U.S. patent application number 16/443405 was filed with the patent office on 2019-11-21 for methods for systemically delivering polypeptides and microorganisms therefor.
This patent application is currently assigned to WISCONSIN ALUMNI RESEARCH FOUNDATION. The applicant listed for this patent is WISCONSIN ALUMNI RESEARCH FOUNDATION. Invention is credited to Alan Attie, Mark Keller, Jee-Hwan Oh, Jan Peter Van Pijkeren.
Application Number | 20190351020 16/443405 |
Document ID | / |
Family ID | 67543787 |
Filed Date | 2019-11-21 |
![](/patent/app/20190351020/US20190351020A1-20191121-D00001.png)
![](/patent/app/20190351020/US20190351020A1-20191121-D00002.png)
![](/patent/app/20190351020/US20190351020A1-20191121-D00003.png)
![](/patent/app/20190351020/US20190351020A1-20191121-D00004.png)
![](/patent/app/20190351020/US20190351020A1-20191121-D00005.png)
![](/patent/app/20190351020/US20190351020A1-20191121-D00006.png)
![](/patent/app/20190351020/US20190351020A1-20191121-D00007.png)
![](/patent/app/20190351020/US20190351020A1-20191121-D00008.png)
![](/patent/app/20190351020/US20190351020A1-20191121-D00009.png)
![](/patent/app/20190351020/US20190351020A1-20191121-D00010.png)
![](/patent/app/20190351020/US20190351020A1-20191121-D00011.png)
View All Diagrams
United States Patent
Application |
20190351020 |
Kind Code |
A1 |
Van Pijkeren; Jan Peter ; et
al. |
November 21, 2019 |
METHODS FOR SYSTEMICALLY DELIVERING POLYPEPTIDES AND MICROORGANISMS
THEREFOR
Abstract
Methods and microorganisms for systemically introducing a
polypeptide in the bloodstream of a subject. The methods of the
invention include administering into the gastrointestinal tract of
a subject a bacterium configured to express and produce and release
the polypeptide. The bacterium is administered in an amount
effective to introduce the polypeptide in the bloodstream of the
subject, preferably in a detectable amount. The microorganisms of
the invention include lactic acid bacteria, such as Lactobacillus
reuteri, that comprise a recombinant gene configured to express a
polypeptide to be systemically introduced.
Inventors: |
Van Pijkeren; Jan Peter;
(Madison, WI) ; Attie; Alan; (Madison, WI)
; Keller; Mark; (McFarland, WI) ; Oh;
Jee-Hwan; (Madison, WI) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
WISCONSIN ALUMNI RESEARCH FOUNDATION |
Madison |
WI |
US |
|
|
Assignee: |
WISCONSIN ALUMNI RESEARCH
FOUNDATION
Madison
WI
|
Family ID: |
67543787 |
Appl. No.: |
16/443405 |
Filed: |
June 17, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15431373 |
Feb 13, 2017 |
10376563 |
|
|
16443405 |
|
|
|
|
62294578 |
Feb 12, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 9/0053 20130101;
C07K 14/54 20130101; A61K 38/20 20130101; C07K 2319/02 20130101;
A61K 9/10 20130101; A61K 38/02 20130101; A61K 47/26 20130101; A61K
2035/11 20130101; A61K 35/747 20130101 |
International
Class: |
A61K 38/20 20060101
A61K038/20; A61K 9/00 20060101 A61K009/00; C07K 14/54 20060101
C07K014/54; A61K 35/747 20060101 A61K035/747; A61K 38/02 20060101
A61K038/02 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0001] This invention was made with government support under
DK101573 and DK102948 awarded by the National Institutes of Health.
The government has certain rights in the invention.
Claims
1-20. (canceled)
21. A method of systemically introducing a polypeptide into a
bloodstream of a subject, the method comprising administering into
the gastrointestinal tract of the subject a bacterium that produces
and releases the polypeptide, wherein the bacterium comprises a
recombinant gene configured to express the polypeptide, wherein the
bacterium is administered in an amount effective to introduce the
polypeptide in the bloodstream of the subject in a detectable
amount without the bacterium being introduced in the bloodstream of
the subject in a detectable amount.
22. The method of claim 21, wherein the bacterium is administered
in an amount effective to introduce the polypeptide in the
bloodstream in an amount effective to induce at least one direct
systemic effect in the subject.
23. The method of claim 21, wherein the bacterium is administered
in an amount effective to introduce the polypeptide in the
bloodstream in an amount effective to induce at least one direct
effect in a non-gastrointestinal tissue in the subject.
24. The method of claim 21, wherein the bacterium is administered
in an amount effective to introduce the polypeptide in the
bloodstream in an amount effective to induce at least one direct
effect in a tissue selected from the group consisting of liver,
muscles, lungs, kidneys, pancreas, and adipose tissue in the
subject.
25. The method of claim 21, wherein the subject suffers from a
condition treatable with systemic introduction of the polypeptide
and wherein the polypeptide is introduced in the bloodstream of the
subject in an amount effective to treat the condition.
26. The method of claim 21, wherein the subject suffers from a
condition treatable with systemic introduction of the polypeptide
but not treatable with local introduction of the polypeptide to the
gastrointestinal tract without systemic introduction of the
polypeptide, and wherein the polypeptide is introduced in the
bloodstream of the subject in an amount effective to treat the
condition.
27. The method of claim 21, wherein the recombinant gene is codon
optimized.
28. The method of claim 21, wherein the polypeptide is selected
from the group consisting of a cytokine, a hormone, an antibody, an
antimicrobial peptide, and an antigenic peptide.
29. The method of claim 21, wherein the polypeptide is selected
from the group consisting of interleukin-22 (IL-22), interleukin-35
(IL-35), insulin, leptin, cathelicidin related antimicrobial
peptide, a peptide inhibitor of proprotein convertase
subtilisin/kexin type 9 (PCSK9), and an endolysin.
30. The method of claim 29, wherein the subject suffers from at
least one condition selected from the group consisting of insulin
resistance, hyperglycemia, lipid dysregulation, hyperlipidemia, and
obesity, and wherein the polypeptide is introduced in the
bloodstream of the subject in an amount effective to treat the at
least one condition.
31. The method of claim 21, wherein the polypeptide is
interleukin-22 (IL-22).
32. The method of claim 21, wherein the bacterium expresses a
mucus-binding protein.
33. The method of claim 21, wherein the bacterium expresses
CmbA.
34. The method of claim 21, wherein the bacterium has a mutation
rate less than about 100.times.10.sup.-10 mutations per cell per
generation.
35. The method of claim 21, wherein the bacterium comprises a
member of lactic acid bacteria.
36. The method of claim 21, wherein the bacterium comprises a
member of lactic acid bacteria other than a member of the
Lactococcus genus.
37. The method of claim 21, wherein the bacterium comprises a
member of Lactobacillus.
38. The method of claim 21, wherein the bacterium expresses a
mucus-binding protein and has a mutation rate less than about
100.times.10.sup.-10 mutations per cell per generation.
39. The method of claim 38, wherein the mucus-binding protein is
CmbA.
40. The method of claim 39, wherein the recombinant gene is codon
optimized.
Description
FIELD OF THE INVENTION
[0002] The invention is directed to systemically delivering
polypeptides to the bloodstream of a subject, such as through
administering into the gastrointestinal tract of the subject a
microorganism that produces and releases the polypeptides. The
invention is also directed to microorganisms suitable for this
purpose.
BACKGROUND
[0003] Polypeptides, such as enzymes, antibodies, hormones,
cytokines, etc., are tremendously useful as therapeutic agents.
However, routes for systemically introducing such polypeptides to a
subject are limited. Oral administration of the polypeptides is
typically not feasible, as the polypeptides are either degraded in
the gastrointestinal tract or are blocked from reaching the
bloodstream. Direct intravenous administration is therefore the
major route by which polypeptides are systemically introduced.
[0004] Certain types of genetically engineered bacteria have been
used as vehicles for locally delivering polypeptides to various
tissues. Engineered Lactococcus lactis, for example, has been
administered intragastrically for delivering polypeptides such as
trefoil factors and interleukin-10 locally to intestinal/mucosal
tissues. See Steidler et al. 2000 and Huyghebaert et al. 2005.
However, a systemic increase in polypeptides delivered via
Lactococcus lactis was not found.
[0005] Other types of genetically engineered bacteria have been
used as vehicles for delivery of polypeptides to tumors in the
body. An engineered Bifidobacterium strain, for example, has been
shown to translocate from the gastrointestinal tract after oral
administration and target to, replicate in, and express genes
within tumors. See Cronin et al. 2010. This effect, however,
depends on the unique ability of the Bifidobacterium to translocate
from the gastrointestinal tract to extra-intestinal sites in the
body. While Bifidobacterium may serve as a useful delivery vehicle
for some purposes, the systemic distribution of the Bifidobacterium
is potentially deleterious in certain subject populations such as
immunocompromised patients.
[0006] Engineered bacteria capable of being administering into the
gastrointestinal tract and delivering polypeptides in the
bloodstream without systemic levels of the bacteria themselves
being increased are needed.
SUMMARY OF THE INVENTION
[0007] The invention is directed to methods and microorganisms for
systemically introducing a polypeptide in a bloodstream of a
subject.
[0008] One method comprises administering into the gastrointestinal
tract of the subject a bacterium configured to produce and release
the polypeptide. The bacterium may comprise a recombinant gene
configured to express the polypeptide. The bacterium is
administered in an amount effective to introduce the polypeptide in
the bloodstream of the subject, preferably in a detectable
amount.
[0009] In some versions, the bacterium is administered in an amount
effective to introduce the polypeptide in the bloodstream of the
subject without the bacterium being substantially introduced in the
bloodstream of the subject.
[0010] In some versions, the bacterium is administered in an amount
effective to introduce the polypeptide in the bloodstream in an
amount effective to induce at least one direct systemic effect in
the subject. In some versions, the bacterium is administered in an
amount effective to introduce the polypeptide in the bloodstream in
an amount effective to induce at least one direct effect in a
non-gastrointestinal tissue in the subject. In some versions, the
bacterium is administered in an amount effective to introduce the
polypeptide in the bloodstream in an amount effective to induce at
least one direct effect in a tissue selected from the group
consisting of liver, muscles, lungs, kidneys, pancreas, and adipose
tissue in the subject.
[0011] In some versions, the subject suffers from a condition
treatable with systemic introduction of the polypeptide. In some
versions, the subject suffers from a condition treatable with
systemic introduction of the polypeptide but not treatable with
local introduction of the polypeptide to the gastrointestinal tract
without systemic introduction of the polypeptide. In either case,
the polypeptide is introduced in the bloodstream of the subject in
an amount effective to treat the condition, independent of the
bacterium getting into the bloodstream.
[0012] In some versions, the polypeptide is a therapeutic
polypeptide.
[0013] In some versions, the polypeptide is selected from the group
consisting of a cytokine, a hormone, an antibody, an antimicrobial
peptide, and an antigenic peptide.
[0014] In some versions, the polypeptide is selected form the group
consisting of IL-22, IL-35, insulin, leptin, cathelicidin related
antimicrobial peptide, a peptide inhibitor of PCSK9, and an
endolysin.
[0015] In some versions, the subject suffers from at least one
condition selected from the group consisting of insulin resistance,
hyperglycemia, lipid dysregulation, hyperlipidemia, and obesity,
and wherein the polypeptide is introduced in the bloodstream of the
subject in an amount effective to treat the at least one
condition.
[0016] In some versions, the bacterium comprises a bacterium other
than a member of the Bifidobacterium genus. In some versions, the
bacterium comprises a member of lactic acid bacteria, such as a
member of lactic acid bacteria other than a member of the
Lactococcus genus. In some versions, the bacterium comprises a
member of Lactobacillus, such as Lactobacillus reuteri.
[0017] A microorganism of the invention comprises a bacterium
comprising a recombinant gene configured to express a polypeptide,
wherein the bacterium is configured to produce and release the
polypeptide and is capable of introducing the polypeptide in the
bloodstream of the subject.
[0018] In some versions, the bacterium is capable of introducing
the polypeptide in the bloodstream of the subject without the
bacterium being substantially introduced in the bloodstream of the
subject.
[0019] In some versions, the polypeptide is capable of treating a
condition in a subject with systemic introduction of the
polypeptide in the subject.
[0020] In some versions, the polypeptide is selected form the group
consisting of IL-22, IL-35, insulin, leptin, cathelicidin related
antimicrobial peptide, a peptide inhibitor of PCSK9, and an
endolysin.
[0021] In some versions, the bacterium comprises a bacterium other
than a member of the Bifidobacterium genus. In some versions, the
bacterium comprises a member of lactic acid bacteria, such as a
member of lactic acid bacteria other than a member of the
Lactococcus genus. In some versions, the bacterium comprises a
member of Lactobacillus, such as Lactobacillus reuteri.
[0022] The objects and advantages of the invention will appear more
fully from the following detailed description of the preferred
embodiment of the invention made in conjunction with the
accompanying drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] FIGS. 1A and 1B show mutation rates of various types of
bacteria.
[0024] FIG. 2 is a plasmid map of the pVPL3461 murine
interleukin-22 (mIL-22)-expressing plasmid of the invention,
showing an erythromycin resistance gene (Em), an chloramphenicol
resistance gene coding sequence (Cm), a phelp promoter (Phelp)
(Riedel et al. 2007) for the chloramphenicol resistance gene coding
sequence, an mIL-22 coding sequence (mIL-22), a signal peptide for
secretion of mIL-22 (SP), a promoter for the signal peptide and the
mIL-22 coding sequence (Promoter), and an inverted repeat (IR),
which serves as a transcriptional terminator.
[0025] FIGS. 3A and 3B show secretion of mIL-22 from engineered L.
reuteri cells. FIG. 3A shows mIL-22 secretion from L. reuteri cells
harboring the pVPL3461 plasmid compared to wild-type L. reuteri
cells as a control. FIG. 3B shows mIL-22 secretion from L. reuteri
cells harboring a chromosomal copy of a mIL-22 gene compared to
wild-type L. reuteri cells as a control.
[0026] FIG. 4 shows a schema of methods for assessing delivery of
mIL-22 to mice from orally administered L. reuteri cells harboring
the pVPL3461 plasmid, including detecting plasma mIL-22 levels and
determining expression of mIL-22 target genes reg3-beta and
reg3-gamma.
[0027] FIG. 5 shows plasma IL-22 levels in sham gavaged mice
(untreated), mice gavaged with wild-type L. reuteri
(1.times.10.sup.9 CFU), and mice gavaged with L. reuteri engineered
to secrete IL-22 (1.times.10.sup.9 CFU). Eight-week-old male
C57BL/6 mice (n=8/group) were gavaged daily for 7 days. Blood was
collected from the animals prior to gavage treatment (T=0) and one
hour after gavage at the 7th day of administration (T=7). Center
lines show the median values. Box limits indicate the 25th and 75th
percentiles as determined by R software. Whiskers extend 1.5 times
the interquartile range from the 25th and 75th percentiles.
