U.S. patent application number 16/502970 was filed with the patent office on 2019-10-24 for uses of novel fatty acid desaturases and elongases and products thereof.
The applicant listed for this patent is BASF Plant Science Company GmbH. Invention is credited to Jorg BAUER, Johnathan A. Napier, Olga Sayanova.
Application Number | 20190323022 16/502970 |
Document ID | / |
Family ID | 43448970 |
Filed Date | 2019-10-24 |
View All Diagrams
United States Patent
Application |
20190323022 |
Kind Code |
A1 |
BAUER; Jorg ; et
al. |
October 24, 2019 |
USES OF NOVEL FATTY ACID DESATURASES AND ELONGASES AND PRODUCTS
THEREOF
Abstract
The invention provides isolated nucleic acid molecules which
encode novel fatty acid desaturases and elongases from the organism
Emiliana huxleyi. The invention also provides recombinant
expression vectors containing desaturase or elongase nucleic acid
molecules, host cells into which the expression vectors have been
introduced, and methods for large-scale production of long chain
polyunsaturated fatty acids (LCPUFAs), e.g. arachidonic acid (ARA),
eicosapentaenoic acid (EPA) or docosahexaenoic acid (DHA).
Inventors: |
BAUER; Jorg; (Teltow,
DE) ; Napier; Johnathan A.; (Preston, GB) ;
Sayanova; Olga; (Redbourn, GB) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
BASF Plant Science Company GmbH |
Ludwigshafen |
|
DE |
|
|
Family ID: |
43448970 |
Appl. No.: |
16/502970 |
Filed: |
July 3, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15351962 |
Nov 15, 2016 |
10351870 |
|
|
16502970 |
|
|
|
|
13384277 |
Jan 16, 2012 |
9493520 |
|
|
PCT/EP10/60178 |
Jul 15, 2010 |
|
|
|
15351962 |
|
|
|
|
61226301 |
Jul 17, 2009 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Y 114/19004 20130101;
C12Y 602/01003 20130101; C12N 15/8247 20130101; C12N 9/93 20130101;
C07K 14/435 20130101; C12P 7/6427 20130101; C12N 9/1029 20130101;
C12P 7/6472 20130101; C12N 9/0083 20130101; C12Y 114/19 20130101;
C12Y 114/19003 20130101; C12N 9/0071 20130101; C12Y 114/19006
20130101 |
International
Class: |
C12N 15/82 20060101
C12N015/82; C07K 14/435 20060101 C07K014/435; C12N 9/00 20060101
C12N009/00; C12N 9/02 20060101 C12N009/02 |
Foreign Application Data
Date |
Code |
Application Number |
Jul 17, 2009 |
EP |
09165752.8 |
Claims
1. Plant seed oil obtained from seeds of a transgenic plant
comprising docosahexaenoic acid (DHA), eicosapentaenoic acid (EPA),
and docosapentaenoic acid (DPA), wherein the oil comprises at least
1% DHA and not more than 6% EPA, based on the total fatty acids of
the transgenic seeds, and wherein the oil has a ratio of DHA to DPA
of at least 2.
2. The oil of claim 1, wherein the transgenic plant is a transgenic
oilseed plant.
3. The oil of claim 2, wherein the oilseed plant is flax (Linum
sp.), rapeseed (Brassica sp.), soybean (Glycine sp.), sunflower
(Helianthus sp.), cotton (Gossypium sp.), corn (Zea mays), olive
(Olea sp.), safflower (Carthamus sp.), cocoa (Theobroma cacoa),
peanut (Arachis sp.), hemp, camelina, crambe, oil palm, coconuts,
groundnuts, sesame, castor bean, lesquerella, tallow tree,
sheanuts, tungnuts, kapok fruit, poppy, jojoba, or perilla.
4. The oil of claim 2, wherein the oilseed plant is from the plant
family of Brassicaceae.
5. The oil of claim 2, wherein the oilseed plant is a Brassica
plant.
6. The oil of claim 1, wherein the oil has a ratio of DHA to DPA of
2.9.
7. The oil of claim 1, wherein the oil comprises at least 1% but
not more than 5% EPA.
8. The oil of claim 1, wherein the DHA, EPA and DPA are
triglyceride esters.
9. Plant seed oil obtained from seeds of a transgenic plant plant
comprising docosahexaenoic acid (DHA), eicosapentaenoic acid (EPA),
and docosapentaenoic acid (DPA), wherein the oil comprises at least
1% DHA and not more than 6% EPA, based on the total fatty acids of
the transgenic seed, and wherein the seeds of the transgenic plant
have a conversion rate of DPA to DHA of at least 75%.
10. The oil of claim 9, wherein the transgenic plant is a
transgenic oilseed plant.
11. The oil of claim 10, wherein the oilseed plant is flax (Linum
sp.), rapeseed (Brassica sp.), soybean (Glycine sp.), sunflower
(Helianthus sp.), cotton (Gossypium sp.), corn (Zea mays), olive
(Olea sp.), safflower (Carthamus sp.), cocoa (Theobroma cacoa),
peanut (Arachis sp.), hemp, camelina, crambe, oil palm, coconuts,
groundnuts, sesame, castor bean, lesquerella, tallow tree,
sheanuts, tungnuts, kapok fruit, poppy, jojoba, or perilla.
12. The oil of claim 10, wherein the oilseed plant is from the
plant family of Brassicaceae.
13. The oil of claim 10, wherein the oilseed plant is a Brassica
plant.
14. The oil of claim 9, wherein the oil has a ratio of DHA to DPA
of at least 2.
15. The oil of claim 14, wherein the ratio of DHA to DPA is
2.9.
16. The oil of claim 9, wherein the oil comprises not more than 5%
EPA.
17. The oil of claim 9, wherein the DHA, EPA and DPA are
triglyceride esters.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 15/351,962 filed Nov. 16, 2016, now U.S. Pat. No. 10,351,870,
which is a continuation of U.S. application Ser. No. 13/384,277
filed Jan. 16, 2012, now U.S. Pat. No. 9,493,520, which is a
national stage application (under 35 U.S.C. .sctn. 371) of
PCT/EP2010/060178, filed Jul. 15, 2010, which claims benefit of
U.S. Provisional Application No. 61/226,301, filed Jul. 17, 2009,
and European Application No. 09165752.8, filed Jul. 17, 2009. The
entire contents of each of these applications are hereby
incorporated by reference herein in their entirety.
SUBMISSION OF SEQUENCE LISTING
[0002] The Sequence Listing associated with this application is
filed in electronic format via EFS-Web and hereby incorporated by
reference into the specification in its entirety. The name of the
text file containing the Sequence Listing is
074021_0167_02_590745_5 T25. The size of the text file is 59,186
bytes and the text file was created on Jun. 24, 2019.
[0003] The invention in principle pertains to the field of
recombinant manufacture of fatty acids. It provides nucleic acid
molecules which encode novel fatty acid desaturases and elongases.
The invention also provides recombinant expression vectors
containing desaturase and elongase nucleic acid molecules, host
cells into which the expression vectors have been introduced, and
methods for large-scale production of long chain polyunsaturated
fatty acids (LCPUFAs), e.g. arachidonic acid (ARA),
eicosapentaenoic acid (EPA) or docosahexaenoic acid (DHA).
[0004] Fatty acids are carboxylic acids with long-chain hydrocarbon
side groups that play a fundamental role in many biological
processes. Fatty acids are rarely found free in nature but, rather,
occur in esterified form as the major component of lipids. As such,
lipids/fatty acids are sources of energy (e.g., b-oxidation). In
addition, lipids/fatty acids are an integral part of cell membranes
and, therefore, are indispensable for processing biological or
biochemical information.
[0005] Fatty acids can be divided into two groups: saturated fatty
acids formed of single carbon bonds and the unsaturated fatty acids
which contain one or more carbon double bonds in cis-configuration.
Unsaturated fatty acids are produced by terminal desaturases that
belong to the class of nonheme-iron enzymes. Each of these enzymes
are part of an electron-transport system that contains two other
proteins, namely cytochrome b5 and NADH-cytochrome b5 reductase.
Specifically, such enzymes catalyze the formation of double bonds
between the carbon atoms of a fatty acid molecule, for example, by
catalyzing the oxygen-dependent dehydrogenation of fatty acids
(Sperling et al., 2003). Human and other mammals have a limited
spectrum of desaturases that are required for the formation of
particular double bonds in unsaturated fatty acids and thus, have a
limited capacity for synthesizing essential fatty acids, e.g., long
chain polyunsaturated fatty acids (LCPUFAs). Thus, humans have to
take up some fatty acids through their diet. Such essential fatty
acids include, for example, linoleic acid (C18:2), linolenic acid
(C18:3). In contrast, insects, microorganisms and plants are able
to synthesize a much larger variety of unsaturated fatty acids and
their derivatives. Indeed, the biosynthesis of fatty acids is a
major activity of plants and microorganisms.
[0006] Long chain polyunsaturated fatty acids (LCPUFAs) such as
docosahexaenoic acid (DHA, 22:6(4,7,10,13,16,19)) are essential
components of cell membranes of various tissues and organelles in
mammals (nerve, retina, brain and immune cells). For example, over
30% of fatty acids in brain phospholipid are 22:6 (n-3) and 20:4
(n-6) (Crawford, M. A., et al., (1997) Am. J. Clin. Nutr.
66:1032S-1041S). In retina, DHA accounts for more than 60% of the
total fatty acids in the rod outer segment, the photosensitive part
of the photoreceptor cell (Giusto, N. M., et al. (2000) Prog. Lipid
Res. 39:315-391). Clinical studies have shown that DHA is essential
for the growth and development of the brain in infants, and for
maintenance of normal brain function in adults (Martinetz, M.
(1992) J. Pediatr. 120:S129-S138). DHA also has significant effects
on photoreceptor function involved in the signal transduction
process, rhodopsin activation, and rod and cone development
(Giusto, N. M., et al. (2000) Prog. Lipid Res. 39:315-391). In
addition, some positive effects of DHA were also found on diseases
such as hypertension, arthritis, atherosclerosis, depression,
thrombosis and cancers (Horrocks, L. A. and Yeo, Y. K. (1999)
Pharmacol. Res. 40:211-215). Therefore, appropriate dietary supply
of the fatty acid is important for human health. Because such fatty
acids cannot be efficiently synthesized by infants, young children
and senior citizerns, it is particularly important for these
individuals to adequately intake these fatty acids from the diet
(Spector, A. A. (1999) Lipids 34:51-53).
[0007] Currently the major sources of DHA are oils from fish and
algae. Fish oil is a major and traditional source for this fatty
acid, however, it is usually oxidized by the time it is sold. In
addition, the supply of fish oil is highly variable, particularly
in view of the shrinking fish populations. Moreover, the algal
source of oil is expensive due to low yield and the high costs of
extraction.
[0008] EPA and ARA are both .DELTA.5 essential fatty acids. They
form a unique class of food and feed constituents for humans and
animals. EPA belongs to the n-3 series with five double bonds in
the acyl chain. EPA is found in marine food and is abundant in oily
fish from North Atlantic. ARA belongs to the n-6 series with four
double bonds. The lack of a double bond in the .omega.-3 position
confers on ARA different properties than those found in EPA. The
eicosanoids produced from AA have strong inflammatory and platelet
aggregating properties, whereas those derived from EPA have
anti-inflammatory and anti-platelet aggregating properties. ARA can
be obtained from some foods such as meat, fish and eggs, but the
concentration is low.
[0009] Gamma-linolenic acid (GLA) is another essential fatty acid
found in mammals. GLA is the metabolic intermediate for very long
chain n-6 fatty acids and for various active molecules. In mammals,
formation of long chain polyunsaturated fatty acids is rate-limited
by .DELTA.6 desaturation. Many physiological and pathological
conditions such as aging, stress, diabetes, eczema, and some
infections have been shown to depress the .DELTA.6 desaturation
step. In addition, GLA is readily catabolized from the oxidation
and rapid cell division associated with certain disorders, e.g.,
cancer or inflammation. Therefore, dietary supplementation with GLA
can reduce the risks of these disorders. Clinical studies have
shown that dietary supplementation with GLA is effective in
treating some pathological conditions such as atopic eczema,
premenstrual syndrome, diabetes, hypercholesterolemia, and
inflammatory and cardiovascular disorders.
[0010] A large number of beneficial health effects have been shown
for DHA or mixtures of EPA/DHA. DHA is a n-3 very long chain fatty
acid with six double bonds.
[0011] Although biotechnology offers an attractive route for the
production of specialty fatty acids, current techniques fail to
provide an efficient means for the large scale production of
unsaturated fatty acids. Accordingly, there exists a need for an
improved and efficient method of producing unsaturated fatty acids,
such as DHA, EPA and ARA.
[0012] Thus, the present invention relates to a polynucleotide
comprising a nucleic acid sequence elected from the group
consisting of: [0013] a) a nucleic acid sequence having a
nucleotide sequence as shown in SEQ ID NOs: 1, 3, 5, 7 or 9; [0014]
b) a nucleic acid sequence encoding a polypeptide having an amino
acid sequence as shown in SEQ ID NOs: 2, 4, 6, 8 or 10; [0015] c) a
nucleic acid sequence being at least 70% identical to the nucleic
acid sequence of a) or b), wherein said nucleic acid sequence
encodes a polypeptide having desaturase or elongase activity;
[0016] d) a nucleic acid sequence encoding a polypeptide having
desaturase or elongase activity and having an amino acid sequence
which is at least 82% identical to the amino acid sequence of any
one of a) to c); and [0017] e) a nucleic acid sequence which is
capable of hybridizing under stringent conditions to any one of a)
to d), wherein said nucleic acid sequence encodes a polypeptide
having desaturase or elongase activity.
[0018] The term "polynucleotide" as used in accordance with the
present invention relates to a polynucleotide comprising a nucleic
acid sequence which encodes a polypeptide having desaturase or
elongase activity. Preferably, the polypeptide encoded by the
polynucleotide of the present invention having desaturase or
elongase activity upon expression in a plant shall be capable of
increasing the amount of PUFA and, in particular, LCPUFA in, e.g.,
seed oils or the entire plant or parts thereof. Such an increase
is, preferably, statistically significant when compared to a LCPUFA
producing transgenic control plant which expresses the the present
state of the art set of desaturases and elongases required for
LCPUFA synthesis but does not express the polynucleotide of the
present invention. Whether an increase is significant can be
determined by statistical tests well known in the art including,
e.g., Student's t-test. More preferably, the increase is an
increase of the amount of triglycerides containing LCPUFA of at
least 5%, at least 10%, at least 15%, at least 20% or at least 30%
compared to the said control. Preferably, the LCPUFA referred to
before is a polyunsaturated fatty acid having a C-20 or C-22 fatty
acid body, more preferably, ARA, EPA or DHA. Suitable assays for
measuring the activities mentioned before are described in the
accompanying Examples.
[0019] The term "desaturase" or "elongase" as used herein refers to
the activity of a desaturase, introducing a double bond into the
carbon chain of a fatty acid, preferably into fatty acids with 18,
20 or 22 carbon molecules, or an elongase, introducing two carbon
molecules into the carbon chain of a fatty acid, preferably into
fatty acids with 18, 20 or 22 carbon molecules
[0020] More preferably, polynucleotides having a nucleic acid
sequence as shown in SEQ ID NOs: 1, 3, 5, 7 or 9 encoding
polypeptides having amino acid sequences as shown in SEQ ID NOs: 2,
4, 6, 8 or 10 or variants thereof, preferably, exhibit desaturase
or elongase activity.
[0021] Polynucleotides encoding a polypeptide having desaturase or
elongase activity as specified above has been obtained in
accordance with the present invention, preferably, from Emiliana
huxleyi. However, orthologs, paralogs or other homologs may be
identified from other species. Preferably, they are obtained from
plants such as algae, for example Isochrysis, Mantoniella,
Ostreococcus or Crypthecodinium, algae/diatoms such as
Phaeodactylum, Thalassiosira or Thraustochytrium, mosses such as
Physcomitrella or Ceratodon, or higher plants such as the
Primulaceae such as Aleuritia, Calendula stellata, Osteospermum
spinescens or Osteospermum hyoseroides, microorganisms such as
fungi, such as Aspergillus, Phytophthora, Entomophthora, Mucor or
Mortierella, bacteria such as Shewanella, yeasts or animals.
Preferred animals are nematodes such as Caenorhabditis, insects or
vertebrates. Among the vertebrates, the nucleic acid molecules may,
preferably, be derived from Euteleostomi, Actinopterygii;
Neopterygii; Teleostei; Euteleostei, Protacanthopterygii,
Salmoniformes; Salmonidae or Oncorhynchus, more preferably, from
the order of the Salmoniformes, most preferably, the family of the
Salmonidae, such as the genus Salmo, for example from the genera
and species Oncorhynchus mykiss, Trutta trutta or Salmo trutta
fario. Moreover, the nucleic acid molecules may be obtained from
the diatoms such as the genera Thallasiosira or Phaeodactylum.
[0022] Thus, the term "polynucleotide" as used in accordance with
the present invention further encompasses variants of the
aforementioned specific polynucleotides representing orthologs,
paralogs or other homologs of the polynucleotide of the present
invention. Moreover, variants of the polynucleotide of the present
invention also include artificially generated muteins. Said muteins
include, e.g., enzymes which are generated by mutagenesis
techniques and which exhibit improved or altered substrate
specificity, or codon optimized polynucleotides. The polynucleotide
variants, preferably, comprise a nucleic acid sequence
characterized in that the sequence can be derived from the
aforementioned specific nucleic acid sequences shown in any one of
SEQ ID NOs: 1, 3, 5, 7 or 9 or by a polynucleotide encoding a
polypeptide having an amino acid sequence as shown in any one of
SEQ ID NOs: 2, 4, 6, 8 or 10 by at least one nucleotide
substitution, addition and/or deletion, whereby the variant nucleic
acid sequence shall still encode a polypeptide having a desaturase
or elongase activity as specified above. Variants also encompass
polynucleotides comprising a nucleic acid sequence which is capable
of hybridizing to the aforementioned specific nucleic acid
sequences, preferably, under stringent hybridization conditions.
These stringent conditions are known to the skilled worker and can
be found in Current Protocols in Molecular Biology, John Wiley
& Sons, N.Y. (1989), 6.3.1-6.3.6. A preferred example for
stringent hybridization conditions are hybridization conditions in
6.times.sodium chloride/sodium citrate (=SSC) at approximately
45.degree. C., followed by one or more wash steps in 0.2.times.SSC,
0.1% SDS at 50 to 65.degree. C. The skilled worker knows that these
hybridization conditions differ depending on the type of nucleic
acid and, for example when organic solvents are present, with
regard to the temperature and concentration of the buffer. For
example, under "standard hybridization conditions" the temperature
differs depending on the type of nucleic acid between 42.degree. C.
and 58.degree. C. in aqueous buffer with a concentration of 0.1 to
5.times.SSC (pH 7.2). If organic solvent is present in the
abovementioned buffer, for example 50% formamide, the temperature
under standard conditions is approximately 42.degree. C. The
hybridization conditions for DNA: DNA hybrids are, preferably,
0.1.times.SSC and 20.degree. C. to 45.degree. C., preferably
between 30.degree. C. and 45.degree. C. The hybridization
conditions for DNA:RNA hybrids are, preferably, 0.1.times.SSC and
30.degree. C. to 55.degree. C., preferably between 45.degree. C.
and 55.degree. C. The abovementioned hybridization temperatures are
determined for example for a nucleic acid with approximately 100 bp
(=base pairs) in length and a G+C content of 50% in the absence of
formamide. The skilled worker knows how to determine the
hybridization conditions required by referring to textbooks such as
the textbook mentioned above, or the following textbooks: Sambrook
et al., "Molecular Cloning", Cold Spring Harbor Laboratory, 1989;
Hames and Higgins (Ed.) 1985, "Nucleic Acids Hybridization: A
Practical Approach", IRL Press at Oxford University Press, Oxford;
Brown (Ed.) 1991, "Essential Molecular Biology: A Practical
Approach", IRL Press at Oxford University Press, Oxford.
Alternatively, polynucleotide variants are obtainable by PCR-based
techniques such as mixed oligonucleotide primer-based amplification
of DNA, i.e. using degenerated primers against conserved domains of
the polypeptides of the present invention. Conserved domains of the
polypeptide of the present invention may be identified by a
sequence comparison of the nucleic acid sequences of the
polynucleotides or the amino acid sequences of the polypeptides of
the present invention. Oligonucleotides suitable as PCR primers as
well as suitable PCR conditions are described in the accompanying
Examples. As a template, DNA or cDNA from bacteria, fungi, plants
or animals may be used. Further, variants include polynucleotides
comprising nucleic acid sequences which are at least 50%, at least
55%, at least 60%, at least 65%, at least 70%, at least 75%, at
least 80%, at least 85%, at least 90%, at least 95%, at least 98%
or at least 99% identical to the nucleic acid sequences shown in
any one of SEQ ID NOs: 1, 3, 5, 7 or 9, preferably, encoding
polypeptides retaining a desaturase or elongase activity as
specified above. Moreover, also encompassed are polynucleotides
which comprise nucleic acid sequences encoding a polypeptide having
an amino acid sequences which are at least 50%, at least 55%, at
least 60%, at least 65%, at least 70%, at least 75%, at least 80%,
at least 85%, at least 90%, at least 95%, at least 98% or at least
99% identical to the amino acid sequences shown in any one of SEQ
ID NOs: 2, 4, 6, 8 or 10, wherein the polypeptide, preferably,
retains desaturase or elongase activity as specified above. The
percent identity values are, preferably, calculated over the entire
amino acid or nucleic acid sequence region. A series of programs
based on a variety of algorithms is available to the skilled worker
for comparing different sequences. In a preferred embodiment, the
percent identity between two amino acid sequences is determined
using the Needleman and Wunsch algorithm (Needleman 1970, J. Mol.
