U.S. patent application number 16/247003 was filed with the patent office on 2019-12-12 for methods and compositions for treatment of cartilage and disc tissue pathologies.
The applicant listed for this patent is THE ROYAL INSTITUTION FOR THE ADVANCEMENT OF LEARNING/MCGILL UNIVERSITY. Invention is credited to John ANTONIOU, Laura M. EPURE, Rahul GAWRI, Michael P. GRANT, Lisbet HAGLUND, Fackson MWALE, Peter J. ROUGHLEY.
Application Number | 20190375788 16/247003 |
Document ID | / |
Family ID | 52585327 |
Filed Date | 2019-12-12 |
![](/patent/app/20190375788/US20190375788A1-20191212-D00001.png)
![](/patent/app/20190375788/US20190375788A1-20191212-D00002.png)
![](/patent/app/20190375788/US20190375788A1-20191212-D00003.png)
![](/patent/app/20190375788/US20190375788A1-20191212-D00004.png)
![](/patent/app/20190375788/US20190375788A1-20191212-D00005.png)
![](/patent/app/20190375788/US20190375788A1-20191212-D00006.png)
![](/patent/app/20190375788/US20190375788A1-20191212-D00007.png)
![](/patent/app/20190375788/US20190375788A1-20191212-D00008.png)
![](/patent/app/20190375788/US20190375788A1-20191212-D00009.png)
![](/patent/app/20190375788/US20190375788A1-20191212-D00010.png)
![](/patent/app/20190375788/US20190375788A1-20191212-D00011.png)
View All Diagrams
United States Patent
Application |
20190375788 |
Kind Code |
A1 |
MWALE; Fackson ; et
al. |
December 12, 2019 |
METHODS AND COMPOSITIONS FOR TREATMENT OF CARTILAGE AND DISC TISSUE
PATHOLOGIES
Abstract
An isolated polypeptide comprising a peptide selected from: i)
DHX.sub.1SDNYT, wherein X.sub.1 is L or H (SEQ ID NO:3); ii) a
conservative variant of i) iii) a fragment of i) or ii); wherein
the conservative variant and/or fragment retains biological
activity and the peptide is 15 or less amino acids as well as
recombinant cells, and uses thereof.
Inventors: |
MWALE; Fackson; (Montreal,
CA) ; ANTONIOU; John; (Westmount, CA) ;
HAGLUND; Lisbet; (Montreal, CA) ; ROUGHLEY; Peter
J.; (Beaconsfield, CA) ; GAWRI; Rahul;
(Toronto, CA) ; EPURE; Laura M.; (Pierrefonds,
CA) ; GRANT; Michael P.; (Sainte-Catherine,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
THE ROYAL INSTITUTION FOR THE ADVANCEMENT OF LEARNING/MCGILL
UNIVERSITY |
Montreal |
|
CA |
|
|
Family ID: |
52585327 |
Appl. No.: |
16/247003 |
Filed: |
January 14, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14914452 |
Feb 25, 2016 |
10202420 |
|
|
PCT/CA2014/000656 |
Aug 27, 2014 |
|
|
|
16247003 |
|
|
|
|
61975329 |
Apr 4, 2014 |
|
|
|
61870394 |
Aug 27, 2013 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 19/02 20180101;
A61K 35/32 20130101; C07K 7/06 20130101; C07K 7/08 20130101; A61K
38/00 20130101; A61P 19/08 20180101; A61P 29/00 20180101; A61P
19/00 20180101; A61K 35/28 20130101 |
International
Class: |
C07K 7/06 20060101
C07K007/06; A61K 35/32 20060101 A61K035/32; C07K 7/08 20060101
C07K007/08; A61K 35/28 20060101 A61K035/28 |
Claims
1. An isolated polypeptide comprising a peptide selected from:
TABLE-US-00008 (SEQ ID NO: 30) i)
DHX.sub.1X.sub.2X.sub.3X.sub.4X.sub.5X.sub.6;
X.sub.1 is any amino acid, optionally L, H, R Q; X.sub.2 is S or L;
X.sub.3 is D, S or N; X.sub.4 is N or D; X.sub.5 is Y or S; and/or
X.sub.6 is T or Y; ii) a conservative variant of i), and iii) a
fragment of i) or ii); wherein the conservative variant and/or
fragment retains biological activity and the peptide is 15 or less
amino acids.
2. The isolated polypeptide of claim 1, wherein the peptide
consists of DHX.sub.1SDNYT (SEQ ID NO:1), wherein X.sub.1 is L or H
or a conservative variant thereof that retains biological
activity.
3. The isolated polypeptide of claim 1, comprising i) a peptide
sequence consisting of DHLSDNYT (SEQ ID NO:2) or a conservative
variant thereof that retains biological activity, or ii) a peptide
sequence consisting of DHHSDNYT (SEQ ID NO:3) or a conservative
variant thereof that retains biological activity.
4. The isolated polypeptide of claim 1, wherein the peptide is 4,
5, 6, 7, 9, 10, 11, 12, 13, 14 or 15 amino acids.
5. The isolated polypeptide of claim 1, comprising a peptide
selected from: TABLE-US-00009 (SEQ ID NO: 6) i)
DHX.sub.1X.sub.2X.sub.3X.sub.4X.sub.5X.sub.6X.sub.7X.sub.8X.sub.9DX.su-
b.10X.sub.11X.sub.12X.sub.13 or (SEQ ID NO: 4)
DHX.sub.1SDNYTX.sub.2DHDRX.sub.3I;
X.sub.1 is any amino acid, optionally L, H, R Q; X.sub.2 is S or L;
X.sub.3 is D, S, or N; X.sub.4 is N or D: X.sub.5 is Y or S;
X.sub.6 is T or Y; X.sub.7 is L, V, or T; X.sub.8 is any amino
acid, optionally D, G, N, or P; X.sub.9 is H, Y, or P; X.sub.10 is
R or Q; X.sub.11 is A, V, or D; X.sub.12 is I or R; and/or X.sub.13
is H or V; ii) a conservative variant of i); and iii) a fragment of
i) or ii) wherein the conservative variant and/or fragment retains
biological activity.
6. The isolated polypeptide of claim 5, wherein the sequence is: i)
DHLSDNYTLDHDRAI (SEQ ID NO: 9) or a conservative variant and/or
fragment thereof that retains biological activity or has at least
80% sequence identity to SEQ ID NO: 9, or ii) DHHSDNYTVDHDRVI (SEQ
ID NO: 10) or a conservative variant and/or fragment thereof that
retains biological activity or has at least 80% sequence identity
to SEQ ID NO: 10.
7. The isolated polypeptide of claim 1, wherein the peptide is
conjugated to a stabilizing moiety and/or carrier.
8. An isolated nucleic acid that encodes the polypeptide of claim
1.
9. A vector comprising the isolated nucleic acid of claim 8.
10. A recombinant cell expressing the polypeptide of claim 1.
11. The recombinant cell of claim 10, wherein the cell is a
chondrocyte lineage cell, a stem cell or a disc cell.
12. A pharmaceutical composition comprising the isolated
polypeptide of claim 1 and a pharmaceutically acceptable carrier,
stabilizing agent, or diluent.
13. A pharmaceutical composition comprising a scaffold formed of a
biocompatible material comprising the isolated polypeptide of claim
1 and a pharmaceutically acceptable carrier, stabilizing agent, or
diluent.
14. A method of inducing matrix synthesis in a cartilage,
chondrocyte cell, and/or disc cell or in a tissue comprising a
cartilage, chondrocyte cell, and/or disc cell, the method
comprising incubating/culturing the cartilage, chondrocyte cell,
and/or disc cell with an effective amount of the isolated
polypeptide of claim 1 under conditions to induce proteoglycan
and/or collagen synthesis, thus producing an induced cartilage,
chondrocyte cell, and/or disc cell with increased matrix
synthesis.
15. A method of producing cartilage, a chondrocyte cell, and/or
disc tissue for implanting into a subject, the method comprising
incubating/culturing the cartilage, chondrocyte cell, and/or disc
cell with an effective amount of the isolated polypeptide of claim
1 under conditions to induce proteoglycan and collagen synthesis,
thus producing an induced cartilage, chondrocyte cell, and/or disc
cell with increased matrix synthesis, wherein a substantially pure
population of the induced cartilage, chondrocyte cell, and/or disc
cell can be isolated.
16. A method of alleviating a symptom of and/or treating a
cartilage and/or disc disorder, comprising administering to a
subject in need thereof the isolated polypeptide of claim 1.
17. The method of claim 16, wherein the cartilage and/or disc
disorder is intervertebral disc degeneration or an inflammatory or
degenerative joint disease, wherein the inflammatory or
degenerative joint disease comprises arthritis, undesirable
osteogenesis, and/or calcification.
18. A method of alleviating a symptom of and/or treating a
cartilage and/or disc disorder, comprising administering to a
subject in need thereof the recombinant cell of claim 10.
19. A method of alleviating a symptom of and/or treating a
cartilage and/or disc disorder, comprising administering to a
subject in need thereof the pharmaceutical composition of claim 12.
Description
[0001] This is a Patent Cooperation Treaty Application which claims
the benefit of 35 U.S.C. .sctn. 119 based on the priority of U.S.
Provisional Patent Applications No. 61/870,394, filed Aug. 27, 2013
and 61/975,329, filed Aug. 4, 2014, which are incorporated herein
by reference in their entirety.
FIELD
[0002] The disclosure relates to methods and compositions for the
treatment of cartilage and disc disorders and particularly to
methods and compositions using Link N fragments for the treatment
of cartilage and disc disorders such as arthritis and
intervertebral disc degeneration.
BACKGROUND
[0003] The intervertebral discs (IVDs) link adjacent vertebrae
within the spine. They are composed of the peripheral annulus
fibrosus (AF) and the central nucleus pulposus (NP). The AF is a
fibrosus tissue with concentric lamellae rich in collagen fibrils
(1). The NP has a more amorphous consistency, with collagen fibrils
that have a random orientation and a high content of aggrecan that
give it a gelatinous appearance and provides for the ability to
resist compressive loads. Aggrecan is a large proteoglycan with
numerous glycosaminoglycan (GAG) chains attached to its core
protein, which in the NP provides the osmotic properties needed to
counter the effects of compression.
[0004] Mechanisms that contribute to degenerative changes in the
disc lead to biochemical alterations in the composition and
structure of extracellular matrix due to both depleted synthesis
and increased degradation, with aggrecan being particularly
susceptible to proteolytic damage and loss. Aging, poor nutrition,
biomechanical (2-5), biochemical (6-10) and genetic influences
(11-14) are associated with increased IVD degeneration. During
degeneration, loss of GAG content in the NP occurs, changing it
from a gelatinous structure to a fibrotic texture as it becomes
more collagenous, and fissures appear in both the NP and AF
(15,16). This is commonly associated with low back pain, possibly
due to the nerve ingrowth and loss of disc height, which are
facilitated by proteoglycan depletion (17). Currently, there is no
medical treatment for IVD degeneration, ultimately leaving surgical
excision of the damaged tissue, insertion of a cage or prosthesis
to restore the IVD space, and vertebral bone fusion as the only
offered option. While this may provide relatively good clinical
short-term results (18) in pain relief, in many instances it also
alters spine biomechanics leading to subsequent adjacent-level disc
degeneration.
[0005] Biological repair of the degenerating IVD would be
preferable to surgical excision.
[0006] Disc degeneration starts early in life and progresses with
increasing age (48, 49). This process is characterised by a
phenotypic change of the resident cells and results in increased
production of inflammatory cytokines (50, 51). A number of
cytokines have been linked to disc degeneration; IL-1.beta. and
TNF-.alpha. were the first to be described, but additional
candidates such as IL-6 and IL-8 have more recently been described
especially in animal models (17). Studies of human discs from
degenerate/herniated specimens showed, in addition to IL-1.beta.
and TNF-.alpha., increased levels of IL-2, IL-4, IL-10, IL-12 and
IL-17 when compared to healthy control (52). The exact mechanism
leading to increased cytokine production is unclear. Multiple
internal and external cues could influence cytokine production,
such as heredity, mechanical loading, oxygenation, or the presence
of inflammatory cells (17). In addition, accumulation of specific
matrix fragmentation products may activate Toll-like receptors and
thereby induce cytokine production.
[0007] Inflammatory cytokines are known to induce protease
production, which subsequently leads to structural failure and loss
of IVD height due to degradation of the extracellular matrix (ECM),
including aggrecan and collagen (53). Although proteases are
responsible for fragmentation and breakdown of important components
of the ECM, they also have significant roles in normal remodeling
of the disc. Cathepsin K activity, along with matrix
metalloproteinase (MMP) proteolysis of aggrecan, has been suggested
to be mainly a process of normal tissue remodeling in the disc (54,
55). However, matrix metalloproteinases (MMP1, 2, 3, 7, 9, 13),
aggrecanases (ADAMTS4, 5), and cathepsins (cathepsins D and L) are
all elevated during disc degeneration (56, 9). In addition, the
serine protease HTRA1, is thought to play a central role in disc
degeneration as elevated levels of HTRA1 and its degradation of
CHAD correlated to the degree of disc degeneration (10, 57).
[0008] Degradation of the protein and proteoglycan content of the
nucleus pulposus (NP) can result in loss of disc height and the
weight bearing capacity of the disc. In the final stages of disc
degradation fissures in the annular ring occur, leading to
extrusion of NP material and pain due to compression of nerves. A
repair strategy of the painful degenerate disc requires production
of ECM components and down regulation of proteinase activity in the
inflammatory milieu. These properties are associated with several
growth factors such as TGF-.beta. and BMP 7 (58-61). However, the
use of growth factors in clinical practice is limited by their high
cost and potential side effects.
[0009] Osteoarthritis (OA) is a chronic degenerative joint disorder
that affects millions of people. It is characterized by the
destruction of articular cartilage due to an imbalance in the
anabolic and catabolic activities of chondrocytes. Articular
cartilage is an avascular connective tissue, covering the bony
parts of diarthrodial joints allowing the frictionless motion of
the joint, by absorbing and dissipating load. These properties are
related to the composition and structure of its extracellular
matrix (ECM). It is composed of collagen fibrils, proteoglycans
(predominantly aggrecan), noncollagenous proteins and a high
content of water. The only cell type in articular cartilage is the
chondrocyte, and is responsible for the synthesis and maintenance
of the extracellular matrix.
[0010] During osteoarthritis (OA), characterized by degradation of
articular cartilage and inflammation of the synovial membrane, this
equilibrium is disrupted due to increased degradation of collagens
and proteoglycans from the matrix and depleted synthesis of
molecules. Cartilage responds to a complex multitude of autocrine
and paracrine (anabolic and catabolic) factors that regulate gene
expression and protein synthesis in chondrocytes.
[0011] Matrix degradation is mediated by matrix metalloproteinases
(MMPs) and ADAMTS-4 and -5, induced by Interleukin-1beta
(IL-1.beta.), the major cytokine implicated in OA. Other cytokines
that have been implicated in OA pathogenesis include tumor necrosis
factor-alpha (TNF-.alpha.), IL-6, other common c-chain cytokines
such as IL-2, IL-7, IL-15, and IL-21, and chemokines. These factors
produced by synovial cells and chondrocytes results in the
upregulation of members of the matrix metalloproteinase (MMP) and a
disintegrin and metalloproteinase with thrombospondin motifs
(ADAMTS) families of enzymes. MMPs are involved in ECM turnover and
cartilage degeneration. Aging, obesity, and joint injuries are
associated with increased OA. It is characterized by progressive
cellular and molecular changes in all joint tissues, including
articular cartilage, subchondral bone, synovium, ligaments, and
peri-articular muscles. There are currently no therapies that
reverse or repair cartilage degradation in OA patients.
[0012] There is general agreement that since inflammatory processes
play a fundamental role in the pathogenesis of various rheumatic
diseases, such as, OA and rheumatoid arthritis (RA) selective
inhibition of inflammatory activities is vital for therapy and that
the family of NF-.kappa.B transcription factors play a prominent
role in this process. Thus several studies have been directed
towards the pharmacologic modulation of the NF-.kappa.B pathways
using non-steroidal anti-inflammatory drugs, corticosteroids,
nutraceuticals, antisense DNA therapy, RNA interference and
anti-rheumatic drugs.
[0013] Link N is a 16 amino acid sequence that has been shown to
increase proteoglycan synthesis and production of other matrix
components by IVD cells (29, 34). It has also been shown to
increase disc height in a rabbit disc puncture degeneration model,
thereby demonstrating a regenerative potential also in vivo (31).
This naturally occurring peptide represents the N-terminal region
of the link protein that stabilizes proteoglycan aggregates in both
disc and cartilage, and is generated by MMPs during tissue turnover
in vivo. Link N interacts with the Bone Morphogenetic Protein (BMP)
Type II Receptor and activates Smad1/5 signaling in cultured rabbit
IVD cells (33).
[0014] Fragments of Link N have been tested. Wang et al. reported
that the stimulatory effect of Link N was lost when they evaluated
a number of shorter Link N-derived peptides (33) including a
peptide spanning amino acid residues 1-12.
SUMMARY
[0015] An aspect of the disclosure includes an isolated polypeptide
comprising a peptide selected from:
[0016] i) DHX.sub.1SDNYT, wherein X.sub.1 is L or H (SEQ ID
NO:1);
[0017] ii) a conservative variant of i)
[0018] iii) a fragment of i) or ii);
[0019] wherein the conservative variant and/or fragment retains
biological activity and the peptide is 15 or less amino acids.
[0020] In an embodiment, the isolated polypeptide comprises a
peptide sequence consisting of: 1) DHLSDNYT (SEQ ID NO:2); and/or a
conservative variant thereof that retains biological activity or 2)
DHHSDNYT (SEQ ID NO:3) or a conservative variant thereof that
retains biological activity
[0021] In another embodiment, the isolated polypeptide comprises a
peptide selected from:
i) DHX.sub.1SDNYTX.sub.2DHDR X.sub.3I, wherein X.sub.1 is L or H,
X.sub.2 is L or V and X.sub.3 is A or V (SEQ ID NO: 4); ii) a
conservative variant of i); and iii) a fragment of i) or ii)
wherein the conservative variant and/or fragment retains biological
activity.
[0022] Another aspect includes an isolated nucleic acid that
encodes a polypeptide comprising a Link N fragment peptide.
[0023] A further aspect includes a vector comprising 1) a nucleic
acid that encodes a polypeptide comprising a Link N fragment
peptide; or 2) a Link N fragment polypeptide
[0024] A further aspect is a recombinant cell expressing a
polypeptide comprising a Link N fragment peptide.
[0025] Yet another aspect is a composition comprising a polypeptide
comprising a Link fragment polypeptide, a recombinant cell
expressing a polypeptide comprising a Link N fragment peptide,
[0026] Methods for making and using said products are also
described.
[0027] Other features and advantages of the present disclosure will
become apparent from the following detailed description. It should
be understood, however, that the detailed description and the
specific examples while indicating preferred embodiments of the
disclosure are given by way of illustration only, since various
changes and modifications within the spirit and scope of the
disclosure will become apparent to those skilled in the art from
this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] An embodiment of the present disclosure will now be
described in relation to the drawings in which:
[0029] FIG. 1: Proteoglycan synthesis by bovine or human disc
cells. Synthesis was estimated by evaluating .sup.35SO.sub.4
incorporation, after 48 h in the presence of Link N (1 .mu.g/mL),
scrambled S-Link N (1 .mu.g/mL), reversed R-Link N (1 .mu.g/mL) or
media without peptide supplementation. Relative proteoglycan
expression is shown in bovine nucleus pulposus (NP) and annulus
fibrosus (AF) cells (a), and in human nucleus pulposus (NP) and
inner annulus fibrosus (iAF) cells (b). Data are expressed as a
mean.+-.SD, of the ratio relative to incorporation by control cells
exposed to medium alone (n=3). Values where p.ltoreq.0.05 (*) were
taken as significant.
[0030] FIG. 2: Stability of Link-N in culture medium. Link N was
incubated for 48 h at 37.degree. C., 5% CO.sub.2 in culture medium
and the peak intensity of the intact peptide was followed by mass
spectrometry. Aliquots were analyzed at 6, 12, 24, 36 and 48 h.
Data is plotted as ratio relative to signal intensity at time 0.
The plot is one out of three representative experiments.
[0031] FIG. 3: Stability of Link-N in the presence of cells. Link N
was incubated for 48 h at 37.degree. C., 5% CO.sub.2 in the
presence of human NP (a) or AF (b) cells, and the peak intensity of
the intact peptide was followed by mass spectrometry. Aliquots were
analyzed at 6, 12, 24, 36 and 48 h. Data is plotted as ratio
relative to signal intensity at time 0. The plot is one out of
three representative experiments conducted with cells from three
different donors.
[0032] FIG. 4: Mass spectrometry of processed Link N. (a) Mass
spectrum of peptides detected in medium from human NP (black) and
AF (grey) cells. Fragmented Link N with a mass of 964.4 Da is
indicated in the graph. The 964.4 Da peptide eluted from the column
in 2 different regions, with retention times of around 23 and 32
min. (b) Schematic illustration of the two possible Link N
fragments of 964.4 Da, Link N 1-8 (highlighted in dark gray) and
Link N 4-11 (highlighted in light gray). (c) The amino acid
sequence of the generated 964.4 Da fragment was identified by
tandem MS. The sequence was confirmed by evaluating the generated
fragmentation products of the peptide. Major detected peaks are A
[(845.3 Da) DHLSDNY (SEQ ID NO:19) (+1)], B [(682.28 Da) DHLSDN
(SEQ ID NO:20) (+1)] and C [(568.2 Da) DHLSD (SEQ ID NO:21) (+1)],
masses that can only be generated by the 1-8 sequence.
