/or COX-2
[0199] Current non-steroidal anti-inflammatory drugs (NSAIDs)
inhibit both isoforms, but most tend to inhibit the two isoforms to
different degrees. Since COX-2 is considered the enzyme associated
with an inflammatory response, enzyme selectivity is generally
measured in terms of specificity for COX-2. Typically, cells of a
target organ that express COX-1 or COX-2 are exposed to increasing
levels of NSAIDs. If the cell does not normally produce COX-2,
COX-2 is induced by a stimulant, usually bacterial
lipopolysaccharide (LPS).
[0200] The relative activity of NSAIDs on COX-1 and COX-2 is
expressed by the ratio of IC.sub.50s for each enzyme: COX-2
(IC.sub.50)/COX-1 (IC.sub.50). The smaller the ratio, the more
specific the NSAID is for COX-2. For example, various NSAIDs have
been reported to have ratios of COX-2 (IC.sub.50)/COX-1 (IC.sub.50)
ranging from 0.33 to 122. See, Englehart et al., J Inflammatory Res
44:422-33 (1995). Aspirin has an IC.sub.50 ratio of 0.32,
indicating that it inhibits COX-1 more than COX-2, while
indomethacin is considered a COX-2 inhibitor since its COX-2
(IC.sub.50)/COX-1 (IC.sub.50) ratio is 33. Even selective COX-2
inhibitors retain some COX-1 inhibition at therapeutic levels
obtained in vivo. Cryer and Feldman, Am J Med. 104(5):413-21
(1998).
[0201] Commercially available NSAIDs that find use in the methods
and compositions include the traditional NSAIDs diclofenac
potassium, diclofenac sodium, diclofenac sodium with misoprostol,
diflunisal, etodolac, fenoprofen calcium, flurbiprofen, ibuprofen,
indomethacin, ketoprofen, meclofenamate sodium, mefenamic acid,
meloxicam, nabumetone, naproxen sodium, piroxicam, tolmetin sodium,
the selective COX-2 inhibitors celecoxib, rofecoxib, and
valdecoxib, the acetylated salicylates, such as aspirin, and the
non-acetylated salicylates, such as magnesium salicylate, choline
salicylate, salsalate, salicylic acid esters and sodium
salicylate.
[0202] b. Inhibitors of 5-LOX
[0203] Metabolism of arachidonic acid through the lipoxygenase
("LOX") pathway lead to the formation of leukotrienes ("LTs") that
are implicated in a range of pathologies. The primary inflammatory
enzyme is 5-lipoxygenase ("5-LOX"). The 5-LOX cascade results in
the formation of LTB4 and the cysteinyl LTs LTC4, LTD4, and LTE4.
LTB4 is a potent stimulator of leukocyte activation. Cysteinyl LTs
"may participate in the damage of gastric mucosa by inducing
mucosal microvascular injury and gastric vessel vasoconstriction,
promoting breakdown of the mucosal barrier and stimulating the
secretion of gastric acid, as well as the production of interleukin
1 ("IL1") and proinflammatory cytokines." Martel-Pelletier et al.,
Ann. Rheumatic Dis 62:501-509 (2003) ("Martel-Pelletier 2003").
Additional lipoxygenases, 12-LOX and 15-LOX, exist that contribute
to the formation of anti-inflammatory compounds known as lipoxins,
or LXs. Thus, for purposes of reducing inflammation, it is
desirable to inhibit 5-LOX without also inhibiting 12-LOX and
15-LOX.
[0204] Because of its role in inflammation, a number of inhibitors
of 5-LOX have been developed. See, e.g., Julemont et al., Expert
Opinion on Therapeutic Patents, 13(1):1-13 (2003) (review of
patents directed to 5-LOX inhibitors for 1999-2002). One orally
effective inhibitor is REV 5901
[alpha-pentyl-3-(2-quinolinylmethoxy)-benzene-methanol] (see, Van
Inwegen et al., Pharmacol Exp Therapeutics 241(1):117-124 (1987)).
5-LOX can also be inhibited by inhibiting the 5-lipoxygenase
activating protein ("FLAP") by MK-886. (see, Smirnov et al., Br J
Pharmacol 124:572-578 (1998)). This inhibitor, however, induces
apoptosis in some cell types and is best used in in vitro studies.
Other inhibitors are described in, e.g., U.S. Patent Application
No. 20040198768
[0205] c. Joint COX/LOX Inhibitors
[0206] Because of the inflammatory effects of prostaglandins and
leukotrienes, and because blocking the COX pathway has been thought
to shuttle arachidonic acid into the LOX pathway, it has been
suggested that dual inhibition of both COX-2 and 5-LOX would
maximize the inhibition of inflammation. See, e.g.,
Martel-Pelletier 2003, supra. Several compounds have been developed
to block both COX-2 and 5-LOX. One, tepoxalin, blocks COX-1, COX-2,
and 5-LOX, and is commercially available as a veterinary
pharmaceutical for dogs, under the name Zubrin.RTM. (Schering
Plough Animal Health Corp., Union, N.J.). Tepoxalin has also been
shown to block the COX enzymes and LOX in humans and to be well
tolerated. A second inhibitor of COX and 5-LOX, licofelone (Merkle
GmbH, Germany), is in Phase III clinical trials as a treatment for
osteoarthritis and has shown gastric tolerability superior to
naproxen. See, Bias et al., Am J Gastroenterol 99(4):611 (2004).
See also, Martel-Pelletier 2003, supra; Tries et al., Inflamm Res
51:135-43 (2002). A number of other dual COX/LOX inhibitors, and
especially COX-2/5-LOX inhibitors, have been developed, as
exemplified by U.S. Pat. No. 6,753,344 (thiophene substituted
hydroxamic acid derivatives), U.S. Pat. No. 6,696,477 (heterocyclo
substituted hydroxamic acid derivatives), U.S. Pat. No. 6,677,364
(substituted sulfonylphenylheterocycles), and U.S. Patent
Application Nos. 20040248943 (pyrazole substituted hydroxamic acid
derivatives), 20040147565 (substituted sulfonylphenylheterocycles),
20030180402 (flavans isolated from the genus Acacia), and
20030176708 (thiophene substituted hydroxamic acid
derivatives).
[0207] d. Phosphodiesterase Inhibitors (PDEi)
[0208] In various embodiments, the inhibitor of sEH is
co-administered with an inhibitor of phosphodiesterase. The PDEi
may or may not be selective, specific or preferential for cAMP.
Exemplary PDEs that degrade cAMP include without limitation PDE3,
PDE4, PDE7, PDE8 and PDE10. Exemplary cAMP selective hydrolases
include PDE4, 7 and 8. Exemplary PDEs that hydrolyse both cAMP and
cGMP include PDE1, 2, 3, 10 and 11. Isoenzymes and isoforms of PDEs
are well known in the art. See, e.g., Boswell-Smith et al., Brit.
J. Pharmacol. 147:S252-257 (2006), and Reneerkens, et al.,
Psychopharmacology (2009) 202:419-443, the contents of which are
incorporated herein by reference.
[0209] In some embodiments, the PDE inhibitor is a non-selective
inhibitor of PDE. Exemplary non-selective PDE inhibitors that find
use include without limitation caffeine, theophylline,
isobutylmethylxanthine, aminophylline, pentoxifylline, vasoactive
intestinal peptide (VIP), secretin, adrenocorticotropic hormone,
pilocarpine, alpha-melanocyte stimulating hormone (MSH), beta-MSH,
gamma-MSH, the ionophore A23187, prostaglandin E1.
[0210] In some embodiments, the PDE inhibitor used specifically or
preferentially inhibits PDE4. Exemplary inhibitors that selectively
inhibit PDE4 include without limitation rolipram, roflumilast,
cilomilast, ariflo, HT0712, ibudilast and mesembrine.
[0211] In some embodiments, the PDE inhibitor used specifically or
preferentially inhibits a cAMP PDE, e.g., PDE4, PDE7 or PDE8. In
some embodiments, the PDE inhibitor used inhibits a cAMP PDE, e.g.,
PDE1, PDE2, PDE3, PDE4, PDE7, PDE8, PDE10 or PDE11. Exemplary
agents that inhibit a cAMP phosphodiesterase include without
limitation rolipram, roflumilast, cilomilast, ariflo, HT0712,
ibudilast, mesembrine, cilostamide, enoxamone, milrinone,
siguazodan and BRL-50481.
