U.S. patent application number 16/406229 was filed with the patent office on 2019-11-28 for methods for the administration of iloperidone.
The applicant listed for this patent is Vanda Pharmaceuticals Inc.. Invention is credited to Christian Lavedan, Mihael Polymeropoulos, Simona Volpi, Curt Wolfgang.
Application Number | 20190360047 16/406229 |
Document ID | / |
Family ID | 41280442 |
Filed Date | 2019-11-28 |
United States Patent
Application |
20190360047 |
Kind Code |
A1 |
Wolfgang; Curt ; et
al. |
November 28, 2019 |
METHODS FOR THE ADMINISTRATION OF ILOPERIDONE
Abstract
The present invention relates to methods for the identification
of genetic polymorphisms that may be associated with a risk for QT
prolongation after treatment with iloperidone and related methods
of administering iloperidone to patients with such
polymorphisms.
Inventors: |
Wolfgang; Curt; (Germantown,
MD) ; Polymeropoulos; Mihael; (Potomac, MD) ;
Lavedan; Christian; (Potomac, MD) ; Volpi;
Simona; (Derwood, MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Vanda Pharmaceuticals Inc. |
Washington |
DC |
US |
|
|
Family ID: |
41280442 |
Appl. No.: |
16/406229 |
Filed: |
May 8, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14847784 |
Sep 8, 2015 |
|
|
|
16406229 |
|
|
|
|
14044183 |
Oct 2, 2013 |
|
|
|
14847784 |
|
|
|
|
12208027 |
Sep 10, 2008 |
|
|
|
14044183 |
|
|
|
|
11576178 |
Mar 28, 2007 |
8586610 |
|
|
PCT/US2005/035526 |
Sep 30, 2005 |
|
|
|
12208027 |
|
|
|
|
60614798 |
Sep 30, 2004 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 31/454 20130101;
A61K 31/4525 20130101; A61P 25/24 20180101; A61K 31/496 20130101;
A61K 31/135 20130101; A61P 25/18 20180101; A61K 31/135 20130101;
A61P 25/22 20180101; C12Q 2600/106 20130101; A61K 31/454 20130101;
A61P 9/06 20180101; C12Q 2600/156 20130101; C12Q 1/6883 20130101;
A61K 31/4525 20130101; A61K 31/496 20130101; A61P 25/00 20180101;
A61K 2300/00 20130101; A61K 2300/00 20130101; A61K 2300/00
20130101; A61K 2300/00 20130101 |
International
Class: |
C12Q 1/6883 20060101
C12Q001/6883; A61K 31/496 20060101 A61K031/496; A61K 31/454
20060101 A61K031/454; A61K 31/4525 20060101 A61K031/4525; A61K
31/135 20060101 A61K031/135 |
Claims
1. A method for treating a patient with iloperidone, wherein the
patient is suffering from schizophrenia, the method comprising the
steps of: determining whether the patient demonstrates reduced
CYP2D6-mediated metabolism relative to wild type by: obtaining or
having obtained a biological sample from the patient; and
performing or having performed a genotyping assay on the biological
sample to determine if the patient has a genotype associated with
reduced CYP2D6-mediated metabolism; and if the patient has a CYP2D6
normal metabolizer genotype, then internally administering
iloperidone to the patient in a first amount, and if the patient
has a CYP2D6 poor metabolizer genotype, then internally
administering iloperidone to the patient in a second amount,
wherein the first amount of iloperidone causes an iloperidone blood
exposure level that is therapeutically effective in a patient
having a CYP2D6 normal metabolizer genotype, wherein the second
amount of iloperidone is one of 25%, 50%, or 75% of the first
amount, and wherein a risk of QTc prolongation for a patient having
a CYP2D6 poor metabolizer genotype is lower following the internal
administration of the second amount of iloperidone than it would be
if the iloperidone were administered in the first amount.
2. The method of claim 1, wherein the performing or having
performed the genotyping assay step comprises: extracting or having
extracted genomic DNA or mRNA from the biological sample, and
sequencing or having sequenced CYP2D6 DNA derived from the
extracted genomic DNA or from the extracted mRNA, wherein the
sequencing or having sequenced step further comprises: amplifying
or having amplified a CYP2D6 region in the extracted genomic DNA or
mRNA to prepare a DNA sample enriched in DNA from the CYP2D6 gene
region; and sequencing or having sequenced the DNA sample by
hybridizing the DNA sample to nucleic acid probes to determine if
the patient has a genotype associated with reduced CYP2D6-mediated
metabolism.
3. The method of claim 1, wherein the CYP2D6 poor metabolizer
genotype includes two alleles, wherein each of the two alleles is
one of the following: *3, *4, *5, *6, *7, *8, *9, *10, *17, or *41,
and wherein the second amount is 50% of the first amount.
4. The method of claim 1, further comprising, if the patient has a
CYP2D6 intermediate metabolizer genotype, then internally
administering iloperidone to the patient in a third amount, wherein
the third amount is greater than the second amount, and smaller
than the first amount, and wherein a risk of QTc prolongation for a
patient having a CYP2D6 intermediate metabolizer genotype is lower
following the internal administration of the third amount of
iloperidone than it would be if the iloperidone were administered
in the first amount.
5. The method of claim 4, wherein the CYP2D6 intermediate
metabolizer genotype includes two alleles, wherein one of the two
alleles is one of the following: *3, *4, *5, *6, *7, *8, *9, *10,
*17, or *41, wherein the other of the two alleles is one of *1 or
*2.
6. The method of claim 1, wherein the first amount of iloperidone
is about 24 mg/day, and the second amount of iloperidone is about
12 mg/day.
7. The method of claim 4, wherein the first amount of iloperidone
is about 24 mg/day, the second amount of iloperidone is about 12
mg/day, and the third amount of iloperidone is at least 12 mg/day
and smaller than 24 mg/day.
8. The method of claim 1, wherein the first amount of iloperidone
and the second amount of iloperidone are provided in a controlled
release depot formulation of iloperidone.
9. The method of claim 8, wherein the first amount of iloperidone
is up to 1000 mg, and wherein the second amount of iloperidone is
up to 500 mg.
10. A method of treating a patient who is suffering from a
schizoaffective disorder, depression, Tourette's syndrome, a
psychotic disorder or a delusional disorder, the method comprising:
determining if the patient has a genotype associated with reduced
CYP2D6-mediated metabolism by obtaining or having obtained a
biological sample from the patient, and performing or having
performed a genotyping assay on the biological sample to determine
whether the patient has a genotype associated with reduced
CYP2D6-mediated metabolism, and if the patient has a CYP2D6 normal
metabolizer genotype, then internally administering iloperidone to
the patient in a first amount, and if the patient has a CYP2D6 poor
metabolizer genotype, then internally administering iloperidone to
the patient in a second amount, wherein the first amount of
iloperidone causes an iloperidone blood exposure level that is
therapeutically effective in a patient having a CYP2D6 normal
metabolizer genotype, and wherein the second amount of iloperidone
is one of 25%, 50%, or 75% of first amount.
11. The method of claim 10, wherein the patient is at risk for a
prolonged QT interval.
12. The method of claim 10, wherein the CYP2D6 poor metabolizer
genotype includes two alleles, wherein each of the two alleles is
one of the following: *3, *4, *5, *6, *7, *8, *9, *10, *17, or *41,
and wherein the second amount is 50% of the first amount.
13. The method of claim 10, further comprising, if the patient has
a CYP2D6 intermediate metabolizer genotype, then internally
administering iloperidone to the patient in a third amount, wherein
the third amount is greater than the second amount, and smaller
than the first amount, and wherein a risk of QTc prolongation for a
patient having a CYP2D6 intermediate metabolizer genotype is lower
following the internal administration of the third amount of
iloperidone than it would be if the iloperidone were administered
in the first amount.
14. The method of claim 13, wherein the CYP2D6 intermediate
metabolizer genotype includes two alleles, wherein one of the two
alleles is one of the following: *3, *4, *5, *6, *7, *8, *9, *10,
*17, or *41, wherein the other of the two alleles is one of *1 or
*2.
15. The method of claim 10, wherein the first amount of iloperidone
is about 24 mg/day, and the second amount of iloperidone is 12
mg/day.
16. The method of claim 10, wherein the first amount of iloperidone
is a controlled release depot formulation of iloperidone including
an amount of iloperidone of up to 1000 mg, and wherein the second
amount of iloperidone is a controlled release depot formulation of
iloperidone including an amount of iloperidone of up to about 500
mg.
17. A method of treating a patient who is suffering from a
schizoaffective disorder, depression, Tourette's syndrome, a
psychotic disorder or a delusional disorder, the method comprising:
determining if the patient is at risk for iloperidone-induced QTc
prolongation by obtaining or having obtained a biological sample
from the patient, and performing or having performed a genotyping
assay on the biological sample to determine whether the patient has
a CYP2D6 poor metabolizer genotype, wherein the presence of a
CYP2D6 poor metabolizer genotype indicates risk for
iloperidone-induced QTc prolongation, and if the patient is not at
risk for iloperidone-induced QTc prolongation, then internally
administering iloperidone to the patient in a first amount, and if
the patient is at risk for iloperidone-induced QTc prolongation,
then internally administering iloperidone to the patient in a
second amount, wherein the first amount of iloperidone causes an
iloperidone blood exposure level that is therapeutically effective
in a patient not having a CYP2D6 poor metabolizer genotype, and
wherein the second amount of iloperidone is one of 25%, 50%, or 75%
of first amount.
18. The method of claim 17, wherein the patient is at risk for
iloperidone-induced QTc prolongation, and is a CYP2D6 poor
metabolizer having a CYP2D6 genotype including two alleles, wherein
each of the two alleles is one of the following: *3, *4, *5, *6,
*7, *8, *9, *10, *17, or *41.
19. The method of claim 17, wherein the first amount of iloperidone
is a controlled release depot formulation of iloperidone including
an amount of iloperidone of up to about 1000 mg, and wherein the
second amount of iloperidone is a controlled release depot
formulation of iloperidone including an amount of iloperidone of up
to about 500 mg.
