U.S. patent application number 16/426905 was filed with the patent office on 2019-10-17 for erythroid cells comprising arginase.
The applicant listed for this patent is RUBIUS THERAPEUTICS, INC.. Invention is credited to Noubar B. Afeyan, David Arthur Berry, Avak Kahvejian, Jordi Mata-Fink, John Round.
Application Number | 20190316091 16/426905 |
Document ID | / |
Family ID | 52293163 |
Filed Date | 2019-10-17 |
View All Diagrams
United States Patent
Application |
20190316091 |
Kind Code |
A1 |
Kahvejian; Avak ; et
al. |
October 17, 2019 |
ERYTHROID CELLS COMPRISING ARGINASE
Abstract
Compositions comprising synthetic membrane-receiver complexes,
methods of generating synthetic membrane-receiver complexes, and
methods of treating or preventing diseases, disorders or conditions
therewith.
Inventors: |
Kahvejian; Avak; (Lexington,
MA) ; Mata-Fink; Jordi; (Baltimore, MD) ;
Round; John; (Cambridge, MA) ; Berry; David
Arthur; (Newton, MA) ; Afeyan; Noubar B.;
(Lexington, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
RUBIUS THERAPEUTICS, INC. |
Cambridge |
MA |
US |
|
|
Family ID: |
52293163 |
Appl. No.: |
16/426905 |
Filed: |
May 30, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15899895 |
Feb 20, 2018 |
|
|
|
16426905 |
|
|
|
|
15473421 |
Mar 29, 2017 |
10344263 |
|
|
15899895 |
|
|
|
|
14738414 |
Jun 12, 2015 |
9644180 |
|
|
15473421 |
|
|
|
|
14581486 |
Dec 23, 2014 |
|
|
|
14738414 |
|
|
|
|
PCT/US2014/065304 |
Nov 12, 2014 |
|
|
|
14581486 |
|
|
|
|
62059100 |
Oct 2, 2014 |
|
|
|
62025367 |
Jul 16, 2014 |
|
|
|
62006825 |
Jun 2, 2014 |
|
|
|
62006829 |
Jun 2, 2014 |
|
|
|
62006832 |
Jun 2, 2014 |
|
|
|
61991319 |
May 9, 2014 |
|
|
|
61973764 |
Apr 1, 2014 |
|
|
|
61919432 |
Dec 20, 2013 |
|
|
|
61962867 |
Nov 18, 2013 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 9/88 20130101; A61K
31/7088 20130101; A61P 1/04 20180101; A61P 37/06 20180101; A61P
3/10 20180101; A61P 1/00 20180101; A61P 37/02 20180101; A61K 39/001
20130101; A61P 17/00 20180101; C12Y 403/01024 20130101; C07K
2317/622 20130101; C12Y 304/22 20130101; A61K 38/1774 20130101;
A61P 13/12 20180101; C12Y 204/02004 20130101; A61P 25/00 20180101;
A61P 43/00 20180101; A61K 39/385 20130101; A61K 35/18 20130101;
A61K 9/5068 20130101; C12N 5/0641 20130101; A61P 7/06 20180101;
Y02A 50/30 20180101; A61P 7/00 20180101; A61P 9/00 20180101; C12N
2510/00 20130101; C07K 16/082 20130101; A61K 38/177 20130101; Y02A
50/473 20180101; A61K 47/6901 20170801; A61K 9/0019 20130101; A61K
38/177 20130101; A61K 2300/00 20130101; A61K 38/1774 20130101; A61K
2300/00 20130101 |
International
Class: |
C12N 5/078 20060101
C12N005/078; A61K 31/7088 20060101 A61K031/7088; A61K 9/00 20060101
A61K009/00; A61K 38/17 20060101 A61K038/17; A61K 9/50 20060101
A61K009/50; A61K 47/69 20060101 A61K047/69; A61K 39/385 20060101
A61K039/385; A61K 39/00 20060101 A61K039/00; C07K 16/08 20060101
C07K016/08; C12N 9/88 20060101 C12N009/88; A61K 35/18 20060101
A61K035/18 |
Claims
1. An enucleated erythroid cell comprising an exogenous polypeptide
comprising arginase or a functional fragment thereof, wherein the
enucleated erythroid cell is made by a process comprising
introducing into an erythroid cell precursor a nucleic acid
encoding the exogenous polypeptide.
2. The enucleated erythroid cell of claim 1, which comprises at
least 1,000 copies of the exogenous polypeptide.
3. The enucleated erythroid cell of claim 1, which comprises at
least 10,000 copies of the exogenous polypeptide.
4. The enucleated erythroid cell of claim 1, wherein the exogenous
polypeptide is intracellular.
5. The enucleated erythroid cell of claim 1, wherein the exogenous
polypeptide is on the surface of the enucleated erythroid cell.
6. The enucleated erythroid cell of claim 1, wherein the exogenous
polypeptide is not fused to an endogenous polypeptide.
7. The enucleated erythroid cell of claim 1, wherein the exogenous
polypeptide consists essentially of arginase.
8. The enucleated erythroid cell of claim 1, wherein the exogenous
polypeptide consists of arginase.
9. The enucleated erythroid cell of claim 1, further comprising a
second exogenous polypeptide comprising an arginine
transporter.
10. The enucleated erythroid cell of claim 1, which exhibits an
increase in arginase activity of at least 2-fold relative to that
of an enucleated erythroid cell that does not comprise the
exogenous polypeptide.
11. The enucleated erythroid cell of claim 1, which is a
reticulocyte.
12. The enucleated erythroid cell of claim 1, which is an
erythrocyte.
13. The enucleated erythroid cell of claim 1, which lacks A and B
antigens.
14. The enucleated erythroid cell of claim 1, which is a human
cell.
15. The enucleated erythroid cell of claim 1, which comprises fetal
hemoglobin.
16. The enucleated erythroid cell of claim 1, which exhibits
substantially the same osmotic membrane fragility as an isolated,
unmodified, uncultured enucleated erythroid cell.
17. The enucleated erythroid cell of claim 1, wherein introducing
the nucleic acid comprises using a lentiviral vector.
18. The enucleated erythroid cell of claim 1, wherein the process
comprises expanding the erythroid cell precursor by at least
20,000-fold in culture.
19. The enucleated erythroid cell of claim 1, wherein the nucleated
erythroid cell precursor is a CD34+ hematopoietic stem cell.
20. The enucleated erythroid cell of claim 1, wherein the nucleic
acid comprises DNA.
21. The enucleated erythroid cell of claim 1, wherein the nucleic
acid comprises RNA.
22. A pharmaceutical composition comprising a plurality of the
enucleated erythroid cells of claim 1 and a pharmaceutically
acceptable carrier.
23. The pharmaceutical composition of claim 22, which is formulated
for intravenous administration.
24. The pharmaceutical composition of claim 22, wherein at least
about 90% of enucleated erythroid cells in the pharmaceutical
composition comprise the exogenous polypeptide.
25. A pharmaceutical composition comprising (i) a plurality of the
enucleated erythroid cells of claim 1, wherein at least 70% of
cells in the pharmaceutical composition are enucleated, and (ii) a
pharmaceutically acceptable carrier.
26. The pharmaceutical composition of claim 25, wherein at least
90% of cells in the pharmaceutical composition are enucleated.
27. A nucleated erythroid cell precursor comprising an exogenous
polypeptide comprising arginase or a functional fragment thereof,
wherein the nucleated erythroid cell precursor was made by a
process comprising introducing an exogenous nucleic acid encoding
the exogenous polypeptide into the nucleated erythroid cell
precursor.
28. The nucleated erythroid cell precursor of claim 27, which has
been cultured after the introduction of the exogenous nucleic
acid.
29. A method of reducing arginine levels in a subject, comprising
administering to the subject the pharmaceutical composition of
claim 22, thereby reducing arginine levels in the subject.
30. A method of treating familial hyperarginemia in a subject in
need thereof, the method comprising administering to the subject
the pharmaceutical composition of claim 22, thereby treating said
familial hyperarginemia in the subject.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 15/899,895, filed Feb. 20, 2018, which is a
continuation of U.S. patent application Ser. No. 15/473,421, filed
Mar. 29, 2017, which is a continuation of U.S. patent application
Ser. No. 14/738,414, filed Jun. 12, 2015, which is a continuation
of U.S. patent application Ser. No. 14/581,486, filed Dec. 23,
2014, which is a continuation of International Application No.
PCT/US2014/065304, filed Nov. 12, 2014, entitled "Synthetic
Membrane-Receiver Complexes", which claims the benefit of U.S.
Provisional Application No. 61/962,867, filed Nov. 18, 2013; U.S.
Provisional Application No. 61/919,432, filed Dec. 20, 2013; U.S.
Provisional Application No. 61/973,764, filed Apr. 1, 2014; U.S.
Provisional Application No. 61/991,319, filed May 9, 2014; U.S.
Provisional Application No. 62/006,825, filed Jun. 2, 2014; U.S.
Provisional Application No. 62/006,829, filed Jun. 2, 2014; U.S.
Provisional Application No. 62/006,832, filed Jun. 2, 2014; U.S.
Provisional Application No. 62/025,367, filed Jul. 16, 2014; U.S.
Provisional Application No. 62/059,100, filed Oct. 2, 2014, all of
which are incorporated by reference herein in their entirety.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Feb. 17, 2015, is named 28345US_CRF_sequencelisting.txt and is
67,497 bytes in size.
FIELD OF THE INVENTION
[0003] The field of the invention is pharmaceutical compositions
for the treatment of diseases and disorders.
BACKGROUND
[0004] The circulatory system permits blood and lymph circulation
to transport, e.g., nutrients, oxygen, carbon dioxide, cellular
waste products, hormones, cytokines, blood cells, and pathogens to
and from cells in the body. Blood is a fluid comprising, e.g.,
plasma, red blood cells, white blood cells, and platelets that is
circulated by the heart through the vertebrate vascular system. The
circulatory system becomes a reservoir for many toxins and
pathogenic molecules upon their introduction to or production by
the body. The circulatory system also serves as a reservoir for
cellular secretions or detritus from within the body. The perpetual
or aberrant circulation and proliferation of such molecules and
entities can drive disease and/or exacerbate existing
conditions.
[0005] The efficacy of therapeutic compositions that alleviate or
prevent diseases and conditions associated with the circulatory
system is often limited by their half-life, which is typically up
to a few days. The short half-life often necessitates repeated
injections and hospitalizations. It is thought that the short
half-life may be due to both renal clearance, e.g., of proteins
smaller than 60 kDa, and non-renal clearance, e.g., via liver
excretion or immune-mediated removal. The activity of therapies is
also often limited by an immune reaction elicited against them
(see, e.g., Wang et al., Leukemia 2003, 17:1583). Several
approaches are practiced in the art.
[0006] One approach includes the use of "erythrocyte ghosts" that
are derived from a hemolyzed red blood cell. To prepare erythrocyte
ghosts, red blood cells undergo hypotonic lysis. The red blood
cells are exposed to low ionic strength buffer causing them to
burst. The resulting lysed cell membranes are isolated by
centrifugation. The pellet of lysed red blood cell membranes is
resuspended and incubated in the presence of the therapeutic agent,
for example, such as an antibiotic or chemotherapeutic agent in a
low ionic strength buffer. The therapeutic agent distributes within
the cells. Erythrocyte ghosts and derivatives used to encapsulate
payloads, such as therapeutic agents, can shield those payloads
from the immune system, but the erythrocyte ghosts themselves are
subject to rapid clearance by the reticulo-endothelial system (see,
e.g., Loegering et al. 1987 Infect Immun 55(9):2074). Erythrocyte
ghosts also elicit an immune response in mammalian subjects. These
vesicles are typically constituted of both lipids and proteins,
including potentially high amounts of phosphatidylserine, which is
normally found on the inner leaflet of the plasma membrane. This
leads to potential immunological reactions in the recipient
mammalian subjects. The undesirable effects seriously limit the
potential for therapeutic applications of technologies based on
erythrocyte ghosts.
[0007] Another approach for drug encapsulation includes the use of
exosomes. "Exosomes" include cell-derived vesicles that are present
in many and perhaps all biological fluids, including blood, urine,
and cultured medium of cell cultures. The reported diameter of
exosomes is between 30 and 100 nm, which is larger than low-density
lipoprotein (LDL), but smaller than, for example, red blood cells.
Exosomes are either released from the cell when multivesicular
bodies fuse with the plasma membrane or they are released directly
from the plasma membrane. Exosome delivery methods require a better
understanding of their biology, as well as the development of
production, characterization, targeting and cargo-loading
nanotechnologies. Attempts have been made to manufacture exosomes
using human embryonic stem cell derived mesenchymal stem cells
(hESC-MSCs). However, as hESC-MSCs are not infinitely expansible,
large scale production of exosomes would require replenishment of
hESC-MSC through derivation from hESCs and incur recurring costs
for testing and validation of each new batch (Chen et al. 2011
Journal of Translational Medicine 9:47). Clinical translation is
also hindered by the lack of suitable and scalable nanotechnologies
for the purification and loading of exosomes (Lakhal and Wood 2011
BioEssays 33(10):737). Current ultracentrifugation protocols are
commercially unreproducible, as they produce a heterogeneous mix of
exosomes, other cellular vesicles and macromolecular complexes.
Therefore, purification methods based on the use of specific,
desired markers, such as the expression of a targeting moiety on
the surface of the exosome, are required. In addition, siRNA
loading into exosomes is relatively inefficient and
cost-ineffective, highlighting the need for the development of
transfection reagents tailored for nanoparticle applications.
Further, exosomes are rapidly cleared from circulation and
substantially accumulate in the liver within 24 hours of
administration (Ohno et al., 2013 Mol Therapy 21(1):185), limiting
their application for long-term drug delivery to the circulatory of
a subject.
[0008] Polyethylene glycol-coated liposomes are presently used as
carriers for in vivo drug delivery. A "liposome" includes an
artificially-prepared spherical vesicle composed of a lamellar
phase lipid bilayer. The liposome can be used as a vehicle for
administration of nutrients and pharmaceutical agents. Liposomes
can be prepared by disrupting biological membranes, e.g., by
sonication. Liposomes are often composed of
phosphatidylcholine-enriched phospholipids and may also contain
mixed lipid chains with surfactant properties such as egg
phosphatidylethanolamine A liposome design may employ surface
ligands for attaching to a target, e.g., unhealthy tissue. Types of
liposomes include the multilamellar vesicle (MLV), the small
unilamellar liposome vesicle (SUV), the large unilamellar vesicle
(LUV), and the cochleate vesicle. Liposomes as cariers of
anthracycline antibiotics have been a subject of a great number of
studies. As a result, liposome formulations of daunorubicin
(DaunoXome.TM.) and doxorubicin (Doxil.TM.) are now commercially
available. The pharmacokinetics of the liposomal forms of
anthracycline antibiotics differ from that of their free forms in
higher peak concentrations and longer circulations times of the
drugs. The kinetics of DaunoXome and Doxil clearance from plasma is
close to mono-exponential. The half-life of DaumoXome in patient
plasma is on the order of a few hours. In Doxil, polyethylene
glycol-coated liposomes are used. The immune system poorly
recognizes such liposomes; therefore the plasma half-life of Doxil
is in the order of tens of hours.
[0009] Red blood cells have been considered for use, e.g., to
degrade toxic metabolites or inactivate xenobiotics, as drug
delivery systems, as carriers of antigens for vaccination, and in
other biomedical applications (Magnani Ed. 2003, Erythrocyte
Engineering for Drug Delivery and Targeting). Many of these
applications require procedures for the transient opening of pores
across the red cell membrane. Drugs have commonly been loaded into
freshly isolated red blood cells, without culturing, using
disruptive methods based on hypotonic shock. Hypotonic dialysis can
induce a high degree of hemolysis, irreversible modifications in
the morphology of the cells and phosphotidyl serine exposure, which
has been recognized as an important parameter associated with
premature red blood cells removal and induction of
transfusion-related pathologies (Favretto 2013 J Contr Rel).
[0010] Many drugs, particularly protein therapeutics, stimulate
immunogenic responses that include B cell antibody production, T
cell activation, and macrophage phagocytosis. The causes of
immunogenicity can be extrinsic or intrinsic to the protein.
Extrinsic factors are drug formulation, aggregate formation,
degradation products, contaminants and dosing. The administration
mode, as well as the drug regimen, also strongly influences how
immunogenicity is assessed. That is, immunogenicity will have
different effects for drugs that are given in acute indications
compared to drugs to treat chronic diseases. In the latter case,
patients are exposed to the drug over a longer period of time and
as such can mount a complete response. Pegylation is a technology
designed to prolong the half-life, as well as minimize immunogenic
responses. In contrast to assumptions that polyethylene glycol
(PEG) is non-immunogenic and non-antigenic, certain animal studies
show that uricase, ovalbumin and some other PEGylated agents can
elicit antibody formation against PEG (anti-PEG). In humans,
anti-PEG may limit therapeutic efficacy and/or reduce tolerance of
PEG-asparaginase (PEG-ASNase) in patients with acute lymphoblastic
leukemia and of pegloticase in patients with chronic gout, but did
not impair hyposensitization of allergic patients with
mPEG-modified ragweed extract or honeybee venom or the response to
PEG-IFN in patients with hepatitis C. Anti-PEG antibodies can be
found in 22-25% of healthy blood donors. Two decades earlier, the
occurrence was 0.2%. This increase may be due to an improvement of
the limit of detection of antibodies and to greater exposure to PEG
and PEG-containing compounds in cosmetics, pharmaceuticals and
processed food products. These results raise concerns regarding the
efficacy of PEG-conjugated drugs for a subset of patients (Garay,
Expert Opin Drug Deliv, 2012 9(11):1319).
[0011] Attempts in the art to create passive half-life improvement
methods focus on increasing the apparent hydrodynamic radius of a
drug. The kidney's glomerular filtration apparatus is the primary
site in the body where blood components are filtered, see for
reference e.g., Osicka et al. Clin Sci 1997 93:65 and Myers et al.
Kidney Int 1982 21:633. The main determinant of filtration is the
hydrodynamic radius of the molecule in the blood; smaller molecules
(<80 kDa) are filtered out of the blood to a higher extent than
larger molecules. Researchers have used this generalized rule to
modify drugs to exhibit a larger hydrodynamic radius and thus
longer half-life, mainly via chemical conjugation to large
molecular weight water-soluble polymers, such as polyethylene
glycol (PEG). Numerous PEGylated protein and small molecule
therapeutics are currently offered in the clinic (Pasut and
Veronese, 2009 Adv Drug Deliv Rev 61(13):1177; Fishburn, 2008 J
Pharm Sci 97(10):4167). Though effective in many cases in
increasing circulation half-life, especially as the hydrodynamic
radius of the graft or fusion increases (Gao, Liu, et al., 2009
PNAS 106(36):15231), these methods offer challenges in
manufacturing and maintenance of biological effector function.
Heterogeneities in conjugation reactions can cause complex product
mixtures with varying biological activities, due mostly to the
utilization of site-unspecific chemistries. Extensive biochemical
characterization often follows precise purification methods to
retain a homogenous therapeutic product (Huang, Gough, et al, 2009
Anal Chem 81(2):567; Bailon, Palleroni, et al., 2001 Bioconj Chem
12(2):195; Dhalluin, Ross, et al., 2005 Bioconj Chem 16(3):504).
Furthermore, attachment of large moieties, such as branched PEGs,
to reactive zones of proteins can lead to decreased receptor
affinity (Fishburn, 2008 J Pharm Sci 97(10):4167).
[0012] Albumin may be used to bind a therapeutic protein for
increased circulation of the drug (Dennis et al, 2002 J Bil Chem
277(38):35035; Walker, Dunlevy, et al., 2010 Prot Engr Des Sel
23(4):271) to increase the apparent size of the therapeutic by
engineering it to bind another protein in the blood. In this
manner, the drug attains its large molecular size only after
administration into the blood stream. The addition of
affinity-matured serum albumin-binding peptides to antibody
fragments increased their circulation time 24 fold in mice (Dennis
et al, 2002 J Bil Chem 277(38):35035). This method is complicated
by the dynamics of albumin recycle by the neonatal Fc receptor
(FcRn) and the use of cysteine-constrained cyclic peptides for
functionality. Alternatively, recombinant addition of large
antibody fragments may be made to a protein drug. This may cause
structural as well as manufacturing complications, e.g., because of
the use of complex cyclic or large domains for functionality.
Despite high affinity for albumin, they require the physical
constraint of correctly forming a cyclic structure prior to use.
Methods of fusing larger antibody fragments may not be amendable to
proteins with an already complex folding structure or low
expression yield.
[0013] The potential of chimeric antigen receptor T-cell therapies,
antibody-coupled T-cell receptor (ACTR) therapies and other
adoptive T-cell therapies in effecting complete and durable
responses has been demonstrated in a number of malignant and
infectious diseases. The development of more potent T cells is
limited, however, by safety concerns, highlighted by the occurrence
of on-target and off-target toxicities that, although uncommon,
have been fatal on occasions. Timely pharmacological intervention
can be effective in the management of adverse events but adoptively
transferred T cells can persist long term, along with any unwanted
effects. T cells targeting differentiation antigens can be expected
to also recognize nonmalignant cells that express the same
antigens, resulting in adverse events. For example, melanoma
patients treated with T cells targeting melanocyte differentiation
antigens, such as MART-1 and gp100, often develop vitiligo and
uveitis. These on-target toxicities have been observed across all
forms of therapeutic approaches, including tumor-infiltrating
cells, in vitro-expanded T-cell clones and TCR-transgenic cells. In
general, on-target autoimmunity is associated with tumor regression
and is more prominent in treatment approaches that are more
efficacious. On-target but off-tumour toxicities can be immediately
life-threatening. For example, patients with colorectal cancer with
lung and liver metastases may develop respiratory distress within
15 min of HER2-specific CAR T-cell infusion and may subsequently
die from multiorgan failure 5 days later. As T-cell therapy becomes
more effective, acute toxicities have also become more evident.
Cytokine release syndrome, which is characterized by fevers,
rigors, hypotension and hypoxia, has been observed in a number of
CD19 CAR T-cell studies as a result of large-scale T-cell
activation upon the recognition of CD19+ malignant cells.
[0014] There is an ongoing need to provide therapeutic compositions
through the circulatory system that alleviate or prevent such
diseases and conditions. There is a further a need for methods and
compositions that increase the half-life, safety profile, and/or
efficacy of such therapeutic compositions. Aspects of the invention
address one or more of the shortcomings of current methods and
compositions.
SUMMARY OF THE INVENTION
[0015] In some aspects, disclosed herein is a method of reducing
the circulatory concentration of a target self-antibody. The method
comprises the steps of administering to a human subject suffering
from or at risk of developing a self-antibody mediated disease,
disorder or condition, a pharmaceutical composition comprising a
synthetic membrane-receiver polypeptide complex, wherein the
pharmaceutical composition is administered in an amount effective
to substantially reduce the circulatory concentration of the target
self-antibody.
[0016] In certain embodiments, the synthetic membrane-receiver
polypeptide complex has a volume of distribution equal to the
plasma volume of the subject.
[0017] In other embodiments, the synthetic membrane-receiver
polypeptide complex has a volume of distribution of less than 0.09
l/kg.
[0018] In certain embodiments, the method comprises administering
the pharmaceutical composition at least twice over a treatment
period such that the self-antibody mediated disease, disorder or
condition is treated, or a symptom thereof is decreased.
[0019] In other embodiments, the method comprises administering the
pharmaceutical composition at least twice over a treatment period
such that the self-antibody mediated disease, disorder or condition
is prevented.
[0020] In yet other embodiments, the method comprises administering
the pharmaceutical composition a sufficient number of times over a
treatment period such that the circulatory concentration of the
target self-antibody is substantially decreased during the
treatment period.
[0021] In yet other embodiments, the method comprises administering
the pharmaceutical composition a sufficient number of times over a
treatment period such that the circulatory concentration of the
target self-antibody is substantially decreased during the
treatment period such that one or more symptoms of the
self-antibody mediated disease, disorder or condition is prevented,
decreased or delayed.
[0022] In yet other embodiments, the method comprises administering
the pharmaceutical composition a sufficient number of times over a
treatment period such that the circulatory concentration of the
target self-antibody is decreased at a rate greater than i) the
endogenous clearance rate of the target self-antibody by the human
subject, or ii) the endogenous production rate of the target
self-antibody by the human subject, or iii) both i) and ii).
[0023] In some embodiments, the circulatory concentration of the
target self-antibody is decreased by at least about 1%, 5%, 10%,
15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%,
80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, or
greater than 99.99% during part or the entirety of the treatment
period.
[0024] In other embodiments, the circulatory concentration of the
target self-antibody is decreased by at least about 1%, 5%, 10%,
15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%,
80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, or
greater than 99.99% within about 1, 5, 10, 15, 20, 30, 40, or 50
minutes, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, or 23 hours, or 1, 2, 3, 4, 5, or 6
days or about 1, 2, 3, 4, 5, or 6 weeks of the administration.
[0025] In some embodiments, the method comprises administering the
pharmaceutical composition a sufficient number of times a treatment
period such that the circulatory concentration of the target
self-antibody is substantially decreased for at least about one
week, two weeks, three weeks, four weeks, one month, two months,
three months, four months, five months, six months, or greater than
six months.
[0026] In other embodiments, the method comprises administering the
pharmaceutical composition a sufficient number of times a treatment
period such that the circulatory concentration of the target
self-antibody is substantially decreased for a period of time at
least as long as the treatment period.
[0027] In some embodiments, the treatment period is not longer than
a year, six months, three months, two months, one month, two weeks,
one week, three days, two days, one day.
[0028] In some embodiments, the time interval between
administrations within a treatment period is no longer than the
period in which the number of synthetic membrane-receiver
polypeptide complexes in circulation is reduced to less than about
5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%,
70%, 75%, 80%, 85%, 90%, or 95% of the number of synthetic
membrane-receiver polypeptide complexes present in the administered
pharmaceutical composition.
[0029] In other embodiments, the frequency of administration is
sufficient to effectively reduce the circulatory concentration of
the target self-antibody below a level that is associated with a
symptom of the self-antibody mediated disease, disorder or
condition.
[0030] In some embodiments, the administering of the pharmaceutical
composition reduces the concentration of unbound target
self-antibody or the concentration of total target self-antibody in
the circulatory system of the subject.
[0031] In some embodiments, the concentration of total target
self-antibody is approximately equal to the concentration of
unbound and bound target self-antibody in the circulatory system of
the subject.
[0032] In certain embodiments, the pharmaceutical composition
further comprises a pharmaceutically active agent.
[0033] In certain embodiments, the method further comprises the
step of administering a pharmaceutically active agent, wherein the
pharmaceutically active agent is administered prior to, after, or
concurrent with the pharmaceutical composition.
[0034] In some embodiments, the pharmaceutical composition is
administered topically or parenterally.
[0035] In some embodiments, the pharmaceutically active agent is
selected from a biological agent, a small molecule agent, or a
nucleic acid agent.
[0036] In some embodiments, the pharmaceutical composition further
comprises a pharmaceutically acceptable carrier.
[0037] In some embodiments, the method further comprises the step
of selecting for treatment a subject suffering from or at risk of a
self-antibody mediated disease, disorder or condition selected from
the group consisting of: type I diabetes, multiple sclerosis,
ulcerative colitis, lupus, immune thrombocytopenia purpura, warm
antibody hemolytic anemia, cold agglutinin disease, Goodpasture
syndrome, antiphospholipid antibody syndrome, and membranous
glomerulonephritis.
[0038] In some embodiments, the synthetic membrane-receiver
polypeptide complex is formulated for short-term duration in the
circulatory system of the subject.
[0039] In other embodiments, the synthetic membrane-receiver
polypeptide complex is formulated for long-term duration in the
circulatory system of the subject.
[0040] In some embodiments, the receiver polypeptide is not
substantially disassociated from the membrane in the circulatory
system of the subject.
[0041] In some embodiments, the receiver polypeptide is present in
the circulatory system for at least 21 days.
[0042] In certain embodiments, the synthetic membrane-receiver
polypeptide complex comprises phosphatidylcholine, sphingomyelin,
lysophosphatidylcholine, phosphatidylethanolamine,
phosphatidylserine, phosphatidylinositol, or phosphatidic acid.
[0043] In some embodiments, the synthetic membrane-receiver
polypeptide complex further comprises i) a CD47, CD55, or CD59
polypeptide or a functional fragment thereof, or ii) a cell
membrane polypeptide, or iii) both i) and ii).
[0044] In some embodiments, the synthetic membrane-receiver
polypeptide complex comprises a CD47, CD55, or CD59 polypeptide or
a functional fragment thereof in an amount effective for the
polypeptide complex to reside in the circulatory system for
long-term duration.
[0045] In some embodiments, the synthetic membrane-receiver
polypeptide complex does not contain a substantial amount of a
replicating nucleic acid.
[0046] In some embodiments, the synthetic membrane-receiver
polypeptide complex comprises at least 10 copies, 100 copies, 1,000
copies, 10,000 copies, 25,000 copies, 50,000 copies, or 100,000
copies of the receiver polypeptide, and/or wherein the synthetic
membrane-receiver polypeptide complex comprises a ratio of the
receiver polypeptide relative to a membrane lipid selected from the
group consisting of phosphatidylcholine, sphingomyelin,
lysophosphatidylcholine, phosphatidylethanolamine,
phosphatidylserine, phosphatidylinositol, or phosphatidic acid.
[0047] In certain embodiments, the synthetic membrane-receiver
polypeptide complex comprises at least a second polypeptide in
addition to the receiver polypeptide.
[0048] In certain embodiments, the synthetic membrane-receiver
polypeptide complex has catalytic activity for more than one
substrate independent of the receiver polypeptide.
[0049] In some embodiments, the second polypeptide is associated
with the membrane.
[0050] In certain embodiments, the receiver polypeptide is encoded
by an exogenous nucleic acid.
[0051] In certain embodiments, the exogenous nucleic acid is not
substantially retained by the synthetic membrane-receiver
polypeptide complex.
[0052] In some embodiments, the expression of the receiver
polypeptide is effectively terminated.
[0053] In some embodiments, the receiver polypeptide is associated
with the membrane.
[0054] In other embodiments, the receiver polypeptide is a fusion
or a chimera.
[0055] In some embodiments, the fusion or chimera comprises at
least one of an S domain, an A domain or a U domain, wherein the S
domain is a surface domain exposed to the environment around the
synthetic membrane-receiver polypeptide complex, wherein the A
domain is an anchor, wherein the U domain faces the unexposed side
of the synthetic membrane-receiver polypeptide complex, and wherein
the S domain, the A domain, and/or the U domain are of different
polypeptide origin.
[0056] In some embodiments, the S domain and/or the A domain
comprises at least 6 or at least 30 amino acids.
[0057] In certain embodiments, the target self-antibody
specifically recognizes glycoprotein (GP Ib-IX, IIb-IIIa, IV, or
Ia-IIa), the NC1 domain of collagen .alpha.3 (IV), B2
glycoprotein-1, or phospholipase A2 receptor.
[0058] In certain embodiments, the receiver polypeptide comprises
an antigenic polypeptide selected from the group consisting of
glycoprotein (GP Ib-IX, IIb-IIIa, IV, or Ia-IIa), the NC1 domain of
collagen .alpha.3 (IV), B2 glycoprotein-1, or phospholipase A2
receptor, or an antigenic fragment thereof.
[0059] In some embodiments, the S domain comprises the antigenic
polypeptide or antigenic fragment thereof.
[0060] In some aspects, provided herein is a pharmaceutical
composition administered by the methods disclosed herein.
[0061] In certain embodiments, the pharmaceutical composition
further comprises a pharmaceutically acceptable carrier.
[0062] In certain embodiments, the pharmaceutical composition
comprises a population of synthetic membrane-receiver polypeptide
complexes.
[0063] In some embodiments, the pharmaceutical composition
comprises at least 1.times.10.sup.5 synthetic membrane-receiver
polypeptide complexes. In certain embodiments, the synthetic
membrane-receiver polypeptide complexes are provided in a volume of
about 10 nl, 100 nl, 1 .mu.l, 10 .mu.l, 100 .mu.l, 1 ml, 10 ml, 20
ml, or 50 ml.
[0064] In certain embodiments, the pharmaceutical composition
comprises at least 1.times.10.sup.11 synthetic membrane-receiver
polypeptide complexes. In certain embodiments, the synthetic
membrane-receiver polypeptide complexes are provided in a volume of
about 1 ml, 10 ml, 20 ml, 50 ml, 100 ml, 250 ml, or 500 ml.
[0065] In certain embodiments, the pharmaceutical composition is a
composition formulated for long-term storage.
[0066] In certain embodiments, the pharmaceutical composition is a
composition which is frozen.
[0067] In some embodiments, the pharmaceutical composition
comprises a pharmaceutically active agent.
[0068] In certain embodiments, the pharmaceutically active agent is
selected from a biological agent, a small molecule agent, or a
nucleic acid agent.
[0069] In some aspects, provided herein is a dosage form comprising
the compositions disclosed herein formulated as a liquid suspension
for intravenous injection.
[0070] In some aspects, provided herein is a medical device
comprising a container holding the pharmaceutical compositions
disclosed herein and an applicator for intravenous injection of the
pharmaceutical composition to the subject.
[0071] In some aspects, provided herein is a medical kit comprising
the pharmaceutical compositions disclosed herein and a medical
device for intravenous injection of the pharmaceutical composition
to the subject.
[0072] In some aspects, provided herein is the synthetic
membrane-receiver polypeptide complex of the pharmaceutical
composition administered by the methods disclosed herein.
[0073] In some aspects, provided herein is a population of
synthetic membrane-receiver polypeptide complexes as disclosed
herein.
[0074] In some embodiments, the population of synthetic
membrane-receiver polypeptide complexes are formulated as a
liquid.
[0075] In other embodiments, the population of synthetic
membrane-receiver polypeptide complexes are frozen.
[0076] In some aspects, provided herein is an isolated receiver
polypeptide of the synthetic membrane-receiver polypeptide complex
as disclosed herein.
[0077] In some aspects, provided herein is an exogenous nucleic
acid encoding the receiver polypeptide disclosed herein.
[0078] In some aspects, provided herein is a synthetic
membrane-receiver polypeptide complex comprising: a receiver
polypeptide capable of interacting with a target, and a membrane
comprising a second polypeptide, wherein the synthetic
membrane-receiver polypeptide complex has catalytic activity
independent of the receiver.
[0079] In some embodiments, the synthetic membrane-receiver
polypeptide complex is formulated for intravenous administration to
the circulatory system of a mammalian subject, which for example
can be a human.
[0080] In certain embodiments, the receiver polypeptide is capable
of reducing the concentration of unbound target or total target in
the circulatory system of the subject.
[0081] In certain embodiments, the synthetic membrane-receiver
polypeptide complex has a volume of distribution approximately
equal or equivalent to the plasma volume of the subject.
[0082] In some embodiments, the synthetic membrane-receiver
polypeptide complex has a volume of distribution of less than 0.09
l/kg.
[0083] In some embodiments, the receiver polypeptide is present in
the circulatory system for substantially the duration of the
synthetic membrane-receiver polypeptide complex in the circulatory
system of the subject.
[0084] In some embodiments, the synthetic membrane-receiver
polypeptide complex is formulated for short-term duration in the
circulatory system of the subject.
[0085] In some embodiments, the synthetic membrane-receiver
polypeptide complex is formulated for long-term duration in the
circulatory system of the subject.
[0086] In certain embodiments, the receiver polypeptide is present
in the circulatory system for at least about 21 days.
[0087] In certain embodiments, the synthetic membrane-receiver
polypeptide complex comprises phosphatidylcholine, sphingomyelin,
lysophosphatidylcholine, phosphatidylethanolamine,
phosphatidylserine, phosphatidylinositol, or phosphatidic acid.
[0088] In other embodiments, the synthetic membrane-receiver
polypeptide complex further comprises a CD47, CD55, or CD59
polypeptide or a functional fragment thereof.
[0089] In other embodiments, the synthetic membrane-receiver
polypeptide complex comprises a CD47, CD55, or CD59 polypeptide or
a functional fragment thereof in an amount effective for the
complex to reside in the circulatory system for long-term
duration.
[0090] In some embodiments, the interaction of the complex with a
target comprises binding, degrading, cleaving and/or sequestering
the target.
[0091] In other embodiments, the interaction of the complex with a
target comprises altering an activity of the target.
[0092] In other embodiments, the interaction of the complex with a
target comprises reducing an activity of the target.
[0093] In other embodiments, the interaction of the complex with a
target comprises inactivating the target.
[0094] In some embodiments, the target is a self-antibody, a
complement protein, an immune complex, a serum amyloid protein, a
metabolite or a toxin.
[0095] In other embodiments, the target is an inflammatory
molecule, a cytokine or a chemokine.
[0096] In other embodiments, the target is a lipid or a
carbohydrate, an amino acid.
[0097] In other embodiments, the target is a virus, a viral
antigen, an envelope antigen or a capsid antigen.
[0098] In other embodiments, the target is a bacterium, a bacterial
antigen, a bacterial surface antigen, a secreted bacterial toxin,
or a secreted bacterial antigen.
[0099] In other embodiments, the target is a fungus, a fungal
antigen, a fungal cell surface antigen, a secreted fungal toxin, or
a secreted fungal antigen.
[0100] In other embodiments, the target is DNA or RNA.
[0101] In other embodiments, the target is a circulating cell, an
inflammatory cell, a tumor cell, or a metastatic cancer cell.
[0102] In certain embodiments, the receiver polypeptide is a
complement receptor 1 (CR1) polypeptide, a variant or functional
fragment thereof.
[0103] In some embodiments, the CR1 polypeptide comprises one or
more Short Consensus Repeats (SCRs), Complement Control Proteins
(CCPs) and/or Long Homologous Repeats (LHRs).
[0104] In certain embodiments, the receiver polypeptide is a duffy
antigen receptor complex (DARC), a variant or functional fragment
thereof.
[0105] In other embodiments, the receiver polypeptide is an
antibody, a single-chain variable fragment, a nanobody, a diabody,
or a DARPin.
[0106] In other embodiments, the receiver polypeptide is a lyase, a
hydrolase, a protease, or a nuclease.
[0107] In other embodiments, the receiver polypeptide is exposed to
the environment around the synthetic receiver polypeptide
complex.
[0108] In other embodiments, the receiver polypeptide is located at
the unexposed side of the synthetic receiver polypeptide
complex.
[0109] In other embodiments, the receiver polypeptide is associated
with the membrane.
[0110] In other embodiments, the receiver polypeptide is a fusion
or a chimera.
[0111] In certain embodiments, the fusion or chimera comprises at
least one of an S domain, an A domain or a U domain, wherein the S
domain is a surface domain exposed to the environment around the
synthetic membrane-receiver polypeptide complex, wherein the A
domain is an anchor, wherein the U domain faces the unexposed side
of the synthetic membrane-receiver polypeptide complex, and wherein
the S domain, the A domain, and/or the U domain are of different
polypeptide origin.
[0112] In some embodiments, the S domain and/or the A domain
comprises at least 6 or at least 30 amino acids.
[0113] In certain embodiments, the synthetic membrane-receiver
polypeptide complex comprises at least 10 copies, 100 copies, 1,000
copies, 10,000 copies, 25,000 copies, 50,000 copies, or 100,000
copies of the receiver polypeptide, and/or wherein the synthetic
membrane-receiver polypeptide complex comprises a ratio of the
receiver polypeptide relative to a membrane lipid selected from the
group consisting of phosphatidylcholine, sphingomyelin,
lysophosphatidylcholine, phosphatidylethanolamine,
phosphatidylserine, phosphatidylinositol, or phosphatidic acid.
[0114] In certain embodiments, the receiver polypeptide is encoded
by a recombinant nucleic acid.
[0115] In certain embodiments, the recombinant nucleic acid is not
retained by the synthetic membrane-receiver polypeptide
complex.
[0116] In certain embodiments, the expression of the receiver
polypeptide is effectively terminated.
[0117] In certain embodiments, the synthetic membrane-receiver
polypeptide complex does not contain a substantial amount of a
replicating nucleic acid.
[0118] In some aspects, provided herein is a pharmaceutical
composition comprising a population of synthetic membrane-receiver
polypeptide complexes as disclosed herein and a pharmaceutically
acceptable carrier.
[0119] In certain embodiments, the pharmaceutical composition
comprises at least 1.times.10.sup.5 synthetic membrane-receiver
complexes.
[0120] In some embodiments, the synthetic membrane-receiver
complexes are provided in a volume of about 10 nl, 100 nl, 1 .mu.l,
10 .mu.l, 100 .mu.l, 1 ml, 10 ml, 20 ml, or 50 ml.
[0121] In certain embodiments, the pharmaceutical composition
comprises at least 1.times.10.sup.11 synthetic membrane-receiver
complexes.
[0122] In some embodiments, the synthetic membrane-receiver
complexes are provided in a volume of about 1 ml, 10 ml, 20 ml, 50
ml, 100 ml, 250 ml, or 500 ml.
[0123] In some embodiments, the pharmaceutical composition is a
composition formulated for long-term storage.
[0124] In some embodiments, the pharmaceutical composition is a
composition which is frozen.
[0125] In certain embodiments, the pharmaceutical composition
comprises a pharmaceutically active agent.
[0126] In some embodiments, the pharmaceutically active agent is
selected from a biological agent, a small molecule agent, or a
nucleic acid agent.
[0127] In some aspects, provided herein is a dosage form comprising
the pharmaceutical compositions disclosed herein formulated as a
liquid suspension for intravenous injection.
[0128] In some aspects, provided herein is a medical device
comprising a container holding the pharmaceutical composition
disclosed herein and an applicator for intravenous injection of the
pharmaceutical composition to a subject.
[0129] In some aspects, provided herein is a medical kit comprising
the pharmaceutical composition disclosed herein and a medical
device for intravenous injection of the pharmaceutical composition
to a subject.
[0130] In some aspects, provided herein is a method of treating or
preventing a disease, disorder or condition associated with the
presence of or the concentration of a target in the circulatory
system of a mammalian subject. The method comprises administering
intravenously to the subject the pharmaceutical compositions
disclosed herein in an amount effective to treat or prevent
disease, disorder or condition.
[0131] In certain embodiments, the target is associated with the
disease, disorder or condition.
[0132] In some aspects, provided herein is a method of modulating
the circulatory concentration of a target. The method comprises
administering to a mammalian subject suffering from or at risk of
developing a disease, disorder or condition associated with the
presence, absence, elevated or depressed concentration of the
target in the circulatory system of the subject, a pharmaceutical
composition comprising a synthetic membrane-receiver polypeptide
complex in an amount effective to substantially modulate the
circulatory concentration of the target.
[0133] In certain embodiments, the synthetic membrane-receiver
polypeptide complex has a volume of distribution equal to the
plasma volume of the subject.
[0134] In certain embodiments, the administration is repeated when
the amount of synthetic membrane-receiver polypeptide complexes in
circulation is reduced to 50% of i) the concentration of the
complexes that were first administered or ii) Cmax of the synthetic
membrane-receiver polypeptide complexes in circulation.
[0135] In certain embodiments, the synthetic membrane-receiver
polypeptide complex interacts with the target in circulation.
[0136] In certain embodiments, the interaction with the target
comprises binding, degrading, cleaving and/or sequestering the
target.
[0137] In other embodiments, the interaction with a target
comprises altering an activity of the target.
[0138] In other embodiments, the interaction with the target
comprises reducing an activity of the target.
[0139] In other embodiments, the interaction with the target
comprises inactivating the target.
[0140] In other embodiments, the interaction with the target
comprises catalytically converting the target.
[0141] In certain embodiments, modulating consists of reducing the
circulatory concentration of the target.
[0142] In certain embodiments, the presence or elevated level of
the target in the circulatory system of the subject is associated
with the disease, disorder or condition.
[0143] In certain embodiments, the method further comprises
increasing the circulatory concentration of a non-target
compound.
[0144] In certain embodiments, the absence or depressed level of
the non-target compound in the circulatory system of the subject is
associated with the disease, disorder or condition.
[0145] In certain embodiments, the target is a biological compound,
an inorganic compound, an organic compound, a gaseous compound or
an element.
[0146] In certain embodiments, the target is less than 1000 Da,
less than 500 Da, less than 250 Da, or less than 100 Da.
[0147] In certain embodiments, the target is more than 1 kDa.
[0148] In certain embodiments, the target is a polypeptide, a
lipid, a carbohydrate, a nucleic acid, an amino acid, metabolite,
or a small molecule.
[0149] In other embodiments, the target is an antibody, a
complement factor, an immune complex, a serum amyloid protein, a
bacterial pathogen, a fungal pathogen, a viral pathogen, or an
infected, pathogenic, apoptotic, necrotic, aberrant or oncogenic
mammalian cell.
[0150] In other embodiments, the target is an amyloid
polypeptide.
[0151] In other embodiments, the target is a complement
polypeptide.
[0152] In certain embodiments, the substantial modulation of the
circulatory concentration of the target is reversible.
[0153] In other embodiments, the substantial modulation of the
circulatory concentration of the target is temporally
restricted.
[0154] In other embodiments, the substantial modulation of the
circulatory concentration of the target is spatially
restricted.
[0155] In some aspects, disclosed herein is a method of reducing
the circulatory concentration of a target serum amyloid protein.
The method comprises the steps of administering to a mammalian
subject suffering from or at risk of developing an amyloidosis, a
pharmaceutical composition comprising a synthetic membrane-receiver
complex, wherein the pharmaceutical composition is administered in
an amount effective to substantially reduce the circulatory
concentration of the target serum amyloid protein.
[0156] In certain embodiments, the synthetic membrane-receiver
complex has a volume of distribution equal to the plasma volume of
the subject. In some embodiments, the synthetic membrane-receiver
complex has a volume of distribution of less than 0.09 l/kg.
[0157] In certain embodiments, the method comprises administering
the pharmaceutical composition at least twice over a treatment
period such that the amyloidosis is treated, or a symptom thereof
is decreased.
[0158] In other embodiments, the method comprises administering the
pharmaceutical composition at least twice over a treatment period
such that the amyloidosis is prevented.
[0159] In yet other embodiments, the method comprises administering
the pharmaceutical composition a sufficient number of times over a
treatment period such that the circulatory concentration of the
target serum amyloid protein is substantially decreased during the
treatment period.
[0160] In yet other embodiments, the method comprises administering
the pharmaceutical composition a sufficient number of times over a
treatment period such that the circulatory concentration of the
target serum amyloid protein is substantially decreased during the
treatment period such that one or more symptom of the amyloidosis
is prevented, decreased or delayed.
[0161] In yet other embodiments, the method comprises administering
the pharmaceutical composition a sufficient number of times over a
treatment period such that the circulatory concentration of the
target serum amyloid protein is decreased at a rate greater than i)
the endogenous clearance rate of the target serum amyloid protein
by the mammalian subject, or ii) the endogenous production rate of
the target serum amyloid protein by the mammalian subject, or iii)
both i) and ii).
[0162] In some embodiments, the circulatory concentration of the
target serum amyloid protein is decreased by at least about 1%, 5%,
10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%,
or greater than 99.99% during part or the entirety of the treatment
period.
[0163] In other embodiments, the circulatory concentration of the
target serum amyloid protein is decreased by at least about 1%, 5%,
10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%,
or greater than 99.99% within about 1, 5, 10, 15, 20, 30, 40, or 50
minutes, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, or 23 hours, or 1, 2, 3, 4, 5, or 6
days or about 1, 2, 3, 4, 5, or 6 weeks of the administration.
[0164] In some embodiments, the method comprises administering the
pharmaceutical composition a sufficient number of times a treatment
period such that the circulatory concentration of the target serum
amyloid protein is substantially decreased for at least about one
week, two weeks, three weeks, four weeks, one month, two months,
three months, four months, five months, six months, or greater than
six months.
[0165] In other embodiments, the method comprises administering the
pharmaceutical composition a sufficient number of times a treatment
period such that the circulatory concentration of the target serum
amyloid protein is substantially decreased for a period of time at
least as long as the treatment period.
[0166] In some embodiments, the treatment period is not longer than
a year, six months, three months, two months, one month, two weeks,
one week, three days, two days, one day.
[0167] In some embodiments, the time interval between
administrations within a treatment period is no longer than the
period in which the number of synthetic membrane-receiver complexes
in circulation is reduced to less than about 5%, 10%, 15%, 20%,
25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, or 95% of the number of synthetic membrane-receiver complexes
present in the administered pharmaceutical composition.
[0168] In other embodiments, the frequency of administration is
sufficient to effectively reduce the circulatory concentration of
the target serum amyloid protein below a level that is associated
with a symptom of the amyloidosis.
[0169] In some embodiments, the administering of the pharmaceutical
composition reduces the concentration of unbound target serum
amyloid protein or the concentration of total target serum amyloid
protein in the circulatory system of the subject.
[0170] In some embodiments, the concentration of total target serum
amyloid protein is approximately equal to the concentration of
unbound and bound target serum amyloid protein in the circulatory
system of the subject.
[0171] In some embodiments, the method further comprises the step
of selecting for treatment a subject suffering from or at risk of
an amyloidosis selected from the group consisting of: A amyloidosis
(AA), Ig light chain amyloidosis (AL), transthyretin (TTR)
amyloidosis, and fibrinogen amyloidosis.
[0172] In certain embodiments, the target serum amyloid protein is
selected from the group consisting of: amyloid P protein, amyloid A
protein, light chain, misfolded transthyretin, and fibrinogen alpha
chain.
[0173] In some embodiments, the receiver is associated with the
membrane. Optionally, the receiver is a fusion or a chimera. If
desired, the fusion or chimera may comprise at least one of an S
domain, an A domain or a U domain, wherein the S domain is a
surface domain exposed to the environment around the synthetic
membrane-receiver complex, wherein the A domain is an anchor,
wherein the U domain faces the unexposed side of the synthetic
membrane-receiver complex, and wherein the S domain, the A domain,
and/or the U domain are of different polypeptide origin. In some
embodiments, the S domain and/or the A domain comprise a
polypeptide comprising at least 6 or at least 30 amino acids. In
some embodiments, the S domain comprises the antigenic polypeptide
or antigenic fragment thereof.
[0174] In some aspects, disclosed herein is a method of reducing
the circulatory concentration of a target immune complex. The
method comprises the steps of administering to a mammalian subject
suffering from or at risk of developing an immune
complex-associated disease, disorder or condition, a pharmaceutical
composition comprising a synthetic membrane-complement receptor 1
(CR1) receiver complex, wherein the pharmaceutical composition is
administered in an amount effective to substantially reduce the
circulatory concentration of the target immune complex.
[0175] In certain embodiments, the synthetic membrane-CR1 receiver
complex has a volume of distribution equal to the plasma volume of
the subject. In some embodiments, the synthetic membrane-CR1
receiver complex has a volume of distribution of less than 0.09
l/kg.
[0176] In certain embodiments, the method comprises administering
the pharmaceutical composition at least twice over a treatment
period such that the immune complex-associated disease, disorder or
condition is treated, or a symptom thereof is decreased.
[0177] In other embodiments, the method comprises administering the
pharmaceutical composition at least twice over a treatment period
such that the immune complex-associated disease, disorder or
condition is prevented.
[0178] In yet other embodiments, the method comprises administering
the pharmaceutical composition a sufficient number of times over a
treatment period such that the circulatory concentration of the
target immune complex is substantially decreased during the
treatment period.
[0179] In yet other embodiments, the method comprises administering
the pharmaceutical composition a sufficient number of times over a
treatment period such that the circulatory concentration of the
target immune complex is substantially decreased during the
treatment period such that one or more symptom of the a immune
complex-associated disease, disorder or condition is prevented,
decreased or delayed.
[0180] In yet other embodiments, the method comprises administering
the pharmaceutical composition a sufficient number of times over a
treatment period such that the circulatory concentration of the
target immune complex is decreased at a rate greater than i) the
endogenous clearance rate of the target immune complex by the
mammalian subject, or ii) the endogenous production rate of the
target immune complex by the mammalian subject, or iii) both i) and
ii).
[0181] In some embodiments, the circulatory concentration of the
target immune complex is decreased by at least about 1%, 5%, 10%,
15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%,
80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, or
greater than 99.99% during part or the entirety of the treatment
period.
[0182] In other embodiments, the circulatory concentration of the
target immune complex is decreased by at least about 1%, 5%, 10%,
15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%,
80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, or
greater than 99.99% within about 1, 5, 10, 15, 20, 30, 40, or 50
minutes, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, or 23 hours, or 1, 2, 3, 4, 5, or 6
days or about 1, 2, 3, 4, 5, or 6 weeks of the administration.
[0183] In some embodiments, the method comprises administering the
pharmaceutical composition a sufficient number of times a treatment
period such that the circulatory concentration of the target immune
complex is substantially decreased for at least about one week, two
weeks, three weeks, four weeks, one month, two months, three
months, four months, five months, six months, or greater than six
months.
[0184] In other embodiments, the method comprises administering the
pharmaceutical composition a sufficient number of times a treatment
period such that the circulatory concentration of the target immune
complex is substantially decreased for a period of time at least as
long as the treatment period.
[0185] In some embodiments, the treatment period is not longer than
a year, six months, three months, two months, one month, two weeks,
one week, three days, two days, one day.
[0186] In some embodiments, the time interval between
administrations within a treatment period is no longer than the
period in which the number of synthetic membrane-CR1 receiver
complexes in circulation is reduced to less than about 5%, 10%,
15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%,
80%, 85%, 90%, or 95% of the number of synthetic membrane-CR1
receiver complexes present in the administered pharmaceutical
composition.
[0187] In other embodiments, the frequency of administration is
sufficient to effectively reduce the circulatory concentration of
the target immune complex below a level that is associated with a
symptom of the immune complex-associated disease, disorder or
condition.
[0188] In some embodiments, the administering of the pharmaceutical
composition reduces the concentration of unbound target immune
complex or the concentration of total target immune complex in the
circulatory system of the subject.
[0189] In some embodiments, the concentration of total target
immune complex is approximately equal to the concentration of
unbound and bound target immune complex in the circulatory system
of the subject.
[0190] In some embodiments, the method further comprises the step
of selecting for treatment a subject suffering from or at risk of a
immune complex-associated disease, disorder or condition selected
from the group consisting of: IgA nephropathy and lupus
nephritis.
[0191] In certain embodiments, the target immune complex comprises
i) IgM or IgG, and ii) C3b and/or C4b.
[0192] In some embodiments, the receiver is associated with the
membrane. Optionally, the receiver is a fusion or a chimera. If
desired, the fusion or chimera may comprise at least one of an S
domain, an A domain or a U domain, wherein the S domain is a
surface domain exposed to the environment around the synthetic
membrane-CR1 receiver complex, wherein the A domain is an anchor,
wherein the U domain faces the unexposed side of the synthetic
membrane-CR1 receiver complex, and wherein the S domain, the A
domain, and/or the U domain are of different polypeptide origin. In
some embodiments, the S domain and/or the A domain comprise a
polypeptide comprising at least 6 or at least 30 amino acids. In
some embodiments, the S domain comprises the antigenic polypeptide
or antigenic fragment thereof.
[0193] In certain embodiments, the CR1 receiver polypeptide
comprises one or more of any one of a complement control protein
(CCP) module, a short consensus repeat (SCR), and/or a long
homologous repeat (LHRs)
[0194] In some aspects, disclosed herein is a method of reducing
the circulatory concentration of a target complement protein. The
method comprises the steps of administering to a mammalian subject
suffering from or at risk of developing a disease, disorder or
condition associated with the dysregulation of a complement
protein, a pharmaceutical composition comprising a synthetic
membrane-receiver complex, wherein the pharmaceutical composition
is administered in an amount effective to substantially reduce the
circulatory concentration of the target complement protein.
[0195] In certain embodiments, the synthetic membrane-receiver
complex has a volume of distribution equal to the plasma volume of
the subject. In some embodiments, the synthetic membrane-receiver
complex has a volume of distribution of less than 0.09 l/kg.
[0196] In certain embodiments, the method comprises administering
the pharmaceutical composition at least twice over a treatment
period such that the disease, disorder or condition associated with
the dysregulation of a complement protein is treated, or a symptom
thereof is decreased.
[0197] In other embodiments, the method comprises administering the
pharmaceutical composition at least twice over a treatment period
such that the disease, disorder or condition associated with the
dysregulation of a complement protein is prevented.
[0198] In yet other embodiments, the method comprises administering
the pharmaceutical composition a sufficient number of times over a
treatment period such that the circulatory concentration of the
target complement protein is substantially decreased during the
treatment period.
[0199] In yet other embodiments, the method comprises administering
the pharmaceutical composition a sufficient number of times over a
treatment period such that the circulatory concentration of the
target complement protein is substantially decreased during the
treatment period such that one or more symptom of the disease,
disorder or condition associated with the dysregulation of a
complement protein is prevented, decreased or delayed.
[0200] In yet other embodiments, the method comprises administering
the pharmaceutical composition a sufficient number of times over a
treatment period such that the circulatory concentration of the
target complement protein is decreased at a rate greater than i)
the endogenous clearance rate of the target complement protein by
the mammalian subject, or ii) the endogenous production rate of the
target complement protein by the mammalian subject, or iii) both i)
and ii).
[0201] In some embodiments, the circulatory concentration of the
target complement protein is decreased by at least about 1%, 5%,
10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%,
or greater than 99.99% during part or the entirety of the treatment
period.
[0202] In other embodiments, the circulatory concentration of the
target complement protein is decreased by at least about 1%, 5%,
10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%,
or greater than 99.99% within about 1, 5, 10, 15, 20, 30, 40, or 50
minutes, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, or 23 hours, or 1, 2, 3, 4, 5, or 6
days or about 1, 2, 3, 4, 5, or 6 weeks of the administration.
[0203] In some embodiments, the method comprises administering the
pharmaceutical composition a sufficient number of times a treatment
period such that the circulatory concentration of the target
complement protein is substantially decreased for at least about
one week, two weeks, three weeks, four weeks, one month, two
months, three months, four months, five months, six months, or
greater than six months.
[0204] In other embodiments, the method comprises administering the
pharmaceutical composition a sufficient number of times a treatment
period such that the circulatory concentration of the target
complement protein is substantially decreased for a period of time
at least as long as the treatment period.
[0205] In some embodiments, the treatment period is not longer than
a year, six months, three months, two months, one month, two weeks,
one week, three days, two days, one day.
[0206] In some embodiments, the time interval between
administrations within a treatment period is no longer than the
period in which the number of synthetic membrane-receiver complexes
in circulation is reduced to less than about 5%, 10%, 15%, 20%,
25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, or 95% of the number of synthetic membrane-receiver complexes
present in the administered pharmaceutical composition.
[0207] In other embodiments, the frequency of administration is
sufficient to effectively reduce the circulatory concentration of
the target complement protein below a level that is associated with
a symptom of the disease, disorder or condition associated with the
dysregulation of a complement protein.
[0208] In some embodiments, the administering of the pharmaceutical
composition reduces the concentration of unbound target complement
protein or the concentration of total target complement protein in
the circulatory system of the subject.
[0209] In some embodiments, the concentration of total target
complement protein is approximately equal to the concentration of
unbound and bound target complement protein in the circulatory
system of the subject.
[0210] In some embodiments, the method further comprises the step
of selecting for treatment a subject suffering from or at risk of a
disease, disorder or condition associated with the dysregulation of
a complement protein selected from the group consisting of:
atypical hemolytic-uremic syndrome (aHUS), paroxysmal nocturnal
hemoglobinuria (PNH), age-related macular degeneration, autoimmune
hemolytic anemia, complement factor I deficiency, and non-alcoholic
steatohepatitis.
[0211] In certain embodiments, the target complement protein is
selected from the group consisting of: C1q, C1r, C1s, C2, C3, C4,
C5, C6, C7, C8, and C9.
[0212] In some aspects, disclosed herein is a method of modulating
the circulatory concentration of a target metabolite. The method
comprises the steps of administering to a mammalian subject
suffering from or at risk of developing a metabolic disease,
disorder or condition, a pharmaceutical composition comprising a
synthetic membrane-receiver complex, wherein the pharmaceutical
composition is administered in an amount effective to substantially
modulate the circulatory concentration of the target
metabolite.
[0213] In certain embodiments, the synthetic membrane-receiver
complex has a volume of distribution equal to the plasma volume of
the subject. In some embodiments, the synthetic membrane-receiver
complex has a volume of distribution of less than 0.09 l/kg.
[0214] In certain embodiments, the method comprises administering
the pharmaceutical composition at least twice over a treatment
period such that the metabolic disease, disorder or condition is
treated, or a symptom thereof is decreased.
[0215] In other embodiments, the method comprises administering the
pharmaceutical composition at least twice over a treatment period
such that the metabolic disease, disorder or condition is
prevented.
[0216] In yet other embodiments, the method comprises administering
the pharmaceutical composition a sufficient number of times over a
treatment period such that the circulatory concentration of the
target metabolite is substantially decreased during the treatment
period.
[0217] In yet other embodiments, the method comprises administering
the pharmaceutical composition a sufficient number of times over a
treatment period such that the circulatory concentration of a
metabolite is substantially increased during the treatment
period.
[0218] In yet other embodiments, the method comprises administering
the pharmaceutical composition a sufficient number of times over a
treatment period such that the circulatory concentration of the
target metabolite is substantially decreased during the treatment
period such that one or more symptom of the a metabolic disease,
disorder or condition is prevented, decreased or delayed.
[0219] In yet other embodiments, the method comprises administering
the pharmaceutical composition a sufficient number of times over a
treatment period such that the circulatory concentration of a
metabolite is substantially increased during the treatment period
such that one or more symptom of the a metabolic disease, disorder
or condition is prevented, decreased or delayed.
[0220] In yet other embodiments, the method comprises administering
the pharmaceutical composition a sufficient number of times over a
treatment period such that the circulatory concentration of the
target metabolite is decreased at a rate greater than i) the
endogenous clearance rate of the target metabolite by the mammalian
subject, or ii) the endogenous production rate of the target
metabolite by the mammalian subject, or iii) both i) and ii).
[0221] In yet other embodiments, the method comprises administering
the pharmaceutical composition a sufficient number of times over a
treatment period such that the circulatory concentration of a
metabolite is increased at a rate greater than i) the endogenous
clearance rate of a metabolite by the mammalian subject, or ii) the
endogenous production rate of a metabolite by the mammalian
subject, or iii) both i) and ii).
[0222] In some embodiments, the circulatory concentration of the
target metabolite is decreased by at least about 1%, 5%, 10%, 15%,
20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%,
85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, or greater
than 99.99% during part or the entirety of the treatment
period.
[0223] In some embodiments, the circulatory concentration of a
metabolite is increased by at least about 1%, 5%, 10%, 15%, 20%,
25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, or greater than
99.99% during part or the entirety of the treatment period.
[0224] In other embodiments, the circulatory concentration of the
target metabolite is decreased by at least about 1%, 5%, 10%, 15%,
20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%,
85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, or greater
than 99.99% within about 1, 5, 10, 15, 20, 30, 40, or 50 minutes,
or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, or 23 hours, or 1, 2, 3, 4, 5, or 6 days or
about 1, 2, 3, 4, 5, or 6 weeks of the administration.
[0225] In other embodiments, the circulatory concentration of a
metabolite is increased by at least about 1%, 5%, 10%, 15%, 20%,
25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, or greater than
99.99% within about 1, 5, 10, 15, 20, 30, 40, or 50 minutes, or
about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, or 23 hours, or 1, 2, 3, 4, 5, or 6 days or
about 1, 2, 3, 4, 5, or 6 weeks of the administration.
[0226] In some embodiments, the method comprises administering the
pharmaceutical composition a sufficient number of times a treatment
period such that the circulatory concentration of the target
metabolite is substantially decreased for at least about one week,
two weeks, three weeks, four weeks, one month, two months, three
months, four months, five months, six months, or greater than six
months.
[0227] In some embodiments, the method comprises administering the
pharmaceutical composition a sufficient number of times a treatment
period such that the circulatory concentration of a metabolite is
substantially increased for at least about one week, two weeks,
three weeks, four weeks, one month, two months, three months, four
months, five months, six months, or greater than six months.
[0228] In other embodiments, the method comprises administering the
pharmaceutical composition a sufficient number of times a treatment
period such that the circulatory concentration of the target
metabolite is substantially decreased for a period of time at least
as long as the treatment period.
[0229] In other embodiments, the method comprises administering the
pharmaceutical composition a sufficient number of times a treatment
period such that the circulatory concentration of a metabolite is
substantially increased for a period of time at least as long as
the treatment period.
[0230] In some embodiments, the treatment period is not longer than
a year, six months, three months, two months, one month, two weeks,
one week, three days, two days, one day.
[0231] In some embodiments, the time interval between
administrations within a treatment period is no longer than the
period in which the number of synthetic membrane-receiver complexes
in circulation is reduced to less than about 5%, 10%, 15%, 20%,
25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, or 95% of the number of synthetic membrane-receiver complexes
present in the administered pharmaceutical composition.
[0232] In other embodiments, the frequency of administration is
sufficient to effectively reduce the circulatory concentration of
the target metabolite below a level that is associated with a
symptom of the metabolic disease, disorder or condition.
[0233] In other embodiments, the frequency of administration is
sufficient to effectively increase the circulatory concentration of
a metabolite above a level that is associated with a symptom of the
metabolic disease, disorder or condition.
[0234] In some embodiments, the administering of the pharmaceutical
composition reduces the concentration of unbound target metabolite
or the concentration of total target metabolite in the circulatory
system of the subject.
[0235] In some embodiments, the concentration of total target
metabolite is approximately equal to the concentration of unbound
and bound target metabolite in the circulatory system of the
subject.
[0236] In some embodiments, the administering of the pharmaceutical
composition increases the concentration of an unbound metabolite or
the concentration of total metabolite in the circulatory system of
the subject.
[0237] In some embodiments, the method further comprises the step
of selecting for treatment a subject suffering from or at risk of a
metabolic disease, disorder or condition selected from the group
consisting of: Phenylketonuria (PKU), Adenosine Deaminase
Deficiency-Severe Combined Immunodeficiency (ADA-SCID),
Mitochondrial Neurogastrointestinal Encephalopathy (MNGIE), Primary
Hyperoxaluria, Alkaptonuria, and Thrombotic Thrombocytopenic
Purpura (TTP).
[0238] In certain embodiments, the target metabolite is selected
from the group consisting of: Phenylalanine, Adenosine, Thymidine,
Deoxyuridine, Oxalate, Homogentisate, von Willenbrand Factor.
[0239] In some embodiments, the receiver is associated with the
membrane. Optionally, the receiver is a fusion or a chimera. If
desired, the fusion or chimera may comprise at least one of an S
domain, an A domain or a U domain, wherein the S domain is a
surface domain exposed to the environment around the synthetic
membrane-receiver complex, wherein the A domain is an anchor,
wherein the U domain faces the unexposed side of the synthetic
membrane-receiver complex, and wherein the S domain, the A domain,
and/or the U domain are of different polypeptide origin. In some
embodiments, the S domain and/or the A domain comprise a
polypeptide comprising at least 6 or at least 30 amino acids. In
some embodiments, the S domain comprises the antigenic polypeptide
or antigenic fragment thereof.
[0240] In certain embodiments, the receiver polypeptide is selected
from the group consisting of: Phenylalanine Hydroxylase, Adenosine
Deaminase, Thymidine Phosphorylase, Glyoxalate Reductase,
Homogentisate Reductase, ADAMTS13.
[0241] Aspects of the invention relate to synthetic membrane
receiver complexes that comprise non-polypeptide receivers, such as
nucleic acids, lipids, carbohydrates and/or small molecules. In
some embodiments, the receiver is associated with the membrane.
Optionally, the receiver is a fusion or a chimera with a
polypeptide. If desired, the fusion or chimera may comprise at
least one of an S domain, an A domain or a U domain, wherein the S
domain is a surface domain exposed to the environment around the
synthetic membrane-receiver complex, wherein the A domain is an
anchor, wherein the U domain faces the unexposed side of the
synthetic membrane-receiver complex, and wherein the S domain, the
A domain, and/or the U domain are of different origin. In some
embodiments, the S domain and/or the A domain comprise a
polypeptide comprising at least 6 or at least 30 amino acids. In
some embodiments, the S domain comprises the antigenic polypeptide
or antigenic fragment thereof.
[0242] In certain embodiments, the pharmaceutical compositions
described herein comprise a population of synthetic
membrane-receiver complexes such as at least 1.times.10.sup.5
synthetic membrane-receiver complexes, optionally in a volume of
about 10 nl, 100 nl, 1 .mu.l, 10 .mu.l, 100 .mu.l, 1 ml, 10 ml, 20
ml, or 50 ml. In certain embodiments, the pharmaceutical
compositions described herein comprise a population of synthetic
membrane-receiver complexes such as at least 1.times.10.sup.11
synthetic membrane-receiver complexes, optionally in a volume of
about 1 ml, 10 ml, 20 ml, 50 ml, 100 ml, 250 ml, or 500 ml.
[0243] In some aspects, provided herein is the synthetic
membrane-receiver complex of the pharmaceutical composition
administered by the methods disclosed herein.
[0244] In some aspects, provided herein is a population of
synthetic membrane-receiver complexes as disclosed herein.
Optionally, the population of synthetic membrane-receiver complexes
is formulated as a liquid. Alternatively, the population of
synthetic membrane-receiver complexes is frozen.
[0245] In some aspects, provided herein is an isolated receiver of
the synthetic membrane-receiver complex as disclosed herein.
[0246] In some aspects, provided herein is an exogenous nucleic
acid encoding the receiver disclosed herein.
[0247] In some aspects, provided herein is a synthetic
membrane-receiver complex comprising: a receiver capable of
interacting with a target, and a membrane comprising a polypeptide
that is not the receiver, wherein the synthetic membrane-receiver
complex has catalytic activity independent of the receiver.
[0248] In some embodiments, the synthetic membrane-receiver complex
comprises a receiver that is not a polypeptide.
[0249] In some embodiments, any synthetic membrane-receiver complex
described herein, including those comprising a polypeptide
receiver, optionally comprise a payload, such as a therapeutic
agent.
[0250] Aspects of the invention relate to isolated, enucleated
erythroid cell comprising a receiver polypeptide that is
functionally active when the enucleated erythroid cell is
administered to the circulatory system of a subject. In some
embodiments, the erythroid cell is a human cell.
[0251] Aspects of the invention relate to isolated, functional
erythroid precursor cell comprising a receiver polypeptide that is
encoded by an exogenous nucleic acid, wherein the expression of the
receiver polypeptide does not substantially alter: the expression
of a surface marker, selected from the group consisting of GPA,
cKit, and TR when the functional erythroid precursor cell
differentiates; the rate of enucleation when the functional
erythroid precursor cell terminally matures; and/or the rate of
expansion when the functional erythroid precursor cell expands in
culture, wherein the alteration is compared to an isolated,
uncultured erythroid precursor cell of the same stage and lineage
not comprising the polypeptide receiver.
[0252] Aspects of the invention relate to isolated erythroid cell
populations comprising a plurality of functional erythroid cells
comprising a receiver polypeptide localized to an exterior surface
of the erythroid cells, wherein the population is substantially
free of non-erythroid cells. In some embodiments, the population
comprises greater than 5-95% of enucleated erythroid cells.
[0253] Aspects of the invention relate to isolated erythroid cell
populations comprising a plurality of functional erythroid cells
comprising a receiver polypeptide encoded by an exogenous nucleic
acid, wherein during enucleation the receiver polypeptide is
retained by the erythroid cell whereas the exogenous nucleic acid
is not retained. In some embodiments, the population comprises
greater than 5-95% of enucleated erythroid cells, optionally in the
absence of: i) an enrichment step and/or ii) co-culturing with
non-erythroid cells.
[0254] Aspects of the invention relate to isolated erythroid cell
populations comprising a plurality of functional erythroid cells
comprising a receiver polypeptide encoded by an exogenous nucleic
acid, wherein during enucleation the receiver polypeptide is
retained by the erythroid cell whereas the exogenous nucleic acid
is not retained, and wherein the resulting functional enucleated
erythroid cell exhibits substantially the same osmotic membrane
fragility as an isolated, uncultured erythroid cell not comprising
the polypeptide receiver.
[0255] Aspects of the invention relate to isolated erythroid cell
populations comprising a plurality of functional erythroid
precursor cells in substantially the same stage of differentiation
and/or cell cycle stage, wherein the precursor cells comprise an
exogenous nucleic acid encoding a receiver polypeptide, and wherein
a majority of erythrocyte precursor cells is capable of
differentiating into mature erythrocytes that retain the receiver
polypeptide without retaining the exogenous nucleic acid.
[0256] Aspects of the invention relate to isolated erythroid cell
populations comprising a plurality of functional erythroid cells
comprising a receiver polypeptide, wherein an exogenous nucleic
acid encoding the receiver polypeptide is introduced into a
cultured or freshly isolated erythroid cell precursor and wherein
after introduction of the exogenous nucleic acid the functional
erythroid cells expand from the precursor cells by more than
20,000-fold in culture. In some embodiments, the population
comprises greater than 5-95% of enucleated erythroid cells,
optionally in the absence of: i) an enrichment step and/or ii)
co-culturing with non-erythroid cells.
[0257] Aspects of the invention relate to an isolated erythroid
cell population that is cultured from a functional erythrocyte
precursor cell comprising an exogenous nucleic acid, the population
comprising: a pyrenocyte, a functional nucleated erythroid cell and
a functional enucleated erythroid cell, wherein the functional
nucleated erythroid cell and the functional enucleated erythroid
cell comprise an receiver polypeptide encoded by the exogenous
nucleic acid, and wherein the receiver polypeptide is retained by
the functional enucleated erythroid cell, whereas the exogenous
nucleic acid is not retained by the enucleated erythroid cell. In
some embodiments, the enucleated, functional erythroid cell
exhibits substantially the same osmotic membrane fragility as an
isolated, uncultured erythroid cell not comprising the polypeptide
receiver.
[0258] In some embodiments, the erythroid cell populations
described herein comprise greater than 1%, 2%, 3%, 4%, 5%, 6%, 7%,
8%, 9% or greater than 10% fetal hemoglobin.
[0259] In some embodiments, the functional erythroid cell exhibits
at least 10 copies, 100 copies, 1,000 copies, 10,000 copies, 25,000
copies, 50,000 copies, or 100,000 copies of the receiver
polypeptide per cell.
[0260] In certain embodiments, a plurality of functional erythroid
cells loses a substantial portion of its cell membrane after being
administered to the circulatory system of a subject.
[0261] In certain embodiments, the functional erythroid cells
comprise a receiver polypeptide that interacts with a target. In
some embodiments, interacting with a target comprises binding to
the target, degrading the target, cleaving the target, and/or
sequestering the target.
[0262] In some embodiments, the receiver polypeptide is displayed
on the cell surface. In other embodiments, the receiver polypeptide
is localized in the interior of the functional erythroid cell.
[0263] In certain embodiments, the functional erythroid cells
comprise a receiver polypeptide that is selected from the group
consisting of: an antibody, a single-chain variable fragment, a
nanobody, a diabody, a darbin, a lyase, a hydrolase, a protease, a
nuclease, and a DNase.
[0264] In some embodiments, the functional erythroid cells comprise
a receiver polypeptide that interacts with a target that is
selected from the group consisting of: an immune complex, an
inflammatory molecule, an inflammatory cell, a lipid, a
carbohydrate, an amino acid, a virus, a bacterium, a bacterial
toxin, a fungus, a fungal toxin, a DNA, an RNA, a cell, a
circulating cell, a tumor cell, a metastatic cancer cell, a
metabolite, a plant toxin, a cytokine, a chemokine, a complement
cascade factor, and a clotting cascade factor.
[0265] In some embodiments, the functional erythroid cells comprise
a receiver polypeptide that is fused to an endogenous polypeptide.
In certain embodiments, the endogenous polypeptide is an
intracellular polypeptide. In some embodiments, the endogenous
polypeptide is an extracellular polypeptide. In some embodiments,
the endogenous polypeptide is membrane-bound.
[0266] In some embodiments, the functional erythroid cells comprise
a receiver polypeptide that is fused to an endogenous extracellular
polypeptide.
[0267] In some embodiments, the functional erythroid cells comprise
a receiver polypeptide that conjugated to the erythroid cell.
[0268] In some embodiments, the functional erythroid cells comprise
a receiver polypeptide that interacts with the target
intercellularly.
[0269] In some embodiments, the functional erythroid cells comprise
a receiver polypeptide that is localized in the cytosol of the
erythroid cell.
[0270] In some embodiments, the functional erythroid cells comprise
a receiver polypeptide that is located in the cell membrane of the
erythroid cell.
[0271] In certain embodiments, the functional erythroid cells
comprise a plurality of receiver polypeptides. In some embodiments,
a first receiver polypeptide is located in the cytosol of the
functional erythroid cell and a second receiver polypeptide is
located on the cell surface of the functional erythroid cell.
[0272] In some embodiments, the functional erythroid cells comprise
a receiver polypeptide that is an Fv portion of an antibody that
binds a botulinum toxin and the target is a botulinum toxin.
[0273] In other embodiments, the functional erythroid cells
comprise a receiver polypeptide that is a complement receptor 1 and
the target is a circulating immune complex.
[0274] In yet other embodiments, the functional erythroid cells
comprise a receiver polypeptide that is a duffy antigen receptor
complex (DARC) and the target is a circulating chemokine.
[0275] In some embodiments, the functional erythroid cells comprise
a receiver polypeptide that is phenylalanine hydroxylase (PAH) and
the target is phenylalanine.
[0276] In some embodiments, the functional erythroid cells comprise
a receiver polypeptide that is expressed as a fusion of the
C-terminus of a cytoplasmic beta globin protein.
[0277] In other embodiments, the functional erythroid cells
comprise a receiver polypeptide that is an exonuclease and wherein
the target is a circulating cell-free DNA molecule.
[0278] In yet other embodiments, the functional erythroid cells
comprise a receiver polypeptide that is expressed as a fusion of
the N-terminus of endogenous glycophorin A.
[0279] In some embodiments, the functional erythroid cells comprise
a receiver polypeptide that is attached extracellularly on the
erythroid cell by covalent bond formation. In some embodiments, the
covalent bond is formed by an isopeptidase. In some embodiments,
the isopeptidase is SpyTag/SpyCatcher. In some embodiments, the
SpyTag is expressed on the surface of the cell. In some
embodiments, the SpyTag is fused to an extracellular terminus of a
transmembrane protein. In some embodiments, the SpyTag is an
in-frame fusion in an extracellular region of a multi-pass membrane
protein. In some embodiments, the SpyTag is fused to a GPI-linked
protein. In some embodiments, the SpyCatcher is fused to the
receiver polypeptide. In some embodiments, the receiver polypeptide
fused to SpyCatcher is expressed and/or secreted in the same
functional erythroid cell that expresses the SpyTag fusion. In some
embodiments, the receiver polypeptide fused to SpyCatcher is
expressed by an exogenous protein production system and then
contacted with the functional erythroid cell that expresses the
SpyTag fusion. In some embodiments, the SpyTag is replaced with
SpyCatcher and the SpyCatcher is replaced with SpyTag. In some
embodiments, the receiver polypeptide is anchored intracellularly
in the functional erythroid cell by covalent bond formation. In
some embodiments, the covalent bond is formed by an isopeptidase.
In some embodiments, the isopeptidase is SpyTag/SpyCatcher. In some
embodiments, the SpyTag is expressed in the intracellular space of
the cell. In some embodiments, the SpyTag is fused to an
intracellular terminus of a membrane protein. In some embodiments,
the SpyTag is an in-frame fusion in an intracellular region of a
multi-pass membrane protein. In some embodiments, the SpyTag is
fused to an endogenous intracellular protein. In some embodiments,
the SpyTag is fused to a cytoskeletal protein. In some embodiments,
the SpyCatcher is fused to the receiver polypeptide. In some
embodiments, the receiver polypeptide fused to SpyCatcher is
expressed in the intracellular space of the same functional
erythroid cell that expresses the SpyTag fusion. In some
embodiments, the SpyTag is replaced with SpyCatcher and the
SpyCatcher is replaced with SpyTag.
[0280] Aspects of the invention relate to methods of generating
functional erythroid cells comprising a receiver polypeptide, the
methods comprising contacting an erythroid cell with a receiver and
exposing the erythroid cell to a controlled cell injury. In certain
embodiments, the controlled cell injury is cell deformation,
electroporation, sonoporation, liposomal transfection, or
salt-based transfection. In some embodiments, the cell is contacted
with an mRNA that encodes the receiver polypeptide. In some
embodiments, the contacting results in an uptake and translation of
the mRNA encoding the receiver polypeptide by the erythroid cell or
erythriod cell precursor.
[0281] In certain embodiments, the populations of erythroid cells
described herein are maintained and/or propagated in vitro. In
other embodiments, the populations of erythroid cells described
herein are lyophilized. In yet other embodiments, the populations
of erythroid cells described herein are frozen.
[0282] Aspects of the invention relate to methods of contacting a
target comprising: introducing into a biological sample or a
subject the erythroid cell populations described herein, and
maintaining the contact of the erythroid cell population with the
sample or subject for a time sufficient for a functional erythroid
cell from the population to interact with a target in the sample or
subject. In some embodiments, interacting with a target comprises
binding to the target, degrading the target, cleaving the target,
and/or sequestering the target. In certain embodiments, the methods
of contacting a target are carried out in vitro. In other
embodiments, the methods of contacting a target are carried out in
vivo, e.g. in an animal. In some embodiments, the methods of
contacting a target further comprise contacting the target with an
assayable moiety. In some embodiments, the assayable moiety is used
to determine the rate and/or degree of interaction between the
functional erythroid cell and the target.
[0283] Aspects of the invention relate to pharmaceutical
compositions comprising the erythroid cell populations comprising
the functional erythroid cells comprising a receiver described
herein. Optionally, the pharmaceutical compositions comprising the
erythroid cell populations further comprise a pharmaceutically
acceptable carrier. Optionally the the pharmaceutical compositions
comprising the erythroid cell populations further comprise a
therapeutic agent.
[0284] Aspects of the invention relate to methods of treating,
preventing, or managing a disease or condition, comprising
administering to a subject in need of such treatment, prevention or
management, a therapeutically or prophylactically effective amount
of the pharmaceutical composition comprising a population of
functional erythroid cells comprising a receiver, thereby treating,
preventing, or managing the disease or condition.
[0285] Aspects of the invention relate to pharmaceutical
compositions comprising a population of functional erythroid cells
comprising a receiver for use in any of the methods of treatment or
prevention described herein. In some embodiments, the receiver
polypeptide interacts with a target residing in the circulatory
system of the subject. In some embodiments, the presence, absence,
elevated or depressed level of the target is associated with a
disease, disorder or condition. In some embodiments, interacting
with a target comprises binding to the target, degrading the
target, cleaving the target, and/or sequestering the target. In
some embodiments, the administration of the pharmaceutical
compositions comprising a population of functional erythroid cells
comprising a receiver results in a substantial reduction of the
concentration or number of the target in the circulatory system of
the subject.
[0286] Aspects of the invention relate to pharmaceutical
compositions comprising a plurality of functional erythroid cells
comprising a receiver polypeptide, wherein the erythroid cells
exhibit the receiver polypeptide in or on the cell, and wherein the
receiver polypeptide when the functional erythroid cell is
administered to the circulatory system of a subject: does not
substantially affect the circulation clearance time of the
functional erythroid cell when compared to a unmodified erythroid
cell in a control animal, and/or does not activate fibrinogen
breakdown, measured by circulating levels of fibrinopeptide A
and/or fibrinopeptide B, compared to an unmodifed erythroid
cell.
[0287] Aspects of the invention relate to methods for culturing the
functional erythroid cell population of described herein,
comprising using one or more culturing factors selected from the
group consisting of stem cell factor, IL-3, IL-6, insulin,
transferrin, erythropoietin, hydrocortisone, and estrogens to
culture the functional erythroid cells.
[0288] Aspects of the invention relate to populations of at least
10.sup.10 cells comprising at least 10% reticulocytes of the same
blood group, wherein a plurality of the reticulocytes comprises a
receiver polypeptide.
[0289] Aspects of the invention relate to a pharmaceutical
composition comprising a synthetic membrane-receiver polypeptide
complex for use in the treatment of any of the diseases, disorders,
or conditions disclosed herein.
[0290] Aspects of the invention relate to a pharmaceutical
composition comprising a synthetic membrane-receiver polypeptide
complex for use in the treatment of a disease, disorder, or
condition associated with the presence of or the concentration of a
target in the circulatory system of a mammalian subject.
[0291] Aspects of the invention relate to a pharmaceutical
composition comprising a synthetic membrane-receiver polypeptide
complex for use in the modulation of the circulatory concentration
of a target.
BRIEF DESCRIPTION OF THE FIGURES
[0292] The figures are meant to be illustrative of one or more
features, aspects, or embodiments of the invention and are not
intended to be limiting.
[0293] FIG. 1A-FIG. 1F is a collection of flow cytometry plots of
red blood cells contacted with fluorescently labeled IgG
encapsulated within liposomes. Cells are shown that are incubated
with no liposomes (FIG. 1A, FIG. 1D), a low dose of liposomes (FIG.
1B, FIG. 1E), and a high dose of liposomes (FIG. 1C, FIG. 1F). On
the bottom histograms, the percentage of cells that are fluorescent
is shown.
[0294] FIG. 2 is a plot of cell surface expression levels assessed
by quantitative flow cytometry. The plot shows of various cell
surface receptors--glycophorin A (solid triangles), cKIT (dashed
squares), transferrin receptor (dotted diamonds)--and an exogenous
surface transgene (open circles) during the course of erythroid
cell differentiation.
[0295] FIG. 3A-FIG. 3AP is a collection of flow cytometry plots and
Western blots that demonstrate the expression of a vast array of
exemplary receivers on the surface, in the cytoplasm, as fusions,
and as intact proteins, in three cell types, enucleated erythroid
cells, nucleated erythroid precursor cells, and erythroleukemic
cells.
[0296] FIG. 3 A-FIG. 3N shows the exogenous expression of surface
and cytoplasmic proteins on enucleated cultured erythroid
cells.
[0297] FIG. 3A--Expression of glycophorin A with an HA epitope tag
at the cytoplasmic C terminus assessed by expression of
co-translated GFP.
[0298] FIG. 3B--Expression of glycophorin A with an HA epitope tag
at the N terminus between the leader sequence and the body of the
gene assessed by anti-HA staining.
[0299] FIG. 3C--Expression of complement receptor 1-derived
fragment of .about.70 kDa with an HA epitope tag at the N terminus
assessed by anti-HA staining.
[0300] FIG. 3D--Expression of antibody scFv as N terminal fusion to
glycophorin A assessed by anti-HA staining.
[0301] FIG. 3E--Expression of antibody scFv fused to C terminus of
Kell-derived fragment of 71 amino acids assessed by anti-HA
staining.
[0302] FIG. 3F--Expression of antibody scFv fused to C terminus of
Kell-derived fragment of 79 amino acids assessed by anti-HA
staining.
[0303] FIG. 3G--Expression of CD55 with HA epitope tag at the
extracellular N terminus after the leader sequence assessed by
anti-HA staining.
[0304] FIG. 3H--Expression of CD59 with HA epitope tag at the
extracellular N terminus after the leader sequences assessed by
anti-HA staining.
[0305] FIG. 3I--Expression of antibody scFv fused to N-terminus of
CD55-derived fragment of 37 amino acids, assessed by anti-HA
Western blot.
[0306] FIG. 3J--Cytoplasmic expression of adenosine deaminase fused
to HA tag assessed by anti-HA Western blot. Expected size
approximately 40 kDa.
[0307] FIG. 3K--Cytoplasmic expression of phenylalanine hydroxylase
fused to HA tag assessed by anti-HA Western blot. Expected size
approximately 33 kDa.
[0308] FIG. 3L--Cytoplasmic expression of phenylalanine hydroxylase
fused to adenosine deaminase and an HA tag assessed by anti-HA
Western blot.
[0309] FIG. 3M--Cytoplasmic expression of adenosine deaminase fused
to the intracellular C terminus of glycophorin A assessed by
anti-HA Western blot. Expected size approximately 55 kDa.
[0310] FIG. 3N--Cytoplasmic expression of phenylalanine hydroxylase
fused to the intracellular C terminus of glycophorin A assessed by
anti-HA Western blot. Expected size approximately 50 kDa.
[0311] FIG. 3O-FIG. 3AJ shows the exogenous expression of surface
and cytoplasmic proteins on nucleated cultured erythroid precursor
cells.
[0312] FIG. 3O--Expression of glycophorin A with an HA epitope tag
at the cytoplasmic C terminus assessed by expression of
co-translated GFP.
[0313] FIG. 3P--Expression of glycophorin A with an HA epitope tag
at the N terminus between the leader sequence and the body of the
gene assessed by anti-HA staining.
[0314] FIG. 3Q--Overexpression of complement receptor 1 assessed by
anti-CR1 staining.
[0315] FIG. 3R--Expression of complement receptor 1-derived
fragment of .about.70 kDa with an HA epitope tag at the N terminus
assessed by anti-HA staining.
[0316] FIG. 3S--Expression of complement receptor 1-derived
fragment of .about.210 kDa with an HA epitope tag at the N terminus
assessed by anti-HA staining.
[0317] FIG. 3T--Expression of complement receptor 1-derived
fragment of .about.230 kDa fused to the N terminus of glycophorin A
with an HA epitope tag at the N terminus assessed by anti-HA
staining.
[0318] FIG. 3U--Expression of antibody scFv as N terminal fusion to
glycophorin A assessed by anti-HA staining.
[0319] FIG. 3V--Expression of antibody scFv fused to the
extracellular C terminus of Kell, assessed by anti-HA staining.
Expected size approximately 108 kDa.
[0320] FIG. 3W--Expression of HA tag fused to the extracellular C
terminus of Kell, assessed by anti-HA staining.
[0321] FIG. 3X--Expression of Kell-derived fragment of 71 amino
acids with HA tag at the C (extracellular) terminus assessed by
anti-HA staining.
[0322] FIG. 3Y--Expression of Kell-derived fragment of 79 amino
acids with HA tag at the C terminus assessed by anti-HA
staining.
[0323] FIG. 3Z--Expression of antibody scFv fused to C terminus of
Kell-derived fragment of 71 amino acids assessed by anti-HA
staining.
[0324] FIG. 3AA--Expression of antibody scFv fused to C terminus of
Kell-derived fragment of 79 amino acids assessed by anti-HA
staining.
[0325] FIG. 3AB--Expression of CD55 with HA epitope tag at the
extracellular N terminus after the leader sequence assessed by
anti-HA staining
[0326] FIG. 3AC--Expression of CD59 with HA epitope tag at the
extracellular N terminus after the leader sequences assessed by
anti-HA staining.
[0327] FIG. 3AD--Expression of antibody scFv fused to N-terminus of
CD55-derived fragment of 37 amino acids, assessed by anti-HA
staining.
[0328] FIG. 3AE--Expression of antibody scFv fused to N-terminus of
CD59 assessed by anti-HA staining.
[0329] FIG. 3AF--Cytoplasmic expression of adenosine deaminase
fused to HA tag assessed by anti-HA Western blot. Expected size
approximately 40 kDa.
[0330] FIG. 3AG--Cytoplasmic expression of phenylalanine
hydroxylase fused to HA tag assessed by anti-HA Western blot.
Expected size approximately 33 kDa.
[0331] FIG. 3AH--Cytoplasmic expression of phenylalanine
hydroxylase fused to adenosine deaminase and an HA tag assessed by
flow cytometry for fluorescence from co-translated GFP.
[0332] FIG. 3AI--Cytoplasmic expression of adenosine deaminase
fused to the intracellular C terminus of glycophorin A assessed by
anti-HA Western blot. Expected size approximately 55 kDa.
[0333] FIG. 3AJ--Cytoplasmic expression of phenylalanine
hydroxylase fused to the intracellular C terminus of glycophorin A
assessed by anti-HA Western blot. Expected size approximately 50
kDa.
[0334] FIG. 3 AK-FIG. 3AP shows the exogenous expression of surface
and cytoplasmic proteins on K562 erythroleukemia cells.
[0335] FIG. 3AK--Overexpression of complement receptor 1 assessed
by anti-CR1 staining.
[0336] FIG. 3AL--Expression of antibody scFv as N terminal fusion
to glycophorin A assessed by anti-HA staining.
[0337] FIG. 3AM--Expression of antibody scFv fused to N-terminus of
CD55-derived fragment of 37 amino acids, assessed by anti-HA
staining.
[0338] FIG. 3AN--Expression of antibody scFv fused to N-terminus of
CD59 assessed by anti-HA staining.
[0339] FIG. 3AO--Cytoplasmic expression of adenosine deaminase
fused to HA tag assessed by anti-HA Western blot. Expected size
approximately 40 kDa.
[0340] FIG. 3AP--Cytoplasmic expression of phenylalanine
hydroxylase fused to HA tag assessed by anti-HA Western blot.
Expected size approximately 33 kDa.
[0341] FIG. 4A-FIG. 4C is a collection of flow cytometry histograms
that measure fluorescence in primary platelets that have been
transfected with mRNA encoding a fluorescent protein (GFP). (FIG.
4A) Untransfected platelets. (FIG. 4B) Platelets transfected with 3
ug GFP mRNA. (FIG. 4C) Platelets transfected with 6.8 ug GFP
mRNA.
[0342] FIG. 5A-FIG. 5D shows protein expression and enzymatic
activity of transgenic erythroid cells in culture. (FIG. 5A) is a
Western blot of exogenously expressed adenosine deaminase detected
with an anti-HA antibody over the course of differentiation, from
nucleated precursor cells ("Diff I D5") through to enucleated
erythroid cells ("Diff III D8"). (FIG. 5B) is a bar chart of
inosine produced from adenosine by intact adenosine
deaminase-expressing 293T cells. (FIG. 5C) is a Western blot of the
exogenously expressed phenylalanine hydroxylase detected with an
anti-HA antibody at various time points over the course of
differentiation, from nucleated precursor cells ("Diff I D5")
through to enucleated erythroid cells ("Diff III D8"). (FIG. 5D) is
a bar chart of tyrosine produced from phenylalanine by lysates of
cultured phenylalanine hydroxylase-expressing enucleated erythroid
cells.
[0343] FIG. 6A-FIG. 6B shows immune complex capture and transfer to
macrophages by cultured erythroid cells that overexpress complement
receptor 1 (CR1). (FIG. 6A) is a flow cytometry plot that shows the
capture of fluorescent immune complexes (white histogram) and
complement-deficient immune complexes (shaded histogram) by
cultured erythroid cells that overexpress CR1. (FIG. 6B) is a bar
chart of flow cytometry data assessing the uptake of fluorescent
immune complexes (hashed bars), complement deficient immune
complexes (gray bars), or no immune complexes (black bars) by
macrophages (left set) or macrophages incubated with cultured
erythroid cells that overexpress CR1 (right set).
[0344] FIG. 7A-FIG. 7D shows the activity of an antibody scFv that
binds hepatitis B surface antigen (scFv) on the surface of a
cultured erythroid cell. (FIG. 7A) is a flow cytometry histogram
showing binding of 450 nM antigen (white histogram) or no antigen
(gray histogram). (FIG. 7B) is a titration of binding signal
assessed by flow cytometry for a range of antigen concentrations.
(FIG. 7C-FIG. 7D) are flow cytometry plots of blood cells from mice
that had been injected with fluorescent antigen and cultured
erythroid cells that (FIG. 7C) do not or (FIG. 7D) do express scFv.
The y-axis measures antigen fluorescence. The x-axis measures
fluorescence of the cultured cells.
[0345] FIG. 8A-FIG. 8D shows the specific clearance of circulating
antibodies mediated by membrane-receiver complexes in vivo. (FIG.
8A) is a set of flow cytometry plots that show no binding (left)
and binding (right) of circulating Dylight650-labeled mouse anti-HA
antibody to CFSE-labeled cultured human erythroid cells isolated
from a recipient mouse that either do not (left) or do (right)
express HA epitope tag on their surface. The x-axis measures CFSE
fluorescence. The y-axis measures anti-HA antibody Dylight650
fluorescence. (FIG. 8B) is data from an HA epitope tag substrate
ELISA comparing anti-HA antibody levels over time in plasma
collected from mice injected with anti-HA antibody (open circles,
solid line), anti-HA antibody followed by cultured human erythroid
cells that do not express HA epitope tag (dashed line), or anti-HA
antibody followed by cultured human erythroid cells that do express
HA epitope tag (dotted line). (FIG. 8C) is a set of flow cytometry
plots that show no binding (left) and binding (right) of
Dylight650-labeled mouse anti-biotin antibody to CFSE-labeled
primary human erythrocytes that either are not (left) or are
(right) conjugated with biotin on their surface. The x-axis
measures CFSE fluorescence. The y-axis measures anti-biotin
antibody Dylight650 fluorescence. (FIG. 8D) is data from a biotin
substrate ELISA comparing anti-biotin antibody levels over time in
plasma collected from mice injected with anti-biotin antibody (open
circles, solid line), anti-biotin antibody followed by cultured
human erythroid cells that are not conjugated to biotin (dashed
line), or anti-biotin antibody followed by cultured human erythroid
cells that are conjugated to biotin (dotted line).
[0346] FIG. 9A-FIG. 9B shows the clearance rate of cultured human
eyrthroid cells in a mouse. (FIG. 9A) is a representative flow
cytometry dot-plot of drawn blood, stained for human glycophorin A
(y-axis) and CFSE (x-axis), in which human cultured cells are
double-positive. (FIG. 9B) is a plot of the clearance rate over
time as a percentage of double-positive cells remaining after NSG
mice were injected with with human red blood cells (solid circles),
cultured enucleated erythroid cells (dashed diamonds), cultured
enucleated erythroid cells that express an intracellular exogenous
protein (dotted squares) and cultured enucleated erythroid cells
that express a surface exogenous protein (open triangles).
[0347] FIG. 10A-FIG. 10D is an assessment of adverse events
following injection of cultured human erythroid cells into a mouse.
(FIG. 10A-FIG. 10B) show levels of (FIG. 10A) fibrinopeptide A and
(FIG. 10B) fibrinopeptide B assessed by ELISA in plasma collected
from mice 20 minutes (black), 6 hours (gray), and 48 hours (white)
after injection with (1) human red blood cells, (2) cultured human
erythroid cells, (3) cultured human erythroid cells expressing an
exogenous cytoplasmic protein, (4) cultured human erythroid cells
expressing an exogenous surface transgene, or (5) recombinant
protein. (FIG. 10C-FIG. 10D) show microscope images of
histologically stained sections of spleen for mice injected with
(FIG. 10C) cultured human erythroid cells and (FIG. 10D)
recombinant protein.
[0348] FIG. 11A-FIG. 11B tracks the expression of exogenous protein
on cultured erythroid cells in circulation. (FIG. 11A) is flow
cytometry data of blood drawn from a mouse that was injected with
cultured human erythroid cells expressing an exogenous surface
protein, showing the the percent of cultured human erythroid cells
that are HA-positive over time. (FIG. 11B) is a Western blot of
blood drawn from two mice, wherein one mouse was injected with
cultured human erythroid cells expressing an exogenous cytoplasmic
protein, and wherein the other mouse was injected with the purified
recombinantly-produced exogenous protein in the absence of any
cells, showing the level of HA-containing protein in the blood over
time.
[0349] FIG. 12A-FIG. 12C is an assessment of expansion and
differentiation of cultured human erythroid cells. (FIG. 12A) is a
plot of expansion rates for distinct cultures of in vitro
differentiated erythroid cells that contain transgenes (dashed line
and dotted line) and cells that do not contain a transgene (solid
line). (FIG. 12B) is a flow cytometry plot of cell surface markers
GPA and CKIT for distinct cultures of cultured human erythroid
cells that do not (left) or do (right) contain a transgene. (FIG.
12C) is a flow cytometry plot of cultured human erythroid cells
that do not (left) or do (right) contain a transgene, wherein the
cells are stained with DNA stain DRAQ5 (y-axis) and
anti-glycophorin A (x-axis), which identifies distinct populations
of (1) enucleated cells, (2) nucleated cells, and (3) nuclei.
[0350] FIG. 13A is a schematic of a synthetic membrane-receiver
complex comprising a receiver polypeptide. The left panel depicts
the flux of a target substrate across the membrane of the synthetic
membrane-receiver complex. The target substrate is altered by an
internally localized enzymatic receiver polypeptide and the
resulting product of the enzymatic reaction either remains in the
synthetic membrane-receiver complex or exits through the membrane.
The right panel depicts a synthetic membrane-receiver complex that
contains at least two receivers (e.g., receiver polypeptides), one
being localized on the surface and one being internally localized.
In this example, the surface-localized receiver aids a substrate to
enter the synthetic membrane-receiver complex, e.g., by carrying
out a transporter function. The second receiver, localized
internally, alters the substrate enzymatically. The resulting
product of the enzymatic reaction either remains in the synthetic
membrane-receiver complex or exits through the membrane, optionally
aided by the first surface-localized receiver.
[0351] FIG. 13B is a schematic of another synthetic
membrane-receiver complex comprising a receiver polypeptide. FIG.
13B depicts a receiver polypeptide localized on the surface of the
synthetic membrane-receiver complex. As shown, a target substrate
can be acted upon directly by the receiver. In the exemplified
configuration, the target substrate does not need to cross the
membrane to be enzymatically converted to a product. Optionally,
the surface-localized enzymatic receiver polypeptide can be made
cleavable, e.g., if the complex enters a specific microenvironment.
In that instance, the receiver polypeptide will be cleaved and
become active in the extracellular space.
[0352] FIG. 13C is a schematic of yet another synthetic
membrane-receiver complex comprising a receiver. FIG. 13C depicts
the lysis of a synthetic membrane-receiver complex containing
internally-localized receiver (e.g., a polypeptide) and optional
payload (e.g., a therapeutic agent) which may result from a variety
of stimuli. Upon lysis, the internally-localized receiver and
optional payload is released into the microenvironment where it may
act on a target substrate.
[0353] FIG. 14A is a schematic of three ways in which a receiver
may be localized in a synthetic membrane-receiver complex. FIG. 14B
is a schematic of three ways in which a receiver localized in or on
a synthetic membrane-receiver complex may act on a target in
circulation. FIG. 14C is a schematic of an auto-catalytic fusion of
an endogenous polypeptide anchor to a receiver utilizing a
SpyTag-SpyCatcher mechanism.
DETAILED DESCRIPTION OF THE INVENTION
[0354] Therapeutic technologies attempting to employ circulating
agents have been developed in the past to address some of the
challenges in delivering treatments such as pharmaceutical drugs to
patients. None possess one or many of the features and benefits of
the synthetic membrane-receiver complexes provided herein. Aspects
of the invention provide compositions capable of multiple, distinct
utilities, which utilize biochemical and biophysical mechanisms not
previously addressed. Aspects of the invention relate to
compositions and methods for performing, e.g., functions related to
circulating clearance and functions related to metabolic enzyme
delivery, and methods for treating or preventing a variety of
diseases, disorders and conditions. Accordingly, the compositions
and methods disclosed herein address the long sought after need for
therapeutic compositions that are distributed through the
circulatory system that have increased half-life, safety profile,
and/or efficacy that avoid shortcomings associated with previous
approaches such as undesirable immunological reactions, short
half-life due to rapid clearance from the circulation, and
off-target effects, among others.
[0355] Functions related to circulating clearance include
activities characterized by, e.g., the specific binding,
degradation, and/or sequestration of a target (e.g., a pathogenic
substance or toxic molecule) in the circulatory system of a subject
by a synthetic membrane-receiver complex comprising a receiver
capable of interacting with a target as described herein. Synthetic
membrane-receiver complexes are introduced or capable of being
introduced into the circulation of a subject. In some embodiments,
the bound or sequestered targets are guided to the liver, spleen,
or any other site in which they may be removed from the circulatory
system.
[0356] Functions related to metabolic enzyme delivery include
activities characterized by, e.g., removal of a target (e.g., a
pathogenic substance or toxic molecule), in circulation of a
subject by a synthetic membrane-receiver complex as described
herein that comprises, e.g., one or more metabolic enzyme receiver
polypeptides within the complex or on the surface of the complex,
such that the receiver polypeptide interacts with and modifies the
target. Modification of the target includes, e.g., alteration of
the bioavailability of the target, cleaving, degrading, and/or
otherwise inactivating the target by the receiver. In some
embodiments, the enzymatic polypeptide is protected from the immune
system. In some embodiments, the half-life of the enzyme is
extended and/or an immunogenic reaction is reduced when
administered in the subject.
[0357] It is to be understood that this invention is not limited to
particular methods, reagents, compounds, compositions or biological
systems, which can, of course, vary. It is also to be understood
that the terminology used herein is for the purpose of describing
particular aspects only, and is not intended to be limiting.
[0358] All of the features disclosed in this specification may be
combined in any combination. Each feature disclosed in this
specification may be replaced by an alternative feature serving the
same, equivalent, or similar purpose. Thus, unless expressly stated
otherwise, each feature disclosed is only an example of a generic
series of equivalent or similar features.
[0359] Many modifications and other embodiments of the inventions
set forth herein will easily come to mind to one skilled in the art
to which these inventions pertain having the benefit of the
teachings presented in the foregoing descriptions and the
associated drawings. Therefore, it is to be understood that the
inventions are not to be limited to the specific embodiments
disclosed and that modifications and other embodiments are intended
to be included within the scope of the appended claims. Although
specific terms are employed herein, they are used in a generic and
descriptive sense only and not for purposes of limitation.
[0360] As used in this specification and the appended claims, the
singular forms "a", "an" and "the" include plural references unless
the content clearly dictates otherwise.
[0361] The use of the alternative (e.g., "or") should be understood
to mean either one, both, or any combination thereof of the
alternatives.
[0362] The term "about" as used herein when referring to a
measurable value such as an amount, a temporal duration, and the
like, is meant to encompass variations of .+-.20% or .+-.10%, more
preferably .+-.5%, even more preferably .+-.1%, and still more
preferably .+-.0.1% from the specified value, as such variations
are appropriate to perform the disclosed methods.
[0363] As used herein, any concentration range, percentage range,
ratio range, or integer range is to be understood to include the
value of any integer within the recited range and, when
appropriate, fractions thereof (such as one tenth and one hundredth
of an integer), unless otherwise indicated.
[0364] "Comprise," "comprising," and "comprises" and "comprised of"
as used herein are synonymous with "include", "including",
"includes" or "contain", "containing", "contains" and are inclusive
or open-ended terms that specifies the presence of what follows
e.g. component and do not exclude or preclude the presence of
additional, non-recited components, features, element, members,
steps, known in the art or disclosed therein.
[0365] As used herein, the terms "such as", "for example" and the
like are intended to refer to exemplary embodiments and not to
limit the scope of the present disclosure.
[0366] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which the invention pertains. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice for testing of the present
invention, preferred materials and methods are described
herein.
[0367] All publications and patent applications cited in this
specification are herein incorporated by reference in their
entirety for all purposes as if each individual publication or
patent application were specifically and individually indicated to
be incorporated by reference for all purposes. The publications
discussed herein are provided solely for their disclosure prior to
the filing date of the present application. Nothing herein is to be
construed as an admission that the inventors described herein are
not entitled to antedate such disclosure by virtue of prior
invention or for any other reason.
Definitions
[0368] "Administration," "administering" and variants thereof means
introducing a composition, such as a synthetic membrane-receiver
complex, or agent into a subject and includes concurrent and
sequential introduction of a composition or agent. The introduction
of a composition or agent into a subject is by any suitable route,
including orally, pulmonarily, intranasally, parenterally
(intravenously, intramuscularly, intraperitoneally, or
subcutaneously), rectally, intralymphatically, or topically.
Administration includes self-administration and the administration
by another. A suitable route of administration allows the
composition or the agent to perform its intended function. For
example, if a suitable route is intravenous, the composition is
administered by introducing the composition or agent into a vein of
the subject. Administration can be carried out by any suitable
route,
[0369] "Anchor" or "anchor domain" or "A domain" is used to refer
to the portion of a receiver polypeptide, including a fusion or
chimeric receiver polypeptide that is in contact with the lipid
layer of a synthetic membrane-receiver polypeptide complex. The
receiver polypeptide may interact with the lipid layer via a
phospholipid tail insertion, covalent binding to a lipid layer
constituent, an ionic bond, hydrogen bond, or via a single or
multi-pass transmembrane polypeptide domain that cross one or more
of the lipid layers.
[0370] As used herein, the term "antibody" encompasses an
immunoglobulin whether natural or partly or wholly synthetically
produced, and fragments thereof. The term also covers any protein
having a binding domain which is homologous to an immunoglobulin
binding domain. These proteins can be derived from natural sources,
or partly or wholly synthetically produced. "Antibody" further
includes a polypeptide comprising a framework region from an
immunoglobulin gene or fragments thereof that specifically binds
and recognizes an antigen. Use of the term antibody is meant to
include whole antibodies, polyclonal, monoclonal and recombinant
antibodies, fragments thereof, and further includes single-chain
antibodies, humanized antibodies; murine antibodies; chimeric,
mouse-human, mouse-primate, primate-human monoclonal antibodies,
anti-idiotype antibodies, antibody fragments, such as, e.g., scFv,
(scFv)2, Fab, Fab', and F(ab')2, F(ab1)2, Fv, dAb, and Fd
fragments, diabodies, and antibody-related polypeptides. Antibody
includes bispecific antibodies and multispecific antibodies so long
as they exhibit the desired biological activity or function.
[0371] The term "antigen binding fragment" used herein refers to
fragments of an intact immunoglobulin, and any part of a
polypeptide including antigen binding regions having the ability to
specifically bind to the antigen. For example, the antigen binding
fragment may be a F(ab')2 fragment, a Fab' fragment, a Fab
fragment, a Fv fragment, or a scFv fragment, but is not limited
thereto. A Fab fragment has one antigen binding site and contains
the variable regions of a light chain and a heavy chain, the
constant region of the light chain, and the first constant region
CH1 of the heavy chain. A Fab' fragment differs from a Fab fragment
in that the Fab' fragment additionally includes the hinge region of
the heavy chain, including at least one cysteine residue at the
C-terminal of the heavy chain CH1 region. The F(ab')2 fragment is
produced whereby cysteine residues of the Fab' fragment are joined
by a disulfide bond at the hinge region. A Fv fragment is the
minimal antibody fragment having only heavy chain variable regions
and light chain variable regions, and a recombinant technique for
producing the Fv fragment is well known in the art. Two-chain Fv
fragments may have a structure in which heavy chain variable
regions are linked to light chain variable regions by a
non-covalent bond. Single-chain Fv (scFv) fragments generally may
have a dimer structure as in the two-chain Fv fragments in which
heavy chain variable regions are covalently bound to light chain
variable regions via a peptide linker or heavy and light chain
variable regions are directly linked to each other at the
C-terminal thereof. The antigen binding fragment may be obtained
using a protease (for example, a whole antibody is digested with
papain to obtain Fab fragments, and is digested with pepsin to
obtain F(ab')2 fragments), and may be prepared by a genetic
recombinant technique. A dAb fragment consists of a VH domain.
Single-chain antibody molecules may comprise a polymer with a
number of individual molecules, for example, dimmer, trimer or
other polymers.
[0372] "Applicator" refers to any device used to connect to a
subject. This includes, e.g., needles, cannulae, catheters, and
tubing.
[0373] "Associated with" when used to describe the relationships
among multiple compounds or molecules encompasses such as, e.g.,
any interaction between a receiver and a target or between a
synthetic membrane-receiver complex and a target. This includes
enzymatic interaction, ionic binding, covalent binding,
non-covalent binding, hydrogen bonding, London forces, van der
Waals forces, hydrophobic interaction, lipophilic interactions,
magnetic interactions, electrostatic interactions, and the
like.
[0374] "Associated with" when used to describe the relationships
among a target, entity, compound, agent, or molecule and a disease,
disorder, condition, symptom or phenotype is any link that may
reasonably be made between them, including a causal link, or a
statistical significant link, an empirically established link, a
suggested link, whether or not causative of the disease, disorder,
condition, symptom or phenotype.
[0375] "Autoimmune disorders" generally are conditions in which a
subject's immune system attacks the body's own cells, causing
tissue destruction. Autoimmune disorders may be diagnosed using
blood tests, cerebrospinal fluid analysis, electromyogram (measures
muscle function), and magnetic resonance imaging of the brain, but
antibody testing in the blood, for self-antibodies (or
auto-antibodies) is particularly useful. Usually, IgG class
antibodies are associated with autoimmune diseases.
[0376] "Binding" describes an interaction among compounds or
molecules, e.g., between a receiver and a target or between a
synthetic membrane-receiver complex and a target, that comes about
by covalent binding or non-covalent binding, including ionic
binding, electrostatic interactions, hydrogen bonding, London
forces, van der Waals forces, hydrophobic interaction, lipophilic
interactions, and similar.
[0377] The "biological activity of a polypeptide" refers to any
molecular activity or phenotype (such as, e.g., binding, signal
transduction, catalytic, etc.) that is caused by the polypeptide,
such as a receiver polypeptide.
[0378] As used herein, the term "biological sample" refers to any
type of material of biological origin isolated from a subject,
including, for example, DNA, RNA, lipids, carbohydrates, and
protein. The term "biological sample" includes tissues, cells and
biological fluids isolated from a subject. Biological samples
include, e.g., but are not limited to, whole blood, plasma, serum,
semen, saliva, tears, urine, fecal material, sweat, buccal, skin,
cerebrospinal fluid, bone marrow, bile, hair, muscle biopsy, organ
tissue or other material of biological origin known by those of
ordinary skill in the art. Biological samples can be obtained from,
e.g., biopsies of internal organs or from cancers. Biological
samples can be obtained from subjects for diagnosis or research or
can be obtained from healthy subjects, as controls or for basic
research.
[0379] The "clearance rate" as used herein is calculated by
measuring the amount or concentration of, e.g., target, receiver,
target-receiver, or synthetic membrane-receiver complexes remaining
in the circulatory system of a subject over time. For example, 1%,
2%, 3%, 4%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%,
95%, or 99% of target detected in a first sample may still be
detected in a second sample that is taken 1 hour, 5 hours, 10
hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 2
weeks, 3 weeks, 4 weeks, 2 months, 3 months, 4 months, 5 months, 6
months, 7 months, 8 months, 9 months, 10 months, 11 months, 12
months, 2 years, 3 years, 4 years, or 5 years later. The clearance
rate may alternatively be expressed as: number of entities (e.g.,
target/receiver) per unit of time (e.g., per day). An increase in
clearance rate is a rate greater than that exhibited in an
untreated or healthy suitable control subject. A decrease in
clearance rate is a rate less than that exhibited in an untreated
or healthy suitable control subject. The increase or decrease may
be 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%,
90%, 100%, 150%, 200%, 500%, 1000% or may be 1.1-fold, 1.2-fold,
1.3 fold, 1.4-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold,
10-fold, 20-fold, 50-fold, 100-fold, 500-fold, or 1000-fold. An
increase in clearance rate of a target includes, e.g., a slow down
in the accumulation of a target, a reaching of a new equilibrium of
generation and degradation, and a reversal of an accumulation,
e.g., a decrease in the number or concentration of the target in
circulation.
[0380] "Cleaving" as used herein is a process that disrupts a
bonding interaction present in a target, such as a polypeptide or
nucleic e.g., to produce two or more entities that after cleaving
can be separated from one another. The separation can involve,
e.g., disrupt an ionic bond, a covalent bond, a polar covalent
bond, a non-polar covalent bond, or a metallic bond. As cleaving
applies to polypeptide targets, cleavage can involve breaking one
or more peptide bonds. As cleaving applies to small molecule
targets, cleavage can involve breaking one or more carbon or
sulfide bonds. As cleaving applies to nucleotide sequences,
cleavage can involve breaking one or more phosphodiester bonds. As
cleaving applies to microbes such as bacteria, fungi, or viruses,
cleavage can involve lysis of a membrane or capsid structure.
Cleaving can be carried out by an enzyme, e.g., a catalytically
active receiver polypeptide. Receivers can comprise, e.g.,
exonuclease, endonuclease, or protease activity.
[0381] The "circulatory system of a subject," as used herein,
encompasses the space occupied by whole blood and optionally the
lymphatic system in a human, inclusive of plasma and all
circulating cells and molecules, and distributed throughout
arteries, veins, capillaries, and lymphatic vessels of all tissues.
The "circulatory concentration" is the concentration of a target,
e.g., a cell, polypeptide (such as an antibody, pathogenic antigen,
etc.), therapeutic agent, small molecule, metabolite or other
entity, a receiver or a synthetic membrane-receiver complex in the
space defined as the circulatory system. In certain embodiments,
the concentration may be defined as the number of free (unbound)
entities in a given volume. In other embodiments, the concentration
may be defined as the total number of entities in a given
volume.
[0382] The term "complementarity determining region (CDR)" used
herein refers to an amino acid sequence found in the variable
region of a heavy chain or a light chain of an immunoglobulin. The
CDRs determine the specificity of an antibody and may provide a
contact residue for binding to a specific epitope of an antigen.
