U.S. patent application number 16/378233 was filed with the patent office on 2019-10-10 for genes expressed in mental illness and mood disorders.
This patent application is currently assigned to PsychNostics, LLC. The applicant listed for this patent is PsychNostics, LLC. Invention is credited to Krish CHANDRASEKARAN, Alagu P. THIRUVENGADAM.
Application Number | 20190309285 16/378233 |
Document ID | / |
Family ID | 51428687 |
Filed Date | 2019-10-10 |
![](/patent/app/20190309285/US20190309285A1-20191010-D00001.png)
![](/patent/app/20190309285/US20190309285A1-20191010-D00002.png)
![](/patent/app/20190309285/US20190309285A1-20191010-D00003.png)
![](/patent/app/20190309285/US20190309285A1-20191010-D00004.png)
![](/patent/app/20190309285/US20190309285A1-20191010-D00005.png)
![](/patent/app/20190309285/US20190309285A1-20191010-D00006.png)
![](/patent/app/20190309285/US20190309285A1-20191010-D00007.png)
![](/patent/app/20190309285/US20190309285A1-20191010-D00008.png)
United States Patent
Application |
20190309285 |
Kind Code |
A1 |
THIRUVENGADAM; Alagu P. ; et
al. |
October 10, 2019 |
GENES EXPRESSED IN MENTAL ILLNESS AND MOOD DISORDERS
Abstract
The present invention relates to a composition comprising a
plurality of cDNA molecules for use in methods of detecting changes
in expression of genes encoding proteins that are associated with
mental illnesses and which are differentially expressed in patients
with mental illnesses, such as bipolar I disorder, bipolar II
disorder, unipolar disorder, schizophrenia. attention deficit
hyperactive disorders, obsessive compulsive disorders, anxiety
disorders or other related mood disorders. The composition and the
cDNA molecules may be used in their entirety or in part as to
diagnose. to stage, to treat. and/or to monitor the treatment of a
subject with mental illness.
Inventors: |
THIRUVENGADAM; Alagu P.;
(Baltimore, MD) ; CHANDRASEKARAN; Krish;
(Baltimore, MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
PsychNostics, LLC |
Baltimore |
MD |
US |
|
|
Assignee: |
PsychNostics, LLC
Baltimore
MD
|
Family ID: |
51428687 |
Appl. No.: |
16/378233 |
Filed: |
April 8, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14763706 |
Jul 27, 2015 |
10301615 |
|
|
PCT/US2014/013841 |
Jan 30, 2014 |
|
|
|
16378233 |
|
|
|
|
61771304 |
Mar 1, 2013 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C40B 30/04 20130101;
C12Q 1/6883 20130101; C40B 40/06 20130101; C12Q 2600/136 20130101;
C12Q 1/6806 20130101; C12Q 2600/158 20130101; C12N 15/1034
20130101 |
International
Class: |
C12N 15/10 20060101
C12N015/10; C12Q 1/6806 20060101 C12Q001/6806; C12Q 1/6883 20060101
C12Q001/6883 |
Claims
1-23. (canceled)
24. A method for treating mental illness comprising: obtaining a
sample containing nucleic acid transcripts from a subject;
combining the sample with a composition comprising a plurality of
cDNA molecules, wherein the plurality of cDNA molecules consists of
two or more cDNA molecules selected from the group consisting of
SEQ ID NOs:1-50, wherein one or more of SEQ ID NOs:1-50 may be
substituted for by the complement of said cDNA molecule, to form
one or more hybridization complexes; detecting the one or more
hybridization complexes; comparing the one or more hybridization
complexes detected with those from a subject without a mental
illness, wherein differences in the intensity of each hybridization
complex indicates differential expression of cDNAs in the sample;
identifying the subject to have a mental illness based on the
differential expression of cDNAs in the sample; and administering
to the subject a treatment for the mental illness.
25. A method for treating mental illness comprising: obtaining a
sample containing nucleic acids from a subject; combining the
sample with an array comprising a plurality of cDNA molecules
immobilized on a substrate, wherein the plurality of cDNA molecules
consists of two or more cDNA molecules selected from the group
consisting of SEQ ID NOs:1-50, wherein one or more of SEQ ID NOs:
1-50 may be substituted for by the complement of said cDNA
molecule, to form one or more hybridization complexes; detecting
the one or more hybridization complexes; comparing the one or more
hybridization complexes detected with those from a subject without
a mental illness, wherein differences in the intensity of each
hybridization complex indicates differential expression of cDNAs in
the sample; identifying the subject to have a mental illness based
on the differential expression of cDNAs in the sample; and
administering to the subject a treatment for the mental
illness.
26. The method of claim 24 or 25, wherein said plurality of cDNA
molecules consists of SEQ ID NOs: 1-8, wherein one or more of SEQ
ID NOs:1-8 may be substituted for by the complement of said cDNA
molecule.
27. The method of claim 24 or 25, wherein said plurality of cDNA
molecules consists of SEQ ID NOs:1-15, wherein one or more of SEQ
ID NOs:1-15 may be substituted for by the complement of said cDNA
molecule.
28. The method of claim 25, wherein said substrate is selected from
the group consisting of a nylon membrane, a nitrocellulose
membrane, a polypropylene support, a glass support and a silicon
support.
29. The method of claim 24 or 25, wherein the sample is blood or is
obtained by separation from blood.
30. The method of claim 24 or 25, wherein said nucleic acids are
amplified prior to hybridization.
31. The method of claim 24 or 25, wherein said differential
expression is a downregulation of at least two-fold in said sample
from said subject with a mental illness.
32. The method of claim 24 or 25, wherein the mental illness is
selected from the group consisting of bipolar I disorder, bipolar
II disorder, unipolar disorder, schizophrenia, an attention deficit
hyperactive disorder, an obsessive compulsive disorder, an anxiety
disorder and a mood related disorder.
33. A method of monitoring treatment for mental illness comprising
obtaining a sample containing nucleic acids from a subject treated
for mental illness; combining the sample with a composition
comprising a plurality of cDNA molecules, wherein the plurality of
cDNA molecules consists of two or more cDNA molecules selected from
the group consisting of SEQ ID NOs:1-50, wherein one or more of SEQ
ID NOs:1-50 may be substituted for by the complement of said cDNA
molecule, to form one or more hybridization complexes; detecting
the one or more hybridization complexes; comparing the one or more
hybridization complexes detected with those from a subject without
a mental illness, wherein differences in the intensity of each
hybridization complex indicates differential expression of cDNAs in
the sample; and altering treatment for the subject treated for
mental illness when differential expression of cDNAs in the sample
is detected.
34. A method of monitoring treatment for mental illness comprising
obtaining a sample containing nucleic acids from a subject treated
for mental illness; combining the sample with an array comprising a
plurality of cDNA molecules immobilized on a substrate, wherein the
plurality of cDNA molecules consists of two or more cDNA molecules
selected from the group consisting of SEQ ID NOs:1-50, wherein one
or more of SEQ ID NOs: 1-50 may be substituted for by the
complement of said cDNA molecule, to form one or more hybridization
complexes; detecting the one or more hybridization complexes;
comparing the one or more hybridization complexes detected with
those from a subject without a mental illness, wherein differences
in the size and intensity of each hybridization complex indicates
differential expression of cDNAs in the sample; and altering
treatment for the subject treated for mental illness when
differential expression of cDNAs in the sample is detected.
35. The method of claim 33 or 34, wherein said plurality of cDNA
molecules consists of SEQ ID NOs: 1-8, wherein one or more of SEQ
ID NOs:1-8 may be substituted for by the complement of said cDNA
molecule.
36. The method of claim 33 or 34, wherein the plurality of cDNA
molecules consists of SEQ ID NOs:1-15, wherein one or more of SEQ
ID NOs:1-15 may be substituted for by the complement of said cDNA
molecule.
37. The method of claim 33 or 34, wherein said plurality of cDNA
molecules consists of SEQ ID NOs: 1-8, wherein one or more of SEQ
ID NOs:1-8 may be substituted for by the complement of said cDNA
molecule.
38. The method of claim 33 or 34, wherein said plurality of cDNA
molecules consists of SEQ ID NOs:1-15, wherein one or more of SEQ
ID NOs:1-15 may be substituted for by the complement of said cDNA
molecule.
39. The method of claim 34, wherein the substrate is selected from
the group consisting of a nylon membrane, a nitrocellulose
membrane, a polypropylene support, a glass support and a silicon
support.
40. The method of claim 33 or 34, wherein the sample is blood or is
obtained by separation from blood.
41. The method of claim 33 or 34, wherein the nucleic acids are
amplified prior to hybridization.
42. The method of claim 33 or 34, wherein said differential
expression is a downregulation of at least two-fold in said sample
from said subject with a mental illness.
43. The method of claim 33 or 34, wherein the mental illnesses is
selected from the group consisting of bipolar I disorder, bipolar
II disorder, unipolar disorder, schizophrenia, an attention deficit
hyperactive disorder, an obsessive compulsive disorder, an anxiety
disorder and a mood related disorder.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 14/763,706, filed on Jul. 27, 2015, which is a National Stage
of International Application No. PCT/US2014/013841, filed on Jan.
30, 2014, which claims priority from U.S. Provisional Application
No. 61/771,304, filed on Mar. 1, 2013, the contents of all of which
are incorporated herein by reference in their entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to a composition comprising a
plurality of cDNA molecules for use in methods of detecting changes
in expression of genes encoding proteins that are associated with
mental illnesses and which are differentially expressed in patients
with mental illnesses, such as bipolar I disorder, bipolar II
disorder, unipolar disorder, schizophrenia, attention deficit
hyperactive disorders, obsessive compulsive disorders, anxiety
disorders or other related mood disorders. The composition and the
cDNAs may be used in their entirety or in part as to diagnose, to
stage, to treat, and/or to monitor the treatment of a subject with
mental illness.
BACKGROUND OF THE INVENTION
[0003] Array technology can provide a simple way to explore the
expression of a single polymorphic gene or the expression profile
of a large number of related or unrelated genes.
[0004] When the expression of a single gene is examined, arrays are
employed to detect the expression of a specific gene or its
variants. When an expression profile is examined, arrays provide a
platform for examining which genes are tissue specific, carrying
out housekeeping functions, parts of a signaling cascade, or
specifically related to a particular genetic predisposition,
condition, disease, or disorder.
[0005] The potential application of gene expression profiling is
particularly relevant to improving diagnosis, prognosis, and
treatment of disease. For example, both the levels of gene
expression and the particular sequences expressed may be examined
in tissues from subjects with mental illnesses such as bipolar I
disorder, bipolar II disorder, unipolar disorder, schizophrenia,
attention deficit hyperactive disorders, obsessive compulsive
disorders, anxiety disorders or other related mood disorders, and
compared with the levels of gene expression and the particular
sequences expressed in normal tissue.
[0006] The Diagnostic and Statistical Manual (DSM-IV) published by
the American Psychiatric Association serves as the basis for the
description, identification and diagnosis of all the mental
illnesses covered by this invention. These illnesses include
bipolar I disorder, bipolar II disorder, unipolar disorder,
attention deficit hyperactive disorder (ADHD) and schizophrenia. At
present there are no biological markers to identify these illnesses
individually or as a group. Membrane potentials have been used to
diagnose bipolar I disorder, bipolar II disorder and ADHD and this
technique is described in pending U.S. patent application Ser. No.
10/823,647 and pending U.S. provisional patent application No.
60/670,237.
[0007] The present invention provides for a composition comprising
a plurality of cDNA molecules for use in methods of detecting
changes in expression of genes encoding proteins that are
associated with mental illnesses. Such a composition, and the cDNA
molecules, can be employed for the diagnosis, prognosis and/or
treatment of mental illnesses that are correlated with differential
gene expression. Differential gene expression may also reflect
inflammation, proliferation, and/or cell activation which occur
secondary to the disease process. The present invention satisfies a
need in the art in that it provides a set of differentially
expressed genes which may be used entirely or in part to diagnose,
to stage, to treat, and/or to monitor the progression or treatment
of a subject with mental illnesses, such as bipolar disorder.
SUMMARY OF THE INVENTION
[0008] The present invention provides a composition comprising a
plurality of cDNA molecules and their complements. The cDNA
molecules of the composition are differentially expressed in vivo
and are selected from SEQ ID NOs: 1-50 as presented in the Sequence
Listing. Earlier studies have shown that each cDNA molecule of SEQ
ID NOs: 1-15 is either upregulated or down-regulated significantly
among various mental illnesses. In one aspect, the composition is
useful to diagnose mental illnesses such as bipolar I disorder,
bipolar II disorder, unipolar disorder, schizophrenia, attention
deficit hyperactive disorders, obsessive compulsive disorders,
anxiety disorders or other related mood disorders, particularly
through the use of blood. In another aspect, the composition is
immobilized on a substrate.
[0009] The invention also provides a high throughput method to
detect differential expression of one or more genes encoding
proteins that are associated with a mental illnesses using the
composition of the present invention. The method comprises exposing
a substrate comprising the composition of the present invention to
a test sample under conditions such that hybridization complexes
form between at least one cDNA molecule of the composition and at
least one polynucleotide in the test sample, detecting the
hybridization complexes, and comparing the hybridization complexes
with those of a standard, wherein differences in the size and
signal intensity of each hybridization complex indicates
differential expression of nucleic acids in the test sample. In one
aspect, the test sample is from a subject with a mental illness and
differential expression determines an early, mid, or late stage of
that mental illness.
[0010] The invention further provides a high throughput method of
screening a library of molecules or compounds to identify a ligand
that binds a cDNA molecule of the composition of the present
invention. The method comprises exposing a substrate comprising the
composition of the present invention to a library of molecules or
compounds under conditions to allow specific binding between at
least one cDNA molecule in the composition and at least one
molecule or compound, and detecting specific binding, thereby
identifying a ligand that binds a cDNA molecule of the composition
of the present invention. Libraries of molecules or compounds are
selected from DNA molecules, RNA molecules, mimetics, peptides,
transcription factors and other regulatory proteins.
[0011] The invention still further provides an isolated cDNA
molecule selected from SEQ ID NOs: 1-15 as presented in the
Sequence Listing. The invention also provides an expression vector
comprising the cDNA molecule, a host cell transfected or
transformed with the expression vector, and a method for producing
a protein encoded by the cDNA molecule comprising culturing the
host cell under conditions suitable for the expression of a protein
encoded by the cDNA molecule and recovering the protein from the
host cell culture. The invention additionally provides a method for
purifying a ligand, the method comprising combining a cDNA molecule
of the invention with a sample under conditions which allow
specific binding between the cDNA molecule and a ligand in the
sample, recovering the bound cDNA molecule, and separating the
ligand from the cDNA molecule, thereby obtaining a purified
ligand.
[0012] The present invention also provides a purified protein
encoded by a cDNA molecule of the invention. The invention also
provides a high-throughput method for using a protein encoded by a
cDNA molecule of the invention to screen a library of molecules or
compounds to identify a ligand that binds a protein encoded by a
cDNA molecule of the invention. The method comprises combining the
protein or a portion thereof with a library of molecules or
compounds under conditions to allow specific binding between the
protein or portion thereof, and a molecule or compound of the
library, and detecting specific binding, thereby identifying a
ligand which specifically binds the protein. Libraries of molecules
or compounds are selected from DNA molecules, RNA molecules, PNAs,
mimetics, peptides, proteins, agonists, antagonists, antibodies or
their fragments, immunoglobulins, inhibitors, drug compounds, and
pharmaceutical agents. The invention further provides for using a
polypeptide encoded by a cDNA molecule of the invention to purify a
ligand. The method comprises combining a protein or a portion
thereof with a sample under conditions to allow specific binding
between the protein or portion thereof, and a ligand in the sample,
recovering the bound protein, and separating the protein from the
ligand, thereby obtaining purified ligand. The invention still
further provides a pharmaceutical composition comprising the
protein. The invention yet still further provides a method for
using the protein to produce an antibody. The method comprises
immunizing an animal with the protein or an antigenically-effective
portion thereof under conditions to elicit an antibody response,
isolating animal antibodies, and screening the isolated antibodies
with the protein to identify an antibody which specifically binds
the protein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] FIG. 1-8 are bar graphs that show changes in gene expression
for different groups of functionally related genes. The relative
percent of genes on the array with higher levels of expression in
mental illness vs. controls is indicated with a grey bar, and the
relative percent with lower levels of expression is indicated with
a hatched bar.