[0033] FIG. 5: Proteoglycan synthesis by bovine and human cells in
response to Link N fragments. Synthesis was estimated by evaluating
.sup.35SO.sub.4 incorporation after 48 h in the presence of Link N
(1 .mu.g/mL), Link N 1-8 (0.5 .mu.g/mL), Link N 9-16 (0.5 .mu.g/mL)
or media without peptide supplementation. Relative proteoglycan
expression is shown in bovine nucleus pulposus (NP) and annulus
fibrosus (AF) (a), and human nucleus pulposus (NP) and inner
annulus fibrosus (iAF) cells (b). Data are expressed as mean.+-.SD,
of the ratio relative to incorporation by control cells exposed to
medium alone (n=3). Values where 0.05 (*) were taken as
significant.
[0034] FIG. 6: Exposure of Link 1-16 to proteinases described to be
involved in disc degeneration. Link 1-16 was exposed to MMPs 3, 7,
12, 13, Cathepsins L, K, and B, ADAMTS 4, 5 and HTRA1 and the peak
area intensity was quantified using mass spectrometry. A, Relative
intensity of the intact Link N 1-16, peptide. B, Relative intensity
of the Link N 1-8, peptide. C Relative intensity of the Link N
9-16, peptide.
[0035] FIG. 7: Proteoglycan synthesis by bovine and human cells in
response to Link N fragments in an inflammatory environment.
Synthesis was estimated by evaluating .sup.35SO.sub.4 incorporation
after 48 h in IL-1-containing medium, supplemented with Link N (1
.mu.g/mL), Link N 1-8 (0.5 .mu.g/mL), Link N 9-16 (0.5 .mu.g/mL) or
medium without peptide supplementation. Relative proteoglycan
expression is shown in bovine nucleus pulposus (NP) and annulus
fibrosus (AF) (A), and human nucleus pulposus (NP) and inner
annulus fibrosus (iAF) cells (B). Data are expressed as mean.+-.SD,
of the ratio relative to proteoglycan produced by cells exposed to
IL-1-containing medium (n=3). Values where p.ltoreq.0.05 (*) were
taken as significant.
[0036] FIG. 8: Proteoglycan (GAG) concentration in human
osteoarthritic (OA) cartilage in response to Link N in an
inflammatory environment. Proteoglycan concentrations were
determined in OA cartilage explants incubated for 21 days with Link
N (1 .mu.g/ml), IL-1-containing medium (5 ng/ml), co-exposed to
Link N and IL-1, or medium without peptide supplementation
(control). The results are presented as the percentage of GAG
retained in cartilage, normalized to control. Values where p 0.05
(*) were taken as significant.
[0037] FIG. 9: Analysis of aggrecan core protein and newly
synthesized type II collagen in human osteoarthritic cartilage. (A)
The immunoblotting of aggrecan (AGG) core protein in control, Link
N, IL-1 and both Link N and IL-1 treated cartilage and the
semi-quantitative analysis of intact aggrecan core protein with a
molecular weight of about 320 kDa. (B) The immunoblotting of type
II collagen (Col II) in control, Link N, IL-1 and both Link N and
IL-1 treated cartilage and the semi-quantitative analysis of
collagen with a molecular weight of 360 kDa. The results are
represented as mean.+-.SD of four cartilage samples from different
donors (* p<0.05).
[0038] FIG. 10: Analysis of MMP-13 and type X collagen (Col X)
expression in human osteoarthritic cartilage. (A) The
immunoblotting of MMP-13 in control, Link N, IL-1 and both Link N
and IL-1 treated cartilage and the semi-quantitative analysis of
MMP-13 protein with a molecular weight of 55 kDa. (B) The
immunoblotting of type X collagen in control, Link N, IL-1 and both
Link N and IL-1 treated cartilage and the semi-quantitative
analysis of collagen alpha chains with a molecular weight of 60
kDa. The results are represented as mean.+-.SD of four cartilage
samples from different donors (*p<0.05).
[0039] FIG. 11: Analysis of NFkB in chondrocytes from OA and normal
donors supplemented with Link N in an inflammatory environment.
Western blot analysis of NFkB in chondrocytes control, Link N
treated, IL-1 treated, Link N (10 ng/ml)+IL-1, Link N (100
ng/ml)+IL-1 and Link N (1000 ng/ml)+IL-1. The results are
represented as mean.+-.SD of three experiments from different
donors (* p<0.05). The results demonstrate that IL-1 induced
activation of NF-kB is dose dependently supressed by Link N in
normal human chondrocytes (A) and OA chondrocytes (B).
[0040] FIG. 12: Proteoglycan concentration in the discs.
Proteoglycan concentrations were determined in discs with induced
degeneration, discs treated with Link N, MSCs, both Link N and
MSCs, and non-degeneration control discs. The results are
represented as mean.+-.SD of seven discs from different bovine
tails. (* p<0.05)
[0041] FIG. 13: Size distribution of proteoglycans in the discs.
The proteoglycan isolated from seven discs with different
treatments was pooled and analyzed by agarose gel electrophoresis.
Proteoglycan was visualized by Toluidine blue staining.
[0042] FIG. 14. Analysis of aggrecan core protein in the discs.
Immunoblotting and semi-quantitative analysis of intact aggrecan
core protein with a molecular weight of about 320 kDa in
degeneration control, Link N treated, MSCs treated, both Link N and
MSCs treated, and no degeneration control discs. The results are
represented as mean.+-.SD of seven discs from different bovine
tails. (* p<0.05)
[0043] FIG. 15. Analysis of newly synthesized type II collagen in
the discs. Immunoblotting and semi-quantitative analysis of type II
collagen alpha chains with a molecular weight of 120 kDa in
degeneration control, Link N treated, MSCs treated, both Link N and
MSCs treated, and no degeneration control discs. The results are
represented as mean.+-.SD of seven discs from different bovine
tails. (* p<0.05)
[0044] FIG. 16: Proteoglycan distribution in the nucleus pulposus
region of the discs. Discs with trypsin-induced degeneration were
cultured for 14 days following injection with: Link N, MSC or Link
N and MSCs. These were compared with degeneration control and
non-degeneration control discs. The discs were evaluated by
histology using Safranin O staining (scale bar, 100 .mu.m).
[0045] FIG. 17: Labeling and tracking of the MSCs. A. MSC cell
membranes were labeled using the PKH67 kit (green fluorescence,
arrow) and the labeling efficiency was evaluated using fluorescence
microscopy. B. Labeled MSCs were cultured in expansion medium for
two days and maintained labeling was verified using fluorescence
microscopy. C. The presence of labeled MSCs was determined in the
NP region after 14 days in organ culture. D. Magnification of
C.
[0046] FIG. 18: Effect of Link N 1-8 on proteoglycan synthesis,
aggrecan and type II collagen expression in bovine disc organ
culture at 2 weeks after trypsin-induced degeneration. (A)
Proteoglycan concentration in the discs were determined at 2 weeks
after treatment in discs with induced degeneration, discs with
induced degeneration and treated with Link N 1-8, and
non-degenerate control discs. The results are represented as
mean.+-.SD of three discs from different bovine tails. (*
p<0.05). (B) Immunoblotting and semi-quantitative analysis of
newly synthesized type II collagen with a molecular weight of about
360 kDa at 2 weeks after treatment in discs with induced
degeneration, discs with induced degeneration and treated with Link
N 1-8, non-degenerate control discs and non-degenerate discs
treated with Link N 1-8. The results are represented as mean.+-.SD
of seven discs from different bovine tails. (* p<0.05). (C)
Immunoblotting and semi-quantitative analysis of intact aggrecan
core protein with a molecular weight of about 320 kDa at 2 weeks
after treatment in discs with induced degeneration, discs with
induced degeneration and treated with Link N 1-8, non-degenerate
control discs and non-degenerate discs treated with Link N 1-8. The
results are represented as mean.+-.SD of seven discs from different
bovine tails. (* p<0.05).
[0047] FIG. 19: Schematic illustration of link protein stabilizing
the interaction between aggrecan G1 domain and hyaluronate. Link
protein (LP) is stabilizing the interaction between aggrecan G1
domain and hyaluronate (HA). The figure also depicts human Link N
[DHLSDNYTLDLDRAIH (SEQ ID NO:32)] and bovine Link N
[DHHSDNYTVDHDRVIH (SEQ ID NO:5)], the N-terminal parts of link
protein, and highlights the substitution of residues (marked in
bold), as occurs in the bovine sequence.
[0048] FIG. 20: Cell viability of bovine intervertebral disc cells
cultured in alginate supplemented with either human or bovine Link
N. Cell viability was measured using the LIVE/DEAD.RTM.
Viability/Cytotoxicity Assay. Bovine intervertebral disc (IVD)
cells embedded in alginate were incubated for 18 days in media
supplemented with either 1 ug/ml bovine (BLN) or human (HLN) Link
N. Beads cultured in media alone for the same period of time were
used as the control (CTL). After 18 days, the beads were harvested
and cell viability assessed. Cell viability for all beads was
assessed at >98% (white bright dots).
[0049] FIG. 21: Cumulative glycosaminoglycan release into the
culture media by nucleus pulposus bovine cells beaded in 1.2%
alginate. Nucleus pulposus (NP) bovine cells beaded in 1.2%
alginate were cultured in medium supplemented with either bovine
(BLN) or human (HLN) Link N (1 .mu.g/ml) or exposed to medium alone
(CTL). For each condition, the media were collected at 3, 6, 9, 12,
15, and 18 days of culture. The sulfate glycosaminoglycan (GAG)
release into the media was measured by 1,9-dimethylmethylene blue
(DMMB) dye-binding assay. Results are presented as box plot in
which the box represents the middle 50% (25%-75% percentile) of the
combined data of three independent experiments performed in
triplicates (*p<0.05 or ***p<0.0001).
[0050] FIG. 22: Cumulative glycosaminoglycan release into the
culture media by annulus fibrosus bovine cells beaded in 1.2%
alginate. Annulus fibrosus (AF) bovine cells beaded in 1.2%
alginate were cultured in medium supplemented with either bovine
(BLN) or human (HLN) Link N (1 .mu.g/ml) or exposed to medium alone
(CTL). For each condition, the media were collected at 3, 6, 9, 12,
15, and 18 days of culture. The sulfate glycosaminoglycan (GAG)
release into the media was measured by 1,9-dimethylmethylene blue
(DMMB) dye-binding assay. Results are presented as box plot in
which the box represents the middle 50% (25%-75% percentile) of the
combined data of three independent experiments performed in
triplicates (**p<0.005 or ***p<0.0001).
[0051] FIG. 23: Changes in aggrecan gene expression. Changes in
aggrecan (AGG) gene expression of the annulus fibrosus (AF) and
nucleus pulposus (NP) bovine cells beaded in 1.2% alginate at 1
week after incubation in medium supplemented with either 1 .mu.g/ml
bovine (BLN) or human Link N (HLN). Gene expression was measured by
RT-PCR. 18S rRNA was used as a housekeeping gene and served to
normalize the results. The values are expressed as a ratio of the
gene expression of cells exposed to Link N relative to that of
cells exposed to medium alone (CTL). (*p<0.05,
**p<0.001).
[0052] FIG. 24: Changes in aggrecan ADAMTS-4 and ADAMTS-5 gene
expression. Changes in (A, B) ADAMTS-4 and (C, D) ADAMTS-5 gene
expression of the annulus fibrosus (AF) and nucleus pulposus (NP)
bovine cells beaded in 1.2% alginate at 1 week and 2 weeks after
incubation in medium supplemented with either 1 .mu.g/ml bovine
(BLN) or human Link N (HLN). Gene expression was measured by
RT-PCR. 18S rRNA was used as a housekeeping gene and served to
normalize the results. The values are expressed as a ratio of the
gene expression of cells exposed to Link N relative to that of
cells exposed to medium alone (CTL). (*p<0.05,
**p<0.001).
[0053] FIG. 25: The effect of bovine or human Link N on Smad1/5
activation in annulus fibrosus and nucleus pulposus bovine cells.
Annulus fibrosus (AF) and nucleus pulposus (NP) bovine cells were
cultured for 6 h in medium supplemented with either 1 .mu.g/ml of
bovine (BLN) or human Link N (HLN). Protein expression was analysed
by immunoblotting using specific antibodies against total Smad1 and
phospho-Smad1/5. Quantitative results depicting the combined data
for three independent experiments performed in triplicates are
presented as mean.+-.standard deviation (*p<0.05; **p<0.01;
.sup..dagger.p<0.001; .sup..sctn. p<0.0001). Bands on gels
are shown for one representative experiment.
[0054] FIG. 26: The effect of bovine or human Link N on Smad2
activation in annulus fibrosus and nucleus pulposus bovine cells.
Annulus fibrosus (AF) and nucleus pulposus (NP) bovine cells were
cultured for 6 h in medium supplemented with either 1 .mu.g/ml of
bovine (BLN) or human Link N (HLN). Protein expression was analysed
by immunoblotting using specific antibodies against total and
phospho-Smad2. Quantitative results depicting the combined data for
three independent experiments performed in triplicates are
presented as mean.+-.standard deviation (*p<0.05). Bands on gels
are shown for one representative experiment.
[0055] FIG. 27: NGF expression in human discs from grades 2 to 4
(AF and NP regions) with degeneration. The figure is a series of
tissue stains and an immunoblot showing that NGF expression in
human IVD increases with degeneration.
[0056] FIG. 28: Link N suppresses TNF.alpha. stimulated expression
of neurotrophin (NGF and BDNF) and Substance P (TAC1) in annulus
fibrosus (AF) cell. AF cells from grade 2 human discs were
stimulated 24 hrs with either Link N (1 .mu.g/ml)+TNF.alpha. (100
ng/ml) or TNF.alpha. (100 ng/ml) alone. The results are shown as
means.+-.S.D. of four independent experiments with four different
donors. * p<0.05 vs. control.
[0057] FIG. 29: Link N suppresses IL-1.beta. stimulated expression
of neurotrophin (NGF and BDNF) and Substance P (TAC1) in annulus
fibrosus (AF) cell. AF cells from grade 2 human discs were
stimulated 24 hrs with either Link N (1 .mu.g/ml)+IL-1.beta. (10
ng/ml) or IL-1.beta. (10 ng/ml) alone. The results are shown as
means.+-.S.D. of four independent experiments with four different
donors. * p<0.05 vs. control.
[0058] FIG. 30: Link N suppresses TNF.alpha. stimulated expression
of neurotrophin (TRKA and TRKB) and Substance P (TAC1R) receptors.
Changes in neutrophin and Substance P gene expression by annulus
fibrosus (AF) from grade 2 human discs 24 hrs stimulated after Link
N (1 .mu.g/ml)+TNF.alpha. (100 ng/ml) or TNF.alpha. (100 ng/ml)
alone supplementation. The results are shown as means.+-.S.D. of
four independent experiments with four different donors. *
p<0.05 vs. control.
[0059] FIG. 31: Link N suppresses Il-1 beta stimulated expression
of neurotrophin (TRKA and TRKB) and Substance P (TAC1R) receptors.
Changes in neutrophin and Substance P gene expression by annulus
fibrosus (AF) from grade 2 human discs 24 hrs stimulated after Link
N (1 .mu.g/ml)+IL-1.beta.. (10 ng/ml) or IL-1.beta.. (10 ng/ml)
alone supplementation. The results are shown as means.+-.S.D. of
four independent experiments with four different donors. *
p<0.05 vs. control.
[0060] FIG. 32: Analysis of NGF gene expression and released in the
media of AF cells incubated with Link N. Western blots and
semi-quantitative analysis of NGF protein with a molecular weight
of about 27 kDa in grade 4 AF cells treated with Link N,
IL-1.beta., or Link N and IL-1.beta. treated. The results are
represented as mean.+-.SD of 4 discs from different donors (*
p<0.05).
[0061] FIG. 33: is a photograph of a bovine coccygeal IVD and a
graph demonstrating that Link N reduced substance P release from
injured bovine IVD. Changes in substance P release by bovine discs
4 or 24 hours after being treated with capsaicin, punctured only or
punctured+Link N (10 .mu.g/ml) supplementation. The results are
shown as means.+-.S.D. of four independent experiments. *p<0.05
vs. control.
DETAILED DESCRIPTION OF THE DISCLOSURE
I. Definitions
[0062] The term "cartilage cell" as used herein means chondrocyte
lineage cells, for example found in cartilage tissue and which can
be used to produce cartilage tissue.
[0063] The term "chondrocyte lineage cells" as used herein means
chondrocyte cells and cells that are cytochemically similar and
express chondrocyte markers, including for example Sox9 and
collagen II, and behave as chondrocyte cells. The chondrocyte cells
can be articular cartilage lineage chondrocytes or hypertrophic
lineage chondrocytes that are capable of hypertrophy.
[0064] The term "cartilage tissue" as used herein means cartilage
tissue and tissue that is histologically similar and expresses
cartilage markers, for example collagen II and aggrecan, and
behaves as cartilage, including articular cartilage tissue and/or
growth plate cartilage like tissue.
[0065] The term "conservative variant" as used herein means a Link
N polypeptide fragment comprising one or more conservative amino
acid substitutions.
[0066] A "conservative amino acid substitution" as used herein, is
one in which one amino acid residue is replaced with another amino
acid residue without abolishing the peptide's desired properties.
Suitable conservative amino acid substitutions can be made by
substituting amino acids with similar hydrophobicity, polarity, and
R-chain length for one another. Examples of conservative amino acid
substitution include:
TABLE-US-00001 Conservative Substitutions Type of Amino Acid
Substitutable Amino Acids Hydrophilic Ala, Pro, Gly, Glu, Asp, Gln,
Asn, Ser, Thr Sulphydryl Cys Aliphatic Val, Ile, Leu, Met Basic
Lys, Arg, His Aromatic Phe, Tyr, Trp
[0067] The term "culturing" as used herein incubating and/or
passaging cells in an adherent, suspension or 3D cell and/or organ
culture. The 3D cell or organ culture can comprise a culture in
which cells are cultured in or on a 3-dimensional scaffold.
[0068] The term "disc cell" as used herein means cells of the NP or
AF cell lineage.
[0069] The terms "enriching" or "enriched" as used herein mean that
the yield (fraction) of cells of one type is increased by at least
about 10%, at least about 20%, at least about 30%, at least about
40%, at least about 50% or at least about 60% over the fraction of
cells of that type in the starting culture or preparation.
Enriching and partially purifying can be used interchangeably.
[0070] The population of cells can be enriched using different
methods such as methods based on markers such as cell surface
markers (e.g. FACS sorting etc).
[0071] As used herein, the term "express" refers to the
transcription of a polynucleotide or translation of a polypeptide
in a cell, such that levels of the molecule are measurably higher
in a cell that has been contacted with or exposed to the molecule
(e.g. the Link N fragment) than they are in a cell that has not
been contacted or exposed to the molecule. Methods to measure the
expression of a molecule are well known to those of ordinary skill
in the art, and include without limitation, Northern blotting,
RT-PCR, in situ hybridization, Western blotting, and immunostaining
such as FACS.
[0072] The term "hybridize" refers to the sequence specific
non-covalent binding interaction with a complementary nucleic acid.
The hybridization is conducted under at least moderately stringent
conditions. In a preferred embodiment, the hybridization is under
high stringency conditions. Appropriate stringency conditions which
promote hybridization are known to those skilled in the art, or can
be found in Current Protocols in Molecular Biology, John Wiley
& Sons, N.Y. (1989), 6.3.1 6.3.6. For example, 6.0.times.sodium
chloride/sodium citrate (SSC) at about 45.degree. C. for 15
minutes, followed by a wash of 2.0.times.SSC at 50.degree. C. for
15 minutes may be employed. The stringency may be selected based on
the conditions used in the wash step. For example, the salt
concentration in the wash step can be selected from a high
stringency of about 0.2.times.SSC at 50.degree. C. for 15 minutes.
In addition, the temperature in the wash step can be at high
stringency conditions, at about 65.degree. C. for 15 minutes.
[0073] By "at least moderately stringent hybridization conditions"
it is meant that conditions are selected which promote selective
hybridization between two complementary nucleic acid molecules in
solution. Hybridization may occur to all or a portion of a nucleic
acid sequence molecule. The hybridizing portion is typically at
least 15 (e.g. 20, 25, 30, 40 or 50) nucleotides in length. Those
skilled in the art will recognize that the stability of a nucleic
acid duplex, or hybrids, is determined by the Tm, which in sodium
containing buffers is a function of the sodium ion concentration
and temperature (Tm=81.5.degree. C.-16.6 (Log 10 [Na+])+0.41(%
(G+C)-600/l), or similar equation). Accordingly, the parameters in
the wash conditions that determine hybrid stability are sodium ion
concentration and temperature. In order to identify molecules that
are similar, but not identical, to a known nucleic acid molecule a
1% mismatch may be assumed to result in about a 1.degree. C.
decrease in Tm, for example if nucleic acid molecules are sought
that have a >95% sequence identity, the final wash temperature
will be reduced by about 5.degree. C. Based on these considerations
those skilled in the art will be able to readily select appropriate
hybridization conditions. In preferred embodiments, stringent
hybridization conditions are selected. By way of example the
following conditions may be employed to achieve stringent
hybridization: hybridization at 5.times.sodium chloride/sodium
citrate (SSC)/5.times.Denhardt's solution/1.0% SDS at Tm--5.degree.
