U.S. patent application number 16/394097 was filed with the patent office on 2019-10-17 for compositions and methods for treating viral infections through stimulated innate immunity in combination with antiviral compound.
The applicant listed for this patent is BAYLOR COLLEGE OF MEDICINE, BOARD OF REGENTS, THE UNIVERSITY OF TEXAS SYSTEM, PULMOTECT, INC.. Invention is credited to Burton DICKEY, Scott EVANS, Brian Gilbert, Diane Markesich, Brenton Scott, Michael TUVIM.
Application Number | 20190314497 16/394097 |
Document ID | / |
Family ID | 55524757 |
Filed Date | 2019-10-17 |
![](/patent/app/20190314497/US20190314497A1-20191017-D00001.png)
![](/patent/app/20190314497/US20190314497A1-20191017-D00002.png)
![](/patent/app/20190314497/US20190314497A1-20191017-D00003.png)
![](/patent/app/20190314497/US20190314497A1-20191017-D00004.png)
United States Patent
Application |
20190314497 |
Kind Code |
A1 |
DICKEY; Burton ; et
al. |
October 17, 2019 |
COMPOSITIONS AND METHODS FOR TREATING VIRAL INFECTIONS THROUGH
STIMULATED INNATE IMMUNITY IN COMBINATION WITH ANTIVIRAL
COMPOUNDS
Abstract
Embodiments are directed to compositions and methods for
treating viral infections.
Inventors: |
DICKEY; Burton; (Houston,
TX) ; EVANS; Scott; (Bellaire, TX) ; Gilbert;
Brian; (Houston, TX) ; Markesich; Diane;
(Houston, TX) ; Scott; Brenton; (Houston, TX)
; TUVIM; Michael; (Houston, TX) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
PULMOTECT, INC.
BOARD OF REGENTS, THE UNIVERSITY OF TEXAS SYSTEM
BAYLOR COLLEGE OF MEDICINE |
Houston
Austin
Houston |
TX
TX
TX |
US
US
US |
|
|
Family ID: |
55524757 |
Appl. No.: |
16/394097 |
Filed: |
April 25, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14860205 |
Sep 21, 2015 |
10286065 |
|
|
16394097 |
|
|
|
|
62053013 |
Sep 19, 2014 |
|
|
|
62053610 |
Sep 22, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 9/0078 20130101;
A61K 38/07 20130101; A61K 31/7056 20130101; A61K 31/215 20130101;
A61P 31/12 20180101; A61K 38/08 20130101; Y02A 50/388 20180101;
A61K 31/24 20130101; A61K 39/39 20130101; A61K 38/06 20130101; A61K
2039/55561 20130101; Y02A 50/30 20180101; A61K 38/05 20130101; A61K
45/06 20130101; A61K 31/7056 20130101; A61K 2300/00 20130101; A61K
31/215 20130101; A61K 2300/00 20130101; A61K 38/08 20130101; A61K
2300/00 20130101; A61K 38/07 20130101; A61K 2300/00 20130101; A61K
38/06 20130101; A61K 2300/00 20130101; A61K 38/05 20130101; A61K
2300/00 20130101 |
International
Class: |
A61K 39/39 20060101
A61K039/39; A61K 31/7056 20060101 A61K031/7056; A61K 31/24 20060101
A61K031/24; A61K 38/07 20060101 A61K038/07; A61K 38/06 20060101
A61K038/06; A61K 38/05 20060101 A61K038/05; A61K 38/08 20060101
A61K038/08; A61K 31/215 20060101 A61K031/215; A61K 45/06 20060101
A61K045/06; A61K 9/00 20060101 A61K009/00 |
Goverment Interests
STATEMENT REGARDING FEDERALLY FUNDED RESEARCH
[0002] This invention was made with government support under grant
number 1R43HL118926-01A1, 1DP2HL123229-01, and 1R01HL117976-01A1
awarded by the National Heart Lung and Blood Institute or the
National Institutes of Health. The government has certain rights in
the invention.
Claims
1. A composition comprising: (a) PAM.sub.2CSK.sub.4lipopeptide, (b)
immune stimulatory Toll-Like Receptor 9 (TLR) agonist oligodeoxy
nucleotide, and (c) antiviral pharmaceutical, selected from
nucleotide or nucleoside analogs, sialidase inhibitor, or protease
inhibitor.
2. (canceled)
3. The composition of claim 1, wherein the immune stimulatory
oligodeoxynucleotide is a type C oligodeoxynucleotide (ODN).
4. The composition of claim 3, wherein the immune stimulatory
oligodeoxynucleotide is ODN2395 or ODNM362 or ODN10101.
5. (canceled)
6. The composition of claim 1, wherein the composition is
formulated for administration to the lungs.
7. A method of treating, inhibiting, or attenuating a viral
infection comprising administering an effective amount of the
composition of claim 1 to an individual that has or is at risk of
viral infection.
8. The method of claim 7, wherein the subject has been exposed to a
virus.
9. (canceled)
10. (canceled)
11. The method of claim 7, wherein the composition is administered
by nebulization.
12. (canceled)
13. A method of treating, inhibiting, or attenuating a viral
infection comprising administering an effective amount of the
composition comprising an aerosolized (a)
PAM.sub.2CSK.sub.4lipopeptide and (b) immune stimulatory Toll-Like
Receptor 9 (TLR) agonist oligodeoxy nucleotide in combination with
an orally administered composition comprising an anti-viral
pharmaceutical to an individual that has or is at risk of viral
infection.
14. (canceled)
15. The method of claim 13, wherein the immune stimulatory
oligodeoxynucleotide is a type C oligodeoxynucleotide (ODN).
16. The method of claim 13, wherein the immune stimulatory
oligodeoxynucleotide is ODN2395 or ODNM362 or ODN10101.
17. The method of claim 13, wherein the antiviral pharmaceutical is
a nucleotide or nucleoside analogs, sialidase inhibitor, or
protease inhibitor.
18.-25. (canceled)
Description
PRIORITY
[0001] This application is a continuation from U.S. application
Ser. No. 14/860,205 filed Sep. 21, 2015, which claims priority to
U.S. Provisional Applications 62/053,013 filed Sep. 19, 2014 and
62/053,610 filed Sep. 22, 2014; each of which is incorporated
herein by reference.
BACKGROUND OF THE INVENTION
I. Field of the Invention
[0003] The present invention relates generally to the fields of
virology, immunology, and antimicrobial pharmacotherapy. More
particularly the compositions and methods of the invention related
to increasing the resistance of an individual to viral
infection.
II. Background
[0004] The susceptibility of the lungs to infection arises from the
architectural requirements of gas exchange. To support ventilation,
humans continuously expose about 80 m.sup.2 lung surface area to
the external environment. Lungs are exposed not only to air, but
also the particles, droplets, and pathogens that are suspended in
the air. Unlike cutaneous surfaces that are wrapped in impermeable
skin or the gastrointestinal tract with a thick adsorbent blanket
of mucus, the lungs present a large environmental interface with a
minimal barrier defense. A more substantial barrier is precluded by
the demand for unimpeded gaseous diffusion.
[0005] Despite their structural vulnerability, the lungs generally
defend themselves successfully against infection through a variety
of mechanical, humoral, and cellular mechanisms (Knowles et al.,
2002; Martin and Frevert, 2005; Rogan, et al., 2006; Travis, et
al., 2001); (Mizgerd, 2008; Bals and Hiemstra, 2004; Bartlett et
al., 2008; Hiemstra, 2007; Hippenstiel et al., 2006; Schutte and
McCray, 2002). Most inhaled microbial pathogens fail to penetrate
to the alveoli due to impaction against the airway walls, where
they are entrapped by mucus and then expelled via the mucociliary
escalator system (Knowles et al., 2002). For those pathogens that
escape this fate, the constitutive presence of antimicrobial
peptides in the airway lining fluid limits their growth (Rogan, et
al., 2006; Travis, et al., 2001). Alveolar macrophages that reside
in the most distal airspaces are able to ingest these organisms,
thereby clearing the lungs from a potential infection.
[0006] Though often regarded as passive gas exchange barriers, the
airway and alveolar epithelia supplement the baseline lung defenses
by undergoing remarkable local structural and functional changes
when pathogenic stimuli are encountered. In response to viral,
fungal, or allergic inflammation, airway secretory cells rapidly
increase their height and fill their apical cytoplasm with
secretory granules, a process termed inflammatory metaplasia (Evans
et al., 2004; Williams et al., 2006). In the presence of pathogens,
the alveolar epithelia activate their plasmalemmal systems and
secretory machinery, thereby engaging leukocytes in lung protection
(Evans et al., 2005). Perhaps most importantly, microbial
interactions with respiratory epithelial pattern recognition
receptors causes numerous microbicidal products to be expressed
into the airway lining fluid, including defensins, cathelicidins,
lysozyme, and reactive oxygen species (Rogan et al., 2006; Forteza
et al., 2005; Akinbi et al., 2000; Bals 15 and Hiemstra, 2004; Bals
and Hiemstra, 2006). It is of note that pneumonia (bacterial or
viral) is the leading cause of death from infection worldwide.
[0007] There is a need for additional methods and compositions for
inhibiting and/or treating viral infections.
SUMMARY
[0008] Certain embodiments are directed to compositions and methods
for treating viral infections. In certain aspects the viral
infection is a viral infection of the lungs. Other embodiments are
directed to delivery devices containing an anti-viral
composition(s). In certain aspects the delivery devices contain a
formulation with activity against a broad spectrum of viruses. In a
further aspect a delivery device can contain a formulation
comprising one or more anti-viral drugs that target a specific
family of viruses. Studies have shown that the combination
treatments described herein are mechanism independent and that
administration of a lipopeptide(s) and immune stimulatory
oligonucleotide(s) can be co-administered or combined with a
variety of antivirals having a variety of therapeutic mechanisms
and targets. Thus, lipopeptide/oligonucleotide compositions and
treatments can be effectively combined with wide variety of
antivirals and are not limited to any particular antiviral.
[0009] Certain embodiments are directed to compositions that
increase resistance of a subject to viruses when administered to
the subject. Additional embodiments are directed to methods of
using such compositions to attenuate viral infection in the
subject. Thus, embodiments include, but are not limited to
compositions, formulations, and methods for the enhancement of a
mammalian (e.g., a human) subject's biological defenses against
viral infection. In certain aspects compositions are administered
or deposited in an effective amount in the lungs of a subject. In
certain aspects the compositions and methods provide a rapid and
temporal increase in resistance to infection and/or augmentation of
biological defenses against viral infection. Attenuation of viral
infection can be by inhibiting, treating, or preventing virus
infection or replication or survival. In specific embodiments the
subject is a human patient.
[0010] Aspects described here increase resistance to infection and
enhance the defenses of the lung and respiratory tract of a
subject. A subject administered a composition described herein is
afforded a therapeutic, prophylactic, or therapeutic and
prophylactic response to a potentially infecting virus.