[0014] FIG. 1--BC032245--This figure shows a comparison of the gene
expression of ATP Synthase FO subunit D in controls, bipolar I,
ADHD, schizophrenia and unipolar blood samples. FOD is
significantly downregulated in bipolar I and schizophrenia while it
is significantly upregulated in unipolar. There is no significant
difference in ADHD patient blood samples.
[0015] FIG. 2--AA022514--This figure shows a comparison of the gene
expression of ATP Synthase OSCP subunit in controls, bipolar I,
ADHD, schizophrenia and unipolar blood samples. OSCP is
significantly downregulated in bipolar I, schizophrenia and ADHD.
There is no significant difference in unipolar patient blood
samples.
[0016] FIG. 3--BC003678--This figure shows a comparison of the gene
expression of ATP Synthase FO subunit F in controls, bipolar I,
ADHD, schizophrenia and unipolar blood samples. FOF is
significantly downregulated in bipolar I and schizophrenia while it
is significantly upregulated in unipolar. There is no significant
difference in ADHD patient blood samples.
[0017] FIG. 4--NM_005011--This figure shows a comparison of the
gene expression of nuclear respiratory factor-1 (NRF-1) in
controls, bipolar I, ADHD, schizophrenia and unipolar blood
samples. NRF-1 is significantly downregulated in bipolar I, ADHD
and unipolar samples, while there is no significant difference in
schizophrenic patient blood samples
[0018] FIG. 5--NC_001807--This figure shows a comparison of the
gene expression of COX I in controls, bipolar I, ADHD,
schizophrenia and unipolar blood samples. COX I is significantly
downregulated in bipolar I, unipolar and ADHD, while there is no
significant difference in schizophrenia patient blood samples.
[0019] FIG. 6--X13274--This figure shows a comparison of the gene
expression of interferon-gamma (IFN-G) in controls, bipolar I,
ADHD, schizophrenia and unipolar blood samples. IFN-gamma is
significantly downregulated in ADHD and unipolars, there is no
significant difference in bipolar I and schizophrenia patient blood
samples.
[0020] FIG. 7--BC017176--This figure shows a comparison of the gene
expression of inositol mono phosphatase (IMPase) in controls,
bipolar I, ADHD, schizophrenia and unipolar blood samples. IMPase
is significantly upregulated in unipolar, ADHD and schizophrenia
while there is no significant difference in bipolar I patient blood
samples.
[0021] FIG. 8--AA447623--This figure shows a comparison of the gene
expression of sorbitol dehydrogenase (SDH) in controls, bipolar I,
ADHD, schizophrenic and unipolar blood samples. SDH is
significantly upregulated in unipolar. There is no significant
difference in bipolar I, schizophrenia and ADHD patient blood
samples.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0022] "Array" refers to an ordered arrangement of cDNA molecules.
The cDNA molecules are arranged on a substrate so that there are a
"plurality" of cDNA molecules, preferably at least 10 cDNA
molecules, more preferably at least 100 cDNA molecules, even more
preferably from about 500 to about 1000 cDNA molecules, and most
preferably at least 10,000 cDNA molecules. Furthermore, the
arrangement of the cDNA molecules on the substrate assures that the
size and signal intensity of each hybridization complex formed
between a cDNA molecule and a sample nucleic acid is individually
distinguishable. The number of cDNA molecules on the array is
primarily related to the convenience of screening a large number of
different cDNA molecules at the same time. The skilled artisan will
understand that arrays having a small number of cDNA molecules,
such as between 10 and 100, may be preferred depending on the
experimental conditions and the assay being performed.
[0023] "cDNA molecule" refers to a chain of nucleotides, an
isolated polynucleotide, nucleotide, nucleic acid molecule, or any
fragment or complement thereof. It may have originated
recombinantly or synthetically and be double-stranded or
single-stranded, coding and/or noncoding, an exon or an intron of a
genomic DNA molecule, or combined with carbohydrate, lipids,
protein or inorganic elements or substances. The skilled artisan
will understand that cDNA molecules may vary in length depending on
the conditions under which the molecules are being used. For
example, the chain may be between about 15 to about 10,000
nucleotides. Preferably, the cDNA molecules of the instant
invention are between about 25 and 500 nucleotides in length, more
preferably from about 100 to about 300 nucleotides and most
preferably from about 150 to about 250 nucleotides.
[0024] The phrase "cDNA molecule encoding a protein" refers to a
nucleic acid sequence that encodes one or more amino acid residues,
a chain of amino acid residues, a peptide, a polypeptide or a
protein. The phrase also refers to a nucleic acid sequence that
closely aligns with sequences which encode conserved protein motifs
or domains that were identified by employing analyses well known in
the art. These analyses include Hidden Markov Models (HMMs) such as
PFAM (Krogh (1994) J Mol Biol 235:1501-1531; Sonnhamer et al.
(1988) Nucl Acids Res 26:320-322), BLAST (Basic Local Alignment
Search Tool; Altschul (1993) J Mol Evol 36: 290-300; and Altschul
et al. (1990) J Mol Biol 215:403-410), or other analytical tools
such as BLIMPS (Henikoff et al. (1998) Nucl Acids Res 26:309-12).
Additionally, the phrase may be associated with specific human
metabolic processes, conditions, disorders, or diseases.
[0025] "Derivative" refers to a cDNA molecule or a protein that has
been subjected to a chemical modification such as the replacement
of a hydrogen by, for example, an acetyl, acyl, alkyl, amino,
formyl, or morpholino group. Derivative cDNA molecules may encode
proteins that retain the essential biological characteristics of
naturally occurring proteins.
[0026] "Disorder" refers to conditions, diseases or syndromes of
mental illness and includes bipolar I disorder, bipolar II
disorder, unipolar disorder, schizophrenia, attention deficit
hyperactive disorders, obsessive compulsive disorders, anxiety
disorders or other related mood disorders as defined by DSM IV of
the American Psychiatric Association.
[0027] "Fragment" refers to a chain of at least 18, 20, 25, 30, 35,
40, 50 or 100 consecutive nucleotides from any part of a cDNA
molecule. Fragments may be used in PCR or hybridization
technologies to identify related nucleic acid molecules and to
screen for or to purify a ligand. Nucleic acids and their ligands
identified in this manner are useful as therapeutics to regulate
replication, transcription or translation.
[0028] A "hybridization complex" is formed between a cDNA molecule
and a nucleic acid of a sample when the purines of one molecule
hydrogen bond with the pyrimidines of the complementary molecule.
In most cases, the molecules will be completely complementary,
e.g., 5'-A-G-T-C-3' base pairs with 3'-T-C-A-G-5'.
[0029] "Ligand" refers to any agent, molecule, or compound which
will bind specifically to a site on a cDNA molecule,
polynucleotide, or protein. Such ligands stabilize or modulate the
activity of cDNA molecules or proteins and may be composed of at
least one of the following: inorganic and organic substances
including nucleic acids, oligonucleotides, polynucleotides, amino
acids, peptides, proteins, carbohydrates, fats, and lipids.
[0030] "Oligonucleotide" or "oligomer" refers to a nucleotide
sequence of at least about 15 nucleotides to as many as about 60
nucleotides, preferably about 18 to 30 nucleotides, and most
preferably about 20 to 25 nucleotides that are used as a "primer"
or "amplimer" in the polymerase chain reaction (PCR) or as an array
element, or in other manners well known to the skilled artisan.
[0031] "Portion" refers to any part of a protein used for any
purpose; but especially, to an epitope for the screening or
purification of ligands or for the production of antibodies.
[0032] "Post-translational modification" of a protein may involve
lipidation, glycosylation, phosphorylation, acetylation,
racemization, proteolytic cleavage, and the like. These processes
may occur synthetically or biochemically. Biochemical modifications
will vary by cellular location, cell type, pH, enzymatic milieu,
and the like.
[0033] "Probe" refers to a cDNA molecule or a fragment thereof that
hybridizes to at least one nucleic acid molecule in a sample or on
a substrate. Where the molecular targets are double stranded, the
probes may be either sense or antisense strands. Where targets are
single stranded, probes are complementary single strands. Probes
can be operably linked to reporter molecules for use in
hybridization reactions including Southern, northern, in situ, dot
blot, array, and like technologies or in screening or purification
assays.
[0034] "Protein" refers to a polypeptide or any portion thereof. A
portion of a protein generally retains biological or immunogenic
characteristics of a native protein. An "oligopeptide" is an amino
acid sequence of at least about 5 residues, more preferably 10
residues and most preferably about 15 residues that is used as part
of a fusion protein to produce an antibody.
[0035] "Purified" refers to any molecule or compound that is
separated from its natural environment and is at least about 60%
free, 70% free, 80% free, 90% free, preferably about 95% free, and
most preferably about 99% free, from other components with which it
is naturally associated.
[0036] "Sample" is used in its broadest sense. A sample containing
nucleic acids, proteins, antibodies, and the like may comprise a
bodily fluid such as blood; a soluble fraction of a cell
preparation or media in which cells were grown; a chromosome, an
organelle, or membrane isolated or extracted from a cell; genomic
DNA, RNA, or cDNA in solution or bound to a substrate; a cell; a
tissue; a tissue print; a fingerprint, skin or hair; and the
like.
[0037] "Specific binding" refers to a special and precise
interaction between two molecules which is dependent upon their
structure, particularly their molecular side groups. For example,
the intercalation of a regulatory protein into the major groove of
a DNA molecule, the hydrogen bonding between two single stranded
nucleic acids, or the binding between an epitope of a protein and
an agonist, antagonist, or antibody.
[0038] "Substrate" refers to any rigid or semi-rigid support to
which cDNA molecules or proteins are bound and includes membranes
(such as nylon, nitrocellulose), polypropylene supports, glass
supports, silicon supports, filters, chips, slides, wafers, fibers,
magnetic or nonmagnetic beads, gels, capillaries or other tubing,
plates, polymers, and microparticles with a variety of surface
forms including wells, trenches, pins, channels and pores.
[0039] "Variant" refers to molecules that are recognized variations
of a cDNA molecule or a protein encoded by the cDNA molecule.
Splice variants may be determined by BLAST score, wherein the score
is at least 100, and most preferably at least 400. Allelic variants
have a high percent identity to the cDNA molecules and may differ,
for example, by about three bases per hundred bases. "Single
nucleotide polymorphism" (SNP) refers to a change in a single base
as a result of a substitution, insertion or deletion. The change
may be conservative (purine for purine) or non-conservative (purine
to pyrimidine) and may or may not result in a change in an encoded
amino acid. Such changes may predispose an individual to a specific
disease or condition. Variants also include polynucleotide having
at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99%
sequence identity with a reference polynucleotide. Similarly,
variants also include polypeptides having at least about 70%, 75%,
80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with a
reference polypeptide.
The Invention
[0040] The present invention provides for a composition comprising
a plurality of cDNA molecules or their complements, wherein the
cDNA molecules are at least one of SEQ ID NOs: 1-50, which may be
used on a substrate to diagnose, to stage, to treat, and/or to
monitor the progression or treatment of mental illnesses. These
cDNA molecules represent known and novel genes differentially
expressed in subjects with mental illness. The composition may be
used in its entirety or in part, as subsets of either upregulated
or downregulated cDNA molecules may be used, such as one or more of
SEQ ID NOs:1-15, or one or more of SEQ ID NOs:1-8.
[0041] Table 1 shows those genes previously found to have either
significantly higher or lower expression in samples from patients
with bipolar I disorder, ADHD, unipolar disorder or schizophrenia.
Column 1 shows the mental illness of the patent from which the
sample was obtained, column 2 shows corresponding SEQ ID number,
column 3 shows the identity of the gene being screened, column 4
shows the GenBank Accession Number for the gene in column 3,
columns 5 and 6 indicated whether gene expression was upregulated
or down-regulated.
TABLE-US-00001 TABLE 1 SEQ ID ILLNESS NO: GENE ACCESSION #
UPREGULATED DOWNREGULATED Bipolar I 1 F0D BC032245 Yes Disorder 2
OSCP BC021233 Yes 3 F0F BC003678 Yes 4 NRF-1 NM_005011 Yes 5 COX I
NC_001807 Yes 10 TFAM NM_003201 Yes 9 COX-II NC_001807 Yes 8 SDH
L29008 Yes 7 IMPase BC017176 Yes 6 IFN Gamma X13274 Yes 11 GFAP
BC013596 Yes 12 HSP60 BC002676 Yes 13 LDH-B BT019765 Yes 14 HK
M75126 Yes 15 GSK3 Beta BC012760 Yes ADHD 1 F0D BC032245 Yes 2 OSCP
BC021233 Yes 3 F0F BC003678 Yes 4 NRF-1 NM_005011 Yes 5 COX I
NC_001807 Yes 10 TFAM NM_003201 Yes 9 COX-II NC_001807 Yes 8 SDH
L29008 Yes 7 IMPase BC017176 Yes 6 IFN Gamma X13274 Yes 11 GFAP
BT019765 Yes 12 HSP60 BC002676 Yes 13 LDH-B BT019765 Yes 14 HK
M75126 Yes 15 GSK3 Beta BC012760 Yes Unipolar 1 F0D BC032245 Yes 2
OSCP BC021233 Yes 3 F0F BC003678 Yes 4 NRF-1 NM_005011 Yes 5 COX I
NC_001807 Yes 10 TFAM NM_003201 Yes 9 COX-II NC_001807 Yes 8 SDH
L29008 Yes 7 IMPase BC017176 Yes 6 IFN Gamma X13274 Yes 11 GFAP
BT019765 Yes 12 HSP60 BC002676 Yes 13 LDH-B BT019765 Yes 14 HK
M75126 Yes 15 GSK3 Beta BC012760 Yes Schizophrenia 1 F0D BC032245
Yes 2 OSCP BC021233 Yes 3 F0F BC003678 Yes 4 NRF-1 NM_005011 Yes 5
COX I NC_001807 Yes 10 TFAM NM_003201 Yes 9 COX-II NC_001807 Yes 8
SDH L29008 Yes 7 IMPase BC017176 Yes 6 IFN Gamma X13274 Yes 11 GFAP
BT019765 Yes 12 HSP60 BC002676 Yes 13 LDH-B BT019765 Yes 14 HK
M75126 Yes 15 GSK3 Beta BC012760 Yes
[0042] FIGS. 1-8 show functional differences in gene expression
that are associated with mental illnesses. Genes were categorized
by their likely function in the blood cells by surveying Genbank
accession number and name for both nucleotide and amino acid
sequences, as well as surveying the scientific literature on each
gene.
[0043] The cDNA molecules of the invention define a differential
expression pattern against which to compare the expression pattern
of the corresponding genes in a subject. Experimentally,
differential expression of the cDNA molecules can be evaluated by
methods including, but not limited to, differential display by
spatial immobilization or by gel electrophoresis, genome mismatch
scanning, representational discriminant analysis, clustering,
transcript imaging, and array technologies. Differential expression
can also be analyzed by quantitative or real-time RT-PCR (Reverse
Transcriptase-Polymerase Chain Reaction) analysis using
gene-specific oligonucleotides. "Oligonucleotide" or "oligomer"
refers to a nucleotide sequence of at least about 15 nucleotides to
as many as about 60 nucleotides, preferably about 18 to 30
nucleotides, and most preferably about 20 to 25 nucleotides that
are used as a "primer" or "amplimer" in the RT-PCR reaction. These
methods may be used alone or in combination.
[0044] The composition may be arranged on a substrate and
hybridized with samples from subjects with diagnosed mental illness
to identify those sequences which are differentially expressed in
mental illnesses. This allows identification of those sequences of
highest diagnostic and potential therapeutic value. In a third
aspect, the composition is arranged on a substrate with an
additional set of cDNA molecules, such as cDNAs molecule encoding
signaling molecules. Such combinations may be useful in the
elucidation of pathways which are affected in a particular mental
disorder or to identify new, co-expressed, candidate, therapeutic
molecules.