20. The method of claim 17, wherein the method comprises: wherein
the first amount of iloperidone is about 24 mg/day, and the second
amount of iloperidone is about 12 mg/day.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of co-pending U.S. patent
application Ser. No. 14/847,784, filed Sep. 8, 2015, which is a
continuation of U.S. patent application Ser. No. 14/044,183, filed
Oct. 2, 2013 (now abandoned), which is a continuation of U.S.
patent application Ser. No. 12/208,027, filed Sep. 10, 2008 (now
abandoned), which is a continuation-in-part of U.S. patent
application Ser. No. 11/576,178, filed Mar. 28, 2007 (now U.S. Pat.
No. 8,586,610, issued Nov. 19, 2013), which is a 35 U.S.C. .sctn.
371 national stage entry of International Patent Application No.
PCT/US2005/035526, filed Sep. 30, 2005, which claims the benefit of
U.S. Provisional Patent Application No. 60/614,798, filed Sep. 30,
2004. Each of the foregoing patent applications is incorporated
herein as though fully set forth.
SEQUENCE LISTING
[0002] The sequence listing contained in the electronic file
entitled "VAND-0002-US-CIP-CON3_SequenceListing.txt," created May
7, 2019 and comprising 4 KB, is hereby incorporated herein by
reference.
BACKGROUND OF THE INVENTION
[0003] Several genes associated with drug metabolism have been
found to be polymorphic. As a result, the abilities of individual
patients to metabolize a particular drug may vary greatly. This can
prove problematic or dangerous where an increased concentration of
a non-metabolized drug or its metabolites is capable of producing
unwanted physiological effects.
[0004] The cytochrome P450 2D6 gene (CYP2D6), located on chromosome
22, encodes the Phase I drug metabolizing enzyme debrisoquine
hydroxylase. A large number of drugs are known to be metabolized by
debrisoquine hydroxylase, including many common central nervous
system and cardiovascular drugs. One such drug is iloperidone
(1-[4-[3-[4-(6-fluoro-1,2-benzisoxazol-3-yl)-1-piperidinyl]propoxy]-3-met-
hoxyphenyl]ethanone). Iloperidone and methods for its production
and use as an antipsychotic and analgesic are described in U.S.
Pat. No. 5,364,866 to Strupczewski et al. The diseases and
disorders that can be treated by administration of iloperidone
include all forms of schizophrenia (i.e., paranoid, catatonic,
disorganized, undifferentiated, and residual), schizoaffective
disorders, bipolar mania/depression, cardiac arrhythmias,
Tourette's Syndrome, brief psychotic disorder, delusional disorder,
psychotic disorder NOS (not otherwise specified), psychotic
disorder due to a general medical condition, schizophreniform
disorder, and substance-induced psychotic disorder. P88 is an
active metabolite of iloperidone. See, e.g., PCT WO2003020707,
which is incorporated herein by reference.
[0005] Among the unwanted physiological effects associated with an
increased concentration of iloperidone or its metabolites is
prolongation of the electrocardiographic QT interval. Mutations in
the CYP2D6 gene have been associated with a number of drug
metabolism-related phenotypes. These include the ultra rapid
metabolizer (UM), extensive metabolizer (EM), intermediate
metabolizer (IM), and poor metabolizer (PM) phenotypes. Where a
particular drug is capable of producing unwanted physiological
effects in its metabolized or non-metabolized forms, it is
desirable to determine whether a patient is a poor metabolizer of
the drug prior to its administration.
[0006] A number of references are directed toward the
identification of CYP2D6 mutations and their corresponding
phenotypes. For example, United States Patent Application
Publication No. 2003/0083485 to Milos et al. describes a novel
CYP2D6 variant associated with the PM phenotype and methods for
assessing whether an individual possesses the variant prior to the
administration of a drug. United States Patent Application
Publication No. 2004/0072235 to Dawson describes a primer set
useful in identifying variants of the CYP2D6 gene. Similarly,
United States Patent Application Publication No. 2004/0091909 to
Huang describes methods for screening an individual for variants in
the CYP2D6 gene and other cytochrome P450 genes and tailoring the
individual's drug therapy according to his or her phenotypic
profile. Finally, United States Patent Application Publication No.
2004/0096874 to Neville et al. describes methods for identifying
cytochrome P450 variants.
SUMMARY OF THE INVENTION
[0007] The present invention comprises the discovery that treatment
of a patient, who has lower CYP2D6 activity than a normal person,
with a drug that is pre-disposed to cause QT prolongation and is
metabolized by the CYP2D6 enzyme, can be accomplishing more safely
by administering a lower dose of the drug than would be
administered to a person who has normal CYP2D6 enzyme activity.
Such drugs include, for example, dolasetron, paroxetine,
venlafaxin, and iloperidone. Patients who have lower than normal
CYP2D6 activity are herein referred to as CYP2D6 Poor
Metabolizers.
[0008] This invention also relates to methods for the
identification of genetic polymorphisms that may be associated with
a risk for QT prolongation after treatment with compounds
metabolized by the CYP2D6 enzyme, particularly iloperidone or an
active metabolite thereof or a pharmaceutically acceptable salt of
either (including, e.g., solvates, polymorphs, hydrates, and
stereoisomers thereof), and related methods of administering these
compounds to individuals with such polymorphisms.
[0009] The present invention describes an association between
genetic polymorphisms in the CYP2D6 locus, corresponding increases
in the concentrations of iloperidone or its metabolites, and the
effect of such increases in concentrations on corrected QT (QTc)
duration relative to baseline. Any number of formulas may be
employed to calculate the QTc, including, for example, the
Fridericia formula (QTcF) and the Bazett formula (QTcB), among
others. The present invention includes any such formula or method
for calculating a QTc.
[0010] A first aspect of the invention provides a method for
treating a patient with iloperidone or an active metabolite thereof
or a pharmaceutically acceptable salt of either, comprising the
steps of determining the patient's CYP2D6 genotype and
administering to the patient an effective amount of iloperidone or
an active metabolite thereof or a pharmaceutically acceptable salt
of either based on the patient's CYP2D6 genotype, such that
patients who are CYP2D6 poor metabolizers receive a lower dose than
patients who are CYP2D6 normal metabolizers.
[0011] Another aspect of the invention provides a method for
treating a patient who is a CYP2D6 poor metabolizer with
iloperidone or an active metabolite thereof or a pharmaceutically
acceptable salt of either, wherein the patient is administered a
lower dosage than would be given to an individual who is not a
CYP2D6 poor metabolizer.
[0012] Another aspect of the invention provides a method of
treating a patient with iloperidone or an active metabolite thereof
or a pharmaceutically acceptable salt of either comprising the
steps of determining whether the patient is being administered a
CYP2D6 inhibitor and reducing the dosage of drug if the patient is
being administered a CYP2D6 inhibitor.
[0013] Another aspect of the invention provides a method for
determining a patient's CYP2D6 phenotype comprising the steps of
administering to the patient a quantity of iloperidone or an active
metabolite thereof or a pharmaceutically acceptable salt of either,
determining a first concentration of at least one of iloperidone
and an iloperidone metabolite in the patient's blood, administering
to the patient at least one CYP2D6 inhibitor, determining a second
concentration of at least one of iloperidone and an iloperidone
metabolite in the patient's blood, and comparing the first and
second concentrations.
[0014] Another aspect of the invention provides a method for
determining whether a patient is at risk for prolongation of his or
her QTc interval due to iloperidone administration comprising the
step of: determining a patient's CYP2D6 metabolizer status by
either determining the patient's CYP2D6 genotype or CYP2D6
phenotype. In the case that a patient is determined to be at risk
for prolongation of his or her QTc interval, the dose of
iloperidone administered to the patient may be reduced.
[0015] Another aspect of the invention provides a method of
administering iloperidone or an active metabolite thereof, or a
pharmaceutically acceptable salt of either, for the treatment of a
disease or disorder in a human patient comprising the steps of
determining the activity of the patient's CYP2D6 enzyme on at least
one of iloperidone and its metabolites relative to the activity of
a wild type CYP2D6 enzyme and reducing the dose of at least one of
iloperidone and its pharmaceutically acceptable salts if the
patient's CYP2D6 enzyme activity is less than that of the wild type
CYP2D6.
[0016] Another aspect of the invention relates to modifying the
dose and/or frequency of dosing with iloperidone or a
pharmaceutically acceptable salt thereof based on the P88:P95 ratio
and/or the (P88+iloperidone):P95 ratio in a blood sample of a
patient being treated with iloperidone or P88, especially patients
susceptible to QT prolongation or to harmful effects associated
with QT prolongation.
[0017] Another aspect of the invention provides a kit for use in
determining a CYP2D6 genotype of an individual, comprising a
detection device, a sampling device, and instructions for use of
the kit.
[0018] Another aspect of the invention provides a kit for use in
determining a CYP2D6 phenotype of an individual, comprising a
detection device, a collection device, and instructions for use of
the kit.
[0019] Another aspect of the invention provides a kit for use in
determining at least one of a P88 to P95 ratio and a P88 and
iloperidone to P95 ratio in an individual, comprising a detection
device, a collection device, and instructions for use of the
kit.
[0020] Yet another aspect of the invention provides a method for
commercializing a pharmaceutical composition comprising at least
one of iloperidone, a pharmaceutically acceptable salt of
iloperidone, an active metabolite of iloperidone, and a
pharmaceutically acceptable salt of an active metabolite of
iloperidone, said method comprising: obtaining regulatory approval
of the composition by providing data to a regulatory agency
demonstrating that the composition is effective in treating humans
when administered in accordance with instructions to determine
whether or not a patient is a CYP2D6 poor metabolizer prior to
determining what dose to administer to the patient; and
disseminating information concerning the use of such composition in
such manner to prescribers or patients or both.
[0021] The foregoing and other features of the invention will be
apparent from the following more particular description of
embodiments of the invention.
DETAILED DESCRIPTION OF THE INVENTION
[0022] Iloperidone is a benzisoxazole-piperidinyl derivative,
currently in development for the treatment of CNS disorders. Data
from placebo-controlled Phase m studies of iloperidone showed a
Fridericia correction of QT duration (QTcF) increase of 0.1 to 8.5
msec at doses of 4-24 mg, when comparing a single ECG at baseline
to a single ECG at endpoint. At lower doses of iloperidone (4 mg-16
mg) QTcF prolongation was minimal (0.1-5 msec). In the most recent
study, a greater prolongation was observed when higher doses of
iloperidone (20-24 mg/day) were studied. The mean change in the
QTcF at doses 20-24 mg/day was 8.5 msec, and 4.6 msec in the 12-16
mg/day dose range in this study. These data suggest that treatment
with iloperidone can be associated with prolongation of the QT
interval similar to other drugs in this class, and that the effect
may be dose sensitive in the clinical dose range.
