U.S. patent application number 16/277650 was filed with the patent office on 2019-11-07 for rna-yy1 interactions.
The applicant listed for this patent is The General Hospital Corporation. Invention is credited to Yesu Jeon, Jeannie T. Lee.
Application Number | 20190338277 16/277650 |
Document ID | / |
Family ID | 47437411 |
Filed Date | 2019-11-07 |
![](/patent/app/20190338277/US20190338277A1-20191107-D00001.png)
![](/patent/app/20190338277/US20190338277A1-20191107-D00002.png)
![](/patent/app/20190338277/US20190338277A1-20191107-D00003.png)
![](/patent/app/20190338277/US20190338277A1-20191107-D00004.png)
![](/patent/app/20190338277/US20190338277A1-20191107-D00005.png)
![](/patent/app/20190338277/US20190338277A1-20191107-D00006.png)
![](/patent/app/20190338277/US20190338277A1-20191107-D00007.png)
![](/patent/app/20190338277/US20190338277A1-20191107-D00008.png)
![](/patent/app/20190338277/US20190338277A1-20191107-D00009.png)
![](/patent/app/20190338277/US20190338277A1-20191107-D00010.png)
![](/patent/app/20190338277/US20190338277A1-20191107-D00011.png)
View All Diagrams
United States Patent
Application |
20190338277 |
Kind Code |
A1 |
Lee; Jeannie T. ; et
al. |
November 7, 2019 |
RNA-YY1 Interactions
Abstract
Methods relating to obtaining libraries of YY1-binding long
non-coding RNAs, libraries obtained thereby, and methods of use
thereof.
Inventors: |
Lee; Jeannie T.; (Boston,
MA) ; Jeon; Yesu; (Cambridge, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The General Hospital Corporation |
Boston |
MA |
US |
|
|
Family ID: |
47437411 |
Appl. No.: |
16/277650 |
Filed: |
February 15, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14130769 |
Apr 4, 2014 |
10208305 |
|
|
PCT/US2012/045402 |
Jul 3, 2012 |
|
|
|
16277650 |
|
|
|
|
61504660 |
Jul 5, 2011 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
G01N 33/6872 20130101;
C12N 15/1048 20130101; G01N 33/5011 20130101; A61P 35/00 20180101;
G01N 33/57484 20130101; C12N 15/1093 20130101; C12N 15/1072
20130101; G01N 2500/02 20130101; G01N 33/574 20130101 |
International
Class: |
C12N 15/10 20060101
C12N015/10; G01N 33/574 20060101 G01N033/574; G01N 33/68 20060101
G01N033/68; G01N 33/50 20060101 G01N033/50 |
Goverment Interests
FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made with Government support under Grant
No. R01-GM090278 awarded by the National Institutes of Health. The
Government has certain rights in the invention.
Claims
1. A method of preparing a library of nuclear ribonucleic acids
(nRNAs) that specifically bind YY1, the method comprising: (a)
contacting a sample containing nRNAs comprising at least 10.sup.4
different nRNAs, with (i) YY1 protein and (ii) a YY1 binding agent,
under conditions sufficient to form complexes between the nRNA, YY1
protein and the YY1 binding agent, and (b) isolating the
complexes.
2. The method of claim 1, further comprising: (c) synthesizing cDNA
complementary to the nRNA, and (d) selecting cDNAs that (i) have
RPKM above a desired threshold or (ii) are enriched compared to a
control library, or both (i) and (ii).
3. The method of claim 1, comprising: (a) providing the sample
comprising nuclear ribonucleic acids, e.g., a wherein the sample
comprises nuclear lysate, comprising nRNAs bound to nuclear
proteins; (b) contacting the sample with an antibody that binds
specifically to YY1 protein, under conditions sufficient to form
complexes between the agent and YY1 proteins such that the nRNAs
remain bound to the YY1 proteins; (c) isolating the complexes; (d)
synthesizing DNA complementary to the nRNAs to provide an initial
population of cDNAs; (e) PCR-amplifying the cDNAs using
strand-specific primers; purifying the initial population of cDNAs
to obtain a purified population of cDNAs that are at least about 20
nucleotides (nt) in length; (f) sequencing at least part of
substantially all of the purified population of cDNAs; comparing
the high-confidence sequences to a reference genome, and selecting
those sequences that have at least 95% identity to sequences in the
reference genome; and (g) selecting those cDNAs that have (i) reads
per kilobase per million reads (RPKM) above a desired threshold,
and (ii) are enriched as compared to a control library; thereby
preparing the library of cDNAs.
4. The method of claim 1, wherein the agent is an antibody and
isolating the complexes comprises immunoprecipitating the
complexes.
5. The method of claim 1, wherein the cDNAs are synthesized using
strand-specific adaptors.
6. The method of claim 1, further comprising sequencing
substantially all of the cDNAs.
7. A library of cDNAs complementary to a pool of nuclear
ribonucleic acids (nRNAs) prepared by the method of claim 1.
8. The library of claim 7, wherein each of the cDNAs is linked to
an individually addressable bead or area on a substrate.
9. (canceled)
10. The method of claim 1, wherein the sample is a cell-free
sample.
11. The method of claim 1, wherein the sample comprises a cell
expressing the lncRNA and YY1.
12. The method of claim 1, wherein the YY1, the lncRNA, or both, is
labeled.
13. The method of claim 1, further comprising isolating lncRNA-YY1
complexes from the sample.
14. The method of claim 13, further comprising isolating unbound
YY1 from the sample.
15. The method of claim 14, wherein isolating lncRNA-YY1 complexes
and unbound YY1 from the sample comprises contacting the sample
with an anti-YY1 antibody, and isolating lncRNA-YY1-antibody
complexes and unbound YY1.
16. The method of claim 15, further comprising: (a) selecting a
compound that disrupts binding of the lncRNA to YY1; (b) contacting
a tumor cell with the compound; (c) measuring proliferation,
survival, or invasiveness of the tumor cell in the presence and
absence of the compound; and (d) identifying as a candidate
therapeutic compound a compound that inhibits proliferation,
affects survival, e.g., induces or promotes cell death, or reduces
or delays metastasis, of the tumor cell.
17. The method of claim 16, further comprising administering the
candidate compound to an animal model of cancer, and detecting an
effect of the compound on cancer in the animal model.
18. A method of identifying an RNA target for the treatment of
cancer, the method comprising: (a) comparing (i) a library of nRNAs
that specifically bind YY1 prepared from a normal cell with (ii) a
library of nRNAs that specifically bind YY1 prepared from a
cancerous cell, wherein the normal cell and cancerous cell are of
the same tissue type; and (b) identifying an nRNA that is
differentially expressed between the libraries of (a)(i) and
(a)(ii) as an RNA target for treatment of cancer.
19. A method of identifying a therapeutic target for the treatment
of cancer, the method comprising: (a) providing a population of
nRNAs from a first cell type, by: (1) providing a sample comprising
nuclear ribonucleic acids from the first cell type; contacting the
sample with an antibody that binds specifically to YY1 protein,
under conditions sufficient to form complexes between the agent and
YY1 proteins such that the nRNAs remain bound to the YY1 proteins;
isolating the complexes; and thereby providing a population of
nRNAs from the first cell type; (b) providing a population of nRNAs
from a second cell type, by: (1) providing a sample comprising
nuclear ribonucleic acids bound to nuclear proteins, from the
second cell type; contacting the sample with an antibody that binds
specifically to YY1 protein, under conditions sufficient to form
complexes between the agent and YY1 proteins such that the nRNAs
remain bound to the YY1 proteins; isolating the complexes;
synthesizing DNA complementary to the nRNAs to provide an initial
population of cDNAs; (2) thereby providing a population of cDNAs
from the second cell type; wherein the first and second cell types
are from the same type of tissue, and the first or second cell type
is a tumor cell; (c) contacting the population of nRNAs from the
first cell type with the cDNAs from the second cell type, under
conditions sufficient for the nRNAs to bind to complementary cDNAs;
and (d) identifying an nRNA that is differentially expressed in the
first or second cell type as a therapeutic target for the treatment
of cancer.
Description
CLAIM OF PRIORITY
[0001] This application is a continuation of U.S. patent
application Ser. No. 14/130,769, filed Apr. 4, 2014, which is a
U.S. National Phase Application under 35 U.S.C. .sctn. 371 of
International Patent Application No. PCT/US2012/045402, filed on
Jul. 3, 2012, which claims the benefit of U.S. Provisional Patent
Application Ser. No. 61/504,660, filed on Jul. 5, 2011, the entire
contents of the foregoing are hereby incorporated by reference.
TECHNICAL FIELD
[0003] This invention relates to methods for modulation of RNA-YY1
interactions, and methods for identifying compounds that modulate
RNA-YY1 interactions.
BACKGROUND
[0004] Transcriptome analyses have suggested that, although only
1-2% of the mammalian genome is protein-coding, 70-90% is
transcriptionally active (Carninci et al., Science 309, 1559-1563,
2005; Kapranov et al., Science 316, 1484-148, 2007; Mercer et al.,
Nat Rev Genet 10, 155-159, 2009). Ranging from 100 nt to >100
kb, these transcripts are largely unknown in function, may
originate within or between genes, and may be conserved and
developmentally regulated (Kapranov et al., 2007, supra; Guttman et
al., 2009). Methods for targeting these transcripts allow for
modulation of gene expression.
SUMMARY
[0005] The present invention is based, at least in part, on the
discovery that YY1 protein acts as an adaptor protein that loads
non-coding RNAs onto target sequences. Thus, methods and compounds
targeting the YY1-RNA interaction can be used to modulate gene
expression.
[0006] In one aspect, the invention provides methods for preparing
a library of nuclear ribonucleic acids (nRNAs) that specifically
bind YY1. Preferably, the methods include (a) contacting a sample
containing nRNAs, e.g. at least 10.sup.4, 10.sup.5, or 10.sup.6
different nRNAs, with (i) YY1 protein and (ii) a YY1 binding agent,
under conditions sufficient to form complexes between the nRNA, YY1
protein and the YY1 binding agent, and (b) isolating the
complexes.
[0007] In some embodiments, the methods further include (c)
synthesizing cDNA complementary to the nRNA, and (d) selecting
cDNAs that (i) have RPKM above a desired threshold or (ii) are
enriched compared to a control library, or both (i) and (ii).
[0008] In a further aspect, the invention provides methods for
preparing a plurality of cDNAs complementary to a pool of nuclear
ribonucleic acids (nRNAs). Preferably, the methods include
providing a sample comprising nuclear ribonucleic acids, e.g., a
sample comprising nuclear lysate, e.g., comprising nRNAs bound to
nuclear proteins; contacting the sample with an agent, e.g., an
antibody, that binds specifically to YY1 protein, under conditions
sufficient to form complexes between the agent and YY1 proteins,
e.g., such that the nRNAs remain bound to the YY1 proteins;
isolating the complexes; synthesizing DNA complementary to the
nRNAs to provide an initial population of cDNAs; optionally
PCR-amplifying the cDNAs using strand-specific primers; purifying
the initial population of cDNAs to obtain a purified population of
cDNAs that are at least about 20 nucleotides (nt) in length, e.g.,
at least 25, 50, 100, 150 or 200 nt in length; sequencing at least
part of substantially all of the purified population of cDNAs;
comparing the high-confidence sequences to a reference genome, and
selecting those sequences that have a high degree of identity to
sequences in the reference genome, e.g., at least 95%, 98%, or 99%
identity, or that have fewer than 10, 5, 2, or 1 mismatches; and
selecting those cDNAs that have (i) reads per kilobase per million
reads (RPKM) above a desired threshold, and (ii) are enriched as
compared to a control library (e.g., a protein-null library or
library made from an IgG pulldown done in parallel); thereby
preparing the library of cDNAs.
[0009] In some embodiments, the methods further include a step of
crosslinking the nRNAs bound to nuclear proteins, e.g., using
methods known in the art, including chemical or other crosslinkers,
e.g., ultraviolet irradiation.
[0010] In some embodiments of the methods described herein, the
agent is an antibody and isolating the complexes comprises
immunoprecipitating the complexes.
[0011] In some embodiments of the methods described herein, the
cDNAs are synthesized using strand-specific adaptors.
[0012] In some embodiments, the methods described herein include
sequencing substantially all of the cDNAs.
[0013] In a further aspect, the invention provides libraries of
cDNAs complementary to a pool of nuclear ribonucleic acids (nRNAs)
prepared by a method described herein. In some embodiments, each of
the cDNAs is linked to an individually addressable bead or area on
a substrate.
[0014] In a further aspect, the invention provides methods for
identifying compounds that disrupts binding of one or more long
non-coding RNAs (lncRNAs) to YY1 protein. Preferably, the methods
include providing a sample comprising a lncRNA and YY1, wherein the
lncRNA can bind to the YY1 and form lncRNA-YY1 complexes;
contacting the sample with a test compound; and detecting the
formation of lncRNA-YY1 complexes in the presence and the absence
of the test compound, wherein a decrease in formation of lncRNA-YY1
complexes in the presence of the test compound as compared to
formation of lncRNA-YY1 complexes in the absence of the test
compound indicates that the test compound disrupts binding of the
lncRNA to YY1.
[0015] In some embodiments of the methods described herein, the
sample is a cell-free sample. In some embodiments, the sample
comprises a cell expressing the lncRNA and YY1. In some
embodiments, the sample is from a mammalian cell, e.g., a human
cell or a non-human animal cell, e.g., a non-human primate, cow,
pig, sheep, horse, cat, dog, or other domestic or agricultural
animal.
