U.S. patent application number 16/537325 was filed with the patent office on 2019-11-28 for angiogenic conditioning to enhance cardiac cellular reprogramming of fibroblasts of the infarcted myocardium.
The applicant listed for this patent is Cornell University, The Research Foundation For The State University Of New York. Invention is credited to Ronald G. Crystal, Robert Gersch, Megumi Mathison, Todd K. Rosengart.
Application Number | 20190358297 16/537325 |
Document ID | / |
Family ID | 50628104 |
Filed Date | 2019-11-28 |
![](/patent/app/20190358297/US20190358297A1-20191128-D00001.png)
![](/patent/app/20190358297/US20190358297A1-20191128-D00002.png)
![](/patent/app/20190358297/US20190358297A1-20191128-D00003.png)
![](/patent/app/20190358297/US20190358297A1-20191128-D00004.png)
![](/patent/app/20190358297/US20190358297A1-20191128-D00005.png)
![](/patent/app/20190358297/US20190358297A1-20191128-D00006.png)
![](/patent/app/20190358297/US20190358297A1-20191128-D00007.png)
![](/patent/app/20190358297/US20190358297A1-20191128-D00008.png)
![](/patent/app/20190358297/US20190358297A1-20191128-D00009.png)
![](/patent/app/20190358297/US20190358297A1-20191128-D00010.png)
![](/patent/app/20190358297/US20190358297A1-20191128-D00011.png)
View All Diagrams
United States Patent
Application |
20190358297 |
Kind Code |
A1 |
Crystal; Ronald G. ; et
al. |
November 28, 2019 |
ANGIOGENIC CONDITIONING TO ENHANCE CARDIAC CELLULAR REPROGRAMMING
OF FIBROBLASTS OF THE INFARCTED MYOCARDIUM
Abstract
Provided is a method of treating coronary artery disease in a
mammal, comprising administering to a region of the heart of the
mammal (a) a first vector encoding one or more angiogenic proteins
which induce vascularization in the heart of the mammal, and (b) a
second vector encoding one or more cardio-differentiating
transcription factors which induce the production of induced
cardiomyocytes (iCM) in the heart of the mammal, whereby the
coronary artery disease in the mammal is treated. In a preferred
embodiment, the first vector is an adenoviral vector encoding VEGF
and the second vector is a lentiviral vector encoding Gata4, Mef2c,
and Tbx5 (GMT).
Inventors: |
Crystal; Ronald G.; (New
York, NY) ; Rosengart; Todd K.; (Bellaire, TX)
; Gersch; Robert; (Philadelphia, PA) ; Mathison;
Megumi; (Houston, TX) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Cornell University
The Research Foundation For The State University Of New
York |
Ithaca
Albany |
NY
NY |
US
US |
|
|
Family ID: |
50628104 |
Appl. No.: |
16/537325 |
Filed: |
August 9, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14439357 |
Apr 29, 2015 |
10383916 |
|
|
PCT/US13/68086 |
Nov 1, 2013 |
|
|
|
16537325 |
|
|
|
|
61721604 |
Nov 2, 2012 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K 14/49 20130101;
A61K 38/1709 20130101; A61K 38/00 20130101; C07K 14/52 20130101;
A61K 48/00 20130101; C07K 14/47 20130101; C12N 2710/10341 20130101;
A61K 48/005 20130101; A61K 38/1866 20130101; C12N 2740/15041
20130101 |
International
Class: |
A61K 38/18 20060101
A61K038/18; C07K 14/47 20060101 C07K014/47; C07K 14/49 20060101
C07K014/49; A61K 48/00 20060101 A61K048/00; C07K 14/52 20060101
C07K014/52; A61K 38/17 20060101 A61K038/17 |
Claims
1. A method of treating coronary artery disease in a mammal,
comprising administering to the heart of the mammal (a) a first
vector encoding one or more angiogenic proteins which induce
vascularization in the heart of the mammal, and (b) a second vector
encoding one or more cardio-differentiating transcription factors
which induce the production of induced cardiomyocytes (iCM) in the
heart of the mammal, whereby the coronary artery disease in the
mammal is treated.
2. The method of claim 1, wherein the angiogenic protein is one or
more of VEGF, FGF, PGF, NRP-1, ANG, PDGF, TGF-.beta., MCP-1,
ephrin, plasminogen activator or plasminogen activator inhibitor,
eNOS, COX-2, CD133, MMP, and DLL44.
3. The method of claim 1, wherein the angiogenic protein is
VEGF.
4. The method of claim 1, wherein the cardio-differentiating
transcription factor is one or more of Hopx, Nkx2-5, Hrt2, Pitx2,
Smyd1, Myocd, Baf60c, Tbx5, Srf, Gata4, Isl1, Mef2c, Hand2, or
Mesp1.
5. The method of claim 4, wherein the cardio-differentiating
transcription factors are Gata4, Mef2c, and Tbx5 (GMT).
6. The method of claim 1, wherein the first vector and the second
vector are viral vectors.
7. The method of claim 6, wherein the viral vectors are retroviral
vectors, lentiviral vectors, HIV-based vectors, HSV-based vectors,
adenovirus-based vectors, parvoviral-based vectors, AAV-based
vectors, or AAV-adenoviral chimeric vectors.
8. The method of claim 1, wherein the first vector is an adenoviral
vector.
9. The method of claim 8, wherein the adenoviral vector is of
serotype 5 and has deletions in the E1 and E3 regions.
10. The method of claim 1, wherein the second vector is a
lentiviral vector.
11. The method of claim 1, wherein the first vector and the second
vector are administered to a myocardial scar or peri-infarcted
region of the heart.
12. The method of claim 1, wherein the coronary artery disease is
myocardial infarction.
13. The method of claim 1, whereby the ventricular function of the
heart of the mammal is improved.
14. The method of claim 1, wherein the iCM are derived from
myocardial fibroblasts.
15. The method of claim 1, wherein the first vector is administered
before the second vector.
16. The method of claim 15, wherein the first vector is
administered about 3 weeks before the second vector.
17. The method of claim 1, wherein the first vector is administered
at the same time as the second vector.
18. The method of claim 1, wherein the first vector is an
adenoviral vector, the second vector is a lentiviral vector, and
the angiogenic protein is VEGF.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This patent application claims the benefit of U.S.
Provisional Patent Application No. 61/721,604, filed Nov. 2, 2012,
which is incorporated by reference in its entirety herein.
INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY
[0002] Incorporated by reference in its entirety herein is a
computer-readable nucleotide/amino acid sequence listing submitted
concurrently herewith and identified as follows: One 1,448 Byte
ASCII (Text) file named "714417SequenceListing.TXT," created on
Nov. 1, 2013.
BACKGROUND OF THE INVENTION
[0003] Coronary artery disease (CAD) remains the leading cause of
death in the West, in part because of the still limited options for
the treatment of diffuse CAD, myocardial infarction and congestive
heart failure (Lloyd-Jones et al., Circulation, 119(3): 480-486
(2009); Taylor et al., J. Heart Lung Transplant, 23(7): 796-803
(2004); Lietz et al., Circulation, 116(5): 497-505 (2007); Anyanwu
et al., Brit. Med. J., 326(7388): 509-510 (2003)). Cardiac stem
cell therapy has been embraced as a new approach to treating
end-stage heart disease that theoretically repopulates otherwise
permanently scarred myocardium with contractile cells (Leor et al.,
Circulation, 94(Suppl. 9): II332-II336 (1996); Taylor et al.,
Nature Med., 4(8): 929-933 (1998); Tomita et al., Circulation,
100(Suppl. 19): II247-II256 (1999); Orlic et al., Nature,
410(6829): 701-704 (Apr. 5, 2001); Scorsin et al., J. Thorac.
Cardiovasc. Surg., 119(6): 1169-1175 (2000); Hare et al., Curr.
Opin. Organ Transplant, 13(5): 536-542 (2008); Rosenzweig, N. Engl.
J. Med., 355(12): 1274-1277 (2006); Murry et al., J. Am. Coll.
Cardiol., 47(19): 1777-85 (2006); Menasche, J. Mol. Cell. Cardiol.,
50(2): 258-265 (2010)). The creation of induced pluripotent stem
cells (iPSCs) and the generation of cardiomyocyte-like cells from
iPSCs appear to have represented breakthroughs in this field (Min
et al., J. Appl. Phys., 92(1): 288-296 (2002); Takahashi et al.,
Cell, 131(5): 861-872 (2007); Yu et al., Science, 318(5858):
1917-1920 (2007); Okita et al., Nature, 448(7151): 313-317 (2007);
Xu et al., Proc. Natl. Acad. Sci. (USA), 106(3): 808-813 (2009);
Gai et al., Cell Biol. Intl., 33(11): 1184-1193 (2009); Mauritz et
al., Circulation, 118(5): 507-517 (2008); Nelson et al.,
Circulation, 120(5): 408-416 (2009); Narazaki et al., Circulation,
118(5): 498-506 (2008); Zhang et al., Circ Res., 104(4): e30-e41
(2009)), but recent reports of iPSC tumorogenicity and
immunogenicity may ultimately reflect limits to the clinical
applicability of iPSCs, as may the logistic challenges of iPSC
delivery in the clinical setting (Okita et al., Circ Res., 109(7):
720-721 (2011); Apostolou et al., Nature, 474(7350): 165 (2011);
Mummery, N. Engl. J. Med., 364(22): 2160-2162 (2011); Zhao et al.,
Nature, 474(7350): 212-214 (2011)).
[0004] The recent discovery that a trio of cardio-differentiating
transcription factors could be used to generate induced
cardiomyocytes (iCM) directly from somatic cells (Ieda et al.,
Cell, 142(3): 375-386 (2010)) offers the exciting new possibility
of generating autologous cells that possess characteristics that
are at least consistent with that of a cardiomyocyte phenotype
(Ieda et al., Cell, 142(3): 375-386 (2010); Efe et al., Nature
Cell. Bio., 13(3): 215-222 (2011); Qian et al., Nature, 485(7400):
593-598 (2012); Passier et al., Cell Stem Cell, 7(2): 139-141
(2010); Song et al., Nature, 485(7400): 599-604 (2012); Srivastava
et al., Circ. Res., 111(1): 5-8 (2012); Jayawardena et al., Circ.