C. based on the above equation, followed by a wash of
0.2.times.SSC/0.1% SDS at 60.degree. C. for 15 minutes. Moderately
stringent hybridization conditions include a washing step in
3.times.SSC at 42.degree. C. for 15 minutes. It is understood,
however, that equivalent stringencies may be achieved using
alternative buffers, salts and temperatures. Additional guidance
regarding hybridization conditions may be found in: Current
Protocols in Molecular Biology, John Wiley & Sons, N.Y., 1989,
6.3.1-6.3.6 and in: Sambrook et al., Molecular Cloning, a
Laboratory Manual, Cold Spring Harbor Laboratory Press, 2000, Third
Edition.
[0074] The term "sequence identity" as used herein refers to the
percentage of sequence identity between two polypeptide sequences
or two nucleic acid sequences. To determine the percent identity of
two amino acid sequences or of two nucleic acid sequences, the
sequences are aligned for optimal comparison purposes (e.g., gaps
can be introduced in the sequence of a first amino acid or nucleic
acid sequence for optimal alignment with a second amino acid or
nucleic acid sequence). The amino acid residues or nucleotides at
corresponding amino acid positions or nucleotide positions are then
compared. When a position in the first sequence is occupied by the
same amino acid residue or nucleotide as the corresponding position
in the second sequence, then the molecules are identical at that
position. The percent identity between the two sequences is a
function of the number of identical positions shared by the
sequences (i.e., % identity=number of identical overlapping
positions/total number of positions.times.100%). In one embodiment,
the two sequences are the same length. The determination of percent
identity between two sequences can also be accomplished using a
mathematical algorithm. A preferred, non-limiting example of a
mathematical algorithm utilized for the comparison of two sequences
is the algorithm of Karlin and Altschul, 1990, Proc. Natl. Acad.
Sci. U.S.A. 87:2264-2268, modified as in Karlin and Altschul, 1993,
Proc. Natl. Acad. Sci. U.S.A. 90:5873-5877. Such an algorithm is
incorporated into the NBLAST and XBLAST programs of Altschul et
al., 1990, J. Mol. Biol. 215:403. BLAST nucleotide searches can be
performed with the NBLAST nucleotide program parameters set, e.g.,
for score=100, wordlength=12 to obtain nucleotide sequences
homologous to a nucleic acid molecules of the present application.
BLAST protein searches can be performed with the XBLAST program
parameters set, e.g., to score-50, wordlength=3 to obtain amino
acid sequences homologous to a protein molecule described herein.
To obtain gapped alignments for comparison purposes, Gapped BLAST
can be utilized as described in Altschul et al., 1997, Nucleic
Acids Res. 25:3389-3402. Alternatively, PSI-BLAST can be used to
perform an iterated search which detects distant relationships
between molecules (Id.). When utilizing BLAST, Gapped BLAST, and
PSI-Blast programs, the default parameters of the respective
programs (e.g., of XBLAST and NBLAST) can be used (see, e.g., the
NCBI website). The percent identity between two sequences can be
determined using techniques similar to those described above, with
or without allowing gaps. In calculating percent identity,
typically only exact matches are counted. In an embodiment, the
isolated nucleic acids are useful as primers.
[0075] The term "isolated" as used herein refers to a component
(e.g. polypeptide, nucleic acid, recombinant cell, induced cell)
hat has been removed and separated from a mixed or heterogeneous
milieu comprising the component. For example with respect to a
polypeptide, the term "isolated polypeptide" refers to a
proteinaceous agent, such as a peptide, polypeptide or protein,
which is substantially free of cellular material or culture medium
when produced recombinantly, or chemical precursors, or other
chemicals, when chemically synthesized. The term "polypeptide" as
used herein refers to a polymer consisting a number of amino acid
residues bonded together in a chain and can include polymers
comprising naturally occurring amino acids as well as modified
bases.
[0076] With respect to a nucleic acid means a polymer of A, G, T, C
and or modified residues, such as DNA, RNA and cDNA substantially
free of cellular material or culture medium when produced by
recombinant DNA techniques, or chemical precursors, or other
chemicals when chemically synthesized. An "isolated nucleic acid"
is also substantially free of sequences which naturally flank the
nucleic acid (i.e. sequences located at the 5' and 3' ends of the
nucleic acid) from which the nucleic acid is derived. The term
"nucleic acid" is intended to include DNA and RNA and can be either
double stranded or single stranded.
[0077] With respect to an isolated population of cells refers to a
population of cells that has been removed and separated from a
mixed or heterogeneous population of cells. In some embodiments, an
isolated population is a substantially pure population of cells as
compared to the heterogeneous population from which the cells were
isolated or enriched from.
[0078] The term "Link N" as used herein means naturally occurring
16 amino acid peptide cleaved from Link protein by MMP and includes
human link N having sequence DHLSDNYTLDHDRAIH (SEQ ID NO:15) and
bovine Link N having sequence DHHSDNYTVDHDRVIH (SEQ ID NO:5). It is
produced in both articular and intervertebral discs and promotes
aggrecan/collagen synthesis by disc (NP and AF) and articular
cartilage (chondrocyte) cells.
[0079] There term "Link N fragment" as used herein means a
polypeptide comprising a peptide selected from i) DHX.sub.1SDNYT,
wherein X.sub.1 is L or H (SEQ ID NO:1); ii) a conservative variant
of i) or iii) a fragment of i) or ii); wherein the conservative
variant and/or fragment retains biological activity and the peptide
is 15 amino acids or less. The Link N fragment can for example be a
polypeptide having a sequence selected from any one of SEQ ID NOs
1-6, a conservative variant thereof and/or a fragment thereof that
retains biological activity.
[0080] The term "mesenchymal stem cell" or MSC as used herein
refers to a cell with the capacity, under different conditions, to
differentiate to more than one differentiated mesenchymal cell
type. MSC include induced mesenchymal stem cells and non-induced
stem cells.
[0081] The term "substantially pure", with respect to a particular
cell population, refers to a population of cells that is at least
about 65%, preferably at least about 75%, at least about 85%, more
preferably at least about 90%, and most preferably at least about
95% pure, with respect to the cells making up a total cell
population.
[0082] The term "subject" as used herein includes all members of
the animal kingdom including mammals, preferably humans.
[0083] The terms "treat", "treating", "treatment", etc., as applied
to an isolated cell, include subjecting the cell to any kind of
process or condition or performing any kind of manipulation or
procedure on the cell. As applied to a subject, the terms refer to
providing medical or surgical attention, care, or management to a
subject.
[0084] The term "treatment" as used herein as applied to a subject,
refers to an approach aimed at obtaining beneficial or desired
results, including clinical results and includes medical procedures
and applications including for example pharmaceutical
interventions, surgery, radiotherapy and naturopathic interventions
as well as test treatments for treating cartilage and/or disc
tissue pathologies. Beneficial or desired clinical results can
include, but are not limited to, alleviation or amelioration of one
or more symptoms or conditions, diminishment of extent of disease,
stabilized (i.e. not worsening) state of disease, preventing spread
of disease, delay or slowing of disease progression, amelioration
or palliation of the disease state, and remission (whether partial
or total), whether detectable or undetectable. Treatment can
include for example, administering the isolated Link N fragment
polypeptide to a subject or implanting cells or transplanting
tissue treated with the isolated Link N fragment polypeptide and/or
recombinant cell expressing said polypeptide. As used herein, the
terms "administering", "implanting" and "transplanting" are used
interchangeably in the context of delivering isolated polypeptides,
cells, tissues and/or products described herein into a subject, by
a method or route which results in at least partial localization of
the introduced cells at a desired site. The cells can be implanted
directly to a vertebrae or joint, or alternatively be administered
by any appropriate route which results in delivery to a desired
location in the subject.
[0085] In understanding the scope of the present disclosure, the
term "comprising" and its derivatives, as used herein, are intended
to be open ended terms that specify the presence of the stated
features, elements, components, groups, integers, and/or steps, but
do not exclude the presence of other unstated features, elements,
components, groups, integers and/or steps. The foregoing also
applies to words having similar meanings such as the terms,
"including", "having" and their derivatives.
[0086] The term "consisting" and its derivatives, as used herein,
are intended to be closed ended terms that specify the presence of
stated features, elements, components, groups, integers, and/or
steps, and also exclude the presence of other unstated features,
elements, components, groups, integers and/or steps.
[0087] Further, terms of degree such as "substantially", "about"
and "approximately" as used herein mean a reasonable amount of
deviation of the modified term such that the end result is not
significantly changed. These terms of degree should be construed as
including a deviation of at least .+-.5% of the modified term if
this deviation would not negate the meaning of the word it
modifies.
[0088] More specifically, the term "about" means plus or minus 0.1
to 50%, 5-50%, or 10-40%, 10-20%, 10%-15%, preferably 5-10%, most
preferably about 5% of the number to which reference is being
made
[0089] As used in this specification and the appended claims, the
singular forms "a", "an" and "the" include plural references unless
the content clearly dictates otherwise. Thus for example, a
composition containing "a compound" includes a mixture of two or
more compounds. It should also be noted that the term "or" is
generally employed in its sense including "and/or" unless the
content clearly dictates otherwise.
[0090] The definitions and embodiments described in particular
sections are intended to be applicable to other embodiments herein
described for which they are suitable as would be understood by a
person skilled in the art.
[0091] The recitation of numerical ranges by endpoints herein
includes all numbers and fractions subsumed within that range (e.g.
1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.90, 4, and 5). It is also to
be understood that all numbers and fractions thereof are presumed
to be modified by the term "about".
[0092] Further, the definitions and embodiments described are
intended to be applicable to other embodiments herein described for
which they are suitable as would be understood by a person skilled
in the art. For example, in the passages herein, different aspects
of the invention are defined in more detail. Each aspect so defined
can be combined with any other aspect or aspects unless clearly
indicated to the contrary. In particular, any feature indicated as
being preferred or advantageous can be combined with any other
feature or features indicated as being preferred or
advantageous.
[0093] Further, the definitions and embodiments described in
particular sections are intended to be applicable to other
embodiments herein described for which they are suitable as would
be understood by a person skilled in the art. For example, in the
following passages, different aspects of the invention are defined
in more detail. Each aspect so defined may be combined with any
other aspect or aspects unless clearly indicated to the contrary.
In particular, any feature indicated as being preferred or
advantageous may be combined with any other feature or features
indicated as being preferred or advantageous.
III. Methods and Products
[0094] As described herein, it has been found that a fragment of
Link N comprising the first 8 amino acids induces and restores
extracellular proteoglycan levels in organ cultures and further
induces proteoglycan and collagen II synthesis is disc cells and
cartilage cells, including in an inflammatory milieu. For example,
as demonstrated in Example 3 the GAG content significantly
increased compared to the control when osteoarthritic explants were
treated with Link N in the presence of IL-1.beta.. Western blot
analysis revealed that this also led to a decrease in the
quantities of the active form of MMP-13 when compared to IL-1.beta.
alone. The quantity of extractable type II collagen was also
increased when explants from OA cartilage were treated with Link N,
in the presence of IL-1.beta.. Link N significantly inhibited
IL-1.beta. stimulated P-P65(NF-kB) in chondrocytes from normal and
OA patients.
[0095] Further it is demonstrated that bovine link N (BLN) also
induces proteoglycan and collagen II synthesis in disc cells as
does human link N (HLN).
[0096] Link N is a 16 amino acid peptide. Prior to the present
disclosure, it was not known whether fragments of Link N existed
and/or were active. For example Wang et al (33) reported that a
link N fragment comprising the first, 12 amino acids of Link N did
not have activity.
[0097] An aspect includes an isolated polypeptide (referred to
herein as a Link N fragment or Link N fragment polypeptide)
comprising a peptide selected from:
TABLE-US-00002 (SEQ ID NO: 30) i)
DHX.sub.1X.sub.2X.sub.3X.sub.4X.sub.5X.sub.6;
[0098] wherein X.sub.1 is any amino acid, optionally L, H, R Q;
[0099] X.sub.2 is S or L; [0100] X.sub.3 is D, S or N; [0101]
X.sub.4 is N or D; [0102] X.sub.5 is Y or S; and/or [0103] X.sub.6
is T or Y;
[0104] ii) a conservative variant of i); and/or
[0105] iii) a fragment of i) and/or ii);
wherein the conservative variant and/or fragment retains biological
activity and the peptide is 15 or less amino acids.
[0106] Examples of Link N sequences are provided in Example 10. In
an embodiment, Link N fragment polypeptides include sequences
described or based on the conservation motif determinable from the
sequences described in Example 10.
[0107] In an embodiment, the isolated polypeptide comprises a
peptide consisting of DHX.sub.1SX.sub.3 NYT (SEQ ID NO:31); wherein
X.sub.1 is any amino acid, optionally L, H, R Q; and/or X.sub.3 is
D, S or N; a conservative variant thereof and/or a fragment
thereof; wherein the conservative variant and/or fragment retains
biological activity and the peptide is 15 or less amino acids.
[0108] In an embodiment the isolated polypeptide (referred to
herein as a Link N fragment or Link N fragment polypeptide)
comprising a peptide selected from
[0109] i) DHX.sub.1SDNYT, wherein X.sub.1 is L or H (SEQ ID
NO:1);
[0110] ii) a conservative variant of i); and
[0111] iii) a fragment of i) and/or ii);
wherein the conservative variant and/or fragment retains biological
activity and the peptide is 15 or less amino acids.
[0112] The conservative variant b) can for example comprise one or
more conservative variant substitutions.
[0113] In an embodiment the biological activity is binding BMP
receptor type II and/or activation of SMAD 1/5 activity.
[0114] In an embodiment, the encompassed conservative variant
polypeptides are those that binds BMP receptor II and activates
SMAD1/5 activity compared to scrambled or reverse Link N.
[0115] The fragment c) can for example be 4 amino acids, 5 amino
acids, 6, amino acids or 7 amino acids of SEQ ID NO:1, 2, 3, 4 or
5. The fragment can comprise the N terminal most amino acids or the
C terminal most amino acids.
[0116] For example, smaller fragments can be tested for activity as
described for example in Example 9.
[0117] In an embodiment, the fragment binds BMP receptor II and
activates SMAD1/5 activity compared to scrambled or reverse Link
N.
[0118] BMP receptor type II binding and/or SMAD activation can be
assessed for example as described in the literature for example in
Wang et al (33).
[0119] In an embodiment, the peptide consists of DHX.sub.1SDNYT
(SEQ ID NO:1); wherein X.sub.1 is L or H or a conservative variant
thereof that retains biological activity.
[0120] In another embodiment, the isolated polypeptide comprises a
peptide sequence consisting of DHLSDNYT (SEQ ID NO:2) or a
conservative variant thereof that retains biological activity.
[0121] In another embodiment, the isolated polypeptide comprises a
peptide sequence consisting of DHHSDNYT (SEQ ID NO:3) or a
conservative variant thereof that retains biological activity. In
an embodiment, the isolated polypeptide comprises a peptide
consisting of DHLSDNYT (SEQ ID NO:2) or DHHSDNYT (SEQ ID NO:3).
[0122] Larger fragments include up to 15 amino acids of Link N
(e.g. human or bovine Link N). In an embodiment, the peptide is 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 amino acids.
[0123] Accordingly in an embodiment, the isolated polypeptide
comprises a peptide selected from:
TABLE-US-00003 (SEQ ID NO: 6) i)
DHX.sub.1X.sub.2X.sub.3X.sub.4X.sub.5X.sub.6X.sub.7X.sub.8X.sub.9DX.su-
b.10X.sub.11X.sub.12, X.sub.13,
[0124] wherein X.sub.1 is any amino acid, optionally L, H, R Q;
[0125] X.sub.2 is S or L; [0126] X.sub.3 is D, S or N; [0127]
X.sub.4 is N or D: [0128] X.sub.5 is Y or S; [0129] X.sub.6 is T or
Y; [0130] X.sub.7 is L V or T; [0131] X.sub.8 is any amino acid,
optionally D G, N or P; [0132] X.sub.9 is H Y or P; [0133] X.sub.10
is R or Q; [0134] X.sub.11 is A V or D; [0135] X.sub.12 is I or R;
and/or [0136] X.sub.13 is H or V;
[0137] ii) a conservative variant of i); and/or
[0138] iii) a fragment of i) and/or ii);
wherein the conservative variant and/or fragment retains biological
activity and wherein the peptide is 15 amino acids or less and one
or more consecutive C terminal and/or N terminal residues are
deleted.
[0139] In an embodiment the isolated polypeptide comprises a
peptide selected from:
[0140] i) DHX.sub.1SX.sub.3 NYTX.sub.7X.sub.8 HDRVIH (SEQ ID NO: 7)
or DHX.sub.1SDNYTX7DHDRX12I (SEQ ID NO: 8); wherein X.sub.1 is L or
H, X.sub.7 is L or V and/or X12 is A or V;
[0141] ii) a conservative variant of i); and
[0142] iii) a fragment of i) and/or ii);
wherein the conservative variant and/or fragment retains biological
activity.
[0143] In another embodiment, the isolated polypeptide comprises
the sequence DHLSDNYTLDHDRAI (SEQ ID NO: 9) or a conservative
variant and/or fragment thereof that retains biological
activity.
[0144] In another embodiment, the isolated polypeptide comprises
the sequence DHHSDNYTVDHDRVI (SEQ ID NO: 10) or a conservative
variant and/or fragment thereof that retains biological
activity.
[0145] It is demonstrated herein that bovine Link N and human Link
N which share 81% sequence identity both have biological activity.
Accordingly, in an embodiment, the isolated polypeptide comprises a
peptide that has at least 80%, 85%, 90%, 95% sequence identity to
SEQ ID NO: 1, 2, 3, 4, 5 or 6. In an embodiment, residues
corresponding to X.sub.1, X.sub.2 and/or X.sub.3 of SEQ ID NO: 4
are modified.
[0146] In an embodiment the fragment is 4 amino acids, 5 amino
acids, 6, amino acids, 7 amino acids, 8 amino acids, 9 amino acids,
10 amino acids, 11 amino acids, 12 amino acids, 13 amino acids, 14
amino acids or 15 amino acids of SEQ ID NO: 4, 5 or 6. The fragment
can comprise the N terminal most amino acids or the C terminal most
amino acids.
[0147] In an embodiment, the fragment binds BMP receptor II and
activates SMAD1/5 activity compared to scrambled or reverse Link
N.
[0148] In an embodiment, the isolated peptide is conjugated to a
solid support, optionally a gel type support such as solvated
polymers with a distribution of functional groups, for example,
polystyrene: Styrene cross-linked with 1-2% divinylbenzene;
[0149] Polyacrylamide: A hydrophilic alternative to polystyrene;
Polyethylene glycol (PEG): PEG-Polystyrene (PEG-PS). In an
embodiment the solid support is a PEG-based supports for example
composed of a PEG-polypropylene glycol network or PEG with
polyamide or polystyrene. In an embodiment, the solid support is a
surface-type support including for example controlled pore glass,
cellulose fibers, and highly cross-linked polystyrene. In an
embodiment, the solid support is a composite for example a gel-type
polymer supported by rigid matrix.
[0150] In an embodiment, the isolated polypeptide comprises one or
more protected groups. In an embodiment, the isolated polypeptide
has a N-terminal protecting group. In an embodiment, the isolated
polypeptide has a C-terminal protecting group. In an embodiment,
the isolated polypeptide has a side change protecting group.
[0151] In an embodiment, the isolated peptide comprises a N
protected group.
[0152] In an embodiment, the isolated polypeptide comprises a Fmoc
protecting group. In an embodiment, the isolated polypeptide
comprises a t-Boc protecting group. Fmoc. In an embodiment, the
protecting group is a Benzylozy carbonyl (Z) group. In an
embodiment, the isolated polypeptide has an alloc protecting group.
In another embodiment, the isolated polypeptide has a lithographic
protecting group.
[0153] In an embodiment, the isolated polypeptide is configured or
comprised in a dendrimer. In an embodiment, the dendrimer comprises
at least 2, at least 3 at least 4 or more isolated polypeptides
described herein conjugated to a dendrimer scaffold. In an
embodiment the dendrimer scaffold is a poly lysine scaffold.
[0154] In an embodiment the isolated polypeptide is conjugated to a
carrier moiety such as PEG or albumin, a bead.
[0155] In an embodiment, the peptide is conjugated to an activity
moiety selected from a homing moiety, a stabilizing moiety, a
protection moiety and an administration moiety, optionally wherein
the activity moiety is proteinaceous.
[0156] For example, a stabilizing moiety can be a protein sequence
of amino acids that resists natural degradation and/or protein
turnover such as an immunoglobulin Fc portion, albumin and the like
optionally wherein the moiety conjugated to the N and/or C terminus
of the isolated peptide.
[0157] In an embodiment the isolated polypeptide is conjugated to a
detectable or purification tag, for example a moiety such as a
peptide sequence that can be appended or introduced into
recombinant protein and is useful for detecting its expression or
purifying the polypeptide. In an embodiment, the purification tag
is conjugated to the isolated peptide via a linker that comprises a
proteolytic cleavage site.
[0158] In an embodiment, the isolated peptide is comprised in a
liposome or nanoparticle. In an embodiment, the liposome is a slow
release liposome. In an embodiment the liposome is a pegylated
liposome.