Biol. (48):444-453) which has been incorporated into the needle
program in the EMBOSS software package (EMBOSS: The European
Molecular Biology Open Software Suite, Rice, P., Longden, I., and
Bleasby, A, Trends in Genetics 16(6), 276-277, 2000), using either
a BLOSUM 45 or PAM250 scoring matrix for distantly related
proteins, or either a BLOSUM 62 or PAM160 scoring matrix for closer
related proteins, and a gap opening penalty of 16, 14, 12, 10, 8,
6, or 4 and a gap extension penalty of 0.5, 1, 2, 3, 4, 5, or 6.
Guides for local installation of the EMBOSS package as well as
links to WEB-Services can be found at emboss.sourceforge.net. A
preferred, non-limiting example of parameters to be used for
aligning two amino acid sequences using the needle program are the
default parameters, including the EBLOSUM62 scoring matrix, a gap
opening penalty of 10 and a gap extension penalty of 0.5. In yet
another preferred embodiment, the percent identity between two
nucleotide sequences is determined using the needle program in the
EMBOSS software package (EMBOSS: The European Molecular Biology
Open Software Suite, Rice, P., Longden, I., and Bleasby, A, Trends
in Genetics 16(6), 276-277, 2000), using the EDNAFULL scoring
matrix and a gap opening penalty of 16, 14, 12, 10, 8, 6, or 4 and
a gap extension penalty of 0.5, 1, 2, 3, 4, 5, or 6. A preferred,
non-limiting example of parameters to be used in conjunction for
aligning two amino acid sequences using the needle program are the
default parameters, including the EDNAFULL scoring matrix, a gap
opening penalty of 10 and a gap extension penalty of 0.5. The
nucleic acid and protein sequences of the present invention can
further be used as a "query sequence" to perform a search against
public databases to, for example, identify other family members or
related sequences. Such searches can be performed using the BLAST
series of programs (version 2.2) of Altschul et al. (Altschul 1990,
J. Mol. Biol. 215:403-10). BLAST using acyltransferase nucleic acid
sequences of the invention as query sequence can be performed with
the BLASTn, BLASTx or the tBLASTx program using default parameters
to obtain either nucleotide sequences (BLASTn, tBLASTx) or amino
acid sequences (BLASTx) homologous to acyltransferase sequences of
the invention. BLAST using acyltransferase protein sequences of the
invention as query sequence can be performed with the BLASTp or the
tBLASTn program using default parameters to obtain either amino
acid sequences (BLASTp) or nucleic acid sequences (tBLASTn)
homologous to acyltransferase sequences of the invention. To obtain
gapped alignments for comparison purposes, Gapped BLAST using
default parameters can be utilized as described in Altschul et al.
(Altschul 1997, Nucleic Acids Res. 25(17):3389-3402).
TABLE-US-00001 TABLE 1 Relation of sequence types of querry and hit
sequences for various BLAST programs Input query Converted
Converted Actual sequence Query Algorithm Hit Database DNA BLASTn
DNA PRT BLASTp PRT DNA PRT BLASTx PRT PRT tBLASTn PRT DNA DNA PRT
tBLASTx PRT DNA
[0023] A polynucleotide comprising a fragment of any of the
aforementioned nucleic acid sequences is also encompassed as a
polynucleotide of the present invention. The fragment shall encode
a polypeptide which still has desaturase and elongase activity as
specified above. Accordingly, the polypeptide may comprise or
consist of the domains of the polypeptide of the present invention
conferring the said biological activity. A fragment as meant
herein, preferably, comprises at least 50, at least 100, at least
250 or at least 500 consecutive nucleotides of any one of the
aforementioned nucleic acid sequences or encodes an amino acid
sequence comprising at least 20, at least 30, at least 50, at least
80, at least 100 or at least 150 consecutive amino acids of any one
of the aforementioned amino acid sequences.
[0024] The variant polynucleotides or fragments referred to above,
preferably, encode polypeptides retaining desaturase or elongase
activity to a significant extent, preferably, at least 10%, at
least 20%, at least 30%, at least 40%, at least 50%, at least 60%,
at least 70%, at least 80% or at least 90% of the desaturase and
elongase activity exhibited by any of the polypeptide shown in any
one of SEQ ID NOs: 2, 4, 6, 8 or 10. The activity may be tested as
described in the accompanying Examples.
[0025] The polynucleotides of the present invention either
essentially consist of the aforementioned nucleic acid sequences or
comprise the aforementioned nucleic acid sequences. Thus, they may
contain further nucleic acid sequences as well. Preferably, the
polynucleotide of the present invention may comprise in addition to
an open reading frame further untranslated sequence at the 3' and
at the 5' terminus of the coding gene region: at least 500,
preferably 200, more preferably 100 nucleotides of the sequence
upstream of the 5' terminus of the coding region and at least 100,
preferably 50, more preferably 20 nucleotides of the sequence
downstream of the 3' terminus of the coding gene region.
Furthermore, the polynucleotides of the present invention may
encode fusion proteins wherein one partner of the fusion protein is
a polypeptide being encoded by a nucleic acid sequence recited
above. Such fusion proteins may comprise as additional part other
enzymes of the fatty acid or PUFA biosynthesis pathways,
polypeptides for monitoring expression (e.g., green, yellow, blue
or red fluorescent proteins, alkaline phosphatase and the like) or
so called "tags" which may serve as a detectable marker or as an
auxiliary measure for purification purposes. Tags for the different
purposes are well known in the art and comprise FLAG-tags,
6-histidine-tags, MYC-tags and the like.
[0026] The polynucleotide of the present invention shall be
provided, preferably, either as an isolated polynucleotide (i.e.
purified or at least isolated from its natural context such as its
natural gene locus) or in genetically modified or exogenously (i.e.
artificially) manipulated form. An isolated polynucleotide can, for
example, comprise less than approximately 5 kb, 4 kb, 3 kb, 2 kb, 1
kb, 0.5 kb or 0.1 kb of nucleotide sequences which naturally flank
the nucleic acid molecule in the genomic DNA of the cell from which
the nucleic acid is derived. The polynucleotide, preferably, is
provided in the form of double or single stranded molecule. It will
be understood that the present invention by referring to any of the
aforementioned polynucleotides of the invention also refers to
complementary or reverse complementary strands of the specific
sequences or variants thereof referred to before. The
polynucleotide encompasses DNA, including cDNA and genomic DNA, or
RNA polynucleotides.
[0027] However, the present invention also pertains to
polynucleotide variants which are derived from the polynucleotides
of the present invention and are capable of interfering with the
transcription or translation of the polynucleotides of the present
invention. Such variant polynucleotides include anti-sense nucleic
acids, ribozymes, siRNA molecules, morpholino nucleic acids
(phosphorodiamidate morpholino oligos), triple-helix forming
oligonucleotides, inhibitory oligonucleotides, or micro RNA
molecules all of which shall specifically recognize the
polynucleotide of the invention due to the presence of
complementary or substantially complementary sequences. These
techniques are well known to the skilled artisan. Suitable variant
polynucleotides of the aforementioned kind can be readily designed
based on the structure of the polynucleotides of this
invention.
[0028] Moreover, comprised are also chemically modified
polynucleotides including naturally occurring modified
polynucleotides such as glycosylated or methylated polynucleotides
or artificial modified ones such as biotinylated
polynucleotides.
[0029] In the studies underlying the present invention,
advantageously, polynucleotides where identified encoding
desaturase and elongases from Emiliana huxleyi. In particular, the
Emiliana huxleyi desaturases .DELTA.4Des(Eh), .DELTA.8Des(Eh) and
.DELTA.5Des(Eh) and elongases .DELTA.9Elo(Eh) and .DELTA.5Elo(Eh)
have been identified. Each of the desaturases are capable of
introducing a double bond into fatty acids. For example, the
expression of the .DELTA.8Des(Eh) leads to introduction of a double
bond at position eight into C20:2n-6 fatty acid. The
polynucleotides of the present invention are particularly suitable
for the recombinant manufacture of LCPUFAs and, in particular, ARA,
EPA and/or DHA.
[0030] In a preferred embodiment of the polynucleotide of the
present invention, said polynucleotide further comprises an
expression control sequence operatively linked to the said nucleic
acid sequence.
[0031] The term "expression control sequence" as used herein refers
to a nucleic acid sequence which is capable of governing, i.e.
initiating and controlling, transcription of a nucleic acid
sequence of interest, in the present case the nucleic sequences
recited above. Such a sequence usually comprises or consists of a
promoter or a combination of a promoter and enhancer sequences.
Expression of a polynucleotide comprises transcription of the
nucleic acid molecule, preferably, into a translatable mRNA.
Additional regulatory elements may include transcriptional as well
as translational enhancers. The following promoters and expression
control sequences may be, preferably, used in an expression vector
according to the present invention. The cos, tac, trp, tet,
trp-tet, Ipp, lac, Ipp-lac, laclq, T7, T5, T3, gal, trc, ara, SP6,
.lamda.-PR or .lamda.-PL promoters are, preferably, used in
Gram-negative bacteria. For Gram-positive bacteria, promoters amy
and SPO2 may be used. From yeast or fungal promoters ADC1, AOX1r,
GAL1, MF.alpha., AC, P-60, CYC1, GAPDH, TEF, rp28, ADH are,
preferably, used. For animal cell or organism expression, the
promoters CMV-, SV40-, RSV-promoter (Rous sarcoma virus),
CMV-enhancer, SV40-enhancer are preferably used. From plants the
promoters CaMV/35S (Franck 1980, Cell 21: 285-294], PRP1 (Ward
1993, Plant. Mol. Biol. 22), SSU, OCS, lib4, usp, STLS1, B33, nos
or the ubiquitin or phaseolin promoter. Also preferred in this
context are inducible promoters, such as the promoters described in
EP 0 388 186 A1 (i.e. a benzylsulfonamide-inducible promoter), Gatz
1992, Plant J. 2:397-404 (i.e. a tetracyclin-inducible promoter),
EP 0 335 528 A1 (i.e. a abscisic-acid-inducible promoter) or WO
93/21334 (i.e. a ethanol- or cyclohexenol-inducible promoter).
Further suitable plant promoters are the promoter of cytosolic
FBPase or the ST-LSI promoter from potato (Stockhaus 1989, EMBO J.
8, 2445), the phosphoribosyl-pyrophosphate amidotransferase
promoter from Glycine max (Genbank accession No. U87999) or the
node-specific promoter described in EP 0 249 676 A1. Particularly
preferred are promoters which enable the expression in tissues
which are involved in the biosynthesis of fatty acids. Also
particularly preferred are seed-specific promoters such as the USP
promoter in accordance with the practice, but also other promoters
such as the LeB4, DC3, phaseolin or napin promoters. Further
especially preferred promoters are seed-specific promoters which
can be used for monocotyledonous or dicotyledonous plants and which
are described in U.S. Pat. No. 5,608,152 (napin promoter from
oilseed rape), WO 98/45461 (oleosin promoter from Arobidopsis, U.S.
Pat. No. 5,504,200 (phaseolin promoter from Phaseolus vulgaris), WO
91/13980 (Bce4 promoter from Brassica), by Baeumlein et al., Plant
J., 2, 2, 1992:233-239 (LeB4 promoter from a legume), these
promoters being suitable for dicots. The following promoters are
suitable for monocots: Ipt-2 or Ipt-1 promoter from barley (WO
95/15389 and WO 95/23230), hordein promoter from barley and other
promoters which are suitable and which are described in WO
99/16890. In principle, it is possible to use all natural promoters
together with their regulatory sequences, such as those mentioned
above, for the novel process. Likewise, it is possible and
advantageous to use synthetic promoters, either additionally or
alone, especially when they mediate a seed-specific expression,
such as, for example, as described in WO 99/16890. In a particular
embodiment, seed-specific promoters are utilized to enhance the
production of the desired PUFA or LCPUFA.
[0032] The term "operatively linked" as used herein means that the
expression control sequence and the nucleic acid of interest are
linked so that the expression of the said nucleic acid of interest
can be governed by the said expression control sequence, i.e. the
expression control sequence shall be functionally linked to the
said nucleic acid sequence to be expressed. Accordingly, the
expression control sequence and, the nucleic acid sequence to be
expressed may be physically linked to each other, e.g., by
inserting the expression control sequence at the 5' end of the
nucleic acid sequence to be expressed. Alternatively, the
expression control sequence and the nucleic acid to be expressed
may be merely in physical proximity so that the expression control
sequence is capable of governing the expression of at least one
nucleic acid sequence of interest. The expression control sequence
and the nucleic acid to be expressed are, preferably, separated by
not more than 500 bp, 300 bp, 100 bp, 80 bp, 60 bp, 40 bp, 20 bp,
10 bp or 5 bp.
[0033] In a further preferred embodiment of the polynucleotide of
the present invention, said polynucleotide further comprises a
terminator sequence operatively linked to the nucleic acid
sequence.
[0034] The term "terminator" as used herein refers to a nucleic
acid sequence which is capable of terminating transcription. These
sequences will cause dissociation of the transcription machinery
from the nucleic acid sequence to be transcribed. Preferably, the
terminator shall be active in plants and, in particular, in plant
seeds. Suitable terminators are known in the art and, preferably,
include polyadenylation signals such as the SV40-poly-A site or the
tk-poly-A site or one of the plant specific signals indicated in
Loke et al. (Loke 2005, Plant Physiol 138, pp. 1457-1468),
downstream of the nucleic acid sequence to be expressed.
[0035] The present invention also relates to a vector comprising
the polynucleotide of the present invention.
[0036] The term "vector", preferably, encompasses phage, plasmid,
viral vectors as well as artificial chromosomes, such as bacterial
or yeast artificial chromosomes. Moreover, the term also relates to
targeting constructs which allow for random or site-directed
integration of the targeting construct into genomic DNA. Such
target constructs, preferably, comprise DNA of sufficient length
for either homolgous or heterologous recombination as described in
detail below. The vector encompassing the polynucleotide of the
present invention, preferably, further comprises selectable markers
for propagation and/or selection in a host. The vector may be
incorporated into a host cell by various techniques well known in
the art. If introduced into a host cell, the vector may reside in
the cytoplasm or may be incorporated into the genome. In the latter
case, it is to be understood that the vector may further comprise
nucleic acid sequences which allow for homologous recombination or
heterologous insertion. Vectors can be introduced into prokaryotic
or eukaryotic cells via conventional transformation or transfection
techniques. The terms "transformation" and "transfection",
conjugation and transduction, as used in the present context, are
intended to comprise a multiplicity of prior-art processes for
introducing foreign nucleic acid (for example DNA) into a host
cell, including calcium phosphate, rubidium chloride or calcium
chloride co-precipitation, DEAE-dextran-mediated transfection,
lipofection, natural competence, carbon-based clusters, chemically
mediated transfer, electroporation or particle bombardment.
Suitable methods for the transformation or transfection of host
cells, including plant cells, can be found in Sambrook et al.
(Molecular Cloning: A Laboratory Manual, 2.sup.nd ed., Cold Spring
Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1989) and other laboratory manuals, such as Methods
in Molecular Biology, 1995, Vol. 44, Agrobacterium protocols, Ed.:
Gartland and Davey, Humana Press, Totowa, N.J. Alternatively, a
plasmid vector may be introduced by heat shock or electroporation
techniques. Should the vector be a virus, it may be packaged in
vitro using an appropriate packaging cell line prior to application
to host cells.
[0037] Preferably, the vector referred to herein is suitable as a
cloning vector, i.e. replicable in microbial systems. Such vectors
ensure efficient cloning in bacteria and, preferably, yeasts or
fungi and make possible the stable transformation of plants. Those
which must be mentioned are, in particular, various binary and
co-integrated vector systems which are suitable for the
T-DNA-mediated transformation. Such vector systems are, as a rule,
characterized in that they contain at least the vir genes, which
are required for the Agrobacterium-mediated transformation, and the
sequences which delimit the T-DNA (T-DNA border). These vector
systems, preferably, also comprise further cis-regulatory regions
such as promoters and terminators and/or selection markers with
which suitable transformed host cells or organisms can be
identified. While co-integrated vector systems have vir genes and
T-DNA sequences arranged on the same vector, binary systems are
based on at least two vectors, one of which bears vir genes, but no
T-DNA, while a second one bears T-DNA, but no vir gene. As a
consequence, the last-mentioned vectors are relatively small, easy
to manipulate and can be replicated both in E. coli and in
Agrobacterium. These binary vectors include vectors from the
pBlB-HYG, pPZP, pBecks, pGreen series. Preferably used in
accordance with the invention are Bin19, pB1101, pBinAR, pGPTV and
pCAMBIA. An overview of binary vectors and their use can be found
in Hellens et al, Trends in Plant Science (2000) 5, 446-451.
Furthermore, by using appropriate cloning vectors, the
polynucleotides can be introduced into host cells or organisms such
as plants or animals and, thus, be used in the transformation of
plants, such as those which are published, and cited, in: Plant
Molecular Biology and Biotechnology (CRC Press, Boca Raton, Fla.),
chapter 6/7, pp. 71-119 (1993); F. F. White, Vectors for Gene
Transfer in Higher Plants; in: Transgenic Plants, vol. 1,
Engineering and Utilization, Ed.: Kung and R. Wu, Academic Press,
1993, 15-38; B. Jenes et al., Techniques for Gene Transfer, in:
Transgenic Plants, vol. 1, Engineering and Utilization, Ed.: Kung
and R. Wu, Academic Press (1993), 128-143; Potrykus 1991, Annu.
Rev. Plant Physiol. Plant Molec. Biol. 42, 205-225.
[0038] More preferably, the vector of the present invention is an
expression vector. In such an expression vector, i.e. a vector
which comprises the polynucleotide of the invention having the
nucleic acid sequence operatively linked to an expression control
sequence (also called "expression cassette") allowing expression in
prokaryotic or eukaryotic cells or isolated fractions thereof.
Suitable expression vectors are known in the art such as
Okayama-Berg cDNA expression vector pcDV1 (Pharmacia), pCDM8,
pRc/CMV, pcDNA1, pcDNA3 (Invitrogene) or pSPORT1 (GIBCO BRL).
Further examples of typical fusion expression vectors are pGEX
(Pharmacia Biotech Inc; Smith 1988, Gene 67:31-40), pMAL (New
England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway,
N.J.), where glutathione S-transferase (GST), maltose E-binding
protein and protein A, respectively, are fused with the recombinant
target protein. Examples of suitable inducible nonfusion E. coli
expression vectors are, inter alia, pTrc (Amann 1988, Gene
69:301-315) and pET 11d (Studier 1990, Methods in Enzymology 185,
60-89). The target gene expression of the pTrc vector is based on
the transcription from a hybrid trp-lac fusion promoter by host RNA
polymerase. The target gene expression from the pET 11d vector is
based on the transcription of a T7-gn10-lac fusion promoter, which
is mediated by a coexpressed viral RNA polymerase (T7 gn1). This
viral polymerase is provided by the host strains BL21 (DE3) or
HMS174 (DE3) from a resident X-prophage which harbors a T7 gn1 gene
under the transcriptional control of the lacUV 5 promoter. The
skilled worker is familiar with other vectors which are suitable in
prokaryotic organisms; these vectors are, for example, in E. coli,
pLG338, pACYC184, the pBR series such as pBR322, the pUC series
such as pUC18 or pUC19, the M113mp series, pKC30, pRep4, pHS1,
pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN-III113-81, .lamda.gt11
or pBdCl, in Streptomyces pIJ101, pIJ364, pIJ702 or pIJ361, in
Bacillus pUB110, pC194 or pBD214, in Corynebacterium pSA77 or
pAJ667. Examples of vectors for expression in the yeast S.
cerevisiae comprise pYep Sec1 (Baldari 1987, Embo J. 6:229-234),
pMFa (Kurjan 1982, Cell 30:933-943), pJRY88 (Schultz 1987, Gene
54:113-123) and pYES2 (Invitrogen Corporation, San Diego, Calif.).
Vectors and processes for the construction of vectors which are
suitable for use in other fungi, such as the filamentous fungi,
comprise those which are described in detail in: van den Hondel, C.
A. M. J. J., & Punt, P. J. (1991) "Gene transfer systems and
vector development for filamentous fungi, in: Applied Molecular
Genetics of fungi, J. F. Peberdy et al., Ed., pp. 1-28, Cambridge
University Press: Cambridge, or in: More Gene Manipulations in
Fungi (J. W. Bennett & L. L. Lasure, Ed., pp. 396-428: Academic
Press: San Diego). Further suitable yeast vectors are, for example,
pAG-1, YEp6, YEp13 or pEMBLYe23. As an alternative, the
polynucleotides of the present invention can be also expressed in
insect cells using baculovirus expression vectors. Baculovirus
vectors which are available for the expression of proteins in
cultured insect cells (for example Sf9 cells) comprise the pAc
series (Smith 1983, Mol. Cell Biol. 3:2156-2165) and the pVL series
(Lucklow 1989, Virology 170:31-39).
[0039] The polynucleotide of the present invention can be expressed
in single-cell plant cells (such as algae), see Falciatore 1999,
Marine Biotechnology 1 (3):239-251 and the references cited
therein, and plant cells from higher plants (for example
Spermatophytes, such as arable crops) by using plant expression
vectors. Examples of plant expression vectors comprise those which
are described in detail in: Becker 1992, Plant Mol. Biol.
