U.S. patent application number 16/554125 was filed with the patent office on 2019-12-19 for genetically modified host cells and use of same for producing isoprenoid compounds.
The applicant listed for this patent is The Regents of the University of California. Invention is credited to Jay D. Keasling, James Kirby, Eric M. Paradise.
Application Number | 20190382802 16/554125 |
Document ID | / |
Family ID | 35787438 |
Filed Date | 2019-12-19 |
![](/patent/app/20190382802/US20190382802A1-20191219-D00001.png)
![](/patent/app/20190382802/US20190382802A1-20191219-D00002.png)
![](/patent/app/20190382802/US20190382802A1-20191219-D00003.png)
![](/patent/app/20190382802/US20190382802A1-20191219-D00004.png)
![](/patent/app/20190382802/US20190382802A1-20191219-D00005.png)
![](/patent/app/20190382802/US20190382802A1-20191219-D00006.png)
![](/patent/app/20190382802/US20190382802A1-20191219-D00007.png)
![](/patent/app/20190382802/US20190382802A1-20191219-D00008.png)
United States Patent
Application |
20190382802 |
Kind Code |
A1 |
Keasling; Jay D. ; et
al. |
December 19, 2019 |
GENETICALLY MODIFIED HOST CELLS AND USE OF SAME FOR PRODUCING
ISOPRENOID COMPOUNDS
Abstract
The present invention provides genetically modified eukaryotic
host cells that produce isoprenoid precursors or isoprenoid
compounds. A subject genetically modified host cell comprises
increased activity levels of one or more of mevalonate pathway
enzymes, increased levels of prenyltransferase activity, and
decreased levels of squalene synthase activity. Methods are
provided for the production of an isoprenoid compound or an
isoprenoid precursor in a subject genetically modified eukaryotic
host cell. The methods generally involve culturing a subject
genetically modified host cell under conditions that promote
production of high levels of an isoprenoid or isoprenoid precursor
compound.
Inventors: |
Keasling; Jay D.; (Berkeley,
CA) ; Kirby; James; (Berkeley, CA) ; Paradise;
Eric M.; (Vienna, VA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Regents of the University of California |
Oakland |
CA |
US |
|
|
Family ID: |
35787438 |
Appl. No.: |
16/554125 |
Filed: |
August 28, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15722844 |
Oct 2, 2017 |
10435717 |
|
|
16554125 |
|
|
|
|
14451056 |
Aug 4, 2014 |
9809829 |
|
|
15722844 |
|
|
|
|
11571315 |
Nov 13, 2007 |
8828684 |
|
|
PCT/US2005/026190 |
Jul 21, 2005 |
|
|
|
14451056 |
|
|
|
|
60592009 |
Jul 27, 2004 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 9/88 20130101; C12P
5/007 20130101; C12P 23/00 20130101; C12N 15/81 20130101; C12Y
402/03024 20130101; C12Y 101/01034 20130101; C12N 9/0006 20130101;
C12N 9/1085 20130101; C12Y 205/01092 20130101 |
International
Class: |
C12P 5/00 20060101
C12P005/00; C12N 9/10 20060101 C12N009/10; C12N 15/81 20060101
C12N015/81; C12P 23/00 20060101 C12P023/00; C12N 9/04 20060101
C12N009/04; C12N 9/88 20060101 C12N009/88 |
Claims
1. A genetically modified eukaryotic host cell that produces an
isoprenoid or an isoprenoid precursor compound via a mevalonate
pathway, the genetically modified eukaryotic host cell comprising
genetic modifications that provide for: a) an increased level of
activity of one or more mevalonate pathway enzymes, b) an increased
level of prenyltransferase activity, and c) a decreased level of
squalene synthase activity wherein the genetic modifications
provide for production of an isoprenoid or an isoprenoid precursor
compound at a level that is at least about 50% higher than the
level of the isoprenoid or isoprenoid precursor compound in a
control cell not comprising the genetic modifications.
2. The genetically modified eukaryotic host cell of claim 1,
wherein the prenyltransferase is farnesyl pyrophosphate
synthase.
3. The genetically modified eukaryotic host cell of claim 1,
wherein the prenyltransferase is geranyl pyrophosphate
synthase.
4. The genetically modified eukaryotic host cell of claim 1,
wherein the prenyltransferase is geranylgeranyl pyrophosphate
synthase.
5. The genetically modified eukaryotic host cell of claim 1,
wherein the genetically modified eukaryotic host cell is a yeast
cell.
6. The genetically modified host cell of claim 5, wherein the
genetically modified eukaryotic host cell is Saccharomyces
cerevisiae.
7. The genetically modified host cell of claim 1, wherein the
genetically modified host cell is genetically modified with a
nucleic acid comprising a nucleotide sequence encoding a truncated
hydroxymethylglutaryl coenzyme-A reductase.
8. The genetically modified host cell of claim 1, wherein the
genetically modified host cell is genetically modified with a
nucleic acid comprising a nucleotide sequence encoding a variant
Ecm22p transcription factor, which variant has increased
transcriptional activation activity compared to wild-type Ecm22p,
wherein the level of transcription of one or more mevalonate
pathway enzymes is increased.
9. The genetically modified host cell of claim 8, wherein the level
of transcription of hydroxymethylglutaryl coenzyme-A synthase,
mevalonate kinase, and phosphomevalonate kinase is increased.
10. The genetically modified host cell of claim 1, wherein the
genetically modified host cell is genetically modified with a
nucleic acid comprising a nucleotide sequence encoding a variant
Upc2p transcription factor, which variant has increased
transcriptional activation activity compared to wild-type Upc2p,
wherein the level of transcription of one or more mevalonate
pathway enzymes is increased
11. The genetically modified host cell of claim 10, wherein the
level of transcription of hydroxymethylglutaryl coenzyme-A
synthase, mevalonate kinase, and phosphomevalonate kinase is
increased.
12. The genetically modified host cell of claim 1, wherein the
genetically modified host cell is genetically modified with a
nucleic acid comprising a heterologous promoter, wherein the
promoter replaces an endogenous promoter operably linked to an
endogenous nucleotide sequence encoding farnesyl pyrophosphate
synthase, wherein the heterologous promoter provides for an
increased level of farnesyl pyrophosphate synthase compared to a
control host cell.
13. The genetically modified host cell of claim 12, wherein the
heterologous promoter is a GAL1 promoter.
14. The genetically modified host cell of claim 1, wherein the
genetically modified host cell is genetically modified with a
nucleic acid comprising a heterologous promoter, wherein the
promoter replaces an endogenous promoter operably linked to an
endogenous nucleotide sequence encoding geranyl pyrophosphate
synthase, wherein the heterologous promoter provides for an
increased level of geranyl pyrophosphate synthase compared to a
control host cell.
15. The genetically modified host cell of claim 14, wherein the
heterologous promoter is a GAL1 promoter.
16. The genetically modified host cell of claim 1, wherein the
genetically modified host cell is genetically modified with a
nucleic acid comprising a heterologous promoter, wherein the
promoter replaces an endogenous promoter operably linked to an
endogenous nucleotide sequence encoding geranylgeranyl
pyrophosphate synthase, wherein the heterologous promoter provides
for an increased level of geranylgeranyl pyrophosphate synthase
compared to a control host cell.
17. The genetically modified host cell of claim 16, wherein the
heterologous promoter is a GAL1 promoter.
18. The genetically modified host cell of claim 1, wherein the
genetically modified host cell is genetically modified with a
nucleic acid comprising a heterologous promoter, which heterologous
promoter replaces an endogenous promoter operably linked to an
endogenous nucleotide sequence encoding squalene synthase, wherein
the heterologous promoter provides for a reduced level of squalene
synthase compared to a control host cell.
19. The genetically modified host cell of claim 1, wherein the
genetically modified host cell is further genetically modified with
a nucleic acid comprising a nucleotide sequence encoding a terpene
synthase.
20. The genetically modified host cell of claim 19, wherein the
terpene synthase is selected from amorpha-4,11-diene synthase
(ADS), beta-caryophyllene synthase, germacrene A synthase,
8-epicedrol synthase, valencene synthase, (+)-delta-cadinene
synthase, germacrene C synthase, (E)-beta-farnesene synthase,
Casbene synthase, vetispiradiene synthase, 5-epi-aristolochene
synthase, Aristolchene synthase, beta-caryophyllene,
alpha-humulene, (E,E)-alpha-farnesene synthase, (-)-beta-pinene
synthase, Gamma-terpinene synthase, limonene cyclase, Linalool
synthase,1,8-cineole synthase, (+)-sabinene synthase,
E-alpha-bisabolene synthase, (+)-bornyl diphosphate synthase,
levopimaradiene synthase, Abietadiene synthase, isopimaradiene
synthase, (E)-gamma-bisabolene synthase, taxadiene synthase,
copalyl pyrophosphate synthase, kaurene synthase, longifolene
synthase, gamma-humulene synthase, Delta-selinene synthase,
beta-phellandrene synthase, limonene synthase, myrcene synthase,
terpinolene synthase, (-)-camphene synthase, (+)-3-carene synthase,
syn-copalyl diphosphate synthase, alpha-terpineol synthase,
syn-pimara-7,15-diene synthase, ent-sandaaracopimaradiene synthase,
sterner-13-ene synthase, E-beta-ocimene, S-linalool synthase,
geraniol synthase, gamma-terpinene synthase, linalool synthase,
E-beta-ocimene synthase, epi-cedrol synthase, alpha-zingiberene
synthase, guaiadiene synthase, cascarilladiene synthase,
cis-muuroladiene synthase, aphidicolan-16b-ol synthase,
elizabethatriene synthase, sandalol synthase, patchoulol synthase,
Zinzanol synthase, cedrol synthase, scareol synthase, copalol
synthase, and manool synthase.
21. The genetically modified host cell of claim 19, wherein the
terpene synthase is amorpha-4,11-diene synthase.
22. A method for enhancing production of an isoprenoid precursor or
an isoprenoid via a mevalonate pathway in a host cell, the method
comprising culturing the genetically modified eukaryotic host cell
of claim 1 in a suitable medium and under conditions that promote
production of the isoprenoid or isoprenoid precursor compound,
wherein the isoprenoid or an isoprenoid precursor compound is
produced at a level that is at least about 50% higher than the
level of the isoprenoid or isoprenoid precursor compound in a
control cell not comprising the genetic modifications.
23. The method of claim 22, wherein the conditions comprise
inclusion in the culture medium of an inducing agent that activates
an inducible promoter.
24. The method of claim 22, wherein the isoprenoid compound is a
monoterpene.
25. The method of claim 22, wherein the isoprenoid is a
polyterpene.
26. The method of claim 22, wherein the isoprenoid is a
diterpene.
27. The method of claim 22, wherein the isoprenoid is a
triterpene.
28. The method of claim 22, wherein the isoprenoid is a
carotenoid.
29. The method of claim 22, wherein the isoprenoid is a
sesquiterpene.
30. The method of claim 29, wherein the sesquiterpene is
amorphadiene.
Description
CROSS-REFERENCE
[0001] This application claims the benefit of U.S. Provisional
Patent Application No. 60/592,009 filed Jul. 27, 2004, which
application is incorporated herein by reference in its
entirety.
FIELD OF THE INVENTION
[0002] The present invention is in the field of production of
isoprenoid compounds, and in particular host cells that are
genetically modified to produce isoprenoid compounds.
BACKGROUND OF THE INVENTION
[0003] Isoprenoids constitute an extremely large and diverse group
of natural products that have a common biosynthetic origin, i.e., a
single metabolic precursor, isopentenyl diphosphate (IPP).
Isoprenoid compounds are also referred to as "terpenes" or
"terpenoids." Over 40,000 isoprenoids have been described. By
definition, isoprenoids are made up of so-called isoprene (C5)
units. The number of C-atoms present in the isoprenoids is
typically divisible by five (C5, C10, C15, C20, C25, C30 and C40),
although irregular isoprenoids and polyterpenes have been reported.
Important members of the isoprenoids include the carotenoids,
sesquiterpenoids, diterpenoids, and hemiterpenes. Carotenoids
include, e.g., lycopene, .beta.-carotene, and the like, many of
which function as antioxidants. Sesquiterpenoids include, e.g.,
artemisinin, a compound having anti-malarial activity. Diterpenoids
include, e.g., taxol, a cancer chemotherapeutic agent.
[0004] Isoprenoids comprise the most numerous and structurally
diverse family of natural products. In this family, terpenoids
isolated from plants and other natural sources are used as
commercial flavor and fragrance compounds as well as antimalarial
and anticancer drugs. A majority of the terpenoid compounds in use
today are natural products or their derivatives. The source
organisms (e.g., trees, marine invertebrates) of many of these
natural products are neither amenable to the large-scale
cultivation necessary to produce commercially viable quantities nor
to genetic manipulation for increased production or derivatization
of these compounds. Therefore, the natural products must be
produced semi-synthetically from analogs or synthetically using
conventional chemical syntheses. Furthermore, many natural products
have complex structures, and, as a result, are currently
uneconomical or impossible to synthesize. Such natural products
must be either extracted from their native sources, such as trees,
sponges, corals and marine microbes; or produced synthetically or
semi-synthetically from more abundant precursors. Extraction of a
natural product from a native source is limited by the availability
of the native source; and synthetic or semi-synthetic production of
natural products can suffer from low yield and/or high cost. Such
production problems and limited availability of the natural source
can restrict the commercial and clinical development of such
products.
[0005] The biosynthesis of isoprenoid natural products in
engineered host cells could tap the unrealized commercial and
therapeutic potential of these natural resources and yield less
expensive and more widely available fine chemicals and
pharmaceuticals. A major obstacle to high level terpenoid
biosynthesis is the production of terpene precursors. In
Saccharomyces cerevisiae, the mevalonate pathway provides for
production of isopentenyl diphosphate (IPP), which can be
isomerized and polymerized into isoprenoids and terpenes of
commercial value. Other valuable precursors are also produced,
including farnesyl diphosphate (FPP) and geranylgeranyl diphosphate
(GPP). However, much of the reaction flux is directed towards the
undesired later steps of the sterol pathway, resulting in the
production of ergosterol.
[0006] There is a need in the art for improved isoprenoid-producing
or isoprenoid precursor-producing host cells that provide for
high-level production of isoprenoid compounds, as well as the
polyprenyl diphosphate precursors of such compounds. The present
invention addresses this need and provides related advantages.
LITERATURE
[0007] U.S. Patent Publication No. 2004/005678; U.S. Patent
Publication No. 2003/0148479; Martin et al. (2003) Nat. Biotech.
21(7):796-802; Polakowski et al. (1998) Appl. Microbiol.
Biotechnol. 49: 67-71; Wilding et al. (2000) J Bacteriol 182(15):
4319-27; U.S. Patent Publication No. 2004/0194162; Donald et al.
(1997) Appl. Env. Microbiol. 63:3341-3344; Jackson et al. (2003)
Organ. Lett. 5:1629-1632; U.S. Patent Publication No. 2004/0072323;
U.S. Patent Publication No. 2004/0029239; U.S. Patent Publication
No. 2004/0110259; U.S. Patent Publication No. 2004/0063182; U.S.
Pat. No. 5,460,949; U.S. Patent Publication No. 2004/0077039; U.S.
Pat. Nos. 6,531,303; 6,689,593; Hamano et al. (2001) Biosci.
Biotechnol. Biochem. 65:1627-1635; T. Kuzuyama. (2004) Biosci.
Biotechnol. Biochem. 68(4): 931-934; T. Kazuhiko. (2004)
Biotechnology Letters. 26: 1487-1491; Brock et al. (2004) Eur J.
Biochem. 271: 3227-3241; Choi, et al. (1999) Appl. Environ.
Microbio. 65 4363-4368; Parke et al., (2004) Appl. Environ.
Microbio. 70: 2974-2983; Subrahmanyam et al. (1998) J. Bact. 180:
4596-4602; Murli et al. (2003) J. Ind. Microbiol. Biotechnol. 30:
500-509.