[0045] In a fourth aspect, the composition can be used for large
scale genetic or gene expression analysis of a large number of
novel, nucleic acid molecules. These samples are prepared by
methods well known in the art and are from mammalian cells or
tissues which are in a certain stage of development; have been
treated with a known molecule or compound, such as a cytokine,
growth factor, a drug, and the like; or have been extracted or
biopsied from a mammal with a known or unknown condition, disorder,
or disease before or after treatment. The sample nucleic acid
molecules are hybridized to the composition for the purpose of
defining a novel gene profile associated with that developmental
stage, treatment, or disorder.
cDNA Molecules and their Use
[0046] cDNA molecules can be prepared by a variety of synthetic or
enzymatic methods well known in the art. cDNA molecules can be
synthesized, in whole or in part, using chemical methods well known
in the art (Caruthers et al. (1980) Nucleic Acids Symp. Ser.
(7)215-233). Alternatively, cDNA molecules can be produced
enzymatically or recombinantly, by in vitro or in vivo
transcription.
[0047] Nucleotide analogs can be incorporated into cDNA molecules
by methods well known in the art. The only requirement is that the
incorporated analog must base pair with native purines or
pyrimidines. For example, 2,6-diaminopurine can substitute for
adenine and form stronger bonds with thymidine than those between
adenine and thymidine. A weaker pair is formed when hypoxanthine is
substituted for guanine and base pairs with cytosine. Additionally,
cDNA molecules can include nucleotides that have been derivatized
chemically or enzymatically.
[0048] cDNA molecules can be synthesized on a substrate. Synthesis
on the surface of a substrate may be accomplished using a chemical
coupling procedure and a piezoelectric printing apparatus as
described by Baldeschweiler et al. (PCT publication WO95/251116).
Alternatively, the cDNA molecules can be synthesized on a substrate
surface using a self-addressable electronic device that controls
when reagents are added as described by Heller et al. (U.S. Pat.
No. 5,605,662). cDNA molecules can be synthesized directly on a
substrate by sequentially dispensing reagents for their synthesis
on the substrate surface or by dispensing preformed DNA fragments
to the substrate surface. Typical dispensers include a micropipette
delivering solution to the substrate with a robotic system to
control the position of the micropipette with respect to the
substrate. There can be a multiplicity of dispensers so that
reagents can be delivered to the reaction regions efficiently.
[0049] cDNA molecules can be immobilized on a substrate by covalent
means such as by chemical bonding procedures or UV irradiation. In
one method, a cDNA molecule is bound to a glass surface which has
been modified to contain epoxide or aldehyde groups. In another
method, a cDNA molecule is placed on a polylysine coated surface
and UV crosslinked to it as described by Shalon et al.
(WO95/35505). In yet another method, a cDNA molecule is actively
transported from a solution to a given position on a substrate by
electrical means (Heller, supra). cDNA molecules do not have to be
directly bound to the substrate, but rather can be bound to the
substrate through a linker group. The linker groups are typically
about 6 to 50 atoms long to provide exposure of the attached cDNA
molecule. Preferred linker groups include ethylene glycol
oligomers, diamines, diacids and the like. Reactive groups on the
substrate surface react with a terminal group of the linker to bind
the linker to the substrate. The other terminus of the linker is
then bound to the cDNA molecule. Alternatively, polynucleotides,
plasmids or cells can be arranged on a filter. In the latter case,
cells are lysed, proteins and cellular components degraded, and the
DNA is coupled to the filter by UV cross-linking.
[0050] The cDNA molecules may be used for a variety of purposes.
For example, the composition of the invention may be used on a
microarray. The microarray, in turn, can be used in high-throughput
methods for detecting a related polynucleotide in a sample,
screening libraries of molecules or compounds to identify a ligand,
diagnosing a particular brain disorder, or inhibiting or
inactivating a therapeutically relevant gene related to the cDNA
molecule.
[0051] When the cDNA molecules of the invention are employed on a
microarray, the cDNA molecules are organized in an ordered fashion
so that each cDNA molecule is present at a specified location on
the substrate. Because the cDNA molecules are at specified
locations on the substrate, the hybridization patterns and
intensities, which together create a unique expression profile, can
be interpreted in terms of expression levels of particular genes
and can be correlated with a particular metabolic process,
condition, disorder, disease, stage of disease, or treatment.
Hybridization
[0052] The cDNA molecules or fragments or complements thereof may
be used in various hybridization technologies. The cDNA molecules
may be labeled using a variety of reporter molecules by either PCR,
recombinant, or enzymatic techniques. For example, a commercially
available vector containing the cDNA molecule is transcribed in the
presence of an appropriate polymerase, such as T7 or SP6
polymerase, and at least one labeled nucleotide. Commercial kits
are available for labeling and cleanup of such cDNA molecules.
Radioactive (Amersham Pharmacia Biotech (APB), Piscataway N.J.),
fluorescent (Operon Technologies, Alameda Calif.), and
chemiluminescent labeling (Promega, Madison Wis.) are well known in
the art.
[0053] A cDNA molecule may represent the complete coding region of
an mRNA molecule or be designed or derived from unique regions of
the mRNA molecule or genomic molecule, an intron, a 3' untranslated
region, or from a conserved motif. The cDNA molecule is at least 18
contiguous nucleotides in length and is usually single stranded.
Such a cDNA molecule may be used under hybridization conditions
that allow binding only to an identical sequence, a naturally
occurring molecule encoding the same protein, or an allelic
variant. Discovery of related human and mammalian sequences may
also be accomplished using a pool of degenerate cDNA molecules and
appropriate hybridization conditions. Generally, a cDNA molecule
for use in Southern or northern hybridizations may be from about
400 to about 5000 nucleotides long. Such cDNA molecules have high
binding specificity in solution-based or substrate-based
hybridizations. An oligonucleotide, a fragment the cDNA molecule,
may be used to detect a polynucleotide in a sample using PCR.
[0054] The stringency of hybridization is determined by G+C content
of the cDNA molecule, salt concentration, and temperature. In
particular, stringency is increased by reducing the concentration
of salt or raising the hybridization temperature. In solutions used
for some membrane based hybridizations, addition of an organic
solvent such as formamide allows the reaction to occur at a lower
temperature. Hybridization may be performed with buffers, such as
5.times.saline sodium citrate (SSC) with 1% sodium dodecyl sulfate
(SDS) at 60.degree. C., that permits the formation of a
hybridization complex between nucleic acid sequences that contain
some mismatches. Subsequent washes are performed with buffers such
as 0.2.times.SSC with 0.1% SDS at either 45.degree. C. (medium
stringency) or 65.degree.-68.degree. C. (high stringency). At high
stringency, hybridization complexes will remain stable only where
the nucleic acid molecules are completely complementary. In some
membrane-based hybridizations, preferably 35% or most preferably
50%, formamide may be added to the hybridization solution to reduce
the temperature at which hybridization is performed. Background
signals may be reduced by the use of detergents such as Sarkosyl or
Triton X-100 (Sigma Aldrich, St. Louis Mo.) and a blocking agent
such as denatured salmon sperm DNA. Selection of components and
conditions for hybridization are well known to those skilled in the
art and are reviewed in Ausubel (supra, pp. 6.11-6.19, 14.11-14.36,
and A1-43).
[0055] Dot-blot, slot-blot, low density and high density arrays are
prepared and analyzed using methods known in the art. The skilled
artisan will understand that cDNA molecules may vary in length
depending on the conditions under which the molecules are being
used. For example, cDNA molecules from about 18 consecutive
nucleotides to about 5000 consecutive nucleotides in length are
contemplated by the invention and used in array technologies.
Preferably, the cDNA molecules of the instant invention are between
about 25 and 500 nucleotides, more preferably from about 100 to
about 300 nucleotides in length, and most preferably from about 150
to about 250 nucleotides.
[0056] The array may be used to monitor the expression level of
large numbers of genes simultaneously and to identify genetic
variants, mutations, and SNPs. Such information may be used to
determine gene function; to understand the genetic basis of a
disorder; to diagnose a disorder; and to develop and monitor the
activities of therapeutic agents being used to control or cure a
disorder. (See, e.g., U.S. Pat. No. 5,474,796; WO95/11995;
WO95/35505; U.S. Pat. Nos. 5,605,662; and 5,958,342.)
Screening and Purification Assays
[0057] A cDNA molecule may be used to screen a library or a
plurality of molecules or compounds for a ligand which specifically
binds the cDNA molecule. Ligands may be DNA molecules, RNA
molecules, PNAs, peptides, proteins such as transcription factors,
promoters, enhancers, repressors, and other proteins that regulate
replication, transcription, or translation of the polynucleotide in
the biological system. The assay involves combining the cDNA
molecule or a fragment thereof with the molecules or compounds
under conditions that allow specific binding and detecting the
bound cDNA molecule to identify at least one ligand that
specifically binds the cDNA molecule.
[0058] In one embodiment, the cDNA molecule may be incubated with a
library of isolated and purified molecules or compounds and binding
activity determined by methods such as a gel-retardation assay
(U.S. Pat. No. 6,010,849) or a reticulocyte lysate transcriptional
assay. In another embodiment, the cDNA molecule may be incubated
with nuclear extracts from biopsied and/or cultured cells and
tissues. Specific binding between the cDNA molecule and a molecule
or compound in the nuclear extract is initially determined by gel
shift assay. Protein binding may be confirmed by raising antibodies
against the protein and adding the antibodies to the
gel-retardation assay where specific binding will cause a
supershift in the assay.
[0059] In another embodiment, the cDNA molecule may be used to
purify a molecule or compound using affinity chromatography methods
well known in the art. In one embodiment, the cDNA molecule is
chemically reacted with cyanogen bromide groups on a polymeric
resin or gel. Then a sample is passed over and reacts with or binds
to the cDNA molecule. The molecule or compound which is bound to
the cDNA molecule may be released from the cDNA molecule by
increasing the salt concentration of the flow-through medium and
collected.
[0060] The cDNA molecule may be used to purify a ligand from a
sample. A method for using a cDNA molecule to purify a ligand would
involve combining the cDNA molecule or a fragment thereof with a
sample under conditions to allow specific binding, recovering the
bound cDNA molecule, and using an appropriate agent to separate the
cDNA molecule from the purified ligand.
Protein Production and Uses
[0061] The full length cDNA molecules or fragment thereof may be
used to produce purified proteins using recombinant DNA
technologies (Ausubel (supra; pp. 16.1-16.62)). One of the
advantages of producing proteins by these procedures is the ability
to obtain highly-enriched sources of the proteins thereby
simplifying purification procedures.
[0062] The proteins may contain amino acid substitutions, deletions
or insertions made on the basis of similarity in polarity, charge,
solubility, hydrophobicity, hydrophilicity, and/or the amphipathic
nature of the residues involved. Such substitutions may be
conservative in nature when the substituted residue has structural
or chemical properties similar to the original residue (e.g.,
replacement of leucine with isoleucine or valine) or they may be
non-conservative when the replacement residue is radically
different (e.g., a glycine replaced by a tryptophan). Computer
programs included in LASERGENE software (DNASTAR, Madison Wis.),
MACVECTOR software (Genetics Computer Group, Madison Wis.) and
RasMol software (www.umass.edu/microbio/rasmol) may be used to help
determine which and how many amino acid residues in a particular
portion of the protein may be substituted, inserted, or deleted
without abolishing biological or immunological activity.
Expression of Encoded Proteins
[0063] Expression of a particular cDNA molecule may be accomplished
by cloning the cDNA molecule into a vector and transforming this
vector into a host cell. The cloning vector used for the
construction of cDNA libraries in the LIFESEQ databases may also be
used for expression. Such vectors usually contain a promoter and a
polylinker useful for cloning, priming, and transcription. An
exemplary vector may also contain the promoter for
.beta.-galactosidase, an amino-terminal methionine and the
subsequent seven amino acid residues of .beta.-galactosidase. The
vector may be transformed into competent E. coli cells. Induction
of the isolated bacterial strain with isopropylthiogalactoside
(IPTG) using standard methods will produce a fusion protein that
contains an N terminal methionine, the first seven residues of
.beta.-galactosidase, about 15 residues of linker, and the protein
encoded by the cDNA molecule.
[0064] The cDNA molecule may be shuttled into other vectors known
to be useful for expression of protein in specific hosts.
Oligonucleotides containing cloning sites and fragments of DNA
sufficient to hybridize to stretches at both ends of the cDNA
molecule may be chemically synthesized by standard methods. These
primers may then be used to amplify the desired fragments by PCR.
The fragments may be digested with appropriate restriction enzymes
under standard conditions and isolated using gel electrophoresis.
Alternatively, similar fragments are produced by digestion of the
cDNA molecule with appropriate restriction enzymes and filled in
with chemically synthesized oligonucleotides. Fragments of the
coding sequence from more than one gene may be ligated together and
expressed.
[0065] Signal sequences that dictate secretion of soluble proteins
are particularly desirable as component parts of a recombinant
sequence. For example, a chimeric protein may be expressed that
includes one or more additional purification-facilitating domains.
Such domains include, but are not limited to, metal-chelating
domains that allow purification on immobilized metals, protein A
domains that allow purification on immobilized immunoglobulin, and
the domain utilized in the FLAGS extension/affinity purification
system (Immunex, Seattle Wash.). The inclusion of a
cleavable-linker sequence such as ENTEROKINASEMAX (Invitrogen, San
Diego Calif.) between the protein and the purification domain may
also be used to recover the protein.
[0066] Suitable host cells may include, but are not limited to,
mammalian cells such as Chinese Hamster Ovary (CHO) and human 293
cells, insect cells such as Sf9 cells, plant cells such as
Nicotiana tabacum, yeast cells such as Saccharomyces cerevisiae,
and bacteria such as E. coli. For each of these cell systems, a
useful expression vector may also include an origin of replication
and one or two selectable markers to allow selection in bacteria as
well as in a transformed eukaryotic host. Vectors for use in
eukaryotic expression hosts may require the addition of 3' poly(A)
tail if the cDNA lacks poly(A).
[0067] Additionally, the vector may contain promoters or enhancers
that increase gene expression. Many promoters are known and used in
the art. Most promoters are host specific and exemplary promoters
includes SV40 promoters for CHO cells; T7 promoters for bacterial
hosts; viral promoters and enhancers for plant cells; and PGH
promoters for yeast. Adenoviral vectors with the rous sarcoma virus
enhancer or retroviral vectors with long terminal repeat promoters
may be used to drive protein expression in mammalian cell lines.
Once homogeneous cultures of recombinant cells are obtained, large
quantities of secreted soluble protein may be recovered from the
conditioned medium and analyzed using chromatographic methods well
known in the art. An alternative method for the production of large
amounts of secreted protein involves the transformation of
mammalian embryos and the recovery of the recombinant protein from
milk produced by transgenic cows, goats, sheep, and the like.
[0068] In addition to recombinant production, proteins or portions
thereof may be produced manually, using solid-phase techniques
(Stewart et al. (1969) Solid-Phase Peptide Synthesis, WH Freeman,
San Francisco Calif.; Merrifield (1963) J Am Chem Soc 5:2149-2154),
or using machines such as the ABI 431A peptide synthesizer (PE
Biosystems, Norwalk Conn.). Proteins produced by any of the above
methods may be used as pharmaceutical compositions to treat
disorders associated with null or inadequate expression of the
genomic sequence.
Screening and Purification Assays
[0069] A protein or a portion thereof encoded by the cDNA molecule
may be used to screen libraries or a plurality of molecules or
compounds for a ligand with specific binding affinity or to purify
a molecule or compound from a sample. The protein or portion
thereof employed in such screening may be free in solution, affixed
to an abiotic or biotic substrate, or located intracellularly. For
example, viable or fixed prokaryotic host cells that are stably
transformed with recombinant nucleic acids that have expressed and
positioned a protein on their cell surface can be used in screening
assays. The cells are screened against libraries or a plurality of
ligands and the specificity of binding or formation of complexes
between the expressed protein and the ligand may be measured. The
ligands may be DNA, RNA, or PNA molecules, agonists, antagonists,
antibodies, immunoglobulins, inhibitors, peptides, pharmaceutical
agents, proteins, drugs, or any other test molecule or compound
that specifically binds the protein. An exemplary assay involves
combining the mammalian protein or a portion thereof with the
molecules or compounds under conditions that allow specific binding
and detecting the bound protein to identify at least one ligand
that specifically binds the protein.