20:1195-1197; Bevan 1984, Nucl. Acids Res. 12:8711-8721; Vectors
for Gene Transfer in Higher Plants; in: Transgenic Plants, Vol. 1,
Engineering and Utilization, Ed.: Kung and R. Wu, Academic Press,
1993, p. 15-38. A plant expression cassette, preferably, comprises
regulatory sequences which are capable of controlling the gene
expression in plant cells and which are functionally linked so that
each sequence can fulfill its function, such as transcriptional
termination, for example polyadenylation signals. Preferred
polyadenylation signals are those which are derived from
Agrobacterium tumefaciens T-DNA, such as the gene 3 of the Ti
plasmid pTiACH5, which is known as octopine synthase (Gielen 1984,
EMBO J. 3, 835) or functional equivalents of these, but all other
terminators which are functionally active in plants are also
suitable. Since plant gene expression is very often not limited to
transcriptional levels, a plant expression cassette preferably
comprises other functionally linked sequences such as translation
enhancers, for example the overdrive sequence, which comprises the
5'-untranslated tobacco mosaic virus leader sequence, which
increases the protein/RNA ratio (Gallie 1987, Nucl. Acids Research
15:8693-8711). As described above, plant gene expression must be
functionally linked to a suitable promoter which performs the
expression of the gene in a timely, cell-specific or
tissue-specific manner. Promoters which can be used are
constitutive promoters (Benfey 1989, EMBO J. 8:2195-2202) such as
those which are derived from plant viruses such as 35S CAMV (Franck
1980, Cell 21:285-294), 19S CaMV (see U.S. Pat. No. 5,352,605 and
WO 84/02913) or plant promoters such as the promoter of the Rubisco
small subunit, which is described in U.S. Pat. No. 4,962,028. Other
preferred sequences for the use in functional linkage in plant gene
expression cassettes are targeting sequences which are required for
targeting the gene product into its relevant cell compartment (for
a review, see Kermode 1996, Crit. Rev. Plant Sci. 15, 4: 285-423
and references cited therein), for example into the vacuole, the
nucleus, all types of plastids, such as amyloplasts, chloroplasts,
chromoplasts, the extracellular space, the mitochondria, the
endoplasmic reticulum, oil bodies, peroxisomes and other
compartments of plant cells. As described above, plant gene
expression can also be facilitated via a chemically inducible
promoter (for a review, see Gatz 1997, Annu. Rev. Plant Physiol.
Plant Mol. Biol., 48:89-108). Chemically inducible promoters are
particularly suitable if it is desired that genes are expressed in
a time-specific manner. Examples of such promoters are a
salicylic-acid-inducible promoter (WO 95/19443), a
tetracyclin-inducible promoter (Gatz 1992, Plant J. 2, 397-404) and
an ethanol-inducible promoter. Promoters which respond to biotic or
abiotic stress conditions are also suitable promoters, for example
the pathogen-induced PRP1-gene promoter (Ward 1993, Plant Mol.
Biol. 22:361-366), the heat-inducible hsp80 promoter from tomato
(U.S. Pat. No. 5,187,267), the cold-inducible alpha-amylase
promoter from potato (WO 96/12814) or the wound-inducible pinII
promoter (EP 0 375 091 A). The promoters which are especially
preferred are those which bring about the expression of genes in
tissues and organs in which fatty acid, lipid and oil biosynthesis
takes place, in seed cells such as the cells of endosperm and of
the developing embryo. Suitable promoters are the napin gene
promoter from oilseed rape (U.S. Pat. No. 5,608,152), the USP
promoter from Vicia faba (Baeumlein 1991, Mol. Gen. Genet. 225
(3):459-67), the oleosin promoter from Arabidopsis (WO 98/45461),
the phaseolin promoter from Phaseolus vulgaris (U.S. Pat. No.
5,504,200), the Bce4 promoter from Brassica (WO 91/13980) or the
legumin B4 promoter (LeB4; Baeumlein 1992, Plant Journal, 2
(2):233-9), and promoters which bring about the seed-specific
expression in monocotyledonous plants such as maize, barley, wheat,
rye, rice and the like. Suitable promoters to be taken into
consideration are the Ipt2 or Ipt1 gene promoter from barley (WO
95/15389 and WO 95/23230) or those which are described in WO
99/16890 (promoters from the barley hordein gene, the rice glutelin
gene, the rice oryzin gene, the rice prolamin gene, the wheat
gliadin gene, wheat glutelin gene, the maize zein gene, the oat
glutelin gene, the sorghum kasirin gene, the rye secalin gene).
Likewise, especially suitable are promoters which bring about the
plastid-specific expression since plastids are the compartment in
which the precursors and some end products of lipid biosynthesis
are synthesized. Suitable promoters such as the viral
RNA-polymerase promoter, are described in WO 95/16783 and WO
97/06250, and the clpP promoter from Arabidopsis, described in WO
99/46394.
[0040] The abovementioned vectors are only a small overview of
vectors to be used in accordance with the present invention.
Further vectors are known to the skilled worker and are described,
for example, in: Cloning Vectors (Ed., Pouwels, P. H., et al.,
Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018). For
further suitable expression systems for prokaryotic and eukaryotic
cells see the chapters 16 and 17 of Sambrook, loc cit.
[0041] It follows from the above that, preferably, said vector is
an expression vector. More preferably, the said polynucleotide of
the present invention is under the control of a seed-specific
promoter in the vector of the present invention. A preferred
seed-specific promoter as meant herein is selected from the group
consisting of Conlinin 1, Conlinin 2, napin, LuFad3, USP, LeB4,
Arc, Fae, ACP, LuPXR, and SBP. For details, see, e.g., US
2003-0159174.
[0042] Moreover, the present invention relates to a host cell
comprising the polynucleotide or the vector of the present
invention.
[0043] Preferably, said host cell is a plant cell and, more
preferably, a plant cell obtained from an oilseed crop. More
preferably, said oilseed crop is selected from the group consisting
of flax (Linum sp.), rapeseed (Brassica sp.), soybean (Glycine
sp.), sunflower (Helianthus sp.), cotton (Gossypium sp.), corn (Zea
mays), olive (Olea sp.), safflower (Carthamus sp.), cocoa
(Theobroma cacoa), peanut (Arachissp.), hemp, camelina, crambe, oil
palm, coconuts, groundnuts, sesame seed, castor bean, lesquerella,
tallow tree, sheanuts, tungnuts, kapok fruit, poppy seed, jojoba
seeds and perilla.
[0044] Also preferably, said host cell is a microorganism. More
preferably, said microorganism is a bacterium, a fungus or algae.
More preferably, it is selected from the group consisting of
Candida, Cryptococcus, Lipomyces, Rhodosporidium, Yarrowia and
Schizochytrium.
[0045] Moreover, a host cell according to the present invention may
also be an animal cell. Preferably, said animal host cell is a host
cell of a fish or a cell line obtained therefrom. More preferably,
the fish host cell is from herring, salmon, sardine, redfish, eel,
carp, trout, halibut, mackerel, zander or tuna.
[0046] Generally, the controlling steps in the production of
LCPUFAs, i.e., the long chain unsaturated fatty acid biosynthetic
pathway, are catalyzed by membrane-associated fatty acid
desaturases and elongases. Plants and most other eukaryotic
organisms have specialized desaturase and elongase systems for the
introduction of double bonds and the extension of fatty acids
beyond C18 atoms. The elongase reactions have several important
features in common with the fatty acid synthase complex (FAS).
However, the elongase complex is different from the FAS complex as
the complex is localized in the cytosol and membrane bound, ACP is
not involved and the elongase 3-keto-acyl-CoA-synthase catalyzes
the condensation of malonyl-CoA with an acyl primer. The elongase
complex consists of four components with different catalytic
functions, the keto-acyl-synthase (condensation reaction of
malonyl-CoA to acyl-CoA, creation of a 2 C atom longer
keto-acyl-CoA fatty acid), the keto-acyl-reductase (reduction of
the 3-keto group to a 3-hydroxy-group), the dehydratase
(dehydration results in a 3-enoyl-acyl-CoA fatty acid) and the
enoly-CoA-reductase (reduction of the double bond at position 3,
release from the complex). For the production of LCPUFAs including
ARA, EPA and/or DHA the elongation reactions, beside the
desaturation reactions, are essential. Higher plants do not have
the necessary enzyme set to produce LCPUFAs (4 or more double
bonds, 20 or more C atoms). Therefore the catalytic activities have
to be conferred to the plants or plant cells. The polynucleotides
of the present invention catalyze the desaturation and elongation
activities necessary for the formation of ARA, EPA and/or DHA. By
delivering the novel desaturases and elongases increased levels of
PUFAs and LCPUFAs are produced.
[0047] However, person skilled in the art knows that dependent on
the host cell, further, enzymatic activities may be conferred to
the host cells, e.g., by recombinant technologies. Accordingly, the
present invention, preferably, envisages a host cell which in
addition to the polynucleotide of the present invention comprises
polynucleotides encoding such desaturases and/or elongases as
required depending on the selected host cell. Preferred desaturases
and/or elongases which shall be present in the host cell are at
least one enzyme selected from the group consisting of:
.DELTA.-4-desaturase, .DELTA.-5-desaturase, .DELTA.-5-elongase,
.DELTA.-6-desaturase, .DELTA.12-desaturase, .DELTA.15-desaturase,
.omega.3-desaturase and .DELTA.-6-elongase. Especially preferred
are the bifunctional d12d15-Desaturases d12d15Des(Ac) from
Acanthamoeba castellanii (WO2007042510), d12d15Des(Cp) from
Claviceps purpurea (WO2008006202) and d12d15Des(Lg)1 from Lottia
gigantea (WO2009016202), the d12-Desaturases d12Des(Co) from
Calendula officinalis (WO200185968), d12Des(Lb) from Laccaria
bicolor (WO2009016202), d12Des(Mb) from Monosiga brevicollis
(WO2009016202), d12Des(Mg) from Mycosphaerella graminicola
(WO2009016202), d12Des(Nh) from Nectria haematococca
(WO2009016202), d12Des(OI) from Ostreococcus lucimarinus
(WO2008040787), d12Des(Pb) from Phycomyces blakesleeanus
(WO2009016202), d12Des(Ps) from Phytophthora sojae (WO2006100241)
and d12Des(Tp) from Thalassiosira pseudonana (WO2006069710), the
d15-Desaturases d15Des(Hr) from Helobdella robusta (WO2009016202),
d15Des(Mc) from Microcoleus chthonoplastes (WO2009016202),
d15Des(Mf) from Mycosphaerella fijiensis (WO2009016202), d15Des(Mg)
from Mycosphaerella graminicola (WO2009016202) and d15Des(Nh)2 from
Nectria haematococca (WO2009016202), the d4-Desaturases d4Des(Eg)
from Euglena gracilis (WO2004090123), d4Des(Tc) from
Thraustochytrium sp. (WO2002026946) and d4Des(Tp) from
Thalassiosira pseudonana (WO2006069710), the d5-Desaturases
d5Des(OI)2 from Ostreococcus lucimarinus (WO2008040787), d5Des(Pp)
from Physcomitrella patens (WO2004057001), d5Des(Pt) from
Phaeodactylum tricornutum (WO2002057465), d5Des(Tc) from
Thraustochytrium sp. (WO2002026946), d5Des(Tp) from Thalassiosira
pseudonana (WO2006069710) and the d6-Desaturases d6Des(Cp) from
Ceratodon purpureus (WO2000075341), d6Des(OI) from Ostreococcus
lucimarinus (WO2008040787), d6Des(Ot) from Ostreococcus tauri
(WO2006069710), d6Des(Pf) from Primula farinosa (WO2003072784),
d6Des(Pir)_BO from Pythium irregulare (WO2002026946), d6Des(Pir)
from Pythium irregulare (WO2002026946), d6Des(Plu) from Primula
luteola (WO2003072784), d6Des(Pp) from Physcomitrella patens
(WO200102591), d6Des(Pt) from Phaeodactylum tricornutum
(WO2002057465), d6Des(Pv) from Primula vialii (WO2003072784) and
d6Des(Tp) from Thalassiosira pseudonana (WO2006069710), the
d8-Desaturases d8Des(Ac) from Acanthamoeba castellanii (EP1790731),
d8Des(Eg) from Euglena gracilis (WO200034439) and d8Des(Pm) from
Perkinsus marinus (WO2007093776), the o3-Desaturases o3Des(Pi) from
Phytophthora infestans (WO2005083053), o3Des(Pir) from Pythium
irregulare (WO2008022963), o3Des(Pir)2 from Pythium irregulare
(WO2008022963) and o3Des(Ps) from Phytophthora sojae
(WO2006100241), the bifunctional d5d6-elongases d5d6Elo(Om)2 from
Oncorhynchus mykiss (WO2005012316), d5d6Elo(Ta) from
Thraustochytrium aureum (WO2005012316) and d5d6Elo(Tc) from
Thraustochytrium sp. (WO2005012316), the d5-elongases d5Elo(At)
from Arabidopsis thaliana (WO2005012316), d5Elo(At)2 from
Arabidopsis thaliana (WO2005012316), d5Elo(Ci) from Ciona
intestinalis (WO2005012316), d5Elo(OI) from Ostreococcus
lucimarinus (WO2008040787), d5Elo(Ot) from Ostreococcus tauri
(WO2005012316), d5Elo(Tp) from Thalassiosira pseudonana
(WO2005012316) and d5Elo(XI) from Xenopus laevis (WO2005012316),
the d6-elongases d6Elo(OI) from Ostreococcus lucimarinus
(WO2008040787), d6Elo(Ot) from Ostreococcus tauri (WO2005012316),
d6Elo(Pi) from Phytophthora infestans (WO2003064638), d6Elo(Pir)
from Pythium irregulare (WO2009016208), d6Elo(Pp) from
Physcomitrella patens (WO2001059128), d6Elo(Ps) from Phytophthora
sojae (WO2006100241), d6Elo(Ps)2 from Phytophthora sojae
(WO2006100241), d6Elo(Ps)3 from Phytophthora sojae (WO2006100241),
d6Elo(Pt) from Phaeodactylum tricornutum (WO2005012316), d6Elo(Tc)
from Thraustochytrium sp. (WO2005012316) and d6Elo(Tp) from
Thalassiosira pseudonana (WO2005012316), the d9-elongases d9Elo(Ig)
from Isochrysis galbana (WO2002077213), d9Elo(Pm) from Perkinsus
marinus (WO2007093776) and d9Elo(Ro) from Rhizopus oryzae
(WO2009016208). Particularly, if the manufacture of ARA is
envisaged in higher plants, the enzymes recited in Table 3, below
(i.e. additionally a d6-desaturase, d6-elongase, d5-elongase,
d5-desaturase, d12-desaturase, and d6-elongase) or enzymes having
essentially the same activity may be combined in a host cell. If
the manufacture of EPA is envisaged in higher plants, the enzymes
recited in Table 4, below (i.e. additionally a d6-desaturase,
d6-elongase, d5-desaturase, d12-desaturase, d6-elongase, omega
3-desaturase and d15-desaturase), or enzymes having essentially the
same activity may be combined in a host cell. If the manufacture of
DHA is envisaged in higher plants, the enzymes recited in Table 5,
below (i.e. additionally a d6-desaturase, d6-elongase,
d5-desaturase, d12-desaturase, d6-elongase, omega 3-desaturase,
d15-desaturase, d5-elongase, and d4-desaturase), or enzymes having
essentially the same activity may be combined in a host cell.
[0048] The present invention also relates to a cell, preferably a
host cell as specified above or a cell of a non-human organism
specified elsewhere herein, said cell comprising a polynucleotide
which is obtained from the polynucleotide of the present invention
by a point mutation, a truncation, an inversion, a deletion, an
addition, a substitution and homologous recombination. How to carry
out such modifications to a polynucleotide is well known to the
skilled artisan and has been described elsewhere in this
specification in detail.
[0049] The present invention furthermore pertains to a method for
the manufacture of a polypeptide encoded by a polynucleotide of any
the present invention comprising [0050] a) cultivating the host
cell of the invention under conditions which allow for the
production of the said polypeptide; and [0051] b) obtaining the
polypeptide from the host cell of step a).
[0052] Suitable conditions which allow for expression of the
polynucleotide of the invention comprised by the host cell depend
on the host cell as well as the expression control sequence used
for governing expression of the said polynucleotide. These
conditions and how to select them are very well known to those
skilled in the art. The expressed polypeptide may be obtained, for
example, by all conventional purification techniques including
affinity chromatography, size exclusion chromatography, high
pressure liquid chromatography (HPLC) and precipitation techniques
including antibody precipitation. It is to be understood that the
method may--although preferred--not necessarily yield an
essentially pure preparation of the polypeptide. It is to be
understood that depending on the host cell which is used for the
aforementioned method, the polypeptides produced thereby may become
posttranslationally modified or processed otherwise.
[0053] The present invention also encompasses a polypeptide encoded
by the polynucleotide of of the present invention or which is
obtainable by the aforementioned method.
[0054] The term "polypeptide" as used herein encompasses
essentially purified polypeptides or polypeptide preparations
comprising other proteins in addition. Further, the term also
relates to the fusion proteins or polypeptide fragments being at
least partially encoded by the polynucleotide of the present
invention referred to above. Moreover, it includes chemically
modified polypeptides. Such modifications may be artificial
modifications or naturally occurring modifications such as
phosphorylation, glycosylation, myristylation and the like (Review
in Mann 2003, Nat. Biotechnol. 21, 255-261, review with focus on
plants in Huber 2004, Curr. Opin. Plant Biol. 7, 318-322).
Currently, more than 300 posttranslational modifications are known
(see full ABFRC Delta mass list at abrf.org/index.cfm/dm.home). The
polypeptides of the present invention shall exhibit the desaturase
or elongase activity referred to above.
[0055] Encompassed by the present invention is, furthermore, an
antibody or fragments thereof which specifically recognizes the
polypeptide of the invention.
[0056] Antibodies against the polypeptides of the invention can be
prepared by well known methods using a purified polypeptide
according to the invention or a suitable fragment derived therefrom
as an antigen. A fragment which is suitable as an antigen may be
identified by antigenicity determining algorithms well known in the
art. Such fragments may be obtained either from the polypeptide of
the invention by proteolytic digestion or may be a synthetic
peptide. Preferably, the antibody of the present invention is a
monoclonal antibody, a polyclonal antibody, a single chain
antibody, a chimerized antibody or a fragment of any of these
antibodies, such as Fab, Fv or scFv fragments etc. Also comprised
as antibodies by the present invention are bispecific antibodies,
synthetic antibodies or chemically modified derivatives of any of
the aforementioned antibodies. The antibody of the present
invention shall specifically bind (i.e. does significantly not
cross react with other polypeptides or peptides) to the polypeptide
of the invention. Specific binding can be tested by various well
known techniques. Antibodies or fragments thereof can be obtained
by using methods which are described, e.g., in Harlow and Lane
"Antibodies, A Laboratory Manual", CSH Press, Cold Spring Harbor,
1988. Monoclonal antibodies can be prepared by the techniques
originally described in Kohler 1975, Nature 256, 495, and Galfre
1981, Meth. Enzymol. 73, 3, which comprise the fusion of mouse
myeloma cells to spleen cells derived from immunized mammals. The
antibodies can be used, for example, for the immunoprecipitation,
immunolocalization or purification (e.g., by affinity
chromatography) of the polypeptides of the invention as well as for
the monitoring of the presence of said variant polypeptides, for
example, in recombinant organisms, and for the identification of
proteins or compounds interacting with the proteins according to
the invention.
[0057] Moreover, the present invention contemplates a non-human
transgenic organism comprising the polynucleotide or the vector of
the present invention.
[0058] Preferably, the non-human transgenic organism is a plant,
plant part, or plant seed. Preferred plants to be used for
introducing the polynucleotide or the vector of the invention are
plants which are capable of synthesizing fatty acids, such as all
dicotyledonous or monocotyledonous plants, algae or mosses. It is
to be understood that host cells derived from a plant may also be
used for producing a plant according to the present invention.