[0159] A further aspect is an isolated nucleic acid that encodes
the isolated Link N fragment polypeptide described herein. The
isolated nucleic acid can be naked or comprised in a vector. Also
provided in an embodiment is nucleic acid that hybridizes to a
nucleic acid that encodes the isolated Link N fragment polypeptide
described herein. In an embodiment, the nucleic acid is codon
optimized.
[0160] Accordingly a further aspect includes a vector comprising
the isolated nucleic acid and/or isolated polypeptide described
herein. Vectors can include retroviral vectors, adenoviral vectors
and DNA virus vectors for nucleic acids and liposomes or
nanoparticles for polypeptides. In an embodiment, the vector is a
liposome or nanoparticle. In an embodiment, the liposome is a slow
release liposome
[0161] The isolated polypeptide and/or nucleic acid can be made
using recombinant techniques, and or synthesized synthetically.
[0162] In an embodiment, the isolated polypeptide is produced
synthetically and is unglycosylated or differentially glycosylated
compared to human in vivo expressed polypeptide.
[0163] In an embodiment, the isolated polypeptide is cyclized. In
an embodiment, the isolated polypeptide comprises one or more D
amino acids or more or more L amino acids.
[0164] A further aspect includes a recombinant cell expressing the
isolated Link N fragment polypeptide described herein and/or
comprising the isolated nucleic acid or vector described
herein.
[0165] A variety of recombinant cells can be made expressing the
Link N fragments of the disclosure. For example a cell can be
transformed, transfected or transduced with a vector comprising a
nucleic acid encoding a Link N fragment of the application.
[0166] In an embodiment, the cell is a chondrocyte lineage cell, a
stem cell or a disc cell, optionally wherein the stem cell is a
mesenchymal stem cell. In an embodiment, the recombinant cell is
for therapeutic use.
[0167] A further aspect is a composition comprising the isolated
polypeptide described herein and optionally a carrier or
diluent.
[0168] Also provided in another aspect is a composition comprising
the isolated nucleic acid, vector, or recombinant cell described
herein.
[0169] In an embodiment, the diluent is a physiological buffer,
optionally a sterile physiological buffer.
[0170] In an embodiment, the composition is a pharmaceutical
composition comprising a pharmaceutically acceptable carrier or
diluent.
[0171] The isolated polypeptide, isolated nucleic acid, vector,
recombinant cell can optionally by lyophilized, or in a liquid, gel
or solid composition.
[0172] The composition can be a lyophilized powder or aqueous or
non-aqueous solution or suspensions, which may further contain
antioxidants, buffers, bacteriostats and solutes. Other components
that may be present in such compositions include water, surfactants
(such as Tween), alcohols, polyols, glycerin and vegetable oils,
for example.
[0173] Suitable diluents for nucleic acids include but are not
limited to water, saline solutions and ethanol.
[0174] Suitable diluents for polypeptides, and/or cells include but
are not limited to saline solutions, pH buffered solutions and
glycerol solutions or other solutions suitable for freezing
polypeptides and/or cells.
[0175] The composition can further comprise stabilizing agents, for
example reducing agents, hydrophobic additives, and protease
inhibitors which are added to physiological buffers.
[0176] In an embodiment, the composition comprises a scaffold
formed of a biocompatible material comprising the isolated
polypeptide, recombinant cell and/or composition described
herein.
[0177] In an embodiment, the biocompatible material is selected
from an alginate agarose, chitosan, Polycaprolacton and/or
hyaluronic acid (or hyaluronate) based biomaterial. Generic
scaffolds for chondrocytes and/or IVD cells can also be used.
[0178] In embodiment, the scaffold is formed into a hydrogel,
microsphere, microcapsule, sponge, foam or fiber.
[0179] In an embodiment, the composition is for preparing a
cartilage or disc cell for transplant into a subject, the
composition comprising an isolated polypeptide and/or recombinant
cell described herein, a cartilage and/or disc cell and a carrier
or diluent, wherein the cartilage and/or disc cell is exposed to an
effective amount of said isolated polypeptide and/or recombinant
cell sufficient to induce the cartilage cell and/or disc cell to
increase proteoglycan and/or collagen II synthesis. The composition
and/or cells of the composition can be isolated and used for
example for treating a tissue pathology in a subject upon
administration of the composition to the subject.
[0180] In an embodiment, the pharmaceutical composition is for use
in the treatment of a cartilage or disc tissue pathology in a
subject, the composition comprising an isolated polypeptide and/or
recombinant cell described herein, a cartilage and/or disc cell and
a pharmaceutically acceptable carrier or diluent, wherein the
treatment comprises exposing the cartilage and/or disc cell to an
effective amount of said isolated polypeptide and/or recombinant
cell sufficient to induce the cartilage cell and/or disc cell to
increase proteoglycan and/or collagen II synthesis for treating the
tissue pathology in the subject upon administration of the
composition to the subject.
[0181] In an embodiment, the composition (including the
pharmaceutical composition) comprises a scaffold formed of a
biocompatible material, and wherein the cartilage and/or disc cell
is disposed on or in the scaffold.
[0182] In an embodiment, the composition comprising the cartilage
and/or disc cell is cultured for at least 1 day, at least 2 days at
least 3 days, at least 4 days or at least 5 days prior to
administration.
[0183] Another aspect includes a method of inducing matrix
synthesis optionally proteoglycan synthesis and/or collagen II
synthesis in a cartilage and/or disc cell or in a tissue comprising
a cartilage and/or disc cell the method comprising incubating the
cartilage and/or disc cell with an effective amount of the isolated
polypeptide, recombinant cell expressing said isolated polypeptide
and/or composition as described herein, under conditions to induce
proteoglycan synthesis, producing an induced cartilage and/or disc
cell with increased matrix synthesis.
[0184] Matrix synthesis can be measured for example by assessing
proteoglycan and/or collagen II synthesis as described in the
Examples.
[0185] In an embodiment the method is conducted in vitro in a cell
culture, optionally a disc organ culture, to produce a cell or
tissue with increased matrix synthesis.
[0186] In an embodiment, the cell and/or tissue is contacted under
conditions to produce cartilage, optionally for use in cartilage
transplantation.
[0187] In an embodiment, the cartilage cell is a chondrocyte. In an
embodiment, the disc cell is an AP cell optionally an iAP cell. In
another embodiment, the disc cell is a NP cell. In a further
embodiment, a mixed population of cells is used e.g. comprising AP
and NP. In an embodiment, the tissue comprises cartilage lineage
cells. In an embodiment, the tissue comprises AP and/or NP lineage
cells.
[0188] In an embodiment, the recombinant cell is a MSC expressing
an isolated polypeptide described herein.
[0189] In an embodiment, the cartilage cell, disc cell and/or
tissue is in a subject and the contacting is conducted by
administering to the subject an isolated polypeptide, a recombinant
cell or a composition of claim 14 or 15, described herein.
[0190] In an embodiment, the induced cartilage and/or disc cell is
introduced into the subject.
[0191] In an embodiment, the cartilage cell and/or disc cell is an
autologous cell that is treated in vitro. For example, in
mosaicplasty small often circular (4-8 mm) autogenous grafts are
taken for example from non-weight bearing regions of the knee. In
an embodiment, Link N is injected or administered before taking
and/or when reintroducing the autogenous graft to try to promote
repair. For example this may help repair the harvest site and/or
treating the implantation site may promote repair around the graft
and where the graft was taken from.
[0192] Another aspect includes a method of producing cartilage
and/or disc tissue for implanting into a subject, the method
comprising incubating/cultured the cartilage and/or disc cell with
an effective amount of the isolated polypeptide, recombinant cell
expressing said isolated polypeptide and/or composition as
described herein, under conditions to induce proteoglycan
synthesis, producing an induced cartilage and/or disc cell with
increased matrix synthesis, optionally increased proteoglycan
synthesis; and isolating a substantially pure population of induced
cartilage and/or disc cells.
[0193] In an embodiment, the matrix comprises a cartilaginous
matrix. In an embodiment, the cartilaginous matrix comprises
proteoglycan and/or collagen, for example collagen II.
[0194] In an embodiment the proteoglycan synthesis is aggrecan.
[0195] In an embodiment, the cartilage and/or disc cell is in
cultured in a 3D culture comprising a scaffold, such as an alginate
scaffold for example as described in the Examples.
[0196] In an embodiment the induced cartilage and/or disc cell is
implanted into a subject.
[0197] In an embodiment approximately 0.5 micrograms/mL is for
example used in a cell culture and/or for administration. In
another embodiment, about 0.5 micrograms/mL to about 10 mg/ml is
used, optionally about 10 micrograms/mL. about 100 micrograms/mL,
about 1000 micrograms/mL, about 2 mgrams/mL, about 3 mgrams/mL,
about 4 mgrams/mL, about 5 mgrams/mL, about 6 mgrams/ml, about 7
mgrams/mL, about 8 mgrams/mL about 9 mgrams/mL or about 10
mgrams/mL. In an embodiment, the dose is any 10 microgram/mL
increment of 0.5 micrograms up to about 10 mgs. In an embodiment,
the amount is weight/volume. In an embodiment, per injection amount
is administered. For example, in an embodiment, up to or about 1 mg
is injected per lumbar disc or up to 1 mg is introduced per
joint.
[0198] A further aspect includes a method of alleviating a symptom
associated with--and/or treating--a cartilage and/or disc tissue
pathology comprising administering to a subject in need thereof an
isolated polypeptide, a recombinant cell, induced cartilage and/or
disc cell and/or a pharmaceutical composition described herein.
[0199] In an embodiment, the symptom is pain. As demonstrated in
FIGS. 27-30 NGF expression in IVD increases with degeneration in
both NP and AF cells and Link N can suppress the TNF alpha induced
gene expression of neurotrophins (NGF, BDNF) and Substance P (TAC1)
in AF cells. FIG. 29 demonstrates that Link N suppresses IL-1beta
induced expression of neurotrophins (NGF, BDNF) and substance P
(TAC1) in AF cells. Neurotrophins, and substance P are mediators of
pain.
[0200] In an embodiment, the cartilage and/or disc tissue pathology
is intervertebral disc degeneration. In an embodiment, the
intervertebral disc degeneration is early stage. For example early
stage disc degeneration includes Thompson grade 1, 2 and/or 3
degeneration, or optionally while the AF is substantially intact
for example as determinable upon imaging such as MRI. Late stage
disc degeneration can include for example Thompson grade 4,
Thompson grade 5 or greater degeneration and/or where fusion has
taken place. For example the products and methods described herein
can be used to treat and/or prevent adjacent disc degeneration
after fusion.
[0201] Sensitive and/or quantitative MRI methods can be used for
selecting subjects suitable for receiving a treatment described
herein. In an embodiment, the treatment is administered
prophylactically, e.g. after detectable degeneration but before
painful degenerate disc to repair and/or retard degeneration.
[0202] In an embodiment, the subject has decreased cell density
and/or metabolic activity, optionally wherein the decreased cell
density and/or metabolic activity is due to age.
[0203] In an embodiment, the cartilage and/or disc tissue pathology
is an inflammatory or degenerative joint disease selected from
arthritis, undesirable osteogenesis and/or calcification.
[0204] In an embodiment, the arthritis is osteoarthritis.
[0205] In another embodiment, the arthritis is rheumatoid
arthritis.
[0206] In an embodiment, the cartilage and/or disc tissue pathology
is osteoporosis.
[0207] In an embodiment, the cartilage and/or disc tissue is
osteolysis.
[0208] In an embodiment, the cartilage and/or disc tissue pathology
is a mechanical injury.
[0209] In an embodiment, the subject is a mammal optionally
selected from a human, horse, cow, goat or dog. In an embodiment,
the subject is human.
[0210] It has been shown that loss of BMP receptor II expression
causes endothelial inflammation and atherosclerosis is a mouse
model. Link N has been shown to bind BMP type II receptor and is
shown herein to inhibit NFkappaB activation. Accordingly a further
aspect is a method of alleviating a symptom and/or treating a
subject with endothelial inflammation and/or atherosclerosis
comprising administering to a subject in need thereof an isolated
Link N fragment polypeptide, a recombinant cell, induced cartilage
and/or disc cell and/or a pharmaceutical composition described
herein.
[0211] In an embodiment, the isolated polypeptide, recombinant cell
and/or pharmaceutical composition is administered to the subject in
a scaffold.
[0212] The isolated Link N polypeptide, recombinant cell, induced
cell or pharmaceutical composition can be administered to the
subject percutaneously and/or near or at the site of tissue
pathology. For disc tissue pathologies, the isolated Link N
fragment polypeptide, recombinant cell and/or induced cells can be
administered, implanted or transplanted into a subject by
intradiscal injection for example, injection into the NP, the AF,
optionally the inner AF. For joint pathologies, the isolated Link N
fragment polypeptide, recombinant cell and/or induced cells can be
administered, implanted or transplanted into a subject by injecting
into the affected region. In some embodiments, autologous cells
and/or tissues for example as done in mosaicplasty are excised,
treated as described and re-implanted.
[0213] In an embodiment, the isolated Link N fragment polypeptide,
recombinant cell and/or induced cells can be administered,
implanted or transplanted into a subject by injecting into synovial
fluid. In an embodiment, where the subject has a implant scaffold
for example to repair lesions, the administration can proceed by
injection/introduction into the embedded implant scaffold.
[0214] In an embodiment, an existing ex vivo scaffold comprising
chondrocytes and/or MSC and/or induced cells can be further
impregnated with isolated Link N polypeptides, compositions
comprising Link N fragment products described herein. The scaffold
can then be injected into a subject in need thereof.
[0215] Disc and cartilage repair can be enhanced by mesenchymal MSC
and Link N supplementation to maximize extracellular matrix
production.
[0216] In an embodiment, the isolated Link N fragment polypeptide,
recombinant cell induced cell and/or composition comprising one or
more of the foregoing is used to repair a disc lesion. Natural disc
degeneration can involve the creation of fissures. To repair such
lesions, Link N fragments and stem cells can be implanted in a
polymerizable scaffold that will fill the lesions and allow uniform
distribution of the introduced agents.
[0217] In a further embodiment, the isolated polypeptide or
pharmaceutical composition comprising the isolated polypeptide is
administered in a combination therapy.
[0218] In an embodiment, the subject has received an implant,
optionally treated as described herein or untreated. The subject is
for example administered an isolated polypeptide described herein
to increase proteoglycan production.
[0219] In an embodiment, the method further comprises contacting
the cell or tissue with or administering to the subject, MSC in
combination with an isolated polypeptide, recombinant cell or
composition described herein.
[0220] The above disclosure generally describes the present
application. A more complete understanding can be obtained by
reference to the following specific examples. These examples are
described solely for the purpose of illustration and are not
intended to limit the scope of the application. Changes in form and
substitution of equivalents are contemplated as circumstances might
suggest or render expedient. Although specific terms have been
employed herein, such terms are intended in a descriptive sense and
not for purposes of limitation.
[0221] The following non-limiting examples are illustrative of the
present disclosure:
EXAMPLES
Example 1
[0222] Presently, there are no established treatments to prevent,
stop or even retard back pain arising from disc degeneration.
Previous studies have shown that Link N can act as a growth factor
and stimulate the synthesis of proteoglycans and collagens, in IVD.
However, the sequences in Link N involved in modulating cellular
activity are not well understood. To determine if disc cells can
proteolytically process Link N, human disc cells were exposed to
native Link N over a 48 h period and as described further below,
mass spectrometric analysis revealed that a peptide spanning
residues 1 to 8 was generated in the presence of AF cells but not
NP cells. Link N 1-8 significantly induced proteoglycan production
in the presence of IL-1.beta. NP and AF cells, confirming that the
biological effect is maintained in the first 8 amino acids of the
peptide and indicating that the effect is sustained in an
inflammatory environment.
[0223] The unique effects of Link N in modulating cellular activity
suggest a sequence and/or motif specific interaction. However, it
is less clear if Link N is stable in a biological system. The fate
of Link N in a biological system was also studied.
Method and Materials
Materials
[0224] Pronase was from Calbiochem (Darmstadt, Germany).
Collagenase 1A, GlutaMAX, NaCl and formic acid were purchased from
Sigma (St. Louis, Mo., USA). Low viscosity alginate (Keltone LV)
was obtained from Kelco Chemical Co. (San Diego, Calif., USA).
Penicillin/streptomycin, gentamicin sulphate, amphotericin B,
Dulbecco's Modified Eagle Medium (DMEM) and foetal calf serum (FCS)
were obtained from Gibco (Burlington, ON, Canada). 20 G 11/2 inch
needles to make alginate beads were obtained from BD syringes,
(Concord, ON, Canada). HPLC grade acetonitrile was purchased from
Rathburn (Walkerburn, Scotland). Trypsin Gold mass spectrometry
grade was purchased from Promega (Madison, Wis., USA). TopSert,
TPX-Short Thread-Vial, 32.times.11.6 mm with integrated 0.2 mL
Glass-Micro-Insert, 15 mm top were purchased from Skandinaviska
GeneTec AB (Vastra Frolunda, Sweden). Vydac UltraMicro Spin.RTM.
Silica C18 300 .ANG. columns were purchased from The Nest Group
(Southborough, Mass., USA). Sequencing grade chymotrypsin was
purchased from Roche Diagnostics GmbH (Mannheim, Germany).
.sup.35SO.sub.4, 2 mCi, stabilized aqueous solution was ordered
from Perkin Elmer (Montreal, Quebec, Canada). NUNC 6 well culture
plates were purchased from Corning Inc. (Edmonton, Alberta,
Canada). MMPs 3, 7, 12, 13, ADAMTS 4,5, were from R&D Systems
(Minneapolis, Minn.). HTRA1 from Thermo Scientific (Waltham,
Mass.). Cathepsins K, B, and L were provided.
Link-N Peptide
[0225] Link N, DHLSDNYTLDHDRAIH (SEQ ID NO: 15); reverse Link N,
HIARDHDLTYNDSLHD (R-Link N) (SEQ ID NO: 16), scrambled Link N,
DLNRAHLHIDYHTDSD (S-Link N) (SEQ ID NO:17), Link-N first 8 peptide
residues, DHLSDNYT (Link N 1-8) (SEQ ID NO:2), and second 8 peptide
residues, LDHDRAIH (Link N 9-16) (SEQ ID NO: 18), were synthesized
by CanPeptide (Pointe Claire, QC, Canada). The scrambled 16 amino
acid peptide sequence was designed using a bioinformatics tool from
Institut Pasteur, Paris, France (http://mobyle.pasteur.fr). The
sequence was selected to mimic the overall properties of Link N,
such as isoelectric point and solubility of the original peptide.
Stock solutions (10 mg/mL) of the peptides were prepared in DMEM,
supplemented with HEPES and pH was adjusted to 7.4 before use.
Source of Tissues
[0226] Human thoracolumbar spines were retrieved through the
Transplant Quebec organ donation program. Discs were obtained from
7 donors, 1 male and 6 female, with a mean age of 29.6 years and an
age range of 16 to 47 years (Table 1). Donors having had recent
chemotherapy, radiation therapies to the spine, or significant
long-standing paralysis were excluded from the study. Spine
retrieval was performed within 8 h of death. Discs with
calcification and loss of disc height were not included in the
study. All procedures were approved by the institutional review
board of the Montreal General Hospital.
[0227] Bovine tails from 18-27 months old steers were obtained from
a local abattoir within 6 h of slaughter.
Isolation of Human and Bovine IVD Cells
[0228] Human and bovine IVDs were separated from the adjoining
vertebral body and divided into NP and AF for bovine IVDs and NP
and inner annulus fibrosus (iAF) for human IVDs. Tissue from the
human outer annulus fibrosus (oAF) was not used for cell isolation
in this study. Cells were enzymatically isolated from each region
as previously described (63). Briefly, NP and AF tissues were
dissected into approximately 2-mm thick pieces, washed twice in PBS
containing 50 .mu.g/mL gentamicin, 100 ug/mL penicillin, 100 U
streptomycin and 0.25 .mu.g/mL fungizone, then digested with 0.2%
pronase for 1 h, followed by collagenase type IA at 0.01% for NP
and 0.04% for AF tissue for 4 h in serum free DMEM.
Monolayer Cultures of Human IVD Cells
[0229] To evaluate the stability of Link N, freshly isolated human
cells from NP and AF regions were plated in 6 well culture plates
at a density of 250,000 cells per well. Cells were cultured at
37.degree. C., 5% CO.sub.2 in 3 mL DMEM, containing 4.5 g/L glucose
and supplemented with 10% FCS, 25 mmol/L HEPES, 50 .mu.g/mL
gentamicin sulphate, 0.25 .mu.g/mL fungizone, 50 .mu.g/mL
L-ascorbate, and 2 mmol/L GlutaMAX. The wells were left for 2 days
before exposure to Link-N (1 .mu.g/mL). 200 .mu.L medium was
collected at fixed time points (0 h, 6 h, 12 h, 24 h, 36 h, and 48
h). Stability of the peptide was also studied at the same time
points in the absence of cells.
Proteinase Treatment of Link N
[0230] 300 .mu.g Link N 1-16 was incubated for 30 minutes, 2 and 24
hours in the presence of 10 different proteinases. The buffer used
for MMPs 3, 7, 12, 13, ADAMTS 4,5, HTRA1 was composed of 50 mM
Tris-HCl, 200 mM NaCl, 5 mM CaCl.sub.2), 0.01% Rapigest. For
cathepsins K, B, and L, the digest buffer was composed of 2.5 mM
DTT, 0.15% chondroitin sulfate A, 0.1 M sodium acetate, pH 5.5.