[0011] Certain embodiments are directed to formulations or
co-formulations of active components to provide for an anti-viral
effect. In certain aspects a co-formulation comprises one or more
(a) lipopeptide(s), (b) immune stimulatory oligonucleotide(s), or
(c) antiviral drug(s). In certain aspects the anti-viral
compositions contain an effective amount of at least one, two, or
three of the following: (a) lipopeptide, (b) stimulatory
oligonucleotide, or (c) antiviral drug(s). In certain aspects one
or more lipopeptides can be included in a formulation. In a further
aspect one or more stimulatory oligonucleotides can be included in
a formulation. In still a further aspect one or more anti-viral
drugs can be included in a formulation. The term stimulatory
oligonucleotide and immune stimulatory oligonucleotide are used
interchangeably to refer to an immune stimulatory oligonucleotide.
In certain aspects the lipopeptide and stimulatory oligonucleotide
are co-formulated or administered simultaneously, i.e.
lipopeptide/stimulatory oligonucleotide co-administration. In a
further aspect the lipopeptide/stimulatory oligonucleotide
co-administration is administered in conjunction with
administration of an additional antiviral drug or therapy.
"Administered in conjunction" or "coadministration" as used herein
refers to administration of two or more active agents in a manner
that will allow them to be present together in-vivo for period of
time. Accordingly, while the term "coadministration" includes
simultaneous administration of two or more active agents, and
administration from a single formulation, it is to be understood
that it is not limited thereto.
[0012] In certain aspects a lipopeptide is selected from diacyl and
triacyl lipopeptides. In certain aspects a lipopeptide is FSL-1;
Pam3Cys (tripalmitoyl-S-glyceryl cysteine);
S-[2,3-bis(palmitoyloxy)-(2RS)-propyl]-N-palmitoyl-(R)-cysteine;
(S-[2,3-bis(palmitoyloxy)-(2-R,S)-propyl]-Npalmitoyl-(R)-Cys-(S)-Ser-(Lys-
)4-hydroxytrihydrochloride; Pam3Cys-Ser-Ser-Asn-Ala;
PaM3Cys-Ser-(Lys)4; Pam3Cys-Ala-Gly; Pam3Cys-Ser-Gly; Pam3Cys-Ser;
PaM3Cys-OMe; Pam3Cys-OH; PamCAG
(palmitoyl-Cys((RS)-2,3-di(palmitoyloxy)-propyl)-Ala-Gly-OH); or
Pam2CSK4 (PaM2CSK4, dipalmitoyl-S-glyceryl
cysteine-serine-(lysine)4), Pam2Cys-Ser-(Lys)4). In certain aspects
the lipopeptide is PAM2CSK4.
[0013] In certain aspects a stimulatory oligonucleotide is a type
A, B, or C oligodeoxynucleotide (ODN). In certain aspects the
stimulatory oligonucleotide is a type C ODN. In a further aspect
the ODN is ODN2395 (tcgtcgttttcggcgcgcgccg (SEQ ID NO:1) or ODNM362
(tcgtcgtcgttcgaacgacgttgat (SEQ ID NO:2) or ODN10101
(tcgtcgttttcgcgcgcgccg (SEQ ID NO:3).
[0014] In certain aspects an antiviral drug is a drug that effects
the biology of a virus and attenuates or inhibits attachment,
entry, replication, shedding, latency or a combination thereof. In
a further aspect the antiviral drug can be a viral mimetic, a
nucleotide analog, a sialidase inhibitor, or a protease inhibitor.
In certain aspects the anti-viral drug is a neuraminidase inhibitor
or nucleotide analog. In a particular aspect the anti-viral drug is
amantadine, rimantadine, ribavirin, zanamivir, or oseltamivir. In
certain aspects the antiviral drug is a small molecule, or an
antibody or antibody fragment.
[0015] In certain embodiments the lipopeptide is PAM2CSK4; the
stimulatory oligonucleotide is ODN2395 (tcgtcgttttcggcgcgcgccg (SEQ
ID NO:1) or ODNM362 (tcgtcgtcgttcgaacgacgttgat (SEQ ID NO:2) or
ODN10101 (tcgtcgttttcgcgcgcgccg (SEQ ID NO:3); and the antiviral
drug is amantadine, rimantadine, ribavirin, zanamivir, or
oseltamivir.
[0016] In one embodiment, the anti-viral compositions contain about
0.1, 0.5, 1, 5, or 10% to about 1, 5, 10, or 20% by weight of at
least one of (a) lipopeptide(s), (b) stimulatory
oligonucleotide(s), or (c) antiviral drug(s).
[0017] In certain aspects a formulation can comprise a lipopeptide
in an amount that is at least, less than or about 0.1, 1, 5, 10,
15, 20, 25, 30, 35, 40, 45, 50, or 55% by weight or volume (or any
range derivable therein).
[0018] In certain aspects a formulation can comprise a stimulatory
oligonucleotide in an amount that is at least, less than or about
0.1, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or 55% by weight or
volume (or any range derivable therein).
[0019] In certain aspects a formulation can comprise an anti-viral
drug in an amount that is at least, less than or about 0.1, 1, 5,
10, 15, 20, 25, 30, 35, 40, 45, 50, or 55% by weight or volume (or
any range derivable therein).
[0020] In one embodiment, the antiviral compositions contain at
least one of (a) lipopeptide, (b) stimulatory oligonucleotide, or
(c) antiviral drug(s). In another embodiment, the anti-viral
compositions contain at least two (a) lipopeptide, (b) stimulatory
oligonucleotide, or (c) antiviral drug(s). In still another
embodiment the anti-viral compositions contain a (a) lipopeptide,
(b) stimulatory oligonucleotide, and (c) antiviral drug(s).
[0021] In one embodiment, the weight ratio of (a) lipopeptide, (b)
stimulatory oligonucleotide, or (c) antiviral drug(s) relative to
each other in the anti-viral compositions includes or is at least
or at most 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 parts lipopeptide (or
any range derivable therein) to, to at least, or to at most 0, 1,
2, 3, 4, 5, 6, 7, 8, 9, 10 parts stimulatory oligonucleotide (or
any range derivable therein) to, to at least or to at most 0, 1, 2,
3, 4, 5, 6, 7, 8, 9, 10 parts anti-viral drug (or any range
derivable therein). In certain aspects a formulation can comprise
about 4 parts lipopeptide, about 1 part stimulatory
oligonucleotide. In additional embodiments, there is also about or
at least about, or at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
parts antiviral drug (or any range derivable therein).
[0022] In certain embodiments a composition can comprise, comprise
at least or comprise at most 0, 0.01, 0.05, 0.1, 0.5, 1, 1.5, 2.0,
2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 10 g of lipopeptide (or any range
derivable therein) per 1. 5, or 10 mL; 0, 0.01, 0.05, 0.1, 0.5, 1,
1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 10 g of stimulatory
oligonucleotide (or any range derivable therein) per 1, 5, or 10
mL; and/or 0, 0.01, 0.05, 0.1, 0.5, 1, 1.5, 2.0, 2.5, 3.0, 3.5,
4.0, 4.5, 5.0, 10, 50 up to 100 g of antiviral drug(s) (or any
range derivable therein) per 1, 5, or 10 mL.
[0023] Certain embodiments are directed to methods of treating,
inhibiting, or attenuating a viral infection in a subject who has
or is at risk for developing such an infection. The methods
comprising administering an effective amount of an anti-viral
composition described herein.
[0024] In certain embodiments a lipopeptide and stimulatory
oligonucleotide can be administered via the respiratory system and
an anti-viral drug can be administered orally or
intravascularly.
[0025] Certain embodiments are directed to compositions capable of
being administered to the respiratory tract 1, 2, 3, 4, or more
times a day, week, or month (or any combination derivable
therein).
[0026] In other aspects a composition is administered in a
nebulized formulation. The (a) lipopeptide, (b) stimulatory
oligonucleotide, or (c) antiviral drug(s) can be administered in an
amount, selected independently for each component, from about,
about at least or about at most 0.1, 1, 5, 10, 50 .mu.g or mg/kg to
about, about at least or about at most 5, 10, 50, 100 .mu.g or
mg/kg of the subject's body weight, including all values and ranges
there between.
[0027] Compositions described herein can be administered via the
respiratory tract. Methods of the invention include the
administration of a composition by inhalation or other methods of
administration to the upper and/or lower respiratory tract. In
certain aspects, the anti-viral composition is administered in a
nebulized or aerosolized formulation. In a further aspect the
composition is aerosolized or nebulized or in a form that can be
inhaled by or instilled in a subject. The composition can be
administered by inhalation or inspiration. The anti-viral
composition, including (a) lipopeptide, (b) stimulatory
oligonucleotide, or (c) antiviral drug(s), can be administered in
an amount of from about, or at least or at most about, 0.01, 0.05.
0.1, 25 0.5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65,
70 .mu.g or mg/kg (or any range derivable therein) to about, or at
least or at most about, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100,
125, 150, 200 .mu.g or mg/kg (or any range derivable therein) of
the subject's body weight. In other aspects, a subject can be
administered about, or at least or at most about 0.01, 0.05. 0.1,
0.5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75,
80, 85, 90, 95, 100, 125, 150, 200 .mu.g or mg (or any range
derivable therein) of (a) lipopeptide, (b) stimulatory
oligonucleotide, or (c) antiviral drug(s) individually or in
combination (total amount). The subject can be at risk of exposure
to or exposed to a virus. Still further embodiments include methods
where the composition is administered before; after; during; before
and after; before and during; during and after; before, after, and
during exposure or suspected exposure or heightened risk of
exposure to the virus. The subject can be exposed to a bioweapon or
to an opportunistic pathogen. In particular aspects the subject is
immunocompromised, such as an infant, a cancer patient, or an AIDS
patient. In certain aspects the subject is located in an area
having or at risk of having a viral outbreak.
[0028] Certain embodiments include a pharmaceutical composition
comprising or consisting essentially of PAM2CSK4, ODNM362, and
optionally an antiviral agent, that is formulated for aerosolized
or nebulized delivery. In certain embodiments the antiviral agent
is ribavirin or oseltamivir. Methods include treating a patient for
a virus infection comprising administering to the patient effective
amounts of PAM2CSK4 and ODNM362, and optionally administering an
antiviral agent, wherein the PAM2CSK4 and ODNM362 are administered
to the patient as an aerosol or with a nebulizer. In certain
embodiments, treatment of the virus infection does not include an
active agent other than a lipopeptide, a stimulatory
oligonucleotide (such as a Class C ODN, including ODNM362), and an
antiviral drug. In certain aspects the compositions or methods
specifically exclude an antigen or immunogen targeting a specific
virus or group viruses.
