U.S. patent application number 16/425990 was filed with the patent office on 2019-10-24 for method of encapsulating a nucleic acid in a lipid nanoparticle host.
The applicant listed for this patent is Novartis AG. Invention is credited to Keith A. Bowman, Noah Gardner, Travis Jeannotte, Chandra Vargeese.
Application Number | 20190321295 16/425990 |
Document ID | / |
Family ID | 53783930 |
Filed Date | 2019-10-24 |
![](/patent/app/20190321295/US20190321295A1-20191024-C00001.png)
![](/patent/app/20190321295/US20190321295A1-20191024-C00002.png)
![](/patent/app/20190321295/US20190321295A1-20191024-C00003.png)
![](/patent/app/20190321295/US20190321295A1-20191024-C00004.png)
![](/patent/app/20190321295/US20190321295A1-20191024-C00005.png)
![](/patent/app/20190321295/US20190321295A1-20191024-C00006.png)
![](/patent/app/20190321295/US20190321295A1-20191024-C00007.png)
![](/patent/app/20190321295/US20190321295A1-20191024-C00008.png)
![](/patent/app/20190321295/US20190321295A1-20191024-C00009.png)
![](/patent/app/20190321295/US20190321295A1-20191024-C00010.png)
![](/patent/app/20190321295/US20190321295A1-20191024-C00011.png)
View All Diagrams
United States Patent
Application |
20190321295 |
Kind Code |
A1 |
Bowman; Keith A. ; et
al. |
October 24, 2019 |
Method of Encapsulating a Nucleic Acid in a Lipid Nanoparticle
Host
Abstract
Encapsulated nucleic acid nanoparticles of uniformly small
particle size are produced by intersecting one or more nucleic acid
streams with one or more lipid streams. The encapsulated nucleic
acid nanoparticles include a nucleic acid encapsulated within a
lipid nanoparticle host. Uniformly small particle sizes are
obtained by intersecting an aqueous nucleic acid stream and a
stream of lipids in organic solvent at high linear velocities and
with total organic solvent concentrations less than 33%.
Inventors: |
Bowman; Keith A.;
(Harleysville, PA) ; Gardner; Noah; (Cambridge,
MA) ; Jeannotte; Travis; (Nashua, NH) ;
Vargeese; Chandra; (Schwenksville, PA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Novartis AG |
Basel |
|
CH |
|
|
Family ID: |
53783930 |
Appl. No.: |
16/425990 |
Filed: |
May 30, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15326291 |
Jan 13, 2017 |
10342761 |
|
|
PCT/US2015/039879 |
Jul 10, 2015 |
|
|
|
16425990 |
|
|
|
|
62025224 |
Jul 16, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2310/14 20130101;
C12N 15/88 20130101; C12N 2320/32 20130101; A61K 48/0008 20130101;
A61K 9/1277 20130101; A61K 48/0091 20130101; A61K 9/1272 20130101;
A61K 31/713 20130101; C12N 15/113 20130101; A61K 31/7105
20130101 |
International
Class: |
A61K 9/127 20060101
A61K009/127; A61K 48/00 20060101 A61K048/00; A61K 31/7105 20060101
A61K031/7105; C12N 15/113 20060101 C12N015/113; C12N 15/88 20060101
C12N015/88; A61K 31/713 20060101 A61K031/713 |
Claims
1. An encapsulated nucleic acid nanoparticle composition
comprising: a pharmaceutically acceptable carrier; and an
encapsulated nucleic acid nanoparticle, the encapsulated nucleic
acid nanoparticle comprising a lipid nanoparticle host and a
nucleic acid, the nucleic acid being encapsulated in the lipid
nanoparticle host; wherein the encapsulated nucleic acid
nanoparticle has an average particle size of from about 40 nm to
about 70 nm and a polydispersity index of less than about 0.1 as
determined by dynamic light scattering.
2. The composition of claim 1, wherein the lipid nanoparticle host
comprises a degradable cationic lipid, a lipidated polyethylene
glycol, cholesterol, and
1,2-distearoyl-sn-glycero-3-phosphocholine.
Description
FIELD OF THE INVENTION
[0001] The invention generally relates to encapsulated nucleic acid
nanoparticle compositions and processes and systems for producing
encapsulated nucleic acid nanoparticles of uniformly small particle
size.
BACKGROUND OF THE INVENTION
[0002] The delivery of biologically active agents (including
therapeutically relevant compounds) to subjects is often hindered
by difficulties in the compounds reaching the target cell or
tissue. In particular, the trafficking of many biologically active
agents into living cells is highly restricted by the complex
membrane systems of the cells. These restrictions can result in the
need to use much higher concentrations of biologically active
agents than is desirable to achieve a result, which increases the
risk of toxic effects and side effects. One solution to this
problem is to utilize specific carrier molecules and carrier
compositions which are allowed selective entry into the cell. Lipid
carriers, biodegradable polymers and various conjugate systems can
be used to improve delivery of biologically active agents to
cells.
[0003] One class of biologically active agents that is particularly
difficult to deliver to cells is a bio therapeutic (including
nucleosides, nucleotides, polynucleotides, nucleic acids and
derivatives, such as mRNA and RNAi agents). In general, nucleic
acids are stable for only a limited duration in cells or plasma.
The development of RNA interference, RNAi therapy, mRNA therapy,
RNA drugs, antisense therapy and gene therapy, among others, has
increased the need for an effective means of introducing active
nucleic acid agents into cells. For these reasons, compositions
that can stabilize and deliver nucleic acid-based agents into cells
are of particular interest.
[0004] The most well-studied approaches for improving the transport
of foreign nucleic acids into cells involve the use of viral
vectors or formulations with cationic lipids. Viral vectors can be
used to transfer genes efficiently into some cell types, but they
generally cannot be used to introduce chemically synthesized
molecules into cells.
[0005] An alternative approach is to use delivery compositions
incorporating cationic lipids which interact with a biologically
active agent at one part and interact with a membrane system at
another part. Such compositions are reported to provide liposomes,
miscelles, lipoplexes, or lipid nanoparticles, depending on the
composition and method of preparation (for reviews, see Felgner,
1990, Advanced Drug Delivery Reviews, 5, 162-187; Felgner, 1993, J.
Liposome Res., 3, 3-16; Gallas, 2013, Chem. Soc. Rev., 42,
7983-7997; Falsini, 2013, J. Med. Chem.
dx.doi.org/10.1021/jm400791q; and references therein).
[0006] Since the first description of liposomes in 1965 by Bangham
(J. Mol. Biol. 13, 238-252), there has been a sustained interest
and effort in developing lipid-based carrier systems for the
delivery of biologically active agents (Allen, 2013, Advanced Drug
Delivery Reviews, 65, 36-48). The process of introducing functional
nucleic acids into cultured cells by using positively charged
liposomes was first described by Philip Felgner et al. Proc. Natl.
Acad. Sci., USA, 84, 7413-7417 (1987). The process was later
demonstrated in vivo by K. L. Brigham et al., Am. J. Med. Sci.,
298, 278-281 (1989). More recently, lipid nanoparticle formulations
have been developed with demonstrated efficacy in vitro and in
vivo. (Falsini, 2013, J. Med. Chem. dx.doi.org/10.1021/jm400791q;
Morrissey, 2005, Nat, Biotech., 23, 1002-1007; Zimmerman, 2006,
Nature, 441, 111-114; Jayaraman, 2012, Angew. Chem. Int. Ed., 51,
8529-8533.)
[0007] Lipid formulations are attractive carriers since they can
protect biological molecules from degradation while improving their
cellular uptake. Out of the various classes of lipid formulations,
formulations which contain cationic lipids are commonly used for
delivering polyanions (e.g. nucleic acids). Such formulations can
be formed using cationic lipids alone and optionally including
other lipids and amphiphiles such as phosphatidylethanolamine. It
is well known in the art that both the composition of the lipid
formulation as well as its method of preparation affect the
structure and size of the resultant aggregate (Leung, 2012, J. Phys
Chem. C, 116, 18440-18450).
[0008] Several techniques have been reported to encapsulate a
nucleic acid in a lipid nanoparticle, including detergent dialysis,
extrusion, high speed mixing, and stepwise dilution. Existing
approaches to nucleic acid encapsulation, however, suffer from low
encapsulation rates or non-scalability, produce nanoparticles that
lack a high degree of uniformity, and/or do not achieve average
particle sizes less than 80 nm. There is a need, therefore, for new
methods to encapsulate nucleic acids in a lipid nanoparticle that
produces a high degree of encapsulation, is scalable, and produces
nanoparticles of uniform size with an average particle diameter
less than 80 nm.
SUMMARY OF THE INVENTION
[0009] The present invention relates to an improved method for
encapsulating a nucleic acid in a lipid nanoparticle host. The
method is scalable and provides for the formation of encapsulated
nucleic acid nanoparticles having small average particle sizes
(e.g., <80 nm), improved uniformity of particle size, and a high
degree of nucleic acid encapsulation (e.g., >90%). Nanoparticles
produced by the processes of the invention possess long term
stability.
[0010] A first aspect of the invention provides a method of
encapsulating a nucleic acid in a lipid nanoparticle host by
joining one or more lipid streams with one or more nucleic acid
streams and flowing the joined streams to provide a first outlet
solution of encapsulated nucleic acid nanoparticles. Each lipid
stream comprises a mixture of one or more lipids in an organic
solvent (e.g., ethanol). Each nucleic acid stream comprises a
mixture of one or more nucleic acids in an aqueous solution. At the
intersection point of the lipid and nucleic acid streams, each
stream is characterized by a linear velocity. The one or more lipid
nanoparticle streams have a combined linear velocity of greater
than or equal to about 1.5 meters/second. Likewise, the one or more
nucleic acid streams have a combined linear velocity of greater
than or equal to about 1.5 meters/second. The final concentration
of organic solvent following joining and mixing of the lipid and
nucleic acid streams is in an amount that minimizes aggregation
(e.g., less than 33%). In certain embodiments, the final
concentration of organic solvent in the first outlet solution is
about 20% to about 25%. In certain embodiments according to the
first aspect, the joined lipid and nucleic acid streams are diluted
with a dilution solvent to provide the first outlet solution. In
other embodiments according to the first aspect, the combined
linear velocity of the combined nucleic acid stream(s) is about 3
to about 14 meters/second and the combined linear velocity of the
lipid stream(s) is about 1.5 to about 7 meters/second.
[0011] In a second aspect of the invention, the first outlet
solution is further processed by dilution, incubation,
concentration, and dialysis. In certain embodiments according to
the second aspect, the dialyzed solution may also be sterile
filtered. Encapsulated nucleic acid nanoparticles produced by the
processes of the second aspect have long-term stability.
[0012] In a third aspect of the invention, the encapsulated lipid
nanoparticles produced by the processes of the invention have an
average diameter less than about 80 nm. In certain embodiments the
nanoparticles have an average diameter of about 30 to about 80 nM.
In preferred embodiments, the nanoparticles have an average
diameter of less than about 70 nm (e.g., about 40-70 nm).
[0013] A fourth aspect of the invention provides an encapsulated
nucleic acid nanoparticle composition comprising a pharmaceutically
acceptable carrier, a lipid nanoparticle host, and a nucleic acid,
where the encapsulated nucleic acid nanoparticle has an average
diameter from about 40 nm to about 70 nm.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] FIG. 1 illustrates a flow diagram of an exemplary process
for preparing and processing encapsulated nucleic acid
nanoparticles.
[0015] FIG. 2 illustrates a representative system for producing
encapsulated nucleic acid nanoparticles.
[0016] FIG. 2a illustrates an alternate embodiment of a dilution
chamber for use in the system of FIG. 2
[0017] FIGS. 3a, 3b, and 3c illustrate alternate embodiments of a
mixing chamber for use in the system of FIG. 2.
[0018] FIG. 4a is an image obtained by cryo-electron microscopy
illustrating the particle uniformity for siRNA encapsulated lipid
nanoparticles produced using a cross-shaped mixing chamber and the
process and materials as described in Process Example 2.
[0019] FIG. 4b is an image obtained by cryo-electron microscopy
illustrating the particle uniformity for siRNA encapsulated lipid
nanoparticles produced using a T-shaped mixing chamber and the
process and materials as described in Process Example 2.
DETAILED DESCRIPTION
1.0 General
[0020] The present invention provides processes for producing
encapsulated nucleic acid nanoparticles with uniformly small
particle sizes. Shown in FIG. 1 is a representative flow chart
generally outlining the steps of one embodiment of the invention.
In step 100, one or more lipid streams are joined at a first
intersection point with one or more nucleic acid streams to provide
a first joined stream. The first joined stream is then flowed (step
110) to permit association of the individual streams of the joined
stream, whereupon the process of lipid nanoparticle assembly and
nucleic acid encapsulation takes place. Depending on the particular
parameters chosen for the initial nucleic acid stream(s), the
joined stream may be optionally further diluted with aqueous media
(step 120) to obtain the first outlet solution (step 130).
Alternatively, the optional dilution step 120 may be omitted and
the first outlet stream obtained directly from the flowing joined
stream by use of an appropriately diluted nucleic acid stream(s) in
step 100. The first outlet solution obtained at step 130 contains
encapsulated nucleic acid nanoparticles.
[0021] Further processing of the first outlet solution may be
performed to remove organic solvent and thereby provide the
encapsulated nucleic acid nanoparticles as a formulation having
long-term stability. Initially, the first outlet solution is
incubated (step 140) for a period of time (e.g., 60 minutes) at
room temperature, followed by dilution with aqueous media (e.g.
water, citrate buffer) (step 150), concentration and dialysis (step
160), and finally sterile filtration (step 170). The dilution step
150 may dilute the organic solvent concentration by two-fold. The
concentration may be by tangential flow filtration.
[0022] Surprisingly, it has been found that small and uniform
particles are obtained by joining/intersecting one or more lipid
streams with one or more nucleic acid streams where the combined
lipid streams and the combined nucleic acid streams, each, maintain
a linear velocity of greater than 1.5 meters/second and the final
concentration of organic solvent upon joining/mixing the streams is
less than 33% by volume. Keeping the organic solvent less than 33%
inhibits aggregation of the nanoparticles, whereas the high flow
rates of the invention keep particle sizes small and uniform. The
processes provide for efficient encapsulation of nucleic acids.
[0023] In some embodiments, the combined linear velocity of the one
or more nucleic acid streams is about 1.5 to about 14 meters/second
and the combined linear velocity of the one or more lipid streams
is about 1.5 to about 7 meters/second. In other embodiments, the
combined linear velocity of the one or more nucleic acid streams is
about 3 to about 14 meters/second and the combined linear velocity
of the one or more lipid streams is about 1.5 to about 4.5
meters/second. In other embodiments, the combined linear velocity
of the one or more nucleic acid streams is about 8 to about 14
meters/second and the combined linear velocity of the one or more
lipid streams is about 1.5 to about 4.5 meters/second. In other
embodiments, the combined linear velocity of the one or more
nucleic acid streams is about 3 to about 8 meters/second and the
combined linear velocity of the one or more lipid streams is about
1.5 to about 4.5 meters/second. In other embodiments, the combined
linear velocity of the one or more nucleic acid streams is about 9
to about 14 meters/second and the combined linear velocity of the
one or more lipid streams is about 3 to about 4 meters/second. In
other embodiments, the combined linear velocity of the one or more
nucleic acid streams is about 11 to about 14 meters/second and the
combined linear velocity of the one or more lipid streams is about
3 to about 4 meters/second. In other embodiments, the combined
linear velocity of the one or more nucleic acid streams is about 9
to about 11 meters/second and the combined linear velocity of the
one or more lipid streams is about 3 to about 4 meters/second. In
other embodiments, the combined linear velocity of the one or more
nucleic acid streams is about 6 to about 8 meters/second and the
combined linear velocity of the one or more lipid streams is about
3 to about 4 meters/second. In still other embodiments, the
combined linear velocity of the one or more nucleic acid streams is
about 10.2 meters/second and the combined linear velocity of the
one or more lipid streams is about 3.4 meters/second. In other
embodiments, the combined linear velocity of the one or more
nucleic acid streams is about 6.8 meters/second and the combined
linear velocity of the one or more lipid streams is about 3.4
meters/second. In still other embodiments, the combined linear
velocity of the one or more nucleic acid streams is about 13.6
meters/second and the combined linear velocity of the one or more
lipid streams is about 3.4 meters/second. In still other
embodiments, the combined linear velocity of the one or more
nucleic acid streams is about 3.4 meters/second and the combined
linear velocity of the one or more lipid streams is about 1.7
meters/second. In other embodiments, the combined linear velocity
of the one or more nucleic acid streams is about 3 meters/second
and the combined linear velocity of the one or more lipid streams
is about 1.5 meters/second. In other embodiments, the combined
linear velocity of the one or more nucleic acid streams is about 14
meters/second and the combined linear velocity of the one or more
lipid streams is about 7 meters/second.
2.0 Nucleic Acids
[0024] Nucleic acids suitable for use with the invention include:
antisense DNA or RNA compositions, chimeric DNA:RNA compositions,
allozymes, aptamers, ribozyme, decoys and analogs thereof, plasmids
and other types of expression vectors, and small nucleic acid
molecules, RNAi agents, short interfering nucleic acid (siNA),
messenger ribonucleic acid" (messenger RNA, mRNA), double-stranded
RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA)
molecules, peptide nucleic acid (PNA), a locked nucleic acid
ribonucleotide (LNA), morpholino nucleotide, threose nucleic acid
(TNA), glycol nucleic acid (GNA), sisiRNA (small internally
segmented interfering RNA), aiRNA (assymetrical interfering RNA),
and siRNA with 1, 2 or more mismatches between the sense and
anti-sense strand to relevant cells and/or tissues, such as in a
cell culture, subject or organism. Such compounds may be purified
or partially purified, and may be naturally occuring or synthetic,
and may be chemically modified. In one embodiment the biologically
active agent is an RNAi agent, short interfering nucleic acid
(siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA),
micro-RNA (miRNA), or a short hairpin RNA (shRNA) molecule. In one
embodiment the biologically active agent is a RNAi agent useful for
mediating RNA interference (RNAi).
[0025] A "ribonucleic acid" (RNA) is a polymer of nucleotides
linked by a phosphodiester bond, where each nucleotide contains
ribose or a modification thereof as the sugar component. Each
nucleotide contains an adenine (A), a guanine (G), a cytosine (C),
a uracil (U) or a modification thereof as the base. The genetic
information in a mRNA molecule is encoded in the sequence of the
nucleotide bases of the mRNA molecule, which are arranged into
codons consisting of three nucleotide bases each. Each codon
encodes for a specific amino acid of the polypeptide, except for
the stop codons, which terminate translation (protein synthesis).
Within a living cell, mRNA is transported to a ribosome, the site
of protein synthesis, where it provides the genetic information for
protein synthesis synthesis (translation). For a fuller
description, see, Alberts B et al. (2007) Molecular Biology of the
Cell, Fifth Edition, Garland Science.
[0026] In eukaryotes, mRNA is transcribed in vivo at the
chromosomes by the cellular enzyme RNA polymerase. During or after
transcription in vivo, a 5' cap (also termed an RNA cap, an RNA
7-methylguanosine cap, or an RNA m7G cap) is added in vivo to the
5' end of the mRNA. The 5' cap is terminal 7-methylguanosine
residue that is linked through a 5'-5'-triphosphate bond to the
first transcribed nucleotide. In addition, most eukaryotic mRNA
molecules have a polyadenylyl moiety ("poly(A) tail") at the 3' end
of the mRNA molecule. In vivo, the eukaryotic cell adds the poly(A)
tail after transcription, often at a length of about 250 adenosine
residues. Thus, a typical mature eukaryotic mRNA has a structure
that begins at the 5' end with an mRNA cap nucleotide followed by a
5' untranslated region (5'UTR) of nucleotides, then an open reading
frame that begins with a start codon which is an AUG triplet of
nucleotide bases, that is the coding sequence for a protein, and
that ends with a stop codon that may be a UAA, UAG, or UGA triplet
of nucleotide bases, then a 3' untranslated region (3'UTR) of
nucleotides and ending with a poly-adenosine tail. While the
features of the typical mature eukaryotic mRNA are made naturally
in a eukaryotic cell in vivo, the same or structurally and
functionally equivalent features can be made in vitro using the
methods of molecular biology. Accordingly, any RNA having the
structure similar to a typical mature eukaryotic mRNA can function
as a mRNA and is within the scope of the term "messenger
ribonucleic acid".
[0027] The mRNA molecule is generally of a size that it can be
encapsulated in a lipid nanoparticle of the invention. While the
size of a mRNA molecule varies in nature depending upon the
identity of the mRNA species that encodes for a particular protein,
an average size for a mRNA molecule is average mRNA size is
500-10,000 bases.
[0028] The term "deoxyribonucleic acid" (DNA) as used herein refers
to a polymeric nucleic acid that carries the genetic information in
the cells of living organisms and many viruses. In vivo, DNA is
capable of self-replication and the synthesis of RNA. DNA consists
of two long chains of nucleotides twisted into a double helix and
joined by hydrogen bonds between the complementary bases adenine
(A) and thymine (T) or cytosine (C) and guanine (G). The sequence
of the nucleotides determines individual hereditary
characteristics. See, The American Heritage.RTM. Dictionary of the
English Language, Fourth Edition (Updated in 2009). Houghton
Mifflin Company.
[0029] Each of the nucleotides of a DNA polymer is linked by a
phosphodiester bond in a 5' to 3' direction. Each nucleotide
contains deoxyribose or a modification thereof as the sugar
component. Each nucleotide contains an adenine (A), a guanine (G),
a cytosine (C), a thymine (T) or a modification thereof as the
base.
[0030] Most DNA molecules existing in vivo are double-stranded
helices, consisting of two long polymers in anti-parallel
formation, one backbone being 3' (three prime) and the other 5'
(five prime). In this double stranded formation, the bases are
paired by hydrogen bonding, with adenine bonding to thymine and
guanine binding to cytosine, which results in a double helix
structure. Other DNA molecules are single stranded, although single
stranded DNA molecules have the potential to become double stranded
if they match with another single stranded DNA or RNA molecule with
a complementary nucleotide sequence. For a fuller description, see,
Alberts B et al. (2007) Molecular Biology of the Cell, Fifth
Edition, Garland Science.
[0031] The sequence of the nucleotide bases along the deoxyribose
backbone that encodes the genetic information. For the synthesis of
proteins, the genetic information is copied into the nucleotide
sequence of a mRNA molecule in a process called transcription, when
the mRNA molecule is created.
[0032] DNA can exist in at least two forms, which have different
sizes. The first form of DNA is a very large-sized polymer called a
chromosome. A chromosome contains the genetic information for many
or most of the proteins in a cell and also contains information
whereby the cell can control the replication of the DNA molecule. A
bacterial cell may contain one or more chromosome. A eukaryotic
cell usually contains more than one cell chromosome, each
chromosome.
[0033] The second form of DNA is a shorter sized form. Many DNA
molecules of the second form are of a size that it can be
encapsulated in a lipid nanoparticle of the invention. Some of
these shorter forms of DNA can be of a size to usefully encode for
proteins. Examples of these second, shorter, useful forms of DNA
include plasmids and other vectors. For a fuller description, see,
Alberts B et al. (2007) Molecular Biology of the Cell, Fifth
Edition, Garland Science.
