U.S. patent application number 16/203111 was filed with the patent office on 2019-10-03 for methods and compositions for producing germ cells from peripheral blood derived germline stem cells.
The applicant listed for this patent is The General Hospital Corporation. Invention is credited to Joshua Johnson, Jonathan L. Tilly.
Application Number | 20190300852 16/203111 |
Document ID | / |
Family ID | 35428927 |
Filed Date | 2019-10-03 |
![](/patent/app/20190300852/US20190300852A1-20191003-D00001.png)
![](/patent/app/20190300852/US20190300852A1-20191003-D00002.png)
![](/patent/app/20190300852/US20190300852A1-20191003-D00003.png)
![](/patent/app/20190300852/US20190300852A1-20191003-D00004.png)
![](/patent/app/20190300852/US20190300852A1-20191003-D00005.png)
![](/patent/app/20190300852/US20190300852A1-20191003-D00006.png)
![](/patent/app/20190300852/US20190300852A1-20191003-D00007.png)
![](/patent/app/20190300852/US20190300852A1-20191003-D00008.png)
United States Patent
Application |
20190300852 |
Kind Code |
A1 |
Tilly; Jonathan L. ; et
al. |
October 3, 2019 |
Methods and Compositions for Producing Germ Cells from Peripheral
Blood Derived Germline Stem Cells
Abstract
The application describes the use of peripheral blood derived
germline stem cells and their progenitors, methods of isolation
thereof, and methods of use thereof.
Inventors: |
Tilly; Jonathan L.;
(Windham, NH) ; Johnson; Joshua; (New Haven,
CT) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The General Hospital Corporation |
Boston |
MA |
US |
|
|
Family ID: |
35428927 |
Appl. No.: |
16/203111 |
Filed: |
November 28, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14990539 |
Jan 7, 2016 |
|
|
|
16203111 |
|
|
|
|
13006752 |
Jan 14, 2011 |
9267111 |
|
|
14990539 |
|
|
|
|
11131152 |
May 17, 2005 |
|
|
|
13006752 |
|
|
|
|
60572222 |
May 17, 2004 |
|
|
|
60574187 |
May 24, 2004 |
|
|
|
60586641 |
Jul 9, 2004 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 15/08 20180101;
A61K 2035/124 20130101; A61K 35/28 20130101; A61P 15/18 20180101;
C12N 5/0611 20130101; C12N 2506/11 20130101; A61P 15/12 20180101;
A61B 17/43 20130101; C12N 5/0609 20130101; A61K 35/14 20130101;
A61P 15/16 20180101; C12N 5/0634 20130101; C12P 21/06 20130101;
A61P 35/00 20180101 |
International
Class: |
C12N 5/0735 20060101
C12N005/0735; C12N 5/075 20060101 C12N005/075; A61K 35/28 20060101
A61K035/28; C12N 5/078 20060101 C12N005/078; C12P 21/06 20060101
C12P021/06; A61K 35/14 20060101 A61K035/14; A61B 17/43 20060101
A61B017/43 |
Goverment Interests
STATEMENT OF GOVERNMENT INTEREST
[0003] This invention was made with Government support under Grant
Nos. R01-AG024999, R01-AG012279 and R01-ES008430 awarded by the
National Institute of Environmental Health of the National
Institutes of Health. The Government has certain rights in this
invention.
Claims
1. An isolated peripheral blood cell that is mitotically competent,
has an XX kayrotype and expresses Vasa, Dazl and Stella.
2-9. (canceled)
10. A method of in vitro fertilization of a female subject, said
method comprising the steps of: a) producing an oocyte by culturing
the isolated cell of claim 1 in the presence of an agent that
differentiates the cell into an oocyte; b) fertilizing the oocyte
in vitro to form a zygote; and c) implanting the zygote into the
uterus of a female subject.
11. A method of oocyte production, comprising culturing the
isolated cell of claim 1 in the presence of an agent that
differentiates the cell into an oocyte, thereby producing an
oocyte.
12. (canceled)
13. A pharmaceutical composition comprising a purified population
of the isolated cells of claim 1 and a pharmaceutically acceptable
carrier.
14-17. (canceled)
18. A method of oocyte production in a subject, comprising
providing the pharmaceutical composition of claim 13 to a tissue of
the subject, wherein the cells engraft into the tissue and
differentiate into oocytes, thereby producing oocytes in the
subject.
19. (canceled)
20. A method of inducing folliculogenesis in a subject, comprising
providing the pharmaceutical composition of claim 13 to the
subject, wherein the cells engraft into a tissue of the subject and
differentiate into oocytes within follicles, thereby inducing
folliculogenesis in the subject.
21. (canceled)
22. A method of treating infertility in a female subject in need
thereof comprising administering a therapeutically effective amount
of the pharmaceutical composition of claim 13 to the subject,
wherein the cells engraft into the ovary and differentiate into
oocytes, thereby treating infertility.
23. A method of repairing damaged ovarian tissue in a subject,
comprising providing a therapeutically effective amount of the
pharmaceutical composition of claim 13 to the tissue, wherein the
cells engraft into the tissue and differentiate into oocytes,
thereby repairing the damaged tissue in the subject.
24-26. (canceled)
27. A method of restoring ovarian function in a menopausal female
subject, comprising administering a therapeutically effective
amount of the pharmaceutical composition of claim 13 to the
subject, wherein the cells engraft into the ovary and differentiate
into oocytes, thereby restoring ovarian function in the
subject.