[0029] In certain aspects the virus is an Adenoviridae,
Coronaviridae, Filoviridae, Flaviviridae, Hepadnaviridae,
Herpesviridae, Orthomyxoviridae, Paramyxovirinae, Pneumovirinae,
Picornaviridae, Poxyiridae, Retroviridae, or Togaviridae virus. In
a further aspect a virus is Parainfluenza, Influenza (seasonal,
swine, avian, etc.), Marburg, Ebola, Severe acute respiratory
syndrome coronavirus, Yellow fever virus, Human respiratory
syncytial virus, Hantavirus, measles, MERS, rhinovirus, human
metapneumovirus, or Vaccinia virus. In other aspects the virus is
influenza, RSV, or parainfluenza virus. In a further aspect the
virus can be a Severe acute respiratory syndrome coronovirus
(SARS-COV) or Middle Eastern Respiratory Syndrome coronavirus
(MERS-COV).
[0030] The terms "attenuating," "inhibiting," "reducing," or
"prevention," or any variation of these terms, when used in the
claims and/or the specification includes any measurable decrease or
complete inhibition to achieve a desired result, e.g., reduction in
post-exposure viral survival, load, or growth.
[0031] As used herein, "an effective amount" means the
concentration or quantity or level of the active compound(s) of the
present invention that can attain a particular medical end, such as
control or destruction of virally-infected cells or viruses,
without producing unacceptable toxic symptoms. The term "effective
amount" also refers to the quantity of an active compound(s) that
is sufficient to yield a desired therapeutic response without undue
adverse side effects (such as toxicity, irritation, or allergic
response) commensurate with a reasonable benefit/risk ratio when
used in the manner of this invention. The specific "effective
amount" can vary with such factors as the particular condition
being treated, the physical condition of the patient, the type of
mammal being treated, the duration of the treatment, the nature of
concurrent therapy (if any), and the specific formulations
employed.
[0032] Other embodiments of the invention are discussed throughout
this application. Any embodiment discussed with respect to one
aspect of the invention applies to other aspects of the invention
as well and vice versa. Each embodiment described herein is
understood to be embodiments of the invention that are applicable
to all aspects of the invention. It is contemplated that any
embodiment discussed herein can be implemented with respect to any
method or composition of the invention, and vice versa.
Furthermore, compositions and kits of the invention can be used to
achieve methods of the invention.
[0033] The use of the word "a" or "an" when used in conjunction
with the term "comprising" in the claims and/or the specification
may mean "one," but it is also consistent with the meaning of "one
or more," "at least one," and "one or more than one."
[0034] Throughout this application, the term "about" is used to
indicate that a value includes the standard deviation of error for
the device or method being employed to determine the value.
[0035] The use of the term "or" in the claims is used to mean
"and/or" unless explicitly indicated to refer to alternatives only
or the alternatives are mutually exclusive, although the disclosure
supports a definition that refers to only alternatives and
"and/or."
[0036] As used in this specification and claim(s), the words
"comprising" (and any form of comprising, such as "comprise" and
"comprises"), "having" (and any form of having, such as "have" and
"has"), "including" (and any form of including, such as "includes"
and "include") or "containing" (and any form of containing, such as
"contains" and "contain") are inclusive or open-ended and do not
exclude additional, unrecited elements or method steps.
[0037] Other objects, features and advantages of the present
invention will become apparent from the following detailed
description. It should be understood, however, that the detailed
description and the specific examples, while indicating specific
embodiments of the invention, are given by way of illustration
only, since various changes and modifications within the spirit and
scope of the invention will become apparent to those skilled in the
art from this detailed description.
DESCRIPTION OF THE DRAWINGS
[0038] The following drawings form part of the present
specification and are included to further demonstrate certain
aspects of the present invention. The invention may be better
understood by reference to one or more of these drawings in
combination with the detailed description of the specification
embodiments presented herein.
[0039] FIG. 1. Effect of PUL-042 on percent survival compared to
untreated control mice following lethal challenge of influenza
infection. The x-axis indicates the day on which PUL-042 and/or
oseltamivir was administered relative to influenza infection.
[0040] FIG. 2. Effect of timing of multiple doses of combination
treatment with PUL-042 and oseltamivir on survival of a lethal
influenza challenge. The x-axis indicates the day of initiation of
treatment and timing of subsequent treatments relative to the
influenza challenge. * Statistically significant difference from
untreated controls. ** Combined results of treatments starting at
D3 or D4, Ave.=49.8%, P<0.001. *** Combination D1 and D4, while
a strong result, was performed only once and statistical
significance was not determined.
[0041] FIG. 3. Effect of PUL-042 combination treatment with
ribavirin on survival of a lethal influenza challenge. Initiating
treatment on D1 after infection increased the percent survival to
95% compared to untreated controls.
[0042] FIG. 4. Effect of PUL-042 on percent survival following
lethal challenge of three influenza viruses. Fifteen outbred NIH
Swiss-Webster mice were used in each group. The x-axis indicates
the day on which PUL-042 and/or oseltamivir was administered
relative to infection challenge.
[0043] FIG. 5. Prior aerosolized PUL-042 treatment fully protects
mice against lethal SARS-COV infection (-24 hrs; challenge dose:
5.times.LD.sub.50).
[0044] FIG. 6. Prior aerosolized PUL-042 treatment reduces
pulmonary yields of infectious SARS-COV (-24 hrs; challenge dose:
5.times.LD50; 3 dpi).
[0045] FIG. 7. Prior treatment with aerosolized PUL-042
significantly reduced the viral loads in MERS-COV-challenged mice
(3 dpi).
DESCRIPTION
[0046] The immune system is the system of specialized cells and
organs that protect an organism from outside biological influences.
When the immune system is functioning properly, it protects the
body against microbial infections, and destroys cancer cells and
foreign substances. If the immune system weakens, its ability to
defend the body also weakens, allowing pathogens to grow in the
body.
[0047] The immune system is often divided into: (a) an innate
immunity comprised of components that provide an immediate
"first-line" of defense to continuously ward off pathogens and (b)
an adaptive (acquired) immunity comprising the production of
antibodies and production or stimulation of T-cells specifically
designed to target particular pathogens. Using adaptive immunity
the body can develop over time a specific immunity to particular
pathogen(s). This response takes days to develop, and so is not
effective at preventing an initial invasion, but it will normally
prevent any subsequent infection, and also aids in clearing up
longer-lasting infections.
[0048] In response to certain inflammatory stimuli, the secretory
cells of the airway epithelium of mice and humans rapidly undergo a
remarkable change in structure termed inflammatory metaplasia. Most
of the structural changes can be ascribed to increased production
of secreted, gel-forming mucins, while additional macromolecules
with functions in mucin secretion, microbial killing or
inflammatory signaling are also upregulated. The physiologic
function of this response is thought to be augmentation of local
defenses against microbial and helminthic pathogens, although that
hypothesis has received only limited formal testing. Paradoxically,
excessive production and secretion of gel-forming mucins is a major
cause of airflow obstruction in common inflammatory diseases of the
airways such as asthma, cystic fibrosis, and chronic obstructive
pulmonary disease (COPD). The stimulation of innate immunity
without the production or with the reduced production of mucin
provides an additional method of attenuating infection of the
respiratory tract by preventing and/or treating a viral infection
of a subject.
III. ANTI-VIRAL COMPOSITIONS AND TREATMENTS
[0049] The compositions and methods of the present invention may be
used in the context of a number of therapeutic or prophylactic
applications. In order to increase the effectiveness of a treatment
with the compositions described or to augment the protection of
another therapy (second therapy), e.g., vaccination or
antimicrobial therapy, it may be desirable to combine these
compositions and methods with other agents and methods effective in
the treatment, reduction of risk of infection, or prevention of
diseases and pathologic conditions, for example, anti-viral
treatments. In certain aspects a plurality of components are
formulated in a composition for administration to a subject in need
of such.
[0050] Administration of a composition described to a subject will
follow general protocols for the administration via the respiratory
system, and the general protocols for the administration of a
particular secondary therapy will also be followed, taking into
account the toxicity, if any, of the treatment. It is expected that
the treatment cycles would be repeated as necessary. It also is
contemplated that various standard therapies, as well as
vaccination, may be applied in combination with the described
therapies.
[0051] In certain embodiments a composition can comprise one or
more of (a) lipopeptide, (b) stimulatory oligonucleotide, and/or
(c) anti-viral drug(s), in various combinations. Combination being
in the form of co-formulation or alternatively co-administration of
components.
[0052] A. Lipopeptides
[0053] Lipopeptides include synthetic triacylated and diacylated
lipopeptides. The peptide component can include single amino acids
such as cysteine or short 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid
peptides. In certain aspects the peptide can include one or more
amino terminal serine and 1, 2, 3, 4, or more carboxy terminal
asparagine, glycine, alanine, lysine residues or combinations
thereof. A nonlimiting example of lipopeptide is FSL-1 (a synthetic
lipoprotein derived from Mycoplasma salivarium 1), Pam3Cys
(tripalmitoyl-S-glyceryl
cysteine)S-[2,3-bis(palmitoyloxy)-(2RS)-propyl]-N-palmitoyl-(R)-cysteine,
where "Pam3" is "tripalmitoyl-Sglyceryl") (Aliprantis et al.,
1999), derivatives of Pam3Cys
(S-[2,3-bis(palmitoyloxy)-(2-R,S)-propyl]-Npalmitoyl-(R)-Cys-(S)-Ser-(Lys-
)4-hydroxytrihydrochloride; Pam3 Cys-Ser-Ser-Asn-Ala; PaM3
Cys-Ser-(Lys)4; Pam3 Cys-Ala-Gly; Pam3 Cys-Ser-Gly; Pam3 Cys-Ser;
PaM3Cys-OMe; Pam3Cys-OH; PamCAG,
palmitoyl-Cys((RS)-2,3-di(palmitoyloxy)-propyl)-Ala-Gly-OH;
Pam2CSK4 (PaM2CSK4, dipalmitoyl-S-glyceryl
cysteine-serine-(lysine)4), Pam2Cys-Ser-(Lys)4); and the like.
Synthetic lipopeptides have been described in the literature. See,
e.g., Kellner et al. (1992); Seifer et al. (1990); Lee et al.
(2003).
[0054] B. Stimulatory Oligonucleotide
[0055] Stimulatory oligonucleotides include nucleic acids
comprising the sequence 5'-CG-3' (a "CpG nucleic acid"), in certain
aspects C is unmethylated. The terms "polynucleotide," and "nucleic
acid," as used interchangeably herein in the context of stimulatory
oligonucleotides molecules, refer to a polynucleotide of any
length, and encompasses, inter alia, single- and double-stranded
oligonucleotides (including deoxyribonucleotides, ribonucleotides,
or both), modified oligonucleotides, and oligonucleosides, alone or
as part of a larger nucleic acid construct, or as part of a
conjugate with a non-nucleic acid molecule such as a polypeptide.