[0212] In some embodiments, the PDE inhibitor used specifically
inhibits PDE5. Exemplary inhibitors that selectively inhibit PDE5
include without limitation sildenafil, zaprinast, tadalafil,
udenafil, avanafil and vardenafil.
[0213] Other means of inhibiting phosphodiesterase activity or gene
expression can also be used in the methods described herein. For
example, a nucleic acid molecule complementary to at least a
portion of a human phosphodiesterase gene (e.g., PDE3, PDE4, PDE7,
PDE8 and PDE10) can be used to inhibit phosphodiesterase gene
expression. Means for inhibiting gene expression using short RNA
molecules, for example, are known. Among these are short
interfering RNA (siRNA), small temporal RNAs (stRNAs), and
micro-RNAs (miRNAs). Short interfering RNAs silence genes through a
mRNA degradation pathway, while stRNAs and miRNAs are approximately
21 or 22 nt RNAs that are processed from endogenously encoded
hairpin-structured precursors, and function to silence genes via
translational repression. See, e.g., McManus et al., RNA,
8(6):842-50 (2002); Morris et al., Science, 305(5688):1289-92
(2004); He and Hannon, Nat Rev Genet. 5(7):522-31 (2004).
[0214] For purposes of reducing the activity of a phosphodiesterase
enzyme, siRNAs to the gene encoding the phosphodiesterase can be
specifically designed using computer programs. Exemplary nucleotide
sequences encoding the amino acid sequences of the various
phosphodiesterase isoforms are known and published, e.g., in
GenBank, e.g., PDE1A (NM_001003683.1.fwdarw.NP 001003683.1 (isoform
2) and NM_005019.3.fwdarw.NP_005010.2 (isoform 1)); PDE1B
(NM_000924.3.fwdarw.NP_000915.1 (isoform 1) and
NM_001165975.1.fwdarw.NP_001159447.1 (isoform 2)); PDE2A
(NM_002599.3.fwdarw.NP_002590.1 (isoform 1);
NM_001143839.2.fwdarw.NP_001137311.1 (isoform 2) and
NM_001146209.1.fwdarw.NP_001139681.1 (isoform 3)); PDE3A
(NM_000921.3.fwdarw.NP_000912.3); PDE3B
(NM_000922.3.fwdarw.NP_000913.2); PDE4A
(NM_001111307.1.fwdarw.NP_001104777.1 (isoform 1);
NM_001111308.1.fwdarw.NP_001104778.1 (isoform 2);
NM_001111309.1.fwdarw.NP_001104779.1 (isoform 3);
NM_006202.2.fwdarw.NP_006193.1 (isoform 4)); PDE4B
(NM_002600.3.fwdarw.NP_002591.2 (isoform 1);
NM_001037341.1.fwdarw.NP_001032418.1 (isoform 1);
NM_001037339.1.fwdarw.NP_001032416.1 (isoform 2);
NM_001037340.1.fwdarw.NP_001032417.1 (isoform 3)); PDE4C-1
(NM_000923.3.fwdarw.NP_000914.2); PDE4C-2
(NM_001098819.1.fwdarw.NP_001092289.1); PDE4C-3
(NM_001098818.1.fwdarw.NP_001092288.1); PDE4D1
(NM_001197222.1.fwdarw.NP_001184151.1); PDE4D2
(NM_001197221.1.fwdarw.NP_001184150.1); PDE4D3
(NM_006203.4.fwdarw.NP_006194.2); PDE4D4
(NM_001104631.1.fwdarw.NP_001098101.1); PDE4D5
(NM_001197218.1.fwdarw.NP_001184147.1); PDE4D6
(NM_001197223.1.fwdarw.NP_001184152.1); PDE4D7
(NM_001165899.1.fwdarw.NP_001159371.1); PDE4D8
(NM_001197219.1.fwdarw.NP_001184148.1); PDE5A
(NM_001083.3.fwdarw.NP_001074.2 (isoform 1);
NM_033430.2.fwdarw.NP_236914.2 (isoform 2);
NM_033437.3.fwdarw.NP_246273.2 (isoform 3)); PDE7A
(NM_002603.2.fwdarw.NP_002594.1 (isoform a);
NM_002604.2.fwdarw.NP_002595.1 (isoform b)); PDE7B
(NM_018945.3.fwdarw.NP_061818.1); PDE8A
(NM_002605.2.fwdarw.NP_002596.1 (isoform 1);
NM_173454.1.fwdarw.NP_775656.1 (isoform 2)); PDE8B
(NM_003719.3.fwdarw.NP_003710.1 (isoform 1);
NM_001029854.2.fwdarw.NP_001025025.1 (isoform 2);
NM_001029851.2.fwdarw.NP_001025022.1 (isoform 3);
NM_001029853.2.fwdarw.NP_001025024.1 (isoform 4);
NM_001029852.2.fwdarw.NP_001025023.1 (isoform 5)).
[0215] As discussed above, software programs for predicting siRNA
sequences to inhibit the expression of a target protein are
commercially available and find use. One program, siDESIGN from
Dharmacon, Inc. (Lafayette, Colo.), permits predicting siRNAs for
any nucleic acid sequence, and is available on the internet at
dharmacon.com. Programs for designing siRNAs are also available
from others, including Genscript (available on the internet at
genscript.com/ssl-bin/app/rnai) and, to academic and non-profit
researchers, from the Whitehead Institute for Biomedical Research
found on the worldwide web at
"jura.wi.mit.edu/pubint/http://iona.wi.mit.edu/siRNAext/."
[0216] e. Other Anti-Inflammatory or Analgesic Agents
[0217] Other non-NSAID anti-inflammatory agents may also be
co-administered with an agent that increases EETs (e.g., an
inhibitor of sEH, an EET, an epoxygenated fatty acid, and mixtures
thereof). For example, an agent that increases EETs (e.g., an
inhibitor of sEH, an EET, an epoxygenated fatty acid, and mixtures
thereof) can be co-administered with an agent that blocks binding
of IL-6 to its cognate receptor (IL6R) or an agent that blocks
binding of tumor necrosis factor alpha (TNF.alpha.) to its cognate
receptor. Monoclonal antibodies directed against IL6 or IL6R and
their potential impact for treatment of tumor-associated cachexia
and as antitumoral agents are reviewed, e.g., by Weidle, et al.,
Cancer Genomics Proteomics. (2010) 7(6):287-302. Treatment with
anti-TNF monoclonal antibodies (e.g., infliximab, adalimumab, and
certolizumab pegol) has been shown to provide substantial benefit
to patients through reductions in both localized and systemic
expression of markers associated with inflammation. Alternatively,
an agent that increases EETs (e.g., an inhibitor of sEH, an EET, an
epoxygenated fatty acid, and mixtures thereof) may be
co-administered with a soluble TNF.alpha. receptor (e.g.,
etanercept) and/or a soluble IL6 receptor. See, e.g., Sethi, et
al., Adv Exp Med Biol. (2009) 647:37-51. In other embodiments, an
agent that increases EETs (e.g., an inhibitor of sEH, an EET, an
epoxygenated fatty acid, and mixtures thereof) is co-administered
with glucosamine, chondroitin sulfate and/or polysulfated
glycosaminoglycan (Adequan).
[0218] In various embodiments, the inhibitor of sEH is
co-administered with an active agent selected from the group
consisting of Gamma-aminobutyric Acid (GABA) analogs,
N-methyl-D-aspartate receptor antagonists, opioids and sodium
channel blockers, or analogs or pro-drugs thereof.
[0219] In various embodiments, the inhibitor of sEH is
co-administered with a Gamma-aminobutyric Acid (GABA) analog, or
analogs or pro-drugs thereof. Illustrative Gamma-aminobutyric Acid
(GABA) analogs include without limitation gabapentin, pregabalin,
and analogs or pro-drugs thereof. In some embodiments, one or both
of the inhibitor of sEH and the Gamma-aminobutyric Acid (GABA)
analog (e.g., gabapentin or pregabalin, or analogs or pro-drugs
thereof), are administered in a sub-therapeutic amount.