[0034] A plasmid is a small DNA molecule that is physically
separate from, and can replicate independently of, chromosomal DNA
within a cell. Plasmids commonly exist in vivo as small circular,
double-stranded DNA molecules. In nature, plasmids carry genes that
can be transcribed and translated to proteins that may benefit
survival of an organism (e.g. antibiotic resistance). In nature,
plasmids can frequently be transmitted from one organism to another
by horizontal gene transfer. Artificial or recombinant plasmids are
widely used in molecular biology, serving to permit the replication
of recombinant DNA sequences and the expression of useful proteins
within host organisms. Plasmid sizes can vary from 1 to over 25
kilobase pairs. A recombinant plasmid can be recombinantly made to
be of a size that it can be encapsulated in a lipid nanoparticle of
the invention.
[0035] In molecular biology, a vector is a DNA molecule used as a
vehicle to artificially carry genetic material from one cell or
from a biochemical reaction in vitro into another cell, where the
DNA can be replicated and/or expressed. A vector containing foreign
DNA is termed recombinant. Among the types of useful vectors are
plasmids and viral vectors. Insertion of a vector into the target
cell is usually called transformation for bacterial cells,
transfection for eukaryotic cells, although insertion of a viral
vector is often called transduction.
[0036] Viral vectors are generally recombinant viruses carrying
modified viral DNA or RNA that has been rendered noninfectious, but
that still contain viral promoters and also the transgene, thus
allowing for translation of the transgene through a viral promoter.
Viral vectors are often designed for permanent incorporation of the
insert into the host genome, and thus leave distinct genetic
markers in the host genome after incorporating the transgene. A
viral vector can be recombinantly made to be of a size that it can
be encapsulated in a lipid nanoparticle of the invention.
[0037] An "RNAi agent" is a composition or compound capable of
mediating RNA interference. The term "RNA interference" (RNAi) is a
post-transcriptional, targeted gene-silencing technique that uses a
RNAi agent to degrade messenger RNA (mRNA) containing a sequence
which is the same as or very similar to the RNAi agent. See: Zamore
and Haley 2005 Science 309: 1519-1524; Zamore et al. 2000 Cell 101:
25-33; Elbashir et al. 2001 Nature 411: 494-498; and Kreutzer et
al., PCT Publication WO 00/44895; Fire, PCT Publication WO
99/32619; Mello and Fire, PCT Publication WO 01/29058; and the
like.
[0038] As used herein, RNAi is equivalent to other terms used to
describe sequence specific RNA interference, such as post
transcriptional gene silencing, translational inhibition,
transcriptional inhibition, or epigenetics. For example, the
formulations containing lipids of the invention can be used in
conjunction with siNA molecules to epigenetically silence genes at
both the post-transcriptional level and/or the pre-transcriptional
level. In a non-limiting example, modulation of gene expression by
siNA molecules can result from siNA mediated cleavage of RNA
(either coding or non-coding RNA) via RISC, or alternately,
translational inhibition as is known in the art. In another
embodiment, modulation of gene expression by siNA can result from
transcriptional inhibition such as is reported e.g., in Janowski et
al. 2005 Nature Chemical Biology 1: 216-222.
[0039] RNAi agents include, inter alia, siRNA or siNA, microRNA
(miRNA), shRNA, short interfering oligonucleotide and
chemically-modified short interfering nucleic acid molecules. The
terms "short interfering RNA" (siRNA) or "short interfering nucleic
acid" (siNA), or the like, as used herein, refer to any molecule
capable of inhibiting or down regulating gene expression or viral
replication by mediating RNA interference (RNAi) or gene silencing
in a sequence-specific manner. siRNAs can be generated by
ribonuclease III cleavage from longer double-stranded RNA (dsRNA)
which are homologous to, or specific to, the silenced gene target.
They can also be made artificially by various methods known in the
art.
[0040] RNAi agents of the present disclosure can target any target
gene and comprise any sequence, and can have any of several
formats, components, substitutions and/or modifications.
[0041] RNAi agent generally comprise two strands, an anti-sense (or
guide) strand and a sense (or passenger) strand; the anti-sense
strand is incorporated into the RISC (RNA interference silencing
complex) and targets the corresponding sequence of a target mRNA.
The sequence (or a portion thereof) of the anti-sense strand
matches that of the target mRNA. A few mismatches (generally no
more than 1-3 per 15 nt sequence) can be present without preventing
target-specific RNAi activity. The anti-sense and sense strand can
be separate molecules, or connected by a linker or loop (to form,
e.g., a shRNA). The anti-sense strand is generally a 49-mer or
shorter, often a 19-mer to 25-mer. The sense strand can be the same
length as, or shorter or longer than the anti-sense strand. As
shown herein, the anti-sense strand can be as short as a 18-mer,
and the sense strand can be as short as a 14-mer.
[0042] The canonical siRNA is two strands of RNA, each a 21-mer,
with a 19-bp (basepair) double-stranded region and two 2-nt
(nucleotide) overhangs. Elbashir et al. 2001 Nature 411: 494-498;
Elbashir et al. 2001 EMBO J. 20: 6877-6888. The overhangs can be
replaced by a dinucleotide such as dTdT, TT, UU, U (2'-OMe) dT, U
(2'-OMe) U (2'-OMe), T(2'-OMe) T (2'-OMe), T(2'-OMe) dT, or the
like. The overhang acts to protect the RNAi agent from cleavage by
nucleases, while not interfering with RNAi activity or contributing
to target recognition. Elbashir et al. 2001 Nature 411: 494-498;
Elbashir et al. 2001 EMBO J. 20: 6877-6888; and Kraynack et al.
2006 RNA 12:163-176. Additional 3'-terminal nucleotide overhangs
include dT (deoxythimidine), 2'-0,4'-C-ethylene thymidine (eT), and
2-hydroxyethyl phosphate (hp). 4-thiouracil and 5-bromouracil
substitutions can also be made. Parrish et al. 2000 Molecular Cell
6: 1077-1087. Nucleotidic overhangs can be replaced by
non-nucleotidic 3' end caps, provided that such caps are capable of
protecting the ends from cleavage, and allowing RNAi activity of
the molecule. See, for example, U.S. Pat. Nos. 8,097,716;
8,084,600; 8,404,831; 8,404,832; and 8,344,128; and U.S. Pat. App.
No. 61/886,739, which is incorporated entirely by reference.
[0043] In either strand, one or more positions can be replaced by a
spacer. These include, without limitation, a sugar, alkyl,
cycloakyl, ribitol or other type of abasic nucleotide,
2'-deoxy-ribitol, diribitol, 2'-methoxyethoxy-ribitol (ribitol with
2'-MOE), C.sub.3-6 alkyl, or 4-methoxybutane-1,3-diol (5300). In
some molecules, a gap can be introduced into the sense strand,
producing two shorter sense strands; this is called a sisiRNA. WO
2007/107162 to Wengels and Kjems. One or more mismatches and bulges
between the sense and anti-sense strand can also be introduced.
U.S. Patent App. No. 2009/0209626 to Khvorova.
[0044] RNAi agents can be constructed from RNA, as in the canonical
siRNA. However, RNA nucleotides can be substituted or modified in
various RNAi agents. At one or more positions, a RNA nucleotide can
be replaced by DNA, a peptide nucleic acid (PNA), locked nucleic
acid (LNA), morpholino nucleotide, threose nucleic acid (TNA),
glycol nucleic acid (GNA), arabinose nucleic acid (ANA),
2'-fluoroarabinose nucleic acid (FANA), cyclohexene nucleic acid
(CeNA), anhydrohexitol nucleic acid (HNA), or unlocked nucleic acid
(UNA). Particularly in the seed region (approximately positions 2-7
of the anti-sense strand and the corresponding positions of the
sense strand), the nucleotides in one or both strand can be
replaced by DNA. The entire seed region can be replaced by DNA,
forming a DNA-RNA hybrid capable of mediating RNA interference.
Yamato et al. 2011. Cancer Gene Ther. 18: 587-597.
[0045] RNA nucleotides can be either substituted with other
components (as described above) and/or modified. Modifications
and/or substitutions can be made at the sugar, phosphate and/or
base. In various aspects, the RNAi agent comprises a
2'-modification of the sugar, for example, 2'-amino, 2'-C-allyl,
2'-deoxy, 2'-deoxy-2'-fluoro (2'-F), 2'-O-methyl (2'-OMe),
2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl (2'-O-AP),
2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl
(2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or
2'O--N-methylacetamido (2'-O-NMA); other RNA modifications are
known in the art. See, for example, Usman and Cedergren 1992 TIBS.
17: 34; Usman et al. 1994 Nucleic Acids Symp. Ser. 31: 163; Burgin
et al. 1996 Biochemistry 35: 14090. In some embodiments, the two
RNA nucleotides on the 3' end of either or both strands are
modified with a 2'-MOE, forming a 2'-MOE clamp. U.S. Pat. Nos.
8,097,716; and 8,084,600.
[0046] One or more phosphate of the sugar-phosphate backbone can be
replaced, e.g., by a modified internucleoside linker. This can
include, without limitation, phosphorothioate, phosphorodithioate,
phosphoramidate, boranophosphonoate, an amide linker, and a
compound of formula (Ia):
##STR00001##
where R.sup.3 is selected from O.sup.-, S.sup.-, NH.sub.2,
BH.sub.3, CH.sub.3, C.sub.1-6 alkyl, C.sub.6-10 aryl, C.sub.1-6
alkoxy and C.sub.6-10 aryl-oxy, wherein C.sub.1-6 alkyl and
C.sub.6-10 aryl are unsubstituted or optionally independently
substituted with 1 to 3 groups independently selected from halo,
hydroxyl and NH.sub.2; and R.sup.4 is selected from O, S, NH, or
CH.sub.2.
[0047] The base can also be modified or substituted, e.g., with
5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil,
hypoxanthine, xantine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)
uracil, 5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopentenyladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine. In certain aspects, the RNAi agent can comprise
a non-natural nucleobase, wherein the non-natural nucleobase is
difluorotolyl, nitroindolyl, nitropyrrolyl, or nitroimidazolyl.
Many other modifications are known in the art. See, for example,
Usman et al. 1992 TIBS 17:34; Usman et al. 1994 Nucl. Acids Symp.
Ser. 31: 163; Burgin et al. 1996 Biochem. 35: 14090.
[0048] For example, one or more position can be represented by
2'-O-methylcytidine-5'-phosphate, 2'-O-methyluridine-5'-phosphate.
In short, any one or more position can be represented by any
modification or substitution known in the art, including, without
limitation, 2'-O-methyl modified nucleotide, a nucleoside
comprising a 5' phosphorothioate group, a terminal nucleoside
linked to a cholesteryl derivative or dodecanoic acid bisdecylamide
group, a locked nucleoside, an abasic nucleoside, a
2'-deoxy-2'-fluoro modified nucleoside, a 2'-amino-modified
nucleoside, 2'-alkyl-modified nucleoside, morpholino nucleoside, an
unlocked ribonucleotide (e.g., an acyclic nucleotide monomer, as
described in WO 2008/147824), a phosphoramidate or a non-natural
base comprising nucleoside, or any combination thereof.
[0049] Any of these various formats, components, substitutions
and/or modifications can be mixed and matched or combined in
different ways to form RNAi agents to any target and comprising any
sequence. For example, the present disclosure pertains to an RNAi
agent which comprises two strands, wherein one or both strands is
an 18-mer which terminates at the 3' end in a phosphate or modified
internucleoside linker, and further comprises, in 5' to 3' order, a
spacer, a second phosphate or modified internucleoside linker, and
a 3' end cap. In another embodiment, the present disclosure
pertains to an RNAi agent which comprises a sense and anti-sense
strand, wherein the anti-sense strand comprises, in 5- to 3-order,
an 18-mer which terminates at the 3' end in a phosphate or modified
internucleoside linker, and further comprises, in 5' to 3' order, a
spacer, a second phosphate or modified internucleoside linker, and
3' end cap; and wherein the sense strand comprises, in 5' to 3'
order, a 14-mer (or longer) which terminates at the 3' end in a
phosphate or modified internucleoside linker, and further
comprises, in 5' to 3' order, a spacer, a second phosphate or
modified internucleoside linker, and 3' end cap.
[0050] In various embodiments of the present disclosure, the RNAi
agent can target any target gene and have any sequence and can have
any format, component, substitution and/or modification as
described herein or known in the art.
[0051] The term "RNAi inhibitor" is any molecule that can down
modulate (e.g. reduce or inhibit) RNA interference function or
activity in a cell or patient. An RNAi inhibitor can down regulate,
reduce or inhibit RNAi (e.g. RNAi mediated cleavage of a target
polynucleotide, translational inhibition, or transcriptional
silencing) by interaction with or interfering with the function of
any component of the RNAi pathway, including protein components
such as RISC, or nucleic acid components such as miRNAs or siRNAs.
An RNAi inhibitor can be a siNA molecule, an antisense molecule, an
aptamer, or a small molecule that interacts with or interferes with
the function of RISC, a miRNA, or a siRNA or any other component of
the RNAi pathway in a cell or patient. By inhibiting RNAi (e.g.
RNAi mediated cleavage of a target polynucleotide, translational
inhibition, or transcriptional silencing), an RNAi inhibitor can be
used to modulate (e.g, up-regulate or down-regulate) the expression
of a target gene. In one embodiment, an RNA inhibitor is used to
up-regulate gene expression by interfering with (e.g. reducing or
preventing) endogenous down-regulation or inhibition of gene
expression through translational inhibition, transcriptional
silencing, or RISC mediated cleavage of a polynucleotide (e.g.
mRNA). By interfering with mechanisms of endogenous repression,
silencing, or inhibition of gene expression, RNAi inhibitors of the
invention can therefore be used to up-regulate gene expression for
the treatment of diseases or conditions resulting from a loss of
function. The term "RNAi inhibitor" is used interchangeably with
the term "siNA" in various embodiments herein.
[0052] The term "enzymatic nucleic acid" as used herein refers to a
nucleic acid molecule that has complementarity in a substrate
binding region to a specified gene target, and also has an
enzymatic activity that acts to specifically cleave a target RNA,
thereby inactivating the target RNA molecule. The complementary
regions allow sufficient hybridization of the enzymatic nucleic
acid molecule to the target RNA and thus permit cleavage.
Complementarity of 100% is preferred, but complementarity as low as
50-75% can also be useful in this invention (see e.g., Werner and
Uhlenbeck, 1995, Nucleic Acids Research, 23, 2092-2096; Hammann et
al., 1999, Antisense and Nucleic Acid Drug Dev., 9, 25-31). The
nucleic acids can be modified at the base, sugar, and/or phosphate
groups. The term enzymatic nucleic acid is used interchangeably
with phrases such as ribozymes, catalytic RNA, enzymatic RNA,
catalytic DNA, aptazyme or aptamer-binding ribozyme, regulatable
ribozyme, catalytic oligonucleotides, nucleozyme, DNAzyme, RNA
enzyme, endoribonuclease, endonuclease, minizyme, leadzyme,
oligozyme or DNA enzyme. All of these terminologies describe
nucleic acid molecules with enzymatic activity. The key features of
an enzymatic nucleic acid molecule are that it has a specific
substrate binding site that is complementary to one or more of the
target nucleic acid regions, and that it has nucleotide sequences
within or surrounding that substrate binding site that impart a
nucleic acid cleaving and/or ligation activity to the molecule
(see, e.g., Cech et al., U.S. Pat. No. 4,987,071; Cech et al.,
1988, 260 JAMA 3030). Ribozymes and enzymatic nucleic acid
molecules of the invention can be chemically modified, e.g., as
described in the art and elsewhere herein.
[0053] The term "antisense nucleic acid", as used herein, refers to
a non-enzymatic nucleic acid molecule that binds to target RNA by
means of RNA-RNA or RNA-DNA or RNA-PNA (protein nucleic acid;
Egholm et al., 1993 Nature 365, 566) interactions and alters the
activity of the target RNA (for a review, see Stein and Cheng, 1993
Science 261, 1004 and Woolf et al., U.S. Pat. No. 5,849,902).
Antisense DNA can be synthesized chemically or expressed via the
use of a single stranded DNA expression vector or equivalent
thereof. Antisense molecules of the invention can be chemically
modified, e.g. as described in the art.
[0054] The term "RNase H activating region" as used herein, refers
to a region (generally greater than or equal to 4-25 nucleotides in
length, preferably from 5-11 nucleotides in length) of a nucleic
acid molecule capable of binding to a target RNA to form a
non-covalent complex that is recognized by cellular RNase H enzyme
(see e.g., Arrow et al., U.S. Pat. No. 5,849,902; Arrow et al.,
U.S. Pat. No. 5,989,912). The RNase H enzyme binds to the nucleic
acid molecule-target RNA complex and cleaves the target RNA
sequence.
[0055] The term "2-5A antisense chimera" as used herein, refers to
an antisense oligonucleotide containing a 5'-phosphorylated
2'-5'-linked adenylate residue. These chimeras bind to target RNA
in a sequence-specific manner and activate a cellular
2-5A-dependent ribonuclease that, in turn, cleaves the target RNA
(Torrence et al., 1993 Proc. Natl. Acad. Sci. USA 90, 1300;
Silverman et al., 2000, Methods Enzymol., 313, 522-533; Player and
Torrence, 1998, Pharmacol. Ther., 78, 55-113). 2-5A antisense
chimera molecules can be chemically modified, e.g. as described in
the art.
[0056] The term "triplex forming oligonucleotides" as used herein,
refers to an oligonucleotide that can bind to a double-stranded DNA
in a sequence-specific manner to form a triple-strand helix.
Formation of such triple helix structure has been shown to inhibit
transcription of the targeted gene (Duval-Valentin et al., 1992
Proc. Natl. Acad. Sci. USA 89, 504; Fox, 2000, Curr. Med. Chem., 7,
17-37; Praseuth et. al., 2000, Biochim. Biophys. Acta, 1489,
181-206). Triplex forming oligonucleotide molecules of the
invention can be chemically modified, e.g. as described in the
art.
[0057] The term "decoy RNA" as used herein, refers to an RNA
molecule or aptamer that is designed to preferentially bind to a
predetermined ligand. Such binding can result in the inhibition or
activation of a target molecule. The decoy RNA or aptamer can
compete with a naturally occurring binding target for the binding
of a specific ligand. Similarly, a decoy RNA can be designed to
bind to a receptor and block the binding of an effector molecule,
or can be designed to bind to receptor of interest and prevent
interaction with the receptor. Decoy molecules of the invention can
be chemically modified, e.g. as described in the art.
[0058] The term "single stranded DNA" (ssDNA) as used herein refers
to a naturally occurring or synthetic deoxyribonucleic acid
molecule comprising a linear single strand, e.g., a ssDNA can be a
sense or antisense gene sequence or EST (Expressed Sequence
Tag).
[0059] The term "allozyme" as used herein refers to an allosteric
enzymatic nucleic acid molecule, including e.g., U.S. Pat. Nos.
5,834,186, 5,741,679, 5,589,332, 5,871,914, and PCT publication
Nos. WO 00/24931, WO 00/26226, WO 98/27104, and WO 99/29842.
[0060] The term "aptamer" as used herein is meant a polynucleotide
composition that binds specifically to a target molecule, wherein
the polynucleotide has a sequence that differs from a sequence
normally recognized by the target molecule in a cell. Alternately,
an aptamer can be a nucleic acid molecule that binds to a target
molecule where the target molecule does not naturally bind to a
nucleic acid. The target molecule can be any molecule of interest.
Aptamer molecules of the invention can be chemically modified, e.g.
as described in the art.
3.0 Lipids
3.1 Cationic Lipids
[0061] Cationic lipids suitable for use in the lipid composition
include, but are not limited to, N,N-dioleyl-N,N-dimethylammonium
chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide
(DDAB), N-(1-(2,3-dioleoyloxy)propyl)N,N,N-trimethylammonium
chloride (DOTAP),
N-(1-(2,3dioleyloxy)propyl)-N,N,N-trimethylammonium chloride
(DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA),
1,2-Dioleoyl-3-Dimethylammonium-propane (DODAP),
1,2-Dioleoylcarbamyl-3-Dimethylammoniumpropane (DOCDAP),
1,2-Dilineoyl-3-Dimethylammoniumpropane (DLINDAP),
Dioleoyloxy-N-[2-spenninecarboxamido)ethyl}-N,N-dimethyl-lpropanaminiumtr-
ifluoroacetate (DOSPA), Dioctadecylamidoglycyl spennine (DOGS),
DC-Chol, 1,2Dimyristyloxypropyl-3-dimethyl-hydroxyethyl ammonium
bromide (DMRIE),
3-Dimethylamino-2-(Cholest-5-en-3beta-oxybutan-4-oxy)-1-(cis,cis-9,12-oct-
adecadienoxy)propane (CLinDMA),
245'-(cholest-5-en-3.about.-oxy)-3'-oxapentoxy)-3-dimethyl-1-(cis,cis-9',-
12'-octadecadienoxy)propane (CpLinDMA),
N,N-Dimethyl-3,4-dioleyloxybenzylamine (DMOBA),
1,2-N,N-Dioleylcarbamyl-3-dimethylaminopropane (DOcarbDAP), and/or
mixtures thereof.
[0062] Other suitable cationic lipids are disclosed in U.S.
Provisional App. Ser. No. 61/918,927 which is incorporated by
reference herein in its entirety. A suitable lipid is a compound,
or salt thereof, of formula (I):
##STR00002##
[0063] wherein n and p are each, independently, 1 or 2; R.sup.1 is
heterocyclyl, heterocyclyl-C.sub.1-8-alkyl or
heterocyclyl-C.sub.1-8-alkoxyl, each of which may be optionally
substituted with 1, 2 or 3 groups, independently selected from
C.sub.1-8-alkyl, C.sub.3-7-cycloalkyl, heterocyclyl,
--[(C.sub.1-C.sub.4)alkylene].sub.v-N(R')R'',
--O--[(C.sub.1-C.sub.4)alkylene].sub.v-N(R')R'' or
--N(H)--[(C.sub.1-C.sub.4)alkylene].sub.v-N(R')R'', where said
(C.sub.1-C.sub.4)alkylene is optionally substituted with one or
more R groups; v is 0, 1, 2, 3 or 4; R is hydrogen or
--C.sub.1-8-alkyl or when v is 0, R is absent; R' and R'', are
each, independently, hydrogen, --C.sub.1-8-alkyl; or R' and R''
combine with the nitrogen to which they are bound, and optionally
including another heteroatom selected from N, O and S, to form a
5-8 membered heterocycle or heteroaryl, optionally substituted with
an --C.sub.1-8-alkyl, hydroxy or cycloalkyl-C.sub.1-8--; R.sup.2
and R.sup.3 are each, independently, C.sub.12-22 alkyl, C.sub.12-22
alkenyl,
##STR00003##
R.sup.4 is selected from hydrogen, C.sub.1-14 alkyl,
##STR00004##
[0064] Other cationic lipids include a compound, or salt thereof,
according to formula (II):
##STR00005##
[0065] Other suitable cationic lipids include those of formulas (I)
and (II) wherein R4 is hydrogen or where R4 is
##STR00006##
[0066] Other suitable cationic lipids include the foregoing lipids
where R' is selected from:
##STR00007## ##STR00008## ##STR00009##
[0067] Other suitable cationic lipids include the foregoing lipids
wherein R.sup.2 is selected from:
##STR00010##
[0068] Other suitable cationic lipids include the foregoing lipids
where R.sup.3 is selected from
##STR00011##
[0069] Other suitable lipids according to the foregoing lipids
include those where R.sup.2 and R.sup.3 are identical.