[0028] FIG. 6 shows counts of bacteria detected in blood from the
same mice described above for FIG. 5.
[0029] FIG. 7 shows jejunal expression of mIL-22 target genes
reg3-beta (reg3B) and reg3-gamma (reg3G) in the same mice described
above for FIG. 5. After 7 days gavage, animals were sacrificed, and
part of the small intestine (jejunum) was subjected to total RNA
isolation followed by cDNA synthesis and real-time PCR. Fold
changes and significance are reported based on comparison to the
untreated group, and data is normalized against the housekeeping
gene .beta.-actin. Data were analyzed with the REST software
package (Pfaffl et al. 2002). Data are presented in a box-whisker
plot (see comments above with respect to FIG. 5 for details).
[0030] FIG. 8 shows liver expression of lipopolysaccharide-binding
protein (LBP) in the same mice described above for FIG. 5.
[0031] FIGS. 9A-9C show results from length measurements in animals
after eight weeks of high-fat diet feeding (T0) and after seven
subsequent weeks of treatment (T7) of daily sham gavage of PBS
without bacteria (sham), daily gavage of L. reuteri VPL1014 (LR),
or daily gavage of the IL-22-secreting L. reuteri VPL3461
(LR-IL22). FIG. 9A shows length measurements at T0. FIG. 9B shows
growth at T7. FIG. 9C shows length measurements of live versus dead
animals.
[0032] FIG. 10 shows growth hormone levels in the serum of the mice
described above for FIGS. 9A-9C at T7.
[0033] FIGS. 11A and 11B show percentage differences in body mass
index (BMI) in the mice described above for FIGS. 9A-9C. FIG. 11A
shows differences in BMI over the course of seven weeks of
treatment (T7-T0). FIG. 11B shows differences in BMI over the
course of six weeks of treatment (T7-T1, wherein T1 refers to the
time after one week of treatment).
[0034] FIGS. 12A and 12B show absolute liver weights and liver
weights relative to mouse body weights in the mice described above
for FIGS. 9A-9C at T7.
DETAILED DESCRIPTION OF THE INVENTION
[0035] The invention provides microorganisms such as bacteria that
are capable of introducing polypeptides in the bloodstream of a
subject. The invention provides microorganisms such as bacteria
that are more specifically capable of introducing the polypeptide
in the bloodstream of the subject without the microorganism itself
being substantially introduced in the bloodstream of the subject.
The invention also provides microorganisms such as bacteria that
are capable of introducing the polypeptide systemically in the
subject without the microorganism itself being substantially
introduced systemically in the subject. "Introduce" and its
grammatical equivalents refer to delivery to a site in the body.
The introducing may result in detectable presence at that site.
"Systemically introduce" and its grammatical equivalents refer to
delivery to the bloodstream or sites in the body via the
bloodstream. The systemic introducing may result in detectable
presence in the bloodstream or such sites. The sites in which the
polypeptides are systemically introduced include sites or tissues
perfused with the bloodstream and which are permeable to
polypeptides. The sites in which the polypeptides are systemically
introduced include sites or tissues other than those in the
gastrointestinal tract. Exemplary sites or tissues include the
liver, muscles, lungs, kidneys, pancreas, adipose tissue, or any
other site or tissue in the body.
[0036] The bacteria of the invention include certain commensal or
probiotic bacteria. The bacteria may include non-pathogenic,
Gram-positive bacteria capable of anaerobic growth. The bacteria
are preferably viable in the gastrointestinal tract of mammals. The
bacteria may be food grade.
[0037] Exemplary bacteria include species of lactic acid bacteria
(i.e., species of the order Lactobacillales). The bacteria may
include species of lactic acid bacteria other than species of the
Lactococcus genus. The bacteria may include species other than
species of the Bifidobacterium genus
[0038] Exemplary bacteria more preferably include species of the
Lactobacillus genus. Exemplary species from the Lactobacillus genus
include L. acetototerans, L. acidifarinae, L. acidipiscis, L.
acidophilus, L. agilis, L. algidus, L. atimentarius, L.
amytolyticus, L. amylophilus, L. amylotrophicus, L. amylovorus, L.
animatis, L. antri, L. apodemi, L. aviarius, L. bifermentans, L.
brevis, L. buchneri, L. camelliae, L. casei, L. catenaformis, L.
ceti, L. coleohominis, L. collinoides, L. composti, L. concavus, L.
coryniformis, L. crispatus, L. crustorum, L. curvatus, L.
delbrueckii subsp. delbrueckii, L. delbrueckii subsp. butgaricus,
L. delbrueckii subsp. lactis, L. dextrinicus, L. diolivorans, L.
equi, L. equigenerosi, L. farraginis, L. farciminis, L. fermentum,
L. fornicalis, L. fructivorans, L. frumenti, L. fuchuensis, L.
gallinarum, L. gasseri, L. gastricus, L. ghanensis, L. graminis, L.
hammesii, L. hamsteri, L. harbinensis, L. hayakitensis, L.
helveticus, L. hitgardii, L. homohiochii, L. iners, L. ingluviei,
L. intestinalis, L. jensenii, L. johnsonii, L. katixensis, L.
kefiranofaciens, L. kefiri, L. kimchii, L. kitasatonis, L. kunkeei,
L. leichmannii, L. lindneri, L. malefermentans, L. coati, L.
manihotivorans, L. mindensis, L. mucosae, L. murinus, L. nagelii,
L. namurensis, L. nantensis, L. oligofermentans, L. oris, L. panis,
L. pantheris, L. parabrevis, L. parabuchneri, L. paracollinoides,
L. parafarraginis, L. parakefiri, L. paratimentarius, L.
paraplantarum, L. pentosus, L. perolens, L. plantarum, L. pontis,
L. psittaci, L. rennini, L. reuteri, L. rhamnosus, L. rimae, L.
rogosae, L. rossiae, L. ruminis, L. saerimneri, L. sakei, L.
salivarius, L. sanfranciscensis, L. satsumensis, L. secaliphilus,
L. sharpeae, L. siliginis, L. spicheri, L. suebicus, L.
thailandensis, L. ultunensis, L. vaccinostercus, L. vaginalis, L.
versmoldensis, L. vini, L. vitulinus, L. zeae, and L. zymae.
[0039] A particularly preferred bacterium is L. reuteri.
[0040] A bacterium that can bind mucus in the gastrointestinal
tract is preferred but not required. We surmise that binding mucus
in the gastrointestinal tract may place the bacterium in close
proximity to epithelial cells. Release of polypeptides so close to
the epithelial cells may help systemic delivery of the
polypeptides. A bacterium capable of binding mucus is L. reuteri,
such as L. reuteri VPL1014, discussed below in the examples. The
ability to bind mucus can be mediated by the presence of a
mucus-binding protein, such as the cell-mucus binding protein CmbA
(Jensen et al. 2014).
[0041] The bacterium preferably has a low mutation rate. The
bacterium preferably has a mutation rate of less than about
100.times.10.sup.-10 mutations per cell per generation, less than
about 60.times.10.sup.-10 mutations per cell per generation, and
more preferably less than about 20.times.10.sup.-10 mutations per
cell per generation.
[0042] The bacterium may be engineered to express a polypeptide of
interest. The bacterium accordingly may comprise a recombinant gene
configured to express the polypeptide of interest. The bacterium
may alternatively or additionally comprise a recombinant DNA
sequence that results in increased expression of the polypeptide of
interest. "Recombinant" used in reference to a gene refers herein
to a sequence of nucleic acids that are not naturally occurring in
the genome of the bacterium. The non-naturally occurring sequence
may include a recombination, substitution, deletion, or addition of
one or more bases with respect to the nucleic acid sequence
originally present in the natural genome of the bacterium. "Gene"
refers to the collection of genetic elements involved in expressing
a coding sequence and may include, in addition to the coding
sequence, a promoter, a ribosomal binding site, an enhancer, etc.
In some versions, increased expression of the polypeptide of
interest can result from introducing or modifying (e.g.,
recombining, substituting, deleting, etc.) genes or other genetic
elements responsible for regulating expression of the polypeptide
of interest, such as genes for transcription factors or signaling
factors.
[0043] The bacterium may be engineered to produce and release the
polypeptide. As used herein, "release" used with respect to the
bacterium releasing the polypeptide refers to disposing the
polypeptide outside the bacterium, i.e., in the extracellular
environment of the microorganism. Release may occur through
secretion of the polypeptide or through lysis of the bacterium,
among other possible mechanisms. Elements for engineering a
bacterium to secrete a polypeptide are well known in the art.
Typical elements include a signal peptide-encoding sequence placed
upstream of--and in-frame with--the coding sequence of the
polypeptide to be secreted. The sequences of a large number of
signal peptides for bacteria are known in the art. Exemplary signal
peptide sequences are available at
www.cbs.dtu.dk/services/SignalP/. Elements for inducing a bacterium
to lyse include lytic proteins, which can be expressed from a
bacterium through recombinant engineering. As used herein, "lytic
protein" refers to any protein that causes or aids in the lysis of
a microorganism.
[0044] Lytic proteins are well known in the art. A number of lytic
proteins, for example, are found in bacteriophages and serve to
lyse microorganisms during the lytic stages of the bacteriophage's
life cycle. These include holins and lysins (Sheehan et al. 1999).
During bacteriophage replication, biologically active lysins are
present in the cytosol but require expression of a membrane
protein, holin, to release the virions from the cell. When holin
levels are optimal, the lysin can access the peptidoglycan layer
for cleavage which leads to bacterial cell lysis (Wang et al.
2000). So far, five main groups of lysins have been identified that
can be distinguished from one and another based on the cleavage
specificity of the different bonds within the peptidoglycan
(Fischetti 2009). Structurally, lysins can consist of a single
catalytic domain, which generally is typical for lysins derived
from bacteriophages targeting Gram-negative bacteria (Cheng et al.
1994). Bacteriophages targeting Gram-positive bacteria typically
encode lysins that contain multiple domains: a N-terminal catalytic
domain and a C-terminal cell-wall binding domain (Nelson et al.
2006, Navarre et al. 1999). A few lysins have been identified that
have three domains (Becker et al. 2009).
[0045] A number of other lytic proteins are native to the
microorganisms themselves (Feliza et al. 2012, Jacobs et al. 1994,
Jacobs et al. 1995, Lopez et al. 1997). These lytic proteins may
affect cell wall metabolism or introduce nicks in the cell wall.
Five protein classes are differentiated by the wall component they
attack (Loessner et al. 2005, Loessner et al. 2002).
[0046] In some versions of the invention, the microorganism is
configured to constitutively express a lysin and to express a holin
in a maltose-dependent manner. In some versions, the microorganism
is configured to express both a lysin and a holin in a
maltose-dependent manner.
[0047] Lytic proteins can be expressed in a maltose-dependent
manner by operably connecting the coding sequence of the lytic
protein to a maltose-sensitive promoter. "Coding sequence" refers
to a nucleic acid in a gene that encodes the gene product.
"Promoter" refers to any nucleic acid that confers, activates, or
enhances expression of an operably connected coding sequence.
"Operably connected" generally refers to a connection of two
genetic elements in a manner wherein one can operate on or have
effects on the other. "Operably connected" used in reference to a
promoter and a coding sequence refers to a connection between the
promoter and the coding sequence such that the coding sequence is
under transcriptional control of the promoter. For example,
promoters are generally positioned 5' (upstream) of a coding
sequence to be operably connected to the promoter. In the
construction of heterologous promoter/coding sequence combinations,
it is generally preferred to position the promoter at a distance
from the transcription start site that is approximately the same as
the distance between that promoter and the coding sequence it
controls in its natural setting, i.e. in the gene from which the
promoter is derived. As is known in the art, some variation in this
distance can be accommodated without loss of promoter function.
[0048] Operably connecting a maltose-inducible promoter to the
coding sequence of a lytic protein induces lysis of the
microorganism, release of the lytic protein, and release of any
other polypeptides made by the microorganism, in a
maltose-dependent manner. Such release occurs in the
gastrointestinal tract due to natural levels of maltose
therein.
[0049] An exemplary maltose-inducible promoter is represented by
SEQ ID NO:1, which is a maltose-inducible promoter found in L.
reuteri. The maltose-inducible promoter represented by SEQ ID NO:1
or variants thereof are suitable for use in the present invention.
Variants of SEQ ID NO:1 include sequences at least about 80%
identical, at least about 83% identical, at least about 85%
identical, at least about 87% identical, at least about 90%
identical, at least about 83% identical, at least about 95%
identical, at least about 97% identical, at least about 98%
identical, or at least about 99% identical to SEQ ID NO:1
[0050] Other methods of inducing lysis of bacteria in vivo are
known.
[0051] The bacteria can be engineered using any methods known in
the art. General methods are provided in Green et al. 2012. Methods
for engineering lactic acid bacteria such as L. lactis are provided
by van Pijkeren et al. 2012, Oh et al. 2014, and Barrangou et al.
2016.
[0052] The recombinant gene may be incorporated into the chromosome
of the bacterium or may be included on an extra-chromosomal
plasmid. The extra-chromosomal plasmid may replicate at any copy
number in the cell and, accordingly, be a single-copy plasmid, a
low-copy plasmid, or a high-copy plasmid. The extra-chromosomal
plasmid is preferably substantially stable within the bacterium.
The rate of loss of the extra-chromosomal plasmid from the
bacterium is preferably less than about 10% per generation, less
than about 5% per generation, or less than about 1% per generation,
wherein percent per generation refers to the percent of the
population per generation in which the plasmid is lost.
[0053] The bacterium may be engineered to produce and release any
polypeptide of interest. The polypeptide may have any of a number
of amino acid chain lengths. In some versions, the polypeptide may
have an amino acid chain length of from about 2 to about 4000 amino
acids, from about 2 to about 3000 amino acids, from about 2 to
about 2000 amino acids, from about 2 to about 1500 amino acids,
from about 2 to about 1000 amino acids, from about 2 to about 500
amino acids, from about 3 to about 250 amino acids, or from about 3
to about 225 amino acids. The polypeptide may have a net positive
charge at neutral pH, a net negative charge at neutral pH, or a net
neutral charge at neutral pH. The polypeptide is preferably soluble
in water. The polypeptide may form a globular or fibrous structure
or may have an intrinsically disordered structure.
[0054] The polypeptide may have any of a number of functionalities.
The polypeptide, for example, may be enzymatic or non-enzymatic.
The polypeptide may be fluorescent or non-fluorescent. Within the
physiological context of a mammal, the polypeptide may be a
cytokine, a hormone, an antibody, an antimicrobial peptide, and an
antigenic peptide, among others.