Res., 110(11): 1465-1473 (2012); Protze et al., J. Mol. Cell.
Cardiol., 53(3): 323-332 (2012)). Perhaps more importantly, this
novel regenerative strategy offers the intriguing potential to
bypass iPSC staging and convert myocardial scar fibroblasts into
functional iCM in situ, potentially transforming regions of
myocardial infarction back into functioning myocardium (Qian et
al., Nature, 485(7400): 593-598 (2012); Song et al., Nature,
485(7400): 599-604 (2012); Srivastava et al., Circ. Res., 111(1):
5-8 (2012); Jayawardena et al., Circ. Res., 110(11): 1465-1473
(2012)). However, recent reports have provided conflicting evidence
regarding the potential efficacy of such in situ myocardial
regeneration (Qian et al., Nature, 485(7400): 593-598 (2012); Song
et al., Nature, 485(7400): 599-604 (2012); Srivastava et al., Circ.
Res., 111(1): 5-8 (2012); Jayawardena et al., Circ. Res., 110(11):
1465-1473 (2012); Protze et al., J. Mol. Cell. Cardiol., 53(3):
323-332 (2012); Chen et al., Circ. Res., 111(1): 50-55 (2012)).
[0005] Accordingly, there is a need for additional methods for the
treatment and understanding of coronary artery disease, including
the generation of iCM cells in situ.
BRIEF SUMMARY OF THE INVENTION
[0006] The invention provides materials and methods useful in the
treatment and understanding of coronary artery disease. In one
aspect, the invention provides a method of treating coronary artery
disease by administering vectors encoding one or more angiogenic
proteins and one or more cardio-differentiating transcription
factors to the heart of a mammal.
[0007] The angiogenic protein may be any protein involved in
vascularization, e.g., vascular endothelial growth factor (VEGF).
The cardio-differentiating transcription factor may be any
transcription factor involved in the differentiation of
cardiomyocytes, e.g., Gata4, Mef2c, and/or Tbx5.
[0008] The vectors may be viral vectors, such as retroviral
vectors, lentiviral vectors, human immunodeficiency virus
(HIV)-based vectors, herpes simplex virus (HSV)-based vectors,
adenovirus-based vectors, parvoviral-based vectors (i.e.,
adeno-associated virus (AAV)-based vectors), and AAV-adenoviral
chimeric vectors. In a preferred embodiment, the method comprises
administering an adenoviral vector encoding VEGF and a lentiviral
vector encoding Gata4, Mef2c, and Tbx5 (GMT).
BRIEF DESCRIPTION OF THE DRAWINGS
[0009] FIG. 1 is a set of photographs showing the generation of
lentivirus encoding individual cardiac transcription factors.
Lentivirus encoding the transcription factors Gata4, Mef2c, and
Tbx5 were prepared in 293T package cells, and protein expression
was detected by Western blot analysis using antibodies specific to
each transgene. A lentivirus expressing a green fluorescent protein
(GFP) marker gene was used as a control for these expression
vectors, and beta-actin was used as a loading control.
[0010] FIGS. 2A-F are a set of photographs and graphs showing iCM
generation in vitro. Primary rat dermal fibroblast (RDF) cells were
cultured and infected with a GMT lentivirus or a GFP control
lentivirus. Fourteen days after infection, cells were fixed and
stained for specified cardiomyocyte markers. FIG. 2A is a set of
photographs relating to immunofluorescence studies. The first
column represents 4',6-diamidino-2-phenylindole (DAPI) staining to
identify cell nuclei. The second column represents GFP fluorescence
to identify cells infected by at least one of the lentivirus
vectors. The third column represents red staining of relevant
cardiomyocyte markers (first row: cardiac troponin T (cTnT); second
row: myosin heavy chain 7 (MHY7); third row: a sarcomeric actinin).
The fourth column depicts a merge of the previous three images.
Note the coincidence of these respective markers and binucleated
cells typical of cardiomyocyte, and that GFP (-) cells also fail to
express markers. Uninfected RDFs did not express either marker (not
shown). All photomicropgraphs were taken at 400.times.
magnification (bar=50 .mu.m). FIGS. 2B-F are a set of graphs
relating to fluorescence-activated cell sorting (FACS) analysis.
Depicted are FACS plots for cTnT staining: RDFs infected with GMT,
demonstrating 7% expression of cTnT in GFPP+P cells (FIG. 2B), RDFs
infected with GFP control lentivirus (FIG. 2C), uninfected RDFs
(FIG. 2D), primary cardiomyocyte control (FIG. 2E), and RDFs
infected with GMT, with use of a secondary antibody only (FIG. 2F).
The graphs show a minimum of 5,000 events.
[0011] FIG. 3 is a graph showing myocardial vascularization.
Vascularization of infarct regions is depicted as assessed by
determining the number of vessels per microscopic field staining
for .alpha.-smooth muscle actin in sections obtained 7 wks after
coronary ligation and administration of AdVEGF-A116AP+P or the
control vector AdNull (n=12/group). *p<0.05.
[0012] FIGS. 4A-E are a set of photographs and graphs showing
cardiomyocyte density in infarct zones. Cardiomyocyte-specific
marker MYH7 staining of the infarct and border zones of sections of
myocardium harvested 7 wks following coronary ligation and
administration of AdVEGF-A116AP+P or the control vector AdNull (4
wks after the administration of lentivirus encoding GMT or a GFP
control) was performed. FIGS. 4A-D are photomicrographs of
representative sections of infarct zones from animals treated with
AdVEGF-A116AP+P/GMT (top row) or /AdNull/GFP (bottom row) at
100.times. (left) and 200.times. (right) magnification,
respectively. Bars represent 100 .mu.m. FIG. 4E is a graph of MYH7
cell density as a percent of total sections analyzed (n=6/group).
Grade I/II indicates that <50% of the examined microscopic
fields were occupied by MYH7P+P cells, and Grade III/IV indicates
that >50% of the examined microscopic fields were occupied by
MYH7P+P cells (see FIG. 7 for microscopic fields representative of
each density grade).
[0013] FIGS. 5A-C are a set of graphs showing the extent of left
ventricular wall fibrosis. The percent of left ventricular
myocardial wall area demonstrating fibrosis as determined by
trichrome staining of sections of myocardial tissue harvested 7 wks
following coronary ligation and administration of AdVEGF-A116AP+P
or the control vector AdNull (4 wks after the administration of
lentivirus encoding GMT or a GFP control) animals is depicted. FIG.
5A shows the extent of fibrosis in animals receiving GMT versus GFP
control vectors (n=12). *p<0.01. FIG. 5B shows the extent of
fibrosis for the four treatment groups (n=6/group). *p<0.05.
FIG. 5C shows the number of myofibroblasts identified per
microscopic field (200.times.) in animals receiving GMT versus GFP
control vectors (n=12), as identified by staining for a-smooth
muscle actin (p=0.09).
[0014] FIGS. 6A-C are a set of graphs showing echocardiographic
analysis of global ventricular function following in vivo
administration of cellular reprogramming and/or AdVEGF-A116AP+P
vectors. Echocardiographic studies were performed at the specified
time points before and following coronary ligation and
administration of AdVEGF-A116AP+P or the control vector AdNull at
time 0, and after the administration of lentivirus encoding GMT or
a GFP control 3 wks later (n=6). FIG. 6A shows the global ejection
fraction for each treatment group. At day 49 (Kruskal-Wallis rank
test; p<0.005): AdVEGF-A116AP+P/GMTP Pvs AdNull/GFP: p<0.05;
AdVEGF-A116AP+P/GMT versus AdVEGF-A116AP+P/GFP: p<0.05;
AdVEGF-A116AP+P/GMT versus AdNull/GMT: p=0.08; AdVEGF-A116AP+P/GFP
versus AdNull/GFP: p=0.86). FIG. 6B shows the change in ejection
fraction from the time of the lentivirus administration (day 21)
baseline to the time of follow up echo 4 wks later (day 49). Top
panel: animals receiving GMT versus GFP control vector (n=12).
*p<0.01. Bottom panel: each study group analyzed separately
(n=6). *p<0.05. AdVEGF-A116AP+P/GMT versus AdVEGF-A116AP+P/GFP:
p=0.008; AdVEGF-A116AP+P/GMT versus AdNull/GFP: p<0.001;
AdNull/GMT versus AdNull/GFP: p=0.004. FIG. 6C shows left
ventricular posterior wall function. Left ventricular posterior
wall thickness at end-systole 7 wks following coronary ligation and
administration of AdVEGF-A116AP+P or the control vector AdNull (4
wks after the administration of lentivirus encoding GMT or a GFP
control). Differences between groups did not reach statistical
significance (p=0.09).
[0015] FIG. 7 is a set of photographs showing MHY7 cell density
classification. MYH7.sup.+ cell number was analyzed in a
semi-quantitative manner as the MYH7.sup.+ cell density in five
areas per slide viewed at 200.times. magnification (at the center
of the infarction zone, in the mid areas between the center of
infarction and the border zone, and in each border zone adjacent to
the infarct). These fields were graded by an investigator blinded
to treatment group as follows: (top left) Grade I: <25% of
selected microscopic field demonstrating MYH7.sup.+ cells; (top
right) Grade II: 25%-50% of selected microscopic field
demonstrating MYH7.sup.| cells; (bottom left) Grade III: 50%-75% of
selected microscopic field demonstrating MYH7.sup.+ cells; and
(bottom right) Grade IV: >75% of selected microscopic field
demonstrating MYH7.sup.+ cells.
[0016] FIG. 8 is a set of photographs showing infarct
vascularization induced by adenoviral mediated transfer of VEGF.
Vascularization of infarct regions was assessed by staining for
a-smooth muscle actin in sections obtained 7 wks after coronary
ligation and administration of AdVEGF-A116AP+P or the control
vector AdNull (n=12/group). The photomicrographs show
representative sections of infarct zones viewed at 200.times. after
administration of AdNull/GMT (top) or AdVEGF-A116AP+P/GMT (bottom).
The bars represent 100 .mu.m.