Mass Spectrometry
[0231] 25 .mu.L medium samples, collected from the monolayer
cultures described above or peptide digests were purified on C18
spin columns according to standard protocols (Harvard Apparatus,
Holliston, Mass.). Eluted peptides were reconstituted in 20 .mu.L,
2% acetonitrile and 0.2% formic acid (FA). Samples were injected
and quantified using a triple quadropole mass spectrometer TSQ
Vantage.TM. (Thermo Scientific, Waltham, Mass.) equipped with an
easy nano-LC system (Thermo Scientific). The mass spectrometer was
operated in SRM mode, with both Q1 and Q3 settings at unit
resolution (FWHM 0.7 Da). A spray voltage of +1,700 V was used with
a heated ion transfer setting of 270.degree. C. for desolvation.
Data were acquired using the Xcalibur software (version 2.1).
Mobile phases used were A (0.1% FA in water) and B (100%
acetonitrile in 0.1% FA). Separation was performed on 10 .mu.m tip,
75 .mu.m.times.15 cm capillary columns (PicoTip.TM. emitter, New
Objective, Woburn, Mass.) packed with Reprosil-Pur C18-AQ resin (3
.mu.m, Dr. Maich GmbH, Switzerland). 1 .mu.L sample was injected
and separation was performed at a flow rate of 300 nL/min using a
gradient of 97% mobile phase A for 5 min, 85% A for 8 min, 65% A
for 42 min, and 19% A for 45-50 min.
[0232] A multiple reaction monitoring method (MRM) for the Link N
peptides was developed, optimized and used with the sum peak area
from transitions, Link 1-16 transitions: 641.30(3+)-->863.41
(y7), 641.30-->748.38 (y6), 641.30-->611.33 (y5) and
641.30-->682.28 (b6), Link 1-8 transitions: 964.40
(1+)-->845.43 (b7)-->682.87 (b6)-->568.23 (b5)-->453.20
(b4)-->712.31 (y6)-->849.37 (y7), Link 9-16 transitions:
488.75 (2+)-->821.43 (b7)-->708.34 (b6)-->496.30
((y4)-->611.32 (y5)-->748.38 (y6). The MRM data was analysed
using the Skyline 1.4 software (MacCoss Lab Software, University of
Washington, Seattle, Wash.).
[0233] Discovery experiments were also run in order to identify any
fragmentation of the peptide by injection of 8 .mu.L sample onto a
reversed phase liquid chromatography system on-line with
electrospray-ion trap mass spectrometry (LC ESI MS), as previously
described (64).
Culture of IVD Cells in 3D Scaffolds
[0234] To compare the metabolic response to the various Link N
peptides, freshly isolated human and bovine cells from NP and AF
regions were embedded in 1.2% alginate beads, as previously
described (65). Cells in alginate beads were cultured at 37.degree.
C., 5% CO.sub.2 in DMEM, containing 4.5 g/L glucose and
supplemented with 10% FCS, 25 mmol/L HEPES, 50 .mu.g/mL gentamicin
sulphate, 0.25 .mu.g/mL fungizone, 50 .mu.g/mL L-ascorbate, and 2
mmol/L GlutaMAX. The beads were stabilized for 7 days and cell
viability was assessed by Live/Dead.RTM. assay prior to further
treatment. 5 beads per well were then cultured in 48 well plates in
the presence of equimolar concentrations of either Link N (1
.mu.g/mL), R-Link N (1 .mu.g/mL), S-Link N (1 .mu.g/mL), Link N 1-8
(0.5 .mu.g/mL) or Link N 9-16 (0.5 .mu.g/mL) in 0.5 mL DMEM. 25
.mu.Ci/mL .sup.35SO.sub.4 was added to the medium to allow
assessment of proteoglycan synthesis (66). In addition, beads were
exposed for 48 h to IL-1.beta. (10 ng/mL) alone, or to a
combination of peptides and IL-1.beta. (51). At the end of the
culture period, medium was collected and dialyzed exhaustively
against miliQ water at 18.2.OMEGA. (Spectra/Por.RTM. 3), followed
by cold chase with 1M MgSO.sub.4 for 2 h to remove any remaining
unincorporated .sup.35SO.sub.4. The .sup.35SO.sub.4 incorporation
was measured using a beta scintillation counter (Beckman Coulter
LS6500, Beckman Coulter, Mississauga, Canada).
Statistical Analysis
[0235] One tailed paired t-test was performed and values 0.05 were
taken as significant.
Results
[0236] The 16 amino acid Link N peptide is known to induce
proteoglycan synthesis in isolated disc cells and intact human
discs, and also to increase disc height in a rabbit disc puncture
degeneration model (34, 31, 29). It is however not clear if the
effect is strictly sequence dependent or if it is attributed to the
overall properties of the peptide. Three variants of the peptide
were synthesized to address this, native (Link N), reversed (R-Link
N) and scrambled (S-Link N), and .sup.35SO.sub.4 incorporation was
used to assess proteoglycan synthesis in response to the peptides.
Bovine and human NP and AF cells were exposed to 1 .mu.g/mL of the
peptides for 48 h. Bovine cells showed a statistically significant
increase in proteoglycan synthesis in response to Link N (NP
p=0.03, AF p=0.03), but no effect was observed when the cells were
exposed to the reversed or scrambled peptides (FIG. 1a). Human
cells showed a similar trend, with a significant increase in
response to native Link N (NP p=0.008, AF p=0.02) and no response
to scrambled or reversed peptides, indicating a sequence specific
response (FIG. 1b). Both bovine and human AF cells showed a trend
towards a stronger response compared to NP cells.
[0237] Peptide stability or maintained activity is important in
order to ensure a sustained effect of treatment. Therefore, mass
spectrometric analysis was performed to evaluate the stability of
Link N in solution. Native Link N with a molecular mass of 1922 Da
was incubated at 37.degree. C. for 48 h in culture medium and the
intensity of the peptide was quantified up to 48 h using targeted
mass spectrometry. No loss of the 1922 Da Link N peptide was found
during this time period (FIG. 2), indicating that the peptide is
stable in solution at 37.degree. C.
[0238] Metabolically active cells have the potential to process
short peptides and thereby possibly alter their biological effect
(67-69). To determine if disc cells can proteolytically process
Link N, human disc cells in monolayer were exposed to native Link N
over a 48 h period and the peak area intensity of the 1922 Da
peptide was quantified in order to assess its fate. The peptide was
found to be stable for at least 48 h in the presence of NP cells
(FIG. 3a). However, a decrease in Link N was detected by 6 h in the
presence of AF cells, and only trace amounts were present after 48
h (FIG. 3b), demonstrating that AF cells have the ability to
process the Link N peptide.
[0239] To identify the processed products of Link N, the presence
of shorter peptides in a mass spectrum ranging from 0-1930 Da were
analyzed. It was apparent when comparing Link N containing medium
from NP and AF cells that a peptide with a mass of 964.4 Da was
accumulated in the AF cell culture medium (FIG. 4a). The same
peptide was present only in very low levels in the NP cell culture
medium (FIG. 4a). The 964.4 peptide eluted from the column at 2
different retention times. This phenomenon is sometimes observed
and is most likely due to peptide precipitation on the column
resulting from the high concentration. Two separate parts of the
native 16 amino acid Link N, representing amino acid 1-8 or 4-11,
could potentially generate a peptide of this mass (FIG. 4b). Tandem
mass spectrometry analysis confirmed that a peptide spanning
residues 1 to 8 was generated in the presence of AF cells, but no
trace of the peptide 9-16 was found (FIG. 4c).
[0240] Maintained activity of peptides designed for biological
treatment is of great importance and the processing of Link N by AF
cells could potentially alter its biological effect. To evaluate
this, two peptides corresponding to amino acid sequence 1-8 (Link N
1-8) and 9-16 (Link N 9-16) were synthesized and their effect on
proteoglycan synthesis was compared to that of native human Link N.
Proteoglycan synthesis was evaluated using .sup.35SO.sub.4
incorporation and bovine and human NP and AF cells were exposed to
equimolar concentrations of the peptides for 48 h. A statistically
significant increase in .sup.35SO.sub.4 incorporation of the same
magnitude as the native peptide was observed (NP p=0.006 and AF
p=0.007) when the bovine cells were exposed to Link N 1-8 alone,
however no effect was seen with Link N 9-16 (FIG. 5a). Human cells
showed a similar trend, with a significant increase in response to
Link 1-8 (NP p=0.004 and AF p=0.01), but no response to Link N
9-16, indicating that the biological effect is specific to a
sequence maintained in the first 8 amino acids of the peptide (FIG.
5b). Both bovine and human AF cells showed a stronger response
compared to NP cells.
[0241] To determine the proteinase responsible for cleaving Link
1-16, digests with 10 different proteinases were carried out for 30
minutes, 2 and 24 hours. The proteinases tested were MMPs 3, 7, 12,
13, ADAMTS 4,5, HTRA1, and cathepsins K, B, and L. The peak area
intensity of the 1922 Da, Link 1-16 peptide was quantified using
mass spectrometry. The intensity of the peak was significantly
diminished already after 30 minutes and was hardly detectable at 2
and 24 hours incubation with cathepsin K, while it was un-affected
by MMPs 3, 7, 12, 13, ADAMTS 4,5, HTRA1, and cathepsins B, and L
(the 2 hour time point is shown in FIG. 6A). A MRM method was set
up to evaluate if the m/z 964.4 Da (+1) Link 1-8 appeared as the
intensity of 1922 Da peptide disappeared. The method confirmed that
Link 1-8 was generated after 2 hours by cathepsin K (FIG. 6B). To
evaluate if cathepsin K generate a cleavage between amino acids 8
and 9 or if Link 1-16 is processed at several sites within the
residue 8-16 region, a MRM method was set up also for the m/z
488.75 Da (2+) Link 9-16 peptide. The analysis showed the presence
of Link 9-16 after 2 hours, confirming that Link N is processed by
a single cleavage between amino acids 8 and 9 (FIG. 6C).
[0242] As disc degeneration is closely linked to the presence of
inflammatory cytokines in vivo (51), and native Link N is known to
work equally well in an inflammatory environment (34) a response to
the peptides was evaluated in the presence of IL-1.beta. to
determine whether their beneficial effect is maintained in an
inflammatory milieu. Proteoglycan synthesis was evaluated using
.sup.35SO.sub.4 incorporation. Link N 1-8 significantly induced
proteoglycan production to the same extent as native Link N in the
presence of IL-113, in bovine NP and AF cells (NP p=0.006 and AF
p=0.013) (FIG. 7A). The same trend was found in human cells, with a
significantly increased response to Link N 1-8 (NP p=0.002 and AF
p=0.004) and no response to Link N 9-16 (FIG. 7B), confirming that
the biological effect is maintained in the first 8 amino acids of
the peptide and indicating that the effect is sustained in an
inflammatory environment.
Discussion
[0243] It has previously been reported that Link N can stimulate
collagen and proteoglycan synthesis in chondrocytes (70), in IVD
cells in vitro and in intact human IVDs ex vivo (19,20), as well as
increase disc height in a rabbit model of disc degeneration (31).
It is however not known how stable native Link N is in a biological
system. The present study demonstrates that AF cells have the
ability to proteolytically process the Link N peptide resulting in
a fragment spanning amino acid residues 1-8. The data also
indicates that the biologically active sequence is preserved within
this fragment and that the peptide is able to increase proteoglycan
synthesis in both NP and AF cells, even in an inflammatory milieu.
AF cells demonstrated a stronger proteoglycan increase over
baseline than NP cells. However the absolute concentration produced
cannot be evaluated with the method used. It is possible that NP
cells have a higher baseline production resulting in a higher total
concentration of proteoglycan both with and without Link N
exposure. A reversed or scrambled Link N peptide, as well as
residues 9-16 of the Link N, had no biological effect.
[0244] Wang et al. have previously reported that the stimulatory
effect of Link N was lost when they evaluated a number of shorter
Link N-derived peptides (33) including a peptide spanning amino
acid residues 1-12. In contrast, it was found here that a peptide
spanning residues 1-8 of Link N was active. In agreement with the
present results they found that a reversed or scrambled peptide had
no effect. It is unclear why the residue 1-12 peptide was inactive
in their system, but could relate to the different conditions that
were used. Wang et al. used 100 ng/mL of the different peptides
independent of size.
[0245] It was determined that there is an optimal concentration of
1 .mu.g/mL of the 16 amino acid native Link N, therefore used this
concentration was used and to maintain equimolar concentrations 0.5
.mu.g/mL of the 8 residue shorter peptides was used. Wang et al
measured cell-associated sulphated GAG in cell lysates whereas
incorporation of radioactive sulphate in the GAG released into the
culture medium was measured herein. The cell source used was also
different, Wang et al. isolated cells from degenerated disc tissue
extracted during surgery for spinal fusion, and expanded the cells
in monolayer culture before transferring them into 3D cultures, a
procedure that may have altered the phenotype and thereby the
response of the cells.
[0246] It has been demonstrated by Abbott et al (71) that monolayer
expanded cells from degenerate human discs respond less well to
native Link N, with only a low upregulation of aggrecan message
levels and a strong induction of MMP3 message levels (71, 18). The
dose of Link-N used in the Wang et al study was again lower than
the optimal dose that was determined, in this case it was 10 times
less (71). The cells tested herein were isolated from organ donors
with mild degeneration, and to preserve the phenotype the cells
were not expanded in monolayer. This difference and the fact that
evaluated cells were not from severely degenerated surgically
removed discs may explain the different results]. Discs with severe
degeneration may not have sufficient cells to provide a detectable
therapeutic response. It is also difficult to separate the
different regions of surgically removed degenerated discs due to
loss of gross morphology, making it difficult to distinguish
differences between NP and AF cells. In addition, the cell yield is
low in severely degenerated discs and it is necessary to expand the
cells to increase cell number, which may influence the phenotype of
cells (72).
[0247] An early event and a hallmark of disc degeneration is the
loss of aggrecan and any therapeutic agent used in the early stage
of degeneration must increase its synthesis. Thus in the present
aggrecan synthesis was focused on as the read out to evaluate the
beneficial effect of the Link N fragment. However, disc
degeneration in vivo is strongly associated with increased
catabolism in the disc matrix. This process involves an up
regulation of various cytokines and proteases likely to also be
expressed early in the disease process (17, 53). It is essential
for a bioactive agent with the ability to reverse or retard the
degenerative process in the disc to exert its anabolic effect in
this catabolic milieu. This data indicates that Link 1-8 has these
properties.
[0248] It was also found that although Link N is processed by AF
cells, a active sequence remains intact. Cathepsin K cleavage of
Link N between residues 8-9 resulting in two peptides, Link 1-8 and
Link 9-16, while MMPs 3, 7, 12, 13, ADAMTS 4,5, HTRA1, and
cathepsins B, and L failed to process Link N. A role of cathepsin K
in disc degeneration has been suggested (55, 73). It is not known
if Link 1-8 is generated in the extracellular matrix of
degenerating intervertebral discs.
[0249] It has been shown that Link N acts through the BMP type II
receptor and that receptor activation leads to Smad1/5 signalling
and an upregulation of BMP-4 and BMP-7 message levels (32). BMP
type II receptor is the only receptor described as a partner for
Link N. It is therefore likely that Link 1-8 interacts with the
same receptor and as both peptides induce proteoglycan synthesis to
a similar extent. If so then one would expect that Link N would
also have the other metabolic properties of Link N, such as the
ability to down-regulate metalloproteinase expression.
[0250] Link N 1-8 is a promising bioactive substance for the
treatment of degenerative disc disease. Patients that could benefit
from this treatment include for example those with early disc
degeneration for example where the AF remains intact before major
collagen degradation has occurred. Degeneration beyond Thompson
grade 3 may require surgical treatment due to the low number of
cells and the severally disrupted ECM remaining in the disc.
However, Link N 1-8 might still be useful in individuals with these
higher grades of degeneration, where it could be used to delay
adjacent level disc disease after fusion (74-76). One advantage in
using this shorter 8 amino acid peptide rather than the original 16
amino acid Link N in therapy could be the production cost The small
size m also be more amenable to in vivo delivery.
TABLE-US-00004 TABLE 1 Identification of Human Intervertebral Disc
(IVD) Donors. Donor Age (yrs) Sex Cause of Death Disc Levels 1 19 F
Cocaine Overdose L1-L2, L2-L3, L5-S1 2 20 F MVA T12-L1, L3-L4,
L5-S1 3 16 F Cardiac Arrest T12-L1, L1-L2, L5-S1 4 36 F MVA T12-L1,
L3-L4, L5-S1 5 25 M Suicide T12-L1, L1-L2, L5-S1 6 47 F CVA T12-L1,
L3-L4, L5-S1 7 42 F ICH T12-L1, L5-S1 ICH = Intracranial
Hemorrhage, MVA = Motor Vehicle Accident, CVA = Cerebro-Vascular
Accident.
Example 2
[0251] As demonstrated previously, Link N is released from Link
protein by MMP cleavage. It is produced in both articular and
intervertebral discs and promotes aggrecan/collagen synthesis by
disc (NP and AF) and articular cartilage (chondrocyte) cells.
[0252] Link N stimulation of human discs in organ culture has been
reported to increase proteoglycan synthesis compared to discs
injected with medium alone by 1.15 to greater than 7 fold.
Proteoglycan synthesis is detectable 9 days after Link N
stimulation.
[0253] In a rabbit model of disc degeneration injection of Link N
at a concentration of 100 micrograms of Link N in 10 microliters of
saline 2 weeks after L2/3 annular puncture, significantly increased
IVD disc height 14 weeks after Link N infections. Aggrecan mRNA was
significantly increased in AF and NP cells (particularly in AF
cells). As well MMP-3 and ADAMTS-4 proteinase expression was
significantly reduced. It was demonstrated that Link N is retained
in the human discus and is only lost slowly through the endplate
and not AF. The specificity of Link N is sequence dependent as a
scrambled Link N or reversed Link N had no effect in human NP cells
or human iAF cells. See for example references 29 and 34.
[0254] The stability of Link N in culture in the presence of NP and
AF was tested as shown in FIG. 3 and as described above. Link N is
processed by AF cells but not by NP cells.
[0255] FIGS. 4b and 4c shows the possible Link N fragments
identified by mass spectrometry. Multiple reaction monitoring of
Link N peptide 1-16 after incubation with a variety of different
proteinases found that the signal is lost only in the presence of
cathepsin K incubation (FIG. 6A). This corresponds to the
appearance of peaks as shown in FIGS. 6B and 6C. Link N 1-8 but not
Link N 9-16 is active for inducing proteoglycan synthesis when
contacted with human NP cells and human iAF cells (FIG. 7A). Link N
1-8 shows similar or better activity than full length Link N (FIG.
7B). Link N and Link N 1-8 but not Link N 9-16 can promote
proteoglycan synthesis in an inflammatory environment.
[0256] These results show that aggrecan production is increased in
both NF and AF cells, Link N is retained in the disc and only lost
slowly through the endplate and not AF. Link N is processed in by
AF cells and not NP cells. Link N is cleaved by cathepsin K
generating the 1-8 fragment and the Link N fragment produced by AF
cells is active. Line N and the fragment work in an inflammatory
environment
Example 3
Methodology:
[0257] Osteoarthritic (OA) cartilage was obtained from four donors
undergoing total knee arthroplasty with informed consent, and OA
cartilage--bone explants and OA chondrocytes were prepared from
each donor. Normal human chondrocytes (PromoCell, Heidelberg,
Germany) and bovine articular cartilage (12 months) were used as
controls.
Explants Preparation and Treatments
[0258] Cartilage explants, approximately 1 cm.sup.2, were prepared
from the same donors and included cartilage with the cortical bone.
Explants were cultured in DMEM supplemented with 10%
heat-inactivated FBS. After 7 days under standard culture
conditions, the explants were exposed to: IL-1.beta. (5 ng/ml),
Link N (1 .mu.g/ml) and co-exposed to IL1.beta.+Link N for 21 days
with culture medium changed every three days.
Tissue Processing and Analysis
[0259] Cartilage plugs of 3 mm diameter were isolated from
different areas from each explant. The expression of Col II, Agg,
Col X and MMP-13 was evaluated by Western blotting. Briefly,
cartilage plugs were extracted with 15 volumes (v/w) 4-M
guanidinium chloride (GuCl), 100-mM sodium acetate, pH 7.4,
containing proteinase inhibitors for 48 h at 4.degree. C. An
aliquot of 100 .mu.l, used for Western blot analysis, was
precipitated with 9 volumes of ethanol and incubated one hour at
37.degree. C. with 50 mU keratanase I (Seikagaku) followed by an
overnight incubation at 37.degree. C. with 20 mU chondroitinase ABC
(Seikagaku). Cartilage matrix components were resolved by SDS/PAGE
on 4-20% gradient gels (Bio-Rad) under reducing conditions, and
transferred to 0.2 um PVDF membranes for immunoblotting. Aggrecan
was detected using a rabbit polyclonal antibody recognizing the
amino-terminal G1 (anti-G1). Col II and MMP-13 were recognized with
anti-Col II and anti-MMP13 rabbit polyclonal antibodies (Abcam),
while type X collagen was recognized with an anti-Col X mouse
monoclonal antibody (Sigma).