[0070] This invention also contemplates the use of competitive drug
screening assays in which neutralizing antibodies capable of
binding the protein specifically compete with a test compound
capable of binding to the protein or oligopeptide or fragment
thereof. One method for high throughput screening using very small
assay volumes and very small amounts of test compound is described
in U.S. Pat. No. 5,876,946. Molecules or compounds identified by
screening may be used in a model system to evaluate their toxicity,
diagnostic, or therapeutic potential.
[0071] The protein may be used to purify a ligand from a sample. A
method for using a protein to purify a ligand would involve
combining the protein or a portion thereof with a sample under
conditions to allow specific binding, recovering the bound protein,
and using an appropriate chaotropic agent to separate the protein
from the purified ligand.
Production of Antibodies
[0072] A protein encoded by a cDNA molecule of the invention may be
used to produce specific antibodies. Antibodies may be produced
using an oligopeptide or a portion of the protein with inherent
immunological activity. Methods for producing antibodies include:
1) injecting an animal, usually goats, rabbits, or mice, with the
protein, or an antigenically effective portion or an oligopeptide
thereof, to induce an immune response; 2) engineering hybridomas to
produce monoclonal antibodies; 3) inducing in vivo production in
the lymphocyte population; or 4) screening libraries of recombinant
immunoglobulins. Recombinant immunoglobulins may be produced as
taught in U.S. Pat. No. 4,816,567.
[0073] Antibodies produced using the proteins of the invention are
useful for the diagnosis of prepathologic disorders as well as the
diagnosis of chronic or acute diseases characterized by
abnormalities in the expression, amount, or distribution of the
protein. A variety of protocols for competitive binding or
immunoradiometric assays using either polyclonal or monoclonal
antibodies specific for proteins are well known in the art.
Immunoassays typically involve the formation of complexes between a
protein and its specific binding molecule or compound and the
measurement of complex formation.
[0074] Immunoassay procedures may be used to quantify expression of
the protein in cell cultures, in subjects with a particular
disorder or in model animal systems under various conditions.
Increased or decreased production of proteins as monitored by
immunoassay may contribute to knowledge of the cellular activities
associated with developmental pathways, engineered conditions or
diseases, or treatment efficacy. The quantity of a given protein in
a given tissue may be determined by performing immunoassays on
freeze-thawed detergent extracts of biological samples and
comparing the slope of the binding curves to binding curves
generated by purified protein.
Labeling of Molecules for Assay
[0075] A wide variety of reporter molecules and conjugation
techniques are known by those skilled in the art and may be used in
various cDNA, polynucleotide, protein, peptide or antibody assays.
Synthesis of labeled molecules may be achieved using commercial
kits for incorporation of a labeled nucleotide such as
.sup.32P-dCTP, Cy3-dCTP or Cy5-dCTP or amino acid such as
.sup.35S-methionine. Polynucleotides, cDNAs, proteins, or
antibodies may be directly labeled with a reporter molecule by
chemical conjugation to amines, thiols and other groups present in
the molecules using reagents such as BIODIPY or FITC (Molecular
Probes, Eugene Oreg.).
[0076] The proteins and antibodies may be labeled for purposes of
assay by joining them, either covalently or noncovalently, with a
reporter molecule that provides for a detectable signal. A wide
variety of labels and conjugation techniques are known and have
been reported in the scientific and patent literature including,
but not limited to U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350;
3,996,345; 4,277,437; 4,275,149; and 4,366,241.
Diagnostics
[0077] In order to provide a basis for the diagnosis of a
condition, disease or disorder associated with gene expression, a
normal or standard expression profile is established. This may be
accomplished by combining a biological sample taken from normal
subjects, either animal or human, with a probe under conditions for
hybridization or amplification. Standard hybridization may be
quantified by comparing the values obtained using normal subjects
with values from an experiment in which a known amount of a
substantially purified target sequence is used. Standard values
obtained in this manner may be compared with values obtained from
samples from patients who are symptomatic for a particular
condition, disease, or disorder. Deviation from standard values
toward those associated with a particular condition is used to
diagnose that condition.
[0078] The cDNA molecules, or fragments thereof, may be used to
detect and quantify altered gene expression; absence, presence, or
excess expression of mRNAs; or to monitor mRNA levels during
therapeutic intervention. Disorders associated with altered
expression include bipolar I disorder, bipolar II disorder,
unipolar disorder, schizophrenia, attention deficit hyperactive
disorders, obsessive compulsive disorders, anxiety disorders or
other related mood disorders. These cDNA molecules can also be
utilized as markers of treatment efficacy against the diseases
noted above and other mental illnesses, conditions, and diseases
over a period ranging from several days to months. The diagnostic
assay may use hybridization or amplification technology to compare
gene expression in a biological sample from a patient to standard
samples in order to detect altered gene expression. Qualitative or
quantitative methods for this comparison are well known in the
art.
[0079] For example, the cDNA molecule may be labeled by standard
methods and added to a biological sample from a patient under
conditions for the formation of hybridization complexes. After an
incubation period, the sample is washed and the amount of label (or
signal) associated with hybridization complexes, is quantified and
compared with a standard value. If the amount of label in the
patient sample is significantly altered in comparison to the
standard value, then the presence of the associated condition,
disease or disorder is indicated.
[0080] Such assays may also be used to evaluate the efficacy of a
particular therapeutic treatment regimen in animal studies and in
clinical trial or to monitor the treatment of an individual
patient. Once the presence of a condition is established and a
treatment protocol is initiated, diagnostic assays may be repeated
on a regular basis to determine if the level of expression in the
patient begins to approximate that which is observed in a normal
subject. The results obtained from successive assays may be used to
show the efficacy of treatment over a period ranging from several
days to months.
Gene Expression Profiles
[0081] A gene expression profile comprises a plurality of cDNA
molecules and a plurality of detectable hybridization complexes,
wherein each complex is formed by hybridization of one or more
probes to one or more complementary sequences in a sample. The cDNA
composition of the invention is used as elements on a microarray to
analyze gene expression profiles. In one embodiment, the microarray
is used to monitor the progression of disease. Researchers can
assess and catalog the differences in gene expression between
healthy and diseased tissues or cells. By analyzing changes in
patterns of gene expression, disease can be diagnosed at earlier
stages before the patient is symptomatic. The invention can be used
to formulate a prognosis and to design a treatment regimen. The
invention can also be used to monitor the efficacy of treatment.
For treatments with known side effects, the microarray is employed
to improve the treatment regimen. A dosage is established that
causes a change in genetic expression patterns indicative of
successful treatment. Expression patterns associated with the onset
of undesirable side effects are avoided. This approach may be more
sensitive and rapid than waiting for the patient to show inadequate
improvement, or to manifest side effects, before altering the
course of treatment.
[0082] In another embodiment, animal models which mimic a human
disease can be used to characterize expression profiles associated
with a particular condition, disorder or disease or treatment of
the condition, disorder or disease. Novel treatment regimens may be
tested in these animal models using microarrays to establish and
then follow expression profiles over time. In addition, microarrays
may be used with cell cultures or tissues removed from animal
models to rapidly screen large numbers of candidate drug molecules,
looking for ones that produce an expression profile similar to
those of known therapeutic drugs, with the expectation that
molecules with the same expression profile will likely have similar
therapeutic effects. Thus, the invention provides the means to
rapidly determine the molecular mode of action of a drug.
Assays Using Antibodies
[0083] Antibodies directed against epitopes on a protein encoded by
a cDNA molecule of the invention may be used in assays to quantify
the amount of protein found in a particular human cell. Such assays
include methods utilizing the antibody and a label to detect
expression level under normal or disease conditions. The antibodies
may be used with or without modification, and labeled by joining
them, either covalently or noncovalently, with a labeling
moiety.
[0084] Protocols for detecting and measuring protein expression
using either polyclonal or monoclonal antibodies are well known in
the art. Examples include ELISA, RIA, and fluorescent activated
cell sorting (FACS). Such immunoassays typically involve the
formation of complexes between the protein and its specific
antibody and the measurement of such complexes. These and other
assays are described in Pound (supra). The method may employ a
two-site, monoclonal-based immunoassay utilizing monoclonal
antibodies reactive to two non-interfering epitopes, or a
competitive binding assay. (See, e.g., Coligan et al. (1997)
Current Protocols in Immunology, Wiley-Interscience, New York N.Y.;
Pound, supra)
Therapeutics
[0085] The cDNA molecules and fragments thereof can be used in gene
therapy. cDNA molecules can be delivered ex vivo to target cells,
such as cells of bone marrow. Once stable integration and
transcription and or translation are confirmed, the bone marrow may
be reintroduced into the subject. Expression of the protein encoded
by the cDNA may correct a disease state associated with mutation of
a normal sequence, reduction or loss of an endogenous target
protein, or overepression of an endogenous or mutant protein.
Alternatively, cDNA molecules may be delivered in vivo using
vectors such as retrovirus, adenovirus, adeno-associated virus,
herpes simplex virus, and bacterial plasmids. Non-viral methods of
gene delivery include cationic liposomes, polylysine conjugates,
artificial viral envelopes, and direct injection of DNA (Anderson
(1998) Nature 392:25-30; Dachs et al. (1997) Oncol Res 9:313-325;
Chu et al. (1998) J Mol Med 76(3-4):184-192; Weiss et al. (1999)
Cell Mol Life Sci 55(3):334-358; Agrawal (1996) Antisense
Therapeutics, Humana Press, Totowa N.J.; and August et al. (1997)
Gene Therapy (Advances in Pharmacology, Vol. 40), Academic Press,
San Diego Calif.).
[0086] In addition, expression of a particular protein can be
modulated through the specific binding of a fragment of a cDNA
molecule to a genomic sequence or an mRNA molecule which encodes
the protein or directs its transcription or translation. The cDNA
molecule can be modified or derivatized to any RNA-like or DNA-like
material including peptide nucleic acids, branched nucleic acids,
and the like. These sequences can be produced biologically by
transforming an appropriate host cell with an expression vector
containing the sequence of interest.
[0087] Molecules which modulate the activity of the cDNA molecule
or encoded protein are useful as therapeutics for brain disorders.
Such molecules include agonists which increase the expression or
activity of the polynucleotide or encoded protein, respectively; or
antagonists which decrease expression or activity of the
polynucleotide or encoded protein, respectively. In one aspect, an
antibody which specifically binds the protein may be used directly
as an antagonist or indirectly as a delivery mechanism for bringing
a pharmaceutical agent to cells or tissues which express the
protein.
[0088] Additionally, any of the proteins, or their ligands, or
complementary nucleic acid sequences may be administered in
combination with other appropriate therapeutic agents. Selection of
the appropriate agents for use in combination therapy may be made
by one of ordinary skill in the art, according to conventional
pharmaceutical principles. The combination of therapeutic agents
may act synergistically to affect the treatment or prevention of
the conditions and disorders associated with an immune response.
Using this approach, one may be able to achieve therapeutic
efficacy with lower dosages of each agent, thus reducing the
potential for adverse side effects. Further, the therapeutic agents
may be combined with pharmaceutically-acceptable carriers including
excipients and auxiliaries which facilitate processing of the
active compounds into preparations which can be used
pharmaceutically. Further details on techniques for formulation and
administration may be found in the latest edition of Remington's
Pharmaceutical Sciences (Maack Publishing, Easton Pa.).
Model Systems
[0089] Animal models may be used as bioassays where they exhibit a
phenotypic response similar to that of humans and where exposure
conditions are relevant to human exposures. Mammals are the most
common models, and most infectious agent, cancer, drug, and
toxicity studies are performed on rodents such as rats or mice
because of low cost, availability, lifespan, reproductive
potential, and abundant reference literature. Inbred and outbred
rodent strains provide a convenient model for investigation of the
physiological consequences of underexpression or overexpression of
genes of interest and for the development of methods for diagnosis
and treatment of diseases. A mammal inbred to overexpress a
particular gene (for example, secreted in milk) may also serve as a
convenient source of the protein expressed by that gene.
Transgenic Animal Models
[0090] Transgenic rodents that overexpress or underexpress a gene
of interest may be inbred and used to model human diseases or to
test therapeutic or toxic agents. (See, e.g., U.S. Pat. Nos.
5,175,383 and 5,767,337.) In some cases, the introduced gene may be
activated at a specific time in a specific tissue type during fetal
or postnatal development. Expression of the transgene is monitored
by analysis of phenotype, of tissue-specific mRNA expression, or of
serum and tissue protein levels in transgenic animals before,
during, and after challenge with experimental drug therapies.
Embryonic Stem Cells
[0091] Embryonic (ES) stem cells isolated from rodent embryos
retain the potential to form embryonic tissues. When ES cells such
as the mouse 129/SvJ cell line are placed in a blastocyst from the
C57BL/6 mouse strain, they resume normal development and contribute
to tissues of the live-born animal. ES cells are preferred for use
in the creation of experimental knockout and knockin animals. The
method for this process is well known in the art and the steps are:
the cDNA is introduced into a vector, the vector is transformed
into ES cells, transformed cells are identified and microinjected
into mouse cell blastocysts, blastocysts are surgically transferred
to pseudopregnant dams. The resulting chimeric progeny are
genotyped and bred to produce heterozygous or homozygous
strains.
Knockout Analysis
[0092] In gene knockout analysis, a region of a gene is
enzymatically modified to include a non-natural intervening
sequence such as the neomycin phosphotransferase gene (neo;
Capecchi (1989) Science 244:1288-1292). The modified gene is
transformed into cultured ES cells and integrates into the
endogenous genome by homologous recombination. The inserted
sequence disrupts transcription and translation of the endogenous
gene.
Knockin Analysis
[0093] ES cells can be used to create knockin humanized animals or
transgenic animal models of human diseases. With knockin
technology, a region of a human gene is injected into animal ES
cells, and the human sequence integrates into the animal cell
genome. Transgenic progeny or inbred lines are studied and treated
with potential pharmaceutical agents to obtain information on the
progression and treatment of the analogous human condition.
[0094] As described herein, the uses of the cDNA molecules,
provided in the Sequence Listing of this application, and their
encoded proteins are exemplary of known techniques and are not
intended to reflect any limitation on their use in any technique
that would be known to the person of average skill in the art.
Furthermore, the cDNA molecules provided in this application may be
used in molecular biology techniques that have not yet been
developed, provided the new techniques rely on properties of
nucleotide sequences that are currently known to the person of
ordinary skill in the art, e.g., the triplet genetic code, specific
base pair interactions, and the like. Likewise, reference to a
method may include combining more than one method for obtaining or
assembling full length cDNA sequences that will be known to those
skilled in the art. It is also to be understood that this invention
is not limited to the particular methodology, protocols, and
reagents described, as these may vary. It is also understood that
the terminology used herein is for the purpose of describing
particular embodiments only, and is not intended to limit the scope
of the present invention which will be limited only by the appended
claims. The examples below are provided to illustrate the subject
invention and are not included for the purpose of limiting the
invention.
EXAMPLES
[0095] I. Preparation of cDNAs
[0096] Nucleic acid sequences (cDNA molecules) were made by RT-PCR
from total cellular RNA using oligonucleotide primers corresponding
to the 5' and 3' ends of the polynucleotides of SEQ ID NOs:1-50
(see Table 2). One primer was synthesized to initiate 5' extension
of the known fragment, and the other, to initiate 3' extension of
the known fragment. Cultured human neuroblastoma SHSY-5Y cells were
obtained from American Type Culture Collection (accession no.
CRL-2266) and were maintained in culture. The cells were lysed,
total RNA was isolated using the RNA STAT-60 kit (Tel-Test,
Friendswood Tex.). cDNA was amplified by PCR using Taq DNA
polymerase with the following parameters: Step 1: 94.degree. C., 3
min; Step 2: 94.degree. C., 15 sec; Step 3: 60.degree. C., 1 min;
Step 4: 72.degree. C., 2 min; Step 5: steps 2, 3, and 4 repeated 29
times; Step 6: 72.degree. C., 5 min; Step 7: storage at 4.degree.
C. DNA was quantified. The primer sequences are shown in Table
2
[0097] Two control cDNAs (GAPDH: SEQ ID NO:51; beta-actin: SEQ ID
NO:52) were prepared in the same manner as the cDNAs of SEQ ID NOs:
1-50. The GenBank Accession number is NM_002046 for GAPDH, and
BC014861 for beta-actin.
[0098] Table 2 shows the identity of the genes from which the cDNA
molecules were made, along with the sequence identifier for the
gene, the GenBank accession number of the gene, the forward (5')
and reverse (3') primers use to prepare the cDNA molecules
corresponding to each gene, and the size of the product that
results from the PCR reaction.