[0017] FIG. 9 is a set of photographs showing myofibroblast density
following GMT administration. Myofibroblasts identified by
non-vascular .alpha.-smooth muscle actin staining of the infarct
and border zones of sections of myocardium harvested 7 wks
following coronary ligation and administration of AdVEGF-A116AP+P
or the control vector AdNull (4 wks after the administration of
lentivirus encoding GMT or a GFP control). The photomicrographs
show representative sections of infarct zones viewed at 400.times.
after administration of AdNull/GFP (top) or AdVEGF-A116AP+P/GMT
(bottom). The bars represent 50 .mu.m.
[0018] FIGS. 10A-10B are set of photographs (FIG. 10A) and a graph
(FIG. 10B) showing scar vascularization upon administration of
AdNull/GFP versus VEGF/GMT. In FIG. 10A, the arrows indicate areas
of vascularization. In FIG. 10B, the graphs shows an increased
number of vessels/hpf upon administration of VEGF. *p<0.05,
.alpha. SMA staining.
[0019] FIGS. 11A-B are a set of photographs (FIG. 11A) and a graph
(FIG. 11B) showing iCM (MHC.sup.+) cell density.
[0020] FIGS. 12A-B are a set of photographs (FIG. 12A) and graphs
(FIG. 12B) showing the extent of fibrosis.
DETAILED DESCRIPTION OF THE INVENTION
[0021] The invention is based, at least in part, on the concept
that, to achieve effective in situ cardio-differentiation, the
myocardial scar and surrounding tissue are conditioned with a gene
coding for an angiogenic mediator, thereby providing vasculature to
a damaged region of the heart that is to be cardio-differentiated
by relevant transcription factors. Ischemia may adversely affect
the survival and/or function of iCM in an infarct zone, inasmuch as
it causes the loss of native cardiomyocytes and exogenous (stem
cell) implants (Zhang et al., J. Mol. Cell. Cardiol., 33(5):
907-921 (2001); Reinecke et al., Circulation, 100(2): 193-202
(1999); Laflamme et al., Nature Biotechnol., 25(9): 1015-1024
(2007); Retuerto et al., J. Thorac. Cardiovasc. Surg., 127(4):
1041-1049 (2004); Retuerto et al., J. Thorac. Cardiovasc. Surg.,
133(2): 478-484 (2007)), such that adequate myocardial scar
vascularization can be an important component of an optimized in
situ cellular reprogramming strategy (Retuerto et al., J. Thorac.
Cardiovasc. Surg., 127(4): 1041-1049 (2004); Retuerto et al., J.
Thorac. Cardiovasc. Surg., 133(2): 478-484 (2007)). The use of
angiogenic conditioning markedly improves the effectiveness of the
use of cardio-differentiating factors to improve cardiac function
after myocardial infarction or other coronary artery disease.
[0022] The invention provides a method of treating coronary artery
disease in a mammal, comprising administering to the heart of the
mammal a first vector encoding one or more angiogenic proteins
which induce vascularization in the heart of the mammal, and a
second vector encoding one or more cardio-differentiating
transcription factors which induce the production of induced
cardiomyocytes (iCM) in the heart of the mammal, whereby the
coronary artery disease in the mammal is treated. Desirably, the
first and second vectors are administered to the same region of the
heart.
[0023] The term "coronary artery disease" refers to any disorder or
condition involving the coronary arteries. Coronary artery disease
is usually attributable to the deposition of atheromatous plaque on
the arterial walls. Narrowing or occlusion of the arterial lumen
results in reduced delivery of oxygen and nutrients to the heart.
Although arterial occlusion usually progresses slowly, sudden
blockage of an artery by a thrombus or embolus is also possible.
Manifestations of coronary artery disease include angina, ischemia,
myocardial infarction, cardiomyopathy, congestive heart failure,
arrhythmias, and aneurysm formation.
[0024] The term "region of the heart" refers to any region of the
heart affected by coronary artery disease. The region of the heart
may include the atria, ventricles, and/or vessels of the heart. The
region of the heart may also be a region damaged, for example, by
myocardial infarction. In this respect, the region of the heart may
be a myocardial scar or peri-infarcted region of the heart.
[0025] The term "mammal" refers to any suitable mammal, including,
but not limited to, a mouse, rat, cat, dog, guinea pig, hamster,
rabbit, cat, dog, pig, cow, horse, primate, and human. The mammal
typically is a human.
[0026] The term "angiogenic protein" refers to a protein that is
involved in vascularization. For example, the angiogenic protein
may be one or more of VEGF (vascular endothelial growth factor)
(e.g., VEGF-A (120, 164, and 188), VEGF-B, VEGF-C, or VEGF-D,
VEGF-E, VEGF-F), FGF (fibroblast growth factor) (e.g., FGF-1,
FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9, FGF-10,
FGF-11, FGF-12, FGF-13, FGF-14, FGF-15, FGF-16, FGF-17, FGF-18,
FGF-19, FGF-20, FGF-21, FGF-22, or FGF-23), PGF (placental growth
factor), NRP-1 (neuropilin-1), ANG (angiopoietin) (e.g., ANG-1 or
ANG-2), PDGF (platelet-derived growth factor) (e.g., PDGF-AA,
PDGF-BB, or PDGF-AB), TGF-.beta. (transforming growth factor beta)
(e.g., TGF-.beta.1, TGF-.beta.2, or TGF-.beta.3), MCP-1 (monocyte
chemotactic protein-1), VE-cadherin (vascular endothelial
cadherin), ephrin, plasminogen activator or plasminogen activator
inhibitor, eNOS (endothelial nitric oxide synthase), COX-2
(cyclooxygenase-2), CD133, MMP (matrix metalloproteinase), and
DLL44 (delta-like ligand 4). The angiogenic protein may also be a
receptor for any of the aforementioned angiogenic proteins. In a
preferred embodiment, the angiogenic protein is VEGF.
[0027] The term "cardio-differentiating transcription factor"
refers to a protein, agent, or transcription factor that is
involved in the induction of cardio-differentiation or the
production of iCM, e.g., the production of iCM from myocardial
fibroblasts. For example, the cardio-differentiating transcription
factor may be one or more of Hopx (homeodomain-only protein),
Nkx2-5 (homeobox protein Nkx-2.5), Hrt2 (Hairy-related
transcription factor 2), Pitx2 (paired-like homeodomain
transcription factor 2 or pituitary homeobox 2), Smyd1
(MYND-domain-containing protein 1), Myocd (myocardin), Baf60c
(BRG1/Brm-associated factor of 60 kDa, subunit c), Tbx5 (T-box
transcription factor 5), Srf (serum response factor), Gata4 (globin
transcription factor 4), Isl1 (insulin gene enhancer protein 1),
Mef2c (myocyte-specific enhancer factor 2C or MADS box
transcription enhancer factor 2, polypeptide C), Hand2 (heart- and
neural crest derivatives-expressed protein 2), and Mesp1 (mesoderm
posterior 1 homolog). The cardio-differentiating transcription
factor may also be a receptor for any of the aforementioned
cardio-differentiating transcription factors. In a preferred
embodiment, the cardio-differentiating transcription factors are
the combination of Gata4, Mef2c, and Tbx5 (GMT).
[0028] The term "vector" refers to any vehicle used to transfer
genetic material to a target cell. The invention provides a vector
comprising a nucleic acid sequence encoding one or more angiogenic
proteins and a vector comprising a nucleic acid sequence encoding
one or more cardio-differentiating transcription factors. The
vectors may be non-viral vectors, including, for example,
lipoplexes, polyplexes, dendrimers, and nanoparticles. Preferably,
the vectors may be viral vectors, including, for example,
retroviral vectors, lentiviral vectors, human immunodeficiency
virus (HIV)-based vectors, herpes simplex virus (HSV)-based
vectors, adenovirus-based vectors, parvoviral-based vectors (i.e.,
adeno-associated virus (AAV)-based vectors), and AAV-adenoviral
chimeric vectors. These gene transfer vectors can be prepared using
standard recombinant DNA techniques described in, e.g., Sambrook et
al., Molecular Cloning, a Laboratory Manual, 2d edition, Cold
Spring Harbor Press, Cold Spring Harbor, N.Y. (1989), and Ausubel
et al., Current Protocols in Molecular Biology, Greene Publishing
Associates and John Wiley & Sons, New York, N.Y. (1994).
[0029] Retrovirus is an RNA virus capable of infecting a wide
variety of host cells. Upon infection, the retroviral genome
integrates into the genome of its host cell and is replicated along
with host cell DNA, thereby constantly producing viral RNA and any
nucleic acid sequence incorporated into the retroviral genome. When
employing pathogenic retroviruses, e.g., human immunodeficiency
virus (HIV) or human T-cell lymphotrophic viruses (HTLV), care must
be taken in altering the viral genomic to eliminate toxicity. A
retroviral vector can additionally be manipulated to render the
virus replication-incompetent. As such, retroviral vectors are
considered to be particularly useful for stable gene transfer in
vivo.
[0030] Lentiviral vectors, such as HIV-based vectors, are exemplary
of retroviral vectors used for gene delivery. Unlike other
retroviruses, lentiviral vectors are known to incorporate their
passenger genes into non-dividing cells, making lentiviral vectors
particularly useful in gene therapy. Lentiviruses are composed of
two copies of RNA, a nuclear capsid (NC), a capsid (CA), a membrane
associated matrix (MA), envelope proteins such as surface
glycoproteins (SU) and transmembrane proteins (TM), and enzymes
such as integrase (IN), protease (PR), and reverse transcriptase
(RT), and accessory proteins. Lentiviral vectors rely on the
physical separation into different plasmids of proteins required
for viral particle formation and infectivity (the packaging and the
envelope constructs) and of cis-acting sequences sufficient to
mobilize the viral genome (the transfer vector). The latter
constitutes the core of the vector, which is a mini-viral genome
devoid of viral open reading frames (ORFs), but carrying an
expression cassette for the transgene of interest. As a consequence
of the deletion of viral ORFs from the transfer vector, virions can
undergo a single round of infection at the conclusion of which
proviral DNA expresses only the transgene of interest (Durand et
al., Viruses, 3(2): 132-159 (2011)).