[0023] The research leading to the present invention was designed
to examine the effect of different doses of iloperidone relative to
the effect of ziprasidone and quetiapine on QTc duration under
carefully controlled conditions. To further evaluate the possible
relationship between exposure to iloperidone and the comparators to
QTc duration, reassessment after pharmacological inhibition of the
principle metabolic pathways for each drug, under steady-state
conditions, was also planned.
Example 1
[0024] Blood samples for pharmacogenetic analysis were collected at
screening. Two polymorphisms previously associated with poor
metabolizing status were genotyped in the CYP2D6 locus, and 251
genotypes were collected. The individual genotypes were studied for
detection of association between genotype class and concentrations
of iloperidone and its metabolites P88 and P95. The functional
effect of the polymorphisms was also evaluated by analyzing the
effect of the addition of the CYP2D6 inhibitor paroxetine on the
concentrations of the parent drug and its metabolites.
[0025] The research leading to the present invention identified a
significant association between CYP2D6 genotype and concentrations
of P88 before the addition of inhibitors as well as the effect of
this association on QTc prolongation.
[0026] Iloperidone is a substrate for two P450 enzymes; CYP2D6 and
CYP3A4. Most metabolic clearance of iloperidone depends on these
two enzymes. CYP2D6 catalyzes hydroxylation of the pendant acetyl
group to form metabolite P94, which is converted to P95 after some
additional reactions. Addition of the CYP2D6 inhibitor fluoxetine,
along with iloperidone resulted in increases of the area under the
curve (AUC) for iloperidone and P88 of 131% and 119% respectively.
Addition of the CYP3A4 inhibitor ketoconazole in interaction
studies resulted in a 38-58% increase in the concentrations of
iloperidone and its main metabolites P88 and P95. P88 has a
pharmacological profile including affinity for the HERG channel
similar to that of iloperidone. P95 is less lipophilic and is
dissimilar in its binding profile compared to iloperidone,
including having very low affinity for the HERG channel. For these
reasons P95 is regarded as being pharmacologically inactive.
[0027] The addition of metabolic inhibitors in this study therefore
allowed for an evaluation of the effect of increasing
blood-concentration of iloperidone and/or its metabolites on QT
duration. More specifically, this study allowed for an evaluation
of the effect of iloperidone on QTc before and after the addition
of the CYP2D6 inhibitor, paroxetine, as well as before and after
the addition of the CYP3A4 inhibitor, ketoconazole.
[0028] The CYP2D6 gene is highly polymorphic, with more than 70
allelic variants described so far. See, e.g.,
www.imm.ki.se/CYPalleles/CYP2D6.htm. Most embodiments of the
present invention concern the two most common polymorphisms within
the CYP2D6 gene in Caucasian populations, CYP2D6G)846A and
CYP2D6P34S (also referred to as CYP2D6C100T). These polymorphisms
correspond to nucleotides 3465 and 1719, respectively, in GenBank
sequence M33388.1 (GI:181303). The CYP2D6P34S/CYP2D6C100T
polymorphism also corresponds to nucleotide 100 in GenBank mRNA
sequence M20403.1 (GI:181349).
[0029] The CYP2D6G)846A polymorphism (known as the CYP2D6*4
alleles, encompassing *4A, *4B, *4C, *4D, *4E, *4F, *4G, *4H, *4J,
*4K, and *4L) represents a G to A transition at the junction
between intron 3 and exon 4, shifting the splice junction by one
base pair, resulting in frameshift and premature termination of the
protein (Kagimoto 1990, Gough 1990, Hanioka 1990). The
CYP2D6P34S/CYP2D6C100T polymorphism (known as the CYP2D6*10 and
CYP2D6*14 alleles) represents a C to T change that results in the
substitution of a Proline at position 34 by Serine (Yokota 1993,
Johansson 1994). Both of these polymorphisms have been associated
with reduced enzymatic activity for different substrates (Johansson
1994, Dahl 1995, Jaanson 2002, see also review by Bertilsson
2002)
[0030] Methods
[0031] A. Samples
[0032] 128 individuals consented to the pharmacogenetic study.
Blood samples were collected according to the pharmacogenetics
protocol and after the consent of patients. The DNA was extracted
from whole blood by Covance using the PUREGENE DNA isolation kit
(D-50K).
[0033] The 128 individuals that participated were a good
representation of the total sample of 165 individuals that
participated in the trial. 22 of 29 total were from the iloperidone
8 mg bid group, 30 of 34 were from the iloperidone 12 mg bid group,
22 of 31 from the 24 mg qd group, 3 of 5 of the risperidone group,
28 of 33 of the ziprazidone group, and 23 of 33 of the quetiapine
group.
[0034] B. Genotyping
[0035] Genotypes for the CYP2D6G1846A polymorphism were ascertained
for 123 of the 128 consenting individuals, while genotypes for the
CYP2D6C100T polymorphism were identified for all 128 participants.
Genotyping was performed on amplified DNA fragments. The CYP2D6
genomic region was amplified using a triplex PCR strategy (Neville
2002). In brief, primers used were:
TABLE-US-00001 Exons 1 & 2 SEQ. ID. 1, 2D6L1F1:
CTGGGCTGGGAGCAGCCTC SEQ. ID. 2, 2D6L1R1: CACTCGCTGGCCTGTTTCATGTC
Exons 3, 4, 5 & 6 SEQ. ID. 3, 2D6L2F: CTGGAATCCGGTGTCGAAGTGG
SEQ. ID. 4, 2D6L2R2: CTCGGCCCCTGCACTGTTTC Exons 7,8 & 9 SEQ.
ID. 5, 2D6L3F: GAGGCAAGAAGGAGTGTCAGGG SEQ. ID. 6, 2D6L3R5B:
AGTCCTGTGGTGAGGTGACGAGG
[0036] Amplification was performed on 40-100 ng of genomic DNA
using a GC-rich PCR kit (Roche Diagnostics, Mannheim, Germany)
according to the manufacturer's recommendations. Thermocycling
conditions were as follows: initial denaturation (3 min 95.degree.
C.), 10 cycles of 30 s of denaturation (30 s at 95.degree. C.),
annealing (30 s at 66.degree. C.), and extension, (60 s at
72.degree. C.) followed by 22 cycles: 30 s at 95.degree. C., 30 s
at 66.degree. C., 60 s+5 s/cycle at 72.degree. C. A final extension
followed (7 min at 72.degree. C.).
[0037] Third Wave Technologies, Inc (Madison, Wis.) developed the
probe sets for genotyping. Genotyping was performed on PCR products
using the Invader.RTM. assay (Lyamichev 1999) (Third Wave
Technologies, Inc) according to the manufacturer's
recommendations.
[0038] The genotypes of individuals distributed among the three
iloperidone groups were not significantly different (Table 1A and
1B).
TABLE-US-00002 TABLE 1A Genotype frequencies by iloperidone dose
class for CYP2D6C100T Iloperidone Genotype dose group CC CT TT
Total Ilo 8 mg bid 19.sup.a 2 1 22 Ilo 12 mg bid 23 6 1 30 Ilo 24
mg qd 15 6 1 22 Total 57 14 3 74 .sup.anumber of individuals
TABLE-US-00003 TABLE 1B Genotype frequencies by iloperidone dose
class for CYP2D6G1846A Iloperidone Genotype dose group AA AG GG
Total Ilo 8 mg bid 0 3 17 20 Ilo 12 mg bid 1 6 23 30 Ilo 24 mg qd 1
5 15 21 Total 2 14 55 71
[0039] C. Statistical Analysis
[0040] The genotype effect of the two CYP2D6 polymorphisms on
period 1 concentrations was evaluated using the following ANOVA
model. Concentrations of iloperidone, P88, and P95 at Period 1,
without inhibitor, at the time at which maximum blood concentration
of the parent compound or metabolite was reached (Tmax) were used
as the dependent variable, the genotypes of each polymorphism as
classes and the treatment as a covariate. In order to adjust for
treatment effects after the single dose of iloperidone, the 8 mg
bid was coded as 8, the 12 mg bid as 12 and the 24 mg qd as 24.
[0041] The function of these polymorphisms on the degree of
inhibition of the CYP2D6 enzyme was calculated from the ratio of
concentrations of P88 and P95 in period 2, after the addition of
the inhibitor of CYP2D6. The concentrations of iloperidone and/or
its metabolites (e.g., P88 and P95) may be determined in period 1
and/or period 2 by any known or later-developed method or device,
including titration.
[0042] Results and Discussion
[0043] In order to understand the functional significance of the
two CYP2D6 polymorphisms on the activity of the enzyme, the
association of the various genotypes with the relative
concentrations of the metabolites P88 and P95 were examined. It is
known that P88 is degraded by CYP2D6 and that CYP2D6 is involved in
the synthesis of P95. The relative amounts of P88 and P95 would
therefore be controlled by the activity of the CYP2D6 enzyme. The
ratio of P88/P95 was calculated before inhibition in Period 1 and
at the Tmax of the two metabolites, as well as the ratio of P88/P95
in Period 2 after the addition of the CYP2D6 inhibitor paroxetine.
In individuals with the wild type enzyme the concentration of P88
is expected to increase in Period 2, while in the same period the
concentration of P95 is expected to decline.
[0044] For Period 1 the mean P88/P95 ratio among the 91 iloperidone
treated patients was equal to 1.0 with a range from 0.14 to 8.19.
Among the same individuals for Period 2 the mean ratio was 2.4 with
a range from 0.5 to 8.49. The mean ratio of the ratios Period
1/Period 2 was equal to 0.37 with a range from 0.11 to 2.75.
[0045] Among the genotyped individuals the values were similar with
means of 1; 2.45; and 0.37 for Period 1, Period 2, and Period
1/Period 2 respectively, indicating no sample bias. For
polymorphism CYP2D6G)846A the means were significantly different
between the three-genotype classes AA, AG and GG. For AA the
respective values were 6.1, 3.41, and 1.89; for AG they were 2.4,
4.2, and 0.52; and for GG, 0.57, 1.94, and 0.28 (Table 2).