28-31. (canceled)
32. A method for oocyte production in a subject, comprising
contacting peripheral blood derived female germline stem cells, or
their progenitor cells, of the subject with an agent that
differentiates the peripheral blood derived female germline stem
cells, or their progenitor cells, into oocytes, thereby producing
oocytes in the subject.
33. (canceled)
34. A kit for oocyte production comprising an agent selected from
the group consisting of a transforming growth factor, bone
morphogenic protein, Wnt family protein, kit-ligand, leukemia
inhibitory factor, meiosis-activating sterol, modulator of Id
protein function and modulator of Snail/Slug transcription factor
function and instructions for using the agent to differentiate the
peripheral blood derived female germline stem cells of claim 32, or
their progenitor cells, into oocytes, thereby producing
oocytes.
35. A method of expanding peripheral blood derived female germline
stem cells, or their progenitor cells, in vivo, ex vivo or in
vitro, comprising contacting the peripheral blood derived female
germline stem cells of claim 32, or their progenitor cells, with an
agent that increases the amount of peripheral blood derived female
germline stem cells, or their progenitor cells, thereby expanding
the peripheral blood derived female germline stem cells, or their
progenitor cells.
36. (canceled)
37. (canceled)
38. A kit for expanding peripheral blood derived female germline
stem cells, or their progenitor cells, comprising an agent selected
from the group consisting of an insulin-like growth factor,
transforming growth factor, bone morphogenic protein, Wnt protein,
fibroblast growth factor, sphingosine-1-phosphate, retinoic acid,
inhibitor of glycogen synthase kinase-3, Bax inhibitor, caspase
inhibitor, inhibitor of nitric oxide production and inhibitor of
histone deacetylase activity, and instructions for using the agent
to increase the amount of peripheral blood derived female germline
stem cells of claim 32, or their progenitor cells, thereby
expanding the peripheral blood derived female germline stem cells,
or their progenitor cells.
39. A method for oocyte production in a subject, comprising
contacting peripheral blood derived female germline stem cells, or
their progenitor cells, of the subject with an agent that increases
the amount of peripheral blood derived female germline stem cells
of claim 32, or their progenitor cells, thereby producing oocytes
in the subject.
40. (canceled)
41. (canceled)
42. A method of restoring fertility to a female subject who desires
restored fertility, comprising administering a therapeutically
effective amount of the peripheral blood derived female germline
stem cells of claim 32, or their progenitor cells, to the subject,
wherein the cells engraft into a tissue and differentiate into
oocytes, thereby restoring fertility in the subject.
43. (canceled)
44. A method of protecting fertility in a female subject undergoing
or expected to undergo chemotherapy, radiotherapy or both
treatments, comprising providing an agent that protects against
reproductive injury prior to or concurrently with chemotherapy,
radiotherapy or both treatments and providing a peripheral blood
derived female germline stem cell of claim 32, or its progenitor
cell, to the subject, wherein the cell engrafts into a tissue and
differentiates into an oocyte, thereby protecting fertility in the
subject.
45. (canceled)
46. A kit for protecting fertility in a female subject undergoing
or expected to undergo chemotherapy, radiotherapy or both
treatments, comprising an agent of claim 45 selected from the group
consisting of S1P, a Bax antagonist, or any agent that increases
SDF-1 activity and instructions for using the agent to protect
peripheral blood derived female germline stem cells of claim 32, or
their progenitor cells, against reproductive injury thereby
protecting fertility in the female subject.
47. A method for in vitro fertilization of a female subject, said
method comprising the steps of: a) producing an oocyte by
contacting a peripheral blood derived female germline stem cell of
claim 32, or its progenitor cell, with an agent that differentiates
the peripheral blood derived female germline stem cell, or its
progenitor cell, into an oocyte; b) fertilizing the oocyte in vitro
to form a zygote; and c) implanting the zygote into the uterus of a
female subject.
48. An isolated peripheral blood cell that is mitotically
competent, has an XY kayrotype and expresses Vasa and Dazl.
49-52. (canceled)
53. A method of restoring or enhancing spermatogenesis, comprising
providing a peripheral blood derived male germline stem cell, or
its progenitor cell, to the testes of a male subject, wherein the
cell engrafts into the seminiferous epithelium and differentiates
into a sperm cell, thereby restoring or enhancing
spermatogenesis.
54. A method of restoring fertility to a male subject having
undergone chemotherapy or radiotherapy, or both and who desires
restored fertility, comprising administering a therapeutically
effective amount of the peripheral blood derived male germline stem
cells of claim 53, or their progenitor cells, to the subject,
wherein the cells engraft into the seminiferous epithelium and
differentiate into sperm cells, thereby restoring fertility.
55. A method of reducing the amount of peripheral blood derived
germline stem cells, or their progenitor cells, in a subject
comprising contacting peripheral blood derived germline stem cells,
or their progenitor cells, in the subject with an agent that (i)
reduces cell proliferation, (ii) inhibits cell survival, or (iii)
promotes cell death, thereby reducing the amount of peripheral
blood derived germline stem cells, or their progenitor cells, in
the subject.
56-59. (canceled)
61. A kit for reducing the amount of female germline stem cells, or
their progenitor cells, comprising an agent that inhibits survival
is selected from the group consisting of a pro-apoptotic tumor
necrosis factor, and instructions for using the agent to inhibit
cell survival of peripheral blood derived germline stem cells in
accordance with the method of claim 55.
62-65. (canceled)
66. A kit for reducing the amount of peripheral blood derived
germline stem cells, or their progenitor cells, comprising an agent
selected from the group consisting of a pro-apoptotic tumor
necrosis factor superfamily member, agonist of pro-apoptotic Bcl-2
family member function and ceramide, and instructions for using the
agent in accordance with the method of claim 55.