SUMMARY OF THE INVENTION
[0008] The present invention provides genetically modified
eukaryotic host cells that produce isoprenoid precursors or
isoprenoid compounds. A subject genetically modified host cell
comprises increased activity levels of one or more of mevalonate
pathway enzymes, increased levels of prenyl transferase activity,
and decreased levels of squalene synthase activity. Methods are
provided for the production of an isoprenoid compound or an
isoprenoid precursor in a subject genetically modified eukaryotic
host cell. The methods generally involve culturing a subject
genetically modified host cell under conditions that promote
production of high levels of an isoprenoid or isoprenoid precursor
compound.
BRIEF DESCRIPTION OF THE DRAWINGS
[0009] FIG. 1 is a schematic representation of the mevalonate
pathway in Saccharomyces cerevisiae. The structures of
intermediates and gene names encoding the various enzymes in the
pathway are shown.
[0010] FIG. 2 is a schematic representation of a portion of the
sterol biosynthesis pathway in an organism expressing amorphadiene
synthase (ADS). The structures of intermediates and the names of
genes encoding the various enzymes in the pathway are shown.
[0011] FIGS. 3A and 3B depict production of amorphadiene by S.
cerevisiae over 96 hours of culture expressing amorphadiene
synthase (ADS) (.diamond-solid.); ADS and truncated
3-hydroxy-3-methylglutaryl coenzyme-A reductase (tHMGR)
(.circle-solid.); ADS and upc2-1 (.quadrature.); and ADS and
ecm22-1 (.tangle-solidup.). The data are shown as total production
(3A) and normalized for cell density (3B). The data are
means.+-.standard deviations (n=3).
[0012] FIG. 4 depicts production of amorphadiene in S. cerevisiae
strain EPY212 grown at methionine concentrations of 0, 0.1, 0.3,
0.5 and 1 after 64 and 87 hours of culture. The data are the means
of means from two samples.
[0013] FIG. 5 depicts production of amorphadiene by S. cerevisiae
by various yeast strains over 144 hours of culture expressing. The
data are means.+-.standard deviations (n=3).
[0014] FIG. 6 depicts a nucleotide sequence encoding a truncated
HMGR.
[0015] FIGS. 7A and 7B depict an amino acid sequence of a truncated
HMGR.
DEFINITIONS
[0016] The terms "isoprenoid," "isoprenoid compound," "terpene,"
"terpene compound," "terpenoid," and "terpenoid compound" are used
interchangeably herein. Isoprenoid compounds are made up various
numbers of so-called isoprene (C5) units. The number of C-atoms
present in the isoprenoids is typically evenly divisible by five
(e.g., C5, C10, C15, C20, C25, C30 and C40). Irregular isoprenoids
and polyterpenes have been reported, and are also included in the
definition of "isoprenoid." Isoprenoid compounds include, but are
not limited to, monoterpenes, sesquiterpenes, triterpenes,
polyterpenes, and diterpenes.
[0017] As used herein, the term "prenyl diphosphate" is used
interchangeably with "prenyl pyrophosphate," and includes
monoprenyl diphosphates having a single prenyl group (e.g., IPP and
DMAPP), as well as polyprenyl diphosphates that include 2 or more
prenyl groups. Monoprenyl diphosphates include isopentenyl
pyrophosphate (IPP) and its isomer dimethylallyl pyrophosphate
(DMAPP).
[0018] As used herein, the term "terpene synthase" refers to any
enzyme that enzymatically modifies IPP, DMAPP, or a polyprenyl
pyrophosphate, such that a terpenoid compound is produced. The term
"terpene synthase" includes enzymes that catalyze the conversion of
a prenyl diphosphate into an isoprenoid.
[0019] The word "pyrophosphate" is used interchangeably herein with
"diphosphate." Thus, e.g., the terms "prenyl diphosphate" and
"prenyl pyrophosphate" are interchangeable; the terms "isopentenyl
pyrophosphate" and "isopentenyl diphosphate" are interchangeable;
the terms farnesyl diphosphate" and farnesyl pyrophosphate" are
interchangeable; etc.
[0020] The term "mevalonate pathway" or "MEV pathway" is used
herein to refer to the biosynthetic pathway that converts
acetyl-CoA to IPP. The mevalonate pathway comprises enzymes that
catalyze the following steps: (a) condensing two molecules of
acetyl-CoA to acetoacetyl-CoA; (b) condensing acetoacetyl-CoA with
acetyl-CoA to form HMG-CoA; (c) converting HMG-CoA to mevalonate;
(d) phosphorylating mevalonate to mevalonate 5-phosphate; (e)
converting mevalonate 5-phosphate to mevalonate 5-pyrophosphate;
and (f) converting mevalonate 5-pyrophosphate to isopentenyl
pyrophosphate. The mevalonate pathway is illustrated schematically
in FIG. 1.
[0021] As used herein, the term "prenyl transferase" is used
interchangeably with the terms "isoprenyl diphosphate synthase" and
"polyprenyl synthase" (e.g., "GPP synthase," "FPP synthase," "OPP
synthase," etc.) to refer to an enzyme that catalyzes the
consecutive 1'-4 condensation of isopentenyl diphosphate with
allylic primer substrates, resulting in the formation of prenyl
diphosphates of various chain lengths.
[0022] The terms "polynucleotide" and "nucleic acid," used
interchangeably herein, refer to a polymeric form of nucleotides of
any length, either ribonucleotides or deoxynucleotides. Thus, this
term includes, but is not limited to, single-, double-, or
multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a
polymer comprising purine and pyrimidine bases or other natural,
chemically or biochemically modified, non-natural, or derivatized
nucleotide bases.
[0023] As used herein, the terms "operon" and "single transcription
unit" are used interchangeably to refer to two or more contiguous
coding regions (nucleotide sequences that encode a gene product
such as an RNA or a protein) that are coordinately regulated by one
or more controlling elements (e.g., a promoter). As used herein,
the term "gene product" refers to RNA encoded by DNA (or vice
versa) or protein that is encoded by an RNA or DNA, where a gene
will typically comprise one or more nucleotide sequences that
encode a protein, and may also include introns and other non-coding
nucleotide sequences.
[0024] The terms "peptide," "polypeptide," and "protein" are used
interchangeably herein, and refer to a polymeric form of amino
acids of any length, which can include coded and non-coded amino
acids, chemically or biochemically modified or derivatized amino
acids, and polypeptides having modified peptide backbones.
[0025] The term "naturally-occurring" as used herein as applied to
a nucleic acid, a cell, or an organism, refers to a nucleic acid,
cell, or organism that is found in nature. For example, a
polypeptide or polynucleotide sequence that is present in an
organism (including viruses) that can be isolated from a source in
nature and which has not been intentionally modified by a human in
the laboratory is naturally occurring.
[0026] The term "heterologous nucleic acid," as used herein, refers
to a nucleic acid wherein at least one of the following is true:
(a) the nucleic acid is foreign ("exogenous") to (i.e., not
naturally found in) a given host microorganism or host cell; (b)
the nucleic acid comprises a nucleotide sequence that is naturally
found in (e.g., is "endogenous to") a given host microorganism or
host cell (e.g., the nucleic acid comprises a nucleotide sequence
endogenous to the host microorganism or host cell); however, in the
context of a heterologous nucleic acid, the same nucleotide
sequence as found endogenously is produced in an unnatural (e.g.,
greater than expected or greater than naturally found) amount in
the cell, or a nucleic acid comprising a nucleotide sequence that
differs in sequence from the endogenous nucleotide sequence but
encodes the same protein (having the same or substantially the same
amino acid sequence) as found endogenously is produced in an
unnatural (e.g., greater than expected or greater than naturally
found) amount in the cell; (c) the nucleic acid comprises two or
more nucleotide sequences that are not found in the same
relationship to each other in nature, e.g., the nucleic acid is
recombinant. An example of a heterologous nucleic acid is a
nucleotide sequence encoding HMGR operably linked to a
transcriptional control element (e.g., a promoter) to which an
endogenous (naturally-occurring) HMGR coding sequence is not
normally operably linked. Another example of a heterologous nucleic
acid a high copy number plasmid comprising a nucleotide sequence
encoding HMGR. Another example of a heterologous nucleic acid is a
nucleic acid encoding HMGR, where a host cell that does not
normally produce HMGR is genetically modified with the nucleic acid
encoding HMGR; because HMGR-encoding nucleic acids are not
naturally found in the host cell, the nucleic acid is heterologous
to the genetically modified host cell.
[0027] "Recombinant," as used herein, means that a particular
nucleic acid (DNA or RNA) is the product of various combinations of
cloning, restriction, and/or ligation steps resulting in a
construct having a structural coding or non-coding sequence
distinguishable from endogenous nucleic acids found in natural
systems. Generally, DNA sequences encoding the structural coding
sequence can be assembled from cDNA fragments and short
oligonucleotide linkers, or from a series of synthetic
oligonucleotides, to provide a synthetic nucleic acid which is
capable of being expressed from a recombinant transcriptional unit
contained in a cell or in a cell-free transcription and translation
system. Such sequences can be provided in the form of an open
reading frame uninterrupted by internal non-translated sequences,
or introns, which are typically present in eukaryotic genes.
Genomic DNA comprising the relevant sequences can also be used in
the formation of a recombinant gene or transcriptional unit.
Sequences of non-translated DNA may be present 5' or 3' from the
open reading frame, where such sequences do not interfere with
manipulation or expression of the coding regions, and may indeed
act to modulate production of a desired product by various
mechanisms (see "DNA regulatory sequences", below).
[0028] Thus, e.g., the term "recombinant" polynucleotide or nucleic
acid refers to one which is not naturally occurring, e.g., is made
by the artificial combination of two otherwise separated segments
of sequence through human intervention. This artificial combination
is often accomplished by either chemical synthesis means, or by the
artificial manipulation of isolated segments of nucleic acids,
e.g., by genetic engineering techniques. Such is usually done to
replace a codon with a redundant codon encoding the same or a
conservative amino acid, while typically introducing or removing a
sequence recognition site. Alternatively, it is performed to join
together nucleic acid segments of desired functions to generate a
desired combination of functions. This artificial combination is
often accomplished by either chemical synthesis means, or by the
artificial manipulation of isolated segments of nucleic acids,
e.g., by genetic engineering techniques.
[0029] By "construct" is meant a recombinant nucleic acid,
generally recombinant DNA, which has been generated for the purpose
of the expression of a specific nucleotide sequence(s), or is to be
used in the construction of other recombinant nucleotide
sequences.
[0030] As used herein, the term "exogenous nucleic acid" refers to
a nucleic acid that is not normally or naturally found in and/or
produced by a given bacterium, organism, or cell in nature. As used
herein, the term "endogenous nucleic acid" refers to a nucleic acid
that is normally found in and/or produced by a given bacterium,
organism, or cell in nature. An "endogenous nucleic acid" is also
referred to as a "native nucleic acid" or a nucleic acid that is
"native" to a given bacterium, organism, or cell. For example, a
cDNA generated from mRNA isolated from a plant and encoding a
terpene synthase represents an exogenous nucleic acid to S.
cerevisiae. In S. cerevisiae, nucleotide sequences encoding HMGS,
MK, and PMK on the chromosome would be "endogenous" nucleic
acids.
[0031] The terms "DNA regulatory sequences," "control elements,"
and "regulatory elements," used interchangeably herein, refer to
transcriptional and translational control sequences, such as
promoters, enhancers, polyadenylation signals, terminators, protein
degradation signals, and the like, that provide for and/or regulate
expression of a coding sequence and/or production of an encoded
polypeptide in a host cell.
[0032] The term "transformation" is used interchangeably herein
with "genetic modification" and refers to a permanent or transient
genetic change induced in a cell following introduction of new
nucleic acid (i.e., DNA exogenous to the cell). Genetic change
("modification") can be accomplished either by incorporation of the
new DNA into the genome of the host cell, or by transient or stable
maintenance of the new DNA as an episomal element. Where the cell
is a eukaryotic cell, a permanent genetic change is generally
achieved by introduction of the DNA into the genome of the cell. In
prokaryotic cells, permanent changes can be introduced into the
chromosome or via extrachromosomal elements such as plasmids and
expression vectors, which may contain one or more selectable
markers to aid in their maintenance in the recombinant host
cell.
[0033] "Operably linked" refers to a juxtaposition wherein the
components so described are in a relationship permitting them to
function in their intended manner. For instance, a promoter is
operably linked to a coding sequence if the promoter affects its
transcription or expression. As used herein, the terms
"heterologous promoter" and "heterologous control regions" refer to
promoters and other control regions that are not normally
associated with a particular nucleic acid in nature. For example, a
"transcriptional control region heterologous to a coding region" is
a transcriptional control region that is not normally associated
with the coding region in nature.
[0034] A "host cell," as used herein, denotes an in vivo or in
vitro eukaryotic cell or a cell from a multicellular organism
(e.g., a cell line) cultured as a unicellular entity, which
eukaryotic cells can be, or have been, used as recipients for a
nucleic acid (e.g., an expression vector that comprises a
nucleotide sequence encoding one or more gene products such as
mevalonate pathway gene products), and include the progeny of the
original cell which has been genetically modified by the nucleic
acid. It is understood that the progeny of a single cell may not
necessarily be completely identical in morphology or in genomic or
total DNA complement as the original parent, due to natural,
accidental, or deliberate mutation. A "recombinant host cell" (also
referred to as a "genetically modified host cell") is a host cell
into which has been introduced a heterologous nucleic acid, e.g.,
an expression vector. For example, a subject eukaryotic host cell
is a genetically modified eukaryotic host cell, by virtue of
introduction into a suitable eukaryotic host cell a heterologous
nucleic acid, e.g., an exogenous nucleic acid that is foreign to
the eukaryotic host cell, or a recombinant nucleic acid that is not
normally found in the eukaryotic host cell.
[0035] As used herein the term "isolated" is meant to describe a
polynucleotide, a polypeptide, or a cell that is in an environment
different from that in which the polynucleotide, the polypeptide,
or the cell naturally occurs. An isolated genetically modified host
cell may be present in a mixed population of genetically modified
host cells.
[0036] Expression cassettes may be prepared comprising a
transcription initiation or transcriptional control region(s)
(e.g., a promoter), the coding region for the protein of interest,
and a transcriptional termination region. Transcriptional control
regions include those that provide for over-expression of the
protein of interest in the genetically modified host cell; those
that provide for inducible expression, such that when an inducing
agent is added to the culture medium, transcription of the coding
region of the protein of interest is induced or increased to a
higher level than prior to induction.
[0037] A nucleic acid is "hybridizable" to another nucleic acid,
such as a cDNA, genomic DNA, or RNA, when a single stranded form of
the nucleic acid can anneal to the other nucleic acid under the
appropriate conditions of temperature and solution ionic strength.
Hybridization and washing conditions are well known and exemplified
in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning:
A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor (1989), particularly Chapter 11 and Table
11.1 therein; and Sambrook, J. and Russell, W., Molecular Cloning:
A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor (2001). The conditions of temperature and
ionic strength determine the "stringency" of the hybridization.
Stringency conditions can be adjusted to screen for moderately
similar fragments, such as homologous sequences from distantly
related organisms, to highly similar fragments, such as genes that
duplicate functional enzymes from closely related organisms.
Hybridization conditions and post-hybridization washes are useful
to obtain the desired determine stringency conditions of the
hybridization. One set of illustrative post-hybridization washes is
a series of washes starting with 6.times.SSC (where SSC is 0.15 M
NaCl and 15 mM citrate buffer), 0.5% SDS at room temperature for 15
minutes, then repeated with 2.times.SSC, 0.5% SDS at 45.degree. C.
for 30 minutes, and then repeated twice with 0.2.times.SSC, 0.5%
SDS at 50.degree. C. for 30 minutes. Other stringent conditions are
obtained by using higher temperatures in which the washes are
identical to those above except for the temperature of the final
two 30 minute washes in 0.2.times.SSC, 0.5% SDS, which is increased
to 60.degree. C. Another set of highly stringent conditions uses
two final washes in 0.1.times.SSC, 0.1% SDS at 65.degree. C.