Thus a stimulatory oligonucleotide may be, for example,
single-stranded DNA (ssDNA), double-stranded DNA (dsDNA),
single-stranded RNA (ssRNA) or double-stranded RNA (dsRNA).
[0056] A stimulatory oligonucleotide may comprise at least one
nucleoside comprising an L-sugar. The L-sugar may be deoxyribose,
ribose, pentose, deoxypentose, hexose, deoxyhexose, glucose,
galactose, arabinose, xylose, lyxose, or a sugar "analog"
cyclopentyl group. The L-sugar may be in pyranosyl or furanosyl
form.
[0057] Stimulatory oligonucleotides generally do not provide for,
nor is there any requirement that they provide for, expression of
any amino acid sequence encoded by the polynucleotide, and thus the
sequence of a stimulatory oligonucleotide may be, and generally is,
non-coding. Stimulatory oligonucleotide may comprise a linear
double or single-stranded molecule, a circular molecule, or can
comprise both linear and circular segments. Stimulatory
oligonucleotide may be single-stranded, or may be completely or
partially double-stranded.
[0058] In some embodiments, a stimulatory oligonucleotide for use
in a subject method is an oligonucleotide, e.g., consists of a
sequence of from about 5 nucleotides to about 200 nucleotides, from
about 10 nucleotides to about 100 nucleotides, from about 12
nucleotides to about 50 nucleotides, from about 15 nucleotides to
about 25 nucleotides, from 20 nucleotides 15 to about 30
nucleotides, from about 5 nucleotides to about 15 nucleotides, from
about 5 nucleotides to about 10 nucleotides, or from about 5
nucleotides to about 7 nucleotides in length. In some embodiments,
a stimulatory oligonucleotide that is less than about 15
nucleotides, less than about 12 nucleotides, less than about 10
nucleotides, or less than about 8 nucleotides in length is
associated with a larger molecule.
[0059] In general, a stimulatory oligonucleotide used in a subject
composition comprises at least one unmethylated CpG motif. The
relative position of any CpG sequence in a polynucleotide in
certain mammalian species (e.g., rodents) is 5'-CG-3'(i.e., the C
is in the 5' position with respect to the G in the 3'
position).
[0060] In some embodiments, a stimulatory oligonucleotide comprises
a central palindromic core sequence comprising at least one CpG
sequence, where the central palindromic core sequence contains a
phosphodiester backbone, and where the central palindromic core
sequence is flanked on one or both sides by phosphorothioate
backbone-containing polyguanosine sequences.
[0061] In other embodiments, a stimulatory oligonucleotide
comprises one or more TCG sequences at or near the 5' end of the
nucleic acid; and at least two additional CG dinucleotides. In some
of these embodiments, the at least two additional CG dinucleotides
are spaced three nucleotides, two nucleotides, or one nucleotide
apart. In some of these embodiments, the at least two additional CG
dinucleotides are contiguous with one another. In some of these
embodiments, the stimulatory oligonucleotide comprises (TCG)n,
where n=1 to 3, at the 5' end of the nucleic acid. In other
embodiments, the stimulatory oligonucleotide comprises (TCG)n,
where n=1 to 3, and where the (TCG)n sequence is flanked by one
nucleotide, two nucleotides, three nucleotides, four nucleotides,
or five nucleotides, on the 5' end of the (TCG)n sequence.
[0062] Exemplary consensus CpG motifs useful in the invention
include, but are not necessarily limited to:
5'-Purine-Purine-(C)-(G)-Pyrimidine-Pyrimidine-3', in which the
stimulatory oligonucleotide comprises a CpG motif flanked by at
least two purine nucleotides (e.g., GG, GA, AG, AA, II, etc.,) and
at least two pyrimidine nucleotides (CC, TT, CT, TC, UU, etc.);
5'-Purine-TCG-Pyrimidine-Pyrimidine-3'; 5'-TCG-N--N-3'; where N is
any base; 5'-Nx(CG)nNy, where N is any base, where x and y are
independently any integer from 0 to 200, e.g., 0, 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 11-15, 16-20, 21-25, 25-30, 30-50, 50-75, 75-100,
100-150, or 150-200; and n is any integer that is 1 or greater,
e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or greater. 5'-Nx(TCG)nNy,
where N is any base, where x and y are independently any integer
from 0 to 200, e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11-15,
16-20, 21-25, 25-30, 30-50, 50-75, 75-100, 100-150, or 150-200; and
n is any integer that is 1 or greater, e.g., 1, 2, 3, 4, 5, 6, 7,
8, 9, 10, or greater. 5'-(TCG)n-3', where n is any integer that is
1 or greater, e.g., to provide a TCG-based TLR9 ligand (e.g., where
n=3, the polynucleotide comprises the sequence 5'TCGNNTCGNNTCG-3';
SEQ ID NO:4); 5 Nm-(TCG)n-Np-3', where N is any nucleotide, where m
is zero, one, two, or three, where n is any integer that is 1 or
greater, and where p is one, two, three, or four; 5
Nm-(TCG)n-Np-3', where N is any nucleotide, where m is zero to 5,
and where n is any integer that is 1 or greater, where p is four or
greater, and where the sequence N--N--N--N comprises at least two
CG dinucleotides that are either contiguous with each other or are
separated by one nucleotide, two nucleotides, or three nucleotides;
and 5'Purine-Purine-CG-Pyrimidine-TCG-3'.
[0063] Where a stimulatory oligonucleotide comprises a sequence of
the formula: 5'-Nm(TCG)n-Np-3', where N is any nucleotide, where m
is zero to 5, and where n is any integer that is 1 or greater,
where p is four or greater, and where the sequence N--N--N--N
comprises at least two CG dinucleotides that are either contiguous
with each other or are separated by one nucleotide, two
nucleotides, or three nucleotides, exemplary stimulatory
oligonucleotide useful in the invention include, but are not
necessarily limited to: (1) a sequence of the formula in which n=2,
and Np is NNCGNNCG; (2) a sequence of the formula in which n=2, and
Np is AACGTTCG; (3) a sequence of the formula in which n=2, and Np
is TTCGAACG; (4) a sequence of the formula in which n=2, and Np is
TACGTACG; (5) a sequence of the formula in which n=2, and Np is A
TCGA TCG; (6) a sequence of the formula in which n=2, and Np is
CGCGCGCG; (7) a sequence of the formula in which n=2, and Np is
GCCGGCCG; (8) a sequence of the formula in which n=2, and Np is
CCCGGGCG; (9) a sequence of the formula in which n=2, and Np is
GGCGCCCG; (1 0) a sequence of the formula in which n=2, and Np is
CCCGTTCG; (11) a sequence ofthe formula in which n=2, and Np is
GGCGTTCG; (12) a sequence of the formula in which n=2, and Np is
TTCGCCCG; (13) a sequence of the 30 formula in which n=2, and Np is
TTCGGGCG; (14) a sequence of the formula in which n=2, and Np is
AACGCCCG; (15) a sequence of the formula in which n=2, and Np is
AACGGGCG; (16) a sequence of the formula in which n=2, and Np is
CCCGAACG; and (17) a sequence of the formula in which n=2, and Np
is GGCGAACG; and where, in any of 1-17, m=zero, one, two, or
three.
[0064] Where a nucleic acid TLR9 ligand comprises a sequence of the
formula: 5'Nm(TCG)n-Np-3', where N is any nucleotide, where m is
zero, one, two, or three, where n is any integer that is 1 or
greater, and where p is one, two, three, or four, exemplary TLR9
ligands useful in the invention include, but are not necessarily
limited to: (1) a sequence of the formula where m=zero, n=1, and Np
is T-T-T; (2) a sequence of the formula where m=zero, n=1, and Np
is T-T-T-T; (3) a sequence of the formula where m=zero, n=1, and Np
is C--C--CC; (4) a sequence of the formula where m=zero, n=1, and
Np is A-A-A-A; (5) a sequence of the formula where m=zero, n=1, and
Np is A-G-A-T; (6) a sequence of the formula where Nm is T, n=1,
and Np is T-T-T; (7) a sequence of the formula where Nm is A, n=1,
and Np is T-T-T; (8) a sequence of the formula where Nm is C, n=1,
and Np is T-T-T; (9) a sequence of the formula where Nm is G, n=1,
and Np is T-T-T; (10) a sequence of the formula where Nm is T, n=1,
and Np is A-T-T; (11) a sequence of the formula where Nm is A, n=1,
and Np is 15 A-T-T; and (12) a sequence of the formula where Nm is
C, n=1, and Np is A-T-T.
[0065] Stimulatory oligonucleotides useful in the invention
include, but are not necessarily limited to, polynucleotides
comprising one or more of the following nucleotide sequences:
TABLE-US-00001 AGCGCT, AGCGCC, AGCGTT, AGCGTC, AACGCT, AACGCC,
AACGTT, AACGTC, GGCGCT, GGCGCC, GGCGTT, GGCGTC, GACGCT, GACGCC,
GACGTT, GACGTC, GTCGTC, GTCGCT, GTCGTT, GTCGCC, ATCGTC, ATCGCT,
ATCGTT, ATCGCC, TCGTCG, or TCGTCGTCG.
[0066] Additional stimulatory oligonucleotides useful in the
invention include, but are not necessarily limited to,
polynucleotides comprising one or more of the following nucleotide
sequences: TCGXXXX, TCGAXXX, XTCGXXX, XTCGAXX, TCGTCGA, TCGACGT,
TCGAACG, TCGAGAT, TCGACTC, TCGAGCG, TCGATTT, TCGCTTT, TCGGTTT,
TCGTTTT, TCGTCGT, ATCGATT, TTCGTTT, TTCGATT, ACGTTCG, AACGTTC,
TGACGTT, TGTCGTT, TCGXXX, TCGAXX, TCGTCG, AACGTT, ATCGAT, GTCGTT,
GACGTT, TCGXX, TCGAX, TCGAT, TCGTT, TCGTC, TCGA, TCGT, TCGX, and
TCG (where "X" is any nucleotide).
[0067] Stimulatory oligonucleotides useful in the invention
include, but are not necessarily limited to, polynucleotides
comprising the following octameric nucleotide sequences:
TABLE-US-00002 AGCGCTCG, AGCGCCCG, AGCGTTCG, AGCGTCCG, AACGCTCG,
AACGCCCG, AACGTTCG, AACGTCCG, GGCGCTCG, GGCGCCCG, GGCGTTCG,
GGCGTCCG, GACGCTCG, GACGCCCG, GACGTTCG, and GACGTCCG.