[0055] Exemplary classes of cytokines include interleukins,
lymphokines, monokines, interferons (IFNs), colony stimulating
factors (CSFs), among others. Specific exemplary cytokines include
IL-1 alpha (IL1a), IL-1 beta (IL1b), IL-2, IL-3, IL-4, IL-5, IL-6,
IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16,
IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25,
IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-35,
IL-36, IFN-alpha, IFN-beta IFN-gamma, TNF-alpha, TNF-beta, CNTF
(C-NTF), LIF, OSM (oncostatin-M), EPO (erythropoietin), G-CSF
(GCSF), GM-CSF (GMCSF), M-CSF (MCSF), SCF, GH (growth hormone), PRL
(prolactin), aFGF (FGF-acidic), bFGF (FGF-basic), INT-2, KGF
(FGF7). EGF, TGF-alpha, TGF-beta, PDGF, betacellulin (BTC), SCDGF,
amphiregulin, and HB-EG, among others.
[0056] Exemplary hormones include epinephrine, melatonin,
triiodothyronine, thyroxine, amylin (or islet amyloid polypeptide),
adiponectin, adrenocorticotropic hormone (or corticotropin),
angiotensinogen, angiotensin, antidiuretic hormone (or vasopres
sin, arginine vasopressin), atrial-natriuretic peptide (or
atriopeptin), brain natriuretic peptide, calcitonin,
cholecystokinin, corticotropin-releasing hormone, cortistatin,
encephalin, endothelin, erythropoietin, follicle-stimulating
hormone, galanin, gastric inhibitory polypeptide, gastrin, ghrelin,
glucagon, glucagon-like peptide-1, gonadotropin-releasing hormone,
growth hormone-releasing hormone, hepcidin, human chorionic
gonadotropin, human placental lactogen, growth hormone, inhibin,
insulin, insulin-like growth factor (or somatomedin), leptin,
lipotropin, luteinizing hormone, melanocyte stimulating hormone,
motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid
hormone, pituitary adenylate cyclase-activating peptide, prolactin,
prolactin releasing hormone, relaxin, renin, secretin,
somatostatin, thrombopoietin, thyroid-stimulating hormone (or
thyrotropin), thyrotropin-releasing hormone, and vasoactive
intestinal peptide, among others.
[0057] Other physiologically active peptides include glucagon-like
peptide-1 (GLP-1); tachykinin peptides, such as substance P,
kassinin, neurokinin A, eledoisin, and neurokinin B; peptide PHI 27
(peptide histidine isoleucine 27); pancreatic polypeptide-related
peptides, such as NPY (neuropeptide Y), PYY (peptide YY), and APP
(avian pancreatic polypeptide); opioid peptides, such as
proopiomelanocortin (POMC) peptides and prodynorphin peptides;
AGG01; B-type natriuretic peptide (BNP); lactotripeptides; and
peptides that inhibit PCSK9 (Zhang et al. 2014).
[0058] Exemplary antibodies include single-chain antibodies,
single-domain antibodies (sdAbs), and single-chain variable
fragments (scFvs).
[0059] Exemplary antimicrobial peptides include cathelicidins,
defensins, protegrins, mastoparan, poneratoxin, cecropin, moricin,
melittin, magainin, dermaseptin, and others.
[0060] In preferred versions, the polypeptide that is systemically
introduced is a polypeptide capable of treating a condition in a
subject with its systemic introduction. In some versions, The
polypeptide that is systemically introduced is a polypeptide
capable of treating a condition in a subject with its systemic
introduction but is not capable of treating a condition in the
subject with its local introduction to the gastrointestinal tract
alone. The condition may be any condition described herein.
[0061] The inventors have unexpectedly found that administering L.
reuteri to the gastrointestinal tract is capable of delivering
produced polypeptides to the bloodstream without the bacteria
themselves being introduced in the bloodstream. Accordingly, an
aspect of the invention includes administering an amount of a
bacterium of the invention into the gastrointestinal tract of a
subject. The bacterium may be administered in any amount effective
to introduce the polypeptide in the bloodstream of the subject.
Exemplary amounts include from about 1.times.10.sup.3 to about
1.times.10.sup.15, from about 1.times.10.sup.5 to about
1.times.10.sup.13, from about 1.times.10.sup.7 to about
1.times.10.sup.11, or about 1.times.10.sup.9 colony forming units
(CFU). Amounts above and below these ranges may be acceptable.
[0062] The bacterium can be administered to the gastrointestinal
tract by any method known in the art. The bacterium may be
administered orally, rectally, or directly into the
gastrointestinal tract via a stoma. The bacterium is preferably
administered directly into or upstream of the small intestines, so
that the bacterium ultimately passes through or into the small
intestines. The bacterium may be swallowed or introduced via a
tube.
[0063] The bacterium may be combined in a composition with a
pharmaceutically acceptable excipient, carrier, buffer, stabilizer
or other material well known to those skilled in the art. Such
materials should be non-toxic and should not interfere with the
efficacy of the bacterium. The precise nature of the carrier or
other material may depend on the route of administration. The
composition may be liquid, solid, or semi-solid. The composition
may comprise a foodstuff or may take the form of a pharmaceutical
composition. Those of relevant skill in the art are well able to
prepare suitable compositions.
[0064] The subject to which the bacterium is administered may be an
animal, such as a mammal or, more specifically, a human.
[0065] In some versions of the invention, the bacterium is
administered in an amount effective to introduce the polypeptide in
the bloodstream in an amount effective to induce at least one
systemic effect in the subject, such as at least one effect in a
non-gastrointestinal tissue in the subject. As used herein,
"systemic effect" refers to an effect that occurs at a site or
tissue in the body other than where the polypeptide is initially
released from the bacterium. In the present case, the term refers
to an effect that occurs at a site or tissue other than the
gastro-intestinal tract, such as the liver, muscles, lungs,
kidneys, pancreas, adipose tissue, or others. The systemic effect
preferably occurs by virtue of the polypeptide being systemically
introduced and accessing a site or tissue other than
gastrointestinal tissue via bloodstream, such that the effect is a
direct effect of the polypeptide and is not a secondary effect of a
primary effect of the polypeptide in the gastrointestinal tissue.
Such effects are referred to herein as "direct systemic effects."
Direct systemic effects of the systemically introduced polypeptide
can be distinguished from secondary effects, for example, by
comparing effects resulting from administering the
polypeptide-producing bacterium into the gastrointestinal tract
with effects resulting from systemically administering the
polypeptide directly into the bloodstream and effects resulting
from locally administering the polypeptide directly into the
gastrointestinal tract. Direct systemic effects are those that are
mirrored by the systemic administration of the polypeptide into the
bloodstream but not the local administration of the polypeptide
into the gastrointestinal tract. The presence of direct systemic
effects of the polypeptide resulting from administering the
polypeptide-producing bacterium into the gastrointestinal tract can
be an indicator of the polypeptide entering the bloodstream,
whether or not the polypeptide itself is detected in the
bloodstream.
[0066] In some versions, the bacterium is administered to a subject
that suffers from a condition treatable with systemic introduction
of the polypeptide. In yet other versions, the bacterium is
administered to a subject that suffers from a condition treatable
with systemic introduction of the polypeptide but is not treatable
with only local introduction of the polypeptide to the
gastrointestinal tract. In either case, the polypeptide is
introduced in the bloodstream of the subject in an amount effective
to treat the condition. As used herein, "treat" used in reference
to a condition refers to ameliorating to any extent the condition
itself or any symptom associated therewith.
[0067] In some versions, the bacterium is administered to a subject
to prevent or inhibit the development of any of the conditions or
associated symptoms described herein. The subject in such a case
may show early signs of the condition or symptom, have a genotype
that predisposes the subject to develop the condition or symptom,
have a behavior or environmental situation that predisposes the
subject to develop the condition or symptom, or otherwise be
predisposed to develop the condition or symptom.
[0068] A particular aspect of the invention is directed to
introducing interleukin-22 (IL-22) in the bloodstream of a subject
by administering a bacterium comprising a recombinant
interleukin-22 (IL-22) gene. The IL-22 may be introduced in the
bloodstream of the subject in an amount effective to induce at
least one IL-22-dependent effect in a non-gastrointestinal tissue
in the subject. An exemplary IL-22 that can be systemically
introduced comprises a sequence of SEQ ID NO:2 or a sequence at
least about 90%, 95%, 97%, 99% or more identical thereto.
[0069] IL-22 is capable of inducing a number of effects in
non-gastrointestinal tissues when circulating systemically through
the bloodstream. In respiratory epithelial cells, for example,
IL-22 can increase antibacterial defense, elevate mucus production,
enhance proliferation, and raise production of
granulocyte-attracting chemokines. In synovial fibroblasts, IL-22
can elevate RANKL expression and increase production of
monocyte-attracting chemokines. In pancreatic cells, IL-22 can
increase protection against damage, inhibit autophagy, and enhance
islet proliferation. In hepatocytes, IL-22 can increase acute-phase
protein production, increase protection against damage, and elevate
liver progenitor cell proliferation. In epidermal keratinocytes,
IL-22 can increase antibacterial defense, retard differentiation
and cornification, induce production of granulocyte-attracting
chemokines, elevate migration and tissue remodeling, and enhance
STATS and IL-20 expression. See Sabat et al. 2014 and Wang et al.
2014 for additional direct IL-22-dependent effects.
[0070] Another particular aspect of the invention is directed to
introducing interleukin-22 (IL-22) in the bloodstream of a diabetic
subject by administering a bacterium comprising a recombinant
interleukin-22 (IL-22) gene. The diabetic subject may suffer from
type 1 or type 2 diabetes. IL-22 has been shown to have a number of
ameliorative effects in diabetic subjects. In type 2 diabetic
subjects, these effects include ameliorating hyperglycemia, insulin
resistance, hyperlipidemia, lipid dysregulation in the liver and
adipose tissues, endotoxemia, and chronic inflammation. See Wang et
al. 2014. As shown in the present examples, IL-22 is also capable
of reducing body mass index (BMI).
[0071] More generally, subjects in which IL-22 is introduced may
include those suffering from of insulin resistance, hyperglycemia,
lipid dysregulation, hyperlipidemia, obesity, or other
manifestations of metabolic syndrome. The systemic effect of the
systemic introduction of IL-22 to such subjects may include a
reduction in body mass index (BMI), liver weight, liver
triglycerides, glucose intolerance, and insulin resistance, or
other effects described elsewhere herein.
[0072] Another polypeptide that may be introduced in the
bloodstream of a subject with the bacteria of the invention is
interleukin-35 (IL-35). Systemic administration of IL-35 treats
type-1 diabetes and inhibits or slows the development of type-1
diabetes. See Singh et al. 2015. An exemplary IL-35 that can be
systemically introduced is a human recombinant IL-35 comprising a
sequence of SEQ ID NO:3 or a sequence at least about 90%, 95%, 97%,
99% or more identical thereto. Bacteria of the invention comprising
a recombinant IL-35 gene can be administered to subjects with
diabetes, such as type 1 diabetes, to systemically introduce the
IL-35 polypeptide in the bloodstream of the subject in an amount
effective to treat the diabetes in the subject.
[0073] Another polypeptide that may be introduced in the
bloodstream of a subject with the bacteria of the invention is
insulin. The insulin can be produced in single-chain form. See,
e.g., Rajpal et al. 2009. An exemplary insulin that can be
systemically introduced includes the insulin A-chain connected to
the insulin B-chain by the linker sequence QRGGGGGQR (SEQ ID NO:4).
See Rajpal et al. 2009. Single-chain insulin retains all of the
physiological effects of traditional two-chain insulin, including
stimulation of glucose uptake into adipocytes, and suppression of
hepatic gluconeogenesis. Bacteria of the invention comprising a
recombinant insulin gene can be administered to subjects with
diabetes, insulin resistance, or hyperglycemia to systemically
introduce the insulin polypeptide in the bloodstream of the subject
in an amount effective to treat the diabetes, or hyperglycemia in
the subject.
[0074] Another polypeptide that may be introduced in the
bloodstream of a subject with the bacteria of the invention is
leptin. Leptin is made by adipose tissue and regulates energy
balance by acting on receptors in the brain. Congenital leptin
deficiency (CLD), or generalized lipodystrophy results in a lack of
leptin and can lead to a litany of disorders, including morbid
obesity (in the case of CLD), diabetes, and infertility. Systemic
leptin replacement therapy mitigates these disorders. An exemplary
leptin polypeptide that can be systemically introduced includes a
polypeptide comprising a sequence of SEQ ID NO:5 or a sequence at
least about 90%, 95%, 97%, 99% or more identical thereto. Bacteria
of the invention comprising a recombinant leptin gene can be
administered to subjects with congenital leptin deficiency or
generalized lipodystrophy to systemically introduce the leptin
polypeptide in the bloodstream of the subject in an amount
effective to treat the obesity, diabetes, infertility or any other
aspect of the congenital leptin deficiency or generalized
lipodystrophy.
[0075] Another polypeptide that may be introduced in the
bloodstream of a subject with the bacteria of the invention is
cathelicidin related antimicrobial peptide (CRAMP). CRAMP is a
small peptide produced by pancreatic islets in response to gut
microbiota-derived short-chain fatty acids. Synonyms for CRAMP
include CAMP, CAP18, Cnlp, FALL39, and MCL. The islet-derived CRAMP
maintains immune homeostasis. CRAMP production is defective in
non-obese diabetic mice, leading to inflammation and activation of
diabetogenic T-cells and resulting in type 1 diabetes (Sun et al.
2015). This process can be reversed by direct systemic
administration of CRAMP. An exemplary CRAMP polypeptide that can be
systemically introduced includes a polypeptide comprising a
sequence of SEQ ID NO:6 or a sequence at least about 90%, 95%, 97%,
99% or more identical thereto. Bacteria of the invention comprising
a recombinant CRAMP gene can be administered to non-obese diabetic
subjects to systemically introduce the CRAMP polypeptide in the
bloodstream of the subject in an amount effective to treat the
diabetes and/or inflammation in these subjects.
[0076] Other polypeptides that may be introduced in the bloodstream
of a subject with the bacteria of the invention include peptide
inhibitors of PCSK9. PCSK9 (proprotein convertase subtilisin/kexin
type 9) is a negative regulator of the hepatic low density
lipoprotein receptor. Inhibition of PCSK9 results in LDL
cholesterol-lowering effects. A number of peptide inhibitors of
PCSK9 are known in the art. See Zhang et al. 2014. Any of these
polypeptides or others can be introduced in the bloodstream of a
subject with the bacteria of the invention. A particularly
preferred peptide inhibitor of PCSK9 is referred to as "Pep2-8,"
which comprises a sequence of SEQ ID NO:7. Bacteria of the
invention comprising a recombinant gene configured to express one
or more peptide inhibitors of PCKS9 can be administered to subjects
with hypercholesterolemia to systemically introduce the peptide
inhibitor of PCSK9 in the bloodstream of the subject in an amount
effective to treat the hypercholesterolemia.