[0220] In various embodiments, the inhibitor of sEH is
co-administered with an N-methyl-D-aspartate receptor antagonist,
or an analog or pro-drug thereof. Illustrative N-methyl-D-aspartate
receptor antagonists include without limitation: AP5 (APV,
R-2-amino-5-phosphonopentanoate); AP7 (2-amino-7-phosphonoheptanoic
acid); CPPene
(3-[(R)-2-carboxypiperazin-4-yl]-prop-2-enyl-1-phosphonic acid);
Selfotel; Amantadine; Dextrallorphan; Dextromethorphan;
Dextrorphan; Dizocilpine (MK-801); Eticyclidine; Gacyclidine;
Ibogaine; Memantine; Methoxetamine; Nitrous oxide; Phencyclidine;
Rolicyclidine; Tenocyclidine; Methoxydine; Tiletamine; Xenon;
Neramexane; Eliprodil; Etoxadrol; Dexoxadrol; NEFA
((4aR,9aS)--N-Ethyl-4,4a,9,9a-tetrahydro-1H-fluoren-4a-amine);
Remacemide; Delucemine; 8a-Phenyldecahydroquinoline (8A-PDHQ);
Aptiganel (Cerestat, CNS-1102); Dexanabinol (HU-211);
Rhynchophylline; and Ketamine.
[0221] In various embodiments, the inhibitor of sEH is
co-administered with an opioid, or an analog or pro-drug thereof.
Illustrative opioids include without limitation morphine, codeine,
thebaine, heroin, hydromorphone, hydrocodone, oxycodone,
oxymorphone, desomorphine, nicomorphine, dipropanoylmorphine,
benzylmorphine, ethylmorphine, buprenorphine, fentanyl, pethidine,
methadone, tramadol and dextropropoxyphene.
[0222] In various embodiments, the inhibitor of sEH is
co-administered with a sodium channel blockers, or an analog or
pro-drug thereof. Illustrative sodium channel blockers include
without limitation tetrodotoxin (TTX), saxitoxin (STX), Benzocaine,
Chloroprocaine, Cocaine, Cyclomethycaine, Dimethocaine/Larocaine,
Piperocaine, Propoxycaine, Procaine/Novocaine, Proparacaine,
Tetracaine/Amethocaine, Articaine, Bupivacaine,
Cinchocaine/Dibucaine, Etidocaine, Levobupivacaine,
Lidocaine/Lignocaine, Mepivacaine, Prilocaine, Ropivacaine,
Trimecaine, and Lidocaine/prilocaine (EMLA), quinidine,
procainamide, disopryamide, tocainide, mexiletine, flecainide,
propafenone, moricizine, Carbamazepine, Phenytoin, Fosphenytoin,
Oxcarbazepine, Lamotrigine, and Zonisamide.
[0223] In various embodiments, the one or more of the inhibitor of
sEH and the active agent selected from the group consisting of
Gamma-aminobutyric Acid (GABA) analogs, N methyl-D-aspartate
receptor antagonists, opioids and sodium channel blockers, or
analogs or pro-drugs thereof, are administered in a sub-therapeutic
amount.
[0224] 7. Formulation and Administration
[0225] In various embodiments of the compositions, the agent that
increases EETs (e.g., an inhibitor of sEH, an EET, an epoxygenated
fatty acid, and mixtures thereof) is administered as the sole
active agent. In other embodiments, an anti-inflammatory agent
and/or analgesic agent is combined with the agent that increases
EETs (e.g., an inhibitor of sEH, an EET, an epoxygenated fatty
acid, and mixtures thereof). The agent that increases EETs and the
anti-inflammatory and/or analgesic agent can be formulated together
(e.g., as a mixture) or separately. Optionally, the compositions
comprise an anti-inflammatory agent and/or analgesic agent, and an
inhibitor of sEH, or one or more EETs or an epoxide of EPA, of DHA,
or one or more epoxides of both. In some embodiments, the
composition is of an epoxide or EPA, of DHA, or epoxides of both,
and an sEHi. The compositions can be prepared and administered in a
wide variety of oral, parenteral and topical dosage forms. In
preferred forms, compositions for use in the methods of the present
invention can be administered orally, by injection, that is,
intravenously, intramuscularly, intracutaneously, subcutaneously,
intraduodenally, or intraperitoneally. The compositions can also be
administered by inhalation, for example, intranasally.
Additionally, the compositions can be administered transdermally.
Accordingly, in some embodiments, the methods contemplate
administration of compositions comprising a pharmaceutically
acceptable carrier or excipient, an agent that increases EETs
(e.g., an sEHi or a pharmaceutically acceptable salt of the
inhibitor and, optionally, one or more EETs or epoxides of EPA or
of DHA, or of both), and optionally an anti-inflammatory agent. In
some embodiments, the methods comprise administration of an sEHi
and one or more epoxides of EPA or of DHA, or of both.
[0226] For preparing the pharmaceutical compositions, the
pharmaceutically acceptable carriers can be either solid or liquid.
Solid form preparations include powders, tablets, pills, capsules,
cachets, suppositories, and dispersible granules. A solid carrier
can be one or more substances which may also act as diluents,
flavoring agents, binders, preservatives, tablet disintegrating
agents, or an encapsulating material.
[0227] In powders, the carrier is a finely divided solid which is
in a mixture with the finely divided active component. In tablets,
the active component is mixed with the carrier having the necessary
binding properties in suitable proportions and compacted in the
shape and size desired. The powders and tablets preferably contain
from 5% or 10% to 70% of the active compound. Suitable carriers are
magnesium carbonate, magnesium stearate, talc, sugar, lactose,
pectin, dextrin, starch, gelatin, tragacanth, methylcellulose,
sodium carboxymethylcellulose, a low melting wax, cocoa butter, and
the like. The term "preparation" is intended to include the
formulation of the active compound with encapsulating material as a
carrier providing a capsule in which the active component with or
without other carriers, is surrounded by a carrier, which is thus
in association with it. Similarly, cachets and lozenges are
included. Tablets, powders, capsules, pills, cachets, and lozenges
can be used as solid dosage forms suitable for oral
administration.
[0228] For preparing suppositories, a low melting wax, such as a
mixture of fatty acid glycerides or cocoa butter, is first melted
and the active component is dispersed homogeneously therein, as by
stirring. The molten homogeneous mixture is then poured into
convenient sized molds, allowed to cool, and thereby to
solidify.
[0229] Liquid form preparations include solutions, suspensions, and
emulsions, for example, water or water/propylene glycol solutions.
For parenteral injection, liquid preparations can be formulated in
solution in aqueous polyethylene glycol solution. Transdermal
administration can be performed using suitable carriers. If
desired, apparatuses designed to facilitate transdermal delivery
can be employed. Suitable carriers and apparatuses are well known
in the art, as exemplified by U.S. Pat. Nos. 6,635,274, 6,623,457,
6,562,004, and 6,274,166.
[0230] Aqueous solutions suitable for oral use can be prepared by
dissolving the active component in water and adding suitable
colorants, flavors, stabilizers, and thickening agents as desired.
Aqueous suspensions suitable for oral use can be made by dispersing
the finely divided active components in water with viscous
material, such as natural or synthetic gums, resins,
methylcellulose, sodium carboxymethylcellulose, and other
well-known suspending agents.
[0231] Also included are solid form preparations which are intended
to be converted, shortly before use, to liquid form preparations
for oral administration. Such liquid forms include solutions,
suspensions, and emulsions. These preparations may contain, in
addition to the active component, colorants, flavors, stabilizers,
buffers, artificial and natural sweeteners, dispersants,
thickeners, solubilizing agents, and the like.
[0232] A variety of solid, semisolid and liquid vehicles have been
known in the art for years for topical application of agents to the
skin. Such vehicles include creams, lotions, gels, balms, oils,
ointments and sprays. See, e.g., Provost C. "Transparent oil-water
gels: a review," Int J Cosmet Sci. 8:233-247 (1986), Katz and
Poulsen, Concepts in biochemical pharmacology, part I. In: Brodie B
B, Gilette J R, eds. Handbook of Experimental Pharmacology. Vol.
28. New York, N.Y.: Springer; 107-174 (1971), and Hadgcraft,
"Recent progress in the formulation of vehicles for topical
applications," Br J Dermatol., 81:386-389 (1972). A number of
topical formulations of analgesics, including capsaicin (e.g.,
Capsin.RTM.), so-called "counter-irritants" (e.g., Icy-Hot.RTM.,
substances such as menthol, oil of wintergreen, camphor, or
eucalyptus oil compounds which, when applied to skin over an area
presumably alter or off-set pain in joints or muscles served by the
same nerves) and salicylates (e.g. BenGay.RTM.), are known and can
be readily adapted for topical administration of sEHi by replacing
the active ingredient or ingredient with an sEHi, with or without
EETs. It is presumed that the person of skill is familiar with
these various vehicles and preparations and they need not be
described in detail herein.
