U.S. patent application number 16/522500 was filed with the patent office on 2019-11-14 for methylation assay.
The applicant listed for this patent is EXACT SCIENCES DEVELOPMENT COMPANY, LLC. Invention is credited to Hatim Allawi, Michael J. Domanico, Graham P. Lidgard, Hongzhi Zou.
Application Number | 20190345567 16/522500 |
Document ID | / |
Family ID | 46048110 |
Filed Date | 2019-11-14 |
![](/patent/app/20190345567/US20190345567A1-20191114-D00001.png)
![](/patent/app/20190345567/US20190345567A1-20191114-D00002.png)
![](/patent/app/20190345567/US20190345567A1-20191114-D00003.png)
![](/patent/app/20190345567/US20190345567A1-20191114-D00004.png)
![](/patent/app/20190345567/US20190345567A1-20191114-D00005.png)
![](/patent/app/20190345567/US20190345567A1-20191114-D00006.png)
![](/patent/app/20190345567/US20190345567A1-20191114-D00007.png)
United States Patent
Application |
20190345567 |
Kind Code |
A1 |
Lidgard; Graham P. ; et
al. |
November 14, 2019 |
METHYLATION ASSAY
Abstract
A method for detecting a methylated genomic locus is provided.
In certain embodiments, the method comprises: a) treating a nucleic
acid sample that contains both unmethylated and methylated copies
of a genomic locus with an agent that modifies cytosine to uracil
to produce a treated nucleic acid; b) amplifying a product from the
treated nucleic acid using a first primer and a second primer,
wherein the first primer hybridizes to a site in the locus that
contain methylcytosines and the amplifying preferentially amplifies
the methylated copies of the genomic locus, to produce an amplified
sample; and c) detecting the presence of amplified methylated
copies of the genomic locus in the amplified sample using a flap
assay that employs an invasive oligonucleotide having a 3' terminal
G or C nucleotide that corresponds to a site of methylation in the
genomic locus.
Inventors: |
Lidgard; Graham P.;
(Madison, WI) ; Domanico; Michael J.; (Madison,
WI) ; Allawi; Hatim; (Middleton, WI) ; Zou;
Hongzhi; (Middleton, WI) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
EXACT SCIENCES DEVELOPMENT COMPANY, LLC |
Madison |
WI |
US |
|
|
Family ID: |
46048110 |
Appl. No.: |
16/522500 |
Filed: |
July 25, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14539841 |
Nov 12, 2014 |
|
|
|
16522500 |
|
|
|
|
12946745 |
Nov 15, 2010 |
8916344 |
|
|
14539841 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/686 20130101;
C12Q 2600/154 20130101; C12Q 2521/301 20130101; C12Q 2523/125
20130101; C12Q 1/6827 20130101; C12Q 1/6827 20130101; C12Q 1/6886
20130101; C12Q 2561/109 20130101 |
International
Class: |
C12Q 1/6886 20060101
C12Q001/6886; C12Q 1/6827 20060101 C12Q001/6827 |
Claims
1. A method for detecting a methylated genomic locus, comprising:
a) treating a nucleic acid sample that contains both unmethylated
and methylated copies of a genomic locus with an agent that
modifies unmethylated cytosine to uracil to produce a treated
nucleic acid; b) amplifying a product from said treated nucleic
acid using a first primer and a second primer, wherein said first
primer hybridizes to a methylated sequence in said locus and said
amplifying preferentially amplifies said methylated copies of said
genomic locus, to produce an amplified sample; and c) detecting the
presence of amplified methylated copies of said genomic locus in
said amplified sample using a flap assay that employs: i. an
invasive oligonucleotide having a 3' terminal G or C nucleotide
that corresponds to a methylated cytosine in said genomic locus and
ii. a flap oligonucleotide that comprises a G or C nucleotide at a
position that corresponds to said methylated cytosine in said
genomic locus.
2. The method of claim 1, wherein said flap probe comprises an
internal G or C nucleotide at a position that corresponds to a
second methylated cytosine in said genomic locus
3. The method of claim 1, wherein said first primer comprises an
internal G or C nucleotide at a position that corresponds to a
second methylated cytosine in said genomic locus.
4. The method of claim 1, wherein said first and second primers
both bind to sites that contain methylcytosines in said genomic
locus.
5. The method of claim 1, wherein said first primer is used as said
invasive oligonucleotide in said flap assay.
6. The method of claim 1, wherein said nucleic acid sample contains
at least 100 times more unmethylated copies of said genomic locus
than methylated copies of said genomic locus.
7. The method of claim 1, further comprising normalizing the amount
of said amplified methylated copies of said genomic locus in said
amplified sample relative to the amount of a control nucleic acid
present in said nucleic acid sample, thereby determining the amount
of methylated copies of said genomic locus in said nucleic acid
sample.
8. The method of claim 7, wherein said control nucleic acid is a
locus different from said genomic locus.
9. The method of claim 7, wherein said control nucleic acid is
detected using a flap assay that employs an invasive
oligonucleotide having a 3' terminal nucleotide that base pairs
with an A or T residue at the site of said methylated cytosine,
thereby detecting the presence of unmethlyated copies of said
genomic locus.
10. The method of claim 7, wherein the said flap assay employs
first flap assay reagents that include a first invasive
oligonucleotide, a first flap probe having a first flap and a first
FRET cassette, and wherein said control nucleic acid is detected
using second flap assay reagents that include a second invasive
oligonucleotide, a second flap probe having a second flap and a
second FRET cassette that produces a signal that is distinguishable
from the first FRET cassette, wherein the first and second flap
reagents are in same reaction mix.
11. The method of claim 1, wherein methylation of said locus is
cancer-related.
12. The method of claim 1, wherein said locus is that of BMP3,
TFPI1, NDRG4, Septin 9, TFPI2, or Vimentin.
13. The method of claim 1, wherein said sample is obtained from a
human.
14. The method of claim 13, wherein said sample is stool.
15. The method of claim 1, wherein said amplifying and detecting
steps are done using a reaction mix that contains both PCR reagents
and flap reagents, and no additional reagents are added to said
reaction mix between said amplifying and detecting steps.
16. The method of claim 15, wherein said reaction mix further
comprises PCR reagents and flap reagents for amplifying and
detecting a second genomic locus.
17. A reaction mixture comprising: a) amplification reagents
comprising a thermostable polymerase, nucleotides, a first primer
and a second primer for amplifying a target genomic locus from a
treated nucleic acid sample; wherein: i. said first primer
hybridizes to a methylated sequence in said locus and optionally
contains a 3' terminal G or C nucleotide that corresponds to a
methylated cytosine in said genomic locus; and ii. said reagents
preferentially amplify methylated copies of said genomic locus, to
produce an amplified sample; b) flap assay reagents comprising a
flap endonuclease, a FRET cassette, a flap oligonucleotide and, if
said first primer does not contain said 3' terminal nucleotide, an
invasive oligonucleotide distinct from said first primer, wherein
i. said invasive oligonucleotide has a 3' terminal G or C
nucleotide that corresponds to a methylated cytosine in said
genomic locus and ii. said a flap oligonucleotide comprises a G or
C nucleotide at a position that corresponds to said methylated
cytosine; and c) said treated nucleic acid sample, wherein said
treated nucleic acid sample is made by treating an initial nucleic
acid sample comprising both methylated copies and methylated copies
of said genomic locus with an agent that modifies unmethylated
cytosine to uracil; wherein said reaction mixture is characterized
in that it can amplify and detect the presence of methylated copies
of said genomic locus in said sample.
18. The reaction mixture of claim 17, wherein said flap probe
comprises an internal G or C nucleotide at a position that
corresponds to a second methylated cytosine in said genomic
locus.
19. The reaction mixture of claim 17, wherein said first primer
comprises an internal G or C nucleotide at a position that
corresponds to a second methylated cytosine in said genomic
locus.
20. The reaction mixture of claim 17, wherein said first and second
primers both hybridize to a methylated sequence in said genomic
locus.
21. The reaction mixture of claim 17, wherein: i. said first primer
contains a 3' terminal nucleotide that base pairs with a methylated
cytosine in said methylated sequence; and ii. said flap assay
reagents do not comprise said invasive oligonucleotide.
22. The reaction mixture of claim 17, wherein: i. said first primer
does not contain a 3' terminal nucleotide that base pairs with a
methylated cytosine in said methylated sequence; and ii. said flap
assay reagents comprise said invasive oligonucleotide.
23. The reaction mixture of claim 17, wherein: the reaction mixture
comprises a first primer and an invasive oligonucleotide that each
contain a 3' terminal nucleotide that base pairs with a methylated
cytosine in said genomic locus, wherein the 3' terminal nucleotide
of said first primer and the 3' terminal nucleotide of said
invasive oligonucleotide base pair with different methylated sites
in said genomic locus.
24. A kit comprising: a) PCR reagents that include a first primer
and a second primer, where the first primer hybridizes to a
methylated sequence in the genomic locus and optionally contains a
3' terminal G or C nucleotide that corresponds to a methylated
cytosine in the methylated sequence; and b) flap assay reagents
comprising a flap endonuclease, a FRET cassette and, if the first
primer does not contain said 3' terminal nucleotide, an invasive
oligonucleotide having a 3' terminal G or C nucleotide that
corresponds to a site of methylation in the genomic locus.
25. The kit of claim 24, further comprising instructions for
performing the method of claim 1.
Description
BACKGROUND
[0001] The methylation of cytosine residues in DNA is an important
epigenetic alteration in eukaryotes. In humans and other mammals
methylcytosine is found almost exclusively in cytosine-guanine
(CpG) dinucleotides. DNA methylation plays an important role in
gene regulation and changes in methylation patterns are involved in
human cancers and certain human diseases. Among the earliest and
most common genetic alterations observed in human malignancies is
the aberrant methylation of CpG islands, particularly CpG islands
located within the 5' regulatory regions of genes, causing
alterations in the expression of such genes. Consequently, there is
great interest in using DNA methylation markers as diagnostic
indicators for early detection, risk assessment, therapeutic
evaluation, recurrence monitoring, and the like. There is also
great scientific interest in DNA methylation for studying
embryogenesis, cellular differentiation, transgene expression,
transcriptional regulation, and maintenance methylation, among
other things.
[0002] This disclosure relates to the detection of methylated DNA
in a sample.
SUMMARY
[0003] A method for detecting a methylated genomic locus is
provided. In certain embodiments, the method comprises: a) treating
a nucleic acid sample that contains both unmethylated and
methylated copies of a genomic locus with an agent that modifies
cytosine to uracil to produce a treated nucleic acid; b) amplifying
a product from the treated nucleic acid using a first primer and a
second primer, wherein the first primer hybridizes to a site in the
locus that contain methylcytosines and the amplifying
preferentially amplifies the methylated copies of the genomic
locus, to produce an amplified sample; and c) detecting the
presence of amplified methylated copies of the genomic locus in the
amplified sample using a flap assay that employs an invasive
oligonucleotide having a 3' terminal G or C nucleotide that
corresponds to a site of methylation in the genomic locus.
BRIEF DESCRIPTION OF THE FIGURES
[0004] FIG. 1 schematically illustrates some of the general
principles of a flap assay.
[0005] FIG. 2 schematically illustrates one embodiment of the
subject method.
[0006] FIG. 3 show the nucleotide sequences of methylated and
unmethylated copies of a fragment of the human vimentin gene (VIM),
before and after bisulfite treatment.
[0007] FIG. 4 shows the nucleotide sequences of an exemplary
forward primer, an exemplary reverse primer, and an exemplary flap
oligonucleotide, aligned with the fragments shown in FIG. 3. The
nucleotide sequences shown in FIG. 4 are set forth in the sequence
listing as VIM unmethylated (SEQ ID NO:18), VIM methylated (SEQ ID
NO:19), SEQ ID NO:13 (forward primer), SEQ ID NO:15 (flap probe),
and SEQ ID NO: 14 (reverse primer).
[0008] FIGS. 5 to 7 each provide data that is described in greater
detail in the Examples section of this application.
DEFINITIONS
[0009] The term "sample" as used herein relates to a material or
mixture of materials, typically, although not necessarily, in
liquid form, containing one or more analytes of interest.
[0010] The term "nucleotide" is intended to include those moieties
that contain not only the known purine and pyrimidine bases, but
also other heterocyclic bases that have been modified. Such
modifications include methylated purines or pyrimidines, acylated
purines or pyrimidines, alkylated riboses or other heterocycles. In
addition, the term "nucleotide" includes those moieties that
contain hapten or fluorescent labels and may contain not only
conventional ribose and deoxyribose sugars, but other sugars as
well. Modified nucleosides or nucleotides also include
modifications on the sugar moiety, e.g., wherein one or more of the
hydroxyl groups are replaced with halogen atoms or aliphatic
groups, are functionalized as ethers, amines, or the like.