[0068] A stimulatory oligonucleotide useful in carrying out a
subject method can comprise one or more of any of the above CpG
motifs. For example, a stimulatory oligonucleotide useful in the
invention can comprise a single instance or multiple instances
(e.g., 2, 3, 4, 5 or more) of the same CpG motif. Alternatively, a
stimulatory oligonucleotide can comprise multiple CpG motifs (e.g.,
2, 3, 4, 5 or more) where at least two of the multiple CpG motifs
have different consensus sequences, or where all CpG motifs in the
stimulatory oligonucleotides have different consensus
sequences.
[0069] A stimulatory oligonucleotide useful in the invention may or
may not include palindromic regions. If present, a palindrome may
extend only to a CpG motif, if present, in the core hexamer or
octamer sequence, or may encompass more of the hexamer or octamer
sequence as well as flanking nucleotide sequences.
[0070] In some embodiments, a stimulatory oligonucleotide is
multimeric. A multimeric stimulatory oligonucleotide comprises two,
three, four, five, six, seven, eight, nine, ten, or more individual
(monomeric) stimulatory oligonucleotides, as described above,
linked via noncovalent bonds, linked via covalent bonds, and either
linked directly to one another, or linked via one or more spacers.
Suitable spacers include nucleic acid and non-nucleic acid
molecules, as long as they are biocompatible. In some embodiments,
multimeric stimulatory oligonucleotide comprises a linear array of
monomeric stimulatory oligonucleotides. In other embodiments, a
multimeric stimulatory oligonucleotide is a branched, or
dendrimeric, array of monomeric stimulatory oligonucleotides.
[0071] Stimulatory oligonucleotide modifications. A stimulatory
oligonucleotide suitable for use in a subject composition can be
modified in a variety of ways. For example, a stimulatory
oligonucleotide can comprise backbone phosphate group modifications
(e.g., methylphosphonate, phosphorothioate, phosphoroamidate and
phosphorodithioate intemucleotide linkages), which modifications
can, for example, enhance their stability in vivo, making them
particularly useful in therapeutic applications. A particularly
useful phosphate group modification is the conversion to the
phosphorothioate or phosphorodithioate forms of a stimulatory
oligonucleotide. Phosphorothioates and phosphorodithioates are more
resistant to degradation in vivo than their unmodified
oligonucleotide counterparts, increasing the half-lives of the
stimulatory oligonucleotides and making them more available to the
subject being treated.
[0072] Other modified stimulatory oligonucleotides encompassed by
the present invention include stimulatory oligonucleotides having
modifications at the 5' end, the 3' end, or both the 5' and 3'
ends. For example, the 5' and/or 3' end can be covalently or
non-covalently associated with a molecule (either nucleic acid,
non-nucleic acid, or both) to, for example, increase the
bio-availability of the stimulatory oligonucleotide, increase the
efficiency of uptake where desirable, facilitate delivery to cells
of interest, and the like.
[0073] The terms "CpG-ODN," "CpG nucleic acid," "CpG
polynucleotide," and "CpG oligonucleotide," used interchangeably
herein, refer to a polynucleotide that comprises at least one
5'-CG-3' moiety, and in many embodiments comprises an unmethylated
5'-CG-3' moiety. In general, a CpG nucleic acid is a single-or
double-stranded DNA or RNA polynucleotide having at least six
nucleotide bases that may comprise, or consist of, a modified
nucleotide or a sequence of modified nucleosides. In some
embodiments, the 5'-CG-3' moiety of the CpG nucleic acid is part of
a palindromic nucleotide sequence. In some embodiments, the
5'-CG-3' moiety of the CpG nucleic acid is part of a
non-palindromic nucleotide sequence.
[0074] C. Anti-Viral Drugs.
[0075] In certain aspects an anti-viral drug(s) may be used in
combination with or as a component of an anti-viral composition
(co-formulated with other components) described herein. Anti-viral
drugs are a class of medication used specifically for treating
viral infections and they should be distinguished from viricides,
which actively deactivate virus particles outside the body. Most of
the antivirals now available are designed to help deal with HIV,
herpes viruses, the hepatitis B and C viruses, and influenza A and
B viruses. Anti-viral agents useful in embodiments include, but are
not limited to, immunoglobulins, amantadine, interferons,
nucleotide analogues, sialidase inhibitors and protease inhibitors.
It is contemplated that one or more of these may be included in
embodiments or they may be excluded from embodiments. In certain
embodiments, the antiviral drug is one that inhibits the virus
directly, instead of destroying or killing the virus. In other
embodiments, an antiviral drug is not an immunoglobulin or agent
that involves the immune system.
[0076] One anti-viral strategy is to interfere with the ability of
a virus to infiltrate a target cell. This stage of viral
replication can be inhibited by using agents that mimic the virus
associated protein (VAP) and bind to the cellular receptors; or by
using agents which mimic the cellular receptor and bind to the VAP.
This includes anti-VAP antibodies, receptor anti-idiotypic
antibodies, extraneous receptor and synthetic receptor mimics
(viral mimetics). Two such "entryblockers" or "viral mimetics" are
amantadine and rimantadine. In certain aspects amantadine,
rimantadine, or compounds with similar mechanisms of action can be
used in composition described herein. In a further aspect
amantadine and rimantadine can be formulated as a treatment for
influenza.
[0077] A second approach to anti-viral therapy is to target the
processes that synthesize virus components after a virus invades a
cell. One way of doing this is to develop nucleotide or nucleoside
analogues that look like the building blocks of RNA or DNA, but
deactivate the enzymes that synthesize the RNA or DNA once the
analog is incorporated. Nucleotide analogs include, but are not
limited to ribivirin, vidarabine, acyclovir, gangcyclovir,
zidovudine, didanosine, zalcitabine, stavudine, and lamivudine. A
number of anti-proliferative compounds are known to inhibit both
cancers and viruses, thus other anti-proliferative compounds can be
used as an anti-viral therapy.
[0078] Another approach is to inhibit sialidases (also referred to
as neuraminidases). Sialidases hydrolyse alpha-(2/3)-,
alpha-(2/6)-, alpha-(2/8)-glycosidic linkages of terminal sialic
residues in oligosaccharides, glycoproteins, glycolipids, colominic
acid, and synthetic substrates. Sialidases act as pathogenic
factors in virus infections. Thus, sialidase inhibitors can be used
to attenuate the ability of a virus to infect a subject.
[0079] Some viruses have a protease that cuts viral protein chains
apart so they can be assembled into their final configuration. HIV
includes a protease, and so considerable research has been
performed to find "protease inhibitors" to attack HIV at that phase
of its life cycle. Protease inhibitors became available in the
1990s and have proven effective.
[0080] The final stage in the life cycle of a virus is the release
of mature viruses from the host cell. Two drugs (neuraminidase
inhibitors, also referred to as sialidase inhibitors) named
zanamivir (RELENZA.TM.) and oseltamivir (TAMIFLU.TM.) that have
been introduced to treat influenza prevent the release of viral
particles by blocking a molecule named neuraminidase that is found
on the surface of flu viruses, and also seems to be constant across
a wide range of flu strains.
[0081] Anti-viral drugs include, but are not limited to abacavir;
acemannan; acyclovir; acyclovir sodium; adefovir; alovudine;
alvircept sudotox; amantadine hydrochloride; amprenavir; aranotin;
arildone; atevirdine mesylate; avridine; cidofovir; cipamfylline;
cytarabine hydrochloride; delavirdine mesylate; desciclovir;
didanosine; disoxaril; edoxudine; efavirenz; enviradene;
envlroxlme; famciclovir; famotine hydrochloride; fiacitabine;
fialuridine; fosarilate; trisodium phosphonoformate; fosfonet
sodium; ganciclovir; ganciclovir sodium; idoxuridine; indinavir;
kethoxal; lamivudine; lobucavir; memotine hydrochloride;
methisazone; nelfinavir; nevlrapme; penciclovir; pirodavir;
ribavirin; rimantadine hydrochloride; ritonavir; saquinavir
mesylate; somantadine hydrochloride; sorivudine; statolon;
stavudine; tilorone hydrochloride; trifluridine; valacyclovir
hydrochloride; vidarabine; vidarabine phosphate; vidarabine sodium
phosphate; viroxime; zalcitabine; zidovudine; zinviroxime,
interferon, cyclovir, alpha-interferon, and/or beta globulin.
[0082] In certain embodiments the antiviral drug is ribivirin or
high dose ribivirin. Ribavirin is an anti-viral drug that is active
against a number of DNA and RNA viruses. It is a member of the
nucleoside antimetabolite drugs that interfere with duplication of
viral genetic material. Though not effective against all viruses,
ribavirin has wide range of activity, including important
activities against influenzas, flaviviruses, and agents of many
viral hemorrhagic fevers.
[0083] Typically, the oral form of ribavirin is used in the
treatment of hepatitis C, in combination with pegylated interferon
drugs. The aerosol form has been used in the past to treat
respiratory syncytial virus-related diseases in children. However,
its efficacy has been called into question by multiple studies, and
most institutions no longer use it.
[0084] D. Other Agents
[0085] In certain aspects of the invention an anti-inflammatory
agent may be used in combination with a composition described
herein.
[0086] Steroidal anti-inflammatories for use herein include, but
are not limited to fluticasone, beclomethasone, any
pharmaceutically acceptable derivative thereof, and any combination
thereof. As used herein, a pharmaceutically acceptable derivative
includes any salt, ester, enol ether, enol ester, acid, base,
solvate or hydrate thereof. Such derivatives may be prepared by
those of skill in the art using known methods for such
derivatization.
[0087] Fluticasone--Fluticasone propionate is a synthetic
corticosteroid. Fluticasone propionate is a white to off-white
powder and is practically insoluble in water, freely soluble in
dimethyl sulfoxide and dimethylformamide, and slightly soluble in
methanol and 95% ethanol. In an embodiment, the formulations of the
present invention may comprise a steroidal anti-inflammatory (e.g.,
fluticasone propionate).
[0088] Beclomethasone--In certain aspects the steroidal
anti-inflammatory can be beclomethasone dipropionate or its
monohydrate. The compound may be a white powder and is very
slightly soluble in water (Physicians' Desk Reference), very
soluble in chloroform, and freely soluble in acetone and in
alcohol.
[0089] Providing steroidal anti-inflammatories according to the
present invention may enhance the compositions and methods of the
invention by, for example, attenuating any unwanted inflammation.
Examples of other steroidal anti-inflammatories for use herein
include, but are not limited to, betamethasone, triamcinolone,
dexamethasone, prednisone, mometasone, flunisolide and
budesonide.