The heavy chain and the light chain may respectively include three
CDRs (CDRH1, CDRH2, and CDRH3, and CDRL1, CDRL2, and CDRL3). Four
framework regions, which have more highly conserved amino acid
sequences than the CDRs, separate the CDR regions in the VH or
VL.
[0383] A "complex" as used herein comprises an association of two
or more entities. A complex may comprise one or more polypeptides,
nucleic acid, lipids, carbohydrates, inorganic compounds, organic
compounds, and the like. A complex can be functional (multiunit
polypeptides) or non-functional (e.g., aggregates or precipitates)
and may have beneficial or detrimental properties (e.g., immune
complexes). Complexes may be naturally occurring or may be man-made
or synthetic. Synthetic complexes include higher order entities,
e.g., subcellular structures and cells if they comprise a synthetic
compound or molecule. For example, a synthetic membrane-receiver
complex includes a cell comprising a receiver.
[0384] As to amino acid sequences, one of skill will recognize that
individual substitutions, deletions or additions to a nucleic acid,
peptide, polypeptide, or protein sequence which alters, adds or
deletes a single amino acid or a small percentage of amino acids in
the encoded sequence is a "conservatively modified variant" where
the alteration results in the substitution of an amino acid with a
chemically similar amino acid. As used herein the term
"conservative amino acid substitution" is illustrated by a
substitution among amino acids within each of the following groups:
(1) glycine, alanine, valine, leucine, and isoleucine, (2)
phenylalanine, tyrosine, and tryptophan, (3) serine and threonine,
(4) aspartate and glutamate, (5) glutamine and asparagine, and (6)
lysine, arginine and histidine.
[0385] "Decrease," in the context of a symptom of a treated
disease, disorder or condition, refers to a reduction in measurable
or conveyable parameters associated with the disease or condition
that manifest as symptoms. Examples of measurable parameters are a
reduction in the subject's body temperature, a reduction in the
concentration of targets in a sample taken from the subject,
reduction in the intensity of inflammation or size of an inflamed
area, reduction in the number of infiltrating cells, reduction in
the number of episodes associated with the disease, disorder or
condition, increase/decrease in organ size, weight gain/loss, etc.
Examples of conveyable parameters are, e.g., the subject's own
assessment of well being and quality of life. For example, for
self-antibody mediated diseases, the decrease may be quantified as
one, or a combination of, the following parameters: reduced
inflammation, reduced flare-ups, reduced fatigue, reduced blood
clotting, reduced swelling, increased energy, or increased hair
growth, etc. The parameters that may be quantified are those
appropriate for assessing the specific disease, disorder or
condition that is being treated. Delay, in the context of symptoms
of a treated disease, disorder or condition, refers to the
significant extension of a manageable health condition that would
otherwise become exacerbated, using a treatment.
[0386] "Degrading" is defined as the process in which a target is
either directly, or indirectly, reduced, inactivated, decomposed,
deconstructed, lysed, dissolved, broken, lessened, impaired,
weakened, deteriorated, diminished, or partitioned.
[0387] "Different polypeptide origin" refers to the organism or
species from which a genetic sequence encoding the polypeptide, the
polypeptide, or portion thereof, is sourced. In certain
embodiments, a fusion comprising polypeptides of different
polypeptide origin may include a receiver polypeptide that is
encoded by the genetic sequence for human adenosine deaminase and
the genetic sequence for phenylalanine hydroxylase from
chromobacterium violaceum.
[0388] A "domain" is a part of a polypeptide, such as a receiver
polypeptide that is generally having a 3-dimensional structure and
may exhibit a distinct activity, function, such as, e.g., a
catalytic, an enzymatic, a structural role, or a binding
function.
[0389] Duration refers to the period of time that a portion of the
synthetic membrane-receiver polypeptide complex exists in a
specific tissue or an organism as a whole. This applies to 0.1% 1%,
5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the
initial dose or concentration of the synthetic membrane-receiver
polypeptide complex. In some embodiments, the synthetic
membrane-receiver complex is formulated for long-term duration. In
some embodiments, the synthetic membrane-receiver complex is
formulated for short-term duration.
[0390] By an "enriched population of cells" it is meant a
population of cells that is substantially comprised of a particular
cell of interest. In an enriched population, 50% or more of the
cells in the population are the cells of interest, e.g., 50%, 60%,
70%, usually 80%, 85%, 90%, more usually 92%, 95%, 96%, 97%, 98%,
or 99%, sometimes as much as 100% of the cells in the population.
The separation of cells of interest from a complex mixture or
heterogeneous culture of cells may be performed by any convenient
means known in the art, for example, by affinity separation
techniques such as magnetic separation using magnetic beads coated
with an affinity reagent, affinity chromatography, or "panning"
with an affinity reagent attached to a solid matrix, e.g., plate,
or other convenient technique. Other techniques providing accurate
separation include fluorescence activated cell sorters, which can
have varying degrees of sophistication, such as multiple color
channels, low angle and obtuse light scattering detecting channels,
impedance channels, etc. The cells may be selected against dead
cells by employing dyes associated with dead cells. Any technique
may be employed which is not unduly detrimental to the viability of
the desired cells.
[0391] "Enucleation" is the rendering of a cell to a
non-replicative state, either through inactivation or removal of
the nucleus.
[0392] An "epitope" includes any segment on an antigen to which an
antibody or other ligand or binding molecule binds. An epitope may
consist of chemically active surface groupings of molecules such as
amino acids or sugar side chains and usually have specific three
dimensional structural characteristics, as well as specific charge
characteristics. In some embodiments, receivers comprise specific
epitopes. In some embodiments, targets comprise specific
epitopes.
[0393] "Erythroid cells" as used herein, include nucleated red
blood cells, red blood cell precursors, and enucleated red blood
cells and those listed in Table 2. For example, the erythroid cells
are a cord blood stem cell, a CD34+ cell, a hematopoietic stem cell
(HSC), a spleen colony forming (CFU-S) cell, a common myeloid
progenitor (CMP) cell, a blastocyte colony-forming cell, a burst
forming unit-erythroid (BFU-E), a megakaryocyte-erythroid
progenitor (MEP) cell, an erythroid colony-forming unit (CFU-E), a
reticulocyte, an erythrocyte, an induced pluripotent stem cell
(iPSC), a mesenchymal stem cell (MSC), a polychromatic normoblast,
an orthochromatic normoblast, or a combination thereof. In some
embodiments, the erythroid cells are immortal or immortalized
cells. For example, immortalized erythroblast cells can be
generated by retroviral transduction of CD34+ hematopoietic
progenitor cells to express Oct4, Sox2, Klf4, cMyc, and suppress
TP53 (e.g., as described in Huang et al., Mol Ther 2013, epub ahead
of print September 3). In addition, the cells may be intended for
autologous use or provide a source for allogeneic transfusion.
Erythroid cells can be contacted with a receiver to generate a
synthetic membrane-receiver complex. Erythroid cells comprising a
receiver are one example of a synthetic membrane-receiver complex.
In some embodiments, erythroid cells arecultured. In some
embodiments, erythroid progenitor cells are contacted with a
receiver to generate a synthetic membrane-receiver complex.
[0394] As used herein, the term "excipient" refers to an inert
substance added to a pharmaceutical composition to further
facilitate administration of a compound. Examples of excipients
include, but are not limited to, calcium carbonate, calcium
phosphate, various sugars and types of starch, cellulose
derivatives, gelatin, vegetable oils, anti-coagulants, and
polyethylene glycols.
[0395] The receiver, including a receiver polypeptide is
"exogenous" or "heterologous", thus it may either not naturally
exist, such as a fusion or chimera comprising domains of different
polypeptide or species origin, it may not naturally occur in a
naturally occurring cell, such as an unmodified erythrocyte or
platelet, it may not function in the same way as a naturally
occurring polypeptide would, or it may not naturally occur in the
quantity that the receiver polypeptide occurs, e.g., in embodiments
in which the synthetic membrane-receiver polypeptide complex is a
cell-derived polypeptide receiver that is overexpressed as compared
to the expression of a naturally occurring polypeptide in an
unmodified cell. In some embodiments, the polypeptide receiver is
expressed from an exogenous nucleic acid. In some embodiments, the
receiver is isolated from a source and loaded into or conjugated to
a synthetic membrane-receiver complex.
[0396] The term "exogenous" when used in the context of nucleic
acid includes a transgene and recombinant nucleic acids.
[0397] As used herein, the term "expression" refers to the process
to produce a polypeptide, such as a receiver polypeptide including
transcription and translation. Expression may be, e.g., increased
by a number of approaches, including: increasing the number of
genes encoding the polypeptide, increasing the transcription of the
gene (such as by placing the gene under the control of a
constitutive promoter), increasing the translation of the gene,
knocking out of a competitive gene, or a combination of these
and/or other approaches.
[0398] A synthetic membrane-receiver complex that is "formulated
for long-term duration" is, in some embodiments, one that is part
of a population of synthetic membrane-receiver complexes wherein a
substantial fraction of the population resides in the circulatory
system for more than 10 days, e.g., 15, 21, 25, 35, 45, 50, 60, 90,
100, 110, or 120 days. In some embodiments, the population may have
an increased half-life, e.g., 1.5.times., 2.times., 5.times.,
10.times., 20.times., 50.times., 100.times. more time in
circulation, when formulated for long-term duration compared to the
duration exhibited by a population of unformulated complexes. In
some embodiments, an entity such as a receiver may have an
increased half-life, e.g., 1.5.times., 2.times., 5.times.,
10.times., 20.times., 50.times., 100.times. more time in
circulation, when formulated for long-term duration compared to the
duration that entity would exhibit in an unmodified state.
[0399] A synthetic membrane-receiver complex that is "formulated
for short-term duration" is, in some embodiments, one that is part
of a population of synthetic membrane-receiver complexes wherein a
substantial fraction of the population resides in the circulatory
system for less than 10 days, e.g., 9, 8, 7, 6, 5, 4, 3, 2 days, 1
day, 12 hours, or 6 hours. In some embodiments, the population may
have a decreased half-life, e.g., 5%, 10%, 20%, 30%, 40%, 50%, 60%,
70%, 80%, 90%, 99% less time in circulation, when formulated for
short-term duration compared to the duration exhibited by a
population of unformulated complexes. In some embodiments, an
entity such as a receiver may have a reduced half-life, e.g., 5%,
10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99% less time in
circulation, when formulated for short-term duration compared to
the duration that entity would exhibit in an unmodified state.
[0400] "Formulated for residency in the circulatory system", as
used herein, describes one or more modifications to an entity, such
as a synthetic membrane-receiver complex formulated for
administration to the circulatory system of a subject that
substantially decrease recognition, modification, degradation,
and/or destruction of the entity by components of the circulatory
system (e.g., circulating immune cells, antibodies, enzymatic
activities) thereby increasing the half-life of the entity when
compared to an unmodified entity.
[0401] A "functional" receiver or synthetic membrane-receiver
complex refers to a synthetic membrane-receiver complex or a
receiver that exhibits a desired or specified activity or
characteristic, including enzymatic, catalytic or metabolic
activity, structural integrity, immunogenic complementarity, target
binding, and correct localization or is capable of promoting a
desired or specified effect or phenotype.
[0402] "Fusion or chimera" is defined as a polypeptide sequence, or
corresponding encoding nucleotide sequence, that is derived from
the combination of two or more sequences that are not found
together in nature. This may be a combination of separate sequences
derived from separate genes within the same genome, or from
heterologous genes derived from distinctly different species'
genomes.
[0403] "Genetic material" refers to nucleic acid molecules having
nucleotide sequences of adenosine, thymine, uracil, cytosine, and
guanine capable of encoding a gene.
[0404] The term "heavy chain" used herein is understood to include
a full-length heavy chain including a variable region (VH) having
amino acid sequences that determine specificity for antigens and a
constant region having three constant domains (CH1, CH2, and CH3),
and fragments thereof. In addition, the term "light chain" used
herein is understood to include a full-length light chain including
a variable region (VL) having amino acid sequences that determine
specificity for antigens and a constant region (CL), and fragments
thereof.
[0405] The term "homolog" indicates polypeptides, including
receiver polypeptide that have the same or conserved residues at a
corresponding position in their primary, secondary or tertiary
structure. Functional homologs include receivers and other
polypeptides that exhibit similar function and/or specificity
(e.g., for a particular target).
[0406] A naturally occurring intact antibody, or immunoglobulin,
includes four polypeptides: two full-length light chains and two
full-length heavy chains, in which each light chain is linked to a
heavy chain by disulfide bonds. Each heavy chain has a constant
region and a variable region. Similarly, each light chain has a
constant region and a variable region. There are five heavy chain
classes (isotypes): gamma (.gamma.), mu (.mu.), alpha (.alpha.),
delta (.delta.), or epsilon (.epsilon.), and additionally several
subclasses gamma 1 (.gamma.1), gamma 2(.gamma.2), gamma
3(.gamma.3), gamma 4(.gamma.4), alpha 1(.alpha.1), and alpha
2(.alpha.2). The light chain constant region can be either kappa
(.kappa.) or lambda (.lamda.) type. The variable regions differ in
sequence among antibodies and are used in the binding and
specificity of a given antibody to its particular antigen.
[0407] As used herein, the term "increase," "enhance," "stimulate,"
and/or "induce" (and like terms) generally refers to the act of
improving or increasing, either directly or indirectly, a
concentration, level, function, activity, or behavior relative to
the natural, expected, or average, or relative to a control
condition.
[0408] As used herein, the term "inhibit," "suppress," "decrease,"
"interfere," and/or "reduce" (and like terms) generally refers to
the act of reducing, either directly or indirectly, a
concentration, level, function, activity, or behavior relative to
the natural, expected, or average, or relative to a control
condition.
[0409] A "library" as used herein includes a collection of nucleic
acid molecules (e.g., DNA, RNA) having diverse nucleic acid
sequences, a genetically diverse collection of clones, a collection
of diverse polypeptides, a diverse collection of cells, etc.
[0410] As used herein, "a mammalian subject" includes all mammals,
including without limitation, humans, domestic animals (e.g., dogs,
cats and the like), farm animals (e.g., cows, sheep, pigs, horses
and the like) and laboratory animals (e.g., monkey, rats, mice,
rabbits, guinea pigs and the like). The terms "individual,"
"subject," "host," and "patient," are used interchangeably herein
and refer to any mammalian subject for whom diagnosis, treatment,
or therapy is desired, particularly humans. The methods described
herein are applicable to both human therapy and veterinary
applications. In some embodiments, the subject is a mammal, and in
other embodiments the subject is a human.
[0411] "Medical device" refers to any device, apparatus or machine
used to deliver a dose of a synthetic membrane-receiver complex
and/or a therapeutic agent. This includes containers, bottles,
vials, syringes, bags, cartridges, cassettes, magazines, cylinders,
or canisters.
[0412] "Medical kit" refers to a packaged unit that includes a
medical device, applicator, appropriate dosage of synthetic
membrane-receiver complex optionally including a therapeutic agent,
and relevant labeling and instructions.
[0413] As used herein, the term "modulate," "modulating", "modify,"
and/or "modulator" generally refers to the ability to alter, by
increase or decrease, e.g., directly or indirectly
promoting/stimulating/upregulating or interfering
with/inhibiting/downregulating a specific concentration, level,
expression, function or behavior, such as, e.g., to act as an
antagonist or agonist. In some instances a modulator may increase
and/or decrease a certain concentration, level, activity or
function relative to a control, or relative to the average level of
activity that would generally be expected or relative to a control
level of activity.
[0414] "Membrane" as used herein is a boundary layer that separates
an interior space from an exterior space comprising one or more
biological compounds, typically lipids, and optionally
polypeptides. Membranes can be lipid bilayers. In certain
embodiments, membranes comprise one or more of phosphatidylcholine,
sphingomyelin, lysophosphatidylcholine, phosphatidylethanolamine,
phosphatidylserine, phosphatidylinositol, or phosphatidic acid. In
some embodiments, membranes comprise one or more polypeptides such
as ankyrin and coenzyme Q10. Included in the definition of membrane
are cell membranes comprising, e.g., a phospholipid bilayer and
cell membrane associated polypeptides. The synthetic
membrane-receiver complex comprises a membrane as defined
herein.
[0415] The phrase "nucleic acid molecule" refers to a single or
double-stranded polymer of deoxyribonucleotide or ribonucleotide
bases. It includes chromosomal DNA and self-replicating plasmids,
vectors, mRNA, tRNA, siRNA, etc. which may be recombinant and from
which exogenous polypeptides may be expressed when the nucleic acid
is introduced into a cell.
[0416] Orthologs are defined as genes in different species that
evolved from a common ancestral gene by speciation.
[0417] The term "pharmaceutically-acceptable" and grammatical
variations thereof, refers to compositions, carriers, diluents and
reagents capable of administration to or upon a subject without the
production of undesirable physiological effects to a degree that
would prohibit administration of the composition. For example,
"pharmaceutically-acceptable excipient" includes an excipient that
is useful in preparing a pharmaceutical composition that is
generally safe, non-toxic, and desirable, and includes excipients
that are acceptable for veterinary use as well as for human
pharmaceutical use. Such excipients can be solid, liquid,
semisolid, or, in the case of an aerosol composition, gaseous.
[0418] As used herein, the term "pharmaceutically acceptable
carrier" includes any of the standard pharmaceutical carriers, such
as a phosphate buffered saline solution, water, emulsions such as
an oil/water or water/oil, and various types of wetting agents. The
term also encompasses any of the agents approved by a regulatory
agency of the US Federal government or listed in the US
Pharmacopeia for use in animals, including humans, as well as any
carrier or diluent that does not cause significant irritation to a
subject and does not abrogate the biological activity and
properties of the administered compound.
[0419] Some agents may be administered as "pharmaceutically
acceptable salt", e.g., prepared from inorganic and organic acids.
Salts derived from inorganic acids include hydrochloric acid,
hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and
the like. Salts derived from organic acids include acetic acid,
propionic acid, glycolic acid, pyruvic acid, oxalic acid, malic
acid, malonic acid, succinic acid, maleic acid, fumaric acid,
tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic
acid, methanesulfonic acid, ethanesulfonic acid, p-toluene-sulfonic
acid, salicylic acid, and the like. Salts can also be prepared from
inorganic and organic bases. Salts derived from inorganic bases,
include by way of example only, sodium, potassium, lithium,
ammonium, calcium and magnesium salts. Salts derived from organic
bases include, but are not limited to, salts of primary, secondary
and tertiary amines Any ordinary skilled person in the art will
know how to select a proper pharmaceutically acceptable carrier, a
pharmaceutically acceptable salt thereof for implementing this
invention without undue experimentation.
[0420] As used herein, the term "pharmaceutical composition" refers
to one or more of the compounds described herein, such as, e.g., a
synthetic membrane-receiver polypeptide complex mixed or
intermingled with, or suspended in one or more other chemical
components, such as physiologically acceptable carriers and
excipients. One purpose of a pharmaceutical composition is to
facilitate administration of a compound to a subject.
[0421] Certain embodiments provide various polypeptide molecules
having sequences associated with a desired function or activity,
such as receiver polypeptides. A polypeptide is a term that refers
to a chain of amino acid residues, regardless of post-translational
modification (e.g., phosphorylation or glycosylation) and/or
complexation with additional polypeptides, synthesis into
multisubunit complexes, with nucleic acids and/or carbohydrates, or
other molecules. Proteoglycans therefore also are referred to
herein as polypeptides. In certain embodiments, the synthetic
membrane-receiver complex comprises a polypeptide receiver and is
referred to a "synthetic membrane-receiver polypeptide complex." In
certain embodiments, the synthetic membrane-receiver complex
comprises one or more non-receiver polypeptides that are optionally
membrane-associated and that exhibit catalytic and/or metabolic
activity independent of the receiver. For example, the non-receiver
polypeptides may have catalytic activity for an organic compound
including a metabolite. In certain embodiments, the synthetic
membrane-receiver complex comprises a sufficient number of
non-receiver polypeptides (and optionally non-protein co-factors)
to support a metabolic pathway.
[0422] The term "pharmaceutically active agent" or "pharmaceutical
agent" is defined as any compound, e.g., a small molecule drug, or
a biologic (e.g., a polypeptide drug or a nucleic acid drug) that
when administered to a subject has a measurable or conveyable
effect on the subject, e.g., it alleviates or decreases a symptom
of a disease, disorder or condition. In some embodiments, the
pharmaceutical agent may be administered prior to, in combination
with, or following the delivery of a synthetic membrane-receiver
polypeptide complex. In some embodiments, the pharmaceutically
active agent exerts a synergistic treatment effect with the
synthetic membrane-receiver polypeptide complex. In some
embodiments, the pharmaceutically active agents exerts an additive
treatment effect with the synthetic membrane-receiver polypeptide
complex.
[0423] A "promoter" is defined as an array of nucleic acid control
sequences that direct transcription of an operably linked nucleic
acid. Promoters include necessary nucleic acid sequences near the
start site of transcription. A promoter also optionally includes
distal enhancer or repressor elements. A "constitutive" promoter is
a promoter that is active under most environmental and
developmental conditions. An "inducible" promoter is a promoter
that is active under environmental or developmental regulation. The
term "operably linked" refers to a functional linkage between a
nucleic acid expression control sequence (such as a promoter, or
array of transcription factor binding sites) and a second nucleic
acid sequence, wherein the expression control sequence directs
transcription of the nucleic acid corresponding to the second
sequence.
[0424] A "receiver," as used herein, is an entity capable of
interacting with a target, e.g., to associate with or bind to a
target. A receiver can comprise or can consist essentially of a
polypeptide. In some embodiments, the receiver comprises a
polypeptide, a carbohydrate, a nucleic acid, a lipid, a small
molecule, or a combination thereof. In embodiments in which a
receiver is a naturally occurring compound or molecule, the
receiver is "synthetic" in the sense that it is an exogenous or
heterologous compound or molecule with regard to its presence in
the synthetic membrane-receiver complex. In other embodiments the
receiver is "synthetic" in the sense that it is a man-made compound
or molecule, such as a fusion or chimera, a non-naturally occurring
polypeptide, carbohydrate, nucleic acid, lipid, or combination
thereof, or a man-made small molecule or other therapeutic agent.
For example, the receiver may comprise a fusion or chimera
comprising one or more of an S domain, an A domain and a U domain.
The S domain is a surface domain exposed to the environment around
the synthetic membrane-receiver complex, such as the circulatory
system of a subject. The A domain is an anchor domain that attaches
the S domain to the synthetic membrane of the synthetic
membrane-receiver polypeptide complex. The U domain faces the
unexposed side of or is located within the synthetic
membrane-receiver complex, i.e. the side that is not exposed to the
external environment of the circulatory system of a subject.
Irrespective of any domains, a receiver may be located on the
surface of the synthetic membrane-receiver polypeptide complex or
may be located within the complex. The receiver may be associated
with the membrane of the synthetic membrane-receiver complex, e.g.,
the receiver is anchored in, conjugated to or otherwise bound to
the membrane. In some embodiments, the receiver may be conjugated
to the membrane of the synthetic membrane-receiver complex by
chemical or enzymatic conjugation. In other embodiments, the
receiver is not conjugated to the membrane. In some embodiments,
the receiver is not associated with the membrane of the synthetic
membrane-receiver complex and is located within the
membrane-encapsulated volume of the complex. In some embodiments, a
receiver located within the synthetic membrane-receiver complex
does not substantially diffuse out of the complex and/or may not
permeate the membrane. In other embodiments, the receiver may
substantially diffuse out of the complex and/or may permeate the
membrane. In some embodiments, the receiver is loaded, e.g.,
introduced into or put onto the synthetic membrane-receiver
complex. A receiver that is loaded is not biologically synthesized
by the synthetic membrane-receiver complex. A receiver suitable for
loading may be e.g., produced in a cell-based expression system,
isolated from a biological sample, or chemically or enzymatically
synthesized, and then loaded into or onto the synthetic
membrane-receiver complex. In some embodiments, the receiver may be
further modified by the synthetic membrane-receiver complex after
loading. In other embodiments, the receiver is not modified after
loading. In some embodiments, the receiver polypeptide is not
loaded onto or into the complex. In some embodiments, the receiver
is made, e.g., biologically synthesized by the synthetic
membrane-receiver complex. Typically a receiver polypeptide is
expressed by the synthetic membrane-receiver complex from an
exogenous nucleic acid molecule (e.g., a DNA or mRNA) that was
introduced into the complex. The receiver may bind to and/or
sequester a target. Alternatively or in addition the receiver may
exhibit a catalytic activity toward the target, e.g., the receiver
may convert or modify the target, or may degrade the target. A
product may then optionally be released from the receiver.
[0425] "Residency" of a synthetic membrane-receiver complex refers
to the period of time it spends in a physiological location. The
specific location of the synthetic membrane-receiver complex may
change during its lifetime and "residency" applies to the period of
time spent in various environments, including vascular circulation,
peripheral tissues, capillaries, digestive system, pulmonary
system, nasal tissues, epidermal surface, and interstitial tissue.
In specific embodiments, the synthetic membrane-receiver complex
resides in the circulatory system of a subject.
[0426] "Replicating nucleic acid" refers to deoxyribonucleic acid
(DNA) that is capable of being copied by enzymes dedicated to the
increasing the number of copies of the DNA. Usually, DNA
replication leads to the production of two identical replicas from
one original DNA molecule. DNA replication comprises the
incorporation of nucleotides into a growing DNA strand by DNA
polymerase matched to the template strand one at a time via the
creation of phosphodiester bonds.
[0427] "Sequestering" is defined as cloistering, occluding,
separating, segregating, hiding, insulating, or isolating of a
target and preventing it from freely interacting with its
environment.
[0428] "Specifically binding" or "specifically interacting", as
used herein, describes any interaction between two entities (e.g.,
a target with a receiver, such as an antibody with an antigen, a
receptor with a ligand, an enzyme with a substrate, biotin with
avidin, etc.) that is saturable, often reversible and so
competitive, as these terms are understood by those of ordinary
skill in the chemical and biochemical arts. e.g., Specific binding
involving biological molecules such as, e.g., proteins, peptides
and nucleic acid occurs when one member of the binding pair has a
site with a shape and distribution of charged, polar, or
hydrophobic moieties such that the interaction of the cognate
ligand with that site is characterized by favorable energetics
(i.e., a negative free energy of binding). The specificity of the
interaction may be measured or expressed as a binding constant
(Kd). The Kd may range from a mM range to a pM range, including
.mu.M ranges and nM ranges. Typical Kd values are below about
10.sup.-6 M, below about 10.sup.-7 M, below about 10.sup.-8 M, and
in some embodiments below about 10.sup.-9 M.
[0429] As used herein, the term "substantially" or "substantial"
refers, e.g., to the presence, level, or concentration of an entity
in a particular space, the effect of one entity on another entity,
or the effect of a treatment. For example, an activity, level or
concentration of an entity is substantially increased if the
increase is 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 50-fold,
100-fold, or 1000-fold relative to a baseline. An activity, level
or concentration of an entity is also substantially increased if
the increase is 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%,
100%, 200%, or 500% relative to a baseline. An entity may be
substantially present in a particular space if it can be detected
by methods known in the art. An entity may not be substantially
present in a particular space if it is present at levels below the
limit of detection for assays and methods known in the art. In some
embodiments, an entity may not be substantially present in a
particular space if it is barely detectable but only in
non-functional quantities or minute quantities that do not cause or
change a phenotype. In other embodiments, an entity may not be
substantially present in a particular population if it is present
and can be detected only in a small number of constituents making
up the population, e.g., less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%
2% or less than 1%, 0.5%, 0.1% of constituents of the population.
For example, an exogenous nucleic acid may not be retained upon
enucleation, the cell is rendered non-replicative, and the
enucleated cell is incapable of continued expression of the
receiver polypeptide encoded bythe exogenous nucleic acid. The loss
of the ability of the cell to continue to significantly translate
the exogenous polypeptide "effectively terminates" protein
expression. In certain embodiments, the synthetic membrane-receiver
complex is substantially incapable of self-replication, e.g., the
replication of nucleic acids. For example, the synthetic
membrane-receiver polypeptide complex does not substantially
incorporate a nucleoside if contacted with labeled nucleoside, such
as thymidine, in an incorporation assay. In some embodiments, the
synthetic membrane-receiver polypeptide complex does not contain a
substantial amount of self-replicating nucleic acids. The term
"substantial identity" of polynucleotide or nucleic acid sequences
means that a polynucleotide comprises a sequence that has at least
25% sequence identity. Alternatively, percent identity can be any
integer from 25% to 100%. More preferred embodiments include at
least: 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%,
85%, 90%, 95%, or 99% compared to a reference sequence using the
programs described herein; preferably BLAST using standard
parameters.
[0430] "Synthetic" refers to a compound or molecule that is either
man-made and non-naturally occurring, or if it is naturally
occurring is placed in a context or location that it would not
naturally exist, or if it naturally exists in the context or
location is in a state of purity, or is present in an amount,
concentration or number that it would not naturally be present in
the context or location. Synthetic entities can be isolated or
purified compounds that are optionally chemically or enzymatically
modified from their natural state, exogenous nucleic acids,
exogenous (heterologous) receivers, and the like. The presence of a
synthetic compound or molecule, as defined herein, in any entity
renders the entire entity "synthetic". For example, a cell
comprising a receiver is a synthetic cell.
[0431] A "target," as used herein, is an entity capable of
interacting with a receiver, e.g., to associate with or bind to a
receiver. A "target" includes, but is not limited to a polypeptide
(e.g., an antibody or antibody-related polypeptide, a complement
constituent, an amyloid protein, a pathogen, a toxin, a prion), a
molecule (e.g., a metabolite, a steroid, a hormone, a carbohydrate;
an oligosaccharide; a chemical; a polysaccharide, a DNA; an RNA; a
lipid, an amino acid, an element, a toxin or pathogen), a complex
(e.g., an immune complex), or a cell (e.g., a cancer cell, a
macrophage, a bacterium, a fungus, a virus, or a parasite). A
target is intended to be detected, diagnosed, impaired, destroyed
or altered (e.g., functionally complemented) by the methods
provided herein. The specific target may occur free or is
associated with other entities in the circulatory system of a
subject.
[0432] A "target self-antibody," as used herein, is a self-antibody
associated with an autoimmune disease. Such self-antibodies may be
detected and analyzed using antibody binding tests involving
contacting the subject's antibodies to samples of the subject's own
tissue, usually thyroid, stomach, liver, and kidney tissue.
Antibodies binding to the "self" tissue (comprising self-antigens)
indicate an autoimmune disorder.
[0433] "Transgene" or "exogenous nucleic acid" refers to a foreign
or native nucleotide sequence that is introduced into a synthetic
membrane-receiver complex. Transgene and exogenous nucleic acid are
used interchangeably herein and encompass recombinant nucleic
acids.
[0434] As used herein, "treat," "treating," and/or "treatment" are
an approach for obtaining beneficial or desired clinical results,
pharmacologic and/or physiologic effect, e.g., alleviation of the
symptoms, preventing or eliminating said symptoms, and refer to
both therapeutic treatment and prophylactic or preventative
treatment of the specific disease, disorder or condition.
Beneficial or desired clinical results, pharmacologic and/or
physiologic effect include, but are not limited to, preventing the
disease, disorder or condition from occurring in a subject that may
be predisposed to the disease, disorder or condition but does not
yet experience or exhibit symptoms of the disease (prophylactic
treatment), alleviation of symptoms of the disease, disorder or
condition, diminishment of extent of the disease, disorder or
condition, stabilization (i.e., not worsening) of the disease,
disorder or condition, preventing spread of the disease, disorder
or condition, delaying or slowing of the disease, disorder or
condition progression, amelioration or palliation of the disease,
disorder or condition, and combinations thereof, as well as
prolonging survival as compared to expected survival if not
receiving treatment.
[0435] A "therapeutic agent" or "therapeutic molecule" includes a
compound or molecule that, when present in an effective amount,
produces a desired therapeutic effect, pharmacologic and/or
physiologic effect on a subject in need thereof.
[0436] The term "therapeutically effective amount" or "effective
amount" is an amount of an agent being administered to a subject
sufficient to effect beneficial or desired clinical results,
pharmacologic and/or physiologic effects. An effective amount can
be administered in one or more administrations. An effective amount
is typically sufficient to palliate, ameliorate, stabilize,
reverse, slow or delay the progression of the disease state. The
effective amount thus refers to a quantity of an agent or frequency
of administration of a specific quantity of an agent sufficient to
reasonably achieve a desired therapeutic and/or prophylactic
effect. For example, it may include an amount that results in the
prevention of, treatment of, or a decrease in, the symptoms
associated with a disease or condition that is being treated, e.g.,
the diseases or medical conditions associated with a target
polypeptide. The amount of a therapeutic composition administered
to the subject will depend on the type and severity of the disease
and on the characteristics of the individual, such as general
health, pathologic conditions, diets, age, sex, body weight and
tolerance to drugs. It will also depend on the degree, severity and
type of disease. Further, the effective amount will depend on the
methods of formulation and administration used, e.g.,
administration time, administration route, excretion speed, and
reaction sensitivity. The skilled artisan will be able to determine
appropriate dosages depending on these and other factors. The
compositions can also be administered in combination with one or
more additional therapeutic compounds. A desirable dosage of the
pharmaceutical composition may be in the range of about 0.001 to
100 mg/kg for an adult. In one example, an intravenous
administration is initiated at a dose which is minimally effective,
and the dose is increased over a pre-selected time course until a
positive effect is observed. Subsequently, incremental increases in
dosage are made limiting to levels that produce a corresponding
increase in effect while taking into account any adverse affects
that may appear. Non-limited examples of suitable dosages can
range, for example, from 1.times.10.sup.10 to 1.times.10.sup.14,
from 1.times.10.sup.11 to 1.times.10.sup.13, or from
5.times.10.sup.11 to 5.times.10.sup.12 synthetic membrane-receiver
polypeptide complexes of the present invention. Specific examples
include about 5.times.10.sup.10, 6.times.10.sup.10,
7.times.10.sup.10, 8.times.10.sup.10, 9.times.10.sup.10,
1.times.10.sup.11, 2.times.10.sup.11, 3.times.10.sup.11,
4.times.10.sup.11, 5.times.10.sup.11, 6.times.10.sup.11,
7.times.10.sup.11, 8.times.10.sup.11, 9.times.10.sup.11,
1.times.10.sup.12, or more synthetic membrane-receiver polypeptide
complexes of the present invention. Each dose of synthetic
membrane-receiver polypeptide complexes can be administered at
intervals such as once daily, once weekly, twice weekly, once
monthly, or twice monthly.
[0437] "Unbound" refers to the state of a target with which the
receiver is capable of interacting. An unbound target is not
associated with another entity or a receiver. An unbound receiver
is not associated with another entity or a target. A target is
considered "bound" once it is associated with the receiver or
another entity. Unbound targets include soluble forms of the target
in circulation. Bound targets include targets that are embedded,
associated with, linked to, or otherwise interacting with entities
in circulation or peripheral tissue. Entities with which a target
may interact include circulating cells, peripheral endothelial
tissue, immune complexes, glycolipids, microbes, immunoglobulins,
serum albumin, clotting factors, lipoproteins, and
electrolytes.
[0438] A "variant" is a polypeptide which differs from the original
protein by one or more amino acid substitutions, deletions,
insertions, or other modifications. These modifications do not
significantly change the biological activity of the original
protein. In many cases, a variant retains at least 10%, 20%, 30%,
40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% of the biological
activity of original protein. The biological activity of a variant
can also be higher than that of the original protein. A variant can
be naturally-occurring, such as by allelic variation or
polymorphism, or be deliberately engineered.
[0439] The amino acid sequence of a variant is substantially
identical to that of the original protein. In many embodiments, a
variant shares at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 99%, or
more global sequence identity or similarity with the original
protein. Sequence identity or similarity can be determined using
various methods known in the art, such as Basic Local Alignment
Tool (BLAST), dot matrix analysis, or the dynamic programming
method. In one example, the sequence identity or similarity is
determined by using the Genetics Computer Group (GCG) programs GAP
(Needleman-Wunsch algorithm). The amino acid sequences of a variant
and the original protein can be substantially identical in one or
more regions, but divergent in other regions.
[0440] As used herein, the term "vector" is a nucleic acid
molecule, preferably self-replicating, which transfers and/or
replicates an inserted nucleic acid molecule, such as a transgene
or exogenous nucleic acid into and/or between host cells. It
includes a plasmid or viral chromosome into whose genome a fragment
of recombinant DNA is inserted and used to introduce recombinant
DNA, or a transgene, into a synthetic membrane-receiver polypeptide
complex.
[0441] The "volume of distribution" (VD) is a pharmacological,
theoretical volume that the total amount of administered drug would
have to occupy (if it were uniformly distributed), to provide the
same concentration as it is in blood plasma. A VD greater than the
blood plasma indicates that an agent is distributed in tissue in
the rest of the body. The VD is influenced by solubility, charge,
size, etc. Generally, non-polar agents with high lipid solubility,
agents with low rates of ionization or low plasma binding
capabilities have higher volumes of distribution than agents that
are more polar, more highly ionized or exhibit high plasma binding.
The volume of distribution is given by the following equation:
V.sub.D=total amount of drug in the body/drug blood plasma
concentration. The units for Volume of Distribution are typically
reported in (ml or liter)/kg body weight. A volume of distribution
"equal to plasma volume" is relative to the volume of the
circulatory system exclusive of circulating cells.
Synthetic Membrane-Receiver Complexes
[0442] Provided herein are synthetic membrane-receiver complexes,
populations, pharmaceutical compositions, and dosage forms thereof,
as well as medical devices and kits comprising a formulation of the
synthetic membrane-receiver complexes.
[0443] The synthetic membrane-receiver complexes described herein
comprise a receiver (e.g., a polypeptide) that is capable of
interacting with a target and further comprise a membrane
comprising a polypeptide that is not the receiver. The synthetic
membrane-receiver complex has catalytic activity independent of the
receiver. Optionally, the synthetic membrane-receiver complexes
comprise a payload, for example a therapeutic agent.
[0444] In some embodiments, synthetic membrane-receiver complex are
generated using cells as a source material. In certain embodiments,
generating a synthetic membrane-receiver complex comprises the step
of contacting an erythroid cell and platelets with a receiver. In
certain embodiments, generating a synthetic membrane-receiver
complex comprises the step of contacting a cell derived from a
hematopoietic stell cell with a receiver.
[0445] In certain embodiments, synthetic membrane-receiver
complexes are administered, e.g., intravenously to the circulatory
system of a mammalian subject, such as a human. In some
embodiments, the membrane-receiver complexes provide a natural
barrier between a receiver and optionally a payload (e.g.,
therapeutic agent) and the immune system. In some embodiments, the
synthetic membrane-receiver complexes are capable of residing in
the circulatory system of a subject for an extended period of time
allowing delivery of a therapeutic effect for a longer period of
time than what can be achieved by delivery through other methods
currently used.
[0446] Synthetic membrane-receiver complexes may interact with a
target in the circulatory system of the subject. In some
embodiments, the concentration of an unbound target or total target
in the circulatory system of the subject is reduced subsequent to
its interaction with the receiver exhibited in or on the synthetic
membrane-receiver complex. In certain embodiments, the presence or
elevated concentration of a target in circulation is associated
with a disease, disorder or condition and reducing the
concentration of the target leads to a reduction in disease burden,
may alleviate a symptom of the disease or has some other treatment
effect. In some embodiments, a reduction in the concentration of
the target prevents the onset of a disease, disorder or
condition.
[0447] Biodistribution is a substantial hurdle in drug delivery and
efficacy. After a drug enters the systemic circulation, it is
distributed to the body's tissues. Distribution is generally uneven
because of differences in blood perfusion, tissue binding (e.g.,
because of lipid content), regional pH, and permeability of cell
membranes. The entry rate of a drug into a tissue depends on the
rate of blood flow to the tissue, tissue mass, and partition
characteristics between blood and tissue. Distribution equilibrium
(when entry and exit rates are the same) between blood and tissue
is reached more rapidly in richly vascularized areas, unless
diffusion across cell membranes is the rate-limiting step. After
equilibrium, drug concentrations in tissues and in extracellular
fluids are reflected by the plasma concentration. Metabolism and
excretion occur simultaneously with distribution, making the
process dynamic and complex.
[0448] The synthetic membrane-receiver complexes when formulated in
a pharmaceutical compositions suitable for administration into the
circulatory system of a subject can have a volume of distribution
equal to the plasma volume of the subject. Advantages of the volume
of distribution characteristic of the synthetic membrane-receiver
complexes include that the biodistribution of the receiver when
administered as a synthetic membrane-receiver complex into the
circulatory system of a subject may be accurately predicted and/or
that potential adverse extravascular effects of the receiver (e.g.,
an inflammatory response, an immune response, toxicity, etc.) are
substantially reduced.
[0449] Distribution of a therapeutic composition out of the
bloodstream and into surrounding tissue increases the apparent
volume of distribution to be greater than the plasma volume of the
subject. Therapeutic compositions that exit the bloodstream and
interact with surrounding tissue, e.g., adipose tissue or muscle,
may interact with those tissues in unpredictable ways and trigger
adverse events. A therapeutic composition, such as a composition
comprising a synthetic membrane-receiver complex described herein,
whose volume of distribution does not substantially exceed the
plasma volume of the subject typically has a safety profile that is
superior to a therapeutic composition with a large volume of
distribution. Further, the amount of a therapeutic composition that
must be loaded to be effective (the effective amount) is in part
dependent on the bioavailability of the therapeutic composition.
Bioavailability is related to the composition's profile and rate of
distribution into extra-vascular tissues, and thus its volume of
distribution. By maintaining a precise and predictable volume of
distribution, typically a therapeutic composition, such as a
composition comprising a synthetic membrane-receiver complex
described herein, will have a more precise and predictable
dose-effect relationship than a therapeutic composition with a less
precise and predictable volume of distribution.
[0450] For example, the drug distribution rate for interstitial
fluids of most tissues is determined primarily by perfusion. For
poorly perfused tissues (e.g., muscle, fat), distribution is very
slow, especially if the tissue has a high affinity for the drug.
Endothelial cells lining the vessel wall are connected by adherens,
tight and gap junctions. These junctional complexes are related to
those found at epithelial junctions but with notable changes in
terms of specific molecules and organization. Endothelial
junctional proteins play important roles in tissue integrity but
also in vascular permeability, leukocyte extravasation and
angiogenesis. Small molecules, protein therapeutics, and viruses
measure 1-30 nm and are capable of diffusing far beyond the
vasculature based on lipophilicity, ability to bind plasma
proteins, and charge. A drug that is confined to the vasculature
has a lesser volume of tissue to occupy and thus may remain at an
effective, therapeutic concentration. In addition, the drug is
unable to interact with peripheral tissues and potential off-target
toxicity effects are limited. Larger circulatory agents (e.g.,
between 1 micron and 20 microns) do not pass through endothelial
tight junctions which are less than 100 nm in width and endothelial
cells are incapable of facilitating the transcytosis of agents of
that size. In some embodiments, the synthetic membrane-receiver
complexes described herein measure between 1 micon and 20 microns.
The vascular properties of these agents limit their diffusive
capabilities to the bloodstream and concentrate the therapeutic
effect of any receiver or payload.
[0451] The synthetic membrane-receiver complexes described herein,
in some embodiments, exhibit advantageous clearance properties. In
some embodiments, synthetic membrane-receiver complexes may be
degraded using a natural degradation process, through the
reticulo-endothelial system. Such degradation typically does not
cause any or little side effects. In some embodiments, receivers
displayed on the synthetic membrane-receiver complexes can be
selectively trapped by organs of the reticulo-endothelial
system.
[0452] The synthetic membrane-rceiver complexes described herein
are, in some embodiments, incapable of self-replication. In some
embodiments, the synthetic membrane-receiver complexes do not
contain self-replicating nucleic acids. Thus, such complexes do not
carry a risk of uncontrolled cellular division, undesired protein
expression and/or the potential of triggering cytokine release
syndrome.
[0453] Membrane Compositions of the Synthetic Membrane-Receiver
Complexes
[0454] 1. Lipids
[0455] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises a membrane that has a mass of
approximately 1.times.10{circumflex over ( )}-12 g and a density of
approximately 1.15 g/cm{circumflex over ( )}3. The mass of the
membrane component can be assessed by separating it from the
remainder of the complex using hypotonic solutions of mildly
alkaline buffer, see e.g., protocols in Dodge et al 1963, Arch
Biochem Biophys 100:119.
[0456] The synthetic membrane-receiver complex comprises a
membrane. In some embodiments, the membrane comprises
phosphatidylcholine, sphingomyelin, lysophosphatidylcholine,
phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol,
or phosphatidic acid. In some embodiments, the membrane is a cell
membrane.
[0457] In one embodiment the synthetic membrane-receiver
polypeptide complex comprises lipid molecules of the class of
choline phospholipids, acidic phospholipids, and
phosphatidylethanolamine
[0458] In one embodiment the synthetic membrane-receiver
polypeptide complex comprises phosphatidylcholine, sphingomyelin,
lysophosphatidylcholine, phosphatidylethanolamine,
phosphatidylserine, phosphatidylinositol, or phosphatidic acid.
[0459] In one embodiment the synthetic membrane-receiver
polypeptide complex comprises choline phospholipids in an
approximate amount of 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%,
59%, 60%, 61%, 62%, 63%, 64%, or 65% relative to the total lipid
content of the complex.
[0460] In one embodiment the synthetic membrane-receiver
polypeptide complex comprises acidic phospholipids in an
approximate amount of 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%,
15%, 16%, 17%, 18%, 19%, or 20% relative to the total lipid content
of the complex.
[0461] In one embodiment the synthetic membrane-receiver
polypeptide complex comprises phosphatidylcholine in an amount
greater than 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%,
21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%,
34%, 35%, 36%, 37%, 38%. 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%,
47%, 48%, 49%, 50%, or greater than 50% relative to the total lipid
content of the complex.
[0462] In one embodiment the synthetic membrane-receiver
polypeptide complex comprises sphingomyelin in an amount greater
than 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%,
22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%,
35%, 36%, 37%, 38%. 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%,
48%, 49%, 50%, or greater than 50% relative to the total lipid
content of the complex.
[0463] In one embodiment the synthetic membrane-receiver
polypeptide complex comprises lysophosphatidylcholine in an amount
greater than 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%,
1%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, or greater
than 10% relative to the total lipid content of the complex.
[0464] In one embodiment the synthetic membrane-receiver
polypeptide complex comprises phosphatidylethanolamine in an amount
greater than 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%,
21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%,
34%, 35%, 36%, 37%, 38%. 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%,
47%, 48%, 49%, 50%, or greater than 50% relative to the total lipid
content of the complex.
[0465] In one embodiment the synthetic membrane-receiver
polypeptide complex comprises phosphatidylserine in an amount
greater than 1%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%,
11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%,
24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%,
37%, 38%. 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%,
50%, or greater than 50% relative to the total lipid content of the
complex.
[0466] In one embodiment the synthetic membrane-receiver
polypeptide complex comprises phosphatidylinositol in an amount
greater than 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%,
1%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, or greater
than 10% relative to the total lipid content of the complex.
[0467] In one embodiment the synthetic membrane-receiver
polypeptide complex comprises phosphatidic acid in an amount
greater than 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%,
1%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, or greater
than 10% relative to the total lipid content of the complex.
[0468] In one embodiment the synthetic membrane-receiver
polypeptide complex comprises molecules from at least one, two, or
three, of the following classes of molecules, including, but not
limited to, choline phospholipids, acidic phospholipids, and
phosphatidylethanolamine
[0469] In one embodiment the molar ratio of choline phospholipids
to acidic phospholipids in the synthetic membrane-receiver
polypeptide complex is less than 1:1000, approximately 1:1000,
approximately 1:500, approximately 1:250, approximately 1:100,
approximately 1:50, approximately 1:25, approximately 1:10,
approximately 1:9, approximately 1:8, approximately 1:7,
approximately 1:6, approximately 1:5, approximately 1:4,
approximately 1:3, approximately 1:2, approximately 1:1,
approximately 2:1, approximately 3:1, approximately 4:1,
approximately 5:1, approximately 6:1, approximately 7:1,
approximately 8:1, approximately 9:1, approximately 10:1,
approximately 25:1, approximately 50:1, approximately 100:1,
approximately 250:1, approximately 500:1, approximately 1000:1, or
greater than approximately 1000:1.
[0470] In one embodiment the molar ratio of choline phospholipids
to phosphatidyl ethanolamine in the synthetic membrane-receiver
polypeptide complex is less than 1:1000, approximately 1:1000,
approximately 1:500, approximately 1:250, approximately 1:100,
approximately 1:50, approximately 1:25, approximately 1:10,
approximately 1:9, approximately 1:8, approximately 1:7,
approximately 1:6, approximately 1:5, approximately 1:4,
approximately 1:3, approximately 1:2, approximately 1:1,
approximately 2:1, approximately 3:1, approximately 4:1,
approximately 5:1, approximately 6:1, approximately 7:1,
approximately 8:1, approximately 9:1, approximately 10:1,
approximately 25:1, approximately 50:1, approximately 100:1,
approximately 250:1, approximately 500:1, approximately 1000:1, or
greater than approximately 1000:1.
[0471] In one embodiment the molar ratio of
phosphatidylethanolamine to acidic phospholipids in the synthetic
membrane-receiver polypeptide complex is less than 1:1000,
approximately 1:1000, approximately 1:500, approximately 1:250,
approximately 1:100, approximately 1:50, approximately 1:25,
approximately 1:10, approximately 1:9, approximately 1:8,
approximately 1:7, approximately 1:6, approximately 1:5,
approximately 1:4, approximately 1:3, approximately 1:2,
approximately 1:1, approximately 2:1, approximately 3:1,
approximately 4:1, approximately 5:1, approximately 6:1,
approximately 7:1, approximately 8:1, approximately 9:1,
approximately 10:1, approximately 25:1, approximately 50:1,
approximately 100:1, approximately 250:1, approximately 500:1,
approximately 1000:1, or greater than approximately 1000:1.
[0472] In one embodiment the synthetic membrane-receiver
polypeptide complex comprises molecules from at least one, two,
three, four, five, six, or seven of the following classes of
molecules, including, but not limited to, phosphatidylcholine,
sphingomyelin, lysophosphatidylcholine, phosphatidylethanolamine,
phosphatidylserine, phosphatidylinositol, or phosphatidic acid.
[0473] The lipid composition of the synthetic membrane-receiver
polypeptide complex can be experimentally measured using methods
known in the art including, e.g., gas-liquid chromatography or thin
layer chromatography, see for example Dodge & Phillips, J Lipid
Res 1967 8:667.
[0474] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises a lipid bilayer composed of an inner
leaflet and an outer leaflet. The composition of the inner and
outer leaflet can be determined by transbilayer distribution assays
known in the art, see e.g., Kuypers et al. Biohim Biophys Acta 1985
819:170. In one embodiment, the composition of the outer leaflet is
between approximately 70-90% choline phospholipids, between
approximately 0-15% acidic phospholipids, and between approximately
5-30% phosphatidylethanolamine. In one embodiment, the composition
of the inner leaflet is between approximately 15-40% choline
phospholipids, between approximately 10-50% acidic phospholipids,
and between approximately 30-60% phosphatidylethanolamine.
[0475] 2. Cholesterol
[0476] In one embodiment the synthetic membrane-receiver
polypeptide complex comprises cholesterol. In one embodiment the
cholesterol content is between approximately 3.0-5.5 nmol
cholesterol per 10{circumflex over ( )}7 complexes. In one
embodiment, the cholesterol content is between approximately
1.8-3.5 nmol cholesterol per 10{circumflex over ( )}7 complexes. In
one embodiment the molar ratio of cholesterol to phospholipids in
the complex is between approximately 0.5-1.5. In a preferred
embodiment the molar ratio of cholesterol to phospholipids is
between approximately 0.8-1.2. In a preferred embodiment the molar
ratio of cholesterol to phospholipids is between approximately
0.84-0.9. In a preferred embodiment the molar ratio of cholesterol
to phospholipids is between approximately 0.5-0.75. In a preferred
embodiment the molar ratio of cholesterol to phospholipids is
between approximately 0.55-0.6.
[0477] 3. Lipids, Proteins, and Carbohydrates
[0478] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises polypeptides other than the receiver
polypeptide. In one embodiment, approximately 52% of the membrane
mass is protein, approximately 40% is lipid, and approximately 8%
is carbohydrate. In one embodiment, approximately 7% of the
carbohydrate content is comprised of glycosphingolipids and
approximately 93% of the carbohydrate content is comprised of
O-linked and N-linked oligosaccharides on membrane-associated
polypeptides.
[0479] In one embodiment the mass ratio of lipid to protein in the
synthetic membrane-receiver polypeptide complex is less than
1:1000, approximately 1:1000, approximately 1:500, approximately
1:250, approximately 1:100, approximately 1:50, approximately 1:25,
approximately 1:10, approximately 1:9, approximately 1:8,
approximately 1:7, approximately 1:6, approximately 1:5,
approximately 1:4, approximately 1:3, approximately 1:2,
approximately 1:1, approximately 2:1, approximately 3:1,
approximately 4:1, approximately 5:1, approximately 6:1,
approximately 7:1, approximately 8:1, approximately 9:1,
approximately 10:1, approximately 25:1, approximately 50:1,
approximately 100:1, approximately 250:1, approximately 500:1,
approximately 1000:1, or greater than approximately 1000:1.
[0480] In one embodiment the mass ratio of lipid to carbohydrate in
the synthetic membrane-receiver polypeptide complex is less than
1:1000, approximately 1:1000, approximately 1:500, approximately
1:250, approximately 1:100, approximately 1:50, approximately 1:25,
approximately 1:10, approximately 1:9, approximately 1:8,
approximately 1:7, approximately 1:6, approximately 1:5,
approximately 1:4, approximately 1:3, approximately 1:2,
approximately 1:1, approximately 2:1, approximately 3:1,
approximately 4:1, approximately 5:1, approximately 6:1,
approximately 7:1, approximately 8:1, approximately 9:1,
approximately 10:1, approximately 25:1, approximately 50:1,
approximately 100:1, approximately 250:1, approximately 500:1,
approximately 1000:1, or greater than approximately 1000:1.
[0481] In one embodiment the mass ratio of carbohydrate to protein
in the synthetic membrane-receiver polypeptide complex is less than
1:1000, approximately 1:1000, approximately 1:500, approximately
1:250, approximately 1:100, approximately 1:50, approximately 1:25,
approximately 1:10, approximately 1:9, approximately 1:8,
approximately 1:7, approximately 1:6, approximately 1:5,
approximately 1:4, approximately 1:3, approximately 1:2,
approximately 1:1, approximately 2:1, approximately 3:1,
approximately 4:1, approximately 5:1, approximately 6:1,
approximately 7:1, approximately 8:1, approximately 9:1,
approximately 10:1, approximately 25:1, approximately 50:1,
approximately 100:1, approximately 250:1, approximately 500:1,
approximately 1000:1, or greater than approximately 1000:1.
[0482] In one embodiment the area occupancy of protein in the
synthetic membrane-receiver polypeptide complex is approximately
23% and the area occupancy of lipid in the synthetic
membrane-receiver polypeptide complex is approximately 77%.
[0483] In one embodiment the synthetic membrane-receiver
polypeptide complex comprises a polypeptide selected from the
following list, including but not limited to, spectrin, myosin-like
polypeptide, band 3, SLC4A1, actin, actin-like polypeptide,
glyceraldehyde 3-P dehydrogenase (G3PD).
[0484] In one embodiment the synthetic membrane-receiver
polypeptide complex comprises at least one, two, three, four, five,
six, or seven of the polypeptides selected from the following list,
including but not limited to, spectrin, myosin-like polypeptide,
band 3, SLC4A1, actin, actin-like polypeptide, glyceraldehyde 3-P
dehydrogenase (G3PD).
[0485] 4. Additional polypeptides
[0486] In some embodiments, the synthetic membrane-receiver complex
comprises at least one polypeptide that is not the receiver. In
some embodiments, the synthetic membrane-receiver complex comprises
at least two, at least three, at least four, at least five, at
least six, at least seven, at least eight, at least nine or at
least ten polypeptides that are not the receiver. In certain
instances, the polypeptide is capable of an enzymatic or catalytic
function independent of the receiver. The non-receiver polypeptide
may be associated with the membrane of the synthetic
membrane-receiver complex.
[0487] In some embodiments, the non-receiver polypeptide may, e.g.,
stabilize the synthetic membrane-receiver complex, target the
synthetic membrane-receiver complex to particular cells and
tissues, engage the reticulo-endothelial system, protect the
synthetic membrane-receiver complex from macrophages and other
phagocytic cells, and/or evade other components of the innate
immune system. Suitable polypeptides include, e.g., complement
regulatory polypeptides, inhibitors of cell-mediated degradation
(e.g., CD47, CD55, and CD59), and anti-inflammatory polypeptides.
Alternatively or in addition, non-receiver polypeptides may shorten
or control the half-life of the complex, including targeting to
macrophages or other phagocytic cells. Suitable non-receiver
polypeptides may promote apoptosis or otherwise trigger
opsonization. In some embodiments, non-receiver polypeptides
include polypeptide carriers, pumps, and channels; Glutl, Band3,
aquaporin 1, RhAH, NA/K ATPase, Ca ATPase, Na--H exchanger, KCa3.1,
KCl cotransporter, and coenzyme Q10.
[0488] As many drugs are systemically delivered to the blood
circulatory system, the answer to the problem of effective drug
delivery often focuses on maintaining the drug in the blood for
extended periods of time. Thus, the development of long-circulating
(long half-life) therapeutics that remain biologically available in
the blood for extended time periods is an unmet need. The synthetic
membrane-receiver complexes described herein can be modified to
increase or decrease their half-life in circulation. In some
embodiments, the half-life of the receiver and optionally the
payload in circulation may be modified by altering the half-life of
the synthetic membrane-receiver complex. In some instances, the
ahlf-life is increased and the increase may be, for instance from
about 1.5-fold to 20-fold increase in serum half-life.
[0489] In some embodiments, receivers may reside in circulation and
may remain functional and active for substantially the duration of
the synthetic membrane-receiver complex in circulation. In some
embodiments, receivers may reside in circulation and may remain
functional and active for more than 21 days in circulation. In some
instances, synthetic membrane-receiver complexes and receivers may
reside in circulation for 30 days, 45 days, 60 days, 100 days, 120
days, or longer. In other embodiments, the synthetic
membrane-receiver complexes and receivers may reside in circulation
for several hours to several days, such as 1, 2, 3, 4, 5, 6, 7, 8,
9, or 10 days. Residency in the circulatory system, in certain
embodiments, is determined by the presence or absence of certain
polypeptides on the synthetic membrane-receiver complex. For
example, the synthetic membrane-receiver complex may comprise a
CD47, CD55, or CD59 polypeptide or a functional fragment
thereof.
[0490] CD47 is a membrane protein that interacts with the myeloid
inhibitory immunoreceptor SIRP.alpha. (also termed CD172a or
SHPS-1) that is present, e.g., on macrophages. Engagement of
SIRP.alpha. by CD47 provides a down-regulatory signal that inhibits
host cell phagocytosis. For example, high levels of CD47 allow
cancer cells to avoid phagocytosis despite the presence
pro-phagocytic signals, such as high levels of calreticulin. CD47
also has further roles in cell adhesion, e.g., by acting as an
adhesion receptor for THBS1 on platelets and in the modulation of
integrins. CD47 interaction with SIRP.alpha. further prevents
maturation of immature dendritic cells, inhibits cytokine
production by mature dendritic cells. CD47 interaction with
SIRP.gamma. mediates cell-cell adhesion, enhances
superantigen-dependent T-cell-mediated proliferation and
co-stimulates T-cell activation.
[0491] CD47 is a 50 kDa membrane receptor that has extracellular
N-terminal IgV domain, five transmembrane domains, and a short
C-terminal intracellular tail. There are four alternatively spliced
isoforms of CD47 that differ only in the length of their
cytoplasmic tail. In some embodiments, the synthetic
membrane-receiver complex may comprise a CD47 or a functional
fragment thereof comprising one or more of: the extracellular
N-terminal IgV domain, one, two, three, four, or five transmembrane
domains, and/or the short C-terminal intracellular tail. The
cytoplasmic tail can be found as four different splice isoforms
ranging from 4 to 36 amino acids. The 16 amino acid form 2 is
expressed in all cells of hematopoietic origin and in endothelial
and epithelial cells. The 36 amino acid form 4 is expressed
primarily in neurons, intestine, and testis. The 4 amino acid form
1 is found in epithelial and endothelial cells. The expression
pattern of the 23 amino acid form 3 resembles that of form 4. In
some embodiments, the synthetic membrane-receiver complex comprises
CD47 or a functional fragment thereof that is of one of form 1,
from 2, form 3, or from 4. In some embodiments, the synthetic
membrane-receiver complex does not comprise form 2. In some
embodiments, the synthetic membrane-receiver complex comprises CD47
polypeptide or a functional polypeptide fragment thereof in an
amount or copy number sufficient to reside in circulation for 15
days, 21 days, 30 days, 45 days, 60 days, 100 days, 120 days, or
longer. In some embodiments, the synthetic membrane-receiver
complex comprises a modified CD47, such as a conformational change.
For example, a conformational change in CD47 is introduced so that
the modified CD47 is capable of interacting with TSP-1. In one
embodiment, the modified CD47 comprising the conformational change
creates a different binding site for SIRP.alpha.. In some
embodiments, the synthetic membrane-receiver complex comprises a
modified CD47 polypeptide or a functional polypeptide fragment
thereof comprising a conformational change in an amount or copy
number sufficient to reside in circulation for less than 10, 9, 8,
7, 6, 5, 4, 3, 2, or less than 1 day. In certain embodiments, the
synthetic membrane-receiver complex comprises a fusion of a CD47
isoform to the extracellular domain of a native erythroid
polypeptide. For example, the N terminus of glycophorin A may be
fused to the CD47 polypeptide or functional fragment thereof, which
may lead to a reduction of the SIRP.alpha.-mediated signal to
macrophages to phagocytose the synthetic membrane-receiver
complex.
[0492] In some embodiments, generating synthetic membrane-receiver
complexes includes the step of contacting a receiver (e.g., a
polypeptide) with a cell, such as an erythroid cell or a platelet.
CD47 is expressed in erythrocytes and platelets to mediate
phagocytosis. In some embodiments, the natural levels of CD47 are
altered in erythrocytes or platelets, e.g., by over-expression or
inhibition of CD47 expression using any suitable method, such as
the introduction of exogenous nucleic acids (e.g., expression
vectors, CD47 mRNA, CD47 siRNA, and the like). In some embodiments,
the natural levels of CD47 are altered such that the synthetic
membrane-receiver complex resides in circulation for 15 days, 21
days, 30 days, 45 days, 60 days, 100 days, 120 days, or longer. In
some embodiments, the natural levels of CD47 are altered such that
the synthetic membrane-receiver complex resides in circulation for
less than 10, 9, 8, 7, 6, 5, 4, 3, 2, or less than 1 day.
[0493] For example, synthetic membrane-receiver complexes that are
administered to a subject may comprise elevated CD47 levels when
compared to native levels of a suitable control. Elevated CD47
levels may be achieved, e.g., by exogenous expression by the
synthetic membrane-receiver complex of CD47 from an exogenous
nucleic acid, by loading of CD47 mRNA into the complex, or by
conjugating CD47 polypeptide to the surface of the complex.
Elevated CD47 levels are useful to increase the half-life of the
population of synthetic membrane-receiver complexes in the
circulatory system of the subject. The synthetic membrane-receiver
complexes comprise a receiver and optionally a payload, such as a
therapeutic agent. In some embodiments, increasing the half-life of
the synthetic membrane-receiver complex increases the half-life of
the receiver and/or the optional payload in circulation, thereby
potentially increasing the therapeutic window in which the receiver
and/or payload is active. In one instance, a population of
10.sup.11 synthetic membrane-receiver polypeptide complexes
comprises an adenosine deaminase receiver and an exogenous CD47
polypeptide on its surface. When administered to a subject with an
enzyme deficiency, such as ADA-SCID, the half-life of the synthetic
membrane-receiver polypeptide complex is extended beyond that of a
complex not comprising exogenous CD47 polypeptide and the subject
requires less frequent dosing. Half-life extension is a particular
advantage when compared to current enzyme therapies not involving
synthetic membrane-receiver polypeptide complexes.
[0494] In some embodiments, CD47 is altered by heparin and/or
chondroitin sulfate glycosaminoglycan (GAG) chains. In some
embodiments, the synthetic membrane-receiver complex expresses CD47
as a proteoglycan. In some embodiments, the synthetic
membrane-receiver complex comprises a CD47 proteoglycan that is
conjugated to the complex. In one embodiment, the CD47 proteoglycan
comprises heparin and/or chondroitin sulfate glycosaminoglycan
(GAG) chains. In one embodiment, that CD47 proteoglycan has a size
of greater than 150 kDa, 200 kDa, or greater than 250 kDa. In one
embodiment, CD47 comprises one or more GAG chains at Ser64.
[0495] In some embodiments, the residency of a synthetic
membrane-receiver complex, e.g., generated using erythroid cells or
platelets can be further modulated by changing the amount or number
of oxidized lipids on the membrane of the synthetic
membrane-receiver complex. In one embodiment, the synthetic
membrane-receiver complex comprises oxidized lipids in an amount
effective to reside in circulation for less than 10, 9, 8, 7, 6, 5,
4, 3, 2, or less than 1 day. In one embodiment, the synthetic
membrane-receiver complex comprises oxidized lipids in an amount
effective to reside in circulation for 15 days, 21 days, 30 days,
45 days, 60 days, 100 days, 120 days, or longer. In some
embodiments, the amount of oxidized lipids in the membrane are
altered such that mobility of CD47 is increased or decreased,
thereby aiding or hindering, respectively the ability of CD47 to
cluster on the membrane. (See, Olsson, Department of Integrative
Medical Biology, Section for Histology and Cell Biology, Umea
University, Umea, Sweden, 2008).
[0496] CD55, also known as complement decay-accelerating factor or
DAF, is a 70 kDa membrane protein. CD55 recognizes C4b and C3b
fragments of the complement system that are created during C4
(classical complement pathway and lectin pathway) and C3 (alternate
complement pathway) activation. It is thought that interaction of
CD55 with cell-associated C4b and C3b proteins interferes with
their ability to catalyze the conversion of C2 and factor B to
active C2a and Bb and thereby prevents the formation of C4b2a and
C3bBb, the amplification convertases of the complement cascade.
CD55 is thought to block the formation of membrane attack
complexes. CD55 may prevent lysis by the complement cascade. In
some embodiments, the synthetic membrane-receiver complex comprises
CD55 polypeptide or a functional polypeptide fragment thereof in an
amount or copy number sufficient to reside in circulation for 15
days, 21 days, 30 days, 45 days, 60 days, 100 days, 120 days, or
longer. In some embodiments, the synthetic membrane-receiver
complex comprises an exogenous CD55 polypeptide and an exogenous
CD47 polypeptide or functional polypeptide fragments thereof in an
amount, copy number and/or ratio sufficient to reside in
circulation for 15 days, 21 days, 30 days, 45 days, 60 days, 100
days, 120 days, or longer.
[0497] CD59 glycoprotein also known as MAC-inhibitory protein
(MAC-IP), membrane inhibitor of reactive lysis (MIRL), protectin,
or HRF is a protein that attaches to host cells via a
glycophosphatidylinositol (GPI) anchor. When complement activation
leads to deposition of C5b678 on host cells, CD59 can prevent C9
from polymerizing and forming the complement membrane attack
complex. CD59 may prevent lysis by the complement cascade. In some
embodiments, the synthetic membrane-receiver complex comprises CD59
polypeptide or a functional polypeptide fragment thereof in an
amount or copy number sufficient to reside in circulation for 15
days, 21 days, 30 days, 45 days, 60 days, 100 days, 120 days, or
longer. In some embodiments, the synthetic membrane-receiver
complex comprises an exogenous CD59 polypeptide and an exogenous
CD47 polypeptide or functional polypeptide fragments thereof in an
amount, copy number and/or ratio sufficient to reside in
circulation for 15 days, 21 days, 30 days, 45 days, 60 days, 100
days, 120 days, or longer.
[0498] In some embodiments, the synthetic membrane-receiver complex
comprises one or more of an exogenous CD55 polypeptide, an
exogenous CD59 polypeptide and/or an exogenous CD47 polypeptide or
functional polypeptide fragments thereof in an amount, copy number
and/or ratio sufficient to reside in circulation for 15 days, 21
days, 30 days, 45 days, 60 days, 100 days, 120 days, or longer.
[0499] Effective amounts of CD47, CD55, and CD59 include 10.sup.2,
10.sup.3, 10.sup.4, 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.9
polypeptides per synthetic membrane-receiver complex.
Alternatively, an effective amount is the amount capable of
extending the synthetic membrane-receiver polypeptide complex's
half-life by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%,
200%, 400%, 800%, 1,000%, or 10,000% relative to the half-life that
the synthetic membrane-receiver polypeptide complex would exhibit
without the polypeptides.
Receivers
[0500] Provided herein are receivers that are exhibited by
synthetic membrane-receiver complexes. In some embodiments, a
receiver is capable of interacting with a target, e.g., to
associate with or bind to a target. A receiver can comprise or may
consist essentially of a polypeptide. In some embodiments, the
receiver comprises a polypeptide, a carbohydrate, a nucleic acid, a
lipid, a small molecule, or a combination thereof. In some
embodiments receivers do not interact with a target but act as
payloads to be delivered by the synthetic membrane-receiver complex
to a cell, tissue or other site in the body of a subject.
[0501] In some embodiments, receivers comprise polypeptides.
Receiver polypeptides may range in size from 6 amino acids to 3000
amino acids and may exceed 6, 10, 15, 20, 25, 30, 35, 40, 50, 60,
70, 80, 90, 100, 150, 200, 300, 400 or may exceed 500 amino acids.
Reciver polypeptides may range in size from about 20 amino acids to
about 500 amino acids, from about 30 amino acids to about 500 amino
acids or from about 40 amino acids to about 500 amino acids.
[0502] In some embodiments, the receiver polypeptide comprises a
chimeric or fusion protein which may comprise two or more distinct
protein domains. These chimeric receivers are heterologous or
exogenous in the sense that the various domains are derived from
different sources, and as such, are not found together in nature
and can be encoded e.g., by exogenous nucleic acids. Receiver
polypeptides can be produced by a number of methods, many of which
are well known in the art and also described herein. For example,
receiver polypeptides can be obtained by extraction (e.g., from
isolated cells), by expression of an exogenous nucleic acid
encoding the receiver polypeptide, or by chemical synthesis.
Receiver polypeptides can be produced by, for example, recombinant
technology, and expression vectors encoding the polypeptide
introduced into host cells (e.g., by transformation or
transfection) for expression of the encoded receiver
polypeptide.
[0503] There are a variety of conservative changes that can
generally be made to an amino acid sequence without altering
activity. These changes are termed conservative substitutions or
mutations; that is, an amino acid belonging to a grouping of amino
acids having a particular size, charge or other characteristic can
be substituted for another amino acid. Substitutions for an amino
acid sequence may be selected from other members of the class to
which the amino acid belongs. For example, the nonpolar
(hydrophobic) amino acids include alanine, leucine, isoleucine,
valine, proline, phenylalanine, tryptophan, methionine, and
tyrosine. The polar neutral amino acids include glycine, serine,
threonine, cysteine, tyrosine, asparagine and glutamine. The
positively charged (basic) amino acids include arginine, lysine and
histidine. The negatively charged (acidic) amino acids include
aspartic acid and glutamic acid. Such alterations are not expected
to substantially affect apparent molecular weight as determined by
polyacrylamide gel electrophoresis or isoelectric point.
Conservative substitutions also include substituting optical
isomers of the sequences for other optical isomers, specifically D
amino acids for L amino acids for one or more residues of a
sequence. Moreover, all of the amino acids in a sequence may
undergo a D to L isomer substitution. Exemplary conservative
substitutions include, but are not limited to, Lys for Arg and vice
versa to maintain a positive charge; Glu for Asp and vice versa to
maintain a negative charge; Ser for Thr so that a free .about.OH is
maintained; and Gln for Asn to maintain a free NH.sub.2. Moreover,
point mutations, deletions, and insertions of the polypeptide
sequences or corresponding nucleic acid sequences may in some cases
be made without a loss of function of the polypeptide or nucleic
acid fragment. Substitutions may include, e.g., 1, 2, 3, or more
residues. Any teaching of a specific amino acid sequence or an
exogenous nucleic acid encoding the polypeptide or teaching of the
name of the name thereof includes any conservative substitution
point mutations, deletions, and insertions of those polypeptide
sequences or corresponding nucleic acid sequences and any sequence
depositied for the protein or gene in a database that can be made
without a loss of function of the polypeptide or nucleic acid
fragment.
[0504] In some embodiments, the receiver polypeptide is associated
with the membrane of the synthetic membrane-receiver polypeptide
complex. In other embodiments, the receiver polypeptide is not
associated with the membrane of the synthetic membrane-receiver
polypeptide complex.
[0505] In one embodiment the mass ratio of lipid to receiver in the
synthetic membrane-receiver polypeptide complex is less than
1:1000, approximately 1:1000, approximately 1:500, approximately
1:250, approximately 1:100, approximately 1:50, approximately 1:25,
approximately 1:10, approximately 1:9, approximately 1:8,
approximately 1:7, approximately 1:6, approximately 1:5,
approximately 1:4, approximately 1:3, approximately 1:2,
approximately 1:1, approximately 2:1, approximately 3:1,
approximately 4:1, approximately 5:1, approximately 6:1,
approximately 7:1, approximately 8:1, approximately 9:1,
approximately 10:1, approximately 25:1, approximately 50:1,
approximately 100:1, approximately 250:1, approximately 500:1,
approximately 1000:1, approximately 10,000:1, approximately
100,000:1, approximately 1,000,000:1, approximately 10,000,000:1,
approximately 100,000,000:1, approximately 1,000,000,000:1 or
greater than approximately 1,000,000,000:1.
[0506] In one embodiment the mass ratio of non-receiver polypeptide
to receiver in the synthetic membrane-receiver polypeptide complex
is less than 1:1000, approximately 1:1000, approximately 1:500,
approximately 1:250, approximately 1:100, approximately 1:50,
approximately 1:25, approximately 1:10, approximately 1:9,
approximately 1:8, approximately 1:7, approximately 1:6,
approximately 1:5, approximately 1:4, approximately 1:3,
approximately 1:2, approximately 1:1, approximately 2:1,
approximately 3:1, approximately 4:1, approximately 5:1,
approximately 6:1, approximately 7:1, approximately 8:1,
approximately 9:1, approximately 10:1, approximately 25:1,
approximately 50:1, approximately 100:1, approximately 250:1,
approximately 500:1, approximately 1000:1, approximately 10,000:1,
approximately 100,000:1, approximately 1,000,000:1, approximately
10,000,000:1, approximately 100,000,000:1, approximately
1,000,000,000:1 or greater than approximately 1,000,000,000:1.
[0507] In certain embodiments, the polypeptide receiver is located
on the surface and is exposed to the environment around the
synthetic membrane-receiver polypeptide complex. In some
embodiments, the polypeptide receiver is located inside and faces
the unexposed side of the synthetic membrane-receiver polypeptide
complex.
[0508] In certain embodiments, the polypeptide receiver comprises
at least one of the following domains, an S domain (surface), an A
domain (anchor), and/or a U domain (unexposed), wherein the S
domain is a surface domain exposed to the environment around the
synthetic membrane-receiver polypeptide complex, wherein the A
domain is an anchor, and wherein the U domain is located within
and/or faces the unexposed side of the synthetic membrane-receiver
polypeptide complex.
[0509] Optionally the receiver polypeptide comprises i) one or more
additional S domains, termed S' domains, or ii) one or more
additional U domains, termed U' domains.
[0510] In some embodiments, the S domain and the A domain form part
of the same polypeptide chain.
[0511] In some embodiments, the A domain and the U domain form part
of the same polypeptide chain.
[0512] In some embodiments, any one or more of the S, A, U domain
is added to the synthetic membrane-receiver polypeptide complex
externally.
[0513] In some embodiments, any one or more of the S, A, U domain
is produced within the synthetic membrane-receiver polypeptide
complex.
[0514] In some embodiments, any one or more of the S, A, U domain
is a polypeptide.
[0515] In some embodiments, any one or more of the S, A, U domain
is not a polypeptide.
[0516] Schematics of exemplary conformations of receivers within or
on synthetic membrane-receiver complexes are shown in FIGS. 14A,
14B, and 14C.
[0517] 1. The A domain
[0518] In certain embodiments, the A domain is a membrane
polypeptide. The A domain can be, e.g., an integral membrane
polypeptide or a membrane associated polypeptide.
[0519] The A domain may be selected from one of the following
classes, including but not limited to, for example, alpha-helical
bitopic, alpha-helical polytopic, beta-barrel transmembrane, all
alpha monotopic/peripheral, all beta monotopic/peripheral,
alpha/beta monotopic/peripheral, alpha+beta monotopic/peripheral,
alpha helical peptides, beta-hairpin peptides, beta-helical
peptides, type 1 transmembrane protein (N-terminus extracellular),
type 2 transmembrane protein (N-terminus intracellular), type 3
transmembrane protein, type 4A transmembrane protein, type 4B
transmembrane protein, lipid-anchored protein,
glycosylphosphatidylinositol (GPI) anchored protein, prenyl chain
anchored protein, or peptides of nonregular structure.
[0520] In certain embodiments, the A domain is endogenous, e.g.,
endogenous to an erythroid cell, a platelet, or a hematopoietic
cell. In some embodiments, the A domain is endogenous to a
mammalian cell.
[0521] In certain embodiments, the A domain is exogenous, e.g.,
exogenous to an erythroid cell, a platelet, or a hematopoietic
cell. In some embodiments, the A domain is exogenous to a mammalian
cell.
[0522] The A domain may be selected from the the following
molecules or fragments thereof, including but not limited to, CD1,
CD2, CD3, CD4, CD5, CD6, CD7, CD8, CD9, CD10, CD11a, CD11b, CD11c,
CD12w, CD13, CD14, CD15, CD16, CDw17, CD18, CD19, CD20, CD21, CD22,
CD23, CD24, CD25, CD26, CD27, CD28, CD29, CD30, CD31, CD32, CD33,
CD34, CD35, CD36, CD37, CD38, CD39, CD40, CD41, CD42, CD43, CD44,
CD45, CD46, CD47, CD48, CD49a, CD49b, CD49c, CD49d, CD49e, CD49f,
CD53, CD54, CD55, CD56, CD57, CD58, CD59, CD61, CD62E, CD62L,
CD62P, CD63, CD68, CD69, CD71, CD72, CD73, CD74, CD80, CD81, CD82,
CD83, CD86, CD87, CD88, CD89, CD90, CD91, CD95, CD96, CD100, CD103,
CD105, CD106, CD107, CD107a, CD107b, CD109, CD117, CD120, CD122,
CD123, CD127, CD132, CD133, CD134, CD135, CD138, CD141, CD142,
CD143, CD144, CD147, CD151, CD152, CD154, CD155, CD156, CD158,
CD163, CD165, CD166, CD168, CD184, CDw186, CD195, CD197, CDw199,
CD209, CD202a, CD220, CD221, CD235a, CD271, CD279, CD303, CD304,
CD309, CD326, Ras-Related protein 1A, semaporin 7A precursor,
Calcium and integrin-binding protein 1, 55 kDa erythrocyte membrane
protein, Flotillin-1, Flotillin-2, Erythroid membrane-associated
protein, eukaryotic translation initiation factor 2C 2, cytochrome
b5 reductase, cell division control protein 42 homolog, KIAA1363
protein, band3, annexin VII, aquaporin, Ecto-ADP-ribosyltransferase
4, Kell, LFA-3, soulute carrier family 2 member 1, LGALS3 protein,
Urea transporter, Rh blood CE group antigen poypeptide,
Rh-associated glycoprotein, Dematin, ABO blood groups, Aquaporin 3,
Aubergers, Band 3, Basigin, C41, CD44, Cis AB, Colton antigen,
Complement Component 4, CR1, DAF, Diego, Duffy, Hh/Bombay antigen,
ii antigen, Indian blood group, Kell, Kidd, Lewis antigen, Lutheran
antigen, MNS antigen system, Cost group, Er group, Dematin,
Stomatin, Tropomyosin, Glucose transporter, Adducin, Rabphilin, C1
tetrahydrofolate synthase, Vel group, Lan antigen, At antigen, Jr
antigen, AnWj antigen, Sd antigen, Batty, Bilkes, Box,
Christiansen, HJK, HOFM, JFV, JONEs, Jensen, Katagiri, Livesay,
Milne, Oldeide, Peters, Rasmussen, Reid, REIT, SARA, Rhesus blood D
group, Aldolase, Tropomodulin, Arginase, Creatine kinase, B-Cam
protein, Rap1A, Bennett-Goodspeed, P antigen system, Rh blood
groupXg antigen system, XK protein, Yt/Cartwright antigen system,
CD58, Rh, Scianna, Radin, DARC (Duffy), CR1 Knops-McCoy, DAF
Cromer, Gerbich (GYPC), CD47, Glycophorin A, Band 3 (AE3), GYPB Ss,
C4A, C4B Chido, Rodgers C4 component of complement, HLA Bg HLA
class I, RHAG Rh-associated Ammonium transport, Glycoprotein,
Colton (Co) Water channel protein, ACHE Cartwright (Yt)
Acetylcholinesterase, Glutathione transferase, Glycophorin C,
Aquaporin, Erythroblast associated membrane protein, CD44,
Synaptobrevin 2, Ribonuclease, Duodenal cytochrome B, ABO glycosyl
transferases, CD59, CD44 Indian (In), AnWj Adhesion receptor, MER2,
DOK Dombrock ADP-ribosyltransferase, SEMA7A JMH Putative adhesion
receptor, UMOD Sda Tamm-Horsfall protein (uromodulin), Diego (Di),
Wright (Wr) Anion channel protein (band 3, AE1), Kidd (Jk) Urea
transporter, FUT3 Lewis (Le) alpha(1,3) fucosyltransferase, OK Oka
Neurothelin, putative adhesion molecule, LW Adhesion receptor, FUT2
Secretor (Se) alpha(1,2) fucosyltransferase, FUT1 Hh alpha(1,2)
fucosyltransferase, LU Lutheran (Lu) Adhesion receptor, P1
Glycosyltransferase, XK Kx Putative neurotransmitter transporter,
XG Xg formerly called PBDX, MIC2, Hemoglobin, Ankyrin, Spectrin,
KEL Kell (forms K, k, Kp, Js) Metalloproteinase, Torkildsen
antigen, coenzyme Q10, Rab 35, Ral A binding protein, Zona
pellucida binding protein, Lyn B protein, KIaa1741 protein, DC38,
Calcium transporting ATPase, GPIX, GPIba, GPIbb, GPV, GPIb-IX-V,
GPVI, GPIa/IIa, GPIIb/IIIa, GPV/IIa.
[0523] 2. The S Domain
[0524] In some embodiments, the S domain is a protein or a
polypeptide. In other embodiments, the S domain is a nucleic acid.
In some embodiments, the S domain is a chemical. In certain
embodiment the S domain is a small molecule.
[0525] In some embodiments, the S domain is a polypeptide selected
from or derived from one or more of the following classes,
including but not limited to, a flexible linker, an epitope tag, an
enzyme, a protease, a nuclease, a receiver, an antibody-like
molecule, a ligand of an antibody, a growth factor, a cytokine, a
chemokine, a growth factor receptor, a cytokine receptor, a
chemokine receptor, an enzymatic recognition sequence, a
transpeptidase recognition sequence, a protease recognition
sequence, a cleavable domain, an intein, a DNA binding protein, and
RNA binding protein, a complement regulatory molecule, a complement
cascade molecule, a clotting cascade molecule, a chelator, a
complement regulatory domain, an SCR domain, a CCP domain, an
immunoglobulin or immunogloblulin-like domain, an armadillo repeat,
a leucine zipper, a dealth effector domain, a cadherein repeat, an
EF hand, a phosphotyrosine binding domain, a pleckstrin homology
domain, an SCR homology 2 domain, a zinc finger domain, a cyclic
peptide, a cell-penetrating peptide.
[0526] In some embodiments, the S domain is a non-polypeptide
molecule, for example a nucleic acid, a carbohydrate, or a small
molecule. In some embodiments, the S domain is a nucleic acid
selected from one or more of the following classes, including but
not limited to, a DNA aptamer, an RNA aptamer, an siRNA, a shRNA, a
single-strand RNA probe, a single strand DNA probe, an mRNA, a
chemically modified oligonucleotide. In some embodiments, the S
domain is a small molecule selected from one or more of the
following classes, including but not limited to, a chelator, DOTA,
a radionuclide, an isotope, an imaging agent, a fluorescent
molecule, a chemiluminescent molecule, a gas.
[0527] 3. The U Domain
[0528] In some embodiments, the U domain is a protein or a
polypeptide. In other embodiments, the U domain is a nucleic acid.
In some embodiments, the U domain is a chemical. In certain
embodiment the U domain is a small molecule.
[0529] In some embodiments, the U domain is a polypeptide selected
from or derived from one or more of the following classes,
including but not limited to, a flexible linker, an epitope tag, an
enzyme, a protease, a nuclease, a receiver, an antibody-like
molecule, a ligand of an antibody, a growth factor, a cytokine, a
chemokine, a growth factor receptor, a cytokine receptor, a
chemokine receptor, an enzymatic recognition sequence, a
transpeptidase recognition sequence, a protease recognition
sequence, a cleavable domain, an intein, a DNA binding protein, and
RNA binding protein, a complement regulatory molecule, a complement
cascade molecule, a clotting cascade molecule, a chelator, a
complement regulatory domain, an SCR domain, a CCP domain, an
immunoglobulin or immunogloblulin-like domain, an armadillo repeat,
a leucine zipper, a dealth effector domain, a cadherein repeat, an
EF hand, a phosphotyrosine binding domain, a pleckstrin homology
domain, an SCR homology 2 domain, a zinc finger domain, a cyclic
peptide, a cell-penetrating peptide, a kinase domain, aphosphatase
domain, a cytoskeletal protein, a protein that interacts with the
cytoskeletal protein, a G-protein coupled receptor, a tyrosine
kinase, an ITIM domain, an ITAM domain.
[0530] In some embodiments, the U domain is a non-polypeptide
molecule, for example a nucleic acid, a carbohydrate, or a small
molecule. In some embodiments, the U domain is a nucleic acid
selected from one or more of the following classes, including but
not limited to, a DNA aptamer, an RNA aptamer, an siRNA, a shRNA, a
single-strand RNA probe, a single strand DNA probe, an mRNA, a
chemically modified oligonucleotide. In some embodiments, the U
domain is a small molecule selected from one or more of the
following classes, including but not limited to, a chelator, DOTA,
a radionuclide, an isotope, an imaging agent, a fluorescent
molecule, a chemiluminescent molecule, a gas.
[0531] Examples of Receiver Polypeptides
[0532] Examples of receiver polypeptides include: the polypeptide
receiver comprises glycophorin A with HA epitope tag at the N
terminus; the polypeptide receiver comprises the leader sequence of
glycophorin A, HA epitope tag, and the body sequence of glycophorin
A; the polypeptide receiver comprises complement receptor 1 (CR1);
the polypeptide receiver comprises the leader sequence of CR1, HA
epitope tag, the body sequence of CR1; the polypeptide receiver
comprises the leader sequence of CR1, HA epitope tag, six SCR
domains of LHR-A and LHR-B of CR1, the membrane proximal two SCR
domains of CR1, the transmembrane region of CR1, and the
intracellular region of CR1; the polypeptide receiver comprises the
leader sequence of CR1, HA epitope tag, nine SCR domains of LHR-A
and LHR-B and LHR-C of CR1, the membrane proximal two SCR domains
of CR1, the transmembrane region of CR1, and the intracellular
region of CR1; the polypeptide receiver comprises the leader
sequence of CR1, LHR-A of CR1, LHR-B of CR1, LHR-C of CR1, the
membrane proximal two SCR domains of CR1, the transmembrane region
of CR1, and the intracellular region of CR1; the polypeptide
receiver comprises leader sequence of CR1, LHR-A of CR1, LHR-B of
CR1, LHR-C of CR1, the membrane proximal two SCR domains of CR1,
the transmembrane region and intracellular region of glycophorin A;
the polypeptide receiver comprises the leader sequence of
glycophorin A, an antibody scFv against hepatitis B surface antigen
(scFv), a (Gly3Ser)2 (SEQ ID NO: 23) flexible linker, HA epitope
tag, and the body of glycophorin A; the polypeptide receiver
comprises Kell, a (Gly3Ser)2 (SEQ ID NO: 23) flexible linker, HA
epitope tag, and scFv; the polypeptide receiver comprises Kell and
HA epitope tag; the polypeptide receiver comprises a 71-amino acid
N-terminal fragment of Kell and an HA epitope tag; the polypeptide
receiver comprises a 71-amino acid N-terminal fragment of Kell, a
(Gly3Ser)2 (SEQ ID NO: 23) flexible linker, and an HA epitope tag;
the polypeptide receiver comprises a 79-amino acid N-terminal
fragment of Kell and an HA epitope tag; the polypeptide receiver
comprises a 79-amino acid N-terminal fragment of Kell, a (Gly3Ser)2
(SEQ ID NO: 23) flexible linker, and an HA epitope tag; the
polypeptide receiver comprises a 71-amino acid N-terminal fragment
of Kell, a (Gly3Ser)2 (SEQ ID NO: 23) flexible linker, scFv, and an
HA epitope tag; the polypeptide receiver comprises a 79-amino acid
N-terminal fragment of Kell, a (Gly3Ser)2 (SEQ ID NO: 23) flexible
linker, scFv, and an HA epitope tag; the polypeptide receiver
comprises the leader sequence of CD55, scFv, an HA epitope tag, and
the terminal 37 amino acids of CD55; the polypeptide receiver
comprises the leader sequence of CD55, an HA epitope tag, and the
body of CD55. In one embodiment, the polypeptide receiver comprises
the leader sequence of CD59, scFv, an HA epitope tag, and the body
of CD59; the polypeptide receiver comprises the leader sequence of
CD59, and HA epitope tag, and the body of CD59; the polypeptide
receiver comprises adenosine deaminase and an HA epitope tag; the
polypeptide receiver comprises phenylalanine hydroxylase and an HA
epitope tag; the polypeptide receiver comprises adenosine
deaminase, a (Gly3Ser)2 (SEQ ID NO: 23) flexible linker,
phenylalanine hydroxylase, and an HA epitope tag; the polypeptide
receiver comprises glycophorin A, adenosine deaminase at the
cytoplasmic C terminus, and an HA epitope tag; the polypeptide
receiver comprises glycophorin A, phenylalanine hydroxylase at the
cytoplasmic C terminus, and an HA epitope tag.
[0533] In certain embodiments, the receiver is capable or
interacting with a macrophage. The receiver polypeptide may
comprise one or more of: the complement receptor (Rieu et al., J.
Cell Biol. 127:2081-2091 (1994)), the scavenger receptor (Brasseur
et al., Photochem. Photobiol. 69:345-352 (1999)), the transferrin
receptor (Dreier et al., Bioconjug. Chem. 9:482-489 (1998); Hamblin
et al., J. Photochem. Photobiol. 26:4556 (1994)); the Fc receptor
(Rojanasakul et al., Pharm. Res. 11:1731-1733 (1994)); and the
mannose receptor (Frankel et al., Carbohydr. Res. 300:251-258
(1997); Chakrabarty et al., J. Protozool. 37:358-364 (1990)).
[0534] Other receivers capable or interacting with a macrophages
include: low density lipoproteins (Mankertz et al., Biochem.
Biophys. Res. Commun. 240:112-115 (1997); von Baeyer et al., Int.
J. Clin. Pharmacol. Ther. Toxicol. 31:382-386 (1993)), very low
density lipoproteins (Tabas et al., J. Cell Biol. 115:1547-1560
(1991)), mannose residues and other carbohydrate moieties (Pittet
et al., Nucl. Med. Biol. 22:355-365 (1995)), poly-cationic
molecules, such as poly-L-lysine (Hamblin et al., J. Photochem.
Photobiol. 26:45-56 (1994)), liposomes (Bakker-Woudenberg et al.,
J. Drug Target. 2:363-371 (1994); Betageri et al., J. Pharm.
Pharmacol. 45:48-53 (1993)) and 2-macroglobulin (Chu et al., J.
Immunol. 152:1538-1545 (1994)).
[0535] In some embodiments, the synthetic membrane-receiver complex
does not comprise a receiver comprising an extracellular domain of
an HIV coreceptor. In some embodiments, the synthetic
membrane-receiver complex does not comprise a receiver capable of
binding to a virus. In some embodiments, the synthetic
membrane-receiver complex does not comprise a receiver comprising
CD4. In some embodiments, the synthetic membrane-receiver complex
does not comprise a receiver comprising an HIV coreceptor. In some
embodiments, the synthetic membrane-receiver complex does not
comprise a receiver comprising CXCR4, CCR5, CCR1, CCR2, CCR3, CCR4,
CCR8, CXCR1, CXCR2, CXCR3, CXCR6, GPR15, APJ, CMKLR1, or CX3CR1 or
a combination thereof.
[0536] In some embodiments, the synthetic membrane-receiver complex
does not contain an exogenous nucleic acid encoding an adenosine
deaminase receiver. In some embodiments, the synthetic
membrane-receiver complex does not comprise a receiver comprising
adenosine deaminase (ADA).
[0537] In some embodiments, the synthetic membrane-receiver complex
does not comprise an exogenous nucleic acid encoding an oncogene.
In some embodiments, the synthetic membrane-receiver complex does
not comprise a receiver comprising oncogene.
[0538] In some embodiments, the synthetic membrane-receiver complex
does not contain an exogenous nucleic acid encoding cdx1, cdx2, or
cdx4. In some embodiments, the synthetic membrane-receiver complex
does not comprise a receiver comprising cdx1, cdx2, or cdx4, or a
combination thereof.
[0539] In some embodiments, the synthetic membrane-receiver complex
does not comprise a receiver comprising a chimeric polypeptide
comprising a ligand binding domain. In some embodiments, the
synthetic membrane-receiver complex does not comprise a receiver
comprising an S domain that is capable of binding a ligand. In some
embodiments, the synthetic membrane-receiver complex does not
comprise a receiver comprising CD3.zeta.; CD3.eta., an IL-2
receptor, an IL-3 receptor, an IL-4 receptor, an IL-7 receptor, an
IL-11 receptor, an IL-13 receptor, a GM-CSF receptor, a LIF
receptor, a CNTF receptor, an oncostatin M receptor, a TGF-.beta.
receptor, an EGF receptor, ATR2/neu, a HER2/neu, a HER3/c-erbB-3,
Xmrk, an insulin receptor, an IGF-1 receptor, IRR, PDGF receptor, a
CSF-1 receptor, c-kit, STK-1/flk-2, an FGF receptor, flg, bek, an
NGF receptor, Rorl and Ror2.
[0540] In some embodiments, the synthetic membrane-receiver complex
does not comprise a receiver comprising E6 or E7 genes of human
papillomavirus.
[0541] In some embodiments, the synthetic membrane-receiver complex
does not comprise a receiver comprising a tumor antigen.
[0542] In some embodiments, the synthetic membrane-receiver complex
does not comprise a receiver comprising glucocerebrosidase.
[0543] In some embodiments, the synthetic membrane-receiver complex
does not comprise a receiver comprising asparaginase.
[0544] In some embodiments, the synthetic membrane-receiver complex
does not comprise a receiver comprising arginine deiminase.
[0545] Provided herein are compositions containing functional
erythroid cells comprising a receiver having functional activities
that are either i) not present in native erythroid cells of the
same lineage, or ii) present in native erythroid cells of the same
lineage in reduced levels or reduced activity levels as compared to
the erythroid cells comprising the receiver. Such functional
activities include complement inhibition, immune complex clearance,
artificial antigen presentation, modulation of the coagulation
cascade, oxygen transfer, drug delivery, cytotoxin adsorption,
avoidance of phagocytosis, and extension of circulation time.
[0546] In some embodiments, functional erythroid cells have higher
levels of a complement receptor polypeptide, such as CR1, than
native erythroid cells of the same lineage by virtue of comprising
a CR-1 receiver. In an alternative embodiment, the functional
erythroid cells comprising a receiver have higher levels of a
complement receptor agonist polypeptide or complement associated
polypeptide than native erythroid cells of the same lineage,
including but not limited to, the polypeptides listed in table 7
and table 10. The complement receptor receiver polypeptide
comprises a human Complement Receptor-1 (CR1) polypeptide, variant,
or functional fragment thereof. The CR1 receiver polypeptide may be
derived from one or more than one of the native alleles of CR1,
e.g., the A allele (also termed the F allele or CR1*1 allele), the
B allele (also termed the S allele or CR1*2 allele), the C allele
(also termed the F' allele or CR1*3 allele), or the D allele (also
termed the CR1*4 allele). The sequences and database accession
numbers for these native forms are provided in table 4. In some
embodiments, the CR1 receiver polypeptide contains a domain of a
CR1 polypeptide. For example, the CR1 polypeptide may comprise one
or more short consensus repeat (SCR) domains, also termed
complement control protein (CCP) modules or Sushi domains, e.g.,
Genbank accession number AAV65577.1. In one embodiment, the CR1
receiver polypeptide comprises one or more Short Consensus Repeats
(SCRs), e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or greater than 44
SCRs. In another embodiment, the CR1 receiver polypeptide comprises
one or more long homologous repeat (LHR) units of CR1, e.g., LHR-A,
LHR-B, LHR-C, or LHR-D, e.g., 1, 2, 3, 4, 5, 6 or greater than 6
LHR domains. In another embodiment, the CR1 receiver polypeptide
may comprise one or more than one extracellular domains of CR1
fused to another cell membrane protein, e.g., glycophorin A,
glycophorin B, glycophorin C, glycophorin D, kell, band 3,
aquaporin 1, glut 1, kidd antigen protein, rhesus antigen,
including, but not limited to the cell surface moieties listed in
table 1 and table 7.
[0547] In some embodiments, a functional erythroid cell contains an
exogenous nucleic acid encoding a complement receptor receiver
polypeptide, or alternatively or in combination, a complement
receptor agonist receiver polypeptide or complement associated
receiver polypeptide including but not limited to, the
polypeptides, and agonists to the polypeptides, listed in table 10.
In some embodiments, the functional erythroid cells further contain
an exogenous decay-accelerating factor (CD59, GenBank: CAG46523.1)
polypeptide, or an exogenous membrane cofactor (CD46, GenBank:
BAA12224.1) polypeptide, or a variant or functional fragment
thereof, or a combination thereof.
[0548] CR1 activities include binding to C3b-containing immune
complexes and shuttling of these immune complexes from circulation
to liver and spleen macrophages of the reticuloendothelial system.
Upon encounter with cells of the reticuloendothelial system, the
immune complex is endocytosed by the phyagocytic cell but the red
blood cell is spared to continue its circulation. The removal of
the immune complex sometimes results in proteolytic cleavage of CR1
from the surface of the red blood cell. To measure binding
activity, one can perform an in vitro binding assay between
erythroid cells and immune complexes. To measure sparing of the
erythroid cell, one can perform an in vitro phagocytosis assay with
phagocytic cells and immune complex-loaded erythroid cells. To
measure in vivo clearance of circulating immune complexes to the
liver, one can perform a clearance and biodistribution assay using
radiolabeled immune complexes.
[0549] Provided are compositions containing functional erythroid
cells containing a receiver comprising a native polypeptide at a
level greater than that of a hematopoietic cell of the same lineage
not comprising the receiver polypeptide. For example, populations
of functional erythroid cells contain receivers, such as complement
receptor 1 levels at least about 1.1, e.g., 1.2, 1.3, 1.4, 1.5,
1.6, 1.7, 1.8, 1.9, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35,
40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450,
500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000,
8000, 9000, 10000, or more than 10000 times greater than
corresponding hematopoietic cells of the same lineage that lack the
CR1 receiver polypeptide. CR1 levels on reticulocytes and
erythrocytes are typically between 50-2000 molecules per cell
(Lach-Trifilieff, J Immunol 1999, 162:7549). Provided are
compositions that contain populations of functional erythroid cells
with CR1 levels of at least about 2500, 5000, 6000, 7000, 8000,
9000, 10000, 15000, 20000, 25000, 30000, 40000, 50000, 100000,
200000, 300000, 400000, 500000, 600000, 700000, 800000, 900000,
1000000, or more than 1000000 molecules per cell. CR1 levels in
wild-type and synthetic membrane-receiver polypeptide complexes can
be measured and quantified by, for example, flow cytometry with
antibodies specific for CR1.
[0550] In some embodiments, the receiver interacts with a
circulating pathogen, such as a virus or a bacterium. In some
embodiments, the functional erythroid cell expresses an exogenous
gene encoding an antibody, scFv, or nanobody specific for the
circulating pathogen. The antibody, scFv, or nanobody may be
expressed as a fusion protein. In other embodiments, the antibody,
scFv, or nanobody receiver or another receiver with affinity to
circulating pathogens is loaded into or onto the erythroid cell.
The antibody, scFv, or nanobody receiver or the other receiver with
affinity to circulating pathogens may be localized intracellularly
or extracellularly. In some embodiments, the receiver is specific
for a viral or bacterial antigen, such as a surface, envelope or
capsid antigen.
[0551] In some embodiments, the receiver interacts with a toxin,
preferably a foreign toxin, such as derived from a pathogen or
otherwise from the environment. In some embodiments, the functional
erythroid cell expresses a exogenous gene encoding a receiver
comprising an amino acid sequence derived from
lipopolysaccharide-binding protein (LBP),
bactericidal/permeability-increasing protein (BPI), amyloid P
component, or a cationic protein. Toxin-binding receivers may be
expressed as a fusion protein. In other embodiments, toxin-binding
receivers may be loaded into or onto the erythroid cell.
Toxin-binding receivers may be localized intracellularly or
extracellularly. In some embodiments, the toxin binding receiver is
specific for a bacterial toxin such as botulinum or anthrax.
[0552] Further, synthetic membrane-receiver complexes may express a
receiver capable of enhancing its ability to sequester a target.
Potential sequestration enhancement receivers include the
polypeptide transporters including, but not limited to, those in
table 1.
[0553] In one embodiment, the receiver comprises a polypeptide that
comprises an amino acid sequence derived from Duffy Antigen
Receptor for Chemokines (DARC). In one embodiment, the functional
erythroid cell expresses a exogenous gene encoding an amino acid
sequence derived from Duffy Antigen Receptor for Chemokines (DARC).
The DARC receiver may be expressed as a full-length protein or a
fragment thereof. DARC may be expressed as a fusion protein. In
other embodiments, DARC protein is loaded into or onto the
erythroid cell. In some embodiments, the loaded DARC is
additionally functionalized or otherwise modified. The DARC
receiver molecule may be localized intracellularly or
extracellularly.
[0554] DARC was identified as a potent multi-ligand chemokine
receptor. DARC belongs to the family of rhodopsin-like seven-helix
transmembrane proteins. Besides erythrocytes DARC is expressed in
post capillary venular endothelial cells, which are the primary
site of leukocyte transmigration in most tissues. DARC provides a
highly specific binding site for both CC and CXC chemokines. DARC
is thought to possess a higher affinity for ELR motif CXC
chemokines. CXC chemokines are neutrophil chemoattractants and may
potentially be pro-angiogenic.
[0555] Interaction between DARC and CXCL8 has demonstrated a
dissociation constant (Kd) of 5 nmol/L and receptor binding sites
estimated at 1000-9000 per erythrocyte (Hadley, Blood, 1997) Unlike
other seven-transmembrane chemokine receptors, DARC lacks the
highly conserved G protein coupling motif located in the second
cytoplasmic loop (Meny, Immunohematology, 2010). DARC is not
G-protein coupled and has no known alternative signaling mechanism.
The biological role of DARC is not fully understood. DARC is
thought to be a) multi-specific; b) unable to initiate
intracellular signals, and c) chemokines bound to erythrocyte
surface are believed to be inaccessible to their normal target
inflammatory cells (Neote, J Biol Chem, 1993). Erythrocytes may
play a role in the regulation of inflammatory processes through the
presence of DARC
[0556] Inflammatory signaling molecules, such as cytokines, can
trigger local and systemic tissue damage when present in high
concentrations. Bursts of cytokines are implicated in the
pathogenesis of bacterial sepsis, rheumatoid arthritis, and several
other inflammatory diseases. Functional erythroid cells that
exogenously express natural cytokine receptors or synthetic
antibody-like receptor mimics can sequester the inflammatory
cytokines. An exemplary chemokine receptor is DARC. Provided herein
are functional erythroid cells comprising a receiver that is a
cytokine receptor or chemokine receptor, including, but not limited
to DARC. For example, functional erythroid cells expressing DARC
receiver (thereby increasing the amount present on native
erythrocytes) may be used to modulate chemokine levels in
circulation and/or within the body's peripheral tissues. The
functional erythroid cells comprising a DARC receiver can either be
marked for destruction or can slowly release the inflammatory
mediators back into circulation, but at a low and diffuse
concentration. The functional erythroid cell comprising a receiver
that comprises a chemokine or cytokine receptor may act as a
reservoir for signal transduction peptides.
[0557] In one embodiment, the receiver comprises a polypeptide that
comprises an amino acid sequence derived from an antibody. In one
embodiment, the functional erythroid cell expresses a exogenous
gene encoding an amino acid sequence derived from an antibody. The
antibody receiver may be expressed as a full-length protein or a
fragment thereof. The antibody may be expressed as a fusion
protein. In other embodiments, the antibody protein is loaded into
or onto the erythroid cell. In some embodiments, the loaded
antibody is additionally functionalized or otherwise modified. The
antibody receiver may be localized intracellularly or
extracellularly. In one embodiment, the receiver comprises an
antibody amino acid sequence that is specific for a desired target.
In some embodiments, the antibody is a scFv. In other embodiments,
the antibody is a nanobody.
[0558] In certain embodiments, the functional erythroid cells
comprise a receiver that comprises an antibody or fragment thereof
that is specific for a target and is located on the cell surface.
For example, a variable fragment (Fv) of an antibody specific for
botulinum toxin binding is expressed on the surface of the
erythroid cell. Botulinum toxin binding antibodies are known in the
art (Amersdorfer, Inf and Immunity, 1997), as is the expression of
the Fv portion of an antibody (Hoedemaeker, Journ of Bio Chemistry,
1997). Upon binding, the toxin is retained by the erythroid cell
through the Fv region, sequestered and shuttled via the circulatory
system to the liver for clearance from the body.
[0559] In one embodiment, the receiver comprises a polypeptide that
comprises an amino acid sequence derived from a scFv antibody. In
one embodiment, the functional erythroid cell expresses a exogenous
gene encoding an amino acid sequence derived from a scFv antibody.
The scFv antibody receiver may be expressed as a full-length
protein or a fragment thereof. The scFv antibody may be expressed
as a fusion protein. In other embodiments, the scFv protein is
loaded into or onto the erythroid cell. Suitable scFv receiver
polypeptides that may be expressed by functional erythroid cells
include, but are not limited to, those listed in table 7.
[0560] scFv antibodies have been constructed mainly from hybridoma,
spleen cells from immunized mice, and B lymphocytes from human. The
variable region of an antibody is formed by the noncovalent
heterodimer of the variable domains of the V(H) and V(L) domains,
which can then be used in the construction of a recombinant scFv
antibody.
[0561] The production of scFvs is known in the art and require mRNA
to first be isolated from hybridoma (or also from the spleen, lymph
cells, and bone morrow) followed by reverse transcription into cDNA
to serve as a template for antibody gene amplification (PCR). With
this method, large libraries with a diverse set of antibody-derived
scFvs (a set comparable to that of the original antibodies from
which the scFvs are modeled) can be created.
[0562] The scFv receiver may be made specific to any target
molecule including, but not limited to, those in table 5.
[0563] In one example, a scFv receiver specific for anthrax toxin
may be expressed on a functional erythroid cell. Upon
administration to a subject in need thereof an effective dose of a
population of erythroid cell comprising a receiver molecule
specific for anthrax toxin can be used to capture and sequester the
anthrax toxin. The erythroid cell migrates to the liver where
clearance occurs.
[0564] In certain embodiments, erythrocytes comprise a receiver
comprising a camelid-derived nanobody expressed on the surface of
the cell. Nanobodies are usually 12-15 kDa. They are considerably
smaller than antibodies and scFv. Nanobodies may thus be easier to
transfect, and the nanobody receiver will be more easily expressed,
translated and or transported to the cell surface in an erythroid
cell. In certain embodiments, nanobody receivers are employed to
minimize immunogenic effects caused by a specific receiver.
Nanobodies because of their small size will offer reduced
immunogenic potential. In certain embodiments, receiver nanobodies
are employed because they limit changes in the mechanical and
morphological behavior of the plasma membrane of the functional
erythroid cell. This may allow the functional erythroid cell to
exhibit normal circulatory red blood cell behavior. In certain
embodiments, receiver nanobodies are employed because they have an
increased ability to recognize hidden or uncommon epitopes compared
to standard antibodies. For example, they can bind to small
enzymatic cavities of a target and modulate the molecular behavior
of the target.
[0565] In certain embodiments, functional erythroid cells comprise
receiver nanobodies with specificity to target epitopes of
molecules in the human complement system. Such functional erythroid
cells may be administered to a subject in need thereof to
selectively deplete one or more over-active factors of the
complement system. For example, C5 may be targeted by erythroid
cells comprising receiver nanobodies with specificity to target
epitopes of C5 and cleared from the system by the erythroid cells
upon administration of the cells into a subject. This approach is
suitable to provide a therapeutic effect, e.g., for a complement
disorder, such as paroxysmal nocturnal hemoglobinuria. In certain
embodiments, functional erythroid cells comprise receiver
nanobodies with specificity to target epitopes of molecules
including, but not limited to, those listed in table 5.
[0566] In some embodiments, the receiver comprises a polypeptide
that comprises an amino acid sequence derived from one of
proteases, nucleases, amylase, lyase (sucrase) or hydrolase (DNase,
lipase). In one embodiment, the functional erythroid cell expresses
a exogenous gene encoding an amino acid sequence derived from one
of proteases, nucleases, amylase, lyase (sucrase) or hydrolase
(DNase, lipase). Receiver proteases, nucleases, amylases, lyases
and hydrolases may be expressed as a full-length protein or a
fragment thereof. Receiver proteases, nucleases, amylases, lyases
and hydrolases may be expressed as a fusion protein. In other
embodiments, receiver proteases, nucleases, amylases, lyases or
hydrolases are loaded into or onto the erythroid cell. In some
embodiments, the loaded receiver proteases, nucleases, amylases,
lyases or hydrolases are additionally functionalized or otherwise
modified. The receiver protease, nuclease, amylase, lyase or
hydrolase receiver molecule may be localized intracellularly or
extracellularly.
[0567] In certain embodiments, functional erythroid cells comprise
a receiver comprising a protease, a nuclease, an amylase, a lyase
or a hydrolase. The functional erythroid cell comprising a
protease, a nuclease, an amylase, a lyase or a hydrolase receiver
is capable of degrading a target on the erythroid cell independent
of circulatory clearance, e.g., by macrophages in the liver. In
certain embodiments, functional erythroid cells comprising a
receiver comprising a protease, a nuclease, an amylase, a lyase or
a hydrolase may be administered to a subject in need thereof to
treat a cancer by selectively degrading metabolites that are
essential for cancer cell growth. For example, asparaginase is used
to decrease local asparagine levels to treat acute lymphoblastic
leukemia and acute myeloid leukemia. Suitable receivers may, e.g.,
comprise one or both of the two major classes of enzymes capable of
degrading target molecules, lyases and hydrolases. In certain
embodiments, functional erythroid cells are provided comprising a
receiver comprising a molecule including but not limited to those
listed in table 7.
[0568] In certain embodiments, erythrocytes comprise a receiver
comprising a lyase. In one embodiment, the lyase is valine
decarboxylase. Valine decarboxylase receiver may be expressed
within the intracellular space of the erythroid cell. Functional
erythroid cells comprising a valine decarboxylase receiver may be
administered to a subject in need thereof to modulate valine levels
within the blood. Erythroid cells comprising a valine decarboxylase
receiver are suitable to treat valinemia, an inherited disorder
that increases levels of the amino acid valine in the blood.
Affected individuals typically develop vomiting, failure to thrive,
intellectual disability, and fatigue. Valinemia is caused by a
deficiency of the valine transaminase enzyme and has an autosomal
recessive pattern of inheritance.
[0569] In certain embodiments, erythrocytes comprise a receiver
comprising a hydrolase. In one embodiment, the hydrolase is
deoxyribonuclease I (DNase I). DNase I receiver may be expressed on
the surface of the erythroid cell. Functional erythroid cells
comprising a DNase I receiver may be administered to a subject in
need thereof to preferentially cleave circulating DNA at
phosphodiester linkages adjacent to a pyrimidine nucleotide,
yielding 5'-phosphate-terminated polynucleotides with a free
hydroxyl group on position 3'. On average tetra-nucleotides are
produced. Erythroid cells comprising a DNase I receiver are
suitable to treat conditions exacerbated by high levels of
immunogenic DNA in circulation, such as systemic lupus
erythematosus (SLE).
[0570] In certain embodiments the receiver is capable of responding
to an external stimulus, e.g., upon binding to a ligand or
contacting the stimulus, wherein responding entails, for example,
moving, re-folding, changing conformation, forming a dimer, forming
a homodimer, forming a heterodimer, forming a multimer, transducing
a signal, emitting energy in a detectable form (e.g.,
fluorescence), functionally interacting with another receiver, or
functionally interacting with a non-receiver polypeptide.
[0571] In some embodiments, the synthetic membrane-receiver complex
does not comprise a fusion molecule capable of promoting fusion of
the synthetic membrane-receiver complex to a target cell that is i)
different from and/or ii) acts independent of the receiver, wherein
the receiver is capable of interacting with a target. In some
embodiments, the synthetic membrane-receiver complex does not
comprise a receiver comprising Syncytin-1.
[0572] In some embodiments, the synthetic membrane-receiver complex
does not comprise a photosensitive synthetic compound, such as,
e.g. a compound that can be activated by photons or quenchable
compounds. In some embodiments, the synthetic membrane-receiver
complex does not comprise an activatable molecular detection agent
capable of producing a detectable response. In some embodiments,
the synthetic membrane-receiver complex does not comprise a
diagnostic compound. In some embodiments, the synthetic
membrane-receiver complex does not comprise a virus or
bacterium.
[0573] Receiver Contacting
[0574] In certain embodiments, the polypeptide receiver is
expressed within the synthetic membrane-receiver polypeptide
complex. The polypeptide receiver may be exhibited on the surface
of the synthetic membrane-receiver polypeptide complex or may
reside within the synthetic membrane-receiver polypeptide
complex.
[0575] In certain embodiments, the polypeptide receiver is
conjugated to the synthetic membrane-receiver polypeptide complex.
The polypeptide receiver usually is conjugated to the surface of
the synthetic membrane-receiver polypeptide complex. Conjugation
may be achieved chemically or enzymatically, by methods known in
the art and described herein. Non-polypeptide receivers may also be
conjugated to a synthetic membrane-receiver complex. In some
embodiments, the receiver is not conjugated to the synthetic
membrane-receiver complex.
[0576] In certain embodiments, the polypeptide receiver is loaded
into the synthetic membrane-receiver polypeptide complex.
Non-polypeptide receivers may also be loaded within a synthetic
membrane-receiver complex. In some embodiments, the receiver is not
loaded into or onto the synthetic membrane-receiver complex.
[0577] In some embodiments, the synthetic membrane-receiver complex
comprises a receiver that is optionally expressed from an exogenous
nucleic acid, conjugated to the complex, loaded into or onto the
complex, and any combination thereof. Optionally, the synthetic
membrane-receiver complex comprises a therapeutic agent or other
payload.
[0578] In some embodiments, the synthetic membrane-receiver complex
is generated by contacting a suitable isolated cell, e.g., an
erythroid cell, a reticulocyte, an erythroid cell precursor, a
platelet, or a platelet precursor, with an exogenous nucleic acid
encoding a receiver polypeptide. In some embodiments, the receiver
polypeptide is encoded by a DNA, which is contacted with a
nucleated erythroid precursor cell or a nucleated platelet
precursor cell. In some embodiments, the receiver polypeptide is
encoded by an RNA, which is contacted with a platelet, a nucleate
erythroid cell, a nucleated platelet precursor cell, or a
reticulocyte. In some embodiments, the receiver is a polypeptide,
which is contacted with a primary platelet, a nucleated erythroid
cell, a nucleated platelet precursor cell, a reticulocyte, or an
erythrocyte.