[0077] Other polypeptides that may be introduced in the bloodstream
of a subject with the bacteria of the invention include lysins,
such as bacteriophage-derived lysins (endolysins), i.e.
enzybiotics. One of the largest concerns in 21st century medicine
is the development of microbial antibiotic-resistance. Little
progress has been made in the discovery and development of novel
antibiotics, and bacteriophage-derived lysins (enzybiotics)
constitute promising alternatives to antibiotics. The enzybiotics
interfere with peptidoglycan cell wall synthesis, mainly of Gram
positive bacteria, but do so in a species specific manner.
Exemplary lysins that can be systemically introduced include those
described in the references cited herein, all of which are
incorporated herein by reference. Bacteria of the invention
comprising a recombinant gene configured to express one or more
lysins can be administered to subjects with sepsis or infection
with pathogens such as S. aureus to systemically introduce the
lysin in the bloodstream of the subject in an amount effective to
treat the sepsis or infection.
[0078] The elements and method steps described herein can be used
in any combination whether explicitly described or not.
[0079] All combinations of method steps as used herein can be
performed in any order, unless otherwise specified or clearly
implied to the contrary by the context in which the referenced
combination is made.
[0080] As used herein, the singular forms "a," "an," and "the"
include plural referents unless the content clearly dictates
otherwise.
[0081] Numerical ranges as used herein are intended to include
every number and subset of numbers contained within that range,
whether specifically disclosed or not. Further, these numerical
ranges should be construed as providing support for a claim
directed to any number or subset of numbers in that range. For
example, a disclosure of from 1 to 10 should be construed as
supporting a range of from 2 to 8, from 3 to 7, from 5 to 6, from 1
to 9, from 3.6 to 4.6, from 3.5 to 9.9, and so forth.
[0082] All patents, patent publications, and peer-reviewed
publications (i.e., "references") cited herein are expressly
incorporated by reference to the same extent as if each individual
reference were specifically and individually indicated as being
incorporated by reference. In case of conflict between the present
disclosure and the incorporated references, the present disclosure
controls.
[0083] It is understood that the invention is not confined to the
particular construction and arrangement of parts herein illustrated
and described, but embraces such modified forms thereof as come
within the scope of the claims.
Examples
Bacterial Strains, Plasmids, Media, and Culture.
[0084] Bacterial strains and plasmids used in the present examples
are listed in Table 1. Lactobacillus reuteri VPL1014 and its
derivatives were routinely cultured at 37.degree. C. in deMan
Rogosa Sharpe (MRS) medium (Difco, BD Biosciences). Where
appropriate, erythromycin was added to a final concentration of 5
.mu.g/ml. Competent cells of L. reuteri were prepared as described
before (Ahrne et al. 1992). To test IL-22 expression and to prepare
bacteria for animal experiments, bacteria were cultured in
Lactobacilli Defined Medium-III (LDM-III, Table 2).
[0085] Specifically, L. reuteri VPL1014 was inoculated in 10 ml MRS
broth, and L. reuteri VPL3461 was inoculated in 10 ml MRS
containing 5 .mu.m/ml erythromycin at 37.degree. C.
Overnight-cultures of each strain were sub-cultured in MRS at
OD.sub.600=0.1. At OD600.gtoreq.1.ltoreq.1.2 cells were harvested
by centrifugation (5,000 rpm for 5 min), and the cell pellets were
washed twice with LDM-III. Washed cell pellets, each derived from
10-ml culture, were stored at -80.degree. C. until use. From this
step onwards, no antibiotics were supplemented to the culture
media. At the day of gavaging, the cell pellets were resuspended in
10 ml freshly prepared pre-warmed LDM-III and incubated at
37.degree. C. until OD.sub.600.gtoreq.3.5.ltoreq.3.7. Bacteria were
concentrated 10-fold, and suspensions were made containing
.about.10.sup.10 CFU/ml L. reuteri VPL1014 or VPL3461. For animal
experiments (see below) 100 .mu.l of the suspension was
administrated by oral gavage to the corresponding animals.
TABLE-US-00001 TABLE 1 Bacterial strains and plasmids used in the
present examples. Strain or plasmid Characteristics Source L.
reuteri A derivative of L. reuteri ATCC PTA 6475, U.S. VPL1014 ATCC
PTA 6475, Pat. No. 7,344,867 to human breast milk isolate BioGaia
AB (Lerum, SE), and van Pijkeren et al. 2012 L. reuteri L. reuteri
VPL1014 harboring Described herein VPL3461 pVPL3461 pJP028
Em.sup.R, derivative Described herein of pNZ8048 containing
promoter from L. reuteri SD2112, signal peptide from L. reuteri
JCM1112, and LPXTG (cell wall anchor domain) pVPL3461 Em.sup.R,
derivative of pJP028 Described herein omitting LPXTG domain and
harboring mIL-22 gene
TABLE-US-00002 TABLE 2 Lactobacilli Defined Medium-III (LDM3)
composition. Basal Medium Amount Ingredient per Liter
K.sub.2HPO.sub.4 1.50 g KH.sub.2PO.sub.4 1.50 g Sodium Acetate
15.00 g Sodium Citrate, Dihydrate 0.25 g Tryptophan 0.05 g
Asparagine, Monohydrate 0.23 g Vitamin-free Casamino acid 10.00 g
Cysteine-HCl, Monohydrate 0.22 g Tween80 (10% v/v) 10 ml Dissolve
in 937.5 ml of DI water and autoclave at 121.degree. C. for 15 min.
Prepare stock solutions (as below) and add to sterile Basal Medium.
Vitamin Solution (in 25 ml dH.sub.2O) 0.5 ml Thiamin HCl 10 mg
.rho.-aminobenzonoic acid 2 mg Calcium pantothenic acid 20 mg
Niacin 50 mg Pyridoxin HCl 25 mg Biotin Solution (in 50 ml 0.01M
HCl) 0.5 ml Biotin 4 mg 96% EtOH 40 .mu.L Riboflavin Solution (in
50 ml dH.sub.2O) 5 ml Riboflavin 4 mg Folic Acid Solution (in 50 ml
0.001M NaOH) 0.5 ml Folic acid 10 mg Nucleic Acid Solution (in 15
ml 1M HCl) 3 ml Adenine hemisulfate 50 mg Guanine 40.3 mg Cytidylic
acid 150 mg Uracil Solution (in 10 ml 1M NaOH) 1 ml Uracil 200 mg
Thymidine Solution (in 12.5 ml dH.sub.2O) 1 ml Thymidine 20 mg Salt
Solution (in 10 ml dH.sub.2O) 1 ml MgSO.sub.4 0.793 g MnSO.sub.4
0.128 g FeSO.sub.4 0.130 g Glucose (40% w/v) 50 ml Total 1 L (LDM),
final pH 6.5
Mutation Rate.
[0086] A suitable microorganism for delivering peptides preferably
has a low mutation rate. The mutation rate of L. reuteri VPL1014
was compared with that of a number of other microorganisms using
conventional methods (Rosche et al. 2000, Foster et al. 2006). As
shown in FIGS. 1A and 1B, L. reuteri displayed an exceptionally low
mutation rate, particularly compared to the other tested probiotic
microorganisms.
Reagents and Enzymes.
[0087] Cloning was performed via ligation cycle reaction (LCR; Kok
et al. 2014). Enzymes and reagents for LCR were purchased from
Fermentas. Polymerase chain reaction (PCR) for cloning purposes was
performed with the high-fidelity enzyme Phusion Hot Start
Polymerase II (Fermentas). PCR for screening purposes was performed
with Taq polymerase (Denville Scientific). To concentrate the LCR
reaction prior to electrotransformation into L. reuteri, we used
Pellet Paint Co-Precipitant (Novagen). Oligonucleotides and
synthetic double-stranded DNA fragments were purchased from
Integrated DNA Technologies. All oligonucleotides and synthetic DNA
fragments used in this study are listed in Table 3.
TABLE-US-00003 TABLE 3 Oligonucleotides and synthetic DNA used in
the present examples. Oligo- nucleotides Sequence oVPL329
attccttggacttcatttactgggtttaac (SEQ ID NO: 8) oVPL363
taatatgagataatgccgactgtac (SEQ ID NO: 9) oVPL1219
ttcatggggatgaatgcttctgctaatacattaccagttaatactcgttg (SEQ ID NO: 10)
oVPL1220 cttggttttctaattttggttcaaagatcaaacacaagcattacgtaaactc (SEQ
ID NO: 11) oVPL1221 gcttgaaacgttcaattgaaatggca (SEQ ID NO: 12)
oVPL1222 tgtaaaaccaataaggactgaagc (SEQ ID NO: 13) oVPL1223
ggagttgcttcagtccttattggttttacattcatggggatgaatgcttctgctaataca (SEQ
ID NO: 14) oVPL1224
tgatctttgaaccaaaattagaaaaccaaggcttgaaacgttcaattgaaatggcaatta (SEQ
ID NO: 15) oVPL1313 actccctgaagaatataccctcc (SEQ ID NO: 16)
oVPL1314 cgctattgagcacagatacgag (SEQ ID NO: 17) oVPL1315
atgcttccccgtataaccatca (SEQ ID NO: 18) oVPL1316
ggccatatctgcatcataccag (SEQ ID NO: 19) oVPL1321 gatcaccgacaagggcctg
(SEQ ID NO: 20) oVPL1322 ggctatgaaactcgtactgcc (SEQ ID NO: 21)
oVPL1325 ggctgtattcccctccatcg (SEQ ID NO: 22) oVPL1326
ccagttggtaacaatgccatgt (SEQ ID NO:2 3) gVPL1
ATTCATGGGGATGAATGCTTCTGCTAATACATTACCAGTTAATA
CTCGTTGTAAATTAGAAGTTAGTAATTTTCAACAACCATATATT
GTTAATCGTACTTTTATGTTAGCTAAAGAAGCTAGTTTAGCTGA
TAATAATACTGATGTTCGTTTAATTGGTGAAAAATTATTTCGTG
GTGTTAGTGCTAAAGATCAATGTTATTTAATGAAACAAGTTTTA
AATTTTACTTTAGAAGATGTTTTATTACCACAAAGTGATCGTTT
TCAACCATATATGCAAGAAGTTGTTCCATTTTTAACTAAATTAA
GTAATCAATTAAGTAGTTGTCATATTAGTGGTGATGATCAAAAT
ATTCAAAAAAATGTTCGTCGTTTAAAAGAAACTGTTAAAAAAT
TAGGTGAAAGTGGTGAAATTAAAGCTATTGGTGAATTAGATTTA
TTATTTATGAGTTTACGTAATGCTTGTGTTTGATCTTTGAACCA AAATTAGAAAACCAAGG (SEQ
ID NO: 24)
Construction of L. reuteri VPL1014 that Secretes mIL-22.
[0088] Our aim was to engineer Lactobacillus reuteri VPL1014 to
secrete the murine cytokine interleukin-22 (mIL-22). We first opted
for expression from the multicopy plasmid pJP028 to maximize mIL-22
production. pJP028 is a derivative of pNZ8048 (de Ruyter et al.
1996) in which the nisin-expression cassette was replaced with a
secretion cassette. By PCR (oVPL1221-oVPL1222), we amplified the
backbone of pJP028, omitting the cell wall anchor domain, to yield
a 4.579 kb product. For optimal expression of mIL-22 in our
expression host, L. reuteri, we first applied in-silico codon
optimization of the mIL-22 coding sequence using the online
software, OPTIMIZER (genomes.urv.es/OPTIMIZER/, Table 4) followed
by synthesis. The resulting synthetic product (gVPL1) was amplified
by PCR (oVPL1219 and oVPL1220), followed LCR (Kok et al. 2014)
placing the gVPL1 fragment between the start and stop codon located
on the pJP028 backbone. The LCR mixture was precipitated and
transformed in L. reuteri VPL1014. Transformants were screened by
PCR (oVPL329-oVPL363) to confirm cloning of mIL-22. One positive
clone was colony purified, a 1.584 kb amplicon was generated by
colony PCR, and the integrity of the construct was confirmed by DNA
sequencing (GeneWiz). The resultant strain was named VPL3461. We
hereafter refer to pVPL3461 when it concerns the plasmid that
encodes codon-optimized mIL-22 (FIG. 2).
[0089] The nucleotide sequence of pVPL3461 is represented by SEQ ID
NO:25. The nucleotide sequence of the IL-22 promoter (L. reuteri
native promoter) in pVPL3461 is represented by SEQ ID NO: 26. The
nucleotide sequence encoding the signal peptide (SP) in pVPL3461 is
represented by SEQ ID NO:27. The nucleotide sequence encoding IL-22
in pVPL3461 is represented by SEQ ID NO:28. The nucleotide sequence
of the inverted repeat (IR) in pVPL3461 is represented by SEQ ID
NO:29. The nucleotide sequence of the chloramphenicol marker (Cm)
in pVPL3461 is represented by SEQ ID NO:30. The nucleotide sequence
of the Phelp promoter in pVPL3461 is represented by SEQ ID NO:31.
The nucleotide sequence of the erythromycin marker (Em) in pVPL3461
is represented by SEQ ID NO:32.
[0090] Additionally, a construct from the pVPL3461 plasmid
comprising the promoter, signal peptide, and mIL-22 coding sequence
was excised from pVPL3461 and incorporated in the L. reuteri
chromosome using methods known in the art. The resultant strain was
named VPL3461chr.
TABLE-US-00004 TABLE 4 Codon optimization table for L. reuteri
F275.*.sup.# Fields: [sequence of nucleotide triplet] [frequency:
per thousand] ([number]) UUU 29.5 (16802) UCU 9.7 (5521) UAU 24.8
(14106) UGU 4.4 (2479) UUC 11.3 (6447) UCC 4.0 (2249) UAC 12.4
(7068) UGC 1.5 (861) UUA 36.4 (20706) UCA 15.0 (8537) UAA 2.3
(1307) UGA 0.4 (219) UUG 15.4 (8765) UCG 4.3 (2458) UAG 0.7 (374)
UGG 10.8 (6134) CUU 22.1 (12555) CCU 9.7 (5489) CAU 15.3 (8708) CGU
14.1 (7995) CUC 6.3 (3597) CCC 3.4 (1927) CAC 8.0 (4562) CGC 5.9
(3360) CUA 9.4 (5359) CCA 17.7 (10090) CAA 35.0 (19877) CGA 8.6
(4869) CUG 5.3 (3005) CCG 6.0 (3428) CAG 11.7 (6653) CGG 9.9 (5610)
AUU 50.7 (28857) ACU 22.3 (12657) AAU 36.1 (20541) AGU 15.6 (8850)
AUC 16.7 (9524) ACC 9.8 (5550) AAC 15.8 (8968) AGC 6.7 (3786) AUA
5.8 (3300) ACA 16.6 (9464) AAA 36.6 (20829) AGA 3.3 (1872) AUG 26.9
(15321) ACG 9.2 (5230) AAG 30.3 (17232) AGG 1.4 (792) GUU 35.0
(19884) GCU 29.0 (16508) GAU 43.5 (24740) GGU 24.3 (13830) GUC 9.2
(5210) GCC 12.4 (7053) GAC 15.2 (8617) GGC 10.9 (6178) GUA 16.1
(9176) GCA 25.3 (14409) GAA 45.6 (25918) GGA 19.8 (11244) GUG 7.7
(4354) GCG 9.8 (5573) GAG 11.2 (6360) GGG 10.1 (5771) *This table
was made based on 568,715 codons among 1,900 CDSs on chromosomal
DNA of strain F275. .sup.#Coding GC 39.50% 1st letter GC 51.33% 2nd
letter GC 35.17% 3rd letter GC 32.00%.