[0090] In accordance with yet another aspect of the invention, the
non-steroidal anti-inflammatory agent may include aspirin, sodium
salicylate, acetaminophen, phenacetin, ibuprofen, ketoprofen,
indomethacin, flurbiprofen, diclofenac, naproxen, piroxicam,
tebufelone, etodolac, nabumetone, tenidap, alcofenac, antipyrine,
amimopyrine, dipyrone, ammopyrone, phenylbutazone, clofezone,
oxyphenbutazone, prexazone, apazone, benzydamine, bucolome,
cinchopen, clonixin, ditrazol, epirizole, fenoprofen, floctafeninl,
flufenamic acid, glaphenine, indoprofen, meclofenamic acid,
mefenamic acid, niflumic acid, salidifamides, sulindac, suprofen,
tolmetin, nabumetone, tiaramide, proquazone, bufexamac, flumizole,
tinoridine, timegadine, dapsone, diflunisal, benorylate, fosfosal,
fenclofenac, etodolac, fentiazac, tilomisole, carprofen, fenbufen,
oxaprozin, tiaprofenic acid, pirprofen, feprazone, piroxicam,
sudoxicam, isoxicam, celecoxib, Vioxx.RTM., and/or tenoxicam.
IV. KITS
[0091] Any of the compositions described herein may be comprised in
a kit. In a nonlimiting example, reagents for production and/or
delivery of a therapeutic composition described herein are included
in a kit. In certain aspects the kit is portable and may be carried
on a person much like an asthma inhaler is carried. The kit may
further include a pathogen detector. The kit may also contain a gas
or mechanical propellant for compositions of the invention.
[0092] The components of the kits may be packaged either in an
aqueous, powdered, or lyophilized form. The container means of the
kits will generally include at least one inhaler, canister, vial,
test tube, flask, bottle, syringe or other container means, into
which a component(s) may be placed, and preferably, suitably
aliquoted. Where there is more than one component in the kit
(second agent, etc.), the kit also will generally contain a second,
third or other additional container into which the additional
components may be separately placed. However, various combinations
of components may be comprised in a vial, canister, or inhaler. A
container of the invention can include a canister or inhaler that
can be worn on a belt or easily carried in a pocket, backpack or
other storage container. The kits of the present invention also
will typically include a container for the described compositions
or their variations, and any other reagent containers in close
confinement for commercial sale. Such containers may include
injection or blow molded plastic containers into which the desired
vials are retained.
[0093] When the components of the kit are provided in one and/or
more liquid solutions, e.g., the liquid solution is an aqueous
solution, with a sterile aqueous solution being particularly
preferred, but not required. However, the components of the kit may
be provided as dried powder(s). When reagents and/or components are
provided as a dry powder, the powder may be reconstituted by the
addition of a suitable solvent or administered in a powdered form.
It is envisioned that a solvent may also be provided in another
container.
[0094] A kit will also include instructions for employing the kit
components as well the use of any other reagent not included in the
kit. Instructions may include variations that can be
implemented.
[0095] It is contemplated that such reagents are embodiments of
kits of the invention. Such kits, however, are not limited to the
particular items identified above and may include any reagent used
directly or indirectly in the detection of pathogenic
microorganisms or administration of a composition described
herein.
[0096] The inventors have used the mouse as model for microbial
infection of the lung. Not be held to any particular mechanism or
theory, it is believed that the increase in resistance to infection
is due to activation of local defenses or innate immunity. The
effects of single and repetitive exposure of a subject to a
composition of the invention have been determined and no obvious
gross pathology, such as premature death, weight loss, or
behavioral changes have been observed.
[0097] One non-limiting benefit of the present invention is that it
can be delivered and have effect quickly and easily. Also, the
compositions can be produced economically in large quantities and
easily stored, as well as easily transported by a person outside of
a hospital setting. Typically, the administration of the inventive
compositions and the methods of the invention result in at least
some killing or inhibition of the invading pathogens even before
cellular entry. In the case that some pathogens do enter cells in
the lungs either by escaping extracellular killing or because the
compositions are administered after pathogen exposure
(preemptively) instead of before pathogen exposure
(preventatively), it is contemplated that the compositions and
related methods promote intracellular killing resulting from the
enhanced or augmented local responses in the lungs.
[0098] A composition described in this application would simplify
countermeasure stockpiling and deployment. Also, the compositions
and methods of the invention would eliminate the difficulty of
rapidly identifying a specific pathogen during a bioweapon attack
or other exposure or potential exposure event. In addition, the
economic advantages of producing and purchasing an agent with
applicability in multiple civilian and biodefense settings are
significant. Augmenting local epithelial mechanisms is particularly
attractive in subjects who often have neutropenia or impaired
adaptive immune function, e.g., immune compromised subjects. The
methods typically act locally rather than systemically, and provide
broad effects against multiple pathogens. The effects are rapid and
are attractive in a biodefense, medical, and epidemic setting.
Augmentation of innate defense capabilities of the lungs in normal
hosts would be valuable during influenza or emergent respiratory
viral epidemics for which adaptive immune vaccines are not
available. Similarly, protection of caregivers during an epidemic
would facilitate care of the sick while limiting spread.
[0099] Many people in the community live with chronically
compromised defenses against infection, such as patients with
diabetes and patients taking immunosuppressive drugs for autoimmune
diseases or to prevent transplant rejection. These people will
benefit from a treatment or an increased resistance to infection
during epidemics or times where potential for exposure to viruses
is elevated. Even more strikingly, cancer patients undergoing
chemotherapy who have transient but severely compromised immune
defenses might benefit from transient protection. Pneumonia is a
common occurrence in these patients, and is the leading cause of
infectious death.
[0100] Resistance to infection can be stimulated to provide
transient protection during prolonged periods of neutropenia. Other
cancer patients, such as those receiving fludarabine or
anti-lymphocyte antibodies, or those receiving calcineurin
inhibitors and steroids after hematopoietic stem cell
transplantation, have impaired adaptive immunity. These patients
might also benefit from episodic stimulation of immunity to protect
against epidemic viruses. Community outbreaks of seasonal
respiratory viruses such as influenza, parainfluenza, and RSV can
cause fatal pneumonia in these compromised patients, and infection
with many of these viruses can be rapidly identified from nasal
washings.
V. VIRUSES
[0101] Class A bioterrorism agents that can be transmitted by
aerosol include smallpox virus, and hemorrhagic fever viruses.
Class B and class C bioterrorism agents also can be effectively
delivered by the respiratory route. These organisms comprise a
variety of viral classes. Because of the potential difficulty in
initially identifying a specific agent, the complexity of locally
stockpiling adaptive immune vaccines and antibiotics directed at
specific agents, and the remarkable virulence of organisms despite
appropriate treatment, stimulation of innate defense capabilities
and increasing the resistance of the lungs to infection can prevent
or preempt or attenuate infection with an agent delivered by the
respiratory route. Such an effect could have great public health
value.
[0102] There are numerous microbes that are considered pathogenic
or potentially pathogenic under certain conditions (i.e.,
opportunistic pathogens/microbes). In certain aspects, the
pathogenicity is determined relative to infection via the lungs. In
certain aspects the microbe is a virus. There are numerous viruses
and viral strains that are considered pathogenic or potentially
pathogenic under certain conditions.
[0103] Viruses can be placed in one of the seven following groups:
Group I: double-stranded DNA viruses, Group II: single-stranded DNA
viruses, Group III: double-stranded RNA viruses, Group IV:
positive-sense single-stranded RNA viruses, Group V: negative-sense
single-stranded RNA viruses, Group VI: reverse transcribing Diploid
single-stranded RNA viruses, Group VII: reverse transcribing
Circular double-stranded DNA viruses. Viruses include the family
Adenoviridae, Arenaviridae, Caliciviridae, Coronaviridae,
Filoviridae, Flaviviridae, Hepadnaviridae, Herpesviridae
(Alphahelpesvirinae, Betaherpesvirinae, Gammaherpesvirinae),
Nidovirales, Papillomaviridae, Paramyxoviridae (Paramyxovirinae,
Pneumovirinae), Parvoviridae (Parvovirinae, Picornaviridae),
Poxviridae (Chordopoxvirinae), Reoviridae, Retroviridae
(Orthoretrovirinae), and/or Togaviridae. These viruses include, but
are not limited to various strains of influenza, such as avian flu
(e.g., H5N1). Particular virus from which a subject may be
protected include, but is not limited to Cytomegalovirus,
Respiratory syncytial virus and the like.
[0104] Examples of pathogenic viruses include, but are not limited
to Influenza A, H5N1, Marburg, Ebola, Dengue, Severe acute
respiratory syndrome coronavirus, Yellow fever virus, Human
respiratory syncytial virus, Vaccinia virus and the like.
VI. FORMULATIONS AND ADMINISTRATION
[0105] The pharmaceutical compositions disclosed herein may be
administered via the respiratory system of a subject. In certain
aspects the compositions are deposited in the lung by methods and
devices known in the art. Therapeutic compositions described herein
may be prepared in water suitably mixed with a surfactant, such as
hydroxypropylcellulose. Dispersions may also be prepared in
glycerol, liquid polyethylene glycols and mixtures thereof, and in
oils. Under ordinary conditions of storage and use, these
preparations contain a preservative to prevent the growth of
microorganisms. The pharmaceutical forms suitable for inhalation
include sterile aqueous solutions or dispersions and sterile
powders for the extemporaneous preparation of sterile inhalable
solutions or dispersions. In all cases the form is typically
sterile and capable of inhalation directly or through some
intermediary process or device. It must be stable under the
conditions of manufacture and storage and must be preserved against
the contaminating action of microorganisms, such as bacteria and
fungi. The carrier can be a solvent or dispersion medium
containing, for example, water, ethanol, polyol (e.g., glycerol,
propylene glycol, and liquid polyethylene glycol, and the like),
suitable mixtures thereof, and/or vegetable oils. The prevention of
the action of microorganisms can be brought about by various
antibacterial and antifungal agents, for example, parabens,
chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
[0106] Some variation in dosage will necessarily occur depending on
the condition of the subject being treated and the particular
circumstances involving exposure or potential exposure. The person
responsible for administration will, in any event, determine the
appropriate dose for the individual subject. Moreover, for human
administration, preparations should meet sterility, pyrogenicity,
general safety, and purity standards as required by FDA Office of
Biologics standards or other similar organizations.
[0107] Sterile compositions are prepared by incorporating the
active components in the required amount in the appropriate solvent
with various other ingredients enumerated above, as required,
followed by, for example, filtered sterilization. Generally,
dispersions are prepared by incorporating the various sterilized
active ingredients into a sterile vehicle which contains the basic
dispersion medium and the required other ingredients from those
enumerated above. In the case of sterile powders for the
preparation of sterile compositions, some methods of preparation
are vacuum-drying and freeze-drying techniques which yield a powder
of the component(s) and/or active ingredient(s) plus any additional
desired ingredient from a previously sterile-filtered solution.
[0108] Pulmonary/respiratory drug delivery can be implemented by
different approaches, including liquid nebulizers, aerosol-based
metered dose inhalers (MDI's), sprayers, dry powder dispersion
devices and the like. Such methods and compositions are well known
to those of skill in the art, as indicated by U.S. Pat. Nos.