TABLE-US-00004 TABLE 2 Ratios of P88, P95 concentrations according
to genotype Popula- P88/P95 tion P88/P95 Period1 P88/P95 Period 2
(Period1/Period2) All 1.0 (0.14-8.19) 2.45 (0.50-8.49) 0.37
(0.11-2.75) CYP2D6G1846A AA 6.1 (3.96-8.19) 3.41 (2.96-3.87) 1.89
(1.0-2.75) AG 2.4 (0.44-7.0) 4.20 (2.2-7.57) 0.52 (0.14-1.28) GG
0.57 (0.14-2.2) 1.94 (0.52-4.71) 0.28 (0.11-0.61)
[0046] The differences between genotype classes were significant at
the p<0.0001 level in ANOVA test. These data suggest that the AA
class represent a CYP2D6 poor metabolizer as indicated by the high
ratio of P88/P95 in period 1 and the relatively small effect of the
addition of the inhibitor in Period 2. The AG class seems to
exhibit an intermediate phenotype between the poor metabolizer and
the wild type with an approximately 2-fold reduction of the CYP2D6
activity after the addition of the inhibitor, as indicated by the
ratio of the ratios (Table 2). This analysis provides a phenotypic
characterization of the CYP2D6G)846A polymorphism as it relates to
the metabolism of iloperidone.
[0047] Having established a functional role of this polymorphism,
the concentrations of P88 at Period 1 at the Tmax of P88 were
calculated for each genotype class. P88 concentrations were
significantly (p<0.005) higher for the AA and AG classes as
compared to the GG class for each of the three iloperidone dose
groups (Table 3).
TABLE-US-00005 TABLE 3 P88 concentrations in Period 1 according to
CYP2D6 genotype Genotype N obs LSMeans P value AA 2 62.70
<0.0001 AG 14 31.40 GG 55 21.03 TRT dose 0.0015 CYP2D6G1846A
*TRT dose 0.0058
[0048] Although the number of individuals carrying the A allele is
limited, the results obtained in the study consistently suggest
that individuals of the AA and AG class are expected to experience
higher concentrations of P88 at Tmax as compared with GG
individuals. Similar results were obtained with polymorphism
CYP2D6C100T (Table 4 and 5).
TABLE-US-00006 TABLE 4 Ratios of P88, P95 concentrations according
to genotype Popula- P88/P95 tion P88/P95 Period1 P88/P95 Period 2
(Period1/Period2) All 1.0 (0.14-8.19) 2.45 (0.50-8.49) 0.37
(0.11-2.75) CYP2D6C100T CC 0.6 (0.14-2.28) 1.93 (0.52-4.71) 0.27
(0.11-0.61) CT 2.2 (0.44-7.0) 4.14 (2.2-7.57) 0.49 (0.14-1.28) TT
5.24 (3.56-8.19) 4.19 (2.96-5.74) 1.46 (0.62-2.75)
TABLE-US-00007 TABLE 5 P88 concentrations in Period 1 according to
CYP2D6 genotype Genotype N obs LSMeans P value CC 57 21.03 CT 14
33.16 <0.0001 TT 3 51.00 TRT dose <0.0001 CYP2D6C100T *TRT
dose 0.0015
[0049] This result is expected given the fact that this
polymorphism is in almost complete linkage disequilibrium with the
CYP2D6G)846A polymorphism.
[0050] In order to understand whether the difference in
concentration of P88 at Period 1 Tmax was relevant to the increases
in QTc after the addition of the inhibitors, the observed mean of
P88 for the CYP2D6G)846A AG group was used to divide all
individuals into two classes. The first includes individuals with
P88 concentrations at Period 3, after the addition of both
inhibitors, of equal to or less than 34 ng/mL and the second class
includes individuals with P88 concentration greater than 34 ng/mL.
The two classes were then compared in regards to the QTc change
from baseline at Period 3. Using an ANOVA statistic for the first
class P88>34 (n=55) the QTc mean change from baseline in Period
3 was 22.7 msec and that for P88.ltoreq.34 (n=12) the mean QTc for
the same period was 7.7 msec. The QTc changes from baseline for
Period 1 and Period 2 according to genotype and iloperidone dose
are given in Table 6 and 7.
TABLE-US-00008 TABLE 6 QTc change at Period 1 according to CYP2D6
genotype and iloperidone dose Iloperidone Dose Genotype 8 mg bid 12
mg bid 24 mg qd CYP2D6G1846A AA 17.7 (1).sup.a 38.4 (1) AG -0.8 (3)
5.8 (6) 19.0 (5) GG 7.8 (17) 11.8 (23) 14.0 (14) CYP2D6C100T TT
-8.4 (1) 17.7 (1) 38.4 (1) CT 2.9 (2) 5.8 (6) 19.0 (5) CC 7.8 (17)
11.8 (23) 9.5 (14) .sup.anumber of individuals
TABLE-US-00009 TABLE 7 QTc change at Period 2 according to CYP2D6
genotype and iloperidone dose Iloperidone Dose Genotype 8 mg bid 12
mg bid 24 mg qd CYP2D6G1846A AA 25.0 (1) 28.4 (1) AG 8.1 (3) 8.7
(6) 20.6 (5) GG 11.7 (18) 14.5 (21) 16.4 (15) CYP2D6C100T TT -0.7
(1) 25.0 (1) 28.4 (1) CT 12.5 (2) 8.7 (6) 20.6 (5) CC 11.7 (16)
14.5 (21) 16.4 (15)
[0051] These results should be viewed with caution, however, since
the number of observations is small. If one was to focus on the
iloperidone 24 mg qd, there is a trend for higher QTc among AA, and
AG individuals for CYP2D6G)846A as compared to GG. This difference
disappears after the addition of the CYP2D6 inhibitor in Period
2.
[0052] These observations suggest that the differences in P88
concentrations during Period 1 between the different classes of
genotypes may be relevant to QTc changes from baseline. Given the
small number of observations and the unbalanced in regards to
genotype design of the study, a confirmatory prospectively designed
study may be required before any further interpretation of this
data is warranted.
[0053] Notwithstanding these caveats, the results discussed above
show that patients can be more safely treated with iloperidone if
the dose of iloperidone is adjusted based on the CYP2D6 genotype of
each patient. For example, if a patient has a genotype which
results in decreased activity of the CYP2D6 protein relative to the
wild type CYP2D6, then the dose of iloperidone administered to such
patient would be reduced to, for example, 75% or less, 50% or less,
or 25% or less of the dose typically administered to a patient
having a CYP2D6 genotype that results in a CYP2D6 protein that has
the same or substantially the same enzymatic activity on P88 as the
wild type CYP2D6 genotype/protein. For example, where the normal
dosage of iloperidone or other CYP2D6-metabolized compound
administered to an individual is 24 mg per day, an individual with
a genotype associated with decreased CYP2D6 activity may receive a
reduced dosage of 18, 12, or 6 mg per day.
[0054] Decreased CYP2D6 activity may be the result of other
mutations, including those described at
www.imm.ki.se/CYPalleles/CYP2D6.htm, which is incorporated herein
by reference. In particular, it is noted that the CYP2D6*2A
mutation includes a CYP2D7 gene conversion in intron 1. In some
cases, the lower CYP2D6 activity in a CYP2D6 poor metabolizer may
be due to factors other than genotype. For example, a patient may
be undergoing treatment with an agent, e.g., a drug that reduces
CYP2D6 activity.
[0055] QTc prolongation is correlated to the ratios of P88/P95 and
(iloperidone+P88)/P95. The mean ratios among CYP2D6 extensive
metabolizers were 0.57 and 1.00, respectively. As shown above in
Tables 3 and 5, CYP2D6 poor metabolizers have elevated P88 levels
compared to CYP2D6 extensive metabolizers.
[0056] As CYP2D6 poor metabolizers comprise approximately 15% of
the population, it was found that approximately 15% of those
studied exhibited a P88/P95 ratio greater than 2.0 while the
remaining 85% exhibited P88/P95 ratios less than 2.0. Table 8 below
shows the least squares mean change in QTc for each dosage group.
While the results for some groups are not statistically
significant, they do indicate a trend supporting the hypothesis
that QTc prolongation is correlated to P88/P95 ratio. Similar
results were obtained when cutoff ratios of 3.0 and 4.0 were
analyzed, providing further support to the hypothesis that the
extent of QTc prolongation a patient may experience after treatment
can be predicted by measuring P88 and P95 blood levels.
TABLE-US-00010 TABLE 8 Mean QTc Prolongation According to P88/P95
Ratio LSMean LSMean LSMean LSMean LSMean QTc change QTc change QTc
change QTc change QTc change from Baseline P88/P95 from Baseline
from Baseline from Baseline from Baseline All Treatment Ratio 8 mg
bid 12 mg bid 8 + 12 mg bid 24 qd Groups <2 7.2 (n = 23) 8.7 (n
= 31) 8.3 (n = 54) 13.9 (n = 24) 10.244 (n = 78) >2 21.3 (n = 5)
17.4 (n = 3) 18.3 (n = 8) 29.4 (n = 5) 21.111 (n = 13) P value
0.0725 0.392 0.0815 0.0329 0.0131
[0057] Similar results were observed when considering QTc
correlation to the (iloperidone+P88)/P95 ratio. Again, as
approximately 15% of the population are CYP2D6 poor metabolizers,
it was found that approximately 15% of those studied exhibited
(iloperidone+P88)/P95 ratios greater than 3.0 while the remaining
85% exhibited ratios less than 3.0. Table 9 below shows the least
squares mean change in QTc for each dosage group. While the results
for some groups are not statistically significant, they do indicate
a trend supporting the hypothesis that QTc prolongation is
correlated to (iloperidone+P88)/P95 ratio. Indeed, when cutoff
ratios of 3 and higher were analyzed, similar results were obtained
providing further support to the hypothesis that the extent of QTc
prolongation a patient may experience after treatment can be
predicted by measuring iloperidone, P88 and P95 blood levels.