[0031] HSV-based viral vectors are suitable for use as a gene
transfer vector to introduce nucleic acids into neurons or other
tissues. The mature HSV virion consists of an enveloped icosahedral
capsid with a viral genome consisting of a linear double-stranded
DNA molecule that is 152 kb. Most replication-deficient HSV vectors
contain a deletion to remove one or more intermediate-early genes
to prevent replication. Advantages of the herpes vector are its
ability to enter a latent stage that can result in long-term DNA
expression and its large viral DNA genome that can accommodate
exogenous DNA up to 25 kb.
[0032] Adenovirus (Ad) is a 36 kb double-stranded DNA virus that
efficiently transfers DNA in vivo to a variety of different target
cell types. For use in the inventive methods, the virus is
preferably made replication deficient by deleting select genes
required for viral replication, such as, for example, all or
portions of the E1, E2, and/or E4 regions. The expendable E3 region
is also frequently deleted to allow additional room for a larger
DNA insert. The vector can be produced in high titers and can
efficiently transfer DNA to replicating and non-replicating cells.
The newly transferred genetic information remains epi-chromosomal,
thus eliminating the risks of random insertional mutagenesis and
permanent alteration of the genotype of the target cell. Adenoviral
vectors can be derived from any serotype of adenovirus. Adenoviral
stocks that can be employed as a source of adenovirus can be
amplified from adenoviral serotypes 1 through 51, which are
currently available from the American Type Culture Collection
(ATCC, Manassas, Va.), or from any other serotype of adenovirus
available from any other source. For instance, an adenovirus can be
of subgroup A (e.g., serotypes 12, 18, and 31), subgroup B (e.g.,
serotypes 3, 7, 11, 14, 16, 21, 34, and 35), subgroup C (e.g.,
serotypes 1, 2, 5, and 6), subgroup D (e.g., serotypes 8, 9, 10,
13, 15, 17, 19, 20, 22-30, 32, 33, 36-39, and 42-47), subgroup E
(serotype 4), subgroup F (serotypes 40 and 41), or any other
adenoviral serotype. Preferably, however, an adenovirus is of
serotype 2, 5, or 9. In one embodiment, the adenoviral vector is of
serotype 5 and has deletions in the E1 and E3 regions.
[0033] AAV vectors are viral vectors of particular interest for use
in gene therapy protocols (see, e.g., Santos Coura et al., Virology
J., 4: 99 (2007)). AAV is a nonenveloped DNA virus, which is not
known to cause human disease. AAV usually requires co-infection
with a helper virus (i.e., an adenovirus or a herpes virus), or
expression of helper genes, for efficient replication. In the
absence of a helper virus, AAVs establish a latent infection within
the target cell. The genome of AAV consists of an approximately 4.7
kb single-stranded linear DNA that contains two open reading frames
(ORFs). The left ORF encodes nonstructural Rep proteins, and the
right ORF encodes capsid (Cap) proteins VP1, VP2, and VP3. Each end
of the AAV genome comprises a 145 base inverted terminal repeat
(ITR), which contains the viral origin of DNA replication and the
packaging signal. AAV ITR nucleotide sequences have been previously
described, (see, e.g., Kotin et al., Human Gene Ther., 5: 793-801
(1994); Berns "Parvoviridae and Their Replication" in Fundamental
Virology, 2nd Edition (B. N. Fields and D. M. Knipe, eds.)).
[0034] AAV vectors used for administration of a therapeutic nucleic
acid can have approximately 96% or more of the parental genome
deleted, such that only the ITRs remain. This eliminates
immunologic or toxic side effects due to expression of viral genes.
In addition, delivering the AAV Rep protein enables integration of
the AAV vector comprising AAV ITRs into a specific region of
genome, if desired. Host cells comprising an integrated AAV genome
show no change in cell growth or morphology (see, for example, U.S.
Pat. No. 4,797,368). AAV vectors can be derived from any serotype
of AAV, including, but not limited to, any of the 11 known AAV
serotypes (i.e., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8,
AAV9, AAV10, and AAV11). AAV stocks that can be employed as a
source of AAV can be amplified from AAV1, AAV2, AAV3, AAV4, or
AAV5, which are currently available from the American Type Culture
Collection (ATCC, Manassas, Va.), or from any other serotype of AAV
available from any other source. Serotype 2 AAV (AAV2) has been the
most extensively studied of all of the AAV serotypes. AAV2 can
infect many different cell types, including skeletal muscle cells,
neurons, vascular smooth muscle cells, and hepatocytes. In the
context of the invention, an AAV2 gene transfer vector preferably
is used to infect neurons.
[0035] The nonpathogenic and persistent long-term nature of AAV
infection, combined with its wide range of infectivity, has made
this virus an important candidate as a therapeutic gene transfer
vector. However, if desired, the integrative properties of AAV can
be conferred to adenovirus by constructing an AAV-Ad chimeric
vector. For example, the AAV ITRs and nucleic acid encoding the Rep
protein incorporated into an adenoviral vector enable the
adenoviral vector to integrate into a mammalian cell genome.
[0036] Regulatory sequences for use in the vector of the invention
can be provided from commonly used promoters derived from viruses
such as polyoma, adenovirus 2, cytomegalovirus, and simian virus
40. The use of viral regulatory elements to direct expression of
the protein can allow for high level constitutive expression of the
protein in a variety of host cells. Ubiquitously expressing
promoters also can be used, including, for example, the early
cytomegalovirus promoter (see, e.g., Boshart et al., Cell, 41:
521-530 (1985)), herpesvirus thymidine kinase (HSV-TK) promoter
(see, e.g., McKnight et al., Cell, 37: 253-262 (1984)),
.beta.-actin promoters (e.g., the human .beta.-actin promoter as
described by Ng et al., Mol. Cell Biol., 5: 2720-2732 (1985)), and
colony stimulating factor-1 (CSF-1) promoter (see, e.g., Ladner et
al., EMBO J., 6: 2693-2698 (1987)).
[0037] Alternatively, the regulatory sequences of the vector can
direct expression of the gene preferentially in a particular cell
type, i.e., tissue-specific regulatory elements can be used.
Examples of tissue-specific promoters which can be used include
cardiovascular system specific promoters, i.e., promoters that are
(a) essentially inactive outside the cardiovascular system or (b)
more active in the cardiovascular system than in other systems. For
example, the tissue-specific promoter may be a promoter specific
for the heart or blood vessels. The promoter can be specific for
particular cell types, such as fibroblasts, cardiomyocytes, or
endothelial cells.
[0038] In order to produce recombinant viral particles, a viral
vector can be introduced into a suitable host cell using known
techniques, such as by transfection. A number of transfection
techniques are generally known in the art (see, e.g., Graham et
al., Virology, 52: 456-467 (1973); Sambrook et al., Molecular
Cloning, a Laboratory Manual, 2d edition, Cold Spring Harbor Press,
Cold Spring Harbor, N.Y. (1989); Davis et al., Basic Methods in
Molecular Biology, Elsevier (1986); and Chu et al., Gene, 13: 97
(1981)). Particularly suitable transfection methods include calcium
phosphate co precipitation (see, e.g., Graham et al., Virology, 52:
456-467 (1973)), direct micro injection into cultured cells (see,
e.g., Capecchi, Cell, 22: 479 488 (1980)), electroporation (see,
e.g., Shigekawa et al., BioTechniques, 6: 742-751 (1988)), liposome
mediated gene transfer (see, e.g., Mannino et al., BioTechniques,
6: 682-690 (1988)), lipid mediated transduction (see, e.g., Felgner
et al., Proc. Natl. Acad. Sci. (USA), 84: 7413-7417 (1987)), and
nucleic acid delivery using high velocity microprojectiles (see,
e.g., Klein et al., Nature, 327: 70-73 (1987)).
[0039] Suitable host cells for producing recombinant viral
particles include, but are not limited to, microorganisms, yeast
cells, insect cells, and mammalian cells, that can be, or have
been, used as recipients of an exogenous nucleic acid molecule.
Thus, a "host cell" as used herein generally refers to a cell which
has been transfected with an exogenous nucleic acid molecule. The
host cell includes any eukaryotic cell or cell line so long as the
cell or cell line is not incompatible with the protein to be
expressed, the selection system chosen, or the fermentation system
employed. Non-limiting examples include CHO dhfr-cells (see, e.g.,
Urlaub et al., Proc. Natl. Acad. Sci. (USA), 77: 4216-4220 (1980)),
293 cells (see, e.g., Graham et al., J. Gen. Virol., 36: 59
(1977)), and myeloma cells such as SP2 and NS0 (see, e.g., Galfre
et al., Meth. Enzymol., 73: 3-46 (1981)).
[0040] In one embodiment, the stable human embryonic kidney cell
line 293 (e.g., ATCC Accession No. ATCC CRL1573) is used in the
practice of the invention. The 293 cell line is readily transfected
and provides a particularly convenient platform in which to produce
recombinant virions. For example, to produce recombinant lentiviral
particles, a human 293 cell line may be co-transfected with a
lentiviral vector containing the transgene, a packaging vector
(e.g., psPAX), and an envelope vector (e.g., pMD2G).
[0041] The first and second vectors may each be derived from the
same virus, e.g., the first vector may be an adenoviral vector and
the second vector may be an adenoviral vector. Alternatively, the
first and second vectors may each be derived from different
viruses, e.g., the first vector may be an adenoviral vector and the
second vector may be a lentiviral vector. In an alternative
embodiment, a single vector encodes both the one or more angiogenic
proteins and the one or more cardio-differentiating transcription
factors, i.e., the first and second vector are the same (single)
vector.
[0042] When the first and second vectors are two vectors, the first
and second vectors may be administered in any order. For instance,
the first vector may be administered before, after, or at the same
time as the second vector. The first vector may be administered,
e.g., about 1 hour, 1 day, 3 days, 5 days, 1 week, 2 weeks, 3
weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, or 10
weeks before or after the second vector. In a preferred embodiment,
the first vector is administered about 3 weeks before the second
vector.