[0011] The term "nucleic acid" and "polynucleotide" are used
interchangeably herein to describe a polymer of any length, e.g.,
greater than about 2 bases, greater than about 10 bases, greater
than about 100 bases, greater than about 500 bases, greater than
1000 bases, up to about 10,000 or more bases composed of
nucleotides, e.g., deoxyribonucleotides or ribonucleotides, and may
be produced enzymatically or synthetically (e.g., PNA as described
in U.S. Pat. No. 5,948,902 and the references cited therein) which
can hybridize with naturally occurring nucleic acids in a sequence
specific manner analogous to that of two naturally occurring
nucleic acids, e.g., can participate in Watson-Crick base pairing
interactions. Naturally-occurring nucleotides include guanine,
cytosine, adenine and thymine (G, C, A and T, respectively).
[0012] The term "nucleic acid sample," as used herein denotes a
sample containing nucleic acid.
[0013] The term "target polynucleotide," as used herein, refers to
a polynucleotide of interest under study. In certain embodiments, a
target polynucleotide contains one or more target sites that are of
interest under study.
[0014] The term "oligonucleotide" as used herein denotes a single
stranded multimer of nucleotides of about 2 to 200 nucleotides.
Oligonucleotides may be synthetic or may be made enzymatically,
and, in some embodiments, are 10 to 50 nucleotides in length.
Oligonucleotides may contain ribonucleotide monomers (i.e., may be
oligoribonucleotides) or deoxyribonucleotide monomers. An
oligonucleotide may be 10 to 20, 11 to 30, 31 to 40, 41 to 50, 51
to 60, 61 to 70, 71 to 80, 80 to 100, 100 to 150 or 150 to 200
nucleotides in length, for example.
[0015] The term "duplex," or "duplexed," as used herein, describes
two complementary polynucleotides that are base-paired, i.e.,
hybridized together.
[0016] The term "primer" as used herein refers to an
oligonucleotide that has a nucleotide sequence that is
complementary to a region of a target polynucleotide. A primer
binds to the complementary region and is extended, using the target
nucleic acid as the template, under primer extension conditions. A
primer may be in the range of about 15 to about 50 nucleotides
although primers outside of this length may be used. A primer can
be extended from its 3' end by the action of a polymerase. An
oligonucleotide that cannot be extended from its 3' end by the
action of a polymerase is not a primer.
[0017] The term "extending" as used herein refers to any addition
of one or more nucleotides to the 3' end of a nucleic acid, e.g. by
ligation of an oligonucleotide or by using a polymerase.
[0018] The term "amplifying" as used herein refers to generating
one or more copies of a target nucleic acid, using the target
nucleic acid as a template.
[0019] The term "denaturing," as used herein, refers to the
separation of a nucleic acid duplex into two single strands.
[0020] The terms "determining", "measuring", "evaluating",
"assessing," "assaying," `detecting," and "analyzing" are used
interchangeably herein to refer to any form of measurement, and
include determining if an element is present or not. These terms
include both quantitative and/or qualitative determinations.
Assessing may be relative or absolute. "Assessing the presence of"
includes determining the amount of something present, as well as
determining whether it is present or absent.
[0021] The term "using" has its conventional meaning, and, as such,
means employing, e.g., putting into service, a method or
composition to attain an end.
[0022] As used herein, the term "T.sub.m" refers to the melting
temperature of an oligonucleotide duplex at which half of the
duplexes remain hybridized and half of the duplexes dissociate into
single strands. The T.sub.m of an oligonucleotide duplex may be
experimentally determined or predicted using the following formula
T.sub.m=81.5+16.6(log.sub.10[Na.sup.+])+0.41 (fraction G+C)-(60/N),
where N is the chain length and [Na.sup.+] is less than 1 M. See
Sambrook and Russell (2001; Molecular Cloning: A Laboratory Manual,
3.sup.rd ed., Cold Spring Harbor Press, Cold Spring Harbor N.Y.,
ch. 10). Other formulas for predicting T.sub.m of oligonucleotide
duplexes exist and one formula may be more or less appropriate for
a given condition or set of conditions.
[0023] As used herein, the term "T.sub.m-matched" refers to a
plurality of nucleic acid duplexes having T.sub.ms that are within
a defined range, e.g., within 5.degree. C. or 10.degree. C. of each
other.
[0024] As used herein, the term "reaction mixture" refers to a
mixture of reagents that are capable of reacting together to
produce a product in appropriate external conditions over a period
of time. A reaction mixture may contain PCR reagents and flap
cleavage reagents, for example, the recipes for which are
independently known in the art.
[0025] The term "mixture", as used herein, refers to a combination
of elements, that are interspersed and not in any particular order.
A mixture is heterogeneous and not spatially separable into its
different constituents. Examples of mixtures of elements include a
number of different elements that are dissolved in the same aqueous
solution, or a number of different elements attached to a solid
support at random or in no particular order in which the different
elements are not spatially distinct. A mixture is not addressable.
To illustrate by example, an array of spatially separated
surface-bound polynucleotides, as is commonly known in the art, is
not a mixture of surface-bound polynucleotides because the species
of surface-bound polynucleotides are spatially distinct and the
array is addressable.
[0026] As used herein, the term "PCR reagents" refers to all
reagents that are required for performing a polymerase chain
reaction (PCR) on a template. As is known in the art, PCR reagents
essentially include a first primer, a second primer, a thermostable
polymerase, and nucleotides. Depending on the polymerase used, ions
(e.g., Mg.sup.2+) may also be present. PCR reagents may optionally
contain a template from which a target sequence can be
amplified.
[0027] As used herein, the term "flap assay" refers to an assay in
which a flap oligonucleotide is cleaved in an overlap-dependent
manner by a flap endonuclease to release a flap that is then
detected. The principles of flap assays are well known and
described in, e.g., Lyamichev et al. (Nat. Biotechnol. 1999
17:292-296), Ryan et al (Mol. Diagn. 1999 4:135-44) and Allawi et
al (J Clin Microbiol. 2006 44: 3443-3447). For the sake of clarity,
certain reagents that are employed in a flap assay are described
below. The principles of a flap assay are illustrated in FIG. 1. In
the flap assay shown in FIG. 1, an invasive oligonucleotide 2 and
flap oligonucleotide 4 are hybridized to target 6 to produce a
first complex 8 that contains a nucleotide overlap at position 10.
First complex 8 is a substrate for flap endonuclease. Flap
endonuclease 12 cleaves flap oligonucleotide 4 to release a flap 14
that hybridizes with FRET cassette 16 that contains a quencher "Q"
and a nearby quenched flourophore "R" that is quenched by the
quencher Q. Hybridization of flap 14 to FRET cassette 16 results in
a second complex 18 that contains a nucleotide overlap at position
20. The second complex is also a substrate for flap endonuclease.
Cleavage of FRET cassette 16 by flap endonuclease 12 results in
release of the fluorophore 22, which produces a fluorescent signal.
These components are described in greater detail below.
[0028] As used herein, the term "invasive oligonucleotide" refers
to an oligonucleotide that is complementary to a region in a target
nucleic acid. The 3' terminal nucleotide of the invasive
oligonucleotide may or may not base pair a nucleotide in the target
(e.g., which may be 5-methylcytosine or uracil, for example).
[0029] As used herein, the term "flap oligonucleotide" refers to an
oligonucleotide that contains a flap region and a region that is
complementary to a region in the target nucleic acid. The target
complementary regions on the invasive oligonucleotide and the flap
oligonucleotide overlap by a single nucleotide such that, when they
are annealed to the target nucleic acid, the complementary
sequences overlap. As is known, if: a) the 3' terminal nucleotide
of the invasive nucleotide and b) the nucleotide that overlaps with
that nucleotide in the flap oligonucleotide both base pair with a
nucleotide in the target nucleic acid, then a particular structure
is formed. This structure is a substrate for an enzyme, defined
below as a flap endonuclease, that cleaves the flap from the target
complementary region of the flap oligonucleotide. If the 3'
terminal nucleotide of the invasive oligonucleotide does not base
pair with a nucleotide in the target nucleic acid, or if the
overlap nucleotide in the flap oligonucleotide does not base pair
with a nucleotide in the target nucleic acid, the complex is not a
substrate for the enzyme.
[0030] The term "flap endonuclease" or "FEN" for short, as used
herein, refers to a class of nucleolytic enzymes that act as
structure specific endonucleases on DNA structures with a duplex
containing a single stranded 5' overhang, or flap, on one of the
strands that is displaced by another strand of nucleic acid, i.e.,
such that there are overlapping nucleotides at the junction between
the single and double-stranded DNA. FENs catalyze hydrolytic
cleavage of the phosphodiester bond at the junction of single and
double stranded DNA, releasing the overhang, or the flap. Flap
endonucleases are reviewed by Ceska and Savers (Trends Biochem.
Sci. 1998 23:331-336) and Liu et al (Annu. Rev. Biochem. 2004 73:
589-615). FENs may be individual enzymes, multi-subunit enzymes, or
may exist as an activity of another enzyme or protein complex,
e.g., a DNA polymerase. A flap endonuclease may be
thermostable.
[0031] As used herein, the term "cleaved flap" refers to a
single-stranded oligonucleotide that is a cleavage product of a
flap assay.
[0032] As used herein, the term "FRET cassette" refers to a hairpin
oligonucleotide that contains a fluorophore moiety and a nearby
quencher moiety that quenches the fluorophore. Hybridization of a
cleaved flap with a FRET cassette produces a secondary substrate
for the flap endonuclease. Once this substrate is formed, the 5'
fluorophore-containing base is cleaved from the cassette, thereby
generating a fluorescence signal.
[0033] As used herein, the term "flap assay reagents" refers to all
reagents that are required for performing a flap assay on a
substrate. As is known in the art, flap assays include an invasive
oligonucleotide, a flap oligonucleotide, a flap endonuclease and a
FRET cassette, as described above. Flap assay reagents may
optionally contain a target to which the invasive oligonucleotide
and flap oligonucleotide bind.
[0034] As used herein, the term "genomic locus" refers to a defined
region in a genome. A genomic locus exists at the same location in
the genomes of different cells from the same individual, or in
different individuals. A genomic locus in one cell or individual
has a nucleotide sequence that is identical or very similar (i.e.,
more than 99% identical) to the same genomic locus in a different
cell or individual. The difference in nucleotide sequence between
the same locus in different cells or individuals may be due to one
or more nucleotide substitutions. A genomic locus may be defined by
genomic coordinates, by name, or using a symbol. A genomic locus in
a nucleic acid sample that has been treated with an agent that
modifies unmethylated cytosine to uracil has the same sequence as
the genomic locus in an unmethylated sample, except that
unmethylated cytosines in the sequence (but not methylated
cytosines) are modified to be become uracils. In amplified copies
of a genomic locus in a nucleic acid sample that has been treated
with such an agent, the uracil is converted to thymine.
[0035] As used herein, the term "methylation state" refers to the
presence or absence of a methyl group on a cytosine residue at a
site of methylation. For clarity, a cytosine that is unmethylated
will be referred to as "unmethylated cytosine" or "unmethylated C",
and a cytosine that is methylated (i.e., 5-methylcytosine) will be
referred to as "methylated cytosine," "methylated C," or "methyl
C."
[0036] As used herein, a "site of methylation" refers to the
position of a cytosine nucleotide that is known to be at least
sometimes methylated in a genomic locus. The cytosine at a site of
methylation can be an unmethylated cytosine or a methylated
cytosine. In other words, the term "site of methylation" refers to
a specific cytosine in a genomic locus, the methylation state of
which is sought to be determined. The site of methylation may be
defined by genomic coordinates, or coordinates relative to the
start codon of a gene, for example.
[0037] As will be described in greater detail below, certain
embodiments of the subject method involve treating a nucleic acid
sample with an agent that specifically converts unmethylated
cytosine to uracil by deamination. Therefore, in an untreated
sample, the site of methylation will occupied by an unmethylated
cytosine or a methylated cytosine, depending on the methylation
status of that site. Likewise, the site of methylation in a treated
sample will be occupied by a methylated cytosine or a uracil,
depending on the methylation status of that site in the sample
prior to treatment.
[0038] The term "corresponds to" and grammatical equivalents, e.g.,
"corresponding", as used herein refers to a specific relationship
between the elements to which the term refers. For example, an
oligonucleotide that corresponds to a sequence in a longer nucleic
acid contains the same nucleotide sequence as or is complementary
to a nucleotide sequence in the nucleic acid.
[0039] In the context of a nucleotide in an oligonucleotide that
corresponds to a site of methylation or a nucleotide in an
oligonucleotide that corresponds to a methylated cytosine, the term
"corresponds to" and grammatical equivalents thereof are intended
to identify the nucleotide that is correspondingly positioned
relative to (i.e., positioned across from) a site of methylation
when the two nucleic acids (e.g., an oligonucleotide and genomic
DNA containing a methylated cytosine) are aligned or base paired.
Again, unless otherwise indicated (e.g., in the case of a
nucleotide that "does not base pair" or "base pairs" with a
particular residue) a nucleotide that "corresponds to" a site of
methylation base pairs with either a methylated site or an
unmethylated site. For clarity, in an oligonucleotide, a G or C
nucleotide at a position that corresponds to a methylated cytosine
in a sequence, e.g., a genomic locus, can: a) base pair with a
methylated cytosine in the sequence, b) base pair a cytosine that
positionally corresponds to the methylated cytosine in an amplified
version of the sequence, or c) base pair with a G residue that is
complementary to such a cytosine in an amplified sequence.