[0070] Specific cationic lipids include a compound is selected from
the group consisting of: [0071]
(9Z,9'Z,12Z,12'Z)-2-(((1,3-dimethylpyrrolidine-3-carbonyl)oxy)methyl)prop-
ane-1,3-diyl bis(octadeca-9,12-dienoate; [0072]
(9Z,9'Z,12Z,12'Z)-2-(((3-(4-methylpiperazin-1-yl)propanoyl)oxy)methyl)pro-
pane-1,3-diyl bis(octadeca-9,12-dienoate); [0073]
(9Z,9'Z,12Z,12'Z)-2-(((4-(pyrrolidin-1-yl)butanoyl)oxy)methyl)propane-1,3-
-diyl bis(octadeca-9,12-dienoate); [0074]
(9Z,9'Z,12Z,12'Z)-2-(((4-(piperidin-1-yl)butanoyl)oxy)methyl)propane-1,3--
diylbis(octadeca-9,12-dienoate); [0075]
(9Z,9'Z,12Z,12'Z)-2-(((3-(dimethylamino)propanoyl)oxy)
methyl)propane-1,3-diyl bis(octadeca-9,12-dienoate); [0076]
(9Z,9'Z,12Z,12'Z)-2-((2-(dimethylamino)acetoxy)methyl)propane-1,3-diyl
bis(octadeca-9,12-dienoate); [0077]
(9Z,9'Z,12Z,12'Z)-2-(((3-(diethylamino)propanoyl)oxy)methyl)
propane-1,3-diyl bis(octadeca-9,12-dienoate); [0078]
(9Z,9'Z,12Z,12'Z)-2-(((1,4-dimethylpiperidine-4-carbonyl)oxy)methyl)propa-
ne-1,3-diyl bis(octadeca-9,12-dienoate); [0079]
(9Z,9'Z,12Z,12'Z)-2-(((1-(cyclopropylmethyl)piperidine-4-carbonyl)oxy)met-
hyl)propane-1,3-diyl bis(octadeca-9,12-dienoate); [0080]
(9Z,9'Z,12Z,12'Z)-2-(((3-morpholinopropanoyl)oxy)methyl)propane-1,3-diylb-
is(octadeca-9,12-dienoate); [0081]
(9Z,9'Z,12Z,12'Z)-2-(((4-(dimethylamino)butanoyl)oxy)methyl)propane-1,3-d-
iyl bis(octadeca-9,12-dienoate); [0082]
2-(((1,3-dimethylpyrrolidine-3-carbonyl)oxy)methyl)propane-1,3-diyl
bis(8-(octanoyloxy)octanoate); [0083]
(9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy-
)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate; [0084]
(9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(dimethylamino)propox-
y)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate; [0085]
(9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-(((((1-ethylpiperidin-3-yl)-
methoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate; [0086]
2-((((2-(diethylamino)ethoxy)carbonyl)oxy)methyl)propane-1,3-diyl
bis(2-heptylundecanoate); [0087]
(9Z,12Z)-3-(((2-(diethylamino)ethoxy)carbonyl)oxy)-2-(((2-heptylundecanoy-
l)oxy)methyl)propyl octadeca-9,12-dienoate; [0088]
2-((((3-(dimethylamino)propoxy)carbonyl)oxy)methyl)propane-1,3-diyl
bis(2-heptylundecanoate); [0089]
(9Z,12Z)-3-(((3-(diethylamino)propoxy)carbonyl)oxy)-2-(((2-heptylundecano-
yl)oxy)methyl)propyl octadeca-9,12-dienoate; [0090]
(9Z,12Z)-3-(((2-(dimethylamino)ethoxy)carbonyl)oxy)-2-(((3-octylundecanoy-
l)oxy)methyl)propyl octadeca-9,12-dienoate; [0091]
2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propane-1,3-diyl
bis(3-octylundecanoate); [0092]
(9Z,12Z)-3-(((3-(diethylamino)propoxy)carbonyl)oxy)-2-(((3-octylundecanoy-
l)oxy)methyl)propyl octadeca-9,12-dienoate; [0093]
(9Z,12Z)-3-(((3-(diethylamino)propoxy)carbonyl)oxy)-2-(((9-pentyltetradec-
anoyl)oxy)methyl)propyl octadeca-9,12-dienoate; [0094]
(9Z,12Z)-3-(((3-(diethylamino)propoxy)carbonyl)oxy)-2-(((5-heptyldodecano-
yl)oxy)methyl)propyl octadeca-9,12-dienoate; [0095]
(9Z,12Z)-3-(2,2-bis(heptyloxy)acetoxy)-2-((((2-(dimethylamino)ethoxy)carb-
onyl)oxy)methyl)propyl octadeca-9,12-dienoate; and [0096]
(9Z,12Z)-3-((6,6-bis(octyloxy)hexanoyl)oxy)-2-((((3-(diethylamino)propoxy-
)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoat.
[0097] Other suitable cationic lipids are disclosed in U.S.
Provisional App. Ser. No. 61/918,941 which is incorporated by
reference herein in its entirety. A suitable lipid is a compound,
or salt thereof, of formula (III):
##STR00012##
Wherein n is 0, 1, 2, 3 or 4; p is 0, 1, 2, 3, 4, 5, 6, 7 or 8;
L.sub.1 is --O-- or a bond; L.sub.2 is --OC(O)-- or --C(O)O--;
R.sup.1 is selected from:
##STR00013##
v is 0, 1, 2, 3 or 4; w is 0, 1, 2, or 3; Cyl is 5-7 membered
nitrogen containing heterocycle optionally substituted with one or
two alkyl groups; R and R' are each, independently, hydrogen or
C.sub.1-8 alkyl; and R.sup.2 is selected from C.sub.6-20 alkyl
optionally substituted with a hydroxyl, C.sub.15-19 alkenyl,
C.sub.1-12alkyl-OC(O)--C.sub.5-20alkyl,
C.sub.1-12alkyl-C(O)O--O.sub.5-20alkyl and
##STR00014##
R.sup.3 is selected from: C.sub.4-22 alkyl, C.sub.12-22
alkenyl,
##STR00015## ##STR00016##
[0098] Other suitable cationic lipids include those of formula
(IV), or salt thereof:
##STR00017##
[0099] Other suitable cationic lipids include those of formula
(V):
##STR00018##
[0100] Other suitable cationic lipids include those of formulas
(III) to (V), wherein R.sup.2 is selected from:
##STR00019## ##STR00020##
[0101] Other suitable cationic lipids include those of formulas
(III) to (V), wherein R.sup.2 is:
##STR00021##
[0102] Other suitable cationic lipids include those of formulas
(III) to (V), wherein the compound is of formula (VI):
##STR00022##
[0103] Other suitable cationic lipids include those of formulas
(III) to (VI), wherein R.sup.3 is selected from:
##STR00023## ##STR00024## ##STR00025## ##STR00026##
##STR00027##
[0104] Other suitable cationic lipids include those of formulas
(III) to (VI), wherein R.sup.3 is
##STR00028##
[0105] Other suitable cationic lipids include those of formulas
(III) to (VI), wherein R.sup.3 is
##STR00029##
[0106] Other suitable cationic lipids include those of formulas
(III) to (VI), wherein the compound is of formula (VII):
##STR00030##
[0107] Other suitable cationic lipids include those of formulas
(III) to (VII), wherein the compound is of formula (VIII):
##STR00031##
[0108] Other suitable cationic lipids include those of formulas
(III) to (VIII), wherein the compound is of formula (IX):
##STR00032##
[0109] Other suitable cationic lipids include those of formulas
(III) to (IX), wherein IV is selected from:
##STR00033## ##STR00034##
[0110] Other suitable cationic lipids include those of formulas
(III) to (IX), wherein R.sup.1 is
##STR00035##
[0111] Other suitable cationic lipids include those of formulas
(III) to (IX), wherein R.sup.1 is
##STR00036##
[0112] Other suitable cationic lipids are selected from: [0113]
2-(10-dodecyl-3-ethyl-8,14-dioxo-7,9,13-trioxa-3-azaoctadecan-18-yl)propa-
ne-1,3-diyl dioctanoate; [0114]
2-(9-dodecyl-2-methyl-7,13-dioxo-6,8,12-trioxa-2-azaheptadecan-17-yl)prop-
ane-1,3-diyl dioctanoate; [0115]
2-(9-dodecyl-2-methyl-7,13-dioxo-6,8,12-trioxa-2-azapentadecan-15-yl)prop-
ane-1,3-diyl dioctanoate; [0116]
2-(10-dodecyl-3-ethyl-8,14-dioxo-7,9,13-trioxa-3-azahexadecan-16-yl)propa-
ne-1,3-diyl dioctanoate; [0117]
2-(8-dodecyl-2-methyl-6,12-dioxo-5,7,11-trioxa-2-azaheptadecan-17-yl)prop-
ane-1,3-diyl dioctanoate; [0118]
2-(10-dodecyl-3-ethyl-8,14-dioxo-7,9,13-trioxa-3-azanonadecan-19-yl)propa-
ne-1,3-diyl dioctanoate; [0119]
2-(9-dodecyl-2-methyl-7,13-dioxo-6,8,12-trioxa-2-azaoctadecan-18-yl)propa-
ne-1,3-diyl dioctanoate; [0120]
2-(8-dodecyl-2-methyl-6,12-dioxo-5,7,11-trioxa-2-azaoctadecan-18-yl)propa-
ne-1,3-diyl dioctanoate; [0121]
2-(10-dodecyl-3-ethyl-8,14-dioxo-7,9,13-trioxa-3-azaicosan-20-yl)propane--
1,3-diyl dioctanoate; [0122]
2-(9-dodecyl-2-methyl-7,13-dioxo-6,8,12-trioxa-2-azanonadecan-19-yl)propa-
ne-1,3-diyl dioctanoate; [0123]
3-(((3-(diethylamino)propoxy)carbonyl)oxy)pentadecyl
4,4-bis(octyloxy)butanoate; [0124]
3-(((3-(diethylamino)propoxy)carbonyl)oxy)pentadecyl
4,4-bis((2-ethylhexyl)oxy)butanoate; [0125]
3-(((3-(diethylamino)propoxy)carbonyl)oxy)pentadecyl
4,4-bis((2-propylpentyl)oxy)butanoate; [0126]
3-(((3-(ethyl(methyl)amino)propoxy)carbonyl)oxy)pentadecyl
4,4-bis((2-propylpentyl)oxy)butanoate; [0127]
3-(((3-(dimethylamino)propoxy)carbonyl)oxy)pentadecyl
4,4-bis((2-propylpentyl)oxy)butanoate; [0128]
3-(((3-(diethylamino)propoxy)carbonyl)oxy)pentadecyl
6,6-bis(octyloxy)hexanoate; [0129]
3-(((3-(diethylamino)propoxy)carbonyl)oxy)pentadecyl
6,6-bis(hexyloxy)hexanoate; [0130]
3-(((3-(diethylamino)propoxy)carbonyl)oxy)pentadecyl
6,6-bis((2-ethylhexyl)oxy)hexanoate; [0131]
3-(((3-(diethylamino)propoxy)carbonyl)oxy)pentadecyl
8,8-bis(hexyloxy)octanoate; [0132]
3-(((3-(diethylamino)propoxy)carbonyl)oxy)pentadecyl
8,8-dibutoxyoctanoate; [0133]
3-(((3-(diethylamino)propoxy)carbonyl)oxy)pentadecyl
8,8-bis((2-propylpentyl)oxy)octanoate; [0134]
3-(((3-(ethyl(methyl)amino)propoxy)carbonyl)oxy)pentadecyl
8,8-bis((2-propylpentyl)oxy)octanoate; [0135]
3-(((3-(dimethylamino)propoxy)carbonyl)oxy)pentadecyl
8,8-bis((2-propylpentyl)oxy)octanoate; [0136]
3-(((3-(dimethylamino)propoxy)carbonyl)oxy)pentadecyl
3-octylundecanoate; [0137]
3-(((3-(dimethylamino)propoxy)carbonyl)oxy)pentadecyl
3-octylundec-2-enoate; [0138]
3-(((3-(dimethylamino)propoxy)carbonyl)oxy)pentadecyl
7-hexyltridec-6-enoate; [0139]
3-(((3-(dimethylamino)propoxy)carbonyl)oxy)pentadecyl
9-pentyltetradecanoate; [0140]
3-(((3-(dimethylamino)propoxy)carbonyl)oxy)pentadecyl
9-pentyltetradec-8-enoate; [0141]
3-(((3-(dimethylamino)propoxy)carbonyl)oxy)pentadecyl
5-heptyldodecanoate; [0142]
3-(((3-(dimethylamino)propoxy)carbonyl)oxy)tridecyl
5-heptyldodecanoate; [0143]
3-(((3-(dimethylamino)propoxy)carbonyl)oxy)undecyl
5-heptyldodecanoate; [0144] 1,3-bis(octanoyloxy)propan-2-yl
(3-(((2-(dimethylamino)ethoxy)carbonyl)oxy)pentadecyl) succinate;
[0145] 1,3-bis(octanoyloxy)propan-2-yl
(3-(((3-(dimethylamino)propoxy)carbonyl)oxy)pentadecyl) succinate;
[0146] 1-(3(((3-(dimethylamino)propoxy)carbonyl)oxy)pentadecyl)
10-octyl decanedioate; [0147]
1-(3(((3-(diethylamino)propoxy)carbonyl)oxy)pentadecyl) 10-octyl
decanedioate; [0148]
1-(3(((3-(ethyl(methyl)amino)propoxy)carbonyl)oxy)pentadecyl)
10-octyl decanedioate; [0149]
1-(3-(((3-(diethylamino)propoxy)carbonyl)oxy)pentadecyl)
10-(2-ethylhexyl) decanedioate; [0150]
1-(3(((3-(ethyl(methyl)amino)propoxy)carbonyl)oxy)pentadecyl)
10-(2-ethylhexyl) decanedioate; [0151]
3-(((3-(dimethylamino)propoxy)carbonyl)oxy)pentadecyl
10-(octanoyloxy)decanoate; [0152]
8-dodecyl-2-methyl-6,12-dioxo-5,7,11-trioxa-2-azanonadecan-19-yl
decanoate; [0153]
3-(((3-(diethylamino)propoxy)carbonyl)oxy)pentadecyl
10-(octanoyloxy)decanoate; [0154]
3-(((3-(ethyl(methyl)amino)propoxy)carbonyl)oxy)pentadecyl
10-(octanoyloxy)decanoate; [0155]
(9Z,12Z)-3-(((3-(dimethylamino)propoxy)carbonyl)oxy)pentadecyl
octadeca-9,12-dienoate; [0156]
(9Z,12Z)-3-(((3-(diethylamino)propoxy)carbonyl)oxy)pentadecyl
octadeca-9,12-dienoate; [0157]
(9Z,12Z)-3-(((3-(ethyl(methyl)amino)propoxy)carbonyl)oxy)pentadecyl
octadeca-9,12-dienoate; [0158]
(9Z,12Z)-3(((2-(dimethylamino)ethoxy)carbonyl)oxy)pentadecyl
octadeca-9,12-dienoate; [0159]
1-((9Z,12Z)-octadeca-9,12-dienoyloxy)pentadecan-3-yl
1,4-dimethylpiperidine-4-carboxylate; [0160]
2-(((3-(diethylamino)propoxy)carbonyl)oxy)tetradecyl
4,4-bis((2-ethylhexyl)oxy)butanoate; [0161]
(9Z,12Z)-(12Z,15Z)-3-((3-(dimethylamino)propanoyl)oxy)henicosa-12,15-dien-
-1-yl octadeca-9,12-dienoate; [0162]
(12Z,15Z)-3-((4-(dimethylamino)butanoyl)oxy)henicosa-12,15-dien-1-yl
3-octylundecanoate; [0163]
(12Z,15Z)-3-((4-(dimethylamino)butanoyl)oxy)henicosa-12,15-dien-1-yl
5-heptyldodecanoate; [0164]
(12Z,15Z)-3-((4-(dimethylamino)butanoyl)oxy)henicosa-12,15-dien-1-yl
7-hexyltridecanoate; [0165]
(12Z,15Z)-3-((4-(dimethylamino)butanoyl)oxy)henicosa-12,15-dien-1-yl
9-pentyltetradecanoate; [0166]
(12Z,15Z)-1-((((9Z,12Z)-octadeca-9,12-dien-1-yloxy)carbonyl)oxy)henicosa--
12,15-dien-3-yl 3-(dimethylamino)propanoate; [0167]
(13Z,16Z)-4-(((2-(dimethylamino)ethoxy)carbonyl)oxy)docosa-13,16-dien-1-y-
l 2,2-bis(heptyloxy)acetate; [0168]
(13Z,16Z)-4-(((3-(diethylamino)propoxy)carbonyl)oxy)docosa-13,16-dien-1-y-
l 2,2-bis(heptyloxy)acetate; [0169] 2,2-bis(heptyloxy)ethyl
3-((3-ethyl-10-((9Z,12Z)-octadeca-9,12-dien-1-yl)-8,15-dioxo-7,9,14-triox-
a-3-azaheptadecan-17-yl)disulfanyl)propanoate; [0170]
(13Z,16Z)-4-(((3-(dimethylamino)propoxy)carbonyl)oxy)docosa-13,16-dien-1--
yl heptadecan-9-yl succinate; [0171]
(9Z,12Z)-2-(((11Z,14Z)-2-((3-(dimethylamino)propanoyl)oxy)icosa-11,14-die-
n-1-yl)oxy)ethyl octadeca-9,12-dienoate; [0172]
(9Z,12Z)-3-(((3-(dimethylamino)propoxy)carbonyl)oxy)-13-(octanoyloxy)trid-
ecyl octadeca-9,12-dienoate; [0173]
3-(((3-(dimethylamino)propoxy)carbonyl)oxy)-13-(octanoyloxy)tridecyl
3-octylundecanoate; [0174]
3-(((3-(dimethylamino)propoxy)carbonyl)oxy)-13-hydroxytridecyl
5-heptyldodecanoate; [0175]
3-(((3-(dimethylamino)propoxy)carbonyl)oxy)-13-(octanoyloxy)tridecyl
5-heptyldodecanoate; [0176]
3-(((3-(dimethylamino)propoxy)carbonyl)oxy)-13-(octanoyloxy)tridecyl
7-hexyltridecanoate; [0177]
3-(((3-(dimethylamino)propoxy)carbonyl)oxy)-13-hydroxytridecyl
9-pentyltetradecanoate; [0178]
3-(((3-(dimethylamino)propoxy)carbonyl)oxy)-13-(octanoyloxy)tridecyl
9-pentyltetradecanoate; [0179]
1-(3-(((3-(dimethylamino)propoxy)carbonyl)oxy)-13-(octanoyloxy)tridecyl)
10-octyl decanedioate; [0180]
3-(((3-(dimethylamino)propoxy)carbonyl)oxy)-13-(octanoyloxy)tridecyl
10-(octanoyloxy)decanoate; [0181]
(9Z,12Z)-3-((3-(dimethylamino)propoxy)carbonyl)oxy)-5-octyltridecyl
octadeca-9,12-dienoate; [0182]
3(((3-(dimethylamino)propoxy)carbonyl)oxy)-5-octyltridecyl
decanoate; [0183]
5(((3-(dimethylamino)propoxy)carbonyl)oxy)-7-octylpentadecyl
octanoate; [0184]
(9Z,12Z)-54(3-(dimethylamino)propoxy)carbonyl)oxy)-7-octylpentadecyl
octadeca-9,12-dienoate; [0185]
9(((3-(dimethylamino)propoxy)carbonyl)oxy)-11-octylnonadecyl
octanoate; [0186]
9(((3-(dimethylamino)propoxy)carbonyl)oxy)-11-octylnonadecyl
decanoate; [0187]
(9Z,12Z)-9(((3-(dimethylamino)propoxy)carbonyl)oxy)nonadecyl
octadeca-9,12-dienoate; [0188]
9(((3-(dimethylamino)propoxy)carbonyl)oxy)nonadecyl hexanoate;
[0189] 9-(((3-(dimethylamino)propoxy)carbonyl)oxy)nonadecyl
3-octylundecanoate; [0190]
9-((4-(dimethylamino)butanoyl)oxy)nonadecyl hexanoate; [0191]
9((4-(dimethylamino)butanoyl)oxy)nonadecyl 3-octylundecanoate;
[0192]
(9Z,9'Z,12Z,12'Z)-2-(((4-(((3-(dimethylamino)propoxy)carbonyl)oxy)hexadec-
anoyl)oxy)propane-1,3-diyl bis(octadeca-9,12-dienoate); [0193]
(9Z,9'Z,12Z,12'Z)-2-(((4-(((3-(diethylamino)propoxy)carbonyl)oxy)hexadeca-
noyl)oxy)propane-1,3-diyl bis(octadeca-9,12-dienoate); [0194]
(9Z,9'Z,12Z,12Z,15Z,15'Z)-2-(((4-(((3-(dimethylamino)propoxy)carbonyl)oxy-
) hexadecanoyl)oxy)propane-1,3-diyl
bis(octadeca-9,12,15-trienoate); [0195]
(Z)-2-(((4-(((3-(dimethylamino)propoxy)carbonyl)oxy)hexadecanoyl)o-
xy)propane-1,3-diyl dioleate; [0196]
2-((4-(((3-(diethylamino)propoxy)carbonyl)oxy)hexadecanoyl)oxy)propane-1,-
3-diyl ditetradecanoate; [0197]
2-((4-(((3-(dimethylamino)propoxy)carbonyl)oxy)hexadecanoyl)oxy)propane-1-
,3-diyl ditetradecanoate; [0198]
2-((4-(((3-(ethyhmethyl)amino)propoxy)carbonyl)oxy)hexadecanoyl)oxy)propa-
ne-1,3-diyl ditetradecanoate; [0199]
2-((4-(((3-(dimethylamino)propoxy)carbonyl)oxy)hexadecanoyl)oxy)propane-1-
,3-diyl didodecanoate; [0200]
2-((4-(((3-(diethylamino)propoxy)carbonyl)oxy)hexadecanoyl)oxy)propane-1,-
3-diyl didodecanoate; [0201]
2-((4-(((3-(ethyhmethyl)amino)propoxy)carbonyl)oxy)hexadecanoyl)oxy)propa-
ne-1,3-diyl didodecanoate; [0202]
2-((4-(((3-(diethylamino)propoxy)carbonyl)oxy)hexadecanoyl)oxy)propane-1,-
3-diyl bis(decanoate); [0203]
2-((4-(((3-(ethyl(methyl)amino)propoxy)carbonyl)oxy)hexadecanoyl)oxy)prop-
ane-1,3-diyl bis(decanoate); [0204]
2-((4-(((3-(diethylamino)propoxy)carbonyl)oxy)hexadecanoyl)oxy)propane-1,-
3-diyl dioctanoate; [0205]
2-((4-(((3-(ethyl(methyl)amino)propoxy)carbonyl)oxy)hexadecanoyl)oxy)prop-
ane-1,3-diyl dioctanoate; [0206]
2-(((13Z,16Z)-4-(((3-(dimethylamino)propoxy)carbonyl)oxy)docosa-13,16-die-
noyl)oxy)propane-1,3-diyl dioctanoate; [0207]
2-(((13Z,16Z)-4-(((3-(diethylamino)propoxy)carbonyl)oxy)docosa-13,16-dien-
oyl)oxy)propane-1,3-diyl dioctanoate; [0208]
(9Z,9'Z,12Z,12'Z)-2-(((2-(((3-(diethylamino)propoxy)carbonyl)oxy)tetradec-
anoyl)oxy)propane-1,3-diyl bis(octadeca-9,12-dienoate); [0209]
(9Z,9'Z,12Z,12'Z)-2-(((2-(((3-(dimethylamino)propoxy)carbonyl)oxy)dodecan-
oyl)oxy)propane-1,3-diyl bis(octadeca-9,12-dienoate); [0210]
(9Z,9'Z,12Z,12'Z)-2-(((2-(((3-(dimethylamino)propoxy)carbonyl)oxy)tetrade-
canoyl)oxy)propane-1,3-diyl bis(octadeca-9,12-dienoate); [0211]
(9Z,9'Z,12Z,12'Z)-2-(((2-(((3-(diethylamino)propoxy)carbonyl)oxy)dodecano-
yl)oxy)propane-1,3-diyl bis(octadeca-9,12-dienoate); [0212]
2-((2-(((3-(diethylamino)propoxy)carbonyl)oxy)tetradecanoyl)oxy)propane-1-
,3-diyl dioctanoate; [0213] 4,4-bis(octyloxy)butyl
4-(((3-(dimethylamino)propoxy)carbonyl)oxy)hexadecanoate; [0214]
4,4-bis(octyloxy)butyl
2-(((3-(diethylamino)propoxy)carbonyl)oxy)dodecanoate; [0215]
(9Z,12Z)-10-dodecyl-3-ethyl-14-(24(9Z,12Z)-octadeca-9,12-dienoyloxy)ethyl-
)-8,13-dioxo-7,9-dioxa-3,14-diazahexadecan-16-yl
octadeca-9,12-dienoate; [0216]
2-((4-(((3-(diethylamino)propoxy)carbonyl)oxy)-11-(octanoyloxy)und-
ecanoyl)oxy)propane-1,3-diyl dioctanoate; and [0217]
(9Z,9'Z,12Z,12'Z)-2-(9-dodecyl-2-methyl-7,12-dioxo-6,8,13-trioxa-2-azatet-
radecan-14-yl)propane-1,3-diyl bis(octadeca-9,12-dienoate).