Another example of stringent hybridization conditions is
hybridization at 50.degree. C. or higher and 0.1.times.SSC (15 mM
sodium chloride/1.5 mM sodium citrate). Another example of
stringent hybridization conditions is overnight incubation at
42.degree. C. in a solution: 50% formamide, 5.times.SSC (150 mM
NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6),
5.times.Denhardt's solution, 10% dextran sulfate, and 20 .mu.g/ml
denatured, sheared salmon sperm DNA, followed by washing the
filters in 0.1.times.SSC at about 65.degree. C. Stringent
hybridization conditions and post-hybridization wash conditions are
hybridization conditions and post-hybridization wash conditions
that are at least as stringent as the above representative
conditions.
[0038] Hybridization requires that the two nucleic acids contain
complementary sequences, although depending on the stringency of
the hybridization, mismatches between bases are possible. The
appropriate stringency for hybridizing nucleic acids depends on the
length of the nucleic acids and the degree of complementation,
variables well known in the art. The greater the degree of
similarity or homology between two nucleotide sequences, the
greater the value of the melting temperature (Tm) for hybrids of
nucleic acids having those sequences. The relative stability
(corresponding to higher Tm) of nucleic acid hybridizations
decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA. For
hybrids of greater than 100 nucleotides in length, equations for
calculating Tm have been derived (see Sambrook et al., supra,
9.50-9.51). For hybridizations with shorter nucleic acids, i.e.,
oligonucleotides, the position of mismatches becomes more
important, and the length of the oligonucleotide determines its
specificity (see Sambrook et al., supra, 11.7-11.8). Typically, the
length for a hybridizable nucleic acid is at least about 10
nucleotides. Illustrative minimum lengths for a hybridizable
nucleic acid are: at least about 15 nucleotides; at least about 20
nucleotides; and at least about 30 nucleotides. Furthermore, the
skilled artisan will recognize that the temperature and wash
solution salt concentration may be adjusted as necessary according
to factors such as length of the probe.
[0039] The term "conservative amino acid substitution" refers to
the interchangeability in proteins of amino acid residues having
similar side chains. For example, a group of amino acids having
aliphatic side chains consists of glycine, alanine, valine,
leucine, and isoleucine; a group of amino acids having
aliphatic-hydroxyl side chains consists of serine and threonine; a
group of amino acids having amide-containing side chains consists
of asparagine and glutamine; a group of amino acids having aromatic
side chains consists of phenylalanine, tyrosine, and tryptophan; a
group of amino acids having basic side chains consists of lysine,
arginine, and histidine; and a group of amino acids having
sulfur-containing side chains consists of cysteine and methionine.
Exemplary conservative amino acids substitution groups are:
valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine,
alanine-valine, and asparagine-glutamine.
[0040] "Synthetic nucleic acids" can be assembled from
oligonucleotide building blocks that are chemically synthesized
using procedures known to those skilled in the art. These building
blocks are ligated and annealed to form gene segments which are
then enzymatically assembled to construct the entire gene.
"Chemically synthesized," as related to a sequence of DNA, means
that the component nucleotides were assembled in vitro. Manual
chemical synthesis of DNA may be accomplished using
well-established procedures, or automated chemical synthesis can be
performed using one of a number of commercially available machines.
The nucleotide sequence of the nucleic acids can be modified for
optimal expression based on optimization of nucleotide sequence to
reflect the codon bias of the host cell. The skilled artisan
appreciates the likelihood of successful expression if codon usage
is biased towards those codons favored by the host. Determination
of preferred codons can be based on a survey of genes derived from
the host cell where sequence information is available.
[0041] A polynucleotide or polypeptide has a certain percent
"sequence identity" to another polynucleotide or polypeptide,
meaning that, when aligned, that percentage of bases or amino acids
are the same, and in the same relative position, when comparing the
two sequences. Sequence similarity can be determined in a number of
different manners. To determine sequence identity, sequences can be
aligned using the methods and computer programs, including BLAST,
available over the world wide web at ncbi.nlm.nih.gov/BLAST. See,
e.g., Altschul et al. (1990), J. Mol. Biol. 215:403-10. Another
alignment algorithm is FASTA, available in the Genetics Computing
Group (GCG) package, from Madison, Wis., USA, a wholly owned
subsidiary of Oxford Molecular Group, Inc. Other techniques for
alignment are described in Methods in Enzymology, vol. 266:
Computer Methods for Macromolecular Sequence Analysis (1996), ed.
Doolittle, Academic Press, Inc., a division of Harcourt Brace &
Co., San Diego, Calif., USA. Of particular interest are alignment
programs that permit gaps in the sequence. The Smith-Waterman is
one type of algorithm that permits gaps in sequence alignments. See
Meth. Mol. Biol. 70: 173-187 (1997). Also, the GAP program using
the Needleman and Wunsch alignment method can be utilized to align
sequences. See J. Mol. Biol. 48: 443-453 (1970).
[0042] Before the present invention is further described, it is to
be understood that this invention is not limited to particular
embodiments described, as such may, of course, vary. It is also to
be understood that the terminology used herein is for the purpose
of describing particular embodiments only, and is not intended to
be limiting, since the scope of the present invention will be
limited only by the appended claims.
[0043] Where a range of values is provided, it is understood that
each intervening value, to the tenth of the unit of the lower limit
unless the context clearly dictates otherwise, between the upper
and lower limit of that range and any other stated or intervening
value in that stated range, is encompassed within the invention.
The upper and lower limits of these smaller ranges may
independently be included in the smaller ranges, and are also
encompassed within the invention, subject to any specifically
excluded limit in the stated range. Where the stated range includes
one or both of the limits, ranges excluding either or both of those
included limits are also included in the invention.
[0044] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can also be used in the practice or testing of the present
invention, the preferred methods and materials are now described.
All publications mentioned herein are incorporated herein by
reference to disclose and describe the methods and/or materials in
connection with which the publications are cited.
[0045] It must be noted that as used herein and in the appended
claims, the singular forms "a," "and," and "the" include plural
referents unless the context clearly dictates otherwise. Thus, for
example, reference to "a genetically modified host cell" includes a
plurality of such genetically modified host cells and reference to
"the isoprenoid compound" includes reference to one or more
isoprenoid compounds and equivalents thereof known to those skilled
in the art, and so forth. It is further noted that the claims may
be drafted to exclude any optional element. As such, this statement
is intended to serve as antecedent basis for use of such exclusive
terminology as "solely," "only" and the like in connection with the
recitation of claim elements, or use of a "negative"
limitation.
[0046] The publications discussed herein are provided solely for
their disclosure prior to the filing date of the present
application. Nothing herein is to be construed as an admission that
the present invention is not entitled to antedate such publication
by virtue of prior invention. Further, the dates of publication
provided may be different from the actual publication dates which
may need to be independently confirmed.
DETAILED DESCRIPTION OF THE INVENTION
[0047] The present invention provides genetically modified
eukaryotic host cells that produce isoprenoid precursors or
isoprenoid compounds. A subject genetically modified host cell
comprises increased activity levels of one or more of mevalonate
pathway enzymes, increased levels of prenyl transferase activity,
and decreased levels of squalene synthase activity. Methods are
provided for the production of an isoprenoid compound or an
isoprenoid precursor in a subject genetically modified eukaryotic
host cell. The methods generally involve culturing a subject
genetically modified host cell under conditions that promote
production of high levels of an isoprenoid or isoprenoid precursor
compound.
[0048] The S. cerevisiae mevalonate and sterol pathways are
depicted schematically in FIG. 1 and FIG. 2 (note that amorphadiene
synthase (ADS) in FIG. 2 is not normally expressed in genetically
unmodified S. cerevisiae.) This pathway is typical of a wide
variety of eukaryotic cells. FPP is converted to squalene by
squalene synthase (ERG9). Squalene is converted to ergosterol in
subsequent steps. In unmodified cells, much of the metabolic flux
directs FPP towards sterol synthesis. In a subject genetically
modified eukaryotic host cell, the metabolic flux is redirected
towards greater production of the isoprenoid precursors IPP and
FPP.
Genetically Modified Host Cells
[0049] The present invention provides genetically modified
eukaryotic host cells, which cells comprise one or more genetic
modifications that provide for increased production of isoprenoid
or isoprenoid precursor compounds. Compared to a control host cell
not genetically modified according to the present invention, a
subject genetically modified host cell exhibits the following
characteristics: increased activity levels of one or more
mevalonate pathway enzymes; increased levels of prenyl transferase
activity; and decreased levels of squalene synthase activity.
[0050] Increased activity levels of one or more mevalonate pathway
enzymes, increased levels of prenyl transferase activity, and
decreased levels of squalene synthase activity increases isoprenoid
or isoprenoid precursor production by a subject genetically
modified host cell. Thus, in some embodiments, a subject
genetically modified host cell exhibits increases in isoprenoid or
isoprenoid precursor production, where isoprenoid or isoprenoid
precursor production is increased by at least about 10%, at least
about 15%, at least about 20%, at least about 25%, at least about
30%, at least about 35%, at least about 40%, at least about 45%, at
least about 50%, at least about 60%, at least about 70%, at least
about 80%, at least about 90%, at least about 2-fold, at least
about 2.5-fold, at least about 5-fold, at least about 10-fold, at
least about 20-fold, at least about 30-fold, at least about
40-fold, at least about 50-fold, at least about 75-fold, at least
about 100-fold, at least about 200-fold, at least about 300-fold,
at least about 400-fold, at least about 500-fold, or at least about
10.sup.3-fold, or more, in the genetically modified host cell,
compared to the level of isoprenoid precursor or isoprenoid
compound produced in a control host cell that is not genetically
modified as described herein. Isoprenoid or isoprenoid precursor
production is readily determined using well-known methods, e.g.,
gas chromatography-mass spectrometry, liquid chromatography-mass
spectrometry, ion chromatography-mass spectrometry, pulsed
amperometric detection, uv-vis spectrometry, and the like.
[0051] In some embodiments, a subject genetically modified host
cell provides for enhanced production of isoprenoid or isoprenoid
precursor per cell, e.g., the amount of isoprenoid or isoprenoid
precursor compound produced using a subject method is at least
about 10%, at least about 15%, at least about 20%, at least about
25%, at least about 30%, at least about 35%, at least about 40%, at
least about 45%, at least about 50%, at least about 60%, at least
about 70%, at least about 80%, at least about 90%, at least about
2-fold, at least about 2.5-fold, at least about 5-fold, at least
about 10-fold, at least about 20-fold, at least about 30-fold, at
least about 40-fold, at least about 50-fold, at least about
75-fold, at least about 100-fold, at least about 200-fold, at least
about 300-fold, at least about 400-fold, or at least about
500-fold, or 10.sup.3-fold, or more, higher than the amount of the
isoprenoid or isoprenoid precursor compound produced by a host cell
that is not genetically modified by the subject methods, on a per
cell basis. Amount of cells is measured by measuring dry cell
weight or measuring optical density of the cell culture.
[0052] In other embodiments, a subject genetically modified host
cell provides for enhanced production of isoprenoid or isoprenoid
precursor per unit volume of cell culture, e.g., the amount of
isoprenoid or isoprenoid precursor compound produced using a
subject genetically modified host cell is at least about 10%, at
least about 15%, at least about 20%, at least about 25%, at least
about 30%, at least about 35%, at least about 40%, at least about
45%, at least about 50%, at least about 60%, at least about 70%, at
least about 80%, at least about 90%, at least about 2-fold, at
least about 2.5-fold, at least about 5-fold, at least about
10-fold, at least about 20-fold, at least about 30-fold, at least
about 40-fold, at least about 50-fold, at least about 75-fold, at
least about 100-fold, at least about 200-fold, at least about
300-fold, at least about 400-fold, or at least about 500-fold, or
10.sup.3-fold, or more, higher than the amount of the isoprenoid or
isoprenoid precursor compound produced by a host cell that is not
genetically modified by the subject methods, on a per unit volume
of cell culture basis.
[0053] In some embodiments, a subject genetically modified
eukaryotic host produces an isoprenoid or isoprenoid precursor
compound in an amount ranging from 1 .mu.g isoprenoid compound/ml
to 100,000 .mu.g isoprenoid compound/ml, e.g., from about 1
.mu.g/ml to about 10,000 .mu.g/ml of isoprenoid compound, 1
.mu.g/nil to 5000 .mu.g/ml of isoprenoid compound, 1 .mu.g/ml to
4500 .mu.g/ml of isoprenoid compound, 1 .mu.g/ml to 4000 .mu.g/ml
of isoprenoid compound, 1 .mu.g/ml to 3500 .mu.g/ml of isoprenoid
compound, 1 .mu.g/ml to 3000 .mu.g/ml of isoprenoid compound, 1
.mu.g/ml to 2500 .mu.g/ml of isoprenoid compound, 1 .mu.g/ml to
2000 .mu.g/ml of isoprenoid compound, 1 .mu.g/ml to 1500 .mu.g/ml
of isoprenoid compound, 1 .mu.g/ml to 1000 .mu.g/ml of isoprenoid
compound, 5 .mu.g/ml to 5000 .mu.g/ml of isoprenoid compound, 10
.mu.g/ml to 5000 .mu.g/ml of isoprenoid compound, 20 .mu.g/ml to
5000 .mu.g/ml of isoprenoid compound, 30 .mu.g/ml to 1000 .mu.g/ml
of isoprenoid compound, 40 .mu.g/ml to 500 .mu.g/ml of isoprenoid
compound, 50 .mu.g/ml to 300 .mu.g/ml of isoprenoid compound, 60
.mu.g/ml to 100 .mu.g/ml of isoprenoid compound, 70 .mu.g/ml to 80
.mu.g/ml of isoprenoid compound, from about 1 .mu.g/ml to about
1,000 .mu.g/ml, from about 1,000 .mu.g/ml to about 2,000 .mu.g/ml,
from about 2,000 .mu.g/ml to about 3,000 .mu.g/ml, from about 3,000
.mu.g/ml to about 4,000 .mu.g/ml, from about 4,000 .mu.g/ml to
about 5,000 .mu.g/ml, from about 5,000 .mu.g/ml to about 7,500
.mu.g/ml, or from about 7,500 .mu.g/ml to about 10,000 .mu.g/ml, or
greater than 10,000 .mu.g/ml isoprenoid compound, e.g., from about
10 mg isoprenoid compound/ml to about 20 mg isoprenoid compound/ml,
from about 20 mg isoprenoid compound/ml to about 50 mg isoprenoid
compound/ml, from about 50 mg isoprenoid compound/ml to about 100
mg isoprenoid compound/ml, or more.
[0054] The subject methods can be used in a variety of different
kinds of eukaryotic host cells. Host cells are, in many
embodiments, unicellular organisms, or are grown in culture as
single cells. Suitable eukaryotic host cells include, but are not
limited to, yeast cells, insect cells, plant cells, fungal cells,
and algal cells. Suitable eukaryotic host cells include, but are
not limited to, Pichia pastoris, Pichia finlandica, Pichia
trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia
opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia
guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica,
Pichia sp., Saccharomyces cerevisiae, Saccharomyces sp., Hansenula
polymorpha, Kluyveromyces sp., Kluyveromyces lactis, Candida
albicans, Aspergillus nidulans, Aspergillus niger, Aspergillus
oryzae, Trichoderma reesei, Chrysosporium lucknowense, Fusarium
sp., Fusarium gramineum, Fusarium venenatum, Neurospora crassa,
Chlamydomonas reinhardtii, and the like. In some embodiments, the
host cell is a eukaryotic cell other than a plant cell. In some
embodiments, subject genetically modified host cell is a yeast
cell. In a particular embodiment, the yeast cell is Saccharomyces
cerevisiae.
[0055] In an exemplary embodiment, the metabolic pathway of
Saccharomyces cerevisiae is engineered to produce sesquiterpenes
from farnesyl diphosphate. One such sesquiterpene, amorphadiene, is
a precursor to the antimalarial drug artemisinin. Amorphadiene,
cyclized from farnesyl diphosphate, can be used as an assay for
isoprenoid precursor levels.
[0056] In an exemplary embodiment, activity levels of HMGR, a
prenyl transferase, Ecm22p and Upc2p are increased and activity
levels of squalene synthase are decreased.