TABLE-US-00002 TABLE 2 SEQ ID NO: 1 Gene: Homo sapiens, ATP
synthase, H+ transporting, mitochondrial F0 complex, subunit d,
transcript variant 2, mRNA GenBank #: BC032245 Forward Primer:
TCCTGGAATGAGACCCTCAC (SEQ ID NO: 53) Reverse Primer:
GAGACACCCACTCAGCACAA (SEQ ID NO: 54) Product Size: 151 bp SEQ ID
NO: 2 Gene: Homo sapiens, ATP synthase, H+ transporting,
mitochondrial F1 complex, O subunit (oligomycin-sensitive
conferring protein (OSCP)), mRNA GenBank #: BC021233 Forward
Primer: GCTTGCTGAAAATGGTCGAT (SEQ ID NO: 55) Reverse Primer:
CGGATCAGTCTTAGCCTCCA (SEQ ID NO: 56) Product Size: 205 bp SEQ ID
NO: 3 Gene: Homo sapiens, ATP synthase, H+ transporting,
mitochondrial F0 complex, subunit f, isoform 2, mRNA GenBank #:
BC003678 Forward Primer: GCGGGACTTCAGTCCTAGTG (SEQ ID NO: 57)
Reverse Primer: CTCGTGCTTGAGATGCTTGT (SEQ ID NO: 58) Product Size:
169 bp SEQ ID NO: 4 Gene: Homo sapiens, Nuclear respiratory factor
1 (NRF1), mRNA GenBank #: NM_005011 Forward Primer:
GATCGTCTTGTCTGGGGAAA (SEQ ID NO: 59) Reverse Primer:
GGTGACTGCGCTGTCTGATA (SEQ ID NO: 60) Product Size: 244 bp SEQ ID
NO: 5 Gene: Homo sapiens, mitochondrial DNA-encoded Cytochrome
Oxidase Subunit I, mRNA GenBank #: NC 001807 Forward Primer:
GGCCTGACTGGCATTGTATT (SEQ ID NO: 61) Reverse Primer:
TGGCGTAGGTTTGGTCTAGG (SEQ ID NO: 62) Product Size: 178 bp SEQ ID
NO: 6 Gene: Homo sapiens, Interferon Gamma, mRNA GenBank #: X13274
Forward Primer: TTCAGCTCTGCATCGTTTTG (SEQ ID NO: 63) Reverse
Primer: TCTTTTGGATGCTCTGGTCA (SEQ ID NO: 64) Product Size: 246 bp
SEQ ID NO: 7 Gene: Homo sapiens, Inositol (myo)-1(or
4)-monophosphatase 2, mRNA GenBank #: BC017176 Forward Primer:
TCAAAGGCCTTGGTTCTGAC (SEQ ID NO: 65) Reverse Primer:
GTGCAGGCCAAACTGGTAAT (SEQ ID NO: 66) Product Size: 189 bp SEQ ID
NO: 8 Gene: Human L-iditol-2 dehydrogenase (Sorbitol
dehydrogenase), mRNA GenBank #: L29008 Forward Primer:
CTCCCCGAGAAAATGATGAA (SEQ ID NO: 67) Reverse Primer:
CACAGAAAGTGGCTCGATCA (SEQ ID NO: 68) Product Size: 188 bp SEQ ID
NO: 9 Gene: Homo sapiens, mitochondrial DNA-encoded Cytochrome
Oxidase Subunit II, mRNA GenBank #: NC 001807 Forward Primer:
TTCATGATCACGCCCTCATA (SEQ ID NO: 69) Reverse Primer:
TAAAGGATGCGTAGGGATGG (SEQ ID NO: 70) Product Size: 187 bp SEQ ID
NO: 10 Gene: Homo sapiens, Transcription factor A, mitochondrial
(TFAM), mRNA GenBank #: NM_003201 Forward Primer:
CCGAGGTGGTTTTCATCTGT (SEQ ID NO: 71) Reverse Primer:
TCCGCCCTATAAGCATCTTG (SEQ ID NO: 72) Product Size: 203 bp SEQ ID
NO: 11 Gene: Homo sapiens, Glial Fibrillary Acidic Protein (GFAP),
mRNA GenBank #: BC013596 Forward Primer: ACATCGAGATCGCCACCTAC (SEQ
lD NO: 73) Reverse Primer: ATCTCCACGGTCTTCACCAC (SEQ ID NO: 74)
Product Size: 166 bp SEQ ID NO: 12 Gene: Homo sapiens, heat shock
60 kDa protein 1 (chaperonin), transcript variant 1, mRNA GenBank
#: BC002676 Forward Primer: CATTCCAGCCTTGGACTCAT (SEQ ID NO: 75)
Reverse Primer: TCACAACCTTTGTTGGGTCA (SEQ ID NO: 76) Product Size:
236 bp SEQ ID NO: 13 Gene: Homo sapiens, Lactate dehydrogenase-B
(LDH-B), mRNA GenBank #: BT019765 Forward Primer:
CCAACCCAGTGGACATTCTT (SEQ ID NO: 77) Reverse Primer:
AAACACCTGCCACATTCACA (SEQ ID NO: 78) Product Size: 219 bp SEQ ID
NO: 14 Gene: Homo sapiens, Hexokinase 1 (HK1), mRNA GenBank #:
M75126 Forward Primer: CCTGGGAGATTTCATGGAGA (SEQ ID NO: 79) Reverse
Primer: GTGCCCACTGTGTCATTCAC (SEQ ID NO: 80) Product Size: 240 bp
SEQ ID NO: 15 Gene: Homo sapiens, Glycogen Synthase Kinase 3 beta,
mRNA GenBank #: BC012760 Forward Primer: ATTACGGGACCCAAATGTCA (SEQ
ID NO: 81) Reverse Primer: TGCAGAAGCAGCATTATTGG (SEQ ID NO: 82)
Product Size: 217 bp SEQ ID NO: 16 Gene: Homo sapiens,
ADP-ribosylation factor 4-like, mRNA GenBank #: BC000043 Forward
Primer: GACCACTGTGGCGCTCTTAT (SEQ ID NO: 83) Reverse Primer:
CAGCCTCTTCTCCACCTCAG (SEQ ID NO: 84) Product Size: 206 bp SEQ ID
NO: 17 Gene: Homo sapiens, Adrenomedullin precursor, mRNA GenBank
#: D14874 Forward Primer: CGTCGGAGTTTCGAAAGAAG (SEQ ID NO: 85)
Reverse Primer: CCCTGGAAGTTGTTCATGCT (SEQ ID NO: 86) Product Size:
206 bp SEQ ID NO: 18 Gene: Homo sapiens, protein kinase C alpha
(PKC alpha), mRNA GenBank #: X52479 Forward Primer:
GTGGCAAAGGAGCAGAGAAC (SEQ ID NO: 87) Reverse Primer:
TGTAAGATGGGGTGCACAAA (SEQ ID NO: 88) Product Size: 151 bp SEQ ID
NO: 19 Gene: Homo sapiens, protein kinase C, beta 1, transcript
variant 2 (PKC beta 1), mRNA GenBank #: BC036472 Forward Primer:
TGAAGGGGAGGATGAAGATG (SEQ ID NO: 89) Reverse Primer:
TAAGGGGGCTGGATCTCTTT (SEQ ID NO: 90) Product Size: 228 bp SEQ ID
NO: 20 Gene: Homo sapiens, protein kinase C delta-type (PKC
delta-type), mRNA GenBank #: D10495 Forward Primer:
CAACTACATGAGCCCCACCT (SEQ ID NO: 91) Reverse Primer:
GAGGCTCTCTGGGTGACTTG (SEQ ID NO: 92) Product Size: 189 bp SEQ ID
NO: 21 Gene: Homo sapiens, 80K-H protein (Protein Kinase C
substrate), mRNA GenBank #: J03075 Forward Primer:
AACGGGGAGTTTGCTTACCT (SEQ ID NO: 93) Reverse Primer:
CGTGCCTTGCTCATACTTCA (SEQ ID NO: 94) Product Size: 195 bp SEQ ID
NO: 22 Gene: Homo sapiens, Protein kinase C inhibitor-2, mRNA
GenBank #: AF085236 Forward Primer: TGAGGACCAGCAGTGTCTTG (SEQ ID
NO: 95) Reverse Primer: CCATCGTTGATCACAAGTCG (SEQ ID NO: 96)
Product Size: 204 bp SEQ ID NO: 23 Gene: Homo sapiens,
Ca2+/calmodulin-dependent protein kinase kinase beta (CAMKKB), mRNA
GenBank #: AF140507 Forward Primer: GCTGACTTTGGTGTGAGCAA (SEQ ID
NO: 97) Reverse Primer: AATTCCAGGGCCTGACTCTT (SEQ ID NO: 98)
Product Size: 242 bp SEQ ID NO: 24 Gene: Homo sapiens, heat shock
protein (HSP 40), E. coli DnaJ homologue, mRNA GenBank #: L08069
Forward Primer: ATTGCCGAGGTACTGGAATG (SEQ ID NO: 99) Reverse
Primer: GCCATCTTTCATGCCTTTGT (SEQ ID NO: 100) Product Size: 203 bp
SEQ ID NO: 25 Gene: Homo sapiens, Transient Receptor Potential
Cation Channel subfamily C, member 7 (TRPC7), mRNA GenBank #:
NM_020389 Forward Primer: GTTAAAACCCTGCCAAACGA (SEQ ID NO: 101)
Reverse Primer: GGACAGCATCCCGAAATCTA (SEQ ID NO: 102) Product Size:
204 bp SEQ ID NO: 26 Gene: Homo sapiens, translocase of outer
mitochondrial membrane homolog 20 homolog (yeast) (TOM 20), mRNA
GenBank #: BC000882 Forward Primer: AAACAGAAGCTTGCCAAGGA (SEQ ID
NO: 103) Reverse Primer: CATCTGGAACACTGGTGGTG (SEQ ID NO: 104)
Product Size: 234 bp SEQ ID NO: 27 Gene: Homo sapiens,
Interleukin-10 (IL-10), mRNA GenBank #: M57627 Forward Primer:
TGCCTTCAGCAGAGTGAAGA (SEQ ID NO: 105) Reverse Primer:
GGTCTTGGTTCTCAGCTTGG (SEQ ID NO: 106) Product Size: 170 bp SEQ ID
NO: 28 Gene: Homo sapiens, Interleukin 2 receptor (IL-2R), mRNA
GenBank #: X01057 Forward Primer: ATCAGTGCGTCCAGGGATAC (SEQ ID NO:
107) Reverse Primer: GACGAGGCAGGAAGTCTCAC (SEQ lD NO: 108) Product
Size: 197 bp SEQ ID NO: 29 Gene: Homo sapiens, Proteasome (prosome,
macropain) 26S subunit, ATPase, 6 mRNA GenBank #: BT006843 Forward
Primer: GCTGCGTCCAGGAAGATTAG (SEQ ID NO: 109) Reverse Primer:
TGCGAACATACCTGCTTCAG (SEQ ID NO: 110) Product Size: 196 bp SEQ ID
NO: 30 Gene: Homo sapiens, Calbindin 1, 28 kDa (CALB1), mRNA
GenBank #: NM_004929 Forward Primer: ATCCCTCATCACAGCCTCAC (SEQ lD
NO: 111) Reverse Primer: TGCCCATACTGATCCACAAA (SEQ ID NO: 112)
Product Size: 177 bp SEQ ID NO: 31 Gene: Homo sapiens, heat shock
70 kDa protein 5 (Glucose-regulated Protein 78 kDa) (GRP 78), mRNA
GenBank #: BC020235 Forward Primer: TAGCGTATGGTGCTGCTGTC (SEQ ID
NO: 113) Reverse Primer: TTTGTCAGGGGTCTTTCACC (SEQ ID NO: 114)
Product Size: 241 bp SEQ ID NO: 32 Gene: Homo sapiens, (HepG2)
glucose transporter gene, mRNA GenBank #: K03195 Forward Primer:
CTTCACTGTCGTGTCGCTGT (SEQ ID NO: 115) Reverse Primer:
TGAAGAGTTCAGCCACGATG (SEQ ID NO: 116) Product Size: 230 bp SEQ ID
NO: 33 Gene: Homo sapiens, solute carrier family 2 (facilitated
glucose transporter), member 3, mRNA GenBank #: BC039196 Forward
Primer: ACCGGCTTCCTCATTACCTT (SEQ ID NO: 117) Reverse Primer:
AGGCTCGATGCTGTTCATCT (SEQ ID NO: 118) Product Size: 159 bp
SEQ ID NO: 34 Gene: Homo sapiens, B-cell lymphoma 3-encoded protein
(bcl-3) mRNA GenBank #: M31732 Forward Primer: CCCTATACCCCATGATGTGC
(SEQ ID NO: 119) Reverse Primer: GGTGTCTGCCGTAGGTTGTT (SEQ ID NO:
120) Product Size: 199 bp SEQ ID NO: 35 Gene: Homo sapiens,
Liver-type 1-phosphofructokinase (PFKL), mRNA GenBank #: X15573
Forward Primer: GGAGCTTCGAGAACAACTGG (SEQ ID NO: 121) Reverse
Primer: CTGTGTGTCCATGGGAGATG (SEQ ID NO: 122) Product Size: 168 bp
SEQ ID NO: 36 Gene: Homo sapiens, translocation (t1;19) fusion
protein (E2A/PRL), mRNA GenBank #: M31522 Forward Primer:
CAAGCTAACTCGCCCTCAAC (SEQ ID NO: 123) Reverse Primer:
GCTGCGAGTCCATCACTGTA (SEQ ID NO: 124) Product Size: 206 bp SEQ ID
NO: 37 Gene: Homo sapiens, Hexose-6-phosphate dehydrogenase
(glucose 1- dehydrogenase) (H6PD) GenBank #: NM_004285 Forward
Primer: GCACAAGCTTCAGGTCTTCC (SEQ ID NO: 125) Reverse Primer:
GAACAAGATCCGAGCGTAGC (SEQ ID NO: 126) Product Size: 247 bp SEQ ID
NO: 38 Gene: Homo sapiens, ATPase, Na+/K+ transporting, alpha 2 (+)
polypeptide, mRNA GenBank #: BC052271 Forward Primer:
CGCAAATACCAAGTGGACCT (SEQ ID NO: 127) Reverse Primer:
AAGCAGAGGATAGCCCCAAT (SEQ 1D NO: 128) Product Size: 179 bp SEQ ID
NO: 39 Gene: Homo sapiens, ATPase, Na+/K+ transporting, alpha 3
polypeptide (ATP1A3), mRNA GenBank #: NM_152296 Forward Primer:
CTGTCAGAGACAGGGTGCAA (SEQ ID NO: 129) Reverse Primer:
ATTGCTGGTCAGGGTGTAGG (SEQ ID NO: 130) Product Size: 238 bp SEQ ID
NO: 40 Gene: Homo sapiens, Phospholipase C, gamma 2
(phosphatidylinositol- specific), mRNA GenBank #: BC007565 Forward
Primer: AACCAACCAGCAAAACCAAG (SEQ ID NO: 131) Reverse Primer:
TTTGTCCCTTTGGGTAGACG (SEQ ID NO: 132) Product Size: 159 bp SEQ ID
NO: 41 Gene: Homo sapiens, aldo-keto reductase family 1, member B1
(aldose reductase) GenBank #: BC010391 Forward Primer:
TGCCACCCATATCTCACTCA (SEQ ID NO: 133) Reverse Primer:
TGTCACAGACTTGGGGATCA (SEQ ID NO: 134) Product Size: 240 bp SEQ ID
NO: 42 Gene: Homo sapiens, mitochondrial DNA-encoded Cytochrome
Oxidase Subunit III, mRNA GenBank #: NC_001807 Forward Primer:
CCCGCTAAATCCCCTAGAAG (SEQ ID NO: 135) Reverse Primer:
GGAAGCCTGTGGCTACAAAA (SEQ ID NO: 136) Product Size: 245 bp SEQ ID
NO: 43 Gene: Homo sapiens, Cytochrome c Oxidase COX Subunit IV (COX
IV), mRNA GenBank #: M21575 Forward Primer: GGCACTGAAGGAGAAGGAGA
(SEQ ID NO: 137) Reverse Primer: GGGCCGTACACATAGTGCTT (SEQ ID NO:
138) Product Size: 204 bp SEQ ID NO: 44 Gene: Homo sapiens,
Cytochrome c Oxidase Subunit Va (COX5A), nuclear gene encoding
mitochondrial protein, mRNA GenBank #: NM_004255 Forward Primer:
GCATGCAGACGGTTAAATGA (SEQ ID NO: 139) Reverse Primer:
AGTTCCTCCGGAGTGGAGAT (SEQ ID NO: 140) Product Size: 152 bp SEQ ID
NO: 45 Gene: Homo sapiens, Cytochrome c Oxidase Subunit Vb (COX5B),
mRNA GenBank #: NM 001862 Forward Primer: ACTGGGTTGGAGAGGGAGAT (SEQ
ID NO: 141) Reverse Primer: AGACGACGCTGGTATTGTCC (SEQ ID NO: 142)
Product Size: 172 bp SEQ ID NO: 46 Gene: Homo sapiens,
High-mobility group box 1 (HMGB1), mRNA GenBank #: NM_002128
Forward Primer: ATATGGCAAAAGCGGACAAG (SEQ ID NO: 143) Reverse
Primer: GCAACATCACCAATGGACAG (SEQ ID NO: 144) Product Size: 193 bp
SEQ ID NO: 47 Gene: Homo sapiens, Amyloid Precursor homologue, mRNA
GenBank #: L09209 Forward Primer: TTCCAAGCCATGGTTAAAGC (SEQ ID NO:
145) Reverse Primer: GCCAACACATGCTGGTAATG (SEQ ID NO: 146) Product
Size: 248 bp SEQ ID NO: 48 Gene: Homo sapiens, Adrenergic alpha-1b
receptor protein, mRNA GenBank #: U03865 Forward Primer:
CCTGAGGATCCATTCCAAGA (SEQ ID NO: 147) Reverse Primer:
CGGTAGAGCGATGAAGAAGG (SEQ ID NO: 148) Product Size: 190 bp SEQ ID
NO: 49 Gene Homo sapiens, Complement Component 1, r subcomponent
(C1R), mRNA GenBank #: NM_001733 Forward Primer:
ATAGAGGGGAACCAGGTGCT (SEQ ID NO: 149) Reverse Primer:
TACGGGCCTTGTAGGTGTTC (SEQ ID NO: 150) Product Size: 172 bp SEQ ID
NO: 50 Gene: Homo sapiens, Endoglin, mRNA 3' end GenBank #: J05481
Forward Primer: CACTAGCCAGGTCTCGAAGG (SEQ ID NO: 151) Reverse
Primer: CTGAGGACCAGAAGCACCTC (SEQ ID NO: 152) Product Size: 165 bp
SEQ ID NO: 51 Gene: Homo sapiens, Glyceraldehyde 3 phosphate
dehydrogenase (GAPDH), mRNA GenBank #: NM_002046 Forward Primer:
GAGTCAACGGATTTGGTCGT (SEQ ID NO: 153) Reverse Primer:
TTGATTTTGGAGGGATCTCG (SEQ ID NO: 154) Product Size: 238 bp SEQ ID
NO: 52 Gene: Homo sapiens, Beta actin, mRNA GenBank #: BC014861
Forward Primer: GGACTTCGAGCAAGAGATGG (SEQ ID NO: 155) Reverse
Primer: AGCACTGTGTTGGCGTACAG (SEQ ID NO: 156) Product Size: 234
bp
II. Selection of Sequences, Dot-Blot and Use
[0099] Purified cDNA molecules corresponding to SEQ ID NOs:1-50 and
the GAPDH and beta-actin controls were immobilized on nylon
membranes by applying 10 ul of each particular cDNA at an average
concentration of 10 ng/ul to the membrane. The membranes were
UV-crosslinked using a STRATALINKER UV-crosslinker (Stratagene),
and baked at 120.degree. C. for 30 min to form the arrays further
used as described herein. Thirty dot-blot membranes (arrays) were
used to evaluate differential expression across the patient and
control samples. Each of the 30 membranes had one location
corresponding to each of the 50 different purified cDNA molecules
and the controls. Thus, each membrane had 52 different cDNA
molecules arranged on its surface.