TABLE-US-00011 TABLE 9 Mean QTc Prolongation According to
(iloperidone + P88)/P95 Ratio LSMean LSMean LSMean LSMean LSMean
QTc change QTc change QTc change QTc change QTc change from
Baseline (ILO + P88)/ from Baseline from Baseline from Baseline
from Baseline All Treatment P95 Ratio 8 mg bid 12 mg bid 8 + 12 mg
bid 24 qd Groups <3 7.2 (n = 23) 8.7 (n = 31) 8.3 (n = 54) 14.4
(n = 24) 10.424 (n = 78) >3 21.3 (n = 5) 15.2 (n = 3) 17.3 (n =
8) 30.5 (n = 5) 20.031 (n = 13) P value 0.0725 0.4223 0.0857 0.0522
0.0278
[0058] While the CYP2D6G)846A (AA or AG) genotype and the
CYP2D6C100T (CT or TT) genotype are illustrated in this Example 1,
the method of the invention can employ other genotypes that result
in decreased activity of the CYP2D6 protein on iloperidone and P88.
It is within the skill of the art, based on the disclosure herein,
to identify additional CYP2D6 genotypes that result in decreased
enzymatic activity on iloperidone and P88.
Example 2
[0059] A second study extended the pharmacogenomic assessment of
iloperidone response by genotyping additional CYP2D6 variants which
lead to the production of a non-functional protein or reduced
enzymatic activity.
[0060] Six of the variants have been shown to result in the absence
of a functional enzyme, either because of a deletion of the gene
(as in the CYP2D6 *5 polymorphism), a frameshift (*3 and *6), a
splicing error (*4), or a truncated or abnormal protein (*7 and
*8). Five other polymorphisms were genotyped that resulted in the
production of a functional protein that was shown to have a
significantly decreased enzymatic activity on various compounds
such as debrisoquine or sparteine (*9, *10, *17, *41), or only a
modest reduction in activity (*2). The actual impact of these
individual polymorphisms on the enzyme vary from compound to
compound, and the presence of several of them in the same protein
can further reduce the CYP2D6 activity.
[0061] Methods
[0062] A. Samples
[0063] From the 300 iloperidone-treated patients initially
genotyped for the CYP2D6*4 and *10 variants (VP-VYV-683-3101), 222
remaining DNA samples were used for this extended pharmacogenomic
analysis. One patient was excluded from the analysis due to
inconsistent results for the CYP2D6 allele *4 generated by Quest
Diagnostics Central Laboratory (Collegeville, Pa.) and Cogenics
(Morrisville, N.C.). Pharmacokinetic data of the
(iloperidone+P88)/P95 ratio was available for 168 of these
patients. QT measurement at Day 14 and 28 was available for 169 and
146 patients respectively.
[0064] B. Genotyping
[0065] Eleven specific CYP2D6 polymorphisms were evaluated (Table
10).
TABLE-US-00012 TABLE 10 CYP2D6 polymorphisms Enzyme Allele DNA
variations Effect activity *1 Wild type Normal *2 2850C > T;
4180G > C R296C; S486T Normal (dx, d, s) *3 2549del
259Frameshift None (d, s) *4 100C > T; 1661G > C; 1846G >
A P34S; splicing None (d, s) defect *5 CYP2D6 deletion CYP2D6
deleted None (d, s) *6 1707delT 118Frameshift None (d, s, dx) *7
2935A > C H324P None (s) *8 1661G > C; 1758G > T; 2850C
> T; 4180G > C G169X None (d, s) *9 2615.sub.--2617delAAG
K281del Decreased (b, d, s) *10 100C > T; 1661G > C; 4180G
> C P34S; S486T Decreased (d, s) *17 1023C > T; 1661G > C;
2850C > T; 4180G > C T107I; R296C; Decreased (d) S486T *41
-1584C; -1235A > G; -740C > T; -678G > A; R296C; splicing
Decreased (s) CYP2D7 gene conversion in intron 1; 1661G > C;
2850C > T; defect; S486T 2988G > A; 4180G > C The DNA
variations and their effects at the RNA or protein level listed
here are based on the description by the Human Cytochrome P450
(CTP) Allele Nomenclature Committee available at:
http://www.cypalleles.ki.se/CYP2D6.htm. The in-vivo changes in
enzyme activity have been reported for bufuralol (b), debrisoquine
(d), dextromethorphan (dx), or sparteine (s). The specific
polymorphisms genotyped in the study reported here are shown in
bold.
[0066] The genotypes of the CYP2D6* 10 allele were generated by
Quest Diagnostics Central Laboratory (Collegeville, Pa.); the
genotypes of the CYP2D6 *2, *3, *5, *6, *7, *8, *9, *17 and *41
alleles were generated by Cogenics (Morrisville, N.C.); and the
genotypes of the CYP2D6 *4 allele were obtained from Quest and also
from Cogenics for a subset of patients.
[0067] The CYP2D6*2 allele is characterized by a series of
mutations. In this assay, the cytosine to thymine transition at
position 2850, which results in an arginine to cysteine
substitution at amino acid 296, was tested (Johansson et al., 1993;
Wang et al. 1995). The first round product from CYP2D6 multiplex
PCR was amplified and the resulting product was digested with HhaI.
The HhaI digestion resulted in 476, 372, 247, 178, and 84 basepair
fragments for wt/wt genotype; 550, 476, 372, 247, 178, and 84
basepair fragments for *2/wt genotype; and 550, 476, 247, and 84
basepair fragments for *2/*2 genotype. The PCR products were gel
electrophoresed and photographed under ultraviolet light.
[0068] The presence of the CYP2D6 alleles *3, *4, *6, *7, and *8
was assayed using multiplex PCR (Stuven et al. 1996). The CYP2D6 *3
allele results from a single base (adenine) deletion at nucleotide
2549 in exon 5 (Buchert et al., 1993). The defect in the CYP2D6 *4
allele is due to a guanine to adenine transition in the last
nucleotide (position 1846) of intron 3 resulting in an aberrant 3'
splice recognition site (Hanioka et al. 1990). The CYP2D6 *6 allele
results from a thymine deletion at position 1707 in exon 3
resulting in a premature stop codon (Saxena et al. 1994). The
CYP2D6 *7 allele results from an adenine to cytosine missense
mutation at position 2935 which results in a histidine to proline
substitution at amino acid 324 in exon 6 leading to a total loss of
enzyme function (Evert et al. 1994). The defect in the CYP2D6 *8
allele is due to a guanine to thymine transition at position 1758
resulting in the insertion of a premature stop codon (Stuven et al.
1996).
[0069] The first round amplification generated a 1578 basepair
product containing all five alleles. The 1578 basepair product
served as the template for a multiplex allele-specific assay to
simultaneously identify the five alleles. First round PCR template
was added to two separate master mixes containing primers that
recognize wild type or mutant alleles. These primers produce PCR
products of 1394, 1010, 304, 219, and 167 basepairs for *7, *3, *4,
*8, and *6 alleles, respectively. As an internal control, the
primers for *8 were reversed; that is, the primer that recognizes
the wild-type allele for *8 was present in the mutant master mix
and the primer for the mutant allele for *8 was present in the
wild-type master mix. For wild-type genotypes (except for *8), PCR
products appeared in the wild-type lanes while no PCR products were
observed in the mutant lane. For heterozygous genotypes, PCR
products of the same fragment size appeared in both the wild-type
and mutant lanes. For mutant genotypes (except for *8), PCR product
appeared only in the mutant lane. The PCR products were gel
electrophoresed and photographed under ultraviolet light.
[0070] The CYP2D6 *5 allele results from a complete deletion of the
CYP2D6 gene (Gaedigk et al. 1991; Steen et al. 1995). A long-range
PCR method was used to identify a deletion of the CYP2D6 locus.
Presence or absence and intensity of PCR products identified the
wild-type, heterozygous mutant, or mutant alleles. The PCR products
were gel electrophoresed and photographed under ultraviolet
light.
[0071] The CYP2D6 *9 mutation is a 3 basepair deletion at positions
2613-2615 (Tyndale et al. 1991). This results in a deletion of
lysine at amino acid 281. The CYP2D6 *41 mutation is due to a
guanine to adenine transition at position 2988 (Raimundo et al.
2004). The first round of amplification generated a 1578 basepair
product containing the two alleles. The 1578 basepair product
served as the template for a multiplex allele-specific assay to
simultaneously identify the two alleles. First round PCR template
was added to two separate master mixes containing primers that
recognize wild-type or mutant alleles. These primers produced PCR
products of 409, 593, and 780 basepairs for the *9 wild-type,
internal control, and *41 wild-type, respectively. For wild-type
genotypes, PCR products appeared in the wild-type lanes while no
PCR products were observed in the mutant lane. For heterozygous
genotypes, PCR products appeared in both the wild-type and mutant
lanes. For mutant genotypes, PCR product appeared only in the
mutant lane. The PCR products were gel electrophoresed and
photographed under ultraviolet light.
[0072] The CYP2D6 * 17 allele results from a cytosine to thymine
base change at position 1023 which results in a threonine to
isoleucine substitution at amino acid 107 in exon 2 (Masimirembwa
et al. 1996). The first round of amplification generated a 369
basepair product containing the CYP2D6 *17 allele. The first round
PCR template was added to two separate master mixes containing
primers that recognize wild-type or mutant alleles as well as an
internal control. These primers produced PCR products of 235 and
181 basepairs for the * 17 allele and internal control,
respectively. For a wild-type genotype, both PCR products appeared
in the wild-type lanes while only the internal control PCR product
was observed in the mutant lane. For heterozygous genotypes, both
PCR products appeared in both the wild-type and mutant lanes. For a
mutant genotype, both PCR products appeared in the mutant lanes
while only the internal control PCR product is observed in the
wild-type lane. The PCR products were gel electrophoresed and
photographed under ultraviolet light.
[0073] C. Statistical Analysis
[0074] Analyses were performed on observed case data using an
ANCOVA model with the baseline value as a covariate for the change
from baseline in QTc (Fridericia formula) and using an ANOVA model
for iloperidone blood exposure at Day 14 and Day 28. Linkage
disequilibrium analysis was performed using Haploview v4.0 (Barrett
et al, 2005).
[0075] Statistically significant associations were observed between
the CYP2D6 *4, CYP2D6 *5, CYP2D6 *10, and CYP2D6 *41 alleles and
the iloperidone blood exposure levels. The ratio of drug
concentration [(iloperidone+P88)/P95] was increased with the
presence of non-functional CYP2D6 alleles and of variants possibly
associated with decreased enzymatic activity. Furthermore, patients
who carried at least one non-functional CYP2D6 allele had a higher
QTc prolongation after 14 days of iloperidone treatment than those
with two functional copies. By Day 28, the QTcF prolongation was
reduced but was still statistically different between the two
patient groups.