Determine mIL-22 Secretion.
[0091] Strains L. reuteri VPL1014 and VPL3461 were cultured in
LDM-III as described above, and the supernatants were collected
after centrifugation (5 min at 3,214.times.g), followed by
filter-sterilization (0.22 .mu.m, Millipore). One hundred
microliters of filter-sterilized supernatant from L. reuteri
VPL1014 and VPL3461 was assessed for the presence of mIL-22 by
ELISA (R&D systems). Production of mIL-22 could not be detected
for L. reuteri 6575-VPL (15 pg/ml cut-off limit), while strain
VPL3461 secreted mIL-22 at levels of 164.2.+-.13.1 ng/ml (n=3). See
FIG. 3A.
[0092] Secretion of mIL-22 from VPL3461chr was similarly tested.
VPL3461chr showed detectable mIL-22 secretion. See FIG. 3B.
Plasmid Stability of pVPL3461 in L. reuteri VPL1014.
[0093] Prior to assessing biological activity of the L.
reuteri-produced mIL-22 in mice, we first assessed the stability of
pVPL3461. Normally, selection of plasmids is achieved by
supplementation of an antibiotic, but we wanted to avoid the
supplementation of antibiotics in mice to maintain a fully
competent microbiota. VPL3461 was cultured overnight in LDM-III
(supplemented with antibiotics). Cells were washed to remove
residual antibiotics, followed by sub-culturing to antibiotic-free
LDM-III (OD600=0.1). After 1 passage (20 hr, .about.10
generations), we showed that 96% of the cell population was
resistant to erythromycin, demonstrating that the rate of loss of
pVPL3461 was 0.4% per generation, and would be considered stable
enough for in-vivo assessment of biological activity.
Animal Trial.
[0094] Twenty-four 6-week old male B6 mice (C57BL/6J) were
purchased from Jackson Labs (Bar Harbor, Me.). Animals were housed
at an environment-controlled facility with a 12-hour light and dark
cycle. Both diet (standard chow, LabDiet, St Louis, Mo.) and water
were freely available to the animals. After transport, animals were
allowed to adjust to the new environment for two weeks, after which
treatment by gavage started. Three groups of 8 animals per group
were treated daily for 7 consecutive days. Treatments were sham
gavage where the animals were subjected to insertion of a gavaging
needle without administering anything (control), gavage of L.
reuteri VPL1014 (WT group) and gavage of L. reuteri VPL3461
(LR_mIL-22). Bacterial load administrated was
.about.1.times.10.sup.9 CFU in a volume of 100 .mu.l of the
respective bacterial supernatant. See FIG. 4.
Blood Collection to Assess Plasma IL-22 Levels.
[0095] At T=0 (prior to the start of treatment) and at T=7 (2 hours
after the last gavage) of the animal trial, blood was collected (50
.mu.l per animal) via retro orbital puncture. Plasma was isolated
from whole blood sample by centrifugation at 9,000 rpm for 7 min
and the plasma fraction was stored at -80.degree. C. until use. By
ELISA (as described above) we determined plasma mIL-22 levels. See
FIG. 4.
[0096] Plasma IL-22 levels after 7 days gavage are shown in FIG. 5.
The mice administered L. reuteri VPL3461 showed a statistically
significant increase in plasma IL-22 levels compared to
controls.
[0097] We also assessed whether the administered L. reuteri VPL1014
and L. reuteri VPL3461 could be detected in the bloodstream of the
animals after 7 days gavage. From each animal, 50 .mu.l blood was
plated on deMan Rogosa Sharp (MRS) medium that is selective for a
broad range of lactic acid bacteria, including L. reuteri. The
results are shown in FIG. 6. The prolonged daily administration of
L. reuteri did not increase the total number of lactic acid
bacteria in the bloodstream. As determined by colony morphology,
the bacteria detected in the bloodstream of animals that were
gavaged with L. reuteri were not L. reuteri. L. reuteri yields
(after 48 h) on MRS plates small-medium sized colonies that are
opaque. From the 3 animals in which we detected bacteria in the
bloodstream, all colonies were pigmented, mostly yellow, and some
were red-ish. Some colonies were also extremely large. The size
combined with the pigmented phenotype made it evident that the
recovered bacteria in the bloodstream were not L. reuteri.
[0098] These results indicate that the systemic increase of IL-22
was not a result of L. reuteri VPL3461 itself entering the
bloodstream.
cDNA Synthesis.
[0099] To assess biological functionality of L. reuteri secreted
mIL-22, we assess gene expression levels of reg3-beta and
reg3-gamma. Both genes are known to be upregulated by IL-22 (Loonen
et al. 2013, Sovran et al. 2015). Part of the small intestine
(jejunum) of each animal was processed for RNA isolation. First,
samples were homogenized (Omni TH, Omni International) followed by
RNA isolation and on-column DNaseI treatment (Qiagen), after which
an additional DNase treatment was conducted (RQI DNase; Promega,
Madison, Wis.). RNA was quantified by Qubit analysis (Invitrogen).
One .mu.g RNA was reverse transcribed using the iScript cDNA
synthesis kit (Bio-Rad Laboratories, Richmond, Calif.). See FIG.
4.
Quantitative Real-Time PCR.
[0100] Relative gene expression levels were determined using the
CFX96.TM. real-time PCR (Bio-Rad). Expression of reg3-beta and
reg3-gamma was determined relative to that of the housekeeping gene
.beta.-actin. The qRT-PCR was performed with the SYBR Green PCR
master mix (Bio-Rad). Primers for amplification of: reg3b
(oVPL1313-oVPL1314), reg3g (oVPL1315-oVPL1316), and .beta.-actin
(oVPL1325-oVPL1326) are listed in Table 3. Gene expression of the
reg genes in the jejunum tissues relative to .beta.-actin was
determined by the Relative Expression Software Tool (REST), which
allows comparison of gene expression between groups of animals
(Pfaffl et al. 2001 and 2002).
[0101] As shown in FIG. 7, mice administered IL-22-expressing L.
reuteri VPL3461 showed an average of 4.7-fold and 3-fold increased
expression of reg3-beta and reg3-gamma, respectively in the jejunum
compared to mice administered wild-type L. reuteri, demonstrating
that the secreted IL-22 is biologically active.
[0102] We also determined liver expression of the gene encoding the
lipopolysaccharide-binding protein (LBP), which is known to be
regulated by IL-22. Expression levels were relative to that of the
control (.beta.-actin). As shown in FIG. 8, liver LBP expression
was not changed in animals that received wild-type L. reuteri.
Animals administered the IL-22-expressing L. reuteri VPL3461
displayed an increased level of LBP gene expression, varying from
1.5-fold to 3.5-fold. We did not detect a statistical difference in
gene expression, but we predict including more animals per group
will show a statistical difference.
Metabolic Syndrome Trial.
[0103] IL-22 has been shown to alleviate metabolic disorders and
provide other therapeutic effects in diabetic subjects. See Wang et
al. 2014. We tested whether administering IL-22-secreting L.
reuteri to mice with diet-induced obesity could recapitulate these
effects.
[0104] Thirty-six 6-week old male B6 mice (C57BL/6J) were purchased
from Jackson Labs (Bar Harbor, Me.). Animals were housed at an
environmental controlled facility with a 12-hour light and dark
cycle. After transport, animals were caged (4 mice per cage) and
immediately placed on an ad libitum high-fat diet: 45% kcal fat
diet containing 21% milk fat and 2% soybean oil (Cat. No. TD08811,
Envigo, Indianapolis, Ind.), for eight weeks. Based on prior work,
animals placed on this diet for eight weeks develop signs of
metabolic syndrome, including glucose intolerance and insulin
sensitivity.
[0105] After eight weeks on the high-fat diet, we initiated the
treatment of daily gavage for a period of seven weeks. Animals in a
first group (12 animals) received a sham gavage of 100 .mu.l PBS
without bacteria. Animals in a second group (12 animals) received
100 .mu.l of L. reuteri VPL1014 (10.sup.9 CFU). Animals in a third
group (12 animals) received 100 .mu.l of the IL-22-secreting L.
reuteri VPL3461 (10.sup.9 CFU).
[0106] The length (nose to anus) of the animals was determined
after eight weeks high-fat diet feeding (T0), and was subsequently
determined every week after for seven weeks (T7). Each animal was
measured three times and the values were averaged. After eight
weeks high-fat diet feeding but prior to the start of the treatment
(T0) we observed that the animals assigned to be receiving
treatment were similar in length (P=0.88) but both groups were
marginally smaller than the control group (control vs WT, P=0.09;
control vs recombinant, P=0.04). See FIG. 9A. After seven weeks of
treatment (T7) we observed that the animals gavaged with the
IL-22-secreting L. reuteri grew faster than animals gavaged with L.
reuteri wild-type (P<0.0001) or PBS control (P<0.0001). See
FIG. 9B. The increased growth is purely driven by recombinant IL-22
that is delivered by L. reuteri because L. reuteri wild-type does
not influence growth compared to the PBS control (P=0.66)
[0107] Healthy mice have a natural curve in their spine. When mice
are obese, the excess weight will press the spine down. When
measuring length of the animal from nose to anus, obese mice may be
perceived to be longer. To determine if this would have affected
our body length data, we measured animals alive and after
euthanasia at T7. When anesthetized or dead, any bias derived from
differences in curvature will be lost as the animal is completely
relaxed. As shown in FIG. 9C, there is no difference in the body
length of the animals when measured alive or dead. This finding
conclusively confirmed that recombinant L. reuteri secreting IL-22
promotes growth.
[0108] Our growth data led us to measure growth hormone levels in
the serum. As shown in FIG. 10, mice treated with IL-22-secreting
L. reuteri had increased levels of growth hormone compared to the
PBS control (P=0.03) at T7. Levels were also higher in the
recombinant group compared to the wild-type but this was not
statistically significant (P=0.09).
[0109] In mice, the body mass index (BMI) can be an indication of
metabolic syndrome. We determined the BMI of the mice as follows:
(body weight (g)/[nose-anus length (mm)].sup.2). As shown in FIGS.
11A and 11B, L. reuteri-derived IL-22 reduces the change in BMI
over the course of seven weeks (T7-T0) and six weeks (T7-T1),
respectively.
[0110] Following seven weeks treatment (T7), animals were killed,
tissues were harvested, and liver weights were determined. Liver
weights are shown as absolute liver weights (FIG. 12A) or liver
weight relative to mouse body weight (FIG. 12B). Both metrics
showed that IL-22-secreting L. reuteri yielded significantly lower
liver weights compared to the wild-type L. reuteri or PBS
control.
[0111] These results show that oral administration of recombinant
L. reuteri engineered to secrete IL-22 systemically delivers IL-22
in a manner that results in systemic physiological effects. In the
present case, the systemic physiological effects included an
increase in growth, an increase in growth hormone in the plasma, a
reduction in BMI, and a reduction in liver weight. The
administration reversed many effects associated with metabolic
syndrome. We predict that systemic delivery of IL-22 will also
reverse many metabolic symptoms of diabetic subjects, including
hyperglycemia and insulin resistance, and will improve insulin
sensitivity, preserve gut mucosal barrier and endocrine functions,
decrease endotoxemia and chronic inflammation, and reverse the
dysregulation of lipid metabolism in liver and adipose tissues.
Delivery of Peptides Other than IL-22.
[0112] L. reuteri can be used to systemically deliver polypeptides
other than IL-22. This can be performed by replacing the mIL-22
reading frame from the pVPL3461 plasmid and replacing it with the
reading frame of any polypeptide of interest. The edited plasmid
can then be introduced into L. reuteri using methods described
above, and the L. reuteri harboring the edited plasmid can be
administered as described above. We predict that the L. reuteri so
modified will be capable of systemically delivering any polypeptide
of interest without the bacterium itself being distributed
systemically. We predict that diseases and conditions that are
alleviated by systemic administration of such polypeptides will be
alleviated with the L. reuteri-dependent systemic delivery of the
peptides.
Statistical Analysis.
[0113] In the present examples, ANOVA (analysis of variance) was
used for data analysis, and significance in comparisons between
groups was analyzed by t-test. Significant difference was
considered when P-value is lower than 0.05.
REFERENCES
[0114] Ahrne, S., Molin, G., & Axelsson, L. (1992).
Transformation of Lactobacillus reuteri with electroporation:
Studies on the erythromycin resistance plasmid pLUL631. Current
Microbiology, 24: 199-205. [0115] Alvarez-Sieiro P, Montalban-Lopez
M, Mu D, Kuipers O P. Bacteriocins of lactic acid bacteria:
extending the family. Appl Microbiol Biotechnol. 2016.
100(7):2939-51. Bahey-El-Din M, Gahan C G M, Griffin B T. 2010.
Lactococcus lactis as a cell factory for delivery of therapeutic
proteins. Curr Gene Ther 10:34-45. [0116] Barrangou R, van Pijkeren
J P. Exploiting CRISPR-Cas immune systems for genome editing in
bacteria. Curr Opin Biotechnol. 2016 February; 37:61-8. [0117]
Becker S C, Dong S, Baker J R, Foster-Frey J, Pritchard D G,
Donovan D M. 2009. LysK CHAP endopeptidase domain is required for
lysis of live staphylococcal cells. FEMS Microbiol Lett 294:52-60.
[0118] Beisel C L, Gomaa A A, Barrangou R. 2014. A CRISPR design
for next-generation antimicrobials. Genome Biol 15:516. [0119]
Bikard D, Euler C W, Jiang W, Nussenzweig P M, Goldberg G W,
Duportet X, Fischetti V A, Marraffini L A. 2014. Exploiting
CRISPR-Cas nucleases to produce sequence-specific antimicrobials.