Preferred plants are selected from the group of the plant families
Adelotheciaceae, Anacardiaceae, Asteraceae, Apiaceae, Betulaceae,
Boraginaceae, Brassicaceae, Bromeliaceae, Caricaceae, Cannabaceae,
Convolvulaceae, Chenopodiaceae, Crypthecodiniaceae, Cucurbitaceae,
Ditrichaceae, Elaeagnaceae, Ericaceae, Euphorbiaceae, Fabaceae,
Geraniaceae, Gramineae, Juglandaceae, Lauraceae, Leguminosae,
Linaceae, Prasinophyceae or vegetable plants or ornamentals such as
Tagetes. Examples which may be mentioned are the following plants
selected from the group consisting of: Adelotheciaceae such as the
genera Physcomitrella, such as the genus and species Physcomitrella
patens, Anacardiaceae such as the genera Pistacia, Mangifera,
Anacardium, for example the genus and species Pistacia vera
[pistachio], Mangifer indica [mango] or Anacardium occidentale
[cashew], Asteraceae, such as the genera Calendula, Carthamus,
Centaurea, Cichorium, Cynara, Helianthus, Lactuca, Locusta,
Tagetes, Valeriana, for example the genus and species Calendula
officinalis [common marigold], Carthamus tinctorius [safflower],
Centaurea cyanus [cornflower], Cichorium intybus [chicory], Cynara
scolymus [artichoke], Helianthus annus [sunflower], Lactuca sativa,
Lactuca crispa, Lactuca esculenta, Lactuca scariola L. ssp. sativa,
Lactuca scariola L. var. integrata, Lactuca scariola L. var.
integrifolia, Lactuca sativa subsp. romana, Locusta communis,
Valeriana locusta [salad vegetables], Tagetes lucida, Tagetes
erecta or Tagetes tenuifolia [african or french marigold],
Apiaceae, such as the genus Daucus, for example the genus and
species Daucus carota [carrot], Betulaceae, such as the genus
Corylus, for example the genera and species Corylus avellana or
Corylus colurna [hazelnut], Boraginaceae, such as the genus Borago,
for example the genus and species Borago officinalis [borage],
Brassicaceae, such as the genera Brassica, Melanosinapis, Sinapis,
Arabadopsis, for example the genera and species Brassica napus,
Brassica rapa ssp. [oilseed rape], Sinapis arvensis Brassica
juncea, Brassica juncea var. juncea, Brassica juncea var.
crispifolia, Brassica juncea var. foliosa, Brassica nigra, Brassica
sinapioides, Melanosinapis communis [mustard], Brassica oleracea
[fodder beet] or Arabidopsis thaliana, Bromeliaceae, such as the
genera Anana, Bromelia (pineapple), for example the genera and
species Anana comosus, Ananas ananas or Bromelia comosa
[pineapple], Caricaceae, such as the genus Carica, such as the
genus and species Carica papaya [pawpaw], Cannabaceae, such as the
genus Cannabis, such as the genus and species Cannabis sativa
[hemp], Convolvulaceae, such as the genera Ipomea, Convolvulus, for
example the genera and species Ipomoea batatus, Ipomoea pandurata,
Convolvulus batatas, Convolvulus tiliaceus, Ipomoea fastigiata,
Ipomoea tiliacea, Ipomoea triloba or Convolvulus panduratus [sweet
potato, batate], Chenopodiaceae, such as the genus Beta, such as
the genera and species Beta vulgaris, Beta vulgaris var. altissima,
Beta vulgaris var. Vulgaris, Beta maritima, Beta vulgaris var.
perennis, Beta vulgaris var. conditiva or Beta vulgaris var.
esculenta [sugarbeet], Crypthecodiniaceae, such as the genus
Crypthecodinium, for example the genus and species Cryptecodinium
cohnii, Cucurbitaceae, such as the genus Cucurbita, for example the
genera and species Cucurbita maxima, Cucurbita mixta, Cucurbita
pepo or Cucurbita moschata [pumpkin/squash], Cymbellaceae such as
the genera Amphora, Cymbella, Okedenia, Phaeodactylum, Reimeria,
for example the genus and species Phaeodactylum tricornutum,
Ditrichaceae such as the genera Ditrichaceae, Astomiopsis,
Ceratodon, Chrysoblastella, Ditrichum, Distichium, Eccremidium,
Lophidion, Philibertiella, Pleuridium, Saelania, Trichodon,
Skottsbergia, for example the genera and species Ceratodon
antarcticus, Ceratodon columbiae, Ceratodon heterophyllus,
Ceratodon purpureus, Ceratodon purpureus, Ceratodon purpureus ssp.
convolutus, Ceratodon, purpureus spp. stenocarpus, Ceratodon
purpureus var. rotundifolius, Ceratodon ratodon, Ceratodon
stenocarpus, Chrysoblastella chilensis, Ditrichum ambiguum,
Ditrichum brevisetum, Ditrichum crispatissimum, Ditrichum
difficile, Ditrichum falcifolium, Ditrichum flexicaule, Ditrichum
giganteum, Ditrichum heteromallum, Ditrichum lineare, Ditrichum
lineare, Ditrichum montanum, Ditrichum montanum, Ditrichum
pallidum, Ditrichum punctulatum, Ditrichum pusillum, Ditrichum
pusillum var. tortile, Ditrichum rhynchostegium, Ditrichum
schimperi, Ditrichum tortile, Distichium capillaceum, Distichium
hagenii, Distichium inclinatum, Distichium macounii, Eccremidium
floridanum, Eccremidium whiteleggei, Lophidion strictus, Pleuridium
acuminatum, Pleuridium alternifolium, Pleuridium holdridgei,
Pleuridium mexicanum, Pleuridium ravenelii, Pleuridium subulatum,
Saelania glaucescens, Trichodon borealis, Trichodon cylindricus or
Trichodon cylindricus var. oblongus, Elaeagnaceae such as the genus
Elaeagnus, for example the genus and species Olea europaea [olive],
Ericaceae such as the genus Kalmia, for example the genera and
species Kalmia latifolia, Kalmia angustifolia, Kalmia microphylla,
Kalmia polifolia, Kalmia occidentalis, Cistus chamaerhodendros or
Kalmia lucida [mountain laurel], Euphorbiaceae such as the genera
Manihot, Janipha, Jatropha, Ricinus, for example the genera and
species Manihot utilissima, Janipha manihot, Jatropha manihot,
Manihot aipil, Manihot dulcin, Manihot manihot, Manihot
melanobasis, Manihot esculenta [manihot] or Ricinus communis
[castor-oil plant], Fabaceae such as the genera Pisum, Albizia,
Cathormion, Feuillea, Inga, Pithecolobium, Acacia, Mimosa,
Medicajo, Glycine, Dolichos, Phaseolus, Soja, for example the
genera and species Pisum sativum, Pisum arvense, Pisum humile
[pea], Albizia berteriana, Albizia julibrissin, Albizia lebbeck,
Acacia berteriana, Acacia littoralis, Albizia berteriana, Albizzia
berteriana, Cathormion berteriana, Feuillea berteriana, Inga
fragrans, Pithecellobium berterianum, Pithecellobium fragrans,
Pithecolobium berterianum, Pseudalbizzia berteriana, Acacia
julibrissin, Acacia nemu, Albizia nemu, Feuilleea julibrissin,
Mimosa julibrissin, Mimosa speciosa, Sericanrda julibrissin, Acacia
lebbeck, Acacia macrophylla, Albizia lebbek, Feuilleea lebbeck,
Mimosa lebbeck, Mimosa speciosa [silk tree], Medicago sativa,
Medicago falcata, Medicago varia [alfalfa], Glycine max Dolichos
soja, Glycine gracilis, Glycine hispida, Phaseolus max, Soja
hispida or Soja max [soybean], Funariaceae such as the genera
Aphanorrhegma, Entosthodon, Funaria, Physcomitrella, Physcomitrium,
for example the genera and species Aphanorrhegma serratum,
Entosthodon attenuatus, Entosthodon bolanderi, Entosthodon
bonplandii, Entosthodon californicus, Entosthodon drummondii,
Entosthodon jamesonii, Entosthodon leibergii, Entosthodon
neoscoticus, Entosthodon rubrisetus, Entosthodon spathulifolius,
Entosthodon tucsoni, Funaria americana, Funaria bolanderi, Funaria
calcarea, Funaria californica, Funaria calvescens, Funaria
convoluta, Funaria flavicans, Funaria groutiana, Funaria
hygrometrica, Funaria hygrometrica var. arctica, Funaria
hygrometrica var. calvescens, Funaria hygrometrica var. convoluta,
Funaria hygrometrica var. muralis, Funaria hygrometrica var.
utahensis, Funaria microstoma, Funaria microstoma var. obtusifolia,
Funaria muhlenbergii, Funaria orcuttii, Funaria plano-convexa,
Funaria polaris, Funaria ravenelii, Funaria rubriseta, Funaria
serrata, Funaria sonorae, Funaria sublimbatus, Funaria tucsoni,
Physcomitrella californica, Physcomitrella patens, Physcomitrella
readeri, Physcomitrium australe, Physcomitrium californicum,
Physcomitrium collenchymatum, Physcomitrium coloradense,
Physcomitrium cupuliferum, Physcomitrium drummondii, Physcomitrium
eurystomum, Physcomitrium flexifolium, Physcomitrium hookeri,
Physcomitrium hookeri var. serratum, Physcomitrium immersum,
Physcomitrium kellermanii, Physcomitrium megalocarpum,
Physcomitrium pyriforme, Physcomitrium pyriforme var. serratum,
Physcomitrium rufipes, Physcomitrium sandbergii, Physcomitrium
subsphaericum, Physcomitrium washingtoniense, Geraniaceae, such as
the genera Pelargonium, Cocos, Oleum, for example the genera and
species Cocos nucifera, Pelargonium grossularioides or Oleum cocois
[coconut], Gramineae, such as the genus Saccharum, for example the
genus and species Saccharum officinarum, Juglandaceae, such as the
genera Juglans, Wallia, for example the genera and species Juglans
regia, Juglans ailanthifolia, Juglans sieboldiana, Juglans cinerea,
Wallia cinerea, Juglans bixbyi, Juglans californica, Juglans
hindsii, Juglans intermedia, Juglans jamaicensis, Juglans major,
Juglans microcarpa, Juglans nigra or Wallia nigra [walnut],
Lauraceae, such as the genera Persea, Laurus, for example the
genera and species Laurus nobilis [bay], Persea americana, Persea
gratissima or Persea persea [avocado], Leguminosae, such as the
genus Arachis, for example the genus and species Arachis hypogaea
[peanut], Linaceae, such as the genera Linum, Adenolinum, for
example the genera and species Linum usitatissimum, Linum humile,
Linum austriacum, Linum bienne, Linum angustifolium, Linum
catharticum, Linum flavum, Linum grandiflorum, Adenolinum
grandiflorum, Linum lewisii, Linum narbonense, Linum perenne, Linum
perenne var. lewisii, Linum pratense or Linum trigynum [linseed],
Lythrarieae, such as the genus Punica, for example the genus and
species Punica granatum [pomegranate], Malvaceae, such as the genus
Gossypium, for example the genera and species Gossypium hirsutum,
Gossypium arboreum, Gossypium barbadense, Gossypium herbaceum or
Gossypium thurberi [cotton], Marchantiaceae, such as the genus
Marchantia, for example the genera and species Marchantia
berteroana, Marchantia foliacea, Marchantia macropora, Musaceae,
such as the genus Musa, for example the genera and species Musa
nana, Musa acuminata, Musa paradisiaca, Musa spp. [banana],
Onagraceae, such as the genera Camissonia, Oenothera, for example
the genera and species Oenothera biennis or Camissonia brevipes
[evening primrose], Palmae, such as the genus Elacis, for example
the genus and species Elaeis guineensis [oil palm], Papaveraceae,
such as the genus Papaver, for example the genera and species
Papaver orientale, Papaver rhoeas, Papaver dubium [poppy],
Pedaliaceae, such as the genus Sesamum, for example the genus and
species Sesamum indicum [sesame], Piperaceae, such as the genera
Piper, Artanthe, Peperomia, Steffensia, for example the genera and
species Piper aduncum, Piper amalago, Piper angustifolium, Piper
auritum, Piper betel, Piper cubeba, Piper longum, Piper nigrum,
Piper retrofractum, Artanthe adunca, Artanthe elongata, Peperomia
elongata, Piper elongatum, Steffensia elongata [cayenne pepper],
Poaceae, such as the genera Hordeum, Secale, Avena, Sorghum,
Andropogon, Holcus, Panicum, Oryza, Zea (maize), Triticum, for
example the genera and species Hordeum vulgare, Hordeum jubatum,
Hordeum murinum, Hordeum secalinum, Hordeum distichon, Hordeum
aegiceras, Hordeum hexastichon, Hordeum hexastichum, Hordeum
irregulare, Hordeum sativum, Hordeum secalinum [barley], Secale
cereale [rye], Avena sativa, Avena fatua, Avena byzantina, Avena
fatua var. sativa, Avena hybrida [oats], Sorghum bicolor, Sorghum
halepense, Sorghum saccharatum, Sorghum vulgare, Andropogon
drummondii, Holcus bicolor, Holcus sorghum, Sorghum aethiopicum,
Sorghum arundinaceum, Sorghum caffrorum, Sorghum cernuum, Sorghum
dochna, Sorghum drummondii, Sorghum durra, Sorghum guineense,
Sorghum lanceolatum, Sorghum nervosum, Sorghum saccharatum, Sorghum
subglabrescens, Sorghum verticilliflorum, Sorghum vulgare, Holcus
halepensis, Sorghum miliaceum, Panicum militaceum [millet], Oryza
sativa, Oryza latifolia [rice], Zea mays [maize], Triticum
aestivum, Triticum durum, Triticum turgidum, Triticum hybernum,
Triticum macha, Triticum sativum or Triticum vulgare [wheat],
Porphyridiaceae, such as the genera Chroothece, Flintiella,
Petrovanella, Porphyridium, Rhodella, Rhodosorus, Vanhoeffenia, for
example the genus and species Porphyridium cruentum, Proteaceae,
such as the genus Macadamia, for example the genus and species
Macadamia intergrifolia [macadamia], Prasinophyceae such as the
genera Nephroselmis, Prasinococcus, Scherffelia, Tetraselmis,
Mantoniella, Ostreococcus, for example the genera and species
Nephroselmis olivacea, Prasinococcus capsulatus, Scherffelia dubia,
Tetraselmis chui, Tetraselmis suecica, Mantoniella squamata,
Ostreococcus tauri, Rubiaceae such as the genus Cofea, for example
the genera and species Cofea spp., Coffea arabica, Coffea canephora
or Coffea liberica [coffee], Scrophulariaceae such as the genus
Verbascum, for example the genera and species Verbascum blattaria,
Verbascum chaixii, Verbascum densiflorum, Verbascum lagurus,
Verbascum longifolium, Verbascum lychnitis, Verbascum nigrum,
Verbascum olympicum, Verbascum phlomoides, Verbascum phoenicum,
Verbascum pulverulentum or Verbascum thapsus [mullein], Solanaceae
such as the genera Capsicum, Nicotiana, Solanum, Lycopersicon, for
example the genera and species Capsicum annuum, Capsicum annuum
var. glabriusculum, Capsicum frutescens [pepper], Capsicum annuum
[paprika], Nicotiana tabacum, Nicotiana alata, Nicotiana attenuata,
Nicotiana glauca, Nicotiana langsdorffii, Nicotiana obtusifolia,
Nicotiana quadrivalvis, Nicotiana repanda, Nicotiana rustica,
Nicotiana sylvestris [tobacco], Solanum tuberosum [potato], Solanum
melongena [eggplant], Lycopersicon esculentum, Lycopersicon
lycopersicum, Lycopersicon pyriforme, Solanum integrifolium or
Solanum lycopersicum [tomato], Sterculiaceae, such as the genus
Theobroma, for example the genus and species Theobroma cacao
[cacao] or Theaceae, such as the genus Camellia, for example the
genus and species Camellia sinensis [tea]. In particular preferred
plants to be used as transgenic plants in accordance with the
present invention are oil fruit crops which comprise large amounts
of lipid compounds, such as peanut, oilseed rape, canola,
sunflower, safflower, poppy, mustard, hemp, castor-oil plant,
olive, sesame, Calendula, Punica, evening primrose, mullein,
thistle, wild roses, hazelnut, almond, macadamia, avocado, bay,
pumpkin/squash, linseed, soybean, pistachios, borage, trees (oil
palm, coconut, walnut) or crops such as maize, wheat, rye, oats,
triticale, rice, barley, cotton, cassava, pepper, Tagetes,
Solanaceae plants such as potato, tobacco, eggplant and tomato,
Vicia species, pea, alfalfa or bushy plants (coffee, cacao, tea),
Salix species, and perennial grasses and fodder crops. Preferred
plants according to the invention are oil crop plants such as
peanut, oilseed rape, canola, sunflower, safflower, poppy, mustard,
hemp, castor-oil plant, olive,
Calendula, Punica, evening primrose, pumpkin/squash, linseed,
soybean, borage, trees (oil palm, coconut). Especially preferred
are sunflower, safflower, tobacco, mullein, sesame, cotton,
pumpkin/squash, poppy, evening primrose, walnut, linseed, hemp,
thistle or safflower. Very especially preferred plants are plants
such as safflower, sunflower, poppy, evening primrose, walnut,
linseed, or hemp.
[0059] Preferred mosses are Physcomitrella or Ceratodon. Preferred
algae are Isochrysis, Mantoniella, Ostreococcus or Crypthecodinium,
and algae/diatoms such as Phaeodactylum or Thraustochytrium. More
preferably, said algae or mosses are selected from the group
consisting of: Emiliana, Shewanella, Physcomitrella,
Thraustochytrium, Fusarium, Phytophthora, Ceratodon, Isochrysis,
Aleurita, Muscarioides, Mortierella, Phaeodactylum,
Cryphthecodinium, specifically from the genera and species
Thallasiosira pseudonona, Euglena gracilis, Physcomitrella patens,
Phytophtora infestans, Fusarium graminaeum, Cryptocodinium cohnii,
Ceratodon purpureus, Isochrysis galbana, Aleurita farinosa,
Thraustochytrium sp., Muscarioides viallii, Mortierella alpina,
Phaeodactylum tricornutum or Caenorhabditis elegans or especially
advantageously Phytophtora infestans, Thallasiosira pseudonona and
Cryptocodinium cohnii.
[0060] Transgenic plants may be obtained by transformation
techniques as elsewhere in this specification. Preferably,
transgenic plants can be obtained by T-DNA-mediated transformation.
Such vector systems are, as a rule, characterized in that they
contain at least the vir genes, which are required for the
Agrobacterium-mediated transformation, and the sequences which
delimit the T-DNA (T-DNA border). Suitable vectors are described
elsewhere in the specification in detail.
[0061] Also encompassed are transgenic non-human animals comprising
the vector or polynucleotide of the present invention. Preferred
non-human transgenic animals envisaged by the present invention are
fish, such as herring, salmon, sardine, redfish, eel, carp, trout,
halibut, mackerel, zander or tuna.
[0062] However, it will be understood that dependent on the
non-human transgenic organism specified above, further, enzymatic
activities may be conferred to the said organism, e.g., by
recombinant technologies. Accordingly, the present invention,
preferably, envisages a non-human transgenic organism specified
above which in addition to the polynucleotide of the present
invention comprises polynucleotides encoding such desaturases
and/or elongases as required depending on the selected host cell.
Preferred desaturases and/or elongases which shall be present in
the organism are at least one enzyme selected from the group of
desaturases and/or elongases or the combinations specifically
recited elsewhere in this specification (see above and Tables 3, 4
and 5).
[0063] Furthermore, the present invention encompasses a method for
the manufacture of polyunsaturated fatty acids comprising: [0064]
a) cultivating the host cell of the invention under conditions
which allow for the production of polyunsaturated fatty acids in
said host cell; [0065] b) obtaining said polyunsaturated fatty
acids from the said host cell.
[0066] The term "polyunsaturated fatty acids (PUFA)" as used herein
refers to fatty acids comprising at least two, preferably, three,
four, five or six, double bonds. Moreover, it is to be understood
that such fatty acids comprise, preferably from 18 to 24 carbon
atoms in the fatty acid chain. More preferably, the term relates to
long chain PUFA (LCPUFA) having from 20 to 24 carbon atoms in the
fatty acid chain. Preferred unsaturated fatty acids in the sense of
the present invention are selected from the group consisting of
DGLA 20:3 (8,11,14), ARA 20:4 (5,8,11,14), iARA 20:4(8,11,14,17),
EPA 20:5 (5,8,11,14,17), DPA 22:5 (4,7,10,13,16), DHA 22:6
(4,7,10,13,16,19), 20:4 (8,11,14,17), more preferably, arachidonic
acid (ARA) 20:4 (5,8,11,14), eicosapentaenoic acid (EPA) 20:5
(5,8,11,14,17), and docosahexaenoic acid (DHA) 22:6
(4,7,10,13,16,19). Thus, it will be understood that most
preferably, the methods provided by the present invention
pertaining to the manufacture of ARA, EPA or DHA. Moreover, also
encompassed are the intermediates of LCPUFA which occur during
synthesis. Such intermediates are, preferably, formed from
substrates by the desaturase or elongase activity of the
polypeptides of the present invention. Preferably, substrates
encompass LA 18:2 (9,12), ALA 18:3(9,12,15), Eicosadienoic acid
20:2 (11,14), Eicosatrienoic acid 20:3 (11,14,17)), DGLA 20:3
(8,11,14), ARA 20:4 (5,8,11,14), eicosatetraenoic acid 20:4
(8,11,14,17), Eicosapentaenoic acid 20:5 (5,8,11,14,17),
Docosahexapentanoic acid 22:5 (7,10,13,16,19).
[0067] The term "cultivating" as used herein refers maintaining and
growing the host cells under culture conditions which allow the
cells to produce the said polyunsaturated fatty acid, i.e. the PUFA
and/or LCPUFA referred to above. This implies that the
polynucleotide of the present invention is expressed in the host
cell so that the desaturase and/or elongase activity is present.
Suitable culture conditions for cultivating the host cell are
described in more detail below.
[0068] The term "obtaining" as used herein encompasses the
provision of the cell culture including the host cells and the
culture medium as well as the provision of purified or partially
purified preparations thereof comprising the polyunsaturated fatty
acids, preferably, ARA, EPA, DHA, in free or in-CoA bound form, as
membrane phospholipids or as triacylglyceride estres. More
preferably, the PUFA and LCPUFA are to be obtained as triglyceride
esters, e.g., in form of an oil. More details on purification
techniques can be found elsewhere herein below.
[0069] The host cells to be used in the method of the invention are
grown or cultured in the manner with which the skilled worker is
familiar, depending on the host organism. Usually, host cells are
grown in a liquid medium comprising a carbon source, usually in the
form of sugars, a nitrogen source, usually in the form of organic
nitrogen sources such as yeast extract or salts such as ammonium
sulfate, trace elements such as salts of iron, manganese and
magnesium and, if appropriate, vitamins, at temperatures of between
0.degree. C. and 100.degree. C., preferably between 10.degree. C.
and 60.degree. C. under oxygen or anaerobic atmosphere dependent on
the type of organism. The pH of the liquid medium can either be
kept constant, that is to say regulated during the culturing
period, or not. The cultures can be grown batchwise, semibatchwise
or continuously. Nutrients can be provided at the beginning of the
fermentation or administered semicontinuously or continuously: The
produced PUFA or LCPUFA can be isolated from the host cells as
described above by processes known to the skilled worker, e.g., by
extraction, distillation, crystallization, if appropriate
precipitation with salt, and/or chromatography. It might be
required to disrupt the host cells prior to purification. To this
end, the host cells can be disrupted beforehand. The culture medium
to be used must suitably meet the requirements of the host cells in
question. Descriptions of culture media for various microorganisms
which can be used as host cells according to the present invention
can be found in the textbook "Manual of Methods for General
Bacteriology" of the American Society for Bacteriology (Washington
D.C., USA, 1981). Culture media can also be obtained from various
commercial suppliers. All media components are sterilized, either
by heat or by filter sterilization. All media components may be
present at the start of the cultivation or added continuously or
batchwise, as desired. If the polynucleotide or vector of the
invention which has been introduced in the host cell further
comprises an expressible selection marker, such as an antibiotic
resistance gene, it might be necessary to add a selection agent to
the culture, such as a antibiotic in order to maintain the
stability of the introduced polynucleotide. The culture is
continued until formation of the desired product is at a maximum.
This is normally achieved within 10 to 160 hours. The fermentation
broths can be used directly or can be processed further. The
biomass may, according to requirement, be removed completely or
partially from the fermentation broth by separation methods such
as, for example, centrifugation, filtration, decanting or a
combination of these methods or be left completely in said broth.