[0579] A receiver polypeptide may be expressed from a transgene
introduced into an erythroid cell by electroporation, chemical or
polymeric transfection, viral transduction, mechanical membrane
disruption, or other method; a receiver polypeptide that is
expressed from mRNA that is introduced into a cell by
electroporation, chemical or polymeric transfection, viral
transduction, mechanical membrane disruption, or other method; a
receiver polypeptide that is over-expressed from the native locus
by the introduction of an external factor, e.g., a transcriptional
activator, transcriptional repressor, or secretory pathway
enhancer; and/or a receiver polypeptide that is synthesized,
extracted, or produced from a production cell or other external
system and incorporated into the erythroid cell.
[0580] In certain embodiments, the polypeptide receiver is
expressed within the synthetic membrane-receiver polypeptide
complex. The polypeptide receiver may be exhibited on the surface
of the synthetic membrane-receiver polypeptide complex or may
reside within the synthetic membrane-receiver polypeptide
complex.
[0581] In certain embodiments, the synthetic membrane-receiver
polypeptide complex is a cell, e.g., an erythroid cell or a
platelet expressing a receiver polypeptide. Receiver polypeptides
can be introduced by transfection of single or multiple copies of
genes, transduction with a virus, or electroporation in the
presence of DNA or RNA. Methods for expression of exogenous
proteins in mammalian cells are well known in the art. For example,
expression of exogenous factor IX in hematopoietic cells is induced
by viral transduction of CD34+ progenitor cells, see Chang et al.,
Nat Biotechnol 2006, 24:1017.
[0582] Nucleic acids such as DNA expression vectors or mRNA for
producing the receiver polypeptide may be introduced into
progenitor cells (e.g., an erythroid cell progenitor or a platelet
progenitor and the like) that are suitable to produce the synthetic
membrane-receiver polypeptide complexes described herein. The
progenitor cells can be isolated from an original source or
obtained from expanded progenitor cell population via routine
recombinant technology as provided herein. In some instances, the
expression vectors can be designed such that they can incorporate
into the genome of cells by homologous or non-homologous
recombination by methods known in the art.
[0583] In some instances, e.g., for a synthetic membrane-receiver
polypeptide complex that is an erythroid cell comprising a receiver
polypeptide, a nucleic acid encoding a non-receiver polypeptide
that can selectively target and cut the genome, for example a
CRISPR/Cas9, transcriptional activator-like effector nuclease
(TALEN), or zinc finger nuclease, is used to direct the insertion
ofthe exogenous nucleic acid of the expression vector encoding the
receiver polypeptide to a particular genomic location, for example
the CR1 locus (1q32.2), the hemoglobin locus (11p15.4), or another
erythroid-associated protein including, but not limited to, those
listed in table 1 and table 3.
[0584] In some instances, the exogenous nucleic acid is an RNA
molecule, or a DNA molecule that encodes for an RNA molecule, that
silences or represses the expression of a target gene. For example,
the molecule can be a small interfering RNA (siRNA), an antisense
RNA molecule, or a short hairpin RNA (shRNA) molecule.
[0585] Methods for transferring expression vectors into progenitor
cells that are suitable to produce the synthetic membrane-receiver
polypeptide complexes described herein include, but are not limited
to, viral mediated gene transfer, liposome mediated transfer,
transformation, gene guns, transfection and transduction, e.g.,
viral mediated gene transfer such as the use of vectors based on
DNA viruses such as adenovirus, adenoassociated virus and herpes
virus, as well as retroviral based vectors. Examples of modes of
gene transfer include e.g., naked DNA, CaPO4 precipitation, DEAE
dextran, electroporation, protoplast fusion, lipofection, and cell
microinjection.
[0586] A progenitor cell subject to transfer of an exogenous
nucleic acid that encodes a polypeptide receiver can be cultured
under suitable conditions allowing for differentiation into mature
enucleated red blood cells, e.g., the in vitro culturing process
described herein. The resulting enucleated red blood cells display
proteins associated with mature erythrocytes, e.g., hemoglobin,
glycophorin A, and receiver polypeptides which can be validated and
quantified by standard methods (e.g., Western blotting or FACS
analysis). Isolated mature enucleated red blood cells comprising a
receiver and platelets comprising a receiver are two examples of
synthetic membrane-receiver polypeptide complexes of the
invention.
[0587] In some embodiments, the synthetic membrane-receiver complex
is generated by contacting a reticulocyte with an exogenous nucleic
acid encoding a receiver polypeptide. In some embodiments, the
receiver polypeptide is encoded by an RNA which is contacted with a
reticulocyte. In some embodiments, the receiver is a polypeptide
which is contacted with a reticulocyte.
[0588] Isolated reticulocytes may be transfected with mRNA encoding
a receiver polypeptide to generate a synthetic membrane-receiver
comple. Messenger RNA may be derived from in vitro transcription of
a cDNA plasmid construct containing the coding sequence
corresponding to the receiver polypeptide. For example, the cDNA
sequence corresponding to the receiver polypeptide may be inserted
into a cloning vector containing a promoter sequence compatible
with specific RNA polymerases. For example, the cloning vector ZAP
Express.RTM. pBK-CMV (Stratagene, La Jolla, Calif., USA) contains
T3 and T7 promoter sequence compatible with T3 and T7 RNA
polymerase, respectively. For in vitro transcription of sense mRNA,
the plasmid is linearized at a restriction site downstream of the
stop codon(s) corresponding to the end of the coding sequence of
the receiver polypeptide. The mRNA is transcribed from the linear
DNA template using a commercially available kit such as, for
example, the RNAMaxx.RTM. High Yield Transcription Kit (from
Stratagene, La Jolla, Calif., USA). In some instances, it may be
desirable to generate 5'-m7GpppG-capped mRNA. As such,
transcription of a linearized cDNA template may be carried out
using, for example, the mMESSAGE mMACHINE High Yield Capped RNA
Transcription Kit from Ambion (Austin, Tex., USA). Transcription
may be carried out in a reaction volume of 20-100 .mu.l at
37.degree. C. for 30 min to 4 h. The transcribed mRNA is purified
from the reaction mix by a brief treatment with DNase I to
eliminate the linearized DNA template followed by precipitation in
70% ethanol in the presence of lithium chloride, sodium acetate or
ammonium acetate. The integrity of the transcribed mRNA may be
assessed using electrophoresis with an agarose-formaldehyde gel or
commercially available Novex pre-cast TBE gels (e.g., Novex,
Invitrogen, Carlsbad, Calif., USA).
[0589] Messenger RNA encoding the receiver polypeptide may be
introduced into reticulocytes using a variety of approaches
including, for example, lipofection and electroporation (van
Tandeloo et al., Blood 98:49-56 (2001)). For lipofection, for
example, 5 .mu.g of in vitro transcribed mRNA in Opti-MEM
(Invitrogen, Carlsbad, Calif., USA) is incubated for 5-15 min at a
1:4 ratio with the cationic lipid DMRIE-C(Invitrogen).
Alternatively, a variety of other cationic lipids or cationic
polymers may be used to transfect cells with mRNA including, for
example, DOTAP, various forms of polyethylenimine, and polyL-lysine
(Sigma-Aldrich, Saint Louis, Mo., USA), and Superfect (Qiagen,
Inc., Valencia, Calif., USA; See, e.g., Bettinger et al., Nucleic
Acids Res. 29:3882-3891 (2001)). The resulting mRNA/lipid complexes
are incubated with cells (1-2.times.10.sup.6 cells/ml) for 2 h at
37.degree. C., washed and returned to culture. For electroporation,
for example, about 5 to 20.times.10.sup.6 cells in 500 .mu.l of
Opti-MEM (Invitrogen, Carlsbad, Calif., USA) are mixed with about
20 .mu.g of in vitro transcribed mRNA and electroporated in a
0.4-cm cuvette using, for example, and Easyject Plus device
(EquiBio, Kent, United Kingdom). In some instances, it may be
necessary to test various voltages, capacitances and
electroporation volumes to determine the useful conditions for
transfection of a particular mRNA into a reticulocyte. In general,
the electroporation parameters required to efficiently transfect
cells with mRNA appear to be less detrimental to cells than those
required for electroporation of DNA (van Tandeloo et al., Blood
98:49-56 (2001)).
[0590] Alternatively, mRNA may be transfected into a reticulocyte
using a peptide-mediated RNA delivery strategy (See, e.g.,
Bettinger et al., Nucleic Acids Res. 29:3882-3891 (2001)). For
example, the cationic lipid polyethylenimine 2 kDA (Sigma-Aldrich,
Saint Louis, Mo., USA) may be combined with the melittin peptide
(Alta Biosciences, Birmingham, UK) to increase the efficiency of
mRNA transfection, particularly in post-mitotic primary cells. The
mellitin peptide may be conjugated to the PEI using a disulfide
cross-linker such as, for example, the hetero-bifunctional
cross-linker succinimidyl 3-(2-pyridyldithio) propionate. In vitro
transcribed mRNA is preincubated for 5 to 15 min with the
mellitin-PEI to form an RNA/peptide/lipid complex. This complex is
then added to cells in serum-free culture medium for 2 to 4 h at
37.degree. C. in a 5% CO.sub.2 humidified environment and then
removed and the transfected cells allowed to continue growing in
culture.
[0591] In some embodiments, the synthetic membrane-receiver complex
is generated by contacting a suitable isolated erythroid cell
precursor or a platelet precursor with an exogenous nucleic acid
encoding a receiver polypeptide. In some embodiments, the receiver
polypeptide is encoded by a DNA, which is contacted with a
nucleated erythroid precursor cell or a nucleated platelet
precursor cell. In some embodiments, the receiver polypeptide is
encoded by an RNA, which is contacted with a platelet, a nucleate
erythroid cell, or a nucleated platelet precursor cell.
[0592] Receivers may be genetically introduced into erythroid cell
precursors, platelet precursor, or nucleated erythroid cells prior
to terminal differentiation using a variety of DNA techniques,
including transient or stable transfections and gene therapy
approaches. The receiver polypeptides may be expressed on the
surface and/or in the cytoplasm of mature red blood cell or
platelet.
[0593] Viral gene transfer may be used to transfect the cells with
DNA encoding a receiver polypeptide. A number of viruses may be
used as gene transfer vehicles including Moloney murine leukemia
virus (MMLV), adenovirus, adeno-associated virus (AAV), herpes
simplex virus (HSV), lentiviruses such as human immunodeficiency
virus 1 (HIV 1), and spumaviruses such as foamy viruses, for
example (See, e.g., Osten et al., HEP 178:177-202 (2007)).
Retroviruses, for example, efficiently transduce mammalian cells
including human cells and integrate into chromosomes, conferring
stable gene transfer.
[0594] A receiver polypeptide may be transfected into an erythroid
cell precursor, a platelet precursor, or a nucleated erythroid
cell, expressed and subsequently retained and exhibited in a mature
red blood cell or platelet. A suitable vector is the Moloney murine
leukemia virus (MMLV) vector backbone (Malik et al., Blood
91:2664-2671 (1998)). Vectors based on MMLV, an oncogenic
retrovirus, are currently used in gene therapy clinical trials
(Hossle et al., News Physiol. Sci. 17:87-92 (2002)). For example, a
DNA construct containing the cDNA encoding a receiver polypeptide
can be generated in the MMLV vector backbone using standard
molecular biology techniques. The construct is transfected into a
packaging cell line such as, for example, PA317 cells and the viral
supernatant is used to transfect producer cells such as, for
example, PG13 cells. The PG13 viral supernatant is incubated with
an erythroid cell precursor, a platelet precursor, or a nucleated
erythroid cell that has been isolated and cultured or has been
freshly isolated as described herein. The expression of the
receiver polypeptide may be monitored using FACS analysis
(fluorescence-activated cell sorting), for example, with a
fluorescently labeled antibody directed against the receiver
polypeptide, if it is located on the surface of the synthetic
membrane-receiver polypeptide complex. Similar methods may be used
to express a receiver polypeptide that is located in the inside of
the synthetic membrane-receiver polypeptide complex.
[0595] Optionally, a fluorescent tracking molecule such as, for
example, green fluorescent protein (GFP) may be transfected using a
viral-based approach (Tao et al., Stem Cells 25:670-678 (2007)).
Ecotopic retroviral vectors containing DNA encoding the enhanced
green fluorescent protein (EGFP) or a red fluorescent protein
(e.g., DsRed-Express) are packaged using a packaging cell such as,
for example, the Phoenix-Eco cell line (distributed by Orbigen, San
Diego, Calif.). Packaging cell lines stably express viral proteins
needed for proper viral packaging including, for example, gag, pol,
and env. Supernatants from the Phoenix-Eco cells into which viral
particles have been shed are used to transduce e.g., erythroid cell
precursors, platelet precursors, or a nucleated erythroid cells. In
some instances, transduction may be performed on a specially coated
surface such as, for example, fragments of recombinant fibronectin
to improve the efficiency of retroviral mediated gene transfer
(e.g., RetroNectin, Takara Bio USA, Madison, Wis.). Cells are
incubated in RetroNectin-coated plates with retroviral Phoenix-Eco
supernatants plus suitable co-factors. Transduction may be repeated
the next day. In this instance, the percentage of cells expressing
EGFP or DsRed-Express may be assessed by FACS. Other reporter genes
that may be used to assess transduction efficiency include, for
example, beta-galactosidase, chloramphenicol acetyltransferase, and
luciferase as well as low-affinity nerve growth factor receptor
(LNGFR), and the human cell surface CD24 antigen (Bierhuizen et
al., Leukemia 13:605-613 (1999)).
[0596] Nonviral vectors may be used to introduce genetic material
into suitable erythroid cells, platelets or precursors thereof to
generate synthetic membrane-receiver polypeptide complexes.
Nonviral-mediated gene transfer differs from viral-mediated gene
transfer in that the plasmid vectors contain no proteins, are less
toxic and easier to scale up, and have no host cell preferences.
The "naked DNA" of plasmid vectors is by itself inefficient in
delivering genetic material encoding a receiver polypeptide to a
cell and therefore is combined with a gene delivery method that
enables entry into cells. A number of delivery methods may be used
to transfer nonviral vectors into suitable erythroid cells,
platelets or precursors thereof including chemical and physical
methods.
[0597] A nonviral vector encoding a receiver polypeptide may be
introduced into suitable erythroid cells, platelets or precursors
thereof using synthetic macromolecules such as cationic lipids and
polymers (Papapetrou et al., Gene Therapy 12:S118-S130 (2005)).
Cationic liposomes, for example form complexes with DNA through
charge interactions. The positively charged DNA/lipid complexes
bind to the negative cell surface and are taken up by the cell by
endocytosis. This approach may be used, for example, to transfect
hematopoietic cells (See, e.g., Keller et al., Gene Therapy
6:931-938 (1999)). For erythroid cells, platelets or precursors
thereof the plasmid DNA (approximately 0.5 .mu.g in 25-100 .mu.L of
a serum free medium, such as, for example, OptiMEM (Invitrogen,
Carlsbad, Calif.)) is mixed with a cationic liposome (approximately
4 .mu.g in 25 .mu.L of serum free medium) such as the commercially
available transfection reagent Lipofectamine.TM. (Invitrogen,
Carlsbad, Calif.) and allowed to incubate for at least 20 min to
form complexes. The DNA/liposome complex is added to suitable
erythroid cells, platelets or precursors thereof and allowed to
incubate for 5-24 h, after which time transgene expression or the
receiver polypeptide may be assayed. Alternatively, other
commercially available liposome transfection agents may be used
(e.g., In vivo GeneSHUTTLE.TM., Qbiogene, Carlsbad, Calif.).
[0598] Optionally, a cationic polymer such as, for example,
polyethylenimine (PEI) may be used to efficiently transfect
erythroid cell progenitor cells, for example hematopoietic and
umbilical cord blood-derived CD34+ cells (See, e.g., Shin et al.,
Biochim Biophys. Acta 1725:377-384 (2005)). Human CD34+ cells are
isolated from human umbilical cord blood and cultured in Iscove's
modified Dulbecco's medium supplemented with 200 ng/ml stem cell
factor and 20% heat-inactivated fetal bovine serum. Plasmid DNA
encoding the receiver polypeptide is incubated with branched or
linear PEIs varying in size from 0.8 K to 750 K (Sigma Aldrich,
Saint Louis, Mo., USA; Fermetas, Hanover, Md., USA). PEI is
prepared as a stock solution at 4.2 mg/ml distilled water and
slightly acidified to pH 5.0 using HCl. The DNA may be combined
with the PEI for 30 min at room temperature at various
nitrogen/phosphate ratios based on the calculation that 1 .mu.g of
DNA contains 3 nmol phosphate and 1 .mu.l of PEI stock solution
contains 10 nmol amine nitrogen. The isolated CD34+ cells are
seeded with the DNA/cationic complex, centrifuged at 280.times.g
for 5 min and incubated in culture medium for 4 or more h until
gene expression of the receiver polypeptide is assessed.
[0599] A plasmid vector may be introduced into suitable erythroid
cells, platelets or precursors thereof using a physical method such
as particle-mediated transfection, "gene gun", biolistics, or
particle bombardment technology (Papapetrou, et al., (2005) Gene
Therapy 12:S118-S130). In this instance, DNA encoding the receiver
polypeptide is absorbed onto gold particles and administered to
cells by a particle gun. This approach may be used, for example, to
transfect erythroid progenitor cells, e.g., hematopoietic stem
cells derived from umbilical cord blood (See, e.g., Verma et al.,
Gene Therapy 5:692-699 (1998)). As such, umbilical cord blood is
isolated and diluted three fold in phosphate buffered saline. CD34+
cells are purified using an anti-CD34 monoclonal antibody in
combination with magnetic microbeads coated with a secondary
antibody and a magnetic isolation system (e.g., Miltenyi MiniMac
System, Auburn, Calif., USA). The CD34+ enriched cells may be
cultured as described herein. For transfection, plasmid DNA
encoding the receiver polypeptide is precipitated onto a particle,
for example gold beads, by treatment with calcium chloride and
spermidine. Following washing of the DNA-coated beads with ethanol,
the beads may be delivered into the cultured cells using, for
example, a Biolistic PDS-1000/He System (Bio-Rad, Hercules, Calif.,
USA). A reporter gene such as, for example, beta-galactosidase,
chloramphenicol acetyltransferase, luciferase, or green fluorescent
protein may be used to assess efficiency of transfection.
[0600] Optionally, electroporation methods may be used to introduce
a plasmid vector into suitable erythroid cells, platelets or
precursors thereof. Electroporation creates transient pores in the
cell membrane, allowing for the introduction of various molecules
into the cells including, for example, DNA and RNA as well as
antibodies and drugs. As such, CD34+ cells are isolated and
cultured as described herein Immediately prior to electroporation,
the cells are isolated by centrifugation for 10 min at 250.times.g
at room temperature and resuspended at 0.2-10.times.10{circumflex
over ( )}6 viable cells/ml in an electroporation buffer such as,
for example, X-VIVO 10 supplemented with 1.0% human serum albumin
(HSA). The plasmid DNA (1-50 .mu.g) is added to an appropriate
electroporation cuvette along with 500 .mu.l of cell suspension.
Electroporation may be done using, for example, an ECM 600
electroporator (Genetronics, San Diego, Calif., USA) with voltages
ranging from 200 V to 280 V and pulse lengths ranging from 25 to 70
milliseconds. A number of alternative electroporation instruments
are commercially available and may be used for this purpose (e.g.,
Gene Pulser Xcell.TM., BioRad, Hercules, Calif.; Cellject Duo,
Thermo Science, Milford, Mass.). Alternatively, efficient
electroporation of isolated CD34+ cells may be performed using the
following parameters: 4 mm cuvette, 1600 .mu.F, 550 V/cm, and 10
.mu.g of DNA per 500 .mu.l of cells at 1.times.105 cells/ml (Oldak
et al., Acta Biochimica Polonica 49:625-632 (2002)).
[0601] Nucleofection, a form of electroporation, may also be used
to transfect suitable erythroid cells, platelets or precursors
thereof. In this instance, transfection is performed using
electrical parameters in cell-type specific solutions that enable
DNA (or other reagents) to be directly transported to the nucleus
thus reducing the risk of possible degradation in the cytoplasm.
For example, a Human CD34 Cell Nucleofector.TM. Kit (from amaxa
inc.) may be used to transfect suitable erythroid cells, platelets
or precursors thereof. In this instance, 1-5.times.10.sup.6 cells
in Human CD34 Cell Nucleofector.TM. Solution are mixed with 1-5
.mu.g of DNA and transfected in the Nucleofector.TM. instrument
using preprogrammed settings as determined by the manufacturer.
[0602] Erythroid cells, platelets or precursors thereof may be
non-virally transfected with a conventional expression vector which
is unable to self-replicate in mammalian cells unless it is
integrated in the genome. Alternatively, erythroid cells, platelets
or precursors thereof may be transfected with an episomal vector
which may persist in the host nucleus as autonomously replicating
genetic units without integration into chromosomes (Papapetrou et
al., Gene Therapy 12:S118-S130 (2005)). These vectors exploit
genetic elements derived from viruses that are normally
extrachromosomally replicating in cells upon latent infection such
as, for example, EBV, human polyomavirus BK, bovine papilloma
virus-1 (BPV-1), herpes simplex virus-1 (HSV) and Simian virus 40
(SV40). Mammalian artificial chromosomes may also be used for
nonviral gene transfer (Vanderbyl et al., Exp. Hematol.
33:1470-1476 (2005)).
[0603] Exogenous nucleic acids encoding a polypeptide receiver may
be assembled into expression vectors by standard molecular biology
methods known in the art, e.g., restriction digestion,
overlap-extension PCR, and Gibson assembly.
[0604] Exogenous nucleic acids may comprise a gene encoding a
polypeptide receiver that is not normally expressed on the cell
surface, e.g., of an erythroid cell, fused to a gene that encodes
an endogenous or native membrane protein, such that the receiver
polypeptide is expressed on the cell surface. For example, a
exogenous gene encoding a receiver polypeptide can be cloned at the
N terminus following the leader sequence of a type 1 membrane
protein, at the C terminus of a type 2 membrane protein, or
upstream of the GPI attachment site of a GPI-linked membrane
protein.
[0605] Standard cloning methods can be used to introduce flexible
amino acid linkers between two fused genes. For example, the
flexible linker is a poly-glycine poly-serine linker such as
[Gly4Ser]3_(SEQ ID NO: 24) commonly used in generating single-chain
antibody fragments from full-length antibodies (Antibody
Engineering: Methods & Protocols, Lo 2004), or ala-gly-ser-thr
polypeptides such as those used to generate single-chain Arc
repressors (Robinson & Sauer, PNAS 1998). In some embodiments,
the flexible linker provides the receiver polypeptide with more
flexibility and steric freedom than the equivalent construct
without the flexible linker. This added flexibility is useful in
applications that require binding to a target, e.g., an antibody or
protein, or an enzymatic reaction of the receiver for which the
active site must be accessible to the substrate (e.g., the
target).
[0606] An epitope tag may be placed between two fused genes, such
as, e.g., a nucleic acid sequence encoding an HA epitope tag--amino
acids YPYDVPDYA (Seq. ID No. 4), a CMyc tag--amino acids EQKLISEEDL
(Seq. ID No. 5), or a Flag tag--amino acids DYKDDDDK (Seq. ID No.
6). The epitope tag may be used for the facile detection and
quantification of expression using antibodies against the epitope
tag by flow cytometry, western blot, or immunoprecipitation.
[0607] In some embodiments, the synthetic membrane-receiver
polypeptide comprises a receiver polypeptide and at least one other
heterologous polypeptide. The second polypeptide can be a
fluorescent protein.The fluorescent protein can be used as a
reporter to assess transduction efficiency. In some embodiments,
the fluorescent protein is used as a reporter to assess expression
levels of the receiver polypeptide if both are made from the same
transcript. In some embodiments, the at least one other polypeptide
is heterologous and provides a function, such as, e.g., multiple
antigens, multiple capture targets, enzyme cascade. In one
embodiment, the recombinant nuceic acid comprises a gene encoding a
receiver and a second gene, wherein the second gene is separated
from the gene encoding the receiver by a viral-derived T2A sequence
(gagggcagaggaagtcttctaacatgcggtgacgtggaggsgsstcccggccct (Seq. ID
No. 7)) that is post-translationally cleaved into two mature
proteins.
[0608] In some embodiments, the receiver polypeptide is complement
receptor 1 (CR-1). The gene sequence for complement receptor 1 is
amplified using PCR. In some embodiments,the exogenous nucleic acid
encoding a receiver polypeptide comprises a gene sequence for a
scFv against hepatitis B antigen that is fused to the 3' end of the
sequence for Kell and amplified using PCR. In some embodiments, the
exogenous nucleic acid encoding a receiver polypeptide comprises a
gene sequence for a scFv against hepatitis B antigen that is fused
to a poly-glycine/serine linker, followed by the 3' end of the
sequence for Kell, and amplified using PCR. In some embodiments,
the exogenous nucleic acid encoding a receiver polypeptide
comprises the 3' end of a gene sequence for a scFv against
hepatitis B antigen that is fused to an epitope tag sequence, of
which may be one, or a combination of, an; HA-tag, Green
fluorescent protein tag, Myc-tag, chitin binding protein, maltose
binding protein, glutathione-S-transferase, poly(His)tag,
thioredoxin, poly(NANP), FLAG-tag, V5-tag, AviTag, Calmodulin-tag,
polyglutamate-tag, E-tag, S-tag, SBP-tag, Softag-1, Softag-3,
Strep-tag, TC-tag, VSV-tag, Xpress-tag, Isopeptag, SpyTag, biotin
carboxyl carrier protein, Nus-tag, Fc-tag, or Ty-tag. The entire
construct is fused to the 3' end of the sequence for Kell and then
amplified using PCR. The exogenous gene constructs encoding the
various receiver polypeptides are, for example, subsequently loaded
into a lentiviral vector and used to transduce a CD34+ cell
population.
[0609] In one embodiment, the gene comprising an adenosine
deaminase receiver is placed in the pSP64 vector. The vector is
linearized and RNA polymerase generates mRNA coding for the
receiver polypeptide. In one embodiment, a population of
neutrophils is electroporated using an Ingenio electroporation kit
such that 10, 100, 1,000, 10,000 TU/ml of mRNA coding for surface
expression of GluN1 receiver to generate a synthetic
membrane-receiver polypeptide complex. In one embodiment, a
population of platelet cells is incubated with Trans-IT mRNA and
10, 100, or 1000 TU/ml (transducing units/ml) of mRNA coding for
thymidine phosphorylase protein receiver to generate a synthetic
membrane-receiver polypeptide complex. In one embodiment, a
population of erythroid cells is incubated with lentiviral vectors
comprising exogenous nucleic acid encoding a receiver polypeptide,
specific plasmids of which may include; pLKO.1 puro, PLKO.1--TRC
cloning vector, pSico, FUGW, pLVTHM, pLJM1, pLionII, pMD2.G,
pCMV-VSV-G, pCI-VSVG, pCMV-dR8.2 dvpr, psPAX2, pRSV-Rev, and
pMDLg/pRRE to generate a synthetic membrane-receiver polypeptide
complex. The vectors may be administered at 10, 100, 1,000, 10,000
pfu and incubated for 12 hrs.
[0610] In one embodiment, a population of erythroid cells is
incubated with Lipofectamine 2000 and 10, 100, or 1000 TU/ml
(transducing units/ml) of DNA coding for oxalase receiver.
[0611] In certain embodiments, the polypeptide receiver is
conjugated to the synthetic membrane-receiver polypeptide complex.
The polypeptide receiver usually is conjugated to the surface of
the synthetic membrane-receiver polypeptide complex. Conjugation
may be achieved chemically or enzymatically. Non-polypeptide
receivers may also be conjugated to a synthetic membrane-receiver
complex.
[0612] In some embodiments, the synthetic membrane-receiver complex
comprises a receiver that is chemically conjugated. Chemical
conjugation of a receiver may be accomplished by covalent bonding
of the receiver to another molecule, with or without use of a
linker. The formation of such conjugates is within the skill of
artisans and various techniques are known for accomplishing the
conjugation, with the choice of the particular technique being
guided by the materials to be conjugated. The addition of amino
acids to the polypeptide (C- or N-terminal) which contain ionizable
side chains, e.g., aspartic acid, glutamic acid, lysine, arginine,
cysteine, histidine, or tyrosine, and are not contained in the
active portion of the polypeptide sequence, serve in their
unprotonated state as a potent nucleophile to engage in various
bioconjugation reactions with reactive groups attached to polymers,
e.g., homo- or hetero-bi-functional PEG (e.g., Lutolf and Hubbell,
Biomacromolecules 2003; 4:713-22, Hermanson, Bioconjugate
Techniques, London. Academic Press Ltd; 1996). Receiver conjugation
is not not restricted to polypeptides, e.g., a peptide ligand, an
antibody, an antibody fragment, or aptamer but is applicable also
for non-polypeptide receivers, e.g., lipids, carbohydrates, nucleic
acids, and small molecules.
[0613] In an embodiment, the receiver may be bound to the surface
of a synthetic membrane-receiver complex through a
biotin-streptavidin bridge. For example, a biotinylated antibody
receiver may be linked to a non-specifically biotinylated surface
of the synthetic membrane-receiver complex through a streptavidin
bridge. Antibodies can be conjugated to biotin by a number of
chemical means (See, e.g., Hirsch et al., Methods Mol. Biol. 295:
135-154 (2004)). Any surface membrane proteins of a synthetic
membrane-receiver complex may be biotinylated using an amine
reactive biotinylation reagent such as, for example, EZ-Link
Sulfo-NHS--SS-Biotin (sulfosuccinimidyl
2-(biotinamido)-ethyl-1,3-dithiopropionate; Pierce-Thermo
Scientific, Rockford, Ill., USA; See, e.g., Jaiswal et al., Nature
Biotech. 21:47-51 (2003)). For example, isolated erythroid cells
may be incubated for 30 min at 4.degree. C. in 1 mg/ml solution of
sulfo-NHS--SS in phosphate-buffered saline. Excess biotin reagent
is removed by washing the cells with Tris-buffered saline. The
biotinylated cells are then reacted with the biotinylated antibody
receiver in the presence of streptavidin to form the synthetic
membrane-receiver complex.
[0614] In another embodiment, the receiver may be attached to the
surface of, e.g., an erythroid cell or platelet with a bispecific
antibody to generate the synthetic membrane-receiver complex. For
example, the bispecific antibody can have specificity for the
erythroid cell or platelet and the receiver.
[0615] In another embodiment, the receiver is attached to, e.g., an
erythroid cell or platelet via a covalent attachment to generate a
synthetic membrane-receiver complex. For example, the receiver may
be derivatized and bound to the erythroid cell or platelet using a
coupling compound containing an electrophilic group that will react
with nucleophiles on the erythroid cell or platelet to form the
interbonded relationship. Representative of these electrophilic
groups are .alpha.,.beta. unsaturated carbonyls, alkyl halides and
thiol reagents such as substituted maleimides. In addition, the
coupling compound can be coupled to a receiver polypeptide via one
or more of the functional groups in the polypeptide such as amino,
carboxyl and tryosine groups. For this purpose, coupling compounds
should contain free carboxyl groups, free amino groups, aromatic
amino groups, and other groups capable of reaction with enzyme
functional groups. Highly charged receivers can also be prepared
for immobilization on, e.g., erythroid cells or platelets through
electrostatic bonding to generate synthetic membrane-receiver
complexes. Examples of these derivatives would include polylysyl
and polyglutamyl enzymes.
[0616] The choice of the reactive group embodied in the derivative
depends on the reactive conditions employed to couple the
electrophile with the nucleophilic groups on the erythroid cell or
platelet for immobilization. A controlling factor is the desire not
to inactivate the coupling agent prior to coupling of the receiver
immobilized by the attachment to the erythroid cell or platelet.
Such coupling immobilization reactions can proceed in a number of
ways. Typically, a coupling agent can be used to form a bridge
between the receiver and the erythroid cell or platelet. In this
case, the coupling agent should possess a functional group such as
a carboxyl group which can be caused to react with the receiver.
One way of preparing the receiver for conjugation includes the
utilization of carboxyl groups in the coupling agent to form mixed
anhydrides which react with the receiver, in which use is made of
an activator which is capable of forming the mixed anhydride.
Representative of such activators are isobutylchloroformate or
other chloroformates which give a mixed anhydride with coupling
agents such as 5,5'-(dithiobis(2-nitrobenzoic acid) (DTNB),
p-chloromercuribenzoate (CMB), or m-maleimidobenzoic acid (MBA).
The mixed anhydride of the coupling agent reacts with the receiver
to yield the reactive derivative which in turn can react with
nucleophilic groups on the erythroid cell or platelet to immobilize
the receiver.
[0617] Functional groups on a receiver polypeptide, such as
carboxyl groups can be activated with carbodiimides and the like
activators. Subsequently, functional groups on the bridging
reagent, such as amino groups, will react with the activated group
on the receiver polypeptide to form the reactive derivative. In
addition, the coupling agent should possess a second reactive group
which will react with appropriate nucleophilic groups on the
erythroid cell or platelet to form the bridge. Typical of such
reactive groups are alkylating agents such as iodoacetic acid,
.alpha., .beta. unsaturated carbonyl compounds, such as acrylic
acid and the like, thiol reagents, such as mercurials, substituted
maleimides and the like.
[0618] Alternatively, functional groups on the receiver can be
activated so as to react directly with nucleophiles on, e.g.,
erythroid cells or platelets to obviate the need for a
bridge-forming compound. For this purpose, use is made of an
activator such as Woodward's Reagent K or the like reagent which
brings about the formation of carboxyl groups in the receiver into
enol esters, as distinguished from mixed anhydrides. The enol ester
derivatives of receivers subsequently react with nucleophilic
groups on, e.g., an erythroid cell or platelet to effect
immobilization of the receiver, thereby creating a synthetic
membrane-receiver complex.
[0619] In some embodiments, the synthetic membrane-receiver complex
is generated by contacting an erythroid cell with a receiver and
optionally a payload, wherein contacting does not include
conjugating the receiver to the erythroid cell using an attachment
site comprising Band 3 (CD233), aquaporin-1, Glut-1, Kidd antigen,
RhAg/R1i50 (CD241), R1i (CD240), Rh30CE (CD240CE), Rh30D (CD240D),
Kx, glycophorin B (CD235b), glycophorin C (CD235c), glycophorin D
(CD235d), Kell (CD238), Duffy/DARCi (CD234), CR1 (CD35), DAF
(CD55), Globoside, CD44, ICAM-4 (CD242), Lu/B-CAM (CD239), XG1/XG2
(CD99), EMMPRIN/neurothelin (CD147), JMH, Glycosyltransferase,
Cartwright, Dombrock, C4A/CAB, Scianna, MER2, stomatin, BA-1
(CD24), GPIV (CD36), CD108, CD139, or H antigen (CD173).
[0620] In some embodiments, the synthetic membrane-receiver complex
comprises a receiver that is enzymatically conjugated.
[0621] In specific embodiments, the receiver can be conjugated to
the surface of, e.g., an erythroid cell or platelet by various
chemical and enzymatic means, including but not limited to those
listed in table 9 to generate a synthetic membrane-receiver
complex. These methods include chemical conjugation with
bifunctional cross-linking agents such as, e.g., an NHS
ester-maleimide heterobifunctional crosslinker to connect a primary
amine group with a reduced thiol group. These methods also include
enzymatic strategies such as, e.g., transpeptidase reaction
mediated by a sortase enzyme to connect one polypeptide containing
the acceptor sequence LPXTG (SEQ ID NO: 25) or LPXTA (SEQ ID NO:
26) with a polypeptide containing the N-terminal donor sequence
GGG, see e.g., Swee et al., PNAS 2013. The methods also include
combination methods, such as e.g., sortase-mediated conjugation of
Click Chemistry handles (an azide and an alkyne) on the antigen and
the cell, respectively, followed by a cyclo-addition reaction to
chemically bond the antigen to the cell, see e.g., Neves et al.,
Bioconjugate Chemistry, 2013.
[0622] If desired, a catalytic bond-forming polypeptide domain can
be expressed on or in e.g., an erythroid cell or platelet, either
intracellularly or extracellularly. Many catalytic bond-forming
polypeptides exist, including transpeptidases, sortases, and
isopeptidases, including those derived from Spy0128, a protein
isolated from Streptococcus pyogenes.
[0623] It has been demonstrated that splitting the autocatalytic
isopeptide bond-forming subunit (CnaB2 domain) of Spy0128 results
in two distinct polypeptides that retain catalytic activity with
specificity for each other. The polypeptides in this system are
termed SpyTag and SpyCatcher. Upon mixing, SpyTag and SpyCatcher
undergo isopeptide bond formation between Asp117 on SpyTag and
Lys31 on SpyCatcher (Zakeri and Howarth, JACS 2010, 132:4526). The
reaction is compatible with the cellular environment and highly
specific for protein/peptide conjugation (Zakeri, B.; Fierer, J.
O.; Celik, E.; Chittock, E. C.; Schwarz-Linek, U.; Moy, V. T.;
Howarth, M. Proc. Natl. Acad. Sci. U.S.A. 2012, 109, E690-E697).
SpyTag and SpyCatcher has been shown to direct post-translational
topological modification in elastin-like protein. For example,
placement of SpyTag at the N-terminus and SpyCatcher at the
C-terminus directs formation of circular elastin-like proteins
(Zhang et al, Journal of the American Chemical Society, 2013).
[0624] The components SpyTag and SpyCatcher can be interchanged
such that a system in which molecule A is fused to SpyTag and
molecule B is fused to SpyCatcher is functionally equivalent to a
system in which molecule A is fused to SpyCatcher and molecule B is
fused to SpyTag. For the purposes of this document, when SpyTag and
SpyCatcher are used, it is to be understood that the complementary
molecule could be substituted in its place.
[0625] A catalytic bond-forming polypeptide, such as a
SpyTag/SpyCatcher system, can be used to attach the receiver to the
surface of, e.g., an erythroid cell, to generate a synthetic
membrane-receiver complex. The SpyTag polypeptide sequence can be
expressed on the extracellular surface of the erythroid cell. The
SpyTag polypeptide can be, for example, fused to the N terminus of
a type-1 or type-3 transmembrane protein, e.g., glycophorin A,
fused to the C terminus of a type-2 transmembrane protein, e.g.,
Kell, inserted in-frame at the extracellular terminus or in an
extracellular loop of a multi-pass transmembrane protein, e.g.,
Band 3, fused to a GPI-acceptor polypeptide, e.g., CD55 or CD59,
fused to a lipid-chain-anchored polypeptide, or fused to a
peripheral membrane protein. The nucleic acid sequence encoding the
SpyTag fusion can be expressed within a synthetic membrane-receiver
complex. A receiver polypeptide can be fused to SpyCatcher. The
nucleic acid sequence encoding the SpyCatcher fusion can be
expressed and secreted from the same erythroid cell that expresses
the SpyTag fusion. Alternatively, the nucleic acid sequence
encoding the SpyCatcher fusion can be produced exogenously, for
example in a bacterial, fungal, insect, mammalian, or cell-free
production system. Upon reaction of the SpyTag and SpyCatcher
polypeptides, a covalent bond will be formed that attaches the
receiver to the surface of the erythroid cell to form a synthetic
membrane-receiver complex. An erythroid cell comprising the
receiver polypeptide fusion is an example of a synthetic
membrane-receiver polypeptide complex that comprises a conjugated
receiver.
[0626] In one embodiment, the SpyTag polypeptide may be expressed
as a fusion to the N terminus of glycophorin A under the control of
the Gatal promoter in an erythroid cell. A receiver polypeptide,
for example complement receptor 1 and the receivers listed in table
7, fused to the SpyCatcher polypeptide sequence can be expressed
under the control of the Gatal promoter in the same erythroid cell.
Upon expression of both fusion polypeptides, an isopeptide bond
will be formed between the SpyTag and SpyCatcher polypeptides,
forming a covalent bond between the erythroid cell surface and the
receiver polypeptide. An erythroid cell comprising the receiver
polypeptide fusion is an example of a synthetic membrane-receiver
polypeptide complex that comprises a conjugated receiver.
[0627] In another embodiment, the SpyTag polypeptide may be
expressed as a fusion to the N terminus of glycophorin A under the
control of the Gatal promoter in an erythroid cell. A receiver
polypeptide, for example complement receptor 1, fused to the
SpyCatcher polypeptide sequence can be expressed in a suitable
mammalian cell expression system, for example HEK293 cells. Upon
expression of the SpyTag fusion polypeptide on the erythroid cell,
the SpyCatcher fusion polypeptide can be brought in contact with
the cell. Under suitable reaction conditions, an isopeptide bond
will be formed between the SpyTag and SpyCatcher polypeptides,
forming a covalent bond between the erythroid cell surface and the
receiver polypeptide. An erythroid cell comprising the receiver
polypeptide fusion is an example of a synthetic membrane-receiver
polypeptide complex that comprises a conjugated receiver.
[0628] A catalytic bond-forming polypeptide, such as a
SpyTag/SpyCatcher system, can be used to anchor a receiver molecule
to the intracellular space of an erythroid cell. The SpyTag
polypeptide sequence can be expressed in the intracellular space of
the erythroid cell by a number of methods, including direct
expression of the transgene, fusion to an endogenous intracellular
protein such as, e.g., hemoglobin, fusion to the intracellular
domain of endogenous cell surface proteins such as, e.g., Band 3,
glycophorin A, Kell, or fusion to a structural component of the
erythroid cytoskeleton. The SpyTag sequence is not limited to a
polypeptide terminus and may be integrated within the interior
sequence of an endogenous polypeptide such that polypeptide
translation and localization is not perturbed. A receiver
polypeptide can be fused to SpyCatcher. The nucleic acid sequence
encoding the SpyCatcher fusion can be expressed within the same
erythroid cell that expresses the SpyTag fusion. Upon reaction of
the SpyTag and SpyCatcher polypeptides, a covalent bond will be
formed that acts to anchor the receiver polypeptide in the
intracellular space of the erythroid cell. An erythroid cell
comprising the receiver polypeptide fusion is an example of a
synthetic membrane-receiver polypeptide complex that comprises a
conjugated receiver.
[0629] In one embodiment, an erythroid cell may express SpyTag
fused to hemoglobin beta intracellularly. The erythroid cell may be
genetically modified with a gene sequence that includes a
hemoglobin promoter, beta globin gene and a SpyTag sequence such
that upon translation, intracellular beta globin is fused to SpyTag
at is C terminus. In addition, the erythroid cell expresses a Gatal
promoter-led gene that codes for SpyCatcher driving phenylalanine
hydroxylase (PAH) expression such that upon translation,
intracellular PAH is fused to SpyCatcher at its N terminus. Upon
expression of both fusion proteins the SpyTag bound beta globin is
linked through an isopeptide bond to the SpyCatcher bound PAH in
the intracellular space, allowing PAH to be anchored to beta globin
and retained during maturation. An erythroid cell comprising the
receiver polypeptide fusion is an example of a synthetic
membrane-receiver polypeptide complex that comprises a conjugated
receiver.
[0630] In another embodiment, the SpyTag polypeptide can be
expressed as a fusion to the receiver polypeptide within an
erythroid cell. The SpyCatcher polypeptide can be expressed as a
fusion to the C terminus (intracellular) of glycophorin A within
the same erythroid cell. Upon expression of both fusion
polypeptides, an isopeptide bond will be formed between the SpyTag
and SpyCatcher polypeptides, forming a covalent bond between the
membrane-anchored endogenous erythroid polypeptide and the receiver
molecule. An erythroid cell comprising the receiver polypeptide
fusion is an example of a synthetic membrane-receiver polypeptide
complex that comprises a conjugated receiver.
[0631] Other molecular fusions may be formed between polypeptides
and include direct or indirect conjugation. The polypeptides may be
directly conjugated to each other or indirectly through a linker.
The linker may be a peptide, a polymer, an aptamer, or a nucleic
acid. The polymer may be, e.g., natural, synthetic, linear, or
branched. Receiver polypeptides can comprise a heterologous fusion
protein that comprises a first polypeptide and a second polypeptide
with the fusion protein comprising the polypeptides directly joined
to each other or with intervening linker sequences and/or further
sequences at one or both ends. The conjugation to the linker may be
through covalent bonds or ionic bonds.
[0632] In certain embodiments, the polypeptide receiver is loaded
into the synthetic membrane-receiver polypeptide complex.
Non-polypeptide receivers may also be loaded within a synthetic
membrane-receiver complex. In some embodiments, synthetic
membrane-receiver complexes are generated by loading, e.g.,
erythroid cells or platelets with one or more receivers, such that
the one or more receivers are internalized within the erythroid
cells or platelets. Optionally, the erythroid cells or platelets
may additionally be loaded with a payload, such as, e.g., a
therapeutic agent.
[0633] A number of methods may be used to load, e.g., erythroid
cells or platelets with a receiver and optionally a payload (e.g.,
a therapeutic agent). Suitable methods include, for example,
hypotonic lysis, hypotonic dialysis, osmosis, osmotic pulsing,
osmotic shock, ionophoresis, electroporation, sonication,
microinjection, calcium precipitation, membrane intercalation,
lipid mediated transfection, detergent treatment, viral infection,
diffusion, receptor mediated endocytosis, use of protein
transduction domains, particle firing, membrane fusion,
freeze-thawing, mechanical disruption, and filtration. Any one such
method or a combination thereof may be used to generate the
synthetic membrane-receiver complexes described herein.
[0634] For hypotonic lysis, e.g., erythroid cell are exposed to low
ionic strength buffer causing them to burst. The receiver or the
payload (e.g., a therapeutic agent) distributes within the cells.
Erythroid cell, specifically red blood cells may be hypotonically
lysed by adding 30-50 fold volume excess of 5 mM phosphate buffer
(pH 8) to a pellet of isolated red blood cells. The resulting lysed
cell membranes are isolated by centrifugation. The pellet of lysed
red blood cell membranes is resuspended and incubated in the
presence of the receiver and/or therapeutic agent in a low ionic
strength buffer, e.g., for 30 min. Alternatively, the lysed red
blood cell membranes may be incubated with the receiver or the
payload (e.g., a therapeutic agent) for as little as one minute or
as long as several days, depending upon the best conditions
determined to efficiently load the erythroid cells.
[0635] Alternatively, erythroid cells, specifically red blood cells
may be loaded with a receiver and optionally a payload (e.g., a
therapeutic agent) using controlled dialysis against a hypotonic
solution to swell the cells and create pores in the cell membrane
(See, e.g., U.S. Pat. Nos. 4,327,710; 5,753,221; and 6,495,351).
For example, a pellet of isolated red blood cells is resuspended in
10 mM HEPES, 140 mM NaCl, 5 mM glucose pH 7.4 and dialyzed against
a low ionic strength buffer containing 10 mM NaH.sub.2PO.sub.4, 10
mM NaHCO.sub.3, 20 mM glucose, and 4 mM MgCl.sub.2, pH 7.4. After
30-60 mM, the red blood cells are further dialyzed against 16 mM
NaH.sub.2PO.sub.4, pH 7.4 solution containing the receiver or the
payload (e.g., a therapeutic agent) for an additional 30-60 mM All
of these procedures may be advantageously performed at a
temperature of 4.degree. C. In some instances, it may be beneficial
to load a large quantity of erythroid cells, specifically red blood
cells with a therapeutic agent by a dialysis approach and a
specific apparatus designed for this purpose may be used (See,
e.g., U.S. Pat. Nos. 4,327,710, 6,139,836 and 6,495,351 B2).
[0636] The loaded erythroid cells, specifically red blood cells can
be resealed by gentle heating in the presence of a physiological
solution such as, for example, 0.9% saline, phosphate buffered
saline, Ringer's solution, cell culture medium, blood plasma or
lymphatic fluid. For example, well-sealed membranes may be
generated by treating the disrupted erythroid cells, specifically
red blood cells for 1-2 mM in 150 mM salt solution of, for example,
100 mM phosphate (pH 8.0) and 150 mM sodium chloride at a
temperature of 60.degree. C. Alternatively, the cells may be
incubated at a temperature of 25-50.degree. C. for 30 min to 4 h
(See, e.g., U.S. Patent Application 2007/0243137 A1).
Alternatively, the disrupted red blood cells may be resealed by
incubation in 5 mM adenine, 100 mM inosine, 2 mM ATP, 100 mM
glucose, 100 mM Na-pyruvate, 4 mM MgCl2, 194 mM NaCl, 1.6 M KCl,
and 35 mM NaH2PO4, pH 7.4 at a temperature of 37.degree. C. for
20-30 mM (See, e.g., U.S. Pat. No. 5,753,221).
[0637] For electroporation, e.g., erythroid cells or platelets are
exposed to an electrical field which causes transient holes in the
cell membrane, allowing the receiver and optional payload (e.g.,
therapeutic agent) to diffuse into the cell (See, e.g., U.S. Pat.
No. 4,935,223). Erythroid cells, specifically red blood cells, for
example, are suspended in a physiological and electrically
conductive media such as platelet-free plasma to which the receiver
and optional payload (e.g., therapeutic agent) is added. The
mixture in a volume ranging from 0.2 to 1.0 ml is placed in an
electroporation cuvette and cooled on ice for 10 mM. The cuvette is
placed in an electroporation apparatus such as, for example, an ECM
830 (from BTX Instrument Division, Harvard Apparatus, Holliston,
Mass.). The cells are electroporated with a single pulse of
approximately 2.4 milliseconds in length and a field strength of
approximately 2.0 kV/cm. Alternatively, electroporation of
erythroid cells, specifically red blood cells may be carried out
using double pulses of 2.2 kV delivered at 0.25 .rho.F using a
Bio-Rad Gene Pulsar apparatus (Bio-Rad, Hercules, Calif., USA) to
achieve a loading capacity of over 60% (Flynn et al., Cancer Lett.
82:225-229 (1994)). The cuvette is returned to the ice bath for
10-60 min and then placed in a 37.degree. C. water bath to induce
resealing of the cell membrane. Any suitable electroporation method
may be used to generate the synthetic membrane-receiver complexes
described herein.
[0638] For sonication, erythroid cells are, for example, exposed to
high intensity sound waves, causing transient disruption of the
cell membrane allowing the receiver and optional payload (e.g.,
therapeutic agent) to diffuse into the cell. Any suitable
sonication method may be used to generate the synthetic
membrane-receiver complexes described herein.
[0639] For detergent treatment, erythroid cells, for example, are
treated with a mild detergent which transiently compromises the
cell membrane by creating holes through which the receiver and
optional payload (e.g., therapeutic agent) may diffuse. After cells
are loaded, the detergent is washed from the cells. For example,
the detergent may be saponin. Any suitable detergent treatment
method may be used to generate the synthetic membrane-receiver
complexes described herein.
[0640] For receptor mediated endocytosis, erythroid cells, for
example, may have a surface receptor which upon binding of the
receiver or payload (e.g., therapeutic agent) induces
internalization of the receptor and the associated receiver or
payload (e.g., therapeutic agent). Any suitable endocytosis method
may be used to generate the synthetic membrane-receiver complexes
described herein.
[0641] In some embodiments, the receiver and optional payload
(e.g., therapeutic agent) may be loaded, e.g., into an erythroid
cell or platelet by fusing or conjugating the receiver or payload
to proteins and/or polypeptides capable of crossing or
translocating the plasma membrane (See, e.g., U.S. Patent
Application 2002/0151004 A1). Examples of protein domains and
sequences that are capable of translocating a cell membrane
include, for example, sequences from the HIV-1-transactivating
protein (TAT), the Drosophila Antennapedia homeodomain protein, the
herpes simplex-1 virus VP22 protein, and transportin, a fusion
between the neuropeptide galanin and the wasp venom peptide
mastoparan. For example, a payload may be fused or conjugated to
all or part of the TAT peptide. A receiver fusion protein
containing all or part of the TAT peptide and/or a fusion protein
containing all or part of the TAT peptide and the payload (e.g., a
therapeutic agent, such as an antibody, enzyme, or peptide) may be
generated using standard recombinant DNA methods. Alternatively,
all or part of the TAT peptide (including receivers comprising all
or part of the TAT peptide) may be chemically coupled to a
functional group associated with the payload (e.g., therapeutic
agent) such as, for example, a hydroxyl, carboxyl or amino group.
In some instances, the link between the TAT peptide and the payload
may be pH sensitive such that once the conjugate or fusion has
entered the intracellular environment, the therapeutic agent is
separated from the TAT peptide.
[0642] In some embodiments, the synthetic membrane-receiver complex
is generated by contacting an erythroid cell with a receiver and
optionally a payload without lysing and resealing the cells to
incorporate the receiver and/or payload. In some embodiments, the
synthetic membrane-receiver complex is generated by contacting an
erythroid cell with a receiver and optionally a payload, wherein
contacting does not comprise hypotonic dialysis.
[0643] In some embodiments, the synthetic membrane-receiver complex
is generated by contacting an erythroid cell with a receiver and
optionally a payload, wherein contacting does not include loading
the receiver and/or payload into or onto the erythroid cell. In
some embodiments, the receiver is generated in an entity that is
not the erythroid cell to be contacted and/or the receiver is
isolated from a sample that does not comprise the erythroid cell to
be contacted. For example, for a polypeptide receiver suitable
entities include a cell line, an in vitro expression system, a
bacterial expression system, etc.
[0644] For mechanical firing, erythroid cells, for example, may be
bombarded with the receiver and optional payload (e.g., therapeutic
agent) attached to a heavy or charged particle such as, for
example, gold microcarriers and are mechanically or electrically
accelerated such that they traverse the cell membrane.
Microparticle bombardment may be achieved using, for example, the
Helios Gene Gun (from, e.g., Bio-Rad, Hercules, Calif., USA). Any
suitable microparticle bombardment method may be used to generate
the synthetic membrane-receiver complexes described herein.
[0645] In some embodiments, erythroid cells or platelets may be
loaded with a receiver and optional payload (e.g., therapeutic
agent) by fusion with a synthetic vesicle such as, for example, a
liposome. In this instance, the vesicles themselves are loaded with
the receiver and optional payload using one or more of the methods
described herein or known in the art. Alternatively, the receiver
and optional payload (e.g., therapeutic agent) may be loaded into
the vesicles during vesicle formation. The loaded vesicles are then
fused with the erythroid cells or platelets under conditions that
enhance cell fusion. Fusion of a liposome, for example, with a cell
may be facilitated using various inducing agents such as, for
example, proteins, peptides, polyethylene glycol (PEG), and viral
envelope proteins or by changes in medium conditions such as pH
(See, e.g., U.S. Pat. No. 5,677,176). Any suitable liposomal fusion
method may be used to generate the synthetic membrane-receiver
complexes described herein.
[0646] For filtration, erythroid cells or platelets and the
receiver and optional payload (e.g., therapeutic agent) may be
forced through a filter of pore size smaller than the cell causing
transient disruption of the cell membrane and allowing the receiver
and optional therapeutic agent to enter the cell. Any suitable
filtration method may be used to generate the synthetic
membrane-receiver complexes described herein.
[0647] For freeze thawing, erythroid cells are subjected to several
freeze thaw cycles, resulting in cell membrane disruption (See,
e.g., U.S. Patent Application 2007/0243137 A1). In this instance, a
pellet of packed red blood cells (0.1-1.0 ml) is mixed with an
equal volume (0.1-1.0 ml) of an isotonic solution (e.g., phosphate
buffered saline) containing the receiver and optional payload
(e.g., therapeutic agent). The red blood cells are frozen by
immersing the tube containing the cells and receiver and optional
payload into liquid nitrogen. Alternatively, the cells may be
frozen by placing the tube in a freezer at -20.degree. C. or
-80.degree. C. The cells are then thawed in, e.g., a 23.degree. C.
water bath and the cycle repeated if necessary to increase loading.
Any suitable freeze-thaw method may be used to generate the
synthetic membrane-receiver complexes described herein.
[0648] The receiver and optional payload (e.g., therapeutic agent)
may be loaded into a cell, e.g., an erythroid cell or platelet in a
solubilized form, e.g., solubilized in an appropriate buffer prior
to loading into erythroid cells or platelets.
[0649] Alternatively, the receiver and optional payload (e.g.,
therapeutic agent) may be loaded into a cell, e.g., an erythroid
cell or platelet in a particulate form as a solid microparticulate
(See, e.g., U.S. Patent Applications 2005/0276861 A1 and U.S.
2006/0270030 A1). In this instance, the receiver or payload may be
poorly water-soluble with a solubility of less than 1-10 mg/ml.
Microparticles of poorly water-soluble receivers or payloads can be
made of less than 10 .mu.m using a variety of techniques such as,
for example, energy addition techniques such as milling (e.g.,
pearl milling, ball milling, hammer milling, fluid energy milling,
jet milling), wet grinding, cavitation or shearing with a
microfluidizer, and sonication; precipitation techniques such as,
for example, microprecipitation, emulsion precipitation,
solvent-antisolvent precipitation, phase inversion precipitation,
pH shift precipitation, infusion precipitation, temperature shift
precipitation, solvent evaporation precipitation, reaction
precipitation, compressed fluid precipitation, protein microsphere
precipitation; and other techniques such as spraying into cryogenic
fluids (See, e.g., U.S. Patent Application 2005/0276861 A1). Water
soluble receivers or payloads may also be used to form solid
microparticles in the presence of various polymers such as, for
example, polylactate-polyglycolate copolymer (PLGA),
polycyanoacrylate, albumin, and/or starch (See, e.g., U.S. Patent
Application 2005/0276861 A1). Alternatively, a water soluble
receivers or payloads may be encapsulated in a vesicle to form a
microparticle. The microparticles composed of the receiver and
optional payload (e.g., therapeutic agent) may be incorporated into
a cell, such as an erythroid cell or platelet using the methods
described herein.
[0650] In specific embodiments, synthetic membrane-receiver
complexes are generated from erythrocytes. For example,
erythrocytes may be loaded with a receiver polypeptide or mRNA
encoding a receiver polypetide by controlled cell injury. The cell
injury can be caused by, for example, pressure induced by
mechanical strain or shear forces, subjecting the cell to
deformation, constriction, rapid stretching, rapid compression, or
pulse of high shear rate. The controlled cell injury leads to
uptake of material, e.g., a receiver and optionally a payload into
the cytoplasm of the cell from the surrounding cell medium. Any
suitable controlled injury method may be used to generate the
synthetic membrane-receiver complexes described herein.
[0651] Using controlled cell injury based on controlled cell
deformation (e.g., mechanical deformation of the cell as it passes
through the constriction) leads to uptake of material, e.g., a
receiver and optionally a payload by diffusion rather than
endocytosis. The material, e.g., a receiver and optionally a
payload is present in the cytoplasm rather than in endosomes
following cellular uptake upon the controlled injury thereby making
the material readily available to the cell. Controlled cell injury,
e.g., by controlled deformation, preserves cell viability (e.g.,
greater than 50%, 70%, or greater than 90%). In certain
embodiments, controlled cell injury, e.g., by controlled
deformation, preserves the state of cellular differentiation and
activity. If desired, a combination treatment is used, e.g.,
controlled injury by deformation followed by or preceded by, e.g.,
electroporation or another cell membrane permeability increasing
method. Optionally, surfactants may be used.
[0652] Mechanical deformation methods are particularly suitable for
cells that do not tolerate other membrane permeability increasing
methods well, e.g., show decreased viability or a different state
of differentiation after performing such methods. Mechanical
deformation methods are also suitable for material, e.g., a
receiver and optionally a payload that does not tolerate other
membrane permeability increasing methods well. Alternatively or in
addition, the receiver or payload may not be sufficiently
introduced into the cell using alternative methods, e.g., because
of e.g., charge, hydrophobicity, or size of the payload.
[0653] One exemplar method of controlled injury by deformation and
devices suitable for such methods is described, e.g., in PCT
Publication No. WO2013059343 INTRACELLULAR DELIVERY, incorporated
herein by reference.
[0654] In a specific embodiment, a population of reticulocytes is
provided that has been subjected to controlled cell injury by
controlled deformation to introduce a receiver, thereby generating
a synthetic membrane-receiver complex. The cells can, e.g., be
compressed and deformed by passage through a micro-channel having a
diameter less than that of an individual reticulocyte, thereby
causing perturbations in the cell membrane such that the membrane
becomes porous. Cells are moved, e.g., pushed, through the channels
or conduits by application of pressure. The compression and
deformation occurs in a delivery medium comprising, e.g., receiver
polypeptide or oligonucleotide (e.g., DNA, RNA, such as mRNA) and
optionally a payload. For example, the delivery medium may comprise
a receiver including but not limited to those listed in table 7 or
coding mRNA thereof. Upon deformation the reticulocyte takes up and
retains the exogenous material. Following controlled injury to the
cell by constriction, stretching, and/or a pulse of high shear
rate, the cells are optionally incubated in a delivery medium that
contains the material, e.g., a receiver and optionally a payload.
The cells may be maintained in the delivery medium for a few
minutes to recover, e.g., to close the injury caused by passing
through the constriction. This may occur at room temperature.
[0655] Controlled cell injury as used herein includes: i)
virus-mediated transfection (e.g., Herpes simplex virus, Adeno
virus, Adeno-associated virus, Vaccinia virus, or Sindbis virus),
ii) chemically-mediated transfection, e.g., cationic polymer,
calcium phosphate, cationic lipid, polymers, and nanoparticles,
such as cyclodextrin, liposomes, cationic liposomes, DEAE-dextran,
polyethyleneimine, dendrimer, polybrene, calcium phosphate,
lipofectin, DOTAP, lipofectamine, CTAB/DOPE, DOTMA; and iii)
physically-mediated transfection, including direct injection,
biolistic particle delivery, electroporation, laser-irradiation,
sonoporation, magnetic nanoparticles, and controlled deformation
(e.g., cell squeezing), as exemplified by micro-needle,
nano-needle, femtosyringe, atomic-force microscopy (AFM) tip, gene
gun (e.g., gold nanoparticles), Amaxa Nucleofector,
phototransfection (multi-photon laser), impalefection, and
magnetofection, and other suitable methods known in the art. Any
suitable method may be used to obtain a synthetic membrane-receiver
complex described herein comprising one or more DNA, RNA (e.g.,
mRNA encoding a receiver polypeptide), or receiver polypeptides and
optionally a payload (e.g., a therapeutic agent).
[0656] Polypeptide receivers can be detected on the synthetic
membrane-receiver complex. The presence of the receiver polypeptide
can be validated and quantified using standard molecular biology
methods, e.g., Western blotting or FACS analysis. Receiver
polypeptides present in the intracellular environment may be
quantified upon cell lysis or using fluorescent detection.
[0657] For example, a population of erythroid cells is loaded with
adenosine deaminase (ADA) using the Pro-Ject protein transfection
reagent kit to generate a synthetic membrane-ADA receiver complex.
The population of synthetic membrane-ADA receiver complexes is then
characterized for active enzyme loading using LCMS to quantify
adenosine and inosine.
[0658] Alternatively, the population of erythroid cells is
incubated in a solution of 10 mM, 100 mM, 500 mM chlorpromazine and
0.01, 0.1, 1.0, 10, 100 mg/ml of adenosine deaminase (ADA). The
population of synthetic membrane-ADA receiver complexes are then
washed and fluorescent imaging is used to quantify ADA loading.
[0659] In one embodiment, a population of erythrocytes is incubated
in a hypotonic salt solution containing a concentration of 0.01,
0.1, 1.0, 10 mg/ml of asparaginase to generate a synthetic
membrane-asparaginase receiver complex. The cell population is
incubated for 1 hr and then resealed by incubation in a hypertonic
solution for 10 mM. The population of synthetic
membrane-asparaginase receiver complexes is then incubated in an
asparagine solution for 1 hr and the asparagine and aspartate
concentrations are quantified using LCMS.
[0660] To generate a synthetic membrane-thymidine phosphorylase
receiver complex, a population of erythrocytes is incubated in a
PBS solution containing a concentration of 0.01, 0.1, 1.0, 10 mg/ml
of thymidine phosphorylase that has been fused via both the C and N
termini to one or more cell penetrating peptides, including;
Penetratin, Antenapedia, TAT, SynB1, SynB3, PTD-4, PTD-5, FHV
Coat-(35-49), BMV Gag-(7-25), HTLV-II Rex-(4-16), D-TAT, R9-Tat,
Transportan, MAP, SBP, FBP, MPG ac, MPG(NLS), Pep-1, Pep-2,
polyarginines, polylysines, (RAca)6R, (RAbu)6R, (RG)6R, (RM)6R,
R10, (RA)6R, R7. Following incubation, synthetic membrane-thymidine
phosphorylase receiver complexes are placed in a solution of
thymidine for 1 hr and samples are quantified for thymine and
thymidine content using LCMS.
[0661] Cells may be loaded using a microfluidic device that
transiently porates the cells, allowing a payload to enter when the
cells are pressured through the system. In one embodiment, a
population of erythrocytes is pressured through a system of
microfluidic channels in a buffer solution containing 0.01, 0.1,
1.0, 10 mg/ml of phenylalanine ammonia hydroxylase. The cell
suspension is then characterized for enzymatic activity using LCMS
to quantify phenylalanine and trans-cinnamic acid.
[0662] In one embodiment, a synthetic cell membrane-receiver
complexes are incubated in a hypotonic solution containing 1 mM of
adenosine deaminase for 1 hr. The synthetic membrane-receiver
complexes are then transferred to an isotonic solution and allowed
to equilibrate and seal in the soluble protein.
[0663] Payloads for Synthetic Membrane-Receiver Complexes
[0664] Synthetic membrane-receiver complexes may optionally be
loaded with payloads such as peptides, proteins, DNA, RNA, siRNA,
and other macromolecules and small therapeutic molecules. In some
embodiments, the payload is transferred to a cell, e.g., an
erythroid cell or platelet by applying controlled injury to the
cell for a predetermined amount of time in order to cause
perturbations in the cell membrane such that the payload can be
delivered to the inside of the cell (e.g., cytoplasm).
[0665] The payload may be a therapeutic agent selected from a
variety of known small molecule pharmaceuticals. Alternatively, the
payload may be may be a therapeutic agent selected from a variety
of macromolecules, such as, e.g., an inactivating peptide nuclei
acid (PNA), an RNA or DNA oligonucleotide aptamer, an interfering
RNA (iRNA), a peptide, or a protein.
[0666] In some embodiments, the synthetic membrane-receiver complex
is generated from a reticulocyte. For example, reticulocytes may be
loaded with an mRNA encoding for a therapeutic exogenous
polypeptide by controlled cell injury. The mRNA may be naked or
modified, as desired. mRNA modification that improve mRNA stability
and/or decrease immunogenicity include, e.g., ARCA: anti-reverse
cap analog (m.sub.2.sup.7,3'-OGP.sub.3G), GP.sub.3G (Unmethylated
Cap Analog), m.sup.7GP3G (Monomethylated Cap Analog),
m.sub.3.sup.2.2.7GP.sub.3G (Trimethylated Cap Analog), m5CTP
(5'-methyl-cytidine triphosphate), m6ATP
(N6-methyl-adenosine-5'-triphosphate), s2UTP (2-thio-uridine
triphosphate), and .PSI. (pseudouridine triphosphate).
[0667] Synthetic membrane-receiver complexes may comprise two or
more payloads, including mixtures, fusions, combinations and
conjugates, of atoms, molecules, etc. as disclosed herein, for
example including but not limited to, a nucleic acid combined with
a polypeptide; two or more polypeptides conjugated to each other; a
protein conjugated to a biologically active molecule (which may be
a small molecule such as a prodrug); and the like.
[0668] In some embodiments, the pharmaceutical composition
comprises one or more therapeutic agents and the synthetic
membrane-receiver complex described herein. In some embodiments,
the synthetic membrane-receiver complexes are co-administered with
of one or more separate therapeutic agents, wherein
co-administration includes administration of the separate
therapeutic agent before, after or concurrent with administration
of the synthetic membrane-receiver complex.
[0669] Suitable payloads include, without limitation,
pharmacologically active drugs and genetically active molecules,
including antineoplastic agents, anti-inflammatory agents, hormones
or hormone antagonists, ion channel modifiers, and neuroactive
agents. Examples of suitable payloads of therapeutic agents include
those described in, "The Pharmacological Basis of Therapeutics,"
Goodman and Gilman, McGraw-Hill, New York, N.Y., (1996), Ninth
edition, under the sections: Drugs Acting at Synaptic and
Neuroeffector Junctional Sites; Drugs Acting on the Central Nervous
System; Autacoids: Drug Therapy of Inflammation; Water, Salts and
Ions; Drugs Affecting Renal Function and Electrolyte Metabolism;
Cardiovascular Drugs; Drugs Affecting Gastrointestinal Function;
Drugs Affecting Uterine Motility; Chemotherapy of Parasitic
Infections; Chemotherapy of Microbial Diseases; Chemotherapy of
Neoplastic Diseases; Drugs Used for Immunosuppression; Drugs Acting
on Blood-Forming organs; Hormones and Hormone Antagonists;
Vitamins, Dermatology; and Toxicology, all incorporated herein by
reference. Suitable payloads further include toxins, and biological
and chemical warfare agents, for example see Somani, S. M. (ed.),
Chemical Warfare Agents, Academic Press, New York (1992)).
[0670] In some embodiments, the synthetic membrane-receiver complex
does not comprise a payload comprising a synthetic
triphosphorylated nucleoside analog. In some embodiments, the
synthetic membrane-receiver complex does not comprise a payload
comprising 2',3'-dideoxycytidine-5'-triphosphate (ddCTP) and/or
3'-azido-3'-deoxythymidine-5'-triphosphate (AZT-TP).
[0671] In some embodiments, the synthetic membrane-receiver complex
does not comprise a payload comprising a bisphosphonate.
[0672] In some embodiments, the payload is a therapeutic agent,
such as a small molecule drug or a large molecule biologic. Large
molecule biologics include, but are not limited to, a protein,
polypeptide, or peptide, including, but not limited to, a
structural protein, an enzyme, a cytokine (such as an interferon
and/or an interleukin), a polyclonal or monoclonal antibody, or an
effective part thereof, such as an Fv fragment, which antibody or
part thereof, may be natural, synthetic or humanized, a peptide
hormone, a receptor, or a signaling molecule.
[0673] Large molecule biologics are immunoglobulins, antibodies, Fv
fragments, etc., that are capable of binding to antigens in an
intracellular environment. These types of molecules are known as
"intrabodies" or "intracellular antibodies." An "intracellular
antibody" or an "intrabody" includes an antibody that is capable of
binding to its target or cognate antigen within the environment of
a cell, or in an environment that mimics an environment within the
cell. Selection methods for directly identifying such "intrabodies"
include the use of an in vivo two-hybrid system for selecting
antibodies with the ability to bind to antigens inside mammalian
cells. Such methods are described in PCT/GB00/00876, incorporated
herein by reference. Techniques for producing intracellular
antibodies, such as anti-.beta.-galactosidase scFvs, have also been
described in Martineau et al., J Mol Biol 280:117-127 (1998) and
Visintin et al., Proc. Natl. Acad. Sci. USA 96:11723-1728
(1999).
[0674] Large molecule biologics include but is not limited to, at
least one of a protein, a polypeptide, a peptide, a nucleic acid, a
virus, a virus-like particle, an amino acid, an amino acid
analogue, a modified amino acid, a modified amino acid analogue, a
steroid, a proteoglycan, a lipid and a carbohydrate or a
combination thereof (e.g., chromosomal material comprising both
protein and DNA components or a pair or set of effectors, wherein
one or more convert another to active form, for example
catalytically).
[0675] A Large molecule biologic may include a nucleic acid,
including, but not limited to, an oligonucleotide or modified
oligonucleotide, an antisense oligonucleotide or modified antisense
oligonucleotide, an aptamer, a cDNA, genomic DNA, an artificial or
natural chromosome (e.g., a yeast artificial chromosome) or a part
thereof, RNA, including an siRNA, a shRNA, mRNA, tRNA, rRNA or a
ribozyme, or a peptide nucleic acid (PNA); a virus or virus-like
particles; a nucleotide or ribonucleotide or synthetic analogue
thereof, which may be modified or unmodified.
[0676] The large molecule biologic can also be an amino acid or
analogue thereof, which may be modified or unmodified or a
non-peptide (e.g., steroid) hormone; a proteoglycan; a lipid; or a
carbohydrate. If the large molecule biologic is a polypeptide, it
can be loaded directly into, e.g., an erythroid cell or a platelet
according to the methods described herein. Alternatively, an
exogenous nucleic acid encoding a polypeptide, which sequence is
operatively linked to transcriptional and translational regulatory
elements active in a cell at a target site, may be loaded.
[0677] Small molecules, including inorganic and organic chemicals,
may also be used as payloads of the synthetic membrane-receiver
complexes described herein.
[0678] In some embodiments, the small molecule is a
pharmaceutically active agent. Useful classes of pharmaceutically
active agents include, but are not limited to, antibiotics,
anti-inflammatory drugs, angiogenic or vasoactive agents, growth
factors and chemotherapeutic (anti-neoplastic) agents (e.g., tumour
suppressers).
[0679] If a prodrug is loaded into the synthetic membrane-receiver
complex in an inactive form it is often useful that the synthetic
membrane-receiver complex further comprises a receiver such as an
activating polypeptide which converts the inactive prodrug to
active drug form. In an embodiment, activating receiver
polypeptides include, but are not limited to, viral thymidine
kinase (encoded by Genbank Accession No. J02224), carboxypeptidase
A (encoded by Genbank Accession No. M27717), .alpha.-galactosidase
(encoded by Genbank Accession No. M13571), .beta.-gluucuronidase
(encoded by Genbank Accession No. M15182), alkaline phosphatase
(encoded by Genbank Accession No. J03252 J03512), or cytochrome
P-450 (encoded by Genbank Accession No. D00003 N00003), plasmin,
carboxypeptidase G2, cytosine deaminase, glucose oxidase, xanthine
oxidase, .beta.-glucosidase, azoreductase, t-gutamyl transferase,
.beta.-lactamase, and penicillin amidase.
[0680] Either the receiver polypeptide or the exogenous gene
encoding it may be loaded into, e.g., an erythroid cell or
platelet, to generate a synthetic membrane-receiver complex. Both
the prodrug and the activating receiver polypeptide may be encoded
by genes on the same exogenous nucleic acid. Furthermore, either
the prodrug or the the activating receiver polypeptide of the
prodrug may be transgenically expressed in a synthetic
membrane-receiver complex.
[0681] The synthetic membrane-receiver complexes may also be
labeled with one or more positive markers that can be used to
monitor over time the number or concentration of synthetic
membrane-receiver complexes in the blood circulation of an
individual. The overall number of synthetic membrane-receiver
complexes will decay over time following initial transfusion. In
some embodiments, the signal from one or more positive markers are
correlated with that of an activated molecular marker, generating a
proportionality of signal that is independent of the number of
synthetic membrane-receiver complexes remaining in the circulation.
Suitable fluorescent compounds include those that are approved by
the Food & Drug Administration for human use including but not
limited to fluorescein, indocyanin green, and rhodamine B. For
example, synthetic membrane-receiver complexes may be
non-specifically labeled with fluorescein isothiocyanate (FITC;
Bratosin et al., Cytometry 46:351-356 (2001)). For example, a
solution of FITC-labeled lectins in phosphate buffered saline (PBS)
with 0.2 mM phenylmethysulfonyl fluoride (PMSF) is added to an
equal volume of isolated erythroid cells or platelets in the same
buffer. The cells are incubated with the FITC-labeled lectins for 1
h at 4.degree. C. in the dark. The lectins bind to sialic acids and
beta-galactosyl residues on the surface of the erythroid cells.
[0682] Other dyes may be useful for tracking synthetic
membrane-receiver complexes in human and non-human circulation. A
number of reagents may be used to non-specifically label a
synthetic membrane-receiver complex. For example, erythroid cells
or platelets may be labeled with PKH26 Red (See, e.g., Bratosin, et
al., (1997) Cytometry 30:269-274). Erythroid cells or platelets
(1-3.times.10.sup.7 cells) are suspended in 1 ml of diluent and
rapidly added to 1 ml or 2 .mu.M PKH26 dissolved in the same
diluent. The mixture is mixed by gentle pipetting and incubated at
25.degree. C. for 2-5 min with constant stirring. The labeling may
be stopped by adding an equal volume of human serum or compatible
protein solution (e.g., 1% bovine serum albumin). After an
additional minute, an equal volume of cell culture medium is added
and the cells are isolated by centrifugation at 2000.times.g for 5
min Cells are washed three times by repeated suspension in cell
culture medium and centrifugation. PHK26-labeled synthetic
membrane-receiver complexes may be monitored with a maximum
excitation wavelength of 551 nm and a maximum emission wavelength
of 567 nm.
[0683] Synthetic membrane-receiver complexes may be tracked in vivo
using VivoTag 680 (VT680; VisEn Medical, Woburn, Mass., USA), a
near-infrared fluorochrome with a peak excitation wavelength of
670.+-.5 nm and a peak emission wavelength of 688.+-.5 nm. VT680
also contains an amine reactive NHS ester which enables it to
cross-link with proteins and peptides. The surface of cells, e.g.,
erythroid cells or platelets may be labeled with VT680 (See, e.g.,
Swirski, et al., (2007) PloS ONE 10:e1075). For example,
4.times.10.sup.6 cells/ml are incubated with VT680 diluted in
complete culture medium at a final concentration of 0.3 to 300
.mu.g/ml for 30 min at 37.degree. C. The cells are washed twice
with complete culture medium after labeling. Cells may be
non-specifically labeled based on proteins expressed on the surface
of the synthetic membrane-receiver complex. Alternatively, a
specific protein, such as a receiver may be labeled with VT680. In
some embodiments, a protein or peptide may be directly labeled with
VT680 ex vivo and subsequently either attached to the surface of
the cell or incorporated into the interior of the cell using
methods described herein. In vivo monitoring may, for example, be
performed using the dorsal skin fold. Laser scanning microscopy may
be performed using, for example, an Olympus IV 100 in which VT680
is excited with a red laser diode of 637 nm and detected with a
660/LP filter. Alternatively, multiphoton microscopy may be
performed using, for example, a BioRad Radiance 2100 MP centered
around an Olympus BX51 equipped with a 20.times./0.95 NA objective
lens and a pulsed Ti:Sapphire laser tuned to 820 nm. The latter
wavelength is chosen because VT680 has a peak in its two-photon
cross-section at 820 nm.
[0684] Alternatively or in addition, a synthetic membrane-receiver
complex may be labeled with other red and/or near-infrared dyes
including, for example, cyanine dyes such as Cy5, Cy5.5, and Cy7
(Amersham Biosciences, Piscataway, N.J., USA) and/or a variety of
Alexa Fluor dyes including Alexa Fluor 633, Alexa Fluor 635, Alexa
Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700 and
Alexa Fluor 750 (Molecular Probes-Invitrogen, Carlsbad, Calif.,
USA). Additional suitable fluorophores include IRD41 and IRD700
(LI-COR, Lincoln, Nebr., USA), NIR-1 and 1C5-OSu (Dejindo,
Kumamotot, Japan), LaJolla Blue (Diatron, Miami, Fla., USA),
FAR-Blue, FAR-Green One, and FAR-Green Two (Innosense, Giacosa,
Italy), ADS 790-NS and ADS 821-NS (American Dye Source, Montreal,
Calif.). Quantum dots (Qdots) of various emission/excitation
properties may also be used for labeling synthetic
membrane-receiver complexes (See, e.g., Jaiswal et al., Nature
Biotech. 21:47-51 (2003)). Many of these fluorophores are available
from commercial sources either attached to primary or secondary
antibodies or as amine-reactive succinimidyl or monosuccinimidyl
esters, for example, ready for conjugation to a protein or proteins
either on the surface or inside the synthetic membrane-receiver
complex.
[0685] Magnetic nanoparticles may be used to track synthetic
membrane-receiver complexes in vivo using high resolution MRI
(Montet-Abou et al., Molecular Imaging 4:165-171 (2005)). Magnetic
particles may be internalized by several mechanisms. Magnetic
particles may be taken up by a cell, e.g., an erythroid cell or a
platelet through fluid-phase pinocytosis or phagocytosis.
Alternatively, the magnetic particles may be modified to contain a
surface agent such as, for example, a membrane translocating HIV
TAT peptide which promotes internalization. In some instances, a
magnetic nanoparticle such as, for example, Feridex IV.RTM., an FDA
approved magnetic resonance contrast reagent, may be internalized
into, e.g., erythroid cells or platelets in conjunction with a
transfection agent such as, for example, protamine sulfate (PRO),
polylysine (PLL), and lipofectamine (LFA).
[0686] In some embodiments, the synthetic membrane-receiver
polypeptide complexes are generated comprising contacting an
erythroid cell with a receiver, such as a polypeptide. In some
embodiments, the receiver polypeptide is encoded by an exogenous
nucleic acid and is expressed by the erythroid cell. In some
embodiments, a naturally occurring erythroid cell does not comprise
the receiver. For example, a naturally occurring erythroid cell
does not express an endogenous polypeptide that is structurally and
functionally the same as the receiver polypeptide. In some
embodiments, the erythroid cell comprises a receiver that is
over-expressed. For example, the receiver is present in
substantially higher copy numbers than it would be if it were
endogenously expressed by a naturally occurring erythroid cell. In
some embodiments, the synthetic membrane-receiver polypeptide
complexes are generated by differentiating and maturing the
erythroid cells in vitro or in vivo after contacting the cells with
a receiver. It is known in the art that erythrocytes undergo a
complex process of maturation as they differentiate from precursor
cells. The maturation process includes a substantial cytoskeleton
and membrane rearrangement and degradation or expulsion of
non-essential polypeptides, see e.g., Liu J et al. (2010) Blood
115(10):2021-2027; and Lodish H F et al. (1975) Developmental
Biology 47(1):59). For naturally occurring erythrocytes this
maturation process happens in vivo, first in the bone marrow and
then in circulation as reticulocytes mature into erythrocytes. For
cultured erythrocytes this maturation process happens both ex vivo,
in culture, and in vivo in circulation as cultured reticulocytes
mature into eyrthrocytes (see e.g., Neildez-Nguyen et al. 2002
Nature Biotechnol 20:467). In some embodiments, the synthetic
membrane-receiver polypeptide complexes generated from erythroid
cells retain their receivers during the maturation process, in
vitro or in vivo and the receivers are not lost. In some
embodiments, the synthetic membrane-receiver polypeptide complexes
generated from erythroid cells retain their receivers after
maturation. In some embodiments, fully matured synthetic
membrane-receiver polypeptide complexes generated from erythroid
cells retain their receiver. The receiver may be retained in vitro,
e.g., in culture and/or may be retained in vivo, e.g., after
administration to the circulatory system of the subject. In some
embodiments, the receiver may be retained by the synthetic
membrane-receiver polypeptide complexes for the life of the complex
in circulation. These findings are surprising in view of the art
which suggested that receivers would be excluded from the erythroid
cells during the maturation process. It was further unexpected that
receivers would be retained and functionally active when the
synthetic membrane-receiver polypeptide complexes generated from
erythroid cells are administered to the circulatory system of a
subject. In some embodiments culturing of eythroid cells comprising
a receiver provides a method of producing a substantially more
homogeneous and/or substantially more scalable population of
therapeutic synthetic membrane-receiver complexes than is
achievable by methods relying upon isolation and modification of
non-cultured erythrocytes. Despite a great need for human erythroid
cell-based treatment and preventive methods and recognition for its
value in the art, no systems derived from modified cultured cells
have previously been generated or shown to retain receiver activity
in circulation, and the art suggested that such systems would not
be achievable. When cultured human erythrocytes have been
experimentally administered to a human subject previously they were
unmodified (Giarratana et al., Blood 2011, 118:5071).
Targets
[0687] Provided herein are synthetic membrane-receiver polypeptide
complexes comprising a receiver polypeptide capable of interacting
with a target. Further provided herein are synthetic
membrane-receiver complexes comprising a non-polypeptide receiver
capable of interacting with a target. The synthetic
membrane-receiver complexes may be administered to a subject in
need thereof to modulate the amount or concentration of a target
residing in the circulatory system of the subject. A suitable
receiver may be chosen to interact with a specific target. Suitable
targets include entities that are associated with a specific
disease, disorder, or condition. However, targets may also be
chosen independent of a specific disease, disorder, or
condition.
[0688] In some embodiments, the target is an antibody or
antibody-like molecule, for example an autoimmune or a
self-antibody, or a foreign antibody, or a therapeutic antibody,
including but not limited to, e.g., an antibody against beta-2
glycoprotein 1, an antibody against I/i antigen, an antibody
against the NC1 domain of collagen .alpha.3(IV), an antibody
against platelet glycoprotein, an antibody against phospholipase A2
receptor, an antibody against erythrocyte glycophorin A, B, or C,
or an antibody against erythrocyte Rh antigen.
[0689] In some embodiments, the target is a molecule of the
complement cascade, for example C1, C1r, C1s, C1q, C2, C2a, C2b,
C3, C3a, C3b, C4, C4b, C4a, C3bBb, C3bBb3b, C4b2b, C4b2b3b, C5,
CSa, C5b, C6, C7, C8, C9, poly-C9, membrane attack complex. Factor
B, Factor D, Properdin, C3, C3a, C3b, iC3b, C3c, C3dg, C3dk, C3e,
Bb, Factor I, C1q, Clr, C1s, C4, C4a, C4b, C2, C4 bp,
Mannose-Binding Lectin (MBL), MBL-Associated Serine Protease 1
(MASP1), MBL-Associated Serine Protease 2 (MASP2), C5, CSa, C6, C7,
C8, C9, CR1, CR2, CR3, CR4, C3aR, C3eR, Decay-accelerating factor
(DAF), Membrane cofactor protein (MCP), CD59, C3 Beta chain
Receptor, C1 inhibitor, C4 binding protein, Factor I, Factor H.
[0690] In some embodiments, the target is an immune complex, for
example an IgG immune complex, an IgA immune complex, an IgM immune
complex.
[0691] In some embodiments,the target is an amyloid placque, for
example a placque comprised of beta amyloid, IAPP (Amylin),
alpha-synuclein, PrPSc, huntingtin, calcitonin, atrial natriuretic
factor, apolipoprotein AI, serum amyloid A, medin, prolactin,
transthyretin, lysozyme, beta 2 microglobulin, gelsolin,
keratoepithelin, cystatin, immunoglobulin light chain AL,
S-IBM.
[0692] In some embodiments, the target is a bacterium, for example
Enterococcus, Streptococcus, or Mycobacteria, Rickettsia,
Mycoplasma, Neisseria meningitides, Neisseria gonorrheoeae,
Legionella, Vibrio cholerae, Streptococci, Staphylococcus aureus,
Staphylococcus epidermidis, Pseudomonas aeruginosa, Corynobacteria
diphtheriae, Clostridium spp., enterotoxigenic Eschericia coli, and
Bacillus anthracis. Other pathogens for which bacteremia has been
reported at some level include the following: Rickettsia,
Bartonella henselae, Bartonella quintana, Coxiella burnetii,
chlamydia, Mycobacterium leprae, Salmonella; shigella; Yersinia
enterocolitica; Yersinia pseudotuberculosis; Legionella
pneumophila; Mycobacterium tuberculosis; Listeria monocytogenes;
Mycoplasma spp.; Pseudomonas fluorescens; Vibrio cholerae;
Haemophilus influenzae; Bacillus anthracis; Treponema pallidum;
Leptospira; Borrelia; Corynebacterium diphtheriae; Francisella;
Brucella melitensis; Campylobacter jejuni; Enterobacter; Proteus
mirabilis; Proteus; and Klebsiella pneumoniae.
[0693] In some embodiments, the target is a virus, including but
limited to, those whose infection involves injection of genetic
materials into host cells upon binding to cell surface receptors,
viruses whose infection is mediated by cell surface receptors.
Non-limiting examples of these viruses can be selected from
Paramyxoviridae (e.g., pneumovirus, morbillivirus, metapneumovirus,
respirovirus or rubulavirus), Adenoviridae (e.g., adenovirus),
Arenaviridae (e.g., arenavirus such as lymphocytic choriomeningitis
virus), Arteriviridae (e.g., porcine respiratory and reproductive
syndrome virus or equine arteritis virus), Bunyaviridae (e.g.,
phlebovirus or hantavirus), Caliciviridae (e.g., Norwalk virus),
Coronaviridae (e.g., coronavirus or torovirus), Filoviridae (e.g.,
Ebola-like viruses), Flaviviridae (e.g., hepacivirus or
flavivirus), Herpesviridae (e.g., simplexvirus, varicellovirus,
cytomegalovirus, roseolovirus, or lymphocryptovirus),
Orthomyxoviridae (e.g., influenza virus or thogotovirus),
Parvoviridae (e.g., parvovirus), Picomaviridae (e.g., enterovirus
or hepatovirus), Poxviridae (e.g., orthopoxvirus, avipoxvirus, or
leporipoxvirus), Retroviridae (e.g., lentivirus or spumavirus),
Reoviridae (e.g., rotavirus), Rhabdoviridae (e.g., lyssavirus,
novirhabdovirus, or vesiculovirus), and Togaviridae (e.g.,
alphavirus or rubivirus). Specific examples of these viruses
include human respiratory coronavirus, influenza viruses A-C,
hepatitis viruses A to G, and herpes simplex viruses 1-9.
[0694] In some embodiments, the target is a parasite, including but
not limited to, for example, intestinal or blood-borne parasites,
protozoa, trypanosomes; haemoprotozoa and parasites capable of
causing malaria; enteric and systemic cestodes including taeniid
cestodes; enteric coccidians; enteric flagellate protozoa; filarial
nematodes; gastrointestinal and systemic nematodes and
hookworms.
[0695] In some embodiments, the target is a fungus, including but
not limited to, for example, Candida albicans, Candida glabrata,
Aspergillus, T. glabrata, Candida tropicalis, C. krusei, and C.
parapsilosis.
[0696] In some embodiments, the target is a bacterial toxin,
including but not limited to, for example, AB toxin, alpha toxin,
anthrax toxin, bacteriocin, botunlinum toxin, cholesterol-dependent
cytolysin, Clostridium botulinum C3 toxin, Clostridium difficile
toxin A, Clostridium difficile toxin B, Clostridium enterotoxin,
Clostridium perfringens alpha toxin, Clostridium perfringens beta
toxin, Cord factor, CrylAc, Cryptophycin, Delta endotoxin,
Diphtheria toxin, Enterotoxin type B, erythrogenic toxin,
exfoliatin, haemolysin E, heat-labile enterotoxin, heat-stable
enterotoxin, hemolysin, leukocidin, lipopolysaccharide,
Listeriolysin 0, microcin, Panton-Valentine leucocidin,
pathogenicity island, phenol-soluble modulin, pneumolysin,
pore-forming toxin, Pseudomonas exotoxin, RTX toxin, sakacin,
Staphylococcus aureus alpha toxin, Staphylococcus aureus beta
toxin, Staphylococcus aureus delta toxin, Streptolysin,
Symplocamide A, tabtoxin, tetanolysin, tetanospasmin,
thiol-activated cytolysin, tolaasin, toxic shock syndrome toxin,
toxoflavin, trehalose dimycolate, verocytotoxin, and vibriocin.
[0697] In some embodiments, the target is a prion protein,
including but not limited to, for example, PRP, PRPc, PRPsc,
PRPres.
[0698] In some embodiments, the target is a cytokine or a chemokine
or a growth factor, including but not limited to, for example,
acylation stimulating protein, adipokine, albinterferon, CCL1,
CCL11, CCL12, CCL13, CCL14, CCL15, CCL16, CCL17, CCL18, CCL19,
CCL2, CCL20, CCL21, CCL22, CCL23, CCL24, CCL25, CCL26, CCL27,
CCL28, CCL3, CCL5, CCL6, CCL7, CCL8, CCL9, colony-stimulating
factor, CX3CL1, CX3CR1, CXCL1, CXCL10, CXCL11, CXCL13, CXCL14,
CXCL15, CXCL16, CXCL17, CXCL2, CXCL3, CXCL5, CXCL6, CXCL7, CXCL9,
erythropoietin, Gc-MAF, granulocyte colony-stimulating factor,
granulocyte macrophage colony-stimulating factor, hepatocyte growth
factor, IL 10 family, IL 17 family, IL1A, IL1B, interferon,
interferon beta 1a, interferon beta 1b, interferon gamma,
interferon type I, interferon type II, interferon type III,
interleukin, interleukin 1 family, interleukin 1 receptor
antagonist, interleukin 10, interleukin 12, interleukin 12 subunit
beta, interleukin 13, interleukin 16, interleukin 2, interleukin
23, interleukin 23 subunit alpha, interleukin 34, interleukin 35,
interleukin 6, interleukin 7, interleukin 8, interleukin-36,
leukemia inhibitory factor, leukocyte-promoting factor, lymphokine,
lymphotoxin, lymphotoxin alpha, lymphotoxin beta, macrophage
colony-stimulating factor, macrophage inflammatory protein,
macrophage-activating factor, monokine, myokine, myonectin,
nicotinamide phosphoribosyltransferase, oncostatin M, oprelvekin,
platelet factor 4, proinflammatory cytokine, promegapoietin, RANKL,
stromal cell-derived factor 1, talimogene laherparepvec, tumor
necrosis factor alpha, tumor necrosis factors, XCL1, XCL2, XCR1,
angiopoietin, basic fibroblast growth factor, betacellulin, bone
morphogenetic protein, brain-derived neurotrophic factor, CCN
intercellular signaling protein, CTGF, darbepoetin alfa, endoglin,
epidermal growth factor, epoetin alfa, epoetin beta,
erythropoietin, FGF15, FGF15/19, fibroblast growth factor,
fibroblast growth factor 23, filgrastim, GLIA maturation factor,
granulocyte colony-stimulating factor, granulocyte macrophage
colony-stimulating factor, growth differentiation factor-9,
heberprot-P, hemopoietic growth factors, heparin-binding EGF-like
growth factor, hepatocyte growth factor, insulin-like growth
factor, insulin-like growth factor 1, insulin-like growth factor 2,
keratinocyte growth factor, myostatin, nerve growth factor,
neurotrophin-3, neurotrophin-4, oncomodulin, osteopromotive,
palifermin, PDGFB, placental growth factor, platelet alpha-granule,
platelet-derived growth factor, platelet-derived growth factor
receptor, proliferative index, thrombopoietin, transforming growth
factor, vascular endothelial growth factor.
[0699] In some embodiments, the target is a small molecule, for
example a chemical, an amino acid, an atom, an element, an organic
acid, <2000 Da, <1000 Da, <500 Da, including but not
limited to, for example, iron, copper, calcium, potassium, ethanol,
methanol, glycine, alanine, valine, leucine, isoleucine, serine,
cysteine, selenocysteine, threonine, methionine, proline,
phenylalanine, tyrosine, tryptophan, histidine, lysine, arginine,
aspartate, glutamate, asparagine, glutamine
[0700] In some embodiments, the target is a lipid, lipid complex,
proteolipid complex, or cholesterol, including but not limited to
for example, LDL, VLDL, HDL, HDL2B, triglycerides, LP(a),
cholesterol.
[0701] In some embodiments, the target is a mammalian cell,
including but not limited to, for example, a human cell, a
circulating cell, an immune cell, a neutrophil, an eosinophil, a
basophil, a lymphocyte, a monocyte, a B cell, a T cell, a CD4+ T
cell, a CD8+ T cell, a gamma-delta T cell, a regulatory T cell, a
natural killer cell, a natural killer T cell, a macrophage, a
Kupffer cell, a dendritic cell, a cancer cell, a cancer stem cell,
a circulating tumor cell, a cancer cell from one of the following
cancers including, but not limited to, ACUTE lymphoblastic
leukaemia (ALL), ACUTE myeloid leukaemia (AML), anal cancer, bile
duct cancer, bladder cancer, bone cancer, bowel cancer, brain
tumours, breast cancer, cancer of unknown primary, cancer spread to
bone, cancer spread to brain, cancer spread to liver, cancer spread
to lung, carcinoid, cervical cancer, choriocarcinoma, chronic
lymphocytic leukaemia (CLL), chronic myeloid leukaemia (CML), colon
cancer, colorectal cancer, endometrial cancer, eye cancer,
gallbladder cancer, gastric cancer, gestational trophoblastic
tumours (GTT), hairy cell leukaemia, head and neck cancer, hodgkin
lymphoma, kidney cancer, laryngeal cancer, leukaemia, liver cancer,
lung cancer, lymphoma, melanoma skin cancer, mesothelioma, men's
cancer, molar pregnancy, mouth and oropharyngeal cancer, myeloma,
nasal and sinus cancers, nasopharyngeal cancer, non hodgkin
lymphoma (NHL), oesophageal cancer, ovarian cancer, pancreatic
cancer, penile cancer, prostate cancer, rare cancers, rectal
cancer, salivary gland cancer, secondary cancers, skin cancer (non
melanoma), soft tissue sarcoma, stomach cancer, testicular cancer,
thyroid cancer, unknown primary cancer, uterine cancer, vaginal
cancer, and vulval cancer.
Sourcing
[0702] Synthetic membrane-receiver complexes can be generated by
any method described herein. In some embodiments, the steps
comprise contacting isolated optionally cultured cells derived from
hematopoietic stem cells with a receiver. Hematopoietic stem cells
give rise to all of the blood cell types found in mammalian blood
including myeloid (monocytes and macrophages, neutorphils,
basophils, eosinophils, erythrocytes, megakaryocytes/platelets,
dendritic cells) and lymphoid lineages (T-cells, B-cells,
NK-cells). Hematopoietic stem cells may be isolated from the bone
marrow of adult bones including, for example, femur, hip, rib, or
sternum bones. Cells may be obtained directly from the hip, for
example, by removal of cells from the bone marrow using aspiration
with a needle and syringe. Alternatively, hematopoietic stem cells
may be isolated from normal peripheral blood following
pre-treatment with cytokines such as, for example, granulocyte
colony stimulating factor (G-CSF). G-CSF mobilizes the release of
cells from the bone marrow compartment into the peripheral
circulation. Other sources of hematopoietic stem cells include
umbilical cord blood and placenta.
[0703] In some embodiments, the synthetic membrane-receiver complex
is generated from megakaryocytes or platelets. In some embodiments,
the synthetic membrane-receiver complex is generated from an
erythroid cell, such as, e.g. an erythrocyte or a reticulocyte. In
some embodiments, the synthetic membrane-receiver complex is not
generated from a neutrophil, an eosinophil, or a basophil. In some
embodiments, the synthetic membrane-receiver complex is not
generated from a monocyte or a macrophage.
[0704] In some embodiments, the synthetic membrane-receiver complex
is not generated from a CD34.sup.+Thy-1.sup.+ hematopoietic stem
cell or cell populations enriched in CD34.sup.+Lin.sup.- or
CD34.sup.+Thy-1.sup.+Lin.sup.- cells.
[0705] In some embodiments, the synthetic membrane-receiver complex
is not generated from or does not comprise an autologous CD34+
cell.
[0706] Isolated hematopoietic stem cells may be cultured, expanded
and differentiated ex vivo to provide a variety of source material
to generate synthetic membrane-receiver complexes. For example,
hematopoietic stem cells isolated from bone marrow,
cytokine-stimulated peripheral blood or umbilical cord blood may be
expanded and differentiated ex vivo into mature erythrocytes
(Giarratana et al., Nature Biotech. 23:69-74 (2005); U.S. Patent
Application 2007/0218552). As such, CD34+ cells are isolated from
bone marrow or peripheral or cord blood using, for example,
magnetic microbead selection and Mini-MACS columns (Miltenyi
Biotech). In one example, the cells are subsequently cultured in
modified serum-free medium supplemented with 1% bovine serum
albumin (BSA), 120 .mu.g/ml iron-saturated human transferrin, 900
ng/ml ferrous sulfate, 90 ng/ml ferric nitrate and 10 .mu.g/ml
insulin and maintained at 37.degree. C. in 5% carbon dioxide in
air. Expansion and differentiation of the cell culture may occur in
multiple steps. For example, in the initial growth step following
isolation, the cells may be expanded in the medium described herein
in the presence of multiple growth factors including, for example,
hydrocortisone, stem cell factor, IL-3, and erythropoietin. In the
second stage, the cells may optionally be co-cultured, for example,
on an adherent stromal layer in the presence of erythropoietin. In
a third stage, the cells may be cultured on an adherent stromal
layer in culture medium in the absence of exogenous factors. The
adherent stromal layer may be murine MS-5 stromal cells, for
example. Alternatively, the adherent stromal layer may be
mesenchymal stromal cells derived from adult bone marrow. The
adherent stromal cells may be maintained in RPMI supplemented with
10% fetal calf serum, for example. In some embodiments, the
erythroid precursor cells and cell populations derived therefrom
are not co-cultured with non-erythroid cells, e.g., with an
adherent stromal layer, i.e. they are cultured in the absence of
non-erythroid cells. In some embodiments, erythroid cells
comprising a receiver are cultured in the absence of non-erythroid
cells and are differentiated so that greater than 10%, 15%, 20%,
25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, 95% or greater than 98% of erythroid cells are enucleated and
the population of enucleated cells is obtained without an
enrichment step, such as gravitational separation, magnetic or
fluorescent sorting, irradiation, poisoning of nucleated cells, and
the like to select for enucleated cells.
[0707] In some instances, it may be desirable to expand and
partially differentiate the CD34+ hematopoietic stem cells in vitro
and to allow terminal differentiation into mature erythrocytes to
occur in vivo (See, e.g., Neildez-Nguyen et al., Nature Biotech.
20:467-472 (2002)). Isolated CD34+ hematopoietic stem cells may be
expanded in vitro in the absence of the adherent stromal cell layer
in medium containing various factors including, for example, Flt3
ligand, stem cell factor, thrombopoietin, erythropoietin, and
insulin growth factor. The resulting erythroid precursor cells may
be characterized by the surface expression of CD36 and GPA, and may
be transfused into a subject where terminal differentiation to
mature erythrocytes is allowed to occur.
[0708] In some embodiments, the erythroid cell population comprises
a plurality of enucleated functional erythroid cells that comprise
a receiver polypeptide that is retained during enucleation. The
resulting isolated enucleated functional erythroid cell comprising
a receiver polypeptide exhibits substantially the same osmotic
membrane fragility as a corresponding isolated, unmodified,
uncultured erythroid cell.
[0709] In some embodiments, the erythroid cell population comprises
a plurality of erythrocyte precursor cells in substantially the
same stage of differentiation and/or cell cycle stage, wherein the
precursor cells comprise an exogenous nucleic acid encoding a
receiver. The majority of erythrocyte precursor cells that comprise
an exogenous nucleic acid encoding a receiver are capable of
differentiating into mature functional erythrocytes that retain the
receiver without retainingthe exogenous nucleic acid.
[0710] In some embodiments, the primary cells may be collected
through venipuncture, capillary puncture, or arterial puncture.
From the collected whole blood erythrocytes, platelets or other
cells may then be isolated using one, or a combination of
techniques including plasma depletion, density gradient,
Hetastarch, PrepaCyte-CB, and centrifugation.
[0711] In some embodiments, generating a synthetic
membrane-receiver complex comprises contacting isolated optionally
cultured cells that are autologous and/or allogeneic to the subject
with a receiver. For example, erythrocytes allogeneic to the
subject include one or more of blood type specific erythrocytes or
one or more universal donor erythrocytes. In some embodiments,
synthetic membrane-receiver complexes may be generated through
fusion of erythrocytes, e.g., between erythrocytes autologous to
the subject and one or more allogeneic erythrocytes, liposomes,
and/or artificial vesicles.
[0712] In certain embodiments, autologous transfusion of synthetic
membrane-receiver complexes includes isolating erythrocytes,
reticulocytes or hematopoietic stem cells from a subject,
generating a suitable synthetic membrane-receiver complex by
contacting the cell with a receiver by methods described herein and
administering (e.g., by transfusion) the synthetic
membrane-receiver complex into the same subject.
[0713] In certain embodiments, allogeneic transfusion of synthetic
membrane-receiver complexes includes isolating erythrocytes,
reticulocytes or hematopoietic stem cells from a donor, generating
a suitable synthetic membrane-receiver complex by contacting the
cell with a receiver by methods described herein and administering
(e.g., by transfusion) the synthetic membrane-receiver complex into
a subject that is different from the donor. Where allogeneic cells
are used for transfusion, care needs to be taken to use a
compatible ABO blood group to prevent an acute intravascular
hemolytic transfusion reaction which is characterized by complement
activation and lysis of incompatible erythrocytes. The ABO blood
types are defined based on the presence or absence of the blood
type antigens A and B, monosaccharide carbohydrate structures that
are found at the termini of oligosaccharide chains associated with
glycoproteins and glycolipids on the surface of the erythrocytes
(reviewed in Liu et al., Nat. Biotech. 25:454-464 (2007)). Group 0
erythrocytes lack either of these antigenic monosaccharide
structures. Subjects with group A erythrocytes have naturally
occurring antibodies to group B erythrocytes whereas subjects with
group B erythrocytes have antibodies to group A erythrocytes. Blood
group AB subjects have neither antibody and blood group 0
individuals have both. Subjects with either anti-A and/or anti-B
antibodies cannot receive a transfusion of blood containing the
corresponding antigen. Because group 0 erythrocytes contain neither
A nor B antigens, they can be safely transfused into recipients of
any ABO blood group, e.g., group A, B, AB, or O recipients. Group 0
erythrocytes are considered universal and may be used in all blood
transfusions. In contrast, group A erythrocytes may be given to
group A and AB recipients, group B erythrocytes may be given to
group B and AB recipients, and group AB erythrocytes may only be
given to AB recipients. In embodiments in which synthetic
membrane-receiver complexes are generated by contecting
erythrocytes or their precursors with a receiver the sourced
erythrocytes or their precursors are matched for compatibility with
the recipient.
[0714] In some instances, it may be beneficial to convert a
synthetic membrane-receiver complex comprising a non-group O
erythrocyte to a universal blood type. Enzymatic removal of the
immunodominant monosaccharides on the surface of group A and group
B erythrocytes may be used to generate a population of group O-like
synthetic membrane-receiver complexes (See, e.g., Liu et al., Nat.
Biotech. 25:454-464 (2007)). Group B synthetic membrane-receiver
complexes may be converted using an .alpha.-galactosidase derived
from green coffee beans. Alternatively or in addition,
.alpha.-N-acetylgalactosaminidase and .alpha.-galactosidase
enzymatic activities derived from E. meningosepticum bacteria may
be used to respectively remove the immunodominant A and B antigens
(Liu et al., Nat. Biotech. 25:454-464 (2007)), if present on the
synthetic membrane-receiver complexes. In one example, packed red
blood cells isolated as described herein, are incubated in 200 mM
glycine (pH 6.8) and 3 mM NaCl in the presence of either
.alpha.-N-acetylgalactosaminidase and .alpha.-galactosidase (about
300 .mu.g/ml packed red blood cells) for 60 mM at 26.degree. C.
After treatment, the red blood cells are washed by 3-4 rinses in
saline with centrifugation and ABO-typed according to standard
blood banking techniques.
[0715] In specific embodiments, the synthetic membrane-receiver
complexes described herein may be generated in the following way.
First, erythroid precursor cells are isolated. These cells may
alternatively be autologous to the patient or from substantially
universal donor blood. For example, the cells may be ABO type O,
rhesus factor Rh r/r, Duffy -/-, and large Kell antigen K1
negative. In the course of differentiation from erythroid precursor
cell to erythroid cell, an exogenous nucleic acid encoding the
receiver is introduced. the exogenous nucleic acid encoding the
receiver can be under the control of an erythroid-specific
promoter, such as a GATA-1 promoter (see e.g., Repik et al., Clin
Exp Immunol 2005, 140:230).the exogenous nucleic acid encoding the
receiver can be introduced in any way known in the art, for
example, as plasmid DNA, virus, or mRNA. Nucleic acid introduction
can be achieved by a variety of standard methods, e.g.,
transfection, transduction, or electroporation.
[0716] In specific embodiments, the synthetic membrane-receiver
complexes described herein may be generated by contacting platelets
with a receiver. Each day an adult human produces 2.times.10.sup.11
red blood cells, and about one-half as many white cells and
platelets. In humans, nearly all blood cell production occurs in
the red bone marrow that represents a hierarchical developmental
system composed of hematopoietic stem cells, intermediate level
progenitors and maturing cells committed to each lineage.
[0717] Although the morphology of all the major blood cell types is
similar through their initial development stages, megakaryocytes,
cells committed to platelet production, are marked by an obvious
structural and functional departure beyond the blast cell level of
differentiation growing to a size 10 times the diameter of most
other bone marrow and blood cells, and containing up to 128 times
the normal chromosomal complement, these cells give rise to blood
platelets. After a series of normal cell divisions, the developing
megakaryocyte precursor enters a unique cell cycle characterized by
a brief (about 1 h) G1 phase, a typical (7 h) S phase, a very brief
(.sup..about.45 min) G2 phase, followed by the endomitotic phase
(an aborted M phase). Once the cell develops a highly polyploid
nucleus, it also develops demarcation membranes necessary for
cytoplasmic fragmentation. This event is accompanied by expression
of glycoprotein GPIIbIIIa (platelet fibrinogen receptor;
Papayannopoulou et al., Exp. Hematol., 24: 660-9, 1996) and GPIb
(von Willibrand factor receptor; Kaushansky et al., Nature, 369:
568-571, 1994), the granules that contain ADP, serotonin,
-thromboglobulin, and other substances critical for mature platelet
function. Finally, highly polyploid megakaryocytes undergo
cytoplasmic partitioning, allowing the release of thousands of
platelets (Choi et al., Blood, 85: 402-413, 1995; Cramer et al.,
Blood, 89: 2336-2346, 1997).
[0718] Like all blood cell precursors, megakaryocytes are derived
from pluripotent marrow stem cells that retain the capacity to
extensively self-renew, or to differentiate into all of the
elements of the blood. Platelet production is in part regulated by
signaling mechanisms induced by interaction between thrombopoietin
(TPO) and its cellular receptor TPOR/MPUc-MPL.
[0719] Thrombopoietin (TPO) is a hematopoietic growth factor
involved in stimulation of megakaryocytopoiesis and platelet
production. TPO is expressed in liver and kidney, and, in response
to platelet demand, its expression may be also upregulated in the
bone marrow microenvironment (Kato et al., Stem Cells, 16: 322-328,
1998; McCarty et al., Blood, 86:3668-3675, 1995). As TPO expression
is mostly constitutive, the TPO levels are believed to be regulated
by sequestering by platelets (Fielder et al., Blood 87: 2154,
1996).
[0720] The gene encoding TPO has been cloned and characterized
(Kuter et al., Proc. Natl. Acad. Sci. USA, 91:11104-11108, 1994;
Bartley et al., Cell, 77:1117-1124, 1994; Kaushansky et al.,
Nature, 369:568-571, 1994; Wendling et al., Nature, 369:571-574,
1994, and de Sauvage et al., Nature, 369:533-538, 1994). Human TPO
(hTPO) cDNA encodes a 353 amino acid-long polypeptide. The
full-length hTPO secreted from mammalian cells after cleavage of
the signal peptide consists of 332 amino acids. Although the
predicted molecular mass of this protein is 38 kD, the molecular
masses reported from measurements of material in serum or in
culture fluid from recombinant cells vary from 18 to 85 kD
(glycosylation, and post-translational proteolytic processing).
[0721] The cell surface receptor for TPO (TPOR/MPL/c-MPL) is a
product of the protooncogene c-mpl, a homologue of v-mpl, an
envelope protein of the myeloproliferative leukaemia virus (MPLV)
shown to induce a pan-myeloid disorder (Wendling, Virol.,
149:242-246, 1986). The human c-mpl gene codes for a protein of 635
aa having a predicted molecular weight of 71 kD (Vigon et al.,
Proc. Natl. Acad. Sci. USA, 89:5640-44, 1992; Mignotte et al.,
Genomics, 20: 5-12, 1994).
[0722] Mice rendered null for the expression of either TPO or its
receptor (TPOR/MPL/c-MPL) manifest a severe thrombocytopenic
phenotype (Gurney et al., Science, 265: 1445, 1994; Kaushansky et
al., J. Clin. Invest., 96: 1683, 1995; de Sauvage et al., J. Exp.
Med., 183: 651, 1996).
[0723] Multiple cytokines (e.g., stem cell factor [SCF], IL-1,
IL-3, IL-6, IL-11, leukaemia inhibiting factor [LIF], G-CSF,
GM-CSF, M-CSF, erythropoietin (EPO), kit ligand, and -interferon)
have been shown to possess thrombocytopoietic activity.
[0724] The resulting platelets are small disc-shaped cell fragments
which undergo a rapid transformation when they encounter sites of
vascular damage. They become more spherical and extrude
pseudopodia, their fibrinogen receptors are activated leading to
aggregation, and they release their granule contents and eventually
they form a plug which is responsible for primary hemostasis
(Siess, W., Physiol. Rev. 69: 58-178, 1989). Activation of
platelets is also implicated in the pathogenesis of unstable
angina, myocardial infarction and stroke (Packham, M. A., Can J.
Physiol Pharmacol. 72: 278-284).
[0725] Several physiological substances are involved in the
activation of platelets such as collagen, which is exposed at the
subendothelial surfaces, thrombin, generated by the coagulation
cascade, and thromboxane A2 (TXA.sub.2) and ADP, which are released
from activated platelets. Collagen binds to several platelet
membrane proteins including integrin .alpha.2 .beta.1 leading to
platelet activation through the release of TXA.sub.2 and ADP
(Shattil, S. J., et al., Curr. Opin. Cell Biol. 6: 695-704, 1994).
In contrast, thrombin, TXA.sub.2, and ADP, activate G-protein
coupled receptors directly and induce platelet aggregation and
granule release (Hourani, S. M, and Cusack, N. J., Pharmacol. Rev.
43: 243-298, 1991). The major events involved in platelet
activation are believed to be the result of the activation of
.beta.-isoforms of phospholipase C (PLC) leading to the generation
of inositol 1,4,5 triphosphate and diacylglycerol. Platelets mainly
contain two isoforms, PLC-.beta.2 and PLC-.beta.3.
[0726] Platelet receptors which mediate platelet adhesion and
aggregation are located on the two major platelet surface
glycoprotein complexes. These complexes are the glycoprotein Ib-IX
complex which facilitates platelet adhesion by binding von
Willebrand factor (vWF), and the glycoprotein IIb-IIIa complex
which links platelets into aggregates by binding to fibrinogen.
Patients with the Bernard-Soulier syndrome, a congenital bleeding
disorder, show deficient platelet adhesion due to a deficiency in
the glycoprotein Ib-IX complex which binds vWF, mild
thrombocytopenia, and large lymphocoid platelets.
[0727] Glycoprotein V (GPV) is a major (.apprxeq.12,000
molecules/platelet), heavily glycosylated platelet membrane protein
(Mr 82,000). Exposure of platelets to thrombin liberates a 69 kDa
soluble fragment termed GPVf1. GPV can interact non-covalently with
the GPIb-IX complex a complex formed by the non-covalent
association of GPIb (consisting of GPIb.alpha., a 145 kDa protein,
disulfide linked to GPIb.beta., a 24 kDa protein) with GPIX (a 22
kDa protein). The binding sites for von Willebrand factor and for
thrombin on the GPIb-IX complex have been localized on GPIb.alpha..
Since thrombin is now known to activate platelets by cleaving the
thrombin receptor (Vu et. al., Cell 64:1057-1068 (1990)), a
G-protein coupled receptor, it is unknown whether thrombin cleaves
GPV incidently as a consequence of thrombin binding to GPIb.alpha.,
or whether this cleavage has a physiological role. GPIB.alpha.,
GPIB.beta., and GPIX contain one or more homologous 24 amino acid
leucine-rich domains. These domains are also found in a large
family of leucine-rich glycoproteins (LRG).
[0728] GPV is a marker for the megakaryocytic cell lineage. A
monoclonal antibody specific for GPV (SW16) does not bind to red
cells, leukocytese endothelial cells, or cell lines such as HEL or
MEG-01 which are known to express platelet megakaryocyte
markers.
[0729] Mature GPV is composed of 543 amino acids which contain a
single transmembrane domain, a short cytoplasmic domain (16
residues) and a large extracellular domain with 8 potential
N-glycosylation sites. Analysis of the extracellular domain
revealed the presence of 15 tandem Leu-rich repeats of 24 amino
acids with homology to GPIb.alpha., and identified a cleavage site
for thrombin near the C-terminus with homology to the Act chain of
fibrinogen.
Culturing
[0730] Sources for generating synthetic membrane-receiver complexes
described herein include circulating cells such as erythroid cells.
A suitable cell source may be isolated from a subject as described
herein from patient-derived hematopoietic or erythroid progenitor
cells, derived from immortalized erythroid cell lines, or derived
from induced pluripotent stem cells, optionally cultured and
differentiated. Methods for generating erythrocytes using cell
culture techniques are well known in the art, e.g., Giarratana et
al., Blood 2011, 118:5071, Huang et al., Mol Ther 2013, epub ahead
of print September 3, or Kurita et al., PLOS One 2013, 8:e59890.