[0043] The administration of a lentiviral vector encoding three
transcription factors (Gata4, Mef2c and Tbx5 (GMT)) used as a
stimulus for iCM generation together with administration of an
adenoviral vector encoding all three major isoforms of VEGF results
in greater improvements in post-infarct myocardial function than
does the administration of GMT or VEGF alone. In fact, this
discovery stands in contradistinction to the recent work of other
investigators that suggests that cellular reprogramming mediated by
GMT strategy is ineffectual (Chen et al., Circ. Res., 111(1): 50-55
(2012)).
[0044] The coronary artery disease of the mammal may be considered
to be treated if any improvement in cardiac function or
pathophysiology results from the administration of the vectors. For
example, increased numbers of cardiomyocytes or iCM, reduced
fibrosis, increased vascularization, improved ventricular function,
and increased ejection fraction are indicators of successful
treatment of coronary artery disease. These indicators may be
measured or evaluated by any method known in the art, including
immunohistochemistry, immunofluorescence, fluorescence activated
cell sorting (FACS), microscopy, or echocardiography.
[0045] The presumptive origin of improvements in post-infarct
ventricular function is the generation of functional iCM in areas
of myocardial scar and the enhancement of the survival and/or
function of these "reprogrammed" myocytes by scar
prevascularization (Qian et al., Nature, 485(7400): 593-598 (2012);
Passier et al., Cell Stem Cell, 7(2): 139-141 (2010); Song et al.,
Nature, 485(7400): 599-604 (2012); Srivastava et al., Circ. Res.,
111(1): 5-8 (2012); Retuerto et al., J. Thorac. Cardiovasc. Surg.,
127(4): 1041-1049 (2004); Retuerto et al., J. Thorac. Cardiovasc.
Surg., 133(2): 478-484 (2007)). Interestingly, the observed
improvements in ejection fraction and decreases in fibrosis
following cellular reprogramming appear to far exceed what would be
expected solely on the basis of the relatively inefficient
generation of iCM from substrate cells (Qian et al., Nature,
485(7400): 593-598 (2012); Passier et al., Cell Stem Cell, 7(2):
139-141 (2010); Song et al., Nature, 485(7400): 599-604 (2012);
Srivastava et al., Circ. Res., 111(1): 5-8 (2012)). More
specifically, in comparison to a rate of transdifferentiating
infarct fibroblasts into iCM in vivo in the range of 1%-20%,
reductions in fibrosis and improvements in ejection fraction
ranging up to 50% suggest alternative or additional mechanisms may
be responsible for these outcomes (Qian et al., Nature, 485(7400):
593-598 (2012); Song et al., Nature, 485(7400): 599-604 (2012);
Jayawardena et al., Circ. Res., 110(11): 1465-1473 (2012)).
[0046] The generation of functionally competent, contractile iCM
may individually contribute to the restoration of global cardiac
function. The significant increases in MYH7.sup.+ (cardiomyocyte)
cell density in GMT treated versus control animals in both infarct
and border zones, similar to the previous observations of Qian et
al. and Song et al., is supportive of this mechanism (Qian et al.,
Nature, 485(7400): 593-598 (2012); Song et al., Nature, 485(7400):
599-604 (2012)). Alternatively, the generation of iCM in thinned
zones of infarction might improve wall stresses and thereby
decrease global myocardial workloads, as supported by observations
of the improved systolic function of remote left ventricular wall
segments in treated animals, and as previously postulated to be a
mechanism of action underlying the efficacy of stem cell implant
therapies (Leor et al., Circulation, 94(Suppl. 9): II332-II336
(1996); Taylor et al., Nature Med., 4(8): 929-933 (1998); Tomita et
al., Circulation, 100(Suppl. 19): II247-II256 (1999); Orlic et al.,
Nature, 410(6829): 701-704 (Apr. 5, 2001); Scorsin et al., J.
Thorac. Cardiovasc. Surg., 119(6): 1169-1175 (2000); Hare et al.,
Curr. Opin. Organ Transplant, 13(5): 536-542 (2008); Rosenzweig, N.
Engl. J. Med., 355(12): 1274-1277 (2006); Murry et al., J. Am.
Coll. Cardiol., 47(19): 1777-85 (2006); Menasche, J. Mol. Cell.
Cardiol., 50(2): 258-265 (2010); Min et al., J. Appl. Phys., 92(1):
288-296 (2002)).
[0047] The dramatic decrease in fibrosis seen in animals treated
according to the method of the present invention appears to far
exceed increases in the number of newly generated iCM, thereby
suggesting that the decrease in fibrosis may also contribute to the
significant improvements in ejection fraction observed in treated
animals. It is conceivable that a paracrine effect of a relatively
limited number of iCM might underlie this reduction in fibrosis,
due to the expression by iCM of chemokines such as basic fibroblast
growth factor and tissue inhibitor of matrix metalloproteinase
(TIMP)-2 that have been reported to limit or reduce fibrosis
(Daskalopoulos et al., Microsc. Microanal., 18(1): 35-49 (2012);
Fedak et al., Circ. Heart Failure, 5(3): 349-356 (2012); van den
Borne et al., Nature Rev. Cardiol., 7(1): 30-37 (2010)).
[0048] Alternatively, the administration of cellular reprogramming
and/or VEGF transgenes may divert resident/scar fibroblasts away
from their normal post-infarct differentiation into myofibroblasts,
which are known to produce fibrosis via expression of collagen and
other extracellular matrix components, and towards a more benign
fate as iCM (Daskalopoulos et al., Microsc. Microanal., 18(1):
35-49 (2012); Fedak et al., Circ. Heart Failure, 5(3): 349-356
(2012); van den Borne et al., Nature Rev. Cardiol., 7(1): 30-37
(2010); Chen et al., Am. J. Physiol. Heart Circ. Physiol., 291(4):
H1653-1658 (2006); Yang et al., J. Appl. Physiol., 93(3): 1140-1151
(2002); Zhang et al., Circulation, 119(13): 1776-1784 (2009); Song
et al., Biochem. Biophys. Res. Comm., 354(4): 999-1003 (2007);
Claes et al., Cardiovasc. Res., 91(3): 369-370 (2011)). The
four-fold reduction of myofibroblast populations observed in
GMT-treated animals versus controls, consistent with a similar
trend in reduced extent of fibrosis, supports this supposition.
Theoretically, alternative processes such as myofibroblast
apoptosis and/or repressed function (i.e., decreased extracellular
matrix component expression) could also play a role in such
mechanisms (Daskalopoulos et al., Microsc. Microanal., 18(1): 35-49
(2012); Fedak et al., Circ. Heart Failure, 5(3): 349-356 (2012);
van den Borne et al., Nature Rev. Cardiol., 7(1): 30-37 (2010);
Chen et al., Am. J. Physiol. Heart Circ. Physiol., 291(4):
H1653-1658 (2006); Yang et al., J. Appl. Physiol., 93(3): 1140-1151
(2002); Zhang et al., Circulation, 119(13): 1776-1784 (2009); Song
et al., Biochem. Biophys. Res. Comm., 354(4): 999-1003 (2007);
Claes et al., Cardiovasc. Res., 91(3): 369-370 (2011)).
[0049] The use of lentivirus and adenovirus vectors which infect
dividing and non-dividing cells (including cardiomyocytes) raises
the possibility also of GMT/VEGF effects on resident cardiomyocytes
in addition to the targeting of fibroblasts (Qian et al., Nature,
485(7400): 593-598 (2012); Passier et al., Cell Stem Cell, 7(2):
139-141 (2010); Song et al., Nature, 485(7400): 599-604 (2012);
Srivastava et al., Circ. Res., 111(1): 5-8 (2012); Jayawardena et
al., Circ. Res., 110(11): 1465-1473 (2012)). Some evidence in the
literature suggests that such effects might include changes in
cardiomyocyte structure, function, or stability/resistance to
ischemia (i.e., cardiac "super cells") (Daskalopoulos et al.,
Microsc. Microanal., 18(1): 35-49 (2012); Fedak et al., Circ. Heart
Failure, 5(3): 349-356 (2012); van den Borne et al., Nature Rev.
Cardiol., 7(1): 30-37 (2010); Chen et al., Am. J. Physiol. Heart
Circ. Physiol., 291(4): H1653-1658 (2006); Yang et al., J. Appl.
Physiol., 93(3): 1140-1151 (2002); Zhang et al., Circulation,
119(13): 1776-1784 (2009); Song et al., Biochem. Biophys. Res.
Comm., 354(4): 999-1003 (2007); Claes et al., Cardiovasc. Res.,
91(3): 369-370 (2011)). GMT and/or VEGF when administered via these
vectors might influence the differentiation of other
non-proliferating cells, such as resident cardiac progenitor cells,
fibroblasts, or endocardial cells towards a cardiomyocyte fate
and/or away from a myofibroblast phenotype.
[0050] Scar vascularization is important to support the survival
and function of stem cell implants, and a plateau in
neovascularization begins 3 weeks following administration of VEGF
(Retuerto et al., J. Thorac. Cardiovasc. Surg., 127(4): 1041-1049
(2004); Retuerto et al., J. Thorac. Cardiovasc. Surg., 133(2):
478-484 (2007); Amano et al., Mol Ther., 12(4): 716-724 (2005)).
Preliminary cell survival studies suggest that similar
considerations apply to observation of increased neovascularization
providing the nutrient perfusion needed to support the conversion
of low metabolic fibroblasts into high metabolic (induced)
cardiomyocytes.
[0051] The importance of scar prevascularization to the presently
described in situ cellular reprogramming strategy is supported by
the observation of the ability of AdVEGF to induce scar
vascularization in an acute myocardial infarction model, together
with the observation of significant improvements in ejection
fraction when VEGF is administered as a supplement to GMT. The lack
of change in MYH7.sup.+ cell density observed when VEGF is
administered without GMT suggests that VEGF does not play a
significant, independent role in cellular reprogramming in this
setting. In contrast, in the context of the lag in
neovascularization induced by VEGF relative to the more rapid time
course of myocardial infarction, and the observation of an
equivalent extent of fibrosis in animals treated with VEGF versus
without VEGF, the (comparatively limited) improvement in ejection
fraction observed after VEGF administration (without GMT) is
potentially attributable to the anti-apoptotic as well as the
angiogenic properties of VEGF, in promoting the viability and/or
function of border zone cells (Daskalopoulos et al., Microsc.