67. (canceled)
68. (canceled)
69. A method of providing contraception to a subject comprising
contacting peripheral blood derived germline stem cells, or their
progenitor cells, with an agent that decreases the amount of
peripheral blood derived germline stem cells, or their progenitor
cells, thereby providing contraception to the subject.
70. A kit for contraception in a subject comprising an agent of
claim 69, and instructions for using the agent to decrease the
amount of peripheral blood derived germline stem cells, or their
progenitor cells, thereby providing contraception to the subject.
Description
RELATED APPLICATIONS/PATENTS & INCORPORATION BY REFERENCE
[0001] This application is a continuation application of U.S. Ser.
No. 14/990,539, filed Jan. 7, 2016, which is a divisional of U.S.
Ser. No. 13/006,752, filed on Jan. 14, 2011 now U.S. Pat. No.
9,267,111, which is a continuation of U.S. Ser. No. 11/131,152,
filed on May 17, 2005, abandoned, which claims the benefit of U.S.
Ser. Nos. 60/572,222, filed on May 17, 2004; 60/574,187, filed on
May 24, 2004; and 60/586,641, filed on Jul. 9, 2004. The entire
contents of each of the aforementioned patent applications are
incorporated herein by reference.
[0002] Each of the applications and patents cited in this text, as
well as each document or reference cited in each of the
applications and patents (including during the prosecution of each
issued patent; "application cited documents"), and each of the PCT
and foreign applications or patents corresponding to and/or
claiming priority from any of these applications and patents, and
each of the documents cited or referenced in each of the
application cited documents, are hereby expressly incorporated
herein by reference, and may be employed in the practice of the
invention. More generally, documents or references are cited in
this text, either in a Reference List before the claims, or in the
text itself; and, each of these documents or references ("herein
cited references"), as well as each document or reference cited in
each of the herein cited references (including any manufacturer's
specifications, instructions, etc.), is hereby expressly
incorporated herein by reference.
SEQUENCE LISTING
[0004] This application contains a Sequence Listing that has been
submitted electronically in ASCII text format and is hereby
incorporated by reference in its entirety. Said ASCII text format,
created on Dec. 29, 2015, is named 051588_00406(DIV)_SL_txt and is
944 bytes in size.
BACKGROUND OF THE INVENTION
[0005] A basic doctrine of reproductive biology, which states that
mammalian females lose the capacity for germ-cell renewal during
fetal life, has only recently been successfully challenged by
Johnson et al., (2004) Nature 428: 145. Johnson et al. are the
first to conclusively demonstrate that juvenile and adult mouse
ovaries possess mitotically active germ cells that, based on rates
of oocyte degeneration and clearance, sustain oocyte and follicle
production in the postnatal mammalian ovary.
[0006] It has been recently determined that the precursors of germ
cells are not confined exclusively to the ovaries. Germ cell marker
genes have now been identified in cells derived from bone marrow.
In addition, transplantation of bone marrow to a conditioned host
allowed for bone marrow cell development into new oocytes within
the ovary.
[0007] Umbilical cord blood from newborn infants is a known
reservoir of stem cells that may contribute to a variety of somatic
cell lineages, including hematopoietic precursors (for reviews see
Korbling and Anderlini 2001 Blood 98: 2900-2908; Ho and Punzel,
2003 J Leukoc Biol 73: 547-555; Sanchez-Ramos 2002 J Neurosci Res
69: 880-893; Lee 2004 Blood 103:1669-75). Cord blood samples are
easily and safely collected and may be stored for future
therapeutic use (Rogers and Casper 2004 Sexuality, Reproduction
& Menopause 2: 64-70); further, their availability to
individual patients offers a potential source of perfectly-matched
donor cells. It was heretofore unknown whether peripheral blood,
such as cord blood also contained germ cell precursors.
SUMMARY OF THE INVENTION
[0008] Methods of the invention relate to the use of peripheral
blood derived germline stem cells and their progenitor cells to,
among other things, replenish or expand germ cell reserves of the
testes and ovary, to enhance or restore fertility, and in females,
to ameliorate symptoms and consequences of menopause.
[0009] In one aspect, the present invention provides compositions
comprising peripheral blood derived female germline stem cells.
[0010] In one embodiment, the present invention provides
compositions comprising peripheral blood derived female germline
stem cells, wherein the cells are mitotically competent and express
Vasa, Dazl, and Stella. Consistent with their mitotically competent
phenotype, peripheral blood derived female germline stem cells of
the invention do not express growth/differentiation factor-9
("GDF-9"), zona pellucida proteins (e.g., zona pellucida protein-3,
"ZP3"), histone deacetylase-6 ("HDAC6") and synaptonemal complex
protein-3 ("SCP3").
[0011] Upon transplantation into a host, peripheral blood derived
female germline stem cells of the invention can produce oocytes
after a duration of at least 1 week, more preferably 1 to about 2
weeks, about 2 to about 3 weeks, about 3 to about 4 weeks or more
than about 5 weeks post transplantation.
[0012] In another aspect, the present invention provides
compositions comprising progenitor cells derived from peripheral
blood derived female germline stem cells. In one embodiment, the
present invention provides compositions comprising peripheral blood
derived female germline stem cell progenitors, wherein the cells
express Vasa, Dazl and Stella, and wherein the cells do not express
GDF-9, zona pellucida proteins, HDAC6 and SCP3. Upon
transplantation into a host, peripheral blood derived female
germline stem cell progenitors of the invention can produce oocytes
after a duration of less than 1 week, preferably about 24 to about
48 hours post transplantation.