[0040] As will be described in greater detail below, the subject
method may also involve amplifying a nucleic acid product sample
that has been treated with an agent that specifically converts
unmethylated cytosine to uracil (see, for example, Frommer et a.
Proc. Natl. Acad. Sci. 1992 89:1827-1831). As a result of the
amplification step, methylated cytosines are converted to
cytosines, and uracils are converted to thymines. The methylation
state of a cytosine nucleotide in the initial sample can therefore
be evaluated by determining whether a base-pair in the
amplification product that is at the same position as the cytosine
in question is a C/G base pair (which indicates that the cytosine
in question is methylated) or an A/T base pair (which indicates
that the cytosine residue is unmethylated). Thus, the methylation
status of a cytosine in an initial sample can be determined by
amplifying a double stranded product from a sample that has been
treated with an agent that specifically converts unmethylated
cytosine to uracil, and then examining the position corresponding
to the target cytosine in either of the strands (i.e., either the
top strand or the bottom strand) of the amplification product to
determine whether an A or T is present (which indicates that the
cytosine in question is methylated), or if a G or C is present
(which indicates that the cytosine in question is methylated).
Thus, in the context of an oligonucleotide that hybridizes to a
double stranded amplification product produced by amplification of
a genomic locus from a sample that has been treated with an agent
that specifically converts unmethylated cytosine to uracil, a
nucleotide that "corresponds to" a site of methylation is a
nucleotide that base pairs with either the top strand or the bottom
strand at the site of methylation.
[0041] As used herein, a "sequence that is methylated" is a
nucleotide sequence that contains a site of methylation, i.e., a
cytosine nucleotide that is known to be at least sometimes
methylated.
[0042] As used herein, the term "unmethylated", with reference a
nucleotide sequence, refers to the copies of a sequence that are
not methylated.
[0043] As used herein, the term "methylated", with reference a
nucleotide sequence, refers to copies of a sequence that contain
5-methylcytosine. Methylation of a genomic locus may, e.g., alter
the expression of a protein, which causes a phenotypic change
(e.g., a cancer-related phenotype) in the cells that have such a
methylated locus. Alternatively, methylation of a genomic locus may
be silent.
[0044] A sample that comprises "both unmethylated and methylated
copies of a genomic locus" and grammatical equivalents thereof,
refers to a sample that contains multiple DNA molecules of the same
genomic locus, where the sample contains both unmethylated copies
of the genomic locus and methylated copies of the same locus. In
this context, the term "copies" is not intended to mean that the
sequences were copied from one another. Rather, the term "copies"
in intended to indicate that the sequences are of the same locus in
different cells or individuals. In other words, a sample contains a
mixture of nucleic acid molecules having the same nucleotide
sequence, except that some of the molecules contain methylated
cytosine residues.
[0045] As used herein, the term "degree of methylation" refers to
the relative number, percentage, or fraction of members of a
particular target nucleotide species within a sample that are
methylated compared to those members of that particular target
nucleotide species that are not methylated.
[0046] As used herein, the term "an agent that modifies
unmethylated cytosine to uracil" refers to any agent that
specifically deaminates unmethlyated cytosine to produce uracil.
Such agents are specific in that they do not deaminate
5-methylcytosine to produce uracil. Bisulfite is an example of such
an agent.
[0047] As used herein, the term "a treated nucleic acid sample" is
a nucleic acid sample that has been treated with an agent that
modifies unmethylated cytosine to uracil.
[0048] As used herein, the term "initial sample" refers to a sample
that has not been treated with an agent that modifies unmethylated
cytosine to uracil
[0049] As used herein the term "nucleotide sequence" refers to a
contiguous sequence of nucleotides in a nucleic acid. As would be
readily apparent, the number of nucleotides in a nucleotide
sequence may vary greatly. In particular embodiments, a nucleotide
sequence (e.g., of an oligonucleotide) may be of a length that is
sufficient for hybridization to a complementary nucleotide sequence
in another nucleic acid. In these embodiments, a nucleotide
sequence may be in the range of at least 10 to 50 nucleotides,
e.g., 12 to 20 nucleotides in length, although lengths outside of
these ranges may be employed in many circumstances.
[0050] As used herein the term "fully complementary to" in the
context of a first nucleic acid that is fully complementary to a
second nucleic acid refers to a case when every nucleotide of a
contiguous sequence of nucleotides in a first nucleic acid base
pairs with a complementary nucleotide in a second nucleic acid.
[0051] As used herein the term a "primer pair" is used to refer to
two primers that can be employed in a polymerase chain reaction to
amplify a genomic locus. A primer pair may in certain circumstances
be referred to as containing "a first primer" and "a second primer"
or "a forward primer" and "a reverse primer". Use of any of these
terms is arbitrary and is not intended to indicate whether a primer
hybridizes to a top strand or bottom strand of a double stranded
nucleic acid.
[0052] A "CpG" island is defined as a region of DNA of greater than
500 bp with a G/C content of at least 55% and an observed
CpG/expected CpG ratio of at least 0.65, as defined by Takai et al
Proc. Natl. Acad. Sci. 2002 99: 3740-3745). Use of this formula to
identify CpG islands excludes other GC-rich genomic sequences such
as Alu repeats.
DESCRIPTION OF EXEMPLARY EMBODIMENTS
[0053] Before the present invention is described in greater detail,
it is to be understood that this invention is not limited to
particular embodiments described, as such may, of course, vary. It
is also to be understood that the terminology used herein is for
the purpose of describing particular embodiments only, and is not
intended to be limiting, since the scope of the present invention
will be limited only by the appended claims.
[0054] Where a range of values is provided, it is understood that
each intervening value, to the tenth of the unit of the lower limit
unless the context clearly dictates otherwise, between the upper
and lower limit of that range and any other stated or intervening
value in that stated range, is encompassed within the invention.
The upper and lower limits of these smaller ranges may
independently be included in the smaller ranges and are also
encompassed within the invention, subject to any specifically
excluded limit in the stated range. Where the stated range includes
one or both of the limits, ranges excluding either or both of those
included limits are also included in the invention.
[0055] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can also be used in the practice or testing of the present
invention, the preferred methods and materials are now
described.
[0056] All publications and patents cited in this specification are
herein incorporated by reference as if each individual publication
or patent were specifically and individually indicated to be
incorporated by reference and are incorporated herein by reference
to disclose and describe the methods and/or materials in connection
with which the publications are cited. The citation of any
publication is for its disclosure prior to the filing date and
should not be construed as an admission that the present invention
is not entitled to antedate such publication by virtue of prior
invention. Further, the dates of publication provided may be
different from the actual publication dates which may need to be
independently confirmed.
[0057] It must be noted that as used herein and in the appended
claims, the singular forms "a", "an", and "the" include plural
referents unless the context clearly dictates otherwise. It is
further noted that the claims may be drafted to exclude any
optional element. As such, this statement is intended to serve as
antecedent basis for use of such exclusive terminology as "solely,"
"only" and the like in connection with the recitation of claim
elements, or use of a "negative" limitation.
[0058] As will be apparent to those of skill in the art upon
reading this disclosure, each of the individual embodiments
described and illustrated herein has discrete components and
features which may be readily separated from or combined with the
features of any of the other several embodiments without departing
from the scope or spirit of the present invention. Any recited
method can be carried out in the order of events recited or in any
other order which is logically possible.
[0059] In the following description, the skilled artisan will
understand that any of a number of polymerases and flap
endonucleases could be used in the methods, including without
limitation, those isolated from thermostable or hyperthermostable
prokaryotic, eukaryotic, or archaeal organisms. The skilled artisan
will also understand that the enzymes that are used in the method,
e.g., polymerase and flap endonuclease, include not only naturally
occurring enzymes, but also recombinant enzymes that include
enzymatically active fragments, cleavage products, mutants, and
variants of wild type enzymes.
[0060] In further describing the method, the reagent mixture used
in the method will be described first, followed by a description of
the method by which a sample may be treated and the reaction
conditions that may be used in the method.
[0061] Reaction Mixture
[0062] The reaction mixture may vary depending how the reaction is
performed, e.g., whether, for example, one or both of the first and
second primers hybridize to methylated sequences, or whether the
first primer (which is used for amplification of a genomic locus)
is also employed as an invasive oligonucleotide in the flap assay,
in which case no distinct invasive oligonucleotide need be included
in the assay mixture.
[0063] In general terms, the reaction mixture used in the method
may generally contain: a) amplification reagents comprising a
thermostable polymerase, nucleotides, a first primer and a second
primer for amplifying a target genomic locus from a treated nucleic
acid sample; wherein: i. the first primer hybridizes to a
methylated sequence in the genomic locus and optionally contains a
3' G or C terminal nucleotide that corresponds to a methylated
cytosine in the genomic locus; and ii. the reagents preferentially
amplify methylated copies of the genomic locus, to produce an
amplified sample; b) flap assay reagents comprising a flap
endonuclease, a FRET cassette, a flap oligonucleotide and, if the
first primer does not contain a 3' terminal nucleotide that
corresponds to the methylated cytosine, an invasive
oligonucleotide, that is distinct from the first primer, that has a
3' terminal G or C nucleotide that corresponds to the methylated
cytosine; and c) the treated nucleic acid sample, wherein the
treated nucleic acid sample is made by treating an initial nucleic
acid sample comprising both methylated copies and unmethylated
copies of the genomic locus with an agent that modifies
unmethylated cytosine to uracil. The flap oligonucleotide contains
a G or C nucleotide at a position that corresponds to the
methylated cytosine. The reaction mixture is characterized in that
it can amplify and detect the presence of methylated copies of the
genomic locus in the sample.
[0064] As noted above, the amplification generally employs a first
primer that hybridizes to a methylated sequence in a genomic locus
and preferentially amplifies methylated copies of the genomic
locus. In certain embodiments, the first primer may contain one or
more nucleotides (e.g., G residues) that base pair with
corresponding methylated cytosine nucleotides in the methylated
sequence (which would have been converted to a uracil if they were
unmethylated). In particular embodiments, the first primer may
contain up to 3 or 4 nucleotides that base pair with corresponding
methylated cytosines in a methylated sequence, particularly toward
the 3' end of the primer thereby making the primer a methylation
specific primer in that it preferentially amplifies methylated
copies of the genomic locus. In one embodiment, the primer may
contain a 3' terminal nucleotide that base pairs with a methylated
cytosine in the methylated sequence, or base pairs with a G residue
in an amplicon complementary to a methylated cytosine, as well as
1, 2 or 3 further nucleotides that base pair with other methylated
cytosines or their complements in the sequence. Thus, the first
primer may contain one or more internal G or C nucleotides at
positions that correspond to a corresponding number of second
methylated cytosine in the genomic locus.
[0065] While thereby preferential amplification of methylated
copies of a genomic locus may be done using a pair of primers in
which only one of the primers is methylation specific, in
particular embodiments, both the first and second primers may be
methylation-specific in that they both hybridize to methylated
sequences in the genomic locus.
[0066] The design of the methylation-specific primers that may be
present in the reaction mixture may be adapted from, e.g., the
primer design methods described by, e.g., Herman et al
(Methylation-specific PCR: a novel PCR assay for methylation status
of CpG islands. Proc. Natl. Acad. Sci. 1996 93: 9821-6) and Ehrich
et al (Quantitative high-throughput analysis of DNA methylation
patterns by base-specific cleavage and mass spectrometry. Proc.
Natl. Acad. Sci. 2005 102: 15785-90), as well as those reviewed in
Li (Designing PCR primer for DNA methylation mapping. Methods Mol
Biol. 2007 402: 371-84), Derks et al (Methylation-specific PCR
unraveled. Cell Oncol. 2004 26:291-9) and Cottrell et al (Sensitive
detection of DNA methylation. Ann N Y Acad. Sci. 2003 983:120-30).
Since the identities of many if not most CpG islands in the human
and other genomes are known, (see, e.g., Lauss et al Br. J. Cancer.
MethCancerDB--aberrant DNA methylation in human cancer 2008 98:
816-817; Wang et al Bioinformatics, An evaluation of new criteria
for CpG islands in the human genome as gene markers 2003 20:
1170-1177) the design of methylation-specific primers for analysis
of a number of different genomic loci may be done without undue
effort.
[0067] As noted above, the presence of distinct invasive
oligonucleotides in the reaction mixture may depend on whether the
first primer is also employed as an invasive oligonucleotide in the
flap assay. As such, in some embodiments, the first primer contains
a 3' terminal nucleotide that base pairs with a methylated cytosine
in the sequence to which the primer binds. In these embodiments,
the first primer may be employed as an invasive oligonucleotide in
the flap assay and, as such, the reaction mixture need not contain
an invasive oligonucleotide in addition to the first primer. In
other embodiments, the first primer does not contain a 3' terminal
nucleotide that base pairs with a methylated cytosine in the
methylated sequence. In these embodiments, the reaction mixture may
contain a distinct invasive oligonucleotide that contains a 3'
terminal G or C nucleotide that corresponds to the site of
methylation. In these embodiments, the 3' terminal nucleotide of
the invasive oligonucleotide may base pair with a site of
methylation that is internal to the sequences of the primers in the
amplification product.