3-hydroxy-3-methylglutaryl coenzyme-A reductase (HMGR) and a prenyl
transferase, e.g., farnesyl diphosphate synthase (FPPS), catalyze
bottle neck reactions in an amorphadiene synthesis pathway.
Increasing activity of HMGR and a prenyl transferase, e.g., FPPS,
overcomes these bottlenecks. Two transcription factors, Ecm22p and
Upc2p, are important in sterol synthesis regulation. Each of these
two factors is mutated at a single amino acid near their C-termini,
which mutation increases activity of each factor. Squalene synthase
catalyzes the reaction from farnesyl diphosphate to squalene in the
undesired sterol synthesis pathway. Thus, to maximize precursor
pools and prevent undue flux to sterols, transcription of ERG9 has
been limited.
Increased Level of Activity of One or More Mevalonate Pathway
Enzymes
[0057] The mevalonate pathway comprises enzymes that catalyze the
following steps: (a) condensing two molecules of acetyl-CoA to
acetoacetyl-CoA, typically by action of acetoacetyl-CoA thiolase;
(b) condensing acetoacetyl-CoA with acetyl-CoA to form HMG-CoA,
typically by action of HMG synthase (HMGS); (c) converting HMG-CoA
to mevalonate, typically by action of HMGR; (d) phosphorylating
mevalonate to mevalonate 5-phosphate, typically by action of
mevalonate kinase (MK); (e) converting mevalonate 5-phosphate to
mevalonate 5-pyrophosphate, typically by action of
phosphomevalonate kinase (PMK); and (f) converting mevalonate
5-pyrophosphate to isopentenyl pyrophosphate, typically by action
of mevalonate pyrophosphate decarboxylase (MPD).
[0058] A subject genetically modified eukaryotic host cell
comprises one or more genetic modifications resulting in one or
more of the following: increased level of HMGS activity; increased
level of HMGR activity; increased level of MK activity; increased
level of PMK activity; and increased level of MPD activity.
[0059] In some embodiments, a subject genetically modified host
cell is genetically modified such that the level of activity of one
or more mevalonate pathway enzymes is increased. The level of
activity of one or more mevalonate pathway enzymes in a subject
genetically modified host cell can be increased in a number of
ways, including, but not limited to, 1) increasing the promoter
strength of the promoter to which the mevalonate pathway enzyme
coding region is operably linked; 2) increasing the copy number of
the plasmid comprising a nucleotide sequence encoding the
mevalonate pathway enzyme; 3) increasing the stability of a
mevalonate pathway enzyme mRNA (where a "mevalonate pathway enzyme
mRNA" is an mRNA comprising a nucleotide sequence encoding the
mevalonate pathway enzyme); 4) modifying the sequence of the
ribosome binding site of a mevalonate pathway enzyme mRNA such that
the level of translation of the mevalonate pathway enzyme mRNA is
increased; 5) modifying the sequence between the ribosome binding
site of a mevalonate pathway enzyme mRNA and the start codon of the
mevalonate pathway enzyme coding sequence such that the level of
translation of the mevalonate pathway enzyme mRNA is increased; 6)
modifying the entire intercistronic region 5' of the start codon of
the mevalonate pathway enzyme coding region such that translation
of the mevalonate pathway enzyme mRNA is increased; 7) modifying
the codon usage of mevalonate pathway enzyme such that the level of
translation of the mevalonate pathway enzyme mRNA is increased, 8)
expressing rare codon tRNAs used in the mevalonate pathway enzyme
such that the level of translation of the mevalonate pathway enzyme
mRNA is increased; 9) increasing the enzyme stability of mevalonate
pathway enzyme; 10) increasing the specific activity (units
activity per unit protein) of the mevalonate pathway enzyme; 11)
expressing a modified form of a mevalonate pathway enzyme such that
the modified enzyme exhibits increased solubility in the host cell;
or 12) expressing a modified form of a mevalonate pathway enzyme
such that the modified enzyme lacks a domain through which
regulation occurs. The foregoing modifications may be made singly
or in combination; e.g., two or more of the foregoing modifications
may be made to provide for an increased level of mevalonate pathway
enzyme activity.
[0060] The enzyme HMG-CoA reductase (HMGR) catalyzes an
irreversible reaction that reduces 3-hydroxy-3-methylglutaryl
Coenzyme A (HMG-CoA) to mevalonate. This step is the committed step
in the sterol biosynthesis pathway. Thus, HMGR is a major point of
regulation in organisms that naturally utilize the mevalonate
pathway to produce isoprenoids.
[0061] In some embodiments, a subject genetically modified host
cell is genetically modified such that the level of HMGR activity
is increased. The level of HMGR activity in the genetically
modified host cell can be increased in a number of ways, including,
but not limited to, 1) increasing the promoter strength of the
promoter to which the HMGR coding region is operably linked; 2)
increasing the copy number of the plasmid comprising a nucleotide
sequence encoding HMGR; 3) increasing the stability of an HMGR mRNA
(where an "HMGR mRNA" is an mRNA comprising a nucleotide sequence
encoding HMGR); 4) modifying the sequence of the ribosome binding
site of an HMGR mRNA such that the level of translation of the HMGR
mRNA is increased; 5) modifying the sequence between the ribosome
binding site of an HMGR mRNA and the start codon of the HMGR coding
sequence such that the level of translation of the HMGR mRNA is
increased; 6) modifying the entire intercistronic region 5' of the
start codon of the HMGR coding region such that translation of the
HMGR mRNA is increased; 7) modifying the codon usage of HMGR such
that the level of translation of the HMGR mRNA is increased, 8)
expressing rare codon tRNAs used in HMGR such that the level of
translation of the HMGR mRNA is increased; 9) increasing the enzyme
stability of HMGR; 10) increasing the specific activity (units
activity per unit protein) of HMGR; or 11) truncating the HMGR to
remove a negative regulatory element. The foregoing modifications
may be made singly or in combination; e.g., two or more of the
foregoing modifications may be made to provide for an increased
level of HMGR activity.
[0062] In many embodiments, the level of HMGR is increased by
genetically modifying a eukaryotic host cell such that it produces
a truncated form of HMGR (tHMGR), which truncated form has
increased enzymatic activity relative to wild-type HMGR. tHMGR
lacks a membrane-spanning domain and is therefore soluble and lacks
the feedback inhibition of HMGR. tHMGR retains its catalytic
C-terminus region, and thus retains the activity of HMGR. In some
embodiments, the truncated HMGR has the amino acid sequence
depicted in FIGS. 7A and 7B (SEQ ID NO:2). In some embodiments, the
truncated HMGR is encoded by a nucleic acid comprising the
nucleotide sequence depicted in FIG. 6 (SEQ ID NO:1).
[0063] In some embodiments, the level of activity of one or more of
HMGS, MK, and PMK is increased. In S. cerevisiae, the genes
encoding HMGS (ERG13), MK (ERG12), and PMK (ERGS) comprise a sterol
regulatory element that binds the transcription factors Ecm22p and
Upc2p, where, upon binding of Ecm22p and Upc2p, transcription is
activated. In some embodiments, the level of activity of one or
more of HMGS, MK, and PMK is increased by increasing the activity
of Ecm22p and Upc2p. Vik et al. (2001) Mol. Cell. Biol.
19:6395-405.
[0064] Normally S. cerevisiae does not take up sterols from the
environment under aerobic conditions. Lewis et al. ((1988) Yeast
4:93-106) isolated a yeast mutant, upc2-1 (uptake control), which
resulted in aerobic sterol uptake. The upc2-1 allele comprises a
guanine to adenine transition in the open reading frame designated
YDR213W on chromosome IV. Crowley et al. (1998) J. Bacteriol. 16:
4177-4183. The nucleic acid sequence of wild-type Upc2 is known and
can be obtained through GenBank Accession No. 268194. This
wild-type allele is noted as coordinates 889746-892487 on the S.
cerevisiae chromosome. As previously found by Lewis et al., under
native conditions the level of sterol uptake was 10- to 20-fold
greater than with the isogenic wild type. The mutant resulted in an
increased ergosterol production.
[0065] The single amino acid change near the C-termini of Upc2p and
Ecm22p transcription factors has been shown to increase their
activity. In many embodiments, a subject genetically modified host
cell is genetically modified such that Upc2p comprises a
glycine-to-aspartic acid substitution at amino acid 888; and Ecm22p
comprises a glycine-to-aspartic acid substitution at amino acid
790.
Increased Level of Prenyltransferase Activity
[0066] In some embodiments, a subject genetically modified
eukaryotic host cell is genetically modified such that the level of
geranyl diphosphate synthase (GPPS) and/or farnesyl diphosphate
synthase (FPPS) activity is increased.
[0067] The enzyme farnesyl diphosphate synthase (FPPS) catalyzes a
reaction that converts geranyl diphosphate (GPP) into farnesyl
diphosphate (FPP). This step has also been shown to be rate
limiting in the mevalonate pathway. Thus, FPPS is a point of
regulation in organisms that naturally utilize the mevalonate
pathway to produce isoprenoids. As such, and for ease of further
description, modulating levels of activity of a prenyl transferase
is discussed in terms of modulating the level of activity of a
FPPS.
[0068] In some embodiments, the level of FPPS activity is
increased. The level of FPPS activity in a genetically modified
host cell can be increased in a number of ways, including, but not
limited to, 1) increasing the promoter strength of the promoter to
which the FPPS coding region is operably linked; 2) increasing the
copy number of the plasmid comprising a nucleotide sequence
encoding FPPS; 3) increasing the stability of an FPPS mRNA (where
an "FPPS mRNA" is an mRNA comprising a nucleotide sequence encoding
FPPS); 4) modifying the sequence of the ribosome binding site of an
FPPS mRNA such that the level of translation of the FPPS mRNA is
increased; 5) modifying the sequence between the ribosome binding
site of an FPPS mRNA and the start codon of the FPPS coding
sequence such that the level of translation of the FPPS mRNA is
increased; 6) modifying the entire intercistronic region 5' of the
start codon of the FPPS coding region such that translation of the
FPPS mRNA is increased; 7) modifying the codon usage of FPPS such
that the level of translation of the FPPS mRNA is increased, 8)
expressing rare codon tRNAs used in FPPS such that the level of
translation of the FPPS mRNA is increased; 9) increasing the enzyme
stability of FPPS; or 10) increasing the specific activity (units
activity per unit protein) of FPPS. The foregoing modifications may
be made singly or in combination; e.g., two or more of the
foregoing modifications may be made to provide for an increased
level of FPPS activity.
Decreased Level of Squalene Synthase Activity
[0069] The enzyme squalene synthase catalyzes a reaction that
converts farnesyl diphosphate into squalene. This step is the first
step in the pathway leading from farnesyl diphosphate to
ergosterol. Thus by limiting the action of this enzyme, FPP is
shunted towards terpenoid production pathways utilizing, e.g.,
terpene synthases or GGPP synthase and subsequent terpene
synthases.
[0070] In some embodiments, a subject genetically modified host
cell is genetically modified such that the level of squalene
synthase activity is decreased. The level of squalene synthase
activity in the genetically modified host cell can be decreased in
a number of ways, including, but not limited to, 1) decreasing the
promoter strength of the promoter to which the squalene synthase
coding region is operably linked; 2) decreasing the stability of an
squalene synthase mRNA (where a "squalene synthase mRNA" is an mRNA
comprising a nucleotide sequence encoding squalene synthase); 3)
modifying the sequence of the ribosome binding site of a squalene
synthase mRNA such that the level of translation of the squalene
synthase mRNA is decreased; 4) modifying the sequence between the
ribosome binding site of a squalene synthase mRNA and the start
codon of the squalene synthase coding sequence such that the level
of translation of the squalene synthase mRNA is decreased; 5)
modifying the entire intercistronic region 5' of the start codon of
the squalene synthase coding region such that translation of the
squalene synthase mRNA is decreased; 6) modifying the codon usage
of squalene synthase such that the level of translation of the
squalene synthase mRNA is decreased, 7) decreasing the enzyme
stability of squalene synthase; 8) decreasing the specific activity
(units activity per unit protein) of squalene synthase, or 9) using
a chemically-repressible-promoter and repressing the
chemically-repressible-promoter by adding a chemical to a growth
medium. The foregoing modifications may be made singly or in
combination; e.g., two or more of the foregoing modifications may
be made to provide for a decreased level of squalene synthase
activity.
[0071] In an exemplary embodiment, the activity of squalene
synthase in S. cerevisiae has been reduced or eliminated. Yeast
ERG9 mutants that are unable to convert mevalonate into squalene
have been produced. See, e.g., Karst et al. (1977) Molec. Gen.
Genet. 154:269-277; U.S. Pat. No. 5,589,372; and U.S. Patent
Publication No. 2004/0110257. Genetic modifications include
decreasing the activity of squalene synthase by blocking or
reducing the production of squalene synthase, reducing the activity
of squalene synthase, or by inhibiting the activity of squalene
synthase. Blocking or reducing the production of squalene synthase
can include placing the squalene synthase gene under the control of
a promoter that requires the presence of an inducing compound in
the growth medium. By establishing conditions such that the inducer
becomes depleted from the medium, the expression of squalene
synthase can be turned off. Some promoters are turned off by the
presence of a repressing compound. E.g., the promoters from the
yeast CTR3 or CTRL genes can be repressed by addition of copper.
Blocking or reducing the activity of squalene synthase can include
excision technology similar to that described in U.S. Pat. No.
4,743,546, incorporated herein by reference. In this approach the
ERG9 gene is cloned between specific genetic sequences that allow
specific, controlled excision of the ERG9 gene from the genome.
Excision could be prompted by, e.g., a shift in the cultivation
temperature of the culture, as in U.S. Pat. No. 4,743,546, or by
some other physical or nutritional signal. Such a genetic
modification includes any type of modification and specifically
includes modifications made by recombinant technology and by
classical mutagenesis. Inhibitors of squalene synthase are known
(see U.S. Pat. No. 4,871,721 and the references cited in U.S. Pat.
No. 5,475,029) and can be added to cell cultures.
[0072] In some embodiments, the codon usage of a squalene synthase
coding sequence is modified such that the level of translation of
the ERG9 mRNA is decreased. Reducing the level of translation of
ERG9 mRNA by modifying codon usage is achieved by modifying the
sequence to include codons that are rare or not commonly used by
the host cell. Codon usage tables for many organisms are available
that summarize the percentage of time a specific organism uses a
specific codon to encode for an amino acid. Certain codons are used
more often than other, "rare" codons. The use of "rare" codons in a
sequence generally decreases its rate of translation. Thus, e.g.,
the coding sequence is modified by introducing one or more rare
codons, which affect the rate of translation, but not the amino
acid sequence of the enzyme translated. For example, there are 6
codons that encode for arginine: CGT, CGC, CGA, CGG, AGA, and AGG.
In E. coli the codons CGT and CGC are used far more often (encoding
approximately 40% of the arginines in E. coli each) than the codon
AGG (encoding approximately 2% of the arginines in E. coli).
Modifying a CGT codon within the sequence of a gene to an AGG codon
would not change the sequence of the enzyme, but would likely
decrease the gene's rate of translation.
Generating a Genetically Modified Host Cell
[0073] A subject genetically modified host cell is generated using
standard methods well known to those skilled in the art. In some
embodiments, a heterologous nucleic acid comprising a nucleotide
sequence encoding a variant mevalonate pathway enzyme and/or a
heterologous nucleic acid comprising a nucleotide sequence encoding
a variant transcription factor that controls transcription of a
mevalonate pathway enzyme(s) is introduced into a host cell and
replaces all or a part of an endogenous gene, e.g., via homologous
recombination. In some embodiments, a heterologous nucleic acid is
introduced into a parent host cell, and the heterologous nucleic
acid recombines with an endogenous nucleic acid encoding a
mevalonate pathway enzyme, a prenyltransferase, a transcription
factor that controls transcription of one or more mevalonate
pathway enzymes, or a squalene synthase, thereby genetically
modifying the parent host cell. In some embodiments, the
heterologous nucleic acid comprises a promoter that has increased
promoter strength compared to the endogenous promoter that controls
transcription of the endogenous prenyltransferase, and the
recombination event results in substitution of the endogenous
promoter with the heterologous promoter. In other embodiments, the
heterologous nucleic acid comprises a nucleotide sequence encoding
a truncated HMGR that exhibits increased enzymatic activity
compared to the endogenous HMGR, and the recombination event
results in substitution of the endogenous HMGR coding sequence with
the heterologous HMGR coding sequence. In some embodiments, the
heterologous nucleic acid comprises a promoter that provides for
regulated transcription of an operably linked squalene synthase
coding sequence and the recombination event results in substitution
of the endogenous squalene synthase promoter with the heterologous
promoter.