[0013] In one embodiment, the present invention provides an
isolated peripheral blood cell, wherein the cell is mitotically
competent and expresses Vasa, Dazl and Stella. Preferably, the cell
is a peripheral blood derived female germline stem cell, or its
progenitor cell, having an XX karyotype. Preferably, the peripheral
blood derived female germline stem cells, or their progenitor
cells, are non-embryonic, mammalian, and even more preferably,
human.
[0014] In another embodiment, the present invention provides
purified populations of peripheral blood derived female germline
stem cells and/or their progenitor cells. In specific embodiments,
the purified population of cells is about 50 to about 55%, about 55
to about 60%, about 65 to about 70%, about 70 to about 75%, about
75 to about 80%, about 80 to about 85%, about 85 to about 90%,
about 90 to about 95% or about 95 to about 100% of the cells in the
composition.
[0015] In yet another embodiment, the present invention provides
pharmaceutical compositions comprising peripheral blood derived
female germline stem cells, and/or their progenitor cells, and a
pharmaceutically acceptable carrier. The pharmaceutical
compositions can comprise purified populations of peripheral blood
derived female germline stem cells and/or their progenitor
cells.
[0016] Compositions comprising peripheral blood derived germline
stem cells of the invention can be provided by direct
administration to ovarian tissue, or indirect administration, for
example, to the circulatory system of a subject (e.g., to the
extra-ovarian circulation).
[0017] In yet another aspect, the invention provides methods for
manipulating peripheral blood derived germline stem cells, or their
progenitor cells, in vivo, ex vivo or in vitro as described herein
below.
[0018] In one embodiment, the invention provides a method for
expanding peripheral blood derived female germline stem cells, or
their progenitor cells, in vivo, ex vivo or in vitro, comprising
contacting peripheral blood derived female germline stem cells, or
their progenitor cells, with an agent that increases the amount of
peripheral blood derived female germline stem cells, or their
progenitor cells, by promoting proliferation or survival thereof,
thereby expanding the peripheral blood derived female germline stem
cells, or their progenitor cells. Such agents may promote
mobilization of peripheral blood derived stem cells or of
progenitor cells derived from peripheral blood derived stem cells
from within the peripheral blood into the peripheral blood (e.g.,
GCSF, GMCSF). In a preferred embodiment, the agent includes, but is
not limited to, a hormone or growth factor (e.g., insulin-like
growth factor ("IGF"), transforming growth factor ("TGF"), bone
morphogenic protein ("BMP"), Wnt protein, or fibroblast growth
factor ("FGF")), a cell-signaling molecule (e.g.,
sphingosine-1-phosphate ("S1P"), or retinoic acid ("RA")), or a
pharmacological or pharmaceutical compound (e.g., an inhibitor of
glycogen synthase kinase-3 ("GSK-3"), an inhibitor of apoptosis
such as a Bax inhibitor or a caspase inhibitor, an inhibitor of
nitric oxide production, or an inhibitor of HDAC activity).
[0019] In another embodiment, the invention provides a method for
identifying an agent that promotes proliferation or survival of a
peripheral blood derived female germline stem cell, or its
progenitor cell, comprising contacting the peripheral blood derived
female germline stem cells, or their progenitor cells, with a test
agent; and detecting an increase in the number of peripheral blood
derived female germline stem cells, or their progenitor cells,
thereby identifying an agent that promotes proliferation or
survival of a peripheral blood derived female germline stem cell,
or its progenitor cell.
[0020] In yet another embodiment, the invention provides a method
for using the female germline stem cells, or their progenitor
cells, to characterize pharmacogenetic cellular responses to
biologic or pharmacologic agents, comprising isolating peripheral
blood derived female germline stem cells, or their progenitor
cells, from a population of subjects, expanding said cells in
culture to establish a plurality of cell cultures, optionally
differentiating said cells into a desired lineage, contacting the
cell cultures with one or more biologic or pharmacologic agents,
identifying one or more cellular responses to the one or more
biologic or pharmacologic agents, and comparing the cellular
responses of the cell cultures from different subjects.
[0021] In yet another embodiment, the invention provides a method
for oocyte production, comprising culturing a peripheral blood
derived female germline stem cell, or its progenitor cell, in the
presence of an agent that differentiates a peripheral blood derived
female germline stem cell, or its progenitor cell, into an oocyte,
thereby producing an oocyte. In a preferred embodiment, the agent
includes, but is not limited to, a hormone or growth factor (e.g.,
a TGF, BMP or Wnt family protein, kit-ligand ("SCF") or leukemia
inhibitory factor ("LIF")), a signaling molecule (e.g.,
meiosis-activating sterol, "FF-MAS"), or a pharmacologic or
pharmaceutical agent (e.g., a modulator of Id protein function or
Snail/Slug transcription factor function).
[0022] In yet another embodiment, the invention provides a method
for in vitro fertilization of a female subject, said method
comprising the steps of: [0023] a) producing an oocyte by culturing
a peripheral blood derived female germline stem cell, or its
progenitor, in the presence of an oocyte differentiation agent;
[0024] b) fertilizing the oocyte in vitro to form a zygote; and
[0025] c) implanting the zygote into the uterus of a female
subject.