III. Preparation of Samples
[0100] Test samples were prepared from samples obtained from the 25
subjects shown in Table 3 for hybridization to the arrays. Total
RNA was extracted from the samples using the RNA STAT-60 kit
(Tel-Test, Friendswood Tex.). Each RNA sample was reverse
transcribed using MMLV reverse-transcriptase, 0.05 pg/ul oligo-d(T)
primer (21 mer), 1.times.first strand buffer, 0.03 units/ul RNase
inhibitor, 500 uM dATP, 500 uM dGTP, 500 uM dTTP, 40 uM dCTP, and
40 uM .sup.32P-dCTP. The reverse transcription reaction was
performed in a 30 ul volume containing 200 ng RNA using the
SUPERSCRIPT III kit (Invitrogen, Carlsbad, Calif.). Reactions were
incubated at 45.degree. C. for 1 hr, treated with 1 ul of
DNase-free RNaseA and incubated for 10 minutes at 60.degree. C. to
the stop the reaction and degrade the RNA. cDNA molecules were
purified using two successive gel filtration spin columns (Qiagen)
to form the test samples further used as described herein.
[0101] Table 3 contains information about the patients from which
blood samples used in the preparation of nucleic acids for
hybridization with the arrays were obtained. Column 2 shows the
illness, column 3 shows the patient ID #, columns 4 shows the
gender and column 5 shows the age, and column 6 shows the ethnicity
of the donor. Blood sample were obtained from practicing
psychiatrists within the Columbia, Md. area by a qualified
phlebotomist and with the consent of patients. Samples were
comprised of whole blood, from which RNA was isolated.
TABLE-US-00003 TABLE 3 SAMPLE PATIENT NO. ILLNESS ID GENDER AGE
ETHNICITY 1 Normal CT20 male Caucasian 2 CT27 male Asian 3 CT28
male Caucasian 4 CT1 male 45 Asian 5 CT2 male 69 Asian 6 Bipolar I
CT3 female Caucasian 7 CT5 male Caucasian 8 1035 female 53
Caucasian 9 1048 female 42 Caucasian 10 1050 female 30 Caucasian 11
1053 female 14 Hispanic 12 1054 male 16 Hispanic 13 1057 female 46
Caucasian 14 ADHD 1061 female 34 Caucasian 15 1062 female 23
Caucasian 16 1075 male 16 Caucasian 17 1076 female 48 Caucasian 18
Unipolar CT15 male Caucasian 19 CT29 female Black 20 1002 male 28
Caucasian 21 1077 female 26 Caucasian 22 Schizophrenia CT11 male
Black 23 CT16 male Black 24 NA36 male 35 Caucasian 25 NA37 male 40
Caucasian
IV. Hybridization and Detection
[0102] For each of the 25 different test samples prepared in
section II, above, 30 ul of test sample containing 0.2 ug of the
.sup.32P-labeled cDNA was added to 5 ml of hybridization solution
(NorthernsMax, Ambion). Each of the 25 resulting solutions were
added to one of the blots produced in section II. above, and the
blots were hybridized at 37.degree. C. for 24 hr. The blots were
washed twice for 10 min at 45.degree. C. in low stringency wash
buffer (1.times.. SSC, 0.1% SDS), once for 15 min at 55.degree. C.,
once at 45.degree. C. in high stringency wash buffer
(0.1.times.SSC), and dried.
[0103] Reporter-labeled hybridization complexes were detected by
exposing the blot to x-ray film and developing the film after
different periods of exposure. The intensity of hybridization was
quantified by the signal intensity of the hybridized band using a
densitometer.
[0104] The results of the gene expression analysis of eight
different genes are shown in FIGS. 1-8. The intensity of
hybridization was determined using a densitometer for each of the
eight selected genes on each of the 25 blots. The ratio of
hybridization intensity of the test gene to that of the control
gene (beta-actin) was determined. The ratio was plotted and is
shown in the FIGS. 1-8. Table 4 shows the results obtained from
each of the eight genes analyzed.
TABLE-US-00004 TABLE 4 TYPE OF CHANGE IN ILLNESS GENE ACCESSION #
GENE EXPRESSION Bipolar I F0D BC032245 downregulated Disorder OSCP
BC021233 downregulated F0F BC003678 downregulated NRF-1 NM_005011
downregulated COX I NC_001807 downregulated IFN Gamma X13274 no
significant difference IMPase BC017176 no significant difference
SDH L29008 no significant difference ADHD F0D BC032245 no
significant difference OSCP BC021233 downregulated F0F BC003678 no
significant difference NRF-1 NM_005011 downregulated COX I
NC_001807 downregulated IFN Gamma X13274 downregulated IMPase
BC017176 upregulated SDH L29008 no significant difference Unipolar
F0D BC032245 upregulated OSCP BC021233 no significant difference
F0F BC003678 upregulated NRF-1 NM_005011 downregulated COX I
NC_001807 downregulated IFN Gamma X13274 downregulated IMPase
BC017176 upregulated SDH L29008 upregulated Schizophrenia F0D
BC032245 downregulated OSCP BC021233 downregulated F0F BC003678
downregulated NRF-1 NM_005011 no significant difference COX I
NC_001807 no significant difference IFN Gamma X13274 no significant
difference IMPase BC017176 upregulated SDH L29008 no significant
difference
V. Other Hybridization Technologies and Analyses
[0105] Other hybridization technologies utilize a variety of
substrates such as DNA array, capillary tubes, etc. Arranging cDNA
molecules on polymer coated slides is described as follows.
[0106] The cDNA molecules are applied to a membrane substrate by
one of the following methods. A mixture of cDNA molecules is
fractionated by gel electrophoresis and transferred to a nylon
membrane by capillary transfer. Alternatively, the cDNA molecules
are individually ligated to a vector and inserted into bacterial
host cells to form a library. The cDNA molecules are then arranged
on a substrate by one of the following methods. In the first
method, bacterial cells containing individual clones are
robotically picked and arranged on a nylon membrane. The membrane
is placed on LB agar containing selective agent (carbenicillin,
kanamycin, ampicillin, or chloramphenicol depending on the vector
used) and incubated at 37.degree. C. for 16 hr. The membrane is
removed from the agar and consecutively placed colony side up in
10% SDS, denaturing solution (1.5 M NaCl, 0.5 M NaOH), neutralizing
solution (1.5 M NaCl, 1 M Tris, pH 8.0), and twice in 2.times.SSC
for 10 min each. The membrane is then UV irradiated in a
STRATALINKER UV-crosslinker (Stratagene).
[0107] In the second method, cDNA molecules are amplified from
bacterial vectors by thirty cycles of PCR using primers
complementary to vector sequences flanking the insert. PCR
amplification increases a starting concentration of 1-2 ng nucleic
acid to a final quantity greater than 5 .mu.g. Amplified nucleic
acids from about 400 bp to about 5000 bp in length are purified
using SEPHACRYL-400 beads (APB). Purified nucleic acids are
arranged on a nylon membrane manually or using a dot/slot blotting
manifold and suction device and are immobilized by denaturation,
neutralization, and UV irradiation as described above.
[0108] Hybridization probes derived from cDNA molecules of the
Sequence Listing are employed for screening cDNA molecules, mRNA
molecules, or genomic DNA in membrane-based hybridizations. Probes
are prepared by diluting the cDNA molecules to a concentration of
40-50 ng in 45 pl TE buffer, denaturing by heating to 100.degree.
C. for five min, and briefly centrifuging. The denatured cDNA is
then added to a REDIPRIME tube (APB), gently mixed until blue color
is evenly distributed, and briefly centrifuged. Five microliters of
.sup.32P-dCTP is added to the tube, and the contents are incubated
at 37.degree. C. for 10 min. The labeling reaction is stopped by
adding 5 .mu.l of 0.2 M EDTA, and probe is purified from
unincorporated nucleotides using a PROBEQUANT G-50 microcolumn
(APB). The purified probe is heated to 100.degree. C. for five
min., snap cooled for two min. on ice.
[0109] Membranes are pre-hybridized in hybridization solution
containing 1% Sarkosyl and 1.times. high phosphate buffer (0.5 M
NaCl, 0.1 M Na.sub.2HPO.sub.4, 5 mM EDTA, pH 7) at 55.degree. C.
for two hr. The probe, diluted in 15 ml fresh hybridization
solution, is then added to the membrane. The membrane is hybridized
with the probe at 55.degree. C. for 16 hr. Following hybridization,
the membrane is washed for 15 min at 25.degree. C. in 1 mM Tris (pH
8.0), 1% Sarkosyl, and four times for 15 min each at 25.degree. C.
in 1 mM Tris (pH 8.0). To detect hybridization complexes, XOMAT-AR
film (Eastman Kodak, Rochester N.Y.) is exposed to the membrane
overnight at -70.degree. C., developed, and examined.
VI. Production of Specific Antibodies
[0110] A denatured protein from a reverse phase HPLC separation is
obtained in quantities up to 75 mg. This denatured protein is used
to immunize mice or rabbits following standard protocols. About 100
.mu.g is used to immunize a mouse, while up to 1 mg is used to
immunize a rabbit. The denatured protein is radioiodinated and
incubated with murine B-cell hybridomas to screen for monoclonal
antibodies. About 20 mg of protein is sufficient for labeling and
screening several thousand clones.
[0111] In another approach, the amino acid sequence translated from
a cDNA of the invention is analyzed using PROTEAN software
(DNASTAR) to determine regions of high immunogenicity,
antigenically-effective portions of the protein. The optimal
sequences for immunization are usually at the C-terminus, the
N-terminus, and those intervening, hydrophilic regions of the
protein that are likely to be exposed to the external environment
when the protein is in its natural conformation. Typically,
oligopeptides about 15 residues in length are synthesized using an
ABI 431 Peptide synthesizer (PE Biosystems) using Fmoc-chemistry
and then coupled to keyhole limpet hemocyanin (KLH; Sigma Aldrich)
by reaction with M-maleimidobenzoyl-N-hydroxysuccinimide ester. If
necessary, a cysteine may be introduced at the N-terminus of the
peptide to permit coupling to KLH. Rabbits are immunized with the
oligopeptide-KLH complex in complete Freund's adjuvant. The
resulting antisera are tested for antipeptide activity by binding
the peptide to plastic, blocking with 1% BSA, reacting with rabbit
antisera, washing, and reacting with radioiodinated goat
anti-rabbit IgG.
[0112] Hybridomas are prepared and screened using standard
techniques. Hybridomas of interest are detected by screening with
radioiodinated protein to identify those fusions producing a
monoclonal antibody specific for the protein. In a typical
protocol, wells of 96 well plates (FAST, Becton-Dickinson, Palo
Alto Calif.) are coated with affinity-purified, specific
rabbit-anti-mouse (or suitable anti-species Ig) antibodies at 10
mg/ml. The coated wells are blocked with 1% BSA and washed and
exposed to supernatants from hybridomas. After incubation, the
wells are exposed to radiolabeled protein at 1 mg/ml. Clones
producing antibodies bind a quantity of labeled protein that is
detectable above background.
[0113] Such clones are expanded and subjected to 2 cycles of
cloning at 1 cell/3 wells. Cloned hybridomas are injected into
pristane-treated mice to produce ascites, and monoclonal antibody
is purified from the ascitic fluid by affinity chromatography on
protein A (APB). Monoclonal antibodies with affinities of at least
10.sup.8 M.sup.-1, preferably 10.sup.9 to 10.sup.10 M.sup.-1 or
stronger, are made by procedures well known in the art.
VII. Screening Molecules for Specific Binding with the CDNA or
Protein
[0114] The cDNA or fragments thereof and the protein or portions
thereof are labeled with .sup.32P-dCTP, Cy3-dCTP, Cy5-dCTP (APB),
or BIODIPY or FITC (Molecular Probes), respectively. Candidate
molecules or compounds previously arranged on a substrate are
incubated in the presence of labeled nucleic or amino acid. After
incubation under conditions for either a cDNA or a protein, the
substrate is washed, and any position on the substrate retaining
label, which indicates specific binding or complex formation, is
assayed. The binding molecule is identified by its arrayed position
on the substrate. Data obtained using different concentrations of
the nucleic acid or protein are used to calculate affinity between
the labeled nucleic acid or protein and the bound molecule. High
throughput screening using very small assay volumes and very small
amounts of test compound is fully described in Burbaum et al. U.S.