The fatty acid preparations obtained by the method of the
invention, e.g., oils, comprising the desired PUFA or LCPUFA as
triglyceride esters are also suitable as starting material for the
chemical synthesis of further products of interest. For example,
they can be used in combination with one another or alone for the
preparation of pharmaceutical or cosmetic compositions, foodstuffs,
or animal feeds. Chemically pure triglycerides comprising the
desired PUFA or LCPUFA can also be manufactured by the methods
described above. To this end, the fatty acid preparations are
further purified by extraction, distillation, crystallization,
chromatography or combinations of these methods. In order to
release the fatty acid moieties from the triglycerides, hydrolysis
may be also required. The said chemically pure triglycerides or
free fatty acids are, in particular, suitable for applications in
the food industry or for cosmetic and pharmacological
compositions.
[0070] Moreover, the present invention relates to a method for the
manufacture of poly-unsaturated fatty acids comprising: [0071] a)
cultivating the non-human transgenic organism of the invention
under conditions which allow for the production of poly-unsaturated
fatty acids in said non-human transgenic organism; and [0072] b)
obtaining said poly-unsaturated fatty acids from the said non-human
transgenic organism.
[0073] Further, it follows from the above that a method for the
manufacture of an oil, lipid or fatty acid composition is also
envisaged by the present invention comprising the steps of any one
of the aforementioned methods and the further step of formulating
PUFA or LCPUFA as oil, lipid or fatty acid composition. Preferably,
said oil, lipid or fatty acid composition is to be used for feed,
foodstuffs, cosmetics or medicaments. Accordingly, the formulation
of the PUFA or LCPUFA shall be carried out according to the GMP
standards for the individual envisaged products. For example, an
oil may be obtained from plant seeds by an oil mill. However, for
product safety reasons, sterilization may be required under the
applicable GMP standard. Similar standards will apply for lipid or
fatty acid compositions to be applied in cosmetic or pharmaceutical
compositions. All these measures for formulating oil, lipid or
fatty acid compositions as products are comprised by the
aforementioned manufacture.
[0074] The term "oil" refers to a fatty acid mixture comprising
unsaturated and/or saturated fatty acids which are esterified to
triglycerides. Preferably, the triglycerides in the oil of the
invention comprise PUFA or LCPUFA as referred to above. The amount
of esterified PUFA and/or LCPUFA is, preferably, approximately 30%,
a content of 50% is more preferred, a content of 60%, 70%, 80% or
more is even more preferred. The oil may further comprise free
fatty acids, preferably, the PUFA and LCPUFA referred to above. For
the analysis, the fatty acid content can be, e.g., determined by GC
analysis after converting the fatty acids into the methyl esters by
transesterification. The content of the various fatty acids in the
oil or fat can vary, in particular depending on the source. The
oil, however, shall have a non-naturally occurring composition with
respect to the PUFA and/or LCPUFA composition and content. It will
be understood that such a unique oil composition and the unique
esterification pattern of PUFA and LCPUFA in the triglycerides of
the oil shall only be obtainable by applying the methods of the
present invention specified above. Moreover, the oil of the
invention may comprise other molecular species as well.
Specifically, it may comprise minor impurities of the
polynucleotide or vector of the invention. Such impurities,
however, can be detected only by highly sensitive techniques such
as PCR.
[0075] The contents of all references cited throughout this
application are herewith incorporated by reference in general and
with respect to their specific disclosure content referred to
above.
FIGURES
[0076] FIG. 1 shows a schematical figure of the different enzymatic
activities leading to the production of ARA, EPA and DHA.
[0077] FIG. 2 shows a yeast expression experiment with feeding of
22:5n-3 in the presence (A) and absence (B) of d4Des(Eh).
[0078] FIG. 3 shows a yeast expression experiment with feeding of
20:3n-3 in the presence (A) and absence (B) of d8Des(Eh).
[0079] FIG. 4 shows a yeast expression experiment with feeding of
18:3n-3 in the presence (A) and absence (B) of d9Elo(Eh).
[0080] FIG. 5 shows a yeast expression experiment with feeding of
18:3n-6 (GLA) and 18:4n-3 (SDA) in the presence (A) and absence (B)
of d5Elo(Eh).
[0081] FIG. 6 shows a yeast expression experiment with feeding of
20:4n-6 (ARA) and 20:5n-3 (EPA) in the presence (A) and absence (B)
of d5Elo(Eh).
[0082] FIG. 7 shows the expression of d9Elo(Eh) in seeds of two
Arabidopsis events. As control seeds not expression d9Elo(Eh) are
shown (WT).
[0083] FIG. 8 shows the Acyl-CoA analysis of mature Arabidopsis
seeds from both events expressing the d9Elo(Eh) in comparison to
seeds not expressing d9Elo(Eh) (Col0)).
[0084] FIG. 9 shows the expression of d9Elo(Eh), d8Des(Eh) and
d5Des(Eh) in seeds of various Arabidopsis events.
[0085] FIG. 10 shows gas chromatographic analysis of mature
Arabidopsis seeds transformed with the construct OstELO5EmD4. Peaks
were quantified and listed in the table below. The products of
d5Elo(Ot) and d4Des(Eh) activity are 22:6n-3 (DHA).
[0086] FIG. 11 is a comparison between two d4-desaturases (Tc and
Eh) showing that d4Des(Eh) is different from known d4-desaturases
in producing a high ratio of DHA:DPA.
[0087] FIG. 12 shows the expression of d5Elo(Eh) in seeds of
various Arabidopsis events.
[0088] FIG. 13 is a comparison between three different
d6-desaturases and the substrate specificity of d5Des(Eh).
[0089] This invention is further illustrated by the following
examples which should not be construed as limiting. The contents of
all references, patents and published patent applications cited
throughout this application, as well as the figures, are
incorporated herein by reference.
EXAMPLES
Example 1: Organism and Culture Conditions
[0090] Emiliana huxleyi was grown as described in Sciandra et al.
(2003) Marine Ecology Progress Series 261:111-122 with following
conditions:
[0091] Growth in 50 ml inconical flasks using K/2 medium (Keller et
al. (1987) Journal of Phycology 23:633-638). The flasks were placed
in a growth chamber at a temperature of 17.+-.0.1.degree. C. under
14L:10D irradiance. Light was provided by fluorescent lamps giving
a photon fluxdensity (400 to 700 nm) of 170 .mu.mol photon m-2
s-1.
Example 2: Cloning of Novel Desaturase and Elongase Sequences
[0092] RNA from cells grown as described under Example 1 was
extracted using the RNA-extraction Kit from Qiagen, a RACE-library
was generated using the RACE-Kit from Clontech. From the
RACE-library sequences for desaturase and elongases were amplified
with PCR using following primer pairs and PCR conditions.
[0093] PCR reaction (50 .mu.L):
[0094] 5.00 .mu.L Template cDNA
[0095] 5.00 .mu.L 10.times. Puffer (Advantage-Polymerase)+25 mM
MgCl.sub.2
[0096] 5.00 .mu.L 2 mM dNTP
[0097] 1.25 .mu.L je Primer (10 pmol/.mu.L)
[0098] 0.50 .mu.L Advantage-Polymerase
[0099] The Advantage polymerase mix from Clontech was used.
[0100] Reaction conditions of the PCR:
[0101] Annealing: 1 min 55.degree. C.
[0102] Denaturation: 1 min 94.degree. C.
[0103] Elongation: 2 min 72.degree. C.
[0104] Cycles: 35
[0105] Primer pairs used in PCR:
TABLE-US-00002 Name Primer pair (5' orientation) SEQ ID NO. Eh4ff
CCATGGGAGGCGCCGGCGCGAG 11 Eh4rv CTAGTCCGCCTTGAGGTTCTC 12 Eh5ff
ACCATGTGCAAGGCGAGCGGCCT 13 Eh5rv TCACCAATCATGAGGAAGGT 14 Eh8ff
CCATGGGCAAGGGCGGCAACGC 15 Eh8rv GGGCAGAGATGCCGCACTAG 16 Eh9ff
ACCATGCTCGATCGCGCCTCGTC 17 Eh9rv TCACAGCGCCTTGCGGGTAGC 18
[0106] The PCR reactions resulted in following polynucleotide
sequences:
TABLE-US-00003 Gene Activity Length in bp SEQ ID NO. D4Des(Eh)
D4-desaturase 1280 5 D8Des(Eh) D8-desaturase 1256 1 D9Elo(Eh)
D9-elongase 804 3 D5Elo(Eh) Multi-elongase 921 7
[0107] A list of identified full-length coding sequences is shown
in Table 1.
TABLE-US-00004 TABLE 1 List of full-length coding sequences and
deduced amino acid sequences Coding sequence Amino acid SEQ ID NO:
Gene in bp sequence 1 D8Des(Eh) 1254 417 3 D9Elo(Eh) 801 266 5
D4Des(Eh) 1278 425 7 D5Elo(Eh) 918 305
[0108] Open reading frames as shown in Table 1 were cloned into the
pESC(Leu) vector from Stratagene according to manufactures reaction
conditions. Reactions were transformed into E. coli DH5.alpha. and
plasmid DNA was isolated. The plasmids pESC-d4Des(Eh),
pESC-d8Des(Eh), pESC-d9Elo(Eh), pESC-d5Elo(Eh) were then used for
yeast transformation.
Example 3: Yeast Transformation and Growth Conditions
[0109] S. cerevisiae strain INVSC from Invitrogen was transformed
with the constructs pESC-d4Des(Eh), pESC-d8Des(Eh), pESC-d9Elo(Eh),
pESC-d5Elo(Eh) and pESC using the S. C. EasyComp Transformation Kit
(Invitrogen, Carlsbad, Calif.) with selection on leucine-deficient
medium.
[0110] Yeast were grown after transformation in complete medium
containing all amino acids and nucleotides. Then yeast were plated
on different medium containing either the complete medium (SD) or
the complete medium lacking leucine (SD-Leu). Only yeast containing
pESC-d4Des(Eh), pESC-d8Des(Eh), pESC-d9Elo(Eh), pESC-d5Elo(Eh) or
pESC vector can grow on this medium.
Example 4: Functional Expression of Desaturases and Elongases in
Yeast and Gas Chromatographic Analysis
[0111] Yeast cells containing the respective pESC plasmids as
prepared above were incubated 12 h in liquid DOB-U medium at
28.degree. C., 200 rpm inkubiert and than additional 12 h in
induction medium (DOB-U+2% (w/v) galactose+2% (w/v) raffinose). To
the induction medium 250 .mu.M of the respective fatty acids were
added to check for enzyme activity and specificity.
[0112] Yeast cells were analyzed as following:
[0113] Yeast cells from induction medium were harvested by
centrifugation (100.times.g, 5 min, 20.degree. C.) and washed with
100 mM NaHCO.sub.3, pH 8,0, to remove residual fatty acids. From
the yeast pellet a total extract of fatty acid methylesters (FAME)
was generated by adding 2 ml 1 N methanolic sulfuric acid and 2%
(v/v) Dimethoxypropan for 1 h at 80.degree. C. FAME were extracted
two times with Petrolether (PE). Not derivased fatty acids were
removed by washing with 2 ml 100 mM NaHCO.sub.3, pH 8,0 and 2 ml
Aqua dent. The PE-phases were dried with Na.sub.2SO.sub.4 and
eluted in 100 .mu.l PE. The samples were then separated with a
DB-23-column (30 m, 0.25 mm, 0,25 .mu.m, Agilent) in a
Hewlett-Packard 6850-machine with FID using following conditions:
oven temperature 50.degree. C. to 250.degree. C. with a rate of
5.degree. C./min and finally 10 min at 250.degree. C.
[0114] The identification of the fatty acids was done using the
retention times of known fatty acid standards (Sigma). The method
is described e.g. in Napier and Michaelson, 2001, Lipids.
36(8):761-766; Sayanova et al., 2001, Journal of Experimental
Botany. 52(360):1581-1585, Sperling et al., 2001, Arch. Biochem.
Biophys. 388(2):293-298 and Michaelson et al., 1998, FEBS Letters.
439(3):215-218.
Example 5: Functional Characterization of d4Des(Eh)
[0115] As described above d4Des(Eh) was functionally characterized
in yeast. The result of the analysis is shown in FIG. 2. Yeast
transformed with pESC-d4Des(Eh) was compared to yeast transformed
with pESC (control) while feeding the yeast cells with the fatty
acid DPA 22:5n-3. Based on this comparison pESC-d4Des(Eh) exhibits
d4-desaturase activity as in the control no 22:6 is observed.
Therefore d4Des(Eh) is a functional d4-desaturase.
Example 6: Functional Characterization of d8Des(Eh)
[0116] As described above d8Des(Eh) was functionally characterized
in yeast. The result of the analysis is shown in FIG. 3. Yeast
transformed with pESC-d8Des(Eh) was compared to yeast transformed
with pESC (control) while feeding the fatty acid 20:3n-3. Based on
this comparison a new fatty acid was formed compared to the
control, which is 20:4n-3. The formation of this fatty acid proves
that d8Des(Eh) was functionally expressed and has d8-desaturase
activity. The conversion rate of 20:3n-3 to 20:4n-3 was 5%.
Example 7: Functional Characterization of d9Elo(Eh)
[0117] As described above d9Elo(Eh) was functionally characterized
in yeast. The result of the analysis is shown in FIG. 4. Yeast
transformed with pESC-d9Elo(Eh) was compared to yeast transformed
with pESC (control) while feeding the fatty acids 18:3n-3 (ALA) or
18:2 (LA). Based on this comparison a new fatty acid was formed
compared to the control, which is 20:3n-3 or 20:2n-6, respectively.
The formation of these fatty acids proves that d9Elo(Eh) was
functionally expressed and has d9-elongase activity. The conversion
rate of 18:3n-3 to 20:3n-3 was 17%, the conversion rate of 18:2n-6
to 20:2n-6 was 49%.
Example 8: Functional Characterization of d5Elo(Eh)
[0118] As described above d5Elo(Eh) was functionally characterized
in yeast. The result of the analysis is shown in FIGS. 5 and 6.
Yeast transformed with pESC-d5Elo(Eh) was compared to yeast
transformed with pESC (control) while feeding the fatty acids
18:3n-6 (GLA), 18:4 (SDA) or 20:4n-6 (ARA), 20:5n-3 (EPA),
respectively. Based on this comparison new fatty acids formation
was observed when compared to the control, which is 20:3n-6 or
20:4n-3 when fed GLA or SDA and 22:4n-6 or 22:5n-3 when fed ARA or
EPA, respectively. The formation of these fatty acids proves that
d5Elo(Eh) was functionally expressed and has d5-elongase activity.
The conversion rate of GLA was 13%, the conversion rate of 18:4n-3
was 30%, the conversion rate of ARA was 38% and the conversion rate
of EPA was 30%. Surprisingly the elongase used a wide variety of
substrates of elongation. The specification indicates a
multifunctional elongase activity with higher specificities for
omega3 fatty acids.
Example 9: Expression of Novel Elongases from Emiliana huxleyi in
Plants
[0119] The novel desaturases and elongases were cloned into a plant
transformation vector as described in WO2003/093482, WO2005/083093
or WO2007/093776. Exemplary suitable combinations of genes are
described in Table 2, 3 and 4.
TABLE-US-00005 TABLE 2 Gene combinations for the production of ARA.
Gene Activity SEQ ID NO: D6Des(Ot) .DELTA.6-Desaturase 19 D6Elo(Pp)
.DELTA.6-Elongase 21 D5Des(Eh) .DELTA.5-Desaturase 9 D12Des(Ps)
.DELTA.12-Desaturase 23 D6Elo(Tp) .DELTA.6-Elongase 25 D8Des(Eh)
.DELTA.8-Desaturase 1 D9Elo(Eh) .DELTA.9-Elongase 3
TABLE-US-00006 TABLE 3 Gene combinations for the production of EPA.
Gene Activity SEQ ID NO: D6Des(Ot) .DELTA.6-Desaturase 19 D5Elo(Eh)
.DELTA.5-Elongase 7 D5Des(Eh) .DELTA.5-Desaturase 9 D12Des(Ps)
.DELTA.12-Desaturase 23 D6Elo(Tp) .DELTA.6-Elongase 25 o3-Des(Pi)
Omega 3-Desaturase 27 D15Des(Cp) .DELTA.15-Desaturase 29 D8Des(Eh)
.DELTA.8-Desaturase 1 D9Elo(Eh) .DELTA.9-Elongase 3
TABLE-US-00007 TABLE 4 Gene combinations for the production of DHA.
Gene Activity SEQ ID NO: D6Des(Ot) .DELTA.6-Desaturase 19 D5Elo(Eh)
.DELTA.5-Elongase 7 D5Des(Eh) .DELTA.5-Desaturase 9 D12Des(Ps)
.DELTA.12-Desaturase 23 D6Elo(Tp) .DELTA.6-Elongase 25
.omega.3-Des(Pi) Omega 3-Desaturase 27 D15Des(Cp)
.DELTA.15-Desaturase 29 D5Elo(Ot) .DELTA.5-elongase 31 D4Des(Eh)
.DELTA.4-desaturase 5 D8Des(Eh) .DELTA.8-Desaturase 1 D9Elo(Eh)
.DELTA.9-Elongase 3
[0120] Based on the gene combinations as described in Table 2,
Table 3 or Table 4 following combinations were designed: [0121]
AP2:
LuCnI-d5Des(Eh)_LuCnI-d8Des8Eh)_Napin-o3Des(Pi)_Napin-d12Des(Ps)_LuCnI-d9-
Elo(Eh) [0122] OstELO5EmD4:
VfUSP-d6Elo(Pp)_LuCnI-d5Des8Tc)_VfSBP-d6Des(Ot)_Napin-o3Des(Pi)_Napin-d12-
Des(Ps)_LuCnI-d5Elo(Ot)_LuCnI-d4Des(Eh) [0123] OstELO5TcD4:
VfUSP-d6Elo(Pp)_LuCnI-d5Des8Tc)_VfSBP-d6Des(Ot)_Napin-o3Des(Pi)_Napin-d12-
Des(Ps)_LuCnI-d5Elo(Ot)_LuCnI-d4Des(Tc)
[0124] Transgenic rapeseed lines were generated as described in
Deblaere et al, 1984, Nucl. Acids. Res. 13, 4777-4788 and seeds of
transgenic rapeseed plants are analyzed as described in Qiu et al.
2001, J. Biol. Chem. 276, 31561-31566.
[0125] Transgenic Arabidopsis plants were generated as described in
Bechtholdt et al. 1993 C. R. Acad. Sci. Ser. III Sci. Vie., 316,
1194-1199. Seeds of transgenic Arabidopsis plants expressing
d9Elo(Eh) by using the seed-specific promoter Glycinin from soybean
(Lelievre et al. (1992) Plant Physiol 98:387-391) were analyzed by
gas chromatography (FIG. 7). Compared to non-transgenic control
plants (WT) there are changes in the fatty acid profile, proving
that d9Elo(Eh) was functionally expression in seeds. The major
shifts in the fatty acid profile is directed to a 10fold increase
in the fatty acid 20:2n-6 and 20:3n-3 (FIG. 7). Therefore d9Elo(Eh)
exhibits a .DELTA.9-elongase activity, which is consistent with the
yeast characterization. Further, the levels of 18:2 and ALA in the
transgenic events expressing d9Elo(Eh) are lowered compared to WT,
as these fatty acids are direct substrates for the d9Elo(Eh).
Further, the endogenous elongation system in the plant is unchanged
as levels of 20:1 and 22:1 are similar between transgenic plants
expression d9Elo(Eh) and WT control. This indicates that the
expression of d9Elo(Eh) does not disturb endogenous elongation
process, but delivers additional activity.
[0126] To further prove the activity of d9Elo(Eh) expressed in
seeds of Arabidopsis thaliana AcylCoA-measurements were done.
Substrates and products of the d9Elo(Eh) elongation reaction are
AcylCoA-esters, which are then further incorporated into
triacylglycerides (oil). The analysis of the acylCoA-pool reveals
the formation and flux of the elongation reaction.
[0127] FIG. 8 summarizes the AcylCoA measurements for Arabidopsis
event expressing d9Elo(Eh) in comparison to controls not expressing
d9Elo(Eh) (Col0). The change in the chromatogram is indicated by a
star. At this position a massive amount of 20:2n-6 is detected,
which is much lower in the control. The conditions for separation
of the fatty acid CoA-esters does not allow the detection of
20:3n-3 as this CoA ester is not separated from 18:3CoA.
[0128] The massive occurrence of 20:2n-6-CoA proves the expression
of d9Elo(Eh) as this is the direct product of its enzymatic
activity.
[0129] Further, transgenic Arabidopsis lines have been generated to
validate the activity of d8Des(Eh) and d5Des(Eh). Vector AP2 has
been constructed according to standard molecular biology steps as
described in WO2003/093482, WO2005/083093, WO2007/093776 or
WO2009/016202 and transformed into Arabidopsis thaliana as
described above. Analysis of transgenic seeds is shown in FIG. 9.
The products of d9Elo(Eh) are 20:2 and 20:3n-3.
[0130] Further, transgenic Arabidopsis lines have been generated to
validate the activity of d4Des(Eh). Construct OstELO5EmD4 was
transformed into Arabidopsis as described above and seeds of a
number of individual lines have been analyzed by gas chromatography
(FIG. 10). The activity of d4Des(Eh) is demonstrated by the
formation of DHA 22:6 (last column). All lines show the production
of DHA with levels of up to 4.7%. Of special interest is the ratio
of DHA to DPA. Surprisingly the ratio of d4Des(Eh) is much higher
than in d4-desaturases known in the art. A comparison against the
d4-desaturase from Thraustochytrium ssp. of WO2002/026946 is shown
in FIG. 11. The enzyme from Thraustochytrium ssp. showed so far
highest levels of DHA (WO2005/083093), but with an unfavorable
ratio of DPA to DHA. A high ratio of DHA:DPA is for the commercial
use of such oils of importance.
[0131] Further, transgenic Arabidopsis lines have been generated to
validate the activity of d5Elo(Eh). Construct EmELO5TcD4 was
transformed into Arabidopsis as described above and seeds of a
number of individual lines have been analyzed by gas chromatography
(FIG. 12). The activity of d5Elo(Eh) is demonstrated by the
formation of DPA 22:5 and DHA 22:6. Most lines show the production
of these two fatty acids, proofing that d5Elo(Em) is functionally
expressed in the seeds.