[0026] In yet another embodiment, the invention provides a method
for in vitro fertilization of a female subject, said method
comprising the steps of: [0027] a) producing an oocyte by
contacting a peripheral blood derived female germline stem cell, or
its progenitor cell, with an agent that differentiates said cell(s)
into an oocyte; [0028] b) fertilizing the oocyte in vitro to form a
zygote; and [0029] c) implanting the zygote into the uterus of a
female subject.
[0030] In yet another embodiment, the invention provides a method
for identifying an agent that induces differentiation of a
peripheral blood derived female germline stem cell, or its
progenitor cell, into an oocyte comprising contacting peripheral
blood derived female germline stem cells, or their progenitor
cells, with a test agent; and detecting an increase in the number
of oocytes, thereby identifying an agent that induces
differentiation of a peripheral blood derived female germline stem
cell, or its progenitor.
[0031] In yet another embodiment, the present invention provides a
method for oocyte production, comprising providing a peripheral
blood derived female germline stem cell, or its progenitor cell, to
a tissue, preferably the ovary, wherein the cell engrafts into the
tissue and differentiates into an oocyte, thereby producing an
oocyte.
[0032] In yet another embodiment, the present invention provides a
method for inducing folliculogenesis, comprising providing a
peripheral blood derived female germline stem cell, or its
progenitor cell, to a tissue, preferably the ovary, wherein the
cell engrafts into the tissue and differentiates into an oocyte
within a follicle, thereby inducing folliculogenesis.
[0033] In yet another embodiment, the present invention provides a
method for treating infertility in a female subject in need thereof
comprising administering a therapeutically effective amount of a
composition comprising peripheral blood derived female germline
stem cells, or their progenitor cells, to the subject, wherein the
cells engraft into a tissue, preferably ovarian tissue, and
differentiate into oocytes, thereby treating infertility. Except
where expressly stated herein, the female subject in need of
fertility treatment is not a subject who has undergone prior
chemotherapy or radiotherapy.
[0034] In yet another embodiment, the present invention provides a
method for restoring fertility to a female subject having undergone
chemotherapy or radiotherapy (or both treatments) and who desires
restored fertility, comprising administering a therapeutically
effective amount of peripheral blood derived female germline stem
cells, or their progenitor cells, to the subject, wherein the cells
engraft into a tissue, preferably ovarian tissue, and differentiate
into oocytes, thereby restoring fertility in the subject.
Preferably, the peripheral blood derived female germline stem cells
comprise a purified sub-population of cells obtained from the
peripheral blood. Chemotherapeutic drugs include, but are not
limited to, busulfan, cyclophosphamide, 5-FU, vinblastine,
actinomycin D, etoposide, cisplatin, methotrexate, doxorubicin,
among others. Radiotherapy includes, but is not limited to,
ionizing radiation, ultraviolet radiation, X-rays, and the
like.
[0035] In yet another embodiment, the present invention provides a
method for protecting fertility in a female subject undergoing or
expected to undergo chemotherapy or radiotherapy (or both
treatments), comprising providing an agent that protects against
reproductive injury prior to or concurrently with chemotherapy or
radiotherapy (or both treatments) and providing a peripheral blood
derived female germline stem cell, or its progenitor cell, to the
subject, wherein the cell engrafts into a tissue, preferably
ovarian tissue, and differentiates into an oocyte, thereby
protecting fertility in the subject. The protective agent can be
S1P, a Bax antagonist, or any agent that increases SDF-1
activity.
[0036] In yet another embodiment, the present invention provides a
method for repairing damaged ovarian tissue, comprising providing a
therapeutically effective amount of a composition comprising
peripheral blood derived female germline stem cells, or their
progenitor cells, to the tissue, wherein the cells engraft into the
tissue and differentiate into oocytes, thereby repairing the
damaged tissue. Damage can be caused, for example, by exposure to
cytotoxic factors, hormone deprivation, growth factor deprivation,
cytokine deprivation, cell receptor antibodies, and the like.
Except where expressly stated herein, the damage is not caused by
prior chemotherapy or radiotherapy. Damage can also be caused be
diseases that affect ovarian function, including, but not limited
to cancer, polycystic ovary disease, genetic disorders, immune
disorders, metabolic disorders, and the like.
[0037] In yet another embodiment, the present invention provides a
method for restoring ovarian function in a female subject having
undergone chemotherapy or radiotherapy (or both treatments) and who
desires restored ovarian function, comprising administering a
therapeutically effective amount of peripheral blood derived female
germline stem cells, or their progenitor cells, to an ovary of the
subject, wherein the cells engraft into the ovary and differentiate
into oocytes within the ovary, thereby restoring ovarian function
in the subject.
[0038] In yet another embodiment, the present invention provides a
method for restoring ovarian function in a menopausal female
subject, comprising administering a therapeutically effective
amount of a composition comprising peripheral blood derived female
germline stem cells, or their progenitor cells, to the subject,
wherein the cells engraft into the ovary and differentiate into
oocytes, thereby restoring ovarian function. The menopausal female
subject can be in a stage of either peri- or post-menopause, with
said menopause caused by either normal (e.g., aging) or
pathological (e.g., surgery, disease, ovarian damage)
processes.
[0039] Restoration of ovarian function can relieve adverse symptoms
and complications associated with menopausal disorders, including,
but not limited to, somatic disorders such as osteoporosis,
cardiovascular disease, somatic sexual dysfunction, hot flashes,
vaginal drying, sleep disorders, depression, irritability, loss of
libido, hormone imbalances, and the like, as well as cognitive
disorders, such as loss of memory; emotional disorders, depression,
and the like.