[0260] The total glycosaminoglycan (GAG, predominantly aggrecan)
content in the tissue was quantified using the
1,9-dimethylmethylene blue (DMMB) dye-binding assay.
OA Chondrocyte Isolation and Culture
[0261] OA chondrocytes were recovered from the cartilage of each
knee by sequential digestion with 0.125% Pronase followed by 0.2%
Collagenase. After isolation, the cells were expanded in DMEM
supplemented with 10% heat-inactivated FBS and 1% Streptomycin.
NFkB Signaling
[0262] OA and normal chondrocytes were transferred to 6-well plates
and grown to 90% confluency. Cells were serum deprived overnight
and incubated in culture medium containing IL-1.beta. (5 ng/ml),
Link N (1 .mu.g/ml) or combination of the two for 10 minutes at
37.degree. C. Cells were lysed in RIPA (radio immuno-precipitation
assay) buffer and protease cocktail II (Sigma) and phosphatase
(ThermoScientific) inhibitors. Lysate was electrophoresed on a
4-20% gradient gels (Bio-Rad) under reducing conditions, and
transferred to 0.2 um PVDF membranes. Blots were probed with
anti-phospho-NFkB antibody (Cell Signaling), and NFkB (Cell
Signaling) and GAPDH (Sigma) for normalization.
Results:
[0263] Link N significantly induced proteoglycan production in the
presence of IL-113, in OA explants and chondrocytes. In OA
cartilage, a significant increase in proteoglycan synthesis was
observed retained in the matrix in response to Link N. Similar
results were obtained for Col II. Link N also suppressed MMP-13
activation and Col X expression. Interestingly, in OA and normal
chondrocytes, IL-1.beta.-induced activation of NF-.kappa.B was
dose-dependently suppressed by Link N.
[0264] FIG. 8 demonstrates that GAG is retained in OA explants
treated with Link N. GAG retention was calculated as a % retention
of control (CTL) explants.
[0265] FIG. 8 demonstrates that Link N significantly induced
proteoglycan production in the presence of IL-1.beta., in OA
explants and chondrocytes.
[0266] FIG. 9 demonstrates that in OA cartilage, a significant
increase in aggrecan synthesis is observed and retained in the
matrix in response to Link N. Similar results are obtained for Col
II.
[0267] FIG. 10 demonstrates that Link N suppresses IL-113 induced
MMP-13 activation (A) and Col X expression (B) and FIG. 11
demonstrates that IL-113 induced activation of NF-kB is dose
dependently suppressed by Link N in normal human chondrocytes (A)
and OA chondrocytes (B).
[0268] Accordingly Link N stimulates the retention of proteoglycan
in osteoarthritic cartilage and can stimulate proteoglycan and
collagen in an inflammatory environment. Link N can suppress the
active form of MMP-13 in osteoarthritic cartilage and Link N
suppresses IL-1 beta induced protease expression, and without
wishing to be bound by theory for example through downregulation of
NFkB.
[0269] OA is closely linked to the presence of inflammatory
cytokines in vivo. It is demonstrated that Link N can induce
proteoglycan synthesis in an inflammatory environment in the
intervertebral disc. It is however, not known if Link N can restore
proteoglycan content in osteoarthritic cartilage in an inflammatory
milieu. To test this, human explants from osteoarthritic cartilage
were cultured for 21 days with Link N, in the presence of
IL-1.beta., with a combination of Link N and IL-1.beta., or medium
alone. The concentration of extractable proteoglycans was
quantified by the DMMB assay. Link N increased the GAG content of
the explants to about 50% when normalized to the control.
IL-1.beta. decreased the proteoglycan concentrations when compared
to the control. However, Link N increased the GAG content of the
explants to about 30% in the presence of IL-1.beta. when normalized
to the control. This indicates that during cartilage degeneration
Link N has the potential to restore proteoglycan and that the
effect is sustained in an inflammatory environment.
[0270] The effect of Link N on the synthesis and retention of
aggrecan in the tissue using an antibody against the G1 domain was
next analyzed. After culturing the explants for 21 days in the
absence of supplements, explants show weak aggrecan G1 containing
fragments. With Link N supplementation, the content of aggrecan G1
containing fragments is increased significantly (P<0.0001). When
explants were treated with IL-1 alone the intensity of the staining
of aggrecan G1 containing fragments was similar compared to that of
the control although few of the lower molecular weight fragments
were observed whereas the supplementation of Link N and IL-1
significantly increased the quantity to a level comparable to the
Link N alone treated explants.
[0271] Since the G1 domain bands are produced by aggrecanases and
MMP activity in cartilage in vivo as a result of ongoing metabolism
of the matrix, the effect of Link N on MMP-13 expression in an
inflammatory milieu was next tested. MMP-13 expression was analyzed
by western blotting after culturing explants in the absence or
presence of Link N alone, Il-1 alone or together with Link N. After
culturing the explants for 21 days in the absence of supplements,
explants show weak active MMP-13. Link N significantly induced
active MMP-13 when compared to controls. With Il-1 supplementation,
active MMP-13 is increased more than that stimulated by Link N. In
contrast, adding Link-N in the presence of IL-1.beta. led to a
decrease in the quantities of the active form of MMP-13 when
compared to IL-1.beta. alone. Thus Link N suppresses the active
form of MMP-13, in an inflammatory milieu.
[0272] Cartilage repair also requires collagen production to
generate a stable matrix. Therefore, the levels of recently
produced extractable type II collagen were assessed. The quantity
of type II collagen extracted from the osteoarthritic control
explants was lower than in Link N supplemented explants although
not significant. When the explants were treated with Il-1 alone,
the quantities of type II collagen were decreased significantly
when compared to control explants. In contrast, adding Link-N in
the presence of IL-1.beta. led to an increase in the quantities of
type II collagen when compared to IL-1.beta. alone. Thus Link N not
only stimulated aggrecan production, in an inflammatory milieu but
also that of type II collagen.
[0273] Several studies have shown that many genes encoding
pro-inflammatory cytokines and matrix degrading enzymes are
regulated by the transcription factor, nuclear factor-kappa B
(NF-.kappa.B). Suppression of the NF-.kappa.B activating cascade
using Link N could down-regulate the expression of pro-inflammatory
mediators.
[0274] The effect of Link N on NF-.kappa.B activation by IL-1 in
normal chondrocytes was next assessed. Normal chondrocytes from
were stimulated with IL-1.beta. in the presence or absence of
varying concentrations of Link N. Stimulation of phosphorylated
NF-kappaB RelA (p65) was determined by western blotting using
antibodies specific to P-P65(NF-kB). After culturing chondrocytes
cells in the absence of IL-1.beta., chondrocytes show no
P-P65(NF-kB) protein. With Link N supplementation, no effect on
P-P65(NF-kB) protein was observed. As expected, P-P65(NF-kB) is
prominent after stimulation with IL-1.beta.. Link N significantly
inhibited IL-1.beta. stimulated P-P65(NF-kB) in a dose-dependent
manner--100 ng of Link N was very similar to 1000 ng Link N.
Similar results were observed when chondrocytes from OA patients
were used. This data demonstrates that Link N suppresses IL-1beta
mediated NF-kB activation and may suppress IL-1.beta. stimulated
MMP-13 and inflammatory cytokines by inhibiting NF-.kappa.B
signaling.
Discussion
[0275] Articular cartilage architecture is kept intact and
functional through anabolic and catabolic factors, which act on the
chondrocytes that in turn maintain tissue homeostasis by balancing
synthesis and degradation. Degradation and loss of collagen and
aggrecan, subchondral bone remodeling, and inflammation of the
synovial membrane characterize osteoarthritis, as the balance
shifts to catabolism. It has previously been reported that Link N
can stimulate collagen and proteoglycan synthesis in chondrocytes.
It is however, not known if Link N can restore proteoglycan and
collagen content in osteoarthritic cartilage in an inflammatory
milieu. The results herein demonstrates that in early OA, Link N
has the potential to restore proteoglycan and collagen content. The
data also indicate that Link N can also suppress proteolysis,
increase proteoglycan and collagen synthesis by inhibiting
NF-.kappa.B signaling even in an inflammatory milieu.
[0276] Link N, a bioactive factor, has been demonstrated to have
the potential to stimulate disc repair. It has been identified
using isolated IVD cells in vitro, to induce collagen and
proteoglycan message levels and has been reported to increase
incorporation of radioactive .sup.35SO.sub.4 into newly synthesized
proteoglycans (6,16,18). Indeed, Link N injection into intact human
IVDs ex vivo resulted in increased incorporation of radioactive
.sup.35SO.sub.4 in newly synthesized proteoglycans, and led to
partial restoration of disc height when injected into rabbit discs
in a stab model of disc degeneration. The results indicate that
Link N can stimulate proteoglycan and collagen expression in
chondrocytes from OA patients, consistent with a functional role in
restoring the functional properties of cartilage.
[0277] Link N suppressed the activation of P-P65(NF-kB) in
chondrocytes. NF-kB signaling pathways play active roles in the
development and progression of arthritis in vivo (19,20). Indeed,
our studies showed the activation of NF-kB in articular
chondrocytes following stimulation with IL-1b, which plays an
important role in the catabolism of the articular cartilage. NF-kB
expression correlated with collagenase-3 (metalloproteinase
(MMP)-13) and stromelysin 1 (MMP-3) levels. Also, a shift to
nuclear NF-kB localization was shown in chondrocytes during
cartilage destruction in the early stage of arthritis in DBA/1 mice
immunized with type II collagen. The present results show that
stimulation with IL-1b causes stimulation of NF-kB activation in
articular chondrocytes
[0278] In order to have a functional matrix newly laid down matrix
has to be remodelled. This involves upregulation of various
proteases. In this study Link N significantly suppressed active
MMP-13 when compared to controls. Thus in order to remodel the
newly synthesised ECM for its new function within the cartilage,
upregulation of the proteases is required. Human disc cells
supplemented with Link N upregulate proteases in vitro and in a
rabbit in vivo model of disc degeneration. Thus, Link N appears to
be effective at stimulating repair of the cartilage, involving
remodelling of the disc ECM to restore the function of
cartilage.
[0279] The potential use of inhibitors of NF-kB to reduce articular
cartilage degradation by MMPs in arthritis has been described.
Favorable results using nonsteroidal anti-inflammatory drugs
(NSAIDs), glucocorticoids, and different agents demonstrate
decreased NF-kB activation. However, the use of NSAIDs can result
in gastrointestinal side effects and the lack of specificity in
antisense and transcription factor decoy strategies present a big
challenge when targeting gene expression is to be inhibited in only
a single organ. Furthermore, the problems of protein delivery,
immunogenicity, and cost of treatment have limited the realistic
prospect of whole proteins for therapy.
Example 4
[0280] An organ culture model of early disc degeneration, involving
proteoglycan depletion but no substantial collagen disruption is
used to study the effect of molecular and cell-based therapies,
using Link N as an economic growth factor analog and mesenchymal
stem cells (MSCs) as a cell supplement.
Materials and Methods
Mesenchymal Stem Cell Culture
[0281] Human MSCs harvested from bone marrow were obtained from
Lonza (Basel, Switzerland). According to the supplier, the cells
were positive for CD105, CD166, CD29, and CD44 and negative for
CD14, CD34, and CD45. In addition, the cells were confirmed to be
able to differentiate into osteogenic, chondrogenic, and adipogenic
lineages. All cells were expanded in Dulbecco's modified Eagle's
medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100
U/mL penicillin, and 100 .mu.g/mL streptomycin and were used within
four passages (19,20). All culture reagents were from Wisent Inc.
(St-Bruno, Canada).
Mesenchymal Stem Cell Labeling and Tracking
[0282] MSCs were labeled with PKH67 (Sigma-Aldrich, Oakville,
Canada) following the instructions of the supplier. Briefly,
2.times.10.sup.6 MSCs were washed with DMEM without FBS and
collected as a loose pellet by centrifugation at 400 g for 5 min.
The pellet was re-suspended in Diluent C and quickly mixed with the
dye solution. The cell/dye suspension was then incubated for 5 min,
whereafter the reaction was stopped by adding an equal volume of
FBS. Viability of the cells was measured by staining with trypan
blue. An aliquot was cultured in monolayer (Sarstedt,
Saint-Leonard, Canada) for two days to track the labeling
efficiency. The remainder of the cells were re-suspended in either
phosphate-buffered saline (PBS) (Wisent), or in PBS supplemented
with 1 mg/mL Link N (CanPeptide, Montreal, Canada). The cell
suspension was then injected into bovine discs pretreated with
trypsin to induce degeneration (21).
Disc Isolation and Culture
[0283] The largest first 3-4 caudal discs were isolated from the
tails of 24- to 30-month-old steers, as described previously
(21,22). Briefly, the tails were dissected free of skin, muscles
and ligaments, and pedicles for each segment were removed. The bone
and the adjacent calcified part of the cartilaginous endplate were
removed, so that the surface of the disc was soft and flexible
without detectable calcified tissue. After the discs were rinsed in
PBS supplemented with 1,000 U/mL penicillin, 1,000 .mu.g/mL
streptomycin and 0.25 .mu.g/mL fungizone (GIBCO, Burlington,
Canada), they were preconditioned for 3 days in sterile 80 mL
specimen containers (STARPLEX Scientific, Etobicoke, Canada)
containing 50 mL culture medium (DMEM with 2 mM Glutamax and 25 mM
Hepes, supplemented with 5% FBS, 100 U/mL penicillin, 100 .mu.g/mL
streptomycin, 50 .mu.g/mL L-ascorbate). Degeneration was induced by
a single injection of 100 .mu.g trypsin (Sigma-Aldrich) dissolved
in 75 .mu.L PBS into the center of the disc using a 28 G1/2 needle
(21) The needle was placed on top of the disc to measure the
distance needed to reach the center and was then inserted to the
same depth. Once in the center, the trypsin solution was slowly
injected and the needle was then gradually pulled out to avoid back
flow. The discs were then cultured for another 4 days, before
injection of MSCs (10.sup.5 cells), Link N (75 .mu.g), or a
combination of MSCs (10.sup.5 cells) and Link N (75 .mu.g) in a
final volume of 75 .mu.L PBS. The Link N concentration was based on
the optimal dose for isolated bovine disc cells (1 .mu.g/ml)
assuming an average volume of the bovine discs to be 7.5 mL. The
number of MSCs used was based on a study by Liebscher et al (23)
which measured the cell density of healthy human discs. About half
the number of cells found in a healthy adult human disc were used
in this study, in order to avoid a potential detrimental effect on
cell survival due to nutrient deprivation as the bovine discs
already have a high cell density. For all experimental conditions,
seven discs were injected. Seven of the trypsin-treated discs were
injected with PBS alone to serve as degeneration controls and to
verify that the trypsin was active in degrading the proteoglycan
content of the NP. Seven discs were cultured without any injection
to serve as non-degeneration controls. The discs were then cultured
for 14 days and the media were changed every 3 days.
Analysis of Discs by Microscopy and Histology
[0284] At termination of culture two sections were taken through
the center of the discs using an in-house designed cutting tool
consisting of two microtome blades (21). This gives two 750 .mu.m
thick slices about 3 cm wide (disc diameter) and 1 cm high (disc
height). One slice was fixed in formalin-free fixative (Accustain,
Sigma-Aldrich) for histology analysis. Fixed samples were embedded
in paraffin wax and 5-.mu.m-thick sections were cut and stained
with hematoxylin and Safranin O-fast green (24). The other slice
was used fresh to study the distribution of MSCs in the disc
tissue. The labeled stem cells populating the discs were visualized
using an inverted confocal laser scanning microscope (CLSM, Zeiss
LSM 510). Twenty consecutive 6 .mu.m sections were imaged, and CLSM
stacks were split into single images.
Extraction of Extracellular ECM Proteins and Proteoglycans
[0285] The remaining nucleus pulposus (NP) tissue was collected and
the wet weight was recorded (21). The tissue was cut into small
pieces and suspended in 14 volumes of extraction buffer [4 M
guanidinium chloride, 50 mM sodium acetate, pH 5.8, 10 mM EDTA,
COMPLETE.RTM. (Roche, Laval, Canada) for protein and proteoglycan
extraction. The tissue was extracted with continuous stirring at
4.degree. C. for 48 hours, and the extracts were cleared by
centrifugation at 12,000 g for 30 min at 4.degree. C. The
supernatants were collected and stored at -80.degree. C. for
further analysis.
GAG Analysis
[0286] Sulfated glycosaminoglycans (GAGs) were quantified in tissue
extracts by a modified dimethyl methylene blue (DMMB) dye-binding
assay (25,26). Samples were diluted to fall within the middle of
the linear range of the standard curve. Extraction buffer of an
equal volume as the tissue extracts was added to the standard curve
to compensate for possible interference.
Proteoglycan Analysis by Agarose Gel Electrophoresis
[0287] Proteoglycan composition was analyzed by agarose gel
electrophoresis (27). Proteoglycans in 10 .mu.L aliquots of disc
extracts were precipitated with anhydrous ethanol and dissolved in
distilled water. The samples were mixed with sample buffer (0.1 M
Tris-HCl, 0.768 M glycine, 0.01% Bromophenol blue, 1.2% glycerol,
0.05% SDS, pH 8.3) and boiled for 10 min. The proteoglycans were
separated by electrophoresis in 1.2% agarose gels. The gel was
stained with 0.02% (w/v) Toluidine blue in 3% acetic acid with 0.5%
(w/v) Triton X 100, and destained with 3% acetic acid then
distilled water.
Aggrecan and Type II Collagen Analysis by Western Blot
[0288] Proteins and proteoglycan in 10 .mu.L aliquots of disc
extracts were precipitated by the addition of 9 volumes of
anhydrous ethanol, washed twice in 95% ethanol, and finally
lyophilized. Samples for analysis of type II collagen were
dissolved in distilled water. Samples for analysis of aggrecan were
dissolved in buffer (0.05 M Tris-HCl, with 0.03M Sodium acetate, pH
7.4, COMPLETE.RTM.), and digested by keratanase I and
chondroitinase ABC (Amsbio, Lake Forest, Calif., US). The samples
from the same treatment group were pooled, mixed with SDS sample
buffer, and boiled for 10 minutes. Then the proteins were separated
by SDS-PAGE (4-12% Bio-Rad.RTM. gels) under reducing conditions.
Separated proteins were transferred to nitrocellulose membranes
which were blocked with 1% BSA in PBS with 0.2% Tween 20 (blocking
buffer). Then they were incubated with the primary antibodies at a
1:2,000 dilution in blocking buffer at 4.degree. C. overnight,
followed by incubation with the secondary antibody conjugated with
horseradish peroxidase (1:5,000 dilution, Sigma-Aldrich) in
blocking buffer. The primary antibody recognizing collagen type II
was from Abcam (Toronto, Canada); the primary antibody recognizing
the aggrecan G1 domain was prepared as described previously (28).
The bound antibody was visualized by chemiluminescence (GE
Healthcare Baie d'Urfe Canada) and analyzed using a Bio-Rad
VersaDoc image analysis system (Bio-Rad, Mississauga, Canada).
Statistical Analysis
[0289] Statistical analysis was performed by using analysis of
variance followed by Fisher protected least significant difference
post hoc test by using GraphPad Prism (GraphPad Software, Inc. La
Jolla, Calif. USA). Results are presented as the mean.+-.standard
deviation (SD) of seven independent experiments with discs from
different bovine tails. Differences were considered statistically
significant where p<0.05.
Results
[0290] Link N is known to induce proteoglycan synthesis by isolated
disc cells and in degenerate rabbit discs, and to enhance
chondrogenesis of MSCs in vitro (20,29-32). It is however, not
known if Link N or MSCs alone can restore the proteoglycan content
in larger discs with early degeneration. It is also not known if a
combination of Link N and MSCs would have an additive effect. To
test this, bovine discs with proteolytically induced aggrecan
depletion were treated with Link N or MSCs alone or with a
combination of Link N and MSCs. The discs were cultured for a 2
week period after treatment and the concentration of extractable
proteoglycans was quantified by the DMMB assay (FIG. 12). Without
intervention the GAG content in degenerate discs dropped to about
50% of that in non-degenerate controls. In contrast, Link N and
MSCs alone, or in combination, significantly increased the GAG
content of the discs compared to the GAG content in degeneration
control discs (p<0.05). The proteoglycan concentrations in
treated discs were similar to that in non-degenerated discs.
However, no statistical significance was observed amongst the
treated groups (p>0.05). This indicates that in early
degeneration either Link N or MSCs alone have the potential to
restore proteoglycan to its original level and no additional
benefit is achieved by a combination therapy.
[0291] Having equal proteoglycan content does not necessarily imply
that the structure is the same as that in the normal disc. To
address this, extracted proteoglycans were analyzed by agarose gel
electrophoresis. The size distribution and intensity of staining in
the treated discs is equivalent to that of non-degenerated control
discs, whereas the intensity of the staining was lower in
degeneration control discs (FIG. 13). The data demonstrates that
the newly synthesized proteoglycans produced in the treated discs
are of the same size range as those of the non-degenerate
discs.
[0292] In addition, the presence and abundance of intact aggrecan
core protein was evaluated by SDS-PAGE. Intact aggrecan core
protein with a mass larger than 250 kDa was significantly lower in
degeneration control discs compared to non-degenerated control
discs (p<0.05), whereas the injection of Link N and/or MSCs
significantly increased the quantity to a level comparable to the
non-degenerate control discs (FIG. 14).