Microanal., 18(1): 35-49 (2012); Fedak et al., Circ. Heart Failure,
5(3): 349-356 (2012); van den Borne et al., Nature Rev. Cardiol.,
7(1): 30-37 (2010); Chen et al., Am. J. Physiol. Heart Circ.
Physiol., 291(4): H1653-1658 (2006); Yang et al., J. Appl.
Physiol., 93(3): 1140-1151 (2002); Zhang et al., Circulation,
119(13): 1776-1784 (2009); Song et al., Biochem. Biophys. Res.
Comm., 354(4): 999-1003 (2007); Claes et al., Cardiovasc. Res.,
91(3): 369-370 (2011)).
[0052] The methods of the invention may be combined with any other
known treatments for coronary artery disease, such as
pharmacological therapies or interventional/surgical procedures.
Pharmacological therapies include anti-platelet and anticoagulant
drugs, beta blockers, ACE inhibitors, nitrates, and calcium channel
blockers. Interventional procedures and surgeries include coronary
artery bypass grafting (commonly called bypass or CABG), which is
usually reserved for patients with severe coronary artery disease,
and percutaneous coronary intervention (commonly called angioplasty
or PCI), which typically involves involving coronary artery stent
placement.
[0053] The following example further illustrates the invention but,
of course, should not be construed as in any way limiting its
scope.
EXAMPLE 1
[0054] This example demonstrates the administration of
adenovirus-mediated VEGF into infarcted myocardium following
lentivirus-mediated administration of the cellular reprogramming
transcription factors Gata 4, Mef 2c and Tbx5 (GMT).
[0055] Vectors and cells: An adenovirus vector (AdVEGF-A116A.sup.+)
based on an Ad5 serotype backbone with deletions in the E1 and E3
regions and containing an artificial splice sequence cassette was
used to provide delivery of all three major isoforms of VEGF (121,
165, and 189) (Amano et al., Mol Ther., 12(4): 716-724 (2005)). An
analogous construct with an empty expression cassette (AdNull) was
used as a control vector.
[0056] Lentivirus vectors were constructed to provide expression of
Gata4, Mef2c, and Tbx5 (GMT) in targeted myocardial tissues. For
GMT vector construction, RNA was first isolated from rat heart
using TRIzol reagent (Invitrogen) and converted to cDNA using a
reverse transcription kit (Roche). These samples (for Mef2c) or
commercially available cDNA (for Gata4 and Tbx5; AddGene) were used
to amplify relevant coding sequences using primers based on the
PubMed nucleotide coding sequences for these three transgenes
(Table 1) (Ieda et al., Cell, 142(3): 375-386 (2010); Qian et al.,
Nature, 485(7400): 593-598 (2012)). Primers were designed to
include a Sal1 binding site 5' and Xho1 restriction site 3' of each
coding sequence. Gene inserts were amplified using a PCR kits
(Roche) and cloned into the pENTR3C vector prior to homologous
recombination into the F12-CMV vector (Invitrogen) under the
control of a CMV promoter. F12-CMV also includes an eGFP cassette
under the control of an ubiquitin promoter for lineage and
efficiency analysis.
TABLE-US-00001 TABLE 1 Primers used for plasmid construction Primer
Name Sequence Tm Gata4 5' GGCGGTCGACATGTACCAAAGCCTGGCTATG 72.6 (SEQ
ID NO: 1) Gata4 3' GATTCTCGAGTACGCGGTGATTATGTCCCCATG 70.9 (SEQ ID
NO: 2) Mef2c 5' GGACTGTCGACATGGGGAGAAAAAAGATTCAG 68.5 (SEQ ID NO:
3) Mef2c 3' TGTGACTCGAGTCATGTTGCCCATCCTTCAGAGAG 71.7 (SEQ ID NO: 4)
Tbx5 5' CACCGTCGACATGGCCGACGCAGATGAG 73.4 (SEQ ID NO: 5) Tbx5 3'
CCTTCTCGAGTCAAGCTATTCTCGCTCCACTCTG 71.9 (SEQ ID NO: 6)
[0057] Gata4, Mef2c, and Tbx5 F12-CMV plasmids thus generated were
transfected into the 293T human kidney fibroblasts cell line (ATCC)
along with gateway system using plasmids pMD2G and psPAX via
LIPOFETAMINE.TM. 2000 reagent (Invitrogen). Viral bearing
supernatant was isolated and cellular debris was removed by
centrifugation and syringe filtering (0.45 .mu.m pore size;
Sarstedt). Virus was further concentrated by centrifugation (2 h at
10,000.times.g) and supernatants were then aspirated and pellets
diluted in viral diluent (3% sucrose, 10 mM Tris-HCl, pH 7.6, 150
mM NaCl).
[0058] Dermal fibroblasts derived from 1 cm.sup.2 biopsies of the
abdominal skin of Fischer 344 rats were plated on plastic dishes
(Xu et al., Proc. Natl. Acad. Sci. (USA), 106(3): 808-813 (2009);
Ieda et al., Cell, 142(3): 375-386 (2010)). Attached fibroblasts
were cultured for 7 d in DMEM medium/10% FBS at 10.sup.4/cm.sup.2.
Cells were then re-plated and infected with appropriate vectors
after 24 h. Cardiomyocytes were obtained from the neonatal
ventricles of Sprague Dawley rats (gift of E. Entcheva) which were
cut into small pieces and digested with collagenase type II
solution. A single-cell suspension of primary cardiomyocytes was
then obtained by gentle passage through a 40-.mu.m cell strainer
and cells were plated on tissue culture treated dishes (Thermo
Scientific).
[0059] In vitro immunofluorescence (IF) studies: Lentivirus
encoding GMT or GFP control vectors in the presence of 8 .mu.g/ml
POLYBRENE.TM. (Millipore) were added to rat dermal fibroblast
culture media (DMEM+10% FBS) for 16 hrs. This media was then
removed and the cells were allowed to transdifferentiate under
normal culture conditions over a 14 d time course. These cells were
washed twice with phosphate buffered saline (PBS) and fixed with 4%
paraformaldehyde (Affymetrix) for 10 min. Cells were then
permeabilized with 0.5% saponin (Sigma) at room temperature for 10
min. Slides were blocked with 10% goat serum (Santa Cruz) prior to
incubation in 5% goat serum with primary antibodies directed toward
cardiac troponin T (cTnT; Abcam), beta myosin heavy chain 7 (MYH7;
Sigma), or .alpha. sarcomeric actinin (Sigma). Primary antibodies
were bound with fluorescent secondary (647 nm; Alexafluor), and
fluorescence was visualized using a Ti-S inverted phase/fluorescent
microscope with SPOT cooled 2.0 megapixel digital camera system
(Nikon).
[0060] Fluorescence activated cell sorting (FACS): For FACS
analyses, cells were washed with PBS and treated with 0.05% trypsin
(Gibco). These cells were then pelleted and permeabilized with 0.1%
saponin for 30 min at 4.degree. C., re-pelleted and suspended in 5%
goat serum, and incubated with relevant primary antibodies followed
by incubation with a fluorescent secondary antibody (647 nm;
Alexafluor). Cells were fixed with 1% paraformaldehyde and analyzed
for fluorescence using Cell Quest V3.3 software on a FACS Calibur
Flow Cytometer (Becton/Dickinson) (Ieda et al., Cell, 142(3):
375-386 (2010); Efe et al., Nature Cell. Bio., 13(3): 215-222
(2011); Qian et al., Nature, 485(7400): 593-598 (2012)).
[0061] Myocardial infarction in an animal model: Myocardial
infarction was created by coronary ligation, as previously
described, in adult male Fischer 344 rats (275-300 g; Harlan;
Indianapolis, Ind.), using protocols approved by the State
University of New York, Stony Brook Institutional Animal Care and
Use Committee (IACUC) (Retuerto et al., J. Thorac. Cardiovasc.
Surg., 127(4): 1041-1049 (2004); Retuerto et al., J. Thorac.
Cardiovasc. Surg., 133(2): 478-484 (2007)). Animals were housed,
operated on, and cared for in facilities run by the Division of
Laboratory Animal Resources (DLAR) at Stony Brook University, which
is fully accredited by the Association for the Assessment and
Accreditation of Laboratory Animal Care (AAALAC) International.
[0062] Animals were first anesthetized with isofluorane 4% in an
induction box, intubated, and placed on a rodent ventilator
(Harvard Apparatus) using isofluorane inhalation (3.5%)
supplemented with oxygen. Lidocaine (4 mg/kg) was administered
intramuscularly. A left thoracotomy was then performed, and the
left coronary artery was ligated 1 to 2 mm from its origin with a
7-0 polypropylene suture. This prep consistently produces a gross
(pale) antero-apical myocardial infarction (MI) with <20%
mortality.
[0063] At the time of coronary ligation, five uniformly distributed
20 .mu.L injections each containing 2.times.10.sup.8 pu
(1.times.10.sup.9 total dose) of Ad VEGF-A116A.sup.+ or AdNull
(n=12/group) was administered around the infarct zone, identified
as an area of blanching on the anterolateral wall of the left
ventricle, by operators blinded to treatment group. The chest was
then sutured closed layer-by-layer, and the animals were placed in
a heated chamber and allowed to recover under supervision.
Ketorolac (3-5 mg/kg) and buprenorphine (0.05-0.1 mg/kg) were
administered subcutaneously at the time of closure and every 12-24
hr post-operatively as needed, determined by the level of activity
displayed by the animals.
[0064] A second thoracotomy was performed 3 wks later, and animals
previously receiving AdVEGF-A116A.sup.+ or AdNull each then
underwent administration into the infarct zone of 1.times.10.sup.5
TU of lentivirus (5 uniformly distributed 20 .mu.L injections)
encoding Gata4, Mef2c, or Tbx5 coupled to a GFP marker, or encoding
GFP alone (final n=6/group). Animals again recovered as described
above. Euthanasia was later achieved 4 wks later by deep (4%)
isoflurane anesthesia followed by exsanguination, consistent with
AVMA guidelines.