[0040] In yet another embodiment, the present invention provides a
method for detecting or diagnosing premature ovarian failure in a
subject, comprising determining the number of female germline stem
cells, or their progenitors, present in a sample of peripheral
blood obtained from the subject, wherein the number of female
germline stem cells, or their progenitors, in the sample is
substantially less than the number of female germline stem cells,
or their progenitors, in a sample obtained from a healthy subject,
thereby detecting or diagnosing premature ovarian failure in the
subject.
[0041] Methods of the present invention can be used in the
production of other reproductive cell types. Accordingly, in yet
another aspect, the present invention provides compositions
comprising peripheral blood derived male germline stem cells,
wherein the peripheral blood derived male germline stem cells are
mitotically competent and express Vasa and Dazl. Peripheral blood
derived male germline stem cells of the invention have an XY
karyotype, whereas peripheral blood derived female germline stem
cells of the invention have an XX karyotype. Preferably, the
peripheral blood derived male germline stem cells are
non-embryonic, mammalian, and even more preferably, human.
[0042] In one embodiment, the invention provides an isolated
peripheral blood cell that is mitotically competent, has an XY
kayrotype and expresses Vasa and Dazl.
[0043] In another embodiment, the present invention provides a
method for restoring or enhancing spermatogenesis, comprising
providing a peripheral blood derived male germline stem cell, or
its progenitor cell, to the testes of a male subject, wherein the
cell engrafts into the seminiferous epithelium and differentiates
into a sperm cell, thereby restoring or enhancing
spermatogenesis.
[0044] In yet another embodiment, the present invention provides a
method for restoring fertility to a male subject having undergone
chemotherapy or radiotherapy (or both) and who desires restored
fertility, comprising administering a therapeutically effective
amount of peripheral blood derived male germline stem cells, or
their progenitor cells, to the subject, wherein the cells engraft
into the seminiferous epithelium and differentiate into sperm
cells, thereby restoring fertility.
[0045] In yet another embodiment, the invention provides a method
for reducing the amount of peripheral blood derived germline stem
cells, or their progenitor cells, in vivo, ex vivo or in vitro,
comprising contacting peripheral blood derived germline stem cells,
or their progenitor cells, with an agent that reduces cell
proliferation, thereby reducing the amount of peripheral blood
derived germline stem cells, or their progenitor cells. In a
preferred embodiment, the agent includes, but is not limited to, a
hormone or growth factor (e.g., TGF-.beta.), a peptide antagonist
of mitogenic hormones or growth factors (e.g., the BMP antagonists,
Protein Related to DAN and Cerberus ("PRDC") and Gremlin), or a
pharmacological or pharmaceutical compound (e.g., a cell cycle
inhibitor, or an inhibitor of growth factor signaling).
[0046] In yet another embodiment, the invention provides a method
for reducing the amount of peripheral blood derived germline stem
cells, or their progenitor cells, in vivo, ex vivo or in vitro,
comprising contacting peripheral blood derived germline stem cells,
or their progenitor cells, with an agent that inhibits cell
survival or promotes cell death, thereby reducing the amount of
peripheral blood derived germline stem cells, or their progenitor
cells. In a preferred embodiment, the agent the that inhibits cell
survival includes, but is not limited to, a hormone, growth factor
or cytokine (e.g., a pro-apoptotic tumor necrosis factor ("TNF")
super family member such as TNF-.alpha., Fas-ligand ("FasL") and
TRAIL), an antagonist of pro-survival Bcl-2 family member function,
a signaling molecule (e.g., a ceramide), or a pharmacological or
pharmaceutical compound (e.g., an inhibitor of growth factor
signaling). In a preferred embodiment, the agent the that promotes
cell death includes, but is not limited to, a pro-apoptotic tumor
necrosis factor superfamily member (e.g., TNF-.alpha., FasL and
TRAIL), agonist of pro-apoptotic Bcl-2 family member function and
ceramide.
[0047] In yet another embodiment, the invention provides a method
for identifying an agent that reduces proliferation or survival, or
promotes cell death, of a peripheral blood derived germline stem
cell, or its progenitor cell, comprising contacting peripheral
blood derived germline stem cells, or their progenitor cells, with
a test agent; and detecting a decrease in the number of peripheral
blood derived germline stem cells, or their progenitor cells,
thereby identifying an agent that reduces proliferation or
survival, or promotes cell death, of a female germline stem cell,
or its progenitor cell.
[0048] In yet another embodiment, the present invention provides a
method for contraception in a male or female subject comprising
contacting peripheral blood derived germline stem cells, or their
progenitor cells, of the subject with an agent that decreases the
proliferation, function or survival of peripheral blood derived
germline stem cells, or their progenitor cells, or the ability of
said cells to produce new oocytes or sperm cells or other somatic
cell types required for fertility, thereby providing contraception
to the subject.
[0049] In yet another aspect, the present invention provides kits
for use in employing various agents of the invention.
[0050] In one embodiment, the present invention provides a kit for
expanding a peripheral blood derived female germline stem cell, or
its progenitor cell, in vivo, ex vivo or in vitro, comprising an
agent that promotes cell proliferation or survival of the
peripheral blood derived female germline stem cell, or its
progenitor cell, and instructions for using the agent to promote
cell proliferation or survival of the peripheral blood derived
female germline stem cell, or its progenitor, thereby expanding a
female germline stem cell, or its progenitor cell in accordance
with the methods of the invention.
[0051] In another embodiment, the present invention provides a kit
for oocyte production, comprising an agent that differentiates a
peripheral blood derived female germline stem cell, or its
progenitor cell, into an oocyte and instructions for using the
agent to differentiate a peripheral blood derived female germline
stem cell, or its progenitor cell, into an oocyte in accordance
with the methods of the invention.