[0218] As used herein, the term "alkyl" refers to a fully saturated
branched or unbranched hydrocarbon chain having the specified
number of carbon atoms. For example, C.sub.1-8 alkyl refers to an
alkyl group having from 1 to 8 carbon atoms. For example,
C.sub.4-22 alkyl refers to an alkyl group having from 4 to 22
carbon atoms. For example, C.sub.6-10 alkyl refers to an alkyl
group having from 6 to 10 carbon atoms. For example, C.sub.12-22
alkyl refers to an alkyl group having from 12 to 22 carbon atoms.
Representative examples of alkyl include, but are not limited to,
methyl, ethyl, n-propyl, iso-propyl, n-butyl, sec-butyl, iso-butyl,
tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, 3-methylhexyl,
2,2-dimethylpentyl, 2,3-dimethylpentyl, n-heptyl, n-octyl, n-nonyl,
n-decyl, n-undecanyl, n-dodecanyl, n-tridecanyl,
9-methylheptadecanyl, 1-heptyldecyl, 2-octyldecyl, 6-hexyldodecyl,
4-heptylundecyl, and the like.
[0219] As used herein, the term "alkylene" refers to divalent alkyl
group as defined herein above. Representative examples of alkylene
include, but are not limited to, methylene, ethylene, n-propylene,
iso-propylene, n-butylene, sec-butylene, iso-butylene,
tert-butylene, n-pentylene, isopentylene, neopentylene, n-hexylene,
3-methylhexylene, 2,2-dimethylpentylene, 2,3-dimethylpentylene,
n-heptylene, n-octylene, n-nonylene, n-decylene, and the like.
[0220] As used herein, the term "alkenyl" refers to an unsaturated
branched or unbranched hydrocarbon chain having the specified
number of carbon atoms and one or more carbon-carbon double bonds
within the chain. For example, C.sub.12-22 alkenyl refers to an
alkenyl group having 12 to 22 carbon atoms with one or more
carbon-carbon double bonds within the chain. In certain embodiments
alkenyl groups have one carbon-carbon double bond within the chain.
In other embodiments, alkenyl groups have more than one
carbon-carbon double bond within the chain. Alkyenyl groups may be
optionally substituted with one or more substituents as defined in
formulas (I) or (III). Representative examples of alkenyl include,
but are not limited to, ethylenyl, propenyl, butenyl, pentenyl,
hexenyl and the like. Other examples of alkenyl include, but are
not limited to: Z-octadec-9-enyl, Z-undec-7-enyl,
Z-heptadeca-8-enyl, (9Z,12Z)-octadeca-9,12-dienyl,
(8Z,11Z)-heptadeca-8,11-dienyl, (8Z, 11Z,
14Z)-heptadeca-8,11,14-trienyl, linolenyl, 2-octyldeca-1-enyl,
linoleyl and olelyl.
[0221] As used herein, the term "alkenylene" refers a divalent
alkenyl group as defined herein above. Representative examples of
alkenylene include, but are not limited to, ethenylene,
propenylene, butenylene, pentenylene, hexenylene and the like.
[0222] As used herein, the term "alkoxy" refers to refers to any
alkyl moiety attached through an oxygen bridge (i.e. a
--O--C.sub.1-3 alkyl group wherein C.sub.1-3 alkyl is as defined
herein). Examples of such groups include, but are not limited to,
methoxy, ethoxy, and propoxy.
[0223] As used herein, the term "cycloalkyl" refers to a saturated
monocyclic, bicyclic or tricyclic hydrocarbon ring having the
specified number of carbon atoms. For example, C.sub.3-7 cycloalkyl
refers to a cycloalkyl ring having from 3 to 7 carbon atoms.
Cycloalkyl groups may be optionally substituted with one or more
substituents as defined in formula (I). Representative examples of
cycloalkyl include, but are not limited to, cyclopropyl,
cyclobutyl, cyclopentyl, cyclohexyl, bicyclo[2.1.1]hexyl,
bicyclo[2.2.1]heptyl, adamantyl and the like.
[0224] As used herein, the term "halo" refers to fluoro, chloro,
bromo, and iodo.
[0225] As used herein, the term "heterocyclic" refers to a 4 to 12
membered saturated or unsaturated monocyclic or bicyclic ring
containing from 1 to 4 heteroatoms. Heterocyclic ring systems are
not aromatic. Heterocyclic groups containing more than one
heteroatom may contain different heteroatoms. Heterocyclic groups
are monocyclic, spiro, or fused or bridged bicyclic ring systems.
Examples of monocyclic heterocyclic groups include
tetrahydrofuranyl, dihydrofuranyl, 1,4-dioxanyl, morpholinyl,
1,4-dithianyl, azetidinyl, piperazinyl, piperidinyl,
1,3-dioxolanyl, imidazolidinyl, imidazolinyl, pyrrolinyl,
pyrrolidinyl, tetrahydropyranyl, dihydropyranyl,
1,2,3,6-tetrahydropyridinyl, oxathiolanyl, dithiolanyl,
1,3-dioxanyl, 1,3-dithianyl, oxathianyl, thiomorpholinyl,
1,4,7-trioxa-10-azacyclododecanyl, azapanyl and the like. Examples
of spiro heterocyclic rings include, but are not limited to,
1,5-dioxa-9-azaspiro[5.5]undecanyl,
1,4-dioxa-8-azaspiro[4.5]decanyl, 2-oxa-7-azaspiro[3.5]nonanyl, and
the like. Fused heterocyclic ring systems have from 8 to 11 ring
atoms and include groups wherein a heterocyclic ring is fused to a
phenyl ring. Examples of fused heterocyclic rings include, but are
not limited to decahydroqunilinyl,
(4aS,8aR)-decahydroisoquinolinyl, (4aS,8aS)-decahydroisoquinolinyl,
octahydrocyclopenta[c]pyrrolyl, isoinolinyl,
(3aR,7aS)-hexahydro-[1,3]dioxolo[4.5-c]pyridinyl,
octahydro-1H-pyrrolo[3,4-b]pyridinyl, tetrahydroisoquinolinyl and
the like.
[0226] As used herein, the term "heterocyclylC.sub.1-8alkyl" refers
to a heterocyclic ring as defined above which is attached to the
rest of the molecule by a single bond or by a C.sub.1-8alkyl
radical as defined above.
[0227] As used herein, the term "heteroaryl" refers to a 5- or
6-membered aromatic monocyclic ring radical which comprises 1, 2, 3
or 4 heteroatoms individually selected from nitrogen, oxygen and
sulfur. The heteroaryl radical may be bonded via a carbon atom or
heteroatom. Examples of heteroaryl include, but are not limited to,
furyl, pyrrolyl, thienyl, pyrazolyl, imidazolyl, thiazolyl,
isothiazolyl, oxazolyl, isoxazolyl, triazolyl, tetrazolyl,
pyrazinyl, pyridazinyl, pyrimidyl or pyridyl.
[0228] As used herein, the term "heteroarylC.sub.1-8alkyl" refers
to a heteroaryl ring as defined above which is attached to the rest
of the molecule by a single bond or by a C.sub.1-8alkyl radical as
defined above.
3.2 Neutral Lipids
[0229] Neutral lipids suitable for use in a lipid composition of
the invention include, for example, a variety of neutral, uncharged
or zwitterionic lipids. Examples of neutral phospholipids suitable
for use in the present invention include, but are not limited to:
5-heptadecylbenzene-1,3-diol (resorcinol),
dipalmitoylphosphatidylcholine (DPPC),
distearoylphosphatidylcholine (DSPC), phosphocholine (DOPC),
dimyristoylphosphatidylcholine (DMPC), phosphatidylcholine (PLPC),
1,2-distearoyl-sn-glycero-3-phosphocholine (DAPC),
phosphatidylethanolamine (PE), egg phosphatidylcholine (EPC),
dilauryloylphosphatidylcholine (DLPC),
dimyristoylphosphatidylcholine (DMPC), 1-myristoyl-2-palmitoyl
phosphatidylcholine (MPPC), 1-palmitoyl-2-myristoyl
phosphatidylcholine (PMPC), 1-palmitoyl-2-stearoyl
phosphatidylcholine (PSPC),
1,2-diarachidoyl-sn-glycero-3-phosphocholine (DBPC),
1-stearoyl-2-palmitoyl phosphatidylcholine (SPPC),
1,2-dieicosenoyl-sn-glycero-3-phosphocholine (DEPC),
palmitoyloleoyl phosphatidylcholine (POPC), lysophosphatidyl
choline, dioleoyl phosphatidylethanolamine (DOPE),
dilinoleoylphosphatidylcholine di stearoylphophatidylethanolamine
(DSPE), dimyristoyl phosphatidylethanolamine (DMPE), dipalmitoyl
phosphatidylethanolamine (DPPE), palmitoyloleoyl
phosphatidylethanolamine (POPE), lysophosphatidylethanolamine and
combinations thereof. In one embodiment, the neutral phospholipid
is selected from the group consisting of
distearoylphosphatidylcholine (DSPC) and dimyristoyl phosphatidyl
ethanolamine (DMPE).
3.3 Anionic Lipids
[0230] Anionic lipids suitable for use in the present invention
include, but are not limited to, phosphatidylglycerol, cardiolipin,
diacylphosphatidylserine, diacylphosphatidic acid, N-dodecanoyl
phosphatidyl ethanoloamine, N-succinyl phosphatidylethanolamine,
N-glutaryl phosphatidylethanolamine cholesterol hemisuccinate
(CHEMS), and lysylphosphatidylglycerol.
3.4 Helper Lipids
[0231] Helper lipids are lipids that enhance transfection (e.g.
transfection of the nanoparticle including the biologically active
agent) to some extent. The mechanism by which the helper lipid
enhances transfection may include, e.g., enhancing particle
stability and/or enhancing membrane fusogenicity. Helper lipids
include steroids and alkyl resorcinols. Helper lipids suitable for
use in the present invention include, but are not limited to,
cholesterol, 5-heptadecylresorcinol, and cholesterol
hemisuccinate.
3.4 Stealth Lipids
[0232] Stealth lipids are lipids that increase the length of time
for which the nanoparticles can exist in vivo (e.g. in the blood).
Stealth lipids suitable for use in a lipid composition of the
invention include, but are not limited to, stealth lipids having a
hydrophilic head group linked to a lipid moiety. Examples of such
stealth lipids include compounds of formula (XI), as described in
WO2011/076807
##STR00037##
or a salt or pharmaceutically acceptable derivative thereof,
wherein: Z is a hydrophilic head group component selected from PEG
and polymers based on poly(oxazoline), poly(ethyleneoxide),
poly(vinyl alcohol), poly(glycerol), poly(N-vinylpyrro-lidone),
poly[N-(2-hydroxypropyl)methacrylamide], polysaccharides and
poly(amino acid)s, wherein the polymer may be linear or branched,
and wherein the polymer may be optionally substituted; wherein Z is
polymerized by n subunits; n is a number-averaged degree of
polymerization between 10 and 200 units of Z, wherein n is
optimized for different polymer types; L.sub.1 is an optionally
substituted C.sub.1-10 alkylene or C.sub.1-10 heteroalkylene linker
including zero, one, two or more of an ether (e.g., --O--), ester
(e.g., --C(O)O--), succinate (e.g.,
--O(O)C--CH.sub.2--CH.sub.2--C(O)O--)), carbamate (e.g.,
--OC(O)--NR'--), carbonate (e.g., --OC(O)O--), ketone (e.g.,
--C--C(O)--C--), carbonyl (e.g., --C(O)--), urea (e.g.,
--NRC(O)NR'--), amine (e.g., --NR'--), amide (e.g., --C(O)NR'--),
imine (e.g., --C(NR')--), thioether (e.g., --S--), xanthate (e.g.,
--OC(S)S--), and phosphodiester (e.g., --OP(O).sub.2O--); any of
which may be substituted by zero, one or more Z groups; wherein R'
is independently selected from --H, --NH--, --NH.sub.2, --O--,
--S--, a phosphate or an optionally substituted C.sub.1-10
alkylene; X.sub.1 and X.sub.2 are independently selected from a
carbon or a heteroatom selected from --NH--, --O--, --S-- or a
phosphate; A.sub.1 and A.sub.2 are independently selected from a
C.sub.6-30 alkyl, C.sub.6-30 alkenyl, and C.sub.6-30 alkynyl,
wherein A.sub.1 and A.sub.2 may be the same or different, or
wherein A.sub.1 and A.sub.2 together with the carbon atom to which
they are attached form an optionally substituted steroid.
[0233] Specific stealth lipids include, but are not limited to,
those listed in Table 1.
TABLE-US-00001 TABLE 1 Stealth Lipids Stealth Lipid Lipid S001
##STR00038## S002 ##STR00039## S003 ##STR00040## S004 ##STR00041##
S005 ##STR00042## S006 ##STR00043## S007 ##STR00044## S008
##STR00045## S009 ##STR00046## S010 ##STR00047## S011 ##STR00048##
S012 ##STR00049## S013 ##STR00050## S014 ##STR00051## S015
##STR00052## S016 ##STR00053## S017 ##STR00054## S018 ##STR00055##
S019 ##STR00056## S020 ##STR00057## S021 ##STR00058## S022
##STR00059## S023 ##STR00060## S024 ##STR00061## S025 ##STR00062##
S026 ##STR00063## S027 ##STR00064## S028 ##STR00065## S029
##STR00066## S030 ##STR00067## S031 ##STR00068## S032 ##STR00069##
S033 ##STR00070##
[0234] Other stealth lipids suitable for use in a lipid composition
of the present invention and information about the biochemistry of
such lipids can be found in Romberg et al., Pharmaceutical
Research, Vol. 25, No. 1, 2008, p. 55-71 and Hoekstra et al.,
Biochimica et Biophysica Acta 1660 (2004) 41-52.
[0235] In one embodiment, the suitable stealth lipid comprises a
group selected from PEG (sometimes referred to as poly(ethylene
oxide) and polymers based on poly(oxazoline), poly(vinyl alcohol),
poly(glycerol), poly(N-vinylpyrrolidone), polyaminoacids and
poly[N-(2-hydroxypropyl) methacrylamide]. Additional suitable PEG
lipids are disclosed, e.g., in WO 2006/007712.
[0236] Specific suitable stealth lipids include
polyethyleneglycol-diacylglycerol or
polyethyleneglycol-diacylglycamide (PEG-DAG) conjugates including
those comprising a dialkylglycerol or dialkylglycamide group having
alkyl chain length independently comprising from about C.sub.4 to
about C.sub.40 saturated or unsaturated carbon atoms. The
dialkylglycerol or dialkylglycamide group can further comprise one
or more substituted alkyl groups. In any of the embodiments
described herein, the PEG conjugate can be selected from
PEG-dilaurylglycerol, PEG-dimyristylglycerol (PEG-DMG) (catalog #
GM-020 from NOF, Tokyo, Japan), PEG-dipalmitoylglycerol,
PEG-disterylglycerol, PEG-dilaurylglycamide,
PEG-dimyristylglycamide, PEG-dipalmitoylglycamide, and PEG-di
sterylglycamide, PEG-cholesterol (1-[8'-(Cholest-5-en-3
[beta]-oxy)carboxamido-3',6'-dioxaoctanyl]carbamoyl-[omega]-methyl-poly(e-
thylene glycol), PEG-DMB
(3,4-Ditetradecoxylbenzy-[omega]-methyl-poly(ethylene glycol)
ether),
1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene
glycol)-2000] (catalog #880150P from Avanti Polar Lipids,
Alabaster, Ala., USA).
[0237] In one embodiment the stealth lipid is 5010, 5024, 5027,
5031, or S033.
[0238] In another embodiment the stealth lipid is 5024.
[0239] Unless otherwise indicated, the term "PEG" as used herein
means any polyethylene glycol or other polyalkylene ether polymer.
In one embodiment, PEG is an optionally substituted linear or
branched polymer of ethylene glycol or ethylene oxide. In one
embodiment PEG is unsubstituted. In one embodiment the PEG is
substituted, e.g., by one or more alkyl, alkoxy, acyl, hydroxy or
aryl groups. In one embodiment, the term includes PEG copolymers
such as PEG-polyurethane or PEG-polypropylene (see, e.g., J. Milton
Harris, Poly(ethylene glycol) chemistry: biotechnical and
biomedical applications (1992)); in another embodiment, the term
does not include PEG copolymers. In one embodiment, the PEG has a
molecular weight of from about 130 to about 50,000, in a
sub-embodiment about 150 to about 30,000, in a sub-embodiment about
150 to about 20,000, in a sub-embodiment about 150 to about 15,000,
in a sub-embodiment about 150 to about 10,000, in a sub-embodiment
about 150 to about 6000, in a sub-embodiment about 150 to about
5000, in a sub-embodiment about 150 to about 4000, in a
sub-embodiment about 150 to about 3000, in a sub-embodiment about
300 to about 3000, in a sub-embodiment about 1000 to about 3000,
and in a sub-embodiment about 1500 to about 2500.
[0240] In certain embodiments the PEG is a "PEG-2K", also termed
"PEG 2000", which has an average molecular weight of about 2000
daltons. PEG-2K is represented herein by the following formula
(XIIa), wherein n is 45, meaning that the number-averaged degree of
polymerization comprises about 45 subunits. However, other PEG
embodiments known in the art may be used, including, e.g., those
where the number-averaged degree of polymerization comprises about
23 subunits (n=23) and/or 68 subunits (n=68).
##STR00071##
[0241] Preferred compounds of formulas (I)-(IX) for use in the
processes of the invention are Examples 1-36 below.
4.0 Encapsulated Nucleic Acid Nanoparticles
[0242] By "lipid nanoparticle" is meant a particle that comprises a
plurality of (i.e. more than one) lipid molecules physically
associated with each other by intermolecular forces. The lipid
nanoparticles may be, e.g., microspheres (including unilamellar and
multilamellar vesicles, e.g. liposomes), a dispersed phase in an
emulsion, micelles or an internal phase in a suspension.
[0243] The term "lipid nanoparticle host" refers to a plurality of
lipid molecules physically associated with each other by
intermolecular forces/electrostatic interactions to encapsulate one
or more nucleic acid molecules, such as an siRNA.
[0244] Certain embodiments provide an encapsulated nucleic acid
nanoparticle composition comprising a pharmaceutically acceptable
carrier and an encapsulated nucleic acid nanoparticle. The
encapsulated nucleic acid nanoparticle includes a lipid
nanoparticle host and a nucleic acid that is encapsulated in the
lipid nanoparticle host. The term "pharmaceutically acceptable
carrier" as used herein, means a non-toxic, inert diluent.
Materials which can serve as pharmaceutically acceptable carriers
include, but are not limited to, pyrogen-free water, deionized
water, isotonic saline, Ringer's solution, and phosphate buffer
solutions. In preferred embodiments, the encapsulated nucleic acid
nanoparticle has an average size of about 40 to about 70 nm and a
polydispersity index of less than about 0.1 as determined by
dynamic light scattering, e.g., using a Malvern Zetasizer Nano ZS.
The lipid nanoparticle host comprises a degradable cationic lipid,
a lipidated polyethylene glycol, cholesterol, and
1,2-distearoyl-sn-glycero-3-phosphocholine components as described
elsewhere herein.
[0245] Embodiments of the present invention provide methods of
preparing an encapsulated nucleic acid nanoparticle composition
comprising a cationic lipid and another lipid component. Another
embodiment provides a method using a cationic lipid and a helper
lipid, for example cholesterol. Another embodiment provides for a
method using a cationic lipid, a helper lipid, for example
cholesterol, and a neutral lipid, for example DSPC. Another
embodiment of the present invention provides a method using a
cationic lipid, a helper lipid, for example cholesterol, a neutral
lipid, for example DSPC, and a stealth lipid, for example S010,
S024, S027, S031, or S033. Another embodiment of the present
invention provides for a method of encapsulating a nucleic acid in
a lipid nanoparticle host where the nanoparticle comprises a
cationic lipid, a helper lipid, for example cholesterol, a neutral
lipid, for example DSPC, a stealth lipid, for example S010, S024,
S027, S031, or S033, and the nucleic acid is, for example a RNA or
DNA. Another embodiment of the present invention provides a method
of using a cationic lipid, a helper lipid, for example cholesterol,
a neutral lipid, for example DSPC, and a stealth lipid, for example
S010, S024, S027, S031, or S033, where the nucleic acid is, for
example, mRNA, siRNA or DNA.