[0233] The agent that increases EETs (e.g., an inhibitor of sEH, an
EET, an epoxygenated fatty acid, and mixtures thereof), optionally
mixed with an anti-inflammatory and/or analgesic agent, can be
mixed into such modalities (creams, lotions, gels, etc.) for
topical administration. In general, the concentration of the agents
provides a gradient which drives the agent into the skin. Standard
ways of determining flux of drugs into the skin, as well as for
modifying agents to speed or slow their delivery into the skin are
well known in the art and taught, for example, in Osborne and
Amann, eds., Topical Drug Delivery Formulations, Marcel Dekker,
1989. The use of dermal drug delivery agents in particular is
taught in, for example, Ghosh et al., eds., Transdermal and Topical
Drug Delivery Systems, CRC Press, (Boca Raton, Fla., 1997).
[0234] In some embodiments, the agents are in a cream. Typically,
the cream comprises one or more hydrophobic lipids, with other
agents to improve the "feel" of the cream or to provide other
useful characteristics. In one embodiment, for example, a cream may
contain 0.01 mg to 10 mg of sEHi, with or without one or more EETs,
per gram of cream in a white to off-white, opaque cream base of
purified water USP, white petrolatum USP, stearyl alcohol NF,
propylene glycol USP, polysorbate 60 NF, cetyl alcohol NF, and
benzoic acid USP 0.2% as a preservative. In various embodiments,
sEHi can be mixed into a commercially available cream,
Vanicream.RTM. (Pharmaceutical Specialties, Inc., Rochester, Minn.)
comprising purified water, white petrolatum, cetearyl alcohol and
ceteareth-20, sorbitol solution, propylene glycol, simethicone,
glyceryl monostearate, polyethylene glycol monostearate, sorbic
acid and BHT.
[0235] In other embodiments, the agent or agents are in a lotion.
Typical lotions comprise, for example, water, mineral oil,
petrolatum, sorbitol solution, stearic acid, lanolin, lanolin
alcohol, cetyl alcohol, glyceryl stearate/PEG-100 stearate,
triethanolamine, dimethicone, propylene glycol, microcrystalline
wax, tri (PPG-3 myristyl ether) citrate, disodium EDTA,
methylparaben, ethylparaben, propylparaben, xanthan gum,
butylparaben, and methyldibromo glutaronitrile.
[0236] In some embodiments, the agent is, or agents are, in an oil,
such as jojoba oil. In some embodiments, the agent is, or agents
are, in an ointment, which may, for example, white petrolatum,
hydrophilic petrolatum, anhydrous lanolin, hydrous lanolin, or
polyethylene glycol. In some embodiments, the agent is, or agents
are, in a spray, which typically comprise an alcohol and a
propellant. If absorption through the skin needs to be enhanced,
the spray may optionally contain, for example, isopropyl
myristate.
[0237] Whatever the form in which the agents that inhibit sEH are
topically administered (that is, whether by solid, liquid, lotion,
gel, spray, etc.), in various embodiments they are administered at
a dosage of about 0.01 mg to 10 mg per 10 cm.sup.2. An exemplary
dose for systemic administration of an inhibitor of sEH is from
about 0.001 .mu.g/kg to about 100 mg/kg body weight of the mammal.
In various embodiments, dose and frequency of administration of an
sEH inhibitor are selected to produce plasma concentrations within
the range of 2.5 .mu.M and 30 nM.
[0238] The agent that increases EETs (e.g., an inhibitor of sEH, an
EET, an epoxygenated fatty acid, and mixtures thereof), optionally
mixed with an anti-inflammatory and/or analgesic agent, can be
introduced into the bowel by use of a suppository. As is known in
the art, suppositories are solid compositions of various sizes and
shapes intended for introduction into body cavities. Typically, the
suppository comprises a medication, which is released into the
immediate area from the suppository. Typically, suppositories are
made using a fatty base, such as cocoa butter, that melts at body
temperature, or a water-soluble or miscible base, such as
glycerinated gelatin or polyethylene glycol.
[0239] The pharmaceutical preparation is preferably in unit dosage
form. In such form the preparation is subdivided into unit doses
containing appropriate quantities of the active component. The unit
dosage form can be a packaged preparation, the package containing
discrete quantities of preparation, such as packeted tablets,
capsules, and powders in vials or ampoules. Also, the unit dosage
form can be a capsule, tablet, cachet, or lozenge itself, or it can
be the appropriate number of any of these in packaged form.
[0240] The term "unit dosage form", as used in the specification,
refers to physically discrete units suitable as unitary dosages for
human subjects and animals, each unit containing a predetermined
quantity of active material calculated to produce the desired
pharmaceutical effect in association with the required
pharmaceutical diluent, carrier or vehicle. The specifications for
the novel unit dosage forms of this invention are dictated by and
directly dependent on (a) the unique characteristics of the active
material and the particular effect to be achieved and (b) the
limitations inherent in the art of compounding such an active
material for use in humans and animals, as disclosed in detail in
this specification, these being features of the present
invention.
[0241] A therapeutically effective amount or a sub-therapeutic
amount of one or more of the following: an sEH inhibitor, an EET,
an epoxygenated fatty acid, can be administered in combination with
an anti-inflammatory agent (e.g., inhibitors of COX-1 or of -2, or
both, or of a LOX enzyme). The dosage of the specific compounds
depends on many factors that are well known to those skilled in the
art. They include for example, the route of administration and the
potency of the particular compound. An exemplary dose is from about
0.001 .mu.g/kg to about 100 mg/kg body weight of the mammal. Doses
of anti-inflammatory agents (e.g., NSAIDs, including inhibitors of
COX-1, COX-2 and/or 5-LOX), phosphodiesterase inhibitors,
Gamma-aminobutyric Acid (GABA) analogs (e.g., gabapentin and/or
pregabalin), N-methyl-D-aspartate receptor antagonists, opioids and
sodium channel blockers, or analogs or pro-drugs thereof are known
in the art, and can be found, e.g., in the published literature and
in reference texts, e.g., the Physicians' Desk Reference, 66th Ed.,
2012, Thomson Healthcare or Brunton, et al., Goodman & Gilman's
The Pharmacological Basis of Therapeutics, 12th edition, 2010,
McGraw-Hill Professional). Because of the cooperative action
between the agent that increases EETs (e.g., an sEH inhibitor, an
EET, an epoxygenated fatty acid, and mixtures thereof) and the
anti-inflammatory agent, one or both of the co-administered agents
can be administered at a sub-therapeutic dose.
[0242] Determination of an effective amount is well within the
capability of those skilled in the art, especially in light of the
detailed disclosure provided herein. Generally, an efficacious or
effective amount of a combination of one or more polypeptides of
the present invention is determined by first administering a low
dose or small amount of a polypeptide or composition and then
incrementally increasing the administered dose or dosages, adding a
second or third medication as needed, until a desired effect of is
observed in the treated subject with minimal or no toxic side
effects. Applicable methods for determining an appropriate dose and
dosing schedule for administration of a combination of the present
invention are described, for example, in Goodman and Gilman's The
Pharmacological Basis of Therapeutics, 12th Edition, 2010, supra;
in a Physicians' Desk Reference (PDR), 65.sup.th Edition, 2011; in
Remington: The Science and Practice of Pharmacy, 21.sup.st Ed.,
2005, supra; and in Martindale: The Complete Drug Reference,
Sweetman, 2005, London: Pharmaceutical Press, and in Martindale,
Martindale: The Extra Pharmacopoeia, 31st Edition, 1996, Amer
Pharmaceutical Assn, each of which are hereby incorporated herein
by reference.
[0243] EETs, EpDPEs, or EpETEs are unstable, and can be converted
to the corresponding diols, in acidic conditions, such as those in
the stomach. To avoid this, EETs, EpDPEs, or EpETEs can be
administered intravenously or by injection. EETs, EpDPEs, or EpETEs
intended for oral administration can be encapsulated in a coating
that protects the compounds during passage through the stomach. For
example, the EETs, EpDPEs, or EpETEs can be provided with a
so-called "enteric" coating, such as those used for some brands of
aspirin, or embedded in a formulation. Such enteric coatings and
formulations are well known in the art. In some formulations, the
compositions are embedded in a slow-release formulation to
facilitate administration of the agents over time.