Nat Biotech 32:1146-1150. [0120] Borysowski J, Weber-Dabrowska B,
Gorski A. Bacteriophage endolysins as a novel class of
antibacterial agents. Exp Biol Med (Maywood). 2006 April;
231(4):366-77. [0121] Britton, R. A.; Irwin, R.; Quach, D.;
Schaefer, L.; Zhang, J.; Lee, T.; Parameswaran, N.; McCabe, L. R.
Probiotic L. reuteri Treatment Prevents Bone Loss in a Menopausal
Ovariectomized Mouse Model. J Cell Physiol 2014, 229 (11), n/a-n/a
DOI: 10.1002/jcp.24636. [0122] Chatel J-M, Pothelune L, Ah-Leung S,
Corthier G, Wal J-M, Langella P. 2008. In vivo transfer of plasmid
from food-grade transiting lactococci to murine epithelial cells.
Gene Ther 15:1184-1190. [0123] Cheng X, Zhang X, Pflugrath J W,
Studier F W. 1994. The structure of bacteriophage T7 lysozyme, a
zinc amidase and an inhibitor of T7 RNA polymerase. Proc Natl Acad
Sci USA 91:4034-4038. [0124] Citorik R J, Mimee M, Lu T K. 2014.
Sequence-specific antimicrobials using efficiently delivered
RNA-guided nucleases. Nat Biotech 32:1141-1145. [0125] Cotter P D,
Ross R P, Hill C. 2013. Bacteriocins |[mdash]| a viable alternative
to antibiotics? Nat Rev Microbiol 11:95-105. [0126] Cronin, M.;
Akin, A. R.; Collins, S. A.; Meganck, J.; Kim, J.-B.; Baban, C. K.;
Joyce, S. A.; van Dam, G. M.; Zhang, N.; van Sinderen, D.; et al.
High resolution in vivo bioluminescent imaging for the study of
bacterial tumour targeting. PLoS ONE 2012, 7 (1), e30940
DOI:10.1371/journal.pone.0030940. [0127] Cronin M, Morrissey D,
Rajendran S, El Mashad S M, van Sinderen D, O'Sullivan G C, Tangney
M. Orally administered bifidobacteria as vehicles for delivery of
agents to systemic tumors. Mol Ther. 2010 July; 18(7):1397-407.
[0128] de Azevedo M, Karczewski J, Lefe{grave over (v)}re F,
Azevedo V, Miyoshi A, Wells J M, Langella P, Chatel J-M. 2012. In
vitro and in vivo characterization of DNA delivery using
recombinant Lactococcus lactis expressing a mutated form of L.
monocytogenes Internalin A. BMC Microbiol 12:299. [0129] de Ruyter,
P. G.; Kuipers, O. P.; de Vos, W. M. Controlled gene expression
systems for Lactococcus lactis with the food-grade inducer nisin.
Appl Environ Microbiol 1996, 62 (10), 3662-3667. [0130] De Weirdt
R, Crabbe A, Roos S, Vollenweider S, Lacroix C, van Pijkeren J-P,
Britton R A, Sarker S, Van de Wiele T, Nickerson C A. 2012.
Glycerol Supplementation Enhances L. reuteri's Protective Effect
against S. Typhimurium Colonization in a 3-D Model of Colonic
Epithelium. PLoS ONE 7:e37116. [0131] Dishisha T, Pereyra L P, Pyo
S-H, Britton R A, Hatti-Kaul R. 2014. Flux analysis of the
Lactobacillus reuteri propanediol-utilization pathway for
production of 3-hydroxypropionaldehyde, 3-hydroxypropionic acid and
1,3-propanediol from glycerol. Microb Cell Fact 13:76. [0132]
Doleyres Y, Beck P, Vollenweider S, Lacroix C. 2005. Production of
3-hydroxypropionaldehyde using a two-step process with
Lactobacillus reuteri. Appl Microbiol Biotechnol 68:467-474. [0133]
Eaton, K. A.; Honkala, A.; Auchtung, T. A.; Britton, R. A.
Probiotic Lactobacillus reuteri Ameliorates Disease Due to
Enterohemorrhagic Escherichia coli in Germfree Mice. Infect Immun
2011, 79 (1), 185-191 DOI: 10.1128/IAI.00880-10. [0134] Elzagheid,
A.; Algars, A.; Bendardaf, R.; Lamlum, H.; Ristamaki, R.; Collan,
Y.; Syrjanen, K.; Pyrhonen, S. E-cadherin expression pattern in
primary colorectal carcinomas and their metastases reflects disease
outcome. World J Gastroenterol 2006, 12 (27), 4304-4309. [0135]
Feliza A. Bourguet, Brian E. Souza, Angela K. Hinz, Matthew A.
Coleman, and Paul J. Jackson. Characterization of a Novel Lytic
Protein Encoded by the Bacillus cereus E33L Gene ampD as a Bacillus
anthracis Antimicrobial Protein. Appl Environ Microbiol. 2012
April; 78(8): 3025-3027. [0136] Field D, Connor P M O, Cotter P D,
Hill C, Ross R P. 2008. The generation of nisin variants with
enhanced activity against specific gram-positive
pathogens.--PubMed--NCBI. Mol Microbiol 69:218-230. [0137] Field D,
Begley M, O'Connor P M, Daly K M, Hugenholtz F, Cotter P D, Hill C,
Ross R P. 2012. Bioengineered Nisin A Derivatives with Enhanced
Activity against Both Gram Positive and Gram Negative Pathogens.
PLoS ONE 7:e46884 [0138] Fischetti V A. 2004. The use of phage
lytic enzymes to control bacterial infections, p 321-334 In Kutter
E, Sulakvelidze A, editors. (ed), Bacteriophages: biology and
applications. CRC Press, Boca Raton, Fla. [0139] Fischetti V A.
2009. Bacteriophage Lysins: the Ultimate EnzybioticEnzybiotics.
John Wiley & Sons, Inc., Hoboken, N.J., USA [0140] Fogel, M.
R.; Gray, G. M. Starch hydrolysis in man: an intraluminal process
not requiring membrane digestion. J Appl Physiol 1973, 35 (2),
263-267. [0141] Foster, P. L. Methods for determining spontaneous
mutation rates. Meth Enzymol 2006, 409, 195-213. [0142] Frese S A,
Benson A K, Tannock G W, Loach D M, Kim J, Zhang M, Oh P L, Heng N
C, Patil P B, Juge N, Mackenzie D A, Pearson B M, Lapidus A, Dalin
E, Tice H, Goltsman E, Land M, Hauser L, Ivanova N, Kyrpides N C,
Walter J. The evolution of host specialization in the vertebrate
gut symbiont Lactobacillus reuteri. PLoS Genet. 2011 February;
7(2):e1001314. [0143] Gibson D G, Young L, Chuang R-Y, Venter J C,
Hutchison C A, Smith H O. 2009. Enzymatic assembly of DNA molecules
up to several hundred kilobases. Nat Meth 6:343-345. [0144] Gomaa A
A, Klumpe H E, Luo M L, Selle K, Barrangou R, Beisel C L. 2014.
Programmable Removal of Bacterial Strains by Use of
Genome-Targeting CRISPR-Cas Systems. mBio 5:e00928-13. [0145] Green
et al., Molecular Cloning: A Laboratory Manual, 4th ed., Cold
Spring Harbor Laboratory Press, 2012. [0146] Guimaraes, V. D.;
Gabriel, J. E.; Lefevre, F.; Cabanes, D.; Gruss, A.; Cossart, P.;
Azevedo, V.; Langella, P. Internalin-expressing Lactococcus lactis
is able to invade small intestine of guinea pigs and deliver DNA
into mammalian epithelial cells. Microbes Infect 2005, 7 (5-6),
836-844 DOI: 10.1016/j.micinf.2005.02.012. [0147] Guimaraes V,
Innocentin S, Chatel J-M, Lefevre F, Langella P, Azevedo V, 582
Miyoshi A. 2009. A new plasmid vector for DNA delivery using
lactococci. Genet Vaccines Ther 7:4. [0148] Huyghebaert N, Vermeire
A, Neirynck S, Steidler L, Remaut E, Remon J P. Development of an
enteric-coated formulation containing freeze-dried, viable
recombinant Lactococcus lactis for the ileal mucosal delivery of
human interleukin-10. Eur J Pharm Biopharm. 2005 August;
60(3):349-59. [0149] Jacobs C, Huang L J, Bartowsky E, Normark S,
Park J T. Bacterial cell wall recycling provides cytosolic
muropeptides as effectors for beta-lactamase induction. EMBO J.
1994 October 3; 13(19):4684-94. [0150] Jacobs C, Joris B, Jamin M,
Klarsov K, Van Beeumen J, Mengin-Lecreulx D, van Heijenoort J, Park
J T, Normark S, Frere J M. AmpD, essential for both beta-lactamase
regulation and cell wall recycling, is a novel cytosolic
N-acetylmuramyl-L-alanine amidase. Mol Microbiol. 1995 February;
15(3):553-9. [0151] Jensen H, Roos S, Jonsson H, Rud I, Grimmer S,
van Pijkeren J P, Britton R A, Axelsson L. Role of Lactobacillus
reuteri cell and mucus-binding protein A (CmbA) in adhesion to
intestinal epithelial cells and mucus in vitro. Microbiology. 2014
April; 160(Pt 4):671-81. [0152] Kok, S. D., Stanton, L. H., Slaby,
T., Durot, M., Holmes, V. F., Patel, K. G., Platt, D., Shapland, E.
B. and Chandran, S. S. (2014). Rapid and reliable DNA assembly via
ligase cycling reaction. ACS synthetic biology, 3: 97-106. [0153]
Kommineni S, Bretl D J, Lam V, Chakraborty R, Hayward M, Simpson P,
Cao Y, Bousounis P, Kristich C J, Salzman N H. 2015. Bacteriocin
production augments niche competition by enterococci in the
mammalian GI tract. Nature 526:719-722. [0154] Lecuit, M.; Ohayon,
H.; Braun, L.; Mengaud, J.; Cossart, P. Internalin of Listeria
monocytogenes with an intact leucine-rich repeat region is
sufficient to promote internalization. Infect Immun 1997, 65 (12),
5309-5319. [0155] Liu, Y.; Fatheree, N. Y.; Mangalat, N.; Rhoads,
J. M. Human-derived probiotic Lactobacillus reuteri strains
differentially reduce intestinal inflammation. Am J Physiol
Gastrointest Liver Physiol 2010, 299 (5), G1087-G1096 DOI:
10.1152/ajpgi.00124.2010. [0156] Loessner M J. Bacteriophage
endolysins--current state of research and applications. Curr Opin
Microbiol. 2005 August; 8(4):480-7. [0157] Loessner M J, Kramer K,
Ebel F, Scherer S. C-terminal domains of Listeria monocytogenes
bacteriophage murein hydrolases determine specific recognition and
high-affinity binding to bacterial cell wall carbohydrates. Mol
Microbiol. 2002 April; 44(2):335-49. [0158] Loonen, L. M., Stolte,
E. H., Jaklofsky, M. T., Meijerink, M., Dekker, J., van Baarlen,
P., & Wells, J. M. (2014). REG3.gamma.-deficient mice have
altered mucus distribution and increased mucosal inflammatory
responses to the microbiota and enteric pathogens in the ileum.
Mucosal immunology, 7: 939-947. [0159] Lopez R, Garcia E, Garcia P,
Garcia J L. The pneumococcal cell wall degrading enzymes: a modular
design to create new lysins? Microb Drug Resist. 1997;
3(2):199-211. Mackenzie D A, Jeffers F, Parker M L, Vibert-Vallet
A, Bongaerts R J, Roos S, Walter J, Juge N. Strain-specific
diversity of mucus-binding proteins in the adhesion and aggregation
properties of Lactobacillus reuteri. Microbiology. 2010 November;
156(Pt 11):3368-78. Oh J H, van Pijkeren J P. CRISPR-Cas9-assisted
recombineering in Lactobacillus reuteri. Nucleic Acids Res. 2014;
42(17):e131. [0160] Navarre W W, Ton-That H, Faull K F, Schneewind
O. 1999. Multiple Enzymatic Activities of the Murein Hydrolase from
Staphylococcal Phage .phi.11. Journal of Biological Chemistry
274:15847-15856. [0161] Nelson D, Schuch R, Chahales P, Zhu S,
Fischetti V A. 2006. PlyC: A multimeric bacteriophage lysin. Proc
Natl Acad Sci USA 103:10765-10770. [0162] Nicoletti M, Bertani G.
1983. DNA fusion product of phage P2 with plasmid pBR322: A new
phasmid. Mol Gen Genet 189:343-347. [0163] Oh, P. L.; Benson, A.
K.; Peterson, D. A.; Patil, P. B.; Moriyama, E. N.; Roos, S.;
Walter, J. Diversification of the gut symbiont Lactobacillus
reuteri as a result of host-driven evolution. ISME J 2010, 4 (3),
377-387 DOI: 10.1038/ismej.2009.123. [0164] Oh J H, van Pijkeren J
P. CRISPR-Cas9-assisted recombineering in Lactobacillus reuteri.
Nucleic Acids Res. 2014; 42(17):e131. [0165] Paez-Espino D, Morovic
W, Sun C L, Thomas B C, Ueda K-I, Stahl B, Barrangou R, Banfield J
F. 2013. Strong bias in the bacterial CRISPR elements that confer
immunity to phage. Nat Comms 4:1430-1430. [0166] Palffy, R.;
Gardlik, R.; Hodosy, J.; Behuliak, M.; Resko, P.; Radvansky, J.;
Celec, P. Bacteria in gene therapy: bactofection versus alternative
gene therapy. Gene Ther 2006, 13 (2), 101-105
DOI:10.1038/sj.gt.3302635. [0167] Pfaffl, M. W. (2001). A new
mathematical model for relative quantification in real-time RT-PCR.
Nucleic acids research, 29: e45-e45. [0168] Pfaffl, M. W., Horgan,
G. W., & Dempfle, L. (2002). Relative expression software tool
(REST.COPYRGT.) for group-wise comparison and statistical analysis
of relative expression results in real-time PCR. Nucleic acids
research, 30: e36-e36. [0169] Rajpal G, Liu M, Zhang Y, Aryan P.
Single-chain insulins as receptor agonists. Mol Endocrinol. 2009
May; 23(5):679-88. [0170] Riboulet-Bisson E, Sturme M H J, Jeffery
I B, O'Donnell M M, Neville B A, Forde B M, Claesson M J, Harris H,
Gardiner G E, Casey P G, Lawlor P G, O'Toole P W, Ross R P. 2012.
Effect of Lactobacillus salivarius Bacteriocin Abp118 on the Mouse
and Pig Intestinal Microbiota. PLoS ONE 7:e31113. [0171] Riedel, C.