Further Genetic Modifications
[0074] In some embodiments, a subject genetically modified host
cell comprises one or more genetic modifications in addition to
those discussed above. For example, in some embodiments, a subject
genetically modified host cell is further genetically modified with
one or more nucleic acids comprising nucleotide sequences encoding
one or more of a prenyltransferase (e.g., a prenyltransferase other
than FPP and GPP); a terpene synthase; and the like.
Codon Usage
[0075] In some embodiments, the nucleotide sequence encoding a gene
product (e.g., a prenyltransferase, a terpene synthase, etc.) is
modified such that the nucleotide sequence reflects the codon
preference for the particular host cell. For example, the
nucleotide sequence will in some embodiments be modified for yeast
codon preference. See, e.g., Bennetzen and Hall (1982) J. Biol.
Chem. 257(6): 3026-3031.
[0076] As noted above, in some embodiments, the codon usage of a
squalene synthase coding sequence is modified such that the level
of translation of the ERG9 mRNA is decreased. Reducing the level of
translation of ERG9 mRNA by modifying codon usage is achieved by
modifying the sequence to include codons that are rare or not
commonly used by the host cell. Codon usage tables for many
organisms are available that summarize the percentage of time a
specific organism uses a specific codon to encode for an amino
acid. Certain codons are used more often than other, "rare" codons.
The use of "rare" codons in a sequence generally decreases its rate
of translation. Thus, e.g., the coding sequence is modified by
introducing one or more rare codons, which affect the rate of
translation, but not the amino acid sequence of the enzyme
translated. For example, there are 6 codons that encode for
arginine: CGT, CGC, CGA, CGG, AGA, and AGG. In E. coli the codons
CGT and CGC are used far more often (encoding approximately 40% of
the arginines in E. coli each) than the codon AGG (encoding
approximately 2% of the arginines in E. coli). Modifying a CGT
codon within the sequence of a gene to an AGG codon would not
change the sequence of the enzyme, but would likely decrease the
gene's rate of translation.
Increased Acetyl-CoA Supply
[0077] Since acetyl-CoA is a reactant used by both acetoacetyl-CoA
thiolase and HMGS in the MEV pathway, in some host cells, increases
in the intracellular pool of acetyl-CoA could lead to increases in
isoprenoid and isoprenoid precursors. Modifications that would
increase the levels of intracellular acetyl-CoA include, but are
not limited to, modifications that would decrease the total
activity of lactate dehydrogenase within the cell, modifications
that would decrease the total activity of acetate kinase within the
cell, modifications that would decrease the total activity of
alcohol dehydrogenase within the cell, modifications that would
interrupt the tricarboxylic acid cycle, such as those that would
decrease the total activity of 2-ketoglutarate dehydrogenase, or
modifications that would interrupt oxidative phosphorylation, such
as those that would decrease the total activity of the (F1F0)H+-ATP
synthase, or combinations thereof.
Prenyltransferases
[0078] Prenyltransferases constitute a broad group of enzymes
catalyzing the consecutive condensation of IPP resulting in the
formation of prenyl diphosphates of various chain lengths. Suitable
prenyltransferases include enzymes that catalyze the condensation
of IPP with allylic primer substrates to form isoprenoid compounds
with from about 5 isoprene units to about 6000 isoprene units or
more, e.g., from about 5 isoprene units to about 10 isoprene units,
from about 10 isoprene units to about 15 isoprene units, from about
15 isoprene units to about 20 isoprene units, from about 20
isoprene units to about 25 isoprene units, from about 25 isoprene
units to about 30 isoprene units, from about 30 isoprene units to
about 40 isoprene units, from about 40 isoprene units to about 50
isoprene units, from about 50 isoprene units to about 100 isoprene
units, from about 100 isoprene units to about 250 isoprene units,
from about 250 isoprene units to about 500 isoprene units, from
about 500 isoprene units to about 1000 isoprene units, from about
1000 isoprene units to about 2000 isoprene units, from about 2000
isoprene units to about 3000 isoprene units, from about 3000
isoprene units to about 4000 isoprene units, from about 4000
isoprene units to about 5000 isoprene units, or from about 5000
isoprene units to about 6000 isoprene units or more.
[0079] Suitable prenyltransferases include, but are not limited to,
an E-isoprenyl diphosphate synthase, including, but not limited to,
geranylgeranyl diphosphate (GGPP) synthase, hexaprenyl diphosphate
(HexPP) synthase, heptaprenyl diphosphate (HepPP) synthase,
octaprenyl (OPP) diphosphate synthase, solanesyl diphosphate (SPP)
synthase, decaprenyl diphosphate (DPP) synthase, chicle synthase,
and gutta-percha synthase; and a Z-isoprenyl diphosphate synthase,
including, but not limited to, nonaprenyl diphosphate (NPP)
synthase, undecaprenyl diphosphate (UPP) synthase, dehydrodolichyl
diphosphate synthase, eicosaprenyl diphosphate synthase, natural
rubber synthase, and other Z-isoprenyl diphosphate synthases.
[0080] The nucleotide sequences of numerous prenyltransferases from
a variety of species are known, and can be used or modified for use
in generating a subject genetically modified eukaryotic host cell.
Nucleotide sequences encoding prenyltransferases are known in the
art. See, e.g., Human farnesyl pyrophosphate synthetase mRNA
(GenBank Accession No. J05262; Homo sapiens); farnesyl diphosphate
synthetase (FPP) gene (GenBank Accession No. J05091; Saccharomyces
cerevisiae); isopentenyl diphosphate:dimethylallyl diphosphate
isomerase gene (J05090; Saccharomyces cerevisiae); Wang and Ohnuma
(2000) Biochim. Biophys. Acta 1529:33-48; U.S. Pat. No. 6,645,747;
Arabidopsis thaliana farnesyl pyrophosphate synthetase 2 (FPS2)/FPP
synthetase 2/farnesyl diphosphate synthase 2 (At4g17190) mRNA
(GenBank Accession No. NM_202836); Ginkgo biloba geranylgeranyl
diphosphate synthase (ggpps) mRNA (GenBank Accession No. AY371321);
Arabidopsis thaliana geranylgeranyl pyrophosphate synthase
(GGPS1)/GGPP synthetase/farnesyltranstransferase (At4g36810) mRNA
(GenBank Accession No. NM_119845); Synechococcus elongatus gene for
farnesyl, geranylgeranyl, geranylfarnesyl, hexaprenyl, heptaprenyl
diphosphate synthase (SelF-HepPS) (GenBank Accession No. AB016095);
etc.
[0081] In many embodiments, a eukaryotic host cell is genetically
modified with a nucleic acid comprising a prenyltransferase. For
example, in many embodiments, a host cell is genetically modified
with a nucleic acid comprising nucleotide sequences encoding a
prenyltransferase selected from a GGPP synthase, a GFPP synthase, a
HexPP synthase, a HepPP synthase, an OPP synthase, an SPP synthase,
a DPP synthase, an NPP synthase, and a UPP synthase.
Terpene Synthases
[0082] Terpene synthases catalyze the production of isoprenoid
compounds via one of the most complex reactions known in chemistry
or biology. In general, terpene synthases are moderately sized
enzymes having molecular weights of about 40 to 100 kD. As an
enzyme, terpene synthases can be classified as having low to
moderate turnover rates coupled with exquisite reaction specificity
and preservation of chirality. Turnover comprises binding of
substrate to the enzyme, establishment of substrate conformation,
conversion of substrate to product and product release. Reactions
can be performed in vitro in aqueous solvents, typically require
magnesium ions as cofactors, and the resulting products, which are
often highly hydrophobic, can be recovered by partitioning into an
organic solvent. U.S. Pat. No. 6,890,752.
[0083] In some embodiments, a subject genetically modified host
cell is further genetically modified with a nucleic acid comprising
a nucleotide sequence encoding a terpene synthase. In some
embodiments, a nucleic acid with which a host cell is genetically
modified comprises a nucleotide sequence encoding a terpene
synthase that differs in amino acid sequence by one or more amino
acids from a naturally-occurring terpene synthase or other parent
terpene synthase, e.g., a variant terpene synthase. A "parent
terpene synthase" is a terpene synthase that serves as a reference
point for comparison. Variant terpene synthases include consensus
terpene synthases and hybrid terpene synthases. In some
embodiments, the synthetic nucleic acid comprises a nucleotide
sequence encoding a consensus terpene synthase. In other
embodiments, the synthetic nucleic acid comprises a nucleotide
sequence encoding a hybrid terpene synthase.
[0084] A nucleic acid comprising a nucleotide sequence encoding any
known terpene synthase can be used. Suitable terpene synthases
include, but are not limited to, amorpha-4,11-diene synthase (ADS),
beta-caryophyllene synthase, germacrene A synthase, 8-epicedrol
synthase, valencene synthase, (+)-delta-cadinene synthase,
germacrene C synthase, (E)-beta-farnesene synthase, Casbene
synthase, vetispiradiene synthase, 5-epi-aristolochene synthase,
Aristolchene synthase, beta-caryophyllene, alpha-humulene,
(E,E)-alpha-farnesene synthase, (-)-beta-pinene synthase,
Gamma-terpinene synthase, limonene cyclase, Linalool
synthase,1,8-cineole synthase, (+)-sabinene synthase,
E-alpha-bisabolene synthase, (+)-bornyl diphosphate synthase,
levopimaradiene synthase, Abietadiene synthase, isopimaradiene
synthase, (E)-gamma-bisabolene synthase, taxadiene synthase,
copalyl pyrophosphate synthase, kaurene synthase, longifolene
synthase, gamma-humulene synthase, Delta-selinene synthase,
beta-phellandrene synthase, limonene synthase, myrcene synthase,
terpinolene synthase, (-)-camphene synthase, (+)-3-carene synthase,
syn-copalyl diphosphate synthase, alpha-terpineol synthase,
syn-pimara-7,15-diene synthase, ent-sandaaracopimaradiene synthase,
sterner-13-ene synthase, E-beta-ocimene, S-linalool synthase,
geraniol synthase, gamma-terpinene synthase, linalool synthase,
E-beta-ocimene synthase, epi-cedrol synthase, alpha-zingiberene
synthase, guaiadiene synthase, cascarilladiene synthase,
cis-muuroladiene synthase, aphidicolan-16b-ol synthase,
elizabethatriene synthase, sandalol synthase, patchoulol synthase,
Zinzanol synthase, cedrol synthase, scareol synthase, copalol
synthase, manool synthase, and the like.
[0085] Nucleotide sequences encoding terpene synthases are known in
the art, and any known terpene synthase-encoding nucleotide
sequence can used to genetically modify a host cell. For example,
the following terpene synthase-encoding nucleotide sequences,
followed by their GenBank accession numbers and the organisms in
which they were identified, are known and can be used:
(-)-germacrene D synthase mRNA (AY438099; Populus balsamifera
subsp. trichocarpa x Populus deltoids); E,E-alpha-farnesene
synthase mRNA (AY640154; Cucumis sativus); 1,8-cineole synthase
mRNA (AY691947; Arabidopsis thaliana); terpene synthase 5 (TPS5)
mRNA (AY518314; Zea mays); terpene synthase 4 (TPS4) mRNA
(AY518312; Zea mays); myrcene/ocimene synthase (TPS10) (At2g24210)
mRNA (NM_127982; Arabidopsis thaliana); geraniol synthase (GES)
mRNA (AY362553; Ocimum basilicum); pinene synthase mRNA (AY237645;
Picea sitchensis); myrcene synthase 1e20 mRNA (AY195609;
Antirrhinum majus); (E)-.beta.-ocimene synthase (0e23) mRNA
(AY195607; Antirrhinum majus); E-.beta.-ocimene synthase mRNA
(AY151086; Antirrhinum majus); terpene synthase mRNA (AF497492;
Arabidopsis thaliana); (-)-camphene synthase (AG6.5) mRNA (U87910;
Abies grandis); (-)-4S-limonene synthase gene (e.g., genomic
sequence) (AF326518; Abies grandis); delta-selinene synthase gene
(AF326513; Abies grandis); amorpha-4,11-diene synthase mRNA
(AJ251751; Artemisia annua); E-a-bisabolene synthase mRNA
(AF006195; Abies grandis); gamma-humulene synthase mRNA (U92267;
Abies grandis); 8-selinene synthase mRNA (U92266; Abies grandis);
pinene synthase (AG3.18) mRNA (U87909; Abies grandis); myrcene
synthase (AG2.2) mRNA (U87908; Abies grandis); etc.
[0086] Amino acid sequences of the following terpene synthases are
found under the GenBank Accession numbers shown in parentheses,
along with the organism in which each was identified, following
each terpene synthase: (-)-germacrene D synthase (AAR99061; Populus
balsamifera subsp. trichocarpa x Populus deltoids); D-cadinene
synthase (P93665; Gossypium hirsutum); 5-epi-aristolochene synthase
(Q40577; Nicotiana tabacum); E,E-alpha-farnesene synthase
(AAU05951; Cucumis sativus); 1,8-cineole synthase (AAU01970;
Arabidopsis thaliana); (R)-limonene synthase 1 (Q8L5K3; Citrus
limon); syn-copalyl diphosphate synthase (AAS98158; Oryza sativa);
a taxadiene synthase (Q9FT37; Taxus chinensis; Q93YA3; Taxus bacca;
Q41594; Taxus brevifolia); a D-cadinene synthase (Q43714; Gossypium
arboretum); terpene synthase 5 (AAS88575; Zea mays); terpene
synthase 4 (AAS88573; Zea mays); terpenoid synthase (AAS79352;
Vitis vinifera); geraniol synthase (AAR11765; Ocimum basilicum);
myrcene synthase 1e20 (AA041727; Antirrhinum majus);
5-epi-aristolochene synthase 37 (AAP05762; Nicotiana attenuata);
(+)-3-carene synthase (AA073863; Picea abies); (-)-camphene
synthase (AAB70707; Abies grandis); abietadiene synthase (AAK83563;
Abies grandis); amorpha-4,11-diene synthase (CAB94691; Artemisia
annua); trichodiene synthase (AAC49957; Myrothecium roridum);
gamma-humulene synthase (AAC05728; Abies grandis); .delta.-selinene
synthase (AAC05727; Abies grandis); etc.
Nucleic Acids, Vectors, Promoters
[0087] To generate a genetically modified host cell, one or more
nucleic acids comprising nucleotide sequences encoding one or more
gene products is introduced stably or transiently into a host cell,
using established techniques, including, but not limited to,
electroporation, calcium phosphate precipitation, DEAE-dextran
mediated transfection, liposome-mediated transfection, heat shock
in the presence of lithium acetate, and the like. For stable
transformation, a nucleic acid will generally further include a
selectable marker, e.g., any of several well-known selectable
markers such as neomycin resistance, ampicillin resistance,
tetracycline resistance, chloramphenicol resistance, kanamycin
resistance, and the like.
[0088] In many embodiments, the nucleic acid with which the host
cell is genetically modified is an expression vector that includes
a nucleic acid comprising a nucleotide sequence that encodes a gene
product, e.g., a mevalonate pathway enzyme, a transcription factor,
a prenyltransferase, a terpene synthase, etc. Suitable expression
vectors include, but are not limited to, baculovirus vectors,
bacteriophage vectors, plasmids, phagemids, cosmids, fosmids,
bacterial artificial chromosomes, viral vectors (e.g. viral vectors
based on vaccinia virus, poliovirus, adenovirus, adeno-associated
virus, SV40, herpes simplex virus, and the like), P1-based
artificial chromosomes, yeast plasmids, yeast artificial
chromosomes, and any other vectors specific for specific hosts of
interest (such as yeast). Thus, for example, a nucleic acid
encoding a gene product(s) is included in any one of a variety of
expression vectors for expressing the gene product(s). Such vectors
include chromosomal, nonchromosomal and synthetic DNA
sequences.