[0293] Disc repair also requires collagen production to generate a
stable matrix. Therefore, the levels of recently produced
extractable type II collagen were assessed (FIG. 15). The quantity
of type II collagen extracted from the degeneration control discs
was significantly lower than in non-degenerated control discs. When
the discs were injected with MSCs and/or Link N, the quantities of
type II collagen were increased to a similar level to that detected
in non-degenerate control discs. Thus both Link N and MSCs not only
stimulate aggrecan production, but also that of type II
collagen.
[0294] Histological analysis was used to evaluate proteoglycan
distribution within the repair tissue. Safranin O and fast green
staining of tissue sections confirmed a uniform loss of
proteoglycans in the degeneration control discs, where little
Safranin O (red) staining was found (FIG. 16). The results further
confirmed that the proteoglycan content in degeneration control
discs was depleted throughout the NP region. In the discs treated
with MSCs or Link N alone or together, the intensity and
distribution of the Safranin O staining showed an even distribution
throughout the NP region, similar to that of non-degeneration
control discs. Thus the newly synthesized proteoglycan was able to
diffuse throughout the ECM and restore tissue content even in areas
remote from the cells.
[0295] For MSC induced repair processes to be sustained the
injected stem cells need to remain viable and distributed
throughout the repair tissue. To address this, MSCs were labeled
with PKH67 (FIG. 17A,B) and cultured for two days in monolayer to
evaluate labeling efficiency and dye sustainability. MSC viability
was higher than 90% when the cells were labeled and suspended in
PBS or Link N/PBS solution prior to injecting into the
trypsin-treated discs. To evaluate if the injected MSCs survived
and integrated in the ECM of the discs, cells were traced by
confocal microscopy. Labeled MSCs were found distributed throughout
the NP region after the two week organ culture period, (FIG. 17C,D)
indicating the feasibility of a sustainable repair process.
Discussion
[0296] In the present study an organ culture model of early disc
degeneration was used to study the potential of molecular and
cell-based therapies to restore IVD proteoglycan content. Link N
was used as a molecular agent and MSCs as a cell supplement. The
degenerate discs were treated with either therapy separately or in
combination, and the results revealed that Link N or MSCs alone
have the ability to restore tissue proteoglycan and that no
additional effect was observed by a combination of the two.
[0297] Previous work has demonstrated the potential of Link N to
stimulate disc repair (20,29,31-35). Although, Link N is cleaved by
AF cells as shown herein, the resulting N-terminal 8 amino acid
peptide appears to be proteolytically stable and retains biological
activity. Studies utilizing isolated IVD cells in vitro, showed
that Link N could induce collagen and proteoglycan message levels
and result in increased incorporation of radioactive
.sup.35SO.sub.4 into newly synthesized proteoglycans (34,35). In
addition, Link N injection into intact human IVDs ex vivo (34)
resulted in increased incorporation of radioactive .sup.35SO.sub.4
in newly synthesized proteoglycans, and Link N led to partial
restoration of disc height when injected into rabbit discs in a
stab model of disc degeneration (31). The model used in the present
study mimics early stage degeneration in a young adult, where the
tissue has sufficient numbers of cells that can respond to Link N
stimulation. In contrast, diminishing cell numbers, cell senescence
and possibly an inflammatory environment on the other hand often
characterize human disc degeneration. Previous work from our group
has shown that Link N is equally potent in an inflammatory
environment (34) At this stage it might be necessary to also supply
additional cells capable of synthesizing disc ECM.
[0298] There is no benign site where autologous IVD cells can be
harvested and used as a cell source for IVD repair, leaving MSCs as
an attractive option. The potential use of MSCs for IVD repair has
been described in small animals (36-38). Favorable results in
rabbits demonstrate increased disc height, as well as ECM
deposition and hydration. However, other studies in the rabbit
report osteophyte formation, especially when MSCs were administered
without a scaffold or without sealing of the AF (39). As Link N is
known to promote chondrogenesis and reduce osteogenesis of human
MSCs in vitro, it may be an ideal candidate for a combination
therapy (20). In addition to animal studies, a small-scale human
clinical trial has reported improved pain and disability score
(40). No increase in disc height was found in the clinical trials,
but an increase in hydration measured by MRI could be detected. The
present results indicate that MSC supplementation could be a viable
option in early degeneration. However, as endplate calcification is
associated with degeneration (41), it remains to be seen whether
the resulting compromised nutritional pathway in degenerate discs
would support the metabolic activity of additional cells
(42,43).
[0299] The current model does not result in the generation of
fissures only molecular depletion, whereas natural disc
degeneration often involves the creation of fissures. To repair
such lesions, it may require injecting Link N and stem cells in a
polymerizable scaffold that will fill the lesions and allow uniform
distribution of the therapeutic agents.
TABLE-US-00005 TABLE 2 Randomization of discs Non- Degeneration
degeneration Link N + Animal control control Link N MSCs MSCs 1 X x
x x 2 x x x x 3 X x x x 4 X x x x 5 X x x x 6 X x x x 7 x x x x 8 X
x x x 9 X x x
Example 5
[0300] Additional tests were conducted using a bovine disc organ
culture. FIG. 18 demonstrates that Link N 1-8 induces statistically
significant increase in on proteoglycan synthesis, aggrecan and
type II collagen expression in degenerated bovine discs at 2 weeks
post Link N 1-8 treatment.
[0301] It is demonstrated that Link N and the fragment comprising
amino acids 1-8 can restore aggrecan levels in the degenerate
disc.
Example 6
[0302] Human Link N [DHLSDNYTLDHDRAIH] (SEQ ID NO:15) can stimulate
extracellular matrix biosynthesis by intervertebral disc (IVD)
cells, both in vitro and in vivo. To date, there have been no
reports on the effect of bovine Link N [DHHSDNYTVDHDRVIH] (SEQ ID
NO:5) on disc cells. The purpose of this study is to compare the
effect of bovine Link N (BLN) to that of human Link N (HLN) on
bovine annulus fibrosus (AF) and nucleus pulposus (NP) cells.
[0303] Methods: Cells isolated from NP and AF regions of coccygeal
discs from healthy 22-24 months old steers were either immediately
embedded in 1.2% alginate beads for proteoglycan synthesis and gene
expression or culture in monolayer for protein extraction. The
beads were incubated for 18 days in media supplemented with 1
.mu.g/ml of either HLN or BLN. The sulfated glycosaminoglycan (GAG)
release was analyzed. After 7 and 14 days of culture, quantitative
PCR was performed for aggrecan (AGG), ADAMTS-4 and ADAMTS-5. Smad
activation was analyzed by immunoblotting using specific antibodies
directed against P-Smad1/5 and P-Smad2.
[0304] Results: In both NP and AF cells, incubation with BLN and
HLN resulted in increased GAG release into the culture media. GAG
release was significantly higher in AF cells incubated with either
BLN or HLN compared to control media. However, NP cells had a
significant and consistent increase in GAG release when incubated
with HLN. In AF cells, both Link-N supplementations induced a fast
activation (<10 minutes) of Smad1/5 that decreased below control
levels over the course of 6 hours. In NP cells, Smad1/5 appeared
delayed, beginning after 30 minutes and continued to increase with
time.
[0305] BLN is capable of stimulating GAG release in bovine IVD
cells through the activation of Smad1/5. The fast activation of
Smad1/5 by BLN in AF cells may explain our findings that AF cells
respond better than NP cells to BLN supplementation in promoting
GAG synthesis; Both peptides have features needed for any agent
designed to stimulate disc repair.
[0306] Further details are found in Example 7.
Example 7
[0307] Intervertebral discs (IVDs) are composite structures
comprised of the peripheral collagen-rich annulus fibrosus (AF)
surrounding the proteoglycan-rich central nucleus pulposus (NP)
[77]. They resist compression as they have a high content of the
proteoglycan aggrecan, which interacts with hyaluronate to produce
large proteoglycan aggregates. These interactions are stabilized by
the further interaction of a link protein (FIG. 19) [78,79]. The
disc cells residing in the AF and NP regulate homeostasis of IVDs
through metabolic processes, maintaining a balance between anabolic
and catabolic factors and controlling the expression of matrix
molecules and degradative enzymes. An imbalance of this steady
state metabolism leads to biochemical alterations in the
composition and structure of IVD matrix due to both depleted
synthesis and increased degradation, with aggrecan being
particularly susceptible to proteolytic damage and loss. The
progressive breakdown of the extracellular matrix (ECM) is closely
associated with disc degeneration [80].
[0308] IVD degeneration plays a major role in the etiology of low
back pain, which can significantly affect more than half of the
population [53, 81-82]. Thus, for low back pain therapy, reversing
the degeneration process and repairing (restoring the structure or
function of) the degenerated IVDs is crucial. Lately, cell or
growth factor therapies have been proposed to induce IVD repair
[83-86]. Several studies have suggested using growth factors to
stimulate cellular metabolism and change tissue homeostasis to
anabolic status (matrix synthesis), thereby reversing the
degeneration process.
[0309] Disc repair may be enhanced by growth factor supplementation
such as bone morphogenetic proteins (BMPs) and transforming growth
factor-.beta. (TGF .beta.). These growth factors can be applied
directly to maximize extracellular matrix production and to promote
tissue regeneration. As an economical alternative to growth
factors, it may be possible to use Link N for tissue regeneration.
Human Link N peptide [DHLSDNYTLDHDRAIH] (SEQ ID NO:15) is the
N-terminal peptide of link protein, a glycoprotein that stabilizes
the non-covalent interaction between the aggrecan G1 domain and
hyaluronate (FIG. 19). Human Link N can stimulate collagen and
proteoglycan synthesis in human articular cartilage and bovine IVD
cells in vitro [87-88, 35], and can increase disc height in a
rabbit model of disc degeneration in vivo [31]. Previous studies
have shown that Link N can also decrease the expression of type X
collagen, a marker of chondrocyte hypertrophy [89], and stimulate
the expression of type II collagen, a marker of cartilage and disc
ECM formation [90]. Therefore, Link N has the potential to be used
together with stem cells to promote the formation of the ECM
necessary for IVD repair.
[0310] To date, there have been no reports on the effect of bovine
Link N [DHHSDNYTVDHDRVIH] (SEQ ID NO:5) on disc cells. The purpose
of this study is to compare the effects of bovine Link N (BLN) and
human Link N (HLN) on bovine IVD cells in order to determine
whether substitution of residues (marked in bold), as occurs in the
BLN sequence, alter Link N function.
Materials and Methods
Bovine Disc Cell Isolation
[0311] Coccygeal IVDs from healthy 20-24 month old steers were
obtained from a local abattoir at 2-3 hours after slaughter. The
IVDs were separated from their adjacent vertebral bodies, and the
cells were isolated from the NP and AF regions by sequential
digestion with 0.2% Pronase followed by 0.125% Collagenase
digestion as previously described [88]. After isolation, the NP and
AF cells were either immediately embedded in alginate beads or were
plated in 6 well plates for protein extraction.
Alginate Embedding
[0312] After isolation the NP and AF cells were resuspended in 1.2%
alginate (dissolved in 0.15 M NaCl) at a concentration of 2 million
cells per ml. Alginate was chosen to assess the effect on matrix
production in the absence of extensive cell proliferation [91-92].
Droplets of cell suspension were released through an 18-gauge
needle into 102 mM calcium chloride solution and were let to
polymerize for 10 minutes. Alginate beads were subsequently
stabilized for 7 days in culture media (Dulbecco's Modified Eagle
Medium high glucose supplemented with 10% fetal bovine serum and
antibiotics).
Culture and Treatment of Alginate Beads
[0313] After stabilization, the alginate beads were placed in 24
well plates at a density of 9 beads/well and were incubated for 18
days in media supplemented with 1 .mu.g/ml of either HLN or BLN
(CanPeptide, Montreal). Beads cultured in media alone for the same
period of time were used as the control (CTL). The concentration of
BLN and HLN supplementation was chosen based on the finding that 1
.mu.g/ml Link N induces the maximal response at stimulating
proteoglycan synthesis in disc cells [93]. Culture medium was
changed every third day for 18 days in order to allow sufficient
time for any phenotypic changes to occur under the different Link N
supplementation.
Culture and Treatment of Disc Cells
[0314] AF and NP cells were expanded in culture medium (Dulbecco's
Modified Eagle Medium high glucose supplemented with 10% fetal
bovine serum and antibiotics) into 6 well plates
(7.5.times.10.sup.5 cells/well) until reaching 80-90% confluence.
The cells were pre-incubated overnight in serum-free medium, then
were incubated in 1 .mu.g/ml HLN or BLN for different time points
up to 6 hours. Cells incubated in medium alone were use as the
control (CTL).
Cell Viability
[0315] Cell viability was assessed at day 18 on the alginate beads
using a live/dead fluorescence assay (Live/Dead.RTM., Invitrogen)
and visualized by fluorescent microscopy.
Proteoglycan Content
[0316] The culture media of the alginate beads, with or without
Link N, was changed every third day, and the sulfated
glycosaminoglycan (GAG, predominantly aggrecan) released into the
media was analyzed using the 1,9-dimethylmethylene blue (DMMB)
dye-binding assay [94]. GAG retention in the alginate was not
measured since alginate is a polyanion that reacts with DMMB and
therefore interferes with the assay.
Total RNA Isolation and Gene Expression
[0317] At day 7 and day 14 the alginate beads were resuspended in
citrate buffer and the cells were recovered for gene expression.
Total RNA was extracted from disc cells using Trizol (Invitrogen,
Burlington, ON, Canada), following the manufacturer's instructions.
One microgram total RNA was reverse transcribed into cDNA using the
Superscript.TM. First Strand cDNA synthesis kit (Invitrogen,
Carlsbad, Calif., USA). Following reverse transcription, real time
PCR was applied to quantitatively analyze message levels of
aggrecan (AGG), ADAMTS-4 and ADAMTS-5. One microliter of cDNA was
amplified using gene-specific primers (Table 3). Initially, the
expression of the target gene was normalized to 18S rRNA expression
levels, and then the expression of the Link N-incubated beads was
normalized to the control beads.
Protein Expression
[0318] The incubated AF and NP cells were then lysed in a buffer
(pH 7.4) containing 10 mM HEPES, 50 mM Na.sub.4P.sub.2O.sub.7, 50
mM NaF, 50 mM NaCl, 5 mM EDTA, 5 mM EGTA, 2 mM Na.sub.3VO.sub.4, 1%
Triton X-100 (all from Sigma-Aldrich), and a protease and
phosphatase inhibitor cocktail (Roche Diagnostics, Laval, QC,
Canada). Proteins were separated on 10% acrylamide gels and
transferred to PVDF membranes for western blot to measure protein
expression using specific antibodies directed against P-Smad1/5,
P-Smad2, Smad1 and Smad2 (Cell Signaling Technology, Danvers,
Mass.). The membranes were incubated in ESL Chemiluminescent
reagent (GE Healthcare, Piscataway, N.J.) and scanned using the
Molecular Imager VersaDoc.TM. MP 4000 System (Bio-Rad Canada,
Mississauga, ON, Canada). The band intensities were quantified by
densitometry using the ImageJ software program. The phosphorylation
of Smad1/5 and Smad2 were normalized to the corresponding Smad1 and
Smad2 total forms.
Statistical Analysis
[0319] All experiments were performed in triplicate and were
repeated with three independent cultures. The effect of treatment
and culture period as well as the significance of differences among
the experimental groups (CTL, BLN and HLN) at each time point were
assessed by repeated measures ANOVA followed by Tukey's Multiple
Comparison Test. P value less than 0.05 was considered
statistically significant.
Results
Alginate Bead Viability
[0320] The cell-seeded alginate scaffolds were maintained in
culture for a period of 18 days in order to verify that
supplementation of 1 .mu.g/ml HLN or BLN was not detrimental to the
viability of AF and NP cells. For scaffolds supplemented with
either HLN or BLN, cellular viability was maintained at >98%
(FIG. 20).
Effect of Bovine and Human Link N on Proteoglycan Synthesis
[0321] For both NP and AF cells incubated with or without Link N,
the rate of GAG release into the culture medium increased with time
(FIGS. 21 and 22). NP cells tended to exhibit a similar total GAG
release to that of AF cells.
[0322] The GAG release by NP cells supplemented with 1 .mu.g/ml HLN
was significantly higher than the control at all-time points
(p<0.05 for day 3 and p<0.0001 for days 6, 9, 12, 15, 18).
When compared with the GAG release by NP cells supplemented with
BLN, this difference was only significant (p<0.05) starting at
day 12. In contrast, no statistical significance was observed
between the GAG release by NP cells supplemented with BLN compared
with the control, although a tendency towards an increase was
observed (FIG. 21).
[0323] For AF cells supplemented with 1 .mu.g/ml HLN the GAG
release was significantly higher than the control starting from day
6 (p<0.005 for day 6 and p<0.0001 for days 9, 12, 15, 18)
while for those supplemented with 1 .mu.g/ml BLN, the GAG release
was significantly higher than the control starting from day 9
(p<0.001) (FIG. 22). Finally, although GAG release tended to be
higher in AF cells supplemented with HLN than that of BLN at
all-time points, it was only at day 18 that this difference was
significant.
[0324] Similarly to the results of our previous experiments [95],
most of the GAG synthesis was found released in the culture medium
with minimal retention in the alginate beads. GAG release is
therefore a measure of proteoglycan synthesis, and it appears that
BLN is also capable of stimulating GAG release.
The Effect of Bovine or Human Link N on Matrix Metabolism
[0325] To investigate the effect of BLN or HLN on proteoglycan and
proteinase expression, bovine cell-seeded alginate scaffolds were
exposed to 1 .mu.g/mL Link N and relative gene expression was
evaluated for AGG, ADAMTS-4 and ADAMTS-5. Results are expressed
relative to cells unexposed to Link N (CTL). Both Link N treatments
led to an increase in AGG gene expression in NP cells, when
compared to the control, however, with HLN incubation, this
increase was larger and statistically significant (p=0.0107) (FIG.
23). In AF cells, the AGG expression was upregulated in response to
HLN incubation compared to controls (p=0.0257), but no significant
effect was observed between BLN compared to controls
(p>0.1).
[0326] Although at day 7, no important change in ADAMTS-4
expression of NP cells was observed, at day 14, the expression
indicated a non-significant decreasing tendency (FIG. 24B). In
contrast, for the AF cells, an increase in mRNA ADAMTS-4 expression
was observed with both BLN and HLN incubations, although the
differences were not significant compared to the controls (FIG.
24A).
[0327] At day 7, in response to HLN incubation, ADAMTS-5 expression
was upregulated for both AF and NP cells. However, this increase
was only significant for AF cells (p=0.0149). In response to BLN
incubation, ADAMTS-5 expression was down-regulated in AF cells
(p=0.0329) and upregulated in NP cells when compared to controls
(p=0.0058) (FIGS. 24C and 24D).
Canonical Smad-Mediated Signaling as a Regulator of Human and
Bovine Link N Function in Bovine Disc Cells
[0328] To explain the molecular mechanisms by which BLN and HLN
induce anabolic responses in bovine NP and AF cells, we
investigated whether BLN and HLN activate Smad1/5 proteins as
principal transducers of the Smad canonical signaling pathways.
[0329] Western blot results revealed that HLN activates the Smad1/5
in bovine AF cells within 5 minutes, while the activation with BLN
occurred within 10 minutes, achieving maximum activation at 30
minutes (FIG. 25). For both Link N supplementations, Smad1/5 levels
in AF cells decreased to below the control levels after 6 hours. In
NP cells, BLN and HLN supplementation significantly stimulated
Smad1/5 after 30 minutes and continued to increase with time.
However, for both IVD cells, HLN appeared to be more effective at
Smad1/5 activation than BLN.
[0330] In AF cells, incubation in either HLN or BLN seemed to
induce a slightly increased Smad2 activation up to three hours. In
contrast, no Smad2 activation was detected in NP cells incubated in
Link N (FIG. 26).
Discussion
[0331] Previous studies have shown that Link N can act as a growth
factor and stimulate the synthesis of proteoglycans and collagens
in vitro in bovine IVD cells [88, 35] and can increase disc height
in a rabbit model of disc degeneration in vivo [31]. Link N can
also stimulate proteoglycan synthesis by human disc cells in 3-D
scaffolds as well as in intact human discs [93]. The present data
indicates that HLN significantly stimulated proteoglycan synthesis
at all-time points in NP cells and from day 6 in AF cells. NP cells
supplemented with BLN showed a tendency towards an increase in
proteoglycan synthesis that was not significant. Interestingly, the
GAG release of AF cells supplemented with BLN was significantly
higher than the control from day 9 onwards, suggesting that BLN is
more effective in stimulating proteoglycan synthesis in AF cells
than in NP cells. In addition, HLN is able to down-regulate
ADAMTS-4 expression after 14 days in bovine NP cells but does not
significantly affect ADAMTS-4 expression in AF cells. BLN had no
significant effect on ADAMTS-4 expression after 14 days in NP
cells, although a tendency towards an increase was observed in AF
cells. BLN was able to downregulate ADAMTS-5 in the AF cells while
upregulating ADAMTS-5 in NP cells after 14 days. Finally, BLN and
HLN stimulate proteoglycan synthesis by NP and AF cells, through
Smad1/5 signaling pathways.