[0244] It is understood that, like all drugs, sEHis have half-lives
defined by the rate at which they are metabolized by or excreted
from the body, and that the sEHis will have a period following
administration during which they will be present in amounts
sufficient to be effective. If EETs, EpDPEs, or EpETEs are
administered after the sEHi is administered, therefore, it is
desirable that the EETs, EpDPEs, or EpETEs be administered during
the period during which the sEHi will be present in amounts to be
effective in delaying hydrolysis of the EETs, EpDPEs, or EpETEs.
Typically, the EETs, EpDPEs, or EpETEs will be administered within
48 hours of administering an sEH inhibitor. Preferably, the EETs,
EpDPEs, or EpETEs are administered within 24 hours of the sEHi, and
even more preferably within 12 hours. In increasing order of
desirability, the EETs, EpDPEs, or EpETEs are administered within
10, 8, 6, 4, 2, hours, 1 hour, or one half hour after
administration of the inhibitor. When co-administered, the EETs,
EpDPEs, or EpETEs are preferably administered concurrently with the
sEHi.
[0245] It will be appreciated that the sEHis and, optionally, the
EETs, EpDPEs, or EpETEs, do not need to be combined with the
anti-inflammatory agent (e.g., COX-1 inhibitor, COX-2 inhibitor,
LOX inhibitor, or COX/LOX inhibitor) or the analgesic agent. They
can instead be administered separately. If the sEHis are
administered separately (with or without EETs, EpDPEs, or EpETEs),
they should be administered shortly before or concurrently with
administration of the anti-inflammatory agent (e.g., COX-1
inhibitor, COX-2 inhibitor, LOX inhibitor, or COX/LOX inhibitor) or
analgesic agent. If the sEHi is administered after administration
of the anti-inflammatory agent (e.g., COX-1 inhibitor, COX-2
inhibitor, LOX inhibitor, or COX/LOX inhibitor) or analgesic agent,
it should be administered as soon as possible after administration
of the anti-inflammatory agent (e.g., COX-1 inhibitor, COX-2
inhibitor, LOX inhibitor, or COX/LOX inhibitor) or analgesic agent
to maximize the cooperative action between the co-administered
agents. Administration of the sEHi will still be beneficial even if
it follows the anti-inflammatory agent (e.g., COX-1 inhibitor,
COX-2 inhibitor, LOX inhibitor, or COX/LOX inhibitor) or analgesic
agent by some time, however, so long as amounts of the
anti-inflammatory agent (e.g., COX-1 inhibitor, COX-2 inhibitor,
LOX inhibitor, or COX/LOX inhibitor) or analgesic agent are
sufficient to inhibit the respective enzyme are still present.
[0246] 8. Methods of Monitoring
[0247] A variety of methods can be employed in determining efficacy
of therapeutic and/or prophylactic treatment of pain and/or
inflammation with an agent that increases EETs, optionally in
combination with an anti-inflammatory and/or analgesic agent.
Generally, efficacy is the capacity to produce an effect without
significant toxicity. Efficacy indicates that the therapy provides
therapeutic or prophylactic effects for a given intervention
(examples of interventions can include by are not limited to
administration of a pharmaceutical formulation, employment of a
medical device, or employment of a surgical procedure). Efficacy
can be measured by comparing treated to untreated individuals or by
comparing the same individual before and after treatment. Efficacy
of a treatment can be determined using a variety of methods,
including pharmacological studies, diagnostic studies, predictive
studies and prognostic studies. Examples of indicators of efficacy
include but are not limited to patient response to stimulus (e.g.,
touching, pressure, temperature or weight-bearing), blood levels of
PGE.sub.2, blood pressure, heart rate, behavior assessment (e.g.,
level of activity, limb load distribution, kinematics, loss of
laminitis stance, willingness to stand and walk without
encouragement, eating). In various embodiments, efficacy can be
determined by assigning a pain score, e.g., using a visual analog
scale (VAS) or other known methods for quantifying pain in a
non-human animal. See, e.g., Bufalari, et al., Veterinary Research
Communications, 31(Suppl. 1), 55-58; Love, et al., Vet Anaesth
Analg. (2011) 38(1):3-14; Vinuela-Fernandez, et al., Equine Vet J.
(2011) 43(1):62-8; Ashley, et al., Equine Vet J. (2005)
37(6):565-75; Guillot, et al., J Vet Intern Med. (2011)
25(5):1050-6; Hielm-Bjorkman, et al., Am J Vet Res. (2011)
72(5):601-7; Brown, et al., J Am Vet Med Assoc. (2010)
237(1):66-70; and Brondani, et al., Am J Vet Res. (2011)
72(2):174-83. A lower pain score assigned after treatment with the
agent that increases EETs indicates efficacy.
[0248] The methods of the present invention provide for detecting
prevention, reduction, inhibition and/or reversal of painful and/or
inflammatory conditions in a non-human mammal. A variety of methods
can be used to monitor both therapeutic treatment for symptomatic
patients and prophylactic treatment for asymptomatic patients.
[0249] Monitoring methods entail determining a baseline value of
pain and/or inflammation in a patient before administering a dosage
of the one or more agents that increase EETs, optionally in
combination with an anti-inflammatory and/or analgesic agent, and
comparing this with a value of pain and/or inflammation after
treatment, respectively. The value can be based on one or more
indicators of efficacy.
[0250] With respect to therapies using one or more agents that
increase EETs, a significant decrease (i.e., greater than the
typical margin of experimental error in repeat measurements of the
same sample, expressed as one standard deviation from the mean of
such measurements) in value of the pain and/or inflammation signals
a positive treatment outcome (i.e., that administration of the one
or more agents that increase EETs) has blocked or inhibited, or
reduced progression of the painful and/or inflammatory
condition).
[0251] In other methods, a control value of pain and/or
inflammation (e.g., a mean and standard deviation) is determined
from a control population of individuals who have undergone
successful treatment with an agent that increases EETs). Measured
values of pain and/or inflammation in a patient are compared with
the control value. If the measured level in a patient is not
significantly different (e.g., more than one standard deviation)
from the control value, treatment can be discontinued. If the pain
and/or inflammation levels in the patient are significantly above
the control value, continued administration of the agent that
increases EETs is warranted.
[0252] In other methods, a patient who is not presently receiving
treatment but has undergone a previous course of treatment is
monitored for symptoms and or indicators of pain and/or
inflammation to determine whether a resumption of treatment is
required. The measured value of pain and/or inflammation in the
patient can be compared with a value of pain and/or inflammation
previously achieved in the patient after a previous course of
treatment. A significant increase in pain and/or inflammation
relative to the previous measurement (i.e., greater than a typical
margin of error in repeat measurements of the same sample) is an
indication that treatment can be resumed. Alternatively, the value
measured in a patient can be compared with a control value (mean
plus standard deviation) determined in a population of patients
after successfully undergoing a course of treatment. Alternatively,
the measured value in a patient can be compared with a control
value in populations of prophylactically treated patients who
remain free of symptoms of disease, or populations of
therapeutically treated patients who show amelioration of disease
characteristics. In all of these cases, a significant increase in
pain and/or inflammation relative to the control level (i.e., more
than a standard deviation) is an indicator that treatment should be
resumed in a patient.
[0253] Where a tissue sample is evaluated, the tissue sample for
analysis is can be blood, plasma, serum, mucous, tissue biopsy,
and/or synovial fluid from the patient, as appropriate. Pain and/or
inflammation can be detected using any method known in the art,
e.g., visual observation of a biopsy by a qualified pathologist, or
other visualization techniques, e.g., radiography, ultrasound,
magnetic resonance imaging (MRI).
[0254] Further, the level of immune system activity in conjunction
with pain and/or inflammation in a patient before administering a
dosage of an agent that increases EETs can be compared with a value
for immune system activity in conjunction with pain and/or
inflammation after treatment, respectively.
EXAMPLES
[0255] The following examples are offered to illustrate, but not to
limit the claimed invention.