Pat. No. 5,876,946.
[0115] All patents and publications mentioned in the specification
are herein incorporated by reference. Various modifications and
variations of the described method and system of the invention will
be apparent to those skilled in the art without departing from the
scope and spirit of the invention. Although the invention has been
described in connection with specific preferred embodiments, it
should be understood that the invention as claimed should not be
unduly limited to such specific embodiments. Indeed, various
modifications of the described modes for carrying out the invention
that are obvious to those skilled in the field of molecular biology
or related fields are intended to be within the scope of the
following claims.
Sequence CWU 1
1
1561151DNAHomo sapiens 1tcctggaatg agaccctcac ctccaggttg gctgctttac
ctgagaatcc accagctatc 60gactgggctt actacaaggc caatgtggcc aaggctggct
tggtggatga ctttgagaag 120aaggtgaaat cttgtgctga gtgggtgtct c
1512205DNAHomo sapiens 2gcttgctgaa aatggtcgat taagcaatac ccaaggagtc
gtttctgcct tttctaccat 60gatgagtgtc catcgcggag aggtaccttg cacagtgacc
tctgcatctc ctttagaaga 120agccacactc tctgaattaa aaactgtcct
caagagcttc ctaagtcaag gccaagtatt 180gaaattggag gctaagactg atccg
2053169DNAHomo sapiens 3gcgggacttc agtcctagtg gcattttcgg agcgtttcaa
agaggttact accggtacta 60caacaagtac atcaatgtga agaaggggag catctcgggg
attaccatgg tgctggcatg 120ctacgtgctc tttagctact ccttttccta
caagcatctc aagcacgag 1694244DNAHomo sapiens 4gatcgtcttg tctggggaaa
ccgcagcagc cgtcggagca cttactggag tccaagatgc 60taatggcctc tttatggcag
atcgtgcagg tcgcaagtgg atcctgactg acaaagccac 120aggcctggtc
cagatccctg tgagcatgta ccagactgtg gtgaccagcc tcgcccaggg
180caacggacca gtgcaggtgg ccatggcccc tgtgaccacc aggatatcag
acagcgcagt 240cacc 2445185DNAHomo sapiens 5ggcctgactg gcattgtatt
agcaaactca tcactagaca tcgtactaca cgacacgtac 60tacgttgtag ctcacttcca
ctatgtccta tcaataggag ctgtatttgc catcatagga 120ggcttcattc
actgatttcc cctattctca ggctacaccc tagaccaaac ctacgccaaa 180atcca
1856246DNAHomo sapiens 6ttcagctctg catcgttttg ggttctcttg gctgttactg
ccaggaccca tatgtaaaag 60aagcagaaaa ccttaagaaa tattttaatg caggtcattc
agatgtagcg gataatggaa 120ctcttttctt aggcattttg aagaattgga
aagaggagag tgacagaaaa ataatgcaga 180gccaaattgt ctccttttac
ttcaaacttt ttaaaaactt taaagatgac cagagcatcc 240aaaaga
2467189DNAHomo sapiens 7tcaaaggcct tggttctgac agaaattggc cccaaacgtg
accctgcgac cctgaagctg 60ttcctgagta acatggagcg gctgctgcat gccaaggcgc
atggggtccg agtgattgga 120agctccacat tggcactctg ccacctggcc
tcaggggccg cggatgccta ttaccagttt 180ggcctgcac 1898188DNAHomo
sapiens 8ctccccgaga aaatgatgaa ttctgcaaga tgggccgata caatctgtca
ccttccatct 60tcttctgtgc cacgcccccc gatgacggga acctctgccg gttctataag
cacaatgcag 120ccttttgtta caagcttcct gacaatgtca cctttgagga
aggcgccctg atcgagccac 180tttctgtg 1889187DNAHomo sapiens
9ttcatgatca cgccctcata atcattttcc ttatctgctt cctagtcctg tatgcccttt
60tcctaacact cacaacaaaa ctaactaata ctaacatctc agacgctcag gaaatagaaa
120ccgtctgaac tatcctgccc gccatcatcc tagtcctcat cgccctccca
tccctacgca 180tccttta 18710203DNAHomo sapiens 10ccgaggtggt
tttcatctgt cttggcaagt tgtccaaaga aacctgtaag ttcttacctt 60cgattttcta
aagaacaact acccatattt aaagctcaga acccagatgc aaaaactaca
120gaactaatta gaagaattgc ccagcgttgg agggaacttc ctgattcaaa
gaaaaaaata 180tatcaagatg cttatagggc gga 20311166DNAHomo sapiens
11acatcgagat cgccacctac aggaagctgc tagagggcga ggagaaccgg atcaccattc
60ccgtgcagac cttctccaac ctgcagattc gagaaaccag cctggacacc aagtctgtgt
120cagaaggcca cctcaagagg aacatcgtgg tgaagaccgt ggagat
16612236DNAHomo sapiens 12cattccagcc ttggactcat tgactccagc
taatgaagat caaaaaattg gtatagaaat 60tattaaaaga acactcaaaa ttccagcaat
gaccattgct aagaatgcag gtgttgaagg 120atctttgata gttgagaaaa
ttatgcaaag ttcctcagaa gttggttatg atgctatggc 180tggagatttt
gtgaatatgg tggaaaaagg aatcattgac ccaacaaagg ttgtga 23613219DNAHomo
sapiens 13ccaacccagt ggacattctt acgtatgtta cctggaaact aagtggatta
cccaaacacc 60gcgtgattgg aagtggatgt aatctggatt ctgctagatt tcgctacctt
atggctgaaa 120aacttggcat tcatcccagc agctgccatg gatggatttt
gggggaacat ggcgactcaa 180gtgtggctgt gtggagtggt gtgaatgtgg caggtgttt
21914240DNAHomo sapiens 14cctgggagat ttcatggaga aaaggaagat
caaggacaag aagttacctg tgggattcac 60gttttctttt ccttgccaac aatccaaaat
agatgaggcc atcctgatca cctggacaaa 120gcgatttaaa gcgagcggag
tggaaggagc agatgtggtc aaactgctta acaaagccat 180caaaaagcga
ggggactatg atgccaacat cgtagctgtg gtgaatgaca cagtgggcac
24015217DNAHomo sapiens 15attacgggac ccaaatgtca aactaccaaa
tgggcgagac acacctgcac tcttcaactt 60caccactcaa gaactgtcaa gtaatccacc
tctggctacc atccttattc ctcctcatgc 120tcggattcaa gcagctgctt
caacccccac aaatgccaca gcagcgtcag atgctaatac 180tggagaccgt
ggacagacca ataatgctgc ttctgca 21716206DNAHomo sapiens 16gaccactgtg
gcgctcttat acccgccgga cagacggtct agtgtttgtg gtggacgctg 60cggaggctga
gcggctggag gaagccaagg tggagttgca ccgaatcagc cgggcctcgg
120acaaccaggg cgtgccagtg ctggtgctgg ccaacaagca ggaccagccc
ggggcactga 180gcgctgctga ggtggagaag aggctg 20617232DNAHomo sapiens
17cgtcggagtt tcgaaagaag tggaataagt gggctctgag tcgtgggaag agggaactgc
60ggatgtccag cagctacccc accgggctcg ctgacgtgaa ggccgggcct gcccagaccc
120ttattcggcc ccaggacatg aagggtgcct ctcgaagccc cgaagacagc
agtccggatg 180ccgcccgcat ccgagtcaag cgctaccgcc agagcatgaa
caacttccag gg 23218151DNAHomo sapiens 18gtggcaaagg agcagagaac
tttgacaagt tcttcacacg aggacagccc gtcttaacac 60cacctgatca gctggttatt
gctaacatag accagtctga ttttgaaggg ttctcgtatg 120tcaaccccca
gtttgtgcac cccatcttac a 15119228DNAHomo sapiens 19tgaaggggag
gatgaagatg aactcttcca atccatcatg gaacacaacg tagcctatcc 60caagtctatg
tccaaggaag ctgtggccat ctgcaaaggg ctgatgacca aacacccagg
120caaacgtctg ggttgtggac ctgaaggcga acgtgatatc aaagagcatg
catttttccg 180gtatattgat tgggagaaac ttgaacgcaa agagatccag ccccctta
22820189DNAHomo sapiens 20caactacatg agccccacct tctgtgacca
ctgcggcagc ctgctctggg gactggtgaa 60gcagggatta aagtgtgaag actgcggcat
gaatgtgcac cataaatgcc gggagaaggt 120ggccaacctc tgcggcatca
accagaagct tttggctgag gccttgaacc aagtcaccca 180gagagcctc
18921195DNAHomo sapiens 21aacggggagt ttgcttacct gtacagccag
tgctacgagc tcaccaccaa cgaatacgtc 60taccgcctct gccccttcaa gcttgtctcg
cagaaaccca aactcggggg ctctcccacc 120agccttggca cctggggctc
atggattggc cccgaccacg acaagttcag tgccatgaag 180tatgagcaag gcacg
19522204DNAHomo sapiens 22tgaggaccag cagtgtcttg tgttccgtga
tgtggcccct caggctcctg tgcacttcct 60ggtcattcct aagaagccca ttcctcggat
tagccaggct gaagaagaag accagcagct 120tctaggacac ctactccttg
tggccaagca gacagcaaag gctgagggcc tgggagatgg 180ataccgactt
gtgatcaacg atgg 20423242DNAHomo sapiens 23gctgactttg gtgtgagcaa
tgaattcaag ggcagtgacg cgctcctctc caactacgtg 60ggcacgcccg ccttcatggc
tcccgagtcg ctctctgaga cccgcaagat cttctctggg 120aaggccaagg
atgtttgggc catgggtgtg acactatact gctttgtctt tggccagtgc
180ccattcatgg acgagcggat catgtgttta cacagtaaga tcaagagtca
ggccctggaa 240tt 24224203DNAHomo sapiens 24attgccgagg tactggaatg
caaataagaa ttcatcagat aggacctgga atggttcagc 60aaattcagtc tgtgtgcatg
gagtgccagg gccatgggga gcggatcagt cctaaagata 120gatgtaaaag
ctgcaacgga aggaagatag ttcgagagaa gaaaatttta gaagttcata
180ttgacaaagg catgaaagat ggc 20325204DNAHomo sapiens 25gttaaaaccc
tgccaaacga aaccttcaca gactacccaa aacaaatctt cagagtgaaa 60accacacagt
tctcctggac agaaatgctc attatgaagt gggtcttagg aatgatttgg
120tccgaatgca aggaaatctg ggaggagggg ccacgggagt acgtgctgca
cttgtggaac 180ctgctagatt tcgggatgct gtcc 20426238DNAHomo sapiens
26aaagaaacag aagcttgcca aggagagagc tgggctttcc aagttacctg accttaaaga
60tgctgaagct gttcagaagt tcttccttga agaaatacag cttggtgaag agttactagc
120tcaaggtgaa tatgagaagg gcgtagacca tctgacaaat gcaattgctg
tgtgtggaca 180gccacagcag ttactgcagg tcttacagca aactcttcca
ccaccagtgt tccagatg 23827170DNAHomo sapiens 27tgccttcagc agagtgaaga
ctttctttca aatgaaggat cagctggaca acttgttgtt 60aaaggagtcc ttgctggagg
actttaaggg ttacctgggt tgccaagcct tgtctgagat 120gatccagttt
tacctggagg aggtgatgcc ccaagctgag aaccaagacc 17028197DNAHomo sapiens
28atcagtgcgt ccagggatac agggctctac acagaggtcc tgctgagagc gtctgcaaaa
60tgacccacgg gaagacaagg tggacccagc cccagctcat atgcacaggt gaaatggaga
120ccagtcagtt tccaggtgaa gagaagcctc aggcaagccc cgaaggccgt
cctgagagtg 180agacttcctg cctcgtc 19729196DNAHomo sapiens
29gctgcgtcca ggaagattag atagaaaaat acatattgat ttgccaaatg aacaagcaag
60attagacata ctgaaaatcc atgcaggtcc cattacaaag catggtgaaa tagattatga
120agcaattgtg aagctttcgg atggctttaa tggagcagat ctgagaaatg
tttgtactga 180agcaggtatg ttcgca 19630177DNAHomo sapiens
30atccctcatc acagcctcac agtttttcga gatctggctc catttcgacg ctgacggaag
60tggttacctg gaaggaaagg agctgcagaa cttgatccag gagctccagc aggcgcgaaa
120gaaggctgga ttggagttat cacctgaaat gaaaactttt gtggatcagt atgggca
17731241DNAHomo sapiens 31tagcgtatgg tgctgctgtc caggctggtg
tgctctctgg tgatcaagat acaggtgacc 60tggtactgct tgatgtatgt ccccttacac
ttggtattga aactgtggga ggtgtcatga 120ccaaactgat tccaaggaac
acagtggtgc ctaccaagaa gtctcagatc ttttctacag 180cttctgataa
tcaaccaact gttacaatca aggtctatga aggtgaaaga cccctgacaa 240a
24132230DNAHomo sapiens 32cttcactgtc gtgtcgctgt ttgtggtgga
gcgagcaggc cggcggaccc tgcacctcat 60aggcctcgct ggcatggcgg gttgtgccat
actcatgacc atcgcgctag cactgctgga 120gcagctaccc tggatgtcct
atctgagcat cgtggccatc tttggctttg tggccttctt 180tgaagtgggt
cctggcccca tcccatggtt catcgtggct gaactcttca 23033159DNAHomo sapiens
33accggcttcc tcattacctt cttggctttt accttcttca aagtccctga gacccgtggc
60aggacttttg aggatatcac acgggccttt gaagggcagg cacacggtgc agatagatct
120ggaaaggacg gcgtcatgga gatgaacagc atcgagcct 15934199DNAHomo
sapiens 34ccctataccc catgatgtgc cccatggaac accccctttc tgctgacatc
gccatggcca 60cccgtgcaga tgaggacgga gacacgcctc tccatattgc tgtggtgcag
ggtaacctgc 120cagctgtgca ccggctggtc aacctcttcc agcagggggg
ccgggagctc gacatctaca 180acaacctacg gcagacacc 19935168DNAHomo
sapiens 35ggagcttcga gaacaactgg aacatttaca agctcctcac ccaccagaag
ccccccaagg 60agaagtctaa cttctccctg gccatcctga atgtgggggc cccggcggct
ggcatgaatg 120cggccgtgcg ctcggcggtg cggaccggca tctcccatgg acacacag
16836206DNAHomo sapiens 36caagctaact cgccctcaac tcccaactcg
gctggttctt ccagttcttt taacatgtca 60aactctggag atttgttcat gagcgtgcag
tcactcaatg gggattctta ccaaggggcc 120caggttggag ccaacgtgca
atcacaggtg gatacccttc gccatgttat cagccagaca 180ggaggataca
gtgatggact cgcagc 20637247DNAHomo sapiens 37gcacaagctt caggtcttcc
aggcgctgcg gggcctgcag aggggcagtg ccgtcgtggg 60ccagtaccag tcttacagtg
agcaggtgcg cagagagctg cagaagccag acagcttcca 120cagcctgacg
ccgaccttcg cagccgtcct agtgcacatt gacaaccttc gctgggaggg
180cgtgcctttc atcctgatgt ctggcaaagc cttggacgag agagtgggct
acgctcggat 240cttgttc 24738179DNAHomo sapiens 38cgcaaatacc
aagtggacct gtccaagggc ctcaccaacc agcgggctca ggacgttctg 60gctcgagatg
ggcccaacgc cctcacacca cctcccacaa cccctgagtg ggtcaagttc
120tgccgtcagc ttttcggggg gttctccatc ctgctgtgga ttggggctat cctctgctt
17939238DNAHomo sapiens 39ctgtcagaga cagggtgcaa ttgtggctgt
gaccggggat ggtgtgaacg actcccccgc 60tctgaagaag gccgacattg gggtggccat
gggcatcgct ggctctgacg tctccaagca 120ggcagctgac atgatcctgc
tggacgacaa ctttgcctcc atcgtcacag gggtggagga 180gggccgcctg
atcttcgaca acctaaagaa gtccattgcc tacaccctga ccagcaat
23840159DNAHomo sapiens 40aaccaaccag caaaaccaag gacaacttag
aaaatcctga cttccgagaa atccgctcct 60ttgtggagac gaaggctgac agcatcatca
gacagaagcc cgtcgacctc ctgaagtaca 120atcaaaaggg cctgacccgc
gtctacccaa agggacaaa 15941240DNAHomo sapiens 41tgccacccat
atctcactca ggagaagtta atccagtact gccagtccaa aggcatcgtg 60gtgaccgcct
acagccccct cggctctcct gacaggccct gggccaagcc cgaggaccct
120tctctcctgg aggatcccag gatcaaggcg atcgcagcca agcacaataa
aactacagcc 180caggtcctga tccggttccc catgcagagg aacttggtgg
tgatccccaa gtctgtgaca 24042245DNAHomo sapiens 42cccgctaaat
cccctagaag tcccactcct aaacacatcc gtattactcg catcaggagt 60atcaatcacc
tgagctcacc atagtctaat agaaaacaac cgaaaccaaa taattcaagc
120actgcttatt acaattttac tgggtctcta ttttaccctc ctacaagcct
cagagtactt 180cgagtctccc ttcaccattt ccgacggcat ctacggctca