[0332] Previously, we found that although cell proliferation was
not expected to be extensive in alginate, [91-92] it may have
contributed to changes in GAG production. In this study we analyzed
the message level of aggrecan and the cumulative proteoglycan
release, and found that the GAG release for both AF and NP cells
incubated with Link N increased compared with the control, as did
the mRNA expression of aggrecan. The similarity in GAG synthesis by
NP and AF cells that we found and the increased presence and
survival of AF cells during proteolytic isolation may mean that AF
cells could serve as a functional substitute for NP cells, which
would be beneficial for tissue engineering.
[0333] The fact that BLN stimulated ADAMTS-5 in the NP while
downregulating it in the AF may be explained by the facts that
repair involves remodeling of the disc ECM, and that remodeling
involves proteolysis. Hence, there is no need for a complete
absence of proteolysis during repair, as long as the matrix
synthesis exceeds turnover. HLN and BLN can stimulate proteoglycan
production to help restore disc function. The fact that HLN
activated Smad1/5 in bovine AF cells immediately, within 5 minutes,
while the activation with BLN occurred gradually within 30 minutes,
suggests that HLN activation may be direct while that of BLN may be
indirect. The indirect activation may also be the case with NP
cells, where supplementation with BLN and HLN significantly
stimulated Smad1/5 after 30 minutes and continued to increase for
the duration of the testing period (6 hours). Thus, BLN in the AF
and NP as well as HLN in the NP may activate other molecules that
in turn stimulate proteoglycan synthesis.
[0334] The fast activation within 10 minutes of Smad1/5 by BLN in
AF cells may explain our finding that AF cells respond better than
NP cells to BLN supplementation in promoting proteoglycan
synthesis. Previous, studies have shown that AF cells from bovine
discs produced more proteoglycan than NP cells when stimulated with
TGF-.beta. [96]. However, this is not always the case, as NP and AF
cells were capable of responding in a similar manner [97]. The
ability of Link N to directly stimulate Smad1/5 may vary due to
differences in age. In young discs the NP is the main source of
proteoglycan. However, increased proteoglycan content in the AF is
observed with age and degeneration [96, 98], probably through
direct activation of Smad1/5 signaling.
Although, both peptides have features needed for any agent designed
to stimulate disc repair, HLN supplementation could be a better
option for treating disc degeneration during its early stages,
while the AF is still intact. This axiom posits an intact AF for
optimal repair in order to prevent the protrusion of the NP due to
the increased swelling potentially associated with proteoglycan
accumulation.
[0335] BLN can stimulate proteoglycan production in vitro in both
the NP and AF cells by indirect activation of Smad1/5 signaling.
Therefore in principle, BLN supplementation could also be an option
for treating disc degeneration. HLN at the concentration of 1 ug/ml
is effective at stimulating proteoglycan synthesis and can directly
activate Smad1/5 signaling in the AF, which is the main source of
proteoglycan synthesis with age and degeneration.
LIST OF ABBREVIATIONS
[0336] 18S rRNA: 18S ribosomal RNA; ADAMTS: a disintegrin and
metalloprotease with thrombospondin-like repeats; AGG: aggrecan;
AF: annulus fibrosus; BLN: bovine Link N; BMPs: bone morphogenetic
proteins; DMMB: 1,9-dimethylmethylene blue; ECM: extracellular
matrix; GAG: sulfated glycosaminoglycan; HA: hyaluronate; HLN:
human Link N; IVD: intervertebral disc; LP: link protein; NP:
nucleus pulposus; PCR: polymerase chain reaction; RT: reverse
transcription; TGF .beta.: transforming growth factor-.beta..
TABLE-US-00006 TABLE 3 Oligonucleotide primers used to assess gene
expression Gene Sequence Size AGG Forward (6499-6518): 167 bp
AATGCCCAGGACTACCAGTG (SEQ ID NO: 22) Reverse (6636-6665):
CCCTTCTCATGCCAGATCAT (SEQ ID NO: 23) ADAMTS-4 Forward (1528-1547):
151 bp CAATGCACTGGTCTGAATGG (SEQ ID NO: 24) Reverse (1659-1678):
CTAGGAGACAGTGCCCGAAG (SEQ ID NO: 25) ADAMTS-5 Forward (1165-1184):
186 bp GGGACCATATGCTCTCCTGA (SEQ ID NO: 26) Reverse (1331-1350):
AATGCTGGTGAGGATGGAAG (SEQ ID NO: 27) 18S Forward (1351-1370): 201
bp rRNA GGAGCGATTTGTCTGGGTTA (SEQ ID NO: 28) Reverse (1532-1551):
CGCTGAGCCAGTCAGTGTAG (SEQ ID NO: 29)
Example 8
[0337] FIG. 27 is a series of cell stainings and an immunoblot
showing that NGF expression in IVD increases with degeneration in
both NP and AF cells. FIG. 28 demonstrates that Link N suppresses
TNF alpha induced gene expression of neurotrophins (NGF, BDNF) and
Substance P (TAC1) in AF cells. FIG. 29 demonstrates that Link N
suppresses IL-1beta induced expression of neurotrophins (NGF, BDNF)
and substance P (TAC1) in AF cells. FIGS. 30 and 31 demonstrate
that the effect of Link N is mediated by reducing the level of
neurotrophin and SP receptors.
[0338] FIG. 32 shows that Link N is capable to inhibit suppresses
IL-1beta induced NGF release in grade 4 human AF cells. FIG. 33
demonstrates that Link N (10 .mu.g/ml) supplementation reduces the
Substance P release from injured bovine discs 24 hours after
puncture.
[0339] It is demonstrated that NGF expression human IVD increases
with degeneration. Link N decreases Substance P release from
mechanically injured IVDs. Link N significantly suppresses TNFalpha
and IL-1beta induced neurotrophin gene expression and neurotrophin
receptors in AF cells.
Example 9
[0340] Smaller fragments are tested for activity. Fragments of
amino acids 1-4, 4-8 and 3-6 of SEQ ID NO: 1 are tested. Smaller
and smaller fragments e.g. consisting of amino acids 1-7, 1-6, 1-5
etc are tested until activity is lost. Similarly smaller fragments
missing amino acids from the NH2 end are tested, e.g. consisting of
amino acids 2-8, 3-8, 4-8, 5-8 etc are tested. PCR analysis and/or
35S as described in other embodiments could be used as a
readout.
Example 10
[0341] Link N fragments can include one or more amino acid changes
found in one of the species in the table below.
TABLE-US-00007 Table of sequences for different species of Link N.
SEQ ID 1 2 3 4 5 6 7 8 -- 9 10 11 12 13 14 15 16 NO: Human D H L S
D N Y T -- L D H D R A I H 15 Bovine D H H S D N Y T -- V D H D R V
I H 5 Horse D H R S D N Y T -- L D H D R V I H 11 Rabbit D H Q S N
N Y T -- L G H D R V I H 12 Dog D H H S D N Y T -- L N Y D R V I H
13 Mouse D H H L S D S Y -- T P P D Q D R V 14 D H X1 X2 X3 X4 X5
X6 X7 X8 X9 D X10 X11 X12 X13
[0342] While the present application has been described with
reference to what are presently considered to be the preferred
examples, it is to be understood that the application is not
limited to the disclosed examples. To the contrary, the application
is intended to cover various modifications and equivalent
arrangements included within the spirit and scope of the appended
claims.
[0343] All publications, patents and patent applications are herein
incorporated by reference in their entirety to the same extent as
if each individual publication, patent or patent application was
specifically and individually indicated to be incorporated by
reference in its entirety. Specifically, the sequences associated
with each accession numbers provided herein including for example
accession numbers and/or biomarker sequences (e.g. protein and/or
nucleic acid) provided in the Tables or elsewhere, are incorporated
by reference in its entirely.
CITATIONS FOR REFERENCES REFERRED TO IN THE SPECIFICATION
[0344] 1. Mwale, F. (2013) Collagen and other proteins of the
nucleus pulposus, annulus fibrosus, and cartilage endplates. L. M.
Shapiro, M. V. Risbud (eds.), The Intervertebral discs 5, 79-92
[0345] 2. Ishihara, H., McNally, D. S., Urban, J. P., and Hall, A.
C. (1996) Effects of hydrostatic pressure on matrix synthesis in
different regions of the intervertebral disk. J Appl Physiol (1985)
80, 839-846 [0346] 3. Handa, T., Ishihara, H., Ohshima, H., Osada,
R., Tsuji, H., and Obata, K. (1997) Effects of hydrostatic pressure
on matrix synthesis and matrix metalloproteinase production in the
human lumbar intervertebral disc. Spine (Phila Pa. 1976) 22,
1085-1091 [0347] 4. Hutton, W. C., Elmer, W. A., Boden, S. D.,
Hyon, S., Toribatake, Y., Tomita, K., and Hair, G. A. (1999) The
effect of hydrostatic pressure on intervertebral disc metabolism.
Spine (Phila Pa. 1976) 24, 1507-1515 [0348] 5. Hsieh, A. H., and
Lotz, J. C. (2003) Prolonged spinal loading induces matrix
metalloproteinase-2 activation in intervertebral discs. Spine
(Phila Pa. 1976) 28, 1781-1788 [0349] 6. Kang, J. D.,
Stefanovic-Racic, M., McIntyre, L. A., Georgescu, H. I., and Evans,
C. H. (1997) Toward a biochemical understanding of human
intervertebral disc degeneration and herniation. Contributions of
nitric oxide, interleukins, prostaglandin E2, and matrix
metalloproteinases. Spine (Phila Pa. 1976) 22, 1065-1073 [0350] 7.
Goupille, P., Jayson, M. I., Valat, J. P., and Freemont, A. J.
(1998) Matrix metalloproteinases: the clue to intervertebral disc
degeneration? Spine (Phila Pa. 1976) 23, 1612-1626 [0351] 8.
Oegema, T. R., Jr., Johnson, S. L., Aguiar, D. J., and Ogilvie, J.
W. (2000) Fibronectin and its fragments increase with degeneration
in the human intervertebral disc. Spine 25, 2742-2747. [0352] 9.
Roberts, S., Caterson, B., Menage, J., Evans, E. H., Jaffray, D.
C., and Eisenstein, S. M. (2000) Matrix metalloproteinases and
aggrecanase: their role in disorders of the human intervertebral
disc. Spine (Phila Pa. 1976) 25, 3005-3013 [0353] 10. Akhatib, B.,
Onnerfjord, P., Gawri, R., Ouellet, J., Jarzem, P., Heinegard, D.,
Mort, J., Roughley, P., and Haglund, L. (2013) Chondroadherin
Fragmentation Mediated by the Protease HTRA1 Distinguishes Human
Intervertebral Disc Degeneration from Normal Aging. J Biol Chem
288, 19280-19287 [0354] 11. Annunen, S., Paassilta, P., Lohiniva,
J., Perala, M., Pihlajamaa, T., Karppinen, J., Tervonen, O.,
Kroger, H., Lande, S., Vanharanta, H., Ryhanen, L., Goring, H. H.,
Ott, J., Prockop, D. J., and Ala-Kokko, L. (1999) An allele of
COL9A2 associated with intervertebral disc disease. Science 285,
409-412. [0355] 12. Kawaguchi, Y., Osada, R., Kanamori, M.,
Ishihara, H., Ohmori, K., Matsui, H., and Kimura, T. (1999)
Association between an aggrecan gene polymorphism and lumbar disc
degeneration. Spine 24, 2456-2460. [0356] 13. Ala-Kokko, L. (2002)
Genetic risk factors for lumbar disc disease. Ann Med 34, 42-47
[0357] 14. Roughley, P., Martens, D., Rantakokko, J., Alini, M.,
Mwale, F., and Antoniou, J. (2006) The involvement of aggrecan
polymorphism in degeneration of human intervertebral disc and
articular cartilage. Eur Cell Mater 11, 1-7; discussion 7 [0358]
15. Thompson, J. P., Pearce, R. H., Schechter, M. T., Adams, M. E.,
Tsang, I. K., and Bishop, P. B. (1990) Preliminary evaluation of a
scheme for grading the gross morphology of the human intervertebral
disc. Spine 15, 411-415. [0359] 16. Mwale, F., Roughley, P., and
Antoniou, J. (2004) Distinction between the extracellular matrix of
the nucleus pulposus and hyaline cartilage: a requisite for tissue
engineering of intervertebral disc. Eur Cell Mater 8, 58-64 [0360]
17. Wuertz, K., and Haglund, L. (2013) Inflammatory Mediators in
Intervertebral Disk Degeneration and Discogenic Pain. Global Spine
J 3, 175-184 [0361] 18. Abbaszade, I., Liu, R. Q., Yang, F.,
Rosenfeld, S. A., Ross, O. H., Link, J. R., Ellis, D. M.,
Tortorella, M. D., Pratta, M. A., Hollis, J. M., Wynn, R., Duke, J.
L., George, H. J., Hillman, M. C., Jr., Murphy, K., Wiswall, B. H.,
Copeland, R. A., Decicco, C. P., Bruckner, R., Nagase, H., Itoh,
Y., Newton, R. C., Magolda, R. L., Trzaskos, J. M., and Burn, T. C.
(1999) Cloning and characterization of ADAMTS11, an aggrecanase
from the ADAMTS family. J Biol. Chem. 274, 23443-23450 [0362] 19.
Almaawi, A., Wang, H. T., Ciobanu, O., Rowas, S. A., Rampersad, S.,
Antoniou, J., and Mwale, F. (2013) Effect of acetaminophen and
nonsteroidal anti-inflammatory drugs on gene expression of
mesenchymal stem cells. Tissue Eng Part A 19, 1039-1046 [0363] 20.
Antoniou, J., Wang, H. T., Alaseem, A. M., Haglund, L., Roughley,
P. J., and Mwale, F. (2012) The effect of Link N on differentiation
of human bone marrow-derived mesenchymal stem cells. Arthritis
research & therapy 14, R267 [0364] 21. Jim, B., Steffen, T.,
Moir, J., Roughley, P., and Haglund, L. (2011) Development of an
intact intervertebral disc organ culture system in which
degeneration can be induced as a prelude to studying repair
potential. Eur Spine J 20, 1244-1254 [0365] 22. Demers, C. N.,
Antoniou, J., and Mwale, F. (2004) Value and limitations of using
the bovine tail as a model for the human lumbar spine. Spine (Phila
Pa. 1976) 29, 2793-2799 [0366] 23. Liebscher, T., Haefeli, M.,
Wuertz, K., Nerlich, A. G., and Boos, N. (2011) Age-related
variation in cell density of human lumbar intervertebral disc.
Spine (Phila Pa. 1976) 36, 153-159 [0367] 24. Rosenberg, L. (1971)
Chemical basis for the histological use of safranin O in the study
of articular cartilage. J Bone Joint Surg Am 53, 69-82 [0368] 25.
Barbosa, I., Garcia, S., Barbier-Chassefiere, V., Caruelle, J. P.,
Martelly, I., and Papy-Garcia, D. (2003) Improved and simple micro
assay for sulfated glycosaminoglycans quantification in biological
extracts and its use in skin and muscle tissue studies.
Glycobiology 13, 647-653 [0369] 26. Mort, J. S., and Roughley, P.
J. (2007) Measurement of glycosaminoglycan release from cartilage
explants. Methods Mol Med 135, 201-209 [0370] 27. Bjornsson, S.
(1993) Size-dependent separation of proteoglycans by
electrophoresis in gels of pure agarose. Anal Biochem 210, 292-298
[0371] 28. Sztrolovics, R., White, R. J., Roughley, P. J., and
Mort, J. S. (2002) The mechanism of aggrecan release from cartilage
differs with tissue origin and the agent used to stimulate
catabolism. Biochem. J. 362, 465-472 [0372] 29. Mwale, F., Demers,
C. N., Petit, A., Roughley, P., Poole, A. R., Steffen, T., Aebi,
M., and Antoniou, J. (2003) A synthetic peptide of link protein
stimulates the biosynthesis of collagens II, IX and proteoglycan by
cells of the intervertebral disc. J Cell Biochem 88, 1202-1213.31.
Mwale, F., Masuda, K., Pichika, R., Epure, L. M., Yoshikawa, T.,
Hemmad, A., Roughley, P. J., and Antoniou, J. (2011) The efficacy
of Link N as a mediator of repair in a rabbit model of
intervertebral disc degeneration. Arthritis Res Ther 13, R120
[0373] 32. Wang, Z., Weitzmann, M. N., Sangadala, S., Hutton, W.
C., and Yoon, S. T. (2013) Link Protein N-terminal Peptide Binds to
Bone Morphogenetic Protein (BMP) Type II Receptor and Drives Matrix
Protein Expression in Rabbit Intervertebral Disc Cells. J Biol Chem
288, 28243-28253 [0374] 33. Wang, Z., Hutton, W. C., and Yoon, S.
T. (2013) ISSLS Prize winner: Effect of link protein peptide on
human intervertebral disc cells. Spine (Phila Pa. 1976) 38,
1501-1507 [0375] 34. Gawri, R., Antoniou, J., Ouellet, J., Awwad,
W., Steffen, T., Roughley, P., Haglund, L., and Mwale, F. (2013)
Best Paper NASS 2013: Link-N can stimulate proteoglycan synthesis
in the degenerated human intervertebral discs. European cells &
materials 26, 107-119 [0376] 35. Petit, A., Yao, G., Rowas, S. A.,
Gawri, R., Epure, L., Antoniou, J., and Mwale, F. (2011) Effect of
synthetic link N peptide on the expression of type I and type II
collagens in human intervertebral disc cells. Tissue Eng Part A 17,
899-904 [0377] 36. Yang, H., Wu, J., Liu, J., Ebraheim, M.,
Castillo, S., Liu, X., Tang, T., and Ebraheim, N. A. (2010)
Transplanted mesenchymal stem cells with pure fibrinous
gelatin-transforming growth factor-beta1 decrease rabbit
intervertebral disc degeneration. Spine J 10, 802-810 [0378] 37.
Hiyama, A., Mochida, J., Iwashina, T., Omi, H., Watanabe, T.,
Serigano, K., Tamura, F., and Sakai, D. (2008) Transplantation of
mesenchymal stem cells in a canine disc degeneration model. J
Orthop Res 26, 589-600 [0379] 38. Sakai, D., Mochida, J., Yamamoto,
Y., Nomura, T., Okuma, M., Nishimura, K., Nakai, T., Ando, K., and
Hotta, T. (2003) Transplantation of mesenchymal stem cells embedded
in Atelocollagen gel to the intervertebral disc: a potential
therapeutic model for disc degeneration. Biomaterials 24, 3531-3541
[0380] 39. Vadala, G., Sowa, G., Hubert, M., Gilbertson, L. G.,
Denaro, V., and Kang, J. D. (2012) Mesenchymal stem cells injection
in degenerated intervertebral disc: cell leakage may induce
osteophyte formation. J Tissue Eng Regen Med 6, 348-355 [0381] 40.
Orozco, L., Soler, R., Morera, C., Alberca, M., Sanchez, A., and
Garcia-Sancho, J. (2011) Intervertebral disc repair by autologous
mesenchymal bone marrow cells: a pilot study. Transplantation 92,
822-828 [0382] 41. Hristova, G. I., Jarzem, P., Ouellet, J. A.,
Roughley, P. J., Epure, L. M., Antoniou, J., and Mwale, F. (2011)
Calcification in human intervertebral disc degeneration and
scoliosis. J Orthop Res 29, 1888-1895 [0383] 42. Nachemson, A.,
Lewin, T., Maroudas, A., and Freeman, M. A. (1970) In vitro
diffusion of dye through the endplates and the annulus fibrosus of
human lumbar inter-vertebral discs. Acta Orthop Scand 41, 589-607
[0384] 43. Urban, J. P., and Roberts, S. (2003) Degeneration of the
intervertebral disc. Arthritis Res Ther 5, 120-130 [0385] 45.
Antoniou, J., Epure, L. M., Michalek, A. J., Grant, M. P.,
Iatridis, J. C., and Mwale, F. (2013) Analysis of quantitative
magnetic resonance imaging and biomechanical parameters on human
discs with different grades of degeneration. J Magn Reson Imaging
[0386] 46. Majumdar, S., Link, T. M., Steinbach, L. S., Hu, S., and
Kurhanewicz, J. (2011) Diagnostic tools and imaging methods in
intervertebral disk degeneration. Orthop Clin North Am 42, 501-511,
viii [0387] 47. Borthakur, A., Maurer, P. M., Fenty, M., Wang, C.,
Berger, R., Yoder, J., Balderston, R. A., and Elliott, D. M. (2011)
T1rho magnetic resonance imaging and discography pressure as novel
biomarkers for disc degeneration and low back pain. Spine (Phila
Pa. 1976) 36, 2190-2196 [0388] 48. Roughley, P. J. (2004) Biology
of intervertebral disc aging and degeneration: involvement of the
extracellular matrix. Spine 29, 2691-2699 [0389] 49. Antoniou, J.,
Steffen, T., Nelson, F., Winterbottom, N., Hollander, A. P., Poole,
R. A., Aebi, M., and Alini, M. (1996) The human lumbar
intervertebral disc: evidence for changes in the biosynthesis and
denaturation of the extracellular matrix with growth, maturation,
ageing, and degeneration. J. Clin. Invest. 98, 996-1003 [0390] 50.
Roberts, S., Evans, E. H., Kletsas, D., Jaffray, D. C., and
Eisenstein, S. M. (2006) Senescence in human intervertebral discs.
Eur. Spine J. 15 Suppl 3, S312-S316 [0391] 51. Le Maitre, C. L.,
Freemont, A. J., and Hoyland, J. A. (2005) The role of
interleukin-1 in the pathogenesis of human intervertebral disc
References