[0016] In some embodiments of the methods described herein, the
YY1, the lncRNA, or both, is labeled.
[0017] In some embodiments, the test compound is a nucleic acid,
e.g., an antagomir, mixmer, or gapmer of LNA.
[0018] In some embodiments, the methods described herein further
include isolating lncRNA-YY1 complexes from the sample, and
optionally isolating unbound YY1 from the sample, e.g., by
contacting the sample with an anti-YY1 antibody, and isolating
lncRNA-YY1-antibody complexes and unbound YY1.
[0019] In some embodiments, the methods further include selecting a
compound that disrupts binding of the lncRNA to YY1; contacting a
tumor cell with the compound; measuring proliferation, survival, or
invasiveness of the tumor cell in the presence and absence of the
compound; and identifying as a candidate therapeutic compound a
compound that inhibits proliferation, affects survival, e.g.,
induces or promotes cell death, or reduces or delays metastasis, of
the tumor cell.
[0020] In some embodiments, the methods further include
administering the candidate compound to an animal model of cancer,
and detecting an effect of the compound on cancer in the animal
model, e.g., an effect on tumor size or metastasis.
[0021] In a further aspect, the invention provides methods for
identifying an RNA target for the treatment of cancer, the method
comprising: (a) comparing (i) a library of nRNAs that specifically
bind YY1 prepared from a normal cell with (ii) a library of nRNAs
that specifically bind YY1 prepared from a cancerous cell, wherein
the normal cell and cancerous cell are of the same tissue type; and
(b) identifying an nRNA that is differentially expressed between
the libraries of (a)(i) and (a)(ii) as an RNA target for treatment
of cancer.
[0022] In a further aspect, the invention provides methods for
identifying a therapeutic target for the treatment of cancer, the
method comprising: providing a population of nRNAs from a first
cell type, by: [0023] (1) providing a sample comprising nuclear
ribonucleic acids, e.g., a sample comprising nuclear lysate, e.g.,
comprising nRNAs bound to nuclear proteins, from the first cell
type; [0024] contacting the sample with an agent, e.g., an
antibody, that binds specifically to YY1 protein, under conditions
sufficient to form complexes between the agent and YY1 proteins,
e.g., such that the nRNAs remain bound to the YY1 proteins; [0025]
isolating the complexes; and [0026] thereby providing a population
of nRNAs from the first cell type; [0027] (b) providing a
population of nRNAs from a second cell type, by: [0028] (1)
providing a sample comprising nuclear ribonucleic acids, e.g., a
sample comprising nuclear lysate, e.g., comprising nRNAs bound to
nuclear proteins, from the second cell type; [0029] contacting the
sample with an agent, e.g., an antibody, that binds specifically to
YY1 protein, under conditions sufficient to form complexes between
the agent and YY1 proteins, e.g., such that the nRNAs remain bound
to the YY1 proteins; [0030] isolating the complexes; [0031]
synthesizing DNA complementary to the nRNAs to provide an initial
population of cDNAs; [0032] (2) thereby providing a population of
cDNAs from the second cell type; [0033] (c) wherein the first and
second cell types are from the same type of tissue, and the first
or second cell type is a tumor cell; [0034] (d) contacting the
population of nRNAs from the first cell type with the cDNAs from
the second cell type, under conditions sufficient for the nRNAs to
bind to complementary cDNAs; and [0035] (e) identifying an nRNA
that is differentially expressed in the first or second cell type
as a therapeutic target for the treatment of cancer.
[0036] As used herein, "YY1" refers to transcriptional repressor
protein YY1, the human homolog of which has a nucleic acid sequence
as set forth in the GenBank database at
NM_003403.3.fwdarw.NP_003394.1
[0037] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Methods
and materials are described herein for use in the present
invention; other, suitable methods and materials known in the art
can also be used. The materials, methods, and examples are
illustrative only and not intended to be limiting. All
publications, patent applications, patents, sequences, database
entries, and other references mentioned herein are incorporated by
reference in their entirety. In case of conflict, the present
specification, including definitions, will control.
[0038] Other features and advantages of the invention will be
apparent from the following detailed description and figures, and
from the claims.
DESCRIPTION OF DRAWINGS
[0039] FIGS. 1A-E. Newly introduced Xist transgenes squelch Xist
RNA from Xi in MEFs.
[0040] 1A. Map of Xist and transgenes. M, MluI; R, RsrII; N, NheI;
P, PmlI.
[0041] 1B. qRT-PCR of Xist in wildtype female MEF (WT) and two X+P
clones. Transgenic RNA quantitated at uXist; total Xist at Exons
1-3. Xist levels normalized to WT (set arbitrarily to 1.0).
Averages .+-.1 standard deviation (SD) from three independent
experiments shown.
[0042] 1C. Xist qRT-PCR measured at Exons 1-3.
[0043] 1D. qRT-PCR of transgenic Xist for X-RF(7) and X-RARF(10).
Levels at Dox 0h set to 1.0.
[0044] 1E. qRT-PCR of endogenous (uRA) and total (exons 1-3) Xist
in X-RA clones.
[0045] FIGS. 2A-B. Autosomal transgenes attract Xist RNA way from
Xi.
[0046] 2A. Map of Xist, FISH probes, and transgenes. P, PasI.
[0047] 2B. qRT-PCR for total (uRA) and endogenous (dRE) Xist.
[0048] FIGS. 3A-E. YY1 protein is required for Xist
localization.
[0049] 3A. Map of the proximal 2-kb region of Xist. One CTCF and
three putative YY1 binding sites near Repeat F are shown.
[0050] 3B. Western blot and qRT-PCR 48 hours after Ctcf knockdown
using C1 or C3 siRNA. Averages .+-.SD of three independent
experiments shown.
[0051] 3C. YY1 Western blot and Yy1/Xist qRT-PCR after Yy1
knockdown using Y1 or Y2 siRNA. Averages .+-.SD from 7 independent
experiments shown for qRT-PCR. One representative Western blot
shown.
[0052] 3D. Xist FISH after Yy1 knockdown. Cells with pinpoint or no
Xist were scored negative. Averages .+-.SD from 206-510
nuclei/sample from three independent experiments.
[0053] 3E. H3K27me3 immunostaining followed by Xist RNA FISH in
Yy1-knockdown cells. Histogram shows counts (n=62-138).
[0054] FIGS. 4A-C. Mutating YY1-binding sites in the DNA abolishes
Xist RNA loading
[0055] 4A. Map of proximal Xist, YY1-binding sites, transgenes, and
EMSA probe. Site-directed mutation of YY1 sites shown.
[0056] 4B. Left panels: SDS-PAGE, Coomassie staining, and Western
blot of purified recombinant His-YY1 protein. Right panel: EMSA
using YY1 and a 280-bp uRF probe. WT, wildtype YY1 probe. Mut,
mutated YY1 probe. Arrow, YY1-uRF shift. Asterisks, increasing Yy1
occupancy on uRF probe.
[0057] 4C. qRT-PCR of total (Exons 1-3) and endogenous (uRA) Xist
in female X-RA.sup.YyIm cells.
[0058] FIGS. 5A-C. Xi-specific YY1 binding in MEFs and ES
cells.
[0059] 5A. Map of the Xist deletion in MEF lines (Csankovszki et
al., 1999; Zhang et al., 2007), ChIP-PCR amplicons, and YY1
sites.
[0060] 5B. YY1 ChIP analyses in indicated cell lines. At least
three independent experiments performed for each cell line.
Averages .+-.standard errors (SE) from at least 3 independent
experiments shown. Statistical significance, P, determined by the
Student t-test (asterisks).
[0061] 5C. YY1 knockdown in differentiating female ES cells
(Tsix.sup.TST/+) via the indicated timeline. Cells were split into
siRNA-treated and -untreated samples on day 6 (d6). Western blot
showed good knockdown. Xist qRT-PCR showed constant steady state
levels; averages .+-.SD from three independent knockdown
experiments shown.
[0062] FIGS. 6A-F. YY1 is an RNA-binding protein that bridges Xist
and chromatin.
[0063] 6A. Map of Xist, transgenes, and RT-PCR amplicons.
[0064] 6B. UV-crosslink RIP of female MEFs, followed by qRT-PCR for
Xist (dRC, Exons 1-3) or RNA controls (U1 snRNA, Gapdh). Samples
were precipitated with YY1 antibodies or IgG. 1% input used. -UV
and -RT controls performed in parallel. Left panel, EtBr-stained
gel. Right panel, RT-PCR quantitation. Averages .+-.SE of 3
independent experiments.
[0065] 6C. RNA pulldown assay using purified His-YY1 or His-GFP
(Western blot) and WT female ES RNA. RT-PCR quantitation shown at 3
different Xist positions (uRF, uRA, dRE) and two controls (Gadph,
.alpha.-tubulin). Averages of 5 independent experiments .+-.SE.
[0066] 6D. RNA pulldown assay using RNAs from transgenic lines
after dox induction. qRT-PCR performed at dRC. Averages .+-.SE for
3 independent experiments.
[0067] 6E. RNA pulldown assay using equal molar amounts of in
vitro-transcribed RNA fragments AF (2.5 kb), BC (2.5 kb), eE1 (2.5
kb), B (1.2 kb), and C (1.8 kb) as illustrated in the map.
Quantitated by qRT-PCR. 20% of input shown on the gel. P calculated
using t-test. B, BamHI; E, EcoRI; Bs, BstBI; S, ScaI. Averages of 2
independent experiments .+-.SE.
[0068] 6F. Schematic diagram showing that YY1 contacts Xist RNA and
DNA via different nucleic acid motifs.
DETAILED DESCRIPTION
[0069] The experiments described herein elucidate how Xist RNA
loads onto Xi and establishes its action in cis. This work
identifies its primary loading site--dubbed the `nucleation
center`--and shows that bound YY1 proteins trap the Xist silencing
complex before it can translocate in cis along Xi. A most
surprising observation, however, is that Xist RNA is not inherently
cis-acting. The RNA freely diffuses and trans-migrates between any
chromosome bearing an open loading site. These discoveries imply
that Xist RNA is not irreversibly bound to chromatin and that, when
displaced from chromatin, the RNA remains stable and free to act in
trans. Thus, the RNA's selective action on Xi cannot only be the
result of Xi-specific transcription, but must also be the
consequence of allele-specific binding of YY1 to the nucleation
center. Even so, YY1 alone cannot specify the Xi fate, as Xist does
not nucleate at any other of a large number of genome-wide
YY1-bound sites. YY1 and as yet undefined accessory factors--such
as lncRNAs like Tsix which are specific to X--may conspire to
define the nucleation center.
[0070] Importantly, YY1 binds both DNA and RNA. Specific YY1-DNA
contacts are required to formulate the nucleation center, and
specific YY1-RNA interactions are necessary to load Xist particles
(FIG. 6F). YY1 is therefore a bivalent protein that bridges
regulatory long ncRNA and its chromatin target. Its zinc fingers
may mediate the interaction with both DNA and RNA, as some zinc
finger proteins can bind RNA as well as DNA in vitro (Iuchi, 2001).
Interestingly, although YY1 binds the AAnATGGCG motif on DNA, its
interaction with Xist RNA does not occur through the corresponding
motif on the RNA. Instead it contacts Xist RNA via Repeat C, a
C-rich repeat unique to Xist and one of the best-conserved elements
within eutherian Xist/XIST (Brockdorff et al., 1992; Brown et al.,
1992). A recent study has shown that targeting Repeat C and an
adjacent exon 1 sequence using locked nucleic acids (LNAs) causes
rapid Xist displacement from Xi (Sarma et al., 2010). Given that
Repeat C is the YY1-binding domain of Xist RNA, one possibility is
that the LNA inhibited crucial interactions between Xist and the
YY1 receptor. This work shows that Repeat A is not required. It was
previously reported that human XIST without the Repeat A region
cannot localize properly (Chow et al., 2007); however, the deletion
removed not only Repeat A but also three of eight clustered YY1
sites, which could therefore compromise the nucleation center. The
data demonstrate that Xist RNA's interactions with two proteins are
crucial for XCI: EZH2 (PRC2) via Repeat A to form the silencing
complex, and YY1 via Repeat C to load onto the nucleation center
(FIG. 6F).
[0071] The data have implications for Polycomb regulation. Because
the PRC2 subunits, EED, EZH2, SUZ12, and RBAP48, lack
sequence-specific DNA binding subunits, cis-acting long ncRNAs have
been proposed as locus-specific recruiting tools (Zhao et al.,
2008; Lee, 2009, 2010). The concept of YY1 as docking protein is
intriguing, given that the related protein, PHO, has been proposed
to recruit Polycomb complexes in fruit flies (Ringrose and Paro,
2004; Schwartz and Pirrotta, 2008). Mammalian YY1 has been
implicated as a binding partner for PRC2 (Atchison et al., 2003;
Wilkinson et al., 2006; Ku et al., 2008). This idea has been
debated, however, as YY1 has not generally co-purified with PRC2
(Kuzmichev et al., 2002; Landeira et al., 2010; Li et al., 2010),
mutating YY1 sites in HOX-D does not abrogate PRC2 binding (Woo et
al., 2010), and YY1 motifs are not enriched near PRC2-binding sites
(Mendenhall et al., 2010). Nevertheless, this work demonstrates
that YY1 is required for Xist loading and, by inference, for
Polycomb recruitment in the context of XCI.