[0076] The eleven CYP2D6 variants that were genotyped in
iloperidone-treated patients are listed in Table 10, and their
respective allele frequency per race is provided in Table 11.
TABLE-US-00013 TABLE 11 CYP2D6 Allele Frequencies in
Iloperidone-treated Patients Black & African Overall Asian
Americans White Others Allele (N = 222) (N = 17) (N = 108) (N = 89)
(N = 8) *2 39.2% (n = 174) 32.3% (n = 11) 44.4% (n = 96) 34.3% (n =
61) 37.5% (n = 6) .sup. *4.sup..dagger. 12.7% (n = 75) 12.0% (n =
6) 11.0% (n = 33) 16.2% (n = 35) 3.8% (n = 1) *5 5.2% (n = 23) 2.9%
(n = 1) 6.0% (n = 13) 4.5% (n = 8) 6.3% (n = 1) *6 0.4% (n = 2)
0.0% (n = 0) 0.5% (n = 1) 0.5% (n = 1) 0.0% (n = 0) *7 0.2% (n = 1)
2.9% (n = 1) 0.0% (n = 0) 0.0% (n = 0) 0.0% (n = 0) *8 0.0% (n = 0)
0.0% (n = 0) 0.0% (n = 0) 0.0% (n = 0) 0.0% (n = 0) *9 1.8% (n = 8)
0.0% (n = 0) 0.5% (n = 1) 3.9% (n = 7) 0.0% (n = 0)
*10.sup..dagger. 16.0% (n = 95) 20.0% (n = 10) 14.7% (n = 44) 17.1%
(n = 37) 15.4% (n = 4) *17 9.5% (n = 42) 5.9% (n = 2) 17.6% (n =
38) 1.1% (n = 2) 0.0% (n = 0) *41 5.9% (n = 26) 8.8% (n = 3) 1.4%
(n = 3) 11.2% (n = 20) 0.0% (n = 0) .sup..dagger.Genotypes for an
additional 74 patients were obtained for markers *4 and *10,
including 8 Asians, 42 Black and African Americans, 19 Whites, and
5 from other racial groups. N and n denote the number of patients
and the number of alleles, respectively, from which frequencies
were determined.
[0077] Six non-functional CYP2D6 variants were genotyped: *3, *4,
*5, *6, *7, and *8. The most common variant was *4, detected in
16.2%, 11.0%, and 12.0% White, Black and African American, and
Asian patients, respectively. It has been previously reported that
the *4 variant was the most common non-functional CYP2D6 variant
among Caucasians (.about.20%) and African Americans (7.5%), while
it was expected to be rare among Asians (Bradford 2002). The *5
variant was observed at a frequency of 3-6%, depending on the
racial group, consistent with previous reports (Bradford 2002). As
expected, *3, *6, *7 were rare, and *8 was not observed in any
patient.
[0078] Four variants were genotyped which are associated with
reduced CYP2D6 enzymatic activity: *10 has been observed frequently
in Asia (38-70%), *17 has been reported in .about.22% of African
Americans, *41 is believed to be common among Caucasians (possibly
.about.20%), and *9 has been observed only in a small percentage of
individuals (1-2%) (Bradford 2002).
[0079] The * 10 variant was observed in 15-20% of the
iloperidone-treated patients across all racial groups. * 10
occurred more frequently than expected for Whites and African
Americans, but less frequently among Asians. Other studies have
reported a high percentage of *10 in Asians (all above 38%) but a
much lower percentage in Caucasians (4-8%) and in African Americans
(2-7%) (Bradford 2002). Variant *17 was the most common variant in
Black and African Americans (17.6%), and more rare in Asians (5.9%)
and Whites (1.1%); this result is in agreement with the expected
frequencies for these populations (Bradford 2002).
[0080] As expected, the *41 variant was most common amongst Whites
(11.2%) and rare in African Americans (1.4%). This variant, which
has not been extensively studied in other populations, was also
seen in 8.8% of Asians.
[0081] The functional *2 variant has been reported as the most
commonly occurring variant coding for a CYP2D6 protein, with a
slightly reduced activity (.about.80% of the wild type) (Bradford
2002). The *2 variant was the most commonly observed variant, with
a frequency of 32 to 44% depending of the racial group.
[0082] Because of the high frequency of the CYP2D6 variants, it is
likely that a number of individuals carry more than one allele
associated with reduced or abolished enzymatic activity.
[0083] Only 7 patients (3.1%) with 2 non-functional alleles were
identified in this study: 6 homozygotes *4/*4 and one compound
heterozygote *5/*4. Seventy-two patients (32.1%) had only one
functional copy of CYP2D6. Sixty-one patients (27.2%) had 2
functional copies of CYP2D6, with one or 2 allelic variants with
possible decreased enzymatic activity. The other 84 patients
(37.5%) carried only the *2 variant or were homozygote wt/wt at
each variant locus. Linkage Disequilibrium (LD) analysis revealed
that several CYP2D6 loci were in complete linkage disequilibrium.
The *4 variant was in LD with * 10 (D'=1, LD 42.33) and *2 (D'=1,
LD 5.75). The *2 variant was also in LD with *17 (D'=1, LD 13.44),
*10 (D'=1, LD 8.89), and *41 (D'=1, LD 5.43).
[0084] Analysis of individual CYP2D6 variants with iloperidone
blood exposure showed that the *4 and * 10 variants were
significantly associated with the (iloperidone+P88)/P95 ratio, with
ratios of 2.28 for the *4 allele as compared to 1.10 for the wt
(p=2.8E-08) and 2.20 for the *10 allele as compared to 1.03 for the
wt (p=2.4E-09) (Table 12). Significant association was also seen
for the *5 and *41 variants with ratios of 2.16 for the *5 allele
as compared to 1.19 for the wt (p=0.0016) and 2.02 for the *41
allele as compared to 1.19 for the wt (p=0.0045) (Table 12).
TABLE-US-00014 TABLE 12 Association of CYP2D6 Alleles With Exposure
to Iloperidone at Day 14 Mean (Iloperidone + Variant Allele N
P88)/P95 Ratio P value CYP2D6 *2 *2 104 1.37 0.45 wt 60 1.21 CYP2D6
*4 *4 53 2.28 2.8E-08 wt 165 1.10 CYP2D6 *5 *5 20 2.16 0.0016 wt
144 1.19 CYP2D6 *7 *7 1 1.97 0.61 wt 163 1.30 CYP2D6 *9 *9 8 1.33
0.96 wt 156 1.3 CYP2D6 *10 *10 67 2.20 2.4E-09 wt 151 1.03 CYP2D6
*17 *17 28 0.93 0.090 wt 136 1.39 CYP2D6 *41 *41 23 2.02 0.0045 wt
141 1.19
[0085] As discussed previously, the presence of multiple CYP2D6
variants may further affect the overall amount of CYP2D6 expressed
and its total enzymatic activity. Therefore, an additional analysis
was conducted, taking into account the presence of all functional
and non-functional alleles as well as the expected decreased
activity associated with some of the variants. A clear gradient of
increased (iloperidone+P88)/P95 ratio was observed with the
presence of alleles associated with decreased activity and
non-functional alleles (Table 13). Patients with 2 non-functional
alleles were found to have an (iloperidone+P88)/P95 ratio of 6.4,
which was much higher than patients with only one non-functional
allele (1.8), with one or two alleles associated with decreased
activity (1.15), or with two functional alleles (0.80) (Table
13).
TABLE-US-00015 TABLE 13 Effect of CYP2D6 Variants on Iloperidone
Blood Exposure at Day 14 Combination of 2 CYP2D6 Mean (Iloperidone
+ alleles N P88)/P95 Ratio P value 2 functional alleles (*1 or 60
0.80 *2) 2 functional alleles with 1 49 1.15 0.018 or 2 alleles
associated with decreased activity 1 non-functional allele, and 54
1.80 1.1E-07 1 functional allele associated or not with decreased
activity 2 non-functional alleles 5 6.40 3.1E-17
[0086] Since a significantly decreased metabolism of iloperidone
was observed in patients who carried at least one non-functional
CYP2D6 allele, whether or not these patients had also an increased
QTcF prolongation after iloperidone treatment (Table 14) was also
investigated. After 14 days of treatment, patients with at least
one non-functional CYP2D6 allele had a significantly higher
prolongation of the QTcF interval (16.3 msec) than those with 2
functional copies (9.7 msec, p=0.01). By Day 28, the QTcF
prolongation was reduced but was still statistically different
between the 2 groups (11.4 and 4.4 msec respectively, p=0.02).
TABLE-US-00016 TABLE 14 Effect of CYP2D6 Variants on QTcF
prolongation Day 14 Day 28 QTcF change Mean (Iloperidone + QTcF
change Mean (Iloperidone + CYP2D6 alleles (msec) .sup..dagger.
P88)/P95 Ratio (msec) .sup..dagger. P88)/P95 Ratio 2 functional 9.7
(N = 110) 1.0 (N = 109) 4.4 (N = 90) 0.8 (N = 103) alleles 1 or 2
non- 16.3 (N = 59) 2.2 (N = 59) 11.4 (N = 56) 2.4 (N = 59)
functional alleles P = 0.01 P = 6.8E-08 P = 0.02 P = 1.4E-07
.sup..dagger. LS Squares Mean QTcF change from baseline
[0087] D. Results and Discussion
[0088] Comparison based on the (iloperidone+P88)/P95 ratio
regardless of the specific CYP2D6 genotype revealed that patients
with a ratio .ltoreq.1 have a QTc at Day 14 of 7.9 msec as compared
to 16.0 msec for patients with a ratio >1, p=0.0002 (Table 15).
At Day 28, QTcF was reduced to 4.8 and 10.1 msec for patients with
a ratio .ltoreq.1 or >1 respectively.
TABLE-US-00017 TABLE 15 Effect of Iloperidone Blood Exposure on
QTcF prolongation Mean (Iloperidone + Day 14 Day 28 P88)/P95 Ratio
QTcF change (msec) .sup..dagger. QTcF change (msec) .sup..dagger.