[0089] Numerous suitable expression vectors are known to those of
skill in the art, and many are commercially available. The
following vectors are provided by way of example; for eukaryotic
host cells: pXT1, pSG5 (Stratagene), pSVK3, pBPV, pMSG, and
pSVLSV40 (Pharmacia). However, any other plasmid or other vector
may be used so long as it is compatible with the host cell.
[0090] The nucleotide sequence in the expression vector is operably
linked to an appropriate expression control sequence(s) (promoter)
to direct synthesis of the encoded gene product. Depending on the
host/vector system utilized, any of a number of suitable
transcription and translation control elements, including
constitutive and inducible promoters, transcription enhancer
elements, transcription terminators, etc. may be used in the
expression vector (see, e.g., Bitter et al. (1987) Methods in
Enzymology, 153:516-544).
[0091] Non-limiting examples of suitable eukaryotic promoters
(promoters that are functional in eukaryotic cells) include CMV
immediate early, HSV thymidine kinase, early and late SV40, LTRs
from retrovirus, and mouse metallothionein-I. Selection of the
appropriate vector and promoter is well within the level of
ordinary skill in the art. The expression vector may also contain a
ribosome binding site for translation initiation and a
transcription terminator. The expression vector may also include
appropriate sequences for amplifying expression.
[0092] In addition, the expression vectors will in many embodiments
contain one or more selectable marker genes to provide a phenotypic
trait for selection of transformed host cells such as dihydrofolate
reductase or neomycin resistance for eukaryotic cell culture.
[0093] Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the S. cerevisiae TRP1 gene,
etc.; and a promoter derived from a highly-expressed gene to direct
transcription of the gene product-encoding sequence. Such promoters
can be derived from operons encoding glycolytic enzymes such as
3-phosphoglycerate kinase (PGK), .alpha.-factor, acid phosphatase,
or heat shock proteins, among others.
[0094] In many embodiments, a genetically modified host cell is
genetically modified with a nucleic acid that includes a nucleotide
sequence encoding a gene product, where the nucleotide sequence
encoding the gene product is operably linked to an inducible
promoter. Inducible promoters are well known in the art. Suitable
inducible promoters include, but are not limited to, the pL of
bacteriophage .lamda.; Plac; Ptrp; Ptac (Ptrp-lac hybrid promoter);
an isopropyl-beta-D-thiogalactopyranoside (IPTG)-inducible
promoter, e.g., a lacZ promoter; a tetracycline-inducible promoter;
an arabinose inducible promoter, e.g., PBAD (see, e.g., Guzman et
al. (1995) J. Bacteriol. 177:4121-4130); a xylose-inducible
promoter, e.g., Pxyl (see, e.g., Kim et al. (1996) Gene 181:71-76);
a GAL1 promoter; a tryptophan promoter; a lac promoter; an
alcohol-inducible promoter, e.g., a methanol-inducible promoter, an
ethanol-inducible promoter; a raffinose-inducible promoter; a
heat-inducible promoter, e.g., heat inducible lambda PL promoter, a
promoter controlled by a heat-sensitive repressor (e.g.,
0857-repressed lambda-based expression vectors; see, e.g., Hoffmann
et al. (1999) FEMS Microbiol Lett. 177(2):327-34); and the
like.
[0095] In many embodiments, a genetically modified host cell is
genetically modified with a nucleic acid that includes a nucleotide
sequence encoding a gene product, where the nucleotide sequence
encoding the gene product is operably linked to a constitutive
promoter. In yeast, a number of vectors containing constitutive or
inducible promoters may be used. For a review see, Current
Protocols in Molecular Biology, Vol. 2, 1988, Ed. Ausubel, et al.,
Greene Publish. Assoc. & Wiley Interscience, Ch. 13; Grant, et
al., 1987, Expression and Secretion Vectors for Yeast, in Methods
in Enzymology, Eds. Wu & Grossman, 31987, Acad. Press, N.Y.,
Vol. 153, pp. 516-544; Glover, 1986, DNA Cloning, Vol. II, IRL
Press, Wash., D.C., Ch. 3; Bitter, 1987, Heterologous Gene
Expression in Yeast, Methods in Enzymology, Eds. Berger &
Kimmel, Acad. Press, N.Y., Vol. 152, pp. 673-684; and The Molecular
Biology of the Yeast Saccharomyces, 1982, Eds. Strathern et al.,
Cold Spring Harbor Press, Vols. I and II. A constitutive yeast
promoter such as ADH or LEU2 or an inducible promoter such as GAL
may be used (Cloning in Yeast, Ch. 3, R. Rothstein in: DNA Cloning
Vol. 11, A Practical Approach, Ed. DM Glover, 1986, IRL Press,
Wash., D.C.). Alternatively, vectors may be used which promote
integration of foreign DNA sequences into the yeast chromosome.
Compositions Comprising a Subject Genetically Modified Eukaryotic
Host Cell
[0096] The present invention further provides compositions
comprising a subject genetically modified eukaryotic host cell. A
subject composition comprises a subject genetically modified
eukaryotic host cell, and will in some embodiments comprise one or
more further components, which components are selected based in
part on the intended use of the genetically modified eukaryotic
host cell. Suitable components include, but are not limited to,
salts; buffers; stabilizers; protease-inhibiting agents; cell
membrane- and/or cell wall-preserving compounds, e.g., glycerol,
dimethylsulfoxide, etc.; nutritional media appropriate to the cell;
and the like.
Methods for Producing Isoprenoid Compounds
[0097] The present invention provides methods of producing an
isoprenoid or an isoprenoid precursor compound. The methods
generally involve culturing a subject genetically modified host
cell in a suitable medium.
[0098] Isoprenoid precursor compounds that can be produced using a
subject method include any isoprenyl diphosphate compound.
Isoprenoid compounds that can be produced using the method of the
invention include, but are not limited to, monoterpenes, including
but not limited to, limonene, citranellol, geraniol, menthol,
perillyl alcohol, linalool, thujone; sesquiterpenes, including but
not limited to, periplanone B, gingkolide B, amorphadiene,
artemisinin, artemisinic acid, valencene, nootkatone, epi-cedrol,
epi-aristolochene, farnesol, gossypol, sanonin, periplanone, and
forskolin; diterpenes, including but not limited to, casbene,
eleutherobin, paclitaxel, prostratin, and pseudopterosin; and
triterpenes, including but not limited to, arbrusideE, bruceantin,
testosterone, progesterone, cortisone, digitoxin. Isoprenoids also
include, but are not limited to, carotenoids such as lycopene,
.alpha.- and .beta.-carotene, .alpha.- and .beta.-cryptoxanthin,
bixin, zeaxanthin, astaxanthin, and lutein. Isoprenoids also
include, but are not limited to, triterpenes, steroid compounds,
and compounds that are composed of isoprenoids modified by other
chemical groups, such as mixed terpene-alkaloids, and coenzyme
Q-10.
[0099] In some embodiments, a subject method further comprises
isolating the isoprenoid compound from the cell and/or from the
culture medium.
[0100] In general, a subject genetically modified host cell is
cultured in a suitable medium (e.g., Luria-Bertoni broth,
optionally supplemented with one or more additional agents, such as
an inducer (e.g., where one or more nucleotide sequences encoding a
gene product is under the control of an inducible promoter), etc.).
In some embodiments, a subject genetically modified host cell is
cultured in a suitable medium; and the culture medium is overlaid
with an organic solvent, e.g., dodecane, forming an organic layer.
The isoprenoid compound produced by the genetically modified host
cell partitions into the organic layer, from which it can be
purified. In some embodiments, where one or more gene
product-encoding nucleotide sequence is operably linked to an
inducible promoter, an inducer is added to the culture medium; and,
after a suitable time, the isoprenoid compound is isolated from the
organic layer overlaid on the culture medium.
[0101] In some embodiments, the isoprenoid compound will be
separated from other products which may be present in the organic
layer. Separation of the isoprenoid compound from other products
that may be present in the organic layer is readily achieved using,
e.g., standard chromatographic techniques.
[0102] In some embodiments, the isoprenoid compound is pure, e.g.,
at least about 40% pure, at least about 50% pure, at least about
60% pure, at least about 70% pure, at least about 80% pure, at
least about 90% pure, at least about 95% pure, at least about 98%
pure, or more than 98% pure, where "pure" in the context of an
isoprenoid compound refers to an isoprenoid compound that is free
from other isoprenoid compounds, contaminants, etc.
EXAMPLES
[0103] The following examples are put forth so as to provide those
of ordinary skill in the art with a complete disclosure and
description of how to make and use the present invention, and are
not intended to limit the scope of what the inventors regard as
their invention, nor are they intended to represent that the
experiments below are all or the only experiments performed.
Efforts have been made to ensure accuracy with respect to numbers
used (e.g., amounts, temperature, etc.) but some experimental
errors and deviations should be accounted for. Unless indicated
otherwise, parts are parts by weight, molecular weight is weight
average molecular weight, temperature is in degrees Celsius, and
pressure is at or near atmospheric. Standard abbreviations may be
used, e.g., bp, base pair(s); kb, kilobase(s); pl, picoliter(s); s
or sec, second(s); min, minute(s); h or hr, hour(s); aa, amino
acid(s); kb, kilobase(s); bp, base pair(s); nt, nucleotide(s);
i.m., intramuscular(ly); i.p., intraperitoneal(ly); s.c.,
subcutaneous(ly); and the like.
Example 1: Producing High Levels of an Isoprenoid Compound in a
Genetically Modified Yeast Cell
Materials and Methods
[0104] Chemicals.
[0105] Dodecane and caryophyllene were purchased from Sigma-Aldrich
(St. Louis, Mo.). 5-fluoortic acid (5-FOA) was purchased from Zymo
Research (Orange, Calif.). Complete Supplement Mixtures for
formulation of Synthetic Defined media were purchased from Qbiogene
(Irvine, Calif.). All other media components were purchased from
either Sigma-Aldrich or Becton, Dickinson (Franklin Lakes,
N.J.).
[0106] Strains and Media.
[0107] Escherichia coli strains DH10B and DH5a were used for
bacterial transformation and plasmid amplification in the
construction of the expression plasmids used in this study. The
strains were cultivated at 37.degree. C. in Luria-Bertani medium
with 100 mg liter.sup.-1 ampicillin with the exception of
p.delta.-UB based plasmids which were cultivated with 50 mg
liter.sup.-1 ampicillin.
[0108] Saccharomyces cerevisiae strain BY4742 (Baker Brachmann et
al. (1998) Yeast 14(2):115-132), a derivative of 5288C, was used as
the parent strain for all yeast strains. This strain was grown in
rich YPD medium. Burke et al. Methods in yeast genetics: a Cold
Spring Harbor laboratory course manual. 2000, Plainview, N.Y.: Cold
Spring Harbor Laboratory Press. Engineered yeast strains were grown
in Synthetic Defined medium (SD) (Burke et al. (2000) supra) with
leucine, uracil, histidine, and/or methionine dropped out where
appropriate. For induction of genes expressed from the GAL1
promoter, S. cerevisiae strains were grown in 2% galactose as the
sole carbon source.
[0109] Plasmid Construction.
[0110] To create plasmid pRS425ADS for expression of ADS with the
GAL1 promoter, ADS was amplified by polymerase chain reaction (PCR)
from pADS (Martin et al. (2003) Nat. Biotechnol. 21(7): p. 796-802)
using primer pair ADS-SpeI-F/ADS-HindIII-R (Table 1). Using these
primers, the nucleotide sequence 5'-AAAACA-3' was cloned
immediately upstream of the start codon of ADS. This consensus
sequence was used for efficient translation (Looman et al. (1993)
Nucleic Acids Research. 21(18):4268-71; Yun et al. (1996) Molecular
Microbiol. 19(6):1225-39) of ADS and the other galactose-inducible
genes used in this study. The amplified product was cleaved with
Spa and HindIII and cloned into SpeI and HindIII digested
pRS425GAL1 (Mumberg et al. (1995) Gene 156(1):119-122).
TABLE-US-00001 TABLE 1 Primer Sequence (5' to 3') ADS-SpeI-F
GGACTAGTAAAACAATGGCCCTGACCGAAGAG (SEQ ID NO: 3) ADS-HindIII-R
CCAAGCTTTCAGATGGACATCGGGTAAAC (SEQ ID NO: 4) HMGR-BamHI-F
CGGGATCCAAAACAATGGCTGCAGACCAATTGGTG (SEQ ID NO: 5) HMGR-SalI-R
GCGTCGACTTAGGATTTAATGCAGGTGACG (SEQ ID NO: 6) pRS42X-
CTGCCGCGGGGCCGCAAATTAAAGCCTTC PvuIISacII-F (SEQ ID NO: 7) pRS42X-
CTGCCGCGGTAGTACGGATTAGAAGCCGC PvuIISacII-R (SEQ ID NO: 8)
UPC2-BamHI-F CGGGATCCAAAACAATGAGCGAAGTCGGTATACAG (SEQ ID NO: 9)
UPC2-SalI-R GCGTCGACTCATAACGAAAAATCAGAGAAATTTG (SEQ ID NO: 10)
ECM22-BamHI-R CGGGATCCAAAACAATGACATCCGATGATGGGAATG (SEQ ID NO: 11)
ECM22-SalI-R GCGTCGACTTACATAAAAGCTGAAAAGTTTGTAG (SEQ ID NO: 12)
Restriction sites are underlined and bold indicates a start or stop
codon.
[0111] For expression of tHMGR, plasmid pRS-HMGR was constructed.
First SacII restriction sites were introduced into pRS426GAL1
(Mumberg et al. (1995) Gene 156(1):119-122) at the 5' end of the
GAL1 promoter and 3' end of the CYC1 terminator. The
promoter-multiple cloning site-terminator cassette of pRS426GAL1
was PCR amplified using primer pair
pRS42X-PvuIISacII-F/pRS42X-PvuIISacII-R (Table 1). The amplified
product was cloned directly into PvuII digested pRS426GAL1 to
construct vector pRS426-SacII. The catalytic domain of HMG1 was PCR
amplified from plasmid pRH127-3 (Donald et al. (1997) Appl.
Environ. Microbiol. 63(9):3341-44) with primer pair
HMGR-BamHI-F/HMGR-SalI-R. The amplified product was cleaved with
BamHI and SalI and cloned into BamHI and XhoI digested
pRS426-SacII.
[0112] The upc2-1 allele of UPC2 was PCR amplified from plasmid
pBD33 using primer pair UPC2-BamHI-F/UPC2-SalI-R. The amplified
product was cleaved with BamHI and SalI and cloned into BamHI and
XhoI digested pRS426-SacII to create plasmid pRS-UPC2. Likewise the
ECM22 gene containing the upc2-1 like mutation (glycine to
aspartate at residue 790) was PCR amplified from plasmid pBD36
using primer pair ECM22-BamHI-F/UPC2-SalI-R. The amplified product
was cleaved with BamHI and SalI and cloned into BamHI and XhoI
digested pRS426-SacII to create plasmid pRS-ECM22.
[0113] A plasmid was constructed for the integration of the tHMGR
expression cassette of pRS-HMGR into the yeast genome utilizing
plasmid p.delta.-UB (Lee et al. (1997) Biotechnol Prog.
13(4):368-373). pRS-HMGR was cleaved with SacII and the expression
cassette fragment was gel extracted and cloned into SacII digested
p.delta.-UB. For the integration of upc2-1, p.delta.-UPC2 was
created in an identical manner by digesting pRS-UPC2 with SacII and
moving the appropriate fragment to p.delta.-UB.
[0114] To replace the ERG9 promoter with the MET3 promoter, plasmid
pRS-ERG9 was constructed. Plasmid pRH973 (Gardner et al. (1999) J.