[0052] In yet another embodiment, the present invention provides a
kit for oocyte production, comprising an agent that increases the
amount of peripheral blood derived female germline stem cells, or
their progenitor cells, by promoting proliferation or survival
thereof, and instructions for using the agent to increase the
amount of peripheral blood derived female germline stem cells or
their progenitor cells, thereby producing oocytes in accordance
with the methods of the invention.
[0053] In yet another embodiment, the present invention provides a
kit for oocyte production comprising an agent that differentiates
peripheral blood derived female germline stem cells, or their
progenitor cells, into oocytes and instructions for using the agent
to differentiate the peripheral blood derived female germline stem
cells, or their progenitor cells, into oocytes, thereby producing
oocytes in accordance with the methods of the invention.
[0054] In yet another embodiment, the present invention provides a
kit for treating infertility in a female subject in need thereof
comprising an agent that increases the amount of peripheral blood
derived female germline stem cells, or their progenitor cells, by
promoting proliferation or survival thereof and instructions for
using the agent to increase the amount of peripheral blood derived
female germline stem cells or their progenitor cells, thereby
treating infertility in the subject in accordance with the methods
of the invention.
[0055] In yet another embodiment, the present invention provides a
kit for treating infertility in a female subject in need thereof
comprising an agent that differentiates peripheral blood derived
female germline stem cells, or their progenitor cells, into
oocytes, and instructions for using the agent to differentiate
peripheral blood derived female germline stem cells, or their
progenitor cells, into oocytes, thereby treating infertility in the
subject in accordance with the methods of the invention.
[0056] In yet another embodiment, the present invention provides a
kit for protecting fertility in a female subject undergoing or
expected to undergo chemotherapy or radiotherapy (or both
treatments), comprising an agent that that protects peripheral
blood derived female germline stem cells, or their progenitor
cells, against reproductive injury and instructions for using the
agent to protect peripheral blood derived female germline stem
cells, or their progenitor cells, against reproductive injury
thereby protecting fertility in the female subject in accordance
with the methods of the invention.
[0057] In yet another embodiment, the present invention provides a
kit for restoring ovarian function in a post-menopausal female
subject comprising an agent that increases the amount of peripheral
blood derived female germline stem cells, or their progenitor
cells, by promoting proliferation or survival thereof and
instructions for using the agent to increase the amount of
peripheral blood derived female germline stem cells or their
progenitor cells, thereby restoring ovarian function in the subject
in accordance with the methods of the invention.
[0058] In yet another embodiment, the present invention provides a
kit for restoring ovarian function in a post-menopausal female
subject comprising an agent that differentiates peripheral blood
derived female germline stem cells, or their progenitor cells, into
oocytes, and instructions for using the agent to differentiate
peripheral blood derived female germline stem cells, or their
progenitor cells, into oocytes, thereby restoring ovarian function
in the subject in accordance with the methods of the invention.
[0059] In another embodiment, the present invention provides a kit
for reducing the amount of peripheral blood derived germline stem
cells, or their progenitor cells, in vivo, ex vivo or in vitro,
comprising an agent that inhibits cell survival or promotes cell
death and instructions for using the agent to inhibit cell survival
or promote cell death of the peripheral blood derived germline stem
cells, or their progenitor cells, thereby the reducing the amount
of peripheral blood derived germline stem cells, or their
progenitor cells, in accordance with the methods of the
invention.
[0060] In yet another embodiment, the present invention provides a
kit for contraception in a male of female subject comprising an
agent that decreases the proliferation, function or survival of
peripheral blood derived germline stem cells, or their progenitor
cells, or the ability of said cells to produce new oocytes or other
somatic cell types required for fertility and instructions for
using the agent to decrease the proliferation, function or survival
of peripheral blood derived germline stem cells, or their
progenitor cells, or the ability of said cells to produce new
oocytes or sperm cells or other somatic cell types required for
fertility, thereby providing contraception to the subject in
accordance with the methods of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0061] The patent or application file contains at least one drawing
executed in color. Copies of this patent or patent application
publication with color drawings will be provided by the Office upon
request and payment of the necessary fee.
[0062] FIGS. 1A-1E indicate that peripheral blood contains
oocyte-producing germ cells. In particular, FIG. 1A shows a
primordial-early primary follicle containing a GFP-positive oocyte
(green; nuclei visualized by propidium iodide in red) in an adult
GFP-transgenic mouse (scale bar=10 mm). FIG. 1B shows an early
primary oocyte in a wild-type ovary prior to PBCT, showing a lack
of GFP signal (compare with A). FIGS. 1C-1E show examples of
primordial and early primary follicles containing GFP-positive
oocytes (compare with A) in ovaries of wild-type mice 24 hours
after PBCT using peripheral blood harvested from adult
GFP-transgenic females. FIG. 1F shows GFP-negative oocytes in the
same ovaries as those shown in FIGS. 1C-1E.
[0063] FIGS. 2A-2H show further results indicating that peripheral
blood contains oocyte-producing germ cells. In particular, FIGS. 2A
and 2B depict follicles containing GFP-positive (brown) oocytes in
ovaries of adult Oct4-GFP transgenic mice. Scale bar=10 mm. FIG. 2C
depicts oocytes in a wild-type ovary prior to PBCT using Oct4-GFP
(TgOG2) females as donors, showing a lack of GFP signal (inset,
primordial oocyte). FIGS. 2D-2F show primordial follicles
containing GFP-positive oocytes in ovaries of wild-type female mice
28-30 hr after PBCT, using adult TgOG2 transgenic females as
peripheral blood cell donors (see also FIG. 8). Scale bars=10 mm.