6,797,258, 6,794,357, 6,737,045, and 6,488,953, all of which are
incorporated by reference. According to the invention, at least one
pharmaceutical composition can be delivered by any of a variety of
inhalation or nasal devices known in the art for administration of
a therapeutic agent by inhalation. Other devices suitable for
directing pulmonary or nasal administration are also known in the
art. Typically, for pulmonary administration, at least one
pharmaceutical composition is delivered in a particle size
effective for reaching the lower airways of the lung or sinuses.
Some specific examples of commercially available inhalation devices
suitable for the practice of this invention are Turbohaler.TM.
(Astra), Rotahaler.RTM.) (Glaxo), Diskus.RTM. (Glaxo), Spiros.TM.
inhaler (Dura), devices marketed by Inhale Therapeutics, AERx.TM.
(Aradigm), the Ultravent.RTM. nebulizer (Mallinckrodt), the Acorn
II.RTM. nebulizer (Marquest Medical Products), the Ventolin.RTM.
metered dose inhaler (Glaxo), the Spinhaler.RTM. powder inhaler
(Fisons), Aerotech II.RTM. or the like.
[0109] All such inhalation devices can be used for the
administration of a pharmaceutical composition in an aerosol. Such
aerosols may comprise either solutions (both aqueous and
non-aqueous) or solid particles. Metered dose inhalers typically
use a propellant gas and require actuation during inspiration. See,
e.g., WO 98/35888 and WO 94/16970. Dry powder inhalers use
breath-actuation of a mixed powder. See U.S. Pat. Nos. 5,458,135
and 4,668,218; PCT publications WO 97/25086, WO 94/08552 and WO
94/06498; and European application EP 0237507, each of which is
incorporated herein by reference in their entirety. Nebulizers
produce aerosols from solutions, while metered dose inhalers, dry
powder inhalers, and the like generate small particle aerosols.
Suitable formulations for administration include, but are not
limited to nasal spray or nasal drops, and may include aqueous or
oily solutions of a composition described herein.
[0110] A spray comprising a pharmaceutical composition described
herein can be produced by forcing a suspension or solution of a
composition through a nozzle under pressure. The nozzle size and
configuration, the applied pressure, and the liquid feed rate can
be chosen to achieve the desired output and particle size. An
electrospray can be produced, for example, by an electric field in
connection with a capillary or nozzle feed.
[0111] A pharmaceutical composition described herein can be
administered by a nebulizer such as a jet nebulizer or an
ultrasonic nebulizer. Typically, in a jet nebulizer, a compressed
air source is used to create a high-velocity air jet through an
orifice. As the gas expands beyond the nozzle, a low-pressure
region is created, which draws a composition through a capillary
tube connected to a liquid reservoir. The liquid stream from the
capillary tube is sheared into unstable filaments and droplets as
it exits the tube, creating the aerosol. A range of configurations,
flow rates, and baffle types can be employed to achieve the desired
performance characteristics from a given jet nebulizer.
[0112] In an ultrasonic nebulizer, high-frequency electrical energy
is used to create vibrational, mechanical energy, typically
employing a piezoelectric transducer. This energy is transmitted to
the composition creating an aerosol.
[0113] In a metered dose inhaler (MDI) or in other device that us
propellant, a propellant, a composition, and any excipients or
other additives are contained in a canister as a mixture with a
compressed gas. Actuation of the metering valve releases the
mixture as an aerosol. Pharmaceutical compositions for use with a
metered-dose inhaler device will generally include a finely divided
powder containing a composition of the invention as a suspension in
a non-aqueous medium, for example, suspended in a propellant with
the aid of a surfactant. The propellant can be any conventional
material employed for this purpose such as chlorofluorocarbon, a
hydrochlorofluorocarbon, a hydrofluorocarbon, or a hydrocarbon
including trichlorofluoromethane, dichlorodifluoromethane,
dichlorotetrafluoroethanol and 1,1,1,2-tetrafluoroethane, HFA-134a
(hydrofluroalkane-134a), HFA-227 (hydrofluroalkane-227), or the
like.
[0114] As used herein, "carrier" includes any and all solvents,
dispersion media, vehicles, coatings, diluents, antibacterial and
antifungal agents, isotonic and absorption delaying agents,
buffers, carrier solutions, suspensions, colloids, and the like.
The use of such media and agents for pharmaceutical active
substances is well known in the art. Except insofar as any
conventional media or agent is incompatible with the active
ingredient, its use in the therapeutic compositions is
contemplated. Supplementary active ingredients can also be
incorporated into the compositions.
[0115] The phrase "pharmaceutically acceptable" refers to molecular
entities and compositions that do not produce an allergic or
similar untoward reaction when administered to a subject. The
preparation of an aqueous composition that contains a polypeptide
or peptide as an active ingredient is well understood in the
art.
VII. EXAMPLES
[0116] The following examples as well as the figures are included
to demonstrate preferred embodiments of the invention. It should be
appreciated by those of skill in the art that the techniques
disclosed in the examples or figures represent techniques
discovered by the inventors to function well in the practice of the
invention, and thus can be considered to constitute preferred modes
for its practice. However, those of skill in the art should, in
light of the present disclosure, appreciate that many changes can
be made in the specific embodiments which are disclosed and still
obtain a like or similar result without departing from the spirit
and scope of the invention.
Example 1
Effect of Time and Frequency of Pul042 and Combination Treatments
Against Influenza
[0117] Studies were designed and performed to compare the effect of
timing and frequency of aerosolized PUL042 (Pam2CSK4+ODN-M362) and
oral or aerosolized Tamiflu (Oseltamivir phosphate) as combination
treatments to inhibit pulmonary influenza A/HK/8/68 (H3N2) virus
(FluA) infection in mice. Survival and body weights were followed
up to 21 days. Similar studies were also conducted using the
antiviral ribavirin (RBV). (See FIG. 1, FIG. 2, FIG. 3, and FIG.
4). Similar studies have been conducted with coronavirus such as
MERS-COV and SARS-COV (See FIG. 5, FIG. 6, and FIG. 7).
[0118] Mice:
[0119] NIH Swiss-Webster, female, 6-8 weeks of age, approximately
20 g. On day 0 hour 0 mice are divided into groups and infected.
Treats start at +48 h (day 2). Groups included the following:
[0120] Group 1: Untreated, infected control, no treatments.
[0121] Group 2: Water by gavage at +48, +72 and +96 h (no
infection)
[0122] Group 3: Tamiflu by gavage at 4 mg/kg/day given at +48, +72
and +96 h
[0123] Group 4: Aerosol PUL042 at +48 h.
[0124] Group 5: Aerosol PUL042 at +48 and +96 h.
[0125] Group 6: Aerosol PUL042 plus Tamiflu by gavage at +48 h
followed by Tamiflu by gavage at +72 and +96 h.
[0126] Group 7: Aerosol PUL042 plus Tamiflu by gavage at +48 and
+96 h with Tamiflu by gavage at +72 h.
[0127] Group 8: Aerosol PUL042/Tamiflu combination at +48 h.
[0128] Group 9: Aerosol PUL042/Tamiflu combination at +48 and +96 h
with aerosol Tamiflu at +72 h.
[0129] Group 10: aerosol Tamiflu at +48, +72 and +96 h
[0130] PUL-042:
[0131] 16 .mu.M Pam2CSK4+4 .mu.M ODN-M362 formulated and supplied
by Pulmotect for each aerosol exposure. Five (5) mL for 15 min
aerosol treatments are needed (total for 3 exposures=20 mL of
PUL042).
[0132] Virus:
[0133] Influenza A/HK/8/68 (H3N2; Mouse Lung Pool 1-17-2012). Stock
titer=7.64 log.sub.10 TCID.sub.50/mL. Dilute virus 1:500 in 0.05%
gelatin-MEM [1:500=20.0 .mu.L to 10 mL of 0.05% gelatin-MEM]; use 9
mL in reservoir of nebulizer. Titer is determined in pre- and
post-nebulization reservoir solutions. Estimated virus/mouse when
exposed to aerosol for 20 min with Aerotech II nebulizer flowing at
10 L/min air .about.10.sup.5 TCID.sub.50.
[0134] Virus Infection:
[0135] Half of the mice from each group is randomized into 1 of 2
treatment boxes and exposed to influenza virus aerosol for 20 min.
Virus and drug exposures are generated from an Aerotech II
nebulizer flowing at 10 L/min of room air generated from an Aridyne
2000 compressor.
[0136] PUL042 Treatments:
[0137] Mice are placed into a sealed plastic box. For PUL042
treatment, a selected group of mice is administered aerosol of
PUL042 for 15 min. After exposure, mice are returned to their
pre-assigned groups.
[0138] Oral Tamiflu (Oseltamivir Phosphate) Gavage Treatments:
[0139] Oseltamivir phosphate is obtained from Tamiflu capsules. For
gavage, powder from 1 capsule (163 mg/capsule; 45% oseltamivir
carboxylate equivalent) is suspended in 1 mL of sterile water,
vortexed, and sonicated in a water bath at room temperature for 1-5
min. The solution is equivalent to 75 mg oseltamivir
carboxlyate/mL. For each treatment, Tamiflu is diluted and
administered by gavage (oral) using 100 .mu.L of 0.8 mg Oseltamivir
carboxylate/mL (dilute: 0.424 mL of 75 mg Osel/mL+39.576 mL
H.sub.2O) for a dose of 4 mg/kg/day in 100 .mu.L.
[0140] Aerosols of PUL042 and/or Tamiflu:
[0141] Oseltamivir phosphate is obtained from Tamiflu capsules. For
each day's aerosol, powder from 5 or 6 capsules (167.+-.1
mg/capsule; 45.0% oseltamivir carboxylate equivalent) is suspended
in 5 or 6 mL of either PUL042 (combination) or in sterile water
(Tamiflu-only) and vortexed vigorously. The suspension is
centrifuged at full speed in the clinical centrifuge for 15 min and
the supernatant fraction is removed and place in the nebulizer. The
solution is equivalent to 75 mg oseltamivir carboxlyate/mL. The
estimated deposition is 1.7 mg/kg in the lungs and 3.4 mg/kg in the
stomach.
[0142] Procedures:
[0143] On Day 0, all Groups are exposed to a 20 min aerosol
calculated to deposit approximately 10.sup.5 TCID.sub.50 of FluA/HK
per mouse (approximately 85-100% mortality). Mice are returned to
their appropriate groups and weighed.
[0144] On Day +2 (+48 h), Group 1 is treated with oral water;
Groups 4, 5, 6, and 7 are treated with aerosolized PUL042; Groups
3, 6, and 7 are treated with Oral Tamiflu; Groups 8 and 9 are
treated with a combination of PUL042 and Tamiflu; Group 10 is
treated with aerosolized Tamiflu.