.ltoreq.1 7.9 (N = 127) 4.8 (N = 119) >1 16.0 (N = 99) 10.1 (N =
79) P = 0.0002 P = 0.062 .sup..dagger. LS Squares Mean QTcF change
from baseline
[0089] The genotyping of multiple CYP2D6 variants in more than 200
iloperidone-treated patients (Table 11) revealed that the CYP2D6*4
and *10 alleles, which are in linkage disequilibrium, were the most
common alleles associated with decreased or abolished enzymatic
activity in Whites (16.2 and 17.1% respectively ) and Asians (12
and 20% respectively). In Black and African Americans, the * 17
allele was more common than the *4 and * 10 alleles (17.6% vs. 11
and 14.7% respectively). The frequency of the *5 allele was
.about.5%, while the other non-functional alleles were very rare.
Most extensive analyses of frequency data of CYP2D6 variants came
from European Caucasians populations, Chinese and Japanese
populations, or selected African regions. To date, few studies have
been reported on allele frequencies in the US population, and some
of the differences observed in this study with data from European
Caucasians, Africans, Chinese or Japanese populations are likely to
reflect regional and national specificities of US populations.
[0090] It was observed that the *4, *10, *5 and *41 alleles were
significantly associated with a reduced CYP2D6 iloperidone
metabolism, more specifically, an increase of the
(iloperidone+P88)/P95 ratio (Table 12). When taking into account
the genotype data of all alleles tested, this ratio was shown to be
clearly dependent on the number of non-functional alleles and of
alleles associated with decreased activity (Table 13).
[0091] Furthermore it appears that the reduced iloperidone
metabolism was associated with a higher QTcF prolongation after 14
and 28 days of treatment. A significant difference was observed
between patients with at least one-functional CYP2D6 allele and
patients with 2 functional alleles (Table 14). This difference was
also observed between patients with a (iloperidone+P88)/P95 ratio
.ltoreq.1 or >1 regardless of their specific CYP2D6 genotypes
(Table 15). These results offer a potential risk management
strategy and prospective testing tools for physicians when treating
patients with iloperidone if the potential for QTcF prolongation is
considered to be a risk for the patient.
[0092] The starting point for determining the optimum dose of
iloperidone is, as discussed above, a dose that has been shown to
be acceptably safe and effective in patients having a CYP2D6
genotype that results in a protein having the same activity on
iloperidone and P88 as the wild type CYP2D6 protein. Such doses are
known in the art and are disclosed, for example, in U.S. Pat. No.
5,364,866 discussed above.
[0093] Generally, the dose of iloperidone administered to a patient
will be decreased, as discussed above, if the enzymatic activity of
the CYP2D6 enzyme on iloperidone and P88 is less than about 75% of
that of the wild type CYP2D6. Enzymatic activity may be determined
by any number of methods, including, for example, measuring the
levels of iloperidone and/or P88 in an individual's blood. In such
a case, the iloperidone dose can be lowered such that measured
levels of iloperidone and/or P88 are substantially the same as
levels measured in the blood of individuals having normal CYP2D6
enzymatic activity. For example, if the CYP2D6 enzymatic activity
of a patient is estimated by one or more methods (e.g., genotyping,
determination of dextromorphan blood levels) to be 50% of the
enzymatic activity normally observed in an individual having normal
CYP2D6 enzymatic activity, the dose for the patient may need to be
adjusted to one-half of the dose given to an individual having
normal CYP2D6 enzymatic activity. Similarly, for ultrarapid
metabolizers, an analogous calculation will lead to the conclusion
that a dose adjustment of twice that given an individual having
normal CYP2D6 enzymatic activity may be needed in order to achieve
similar blood levels for the parent compound and active
metabolites.
[0094] Alternatively, the dose of iloperidone administered to a
patient may be decreased based upon the patient's CYP2D6 genotype
alone, or upon the patient's P88:P95 or (iloperidone+P88):P95
ratios. For example, if a patient has a "poor metabolizer"
genotype, or has a high P88:P95 or (iloperidone+P88):P95 ratio, the
patient's dose of iloperidone may be reduced by, for example, 25%,
50%, or 75%. A patient's genotype can be readily determined using
standard techniques on samples of body fluids or tissue. Such
techniques are disclosed, e.g., in PCT Application Publication
Number WO03054226.
[0095] Furthermore, while the disclosure herein focuses on
genotype, it is apparent to one of skill in the art that phenotype
can also be used as an indicator of decreased activity of the
CYP2D6 protein on iloperidone and P88. For example, McElroy et al.
describe a correlation between CYP2D6 phenotype and genotyping as
determined by dextromethorphan/dextrorphan ratios. Therefore,
although it is more convenient given the state of the art to look
at genotype, if one were to determine that a given patient
expressed a mutant CYP2D6 with lower activity on iloperidone and
P88 than the wild type, or expressed abnormally low amounts of
CYP2D6, then that patient would be given a lower dose of
iloperidone than a patient with wild type CYP2D6, as discussed
above. Alternative methods for determining the relative activity of
a patient's CYP2D6 gene include biochemical assays to directly
measure enzymatic activity, protein sequencing to examine the amino
acid sequence of a patient's CYP2D6, monitoring transcription and
translation levels, and sequencing the CYP2D6 gene mRNA transcript.
For example, Chainuvati et al. describe assessment of the CYP2D6
phenotype using a multi-drug phenotyping cocktail (the Cooperstown
5+1 cocktail).
[0096] Iloperidone can be formulated into dosage units and
administered to patients using techniques known in the art. See,
e.g., PCT Application Publication Number WO03054226, US Patent
Application Publication Number 20030091645, PCT Application Serial
Number PCT EP03/07619, and PCT Application Publication Number
WO02064141, all of which are incorporated herein by reference as
though fully set forth.
[0097] In addition, the present invention provides a kit for
determining a patient's CYP2D6 genotype and/or phenotype. Such a
kit may include, for example, a detection means, a collection
device, containers, and instructions, and may be used in
determining a treatment strategy for a patient having one or more
diseases or disorders for which iloperidone treatment is
indicated.
[0098] Detection means may detect a CYP2D6 polymorphism directly or
may detect the characteristic mRNA of the polymorphic gene or its
polypeptide expression product. In addition, as will be recognized
by one of skill in the art, detection means may also detect
polymorphisms in linkage disequilibrium with a CYP2D6 polymorphism.
Accordingly, any polymorphism in linkage disequilibrium with the
CYP2D6 polymorphisms disclosed in this application may be used to
indirectly detect such a CYP2D6 polymorphism, and is within the
scope of the present invention.
[0099] Detection means suitable for use in the methods and devices
of the present invention include those known in the art, such as
polynucleotides used in amplification, sequencing, and single
nucleotide polymorphism (SNP) detection techniques, Invader.RTM.
assays (Third Wave Technologies, Inc.), Taqman.RTM. assays (Applied
Biosystems, Inc.), gene chip assays (such as those available from
Affymetrix, Inc. and Roche Diagnostics), pyrosequencing,
fluorescence resonance energy transfer (FRET)-based cleavage
assays, fluorescent polarization, denaturing high performance
liquid chromatography (DHPLC), mass spectrometry, and
polynucleotides having fluorescent or radiological tags used in
amplification and sequencing.
[0100] A preferred embodiment of a kit of the present invention
includes an Invader.RTM. assay, wherein a specific upstream
"invader" oligonucleotide and a partially overlapping downstream
probe together form a specific structure when bound to a
complementary DNA sequence. This structure is recognized and cut at
a specific site by the Cleavase enzyme, releasing the 5' flap of
the probe oligonucleotide. This fragment then serves as the
"invader" oligonucleotide with respect to synthetic secondary
targets and secondary fluorescently-labeled signal probes contained
in a reaction mixture. This results in the specific cleavage of the
secondary signal probes by the Cleavase enzyme. Fluorescence signal
is generated when this secondary probe, labeled with dye molecules
capable of fluorescence resonance energy transfer, is cleaved.
Cleavases have stringent requirements relative to the structure
formed by the overlapping DNA sequences or flaps and can,
therefore, be used to specifically detect single base pair
mismatches immediately upstream of the cleavage site on the
downstream DNA strand. See, e.g., Ryan et al., Molecular Diagnosis,
4; 2:135-144 (1999); Lyamichev et al., Nature Biotechnology,
17:292-296 (1999); and U.S. Pat. Nos. 5,846,717 and 6,001,567, both
to Brow et al., all of which are hereby incorporated herein by
reference.
[0101] Another preferred embodiment of a kit of the present
invention includes a detection means comprising at least one CYP2D6
genotyping oligonucleotide specific to alleles known to predict a
patient's metabolizer phenotype. More particularly, the means
comprises an oligonucleotide specific for the CYP2D6G)846A or
CYP2D6C100T polymorphism. The means may similarly comprise
oligonucleotides specific for each polymorphism as well as the wild
type sequence.
[0102] Detection methods, means, and kits suitable for use in the
present invention are described in International Publication Nos.
WO 03/0544266 and WO 03/038123, each of which is hereby
incorporated herein by reference. It should also be understood that
the methods of the present invention described herein generally may
further comprise the use of a kit according to the present
invention.
[0103] Collection devices suitable for use in the present invention
include devices known in the art for collecting and/or storing a
biological sample of an individual from which nucleic acids and/or
polypeptides can be isolated. Such biological samples include, for
example, whole blood, semen, saliva, tears, urine, fecal material,
sweat, buccal smears, skin, hair, and biopsy samples of organs and
muscle. Accordingly, suitable collection devices include, for
example, specimen cups, swabs, glass slides, test tubes, lancets,
and Vacutainer.RTM. tubes and kits.
[0104] The present invention encompasses treatment of a patient for
any disease or condition that is ameliorated by administration of
iloperidone. As discussed above, such diseases or conditions
include, for example, schizoaffective disorders including
schizophrenia, depression including bipolar depression, as well as
other conditions such as cardiac arrythmias, Tourette's syndrome,
psychotic disorders and delusional disorders.
[0105] A related aspect of the invention is a method for obtaining
regulatory approval for a pharmaceutical composition comprising
iloperidone or an active metabolite thereof, or a pharmaceutically
acceptable salt of either, which comprises including in proposed
prescribing information instructions to determine whether or not a
patient is a CYP2D6 poor metabolizer prior to determining what dose
to administer to the patient. In another related aspect, the
invention is a method for commercializing (i.e., selling and
promoting) pharmaceutical compositions comprising such compounds
said method comprising obtaining regulatory approval of the
composition by providing data to a regulatory agency demonstrating
that the composition is effective in treating humans when
administered in accordance with instructions to determine whether
or not a patient is a CYP2D6 poor metabolizer prior to determining
what dose to administer to the patient and then disseminating
information concerning the use of such composition in such manner
to prescribers (e.g., physicians) or patients or both.