Protocols vary according to growth factors, starting cell lines,
culture period, and morphological traits by which the resulting
cells are characterized. Culture systems have also been established
for blood production that may substitute for donor transfusions
(Fibach et al. 1989 Blood 73:100). Recently, CD34+ cells were
differentiated to the reticulocyte stage, followed by successful
transfusion into a human subject (Giarratana et al., Blood 2011,
118:5071).
[0731] Provided herein are culturing methods for erythroid cells
and synthetic membrane-receiver complexes derived from erythroid
cells. Erythroid cells can be cultured from hematopoietic
progenitor cells, including, for example, CD34+ hematopoietic
progenitor cells (Giarratana et al., Blood 2011, 118:5071), induced
pluripotent stem cells (Kurita et al., PLOS One 2013, 8:e59890),
and embryonic stem cells (Hirose et al. 2013 Stem Cell Reports
1:499). Cocktails of growth and differentiation factors that are
suitable to expand and differentiate progenitor cells are known in
the art. Examples of suitable expansion and differentiation factors
include, but are not limited to, stem cell factor (SCF), an
interleukin (IL) such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7,
IL-8, IL-9, IL-11, IL-12, CSF, G-CSF, thrombopoietin (TPO), GM-CSF,
erythropoietin (EPO), Flt3, Flt2, PIXY 321, and leukemia inhibitory
factor (LIF).
[0732] Erythroid cells can be cultured from hematopoietic
progenitors, such as CD34+ cells, by contacting the progenitor
cells with defined factors in a multi-step culture process. For
example, erythroid cells can be cultured from hematopoietic
progenitors in a three-step process.
[0733] The first step may comprise contacting the cells in culture
with stem cell factor (SCF) at 1-1000 ng/mL, erythropoietin (EPO)
at 1-100 U/mL, and interleukin-3 (IL-3) at 0.1-100 ng/mL. The first
step optionally comprises contacting the cells in culture with a
ligand that binds and activates a nuclear hormone receptor, such as
e.g., the glucocorticoid receptor, the estrogen receptor, the
progesterone receptor, the androgen receptor, or the pregnane x
receptor. The ligands for these receptors include, for example, a
corticosteroid, such as, e.g., dexamethasone at 10 nM-100 .mu.M or
hydrocortisone at 10 nM-100 .mu.M; an estrogen, such as, e.g.,
beta-estradiol at 10 nM-100 .mu.M; a progestogen, such as, e.g.,
progesterone at 10 nM-100 .mu.M, hydroxyprogesterone at 10 nM-100
.mu.M, 5a-dihydroprogesterone at 10 nM-100 11-deoxycorticosterone
at 10 nM-100 .mu.M, or a synthetic progestin, such as, e.g.,
chlormadinone acetate at 10 nM-100 .mu.M; an androgen, such as,
e.g., testosterone at 10 nM-100 .mu.M, dihydrotestosterone at 10
nM-100 .mu.M or androstenedione at 10 nM-100 .mu.M; or a pregnane x
receptor ligand, such as, e.g., rifampicin at 10 nM-100 hyperforin
at 10 nM-100 .mu.M, St. John's Wort (hypericin) at 10 nM-100 .mu.M,
or vitamin E-like molecules, such as, e.g., tocopherol at 10 nM-100
.mu.M. The first step may also optionally comprise contacting the
cells in culture with an insulin-like molecule, such as, e.g.,
insulin at 1-50 .mu.g/mL, insulin-like growth factor 1 (IGF-1) at
1-50 .mu.g/mL, insulin-like growth factor 2 (IGF-2) at 1-50
.mu.g/mL, or mechano-growth factor at 1-50 .mu.g/mL. The first step
further may optionally comprise contacting the cells in culture
with transferrin at 0.1-5 mg/mL.
[0734] The first step may optionally comprise contacting the cells
in culture with one or more interleukins (IL) or growth factors
such as, e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9,
IL-11, IL-12, granulocyte colony-stimulating factor (G-CSF),
macrophage colony-stimulating factor (M-CSF),
granulocyte-macrophage colony-stimulating factor (GM-CSF),
thrombopoietin, fibroblast growth factor (FGF), platelet-derived
growth factor (PDGF), transforming growth factor beta (TGF-B),
tumor necrosis factor alpha (TNF-A), megakaryocyte growth and
development factor (MGDF), leukemia inhibitory factor (LIF), and
Flt3 ligand. Each interleukin or growth factor may typically be
supplied at a concentration of 0.1-100 ng/mL. The first step may
also optionally comprise contacting the cells in culture with serum
proteins or non-protein molecules such as, e.g., fetal bovine serum
(1-20%), human plasma (1-20%), plasmanate (1-20%), human serum
(1-20%), albumin (0.1-100 mg/mL), or heparin (0.1-10 U/mL).
[0735] The second step may comprise contacting the cells in culture
with stem cell factor (SCF) at 1-1000 ng/mL and erythropoietin
(EPO) at 1-100 U/mL. The second step may also optionally comprise
contacting the cells in culture with an insulin-like molecule, such
as e.g., insulin at 1-50 .mu.g/mL, insulin-like growth factor 1
(IGF-1) at 1-50 .mu.g/mL, insulin-like growth factor 2 (IGF-2) at
1-50 .mu.g/mL, or mechano-growth factor at 1-50 .mu.g/mL. The
second step may further optionally comprise contacting the cells in
culture with transferrin at 0.1-5 mg/mL. The second may also
optionally comprise contacting the cells in culture with serum
proteins or non-protein molecules such as, e.g., fetal bovine serum
(1-20%), human plasma (1-20%), plasmanate (1-20%), human serum
(1-20%), albumin (0.1-100 mg/mL), or heparin (0.1-10 U/mL).
[0736] The third step may comprise contacting the cells in culture
with erythropoietin (EPO) at 1-100 U/mL. The third step may
optionally comprise contacting the cells in culture with stem cell
factor (SCF) at 1-1000 ng/mL. The third step may further optionally
comprise contacting the cells in culture with an insulin-like
molecule, such as e.g., insulin at 1-50 .mu.g/mL, insulin-like
growth factor 1 (IGF-1) at 1-50 .mu.g/mL, insulin-like growth
factor 2 (IGF-2) at 1-50 .mu.g/mL, or mechano-growth factor at 1-50
.mu.g/mL. The third step may also optionally comprise contacting
the cells in culture with transferrin at 0.1-5 mg/mL. The third
step may also optionally comprise contacting the cells in culture
with serum proteins or non-protein molecules such as, e.g., fetal
bovine serum (1-20%), human plasma (1-20%), plasmanate (1-20%),
human serum (1-20%), albumin (0.1-100 mg/mL), or heparin (0.1-10
U/mL).
[0737] In some embodiments, methods of expansion and
differentiation of the synthetic membrane-receiver complexes do not
include culturing the synthetic membrane-receiver complexes in a
medium comprising a myeloproliferative receptor (mpl) ligand.
[0738] The culture process may optionally comprise contacting cells
by a method known in the art with a molecule, e.g., a DNA molecule,
an RNA molecule, a mRNA, an siRNA, a microRNA, a lncRNA, a shRNA, a
hormone, or a small molecule, that activates or knocks down one or
more genes. Target genes can include, for example, genes that
encode a transcription factor, a growth factor, or a growth factor
receptor, including but not limited to, e.g., GATA1, GATA2, CMyc,
hTERT, p53, EPO, SCF, insulin, EPO-R, SCF-R, transferrin-R,
insulin-R.
[0739] In one embodiment, CD34+ cells are placed in a culture
containing varying amounts of IMDM, FBS, glutamine, BSA,
holotransferrin, insulin, dexamethasone, .beta.-estradiol, IL-3,
SCF, and erythropoietin, in three separate differentiation stages
for a total of 22 days.
[0740] In one embodiment, CD34+ cells are placed in a culture
containing varying amounts of IMDM, FBS, glutamine, BSA,
holotransferrin, insulin, dexamethasone, .beta.-estradiol, IL-3,
SCF, and thrombopoietin, in three separate differentiation stages
for a total of 14 days.
[0741] In one embodiment, CD34+ cells are placed in a culture
containing varying amounts of IMDM, FBS, glutamine, BSA,
holotransferrin, insulin, dexamethasone, .beta.-estradiol, IL-3,
SCF, and GCSF, in three separate differentiation stages for a total
of 15 days.
Compositions
[0742] Provided herein are pharmaceutical compositions comprising
synthetic membrane-receiver complexes that are suitable for
administration to a subject. The pharmaceutical compositions
generally comprise a population of synthetic membrane-receiver
complexes and a pharmaceutically-acceptable carrier in a form
suitable for administration to a subject.
Pharmaceutically-acceptable carriers are determined in part by the
particular composition being administered, as well as by the
particular method used to administer the composition. Accordingly,
there is a wide variety of suitable formulations of pharmaceutical
compositions comprising a population of synthetic membrane-receiver
complexes. (See, e.g., Remington's Pharmaceutical Sciences, Mack
Publishing Co., Easton, Pa. 18th ed. (1990)). The pharmaceutical
compositions are generally formulated as sterile, substantially
isotonic and in full compliance with all Good Manufacturing
Practice (GMP) regulations of the U.S. Food and Drug
Administration.
[0743] Pharmaceutically-acceptable excipients include excipients
that are generally safe, non-toxic, and desirable, including
excipients that are acceptable for veterinary use as well as for
human pharmaceutical use. Such excipients can be solid, liquid,
semisolid, or, in the case of an aerosol composition, gaseous.
[0744] Examples of carriers or diluents include, but are not
limited to, water, saline, Ringer's solutions, dextrose solution,
and 5% human serum albumin. The use of such media and compounds for
pharmaceutically active substances is well known in the art. Except
insofar as any conventional media or compound is incompatible with
the synthetic membrane-receiver complexes described herein, use
thereof in the compositions is contemplated. Supplementary
therapeutic agents may also be incorporated into the compositions.
Typically, a pharmaceutical composition is formulated to be
compatible with its intended route of administration. The synthetic
membrane-receiver complexes can be administered by parenteral,
topical, intravenous, oral, subcutaneous, intraarterial,
intradermal, transdermal, rectal, intracranial, intraperitoneal,
intranasal; intramuscular route or as inhalants. The synthetic
membrane-receiver complexes can optionally be administered in
combination with other therapeutic agents that are at least partly
effective in treating the disease, disorder or condition for which
the synthetic membrane-receiver complexes are intended.
[0745] Solutions or suspensions used for parenteral, intradermal,
or subcutaneous application can include the following components: a
sterile diluent such as water for injection, saline solution, fixed
oils, polyethylene glycols, glycerine, propylene glycol or other
synthetic solvents; antibacterial compounds such as benzyl alcohol
or methyl parabens; antioxidants such as ascorbic acid or sodium
bisulfite; chelating compounds such as ethylenediaminetetraacetic
acid (EDTA); buffers such as acetates, citrates or phosphates, and
compounds for the adjustment of tonicity such as sodium chloride or
dextrose. The pH can be adjusted with acids or bases, such as
hydrochloric acid or sodium hydroxide. The parenteral preparation
can be enclosed in ampoules, disposable syringes or multiple dose
vials made of glass or plastic.
[0746] Pharmaceutical compositions suitable for injectable use
include sterile aqueous solutions (where water soluble) or
dispersions and sterile powders for the extemporaneous preparation
of sterile injectable solutions or dispersion. For intravenous
administration, suitable carriers include physiological saline,
bacteriostatic water, Cremophor EL.TM. (BASF, Parsippany, N.J.) or
phosphate buffered saline (PBS). In all cases, the composition must
be sterile and should be fluid to the extent that easy
syringeability exists. It must be stable under the conditions of
manufacture and storage and must be preserved against the
contaminating action of microorganisms such as bacteria and fungi.
The carrier can be a solvent or dispersion medium containing, e.g.,
water, ethanol, polyol (e.g., glycerol, propylene glycol, and
liquid polyethylene glycol, and the like), and suitable mixtures
thereof. The proper fluidity can be maintained, e.g., by the use of
a coating such as lecithin, by the maintenance of the required
particle size in the case of dispersion and by the use of
surfactants. Prevention of the action of microorganisms can be
achieved by various antibacterial and antifungal compounds, e.g.,
parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the
like. In many cases, it will be preferable to include isotonic
compounds, e.g., sugars, polyalcohols such as manitol, sorbitol,
sodium chloride in the composition. Prolonged absorption of the
injectable compositions can be brought about by including in the
composition a compound which delays absorption, e.g., aluminum
monostearate and gelatin.
[0747] Sterile injectable solutions can be prepared by
incorporating the synthetic membrane-receiver complexes in an
effective amount and in an appropriate solvent with one or a
combination of ingredients enumerated herein, as desired.
Generally, dispersions are prepared by incorporating the synthetic
membrane-receiver complexes into a sterile vehicle that contains a
basic dispersion medium and any desired other ingredients. In the
case of sterile powders for the preparation of sterile injectable
solutions, methods of preparation are vacuum drying and
freeze-drying that yields a powder of the active ingredient plus
any additional desired ingredient from a previously
sterile-filtered solution thereof. The synthetic membrane-receiver
complexes can be administered in the form of a depot injection or
implant preparation which can be formulated in such a manner to
permit a sustained or pulsatile release of the synthetic
membrane-receiver complexes, their receiver(s) and/or their
oprional payload(s).
[0748] Oral compositions generally include an inert diluent or an
edible carrier. They can be enclosed in gelatin capsules or
compressed into tablets. For the purpose of oral therapeutic
administration, the synthetic membrane-receiver complexes can be
incorporated with excipients and used in the form of tablets,
troches, or capsules. Oral compositions can also be prepared using
a fluid carrier for use as a mouthwash, wherein the compound in the
fluid carrier is applied orally and swished and expectorated or
swallowed. Pharmaceutically compatible binding compounds, and/or
adjuvant materials can be included as part of the composition. The
tablets, pills, capsules, troches and the like can contain any of
the following ingredients, or compounds of a similar nature: a
binder such as microcrystalline cellulose, gum tragacanth or
gelatin; an excipient such as starch or lactose, a disintegrating
compound such as alginic acid, Primogel, or corn starch; a
lubricant such as magnesium stearate or Sterotes; a glidant such as
colloidal silicon dioxide; a sweetening compound such as sucrose or
saccharin; or a flavoring compound such as peppermint, methyl
salicylate, or orange flavoring.
[0749] For administration by inhalation, the synthetic
membrane-receiver complexes are delivered in the form of an aerosol
spray from pressured container or dispenser which contains a
suitable propellant, e.g., a gas such as carbon dioxide, or a
nebulizer.
[0750] Systemic administration of compositions comprising synthetic
membrane-receiver complexes can also be by transmucosal or
transdermal means. For transmucosal or transdermal administration,
penetrants appropriate to the barrier to be permeated are used in
the formulation. Such penetrants are generally known in the art,
and include, e.g., for transmucosal administration, detergents,
bile salts, and fusidic acid derivatives. Transmucosal
administration can be accomplished through the use of nasal sprays
or suppositories. For transdermal administration, the modified red
blood cells are formulated into ointments, salves, gels, or creams
as generally known in the art.
[0751] The synthetic membrane-receiver complexes can also be
prepared as pharmaceutical compositions in the form of
suppositories (e.g., with conventional suppository bases such as
cocoa butter and other glycerides) or retention enemas for rectal
delivery.
[0752] In some embodiments, the synthetic membrane-receiver
complexes are prepared with carriers that will decrease the rate
with which synthetic membrane-receiver complexes are eliminated
from the body of a subject. For example, controlled release
formulation are suitable, including implants and microencapsulated
delivery systems. Biodegradable, biocompatible polymers can be
used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic
acid, collagen, polyorthoesters, and polylactic acid. Methods for
preparation of such formulations will be apparent to those skilled
in the art. The materials can also be obtained commercially from
Alza Corporation and Nova Pharmaceuticals, Inc.
[0753] In one embodiment the pharmaceutical composition comprising
synthetic membrane-receiver polypeptide complexes is administered
intravenously into a subject that would benefit from the
pharmaceutical composition. In other embodiments, the composition
is administered to the lymphatic system, e.g., by intralymphatic
injection or by intranodal injection (see e.g., Senti et al., 2008
PNAS 105(46):17908), or by intramuscular injection, by subcutaneous
administration, by direct injection into the thymus, or into the
liver.
[0754] In one embodiment, the pharmaceutical composition comprising
synthetic membrane-receiver polypeptide complexes is administered
as a liquid suspension. In one embodiment the pharmaceutical
composition is administered as a coagulated formulation that is
capable of forming a depot following administration, and in a
preferred embodiment slowly release synthetic membrane-receiver
polypeptide complexes into circulation, or in a preferred
embodiment remain in depot form.
[0755] In one embodiment, the pharmaceutical composition comprising
synthetic membrane-receiver complexes is stored using methods and
buffer compositions that are capable of maintaining viability of
the synthetic membrane-receiver complexes. For example,
deoxygenation prior to storage to maintain an anaerobic state,
manipulation of pH, supplementation of metabolic precursors,
manipulation of osmotic balance, increasing of the volume of the
suspending medium, and/or reduction of oxidative stress by adding
protective molecules can be used to maintain the viability of the
synthetic membrane-receiver complexes. Several studies employing a
combination of these strategies have reported maintenance of
viability of erythrocytes allowing an extension of storage beyond 6
weeks (see e.g., Yoshida and Shevkoplyas, Blood Transfus 2010
8:220).
[0756] Pharmaceutically acceptable carriers or excipients may be
used to deliver the synthetic membrane-receiver polypeptides
described herein. Excipient refers to an inert substance used as a
diluent or vehicle. Pharmaceutically acceptable carriers are used,
in general, with a compound so as to make the compound useful for a
therapy or as a product. In general, for any substance, a
pharmaceutically acceptable carrier is a material that is combined
with the substance for delivery to a subject. Conventional
pharmaceutical carriers, aqueous, powder or oily bases, thickeners
and the like may be necessary or desirable. In some cases the
carrier is essential for delivery, e.g., to solubilize an insoluble
compound for liquid delivery; a buffer for control of the pH of the
substance to preserve its activity; or a diluent to prevent loss of
the substance in the storage vessel. In other cases, however, the
carrier is for convenience, e.g., a liquid for more convenient
administration. Pharmaceutically acceptable salts of the compounds
described herein may be synthesized according to methods known to
those skilled in the arts.
[0757] Typically, pharmaceutically acceptable compositions are
highly purified to be free of contaminants, are biocompatible and
not toxic, and are suited to administration to a subject. If water
is a constituent of the carrier, the water is highly purified and
processed to be free of contaminants, e.g., endotoxins.
[0758] The pharmaceutically acceptable carrier may be lactose,
dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium
phosphate, alginates, gelatin, calcium silicate, micro-crystalline
cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl
cellulose, methylhydroxy benzoate, propylhydroxy benzoate, talc,
magnesium stearate, and/or mineral oil, but is not limited thereto.
The pharmaceutical composition may further include a lubricant, a
wetting agent, a sweetener, a flavor enhancer, an emulsifying
agent, a suspension agent, and/or a preservative.
[0759] Provided are pharmaceutical compositions containing
synthetic membrane-receiver complexes having effective levels of
receivers. Such compositions contain a plurality of synthetic
membrane-receiver complexes, e.g., 1.times.10.sup.3 complexes, or
1.times.10.sup.4, 1.times.10.sup.5, 1.times.10.sup.6,
1.times.10.sup.7, 1.times.10.sup.8, 1.times.10.sup.9,
1.times.10.sup.10, 1.times.10.sup.11, 1.times.10.sup.12, or greater
than 1.times.10.sup.12 complexes. In specific examples, synthetic
membrane-receiver complexes generated from erythroid cells may be
administered as packed red blood cells in a saline solution at a
concentration of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or
greater than 90% mass to volume ratio (% m/v). The time of
administration to a patient may range from 10 minutes to four
hours, or more.
[0760] In specific examples, synthetic membrane-receiver complexes
generated from erythroid cells can be stored in an appropriate
buffer, e.g., an FDA-approved anticoagulant preservative solution
such as anticoagulant citrate-dextrose A (ACD-A), citrate-phosphate
dextrose (CPD), Citratephosphate-dextrose-dextrose (CP2D), or
citrate-phosphate-dextrose-adenine (CPDA-1). The compositions may
be stored for up to 21 days.
[0761] Alternatively, synthetic membrane-receiver complexes
generated from erythroid cells can be stored in an approved
additive solution, e.g., AS-1 (Adsol), AS-3 (Nutricel), AS-5
(Optisol), or AS-7 (SOLX).
[0762] Alternatively, synthetic membrane-receiver complexes
generated from erythroid cells can stored in a glycerol
cryoprotective solution. The compositions may be frozen and stored
for up to 10 years. Frozen cells may be thawed and deglycerolized
by successive washing steps, for example with 0.9% sodium chloride
before use.
[0763] Provided herein are compositions and pharmaceutical
compositions comprising a plurality of cultured functional
erythroid cells that comprise a receiver. The compositions and
pharmaceutical compositions may comprise a solution of appropriate
storage buffer such as, e.g., anticoagulant citrate-dextrose A. The
compositions and pharmaceutical compositions comprising the
plurality of cultured functional erythroid cells that comprise a
receiver may additionally comprise an approved additive such as,
e.g., Adsol. The compositions and pharmaceutical compositions
comprising the plurality of cultured functional erythroid cells
that comprise receiver may additionally comprise a glycerol
cryoprotective solution for frozen storage.
[0764] In one embodiment, the synthetic membrane-receiver
polypeptide complex is able to form a multi-complex aggregate,
e.g., a dimer, a trimer, a multimer, with another synthetic
membrane-receiver polypeptide complex.
[0765] In one embodiment the synthetic membrane-receiver
polypeptide complex is able to form a multi-complex aggregate,
e.g., a dimer, a trimer, a multimer, with component of the
circulatory system, e.g an erythrocyte, a reticulocyte, a platelet,
a macrophage, a lymphocyte, a T cell, a B cell, a mast cell.
[0766] The dosing and frequency of the administration of the
synthetic membrane-receiver complexes and pharmaceutical
compositions thereof can be determined by the attending physician
based on various factors such as the severity of disease, the
patient's age, sex and diet, the severity of any inflammation, time
of administration, and other clinical factors. In one example, an
intravenous administration is initiated at a dose which is
minimally effective, and the dose is increased over a pre-selected
time course until a positive effect is observed. Subsequently,
incremental increases in dosage are made limiting to levels that
produce a corresponding increase in effect while taking into
account any adverse affects that may appear.
[0767] Non-limited examples of suitable dosages can range, for
example, from 1.times.10.sup.10 to 1.times.10.sup.14, from
1.times.10.sup.11 to 1.times.10.sup.13, or from 5.times.10.sup.11
to 5.times.10.sup.12 synthetic membrane-receiver complexes.
Specific examples include about 5.times.10.sup.10,
6.times.10.sup.10, 7.times.10.sup.10, 8.times.10.sup.10,
9.times.10.sup.10, 1.times.10.sup.11, 2.times.10.sup.11,
3.times.10.sup.11, 4.times.10.sup.11, 5.times.10.sup.11,
6.times.10.sup.11, 7.times.10.sup.11, 8.times.10.sup.11,
9.times.10.sup.11, 1.times.10.sup.12, or more synthetic
membrane-receiver complexes. Each dose of synthetic
membrane-receiver complexes can be administered at intervals such
as once daily, once weekly, twice weekly, once monthly, or twice
monthly.
[0768] "Complex-based proportional dosage" is the number of
synthetic membrane-receiver complexes administered as a dose
relative to a naturally occurring quantity of circulating entities.
The circulating entities may be cells, e.g., erythrocytes,
reticulocytes, or lymphocytes, or targets, e.g., antigens,
antibodies, viruses, toxins, cytokines, etc. The units are defined
as synthetic membrane-receiver complex per circulating entity, ie
SCMRC/CE. This dosage unit may include 10.sup.-7, 10.sup.-6,
10.sup.-5, 10.sup.-4, 10.sup.-3, 10.sup.-2, 10.sup.-1, 1, 10,
10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5, 10.sup.6, 10.sup.7,
10.sup.8, 10.sup.9.
[0769] The pharmaceutical compositions described herein comprise a
synthetic membrane-receiver complex and optionally a
pharmaceutically active or therapeutic agent. The therapeutic agent
can be a biological agent, a small molecule agent, or a nucleic
acid agent.
[0770] Dosage forms are provided that comprise a pharmaceutical
composition comprising a synthetic membrane-receiver complex
described herein. In some embodiments, the dosage form is
formulated as a liquid suspension for intravenous injection.
[0771] Medical devices are provided that comprise a container
holding a pharmaceutical composition comprising a synthetic
membrane-receiver complex described herein and an applicator for
intravenous injection of the pharmaceutical composition to a
subject.
[0772] Medical kits are provided that comprise a pharmaceutical
composition comprising a synthetic membrane-receiver complex
described herein and a medical device for intravenous injection of
the pharmaceutical composition to a subject.
[0773] A pharmaceutically acceptable suspension of synthetic
membrane-receiver complexes is preferably packaged in a volume of
approximately 10 to approximately 250 ml. The packaging can be a
syringe or an IV bag suitable for transfusions. Administration of
the suspension is carried out, e.g., by intravenous or
intra-arterial injection, optionally using a drip from an IV bag or
the like. The administration is typically carried out intravenously
in the arm or via a central catheter. For administrations exceeding
50 ml use of a drip is preferred.
Processes and Properties
[0774] In some embodiments, the membrane-receiver complex is
generated using a precursor hematopoietic cell, e.g., a CD34+ cell,
an erythrocyte, a platelet, a megakaryocyte, or a neutrophil as a
source. In some embodiments, the precursor hematopoietic cell is
isolated from a human donor by a GMP-compliant process. In some
embodiments, the starting cells are sourced from an autologous
donor. In some embodiments, the starting cells are sourced from an
allogeneic donor. The donor may be typed for blood cell antigen
polymorphisms and/or the donor is genotyped for blood cell
antigens. The donor can be a universal blood donor. In some
embodiments, the donor has the Bombay phenotype, i.e. does not
express the H antigen. In some embodiments, the donor has ABO blood
type 0 and is Rh-negative.
[0775] In some embodiments, the membrane-receiver complex is
generated using CD34+ hematopoietic progenitor cells, mobilized
peripheral CD34+ cells, or bone marrow-derived CD34+ cells as a
source for the starting material. In some embodiments, the starting
cells are derived from umbilical cord blood, are induced
pluripotent stem cells or are embryonic stem cells.
[0776] The synthetic membrane-receiver complex may be cultured.
Cultured complexes can be scaled up from bench-top scale to
bioreactor scale. For example, the complexes are cultured until
they reach saturation density, e.g., 1.times.10.sup.5,
1.times.10.sup.6, 1.times.10.sup.7, or greater than
1.times.10.sup.7 complexes per ml. Optionally, upon reaching
saturation density, the complexes can be transferred to a larger
volume of fresh medium. The membrane-receiver complexes may be
cultured in a bioreactor, such as, e.g., a Wave-type bioreactor, a
stirred-tank bioreactor. Various configurations of bioreactors are
known in the art and a suitable configuarion may be chosen as
desired. Configurations suitable for culturing and/or expanding
populations of synthetic membrane-receiver complexes can easily be
determined by one of skill in the art without undue
experimentation. The bioreactor can be oxygenated. The bioreactor
may optionally contain one or more impellers, a recycle stream, a
media inlet stream, and control components to regulate the influx
of media and nutrients or to regulate the outflux of media,
nutrients, and waste products.
[0777] In some embodiments, the bioreactor may contain a population
of human functional erythroid cells comprising a receiver that shed
their intracellular DNA over the course of the culture process. For
example, the bioreactor may contain a population of human erythroid
cells, enucleated erythroid cells, and pyrenocytes after culture.
In a specific embodiment, the human erythroid cells and enucleated
erythroid cells comprise a receiver and the receiver is retained by
the enucleated erythroid cell, whereas the exogenous nucleic acid
encoding the receiver is not retained by the enucleated cell. In
certain embodiments, the enucleated functional erythroid cell
comprising the receiver exhibits substantially the same osmotic
membrane fragility as a corresponding isolated unmodified,
uncultured erythroid cell.
[0778] In one embodiment. The population of synthetic
membrane-receiver complexes generated from erythroid cells or
erythroid cell precursors in the bioreactor undergo a total
expansion of greater than 20,000-fold in 14 days or greater. In
some embodiments, the receiver is introduced into a cultured or
freshly isolated erythroid cell precursor and after introduction of
an exogenous nucleic acid encoding the receiver the population of
synthetic membrane-receiver complexes generated from the erythroid
cell precursors in the bioreactor expands in the bioreactor from
the precursor cells by more than 20,000-fold.
[0779] In some embodiments, the bioreactor is a Wave bioreactor or
a impeller-driven agitator. The bioreactor may be aerated by means
of a sparger. In one embodiment, the bioreactor is disposable. In
one embodiment, the bioreactor is CIP (cleaned in place). The final
complexes number of synthetic membrane-receiver complexes that may
be obtained in a bioreactor setting as described herein can be
greater than 10.sup.9, 10.sup.10, 10.sup.11, 10.sup.12, 10.sup.13
or greater than 10.sup.13 complexes. The density of synthetic
membrane-receiver complexes may be monitored during culture by
measuring cell density by hemacytometer counting or by optical
density reading at 600 nm. Optionally, the culture process is
monitored for pH levels, oxygenation, agitation rate, and/or
recycle rate.
[0780] The identity of the membrane-receiver complexes can be
assessed by in vitro assays. For example, the identity of the
membrane-receiver complexes is assessed by counting the number of
complexes in a population, e.g., by microscopy, by flow cytometry,
or by hemacytometry. Alternatively or in addition, the identity of
the membrane-receiver complexes is assessed by analysis of protein
content of the complex, e.g., by flow cytometry, Western blot,
immunoprecipitation, fluorescence spectroscopy, chemiluminescence,
mass spectrometry, or absorbance spectroscopy. In one embodiment,
the protein content assayed is a non-surface protein, e.g., an
integral membrane protein, hemoglobin, adult hemoglobin, fetal
hemoglobin, embryonic hemoglobin, a cytoskeletal protein. In one
embodiment, the protein content assayed is a surface protein, e.g.,
a differentiation marker, a receptor, a co-receptor, a transporter,
a glycoprotein. In one embodiment, the surface protein is selected
from the list including, but not limited to, glycophorin A, CKIT,
transferrin receptor, Band3, Kell, CD45, CD46, CD47, CD55, CD59,
CR1. In some embodiments, the identity of the membrane-receiver
complexes is assessed by analysis of the receiver content of the
complex, e.g., by flow cytometry, Western blot,
immunoprecipitation, fluorescence spectroscopy, chemiluminescence,
mass spectrometry, or absorbance spectroscopy. For example, the
identity of the membrane-receiver complexes can be assessed by the
mRNA content of the complexes, e.g., by RT-PCR, flow cytometry, or
northern blot. The identity of the membrane-receiver complexes can
be assessed by nuclear material content, e.g., by flow cytometry,
microscopy, or southern blot, using, e.g., a nuclear stain or a
nucleic acid probe. Alternatively or in addition, the identity of
the membrane-receiver complexes is assessed by lipid content of the
complexes, e.g. by flow cytometry, liquid chromatography, or by
mass spectrometry.
[0781] In some embodiments, the identity of the membrane-receiver
complexes is assessed by metabolic activity of the complexes, e.g.
by mass spectrometry, chemiluminescence, fluorescence spectroscopy,
absorbance spectroscopy. Metabolic activity can be assessed by ATP
consumption rate and/or the metabolic activity is assessed
measuring 2,3-diphosphoglycerate (2,3-DPG) level in the synthetic
membrane-receiver complex. The metabolic activity can be assessed
as the rate of metabolism of one of the following, including but
not limited to, Acetylsalicylic acid, N-Acetylcystein,
4-Aminophenol, Azathioprine, Bunolol, Captopril, Chlorpromazine,
Dapsone, Daunorubicin, Dehydroepiandrosterone, Didanosin, Dopamine,
Epinephrine, Esmolol, Estradiol, Estrone, Etoposide, Haloperidol,
Heroin, Insulin, Isoproterenol, Isosorbide dinitrate, LY 217896,
6-mercaptopurine, Misonidazole, Nitroglycerin, Norepinephrine,
Para-aminobenzoic acid. In some embodiments, the identity of the
membrane-receiver complexes is assessed by partitioning of a
substrate by the complexes, e.g by mass spectrometry,
chemiluminescence, fluorescence spectroscopy, or absorbance
spectroscopy. The substrate can be one of the following, including
but not limited to, Acetazolamide, Arbutine, Bumetamide,
Creatinine, Darstine, Desethyldorzolamide, Digoxigenin
digitoxoside, Digoxin-16'-glucuronide, Epinephrine, Gentamycin,
Hippuric acid, Metformin, Norepinephrine, p-Aminohippuric acid,
Papaverine, Penicillin G, Phenol red, Serotonin, Sulfosalicylic
acid, Tacrolimus, Tetracycline, Tucaresol, and Vancomycin.
[0782] In one embodiment, the population of synthetic
membrane-receiver omplexes is differentiated from a precursor cell
or complex. In this embodiment, the differentiation state of the
population of synthetic membrane-receiver complexes is assessed by
an in vitro assay. The in vitro assays include those described
herein for assessing the identity of the complexes, including but
not limited to expansion rate, number, protein content or
expression level, mRNA content or expression level, lipid content,
partition of a substrate, catalytic activity, or metabolic
activity.
[0783] In some embodiments, the membrane-receiver complexes are
cultured and the differentiation state of the complexes is assessed
at multiple time points over the course of the culture process.
[0784] Synthetic membrane-receiver complexes may be generated using
reticulocytes as a source for starting material. The purity of
isolated reticulocytes may be assessed using microscopy in that
reticulocytes are characterized by a reticular (mesh-like) network
of ribosomal RNA that becomes visible under a microscope with
certain stains such as new methylene blue or brilliant cresyl blue.
Surface expression of transferrin receptor (CD71) is also higher on
reticulocytes and decreases and they mature to erythrocytes,
allowing for enrichment and analysis of reticulocyte populations
using anti-CD71 antibodies (See, e.g., Miltenyi CD71 microbeads
product insert No. 130-046-201). Alternatively, analysis of
creatine and hemoglobin A1C content and pyruvate kinase, aspartate
aminotransferase, and porphobilinogen deaminase enzyme activity may
be used to assess properties of the isolated reticulocytes relative
to mature erythrocytes (See, e.g., Brun et al., Blood 76:2397-2403
(1990)). For example, the activity of porphobilinogen deaminase is
nearly 9 fold higher whereas the hemoglobin A1C content is nearly
10 fold less in reticulocytes relative to mature erythrocytes.
[0785] In some embodiments, cells suitable for generating synthetic
membrane-receiver complexes are differentiated ex vivo and/or in
vivo from one or more stem cells. In one embodiment, the one or
more stem cells are one or more hematopoietic stem cells. Various
assays may be performed to confirm the ex vivo differentiation of
cultured hematopoietic stem cells into reticulocytes and
erythrocytes, including, for example, microscopy, hematology, flow
cytometry, deformability measurements, enzyme activities, and
hemoglobin analysis and functional properties (Giarratana et al.,
Nature Biotech. 23:69-74 (2005)). The phenotype of cultured
hematopoietic stem cells may be assessed using microscopy of cells
stained, for example, with Cresyl Brilliant blue. Reticulocytes,
for example, exhibit a reticular network of ribosomal RNA under
these staining conditions whereas erythrocytes are devoid of
staining. Enucleated cells may also be monitored for standard
hematological variables including mean corpuscular volume (MCV;
femtoliters (fL)), mean corpuscular hemoglobin concentration (MCHC;
%) and mean corpuscular hemoglobin (MCH; pg/cell) using, for
example, an XE2100 automat (Sysmex, Roche Diagnostics).
[0786] In some embodiments, the synthetic membrane-receiver
complexes are assessed for their basic physical properties, e.g.,
size, mass, volume, diameter, buoyancy, density, and membrane
properties, e.g., viscosity, deformability fluctuation, and
fluidity.
[0787] In one embodiment, the diameter of the synthetic
membrane-receiver complexes is measured by microscopy or by
automated instrumentation, e.g., a hematological analysis
instrument. In one embodiment the diameter of the synthetic
membrane-receiver complexes is between about 1-20 microns. In one
embodiment, the diameter of the synthetic membrane-receiver
complexes is at least in one dimension between about 1-20 microns.
In one embodiment, the diameter of the synthetic membrane-receiver
complexes is less than about 1 micron. In one embodiment, the
diameter of the complexes in one dimension is larger than about 20
microns. In one embodiment, the diameter of the synthetic
membrane-receiver complexes is between about 1 micron and about 20
microns, between about 2 microns and about 20 microns between about
3 microns and about 20 microns between about 4 microns and about 20
microns between about 5 microns and about 20 microns between about
6 microns and about 20 microns, between about 5 microns and about
15 microns or between about 10 microns and about 30 microns.
[0788] In one embodiment, the mean corpuscular volume of the
synthetic membrane-receiver complexes is measured using a
hematological analysis instrument. In one embodiment the volume of
the mean corpuscular volume of the complexes is greater than 10 fL,
20 fL, 30 fL, 40 fL, 50 fL, 60 fL, 70 fL, 80 fL, 90 fL, 100 fL, 110
fL, 120 fL, 130 fL, 140 fL, 150 fL, or greater than 150 fL. In one
embodiment the mean corpuscular volume of the complexes is less
than 30 fL, 40 fL, 50 fL, 60 fL, 70 fL, 80 fL, 90 fL, 100 fL, 110
fL, 120 fL, 130 fL, 140 fL, 150 fL, 160 fL, 170 fL, 180 fL, 190 fL,
200 fL, or less than 200 fL. In one embodiment the mean corpuscular
volume of the complexes is between 80-100 femtoliters
[0789] In one embodiment the average buoyant mass of the synthetic
membrane-receiver complexes (pg/cell) is measured using a suspended
microchannel resonatory or a double suspended microchannel
resonatory (see e.g., Byun et al PNAS 2013 110(19):7580 and Bryan
et al. Lab Chip 2014 14(3):569).
[0790] In one embodiment the dry density of the synthetic
membrane-receiver complexes is measured by buoyant mass in an
H2O-D2O exchange assay (see e.g., Feijo Delgado et al., PLOS One
2013 8(7):e67590).
[0791] In some embodiments, the synthetic membrane-receiver
complexes have an average membrane deformability fluctuation of
standard deviation greater than 10, 20, 30, 40, 50, 60, 70, 80, 90,
100 or greater than 100 mrad as measured by spatial light
interference microscopy (SLIM) (see e.g., Bhaduri et al., Sci
Reports 2014, 4:6211).
[0792] In one embodiment, the average membrane viscosity of a
population of synthetic membrane-receiver complexes is measured by
detecting the average fluorescence upon incubation with
viscosity-dependent quantum yield fluorophores (see e.g., Haidekker
et al. Chem & Biol 2001 8(2):123).
[0793] In one embodiment, the membrane fluidity of the synthetic
membrane-receiver complexes is measured by fluorescence
polarization, e.g., with BMG Labtech POLARstar Omega microplate
reader.
[0794] For example, to measure deformability reticulocytes may be
separated from nucleated cells on day 15 of culture, for example,
by passage through a deleukocyting filter (e.g., Leucolab LCG2,
Macopharma) and subsequently assayed using ektacytometry. The
enucleated cells are suspended in 4% polyvinylpyrrolidone solution
and then exposed to an increasing osmotic gradient from 60 to 450
mosM. Changes in the laser diffraction pattern (deformability
index) of the cells are recorded as a function of osmolarity, to
assess the dynamic deformability of the cell membrane. The maximum
deformability index achieved at a physiologically relevant
osmolarity is related to the mean surface area of erythrocytes.
[0795] In some embodiments, the synthetic membrane-receiver
complexes are analyzed for hemoglobin contents. Assays of
hemoglobin may be used to assess the phenotype of differentiated
cells (Giarratana et al., Nature Biotech. 23:69-74 (2005)). For
example, high performance liquid chromatography (HPLC) using a
Bio-Rad Variant II Hb analyzer (Bio-Rad Laboratories) may be used
to assess the percentage of various hemoglobin fractions. Oxygen
equilibrium may be measured using a continuous method with a
double-wavelength spectrophotometer (e.g., Hemox analyzer, TCS).
The binding properties of hemoglobin may be assessed using flash
photolysis. In this method, the rebinding of CO to intracellular
hemoglobin tetramers are analyzed at 436 nm after photolysis with a
10 nanosecond pulse at 532 nm.
[0796] The synthetic membrane-receiver complexes described herein
can be purified following manufacture if desired. Many suitable
methods of purification are known in the art. For example, the
synthetic membrane-receiver complexes are purified by
centrifugation, magnetophoresis, irradiation, acoustophoresis, and
chemical or physical enucleation. In one embodiment synthetic
membrane-receiver complexes are purified by ex vivo maturation
with, e.g., a stromal cell co-culture. In one embodiment, synthetic
membrane-receiver complexes are purified by chemical or enzymatic
treatment of complexes, e.g by treatment with a deglycosylation
enzyme.
[0797] In one embodiment the synthetic membrane-receiver
polypeptide complexes are purified by disabling any residual
replicative potential of the membrane-receiver polypeptide
complexes. In one embodiment the synthetic membrane-receiver
polypeptide complexes are subjected to radiation, e.g., X rays,
gamma rays, beta particles, alpha particles, neutrons, protons,
elemental nuclei, UV rays in order to damage residual
replication-competent nucleic acids.
[0798] Ionizing radiation is energy transmitted via X rays, gamma
rays, beta particles (high-speed electrons), alpha particles (the
nucleus of the helium atom), neutrons, protons, and other heavy
ions such as the nuclei of argon, nitrogen, carbon, and other
elements. X rays and gamma rays are electromagnetic waves like
light, but their energy is much higher than that of light (their
wavelengths are much shorter). Ultraviolet (UV) light is a
radiation of intermediate energy that can damage cells but UV light
differs from the forms of electromagnetic radiation mentioned above
in that it does not cause ionization (loss of an electron) in atoms
or molecules, but rather excitation (change in energy level of an
electron). The other forms of radiation--particles--are either
negatively charged (electrons), positively charged (protons, alpha
rays, and other heavy ions), or electrically neutral
(neutrons).
[0799] Radiation-induced ionizations may act directly on the
cellular component molecules or indirectly on water molecules,
causing water-derived radicals. Radicals react with nearby
molecules in a very short time, resulting in breakage of chemical
bonds or oxidation (addition of oxygen atoms) of the affected
molecules. The major effect in cells is DNA breaks. Since DNA
consists of a pair of complementary double strands, breaks of
either a single strand or both strands can occur. However, the
latter is believed to be much more important biologically. Most
single-strand breaks can be repaired normally thanks to the
double-stranded nature of the DNA molecule (the two strands
complement each other, so that an intact strand can serve as a
template for repair of its damaged, opposite strand). In the case
of double-strand breaks, however, repair is more difficult and
erroneous rejoining of broken ends may occur. These so-called
misrepairs result in induction of mutations, chromosome
aberrations, or cell death.
[0800] Deletion of DNA segments is the predominant form of
radiation damage in cells that survive irradiation. It may be
caused by (1) misrepair of two separate double-strand breaks in a
DNA molecule with joining of the two outer ends and loss of the
fragment between the breaks or (2) the process of cleaning (enzyme
digestion of nucleotides--the component molecules of DNA) of the
broken ends before rejoining to repair one double-strand break.
[0801] Radiations differ not only by their constituents (electrons,
protons, neutrons, etc.) but also by their energy. Radiations that
cause dense ionization along their track (such as neutrons) are
called high-linear-energy-transfer (high-LET) radiation, a physical
parameter to describe average energy released per unit length of
the track. (See the accompanying figure.) Low-LET radiations
produce ionizations only sparsely along their track and, hence,
almost homogeneously within a cell. Radiation dose is the amount of
energy per unit of biological material (e.g., number of ionizations
per cell). Thus, high-LET radiations are more destructive to
biological material than low-LET radiations--such as X and gamma
rays--because at the same dose, the low-LET radiations induce the
same number of radicals more sparsely within a cell, whereas the
high-LET radiations--such as neutrons and alpha particles--transfer
most of their energy to a small region of the cell. The localized
DNA damage caused by dense ionizations from high-LET radiations is
more difficult to repair than the diffuse DNA damage caused by the
sparse ionizations from low-LET radiations.
[0802] In one embodiment, a population of synthetic
membrane-receiver polypeptide complexes are subjected to gamma
irradiation using an irradiation dose of more than 1, 5, 10, 15,
20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, or more than 100
kGy.
[0803] In one embodiment, a population of synthetic
membrane-receiver polypeptide complexes are subjected to X-ray
irradiation using an irradiation dose of more than 0.1, 0.5, 1, 5,
10, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400,
500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000,
8000, 9000, 10000, or greater than 10000 mSv.
[0804] The purity of a population of synthetic membrane-receiver
complexes can be assessed by measuring the homogeneity of the
population. In one embodiment, the average distribution width of
the synthetic membrane-receiver complexes is measured by a
hematological analysis instrument. In one embodiment, the
population of synthetic membrane-receiver complexes has a
reticulocyte to non-reticulocyte ratio greater than 10, 100, 1000,
10.sup.4, 10.sup.5, 10.sup.6, or greater than 10.sup.6. The
homogeneity of the population of synthetic membrane-receiver
complexes may be assessed by measuring the stromal cell content of
the population. In one embodiment, the population of synthetic
membrane-receiver complexes has less than 1 ppb of stromal cells.
Alternatively or in addition, the homogeneity of the population of
synthetic membrane-receiver complexes is assessed by measuring the
viral titer and/or a bacterial colony forming potential of the
population.
[0805] In one embodiment the homogeneity of a population of
synthetic membrane-receiver complexes is assessed by an in vitro
assay. The in vitro assays include those described herein for
assessing the identity of the complexes, including but not limited
to expansion rate, number, protein content or expression level,
mRNA content or expression level, lipid content, partition of a
substrate, catalytic activity, or metabolic activity.
[0806] Mature erythrocytes for use in generating the synthetic
membrane-receiver complexes may be isolated using various methods
such as, for example, a cell washer, a continuous flow cell
separator, density gradient separation, fluorescence-activated cell
sorting (FACS), Miltenyi immunomagnetic depletion (MACS), or a
combination of these methods (See, e.g., van der Berg et al., Clin.
Chem. 33:1081-1082 (1987); Bar-Zvi et al., J. Biol. Chem.
262:17719-17723 (1987); Goodman et al., Exp. Biol. Med.
232:1470-1476 (2007)).
[0807] Erythrocytes may be isolated from whole blood by simple
centrifugation (See, e.g., van der Berg et al., Clin. Chem.
33:1081-1082 (1987)). For example, EDTA-anticoagulated whole blood
may be centrifuged at 800.times.g for 10 min at 4.degree. C. The
platelet-rich plasma and buffy coat are removed and the red blood
cells are washed three times with isotonic saline solution (NaCl, 9
g/L).
[0808] Alternatively, erythrocytes may be isolated using density
gradient centrifugation with various separation mediums such as,
for example, Ficoll, Hypaque, Histopaque, Percoll, Sigmacell, or
combinations thereof. For example, a volume of Histopaque-1077 is
layered on top of an equal volume of Histopaque-1119.
EDTA-anticoagulated whole blood diluted 1:1 in an equal volume of
isotonic saline solution (NaCl, 9 g/L) is layered on top of the
Histopaque and the sample is centrifuged at 700.times.g for 30 mM
at room temperature. Under these conditions, granulocytes migrate
to the 1077/1119 interface, lymphocytes, other mononuclear cells
and platelets remain at the plasma/1077 interface, and the red
blood cells are pelleted. The red blood cells are washed twice with
isotonic saline solution.
[0809] Alternatively, erythrocytes may be isolated by
centrifugation using a Percoll step gradient (See, e.g., Bar-Zvi et
al., J. Biol. Chem. 262:17719-17723 (1987)). For example, fresh
blood is mixed with an anticoagulant solution containing 75 mM
sodium citrate and 38 mM citric acid and the cells washed briefly
in Hepes-buffered saline. Leukocytes and platelets are removed by
adsorption with a mixture of .alpha.-cellulose and Sigmacell (1:1).
The erythrocytes are further isolated from reticulocytes and
residual white blood cells by centrifugation through a 45/75%
Percoll step gradient for 10 mM at 2500 rpm in a Sorvall SS34
rotor. The erythrocytes are recovered in the pellet while
reticulocytes band at the 45/75% interface and the remaining white
blood cells band at the 0/45% interface. The Percoll is removed
from the erythrocytes by several washes in Hepes-buffered saline.
Other materials that may be used to generate density gradients for
isolation of erythrocytes include OptiPrep.TM., a 60% solution of
iodixanol in water (from Axis-Shield, Dundee, Scotland).
[0810] Erythrocytes may be separated from reticulocytes, for
example, using flow cytometry (See, e.g., Goodman el al., Exp.
Biol. Med. 232:1470-1476 (2007)). In this instance, whole blood is
centrifuged (550.times.g, 20 mM, 25.degree. C.) to separate cells
from plasma. The cell pellet is resuspended in phosphate buffered
saline solution and further fractionated on Ficoll-Paque (1.077
density), for example, by centrifugation (400.times.g, 30 mM,
25.degree. C.) to separate the erythrocytes from the white blood
cells. The resulting cell pellet is resuspended in RPMI
supplemented with 10% fetal bovine serum and sorted on a FACS
instrument such as, for example, a Becton Dickinson FACSCalibur (BD
Biosciences, Franklin Lakes, N.J., USA) based on size and
granularity.
[0811] Erythrocytes may be isolated by immunomagnetic depletion
(See, e.g., Goodman, et al., (2007) Exp. Biol. Med. 232:1470-1476).
In this instance, magnetic beads with cell-type specific antibodies
are used to eliminate non-erythrocytes. For example, erythrocytes
are isolated from the majority of other blood components using a
density gradient as described herein followed by immunomagnetic
depletion of any residual reticulocytes. The cells are pre-treated
with human antibody serum for 20 min at 25.degree. C. and then
treated with antibodies against reticulocyte specific antigens such
as, for example, CD71 and CD36. The antibodies may be directly
attached to magnetic beads or conjugated to PE, for example, to
which magnetic beads with anti-PE antibody will react. The
antibody-magnetic bead complex is able to selectively extract
residual reticulocytes, for example, from the erythrocyte
population.
[0812] Erythrocytes may also be isolated using apheresis. The
process of apheresis involves removal of whole blood from a patient
or donor, separation of blood components using centrifugation or
cell sorting, withdrawal of one or more of the separated portions,
and transfusion of remaining components back into the patient or
donor. A number of instruments are currently in use for this
purpose such as for example the Amicus and Alyx instruments from
Baxter (Deerfield, Ill., USA), the Trima Accel instrument from
Gambro BCT (Lakewood, Colo., USA), and the MCS+9000 instrument from
Haemonetics (Braintree, Mass., USA). Additional purification
methods may be necessary to achieve the appropriate degree of cell
purity.
[0813] In some embodiments, the synthetic membrane-receiver
complexes are differentiated ex vivo and/or in vivo from one or
more reticulocytes. Reticulocytes may be used to generate synthetic
membrane-receiver complexes. Reticulocytes are immature red blood
cells and compose approximately 1% of the red blood cells in the
human body. Reticulocytes develop and mature in the bone marrow.
Once released into circulation, reticulocytes rapidly undergo
terminal differentiation to mature erythrocytes. Like mature
erythrocytes, reticulocytes do not have a cell nucleus. Unlike
mature erythrocytes, reticulocytes maintain the ability to perform
protein synthesis. In some embodiments, exogenous nucleic acid
(such as mRNA) encoding a receiver is introduced into reticulocytes
to generate synthetic membrane-receiver complexes.
[0814] Reticulocytes of varying age may be isolated from peripheral
blood based on the differences in cell density as the reticulocytes
mature. Reticulocytes may be isolated from peripheral blood using
differential centrifugation through various density gradients. For
example, Percoll gradients may be used to isolate reticulocytes
(See, e.g., Noble el al., Blood 74:475-481 (1989)). Sterile
isotonic Percoll solutions of density 1.096 and 1.058 g/ml are made
by diluting Percoll (Sigma-Aldrich, Saint Louis, Mo., USA) to a
final concentration of 10 mM triethanolamine, 117 mM NaCl, 5 mM
glucose, and 1.5 mg/ml bovine serum albumin (BSA). These solutions
have an osmolarity between 295 and 310 mOsm. Five milliliters, for
example, of the first Percoll solution (density 1.096) is added to
a sterile 15 ml conical centrifuge tube. Two milliliters, for
example, of the second Percoll solution (density 1.058) is layered
over the higher density first Percoll solution. Two to four
milliliters of whole blood are layered on top of the tube. The tube
is centrifuged at 250.times.g for 30 mM in a refrigerated
centrifuge with swing-out tube holders. Reticulocytes and some
white cells migrate to the interface between the two Percoll
layers. The cells at the interface are transferred to a new tube
and washed twice with phosphate buffered saline (PBS) with 5 mM
glucose, 0.03 mM sodium azide and 1 mg/ml BSA. Residual white blood
cells are removed by chromatography in PBS over a size exclusion
column.
[0815] Alternatively, reticulocytes may be isolated by positive
selection using an immunomagnetic separation approach (See, e.g.,
Brun et al., Blood 76:2397-2403 (1990)). This approach takes
advantage of the large number of transferrin receptors that are
expressed on the surface of reticulocytes relative to erythrocytes
prior to maturation. Magnetic beads coated with an antibody to the
transferrin receptor may be used to selectively isolate
reticulocytes from a mixed blood cell population. Antibodies to the
transferrin receptor of a variety of mammalian species, including
human, are available from commercial sources (e.g., Affinity
BioReagents, Golden, Colo., USA; Sigma-Aldrich, Saint Louis, Mo.,
USA). The transferrin antibody may be directly linked to the
magnetic beads. Alternatively, the transferrin antibody may be
indirectly linked to the magnetic beads via a secondary antibody.
For example, mouse monoclonal antibody 10D2 (Affinity BioReagents,
Golden, Colo., USA) against human transferrin may be mixed with
immunomagnetic beads coated with a sheep anti-mouse immunoglobulin
G (Dynal/Invitrogen, Carlsbad, Calif., USA). The immunomagnetic
beads are then incubated with a leukocyte-depleted red blood cell
fraction. The beads and red blood cells are incubated at 22.degree.
C. with gentle mixing for 60-90 min followed by isolation of the
beads with attached reticulocytes using a magnetic field. The
isolated reticulocytes may be removed from the magnetic beads
using, for example, DETACHaBEAD.RTM. solution (from Invitrogen,
Carlsbad, Calif., USA). Alternatively, reticulocytes may be
isolated from in vitro growth and maturation of CD34+ hematopoietic
stem cells using the methods described herein.
[0816] Terminally-differentiated, enucleated erythrocytes can be
separated from other cells based on their DNA content. In a
non-limiting example, cells are first labeled with a vital DNA dye,
such as Hoechst 33342 (Invitrogen Corp.). Hoechst 33342 is a
cell-permeant nuclear counterstain that emits blue fluorescence
when bound to double-stranded DNA. Undifferentiated precursor
cells, macrophages or other nucleated cells in the culture are
stained by Hoechst 33342, while enucleated erythrocytes are
Hoechst-negative. The Hoechst-positive cells can be separated from
enucleated erythrocytes by using fluorescence activated cell
sorters or other cell sorting techniques. The Hoechst dye can be
removed from the isolated erythrocytes by dialysis or other
suitable methods.
[0817] A population of synthetic membrane-receiver complexes can be
purified by reducing the nuclear material content of the population
of complexes. For example, the enucleation rate of the population
of complexes is increased, and/or the number of enucleated
synthetic membrane-receiver complexes is increased or enriched.
[0818] Populations of synthetic membrane-receiver complexes can be
incubated with a small molecule, e.g., an actin inhibitor, e.g.,
cytochalasin A, B, C, D, E, F, H, J, and then centrifuged to remove
nuclear material. Alternatively or in addition, a population of
synthetic membrane-receiver complexes can be mechanically
manipulated by passing through progressively smaller
size-restrictive filters to remove nuclear material. The population
of synthetic membrane-receiver complexes may also be incubated on a
fibronectin-coated plastic surface to increase the removal of
nuclear material. In one embodiment, the population of synthetic
membrane-receiver complexes is incubated in co-culture with stromal
cells, e.g., macrophages, to increase the removal of nuclear
material.
[0819] In some embodiments, the population of synthetic
membrane-receiver complexes is greater than 5%, 10%, 15%, 20%, 25%,
30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%,
95%, 99%, 99.5%, 99.9%, or greater than 99.9% enucleated.
[0820] In some embodiments, the synthetic membrane-receiver
complexes are not co-cultured with support cells, e.g., with an
adherent stromal layer. In some embodiments, the population of
synthetic membrane-receiver complexes is generated by contacting
erythroid cells with a receiver and differentiating the erythroid
cells to obtain a population of enucleated cells comprising the
receiver. The population of synthetic membrane-receiver complexes
is obtained without an enrichment step, such as gravitational
separation, magnetic or fluorescent sorting, irradiation, poisoning
of nucleated cells, and the like to select for enucleated
cells.
[0821] In some embodiments, the population of synthetic
membrane-receiver complexes is comprised of greater than 5%, 10%,
15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%,
80%, 85%, 90%, 95%, 99%, 99.5%, 99.9%, or greater than 99.9% of
synthetic membrane-receiver complexes that lack nuclear material as
assessed by an assay to detect nuclear material such as those
described herein.
[0822] In some embodiments, the presence, biological activity
and/or function of a receiver, such as a receiver polypeptide
exhibited by synthetic membrane-receiver complexes is assessed.
Many suitable assays are available and known in the art.
[0823] In one embodiment, the receiver is a polypeptide on the
surface of the synthetic membrane-receiver complex. The presence of
the receiver can be assessed by assays including but not limited to
flow cytometry, western blotting, RT-PCR, Northern blotting, Coombs
rosetting, mass spectrometry. In one embodiment, the receiver is a
polypeptide in the interior of the synthetic membrane-receiver
complex. The presence of the receiver can be assessed by assays
including but not limited to Western blotting, RT-PCR, Norther
blotting, PCR, Southern blotting, mass spectrometry.
[0824] In one embodiment, the receiver is a nucleic acid on the
surface of the synthetic membrane-receiver complex. The presence of
the receiver can be assessed by assays including but not limited to
flow cytometry, flow cytometry with a homologous fluorescent probe,
southern blotting, northern blotting, PCR. In one embodiment, the
receiver is a nucleic acid in the interior of the synthetic
membrane-receiver complex. The presence of the receiver can be
assessed by assays including but not limited to southern blotting,
northern blotting, PCR.
[0825] In one embodiment, the receiver is a small molecule on the
surface of the synthetic membrane-receiver complex. The presence of
the receiver can be assessed by assays including but not limited to
flow cytometry, mass spectrometry. In one embodiment, the receiver
is a small molecule in the interior of the synthetic
membrane-receiver complex. The presence of the receiver can be
assessed by assays including but not limited to mass spectrometry,
fluorescence spectroscopy.
[0826] In one embodiment, the receiver is a lipid in the membrane
of the synthetic membrane-receiver complex. The presence of the
receiver can be assessed by assays including but not limited to
mass spectrometry, flow cytometry, membrane solubility,
fluorescence polarization, spatial light interferences
microscopy.
[0827] In one embodiment, the receiver is fluorescent or is fused
to a fluorescent molecule or is co-expressed from an exogenous
nucleic acid (e.g., in a vector) with a fluorescent reporter
protein like GFP. The presence of the receiver in or on the
synthetic membrane-receiver complex can be assessed by assays
including but not limited to flow cytometry, fluorescence
spectroscopy, absorbance spectroscopy.
[0828] In one embodiment, the receiver is a gaseous molecule. The
presence of the receiver in or on the synthetic membrane-receiver
complex can be assessed by assays including but not limited to
chemiluminescence assays, mass spectroscopy.
[0829] The presence of the receiver in or on the synthetic
membrane-receiver complex can be assessed by flow cytometry in a
quantitative fashion using calibration beads such as commercially
available cytometry calibration beads to quantify the number of
receivers on an individual complex. Alternatively or in addition,
the presence of the receiver in or on the synthetic
membrane-receiver complex can be assessed by Western blot in a
quantitative fashion using a standard of known concentration that
is detectable using the same detection reagents as the receiver,
and in this way the number of receivers on an individual complex
can be quantified.
[0830] In some embodiments, the presence of two or more different
receivers can be assessed by the same or different methods, either
simultaneously, in sequential fashion, or in parallel. For example,
in one embodiment a receiver on the surface can be assessed by flow
cytometry using an antibody specific to the receiver and a
different receiver not on the surface that is fluorescent can be
assessed by fluorescent signal using a different channel in flow
cytometry. In a different example, a receiver on the surface can be
assessed by flow cytometry and a different receiver not on the
surface can be assessed by Western blot.
[0831] In a specific embodiment, the receiver is retained on the
synthetic membrane-receiver complex following terminal
differentiation of the cell source. For example, the
membrane-receiver complex is generated from a cultured erythroid
cell and the expression or presence of the receiver is assessed
following terminal differentiation of the cell by a suitable
method, e.g., by flow cytometry, Western blot, immunoprecipitation,
fluorescence spectroscopy, chemiluminescence, Southern blot,
Northern blot, or absorbance spectroscopy.
[0832] In a specific embodiment, the receiver is retained on the
synthetic membrane-receiver complex following circulation in vivo
after administration of the synthetic membrane-receiver complex to
a subject. The synthetic membrane-receiver complex can be injected
into a laboratory animal or animal model, such as a mouse
intravenously, e.g., via the tail vein, or is injected into a human
intravenously. Then blood is drawn and the presence of the receiver
on the synthetic membrane-receiver complex is assessed by suitable
assay, e.g., by flow cytometry, Western blot, immunoprecipitation,
fluorescence spectroscopy, chemiluminescence, Southern blot,
Northern blot, or absorbance spectroscopy.
[0833] In some embodiments, the biological activity of the receiver
in or on the synthetic membrane-receiver complex, the overall
biological activity of the complex, and the overall activity of a
population of complexes can be assessed by in vitro assays.
[0834] In some embodiments, the activity of the synthetic
membrane-receiver complex is rapidly iterated using a model cell
line. For example, a library of suitable receivers is expressed in
a model cell line, e.g., HEK293T or K562, and the activity is
assessed via a suitable assay; then the best receiver candidate,
e.g., the one that is expressed at the highest level or one that
demonstrates the highest activity in the suitable assay, is
expressed, e.g., in cultured erythroid cells to generate synthetic
membrane-receiver complexes.
[0835] In one embodiment, the activity of the synthetic membrane
receiver complex is rapidly iterated using a cultured mouse
erythroid cell model. For example, a library of suitable receivers
is expressed in cultured mouse erythroid cells; activity is
assessed in a suitable mouse model of disease or a suitable mouse
model system for assessing activity; the best receiver candidate,
e.g., the one that is expressed at the highest level or the one
that demonstrates the highest activity in the suitable assay, is
then expressed, e.g., in cultured erythroid cells to generate
synthetic membrane-receiver complex.
[0836] In some instances, the receiver is an enzyme and the
activity of the receiver can be assessed by an enzymatic assay in
which the disappearance of a specific substrate molecule is
detected or the appearance of a specific product molecule is
detected. Such assays include but are not limited to, colorimetric
assays, mass spectrometry, HPLC, fluorescent assays.
[0837] For example, a) the receiver is adenosine deaminase (ADA)
and the enzymatic assay detects the conversion of adenosine to
inosine; b) the receiver is phenylalanine hydroxylase (PAH) and the
assay detects the conversion of phenylalanine to tyrosine; c) the
receiver is phenylalanine ammonia lyase (PAL) and the assay detects
the conversion of phenylalanine to trans-cinnamic acid; d) the
receiver is thymidine phosphorylase (TP) and the assay detects the
conversion of thymidine to thymine and 2-deoxy-ribose; e) the
receiver is Purine nucleoside phosphorylase (PNP) and the assay
detects the conversion of inosine to hypoxanthine, adenosine into
adenine, and guanosine into guanine; f) the receiver is
homogentisate 1,2-dioxygenase (HDG) and the assay detects the
conversion of homogentisate to maleylacetoacetate; g) the receiver
is cystathionine beta synthase and the assay detects the conversion
of serine and homocysteine to cystathionine; h) the receiver is
oxalate oxidase and the assay detects the oxidation of oxalate.
[0838] In some embodiments, activity of the synthetic
membrane-receiver complex is assessed in an animal model, for
example a mouse model, and immunodeficient mouse, or an NSG mouse,
of a disease, for example a metabolic disease or an enzyme
deficiency, or that can demonstrate the effect of the synthetic
membrane-receiver complex, for example a mouse into which a
substrate is injected and the product of the receiver-mediated
conversion measured.
[0839] In one embodiment, the receiver is complement receptor 1
(CR1) polypeptide, a derivative or functional fragment thereof. The
activity of the CR1 receiver can be assessed in several ways
including, for example, the specific capture of immune complexes by
the CR1 receiver, the efficient transfer of the immune complexes to
macrophages, or the in vivo clearance of immune complexes from a
mouse.
[0840] Functionality of erythroid cells overexpressing CR1 receiver
may be assessed by one or more processes: capture of immune
complexes on the erythroid cell surface comprising CR1 receiver,
release of the immune complexes to macrophages while sparing the
erythroid cell comprising CR1 receiver, and proper circulation of
the erythroid cells comprising CR1 receiver. These three parameters
can be assayed in vitro Immune complex capture assays are described
in the art, e.g., Oudin et al., J Immunol 2000 and Schifferli et
al., J Immunol 1991. For example, labeled immune complexes are
incubated with erythroid cells expressing native CR1 or CR1
receiver polypeptide or a fragment thereof and the number of immune
complexes captured by the erythroid cells is assayed by flow
cytometry. Macrophage transfer assays are described in the art,
e.g., Kuhn et al., J Immunol 1998. For example, labeled immune
complexes loaded onto erythrocytes expressing native CR1 or CR1
receiver polypeptide or a fragment thereof are incubated with
macrophages. The transfer of immune complex from erythrocyte
surface to macrophage, and the consumption or sparing of
erythrocytes by macrophages, can be measured by flow cytometry.
Proper circulation can be predicted by analyzing erythroid cell
morphology and deformability. Morphology of erythroid cells
expressing native CR1 or CR1 receiver polypeptide or a fragment
thereof can be assessed by eye using standard microscopy
techniques, as described e.g., by Giarratana et al., Blood 2011 and
Repik et al., Clin Exp Immunol 2005. Deformability of erythroid
cells expressing native CR1 or CR1 receiver polypeptide or a
fragment thereof can be assessed by ektacytometry, also known as
laser-assisted optical rotational cell analysis (LORCA), as
described e.g., Giarratana et al., Blood 2011.
[0841] For example, a synthetic membrane-CR1 receiver complex (the
complex comprises a CR1 polypeptide receiver) is incubated with
immune complexes, such as in vitro generated immune complexes or
patient-derived immune complexes. The capture of the immune
complexes by the CR1 receiver is assessed by, for example, flow
cytometry using a fluorescent marker in the immune complex or by
flow cytometry using a secondary detection agent against an element
of the immune complex.
[0842] In one embodiment, the synthetic membrane-CR1 receiver
complex is first incubated with immune complexes and then incubated
with macrophages, such as primary macrophages, primary monocytes,
cultured macrophages, cultured monocytpes, U937 cells,
PMA-activated U937 cells, AA9 cells, RAW 264.7 cells, J774 Cells,
THP1 cells, KG-1 cells, NR8383 cells, MV-4-11 cells, 3D4/31 cells,
MD cells, Fcwf-4 cells, DH82 cells. The macrophages are assayed by,
for example, flow cytometry or radiography, for the presence of
immune complexes transferred by the synthetic membrane-CR1 receiver
complex. The transfer of captured immune complexes from cultured
erythroid cells to macrophages is a standard assay in the art, see
for example: Repik et al. 2005 Clin Exp Immunol. 140:230; Li et al.
2010 Infection Immunity 78(7):3129.
[0843] In one embodiment, activity of the synthetic membrane-CR1
receiver complex is assessed in an animal model. For example, a
suitable mouse model may be used, such as an immunodeficient mouse,
or an NSG mouse. The mouse disease model can be for example an
immune complex disease, such as lupus. Mouse models include
NZBWF1/J, MRL/MpJ, MRL/MpJ-Fas(lpr), Smn.C3-Fasl/J, NZM2410/Aeg,
129S4-Cd48, Cg-Sle1, NZM-Sle1 Sle2 Sle3/LmoJ, and BXSB.129P2.
Alternatively or in addition, a disease phenotype may be introduced
into a mouse, e.g., by injection of immune complexes. The synthetic
membrane-CR1 receiver complexes may be injected into any suitable
mouse (or other animal model) to test one or more biological
effects of the complex, e.g., the clearance of the injected immune
complexes by the synthetic membrane-CR1 receiver complex.
[0844] In some embodiments, the synthetic membrane-receiver complex
comprising a CR1 receiver is not generated in a mouse and/or are
not generated from mouse erythroid cells. In some embodiments, the
synthetic membrane-receiver complex comprising a CR1 receiver is
not generated in a laboratory animal and/or are not generated from
an erythroid cells derived from a laboratory animal.
[0845] In one embodiment, the receiver is a complement regulatory
molecule or has complement regulatory activity. This activity of
the receiver can be assessed by both in vitro and in vivo assays.
For instance, the activity of the receiver can be assessed by
measuring the reduction in an in vitro complement activation assay,
e.g., CH50 assay that measures complement-mediated lysis of
sensitized sheep erythroctyes, or AH50 assay that measured
alternate pathway complement-mediated lysis of non-sensitized
rabbit erythrocytes. Alternatively, the activity of the receiver
can be assessed by detecting the cleavage or absence of cleavage,
which may or may not expose a neoepitope, of a recombinant
complement component that has been incubated with the receiver,
including but not limited to e.g., the cleavage of recombinant C2
into C2a and C2b, the cleavage of factor B into factor Ba and
factor Bb, the cleavage of factor C3b into iC3bH and iC3bL, the
cleavage of C3bBb into C3b and Bb, the cleavage of C4bBb into C4b
and Bb, or the cleavage of factor C4b into iC4bH and iC4bL. The
cleavage or absence of cleavage of a suitable recombinant
complement component can be assessed by protein analysis methods
known in the art including, but not limited to, e.g.,
chromatography, gel electrophoresis, ELISA, and western blotting.
Suitable in vivo assays for receiver activity include injection of
the synthetic membrane-receiver complex into animal, for example a
mouse, and examining the deposition of complement factors, for
example membrane attack complex, by histological staining.
[0846] In one embodiment, the receiver is capable of binding or
capturing a target and the activity of the receiver can be assessed
by detecting the captured target on the receiver in vitro or in
vivo.
[0847] In one embodiment, the synthetic membrane-receiver complex
is incubated with the target in vitro, and the capture of the
target by the receiver is detectected using an in vitro assay
including but not limited to, for example, flow cytometry,
immunohistochemistry, magnetic separation, radiography,
colony-forming assays, microscopy.
[0848] In one embodiment, the synthetic membrane-receiver complex
is incubated with the target in vitro, and the capture of the
target by the receiver is detected using an in vitro co-culture
assay including but not limited to for example a macrophage
consumption assay of opsonized receiver complex, a T cell
activation assay, a B cell stimulation assay, a mast cell
degranulation assay, an infectious potential assay.
[0849] In an embodiment, the synthetic membrane-receiver complex is
incubated with the target in vitro, and the release or off-rate of
the captured target is measured using an in vitro assay including
but not limited to, for example, flow cytometry,
immunohistochemistry, magnetic separation, radiography,
colony-forming assays, microscopy.
[0850] The capture of the target by the synthetic membrane-receiver
complex can be assayed in an in vivo assay, for example in an
animal, including a mouse model of diseases in which the target is
naturally present in the mouse. Suitable diseases include bacterial
infections, viral infections, fungal infections, immune complex
diseases, self-antibody diseases, hyperlipidemia, hyperglycemia. In
other mouse models, the target is administered to the mouse
externally, e.g., by injection or by feeding. In these assays, the
capture of the target by the synthetic membrane-receiver complex is
assayed either by examining the animal, e.g. the plasma, the
tissue, for reduction or retention of the target, or by isolating
or collecting the receiver complex from the animal, e.g., from the
blood, from the plasma, from a tissue, and assaying the presence of
the target on the receiver using an in vitro assay including, but
not limited to, for example, flow cytometry, immunohistochemistry,
magnetic separation, radiography, colony-forming assays,
microscopy.
[0851] In some embodiments, the receiver is capable of binding or
capturing a target and substantially increasing the clearance of
the target in vivo, or substantially reducing the concentration of
the target in circulation. The activity of the receiver on the
synthetic membrane-receiver complex can be assessed by detecting
the enhanced clearance of the target in vitro or in vivo.
[0852] In one embodiment, the synthetic membrane-receiver complex
is incubated with the target in vitro, and the capture of the
target by the receiver is detectected using an in vitro assay
including but not limited to, for example, flow cytometry,
immunohistochemistry, magnetic separation, radiography,
colony-forming assays, microscopy. Subsequently, the synthetic
membrane-receiver complex is incubated in a co-culture assay with a
cell known to promote clearance, for example a macrophage or a
monocyte, and the clearance of the target and receiver complex is
assessed by, for example, flow cytometry, immunohistochemistry,
magnetic separation, radiography, colony-forming assays,
microscopy.
[0853] In one embodiment, the synthetic membrane-receiver complex
is incubated with the target in vitro, and the capture of the
target by the receiver is detectected using an in vitro assay
including but not limited to, for example, flow cytometry,
immunohistochemistry, magnetic separation, radiography,
colony-forming assays, microscopy. Subsequently, the synthetic
membrane-receiver complex is incubated in a physical system that
mimics the clearance mechanism of the complex in vivo, for example
an artificial spleen, a microchannel, a packed column, a resin, a
tissue explant, a centrifuge, and the clearance of the target and
receiver complex is assessed by, for example, flow cytometry,
immunohistochemistry, magnetic separation, radiography,
colony-forming assays, microscopy.
[0854] In one embodiment, the clearance of the target by the
synthetic membrane-receiver complex is assayed in an in vivo assay,
for example in an animal, including, for example, a mouse model of
diseases in which the target is naturally present in the mouse, for
example bacterial infection, viral infection, fungal infection,
immune complex disease, self-antibody disease, hyperlipidemia,
hyperglycemia, or for example, a mouse model in which the target is
administered to the mouse externally, e.g., by injection or by
feeding. In these assays, the clearance of the target by the
receiver complex is assayed either by examining the animal, e.g.
the plasma, the tissue, for reduction of the target, or by
isolating or collecting the synthetic membrane-receiver complex
from the animal, e.g., from the blood, from the plasma, from a
tissue, and assaying the presence of the target on the receiver
using an in vitro assay including, but not limited to, for example,
flow cytometry, immunohistochemistry, magnetic separation,
radiography, colony-forming assays, microscopy.
[0855] In some embodiments, the synthetic membrane-receiver complex
is capable of delivering a suitable receiver to a specific
subcellular compartment, for example a lysosome.
[0856] For example, a receiver may be delivered to the lysosomal
compartment of a target cell, e.g., a macrophage. The successful
delivery of the receiver to the lysosomal compartment of a target
cell is assessed by microscopy and the detection of punctate spots
corresponding to a fluorescent receiver or fluorescent receiver
detection agent. Alternatively or in addition, the successful
delivery of the receiver to the lysosomal compartment of a target
cell is assessed by microscopy and the colocalization of a
fluorescent receiver detection agent with a fluorescent detection
agent for a known lysosomal marker, e.g., lysotracker, LAMP-1.
[0857] In some embodiments, the receiver is an enzyme that can
degrade toxic components that have built up in the lysosome of a
cell exhibiting the genotype or phenotype of, or derived from a
patient with, a lysosomal storage disease. For example, the
receiver is capable of degrading the toxic material built up in the
cell and rescue the cell phenotype, e.g., preventing cell
death.
[0858] The population of synthetic membrane-receiver complexes can
be assessed for the inability of the complexes to replicate, the
ability of the complexes to circulate safely through the
vasculature, and the lack of immunogenicity of the complexes.
[0859] In some embodiments, the safety of the population of
synthetic membrane-receiver complexes is assessed by measuring the
replication potential of the population of complexes using a
suitable in vitro or in vivo assay. For example, tests for a
substantial inability of the synthetic membrane-receiver complexes
to self-replicate include: a) a susbstanital inability to form a
tumor when injected into an immunocompromised mouse; b) a
substantial inability to form a colony when cultured in soft agar;
c) a substantial inability to incorporate thymidine in a thymidine
incorporation assay; d) a substantial lack of positive signal upon
transfection with DNA encoding a fluorescent reporter, e.g., less
than 10%, 1%, 0.1%, 0.01%, 0.001%, 1 ppm, 100 ppb, 10 ppb, 1 ppb,
100 ppt, 10 ppt, 1 ppt, or less than 1 ppt positive signal; e) a
substantial lack of positive signal upon staining with a nuclear
dye, e.g., less than 10%, 1%, 0.1%, 0.01%; and 0.001%, 1 ppm, 100
ppb, 10 ppb, 1 ppb, 100 ppt, 10 ppt, 1 ppt, or less than 1 ppt
positive signal; f) a substantial lack of positive signal upon
staining with cell markers of hematological malignancy, e.g., CKIT,
CD34, EpCam, e.g., less than 10%, 1%, 0.1%, 0.01%, 0.001%, 1 ppm,
100 ppb, 10 ppb, 1 ppb, 100 ppt, 10 ppt, 1 ppt, or less than 1 ppt
positive signal. In certain embodiments, synthetic
membrane-receiver complexes are provided that do not contain a
substantial amount of a replicating nucleic acid.
[0860] In some embodiments, the safety of the population of
synthetic membrane-receiver complexes is assessed by measuring the
ability of an administered complex to circulate in vivo (in the
circulatory system of a subject) without causing substantial
vascular occlusion or induction of the clotting cascade.
Optionally, the circulation pharmacokinetics of the synthetic
membrane-receiver complexes may be assessed.
[0861] In one embodiment, the circulation pharmacokinetics of the
synthetic membrane-receiver complexes is assessed by injecting the
complex into an animal intravenously, such as a mouse. The mouse
can be an NSG (nod-SCID-gamma) immunodeficient mouse. The mouse is
depleted of macrophages prior to injection with the complex, e.g.,
by intraperitoneal injection of human red blood cells, or by
intravenous injection with clodronate liposomes. The synthetic
membrane-receiver complexes can be labeled with a fluoresecent dye,
e.g., CFSE. After injection of the complexes, blood is drawn and
the number of synthetic membrane-receiver complexes remaining is
assessed by, e.g., flow cytometry, western blot, and the clearance
rate of the synthetic membrane-receiver complexes is deduced from
these data. Human red blood cells can be injected into the same
animal model as the synthetic membrane-receiver complexes and the
clearance rates of the complexes and human red blood cells are
compared.
[0862] In one embodiment, the risk of activation of the clotting
cascade by the synthetic membrane-receiver polypeptide complex is
assessed with an in vitro assay. In one embodiment, the synthetic
membrane-receiver polypeptide complex is incubated with human blood
and clotting cascade activation is assessed by measuring the time
required for coagulation in the presence of kaolin,
negatively-charged phospholipids, and calcium (activated partial
thromboplastn time (aPTT) test), see e.g., Exner and Rickard,
Biomedicine 1977 27(2):62, or by measuring the time required for
coagulation in the presence of thromboplastin and calcium
(prothrombin time (PT) test), see e.g., Jaques and Dunlop 1945, Am
J Physiol 145:67. The normal range for the aPTT test is
approximately 25-38 seconds. The normal range for the PT test is
approximately 10-12 seconds.
[0863] In one embodiment, any adverse events induced by the
synthetic membrane-receiver complexes are assessed by injecting the
complex into an animal intravenously and assessing the activation
of the clotting cascade. The level of clotting cascade induction is
assessed by drawing blood and assessing the levels of clotting
cascade components in the plasma by, e.g., Western Blot or ELISA.
The clotting cascade components are typically fibrinogen breakdown
products, e.g., fibrinopeptide A and fibrinopeptide B. For example,
the level of clotting cascade induction is assessed by drawing
blood and assessing the levels of clotting activity in the plasma
by platelet activation assay, e.g., incubating the plasma with
platelets and assessing the activation of the platelets by flow
cytometry, e.g., by staining for markers of activation, e.g., by
staining for PAC-1, CD62p, or CD40L.
[0864] In one embodiment, any adverse events induced by the
synthetic membrane-receiver complexes are assessed by injecting the
complex into an animal intravenously and assessing the activation
of inflammatory pathways. The level of inflammation can be assessed
by drawing blood and assessing the levels of inflammatory cytokines
in the plasma by, e.g., Western Blot or ELISA. In one embodiment,
the inflammatory citokines are interferon gamma, tumor necrosis
factor alpha, or IL-12 fragment p70.
[0865] In one embodiment, any adverse events induced by the
synthetic membrane-receiver complexes are assessed by injecting the
complex into an animal intravenously and assessing the status of
tissues, e.g., liver, spleen, heart, lungs, brain, skin, kidneys.
The status of tissue can be assessed by gross necropsy, dissection
of the tissue, histological staining, and imaging by
microscopy.
[0866] In one embodiment, the ability of the synthetic
membrane-receiver complex to circulate in vivo without causing
substantial vascular occlusion or activation of the clotting
cascade is assessed by measuring the deformability of the complex.
The deformability of the synthetic membrane-receiver complex is
assessed using an in vitro assay. For example, the assay is an
osmotic fragility assay. Mechanical fragility of the synthetic
membrane-receiver complex can be assessed by measuring the
structural integrity in response to shear stress in a Couett-type
shearing system. In one embodiment, the deformability of the
synthetic membrane-receiver complex is assessed using an
Ektacytometer. In one embodiment, the deformability of the
synthetic membrane-receiver complex is assessed by measuring the
elongation index at a defined pressure by laser diffraction using a
laser-assisted optical rotational cell analyzer (LORCA) instrument.
In one embodiment, the deformability of the synthetic
membrane-receiver complex is assessed by measuring the transit time
through a series of micron-scale constrictions of defined
dimensions at a fixed pressure in a microfluidic device. In one
embodiment, the deformability of the synthetic membrane-receiver
complex is assessed by measuring the survival rate through a series
of micron-scale constrictions of defined dimensions at a fixed
pressure in a microfluidic device. The microfluidic device can be
selected from one of the following, including but not limited to, a
poly dimethyl siloxane (PDMS) chip with micron-scale constrictions
(e.g., Hoelzle et al. J Vis Exp 2014 91:e51474); a chip with
funnel-shaped constrictions (e.g., Guo et al. Lab Chip 2012
12:1143); a PDMS chip with pillars (e.g., Zhang et al. PNAS 2012
109(46):18707); or an in vitro artificial spleen microbead packed
column (Guillaume DePlaine et al., Blood 2011, 117(8)).
[0867] In one embodiment, the ability of the synthetic
membrane-receiver complex to circulate in vivo without causing
substantial vascular occlusion or activation of the clotting
cascade is assessed by measuring the vascular occlusion of the
complex. Vascular occlusion of the synthetic membrane-receiver
complex can be assessed using an in vitro assay. For example, the
vascular occlusion of the synthetic membrane-receiver complex is
assessed using an ex vivo assay. The synthetic membrane-receiver
complex is incubated at a 1:1 ratio with reference human red blood
cells and induction of multi-cell rosettes are assessed by light
microscopy in comparison to a reference assay with Rh-mismatched
blood. The vascular occlusion of the synthetic membrane-receiver
complex is assessed by measuring the adhesion of the complex to
human vascular endothelial cells under flow conditions, see e.g.,
Kaul D K, Finnegan E, and Barabino G A (2009) Microcirculation
16(1):97-111. Alternatively or in addition, vascular occlusion is
assessed by measuring the peripheral resistance unit (PRU) increase
in an ex vivo perfusion assay of rat vascular endothelium, see
e.g., Kaul, Fabry and Nagel, PNAS 1989, 86:3356. Further, vascular
occlusion is assessed by intravital microscopy, see e.g., Zennadi
et al. 2007 Blood 110(7):2708. Vascular occlusion may also be
assessed by measuring flow rates and adhesion of the complex in
vitro graduated height flow chambers, see e.g., Zennadi et al 2004,
Blood 104(12):3774.
[0868] In some embodiments, the safety of the population of
synthetic membrane-receiver complexes is assessed by measuring the
immunogenicity of the population of complexes using a suitable in
vitro or in vivo assay.
[0869] For example, the population of synthetic membrane-receiver
complexes a) does not induce agglutination in a Coombs test using
serum from the intended recipient subject or b) does not induce
agglutination in a Coombs test using pooled human serum.
[0870] In one embodiment, the population of synthetic
membrane-receiver complexes is derived from a progenitor cell that
has been genotyped for the predominant blood group antigens and
matched to the blood group antigen genotype of the recipient.
[0871] In one embodiment, the population of synthetic
membrane-receiver complexes comprises a receiver or other exogenous
protein that has less than 10%, 1%, 0.1%, 0.01%, 0.001%, or less
than 0.001% predicted T cell reactivity by an in silico T cell
epitope prediction algorithm.
[0872] In one embodiment, the population of synthetic
membrane-receiver complexes comprises a receiver or other exogenous
protein that has less than 10%, 1%, 0.1%, 0.01%, 0.001%, or less
than 0.001% reactivity in an in vitro T cell activation assay,
e.g., Antitope Inc. EpiScreen assay.
[0873] For example, synthetic membrane-receiver complexes derived
from erythrocytes can be centrifuged and resuspended in appropriate
solution (e.g., standard AS-3 solution) for infusion into subjects
in need thereof. In some embodiments, the synthetic
membrane-receiver complexes to be infused have the same ABO type as
that of the recipient to minimize the risk of infusion-associated
immune reactions. The synthetic membrane-receiver complexes can
also be pretreated to remove blood type-specific antigens or
otherwise reduce antigenicities. Methods suitable for this purpose
include, but are not limited to, those described in U.S. Patent
Application Publication Nos. 20010006772 and 20030207247.
Methods of Treatment and Prevention
[0874] Provided herein are methods of modulating the circulatory
concentration of a target to treat or prevent a disease, disorder
or condition associated with the presence, absence, elevated or
depressed concentration of the target in the circulatory system of
a subject. The subject may suffer from the disease, disorder or
condition or may be at risk of developing the disease, disorder or
condition. The methods provided herein include the administration
of a suitable synthetic membrane-receiver polypeptide complex
described herein in an amount effective to substantially modulate
the circulatory concentration of the target, thereby preventing or
treating the disease, disorder or condition. In some embodiments,
the synthetic membrane-receiver polypeptide complex is formulated
as a pharmaceutical composition. In some embodiments, the
pharmaceutical composition is formulated for intravenous injection
to the subject. The compositions may be administered once to the
subject. Alternatively, multiple administrations may be performed
over a period of time. For example, two, three, four, five, or more
administrations may be given to the subject. In some embodiments,
administrations may be given as needed, e.g., for as long as
symptoms associated with the disease, disorder or condition
persist. In some embodiments, repeated administrations may be
indicated for the remainder of the subject's life. Treatment
periods may vary and could be, e.g., no longer than a year, six
months, three months, two months, one month, two weeks, one week,
three days, two days, or no longer than one day.
[0875] In some embodiments, the compositions are administered at
least twice over a treatment period such that the disease, disorder
or condition is treated, or a symptom thereof is decreased. In some
embodiments, the compositions are administered at least twice over
a treatment period such that the disease, disorder or condition is
treated, or a symptom thereof is prevented. In some embodiments,
the pharmaceutical composition is administered a sufficient number
of times over a treatment period such that the circulatory
concentration of the target is substantially decreased during the
treatment period. In some embodiments, the pharmaceutical
composition is administered a sufficient number of times over a
treatment period such that the circulatory concentration of the
target self-antibody is substantially decreased during the
treatment period such that one or more symptoms of the
self-antibody mediated disease, disorder or condition is prevented,
decreased or delayed. In some embodiments, decreasing the
circulatory concentration of the target includes decreasing the
peak concentration, while in others it includes decreasing the
average concentration. In some embodiments, a substantial decrease
during the treatment period can be determined by comparing a
pretreatment or post-treatment period in the human subject, or by
comparing measurements made in a population undergoing treatment
with a matched, untreated control population. In some embodiments,
the circulatory concentration of the target is decreased by at
least about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%,
55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%,
99.5%, 99.9%, 99.99%, or greater than 99.99% during part or the
entirety of the treatment period. In some embodiments, the
circulatory concentration of the target is decreased by at least
about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%,
99.9%, 99.99%, or greater than 99.99% within about 1, 5, 10, 15,
20, 30, 40, or 50 minutes, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 hours, or 1,
2, 3, 4, 5, or 6 days or about 1, 2, 3, 4, 5, or 6 weeks of the
administration.
[0876] In some embodiments, the pharmaceutical composition is
administered a sufficient number of times over a treatment period
such that the circulatory concentration of the target is decreased
at a rate greater than i) the endogenous clearance rate of the
target \by the human subject, or ii) the endogenous production rate
of the target by the human subject, or iii) both i) and ii). In
some embodiments, the pharmaceutical composition is administered a
sufficient number of times a treatment period such that the
circulatory concentration of the target is substantially decreased
for at least about one week, two weeks, three weeks, four weeks,
one month, two months, three months, four months, five months, six
months, or greater than six months. In some embodiments, the
pharmaceutical composition is administered a sufficient number of
times a treatment period such that the circulatory concentration of
the target is substantially decreased for a period of time at least
as long as the treatment period.
[0877] In some embodiments, the pharmaceutical composition is
administered at a frequency sufficient to effectively reduce the
circulatory concentration of the target below a level that is
associated with a symptom of the disease, disorder or
condition.
[0878] In some embodiments, the time interval between
administrations within a treatment period is no longer than the
period in which the number of synthetic membrane-receiver complexes
in circulation is reduced to less than about 5%, 10%, 15%, 20%,
25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, or 95% of the number of synthetic membrane-receiver complexes
present in the administered pharmaceutical composition.
[0879] Diseases, disorders and conditions associated with targets
in the circulatory system that may be treated or prevented by
administering synthetic membrane-receiver polypeptide complexes are
described herein.
[0880] Diseases, disorders and conditions associated with targets
in the circulatory system that may be treated or prevented by
administering synthetic membrane-receiver polypeptide complexes
include, but are not limited to: self-antibody-mediated diseases,
complement dysregulation-associated diseases, immune complex
associated diseases, amyloidoses, diseases associated with
infectious agents or pathogens (e.g., bacterial, fungal, viral,
parasitic infections), disease associated with toxic proteins,
diseases associated with the accumulation of lipids, diseases
associated with apoptotic, necrotic, aberrant or oncogenic
mammalian cells, and metabolic diseases.
[0881] Provided herein, in some embodiments, are methods for the
treatment or prevention of diseases or conditions that are
associated with targets (e.g., molecules or entities) that reside,
at least in part, in the circulatory system. The methods comprise,
in certain embodiments, administering to a subject in need thereof
functional erythroid cells comprising a receiver, populations of
functional erythroid cells comprising a receiver, or compositions,
preferably pharmaceutical compositions comprising functional
erythroid cells comprising a receiver, in an amount effective to
treat or prevent the disease or condition that is associated with
molecules or entities that reside, at least in part, in the
circulatory system.
[0882] Methods are provided for the treatment or prevention of
inflammation and diseases associated with inflammation, including
sepsis, autoimmune disease, cancer, and microbial infections, the
methods comprising, administering to a subject in need thereof an
erythrocyte comprising an immune-modulatory receiver in an amount
effective to treat or prevent the inflammation or an associated
disease. In some embodiments, an erythrocyte comprises an
immunomodulatory receiver that comprises a chemokine or cytokine
receptor. In a particular embodiment, the chemokine receptor is
DARC.
[0883] Methods are provided for the modulation of chemokine
homeostasis at sites of inflammation, the methods comprising,
administering to a subject in need thereof an erythrocyte
comprising a chemokine-modulatory receiver in an amount effective
to modulate chemokine homeostasis at sites of inflammation. In some
embodiments, the erythrocyte comprising a chemokine-modulatory
receiver comprises a receiver that comprises a chemokine receptor.
In a particular embodiment, the chemokine receptor is DARC. In some
embodiments, the site of inflammation is vascular. (Darbonne, J
Clinical Invet, 1991).
[0884] Further provided are methods of inducing toxin clearance.
The methods include administering to a subject in need thereof a
population of functional erythroid cells comprising a receiver that
is capable of interacting with a toxin, such as e.g., an antibody,
scFv or nanobody receiver, in an amount effective to clear toxins
from circulation. Such methods may be employed to sequester the
toxin and reduce the amount of tissue damage that would otherwise
occur within the vasculature and dissipating its pathogenic effects
in a less acute manner
[0885] In some embodiments, provided are methods of treating
diseases, including, but not limited to, metabolic diseases,
cancers, clotting and anti-clotting diseases. The methods include
administering to a subject in need thereof a pharmaceutical
composition of functional erythroid cells comprising a receiver
provided herein in an amount sufficient to treat the metabolic
disease, the cancer, the clotting disease or anti-clotting disease
of the subject.
[0886] In certain embodiments, synthetic membrane-receiver
polypeptide complexes exhibit one or more receiver polypeptides on
their surface, exposed to the environment the circulatory system of
the subject.
[0887] In other embodiments, the synthetic membrane-receiver
polypeptide complexes comprise one or more receiver polypeptides
facing the unexposed side of the synthetic membrane-receiver
polypeptide complex.
[0888] The receiver polypeptide may interact with targets that are
present in the circulatory system. The interaction of the receiver
with the target may include, but is not limited to: i) binding of
the receiver to the target; ii) degrading the target, iii) cleaving
the target; iv) sequestering the target, and/or v) catalytically
converting the target.
[0889] For example, the receiver polypeptide may be an antibody, a
single-chain variable fragment, a nanobody, a diabody, a darpin, a
lyase, a hydrolase, a protease, or a nuclease.
[0890] In some embodiments, the synthetic membrane-receiver complex
comprises a receiver that is not a polypeptide. In some
embodiments, the receiver comprises a carbohydrate (e.g., a GAG), a
lipid, DNA, a RNA, a peptide nucleic acid (PNA), or a non-protein
ligand, drug or substrate that is capable of interacting with the
target.
[0891] In some embodiments, the interaction between the receiver
and the target leads to a direct or indirect reduction of the
concentration of the target in the circulatory system. For example,
a receiver may directly convert a target into a different product.
The receiver may have a catalytic activity toward the target, such
as cleaving, degrading, etc. The conversion may be from a target to
a degradation product, from a toxic or harmful target to a
non-toxic product, etc. The catalytic activity of the receiver may
also involve addition of one or more chemical groups to the target.
Modification of the target by the receiver may cause, directly or
indirectly, e.g., de/phosphorylation, de/ubiquitination,
de/methylation, glycosylation, etc. on the target. The receiver may
indirectly cause a second modification on the target if the
receiver put a first modification that leads to a second
modification, e.g., by a different enzyme. Any such modifications
may then lead, e.g., to the degradation of the target or to a
conversion of the target to a non-harmful or less harmful product.
In some embodiments, a decrease in target concentration may be
directly or indirectly associated with an increase in a non-target
compound. For example, a toxic metabolite may be converted into a
non-toxic or less toxic metabolite. In another example, a target
may be converted into a product that is lacking or is present in an
depressed amount. In this case, a disease, disorder or condition
may be associated with the lack of or depressed amount of the
non-target compound and conversion of the target, e.g., by a
catalytic action of the synthetic membrane-receiver polypeptide
complex is capable of increasing the amount of the non-target
compound effective to treat the disease, disorder or condition.
[0892] In other examples, the receiver may bind to the target and
keep it sequestered, e.g., being associated with the synthetic
membrane-receiver polypeptide complex. The sequestration may
inhibit an activity harbored by the target, e.g., a harmful
activity, such as that exerted by a self-antibody which may be
causative of an autoimmune disease, or a bacterial toxin that may
cause sepsis, etc. Alternatively or in addition, upon sequestration
or binding of the target the target is redistributed in the
circulatory system of the subject according to the distribution of
the synthetic membrane-receiver polypeptide complex. This may
significantly limit the volume of distribution of the target, and
thus potentially its harmful or adverse impact. The target may be
degraded or accumulated at a specific site or organ in the body of
the subject directed by the turnover or half-life and distribution
of the synthetic membrane-receiver polypeptide complex.
[0893] The administration of the pharmaceutical composition may be
sufficient to substantially decrease the concentration or amount of
the target molecule in circulation during the treatment period,
wherein the substantial decrease can be determined in comparison to
a pre-treatment or post-treatment period in the human subject, or
via comparison of measurements made in a population undergoing
treatment as compared to a matched untreated control population.
The substantial decrease of the target molecule can include a
substantial decrease of the peak concentration or amount of the
target molecule present in a human patient or a substantial
decrease in the average concentration or amount of the target
molecule present in a human patient.
[0894] In some embodiments, provided are methods for treating
diseases that are marked by periodic flares, wherein a flare is
defined as a recurrence of symptoms or an onset of more severe
symptoms. Diseases marked by periodic flares include self-antibody
mediated diseases, immune complex associated diseases, autoimmune
diseases, including for example lupus, rheumatoid arthritis, and
goodpasture syndrome.
[0895] In some embodiments, provided are methods comprising
administering the pharmaceutical composition to a patient a
sufficient number of times over a treatment period such that the
time between flares is reduced compared to an individual who does
not receive the pharmaceutical composition.
[0896] In some embodiments, provided are methods comprising
administering the pharmaceutical composition to a patient a
sufficient number of times over a treatment period such that the
severity of the flares is reduced compared to an individual who
does not receive the pharmaceutical composition.
[0897] In some embodiments, methods of treatment and prevention
using synthetic membrane-receiver complexes generated from
erythroid cells described herein do not comprise the step of
detecting the erythroid cell in vivo, e.g., through a detection
agent that is associated with the erythroid cell.
[0898] In some embodiments, the synthetic membrane-receiver complex
is not generated from a human donor pluripotent hematopoietic stem
cell. In some embodiments, a population of synthetic
membrane-receiver complexes is not expanded in a bioreactor. In
some embodiments, the population of synthetic membrane-receiver
complexes after expansion and/or differentiation does not comprise
a single species of differentiated human blood cells. In some
embodiments, the synthetic membrane-receiver complex is not a
differentiated, mature human blood cell. In some embodiments, the
synthetic membrane-receiver complex is not generated from a blood
cell derived from a universal donor, e.g. blood type O, Rh factor
negative.
[0899] In some embodiments, a synthetic membrane-ADA polypeptide
receiver complex is not used to treat severe combined immune
deficiency (ADA-SCID).
[0900] In some embodiments, the methods of treatments described
herein do not comprise administering a synthetic membrane-receiver
complex generated from an erythroid cell that is contacted with a
polypeptide receiver in an amount effective to induce immune
tolerance to the polypeptide receiver in a subject.
[0901] Suitable targets include biological compounds, inorganic or
organic compounds. Suitable targets may range in size from less
than 100 Da, less than 250 Da, less than 500 Da, less than 1000 Da
to targets of more than 1 kDa. Targets can be, e.g., polypeptides,
lipids, carbohydrates, nucleic acids, small molecules, metabolites
and elements. In some embodiments, the target is an antibody, a
complement factor, an immune complex, a serum amyloid protein, a
bacterial pathogen, a fungal pathogen, a viral pathogen, or an
infected, pathogenic, apoptotic, necrotic, aberrant or oncogenic
mammalian cell.
[0902] Diseases, disorders and conditions associated with targets
in the circulatory system that may be treated or prevented by
administering synthetic membrane-receiver polypeptide complexes
include, but are not limited to: self-antibody-mediated diseases,
complement dysregulation-associated diseases, immune complex
associated diseases, amyloidoses, diseases associated with
infectious agents or pathogens (e.g., bacterial, fungal, viral,
parasitic infections), disease associated with toxic proteins,
diseases associated with the accumulation of lipids, diseases
associated with apoptotic, necrotic, aberrant or oncogenic
mammalian cells, and metabolic diseases.
[0903] In some embodiments, provided are methods of treating
diseases, including, but not limited to, metabolic diseases,
cancers, clotting and anti-clotting diseases. The methods include
administering to a subject in need thereof a pharmaceutical
composition of erythrocyte cells comprising a receiver provided
herein in an amount sufficient to treat the metabolic disease, the
cancer, the clotting disease or anti-clotting disease of the
subject.
[0904] Self-Antibody Mediated Diseases
[0905] In some embodiment, the synthetic membrane-receiver
polypeptide complexes described herein may be used to treat or
prevent diseases, disorders or conditions that are associated with
self-antibodies.
[0906] In specific embodiments, methods are provided for reducing
the circulatory concentration of a target self-antibody in a
subject (e.g., a human) suffering from or at risk of developing a
self-antibody mediated disease, disorder or condition. The methods
include administering a pharmaceutical composition comprising a
synthetic membrane-receiver polypeptide complex described herein.
The pharmaceutical composition is administered in an amount
effective to substantially reduce the circulatory concentration of
the target self-antibody. In certain embodiments, the
administration is carried out intravenously.
[0907] In certain embodiments, synthetic membrane-receiver
polypeptide complexes are administered that comprise a receiver
that specifically binds and sequesters a target self-antibody that
is present in the circulatory system of the subject.
[0908] In certain embodiments, the pharmaceutical composition will
reduce the target self-antibody load in the circulatory system,
thereby reducing the burden of the disease, disorder or condition
associated with the presence or elevated concentration of the
target self-antibody. Diseases associated with target
self-antibodies include, but are not limited to, Goodpasture
syndrome, membranous glomerulonephropathy, antiphospholipid
syndrome (APS), catastrophic antiphospholipid syndrome (CAPS), and
those listed in table 6 and table 8.
[0909] Self-antibody mediated diseases arise from an abnormal
immune response of the body against substances and tissues normally
present in the body. This may be restricted to certain organs
(e.g., in autoimmune thyroiditis) or involve a particular tissue in
different places, e.g., Goodpasture syndrome, which may affect the
basement membrane in both the lung and the kidney. The treatment of
self-antibody mediated diseases typically includes
immunosuppressive medications that decrease the immune response,
such as cyclophosphamide and rituximab. In certain embodiments,
treatment with the pharmaceutical compositions described herein is
combined with one or more immunosuppressive medications, and
effective agents may be, e.g., co-administered or
co-formulated.
[0910] In healthy subjects, the immune system is able to recognize
and ignore the body's own healthy proteins, cells, and tissues, and
does not overreact to non-threatening substances in the
environment, such as foods. If the immune system ceases to
recognize one or more of the body's normal constituents as "self"
it may produce pathological self-antibodies, i.e. antibodies that
recognize "self" antigens. These self-antibodies are directed
against the body's own healthy cells, tissues, and/or organs, and
may cause inflammation and tissue damage.
[0911] In certain embodiments, synthetic membrane-receiver
polypeptide complexes are provided that comprise receivers
comprising epitopes capable of being recognized by target
self-antibodies. For example, the target self-antibody may
specifically recognizes glycoprotein (GP Ib-IX, IIb-IIIa, IV, or
Ia-IIa), the NC1 domain of collagen .alpha.3 (IV), B2
glycoprotein-1, or phospholipase A2 receptor, and the receiver
polypeptide may comprise an antigenic polypeptide selected from the
group.
[0912] Target self-antibodies sequestered by the synthetic
membrane-receiver polypeptide complexes may be cleared from
circulation, e.g., through the reticulo-endothelial system.
Sequestration and/or degradation of the target self-antibody may
reduce the degree of inflammation that is normally caused when the
self-antibody interacts with "self" tissues.
[0913] In one embodiment the disease or condition is
antiphospholipid syndrome, the receiver is beta2-glycoprotein-1 or
fragment thereof, and the target is pathogenic self-antibody
against beta2-glycoprotein-1.
[0914] In one embodiment the disease or condition is catastrophic
antiphospholipid syndrome, the receiver is beta2-glycoprotein-1 or
fragment thereof, and the target is pathogenic self-antibody
against beta2-glycoprotein-1.
[0915] In one embodiment the disease or condition is cold
agglutinin disease, the receiver is I/i antigen or fragment
thereof, and the target is pathogenic self-antibody against I/i
antigen.
[0916] In one embodiment the disease or condition is Goodpasture
syndrome, the receiver is a3 NC1 domain of collagen (IV) or
fragment thereof, and the target is pathogenic self-antibody
against a3 NC1 domain of collagen (IV).
[0917] In one embodiment the disease or condition is immune
thrombocytopenia purpura, the receiver is platelet glycoproteins
(Ib-IX, IV, Ia-IIa) or fragment thereof, and the target is
pathogenic self-antibody against platelet glycoprotein.
[0918] In one embodiment the disease or condition is membranous
nephropathy, the receiver is phospholipase A2 receptor or fragment
thereof, and the target is pathogenic self-antibody against
phospholipase A2 receptor.
[0919] In one embodiment the disease or condition is warm antibody
hemolytic anemia, the receiver is glycophorin A, glycophorin B,
and/or glycophorin C, Rh antigen or fragment thereof, and the
target is pathogenic self-antibody against glycophorins and/or Rh
antigen.
[0920] Exemplary self-antibody diseases are Goodpasture syndrome,
catastrophic antiphospholipid syndrome, and membranous
glomerulopathy.
[0921] 1. Goodpasture Syndrome
[0922] In some embodiment, subjects may be identified as having
received or would benefit from receiving treatment for Goodpasture
Syndrome. Subjects suffering from or at risk of developing
Goodpasture Syndrome may be administered a pharmaceutical
composition comprising the synthetic membrane-receiver polypeptide
complex described herein to treat or prevent disease.
[0923] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises a receiver comprising a3IV collagen
(COL4A3), or a derivative or functional fragment thereof. A
suitable receiver may be exhibited on the surface of the synthetic
membrane-receiver polypeptide complex. COL4A3 is normally found on
kidney cells and presents a target to which self-antibodies
associated with Goodpasture syndrome have been shown to bind.
[0924] COL4A3 is found in air sacs in the lungs and glomeruli of
the kidneys. Self-antibodies associated with Goodpasture syndrome
are directed against the glomerular basement membrane and can cause
kidney damage. Where the disorder is triggered by a viral
respiratory infection or by intake of hydrocarbon solvents the
resulting immune response can cause bleeding in the air sacs of the
lungs and inflammation in the kidney's glomeruli.
[0925] 2. Catastrophic Antiphospholipid Syndrome (CAPS)
[0926] In some embodiment, subjects may be identified as having
received or would benefit from receiving treatment for
antiphospholipid syndrome (APS). Subjects suffering from or at risk
of developing APS may be administered a pharmaceutical composition
comprising the synthetic membrane-receiver polypeptide complex
described herein to treat or prevent disease.
[0927] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises a receiver comprising
.beta.2-glycoprotein 1 (b2GPI), or a derivative or functional
fragment thereof. A suitable receiver may be exhibited on the
surface of the synthetic membrane-receiver polypeptide complex.
b2GPI is normally found on endothelial cells and presents a target
to which self-antibodies associated with APS have been shown to
bind.
[0928] Antiphospholipid syndrome (APS) is a multisystem
self-antibody mediated condition characterized by vascular
thrombosis and/or pregnancy loss associated with persistently
positive antiphospholipid antibodies (aPL). Catastrophic APS (CAPS)
is the most severe form of APS with multiple organ involvement
developing over a short period of time, usually associated with
microthrombosis. `Definite` and `probable` CAPS have been defined
based on the preliminary classification criteria; however,
aPL-positive patients with multiple organ thromboses and/or
thrombotic microangiopathies are encountered who do not fulfill
these criteria. Previous APS diagnosis and/or persistent clinically
significant aPL positivity is of great importance for the CAPS
diagnosis; however, almost half of the patients who develop CAPS do
not have a history of aPL positivity.
[0929] 3. Membranous Glomerulopathy (MGN)
[0930] In some embodiment, subjects may be identified as having
received or would benefit from receiving treatment for membranous
glomerulopathy (MGN), also called membranous glomerulonephritis
membranous nephritis (MN). Subjects suffering from or at risk of
developing MGN may be administered a pharmaceutical composition
comprising the synthetic membrane-receiver polypeptide complex
described herein to treat or prevent disease.
[0931] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises a receiver comprising phospholipase
A2 receptor, or a derivative or functional fragment thereof. A
suitable receiver may be exhibited on the surface of the synthetic
membrane-receiver polypeptide complex. Phospholipase A2 receptor is
normally found on podocytes and presents a target to which
self-antibodies associated with MGN have been shown to bind.
[0932] The term membranous nephritis, or membranous
glomerulonephritis, is used to describe a chronic glomerular
disease that on light, immunofluorescence, and electron microscopy
study of renal tissue shows a set of distinct morphologic features
in glomeruli, including thickened glomerular basement membrane
(GBM) and GBM spikes, granular staining for IgG and complement
along the periphery of glomerular all capillary loops, and
electron-dense subepithelial deposits corresponding to the granular
IgG staining.
[0933] Clinically, most patients present with nephrotic syndrome or
have proteinuria detected on a routine urinalysis. Idiopathic Minn.
occurs in all age groups and races and both sexes all over the
world and is a leading cause of nephrotic syndrome among Caucasian
adults. Spontaneous remission of the disease is common in children
but also occurs in adults. Although several immunosuppressive drugs
often are used to treat individual patients, with or without
treatment, nearly a third of patients progress to end-stage renal
disease.
[0934] Complement Dysregulation-Associated Diseases
[0935] In some embodiment, the synthetic membrane-receiver
polypeptide complexes described herein may be used to treat or
prevent diseases, disorders or conditions that are associated with
complement dysregulation.
[0936] In specific embodiments, methods are provided for reducing
the circulatory concentration of a target complement protein in a
subject (e.g., a human) suffering from or at risk of developing a
disease, disorder or condition associated with complement
dysregulation. The methods include administering a pharmaceutical
composition comprising a synthetic membrane-receiver polypeptide
complex described herein. The pharmaceutical composition is
administered in an amount effective to substantially reduce the
circulatory concentration of the target complement protein. In
certain embodiments, the administration is carried out
intravenously.
[0937] In certain embodiments, synthetic membrane-receiver
polypeptide complexes are administered that comprise a receiver
that specifically binds and sequesters a target complement protein
that is present in the circulatory system of the subject.
[0938] In certain embodiments, the therapeutic compositions of the
invention provide functional erythroid cells comprising receivers
in compositions that are useful to treat, prevent, or reduce the
severity of a disease, disorder or condition associated with
complement pathophysiology or improper immune complex
clearance.
[0939] In specific embodiments, methods are provided for reducing
the circulatory concentration of a target complement protein in a
subject (e.g., a human) suffering from or at risk of developing a
disease, disorder or condition associated with complement
dysregulation. The methods include administering a pharmaceutical
composition comprising a synthetic membrane-receiver polypeptide
complex described herein. The pharmaceutical composition is
administered in an amount effective to substantially reduce the
circulatory concentration of the target complement protein. In
certain embodiments, the administration is carried out
intravenously.
[0940] In certain embodiments, synthetic membrane-receiver
polypeptide complexes are administered that comprise a receiver
that specifically binds and sequesters a target complement protein
that is present in the circulatory system of the subject.
[0941] Provided are therapeutic compositions present in an amount
effect to treat a disease or condition associated with complement
over-activation such as systemic lupus erythematosus, ischemia
reperfusion injury, organ transplantation, myocardial infarction,
rheumatoid arthritis, scleroderma, polyarteritis nodosa, serum
sickness, arthus reaction, farmer's lung, Henoch-Schonlein purpura,
bacterial endocarditis, vasculitis, and other Type III
Hypersensitivity conditions. Further provided are therapeutic
compositions present in an amount able to treat an infectious
disease in which opsonized pathogen is present in the blood, such
as carbapenem-resistant enterobacteriaceae, drug resistant
Neisseria gonorrhoeae, fully resistant Streptococcus pneumonia,
drug resistant tuberculosis, generalized bacterial sepsis, human
immunodeficiency virus infection, hepatitis B virus infection, or
malaria. In a further embodiment, provided are therapeutic
compositions present in an amount effect to treat a complement
factor deficiency-associated disease such as cofactor H deficiency,
paroxysmal nocturnal hemoglobinuria, factor B deficiency, factor D
deficiency, C1q deficiency, C1r deficiency, C4 deficiency, C2
deficiency, C3 deficiency, C5 deficiency, C6 deficiency, C7
deficiency, factor I deficiency, factor D deficiency, MBL
deficiency, MASP2 deficiency, CD55 deficiency, CD59 deficiency, and
other deficiencies in genes associate with complement activity
including but not limited to those listed in table 6 and table
8.
[0942] In certain embodiments, the pharmaceutical composition will
reduce the target complement protein load in the circulatory
system, thereby reducing the burden of the disease, disorder or
condition associated with the presence or elevated concentration of
the target complement protein. Diseases associated with complement
dysregulation include, but are not limited to, atypical hemolytic
uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH),
age-related macular degeneration (AMD), complement factor I (CFI)
deficiency and those listed in table 6 and table 8.
[0943] In certain embodiments, the receiver polypeptide may
specifically interact with a complement protein selected from the
group consisting of: C1q, C1r, C1s, C2, C3, C3a, C3b, C4, C5, C5a,
C5b, C6, C7, C8, and C9, Factor B, Factor D, Properdin, iC3b, C3c,
C3dg, C3dk, C3e, Bb, C4a, C4b, and in table 5 and table 10.
[0944] In certain embodiments, the receiver polypeptide may
comprise CD46, CD55, CD59, factor H, CR1, factor I, CR1, CR2, CR3,
CR4, C3aR, C3eR, Decay-accelerating factor (DAF), Membrane cofactor
protein (MCP), C3 Beta chain Receptor, C1 inhibitor, C4 binding
protein, and those listed in table 10.
[0945] Homologous restriction factormicrobial protein NalP,
microbial protein SpeB, microbial protein EspP, a derivative or a
functional fragment thereof. Alternatively or in addition, the
receiver polypeptide may comprise one or more complement control
protein (CCP) modules and/or short consensus repeats (SCR) of
different origin.
[0946] The complement system is composed of more than 32 proteins
including 7 serum and 9 membrane regulatory proteins, 1 serosal
regulatory protein, and 8 cell membrane receptors that bind
complement fragments. Activation of complement occurs with the
initiation of an inflammatory reaction, most of which occurs in the
intravascular space. The soluble components of complement are
present in the circulation and also in body fluids and tissues. In
addition to the specific activation induced by antigen-antibody
complexes, complement is activated through the pattern recognition
receptors, which have the ability to discriminate between self and
non-self antigens based on repeating patterns of molecular
structure (pathogen-associated molecular patterns) present on the
surface of pathogens. Complement-activating pattern recognition
receptors include mannose-binding lectin (MBL), ficolins,
C-reactive protein, C1q, and natural IgM (IgM).
[0947] Excessive, deregulated, or chronic inflammation can initiate
or contribute to several pathologies. For example, the activation
of complement during an inflammatory reaction contributes to
inflammation-driven tissue injury, which occurs in the
ischemia/reperfusion (I/R) setting, vasculitides of various
etiologies, nephritis, and arthritis. A deficiency in complement
components may also result in tissue injury, as observed in
autoimmune reactions. Further, alterations in the expression of
complement regulatory proteins may lead to excessive complement
activation and can also contribute to tissue injury.
[0948] In one embodiment the disease or condition is age-related
macular degeneration, the receiver is a suitable complement
regulatory protein or fragment thereof, and the target is active
complement.
[0949] In one embodiment the disease or condition is atypical
hemolytic uremic syndrome, the receiver is complement factor H, or
a suitable complement regulatory protein or fragment thereof, and
the target is active complement.
[0950] In one embodiment the disease or condition is Complement
Factor I deficiency, the receiver is Complement Factor I, a
suitable complement regulatory protein or fragment thereof, and the
target is active complement.
[0951] In one embodiment the disease or condition is paroxysmal
nocturnal hemoglobinuria, the receiver is a suitable complement
regulatory protein or fragment thereof, and the target is active
complement.
[0952] In one embodiment the disease or condition is autoimmune
hemolytic anemia, the receiver is a suitable complement regulatory
molecule or fragment thereof, and the target is active
complement.
[0953] In one embodiment the disease or condition is non-alcoholic
steatohepatitis, the receiver is a suitable complement regulatory
molecule or fragment thereof, and the target is active
complement.
[0954] 1. Paroxysmal Nocturnal Hemoglobinuria (PNH)
[0955] In some embodiments, subjects may be identified as having
received or would benefit from receiving treatment for paroxysmal
nocturnal hemoglobinuria (PNH). Subjects suffering from or at risk
of developing PNH may be administered a pharmaceutical composition
comprising the synthetic membrane-receiver polypeptide complex
described herein to treat or prevent disease.