[0132] Further, transgenic Arabidopsis lines have been generated to
validate the activity and substrate specificity of d5Des(Eh). For
this purpose two .DELTA.6-desaturases were selected based on their
different substrate specificity. The borage.DELTA.6 is expected to
use phosphatidylcholin-18:2 as substrate (WO96/21022), whereas the
Ostreococcus .DELTA.6 (Ostr.DELTA.6) uses Acyl-CoA ester
(WO2005/012316). In combination with the d6-elongase from
Physcomitrella patens (WO2001/059128) both d6-desaturases produce
DGLA or 20:4n-3, respectively. The ratio of ARA to EPA is for the
borage.DELTA.6 2.9, for the Ostr.DELTA.6 2.3. It is noted that the
use of Ostr.DELTA.6 results in 3-4 times higher levels of products
compared to the borage.DELTA.6. The further combination of the
d5Des(Eh) resulted in the production of ARA and EPA, demonstrating
the functionality of the d5Des(Eh). The conversion of d5Des(Eh) of
DGLA to ARA is 29% (borage.DELTA.6) or 47% (Ostr.DELTA.6). For
20:4n-3 to EPA it is 33% (borage.DELTA.6) or 26%
(Ostr.DELTA.6).
[0133] Based on these results it is concluded that for Acyl-CoA
substrates d5Des(Eh) is specific for the omega6 fatty acid DGLA.
This is a novel substrate specificity not observed in the state of
the art d5-desaturases.
REFERENCE LIST
[0134] Arondel, V., Lemieux, B., Hwang, I., Gibson, S., Goodman, H.
M., and Somerville, C. R. (1992). Map-based cloning of a gene
controlling omega-3 fatty acid desaturation in Arabidopsis. Science
258, 1353-1355. [0135] Broadwater, J. A., Whittle, E., and
Shanklin, J. (2002). Desaturation and hydroxylation. Residues 148
and 324 of Arabidopsis FAD2, in addition to substrate chain length,
exert a major influence in partitioning of catalytic specificity.
J. Biol. Chem. 277, 15613-15620. [0136] Broun, P., Shanklin, J.,
Whittle, E., and Somerville, C. (1998b). Catalytic plasticity of
fatty acid modification enzymes underlying chemical diversity of
plant lipids. Science 282, 1315-1317. [0137] Calvo, A. M., Gardner,
H. W., and Keller, N. P. (2001). Genetic connection between fatty
acid metabolism and sporulation in Aspergillus nidulans. J. Biol.
Chem. 276, 25766-25774. [0138] Knutzon, D. S., Thurmond, J. M.,
Huang, Y. S., Chaudhary, S., Bobik, E. G., Jr., Chan, G. M.,
Kirchner, S. J., and Mukerji, P. (1998). Identification of
Delta5-dehydratase from Mortierella alpina by heterologous
expression in Bakers' yeast and canola. J. Biol. Chem. 273,
29360-29366. [0139] Mantle, P. G. and Nisbet, L. J. (1976).
Differentiation of Claviceps purpurea in axenic culture. J. Gen.
Microbiol. 93, 321-334. [0140] Mey, G., Oeser, B., Lebrun, M. H.,
and Tudzynski, P. (2002). The biotrophic, non-appressorium-forming
grass pathogen Claviceps purpurea needs a Fus3/Pmk1 homologous
mitogen-activated protein kinase for colonization of rye ovarian
tissue. Mol. Plant Microbe Interact. 15, 303-312. [0141] Okuley,
J., Lightner, J., Feldmann, K., Yadav, N., Lark, E., and Browse, J.
(1994). Arabidopsis FAD2 gene encodes the enzyme that is essential
for polyunsaturated lipid synthesis. Plant Cell 6, 147-158. [0142]
Qi, B., Fraser, T., Mugford, S., Dobson, G., Sayanova, O., Butler,
J., Napier, J. A., Stobart, A. K., and Lazarus, C. M. (2004).
Production of very long chain polyunsaturated omega-3 and omega-6
fatty acids in plants. Nat. Biotechnol. 22, 739-745. [0143] Qiu,
X., Hong, H., and McKenzie, SL. (2001) Identification of a Delta 4
fatty acid desaturase from Thraustochytrium sp. involved in the
biosynthesis of docosahexanoic acid by heterologous expression in
Saccharomyces cerevisiae and Brassica juncea. J Biol Chem 276,
31561-6. [0144] Shanklin, J. and Cahoon, E. B. (1998). DESATURATION
AND RELATED MODIFICATIONS OF FATTY ACIDS1. Annu. Rev. Plant Physiol
Plant Mol. Biol. 49, 611-641. [0145] Tudzynski, P., Correia, T.,
and Keller, U. (2001). Biotechnology and genetics of ergot
alkaloids. Appl. Microbiol. Biotechnol. 57, 593-605.
[0146] All references cited in this specification are herewith
incorporated by reference with respect to their entire disclosure
content and the disclosure content specifically mentioned in this
specification.
Sequence CWU 1
1
3211256DNAEmiliana huxleyi 1ccatgggcaa gggcggcaac gcgaacccgc
gggagctcaa aggcggcaag gccgagcagc 60tgacagtcta cctgtatggc aaggctgtcg
acgtctcgaa gttcgcgaag ctgcacccgg 120gaggcgccaa ggcgctgcgc
atcttcaaca accgcgacgc caccgagcag ttcgagatgt 180accactcgcc
cgccgcccac aagatgatgc gtgcgatgtc gaagagcgcg ccggaggccc
240cgagggagag cgaggtcgcg acgtcggtcg ttgggacgga cttcgccaag
ctgacgcaga 300cgctgcacga cgtcggatgc ttcgacccgc actaccctga
cgaggccttc aagctcggcc 360tcacgctgct gcccggattc ctcggcttct
acctgctgcg gagcggcatg ccggcgctcg 420gatccttcct gatcgctttc
tcgtactaca tgtcggggtg gacctcccac gattacttgc 480accacggctg
cctcaagggc ggccaaaagc agctggtgca ctggaacaac gccgtcggct
540acgcaatcgg cgcttggcag ggctacgcgg tcggctggtg gcgagcgcgc
cacaacacgc 600accacctcgt cactaacgaa gaaggcaacg accccgacat
catgaccgcg cccgtgctca 660tcttcgtgcg caacagcccg gtgatcgccg
ctgccctcaa cgcggcgcag cggtggcagc 720agtactacta cgtgcccgcg
atgagcctca tggacatgta ctggcgcttc gagtcgatgc 780agtacctggc
cgcgcgaccc ttcaacaagg tgtgggcctc gtgggcgctc ctcgcgctgc
840actactcctt tgtcggctac atgttccacg gacagtacca gtggctgctg
ctgacgatgc 900tggtgcgcgg cttcctcacg ggcatcgtcg tcttctcgac
gcattatggc gaggaggtca 960tcccgggcga ccacggcatg acactcgtcg
agcagacggc gctcacctct cgcaacatca 1020ccggcgggta cctcgtcaac
ctgctcacgg gctacatctc gctgcagacg gagcaccacc 1080tctggccgat
gatgcccacc gcgcgcctcg aggcggcgca gccctacgcg cgcgccttct
1140tcaagaagca cggcttcgtc taccgcgagt cgaacctcgt cgagtgcgtc
aagtacaaca 1200tcgccgccct cgacatccgc acgcgcaacg gcgagtgggc
agagatgccg cactag 12562417PRTEmiliana huxleyi 2Met Gly Lys Gly Gly
Asn Ala Asn Pro Arg Glu Leu Lys Gly Gly Lys1 5 10 15Ala Glu Gln Leu
Thr Val Tyr Leu Tyr Gly Lys Ala Val Asp Val Ser 20 25 30Lys Phe Ala
Lys Leu His Pro Gly Gly Ala Lys Ala Leu Arg Ile Phe 35 40 45Asn Asn
Arg Asp Ala Thr Glu Gln Phe Glu Met Tyr His Ser Pro Ala 50 55 60Ala
His Lys Met Met Arg Ala Met Ser Lys Ser Ala Pro Glu Ala Pro65 70 75
80Arg Glu Ser Glu Val Ala Thr Ser Val Val Gly Thr Asp Phe Ala Lys
85 90 95Leu Thr Gln Thr Leu His Asp Val Gly Cys Phe Asp Pro His Tyr
Pro 100 105 110Asp Glu Ala Phe Lys Leu Gly Leu Thr Leu Leu Pro Gly
Phe Leu Gly 115 120 125Phe Tyr Leu Leu Arg Ser Gly Met Pro Ala Leu
Gly Ser Phe Leu Ile 130 135 140Ala Phe Ser Tyr Tyr Met Ser Gly Trp
Thr Ser His Asp Tyr Leu His145 150 155 160His Gly Cys Leu Lys Gly
Gly Gln Lys Gln Leu Val His Trp Asn Asn 165 170 175Ala Val Gly Tyr
Ala Ile Gly Ala Trp Gln Gly Tyr Ala Val Gly Trp 180 185 190Trp Arg
Ala Arg His Asn Thr His His Leu Val Thr Asn Glu Glu Gly 195 200
205Asn Asp Pro Asp Ile Met Thr Ala Pro Val Leu Ile Phe Val Arg Asn
210 215 220Ser Pro Val Ile Ala Ala Ala Leu Asn Ala Ala Gln Arg Trp
Gln Gln225 230 235 240Tyr Tyr Tyr Val Pro Ala Met Ser Leu Met Asp
Met Tyr Trp Arg Phe 245 250 255Glu Ser Met Gln Tyr Leu Ala Ala Arg
Pro Phe Asn Lys Val Trp Ala 260 265 270Ser Trp Ala Leu Leu Ala Leu
His Tyr Ser Phe Val Gly Tyr Met Phe 275 280 285His Gly Gln Tyr Gln
Trp Leu Leu Leu Thr Met Leu Val Arg Gly Phe 290 295 300Leu Thr Gly
Ile Val Val Phe Ser Thr His Tyr Gly Glu Glu Val Ile305 310 315
320Pro Gly Asp His Gly Met Thr Leu Val Glu Gln Thr Ala Leu Thr Ser
325 330 335Arg Asn Ile Thr Gly Gly Tyr Leu Val Asn Leu Leu Thr Gly
Tyr Ile 340 345 350Ser Leu Gln Thr Glu His His Leu Trp Pro Met Met
Pro Thr Ala Arg 355 360 365Leu Glu Ala Ala Gln Pro Tyr Ala Arg Ala
Phe Phe Lys Lys His Gly 370 375 380Phe Val Tyr Arg Glu Ser Asn Leu
Val Glu Cys Val Lys Tyr Asn Ile385 390 395 400Ala Ala Leu Asp Ile
Arg Thr Arg Asn Gly Glu Trp Ala Glu Met Pro 405 410
415His3804DNAEmiliana huxleyi 3accatgctcg atcgcgcctc gtccgacgcg
gccatctggt ctgcggtgtc cgatccggaa 60atcctgatcg gcactttctc ctacctgctg
ctcaagccgc tgctacgcaa ctcagggctc 120gtggacgagc ggaaaggcgc
ctaccggacc tcgatgatct ggtacaacgt ggtgctcgcg 180ctcttctccg
cgacgagctt ctacgtgact gcgaccgcgc tcgggtggga caagggcacc
240ggcgagtggc tccgcagtct cacgggcgac agcccgcagc agctgtggca
atgcccgtcg 300agggtatggg actccaagct gttcctgtgg acggccaagg
ccttctacta ctcaaagtac 360gtggagtacc tcgacacggc gtggctcgtc
ctcaagggga agaaggtctc cttcctgcag 420ggcttccacc actttggcgc
gccgtgggac gtgtacctgg gcattcggct gaagaacgag 480ggcgtgtgga
tcttcatgtt cttcaactcg ttcatccaca cggtcatgta cacgtactac
540ggcctcaccg ccgcgggcta caagatccgc ggcaagccga tcatcaccgc
gatgcaaata 600agccagttcg tcggcggctt tgtcctagtg tgggactaca
tcaacgtgcc gtgcttccac 660gccgacgccg ggcaggtctt cagctgggtc
tttaactatg cttacgtcgg ctccgtcttt 720ctgctctttt gccacttctt
ctacatggac aacatcgcga aggccaaggc caagaaggcc 780gtcgctaccc
gcaaggcgct gtga 8044266PRTEmiliana huxleyi 4Met Leu Asp Arg Ala Ser
Ser Asp Ala Ala Ile Trp Ser Ala Val Ser1 5 10 15Asp Pro Glu Ile Leu
Ile Gly Thr Phe Ser Tyr Leu Leu Leu Lys Pro 20 25 30Leu Leu Arg Asn
Ser Gly Leu Val Asp Glu Arg Lys Gly Ala Tyr Arg 35 40 45Thr Ser Met
Ile Trp Tyr Asn Val Val Leu Ala Leu Phe Ser Ala Thr 50 55 60Ser Phe
Tyr Val Thr Ala Thr Ala Leu Gly Trp Asp Lys Gly Thr Gly65 70 75
80Glu Trp Leu Arg Ser Leu Thr Gly Asp Ser Pro Gln Gln Leu Trp Gln
85 90 95Cys Pro Ser Arg Val Trp Asp Ser Lys Leu Phe Leu Trp Thr Ala
Lys 100 105 110Ala Phe Tyr Tyr Ser Lys Tyr Val Glu Tyr Leu Asp Thr
Ala Trp Leu 115 120 125Val Leu Lys Gly Lys Lys Val Ser Phe Leu Gln
Gly Phe His His Phe 130 135 140Gly Ala Pro Trp Asp Val Tyr Leu Gly
Ile Arg Leu Lys Asn Glu Gly145 150 155 160Val Trp Ile Phe Met Phe
Phe Asn Ser Phe Ile His Thr Val Met Tyr 165 170 175Thr Tyr Tyr Gly
Leu Thr Ala Ala Gly Tyr Lys Ile Arg Gly Lys Pro 180 185 190Ile Ile
Thr Ala Met Gln Ile Ser Gln Phe Val Gly Gly Phe Val Leu 195 200
205Val Trp Asp Tyr Ile Asn Val Pro Cys Phe His Ala Asp Ala Gly Gln
210 215 220Val Phe Ser Trp Val Phe Asn Tyr Ala Tyr Val Gly Ser Val
Phe Leu225 230 235 240Leu Phe Cys His Phe Phe Tyr Met Asp Asn Ile
Ala Lys Ala Lys Ala 245 250 255Lys Lys Ala Val Ala Thr Arg Lys Ala
Leu 260 26551280DNAEmiliana huxleyi 5ccatgggagg cgccggcgcg
agcgaggctg aacggcccaa gtggaccacg atccacgggc 60ggcacgtcga tgtgtcaaag
ttccgccacc cgggtgggaa catcatcgag ctcttctatg 120gcatggactc
gacgagcgcg ttcgagcagt tccacggcca ccacaagggc gcgtggaaga
180tgctcaaggc gctgccgacc aaggaggtcg accccgccga cgtgccgcag
cagccgcagg 240agcacgttgc cgagatgacg cggctgatga cgtcgtggcg
cgagcgcggc ctctttaagc 300cgcgccccgt cgcctcgggc atctacggtc
tcgccgtcgt cgctgccatc gtcgcgtgca 360tcgcctgcgc gccgcacgcg
ccggtgctga gcgggatcgg gctcggcagc tgctgggcgc 420agtgcggctt
cctgcagcac atgggcgggc accgcgagtg gggggtgcgg tactccttcc
480tcctgcagca cttcttcgag ggcctcctca agggcgggtc cgcctcgtgg
tggcgcaacc 540gccacaacaa gcatcacgca aagactaacg tgctcggcga
ggacggcgac ctgcggacga 600ctcccttctt cgcctgggac ccgacgctcg
ccaagaaggt tccagactgg tcgctcaaga 660cgcaggcctt caccttcctc
cccgccctcg gagcgtacgt ctttgtcttt gccttcacga 720tccgcaagta
tgccgtcgtc aagaagctct ggcacgagct cgcactcatg atcgcgcact
780acgcgatgtt ctactacgcg ctgcagctcg ccggtgcgtc gctcggcagc
ggcctcgcct 840tttactgcac cggctacgcc tggcaaggca tctacctcgg
cttcttcttc ggcctgtccc 900acttcgcggt cgagcgagtc ccctccaccg
ccacctggct cgagtcgtcc atgatcggca 960ccgtcgactg gggaggctcc
tccgcctttt gcggctacgt ctccggcttc ctcaacatcc 1020agatcgagca
ccacatggcg ccgcagatgc cgatggagaa cctgcgccag atccgcgccg
1080actgcaaggc gagcgcggag aagctcgggc ttccctatcg cgagctctcc
ttcgccggcg 1140cggtcaagct gatgatggtc ggcctctggc gcacggggag
ggacgagctg cagctgcgct 1200ccgacaggcg caagtactcg cgcacccagg
cctacatggc ggccgcctcg gcggtggtgg 1260agaacctcaa ggcggactag
12806425PRTEmiliana huxleyi 6Met Gly Gly Ala Gly Ala Ser Glu Ala
Glu Arg Pro Lys Trp Thr Thr1 5 10 15Ile His Gly Arg His Val Asp Val
Ser Lys Phe Arg His Pro Gly Gly 20 25 30Asn Ile Ile Glu Leu Phe Tyr
Gly Met Asp Ser Thr Ser Ala Phe Glu 35 40 45Gln Phe His Gly His His
Lys Gly Ala Trp Lys Met Leu Lys Ala Leu 50 55 60Pro Thr Lys Glu Val
Asp Pro Ala Asp Val Pro Gln Gln Pro Gln Glu65 70 75 80His Val Ala
Glu Met Thr Arg Leu Met Thr Ser Trp Arg Glu Arg Gly 85 90 95Leu Phe
Lys Pro Arg Pro Val Ala Ser Gly Ile Tyr Gly Leu Ala Val 100 105
110Val Ala Ala Ile Val Ala Cys Ile Ala Cys Ala Pro His Ala Pro Val
115 120 125Leu Ser Gly Ile Gly Leu Gly Ser Cys Trp Ala Gln Cys Gly
Phe Leu 130 135 140Gln His Met Gly Gly His Arg Glu Trp Gly Val Arg
Tyr Ser Phe Leu145 150 155 160Leu Gln His Phe Phe Glu Gly Leu Leu
Lys Gly Gly Ser Ala Ser Trp 165 170 175Trp Arg Asn Arg His Asn Lys
His His Ala Lys Thr Asn Val Leu Gly 180 185 190Glu Asp Gly Asp Leu
Arg Thr Thr Pro Phe Phe Ala Trp Asp Pro Thr 195 200 205Leu Ala Lys
Lys Val Pro Asp Trp Ser Leu Lys Thr Gln Ala Phe Thr 210 215 220Phe
Leu Pro Ala Leu Gly Ala Tyr Val Phe Val Phe Ala Phe Thr Ile225 230
235 240Arg Lys Tyr Ala Val Val Lys Lys Leu Trp His Glu Leu Ala Leu
Met 245 250 255Ile Ala His Tyr Ala Met Phe Tyr Tyr Ala Leu Gln Leu
Ala Gly Ala 260 265 270Ser Leu Gly Ser Gly Leu Ala Phe Tyr Cys Thr
Gly Tyr Ala Trp Gln 275 280 285Gly Ile Tyr Leu Gly Phe Phe Phe Gly
Leu Ser His Phe Ala Val Glu 290 295 300Arg Val Pro Ser Thr Ala Thr
Trp Leu Glu Ser Ser Met Ile Gly Thr305 310 315 320Val Asp Trp Gly
Gly Ser Ser Ala Phe Cys Gly Tyr Val Ser Gly Phe 325 330 335Leu Asn
Ile Gln Ile Glu His His Met Ala Pro Gln Met Pro Met Glu 340 345
350Asn Leu Arg Gln Ile Arg Ala Asp Cys Lys Ala Ser Ala Glu Lys Leu
355 360 365Gly Leu Pro Tyr Arg Glu Leu Ser Phe Ala Gly Ala Val Lys
Leu Met 370 375 380Met Val Gly Leu Trp Arg Thr Gly Arg Asp Glu Leu
Gln Leu Arg Ser385 390 395 400Asp Arg Arg Lys Tyr Ser Arg Thr Gln
Ala Tyr Met Ala Ala Ala Ser 405 410 415Ala Val Val Glu Asn Leu Lys
Ala Asp 420 4257921DNAEmiliana huxleyi 7accatgtgta aggcttctgg
tcttgcttca ggtgctaaac ctgctgctgc ttcaactatt 60gatcagtctg ctggacttgg
aagagttgct gttattgttg gatctttcac tgctgctatg 120tgttatgctc
ttcaacctct tgattcacct ggtactatct atcatgattc agctgttatg
180ggtgctcttt tgtcttggcc aatggtttac attgctcctc ttgcttacgt
ttgtgctgtt 240atggctggat gtagacttat gtcacaaaga gcttctatta
agccattttt gaaacaatac 300gttcagcctg tttacaatgt tttccaaatt
gttatgtgtt cttacatggt ttggggtttg 360gctcctaaag ttgatgttct