[0106] Another aspect of the invention is a method for obtaining
regulatory approval for the administration of iloperidone based, in
part, on labeling that instructs the administration of a lower dose
if the patient is already being administered a CYP2D6 inhibitor,
e.g., paroxetine, etc.
Embodiments
[0107] 1. A method for treating a patient with an active
pharmaceutical ingredient including at least one of: iloperidone, a
pharmaceutically acceptable salt of iloperidone, an active
metabolite of iloperidone, and a pharmaceutically acceptable salt
of an active metabolite of iloperidone, comprising the steps of:
determining the patient's CYP2D6 genotype; and administering to the
patient an effective amount of the active pharmaceutical
ingredient, whereby the amount of the active pharmaceutical
ingredient is determined based on the patient's CYP2D6
genotype.
[0108] 2. The method of embodiment 1, wherein the amount of the
active pharmaceutical ingredient is decreased if the genotype
indicates decreased enzymatic activity of the CYP2D6 enzyme
relative to the wild type.
[0109] 3. The method of embodiment 2, wherein the amount of the
active pharmaceutical ingredient is decreased if the patient's
CYP2D6G1846A genotype is AA.
[0110] 4. The method of embodiment 2, wherein the amount of the
active pharmaceutical ingredient is decreased if the patient's
CYP2D6G1846A genotype is GA.
[0111] 5. The method of embodiment 2, wherein the amount of the
active pharmaceutical ingredient is decreased if the patient's
CYP2D6C100T genotype is TT.
[0112] 6. The method of embodiment 2, wherein the amount of the
active pharmaceutical ingredient is decreased if the patient's
CYP2D6C100T genotype is CT.
[0113] 7. The method of embodiment 2, wherein the amount of the
active pharmaceutical ingredient is decreased if the patient's
CYP2D6 genotype is 100C>T; 1661G>C; 1846G>A.
[0114] 8. The method of embodiment 2, wherein the amount of the
active pharmaceutical ingredient is decreased if the patient's
CYPD26 genotype is 100C>T; 1661G>C; 4180G>C.
[0115] 9. The method of embodiment 2, wherein the amount of the
active pharmaceutical ingredient is decreased if the patient's
CYP2D6 genotype is CYP2D6 deleted.
[0116] 10. The method of embodiment 2, wherein the amount of the
active pharmaceutical ingredient is decreased if the patient's
CYP2D6 genotype is -1584C; -1235 A>G; -740 C>T;
[0117] 678 G>A; CYP2D7 gene conversion in intron 1; 1661 G>C;
2850 C>T; 2988 G>A; 4180 G>C.
[0118] 11. The method of embodiment 1, wherein the patient is
suffering from at least one of schizophrenia, schizoaffective
disorder, depression, bipolar mania/depression, cardiac arrhythmia,
Tourette's Syndrome, a psychotic disorder, a delusional disorder,
and schizophreniform disorder.
[0119] 12. The method of embodiment 11, wherein the patient is at
risk for a prolonged QT interval.
[0120] 13. A method for treating a patient who is a CYP2D6 poor
metabolizer with a pharmaceutically active ingredient including at
least one of: iloperidone, a pharmaceutically acceptable salt of
iloperidone, an active metabolite of iloperidone, and a
pharmaceutically acceptable salt of an active metabolite of
iloperidone, wherein the patient is administered a lower dosage
than would be given to an individual who is not a CYP2D6 poor
metabolizer.
[0121] 14. The method of embodiment 13, wherein the patient is
determined to be a CYP2D6 poor metabolizer based on at least one of
the patient's genotype, the patient's phenotype, and the fact that
the patient is being treated with an agent that reduces CYP2D6
activity.
[0122] 15. The method of embodiment 13, wherein the patient's
genotype includes at least one CYP2D6 allele selected from a group
consisting of 2549 A deletion, 1846 G>A, 1707 T deletion, 2935
A>C, 1758 G>T, 2613-2615 AGA deletion, 1023 C>T, 2850
C>T, 4180G>C, 1659 G>A, 1661 G>C, 2850 C>T, 3183
G>A, -1584 C, -1235 A>G, -740C>T, -678 G>A, 100 C>T,
2988 G>A, and CYP2D6 deletion.
[0123] 16. The method of embodiment 14, wherein the patient's
genotype includes at least one deletion of the CYP2D6 gene.
[0124] 17. The method of embodiment 15, wherein the patient's
genotype includes a CYP2D7 gene conversion in intron 1.
[0125] 18. The method of embodiment 13, wherein the patient is
suffering from at least one of schizophrenia, schizoaffective
disorder, depression, bipolar mania/depression, cardiac arrhythmia,
Tourette's Syndrome, a psychotic disorder, a delusional disorder,
and schizophreniform disorder.
[0126] 19. A method of treating a patient with a pharmaceutically
active ingredient including at least one of: iloperidone, a
pharmaceutically acceptable salt of iloperidone, an active
metabolite of iloperidone, and a pharmaceutically acceptable salt
of an active metabolite of iloperidone comprising the steps of:
determining whether the patient is being administered a CYP2D6
inhibitor, and reducing the dosage of drug if the patient is being
administered a CYP2D6 inhibitor.
[0127] 20. The method of embodiment 19, wherein the CYP2D6
inhibitor includes at least one of paroxetine, dolasetron,
venlafaxin, and fluoxetine.
[0128] 21. The method of embodiment 19, wherein the patient is
suffering from at least one of schizophrenia, schizoaffective
disorder, depression, bipolar mania/depression, cardiac arrhythmia,
Tourette's Syndrome, a psychotic disorder, a delusional disorder,
and schizophreniform disorder.
[0129] 22. A method for determining a patient's CYP2D6 phenotype
comprising the steps of: administering to the patient a quantity of
at least one of: iloperidone, a pharmaceutically acceptable salt of
iloperidone, an active metabolite of iloperidone, and a
pharmaceutically acceptable salt of an active metabolite of
iloperidone; and determining a first concentration of at least one
of iloperidone and an iloperidone metabolite in the patient's
blood.
[0130] 23. The method of embodiment 22, wherein the iloperidone
metabolite is selected from a group consisting of P88 and P95.
[0131] 24. The method of embodiment 23, wherein a first
concentration is determined for each of P88 and P95.
[0132] 25. The method of embodiment 24, wherein the patient is
designated a poor metabolizer if the ratio of first concentrations
of P88 to P95 is greater than or equal to about 2.0.
[0133] 26. The method of embodiment 24, wherein the patient is
designated a poor metabolizer if the ratio of first concentrations
of (P88+iloperidone)/P95 is greater than or equal to about 1.0.
[0134] 27. The method of embodiment 24, wherein the patient is
designated a poor metabolizer if the ratio of first concentrations
of iloperidone and P88 to P95 is greater than or equal to about
3.0.
[0135] 28. The method of embodiment 22, further comprising the
steps of: administering to the patient at least one CYP2D6
inhibitor; determining a second concentration of at least one of
iloperidone and an iloperidone metabolite in the patient's blood;
and comparing the fuirst and second concentrations.
[0136] 29. The method of embodiment 28, wherein the CYP2D6
inhibitor is selected from a group consisting of paroxetine,
ketoconazole, and fluoxetine.
[0137] 30. The method of embodiment 28, wherein a second
concentration is determined for each of P88 and P95.
[0138] 31. The method of embodiment 30, wherein the patient is
designated a poor metabolizer if the ratio of second concentrations
of P88 to P95 is greater than or equal to about 2.0.
[0139] 32. The method of embodiment 28, wherein a first and second
concentration is determined for each of iloperidone, P88, and
P95.
[0140] 33. The method of embodiment 32, wherein the patient is
designated a poor metabolizer if the ratio of second concentrations
of iloperidone and P88 to P95 is greater than or equal to about
3.0.
[0141] 34. A method for determining whether a patient is at risk
for prolongation of his or her QTc interval due to administration
of at least one of: iloperidone, a pharmaceutically acceptable salt
of iloperidone, an active metabolite of iloperidone, and a
pharmaceutically acceptable salt of an active metabolite of
iloperidone comprising the steps of: measuring a first QTc
interval; administering to the patient a quantity of at least one
of: iloperidone, a pharmaceutically acceptable salt of iloperidone,
an active metabolite of iloperidone, and a pharmaceutically
acceptable salt of an active metabolite of iloperidone, measuring a
second QTc interval; and comparing the first and second QTc
interval.
[0142] 35. The method of embodiment 34, wherein the dose of
iloperidone administered to the patient is about 24 milligrams per
day.
[0143] 36. The method of embodiment 34, further comprising the step
of administering to the patient at least one CYP2D6 inhibitor after
the administering step.
[0144] 37. The method of embodiment 36, wherein the CYP2D6
inhibitor is selected from a group consisting of paroxetine,
ketoconazole, and fluoxetine.
[0145] While this invention has been described in conjunction with
the specific embodiments outlined above, it is evident that many
alternatives, modifications and variations will be apparent to
those skilled in the art. Accordingly, the embodiments of the
invention as set forth above are intended to be illustrative, not
limiting. Various changes may be made without departing from the
spirit and scope of the invention as defined in the following
claims.
Sequence CWU 1
1
6119DNAArtificial SequencePrimer for amplifying CYP2D6 Exons 1 and
2 1ctgggctggg agcagcctc 19223DNAArtificial SequencePrimer for
amplifying CYP2D6 Exons 1 and 2 2cactcgctgg cctgtttcat gtc
23322DNAArtificial SequencePrimer for amplifying CYP2D6 Exons 3, 4,
5 and 6 3ctggaatccg gtgtcgaagt gg 22420DNAArtificial SequencePrimer
for amplifying CYP2D6 Exons 3, 4, 5 and 6 4ctcggcccct gcactgtttc
20522DNAArtificial SequencePrimer for amplifying CYP2D6 Exons 7, 8
and 9 5gaggcaagaa ggagtgtcag gg 22623DNAArtificial SequencePrimer
for amplifying CYP2D6 Exons 7, 8 and 9 6agtcctgtgg tgaggtgacg agg
23
* * * * *
References