[0956] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises a receiver comprising a complement
regulatory protein, such as cofactor H, or a derivative or
functional fragment thereof. A suitable receiver may be exhibited
on the surface of the synthetic membrane-receiver polypeptide
complex and may be administered to reduce inflammation.
[0957] Paroxysmal nocturnal hemoglobinuria is an acquired disorder
that leads to the premature death and impaired production of blood
cells. The disorder affects erythrocytes, leukocytes), and
platelets (thrombocytes). PNH affects both sexes equally and can
occur at any age, although it is most often diagnosed in young
adulthood.
[0958] People with paroxysmal nocturnal hemoglobinuria have sudden,
recurring episodes of symptoms (paroxysmal symptoms), which may be
triggered by stresses on the body, such as infections or physical
exertion. During these episodes, red blood cells are prematurely
destroyed (hemolysis). Affected individuals may pass dark-colored
urine due to the presence of hemoglobin (hemoglobinuria). In many,
but not all cases, hemoglobinuria is most noticeable in the
morning, upon passing urine that has accumulated in the bladder
during the night (nocturnal).
[0959] The premature destruction of red blood cells results in a
deficiency of these cells in the blood (hemolytic anemia), which
can cause signs and symptoms such as fatigue, weakness, abnormally
pale skin (pallor), shortness of breath, and an increased heart
rate. People with PNH may also be prone to infections due to a
deficiency of white blood cells.
[0960] Abnormal platelets associated with PNH can cause problems in
the blood clotting process. As a result, people with this disorder
may experience abnormal blood clotting (thrombosis), especially in
large abdominal veins; or, less often, episodes of severe bleeding
(hemorrhage).
[0961] 2. Atypical Hemolytic Uremic Syndrome (aHUS)
[0962] In some embodiments, subjects may be identified as having
received or would benefit from receiving treatment for atypical
hemolytic uremic syndrome (aHUS). Subjects suffering from or at
risk of developing aHUS may be administered a pharmaceutical
composition comprising the synthetic membrane-receiver polypeptide
complex described herein to treat or prevent disease.
[0963] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises a receiver comprising a complement
regulatory protein, such as cofactor I, or a derivative or
functional fragment thereof. A suitable receiver may be exhibited
on the surface of the synthetic membrane-receiver polypeptide
complex and may be administered to reduce inflammation.
[0964] Atypical hemolytic uremic syndrome (aHUS) is a rare syndrome
of hemolysis, thrombocytopenia, and renal insufficiency. Genetic
mutations in the alternate pathway of complement is the cause in
more than 60% of patients affected by this thrombotic
microangiopathy. aHUS may be treated using plasma therapy,
complement blockade, and/or liver transplantation. Because aHUS
shares many of the presenting characteristics of the other
thrombotic microangiopathies, and confirmatory genetic results are
not available at the time of presentation, the diagnosis relies
heavily on the recognition of a clinical syndrome consistent with
the diagnosis in the absence of signs of an alternate cause of
thrombotic microangiopathy.
[0965] 3. Age-Related Macular Degeneration (AMD)
[0966] In some embodiments, subjects may be identified as having
received or would benefit from receiving treatment for age related
macular degeneration (AMD). Subjects suffering from or at risk of
developing AMD may be administered a pharmaceutical composition
comprising the synthetic membrane-receiver polypeptide complex
described herein to treat or prevent disease.
[0967] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises a receiver comprising a complement
regulatory protein, such as CD55 and CD59, or a derivative or
functional fragment thereof. A suitable receiver may be exhibited
on the surface of the synthetic membrane-receiver polypeptide
complex and may be administered to reduce inflammation.
[0968] Age related macular degeneration (AMD) is a common form of
blindness in the western world and genetic variations of several
complement genes, including the complement regulator Factor H, the
central complement component C3, Factor B, C2, and also Factor I
confer a risk for the disease. However deletion of a chromosomal
segment in the Factor H gene cluster on human chromosome 1, which
results in the deficiency of the terminal pathway regulator CFHR1,
and of the putative complement regulator CFHR3 has a protective
effect for development of AMD. The Factor H gene encodes two
proteins Factor H and FHL1 which are derived from alternatively
processed transcripts. In particular a sequence variation at
position 402 of both Factor H and FHL1 is associated with a risk
for AMD. A tyrosine residue at position 402 represents the
protective and a histidine residue the risk variant. AMD is
considered a chronic inflammatory disease, which can be caused by
defective and inappropriate regulation of the continuously
activated alternative complement pathway. This activation generates
complement effector products and inflammatory mediators that
stimulate further inflammatory reactions. Defective regulation can
lead to formation of immune deposits, drusen and ultimately
translate into damage of retinal pigment epithelial cells, rupture
of the interface between these epithelial cells and the Bruch's
membrane and vision loss.
[0969] Immune Complex-Associated Diseases
[0970] In some embodiments, the synthetic membrane-receiver
polypeptide complexes described herein may be used to treat or
prevent diseases, disorders or conditions that are associated with
immune complexes or improper immune complex clearance.
[0971] In specific embodiments, methods are provided for reducing
the circulatory concentration of a target immune complex in a
subject (e.g., a human) suffering from or at risk of developing a
disease, disorder or condition associated with immune complexes.
The methods include administering a pharmaceutical composition
comprising a synthetic membrane-complement receptor 1 (CR1)
receiver complex. The pharmaceutical composition is administered in
an amount effective to substantially reduce the circulatory
concentration of the target immune complex. In certain embodiments,
the administration is carried out intravenously.
[0972] In certain embodiments, synthetic membrane-complement
receptor 1 (CR1) receiver complexes are administered that
specifically bind and sequester a target immune complex that is
present in the circulatory system of the subject.
[0973] In some embodiments, functional erythroid cells comprising a
receiver that comprises complement receptor 1 (CR1) may be
administered to a subject exhibiting immune complexes in
circulation. For example, a population of functional erythroid
cells comprising a receiver that comprises complement receptor 1
(CR1) can bind C3b within an immune complex and removal and
clearance from circulation can occur through the liver.
[0974] Compositions comprising erythrocyte-bound CR1 receiver, such
as a plurality of functional erythroid cells comprising elevated
levels of CR1, is preferably administered to a subject having been
diagnosed with or being suspected of having a disease state that
has resulted from an overabundance of immune complex formation or
that has caused a reduction or depletion in the native CR1 level,
such as an immune complex-associated disorder or disease.
[0975] In certain embodiments, the pharmaceutical composition will
reduce the target immune complex load in the circulatory system,
and/or prevent the deposition of immune complexes in sensitive soft
tissue, thereby reducing the burden of the disease, disorder or
condition associated with the presence or elevated concentration of
the target immune complex. Diseases associated with complement
dysregulation include, but are not limited to, systemic lupus
erythematosus (SLE), lupus nephritis, IgA nephropathy, Dense
Deposit Disease, lupus nephritis, Goodpasture's syndrome,
membranoproliferative glomerulonephritis, immune complex
vasculitis, cold agglutinin disease, polymyositis, acute pulmonary
hemorrhage, membranous glomerulonephritis, membranous
glomerulonephritis, rapidly-progressive glomerulonephritis,
post-streptococcal glomerulonephritis, post-staphylococcal
glomerulonephritis, Pauci-immune glomerulonephritis, blood
hyperviscosity syndrome, and cutaneous leukocytoclastic angiitis
and those listed in table 6 and table 8.
[0976] In certain embodiments, the target immune complex comprises
i) IgM or IgG, and ii) C3b and/or C4b.
[0977] In certain embodiments, the CR1 receiver comprises one or
more complement control protein (CCP) modules, short consensus
repeats (SCR) and/or long homologous repeats (LHRs). In some
embodiments, the CR1 receiver comprises a functional fragment of
the full-length CR1 polypeptide.
[0978] Type III, or immune-complex, reactions are characterized by
tissue damage caused by the activation of complement in response to
antigen-antibody (immune) complexes (IgG and IgM) that are
deposited in tissues. Once the antigen-antibody complexes form,
they are deposited in various tissues of the body, especially the
blood vessels, kidneys, lungs, skin, and joints. Deposition of the
immune complexes causes an inflammatory response, which leads to
the release of tissue-damaging enzymes and interleukin-1, which
induces fever. Immune complexes underlie many autoimmune diseases,
such as systemic lupus erythematosus (an inflammatory disorder of
connective tissue), most types of glomerulonephritis (inflammation
of the capillaries of the kidney), and rheumatoid arthritis.
[0979] Type III hypersensitivity reactions can be provoked by
inhalation of antigens into the lungs. A number of conditions are
attributed to this type of antigen exposure, including farmer's
lung, caused by fungal spores from moldy hay; pigeon fancier's
lung, resulting from proteins from powdery pigeon dung; and
humidifier fever, caused by normally harmless protozoans that can
grow in air-conditioning units and become dispersed in fine
droplets in climate-controlled offices. In each case, the person
will be sensitized to the antigen with IgG antibodies to the agent
circulating in the blood. Inhalation of the antigen will stimulate
the reaction and cause chest tightness, fever, and malaise,
symptoms that usually pass in a day or two but recur when the
individual is re-exposed to the antigen. Permanent damage is rare
unless individuals are exposed repeatedly. Some occupational
diseases of workers who handle cotton, sugarcane, or coffee waste
in warm countries have a similar cause, with the sensitizing
antigen usually coming from fungi that grow on the waste rather
than the waste itself.
[0980] In one embodiment the disease or condition is IgA
nephropathy, the receiver is Complement receptor 1 or fragment
thereof, and the target is Immune complexes.
[0981] In one embodiment the disease or condition is lupus
nephritis, the receiver is Complement receptor 1 or fragment
thereof, and the target is immune complex.
[0982] In one embodiment the disease or condition is systemic lupus
erythematosus, the receiver is Complement receptor 1 or fragment
thereof, and the target is immune complex.
[0983] 1. Systemic Lupus Erythematosus (SLE)
[0984] In some embodiments, subjects may be identified as having
received or would benefit from receiving treatment for systemic
lupus erythematosus (SLE). Subjects suffering from or at risk of
developing SLE may be administered a pharmaceutical composition
comprising the synthetic membrane-CR1 receiver complex to treat or
prevent disease.
[0985] In certain embodiments, the CR1 receiver interacts with the
target C3b, a constituent of a circulating immune complex. In some
embodiments, the immune complex once bound to the synthetic
membrane-CR1 receiver complex is degraded through the
reticulo-endothelial system.
[0986] Systemic lupus erythematosus (SLE) is a chronic inflammatory
disease that has protean manifestations and follows a relapsing and
remitting course. More than 90% of cases of SLE occur in women,
frequently starting at childbearing age. SLE is a chronic
autoimmune disease that can affect almost any organ system; thus,
its presentation and course are highly variable, ranging from
indolent to fulminant. In childhood-onset SLE, there are several
clinical symptoms more commonly found than in adults, including
malar rash, ulcers/mucocutaneous involvement, renal involvement,
proteinuria, urinary cellular casts, seizures, thrombocytopenia,
hemolytic anemia, fever, and lymphadenopathy. In adults, Raynaud
pleuritis and sicca are twice as common as in children and
adolescents. A presentation of a triad of fever, joint pain, and
rash in a woman of childbearing age should prompt investigation
into the diagnosis of SLE.
[0987] SLE is an autoimmune disorder characterized by multisystem
inflammation with the generation of self-antibodies.
Self-antibodies may be present for many years before the onset of
the first symptoms of SLE. Further, T cells from patients with
lupus show defects in both signaling and effector function (e.g.,
decreased secretion of interleukin (IL)-2). T-cell abnormalities
offer targets for therapy, e.g., belimumab, which targets the
B-lymphocyte stimulator (BLys) signaling pathway.
[0988] Many clinical manifestations of SLE are mediated by
circulating immune complexes that form with antigens in various
tissues or the direct effects of antibodies to cell surface
components Immune complexes form in the microvasculature, leading
to complement activation and inflammation. Moreover,
antibody-antigen complexes deposit on the basement membranes of
skin and kidneys. In active SLE, this process has been confirmed by
demonstration of complexes of nuclear antigens such as DNA,
immunoglobulins, and complement proteins at these sites.
Self-antibodies (e.g., lupus anticoagulant (LA), and anti-ribosomal
P antibodies) can be used as biomarkers to determine future
neuropsychiatric events in SLE.
Other indications include the presence of serum antinuclear
antibodies (ANAs) which are found in nearly all individuals with
active SLE. Antibodies to native double-stranded DNA (dsDNA) are
relatively specific for the diagnosis of SLE. Cytotoxic T cells and
suppressor T cells (which would normally down-regulate immune
responses) are decreased. The generation of polyclonal T-cell
cytolytic activity is impaired. Helper (CD4.sup.+) T cells are
increased. A lack of immune tolerance is observed in animal lupus
models.
[0989] 2. IgA Nephropathy
[0990] In some embodiments, subjects may be identified as having
received or would benefit from receiving treatment for IgA
nephropathy. Subjects suffering from or at risk of developing IgA
nephropathy may be administered a pharmaceutical composition
comprising the synthetic membrane-CR1 receiver complex to treat or
prevent disease.
[0991] In certain embodiments, the CR1 receiver interacts with the
target C3b, a constituent of a circulating IgA immune complex. In
some embodiments, the immune complex once bound to the synthetic
membrane-CR1 receiver complex is degraded through the
reticulo-endothelial system.
[0992] IgA nephropathy also known as Berger's disease is a kidney
disease associated with the accumulation of IgA-immune complexes.
The presence of the immune complexes triggers a local inflammation
that reduces the kidneys' ability to filter waste, excess water and
electrolytes from the blood. Kidney damage may be indicated by
blood and protein in urine, high blood pressure and swollen
feet.
[0993] IgA nephropathy usually progresses slowly over many years.
Some subjects present blood in their urine without developing
problems, some eventually achieve complete remission, and others
develop end-stage kidney failure.
[0994] IgA nephropathy is the most common glomerulonephritis
worldwide. Clinically, it is characterized by hematuria and
proteinuria; about 20-30% of the IgAN patients develop progressive
renal failure within 10-20 years from the onset of disease.
Histologically, the glomerular mesangium contains deposits of IgA1,
the C3 component of complement, and less frequently, IgG and/or
IgM. Circulating immune complexes (CICs) composed of IgA1, C3, and
IgG are involved in the pathogenesis of the disease.
[0995] Serum IgA1 from IgAN patients may exhibit alterations in the
glycan side chains. Human IgA1 contains N- and O-linked glycans.
IgA1 from IgAN patients display altered glycan moieties, usually
with a reduced content of galactose (Gal). The Gal-deficient IgA1
may be present in CICs with IgG. IgA1 from sera of IgAN patients
exhibit increased binding to lectins specific for a terminal
GalNAc, such as Helix aspersa (HAA) or Helix pomatia (HPO).
[0996] Amyloidoses
[0997] In some embodiment, the synthetic membrane-receiver
polypeptide complexes described herein may be used to treat or
prevent amyloidosis. In some embodiments, membrane-receiver
complexes are used that do not contain a receiver polypeptide. The
receiver can for example be a glycosaminoglycans (GAG).
[0998] In specific embodiments, methods are provided for reducing
the circulatory concentration of a target serum amyloid protein in
a subject (e.g., a human) suffering from or at risk of developing
amyloid plaques. The methods include administering a pharmaceutical
composition comprising a synthetic membrane-receiver complex
described herein. The pharmaceutical composition is administered in
an amount effective to substantially reduce the circulatory
concentration of the target serum amyloid protein. In certain
embodiments, the administration is carried out intravenously.
[0999] In certain embodiments, synthetic membrane-receiver
complexes are administered that comprise a receiver that
specifically binds, sequesters and/or degrades a target serum
amyloid protein or target amyloid plaque that is present in the
circulatory system of the subject.
[1000] In certain embodiments, the pharmaceutical composition will
reduce the target serum amyloid protein or amyloid plaque load in
the circulatory system, e.g., preventing their deposition in soft
tissue, thereby reducing the burden of the amyloidosis. Amyloidoses
include, but are not limited to, AA amyloidosis, light chain (AL)
amyloidosis, beta-2 microglobulin amyloidosis and those listed in
table 6 and table 8.
[1001] In certain embodiments, the receiver polypeptide may
specifically interact with a target serum amyloid protein selected
from the group consisting of: amyloid P protein, amyloid A protein,
light chain, misfolded transthyretin, and fibrinogen alpha
chain.
[1002] Amyloidosis is a rare disease associated with amyloid
plaques build up. Amyloidosis can affect different organs such as,
e.g., the heart, kidneys, liver, spleen, nervous system and
digestive tract. Severe amyloidosis can lead to life-threatening
organ failure.
[1003] Acquired systemic amyloidosis is thought to be the cause of
death in about 1 in 1,000 persons in Western countries and is most
common in the elderly. Systemic AL amyloidosis is the most common
and serious type, accounting for over 60% of cases.
Dialysis-related .beta..sub.2-microglobulin amyloidosis affects
about 1 million patients worldwide. Senile transthyretin (ATTR)
amyloidosis, which predominantly involves the heart, occurs in
about one quarter of persons older than 80 years.
[1004] In one embodiment the disease or condition is AA
amyloidosis, the receiver is an an antibody-like binder to serum
amyloid A protein or serum amyloid P component or fragment thereof,
and the target is serum amyloid A protein and amyloid placques.
[1005] In one embodiment the disease or condition is beta2
microglobulin amyloidosis, the receiver is an antibody-like binder
to beta-2 microglobulin or serum amyloid P component or fragment
thereof, and the target is beta-2 microglobulin or amyloid
placques.
[1006] In one embodiment the disease or condition is light chain
amyloidosis, the receiver is an antibody-like binder to light
chain, serum amyloid P component or fragment thereof, and the
target is antibody light chain or amyloid placques.
[1007] 1. AA amyloidosis
[1008] In some embodiments, subjects may be identified as having
received or would benefit from receiving treatment for AA
amyloidosis. Subjects suffering from or at risk of developing AA
amyloidosis may be administered a pharmaceutical composition
comprising the synthetic membrane-receiver polypeptide complexes
described herein to treat or prevent disease.
[1009] AA amyloidosis is a complication of chronic infections and
inflammatory diseases or any condition that leads to long-term
overproduction of the acute phase reactant SAA. The amyloid fibrils
are composed of an N-terminal cleavage fragment of SAA (the AA
protein). AA amyloidosis occurs in 1% to 5% of patients with
rheumatoid arthritis, juvenile idiopathic arthritis and Crohn's
disease. Tuberculosis and leprosy are also important causes of AA
amyloidosis in some parts of the world. Most patients present with
proteinuria, and liver and gastrointestinal involvement may occur
with time.
[1010] 2. AL Amyloidosis
[1011] In some embodiments, subjects may be identified as having
received or would benefit from receiving treatment for AL
amyloidosis. Subjects suffering from or at risk of developing AL
amyloidosis may be administered a pharmaceutical composition
comprising the synthetic membrane-receiver polypeptide complexes
described herein to treat or prevent disease.
[1012] Systemic AL occurs in about 2% of people with monoclonal
B-cell dyscrasias. AL fibrils are derived from monoclonal
immunoglobulin light chains, affecting usually the kidneys, heart,
liver and peripheral nerves.
[1013] 3. .beta.2-Microglobulin Amyloidosis
[1014] In some embodiments, subjects may be identified as having
received or would benefit from receiving treatment for
.beta.2-Microglobulin amyloidosis. Subjects suffering from or at
risk of developing .beta.2-Microglobulin amyloidosis may be
administered a pharmaceutical composition comprising the synthetic
membrane-receiver polypeptide complexes described herein to treat
or prevent disease.
[1015] .beta..sub.2-Microglobulin amyloid deposition occurs in
patients with dialysis-dependent chronic renal failure, mainly
affecting articular and periarticular structures. It typically
causes arthralgia of the shoulders, knees, wrists and small joints
of the hand; joint swelling and carpal tunnel syndrome. The amyloid
fibril precursor protein is .beta..sub.2-microglobulin, which is
the invariant chain of the major histocompatibility complex (MHC)
class I molecule and is expressed by all nucleated cells. Since it
is normally filtered freely at the glomerulus, reabsorbed and
catabolized by proximal tubular cells, decreasing renal function
causes a proportionate rise in its concentration. Disease-related
amyloidosis (DRA) is present in 20% to 30% of patients within 3
years of starting dialysis for end-stage renal failure.
[1016] In some embodiments, membrane-receiver complexes that do not
contain a receiver polypeptide are used for treatment of an
amyloidosis and or for the reduction of a serum amyloid protein or
amyloid plaque. In one embodiment, the synthetic membrane-receiver
complex comprises a receiver comprising a glycosaminoglycans (GAG),
or a derivative or functional fragment thereof. A suitable receiver
may be exhibited on the surface of the synthetic membrane-receiver
complex and may be administered to bind a circulating amyloidogenic
precursors. In certain embodiments, amyloid deposits are prevented
from forming.
[1017] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises a receiver comprising a serum amyloid
P-component (SAP), or a derivative or functional fragment thereof.
A suitable receiver may be exhibited on the surface of the
synthetic membrane-receiver polypeptide complex and may be
administered to prevent amyloids from aggregating. Serum amyloid
P-component (protein SAP) has been described to bind in vitro to
isolated amyloid fibrils of both primary and secondary types.
[1018] Infectious Agent-Mediated Diseases and Conditions
[1019] In some embodiments, the synthetic membrane-receiver
polypeptide complexes described herein may be used to treat or
prevent diseases, disorders or conditions that are associated with
infectious agents.
[1020] In some embodiments, functional erythroid cells comprising a
receiver specific for circulating pathogens are administered to a
subject in need thereof in an amount effective to treat an
infectious disease in which opsonized pathogen is present in the
blood, such as carbapenem-resistant enterobacteriaceae, drug
resistant Neisseria gonorrhoeae, fully resistant Streptococcus
pneumoniae, drug resistant tuberculosis, generalized bacterial
sepsis, human immunodeficiency virus infection, hepatitis B virus
infection, or malaria. In some embodiments, functional erythroid
cells comprise a receiver specific for circulating pathogens that
include, but are not limited to, the targets in table 5.
[1021] In specific embodiments, methods are provided for reducing
the circulatory concentration of a target infectious agent in a
subject (e.g., a human) suffering from or at risk of developing an
infectious disease. The methods include administering a
pharmaceutical composition comprising a synthetic membrane-receiver
polypeptide complex described herein. The pharmaceutical
composition is administered in an amount effective to substantially
reduce the circulatory concentration of the target infectious
agent. In certain embodiments, the administration is carried out
intravenously.
[1022] In certain embodiments, synthetic membrane-receiver
polypeptide complexes are administered that comprise a receiver
that specifically binds, sequesters, and/or degrades an infectious
agent, such as a bacterium, a virus, a fungus, or a parasite that
is present in the circulatory system of the subject.
[1023] In certain embodiments, synthetic membrane-receiver
polypeptide complexes are administered to reduce the plasma titer
of the infectious agent, e.g., virus titer.
[1024] In certain embodiments, synthetic membrane-receiver
polypeptide complexes are administered to reduce the ability of the
infectious agent to access enough host cells per unit of time. A
decrease in the rate of infection of host cells may correlate with
an increasing inability of the infectious agent to perpetuate the
infection or perpetuate the deleterious effect to the subject host.
The infection may be suppressed and/or contained.
[1025] In certain embodiments, the pharmaceutical composition will
reduce the target infectious agent load in the circulatory system,
slowing or stopping the infection and aiding the immune system in
its defense, thereby reducing the burden of the infectious disease.
Infectious diseases include, but are not limited to, Hepatitis A,
Hepatitis B, Hepatitis C, HIV, Ebola, C. difficile, C. botulinum,
Anthrax, E. coli, Mycobacterium tuberculosis, Candida, malaria and
those listed in table 6 and table 8.
[1026] In one embodiment the disease or condition is Anthrax (B.
anthracis) infection, the receiver is an antibody-like binder to B.
anthracis surface protein or fragment thereof, and the target is B.
anthracis.
[1027] In one embodiment the disease or condition is C. botulinum
infection, the receiver is an antibody-like binder to C. botulinum
surface protein or fragment thereof, and the target is C.
botulinum.
[1028] In one embodiment the disease or condition is C. difficile
infection, the receiver is an antibody-like binder to C. difficile
surface protein or fragment thereof, and the target is C.
difficile.
[1029] In one embodiment the disease or condition is Candida
infection, the receiver is an antibody-like binder to candida
surface protein or fragment thereof, and the target is candida.
[1030] In one embodiment the disease or condition is E. coli
infection, the receiver is an antibody-like binder to E. coli
surface protein or fragment thereof, and the target is E. coli.
[1031] In one embodiment the disease or condition is Ebola
infection, the receiver is an antibody-like binder to Ebola surface
protein or fragment thereof, and the target is Ebola.
[1032] In one embodiment the disease or condition is Hepatitis B
(HBV) infection, the receiver is an antibody-like binder to HBV
surface protein or fragment thereof, and the target is HBV.
[1033] In one embodiment the disease or condition is Hepatitis C
(HCV) infection, the receiver is an antibody-like binder to HCV
surface protein or fragment thereof, and the target is HCV.
[1034] In one embodiment the disease or condition is Human
immunodeficiency virus (HIV) infection, the receiver is an
antibody-like binder to HIV envelope proteins or CD4 or CCR5 or
fragment thereof, and the target is HIV.
[1035] In one embodiment the disease or condition is M.
tuberculosis infection, the receiver is an antibody-like binder to
M. tuberculosis surface protein or fragment thereof, and the target
is M. tuberculosis.
[1036] In one embodiment the disease or condition is malaria (P.
falciparum) infection, the receiver is an antibody-like binder to
P. falciparum surface protein or fragment thereof, and the target
is P. falciparum.
[1037] 1. Bacterial Infections
[1038] In some embodiments, subjects may be identified as having
received or would benefit from receiving treatment for a bacterial
infection. Subjects suffering from or at risk of developing a
bacterial infection may be administered a pharmaceutical
composition comprising the synthetic membrane-receiver polypeptide
complex described herein to treat or prevent disease.
[1039] In some embodiments, the target is a bacterium. In certain
embodiments, the target comprises a bacterial antigen. In some
embodiments, the bacterial antigen comprises a cell surface
antigen, a secreted toxin, or a secreted bacterial antigen.
[1040] Bacteremia is the presence of bacteria in the blood.
Gram-negative bacteremia secondary to infection usually originates
in the genitourinary system or GI tract, or the skin in patients
with decubitus ulcers. Chronically ill and immunocompromised
patients have an increased risk of gram-negative bacteremia. They
may also develop bacteremia with gram-positive cocci, anaerobes,
and fungi. Staphylococcal bacteremia is common in injection drug
users. Bacteroides bacteremia may develop in patients with
infections of the abdomen and the pelvis, particularly the female
genital tract. The bacteria most likely to cause bacteremia include
members of the Staphylococcus, Streptococcus, Pseudomonas,
Haemophilus, and Esherichia coli (E. coli) genera.
[1041] Bacterial infectious diseases that can be treated by the
pharmaceutical compositions comprising a synthetic
membrane-receiver polypeptide complex described herein include, but
are not limited to, Mycobacteria, Rickettsia, Mycoplasma, Neisseria
meningitides, Neisseria gonorrheoeae, Legionella, Vibrio cholerae,
Streptococci, Staphylococcus aureus, Staphylococcus epidermidis,
Pseudomonas aeruginosa, Corynobacteria diphtheriae, Clostridium
spp., enterotoxigenic Eschericia coli, and Bacillus anthracis.
Other pathogens for which bacteremia has been reported include:
Rickettsia, Bartonella henselae, Bartonella quintana, Coxiella
burnetii, chlamydia, Mycobacterium leprae, Salmonella; shigella;
Yersinia enterocolitica; Yersinia pseudotuberculosis; Legionella
pneumophila; Mycobacterium tuberculosis; Listeria monocytogenes;
Mycoplasma spp.; Pseudomonas fluorescens; Vibrio cholerae;
Haemophilus influenzae; Bacillus anthracis; Treponema pallidum;
Leptospira; Borrelia; Corynebacterium diphtheriae; Francisella;
Brucella melitensis; Campylobacter jejuni; Enterobacter; Proteus
mirabilis; Proteus; and Klebsiella pneumoniae.
[1042] In some embodiments, a membrane-receiver polypeptide complex
may be used to treat the infectious bacterial disease. A suitable
receiver polypeptide may comprise, for example, CD14 or a
functional fragment thereof. CD14 is associated with
monocyte/macrophages and binds lipopolysaccharide associated with
gram negative bacteria as well as lipoteichoic acid associated with
the gram positive bacteria Bacillus subtilis. Other suitable
receivers may comprise adenylate cyclase (Bordatella pertussis),
Gal alpha 1-4Gal-containing isoreceptors (E. coli), glycoconjugate
receptors (enteric bacteria), Lewis(b) blood group antigen receptor
(Heliobacter pylori), CR3 receptor, protein kinase receptor,
galactose N-acetylgalactosamine-inhibitable lectin receptor,
chemokine receptor (Legionella), annexin I (Leishmania mexicana),
ActA protein (Listeria monocytogenes), meningococcal virulence
associated Opa receptors (Meningococcus), acute over
(.alpha.)5.beta.3 integrin (Mycobacterium avium-M), heparin
sulphate proteoglycan receptor, CD66 receptor, integrin receptor,
membrane cofactor protein, CD46, GM1, GM2, GM3, and CD3 (Neisseria
gonorrhoeae), KDEL receptor (Pseudomonas), epidermal growth factor
receptor (Samonella typhiurium), .beta.1 integrin (Shigella),
nonglycosylated J774 receptor (Streptococci) or combinations or
functional fragments thereof.
[1043] In some embodiments, the synthetic membrane-receiver complex
may comprise more than one receiver. One receiver may function to
interact with the target, while the other receiver may modify the
target, e.g., disrupting the integrity of the target, marking the
target for degradation and/or inactivating the target. For example,
if the target is a bacterium, one receiver functions to interact
with the target bacterium (e.g., through an interaction with an
epitope if the receiver comprises an antibody-like function). The
other receiver may be capable of breaching the cell membrane of the
bacterium. Suitable second receivers include, for example,
lysozymes, bacteriocidal permeability increasing peptides,
proteases, and other pore forming antimicrobials. For example, a
lysozyme receiver may hydrolyse 1,4-beta-linkages between
N-acetylmuramic acid and N-acetyl-D-glucosamine residues in a
peptidoglycan and between N-acetyl-D-glucosamine residues in
chitodextrins of certain bacteria.
[1044] Alternatively, a second receiver may comprise a
bacteriostatic or bactericidal agent that may be contacted with the
bacterium. Yet another alternative is that the synthetic
membrane-receiver complex comprises (e.g., through loading) a
bacteriostatic or bactericidal agent that may be contacted with the
bacterium. Examples of bacteriostatic or bactericidal agents that
may be associated with a receiver or the complex include, but are
not limited to, beta-lactam compounds (penicillin, methicillin,
nafcillin, oxacillin, cloxacillin, dicloxacilin, ampicillin,
ticarcillin, amoxicillin, carbenicillin, piperacillin);
cephalosporins & cephamycins (cefadroxil, cefazolin,
cephalexin, cephalothin, cephapirin, cephradine, cefaclor,
cefamandole, cefonicid, cefuroxime, cefprozil, loracarbef,
ceforanide, cefoxitin, cefmetazole, cefotetan, cefoperazone,
cefotaxime, ceftazidine, ceftizoxine, ceftriaxone, cefixime,
cefpodoxime, proxetil, cefdinir, cefditoren, pivoxil, ceftibuten,
moxalactam, cefepime); other beta-lactam drugs (aztreonam,
clavulanic acid, sulbactam, tazobactam, ertapenem, imipenem,
meropenem); cell wall membrane active agents (vancomycin,
teicoplanin, daptomycin, fosfomycin, bacitracin, cycloserine);
tetracyclines (tetracycline, chlortetracycline, oxytetracycline,
demeclocycline, methacycline, doxycycline, minocycline,
tigecycline); macrolides (erythromycin, clarithromycin,
azithromycin, telithromycin); clindamycin; choramphenicol;
quinupristin-dalfopristin; linezolid; aminoglycosides
(streptomycin, neomycin, kanamycin, amikacin, gentamicin,
tobramycin, sisomicin, netilmicin); spectinomycin; sulfonamides
(sulfacytine, sulfisoxazole, silfamethizole, sulfadiazine,
sulfamethoxazole, sulfapyridine, sulfadoxine); trimethoprim;
pyrimethamine; trimethoprim-sulfamethoxazole; fluoroquinolones
(ciprofloxacin, gatifloxacin, gemifloxacin, levofloxacin,
lomefloxacin, moxifloxacin, norfloxacin, ofloxacin); colistimethate
sodium, methenamine hippurate, methenamine mandelate,
metronidazole, mupirocin, nitrofurantoin, and polymyxin B. Examples
of anti-mycobacteria drugs include, but are not limited to:
isoniazid, rifampin, rifabutin, rifapentine, pyrazinamide,
ethambutol, ethionamide, capreomycin, clofazimine, and dapsone.
[1045] In some embodiments, methods of treatment of bacterial
infectious diseases are provided comprising co-administration of
one or more bacteriostatic or bactericidal agents and the synthetic
membrane-receiver complex described herein, wherein
co-administration includes administration of the bacteriostatic or
bactericidal agent before, after or concurrent with administration
of the synthetic membrane-receiver complex.
[1046] In some embodiments, methods of treatment of bacterial
infectious diseases are provided comprising administration of a
pharmaceutical composition comprising one or more bacteriostatic or
bactericidal agents and the synthetic membrane-receiver complex
described herein.
[1047] In some embodiments, the receiver may sequester the target
bacterium and distribute it in the circulatory system without
directly modifying the target. In certain embodiments, the
synthetic membrane-receiver complex may subject the associated
target bacterium to degradation by the reticulo-endothelial
system.
[1048] 2. Fungal Infections
[1049] In some embodiments, subjects may be identified as having
received or would benefit from receiving treatment for a fungal
infection. Subjects suffering from or at risk of developing a
fungal infection may be administered a pharmaceutical composition
comprising the synthetic membrane-receiver polypeptide complex
described herein to treat or prevent disease.
[1050] In some embodiments, the target is a fungus. In certain
embodiments, the target comprises a fungal antigen. In some
embodiments, the fungal antigen comprises a cell surface antigen, a
secreted toxin, or a secreted fungal antigen.
[1051] Fungemia (also known as candidemia, candedemia, and invasive
candidiasis) is the presence of fungi or yeasts in the blood. The
most commonly known pathogen is Candida albicans, causing roughly
70% of fungemias, followed by Candida glabrata with 10%, and
Aspergillus with 1%. Infections with T. glabrata, Candida
tropicalis, C. krusei, and C. parapsilosis may also occur.
[1052] In some embodiments, a membrane-receiver polypeptide complex
may be used to treat the infectious fungal disease. In some
embodiments, the synthetic membrane-receiver complex may comprise
more than one receiver. One receiver may function to interact with
the target, while the other receiver may modify the target, e.g.,
disrupting the integrity of the target, marking the target for
degradation and/or inactivating the target. The second receiver may
comprise an antifungal agent that may be contacted with the fungus.
In another embodiment, the synthetic membrane-receiver complex
comprises (e.g., through loading) an antifungal agent that may be
contacted with the fungus.
[1053] Examples of antifungal agents that may be associated with a
receiver or the complex include, but are not limited to,
allylamines; terbinafine; antimetabolites; flucytosine; azoles;
fluconazole; itraconazole; ketoconazole; ravuconazole;
posaconazole; voriconazole; glucan synthesis inhibitors;
caspofungin; micafungin; anidulafungin; polyenes; amphotericin B;
amphotericin B Lipid Complex (ABLC); amphotericin B Colloidal
Dispersion (ABCD); liposomal amphotericin B (L-AMB); liposomal
nystatin; and griseofulvin.
[1054] In some embodiments, methods of treatment of fungal
infectious diseases are provided comprising co-administration of
one or more antifungal agents and the synthetic membrane-receiver
complex described herein, wherein co-administration includes
administration of the antifungal agent before, after or concurrent
with administration of the synthetic membrane-receiver complex.
[1055] In some embodiments, methods of treatment of bacterial
infectious diseases are provided comprising administration of a
pharmaceutical composition comprising one or more antifungal agents
and the synthetic membrane-receiver complex described herein.
[1056] In some embodiments, the receiver may sequester the target
fungus and distribute it in the circulatory system without directly
modifying the target. In certain embodiments, the synthetic
membrane-receiver complex may subject the associated target fungus
to degradation by the reticulo-endothelial system.
[1057] 3. Parasite Infections
[1058] In some embodiments, subjects may be identified as having
received or would benefit from receiving treatment for a parasitic
infection. Subjects suffering from or at risk of developing a
parasitic infection may be administered a pharmaceutical
composition comprising the synthetic membrane-receiver polypeptide
complex described herein to treat or prevent disease.
[1059] In some embodiments, the target is a parasite. In certain
embodiments, the target comprises a parasitic antigen. In some
embodiments, the parasitic antigen comprises a cell surface
antigen, a secreted toxin, or a secreted parasitic antigen.
Suitable targets include intestinal or blood-borne parasites,
including protazoa.
[1060] Typically, blood-borne parasites are transmitted through an
arthropod vector. Most important arthropod for transmitting
parasitic infections are mosquitoes. Mosquitoes carry malaria and
filarial nematodes. Biting flies transmit African trypanosomiasis,
leishmaniasis and several kinds of filariasis. Examples of
parasites include, but are not limited to, trypanosomes;
haemoprotozoa and parasites capable of causing malaria; enteric and
systemic cestodes including taeniid cestodes; enteric coccidians;
enteric flagellate protozoa; filarial nematodes; gastrointestinal
and systemic nematodes and hookworms.
[1061] In some embodiments, a membrane-receiver polypeptide complex
may be used to treat the parasitic infection. In some embodiments,
the synthetic membrane-receiver complex may comprise more than one
receiver. One receiver may function to interact with the target,
while the other receiver may modify the target, e.g., disrupting
the integrity of the target, marking the target for degradation
and/or inactivating the target. The second receiver may comprise an
anti-parasitic agent that may be contacted with the fungus. In
another embodiment, the synthetic membrane-receiver complex
comprises (e.g., through loading) an anti-parasitic agent that may
be contacted with the fungus.
[1062] Examples of anti-parasitic agents that may be associated
with a receiver or the complex include, but are not limited to,
antiprotozoal agents; eflornithine; furazolidone; melarsoprol;
metronidazole; ornidazole; paromomycin sulfate; pentamidine;
pyrimethamine; tinidazole; antimalarial agents; quinine;
chloroquine; amodiaquine; pyrimethamine; sulphadoxine; proguanil;
mefloquine; halofantrine; primaquine; artemesinin and derivatives
thereof; doxycycline; clindamycin; benznidazole; nifurtimox;
antihelminthics; albendazole; diethylcarbamazine; mebendazole;
niclosamide; ivermectin; suramin; thiabendazole; pyrantel pamoate;
levamisole; piperazine family; praziquantel; triclabendazole;
octadepsipeptides; and emodepside.
[1063] In some embodiments, methods of treatment of parasitic
infectious diseases are provided comprising co-administration of
one or more anti-parasitic agents and the synthetic
membrane-receiver complex described herein, wherein
co-administration includes administration of the anti-parasitic
agent before, after or concurrent with administration of the
synthetic membrane-receiver complex.
[1064] In some embodiments, methods of treatment of parasitic
infectious diseases are provided comprising administration of a
pharmaceutical composition comprising one or more anti-parasitic
agents and the synthetic membrane-receiver complex described
herein.
[1065] In some embodiments, the receiver may sequester the target
parasite and distribute it in the circulatory system without
directly modifying the target. In certain embodiments, the
synthetic membrane-receiver complex may subject the associated
target parasite to degradation by the reticulo-endothelial
system.
[1066] 4. Viral Infections
[1067] In some embodiments, subjects may be identified as having
received or would benefit from receiving treatment for a viral
infection. Subjects suffering from or at risk of developing a viral
infection may be administered a pharmaceutical composition
comprising the synthetic membrane-receiver polypeptide complex
described herein to treat or prevent disease.
[1068] In some embodiments, the target is a virus. In certain
embodiments, the target comprises a viral antigen. In some
embodiments, the viral antigen comprises an envelope antigen or a
capsid antigen. Suitable viral targets include adenovirus,
coxsackievirus, hepatitis a virus, poliovirus, epstein-barr virus,
herpes simplex, type 1, herpes simplex, type 2, human
cytomegalovirus, human herpesvirus, type 8, varicella-zoster virus,
hepatitis B virus, hepatitis C viruses, human immunodeficiency
virus (HIV), influenza virus, measles virus, mumps virus,
parainfluenza virus, respiratory syncytial virus, papillomavirus,
rabies virus, and Rubella virus. Other suitable viral targets
include Paramyxoviridae (e.g., pneumovirus, morbillivirus,
metapneumovirus, respirovirus or rubulavirus), Adenoviridae (e.g.,
adenovirus), Arenaviridae (e.g., arenavirus such as lymphocytic
choriomeningitis virus), Arteriviridae (e.g., porcine respiratory
and reproductive syndrome virus or equine arteritis virus),
Bunyaviridae (e.g., phlebovirus or hantavirus), Caliciviridae
(e.g., Norwalk virus), Coronaviridae (e.g., coronavirus or
torovirus), Filoviridae (e.g., Ebola-like viruses), Flaviviridae
(e.g., hepacivirus or flavivirus), Herpesviridae (e.g.,
simplexvirus, varicellovirus, cytomegalovirus, roseolovirus, or
lymphocryptovirus), Orthomyxoviridae (e.g., influenza virus or
thogotovirus), Parvoviridae (e.g., parvovirus), Picomaviridae
(e.g., enterovirus or hepatovirus), Poxviridae (e.g.,
orthopoxvirus, avipoxvirus, or leporipoxvirus), Retroviridae (e.g.,
lentivirus or spumavirus), Reoviridae (e.g., rotavirus),
Rhabdoviridae (e.g., lyssavirus, novirhabdovirus, or
vesiculovirus), and Togaviridae (e.g., alphavirus or rubivirus).
Specific examples of these viruses include human respiratory
coronavirus, influenza viruses A-C, hepatitis viruses A to G, and
herpes simplex viruses 1-9.
[1069] In some embodiments, a membrane-receiver polypeptide complex
may be used to treat the viral infection. In some embodiments, the
synthetic membrane-receiver complex may comprise more than one
receiver. One receiver may function to interact with the target,
while the other receiver may modify the target, e.g., disrupting
the integrity of the target, marking the target for degradation
and/or inactivating the target.
[1070] For example, if the target is a virus, one receiver
functions to interact with the target virus (e.g., through an
interaction with a viral epitope if the receiver comprises an
antibody-like function). The other receiver may be capable of
breaching the viral envelope or capsid. Suitable second receivers
include, for example, antiviral agents, proteases, nucleases,
antisense molecules, ribozymes, RNAi molecules (e.g., siRNA or
shRNA), or other molecules that are toxic or detrimental to the
virus.
[1071] The second receiver may comprise an anti-viral agent that
may be contacted with the virus. In another embodiment, the
synthetic membrane-receiver complex comprises (e.g., through
loading) an anti-viral agent that may be contacted with the
virus.
[1072] Examples of anti-viral agents that may be associated with a
receiver or the complex include, but are not limited to,
thiosemicarbazones; metisazone; nucleosides and nucleotides;
acyclovir; idoxuridine; vidarabine; ribavirin; ganciclovir;
famciclovir; valaciclovir; cidofovir; penciclovir; valganciclovir;
brivudine; ribavirin, cyclic amines; rimantadine; tromantadine;
phosphonic acid derivatives; foscarnet; fosfonet; protease
inhibitors; saquinavir; indinavir; ritonavir; nelfinavir;
amprenavir; lopinavir; fosamprenavir; atazanavir; tipranavir;
nucleoside and nucleotide reverse transcriptase inhibitors;
zidovudine; didanosine; zalcitabine; stavudine; lamivudine;
abacavir; tenofovir disoproxil; adefovir dipivoxil; emtricitabine;
entecavir; non-nucleoside reverse transcriptase inhibitors;
nevirapine; delavirdine; efavirenz; neuraminidase inhibitors;
zanamivir; oseltamivir; moroxydine; inosine pranobex; pleconaril;
and enfuvirtide.
[1073] In some embodiments, methods of treatment of viral
infectious diseases are provided comprising co-administration of
one or more anti-viral agents and the synthetic membrane-receiver
complex described herein, wherein co-administration includes
administration of the anti-viral agent before, after or concurrent
with administration of the synthetic membrane-receiver complex.
[1074] In some embodiments, methods of treatment of viral
infectious diseases are provided comprising administration of a
pharmaceutical composition comprising one or more antiviral agents
and the synthetic membrane-receiver complex described herein.
[1075] In some embodiments, the receiver may sequester the target
virus and distribute it in the circulatory system without directly
modifying the target. In certain embodiments, the synthetic
membrane-receiver complex may subject the associated target virus
to degradation by the reticulo-endothelial system.
[1076] Conditions Associated with Toxins and Poisons
[1077] In some embodiments, the synthetic membrane-receiver
polypeptide complexes described herein may be used to treat or
prevent toxic conditions or poisoning caused by toxins or
poisons.
[1078] Sepsis and septic shock, which represent major causes of
mortality in modern intensive care medicine, are caused by an
inadequate inflammatory and immunological host response to
bacterial infection. Evidence suggests that the systemic spread of
microbial toxins, rather than bacteremia itself, is the crucial
event in the pathogenesis. The endothelium is a main target of
bacterial toxins. The resulting endothelial dysfunction is believed
to contribute to the underlying pathomechanisms and the collapse of
homeostasis of organ function.
[1079] Bacterial toxins targeting endothelial cells severely alter
the behavior of extravascular cells and circulating leukocytes via
excessive formation of vasoactive mediators and overexpression of
adhesion molecules (Grandel, Crit Rev Immunol, 2003).
[1080] Pore-forming toxins (PFTs) are one of the most common
protein toxins found in nature. These toxins disrupt cells by
forming pores in cellular membranes and altering their
permeability. In bacterial infections, attack by PFTs is a major
virulence mechanism. It has been demonstrated that the inhibition
of the pore-forming a-toxin can reduce the severity of
Staphylococcus aureus infections, and similar PFT-targeted
strategies have shown therapeutic potential against other
pathogens, including Escherichia coli, Listeria monocytogenes,
Bacillus anthracis and Streptococcus pneumoniae. As well as their
role in bacterial pathogenesis, PFTs are commonly used in venomous
attacks by animals such as sea anemones, scorpions and snakes. Over
80 families of PFTs have been identified, displaying diverse
molecular structures and distinctive epitopic targets (Zhang,
Nature Nano, 2013).
[1081] A number of biomolecules show interactions with endotoxins,
such as lipopolysaccharide-binding protein (LBP),
bactericidal/permeability-increasing protein (BPI), amyloid P
component, cationic protein, or the enzyme employed in the
biological endotoxin assay (anti-LPS) factor from Limulus amebocyte
lysate (LAL). These proteins are directly involved in the reaction
of many different species upon administration of endotoxin.
[1082] In one embodiment, functional erythroid cells comprise a
receiver that comprises an amino acid sequence derived from
lipopolysaccharide binding protein (LBP). A population of
functional erythroid cells comprising a receiver that comprises an
amino acid sequence derived from lipopolysaccharide binding protein
(LBP) may be administered to a subject in need thereof in an amount
effective to remove immunogenic lipopolysaccharide that may be in
circulation as a result of a microbial infection.
[1083] Further provided are methods of inducing toxin clearance.
The methods include administering to a subject in need thereof a
population of functional erythroid cells comprising a receiver that
is capable of interacting with a toxin, such as e.g., an antibody,
scFv or nanobody receiver, in an amount effective to clear toxins
from circulation. The compositions comprising functional erythroid
cells that comprise the toxin-specific receiver may be administered
to subjects that exhibit levels of toxic metabolites or infectious
agents such as anthrax, botulinum, cytokines, sarin, hemolysin,
venoms, and including, but not limited to, those in table 5.
[1084] In one embodiment, functional erythroid cells comprise a
receiver that comprises an amino acid sequence derived from the
endotoxin receptor CD14. A population of functional erythroid cells
comprising a receiver that comprises an amino acid sequence derived
from the endotoxin receptor CD14 may be administered to a subject
in need thereof in an amount effective to bind to a target
endotoxin in circulation. Such methods may be employed to sequester
the toxin and reduce the amount of tissue damage that would
otherwise occur within the vasculature and dissipating its
pathogenic effects in a less acute manner.
[1085] In one embodiment, the receiver interacts with cell-free
circulating DNA. In one embodiment, the functional erythroid cell
expresses exogenous gene encoding a receiver comprising an amino
acid sequence derived from a DNA-interacting polypeptide, such as,
e.g., DNase, a transcription factor DNA binding domain or histone
fragments. The DNase, DNA binding domain or histone fragment may be
expressed as a fusion protein. In other embodiments, the DNAse, DNA
binding domain, histone fragment or another receiver with affinity
to circulating DNA is loaded into or onto the erythroid cell. In
one embodiment, the receiver is a DNase, DNA binding domain or
histone fragment that is localized extracellularly.
[1086] A hallmark of apoptosis is DNA degradation, in which
chromosomal DNA is first cleaved into large fragments (50-300 kb)
and subsequently into multiples of nucleosomal units (180-200 bp)
(Nagata, Cell Death Differ, 2003). The contents of apoptotic cells
are ingested by phagocytes or neighboring cells and the DNA is
completely digested by DNase II in lysosomes (Nagata, Cell Death
Differ, 2003). Thus, DNA fragments released by apoptosis may be
removed before appearing in the circulation. In instances where the
engulfment of apoptotic bodies is impaired or cell death is
increased an inflammatory response may occur. For example,
autoimmunity occurs frequently in cancer and other conditions
involving increased circulating DNA (Viorritto, Clin Immunol,
2007).
[1087] Extracellular DNA, or circulating cell free DNA (cf-DNA), is
present in blood plasma. These cf-DNAs, at least part of them, are
believed to originate from cancer cells and contain a number of
cancer specific entities, including oncogenes, tumor suppressor
genes, aberrant microsatellites, aberrant DNA methylation genes,
and rearranged chromosomal DNA. The term, `genometastasis` has been
proposed to describe the phenomena of an apoptotic body containing
DNA that horizontally enters and transforms healthy cells
(Garcia-Olmo, Expert Opinion on Bio Therapy, 2012).
[1088] In certain embodiments, functional erythroid cells
comprising a receiver specific for circulating DNA are administered
to a subject in need thereof in an amount effective to treat a
DNA-driven pathogenesis, such as systemic lupus erythematosus and
cancers suspected of genometastasis. In some embodiments,
functional erythroid cells comprise an extracellular receiver
comprising DNAse fused to the N terminal of glycophorin A such that
it is capable of degrading circulating DNA within the
vasculature.
[1089] In specific embodiments, methods are provided for reducing
the circulatory concentration of a target toxin or poison in a
subject (e.g., a human) suffering from or at risk of developing a
toxic condition or poisoning. The methods include administering a
pharmaceutical composition comprising a synthetic membrane-receiver
polypeptide complex described herein. The pharmaceutical
composition is administered in an amount effective to substantially
reduce the circulatory concentration of the target toxin or poison.
In certain embodiments, the administration is carried out
intravenously.
[1090] In certain embodiments, synthetic membrane-receiver
polypeptide complexes are administered that comprise a receiver
that specifically binds, sequesters, and/or degrades a toxin or
poison, such as a pathogenic toxin, a venom, a prion protein, a
cytokine, a metal (e.g., heavy metal), or an alcohol (e.g.,
methanol) that is present in the circulatory system of the subject.
Conditions associated with toxins or poisons include, but are not
limited to bacterial toxin-induced shock, spider venom-induced
shock, prion diseases, cytokine storm, iron poisoning, copper
poisoning, Wilson disease, heavy metal poisoning, methanol
poisoning and those listed in table 6 and table 8.
[1091] Further provided are methods of inducing toxin clearance. In
specific embodiments, the methods include administering to a
subject in need thereof a pharmaceutical composition of erythrocyte
cells comprising a receiver provided herein in an amount sufficient
to induce toxin clearance in the subject. The compositions may be
administered to subjects that exhibit levels of toxic metabolites
or infectious agents such as anthrax, botulinum, cytokines, sarin,
hemolysin, venoms, and those included, but not limited to table
5.
[1092] In one embodiment the disease or condition is alpha
hemolysin poisoning, the receiver is an antibody-like binder to
alpha hemolysin or fragment thereof, and the target is alpha
hemolysin.
[1093] In one embodiment the disease or condition is antrax toxin
poisoning, the receiver is an antibody-like binder to anthrax toxin
or fragment thereof, and the target is anthrax toxin.
[1094] In one embodiment the disease or condition is bacterial
toxin-induced shock, the receiver is an antibody-like binder to
bacterial toxin or fragment thereof, and the target is bacterial
toxin.
[1095] In one embodiment the disease or condition is botulinum
toxin poisoning, the receiver is an antibody-like binder to
botulinum toxin or fragment thereof, and the target is botulinum
toxin.
[1096] In one embodiment the disease or condition is prion disease
caused by PRP, the receiver is an antibody-like binder to prion
protein PRP or fragment thereof, and the target is prion protein
PRP.
[1097] In one embodiment the disease or condition is prion disease
caused by PRPc, the receiver is an antibody-like binder to prion
protein PRPc or fragment thereof, and the target is prion protein
PRPc.
[1098] In one embodiment the disease or condition is prion disease
caused by PRPsc, the receiver is an antibody-like binder to prion
protein PRPsc or fragment thereof, and the target is prion protein
PRPsc.
[1099] In one embodiment the disease or condition is prion disease
caused by PRPres, the receiver is an antibody-like binder to prion
protein PRPres or fragment thereof, and the target is prion protein
PRPres.
[1100] In one embodiment the disease or condition is sepsis or
cytokine storm, the receiver is an antibody-like binder to
cytokines or duffy antigen receptor of chemokines (DARC) or
fragment thereof, and the target is cytokines.
[1101] Wilson's disease is caused by a failure of copper metabolism
and a buildup of copper in liver, brain, and other organs. Copper
chelators are used clinically, for example D-penicillamine, but
they suffer from short half-lives that reduce their therapeutic
efficacy. In one embodiment, the receiver on the surface of a
synthetic membrane-receiver complex is D-penicillamine
Administration of the synthetic membrane-receiver complex will
allow D-penicillamine to remain in circulation for substantially
longer than free D-penicillamine, thus capturing copper for a
longer period of time and providing a clinical benefit in Wilson's
disease.
[1102] In one embodiment the disease or condition is spider venom
poisoning, the receiver is an antibody-like binder to spider venom
or fragment thereof, and the target is spider venom.
[1103] 1. Toxins
[1104] In some embodiment, subjects may be identified as having
received or would benefit from receiving treatment for botulinum
toxin (BTX) poisoning. Subjects suffering from or at risk of
developing BTX poisoning may be administered a pharmaceutical
composition comprising the synthetic membrane-receiver polypeptide
complex described herein to treat or prevent disease.
[1105] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises a receiver comprising an antibody
domain or antibody-like domain that binds to BTX of any of the
types A-H, or a derivative or functional fragment thereof. A
suitable receiver may be exhibited on the surface of the synthetic
membrane-receiver polypeptide complex. The suitable receiver is
capable of binding to BTX and preventing BTX from carrying out its
function.
[1106] BTX is produced by Clostridium botulinum and is a potent
neurotoxin with an estimated human lethal dose of 1.3-2.1 ng/kg
intravenously (Arnon et al. 2001 J Am Med Assoc 285(8):1059). BTX
is a protease that attacks one of the fusion proteins (SNAP-25,
syntaxin or synaptobrevin) at a neuromuscular junction, preventing
vesicles from anchoring to the membrane to release acetylcholine.
By inhibiting acetylcholine release, the toxin interferes with
nerve impulses and causes flaccid (sagging) paralysis of
muscles.
[1107] 2. Prions--Creutzfeldt-Jakob Disease
[1108] In some embodiment, subjects may be identified as having
received or would benefit from receiving treatment for
Creutzfeldt-Jakob Disease (CJD) caused by prion protein in the
scrapie form (PrPsc). Subjects suffering from or at risk of
developing CJD may be administered a pharmaceutical composition
comprising the synthetic membrane-receiver polypeptide complex
described herein to treat or prevent disease.
[1109] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises a receiver comprising an antibody
domain or antibody-like domain that binds to PrPsc or a derivative
or functional fragment thereof. A suitable receiver may be
exhibited on the surface of the synthetic membrane-receiver
polypeptide complex. The suitable receiver is capable of binding to
PrPsc and preventing PrPsc from carrying out its function.
[1110] PrPsc is a misfolded form of PrP that can induce normal PrP
to misfold in an autocatalytic fashion. PrPsc is protease resistant
and forms insoluble aggregates and fibrils that damage cells. In
CJD, the PrPsc aggregates and fibrils lead to rapid
neurodegeneration, causing the brain tissue to develop holes and
take on a sponge-like texture.
[1111] 3. Cytokines
[1112] In some embodiment, subjects may be identified as having
received or would benefit from receiving treatment for sepsis.
Subjects suffering from or at risk of developing sepsis poisoning
may be administered a pharmaceutical composition comprising the
synthetic membrane-receiver polypeptide complex described herein to
treat or prevent disease.
[1113] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises one or more receivers comprising an
antibody domain, antibody-like domain, or cytokine receptor domain
that bind to one or more of the cytokines tumor necrosis factor
alpha (TNFa), interferon gamma (IFNg), or interleukin-2 (IL-2) or a
derivative or functional fragment thereof. A suitable receiver may
be exhibited on the surface of the synthetic membrane-receiver
polypeptide complex. The suitable receiver is capable of binding to
the cytokine and preventing the cytokine from carrying out its
function, e.g., by preventing the cytokine from biding to its
native receptor.
[1114] Cytokines like TNFa, IFNg, and IL-2 are produced by immune
cells in response to infection and are powerful inflammatory
stimuli for other immune cells. In sepsis, a serious bacterial
infection induces whole-body inflammation driven by a storm of
cytokines, which triggers multi-organ failure, acute respiratory
distress, heart failure, encephalopathy, and edema.
[1115] Diseases and Conditions Associated with the Accumulation of
Lipids or Cholesterols
[1116] In some embodiments, the synthetic membrane-receiver
polypeptide complexes described herein may be used to treat or
prevent diseases and conditions associated with the accumulation of
lipids or cholesterols.
[1117] In one embodiment, the receiver interacts with one or more
lipids. In one embodiment, the functional erythroid cell expresses
a exogenous gene encoding an amino acid sequence derived from a
lipase. The lipase may be expressed as a full-length protein or a
fragment thereof. The lipase may be expressed as a fusion protein.
In other embodiments, the lipase protein receiver or another
receiver with affinity to lipids is loaded into or onto the
erythroid cell. The lipase protein receiver or the other receiver
with affinity to lipids may be localized intracellularly or
extracellularly. In one embodiment, the receiver comprises an amino
acid sequence derived from lipoprotein lipase.
[1118] Hyperlipidemia or hyperlipoproteinemia is an excess of
lipids, largely cholesterol and triglycerides, in the blood. Lipids
travel in the blood attached to proteins to remain dissolved while
in circulation. Hyperlipidemia, in general, can be divided into two
subcategories; hypercholesterolemia, in which there is a high level
of cholesterol and hypertriglyceridemia, in which there is a high
level of triglycerides, the most common form of fat. Excess LDL
cholesterol contributes to the blockage of arteries, which
eventually leads to heart attack. Population studies have shown
that the higher the level of LDL cholesterol, the greater the risk
of heart disease.
[1119] Hyperlipidemia usually has no noticeable symptoms and tends
to be discovered during routine examination or evaluation for
atherosclerotic cardiovascular disease. However, deposits of
cholesterol (known as xanthomas) may form under the skin
(especially around the eyes or along the Achilles tendon) in
individuals with familial forms of the disorder or in those with
very high levels of cholesterol in the blood. Individuals with
hypertriglyceridemia may develop numerous pimple-like lesions
across their body. Extremely high levels of triglycerides may also
result in pancreatitis, a severe inflammation of the pancreas that
may be life-threatening.
[1120] In certain embodiments, functional erythroid cells comprise
a receiver that is capable of interacting with a lipid, or has
affinity to a target lipid or target lipid-associated molecule
listed in table 5. In certain embodiments, a population of
functional erythroid cells comprising a receiver that is capable of
interacting with a lipid or comprising a receiver that comprises an
amino acid sequence derived from lipoprotein lipase is administered
to a subject in need thereof in an amount effective to treat or
prevent hyperlipidemia.
[1121] In certain embodiments, a population of functional erythroid
cells comprising a receiver that is capable of interacting with a
lipid or comprising a receiver that comprises an amino acid
sequence derived from lipoprotein lipase is administered to a
subject in need thereof in an amount effective to remove
chylomicrons, which are lipoprotein particles consisting of lipids,
protein, and cholesterol, from the blood circulation. In some
embodiments, the receiver is lipoprotein lipase and the receiver is
localized on the surface of the erythroid cell. In certain
embodiments, a population of functional erythroid cells comprising
a receiver that comprises an amino acid sequence derived from
lipoprotein lipase is administered to a subject in need thereof in
an amount effective to treat, alleviate or prevent lipoprotein
lipase deficiency. Familial lipoprotein lipase deficiency is a
group of rare genetic disorders in which a person lacks the ability
to break down lipids, which causes a large amount of fat to build
up in the blood.
[1122] In specific embodiments, methods are provided for reducing
the circulatory concentration of a target lipid or cholesterol in a
subject (e.g., a human) suffering from or at risk of developing a
disease or condition associated with the accumulation of lipids or
cholesterols. The methods include administering a pharmaceutical
composition comprising a synthetic membrane-receiver polypeptide
complex described herein. The pharmaceutical composition is
administered in an amount effective to substantially reduce the
circulatory concentration of the target lipid or cholesterol. In
certain embodiments, the administration is carried out
intravenously.
[1123] In certain embodiments, synthetic membrane-receiver
polypeptide complexes are administered that comprise a receiver
that specifically binds, sequesters, and/or degrades a target lipid
or cholesterol, or a complex or aggregate that comprises a lipid or
cholesterol, that is present in the circulatory system of the
subject. Reduction in the amount or concentration of circulating
lipids or cholesterols and associated complexes therewith may
reduce or alleviate cardiovascular and other circulatory problems.
Diseases or conditions associated with the accumulation of lipids
or cholesterols include, but are not limited to lipoprotein lipase
deficiency, hypercholesterolemia, coronary artery disease and those
listed in table 6 and table 8.
[1124] In one embodiment the disease or condition is
hypercholesterolemia, the receiver is an antibody-like binder to
low-density lipoprotein (LDL), LDL receptor or fragment thereof,
and the target is LDL.
[1125] In one embodiment the disease or condition is
hypercholesterolemia, the receiver is an antibody-like binder to
high-density lipoprotein (HDL) or HDL receptor or fragment thereof,
and the target is HDL.
[1126] In one embodiment the disease or condition is lipoprotein
lipase deficiency, the receiver is lipoprotein lipase or fragment
thereof, and the target is chilomicrons and very low density
lipoproteins (VLDL).
[1127] Lipoprotein Lipase Deficiency (Glybera)
[1128] In some embodiment, subjects may be identified as having
received or would benefit from receiving treatment for lipoprotein
lipase deficiency. Subjects suffering from or at risk of developing
lipoprotein lipase deficiency may be administered a pharmaceutical
composition comprising the synthetic membrane-receiver polypeptide
complex described herein to treat or prevent disease.
[1129] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises a receiver comprising the enzyme
lipoprotein lipase or a derivative or functional fragment thereof.
A suitable receiver may be exhibited on the surface of the
synthetic membrane-receiver polypeptide complex. The suitable
receiver is capable of hydrolyzing triglycerides in lipoproteins,
such as those found in chylomicrons and very low-density
lipoproteins (VLDL), into two free fatty acids and one
monoacylglycerol molecule.
[1130] Lipoprotein lipase deficiency is a rare disorder in which
afflicted individuals lack the ability to produce lipoprotein
lipase enzymes necessary for effective breakdown of fatty acids.
The disorder usually presents in childhood and is characterized by
very severe hypertriglyceridemia with episodes of abdominal pain,
recurrent acute pancreatitis, eruptive cutaneous xanthomata, and
hepatosplenomegaly. Clearance of chylomicrons from the plasma is
impaired, causing triglycerides to accumulate in plasma and the
plasma to have a milky appearance. Symptoms usually resolve with
restriction of total dietary fat to <20 grams/day
[1131] Diseases and Conditions Associated with Infected, Aberrant
or Oncogenic Cells
[1132] In some embodiments, the synthetic membrane-receiver
polypeptide complexes described herein may be used to treat or
prevent diseases and conditions associated with infected, aberrant
or oncogenic cells, such as, e.g., cancer.
[1133] In one embodiment, the receiver interacts with a cancer stem
cell (CSC) or another cancer-associated circulatory cell. In one
embodiment, the functional erythroid cell expresses a exogenous
gene encoding an antibody, scFv or nanobody specific for a CSC
antigen. The antibody, scFv or nanobody may be expressed as a
fusion protein. In other embodiments, the antibody, scFv or
nanobody receiver or another receiver with affinity to circulating
cancer cells is loaded into or onto the erythroid cell. In one
embodiment, the receiver is an antibody, scFv or nanobody that is
localized extracellularly. In certain embodiments, the antibody,
scFv or nanobody receiver is specific for a CSC antigen selected
from CD44, CD47, and MET.
[1134] Cancer stem cells (CSCs), which comprise a small fraction of
cancer cells, are believed to constitute the origin of most human
tumors. One of the key steps in the metastatic cascade is the
migration of tumor cells away from the primary tumor, and CSCs are
likely associated with this migration. Most adult tissues maintain
some aspect of migratory capacity through the ability to generate
an epithelial to mesenchymal transition (EMT)-like process during
wound healing, tissue regeneration and organ fibrosis. It has been
hypothesized that CSCs may also activate their migration through
the process of EMT.
[1135] A number of studies have linked circulating tumor cells
(CTCs) to tumor progression in a variety of solid tumors, and CTC
enumeration has begun to be utilized as a prognostic tool in
patients with metastatic breast (Cristofanilli et al., 2004), colon
(Cohen et al., 2008) and prostate cancer (Danila et al., 2007).
Potentially, a fraction of CTCs have CSC activity, and it is
hypothesized that CSCs in a primary tumor which enter the
circulation become circulating CSCs and remain so until they lodge
or home to a target organ. CTCs isolated from patients with
melanomas have been found to generate metastases in
xenotransplantation models (Ma et al., 2010, Shiozawa, Pharm and
Thera, 2013).
[1136] The vasculature is a powerful conduit for the proliferation
of various circulating tumor cells, metastases, and cancer stem
cells. In certain embodiments, functional erythroid cells
comprising a receiver specific for circulating cancer cells are
administered to a subject in need thereof in an amount effective to
treat or prevent metastases. In certain embodiments, populations of
functional erythroid cells comprising a receiver specific for
circulating cancer cells are administered to a subject in need
thereof in an amount effective to interact with CSCs or CTCs to
clear them from circulation, e.g., by facilitating degradation in
the liver. In some embodiments, functional erythroid cells comprise
an antibody, scFv, or nanobody receiver specific for CD44, CD47, or
MET (three characteristic surface antigens of CTC). Suitable cancer
cells that may be cleared by the erythroid cells described herein
include, but are not limited to, cells associated with the cancers
listed in table 5 and table 8.
[1137] In specific embodiments, methods are provided for reducing
the circulatory concentration of a target cell in a subject (e.g.,
a human) suffering from or at risk of developing a disease or
condition associated with an infected, aberrant or oncogenic cell.
The methods include administering a pharmaceutical composition
comprising a synthetic membrane-receiver polypeptide complex
described herein. The pharmaceutical composition is administered in
an amount effective to substantially reduce the circulatory
concentration of the target cell. In certain embodiments, the
administration is carried out intravenously.
[1138] In certain embodiments, synthetic membrane-receiver
polypeptide complexes are administered that comprise a receiver
that specifically binds, sequesters, and/or degrades a target cell,
such as an infected, aberrant or oncogenic cell that is present in
the circulatory system of the subject. Reduction in the amount or
concentration of circulating target cells may reduce or alleviate
conditions associated with the infected, aberrant or oncogenic
cell, such as, e.g., an infection or cancer. Diseases or conditions
associated with infected, aberrant or oncogenic cells include, but
are not limited to cancer and those listed in table 6 and table
8.
[1139] In one embodiment the disease or condition is cancer, the
receiver is an antibody-like binder to CD44 or fragment thereof,
and the target is a circulating tumor cell.
[1140] In one embodiment the disease or condition is cancer, the
receiver is an antibody-like binder to EpCam or fragment thereof,
and the target is a circulating tumor cell.
[1141] In one embodiment the disease or condition is cancer, the
receiver is an antibody-like binder to Her2 or fragment thereof,
and the target is a circulating tumor cell.
[1142] In one embodiment the disease or condition is cancer, the
receiver is an antibody-like binder to EGFR or fragment thereof,
and the target is a circulating tumor cell.
[1143] In one embodiment the disease or condition is cancer (B
cell), the receiver is an antibody-like binder to CD20 or fragment
thereof, and the target is a cancerous B cell.
[1144] In one embodiment the disease or condition is cancer (B
cell), the receiver is an antibody-like binder to CD19 or fragment
thereof, and the target is a cancerous B cell.
[1145] Circulating Cancer Cell
[1146] In some embodiment, subjects may be identified as having
received or would benefit from receiving treatment for cancer.
Subjects suffering from or at risk of developing cancer may be
administered a pharmaceutical composition comprising the synthetic
membrane-receiver polypeptide complex described herein to treat or
prevent disease.
[1147] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises a receiver comprising an antibody
domain or antibody-like domain that binds to a circulating cancer
cell, e.g., a proliferative B cell, via a cancer cell specific
receptor, e.g., CD19, or a derivative or functional fragment
thereof. A suitable receiver may be exhibited on the surface of the
synthetic membrane-receiver polypeptide complex. The suitable
receiver is capable of binding to CD19 on the circulating cancer
cell and promoting the clearance of the CD19-expressing cancer
cell.
[1148] CD19 is a common receptor to B cells, and is a validated
marker for B cell cancers including B cell leukemias and lymphomas
(Scheuermann and Racila, (1995) Leukemia and Lymphoma 18 (5):
385-397. It is increasingly understood to play an additional role
in the proliferation of B cells in cancer by stabilizing the Myc
oncoprotein (Chung et al. 2012, J Clin Invest 122(6):2257). In B
cell cancers, proliferative B cells overwhelm lymph nodes and bone
marrow. Strategies to target and clear these B cells, including
antibody therapy (Rituximab), are accepted as part of the standard
of care.
[1149] Tumor metastasis is the main driver of cancer mortality and
therapies targeting metastasis are limited in number, mechanism of
action and efficacy. Hematogenous tumor cell spreading (via
bloodstream) is a common route for many carcinomas and is a highly
complex process involving primary site detachment, migration,
transport into the bloodstream, tumor cell adhesion in the
vasculature and proliferation at the metastatic site.
[1150] Diseases and Conditions Associated with a Metabolic
Defect
[1151] In some embodiments, the synthetic membrane-receiver
polypeptide complexes described herein may be used to treat or
prevent diseases and conditions associated with a metabolic defect.
A schematic example of a synthetic membrane-receiver polypeptide
complex is shown in FIG. 13A.
[1152] As described herein, many small molecule metabolites can
diffuse across the membrane of, e.g., erythroid cells comprising a
suitable receiver, or are actively transported by defined
transmembrane channels (see, e.g., Tunnicliff, Comp. Biochem.
Physiol. 1994). Some metabolites, however, may require additional
assistance to reach the intracellularly localized receiver enzyme,
thus the synthetic membrane-receiver complex may optionally
comprise a transporter.
[1153] In one embodiment, the surface exposed receiver polypeptide
may shuttle the substrate across the cell membrane into the
synthetic membrane-receiver complex, e.g., an erythroid cell
comprising a receiver. The functional erythroid cell comprising a
receiver may contain multiple receiver polypeptides, including, but
not limited to, the receiver polypeptides listed in Table 7. The
receiver polypeptides may increase the cell's capabilities to
transport metabolites or other substrates across the membrane. For
example, a Glut1 transporter may be contained in the functional
erythroid cell's membrane in combination with an intracellularly
expressed receiver glucokinase, such that the erythroid cell
internalizes and phosphorylates an amount of glucose greater than
that of a non-modified erythroid cell. Erythroid cells comprising a
receiver glucokinase may be used to reduce blood glucose levels.
Diabetes mellitus type II is associated with hyperglycemia as a
result of insulin resistance and relative lack of insulin. The
hyperglycemia may be alleviated by erythroid cells comprising a
receiver glucokinase that capture glucose through
surface-localized, receiver Glut1 and phosphorylation by an
intracellularly localized, receiver glucokinase. Modified glucose
may be unable to exit the cell. The synthetic membrane-receiver
complex acts as a "buffer" to respond to hyperglycemic
conditions.
[1154] Optionally, a second receiver polypeptide may be present in
the functional erythroid cell that exhibits increase transport
capabilities. The second receiver polypeptide may be localized
intracellularly. The second intracellularly localized receiver
polypeptide can enzymatically modify, convert, change or otherwise
alter the target substrate that was shuttled into the cell by the
first receiver polypeptide localized on the cell surface.
[1155] In specific embodiments, methods are provided for modulating
the circulatory concentration of a target metabolite in a subject
(e.g., a human) suffering from or at risk of developing a disease
or condition associated with a metabolic defect. The methods
include administering a pharmaceutical composition comprising a
synthetic membrane-receiver polypeptide complex described herein.
The pharmaceutical composition is administered in an amount
effective to substantially modulate the circulatory concentration
of the target metabolite. In some embodiments, the target
metabolite is present or present in elevated levels in circulation
and the amount or concentration of the target metabolite is
reduced. For example if the level or concentration of a metabolite
is toxic, the toxic target metabolite may be degraded or the toxic
target metabolite may be converted into another non-toxic product
(e.g., by catalytic action of the receiver). In some embodiments, a
non-target metabolite is absent or present in depressed levels in
circulation and a target metabolite is converted to the non-target
metabolite so that its level or concentration is increased. In such
embodiments, the absence of depressed levels of the non-target
metabolite is associated with the metabolic disease or disorder and
conversion of the target metabolite to the non-target metabolite
can at least partially restore or replenish the level or
concentration of the non-target metabolite, thereby treating or
preventing the metabolic disease. In certain embodiments, the
administration is carried out intravenously. Diseases or conditions
associated with a metabolic defect include, but are not limited to
mitochondrial neurogastrointestinal encephalomyopathy (MNGIE),
adenosine deaminase (ADA) deficiency, purine nucleoside
phosphorylase (PNP) deficiency, phenylketonuria, alkaptonuria,
homocystinuria, primary hyperoxaluria and those listed in table 6
and table 8.
[1156] In specific embodiments, methods of treating a metabolic
disease include administering to a subject in need thereof a
pharmaceutical composition of erythrocyte cells comprising a
receiver provided herein in an amount sufficient to treat the
metabolic disease. The compositions may be administered to subjects
that exhibit disorders of carbohydrate metabolism, amino acid
metabolism, organic acid metabolism, mitochondrial metabolism,
fatty acid metabolism, purine-pyrimidine metabolism, steroid
metabolism, peroxisomal function, lysosomal storage, or urea cycle.
Of these disorders, specific indications include ADA-SCID, primary
hyperoxaluria, and phenylketonuria, as well as, but not limited to,
the conditions listed in table 6 and table 8.
[1157] In one embodiment the disease or condition is
3-methylcrotonyl-CoA carboxylase deficiency, the receiver is
3-methylcrotonyl-CoA carboxylase or fragment thereof, and the
target is 3-hydroxyvalerylcarnitine, 3-methylcrotonylglycine
(3-MCG) and 3-hydroxyisovaleric acid (3-HIVA).
[1158] In one embodiment the disease or condition is acute
intermittent porphyria, the receiver is porphobilinogen deaminase
or fragment thereof, and the target is porphobilinogen.
[1159] In one embodiment the disease or condition is adenine
phosphoribosyltransferase deficiency, the receiver is adenine
phosphoribosyltransferase or fragment thereof, and the target is
insoluble purine 2,8-dihydroxyadenine.
[1160] In one embodiment the disease or condition is adenosine
deaminase deficiency, the receiver is adenosine deaminase or
fragment thereof, and the target is adenosine.
[1161] In one embodiment the disease or condition is alkaptonuria,
the receiver is homogentisate oxidase or fragment thereof, and the
target is homogentisate.
[1162] In one embodiment the disease or condition is argininemia,
the receiver is ammonia monooxygenase or fragment thereof, and the
target is ammonia.
[1163] In one embodiment the disease or condition is
argininosuccinate aciduria, the receiver is ammonia monooxygenase
or fragment thereof, and the target is ammonia.
[1164] In one embodiment the disease or condition is citrullinemia
type I, the receiver is ammonia monooxygenase or fragment thereof,
and the target is ammonia.
[1165] In one embodiment the disease or condition is citrullinemia
type II, the receiver is ammonia monooxygenase or fragment thereof,
and the target is ammonia.
[1166] In one embodiment the disease or condition is glutaric
acidemia type I, the receiver is lysine oxidase or fragment
thereof, and the target is 3-hydroxyglutaric and glutaric acid
(C5-DC) amd lysine.
[1167] In one embodiment the disease or condition is gout with
hyperuricemia, the receiver is uricase or fragment thereof, and the
target is uric acid (urate crystals).
[1168] In one embodiment the disease or condition is hemolytic
anemia due to pyrimidine 5' nucleotidase deficiency, the receiver
is pyrimidine 5' nucleotidase or fragment thereof, and the target
is pyrimidines.
[1169] In one embodiment the disease or condition is
homocystinuria, the receiver is Cystathionine B synthase or
fragment thereof, and the target is homocysteine.
[1170] In one embodiment the disease or condition is
hyperammonemia/ornithinemia/citrullinemia (ornithine transporter
defect), the receiver is ammonia monooxygenase or fragment thereof,
and the target is ammonia.
[1171] In one embodiment the disease or condition is isovaleric
acidemia, the receiver is leucine metabolizing enzyme or fragment
thereof, and the target is leucine.
[1172] In one embodiment the disease or condition is Lesch-Nyhan
syndrome, the receiver is uricase or fragment thereof, and the
target is uric acid.
[1173] In one embodiment the disease or condition is maple syrup
urine disease, the receiver is a leucine metabolizing enzyme or
fragment thereof, and the target is leucine.
[1174] In one embodiment the disease or condition is methylmalonic
acidemia (vitamin b12 non-responsive), the receiver is
methylmalonyl-CoA mutase or fragment thereof, and the target is
methylmalonate.
[1175] In one embodiment the disease or condition is mitochondrial
neurogastrointestinal encephalomyopathy (MNGIE), the receiver is
thymidine phosphorylase or fragment thereof, and the target is
thymidine.
[1176] In one embodiment the disease or condition is
phenylketonuria, the receiver is phenylalanine hydroxylase,
phenylalanine ammonia lyase or fragment thereof, and the target is
phenylalanine.
[1177] In one embodiment the disease or condition is primary
hyperoxaluria, the receiver is oxalate oxidase or fragment thereof,
and the target is oxalate.
[1178] In one embodiment the disease or condition is propionic
acidemia, the receiver is a propionate convertase or fragment
thereof, and the target is proprionyl coA.
[1179] In one embodiment the disease or condition is purine
nucleoside phosphorylase deficiency, the receiver is purine
nucleoside phosphorylase or fragment thereof, and the target is
Inosine and/or dGTP.
[1180] In one embodiment the disease or condition is transferase
deficient galactosemia (galactosemia type 1), the receiver is
galactose dehydrogenase or fragment thereof, and the target is
galactose-1-phosphate.
[1181] In one embodiment the disease or condition is tyrosinemia
type 1, the receiver is tyrosine phenol-lyase or fragment thereof,
and the target is tyrosine.
[1182] 1. Adenosine Deaminase (ADA) Deficiency
[1183] In some embodiments, subjects may be identified as having
received or would benefit from receiving treatment for adenosine
deaminase (ADA) deficiency. Subjects suffering from or at risk of
developing ADA deficiency may be administered a pharmaceutical
composition comprising the synthetic membrane-receiver polypeptide
complex described herein to treat or prevent disease.
[1184] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises a receiver comprising adenosine
deaminase (ADA) or a derivative or functional fragment thereof. A
suitable receiver may be exhibited on the surface or on the
unexposed side of the synthetic membrane-receiver polypeptide
complex and may be administered to convert deoxy-adenosine to
deoxy-inosine, thereby preventing the build-up of toxic
deoxy-adenosine levels.
[1185] In certain embodiments, compositions comprising a plurality
of functional erythroid cells comprising an adenosine deaminase
(ADA) receiver are provided. Such compositions may be used to treat
subjects that exhibit ADA-severe combined immunodeficiency
(SCID).
[1186] Subjects that exhibit an ADA-deficiency are experiencing a
build-up of deoxy-adenosine in the body's tissues. The high
deoxy-adenosine levels are toxic to immature leukocytes. As a
consequence, the subject's adaptive immune response is impaired,
which makes them highly susceptible to infection. ADA is an
endogenous enzyme produced by a wide variety of cells, including
erythrocytes. ADA is responsible for converting deoxy-adenosine to
deoxy-inosine, thereby preventing the build-up of toxic
deoxy-adenosine levels. Available enzyme replacement therapies
source ADA from bovine intestine. The foreign-sourced ADA is
subject to immunogenic reactions and inhibitor development.
Inhibitor development may occur when a subject's immune system
develops the ability to clear and/or alter a therapeutic molecule
such that its therapeutic effect is decreased. In addition, the
emergence of new variant Creutzfeldt-Jakob disease has raised
concerns about sourcing ADA from bovine intestine (Booth 2009,
Biologics: Targets and Therapy).
[1187] In certain embodiments, provided herein are compositions
comprising a plurality of functional erythroid cells comprising an
adenosine deaminase (ADA) receiver which may be administered to
ADA-SCID subjects to elevate the level of ADA over that of the
endogenous levels of existing wild type cells in the ADA-SCID
subject. Most ADA-SCID subjects severely lack a functioning
deoxy-adenosine metabolism. The erythroid cells may contain
exogenous ADA within their intracellular space. The intracellularly
localized exogenous ADA receiver polypeptide may then convert
deoxy-adenosine to deoxy-inosine, thereby lowering the levels of
deoxy-adenosine. Deoxy-adenosine crosses the cell membrane, is
converted to deoxy-inosine, and diffuses back into circulation.
This may be sufficient to preserve immature leukocyte populations,
thereby treating the disease. In some embodiments, the adenosine
deaminase receiver is expressed as a fusion to the C terminus of
hemoglobin beta such that the ADA is retained in the functional
erythroid cell during enucleation. Alternatively, the ADA gene is
fused to the part of the gene encoding the C terminus of
glycophorin A such that upon expression it is tethered to the
intracellular portion of the transmembrane antigen.
[1188] 2. Phenylketonuria (PKU)
[1189] In some embodiments, subjects may be identified as having
received or would benefit from receiving treatment for
phenylketonuria (PKU). Subjects suffering from or at risk of
developing PKU may be administered a pharmaceutical composition
comprising the synthetic membrane-receiver polypeptide complex
described herein to treat or prevent disease.
[1190] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises a receiver comprising phenylalanine
ammonia lyase (PAL) or a derivative or functional fragment
thereof.
[1191] In another embodiment, the synthetic membrane-receiver
polypeptide complex comprises a receiver comprising phenylalanine
hydroxylase (PAH) or a derivative or functional fragment
thereof.
[1192] A suitable receiver may be exhibited on the surface or on
the unexposed side of the synthetic membrane-receiver polypeptide
complex and may be administered to convert phenylalanine to
tyrosine, thereby preventing the build-up of toxic phenylalanine
levels to treat or prevent PKU.
[1193] In specific embodiments, compositions comprising a plurality
of functional erythroid cells comprising a phenylalanine ammonia
lyase (PAL) receiver are provided. Such compositions may be used to
treat subjects that exhibit or are diagnosed with phenylketonuria
(PKU).
[1194] Subjects diagnosed with PKU are deficient in phenylalanine
ammonia hydroxylase (PAH) activity due to an enzyme mutation or
production deficiency. PAH, along with its cofactor
tetrahydrobiopterin, is responsible for converting phenylalanine to
tyrosine. PAH deficiency leads to phenylalanine accumulation and is
associated with several neurological disorders.
[1195] PAL is an enzyme isolated from plants, yeast, and fungi
chrysanthemi. PAL is a large, 270 kDa enzyme that can elicit a
strong immunogenic reaction. It is also quickly cleared from the
body, therefore requiring large, frequent infusions. Even in its
pegylated form, PAL only remains in circulation for approximately
three days. The short half-life makes PAL treatment difficult for
patients to adhere to (Gamez, Molecular Therapy 2005).
[1196] In certain embodiments, provided herein are compositions
comprising a plurality of functional erythroid cells comprising a
phenylalanine ammonia lyase (PAL) receiver, which may be
administered to phenylketonuria (PKU) subjects to treat
phenylalanine accumulation. The functional erythroid cells may
contain exogenous PAL within their intracellular space. The
intracellularly localized exogenous PAL polypeptide may then
convert phenylalanine to trans-cinnamic acid, a benign metabolite,
thereby lowering the levels of phenylalanine. Phenylalanine crosses
the cell membrane, is converted to trans-cinnamic acid, and
diffuses back into circulation. This may be sufficient to reduce
phenylalanine concentrations in the blood.
[1197] In specific embodiments, compositions comprising a plurality
of functional erythroid cells comprising a phenylalanine
hydroxylase (PAH) receiver are provided. Such compositions may be
used to treat subjects that exhibit or are diagnosed with
phenylketonuria (PKU). PAH is an enzyme that can be isolated from
bacteria or mammals. PAH from Chromobacterium violaceum is a
monomeric .about.30 kDa protein (Yew et al. 2013 Mol Gen Metab
109:339).
[1198] In certain embodiments, provided herein are compositions
comprising a plurality of functional erythroid cells comprising a
phenylalanine hydroxylase (PAH) receiver, which may be administered
to phenylketonuria (PKU) subjects to treat phenylalanine
accumulation. The functional erythroid cells may contain exogenous
PAH within their intracellular space. The intracellularly localized
exogenous PAH polypeptide may then convert phenylalanine to
tyrosine, thereby lowering the levels of phenylalanine.
Phenylalanine crosses the cell membrane, is converted to tyrosine,
which diffuses back into circulation. This may be sufficient to
reduce phenylalanine concentrations in the blood.
[1199] 3. MNGIE
[1200] In some embodiment, subjects may be identified as having
received or would benefit from receiving treatment for
Mitochondrial Neurogastrointestinal Encephalopathy (MNGIE).
Subjects suffering from or at risk of developing MNGIE may be
administered a pharmaceutical composition comprising the synthetic
membrane-receiver polypeptide complex described herein to treat or
prevent disease.
[1201] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises a receiver comprising the enzyme
thymidine phosphorylase (TP) or a derivative or functional fragment
thereof. A suitable receiver may be exhibited on the surface of the
synthetic membrane-receiver polypeptide complex. A suitable
receiver may be contained in the interior of the synthetic
membrane-receiver polypeptide complex. The suitable receiver is
capable of catalyzing the phosphorylation of thymidine or
deoxyuridine to thymine or uracil.
[1202] In MNGIE, aberrant thymidine metabolism leads to impaired
replication or maintenance of mtDNA, causing mtDNA depletion,
deletion, or both (Nishino et al. 1999 Science 283:689). The
disease is characterized by progressive gastrointestinal
dysmotility and cachexia manifesting as early satiety, nausea,
dysphagia, gastroesophageal reflux, postprandial emesis, episodic
abdominal pain and/or distention, and diarrhea;
ptosis/ophthalmoplegia or ophthalmoparesis; hearing loss; and
demyelinating peripheral neuropathy manifesting as paresthesias
(tingling, numbness, and pain) and symmetric and distal weakness
more prominently affecting the lower extremities. There is no
treatment for MNGIE. Management is supportive and includes
attention to swallowing difficulties and airway protection;
dromperidone for nausea and vomiting; celiac plexus block with
bupivicaine to reduce pain; bolus feedings, gastrostomy, and
parenteral feeding for nutritional support; antibiotics for
intestinal bacterial overgrowth; morphine, amitriptyline,
gabapentin, and phenytoin for neuropathic symptoms; specialized
schooling arrangements; and physical and occupational therapy.
[1203] 4. Lysosomal Enzyme Deficiency
[1204] The synthetic complexes described herein can be useful for
the treatment of Lysosomal storage disorders. In one embodiment a
synthetic membrane-receiver polypeptide complex comprises a
receiver, e.g., an enzyme that is active in cell lysosomes and can
degrade accumulated toxic compounds, e.g., proteins, polypeptides,
carbohydrates, or lipids, in lysosomes of cells with a deficiency
in a lysosomal enzyme. The receiver will act by reducing the amount
of toxic compound accumulated in the lysosomes of these cells, thus
reducing the burden of the disease. Lysosomal storage disorders
include, but are not limited to, mucopolysaccharidosis I, Gaucher
Disease, Fabry Disease, Pompe Disease and those listed in table 6
and table 8.
[1205] In one embodiment, subjects may be identified as having
received or would benefit from receiving treatment for Gaucher's
disease. Subjects suffering from or at risk of developing Gaucher's
disease may be administered a pharmaceutical composition comprising
the synthetic membrane-receiver polypeptide complex described
herein to treat or prevent disease.
[1206] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises a receiver comprising the enzyme
glucocerebrosidase or a derivative or functional fragment thereof.
A suitable receiver may be exhibited on the surface of the
synthetic membrane-receiver polypeptide complex or in the interior
of the synthetic membrane-receiver polypeptide complex. The
suitable receiver is capable of cleaving by hydrolysis the
beta-glucosidic linkage of the chemical glucocerebroside, a
sphingolipid.
[1207] Gaucher's disease is caused by a hereditary deficiency of
the enzyme glucocerebrosidase. When the enzyme is defective,
glucocerebroside accumulates in white blood cells, spleen, liver,
kidneys, lungs, brain, and bone marrow. The disorder is
characterized by bruising, fatigue, anemia, low blood platelets,
and enlargement of the liver and spleen. Manifestations may include
enlarged spleen and liver, liver malfunction, skeletal disorders
and bone lesions that may be painful, severe neurologic
complications, swelling of lymph nodes and (occasionally) adjacent
joints, distended abdomen, a brownish tint to the skin, anemia, low
blood platelets, and yellow fatty deposits on the white of the eye
(sclera). Persons affected most seriously may also be more
susceptible to infection.
[1208] Several lysosomal storage disorders are addressable by
methods of treatment described herein. For example: In one
embodiment the disease or condition is aspartylglucosaminuria
(208400), the receiver is N-aspartylglucosaminidase or fragment
thereof, and the target is glycoproteins. In one embodiment the
disease or condition is cerebrotendinous xanthomatosis (cholestanol
lipidosis; 213700), the receiver is sterol 27-hydroxylase or
fragment thereof, and the target is lipids, cholesterol, and bile
acid. In one embodiment the disease or condition is ceroid
lipofuscinosis adult form (CLN4, Kufs' disease; 204300), the
receiver is palmitoyl-protein thioesterase-1 or fragment thereof,
and the target is lipopigments. In one embodiment the disease or
condition is ceroid lipofuscinosis infantile form (CLN1,
Santavuori-Haltia disease; 256730), the receiver is
palmitoyl-protein thioesterase-1 or fragment thereof, and the
target is lipopigments. In one embodiment the disease or condition
is ceroid lipofuscinosis juvenile form (CLN3, Batten disease,
Vogt-Spielmeyer disease; 204200), the receiver is lysosomal
transmembrane CLN3 protein or fragment thereof, and the target is
lipopigments. In one embodiment the disease or condition is ceroid
lipofuscinosis late infantile form (CLN2, Jansky-Bielschowsky
disease; 204500), the receiver is lysosomal pepstatin-insensitive
peptidase or fragment thereof, and the target is lipopigments. In
one embodiment the disease or condition is ceroid lipofuscinosis
progressive epilepsy with intellectual disability (600143), the
receiver is transmembrane CLN8 protein or fragment thereof, and the
target is lipopigments. In one embodiment the disease or condition
is ceroid lipofuscinosis variant late infantile form (CLN6;
601780), the receiver is transmembrane CLN6 protein or fragment
thereof, and the target is lipopigments. In one embodiment the
disease or condition is ceroid lipofuscinosis variant late
infantile form, Finnish type (CLN5; 256731), the receiver is
lysosomal transmembrane CLN5 protein or fragment thereof, and the
target is lipopigments. In one embodiment the disease or condition
is cholesteryl ester storage disease (CESD), the receiver is
lisosomal acid lipase or fragment thereof, and the target is lipids
and cholesterol. In one embodiment the disease or condition is
congenital disorders of N-glycosylation CDG Ia (solely neurologic
and neurologic-multivisceral forms; 212065), the receiver is
phosphomannomutase-2 or fragment thereof, and the target is
N-glycosylated protein. In one embodiment the disease or condition
is congenital disorders of N-glycosylation CDG Ib (602579), the
receiver is mannose (Man) phosphate (P) isomerase or fragment
thereof, and the target is N-glycosylated protein. In one
embodiment the disease or condition is congenital disorders of
N-glycosylation CDG Ic (603147), the receiver is
dolicho-P-Glc:Man9GlcNAc2-PP-dolichol glucosyltransferase or
fragment thereof, and the target is N-glycosylated protein. In one
embodiment the disease or condition is congenital disorders of
N-glycosylation CDG Id (601110), the receiver is
dolicho-P-Man:Man5GlcNAc2-PP-dolichol mannosyltransferase or
fragment thereof, and the target is N-glycosylated protein. In one
embodiment the disease or condition is congenital disorders of
N-glycosylation CDG Ie (608799), the receiver is dolichol-P-mannose
synthase or fragment thereof, and the target is N-glycosylated
protein. In one embodiment the disease or condition is congenital
disorders of N-glycosylation CDG If (609180), the receiver is
protein involved in mannose-P-dolichol utilization or fragment
thereof, and the target is N-glycosylated protein. In one
embodiment the disease or condition is congenital disorders of
N-glycosylation CDG Ig (607143), the receiver is
dolichyl-P-mannose:Man-7-GlcNAc-2-PP-dolichyl-.alpha.-6-mannosyltransfera-
se or fragment thereof, and the target is N-glycosylated protein.
In one embodiment the disease or condition is congenital disorders
of N-glycosylation CDG Ih (608104), the receiver is
dolichyl-P-glucose:Glc-1-Man-9-GlcNAc-2-PP-dolichyl-.alpha.-3-glucosyltra-
nsferase or fragment thereof, and the target is N-glycosylated
protein. In one embodiment the disease or condition is congenital
disorders of N-glycosylation CDG Ii (607906), the receiver is
.alpha.-1,3-Mannosyltransferase or fragment thereof, and the target
is N-glycosylated protein. In one embodiment the disease or
condition is congenital disorders of N-glycosylation CDG IIa
(212066), the receiver is
mannosyl-.alpha.-1,6-glycoprotein-.beta.-1,2-N-acetylglucosminyltransfera-
se or fragment thereof, and the target is N-glycosylated protein.
In one embodiment the disease or condition is congenital disorders
of N-glycosylation CDG IIb (606056), the receiver is glucosidase I
or fragment thereof, and the target is N-glycosylated protein. In
one embodiment the disease or condition is congenital disorders of
N-glycosylation CDG IIc (Rambam-Hasharon syndrome; 266265, the
receiver is GDP-fucose transporter-1 or fragment thereof, and the
target is N-glycosylated protein. In one embodiment the disease or
condition is congenital disorders of N-glycosylation CDG IId
(607091), the receiver is .beta.-1,4-galactosyltransferase or
fragment thereof, and the target is N-glycosylated protein. In one
embodiment the disease or condition is congenital disorders of
N-glycosylation CDG He (608779), the receiver is oligomeric golgi
complex-7 or fragment thereof, and the target is N-glycosylated
protein. In one embodiment the disease or condition is congenital
disorders of N-glycosylation CDG Ij (608093), the receiver is
UDP-GlcNAc:dolichyl-P NAcGlc phosphotransferase or fragment
thereof, and the target is N-glycosylated protein. In one
embodiment the disease or condition is congenital disorders of
N-glycosylation CDG Ik (608540), the receiver is
.beta.-1,4-mannosyltransferase or fragment thereof, and the target
is N-glycosylated protein. In one embodiment the disease or
condition is congenital disorders of N-glycosylation CDG Il
(608776), the receiver is .alpha.-1,2-mannosyltransferase or
fragment thereof, and the target is N-glycosylated protein. In one
embodiment the disease or condition is congenital disorders of
N-glycosylation, type I (pre-Golgi glycosylation defects), the
receiver is .alpha.-1,2-mannosyltransferase or fragment thereof,
and the target is N-glycosylated protein. In one embodiment the
disease or condition is cystinosis, the receiver is cystinosin
(lysosomal cystine transporter) or fragment thereof, and the target
is cysteine. In one embodiment the disease or condition is Fabry's
disease (301500), the receiver is trihexosylceramide
.alpha.-galactosidase or fragment thereof, and the target is
globotriaosylceramide. In one embodiment the disease or condition
is Farber's disease (lipogranulomatosis; 228000), the receiver is
ceramidase or fragment thereof, and the target is lipids. In one
embodiment the disease or condition is Fucosidosis (230000), the
receiver is .alpha.-L-fucosidase or fragment thereof, and the
target is fucose and complex sugars. In one embodiment the disease
or condition is galactosialidosis (Goldberg's syndrome, combined
neuraminidase and .beta.-galactosidase deficiency; 256540), the
receiver is protective protein/cathepsin A (PPCA) or fragment
thereof, and the target is lipids and glycoproteins. In one
embodiment the disease or condition is Gaucher's disease, the
receiver is glucosylceramide .beta.-glucosidase or fragment
thereof, and the target is sphingolipids. In one embodiment the
disease or condition is glutamyl ribose-5-phosphate storage disease
(305920), the receiver is ADP-ribose protein hydrolase or fragment
thereof, and the target is glutamyl ribose 5-phosphate. In one
embodiment the disease or condition is glycogen storage disease
type 2 (Pompe's disease), the receiver is alpha glucosidase or
fragment thereof, and the target is glycogen. In one embodiment the
disease or condition is GM1 gangliosidosis, generalized, the
receiver is ganglioside .beta.-galactosidase or fragment thereof,
and the target is acidic lipid material, gangliosides. In one
embodiment the disease or condition is GM2 activator protein
deficiency (Tay-Sachs disease AB variant, GM2A; 272750), the
receiver is GM2 activator protein or fragment thereof, and the
target is gangliosides. In one embodiment the disease or condition
is GM2 gangliosidosis, the receiver is Ganglioside
.beta.-galactosidase or fragment thereof, and the target is
gangliosides. In one embodiment the disease or condition is
infantile sialic acid storage disorder (269920), the receiver is Na
phosphate cotransporter, sialin or fragment thereof, and the target
is sialic acid. In one embodiment the disease or condition is
Krabbe's disease (245200), the receiver is galactosylceramide
.beta.-galactosidase or fragment thereof, and the target is
sphingolipids. In one embodiment the disease or condition is
lysosomal acid lipase deficiency (278000), the receiver is
lysosomal acid lipase or fragment thereof, and the target is
cholesteryl esters and triglycerides. In one embodiment the disease
or condition is metachromatic leukodystrophy (250100), the receiver
is arylsulfatase A or fragment thereof, and the target is
sulfatides. In one embodiment the disease or condition is
mucolipidosis ML II (I-cell disease; 252500), the receiver is
N-Acetylglucosaminyl-1-phosphotransfeerase catalytic subunit or
fragment thereof, and the target is N-linked glycoproteins. In one
embodiment the disease or condition is mucolipidosis ML III
(pseudo-Hurler's polydystrophy), the receiver is
N-acetylglucosaminyl-1-phosphotransfeerase or fragment thereof, and
the target is N-linked glycoproteins. In one embodiment the disease
or condition is mucolipidosis ML III (pseudo-Hurler's
polydystrophy) Type III-A (252600), the receiver is catalytic
subunit or fragment thereof, and the target is N-linked
glycoproteins. In one embodiment the disease or condition is
mucolipidosis ML III (pseudo-Hurler's polydystrophy) Type
III-C(252605), the receiver is substrate-recognition subunit or
fragment thereof, and the target is N-linked glycoproteins. In one
embodiment the disease or condition is mucopolysaccharidosis MPS I
H/S (Hurler-Scheie syndrome; 607015), the receiver is
.alpha.-1-iduronidase or fragment thereof, and the target is
glycosaminoglycans. In one embodiment the disease or condition is
mucopolysaccharidosis MPS I-H (Hurler's syndrome; 607014), the
receiver is .alpha.-1-iduronidase or fragment thereof, and the
target is glycosaminoglycans. In one embodiment the disease or
condition is mucopolysaccharidosis MPS II (Hunter's syndrome;
309900), the receiver is iduronate sulfate sulfatase or fragment
thereof, and the target is glycosaminoglycans. In one embodiment
the disease or condition is mucopolysaccharidosis MPS III
(Sanfilippo's syndrome) Type III-A (252900), the receiver is
Heparan-S-sulfate sulfamidase or fragment thereof, and the target
is glycosaminoglycans. In one embodiment the disease or condition
is mucopolysaccharidosis MPS III (Sanfilippo's syndrome) Type III-B
(252920), the receiver is N-acetyl-D-glucosaminidase or fragment
thereof, and the target is glycosaminoglycans. In one embodiment
the disease or condition is mucopolysaccharidosis MPS III
(Sanfilippo's syndrome) Type III-C (252930), the receiver is
acetyl-CoA-glucosaminide N-acetyltransferase or fragment thereof,
and the target is glycosaminoglycans. In one embodiment the disease
or condition is mucopolysaccharidosis MPS III (Sanfilippo's
syndrome) Type III-D (252940), the receiver is
N-acetyl-glucosaminine-6-sulfate sulfatase or fragment thereof, and
the target is glycosaminoglycans. In one embodiment the disease or
condition is mucopolysaccharidosis MPS I-S(Scheie's syndrome;
607016), the receiver is .alpha.-1-iduronidase or fragment thereof,
and the target is glycosaminoglycans. In one embodiment the disease
or condition is mucopolysaccharidosis MPS IV (Morquio's syndrome)
Type IV-A (253000), the receiver is galactosamine-6-sulfate
sulfatase or fragment thereof, and the target is
glycosaminoglycans. In one embodiment the disease or condition is
mucopolysaccharidosis MPS IV (Morquio's syndrome) Type IV-B
(253010), the receiver is .beta.-galactosidase or fragment thereof,
and the target is glycosaminoglycans. In one embodiment the disease
or condition is mucopolysaccharidosis MPS IX (hyaluronidase
deficiency; 601492), the receiver is hyaluronidase or fragment
thereof, and the target is glycosaminoglycans. In one embodiment
the disease or condition is mucopolysaccharidosis MPS VI
(Maroteaux-Lamy syndrome; 253200), the receiver is N-acetyl
galactosamine .alpha.-4-sulfate sulfatase (arylsulfatase B) or
fragment thereof, and the target is glycosaminoglycans. In one
embodiment the disease or condition is mucopolysaccharidosis MPS
VII (Sly's syndrome; 253220), the receiver is .beta.-glucuronidase
or fragment thereof, and the target is glycosaminoglycans. In one
embodiment the disease or condition is mucosulfatidosis (multiple
sulfatase deficiency; 272200), the receiver is sulfatase-modifying
factor-1 or fragment thereof, and the target is sulfatides. In one
embodiment the disease or condition is Niemann-Pick disease type A,
the receiver is sphingomyelinase or fragment thereof, and the
target is sphingomyelin. In one embodiment the disease or condition
is Niemann-Pick disease type B, the receiver is sphingomyelinase or
fragment thereof, and the target is sphingomyelin. In one
embodiment the disease or condition is Niemann-Pick disease Type
C1/Type D (257220), the receiver is NPC1 protein or fragment
thereof, and the target is sphingomyelin. In one embodiment the
disease or condition is Niemann-Pick disease Type C2 (607625), the
receiver is epididymal secretory protein 1 (HE1; NPC2 protein) or
fragment thereof, and the target is sphingomyelin. In one
embodiment the disease or condition is prosaposin deficiency
(176801), the receiver is prosaposin or fragment thereof, and the
target is sphingolipids. In one embodiment the disease or condition
is pycnodysostosis (265800), the receiver is cathepsin K or
fragment thereof, and the target is kinins. In one embodiment the
disease or condition is sandhoffs disease; 268800, the receiver is
.beta.-hexosaminidase B or fragment thereof, and the target is
gangliosides. In one embodiment the disease or condition is saposin
B deficiency (sulfatide activator deficiency), the receiver is
saposin B or fragment thereof, and the target is sphingolipids. In
one embodiment the disease or condition is saposin C deficiency
(Gaucher's activator deficiency), the receiver is saposin C or
fragment thereof, and the target is sphingolipids. In one
embodiment the disease or condition is Schindler's disease Type I
(infantile severe form; 609241), the receiver is
N-acetyl-galactosaminidase or fragment thereof, and the target is
glycoproteins. In one embodiment the disease or condition is
Schindler's disease Type II (Kanzaki disease, adult-onset form;
609242), the receiver is N-acetyl-galactosaminidase or fragment
thereof, and the target is glycoproteins. In one embodiment the
disease or condition is Schindler's disease Type III (intermediate
form; 609241), the receiver is N-acetyl-galactosaminidase or
fragment thereof, and the target is glycoproteins. In one
embodiment the disease or condition is sialidosis (256550), the
receiver is neuraminidase 1 (sialidase) or fragment thereof, and
the target is mucopolysaccharides and mucolipids. In one embodiment
the disease or condition is sialuria Finnish type (Salla disease;
604369), the receiver is Na phosphate cotransporter, sialin or
fragment thereof, and the target is sialic acid. In one embodiment
the disease or condition is sialuria French type (269921), the
receiver is UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine
kinase, sialin or fragment thereof, and the target is sialic acid.
In one embodiment the disease or condition is sphingolipidosis Type
I (230500), the receiver is ganglioside .beta.-galactosidase or
fragment thereof, and the target is sphingolipids. In one
embodiment the disease or condition is sphingolipidosis Type II
(juvenile type; 230600), the receiver is ganglioside
.beta.-galactosidase or fragment thereof, and the target is
sphingolipids. In one embodiment the disease or condition is
sphingolipidosis Type III (adult type; 230650), the receiver is
ganglioside .beta.-galactosidase or fragment thereof, and the
target is sphingolipids. In one embodiment the disease or condition
is Tay-Sachs disease; 272800, the receiver is .beta.-hexosaminidase
A or fragment thereof, and the target is gangliosides. In one
embodiment the disease or condition is Winchester syndrome
(277950), the receiver is metalloproteinase-2 or fragment thereof,
and the target is mucopolysaccharides. In one embodiment the
disease or condition is Wolman's disease, the receiver is lysosomal
acid lipase or fragment thereof, and the target is lipids and
cholesterol. In one embodiment the disease or condition is
.alpha.-mannosidosis (248500), type I (severe) or II (mild), the
receiver is .alpha.-D-mannosidase or fragment thereof, and the
target is carbohydrates and glycoproteins. In one embodiment
the
disease or condition is .beta.-mannosidosis (248510), the receiver
is .beta.-D-mannosidase or fragment thereof, and the target is
carbohydrates and glycoproteins.
[1209] Selective Starvation of Metabolites
[1210] In some embodiments, the synthetic membrane-receiver
polypeptide complexes described herein may be used to treat or
prevent cancers.
[1211] In specific embodiments, methods are provided for reducing
the circulatory concentration of a target metabolite, such as an
amino acid cell in a subject (e.g., a human) suffering from or at
risk of developing a cancer. The target metabolite is essential for
survival of the cancer cell but not for survival of a healthy,
normal cell. In certain embodiments, the cancer cell is thereby
selectively starved of the critical metabolite but healthy normal
cells are spared because the metabolite is non-critical for those
cells. The methods include administering a pharmaceutical
composition comprising a synthetic membrane-receiver polypeptide
complex described herein. The pharmaceutical composition is
administered in an amount effective to substantially reduce the
circulatory concentration of the target metabolite. In certain
embodiments, the administration is carried out intravenously.
Diseases that benefit from a selective starvation of a target
metabolites include cancers such as acute lymphoblastic leukemia,
acute myeloblastic leukemia, pancreatic adenocarcinoma, p53-null
solid tumors and those listed in table 6 and table 8.
[1212] In specific embodiments, provided are methods of treating
cancer that include administering to a subject in need thereof a
pharmaceutical composition of erythrocyte cells that comprise a
receiver provided herein in an amount sufficient to treat cancer.
The compositions comprising functional erythroid cells that
comprise a chemotherapeutic or a receiver polypeptides capable of
treating tumors and liquid cancers, may be administered to subjects
that exhibit a cancers, including adrenal, anal, bile duct,
bladder, bone, central nervous system, breast, leukemia, liver,
lung, lymphoma, multiple myeloma, osteosarcoma, pancreatic, and
those listed in, but not limited to, table 6 and table 8.
[1213] In one embodiment the disease or condition is acute
lymphoblastic leukemia, the receiver is asparaginase or fragment
thereof, and the target is asparagine.
[1214] In one embodiment the disease or condition is acute
myeloblastic leukemia, the receiver is asparaginase or fragment
thereof, and the target is asparagine.
[1215] In one embodiment the disease or condition is p53-null solid
tumor, the receiver is serine dehyrdatase or serine hydroxymethyl
transferase or fragment thereof, and the target is serine.
[1216] In one embodiment the disease or condition is pancreatic
adenocarcinoma, the receiver is asparaginase or fragment thereof,
and the target is asparagine.
[1217] Acute Lymphoblastic Leukemia (ALL)
[1218] In some embodiments, subjects may be identified as having
received or would benefit from receiving treatment for acute
lymphoblastic leukemia (ALL). Subjects suffering from or at risk of
developing ALL may be administered a pharmaceutical composition
comprising the synthetic membrane-receiver polypeptide complex
described herein to treat or prevent disease.
[1219] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises a receiver comprising asparaginase or
a derivative or functional fragment thereof. A suitable receiver
may be exhibited on the surface or on the unexposed side of the
synthetic membrane-receiver polypeptide complex and may be
administered to reduce the concentration of asparagine in
circulation thereby depriving a cancer cell lacking the ability to
synthesize L-asparagine and relying on the local environment for
the amino acid of asparagine.
[1220] In specific embodiments, compositions comprising a plurality
of functional erythroid cells comprising an asparaginase receiver
are provided. Such compositions may be used to treat subjects that
exhibit or are diagnosed with acute lymphoblastic leukemia
(ALL).
[1221] Tumor cells lack the ability to synthesize L-asparagine and
rely on their local environment for the amino acid. Asparaginase is
an enzyme that can be isolated from both Escherichia coli and
Erwinia chrysanthemi. The foreign-sourced asparaginase is subject
to immunogenic reactions that can generate life-threatening human
anti-bacterial antibody responses (Avramis, Anticancer Res., 2009
January; 29(1):299-302). It has provided therapeutic benefit as a
stand-alone enzyme replacement therapy, but inhibitor development
is a common result of chronic treatment.
[1222] In specific embodiments, provided herein are compositions
comprising a plurality of functional erythroid cells comprising an
asparaginase receiver which may be administered to ALL subjects to
deprive the cancer cells of asparagine. The functional erythroid
cells may contain exogenous asparaginase within their intracellular
space. The intracellularly localized exogenous asparaginase
polypeptide may then convert asparagine to aspartate, thereby
lowering the levels of asparagine. Asparagine crosses the cell
membrane, is converted to aspartate, and diffuses back into
circulation. This may be sufficient to create a local deficiency in
the critical nutrient and starving tumor cells.
[1223] Diseases and Conditions Associated with Vascular
Deficiencies
[1224] In some embodiments, the synthetic membrane-receiver
polypeptide complexes described herein may be used to treat or
prevent diseases and conditions associated with vascular
deficiencies, e.g., of a vascular protein. A schematic example of
this aspect of the invention is shown in FIG. 13B.
[1225] In some embodiments, the surface exposed receiver
polypeptide may interact with a target substrate and can modify,
convert, change or otherwise alter the target substrate.
Alternatively, the surface exposed receiver polypeptide is cleaved
from the surface of the synthetic membrane-receiver complex in
response to a specific microenvironment or molecule. In one
embodiment, the receiver's catalytic activity may be initiated
after cleavage.
[1226] In some embodiments, the synthetic membrane-receiver
complexes comprise a receiver and optionally comprise a payload,
such as a therapeutic agent, that can be released upon lysis of the
synthetic membrane-receiver complex. The payload may be an enzyme,
protein, antibody, or small molecule. The lytic event may be
triggered by a stimulus in the microenvironment in which the
synthetic membrane-receiver complex is present. The stimulus may,
for example, recruit membrane-targeting enzymes, trigger the
complement system to lyse the synthetic membrane-receiver complex,
or mark the complex for destruction. Alternatively, in embodiments
in which the synthetic membrane-receiver complex is generated from
a cell, e.g., an erythroid cell, the synthetic membrane-receiver
complex may be modified to undergo apotosis when exposed to a
specific stimulus or once a certain period of time has passed. A
schematic example is shown in FIG. 13C.
[1227] In specific embodiments, methods are provided for reducing
the circulatory concentration of a target vascular protein in a
subject (e.g., a human) suffering from or at risk of developing a
disease or condition associated with a vascular deficiency. The
methods include administering a pharmaceutical composition
comprising a synthetic membrane-receiver polypeptide complex
described herein. The synthetic membrane-receiver polypeptide
complex may comprise a receiver that can degrade, cleave, or
convert a vascular protein. In some embodiments, a function of a
missing vascular enzyme (a non-target) is restored. In some
embodiments, the amount of the target vascular protein is reduced
to effectively restore the homeostatic balance of vascular proteins
to levels effective to treat or prevent the disease or condition.
In certain embodiments, the administration is carried out
intravenously. Diseases or conditions associated with vascular
deficiencies include, but are not limited to thrombotic
thrombocytopenic purpura, hemophilia A, hemophilia B, von
Willebrand disease and those listed in table 6 and table 8.
[1228] In specific embodiments, provided are methods of treating a
clotting disease or anti-clotting disease. The methods include
administering to a subject in need thereof a pharmaceutical
composition of erythrocyte cells that comprise a receiver provided
herein in an amount sufficient to treat the clotting disease or
anti-clotting disease. The compositions may be administered to
subjects that exhibit hemophilia type A, hemophilia type B,
hemophilia Type C, von Willebrand disease, Factor II deficiency,
Factor V deficiency, Factor VII deficiency, Factor X deficiency,
Factor XII deficiency, thrombophilia, pulmonary embolism, stroke,
and those disease or deficiencies included in, but not limited to,
table 6 and table 8.
[1229] In one embodiment the disease or condition is hemophilia A,
the receiver is factor VIII or fragment thereof, and the target is
thrombin (factor II a) or factor X.
[1230] In one embodiment the disease or condition is hemophilia B,
the receiver is factor IX or fragment thereof, and the target is
factor XIa or factor X.
[1231] In one embodiment the disease or condition is thrombotic
thrombocytopenic purpura, the receiver is ADAMTS13 or fragment
thereof, and the target is ultra-large von Willebrand factor
(ULVWF).
[1232] Hemophilia
[1233] In some embodiments, subjects may be identified as having
received or would benefit from receiving treatment for hemophilia.
Subjects suffering from or at risk of developing hemophilia may be
administered a pharmaceutical composition comprising the synthetic
membrane-receiver polypeptide complex described herein to treat or
prevent disease.
[1234] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises a receiver comprising coagulation
factor VIII or a derivative or functional fragment thereof. A
suitable receiver may be exhibited on the surface of the synthetic
membrane-receiver polypeptide complex and may be administered to
provide factor VIII function to subjects exhibiting hemophilia
A.
[1235] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises a receiver comprising coagulation
factor IX or a derivative or functional fragment thereof. A
suitable receiver may be exhibited on the surface of the synthetic
membrane-receiver polypeptide complex and may be administered to
provide factor IX function to subjects exhibiting hemophilia B.
[1236] Hemophilia is a common bleeding disorder (occurring in
approximately 1:10,000 males) in which causes severe internal
bleeding that often leads to death because the patient's blood
doesn't clot normally. Hemophilia usually is inherited with
patients displaying severe uncontrollable bleeding events beginning
at birth and re-occurring throughout the individual's life.