[0072] RIP-Seq--Methods of Producing Long Non-Coding RNAs
[0073] Described herein are methods for producing libraries of
lncRNAs that bind to YY1. In some embodiments, the methods include
the steps shown in FIG. 1A; one of skill in the art will appreciate
that other techniques can be substituted for those shown.
[0074] In some embodiments, the methods include providing a sample
comprising nuclear ribonucleic acids (nRNAs) bound to YY1; and
contacting the sample with an agent, e.g., an antibody, that binds
specifically to YY1, under conditions and for a time sufficient to
form complexes between the agent and the protein; isolating the
complexes; synthesizing DNA complementary to the nRNAs to provide
an initial population of cDNAs; PCR-amplifying, if necessary, using
strand-specific primers; purifying the initial population of cDNAs
to obtain a purified population of cDNAs that are at least 20
nucleotides (nt) in length; high-throughput sequencing the purified
population of cDNAs. Homopolymer reads are filtered, and reads
matching the mitochondrial genome and ribosomal RNAs are excluded
from all subsequent analyses. Reads that align to a reference
genome with .ltoreq.1 mismatch are retained, excluding
homopolymers, reads that align to the mitochondrial genome, and
ribosomal RNAs. High probability YY1-interacting transcripts are
then called based on two criteria: (1) that the candidate
transcript has a minimum read density in RPKM terms (number of
reads per kilobase per million reads); (2) that the candidate
transcript is enriched in the wildtype library versus a suitable
control library (such as a protein-null library or library made
from an IgG pulldown done in parallel).
[0075] In general, to construct RIP-seq libraries, cell nuclei are
prepared, treated with DNAse, and incubated with antibodies
directed against a chromatin-associated factor of interest, along
with a control IgG reaction in parallel. RNA-protein complexes are
then immunoprecipitated with agarose beads, magnetic beads, or any
other platform in solution or on a solid matrix (e.g., columns,
microfluidic devices). RNAs are extracted using standard
techniques. To capture all RNAs (not just polyA RNAs) and to
preserve strand information, asymmetric primers are used to
generate cDNA from the RNA template, in which the first adaptor
(adaptor1) to make the first strand cDNA contains a random multimer
sequence (such as random hexamers) at the 3' end. A reverse
transcriptase is used to create the first strand. A distinct second
adaptor (adaptor2) is used to create the second strand. One example
is as follows: If Superscript II is used, it will add non-template
CCC 3' overhangs, which can then be used to hybridize to a second
adaptor containing GGG at the 3' end, which anneal to the
non-template CCC overhangs. Other methods of creating second
strands may be substituted. PCR using adaptor1- and
adaptor2-specific primer pairs is then the performed to amplify the
cDNAs and the products sequenced via standard methods of high
throughput sequencing. Prior to sequencing, a size-selection step
can be incorporated (if desired) in which RNAs or cDNAs of desired
sizes are excised after separation by gel electrophoresis (e.g., on
a Nu-Sieve agarose gel or in an acrylamide gel) or other methods of
purification, such as in a microfluidic device or in standard
biochemical columns.
[0076] YY1--Binding lncRNAs and lncRNA Libraries
[0077] The present invention includes libraries of lncRNAs produced
by methods described herein. In some embodiments, the libraries are
in solution, or are lyophilized. In some embodiments, the libraries
are bound to a substrate, e.g., wherein each member of the library
is bound to an individually addressable member, e.g., an individual
area on an array (e.g., a microarray), or a bead.
[0078] In one embodiment, a lncRNA includes a nucleotide sequence
that is at least about 85% or more homologous to the entire length
of a lncRNA sequence shown herein, e.g., in Table 2, 3, 4, or 5, or
a fragment comprising at least 20 nt thereof (e.g., at least 25,
30, 35, 40, 50, 60, 70, 80, 90, or 100 nt thereof, e.g., at least
5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50% or more of the full
length lncRNA). In some embodiments, the nucleotide sequence is at
least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or
100% to a lncRNA sequence shown herein. In some embodiments, the
nucleotide sequence is at least about 85%, e.g., is at least about
90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homologous
to a lncRNA sequence described herein in a region that is much more
conserved but has lower sequence identity outside that region.
[0079] LncRNAs may be functionally conserved without being highly
conserved at the level of overall nucleotide identity. For example,
mouse Xist shows only 76% overall nucleotide identity with human
XIST using sliding 21-bp windows, or an overall sequence identity
of only 60%. However, within specific functional domains, such as
Repeat A, the degree of conservation can be >70% between
different mammalian species. The crucial motif in Repeat A is the
secondary structures formed by the repeat. For YY1-Xist
interactions, the crucial motif is Repeat C, which has a similar
degree of conservation between mammalian species. Other lncRNAs
interacting with YY1 may therefore be similarly low in overall
conservation but still have conservation in secondary structure
within specific domains of the RNA, and thereby demonstrate
functional conservation with respect to recruitment of YY1.
[0080] Calculations of homology or sequence identity between
sequences (the terms are used interchangeably herein) are performed
as follows.
[0081] To determine the percent identity of two nucleic acid
sequences, the sequences are aligned for optimal comparison
purposes (e.g., gaps can be introduced in one or both of a first
and a second amino acid or nucleic acid sequence for optimal
alignment and non-homologous sequences can be disregarded for
comparison purposes). The length of a reference sequence aligned
for comparison purposes is at least 80% of the length of the
reference sequence, and in some embodiments is at least 90% or
100%. The nucleotides at corresponding amino acid positions or
nucleotide positions are then compared. When a position in the
first sequence is occupied by the same nucleotide as the
corresponding position in the second sequence, then the molecules
are identical at that position (as used herein nucleic acid
"identity" is equivalent to nucleic acid "homology"). The percent
identity between the two sequences is a function of the number of
identical positions shared by the sequences, taking into account
the number of gaps, and the length of each gap, which need to be
introduced for optimal alignment of the two sequences.
[0082] For purposes of the present invention, the comparison of
sequences and determination of percent identity between two
sequences can be accomplished using a Blossum 62 scoring matrix
with a gap penalty of 12, a gap extend penalty of 4, and a
frameshift gap penalty of 5.
[0083] There are several potential uses for the lncRNAs described
herein in the YY1 transcriptome: The RNAs themselves, or antagomirs
and small molecules designed against them, can be utilized to
modulate expression (either up or down) of YY1 target genes. In
addition, the lncRNAs can be used in methods of detecting or
identifying cancerous cells, as described herein.
[0084] Methods of Detecting Cancer
[0085] YY1 expression is altered in cancerous cells (see, e.g., Lee
et al., Oncogene. "Yin Yang 1 positively regulates BRCA1 and
inhibits mammary cancer formation." 2011 Jun. 13 (doi:
10.1038/onc.2011.217); Zaravinos and Spandidos, Cell Cycle. 2010
Feb. 1; 9(3):512-22; Wang et al., Expert Opin Ther Targets. 2006
April; 10(2):253-66; Castellano et al., Cell Cycle. 2009 May 1;
8(9):1367-72. Epub 2009 May 26). Libraries of YY1-binding lncRNAs
described herein, and nucleic acids targeting them, can be used to
detect modulated gene expression in a cell, e.g., a cancer cell.
The cells can be, e.g., from a subject who has cancer, e.g., tumor
cells or cells suspected of being tumor cells.
[0086] These methods can be used to diagnose cancer a subject by
detecting the presence of differential expression of YY1-binding
lncRNAs in a suspected cancer cell versus a normal cell, e.g., a
cell from the same subject, e.g., from the same tissue in the same
subject. The presence of differential expression indicates the
presence of cancer in the subject. These methods can also be used
to identify lncRNAs that are differentially expressed in cancer
cells versus normal cells; once identified, those lncRNAs can be
targeted to alter the proliferative state of the cell. Thus the
methods described herein can be used to identify therapeutic
targets for the treatment of cancer; the lncRNAs can be targeted
using antagomirs, antisense, siRNA and other inhibitory nucleic
acids, e.g., as described in U.S. Provisional Patent Application
No. 61/425,174.
[0087] As used herein, treating includes "prophylactic treatment"
which means reducing the incidence of or preventing (or reducing
risk of) a sign or symptom of a disease in a patient at risk for
the disease, and "therapeutic treatment", which means reducing
signs or symptoms of a disease, reducing progression of a disease,
reducing severity of a disease, in a patient diagnosed with the
disease. With respect to cancer, treating includes inhibiting tumor
cell proliferation, increasing tumor cell death or killing,
inhibiting rate of tumor cell growth or metastasis, reducing size
of tumors, reducing number of tumors, reducing number of
metastases, increasing 1-year or 5-year survival rate.
[0088] Examples of cellular proliferative and/or differentiative
disorders include cancer, e.g., carcinoma, sarcoma, metastatic
disorders or hematopoietic neoplastic disorders, e.g., leukemias. A
metastatic tumor can arise from a multitude of primary tumor types,
including but not limited to those of prostate, colon, lung, breast
and liver origin.
[0089] As used herein, the terms "cancer", "hyperproliferative" and
"neoplastic" refer to cells having the capacity for autonomous
growth, i.e., an abnormal state or condition characterized by
rapidly proliferating cell growth. Hyperproliferative and
neoplastic disease states may be categorized as pathologic, i.e.,
characterizing or constituting a disease state, or may be
categorized as non-pathologic, i.e., a deviation from normal but
not associated with a disease state. The term is meant to include
all types of cancerous growths or oncogenic processes, metastatic
tissues or malignantly transformed cells, tissues, or organs,
irrespective of histopathologic type or stage of invasiveness.
"Pathologic hyperproliferative" cells occur in disease states
characterized by malignant tumor growth. Examples of non-pathologic
hyperproliferative cells include proliferation of cells associated
with wound repair.
[0090] The terms "cancer" or "neoplasms" include malignancies of
the various organ systems, such as affecting lung (e.g. small cell,
non-small cell, squamous, adenocarcinoma), breast, thyroid,
lymphoid, gastrointestinal, genito-urinary tract, kidney, bladder,
liver (e.g. hepatocellular cancer), pancreas, ovary, cervix,
endometrium, uterine, prostate, brain, as well as adenocarcinomas
which include malignancies such as most colon cancers, colorectal
cancer, renal-cell carcinoma, prostate cancer and/or testicular
tumors, non-small cell carcinoma of the lung, cancer of the small
intestine and cancer of the esophagus.
[0091] The term "carcinoma" is art recognized and refers to
malignancies of epithelial or endocrine tissues including
respiratory system carcinomas, gastrointestinal system carcinomas,
genitourinary system carcinomas, testicular carcinomas, breast
carcinomas, prostatic carcinomas, endocrine system carcinomas, and
melanomas. In some embodiments, the disease is renal carcinoma or
melanoma. Exemplary carcinomas include those forming from tissue of
the cervix, lung, prostate, breast, head and neck, colon and ovary.
The term also includes carcinosarcomas, e.g., which include
malignant tumors composed of carcinomatous and sarcomatous tissues.
An "adenocarcinoma" refers to a carcinoma derived from glandular
tissue or in which the tumor cells form recognizable glandular
structures.
[0092] The term "sarcoma" is art recognized and refers to malignant
tumors of mesenchymal derivation.
[0093] Additional examples of proliferative disorders include
hematopoietic neoplastic disorders. As used herein, the term
"hematopoietic neoplastic disorders" includes diseases involving
hyperplastic/neoplastic cells of hematopoietic origin, e.g.,
arising from myeloid, lymphoid or erythroid lineages, or precursor
cells thereof. Preferably, the diseases arise from poorly
differentiated acute leukemias, e.g., erythroblastic leukemia and
acute megakaryoblastic leukemia. Additional exemplary myeloid
disorders include, but are not limited to, acute promyeloid
leukemia (APML), acute myelogenous leukemia (AML) and chronic
myelogenous leukemia (CML) (reviewed in Vaickus, L. (1991) Crit
Rev. in Oncol./Hemotol. 11:267-97); lymphoid malignancies include,
but are not limited to acute lymphoblastic leukemia (ALL) which
includes B-lineage ALL and T-lineage ALL, chronic lymphocytic
leukemia (CLL), prolymphocytic leukemia (PLL), hairy cell leukemia
(HLL) and Waldenstrom's macroglobulinemia (WM). Additional forms of
malignant lymphomas include, but are not limited to non-Hodgkin
lymphoma and variants thereof, peripheral T cell lymphomas, adult T
cell leukemia/lymphoma (ATL), cutaneous T-cell lymphoma (CTCL),
large granular lymphocytic leukemia (LGF), Hodgkin's disease and
Reed-Sternberg disease.
[0094] Methods of Screening
[0095] Included herein are methods for screening test compounds,
e.g., polypeptides, polynucleotides, inorganic or organic large or
small molecule test compounds, to identify agents useful in the
treatment of cancer.
[0096] As used herein, "small molecules" refers to small organic or
inorganic molecules of molecular weight below about 3,000 Daltons.
In general, small molecules useful for the invention have a
molecular weight of less than 3,000 Daltons (Da). The small
molecules can be, e.g., from at least about 100 Da to about 3,000
Da (e.g., between about 100 to about 3,000 Da, about 100 to about
2500 Da, about 100 to about 2,000 Da, about 100 to about 1,750 Da,
about 100 to about 1,500 Da, about 100 to about 1,250 Da, about 100
to about 1,000 Da, about 100 to about 750 Da, about 100 to about
500 Da, about 200 to about 1500, about 500 to about 1000, about 300
to about 1000 Da, or about 100 to about 250 Da).