Biol. Chem. 274(44):31671-31678) contained a truncated 5' segment
of ERG9 placed behind the MET3 promoter. pRH973 was cleaved with
ApaI and ClaI and cloned into ApaI and ClaI digested pRS403
(Sikorski et al. (1989) Genetics, 122(1):19-27).
[0115] For expression of ERG20, plasmid pRS-ERG20 was constructed.
Plasmid pRS-SacII was first digested with SalI and XhoI which
created compatible cohesive ends. The plasmid was then
self-ligated, eliminating SalI and XhoI sites to create plasmid
pRS-SacII-DX. ERG20 was PCR amplified from the genomic DNA of
BY4742 using primer pair ERG20-SpeI-F/ERG20-SmaI-R. The amplified
product was cleaved with SpeI and SmaI and cloned into SpeI and
SmaI digested pRS-SacII-DX. For the integration of the ERG20
expression cassette, pRS-ERG20 was cleaved with SacII and the
expression cassette fragment was gel extracted and cloned into
SacII digested p.delta.-UB.
[0116] A description of plasmids used in this study is provided in
Table 2.
TABLE-US-00002 TABLE 2 Name Gene expressed Plasmid status Marker
pRS425ADS ADS 2-micron replicon LEU2 pRS-HMGR tHMGR 2-micron
replicon URA3 pRS-UPC2 upc2-1 2-micron replicon URA3 pRS-ECM22
ECM22 (upc2-1 mutant) 2-micron replicon URA3 p.delta.-HMGR tHMGR
Integration URA3 p.delta.-UPC2 upc2-1 Integration URA3 pRS-ERG9
P.sub.MET3-ERG9 Integration HIS3 p.delta.-ERG20 ERG20 Integration
URA3
[0117] A list of yeast strains used in this study, and the relevant
genotypes of the strains, is provided in Table 3.
TABLE-US-00003 TABLE 3 BY4742 MAT.alpha. his3.DELTA.1 leu2.DELTA.0
lys2.DELTA.0 ur.alpha.3.DELTA.0 EPY201 BY4742 pRS425ADS EPY203
BY4742 pRS425ADS pRS-HMGR EPY204 BY4742 pRS425ADS pRS-UPC2 EPY205
BY4742 pRS425ADS pRS-ECM22 EPY206 BY4742 pRS425ADS pRS-ERG20 EPY207
BY4742 pRS425ADS tHMGR (ura+) EPY209 BY4742 pRS425ADS tHMGR upc2-1
(ura+) EPY212 BY4742 pRS425ADS tHMGR upc2-1 erg9::PMET3-ERG9 (ura+)
EPY214 BY4742 pRS425ADS tHMGR upc2-1 erg9::PMET3-ERG9 ERG20
(ura+)
[0118] Yeast Transformation and Strain Construction.
[0119] S. cerevisiae strain BY4742 (Carrie Baker Brachmann et al.
(1998) "Yeast" 14(2):115-132), a derivative of S288C was used as
the parent strain for all S. cerevisiae strains. Transformation of
all strains of S. cerevisiae was performed by the standard lithium
acetate method (Gietz et al. (2002) Guide to Yeast Genetics and
Molecular and Cell Biology, Pt B., Academic Press Inc: San Diego.
87-96). Three to ten colonies from each transformation were
screened for the selection of the highest amorphadiene producing
transformant. Strain EPY201 was constructed by the transformation
of strain BY4742 with plasmid pRS425ADS and selection on SD-LEU
plates. Strains EPY203, EPY204, EPY205, and EPY206 were constructed
by the transformation of strain EPY201 with plasmid pRS-HMGR,
pRS-UPC2, pRS-ECM22, and pRS-ERG20, respectively. Transformants
were selected on SD-LEU-URA plates. Plasmid p.delta.-HMGR was
digested with XhoI before transformation of the DNA into strain
EPY201 for the construction of EPY207. Strain EPY207 was cultured
and plated on SD-LEU plates including 1 g/L 5-FOA selection of the
loss of the URA3 marker. The resulting uracil auxotroph was then
transformed with XhoI digested p.delta.-UPC2 plasmid DNA for the
construction of EPY209, which was selected on SD-LEU-URA plates.
Plasmid pRS-ERG9 was cleaved with HindII for the integration of the
P.sub.MET3-ERG9 fusion at the ERG9 loci of EPY209 for the
construction of EPY212. This strain was selected for on
SD-LEU-URA-HIS-MET plates. EPY212 was cultured and plated on
SD-LEU-HIS-MET plates containing 5-FOA for selection of the loss of
the URA3 marker. The resulting uracil auxotroph was then
transformed with XhoI digested p.delta.-ERG20 plasmid DNA for the
construction of EPY214, which was selected on SD-LEU-URA-HIS-MET
plates.
[0120] Yeast Cultivation.
[0121] For time course experiments for the measurement of
amorphadiene production, culture tubes containing 5 mL of SD (2%
galactose) media (with appropriate amino acid omissions as
described above) were inoculated with the strains of interest.
These innocula were grown at 30.degree. C. to an optical density at
600 nm (OD.sub.600) of approximately 1. 250 mL baffled flasks
containing 50 mL SD media were inoculated to an OD.sub.600 0.05
with these seed cultures. FIG. 4. represents strains grown in
SD-URA-LEU-HIS with methionine at the level indicated. Media for
strains shown in FIG. 5 contained SD-URA supplemented with
methionine to a final concentration of 1 mM. All other production
experiments used SD-URA or SD-URA-LEU where appropriate.
[0122] All flasks also contained 5 mL dodecane. This dodecane layer
was sampled and diluted in ethyl acetate for determination of
amorphadiene production by GC-MS.
[0123] GC-MS Analysis of Amorphadiene.
[0124] Amorphadiene production by the various strains was measured
by GC-MS as previously described (Martin et al. (2001)
Biotechnology and Bioengineering, 75(5):497-503) by scanning only
for two ions, the molecular ion (204 m/z) and the 189 m/z ion.
Amorphadiene concentrations were converted to caryophyllene
equivalents using a caryophyllene standard curve and the relative
abundance of ions 189 and 204 m/z to their total ions.
Results
[0125] To maximize production of amorphadiene, a step-wise approach
was taken with the successive integration of constructs into the S.
cerevisiae genome.
[0126] Production of Amorphadiene.
[0127] A platform host cell, S. cerevisiae, was engineered for
high-level production of isoprenoids. S. cerevisiae directs all of
its isoprenoid production through isopentenyl diphosphate (IPP),
and most of this then through farnesyl diphosphate (FPP). The
levels of IPP and FPP were increased in the host strain. IPP and
FPP are metabolized to a variety of native products. Instead of
measuring FPP levels, the level of amorphadiene, a direct product
of FPP that will not be metabolized or degraded during the time
course of growth, was measured. Amorphadiene synthase (ADS) was
expressed in S. cerevisiae for the enzymatic cyclization of FPP to
the sesquiterpene amorphadiene. Amorphadiene is also readily
quantified by GCMS.
[0128] ADS was expressed on the 2-micron plasmid pRS425ADS under
the inducible control of the GAL1 promoter. Cultures of S.
cerevisiae were grown for six days on galactose for expression of
ADS, and amorphadiene levels were measured every 24 hours. S.
cerevisiae modified solely by the introduction of pRS425ADS reached
a maximum amorphadiene production of 4.6 .mu.g amorphadiene
mL.sup.-1 after four days (FIG. 3A).
[0129] Previous control experiments consisting of media spiked with
pure amorphadiene showed the rapid loss of the sesquiterpene from
the liquid phase. A layer of dodecane equivalent to 10% of the
medium volume was added to each shaker flask to sequester the
amorphadiene from the culture. The addition of this organic layer
ensures accurate measurement of the total amount of amorphadiene
produced by preventing loss to the air. The volatilization of
amorphadiene is a particular problem during extended time courses
of several days like those used in this study.
[0130] Overexpression of HMG-CoA Reductase.
[0131] The medical importance of the biosynthesis of cholesterol
and the experimental ease of analysis in S. cerevisiae has made it
an ideal organism for study of the regulation of the mevalonate
pathway over the past decades (Szkopinska et al. (2000) Biochemical
and Biophysical Research Communications, 267(1):473-477;
Dimster-Denk et al. (1999) J. Lipid Res., 40(5):850-860).
[0132] These studies have elucidated a complex system of
regulation, with 3-hydroxy-3-methylglutaryl-coenzyme A reductase
(HMGR) as the major regulatory control point of the pathway. Two
isozymes of HMGR, Hmg1p and Hmg1p, are present in yeast, with Hmg1p
being the more stable of the two (Hampton et al. (1996) Trends in
Biochemical Sciences, 21(4):140-145). Hmg1p is an integral membrane
bound protein containing an N-terminal region responsible for
anchoring the protein to the ER membrane (Liscum et al. (1985) J.
Biol. Chem. 260(1):522-530). For expression of a soluble form of
the enzyme (Donald et al. (1997) Appl. Environ. Microbiol.
63(9):3341-44) removed the membrane-bound N-terminus of Hmg1p and
expressed only the catalytic domain. In our study, this truncated
form of HMGR (tHMGR) on a 2-micron plasmid was expressed under the
control of the GAL1 promoter. When expressed in conjunction with
ADS, S. cerevisiae reached a maximal production of 11.2 .mu.g
amorphadiene mL.sup.-1 after four days (FIG. 3A).
[0133] Overexpression of Sterol-Involved Transcription Factors.
[0134] In another approach to increase amorphadiene, two S.
cerevisiae transcription factors previously identified for their
importance in regulation of sterol biosynthesis were used. upc2-1
S. cerevisiae mutants were originally identified by their unique
ability to uptake sterols under aerobic conditions (Lewis et al.
(1988) Yeast, 4(2):93-106). Further characterization showed that
these mutants had increased sterol synthesis capabilities (Lewis et
al. (1988) Yeast, 4(2):93-106). The mutation responsible for these
characteristics is a single guanine to adenine transition in the
UPC2 gene; this point mutation results in a residue change from
glycine to aspartate at amino acid 888 near the carboxy terminus
(Crowley et al. (1998) J. Bacteriol., 180(16):4177-83). A homolog
to this gene, ECM22, was later identified with 45% amino acid
sequence identity (Shianna et al. (2001) J. Bacteria,
183(3):830-834). 36 amino acids are completely conserved between
UPC2 and ECM22 at the locus of the upc2-1 point mutation (Shianna
et al. (2001) J. Bacteriol., 183(3):830-834). The upc2-1 point
mutation was introduced into the wild type ECM22 allele resulting
in a strain with a similar phenotype to that of the upc2-1 mutant
(Shianna et al. (2001) J. Bacteriol, 183(3):830-834).
[0135] Vik and Rine identified ERG2 and ERGS as targets for gene
regulation by Ecm22p and Upc2p. A 7 base pair sterol regulatory
element was identified as the necessary binding location for these
transcription factors. This 7 base pair sequence element is found
in the promoters of many other sterol pathway genes including ERGS,
ERG12, and ERG13 (Vik et al. (2001) Mol. Cell. Biol.,
21(19):6395-6405). The enzyme products for each of these three
genes are involved in isoprenoid synthesis upstream of FPP (see
FIG. 1).
[0136] It was hypothesized that coexpression of the mutant alleles
for UPC2 and ECM22 with ADS would increase amorphadiene production
by increasing metabolic flux through the mevalonate pathway. The
upc2-1 mutant alleles of UPC2 and ECM22 were each expressed under
the control of the GAL1 promoter on a 2-micron plasmid in a strain
already harboring pRS425ADS. Absolute amorphadiene production in
the cultures increased only minimally for UPC2 and ECM22
expression, in part due to decreased cell densities. However
production normalized for cell density rose 76% and 53% for the
expression of UPC2 and ECM22, respectively (FIG. 3B).
[0137] This relatively small increase in amorphadiene production
compared to overexpression of tHMGR supports the fact that HMGR
activity is the major limiting bottleneck of the mevalonate
pathway. Even high-level expression of ERG 8, ERG12, and ERG13 is
unlikely to greatly enhance flux through the pathway if HMGR
remains at basal expression level. The decreased cell densities
observed for the overexpression of UPC2 and ECM22 is unlikely due
to increased flux through the mevalonate pathway to FPP. It is
instead likely caused by an unfavorable change in transcriptional
regulation for one or multiple other genes controlled by UPC2 and
ECM22.
[0138] Coexpression of tHMGR and Upc2-1.
[0139] Overexpression of tHMGR and upc2-1 each increased the final
yield of amorphadiene in the cell cultures. To test the possibility
of a synergistic effect from the overexpression of these genes
together, the expression cassettes were integrated sequentially
into the S. cerevisiae genome. Plasmid p.delta.-UB (Lee et al.
(1997) Biotechnol Prog., 13(4):368-373) was used for the
construction of the integration plasmids. This plasmid contains a
reusable URA3 Blaster Cassette allowing for recycling of the URA3
marker. Additionally, it integrates at a .delta.-sequence (found in
the long terminal repeats of Ty-transposon sites), of which there
are approximately 425 dispersed through the genome (Dujon (1996)
Trends in Genetics, 12(7):263-270).
[0140] tHMGR was integrated into the chromosome of a strain
harboring pRS425ADS using p.delta.-HMGR. The amorphadiene
production level of 13.8 .mu.g amorphadiene mL.sup.-1 was
comparable in this strain to strain EP203 which contained tHMGR on
a high-copy plasmid (FIG. 5). After recycling the URA3 marker by
plating on 5-FOA, upc2-1 was integrating into the chromosome using
plasmid p.delta.-UPC2. The effects of overexpressing tHMGR and
upc2-1 combined to raise amorphadiene production to 16.2 .mu.g
amorphadiene mL.sup.-1 (FIG. 5). Although expression of upc2-1 in
combination with tHMGR raised absolute amorphadiene production by
17%, this increase is only comparable to that seen when upc2-1 is
expressed with ADS alone. With the removal of the HMGR bottleneck,
we expected a more significant impact from upc2-1 expression.
Potential increases in amorphadiene production might be prevented
due to the routing of FPP to other metabolites.
[0141] Down-Regulation of Squalene Synthase.
[0142] The increases seen in amorphadiene production suggested an
increased precursor pool of FPP. FPP is central to the synthesis of
a number of S. cerevisiae compounds including sterols, dolichols
and polyprenols, and prenylated proteins. Although increased flux
through the mevalonate pathway lead to higher amorphadiene
production, a number of other enzymes were also competing for the
increased pool of FPP, most importantly squalene synthase encoded
by ERG9. Squalene synthesis is the branch-point from FPP leading to
ergosterol. In a strain expressing the catalytic domain of HMGR and
containing an ERG9 deletion, FPP was seen to accumulate (Song
(2003) Analytical Biochemistry, 317(2):180-185). With the aim of
routing FPP away from the sterol production and toward amorphadiene
production, reduction in squalene synthase activity would be
useful. However, an ERG9 deletion is lethal without exogenous
supplementation of sterols.
[0143] Employing an alternate strategy, ERG9 was transcriptionally
down-regulated by replacing its native promoter with a methionine
repressible promoter, P.sub.MET3 (Cherest et al. (1985) Gene,
34(2-3):269-281). Gardner et al. previously utilized such a
P.sub.MET3-ERG9 fusion construct for the study of HMGR degradation
signals (Gardner et a (1999) J. Biol. Chem. 274(44):31671-31678;
Gardner et al. (2001) J. Biol. Chem., 276(12):8681-8694). Plasmid
pRS-ERG9 was constructed to utilize the same strategy as Gardner in
the replacement of the ERG9 native promoter with the MET3 promoter.
The utility of the P.sub.MET3-ERG9 fusion is underscored by the
tight regulatory control between 0 and 100 .mu.M extracellular
concentrations of methionine (Mao et al. (2002) Current
Microbiology, 45(1):37-40). In the presence of the high
extracellular concentrations of methionine, expression from the
MET3 promoter is very low. After integration of pRS-ERG9 at the
ERG9 locus, we could tune the squalene synthase expression based
upon methionine supplementation to the medium.