[0246] In some embodiments of the invention, the lipid
solution/stream(s) contain a cationic lipid compound, a helper
lipid (cholesterol), an optional neutral lipid (DSPC) and a stealth
lipid (e.g., S010, S024, S027, or S031). Where a formulation
contains four lipid components, the molar ratios of the lipids may
range from 20 to 70 mole percent for the cationic lipid with a
target of 40-60, the mole percent of helper lipid ranges from 20 to
70 with a target of 30 to 50, the mole percent of neutral lipid
ranges from 0-30, the mole percent of PEG lipid has a range from 1
to 6 with a target of 2 to 5.
[0247] In some embodiments, the lipid solution/stream(s) contain
30-60% of a compound of formula (III), 30-60% cholesterol/5-10%
DSPC, and 1-5% PEG-DMG, S010, S011 or S024.
[0248] Another embodiment of the present invention provides a
method of encapsulating a nucleic acid in a lipid nanoparticle host
using a cationic lipid and a helper lipid, for example cholesterol,
in a lipid molar ratio of about 40-55 cationic lipid/about 40-55
helper lipid. Another embodiment provides a method using a cationic
lipid, a helper lipid, for example cholesterol, and a neutral
lipid, for example DSPC in a lipid molar ratio of about 40-55 a
cationic lipid/about 40-55 helper lipid/about 5-15 neutral lipid.
Another embodiment provides a method using a cationic lipid, a
helper lipid, for example cholesterol, a neutral lipid, for example
DSPC, and a stealth lipid, for example S010, S024, S027, S031, or
S033 in a lipid molar ratio of about 40-55 cationic lipid/about
40-55 helper lipid/about 5-15 neutral lipid/about 1-10 stealth
lipid.
[0249] Another embodiment of the present invention provides a
method of encapsulating a nucleic acid in a lipid nanoparticle host
using a cationic lipid and a helper lipid, for example cholesterol,
in a lipid molar ratio of about 40-50 cationic lipid/about 40-50
helper lipid. Another embodiment provides a method using a cationic
lipid, a helper lipid, for example cholesterol, and a neutral
lipid, for example DSPC in a lipid molar ratio of about 40-50
cationic lipid/about 40-50 helper lipid/about 5-15 neutral lipid.
Another embodiment provides a method using a cationic lipid, a
helper lipid, for example cholesterol, a neutral lipid, for example
DSPC, and a stealth lipid, for example S010, 5024, 5027, 5031, or
5033 in a lipid molar ratio of about 40-50 cationic lipid/about
40-50 helper lipid/about 5-15 neutral lipid/about 1-5 stealth
lipid.
[0250] Another embodiment of the present invention provides a
method of encapsulating a nucleic acid in a lipid nanoparticle host
using a cationic lipid and a helper lipid, for example cholesterol,
in a lipid molar ratio of about 43-47 cationic lipid/about 43-47
helper lipid. Another embodiment provides a method using a cationic
lipid, a helper lipid, for example cholesterol, and a neutral
lipid, for example DSPC in a lipid molar ratio of about 43-47
cationic lipid/about 43-47 helper lipid/about 7-12 neutral lipid.
Another embodiment provides a method using a cationic lipid, a
helper lipid, for example cholesterol, a neutral lipid, for example
DSPC, and a stealth lipid, for example S010, 5024, 5027, 5031, or
5033 in a lipid molar ratio of about 43-47 cationic lipid/about
43-47 helper lipid/about 7-12 neutral lipid/about 1-4 stealth
lipid.
[0251] Another embodiment of the present invention provides a
method of encapsulating a nucleic acid in a lipid nanoparticle host
using a cationic lipid and a helper lipid, for example cholesterol,
in a lipid molar ratio of about 45% cationic lipid and about 44%
helper lipid. Another embodiment provides a method using a cationic
lipid, a helper lipid, for example cholesterol, and a neutral
lipid, for example DSPC in a lipid molar ratio of about 45%
cationic lipid, about 44% helper lipid, and about 9% neutral lipid.
Another embodiment provides a method using a cationic lipid, a
helper lipid, for example cholesterol, a neutral lipid, for example
DSPC, and a stealth lipid, for example 5010, 5024, 5027, 5031, or
5033 in a lipid molar ratio of about 45% cationic lipid, about 44%
helper lipid, about 9% neutral lipid, and about 2% stealth
lipid.
[0252] One embodiment of the present invention provides a method of
preparing an encapsulated nucleic acid nanoparticle composition
comprising a compound of formula (I) and another lipid component.
Another embodiment provides a method using a compound of formula
(I) and a helper lipid, for example cholesterol. Another embodiment
provides for a method using a compound of formula (I), a helper
lipid, for example cholesterol, and a neutral lipid, for example
DSPC. Another embodiment of the present invention provides a method
using a compound of formula (I), a helper lipid, for example
cholesterol, a neutral lipid, for example DSPC, and a stealth
lipid, for example S010, S024, S027, S031, or S033. Another
embodiment of the present invention provides for a method of
encapsulating a nucleic acid in a lipid nanoparticle host where the
nanoparticle comprises a compound of formula (I), a helper lipid,
for example cholesterol, a neutral lipid, for example DSPC, a
stealth lipid, for example S010, S024, S027, S031, or S033, and the
nucleic acid is, for example a RNA or DNA. Another embodiment of
the present invention provides a method of using a compound of
formula (I) a helper lipid, for example cholesterol, a neutral
lipid, for example DSPC, and a stealth lipid, for example S010,
S024, S027, S031, or S033, where the nucleic acid is, for example,
mRNA, siRNA or DNA.
[0253] Another embodiment of the present invention provides a
method of encapsulating a nucleic acid in a lipid nanoparticle host
using a compound of any of formulas (I)-(IX) and a helper lipid,
for example cholesterol, in a lipid molar ratio of about 40-55
compound of formula (I)/about 40-55 helper lipid. Another
embodiment provides a method using a compound of any of formulas
(I)-(IX), a helper lipid, for example cholesterol, and a neutral
lipid, for example DSPC in a lipid molar ratio of about 40-55
compound of any of formulas (I)-(IX)/about 40-55 helper lipid/about
5-15 neutral lipid. Another embodiment provides a method using a
compound of any of formulas (I)-(IX), a helper lipid, for example
cholesterol, a neutral lipid, for example DSPC, and a stealth
lipid, for example S010, S024, S027, S031, or S033 in a lipid molar
ratio of about 40-55 compound of formula (I)/about 40-55 helper
lipid/about 5-15 neutral lipid/about 1-10 stealth lipid.
[0254] Another embodiment of the present invention provides a
method of encapsulating a nucleic acid in a lipid nanoparticle host
using a compound of any of formulas (I)-(IX) and a helper lipid,
for example cholesterol, in a lipid molar ratio of about 40-50
compound of any of formulas (I)-(IX)/about 40-50 helper lipid.
Another embodiment provides a method using a compound of any of
formulas (I)-(IX), a helper lipid, for example cholesterol, and a
neutral lipid, for example DSPC in a lipid molar ratio of about
40-50 compound of any of formulas (I)-(IX)/about 40-50 helper
lipid/about 5-15 neutral lipid. Another embodiment provides a
method using a compound of any of formulas (I)-(IX), a helper
lipid, for example cholesterol, a neutral lipid, for example DSPC,
and a stealth lipid, for example S010, S024, S027, S031, or S033 in
a lipid molar ratio of about 40-50 compound of any of formulas
(I)-(IX)/about 40-50 helper lipid/about 5-15 neutral lipid/about
1-5 stealth lipid.
[0255] Another embodiment of the present invention provides a
method of encapsulating a nucleic acid in a lipid nanoparticle host
using a compound of any of formulas (I)-(IX) and a helper lipid,
for example cholesterol, in a lipid molar ratio of about 43-47
compound of any of formulas (I)-(IX)/about 43-47 helper lipid.
Another embodiment provides a method using a compound of any of
formulas (I)-(IX), a helper lipid, for example cholesterol, and a
neutral lipid, for example DSPC in a lipid molar ratio of about
43-47 compound of any of formulas (I)-(IX)/about 43-47 helper
lipid/about 7-12 neutral lipid. Another embodiment provides a
method using a compound of any of formulas (I)-(IX), a helper
lipid, for example cholesterol, a neutral lipid, for example DSPC,
and a stealth lipid, for example S010, S024, S027, S031, or S033 in
a lipid molar ratio of about 43-47 compound of any of formulas
(I)-(IX)/about 43-47 helper lipid/about 7-12 neutral lipid/about
1-4 stealth lipid.
[0256] Another embodiment of the present invention provides a
method of encapsulating a nucleic acid in a lipid nanoparticle host
using a compound of any of formulas (I)-(IX) and a helper lipid,
for example cholesterol, in a lipid molar ratio of about 45%
compound of any of formulas (I)-(IX) and about 44% helper lipid.
Another embodiment provides a method using a compound of any of
formulas (I)-(IX), a helper lipid, for example cholesterol, and a
neutral lipid, for example DSPC in a lipid molar ratio of about 45%
compound of any of formulas (I)-(IX), about 44% helper lipid, and
about 9% neutral lipid. Another embodiment provides a method using
a compound of any of formulas (I)-(IX), a helper lipid, for example
cholesterol, a neutral lipid, for example DSPC, and a stealth
lipid, for example S010, S024, S027, S031, or S033 in a lipid molar
ratio of about 45% compound of any of formulas (I)-(IX), about 44%
helper lipid, about 9% neutral lipid, and about 2% stealth
lipid.
[0257] The ratio of lipids:nucleic acid (e.g. siRNA) in the
processes of the invention may be approximately 15-20:1 (wt/wt). In
certain embodiments, the ratio of lipids:nucleic acid is about
17-19:1. In other embodiments, the ratio of lipids:nucleic acid is
about 18.5:1
[0258] The nanoparticles produced by the processes of the invention
have an average/mean diameter and a distribution of sizes around
the average value. A narrower range of particle sizes corresponds
to a more uniform distribution of particle sizes. Particle size may
be determined at the time of collection of the nanoparticles, after
an incubation time, or after fully processing (e.g., dilution,
filtration, dialysis, etc) a nanoparticle formulation. For example,
particle size determination is typically done after a 60 min
incubation period and/or after full sample processing. Average
particle sizes are reported as either a Z-Average or a number
average. Z-Averages are measured by dynamic light scattering on a
Malvern Zetasizer. The nanoparticle sample is diluted in phosphate
buffered saline (PBS) so that the count rate is approximately
200-400 kcts. The data is presented as a weighted average of the
intensity measure. Dynamic light scattering also provides a
polydispersity index (PDI) that quantifies the width of the
particle size distribution. A larger PDI correlates with a larger
particle size distribution and vice versa. Number averages, on the
other hand, can be determined by measurement under a
microscope.
[0259] In some embodiments, the encapsulated nucleic acid
nanoparticles produced by the processes of the invention have an
average diameter of about 30 to about 150 nm. In other embodiments,
the particles have an average diameter of about 30 to about 40 nm.
In other embodiments, the particles have an average diameter of
about 40 to about 70 nm. In other embodiments, the particles have
an average diameter of about 65 to about 80 nm. In other
embodiments, the particles have a Z-average of about 50 to about 80
nm and/or a number average of about 40 to about 80 nm. In still
other embodiments, the particles have a Z-average of about 50 to
about 70 nm and/or a number average of about 40 to about 65 nm. In
yet other embodiments, the particles have a Z-average of about 70
to about 80 nm and/or a number average of about 60 to about 80 nm.
The particular size of the particles obtained may depend on the
linear velocity of the nucleic acid and lipid streams, the use of
an optional dilution step, and the particular nucleic acid or
lipids used. Greater linear velocities and maintaining the organic
solvent concentration in the first outlet solution <33% tend to
produce smaller particle sizes.
[0260] In some embodiments, the encapsulated siRNA nanoparticles
produced by the processes of the invention have an average diameter
of about 30 to about 150 nm. In other embodiments, the particles
have an average diameter of about 30 to about 40 nm. In other
embodiments, the particles have an average diameter of about 40 to
about 70 nm. In other embodiments, the particles have an average
diameter of about 65 to about 80 nm. In other embodiments, the
particles have a Z-average of about 50 to about 80 nm and/or a
number average of about 40 to about 80 nm. In still other
embodiments, the particles have a Z-average of about 50 to about 70
nm and/or a number average of about 40 to about 65 nm. In yet other
embodiments, the particles have a Z-average of about 70 to about 80
nm and/or a number average of about 60 to about 80 nm. In still
other embodiments, encapsulated siRNA nanoparticles produced by the
processes of the invention may have average diameters of about 30,
about 35, about 40, about 45, about 50, about 55, about 60, about
65, about 70, about 75, or about 80 nm.
[0261] Using dynamic light scattering (e.g., Malvern Zetasizer
NanoZS), the polydispersity index (PDI) may range from 0 to 1.0. In
certain preferred embodiments, the PDI is less than about 0.2. In
other preferred embodiments, the PDI is less than about 0.1.
[0262] The processes of the present invention may be further
optimized by one skilled in the art by combining cationic lipids
with the desired pKa range, stealth lipids, helper lipids, and
neutral lipids into formulations, including, e.g., liposome
formulations, lipid nanoparticles (LNP) formulations, and the like
for delivery to specific cells and tissues in vivo. In one
embodiment, further optimization is obtained by adjusting the lipid
molar ratio between these various types of lipids. In one
embodiment, further optimization is obtained by adjusting one or
more of: the desired particle size, N/P ratio, and/or process
parameters. The various optimization techniques known to those of
skill in the art pertaining to the above listed embodiments are
considered as part of this invention.
5.0 Processes for Encapsulating a Nucleic Acid in a Lipid
Nanoparticle Host
[0263] The following methods can be used to make lipid
nanoparticles of the invention. To achieve size reduction and/or to
increase the homogeneity of size in the particles, the skilled
person may use the method steps set out below, experimenting with
different combinations. Additionally, the skilled person could
employ sonication, filtration or other sizing techniques which are
used in liposomal formulations.
[0264] The process for making a composition of the invention
typically comprises providing an aqueous solution, such as citrate
buffer, comprising a nucleic acid in a first reservoir, providing a
second reservoir comprising an organic solution, such as an organic
alcohol, for example ethanol, of the lipid(s) and then mixing the
aqueous solution with the organic lipid solution. The first
reservoir is optionally in fluid communication with the second
reservoir. The mixing step is optionally followed by an incubation
step, a filtration or dialysis step, and a dilution and/or
concentration step. The incubation step comprises allowing the
solution from the mixing step to stand in a vessel for about 0 to
about 24 hours (preferably about 1 hour) at about room temperature
and optionally protected from light. In one embodiment, a dilution
step follows the incubation step. The dilution step may involve
dilution with aqueous buffer (e.g. citrate buffer or pure water)
e.g., using a pumping apparatus (e.g. a peristaltic pump). The
filtration step may be ultrafiltration or dialysis. Ultrafiltration
comprises concentration of the diluted solution followed by
diafiltration, e.g., using a suitable pumping system (e.g. pumping
apparatus such as a peristaltic pump or equivalent thereof) in
conjunction with a suitable ultrafiltration membrane (e.g. GE
Hollow fiber cartridges or equivalent). Dialysis comprises solvent
(buffer) exchange through a suitable membrane (e.g. 10,000 mwc
snakeskin membrane).
[0265] In one embodiment, the mixing step provides a clear single
phase.
[0266] In one embodiment, after the mixing step, the organic
solvent is removed to provide a suspension of particles, wherein
the nucleic acid is encapsulated by the lipid(s).
[0267] The selection of an organic solvent will typically involve
consideration of solvent polarity and the ease with which the
solvent can be removed at the later stages of particle formation.
The organic solvent, which is also used as a solubilizing agent, is
preferably in an amount sufficient to provide a clear single phase
mixture of nucleic acid and lipids. Suitable organic solvents
include those described by Strickley, Pharmaceutical Res. (2004),
21, 201-230 for use as co-solvents for injectable formulations. For
example, the organic solvent may be selected from one or more (e.g.
two) of ethanol, propylene glycol, polyethylene glycol 300,
polyethylene glycol 400, glycerin, dimethylacetamide (DMA),
N-methyl-2-pyrrolidone (NMP), and dimethylsulfoxide (DMSO).
Preferably, the organic solvent is ethanol.
[0268] There is herein disclosed an apparatus for making a
composition of the present invention. The apparatus typically
includes at least one reservoir for holding an aqueous solution
comprising a nucleic acid and another one or more reservoirs for
holding an organic lipid solution. The apparatus also typically
includes a pump mechanism configured to pump the aqueous and the
organic lipid solutions into a mixing region or mixing chamber. In
some embodiments, the mixing region or mixing chamber comprises a
cross coupling, or equivalent thereof, which allows the aqueous and
organic fluid streams to combine as input into the cross connector
and the resulting combined aqueous and organic solutions to exit
out of the cross connector into a collection reservoir or
equivalent thereof. In other embodiments, the mixing region or
mixing chamber comprises a T coupling or equivalent thereof, which
allows the aqueous and organic fluid streams to combine as input
into the T connector and the resulting combined aqueous and organic
solutions to exit out of the T connector into a collection
reservoir or equivalent thereof.
[0269] The processes according to the present invention may be
better understood by reference to FIG. 2, which illustrates a
system for use in exemplary methods of forming encapsulated nucleic
acid nanoparticles. The apparatus 1 contains a cross 16 having
passages 12, 22, and 32 for receiving, respectively, a first
nucleic acid stream 10, a second nucleic acid stream 20, and a
lipid stream 30. The streams 10, 20, and 30 may be delivered to the
passages 12, 22, and 32 by pumping the respective streams through a
suitable tubing leading from one or more reservoirs containing a
nucleic acid solution and one or more reservoirs containing a
solution of lipids (tubing and reservoirs not shown). The passages
12, 22, and 32 in FIG. 2 have approximately equal inner diameters.
The streams 10, 20, and 30 meet at the intersection point 14 to
form a combined stream 40. Because of the geometry of cross 16, the
lipid stream 30 flows in a direction orthogonal to the nucleic acid
streams 10 and 20, which flow in opposing directions at about
180.degree. relative to each other toward the intersection point
14. The combined stream 40 flows through passage 42 into a process
chamber 70, the body of which (72) may have a larger diameter than
the passage 42. The process chamber 70 may also have various
lengths. For example, the process chamber 70 may have a length
about 100-2000 times the diameter of the passages 12, 22, and 32
and a diameter about 4 times the diameter of the passages 12, 22,
and 32.
[0270] In the embodiment of FIG. 2, the joined stream 40 intersects
with a dilution stream 50 entering through passage 52. The dilution
stream 50 may be delivered through a tubing from a dilution
reservoir containing a dilution solution. In FIG. 2, passage 52 has
about 2-fold larger diameter than the passages 12, 22, and 32. The
joined stream 40 and the dilution stream 50 intersect in T chamber
54. The stream produced by the intersection of joined stream 40 and
dilution stream 50 is the first outlet solution 60 containing
encapsulated nucleic acid nanoparticles.
[0271] In certain embodiments, the concentration of nucleic acid in
the one or more nucleic acid streams is about 0.1 to about 1.5
mg/mL and the concentration of lipids in the one or more lipid
streams is about 10 to about 25 mg/mL. In other embodiments, the
concentration of nucleic acid in the one or more nucleic acid
streams is about 0.2 to about 0.9 mg/mL and the concentration of
lipids in the one or more lipid streams is about 15 to about 20
mg/mL. In other embodiments, the concentration of nucleic acid in
the one or more nucleic acid streams is from about 0.225, 0.3,
0.33, or 0.45 to about 0.675 mg/mL, and the concentration of lipids
in the one or more lipid streams is about 16-18 mg/mL. In other
embodiments, the concentration of nucleic acid in the one or more
nucleic acid streams is about 0.225, 0.3, 0.33, 0.45, or 0.675
mg/mL and the concentration of lipids in the one or more lipid
streams is about 16.7 mg/mL.
[0272] The lipid streams comprise a mixture of one or more lipids
in an organic solvent. The one or more lipids may be a mixture of a
cationic lipid, a neutral lipid, a helper lipid, and a stealth
lipid, each of which may be present in about the same relative
amounts as described elsewhere hereinabove for the final
encapsulated nucleic acid nanoparticle. The organic solvent used in
the lipid stream is one capable of solubilizing the lipids and that
is also miscible with aqueous media. Suitable organic solvents
include ethanol, propylene glycol, polyethylene glycol 300,
polyethylene glycol 400, glycerin, dimethylacetamide (DMA),
N-methyl-2-pyrrolidone (NMP), and dimethylsulfoxide (DMSO).
Preferably the organic solvent comprises about 80% or more ethanol.
Preferably, the organic solvent comprises about 90% or more
ethanol. More preferably, the organic solvent is ethanol. In
certain embodiments, the lipid stream comprises an optional buffer
solution, such as a buffer solution of sodium citrate (e.g., 25
mM).
[0273] The nucleic acid stream comprises a mixture of a suitable
nucleic acid in a first aqueous solution. The first aqueous
solution may include no salts or at least one salt. For example,
the first aqueous solution may include a suitable nucleic acid in
deionized or distilled water without an added salt. In certain
embodiments, the first aqueous solution is a first buffer solution
that includes at least one salt such as, for example sodium
chloride and/or sodium citrate. In the first aqueous solution,
sodium chloride may be present in concentrations ranging from about
0 to about 300 mM. In certain embodiments, the concentration of
sodium chloride is about 50, 66, 75, 100, or 150 mM. The first
aqueous solution may include sodium citrate in a concentration of
about 0 mM to about 100 mM. The first buffer solution preferably
has a pH of about 4 to about 6.5, more preferably about 4.5-5.5. In
some embodiments, the pH of the first buffer solution is about 5
and the sodium citrate concentration is about 25 mM. In other
embodiments, the pH of the first buffer solution is about 6 and the
concentration of sodium citrate is about 100 mM. Preferably, the
first buffer solution has a pH that is less than the pKa of the
cationic lipid. For the embodiments of the invention that include
no salt in the aqueous solution, the lipid stream includes the
optional buffer solution. In the absence of a salt (e.g., sodium
citrate) in either the nucleic acid stream or lipid stream, no
encapsulation occurs.
[0274] Other possible buffers include, but are not limited to,
sodium acetate/acetic acid, Na.sub.2HPO.sub.4/citric acid,
potassium hydrogen phthalate/sodium hydroxide, disodium hydrogen
phthalate/sodium dihydrogen orthophosphate, dipotassium hydrogen
phthalate/potassium dihydrogen orthophosphate, potassium dihydrogen
orthophosphate/sodium hydroxide.