Although there are several types of clotting factors that work
together with platelets to help the blood coagulate, people with
hemophilia usually have quantitative or qualitative defects in the
proteins that encode coagulation factor VIII (hemophilia A) or
factor IX (hemophilia B) that prevent normal hemostasis. Hemophilia
usually occurs in males because Factors VIII and IX are located on
the X chromosome (although with rare exceptions females who inherit
a defective X chromosome each from an affected father and mother
who is a carrier for the disease). About 1 in 10,000 individuals
are born with hemophilia each year all over the world.
[1237] Hemostasis is the complex physiological process that leads
to the cessation of bleeding. Platelets, plasma proteins, blood
vessels and endothelial cells each play an important role in the
events that immediately follow tissue injury and which, under
normal circumstances, results in the rapid formation of a clot.
Central to this is the coagulation cascade, a series of proteolytic
events in which certain plasma proteins (or coagulation factors)
are sequentially activated in a "cascade" by another previously
activated coagulation factor, leading to the rapid generation of
thrombin. The large quantities of thrombin produced in this cascade
then function to cleave fibrinogen into the fibrin peptides that
are required for clot formation.
[1238] The coagulation factors circulate as inactive single-chain
zymogens, and are activated by cleavage at one or more positions to
generate a two-chain activated form of the protein. Factor VII
(FVII), a vitamin K-dependent plasma protein, initially circulates
in the blood as a zymogen. The FVII zymogen is activated by
proteolytic cleavage at a single site, Arg152-Ile153, resulting is
a two-chain protease linked by a single disulphide bond (FVIIa).
FVIIa binds its cofactor, tissue factor (TF), to form a complex in
which FVIIa can efficiently activate factor X (FX) to FXa, thereby
initiating the series of events that result in fibrin formation and
hemostasis.
[1239] The blood coagulation pathway, in part, involves the
formation of an enzymatic complex of Factor Villa (FVIIIa) and
Factor IXa (FIXa) (Xase complex) on the surface of platelets. FIXa
is a serine protease with relatively weak catalytic activity
without its cofactor FVIIIa. The Xase complex cleaves Factor X (FX)
into Factor Xa (FXa), which in turn interacts with Factor Va (FVa)
to cleave prothrombin and generate thrombin.
[1240] About 9 out of 10 people who have hemophilia have type A.
Hemophilia A is a bleeding disorder caused by mutations and/or
deletions in the Factor VIII (FVIII) gene resulting in a deficiency
of FVIII activity. In some cases, patients have reduced levels of
FVIII due to the presence of FVIII inhibitors, such as anti-FVIII
antibodies. Hemophilia A is characterized by spontaneous hemorrhage
and excessive bleeding after trauma. Over time, the repeated
bleeding into muscles and joints, which often begins in early
childhood, results in hemophilic arthropathy and irreversible joint
damage. This damage is progressive and can lead to severely limited
mobility of joints, muscle atrophy and chronic pain
(Rodriguez-Merchan, E. C., Semin. Thromb. Hemost. 29:87-96
(2003)).
[1241] The disease can be treated by replacement therapy targeting
restoration of FVIII activity to 1 to 5% of normal levels to
prevent spontaneous bleeding (see, e.g., Mannucci, P. M., et al.,
N. Engl. J. Med. 344: 1773-9 (2001), herein incorporated by
reference in its entirety). There are plasma-derived and
recombinant FVIII products available to treat bleeding episodes
on-demand or to prevent bleeding episodes from occurring by
treating prophylactically. Based on the half-life of these products
(10-12 hr) (White G. C., et al., Thromb. Haemost. 77:660-7 (1997);
Morfmi, M., Haemophilia 9 (suppl 1):94-99; discussion 100 (2003)),
treatment regimens require frequent intravenous administration,
commonly two to three times weekly for prophylaxis and one to three
times daily for on-demand treatment (Manco-Johnson, M. J., et al,
N. Engl. J. Med. 357:535-544 (2007)), each of which is incorporated
herein by reference in its entirety. Such frequent administration
is painful and inconvenient.
[1242] Although on-demand treatment is frequently used, there is a
trend toward prophylaxis and the prevention of joint damage
(Blanchette P, et al., Haemophilia 2004: 10; 679-683,
Manco-Johnson, M J, et al., N. Engl. J. Med. 2007; 357:535-544).
Current FVIII products are administered every two to three days for
prophylaxis due to the relatively short half-life of 10-12 hr in
order to maintain a FVIII:C above 1% in patients (Morfini, M,
Haemophilia 2003; 9 (suppl 1):94-99; discussion 100, White G C, et
al, Thromb. Haemost. 1997:77:660-7, Blanchette, P, et al, J.
Thromb. Haemost. 2008 August; 6(8): 1319-26). Longer-acting FVIII
therapies that provide prolonged protection from bleeding would
represent an improvement in the quality of life for patients with
hemophilia A.
[1243] Strategies to extend the half-life of clotting factors
include pegylation (Rostin J, et al, Bioconj. Chem. 2000;
11:387-96), glycopegylation (Stennicke H R, et al, Thromb. Haemost.
2008; 100:920-8), formulation with pegylated liposomes (Spira J, et
al, Blood 2006; 108:3668-3673, Pan J, et al, Blood 2009;
114:2802-2811) and conjugation with albumin (Schulte S., Thromb.
Res. 2008; 122 Suppl 4:S14-9).
[1244] Under normal conditions, activated platelets provide the
lipid surface supporting coagulation. Since platelets are activated
by thrombin, which is formed at sites of vascular injury,
coagulation processes are restricted to the sites of injuries.
However, it is undesirable to provide the body with peptides that
are general substitutes for procoagulant lipids as this would cause
systemic coagulation and ultimately lead to disseminated
intravascular coagulation (DIC).
[1245] U.S. Pat. Nos. 7,109,170 and 6,624,289 disclose regions of
the FIXa protease domain that interact with FVIIIa and that
comprise the FVIIIa binding site of FIXa. The peptides inhibit
binding of FIXa to FVIIIa. The disclosed peptides may be useful as
anticoagulants for preventing or treating thrombosis.
[1246] US20010014456A1 discloses binding molecules for human FVIII
and FVIII-like proteins. These polypeptides bind FVIII and/or
FVIII-like polypeptides and are useful for the detection and
purification of human FVIII and/or FVIII-like polypeptides from
solutions such as blood or conditioned media.
[1247] In U.S. Pat. No. 7,033,590 FIX/FIXa activating antibodies
and antibody derivatives are used for increasing the amidolytic
activity of FIXa, and for treating blood coagulation disorders such
as hemophilia A and hemorrhagic diathesis.
[1248] U.S. Pat. No. 7,084,109 discloses FVIIa antagonists that are
peptides and inhibit FVIIa activity. The peptides may be useful for
the prevention of arterial thrombosis in combination with
thrombolytic therapy.
[1249] Hemophilia can be mild, moderate, or severe, depending on
how much normal functional clotting factor is present in the blood.
About 7 out of 10 people who have hemophilia A have the severe form
of the disorder.
[1250] Hemophilia B (also known as Christmas disease) is one of the
most common inherited bleeding disorders in the world. It results
in decreased in vivo and in vitro blood clotting activity and
requires extensive medical monitoring throughout the life of the
affected individual.
[1251] In the absence of intervention, the afflicted individual may
suffer from spontaneous bleeding in the joints, which produces
severe pain and debilitating immobility. Bleeding into muscles
results in the accumulation of blood in those tissues. Spontaneous
bleeding in the throat and neck may cause asphyxiation if not
immediately treated. Bleeding into the urine, and severe bleeding
following surgery, minor accidental injuries, or dental extractions
also are prevalent.
[1252] Hemophilia B is caused by a deficiency in Factor IX that may
result from either the decreased synthesis of the Factor IX protein
or a defective molecule with reduced activity.
[1253] Human FIX, one member of the group of vitamin K-dependent
polypeptides, is a single-chain glycoprotein with a molecular
weight of 57 kDa, which is secreted by liver cells into the blood
stream as an inactive zymogen of 415 amino acids. It contains 12
.gamma.-carboxy-glutamic acid residues localized in the N-terminal
Gla-domain of the polypeptide. The Gla residues require vitamin K
for their biosynthesis. Following the Gla domain there are two
epidermal growth factor domains, an activation peptide, and a
trypsin-type serine protease domain. Further posttranslational
modifications of FIX encompass hydroxylation (Asp 64), N-(Asn157
and Asn167) as well as O-type glycosylation (Ser53, Ser61, Thr159,
Thr169, and Thr172), sulfation (Tyr155), and phosphorylation
(Ser158). FIX is converted to its active form, Factor IXa, by
proteolysis of the activation peptide at Arg145-Ala146 and
Arg180-Val181 leading to the formation of two polypeptide chains,
an N-terminal light chain (18 kDa) and a C-terminal heavy chain (28
kDa), which are held together by one disulfide bridge. Activation
cleavage of Factor IX can be achieved in vitro e.g., by Factor XIa
or Factor VIIa/TF. Factor IX is present in human plasma in a
concentration of 5-10 .mu.g/ml. Terminal plasma half-life of Factor
IX in humans was found to be about 15 to 18 hours (White G C et al.
1997. Recombinant factor IX. Thromb Haemost. 78: 261-265; Ewenstein
B M et al. 2002. Pharmacokinetic analysis of plasma-derived and
recombinant F IX concentrates in previously treated patients with
moderate or severe hemophilia B. Transfusion 42: 190-197).
[1254] The treatment of hemophilia B occurs by replacement of the
missing clotting factor by exogenous factor concentrates highly
enriched in Factor IX. However, generating such a concentrate from
blood is difficult. Purification of Factor IX from plasma (plasma
derived Factor IX; pdFIX) almost exclusively yields active Factor
IX. However, such purification of FIX from plasma is very difficult
because FIX is only present in low concentration in plasma
(Andersson, Thrombosis Research 7: 451 459 (1975). Further,
purification from blood requires the removal or inactivation of
infectious agents such as HIV and HCV. In addition, pdFIX has a
short half-life and therefore requires frequent dosing. Recombinant
FIX (rFIX) is also available, but suffers from the same short
half-life and need for frequent dosing (e.g., 2-3 times per week
for prophylaxis) as pdFIX.
[1255] A recombinant FVIIa product is marketed by Novo Nordisk
(NovoSeven). Recombinant FVIIa has been approved for the treatment
of hemophilia A or B patients that have inhibitors to FVIII or FIX,
and is used to stop bleeding episodes or prevent bleeding
associated with trauma and/or surgery, as well as being approved
for the treatment of patients with congenital FVII deficiency.
FVIIa therapy leaves significant unmet medical need, because an
average of 3 doses of FVIIa over a 6 hour time period are required
to manage acute bleeding episodes in hemophilia patients.
[1256] Complications of replacement therapy include developing
antibodies response to the normal therapeutic protein that is
foreign to the patient's immune system (known as inhibitor
formation), which ultimately leads to inactivation or destruction
of the clotting factor and uncontrolled bleeding in about 30% of
patients, developing viral infections from human clotting factors
(from blood contaminated with HIV or Hepatitis from infected blood
donors especially in third world countries), very expensive costs
of the replacement protein which has a very short half-life (days)
which requires frequent re-administration to subside a severe
vascular injury and damage to joints, muscles, or other parts of
the body resulting from delays in treatment.
[1257] In specific embodiments, provided herein are platelets
comprising a receiver polypeptide capable of treating or preventing
clotting diseases, including hemophilia. Suitable receiver
polypeptides include clotting factors, e.g., Factor VIII and/or
Factor IX. Human Factor VIII has the accession number NM 000132.3
and Human Factor IX has the accession number NM 000133.3.
[1258] In some embodiments, methods of treatment of hemophilia are
provided comprising co-administration of one or more recombinant
factors (e.g., recombinant FIX, FIXa, FVIII, and FVIIa) and the
synthetic membrane-receiver complex described herein, wherein
co-administration includes administration of the recombinant factor
before, after or concurrent with administration of the synthetic
membrane-receiver complex.
[1259] In some embodiments, methods of treatment of viral
infectious diseases are provided comprising administration of a
pharmaceutical composition comprising one or more recombinant
factors (e.g., recombinant FIX, FIXa, FVIII, and FVIIa) and the
synthetic membrane-receiver complex described herein.
[1260] In some embodiments, a single treatment is utilized to
provide long-term protection against episodes of bleeding. In some
embodiments that treat hemophilia, treatment is performed on a
regular basis (e.g., weekly, monthly, yearly, once every 2, 3, 4, 5
or more years, and the like) in order to prevent episodes of
bleeding. In some embodiments, treatment is only administered when
episodes of abnormal bleeding occur (e.g., following accidents,
prior to or following surgery, etc). In some embodiments,
maintenance therapy is administered in combination with extra
therapy when episodes of abnormal bleeding occur.
[1261] Thrombotic Thrombocytopenic Purpura
[1262] In some embodiment, subjects may be identified as having
received or would benefit from receiving treatment for Thrombotic
Thrombocytopenic Purpura (TTP). Subjects suffering from or at risk
of developing TTP may be administered a pharmaceutical composition
comprising the synthetic membrane-receiver polypeptide complex
described herein to treat or prevent disease.
[1263] In one embodiment, the synthetic membrane-receiver
polypeptide complex comprises a receiver comprising the protease
ADAMTS13 or a derivative or functional fragment thereof. A suitable
receiver may be exhibited on the surface of the synthetic
membrane-receiver polypeptide complex. The suitable receiver is
capable of cleaving ultra-large von Willebrand Factor (UL-VWF)
multimers into smaller multimers.
[1264] Circulating multimers of UL-VWF increase platelet adhesion
to areas of endothelial injury, particularly at arteriole-capillary
junctions. Red blood cells passing the microscopic clots are
subjected to shear stress which damages their membranes, leading to
intravascular hemolysis, which in turn leads to anaemia and
schistocyte formation. Reduced blood flow due to thrombosis and
cellular injury results in end organ damage. Current therapy is
based on support and plasmapheresis to replenish blood levels of
the enzyme.
EXAMPLES
Example 1: Gene Assembly
[1265] DNA encoding the following genes--glycophorin A (Uniprot ID
P02724), Kell (Uniprot ID P23276), antibody scFv against hepatitis
B surface antigen (Bose et al. 2003 Mol Immunol 40(9):617, GenBank
ID AJ549501.1), adenosine deaminase (Uniprot ID P00813),
phenylalanine hydroxylase from Chromobacterium violaceum (GenBank
ID AF146711.1), complement receptor 1 (Uniprot ID P17927), CD46
(GenBank: BAA12224.1), CD55 (Uniprot ID P08174), CD59 (Uniprot ID
P13987), green fluorescent protein (Uniprot ID P42212), thymidine
phosphorylase (Uniprot ID P19971), glucocerebrosidase (Uniprot ID
P04062), beta2 glycoprotein 1 (Uniprot ID P02749), phospholipase a2
receptor (Uniprot ID Q13018), collagen alpha-3(IV) (Uniprot ID
Q01955), serum amyloid P (Uniprot ID P02743), lipoprotein lipase
(Uniprot ID P06858), asparaginase (Uniprot ID P00805), factor IX
(Uniprot ID F2RM35), ADAMTS13 (Uniprot ID Q76LX8)--were purchased
as cDNA from Dharmacon (GE Life Sciences) or synthesized de novo by
DNA2.0 and Genscript.
[1266] 1. Single Gene Cloning (CR1)
[1267] Genes were assembled into expression vectors by standard
molecular biology methods known in the art. The gene for complement
receptor 1 (CR1) was synthesized by a commercial vendor (DNA2.0)
and supplied in a standard cloning vector (pJ series). The gene was
amplified out of the pJ vector by polymerase chain reaction (PCR)
using oligos with non-homologous terminal sequences to prepare for
insertion into the mammalian expression vector (System Biosciences,
pM series): the upstream oligo consisted of 25 nt homologous to the
upstream pM insertion site and 25 nt homologous to the start of
CR1; the downstream oligo consisted of 25 nt homologous to the
downstream pM insertion site and 25 nt homologous to the end of
CR1. The amplified product was purified by gel electrophoresis
(Qiagen). The pM vector was linearized by PCR with tail-to-tail
oligos homologous to the upstream and downstream insertion sites
and purified by PCR purification (Qiagen). The CR1 amplicon was
ligated into the linearized pM vector by Gibson assembly, described
in detail in Gibson 2011, Methods Enzymology Vol 498, p. 394.
Sequences were confirmed by Sanger sequencing.
[1268] 2. Fusion of Two Genes (Membrane Kell-scFv)
[1269] The gene for Kell was purchased as cDNA and supplied in a
standard cloning vector (pJ series). The gene for an antibody scFv
specific to hepatitis B surface antigen (scFv, described in Bose
2003, Molecular Immunology 40:617) was synthesized by a commercial
vendor (DNA2.0) and supplied in a standard cloning vector (pJ
series). The genes was amplified out of the pJ vectors by
polymerase chain reaction (PCR) using oligos with non-homologous
terminal sequences to prepare for insertion into the mammalian
expression vector (System Biosciences, pM series). Kell was
amplified with an upstream oligo consisting of 25 nt homologous to
the upstream pM insertion site and 25 nt homologous to the 5'
terminus of Kell, and a downstream oligo consisting of 25 nt
homologous to the 5' terminus of scFv and 25 nt homologous to the
3' terminus of Kell. scFv was amplified with an upstream oligo
consisting of 25 nt homologous to the 3' terminus of Kell insertion
site and 25 nt homologous to the 5' terminus of scFv, and a
downstream oligo consisting of 25 nt homologous to the downstream
pM insertion site and 25 nt homologous to the 3' terminus of scFv.
The amplified products were purified by gel electrophoresis
(Qiagen). The pM vector was linearized by PCR with tail-to-tail
oligos homologous to the upstream and downstream insertion sites
and purified by PCR purification (Qiagen). The Kell and scFv
amplicons were ligated into the linearized pM vector by one-pot
Gibson assembly, described in detail in Gibson 2011, Methods
Enzymology Vol 498, p. 394. Sequences were confirmed by Sanger
sequencing.
[1270] 3. Linker-Assembly Between Genes (Kell-scfv)
[1271] The gene for Kell was purchased as cDNA and supplied in a
standard cloning vector (pJ series). The gene for an antibody scFv
specific to hepatitis B surface antigen (scFv, described in Bose
2003, Molecular Immunology 40:617) was synthesized by a commercial
vendor (DNA2.0) and supplied in a standard cloning vector (pJ
series). The genes was amplified out of the pJ vectors by
polymerase chain reaction (PCR) using oligos with non-homologous
terminal sequences to prepare for insertion into the mammalian
expression vector (System Biosciences, pM series). Kell was
amplified with an upstream oligo consisting of 25 nt homologous to
the upstream pM insertion site and 25 nt homologous to the 5'
terminus of Kell; and a downstream oligo consisting of 25 nt
homologous to the 5' terminus of scFv, 24 nt encoding a
(GlyGlyGlySer)x2 (SEQ ID NO: 23) spacer, and 25 nt homologous to
the 3' terminus of Kell. scFv was amplified with an upstream oligo
consisting of 25 nt homologous to the 3' terminus of Kell insertion
site, 24 nt encoding a (GlyGlyGlySer)x2_(SEQ ID NO: 23) spacer, and
25 nt homologous to the 5' terminus of scFv; and a downstream oligo
consisting of 25 nt homologous to the downstream pM insertion site
and 25 nt homologous to the 3' terminus of scFv. The amplified
products were purified by gel electrophoresis (Qiagen). The pM
vector was linearized by PCR with tail-to-tail oligos homologous to
the upstream and downstream insertion sites and purified by PCR
purification (Qiagen). The Kell and scFv amplicons were ligated
into the linearized pM vector by one-pot Gibson assembly, described
in detail in Gibson 2011, Methods Enzymology Vol 498, p. 394.
Sequences were confirmed by Sanger sequencing.
[1272] 4. Epitope Tag Attachment (Kell-scFv)
[1273] The gene for Kell was purchased as cDNA and supplied in a
standard cloning vector (pJ series). The gene for an antibody scFv
specific to hepatitis B surface antigen (scFv, described in Bose
2003, Molecular Immunology 40:617) was synthesized by a commercial
vendor (DNA2.0) and supplied in a standard cloning vector (pJ
series). The genes was amplified out of the pJ vectors by
polymerase chain reaction (PCR) using oligos with non-homologous
terminal sequences to prepare for insertion into the mammalian
expression vector (System Biosciences, pM series). Kell was
amplified with an upstream oligo consisting of 25 nt homologous to
the upstream pM insertion site and 25 nt homologous to the 5'
terminus of Kell; and a downstream oligo consisting of 25 nt
homologous to the 5' terminus of scFv, 24 nt encoding a
(GlyGlyGlySer)x2 (SEQ ID NO: 23) spacer, and 25 nt homologous to
the 3' terminus of Kell. scFv was amplified with an upstream oligo
consisting of 25 nt homologous to the 3' terminus of Kell insertion
site, 24 nt encoding a (GlyGlyGlySer)x2 (SEQ ID NO: 23) spacer, and
25 nt homologous to the 5' terminus of scFv; and a downstream oligo
consisting of 25 nt homologous to the downstream pM insertion site,
the 27 nt sequence tacccctatgacgtgcccgactatgcc (Seq. ID No. 8)
encoding an HA epitope tag, and 25 nt homologous to the 3' terminus
of scFv. The amplified products were purified by gel
electrophoresis (Qiagen). The pM vector was linearized by PCR with
tail-to-tail oligos homologous to the upstream and downstream
insertion sites. The downstream primer additionally contained the
27 nt sequence tacccctatgacgtgcccgactatgcc (Seq. ID No. 8) encoding
an HA epitope tag. The linearized vector was purified by PCR
purification (Qiagen). The Kell and scFv amplicons were ligated
into the linearized pM vector by one-pot Gibson assembly, described
in detail in Gibson 2011, Methods Enzymology Vol 498, p. 394.
Sequences were confirmed by Sanger sequencing.
[1274] 5. Fusion of Two Genes (Reporter Assembly) (GPA-HA)
[1275] The genes for complement receptor 1 (CR1) and green
fluorescent protein (GFP) were synthesized by a commercial vendor
(DNA2.0) and supplied in standard cloning vectors (pJ series). The
CR1 gene was amplified out of the pJ vector by polymerase chain
reaction (PCR) using oligos with non-homologous terminal sequences
to prepare for insertion into the mammalian expression vector
(System Biosciences, pM series): the upstream oligo consisted of 25
nt homologous to the upstream pM insertion site and 25 nt
homologous to the start of CR1; the downstream oligo consisted of
54 nt homologous to the viral-derived T2A sequence
gagggcagaggaagtcttctaacatgcggtgacgtggaggsgsstcccggccct (Seq. ID No.
7). The GFP gene was amplified out of the pJ vector by polymerase
chain reaction (PCR) using oligos with non-homologous terminal
sequences to prepare for insertion into the mammalian expression
vector (System Biosciences, pM series): the upstream oligo
consisted of 54 nt homologous to the viral-derived T2A sequence
gagggcagaggaagtcttctaacatgcggtgacgtggaggsgsstcccggccct (Seq. ID No.
7) and 25 nt homologous to the start of GFP; the downstream oligo
consisted of 25 nt homologous to the downstream pM insertion site
and 25 nt homologous to the end of GFP. The amplified products were
purified by gel electrophoresis (Qiagen). The pM vector was
linearized by PCR with tail-to-tail oligos homologous to the
upstream and downstream insertion sites and purified by PCR
purification (Qiagen). The CR1 and GFP amplicons were ligated
together and into the linearized pM vector by Gibson assembly,
described in detail in Gibson 2011, Methods Enzymology Vol 498, p.
394. Sequences were confirmed by Sanger sequencing.
Example 2: mRNA Assembly
[1276] A gene of interest is cloned into the multiple cloning site
of the pSP64 vector (Promega) using standard molecular biology
methods. The vector is digested with EcoRI (NEB) to generate a
linearized dsDNA vector containing the SP6 promoter, gene of
interest, and 30 nucleotide long poly-A tail. mRNA is synthesized
by reaction with SP6 RNA polymerase (Promega) according to
manufacturer's instructions, including recommended concentrations
of 5' cap analog (ARCA) to synthesize capped mRNA transcript. The
reaction mixture is then treated with DNAse to digest the template
vector (Riboprobe from Promega) and the mRNA is purified using the
EZNA MicroElute RNA Clean-Up kit (Omega).
Example 3: Cell Culture
[1277] 1. Human Red Blood Cells (RBCs)
[1278] CD34 cells are isolated from peripheral blood by
supermagnetic microbead selection by the use of Mini-MACS columns
(Miltenyi Biotec; 94%+/-3% purity). The cells are cultured in
erythroid differentiation medium (EDM) on the basis of IMDM
supplemented with stabilized glutamine, 330 .mu.g/mL holo-human
transferrin, 10 .mu.g/mL recombinant human insulin, 2 IU/mL
heparin, and 5% solvent/detergent virus-inactivated plasma. The
expansion procedure comprises 3 steps. In the first step (day 0 to
day 7), 10{circumflex over ( )}4/mL CD34+ cells are cultured in EDM
in the presence of 1 .mu.M hydrocortisone, 100 ng/mL SCF, 5 ng/mL
IL-3, and 3 IU/mL EPO. On day 4, 1 volume of cell culture is
diluted in 4 volumes of fresh medium containing SCF, IL-3, EPO, and
hydrocortisone. In the second step (day 7 to day 11), the cells are
resuspended at 10{circumflex over ( )}5/mL in EDM supplemented with
SCF and EPO. In the third step (day 11 to day 18), the cells are
cultured in EDM supplemented with EPO alone. Cell counts are
adjusted to 7.5.times.10{circumflex over ( )}5 to
1.times.10{circumflex over ( )}6 and 5-10.times.10{circumflex over
( )}6 cells/mL on days 11 and 15, respectively. Beyond day 18, the
culture medium containing EPO is renewed twice a week. The cultures
are maintained at 37.degree. C. in 5% CO2 in air.
[1279] 2. Mouse Red Blood Cells
[1280] Methods of culturing mouse erythroid cells from mouse fetal
liver erythroid progenitors are known in the art, see e.g., Shi et
al. 2014, PNAS 2014 111(28):10131.
[1281] Mouse erythroid progenitors are isolated from fetal livers.
Fetal livers are purchased from Charles River Labs. Livers are put
in 1 ml PBS on ice. Pipette up and down to get a single-cell
suspension solution and pass by a 70 um strainer (BD Falcon
35-2235). Rinse the mesh with 1 ml PBS. Combine the flow through (1
ml per embryo). Pellet the cells at 1.5 k RPM for 5 min, re-suspend
with red cell lysis buffer (Ammonium Chloride Solution from
Stemcell), and incubate on ice for 10 mins. Pellet the cells at 1.5
k RPM for 5 min, remove the lysis buffer, and re-suspend with 10 ml
PBS-2% FBS. Add chromPure Rat IgG (Jackson ImmunoResearch,
#012-000-003) at 50 ul/mouse and incubate at 4 C for 5 min Add
Biotinylated anti-mouse TER119 (BD Pharmingen, #553672) at (at 1
ul/1*10{circumflex over ( )}6 cells) and incubate at 4 C for 15
min. Add Ms Lineage Panel (Fisher Scientific (Thermo Fisher
Scientific) # BDB559971) to the cells at (2 ul/1*10{circumflex over
( )}6 cells) and incubate at 4 C for 15 min Washing once with
10.times. volume of PBS/and Spin the cells with 1.5 k RPM for 5 min
at 4 degree. Add Streptavidin Particles Plus--DM (magnetic beads)
(BD Pharmigen, #557812) (5 ul/1*10{circumflex over ( )}6 cells) and
incubate at 4 C for 30 min. Prepare 2-4 FACS tubes on a magnetic
holder. Aliquot 2 ml cells into each tube (4 ml in total), and
carefully take the cells out of the tube and put into the other
tube on the other side avoiding the disruption of the magnetic
stick beads. Repeat the same procedure and take the Ter119 negative
and linkage negative cells to a new tube. Concentrate the cells,
and resuspend the cells with 50-100 ul PBS (2% FBS).
[1282] Purified erythroid progenitors are cultured in
differentiation medium comprising (for 40 mL): IMDM: 29 ml, FBS
(Stem Cell): 6 ml (Final 15%), 10% BSA in IMDM (Stem Cell): 4 ml
(Final 1%), 10 mg/ml Holo-transferrin: 2000 ul (Final: 500ug/ml),
100*L-Glutamine: 400ul, 100*penicillin streptomycin: 400 ul, 10U/ul
Epo: 2 ul (Final: 0.5 U/ml), 10 mg/ml Insulin: 40 ul (Final:
10ug/ml). Culture 2*10{circumflex over ( )}5 cells/ml in the
differentiation medium in 24 wells plate at 37 C. After a total
culture of 44-48 hours, analyses are performed, for example by flow
cytometry as performed herein. Enucleated red blood cells are gated
out using (Hoechst stain) for differentiation profile analysis. A
successful culture will yield 16 fold increase.
[1283] 3. Platelets
[1284] Donated CD34+ cells are acquired from the Fred Hutchinson
Cancer Research Center. The CD34+ enriched cells are plated in a
serum-free medium at 2-4.times.10{circumflex over ( )}4 cells/mL
and medium refreshment is done on day 4 by adding an equal volume
of media. On day 6, cells are counted and analyzed:
1.5.times.10{circumflex over ( )}5 cells are washed and placed in 1
mL of the same medium supplemented with a cytokine cocktail
consisting of TPO 30 ng/mL, SCF 1 ng/mL, interleukin (IL)-6 7.5
ng/mL and IL-9 13.5 ng/mL] to induce megakaryocyte differentiation.
At day 10, 1/2-1/4 of the suspension culture is replaced with fresh
medium. All cytokines are purchased from Peprotech. The cultures
are incubated in a humidified atmosphere (10% CO2) at 39.degree. C.
for the first 6 days of culture and 37.degree. C. for the last 8
days. Viable nucleated cells are counted with a hemocytometer (0.4%
trypan blue; Invitrogen, Burlington, ON, Canada).
[1285] Clonogenic progenitor cells (CPC) are assayed using
MethoCult H4436 for myeloid CPC, and MegaCult-C for colony-forming
unit-megakaryocyte (CFU-Mk), according to manufacturer's
instructions (StemCell Technologies, Vancouver, BC, Canada). To
assess differentiation, cells are stained with antibodies against
CD61m CD42b, CD41, CD61, and CD49b by flow cytometry using a
FACS-Calibur (Becton Dickinson). For cell cycle analysis, cells are
rinsed with phosphate-buffered saline (PBS), fixed with
formaldehyde 2% (Sigma, St Louis, Mo., USA) for 5 min and
permeabilized with 0.1% of Triton X-100 (Bio-Rad, Hercules, Calif.,
USA). Cells are then marked with mAb-Ki-67-FITC (BD Bioscience, San
Jose, Calif., USA), washed and resuspended in 0.5 mL PBS-1% fetal
bovine serum (FBS)-0.01% azide 7-amino-actinomycin D (7-AAD)
following the manufacturer's instructions (BD Biosciences).
Example 4: Cell Isolation
[1286] 1. Primary RBCs
[1287] Whole blood is collected using aseptic techniques in tubes
containing low molecular weight heparin, dalteparin sodium (9
units/mL blood). Blood is centrifuged at 5000.times.g for 5 minutes
and after removal of plasma and buffy coat (both can be retained
for later use), the erythrocytes are washed twice in cold (4C)
phosphate buffered saline (PBS) with centrifugation. The resultant
red blood cell population is stored at 4 C in CPDA-1 anticoagulant
or a glycerol solution for long-term preservation.
[1288] 2. Primary Platelets
[1289] Whole blood (40 ml) is collected in 3.8% sodium citrate (1:9
citrate to blood vol/vol) from healthy individuals under an
appropriate IRB protocol. Blood is centrifuged at 200 g for 15
minutes to isolate platelet-rich plasma (PRP). Platelets are then
washed in modified Tyrode's buffer (containing 138 mM NaCl, 5.5 mM
dextrose, 12 mM NaHCO.sub.3, 0.8 mM CaCl2, 0.4 mM MgCl2, 2.9 mM
KCl2, 0.36 mM Na2HPO4 and 20 mM Hepes, pH 7.4) in presence of 1
.mu.M prostaglandin 12, and resuspended in the same buffer.
Example 5: Irradiation of Primary or Cultured Cell
[1290] Irradiation of a population of synthetic membrane-receiver
complexes can be performed to ensure that they are incapable of
replication. Such protocols are similar to those known in the art
for irradiating cells, e.g., primary red blood cells. Briefly, one
unit (350 ml) of whole blood is taken and divided into two aliquots
of 175 ml each, 10 such units are thus divided into 20 aliquots.
One aliquot (175 ml) from each unit of blood is subjected to gamma
irradiation of 25 Gy, and not exceeding 50 Gy, by a self-contained
gamma cell irradiator (GammaCell 1000, Theratronics). The blood is
then stored at 4 C under conventional blood banking conditions.
Sampling is done from these 10 irradiated and 10 non-irradiated
blood bags on days 0, 7, 14, and 21 with the help of sampling site
coupler (Fenwal, USA). Tests for cell proliferation are conducted,
including a thymidine incorporation assay to quantify any mitotic
potential. Supernatant is assayed for free hemoglobin by absorbance
spectroscopy, and for free lactate dehydrogenase by colorimetric
assay (Pierce) to evaluate levels of cell lysis.
Example 6: Enucleation of Erythroid Cells
[1291] Erythroid cells are grown to semiconfluence (1 to
4.times.10{circumflex over ( )}4 cells per cm2) on 12-mm diameter
coverslips coated with collagen in IMDM medium supplemented with
100 units/mi of penicillin and 100 units/ml of streptomycin. The
collagen is necessary to prevent all the cells from falling off the
coverslip during centrifugation. Cells are grown to monolayers
(5.times.104 cells per cm2) on coverslips either in the same medium
or in Dulbecco's modified Eagle's medium with 10% calf serum. It is
not necessary to coat the cell coverslips with collagen. In order
to enucleate the cells, the coverslips are inverted (cell side
down) and placed into the bottom of 15-m1 Corex centrifuge tubes
containing 2-5 ml of medium with 10 g of cytochalasin B per ml. The
centrifuge tubes with the coverslips are placed immediately into a
Sorvall RC-2 centrifuge that has been warmed to 37 C by spinning
the (SS 34) rotor with the head in place for about 1 hr at 10,000
rpm (with the temperature regulator set at 37-39.degree.). The
length of time and speed of centrifugation are crucial factors for
successful enucleation. Cells are spun at 9000 rpm for 1 hr at
37.+-.20 and cells are spun at 6500 rpm for 50 min at 37.+-.-20.
After centrifugation, the coverslips are removed from the
centrifuge and placed cell side up into 35-mm (Falcon) tissue
culture dishes (Biolquest) containing 3 ml of medium without
cytochalasin B. Within 30-60 min at 370, the cells are
morphologically normal and 90-99% lacked nuclei. Enucleated cells
are removed from the coverslips by treatment with trypsin-EDTA
(Grand Island Biological Co.) and the cells are suspended in normal
medium. The enucleated cells are then replated in small drops on
22-mm2 coverslips kept in 35-mm tissue culture dishes and placed in
an incubator. At time intervals after replating, the coverslips are
mounted on slides (12) and observations on the enucleates are made
with Zeiss phase contrast, polarized light, and Nomarski
optics.
Example 7: Contacting of Cells
[1292] 1. Nucleic Acid--Transfection
[1293] The nucleic acid of interest is scaled up to provide
approximately 5 ug nucleic acid per 1{circumflex over (0)} 5
complexes to be loaded, e.g., a cell, such as an erythroid cell, a
platelet, or a hematopoietic precursor cell. The nucleic acid is
diluted in Opti-MEM Medium (Life Technologies) at a ratio of 1 ug
to 50 uL medium. The diluted nucleic is then combined with a
transfection reagent (Trans-IT for DNA, Trans-IT mRNA for mRNA,
Trans-IT siRNA for siRNA, Mirus Bio) at a 1:1 volume ratio and
allowed to form complexes for 5 minutes at room temperature. The
nucleic acid complex is added to cells for 12-24 hours. Optionally,
after this period of time, the media can be exchanged with fresh
media such that the transfection reagents are no longer
present.
[1294] 2. Nucleic Acid--Viral Transduction
[1295] The gene of interest is cloned into the multiple cloning
site of lentivirus vector pCDH with the MSCV promoter sequence from
System Biosciences.
[1296] Lentivirus is produced in 293T cells by transfecting the
cells with lipofectamine 5.times.10{circumflex over ( )}6 293T
cells (Lenti-X 293T Cell Line, Clontech catalog #632180) are plated
in a P10 petri dish the day before transfection. Cell confluency
should be around 70%. One plate is transfected per construct. 20
.mu.l (10 .mu.g) pPACKH1 (System Biosciences) plasmid mix+2 .mu.g
lenti construct+20 .mu.l Plus reagent (LifeTechnologies, Catalog
#11514-015) are combined in 400 .mu.l Optimem and incubated 15 min
at RT. 30 .mu.l of LF2000 (LifeTechnologies, Catalog #11668-019) is
diluted into 400 .mu.l Optimem, added dropwise to DNA mix, and
incubated for 15 min RT. DNA mix is added to cells (cells are in 9
ml of Optimem). Cells are incubated for 6 hours and then the medium
is changed to DMEM/10% FBS. The virus supernatant is collected 48
hours post-transfection by centrifugation at 1,500 rpm for 5
minutes. The supernatant is collected and frozen in 1 ml aliquots
at -80.degree. C.
[1297] Target cells are transduced at day 3-7 of the culture
process described herein. 5.times.1{circumflex over (0)} 5 cultured
cells are plated in 500 .mu.L of medium containing 20 .mu.g/mL
polybrene in a 24-well plate. For each virus, cells are transduced
in triplicate wells. Virus supernatant is added in another 500
.mu.L of medium and the sample is mixed by pipetting. Infection is
achieved by spinoculation, spinning the plate at 2000 rpm for 90
minutes at room temperature. After spinoculation, the cells are
incubated at 37 C overnight, and the next day 1 mL of fresh IMDM
medium with appropriate cytokines is added.
[1298] 3. Nucleic Acid--Cationic Polymer
[1299] An mRNA encoding the transgene of interest, and including an
upstream promoter sequence and a downstream poly A tail, can be
purchased from multiple commercial vendors (e.g., IDT-DNA,
Coralville Iowa). RNA transfections are carried out using RNAIMax
(Invitrogen, Carlsbad, Calif.) or TRANSIT-mRNA (Mims Bio, Madison,
Wis.) cationic lipid delivery vehicles. RNA and reagent are first
diluted in Opti-MEM basal media (Invitrogen, Carlsbad, Calif.). 100
ng/uL RNA is diluted 5.times. and 5 .mu.L, of RNAIMax per .mu.g of
RNA is diluted 10.times.. The diluted components are pooled and
incubated 15 minutes at room temperature before they are dispensed
to culture media. For TRANSIT-mRNA transfections, 100 ng/uL RNA is
diluted 10.times. in Opti-MEM and BOOST reagent is added (at a
concentration of 2 .mu.L, per .mu.g of RNA), TRANSIT-mRNA is added
(at a concentration of 2 .mu.L, per .mu.g of RNA), and then the
RNA-lipid complexes are delivered to the culture media after a
2-minute incubation at room temperature. RNA transfections are
performed in Nutristem xenofree hES media (STEMGENT.RTM.,
Cambridge, Mass.) or Opti-MEM plus 2% FBS. Successful introduction
of the mRNA transcript into host cells can be monitored using
various known methods, such as a fluorescent label or reporter
protein, such as Green Fluorescent Protein (GFP). Successful
transfection of a modified mRNA can also be determined by measuring
the protein expression level of the target polypeptide by e.g.,
Western Blotting or immunocytochemistry. Similar methods may be
followed for large volume scale-up to multi-liter (5-10,000 L)
culture format following similar RNA-lipid complex ratios.
[1300] 4. Nucleic Acid--Electroporation
[1301] mRNA ecoding the transgene of interest, and including an
upstream promoter sequence and a downstream poly A tail, can be
purchased from multiple commercial vendors (e.g., IDT-DNA,
Coralville Iowa). Electroporation parameters are optimized by
transfecting erythroid lineage cells with mRNA transcripts and
measuring transfection efficiency by quantitative RT-PCR with
primers designed to specifically detect the exogenous transcripts.
For certain cells preparations, discharging a 150 uF capacitor into
2.5.times.10{circumflex over ( )}6 cells suspended in 50 .mu.l of
Opti-MEM (Invitrogen, Carlsbad, Calif.) in a standard
electroporation cuvette with a 2 mm gap is sufficient for repeated
delivery in excess of 10,000 copies of modified mRNA transcripts
per cell, as determined using the standard curve method, while
maintaining high viability (>70%). Cell density may vary from
1.times.10{circumflex over ( )}6 cell/50 .mu.l to a density of
2.5.times.1{circumflex over (0)} 6 cells/500 and require from 110V
to 145V to transfect cells with similar efficiencies measured in
transcript copies per cell. Large multi-liter (5-10,000 L)
electroporation may be performed similar to large volume flow
electroporation strategies similar to methods described with the
above described constraints (Li et al., 2002; Geng et al.,
2010).
[1302] 5. Polypeptide--Liposome
[1303] Cells, including primary terminally-differentiated cells
e.g., erythrocytes, can be loaded with exogenous protein on their
surface and in their cytoplasm. The loading of proteins can be
performed using liposomes.
[1304] Lipids (Pro-Ject reagent, Pierce) in organic solvent were
dried under nitrogen into a thin film in glass scintillation vial.
Approximately 2 uL lipids were used per 10{circumflex over ( )}5
cells. Polyclonal mouse IgG (Abcam) was labeled with Dylight-650
(Pierce) per manufacturer's instructions. Protein solution at 0.1
mg/mL in PBS was added to the dried lipid mixture. The solution was
pipetted several times, incubated for 5 minutes at room
temperature, then vortexed vigorously to generate encapsulating
liposomes. Serum-free medium was added to bring the total volume to
500 uL per 10{circumflex over ( )}5 cells. The liposomal mixture
was then incubated with the cells for 3-4 hours at 37 C.
[1305] FIG. 1A-FIG. 1F shows the loading of an exogenous protein,
in this case fluorescently-labeled IgG, into primary erythrocytes
with liposomes. The loading is measured by flow cytometry. The
loading is dose-dependent, as 0.06% of cells are fluorescent
without liposomes, .about.60% of cells are fluorescent at a low
liposome dose, and .about.85% of cells are fluorescent at a high
liposome dose. The data in FIG. 1A-FIG. 1F is strong proof that
exogenous proteins can be loaded into erythroid cells with
liposomes.
[1306] 6. Polypeptide--Mechanical Disruption
[1307] Cells may be loaded using a microfluidic device containing 1
.mu.m, 2 .mu.m, 3 .mu.m, 4 .mu.m, 5 .mu.m, 10 .mu.m wide channels
that transiently porate the cells, allowing a payload to enter when
the cells are pressured through the system.
[1308] The silicon-based devices are fabricated at the
Massachusetts Institute of Technology microfabrication facility
using photolithography and deep reactive ion etching techniques. In
this process, 6'' silicon wafers with a 450-.mu.m thickness are
treated with hexamethyldisilazane, spin coated with photoresist
(OCG934; FujiFilm) for 60 s at 3,000 rpm, exposed to UV light (EV1;
EVG) through a chrome mask with the constriction channel design,
and developed in AZ405 (AZ Electronic Materials) solution for 100
s. After 20 min of baking at 90.degree. C., the wafer is etched by
deep reactive ion etching (SPTS Technologies) to the desired depth
(typically 15 .mu.m). The process is repeated on the opposite side
of the wafer (i.e., the one not containing the etched channels)
using a different mask, which contains the access hole patterns,
and using a thicker photoresist AZ9260 (AZ Electronic Materials).
Wet oxidation is then used to grow 100-200 nm of silicon oxide
before the wafer is anodically bonded to a Pyrex wafer and diced
into individual devices. Before each experiment, devices are
visually inspected and mounted onto a holder with inlet and outlet
reservoirs (all designed in-house and produced by Firstcut). These
reservoirs interface with the device using Buna-N O-rings
(McMaster-Carr) to provide proper sealing. The inlet reservoir is
connected to a home-made pressure regulator system using Teflon
tubing to provide the necessary driving force to push material
through the device. A population of erythroid cells is first
suspended in the desired delivery buffer [growth medium, PBS, or
PBS supplemented with 3% FBS and 1% F-68 Pluronics (Sigma)], mixed
with the desired delivery material, and placed in the device's
inlet reservoir. This reservoir is connected to a compressed air
line controlled by a regulator, and the selected pressure (0-70
psi) is used to drive the fluid through the device. Treated cells
are then collected from the outlet reservoir. Cells are incubated
at room temperature in the delivery solution for 5-20 min after
treatment to ensure hole closure before being subjected to any
further treatment. To deliver fluorescently labeled phenylalanine
ammonia hydroxylase (PAH), the experiments are conducted as
described above such that the delivery buffer contained 0.1-0.3
mg/mL PAH. GFP knockdown is measured as the percentage reduction in
a cell population's average fluorescence intensity relative to
untreated controls.
[1309] 7. Polypeptide--Surface Conjugation
[1310] The cell surface is treated with Traut's reagent
(2-iminothiolane HCl, Pierce) to thiolate primary amines Traut's
reagent is dissolved in Tris buffer pH 8 with EDTA to prevent
oxidation of sulfhydryls. Approximately 1 pmol Traut's reagent is
used to treat 1{circumflex over (0)} 6 cells. Incubate Traut's
reagent with cells for 1 hour at room temperature. Remove excess or
unreacted reagent by centrifugation and washing the cells. The
number of available sulfhydryl groups can be measured using
Ellman's Reagent. In the meantime, treat suitable receiver
polypeptide with amine-to-sulfhydryl crosslinker, such as SMCC
(Pierce) according to manufacturer's instructions. Excess
crosslinking reagent is removed by desalting. The
maleimide-functionalized protein is then incubated with the
thiolated cells for several hours. Unreacted protein is separated
from the conjugated cells by centrifugation and washing.
[1311] 8. Polypeptide--Non-Covalent Surface Attachment
[1312] The gene for an antibody scFv against hepatitis B surface
antigen (scFv, described in Bose 2003, Molecular Immunology 40:617)
is fused to a 6-histidine (SEQ ID NO: 27) affinity tag and to the
gene encoding the polypeptide sequence that binds mouse glycophorin
A, HWMVLPWLPGTLDGGSGCRG (SEQ ID NO: 28), in a mammalian expression
vector (Genlantis). The full fusion protein is produced by
transient transfection of HEK-293T cells using standard methods and
purified on a Ni-NTA affinity resin (Pierce) according to
manufacturer's instructions. The purified fusion protein is
incubated with mouse erythrocytes at >100 nM concentration to
allow for rapid equilibration and binding of the peptide to
glycophorin A.
[1313] 9. Polypeptide--Lipid Insertion into Membrane
[1314] Traut's reagent (Thermo Fisher) is used to generate
sulfhydryl groups on an amine-containing suitable receiver
polypeptide molecule following manufacturer's protocol. The
reaction mixture is incubated for 1 h at room temperature (RT) on a
shaker and washed through a spin desalting column (Zeba, MWCO 7K,
Thermo Scientific) following the manufacturer's instructions to
remove the unreacted Traut's reagent. The generation of sulfhydryl
groups on the modified polypeptide is quantified using Ellman's
Reagent (Pierce) based on the manufacturer's protocol.
[1315] DSPE-PEG.sub.3400-mal (1.times.1{circumflex over (0)}-3 M in
PBS, 4 .mu.L, molar ratio lipid:Polypeptide=1:1) (all lipids
purchased from Avanti Polar Lipids and stored as chloroform
solution under argon at -20 C) are added to the desalted
polypeptide solution and incubated at RT on a shaker. After 1 h,
the sample solution is filtered using a centrifugal filter device
(Microcon, Millipore Co.) at 14 000 g for 15 mM at 4.degree. C. to
remove the small molecules and suspended in 600 .mu.L PBS (1 mg/mL
polypeptide).
[1316] 200 .mu.L of whole blood is suspended in 1000 .mu.L PBS and
spun at 1500 g for 30 s, repeated four times. Finally, the RBCs are
suspended in 800 .mu.L PBS. The conjugation of
RBC/DSPE-PEG-Polypeptide is prepared by mixing the above RBCs
suspensions and various amounts of DSPE-PEG-Polypeptide solution (1
mg per mL) followed by incubation for 15-30 min at 37.degree. C.
The mixture is kept for 5 mM at room temperature, then washed three
times in PBS and resuspended to a final RBC concentration of
5.times.10{circumflex over ( )}8 per mL. An automated cell counter
(Countess, Invitrogen) is used to measure the cell
concentration.
[1317] 10. Polypeptide--Hypotonic Loading
[1318] A suitable receiver polypeptide, in this instance mouse IgG,
was purchased from Abcam and was added at 0.25 mg/mL to a RBC
suspension in isotonic solution at a hematocrit (Hct) of 70%. The
suspension was dialyzed in 250 mL of a hypotonic solution containg
10 mM sodium phosphate pH 7.4, 10 mM sodium bicarbonate, and 20 mM
glucose, stirred at 15 rpm for 1 hour at 4 C. The cells were then
isotonically resealed by adding 1/10 volume of resealing solution
comprising 5 mM adenine, 100 mM inosine, 100 mM sodium pyruvate,
100 mM sodium phosphate, 100 mM glucose, 12% (w/v) NaCl at pH 7.4.
Cells were then incubated at 37 C for 30 minutes.
[1319] 11. Polypeptide--Cell-Penetrating Peptide
[1320] The manufacture of protamine-conjugated polypeptide is known
in the art, see e.g., Kwon et al. 2009 J Contr Rel 139(3):182. 5
mg/ml of Low Molecular Weight Protamine (LMWP) in 50 mM HEPES
buffer (pH 8) is mixed with the heterobifunctional cross-linker
3-(2-pyridyldithio)propionic acid N-hydroxysuccinimide (SPDP,
Sigma-Aldrich) at a 1:10 molar ratio in DMSO and shaken for 1 h at
room temperature. The reaction mixture is then treated with 50 mM
dithiothreitol (DTT, Sigma-Aldrich) and the thiolated LMWP is
purified by HPLC on a heparin affinity column. The product is
collected by ultrafiltration, lyophilized, and stored at
-20.degree. C. until further use.
[1321] For conjugation, 5 mg/ml suitable receiver polypeptide is
mixed with SPDP (40 .mu.l of 0.1 M SPDP in ethanol to 1 ml protein
solution) in phosphate buffer, and stirred at room temperature for
1 h. Unreacted SPDP is removed by rapid desalting and buffer
exchange by FPLC with 0.1 M phosphate buffer (pH 7.4). Activated
polypeptide is then conjugated with a 10-fold molar excess of the
above-prepared LMWP-SH for 24 h at 4.degree. C. The
LMWP-polypeptide conjugates are isolated by ion-exchange
chromatography using a heparin affinity column followed by five
rounds of centrifugal filtration (molecular weight cut-off: 5,000
Da). Pooled LMWP-polypeptide conjugates are concentrated, and the
degree of conjugation determined by MALDI-TOF mass
spectroscopy.
[1322] For uptake experiments, fresh sheep erythrocytes (MP
Biomedicals, Solon, Ohio) are suspended in Hank's balanced salt
solution (HBSS) at a density of 5.times.10{circumflex over ( )}8
cells/ml, and are then incubated with a 0.5 mg/ml solution of the
LMWP-polypeptide conjugates for 30 min at room temperature under
gentle shaking. RBCs are then washed with HBSS and stored at 2-8
C.
[1323] 12. Polypeptide--Chemical permeability
[1324] 3.times.1{circumflex over (0)} 8 RBCs were preincubated for
30 mM with chlorpromazine (Sigma Aldrich) at 200 .mu.M in Ringer's
solution. Afterwards, the suitable receiver polypeptide was added
in Ringer's solution (1 to 4 .mu.M) to a final volume of 400 .mu.l
and incubated for 30 min at room temperature under mild agitation.
After incubation, cells were washed twice, resuspended in Ringer
and collected for analysis.
[1325] 13. Polypeptide--Enzymatic Conjugation
[1326] Cell surface enzymatic conjugations with sortase are known
in the art, see e.g., Shi et al PNAS 2014 111(28):10131. To label
the GPA N terminus with polypeptide, 30 uL of 500 uM S aureus
sortase and 1 mM polypeptide with LPETGG (SEQ ID NO: 29) at the C
terminus is preincubated in 50 mM Tris pH 7.5, 150 mM NaCl, on ice
for 15 minutes and added to 5.times.1{circumflex over (0)} 7 RBCs
in DMEM. The sortase and cell mixture is incubated on ice for 30
min with occasional gentle mixing, then spun at 500.times.g for 2
mM at 4 C to remove buffer/DMEM, then washed three times with 1 mL
of ice-cold PBS.
[1327] 14. Gas
[1328] The following steps are taken to load erythroid cells with
nitric oxide (NO). To avoid oxidative side reactions or
S-nitrosylation of erythrocytic proteins other than Hb by
S-nitrocysteine (CSNO), S-nitrosothiol (SNO)Hb is synthesized in
intact RBCs by (i) addition of aqueous NO to fully deoxygenated
RBCs to yield Fe-nitrosylHb [HbFe(II)NO]; (ii) washing under
anaerobic conditions; and (iii) reoxygenation, effecting
intraerythrocytic intramolecular transfer of NO from heme
[Fe(II)NO] to Cys-B93. Sulfanilamide [SA; 3.4% (wt_vol)] in 0.4MHCl
is prepared with and without 1% (wt/vol) HgCl2, as is 0.1% (wt/vol)
of N-(1-naphthyl)ethylenediamine (NED). Equal volumes of SNOHb are
added to SA with or without HgCl2 and then reacted with NED. [SNO]
is determined from the difference in absorbance (540 nm) using
colorimetry.
[1329] 15. Small Molecule (Cytoplasm)
[1330] Liposomal ProJect reagent (Pierce) is dried under nitrogen
into a thin film in glass scintillation vials. Approximately 2 uL
reagent is needed per 10{circumflex over ( )}5 cells. Solution of
small molecule of interest in PBS is added to the dried liposome
reagent. The solution is pipetted several times, incubated for 5
minutes at room temperature, then vortexed vigorously to generate
encapsulating liposomes. Serum-free medium is added to bring the
total volume to 500 uL per 10{circumflex over ( )}5 cells. The
liposomal mixture is incubated with the cells for 3-4 hours at
37.degree. C.
[1331] 16. Small Molecule (Surface)
[1332] The conjugation of small molecules to the surface of cells
using chemical functionalities is well known in the art, see e.g.,
Hermanson G T, Bioconjugation Techniques 2.sup.nd Ed, ISBN
978-0123705013. Briefly, the small molecule of interest is provided
with an amine-reactive functional group, such as NHS ester, for
example NHS ester biotin (Pierce). The small molecule of interest
is stored in organic solvent to prevent hydrolysis of the NHS ester
functional group. The small molecule of interest is incubated with
cells in aqueous medium in large molar excess (at least 10 pmol for
10{circumflex over ( )}6 cells) to drive conjugation to primary
amines on the cell surface. After 1 hr incubation, the excess
unreacted molecule is removed by centrifugation and washing of the
cells.
Example 8: Assessment of Polypeptide Presence
[1333] 1. Fluorescent Transgene
[1334] Erythroid cells were cultured as described herein. A
transgene encoding glycophorin A with an HA tag on the C-terminus
fused to GFP with an intervening viral T2A peptide was constructed
by Gibson assembly as described herein. The transgene was
introduced into the erythroid cells by lentiviral transduction as
described herein. Two days after transduction, cells were
collected, washed in PBS buffer, and analyzed on a flow cytometer
(Attune, Life Technologies). Transduction efficiency was assessed
as the percentage of GFP-positive cells in the population.
[1335] 2. Cell Surface Proteins
[1336] For cell surface proteins, the level of protein expression
can be detected as early as 2 days after transfection by flow
cytometry with antibodies specific for the protein or for a
co-expressed epitope tag. Erythroid cells were cultured as
described herein. A transgene encoding glycophorin A with an HA tag
at the N-terminus was constructed by Gibson assembly as described
herein. The transgene was introduced into the erythroid cells by
lentiviral transduction as described herein. Two days after
transduction, cells were collected, washed in PBS buffer, and
stained with 1:50 dilution of mouse anti-HA antibody (Abcam) for 1
hr. Cells were washed and then stained with a 1:100 dilution of
alexa 488-labeled goat anti-mouse secondary antibody (Life
Technologies) for 30 minutes on ice. Cells were washed and analyzed
on a flow cytometer (Attune, Life Technologies). Transduction
efficiency was assessed as the percentage of alexa 488-positive
cells in the population.
[1337] 3. Intracellular Proteins
[1338] For intracellular proteins, the level of protein expression
can be detected as early as 8-12 hours after transfection by
Western Blot. Erythroid cells were cultured as described herein. A
transgene encoding adenosine deaminase with an HA tag at the
C-terminus was constructed by Gibson assembly as described herein.
The transgene was introduced into the erythroid cells by lentiviral
transduction as described herein. Two days after transduction,
cells were collected, washed in PBS buffer, and lysed in RIPA cell
lysis buffer (Pierce). Cell lysate was denatured by boiling in 100
mM DTT, then loaded onto a NuPage SDS-PAGE pre-cast gel. After
electrophoresis and transfer to nitrocellulose membrane, protein
bands were developed by staining with 1:5000 dilution of mouse
anti-HA antibody (Abcam) followed by 1:5000 dilution of goat
anti-mouse HRP (Pierce), and subsequent treatment with HRP
substrate (SuperSignal, Pierce). Images were captured using an
Amersham imager (GE healthcare).
Example 9: Assessment of Small Molecule Presence
[1339] Eyrthrocytes from a normal human donor were purchased
(Research Blood Components). Cells were then biotinylated with
NHS-biotin (Sigma) per manufacturer's instructions using
0.02.times. volumes of 2 mM stock biotin reagent for 30 minutes at
room temperature. Anti-biotin antibody (Abcam) was fluorescently
labeled with Dylight 650 (Pierce). Labeling efficiency of the cells
was assessed by flow cytometry as described herein using the
labeled anti-biotin antibody as a detection marker.
Example 10: Assessment of Gas Level
[1340] A standard protocol is used to determine NO2- and NO3-levels
in the three blood components, see e.g., Yang et al. 2003, Free
Radic Res 37(1):1. Briefly, a "stop solution" (K3Fe(CN)6,
N-ethylmaleimide, water, NP40) is added to blood to maintain
nitrite levels until sample analysis. A 1:4 dilution of "stop
solution" to blood is vortexed and placed on dry ice. At the time
of sample analysis, a 1:1 dilution of 99.9% pure methanol and
thawed sample is centrifuged for 2 min at 13,000 rpm; the
supernatant is immediately injected into the chemiluminescent
nitric oxide analyzer (NOA, Sievers, Model 280 NO analyzer,
Boulder, Colo.) using helium as the carrier gas. The triiodide
(I3-) ozone-based chemiluminescent assay is used to analyze nitrite
levels. To analyze nitrate, deionized water (Millipore CQ-Gard,
Bedford, Mass.) is added to blood to lyse cells. A 9:1 dilution of
deionized water to blood is vortexed and placed on dry ice. At the
time of sample analysis, a 3:1 dilution of pure HPLC grade ethanol
and thawed sample is centrifuged, and the supernatant is
immediately analyzed using a Vanadium(III)chloride chemiluminescent
assay, see e.g., Ewing and Janero, 1998 Free Radic Biol Med
25(4-5):621. The VC13 reaction solution is maintained at 90.degree.
C. with helium as the carrier gas. 1 .mu.M nitrite and nitrate
solutions are used to generate standard curves for comparisons and
adjustments of sample nitrite and nitrate concentrations.
[1341] A thiol-stabilization solution (NEM-DPTA; K3Fe(CN)6,
N-ethylmaleimide, Diethylenetriaminepenta acetic acid, NP40, water)
is added to blood to maintain SNOHb and HbNO levels by inhibiting
additional thiol reactions. A 4:1 dilution of NEM-DPTA to blood is
vortexed and placed on dry ice. A 9:1 dilution of sample and 5%
acid sulfanilamide (AS) is incubated for 5 min; half is injected
into the NOA (I3-assay) to give combined SNOHb and HbNO levels. The
remaining sample is incubated with 50 mM HgCl2, then incubated
again with 5% AS, and injected into the NOA to give HbNO
levels.
Example 11: Assessment of Expression and Activity
[1342] The expression of exogenous proteins in and on cultured
cells can be assessed quantitatively by flow cytometry (if the
protein is expressed on the surface) or by Western blot (for
proteins expressed in the cytoplasm).
[1343] 1. Quantitative Flow Cytometry
[1344] Anti-mouse Fc-binding quantitative flow cytometry beads
(Simply Cellular Calibration) were purchased from Bangs Labs.
Fluorescently labeled mouse antibodies against relevant cell
surface receptors--glycophorin A, Ckit, and transferrin
receptor--were purchased from BioLegend. Fluorescently labeled
mouse antibody against the HA epitope tag was purchased from Life
Technologies. Erythroid cells were cultured as described herein. A
transgene encoding glycophorin A with an HA tag at the N-terminus
was constructed by Gibson assembly as described herein. The
transgene was introduced into the erythroid cells by lentiviral
transduction as described herein. At least two days after
transduction, 2.times.10{circumflex over ( )}5 cells were
collected, washed in PBS buffer, and stained with 1:100 dilution of
one of the above-listed antibodies for 1 hr. Cells were washed and
analyzed on a flow cytometer (Attune, Life Technologies). The
protocol was repeated for each of the four antibodies listed above.
Quantification was performed according to manufacturer's
instructions. Briefly, one drop of each of the five bead samples
was incubated with 1:100 dilution of an above-listed antibody. The
beads were incubated for 1 hr, washed in PBS, and analyzed on a
flow cytometer (Attune, Life Technologies). The protocol was
repeated for each of the four antibodies listed above. Calibration
curves were fit using the manufacturer's provided excel
spreadsheets, from which quantification of fluorescence intensity
for the cell-based signals was derived.
[1345] 2. Quantitative Western Blot
[1346] Erythroid cells were cultured as described herein. A
transgene encoding adenosine deaminase with an HA tag at the
C-terminus was constructed by Gibson assembly as described herein.
The transgene was introduced into the erythroid cells by lentiviral
transduction as described herein. Two days after transduction,
cells were collected, washed in PBS buffer, and lysed in RIPA cell
lysis buffer (Pierce).
[1347] The transgene was introduced into HEK293T cells by transient
transfection using lipofectamine 2000 (Life technologies). Cells
were cultured for one week and the supernatant was harvested.
Recombinant protein was purified on an HA affinity column (Pierce)
according to manufacturer's instructions. Protein concentration was
assessed by absorbance at 280 nm.
[1348] Western blotting was performed as described herein. In
addition to the cell lysate samples, known amounts of the
recombinant adenosine deaminase were run on the same gel. Following
image collection, the intensity of the recombinant bands were used
to generate a standard curve to quantify the amount of protein
present in the cell samples.
[1349] The robust expression of transgenes at high levels has
important implications for the therapeutic capacity of the final
cell population. FIG. 2 quantifies the expression of three surface
proteins indicative of differentiation and one exogenous transgene
by quantitative flow cytometry, and demonstrates that the transgene
is robustly expressed at a high level.
[1350] Erythroid cells in culture were collected at seven time
points during a four-stage in vitro differentiation process. At the
first time point ("Expand D6") the cells are nucleated
hematopoietic precursors. By the final time point ("Diff 3 D8") the
cells are predominantly enucleated erythroid cells. GPA (solid
triangles), a canonical marker of erythroid cells, starts low in
the precursor cells and rapidly reaches >1.times.10{circumflex
over ( )}6 copies per cell. CKIT (dashed squares), a receptor for
stem cell factor, starts high then decreases to
<1.times.10{circumflex over ( )}4 copies per cell as
differentiation ensues. TR (dotted diamonds), necessary for the
transport of iron into erythroid cells, increases initially then
gradually declines to <1.times.10{circumflex over ( )}5 copies
per cell. The transgene (open circles) is introduced at the end of
the second differentiation stage ("Diff 1") and is steadily
expressed at approximately 1.times.10{circumflex over ( )}5 copies
per cell throughout differentiation. The above data demonstrate
that transgenes are robustly expressed in cultured cells.
[1351] The expression of exogenous proteins in and on cultured
cells can be assessed by flow cytometry (if the protein is
expressed on the surface) as described herein, or by Western blot
(for proteins expressed in the cytoplasm) as described herein. In
instances where an exogenous gene is in a single-transcript
construct that contains a downstream fluorescent reporter protein,
the fluorescence of the reporter protein can be used as a proxy for
expression of the upstream gene, and assessed by flow cytometry as
described herein.
[1352] FIG. 3 A-FIG. 3N shows the exogenous expression of surface
and cytoplasmic proteins on enucleated cultured erythroid cells.
The above data conclusively demonstrate that multiple protein
classes--including cytoplasmic, surface, intact, fusions to type I
membrane proteins, fusions to type II membrane proteins, fusions to
GPI-linked membrane proteins, intracellular fusions, overexpressed,
and de novo expressed--can be expressed on multiple cell types
including cultured enucleated erythroid cells, cultured nucleated
erthyroid precursor cells, and K562 erythroleukemia cells.
[1353] FIG. 3B and FIG. 3D demonstrate the simultaneous expression
of two exogenous proteins in an enucleated cultured cell.
[1354] In FIG. 3B, Erythroid cells were cultured as described
herein. A transgene construct encoding glycophorin A signal
sequence, an HA epitope tag, glycophorin A coding sequence, viral
T2A cleavable sequence and GFP was assembled by Gibson assembly as
described herein. The transgene was introduced into the erythroid
cells by lentiviral transduction as described herein. The cells
were cultured to terminal differentiation as described herein.
Cells were analyzed by flow cytometry as described herein, using a
fluorescent anti-HA antibody and GFP fluorescence to detect
expression of both transgenes.
[1355] In FIG. 3D, Erythroid cells were cultured as described
herein. A transgene construct encoding glycophorin A signal
sequence, antibody scFv specific to hepatitis B surface antigen, HA
epitope tag, glycophorin A coding sequence, viral T2A cleavable
sequence and GFP was assembled by Gibson assembly as described
herein. The transgene was introduced into the erythroid cells by
lentiviral transduction as described herein. The cells were
cultured to terminal differentiation as described herein. Cells
were analyzed by flow cytometry as described herein, using a
fluorescent anti-HA antibody and GFP fluorescence to detect
expression of both transgenes.
Example 12: Expression of Protein from mRNA in Platelets
[1356] The expression in platelets of exogenous proteins translated
from exogenous transfected mRNA was measured by flow cytometry. In
brief, platelet-enriched serum was centrifuged at 190 g for 15
minutes to remove erythrocytes and leukocytes. The supernatant was
then spun for an additional 5 minutes at 2500 g to pellet
platelets. Platelets were resuspended in 5 mL of Tyrode's buffer
with 1 uM prostaglandin, washed, and resuspended in 750 uL of
Tyrode's buffer with 1 uM prostaglandin. mRNA encoding the gene of
interest, in this example GFP, was mixed with lipofectamine at a
1:1 mg/mL ratio. The mixture was incubated for 5 minutes, then
added to the washed platelet population. The combination was
incubated for 24 hours at room temperature with slow rocking.
Platelet expression of the transgene was assayed by flow cytometry
measuring GFP fluorescence. Surface proteins can also be assayed by
flow cytometry. Cytoplasmic or other intracellularly-expressed
proteins can also be assayed by Western blot.
[1357] There is therapeutic relevance to introducing exogenous
proteins into and onto platelets. Since platelets do not possess a
nucleus or RNA transcription machinery, DNA transfection is not a
viable means of inducing exogenous protein expression in platelets.
However,mRNA transfection and translation is a way of introducing
exogenous proteins into cells. It is thought that platelets contain
mRNA translation machinery, but until now it was not known whether
they are able to accept and translate exogenous mRNA into
protein.
[1358] FIG. 4A-FIG. 4C is a collection of flow cytometry plots that
demonstrate the translation of exogenous mRNA encoding a transgene,
in this case GFP, by platelets. The GFP is detected by fluorescence
in the FL1 channel after excitation with a 488 nm laser. (FIG. 4A)
Untransfected platelets (1.7% GFP+). (FIG. 4B) Platelets
transfected with 3 ug GFP mRNA (8.6% GFP+). (FIG. 4C) Platelets
transfected with 6.8 ug GFP mRNA (3.3% GFP+).
[1359] The data conclusively demonstrate, for the first time, the
translation of exogenous mRNA into exogenous protein by
platelets.
Example 13: Activity of Enzymes
[1360] FIG. 5A-FIG. 5D demonstrates the activity for enzymes
contained on erythroid cells. Biochemical activity of cytoplasmic
enzymes was assessed by Western blot for retention of a protein
over the course of differentiation. Biological activity of
cytoplasmic enzymes was assessed by in vitro enzymatic activity
assay.
[1361] FIG. 5A-FIG. 5D shows the activity of two different
intracellular enzymes expressed in cultured erythroid cells.
[1362] 1. Adenosine Deaminase.
[1363] A transgene encoding adenosine deaminase with an HA tag at
the C-terminus was constructed by Gibson assembly as described
herein. The transgene was introduced into HEK-293T cells by
lipofectamine transfection (Life Technologies) as described herein.
Enzymatic activity is assayed using a protocol derived from
Helenius 2012, Biochim Biophys Acta 1823(10):1967, in which a
specific mixture of enzymes convert purines into uric acid and H2O2
followed by fluorometric detection of the generated H2O2. In brief,
two days after transfection, cells were collected, media aspirated,
and Krebs Ringer phosphate glucose (KRPG; comprising: 145 mM NaCl,
5.7 mM sodium phosphate, 4.86 mM KCl, 0.54 mM CaCl2, 1.22 mM MgSO4,
and 5.5 mM glucose; pH 7.35) added to the cells at
2.times.10{circumflex over ( )}5 cells/mL. Adenosine was added at
50 uM. After reaction for 6 hours, supernatant was collected and
heat inactivated for 5 minutes at 60 C. Aliquots of supernatant
were transferred to wells in a white 96-well microplate containing
0.25 U/ml bacterial purine nucleoside phosphorylase (PNP) and 0.15
U/ml microbial xanthine oxidase (XO), both from Sigma. After 20 mM
incubation at RT, 30 .mu.l of H2O2-detecting mixture containing HRP
(final concentration 1 U/ml, Sigma) and Amplex Red reagent (60
.mu.M, Invitrogen, Molecular Probes) was added to the microwells,
followed by measurement of the fluorescence intensity at the
emission and excitation wavelengths of 545 and 590 nm, respectively
(Tecan Infinite M200).
[1364] 2. Phenylalanine Hydroxylase
[1365] Erythroid cells were cultured as described herein. A
transgene encoding phenylalanine hydroxylase with an HA tag at the
C-terminus was constructed by Gibson assembly as described herein.
The transgene was introduced into the erythroid cells by lentiviral
transduction as described herein. Two days after transduction,
cells were collected, washed in PBS buffer, and lysed in RIPA cell
lysis buffer (Pierce). Cell lysates (64 ug total protein) were
added to 1 mL reaction buffer containing 100 mM Tris-HCl, pH 7.5, 4
mM DTT, 4 mM Phenylalanine, 33 pg catalase, and 0.4 mM DMPH4 (all
from Sigma). Reactions were run overnight at 37 C. After
incubation, samples were de-proteinized by centrifugal filtration
in an Amicon Ultra-4 Centrifugal Filter 10 KD (Millipore UFC801024)
spinning at 3700 rpm for 10 mM Samples were collected and assayed
for tyrosine concentration by absorbance at 540 nm.
[1366] Both of these exogenous proteins were retained through the
end of terminal differentiation, a non-trivial feat given that it
is well-known in the field that erythroid cells undergo a rigorous
program of elimination of proteins unnecessary for basic function
(Liu J et al. (2010) Blood 115(10):2021-2027, Lodish H F et al.
(1975) Developmental Biology 47(1):59). In FIG. 5A, the exogenously
over-expressed protein adenosine deaminase is detected by anti-HA
Western blot at various time points over the course of
differentiation, from nucleated precursor cells ("Diff I D5")
through to enucleated erythroid cells ("Diff III D8"). In FIG. 5C,
the exogenously expressed microbial protein phenylalanine
hydroxylase is detected by anti-HA Western blot at various time
points over the course of differentiation, from nucleated precursor
cells ("Diff I D5") through to enucleated erythroid cells ("Diff
III D8").
[1367] Additionally, both of these enzymes maintained their ability
to enzymatically convert substrate into product. FIG. 5B shows the
enzymatic conversion of adenosine to inosine by intact adenosine
deaminase-expressing 293T cells. FIG. 5D shows the enzymatic
conversion of phenylalanine to tyrosine by lysates of cultured
phenylalanine hydroxylase-expressing enucleated erythroid
cells.
[1368] These data conclusively demonstrate that exogenous enzymes
are retained on erythroid cells throughout the culture process and
that they are enzymatically active in erythroid cells, which has
profound therapeutic implications.
Example 14: Activity of CR1
[1369] FIG. 6A-FIG. 6B shows both biochemical and biological
activity for complement receptor 1 (CR1) over-expressed on the
surface of cultured erythroid cells. Biochemical activity of CR1
was assessed by flow cytometry for binding to an immune complex.
Biological activity of CR1 was assessed by transfer of immune
complexes to macrophages in a co-culture assay.
[1370] 1. Immune Complex Binding of CR1-Expressing Cells.
[1371] Erythroid cells were cultured as described herein. A
transgene construct encoding complement receptor 1 (CR1) was
constructed by Gibson assembly as described herein. The transgene
was introduced into the erythroid cells by lentiviral transduction
as described herein. Transgene expression levels were assessed by
flow cytometry as described herein using an anti-CR1 antibody
(Abcam). The cells were cultured to terminal differentiation as
described herein.
[1372] Dylight 650-labeled bovine serum albumin (BSA-650) was
incubated with polyclonal rabbit anti-BSA (Abcam) in an excess of
antibody for 30 minutes at room temp. The complexes were then mixed
with human serum at a 1:1 volume ratio for 30 minutes at 37 C.
Control complexes were either not mixed with human serum or mixed
with heat-inactivated human serum.
[1373] Complexes were incubated with the CR1-expressing cells for
30 minutes at 37 C. Cells were washed and analyzed by flow
cytometry for capture of immune complexes by detecting Dylight 650
fluorescence.
[1374] 2 Immune Complex Transfer to Macrophages
[1375] Cultured U937 monocytes were activated by incubation with
100 nM phorbol myristate acetate (PMA) for 24 hours at 37 C. Cells
coated with immune complexes (see above) were incubated with
activated U937 macrophages for 30 minutes at 37 C. The co-culture
was analyzed by flow cytometry. Macrophages were identified by
FSC/SSC gating. Presence of immune complex on macrophages was
analyzed by detecting Dylight 650 fluorescence in the macrophage
population.
[1376] FIG. 6A-FIG. 6B shows the biochemical and biological
activity of complement receptor 1 (CR1) exogenously over-expressed
on cultured erythroid cells.
[1377] FIG. 6A shows the biochemical activity of CR1, defined as
the capture of immune complexes in vitro. The black histogram shows
the capture of BSA-based immune complexes by CR1 over-expressed on
cultured erythroid cells. The shaded histogram shows the minimal
background binding to complexes of BSA and IgG that lack human
complement, demonstrating that the binding event is
CR1-mediated.
[1378] FIG. 6B shows the biological activity of CR1, defined as the
transfer of captured immune complexes from cultured erythroid cells
to macrophages. This is a standard assay in the field, see: Repik
et al. 2005 Clin Exp Immunol. 140:230; Li et al. 2010 Infection
Immunity 78(7):3129. Transfer is assessed by flow cytometry and
measured as the intensity of labeled immune complex-derived
fluorescence on macrophages. In this assay, macrophages that are
incubated with no immune complexes (black bars) do not become
fluorescent. Macrophages that are incubated with complexes of BSA
and IgG that lack complement (and therefore do not bind CR1) take
up only a small amount of immune complex (solid gray bars),
independent of the presence of cultured CR1-overexpressing
erythroid cells. This uptake is likely due to Fc-gamma receptors on
the U937 cells interacting with the Fc regions of the IgG
molecules. Macrophages that are incubated with immune complexes
(BSA+IgG+complement) in the absence of CR1-overexpressing cells
(hashed bar, left) take up the same amount of immune complex as in
the absence of complement, likely by the same Fc-gamma mediated
method. However, the macrophages that are incubated with immune
complexes in the presence of CR1-overexpressing cells (hashed bar,
right) take up nearly double the number of immune complexes as
measured by fluorescence.
[1379] These data conclusively demonstrate that CR1 overexpression
on cultured erythroid cells enables the capture of immune complexes
on said erythroid cells, facilitates the transfer of immune
complexes from erythoroid cells to macrophages, and significantly
increases the rate and number of immune complexes taken up by
macrophages.
Example 15: Activity of scFv
[1380] FIG. 7A-FIG. 7D shows the biochemical and biological
activity of antibody scFv exogenously expressed on the surface of
cultured erythroid cells as a fusion to the transmembrane protein
GPA.
[1381] Erythroid cells were cultured as described herein. A
transgene construct encoding the leader sequence of glycophorin A,
an antibody scFv specific to hepatitis B surface antigen (scFv,
described in Bose 2003, Molecular Immunology 40:617), an HA epitope
tag, a [Gly-3-Ser]2 flexible linker, and the body of glycophorin A
was assembled by Gibson assembly as described herein. The transgene
was introduced into the erythroid cells by lentiviral transduction
as described herein. Transgene expression was assessed by flow
cytometry as described herein using an anti-HA antibody (Abcam).
The cells were cultured to terminal differentiation as described
herein. Biochemical activity of the antibody scFv was assessed by
flow cytometry for binding to the target protein, in this case
hepatitis B surface antigen (HBsAg). Recombinant HBsAg protein
(Abcam) was labeled with Dylight-650 fluorophore (Pierce).
scFv-expressing cells were incubated with 100 nM labeled protein,
washed in PBS, and analyzed for Dylight 650 fluorescence by flow
cytometry as described herein.
[1382] Biological activity of the antibody scFv was assessed by in
vivo capture of HBsAg detected by flow cytometry. Recombinant HBsAg
protein (Abcam) was labeled with Dylight-650 fluorophore (Pierce).
scFv-expressing cells were fluorescently labeled with CFSE (Sigma)
Immunocompromised NSG mice (Jackson labs) were injected with
.about.400 pmol of the labeled HBsAg into the tail vein. A few
minutes later, the same mice were injected with
2.times.10{circumflex over ( )}7 scFv-expressing cells. Blood was
collected by submandibular puncture at regular intervals in an
EDTA-containing tube. Collected blood cells were washed and
analyzed by flow cytometry as described herein. Human cells were
identified as those that were CFSE positive. Capture of HBsAg was
detected as Dylight 650 fluorescence on the human cells.
[1383] FIG. 7A-FIG. 7B show the biochemical activity of antibody
scFv, defined as the binding of its cognate antigen, hepatitis B
surface antigen (HBsAg). In FIG. 7A, cells that express (black) or
do not express (gray shaded) the antibody scFv are incubated with
450 nM HBsAg and stained with biotinylated anti-HBsAg antibody and
fluorescent streptavidin. Cells that express the antibody scFv (45%
of the cells in this culture) bind to the antigen. In FIG. 7B,
cells that express the antibody scFv are incubated with various
concentrations of HBsAg and stained as above, showing that the
binding event is dose-dependent with an affinity of approximately
10 nM.
[1384] FIG. 7C-FIG. 7D show the biological activity of antibody
scFv, defined as the capture of cognate antigen HBsAg while in
circulation in a mouse. In this experiment, immunocompromised NSG
mice were injected with .about.400 pmol fluorescently-labeled HBsAg
via the tail vein. Five minutes later, cultured enucleated
erythroid cells (7C) or cultured enucleated erythroid cells that
expressed exogenous antibody scFv (7D) were injected via the tail
vein. Prior to injection, all cultured cells were labeled with CFSE
fluorescent dye. Blood was collected 6 hours later, analyzed on a
flow cytometer, and gated on CFSE+ human cells. Bare cultured cells
did not bind to HBsAg (7C), whereas antibody scFv-expressing cells
do bind to HBsAg (7D). Consistently with the biochemical activity
experiment, approximately 45% of the cells in this culture express
antibody-scFv.
[1385] These data demonstrate that the antibody scFv is
biochemically active when expressed on the surface of cultured
erythroid cells and that the antibody scFv on the erythroid cell is
able to bind its target in vivo when in circulation. This has
profound implications for therapeutic approaches in which the
capture, sequestration, and clearance of a substance in circulation
is desired.
Example 16: Activity--Circulating Clearance
[1386] FIG. 8A-FIG. 8D shows both biochemical and biological
activity for surface molecule capture agents used for circulating
clearance of a target.
[1387] Biochemical activity of the capture agents, in this case HA
polypeptide and biotin, was assessed by flow cytometry for binding
to the target protein, in this case anti-HA antibody and
anti-biotin antibody. Biological activity of the capture agents was
assessed by in vivo capture and clearance of target protein as
detected by flow cytometry and plasma protein quantification.
[1388] 1. Capture of Anti-Biotin Antibody by Chemically-Modified
Cells
[1389] Eyrthrocytes from a normal human donor were purchased
(Research Blood Components). Cells were labeled with CFSE (Sigma)
per manufacturer's instructions for 20 minutes at 37 C. Cells were
then biotinylated with NHS-biotin (Sigma) per manufacturer's
instructions using 0.02 volumes of 2 mM stock biotin reagent for 30
minutes at room temperature. Anti-biotin antibody (Abcam) was
fluorescently labeled with Dylight 650 (Pierce). Labeling
efficiency of the cells was assessed by flow cytometry using the
labeled anti-biotin antibody and CFSE fluorescence as detection
markers. 250 ug labeled antibody was injected into an NSG mouse
(Jackson Labs) intravenously via the tail vein. Four hours later
1.times.10{circumflex over ( )}8 biotinylated cells were injected
intravenously via the tail vein. Blood was collected by
submandibular puncture at regular intervals in an EDTA-containing
tube. Collected blood cells were washed and analyzed by flow
cytometry as described herein. Human cells were identified as those
that were CFSE positive. Capture of anti-biotin antibody was
detected as Dylight 650 fluorescence on the human cells. Plasma
from the blood draw was analyzed by ELISA using a biotin-coated
microplate (Pierce) per manufacturer's instructions to detect the
level of antibody in circulation.
[1390] 2. Capture of Anti-HA Antibody by Transgenic Cultured
Cells
[1391] Erythroid cells were cultured as described herein. A
transgene construct encoding glycophorin A signal sequence, an HA
epitope tag, glycophorin A coding sequence, viral T2A cleavable
sequence and GFP was assembled by Gibson assembly as described
herein. The transgene was introduced into the erythroid cells by
lentiviral transduction as described herein. The cells were
cultured to terminal differentiation as described herein. Cells
were analyzed by flow cytometry as described herein, using an
anti-HA antibody (Life Technologies) fluorescently labeled with
Dylight 650 (Pierce) and GFP fluorescence to detect expression of
both transgenes. 250 ug labeled anti-HA antibody was injected into
an NSG mouse (Jackson Labs) intravenously via the tail vein. Four
hours later 1.times.10{circumflex over ( )}8 cultured cells were
injected intravenously via the tail vein. Blood was collected by
submandibular puncture at regular intervals in an EDTA-containing
tube. Collected blood cells were washed and analyzed by flow
cytometry as described herein. Human cells were identified as those
that were CFSE positive. Capture of anti-HA antibody was detected
as Dylight 650 fluorescence on the human cells. Plasma from the
blood draw was analyzed by ELISA using an HA peptide-coated
microplate (Pierce) per manufacturer's instructions to detect the
level of antibody in circulation.
[1392] FIG. 8A-FIG. 8D shows biochemical and biological activity of
(FIG. 8A-FIG. 8B) the polpeptide HA expressed on the surface of
cultured erythroid cells as a fusion to GPA and of (FIG. 8C-FIG.
8D) biotin chemically conjugated to the surface of primary
erythrocytes. Biochemical activity is defined as the capture of a
target protein in vitro. Biological activity is defined as the
enhanced clearance of a target protein in vitro.
[1393] In FIG. 8A, the HA polypeptide, expressed as a fusion to the
N terminus of GPA, captures a mouse anti-HA antibody in vivo. NSG
mice were injected with fluorescently-labeled mouse anti-HA
antibody, followed by injection of cultured human erythroid cells
that either do not (left) or do (right) express HA epitope tag on
their surface as a fusion to GPA. Blood was drawn and cells
analyzed on the flow cytometer. The x-axis measures CFSE
fluorescence. The y-axis measures anti-HA antibody Dylight 650
fluorescence. CFSE-positive cultured human erythrocytes are
observed in both samples, but only the cells expressing the HA
epitope tag are able to capture circulating anti-HA antibody.
[1394] In FIG. 8B, mice were injected with anti-HA antibody then
optionally with cultured human erythroid cells that either do not
or do express HA peptide on their surface as a fusion to GPA.
Plasma was collected at multiple time points and the level of
anti-HA antibody in plasma was assessed by ELISA using an HA
peptide-coated plate as a substrate. Mice injected with anti-HA
antibody alone (open circles, solid line--this mouse died after 120
minutes of causes unrelated to treatment) or with anti-HA antibody
followed by cells that do not express HA peptide on their surface
(dashed line) have significant antibody in circulation out to 24
hours post injection of cells. In contrast, mice injected with
anti-HA antibody followed by cells that express HA peptide on their
surface are depleted of target antibody within minutes. This data
conclusively demonstrates that the target antibody is rapidly and
specifically cleared from circulation by cultured erythroid cells
that express receiver polypeptide on their surface.
[1395] In FIG. 8C, the biotin molecule, conjugated to the surface
of erythroid cells by amine functionalization chemistry, captures a
mouse anti-biotin antibody. In both of these cases capture was
assessed by flow cytometry. Cells that are CFSE labeled and
biotinylated show up as double positive when stained with a
fluorescent anti-biotin antibody (lower dot plot), whereas
CFSE-labeled cells that are not biotinylated only show up as single
positive (upper dot plot).
[1396] In FIG. 8D, mice were injected with anti-biotin antibody
then optionally with cultured human erythroid cells that either are
not or are conjugated to biotin on their surface. Plasma was
collected at multiple time points and the level of anti-biotin
antibody in plasma was assessed by ELISA using a biotin-coated
plate as a substrate. Mice injected with anti-biotin antibody alone
(open circles, solid line) or with anti-biotin antibody followed by
cells that are not conjugated to biotin on their surface (dashed
line) have significant antibody in circulation out to 24 hours post
injection of cells. In contrast, mice injected with anti-biotin
antibody followed by cells that are conjugated to biotin on their
surface are depleted of target antibody within minutes. This data
conclusively demonstrates that target antibodies are rapidly and
specifically cleared from circulation by cultured erythroid cells
that contain receiver polypeptide on their surface.
[1397] Together the data conclusively demonstrate that suitable
receivers on membrane-receiver complexes are able to bind their
target molecules in vivo and mediate rapid circulating clearance of
target molecules when in circulation, which has profound
therapeutic implications.
Example 17: Activity of Complement Regulators
[1398] The complement regulatory activity of the synthetic
membrane-receiver complexes is assessed by standard CH50 and AH50
assays known in the art (see e.g., Kabat et al. 1961 Exp Immunochem
pp. 133-239 and Platts-Mills et al. 1974 J Immunol 113:348).
[1399] Briefly, the CH50 assay utilizes sheep erythrocytes (SRBC)
as target cells. Briefly, a suspension containing
1.times.10{circumflex over ( )}9 SRBC/ml is prepared in the GVB(2+)
buffer (gelatin/Veronal-buffered saline with Ca2+ and Mg2+), pH
7.35. Hemolysin (rabbit anti-sheep antiserum) is titrated to
determine the optimal dilution to sensitize SRBC. Diluted hemolysin
(1:800) is mixed with an equal volume of SRBC (1.times.109
SRBC/ml), and the whole is incubated at 37.degree. C. for 15
minutes. This results in 5.times.10{circumflex over ( )}8/m1
antibody-coated erythrocytes (EA). EA (100 .mu.l) are incubated
with 100 .mu.l of five serial twofold dilutions (1:20, 1:40, 1:80,
1:160, and 1:320) of the normal human serum (NHS) or similar
dilution of the mixture of NHS and the membrane-receiver complex at
37.degree. C. for 1 hour. NHS incubated with GVB2+ buffer is used
as the control. Background control is obtained by incubating EA
with buffer alone (serum is not added), and total lysis (100%
hemolysis) is determined by adding distilled water to EA. The
reaction is stopped using 1.2 ml of ice-cold 0.15 M NaCl, the
mixture is spun to pellet the unlysed cells, and the optical
density of the supernatant is determined spectrophotometrically
(412 nm). The percentage of hemolysis is determined relative to the
100% lysis control. Complement activity is quantitated by
determining the serum dilution required to lyse 50% of cells in the
assay mixture. The results are expressed as the reciprocal of this
dilution in CH50 units/ml of serum.
[1400] Briefly, the AH50 assay depends on lysis of unsensitized
rabbit erythrocytes (Erab) by human serum by activation of the
alternative pathway. Activation of the calcium-dependent classical
pathway is prevented by addition of the calcium chelator ethylene
glycol tetraacetic acid (EGTA) to the assay buffer, and magnesium,
necessary for both pathways, is added to the buffer. Briefly, a
cell suspension of rabbit RBC (2.times.10{circumflex over ( )}8
cell/ml) is prepared in the GVB-Mg2+-EGTA buffer. A serial 1.5-fold
dilution (1:4, 1:6, 1:9, 1:13.5, and 1:20.25) of normal human serum
(NHS) or similar dilution of the mixture of NHS and the
membrane-receiver complex are prepared in GVB-Mg2+-EGTA buffer, and
100 .mu.l of each serum dilution is added to 50 .mu.l of
standardized Erab. NHS incubated with GVB-Mg2+-EGTA buffer is used
as the control. The mixture is then incubated at 60 minutes at
37.degree. C. in a shaking water bath to keep cells in suspension,
and 1.2 ml of ice-cold NaCl (0.15 M) is used to stop the reaction.
The tubes are spun at 1250 g, at 4.degree. C., for 10 minutes to
pellet the cells, and the optical density of the supernatant is
determined spectrophotometrically (412 nm). Background control has
100 .mu.l GVB-Mg2+-EGTA buffer, and 50 .mu.l Erab and does not
exceed 10% of the total lysis. In the total lysis control tube 100
.mu.l of distilled water is added to 50 .mu.l Erab suspension, and
the percentage of hemolysis is determined relative to 100% lysis
control. The results of the assay are calculated and complement
activity is quantitated by determining the serum dilution required
to lyse 50% of cells in the assay mixture. The results are
expressed as the reciprocal of this dilution in AH50 units/ml of
serum.
Example 18: Activity of Platelet-Loaded Thymidine Phosphorylase
[1401] A transgene encoding thymidine phosphorylase with an HA tag
at the C-terminus is constructed by Gibson assembly as described
herein. Platelets are cultured from precursor cells as described
herein. The transgene is introduced into the cultured platelet
precursor cells by lentiviral transduction as described herein.
Expression of thymidine phosphorylase within the cultured platelets
is assessed by Western blotting using an anti-HA detection
antibody, as described herein.
[1402] Thymidine phosphorylase activity is determined in platelet
samples by quantifying the rate of conversion of thymidine to
thymine. Preliminary experiments are conducted to determine the
linear metabolite formation kinetics with respect to time and
enzyme dilution; the method is shown to be linear for up to 16 mM,
over a thymine phosphorylase range of 4.0-719 nmol/min/ml
(corresponding to a sample dilution range of 10-9088). Lysates of
pre-dialysis samples cultured platelet and control platelet samples
are prepared by diluting thawed samples 1:710 with 125 mM Tris-HCl,
pH 7.4. Twenty-five ul of the platelet lysate is then added to 100
ul sodium phosphate buffer (100 mM, pH 6.5) and 25 ul thymidine
standard (10 mM), mixed and incubated at 37 C for 10 mM The
reaction is terminated with 25 ul of 40% TCA. Assay blanks are
prepared by adding TCA to the sodium phosphate buffer/thymidine
incubation mixture prior to adding the platelet lysate. Samples are
centrifuged at 13,400.times.g for 2 mM, and the supernatant washed
twice with water-saturated diethyl ether with 2 mM on a shaker to
extract the TCA. To avoid ether interfering with HPLC separation,
effective removal is achieved by exposing the matrix to the air for
5 min to allow evaporation of the ether. A sample volume of 10 ul
is injected into the HPLC.
[1403] Chromatographic separation of substrate and product is
achieved using reversed phase chromatography with isocratic elution
using a Waters Alliance HPLC 2795 system. A pre-packed C18 column
(Spherisorb ODS 125 mm.times.4.6 mm ID, 5 um particle size, Waters)
is used as the stationary stage. Analytes are eluted using a mobile
phase of ammonium acetate (40 mM) with the ion-pairing agent
tetrabutyl ammonium hydrogen sulphate (5 mM) adjusted to pH 2.70
with HCl, delivered at a flow rate of 1.0 ml/min, with a run time
of 8 mM UV detection is at 254 nm and 0.1 absorbance units full
scale. Metabolites are identified by comparing spectra with pure
standards.
Example 19: Activity of Platelet-Displayed Goodpasture Antigen
[1404] A transgene encoding collagen alpha-3(IV) (COL4A3) NC1
domain antigen fused to the N terminus of CD42b (GP1B, genbank
AAH27955.1) with an intervening HA tag is constructed by Gibson
assembly as described herein. Platelets are cultured from precursor
cells as described herein. The transgene is introduced into the
cultured platelet precursor cells by lentiviral transduction as
described herein. Expression of the exogenous antigen on the
cultured platelets is assessed by flow cytometry using an anti-HA
detection antibody as described herein.
[1405] Serum is collected from a patient suffering from
Goodpasture's syndrome, and the serum is tested for anti-COL4A3
antibodies by commercial ELISA (MyBioSource COL4A3 ELISA Kit). The
binding capacity of the antigen-expressing platelets is assessed by
flow cytometry as described herein, using this anti-COL4A3 serum as
the primary detection antibody and fluorescent anti-human IgG as
the secondary detection antibody.
[1406] Platelet-facilitated clearance of a circulating antigen in
vivo is modeled in a mouse using the antigen-expressing platelets.
NSG mice are injected with 100 uL of mouse anti-human COL4A3
antibody (Creative BioMart) fluorescently labeled with Dylight 650
dye. CFSE-labeled cultured platelets (10{circumflex over ( )}8 per
mouse) that express the exogenous antigen are then injected via the
tail vein. Blood is drawn from a submandibular location at 10 mM,
30 min, 2 h, 12 h, and 24 h. Blood is centrifuged to collect the
platelet-rich fraction, which is then stained and analyzed by flow
cytometry as described herein. Antibody capture by platelets is
determined by tracking the CFSE-Dylight 650 double positive
population.
Example 20: Activity In Vivo (Mouse)
[1407] Mouse erythroid cells are cultured as described herein.
Erythroid precursor cells are transduced with a suitable receiver
polypeptide transgene, e.g., encoding complement receptor 1 (CR1)
using a lentivirus as described herein. Cells are cultured to
terminal differentiation as described herein. The presence of the
exogenous protein in the cells is assessed by flow cytometry as
described herein. The cells are labeled with a fluorescent die,
e.g., CFSE (Sigma Aldrich) per manufacturer's instructions to aid
in their detection. The cells are injected into a NZBWF1/J mouse
model of lupus, or other appropriate model of disease or activity
corresponding to the suitable receiver polypeptide, approximately
1.times.10{circumflex over ( )}8 cells injected via the tail vein.
Blood is collected at multiple time points by submandibular
puncture. Immune complex levels in the plasma are detected by Raji
cell assay, see e.g., Theofilopoulos et al. 976, J Clin Invest
57(1):169. Pharmacokinetics of the cultured cells are assessed by
flow cytometry as described herein, by tracking the percentage of
CFSE fluorescent cells in the drawn blood sample. Mouse overall
health is assessed by gross necropsy, including histology of kidney
tissue to track reduction of immune complex deposition and
inflammation-mediated damage.
Example 21: Rapid Screening
[1408] Cell lines, e.g., 293T and K562, have shorter expression and
culturing cycles (.about.1 day) compared to cultured erythroid
cells (days-weeks). These cell lines can be used to rapidly iterate
through a gene library encoding suitable receiver polypeptides to
identify the receiver polypeptide with the highest expression or
activity.
[1409] A library of suitable receiver polypeptide transgenes, e.g.,
full-length and shorter variants of complement receptor 1 (CR1),
are constructed by polymerase chain reaction and Gibson assembly as
described herein. The library of transgenes is transfected into
HEK293T cells in a parallel fashion in a microtiter plate using
lipofectamine as described herein and transduced into K562 cells
using lentivirus as described herein. The expression of the
receivers is assessed by flow cytometry as described herein after
24-48 hours. The activity of each of the receivers in the library
is assessed by capture of fluorescent immune complex detected with
flow cytometry as described herein, and by the transfer of
fluorescent immune complexes to cultured monocytes detected with
flow cytometry as described herein. The receivers from the library
that are most functional--e.g., are highest expressed, capture most
immune complexes, or best transfer immune complexes to
monocytes--are then individually transduced into parallel erythroid
cell cultures as described herein using lentivirus as described
herein. The expression of each receiver on cultured erythroid cells
is assessed by flow cytometry as described herein. The activity of
each receiver on cultured erythroid cells is assessed by capture of
fluorescent immune complex detected with flow cytometry as
described herein, and by the transfer of fluorescent immune
complexes to cultured monocytes detected with flow cytometry as
described herein.
Example 22: Assessment of Clearance Rate of RBC In Vivo
[1410] The clearance rate of erythroid cells was assessed in vivo
in an immunocompromised mouse model. NSG mice were treated at day
-1 with 100 uL of clordonate liposome (Clodrosomes.com) solution to
selectively deplete macrophages. Cells were labeled with the
fluorescent tag CFSE and approximately 1.times.10{circumflex over (
)}8 cells were injected into each mouse via the tail vein. At
regular intervals blood was collected by submandibular puncture and
blood cells were collected. Cells were co-stained with anti-human
GPA antibodies and analyzed by flow cytometry. Human erythroid
cells were distinguished from mouse erythroid cells by CFSE signal
and by human GPA signal.
[1411] For therapeutic applications, it is important that cultured
erythroid cells and cultured erythroid cells containing exogenous
protein either intracellularly or on the surface circulate normally
in vivo. This is shown in FIG. 9A-FIG. 9B using a standard
immunocompromised mouse model. In FIG. 9A, blood collected from an
injected mouse is analyzed on the flow cytometer. Cultured human
erythroid cells are identified in the top right quadrant of the
plot, double-positive for CFSE and human-GPA. In FIG. 9B, mice were
injected with human red blood cells (solid circles), cultured
enucleated erythroid cells (dashed diamonds), cultured enucleated
erythroid cells that express an intracellular exogenous protein
(dotted squares) and cultured enucleated erythroid cells that
express a surface exogenous protein (open triangles). The clearance
rate of the human cells is measured as the percentage of CFSE+
cells remaining over time, scaled to the initial time point (20
minutes post injection). There is no significant difference in
clearance rate between the four samples.
[1412] These data clearly demonstrates that cultured enucleated
erythroid cells have substantially similar circulation to normal
human red blood cells. Furthermore, exogenous proteins expressed
either in the intracellular space or on the surface of the cells do
not substantially affect the circulation behavior of these cells.
This is an important result for therapeutic translation of the
technology.
Example 23: Assessment of Adverse Circulatory Events
[1413] The incidence of adverse events caused by cultured eyrthroid
cells in circulation were assessed by detection of fibrinogen
breakdown products in blood and histology in animals injected with
cultured erythroid cells.
[1414] Detection of Fibrinogen Breakdown Products. Mice were
injected with cultured erythroid cells as described herein. Blood
was collected from mice by submandibular puncture in an
EDTA-containing tube. Cells were separated by centrifugation and
plasma was collected. The levels of fibrinogen breakdown products
fibrinopeptide A and fibrinopeptide B were measured in mouse plasma
by ELISA (MyBiosource) following manufacturer's instructions.
[1415] Histology. Tissue samples from the same mice were collected
following necropsy. Tissues were trimmed, embedded in paraffin wax,
and sectioned. Tissue sections were stained by H&E staining and
trichrome staining. Microscope images were taken at 10.times. and
20.times. magnification.
[1416] For therapeutic applications, it is important that cultured
erythroid cells and cultured erythroid cells that contain exogenous
proteins (either intracellularly or on the surface) not induce
adverse events, such as activation of the clotting cascade and
tissue thrombus formation.
[1417] FIGS. 10A and 10B show the levels of fibrinopeptide A and B
in mouse plasma for mice injected with (1) human red blood cells,
(2) cultured enucleated erythroid cells, (3) cultured enucleated
erythroid cells expressing an intracellular exogenous protein, (4)
cultured enucleated erythroid cells expressing a surface exogenous
protein, and (5) recombinant protein alone. The levels of
fibrinopeptide A and B, a marker of fibrinogen breakdown and
activation of the clotting cascade, are substantially similar for
all samples.
[1418] FIG. 10C and FIG. 10D show histologically stained sections
of spleen for a mouse injected with cultured enucleated erythroid
cells (FIG. 10C) and recombinant protein (FIG. 10D). There is no
substantial difference between the tissue, and no identifiable
tissue damage in spleen, liver, lung, brain, heart, and kidney was
observed between any of the samples.
[1419] These data conclusively demonstrate that cultured erythroid
cells, with or without exogenous protein, do not induce any adverse
events while in circulation in mice.
Example 24: Assessment of Exogenous Protein Retention in
Circulation
[1420] The retention of exogenous proteins in and on cultured
enucleated erythroid cells was assessed by flow cytometry and
Western blotting.
[1421] 1. Retention of Exogenous Protein Assessed by Flow
Cytometry
[1422] Erythroid cells were cultured as described herein. A
transgene construct encoding glycophorin A signal sequence,
antibody scFv specific to hepatitis B surface antigen, HA epitope
tag, and glycophorin A coding sequence was assembled by Gibson
assembly as described herein. The transgene was introduced into the
erythroid cells by lentiviral transduction as described herein. The
cells were cultured to terminal differentiation as described
herein. Cells were fluorescently labeled with CFSE and injected
into an immunocompromised NSG mouse (Jackson Labs) via the tail
vein (1.times.10{circumflex over ( )}8 cells per mouse). At regular
intervals blood was collected by submandibular puncture. Collected
cells were stained with a fluorescent anti-HA antibody (Abcam), and
analyzed by flow cytometry. Human cells were identified as CFSE+
cells, and exogenous protein retention was assessed by the fraction
of CFSE+ cells that also stained positive for the epitope tag.
[1423] 2. Retention of Exogenous Protein Assessed by Western
Blot
[1424] Erythroid cells were cultured as described herein. A
transgene construct encoding adenosine deaminase and an HA epitope
tag was assembled by Gibson assembly as described herein. The
transgene was introduced into the erythroid cells by lentiviral
transduction as described herein. The cells were cultured to
terminal differentiation as described herein. Cells were
fluorescently labeled with CFSE and injected into an
immunocompromised NSG mouse (Jackson Labs) via the tail vein
(1.times.10{circumflex over ( )}8 cells per mouse). At regular
intervals blood was collected by submandibular puncture. Collected
cells were washed, lysed, and analyzed by Western blot as described
herein with a detection antibody against the HA epitope tag.
[1425] For therapeutic applications, it is important that cultured
erythroid cells that contain exogenous proteins either
intracellularly or on the surface retain these transgenes when in
circulation. This feat is non-trivial given that it is widely
hypothesized in the field that erythroid cells undergo a rigorous
program of maturation and elimination of proteins unnecessary for
basic function when in circulation as they mature (Liu J et al.
(2010) Blood 115(10):2021-2027, Lodish H F et al. (1975)
Developmental Biology 47(1):59).
[1426] FIG. 11A-FIG. 11B shows that exogenous proteins expressed in
and on cultured enucleated erythroid cells were retained in
circulation. In FIG. 11A, mice were injected with cultured
enucleated erythroid cells that expressed antibody scFv on their
surface. The percentage of antibody scFv-positive cells began and
remained steadily at approximately 50% through the duration of the
multi-day circulation study. In FIG. 11B, mice were injected either
with cultured enucleated erythroid cells that expressed a
cytoplasmic enzyme with an HA tag or with recombinant enzyme with
an HA tag. When analyzed by Western blot, it is clear that the
enzyme retained within the cultured cell for the duration of the
experiment. The decrease in band intensity is attributable to the
clearance of cells during the experiment, not from the removal of
exogenous enzyme from said cells.
[1427] The data clearly demonstrate that exogenous proteins
expressed in and on culture enucleated erythroid cells are retained
in and on the cells in circulation, which has tremendous and
unprecedented implications for therapeutic relevance.
Example 25: Assessment of Half-Life Extension In Vivo
[1428] Erythroid cells were cultured as described herein. A
transgene construct encoding adenosine deaminase and an HA epitope
tag was assembled by Gibson assembly as described herein. The
transgene was introduced into the erythroid cells by lentiviral
transduction as described herein. The cells were cultured to
terminal differentiation as described herein. Cells were
fluorescently labeled with CFSE and injected into an
immunocompromised NSG mouse (Jackson Labs) via the tail vein
(1.times.10{circumflex over ( )}8 cells per mouse). At regular
intervals blood was collected by submandibular puncture. Collected
cells were washed, lysed, and analyzed by Western blot as described
herein with a detection antibody against the HA epitope tag.
[1429] A transgene encoding adenosine deaminase with an HA tag at
the C-terminus was constructed by Gibson assembly as described
herein. The transgene was introduced into HEK-293T cells by
lipofectamine transfection (Life Technologies) as described herein.
The protein was purified from the cell culture supernatant after 7
days using an HA affinity resin (Pierce) according to
manufacturer's instructions. Protein concentration was assessed by
absorbance of light at 280 nm. Protein (40 ug) was injected into an
immunocompromised NSG mouse (Jackson Labs) via the tail vein. At
regular intervals blood was collected by submandibular puncture.
Plasma was analyzed by Western blot as described herein with a
detection antibody against the HA epitope tag.
[1430] In FIG. 11B, mice were injected either with cultured
enucleated erythroid cells that expressed a cytoplasmic enzyme with
an HA tag or with recombinant enzyme with an HA tag. When analyzed
by Western blot, it is clear that the enzyme's circulating
half-life is significantly extended when expressed within a
circulating cell compared to when injected in soluble form.
Example 26: Assessment of Clearance Rate In Vivo--Platelets
[1431] A population of exogenous thymidine phosphorylase expressing
platelets is cultured using the herein detailed procedure and is
labeled with CFSE and injected into an NSG mouse via the tail vein.
A population of native human-sourced platelets is similarly labeled
with CFSE and injected into another mouse. Samples are taken from
both mice at 10 min, 1 h, 4 h, 8 h, 24 h, and 48 h and flow
cytometry is used to quantify platelet circulation levels. The
half-life of natural vs cultured platelets is compared.
Example 27: Assessment of Adverse Circulatory Events--Platelets
[1432] For therapeutic applications, it is important that cultured
platelets and cultured platelets that contain exogenous proteins
(either intracellularly or on the surface) not induce adverse
events, such as activation of the clotting cascade and tissue
thrombus formation. Upon injection of cultured platelets into an
NSG mouse via the tail vein, fibrinogen breakdown products
fibrinopeptide A and fibrinopeptide B are detected in mouse plasma
by ELISA following manufacturer's protocol (MyBiosource). Tissue
samples from NSG mice are collected following necropsy. Tissues are
trimmed, embedded in paraffin wax, and sectioned. Tissue sections
are stained by H&E staining and trichrome staining. Microscope
images are taken at 10.times. and 20.times. magnification and
assessed by a trained pathologist for any pathogenic features.
Example 28: Assessment of Exogenous Protein Retention in
Circulation--Platelets
[1433] The retention of exogenous proteins in and on cultured
platelets is assessed by flow cytometry and Western blotting.
[1434] CFSE labeled platelets that contain intracellular exogenous
protein are injected into a mouse via the tail vein. At regular
intervals blood is collected by submandibular puncture. Blood is
centrifuged to isolate the platelet-rich plasma, which is then
lysed, and analyzed by Western blot with staining for an epitope
tag present on the exogenous protein.
Example 29: Acquisition of Donor Cells for Production
[1435] After obtaining informed consent, healthy CD34+ stem cell
donors receive rhG-CSF (Granocyte or Neupogen), 10 ug/kg/day s.c.,
for 5 days for peripheral blood stem cell mobilization and then
undergo apheresis for 2 consecutive days to collect mobilized CD34+
HSC. Mononuclear cells (MNC) are isolated from mobilized peripheral
blood by Ficoll density gradient centrifugation and are split in
two parts. One part is used to purify CD34+ cells by using
anti-CD34-coated magnetic beads (Miltenyi Biotec, Inc., Germany),
relative to Miltenyi protocol. The purity of the CD34+ fractions is
controlled. CD34+-enriched HSC are then used immediately in the
two-step culture method or frozen until use in the one-step culture
method.
[1436] Complete medium (CM) used is RPMI 1640 (Eurobio, France),
supplemented with 2 mM L-glutamine and 100 IU/ml
penicillin-streptomycin (Gibco, Grand Island, N.Y., USA) and 10%
heat-inactivated FBS (Gibco). IMDM (Gibco), supplemented with 10%
heat-inactivated FBS, is used for expansion. Recombinant human stem
cell factor (rhSCF), thrombopoietin (TPO), fetal liver tyrosine
kinase 3 ligand (Flt-3L), GM-CSF, and TNF-alpha are purchased from
R&D Systems (Minneapolis, Minn., USA).
Example 30: Scale-Up for Production
[1437] Erythroid cells are scaled up in volume progressively,
maintaining the cells at a density of between 1.times.10{circumflex
over ( )}5 and 2.times.10{circumflex over ( )}6 cells/mL in static
culture. Expansion stage is seeded at 10{circumflex over ( )}5/m1
and includes 3-7 progressive volume transfers; 100 ml, 500 ml, 1 L,
10 L, 50 L, 100 L, 100 L. During the course of production the cell
media includes a combination of IMDM, FBS, BSA, holotransferrin,
insulin, glutamine, dexamethasone, beta estradiol, IL-3, SCF, and
erythropoietin. When the cells reach a volume appropriate for
seeding the production bioreactor, they are transferred to the
production bioreactor for final scale-up and differentiation.
Example 31: Culturing Cells in a Bioreactor (Wave)
[1438] The WAVE Bioreactor 2/10 system is set up according to the
operator manual. In brief, the Cellbag is assembled on the rocking
unit, which is placed on the perfusion module. After inflating the
bag with air, the weight is set to zero. Subsequently, the bag is
filled with the appropriate amount of culturing media and incubated
for at least two hours, allowing the media to reach 37 C. The media
and cells are transferred to the bag via a transfer flask, a
special designed DURAN glass bottle with two ports. In the upper
part of the flask, a filter is connected to the port. In the other
port, by the bottom of the flask, a tube is assembled. The tube one
the transfer flask is coupled with the feed connection on the
Cellbag. The transfer flask is maintained in a LAF hood, to
decrease the risk of contamination.
[1439] Before perfusion is started, tubing and containers for
harvest and feed are connected to the Cellbag. Tubing is prepared
as follows; a 50 or 70 cm long Saniflex ASTP-ELP silicone tubing
(Gore/Saniflex AB), with an inner and outer diameter of 3.2
respectively 6.4 mm, is equipped with male luer lock connections in
both ends. The silicone tubing is connected to one end of a C-Flex
tube, via a female luer lock. At the other end of the C-Flex tube a
male luer lock is assembled and tubings are thereafter autoclaved.
Luer locks are held in place with zip-ties on all tubes. Prior to
perfusion, the silicone part is connected to the Cellbag and the
C-Flex part to a 5 L container (Hyclone Labtainer) for both feed
and harvest. All connections are performed in a laminar airflow
cabinet.
[1440] Control of environmental and metabolic factors can alter the
expression or activity of transcription factors and gene regulatory
proteins of erythroid cells in culture, see e.g., Csaszar et al.,
2009 Biotechnol Bioeng 103(2):402; Csaszar et al. 2012 Cell Stem
Cell 10(2):218. To provide control over inputs and outputs in the
reactor a micro-volume delivery system is created, a key component
of which is a 60-80 cm long fused silica capillary (#TSP100375,
Polymicro Technologies) with an internal diameter of 100 um. At the
input end, the capillary is fed with a luer-lok tip stock syringe
(#309585 BD) connected via a PEEK luer to a MicroTight adapter
(#P-662, Upchurch Scientific). The stock syringe is loaded on a
Model 33 Twin Syringe Pump (#553333, Harvard Apparatus), kept in a
refrigerator at 4 C. At the output end, the capillary enters the
bioreactor: a two port FEP cell culture bag (#2PF-0002, VueLife)
placed on an orbital shaker in a cell culture incubator at 37 C
with 5% CO2. The capillary is fed through a self-sealing rubber
septa (#B-IIS, InterLink) with a needle, into the midpoint of the
bioreactor. The opposing connector on the bioreactor is replaced
with an additional self-sealing rubber septa. Stock syringes and
delivery capillaries are blocked overnight before use with a
solution of PBS with 10% fetal bovine serum to prevent protein
adhesion to syringe and capillary walls.
[1441] National Instruments LabVIEW 7.1 is used to create a program
to control the syringe pump's injections. The program's basic
dosing strategy is an initial injection to concentration L1
followed by wait time t1 and subsequent injections, each to
concentration L2 and followed by wait time t2, repeated for n
times. The user inputs the flow rate, the stock concentration, the
initial culture volume, the desired concentration after injections,
the time between injections, and the total number of
injections.
Example 32: Assess Expansion and Differentiation of Cultured
Erythroid Cells
[1442] It is important to assess the expansion, differentiation,
and enucleation in vitro differentiated cells to ensure that the
introduction of a transgene does not negatively affect the quality
of the cells in culture. Expansion is assessed by cell counting.
Differentiation is assessed by flow cytometry, Western blot, and
RT-PCR. Enucleation is assessed by flow cytometry.
[1443] Assessing Expansion Rate by Cell Counting. Erythroid cells
are cultured as described herein. At various time points, cells are
collected, washed with PBS, and counted using a Countess Automatic
Cell Counter instrument (Life Technologies). The expansion rate of
the cells is determined by the growth in number of cells over
time.
[1444] Assessing Differentiation by Flow Cytometry. Erythroid cells
are cultured as described herein. At various time points, cells are
collected, washed with PBS, and stained with 1:100 dilutions of
fluorescent antibodies against the cell surface markers GPA
(CD235a), CKIT (CD117), and TR (CD71), purchased from Life
Technologies. Labeled cells were analyzed by flow cytometry as
described herein.
[1445] Assessing Differentiation by Western Blot. Erythroid cells
are cultured as described herein. At various time points, cells are
collected, washed with PBS, lysed with RIPA buffer, and analyzed by
Western Blot as described herein using antibodies for
differentiation markers GATA1, GATA2, Band3, CD44, and actin
(Abcam).
[1446] Assessing Enucleation by Flow Cytometry. Erythroid cells are
cultured as described herein. At various time points, cells are
collected, washed with PBS, and stained with a fluorescent antibody
against glycophorin A (Life Technologies) and the nucleic acid
stain DRAQ5 (Pierce) at manufacturer-recommended dilutions, and
analyzed on an Attune flow cytometer as described herein.
[1447] Assessing Enucleation by Microscopy (Benzidine-Giemsa).
Erythroid cells were cultured as described herein. At various time
points, cells were collected, washed with PBS, and spun onto slides
using a Cytospin (Thermo Scientific). Cells were fixed cells after
cytospin with -20 C methanol for 2 min at room temp, rinsed with
water, and air-dried. A benzidine tablet (Sigma#D5905) was
dissolved with 10 mL PBS, to which 10 .mu.L of H2O2 was added. The
solution was filtered with a 0.22 um syringe filter. The cell spot
on the slide was covered with 300-500 uL of benzidine solution,
incubated at room temperature for 1 hr, then washed with water.
Giemsa stain was diluted (Sigma#GS500) 1:20 with water. The cell
spot on the slide was covered with 300-500 uL Giemsa solution,
incubated at room temperature for 40 minutes, washed with water,
and air-dried. Slides were then mounted and sealed before imaging
on a microscope.
[1448] FIG. 12A shows the expansion rate of erythroid cells in
culture during a seven day window of expansion and differentiation
for cells that contain transgenes (dashed line and dotted line) and
cells that do not contain a transgene (solid line). Of note, the
expansion rate of cultured cells that contain a transgene is
indistinguishable from that of cells that do not contain a
transgene.