[0097] The test compounds can be, e.g., natural products or members
of a combinatorial chemistry library. A set of diverse molecules
should be used to cover a variety of functions such as charge,
aromaticity, hydrogen bonding, flexibility, size, length of side
chain, hydrophobicity, and rigidity. Combinatorial techniques
suitable for synthesizing small molecules are known in the art,
e.g., as exemplified by Obrecht and Villalgordo, Solid-Supported
Combinatorial and Parallel Synthesis of Small-Molecular-Weight
Compound Libraries, Pergamon-Elsevier Science Limited (1998), and
include those such as the "split and pool" or "parallel" synthesis
techniques, solid-phase and solution-phase techniques, and encoding
techniques (see, for example, Czarnik, Curr. Opin. Chem. Bio.
1:60-6 (1997)). In addition, a number of small molecule libraries
are commercially available. A number of suitable small molecule
test compounds are listed in U.S. Pat. No. 6,503,713, incorporated
herein by reference in its entirety.
[0098] In some embodiments, the test compounds are nucleic acids,
e.g., one or more nucleic acids that have identity to all or a
portion of the YY1-binding RNA, or a set of randomly generated
oligos. The oligos can be LNAs, and can be antagomirs, mixmers, or
gapmers.
[0099] Libraries screened using the methods of the present
invention can comprise a variety of types of test compounds. A
given library can comprise a set of structurally related or
unrelated test compounds. In some embodiments, the test compounds
are peptide or peptidomimetic molecules. In some embodiments, the
test compounds are nucleic acids.
[0100] In some embodiments, the test compounds and libraries
thereof can be obtained by systematically altering the structure of
a first test compound, e.g., a first test compound that is
structurally similar to a known natural binding partner of the
target polypeptide, or a first small molecule identified as capable
of binding the target polypeptide, e.g., using methods known in the
art or the methods described herein, and correlating that structure
to a resulting biological activity, e.g., a structure-activity
relationship study. As one of skill in the art will appreciate,
there are a variety of standard methods for creating such a
structure-activity relationship. Thus, in some instances, the work
may be largely empirical, and in others, the three-dimensional
structure of an endogenous polypeptide or portion thereof can be
used as a starting point for the rational design of a small
molecule compound or compounds. For example, in one embodiment, a
general library of small molecules is screened, e.g., using the
methods described herein.
[0101] In some embodiments, a test compound is applied to a test
sample, e.g., a cancer cell, and one or more effects of the test
compound is evaluated. In a cultured cancer cell for example, the
ability of the test compound to inhibit proliferation or affect
survival, e.g., to induce or promote cell death, is evaluated.
[0102] In some embodiments, the test sample is, or is derived from
(e.g., a sample taken from) a tumor, e.g., a primary or cultured
tumor cell.
[0103] Methods for evaluating each of these effects are known in
the art. For example, assays of proliferation or cell
survival/viability are well known in the art.
[0104] A test compound that has been screened by a method described
herein and determined to inhibit proliferation or affect survival,
e.g., induce or promote cell death, can be considered a candidate
compound. A candidate compound that has been screened, e.g., in an
in vivo model of a disorder, e.g., a xenograft model, and
determined to have a desirable effect on the disorder, e.g., on
growth or metastasis of a tumor, can be considered a candidate
therapeutic agent. Candidate therapeutic agents, once screened in a
clinical setting, are therapeutic agents. Candidate compounds,
candidate therapeutic agents, and therapeutic agents can be
optionally optimized and/or derivatized, and formulated with
physiologically acceptable excipients to form pharmaceutical
compositions.
[0105] Thus, test compounds identified as "hits" (e.g., test
compounds that inhibit proliferation or affect survival, e.g.,
induce or promote cell death) in a first screen can be selected and
systematically altered, e.g., using rational design, to optimize
binding affinity, avidity, specificity, or other parameter. Such
optimization can also be screened for using the methods described
herein. Thus, in one embodiment, the invention includes screening a
first library of compounds using a method known in the art and/or
described herein, identifying one or more hits in that library,
subjecting those hits to systematic structural alteration to create
a second library of compounds structurally related to the hit, and
screening the second library using the methods described
herein.
[0106] Test compounds identified as hits can be considered
candidate therapeutic compounds, useful in treating cancer. A
variety of techniques useful for determining the structures of
"hits" can be used in the methods described herein, e.g., NMR, mass
spectrometry, gas chromatography equipped with electron capture
detectors, fluorescence and absorption spectroscopy. Thus, the
invention also includes compounds identified as "hits" by the
methods described herein, and methods for their administration and
use in the treatment, prevention, or delay of development or
progression of a disorder described herein.
[0107] Test compounds identified as candidate therapeutic compounds
can be further screened by administration to an animal model of a
tumor, e.g., a xenograft model, as known in the art. The animal can
be monitored for a change in the disorder, e.g., for an improvement
in a parameter of the disorder, e.g., a parameter related to
clinical outcome. In some embodiments, the parameter is tumor size,
and an improvement would be a reduction or stabilization of tumor
size, or a reduction in growth rate; in some embodiments, the
parameter is invasiveness, and an improvement would be a reduction
or delay in metastasis.
Examples
[0108] The invention is further described in the following
examples, which do not limit the scope of the invention described
in the claims.
Example 1. Identification of an X-Inactivation Nucleation Center
and YY1 as Receptor for Xist RNA
[0109] The present Example describes experiments performed to
identify proteins involved in X-inactivation nucleation.
[0110] Experimental Procedures
[0111] The following materials and methods were used in the present
Example.
[0112] Transgene Constructs
[0113] Transgenes were constructed by modifying an Xist plasmid,
pSx9. Xist inserts were generated by PCR and replaced the
corresponding region in pSx9 by digesting with SalI and PmlI. All
constructs were put into the doxycycline-inducible system, pTRE2hyg
(Clontech). Enzyme sites used for deletions are indicated in FIG.
1A. 3' truncations were generated by excising a 13.5-kb PasI
fragment from transgenes. For X-RA.sup.YY1m, YY1 binding sites were
altered with QuikChange.RTM. Multi Site-Directed Mutagenesis Kit
(Stratagene).
[0114] Cell Lines
[0115] Xist deletion fibroblasts (XaXi.sup..DELTA.Xist and
XiX.sup..DELTA.Xist) and Tsix.sup.TST/+ cells have been described
(Zhang et al., 2007; Ogawa et al., 2008). For the tet-inducible
system, rt-TA expressing fibroblasts were isolated from 13.5-dpc
Rosa26-M2rtTA.sup.+/- embryos (Hochedlinger et al., 2005),
immortalized with SV-40 large T-antigen, and cloned by limiting
dilution. Ploidy was checked by metaphase analysis and X-painting.
One male and one female clone was used for further analysis. To
generate transgenic MEF lines, 15 .mu.g of linearized transgene DNA
was introduced into .about.4.times.10.sup.6 cells by
electroporation (200 V, 1,050 .mu.F), selected in 250 .mu.g/ml
hygromycin B, and clones were picked after 2 weeks. Autosomal
integration was confirmed by DNA FISH.
[0116] RNA FISH, DNA FISH, and Immunostaining
[0117] Experiments were performed as described (Zhang et al., 2007)
with minor changes. Xist RNA was detected using an Xist-riboprobe
cocktail unless indicated. RA, E1, E7, and the transgene-specific
probe, pSacBII, were labeled by nick translation (Roche). For
immunostaining, cells were blocked with PBS containing 0.3% Tween20
and 3% BSA for 15 minutes before primary antibody incubation.
H3K27me3 antibodies were from Active Motif (#39535). DNA FISH
combined with RNA FISH or immunostaining was performed as follows:
RNA FISH or immunostaining was performed first. Images were
captured and their positions recorded on a Nikon Eclipse 90i
microscope workstation with Volocity software (Improvision). Slides
were then re-fixed in 4% paraformaldehyde, treated with RNaseA to
remove RNA signals, and denatured for DNA FISH. After overnight
hybridization at 37.degree. C., slides were re-imaged at recorded
positions.
[0118] Quantitative RT-PCR
[0119] Total RNA was isolated using TRIzol.RTM. (Invitrogen) and
treated with TURBO DNase (Ambion). 500 ng of RNA was
reverse-transcribed with random primers (Promega) using
Superscript.RTM. III reverse transcriptase (Invitrogen). Control
reactions without reverse transcriptase (-RT) were also prepared.
qRT-PCR was performed using iQ SYBR Green Supermix (Bio-Rad) on the
CFX96.TM. system (Bio-Rad). For each primer pair, a standard curve
was generated using serial 10-fold dilutions of a plasmid
containing the corresponding DNA. Copy numbers of PCR products were
determined by comparison to these standard curves. Melting curve
analyses showed a single peak for each primer pair, suggesting
homogeneity of PCR products. Expression levels were normalized to
either .alpha.-Tubulin or Gapdh levels. Primer pairs were: uXist F:
5'-TTATGTGGAAGTTCTACATAAACG-3', R: ACCGCACATCCACGGGAAAC; uRA F:
CGGTTCTTCCGTGGTTTCTC, R: GGTAAGTCCACCATACACAC; Exons 1-3 F:
GCTGGTTCGTCTATCTTGTGGG, R: CAGAGTAGCGAGGACTTGAAGAG; dRE F:
CCCAATAGGTCCAGAATGTC, R: TTTTGGTCCTTTTAAATCTC; Tg-A F:
CCGGGACCGATCCAGCCTCC, R: GGTAAGTCCACCATACACAC; Tg-B F:
CCGGGACCGATCCAGCCTCC, R: AGCACTGTAAGAGACTATGAACG; .alpha.-tubulin
F: CTCGCCTCCGCCATCCACCC, R: CTTGCCAGCTCCTGTCTCAC; Gapdh F:
ATGAATACGGCTACAGCAACAGG, R: GAGATGCTCAGTGTTGGGGG; Ctcf F:
GTAGAAGAACTTCAGGGGGC, R: CTGCTCTAGTGTCTCCACTTC; Yy1 F:
CGACGGTTGTAATAAGAAGTTTG, R: ATGTCCCTTAAGTGTGTAG; U1 snRNA F:
GGAAATCATACTTACCTGGC, R: AAACGCAGTCCCCCACTACC; uRF-A F:
CTCGACAGCCCAATCTTTGTT, R: ACCAACACTTCCACTTAGCC; uRB F:
ACTCATCCACCGAGCTACT, R: GATGCCATAAAGGCAAGAAC; ex1 F:
GCTGGTTCGTCTATCTTGTGGG, R: CCTGCACTGGATGAGTTACTTG.
[0120] siRNA Transfection
[0121] siRNAs (Integrated DNA Technologies) were sequences were:
C1, 5'-CAGAGAAAGTAGTTGGTAA-3'; C3, TGGTCAAGCTTGTAAATAA; Y1,
ACAGAAAGGGCAACAATAA; Y2, GCTCAAAGCTAAAACGACA. Control siRNA was
purchased from Invitrogen (#12935-200). Cells were transfected with
siRNAs at a final concentration 20 nM using Lipofectamine.TM.
RNAiMAX (Invitrogen). For both CTCF and YY1 depletion,
transfections were performed twice at 24-hr intervals before cells
were collected at indicated timepoints. Knockdown was confirmed
with RT-PCR, immunostaining, or Western blotting. Most analyses
were performed 48 hrs after transfection when cell growth rates and
viabilities of knockdown cells were comparable to that of control.
CTCF and YY1 antibodies were from Cell Signaling Technology (#2899)
and Santa Cruz Biotechnology (sc-7341), respectively.
[0122] Chromatin Immunoprecipitation (ChIP)
[0123] Experiments were performed as described (Takahashi et al.,
2000) with a few modifications. Approximately 2.times.10.sup.6
cells and 2 .mu.g of antibodies were used per ChIP. Before
incubating with antibodies, chromatin was treated with 0.2
.mu.g/.mu.l of RNaseA at 37.degree. C. for 30 min.
Chromatin-antibody complexes were collected with Dynabeads.RTM.
Protein G (Invitrogen). YY1 antibodies for ChIP were from Santa
Cruz (sc-1703). Primer pairs used for qPCR were: uRF-B F:
GGGCTGCTCAGAAGTCTAT, R: AAAATCACTGAAAGAAACCAC; dRC F:
ACTTTGCATACAGTCCTACTTTACTT, R: GGAAAGGAGACTTGAGAGATGATAC; H19 ICR
F: TCGATATGGTTTATAAGAGGTTGG, R: GGGCCACGATATATAGGAGTATGC; Peg3 F:
CCCCTGTCTATCCTTAGCG, R: ACTGCACCAGAAACGTCAG.
[0124] Electrophoretic Mobility Shift Assay (EMSA)
[0125] Recombinant His-YY1 protein was purified as described (Shi
et al., 1991) except that it was eluted with 250 mM imidazole. For
EMSA, 10 fmoles of 5'-end-labeled probes were incubated with 75-300
ng of purified YY1. Binding reactions were carried out for 30 min
at room temperature in a final volume of 20 .mu.l containing 10 mM
Tris-HCl (pH 8.0), 5 mM MgCl.sub.2, 0.2 mM ZnCl.sub.2, 2 mM DTT,
150 mM NaCl, 1 .mu.g poly(dIdC), 0.1 mg/ml BSA, and 10% glycerol.
Complexes were electrophoresed in a 4% acrylamide gel in TBE.