[0145] On Day +3 (+72 h), Group 1 is treated with oral water;
Groups 3, 6, and 7 are treated with oral Tamiflu; and Groups 9 and
10 are treated with aerosolized Tamiflu.
[0146] On Day +4 (+96 h), Group 1 is treated with oral water;
Groups 5 and 7 are treated with aerosolized PUL042; Groups 3, 6,
and 7 are treated with Oral Tamiflu; Group 9 is treated with
combination PUL042 and Tamiflu; and Group 10 is treated with
aerosolized Tamiflu.
[0147] Mice in each group are observed daily for overt illness,
morbidity, and mortality. Mice are weighed on Days 0, 4 through 11;
and days 14 to 21, if necessary.
Protocol:
TABLE-US-00003 [0148] Duration Oral Dose Drug FluA Aerosol Aerosol
(mg/kg/day) Treatment Challenge End- Group.sup.1 Dose: (min) q.d.
(day) Day 0 points 1 0 None 0 None Yes Body 2 214 + 266 ng/kg/ 15
-- +2, 3, 4 No weights; 3 day.sup.2 15 4 +2, 3, 4 Yes Survival 4 15
-- +2 Yes 5 15 -- +2, 4 Yes 6 15 4 +2, 3, 4 Yes 7 15 4 +2, 3, 4 Yes
8 214 + 266 ng/kg/ 15 -- +2 Yes 9 day.sup.2; 15 -- +2, 3, 4 Yes 10
L: 1.7 15 -- +2, 3, 4 Yes S: 3.4 mg/kg/d.sup.3 .sup.1Mice,
15/group; .sup.2Estimated deposited dosage of Pam2CSK4 + ODN-M362,
16 .mu.M Pam2 + 4 .mu.M ODN; .sup.3Estimated deposited dosage
(mg/kg/day) of aerosolized Oseltamivir (75 mg/mL) in lungs (L) and
stomach (S). Abbreviations: Rx = treatment; Combo, combination
PUL042 aerosol + oral or aerosolized Tamiflu; FluA = influenza
A/HK/8/68 (H3N2) virus.
Timing of Treatments:
TABLE-US-00004 [0149] Total Rx Group Day 0 Day 1 Day 2 Day 3 Day 4
(days) 1 Virus -- -- -- -- None 2 Virus -- Water-g Water-g Water-g
3 3 Virus -- O-g O-g O-g 3 4 Virus -- P -- -- 1 5 Virus -- P -- P 2
6 Virus -- P + O-g O-g O-g 3 7 Virus -- P + O-g O-g P + O-g 3 8
Virus -- P + O-aer -- -- 1 9 Virus -- P + O-aer O-aer P + O-aer 3
10 Virus -- O-aer O-aer O-aer 3 P + O-g or P + O-aer = Combo Rx,
PUL042 aerosol + Oral or aerosolized Tamiflu; O-g = Tamiflu Oral
only; O-aer, Tamiflu Aerosol only. Abbreviations: H, water; O,
Oseltamivir as Tamiflu; P, PUL042; g, gavage; a, aerosol; D, day of
treatment
Example 2
Dose-Response and Temporal Efficacy of Aerosolized PUL-042
Administered in Combination with Ribavirin in Attenuating RSV
Infection
[0150] RSV is a major cause of pneumonia and bronchiolitis in
infants, the elderly, and immunocompromised transplant patients,
and is a major cause of respiratory infection leading to asthma
exacerbations. Further, an immune-suppressed model has been
described in which cotton rats (CR) treated with cyclophosphamide
exhibit characteristics of persistent RSV infection. These
conditions are physiologically relevant to studies targeting
immune-suppressed populations at risk for RSV infections. In
addition, more than 200 CR genes have been cloned encoding
cytokines, chemokines, and lymphocyte cell surface markers.
Analysis of these genes can inform mechanisms of viral pathogenesis
and clearance in the presence or absence of therapeutic
treatments.
[0151] Using aerosolized forms of both drugs given alone or in
combination, the comparative effects of a single dose versus two
doses, and of treatment begun early after infection, or relatively
late in the course of infection is evaluated.
[0152] The studies use an established animal model for RSV
infection, the cotton rat, to evaluate the ability of addition of
PUL-042 to ribavirin treatment to inhibit viral infection and
replication in the nasopharyngeal compartment and compare this to
the activity in the lung, which is more representative of later
stage or more severe viral disease.
[0153] Cotton rats are the optimal model for these studies because
they are 100-fold more permissive than mice to RSV infections in
both the upper and lower airways, and infected animals develop
pathology similar to that seen in humans. The predictive quality of
the CR model for therapeutics in treating RSV infections advanced
clinical trials of RSVIg, Respigam and palivizumab, and an
effective protocol for Ribavirin treatment is well established in
the cotton rat.
Experimental Methods:
[0154] RSV Inoculation and PUL-042 Drug Delivery:
[0155] Sigmoden hispidis cotton rats (CR) are .about.75-150 g body
weight as determined by the age at start of the experiment. Animal
body weight and sex distribution is as similar as possible across
all groups at the start. Body weights are recorded at end of the
experiment. RSV/A/Tracy, 1.22.times.10.sup.5 PFU is given to CR
lightly anesthesized with isoflurane. For PUL-042 or ribavirin
treatment, CR are placed into a sealed plastic box. PUL-042 and
ribavirin exposures are generated from a Pari LC Sprint nebulizer
flowing at 10 L/min of room air generated from a compressor.
[0156] Lung and Nasal Tissue Homogenates and Histopathology:
[0157] Following CO.sub.2 euthanasia, for the same animal, one lung
lobe is clamped off for organ homogenate and the remaining lobes
are perfused with 10% neutral buffered formalin, and inflated for
paraffin embedding. To evaluate the upper airways, one nasal
turbinate is prepared for histopathology and the other is used to
prepare tissue homogenates. Plaque assays are performed on the lung
and nasal homogenates. Total RNA is extracted from lung and
nasopharyngeal tissues and the kinetics of RSV genome replication
is measured by RT-qPCR. This total lung RNA may also be used to
evaluate expression of cotton rat genes associated with
pathogenesis of RSV disease.
[0158] Histopathology:
[0159] Intact lung tissue from the formalin-fixed lobes is prepared
for histology. Sections are stained with hematoxylin-eosin and
coded for blinded scoring of histopathology by veterinary
pathologists. Sections are scored from 0 to 4 based on the extent
and severity of alveolitis, alveolar eosinophilia, bronchiolitis,
bronchiolar eosinophilia, peribronchiolar mononuclear inflammatory
cell infiltrates, and perivascular mononuclear inflammatory cell
infiltrates.
[0160] In these experiments, PUL-042 and ribavirin are at the
concentrations (nebulized in 5 mL water as ribavirin at 100 mg/mL;
PUL-042 at 17 .mu.g/mL ODN+11.6 .mu.g/mL PAM2) applied in prior
mouse influenza A experiments. All experiments are repeated once
for confirmation of results.
[0161] Evaluate the Optimal Start of Treatment and Interval of
Treatment.
[0162] In prior experience with PUL-042 combined with ribavirin
against influenza A, it was found that two sequential combination
treatments on days 1 and 2 post-infection resulted in a 92%
increased survival rate, whereas ribavirin alone on those two days
provided only minimal improvement in survival rate, at 15%,
compared to 0% of untreated. The greatest efficacy of PUL-042 as a
monotherapy was found when the drug was administered on Day 1
post-infection (approximately 40% survival) with the benefit
dropping rapidly if treatment was further delayed.
[0163] Dose Schedules of PUL-042=/- Ribavirin in RSV-infected
cotton rats.
TABLE-US-00005 Viral Titer Group RSV PUL-042 RBV Combination
Evaluation Control 1 Infected UT UT UT D 4 Control 2 Infected UT UT
UT D 5 Control 3 Infected D -1 UT UT D 4 Control 4 Infected D 1 + D
2 UT UT D 4 Control 5 Infected UT D 1 + D 2 UT D 4 Treatment 1
Infected UT UT D 1 + D 2 D 4 Treatment 2 Infected UT UT D 1 + D 3 D
4 Treatment 3 Infected UT UT D 1 + D 4 D 5 Treatment 4 Infected UT
UT D 2 + D 3 D 4 Treatment 5 Infected UT UT D 2 + D 4 D 5 UT =
Untreated; D -1 = 24 h before infection; D 1 = Day 1
post-infection
[0164] The RSV infection in CR is not lethal. Demonstration of an
effect of PUL-042 and ribavirin for RSV requires measurement of
viral load during the course of infection and clearance, and
evaluation of histopathology during the course of RSV disease in
the same animals. The effect of two doses of PUL-042 and ribavirin
initiated on day 1 post-infection, followed by a second treatment
on Day 2, or Day 3, or Day 4 and those initiated on day 2
post-infection, followed by treatment on Day 3 or Day 4 is
evaluated. For treatment schedules ending before Day 4, animals are
euthanized for analysis on Day 4. In addition to untreated controls
for evaluation on days 4 and 5, ribavirin is evaluated alone
administered on Day 1 and Day 2 with evaluation of Day 4 titers.
Because the day of maximal proliferation is Day 4, and RSV is
cleared in these animals by Day 7, any treatment occurring after
Day 4 may not be distinguishable from the result in untreated
animals.
[0165] Simulation of Treatment in an Immune-Suppressed Patient
Population.
[0166] The optimal time course and dosing schedule can be repeated
in cotton rats undergoing cyclophosphamide (CY) treatment and the
effect of PUL-042 alone or combined with ribavirin is measured. As
previously described, intraperitoneal dosing of CY maintains a
state of leukopenia in cotton rats without affecting mortality. RSV
infection in CY-treated CR is persistent as shown by prolonged high
titers in lung tissue at 12 days post-infection. CR are given CY
intraperitoneal (i.p.) injections of 50 mg/kg three times per week
for 3 weeks before RSV infection, and continues until the end of
the time course for each animal. Immunosuppression is confirmed by
complete blood counts (CBC) in blood collected at necropsy by
cardiac puncture from CY-treated and untreated control animals. In
addition to the day 4 time point for measuring virus titers, titers
are measured in the CY-immune suppressed animals at day 10 to
confirm persistent RSV infection and to determine what effect
PUL-042 has on virus replication later in infection. Serum
cytokines levels are also measured in the blood samples.
Sequence CWU 1
1
4122DNAArtificial SequenceSynthetic Primer 1tcgtcgtttt cggcgcgcgc
cg 22225DNAArtificial SequenceSynthetic Primer 2tcgtcgtcgt
tcgaacgacg ttgat 25321DNAArtificial SequenceSynthetic Primer
3tcgtcgtttt cgcgcgcgcc g 21413DNAArtificial SequenceSynthetic
Primermisc_feature(4)..(5)n is a, c, g, or tmisc_feature(9)..(10)n
is a, c, g, or t 4tcgnntcgnn tcg 13
* * * * *