Example 1
Use of a Soluble Epoxide Hydrolase Inhibitor as Adjunctive
Analgesic in a Laminitic Horse
[0256] A 4-year-old, 500 kg, female Thoroughbred horse was examined
by the Veterinary Field Service of the UCDavis Veterinary Medical
Teaching Hospital with the presenting complain of swollen on the
left forelimb and reluctance to walk. The mare was reportedly found
that morning unable to move, painful in both front feet and a
rectal temperature of 38.6.degree. C. Pertinent previous history
included a moderate to severe lesion (44% tear) of the left
forelimb superficial digital flexor tendon while on the racetrack 7
months prior. The mare was then donated to the UCDavis Center for
Equine Health to be used as a research subject, and was
subsequently enrolled in a stem cell study. The mare underwent
computed tomography angiography followed by intraarterial regional
limb perfusion of 99mTc-HMPAO labeled mesenchymal stem cells of the
left forelimb. The cells were delivered via a catheter placed in
the median artery at the level of the distal radius and the
perfusion was performed without the use of a tourniquet. Swelling
of the region of the left carpus and proximal region of the third
metacarpal bone was noted in the immediate post-operative period.
It resolved without obvious complications following treatment that
included leg bandage, stall rest, and oral administration of
phenylbutazone (1 g twice a day) for three days.
[0257] Physical examination findings included tachycardia (60 beats
minute-1), tachypnea (40 breaths minute-1), increased digital
pulses in both forelimbs, bilateral forelimb swelling in the region
of the third metacarpal bones, focal swelling on the medial and
lateral aspect of the left radius that appeared painful on
palpation. The mare had symmetrical adequate muscling but was
standing in a rocked back position and unable to walk without much
encouragement. All other physical examination parameters were
within normal reference limits. Orthogonal radiographic projections
of the left and right front distal extremities revealed medial to
lateral hoof imbalance bilaterally, mild dorsal hoof wall
thickening bilaterally, with fracture of the dorso-distal aspect of
the distal phalanx bilaterally, but no evidence of rotation or
sinking. Orthogonal and craniolateral-caudomedial oblique
radiographic projections of the left radius revealed radial soft
tissue swelling without evidence of osseous involvement.
Irregularity of the caudodistal left radius likely represented
remodeling secondary to previous trauma unlikely to be clinically
significant. The changes in the distal extremities were suggestive
of laminitis.
[0258] A clinical diagnosis of left forelimb cellulitis and
bilateral forelimb laminitis was made. Initial therapy included
cold hydrotherapy (once daily), flunixin meglumine (1 mg/kg, twice
daily, IV), penicillin G procaine (PPG; 24,000 U/kg, twice daily,
IM), gentamicin (3.5 mg/kg, once daily, IV). Soft Ride boots were
applied bilaterally. A sweat stack wrap was placed on the left
forelimb, and a standing sweat wrap was placed on the right, both
containing furazone, dimethyl sulfoxide (DMSO) and epsom salts.
This therapy was continued for the next four days (days 2, 3, 4 and
5), although the dose and route of administration of flunixin
meglumine were changed (0.5 mg/kg, twice daily, PO) on days 4 and
5. Over this period, the cellulitis was improving and the mare
appeared more comfortable until day 5, when it became increasingly
more painful. Phenylbutazone (4 mg/kg, IV) was administered for
pain relief and the therapy was changed such that flunixin
meglumine and PPG were discontinued and phenylbutazone (4 mg/kg
twice daily, PO), trimethoprim sulfamethoxazole (30 mg/kg twice
daily, PO) and pentoxyphiline (11 mg/kg twice daily, PO) were
instituted. On day 6, the mare became very painful (pain score
8.5/10 on visual analog scale, VAS; "0"=no pain and "10"=worst
possible pain (Vinuela-Fernandez et al. 2011) and was standing but
unwilling to walk. Although the cellulitis had improved
significantly (almost not noticeable), the mare was displaying
signs of laminitis in both forefeet. The hind feet also appeared to
be slightly painful. Gabapentin (20 mg/kg twice daily, PO) was
added to the treatment protocol.
[0259] The condition further deteriorated on day 7, with the mare
spending most of the day laying down in lateral recumbency. It
required much encouragement to stand up and, once standing, was
unwilling to walk. At this time, systematic assessments of pain
with the use of a VAS, as well as monitoring of blood pressure,
heart and respiratory rates, and gastrointestinal sounds (Teixeira
Neto et al. 2004) were instituted. Blood pressure was measured in
triplicates, non-invasively with oscillometric technique (Cardell
Model 9401 BP Monitor, Sham Veterinary Inc., Tampa, Fla.), with a
tail cuff (width equal to 40% of the circumference of the base of
the tail) and the horse in standing position (corrected for
heart-tail height difference). Three individuals (two third year
residents--equine surgery and anesthesia--and one board certified
anesthesiologist) independently assessed the patient throughout the
day taking into account changes in expression, demeanor, posture,
stance and mobility. Two individuals (residents) were unaware of
the identity and mechanism of action of the compound. An overall
daily VAS score was then assigned. All assessments were done with
the patient in the stall and the results are shown in FIG. 1. On
day 7, the average VAS score was 9 out of 10 and blood pressure
measurements revealed significant hypertension.
[0260] Euthanasia was being considered at this stage for humane
reasons coupled with technical and financial constraints. A
decision was made to add an experimental drug,
trans-4-{4-[3-(4-Trifluoromethoxy-phenyl)-ureido]-cyclohexyloxy}-benzoic
acid (t-TUCB), to the treatment protocol. This drug has been shown
to be a potent analgesic in classic rodent models of inflammatory
and neuropathic pain (Inceoglu et al. 2006; Schmelzer et al. 2006;
Inceoglu et al. 2007; Inceoglu et al. 2008; Morisseau et al. 2010;
Wagner et al. 2011a; Wagner et al. 2011b), and is currently being
investigated as a potential new analgesic in horses under approval
by the Institutional Animal Care and Use Committee of the
University of California-Davis. Dose (0.1 mg/kg) and frequency of
administration (once daily) were selected to produce plasma
concentrations within the range of approximately 2.5 .mu.M (peak)
and 30 nM (trough). Concentrations in this range are expected to be
sufficient to inhibit the equine sEH in vivo on the basis of
previous studies (Inceoglu et al. 2006; Morisseau et al. 2006;
Inceoglu et al. 2008; Tsai et al. 2010; Ulu et al. 2011) and the in
vitro potency against the equine sEH. The drug was dissolved in
dimethyl sulfoxide (DMSO) to a final concentration of 10 mg/ml,
filter-sterilized with 0.2 .mu.m pore size sterilizing-grade
membranes, and administered intravenously as a bolus by hand over a
period of approximately one minute. To determine the plasma
concentrations of t-TUCB, blood samples were collected from the
opposite jugular vein just prior to t-TUCB administration
(baseline), at 5, 15 and 30 minutes, and at 1, 2, 4, 8, 12 and 24
hours following each of the first three doses (days 8, 9 and 10),
at 6, 12, 18 and 24 hours following each of the next two doses
(days 11 and 12), and at 36, 48, 72 and 96 hours following the last
dose (day 12). Plasma concentrations of phenylbutazone and
gabapentin were determined in these same blood samples, but
corresponded to slightly different time points since they were
being administered one hour after (phenylbutazone) or five hours
before (gabapentin) t-TUCB. The results are shown in FIG. 2. In
addition, blood was also collected on days 8, 9, 10 and 13 for
laboratory analyzes of complete blood cell count (CBC) and serum
biochemistry (CHEM) and results are presented on Table 1.