[1449] FIG. 12B is a collection of flow cytometry plots for cells
stained with antibodies against the cell surface differentiation
markers GPA and CKIT. At this particular stage of differentiation,
the culture is losing its CKIT expression and increasing its GPA
expression as the cells approach terminal maturation. Of note,
cultured cells that contain a transgene are indistinguishable from
those that do not contain a transgene by this metric of
differentiation.
[1450] FIG. 12C is a collection of flow cytometry plots for cells
stained with an antibody against the surface marker GPA and a
fluorescent DNA stain. Three cell populations are evident: (1)
cells that are GPA-high and DNA-low, comprising enucleated
erythroid cells; (2) cells that are GPA-high and DNA-high,
comprising erythroid cells that still contain genetic material; and
(3) cells that are GPA-low and DNA-high, comprising pyrenocytes or
the membrane-encapsulated ejected nuclei from enucleated cells. Of
note, cultured cells that contain a transgene are indistinguishable
from those that do not contain a transgene by this metric of
enucleation.
[1451] The introduction of a transgene into cell culture does not
noticeably affect the rate of expansion, the differentiation, or
the rate of enucleation of the cells in culture.
Example 33: Assess Hemoglobin Content
[1452] 1. Total Hemoglobin
[1453] Erythrocyte hemoglobin content was determined by Drabkin's
reagent (Sigma-Aldrich, product D5941) per manufacturer's
instructions. Briefly, blood cells were combined with the reagent
in an aqueous buffer, mixed thoroughly, and absorbance of light at
a wavelength of 540 nm was measured using a standard
spectrophotometer. A soluble hemoglobin standard curve was used to
quantify the hemoglobin content in the cells.
[1454] 2. Hemoglobin Typing by RT-PCR
[1455] Cells were lysed and total RNA is collected. Reverse
Transcription was carried out with the SuperScript First-Strand
Synthesis System for RT-PCR (Life Technologies) according to
manufacturer's protocol. Briefly, total RNA (5ug) was incubated
with 150 ng random hexamer primer and 10 nmol dNTP mix in 10 uL H2O
for five minutes at 65 C then 1 minute on ice. The reaction master
mixture was prepared with 2 uL 10.times.RT buffer, 4 uL of 25 mM
MgCl2, 2 uL of 0.1 M DTT, and 1 uL of RNAseOUT. The reaction
mixture was added to the RNA/primer mixture, mixed briefly, and
then placed at room temperature for 2 min 1 uL (50 units) of
SuperScript II RT was added to each tube, mixed, and incubated at
25.degree. C. for 10 min The reaction was incubated at 42 C for 50
min, heat inactivated at 70 C for 15 min, then stored on ice.1 uL
RNase H was added and incubated at 37 C for 20 min. This reaction
product, the 1.sup.st strand cDNA, was then stored at -20 C until
needed for RT-PCR reaction.
[1456] Primers to amplify the different hemoglobin genes and
control genes were purchased from IDT-DNA. The primers were as
follows: hHBB_F-tcctgaggagaagtctgccgt (Seq. ID No. 9);
hHBB_R-ggagtggacagatccccaaag (Seq. ID No. 10);
hHBA_F1-tctcctgccgacaagaccaa (Seq. ID No. 11);
hHBA_R1-gcagtggcttagcttgaagttg (Seq. ID No. 12);
hHBA_F2-caacttcaagctaagccactgc (Seq. ID No. 13);
hHBA_R2-cggtgctcacagaagccag (Seq. ID No. 14);
hHBD_F-gactgctgtcaatgccctgt (Seq. ID No. 15);
hHBD_R-aaaggcacctagcaccttctt (Seq. ID No. 16);
hHBG2_F-cactggagctacagacaagaaggtg (Seq. ID No. 17);
hHBG2_R-tctcccaccatagaagataccagg (Seq. ID No. 18);
hHBE_F-aagagcctcaggatccagcac (Seq. ID No. 19);
hHBE_R-tcagcagtgatggatggacac (Seq. ID No. 20);
h18S-RNA-F-cgcagctaggaataatggaatagg (Seq. ID No. 21);
h18S-RNA-R-catggcctcagttccgaaa (Seq. ID No. 22).
[1457] An RT PCR reaction mix was prepared with 25 uL SYBR Green
Mix (2.times.) (Applied Biosystems), 0.5 uL 1.sup.st strand cDNA, 2
uL forward/reverse primer pair mix (each primer at 5 pmol/uL), in a
total volume of 50 uL H2O. Reactions were run in an ABI Prism SDS
7000 instrument (applied biosystems) using the following
amplification cycle: 50 C 2 min, 1 cycle; 95 C 10 min, 1 cycle; 95
C 15 s->60 C 30 s->72 C 30 s, 40 cycles; 72 C 10 min, 1
cycle. Dissociation curve analysis and RT-PCR results was performed
with the SDS 7000 instrument.
Example 34: Assess Differentiation of Cultured Platelets--FACS
[1458] The differentiation state of platelets in culture can be
assessed by flow cytometry. Megakaryocytes (MKs) represent a
distinct cellular morphology that precedes terminal platelet
differentiation. To determine the extent of maturation toward MKs,
1.times.10{circumflex over ( )}6 cultured cells (LAMA-84 and CD34+
cells) are washed and then labeled with (a) anti-CD41-FITC
(GpIIb/IIIa; BD Bioscience, San Jose, Calif., USA) or anti
CD71-FITC or (b) anti-CD33-FITC, anti-CD41-PE, anti-CD45-PerCp and
CD34-APC (Beckman Coulter, Fullerton, Calif., USA), and analyzed
for the percentage of CD41 cells generated.
[1459] To determine the amount of ploidy, differentiated LAMA-84
cells are fixed overnight in 75% ethanol at 4.degree. C. and
labeled with propidium iodide (PI, 50 .mu.g/ml) and analyzed using
the FACScalibur (Becton Dickinson), whereas day 14 differentiated
CD34+ cells are analyzed quantitatively under a microscope after
May-Grunwald/Giemsa staining by quantitating the number of nuclei
per cell and specific morphology of MKs with this stain. Only cells
with MK morphology are analyzed. The presence of multinucleated
cells in the cytospin preparation is indicative of the presence of
polyploid MKs. Differentiated CD34+ cells are assessed for the
presence of multinucleated mature MKs by morphology.
Example 35: Assess Differentiation of Cultured Platelets--qPCR
[1460] The differentiation state of platelets in culture can be
assessed by quantitative PCR. Platelet RNA is extracted to further
characterize the cultured cells. Total RNA is extracted using
TRIzol reagent (Invitrogen). The purity of each platelet
preparation is assessed by PCR analysis of platelet (GPIIIa) and
leukocyte (CD45) markers. The integrity of platelet RNA is assessed
using Bioanalyzer 2100 (Agilent) prior to further analyses.
[1461] Total RNA is collected from cell lysate and a cDNA library
is generated using a commercial synthesis kit (Clontech). The
labeled cDNAs are quantified with the Quant-iT PicoGreen dsDNA Kit
(Invitrogen) and diluted to 3 pM for loading into a single lane and
sequencing on an Illumina 1G Genome Analyzer (Solexa).
[1462] Raw sequences are filtered through serial quality control
criteria. First, the presence of at least 6 nt of the 3' Solexa
adapter is verified. The sequence reads that did not comply with
this criterion are discarded, whereas the others are trimmed to
remove the adapter sequence harbored at the 3' end. The remaining
tags are further filtered regarding their length (>10 nt), copy
number (>4 reads) and readability (<9 non-identified
nucleotides, annotated N). Reads complying with all those criteria
are subsequently defined as usable reads.
[1463] All the usable reads are aligned to pre-microRNAs extracted
from miRBase database. Sequence tags that matched perfectly to more
than one precursor are distributed equally among them. In order to
account for Drosha and Dicer imperfect cleavage, any sequence tag
that perfectly matched the pre-microRNA in the mature microRNA
region, allowing up to 4 nt shift as compared to the reference
mature microRNA position, is considered as a mature microRNA. The
microRNA expression level is defined as the number of reads mapping
each mature microRNA normalized to the total number of usable
reads, considering that the overall number of small RNAs is
invariant. The relative abundance of each microRNA is defined as
the number of reads mapping each microRNA compared to the total
number of reads mapping mature microRNAs.
Example 36: Purification by Centrifugation
[1464] Cultured cell fractions can be purified and separated from
nuclei and contaminating alternate-density cell types via
centrifugation. Cells are centrifuged at 200 g for 15 minutes to
isolate an erythrocyte and reticulocyte rich fraction. The
supernatant is pipetted off and the desirable cell fraction is then
washed in modified Tyrode's buffer (containing 138 mM NaCl, 5.5 mM
dextrose, 12 mM NaHCO.sub.3, 0.8 mM CaCl2, 0.4 mM MgCl2, 2.9 mM
KCl2, 0.36 mM Na2HPO4 and 20 mM Hepes, pH 7.4) in presence of 1
.mu.M prostaglandin 12, and resuspended in the same buffer.
Example 37: Purification by Chemical Enucleation
[1465] Enucleation of cultured cells can be stimulated by chemical
additives to the culture, which can help increase the enucleated
fraction of cells prior to purification. Erythroid cells are
cultured as described herein. 48 hours prior to collection, cells
are incubated with 210 mM Me2SO. Cells are then collected by
centrifugation at 350.times.g for 5 min at room temperature,
resuspended at a level of 3.times.105 cells per ml in fresh medium
containing 210 mM Me2SO and 5 ug/mL of cytochalasin B (or other
actin or nucleus manipulating molecule, ie. p38 MAPK, psoralens)
and incubated at 37 C. The proportion of cells without nuclei is
assessed by flow cytometry as described herein, using DRAQ5 as a
nucleic acid stain and antibodies against glycophorin A as an
erythroid surface marker of differentiation.
Example 38: Purification by Acoustophoresis
[1466] Several mechanical separation systems may be used to obtain
a uniform cell population. Free flow acoustophoresis represents one
mechanical separation method (Petersson 2007, American Chemical
Society). While suspended in saline solution (0.9 mg/mL) with
nutrient additives, including CsCl (0.22 g/mL), is added to the
saline solution. A sample suspension containing cultured erythroid
cells is processed using an acoustopheresis chip (Cell-Care) with
two active outlets (flow rate 0.10 mL/min per outlet).
[1467] Syringe pumps (WPI SP260P, World Precision Instruments Inc.,
Sarasota, Fla.) are used to control the flow rates in the chip. All
outlets are individually connected to high-precision glass syringes
(1005 TLL and 1010 TLL, Hamilton Bonaduz AG, Bonaduz, Switzerland)
via the injectors using Teflon tubing, allowing independent control
of the outlet flow rates. The clean fluid inlet is connected to a
syringe pump and the cell suspension inlet to a 50-mm-long piece of
Teflon tubing (0.3-mm i.d.) with its other end submerged in a
beaker from which the sample suspension is aspirated at a rate
defined by the difference between the net outlet flow and the clean
fluid inlet flow.
[1468] The ultrasound used to induce the standing wave between the
walls of the separation channel is generated using a 20.times.20 mm
piezoelectric ceramic (Pz26, Ferroperm Piezoceramics AS, Kvistgard,
Denmark) attached to the back side of the chip. Ultrasonic gel
(Aquasonic Clear, Parker Laboratories Inc., Fairfield, N.J.)
ensures a good acoustic coupling between the two. The piezoelectric
ceramic is actuated via a power amplifier (model 75A250, Amplifier
Research, Souderton, Pa.) connected to a function generator (HP
3325A, Hewlett-Packard Inc., Palo Alto, Calif.). Even though the
acoustic waves enter the chip from the back side, a standing wave
is induced between the side walls of the separation channel as a
result of the coupling of the mechanical vibrations along the three
axes of the crystal structure.
[1469] The separation process is monitored using a standard
microscope and a wattmeter (43 Thruline Wattmeter, Bird Electronic
Corp., Cleveland, Ohio). The process can subsequently be controlled
by tuning the signal frequency, the actuation power, and the flow
rates.
[1470] The cell size distributions in the samples are analyzed
using a Coulter counter (Multisizer 3, Beckman Coulter Inc.,
Fullerton, Calif.). Each sample is mixed with an electrolyte
(Isoton II, Beckman Coulter Inc.) and analyzed using a 100-um
aperture. The level of hemolysis, i.e., the concentration of free
hemoglobin from damaged red cells, is measured using a photometer
(Plasma/low HB Photometer, HemoCue AB, Angelholm, Sweden).
Example 39: Purification by Ex Vivo Maturation
[1471] Erythroid cells that are not fully mature can be driven to
maturity by ex vivo incubation in a system that mimics the natural
in vivo maturation triggers.
[1472] 1. Co-Culture with Stromal Cells
[1473] In the final stage of culture, erythroid cells are cultured
on an adherent stromal layer in fresh medium without cytokines. The
cultures are maintained at 37 C in 5% CO2 in air. The adherent cell
layer consists of either the MS-5 stromal cell line or mesenchymal
stromal cells (MSCs) established from whole normal adult bone
marrow (see Prockop, D J (1997) Science 276:71) in RPMI
(Invitrogen) supplemented with 10% fetal calf serum. Adherent MSCs
are expanded and purified through at least two successive passages
prior to use in co-culture.
[1474] 2. Culture in Fibronectin-Coated Plates
[1475] In the final stage of culture, erythroid cells are cultured
in plates adsorbed with human fibronectin. To produce these plates,
fibronectin (Sigma Aldrich) is reconstituted with 1 mL sterile
H2O/mg of protein and allowed to dissolve for at least 30 minutes
at 37.degree. C. A small amount of undissolved material may remain.
This will not affect product performance. The fibronectin solution
is diluted 100.times. in sterile balanced salt solution and added
to the culture surface with a minimal volume. The culture surface
is allowed to air dry for at least 45 minutes at room temperature.
Excess fibronectin is removed by aspiration.
Example 40: Purification by Magnetophoresis
[1476] Strategies for separating, enriching, and/or purifying
erythroid cells by magnetophoresis are known in the art, see e.g.,
Zborowski et al., 2003, Biophys J 84(4) 2638 and Jin & Chalmers
2012, PLOS One 2012 7(8):e39491. A commercial magnetic separation
system (QuadroMACS.TM. Separator combining four MidiMACS.TM.
separation units and LD columns, Miltenyi Biotec, Auburn, Calif.)
is used for magnetic erythrocyte enrichment from HSC-derived
erythrocyte cultures. Cells are deoxygenated in a Glove-Bag.TM.
inflatable glove chamber (Cole Parmer, Vernon Hills, Ill.), filled
with nitrogen (Medipure.TM. nitrogen, concentration >99%,
Praxair, Inc., Danbury, Conn.). Before deoxygenation, all materials
and equipment including the separation system, degassed sterile
buffer (PBS+2 mM EDTA+0.5% BSA), and sterile collection tubes are
placed in the glove bag, which is then tightly sealed. Deoxygenated
cultures are loaded directly into a MACS.RTM. LD column which was
placed in the QuadroMACS.TM. separator kept under anoxic conditions
inside an inflatable glove chamber filled with N2 gas. Cells which
pass through the column contained within the magnet are labeled as
negative fraction and they are expected to be "non-magnetic",
including HSCs and erythroid cells before final maturation. The
cells retained in the separation column are labeled as positive
fraction, which is "magnetic" and consist of maturing RBC-like
cells nearly full of functional hemoglobin. They are eluted from LD
column after its removal from the magnet. Once separation is
finished, oxygenated cells are reversibly recovered by exposing the
collected cells to air.
Example 41: Purification by FACS
[1477] A population of erythroid cultured cells is sorted using a
Becton-Dickinson Aria IIu cell sorter. Prior to sorting, cells are
collected, washed with PBS, and stained with a fluorescent antibody
against glycophorin A (Life Technologies) and the nucleic acid
stain DRAQ5 (Pierce) at manufacturer-recommended dilutions. A 100
.mu.m nozzle is used with a drop drive frequency of 28,000
drops/second. The sample threshold rate is approximately 4000
events/second. The temperature control option is used to maintain
sample and collection tubes at 4.degree. C. the entire duration of
sorting. Additionally, the sample agitation feature is used at 200
rpm to prevent the sample from sedimenting throughout the sort. The
sample is sorted in aliquots of approximately 750 .mu.l dispensed
from the syringe. Meanwhile, during these pauses the collection
tubes are kept at 4.degree. C., protected from the light, and
gently mixed prior to resuming sort. The sorted samples are
collected into a 12.times.75 mm borosilicate glass collection tube
containing 250p1 DMEM supplemented with 10% FCS.
Example 41: Purification by Enzymatic Treatment of Cells
[1478] Allogeneic erythrocyte sourcing may benefit from A and B
antigen removal to generate a universally compatible product. This
may be facilitated by a set of enzymes capable of selectively
cleaving the galactose groups, rendering the erythroid cells more
immunogenically favorable.
[1479] Two types of recombinant proteins of endo-B-galactosidase,
which are originally identified from Clostridium perfringens, are
produced in E. coli BL-21 using standard cloning methods. ABase is
prepared for releasing A/B Ag and endo- -galactosidase C (EndoGalC)
for releasing Gala1-3Gal 1-4GlcNAc (Gal Ag), which is known to be
highly immunogenic in xenotransplantation, and has a carbohydrate
structure resembling the A/B Ag. ABase cleaves Gal 1-4G1cNAc
linkage in blood type A [GalNAc.alpha.1-3(Fuc.alpha.1-2) Gal
1-4G1cNAc] and in blood type B [Gal.alpha.1-3(Fuc.alpha.1-2) Gal
1-4GlcNAc].
[1480] Briefly, after cloning of ABase, an expression plasmid with
a C-terminal His tag is constructed in the pET-15b vector eabC
without signal peptide. This exogenous gene is transformed into E.
coli BL-21 cells. The enzyme produced in the cells as a soluble
protein fraction is purified over a nickel-nitrilotriacetic acid
column (QIAGEN GmbH, Hilden, Germany). Finally, 5 mL of purified
recombinant ABase is obtained at the concentration of 3.6 mg/mL
with the specific activity of 1500 U/mg. One unit of the enzymatic
activity is defined as the amount of the enzyme required to
hydrolyze 1 .mu.mol of the substrate per min.
[1481] The effect of ABase treatment on Ag presence, Ab binding and
complement activation is examined Human A/B RBC are digested with
ABase and subjected to flow cytometric analysis after incubation
with cross-reactive (anti-A or anti-B or anti-A and B containging;
type B, type A or type O respectively) human sera. The mean
fluorescence intensity (MFI) is used to quantitate the expression
level of blood type A, B and Gal Ag. Digestion level is expressed
as a percentage of blood type A or B Ag expressed on RBC after
incubation in the absence of ABase.
[1482] Fresh blood type O sera are pooled from three healthy human
volunteers and frozen at -80.degree. C. to preserve endogenous
complement activity until used. Heat-inactivated (for 30 min at
56.degree. C.) sera are used for analysis of Ab binding. RBC with
and without enzyme (ABase) digestion are incubated with 50% blood
type O sera (100 .mu.L) diluted with phosphate-buffered saline
containing 0.2% bovine serum albumin (PBS/BSA) for 30 min at
37.degree. C. After washing, RBC are reacted with FITC-labeled
anti-human IgG/IgM (DAKO, Glostrup, Denmark) (.times.30, 100 .mu.L)
for 30 min at 4.degree. C. and then subjected to flow cytometric
analysis.
[1483] The inhibitory effect of enzyme treatment on complement
activation is also evaluated by the change of C3d deposition. After
RBC are incubated with 50% human sera in the presence of complement
activity for 15 min at 37.degree. C., RBC are reacted with
FITC-labeled rabbit anti-human C3d Ab (DAKO, Glostrup, Denmark)
(.times.100, 100 .mu.L) for 30 min at 4.degree. C. and then applied
to flow cytometric analysis. The percentage of the control level
(in the absence of enzyme) is calculated based on MFI to evaluate
the inhibitory effect of enzyme treatment on Ab binding and C3d
deposition.
Example 42: Purification of Platelets by Centrifugation
[1484] Platelets can be purified from mixed cell suspensions by
centrifugation. Some 40 ml of whole blood is distributed in blood
collection tubes with sodium citrate at 3.2% used as an
anticoagulant. The tubes are centrifuged at 400.times.g for 10 min.
After this stage, three layers are clearly demarcated: plasma, red
blood cells, and an intermediate zone. The plasma is at the top
with the platelets, the red blood cells are at the bottom because
of their heavier density; and the fine, whitish intermediate zone
consists of larger platelets and leukocytes and is called the buffy
coat. Using a Jelco 18G needle, the upper portion of plasma with
platelets is drawn off, and the buffy coat is placed into two other
tubes, this time with no additives: one tube to produce plasma (P
tube) and the other to produce thrombin (T tube). Only 1.5 ml of
plasma is used to produce thrombin, to which 0.5 ml of calcium
gluconate at 10% is added, with 15 min in a double boiler at
37.degree. C. The two tubes are then centrifuged again, this time
at 800.times.g, for the same length of time (T=10 min). After this
final centrifugation, the T tube contains a thrombin-rich liquid
while the P tube contains the platelet sedimentation and some red
blood cells (erythrocyte-platelet clump). The volume is reduced at
this stage by removing two-thirds of the total plasma volume. The
portion removed is platelet poor, while the remaining portion with
the sedimented platelets (that are easily dispersible by stirring)
is platelet rich.
Example 43: Thymidine Incorporation
[1485] Self-replication potential of a cell population can be
assessed using a thymidine incorporation assay known in the art,
see e.g., Harkonen et al. 1991 Exp Cell Res 186L288 and Tanaka et
al. 1992 PNAS 89:8928.
[1486] Briefly, uniformly 13C- and 15N-enriched thymidine [U-13C,
15N-TdR] is obtained from Martek Biosciences (Columbia, Md.), and 3
H-TdR (80 Ci/mmol) is purchased from ICN Radiochemicals (Irvine,
Calif.). Media and buffers are obtained from Fisher Scientific
(Pittsburgh, Pa.). All enzymes except phosphodiesterase are from
Boehinger Mannheim (Indianapolis, Ind.). Phosphodiesterase II is
obtained from Worthington Biochemical Corporation (Lakewood, N.J.).
High-performance liquid chomatography (HPLC) solvents are from EM
Science (Gibbstown, N.J.) and contained <0.1 ppm evaporation
residue.
[1487] Erythroid cells are cultured as described herein. Following
the culture, cells are collected for use in the thymidine
incorporation assay.
[1488] Cells are labeled with [U-13C, 15N]-TdR at 1.6 .mu.g/ml for
18 h, with the addition of unenriched thymidine to achieve a final
thymidine concentration of 1 .mu.M. After they are washed with
phosphate-buffered saline, the cells are cultured in supplemented
DMEM for 6 h more before 3 H-TdR is added at the indicated
concentrations (0.1-10 .mu.Ci/ml) for another 18-h incubation.
Unlabeled thymidine is added to the samples to bring the final
thymidine concentration to 0.13 .mu.M, which is equivalent to the
concentration of 3 H-TdR in the samples receiving 10 .mu.Ci
radiolabel/ml. After removal of 3 H-TdR, the cells are incubated in
supplemented DMEM for an additional 6-54 h before isolation of
DNA.
[1489] DNA is extracted using the modified Puregene DNA isolation
kit (Gentra Systems, Minneapolis, Minn.). Based on the number of
cells in the sample, a scale-up/scale-down procedure is used to
determine the added reagent volumes. For example, when
1.times.10{circumflex over ( )}7 cells are used, 21 n1 containing
328 .mu.g of proteinase K is added to 3 ml of cell lysis solution.
After mixing, the sample is left overnight at room temperature. The
following day, 10 .mu.g of RNase is added and the sample is mixed
and incubated for 2 h at 37 C. Protein precipitation solution (1
ml) is added, and the sample is incubated on ice for 5 min After
centrifugation for 10 min at 2000 g, the supernatant containing DNA
is mixed with 3 ml 100% 2-propanol and gently inverted 50 times or
until white threads of DNA became visible. The sample is then
centrifuged at 2000 g for 5 min The resultant DNA pellet is dried
for 5 min before washing in 3 ml of 70% ethanol and
recentrifugation for 5 min at 2000 g. The final pellet is air-dried
and then rehydrated in deionized H2O and quantitated by absorption
at 260 nm. The same procedure is applied to CD34+ stem cells as a
control for replicative ability.
[1490] Any DNA is denatured by boiling for 3 mM, then chilled
rapidly on ice. The enzymatic hydrolysis procedure is carried out
with a DNA concentration of 0.5 mg/ml. The following protocol
describes volume of reagent added per milliliter of DNA solution.
DNA is hydrolyzed with 10 .mu.l of nuclease P1 (0.5 U/.mu.1) and 5
.mu.l of DNase I (4 U/.mu.1) in 10 .mu.l of buffer containing 200
mM MgCl2, 100 mM ZnCl2, and 1 M Tris, pH 7.2, for 2 h at 45.degree.
C., followed by addition of 20 .mu.l phosphodiesterase (4 mU/.mu.1)
and further incubation for 2 h at 37.degree. C. Finally, 5 .mu.l of
10 M ammonium acetate (pH 9.0) and 10 .mu.l of alkaline phosphatase
(1 U/.mu.1) are added, and the samples incubated for another 2 h at
37.degree. C.
[1491] The digested DNA sample is filtered with a 0.22-um nylon
filter. This sample is analyzed with the HPLC/CRI/IRMS system,
using a 4.6.times.250 mm Supelcosil LC-18-S HPLC column (Supelco,
Bellefonte, Pa.). The same solvent system is used at 1 ml/min and a
linear gradient of 5% to 25% B in 15 min
[1492] After separation by HPLC, the deoxynucleosides are analyzed
using chemical reaction interface mass spectrometry (CRIMS). In
this process, the deoxynucleosides flow into a nebulization and
desolvation system driven by a stream of helium, where they emerge
as a dry particle beam. The 13CO2/12CO2 abundances from this
in-line generated CO2 are determined with a Finnigan/MAT Delta S
isotope ratio mass spectrometer (ThermoFinnigan, San Jose, Calif.)
and its accompanying Isodat data system. 5-Fluorodeoxyuridine
(Sigma) is used as an internal isotope ratio standard.
[1493] Isotope ratios (IR in equation that follows) for three
nucleosides are obtained from each sample: T, dA, and dG. The
enrichment of CO2 evolved from each DNA-derived deoxynucleoside is
computed by the equation (13) CO2 (per mil)=1000.times.(IR
experimental-IR std)/IRstd. To maintain the highest level of
internal consistency and avoid any interexperimental drift, the
isotope ratio for dG is subtracted across all experiments from the
isotope ratio for T. The data from the end of the stable-isotope
labeling period (day 0) to the end of the washout (day 3) are
evaluated.
Example 44: Quantification of Nuclear Material
[1494] The number of cells in a mixed population that contain DNA
is assessed by flow cytometry using the DNA stain DRAQ5 (Pierce).
Cells are incubated with the stain per manufacturer's instructions
and analyzed on a flow cytometer, e.g., an Attune cytometer (Life
Technologies). The percentage of cells above a predefined threshold
of nuclear material content is quantified.
Example 45: Tumorigenicity Assay In Vitro
[1495] To assess the replication potential of cells, a soft agar
colony formation assay can be performed. In brief, a base agar
layer is made by making a 0.5% Agar+1.times.RPMI+10% FCS solution,
all components warmed to 40 C, and adding 1.5 mL of the solution to
a 35 mm petri dish. The agar is allowed to solidify for 30 min at
room temp before use.
[1496] The top agarose layer is prepared by melting 0.7% agarose in
a microwave and cooling to 40 C. A 2.times.RPMI+20% FCS solution is
heated to 40 C. Cells are counted and prepared for plating at 5000
cells per plate at a density of 200,000 cells per mL. 0.1 mL of
cell suspension is added to 10 mL tubes, followed by 3 mL of the
warm 0.7% Agarose and 3 mL of the warm RPMI/FCS solution. The
solution is mixed gently by swirling and added (1.5 mL) to each of
three or four replicate base agar plates.
[1497] Plates are incubated at 37 C in a humidified incubator for
10-30 days. Cells are fed 1-2 times per week with cell culture
media, 0.75 mL/plate.
[1498] To assess colony formation, plates are stained with 0.5 mL
of 0.005% Crystal Violet for >1 hr. Colonies are counted using a
dissecting microscope.
Example 46: Tumorigenicity Assay In Vivo
[1499] Terminally-differentiated cultured erythroid cells are
implanted in various animal models to evaluate the potential for
tumorigenicity. Several tissues are collected from the various
models and analyzed with histological, immunochemical, and
fluorescent assays to quantify tumorigenicity.
[1500] Animals receive daily intraperitoneal injections of CsA (10
mg/kg, Sandimmune, Novatis Pharma, Nurnberg) starting two days
before grafting. For the depletion of NK cells, some rats receive,
in addition to CsA intraperitoneal injections of the monoclonal
antibody (mAb), anti-NKR-P1A (clone 10/78, mouse IgGi, BD
Biosciences, Heidelberg, Germany) or the respective isotype control
(clone PPV-06, mouse IgGi, Exbio, Prague, Czech Republic). The
anti-NKR-P1A mAb (clone 10/78) is directed against the same epitope
as the mAb (clone 3.2.3). One mg of the respective antibodies are
given one day before the injection of erythroid cells followed by
0.5 mg at day 4 after cell transplantation.
[1501] Blood samples are taken before starting these experiments,
at day 0 and 4 days after erythroid cell transplantation, and at
autopsy (day 92) in order to determine the proportion of NK cells
in the blood by flow cytometry. For the analysis of subcutaneous
tumor growth erythroid cells are injected in 100 .mu.l
phosphate-buffered saline (PBS) into the flank of the animals.
Tumor growth is monitored every second day by palpation and size is
recorded using linear calipers. Animals are sacrificed before day
100 when a tumor volume of 1 cm.sup.3 in mice and 5 cm.sup.3 in
rats is reached, when a weight loss of more than 10% occurs, or
when any behavioral signs of pain or suffering are observable.
Autopsies of all animals are performed.
[1502] Murine tissue near the site of injection is immediately
frozen in liquid nitrogen or placed in phosphate-buffered 4%
formalin for 16 h and then embedded in paraffin. Spleens and lymph
nodes are removed for subsequent immunological analyses. The
transplantation of erythroid cells into the striatum of
unilaterally 6-OHDA-lesioned rats is performed. These animals are
sacrificed 6 weeks after transplantation.
[1503] Animal tissue is analyzed by flow cytometry. Appropriate
fluorescent and PE-conjugated antibodies against established cancer
cell biomarkers of CD133, CD3, CD, CD16, CD19, CD20, CD56, CD44,
CD24, and CD133 are added to the excised tissues samples and
analyzed to quantify tumorigenic potential.
Example 47: Deformability by EKTA
[1504] Erythroid cells cultured as described herein are assessed
for deformability characteristics relative to natural erythrocyte
samples via ektacytometry.
[1505] The ektacytometer consists of a Couette-type viscometer
combined with a helium-neon laser used to produce a diffraction
image of red cells suspended in a viscous fluid between the two
cylinders. When the viscometer rotates, normal red cells elongate
in the shear field, causing the diffraction image to become
elliptical. The ellipticity of the image is measured by quantifying
the light intensity along the major (A) and minor (B) axes of the
diffraction pattern and expressing this as a ratio (A-B)/(A+B), the
deformability index (DI) or elongation index (EI). The viscosity of
the medium is chosen to be greater than the internal viscosity of
the densest erythroid cells. A 31 g/liter solution of
polyvinylpyrrolidone (PVP), mw=360,000, in a phosphate buffer of
0.04 M composed of K2HP04 and KH2P04 in distilled water yields a
viscosity of 0.20 poise at 25.degree. C. and 12 poise at 37 C.
[1506] Osmolarity is adjusted with NaCl to the desired level and
measured in a Roebling freezing-point osmometer. The final pH is
varied by using small additions of 1-M solutions of NaOH and HCl
and is measured in a Technicon BG I1 blood gas analyzer. Sodium
azide is added as a preservative to stock solutions to obtain 0.4
g/l.
[1507] The ektacytometer collects three primary metrics from the
erythroid cell samples and compares them to native erythrocytes;
Osmolality minimum (O.sub.min), deformability index (Di.sub.max),
and the osmolality at which the DI reaches half of its maximum
value (O.sub.hyp).
[1508] O.sub.min is related to the surface area to volume ratio of
the cell and has been found to equal the 50% hemolysis point in the
classical osmotic fragility test.
[1509] Di.sub.max is the maximum value of the deformability index,
normally reached at 290 mosmol (the physiologic osmolality value).
This indicates the maximum deformability of the cell under shear
stress and is related to a number of factors, such as surface area,
volume, internal viscosity, and mechanical properties of the cell
membrane.
[1510] O.sub.hyp is the osmolality at which the DI reaches half of
its maximum value. This gives an indication of the position of the
hypertonic part of the curve, which is related to the internal
viscosity of the cell as well as mechanical properties of the
membrane, such as how it will bend under force (stiffness).
[1511] The parameters obtained for the cultured erythroid cells are
compared to the same values for primary erythroid cells.
Example 48: Deformability by LORCA
[1512] The deformability of purified cRBC populations is measured
by a laser diffraction technique (LORCA, laser-assisted optical
rotational cell analyzer, R&R Mechanotrics). In brief, a highly
diluted suspension of cells is sheared in a Couette system with a
gap of 0.3 mm between 2 cylinders, one of which is able to rotate
to induce shear stresses. A laser beam is passed through the
suspension, and the diffraction pattern is measured at 37.degree.
C. At low shear stress, the cells are circular disks, whereas at
high shear stress, the cells become elliptical. The cell
deformability is expressed in terms of the elongation index (EI),
which depends on the ellipticity of the deforming cells. Aliquots
containing 12.5 uL of pelleted RBC pellets are diluted in 5 mL of
polyvinylpyrrolidone solution (molecular weight 360 000). The EI
values at 30 Pa (referred to as Elmax) and 3 Pa are selected as
representative values of the deformability for easy comparison
between samples at various shear stresses.
Example 49: Assessment of Vascular Occlusion--Ex Vivo Rat
Vasculature
[1513] The potential for vascular occlusion of erythroid cells can
be assessed with isolated artificially perfused rat vasculature
using methods known in the art, see e.g., Kaul et al. 1983, J Clin
Invest 72:22. Briefly, in anesthetized (sodium pentabarbitol 30
mg/kg) rats of the Wistar strain, 120-150 g, the right ileocolic
artery and vein are cannulated with heparinized (100 uL/mL)
silastic tubing at a site 3 cm distant from the ileocolic junction.
Under a steady-state perfusion with Ringer's containing 1% bovine
serum albumin, the ascending colon and terminal ileum (3 cm each)
are sectioned between ties. After hemostatic ties of all vascular
connections is achieved, the tissue is isolated. The isolated
mesoappendix is gently spread on an optically clear Lucite block on
a microscope stage. The entire preparation is covered with a
plastic saran wrap except for outlets of cannulas and the
microscope objective.
[1514] The control arterial perfusion pressure (Ppa) and venous
outflow pressures (Pv) are kept constant at 80 and 3.8 mmHg,
respectively, and monitored via Statham-Gould P-50 pressure
transducers (Stathan Instruments Inc, Oxnard CA). The venous
outflow (Fv) rate is monitored using a photoelectric dropcounter
and expressed in mL/min A lapse of 10-12 min is allowed for tissue
equilibration and stabilization of Fv. Only preparations exhibiting
mesoappendix microvasculature free of host blood cells and with a
steady Fv of 4.6+/-0.5 (mean+/-SD) are used. The experiments are
done at 37 C.
[1515] Erythroid cells are isolated as described herein. After
control measurements of Ppa and Fv, erythroid cells (0.2 mL, Hct
30%) are gently delivered via an injection port 15 cm distal to
site of arterial cannulation, and the changes in Ppa and Fv are
recorded on the strip chart of a Grass polygraph (Grass Instrument
Co, Quincy Mass.). The tissue preparations are perfused for 10-15
mM before the infusion of samples with Ringer's solution to allow
stabilization of the tissue and clear the vasculature of the
remaining blood cells of the host animal. The resulting obstruction
after the infusion of cells can be cleared and the flow restored by
briefly (2-3 mM) perfusing the vasculature with fully-oxygenated
Ringer's solution at high pressure (100 mmHg).
[1516] At the end of each experiment the entire tissue preparation
(free of cannulas and luminal content) is weighed. Peripheral
resistance units (PRU) are calculated and expressed as
PRU=.DELTA.P/Q=mmHg/mL/(min-g) where .DELTA.P (mmHg) is the
arteriovenous pressure difference and Q (mL/min-g) is the rate of
venous outflow per gram of tissue.
[1517] In each experiment, pressure-flow recovery time (Tpf) is
determined following the bolus infusion of samples. Tpf is defined
as the time (seconds) required for Ppa and Fv to return to their
base-line levels following the delivery of a given sample, and it
represents total transit time throughout the mesoappendix
vasculature. The parameter values obtained for cultured erythroid
cells are compared to the values obtained for primary erythroid
cells.
Example 50: Assessment of Vascular Occlusion--In Vitro Flow
Chamber
[1518] Methods to assess vascular occlusion of erythroid cells
using in vitro graduated height flow chambers are known in the art,
see e.g., Zennadi et al 2004, Blood 104(12):3774.
[1519] Briefly, graduated height flow chambers are used to
quantitate the adhesion of erythroid cells to endothelial cells
(ECs). Slides coated with ECs are washed with Hanks balanced saline
solution (HBSS) with 1.26 mM Ca2+, 0.9 mM Mg2+ (Gibco, Grand
Island, N.Y.) warmed previously to 37.degree. C. and then fit into
a variable height flow chamber. The flow chamber is mounted on the
stage of an inverted phase contrast microscope (Diaphot; Nikon,
Melville, N.Y.) connected to a thermoplate (Tokai Hit,
Fujinomiya-shi, Japan) set at 37.degree. C. Cells are observed
using a video camera (RS Photometrics, Tucson, Ariz.) attached to
the microscope and connected to a Macintosh G4 computer (Apple,
Cupertino, Calif.). Erythroid cells are cultured as described
herein, and labeled with fluorescent dye PKH 26 red fluorescent
cell linker kit (Sigma) following the manufacturer's instructions.
Cells (3 mL) suspended at 0.2% (vol/vol) in HBSS with Ca2+, Mg2+
are infused into the flow chamber and allowed to adhere to the
slide for 15 minutes without flow. Before exposure to flow, a
minimum of 3 fields at each of 7 different locations along a line
oriented normal to future flow are examined for the total number of
fluorescent cells. Fluid flow (HBSS with Ca2+, Mg2+) is then
started using a calibrated syringe pump. After exposure to flow,
the fields are again examined and the number of adherent cells
counted. The fraction of adherent cells is presented as follows:
Number of cells attached after exposure to flow/Cells present per
field before flow. The wall shear stress is calculated as follows:
.tau.w=(6.mu.Q)/(wH [x]2), in which .tau.w indicates wall shear
stress (dyne/cm2); Q, volumetric flow rate (cm3/s); .mu., media
viscosity; w, width of the flow channel; and H(x), height of the
flow chamber as a function of position along the microscope
slide.
Example 51: Assessment of Vascular Occlusion--Intravital
Microscopy
[1520] Methods to assess vascular occlusion of erythroid cells
using intravital microscopy are known in the art, see e.g., Zennadi
et al. 2007 Blood 110(7):2708.
[1521] Briefly, general anesthesia of a test animal is achieved by
intraperitoneal injection of 100 mg/kg ketamine (Abbott Laboratory,
Chicago, Ill.) and 10 mg/kg xylazine (Bayer, Shawnee Mission,
Kans.). A double-sided titanium frame window chamber is surgically
implanted into the dorsal skin fold under sterile conditions using
a laminar flow hood. Surgery involves carefully removing the
epidermal and dermal layers of one side of a dorsal skin fold,
exposing the blood vessels of the subcutaneous tissue adjacent to
the striated muscles of the opposing skin fold, and then securing
the 2 sides of the chamber to the skin using stainless steel screws
and sutures. A glass window is placed in the chamber to cover the
exposed tissue and secured with a snap ring. Subsequently, animals
are kept at 32.degree. C. to 34.degree. C. until in vivo studies
were performed 3 days after surgery.
[1522] Anesthetized animals with window chambers are placed on the
stage of an Axoplan microscope (Carl Zeiss, Thornwood, N.Y.);
temperature is maintained at 37.degree. C. using a thermostatically
controlled heating pad. All infusions are through the dorsal tail
vein. Erythroid cells are cultured as described herein. Cells are
then labeled with Dil or DiO (Molecular Probes, Eugene, Oreg.) dyes
per manufacturer's instructions. Labeled cells (300 pL; hematocrit
0.50 [50%] in PBS with Ca2+ and Mg2+) are infused, and RBC adhesion
and blood flow dynamics are observed in subdermal vessels for at
least 30 minutes using LD Achroplan 20.times./0.40 Korr and Fluar
5.times./0.25 objectives. Microcirculatory events and cell adhesion
are simultaneously recorded using a Trinitron Color video monitor
(PVM-1353 MD; Sony, Tokyo, Japan) and JVC video cassette recorder
(BR-S3784; VCR King, Durham, N.C.) connected to a digital video
camera C2400 (Hamamatsu Photonics KK, Hamamatsu City, Japan).
Thirty segments of venules are examined for each set of conditions.
Arterioles are distinguished from venules based on (1) observation
of divergent flow as opposed to convergent flow; (2) birefringent
appearance of vessel walls using transillumination, which is
characteristic of arteriolar vascular smooth muscle; and (3)
relatively straight vessel trajectory without evidence of
tortuosity.
[1523] Measurement of red cell flux and adhesion is performed by
examining videotapes produced using .times.20 magnification. Cell
adherence is quantitated by considering cells attached to the
vessel walls and immobile for 1 minute. The percentage of the
length of vessels with diameters up to 25 .mu.m or more than 25
.mu.m, occupied by SS RBCs, is quantified as follows: % venular
length occupied by SS RBCs=(length of vessel wall with adherent
cells/total length of the vessel segments analyzed).times.100.
Changes in RBC flux are calculated as follows: flux=number of
circulating fluorescent human RBCs crossing a single point marked
on vessels less than 50 .mu.m in diameter per minute.
Example 52: Assessment of Vascular Occlusion--Platelets
[1524] Methods to assess vascular occlusion of platelets using
human vascular endothelial cells (HUVECs) can be adapted from
similar methods for eythroctyes. Briefly, a 2-mL volume of 0.05%
hematocrit suspension is added to confluent HUVECs on tissue
culture Petri dish. The cone-and-plate apparatus is assembled
within 1 min after addition of platelets and placed on a Nikon
Diaphot-TMD inverted-phase contrast microscope (Southern Micro
Instruments, Atlanta, Ga.). The motor is started to turn the cone,
and adherence is continuously monitored at 0.1 or 1 dyne/cm2 shear
stress for 30 min Temperature is maintained constant at 37.degree.
C. by an air curtain incubator (Nicholson Precision Instruments,
Inc., Bethesda, Md.) blowing on the adhesion apparatus. Platelet
adherence is visualized and recorded every 5 min by focusing on 8
different fields of view for 20 sec per field for each time point.
The entire experiment is viewed under 400.times. total
magnification through a CCD-72 series camera (Dage-MTI, Inc.,
Michigan City, Ind.) and recorded on videotape with a SVO 2000
video cassette recorder (Sony Electronics, San Jose, Calif.).
Adherence is quantified off-line at the end of each experiment by
counting individual adherent cells during manual playback of
recorded video images. The cell counts in 8 fields for each time
point are averaged and normalized to adherent red cells per square
millimeter of endothelium.
Example 53: Assessment of Mass/Volume/Density with Resonator
[1525] A dual suspended microchannel resonator (SMR) system is used
to characterize the mass, volume, and density of a population of
terminally-differentiated erythroid cells based on Bryan et al,
LabChip, 2014. At the start of a cell density measurement, the
system is first flushed with filtered Percoll media, which serves
as the high density fluid. Next, the sample bypass is filled with a
dilute cell sample, and the vial heights at the sample inlet and
outlet are adjusted to direct fluid flow into the first SMR.
Pressure at the high density fluid inlet is used to set the density
of Fluid 2, and pressure at the waste outlet controls the overall
flow speed in the device. To minimize the likelihood of size
biasing due to heavier cells settling at the bottom of the sample
vial or tubing, a fresh sample is introduced at regular intervals
by flushing the sample bypass channel Data is acquired via LabVIEW
and processed with MATLAB.
[1526] Cell concentration is monitored using a Coulter counter.
Cell measurements are performed on cultures grown to
5.times.10{circumflex over ( )}5-1.times.10{circumflex over ( )}6
cells/ml. High density fluid introduced for measurement in the
second SMR is formulated as a solution of 50% (v/v) Percoll
(Sigma), 1.38% (w/v) powdered L15 media (Sigma), 0.4% (w/v)
glucose, 100 IU penicillin, and 100 .mu.g mL-1 streptomycin. Media
pH is adjusted to 7.2. This Percoll media is stored at 4.degree. C.
and filtered immediately prior to use in the dual SMR.
Example 54: Assessment of Phosphatidyl Serine Content by Annexin
V
[1527] Erythroid cells are cultured as described herein. 50 .mu.L
cell suspension is washed in Ringer solution containing 5 mM
CaCl.sub.2 and then stained with Annexin-V-FITC (1:200 dilution;
ImmunoTools, Friesoythe, Germany) in this solution at 37.degree. C.
for 20 mM under protection from light. Cells are washed and stained
by flow cytometry as described herein, and annexin-V fluorescence
intensity is measured with an excitation wavelength of 488 nm and
an emission wavelength of 530 nm. Relative phosphatidyl serine
exposure is assessed from annexin-V fluorescence.
Example 55: Assessment of Lipid Content by Chromatography
[1528] Lipids are extracted from washed synthetic membrane-receiver
complexes by three extractions with methanol-chloroform 1:1 at room
temperature in the presence of the antioxidant BHT (Sigma Aldrich).
The pooled extracts are washed with 0.05 M KCl in the method of
Folch, Lees and Sloane Stanley 1957, J Biol Chem 226:497. Briefly,
for the first extraction, 15 mL methanol containing 0.05 mg/mL BHT
are added to the washed complexes in a centrifuge tube and allowed
to stand for 30 min with occasional stirring to break up sediment.
15 mL of chloroform is then added and the mixture is allowed to
stand for 30 min with occasional stirring to break up clumps. The
tubes are centrifuged for 5 minutes at 1500 g and the supernatant
fractions decanted into separatory funnels fitted with Teflon
stopcocks. The second and third extractions are performed similarly
with 15 mL of the methanol-BHT added to the residue followed by 15
mL of chloroform, except the extracts stand for only 10 minutes
with occasional stirring after each addition. After centrifugation,
the supernatant fractions are pooled in a separatory funnel then 48
mL of chloroform and 28 mL of 0.05 M KCl are added and mixed. The
mixture is allowed to stand overnight in darkness at 4 C for phase
separation. After being rewarmed to room temperature, the lower of
the two clear phases is collected and evaporated to dryness in
vacuo at 40 C in a rotary vacuum evaporator. The lipid is
transferred quantitatively to a 10 mL volumetric flask with
chloroform and stored at -22 C.
[1529] The concentration of free cholesterol in the lipid extract
is determined as follows. The lipid extract is chromatographed on a
0.5 mm layer of Silica Gel HR (Brinkmann Instruments, Inc.,
Westbury, N.Y.) in hexane-diethyl ether-glacial acetic acid
80:20:1, the TLC plate is stained by spraying with
2,7-dichlorofluorescein solution (see below), the free cholesterol
spot is scraped into a conical centrifuge tube and extracted once
with 2.0 ml and three times with 1.0 ml of chloroform, the extract
is evaporated to dryness in vacuo at 40.degree. C. in a rotary
vacuum evaporator, and the cholesterol is estimated by the ferric
chloride method of Mann 1961 Clin Chem 7:275 without
saponification. A free cholesterol standard, prepared from a
commercial certified reagent grade material by isolation through
the dibromide derivative (see e.g., Fieser J Amer Chem Soc 1953
75:5421), is taken through the chromatographic procedure and
estimated with each set of determinations. The values for free
cholesterol are corrected in each determination for the recovery of
the standard, which averaged 95%. The TLC is necessary to remove
the BHT, which otherwise interferes with the ferric chloride method
by producing a brown product that absorbed at 560 nm.
[1530] The phospholipid distribution is determined in triplicate by
TLC of aliquots of the total lipid extract at 4.degree. C. on
Silica Gel HR, 0.5 mm thick, in chloroform methanol-glacial acetic
acid-water 25:15:4:2 to which is added BHT at a concentration of 50
mg/100 ml to prevent autoxidation during chromatography; the TLC
plates are prepared with water ("neutral" plates). Use of a
"wedged-tip technique" for applying the lipid sample at the origin
of the plate (see e.g., Stahl 1965 Thin-Layer Chromatography,
Academic Press Inc.) results in excellent separations of the
individual phospholipids. In particular, the method provides
complete separation between phosphatidyl ethanolamine (PE),
phosphatidyl serine (PS), lecithin, and sphingomyelin; a discrete
spot migrates between PS and lecithin that is identified as
phosphatidyl inositol (PI). The spots are made visible in UV light
by spraying with a solution of 2,7-dichlorofluorescein (33.3 mg/100
ml of aqueous 2 mM NaOH) and then scraping directly into
Kramer-Gittleman tubes, where the phospholipids are digested at
190.degree. C. for 60 mM with 1.0 ml of 70% perchloric acid. The
remainder of the procedure is performed as described above, except
that after color development, the silica gel is removed by
centrifugation at 3000 g for 5 min and the absorbancy is determined
on the clear supernatant solution. Corrections are made for the
absorbancy of corresponding areas of blank lanes.
[1531] Gas-liquid chromatography is performed on hexane-dissolved
samples with a Barber-Colman instrument, model 5000, equipped with
paired 8-ft columns of EGSS-X (an ethylene glycol succinate
polyester combined with a silicone) 8% on Gas-Chrom P, 100-120 mesh
(Applied Science Laboratories Inc.) and dual flame ionization
detectors. The nitrogen flow rate is 50 ml/min at the inlet. The
column temperature is maintained at 1650 C for 10 min after
injection of the sample, then increased at 2 C/min to 200.degree.
C.
Example 56: Assessment of Membrane Viscosity
[1532] The membrane viscosity of a population of cells can be
assessed by fluorescence photobleaching assay. A 0.5-ml sample of
erythroid cells is collected and washed once in HEPES-buffered
saline (132 mM NaCl, 4.7 mM KCl, 2.0 mM CaCl2, 1.2 mM MgSO4, 20 mM
HEPES, adjusted to pH 7.4). The packed cells are then washed once
in 145 mM NaCl-10 mM NaHCO.sub.3, pH 9.5, and resuspended in the
same buffer with 1 mg/ml DTAF (obtained from Research Organics,
Cleveland, Ohio). The cells are incubated on ice for 1 h, then
washed twice in 50 mM glycine-95 mM NaCl-10 mM NaHCO.sub.3, pH 9.5,
to remove any dye that has not bound covalently to protein.
Finally, the cells are washed twice and resuspended to -2%
hematocrit in HEPES-buffered saline with 1 mg/ml bovine serum
albumin. The same treatment is applied to control native
erythrocytes.
[1533] The flow chamber is mounted on the stage of a Leitz Diavert
(Rockleigh, N.J.) inverted microscope equipped for incident-light
fluorescence microscopy. The dichroic mirror and
excitation/emission filters are the standard combination for use
with fluorescein dyes (Leitz designation 12), with excitation
wavelength in the range 450-490 nm. The objective is an oil
immersion type with 100.times. magnification and 1.25 numerical
aperture. A 100 watt high pressure mercury arc lamp (Osram, Munich)
with an appropriate power supply and housing (Oriel, Stamford,
Conn.) serves as the fluorescence excitation source.
[1534] A computer-controlled electronic shutter (Vincent
Associates, Rochester, N.Y.) limits the exposure duration and is
synchronized with a photon-counting electronic system for measuring
fluorescence intensity. The field diaphragm of the incident light
illuminator is used to limit excitation to a circular area of
diameter 20-40 um. At regular intervals, an output pulse from the
computer causes the shutter to open for a typical duration of 20
ms. Light from the brief fluorescent image is split with a series
of prisms so that half the light is directed to a low-light-level
SIT video camera (Model 66-SIT, Dage-MTI, Michigan City, Ind.) and
half to a photomultiplier tube (Model 8850, RCA, Harrison, N.J.)
enclosed in an ambient temperature housing. During the time that
the electronic shutter is open, a video image processor (Model 794,
Hughes Aircraft, Carlsbad, Calif.) is triggered to acquire the
fluorescent image, providing a video snapshot that can be monitored
to ensure that the subject remains in focus and that no foreign
object intrudes into the field of view. Distances on the video
screen are measured with a video caliper and calibrated by
comparison with the video image of a stage micrometer. Also during
the time the shutter is open, the photomultiplier signal is
processed with the photon-counting technique. An
amplifier/discriminator (Model AD6, Pacific Instruments, Concord,
Calif.) generates a digital logic pulse for each signal pulse above
a given magnitude, and those digital pulses are counted on a
100-MHz gated counter (Model 770, EG&G Ortec, Oak Ridge,
Tenn.). The microcomputer controls the gating, resetting, and
recording of the photon count.
[1535] A typical experiment consists of a number of preliminary
fluorescence measurements made during brief (20 ms) pulses of
excitation light, followed by an extended period of illumination
(typically 30 s) during which the samples cells are bleached,
followed by another series of brief exposures, every 15-30 s, until
the fluorescence appears to have completed its recovery.
[1536] The recovery time and other parameter values obtained for
cultured erythroid cells are compared to the same values obtained
for primary erythroid cells.
Example 57: Assessment of Mean Corpuscular Volume with Advia
Hematology Analyzer
[1537] The Mean corpuscular volume (MCV) of the cultured erythroid
cells is measured using electrical impedance in an Advia 120
hematology analyzer (Siemens Healthcare). The results are compared
to that of natural human erythrocytes.
Example 58: Pathogen Testing of Cultured Erythroid Cells
[1538] RT-PCR is used to quantify adventitious virus presence in
cultured erythroid cell populations and confirm non-contamination
(Assay No. 003000.BSV, BioReliance). Sterility testing of
unprocessed and final bulk, final vials, prebanking cells, and cell
and virus banks is performed by directly inoculating the erythroid
population into 2 different types of media that support the growth
of aerobic and anaerobic bacteria respectively. Samples are
incubated for 14 days followed by testing for microbial
contaminants per BioReliance Sterility Testing protocol USP 71.
Example 59: Assessment of Osmotic Fragility
[1539] Osmotic fragility is evaluated to measure the resistance of
the erythroid cells to lysis when exposed to hypotonic solutions.
Solutions of NaCl in water were made at concentrations spanning 0%
to 1%. Cells were incubated in each of the salt solutions for 15
minutes. The samples were centrifuged to pellet intact cells.
Supernatant was assayed for hemoglobin content by absorption of
light at 540 nm using a spectrophotometer. The point at which 50%
hemolysis occurs is calculated and compared to the value obtained
for primary erythrocytes.
Example 60: Assessment of Rosetting/Immunogenicity
[1540] The direct antiglobulin test, also known as Coombs test,
assesses the agglutination or resetting of erythroid cells caused
by the binding of polyclonal antibodies from serum to surface
antigens on the cell. It can be performed with pooled human serum
for general allogeneic immunogenicity assessment, or with serum
from the intended recipient for specific immunogenicity
prediction.
[1541] In brief, add 1-2 drops of cells stored in an EDTA tube to a
reaction tube. Wash this tube three times with isotonic saline.
After the third wash, prepare a 3% suspension from the washed
cells. Label 2 tubes A and B. Add one drop of the washed 3%
suspension to each tube. Wash these tubes one more time. When
decanting, position the tubes so that the cell button is on top.
This will prevent too many cells from being lost in the washing
process. Drain well, and blot dry with a biowipe Immediately add
one drop human test serum to both tubes, and shake to mix. Allow
the B tube to incubate at room temperature 5 minutes. Centrifuge
the A tube for the time calibrated for the Coombs spin on the
serofuge. Immediately resuspend gently and examine for
agglutination using the lighted agglutination viewer (Beckton
Dickinson). If the A tube is positive, it is not necessary to read
the B tube nor is it necessary to examine the A tube
microscopically. If the A tube is negative by lighted agglutination
viewer, examine for agglutination under the microscope. If the A
tube was negative through the microscopic reading, centrifuge the B
tube after its incubation period and repeat steps 2-4 with the B
tube sample. If the B tube is negative as well, add one drop of
IgG-coated Coombs Control Cells (Check Cells) to the tube and
centrifuge. Examine for agglutination. Agglutination should be
present in this step, or the test is invalid.
[1542] If there is no agglutination in any of the steps before
addition of the check cells (ccc), the test is interpreted as
negative. If agglutination is observed in any of the steps before
addition of the check cells, the test is interpreted as
positive.
Example 61: Assessment of Oxygen-Binding Capacity
[1543] Equilibrium oxygen binding curves at 37.degree. C. are
determined in a tonometer linked to a 1-cm path length cuvette.
Spectral measurements are performed with a spectrophotometer (Cary
50; Variant Inc), and the temperature is controlled with a Peltier
module. Analyses are performed in 50 mM bis-Tris buffer (pH 7.2)
containing 140 mM NaCl and 2 mM glucose. After thorough
deoxygenation under nitrogen, the red cell suspensions are
equilibrated at different partial pressures of oxygen by injection
of known volumes of pure oxygen into the tonometer through a rubber
cap with a Hamilton syringe. The fractional saturation is estimated
by simulation of the absorption spectra in the visible and Soret
regions as a linear combination of the fully deoxygenated and
oxygenated spectra of the RBC suspension by least squares
regression.
Example 62: Assessment of Metabolic State of Cells
[1544] The erythroid cell population may be verified as
metabolically active using a variety of different enzyme based
assays to quantify important metabolic end products. Active
glycolysis is a crucial metabolic pathway to assess and may be
measured with the following assay (Glycolysis cell-based assay kit,
Cayman Chemical, Item 600450).
[1545] 450 ul of assay buffer is aliquoted into a test tube,
followed by 50 uL of the L-Lactic acid standard and mixed
thoroughly. A titration curve is constructed using the lactic acid
concentration standard, beginning with a 1 mM dilution.
[1546] Cells are added to a 96 well plate and centrifuged at 1000
RPM for 5 minutes. 100 uL of the standards are transferred into a
separate 96 well plate. 90 uL of assay buffer is then added to each
well. 10 ul of supernatant in each cell well is then transferred to
corresponding new wells. Add 100 ul of reaction solution to each
well using a repeating pipettor. The plates are then incubated on
an orbital shaker for 30 minutes at RT. The absorbance is read at
490 nm with a plate reader. Results are compared to natural cells
to identify any metabolic differences.
Example 63: Assessment of Platelet Aggregation
[1547] Aggregation propensity of cultured or primary sourced
platelets can be monitored. Platelets are submitted to swirling
analysis by shaking them in front of a light source, with the
results expressed as presence or absence of birefringence. The
units of platelet concentrates produced with a volume of 50-70 mL
are left to rest for one hour and placed in a linear shaker
(C-Mar.RTM.) at 70 rpm at a controlled temperature of
22.+-.2.degree. C. (71.6.+-.3.6.degree. F.).
[1548] The tests of platelets concentrates (platelet count,
platelet aggregation and pH) are carried out on days 1, 3 and 5
after processing; a leukocyte count is performed only on day 1 and
the microbiological control is performed only on the 5th day of
storage. In order to obtain aliquots from samples of platelet
concentrates, a sterile connection (Haemonetics.RTM.) is used which
ensured the integrity of the environment. Platelet aggregation is
achieved using the turbidimetric aggregometry technique using a
dual-channel Chronolog (Crono-Log Corporation.RTM.) within four
hours of blood collection. For this, the cells are initially
obtained through light centrifugation at 1000 rpm for five minutes,
and then centrifuged at 3000 rpm for fifteen minutes
(Eppendorf.RTM.). Samples are subjected to a platelet count in an
automatic counter (Human Count.RTM.).
[1549] After adjusting the platelet concentration, aggregation is
evaluated using different concentrations of inducing agonists:
collagen 2.0 .mu.g/mL and ADP 7.0 .mu.g/mL (Crono-Log
Corporation.RTM.). For each test, 400 .mu.L of PRP and 400 .mu.L of
PPP are used, each one in a different cuvette after waiting for
spontaneous aggregation. The aggregation curve is observed after
five minutes of stimulation by inducing agonists, and soon after,
aggregation is measured and expressed as a percentage according to
the curves formed during the tests. The result of the test is
commonly expressed as a percentage of aggregation by the quantity
of light transmitted through the test solution; aggregation is
classified as normal, low or high.
Example 64: Autologous Culture Process
[1550] The culture of erythroid cells using autologously sourced
progenitor CD34+ cells is done to optimize cell immunocompatibility
for patients. CD34+ cells from the bone marrow are mobilized to the
periphery in a patient using GM-CSF as described herein. Between
10{circumflex over ( )}6-10{circumflex over ( )}8 CD34+ cells are
collected and cultured using the aforementioned 22 day protocol
using defined media. During Day 4 the cells are transfected with a
lentiviral vector containing a gene that codes for the expression
of a therapeutic agent. Upon completion of the culturing protocol,
the cells are purified and assessed across several quality control
metrics including physical properties that correlate with
circulation viability, immunogenicity, replicative potential,
purity, and therapeutic dose. The cells are then stored in
appropriate stabilizing solution and formulated in a syringe or
appropriate delivery vehicle. The cells are then infused into the
same patient that donated the initial CD34+ cells.
Example 65: Autologous Loading Process
[1551] For the preparation of therapeutic erythroid cells loaded
with a suitable receiver, autologously sourced erythrocytes can be
used to optimize cell immunocompatibility for patients. Blood is
drawn from the patient and centrifuged at 5000 g for 20 minutes.
The buffy coat is removed and the remaining red cells are
re-suspended in anticoagulant buffer at a density of 10{circumflex
over ( )}8 cells/ml, giving a total of 10{circumflex over ( )}10
cells. The cells are loaded with a therapeutic receiver of interest
by one of the methods described above. Upon completion of the
loading protocol, the cells are purified and assessed across
several quality control metrics including physical properties that
correlate with circulation viability, immunogenicity, replicative
potential, purity, and therapeutic dose. The cells are then stored
in appropriate stabilizing solution and formulated in a syringe or
appropriate delivery vehicle. The cells are infused into the same
patient that donated the initial erythrocytes.
Example 66: Allogeneic Culture Process
[1552] To create a scalable, universal therapeutic, etyrhoid cells
can be cultured from an allogeneic source. The culture of erythroid
cells using allogeneically sourced progenitor CD34+ cells is done
to streamline the process and culture a volume of therapeutic
capable of treating patients at scale. Donors are blood-typed for
major blood antigens, including A, B, Rh to identify universal
donors (e.g., 0 Rh- or Bombay Rh-). CD34+ cells from the bone
marrow are mobilized to the periphery in a suitable donor using
GM-CSF as described herein. Between 10{circumflex over (
)}6-10{circumflex over ( )}8 CD34+ cells are collected and cultured
using the aforementioned 22 day protocol using defined media.
During Day 4 the cells are transfected with a lentiviral vector
containing a gene that codes for the expression of a therapeutic
agent. Upon completion of the culturing protocol, the cells are
purified and assessed across several quality control metrics
including physical properties that correlate with circulation
viability, immunogenicity, replicative potential, purity, and
therapeutic dose. The cells are then stored in appropriate
stabilizing solution and formulated in a syringe or appropriate
delivery vehicle. The cells are then infused into patients
irrespective of their major blood groups.
Example 67: Allogeneic Loading Process
[1553] The culture of erythroid cells using allogeneically sourced
progenitor CD34+ cells is done to streamline the process to prepare
larger volumes of therapeutic cells capable of treating patients at
scale. Donors are blood-typed for major blood antigens, including
A, B, Rh to identify universal donors (e.g., O Rh--or Bombay Rh-).
The cells are loaded with a therapeutic receiver of interest by one
of the methods described above. Upon completion of the loading
protocol, the cells are purified and assessed across several
quality control metrics including physical properties that
correlate with circulation viability, immunogenicity, replicative
potential, purity, and therapeutic dose. The cells are then stored
in appropriate stabilizing solution and formulated in a syringe or
appropriate delivery vehicle. The cells are then infused into
patients irrespective of their major blood groups.
Example 68: Storage
[1554] 1. Storage in Refrigerated Buffer Solution
[1555] Standard protocols for the storage of red blood cells are
known in the art, see e.g., Meryman and Hornblower 1986,
Transfusion 26(6):500. The standard protocol for the storage of red
blood cells (for up to 42 days) is the collection of blood into
anticoagulant solutions (citrate-dextrose-phosphate). Erythroid
cells are cultured as described herein. Red cell concentrates are
prepared by the removal of plasma by centrifugation. The cells are
stored at 4.+-.2.degree. C. in a slightly hypertonic additive
solution, SAGM (sodium, adenine, glucose, mannitol, 376
mOsm/L).
[1556] 2. Storage in Frozen Buffer Solution
[1557] Methods for glycerolization, freezing, and thawing of
erythroid cells are known in the art, see e.g., Meryman and
Hornblower 1977 Transfusion 17(5):4348. Human blood in citrate
phosphate dextrose is glycerolized and frozen within 4 days of
collection. To prepare glycerolized RBCs, approximately 10 mL of
whole blood is first centrifuged at 1,400 g for 10-15 min, and the
plasma is removed. The resulting packed cells are then glycerolized
in two steps using an aqueous glycerol solution with the following
composition: 57.1 g glycerol, 0.03 g potassium chloride, 0.085 g
magnesium chloride hexahydrate, 0.08 g disodium phosphate, and 1.6
g sodium lactate in a total volume of 100 mL, adjusted to a pH of
6.8.42 In the first step, 1.5 mL of this glycerol solution is added
drop-wise to the packed cells with gentle agitation over a period
of 3 min. The mixture is then allowed to equilibrate undisturbed
for at least 5 min In the second glycerolization step, 5 mL of the
glycerol solution is added drop-wise while the mixture is gently
agitated over a 3-min period, yielding a final glycerol composition
of .about.40% w/v. The entire glycerolization process is carried
out at room temperature. The glycerolized RBCs are then divided
into aliquots of 0.6-1.1 mL in cryogenic vials, placed in a
NalgeneVR Cryo "Mr. Frosty" freezing container (Thermo Scientific,
NC), and stored in a -80 C freezer for at least 12 h and up to 10
years. Frozen RBCs are thawed by placing the cryogenic vial in a 37
C water bath for 1 min All glycerolized blood samples are used in
deglycerolization experiments within 2 h of thawing.
[1558] 3. Formulation as Syringe
[1559] The cell population may be intravenously administered via a
syringe. The therapeutic cells are diluted to a density of
10{circumflex over ( )}7 cells/ml using standard saline buffer at
37 C such that 100 ml of volume, or 10{circumflex over ( )}9 cells,
are delivered. The cell solution is loaded into a 150 cc syringe,
20 gauge needle and injected into the patient through the basilic
vein at 5 cc/min. During injection the patient's vitals are
monitored for any immunogenic or clotting reactions.
[1560] 4. Formulation as Bag
[1561] The cell population may be intravenously administered via
syringe connected to a bag and drip chamber (i.e. an IV drip). The
therapeutic cells are diluted to a density of 10{circumflex over (
)}7 cells/ml using standard saline buffer at 37 C such that 100 ml
of volume, or 10{circumflex over ( )}9 cells, are delivered. The
cell solution is loaded into a 1 L plastic bag, connected to a
catheter and allowed to drain via gravity into the patient through
the basilic vein. During infusion the patient's vitals are
monitored for any immunogenic or clotting reactions.
Example 69: CAPS Catastrophic Antiphospholipid Syndrome
[1562] Cells are cultured in the presence of a lentivirus encoding
the exogenous transgene .beta.2-Glycoprotein I (b2GPI) (GenBank:
X53595.1) fused to the N-terminus of glycophorin A such that the
final cell product expresses >1.times.10{circumflex over ( )}5
copies of the b2GPI receiver on the surface per cell. To ensure
that the receiver is functionally expressed, in vitro activity is
assessed by flow cytometry. Briefly, cells are incubated with serum
from patients with Antiphospholipid Syndrome that have previously
tested positive for anti-b2GPI antibodies by ELISA. The cells are
washed and labeled with secondary antibodies to detect human
primary antibodies bound to their surface and analyzed by flow
cytometry for presence of the fluorophore.
[1563] The cultured erythroid cell population that over expresses
beta-2 glycoprotein I is provided as a treatment for
antiphospholipid syndrome in an early phase clinical trial.
[1564] A patient diagnosed as having antiphospholipid
autoantibodies in circulation is intravenously administered single
doses of 10{circumflex over ( )}9-10{circumflex over ( )}11 cells
once a month for 6-12 months. During the course of treatment
patients' thymidine and thymine levels are monitored with daily
blood tests and relevant APS symptoms such as thrombotic events and
bleeding are documented.
[1565] A population of 10{circumflex over ( )}11 erythroid cells
expressing between 10K and 100K copies of Beta-2 glycoprotein 1 per
cell is stored in a transfusion bag with CPDA-1 and glycerol and
stored at -80 C for up to 10 years. Upon treatment, the bag is
thawed, centrifuged, and the cells removed and resuspended in
saline for administration to a patient. Cells are intravenously
administered with a 50 gauge needle at 5 ml/min at 37 C.
Example 70: Goodpasture Disease
[1566] Cells are cultured in the presence of a lentivirus encoding
the non-collagenous C-terminal domain of the exogenous transgene
COL4A3, NC1-COL4A3 (ID: NM_000091.4) fused to the N-terminus of
glycophorin A such that the final cell product expresses
>1.times.10{circumflex over ( )}5 copies of the NC1-COL4A3
receiver on the surface per cell as assessed by flow cytometry. To
ensure that the receiver is functionally expressed, in vitro
activity is assessed by flow cytometry. Briefly, cells are
incubated with serum from patients with Goodpasture Syndrome that
have previously tested positive for anti-NC1-COL4A3 antibodies by
ELISA. The cells are washed and labeled with secondary antibodies
to detect human primary antibodies bound to their surface and
analyzed by flow cytometry for presence of the fluorophore.
Example 71: Membranous GN
[1567] Cells are cultured in the presence of a lentivirus encoding
the 4.sup.th-6.sup.th extracellular domains of the exogenous
transgene phospholipase A2 receptor (PLA2R) (ID: MGC:178179) fused
to the N-terminus of glycophorin A such that the final cell product
expresses >1.times.10{circumflex over ( )}5 copies of the PLA2R
receiver on the surface per cell as assessed by flow cytometry. To
ensure that the receiver is functionally expressed, in vitro
activity is assessed by flow cytometry. Briefly, cells are
incubated with serum from patients with Membranous
Glomerulonephritis (MGN) that have previously tested positive for
anti-PLA2R antibodies by ELISA. The cells are washed and labeled
with secondary antibodies to detect human primary antibodies bound
to their surface and analyzed by flow cytometry for presence of the
fluorophore.
Example 72: IgA Nephropathy
[1568] Cells are cultured in the presence of a lentivirus encoding
the extracellular domain of exogenous transgene complement receptor
1 (CR1) (SEQ ID 2) fused to the N terminus of glycophorin A such
that the final cell product expresses >1.times.10{circumflex
over ( )}5 copies of CR1 ectodomain receiver per cell as assessed
by flow cytometry. To ensure that the receiver is functionally
expressed, the cell is assayed for its ability to bind immune
complexes and transfer those complexes to macrophages.
[1569] Dylight 650-labeled bovine serum albumin (BSA-650) is
incubated with polyclonal rabbit anti-BSA (Abcam) in an excess of
antibody for 30 minutes at room temp to generate complexes. The
complexes are then mixed with human serum at a 1:1 volume ratio for
30 minutes at 37 C to form immune complexes. Control complexes are
either not mixed with human serum or mixed with heat-inactivated
human serum. The complexes are then incubated with cells for 30
minutes at 37 C. Cells are washed and analyzed by flow cytometry
for capture of immune complexes by detecting Dylight 650
fluorescence.
[1570] Cultured U937 monocytes are activated by incubation with 100
nM phorbol myristate acetate (PMA) for 24 hours at 37 C. Cells
coated with immune complexes (see above) are incubated with
activated U937 macrophages for 30 minutes at 37 C. The co-culture
is analyzed by flow cytometry. Macrophages are identified by
FSC/SSC gating. Presence of immune complex on macrophages is
analyzed by detecting Dylight 650 fluorescence in this cell
population.
Example 73: Systemic Lupus Erythematosus
[1571] Cells are cultured in the presence of a lentivirus encoding
the extracellular domain of exogenous transgene complement receptor
1 (CR1) (SEQ ID 2) fused to the N terminus of glycophorin A such
that the final cell product expresses >1.times.10{circumflex
over ( )}5 copies of CR1 ectodomain receiver per cell as assessed
by flow cytometry. To ensure that the receiver is functionally
expressed, the cell is assayed for its ability to bind immune
complexes and transfer those complexes to macrophages.
[1572] Dylight 650-labeled bovine serum albumin (BSA-650) is
incubated with polyclonal rabbit anti-BSA (Abcam) in an excess of
antibody for 30 minutes at room temp to generate complexes. The
complexes are then mixed with human serum at a 1:1 volume ratio for
30 minutes at 37 C to form immune complexes. Control complexes are
either not mixed with human serum or mixed with heat-inactivated
human serum. The complexes are then incubated with cells for 30
minutes at 37 C. Cells are washed and analyzed by flow cytometry
for capture of immune complexes by detecting Dylight 650
fluorescence.
[1573] Cultured U937 monocytes are activated by incubation with 100
nM phorbol myristate acetate (PMA) for 24 hours at 37 C. Cells
coated with immune complexes (see above) are incubated with
activated U937 macrophages for 30 minutes at 37 C. The co-culture
is analyzed by flow cytometry. Macrophages are identified by
FSC/SSC gating. Presence of immune complex on macrophages is
analyzed by detecting Dylight 650 fluorescence in this cell
population.
Example 74: Paroxysmal Nocturnal Hemoglobinuria
[1574] Cells are cultured in the presence of a lentivirus encoding
the exogenous transgene CD59 (NCBI Reference Sequence: NM_203330.2)
with an N-terminal epitope tag such that the final cell product
expresses >1.times.10{circumflex over ( )}5 copies of CD59
receiver per cell as assessed by flow cytometry. To ensure that the
receiver is functionally expressed, the cell is assayed for its
ability to inhibit membrane attack complex on sheep erythrocytes in
co-culture.
[1575] Briefly, fresh sheep erythrocytes in 10% solution of
1.times. veronal buffered saline (VBS) are sensitized with
polyclonal rabbit anti-sheep RBC antibody (haemolysin) for 30
minutes at 30 C. Serial dilutions of cultured cells are added to
sensitized sheep erythrocytes. Human serum is added at serial
dilutions to each well, starting with 1:4 dilution in VBS. Incubate
at 37.degree. C. for 30 minutes, mixing after 15 minutes.
Centrifuge the samples at 1,500 g for 5 minutes to sediment the
RBCs. Transfer 100 ul of supernatant from each tube to a well in a
96 well flat bottom plate. Add 100 ml of distilled water to each
well. Read the absorbance of the samples at 540 nm using a plate
spectrophotometer. % lysis is calculated as OD540 (test)-OD540
(blank)/OD540 (total lysis)-OD540 (blank)*100.
Example 75: Atypical Hemolytic Uremic Syndrome
[1576] Cells are cultured in the presence of a lentivirus encoding
the exogenous transgene CD59 (NCBI Reference Sequence: NM_203330.2)
with an N-terminal epitope tag such that the final cell product
expresses >1.times.10{circumflex over ( )}5 copies of CD59
receiver per cell as assessed by flow cytometry. To ensure that the
receiver is functionally expressed, the cell is assayed for its
ability to inhibit membrane attack complex on sheep erythrocytes in
co-culture.
[1577] Briefly, fresh sheep erythrocytes in 10% solution of
1.times. veronal buffered saline (VBS) are sensitized with
polyclonal rabbit anti-sheep RBC antibody (haemolysin) for 30
minutes at 30 C. Serial dilutions of cultured cells are added to
sensitized sheep erythrocytes. Human serum is added at serial
dilutions to each well, starting with 1:4 dilution in VBS. Incubate
at 37.degree. C. for 30 minutes, mixing after 15 minutes.
Centrifuge the samples at 1,500 g for 5 minutes to sediment the
RBCs. Transfer 100 ul of supernatant from each tube to a well in a
96 well flat bottom plate. Add 100 ml of distilled water to each
well. Read the absorbance of the samples at 540 nm using a plate
spectrophotometer. % lysis is calculated as OD540 (test)-OD540
(blank)/OD540 (total lysis)-OD540 (blank)*100.
Example 76: Age-related Macular Degeneration
[1578] Cells are cultured in the presence of a lentivirus encoding
the exogenous transgene CD59 (NCBI Reference Sequence: NM_203330.2)
with an N-terminal epitope tag such that the final cell product
expresses >1.times.10{circumflex over ( )}5 copies of CD59
receiver per cell as assessed by flow cytometry. To ensure that the
receiver is functionally expressed, the cell is assayed for its
ability to inhibit membrane attack complex on sheep erythrocytes in
co-culture.
[1579] Briefly, fresh sheep erythrocytes in 10% solution of
1.times. veronal buffered saline (VBS) are sensitized with
polyclonal rabbit anti-sheep RBC antibody (haemolysin) for 30
minutes at 30 C. Serial dilutions of cultured cells are added to
sensitized sheep erythrocytes. Human serum is added at serial
dilutions to each well, starting with 1:4 dilution in VBS. Incubate
at 37.degree. C. for 30 minutes, mixing after 15 minutes.
Centrifuge the samples at 1,500 g for 5 minutes to sediment the
RBCs. Transfer 100 ul of supernatant from each tube to a well in a
96 well flat bottom plate. Add 100 ml of distilled water to each
well. Read the absorbance of the samples at 540 nm using a plate
spectrophotometer. % lysis is calculated as OD540 (test)-OD540
(blank)/OD540 (total lysis)-OD540 (blank)*100.
Example 77: B Cell Acute Lymphoblastic Leukemia
[1580] An antibody scFv is generated based on a full-length
anti-CD20 antibody. Splice overlap extension PCR (SOE-PCR) are used
to create fully synthetic anti-CD20 variable (V) genes based on the
V gene sequences of the murine 2B8 (U.S. Pat. No. 5,736,137).
Full-length 2B8 VL and VH genes are then assembled by SOE-PCR to
produce a single chain Fv (scFv) with 18-residue long linker
(Whitlow 218 linker; GSTSGSGKPGSGEGSTKG (SEQ ID NO: 30)) in VL-VH
orientation. Following SOE-PCR which also includes a signal peptide
to the 5'-end (upstream) to enable secretion, the construct is
cloned into pCR.RTM.-2.1-TOPO vector (Invitrogen Corp., Carlsbad,
Calif.) and confirmed by sequencing.
[1581] Cells are cultured in the presence of a lentivirus encoding
the exogenenous anti-CD20 antibody scFv anti-CD20 (Olafsen et al.,
J Nucl Med 2009, 50(9):1500) fused to the N-terminus of glycophorin
A such that the final cell product
expresses>1.times.10{circumflex over ( )}5 copies of anti-CD20
scFv receiver per cell as assessed by flow cytometry. To ensure
that the receiver is functionally expressed, in vitro activity is
assessed by flow cytometry. Briefly, cells are incubated with
soluble CD20 target protein (Abcam) at a range of concentrations.
The target proteins are directly labeled with a fluorophore.
Incubated cells are washed and analyzed by flow cytometry for
presence of the fluorophore.
Example 78: Light Chain Amyloidosis
[1582] Cells are cultured in the presence of a lentivirus encoding
the exogenous transgene Serum Amyloid P (SAP) component (GenBank:
D00097.1) fused to the N terminus of glycophorin A such that the
final cell product expresses >1.times.10{circumflex over ( )}5
copies of SAP receiver per cell as assessed by flow cytometry. To
ensure that the receiver is functionally expressed, in vitro
activity is assessed by flow cytometry. Briefly, cells are
incubated with serum from patients with light chain amyloidosis
that are positive for amyloid plaques by anti-Light Chain ELISA.
Binding of light chain amyloid plaques to the SAP-displaying cells
is detected by secondary labeling with anti-lambda light chain
antibodies (Abcam) that are directly labeled with fluorophore.
Incubated cells are washed and analyzed by flow cytometry for
presence of the fluorophore.
Example 79: Hepatitis B
[1583] Cells are cultured in the presence of a lentivirus encoding
the exogenous transgene antibody scFv against hepatitis B surface
antigen (HBsAg) (SEQ ID No. 1) such that the final cell product
expresses >1.times.10{circumflex over ( )}5 copies of antibody
scFv receiver per cell as assessed by flow cytometry. To ensure
that the receiver is functionally expressed, in vitro activity is
assessed by flow cytometry. Briefly, cells are incubated with
target protein HBsAg (Abcam) that is directly labeled with Dylight
650 fluorophore at a range of concentrations. Incubated cells are
washed and analyzed by flow cytometry for presence of the
fluorophore.
Example 80: ADA-SCID
[1584] Adenosine deaminase activity is monitored in vitro using
HPLC protocol to detect adenosine and inosine levels. Approximately
10{circumflex over ( )}5 erythroid cells expressing an exogenous,
intracellular adenosine deaminase, produced using the
aforementioned transfection protocol, are aliquoted into 1 ml
wells. 1 mM of adenosine is administered to each well and incubated
for 1 hr. The cells are centrifuged and soluble protein is removed
from the supernatant using cold methanol precipitation. The
supernatant samples are then run on an Agilent 1100 HPLC using a
standard inosine and adenosine curve to determine the relative
amounts of nucleoside and intracellular enzymatic activity compared
to natural cells.
[1585] Adenosine deaminase activity is monitored in vivo using HPLC
protocol to detect adenosine and inosine levels. An ADA-SCID mouse
model is treated with clodronate for 3 days prior to cell therapy
administration. 100 ul of 10{circumflex over ( )}8 ADA expressing
human erythroid cells are administered via tail vein injection to
the mouse model and blood samples are taken via a submandibular
bleed at 10 min, 12 h, 24, h, 48 h, 72 h. The samples are analyzed
using HPLC and inosine and adenosine levels are tracked over
time.
[1586] A population of 10{circumflex over ( )}8 cultured erythroid
cells expressing 10K to 100K copies of ADA per cell is administered
via tail vein injection to a cohort of NOD-SCID mice. Prior to
injection adenosine and inosine circulation levels are documented.
Cells are allowed to circulated for 1 week and blood samples are
taken at 10 min, 1 h, 6, h, 12 h, 24, h, 48 h, 96 h, 144 h.
Adenosine and inosine levels are tracked.
[1587] A patient diagnosed with ADA-SCID is confirmed via
genotyping and found to be deficient for ADA activity. Relevant
clinical symptoms used in the diagnosis include lymphocyte count,
adenosine levels, and infection frequency. The patient is
intravenously administered 10{circumflex over ( )}11 erythroid
cells cultured from a blood-type matched donor and expressing
exogenous ADA diluted in 500 ml of saline solution via gravity
drain over the course of 1 hr. The procedure is repeated monthly
for 6 months. Patient lymphocyte counts are tracked using
immunofluorescence analysis of specific CD antigens, adenosine and
inosine levels are monitored using HPLC, and infection rate
recorded over the duration of the treatment. Immunogenic response
to the transfusion is closely monitored.
[1588] The cultured erythroid cell population that over expresses
adenosine deaminase is provided as a treatment for ADA-SCID.
[1589] A patient diagnosed as deficient for adenosine deaminase is
intravenously administered single doses of 10{circumflex over (
)}9-10{circumflex over ( )}11 cells once a month for 6-12 months.
During the course of treatment patients' adenosine and inosine
levels are monitored with daily blood tests and relevant ADA-SCID
symptoms such as lymphocyte counts, infections, and skin rashes are
documented.
[1590] A population of 10{circumflex over ( )}11 erythroid cells
expressing between 10K and 100K copies of ADA per cell is stored in
a transfusion bag with CPDA-1 and glycerol and stored at -80 C for
up to 10 years. Upon treatment, the bag is thawed, centrifuged, and
the cells removed and resuspended in saline for administration to a
patient. Cells are intravenously administered with a 50 gauge
needle at 5 ml/min at 37 C.
Example 81: MNGIE
[1591] Thymidine phosphorylase (TP) activity is monitored in vitro
using HPLC protocol to detect thymidine and thymine levels.
Approximately 10{circumflex over ( )}5 erythroid cells expressing
an exogenous, intracellular thymidine phosphorylase, produced using
the aforementioned transfection protocol, are aliquoted into 1 ml
wells. 1 mM of thymidine is administered to each well and incubated
for 1 hr. The cells are centrifuged and soluble protein is removed
from the supernatant using cold methanol precipitation. The
supernatant samples are then run on an Agilent 1100 HPLC using a
standard thymidine and thymine curve to determine the relative
amounts of nucleoside and intracellular enzymatic activity compared
to natural cells.
[1592] Thymidine phosphorylase activity is monitored in vivo using
HPLC protocol to detect thymidine and thymine levels. A TP
deficient mouse model is treated with clodronate for 3 days prior
to cell therapy administration (Haragushi, Mol. Cell Biol 2002).
100 ul of 10{circumflex over ( )}8 TP expressing erythroid cells
are administered via tail vein injection to the mouse model and
blood samples are taken via a submandibular bleed at 10 min, 12 h,
24, h, 48 h, 72 h. The samples are analyzed using HPLC and
thymidine and thymine levels are tracked over time.
[1593] A patient diagnosed with MNGIE is confirmed via genotyping
and found to be deficient for TYMP. Relevant clinical symptoms used
in the diagnosis include gastrointestinal motility, early satiety,
cachexia, and nausea. The patient is intravenously administered
10{circumflex over ( )}11 erythroid cells cultured from a
blood-type matched donor and expressing exogenous TP diluted in 500
ml of saline solution via gravity drain over the course of 1 hr.
The procedure is repeated monthly for 6 months. The patient's
symptoms are monitored over the duration of the treatment,
including thymidine and thymine levels using HPLC.
[1594] The cultured erythroid cell population that over expresses
thymidine phosphorylase is provided as a treatment for MNGIE.
[1595] A patient diagnosed as deficient for thymidine phosphorylase
is intravenously administered single doses of 10{circumflex over (
)}9-10{circumflex over ( )}11 cells once a month for 6-12 months.
During the course of treatment patients' thymidine and thymine
levels are monitored with daily blood tests and relevant MNGIE
symptoms such as gastrointestinal behavior and cachexia are
documented.
[1596] A population of 10{circumflex over ( )}11 erythroid cells
expressing between 10K and 100K copies of thymidine phosphorylase
per cell is stored in a transfusion bag with CPDA-1 and glycerol
and stored at -80 C for up to 10 years. Upon treatment, the bag is
thawed, centrifuged, and the cells removed and resuspended in
saline for administration to a patient. Cells are intravenously
administered with a 50 gauge needle at 5 ml/min at 37 C.
Example 82: Gaucher Disease
[1597] An in vitro assay is conducted to demonstrate the delivery
of .beta.-glucocerebrosidase (GC) to macrophages using GC-loaded,
or expressing, erythroid cells. Successful delivery is indicative
of potential mechanistic action as a treatment for Gaucher's
disease. Primary cultures of macrophages are prepared using a U937
cell line. Erythroid cells are loaded with GC and CFSE using
transgene expression methods and standard protocol for small
molecule loading, washed with Alsever's solution and added to the
macrophages on coverslips at a ratio of 10:1. Plates are
centrifuged at 2600 g for 5 min and incubated at 37 C for 30 min.
Non-phagocytosed erythroid cells are lysed with hypotonic buffer.
Macrophages are washed with PBS and stained with benzidine and
Giemsa. The macrophages are then analyzed with FACS for
internalized GC and CFSE, as well as accumulated ceramide levels
using a diacylglycerol (DAG) kinase assay.
[1598] Erythroid cells from mice are washed with Alsever's solution
and stained with PKH26 (Sigma Aldrich). Labeled, GC-loaded cells
are injected into mice intraperitoneally. Four days after injection
spleens are prepared for microscopy and 12 micron sections are
visualized using a fluorescent microscope. PKH26 is observed and
quantified. In addition, GC-loaded erythroid cells are administered
and after 7 days circulating macrophage cell levels are quantified
using FACS of respective CD antigens and compared to levels in
control mice. Ceramide levels in the macrophage population are
quantified using the DAG kinase assay.
[1599] A patient is diagnosed with Gaucher's disease according to
characteristic symptoms such as; enlarged liver, anemia,
thrombocytopenia, lung disease, arthritis, and genetic typing that
identifies associated mutant genes. The patient is administered
1{circumflex over (0)} 11 erythroid cells either loaded with or
expressing GC. The cells are diluted in 500 ml of saline solution
and are administered via gravity drain over the course of 1 hr. The
procedure is repeated monthly for 6 months. The patient's symptoms
are monitored over the duration of the treatment, including
macrophage counts, bleeding and thrombotic events, and macrophage
ceramide levels.
Example 83: ALL-Asparaginase
[1600] Asparaginase activity is monitored in vitro using HPLC
protocol to detect L-asparagine and aspartic acid levels.
Approximately 10{circumflex over ( )}5 erythroid cells expressing
an exogenous, intracellular asparaginase, produced using the
standard transfection protocol, are aliquoted into 1 ml wells. 1 mM
of asparagine is administered to each well and incubated for 1 hr.
The cells are centrifuged and soluble protein is removed from the
supernatant using cold methanol precipitation. The supernatant
samples are then run on an Agilent 1100 HPLC using a standard
asparagine and aspartic acid curve to determine the relative
amounts of amino acid and intracellular enzymatic activity compared
to natural cells.
[1601] Asparaginase activity is monitored in vivo using HPLC
protocol to detect asparagine and aspartic acid levels. An acute
lymphocytic leukemia mouse model created via insertion of a mutant
NOTCH1 gene is treated with clodronate for 3 days prior to cell
therapy administration (Haragushi, Mol. Cell Biol 2002). 100 ul of
10{circumflex over ( )}8 asparaginase expressing erythroid cells
are administered via tail vein injection to the mouse model and
blood samples are taken via a submandibular bleed at 10 min, 12 h,
24, h, 48 h, 72 h. The samples are analyzed using HPLC and
asparagine and aspartic acid levels are tracked over time as well
as with T cell proliferation behavior demonstrative of leukemia
progression.
[1602] A patient diagnosed with ALL according to standard symptoms
and somatic mutation analysis, including NOTCH1, RAS/PI3K/AKT
deregulated signaling is intravenously administered 1{circumflex
over (0)} 11 erythroid cells cultured from a blood-type matched
donor. The cells express exogenous, intracellular asparaginase
diluted in 500 ml of saline solution and are administered via
gravity drain over the course of 1 hr. The procedure is repeated
monthly for 6 months. The patient's symptoms are monitored over the
duration of the treatment, including asparagine and aspartic acid
levels using HPLC. Proliferative leukemic cells are quantified
using immunofluorescence of blood samples.
Example 84: Thrombotic Thrombocytopenic Purpura
[1603] An in vitro assay is conducted to demonstrate the activity
of ADAMTS13 expressed on a cultured erythroid cell's membrane. The
ADAMTS13 assay is a FRET-inducible system that relies on a
synthetic 73-amino-acid peptide, FRETS-VWF73. Cleavage of this
substrate between two modified residues relieves the fluorescence
quenching in the intact peptide. Incubation of FRETS-VWF73 with
cultured erythroid cells, compared to native erythrocytes,
demonstrates quantitatively increased fluorescence over time.
Quantitative analysis is achieved within a 1-h period using a
96-well format in commercial plate readers with common filters
(Kokame, Br J Haematol, 2005).
[1604] The mechanistic ability of an ADAMTS13 expressing cultured
erythroid cell is demonstrated using an NSG mouse model that is
administered clodronate for macrophage depletion. Recombinant,
human Von Willebrand factor (VWF) is injected at 10 mM via the tail
vein. 10{circumflex over ( )}8 human erythroid cells expressing
ADAMTS13 is subsequently injected and blood samples are taken at 10
mM, 1 hr, 4 hr, 8 hr, 24 hr. The serum is assayed for VWF cleavage
using gel electrophoresis. Cleavage of the VWF by ADAMTS13 takes
place leading to a reduction in multimer sizes. This reduction is
visualized by agarose gel electrophoresis followed by Western
blotting with a peroxidase-conjugated anti-VWF antibody. The
concentration of ADAMTS13 activity in the test sample is
established by reference to a series of diluted normal plasma
samples.
[1605] A patient is diagnosed with thrombotic thrombocytopenia
purpura according to characteristic symptoms such as;
thrombocytopenia, microangiopathic hemolytic anemia, neurologic
symptoms, kidney failure, and genetic typing that identifies
associated mutant genes. The patient is administered 10'11
erythroid cells expressing ADAMTS13 on the surface. The cells are
diluted in 500 ml of saline solution and are administered via
gravity drain over the course of 1 hr. The procedure is repeated
monthly for 6 months. The patient's symptoms are monitored over the
duration of the treatment, including VWF multimer levels, bleeding,
and thrombotic events.
Example 85: Hemophilia B (FIX)
[1606] An in vitro assay is conducted to demonstrate the activity
of Factor IX (FIX) expressed on a cultured erythroid cell's
membrane. The Factor IXa assay protocol (activated Factor IX,
BIOPHEN Factor IXa, Ref. A221812) is used to provide a quantitative
chromogenic read out of a sample of erythroid cells. FIXa activity
of the erythroid cells is compared to that of both native
erythrocytes and human plasma.
[1607] A mouse model of hemophilia B (Jackson Laboratories,
B6.129P2-F9.sup.tmIDwes/J) is immunosuppressed with
cyclophosphamide and cleared of macrophages with clodronate. The
mouse is then injected with 10{circumflex over ( )}8 human
erythroid cells expressing human FIX on the surface. The mouse is
bled daily for 2 weeks via the tail vein and clotting time is
recorded. Results are compared to a negative control mouse model
and a positive control model that receives a single dose of soluble
FIX.
[1608] A patient is diagnosed with hemophilia B according to
characteristic symptoms such as; spontaneous bleeding,
gastrointestinal tract hemorrhage, bruising, low circulating Factor
IX levels, and genotyping that confirms mutation in the X-linked
gene. The patient is administered 10{circumflex over ( )}11
erythroid cells expressing FIX on the surface. The cells are
diluted in 500 ml of saline solution and are administered via
gravity drain over the course of 1 hr. The procedure is repeated
monthly for 6 months. The patient's symptoms are monitored over the
duration of the treatment, including FIXa levels, spontaneous
bleeding, and thrombotic events.
Example 85: Acute Lymphoblastic Leukemia
[1609] Erythroid cells expressing scFv against the leuekemic
antigen, Wilms' tumor (WT1), are assayed in vitro for rosetting
with primary sourced, WT1 positive, leukemia cells. Cells are
cultivated at 3% hematocrit using McCoy's 5A medium enriched with
20% homologous serum, using the method described by Russell et al.
2011 Blood 118(13):e74. The presence of rosettes is detected and
quantified using a novel Giemsa subvital staining methodology,
modified from techniques applied in van Driessche, Leukemia 2005.
The sampled culture suspension is stained with Giemsa (the final
stain concentration is 5%) for 15 minutes. A small volume of this
suspension (7.5 .mu.l) is used to make a wet mount with 22.times.32
mm (0.17 mm thickness) glass cover slip. The wet mount is examined
immediately with light microscope under oil immersion
magnification. The rosetting rate is determined by examining
erythroid cells in McCoy's 5A medium enriched with 20% homologous
serum.
[1610] An NSG mouse model is treated with clodronate to eliminate
its macrophage population. The mouse is injected with 10{circumflex
over ( )}8 leukemic cells that are positive for WT1. A population
of erythroid cells expressing multiple copies of a scFv against WT1
on its surface is injected shortly thereafter and blood samples are
taken at 10 min, 1 hr, 4 hr, 12 hr, 24 hr, 48 hr time points.
Samples are analyzed using FACS and erythroid-B cell binding is
quantified and compared to that of a positive control erythrocyte
infused mouse.
[1611] A patient diagnosed with acute lymphoblastic leukemia
according to characteristic symptoms such as; fatigue, fever loss
of weight, anemia, abnormal white blood cell count, and positive
bone marrow biopsy. The patient is administered 10{circumflex over
( )}11 erythroid cells expressing anti-WT1 scFv on the surface. The
cells are diluted in 500 ml of saline solution and are administered
via gravity drain over the course of 1 hr. The procedure is
repeated monthly for 6 months. The patient's symptoms are monitored
over the duration of the treatment, including leukemic white blood
cell counts.
[1612] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be readily apparent to one of ordinary
skill in the art in light of the teachings of this invention that
certain changes and modifications can be made thereto without
departing from the spirit or scope of the appended claims.
Tables
TABLE-US-00001 [1613] TABLE 1 Erythroid Polypeptides and
Non-Receiver Polypeptides ABO blood groups Stomatin Peters DAF
Cromer Aquaporin 3 Tropomyosin Rasmussen Gerbich (GYPC) Aubergers
Glucose transporter Reid CD47 Band 3 Adducin REIT Glycophorin A, B,
C Basigin Rabphilin SARA Band 3 (AE3) C41 C1 tetrahydrofolate
Rhesus blood D group GYPB Ss synthase CD44 Vel group Aldolase C4A,
C4B Chido, Rodgers C4 component of complement Cis AB Lan antigen
Tropomodulin HLA Bg HLA class I Diego (Di) At antigen Arginase RHAG
Rh-associated Ammonium transport Colton antigen Jr antigen Creatine
kinase glycoprotein Complement AnWj antigen B-Cam protein Colton
(Co) Water Component 4 channel protein alpha(1,3) Sd antigen Rap1A
ACHE Cartwright (Yt) fucosyltransferase Acetylcholinesterase CR1
Batty Bennett-Goodspeed Glutathione transferase DAF Bilkes P
antigen system Glycophorin C Diego Wright (Wr) Rh blood group
Aquaporin Duffy Box Xg antigen system Erythroblast associated
membrane protein Hh/Bombay antigen Christiansen XK protein CD44 ii
antigen alpha(1,2) Yt/Cartwright antigen Synaptobrevin 2
fucosyltransferase system Indian blood group HJK CD58 Ribonuclease
Kell HOFM Rh ABO glycosyl transferases Kidd JFV AnWj Adhesion CD59
receptor Lewis antigen JONEs Scianna CD44 Lutheran antigen Jensen
Radin MER2 MNS antigen system Katagiri Duodenal cytochrome DOK
Dombrock ADP- B ribosyltransferase Cost group Livesay DARC (Duffy)
SEMA7A JMH Putative adhesion receptor Er group Milne CR1
Knops-McCoy UMOD Sda Tamm- Horsfall protein (uromodulin) Dematin
Oldeide FP Family Anion exchanger channel protein (band 3, AE1)
Indian (In) Annexin Family Tweety Family CTL Family Kidd (Jk) Urea
Bcl-2 Family UT Family DAACS Family transporter FUT3 Lewis (Le)
Bestrophin Family VIC Family DASS family Adenosine deaminase BNip3
Family AAAP Family DMT family OK Oka Neurothelin, CD20 Family
transferrin receptor ENT Family putative adhesion molecule LW
Adhesion receptor CLIC Family c-KIT GPH Family FUT2 Secretor (Se)
Connexin Family Insulin receptors 1 & 2 GUP Family FUT1 Hh
alpha CRAC-C Family Estrogen receptor LCT Family LU Lutheran (Lu)
Ctr Family Dexamethasone MC family Adhesion receptor receptor P1
Glycosyltransferase E-CIC Family JAK2 kinase MET Family XK Kx
Putative ENaC Family ABC family MFS Family neurotransmitter
transporter XG Xg formerly called GIC Family ArsAB family MOP
Family PBDX MIC2 ICC Family F-ATPase Family MTC Family Hemoglobin
Innexin Family IISP Family NCS2 Family Ankyrin IRK-C Family MPT
Family Nramp Family Spectrin LIC Family P-ATPase Family NSS Family
KEL Kell (K, k, Kp, Js) MIP Family AE family OAT Family
Metalloproteinase Torkildsen MIT family APC Family OST Family Rab
35 NSCC2 Family ArsB Family Oxa1 Family Ral A binding protein PCC
Family BASS Family PiT Family Zona pellucida binding Plamolipin
Family CaCA Family PNaS Family protein Lyn B protein PLB Family CCC
Family POT Family KIaa1741 protein PLM Family CDF Family RFC Family
DC38 Presenilin Family CIC Family RND Family* Calciums transporting
RIR-CaC Family CNT Family SSS Family ATPase ACC Family TRIC Family
CPA1 Family STRA6 Family Amt Family TRP-CC Family CPA2 Family SulP
Family ZIP Family HCC Family NIPA Family N-MDE Family ATP-E Family
LPI Family PPI Family Epo receptor dsRNA-T Family MagT1 Family PPI2
Family MgtE Family
TABLE-US-00002 TABLE 2 Erythroid Cells Embryonic stem cells (ESC)
Blastocyte colony-forming cells Cord blood stem cell (CD-SC)
Burst-forming unit erythroid (BFU-E) CD34+ cells
Megakaryocyte-erythroid progenitor (MEP) cell Hematopoietic stem
cells (HSC) Erythroid forming colony unit (CFU-E) Spleen colony
forming unit (CFU-S) Reticulocytes Common myeloid progenitor (CMP)
cells capable Erythrocytes of forming a granulocyte, erythrocyte,
monocyte, or megakaryocyte (CFU-GEMM) Any cell of myeloid lineage
Induced pluripotent stem cells (iPSC) Proerythroblast Mesenchymal
stem cell Polychromatophilic erythrocyte Polychromatic normoblasts
Normoblast Orthochromatic normoblasts
TABLE-US-00003 TABLE 3 Erythroid Promoters Promoter Gene beta
globin promoter beta globin 3' beta-globin enhancer beta globin
beta globin locus control region beta globin GATA-1 promoter GATA-1
GYPA promoter Glycophorin A HK1 promoter Hexokinase
TABLE-US-00004 TABLE 4 Sequences of Complement Receptor 1 4A. CR1
isoform S precursor, Homo sapiens NCBI Reference Sequence No.
NP_000642.3 1 mgassprspe pvgppapglp fccggsllav vvllalpvaw
gqcnapewlp farptnltde 61 fefpigtyln yecrpgysgr pfsiiclkns
vwtgakdrcr rkscrnppdp vngmvhvikg 121 iqfgsqikys ctkgyrligs
ssatciisgd tviwdnetpi cdripcglpp titngdfist 181 nrenfhygsv
vtyrcnpgsg grkvfelvge psiyctsndd qvgiwsgpap qciipnkctp 241
pnvengilvs dnrslfslne vvefrcqpgf vmkgprrvkc qalnkwepel pscsrvcqpp
301 pdvlhaertq rdkdnfspgq evfyscepgy dlrgaasmrc tpqgdwspaa
ptcevkscdd 361 fmgqllngrv lfpvnlqlga kvdfvcdegf qlkgssasyc
vlagmeslwn ssvpvceqif 421 cpsppvipng rhtgkplevf pfgktvnytc
dphpdrgtsf dligestirc tsdpqgngvw 481 sspaprcgil ghcqapdhfl
faklktqtna sdfpigtslk yecrpeyygr pfsitcldnl 541 vwsspkdvck
rkscktppdp vngmvhvitd iqvgsrinys cttghrligh ssaecilsgn 601
aahwstkppi cqripcglpp tiangdfist nrenfhygsv vtyrcnpgsg grkvfelvge
661 psiyctsndd qvgiwsgpap qciipnkctp pnvengilvs dnrslfslne
vvefrcqpgf 721 vmkgprrvkc qalnkwepel pscsrvcqpp pdvlhaertq
rdkdnfspgq evfyscepgy 781 dlrgaasmrc tpqgdwspaa ptcevkscdd
fmgqllngrv lfpvnlqlga kvdfvcdegf 841 qlkgssasyc vlagmeslwn
ssvpvceqif cpsppvipng rhtgkplevf pfgktvnytc 901 dphpdrgtsf
dligestirc tsdpqgngvw sspaprcgil ghcqapdhfl faklktqtna 961
sdfpigtslk yecrpeyygr pfsitcldnl vwsspkdvck rkscktppdp vngmvhvitd
1021 iqvgsrinys cttghrligh ssaecilsgn aahwstkppi cqripcglpp
tiangdfist 1081 nrenfhygsv vtyrcnpgsg grkvfelvge psiyctsndd
qvgiwsgpap qciipnkctp 1141 pnvengilvs dnrslfslne vvefrcqpgf
vmkgprrvkc qalnkwepel pscsrvcqpp 1201 pdvlhaertq rdkdnfspgq
evfyscepgy dlrgaasmrc tpqgdwspaa ptcevkscdd 1261 fmgqllngrv
lfpvnlqlga kvdfvcdegf qlkgssasyc vlagmeslwn ssvpvceqif 1321
cpsppvipng rhtgkplevf pfgkavnytc dphpdrgtsf dligestirc tsdpqgngvw
1381 sspaprcgil ghcqapdhfl faklktqtna sdfpigtslk yecrpeyygr
pfsitcldnl 1441 vwsspkdvck rkscktppdp vngmvhvitd iqvgsrinys
cttghrligh ssaecilsgn 1501 tahwstkppi cqripcglpp tiangdfist
nrenfhygsv vtyrcnlgsr grkvfelvge 1561 psiyctsndd qvgiwsgpap
qciipnkctp pnvengilvs dnrslfslne vvefrcqpgf 1621 vmkgprrvkc
qalnkwepel pscsrvcqpp peilhgehtp shqdnfspgq evfyscepgy 1681
dlrgaaslhc tpqgdwspea prcavkscdd flgqlphgrv lfplnlqlga kvsfvcdegf
1741 rlkgssvshc vlvgmrslwn nsvpvcehif cpnppailng rhtgtpsgdi
pygkeisytc 1801 dphpdrgmtf nligestirc tsdphgngvw sspaprcels
vraghcktpe qfpfasptip 1861 indfefpvgt slnyecrpgy fgkmfsiscl
enlvwssved ncrrkscgpp pepfngmvhi 1921 ntdtqfgstv nyscnegfrl
igspsttclv sgnnvtwdkk apiceiisce ppptisngdf 1981 ysnnrtsfhn
gtvvtyqcht qpdgeqlfel vgersiycts kddqvgvwss ppprcistnk 2041
ctapevenai rvpgnrsfft lteiirfrcq pgfvmvgsht vqcqtngrwg pklphcsrvc
2101 qpppeilhge htlshqdnfs pgqevfysce psydlrgaas ihctpqgdws
peaprctvks 2161 cddflgqlph grvllplnlq lgakvsfvcd egfrlkgrsa
shcvlagmka lwnssvpvce 2221 qifcpnppai lngrhtgtpf gdipygkeis
yacdthpdrg mtfnligess irctsdpqgn 2281 gvwsspaprc elsvpaacph
ppkiqnghyi gghvslylpg mtisyicdpg yllvgkgfif 2341 ctdqgiwsql
dhyckevncs fplfmngisk elemkkvyhy gdyvtlkced gytlegspws 2401
qcqaddrwdp plakctsrth dalivgtlsg tiffilliif lswiilkhrk gnnahenpke
2461 vaihlhsqgg ssvhprtlqt neensrvlp (Seq. ID No. 1) 4B. CR1
isoform F precursor, Homo sapiens NCBI Reference Sequence No.
NP_000564.2 1 mgassprspe pvgppapglp fccggsllav vvllalpvaw
gqcnapewlp farptnltde 61 fefpigtyln yecrpgysgr pfsiiclkns
vwtgakdrcr rkscrnppdp vngmvhvikg 121 iqfgsqikys ctkgyrligs
ssatciisgd tviwdnetpi cdripcglpp titngdfist 181 nrenfhygsv
vtyrcnpgsg grkvfelvge psiyctsndd qvgiwsgpap qciipnkctp 241
pnvengilvs dnrslfslne vvefrcqpgf vmkgprrvkc qalnkwepel pscsrvcqpp
301 pdvlhaertq rdkdnfspgq evfyscepgy dlrgaasmrc tpqgdwspaa
ptcevkscdd 361 fmgqllngrv lfpvnlqlga kvdfvcdegf qlkgssasyc
vlagmeslwn ssvpvceqif 421 cpsppvipng rhtgkplevf pfgktvnytc
dphpdrgtsf dligestirc tsdpqgngvw 481 sspaprcgil ghcqapdhfl
faklktqtna sdfpigtslk yecrpeyygr pfsitcldnl 541 vwsspkdvck
rkscktppdp vngmvhvitd iqvgsrinys cttghrligh ssaecilsgn 601
aahwstkppi cqripcglpp tiangdfist nrenfhygsv vtyrcnpgsg grkvfelvge
661 psiyctsndd qvgiwsgpap qciipnkctp pnvengilvs dnrslfslne
vvefrcqpgf 721 vmkgprrvkc qalnkwepel pscsrvcqpp pdvlhaertq
rdkdnfspgq evfyscepgy 781 dlrgaasmrc tpqgdwspaa ptcevkscdd
fmgqllngrv lfpvnlqlga kvdfvcdegf 841 qlkgssasyc vlagmeslwn
ssvpvceqif cpsppvipng rhtgkplevf pfgkavnytc 901 dphpdrgtsf
dligestirc tsdpqgngvw sspaprcgil ghcqapdhfl faklktqtna 961
sdfpigtslk yecrpeyygr pfsitcldnl vwsspkdvck rkscktppdp vngmvhvitd
1021 iqvgsrinys cttghrligh ssaecilsgn tahwstkppi cqripcglpp
tiangdfist 1081 nrenfhygsv vtyrcnlgsr grkvfelvge psiyctsndd
qvqiwsgpap qciipnkctp 1141 pnvengilvs dnrslfslne vvefrcqpgf
vmkgprrvkc qalnkwepel pscsrvcqpp 1201 peilhgehtp shqdnfspgq
evfyscepgy dlrgaaslhc tpqgdwspea prcavkscdd 1261 flgqlphgrv
lfplnlqlga kvsfvcdegf rlkgssvshc vlvgmrslwn nsvpvcehif 1321
cpnppailng rhtgtpsgdi pygkeisytc dphpdrgmtf nligestirc tsdphgngvw
1381 sspaprcels vraghcktpe qfpfasptip indfefpvgt slnyecrpgy
fgkmfsiscl 1441 enlvwssved ncrrkscgpp pepfngmvhi ntdtqfgstv
nyscnegfrl igspsttclv 1501 sgnnvtwdkk apiceiisce ppptisngdf
ysnnrtsfhn gtvvtyqcht gpdgeqlfel 1561 vgersiycts kddqvgvwss
ppprcistnk ctapevenai rvpgnrsfft lteiirfrcq 1621 pgfvmvgsht
vqcqtngrwg pklphcsrvc qpppeilhge htlshqdnfs pgqevfysce 1681
psydlrgaas lhctpqgdws peaprctvks cddflgqlph grvllplnlq lgakvsfvcd
1741 egfrlkgrsa shcvlagmka lwnssvpvce qifcpnppai lngrhtgtpf
gdipygkeis 1801 yacdthpdrg mtfnligess irctsdpqgn gvwsspaprc
elsvpaacph ppkiqnghyi 1861 gghvslylpg mtisyicdpg yllvgkgfif
ctdqgiwsql dhyckevncs fplfmngisk 1921 elemkkvyhy gdyvtlkced
gytlegspws qcqaddrwdp plakctsrth dalivgtlsg 1981 tiffilliif
lswiilkhrk gnnahenpke vaihlhsqgg ssvhprtlqt neensrvlp (Seq. ID No.