[0144] pRS-ERG9 was integrated into strain EPY209, and amorphadiene
production was measured with a range of 0 to 1 mM methionine in the
medium. Time points of 64 and 87 hours after inoculation are shown
(FIG. 4). The data suggests that minimal expression of ERG9
(methionine concentrations above 0.5 mM) maximize the production of
amorphadiene. As the S. cerevisiae cultures increase in cell
density and metabolize the nutrients in the medium, the methionine
concentration likely drops, explaining why cultures provided with
0.1 mM methionine in the medium have lower yields of amorphadiene.
1 mM methionine was selected for future experiments to ensure high
extracellular concentrations throughout the extended time
courses.
[0145] Strain EPY212 containing an integrated copy of tHMGR and
upc2-1 as well as methionine-repressible allele of ERG9 was grown
in culture and amorphadiene production was measured for six days
(FIG. 5). Limiting the FPP incorporated into squalene had a large
impact on amorphadiene production, increasing it four-fold to 61
.mu.g amorphadiene mL.sup.-1 over the strain EPY209 containing the
wild type ERG9 allele. Although limited in its ability to produce
ergosterol, EPY212 still grew to a final OD .about.75% of that of
EPY209.
[0146] Overexpression of FPP Synthase.
[0147] FPP Synthase (FPPS), encoded by ERG20, was targeted as the
next target for overexpression in hopes of increasing sesquiterpene
yields further. A six-fold increase in FPPS activity has been
correlated with an 80% and 32% increase in dolichol and ergosterol,
respectively (Szkopinska et al. (2000) Biochemical and Biophysical
Research Communications, 267(1):473-477). Similar to the studies
overexpressing HMGR and upc2-1, ERG20 was first cloned behind the
GAL1 promoter on a high copy plasmid to create pRS-ERG20.
Coexpression of ERG20 on this plasmid with pRS425ADS actually
lowered the absolute productivity of amorphadiene by 60%. It is
possible that an increase in FPPS activity increased only the
content of other FPP derived products such as ergosterol. Another
possibility is that overexpression of FPPS increased the
intracellular concentration of FPP--the main signal for HMGR
degradation (Gardner et al. (1999) J Biol. Chem.
274(44):31671-31678). Without the overexpression of a deregulated
form of the reductase, increased FPP concentrations could act to
limit flux through the mevalonate pathway and decrease amorphadiene
production.
[0148] p.delta.-ERG20 was then constructed for the integration and
expression of ERG20 in our highest amorphadiene producer. The URA3
marker was recycled, and p.delta.-ERG20 integrated in the
chromosome to create strain EPY212. This strain overexpressing
FPPS, further increased the production of amorphadiene to 73 .mu.g
amorphadiene mL.sup.-1 (FIG. 5). Earlier we had seen a 60% decrease
in amorphadiene production in strain EPY206 overexpressing ERG20
with ADS. However, now in a strain expressing tHMGR and upc2-1 and
with a regulated squalene synthase, amorphadiene production
increased 20% with the overexpression of ERG20.
[0149] In strains EPY206 and EPY212 each expressing ERG20, a
decrease in cell density was observed. This decrease in cell growth
might be explained by a toxicity caused directly by ERG20p.
Alternatively an effect could arise from an accumulation or
depletion of a pathway intermediate due to modified flux through
the FPP synthase.
[0150] While the present invention has been described with
reference to the specific embodiments thereof, it should be
understood by those skilled in the art that various changes may be
made and equivalents may be substituted without departing from the
true spirit and scope of the invention. In addition, many
modifications may be made to adapt a particular situation,
material, composition of matter, process, process step or steps, to
the objective, spirit and scope of the present invention. All such
modifications are intended to be within the scope of the claims
appended hereto.
Sequence CWU 1
1
1211509DNASaccharomyces cerevisiaeCDS(1)...(1509) 1atg gtt tta acc
aat aaa aca gtc att tct gga tcg aaa gtc aaa agt 48Met Val Leu Thr
Asn Lys Thr Val Ile Ser Gly Ser Lys Val Lys Ser 1 5 10 15tta tca
tct gcg caa tcg agc tca tca gga cct tca tca tct agt gag 96Leu Ser
Ser Ala Gln Ser Ser Ser Ser Gly Pro Ser Ser Ser Ser Glu 20 25 30gaa
gat gat tcc cgc gat att gaa agc ttg gat aag aaa ata cgt cct 144Glu
Asp Asp Ser Arg Asp Ile Glu Ser Leu Asp Lys Lys Ile Arg Pro 35 40
45tta gaa gaa tta gaa gca tta tta agt agt gga aat aca aaa caa ttg
192Leu Glu Glu Leu Glu Ala Leu Leu Ser Ser Gly Asn Thr Lys Gln Leu
50 55 60aag aac aaa gag gtc gct gcc ttg gtt att cac ggt aag tta cct
ttg 240Lys Asn Lys Glu Val Ala Ala Leu Val Ile His Gly Lys Leu Pro
Leu 65 70 75 80tac gct ttg gag aaa aaa tta ggt gat act acg aga gcg
gtt gcg gta 288Tyr Ala Leu Glu Lys Lys Leu Gly Asp Thr Thr Arg Ala
Val Ala Val 85 90 95cgt agg aag gct ctt tca att ttg gca gaa gct cct
gta tta gca tct 336Arg Arg Lys Ala Leu Ser Ile Leu Ala Glu Ala Pro
Val Leu Ala Ser 100 105 110gat cgt tta cca tat aaa aat tat gac tac
gac cgc gta ttt ggc gct 384Asp Arg Leu Pro Tyr Lys Asn Tyr Asp Tyr
Asp Arg Val Phe Gly Ala 115 120 125tgt tgt gaa aat gtt ata ggt tac
atg cct ttg ccc gtt ggt gtt ata 432Cys Cys Glu Asn Val Ile Gly Tyr
Met Pro Leu Pro Val Gly Val Ile 130 135 140ggc ccc ttg gtt atc gat
ggt aca tct tat cat ata cca atg gca act 480Gly Pro Leu Val Ile Asp
Gly Thr Ser Tyr His Ile Pro Met Ala Thr145 150 155 160aca gag ggt
tgt ttg gta gct tct gcc atg cgt ggc tgt aag gca atc 528Thr Glu Gly
Cys Leu Val Ala Ser Ala Met Arg Gly Cys Lys Ala Ile 165 170 175aat
gct ggc ggt ggt gca aca act gtt tta act aag gat ggt atg aca 576Asn
Ala Gly Gly Gly Ala Thr Thr Val Leu Thr Lys Asp Gly Met Thr 180 185
190aga ggc cca gta gtc cgt ttc cca act ttg aaa aga tct ggt gcc tgt
624Arg Gly Pro Val Val Arg Phe Pro Thr Leu Lys Arg Ser Gly Ala Cys
195 200 205aag ata tgg tta gac tca gaa gag gga caa aac gca att aaa
aaa gct 672Lys Ile Trp Leu Asp Ser Glu Glu Gly Gln Asn Ala Ile Lys
Lys Ala 210 215 220ttt aac tct aca tca aga ttt gca cgt ctg caa cat
att caa act tgt 720Phe Asn Ser Thr Ser Arg Phe Ala Arg Leu Gln His
Ile Gln Thr Cys225 230 235 240cta gca gga gat tta ctc ttc atg aga
ttt aga aca act act ggt gac 768Leu Ala Gly Asp Leu Leu Phe Met Arg
Phe Arg Thr Thr Thr Gly Asp 245 250 255gca atg ggt atg aat atg att
tct aaa ggt gtc gaa tac tca tta aag 816Ala Met Gly Met Asn Met Ile
Ser Lys Gly Val Glu Tyr Ser Leu Lys 260 265 270caa atg gta gaa gag
tat ggc tgg gaa gat atg gag gtt gtc tcc gtt 864Gln Met Val Glu Glu
Tyr Gly Trp Glu Asp Met Glu Val Val Ser Val 275 280 285tct ggt aac
tac tgt acc gac aaa aaa cca gct gcc atc aac tgg atc 912Ser Gly Asn
Tyr Cys Thr Asp Lys Lys Pro Ala Ala Ile Asn Trp Ile 290 295 300gaa
ggt cgt ggt aag agt gtc gtc gca gaa gct act att cct ggt gat 960Glu
Gly Arg Gly Lys Ser Val Val Ala Glu Ala Thr Ile Pro Gly Asp305 310
315 320gtt gtc aga aaa gtg tta aaa agt gat gtt tcc gca ttg gtt gag
ttg 1008Val Val Arg Lys Val Leu Lys Ser Asp Val Ser Ala Leu Val Glu
Leu 325 330 335aac att gct aag aat ttg gtt gga tct gca atg gct ggg
tct gtt ggt 1056Asn Ile Ala Lys Asn Leu Val Gly Ser Ala Met Ala Gly
Ser Val Gly 340 345 350gga ttt aac gca cat gca gct aat tta gtg aca
gct gtt ttc ttg gca 1104Gly Phe Asn Ala His Ala Ala Asn Leu Val Thr
Ala Val Phe Leu Ala 355 360 365tta gga caa gat cct gca caa aat gtt
gaa agt tcc aac tgt ata aca 1152Leu Gly Gln Asp Pro Ala Gln Asn Val
Glu Ser Ser Asn Cys Ile Thr 370 375 380ttg atg aaa gaa gtg gac ggt
gat ttg aga att tcc gta tcc atg cca 1200Leu Met Lys Glu Val Asp Gly
Asp Leu Arg Ile Ser Val Ser Met Pro385 390 395 400tcc atc gaa gta
ggt acc atc ggt ggt ggt act gtt cta gaa cca caa 1248Ser Ile Glu Val
Gly Thr Ile Gly Gly Gly Thr Val Leu Glu Pro Gln 405 410 415ggt gcc
atg ttg gac tta tta ggt gta aga ggc ccg cat gct acc gct 1296Gly Ala
Met Leu Asp Leu Leu Gly Val Arg Gly Pro His Ala Thr Ala 420 425
430cct ggt acc aac gca cgt caa tta gca aga ata gtt gcc tgt gcc gtc
1344Pro Gly Thr Asn Ala Arg Gln Leu Ala Arg Ile Val Ala Cys Ala Val
435 440 445ttg gca ggt gaa tta tcc tta tgt gct gcc cta gca gcc ggc
cat ttg 1392Leu Ala Gly Glu Leu Ser Leu Cys Ala Ala Leu Ala Ala Gly
His Leu 450 455 460gtt caa agt cat atg acc cac aac agg aaa cct gct
gaa cca aca aaa 1440Val Gln Ser His Met Thr His Asn Arg Lys Pro Ala
Glu Pro Thr Lys465 470 475 480cct aac aat ttg gac gcc act gat ata
aat cgt ttg aaa gat ggg tcc 1488Pro Asn Asn Leu Asp Ala Thr Asp Ile
Asn Arg Leu Lys Asp Gly Ser 485 490 495gtc acc tgc att aaa tcc taa
1509Val Thr Cys Ile Lys Ser * 5002502PRTSaccharomyces cerevisiae
2Met Val Leu Thr Asn Lys Thr Val Ile Ser Gly Ser Lys Val Lys Ser1 5
10 15Leu Ser Ser Ala Gln Ser Ser Ser Ser Gly Pro Ser Ser Ser Ser
Glu 20 25 30Glu Asp Asp Ser Arg Asp Ile Glu Ser Leu Asp Lys Lys Ile
Arg Pro 35 40 45Leu Glu Glu Leu Glu Ala Leu Leu Ser Ser Gly Asn Thr
Lys Gln Leu 50 55 60Lys Asn Lys Glu Val Ala Ala Leu Val Ile His Gly
Lys Leu Pro Leu65 70 75 80Tyr Ala Leu Glu Lys Lys Leu Gly Asp Thr
Thr Arg Ala Val Ala Val 85 90 95Arg Arg Lys Ala Leu Ser Ile Leu Ala
Glu Ala Pro Val Leu Ala Ser 100 105 110Asp Arg Leu Pro Tyr Lys Asn
Tyr Asp Tyr Asp Arg Val Phe Gly Ala 115 120 125Cys Cys Glu Asn Val
Ile Gly Tyr Met Pro Leu Pro Val Gly Val Ile 130 135 140Gly Pro Leu
Val Ile Asp Gly Thr Ser Tyr His Ile Pro Met Ala Thr145 150 155
160Thr Glu Gly Cys Leu Val Ala Ser Ala Met Arg Gly Cys Lys Ala Ile
165 170 175Asn Ala Gly Gly Gly Ala Thr Thr Val Leu Thr Lys Asp Gly
Met Thr 180 185 190Arg Gly Pro Val Val Arg Phe Pro Thr Leu Lys Arg
Ser Gly Ala Cys 195 200 205Lys Ile Trp Leu Asp Ser Glu Glu Gly Gln
Asn Ala Ile Lys Lys Ala 210 215 220Phe Asn Ser Thr Ser Arg Phe Ala
Arg Leu Gln His Ile Gln Thr Cys225 230 235 240Leu Ala Gly Asp Leu
Leu Phe Met Arg Phe Arg Thr Thr Thr Gly Asp 245 250 255Ala Met Gly
Met Asn Met Ile Ser Lys Gly Val Glu Tyr Ser Leu Lys 260 265 270Gln
Met Val Glu Glu Tyr Gly Trp Glu Asp Met Glu Val Val Ser Val 275 280
285Ser Gly Asn Tyr Cys Thr Asp Lys Lys Pro Ala Ala Ile Asn Trp Ile
290 295 300Glu Gly Arg Gly Lys Ser Val Val Ala Glu Ala Thr Ile Pro
Gly Asp305 310 315 320Val Val Arg Lys Val Leu Lys Ser Asp Val Ser
Ala Leu Val Glu Leu 325 330 335Asn Ile Ala Lys Asn Leu Val Gly Ser
Ala Met Ala Gly Ser Val Gly 340 345 350Gly Phe Asn Ala His Ala Ala
Asn Leu Val Thr Ala Val Phe Leu Ala 355 360 365Leu Gly Gln Asp Pro
Ala Gln Asn Val Glu Ser Ser Asn Cys Ile Thr 370 375 380Leu Met Lys
Glu Val Asp Gly Asp Leu Arg Ile Ser Val Ser Met Pro385 390 395
400Ser Ile Glu Val Gly Thr Ile Gly Gly Gly Thr Val Leu Glu Pro Gln
405 410 415Gly Ala Met Leu Asp Leu Leu Gly Val Arg Gly Pro His Ala
Thr Ala 420 425 430Pro Gly Thr Asn Ala Arg Gln Leu Ala Arg Ile Val
Ala Cys Ala Val 435 440 445Leu Ala Gly Glu Leu Ser Leu Cys Ala Ala
Leu Ala Ala Gly His Leu 450 455 460Val Gln Ser His Met Thr His Asn
Arg Lys Pro Ala Glu Pro Thr Lys465 470 475 480Pro Asn Asn Leu Asp
Ala Thr Asp Ile Asn Arg Leu Lys Asp Gly Ser 485 490 495Val Thr Cys
Ile Lys Ser 500332DNAArtificial SequencePrimer 3ggactagtaa
aacaatggcc ctgaccgaag ag 32429DNAArtificial SequencePrimer
4ccaagctttc agatggacat cgggtaaac 29535DNAArtificial SequencePrimer
5cgggatccaa aacaatggct gcagaccaat tggtg 35630DNAArtificial
SequencePrimer 6gcgtcgactt aggatttaat gcaggtgacg 30729DNAArtificial
SequencePrimer 7ctgccgcggg gccgcaaatt aaagccttc 29829DNAArtificial
SequencePrimer 8ctgccgcggt agtacggatt agaagccgc 29935DNAArtificial
SequencePrimer 9cgggatccaa aacaatgagc gaagtcggta tacag
351034DNAArtificial SequencePrimer 10gcgtcgactc ataacgaaaa
atcagagaaa tttg 341136DNAArtificial SequencePrimer 11cgggatccaa
aacaatgaca tccgatgatg ggaatg 361234DNAArtificial SequencePrimer
12gcgtcgactt acataaaagc tgaaaagttt gtag 34
* * * * *