TABLE-US-00008 TABLE 1 Hematology and serum biochemistry values at
baseline (before the first dose on day 8) and after the first (day
9), second (day 10) and fifth (day 13) dose of an experimental new
drug inhibitor of soluble epoxide hydrolases (t-TUCB 0.1 mg
kg.sup.-1 IV) as part of multimodal analgesic therapy in one horse
with pain due to laminitis. Reference TEST Day 8 Day 9 Day 10 Day
13 limits HEMATOLOGY Red Blood Cells (M .mu.L.sup.-1) 8.1 8.1 8.5
7.8 6.2-10.2 Hemoglobin (g dL.sup.-1) 13.1 13.1 13.6 12.5 11.2-17.2
Hematocrit (%) 33.5 33.1 34.9 32.1 30-46 Mcv (fL) 41.2 40.9 41.1
40.9 37-53 Mch (pg) 16.1 16.2 16 15.9 14-20 Mchc (g dL.sup.-1) 39.1
39.6 39 38.9 36-39 Rdw (%) 18.1 18 17.8 17.9 16-20 Anisocytosis
Slight Slight Slight Slight -- Echinocytes -- Few Few Few -- White
Blood Cells (/.mu.L) 9000 8170 11200 7320 5000-11600 Neutrophils
(/.mu.L) 5652 5245 8299 3967 3400-11900 Lymphocytes (/.mu.L) 2943
2582 2498 3016 1600-5800 Monophils (/.mu.L) 333 270 314 271 0-500
Eosinophils (/.mu.L) 63 57 56 51 0-200 Basophils (/.mu.L) 27 25 22
22 0-100 Platelets (.times.10.sup.3 .mu.L.sup.-1) 250 231 257 251
100-225 Plasma protein (g dL.sup.-1) 7 7 6.9 6.8 5.8-8.7 Plasma
fibrinogen (mg dL.sup.-1) 300 300 400 500 100-400 Pp:Pf 22 22 16 13
-- BIOCHEMISTRY Creatinine (mg dL.sup.-1) 1 1.1 1.1 1.1 0.9-2.0
Magnesium, Ionized (mmol L.sup.-1) 0.54 0.47 0.55 0.51 0.47-0.7
Anion Gap (mmol L.sup.-1) 12 12 11 12 9-17 Sodium (mmol L.sup.-1)
134 137 136 137 125-137 Potassium (mmol L.sup.-1) 4.3 3.8 4 3.8
3.0-5.6 Chloride (mmol L.sup.-1) 99 101 101 99 91-104 Bicarbonate
(mmol L.sup.-1) 27 28 28 30 23-32 Phosphorus (mg dL.sup.-1) 3.3 3.7
2.7 3.4 2.1-4.7 Calcium (mg dL.sup.-1) 12.9 12.4 12.5 12 11.4-14.1
BUN (mg dL.sup.-1) 22 21 21 22 12-27 Glucose (mg dL.sup.-1) 104 88
104 97 50-107 Total Protein (g dL.sup.-1) 6.2 6.2 6.2 5.8 5.8-7.7
Albumin (g dL.sup.-1) 3.3 3.3 3.4 3.1 2.7-4.2 Globulin (g
dL.sup.-1) 2.9 2.9 2.8 2.7 1.6-5.0 AST (IU L.sup.-1) 506 489 459
358 168-494 Creatine Kinase (IU L.sup.-1) 273 223 195 163 119-287
Alkaline Phosphatase (IU L.sup.-1) 118 119 126 113 86-285 GGT (IU
L.sup.-1) 11 11 11 11 8-22 Triglycerides (mg dL.sup.-1) 24 32 30 35
2-41 Bilirubin Total (mg dL.sup.-1) 1.5 1.5 1.6 1.3 0.5-2.3
Bilirubin Direct (mg dL.sup.-1) 0.2 0.1 0.1 0.1 0.2-0.6 Bilirubin
Indirect (mg dL.sup.-1) 1.3 1.4 1.5 1.2 1.7-3.6 SDH-37 (IU
L.sup.-1) 0 0 0 0 0-8 Hemolysis Index 21 77 43 23 2 Icteric Index 3
3 3 2 -- Lipemic Index 5 5 6 9 --
[0261] The first dose of t-TUCB was administered early in the
morning of day 8. The mare spent majority of that day standing in
the stall, was interested in surroundings, begun to walk
spontaneously and was frequently looking out the front stall door.
The average VAS pain score was 5.5. Hypertension was still present.
Initial laboratory analyzes of CBC and CHEM revealed no significant
changes after the first dose of t-TUCB. With these encouraging
results, t-TUCB continued to be administered for four more days
(days 9, 10, 11 and 12). In the following days, the mare continued
to improve in expression, demeanor, posture, stance and mobility,
which was reflected by lower VAS pain scores (FIG. 1A). As
treatment progressed, the hypertension improved gradually towards
normal physiologic values (FIG. 1B).
[0262] Daily plasma concentrations of t-TUCB were within the
expected range, although it did not reach 2.5 .mu.M and it fell
below 30 nM on one occasion in the first day. The calculated volume
of distribution, elimination half-life and clearance of t-TUCB for
this horse were 1.22 ml/kg, 29.8 hr and 0.04 ml hr/kg,
respectively. The highest and lowest measured plasma concentrations
of phenylbutazone were 55 .mu.M and 2 .mu.M, and those of
gabapentin were 18 .mu.M and 1 .mu.M. The true peaks of gabapentin
were likely missed since the first blood sampling occurred five
hours after dosing. This was due to the scheduled times for
gabapentin administration and because the primary goal in this case
was to determine the plasma concentrations of t-TUCB.
[0263] No adverse effects were observed both in the clinical exams
and evaluation of blood work (Table 1). At 30 days follow-up the
mare was normotensive and had no evidence of lameness. At 90 days,
a few irregularities were apparent on the hoof wall, no episodes of
lameness have been noticed.
Discussion
[0264] This case report is the first description of the successful
use of the sEH inhibitor t-TUCB, as analgesic adjunct in a horse
with laminitis. The horse was being treated for laminitis for seven
days and, after an initial improvement, the condition deteriorated
significantly. The severe pain was not responding to NSAIDs and
gabapentin therapy. A remarkable reduction in pain scores occurred
after pharmacological inhibition of sEH with t-TUCB. Notably, after
being recumbent most of the previous day, the horse stood after the
first dose of t-TUCB and was willing to walk, albeit somewhat
reluctantly, in the stall and had good appetite. Inhibitors of sEH
have been shown to be potent anti-inflammatory and analgesic agents
in classic rodent models of both inflammatory and neuropathic pain
(Inceoglu et al. 2006; Schmelzer et al. 2006; Inceoglu et al. 2007;
Inceoglu et al. 2008; Morisseau et al. 2010; Wagner et al. 2011a;
Wagner et al. 2011b). The observations in this horse with naturally
occurring laminitis suggest that these compounds work not only in
experimental models, but may have utility in the treatment of
diseases associated with inflammation and pain. This notion is
being tested in ongoing experiments. Preliminary data show that the
concentration of several epoxides and respective diols derived from
relevant long-chain fatty acids is changed in laminitic compared to
healthy horses (unpublished data).
[0265] Inhibitors of sEH have been shown to be stronger
anti-inflammatory and analgesics than coxibs or NSAIDs in rodent
models of inflammatory pain (Inceoglu et al. 2007; Wagner et al.
2011b). Thus, it is not possible to ascertain the sole analgesic
contribution of t-TUCB in the case reported here even though pain
that was refractory to phenylbutazone and gabapentin promptly
improved once the sEHi was administered. Interactions of t-TUCB
with phenylbutazone, gabapentin and/or pentoxifylinne likely
occurred. It is known that co-administration of NSAIDs and sEHis
result in enhancement of antinociception (Schmelzer et al. 2006).
Interestingly, measured phenylbutazone plasma levels were below its
80% maximal inhibitory concentration (IC80; .about.23 .mu.M)
against COX-2 for most of the time. The IC80 rather than the IC50
value seems more suitable for NSAIDs evaluation, particularly since
valid anti-inflammatory effects are achieved when COX-2 activity is
80% inhibited (Beretta et al. 2005). However, an additive or even a
synergistic effect between t-TUCB and phenylbutazone could be
responsible for the analgesic efficacy in this report.
[0266] The minimum effective analgesic plasma concentration of
gabapentin in horses is unknown (Terry et al. 2010) although it was
used successfully in one horse with neuropathic pain (Davis et al.
2007). Measured plasma concentrations in the horse of the present
report were well below the concentration that has been associated
with analgesia (.about.18 .mu.M) in human volunteers (Eckhardt et
al. 2000). There probably was a positive interaction with the
phosphodiesterase inhibitor pentoxifylline since analgesia produced
by sEHis is cyclic AMP (cAMP)-dependent, other phosphodiesterase
inhibitors have been shown to increase EET concentrations (Inceoglu
et al. 2011), and pentoxifylline itself may have analgesic effects
in inflammatory and neuropathic pain states (Vale et al. 2004; Liu
et al. 2007). Collectively, the above information corroborate with
the conclusion that sEH inhibition with t-TUCB played a central
role in the pain management of the horse of this report. The
favorable interactions between sEHis and NSAIDs in the arachidonic
acid cascade might allow for the use of lower doses of NSAIDs while
maintaining efficacy and minimizing the risks of NSAID-associated
side effects.