[0068] In alternative embodiments, the reaction mixture may
comprise a first primer that contains a 3' terminal nucleotide that
base pairs with a methylated cytosine or its complement in the
genomic locus as well as an invasive oligonucleotide that contains
a 3' terminal G or C nucleotide that corresponds to the site of
methylation. In these embodiments, the 3' terminal nucleotide of
the first primer and the 3' terminal nucleotide of the invasive
oligonucleotide base pair with nucleotides at different sites of
methylation in the genomic locus. In one embodiment, the 3'
terminal nucleotide of the invasive oligonucleotide base pairs with
a site of methylation that is internal to the sequences of the
primers in the amplification product.
[0069] In particular embodiments, a separate invasive
oligonucleotide may contain other nucleotides (e.g., G or C
nucleotides) in addition to the 3' terminal nucleotide that base
pair with nucleotides at other sites of methylation. In other
words, a separate invasive oligonucleotides may contain one or more
(e.g., 1, 2, 3 or 4 or more) internal G or C nucleotides that
correspond to methylated cytosines. These internal nucleotides
increase the specificity of binding of the invasive oligonucleotide
to nucleic acid that has been amplified from methylated copies of
the genomic locus, thereby increasing the fidelity of detection. In
a similar manner, the portion of the flap oligonucleotide that
hybridizes to the amplification product may contain one or more
(e.g., 1, 2, 3 or 4 or more) internal G or C nucleotides that
correspond to methylated cytosines, which serve to increase the
specificity of binding of the flap oligonucleotide to nucleic acid
that has been amplified from methylated copies of the genomic
locus, thereby increasing the fidelity of detection. Thus, in some
embodiments, the flap oligonucleotide may contain one or more
internal G or C nucleotide positions that corresponds to a
corresponding number of second methylated cytosines in the genomic
locus.
[0070] The exact identities and concentrations of the reagents
present in the reaction mixture may be similar to or the same as
those independently employed in PCR and flap cleavage assays, with
the exception that the reaction mixture contains Mg.sup.2+ at a
concentration that is higher than employed in conventional PCR
reaction mixtures (which contain Mg.sup.2+ at a concentration of
between about 1.8 mM and 3 mM). In certain embodiments, the
reaction mixture described herein contains Mg.sup.2+ at a
concentration of 4 mM to 10 mM, e.g., 6 mM to 9 mM. Exemplary
reaction buffers and DNA polymerases that may be employed in the
subject reaction mixture include those described in various
publications (e.g., Ausubel, et al., Short Protocols in Molecular
Biology, 3rd ed., Wiley & Sons 1995 and Sambrook et al.,
Molecular Cloning: A Laboratory Manual, Third Edition, 2001 Cold
Spring Harbor, N.Y.). Reaction buffers and DNA polymerases suitable
for PCR may be purchased from a variety of suppliers, e.g.,
Invitrogen (Carlsbad, Calif.), Qiagen (Valencia, Calif.) and
Stratagene (La Jolla, Calif.). Exemplary polymerases include Taq,
Pfu, Pwo, UlTma and Vent, although many other polymerases may be
employed in certain embodiments. Guidance for the reaction
components suitable for use with a polymerase as well as suitable
conditions for their use is found in the literature supplied with
the polymerase. Primer design is described in a variety of
publications, e.g., Diffenbach and Dveksler (PCR Primer, A
Laboratory Manual, Cold Spring Harbor Press 1995); R. Rapley, (The
Nucleic Acid Protocols Handbook (2000), Humana Press, Totowa,
N.J.); Schena and Kwok et al., Nucl. Acid Res. 1990 18:999-1005).
Primer and probe design software programs are also commercially
available, including without limitation, Primer Detective
(ClonTech, Palo Alto, Calif.), Lasergene, (DNASTAR, Inc., Madison,
Wis.), Oligo software (National Biosciences, Inc., Plymouth,
Minn.), and iOligo (Caesar Software, Portsmouth, N.H).
[0071] Exemplary flap cleavage assay reagents are found in
Lyamichev et al. (Nat. Biotechnol. 1999 17:292-296), Ryan et al
(Mol. Diagn. 1999 4:135-44) and Allawi et al (J Clin Microbiol.
2006 44: 3443-3447). Appropriate conditions for flap endonuclease
reactions are either known or can be readily determined using
methods known in the art (see, e.g., Kaiser et al., J. Biol. Chem.
274:21387-94, 1999). Exemplary flap endonucleases that may be used
in the method include, without limitation, Thermus aquaticus DNA
polymerase I, Thermus thermophilus DNA polymerase I, mammalian
FEN-1, Archaeoglobus fulgidus FEN-1, Methanococcus jannaschii
FEN-1, Pyrococcus furiosus FEN-1, Methanobacterium
thermoautotrophicum FEN-1, Thermus thermophilus FEN-1, CLEAVASE.TM.
(Third Wave, Inc., Madison, Wis.), S. cerevisiae RTH1, S.
cerevisiae RAD27, Schizosaccharomyces pombe rad2, bacteriophage T5
5'-3' exonuclease, Pyroccus horikoshii FEN-1, human exonuclease 1,
calf thymus 5'-3' exonuclease, including homologs thereof in
eubacteria, eukaryotes, and archaea, such as members of the class
II family of structure-specific enzymes, as well as enzymatically
active mutants or variants thereof. Descriptions of cleaving
enzymes can be found in, among other places, Lyamichev et al.,
Science 260:778-83, 1993; Eis et al., Nat. Biotechnol. 19:673-76,
2001; Shen et al., Trends in Bio. Sci. 23:171-73, 1998; Kaiser et
al. J. Biol. Chem. 274:21387-94, 1999; Ma et al., J. Biol. Chem.
275:24693-700, 2000; Allawi et al., J. Mol. Biol. 328:537-54, 2003;
Sharma et al., J. Biol. Chem. 278:23487-96, 2003; and Feng et al.,
Nat. Struct. Mol. Biol. 11:450-56, 2004.
[0072] In particular embodiments, the reaction mix may contain
reagents for assaying multiple (e.g., at least 2, 3, 4 or more)
different targets sequences in parallel. In these cases, the
reaction mix may contain multiple pairs of PCR primers, multiple
different flap oligonucleotides having different flaps, and
multiple different FRET cassettes for detecting the different
flaps, once they are cleaved. In one embodiment, oligonucleotides
in a mixture may have common flaps but different binding sequences
to allow for, for example, any of a number of methylated cytosines
to cleave a common FRET cassette and report a signal where a single
fluorophore is indicative of the presence of a methylated cytosine.
In this embodiment, which site is methylated in the sample may be
determined after the presence of a methylated cytosine has
identified. Optionally, the reaction may contain multiple invasive
oligonucleotides if one of the PCR primers is not used as an
invasive oligonucleotide. Upon cleavage of the FRET cassettes,
multiple distinguishable fluorescent signals may be observed. The
fluorophore may be selected from, e.g., 6-carboxyfluorescein (FAM),
which has excitation and emission wavelengths of 485 nm and 520 nm
respectively, Redmond Red, which has excitation and emission
wavelengths of 578 nm and 650 nm respectively and Yakima Yellow,
which has excitation and emission wavelengths of 532 nm and 569 nm
respectively, and Quasor670 which has excitation and emission
wavelengths of 644 nm and 670 nm respectively, although many others
could be employed. In certain cases, at least one of the PCR primer
pairs, flap oligonucleotides and FRET cassettes may be for the
detection of an internal control. In such an assay, the control
reagents may be, e.g., for amplification and detection of a locus
that is not methylated or, for example, or for the amplification
and detection of copies of the same locus. In these embodiments a
reaction mixture may contain, in addition to other necessary
reagents, at least an oligonucleotide having a 3' terminal
nucleotide that base pairs with an A or T residue at a site of
methylation, thereby providing for the detection of unmethylated
copies of the genomic locus. These embodiments may also employ
primers that amplified the unmethylated copies of the genomic
locus.
[0073] As would be apparent, the various oligonucleotides used in
the method are designed so as to not interfere with each other. For
example, in particular embodiments, the flap oligonucleotide may be
capped at its 3' end, thereby preventing its extension. Likewise,
in certain embodiments the invasive oligonucleotide may also be
capped at its 3' end if it not used as one of the PCR primers. In
particular embodiment, if the invasive oligonucleotide is not used
as one of the PCR primers, then the invasive oligonucleotide may be
present at a concentration that is in the range of 5% to 50%, e.g.,
10% to 40% of the concentration of the PCR primers. Further, in
certain cases, the T.sub.ms of the flap portion and the target
complementary regions of the flap oligonucleotide may independently
be at least 10.degree. C. lower (e.g., 10-20.degree. C. lower) than
the T.sub.ms of the PCR primers, which results in: a) less
hybridization of the flap oligonucleotide to the target nucleic
acid at higher temperatures (65.degree. C. to 75.degree. C.) and b)
less hybridization of any cleaved flap to the FRET cassette at
higher temperatures (65.degree. C. to 75.degree. C.), thereby
allowing the genomic locus to be amplified by PCR at a temperature
at which the flap does not efficiently hybridize.
[0074] In a multiplex reaction, the primers may be designed to have
similar thermodynamic properties, e.g., similar T.sub.ms, G/C
content, hairpin stability, and in certain embodiments may all be
of a similar length, e.g., from 18 to 30 nt, e.g., 20 to 25 nt in
length. The other reagents used in the reaction mixture may also be
T.sub.m matched.
[0075] The assay mixture may be present in a vessel, including
without limitation, a tube; a multi-well plate, such as a 96-well,
a 384-well, a 1536-well plate; and a microfluidic device. In
certain embodiments, multiple multiplex reactions are performed in
the same reaction vessel. Depending on how the reaction is
performed, the reaction mixture may be of a volume of 5 .mu.l to
200 .mu.l, e.g., 10 .mu.l to 100 .mu.l, although volumes outside of
this range are envisioned.
[0076] In certain embodiments, a subject reaction mix may further
contain a nucleic acid sample. In particular embodiments, the
sample may contain genomic DNA or an amplified version thereof
(e.g., genomic DNA amplified using the methods of Lage et al,
Genome Res. 2003 13: 294-307 or published patent application
US20040241658, for example). In exemplary embodiments, the genomic
sample may contain genomic DNA from a mammalian cell, such as, a
human, mouse, rat, or monkey cell. The sample may be made from
cultured cells or cells of a clinical sample, e.g., a tissue
biopsy, scrape or lavage or cells of a forensic sample (i.e., cells
of a sample collected at a crime scene). In particular embodiments,
the genomic sample may be from a formalin fixed paraffin embedded
(FFPE) sample.
[0077] Method for Sample Analysis
[0078] In particular embodiments, the nucleic acid sample may be
obtained from a biological sample such as cells, tissues, bodily
fluids, and stool. Bodily fluids of interest include but are not
limited to, blood, serum, plasma, saliva, mucous, phlegm, cerebral
spinal fluid, pleural fluid, tears, lactal duct fluid, lymph,
sputum, cerebrospinal fluid, synovial fluid, urine, amniotic fluid,
and semen. In particular embodiments, a sample may be obtained from
a subject, e.g., a human, and it may be processed prior to use in
the subject assay. For example, the nucleic acid may be extracted
from the sample prior to use, methods for which are known.
[0079] For example, DNA can be extracted from stool from any number
of different methods, including those described in, e.g., Coll et
al (J. of Clinical Microbiology 1989 27: 2245-2248), Sidransky et
al (Science 1992 256: 102-105), Villa (Gastroenterology 1996 110:
1346-1353) and Nollau (BioTechniques 1996 20: 784-788), and U.S.
Pat. Nos. 5,463,782, 7,005,266, 6,303,304 and 5,741,650. Commercial
DNA extraction kits for the extraction of DNA from stool include
the QIAamp stool mini kit (QIAGEN, Hilden, Germany), Instagene
Matrix (Bio-Rad, Hercules, Calif.), and RapidPrep Micro Genomic DNA
isolation kit (Pharmacia Biotech Inc. Piscataway, N.J.), among
others.
[0080] Treatment of an initial nucleic acid sample to produce a
treated nucleic acid sample involves contacting the initial nucleic
acid sample with an agent that modifies unmethylated cytosine to
uracil under conditions (e.g., a length of time and temperature,
etc.) for the unmethylated cytosines in the nucleic acid to
deaminated, thereby converting into uracils. Such methods are known
and are described in, e.g., Clark et al (Nucleic Acids Res. 1994
22:2990-7), McDonald et al (Biotechniques. 1997 22: 272-4), Herman
et al (Proc. Natl. Acad. Sci. 1996 93:9821-6) and Paul et al
(Biotechniques 1996 21:126-33) as well as a variety of other
references.