U.; Monk, I. R.; Casey, P. G.; Morrissey, D.; O'Sullivan, G. C.;
Tangney, M.; Hill, C.; Gahan, C. G. M. Improved luciferase tagging
system for Listeria monocytogenes allows real-time monitoring in
vivo and in vitro. Appl Environ Microbiol 2007, 73 (9), 3091-3094
DOI:10.1128/AEM.02940-06. [0172] Robert S, Steidler L. 2014.
Recombinant Lactococcus lactis can make the difference in
antigen-specific immune tolerance induction, the Type 1 Diabetes
case. Microb Cell Fact 13:S11. [0173] Rosche, W. A.; Foster, P. L.
Determining mutation rates in bacterial populations. Methods 2000,
20 (1), 4-17. [0174] Sabat R, Ouyang W, Wolk K. Therapeutic
opportunities of the IL-22-IL-22R1 system. Nat Rev Drug Discov.
2014 January; 13(1):21-38. [0175] Schaefer L, Auchtung T A, Hermans
K E, Whitehead D, Borhan B, Britton R A. 2010. The antimicrobial
compound reuterin (3-hydroxypropionaldehyde) induces oxidative
stress via interaction with thiol groups. Microbiology
156:1589-1599. [0176] Sheehan M M, Stanley E, Fitzgerald G F, van
Sinderen D. 1999. Identification and characterization of a lysis
module present in a large proportion of bacteriophages infecting
Streptococcus thermophilus. Appl Environ Microbiol 65:569-577.
[0177] Shi, Y.; Yan, Y.; Ji, W.; Bin Du; Meng, X.; Wang, H.; Sun,
J. Characterization and determination of holin protein of
Streptococcus suis bacteriophage SMP in heterologous host. Virol J
2012, 9 (1), 70-70 DOI: 10.1186/1743-422X-9-70. [0178] Singh K,
Kadesjo E, Lindroos J, Hjort M, Lundberg M, Espes D, Carlsson P O,
Sandler S, Thorvaldson L. Interleukin-35 administration counteracts
established murine type 1 diabetes--possible involvement of
regulatory T cells. Sci Rep. 2015 Jul. 30; 5:12633. [0179] Sovran,
B., Loonen, L. M., Lu, P., Hugenholtz, F., Belzer, C., Stolte, E.
H., . . . & Dekker, J. (2015). IL-22-STAT3 pathway plays a key
role in the maintenance of ileal homeostasis in mice lacking
secreted mucus barrier. Inflammatory bowel diseases, 21: 531-542.
[0180] Spinler J K, Taweechotipatr M, Rognerud C L, Ou C N,
Tumwasorn S, Versalovic J. 2008. Human-derived probiotic
Lactobacillus reuteri demonstrate antimicrobial activities
targeting diverse enteric bacterial pathogens. Anaerobe
14:166-171.
Steidler L, Hans W, Schotte L, Neirynck S, Obermeier F, Falk W,
Fiers W, Remaut E. Treatment of murine colitis by Lactococcus
lactis secreting interleukin-10. Science. 2000 August 25;
289(5483):1352-5. [0182] Sulakvelidze, Alexander; Alavidze,
Zemphira; and J. Glenn Morris, Jr. Bacteriophage Therapy.
Antimicrob Agents Chemother. 2001, 45(3): 649-659). [0183] Summers
W C. Bacteriophage therapy. Annu Rev Microbiol. 2001; 55:437-51.
Sun J, Furio L, Mecheri R, van der Does A M, Lundeberg E, Saveanu
L, Chen Y, van Endert P, Agerberth B, Diana J. Pancreatic
.beta.-Cells Limit Autoimmune Diabetes via an Immunoregulatory
Antimicrobial Peptide Expressed under the Influence of the Gut
Microbiota. Immunity. 2015 Aug. 18; 43(2):304-17. [0184] Sznol, M.;
Lin, S. L.; Bermudes, D.; Zheng, L.-M.; King, I. Use of
preferentially replicating bacteria for the treatment of cancer.
Journal of Clinical Investigation 2000, 105 (8), 1027-1030
DOI:10.1172/JC19818. [0185] Talarico T L, Casas I A, Chung T C,
Dobrogosz W J. 1988. Production and isolation of reuterin, a growth
inhibitor produced by Lactobacillus reuteri. Antimicrob Agents
Chemother 32:1854-1858. [0186] Tannock, G. W.; Wilson, C. M.;
Loach, D.; Cook, G. M.; Eason, J.; O'Toole, P. W.; Holtrop, G.;
Lawley, B. Resource partitioning in relation to cohabitation of
Lactobacillus species in the mouse forestomach. ISME J 2011, 6 (5),
927-938 DOI: 10.1038/ismej.2011.161. [0187] Thomas, C. M.; Hong,
T.; van Pijkeren, J. P.; Hemarajata, P.; Trinh, D. V.; Hu, W.;
Britton, R. A.; Kalkum, M.; Versalovic, J. Histamine Derived from
Probiotic Lactobacillus reuteri Suppresses TNF via Modulation of
PKA and ERK Signaling. PLoS ONE 2012, 7 (2), e31951
DOI:10.1371/journal.pone.0037116.g006. [0188] van Pijkeren, J. P.;
Morrissey, D.; Monk, I. R.; Cronin, M.; Rajendran, S.; O'Sullivan,
G. C.; Gahan, C. G. M.; Tangney, M. A novel Listeria
monocytogenes-based DNA delivery system for cancer gene therapy.
Hum. Gene Ther. 2010, 21 (4), 405-416 DOI: 10.1089/hum.2009.022.
[0189] van Pijkeren J P, Britton R A. High efficiency
recombineering in lactic acid bacteria. Nucleic Acids Res. 2012
May; 40(10):e76. [0190] van Pijkeren, J. P.; Britton, R. A.
Precision genome engineering in lactic acid bacteria. Microb Cell
Fact 2014, 13 Suppl 1, S10-S10 DOI: 10.1186/1475-2859-13-S1-S10.
[0191] van Pijkeren J-P, Neoh K M, Sirias D, Findley A S, Britton R
A. 2012. Exploring optimization parameters to increase ssDNA
recombineering in Lactococcus lactis and Lactobacillus reuteri.
Bioengineered 3:209-217. [0192] Wang I N, Smith D L, Young R. 2000.
Holins: the protein clocks of bacteriophage infections. Annual
Reviews in Microbiology. [0193] Wang X, Ota N, Manzanillo P, Kates
L, Zavala-Solorio J, Eidenschenk C, Zhang J, Lesch J, Lee W P, Ross
J, Diehl L, van Bruggen N, Kolumam G, Ouyang W. Interleukin-22
alleviates metabolic disorders and restores mucosal immunity in
diabetes. Nature. 2014 Oct. 9; 514(7521):237-41. [0194] Wells M. et
al. Lactococcus lactis: high-level expression of tetanus toxin
fragment C and protection against lethal challenge. Mol.
Microbiol., 8 (1993), pp. 1155-1162. [0195] Zhang Y, Eigenbrot C,
Zhou L, Shia S, Li W, Quan C, Tom J, Moran P, Di Lello P, Skelton N
J, Kong-Beltran M, Peterson A, Kirchhofer D. Identification of a
small peptide that inhibits PCSK9 protein binding to the low
density lipoprotein receptor. J Biol Chem. 2014 Jan. 10;
289(2):942-55. [0196] Zhou, Y.; Liang, Y; Lynch, K. H.; Dennis, J.
J.; Wishart, D. S. PHAST: A Fast Phage Search Tool. 2011, 39
(suppl), W347-W352 DOI: 10.1093/nar/gkr485.
Sequence CWU 1
1
321311DNALactobacillus reuteri 1taccaagaat aactttcatc gtaaaaggca
agtaattgag gaaacttgaa gtttttctct 60attacttgcc ttctttattt tattaagcta
aatatgtttt aaataattaa ctataacgga 120cctgcttggc ggaaactaaa
cagtaagaac tttaaattat aaaaatctgc aaccgttttc 180taaaattttg
cgcaagcggt tgcgcaaaat ttttaaattt gatattatta atattgcaat
240aattcatgaa gcgcttacaa taatcacaag tgtcttttag aactatttta
taagttaagg 300agttgttagc a 3112146PRTHomo sapiens 2Ala Pro Ile Ser
Ser His Cys Arg Leu Asp Lys Ser Asn Phe Gln Gln1 5 10 15Pro Tyr Ile
Thr Asn Arg Thr Phe Met Leu Ala Lys Glu Ala Ser Leu 20 25 30Ala Asp
Asn Asn Thr Asp Val Arg Leu Ile Gly Glu Lys Leu Phe His 35 40 45Gly
Val Ser Met Ser Glu Arg Cys Tyr Leu Met Lys Gln Val Leu Asn 50 55
60Phe Thr Leu Glu Glu Val Leu Phe Pro Gln Ser Asp Arg Phe Gln Pro65
70 75 80Tyr Met Gln Glu Val Val Pro Phe Leu Ala Arg Leu Ser Asn Arg
Leu 85 90 95Ser Thr Cys His Ile Glu Gly Asp Asp Leu His Ile Gln Arg
Asn Val 100 105 110Gln Lys Leu Lys Asp Thr Val Lys Lys Leu Gly Glu
Ser Gly Glu Ile 115 120 125Lys Ala Ile Gly Glu Leu Asp Leu Leu Phe
Met Ser Leu Arg Asn Ala 130 135 140Cys Ile1453209PRTArtificial
SequenceRecombinant IL-35 3Arg Lys Gly Pro Pro Ala Ala Leu Thr Leu
Pro Arg Val Gln Cys Arg1 5 10 15Ala Ser Arg Tyr Pro Ile Ala Val Asp
Cys Ser Trp Thr Leu Pro Pro 20 25 30Ala Pro Asn Ser Thr Ser Pro Val
Ser Phe Ile Ala Thr Tyr Arg Leu 35 40 45Gly Met Ala Ala Arg Gly His
Ser Trp Pro Cys Leu Gln Gln Thr Pro 50 55 60Thr Ser Thr Ser Cys Thr
Ile Thr Asp Val Gln Leu Phe Ser Met Ala65 70 75 80Pro Tyr Val Leu
Asn Val Thr Ala Val His Pro Trp Gly Ser Ser Ser 85 90 95Ser Phe Val
Pro Phe Ile Thr Glu His Ile Ile Lys Pro Asp Pro Pro 100 105 110Glu
Gly Val Arg Leu Ser Pro Leu Ala Glu Arg Gln Leu Gln Val Gln 115 120
125Trp Glu Pro Pro Gly Ser Trp Pro Phe Pro Glu Ile Phe Ser Leu Lys
130 135 140Tyr Trp Ile Arg Tyr Lys Arg Gln Gly Ala Ala Arg Phe His
Arg Val145 150 155 160Gly Pro Ile Glu Ala Thr Ser Phe Ile Leu Arg
Ala Val Arg Pro Arg 165 170 175Ala Arg Tyr Tyr Val Gln Val Ala Ala
Gln Asp Leu Thr Asp Tyr Gly 180 185 190Glu Leu Ser Asp Trp Ser Leu
Pro Ala Thr Ala Thr Met Ser Leu Gly 195 200 205Lys49PRTArtificial
SequencePeptide Linker 4Gln Arg Gly Gly Gly Gly Gly Gln Arg1
55146PRTHomo sapiens 5Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys
Thr Leu Ile Lys Thr1 5 10 15Ile Val Thr Arg Ile Asn Asp Ile Ser His
Thr Gln Ser Val Ser Ser 20 25 30Lys Gln Lys Val Thr Gly Leu Asp Phe
Ile Pro Gly Leu His Pro Ile 35 40 45Leu Thr Leu Ser Lys Met Asp Gln
Thr Leu Ala Val Tyr Gln Gln Ile 50 55 60Leu Thr Ser Met Pro Ser Arg
Asn Val Ile Gln Ile Ser Asn Asp Leu65 70 75 80Glu Asn Leu Arg Asp
Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys 85 90 95His Leu Pro Trp
Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly 100 105 110Val Leu
Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg 115 120
125Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro
130 135 140Gly Cys145639PRTHomo sapiens 6Phe Ala Leu Leu Gly Asp
Phe Phe Arg Lys Ser Lys Glu Lys Ile Gly1 5 10 15Lys Glu Phe Lys Arg
Ile Val Gln Arg Ile Lys Asp Phe Leu Arg Asn 20 25 30Leu Val Pro Arg
Thr Glu Ser 35713PRTArtificial SequencePeptide PCSK9 Inhibitor 7Thr
Val Phe Thr Ser Trp Glu Glu Tyr Leu Asp Trp Val1 5
10830DNAArtificial SequencePrimer oVPL329 8attccttgga cttcatttac
tgggtttaac 30925DNAArtificial SequencePrimer oVPL363 9taatatgaga
taatgccgac tgtac 251050DNAArtificial SequencePrimer oVPL1219
10ttcatgggga tgaatgcttc tgctaataca ttaccagtta atactcgttg
501152DNAArtificial SequencePrimer oVPL1220 11cttggttttc taattttggt
tcaaagatca aacacaagca ttacgtaaac tc 521226DNAArtificial
SequencePrimer oVPL1221 12gcttgaaacg ttcaattgaa atggca
261324DNAArtificial SequencePrimer oVPL1222 13tgtaaaacca ataaggactg
aagc 241460DNAArtificial SequencePrimer oVPL1223 14ggagttgctt
cagtccttat tggttttaca ttcatgggga tgaatgcttc tgctaataca
601560DNAArtificial SequencePrimer oVPL1224 15tgatctttga accaaaatta
gaaaaccaag gcttgaaacg ttcaattgaa atggcaatta 601623DNAArtificial
SequencePrimer oVPL1313 16actccctgaa gaatataccc tcc
231722DNAArtificial SequencePrimer oVPL1314 17cgctattgag cacagatacg
ag 221822DNAArtificial SequencePrimer oVPL1315 18atgcttcccc
gtataaccat ca 221922DNAArtificial SequencePrimer oVPL1316
19ggccatatct gcatcatacc ag 222019DNAArtificial SequencePrimer
oVPL1321 20gatcaccgac aagggcctg 192121DNAArtificial SequencePrimer
oVPL1322 21ggctatgaaa ctcgtactgc c 212220DNAArtificial
SequencePrimer oVPL1325 22ggctgtattc ccctccatcg 202322DNAArtificial