[0267] Drugs or techniques that provide complete control of
nociception are not desirable in horses with laminitis because pain
also has a protective function. It is important to prevent
placement of excessive weight on the affected limb that could lead
to destruction of the inflamed laminar tissue. Therefore, a useful
analgesic would control maladaptive pain (i.e., hyperalgesia,
allodynia) while maintaining some degree of adaptive pain (i.e.,
pain that is protective to the organism). In the case reported
here, the pain scores dropped sharply with the inclusion of t-TUCB,
but as in rodents the sEHi did not abolish all nociceptive input
from the feet. Modulation of hyperalgesia and allodynia with the
use of sEHis has been demonstrated in rodent models (Inceoglu et
al. 2006; Schmelzer et al. 2006; Inceoglu et al. 2007; Inceoglu et
al. 2008; Morisseau et al. 2010; Inceoglu et al. 2011; Wagner et
al. 2011a; Wagner et al. 2011b). An analgesic that provides the
above and is also able to arrest the progression of the disease
would be highly desirable. In this context, pharmacologic
inhibition of sEH fully prevented mortality in LPS-exposed mice by
promoting inflammatory resolution as shown by reductions in plasma
levels of pro-inflammatory cytokines and nitric oxide metabolites
and increases in the synthesis of lipoxins (Schmelzer et al. 2005).
As such, it is feasible that the improvement seen in this case of
laminits resulted from nociceptive modulation via several
mechanisms, and possibly also from arresting of the inflammatory
events in laminar tissue. Future studies are warranted to test this
hypothesis.
[0268] Because laminitis is a complex disease we cannot distinguish
the comparative contributions of the different known biological
effects of sEHi. However, laminitis presents as laminar
inflammation and inflammatory pain transitioning into chronic and
possibly neuropathic pain (Hood 1999; Driessen et al. 2010). The
association of hypertension could have a number of causes including
a response from pain itself. However, this complex disorder
addresses the multiple advantages of sEHi in reducing hypertension,
inflammation, inflammatory pain, neuropathic pain and toxicity
associated with NSAIDs and COXIBs (Node et al. 1999; Yu et al.
2000; Schmelzer et al. 2005; Inceoglu et al. 2006; Schmelzer et al.
2006; Chiamvimonvat et al. 2007; Inceoglu et al. 2007; Inceoglu et
al. 2008; Imig & Hammock 2009; Revermann 2010; Wagner et al.
2011a).
[0269] No undesirable effects could be detected in the horse of
this report. To date, no overt adverse effects associated with sEH
inhibition have been observed in studies in rodents (Inceoglu et
al. 2006; Schmelzer et al. 2006; Inceoglu et al. 2007; Inceoglu et
al. 2008; Morisseau et al. 2010) dogs (Tsai et al. 2010), and
non-human primates (Ulu et al. 2011) even when co-administered with
NSAIDs (Schmelzer et al. 2006). In fact, sEH inhibitors appear to
have a remarkable sparing effect in the analgesic action of NSAIDs
(Schmelzer et al. 2006), suggesting that lower effective doses of
NSAIDs could be used thus minimizing risk of undesirable side
effects.
[0270] In conclusion, inhibition of sEH with t-TUCB was associated
with a significant improvement in pain scores in one horse with
laminitis whose pain was refractory to the standard of care
therapy. No adverse effects were noticed. Future studies evaluating
the analgesic and protective effects of these compounds in painful
inflammatory diseases in animals are warranted.
REFERENCES
[0271] Belknap J K, Giguere S, Pettigrew A et al. (2007) Lamellar
pro-inflammatory cytokine expression patterns in laminitis at the
developmental stage and at the onset of lameness: [0272] innate vs.
adaptive immune response. Equine Vet J 39, 42-47. [0273] Beretta C,
Garavaglia G, Cavalli M (2005) COX-1 and COX-2 inhibition in horse
blood by phenylbutazone, flunixin, carprofen and meloxicam: an in
vitro analysis. Pharmacol Res 52, 302-306. [0274] Chiamvimonvat N,
Ho C M, Tsai H J et al. (2007) The soluble epoxide hydrolase as a
pharmaceutical target for hypertension. J Cardiovasc Pharmacol 50,
225-237. [0275] Davis J L, Posner L P, Elce Y (2007) Gabapentin for
the treatment of neuropathic pain in a pregnant horse. J Am Vet Med
Assoc 231, 755-758. [0276] Decker M, Arand M, Cronin A (2009)
Mammalian epoxide hydrolases in xenobiotic metabolism and
signalling. Arch Toxicol 83, 297-318. [0277] Driessen B, Bauquier S
H, Zarucco L (2010) Neuropathic pain management in chronic
laminitis. Vet Clin North Am Equine Pract 26, 315-337. [0278]
Eckhardt K, Ammon S, Hofmann U et al. (2000) Gabapentin enhances
the analgesic effect of morphine in healthy volunteers. Anesth
Analg 91, 185-191. [0279] Hood D M (1999) The pathophysiology of
developmental and acute laminitis. Vet Clin North Am Equine Pract
15, 321-343. [0280] Hood D M, Grosenbaugh D A, Mostafa M B et al.
(1993) The role of vascular mechanisms in the development of acute
equine laminitis. J Vet Intern Med 7, 228-234. [0281] Hwang S H,
Tsai H J, Liu J Y et al. (2007) Orally bioavailable potent soluble
epoxide hydrolase inhibitors. J Med Chem 50, 3825-3840. [0282] Imig
J D, Hammock B D (2009) Soluble epoxide hydrolase as a therapeutic
target for cardiovascular diseases. Nat Rev Drug Discov 8, 794-805.
[0283] Inceoglu B, Jinks S L, Schmelzer K R et al. (2006)
Inhibition of soluble epoxide hydrolase reduces LPS-induced thermal
hyperalgesia and mechanical allodynia in a rat model of
inflammatory pain. Life Sci 79, 2311-2319. [0284] Inceoglu B, Jinks
S L, Ulu A et al. (2008) Soluble epoxide hydrolase and
epoxyeicosatrienoic acids modulate two distinct analgesic pathways.
Proc Natl Acad Sci USA 105, 18901-18906. [0285] Inceoglu B,
Schmelzer K R, Morisseau C et al. (2007) Soluble epoxide hydrolase
inhibition reveals novel biological functions of
epoxyeicosatrienoic acids (EETs). Prostaglandins Other Lipid Mediat
82, 42-49. [0286] Inceoglu B, Wagner K, Schebb N H et al. (2011)
Analgesia mediated by soluble epoxide hydrolase inhibitors is
dependent on cAMP. Proc Natl Acad Sci USA 108, 5093-5097. [0287]
Jones E, Vinuela-Fernandez I, Eager R A et al. (2007) Neuropathic
changes in equine laminitis pain. Pain 132, 321-331. [0288] Lakritz
J, Winder B S, Noorouz-Zadeh J et al. (2000) Hepatic and pulmonary
enzyme activities in horses. Am J Vet Res 61, 152-157. [0289] Liu
J, Feng X, Yu M et al. (2007) Pentoxifylline attenuates the
development of hyperalgesia in a rat model of neuropathic pain.
Neurosci Lett 412, 268-272. [0290] Moalem G, Tracey D J (2006)
Immune and inflammatory mechanisms in neuropathic pain. Brain Res
Rev 51, 240-264. [0291] Morisseau C, Hammock B D (2005) Epoxide
hydrolases: mechanisms, inhibitor designs, and biological roles.
Annu Rev Pharmacol Toxicol 45, 311-333. [0292] Morisseau C, Hammock
B D (2008) Gerry Brooks and epoxide hydrolases: four decades to a
pharmaceutical. Pest Manag Sci 64, 594-609. [0293] Morisseau C,
Inceoglu B, Schmelzer K et al. (2010) Naturally occurring
monoepoxides of eicosapentaenoic acid and docosahexaenoic acid are
bioactive antihyperalgesic lipids. J Lipid Res 51, 3481-3490.
[0294] Morisseau C, Newman J W, Tsai H J et al. (2006)
Peptidyl-urea based inhibitors of soluble epoxide hydrolases.
Bioorg Med Chem Lett 16, 5439-5444. [0295] Murakami M (2011) Lipid
mediators in life science. Exp Anim 60, 7-20. [0296] Node K, Huo Y,
Ruan X et al. (1999) Anti-inflammatory properties of cytochrome
P450 epoxygenase-derived eicosanoids. Science 28
References