[0065] Echocardiography: Echocardiography was performed under light
anesthesia with 3% isoflurane using a Veno 770.TM. Imaging System
(VisualSonics Inc., Toronto, ON, Canada) at five different time
points: prior to and 3 d after coronary ligation and
AdVEGF-A116A.sup.+ or AdNull, at the time of GMT or GFP
administration 21 d later (baseline), and then 2 wks and 4 wks
later after baseline (post-ligation day 35 and day 49,
respectively) (Retuerto et al., J. Thorac. Cardiovasc. Surg.,
127(4): 1041-1049 (2004); Retuerto et al., J. Thorac. Cardiovasc.
Surg., 133(2): 478-484 (2007)). Echo images were obtained of the
left ventricle in both parasternal long-axis and short-axis views
by investigators blinded to treatment group. Left ventricular
end-systolic and end-diastolic diameters and left ventricular
septal and posterior thickness (in both end-systolic and
end-diastolic phases) were measured from M-mode tracings. These
imaging data were then analyzed by investigators blinded to
treatment group. Change in ejection fraction (EF) was calculated
as: (EF at day 49)-(EF at day 21)]/(EF at day 21).
[0066] Histologic analyses: To obtain cardiac tissue specimens,
animals were exsanguinated under deep anesthesia via an incision
made in the right atrium. While the heart was still beating, it was
perfused with normal saline and fixed with phosphate-buffered
saline (pH 7.2) containing 4% (w/v) paraformaldehyde via a 25 gauge
needle inserted into the left ventricular apex. The heart was then
harvested and rinsed with saline to clear the blood. Excised hearts
were fixed with 4% paraformaldehyde for 24 h, and then 2%
paraformaldehyde for 48 h at 4.degree. C. The heart was then cut
transversally and sectioned to obtain two (2-3 mm) slices, one
immediately cephalad and one immediately caudad to the transverse
centerline of the infarct region, which was readily identifiable by
gross inspection. After paraffin embedding of these slices, seven 5
.mu.m thick sections were obtained at 90 .mu.m intervals.
[0067] For analyses of in vivo cellular reprogramming, microscopic
slides of every other section obtained as described above were
stained with primary antibodies against beta myosin heavy chain 7
(anti-MYH7, Sigma), then incubated with secondary IgG antibody.
Five microscopic fields per slide (at the center of the infarction
zone, in the mid areas between the center of infarction and the
border zone [left and right], and in each border zone adjacent to
the infarct [left and right]) viewed at 200.times. magnification
were graded semi-quantitatively in order to determine MYH7.sup.+
cell density. Density grading assessed by an investigator blinded
to treatment group were defined as follows: Grade I: <25% of
selected microscopic field demonstrating MYH7.sup.+ cells/; Grade
II: 25%-50% of selected microscopic field demonstrating MYH7.sup.+
cells; Grade III: 50%-75% of selected microscopic field
demonstrating MYH7.sup.+ cells; and Grade IV: >75% of selected
microscopic field demonstrating MYH7.sup.+ cells (FIG. 7).
[0068] These observations are reported as the percentage of fields
per animal demonstrating a given density grade, and the mean of
these percentages per group for all animals with at least ten
fields analyzable within an infarct zone.
[0069] To assess the extent of fibrosis, 22 sections per animal (at
a 120 .mu.m interval between each section) obtained as described
above were stained with Masson's trichrome. The fibrotic area
(blue) and the non-fibrotic region (red) were outlined using Adobe
PHOTOSHOP.TM. CS5 software, and then quantified with MATLAB &
SIMULINK software (Math Works, Inc). The total area of fibrosis was
calculated as: [total of blue pixels from all sections/total of
blue plus red pixels from all sections].
[0070] For myofibroblast identification, two sections per animal
demonstrating the greatest cross sectional area of fibrosis, as
determined by trichrome staining, were stained for .alpha.-smooth
muscle actin (Anti-Actin-Smooth Muscle, Spring Bioscience
[.alpha.-SMA]). .alpha.-SMA-positive cells in these sections
exclusive of those found in vascular structures or endocardium were
counted at 200.times. magnification.
[0071] For vascularization studies, the number of vessels per
microscopic field was determined from the sections stained as above
with .alpha.-SMA, or with Factor VIII (anti-Factor VIII-related
antigen, Ventana) and counted at 200.times. or 400.times.,
respectively.
[0072] Statistical analysis: Statistical analysis was performed
with SAS, 9.2. The data is presented as mean.+-.standard error of
the mean. The normality of the data was examined with Shapiro-Wilk.
When there was a normal distribution, an ANOVA test was performed
to detect statistical significances between multiple groups. When
the ANOVA test showed significance, a student t-test was performed
with a post hoc Holm-Bonferroni correction. When there was not a
normal distribution, a Kruskal-Wallis test was performed. When the
test was significant, the Wilcoxon rank test was performed with a
post-hoc Holm-Bonferroni correction. For categorical variables, a
Fischer exact test was performed. Values of p<0.05 were
considered statistically significant.
[0073] In vitro iCM generation: The competency of each of the GMT
lentivirus vectors was confirmed by in vitro cell infection assays,
which demonstrated expression of all three of the reprogramming
transcription factors (FIG. 1). Confirmation of the ability of
these transcription factors to induce iCM transdifferentiation was
obtained by immunofluorescence staining of rat dermal fibroblasts
following GMT lentiviral transduction. In these studies, cells
exposed to GMT vectors expressed cardiomyocyte-specific markers
including cardiac troponin T (cTnT), alpha sarcomeric actin, and
beta myosin heavy chain (MYH) 7, while uninfected cells and
fibroblasts exposed only to a GFP control vector failed to express
these markers (FIG. 2A). By FACS quantification, GMT infection
demonstrated evidence of cardiomyocyte marker expression by
approximately 7% of infected fibroblasts (FIGS. 2B-F).
[0074] Vascularization of infarcted myocardium: Vascularization of
the infarct region as assessed by .alpha.-SMA staining was
significantly greater in AdVEGF-A116A.sup.| treated animals
compared to animals receiving an AdNull control vector: 5.5.+-.0.9
versus 3.3.+-.0.4, respectively; p<0.05 (FIG. 3; FIG. 8). A
similar, approximate two-fold increase in vessels stained with
Factor VIII was noted in animals receiving AdVEGF-A116A.sup.+ alone
versus those receiving AdNull alone (14.1.+-.2.1 versus 7.3.+-.1.4,
p<0.05). Also see FIGS. 10A-B.
[0075] Histologic assessment of post-infarct ventricles: In order
to assess the efficacy of GMT administration with or without VEGF
pre-treatment in vivo, a series of histologic analyses were
performed on sections of the heart obtained 4 wks following GMT/GFP
delivery (7 wks following coronary ligation and
AdVEGF-A116A.sup.+/AdNull administration). These studies
demonstrated a greater density of cells staining for the
cardiomyocyte marker MYH7 in the infarct zone in GMT-treated
animals compared to control animals (FIGS. 4A-D). Typically,
GMT-treated animals demonstrated relatively large islands of
MYH7.sup.+ cells, compared to sparse foci of MYH7.sup.+ in control
animals.
[0076] Using a Grade I-IV scale to semi-quantitatively assess MYH7
cell density, GMT treated animals demonstrated Grade III/IV MYH7
cell density in the infarct zone in a greater percentage of
microscopic fields than did GFP control animals, both in the
infarct zone and border zones (Table 2).
TABLE-US-00002 TABLE 2 MYH7.sup.+ cell density* Grade
I.sup..dagger. Grade II.sup..dagger. Grade III.sup..dagger. Grade
IV.sup..dagger. Infarction Area AdVEGF-All6A.sup.+/GMT 12 .+-. 5 44
.+-. 8 30 .+-. 7 14 .+-. 5 AdNull/GMT 29 .+-. 13 41 .+-. 8 22 .+-.
7 8 .+-. 5 AdVEGF-All6A.sup.+/GFP 61 .+-. 14 34 .+-. 13 5 .+-. 3 0
AdNull/GFP 50 .+-. 14 40 .+-. 10 10 .+-. 6 0 Border Zone Area
AdVEGF-All6A.sup.+/GMT 4 .+-. 3 29 .+-. 9 48 .+-. 10 19 .+-. 7
AdNull/GMT 14 .+-. 10 24 .+-. 7 38 .+-. 9 25 .+-. 10
AdVEGF-All6A.sup.+/GFP 30 .+-. 14 48 .+-. 11 21 .+-. 12 1 .+-. 1
AdNull/GFP 43 .+-. 13 32 .+-. 7 22 .+-. 10 3 .+-. 2 *Percent of
microscopic fields analyzed demonstrating density grade (n = 6
animals per treatment group). .dagger.Grade I: <25% of
microscopic field containing MYH7.sup.+ cells: Grade II: 25%-50% of
microscopic field containing MYH7.sup.+ cells, Grade III: 50%-75%
of microscopic field containing MYH7.sup.+ cells; Grade IV: >75%
of microscopic field containing MYH7.sup.+ cells. All measurements
at 200X
[0077] The percentage of microscopic fields demonstrating Grade
III/IV MYH7 cell density was significantly greater in GMT-treated
animals compared to GFP-treated control animals (36%.+-.8% versus
7%.+-.4%, p<0.01) in the infarct zone and in the border zones
adjacent to these infarct zones (65%.+-.10% versus 23%.+-.9%,
p<0.01). Notably, none of the sections demonstrated Grade IV
MYH7 cell density in the infarct zone in the GFP control groups.
The administration of AdVEGF-A116A.sup.+ did not appear to alter
MYH7 cell density (FIG. 4E). Also see FIGS. 11A-B.
[0078] The extent of fibrosis in these sections, as detected by
trichrome staining, was also significantly reduced in GMT-treated
animals compared to those receiving GFP, regardless of VEGF
administration (FIG. 5A). The cross sectional area of fibrosis in
these groups, as a percentage of total left ventricular myocardial
area in sections analyzed, was 12%.+-.2% versus 24%.+-.3%,
(p<0.01). No difference in the extent of fibrosis was detected
in animals treated with AdVEGF-A116A.sup.+ without GMT compared to
AdNull/GFP controls (FIG. 5B). Also, AdVEGF-A116A.sup.+
administration did not further reduce the extent of fibrosis
compared to animals treated with GMT without VEGF. Also see FIGS.