2) 4C. Predicted CR1 isoform X1, Homo sapiens, NCBI Reference
Sequence No. XP_005273121.1 1 mclgrmgass prspepvgpp apglpfccgg
sllavvvlla lpvawgqcna pewlpfarpt 61 nltdefefpi gtylnyecrp
gysgrpfsii clknsvwtga kdrcrrkscr nppdpvngmv 121 hvikgiqfgs
qikysctkgy rligsssatc iisgdtviwd netpicdrip cglpptitng 181
dfistnrenf hygsvvtyrc npgsggrkvf elvgepsiyc tsnddqvgiw sgpapqciip
241 nkctppnven gilvsdnrsl fslnevvefr cqpgfvmkgp rrvkcqalnk
wepelpscsr 301 vcqpppdvlh aertqrdkdn fspgqevfys cepgydlrga
asmrctpqgd wspaaptcev 361 kscddfmgql lngrvlfpvn lqlgakvdfv
cdegfqlkgs sasycvlagm eslwnssvpv 421 ceqifcpspp vipngrhtgk
plevfpfgkt vnytcdphpd rgtsfdlige stirctsdpq 481 gngvwsspap
rcgilghcqa pdhflfaklk tqtnasdfpi gtslkyecrp eyygrpfsit 541
cldnlvwssp kdvckrksck tppdpvngmv hvitdiqvgs rinyscttgh rlighssaec
601 ilsgnaahws tkppicqrip cglpptiang dfistnrenf hygsvvtyrc
npgsggrkvf 661 elvgepsiyc tsnddqvgiw sgpapqciip nkctppnven
gilvsdnrsl fslnevvefr 721 cqpgfvmkgp rrvkcqalnk wepelpscsr
vcqpppdvlh aertqrdkdn fspgqevfys 781 cepgydlrga asmrctpqgd
wspaaptcev kscddfmgql lngrvlfpvn lqlgakvdfv 841 cdegfqlkgs
sasycvlagm eslwnssvpv ceqifcpspp vipngrhtgk plevfpfgkt 901
vnytcdphpd rgtsfdlige stirctsdpq gngvwsspap rcgilghcqa pdhflfaklk
961 tqtnasdfpi gtslkyecrp eyygrpfsit cldnlvwssp kdvckrksck
tppdpvngmv 1021 hvitdiqvgs rinyscttgh rlighssaec ilsgnaahws
tkppicqlcq pppdvlhaer 1081 tqrdkdnfsp gqevfyscep gydlrgaasm
rctpqgdwsp aaptcevksc ddfmgqllng 1141 rvlfpnvlql gakvdfvcde
gfqlkgssas ycvlagmesl wnssvpvceq ifcpsppvip 1201 ngrhtgkple
vfpfgkavny tcdphpdrgt sfdligesti rctsdpqgng vwsspaprcg 1261
ilghcqapdh flfaklktqt nasdfpigts lkyecrpeyy grpfsitcld nlvwsspkdv
1321 ckrkscktpp dpvngmvhvi tdiqvgsrin yscttghrli ghssaecils
gntahwstkp 1381 picqripcgl pptiangdfi stnrenfhyg svvtyrcnlg
srgrkvfelv gepsiyctsn 1441 ddqvgiwsgp apqciipnkc tppnvengil
vsdnrslfsl nevvefrcqp gfvmkgprrv 1501 kcqalnkwep elpscsrvcq
pppeilhgeh tpshqdnfsp gqevfyscep gydlrgaasl 1561 hctpgqdwsp
eaprcavksc ddflgqlphg rvlfplnlql gakvsfvcde gfrlkgssvs 1621
hcvlvgmrsl wnnsvpvceh ifcpnppail ngrhtgtpsg dipygkeisy tcdphpdrgm
1681 tfnligesti rctsdphgng vwsspaprce lsvraghckt peqfpfaspt
ipindfefpv 1741 gtslnyecrp gyfgkmfsis clenlvwssv edncrrkscg
pppepfngmv hintdtqfgs 1801 tvnyscnegf rligspsttc lvsgnnvtwd
kkapiceiis ceppptisng dfysnnrtsf 1861 hngtvvtyqc htgpdgeqlf
elvgersiyc tskddqvgvw ssppprcist nkctapeven 1921 airvpgnrsf
ftlteiirfr cqpgfvmvgs htvqcqtngr wgpklphcsr vcqpppeilh 1981
gehtlshqdn fspgqevfys cepsydlrga aslhctpqgd wspeaprctv kscddflgql
2041 phgrvllpln lqlgakvsfv cdegfrlkgr sashcvlagm kalwnssvpv
ceqifcpnpp 2101 ailngrhtgt pfgdipygke isyacdthpd rgmtfnlige
ssirctsdpq gngvwsspap 2161 rcelsvpaac phppkiqngh yigghvslyl
pgmtisyicd pgyllvgkgf ifctdqgiws 2221 qldhyckevn csfplfmngi
skelemkkvy hygdyvtlkc edgytlegsp wsqcqaddrw 2281 dpplakctsr
thdalivgtl sgtiffilli iflswiilkh rkgnnahenp kevaihlhsq 2341
ggssvhprtl qtneensrvl p (Seq. ID No. 3)
TABLE-US-00005 TABLE 5 Targets General Classes of Targets Microbes
Polypeptides DNA Amino Acids Fungi Toxins RNA Prions Bacteria
Lipids Parasites Cytokines Virus Cells Cellular debris
Complement-associated molecules Complement-Related Targets Immune
complexes C3dg C4a C6 Factor B C3dk C4b C7 Factor D C3e C2 C8
Properdin Bb C4bp C9 C3 membrane attack complex Mannose-Binding
Lectin (MBL) C3a C1q MBL-Associated Serine Protease 1 (MASP1) C3b
C1r MBL-Associated Serine Protease 2 (MASP2) iC3b C1s C5 C3c C4 C5a
Infectious Disease-Related Targets Lipopolysaccharides Cell
invasion Intermedilysin Secreted effector protein protein sptP Zona
occludens toxin Cholera enterotoxin Invasion protein
Seeligeriolysin sipA Actin polymerization protein Cysteine protease
Iota toxin Serine protease RickA component Ia Actin polymerization
protein Cytolethal Ivanolysin Shiga toxin RickA distending toxin
Adenosine monophosphate- Cytolysin LepB Sphingomyelinase protein
transferase vopS adenylate cyclase Cytotoxic Lethal factor
Staphylokinase necrotizing factor Adenylate cyclase ExoY Cytotoxin
Leukotoxin Streptokinase ADP-ribosyltransferase Dermonecrotic
Listeriolysin Streptolysin enzymatic component toxin Aerolysin
Deubiquitinase Microbial Streptopain collagenase Alpha-toxin
Diphtheria toxin Outer membrane Suilysin protein IcsA
autotransporter Alveolysin Enterohemolysin Panton-Valentine
Superantigen Leucocidin F Alveolysin Enterotoxin Perfringolysin
T3SS secreted effector EspF Anthrolysin O Epidermal cell Pertussis
toxin Tetanus toxin differentiation inhibitor Arp2/3
complex-activating Exoenzyme Phospholipase Tir protein rickA Binary
ADP- Exotoxin Plasminogen TolC ribosyltransferase CDT toxin
activator Botulinum neurotoxin G-nucleotide Pneumolysin Toxic shock
syndrome exchange factor toxin C2 toxin, component II Guanine
nucleotide Protective antigen Zink-carboxypeptidase exchange factor
sopE CagA Heat stable Protein kinase Zink-carboxypeptidase
enterotoxin Calmodulin-sensitive IgA-specific serine Pyolysin
Zn-dependent peptidase adenylate cyclase endopeptidase
autotransporter Cell cycle inhibiting factor Inositol phosphate RTX
toxin phosphatase sopB Other Molecular Targets G-CSF IL3 IL10 MIP1a
GM-CSF IL4 IL12 MIP1b M-CSF IL5 IFNa TGFb IL1a IL6 IFNb TNFa IL1b
IL7 IFNg TNFb IL2 IL8 Self-antibodies Non-self antibodies PRP PRPc
PRPsc PRPres Lipid & Cell Targets Circulating tumor cells very
low density triglycerides Fatty acids lipid (VLDL) Metastases high
density chylomicrons Cholesterol lipoprotein Eukaryotic cells low
density apolipoproteins lipoprotein
TABLE-US-00006 TABLE 6 Diseases and Conditions Cancers Acute
Colorectal cancer Macroglobulinemia, Pleuropulmonary lymphoblastic
Waldenstrom Blastoma, leukaemia (ALL) Childhood Acute myeloid
Craniopharyngioma, Male Breast Cancer Pregnancy and leukaemia (AML)
Childhood Breast Cancer Adrenocortical Cutaneous T-Cell Lymphoma
Malignant Fibrous Primary Central Carcinoma Histiocytoma of Bone
Nervous System and Osteosarcoma (CNS) Lymphoma AIDS-Related Ductal
Carcinoma In Situ Melanoma Prostate Cancer Kaposi Sarcoma (DCIS)
AIDS-Related Embryonal Tumors, Merkel Cell Carcinoma Rare cancers
lymphoma Childhood Anal Cancer Endometrial Cancer Mesothelioma
Rectal Cancer Appendix Cancer Ependymoma, Childhood Metastatic
Squamous Renal cell Neck Cancer with carcinoma Occult Primary
Astrocytomas, Epithelial cancer Midline Tract Renal Pelvis and
Childhood Carcinoma Ureter, Transitional Involving NUT Gene Cell
Cancer Atypical Esophageal Cancer Molar pregnancy Retinoblastoma
Teratoid/Rhabdoid Tumor, Childhood Basal Cell
Esthesioneuroblastoma, Mouth and Rhabdomyosarcoma Carcinoma
Childhood oropharyngeal cancer Bile duct cancer Ewing sarcoma
Multiple Endocrine Salivary Gland Neoplasia Syndromes, Cancer
Childhood Bladder cancer Extragonadal Germ Cell Multiple Sarcoma
Tumor Myeloma/Plasma Cell Neoplasm Bone cancer Extrahepatic Bile
Duct Cancer Mycosis Fungoides Secondary cancers Bowel cancer Eye
Cancer Myelodysplastic Sezary Syndrome Syndromes Brain Stem
Gallbladder Cancer Myelodysplastic/ Skin Cancer Glioma,
Myeloproliferative Childhood Neoplasms Brain tumours Gastric cancer
Myeloproliferative Skin cancer (non Disorders, Chronic melanoma)
Breast cancer Gastrointestinal Carcinoid Nasal Cavity and Small
Cell Lung Tumor Paranasal Sinus Cancer Cancer Bronchial Tumors,
Germ Cell Tumor Nasopharyngeal cancer Small Intestine Childhood
Cancer Burkitt Gestational trophoblastic Neuroblastoma Soft Tissue
Sarcoma Lymphoma tumours (GTT) Cancer of Glioma Non-Hodgkin
Squamous Cell unknown primary Lymphoma Carcinoma Cancer spread to
Hairy cell leukaemia Non-Small Cell Lung Squamous Neck bone Cancer
Cancer with Occult Primary, Metastatic Cancer spread to Head and
neck cancer Oesophageal cancer Stomach (Gastric) brain Cancer
Cancer spread to Heart Cancer, Childhood Oral Cancer Stomach cancer
liver Cancer spread to Hepatocellular (Liver) Cancer Oral Cavity
Cancer T-Cell Lymphoma, lung Cutaneous - see Mycosis Fungoides and
Sezary Syndrome Carcinoid Tumor Histiocytosis, Langerhans Cell
Oropharyngeal Cancer Testicular cancer Carcinoma of Hodgkin
Lymphoma Osteosarcoma (Bone Throat Cancer Unknown Primary Cancer)
Cardiac (Heart) Hypopharyngeal Cancer Osteosarcoma and Thymoma and
Tumors, Childhood Malignant Fibrous Thymic Carcinoma Histiocytoma
Central Nervous Intraocular Melanoma Ovarian Cancer Thyroid Cancer
System Atypical Teratoid/Rhabdoid Tumor, Childhood Central Nervous
Islet Cell Tumors, Pancreatic Pancreatic Cancer Transitional Cell
System Embryonal Neuroendocrine Tumors Cancer of the Renal Tumors,
Childhood Pelvis and Ureter Central Nervous Kidney cancer
Pancreatic Unknown primary System, Childhood Neuroendocrine Tumors
cancer (Islet Cell Tumors) Cervical cancer Langerhans Cell
Histiocytosis Papillomatosis, Ureter and Renal Childhood Pelvis,
Transitional Cell Cancer Chordoma, Childhood Laryngeal Cancer
Paraganglioma Urethral Cancer Choriocarcinoma Leukemia Parathyroid
Cancer Uterine Cancer, Endometrial Chronic Lip and Oral Cavity
Cancer Penile Cancer Uterine Sarcoma Lymphocytic Leukemia (CLL)
Chronic myeloid Liver cancer Pharyngeal Cancer Vaginal cancer
leukaemia (CML) Chronic Lobular Carcinoma In Situ Pheochromocytoma
Vulvar Cancer Myeloproliferative (LCIS) Disorders Colon cancer Low
Malignant Potential Pituitary Tumor Waldenstrom Tumor
Macroglobulinemia Lymphoma Lung Cancer Plasma Cell Wilms Tumor
Neoplasm/Multiple Myeloma Complement and Immune Complex-Related
Diseases Age-related ANCA-associated vasculitis Glomerulonephritis
- MYH9-related macular (Includes Pauci-immune) sparse hair -
disease degeneration telangiectasis Atypical Anti-glomerular
basement Goodpasture's sndrome Nail-patella hemolytic uremic
membrane disease syndrome syndrome (Goodpasture's) Autoimmune
Arthus Reaction Granulomatosis with Nail-patella-like hemolytic
anemia polyangiitis (ANCA and renal disease Wegeners) C1 inhibitor
Asthma Guillain-Barre Nephritis deficiency syndrome C1q deficiency
Atypical hemolytic uremic Hemolytic angioedema Non-amyloid syndrome
(HAE) monoclonal immunoglobulin deposition disease C1r deficiency
Autoimmune inner ear disease Henoch-Schonlein Pauci-immune (AIED)
Sensorineural hearing purpura glomerulonephritis loss C1s
deficiency Autoimmune uveitis HIVICK Pediatric systemic lupus
erythematosus C2 deficiency Autosomal dominant Hypersensitivty
Pierson syndrome intermediate Charcot-Marie- vasculitis Tooth
disease type E C3 deficiency Behcet disease Hypocomplementemic
Polyarteritis urticarial vasculitis C4 deficiency Berger (IgA)
Nephropathy Idiopathic membranous polyarteritis nodosa
glomerulonephritis C5 deficiency Buergers disease Idiopathic
nephrotic Polymyalgia syndrome rheumatica C6 deficiency Central
nervous system IgA nephropathy Polymyositis vasculitis (Berger's
disease) C7 deficiency Choroiditis IgA nephropathy/vasculitis
Polymyositis/ (Henoch-Schonlein dermatomyositis purpura) C8
deficiency Chronic demyelinating Immune Poststaphilococcal
polyneuropathy (CIDP) thrombocytopenia glomerulonephritis C9
deficiency Churg-strauss syndrome Immunobullous diseases
Poststeptococcal glomerulonephritis CD55 deficiency Cogan's
syndrome Immunotactoid or Primary fibrillary membranoproliferative
glomerulopathy glomerulonephritis CD59 deficiency Collagen type III
Infection-related Rapidly progressive glomerulopathy
glomerulonephritis glomerulonephritis (Crescentic) Complement
Congenital and infantile Inflammatory Rapidly progressive Factor I
nephrotic syndrome myopathies glomerulonephritis deficiency (RPGN)
Complement Congenital membranous Juvenile Rasmussen factor-H
related nephropathy due to maternal dermatomyositis syndrome
1(CFHR1) anti-neutral endopeptidase deficiency alloimmunization
Complement Cryoglobulinaemia/Cold Juvenile polymyositis Reactive
arthritis factor-H related agglutinin diease 3(CFHR3) deficiency
CR3/CR4 Cryoglobulinemic vasculitis Kawasaki disease Relapsing
defieciency polychondritis (leukocyte adhesion deficiency 1) Factor
B Cutaneous vasculitis Lipoprotein Renal amyloidosis deficiency
glomerulopathy Factor D Demyelinating myopathies Lupus nephritis
Reynolds syndrome deficiency (paraprotein associated) Factor H
Denys-Drash syndrome Lupus nephropathy Rheumatoid arthritis
deficiency Factor I Dermatomyositis May Hegglin anomaly Sarcoidosis
(Nesnier deficiency Boeck Schuamann Disease) Ficolin 3
Dermatomyositis Membranoglomerular Schimke deficiency nephritis
immunoosseous dysplasia MASP2 Diabetic nephropathy
Membranoproliferative Scleroderma deficiency glomerulonephritis MBL
deficiency Drug-induced immune Membranoproliferative Sebastian
syndrome complex vasculitis glomerulonephritis Type I (MPGN Type I)
Non-alcoholic Eosinophilic granulomatosis Membranoproliferative
Secondary steatohepatitis with polyangiitis (Churgg-
glomerulonephritis Type amyloidosis Strauss) II (Dense Deposit
Disease, MPGN Type II) Paroxysmal Epstein Syndrome
Membranoproliferative Severe or recurring nocturnal
glomerulonephritis Type C diff colitis hemoglobinuria III (MPGN
Type III) Properdin Essential mixed Membranouse Sjogren's syndrome
deficency cryoglobulinemia glomerulonephritis Action Familial
Mediterranean fever Menieres disease Staphylococcal or myoclonus -
renal streptococcal sepsis failure syndrome Acute respiratory
Familial renal amyloidosis Microscopic polyangiitis Stiff person
disease syndrome syndrome (ARDS)/Severe acute respiratory syndrome
(SARS) Acute serum Familial steroid-resistant Minimal change
disease Systemic lupus sickness nephrotic syndrome with
erythematosus sensorineural deafness Adult-onset Still Farmer's
lung Mixed connective tissue Systemic sclerosis disease disease
Age-related Fechtner Syndrome Mostly large vessel Takayasu
arteritis macular vasculitis degeneration AL amyloidosis
Fibronectin glomerulopathy mostly mediu m vessel Toxic epidermal
vasculitis necrolysis (Stevens Johnson syndrome) Alport's Fibrosing
alveolitis Mostly small vessel Transplantation/reper- syndrome
vsculitis fusion (solid organ) Alzheimer's Focal segmental
glomerular Muckle-Wells syndrome Vasculitis disease Amyloidosis
(AL, Focal segmental Myasthenia gravis Wegener's AA, MIDD, Other)
glomerulosclerosis granulomatosis Giant cell arteritis Frasier
syndrome Galloway-Mowat syndrome Type 1 diabetes Myasthenia gravis
Graves' disease Pernicious anemia Crohn's disease alopecia areata
thrombocytopenic Primary biliary purpura cirrhosis Ulcerative
colitis autoimmune hepatitis Guillain-Barre Psoriasis syndrome
Inflammatory autoimmune deramtomyositis Autoimmune Rheumatoid
arthritis bowel syndrome myocarditis Multiple sclerosis Juvenile
idiopathic arthritis Autoimmune pemphigus Vitiligo Enzyme
Deficiencies & Vascular Diseases 2,4-dienoyl-CoA Fabry disease
(1:80,000 to Isobutyryl-CoA Peripheral reductase 1:117,000)
dehydrogenase neuropathy deficiency 2-Methyl-3- Familial
hypercholesterolemia Isovaleric acidemia Peroxisomal hydroxy
butyric (1:500) disorders (1:50,000; aciduria e.g., Zellweger
syndrome, neonatal adrenoleukodystrophy, Refsum's disease)
2-methylbutyryl- Familial myocardial Lactase deficiency
Phenylketonuria CoA dehydrogenase infarct/stroke (common)
3-hydroxy-3- Fatty acid oxidation disorders Lesch-Nyhan syndrome
Primary methylglutaryl (1:10,000) hyperoxaluria (HMG) aciduria
3-methylglutaconic Galactokinase deficiency Lipoprotein lipase
Propionic acidemia aciduria deficiency (rare) 3-oxothiolase
Galactose epimerase long-chain 1-3- Recurrent emesis deficiency
hdroxyacyl-CoA (1:100,000) dehydrogenase 4-hydroxybutyric
Galactosemia Lysinuric protein Short-chain acyl- aciduria
intolerance (rare) CoA dehydrogenase 5,10- Galactosemia (1:40,000)
Lysinuric protein Sucrase-isomaltase methylenetetrahydrofolate
intolerance (rare) deficiency (rare) reductase deficiency (common)
5-Oxoprolinuria Gaucher's disease Malonic acidemia Symptoms of
(pyroglutamic pancreatitis aciduria) Abetalipoproteinemia Glutaric
acidemia type I Maple syrup urine Transferase deficient (rare)
disease galactosemia (Galactosemia type 1) Acute Glutaric acidemia
Type II Medium chain acyl-CoA Trifunctional protein Intermittent
dehydrogenase deficiency Porphyria Alkaptonuria Glutathione
Synthetase Medium/short chain L- Tyrosinemia type 1 Deficiency
w/5-oxoprolinuria 3-hydroxy acyl-CoA dehydrogenase Argininemia
Glutathione Synthetase Medum-chain ketoacyl- Tyrosinemia type 2
Deficiency w/o 5- coA thiolase oxoprolinuria argininosuccinate
Glycogenolysis disorders Metachromatic Tyrosinemia type 3 aciduria
(1:20,000) leukodystrophy (1:100,000) Benign Glycogenosis, type I
Metachromatic Upward gaze hyperphenylalaninemia (1:70,000)
leukodystrophy paralysis (1:100,000) beta ketothiolase Hemolytic
anemia due to Methylmalonic acidemia Very long chain deficiency
adenylate kinase deficiency (Cbl C) acyl-CoA dehydrogenase
Biopterin cofactor Hemolytic anemia due to Methylmalonic acidemia
Wilson Disease biosynthesis deficiency in Glucose 6 (Cbl D) defects
phosphate dehydrogenase Biopterin cofactor Hemolytic anemia due to
Methylmalonic acidemia Aicardi-Goutieres regeneration
diphosphoglycerate mutase (vitamin b12 non- Syndrome (may be an
defects deficiency responsive) allelic form of CLE) biotin-
Hemolytic anemia due to Methylmalonic acidemia Cutaneous lupus
unresponsive 3- erythrocyte adenosine w/0 homocystinuria
erythematosus methylcrotonyl- deaminase overproduction CoA
carboxylase deficiency Carbamoyl Hemolytic anemia due to
Methylmalonic aciduria Dermatitis phosphate glucophosphate
isomerase and homocystinuria herpetiformis synthetase deficiency
Carnitine Hemolytic anemia due to Mitochondrial disorders
hemophilia A acylcarnitine glutathione reductase (1:30,000)
translocase deficiency Carnitine Hemolytic anemia due to
Mitochondrial disorders hemophilia B palmitoyltransferase
glyceraldehyde-3-phosphate (1:30,000; e.g., I dehydrogenase
deficiency cytochrome-c oxidase deficiency; MELAS syndrome;
Pearson's syndrome [all rare]) Carnitine Hemolytic anemia due to
Mitochondrial disorders Idiopathic steroid palmitoyltransferase
pyrimidine 5' nucleotidase (1:30,000; e.g., Leigh sensitive
nephrotic II deficiency disease, Kearns-Sayre syndrome (same as
syndrome [rare]) focal segmental glomerulaosclerosis) Carnitine
uptake Hemolytic anemia due to red Mitochondrial disorders Immune
defect cell pyruvate kinase deficiency (1:30,000; e.g.,
thrombocytopenic lipoamide purpura dehydrogenase deficiency [rare])
citrullinemia HHH syndrome (rare) Mitochondrial disorders
Myasthenia gravis type I (1:30,000; e.g., Pearson's syndrome
[rare]) Citrullinemia homocysteinuria Multiple carboxylase
Oligoarticular type II (holocarboxylase juvenile arthritis
synthetase) Congenital Homocystinuria (1:200,000) Multiple
carboxylase Scleroderma disorders of deficiency (e.g.,
glycosylation (rare) holocarboxylase synthetase [rare]) and
biotinidase deficiencies (1:60,000) D-2-
hyperammonemia/ornithinemia/ Muscle Solar urticaria
hydroxyglutaricaciduria citrullinemia (ornithine cramps/spasticity
(maybe protophyria transporter defect) erythema) D-2-
Hyperlipoproteinemia, types I Myoadenylate Thrombotic
hydroxyglutaricaciduria and IV (rare) deaminase deficiency
thrombocytopenic (rare) (1:100,000) purpura Enteropeptidase
Hypermethioninemia due to Niemann-Pick disease, Tubulointerstitial
deficiency (rare) glycine N-methyltransferase type C (rare)
nephritis with deficiency Uveitis/ATIN Ethylmalonic
Hypermethioninemia Nonketotic Von willebrand encephalopathy
encephalopathy due to hyperglycinemia disease adenosine kinase
deficiency Hyperprolinemia Infectious Diseases & agents
Acinetobacter Dengue haemorrhagic fever Infection-induced Sepsis
immune complex vasculitis Arcobacter butzleri Disseminated
infection with Klebsiella Serratia infection - mycobacterium avium
blood infection complex - blood infection Arcobacter cryaerophilus
E. coli Leprosy/Hansen's Staphylococcus Aureus infection - blood
disease infection Arcobacter Enterobacter Malaria Stenotrophomonas
infection - blood maltophilia - blood infection infection
Bacteremia Enterococcus Meningococcus Streptococcal Group A
invasive disease - blood infection Bacterial Glanders - blood
infection Methicillin Resistant Streptococcus endocarditis
Staphylococcus Aureus pneumoniae Campylobacter Gonorrhea
Pseudomonas Streptococcus fetus infection - pyogenes blood
infection Campylobacter Hepatitis Rhodococcus equi -
Trypanosomiasis jejuni infection - blood infection blood infection
Candida Human Immunodeficiency Salmonella Yellow fever Virus
Coagulase-negative Staphylococcus
TABLE-US-00007 TABLE 7 Receivers General Classes of Receivers
Ankyrin repeat proteins Fibronectins Lyases Antibodies Complement
receptors GPI-linked Nanobodies polypeptides Aptamers Cyclic
peptides HEAT repeat proteins Nucleic Acids ARM repeat proteins
DARPins Hydrolases Polypeptides Carbohydrates DNAses Kinases
Single-chain variable fragments (scFv) Cell surface receptors
Enzymes Lipoproteins Tetratricopeptide repeat proteins
Complement-Related Receivers C1 inhibitor C4 binding protein CR3
Factor I C3 Beta chain CD59 CR4 Homologous restriction Receptor
factor C3aR CR1 Decay-accelerating Membrane cofactor factor (DAF)
protein (MCP) C3eR CR2 Factor H PRELP Enzymes triacylglycerol
lipase bile-acid-CoA hydrolase feruloyl esterase phosphatidate
phosphatase (S)-methylmalonyl- bis(2- formyl-CoA hydrolase
phosphatidylglycero- CoA hydrolase ethylhexyl)phthalate phosphatase
esterase [acyl-carrier-protein] bisphosphoglycerate fructose-
phosphatidylinositol phosphodiesterase phosphatase bisphosphatase
deacylase [phosphorylase] Carboxylic-Ester fumarylacetoacetase
phosphodiesterase I phosphatase Hydrolases 1,4-lactonase
carboxymethylenebutenolidase fusarinine-C phosphoglycerate
ornithinesterase phosphatase 11-cis-retinyl-
cellulose-polysulfatase galactolipase phosphoglycolate palmitate
hydrolase phosphatase 1-alkyl-2- cephalosporin-C gluconolactonase
phosphoinositide acetylglycerophospho- deacetylase phospholipase C
choline esterase 2'-hydroxybiphenyl-2- cerebroside-sulfatase
glucose-1- phospholipase A1 sulfinate desulfinase phosphatase
2-pyrone-4,6- cetraxate benzylesterase glucose-6- phospholipase A2
dicarboxylate phosphatase lactonase 3',5'-bisphosphate chlorogenate
hydrolase glutathione phospholipase C nucleotidase thiolesterase
3-hydroxyisobutyryl- chlorophyllase glycerol-1- phospholipase D CoA
hydrolase phosphatase 3'-nucleotidase cholinesterase glycerol-2-
phosphonoacetaldehyde phosphatase hydrolase 3-oxoadipate enol-
choline-sulfatase glycerophosphocholine phosphonoacetate lactonase
phosphodiesterase hydrolase 3-phytase choloyl-CoA hydrolase
Glycosidases, i.e. phosphonopyruvate enzymes that hydrolase
hydrolyse O- and S- glycosyl compounds 4-hydroxybenzoyl-
chondro-4-sulfatase glycosulfatase phosphoprotein CoA thioesterase
phosphatase 4-methyloxaloacetate chondro-6-sulfatase Glycosylases
Phosphoric-diester esterase hydrolases 4-phytase citrate-lyase
deacetylase histidinol-phosphatase Phosphoric-monoester hydrolases
4-pyridoxolactonase cocaine esterase hormone-sensitive
Phosphoric-triester lipase hydrolases 5'-nucleotidase cutinase
Hydrolysing N- phosphoserine glycosyl compounds phosphatase
6-acetylglucose cyclamate Hydrolysing S- poly(3- deacetylase
sulfohydrolase glycosyl compounds hydroxybutyrate) depolymerase 6-
Cysteine endopeptidases hydroxyacylglutathione poly(3-
phosphogluconolactonase hydrolase hydroxyoctanoate) depolymerase
a-amino-acid esterase Cysteine-type hydroxybutyrate-
polyneuridine-aldehyde carboxypeptidases dimer hydrolase esterase
a-Amino-acyl-peptide D-arabinonolactonase hydroxymethylglutaryl-
protein-glutamate hydrolases CoA hydrolase methylesterase
acetoacetyl-CoA deoxylimonate A-ring- iduronate-2-sulfatase
quorum-quenching N- hydrolase lactonase acyl-homoserine lactonase
acetoxybutynylbithiophene dGTPase inositol-phosphate
retinyl-palmitate deacetylase phosphatase esterase acetylajmaline
esterase dihydrocoumarin juvenile-hormone Serine dehyrdatase or
hydrolase esterase serine hydroxymethyl transferase
acetylalkylglycerol Dipeptidases kynureninase Serine endopeptidases
acetylhydrolase acetylcholinesterase Dipeptide hydrolases
L-arabinonolactonase serine- ethanolaminephosphate
phosphodiesterase acetyl-CoA hydrolase Dipeptidyl-peptidases
limonin-D-ring- Serine-type and tripeptidyl- lactonase
carboxypeptidases peptidases acetylesterase Diphosphoric-monoester
lipoprotein lipase S-formylglutathione hydrolases hydrolase
acetylpyruvate disulfoglucosamine-6- L-rhamnono-1,4- sialate
O-acetylesterase hydrolase sulfatase lactonase acetylsalicylate
dodecanoyl-[acyl- lysophospholipase sinapine esterase deacetylase
carrier-protein] hydrolase acetylxylan esterase
Endodeoxyribonucleases mannitol-1- Site specific producing 3'-
phosphatase endodeoxyribonucleases: phosphomonoesters cleavage is
not sequence specific acid phosphatase Endodeoxyribonucleases
Metallocarboxypeptidases Site-specific producing 5'-
endodeoxyribonucleases phosphomonoesters that are specific for
altered bases. Acting on acid Endopeptidases of
Metalloendopeptidases. Site-specific anhydrides to catalyse unknown
catalytic endodeoxyribonucleases: transmembrane mechanism cleavage
is sequence movement of specific substances Acting on acid
Endoribonucleases methylphosphothioglyc- sphingomyelin anhydrides
to facilitate producing 3'- erate phosphatase phosphodiesterase
cellular and subcellular phosphomonoesters movement Acting on GTP
to Endoribonucleases methylumbelliferyl- S-succinylglutathione
facilitate cellular and producing 5'- acetate deacetylase hydrolase
subcellular movement phosphomonoesters Acting on phosphorus-
Endoribonucleases that monoterpene e- steroid-lactonase nitrogen
bonds are active with either lactone hydrolase ribo- or
deoxyribonucleic acids and produce 3'- phosphomonoesters Acting on
sulfur- Endoribonucleases that N- sterol esterase nitrogen bonds
are active with either acetylgalactosamine- ribo- or 4-sulfatase
deoxyribonucleic acids and produce 5'- phosphomonoesters
actinomycin lactonase Enzymes acting on acid N- steryl-sulfatase
anhydrides acetylgalactosamine- 6-sulfatase acylcarnitine hydrolase
Enzymes Acting on N- succinyl-CoA carbon-carbon bonds
acetylgalactosaminoglycan hydrolase deacetylase acyl-CoA hydrolase
Enzymes acting on N-acetylglucosamine- sucrose-phosphate
carbon-nitrogen bonds, 6-sulfatase phosphatase other than peptide
bonds acylglycerol lipase Enzymes acting on N-sulfoglucosamine
sugar-phosphatase carbon-phosphorus sulfohydrolase bonds
acyloxyacyl hydrolase Enzymes acting on oleoyl-[acyl-carrier-
Sulfuric-ester carbon-sulfur bonds protein] hydrolase hydrolases
acylpyruvate hydrolase Enzymes Acting on Omega peptidases tannase
ether bonds ADAMTS13 Enzymes acting on orsellinate-depside
Thioester hydrolases halide bonds hydrolase Adenosine deaminase
Enzymes acting on oxaloacetase Thioether and peptide bonds
trialkylsulfonium (peptidases) hydrolases adenylyl-[glutamate-
Enzymes acting on palmitoyl[protein] Threonine ammonia ligase]
phosphorus-nitrogen hydrolase endopeptidases hydrolase bonds
ADP-dependent Enzymes acting on palmitoyl-CoA thymidine
medium-chain-acyl- sulfur-nitrogen bonds hydrolase phosphorylase
CoA hydrolase ADP-dependent short- Enzymes acting on pectinesterase
trehalose-phosphatase chain-acyl-CoA sulfur-sulfur bonds hydrolase
ADP- Ether hydrolases. Peptidyl peptide triacetate-lactonase
phosphoglycerate hydrolases phosphatase alkaline phosphatase
Exodeoxyribonucleases Peptidyl-amino-acid Triphosphoric- producing
5'- hydrolases monoester hydrolases phosphomonoesters
all-trans-retinyl- Exonucleases that are Peptidylamino-acid
trithionate hydrolase palmitate hydrolase active with either ribo-
hydrolases or or deoxyribonucleic acylamino-acid acids and produce
3'- hydrolases phosphomonoesters aminoacyl-tRNA Exonucleases that
are Peptidyl-dipeptidases tropinesterase hydrolase active with
either ribo- or deoxyribonucleic acids and produce 5'-
phosphomonoesters Aminopeptidases Exoribonucleases phenylacetyl-CoA
ubiquitin thiolesterase producing 3'- hydrolase phosphomonoesters
arylesterase Exoribonucleases Phenylalanine UDP-sulfoquinovose
producing 5'- ammonia lyase synthase phosphomonoesters.
arylsulfatase Factor IX Phenylalanine uricase hydroxylase
Asparaginase Factor VIII pheophorbidase uronolactonase Aspartic
fatty-acyl-ethyl-ester phloretin hydrolase wax-ester hydrolase
endopeptidases synthase b-diketone hydrolase phorbol-diester
xylono-1,4-lactonase hydrolase
TABLE-US-00008 TABLE 8 Selected Diseases, Receivers and Targets
Category Disease Receiver Target Amyloidoses AA Amyloidosis an an
antibody-like binder to Serum amyloid A serum amyloid A protein or
protein and amyloid serum amyloid P component placques Amyloidoses
beta2 microglobulin an an antibody-like binder to Beta2
microglobulin or amyloidosis beta-2 microglobulin or serum amyloid
placques amyloid P component Amyloidoses Light chain amyloidosis an
an antibody-like binder to Antibody light chain or light chain,
serum amyloid P amyloid placques component Cell Cancer an an
antibody-like binder to a circulating tumor cell clearance CD44
Cell Cancer an an antibody-like binder to a circulating tumor cell
clearance EpCam Cell Cancer an an antibody-like binder to a
circulating tumor cell clearance Her2 Cell Cancer an an
antibody-like binder to a circulating tumor cell clearance EGFR
Cell Cancer (B cell) an an antibody-like binder to a cancerous B
cell clearance CD20 Cell Cancer (B cell) an an antibody-like binder
to a cancerous B cell clearance CD19 Clearance Antiphospholipid
beta2-glycoprotein-1 pathogenic self- Ab syndrome antibody against
beta2- glycoprotein-1 Clearance Catastrophic beta2-glycoprotein-1
pathogenic self- Ab antiphospholipid antibody against beta2-
syndrome glycoprotein-1 Clearance Cold agglutinin disease I/i
antigen Pathogenic self- Ab antibody against I/i antigen Clearance
Goodpasture syndrome a3 NC1 domain of collagen pathogenic self- Ab
(IV) antibody against a3 NC1 domain of Collagen (IV) Clearance
Immune Platelet Glycoproteins (Ib-IX, pathogenic self- Ab
thrombocytopenia IIb-IIIa, IV, Ia-IIa) antibody against purpura
platelet glycoprotein Clearance Membranous Phospholipase A2
receptor pathogenic self- Ab Nephropathy antibody against
phospholipase A2 receptor Clearance Warm antibody Glycophorin A,
glycophorin B, pathogenic self- Ab hemolytic anemia and/or
glycophorin C, Rh antibody against antigen glycophorins and/or Rh
antigen Complement Age-related macular a suitable complement active
complement degeneration regulatory protein Complement Atypical
hemolytic complement factor H, or a active complement uremic
syndrome suitable complement regulatory protein Complement
Autoimmune hemolytic a suitable complement active complement anemia
regulatory molecule Complement Complement Factor I Complement
factor I, a suitable active complement deficiency complement
regulatory protein Complement Non-alcoholic a suitable complement
active complement steatohepatitis regulatory molecule Complement
Paroxysmal nocturnal a suitable complement active complement
hemoglobinuria regulatory protein Enzyme 3-methylcrotonyl-CoA
3-methylcrotonyl-CoA 3-hydroxyvalerylcarnitine, carboxylase
deficiency carboxylase 3-methylcrotonylglycine (3-MCG) and 3-
hydroxyisovaleric acid (3-HIVA) Enzyme Acute Intermittent
Porphobilinogen deaminase Porphobilinogen Porphyria Enzyme Acute
lymphoblastic Asparaginase Asparagine leukemia Enzyme Acute
lymphocytic Asparaginase Asparagine leukemia, acute myeloid
leukemia Enzyme Acute myeloblastic Asparaginase Asparagine leukemia
Enzyme Adenine adenine Insoluble purine 2,8-
phosphoribosyltransferase phosphoribosyltransferase
dihydroxyadenine deficiency Enzyme Adenosine deaminase Adenosine
deaminase Adenosine deficiency Enzyme Afibrinogenomia FI enzyme
replacement Enzyme Alcohol poisoning Alcohol dehydrogenase/oxidase
Ethanol Enzyme Alexander's disease FVII enzyme replacement Enzyme
Alkaptonuria homogentisate oxidase homogentisate Enzyme Argininemia
Ammonia monooxygenase ammonia Enzyme argininosuccinate Ammonia
monooxygenase ammonia aciduria Enzyme citrullinemia type I Ammonia
monooxygenase ammonia Enzyme Citrullinemia type II Ammonia
monooxygenase ammonia Enzyme Complete LCAT Lecithin-cholesterol
Cholesterol deficiency, Fish-eye acyltransferase (LCAT) disease,
atherosclerosis, hypercholesterolemia Enzyme Cyanide poisoning
Thiosulfate-cyanide Cyanide sulfurtransferase Enzyme Diabetes
Hexokinase, glucokinase Glucose Enzyme Factor II Deficiency FII
enzyme replacement Enzyme Familial hyperarginemia Arginase Arginine
Enzyme Fibrin Stabilizing factor FXIII enzyme replacement Def.
Enzyme Glutaric acidemia type I lysine oxidase 3-hydroxyglutaric
and glutaric acid (C5-DC), lysine Enzyme Gout Uricase Uric Acid
Enzyme Gout - hyperuricemia Uricase Uric acid (Urate crystals)
Enzyme Hageman Def. FXII enzyme replacement Enzyme Hemolytic anemia
due to pyrimidine 5' nucleotidase pyrimidines pyrimidine 5'
nucleotidase deficiency Enzyme Hemophilia A Factor VIII Thrombin
(factor II a) or Factor X Enzyme Hemophilia B Factor IX Factor XIa
or Factor X Enzyme Hemophilia C FXI enzyme replacement Enzyme
Hepatocellular Arginine deiminase Arginine carcinoma, melanoma
Enzyme Homocystinuria Cystathionine B synthase homocysteine Enzyme
hyperammonemia/ Ammonia monooxygenase Ammonia
ornithinemia/citrullinemia (ornithine transporter defect) Enzyme
Isovaleric acidemia Leucine metabolizing enzyme leucine Enzyme Lead
poisoning d-aminolevulinate lead dehydrogenase Enzyme Lesch-Nyhan
syndrome Uricase Uric acid Enzyme Maple syrup urine Leucine
metabolizing enzyme Leucine disease Enzyme Methylmalonic acidemia
methylmalonyl-CoA mutase methylmalonate (vitamin b12 non-
responsive) Enzyme Mitochondrial thymidine phosphorylase thymidine
neurogastrointestinal encephalomyopathy Enzyme Mitochondrial
Thymidine phosphorylase Thymidine neurogastrointestinal
encephalomyopathy (MNGIE) Enzyme Owren's disease FV enzyme
replacement Enzyme p53-null solid tumor Serine dehyrdatase or
serine serine hydroxymethyl transferase Enzyme Pancreatic
Asparaginase asparagine adenocarcinoma Enzyme Phenylketonuria
Phenylalanine hydroxylase, Phenylalanine phenylalanine ammonia
lyase Enzyme Primary hyperoxaluria Oxalate oxidase Oxalate Enzyme
Propionic acidemia Propionate conversion enzyme? Proprionyl coA
Enzyme Purine nucleoside Purine nucleoside Inosine, dGTP
phosphorylase deficiency phosphorylase Enzyme Stuart-Power Def. FX
enzyme replacement Enzyme Thrombotic ADAMTS13 ultra-large von
Thrombocytopenic willebrand factor Purpura (ULVWF) Enzyme
Transferase deficient galactose dehydrogenase Galactose-1-phosphate
galactosemia (Galactosemia type 1) Enzyme Tyrosinemia type 1
tyrosine phenol-lyase tyrosine Enzyme von Willebrand disease vWF
enzyme replacement IC clearance IgA Nephropathy Complement receptor
1 Immune complexes IC clearance Lupus nephritis Complement receptor
1 immune complex IC clearance Systemic lupus Complement receptor 1
immune complex erythematosus Infectious Anthrax (B. anthracis) an
an antibody-like binder to B. anthracis infection B. anthracis
surface protein Infectious C. botulinum infection an an
antibody-like binder to C. botulinum C. botulinum surface protein
Infectious C. difficile infection an antibody-like binder to C.
difficile C. difficile surface protein Infectious Candida infection
an antibody-like binder to candida candida surface protein
Infectious E. coli infection an antibody-like binder to E. coli E.
coli surface protein Infectious Ebola infection an antibody-like
binder to Ebola Ebola surface protein Infectious Hepatitis B (HBV)
an antibody-like binder to HBV HBV infection surface protein
Infectious Hepatitis C (HCV) an antibody-like binder to HCV HCV
infection surface protein Infectious Human an antibody-like binder
to HIV HIV immunodeficiency virus envelope proteins or CD4 or (HIV)
infection CCR5 or Infectious M. tuberculosis infection an
antibody-like binder to M. tuberculosis M. tuberculosis surface
protein Infectious Malaria (P. falciparum) an antibody-like binder
to P. falciparum infection P. falciparum surface protein Lipid
Hepatic lipase Hepatic lipase (LIPC) Lipoprotein, deficiency,
intermediate density hypercholesterolemia (IDL) Lipid
Hyperalphalipoproteinemia 1 Cholesteryl ester transfer Lipoprotein,
high protein(CETP) density (HDL) Lipid hypercholesterolemia an
antibody-like binder to low- LDL density lipoprotein (LDL), LDL
receptor Lipid hypercholesterolemia an antibody-like binder to
high- HDL density lipoprotein (HDL) or HDL receptor Lipid
lipoprotein lipase lipoprotein lipase chilomicrons and very
deficiency low density lipoproteins (VLDL) Lipid Lipoprotein lipase
lipoprotein lipase (LPL) Lipoprotein, very low deficiency,
disorders of density (VLDL) lipoprotein metabolism Lysosomal
Aspartylglucosaminuria N-Aspartylglucosaminidase glycoproteins
storage (208400) Lysosomal Cerebrotendinous Sterol 27-hydroxylase
lipids, cholesterol, and storage xanthomatosis bile acid
(cholestanol lipidosis; 213700) Lysosomal Ceroid lipofuscinosis
Palmitoyl-protein thioesterase-1 lipopigments storage Adult form
(CLN4, Kufs' disease; 204300) Lysosomal Ceroid lipofuscinosis
Palmitoyl-protein thioesterase-1 lipopigments storage Infantile
form (CLN1, Santavuori-Haltia disease; 256730) Lysosomal Ceroid
lipofuscinosis Lysosomal transmembrane lipopigments storage
Juvenile form (CLN3, CLN3 protein Batten disease, Vogt- Spielmeyer
disease; 204200) Lysosomal Ceroid lipofuscinosis Lysosomal
pepstatin-insensitive lipopigments storage Late infantile form
peptidase (CLN2, Jansky- Bielschowsky disease; 204500) Lysosomal
Ceroid lipofuscinosis Transmembrane CLN8 protein lipopigments
storage Progressive epilepsy with intellectual disability (600143)
Lysosomal Ceroid lipofuscinosis Transmembrane CLN6 protein
lipopigments storage Variant late infantile form (CLN6; 601780)
Lysosomal Ceroid lipofuscinosis Lysosomal transmembrane
lipopigments storage Variant late infantile CLN5 protein form,
Finnish type (CLN5; 256731)
Lysosomal Cholesteryl ester storage lisosomal acid lipase lipids
and cholesterol storage disease (CESD) Lysosomal Congenital
disorders of Phosphomannomutase-2 N-glycosylated protein storage
N-glycosylation CDG Ia (solely neurologic and
neurologic-multivisceral forms; 212065) Lysosomal Congenital
disorders of Mannose (Man) phosphate (P) N-glycosylated protein
storage N-glycosylation CDG Ib isomerase (602579) Lysosomal
Congenital disorders of Dolicho-P-Glc: Man9GlcNAc2- N-glycosylated
protein storage N-glycosylation CDG Ic PP-dolichol
glucosyltransferase (603147) Lysosomal Congenital disorders of
Dolicho-P-Man: N-glycosylated protein storage N-glycosylation CDG
Id Man5GlcNAc2-PP- (601110) dolichol mannosyltransferase Lysosomal
Congenital disorders of Dolichol-P-mannose synthase N-glycosylated
protein storage N-glycosylation CDG Ie (608799) Lysosomal
Congenital disorders of Protein involved in mannose-P-
N-glycosylated protein storage N-glycosylation CDG If dolichol
utilization (609180) Lysosomal Congenital disorders of
Dolichyl-P-mannose: Man-7- N-glycosylated protein storage
N-glycosylation CDG Ig GlcNAc-2-PP-dolichyl-.alpha.-6- (607143)
mannosyltransferase Lysosomal Congenital disorders of
Dolichyl-P-glucose: Glc-1-Man- N-glycosylated protein storage
N-glycosylation CDG Ih 9-GlcNAc-2-PP-dolichyl-.alpha.-3- (608104)
glucosyltransferase Lysosomal Congenital disorders of
.alpha.-1,3-Mannosyltransferase N-glycosylated protein storage
N-glycosylation CDG Ii (607906) Lysosomal Congenital disorders of
Mannosyl-.alpha.-1,6-glycoprotein- N-glycosylated protein storage
N-glycosylation CDG IIa .beta.-1,2-N- (212066)
acetylglucosminyltransferase Lysosomal Congenital disorders of
Glucosidase I N-glycosylated protein storage N-glycosylation CDG
IIb (606056) Lysosomal Congenital disorders of GDP-fucose
transporter-1 N-glycosylated protein storage N-glycosylation CDG
IIc (Rambam-Hasharon syndrome; 266265 Lysosomal Congenital
disorders of .beta.-1,4-Galactosyltransferase N-glycosylated
protein storage N-glycosylation CDG IId (607091) Lysosomal
Congenital disorders of Oligomeric Golgi complex-7 N-glycosylated
protein storage N-glycosylation CDG IIe (608779) Lysosomal
Congenital disorders of UDP-GlcNAc: dolichyl-P N-glycosylated
protein storage N-glycosylation CDG Ij NAcGlc phosphotransferase
(608093) Lysosomal Congenital disorders of
.beta.-1,4-Mannosyltransferase N-glycosylated protein storage
N-glycosylation CDG Ik (608540) Lysosomal Congenital disorders of
.alpha.-1,2-Mannosyltransferase N-glycosylated protein storage
N-glycosylation CDG Il (608776) Lysosomal Congenital disorders of
.alpha.-1,2-Mannosyltransferase N-glycosylated protein storage
N-glycosylation, type I (pre-Golgi glycosylation defects) Lysosomal
Cystinosis Cystinosin (lysosomal cystine Cysteine storage
transporter) Lysosomal Fabry's disease (301500) Trihexosylceramide
.alpha.- globotriaosylceramide storage galactosidase Lysosomal
Farber's disease Ceramidase lipids storage (lipogranulomatosis;
228000) Lysosomal Fucosidosis (230000) .alpha.-L-Fucosidase fucose
and complex storage sugars Lysosomal Galactosialidosis Protective
protein/cathepsin A lysosomal content storage (Goldberg's syndrome,
(PPCA) combined neuraminidase and .beta.-galactosidase deficiency;
256540) Lysosomal Gaucher's disease Glucosylceramide .beta.-
sphingolipids storage glucosidase Lysosomal Glutamyl ribose-5-
ADP-ribose protein hydrolase glutamyl ribose 5- storage phosphate
storage phosphate disease (305920) Lysosomal Glycogen storage
disease alpha glucosidase glycogen storage type 2 (Pompe's disease)
Lysosomal GM1 gangliosidosis, Ganglioside .beta.-galactosidase
acidic lipid material, storage generalized gangliosides Lysosomal
GM2 activator protein GM2 activator protein gangliosides storage
deficiency (Tay-Sachs disease AB variant, GM2A; 272750) Lysosomal
GM2 gangliosidosis Ganglioside .beta.-galactosidase gangliosides
storage Lysosomal Infantile sialic acid Na phosphate cotransporter,
sialic acid storage storage disorder sialin (269920) Lysosomal
Krabbe's disease Galactosylceramide .beta.- sphingolipids storage
(245200) galactosidase Lysosomal Lysosomal acid lipase Lysosomal
acid lipase cholesteryl storage deficiency (278000) esters and
triglycerides Lysosomal Metachromatic Arylsulfatase A sulfatides
storage leukodystrophy (250100) Lysosomal Mucolipidosis ML II (I-
N-Acetylglucosaminyl-1- N-linked glycoproteins storage cell
disease; 252500) phosphotransfeerase catalytic subunit Lysosomal
Mucolipidosis ML III N-acetylglucosaminyl-1- N-linked glycoproteins
storage (pseudo-Hurler's phosphotransfeerase polydystrophy)
Lysosomal Mucolipidosis ML III Catalytic subunit N-linked
glycoproteins storage (pseudo-Hurler's polydystrophy) Type III- A
(252600) Lysosomal Mucolipidosis ML III Substrate-recognition
subunit N-linked glycoproteins storage (pseudo-Hurler's
polydystrophy) Type III- C (252605) Lysosomal Mucopolysaccharidosis
.alpha.-1-Iduronidase glycosaminoglycans storage MPS I H/S (Hurler-
Scheie syndrome; 607015) Lysosomal Mucopolysaccharidosis
.alpha.-1-Iduronidase glycosaminoglycans storage MPS I-H (Hurler's
syndrome; 607014) Lysosomal Mucopolysaccharidosis Iduronate sulfate
sulfatase glycosaminoglycans storage MPS II (Hunter's syndrome;
309900) Lysosomal Mucopolysaccharidosis Heparan-S-sulfate
sulfamidase glycosaminoglycans storage MPS III (Sanfilippo's
syndrome) Type III-A (252900) Lysosomal Mucopolysaccharidosis
N-acetyl-D-glucosaminidase glycosaminoglycans storage MPS III
(Sanfilippo's syndrome) Type III-B (252920) Lysosomal
Mucopolysaccharidosis Acetyl-CoA-glucosaminide N-
glycosaminoglycans storage MPS III (Sanfilippo's acetyltransferase
syndrome) Type III-C (252930) Lysosomal Mucopolysaccharidosis
N-acetyl-glucosaminine-6- glycosaminoglycans storage MPS III
(Sanfilippo's sulfate sulfatase syndrome) Type III-D (252940)
Lysosomal Mucopolysaccharidosis .alpha.-1-Iduronidase
glycosaminoglycans storage MPS I-S (Scheie's syndrome; 607016)
Lysosomal Mucopolysaccharidosis Galactosamine-6-sulfate
glycosaminoglycans storage MPS IV (Morquio's sulfatase syndrome)
Type IV-A (253000) Lysosomal Mucopolysaccharidosis
.beta.-Galactosidase glycosaminoglycans storage MPS IV (Morquio's
syndrome) Type IV-B (253010) Lysosomal Mucopolysaccharidosis
Hyaluronidase deficiency glycosaminoglycans storage MPS IX
(hyaluronidase deficiency; 601492) Lysosomal Mucopolysaccharidosis
N-Acetyl galactosamine .alpha.-4- glycosaminoglycans storage MPS VI
(Maroteaux- sulfate sulfatase (arylsulfatase Lamy syndrome; B)
253200) Lysosomal Mucopolysaccharidosis .beta.-Glucuronidase
glycosaminoglycans storage MPS VII (Sly's syndrome; 253220)
Lysosomal Mucosulfatidosis Sulfatase-modifying factor-1 sulfatides
storage (multiple sulfatase deficiency; 272200) Lysosomal
Niemann-Pick disease Sphingomyelinase sphingomyelin storage type A
Lysosomal Niemann-Pick disease Sphingomyelinase sphingomyelin
storage type B Lysosomal Niemann-Pick disease NPC1 protein
sphingomyelin storage Type C1/Type D ((257220) Lysosomal
Niemann-Pick disease Epididymal secretory protein 1 sphingomyelin
storage Type C2 (607625) (HE1; NPC2 protein) Lysosomal Prosaposin
deficiency Prosaposin sphingolipids storage (176801) Lysosomal
Pycnodysostosis Cathepsin K kinins storage (265800) Lysosomal
Sandhoff's disease; .beta.-Hexosaminidase B gangliosides storage
268800 Lysosomal Saposin B deficiency Saposin B sphingolipids
storage (sulfatide activator deficiency) Lysosomal Saposin C
deficiency Saposin C sphingolipids storage (Gaucher's activator
deficiency) Lysosomal Schindler's disease Type
N-Acetyl-galactosaminidase glycoproteins storage I (infantile
severe form; 609241) Lysosomal Schindler's disease Type
N-Acetyl-galactosaminidase glycoproteins storage II (Kanzaki
disease, adult-onset form; 609242) Lysosomal Schindler's disease
Type N-Acetyl-galactosaminidase glycoproteins storage III
(intermediate form; 609241) Lysosomal Sialidosis (256550)
Neuraminidase 1 (sialidase) mucopolysaccharides storage and
mucolipids Lysosomal Sialuria Finnish type Na phosphate
cotransporter, sialic acid storage (Salla disease; 604369) sialin
Lysosomal Sialuria French type UDP-N-acetylglucosamine-2- sialic
acid storage (269921) epimerase/N- acetylmannosamine kinase, sialin
Lysosomal Sphingolipidosis Type I Ganglioside .beta.-galactosidase
sphingolipids storage (230500) Lysosomal Sphingolipidosis Type II
Ganglioside .beta.-galactosidase sphingolipids storage (juvenile
type; 230600) Lysosomal Sphingolipidosis Type Ganglioside
.beta.-galactosidase sphingolipids storage III (adult type; 230650)
Lysosomal Tay-Sachs disease; .beta.-Hexosaminidase A gangliosides
storage 272800 Lysosomal Winchester syndrome Metalloproteinase-2
mucopolysaccharides
storage (277950) Lysosomal Wolman's disease lysosomal acid lipase
lipids and cholesterol storage Lysosomal .alpha.-Mannosidosis
.alpha.-D-Mannosidase carbohydrates and storage (248500), type I
(severe) glycoproteins or II (mild) Lysosomal .beta.-Mannosidosis
.beta.-D-Mannosidase carbohydrates and storage (248510)
glycoproteins Toxic alpha hemolysin an antibody-like binder to
alpha alpha hemolysin Molecule poisoning hemolysin Toxic antrax
toxin poisoning an antibody-like binder to anthrax toxin Molecule
anthrax toxin Toxic bacterial toxin-induced an antibody-like binder
to bacterial toxin Molecule shock bacterial toxin Toxic botulinum
toxin an antibody-like binder to botulinum toxin Molecule poisoning
botulinum toxin Toxic Hemochromatosis (iron iron chelator molecular
iron Molecule poisoning) Toxic Methanol poisoning Methanol
dehdrogenase Methanol Molecule Toxic Nerve gas poisoning Butyryl
cholinesterase Sarin Molecule Toxic Prion disease caused by an
antibody-like binder to prion Prion protein PRP Molecule PRP
protein PRP Toxic Prion disease caused by an antibody-like binder
to prion Prion protein PRPc Molecule PRPc protein PRPc Toxic Prion
disease caused by an antibody-like binder to prion Prion protein
PRPsc Molecule PRPsc protein PRPsc Toxic Prion disease cuased by an
antibody-like binder to prion Prion protein PRPres Molecule PRPres
protein PRPres Toxic Sepsis or cytokine storm an antibody-like
binder to cytokines Molecule cytokines or Duffy antigen receptor of
chemokines (DARC) Toxic spider venom poisoning an antibody-like
binder to spider venom Molecule spider venom Toxic Wilson disease
copper chelator molecular copper Molecule
TABLE-US-00009 TABLE 9A Conjugation methods Zero-length x-linker
Amine-sulfhydryl x-linker EDC SPDP, LC-SPDP, sulfo-LC- SPDP EDC
plus sulfo NHS SMPT and sulfo-LC-SMPT CMC SMCC and sulfo-SMCC DCC
MBS and sulfo-MBS DIC SIAB and sulfo-SIAB Woodward's reagent K SMPB
and sulfo-SMPB N,N'-carbonyldiimidazole GMBS and sulfo-GMBS Schiff
base + reductive amination SIAX and SIAXX Homobifunctional NHS
esters SIAC and SIACX DSP NPIA DTSSP Carbonyl-sulfydryl x-linker
DSS MPBH BS{circumflex over ( )}3 M2C2H DST PDPH Sulfo-DST
amine-photoreactive x-linker BSOCOES NHS-ASA, Sulfo-NHS-ASA
Sulfo-BSOCOES Sulfo-NHS-LC-ASA EGS SASD Sulfo-EGS HSAB and
sulfo-HSAB DSG SANPAH and sulfo-SANPAH DSC ANB-NOS Homobifunctional
Imidoesters SAND DMA SADP and sulfo-SADP DMP Sulfo-SAPB DMS SAED
DTBP Sulfo-SAMCA Sulfhydryl reactive x-linkers p-Nitrophenyl
diazopyruvate DPDPB PNP-DTP BMH sulfhydryl-photoreactive x- linker
Difluorobenzene derivatives ASIB DFDNB APDP DFDNPS
Benzophenone-4-iodoacetamide Photoreactive x-linker
Benzophenone-4-maleimide BASED Carbonyl-photoreactive x- linker
Homobifunctional aldehydes ABH Formaldehyde
Carboxylate-photoreactive x- linker Glutaraldehyde ASBA bis-epoxide
arginine-photoreactive x-linker 1,4-butanediol diglycidyl ether APG
Homobifunctional hydrazides Bioorthogonal reactions adipic acid
dihydrazide Diels-alder reagent pairs carbohydrazide
Hydrazine-aldehyde reagent pairs Bis-diazonium derivative Boronic
acid salicylhydroxamate o-tolidine diazotized Click chemistry
Bis-diazotized benzidine Staudinger ligation
TABLE-US-00010 TABLE 9B Enzymatic conjugation methods Sortase
DD-transpeptidase Peptidyl transferase G-glutamyl transpeptidase
D-glutamyl transpeptidase Farnesyltransferase Prenyltranferase
Dimethylallyltrans-transferase Geranylgeranyl pyrophosphate
synthase Dehydrodolichol diphosphate synthase
TABLE-US-00011 TABLE 9C Chemistry of reactive groups Amine
reactions Thiol reactions Hydroxyl reactions Active hydrogen
reactions Isothyocyantes Haloacetyl and alkl Epoxides and oxiranes
Diazonium halide derivatives derivatives Isocyanates Maleimides
Carbonyldiimidazole Mannich condensation Acyl azides Aziridines
N,N'0disuccinimidyl Iodination carbonate reactions NHS esters
Acryloyl derivatives N-hydroxysuccinimidyl chloroformate Sulfonyl
chlorides Arylating agents Oxidation with periodate Aldehydes and
Thil-disulfide exchange Enzymatic oxidation glyoxals reagents
Cycloaddition reactions Epoxides and oxiranes Vinylsulfone
derivatives Alkyl halogens Diels-Alder reaction Carbonates
Metal-thiol dative bonds Isocyanates Complex formation with boronic
acid derivatives
TABLE-US-00012 TABLE 10 Complement & Complement Regulatory
Molecules Soluble molecules Alternative Pathway Late Components
Factor B C5 Factor D C5a Properdin C6 C3 C7 C3a C8 C3b C9 iC3b C3c
Receptors C3dg CR1 C3dk CR2 C3e CR3 Bb CR4 Factor I C3aR C3eR
Classical Pathway Decay-accelerating factor (DAF) C1q Membrane
cofactor protein (MCP) C1r CD59 C1s C3 Beta chain Receptor C4
Homologous restriction factor C4a C4b Control Proteins C2 C1
inhibitor C4bp C4 binding protein Factor I Lectin Pathway Factor H
Mannose-Binding Lectin (MBL) MBL-Associated Serine Protease 1
(MASP1) MBL-Associated Serine Protease 2 (MASP2)
Sequence CWU 1
1
3012489PRTHomo sapiens 1Met Gly Ala Ser Ser Pro Arg Ser Pro Glu Pro
Val Gly Pro Pro Ala1 5 10 15Pro Gly Leu Pro Phe Cys Cys Gly Gly Ser
Leu Leu Ala Val Val Val 20 25 30Leu Leu Ala Leu Pro Val Ala Trp Gly
Gln Cys Asn Ala Pro Glu Trp 35 40 45Leu Pro Phe Ala Arg Pro Thr Asn
Leu Thr Asp Glu Phe Glu Phe Pro 50 55 60Ile Gly Thr Tyr Leu Asn Tyr
Glu Cys Arg Pro Gly Tyr Ser Gly Arg65 70 75 80Pro Phe Ser Ile Ile
Cys Leu Lys Asn Ser Val Trp Thr Gly Ala Lys 85 90 95Asp Arg Cys Arg
Arg Lys Ser Cys Arg Asn Pro Pro Asp Pro Val Asn 100 105 110Gly Met
Val His Val Ile Lys Gly Ile Gln Phe Gly Ser Gln Ile Lys 115 120
125Tyr Ser Cys Thr Lys Gly Tyr Arg Leu Ile Gly Ser Ser Ser Ala Thr
130 135 140Cys Ile Ile Ser Gly Asp Thr Val Ile Trp Asp Asn Glu Thr
Pro Ile145 150 155 160Cys Asp Arg Ile Pro Cys Gly Leu Pro Pro Thr
Ile Thr Asn Gly Asp 165 170 175Phe Ile Ser Thr Asn Arg Glu Asn Phe
His Tyr Gly Ser Val Val Thr 180 185 190Tyr Arg Cys Asn Pro Gly Ser
Gly Gly Arg Lys Val Phe Glu Leu Val 195 200 205Gly Glu Pro Ser Ile
Tyr Cys Thr Ser Asn Asp Asp Gln Val Gly Ile 210 215 220Trp Ser Gly
Pro Ala Pro Gln Cys Ile Ile Pro Asn Lys Cys Thr Pro225 230 235
240Pro Asn Val Glu Asn Gly Ile Leu Val Ser Asp Asn Arg Ser Leu Phe
245 250 255Ser Leu Asn Glu Val Val Glu Phe Arg Cys Gln Pro Gly Phe
Val Met 260 265 270Lys Gly Pro Arg Arg Val Lys Cys Gln Ala Leu Asn
Lys Trp Glu Pro 275 280 285Glu Leu Pro Ser Cys Ser Arg Val Cys Gln
Pro Pro Pro Asp Val Leu 290 295 300His Ala Glu Arg Thr Gln Arg Asp
Lys Asp Asn Phe Ser Pro Gly Gln305 310 315 320Glu Val Phe Tyr Ser
Cys Glu Pro Gly Tyr Asp Leu Arg Gly Ala Ala 325 330 335Ser Met Arg
Cys Thr Pro Gln Gly Asp Trp Ser Pro Ala Ala Pro Thr 340 345 350Cys
Glu Val Lys Ser Cys Asp Asp Phe Met Gly Gln Leu Leu Asn Gly 355 360
365Arg Val Leu Phe Pro Val Asn Leu Gln Leu Gly Ala Lys Val Asp Phe
370 375 380Val Cys Asp Glu Gly Phe Gln Leu Lys Gly Ser Ser Ala Ser
Tyr Cys385 390 395 400Val Leu Ala Gly Met Glu Ser Leu Trp Asn Ser
Ser Val Pro Val Cys 405 410 415Glu Gln Ile Phe Cys Pro Ser Pro Pro
Val Ile Pro Asn Gly Arg His 420 425 430Thr Gly Lys Pro Leu Glu Val
Phe Pro Phe Gly Lys Thr Val Asn Tyr 435 440 445Thr Cys Asp Pro His
Pro Asp Arg Gly Thr Ser Phe Asp Leu Ile Gly 450 455 460Glu Ser Thr
Ile Arg Cys Thr Ser Asp Pro Gln Gly Asn Gly Val Trp465 470 475
480Ser Ser Pro Ala Pro Arg Cys Gly Ile Leu Gly His Cys Gln Ala Pro
485 490 495Asp His Phe Leu Phe Ala Lys Leu Lys Thr Gln Thr Asn Ala
Ser Asp 500 505 510Phe Pro Ile Gly Thr Ser Leu Lys Tyr Glu Cys Arg
Pro Glu Tyr Tyr 515 520 525Gly Arg Pro Phe Ser Ile Thr Cys Leu Asp
Asn Leu Val Trp Ser Ser 530 535 540Pro Lys Asp Val Cys Lys Arg Lys
Ser Cys Lys Thr Pro Pro Asp Pro545 550 555 560Val Asn Gly Met Val
His Val Ile Thr Asp Ile Gln Val Gly Ser Arg 565 570 575Ile Asn Tyr
Ser Cys Thr Thr Gly His Arg Leu Ile Gly His Ser Ser 580 585 590Ala
Glu Cys Ile Leu Ser Gly Asn Ala Ala His Trp Ser Thr Lys Pro 595 600
605Pro Ile Cys Gln Arg Ile Pro Cys Gly Leu Pro Pro Thr Ile Ala Asn
610 615 620Gly Asp Phe Ile Ser Thr Asn Arg Glu Asn Phe His Tyr Gly
Ser Val625 630 635 640Val Thr Tyr Arg Cys Asn Pro Gly Ser Gly Gly
Arg Lys Val Phe Glu 645 650 655Leu Val Gly Glu Pro Ser Ile Tyr Cys
Thr Ser Asn Asp Asp Gln Val 660 665 670Gly Ile Trp Ser Gly Pro Ala
Pro Gln Cys Ile Ile Pro Asn Lys Cys 675 680 685Thr Pro Pro Asn Val
Glu Asn Gly Ile Leu Val Ser Asp Asn Arg Ser 690 695 700Leu Phe Ser
Leu Asn Glu Val Val Glu Phe Arg Cys Gln Pro Gly Phe705 710 715
720Val Met Lys Gly Pro Arg Arg Val Lys Cys Gln Ala Leu Asn Lys Trp
725 730 735Glu Pro Glu Leu Pro Ser Cys Ser Arg Val Cys Gln Pro Pro
Pro Asp 740 745 750Val Leu His Ala Glu Arg Thr Gln Arg Asp Lys Asp
Asn Phe Ser Pro 755 760 765Gly Gln Glu Val Phe Tyr Ser Cys Glu Pro
Gly Tyr Asp Leu Arg Gly 770 775 780Ala Ala Ser Met Arg Cys Thr Pro
Gln Gly Asp Trp Ser Pro Ala Ala785 790 795 800Pro Thr Cys Glu Val
Lys Ser Cys Asp Asp Phe Met Gly Gln Leu Leu 805 810 815Asn Gly Arg
Val Leu Phe Pro Val Asn Leu Gln Leu Gly Ala Lys Val 820 825 830Asp
Phe Val Cys Asp Glu Gly Phe Gln Leu Lys Gly Ser Ser Ala Ser 835 840
845Tyr Cys Val Leu Ala Gly Met Glu Ser Leu Trp Asn Ser Ser Val Pro
850 855 860Val Cys Glu Gln Ile Phe Cys Pro Ser Pro Pro Val Ile Pro
Asn Gly865 870 875 880Arg His Thr Gly Lys Pro Leu Glu Val Phe Pro
Phe Gly Lys Thr Val 885 890 895Asn Tyr Thr Cys Asp Pro His Pro Asp
Arg Gly Thr Ser Phe Asp Leu 900 905 910Ile Gly Glu Ser Thr Ile Arg
Cys Thr Ser Asp Pro Gln Gly Asn Gly 915 920 925Val Trp Ser Ser Pro
Ala Pro Arg Cys Gly Ile Leu Gly His Cys Gln 930 935 940Ala Pro Asp
His Phe Leu Phe Ala Lys Leu Lys Thr Gln Thr Asn Ala945 950 955
960Ser Asp Phe Pro Ile Gly Thr Ser Leu Lys Tyr Glu Cys Arg Pro Glu
965 970 975Tyr Tyr Gly Arg Pro Phe Ser Ile Thr Cys Leu Asp Asn Leu
Val Trp 980 985 990Ser Ser Pro Lys Asp Val Cys Lys Arg Lys Ser Cys
Lys Thr Pro Pro 995 1000 1005Asp Pro Val Asn Gly Met Val His Val
Ile Thr Asp Ile Gln Val 1010 1015 1020Gly Ser Arg Ile Asn Tyr Ser
Cys Thr Thr Gly His Arg Leu Ile 1025 1030 1035Gly His Ser Ser Ala
Glu Cys Ile Leu Ser Gly Asn Ala Ala His 1040 1045 1050Trp Ser Thr
Lys Pro Pro Ile Cys Gln Arg Ile Pro Cys Gly Leu 1055 1060 1065Pro
Pro Thr Ile Ala Asn Gly Asp Phe Ile Ser Thr Asn Arg Glu 1070 1075
1080Asn Phe His Tyr Gly Ser Val Val Thr Tyr Arg Cys Asn Pro Gly
1085 1090 1095Ser Gly Gly Arg Lys Val Phe Glu Leu Val Gly Glu Pro
Ser Ile 1100 1105 1110Tyr Cys Thr Ser Asn Asp Asp Gln Val Gly Ile
Trp Ser Gly Pro 1115 1120 1125Ala Pro Gln Cys Ile Ile Pro Asn Lys
Cys Thr Pro Pro Asn Val 1130 1135 1140Glu Asn Gly Ile Leu Val Ser
Asp Asn Arg Ser Leu Phe Ser Leu 1145 1150 1155Asn Glu Val Val Glu
Phe Arg Cys Gln Pro Gly Phe Val Met Lys 1160 1165 1170Gly Pro Arg
Arg Val Lys Cys Gln Ala Leu Asn Lys Trp Glu Pro 1175 1180 1185Glu
Leu Pro Ser Cys Ser Arg Val Cys Gln Pro Pro Pro Asp Val 1190 1195
1200Leu His Ala Glu Arg Thr Gln Arg Asp Lys Asp Asn Phe Ser Pro
1205 1210 1215Gly Gln Glu Val Phe Tyr Ser Cys Glu Pro Gly Tyr Asp
Leu Arg 1220 1225 1230Gly Ala Ala Ser Met Arg Cys Thr Pro Gln Gly
Asp Trp Ser Pro 1235 1240 1245Ala Ala Pro Thr Cys Glu Val Lys Ser
Cys Asp Asp Phe Met Gly 1250 1255 1260Gln Leu Leu Asn Gly Arg Val
Leu Phe Pro Val Asn Leu Gln Leu 1265 1270 1275Gly Ala Lys Val Asp
Phe Val Cys Asp Glu Gly Phe Gln Leu Lys 1280 1285 1290Gly Ser Ser
Ala Ser Tyr Cys Val Leu Ala Gly Met Glu Ser Leu 1295 1300 1305Trp
Asn Ser Ser Val Pro Val Cys Glu Gln Ile Phe Cys Pro Ser 1310 1315
1320Pro Pro Val Ile Pro Asn Gly Arg His Thr Gly Lys Pro Leu Glu
1325 1330 1335Val Phe Pro Phe Gly Lys Ala Val Asn Tyr Thr Cys Asp
Pro His 1340 1345 1350Pro Asp Arg Gly Thr Ser Phe Asp Leu Ile Gly
Glu Ser Thr Ile 1355 1360 1365Arg Cys Thr Ser Asp Pro Gln Gly Asn
Gly Val Trp Ser Ser Pro 1370 1375 1380Ala Pro Arg Cys Gly Ile Leu
Gly His Cys Gln Ala Pro Asp His 1385 1390 1395Phe Leu Phe Ala Lys
Leu Lys Thr Gln Thr Asn Ala Ser Asp Phe 1400 1405 1410Pro Ile Gly
Thr Ser Leu Lys Tyr Glu Cys Arg Pro Glu Tyr Tyr 1415 1420 1425Gly
Arg Pro Phe Ser Ile Thr Cys Leu Asp Asn Leu Val Trp Ser 1430 1435
1440Ser Pro Lys Asp Val Cys Lys Arg Lys Ser Cys Lys Thr Pro Pro
1445 1450 1455Asp Pro Val Asn Gly Met Val His Val Ile Thr Asp Ile
Gln Val 1460 1465 1470Gly Ser Arg Ile Asn Tyr Ser Cys Thr Thr Gly
His Arg Leu Ile 1475 1480 1485Gly His Ser Ser Ala Glu Cys Ile Leu
Ser Gly Asn Thr Ala His 1490 1495 1500Trp Ser Thr Lys Pro Pro Ile
Cys Gln Arg Ile Pro Cys Gly Leu 1505 1510 1515Pro Pro Thr Ile Ala
Asn Gly Asp Phe Ile Ser Thr Asn Arg Glu 1520 1525 1530Asn Phe His
Tyr Gly Ser Val Val Thr Tyr Arg Cys Asn Leu Gly 1535 1540 1545Ser
Arg Gly Arg Lys Val Phe Glu Leu Val Gly Glu Pro Ser Ile 1550 1555
1560Tyr Cys Thr Ser Asn Asp Asp Gln Val Gly Ile Trp Ser Gly Pro
1565 1570 1575Ala Pro Gln Cys Ile Ile Pro Asn Lys Cys Thr Pro Pro
Asn Val 1580 1585 1590Glu Asn Gly Ile Leu Val Ser Asp Asn Arg Ser
Leu Phe Ser Leu 1595 1600 1605Asn Glu Val Val Glu Phe Arg Cys Gln
Pro Gly Phe Val Met Lys 1610 1615 1620Gly Pro Arg Arg Val Lys Cys
Gln Ala Leu Asn Lys Trp Glu Pro 1625 1630 1635Glu Leu Pro Ser Cys
Ser Arg Val Cys Gln Pro Pro Pro Glu Ile 1640 1645 1650Leu His Gly
Glu His Thr Pro Ser His Gln Asp Asn Phe Ser Pro 1655 1660 1665Gly
Gln Glu Val Phe Tyr Ser Cys Glu Pro Gly Tyr Asp Leu Arg 1670 1675
1680Gly Ala Ala Ser Leu His Cys Thr Pro Gln Gly Asp Trp Ser Pro
1685 1690 1695Glu Ala Pro Arg Cys Ala Val Lys Ser Cys Asp Asp Phe
Leu Gly 1700 1705 1710Gln Leu Pro His Gly Arg Val Leu Phe Pro Leu
Asn Leu Gln Leu 1715 1720 1725Gly Ala Lys Val Ser Phe Val Cys Asp
Glu Gly Phe Arg Leu Lys 1730 1735 1740Gly Ser Ser Val Ser His Cys
Val Leu Val Gly Met Arg Ser Leu 1745 1750 1755Trp Asn Asn Ser Val
Pro Val Cys Glu His Ile Phe Cys Pro Asn 1760 1765 1770Pro Pro Ala
Ile Leu Asn Gly Arg His Thr Gly Thr Pro Ser Gly 1775 1780 1785Asp
Ile Pro Tyr Gly Lys Glu Ile Ser Tyr Thr Cys Asp Pro His 1790 1795
1800Pro Asp Arg Gly Met Thr Phe Asn Leu Ile Gly Glu Ser Thr Ile
1805 1810 1815Arg Cys Thr Ser Asp Pro His Gly Asn Gly Val Trp Ser
Ser Pro 1820 1825 1830Ala Pro Arg Cys Glu Leu Ser Val Arg Ala Gly
His Cys Lys Thr 1835 1840 1845Pro Glu Gln Phe Pro Phe Ala Ser Pro
Thr Ile Pro Ile Asn Asp 1850 1855 1860Phe Glu Phe Pro Val Gly Thr
Ser Leu Asn Tyr Glu Cys Arg Pro 1865 1870 1875Gly Tyr Phe Gly Lys
Met Phe Ser Ile Ser Cys Leu Glu Asn Leu 1880 1885 1890Val Trp Ser
Ser Val Glu Asp Asn Cys Arg Arg Lys Ser Cys Gly 1895 1900 1905Pro
Pro Pro Glu Pro Phe Asn Gly Met Val His Ile Asn Thr Asp 1910 1915
1920Thr Gln Phe Gly Ser Thr Val Asn Tyr Ser Cys Asn Glu Gly Phe
1925 1930 1935Arg Leu Ile Gly Ser Pro Ser Thr Thr Cys Leu Val Ser
Gly Asn 1940 1945 1950Asn Val Thr Trp Asp Lys Lys Ala Pro Ile Cys
Glu Ile Ile Ser 1955 1960 1965Cys Glu Pro Pro Pro Thr Ile Ser Asn
Gly Asp Phe Tyr Ser Asn 1970 1975 1980Asn Arg Thr Ser Phe His Asn
Gly Thr Val Val Thr Tyr Gln Cys 1985 1990 1995His Thr Gly Pro Asp
Gly Glu Gln Leu Phe Glu Leu Val Gly Glu 2000 2005 2010Arg Ser Ile
Tyr Cys Thr Ser Lys Asp Asp Gln Val Gly Val Trp 2015 2020 2025Ser
Ser Pro Pro Pro Arg Cys Ile Ser Thr Asn Lys Cys Thr Ala 2030 2035
2040Pro Glu Val Glu Asn Ala Ile Arg Val Pro Gly Asn Arg Ser Phe
2045 2050 2055Phe Thr Leu Thr Glu Ile Ile Arg Phe Arg Cys Gln Pro
Gly Phe 2060 2065 2070Val Met Val Gly Ser His Thr Val Gln Cys Gln
Thr Asn Gly Arg 2075 2080 2085Trp Gly Pro Lys Leu Pro His Cys Ser
Arg Val Cys Gln Pro Pro 2090 2095 2100Pro Glu Ile Leu His Gly Glu
His Thr Leu Ser His Gln Asp Asn 2105 2110 2115Phe Ser Pro Gly Gln
Glu Val Phe Tyr Ser Cys Glu Pro Ser Tyr 2120 2125 2130Asp Leu Arg
Gly Ala Ala Ser Leu His Cys Thr Pro Gln Gly Asp 2135 2140 2145Trp
Ser Pro Glu Ala Pro Arg Cys Thr Val Lys Ser Cys Asp Asp 2150 2155
2160Phe Leu Gly Gln Leu Pro His Gly Arg Val Leu Leu Pro Leu Asn
2165 2170 2175Leu Gln Leu Gly Ala Lys Val Ser Phe Val Cys Asp Glu
Gly Phe 2180 2185 2190Arg Leu Lys Gly Arg Ser Ala Ser His Cys Val
Leu Ala Gly Met 2195 2200 2205Lys Ala Leu Trp Asn Ser Ser Val Pro
Val Cys Glu Gln Ile Phe 2210 2215 2220Cys Pro Asn Pro Pro Ala Ile
Leu Asn Gly Arg His Thr Gly Thr 2225 2230 2235Pro Phe Gly Asp Ile
Pro Tyr Gly Lys Glu Ile Ser Tyr Ala Cys 2240 2245 2250Asp Thr His
Pro Asp Arg Gly Met Thr Phe Asn Leu Ile Gly Glu 2255 2260 2265Ser
Ser Ile Arg Cys Thr Ser Asp Pro Gln Gly Asn Gly Val Trp 2270 2275
2280Ser Ser Pro Ala Pro Arg Cys Glu Leu Ser Val Pro Ala Ala Cys
2285 2290 2295Pro His Pro Pro Lys Ile Gln Asn Gly His Tyr Ile Gly
Gly His 2300 2305 2310Val Ser Leu Tyr Leu Pro Gly Met Thr Ile Ser
Tyr Ile Cys Asp 2315 2320 2325Pro Gly Tyr Leu Leu Val Gly Lys Gly
Phe Ile Phe Cys Thr Asp 2330 2335 2340Gln Gly Ile Trp Ser Gln Leu
Asp His Tyr Cys Lys Glu Val Asn 2345 2350 2355Cys Ser Phe Pro Leu
Phe Met Asn Gly Ile Ser Lys Glu Leu Glu 2360 2365 2370Met Lys Lys
Val Tyr His Tyr Gly Asp Tyr Val Thr Leu Lys Cys 2375 2380 2385Glu
Asp Gly Tyr Thr Leu Glu Gly Ser Pro Trp Ser Gln Cys Gln 2390 2395
2400Ala Asp Asp Arg Trp Asp Pro Pro Leu Ala Lys Cys Thr Ser Arg
2405 2410 2415Thr His Asp Ala Leu Ile Val Gly Thr Leu Ser Gly Thr
Ile Phe 2420 2425 2430Phe Ile Leu Leu Ile Ile Phe Leu Ser Trp Ile
Ile Leu Lys His 2435 2440 2445Arg
Lys Gly Asn Asn Ala His Glu Asn Pro Lys Glu Val Ala Ile 2450 2455
2460His Leu His Ser Gln Gly Gly Ser Ser Val His Pro Arg Thr Leu
2465 2470 2475Gln Thr Asn Glu Glu Asn Ser Arg Val Leu Pro 2480
248522039PRTHomo sapiens 2Met Gly Ala Ser Ser Pro Arg Ser Pro Glu
Pro Val Gly Pro Pro Ala1 5 10 15Pro Gly Leu Pro Phe Cys Cys Gly Gly
Ser Leu Leu Ala Val Val Val 20 25 30Leu Leu Ala Leu Pro Val Ala Trp
Gly Gln Cys Asn Ala Pro Glu Trp 35 40 45Leu Pro Phe Ala Arg Pro Thr
Asn Leu Thr Asp Glu Phe Glu Phe Pro 50 55 60Ile Gly Thr Tyr Leu Asn
Tyr Glu Cys Arg Pro Gly Tyr Ser Gly Arg65 70 75 80Pro Phe Ser Ile
Ile Cys Leu Lys Asn Ser Val Trp Thr Gly Ala Lys 85 90 95Asp Arg Cys
Arg Arg Lys Ser Cys Arg Asn Pro Pro Asp Pro Val Asn 100 105 110Gly
Met Val His Val Ile Lys Gly Ile Gln Phe Gly Ser Gln Ile Lys 115 120
125Tyr Ser Cys Thr Lys Gly Tyr Arg Leu Ile Gly Ser Ser Ser Ala Thr
130 135 140Cys Ile Ile Ser Gly Asp Thr Val Ile Trp Asp Asn Glu Thr
Pro Ile145 150 155 160Cys Asp Arg Ile Pro Cys Gly Leu Pro Pro Thr
Ile Thr Asn Gly Asp 165 170 175Phe Ile Ser Thr Asn Arg Glu Asn Phe
His Tyr Gly Ser Val Val Thr 180 185 190Tyr Arg Cys Asn Pro Gly Ser
Gly Gly Arg Lys Val Phe Glu Leu Val 195 200 205Gly Glu Pro Ser Ile
Tyr Cys Thr Ser Asn Asp Asp Gln Val Gly Ile 210 215 220Trp Ser Gly
Pro Ala Pro Gln Cys Ile Ile Pro Asn Lys Cys Thr Pro225 230 235
240Pro Asn Val Glu Asn Gly Ile Leu Val Ser Asp Asn Arg Ser Leu Phe
245 250 255Ser Leu Asn Glu Val Val Glu Phe Arg Cys Gln Pro Gly Phe
Val Met 260 265 270Lys Gly Pro Arg Arg Val Lys Cys Gln Ala Leu Asn
Lys Trp Glu Pro 275 280 285Glu Leu Pro Ser Cys Ser Arg Val Cys Gln
Pro Pro Pro Asp Val Leu 290 295 300His Ala Glu Arg Thr Gln Arg Asp
Lys Asp Asn Phe Ser Pro Gly Gln305 310 315 320Glu Val Phe Tyr Ser
Cys Glu Pro Gly Tyr Asp Leu Arg Gly Ala Ala 325 330 335Ser Met Arg
Cys Thr Pro Gln Gly Asp Trp Ser Pro Ala Ala Pro Thr 340 345 350Cys
Glu Val Lys Ser Cys Asp Asp Phe Met Gly Gln Leu Leu Asn Gly 355 360
365Arg Val Leu Phe Pro Val Asn Leu Gln Leu Gly Ala Lys Val Asp Phe
370 375 380Val Cys Asp Glu Gly Phe Gln Leu Lys Gly Ser Ser Ala Ser
Tyr Cys385 390 395 400Val Leu Ala Gly Met Glu Ser Leu Trp Asn Ser
Ser Val Pro Val Cys 405 410 415Glu Gln Ile Phe Cys Pro Ser Pro Pro
Val Ile Pro Asn Gly Arg His 420 425 430Thr Gly Lys Pro Leu Glu Val
Phe Pro Phe Gly Lys Thr Val Asn Tyr 435 440 445Thr Cys Asp Pro His
Pro Asp Arg Gly Thr Ser Phe Asp Leu Ile Gly 450 455 460Glu Ser Thr
Ile Arg Cys Thr Ser Asp Pro Gln Gly Asn Gly Val Trp465 470 475
480Ser Ser Pro Ala Pro Arg Cys Gly Ile Leu Gly His Cys Gln Ala Pro
485 490 495Asp His Phe Leu Phe Ala Lys Leu Lys Thr Gln Thr Asn Ala
Ser Asp 500 505 510Phe Pro Ile Gly Thr Ser Leu Lys Tyr Glu Cys Arg
Pro Glu Tyr Tyr 515 520 525Gly Arg Pro Phe Ser Ile Thr Cys Leu Asp
Asn Leu Val Trp Ser Ser 530 535 540Pro Lys Asp Val Cys Lys Arg Lys
Ser Cys Lys Thr Pro Pro Asp Pro545 550 555 560Val Asn Gly Met Val
His Val Ile Thr Asp Ile Gln Val Gly Ser Arg 565 570 575Ile Asn Tyr
Ser Cys Thr Thr Gly His Arg Leu Ile Gly His Ser Ser 580 585 590Ala
Glu Cys Ile Leu Ser Gly Asn Ala Ala His Trp Ser Thr Lys Pro 595 600
605Pro Ile Cys Gln Arg Ile Pro Cys Gly Leu Pro Pro Thr Ile Ala Asn
610 615 620Gly Asp Phe Ile Ser Thr Asn Arg Glu Asn Phe His Tyr Gly
Ser Val625 630 635 640Val Thr Tyr Arg Cys Asn Pro Gly Ser Gly Gly
Arg Lys Val Phe Glu 645 650 655Leu Val Gly Glu Pro Ser Ile Tyr Cys
Thr Ser Asn Asp Asp Gln Val 660 665 670Gly Ile Trp Ser Gly Pro Ala
Pro Gln Cys Ile Ile Pro Asn Lys Cys 675 680 685Thr Pro Pro Asn Val
Glu Asn Gly Ile Leu Val Ser Asp Asn Arg Ser 690 695 700Leu Phe Ser
Leu Asn Glu Val Val Glu Phe Arg Cys Gln Pro Gly Phe705 710 715
720Val Met Lys Gly Pro Arg Arg Val Lys Cys Gln Ala Leu Asn Lys Trp
725 730 735Glu Pro Glu Leu Pro Ser Cys Ser Arg Val Cys Gln Pro Pro
Pro Asp 740 745 750Val Leu His Ala Glu Arg Thr Gln Arg Asp Lys Asp
Asn Phe Ser Pro 755 760 765Gly Gln Glu Val Phe Tyr Ser Cys Glu Pro
Gly Tyr Asp Leu Arg Gly 770 775 780Ala Ala Ser Met Arg Cys Thr Pro
Gln Gly Asp Trp Ser Pro Ala Ala785 790 795 800Pro Thr Cys Glu Val
Lys Ser Cys Asp Asp Phe Met Gly Gln Leu Leu 805 810 815Asn Gly Arg
Val Leu Phe Pro Val Asn Leu Gln Leu Gly Ala Lys Val 820 825 830Asp
Phe Val Cys Asp Glu Gly Phe Gln Leu Lys Gly Ser Ser Ala Ser 835 840
845Tyr Cys Val Leu Ala Gly Met Glu Ser Leu Trp Asn Ser Ser Val Pro
850 855 860Val Cys Glu Gln Ile Phe Cys Pro Ser Pro Pro Val Ile Pro
Asn Gly865 870 875 880Arg His Thr Gly Lys Pro Leu Glu Val Phe Pro
Phe Gly Lys Ala Val 885 890 895Asn Tyr Thr Cys Asp Pro His Pro Asp
Arg Gly Thr Ser Phe Asp Leu 900 905 910Ile Gly Glu Ser Thr Ile Arg
Cys Thr Ser Asp Pro Gln Gly Asn Gly 915 920 925Val Trp Ser Ser Pro
Ala Pro Arg Cys Gly Ile Leu Gly His Cys Gln 930 935 940Ala Pro Asp
His Phe Leu Phe Ala Lys Leu Lys Thr Gln Thr Asn Ala945 950 955
960Ser Asp Phe Pro Ile Gly Thr Ser Leu Lys Tyr Glu Cys Arg Pro Glu
965 970 975Tyr Tyr Gly Arg Pro Phe Ser Ile Thr Cys Leu Asp Asn Leu
Val Trp 980 985 990Ser Ser Pro Lys Asp Val Cys Lys Arg Lys Ser Cys
Lys Thr Pro Pro 995 1000 1005Asp Pro Val Asn Gly Met Val His Val
Ile Thr Asp Ile Gln Val 1010 1015 1020Gly Ser Arg Ile Asn Tyr Ser
Cys Thr Thr Gly His Arg Leu Ile 1025 1030 1035Gly His Ser Ser Ala
Glu Cys Ile Leu Ser Gly Asn Thr Ala His 1040 1045 1050Trp Ser Thr
Lys Pro Pro Ile Cys Gln Arg Ile Pro Cys Gly Leu 1055 1060 1065Pro
Pro Thr Ile Ala Asn Gly Asp Phe Ile Ser Thr Asn Arg Glu 1070 1075
1080Asn Phe His Tyr Gly Ser Val Val Thr Tyr Arg Cys Asn Leu Gly
1085 1090 1095Ser Arg Gly Arg Lys Val Phe Glu Leu Val Gly Glu Pro
Ser Ile 1100 1105 1110Tyr Cys Thr Ser Asn Asp Asp Gln Val Gly Ile
Trp Ser Gly Pro 1115 1120 1125Ala Pro Gln Cys Ile Ile Pro Asn Lys
Cys Thr Pro Pro Asn Val 1130 1135 1140Glu Asn Gly Ile Leu Val Ser
Asp Asn Arg Ser Leu Phe Ser Leu 1145 1150 1155Asn Glu Val Val Glu
Phe Arg Cys Gln Pro Gly Phe Val Met Lys 1160 1165 1170Gly Pro Arg
Arg Val Lys Cys Gln Ala Leu Asn Lys Trp Glu Pro 1175 1180 1185Glu
Leu Pro Ser Cys Ser Arg Val Cys Gln Pro Pro Pro Glu Ile 1190 1195
1200Leu His Gly Glu His Thr Pro Ser His Gln Asp Asn Phe Ser Pro
1205 1210 1215Gly Gln Glu Val Phe Tyr Ser Cys Glu Pro Gly Tyr Asp
Leu Arg 1220 1225 1230Gly Ala Ala Ser Leu His Cys Thr Pro Gln Gly
Asp Trp Ser Pro 1235 1240 1245Glu Ala Pro Arg Cys Ala Val Lys Ser
Cys Asp Asp Phe Leu Gly 1250 1255 1260Gln Leu Pro His Gly Arg Val
Leu Phe Pro Leu Asn Leu Gln Leu 1265 1270 1275Gly Ala Lys Val Ser
Phe Val Cys Asp Glu Gly Phe Arg Leu Lys 1280 1285 1290Gly Ser Ser
Val Ser His Cys Val Leu Val Gly Met Arg Ser Leu 1295 1300 1305Trp
Asn Asn Ser Val Pro Val Cys Glu His Ile Phe Cys Pro Asn 1310 1315
1320Pro Pro Ala Ile Leu Asn Gly Arg His Thr Gly Thr Pro Ser Gly
1325 1330 1335Asp Ile Pro Tyr Gly Lys Glu Ile Ser Tyr Thr Cys Asp
Pro His 1340 1345 1350Pro Asp Arg Gly Met Thr Phe Asn Leu Ile Gly
Glu Ser Thr Ile 1355 1360 1365Arg Cys Thr Ser Asp Pro His Gly Asn
Gly Val Trp Ser Ser Pro 1370 1375 1380Ala Pro Arg Cys Glu Leu Ser
Val Arg Ala Gly His Cys Lys Thr 1385 1390 1395Pro Glu Gln Phe Pro
Phe Ala Ser Pro Thr Ile Pro Ile Asn Asp 1400 1405 1410Phe Glu Phe
Pro Val Gly Thr Ser Leu Asn Tyr Glu Cys Arg Pro 1415 1420 1425Gly
Tyr Phe Gly Lys Met Phe Ser Ile Ser Cys Leu Glu Asn Leu 1430 1435
1440Val Trp Ser Ser Val Glu Asp Asn Cys Arg Arg Lys Ser Cys Gly
1445 1450 1455Pro Pro Pro Glu Pro Phe Asn Gly Met Val His Ile Asn
Thr Asp 1460 1465 1470Thr Gln Phe Gly Ser Thr Val Asn Tyr Ser Cys
Asn Glu Gly Phe 1475 1480 1485Arg Leu Ile Gly Ser Pro Ser Thr Thr
Cys Leu Val Ser Gly Asn 1490 1495 1500Asn Val Thr Trp Asp Lys Lys
Ala Pro Ile Cys Glu Ile Ile Ser 1505 1510 1515Cys Glu Pro Pro Pro
Thr Ile Ser Asn Gly Asp Phe Tyr Ser Asn 1520 1525 1530Asn Arg Thr
Ser Phe His Asn Gly Thr Val Val Thr Tyr Gln Cys 1535 1540 1545His
Thr Gly Pro Asp Gly Glu Gln Leu Phe Glu Leu Val Gly Glu 1550 1555
1560Arg Ser Ile Tyr Cys Thr Ser Lys Asp Asp Gln Val Gly Val Trp
1565 1570 1575Ser Ser Pro Pro Pro Arg Cys Ile Ser Thr Asn Lys Cys
Thr Ala 1580 1585 1590Pro Glu Val Glu Asn Ala Ile Arg Val Pro Gly
Asn Arg Ser Phe 1595 1600 1605Phe Thr Leu Thr Glu Ile Ile Arg Phe
Arg Cys Gln Pro Gly Phe 1610 1615 1620Val Met Val Gly Ser His Thr
Val Gln Cys Gln Thr Asn Gly Arg 1625 1630 1635Trp Gly Pro Lys Leu
Pro His Cys Ser Arg Val Cys Gln Pro Pro 1640 1645 1650Pro Glu Ile
Leu His Gly Glu His Thr Leu Ser His Gln Asp Asn 1655 1660 1665Phe
Ser Pro Gly Gln Glu Val Phe Tyr Ser Cys Glu Pro Ser Tyr 1670 1675
1680Asp Leu Arg Gly Ala Ala Ser Leu His Cys Thr Pro Gln Gly Asp
1685 1690 1695Trp Ser Pro Glu Ala Pro Arg Cys Thr Val Lys Ser Cys
Asp Asp 1700 1705 1710Phe Leu Gly Gln Leu Pro His Gly Arg Val Leu
Leu Pro Leu Asn 1715 1720 1725Leu Gln Leu Gly Ala Lys Val Ser Phe
Val Cys Asp Glu Gly Phe 1730 1735 1740Arg Leu Lys Gly Arg Ser Ala
Ser His Cys Val Leu Ala Gly Met 1745 1750 1755Lys Ala Leu Trp Asn
Ser Ser Val Pro Val Cys Glu Gln Ile Phe 1760 1765 1770Cys Pro Asn
Pro Pro Ala Ile Leu Asn Gly Arg His Thr Gly Thr 1775 1780 1785Pro
Phe Gly Asp Ile Pro Tyr Gly Lys Glu Ile Ser Tyr Ala Cys 1790 1795
1800Asp Thr His Pro Asp Arg Gly Met Thr Phe Asn Leu Ile Gly Glu
1805 1810 1815Ser Ser Ile Arg Cys Thr Ser Asp Pro Gln Gly Asn Gly
Val Trp 1820 1825 1830Ser Ser Pro Ala Pro Arg Cys Glu Leu Ser Val
Pro Ala Ala Cys 1835 1840 1845Pro His Pro Pro Lys Ile Gln Asn Gly
His Tyr Ile Gly Gly His 1850 1855 1860Val Ser Leu Tyr Leu Pro Gly
Met Thr Ile Ser Tyr Ile Cys Asp 1865 1870 1875Pro Gly Tyr Leu Leu
Val Gly Lys Gly Phe Ile Phe Cys Thr Asp 1880 1885 1890Gln Gly Ile
Trp Ser Gln Leu Asp His Tyr Cys Lys Glu Val Asn 1895 1900 1905Cys
Ser Phe Pro Leu Phe Met Asn Gly Ile Ser Lys Glu Leu Glu 1910 1915
1920Met Lys Lys Val Tyr His Tyr Gly Asp Tyr Val Thr Leu Lys Cys
1925 1930 1935Glu Asp Gly Tyr Thr Leu Glu Gly Ser Pro Trp Ser Gln
Cys Gln 1940 1945 1950Ala Asp Asp Arg Trp Asp Pro Pro Leu Ala Lys
Cys Thr Ser Arg 1955 1960 1965Thr His Asp Ala Leu Ile Val Gly Thr
Leu Ser Gly Thr Ile Phe 1970 1975 1980Phe Ile Leu Leu Ile Ile Phe
Leu Ser Trp Ile Ile Leu Lys His 1985 1990 1995Arg Lys Gly Asn Asn
Ala His Glu Asn Pro Lys Glu Val Ala Ile 2000 2005 2010His Leu His
Ser Gln Gly Gly Ser Ser Val His Pro Arg Thr Leu 2015 2020 2025Gln
Thr Asn Glu Glu Asn Ser Arg Val Leu Pro 2030 203532361PRTHomo
sapiens 3Met Cys Leu Gly Arg Met Gly Ala Ser Ser Pro Arg Ser Pro
Glu Pro1 5 10 15Val Gly Pro Pro Ala Pro Gly Leu Pro Phe Cys Cys Gly
Gly Ser Leu 20 25 30Leu Ala Val Val Val Leu Leu Ala Leu Pro Val Ala
Trp Gly Gln Cys 35 40 45Asn Ala Pro Glu Trp Leu Pro Phe Ala Arg Pro
Thr Asn Leu Thr Asp 50 55 60Glu Phe Glu Phe Pro Ile Gly Thr Tyr Leu
Asn Tyr Glu Cys Arg Pro65 70 75 80Gly Tyr Ser Gly Arg Pro Phe Ser
Ile Ile Cys Leu Lys Asn Ser Val 85 90 95Trp Thr Gly Ala Lys Asp Arg
Cys Arg Arg Lys Ser Cys Arg Asn Pro 100 105 110Pro Asp Pro Val Asn
Gly Met Val His Val Ile Lys Gly Ile Gln Phe 115 120 125Gly Ser Gln
Ile Lys Tyr Ser Cys Thr Lys Gly Tyr Arg Leu Ile Gly 130 135 140Ser
Ser Ser Ala Thr Cys Ile Ile Ser Gly Asp Thr Val Ile Trp Asp145 150
155 160Asn Glu Thr Pro Ile Cys Asp Arg Ile Pro Cys Gly Leu Pro Pro
Thr 165 170 175Ile Thr Asn Gly Asp Phe Ile Ser Thr Asn Arg Glu Asn
Phe His Tyr 180 185 190Gly Ser Val Val Thr Tyr Arg Cys Asn Pro Gly
Ser Gly Gly Arg Lys 195 200 205Val Phe Glu Leu Val Gly Glu Pro Ser
Ile Tyr Cys Thr Ser Asn Asp 210 215 220Asp Gln Val Gly Ile Trp Ser
Gly Pro Ala Pro Gln Cys Ile Ile Pro225 230 235 240Asn Lys Cys Thr
Pro Pro Asn Val Glu Asn Gly Ile Leu Val Ser Asp 245 250 255Asn Arg
Ser Leu Phe Ser Leu Asn Glu Val Val Glu Phe Arg Cys Gln 260 265
270Pro Gly Phe Val Met Lys Gly Pro Arg Arg Val Lys Cys Gln Ala Leu
275 280 285Asn Lys Trp Glu Pro Glu Leu Pro Ser Cys Ser Arg Val Cys
Gln Pro 290 295 300Pro Pro Asp Val Leu His Ala Glu Arg Thr Gln Arg
Asp Lys Asp Asn305 310 315 320Phe Ser Pro Gly Gln Glu Val Phe Tyr
Ser Cys Glu Pro Gly Tyr Asp 325 330 335Leu Arg Gly Ala Ala Ser Met
Arg Cys Thr Pro Gln Gly Asp Trp Ser 340 345 350Pro Ala Ala Pro Thr
Cys Glu Val Lys Ser Cys Asp Asp Phe Met Gly 355 360 365Gln Leu Leu
Asn Gly Arg Val Leu Phe Pro Val Asn Leu Gln
Leu Gly 370 375 380Ala Lys Val Asp Phe Val Cys Asp Glu Gly Phe Gln
Leu Lys Gly Ser385 390 395 400Ser Ala Ser Tyr Cys Val Leu Ala Gly
Met Glu Ser Leu Trp Asn Ser 405 410 415Ser Val Pro Val Cys Glu Gln
Ile Phe Cys Pro Ser Pro Pro Val Ile 420 425 430Pro Asn Gly Arg His
Thr Gly Lys Pro Leu Glu Val Phe Pro Phe Gly 435 440 445Lys Thr Val
Asn Tyr Thr Cys Asp Pro His Pro Asp Arg Gly Thr Ser 450 455 460Phe
Asp Leu Ile Gly Glu Ser Thr Ile Arg Cys Thr Ser Asp Pro Gln465 470
475 480Gly Asn Gly Val Trp Ser Ser Pro Ala Pro Arg Cys Gly Ile Leu
Gly 485 490 495His Cys Gln Ala Pro Asp His Phe Leu Phe Ala Lys Leu
Lys Thr Gln 500 505 510Thr Asn Ala Ser Asp Phe Pro Ile Gly Thr Ser
Leu Lys Tyr Glu Cys 515 520 525Arg Pro Glu Tyr Tyr Gly Arg Pro Phe
Ser Ile Thr Cys Leu Asp Asn 530 535 540Leu Val Trp Ser Ser Pro Lys
Asp Val Cys Lys Arg Lys Ser Cys Lys545 550 555 560Thr Pro Pro Asp
Pro Val Asn Gly Met Val His Val Ile Thr Asp Ile 565 570 575Gln Val
Gly Ser Arg Ile Asn Tyr Ser Cys Thr Thr Gly His Arg Leu 580 585
590Ile Gly His Ser Ser Ala Glu Cys Ile Leu Ser Gly Asn Ala Ala His
595 600 605Trp Ser Thr Lys Pro Pro Ile Cys Gln Arg Ile Pro Cys Gly
Leu Pro 610 615 620Pro Thr Ile Ala Asn Gly Asp Phe Ile Ser Thr Asn
Arg Glu Asn Phe625 630 635 640His Tyr Gly Ser Val Val Thr Tyr Arg
Cys Asn Pro Gly Ser Gly Gly 645 650 655Arg Lys Val Phe Glu Leu Val
Gly Glu Pro Ser Ile Tyr Cys Thr Ser 660 665 670Asn Asp Asp Gln Val
Gly Ile Trp Ser Gly Pro Ala Pro Gln Cys Ile 675 680 685Ile Pro Asn
Lys Cys Thr Pro Pro Asn Val Glu Asn Gly Ile Leu Val 690 695 700Ser
Asp Asn Arg Ser Leu Phe Ser Leu Asn Glu Val Val Glu Phe Arg705 710
715 720Cys Gln Pro Gly Phe Val Met Lys Gly Pro Arg Arg Val Lys Cys
Gln 725 730 735Ala Leu Asn Lys Trp Glu Pro Glu Leu Pro Ser Cys Ser
Arg Val Cys 740 745 750Gln Pro Pro Pro Asp Val Leu His Ala Glu Arg
Thr Gln Arg Asp Lys 755 760 765Asp Asn Phe Ser Pro Gly Gln Glu Val
Phe Tyr Ser Cys Glu Pro Gly 770 775 780Tyr Asp Leu Arg Gly Ala Ala
Ser Met Arg Cys Thr Pro Gln Gly Asp785 790 795 800Trp Ser Pro Ala
Ala Pro Thr Cys Glu Val Lys Ser Cys Asp Asp Phe 805 810 815Met Gly
Gln Leu Leu Asn Gly Arg Val Leu Phe Pro Val Asn Leu Gln 820 825
830Leu Gly Ala Lys Val Asp Phe Val Cys Asp Glu Gly Phe Gln Leu Lys
835 840 845Gly Ser Ser Ala Ser Tyr Cys Val Leu Ala Gly Met Glu Ser
Leu Trp 850 855 860Asn Ser Ser Val Pro Val Cys Glu Gln Ile Phe Cys
Pro Ser Pro Pro865 870 875 880Val Ile Pro Asn Gly Arg His Thr Gly
Lys Pro Leu Glu Val Phe Pro 885 890 895Phe Gly Lys Thr Val Asn Tyr
Thr Cys Asp Pro His Pro Asp Arg Gly 900 905 910Thr Ser Phe Asp Leu
Ile Gly Glu Ser Thr Ile Arg Cys Thr Ser Asp 915 920 925Pro Gln Gly
Asn Gly Val Trp Ser Ser Pro Ala Pro Arg Cys Gly Ile 930 935 940Leu
Gly His Cys Gln Ala Pro Asp His Phe Leu Phe Ala Lys Leu Lys945 950
955 960Thr Gln Thr Asn Ala Ser Asp Phe Pro Ile Gly Thr Ser Leu Lys
Tyr 965 970 975Glu Cys Arg Pro Glu Tyr Tyr Gly Arg Pro Phe Ser Ile
Thr Cys Leu 980 985 990Asp Asn Leu Val Trp Ser Ser Pro Lys Asp Val
Cys Lys Arg Lys Ser 995 1000 1005Cys Lys Thr Pro Pro Asp Pro Val
Asn Gly Met Val His Val Ile 1010 1015 1020Thr Asp Ile Gln Val Gly
Ser Arg Ile Asn Tyr Ser Cys Thr Thr 1025 1030 1035Gly His Arg Leu
Ile Gly His Ser Ser Ala Glu Cys Ile Leu Ser 1040 1045 1050Gly Asn
Ala Ala His Trp Ser Thr Lys Pro Pro Ile Cys Gln Leu 1055 1060
1065Cys Gln Pro Pro Pro Asp Val Leu His Ala Glu Arg Thr Gln Arg
1070 1075 1080Asp Lys Asp Asn Phe Ser Pro Gly Gln Glu Val Phe Tyr
Ser Cys 1085 1090 1095Glu Pro Gly Tyr Asp Leu Arg Gly Ala Ala Ser
Met Arg Cys Thr 1100 1105 1110Pro Gln Gly Asp Trp Ser Pro Ala Ala
Pro Thr Cys Glu Val Lys 1115 1120 1125Ser Cys Asp Asp Phe Met Gly
Gln Leu Leu Asn Gly Arg Val Leu 1130 1135 1140Phe Pro Val Asn Leu
Gln Leu Gly Ala Lys Val Asp Phe Val Cys 1145 1150 1155Asp Glu Gly
Phe Gln Leu Lys Gly Ser Ser Ala Ser Tyr Cys Val 1160 1165 1170Leu
Ala Gly Met Glu Ser Leu Trp Asn Ser Ser Val Pro Val Cys 1175 1180
1185Glu Gln Ile Phe Cys Pro Ser Pro Pro Val Ile Pro Asn Gly Arg
1190 1195 1200His Thr Gly Lys Pro Leu Glu Val Phe Pro Phe Gly Lys
Ala Val 1205 1210 1215Asn Tyr Thr Cys Asp Pro His Pro Asp Arg Gly
Thr Ser Phe Asp 1220 1225 1230Leu Ile Gly Glu Ser Thr Ile Arg Cys
Thr Ser Asp Pro Gln Gly 1235 1240 1245Asn Gly Val Trp Ser Ser Pro
Ala Pro Arg Cys Gly Ile Leu Gly 1250 1255 1260His Cys Gln Ala Pro
Asp His Phe Leu Phe Ala Lys Leu Lys Thr 1265 1270 1275Gln Thr Asn
Ala Ser Asp Phe Pro Ile Gly Thr Ser Leu Lys Tyr 1280 1285 1290Glu
Cys Arg Pro Glu Tyr Tyr Gly Arg Pro Phe Ser Ile Thr Cys 1295 1300
1305Leu Asp Asn Leu Val Trp Ser Ser Pro Lys Asp Val Cys Lys Arg
1310 1315 1320Lys Ser Cys Lys Thr Pro Pro Asp Pro Val Asn Gly Met
Val His 1325 1330 1335Val Ile Thr Asp Ile Gln Val Gly Ser Arg Ile
Asn Tyr Ser Cys 1340 1345 1350Thr Thr Gly His Arg Leu Ile Gly His
Ser Ser Ala Glu Cys Ile 1355 1360 1365Leu Ser Gly Asn Thr Ala His
Trp Ser Thr Lys Pro Pro Ile Cys 1370 1375 1380Gln Arg Ile Pro Cys
Gly Leu Pro Pro Thr Ile Ala Asn Gly Asp 1385 1390 1395Phe Ile Ser
Thr Asn Arg Glu Asn Phe His Tyr Gly Ser Val Val 1400 1405 1410Thr
Tyr Arg Cys Asn Leu Gly Ser Arg Gly Arg Lys Val Phe Glu 1415 1420
1425Leu Val Gly Glu Pro Ser Ile Tyr Cys Thr Ser Asn Asp Asp Gln
1430 1435 1440Val Gly Ile Trp Ser Gly Pro Ala Pro Gln Cys Ile Ile
Pro Asn 1445 1450 1455Lys Cys Thr Pro Pro Asn Val Glu Asn Gly Ile
Leu Val Ser Asp 1460 1465 1470Asn Arg Ser Leu Phe Ser Leu Asn Glu
Val Val Glu Phe Arg Cys 1475 1480 1485Gln Pro Gly Phe Val Met Lys
Gly Pro Arg Arg Val Lys Cys Gln 1490 1495 1500Ala Leu Asn Lys Trp
Glu Pro Glu Leu Pro Ser Cys Ser Arg Val 1505 1510 1515Cys Gln Pro
Pro Pro Glu Ile Leu His Gly Glu His Thr Pro Ser 1520 1525 1530His
Gln Asp Asn Phe Ser Pro Gly Gln Glu Val Phe Tyr Ser Cys 1535 1540
1545Glu Pro Gly Tyr Asp Leu Arg Gly Ala Ala Ser Leu His Cys Thr
1550 1555 1560Pro Gln Gly Asp Trp Ser Pro Glu Ala Pro Arg Cys Ala
Val Lys 1565 1570 1575Ser Cys Asp Asp Phe Leu Gly Gln Leu Pro His
Gly Arg Val Leu 1580 1585 1590Phe Pro Leu Asn Leu Gln Leu Gly Ala
Lys Val Ser Phe Val Cys 1595 1600 1605Asp Glu Gly Phe Arg Leu Lys
Gly Ser Ser Val Ser His Cys Val 1610 1615 1620Leu Val Gly Met Arg
Ser Leu Trp Asn Asn Ser Val Pro Val Cys 1625 1630 1635Glu His Ile
Phe Cys Pro Asn Pro Pro Ala Ile Leu Asn Gly Arg 1640 1645 1650His
Thr Gly Thr Pro Ser Gly Asp Ile Pro Tyr Gly Lys Glu Ile 1655 1660
1665Ser Tyr Thr Cys Asp Pro His Pro Asp Arg Gly Met Thr Phe Asn
1670 1675 1680Leu Ile Gly Glu Ser Thr Ile Arg Cys Thr Ser Asp Pro
His Gly 1685 1690 1695Asn Gly Val Trp Ser Ser Pro Ala Pro Arg Cys
Glu Leu Ser Val 1700 1705 1710Arg Ala Gly His Cys Lys Thr Pro Glu
Gln Phe Pro Phe Ala Ser 1715 1720 1725Pro Thr Ile Pro Ile Asn Asp
Phe Glu Phe Pro Val Gly Thr Ser 1730 1735 1740Leu Asn Tyr Glu Cys
Arg Pro Gly Tyr Phe Gly Lys Met Phe Ser 1745 1750 1755Ile Ser Cys
Leu Glu Asn Leu Val Trp Ser Ser Val Glu Asp Asn 1760 1765 1770Cys
Arg Arg Lys Ser Cys Gly Pro Pro Pro Glu Pro Phe Asn Gly 1775 1780
1785Met Val His Ile Asn Thr Asp Thr Gln Phe Gly Ser Thr Val Asn
1790 1795 1800Tyr Ser Cys Asn Glu Gly Phe Arg Leu Ile Gly Ser Pro
Ser Thr 1805 1810 1815Thr Cys Leu Val Ser Gly Asn Asn Val Thr Trp
Asp Lys Lys Ala 1820 1825 1830Pro Ile Cys Glu Ile Ile Ser Cys Glu
Pro Pro Pro Thr Ile Ser 1835 1840 1845Asn Gly Asp Phe Tyr Ser Asn
Asn Arg Thr Ser Phe His Asn Gly 1850 1855 1860Thr Val Val Thr Tyr
Gln Cys His Thr Gly Pro Asp Gly Glu Gln 1865 1870 1875Leu Phe Glu
Leu Val Gly Glu Arg Ser Ile Tyr Cys Thr Ser Lys 1880 1885 1890Asp
Asp Gln Val Gly Val Trp Ser Ser Pro Pro Pro Arg Cys Ile 1895 1900
1905Ser Thr Asn Lys Cys Thr Ala Pro Glu Val Glu Asn Ala Ile Arg
1910 1915 1920Val Pro Gly Asn Arg Ser Phe Phe Thr Leu Thr Glu Ile
Ile Arg 1925 1930 1935Phe Arg Cys Gln Pro Gly Phe Val Met Val Gly
Ser His Thr Val 1940 1945 1950Gln Cys Gln Thr Asn Gly Arg Trp Gly
Pro Lys Leu Pro His Cys 1955 1960 1965Ser Arg Val Cys Gln Pro Pro
Pro Glu Ile Leu His Gly Glu His 1970 1975 1980Thr Leu Ser His Gln
Asp Asn Phe Ser Pro Gly Gln Glu Val Phe 1985 1990 1995Tyr Ser Cys
Glu Pro Ser Tyr Asp Leu Arg Gly Ala Ala Ser Leu 2000 2005 2010His
Cys Thr Pro Gln Gly Asp Trp Ser Pro Glu Ala Pro Arg Cys 2015 2020
2025Thr Val Lys Ser Cys Asp Asp Phe Leu Gly Gln Leu Pro His Gly
2030 2035 2040Arg Val Leu Leu Pro Leu Asn Leu Gln Leu Gly Ala Lys
Val Ser 2045 2050 2055Phe Val Cys Asp Glu Gly Phe Arg Leu Lys Gly
Arg Ser Ala Ser 2060 2065 2070His Cys Val Leu Ala Gly Met Lys Ala
Leu Trp Asn Ser Ser Val 2075 2080 2085Pro Val Cys Glu Gln Ile Phe
Cys Pro Asn Pro Pro Ala Ile Leu 2090 2095 2100Asn Gly Arg His Thr
Gly Thr Pro Phe Gly Asp Ile Pro Tyr Gly 2105 2110 2115Lys Glu Ile
Ser Tyr Ala Cys Asp Thr His Pro Asp Arg Gly Met 2120 2125 2130Thr
Phe Asn Leu Ile Gly Glu Ser Ser Ile Arg Cys Thr Ser Asp 2135 2140
2145Pro Gln Gly Asn Gly Val Trp Ser Ser Pro Ala Pro Arg Cys Glu
2150 2155 2160Leu Ser Val Pro Ala Ala Cys Pro His Pro Pro Lys Ile
Gln Asn 2165 2170 2175Gly His Tyr Ile Gly Gly His Val Ser Leu Tyr
Leu Pro Gly Met 2180 2185 2190Thr Ile Ser Tyr Ile Cys Asp Pro Gly
Tyr Leu Leu Val Gly Lys 2195 2200 2205Gly Phe Ile Phe Cys Thr Asp
Gln Gly Ile Trp Ser Gln Leu Asp 2210 2215 2220His Tyr Cys Lys Glu
Val Asn Cys Ser Phe Pro Leu Phe Met Asn 2225 2230 2235Gly Ile Ser
Lys Glu Leu Glu Met Lys Lys Val Tyr His Tyr Gly 2240 2245 2250Asp
Tyr Val Thr Leu Lys Cys Glu Asp Gly Tyr Thr Leu Glu Gly 2255 2260
2265Ser Pro Trp Ser Gln Cys Gln Ala Asp Asp Arg Trp Asp Pro Pro
2270 2275 2280Leu Ala Lys Cys Thr Ser Arg Thr His Asp Ala Leu Ile
Val Gly 2285 2290 2295Thr Leu Ser Gly Thr Ile Phe Phe Ile Leu Leu
Ile Ile Phe Leu 2300 2305 2310Ser Trp Ile Ile Leu Lys His Arg Lys
Gly Asn Asn Ala His Glu 2315 2320 2325Asn Pro Lys Glu Val Ala Ile
His Leu His Ser Gln Gly Gly Ser 2330 2335 2340Ser Val His Pro Arg
Thr Leu Gln Thr Asn Glu Glu Asn Ser Arg 2345 2350 2355Val Leu Pro
236049PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 4Tyr Pro Tyr Asp Val Pro Asp Tyr Ala1
5510PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 5Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu1 5
1068PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 6Asp Tyr Lys Asp Asp Asp Asp Lys1
5754DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 7gagggcagag gaagtcttct aacatgcggt
gacgtggagg sgsstcccgg ccct 54827DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 8tacccctatg
acgtgcccga ctatgcc 27921DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 9tcctgaggag aagtctgccg t
211021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 10ggagtggaca gatccccaaa g 211120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
11tctcctgccg acaagaccaa 201222DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 12gcagtggctt agcttgaagt tg
221322DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 13caacttcaag ctaagccact gc 221419DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
14cggtgctcac agaagccag 191520DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 15gactgctgtc aatgccctgt
201621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 16aaaggcacct agcaccttct t 211725DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
17cactggagct acagacaaga aggtg 251824DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
18tctcccacca tagaagatac cagg 241921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
19aagagcctca ggatccagca c 212021DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 20tcagcagtga tggatggaca c
212124DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 21cgcagctagg aataatggaa tagg 242219DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
22catggcctca gttccgaaa 19238PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 23Gly Gly Gly Ser Gly Gly Gly
Ser1 52415PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 24Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly
Gly Gly Ser1 5 10 15255PRTArtificial SequenceDescription of
Artificial Sequence Synthetic
peptideMOD_RES(3)..(3)Any amino acid 25Leu Pro Xaa Thr Gly1
5265PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptideMOD_RES(3)..(3)Any amino acid 26Leu Pro Xaa Thr
Ala1 5276PRTArtificial SequenceDescription of Artificial Sequence
Synthetic 6xHis tag 27His His His His His His1 52820PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 28His
Trp Met Val Leu Pro Trp Leu Pro Gly Thr Leu Asp Gly Gly Ser1 5 10
15Gly Cys Arg Gly 20296PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 29Leu Pro Glu Thr Gly Gly1
53018PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 30Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly
Glu Gly Ser Thr1 5 10 15Lys Gly
* * * * *