tggacttaac cctttcgcta tgaatacaga aagagataaa 420aagactgagt
ggtttatgtt cgttcattac ctttctaaat tcgttgattg gacagatact
480ttcttgatga ttggatctaa atcttttaga caggtttcat tcttgcaagt
ttttcatcat 540gctacagttg gtatgatttg gggtgctttg ttgagaaagg
gatggggtgg aggtacttgt 600gtttggggag cttttattaa ctctgttaca
catgttctta tgtatacaca ttacttggtt 660acatctcttg gtcttcataa
ccctcttaag tctcaactta ctaattttca acttgctcaa 720ttcgcttcat
gtgttttgca tgctgctttg gtttttgctt cagagacagt tcttcctgct
780agacttgctt atattcaatt ggtttaccat cctactcttt tgtttctttt
cggttttcag 840atgaagtggg ttccttcttg gatcactgga caaacaatca
ctggtagaga gtcagaggct 900cctgaaaaga aagttgcttg a 9218305PRTEmiliana
huxleyi 8Met Cys Lys Ala Ser Gly Leu Ala Ser Gly Ala Lys Pro Ala
Ala Ala1 5 10 15Ser Thr Ile Asp Gln Ser Ala Gly Leu Gly Arg Val Ala
Val Ile Val 20 25 30Gly Ser Phe Thr Ala Ala Met Cys Tyr Ala Leu Gln
Pro Leu Asp Ser 35 40 45Pro Gly Thr Ile Tyr His Asp Ser Ala Val Met
Gly Ala Leu Leu Ser 50 55 60Trp Pro Met Val Tyr Ile Ala Pro Leu Ala
Tyr Val Cys Ala Val Met65 70 75 80Ala Gly Cys Arg Leu Met Ser Gln
Arg Ala Ser Ile Lys Pro Phe Leu 85 90 95Lys Gln Tyr Val Gln Pro Val
Tyr Asn Val Phe Gln Ile Val Met Cys 100 105 110Ser Tyr Met Val Trp
Gly Leu Ala Pro Lys Val Asp Val Leu Gly Leu 115 120 125Asn Pro Phe
Ala Met Asn Thr Glu Arg Asp Lys Lys Thr Glu Trp Phe 130 135 140Met
Phe Val His Tyr Leu Ser Lys Phe Val Asp Trp Thr Asp Thr Phe145 150
155 160Leu Met Ile Gly Ser Lys Ser Phe Arg Gln Val Ser Phe Leu Gln
Val 165 170 175Phe His His Ala Thr Val Gly Met Ile Trp Gly Ala Leu
Leu Arg Lys 180 185 190Gly Trp Gly Gly Gly Thr Cys Val Trp Gly Ala
Phe Ile Asn Ser Val 195 200 205Thr His Val Leu Met Tyr Thr His Tyr
Leu Val Thr Ser Leu Gly Leu 210 215 220His Asn Pro Leu Lys Ser Gln
Leu Thr Asn Phe Gln Leu Ala Gln Phe225 230 235 240Ala Ser Cys Val
Leu His Ala Ala Leu Val Phe Ala Ser Glu Thr Val 245 250 255Leu Pro
Ala Arg Leu Ala Tyr Ile Gln Leu Val Tyr His Pro Thr Leu 260 265
270Leu Phe Leu Phe Gly Phe Gln Met Lys Trp Val Pro Ser Trp Ile Thr
275 280 285Gly Gln Thr Ile Thr Gly Arg Glu Ser Glu Ala Pro Glu Lys
Lys Val 290 295 300Ala30591368DNAEmiliana huxleyi 9atgtcattgg
ctgctaaaga tgcagcctcg gcccactcat ccgtcttgga ccctaagtat 60cacggagcta
caaataagtc aagaactgat gcagcagacc ttacagttag ttctatcgac
120acttctaagg agatgatcat aaggggtcgt gtgtatgatg tctctgattt
tattaaaagg 180cacccgggag gaagcattat taaactctcc ttaggttctg
atgcaacaga cgcttataac 240aacttccata ttaggtctaa aaaagcggat
aaaatgttga gagctttgcc aagtaggcca 300gtagcggatg gattcgctag
agacgctttg tctgcagact tcgaggccct gagagcccaa 360ctcgaggccg
aaggttactt cgaaccgaat ctgtggcatg tagcttatcg agttgcggaa
420gtcgttgcta tgtactgggc gggtattaga cttatctggg cgggttattg
gtttttagga 480gccattgtag caggaatagc tcaggggaga tgcggttggc
ttcagcatga gggtggtcat 540tattcgctca caggtaatat taaacttgat
cgacacatgc aaatgattat ctatggatta 600ggttgcggaa tgtccggttg
ttattggaga aaccaacata acaagcacca tgcgacaccg 660caaaagttgg
gtgcagatcc agaccttcaa acaatgcctc tggttgcgtt ccatggactc
720atcggtgcta aggctagggg agcaggaaag tcgtggctag catggcaagc
tccacttttc 780tttggaggcg ttatcacaac cctggtatct tttggttggc
agttcgtcca acatccaaag 840cacgcattga gagtaggaaa ccaactcgaa
ttaggctata tggctttacg atatgcttta 900tggtatgcag cattcggtca
tcttgggctt ggtggtgctt tcagattgta cgctttttat 960gtggcagtcg
gaggtacata tatcttcacg aactttgcgg tgtctcacac acataaggat
1020gttgttccac acgataagca tatttcttgg accttgtatt ctgcaaacca
taccactaat 1080caatctaaca cacctctagt caattggtgg atggcctatc
tgaattttca aattgaacat 1140caccttttcc ctagcatgcc acaatataac
catcctaaaa tctgcggaag agtgaaacaa 1200ttgtttgaaa aacatggcgt
agagtacgat gtcagaactt acgcgaagtc aatgcgtgat 1260acatacgtga
atctcttggc tgtgggaaat gcatctcatt cccttcatca gagaaacgag
1320ggattaacga ctagggagtc tgcggctgtt agagttacag gtcattga
136810455PRTEmiliana huxleyi 10Met Ser Leu Ala Ala Lys Asp Ala Ala
Ser Ala His Ser Ser Val Leu1 5 10 15Asp Pro Lys Tyr His Gly Ala Thr
Asn Lys Ser Arg Thr Asp Ala Ala 20 25 30Asp Leu Thr Val Ser Ser Ile
Asp Thr Ser Lys Glu Met Ile Ile Arg 35 40 45Gly Arg Val Tyr Asp Val
Ser Asp Phe Ile Lys Arg His Pro Gly Gly 50 55 60Ser Ile Ile Lys Leu
Ser Leu Gly Ser Asp Ala Thr Asp Ala Tyr Asn65 70 75 80Asn
Phe His Ile Arg Ser Lys Lys Ala Asp Lys Met Leu Arg Ala Leu 85 90
95Pro Ser Arg Pro Val Ala Asp Gly Phe Ala Arg Asp Ala Leu Ser Ala
100 105 110Asp Phe Glu Ala Leu Arg Ala Gln Leu Glu Ala Glu Gly Tyr
Phe Glu 115 120 125Pro Asn Leu Trp His Val Ala Tyr Arg Val Ala Glu
Val Val Ala Met 130 135 140Tyr Trp Ala Gly Ile Arg Leu Ile Trp Ala
Gly Tyr Trp Phe Leu Gly145 150 155 160Ala Ile Val Ala Gly Ile Ala
Gln Gly Arg Cys Gly Trp Leu Gln His 165 170 175Glu Gly Gly His Tyr
Ser Leu Thr Gly Asn Ile Lys Leu Asp Arg His 180 185 190Met Gln Met
Ile Ile Tyr Gly Leu Gly Cys Gly Met Ser Gly Cys Tyr 195 200 205Trp
Arg Asn Gln His Asn Lys His His Ala Thr Pro Gln Lys Leu Gly 210 215
220Ala Asp Pro Asp Leu Gln Thr Met Pro Leu Val Ala Phe His Gly
Leu225 230 235 240Ile Gly Ala Lys Ala Arg Gly Ala Gly Lys Ser Trp
Leu Ala Trp Gln 245 250 255Ala Pro Leu Phe Phe Gly Gly Val Ile Thr
Thr Leu Val Ser Phe Gly 260 265 270Trp Gln Phe Val Gln His Pro Lys
His Ala Leu Arg Val Gly Asn Gln 275 280 285Leu Glu Leu Gly Tyr Met
Ala Leu Arg Tyr Ala Leu Trp Tyr Ala Ala 290 295 300Phe Gly His Leu
Gly Leu Gly Gly Ala Phe Arg Leu Tyr Ala Phe Tyr305 310 315 320Val
Ala Val Gly Gly Thr Tyr Ile Phe Thr Asn Phe Ala Val Ser His 325 330
335Thr His Lys Asp Val Val Pro His Asp Lys His Ile Ser Trp Thr Leu
340 345 350Tyr Ser Ala Asn His Thr Thr Asn Gln Ser Asn Thr Pro Leu
Val Asn 355 360 365Trp Trp Met Ala Tyr Leu Asn Phe Gln Ile Glu His
His Leu Phe Pro 370 375 380Ser Met Pro Gln Tyr Asn His Pro Lys Ile
Cys Gly Arg Val Lys Gln385 390 395 400Leu Phe Glu Lys His Gly Val
Glu Tyr Asp Val Arg Thr Tyr Ala Lys 405 410 415Ser Met Arg Asp Thr
Tyr Val Asn Leu Leu Ala Val Gly Asn Ala Ser 420 425 430His Ser Leu
His Gln Arg Asn Glu Gly Leu Thr Thr Arg Glu Ser Ala 435 440 445Ala
Val Arg Val Thr Gly His 450 4551122DNAArtificial SequenceSynthetic
11ccatgggagg cgccggcgcg ag 221221DNAArtificial SequenceSynthetic
12ctagtccgcc ttgaggttct c 211323DNAArtificial SequenceSynthetic
13accatgtgca aggcgagcgg cct 231420DNAArtificial SequenceSynthetic
14tcaccaatca tgaggaaggt 201522DNAArtificial SequenceSynthetic
15ccatgggcaa gggcggcaac gc 221620DNAArtificial SequenceSynthetic
16gggcagagat gccgcactag 201723DNAArtificial SequenceSynthetic
17accatgctcg atcgcgcctc gtc 231821DNAArtificial SequenceSynthetic
18tcacagcgcc ttgcgggtag c 21191371DNAOstreococcus tauri
19atgtgtgttg agaccgagaa caacgatgga atccctactg tggagatcgc tttcgatgga
60gagagagaaa gagctgaggc taacgtgaag ttgtctgctg agaagatgga acctgctgct
120ttggctaaga ccttcgctag aagatacgtg gttatcgagg gagttgagta
cgatgtgacc 180gatttcaaac atcctggagg aaccgtgatt ttctacgctc
tctctaacac tggagctgat 240gctactgagg ctttcaagga gttccaccac
agatctagaa aggctaggaa ggctttggct 300gctttgcctt ctagacctgc
taagaccgct aaagtggatg atgctgagat gctccaggat 360ttcgctaagt
ggagaaagga gttggagagg gacggattct tcaagccttc tcctgctcat
420gttgcttaca gattcgctga gttggctgct atgtacgctt tgggaaccta
cttgatgtac 480gctagatacg ttgtgtcctc tgtgttggtt tacgcttgct
tcttcggagc tagatgtgga 540tgggttcaac atgagggagg acattcttct
ttgaccggaa acatctggtg ggataagaga 600atccaagctt tcactgctgg
attcggattg gctggatctg gagatatgtg gaactccatg 660cacaacaagc
accatgctac tcctcaaaaa gtgaggcacg atatggattt ggataccact
720cctgctgttg ctttcttcaa caccgctgtg gaggataata gacctagggg
attctctaag 780tactggctca gattgcaagc ttggaccttc attcctgtga
cttctggatt ggtgttgctc 840ttctggatgt tcttcctcca tccttctaag
gctttgaagg gaggaaagta cgaggagctt 900gtgtggatgt tggctgctca
tgtgattaga acctggacca ttaaggctgt tactggattc 960accgctatgc
aatcctacgg actcttcttg gctacttctt gggtttccgg atgctacttg
1020ttcgctcact tctctacttc tcacacccat ttggatgttg ttcctgctga
tgagcatttg 1080tcttgggtta ggtacgctgt ggatcacacc attgatatcg
atccttctca gggatgggtt 1140aactggttga tgggatactt gaactgccaa
gtgattcatc acctcttccc ttctatgcct 1200caattcagac aacctgaggt
gtccagaaga ttcgttgctt tcgctaagaa gtggaacctc 1260aactacaagg
tgatgactta tgctggagct tggaaggcta ctttgggaaa cctcgataat
1320gtgggaaagc actactacgt gcacggacaa cattctggaa agaccgcttg a
137120456PRTOstreococcus tauri 20Met Cys Val Glu Thr Glu Asn Asn
Asp Gly Ile Pro Thr Val Glu Ile1 5 10 15Ala Phe Asp Gly Glu Arg Glu
Arg Ala Glu Ala Asn Val Lys Leu Ser 20 25 30Ala Glu Lys Met Glu Pro
Ala Ala Leu Ala Lys Thr Phe Ala Arg Arg 35 40 45Tyr Val Val Ile Glu
Gly Val Glu Tyr Asp Val Thr Asp Phe Lys His 50 55 60Pro Gly Gly Thr
Val Ile Phe Tyr Ala Leu Ser Asn Thr Gly Ala Asp65 70 75 80Ala Thr
Glu Ala Phe Lys Glu Phe His His Arg Ser Arg Lys Ala Arg 85 90 95Lys
Ala Leu Ala Ala Leu Pro Ser Arg Pro Ala Lys Thr Ala Lys Val 100 105
110Asp Asp Ala Glu Met Leu Gln Asp Phe Ala Lys Trp Arg Lys Glu Leu
115 120 125Glu Arg Asp Gly Phe Phe Lys Pro Ser Pro Ala His Val Ala
Tyr Arg 130 135 140Phe Ala Glu Leu Ala Ala Met Tyr Ala Leu Gly Thr
Tyr Leu Met Tyr145 150 155 160Ala Arg Tyr Val Val Ser Ser Val Leu
Val Tyr Ala Cys Phe Phe Gly 165 170 175Ala Arg Cys Gly Trp Val Gln
His Glu Gly Gly His Ser Ser Leu Thr 180 185 190Gly Asn Ile Trp Trp
Asp Lys Arg Ile Gln Ala Phe Thr Ala Gly Phe 195 200 205Gly Leu Ala
Gly Ser Gly Asp Met Trp Asn Ser Met His Asn Lys His 210 215 220His
Ala Thr Pro Gln Lys Val Arg His Asp Met Asp Leu Asp Thr Thr225 230
235 240Pro Ala Val Ala Phe Phe Asn Thr Ala Val Glu Asp Asn Arg Pro
Arg 245 250 255Gly Phe Ser Lys Tyr Trp Leu Arg Leu Gln Ala Trp Thr
Phe Ile Pro 260 265 270Val Thr Ser Gly Leu Val Leu Leu Phe Trp Met
Phe Phe Leu His Pro 275 280 285Ser Lys Ala Leu Lys Gly Gly Lys Tyr
Glu Glu Leu Val Trp Met Leu 290 295 300Ala Ala His Val Ile Arg Thr
Trp Thr Ile Lys Ala Val Thr Gly Phe305 310 315 320Thr Ala Met Gln
Ser Tyr Gly Leu Phe Leu Ala Thr Ser Trp Val Ser 325 330 335Gly Cys
Tyr Leu Phe Ala His Phe Ser Thr Ser His Thr His Leu Asp 340 345
350Val Val Pro Ala Asp Glu His Leu Ser Trp Val Arg Tyr Ala Val Asp
355 360 365His Thr Ile Asp Ile Asp Pro Ser Gln Gly Trp Val Asn Trp
Leu Met 370 375 380Gly Tyr Leu Asn Cys Gln Val Ile His His Leu Phe
Pro Ser Met Pro385 390 395 400Gln Phe Arg Gln Pro Glu Val Ser Arg
Arg Phe Val Ala Phe Ala Lys 405 410 415Lys Trp Asn Leu Asn Tyr Lys
Val Met Thr Tyr Ala Gly Ala Trp Lys 420 425 430Ala Thr Leu Gly Asn
Leu Asp Asn Val Gly Lys His Tyr Tyr Val His 435 440 445Gly Gln His
Ser Gly Lys Thr Ala 450 45521873DNAPhyscomitrella patens
21atggaagttg ttgagaggtt ctacggagag ttggatggaa aggtttccca aggagtgaac
60gctttgttgg gatctttcgg agttgagttg actgataccc caactactaa gggattgcca
120ctcgttgatt ctccaactcc aattgtgttg ggagtgtctg tttacttgac
catcgtgatc 180ggaggattgc tttggatcaa ggctagagat ctcaagccaa
gagcttctga gccattcttg 240ttgcaagctt tggtgttggt gcacaacttg
ttctgcttcg ctttgtctct ttacatgtgc 300gtgggtatcg cttaccaagc
tatcacctgg agatattcct tgtggggaaa cgcttataac 360ccaaagcaca
aggagatggc tatcctcgtt tacctcttct acatgtccaa gtacgtggag
420ttcatggata ccgtgatcat gatcctcaag agatccacca gacagatttc
tttcctccac 480gtgtaccacc attcttctat ctcccttatc tggtgggcta
ttgctcatca tgctccagga 540ggagaggctt attggagtgc tgctctcaac
tctggagtgc atgtgttgat gtacgcttac 600tacttcttgg ctgcttgctt
gagatcttcc ccaaagctca agaacaagta cctcttctgg 660ggaagatacc
tcacccaatt ccagatgttc cagttcatgc tcaacttggt gcaagcttac
720tacgatatga aaaccaacgc tccatatcca caatggctca tcaagatcct
cttctactac 780atgatctccc tcttgttcct cttcggaaac ttctacgtgc
aaaagtacat caagccatcc 840gatggaaagc aaaagggagc taagaccgag tga
87322290PRTPhyscomitrella patens 22Met Glu Val Val Glu Arg Phe Tyr
Gly Glu Leu Asp Gly Lys Val Ser1 5 10 15Gln Gly Val Asn Ala Leu Leu
Gly Ser Phe Gly Val Glu Leu Thr Asp 20 25 30Thr Pro Thr Thr Lys Gly
Leu Pro Leu Val Asp Ser Pro Thr Pro Ile 35 40 45Val Leu Gly Val Ser
Val Tyr Leu Thr Ile Val Ile Gly Gly Leu Leu 50 55 60Trp Ile Lys Ala
Arg Asp Leu Lys Pro Arg Ala Ser Glu Pro Phe Leu65 70 75 80Leu Gln
Ala Leu Val Leu Val His Asn Leu Phe Cys Phe Ala Leu Ser 85 90 95Leu
Tyr Met Cys Val Gly Ile Ala Tyr Gln Ala Ile Thr Trp Arg Tyr 100 105
110Ser Leu Trp Gly Asn Ala Tyr Asn Pro Lys His Lys Glu Met Ala Ile
115 120 125Leu Val Tyr Leu Phe Tyr Met Ser Lys Tyr Val Glu Phe Met
Asp Thr 130 135 140Val Ile Met Ile Leu Lys Arg Ser Thr Arg Gln Ile
Ser Phe Leu His145 150 155 160Val Tyr His His Ser Ser Ile Ser Leu
Ile Trp Trp Ala Ile Ala His 165 170 175His Ala Pro Gly Gly Glu Ala
Tyr Trp Ser Ala Ala Leu Asn Ser Gly 180 185 190Val His Val Leu Met
Tyr Ala Tyr Tyr Phe Leu Ala Ala Cys Leu Arg 195 200 205Ser Ser Pro
Lys Leu Lys Asn Lys Tyr Leu Phe Trp Gly Arg Tyr Leu 210 215 220Thr
Gln Phe Gln Met Phe Gln Phe Met Leu Asn Leu Val Gln Ala Tyr225 230
235 240Tyr Asp Met Lys Thr Asn Ala Pro Tyr Pro Gln Trp Leu Ile Lys
Ile 245 250 255Leu Phe Tyr Tyr Met Ile Ser Leu Leu Phe Leu Phe Gly
Asn Phe Tyr 260 265 270Val Gln Lys Tyr Ile Lys Pro Ser Asp Gly Lys
Gln Lys Gly Ala Lys 275 280 285Thr Glu 290231197DNAPhytophtora
sojae 23atggctattt tgaaccctga ggctgattct gctgctaacc tcgctactga
ttctgaggct 60aagcaaagac aattggctga ggctggatac actcatgttg agggtgctcc
tgctcctttg 120cctttggagt tgcctcattt ctctctcaga gatctcagag
ctgctattcc taagcactgc 180ttcgagagat ctttcgtgac ctccacctac
tacatgatca agaacgtgtt gacttgcgct 240gctttgttct acgctgctac
cttcattgat agagctggag ctgctgctta tgttttgtgg 300cctgtgtact
ggttcttcca gggatcttac ttgactggag tgtgggttat cgctcatgag
360tgtggacatc aggcttattg ctcttctgag gtggtgaaca acttgattgg
actcgtgttg 420cattctgctt tgttggtgcc ttaccactct tggagaatct
ctcacagaaa gcaccattcc 480aacactggat cttgcgagaa cgatgaggtt
ttcgttcctg tgaccagatc tgtgttggct 540tcttcttgga acgagacctt
ggaggattct cctctctacc aactctaccg tatcgtgtac 600atgttggttg
ttggatggat gcctggatac ctcttcttca acgctactgg acctactaag
660tactggggaa agtctaggtc tcacttcaac ccttactccg ctatctatgc
tgatagggag 720agatggatga tcgtgctctc cgatattttc ttggtggcta
tgttggctgt tttggctgct 780ttggtgcaca ctttctcctt caacaccatg
gtgaagttct acgtggtgcc ttacttcatt 840gtgaacgctt acttggtgtt
gattacctac ctccaacaca ccgataccta catccctcat 900ttcagagagg
gagagtggaa ttggttgaga ggagctttgt gcactgtgga tagatcattt
960ggtccattcc tcgattctgt ggtgcataga atcgtggata cccatgtttg
ccaccacatc 1020ttctccaaga tgcctttcta tcattgcgag gaggctacca