[0081] After treatment, the sample, referred to herein the "treated
sample", is combined with other reagents to produce the reaction
mixture described above, and then subjected to one or more sets of
thermocycling conditions.
[0082] Exemplary conditions include, for example those described in
Allawi et al (J Clin Microbiol. 2006 44: 3443-3447). In one
embodiment, the reaction mixture may be subjected to conventional
PCR thermocycling (i.e., multiple rounds of denaturation at a
temperature of over 90.degree. C., e.g., at about 95.degree. C.,
annealing at a temperature of 65.degree. C. to 75.degree. C. and
extension at a temperature of 65.degree. C. to 75.degree. C.)
followed by a period at high temperature to denature the
thermostable polymerase (e.g., about 99.degree. C.), and then a
period at a temperature that is about 10.degree. C. below the
extension temperature during which fluorescence is detected.
[0083] In other embodiments, the reaction mixture may be subject to
cycling conditions in which an increase in the amount of amplified
product (indicated by the amount of fluorescence) can be measured
in real-time, where the term "real-time" is intended to refer to a
measurement that is taken as the reaction progresses and products
accumulate. The measurement may be expressed as an absolute number
of copies or a relative amount when normalized to a control nucleic
acid in the sample. In one real time embodiment, the reaction may
be subjected to the thermocycling conditions described in, e.g.,
Tadokoro (J. Vir. Methods 2009 155: 182-186). In this embodiment,
the reaction mixture may be subjected to multiple cycles of four
steps that include a denaturation step at a temperature of over
90.degree. C., e.g., at about 95.degree. C., annealing at a
temperature in the range of 61.degree. C. to 69.degree. C., flap
cleavage at a temperature of 50.degree. C., and extension at a
temperature of 72.degree. C. In this embodiment, fluorescence can
be monitored in each cycle to provide a real time measurement of
the amount of product that is accumulating in the reaction
mixture.
[0084] In an alternative embodiment, the reaction mixture may be
subjected to the following thermocycling conditions: a first set of
5 to 15 (e.g., 8 to 12) cycles of: i. a first temperature of at
least 90.degree. C.; ii. a second temperature in the range of
60.degree. C. to 75.degree. C. (e.g., 65.degree. C. to 75.degree.
C.); iii. a third temperature in the range of 65.degree. C. to
75.degree. C.; followed by: a second set of 20-50 cycles of: i. a
fourth temperature of at least 90.degree. C.; ii. a fifth
temperature that is at least 10.degree. C. lower than the second
temperature (e.g., in the range of 50.degree. C. to 55.degree. C.);
and iii. a sixth temperature in the range of 65.degree. C. to
75.degree. C. No additional reagents need to be added to the
reaction mixture during the thermocycling, e.g., between the first
and second sets of cycles. In particular embodiments, the
thermostable polymerase is not inactivated between the first and
second sets of conditions, thereby allowing the target to be
amplified during each cycle of the second set of cycles. In
particular embodiments, the second and third temperatures are the
same temperature such that "two step" thermocycling conditions are
performed. Each of the cycles may be independently of a duration in
the range of 10 seconds to 3 minutes, although durations outside of
this range are readily employed. In each cycle of the second set of
cycles (e.g., while the reaction is in the fifth temperature), a
signal generated by cleavage of the flap probe may be measured to
provide a real-time measurement of the amount of product in the
sample.
[0085] Some of the principles of an example of the subject method
are schematically illustrated in FIG. 2. As noted above, however,
the method may be performed in many different ways, e.g., by
employing the first primer as an invasive oligonucleotide or by
using a single methylation specific primer. As such, FIG. 2 shows
an example of the method and should not be used to limit to only
the embodiment shown.
[0086] With reference to FIG. 2, the method includes treating an
initial sample 30 that comprises both methylated copies of a
genomic locus 32 and unmethylated copies of the genomic locus 34
with an agent that modified unmethylated cytosine to uracil to
produce treated sample 36. This treatment converts unmethylated
cytosines, e.g., 38, to uracils e.g., 40. Methylated cytosines,
e.g., 42 remain as methylated cytosines during the treatment.
Treated sample 36 is then combined with the other reagents.
[0087] Product 44 is then amplified from treated sample 36 using
first primer 46 and second primer 48, where the first primer
hybridizes to a methylated sequence in the locus and the amplifying
preferentially amplifies methylated copies of the genomic locus, to
produce an amplified sample 50. As illustrated, both first primer
46 and the second primer 48 hybridize to methylated sequences.
However, in practice, only one of the primers need hybridize to a
methylated sequence. In particular embodiments and as noted above,
the first primer may have a 3' terminal nucleotide that base pairs
with a methylated cytosine, although this is not necessary if the
reaction employs an invasive oligonucleotide that is distinct from
the first primer. Such primers generally contain G nucleotides at
sites of methylation, thereby allowing the primers to hybridize and
extend more efficiently from sequences that contain methylated
cytosine (which are not affected by the treatment) as opposed to
sequences that contain unmethylated cytosine (which are converted
to U's by the treatment). As illustrated in FIG. 2, the presence of
product 44 in amplified sample 50 may be detected using a flap
assay that employs invasive oligonucleotide 52 that has a 3'
terminal nucleotide that base pairs with a G or C residue that
corresponds to a site of methylation. The choice of the G or C
residue is determined by whether the nucleotide that corresponds to
the site of methylation to be detected is in the top or bottom
strand of the amplification product. As shown, invasive
oligonucleotide 52 has a terminal G nucleotide because it base
pairs with a C corresponding to a site of methylation in initial
sample 30. Again, as noted above, the embodiments illustrated in
FIG. 2 employs a separate invasive oligonucleotide. In other
embodiments, the first oligonucleotide may be employed as an
invasive oligonucleotide in the method and, as such, there is no
need to use a separate invasive oligonucleotide in the assay. As
shown in FIG. 2, the 3' terminal nucleotide of the invasive
oligonucleotide base pairs with an "internal" site of methylation
in the sense that the site is within the amplified region and not
part of the first and second primers.
[0088] As shown, the flap assay relies on the cleavage of complex
53 that contains an invasive oligonucleotide 52, flap
oligonucleotide 56, and the bottom strand of product 44 by a flap
endonuclease (not shown) to release flap 60. Released flap 60 then
hybridizes to FRET cassette 62 to form a second complex 63 that is
cleaved by the flap endonuclease to cleave the fluorophore from the
complex and generate fluorescent signal 64 that can be measured to
indicate the amount of product 44 in the amplified sample.
[0089] Certain aspects of the method described above are
illustrated by example in FIGS. 3 and 4. FIG. 3 show the nucleotide
sequences of methylated and unmethylated copies of a fragment of
the human vimentin gene (VIM), before (SEQ ID NOS:1 and 2) and
after bisulfite treatment (SEQ ID NOS: 3 and 4). FIG. 4 shows the
nucleotide sequences of an exemplary forward primer, an exemplary
reverse primer, and an exemplary flap oligonucleotide, aligned with
the bisufite-treated fragment shown in FIG. 3.
[0090] The amount of product in the sample may be normalized
relative to the amount of a control nucleic acid present in the
sample, thereby determining a relative amount of the methylated
copies of the genomic locus in the sample. In some embodiments, the
control nucleic acid may be a different locus to the genomic locus
and, in certain cases, may be detected using a flap assay that
employs an invasive oligonucleotide having a 3' terminal nucleotide
that base pairs with an A or T residue at the same site of
methylation, thereby detecting the presence of unmethlyated copies
of the genomic locus. The control may be measured in parallel with
measuring the product in the same reaction mixture or a different
reaction mix. If the control is measured in the same reaction
mixture, the flap assay may include further reagents, particularly
a second invasive oligonucleotide, a second flap probe having a
second flap and a second FRET cassette that produces a signal that
is distinguishable from the FRET cassette used to detect the
product. In particular embodiments, the reaction mixture may
further comprise PCR reagents and flap reagents for amplifying and
determining the methylation state of another genomic locus that is
known to be methylated in some samples.
[0091] In certain cases, fluorescence indicating the amount of
cleaved flap can be detected by an automated fluorometer designed
to perform real-time PCR having the following features: a light
source for exciting the fluorophore of the FRET cassette, a system
for heating and cooling reaction mixtures and a fluorometer for
measuring fluorescence by the FRET cassette. This combination of
features, allows real-time measurement of the cleaved flap, thereby
allowing the amount of target nucleic acid in the sample to be
quantified. Automated fluorometers for performing real-time PCR
reactions are known in the art and can be adapted for use in this
specific assay, for example, the ICYCLER.TM. from Bio-Rad
Laboratories (Hercules, Calif.), the Mx3000P.TM., the MX3005P.TM.
and the MX4000.TM. from Stratagene (La Jolla, Calif.), the ABI
PRISM.TM. 7300, 7500, 7700, and 7900 Taq Man (Applied Biosystems,
Foster City, Calif.), the SMARTCYCLER.TM., ROTORGENE2000.TM.
(Corbett Research, Sydney, Australia) and the GENE XPERT.TM. System
(Cepheid, Sunnyvale, Calif.) and the LIGHTCYCLER.TM. (Roche
Diagnostics Corp., Indianapolis, Ind.). The speed of ramping
between the different reaction temperatures is not critical and, in
certain embodiments, the default ramping speeds that are preset on
thermocyclers may be employed.
[0092] In certain cases, the method may further involve graphing
the amount of cleavage that occurs in several cycles, thereby
providing a real time estimate of the abundance of the nucleic acid
target. The estimate may be calculated by determining the threshold
cycle (i.e., the cycle at which this fluorescence increases above a
predetermined threshold; the "Ct" value or "Cp" value). This
estimate can be compared to a control (which control may be assayed
in the same reaction mix as the genomic locus of interest) to
provide a normalized estimate. The thermocycler may also contain a
software application for determining the threshold cycle for each
of the samples. An exemplary method for determining the threshold
cycle is set forth in, e.g., Luu-The et al (Biotechniques 2005 38:
287-293).
[0093] A device for performing sample analysis is also provided. In
certain embodiments, the device comprises: a) a thermocycler
programmed to perform the above-described method and b) a vessel
comprising the above-described reaction mixture.
[0094] Utility
[0095] The method described finds use in a variety of applications,
where such applications generally include sample analysis
applications in which the presence of a methylated sequence in a
given sample is detected.
[0096] In some embodiments, a biological sample may be obtained
from a patient, and the sample may be analyzed using the method. In
particular embodiments, the method may be employed to identify
and/or estimate the amount of methylated copies of a genomic locus
that are in a biological sample that contains both unmethylated
copies of a genomic locus and methylated copies of the genomic
locus In this example, the sample may contain at least 100 times
(e.g., at least 1,000 times, at least 5,000 times, at least 10,000
times, at least 50,000 times or at least 100,000 times) more wild
type copies of the genomic locus than mutant copies of the genomic
locus.
[0097] In particular, the above-described methods may be employed
to diagnose, to predict a response to treatment, or to investigate
a cancerous condition or another mammalian disease that is
associated with aberrant methylation including but not limited to:
a) imprinting disorders including Beckwith-Wiedemann syndrome
(associated with the BWS locus at 11p15.5), Prader-Willi syndrome
(associated with an imprinted region at 15p11-q13), Angelman
syndrome (also associated with an imprinted region at 15p11-q13),
Albright hereditary osteodystrophy (associated with an imprinting
at GNAS), pseudo-hypoparathyroidism types 1a and 1b (associated
with imprinting at HYMAI, PLAG1 and ZAC-AS), transient neonatal
diabetes mellitus and certain cancers (associated with the IGF2/H19
locus, the CDKN1C gene, DIRAS3 gene, and the MEST gene); b) repeat
instability diseases including fragile X syndrome (associated with
methylation at FRAXA) and facioscapulohumeral muscular dystrophy
(associated with methylation at the FSHD locus); c) diseases caused
by a defect in methylation pathways such as systemic lupus
erythematosus, immunodeficiency (SLE, which is a result of global
hypomethylation of T cells) and centromeric instability and facial
anomalies syndrome (ICF) and d) other diseases such as
alpha-thalassemia/mental retardation syndrome, X-linked (associated
with abnormal methylation of ATRX). These diseases are reviewed in
Robertson (DNA methylation and human disease Nat. Reviews 2005 6:
597-610). The method described above, may, for example, be used to
identify aberrant methylation in an unborn child.
[0098] Hypermethylation of CpG islands in various loci is
associated with various cancers. Without being bound to any
particular theory, it is believed that methylation inactivates the
expression of genes, including tumor suppressor genes, cell cycle
related genes, DNA mismatch repair genes, hormone receptors and
tissue or cell adhesion molecules. For example, tumor-specific
deficiency of expression of the DNA repair genes MLH1 and MGMT and
the tumor suppressors, p16, CDKN2 and MTS1, has been directly
correlated to hypermethylation. Increased CpG island methylation is
thought to result in the inactivation of these genes resulting in
increased levels of genetic damage, predisposing cells to later
genetic instability which then contributes to tumor
progression.