[0126] RNA Immunoprecipitation (RIP)
[0127] 1.times.10.sup.7female MEFs per IP were UV-crosslinked at
254 nm (200 J/m.sup.2) in 10 ml ice-cold PBS and collected by
scraping. Cells were incubated in lysis solution (0.5% NP40, 0.5%
sodium deoxycholate, 400 U/ml RNase Inhibitor (Roche), and protease
inhibitor cocktail (Sigma) in PBS pH 7.9) at 4.degree. C. for 25
minutes with rotation, followed by the first DNase treatment (30 U
of TURBO DNase, 15 minutes at 37.degree. C.). After centrifugation,
the supernatant was incubated with 5 .mu.g of either IgG or YY1
antibodies immobilized on Dynabeads.RTM. Protein G, overnight at
4.degree. C. Beads were washed three times with PBS containing 1%
NP40, 0.5% sodium deoxycholate and additional 150 mM NaCl (total
300 mM NaCl) before the second DNase treatment (10 U) for 30 min.
After washing another three times with the same wash buffer
supplemented with 10 mM EDTA, beads were incubated in 100 mM
Tris-HCl (pH 7.5), 50 mM NaCl, 10 mM EDTA, 100 .mu.g of Proteinase
K (Roche), and 0.5% SDS for 30 min at 55.degree. C., from which RNA
was recovered by phenol-chloroform extraction. Input RNA was
isolated from 1% of the cell lysate using TRIzol after Proteinase K
treatment.
[0128] In Vitro RNA Pulldown Assay
[0129] 2 .mu.g of His-YY1 or His-GFP proteins were immobilized with
Dynabeads.RTM. His-Tag Isolation and Pulldown (Invitrogen) in PBS
supplemented with 15 mM (3-mercaptoethanol for 2 hrs. 5 .mu.g of
total RNA was incubated with protein-bead complexes at room
temperature for 1 h in PBS containing 2 mM MgCl.sub.2, 0.2 mM
ZnCl.sub.2, 15 mM (3-mercaptoethanol, 100 U/ml RNase Inhibitor, 0.1
mg/ml yeast tRNA (Ambion), 0.05% BSA and 0.2% NP40. RNA was treated
with TURBO DNase and renatured by a heat treatment followed by slow
cooling down before incubation. Beads were washed with the same
incubation buffer supplemented with additional 150 mM NaCl (total
300 mM NaCl). For mutant RNA pulldowns, total RNA was isolated from
dox-induced transgenic male MEF lines and less RNA was used (500
ng) because Xist was overexpressed. For RNA fragment pulldowns,
each fragment was transcribed in vitro using the MEGAscript.RTM.
Kit (Ambion). Transcripts were treated with DNase for 1 hr at
37.degree. C., TRIzol-purified, and renatured by heating and slow
cooling down. 0.5 pmol of RNA and 1 .mu.g of protein were used per
reaction, and 10% of each pulled-down product was analyzed by
qRT-PCR. Standard curves for all amplified regions were generated
from the same Xist-containing plasmid.
[0130] Results
[0131] Squelching of Endogenous Xist RNA by Newly Introduced Xist
Transgenes
[0132] To study Xist RNA localization, a full-length
doxycycline(dox)-inducible Xist transgene (X+P; FIG. 1A) was
introduced into female mouse embryonic fibroblasts (MEF). RNA
fluorescent in situ hybridization (FISH) showed transgene
expression and formation of small Xist foci even without
dox-induction, likely due to inclusion of 180-bp of Xist's promoter
sequence (Pillet et al., 1995; Stavropoulos et al., 2005). [Note:
Cells are tetraploid due to SV40 Large T-transformation; two Xi are
present]. Dox-induction for 24 hours significantly boosted
expression and led to development of large Xist clouds.
Quantitative RT-PCR (qRT-PCR) indicated that total Xist levels were
2-5 times higher than in wildtype (WT) cells before dox-induction,
and increased 2-3 times further upon induction (FIG. 1C; exons1-3).
To examine transgenic contributions, amplification with
transgene-specific primers (uXist) was performed, and >10-fold
induction with dox was observed.
[0133] Two unusual observations were made. First, the transgene not
only formed Xist clouds but was also hypermethylated at H3K27
(H3K27me3) (FIG. 1B). This was unexpected, because previous
analyses using a mouse embryonic stem (ES) model showed that the
X-chromosome becomes refractory to Xist after the first 3 days of
cell differentiation (Wutz and Jaenisch, 2000; Kohlmaier et al.,
2004). More surprisingly, ectopic Xist clouds were always more
prominent than endogenous clouds. In fact, even before dox
induction, the transgene displayed a large Xist cloud and the Xi's
RNA cloud was already suppressed in 56-85% of cells (FIG. 1B).
After induction, Xist clouds disappeared from Xi completely in
94-98% of cells (FIG. 1B). Multiple independent clones showed this
behavior. Thus, newly introduced Xist transgenes in MEFs act on the
endogenous locus in trans and "squelches" Xist RNA clouds on
Xi.
[0134] Squelching Depends on a 700-Bp RNA Localization Domain
Around Repeat F
[0135] Several mechanisms could underlie squelching. Introduction
of homologous transgene sequences could induce RNAi-based
transcriptional gene silencing (TGS)(Wassenegger et al., 1994).
Alternatively, the transgene could outcompete endogenous Xist for a
limited supply of locus-specific transcription factors (Gill and
Ptashne, 1988). Post-transcriptional mechanisms, such as those
affecting RNA localization, must also be entertained. To address
potential mechanisms, transgene deletional analysis was performed
to identify squelching sequences. Deletions focused on Xist's
conserved proximal end and deleted a 2-kb region spanning Xist's P1
and P2 promoters (Johnston et al., 1998), Repeat A, and Repeat F
(Brockdorff et al., 1992; Brown et al., 1992; Nesterova et al.,
2001)(FIG. 1A, X-RARF). In contrast to X+P clones, multiple
independent clones of X-RARF did not squelch endogenous Xist (FIG.
1C). qRT-PCR showed increased X-RARF expression after dox induction
(FIG. 1D), but RNA FISH revealed no RNA accumulation at the X-RARF
site. These results implied either an RNA localization or
stabilization defect in X-RARF. Thus, the deleted 2-kb region is
responsible for both squelching and RNA accumulation.
[0136] To narrow down required regions, smaller deletions were made
and multiple independent clones of each were examined
(representative clones shown in all analyses below). Transgene X
deleted only the Xist promoter but had no measurable trans effects
(FIG. 1A. The X-RA transgene eliminated the Xist promoter, Repeat
A, and RepA RNA (Zhao et al., 2010)(FIG. 1A), but also did not
affect squelching or accumulation of Xist transcripts at the
transgene site. By contrast, transgene X-RF deleted a 700-bp region
around Repeat F and abolished both squelching and RNA localization.
Like X-RARF, X-RF induction increased steady state Xist levels
(FIG. 1D), but Xist RNA failed to accumulate at the transgene site.
At the same time, Xist clouds on Xi were spared. There is thus a
strong correlation between transgenic Xist accumulation and
squelching of endogenous Xist RNA. Thus, Xist's promoter, Repeat A,
and RepA RNA are not required for squelching and implicate the
700-bp region around Repeat F in both Xist localization and
squelching.
[0137] Xist RNA Diffuses Away from Xi and is Attracted to the
Transgene
[0138] These findings led to suspicion of a direct connection
between squelching and RNA localization, as squelching of
endogenous Xist occurs when newly introduced Xist transgenes can
accumulate RNA. The question was asked whether the transgene could
exert trans effects and cause displacement of Xist RNA from Xi.
Indeed, although Xist clouds faded away on Xi during squelching,
the stability (or steady state levels) of endogenous Xist RNA was
surprisingly not affected (FIG. 1E). To investigate the fate of
endogenous Xist RNA, Xist molecules were tracked in
squelching-competent X-RA clones. Serial RNA/DNA FISH distinguished
endogenous versus transgenic RNAs by a Repeat-A probe (FIG. 2A,
RA), and X versus transgenic DNA by a vector-specific probe.
Intriguingly, endogenous Xist localized not only to Xi but also to
the transgenic site. Thus, endogenous Xist RNA trans-migrated
between Xi and the homologous ectopic site. This behavior was seen
even before dox-induction, demonstrating that high transgene
expression is not required to attract Xist RNA away from Xi.
H3K27me3 enrichment followed Xist accumulation at the transgene
site. Because X-RA lacks Polycomb-recruiting sequences (Zhao et
al., 2008), that transgenic H3K27me3 likely reflected the action of
wildtype Xist-Polycomb complexes relocalized to the transgene site
from Xi. These data show that Xist RNA is diffusible in the nucleus
and remains stable when not bound to chromatin.
[0139] Because earlier experiments in male cells had shown that
transgenic Xist could not diffuse between X and autosome (Lee et
al., 1996; Lee et al., 1999; Wutz and Jaenisch, 2000; Kohlmaier et
al., 2004), the consequences of introducing these transgenes into
male MEFs were examined. Consistent with prior reports, RNA/DNA
FISH showed that X-RA male cells formed Xist clouds at the
transgene site, but the RNA never transmigrated to the X. Also
consistent with previous studies (Plath et al., 2003; Kohlmaier et
al., 2004), the Repeat-A-deficient RNA induced H3K27me3 poorly on
the autosome in spite of RNA accumulation (H3K27me3 pinpoints were
seen at some insertion sites). However, X+P cells efficiently
formed Xist clouds and H3K27me3 foci, further arguing that Xist
function is not confined to an early developmental time window.
Nevertheless, Xist produced from X+P could not bind the male Xa.
These results demonstrate that, although diffusible, Xist RNA is
not promiscuous. The male Xa is resistant to Xist, either because
it lacks a receptor for Xist RNA or other accessory factors.
[0140] Xist Localization Requires YY1 Protein
[0141] To identify candidate receptors for Xist particles, a
"squelching assay" was designed on the principle that RNA binding
sites on Xi and transgene must compete for a limited pool of Xist
particles. To confirm that the receptors are contained in Xist exon
1, it was asked if Xist exon 1 were sufficient to attract RNA in
trans. Transgene X+PE1 (FIG. 2A) was tested in female MEFs by
performing RNA FISH using differentially labeled exon 1 and 7
probes that distinguished endogenous from transgenic transcripts.
Indeed, exon 1 attracted endogenous Xist RNA, though not as
efficiently as full-length transgenes (22% of cells). As observed
in other transgenic lines, Xist RNA remained stable when displaced
from Xi in X+PE1 cells (FIG. 2B). Combined, these results show that
sequences within exon 1 are not only necessary but also sufficient
to squelch endogenous Xist. Receptors for Xist particles must
therefore reside therein.
[0142] Towards pinpointing specific receptors, exon 1 was searched
for conserved motifs. Near Repeat F are two potential binding sites
for CTCF (Lobanenkov et al., 1990; Essien et al., 2009) and YY1
(Hariharan et al., 1991; Park and Atchison, 1991; Seto et al.,
1991; Shi et al., 1991; Flanagan et al., 1992; Kim et al.,
2007)(FIG. 3A). These two proteins have been implicated in other
contexts, such as regulation of X-chromosome pairing through
binding sites in Tsix/Xite (Donohoe et al., 2007; Xu et al., 2007;
Donohoe et al., 2009) and regulation of human XCI through sites
upstream of XIST (Hendrich et al., 1993; Pugacheva et al., 2005). A
role in RNA localization had not been suspected previously. To test
whether CTCF is required for Xist localization, good knockdown of
CTCF was achieved in female MEFs, but no reduction in Xist levels
or clouds was observed (FIG. 3B). Therefore, CTCF is not needed for
Xist binding to Xi.
[0143] By contrast, knocking down YY1 (FIG. 3C) resulted in loss of
Xist clouds from >70% of cells (FIG. 3D). In cells where Xist
was still detectable, RNA signals were pinpoint or severely
attenuated (arrows, FIG. 3D). Similar results were obtained for two
YY1-specific siRNAs, Y1 and Y2, arguing against off-target effects.
Transfection with scrambled siRNA (siRNA-Scr) had no effect on YY1
or Xist. Interestingly, although YY1 knockdown affected Xist
localization, it did not affect total RNA levels, agreeing with
conclusions drawn from the transgene studies that Xist RNA remains
stable when displaced from chromatin. Whereas Xist clouds
disappeared within 24-48 h of YY1 knockdown, H3K27me3 enrichment
persisted up to 48 h and did not disappear from Xi until 72 h (FIG.
3E; 70-80%), consistent with slower kinetics of H3K27me3 turnover.
These data demonstrate that YY1 is essential for Xist
localization.
[0144] A Trio of YY1-Binding Sites Serves as Nucleation Center
[0145] The data implicate YY1 as a potential receptor for Xist
particles. To investigate this idea, three conserved elements
matching the YY1 consensus, AAnATGGCG, separated by .about.100 bp
near Repeat F were examined. These elements were previously
proposed to bind YY1 based on bioinformatic and ChIP analyses,
though direct DNA-protein interactions were not demonstrated (Kim
et al., 2007). To test direct binding, electrophoretic mobility
shift assays (EMSA) were performed and purified recombinant YY1
protein shifted a 280-bp DNA probe containing the trio motif (FIG.
4A,B). Elevating YY1 protein concentration both intensified the
shifted band (arrow) and led to appearance of two higher molecular
weight species (asterisks) indicative of progressive site
occupancy. When the motifs were mutated, YY1 binding was severely
attenuated (FIG. 4A,B). Thus, YY1 directly binds the trio
motif.