acgctattaa gcctctcctc 1080ggaaagttct acttgaagga taccactcct
gttcctgttg ctctctggag atcttacacc 1140cattgcaagt tcgttgagga
tgatggaaag gtggtgttct acaagaacaa gctctag 119724398PRTPhytophtora
sojae 24Met Ala Ile Leu Asn Pro Glu Ala Asp Ser Ala Ala Asn Leu Ala
Thr1 5 10 15Asp Ser Glu Ala Lys Gln Arg Gln Leu Ala Glu Ala Gly Tyr
Thr His 20 25 30Val Glu Gly Ala Pro Ala Pro Leu Pro Leu Glu Leu Pro
His Phe Ser 35 40 45Leu Arg Asp Leu Arg Ala Ala Ile Pro Lys His Cys
Phe Glu Arg Ser 50 55 60Phe Val Thr Ser Thr Tyr Tyr Met Ile Lys Asn
Val Leu Thr Cys Ala65 70 75 80Ala Leu Phe Tyr Ala Ala Thr Phe Ile
Asp Arg Ala Gly Ala Ala Ala 85 90 95Tyr Val Leu Trp Pro Val Tyr Trp
Phe Phe Gln Gly Ser Tyr Leu Thr 100 105 110Gly Val Trp Val Ile Ala
His Glu Cys Gly His Gln Ala Tyr Cys Ser 115 120 125Ser Glu Val Val
Asn Asn Leu Ile Gly Leu Val Leu His Ser Ala Leu 130 135 140Leu Val
Pro Tyr His Ser Trp Arg Ile Ser His Arg Lys His His Ser145 150 155
160Asn Thr Gly Ser Cys Glu Asn Asp Glu Val Phe Val Pro Val Thr Arg
165 170 175Ser Val Leu Ala Ser Ser Trp Asn Glu Thr Leu Glu Asp Ser
Pro Leu 180 185 190Tyr Gln Leu Tyr Arg Ile Val Tyr Met Leu Val Val
Gly Trp Met Pro 195 200 205Gly Tyr Leu Phe Phe Asn Ala Thr Gly Pro
Thr Lys Tyr Trp Gly Lys 210 215 220Ser Arg Ser His Phe Asn Pro Tyr
Ser Ala Ile Tyr Ala Asp Arg Glu225 230 235 240Arg Trp Met Ile Val
Leu Ser Asp Ile Phe Leu Val Ala Met Leu Ala 245 250 255Val Leu Ala
Ala Leu Val His Thr Phe Ser Phe Asn Thr Met Val Lys 260 265 270Phe
Tyr Val Val Pro Tyr Phe Ile Val Asn Ala Tyr Leu Val Leu Ile 275 280
285Thr Tyr Leu Gln His Thr Asp Thr Tyr Ile Pro His Phe Arg Glu Gly
290 295 300Glu Trp Asn Trp Leu Arg Gly Ala Leu Cys Thr Val Asp Arg
Ser Phe305 310 315 320Gly Pro Phe Leu Asp Ser Val Val His Arg Ile
Val Asp Thr His Val 325 330 335Cys His His Ile Phe Ser Lys Met Pro
Phe Tyr His Cys Glu Glu Ala 340 345 350Thr Asn Ala Ile Lys Pro Leu
Leu Gly Lys Phe Tyr Leu Lys Asp Thr 355 360 365Thr Pro Val Pro Val
Ala Leu Trp Arg Ser Tyr Thr His Cys Lys Phe 370 375 380Val Glu Asp
Asp Gly Lys Val Val Phe Tyr Lys Asn Lys Leu385 390
39525819DNAThalassiosira pseudonana 25atggatgctt ataacgctgc
tatggataag attggagctg ctatcatcga ttggagtgat 60ccagatggaa agttcagagc
tgatagggag gattggtggt tgtgcgattt cagatccgct 120atcaccattg
ctctcatcta catcgctttc gtgatcttgg gatctgctgt gatgcaatct
180ctcccagcta tggacccata ccctatcaag ttcctctaca acgtgtctca
aatcttcctc 240tgcgcttaca tgactgttga ggctggattc ctcgcttata
ggaacggata caccgttatg 300ccatgcaacc acttcaacgt gaacgatcca
ccagttgcta acttgctctg gctcttctac 360atctccaaag tgtgggattt
ctgggatacc atcttcattg tgctcggaaa gaagtggaga 420caactctctt
tcttgcacgt gtaccatcat accaccatct tcctcttcta ctggttgaac
480gctaacgtgc tctacgatgg agatatcttc ttgaccatcc tcctcaacgg
attcattcac 540accgtgatgt acacctacta cttcatctgc atgcacacca
aggattctaa gaccggaaag 600tctttgccaa tctggtggaa gtcatctttg
accgctttcc aactcttgca attcaccatc 660atgatgtccc aagctaccta
cttggttttc cacggatgcg ataaggtttc cctcagaatc 720accatcgtgt
acttcgtgta cattctctcc cttttcttcc tcttcgctca gttcttcgtg
780caatcctaca tggctccaaa gaagaagaag tccgcttga
81926272PRTThalassiosira pseudonana 26Met Asp Ala Tyr Asn Ala Ala
Met Asp Lys Ile Gly Ala Ala Ile Ile1 5 10 15Asp Trp Ser Asp Pro Asp
Gly Lys Phe Arg Ala Asp Arg Glu Asp Trp 20 25 30Trp Leu Cys Asp Phe
Arg Ser Ala Ile Thr Ile Ala Leu Ile Tyr Ile 35 40 45Ala Phe Val Ile
Leu Gly Ser Ala Val Met Gln Ser Leu Pro Ala Met 50 55 60Asp Pro Tyr
Pro Ile Lys Phe Leu Tyr Asn Val Ser Gln Ile Phe Leu65 70 75 80Cys
Ala Tyr Met Thr Val Glu Ala Gly Phe Leu Ala Tyr Arg Asn Gly
85 90 95Tyr Thr Val Met Pro Cys Asn His Phe Asn Val Asn Asp Pro Pro
Val 100 105 110Ala Asn Leu Leu Trp Leu Phe Tyr Ile Ser Lys Val Trp
Asp Phe Trp 115 120 125Asp Thr Ile Phe Ile Val Leu Gly Lys Lys Trp
Arg Gln Leu Ser Phe 130 135 140Leu His Val Tyr His His Thr Thr Ile
Phe Leu Phe Tyr Trp Leu Asn145 150 155 160Ala Asn Val Leu Tyr Asp
Gly Asp Ile Phe Leu Thr Ile Leu Leu Asn 165 170 175Gly Phe Ile His
Thr Val Met Tyr Thr Tyr Tyr Phe Ile Cys Met His 180 185 190Thr Lys
Asp Ser Lys Thr Gly Lys Ser Leu Pro Ile Trp Trp Lys Ser 195 200
205Ser Leu Thr Ala Phe Gln Leu Leu Gln Phe Thr Ile Met Met Ser Gln
210 215 220Ala Thr Tyr Leu Val Phe His Gly Cys Asp Lys Val Ser Leu
Arg Ile225 230 235 240Thr Ile Val Tyr Phe Val Tyr Ile Leu Ser Leu
Phe Phe Leu Phe Ala 245 250 255Gln Phe Phe Val Gln Ser Tyr Met Ala
Pro Lys Lys Lys Lys Ser Ala 260 265 270271086DNAPhytophtora
infestans 27atggcgacga aggaggcgta tgtgttcccc actctgacgg agatcaagcg
gtcgctacct 60aaagactgtt tcgaggcttc ggtgcctctg tcgctctact acaccgtgcg
ttgtctggtg 120atcgcggtgg ctctaacctt cggtctcaac tacgctcgcg
ctctgcccga ggtcgagagc 180ttctgggctc tggacgccgc actctgcacg
ggctacatct tgctgcaggg catcgtgttc 240tggggcttct tcacggtggg
ccacgatgcc ggccacggcg ccttctcgcg ctaccacctg 300cttaacttcg
tggtgggcac tttcatgcac tcgctcatcc tcacgccctt cgagtcgtgg
360aagctcacgc accgtcacca ccacaagaac acgggcaaca ttgaccgtga
cgaggtcttc 420tacccgcaac gcaaggccga cgaccacccg ctgtctcgca
acctgattct ggcgctcggg 480gcagcgtggc tcgcctattt ggtcgagggc
ttccctcctc gtaaggtcaa ccacttcaac 540ccgttcgagc ctctgttcgt
gcgtcaggtg tcagctgtgg taatctctct tctcgcccac 600ttcttcgtgg
ccggactctc catctatctg agcctccagc tgggccttaa gacgatggca
660atctactact atggacctgt ttttgtgttc ggcagcatgc tggtcattac
caccttccta 720caccacaatg atgaggagac cccatggtac gccgactcgg
agtggacgta cgtcaagggc 780aacctctcgt ccgtggaccg atcgtacggc
gcgctcattg acaacctgag ccacaacatc 840ggcacgcacc agatccacca
ccttttccct atcattccgc actacaaact caagaaagcc 900actgcggcct
tccaccaggc tttccctgag ctcgtgcgca agagcgacga gccaattatc
960aaggctttct tccgggttgg acgtctctac gcaaactacg gcgttgtgga
ccaggaggcg 1020aagctcttca cgctaaagga agccaaggcg gcgaccgagg
cggcggccaa gaccaagtcc 1080acgtaa 108628361PRTPhytophtora infestans
28Met Ala Thr Lys Glu Ala Tyr Val Phe Pro Thr Leu Thr Glu Ile Lys1
5 10 15Arg Ser Leu Pro Lys Asp Cys Phe Glu Ala Ser Val Pro Leu Ser
Leu 20 25 30Tyr Tyr Thr Val Arg Cys Leu Val Ile Ala Val Ala Leu Thr
Phe Gly 35 40 45Leu Asn Tyr Ala Arg Ala Leu Pro Glu Val Glu Ser Phe
Trp Ala Leu 50 55 60Asp Ala Ala Leu Cys Thr Gly Tyr Ile Leu Leu Gln
Gly Ile Val Phe65 70 75 80Trp Gly Phe Phe Thr Val Gly His Asp Ala
Gly His Gly Ala Phe Ser 85 90 95Arg Tyr His Leu Leu Asn Phe Val Val
Gly Thr Phe Met His Ser Leu 100 105 110Ile Leu Thr Pro Phe Glu Ser
Trp Lys Leu Thr His Arg His His His 115 120 125Lys Asn Thr Gly Asn
Ile Asp Arg Asp Glu Val Phe Tyr Pro Gln Arg 130 135 140Lys Ala Asp
Asp His Pro Leu Ser Arg Asn Leu Ile Leu Ala Leu Gly145 150 155
160Ala Ala Trp Leu Ala Tyr Leu Val Glu Gly Phe Pro Pro Arg Lys Val
165 170 175Asn His Phe Asn Pro Phe Glu Pro Leu Phe Val Arg Gln Val
Ser Ala 180 185 190Val Val Ile Ser Leu Leu Ala His Phe Phe Val Ala
Gly Leu Ser Ile 195 200 205Tyr Leu Ser Leu Gln Leu Gly Leu Lys Thr
Met Ala Ile Tyr Tyr Tyr 210 215 220Gly Pro Val Phe Val Phe Gly Ser
Met Leu Val Ile Thr Thr Phe Leu225 230 235 240His His Asn Asp Glu
Glu Thr Pro Trp Tyr Ala Asp Ser Glu Trp Thr 245 250 255Tyr Val Lys
Gly Asn Leu Ser Ser Val Asp Arg Ser Tyr Gly Ala Leu 260 265 270Ile
Asp Asn Leu Ser His Asn Ile Gly Thr His Gln Ile His His Leu 275 280
285Phe Pro Ile Ile Pro His Tyr Lys Leu Lys Lys Ala Thr Ala Ala Phe
290 295 300His Gln Ala Phe Pro Glu Leu Val Arg Lys Ser Asp Glu Pro
Ile Ile305 310 315 320Lys Ala Phe Phe Arg Val Gly Arg Leu Tyr Ala
Asn Tyr Gly Val Val 325 330 335Asp Gln Glu Ala Lys Leu Phe Thr Leu
Lys Glu Ala Lys Ala Ala Thr 340 345 350Glu Ala Ala Ala Lys Thr Lys
Ser Thr 355 360291434DNAClaviceps purpurea 29atggctgcta ctacctctgc
tatgagcaag gatgctgttc ttagaagaac tgctgctgct 60actactgcta tcgatcacga
aagctctacc tctgcttctc cagctgattc tcctagactc 120tctgcttctt
ctacctctct ctcttctctc agctctctcg acgctaagga taaggatgat
180gagtacgctg gacttcttga tacttacgga aacgctttca cccctcctga
tttcactatc 240aaggatatca gagatgctat ccctaagcac tgcttcgagc
gttctgctat caagggatac 300gcttatatcc tcagagatgt ggcttgcctt
tctaccactt tctacctctt ccacaacttc 360gttacccctg agaacgttcc
ttacacccct cttagagttt tcctctgggg agtttacact 420gctcttcagg
gacttttcgg aactggactc tggattatcg ctcacgagtg tggacacggt
480gctttctctc cttctaccct cactaacgat cttactggat gggttctcca
ctctgctctt 540ctcgtgcctt acttctcttg gaagttctct cactctgctc
accacaaggg aaccggaaat 600atggaaaggg atatggcttt cctccctaga
actagggctc aatacgctac cagattcgga 660agagctatgg atcagcttgg
agatctttgc gaggaaaccc ctatctacac tgctggattc 720cttgttttcc
agcagcttct tggatggcct tcttacttga tcgctaacgt tactggacac
780gatcttcacg agagacagag agagggaaga ggaaagggaa agaagaacgg
attcggagga 840actgttaacc acttcgaccc tcgttctcct atcttcgatg
acaagcacgc taagtttatc 900gttctcagcg atatcggact tggacttgct
atcgctgctc ttgtttacct cggaaacaga 960ttcggatggg ctaacgttgc
tgtttggtac ttcgttcctt acctctgggt taaccactgg 1020atcgttgcta
tcactttcct tcagcacact gatcctactc ttcctcacta cactgctgag
1080gaatggaact tcgttcgtgg agctgctgct acaatcgata gagagatggg
atttatcggt 1140agacacctct tccacggaat cgttgagact cacgtgcttc
accactacgt ttcttcaatc 1200cctttctaca acgctgatga ggcttctgag
gctatcaagc ctgttatggg aaagcactac 1260cgttctgaga ctaaggatgg
acctatgggt tttatcaggg ctttgtggaa aactgctaga 1320tggtgtcaat
gggttgagcc ttctgctgat gctcaaggtg ctggtgaagg tgttctcttc
1380ttcaggaaca gaaacggact tggaactaag cctatctcta tgaggaccca gtga
143430477PRTClaviceps purpurea 30Met Ala Ala Thr Thr Ser Ala Met
Ser Lys Asp Ala Val Leu Arg Arg1 5 10 15Thr Ala Ala Ala Thr Thr Ala
Ile Asp His Glu Ser Ser Thr Ser Ala 20 25 30Ser Pro Ala Asp Ser Pro
Arg Leu Ser Ala Ser Ser Thr Ser Leu Ser 35 40 45Ser Leu Ser Ser Leu
Asp Ala Lys Asp Lys Asp Asp Glu Tyr Ala Gly 50 55 60Leu Leu Asp Thr
Tyr Gly Asn Ala Phe Thr Pro Pro Asp Phe Thr Ile65 70 75 80Lys Asp
Ile Arg Asp Ala Ile Pro Lys His Cys Phe Glu Arg Ser Ala 85 90 95Ile
Lys Gly Tyr Ala Tyr Ile Leu Arg Asp Val Ala Cys Leu Ser Thr 100 105
110Thr Phe Tyr Leu Phe His Asn Phe Val Thr Pro Glu Asn Val Pro Tyr
115 120 125Thr Pro Leu Arg Val Phe Leu Trp Gly Val Tyr Thr Ala Leu
Gln Gly 130 135 140Leu Phe Gly Thr Gly Leu Trp Ile Ile Ala His Glu
Cys Gly His Gly145 150 155 160Ala Phe Ser Pro Ser Thr Leu Thr Asn
Asp Leu Thr Gly Trp Val Leu 165 170 175His Ser Ala Leu Leu Val Pro
Tyr Phe Ser Trp Lys Phe Ser His Ser 180 185 190Ala His His Lys Gly
Thr Gly Asn Met Glu Arg Asp Met Ala Phe Leu 195 200 205Pro Arg Thr
Arg Ala Gln Tyr Ala Thr Arg Phe Gly Arg Ala Met Asp 210 215 220Gln
Leu Gly Asp Leu Cys Glu Glu Thr Pro Ile Tyr Thr Ala Gly Phe225 230
235 240Leu Val Phe Gln Gln Leu Leu Gly Trp Pro Ser Tyr Leu Ile Ala
Asn 245 250 255Val Thr Gly His Asp Leu His Glu Arg Gln Arg Glu Gly
Arg Gly Lys 260 265 270Gly Lys Lys Asn Gly Phe Gly Gly Thr Val Asn
His Phe Asp Pro Arg 275 280 285Ser Pro Ile Phe Asp Asp Lys His Ala
Lys Phe Ile Val Leu Ser Asp 290 295 300Ile Gly Leu Gly Leu Ala Ile
Ala Ala Leu Val Tyr Leu Gly Asn Arg305 310 315 320Phe Gly Trp Ala
Asn Val Ala Val Trp Tyr Phe Val Pro Tyr Leu Trp 325 330 335Val Asn
His Trp Ile Val Ala Ile Thr Phe Leu Gln His Thr Asp Pro 340 345
350Thr Leu Pro His Tyr Thr Ala Glu Glu Trp Asn Phe Val Arg Gly Ala
355 360 365Ala Ala Thr Ile Asp Arg Glu Met Gly Phe Ile Gly Arg His
Leu Phe 370 375 380His Gly Ile Val Glu Thr His Val Leu His His Tyr
Val Ser Ser Ile385 390 395 400Pro Phe Tyr Asn Ala Asp Glu Ala Ser
Glu Ala Ile Lys Pro Val Met 405 410 415Gly Lys His Tyr Arg Ser Glu
Thr Lys Asp Gly Pro Met Gly Phe Ile 420 425 430Arg Ala Leu Trp Lys
Thr Ala Arg Trp Cys Gln Trp Val Glu Pro Ser 435 440 445Ala Asp Ala
Gln Gly Ala Gly Glu Gly Val Leu Phe Phe Arg Asn Arg 450 455 460Asn
Gly Leu Gly Thr Lys Pro Ile Ser Met Arg Thr Gln465 470
47531903DNAOstreococcus tauri 31atgtctgctt ctggagcttt gttgcctgct
attgctttcg ctgcttacgc ttacgctacc 60tacgcttatg ctttcgagtg gtctcatgct
aacggaatcg ataacgtgga tgctagagag 120tggattggag ctttgtcttt
gagactccct gcaattgcta ccaccatgta cctcttgttc 180tgccttgtgg
gacctagatt gatggctaag agggaggctt ttgatcctaa gggattcatg
240ctcgcttaca acgcttacca aaccgctttc aacgttgtgg tgctcggaat
gttcgctaga 300gagatctctg gattgggaca acctgtttgg ggatctacta
tgccttggag cgataggaag 360tccttcaaga ttttgttggg agtgtggctc
cattacaaca ataagtacct cgagttgttg 420gatactgtgt tcatggtggc
taggaaaaag accaagcagc tctctttctt gcatgtgtac 480catcatgctt
tgttgatttg ggcttggtgg cttgtttgtc atctcatggc taccaacgat
540tgcatcgatg cttatttcgg agctgcttgc aactctttca tccacatcgt
gatgtactcc 600tactacctca tgtctgcttt gggaattaga tgcccttgga
agagatatat cacccaggct 660cagatgttgc aattcgtgat cgtgttcgct
catgctgttt tcgtgctcag acaaaagcac 720tgccctgtta ctttgccttg
ggcacaaatg ttcgtgatga caaatatgtt ggtgctcttc 780ggaaacttct
acctcaaggc ttactctaac aagtctaggg gagatggagc ttcttctgtt
840aagcctgctg agactactag agcaccttct gtgagaagaa ccaggtccag
gaagatcgat 900tga 90332300PRTOstreococcus tauri 32Met Ser Ala Ser
Gly Ala Leu Leu Pro Ala Ile Ala Phe Ala Ala Tyr1 5 10 15Ala Tyr Ala
Thr Tyr Ala Tyr Ala Phe Glu Trp Ser His Ala Asn Gly 20 25 30Ile Asp
Asn Val Asp Ala Arg Glu Trp Ile Gly Ala Leu Ser Leu Arg 35 40 45Leu
Pro Ala Ile Ala Thr Thr Met Tyr Leu Leu Phe Cys Leu Val Gly 50 55
60Pro Arg Leu Met Ala Lys Arg Glu Ala Phe Asp Pro Lys Gly Phe Met65
70 75 80Leu Ala Tyr Asn Ala Tyr Gln Thr Ala Phe Asn Val Val Val Leu
Gly 85 90 95Met Phe Ala Arg Glu Ile Ser Gly Leu Gly Gln Pro Val Trp
Gly Ser 100 105 110Thr Met Pro Trp Ser Asp Arg Lys Ser Phe Lys Ile
Leu Leu Gly Val 115 120 125Trp Leu His Tyr Asn Asn Lys Tyr Leu Glu
Leu Leu Asp Thr Val Phe 130 135 140Met Val Ala Arg Lys Lys Thr Lys
Gln Leu Ser Phe Leu His Val Tyr145 150 155 160His His Ala Leu Leu
Ile Trp Ala Trp Trp Leu Val Cys His Leu Met 165 170 175Ala Thr Asn
Asp Cys Ile Asp Ala Tyr Phe Gly Ala Ala Cys Asn Ser 180 185 190Phe
Ile His Ile Val Met Tyr Ser Tyr Tyr Leu Met Ser Ala Leu Gly 195 200
205Ile Arg Cys Pro Trp Lys Arg Tyr Ile Thr Gln Ala Gln Met Leu Gln
210 215 220Phe Val Ile Val Phe Ala His Ala Val Phe Val Leu Arg Gln
Lys His225 230 235 240Cys Pro Val Thr Leu Pro Trp Ala Gln Met Phe
Val Met Thr Asn Met 245 250 255Leu Val Leu Phe Gly Asn Phe Tyr Leu
Lys Ala Tyr Ser Asn Lys Ser 260 265 270Arg Gly Asp Gly Ala Ser Ser
Val Lys Pro Ala Glu Thr Thr Arg Ala 275 280 285Pro Ser Val Arg Arg
Thr Arg Ser Arg Lys Ile Asp 290 295 300
* * * * *