SequencePrimer oVPL1326 23ccagttggta acaatgccat gt
2224500DNAArtificial SequencegVPL1 Codon-Optimized IL-22 Coding
Sequence 24attcatgggg atgaatgctt ctgctaatac attaccagtt aatactcgtt
gtaaattaga 60agttagtaat tttcaacaac catatattgt taatcgtact tttatgttag
ctaaagaagc 120tagtttagct gataataata ctgatgttcg tttaattggt
gaaaaattat ttcgtggtgt 180tagtgctaaa gatcaatgtt atttaatgaa
acaagtttta aattttactt tagaagatgt 240tttattacca caaagtgatc
gttttcaacc atatatgcaa gaagttgttc catttttaac 300taaattaagt
aatcaattaa gtagttgtca tattagtggt gatgatcaaa atattcaaaa
360aaatgttcgt cgtttaaaag aaactgttaa aaaattaggt gaaagtggtg
aaattaaagc 420tattggtgaa ttagatttat tatttatgag tttacgtaat
gcttgtgttt gatctttgaa 480ccaaaattag aaaaccaagg
500255090DNAArtificial SequenceVector pVPL3461 25aatgattgaa
aacaaaattg actttaatga aaaaagaaat ttgatgattt catcggttat 60tttagtaatt
gggattggaa atgcctatct tcaattagga aaatatcaat tctctggatt
120agctgttgca gctgtcctcg ggataataat gaatttaatc cttccacaaa
aagccaaaag 180tgaaatgtag tttgaatttt taagcagagt aagaaaaggc
atccgacctc ttactctgct 240tttttcgtat gataacaaaa caaaaaatta
agaggtcgtg gaaaaaacag attgtaagaa 300aaagtttatc aagtctaaga
aaacgttttc tttacactct tatcaattga ttagtaggta 360tatataaacc
taattttttt tgaattttaa cgaaattaat gatatattaa cattcgtaac
420ttggggtagt tcgttttatt tgcaacgttc atccaattta caagccaaat
tattgttata 480aggaaagagg tggaatatga atgttatcga agaataatcg
aaaggaacaa ttccggaaac 540aagagccgaa aaagcaacgt tttgcaatta
aaaagctcac tgtcggagtt gcttcagtcc 600ttattggttt tacattcatg
gggatgaatg cttctgctaa tacattacca gttaatactc 660gttgtaaatt
agaagttagt aattttcaac aaccatatat tgttaatcgt acttttatgt
720tagctaaaga agctagttta gctgataata atactgatgt tcgtttaatt
ggtgaaaaat 780tatttcgtgg tgttagtgct aaagatcaat gttatttaat
gaaacaagtt ttaaatttta 840ctttagaaga tgttttatta ccacaaagtg
atcgttttca accatatatg caagaagttg 900ttccattttt aactaaatta
agtaatcaat taagtagttg tcatattagt ggtgatgatc 960aaaatattca
aaaaaatgtt cgtcgtttaa aagaaactgt taaaaaatta ggtgaaagtg
1020gtgaaattaa agctattggt gaattagatt tattatttat gagtttacgt
aatgcttgtg 1080tttgatcttt gaaccaaaat tagaaaacca aggcttctgc
taatacattg aaacgttcaa 1140ttgaaatggc aattaaacaa attacagcac
gtgttgcttt gattgatagc caaaaagcag 1200cagttgataa agcaattact
gatattgctg aaaaattgta atttataaat aaaaatcacc 1260ttttagaggt
ggttttttta tttataaatt attcgtttga tttcgctttc gatagaacaa
1320tcaaagcgag attataaaag ccagtcatta ggcctatctg acaattcctg
aatagagttc 1380ataaacaatc cagcatgata accatcacaa acagaatgat
gtacctgtaa agatagcggt 1440aaatatattg aattaccttt attaatgaat
tttcctgctg taataatggg tagaaggtaa 1500ttactattat tattgatatt
taagttaaac ccagtaaatg aagtccaagg aataatagaa 1560agagaaaaag
cattttcagg tataggtgtt ttgggaaaca atttccccga accattatat
1620ttctctacat cagaaaggta taaatcataa aactctttga agtcattctt
tacaggagtc 1680caaataccag agaatgtttt agatacacca tcaaaaattg
tataaagtgg ctctaactta 1740tcccaataac ctaactctcc gtcgctattg
taaccagttc taaaagctgt atttgagttt 1800atcacccttg tcactaagaa
aataaatgca gggtaaaatt tatatccttc ttgttttatg 1860tttcggtata
aaacactaat atcaatttct gtggttatac taaaagtcgt ttgttggttc
1920aaataatgat taaatatctc ttttctcttc caattgtcta aatcaatttt
attaaagttc 1980atgggtttca ctctccttct acatttttta acctaataat
gccaaatacc gtttgccacc 2040cctctctttt gataattata atattggcga
aattcgcttc taaagatgaa acgcaatatt 2100atatgcttgc tttataattg
tgagcgctca caatttatgt gattatacca gccccctcac 2160tacatgtcaa
gaataaactg ccaaagcata atgtaaggaa gataaatccc ataagggcgg
2220gagcagaatg tccgagacta atgtaaattt gtccaccaat taaaggaccg
ataacgcgag 2280cttctcgagt gcatattttc ggcaatcttc tcaatgagat
gctcttcagc atgttcaatg 2340atgtcgattt tttattaaaa cgtctcaaaa
tcgtttctga gacgttttag cgtttatttc 2400gtttagttat cggcataatc
gttaaaacag gcgttatcgt agcgtaaaag cccttgagcg 2460tagcgtgctt
tgcagcgaag atgttgtctg ttagattatg aaagccgatg actgaatgaa
2520ataataagcg cagcgtcctt ctatttcggt tggaggaggc tcaagggagt
ttgagggaat 2580gaaattccct catgggtttg attttaaaaa ttgcttgcaa
ttttgccgag cggtagcgct 2640ggaaaatttt tgaaaaaaat ttggaatttg
gaaaaaaatg gggggaaagg aagcgaattt 2700tgcttccgta ctacgacccc
ccattaagtg ccgagtgcca atttttgtgc caaaaacgct 2760ctatcccaac
tggctcaagg gtttgagggg tttttcaatc gccaacgaat cgccaacgtt
2820ttcgccaacg ttttttataa atctatattt aagtagcttt attgttgttt
ttatgattac 2880aaagtgatac actaatttta taaaattatt tgattggagt
tttttaaatg gtgatttcag 2940aatcgaaaaa aagagttatg atttctctga
caaaagagca agataaaaaa ttaacagata 3000tggcgaaaca aaaaggtttt
tcaaaatctg cggttgcggc gttagctata gaagaatatg 3060caagaaagga
atcagaacaa aaaaaataag cgaaagctcg cgtttttaga aggatacgag
3120ttttcgctac ttgtttttga taaggtaata tatcatggct attaaaaata
ctaaagctag 3180aaattttgga tttttattat atcctgactc aattcctaat
gattggaaag aaaaattaga 3240gagtttgggc gtatctatgg ctgtcagtcc
tttacacgat atggacgaaa aaaaagataa 3300agatacatgg aatagtagtg
atgttatacg aaatggaaag cactataaaa aaccacacta 3360tcacgttata
tatattgcac gaaatcctgt aacaatagaa agcgttagga acaagattaa
3420gcgaaaattg gggaatagtt cagttgctca tgttgagata cttgattata
tcaaaggttc 3480atatgaatat ttgactcatg aatcaaagga cgctattgct
aagaataaac atatatacga 3540caaaaaagat attttgaaca ttaatgattt
tgatattgac cgctatataa cacttgatga 3600aagccaaaaa agagaattga
agaatttact tttagatata gtggatgact ataatttggt 3660aaatacaaaa
gatttaatgg cttttattcg ccttagggga gcggagtttg gaattttaaa
3720tacgaatgat gtaaaagata ttgtttcaac aaactctagc gcctttagat
tatggtttga 3780gggcaattat cagtgtggat atagagcaag ttatgcaaag
gttcttgatg ctgaaacggg 3840ggaaataaaa tgacaaacaa agaaaaagag
ttatttgctg aaaatgagga attaaaaaaa 3900gaaattaagg acttaaaaga
gcgtattgaa agatacagag aaatggaagt tgaattaagt 3960acaacaatag
atttattgag aggagggatt attgaataaa taaaagcccc cctgacgaaa
4020gtcgacggca atagttaccc ttattatcaa gataagaaag aaaaggattt
ttcgctacgc 4080tcaaatcctt taaaaaaaca caaaagacca cattttttaa
tgtggtcttt attcttcaac 4140taaagcaccc attagttcaa caaacgaaaa
ttggataaag tgggatattt ttaaaatata 4200tatttatgtt acagtaatat
tgacttttaa aaaaggattg attctaatga agaaagcaga 4260caagtaagcc
tcctaaattc actttagata aaaatttagg aggcatatca aatgaacgag
4320aaaaatataa aacacagtca aaactttatt acttcaaaac ataatataga
taaaataatg 4380acaaatataa gattaaatga acatgataat atctttgaaa
tcggctcagg aaaaggccat 4440tttacccttg aattagtaaa gaggtgtaat
ttcgtaactg ccattgaaat agaccataaa 4500ttatgcaaaa ctacagaaaa
taaacttgtt gatcacgata atttccaagt tttaaacaag 4560gatatattgc
agtttaaatt tcctaaaaac caatcctata aaatatatgg taatatacct
4620tataacataa gtacggatat aatacgcaaa attgtttttg atagtatagc
taatgagatt 4680tatttaatcg tggaatacgg gtttgctaaa agattattaa
atacaaaacg ctcattggca 4740ttacttttaa tggcagaagt tgatatttct
atattaagta tggttccaag agaatatttt 4800catcctaaac ctaaagtgaa
tagctcactt atcagattaa gtagaaaaaa atcaagaata 4860tcacacaaag
ataaacaaaa gtataattat ttcgttatga aatgggttaa caaagaatac
4920aagaaaatat ttacaaaaaa tcaatttaac aattccttaa aacatgcagg
aattgacgat 4980ttaaacaata ttagctttga acaattctta tctcttttca
atagctataa attatttaat 5040aagtaataat atgagataat gccgactgta
ctttttacag tcggttttct 509026500DNALactobacillus reuteri
26aatgattgaa aacaaaattg actttaatga aaaaagaaat ttgatgattt catcggttat
60tttagtaatt gggattggaa atgcctatct tcaattagga aaatatcaat tctctggatt
120agctgttgca gctgtcctcg ggataataat gaatttaatc cttccacaaa
aagccaaaag 180tgaaatgtag tttgaatttt taagcagagt aagaaaaggc
atccgacctc ttactctgct 240tttttcgtat gataacaaaa caaaaaatta
agaggtcgtg gaaaaaacag attgtaagaa 300aaagtttatc aagtctaaga
aaacgttttc tttacactct tatcaattga ttagtaggta 360tatataaacc
taattttttt tgaattttaa cgaaattaat gatatattaa cattcgtaac
420ttggggtagt tcgttttatt tgcaacgttc atccaattta caagccaaat
tattgttata 480aggaaagagg tggaatatga 50027144DNAArtificial
SequenceArtificical signal peptide in pVPL3461 27atgttatcga
agaataatcg aaaggaacaa ttccggaaac aagagccgaa aaagcaacgt 60tttgcaatta
aaaagctcac tgtcggagtt gcttcagtcc ttattggttt tacattcatg
120gggatgaatg cttctgctaa taca 14428438DNAMus musculus 28ttaccagtta
atactcgttg taaattagaa gttagtaatt ttcaacaacc atatattgtt 60aatcgtactt
ttatgttagc taaagaagct agtttagctg ataataatac tgatgttcgt
120ttaattggtg aaaaattatt tcgtggtgtt agtgctaaag atcaatgtta
tttaatgaaa 180caagttttaa attttacttt agaagatgtt ttattaccac
aaagtgatcg ttttcaacca 240tatatgcaag aagttgttcc atttttaact
aaattaagta atcaattaag tagttgtcat 300attagtggtg atgatcaaaa
tattcaaaaa aatgttcgtc gtttaaaaga aactgttaaa 360aaattaggtg
aaagtggtga aattaaagct attggtgaat tagatttatt atttatgagt
420ttacgtaatg cttgtgtt 4382970DNAArtificial SequenceInverted repeat
in pVPL3461 29aaaaattgta atttataaat aaaaatcacc ttttagaggt
ggttttttta tttataaatt 60attcgtttga 7030648DNAArtificial
SequenceChloramphenicol marker in pVPL3461 30atgaacttta ataaaattga
tttagacaat tggaagagaa aagagatatt taatcattat 60ttgaaccaac aaacgacttt
tagtataacc acagaaattg atattagtgt tttataccga 120aacataaaac
aagaaggata taaattttac cctgcattta ttttcttagt gacaagggtg
180ataaactcaa atacagcttt tagaactggt tacaatagcg acggagagtt
aggttattgg 240gataagttag agccacttta tacaattttt gatggtgtat
ctaaaacatt ctctggtatt 300tggactcctg taaagaatga cttcaaagag
ttttatgatt tatacctttc tgatgtagag 360aaatataatg gttcggggaa
attgtttccc aaaacaccta tacctgaaaa tgctttttct 420ctttctatta
ttccttggac ttcatttact gggtttaact taaatatcaa taataatagt
480aattaccttc tacccattat tacagcagga aaattcatta ataaaggtaa
ttcaatatat 540ttaccgctat ctttacaggt acatcattct gtttgtgatg
gttatcatgc tggattgttt 600atgaactcta ttcaggaatt gtcagatagg
cctaatgact ggctttta 64831211DNAArtificial SequencePhelp promoter in
pVPL3461 31cattatgctt tggcagttta ttcttgacat gtagtgaggg ggctggtata
atcacataaa 60ttgtgagcgc tcacaattat aaagcaagca tataatattg cgtttcatct
ttagaagcga 120atttcgccaa tattataatt atcaaaagag aggggtggca
aacggtattt ggcattatta 180ggttaaaaaa tgtagaagga gagtgaaacc c
21132735DNAArtificial SequenceErythromycin marker in pVPL3461
32atgaacgaga aaaatataaa acacagtcaa aactttatta cttcaaaaca taatatagat
60aaaataatga caaatataag attaaatgaa catgataata tctttgaaat cggctcagga
120aaaggccatt ttacccttga attagtaaag aggtgtaatt tcgtaactgc
cattgaaata 180gaccataaat tatgcaaaac tacagaaaat aaacttgttg
atcacgataa tttccaagtt 240ttaaacaagg atatattgca gtttaaattt
cctaaaaacc aatcctataa aatatatggt 300aatatacctt ataacataag
tacggatata atacgcaaaa ttgtttttga tagtatagct 360aatgagattt
atttaatcgt ggaatacggg tttgctaaaa gattattaaa tacaaaacgc
420tcattggcat tacttttaat ggcagaagtt gatatttcta tattaagtat
ggttccaaga 480gaatattttc atcctaaacc taaagtgaat agctcactta
tcagattaag tagaaaaaaa 540tcaagaatat cacacaaaga taaacaaaag
tataattatt tcgttatgaa atgggttaac 600aaagaataca agaaaatatt
tacaaaaaat caatttaaca attccttaaa acatgcagga 660attgacgatt
taaacaatat tagctttgaa caattcttat ctcttttcaa tagctataaa
720ttatttaata agtaa 735
* * * * *
References