[0275] In certain embodiments, the organic solvent comprises
ethanol and the first outlet solution comprises about 20-25%
ethanol, about 0.15-0.25 mg/mL nucleic acid, and about 3-4.5 mg/mL
lipids. In other embodiments, the organic solvent comprises ethanol
and the first outlet solution comprises about 20% ethanol, about
0.15-0.2 mg/mL nucleic acid, and about 3-3.5 mg/mL lipids. In yet
other embodiments, the organic solvent comprises ethanol and the
first outlet solution comprises about 20% ethanol, about 0.18 mg/mL
nucleic acid, and about 3.3 mg/mL lipids. In other embodiments, the
organic solvent comprises ethanol and the first outlet solution
comprises about 25% ethanol, about 0.2-0.25 mg/mL nucleic acid, and
about 4-4.5 mg/mL lipids. In still other embodiments, the organic
solvent comprises ethanol and the first outlet solution comprises
about 25% ethanol, about 0.23 mg/mL nucleic acid, and about 4.2
mg/mL lipids.
[0276] In certain embodiments according to FIG. 2, the nucleic acid
streams 10 and 20 have a combined linear velocity of about 3 to
about 8 meters/second, the lipid stream 30 has a linear velocity of
about 1.5 to about 4.5 meters per second, the ratio by mass of
lipids:nucleic acid is about 15-20:1, and the concentration of
organic solvent in the outlet solution 60 is less than 33%. In
particular embodiments, the mass ratio of lipids:nucleic acid is
about 15-20:1 or about 17-19:1 and the concentration of the organic
solvent in the outlet solution 60 is about 20-25%. In other
particular embodiments, the mass ratio of lipids:nucleic acid is
about 18.5:1 and the concentration of the organic solvent in the
outlet solution 60 is about 25%. It is understood that the
selection of linear velocities for the nucleic acid streams and
lipid stream from the above ranges is confined by the requirement
to maintain the ratio of lipids to nucleic acid as defined herein.
Thus, adjustment of other parameters (e.g., nucleic acid
concentration (mg/mL)), flow rate (mL/min) may be necessary to
achieve the targeted lipid to nucleic acid ratio.
[0277] In other embodiments according to FIG. 2, the nucleic acid
streams 10 and 20 have a combined linear velocity of about 6 to
about 8 meters/second, the lipid stream 30 has a linear velocity of
about 3 to about 4 meters per second, the ratio by mass of
lipids:nucleic acid is about 15-20:1, and the concentration of
organic solvent in the outlet solution 60 is less than 33%. In
particular embodiments, the mass ratio of lipids:nucleic acid is
about 15-20:1 or about 17-19:1 and the concentration of the organic
solvent in the outlet solution 60 is about 20-25%. In other
particular embodiments, the mass ratio of lipids:nucleic acid is
about 18.5:1 and the concentration of the organic solvent in the
outlet solution 60 is about 25%.
[0278] In one embodiment according to FIG. 2, the nucleic acid
streams 10 and 20 have a combined linear velocity of about 6.8
meters/second, the lipid stream 30 has a linear velocity of about
3.4 meters per second, each stream 10/20/30/50 has about the same
flow rate (mL/min), the ratio by mass of lipids:nucleic acid is
about 15-20:1, and the concentration of organic solvent in the
outlet solution 60 is about 25%. By providing about equal volumes
of two nucleic streams, one lipid stream and one dilution stream,
the total concentration of organic solvent derived from the lipid
stream (lipid in 100% organic solvent) in the first outlet solution
is about 25%. In particular embodiments, the mass ratio of
lipids:nucleic acid is about 17-19:1. In other particular
embodiments, the mass ratio of lipids:nucleic acid is about
18.5:1.
[0279] In typical embodiments of the invention, each nucleic acid
stream 10/20 may have a nucleic acid concentration of about 0.45
mg/mL and a linear velocity of 3.4 meters/second, the lipid stream
30 may have a total lipid concentration of about 16.7 mg/mL and a
linear velocity of about 3.4 meters/second, and the flow rates of
the individual streams are about equal. For example, the passages
12, 22, and 32 may have inner diameters of 0.5 mm and the streams
10, 20, and 30 each have a flow rate of about 40 mL/min and a
corresponding linear velocity of about 3.4 meters/second.
Alternatively, the passages 12, 22, and 32 may have inner diameters
of 1.0 mm and the streams 10, 20, and 30 each have a flow rate of
about 160 mL/min while the corresponding linear velocities remain
about 3.4 meters/second. In a further alternative, the passages 12,
22, and 32 may have inner diameters of about 2.0 mm and the streams
10, 20, and 30 each have a flow rate of about 640 mL/min, while the
linear velocities remain about 3.4 meters/second. As is evident
from the foregoing examples, a doubling in the diameter of the
passageway and stream requires a 4-fold increase in flow rate to
maintain a constant linear velocity. In these examples, the
dilution stream 50 has the same flow rate as the streams 10, 20,
and 30, although the 2-fold greater diameter of the passage 52
results in a 50% lower linear velocity for the dilution stream at
each process scale. It has surprisingly been found that the process
of the invention may be scaled as described above while retaining
the same high degree of nucleic acid encapsulation and small and
uniform particle sizes.
[0280] The linear velocity of the combined nucleic acid streams
10/20 relative to the lipid stream 30 is related to the
concentrations of nucleic acid and lipids in the respective streams
and the flow rates (mL/min) of the individual streams, including
the dilution stream 50. The concentrations of nucleic acid and
lipids are not, however, limited to the specific values given above
and may be adjusted up or down, provided that the flow rates are
correspondingly adjusted, as needed, to generally maintain the
ratio of lipids:nucleic acid about 15-20:1. For example, a 10%
decrease in concentration of nucleic acid from 0.45 mg/mL to 0.405
mg/mL would be accompanied by about 1.11-fold increase in flow rate
(mL/min) to keep the overall delivery of nucleic acid constant.
Keeping the diameter of the nucleic acid streams constant, the
1.11-fold increase in flow rate in mL/min also results in a
1.11-fold increase in linear velocity in meters/second. Also
keeping the dilution stream flow rate constant, the overall
concentration of organic solvent from the lipid stream in the
outlet solution 60 would decrease to about 23.5%. Of course, the
flow rate of the dilution stream 50 could likewise be lowered to
keep the organic solvent concentration about 25%, if so desired.
Eventually, a sufficient reduction in nucleic acid concentration
and corresponding increase in nucleic acid stream flow rate may
obviate the necessity of the dilution stream 50 to maintain the
organic solvent concentration about 25% in the first outlet
solution 60. Conversely, the nucleic acid concentration may be
increased (e.g., to 0.9 mg/mL). Such a two-fold increase, however,
would require a corresponding decrease in nucleic acid stream flow
rate(s) and increase in dilution stream rate to keep the
concentration of organic solvent about 25% and the ratio of
lipids:nucleic acid about 15-20:1. Further variations in nucleic
acid or lipid concentration, flow rates, or linear velocities of
streams 10, 20, 30, and 50 may be made in accordance with the
foregoing principles.
[0281] In other embodiments of the invention, the flow rates and/or
linear velocities of the nucleic acid streams 10/20 and the lipid
stream 30 may both be lowered or raised together. Thus, keeping a
constant diameter and concentration for each stream, the linear
velocities of the combined nucleic acid streams may be reduced to
3.4 meters/second and the lipid stream to 1.7 meters/second. In
other embodiments, the velocity of the combined nucleic acid
streams may be reduced to about 3 meters/second and the lipid
stream to about 1.5 meter/second. Likewise, the velocity of the
combined nucleic acid streams may be raised to about 14
meters/second and the lipid stream to about 7 meters/second.
Generally, the upper range of velocity is subject only to the
mechanical limitations of the equipment used to pump the streams.
Very high flow rates/velocities may result in back pressure that
causes equipment failure. In general, the velocity of the combined
nucleic acid streams according to FIG. 2 may range from about 3
meters/second to about 14 meters per second and for the lipid
stream from about 1.5 to about 4.5 meters/second. Preferably, the
velocity of the combined nucleic acid stream is from about 6-8
meters/second and for the lipid stream about 3-4 meters/second. In
certain embodiments, the combined velocity of the combined nucleic
acid streams is about 6.8 meters/second and for the lipid stream
about 3.4 meters/second.
[0282] In some embodiments of the invention, the concentrations of
the nucleic acid and the lipids may both be lowered or raised
together. For example, although it is generally desirable to keep
concentrations as high as possible for a more efficient process, it
is possible to lower the concentrations of the nucleic acid to
about 0.045 mg/mL and the lipids to about 1.67 mg/mL. At still
lower concentrations, however, particle aggregation tends to
increase.
[0283] In certain embodiments according to FIG. 2, the
concentration of nucleic acid in the one or more nucleic acid
streams is about 0.1 to about 1.5 mg/mL and the concentration of
lipids in the one or more lipid streams is about 10 to about 25
mg/mL. In other embodiments, the concentration of nucleic acid in
the one or more nucleic acid streams is about 0.2 to about 0.9
mg/mL and the concentration of lipids in the one or more lipid
streams is about 15 to about 20 mg/mL. In other embodiments, the
concentration of nucleic acid in the one or more nucleic acid
streams is from about 0.225, 0.3, 0.33, or 0.45 to about 0.675
mg/mL, and the concentration of lipids in the one or more lipid
streams is about 16-18 mg/mL. In other embodiments, the
concentration of nucleic acid in the one or more nucleic acid
streams is about 0.225, 0.3, 0.33, 0.45, or 0.675 mg/mL and the
concentration of lipids in the one or more lipid streams is about
16.7 mg/mL. Generally, higher nucleic acid concentrations require a
correspondingly increased level of dilution from the dilution
stream 50 to maintain the nucleic acid concentration in the first
outlet stream 60 in a preferred range (e.g., about 0.15-0.25
mg/mL).
[0284] In other embodiments, the T junction 54 in FIG. 2 may be
replaced with a cross 54a (FIG. 2a) such that two dilution streams
50a and 50b may intersect with the joined stream (e.g., stream 40).
The dilution streams 50a and 50b enter through passages 52a and 52b
of the cross 54a. Using two dilution streams rather than a single
dilution stream allows for a greater dilution factor of the joined
stream 40. The resulting greater dilution of the first outlet
stream 60 may provide somewhat smaller particle sizes. For example,
using the nucleic acid stream/lipid stream flow rates and
velocities described above in connection with FIG. 2, but
substituting the cross 54a from FIG. 2a, can double the volume of
dilution solvent. The resulting greater dilution of the first
joined stream 40 produces a first outlet stream 60 with a lower
concentration of organic solvent (e.g., ethanol) from the lipid
stream. For example, using the cross 54a, the organic solvent
concentration in the first outlet solution may be reduced to about
20%. In other respects, the nucleic acid concentrations, lipid
concentrations, flow rates, velocities, etc. may be varied using
the cross 54a the same as described above in relation to FIG.
2.
[0285] Alternatively, the joined stream from any of the foregoing
embodiments may simply be diluted in a dilution pool containing an
equivalent volume of dilution solvent as that provided by dilution
streams 50, 50a, or 50b.
[0286] In alternative embodiments, the cross 16 in FIG. 2 may be
replaced with a T-shaped chamber 86, as shown in FIG. 3a. Processes
using chamber 86 have two entry passages 82 and 92 for one nucleic
acid stream 80 and one lipid stream 90. In processes using the
mixing chamber 86, the nucleic acid stream and the lipid stream
have opposing flows at about 180.degree. relative to each other.
Using chamber 86, the flow rate and velocity of the single nucleic
acid stream may be double that of the lipid stream in order to
maintain the same ratio of lipid:nucleic acid that may be achieved
using the cross 16, which utilizes two nucleic acid streams. For
example, in one embodiment using T chamber 86 (e.g., 0.5 mm
diameter passages 82 and 92) a nucleic acid stream having about
0.45 mg/mL nucleic acid may have a flow rate of about 80 mL/min and
linear velocity of 6.8 meters/second and the lipid stream may have
a concentration of about 16.7 mg/mL and a linear velocity of 3.4
meters/second. Employing a dilution stream 50 as shown in FIG. 2 at
a flow rate of 40 mL/min in the process using chamber 86 results in
a concentration of organic solvent in the first outlet solution of
about 25%. Surprisingly, the same beneficial properties of small
particle size and uniformity may be obtained using T chamber 86 as
can be obtained using cross 16. Using T chamber 86 differs by
doubling the nucleic acid stream flow rate compared to the
individual nucleic acid stream flow rates in FIG. 2. The overall
nucleic acid stream flow rates remain the same for both processes,
therefore resulting in nanoparticles having substantially
equivalent properties.
[0287] In certain embodiments using T chamber 86 and a dilution
stream 50, the nucleic acid stream 80 has a linear velocity of
about 3 to about 8 meters/second, the lipid stream 90 has a linear
velocity of about 1.5 to about 4.5 meters per second, the ratio by
mass of lipids:nucleic acid is about 15-20:1, and the concentration
of organic solvent in the outlet solution is less than 33%. In
particular embodiments, the mass ratio of lipids:nucleic acid is
about 15-20:1 or about 17-19:1 and the concentration of the organic
solvent in the outlet solution is about 20-25%. In other particular
embodiments, the mass ratio of lipids:nucleic acid is about 18.5:1
and the concentration of the organic solvent in the outlet solution
is about 25%.
[0288] In other embodiments using T chamber 86 and a dilution
stream 50, the nucleic acid stream 80 has a linear velocity of
about 6 to about 8 meters/second, the lipid stream 90 has a linear
velocity of about 3 to about 4 meters per second, the ratio by mass
of lipids:nucleic acid is about 15-20:1, and the concentration of
organic solvent in the outlet solution is less than 33%. In
particular embodiments, the mass ratio of lipids:nucleic acid is
about 15-20:1 or about 17-19:1 and the concentration of the organic
solvent in the outlet solution is about 20-25%. In other particular
embodiments, the mass ratio of lipids:nucleic acid is about 18.5:1
and the concentration of the organic solvent in the outlet solution
is about 25%.
[0289] In one embodiment using T chamber 86 and a dilution stream
50, the nucleic acid stream 80 has a linear velocity of about 6.8
meters/second, the lipid stream 90 has a linear velocity of about
3.4 meters per second, stream 80 has double the flow rate (mL/min)
of stream 90 and dilution stream 50, the ratio by mass of
lipids:nucleic acid is about 15-20:1, and the concentration of
organic solvent in the outlet solution is about 25%. In particular
embodiments, the mass ratio of lipids:nucleic acid is about
17-19:1. In other particular embodiments, the mass ratio of
lipids:nucleic acid is about 18.5:1.
[0290] In certain embodiments using T chamber 86 without a dilution
stream 50, the nucleic acid stream 80 has a linear velocity of
about 8 to about 14 meters/second, the lipid stream 90 has a linear
velocity of about 1.5 to about 4.5 meters per second, the ratio by
mass of lipids:nucleic acid is about 15-20:1, and the concentration
of organic solvent in the outlet solution is less than 33%. In
particular embodiments, the mass ratio of lipids:nucleic acid is
about 15-20:1 or about 17-19:1 and the concentration of the organic
solvent in the outlet solution is about 20-25%. In other particular
embodiments, the mass ratio of lipids:nucleic acid is about 18.5:1
and the concentration of the organic solvent in the outlet solution
is about 20 or 25%.
[0291] In other embodiments using T chamber 86 without a dilution
stream 50, the nucleic acid stream 80 has a linear velocity of
about 9 to about 11 meters/second, the lipid stream 90 has a linear
velocity of about 3 to about 4 meters per second, the ratio by mass
of lipids:nucleic acid is about 15-20:1, and the concentration of
organic solvent in the outlet solution is less than 33%. In
particular embodiments, the mass ratio of lipids:nucleic acid is
about 15-20:1 or about 17-19:1 and the concentration of the organic
solvent in the outlet solution is about 20-25%. In other particular
embodiments, the mass ratio of lipids:nucleic acid is about 18.5:1
and the concentration of the organic solvent in the outlet solution
is about 25%.
[0292] In one embodiment using T chamber 86 without a dilution
stream 50, the nucleic acid stream 80 has a linear velocity of
about 10.2 meters/second, the lipid stream 90 has a linear velocity
of about 3.4 meters per second, stream 80 has triple the flow rate
(mL/min) of stream 90, the ratio by mass of lipids:nucleic acid is
about 15-20:1, and the concentration of organic solvent in the
outlet solution is about 25%. In particular embodiments, the mass
ratio of lipids:nucleic acid is about 17-19:1. In other particular
embodiments, the mass ratio of lipids:nucleic acid is about
18.5:1.
[0293] In other embodiments using T chamber 86 without a dilution
stream 50, the nucleic acid stream 80 has a linear velocity of
about 11 to about 14 meters/second, the lipid stream 90 has a
linear velocity of about 3 to about 4 meters per second, the ratio
by mass of lipids:nucleic acid is about 15-20:1, and the
concentration of organic solvent in the outlet solution is less
than 33%. In particular embodiments, the mass ratio of
lipids:nucleic acid is about 15-20:1 or about 17-19:1 and the
concentration of the organic solvent in the outlet solution is
about 20-25%. In other particular embodiments, the mass ratio of
lipids:nucleic acid is about 18.5:1 and the concentration of the
organic solvent in the outlet solution is about 20%.
[0294] In one embodiment using T chamber 86 without a dilution
stream 50, the nucleic acid stream 80 has a linear velocity of
about 13.6 meters/second, the lipid stream 90 has a linear velocity
of about 3.4 meters per second, stream 80 has quadruple the flow
rate (mL/min) of stream 90, the ratio by mass of lipids:nucleic
acid is about 15-20:1, and the concentration of organic solvent in
the outlet solution is about 20%. In particular embodiments, the
mass ratio of lipids:nucleic acid is about 17-19:1. In other
particular embodiments, the mass ratio of lipids:nucleic acid is
about 18.5:1.
[0295] As discussed above in connection with FIG. 2, the scale,
concentrations, flow rates, and linear velocities of the nucleic
acid stream 80 and lipid stream 90 may similarly be varied using
the T chamber 86. In particular, the nucleic acid concentrations,
lipid concentrations, and ethanol concentrations described
hereinabove in connection with FIG. 2 also apply to embodiments of
the invention employing the T chamber 86. In one exemplary
embodiment, the nucleic acid concentration may be reduced by
one-third (e.g., from 0.45 to 0.3 mg/mL) and the flow rate of the
nucleic acid stream increased by 50% (e.g., from 80 mL/min to 120
mL/min) to maintain the same overall delivery of nucleic acid
(about 36 mg/min). The linear velocity would similarly be increased
to about 10.2 meters/second. Because of the greater dilution of the
nucleic acid stream, a concentration of about 25% organic solvent
in the outlet solution may be obtained without using a
supplementary dilution stream. By further increasing the nucleic
acid stream flow rate to 160 mL/min (velocity of 13.6 meters/second
for 0.5 mm stream), the concentration of organic solvent in the
outlet solution is reduced to about 20%. In this latter process,
the velocity of the nucleic acid stream may be reduced to about 6.8
meters/second and the velocity of the lipid stream reduced to about
1.7 meters/second without significant change in the particle size
and uniformity.
[0296] Although the various nucleic acid, lipid, and dilution
streams in FIGS. 2 and 3 and generally described above intersect
either at right angles or head-on, these angles are not critical.
For example, the T chamber 86 in FIG. 3 may be replaced by a
Y-shaped chamber 84 (FIG. 3b). Or alternatively, the orientation of
the T chamber may be rotated as shown in chamber 94 (FIG. 3c).
Although FIG. 3c shows the nucleic acid stream 80 intersecting the
forward flow of the lipid stream 90, the positions of the nucleic
acid and lipid streams may be reversed in FIG. 3c.
[0297] In still other embodiments, the number of nucleic acid and
lipid streams may be further varied with appropriate adjustment of
concentrations and flow rates. For example, with suitable equipment
2, 3, or 4 lipid streams may be joined with 1, 2, 3, or 4 nucleic
acid streams.
[0298] The processes of the invention described herein provide for
high rates of nucleic acid encapsulation. Generally the
encapsulation rate is >70%. In some embodiments of the
invention, 75% or more of the nucleic acid is encapsulated. In
other embodiments, 80% or 85% of the nucleic acid is encapsulated.
In still other embodiments, 90% or more of the nucleic acid is
encapsulated. In other embodiments about 91, about 92, about 93,
about 94, about 95, about 96, about 97, about 98, about 99, or
about 100 of the nucleic acid is encapsulated.
[0299] Following formation of the encapsulated nucleic acid
nanoparticles as described herein, the first outlet solution may be
incubated for about 60 minutes at room temperature. After
incubation, the solution may be mixed with a second dilution
solvent to dilute the first outlet solution by about 2-fold to
provide a second outlet solution. The second dilution solvent may
be a third buffer solution or water. The dilution step may be
carried out by mixing the incubated first outlet solution with the
second dilution solvent (water) in a T connector like the T chamber
86 in FIG. 3a. The incubated first outlet solution and the second
dilution solvent may be supplied to the T connector at any suitable
flow rate or velocity, such as, for example, about 0.5 to 1
meter/second. Following the dilution step, the concentration of
organic solvent in the second outlet solution is reduced by
one-half relative to the first outlet solution. Thus, in some
embodiments, the concentration of organic solvent (e.g., ethanol)
in the second outlet solution is less than 16.5%. In other
embodiments, the concentration of organic solvent (e.g., ethanol)
in the second outlet solution is about 10-15%, about 10-12.5%,
about 12.5%, or about 10%. The second outlet solution may be
concentrated by tangential flow filtration and subjected to a
15.times. diafiltration with phosphate buffered saline (PBS) to
remove the starting buffer and ethanol, which are replaced with
PBS. After tangential flow filtration, the pool of concentrated
encapsulated nucleic acid nanoparticles in PBS may be collected and
sterile filtered as described in more detail in the Examples below.
Encapsulated nucleic acid nanoparticles present in formulations
produced by the foregoing additional process steps may be storage
stable at 4.degree. C. for greater than 6 months.
[0300] According to each of the embodiments disclosed herein, are
further embodiments where the nucleic acid is an siRNA. For
example, according to the embodiments described herein are further
embodiments where the nucleic stream is an siRNA stream comprising
a mixture of one or more siRNA molecules in a buffer solution and
having the linear velocities disclosed herein.
6.0 Process Examples
6.1 siRNA Lipid Formulations
[0301] The encapsulated siRNA lipid nanoparticles were formed by
mixing solutions of lipids dissolved in ethanol with siRNA
dissolved in a citrate buffer by the systems and apparatus
generally shown in FIGS. 2-3b, and described generally above.
Mixing chambers were used having passages with inner diameters of
0.5, 1.0, or 2.0 mm. The processing chambers had lengths of from 50
mm to 1000 mm. The dilution chambers had passages with inner
diameters equivalent to or of at least to 2 times that of the
mixing chamber about 0.5 or 1.0 or 2.0 or 4.0 mm. The lipid
solution contained a cationic lipid, a helper lipid (cholesterol),
a neutral lipid (DSPC) and a stealth lipid.
[0302] The concentrations of total lipids were either 16.7 mg/mL or
25 mg/mL. The total lipid to siRNA ratio for these experiments was
about 18.3:1. The concentration of siRNA solutions were 0.225, 0.3,
0.3375, or 0.45 mg/mL in a sodium citrate: sodium chloride buffer
with pH 5. The concentration of NaCl was 50 mM, 66 mM, 75 mM, or
100 mM. The flow rates and linear velocities were varied as
described below.