[0099] Hypermethylation has been associated with several cancers,
as illustrated in Table 1 (adapted from Das et al J. Clin. Oncol.
2004 22:4632-42). Thus, the method may be employed as a diagnostic
for those cancers.
TABLE-US-00001 TABLE 1 Methylated Putative Role in Tumor Gene
Development Site of Tumor APC Deranged regulation of cell Breast,
Lung, proliferation, cell migration, cell Esophageal adhesion,
cytoskeletal reorganization, and chromosomal stability BRCA1
Implicated in DNA repair and Breast, Ovarian transcription
activation CDKN2A/ Cyclin-dependent kinase inhibitor GIT, Head and
neck, p16 NHL, Lung DAPK1 Calcium/calmodulin-dependent Lung enzyme
that phosphorylates serine/threonine residues on proteins;
Suppression of apoptosis E-cadherin Increasing proliferation,
invasion, Breast, Thyroid, and/or metastasis Gastric ER Hormone
resistance Breast, Prostate GSTP1 Loss of detoxification of active
Prostate, Breast, Renal metabolites of several carcinogens hMLH1
Defective DNA mismatch repair Colon, Gastric, and gene mutations
Endometrium, Ovarian MGMT p53-related gene involved in DNA Lung,
Brain repair and drug resistance p15 Unrestrained entry of cells
into Leukemia, activation and proliferation Lymphoma, Squamous cell
carcinoma, lung RASSF1A Loss of negative regulator control Lung,
Breast, Ovarian, of cell proliferation through Kidney, inhibition
of G.sub.1/S-phase Nasopharyngeal progression Rb Failure to repress
the transcription Retinoblastoma, of cellular genes required for
DNA Oligodendroglioma replication and cell division VHL Altered RNA
stability through and Renal cell cancer erroneous degradation of
RNA- bound proteins Abbreviations: APC, adenomatous polyposis coli;
BRCA1, breast cancer 1; CDKN2A/p16, cyclin-dependent kinase 2A;
DAPK1, death-associated protein kinase 1; ER, estrogen receptor;
GSTP1, glutathione S-transferase Pi 1; hMLH1, Mut L homologue 1;
MGMT, O-6 methylguanine-DNA methyltransferase; RASSF1A, Ras
association domain family member 1; Rb, retinoblastoma; VHL, von
Hippel-Lindau; GIT, gastrointestinal tract; NHL, non-Hodgkin's
lymphoma.
[0100] The hypermethylation of the following genes is also
associated with cancer: PYCARD, CDH13, COX2, DAPK1, ESR1, GATA4,
SYK, MLH1, TP73, PRDM2, PGR, SFRP1, SOCS1, SOCS3, STK11, TME1-1-2,
THBS1, RASSFS, PRKCDBP, MGMT, CDKN2A, SFRP1, TME1-1-2, HS3ST2
(30ST2), RASSF1A, GATA4 and RARB.
[0101] In these embodiments, the method may be employed to detect
aberrant methylation (e.g., hypermethylation or hypomethylation) in
a gene, which aberrant methylation may be associated with, e.g.,
breast cancer, melanoma, renal cancer, endometrial cancer, ovarian
cancer, pancreatic cancer, leukemia, colorectal cancer, prostate
cancer, mesothelioma, glioma, medullobastoma, polycythemia,
lymphoma, sarcoma or multiple myeloma, etc.
[0102] The use of DNA methylation markers for diagnosing cancers
has been reviewed in a variety of publications such as: Qureshi et
al (Int J Surg. 2010 Utility of DNA methylation markers for
diagnosing cancer. 8:194-8), Muraki et al (Oncol Rep. 2009
Epigenetic DNA hypermethylation: clinical applications in
endometrial cancer 22:967-72), Balch et al (Endocrinology. 2009
Minireview: epigenetic changes in ovarian cancer. 150:4003-11),
Pfeifer (Semin Cancer Biol. 2009 DNA methylation patterns in lung
carcinomas 19:181-7), Szalmas et al (Semin Cancer Biol. 2009
Epigenetic alterations in cervical carcinogenesis 19:144-52), Hoque
(Expert Rev Mol Diagn. 2009 DNA methylation changes in prostate
cancer: current developments and future clinical implementation
9:243-57), and Campan et al (Curr Top Microbiol Immunol. 2006 DNA
methylation profiles of female steroid hormone-driven human
malignancies 310:141-78).
[0103] In one embodiment, the method may be employed to detected
methylation in fecal DNA, thereby providing a diagnostic for
colorectal cancer. In these embodiments, the method may be employed
to investigate methylation of BMP3, EYA2, ALX4, or Vimentin, for
example. These genes and their methylation are described in, for
example, Chen et al (J Natl Cancer Inst. 2005 Detection in fecal
DNA of colon cancer-specific methylation of the nonexpressed
vimentin gene. 97:1124-32), Zou et al (Cancer Epidemiol Biomarkers
Prev. 2007 Highly methylated genes in colorectal neoplasia:
implications for screening. 16:2686-96) and Li (Nat Biotechnol.
2009 Sensitive digital quantification of DNA methylation in
clinical samples. 27:858-63).
[0104] The subject method may be employed to diagnose patients with
cancer or a pre-cancerous condition (e.g., adenoma etc.), alone, or
in combination with other clinical techniques (e.g., a physical
examination, such as, a colonoscopy) or molecular techniques (e.g.,
immunohistochemical analysis). For example, results obtained from
the subject assay may be combined with other information, e.g.,
information regarding the methylation status of other loci,
information regarding the mutations at other loci, information
regarding rearrangements or substitutions in the same locus or at a
different locus, cytogenetic information, information regarding
rearrangements, gene expression information or information about
the length of telomeres, to provide an overall diagnosis of cancer
or other diseases.
[0105] In one embodiment, a sample may be collected from a patient
at a first location, e.g., in a clinical setting such as in a
hospital or at a doctor's office, and the sample may be forwarded
to a second location, e.g., a laboratory where it is processed and
the above-described method is performed to generate a report. A
"report" as described herein, is an electronic or tangible document
which includes report elements that provide test results that may
include a Ct value, or Cp value, or the like that indicates the
presence of mutant copies of the genomic locus in the sample. Once
generated, the report may be forwarded to another location (which
may the same location as the first location), where it may be
interpreted by a health professional (e.g., a clinician, a
laboratory technician, or a physician such as an oncologist,
surgeon, pathologist), as part of a clinical diagnosis.
[0106] Kits
[0107] Also provided are kits for practicing the subject method, as
described above. The components of the kit may be present in
separate containers, or multiple components may be present in a
single container. The components of the kit may include: a) a first
primer and a second primer, where the first primer corresponds to a
methylated sequence in the genomic locus and optionally contains a
3' terminal nucleotide that base pairs with a methylated cytosine
or its complement in the methylated sequence; and b) flap assay
reagents comprising a flap endonuclease, a FRET cassette and, if
the first primer does not contain a 3' terminal nucleotide that
base pairs with a methylated cytosine in the methylated sequence,
an invasive oligonucleotide having a 3' terminal nucleotide that
base pairs with a G or C residue that corresponds to a site of
methylation in the genomic locus. The particulars of these reagents
are described above. The kit may further contain an agent that
modifies unmethylated cytosine to uracil. The kit further comprises
PCR and flap reagents for amplification and detection of a control
nucleic acid.
[0108] In addition to the above-mentioned components, the kit may
further include instructions for using the components of the kit to
practice the subject methods. The instructions for practicing the
subject methods are generally recorded on a suitable recording
medium. For example, the instructions may be printed on a
substrate, such as paper or plastic, etc. As such, the instructions
may be present in the kits as a package insert, in the labeling of
the container of the kit or components thereof (i.e., associated
with the packaging or subpackaging) etc. In other embodiments, the
instructions are present as an electronic storage data file present
on a suitable computer readable storage medium, e.g. CD-ROM,
diskette, etc. In yet other embodiments, the actual instructions
are not present in the kit, but means for obtaining the
instructions from a remote source, e.g. via the internet, are
provided. An example of this embodiment is a kit that includes a
web address where the instructions can be viewed and/or from which
the instructions can be downloaded. As with the instructions, this
means for obtaining the instructions is recorded on a suitable
substrate. In addition to the instructions, the kits may also
include one or more control samples, e.g., positive or negative
controls analytes for use in testing the kit.
[0109] All publications and patent applications cited in this
specification are herein incorporated by reference as if each
individual publication or patent application were specifically and
individually indicated to be incorporated by reference. The
citation of any publication is for its disclosure prior to the
filing date and should not be construed as an admission that the
present invention is not entitled to antedate such publication by
virtue of prior invention.
[0110] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it is readily apparent to those of ordinary skill
in the art in light of the teachings of this invention that certain
changes and modifications may be made thereto without departing
from the spirit or scope of the appended claims.
Example 1
Detection of Methylated C6ORF150 Sequences in the Presence of
Unmethylated C6ORF150
[0111] The assay was designed to detect and quantitate the
methylated CpG sequences in the presence of unmethylated sequence.
In order to simulate the methylated and unmethylated genomic DNA,
plasmids were prepared and cloned to match the sequence that
results following the bisulfite reaction conversion of unmethylated
C to U, which behaves as if it were a T in the PCR process, as
exemplified for the vimentin sequence in FIG. 3. For each example,
the methylated version of the sequence uses a plasmid with the CG
motif intact and the unmethylated representative plasmid replaces
this with a TG motif.
[0112] In this example, 2 CGs were designed on each primer, and
they were not at 3'ends of the primers. The assay was then used to
detect methylated copies spiked in unmethylated copies at 4
different levels, including 10.sup.4 methylated copies in 10.sup.5
unmethylated copies (1:10), 10.sup.3 methylated copies in 10.sup.5
unmethylated copies (1:100), 10.sup.2 methylated copies in 10.sup.5
unmethylated copies (1:1000), and 10 methylated copies in 10.sup.5
unmethylated copies (1:10000).
[0113] The target sequence of the plasmid representing the
methylated sequence was as follows, with every C base corresponding
to a methyl C for an analogous genomic DNA:
TABLE-US-00002 (SEQ ID NO: 1)
ATGGAATGTTAGGGGCGTTTCGATGGATTTTATCGAGTTTTCGGTTGTTTT
CGAGGTCGTTTTGTTTAAGGCGGGAAAGTTCGGTTTCGTTAGGAAGTCGGG
ATTTCGGTAGAAAAAGAGCGTTTCGGATATTTAGGAGAGGTCGTTCGTTCG
CGTAATTGGGGTTCGCGTTAAAAAGGTTTTTTAGCGCGTTTAGGATACGTA GTC
[0114] The assay employed a forward primer
5'-GGGATTTCGGTAGAAAAAGAGCGT-3' (SEQ ID NO:2), a reverse primer
5'-ACCTTTTTAACGCGAACCCCA-3' (SEQ ID NO:3), an invasive
oligonucleotide, that was not the forward PCR primer
5'-TCGGATATTTAGGAGAGGTg-3' (SEQ ID NO:4), and a flap probe
5'-GACGCGGAGCGTTCGTTCGCG-3'/3C6/(SEQ ID NO:5) where the area
corresponding to methylated bases is shown underlined and the
3'-end is blocked with a hexanediol group in order to inhibit
primer extension. The first nine bases of the flap probe are the
region cleaved away by the flap endonuclease and then bind to the
FRET cassette. Note that the 3'-end base of the invasive probe,
shown as a lower case g, is designed to mismatch the target so as
to discourage primer extension by the Taq polymerase. Primers,
invasive oligos, and flap probes were supplied as non-catalog items
by Integrated DNA Technologies (IDT, Coralville, Iowa).
[0115] The binding regions for the primers and invasive probe are
shown on the target sequence underlined, and the target binding
region of the flap probe is shown in italics:
TABLE-US-00003 (SEQ ID NO: 1)
ATGGAATGTTAGGGGCGTTTCGATGGATTTTATCGAGTTTTCGGTTGTTTT
CGAGGTCGTTTTGTTTAAGGCGGGAAAGTTCGGTTTCGTTAGGAAGTCGGG
ATTTCGGTAGAAAAAGAGCGTTTCGGATATTTAGGAGAGGTCGTTCGTTCG
CGTAATTGGGGTTCGCGTTAAAAAGGTTTTTTAGCGCGTTTAGGATACGTA GTC.
[0116] The FRET cassette used was
5'-FAM/TCT/Quencher/AGCCGGTTTTCCGGCT GAGACTCCGCGTCCGT-3'/3C6 (SEQ
ID NO:6), where FAM is fluorescein, the quencher is the
Eclipse.RTM. Dark Quencher, and the 3'-end is blocked with a
hexanediol group in order to inhibit primer extension. The FRET
cassette was supplied by Hologic (Madison, Wis.).
[0117] Cycling conditions were 95.degree. C. for 3 min; 50 cycles
at 95.degree. C. for 20 sec, 50.degree. C. for 1 min, and
70.degree. C. for 30 sec, with a final 40.degree. C. hold.