[0146] To ask if the trio motif is involved in Xist localization,
site-directed mutagenesis was performed at all three YY1 sites on
the X-RA transgene (X-RA.sup.Yy1m; FIG. 4A). X-RA was used because
it is both squelching-competent and its RNA can be distinguished
from endogenous Xist RNA by RNA FISH using a Repeat A probe. Serial
RNA/DNA FISH showed dramatic differences between X-RA and
X-RA.sup.Yy1m clones. Before dox induction, RNA was never observed
at the X-RA.sup.Yy1m transgenic site, whereas Xist RNA showed
robust accumulation on Xi. This result contrasted with obvious
squelching in uninduced X-RA clones. Dox induction revealed further
differences. Transgene expression resulted in a huge burst of RNA
around the transgene site, but the RNA seemed to diffuse away
rather than localize (a concentration gradient was seen around the
transgene; 62.9%, n=116). Thus, mutating the YY1-binding sites
prevented anchoring of Xist RNA and abolished the transgene's
ability to squelch Xist RNA from Xi. In wildtype cells, YY1 protein
did not decorate Xi at any time. Thus, a trio of YY1-binding sites
serves as nucleation center for Xist binding to Xi.
[0147] Xist Diffuses Bidirectionally Between Xi and Transgene, but
Xa is Always Resistant
[0148] Curiously, two Xi in transgenic cells often did not have
equal Xist clouds. The Xi closer to the transgene usually exhibited
the larger Xist cloud (49.1%, n=116) and, strangely, this cloud
consisted mostly of mutated transgenic rather than Xi-synthesized
RNA, as RA-probe signals on proximal Xi were less than on distal
Xi. This disparity was observed only after dox-induction.
Therefore, transgenic RNA--though it could not bind to its own
transgene site in cis--must be able to displace endogenous Xist
from the Xi closer to it. This odd finding implied that YY1 must
interact with DNA and RNA via different nucleic acid motifs.
qRT-PCR showed no change in steady state levels of endogenous or
transgenic RNA (FIG. 4C), indicating that mutated as well as
wildtype Xist molecules are likely stable even when not
chromatin-bound.
[0149] At no time did transgenic Xist localize onto Xa, even when
Xa was in proximity in female cells. This was also the case in male
MEF clones carrying X-RA.sup.Yy1m. Prior to dox induction,
transgene expression was minimal. Pinpoint nascent Xist transcripts
were seen in 68% of cells (n=78), and the rest showed no detectable
Xist. When induced, transgenic RNA localized poorly around the
transgene site (81%, n=74), similar to that observed in
X-RA.sup.Yy1m female cells. In males, Xa never attracted Xist RNA
even when the transgene locus was close. Xa is therefore always
resistant.
[0150] Taken together, these data illustrate several crucial
points: (i) A cluster of YY1 sites near Repeat F serves nucleation
center for Xist binding. (ii) Xist particles are freely diffusible.
(iii) Exchange of Xist molecules can occur bidirectionally, from
transgene to Xi (FIG. 4C) as well as from Xi to transgene (FIGS.
1-2). (iv) While X-RA.sup.Yy1m transgenes could not strip Xist RNA
from Xi, Xi could attract RNA produced by X-RA.sup.Yy1m. This lack
of reciprocity argues that, while YY1 binds the AAnATGGCG motif in
DNA, its interaction with Xist RNA does not occur through the
corresponding RNA motif, AAnAUGGCG. (v) Xa is refractory to Xist
binding, even though Xa also possesses the trio of YY1 sites.
[0151] Xi-Specific Binding of YY1
[0152] Xa's immunity implies an epigenetic difference between Xa
from Xi. To ask if differential YY1 binding could underlie the
difference, YY1 binding patterns were examined in vivo by chromatin
immunoprecipitation (ChIP) assays using YY1 antibodies and qPCR
primers flanking the YY1 sites (FIG. 5A). Strong enrichment of YY1
to this region (uRF) was observed in female but not male MEFs (FIG.
5B). The enrichment was comparable to that for intron 1 of Peg3, an
imprinted gene known to bind YY1 (Kim et al., 2009). By contrast,
no enrichment occurred in a region downstream of the Repeat C (dRC)
or in the H19 imprinting control center (ICR). These data
demonstrate that YY1 specifically occupies the Repeat F YY1 sites.
To distinguish Xa from Xi, female MEFs were used that bear a
conditional deletion of Xist exons 1-3 either on Xa
(XiXa.sup..DELTA.Xist) or Xi (XaXi.sup..DELTA.Xist)(Zhang et al.,
2007). ChIP consistently showed enriched YY1 binding to uRF in
XiXa.sup..DELTA.Xist but not in XaXi.sup..DELTA.Xist. In
XiXa.sup..DELTA.Xist, YY1 could only have bound to Xi, as the uRF
region is deleted on Xa. By the same logic, the lack of YY1
enrichment at uRF in XaXi.sup..DELTA.Xist cells implies that YY1 is
not enriched on Xa. Thus, YY1 differentially binds the nucleation
center of Xi and Xa. Thus differential susceptibility of Xa and Xi
to Xist is likely not only the result of allele-specific Xist
transcription, but primarily the consequence of allele-specific YY1
occupancy. In differentiating female ES cells, knockdown of YY1
also did not alter the stability of Xist RNA but significantly
interfered with Xist localization (FIG. 5C). Therefore, YY1 is
likely crucial for Xist localization throughout the XCI process
(initiation, establishment, and maintenance).
[0153] YY1 is an RNA-Binding Protein and Serves as Receptor for
Xist
[0154] If YY1 serves as docking protein for Xist silencing
complexes, it must directly interact with Xist RNA. To look for
interactions in vivo, RNA immunoprecipitation (RIP) was performed
with YY1 antibodies following UV-crosslinking of RNA to protein in
MEFs. qRT-PCR of YY1 pulldown material showed significant
co-immunoprecipitation of Xist RNA (FIG. 6A,B). The interaction was
not detected without UV crosslinking, in RT-negative samples, and
when IgG antibodies were used. Moreover, the abundant U1 snRNA was
not co-immunoprecipitated. Because UV crosslinking occurs at
near-zero Angstrom, the observed pulldown suggests specific and
direct Xist-YY1 interaction in vivo.
[0155] To probe its nature, out RNA pulldown assays were carried in
vitro using purified recombinant His-tagged YY1 proteins. To ask if
YY1 preferentially binds Xist RNA among a complex pool of cellular
RNAs, total RNA was purified from female MEFs and quantitated the
interaction between YY1 and Xist relative to other RNAs. At
multiple qPCR positions (uRF, uRA, dRE), Xist pulldown by YY1 was
enriched above background (GFP)(FIG. 6C). Neither Gapdh nor
.alpha.-tubulin RNA showed enrichment. Therefore, consistent with
in vivo RIP, YY1 specifically and directly interacts with Xist in
vitro.
[0156] Site-directed mutagenesis showed that, although YY1 binds
exon 1 DNA via the motif, AAnATGGCG, YY1 cannot bind Xist RNA via
the corresponding motif in the RNA (AAnAUGGCG) (FIG. 4). To
determine where YY1 binds RNA, pulldown assays were carried out
using a panel of mutated transgenic RNAs (FIG. 6A). To isolate
transgenic RNAs from endogenous Xist, the transgenic constructs
were introduced into male MEFs, induced expression using
doxycycline, isolated RNA, and tested the RNA for binding to YY1 in
a pulldown assay. All four transgenic RNAs bound YY1 specifically
(FIG. 6D, P<0.02 in all cases). The control Gapdh RNA did not
demonstrate significant differences between pulldown with YY1
versus GFP. These results show that deleting Repeat A (X-RA) and
mutating the clustered YY1 motifs (X-RA.sup.YY1m) had no effect on
Xist-YY1 interactions, further supporting the notion that YY1 does
not bind Xist via AAnAUGGCG.
[0157] The ability of X-RAE1 RNA to bind YY1 delimits the
interaction domain to the portion of exon 1 downstream of Repeat A
(FIG. 6A). To pinpoint Xist RNA's YY1-binding domain, RNA
subfragments were generated, in vitro-transcribed and purified
each, and tested them for YY1 binding in a pulldown assay (FIG.
6E). Although several RNA domains showed more binding to YY1 than
background (GFP), the difference was strongest and statistically
significant only for fragments containing Repeat C, a conserved
C-rich element unique to Xist that is repeated 14 times in tandem
(Brockdorff et al., 1992; Brown et al., 1992). Repeat C by itself
showed 20-fold enrichment (P=0.047). A fragment containing both
Repeats B and C showed 10-fold better binding than background
(P=0.033). Repeat B might also have some affinity for YY1, as it
showed 5-fold enrichment and the difference bordered statistical
significance (P=0.053). Repeat C's binding to YY1 was especially
interesting, given recent observation that locked nucleic acid
(LNA) antagomirs against this repeat displace Xist RNA from Xi
without affecting RNA stability (Sarma et al., 2010)--a finding
that suggested Repeat C as an anchoring sequence to Xi. Thus Repeat
C, and potentially also Repeat B, of Xist RNA likely make direct
contact with YY1, which in turn anchors the Xist particle to Xi via
a trio of DNA elements near Repeat F (FIG. 6F). Thus, YY1 is an
RNA-binding protein that serves as receptor for the Xist silencing
complex on Xi.
Example 2. Preparation of a Library of YY1-Interacting lncRNAs
Using RIP-Seq
[0158] A library of YY1-interacting lncRNAs is prepared using
RIP-Seq or CLIP-seq.
[0159] RIP-Seq Library
[0160] RNA immunoprecipitation is performed (Zhao et al., 2008)
using 10.sup.7 wildtype 16.7 (Lee and Lu, 1999) and Ezh2-/- (Shen
et al., 2008) ES cells. To construct RIP-seq libraries, cell nuclei
are isolated, nuclear lysates were prepared, treated with 400 U/ml
DNAse, and incubated with anti-YY1 antibodies (Active Motif) or
control IgG (Cell Signaling Technology). RNA-protein complexes are
immunoprecipitated with protein A agarose beads and RNA extracted
using Trizol (Invitrogen). To preserve strand information, template
switching is used for the library construction (Cloonan et al.,
2008). 20-150 ng RNA and Adaptor1 (5'-CTTTCCCTACACGACGCTCT
TCCGATCT-3') are used for first-strand cDNA synthesis using
Superscript II Reverse Transcription Kit (Invitrogen). Superscript
II adds non-template CCC 3' overhangs, which were used to hybridize
to Adaptor2-GGG template-switch primer
(5'-CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTGGG-3'). During
1.sup.st-strand cDNA synthesis, samples are incubated with adaptor1
at 20.degree. C. for 10 min, followed by 37.degree. C. for 10 min
and 42.degree. C. for 45 min. Denatured template switch primer is
then added and each tube incubated for 30 min at 42.degree. C.,
followed by 75.degree. C. for 15 min. Resulting cDNAs are amplified
by forward (5'-AATGATACGGCGACCACCGAGATCTACA
CTCTTTCCCTACACGACGCTCTTCCGATCT-3') and reverse
(5'-CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT-3') Illumina primers. PCR is
performed by Phusion polymerase (BioRad) as follows: 98.degree. C.
for 30 s, 20-24 cycles of [98.degree. C. 10 s, 65.degree. C. 30 s,
72.degree. C. 30 s], and 72.degree. C. for 5 min. PCR products are
loaded on 3% NuSieve gel for size-selection and 200-1,200 bp
products are excised and extracted by QIAEX II Agarose Gel
Extraction Kit (Qiagen). Minus-RT samples are expected to yield no
products. DNA concentrations are quantitated by PicoGreen. 5-10 ml
of 2-20 nM cDNA samples are sequenced.
[0161] CLIP-Seq Library
[0162] A CLIP-Seq library is prepared as described above for the
RIP-Seq library, with the additional steps of UV crosslinking
before the IP Seq is performed, a limited RNAse step to reduce the
fragment size of interacting RNAs, electroporesis of IP material in
an SDS-PAGE gel, and excision of specific RNA-protein bands.
CLIP-seq libraries will be made from nuclear lysates and/or the
chromatin fraction. Exemplary methods for performing CLIP-Seq are
described at Yeo et al., Nat Struct Mol Biol. 2009 February;
16(2):130-7. Epub 2009 Jan. 11; Zhang and Darnell, "Mapping in vivo
protein-RNA interactions at single-nucleotide resolution from
HITS-CLIP data." Nat Biotechnol. 2011 Jun. 1; Jensen and Darnell,
Methods Mol Biol. 2008; 488:85-98; Licatalosi et al., Nature. 2008
Nov. 27; 456(7221):464-9. Epub 2008 Nov. 2; Ule et al., Methods.
2005 December; 37(4):376-86; and Ule et al., Science. 2003 Nov. 14;
302(5648):1212-5.
[0163] Bioinformatic Analysis
[0164] Except as noted below, all analyses are performed using
custom C++ programs. Image processing and base calling were
performed using the Illumina pipeline. 3' adaptor sequences were
detected by crossmatch and matches of bases are trimmed,
homopolymer reads filtered, and reads matching the mitochondrial
genome and ribosomal RNAs excluded from all subsequent analyses.