[0303] For siRNA encapsulation experiments, the cationic lipids and
stealth lipids (i.e., PEG lipid) used are shown in the Table
below.
TABLE-US-00002 TABLE 2 lipid ID lipid type Chemical name A1
cationic
((5-((dimethylamino)methyl)-1,3-phenylene)bis(oxy))bis(octane-
lipid 8,1-diyl) bis(decanoate) A2 cationic
(9Z,9'Z,12Z,12'Z)-2-((4-(((3- lipid
(dimethylamino)propoxy)carbonyl)oxy)hexadecanoyl)oxy)propane-
1,3-diyl bis(octadeca-9,12-dienoate) A3 cationic
(9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- lipid
(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-
9,12-dienoate A4 cationic
(9Z,9'Z,12Z,12'Z)-((5-((dimethylamino)methyl)-1,3- lipid
phenylene)bis(oxy))bis(butane-4,1-diyl) bis(octadeca-9,12-
dienoate) B1 PEG lipid PEG-dimyristylglycerol B2 PEG lipid
2,3-bis(tetradecyloxy)propyl (158-hydroxy-
3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,
69,72,75,78,81,84,87,90,93,96,99,102,105,108,111,114,117,120,
123,126,129,132,135,138,141,144,147,150,153,156-
dopentacontaoxaoctapentacontahectyl)carbamate
[0304] The siRNA used for these experiments had sequences and SEQ
ID NOs. as shown in Table below.
TABLE-US-00003 TABLE 3 SEQ ID Antisense generic NO. Position
Location sequence Sense generic sequence Gene 1 457 3'UTR
AGCACTGAGAA GACAGTATTCTCAGTGCT APOC3 TACTGTC 2 524 3'UTR
TTCTTGTCCAG AATAAAGCTGGACAAGAA APOC3 CTTTATT 3 72 CDS ACAACAAGGAG
CCGGGTACTCCTTGTTGT APOC3 TACCCGG 4 UUuAAUUGAAA
uGucuuGGuuucAAuuAAAuu FVII CcAAGAcAuu 5 UCAuGAAAucGu
CAACGuAACGAuuuCAuGAuu EPAS1 uAcGuuGuu
6.2 Process Example 1 Encapsulation of siRNA
6.2.1 Preparation of Lipid Mixture in Ethanol
[0305] The following is an example of siRNA encapsulated at a
cationic lipid amine to siRNA phosphate (N:P) molar ratio of 4.5:1.
Lipids (cationic lipid, DSPC, cholesterol and lipidated PEG) in the
amounts shown in Table 4 are dissolved in 150 mL of ethanol. The
molar ratios of lipids are 45:9:44:2, respectively. The mixture is
sonicated briefly, then gently agitated for 5 minutes and then
maintained at 37.degree. C. until use.
TABLE-US-00004 TABLE 4 Lipid mixture components Reagent Amount (mg)
MW Final Concentration (mM) Cationic lipid A1 1315.9 732.15 12 DSPC
284 790.16 2.4 Cholesterol 679.5 386.67 11.7 PEG lipid B1 226.6
2837 0.53
6.2.2 Preparation of siRNA SEQ ID NO. 1 in Citrate Buffer
[0306] The buffer for the siRNA streams is 100 mM sodium chloride
and 25 mM sodium citrate at a pH of 5. The pH of the citrate buffer
is first confirmed to be pH 5.00. If it is not, the pH is adjusted
before proceeding. Enough siRNA in water for the encapsulation is
thawed from -80.degree. C. storage. The siRNA SEQ ID NO. 1 is added
to citrate buffer solution and the concentration of the dissolved
siRNA is measured by optical density at 260 nm in a UV
spectrophotometer. The final concentration of the siRNA is adjusted
to 0.45 mg/ml in 150 ml of citrate buffer in a sterile PETG bottle
and is held at room temperature until use.
6.2.3 Encapsulation of siRNA in Lipid Nanoparticles
[0307] The siRNA encapsulation is carried out using a system as
shown generally in FIG. 2. Sterile syringes are loaded with an
equal volume (25 ml) of lipids in ethanol (syringe (a)), siRNA in
citrate buffer (syringes (b1) and (b2)), and water alone (syringe
(c)). Tubing leading from Luer fittings on the syringe (a)
containing 16.7 mg/mL lipids is attached to the center input of a
cross junction with a 0.5 mm inner diameter. Tubing leading from
Luer fittings on syringes (b1) and (b2) containing siRNA at 0.45
mg/ml are attached to the side inputs of the cross junction. The
tubing is fluorinated ethylene propylene (FEP) tubing with 1.55 mm
inner diameter. Syringes (a), (b1) and (b2) are installed on
syringe pump A. Tubing leading from the center input of the cross
opposite the lipid input is attached to a T junction with a 1 mm
inner diameter (see e.g., FIG. 2, T junction 54). Tubing leading
from a Luer fitting on syringe (c) containing water alone is
attached to the T junction to enable in-line dilution of siRNA
lipid nanoparticles, and syringe (c) is installed on syringe pump
B. Have the output line from the T junction positioned over a
sterile PETG bottle for collection of the diluted siRNA lipid
nanoparticles. It is important to make sure that all fittings are
tight on the syringes. The syringe pumps are set to the appropriate
syringe manufacturer and size and a flow rate of 40 ml per minute.
Start both pumps simultaneously, and start collecting material
after approximately 0.5 seconds. Approximately 90 ml of
encapsulated siRNA lipid nanoparticles will be collected and which
contains 25% ethanol by volume, 0.23 mg/mL of the siRNA, 4.2 mg/mL
of the lipids, and 50 mM NaCl. After a 60 min. post mixing
incubation period, particle sizes are determined using a Malvern
Zetasizer.
6.2.4 Dilution of siRNA Lipid Nanoparticles
[0308] A 1.0 mm inner diameter T junction is set up for further
dilution of the siRNA lipid nanoparticle suspension. This dilution
step is run with two syringes on one syringe pump. One 140 mL
syringe contains the siRNA lipid nanoparticles and a second 140 mL
syringe contains water. The flow rate is set to 25 ml per minute.
The siRNA stream and the water stream enter the T junction at 180
degrees from each other. The diluted siRNA lipid nanoparticle
suspension is collected into a sterile PETG bottle. The final
volume will be approximately 280 ml, with an ethanol concentration
of 12.5%.
6.2.5 Dialysis and Concentration of siRNA Lipid Nanoparticles by
Tangential Flow Filtration
[0309] For every 50 mg of siRNA in the encapsulation run, use a
Vivaflow 50 cartridge. For a 100 mg siRNA encapsulation run, use 2
Vivaflow 50 cartridges attached in series. The regenerated
cellulose cartridges must first be rinsed to remove any storage
solution from the manufacturer. This is done by filling an empty
TFF reservoir with 500 ml of DI water and recirculate with a
peristaltic pump at a flow rate of 115 ml/min. The permeate line
should not be restricted and the rinsing process is complete when
the entire 500 ml of water is flushed through the membrane.
[0310] Load the siRNA lipid nanoparticle suspension into the
Minimate TFF reservoir. Concentrate the mixture while maintaining
an overall pressure of 20-25 psi. The filtrate should elute at
approximately 4 ml per minute throughout the concentration step.
This rate is achieved by restricting the permeate line with a pinch
valve until the proper flow rate is achieved. Concentrate until the
liquid level in the reservoir is at the 15 ml graduation. Diafilter
the concentrated siRNA lipid nanoparticle suspension against 225 ml
of pyrogen-free, nuclease-free 1.times.PBS. Increase the flow rate
to 80 ml/min. After diafiltration, resume concentration of the
material to the holdup volume of the TFF system. Collect the siRNA
lipid nanoparticle suspension from the reservoir. It is possible to
rinse the TFF system with additional 2 ml of 1.times.PBS and to
collect this wash that contains diluted siRNA lipid nanoparticle
suspension, but this wash should be collected separately from the
concentrated siRNA lipid nanoparticle suspension. Store materials
at 4.degree. C. until analysis.
6.2.6 Sterile Filtration Step
[0311] The siRNA lipid nanoparticles are filtered by heating
approximately 10 ml of the suspension in a glass vial which is
placed in a aluminum block heater preheated to 50.degree. C. for 10
min. The vial is then removed and the solution is removed with a
syringe and filtered through a 0.22 .mu.m PES syringe filter
directly into a sterile vial. This final product is stored at
4.degree. C.
6.2.7 Percent Encapsulation Determination (SYBR GOLD)
[0312] To determine the efficiency of the siRNA formulation into
lipid nanoparticles, the percent encapsulation of the siRNA can be
determined by measuring sybr gold fluorescence. When bound to
siRNA, sybr gold fluoresces. The intensity of sybr gold
fluorescence is proportional to the amount of siRNA.
[0313] A standard solution of siRNA stock at approximately 0.9
mg/mL is prepared in PBS. The concentration of siRNA stock is
verified by UV measurement. The siRNA stock is diluted with PBS to
8 .mu.g/mL. Serial dilution is done to prepare 4, 2, 1, 0.5 and
0.25 .mu.g/mL siRNA solutions. 6 .mu.g/mL of siRNA is prepared by
mixing equal volumes of 8 .mu.g/mL and 4 .mu.g/mL solutions.
[0314] To prepare test samples, 10 .mu.L of siRNA lipid
nanoparticle suspension are diluted with 990 .mu.L of PBS (this is
now solution A). Note: This first dilution step applies for the
formulations with expected siRNA concentration of .about.3.6 mg/mL
or less. If the concentration is higher than -3.6 mg/mL, the
dilution should be greater. 40 uL of solution A is diluted with 160
.mu.L of PBS (this is now solution 1).
[0315] For the measurement of free siRNA in a formulation, a
solution of 0.02% sybr gold in PBS is prepared (e.g., 3 .mu.L of
sybr gold in 15 mL of PBS) (solution 2). In a 96-well black,
clear-bottom plate 10 .mu.L of solution 1 is mixed with 190 .mu.L
of solution 2 to provide sample mixture 1. In this mix, sybr gold
will bind only to the nonencapsulated (i.e. free) siRNA. It will
not have access to the siRNA encapsulated in the liposome.
[0316] For the measurement of total siRNA in a formulation, a
solution of 0.02% sybr gold and 0.2% triton-x in PBS is prepared
(e.g., 3 .mu.L of sybr gold in 15 mL of 0.2% triton in PBS)
(solution 3). In a 96-well black, clear-bottom plate 10 .mu.L of
solution 1 is mixed with 190 .mu.L of solution 3 to provide sample
mixture 2. In this mix, triton-x disrupts the liposomes and exposes
previously encapsulated siRNA to sybr gold binding. Hence, sybr
gold will bind to the non-encapsulated (i.e. free) siRNA and to all
newly exposed siRNA. The free siRNA+newly exposed siRNA=total
siRNA
[0317] The standard solutions described above (10 .mu.L each) are
mixed with either 190 .mu.L solution 2 to provide standard mixtures
1 or 190 .mu.L solution 3 to provide standard mixtures 2.
[0318] The fluorescence of all mixes is measured on the SpectraMax
M5 spectrophotometer using software SoftMax pro 5.2 and the
following parameters:
.lamda..sub.ex=485 nm .lamda..sub.em=530 nm Read Mode:
Fluorescence, Top read
Wavelengths: Ex 485 nm, Em 530 nm, Auto Cutoff On 530 nm
Sensitivity: Readings 6, PMT: Auto
Automix: Before: Off
Autocalibrate: On
[0319] Assay plate type: 96 Well costarblk/clrbtm Wells to read:
Read entire plate Settling time: Off Column Way. Priority: Column
priority
Carriage Speed: Normal
[0320] Auto read: Off
[0321] The fluorescence intensity values obtained from standard
mixtures 1 are used to create the calibration curve for free siRNA.
The fluorescence intensity of a sample 1 mixture is then plugged
into the equation provided by the calibration curve for free siRNA.
The found concentration of the sample is then multiplied by the
dilution magnitude to obtain the free siRNA in the lipid
nanoparticle formulation.
[0322] The fluorescence intensity values obtained from standard
mixtures 2 are used to create the calibration curve for total
siRNA. The fluorescence intensity of a sample 2 mixture is then
plugged into the equation provided by the calibration curve for
total siRNA. The found concentration of the sample is then
multiplied by the dilution magnitude to obtain the total siRNA in
the lipid nanoparticle formulation.
[0323] The encapsulated siRNA is calculated by the formula: [(total
siRNA-free siRNA)/(total siRNA)].times.100%.
6.2.8 Percent Encapsulation Determination Using Size Exclusion
Chromatography (SEC)
[0324] Because the size of free siRNA (5 nm) is different than the
size of a liposome (50-200 nm), they will elute at different times
in the size exclusion column. Free siRNA elutes after the
liposomes. Retention time for siRNA is .about.17 minutes whereas
the retention time for liposomes is .about.10 minutes. Detection of
eluted siRNA is carried out via UV detector with absorption
wavelength set at 260 nm.
[0325] siRNA stock at approximately 0.9 mg/mL is prepared in PBS.
To a 200 .mu.L it aliquot of stock, 104, of TRITON X-100 are added.
The concentration of siRNA stock is verified by UV measurement.
Serial dilutions are done to prepare standards at 1/2, 1/4, 1/8,
1/16 and 1/32 concentration of the siRNA stock. 10 .mu.L of TRITON
X-100 are added to 200 .mu.L of each standard. The concentration of
each standard is verified by UV measurement.
[0326] In a HPLC vial, 254, of lipid nanoparticle formula are added
to 185 of 1.times.PBS (10.times.PBS (FISHER, BP399) diluted with
deionized water to 1.times.). The dispersion is gently vortexed
until homogeneous (dispersion 1). In another HPLC vial, 254, of
lipid nanoparticle formula are added to 185 .mu.L of 20% TRITON-X.
The dispersion is gently vortexed until clear and homogeneous
(dispersion 2).
[0327] The size exclusion chromatography is performed on an AGILENT
1200 HPLC using EMPOWER PRO software. The parameters are:
Column temperature: 30.degree. C. Mobile Phase rate flow: 1 ml/min
for 30 minutes UV detector wavelength: 260 nm Injection volume: 20
uL Number of injections: 2
[0328] 20 .mu.L of standards and dispersions are injected onto size
exclusion column, mobile phase 1.times.PBS with pH adjusted to 7.7
flowing at 1 mL/min for 30 minutes. The eluted material is detected
by UV detector with 260 nm absorption wavelength.
[0329] From the siRNA standards, the peak at .about.17 minutes
represents the siRNA. From dispersion 1, the peak at .about.10
minutes represents the lipid nanoparticle containing encapsulated
siRNA and the peak at .about.17 minutes represents the
nonencapsulated (i.e. free) siRNA.
[0330] In dispersion 2, TRITON-X disrupts the lipid nanoparticle
enabling previously encapsulated siRNA to elute together with
already free siRNA at 17 minutes. The peak at .about.10 minutes
disappears, and only one peak in the chromatogram remains, i.e. the
peak at .about.17 minutes, representing both non-encapsulated (i.e.
free) siRNA and newly free siRNA. Free siRNA+newly free siRNA=total
siRNA.
[0331] The peak area values obtained from siRNA standards are used
to create the siRNA concentration calibration curve. The integrated
area of the peak at .about.17 minutes in dipersion 1 is plugged
into the equation provided by calibration curve for free siRNA to
obtain the concentration of the free siRNA in the dispersion. The
found concentration of the sample is then multiplied by the
dilution magnitude to obtain the free siRNA in the lipid
nanoparticle formulation.
[0332] The integrated area of the peak at .about.17 minutes in
dispersion 2 is plugged into the equation provided by calibration
curve for free siRNA to obtain the concentration of the total siRNA
in the dispersion. The found concentration of sample is then
multiplied by the dilution magnitude to obtain the total siRNA in
the lipid nanoparticle formulation.
[0333] Encapsulated siRNA is calculated by formula: [(total
siRNA-free siRNA)/(total siRNA)].times.100%.
6.2.9 Particle Analytics
[0334] The siRNA lipid nanoparticles are analyzed for size and
polydispersity using a Zetasizer Nano ZS from Malvern Instruments.
For formulated siRNA at an encapsulated siRNA concentration of
>1 mg/ml, dilute 5 .mu.l of sample with 115 .mu.l of
1.times.PBS. Add to a small volume disposable micro-cuvette. Insert
the cuvette into the Zetasizer Nano ZS. For the machine settings,
set material to be polystyrene latex, dispersant to be water, and
cell to be ZEN040. Measure the sample at 25.degree. C. with no wait
time. Record Z-Ave (set as diameter, in nanometer units) and
polydispersity index (PDI).
[0335] In Table 5 are shown the results obtained for siRNA and
lipid nanoparticle combinations using the procedures described
above. Encapsulation percentages were determined using the SEC
method.
TABLE-US-00005 TABLE 5 siRNA Lipid Nanoparticle Encapsulation
Results siRNA Cationic PEG SEQ Z-Ave # % Encap- lipid lipid ID NO.
(nm) Ave PDI sulation A1 B1 1 65.1 49.6 0.089 92.9 A2 B2 1 72.9
52.2 0.092 93.1 A3 B2 1 81.7 66.5 0.026 97.0 A3 B1 1 72.4 56.6 0.03
98.1 A1 B1 2 71.0 50.5 0.145 94.7
6.3 Process Example 2 Effect of Dilution
[0336] Using the system substantially as shown in FIG. 2, two
aqueous nucleic acids streams having concentrations of 0.45 mg/mL
of siRNA SEQ ID NO:1, 100 mM NaCl, and 25 mM sodium citrate at a pH
of 5 were introduced from opposing directions into a cross-shaped
mixing chamber having passages with inner diameters of 0.5 mm with
flow rates of 40 mL/min each. Simultaneously, a lipid stream was
introduced into the cross-shaped mixing chamber from a direction
orthogonal to the two nucleic acid streams at a flow rate of 40
mL/min. The lipid stream was made up of 45% cationic lipid A1, 44%
cholesterol, 9% DSPC, and 2% PEG-lipid B1 in ethanol. The total
concentration of lipids was 16.7 mg/mL. In one run, the joined
stream from the cross-shaped mixing chamber was subjected to a
dilution step with water using a T-shaped chamber (1.0 mm inner
diameter) analogous to chamber 54 in FIG. 2. The water was
introduced into the T-shaped chamber at a rate of 40 mL/min. The
resultant solution was collected and the encapsulated nucleic acid
nanoparticles analyzed for size and uniformity with the results
shown in entry 1 in Table 6. The solution obtained from entry 1
included 25% ethanol by volume, 0.23 mg/mL of the siRNA, 4.2 mg/mL
of the lipids, and 50 mM NaCl. In a separate experiment using the
same concentrations, flow rates, and initial cross-shaped mixing
chamber, the joined streams from the mixing chamber were diluted in
a volume of water equivalent to the dilution volume used in entry
1. These results are shown in entry 2 in Table 6. The
concentrations of the collected solution were the same as in entry
1. For comparison, another experiment was conducted under the same
process conditions but without any dilution step. These results are
shown in entry 3 in Table 6. Without any dilution step, the
collected solution in entry 3 included 33% ethanol, 0.3 mg/mL
siRNA, 5.6 mg/mL lipids and 66 mM NaCl. The Z-Avg, #-Avg, and PDI
for entries 1 and 2 were less than entry 3, which lacked the
dilution step. The Z-Avg, #-Avg, and PDI in Table were determined
60 minutes post-mixing.
TABLE-US-00006 TABLE 6 Dilution Dilution flow Entry chamber
(mL/min) Z-Avg #-Avg PDI 1 T 40 58 46 0.063 2 pool -- 58 47 0.063 3
-- -- 82 69 0.083
[0337] Using the same process and lipid mixture as described for
entry 1 in Table 6, but with siRNA SEQ ID NO. 3, the
uniformly-sized lipid nanoparticles shown in FIG. 4a were produced.
Replacing the cross-shaped mixing chamber with the T-shaped mixing
chamber of FIG. 3a (0.5 mm inner diameter) while increasing the
concentration of siRNA SEQ ID. NO. 3 to 0.9 mg/mL at a flow rate of
40 mg/mL (same total amount of siRNA in one-half the volume)
produced the less uniformly-sized lipid nanoparticles shown in FIG.
4b. Analogous processes using a T-shaped mixing chamber and siRNA
at 0.9 mg/mL are described in Process Example 4.
6.4 Process Example 3 Effect of Flow Rates, Velocities, and
Solution Concentrations
[0338] In a series of experiments using a T-shaped mixing chamber
analogous to that shown in FIG. 3a and having an inner diameter of
0.5 mm, a single nucleic acid stream and a single lipid stream were
mixed at various flow rates/velocities and concentrations. The
nucleic acid and lipid streams included the same constituents as
described above in Process Example 2. No dilution step was used in
these examples since the initial siRNA concentrations were adjusted
to obtain a final solution concentration the same as entry 1 in
Table 6. The concentration of lipids in ethanol in these
experiments was either 16.7 mg/mL (1.times.) or 25 mg/mL
(1.5.times.). The results are shown in Table 7 below with the
Z-Avg, #-Avg, and PDI determined 60 minutes post-mixing.
TABLE-US-00007 TABLE 7 Lipid linear Total siRNA siRNA linear Lipid
Flow velocity Flow velocity [siRNA] NaCl (mL/min) (m/s) [lipid]
(mL/min) (m/s) (mg/mL) (mM) Z-Avg #-Avg PDI 40 3.4 1x 80 6.8 0.45
100 60 44 0.089 40 3.4 1x 120 10.2 0.3 66 58 46 0.048 40 3.4 1x 160
13.6 0.225 50 60 42 0.110 20 1.7 1x 60 5.1 0.3 66 59 47 0.037 20
1.7 1x 80 6.8 0.225 50 59 43 0.100 40 3.4 1.5x 120 10.2 0.45 100 66
54 0.032 40 3.4 1.5x 160 13.6 0.3375 75 64 43 0.108 20 1.7 1.5x 60
5.1 0.45 100 66 50 0.051 20 1.7 1.5x 80 6.8 0.3375 75 67 46
0.067
6.5 Process Example 4 Effect of Flow Rates and Velocities
[0339] In a series of experiments using a T-shaped mixing chamber
analogous to that shown in FIG. 3a (an inner diameter of 0.5 mm)
and used in Process Example 3, a single nucleic acid stream and a
single lipid stream were mixed from opposing directions at various
flow rates/linear velocities and subsequently diluted with water at
a 1 mm inner diameter dilution tee, as shown generally in FIG. 2.
The siRNA SEQ ID NO. 4, cationic lipid A1, PEG lipid B1,
cholesterol, and DSPC were used in Process Example 4 in amounts as
described above. The total concentration of lipids in the ethanol
stream was 16.7 mg/mL. The concentration of siRNA in the nucleic
acid stream was 0.9 mg/mL. The results in Table 8 show that
increasing linear velocity decreases the particle size and the
PDI.