acattttttg tagccacagg 240cttcc 24543204DNAHomo sapiens 43ggcactgaag
gagaaggaga aggcctcctg gagcagcctc tccatggatg agaaagtcga 60gttgtatcgc
attaagttca aggagagctt tgctgagatg aacaggggct cgaacgagtg
120gaagacggtt gtgggcggtg ccatgttctt catcggtttc accgcgctcg
ttatcatgtg 180gcagaagcac tatgtgtacg gccc 20444152DNAHomo sapiens
44gcatgcagac ggttaaatga ttttgctagt ctagttcgaa tcctagaggt tgttaaggac
60aaagcaggac ctcataagga aatctacccc tatgtcatcc aggaacttag accaacttta
120aatgaactgg gaatctccac tccggaggaa ct 15245172DNAHomo sapiens
45actgggttgg agagggagat catgctggct gcaaagaagg gactggaccc atacaatgta
60ctggccccaa agggagcttc aggcaccagg gaagacccta atttagtccc ctccatctcc
120aacaagagaa tagtaggctg catctgtgaa gaggacaata ccagcgtcgt ct
17246193DNAHomo sapiens 46atatggcaaa agcggacaag gcccgttatg
aaagagaaat gaaaacctat atccctccca 60aaggggagac aaaaaagaag ttcaaggatc
ccaatgcacc caagaggcct ccttcggcct 120tcttcctctt ctgctctgag
tatcgcccaa aaatcaaagg agaacatcct ggcctgtcca 180ttggtgatgt tgc
19347248DNAHomo sapiens 47ttccaagcca tggttaaagc tttagagaag
gaagcagcca gtgagaagca gcagctggtg 60gagacccacc tggcccgagt ggaagctatg
ctgaatgacc gccgtcggat ggctctggag 120aactacctgg ctgccttgca
gtctgacccg ccacggcctc atcgcattct ccaggcctta 180cggcgttatg
tccgtgctga gaacaaagat cgcttacata ccatccgtca ttaccagcat 240gtgttggc
24848190DNAHomo sapiens 48cctgaggatc cattccaaga actttcacga
ggacaccctt agcagtacca aggccaaggg 60ccacaacccc aggagttcca tagctgtcaa
actttttaag ttctccaggg aaaagaaagc 120agctaagacg ttgggcattg
tggtcggtat gttcatcttg tgctggctac ccttcttcat 180cgctctaccg
19049172DNAHomo sapiens 49atagagggga accaggtgct gcattccttc
acagctgtct gccaggatga tggcacgtgg 60catcgtgcca tgcccagatg caagatcaag
gactgtgggc agccccgaaa cctgcctaat 120ggtgacttcc gttacaccac
cacaatggga gtgaacacct acaaggcccg ta 17250165DNAHomo sapiens
50cactagccag gtctcgaagg gctgcgtggc tcaggccccc aatgccatcc ttgaagtcca
60tgtcctcttc ctggagttcc caacgggccc gtcacagctg gagctgactc tccaggcatc
120caagcaaaat ggcacctggc cccgagaggt gcttctggtc ctcag
16551238DNAHomo sapiens 51gagtcaacgg atttggtcgt attgggcgcc
tggtcaccag ggctgctttt aactctggta 60aagtggatat tgttgccatc aatgacccct
tcattgacct caactacatg gtttacatgt 120tccaatatga ttccacccat
ggcaaattcc atggcaccgt caaggctgag aacgggaagc 180ttgtcatcaa
tggaaatccc atcaccatct tccaggagcg agatccctcc aaaatcaa
23852234DNAHomo sapiens 52ggacttcgag caagagatgg ccacggctgc
ttccagctcc tccctggaga agagctacga 60gctgcctgac ggccaggtca tcaccattgg
caatgagcgg ttccgctgcc ctgaggcact 120cttccagcct tccttcctgg
gcatggagtc ctgtggcatc cacgaaacta ccttcaactc 180catcatgaag
tgtgacgtgg acatccgcaa agacctgtac gccaacacag tgct
2345320DNAArtificial Sequencechemically-synthesized PCR primer
53tcctggaatg agaccctcac 205420DNAArtificial
Sequencechemically-synthesized PCR primer 54gagacaccca ctcagcacaa
205520DNAArtificial Sequencechemically-synthesized PCR primer
55gcttgctgaa aatggtcgat 205620DNAArtificial
Sequencechemically-synthesized PCR primer 56cggatcagtc ttagcctcca
205720DNAArtificial Sequencechemically-synthesized PCR primer
57gcgggacttc agtcctagtg 205820DNAArtificial
Sequencechemically-synthesized PCR primer 58ctcgtgcttg agatgcttgt
205920DNAArtificial Sequencechemically-synthesized PCR primer
59gatcgtcttg tctggggaaa 206020DNAArtificial
Sequencechemically-synthesized PCR primer 60ggtgactgcg ctgtctgata
206120DNAArtificial Sequencechemically-synthesized PCR primer
61ggcctgactg gcattgtatt 206220DNAArtificial
Sequencechemically-synthesized PCR primer 62tggcgtaggt ttggtctagg
206320DNAArtificial Sequencechemically-synthesized PCR primer
63ttcagctctg catcgttttg 206420DNAArtificial
Sequencechemically-synthesized PCR primer 64tcttttggat gctctggtca
206520DNAArtificial Sequencechemically-synthesized PCR primer
65tcaaaggcct tggttctgac 206620DNAArtificial
Sequencechemically-synthesized PCR primer 66gtgcaggcca aactggtaat
206720DNAArtificial Sequencechemically-synthesized PCR primer
67ctccccgaga aaatgatgaa 206820DNAArtificial
Sequencechemically-synthesized PCR primer 68cacagaaagt ggctcgatca
206920DNAArtificial
Sequencechemically-synthesized PCR primer 69ttcatgatca cgccctcata
207020DNAArtificial Sequencechemically-synthesized PCR primer
70taaaggatgc gtagggatgg 207120DNAArtificial
Sequencechemically-synthesized PCR primer 71ccgaggtggt tttcatctgt
207220DNAArtificial Sequencechemically-synthesized PCR primer
72tccgccctat aagcatcttg 207320DNAArtificial
Sequencechemically-synthesized PCR primer 73acatcgagat cgccacctac
207420DNAArtificial Sequencechemically-synthesized PCR primer
74atctccacgg tcttcaccac 207520DNAArtificial
Sequencechemically-synthesized PCR primer 75cattccagcc ttggactcat
207620DNAArtificial Sequencechemically-synthesized PCR primer
76tcacaacctt tgttgggtca 207720DNAArtificial
Sequencechemically-synthesized PCR primer 77ccaacccagt ggacattctt
207820DNAArtificial Sequencechemically-synthesized PCR primer
78aaacacctgc cacattcaca 207920DNAArtificial
Sequencechemically-synthesized PCR primer 79cctgggagat ttcatggaga
208020DNAArtificial Sequencechemically-synthesized PCR primer
80gtgcccactg tgtcattcac 208120DNAArtificial
Sequencechemically-synthesized PCR primer 81attacgggac ccaaatgtca
208220DNAArtificial Sequencechemically-synthesized PCR primer
82tgcagaagca gcattattgg 208320DNAArtificial
Sequencechemically-synthesized PCR primer 83gaccactgtg gcgctcttat
208420DNAArtificial Sequencechemically-synthesized PCR primer
84cagcctcttc tccacctcag 208520DNAArtificial
Sequencechemically-synthesized PCR primer 85cgtcggagtt tcgaaagaag
208620DNAArtificial Sequencechemically-synthesized PCR primer
86ccctggaagt tgttcatgct 208720DNAArtificial
Sequencechemically-synthesized PCR primer 87gtggcaaagg agcagagaac
208820DNAArtificial Sequencechemically-synthesized PCR primer
88tgtaagatgg ggtgcacaaa 208920DNAArtificial
Sequencechemically-synthesized PCR primer 89tgaaggggag gatgaagatg
209020DNAArtificial Sequencechemically-synthesized PCR primer
90taagggggct ggatctcttt 209120DNAArtificial
Sequencechemically-synthesized PCR primer 91caactacatg agccccacct
209220DNAArtificial Sequencechemically-synthesized PCR primer
92gaggctctct gggtgacttg 209320DNAArtificial
Sequencechemically-synthesized PCR primer 93aacggggagt ttgcttacct
209420DNAArtificial Sequencechemically-synthesized PCR primer
94cgtgccttgc tcatacttca 209520DNAArtificial
Sequencechemically-synthesized PCR primer 95tgaggaccag cagtgtcttg
209620DNAArtificial Sequencechemically-synthesized PCR primer
96ccatcgttga tcacaagtcg 209720DNAArtificial
Sequencechemically-synthesized PCR primer 97gctgactttg gtgtgagcaa
209820DNAArtificial Sequencechemically-synthesized PCR primer
98aattccaggg cctgactctt 209920DNAArtificial
Sequencechemically-synthesized PCR primer 99attgccgagg tactggaatg
2010020DNAArtificial Sequencechemically-synthesized PCR primer
100gccatctttc atgcctttgt 2010120DNAArtificial
Sequencechemically-synthesized PCR primer 101gttaaaaccc tgccaaacga
2010220DNAArtificial Sequencechemically-synthesized PCR primer
102ggacagcatc ccgaaatcta 2010320DNAArtificial
Sequencechemically-synthesized PCR primer 103aaacagaagc ttgccaagga
2010420DNAArtificial Sequencechemically-synthesized PCR primer
104catctggaac actggtggtg 2010520DNAArtificial
Sequencechemically-synthesized PCR primer 105tgccttcagc agagtgaaga
2010620DNAArtificial Sequencechemically-synthesized PCR primer
106ggtcttggtt ctcagcttgg 2010720DNAArtificial
Sequencechemically-synthesized PCR primer 107atcagtgcgt ccagggatac
2010820DNAArtificial Sequencechemically-synthesized PCR primer
108gacgaggcag gaagtctcac 2010920DNAArtificial
Sequencechemically-synthesized PCR primer 109gctgcgtcca ggaagattag
2011020DNAArtificial Sequencechemically-synthesized PCR primer
110tgcgaacata cctgcttcag 2011120DNAArtificial
Sequencechemically-synthesized PCR primer 111atccctcatc acagcctcac
2011220DNAArtificial Sequencechemically-synthesized PCR primer
112tgcccatact gatccacaaa 2011320DNAArtificial
Sequencechemically-synthesized PCR primer 113tagcgtatgg tgctgctgtc
2011420DNAArtificial Sequencechemically-synthesized PCR primer
114tttgtcaggg gtctttcacc 2011520DNAArtificial
Sequencechemically-synthesized PCR primer 115cttcactgtc gtgtcgctgt
2011620DNAArtificial Sequencechemically-synthesized PCR primer
116tgaagagttc agccacgatg 2011720DNAArtificial
Sequencechemically-synthesized PCR primer 117accggcttcc tcattacctt
2011820DNAArtificial Sequencechemically-synthesized PCR primer
118aggctcgatg ctgttcatct 2011920DNAArtificial
Sequencechemically-synthesized PCR primer 119ccctataccc catgatgtgc
2012020DNAArtificial Sequencechemically-synthesized PCR primer
120ggtgtctgcc gtaggttgtt 2012120DNAArtificial
Sequencechemically-synthesized PCR primer 121ggagcttcga gaacaactgg
2012220DNAArtificial Sequencechemically-synthesized PCR primer
122ctgtgtgtcc atgggagatg 2012320DNAArtificial
Sequencechemically-synthesized PCR primer 123caagctaact cgccctcaac
2012420DNAArtificial Sequencechemically-synthesized PCR primer
124gctgcgagtc catcactgta 2012520DNAArtificial
Sequencechemically-synthesized PCR primer 125gcacaagctt caggtcttcc
2012620DNAArtificial Sequencechemically-synthesized PCR primer
126gaacaagatc cgagcgtagc 2012720DNAArtificial
Sequencechemically-synthesized PCR primer 127cgcaaatacc aagtggacct
2012820DNAArtificial Sequencechemically-synthesized PCR primer
128aagcagagga tagccccaat 2012920DNAArtificial
Sequencechemically-synthesized PCR primer 129ctgtcagaga cagggtgcaa
2013020DNAArtificial Sequencechemically-synthesized PCR primer
130attgctggtc agggtgtagg 2013120DNAArtificial
Sequencechemically-synthesized PCR primer 131aaccaaccag caaaaccaag
2013220DNAArtificial Sequencechemically-synthesized PCR primer
132tttgtccctt tgggtagacg 2013320DNAArtificial
Sequencechemically-synthesized PCR primer 133tgccacccat atctcactca
2013420DNAArtificial Sequencechemically-synthesized PCR primer
134tgtcacagac ttggggatca 2013520DNAArtificial
Sequencechemically-synthesized PCR primer 135cccgctaaat cccctagaag
2013620DNAArtificial Sequencechemically-synthesized PCR primer
136ggaagcctgt ggctacaaaa 2013720DNAArtificial
Sequencechemically-synthesized PCR primer 137ggcactgaag gagaaggaga
2013820DNAArtificial Sequencechemically-synthesized PCR primer
138gggccgtaca catagtgctt 2013920DNAArtificial
Sequencechemically-synthesized PCR primer 139gcatgcagac ggttaaatga
2014019DNAArtificial Sequencechemically-synthesized PCR primer
140agttcctccg gagtggaga 1914120DNAArtificial
Sequencechemically-synthesized PCR primer 141actgggttgg agagggagat
2014220DNAArtificial Sequencechemically-synthesized PCR primer
142agacgacgct ggtattgtcc 2014320DNAArtificial
Sequencechemically-synthesized PCR primer 143atatggcaaa agcggacaag
2014420DNAArtificial Sequencechemically-synthesized PCR primer
144gcaacatcac caatggacag 2014520DNAArtificial
Sequencechemically-synthesized PCR primer 145ttccaagcca tggttaaagc
2014620DNAArtificial Sequencechemically-synthesized PCR primer
146gccaacacat gctggtaatg 2014720DNAArtificial
Sequencechemically-synthesized PCR primer 147cctgaggatc cattccaaga
2014820DNAArtificial Sequencechemically-synthesized PCR primer
148cggtagagcg atgaagaagg 2014920DNAArtificial
Sequencechemically-synthesized PCR primer 149atagagggga accaggtgct
2015020DNAArtificial Sequencechemically-synthesized PCR primer
150tacgggcctt gtaggtgttc 2015120DNAArtificial
Sequencechemically-synthesized PCR primer 151cactagccag gtctcgaagg
2015220DNAArtificial Sequencechemically-synthesized PCR primer
152ctgaggacca gaagcacctc 2015320DNAArtificial
Sequencechemically-synthesized PCR primer 153gagtcaacgg atttggtcgt
2015420DNAArtificial Sequencechemically-synthesized PCR primer
154ttgattttgg agggatctcg 2015520DNAArtificial
Sequencechemically-synthesized PCR primer 155ggacttcgag caagagatgg
2015620DNAArtificial Sequencechemically-synthesized PCR primer
156agcactgtgt tggcgtacag 20
* * * * *