Remaining sequences are then aligned to the reference genome using
shortQueryLookup (Batzoglou et al., 2002). Alignments with
.ltoreq.1 error ae retained. Because library construction and
sequencing generate sequence from the opposite strand of the
YY1-bound RNA, in all further analysis, each read is treated as if
it were reverse-complemented. To determine the correlation
coefficients comparing the original a-YY1 RIP-seq library to its
technical and biological replicates and also to RIP-seq of the
YY1.sup.-/- control line, the number of reads per gene between two
samples is compared and, for each pair, the Pearson correlation
between the number of reads mapped to each refGene is computed.
That is, for each sample, a vector of counts of reads mapped to
each refGene is created and the Pearson correlation between all
pairs of vectors is computed.
[0165] Locations of repetitive sequences in the reference genome
(RepeatMasker) are obtained from the UCSC Genome Browser database
(Kent et al., The human genome browser at UCSC. Genome Res. 2002
June; 12(6):996-1006; Fujita et al., "The UCSC Genome Browser
database: update 2011." Nucleic Acids Res. 2010 Oct. 18) The
overlap of YY1 transcriptome reads with these repeats is obtained
by intersecting coordinates of RepeatMasker data with coordinates
of read alignments. The UCSC transcriptome was used as general
reference (available online at
hgdownload.cse.ucsc.edu/goldenPath/mm9/database/transcriptome.txt.gz).
To obtain a set of non-overlapping distinct transcribed regions,
the UCSC transcriptome transcripts are sorted by start coordinate
and merged overlapping transcripts on the same strand (joined UCSC
transcriptome: 39,003 transcripts total). Read alignment
coordinates are then intersected with those of the merged UCSC
transcripts to determine the number of UCSC transcripts present in
the PRC2 transcriptome. Hits to the transcripts are converted to
RPKM units, where the read count is 1/(n*K*M), and n is the number
of alignments in the genome, K is the transcript length divided by
1,000, and M is the sequencing depth including only reads mapping
to mm9 divided by 1,000,000 (Mortazavi et al., 2008). This
normalization allows for comparisons between transcripts of
differing lengths and between samples of differing sequencing
depths. To generate promoter maps, promoter regions are defined as
-10,000 to +2000 bases relative to TSS (obtained from refGene
catalog, UCSC Genome Browser,). Read counts overlapping promoter
regions are plotted, except that the limit of 10 alignments was
relaxed. For chromosomal alignments, read numbers are computed for
all non-overlapping consecutive 100 kb windows on each chromosome.
Reads are normalized such that those mapping to n locations are
counted as 1/n.sup.th of a read at each location. A list of all
enriched transcripts is found by comparing the RPKM scores on each
strand for all transcripts in the WT and YY1.sup.-/- samples. Then
their coordinates are intersected with coordinates of the feature
of interest.
REFERENCES
[0166] Atchison, L., Ghias, A., Wilkinson, F., Bonini, N., and
Atchison, M. L. (2003). Transcription factor YY1 functions as a PcG
protein in vivo. EMBO J 22, 1347-1358 [0167] Brockdorff, N.,
Ashworth, A., Kay, G. F., McCabe, V. M., Norris, D. P., Cooper, P.
J., Swift, S., and Rastan, S. (1992). The product of the mouse Xist
gene is a 15 kb inactive X-specific transcript containing no
conserved ORF and located in the nucleus. Cell 71, 515-526 [0168]
Brown, C. J., Hendrich, B. D., Rupert, J. L., Lafreniere, R. G.,
Xing, Y., Lawrence, J., and Willard, H. F. (1992). The human XIST
gene: analysis of a 17 kb inactive X-specific RNA that contains
conserved repeats and is highly localized within the nucleus. Cell
71, 527-542 [0169] Brown, C. J., Lafreniere, R. G., Powers, V. E.,
Sebastio, G., Ballabio, A., Pettigrew, A. L., Ledbetter, D. H.,
Levy, E., Craig, I. W., and Willard, H. F. (1991). Localization of
the X inactivation centre on the human X chromosome in Xq13. Nature
349, 82-84 [0170] Chow, J. C., Hall, L. L., Baldry, S. E.,
Thorogood, N. P., Lawrence, J. B., and Brown, C. J. (2007).
Inducible XIST-dependent X-chromosome inactivation in human somatic
cells is reversible. Proc Natl Acad Sci USA 104, 10104-10109 [0171]
Clemson, C. M., Chow, J. C., Brown, C. J., and Lawrence, J. B.
(1998). Stabilization and localization of Xist RNA are controlled
by separate mechanisms and are not sufficient for X inactivation. J
Cell Biol 142, 13-23 [0172] Clemson, C. M., McNeil, J. A., Willard,
H. F., and Lawrence, J. B. (1996). XIST RNA paints the inactive X
chromosome at interphase: evidence for a novel RNA involved in
nuclear/chromosome structure. J Cell Biol 132, 259-275 [0173]
Csankovszki, G., Panning, B., Bates, B., Pehrson, J. R., and
Jaenisch, R. (1999). Conditional deletion of Xist disrupts histone
macroH2A localization but not maintenance of X inactivation. Nat
Genet 22, 323-324 [0174] Donohoe, M. E., Silva, S. S., Pinter, S.
F., Xu, N., and Lee, J. T. (2009). The pluripotency factor Oct4
interacts with Ctcf and also controls X-chromosome pairing and
counting. Nature 460, 128-132 [0175] Donohoe, M. E., Zhang, L. F.,
Xu, N., Shi, Y., and Lee, J. T. (2007). Identification of a Ctcf
cofactor, Yy1, for the X chromosome binary switch. Mol Cell 25,
43-56 [0176] Essien, K., Vigneau, S., Apreleva, S., Singh, L. N.,
Bartolomei, M. S., and Hannenhalli, S. (2009). CTCF binding site
classes exhibit distinct evolutionary, genomic, epigenomic and
transcriptomic features. Genome Biol 10, R131 [0177] Flanagan, J.
R., Becker, K G., Ennist, S. L., Gleason, P. H., Driggers, B. Z.,
Levi, E., Appella, and Ozato, K. (1992). Cloning of a negative
transcription factor that binds to the upstream conserved region of
Moloney murine leukemia virus. Mol Cell Biol 12, 38-44 [0178]
Gartler, S. M., and Riggs, A. D. (1983). Mammalian X-chromosome
inactivation. Annu Rev Genet 17, 155-190 [0179] Gill, G., and
Ptashne, M. (1988). Negative effect of the transcriptional
activator GAL4. Nature 334, 721-724 [0180] Hariharan, N., Kelley,
D. E., and Perry, R. P. (1991). Delta, a transcription factor that
binds to downstream elements in several polymerase II promoters, is
a functionally versatile zinc finger protein. Proc Natl Acad Sci
USA 88, 9799-9803 [0181] Hendrich, B. D., Brown, C. J., and
Willard, H. F. (1993). Evolutionary conservation of possible
functional domains of the human and murine XIST genes. Hum Mol
Genet 2, 663-672 [0182] Hochedlinger, K., Yamada, Y., Beard, C.,
and Jaenisch, R. (2005). Ectopic expression of Oct-4 blocks
progenitor-cell differentiation and causes dysplasia in epithelial
tissues. Cell 121, 465-477 [0183] Iuchi, S. (2001). Three classes
of C2H2 zinc finger proteins. Cell Mol Life Sci 58, 625-635 [0184]
Johnston, C. M., Nesterova, T. B., Formstone, E. J., Newall, A. E.,
Duthie, S. M., Sheardown, S. A., and Brockdorff, N. (1998).
Developmentally regulated Xist promoter switch mediates initiation
of X inactivation. Cell 94, 809-817 [0185] Jonkers, I., Monkhorst,
K., Rentmeester, E., Grootegoed, J. A., Grosveld, F., and Gribnau,
J. (2008). Xist RNA is confined to the nuclear territory of the
silenced X chromosome throughout the cell cycle. Mol Cell Biol 28,
5583-5594 [0186] Kim, J. D., Hinz, A K., Choo, J. H., Stubbs, L.,
and Kim, J. (2007). YY1 as a controlling factor for the Peg3 and
Gnas imprinted domains. Genomics 89, 262-269 [0187] Kim, J. D.,
Kang K., and Kim, J. (2009). YY1's role in DNA methylation of Peg3
and Xist. Nucleic Acids Res 37, 5656-5664 [0188] Kohlmaier, A.,
Savarese, F., Lachner, M., Martens, J., Jenuwein, T., and Wutz, A.
(2004). A chromosomal memory triggered by Xist regulates histone
methylation in X inactivation. PLoS Biol 2, E171 [0189] Ku, M.,
Koche, R. P., Rheinbay, E., Mendenhall, E. M., Endoh, M.,
Mikkelsen, T. S., Presser, A., Nusbaum, C., Xie, X., Chi, A S., et
aL (2008). Genomewide analysis of PRC1 and PRC2 occupancy
identifies two classes of bivalent domains. PLoS Genet 4, e1000242
[0190] Kuzmichev, A., Nishioka, K., Erdjument-Bromage, H., Tempst,
P., and Reinberg, D. (2002). Histone methyltransferase activity
associated with a human multiprotein complex containing the
Enhancer of Zeste protein. Genes Dev 16, 2893-2905 [0191] Landeira,
D., Sauer, S., Poot, R., Dvorkina, M., Mazzarella, L., Jorgensen,
H. F., Pereira, C. F., Leleu, M., Piccolo, F. M., Spivakov, M., et
aL (2010). Jarid2 is a PRC2 component in embryonic stem cells
required for multi-lineage differentiation and recruitment of PRC1
and RNA Polymerase II to developmental regulators. Nat Cell Biol
12, 618-624 [0192] Laverty, C., Lucci, J., and Akhtar, A. (2010).
The MSL complex: X chromosome and beyond. Curr Opin Genet Dev 20,
171-178 [0193] Lee, J. T. (2000). Disruption of imprinted X
inactivation by parent-of-origin effects at Tsix. Cell 103, 17-27
[0194] Lee, J. T. (2009). Lessons from X-chromosome inactivation:
long ncRNA as guides and tethers to the epigenome. Genes Dev 23,
1831-1842 [0195] Lee, J. T. (2010). The X as model for RNA's niche
in epigenomic regulation. Cold Spring Harb Perspect Biol 2, a003749
[0196] Lee, J. T., and Lu, N. (1999). Targeted mutagenesis of Tsix
leads to nonrandom X inactivation. Cell 99, 47-57 [0197] Lee, J.
T., Lu, N., and Han, Y. (1999). Genetic analysis of the mouse X
inactivation center defines an 80-kb multifunction domain. Proc
Natl Acad Sci USA 96, 3836-3841 [0198] Lee, J. T., Strauss, W. M.,
Dausman, J. A., and Jaenisch, R. (1996). A 450 kb transgene
displays properties of the mammalian X-inactivation center. Cell
86, 83-94 [0199] Li, G., Margueron, R., Ku, M., Chambon, P.,
Bernstein, B. E., and Reinberg, D. (2010). Jarid2 and PRC2,
partners in regulating gene expression. Genes Dev 24, 368-380
[0200] Lobanenkov, V. V., Nicolas, R. H., Adler, V. V., Paterson,
H., Klenova, E. M., Polotskaja, A. V., and Goodwin, G. H. (1990). A
novel sequence-specific DNA binding protein which interacts with
three regularly spaced direct repeats of the CCCTC-motif in the 5'
flaking sequence of the chicken c-myc gene. Oncogene 5, 1743-1753
[0201] Lucchesi, J. C., Kelly, W. G., and Panning B. (2005).
Chromatin remodeling in dosage compensation. Annu Rev Genet 39,
615-651 [0202] Luikenhuis, S., Wutz, A., and Jaenisch, R. (2001).
Antisense transcription through the Xist locus mediates Tsix
function in embryonic stem cells. Mol Cell Biol 21, 8512-8520
[0203] Lyon, M. F. (1961). Gene action in the X-chromosome of the
mouse (Mus musculus L.). Nature 190, 372-373 [0204] Marahrens, Y.,
Panning, B., Dausman, J., Strauss, W., and Jaenisch, R. (1997).
Xist-deficient mice are defective in dosage compensation but not
spermatogenesis. Genes Dev 11, 156-166 [0205] Mendenhall, E. M.,
Koche, R. P., Truong, T., Zhou, V. W., Issac, B., Chi, A S., Ku,
M., and Bernstein, B. E. (2010). GC-rich sequence elements recruit
PRC2 in mammalian ES cells. PLoS Genet 6, e1001244 [0206] Meyer, B.