TABLE-US-00008 TABLE 8 Lipid Total siRNA Lipid linear siRNA linear
dilution Flow velocity Flow velocity Flow (mL/min) (m/s) (mL/min)
(m/s) (mL/min) Z-Avg PDI 5 0.43 5 0.42 5 168 0.118 10 0.85 10 0.85
10 130 0.137 20 1.7 20 1.7 20 97 0.070 30 2.6 30 2.6 30 95 0.047 40
3.4 40 3.4 40 85 0.039
6.6 Process Example 5 Effect of Orientation of T-Shaped Mixing
Chamber
[0340] Table 9 shows the results from two experiments using an
alternate mixing chamber (0.5 mm inner diameter) analogous to that
shown in FIG. 3c. In entry 1 are shown the results obtained where
the siRNA enters from the branch and in entry 2 are shown the
results obtained where the lipids enter from the branch. For both
experiments, the siRNA and lipids were the same as those described
above in Process Example 2. The flow rate for the siRNA streams was
120 mL/min and the flow rate of the lipid streams was 40 mL/min.
The siRNA concentration was 0.3 mg/mL in a buffer solution
containing 66 mM NaCl. The concentration of the lipids was 16.7
mg/mL. The Z-Avg, #-Avg, and PDI were determined 60 minutes
post-mixing.
TABLE-US-00009 TABLE 9 entry Initial mixing chamber Z-Avg #-Avg PDI
1 T, siRNA into branch 62 48 0.070 2 T, lipid into branch 66 46
0.106
6.7 Process Example 6 Effect of Mixing Chamber Configurations
[0341] A series of experiments were conducted using mixing chambers
having various configurations of nucleic acid and lipid streams
with the total number of streams ranging from 3 to 6. In each case
the mixing chamber had a 1 mm inner diameter chamber and the flow
rates were adjusted to maintain the combined flow of 240 mL/min for
the siRNA streams and 80 mL/min for the lipid streams. The
concentration of siRNA in these experiments was 0.3 mg/mL and the
concentration of lipids was 16.7 mg/mL. The linear velocity of the
combined siRNA streams was 5.1 meters/second. The linear velocity
of the combined lipid streams was 1.7 meters/second. Where the
number of streams allows for more than one arrangement of streams,
Table 10 indicates the angle between lipid or siRNA streams. For
example, in the case of three lipid streams and three siRNA
streams, each lipid stream is separated from the next lipid stream
by either 60 degrees (i.e., 3 adjacent lipid streams) or 120
degrees (i.e., lipid streams separated by 120 degrees with
intervening siRNA streams also separated by 120 degrees). For the
experimental results summarized in Table 10, siRNA SEQ ID NO. 5 was
used with cationic lipid A4, DSPC, cholesterol, and PEG lipid B1,
in a ratio of 45:9:44:2. The results shown in Table 10 indicate
that substantially the same results are obtained for the various
mixing configurations where the total flow rates/velocities
remained constant.
TABLE-US-00010 TABLE 10 siRNA Lipid flow/ flow/ lipid 60 60 % strm
strm or min min Encap. #siRNA #Lipid (ml/ (ml/ siRNA Z-avg. #avg.
@60 streams streams min) min) angle (nm) (nm) min 2 1 120 80 -- 76
66 90 3 1 80 80 -- 78 68 89 2 2 120 40 90 81 70 90 2 2 120 40 180
81 70 89 1 3 240 26.6 -- 90 76 91 4 2 60 40 60 80 70 83 4 2 60 40
120 80 70 84 4 2 60 40 180 81 71 84 3 3 80 26.6 60 81 70 86 3 3 80
26.6 120 78 67 86 2 4 120 20 60 85 74 85 2 4 120 20 120 83 72
87
6.8 Process Example 7 Encapsulation of mRNA
6.8.1 Materials and Reagents
TABLE-US-00011 [0342] TABLE 11 General materials and reagents for
Leptin mRNA encapsulation in lipid nanoparticles Item Vendor
Catalog or identification number Leptin mRNA SEQ ID NO: 6 Cationic
lipid (9Z,9'Z,12Z,12'Z)-2-(((1,3- dimethylpyrrolidine-3-
carbonyl)oxy)methyl)propane-1,3- diyl bis(octadeca-9,12-dienoate)
1,2-distearoyl-sn-glycero-3- Corden LP-R4-076 phosphocholine (DSPC)
Cholesterol Sigma C8667 Lipidated polyethylene glycol Novartis (PEG
lipid) Ethanol Sigma 459844 Nuclease-free water Life Technologies
10977 100 mM citrate buffer, pH 6.0 Teknova Q2446 Amicon Ultra-15
centrifugal filter Millipore UFC903024 unit, 30 kDa molecular
weight cut- off RNaseZap Life Technologies AM9780 Syringe pump KD
Scientific KDS200 10.times. phosphate buffered saline Lonza 51226
Minimate TFF system, 110 volts PALL Corporation OAPMP110 Vivaflow
50, 100 kDa molecular Sartorius VF05C4 weight cut-off, regenerated
cellulose Quant-IT ribogreen RNA assay kit Life Technologies R11490
Tris-EDTA buffer Promega V6231 Triton X-100 Sigma T8787 Zetasizer
NanoZS Malvern ZEN3600 Masterflex silicone L/S 14 tubing
Cole-Parmer 96410-14 60 ml sterile Plastipak syringe Becton Dickson
309653 140 ml sterile syringe Tyco 8881114030
TABLE-US-00012 (SEQ ID NO: 6) TEV-hLeptin-GAopt-2xhBG-120A
[0343] Sequence features:
TABLE-US-00013 Tobacco Etch Virus (TEV) 5' UTR: 14-154 Optimal
Kozak sequence: 155-163 Human leptin encoding amino acids 1-167 of
Protein Accession # NP_000221, sequence codon optimized by GeneArt:
164-664 2 stop codons: 665-670 2 copies of human beta-globin 3'UTR:
689-954 120 nucleotide polyA tail: 961-1080
GGGAGACGCGUGUUAAAUAACAAAUCUCAACACAACAUAUACAAAACAAA
CGAAUCUCAAGCAAUCAAGCAUUCUACUUCUAUUGCAGCAAUUUAAAUCA
UUUCUUUUAAAGCAAAAGCAAUUUUCUGAAAAUUUUCACCAUUUACGAAC
GAUAGCCGCCACCAUGCACUGGGGAACCCUGUGCGGAUUCCUGUGGCUGU
GGCCCUACCUGUUCUAUGUGCAAGCCGUGCCCAUCCAGAAGGUGCAGGAC
GACACCAAGACCCUGAUCAAGACCAUCGUGACCCGGAUCAACGACAUCAG
CCACACCCAGAGCGUGUCCAGCAAGCAGAAAGUGACCGGCCUGGACUUCA
UCCCCGGCCUGCACCCUAUCCUGACCCUGUCCAAGAUGGACCAGACCCUG
GCCGUGUACCAGCAGAUCCUGACCAGCAUGCCCAGCCGGAACGUGAUCCA
GAUCAGCAACGACCUGGAAAACCUGCGGGACCUGCUGCACGUGCUGGCCU
UCAGCAAGAGCUGCCAUCUGCCUUGGGCCAGCGGCCUGGAAACCCUGGAU
UCUCUGGGCGGAGUGCUGGAAGCCAGCGGCUACUCUACAGAGGUGGUGGC
CCUGAGCAGACUGCAGGGCAGCCUGCAGGAUAUGCUGUGGCAGCUGGAUC
UGAGCCCCGGCUGCUAAUAGCGGACCGGCGAUAGAUGAAGCUCGCUUUCU
UGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACUACU
AAACUGGGGGAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUA
AAAAACAUUUAUUUUCAUUGCAGCUCGCUUUCUUGCUGUCCAAUUUCUAU
UAAAGGUUCCUUUGUUCCCUAAGUCCAACUACUAAACUGGGGGAUAUUAU
GAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUUAUUUUCA
UUGCGGCCGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA.
6.8.2 Preparation of Lipid Mixture in Ethanol
[0344] The following is an example of mRNA encapsulated at a
cationic lipid amine to mRNA phosphate (N:P) molar ratio of 4:1.
Lipids (cationic lipid, DSPC, cholesterol and lipidated PEG) are
dissolved in ethanol. The molar ratios of lipids are 40:10:48:2,
respectively. For example, in Table 12 are the amounts and final
concentrations of all components for a 63 ml volume of lipids in
ethanol. The 63 ml volume represents 1.05.times. of the required
volume to ensure the target volume is available for loading into
syringe. The mixture is weighed out and placed into a sterile
polyethylene terephthalate glycol-modified (PETG) 125 ml bottle and
ethanol is added. The mixture is sonicated briefly, then gently
agitated for 5 minutes and then maintained at 37.degree. C. until
use.
TABLE-US-00014 TABLE 12 Lipid mixture components Reagent Amount
(mg) Final concentration (mM) Cationic lipid 285.82 6.0
(9Z,9'Z,12Z,12'Z)-2-(((1,3- dimethylpyrrolidine-3-
carbonyl)oxy)methyl)propane- 1,3-diyl bis(octadeca-9,12- dienoate)
DSPC 74.67 1.5 Cholesterol 175.38 7.2 PEG lipid 51.03 0.3
6.8.3 Preparation of mRNA in Citrate Buffer
[0345] The pH of the citrate buffer is first confirmed to be pH
6.00. If it is not, the pH is adjusted before proceeding. Enough
mRNA in water for the encapsulation is thawed from -80.degree. C.
storage and exchanged from water into citrate buffer pH 6.0 by use
of Amicon Ultra-15 centrifugal concentrators. Between 10 and 12 mg
of mRNA can be loaded into each concentrator, which is centrifuged
for 5 minutes at 4,000 rpm at 4.degree. C. Volume is increased by
the addition of citrate buffer pH 6.0. An exchange of .gtoreq.10
volumes with citrate buffer pH 6.0 is recommended to achieve the
desired buffer condition. The concentration of the mRNA is measured
by optical density at 260 nm in a UV spectrophotometer. The final
concentration of the mRNA is adjusted to 0.25 mg/ml in 126 ml of
citrate buffer in a sterile 250 ml PETG bottle and is held at room
temperature until use. The 126 ml volume represents 1.05.times. of
the required volume to ensure the target volume is available for
loading into syringe.
6.8.4 Encapsulation of mRNA in Lipid Nanoparticles
[0346] The mRNA encapsulation is carried out using a system as
shown generally in FIG. 2. Sterile 60 ml syringes are loaded with
an equal volume (60 ml) of lipids in ethanol (syringe (a)), mRNA in
citrate buffer (syringes (b1) and (b2)), and citrate buffer alone
(syringe (c)). Tubing leading from Luer fittings on the syringe (a)
containing lipids is attached to the center input of a cross
junction with a 0.5 mm inner diameter. Tubing leading from Luer
fittings on syringes (b1) and (b2) containing mRNA at 0.25 mg/ml
are attached to the side inputs of the cross junction. The tubing
is PTFE tubing with 0.8 mm inner diameter. Syringes (a), (b1) and
(b2) are installed on syringe pump A. Tubing leading from the
center input of the cross opposite the lipid input is attached to a
T junction (see e.g., FIG. 2, T junction 54). Tubing leading from a
Luer fitting on syringe (c) containing citrate buffer alone is
attached to the T junction to enable in-line dilution of mRNA lipid
nanoparticles, and syringe (c) is installed on syringe pump B. Have
the output line from the T junction positioned over a sterile 500
ml PETG bottle for collection of the diluted mRNA lipid
nanoparticles. It is important to make sure that all fittings are
tight on the syringes. In this unoptimized pilot experiment, the
syringe pumps were set to the appropriate syringe manufacturer and
size (BD, Plastipak, 60 ml) and a flow rate of up to 16 ml per
minute. Start both pumps simultaneously, and start collecting
material after approximately 0.5 seconds. Approximately 220-230 ml
of encapsulated mRNA lipid nanoparticles will be collected.
6.8.5 Dilution of mRNA Lipid Nanoparticles
[0347] Use a 140 ml syringe to aspirate 135 ml of the mRNA lipid
nanoparticle suspension. Transfer the remaining 85-95 ml to a
second 140 ml syringe. Prepare 140 ml syringes with the same
volumes of citrate buffer. Another T junction for is set up for
another dilution of the mRNA lipid nanoparticle suspension. This
dilution step is run with both syringes on only one syringe pump.
The 140 ml syringes with 135 ml volumes (one containing lipid
nanoparticles, the other containing citrate buffer) are run first,
and the 140 ml syringes with the smaller volumes are run second. It
is important to make sure that all fittings are tight on the
syringes. For the first run change the settings on the syringe pump
to the correct size and manufacturer (140 ml, Sherwood-Monoject).
The flow rate is set to 25 ml per minute. Collect the diluted mRNA
lipid nanoparticle suspension into a sterile 500 ml PETG bottles.
The final volume will be approximately 440-460 ml.
6.8.6 Dialysis and Concentration of mRNA Lipid Nanoparticles by
Tangential Flow Filtration
[0348] For every 15 mg of mRNA in the encapsulation run, use a
Vivaflow 50 cartridge. For a 30 mg mRNA encapsulation run, use 2
Vivaflow 50 cartridges attached in series. The regenerated
cellulose cartridges must first be rendered pyrogen-free. This
procedure should be started the day before the encapsulation. Using
a Minimate TFF system, set up two Vivaflow 50 cartridges in series
and attach tubing. Load 500 ml of pyrogen-free, nuclease-free water
into the reservoir and run it through cartridges at 20 psi
pressure. Load 100 ml of 0.1 M NaOH/1.0 M NaCl into the reservoir
and run 50 ml through the cartridges. Let the remaining 50 ml stand
in the cartridges overnight. The next morning run the remaining 50
ml through the cartridges at 20 psi. Load more pyrogen-free,
nuclease free water into the reservoir and run 50 ml through the
cartridges. Repeat this water wash two more times. Test an aliquot
of the last water rinse for endotoxin to make sure it is below
detectable amounts.
[0349] Load the mRNA lipid nanoparticle suspension into the
Minimate TFF reservoir. Concentrate the mixture while maintaining
an overall pressure of 20-25 psi. The filtrate should elute at
approximately 4 ml per minute to start, but will slow down.
Concentrate until the liquid level in the reservoir is at the 40 ml
graduation. Diafilter the concentrated mRNA lipid nanoparticle
suspension against 300 ml of pyrogen-free, nuclease-free
1.times.PBS. Keep the pressure of 20-25 psi. After diafiltration,
resume concentration of the material to just below the 10 ml
graduation mark on the reservoir. Collect the mRNA lipid
nanoparticle suspension from the reservoir. It is possible to rinse
the TFF system with additional 5 ml of 1.times.PBS and to collect
this wash that contains diluted mRNA lipid nanoparticle suspension,
but this wash should be collected separately from the concentrated
mRNA lipid nanoparticle suspension. Store materials at 4.degree. C.
until analysis.
6.8.7 Percent Encapsulation Determined in a 384-Well Plate Assay
Format
[0350] To determine the efficiency of the mRNA formulation into
lipid nanoparticles, the percent encapsulation of the mRNA is
measured using a Quant-IT ribogreen RNA assay kit from Life
Technologies. The mRNA lipid nanoparticle suspension is assayed in
nuclease-free TE buffer to determine the concentration of mRNA
outside of the lipid nanoparticles, and also assayed in TE buffer
plus 0.75% Triton X-100 detergent to break apart the lipid
nanoparticles and determine the concentration of mRNA in the entire
lipid nanoparticle suspension. The relation of the two
concentrations is used to calculate the percent encapsulation.
[0351] In both TE buffer and TE buffer plus 0.75% Triton X-100
detergent, prepare a 1000 ng/ml solution of RNA from the 100
.mu.g/ml stock standard RNA provided in the kit. Use this stock to
generate standard curves in both TE buffer and TE buffer plus 0.75%
Triton X-100 detergent according to Table 13.
TABLE-US-00015 TABLE 13 Standard curve for the Quant-IT ribogreen
assay kit Microliters Microliters of Final ng/ml Sample of TE RNA
standard concentration 1 975 25 of stock 1000 2 300 300 of sample 1
500 3 300 300 of sample 2 250 4 300 300 of sample 3 125 5 300 300
of sample 4 62.5 6 300 300 of sample 5 31.25 7 300 300 of sample 6
15.63 8 300 0 0
[0352] Carefully prepare mRNA lipid nanoparticle samples in both TE
buffer and TE buffer plus 0.75% Triton X-100 detergent using
dilutions ranging from 400-2,000 fold. For two-step dilutions, make
sure to perform the first step in PBS, rather than TE or TE plus
Triton. Make two sets of dilutions for each sample in each buffer
condition, and assay each set of dilutions in triplicate for a
total of 6 wells per buffer condition per mRNA lipid nanoparticle
sample. Make the standard curve and diluted mRNA lipid nanoparticle
samples in 96 deep-well plates, ensuring thorough mixing of the
samples as they are prepared. Larger volumes of the standard curve
can be prepared and stored in a sealed 96 deep-well plate at
4.degree. C. for up to 3 days for later use.
[0353] Add 40 .mu.l of standards and samples per well to a black
384-well assay plate (Costar non-treated, #3573). Use a 250 .mu.l
automated multi-channel pipet to aspirate 85 .mu.l of standard
curve and dispense 40 .mu.l into two wells of the assay plate.
Aspirate 125 .mu.l of each diluted mRNA lipid nanoparticle sample
and dispense 40 .mu.l into three wells of the assay plate.
[0354] Dilute the ribogreen reagent in the kit 240-fold in TE
buffer and add 60 .mu.l to each well of the assay plate. Use a 125
.mu.l automated multi-channel pipet to aspirate 125 .mu.l of
diluted ribogreen reagent and dispense 60 .mu.l in each well of the
standard curve so that you are changing your tips between the TE
and TE plus detergent standard curve samples. Change tips between
each diluted mRNA lipid nanoparticle sample.
[0355] Mix the samples in the wells by pipetting up and down. This
can be done, for example, by placing the black 384-well assay plate
on a Biomek FX robot and using 30 .mu.l XL tips. After mixing,
measure the fluorescence using a fluorescence microplate reader
with excitation at 480 nm and emission at 520 nm.
[0356] Subtract the fluorescence value of the reagent blank from
the fluorescence value for each RNA sample to generate a standard
curve of fluorescence versus RNA concentration for TE and TE plus
Triton X-100 conditions. Subtract the fluorescence value of the
reagent blank from that of each of the samples and then determine
the RNA concentration of each of the samples from the appropriate
standard curve. Determine the percent encapsulation of the sample
by dividing the difference in concentrations between sample in TE
plus TritonX-100 and sample in TE buffer alone by the concentration
of the sample in TE plus Triton X-100 detergent.
6.8.8 Particle Analytics
[0357] The mRNA lipid nanoparticles are analyzed for size and
polydispersity using a Zetasizer Nano ZS from Malvern Instruments.
For formulated mRNA at an encapsulated mRNA concentration of >1
mg/ml, dilute 5 .mu.l of sample with 115 .mu.l of 1.times.PBS. Add
to a small volume disposable micro-cuvette (Brand, #759200). Insert
the cuvette into the Zetasizer Nano ZS. For the machine settings,
set material to be polystyrene latex, dispersant to be water, and
cell to be ZEN040. Measure the sample at 25.degree. C. with no wait
time. Record Z-Ave (set as diameter, in nanometer units) and
polydispersity index (PDI).
TABLE-US-00016 TABLE 14 Results of Leptin mRNA encapsulation in
(9Z,9'Z,12Z,12'Z)-2-
(((1,3-dimethylpyrrolidine-3-carbonyl)oxy)methyl)propane-1,3-diyl
bis(octadeca-9,12-dienoate) Z-Ave [mRNA] Process Cationic lipid
(nm) PDI Encapsulation (.mu.g/mL) 4 mg scale
(9Z,9'Z,12Z,12'Z)-2-(((1,3- 111.7 0.135 92.0% 213
dimethylpyrrolidine-3- carbonyl)oxy)methyl)propane- 1,3-diyl
bis(octadeca-9,12- dienoate)
[0358] The above description of the examples and embodiments of the
invention is merely exemplary in nature and, thus, variations
thereof are not to be regarded as a departure from the spirit and
scope of the invention.
Sequence CWU 1
1
11118DNAArtificial SequencesiRNA antisense strand; APOC3 gene
1agcactgaga atactgtc 18218DNAArtificial SequencesiRNA antisense
strand; APOC3 gene 2ttcttgtcca gctttatt 18318DNAArtificial
SequencesiRNA antisense strand; APOC3 gene 3acaacaagga gtacccgg
18421DNAArtificial SequencesiRNA antisense strand; FVII gene
4uuuaauugaa accaagacau u 21521DNAArtificial SequencesiRNA antisense
strand; EPAS1 gene 5ucaugaaauc guuacguugu u 2161080RNAArtificial
SequenceTEV-hLeptin-GAopt-2xhBG-120A5'UTR(14)..(154)Tobacco Etch
Virus (TEV) 5' UTR 14-154misc_feature(155)..(163)Optimal Kozak
sequence3'UTR(689)..(954)2 copies of human beta-globin 3'UTR
689-954polyA_signal(961)..(1080) 6gggagacgcg uguuaaauaa caaaucucaa
cacaacauau acaaaacaaa cgaaucucaa 60gcaaucaagc auucuacuuc uauugcagca
auuuaaauca uuucuuuuaa agcaaaagca 120auuuucugaa aauuuucacc
auuuacgaac gauagccgcc accaugcacu ggggaacccu 180gugcggauuc
cuguggcugu ggcccuaccu guucuaugug caagccgugc ccauccagaa
240ggugcaggac gacaccaaga cccugaucaa gaccaucgug acccggauca
acgacaucag 300ccacacccag agcgugucca gcaagcagaa agugaccggc
cuggacuuca uccccggccu 360gcacccuauc cugacccugu ccaagaugga
ccagacccug gccguguacc agcagauccu 420gaccagcaug cccagccgga
acgugaucca gaucagcaac gaccuggaaa accugcggga 480ccugcugcac
gugcuggccu ucagcaagag cugccaucug ccuugggcca gcggccugga
540aacccuggau ucucugggcg gagugcugga agccagcggc uacucuacag
aggugguggc 600ccugagcaga cugcagggca gccugcagga uaugcugugg
cagcuggauc ugagccccgg 660cugcuaauag cggaccggcg auagaugaag
cucgcuuucu ugcuguccaa uuucuauuaa 720agguuccuuu guucccuaag
uccaacuacu aaacuggggg auauuaugaa gggccuugag 780caucuggauu
cugccuaaua aaaaacauuu auuuucauug cagcucgcuu ucuugcuguc
840caauuucuau uaaagguucc uuuguucccu aaguccaacu acuaaacugg
gggauauuau 900gaagggccuu gagcaucugg auucugccua auaaaaaaca
uuuauuuuca uugcggccgc 960aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1020aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1080718DNAArtificial
SequencesiRNA sense strand; APOC3 gene 7gacagtattc tcagtgct
18818DNAArtificial SequencesiRNA sense strand; APOC3 gene
8aataaagctg gacaagaa 18918DNAArtificial SequencesiRNA sense strand;
APOC3 gene 9ccgggtactc cttgttgt 181021DNAArtificial SequencesiRNA
sense strand; FVII gene 10ugucuugguu ucaauuaaau u
211121DNAArtificial SequencesiRNA sense strand; EPAS1 gene
11caacguaacg auuucaugau u 21
* * * * *