Fluorescent signal acquisition was done at the 50.degree. C. point
in the cycle. The PCR reactions were done in LightCycler.RTM. 480
Multiwell 96 Plates (Roche, Indianapolis) in 10 mM MOPS pH 7.5,
with 7.5 mM MgCl.sub.2, and 250 .mu.M dNTPs (Promega, Madison,
Wis.). Taq polymerase was the iTaq enzyme (BioRad, Hercules,
Calif.) and the cleavage enzyme was Cleavase 2.0 (Hologic, Madison,
Wis.). Forward primer concentration was 500 nM, reverse primer
concentration was 500 nM, flap probe was at 500 nM, invasive oligo
probe was at 70 nM, and the FRET cassette was used at a final
concentration of 200 nM. All amplification and detection was
performed in the LightCycler 480 optical thermocycler (Roche,
Indianapolis, Ind.).
[0118] Data showing kinetic amplification curves and the crossing
point, Cp, of the different ratios of mutant to wild type in the
amplification samples are shown in FIG. 5. In these assays, the Cp
is calculated as being the point at which fluorescence rose to 18%
of the maximum fluorescence.
[0119] The design of primers, invasive probe, and flap probe used
in this example was unable to detect 10.sup.2 methylated copies in
10.sup.5 unmethylated copies (1:1000; FIG. 5). The reactions for
detecting 10.sup.3 methylated copies in 10.sup.5 unmethylated
copies (1:100) and 10.sup.4 methylated copies in 10.sup.5
unmethylated copies (1:10) were also suppressed by excessive
amounts of unmethylated gene copies (FIG. 5).
Example 2
Detection of Methylated ZNF804B Sequences in the Presence of
Unmethylated ZNF804B
[0120] The assay was designed to detect and quantify the methylated
CpG sequences of ZNF804B in the presence of unmethylated ZNF804B
sequence. In order to simulate the methylated and unmethylated
genomic DNA, plasmids were prepared and cloned to match the
sequence that results following the bisulfite reaction conversion
of unmethylated C to U, which behaves as if it were a T in the PCR
process, as exemplified for the vimentin sequence in FIG. 3. For
each example, the methylated version of the sequence uses a plasmid
with the CG motif intact and the unmethylated representative
plasmid replaces this with a TG motif.
[0121] In this example, 1 CG was designed on each primer, and they
were not at 3'ends of the primers. The assay was then used to
detect methylated copies spiked in unmethylated copies at 4
different levels, as in Example 1, including 10.sup.4 methylated
copies in 10.sup.5 unmethylated copies (1:10), 10.sup.3 methylated
copies in 10.sup.5 unmethylated copies (1:100), 10.sup.2 methylated
copies in 10.sup.5 unmethylated copies (1:1000), and 10 methylated
copies in 10.sup.5 unmethylated copies (1:10000).
[0122] The target sequence of the plasmid representing the
methylated sequence was as follows, with every C base corresponding
to a methyl C for an analogous genomic DNA:
TABLE-US-00004 (SEQ ID NO: 7)
TTAATTTGTTTGTTTTATTTGTGGTTGTATAGTTTATTTTTGTAATCGGTT
GGGGAGTTGTTGTTTTTGTTAACGTCGTCGTTAGTTAGAGCGTTGAAGAAA
AGTTGAAGGTTAGTAGGTAACGAAAGAGTAAAGA
[0123] The assay employed a forward primer
5'-GTGGTTGTATAGTTTATTTTTGTAATCGGT-3' (SEQ ID NO:8), a reverse
primer 5'-ACCTTCAACTTTTCTTCAACGCTC-3' (SEQ ID NO:9), an invasive
oligonucleotide, that was not the forward PCR primer
5'-GGGAGTTGTTGTTTTTGTTAAg-3' (SEQ ID NO:10), and a flap probe
5'-GACGCGGAGCGTCGTCGTTAG-3'/3C6/(SEQ ID NO:11) where the area
corresponding to methylated bases is shown underlined and the
3'-end is blocked with a hexanediol group in order to inhibit
primer extension. The first nine bases of the flap probe are the
region cleaved away by the flap endonuclease and then bind to the
FRET cassette. Note that the 3'-end base of the invasive probe,
shown as a lower case g, is designed to mismatch the target so as
to discourage primer extension by the Taq polymerase. Primers,
invasive oligos, and flap probes were supplied as non-catalog items
by Integrated DNA Technologies (IDT, Coralville, Iowa).
[0124] The binding regions for the primers and invasive probe are
shown on the target sequence underlined, and the target binding
region of the flap probe is shown in italics:
TABLE-US-00005 (SEQ ID NO: 7)
TTAATTTGTTTGTTTTATTTGTGGTTGTATAGTTTATTTTTGTAATCGGTT
GGGGAGTTGTTGTTTTTGTTAACGTCGTCGTTAGTTAGAGCGTTGAAGAAA
AGTTGAAGGTTAGTAGGTAACGAAAGAGTAAAGA.
[0125] The FRET cassette used was
5'-FAM/TCT/Quencher/AGCCGGTTTTCCGGCT GAGACTCCGCGTCCGT-3'/3C6 (SEQ
ID NO:6), where FAM is fluorescein, the quencher is the
Eclipse.RTM. Dark Quencher, and the 3'-end is blocked with a
hexanediol group in order to inhibit primer extension. The FRET
cassette was supplied by Hologic (Madison, Wis.).
[0126] Cycling conditions were 95.degree. C. for 3 min; 50 cycles
at 95.degree. C. for 20 sec, 50.degree. C. for 1 min, and
70.degree. C. for 30 sec, with a final 40.degree. C. hold.
Fluorescent signal acquisition was done at the 50.degree. C. point
in the cycle. The PCR reactions were done in LightCycler.RTM. 480
Multiwell 96 Plates (Roche, Indianapolis) in 10 mM MOPS pH 7.5,
with 7.5 mM MgCl.sub.2, and 250 .mu.M dNTPs (Promega, Madison,
Wis.). Taq polymerase was the iTaq enzyme (BioRad, Hercules,
Calif.) and the cleavage enzyme was Cleavase 2.0 (Hologic, Madison,
Wis.). Forward primer concentration was 500 nM, reverse primer
concentration was 500 nM, flap probe was at 500 nM, invasive oligo
probe was at 70 nM, and the FRET cassette was used at a final
concentration of 200 nM. All amplification and detection was
performed in the LightCycler 480 optical thermocycler (Roche,
Indianapolis, Ind.).
[0127] Data showing kinetic amplification curves and the crossing
point, Cp, of the different ratios of mutant to wild type in the
amplification samples are shown in FIG. 6. In these assays, the Cp
is calculated as being the point at which fluorescence rose to 18%
of the maximum fluorescence.
[0128] The design of primers, invasive probe, and flap probe used
in this example could not detect 10 methylated copies in 10.sup.5
unmethylated copies (1:10000; FIG. 6). The reactions for detecting
10.sup.2 methylated copies in 10.sup.5 unmethylated copies
(1:1000), 10.sup.3 methylated copies in 10.sup.5 unmethylated
copies (1:100), and 10.sup.4 methylated copies in 10.sup.5
unmethylated copies (1:10) were also suppressed by excessive
amounts of unmethylated gene copies (FIG. 6).
Example 3
Detection of Methylated Vimentin Sequences in the Presence of
Unmethylated Vimentin
[0129] The assay was designed to detect and quantitate the
methylated CpG sequences of vimentin (VIM) in the presence of
unmethylated VIM sequence. In order to simulate the methylated and
unmethylated genomic DNA, plasmids were prepared and cloned to
match the sequence that results following the bisulfite reaction
conversion of unmethylated C to U, which behaves as if it were a T
in the PCR process, as shown for the vimentin sequence in FIG. 3.
The methylated version of the sequence uses a plasmid with the CG
motif intact and the unmethylated representative plasmid replaces
this with a TG motif.
[0130] In this example, 3 CGs were designed on each primer of the
vimentin methylation detection assay, with one at the 3' end of the
forward primer. In this assay, the forward primer is also the
invasive oligonucleotide. There are also CG motifs located at the
cleavage point of the flap probe, in both senses. The assay was
then used to detect methylated copies spiked in unmethylated copies
at 4 different levels, as in Example 1 and 2, including 10.sup.4
methylated copies in 10.sup.5 unmethylated copies (1:10), 10.sup.3
methylated copies in 10.sup.5 unmethylated copies (1:100), 10.sup.2
methylated copies in 10.sup.5 unmethylated copies (1:1000), and 10
methylated copies in 10.sup.5 unmethylated copies (1:10000).
[0131] The target sequence of the plasmid representing the
methylated sequence was as follows, with every C base corresponding
to a methyl C for an analogous genomic DNA:
TABLE-US-00006 (SEQ ID NO: 12)
TCGTGTTTTCGTTTTTTTATCGTAGGATGTTCGGCGGTTCGGGTATCGCGA
GTCGGTCGAGTTTTAGTCGGAGTTACGTGATTACGTTTATTCGTATTTATA
GTTTGGGCGACG
[0132] The assay employed a forward primer 5'-GGCGGTTCGGGTATCG-3'
(SEQ ID NO:13), a reverse primer 5'-CGTAATCACGTAACTCCGACT-3' (SEQ
ID NO:14), and a flap probe 5'-GACGCGGAGGCGAGTCGGTCG-3'/3C6/(SEQ ID
NO:15) where the area corresponding to methylated bases is shown
underlined and the 3'-end is blocked with a hexanediol group in
order to inhibit primer extension. The first nine bases of the flap
probe are the region cleaved away by the flap endonuclease and then
bind to the FRET cassette. Primers and flap probes were supplied as
non-catalog items by Integrated DNA Technologies (IDT, Coralville,
Iowa).
[0133] The binding regions for the primers and invasive probe are
shown on the target sequence underlined, and the target binding
region of the flap probe is shown in italics:
TABLE-US-00007 (SEQ ID NO: 12)
TCGTGTTTTCGTTTTTTTATCGTAGGATGTTCGGCGGTTCGGGTATCGCGA
GTCGGTCGAGTTTTAGTCGGAGTTACGTGATTACGTTTATTCGTATTTATA
GTTTGGGCGACG.
[0134] The FRET cassette used was
5'-FAM/TCT/Quencher/AGCCGGTTTTCCGGCT GAGACTCCGCGTCCGT-3'/3C6 (SEQ
ID NO:6), where FAM is fluorescein, the quencher is the
Eclipse.RTM. Dark Quencher, and the 3'-end is blocked with a
hexanediol group in order to inhibit primer extension. The FRET
cassette was supplied by Hologic (Madison, Wis.).
[0135] Cycling conditions were 95.degree. C. for 2 mM; 45 cycles at
95.degree. C. for 20 sec, 53.degree. C. for 1 mi; and 40.degree. C.
to hold. Fluorescent signal acquisition was done at the 53.degree.
C. point in the cycle. The PCR reactions were done in
LightCycler.RTM. 480 Multiwell 96 Plates (Roche, Indianapolis) in
10 mM MOPS pH 7.5, with 7.5 mM MgCl.sub.2, and 250 .mu.M dNTPs
(Promega, Madison, Wis.). Taq polymerase was the HotStart GoTaq
enzyme (Promega, Madison, Wis.) and the cleavage enzyme was
Cleavase 2.0 (Hologic, Madison, Wis.). Forward primer concentration
was 500 nM, reverse primer concentration was 500 nM, flap probe was
at 500 nM, and the FRET cassette was used at a final concentration
of 200 nM. All amplification and detection was performed in the
LightCycler 480 optical thermocycler (Roche, Indianapolis,
Ind.).
[0136] Data showing kinetic amplification curves and the crossing
point, Cp, of the different ratios of mutant to wild type in the
amplification samples are shown in FIG. 7. In these assays, the Cp
is calculated as being the point at which fluorescence rose to 18%
of the maximum fluorescence.
[0137] The design of primers, invasive probe, and flap probe used
in this example could linearly detect down to 10 methylated copies
in 10.sup.5 unmethylated copies (1:10000) and is clearly superior
(FIG. 7) to the performance of Examples 1 and 2 (FIGS. 5 and 6).
Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID
NOS: 19 <210> SEQ ID NO 1 <211> LENGTH: 207 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: target methylated C6ORF150
<220> FEATURE: <221> NAME/KEY: misc_difference
<222> LOCATION: 16, 21, 34, 42, 52, 58, 72, 82, 88, 99, 107,
121, 126, 144, 148, 152, 154, 167, 169, 188, 190, 201, 207
<223> OTHER INFORMATION: methylated cytosine residues
<400> SEQUENCE: 1 atggaatgtt aggggcgttt cgatggattt tatcgagttt
tcggttgttt tcgaggtcgt 60 tttgtttaag gcgggaaagt tcggtttcgt
taggaagtcg ggatttcggt agaaaaagag 120 cgtttcggat atttaggaga
ggtcgttcgt tcgcgtaatt ggggttcgcg ttaaaaaggt 180 tttttagcgc
gtttaggata cgtagtc 207 <210> SEQ ID NO 2 <211> LENGTH:
24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 2 gggatttcgg tagaaaaaga gcgt 24
<210> SEQ ID NO 3 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 3 acctttttaa cgcgaacccc a 21 <210> SEQ ID NO 4
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic invasive oligonucleotide <400>
SEQUENCE: 4 tcggatattt aggagaggtg 20 <210> SEQ ID NO 5
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic flap probe <220> FEATURE: <221>
NAME/KEY: misc_difference <222> LOCATION: 10, 14, 18, 20
<223> OTHER INFORMATION: Methylated cytosine <220>
FEATURE: <221> NAME/KEY: misc_difference <222>
LOCATION: 21 <223> OTHER INFORMATION: 3'-C6 hexanediol
modified <400> SEQUENCE: 5 gacgcggagc gttcgttcgc g 21
<210> SEQ ID NO 6 <211> LENGTH: 35 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic FRET cassette <220>
FEATURE: <221> NAME/KEY: misc_difference <222>
LOCATION: 1 <223> OTHER INFORMATION: 5'-FAM modified
<220> FEATURE: <221> NAME/KEY: misc_difference
<222> LOCATION: 3 <223> OTHER INFORMATION: Nucleotide
modified with quencher <220> FEATURE: <221> NAME/KEY:
misc_difference <222> LOCATION: 35 <223> OTHER
INFORMATION: 3'-C6 hexanediol modified <400> SEQUENCE: 6
tctagccggt tttccggctg agactccgcg tccgt 35 <210> SEQ ID NO 7
<211> LENGTH: 136 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Target ZNF804B sequence <220> FEATURE:
<221> NAME/KEY: misc_difference <222> LOCATION: 47, 74,
77, 80, 92, 123 <223> OTHER INFORMATION: Methylated cytosine
<400> SEQUENCE: 7 ttaatttgtt tgttttattt gtggttgtat agtttatttt
tgtaatcggt tggggagttg 60 ttgtttttgt taacgtcgtc gttagttaga
gcgttgaaga aaagttgaag gttagtaggt 120 aacgaaagag taaaga 136
<210> SEQ ID NO 8 <211> LENGTH: 30 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 8 gtggttgtat agtttatttt tgtaatcggt 30 <210> SEQ ID
NO 9 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic primer <400> SEQUENCE: 9
accttcaact tttcttcaac gctc 24 <210> SEQ ID NO 10 <211>
LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic invasive oligonucleotide <400> SEQUENCE: 10
gggagttgtt gtttttgtta ag 22 <210> SEQ ID NO 11 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic flap probe <220> FEATURE: <221> NAME/KEY:
misc_difference <222> LOCATION: 21 <223> OTHER
INFORMATION: 3'-C6 hexanediol modified <220> FEATURE:
<221> NAME/KEY: misc_difference <222> LOCATION: 10, 13,
16 <223> OTHER INFORMATION: Methylated cytosine <400>
SEQUENCE: 11 gacgcggagc gtcgtcgtta g 21 <210> SEQ ID NO 12
<211> LENGTH: 114 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Target vimentin sequence <220> FEATURE:
<221> NAME/KEY: misc_difference <222> LOCATION: 2, 10,
21, 32, 35, 40, 47, 49, 54, 58, 69, 77, 85, 93, 110, 113
<223> OTHER INFORMATION: Methylated cytosine <400>
SEQUENCE: 12 tcgtgttttc gtttttttat cgtaggatgt tcggcggttc gggtatcgcg
agtcggtcga 60 gttttagtcg gagttacgtg attacgttta ttcgtattta
tagtttgggc gacg 114 <210> SEQ ID NO 13 <211> LENGTH: 16
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 13 ggcggttcgg gtatcg 16 <210>
SEQ ID NO 14 <211> LENGTH: 21 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 14 cgtaatcacg taactccgac t 21 <210> SEQ ID NO 15
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic flap probe <220> FEATURE: <221>
NAME/KEY: misc_difference <222> LOCATION: 11, 16, 20
<223> OTHER INFORMATION: Methylated cytosine <220>
FEATURE: <221> NAME/KEY: misc_difference <222>
LOCATION: 21 <223> OTHER INFORMATION: 3'-C6 hexanediol
modified <400> SEQUENCE: 15 gacgcggagg cgagtcggtc g 21
<210> SEQ ID NO 16 <211> LENGTH: 100 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: unmethylated vimentin fragment
<400> SEQUENCE: 16 ccgtgtcctc gtcctcctac cgcaggatgt
tcggcggccc gggcaccgcg agccggccga 60 gctccagccg gagctacgtg
actacgtcca cccgcaccta 100 <210> SEQ ID NO 17 <211>
LENGTH: 100 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Methylated vimentin fragment <220> FEATURE: <221>
NAME/KEY: misc_difference <222> LOCATION: 2, 10, 21, 32, 35,
40, 47, 49, 54, 58, 69, 77, 85, 93 <223> OTHER INFORMATION:
Methylated cytosine <400> SEQUENCE: 17 ccgtgtcctc gtcctcctac
cgcaggatgt tcggcggccc gggcaccgcg agccggccga 60 gctccagccg
gagctacgtg actacgtcca cccgcaccta 100 <210> SEQ ID NO 18
<211> LENGTH: 100 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Unmethylated vimentin fragment after bisulfite
reaction <400> SEQUENCE: 18 uugtgtuutu gtuutuutau uguaggatgt
tuggugguuu ggguauugug aguugguuga 60 gutuuaguug gagutaugtg
autaugtuua uuuguauuta 100 <210> SEQ ID NO 19 <211>
LENGTH: 100 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Methylated vimentin fragment after bisulfite reaction <220>
FEATURE: <221> NAME/KEY: misc_difference <222>
LOCATION: 2, 10, 21, 32, 35, 40, 47, 49, 54, 58, 69, 77, 85, 93
<223> OTHER INFORMATION: Methylated cytosine <400>
SEQUENCE: 19 ucgtgtuutc gtuutuutau cguaggatgt tcggcgguuc ggguaucgcg
agucggucga 60 gutuuagucg gagutacgtg autacgtuua uucguauuta 100
1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 19 <210>
SEQ ID NO 1 <211> LENGTH: 207 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: target methylated C6ORF150
<220> FEATURE: <221> NAME/KEY: misc_difference
<222> LOCATION: 16, 21, 34, 42, 52, 58, 72, 82, 88, 99, 107,
121, 126, 144, 148, 152, 154, 167, 169, 188, 190, 201, 207
<223> OTHER INFORMATION: methylated cytosine residues
<400> SEQUENCE: 1 atggaatgtt aggggcgttt cgatggattt tatcgagttt
tcggttgttt tcgaggtcgt 60 tttgtttaag gcgggaaagt tcggtttcgt
taggaagtcg ggatttcggt agaaaaagag 120 cgtttcggat atttaggaga
ggtcgttcgt tcgcgtaatt ggggttcgcg ttaaaaaggt 180 tttttagcgc
gtttaggata cgtagtc 207 <210> SEQ ID NO 2 <211> LENGTH:
24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 2 gggatttcgg tagaaaaaga gcgt 24
<210> SEQ ID NO 3 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 3 acctttttaa cgcgaacccc a 21 <210> SEQ ID NO 4
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic invasive oligonucleotide <400>
SEQUENCE: 4 tcggatattt aggagaggtg 20 <210> SEQ ID NO 5
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic flap probe <220> FEATURE: <221>
NAME/KEY: misc_difference <222> LOCATION: 10, 14, 18, 20
<223> OTHER INFORMATION: Methylated cytosine <220>
FEATURE: <221> NAME/KEY: misc_difference <222>
LOCATION: 21 <223> OTHER INFORMATION: 3'-C6 hexanediol
modified <400> SEQUENCE: 5 gacgcggagc gttcgttcgc g 21
<210> SEQ ID NO 6 <211> LENGTH: 35 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic FRET cassette <220>
FEATURE: <221> NAME/KEY: misc_difference <222>
LOCATION: 1 <223> OTHER INFORMATION: 5'-FAM modified
<220> FEATURE: <221> NAME/KEY: misc_difference
<222> LOCATION: 3 <223> OTHER INFORMATION: Nucleotide
modified with quencher <220> FEATURE: <221> NAME/KEY:
misc_difference <222> LOCATION: 35 <223> OTHER
INFORMATION: 3'-C6 hexanediol modified <400> SEQUENCE: 6
tctagccggt tttccggctg agactccgcg tccgt 35 <210> SEQ ID NO 7
<211> LENGTH: 136 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Target ZNF804B sequence <220> FEATURE:
<221> NAME/KEY: misc_difference <222> LOCATION: 47, 74,
77, 80, 92, 123 <223> OTHER INFORMATION: Methylated cytosine
<400> SEQUENCE: 7 ttaatttgtt tgttttattt gtggttgtat agtttatttt
tgtaatcggt tggggagttg 60 ttgtttttgt taacgtcgtc gttagttaga
gcgttgaaga aaagttgaag gttagtaggt 120 aacgaaagag taaaga 136
<210> SEQ ID NO 8 <211> LENGTH: 30 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 8 gtggttgtat agtttatttt tgtaatcggt 30 <210> SEQ ID
NO 9 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic primer <400> SEQUENCE: 9
accttcaact tttcttcaac gctc 24 <210> SEQ ID NO 10 <211>
LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic invasive oligonucleotide <400> SEQUENCE: 10
gggagttgtt gtttttgtta ag 22 <210> SEQ ID NO 11 <211>
LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Synthetic flap probe <220> FEATURE: <221> NAME/KEY:
misc_difference <222> LOCATION: 21 <223> OTHER
INFORMATION: 3'-C6 hexanediol modified <220> FEATURE:
<221> NAME/KEY: misc_difference <222> LOCATION: 10, 13,
16 <223> OTHER INFORMATION: Methylated cytosine <400>
SEQUENCE: 11 gacgcggagc gtcgtcgtta g 21 <210> SEQ ID NO 12
<211> LENGTH: 114 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Target vimentin sequence <220> FEATURE:
<221> NAME/KEY: misc_difference <222> LOCATION: 2, 10,
21, 32, 35, 40, 47, 49, 54, 58, 69, 77, 85, 93, 110, 113
<223> OTHER INFORMATION: Methylated cytosine <400>
SEQUENCE: 12 tcgtgttttc gtttttttat cgtaggatgt tcggcggttc gggtatcgcg
agtcggtcga 60 gttttagtcg gagttacgtg attacgttta ttcgtattta
tagtttgggc gacg 114 <210> SEQ ID NO 13 <211> LENGTH: 16
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
primer <400> SEQUENCE: 13 ggcggttcgg gtatcg 16 <210>
SEQ ID NO 14 <211> LENGTH: 21 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic primer <400>
SEQUENCE: 14 cgtaatcacg taactccgac t 21 <210> SEQ ID NO 15
<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Synthetic flap probe <220> FEATURE: <221>
NAME/KEY: misc_difference <222> LOCATION: 11, 16, 20
<223> OTHER INFORMATION: Methylated cytosine <220>
FEATURE: <221> NAME/KEY: misc_difference <222>
LOCATION: 21 <223> OTHER INFORMATION: 3'-C6 hexanediol
modified <400> SEQUENCE: 15 gacgcggagg cgagtcggtc g 21
<210> SEQ ID NO 16 <211> LENGTH: 100 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: unmethylated vimentin fragment
<400> SEQUENCE: 16 ccgtgtcctc gtcctcctac cgcaggatgt
tcggcggccc gggcaccgcg agccggccga 60 gctccagccg gagctacgtg
actacgtcca cccgcaccta 100 <210> SEQ ID NO 17 <211>
LENGTH: 100 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Methylated vimentin fragment <220> FEATURE: <221>
NAME/KEY: misc_difference <222> LOCATION: 2, 10, 21, 32, 35,
40, 47, 49, 54, 58, 69, 77, 85, 93 <223> OTHER INFORMATION:
Methylated cytosine <400> SEQUENCE: 17 ccgtgtcctc gtcctcctac
cgcaggatgt tcggcggccc gggcaccgcg agccggccga 60 gctccagccg
gagctacgtg actacgtcca cccgcaccta 100 <210> SEQ ID NO 18
<211> LENGTH: 100 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Unmethylated vimentin fragment after bisulfite
reaction <400> SEQUENCE: 18 uugtgtuutu gtuutuutau uguaggatgt
tuggugguuu ggguauugug aguugguuga 60 gutuuaguug gagutaugtg
autaugtuua uuuguauuta 100 <210> SEQ ID NO 19 <211>
LENGTH: 100 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Methylated vimentin fragment after bisulfite reaction <220>
FEATURE: <221> NAME/KEY: misc_difference <222>
LOCATION: 2, 10, 21, 32, 35, 40, 47, 49, 54, 58, 69, 77, 85, 93
<223> OTHER INFORMATION: Methylated cytosine <400>
SEQUENCE: 19 ucgtgtuutc gtuutuutau cguaggatgt tcggcgguuc ggguaucgcg
agucggucga 60 gutuuagucg gagutacgtg autacgtuua uucguauuta 100
* * * * *