12A-B.
[0079] Consistent with the reduction in fibrosis detected in
GMT-treated animals, there was approximately a four-fold decrease
in the number of myofibroblasts observed in GMT-treated animals
compared to control animals, regardless of VEGF administration
(FIG. 5C; FIG. 9).
[0080] Improvement in ventricular function following GMT and VEGF
administration: Echocardiography was performed to assess the
functional implications of the outcomes noted above. Echo analyses
performed before and immediately after coronary ligation
demonstrated that ejection fraction was reduced by approximately
30% from baseline values (FIG. 6A). This decrease in cardiac
function persisted 3 wks later, at the time of GMT or GFP
lentivirus administration.
[0081] As detailed in Table 3, mean ejection fraction 4 wks after
GMT or GFP administration was greatest for animals receiving GMT
administration with AdVEGF-A116A.sup.+ pretreatment
(AdVEGF-A116A.sup.+/GMT), being significantly greater than animals
receiving either AdVEGF-A116A.sup.+ without GMT
(AdVEGF-A116A.sup.+/GFP; p<0.05) or both control vectors
(AdNull/GFP; p<0.05).
TABLE-US-00003 TABLE 3 Ejection fraction group means as assessed by
echocardiography* Time (days).sup..dagger. Group 0 3 21 35 49
AdVEGF-All6A.sup.+/GMT 75 .+-. 2 55 .+-. 3 54 .+-. 2 65 .+-. 2 63
.+-. 2.sup..dagger-dbl..sctn..parallel. AdNull/GMT 75 .+-. 1 56
.+-. 3 53 .+-. 2 61 .+-. 3 56 .+-. 2.sup..parallel.
AdVEGF-All6A.sup.+/GFP 76 .+-. 1 51 .+-. 3 51 .+-. 2 53 .+-. 4 51
.+-. 2.sup..sctn.# AdNull/GFP 74 .+-. 1 51 .+-. 2 53 .+-. 3 52 .+-.
8 48 .+-. 2.sup..dagger-dbl.# *All data expressed as a percent
ejection fraction (n/animals per treatment group) .sup..dagger.Day
0 represents time of coronary ligation and AdVEGF-All6A or AdNull
administration; day 21 represents time of administration of
lentivirus encoding GMT or GFP
.sup..dagger-dbl.AdVEGF-All6A.sup.+/GMT versus AdNull/GFP at 49 d:
p < 0.05 .sup..sctn.AdVEGF-All6A.sup.+/GMT versus
AdVEGF-All6A.sup.+/GFP at 49d: p < 0.05
.sup..parallel.AdvEGF-All6A.sup.+/GMT versus AdNull/GMT at 49 d: p
= 0.08 .sup.#AdVEGF-All6A.sup.+/GFP versus AdNull/GFP at 49 d: p =
0.86
[0082] Similar observations were made for differences between
groups in fractional shortening (Table 4).
TABLE-US-00004 TABLE 4 Ventricular functional metrics as assessed
by echocardiography* Parameter Time (days).sup..dagger. End
diastolic volume.sup..dagger-dbl. 0 3 21 35 49
AdVEGF-All6A.sup.+/GMT 217 .+-. 7 181 .+-. 13 215 .+-. 17 222 .+-.
21 234 .+-. 25 AdNull/GMT 206 .+-. 8 147 .+-. 18 239 .+-. 12 208
.+-. 16 231 .+-. 23 AdVEGF-All6A.sup.+/GFP 192 .+-. 11 197 .+-. 11
302 .+-. 30 240 .+-. 32 280 .+-. 32 AdNull/GFP 207 .+-. 13 193 .+-.
19 262 .+-. 17 265 .+-. 32 252 .+-. 26 End systolic volume
AdVEGF-All6A.sup.+/GMT 54 .+-. 5 80 .+-. 7 99 .+-. 10 80 .+-. 11 84
.+-. 7 AdNull/GMT 51 .+-. 2 65 .+-. 5 112 .+-. 10 81 .+-. 10 105
.+-. 14 AdVEGF-All6A.sup.+/GFP 47 .+-. 3 97 .+-. 8 148 .+-. 17 117
.+-. 23 139 .+-. 20 AdNull/GFP 54 .+-. 4 95 .+-. 11 123 .+-. 11 131
.+-. 23 134 .+-. 18 Fractional shortening AdVEGF-All6A.sup.+/GMT 45
.+-. 2 30 .+-. 2 29 .+-. 1 36 .+-. 2 35 .+-.
1.sup..sctn..parallel.# AdNull/GMT 45 .+-. 1 29 .+-. 2 28 .+-. 1 34
.+-. 2 30 .+-. 1.sup..sctn.** AdVEGF-All6A.sup.+/GFP 46 .+-. 1 27
.+-. 2 27 .+-. 1 28 .+-. 2 27 .+-. 1.sup..parallel. AdNull/GFP 44
.+-. 1 27 .+-. 1 28 .+-. 2 27 .+-. 2 25 .+-. 1.sup.#** *All data
expressed as a percent ejection fraction (n = 6 animals per
treatment group) .sup..dagger.Day 0 represents time of coronary
ligation and AdVEGF-All6A or AdNull administration; day 21
represents time of administration of lentivirus encoding GMT or GFP
.sup..dagger-dbl.No significant difference between groups at any
time interval. .sup..sctn.AdVEGF-All6A+/GMT vs. AdNull/GMT: p =
0.08 .parallel.AdVEGF-All6A+/GMT vs. AdVEGF-All6A+/GFP: p < 0.01
#AdVEGF-All6A+/GMT vs. AdNull/GFP: p < 0.0001 **AdNull/GMT vs.
AdNull/GFP: p = 0.07
[0083] When grouped together regardless of prior AdVEGF
administration, GMT-treated animals demonstrated significantly
greater mean ejection fraction compared to similarly combined GFP
control animals, both at 2 wks and at 4 wks following lentivirus
administration (2 wks: 63%.+-.2% versus 52%.+-.2%, p<0.01); 4
wks: 60%.+-.2% versus 49%.+-.2%, p<0.001). In comparison, no
difference in ejection fraction was seen following
AdVEGF-A116A.sup.+ administration alone (without GMT) versus
animals receiving control vectors.
[0084] The change in ejection fraction from the time of the
lentivirus administration baseline to the time of follow up echo 4
wks later (FIG. 6B, top panel) was also greater in the GMT versus
GFP groups (12%.+-.3% versus -7%.+-.3%, p<0.01). Eight (73%)
GFP-treated animals, but none of the GMT animals, demonstrated
decreased ejection fraction during this interval (p<0.01).
Moreover, as depicted in FIG. 6B (bottom panel), the improvement in
ejection fraction observed in the AdVEGF-A116A.sup.+/GMT group was
four times greater than that observed for the AdNull/GMT group
(17%.+-.2% versus 4%.+-.1%, p<0.05), and was significantly
greater (p=0.008) than the change in ejection fraction observed
after administration of VEGF alone (AdVEGF-A116A.sup.|/GFP).
[0085] Interestingly, systolic wall thickening of the (remote,
non-injected) left ventricular posterior wall also trended towards
greater values in the GMT/VEGF group compared to animals receiving
GMT without VEGF and compared to GFP/AdNull controls (FIG. 6C).
[0086] All references, including publications, patent applications,
and patents, cited herein are hereby incorporated by reference to
the same extent as if each reference were individually and
specifically indicated to be incorporated by reference and were set
forth in its entirety herein.
[0087] The use of the terms "a" and "an" and "the" and "at least
one" and similar referents in the context of describing the
invention (especially in the context of the following claims) are
to be construed to cover both the singular and the plural, unless
otherwise indicated herein or clearly contradicted by context. The
use of the term "at least one" followed by a list of one or more
items (for example, "at least one of A and B") is to be construed
to mean one item selected from the listed items (A or B) or any
combination of two or more of the listed items (A and B), unless
otherwise indicated herein or clearly contradicted by context. The
terms "comprising," "having," "including," and "containing" are to
be construed as open-ended terms (i.e., meaning "including, but not
limited to,") unless otherwise noted. Recitation of ranges of
values herein are merely intended to serve as a shorthand method of
referring individually to each separate value falling within the
range, unless otherwise indicated herein, and each separate value
is incorporated into the specification as if it were individually
recited herein. All methods described herein can be performed in
any suitable order unless otherwise indicated herein or otherwise
clearly contradicted by context. The use of any and all examples,
or exemplary language (e.g., "such as") provided herein, is
intended merely to better illuminate the invention and does not
pose a limitation on the scope of the invention unless otherwise
claimed. No language in the specification should be construed as
indicating any non-claimed element as essential to the practice of
the invention.
[0088] Preferred embodiments of this invention are described
herein, including the best mode known to the inventors for carrying
out the invention. Variations of those preferred embodiments may
become apparent to those of ordinary skill in the art upon reading
the foregoing description. The inventors expect skilled artisans to
employ such variations as appropriate, and the inventors intend for
the invention to be practiced otherwise than as specifically
described herein. Accordingly, this invention includes all
modifications and equivalents of the subject matter recited in the
claims appended hereto as permitted by applicable law. Moreover,
any combination of the above-described elements in all possible
variations thereof is encompassed by the invention unless otherwise
indicated herein or otherwise clearly contradicted by context.
Sequence CWU 1
1
6131DNAArtificial SequenceSynthetic primer 1ggcggtcgac atgtaccaaa
gcctggctat g 31233DNAArtificial SequenceSynthetic primer
2gattctcgag tacgcggtga ttatgtcccc atg 33332DNAArtificial
SequenceSynthetic primer 3ggactgtcga catggggaga aaaaagattc ag
32435DNAArtificial SequenceSynthetic primer 4tgtgactcga gtcatgttgc
ccatccttca gagag 35528DNAArtificial SequenceSynthetic primer
5caccgtcgac atggccgacg cagatgag 28634DNAArtificial
SequenceSynthetic primer 6ccttctcgag tcaagctatt ctcgctccac tctg
34
* * * * *