J. (2010). Targeting X chromosomes for repression. Curr Opin Genet
Dev 20, 179-189 [0207] Morey, C., Navarro, P., Debrand, E., Avner,
P., Rougeulle, C., and Clerc, P. (2004). The region 3' to Xist
mediates X chromosome counting and H3 Lys-4 dimethylation within
the Xist gene. Embo J 23, 594-604 [0208] Nesterova, T. B.,
Slobodyanyuk, S. Y., Elisaphenko, E. A., Shevchenko, Al., Johnston,
C., Pavlova, M. E., Rogozin, I. B., Kolesnikov, N. N., Brockdorff,
N., and Zakian, S. M. (2001). Characterization of the genomic Xist
locus in rodents reveals conservation of overall gene structure and
tandem repeats but rapid evolution of unique sequence. Genome Res
11, 833-849 [0209] Ogawa, Y., and Lee, J. T. (2003). Xite,
X-inactivation intergenic transcription elements that regulate the
probability of choice. Mol Cell 11, 731-743 [0210] Ogawa, Y., Sun,
B. K., and Lee, J. T. (2008). Intersection of the RNA interference
and X-inactivation pathways. Science 320, 1336-1341 [0211] Ohhata,
T., Hoki, Y., Sasaki, H., and Sado, T. (2008). Crucial role of
antisense transcription across the Xist promoter in Tsix-mediated
Xist chromatin modification. Development 135, 227-235 [0212] Pal
Bhadra, M., Bhadra, U., and Birchler, J. A. (2006). Misregulation
of sex-lethal and disruption of male-specific lethal complex
localization in Drosophila species hybrids. Genetics 174, 1151-1159
[0213] Park, K., and Atchison, M. L. (1991). Isolation of a
candidate repressor/activator, NF-E1, that binds to the
immunoglobulin kappa 3' enhancer and the immunoglobulin heavy-chain
mu E1 site. Proc Natl Acad Sci USA 88, 9804-9808 [0214] Park, Y.,
Mengus, G., Bai, X., Kageyama, Y., Meller, V. H., Becker, P. B.,
and Kuroda, M. I. (2003). Sequence-specific targeting of Drosophila
roX genes by the MSL dosage compensation complex. Mol Cell 11,
977-986 [0215] Payer, B., and Lee, J. T. (2008). X Chromosome
Dosage Compensation: How Mammals Keep the Balance. Annu Rev Genet
42, 733-772 [0216] Penny, G. D., Kay, G. F., Sheardown, S. A.,
Rastan, S., and Brockdorff, N. (1996). Requirement for Xist in X
chromosome inactivation. Nature 379, 131-137 [0217] Pillet, N.,
Bonny, C., and Schorderet, D. F. (1995). Characterization of the
promoter region of the mouse Xist gene. Proc Natl Acad Sci USA 92,
12515-12519 [0218] Plath, K., Fang, J., Mlynarczyk-Evans, S. K.,
Cao, R., Worringer, K. A., Wang, H., de la Cruz, C. C., Otte, A.
P., Panning, B., and Zhang, Y. (2003). Role of histone H3 lysine 27
methylation in X inactivation. Science 300, 131-135 [0219]
Pugacheva, E. M., Tiwari, V. K., Abdullaev, Z., Vostrov, A. A.,
Flanagan, P. T., Quitschke, W. W., Loukinov, D. I., Ohlsson, R.,
and Lobanenkov, V. V. (2005). Familial cases of point mutations in
the XIST promoter reveal a correlation between CTCF binding and
pre-emptive choices of X chromosome inactivation. Hum Mol Genet 14,
953-965 [0220] Ringrose, L., and Paro, R. (2004). Epigenetic
regulation of cellular memory by the Polycomb and Trithorax group
proteins. Annu Rev Genet 38, 413-443 [0221] Sado, T., Wang, Z.,
Sasaki, H., and Li, E. (2001). Regulation of imprinted X-chromosome
inactivation in mice by Tsix. Development 128, 1275-1286 [0222]
Sarma, K., Levasseur, P., Aristarkhov, A., and Lee, J. T. (2010).
Locked nucleic acids reveal sequence requirements and kinetics of
Xist RNA localization to the X chromosome. Proc Natl Acad Sci USA
in press [0223] Schoeftner, S., Sengupta, A K., Kubicek, S.,
Mechtler, K., Spahn, L., Koseki, H., Jenuwein, T., and Wutz, A.
(2006). Recruitment of PRC1 function at the initiation of X
inactivation independent of PRC2 and silencing. Embo J 25,
3110-3122 [0224] Schwartz, Y. B., and Pirrotta, V. (2008). Polycomb
complexes and epigenetic states. Curr Opin Cell Biol 20, 266-273
[0225] Seto, E., Shi, Y., and Shenk, T. (1991). YY1 is an initiator
sequence-binding protein that directs and activates transcription
in vitro. Nature 354, 241-245 [0226] Shi, Y., Seto, E., Chang, L.
S., and Shenk, T. (1991). Transcriptional repression by YY1, a
human GLI-Kruppel-related protein, and relief of repression by
adenovirus E1A protein. Cell 67, 377-388 [0227] Silva, J., Mak, W.,
Zvetkova, I., Appanah, R., Nesterova, T. B., Webster, Z., Peters,
A. H., Jenuwein, T., Otte, A. P., and Brockdorff, N. (2003).
Establishment of histone h3 methylation on the inactive X
chromosome requires transient recruitment of Eed-Enx1 polycomb
group complexes. Dev Cell 4, 481-495 [0228] Starmer, J., and
Magnuson, T. (2009). A new model for random X chromosome
inactivation. Development 136, 1-10 [0229] Stavropoulos, N., Lu,
N., and Lee, J. T. (2001). A functional role for Tsix transcription
in blocking Xist RNA accumulation but not in X-chromosome choice.
Proc Natl Acad Sci USA 98, 10232-10237 [0230] Stavropoulos, N.,
Rowntree, R. K., and Lee, J. T. (2005). Identification of
developmentally specific enhancers for Tsix in the regulation of X
chromosome inactivation. Mol Cell Biol 25, 2757-2769 [0231] Sun, B.
K., Deaton, A. M., and Lee, J. T. (2006). A transient
heterochromatic state in Xist preempts X inactivation choice
without RNA stabilization. Mol Cell 21, 617-628 [0232] Takahashi,
Y., Rayman, J. B., and Dynlacht, B. D. (2000). Analysis of promoter
binding by the E2F and pRB families in vivo: distinct E2F proteins
mediate activation and repression. Genes Dev 14, 804-816 [0233]
Tian, D., Sun, S., and Lee, J. T. (2010). The long noncoding RNA,
Jpx, is a molecular switch for X chromosome inactivation. Cell 143,
390-403 [0234] Vigneau, S., Augui, S., Navarro, P., Avner, P., and
Clerc, P. (2006). An essential role for the DXPas34 tandem repeat
and Tsix transcription in the counting process of X chromosome
inactivation. Proc Natl Acad Sci USA 103, 7390-7395 [0235]
Wassenegger, M., Heimes, S., Riedel, L., and Sanger, H. L. (1994).
RNA-directed de novo methylation of genomic sequences in plants.
Cell 76, 567-576 [0236] Wilkinson, F. H., Park, K., and Atchison,
M. L. (2006). Polycomb recruitment to DNA in vivo by the YY1 REPO
domain. Proc Natl Acad Sci USA 103, 19296-19301 [0237] Woo, C. J.,
Kharchenko, P. V., Daheron, L., Park, P. J., and Kingston, R. E.
(2010). A region of the human HOXD cluster that confers
Polycomb-group responsiveness. Cell 140, 99-110 [0238] Wutz, A.,
and Gribnau, J. (2007). X inactivation Xplained. Curr Opin Genet
Dev 17, 387-393 [0239] Wutz, A., and Jaenisch, R. (2000). A shift
from reversible to irreversible X inactivation is triggered during
ES cell differentiation. Mol Cell 5, 695-705 [0240] Wutz, A.,
Rasmussen, T. P., and Jaenisch, R. (2002). Chromosomal silencing
and localization are mediated by different domains of Xist RNA. Nat
Genet 30, 167-174 [0241] Xu, N., Donohoe, M. E., Silva, S. S., and
Lee, J. T. (2007). Evidence that homologous X-chromosome pairing
requires transcription and Ctcf protein. Nat Genet 39, 1390-1396
[0242] Zhang, L. F., Huynh, K. D., and Lee, J. T. (2007).
Perinucleolar targeting of the inactive X during S phase: evidence
for a role in the maintenance of silencing. Cell 129, 693-706
[0243] Zhao, J., Ohsumi, T. K., Kung, J. T., Ogawa, Y., Grau, D.
J., Sarma, K., Song, J. J., Kingston, R. E., Borowsky, M., and Lee,
J. T. (2010). Genome-wide identification of polycomb-associated
RNAs by RIP-seq. Mol Cell 40, 939-953
[0244] Zhao, J., Sun, B. K., Erwin, J. A., Song, J. J., and Lee, J.
T. (2008). Polycomb proteins targeted by a short repeat RNA to the
mouse X chromosome. Science 322, 750-756.
Other Embodiments
[0245] It is to be understood that while the invention has been
described in conjunction with the detailed description thereof, the
foregoing description is intended to illustrate and not limit the
scope of the invention, which is defined by the scope of the
appended claims. Other aspects, advantages, and modifications are
within the scope of the following claims.
Sequence CWU 1
1
48124DNAArtificial Sequencesynthetically-generated primers
1ttatgtggaa gttctacata aacg 24220DNAArtificial
Sequencesynthetically-generated primers 2accgcacatc cacgggaaac
20320DNAArtificial Sequencesynthetically-generated primers
3cggttcttcc gtggtttctc 20420DNAArtificial
Sequencesynthetically-generated primers 4ggtaagtcca ccatacacac
20522DNAArtificial Sequencesynthetically-generated primers
5gctggttcgt ctatcttgtg gg 22623DNAArtificial
Sequencesynthetically-generated primers 6cagagtagcg aggacttgaa gag
23720DNAArtificial Sequencesynthetically-generated primers
7cccaataggt ccagaatgtc 20820DNAArtificial
Sequencesynthetically-generated primers 8ttttggtcct tttaaatctc
20920DNAArtificial Sequencesynthetically-generated primers
9ccgggaccga tccagcctcc 201020DNAArtificial
Sequencesynthetically-generated primers 10ggtaagtcca ccatacacac
201120DNAArtificial Sequencesynthetically-generated primers
11ccgggaccga tccagcctcc 201223DNAArtificial
Sequencesynthetically-generated primers 12agcactgtaa gagactatga acg
231320DNAArtificial Sequencesynthetically-generated primers
13ctcgcctccg ccatccaccc 201420DNAArtificial
Sequencesynthetically-generated primers 14cttgccagct cctgtctcac
201523DNAArtificial Sequencesynthetically-generated primers
15atgaatacgg ctacagcaac agg 231620DNAArtificial
Sequencesynthetically-generated primers 16gagatgctca gtgttggggg
201720DNAArtificial Sequencesynthetically-generated primers
17gtagaagaac ttcagggggc 201821DNAArtificial
Sequencesynthetically-generated primers 18ctgctctagt gtctccactt c
211923DNAArtificial Sequencesynthetically-generated primers
19cgacggttgt aataagaagt ttg 232019DNAArtificial
Sequencesynthetically-generated primers 20atgtccctta agtgtgtag
192120DNAArtificial Sequencesynthetically-generated primers
21ggaaatcata cttacctggc 202220DNAArtificial
Sequencesynthetically-generated primers 22aaacgcagtc ccccactacc
202321DNAArtificial Sequencesynthetically-generated primers
23ctcgacagcc caatctttgt t 212420DNAArtificial
Sequencesynthetically-generated primers 24accaacactt ccacttagcc
202519DNAArtificial Sequencesynthetically-generated primers
25actcatccac cgagctact 192620DNAArtificial
Sequencesynthetically-generated primers 26gatgccataa aggcaagaac
202722DNAArtificial Sequencesynthetically-generated primers
27gctggttcgt ctatcttgtg gg 222822DNAArtificial
Sequencesynthetically-generated primers 28cctgcactgg atgagttact tg
222919DNAArtificial Sequencesynthetically-generated primers
29cagagaaagt agttggtaa 193019DNAArtificial
Sequencesynthetically-generated primers 30tggtcaagct tgtaaataa
193119DNAArtificial Sequencesynthetically-generated primers
31acagaaaggg caacaataa 193219DNAArtificial
Sequencesynthetically-generated primers 32gctcaaagct aaaacgaca
193319DNAArtificial Sequencesynthetically-generated primers
33gggctgctca gaagtctat 193421DNAArtificial
Sequencesynthetically-generated primers 34aaaatcactg aaagaaacca c
213526DNAArtificial Sequencesynthetically-generated primers
35actttgcata cagtcctact ttactt 263625DNAArtificial
Sequencesynthetically-generated primers 36ggaaaggaga cttgagagat
gatac 253724DNAArtificial Sequencesynthetically-generated primers
37tcgatatggt ttataagagg ttgg 243824DNAArtificial
Sequencesynthetically-generated primers 38gggccacgat atataggagt
atgc 243919DNAArtificial Sequencesynthetically-generated primers
39cccctgtcta tccttagcg 194019DNAArtificial
Sequencesynthetically-generated primers 40actgcaccag aaacgtcag
194134DNAArtificial Sequencesynthetically-generated
primersmisc_feature29n = g, a, t or cmisc_feature30n = g, a, t or
cmisc_feature31n = g, a, t or cmisc_feature32n = g, a, t or
cmisc_feature33n = g, a, t or cmisc_feature(34)...(34)n = g, a, t
or c 41ctttccctac acgacgctct tccgatctnn nnnn 344237DNAArtificial
Sequencesynthetically-generated primers 42caagcagaag acggcatacg
agctcttccg atctggg 374358DNAArtificial
Sequencesynthetically-generated primers 43aatgatacgg cgaccaccga
gatctacact ctttccctac acgacgctct tccgatct 584434DNAArtificial
Sequencesynthetically-generated primers 44caagcagaag acggcatacg
agctcttccg atct 344519DNAArtificial Sequencesynthetically-generated
primers 45tctataaaat ggcggctcg 194618DNAArtificial
Sequencesynthetically-generated primers 46ggaaaagatg gcggctca
184719DNAArtificial Sequencesynthetically-generated primers
47tgtctaagat ggcggaagt 194820DNAArtificial
Sequencesynthetically-generated primers 48cctgccctct agtggtttct
20
* * * * *