FIGS. 2G-2H depict GFP-positive primordial oocytes in ovaries of
Atm-deficient females 30 h after PBCT using adult TgOG2 transgenic
females as donors. Scale bars=10 mm.
[0064] FIGS. 3A-3F show results indicating that male peripheral
blood does not generate oocytes in transplanted female mice. In
particular, FIGS. 3A-3C depict immunohistochemical detection of GFP
expression (brown) in germ cells in the testes of adult TgOG2 male
mice, confirming faithful and abundant expression of the transgene
in males. FIGS. 3D-3F depict representative immunohistochemical
analyses of ovaries of chemotherapy-treated adult female mice 28-30
hr following PBCT using adult male TgOG2 mice as donors, showing a
lack of GFP signal in primordial oocytes. Serially sectioned
ovaries from three recipients were screened in their entirety, and
no GFP-positive oocytes were observed in over 750 sections
analyzed. In addition to the testicular samples shown in FIGS.
3A-3C, ovaries from adult TgOG2 females were also run in parallel
as a positive control for GFP detection in oocytes (data not shown,
see FIGS. 2A-2H).
[0065] FIGS. 4A-4R show PBCT-derived ovarian follicular cells
expressing germline and oocyte markers. Dual immunofluorescence
analysis showing co-expression of: GFP (green) and MVH (red), shown
in FIGS. 4A-4F; GFP (green) and HDAC6 (red) shown in FIGS. 4G-4L;
GFP (green) and NOBOX (red, note the nuclear localization) shown in
FIGS. 4M-4O; or GFP (green) and GDF9 (red) shown in FIGS. 4P-4R; in
oocytes of immature follicles within ovaries of recipient female
mice 28-30 hr after transplantation with peripheral blood harvested
from adult Oct4-GFP (TgOG2) transgenic females (see FIG. 2 for
controls). In FIGS. 4P and 4R, asterisks denote autofluorescent red
blood cells. All cell nuclei are highlighted by TO-PRO-3 iodide
staining (blue) in the merged panels. Scale bars=10 mm.
[0066] FIGS. 5A-5B depicts analysis of germline markers in
peripheral blood of mice and humans. In particular, FIG. 5A shows
RT-PCR analysis of peripheral blood (PB) mononuclear cells isolated
from adult female mice revealing expression of the germline
markers, Dazl and Stella (L7, `house-keeping` gene; Mock, mock
reverse-transcribed RNA samples). Data shown are representative of
results obtained from analysis of 6 wild-type female mice between
7-10 weeks of age. FIG. 5B shows expression of DAZL and STELLA in
peripheral blood mononuclear cells (PB) collected from 3 human
female donors between 23-33 years of age. As a negative control,
germline markers were not detected in two different adult human
uterine (Ut) endometrial samples analyzed in parallel. GAPDH,
amplified as an internal loading control. Mock, mock
reverse-transcribed RNA samples.
[0067] FIG. 6 depicts expression of Dazl in human umbilical cord
blood, as detected by RT-PCR analysis.
[0068] FIGS. 7A and 7B depict real-time PCR analysis of Mvh levels
in bone marrow or peripheral blood of adult female mice during the
indicated stages of the estrous cycle. The data shown represent the
combined results from an analysis of 3-4 mice per group, with mean
levels at estrus set as the reference point for comparisons to
other stages of the cycle following normalization against
beta-actin for sample loading. For mice in estrus, Mvh expression
in bone marrow was detected during linear amplification in only 1
of the 3 samples analyzed.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0069] "Peripheral blood derived germline stem cells" are any
multipotent cells obtained from peripheral blood that include a
population of male or female germline stem cells.
[0070] "Expansion" refers to the propagation of a cell or cells
without terminal differentiation. "Isolation phenotype" refers to
the structural and functional characteristics of the peripheral
blood derived germline stem cells upon isolation. "Expansion
phenotype" refers to the structural and functional characteristics
of the peripheral blood derived germline stem cells during
expansion. The expansion phenotype can be identical to the
isolation phenotype, or alternatively, the expansion phenotype can
be more differentiated than the isolation phenotype.
[0071] "Differentiation" refers to the developmental process of
lineage commitment. A "lineage" refers to a pathway of cellular
development, in which precursor or "progenitor" cells undergo
progressive physiological changes to become a specified cell type
having a characteristic function (e.g., nerve cell, muscle cell or
endothelial cell). Differentiation occurs in stages, whereby cells
gradually become more specified until they reach full maturity,
which is also referred to as "terminal differentiation." A
"terminally differentiated cell" is a cell that has committed to a
specific lineage, and has reached the end stage of differentiation
(i.e., a cell that has fully matured). Oocytes are an example of a
terminally differentiated cell type.
[0072] The term "isolated" as used herein refers to a peripheral
blood derived germline stem cell or its progenitor cell, in a
non-naturally occurring state (e.g., isolated from the body or a
biological sample, such as peripheral blood, from the body).
[0073] "Progenitor cells" as used herein are germlineage cells that
are 1) derived from germline stem cells of the invention as the
progeny thereof which contain a set of common marker genes; 2) are
in an early stage of differentiation; and 3) retain mitotic
capacity.
[0074] "Progeny" as used herein are all cells derived from
peripheral blood derived germline stem cells of the invention,
including progenitor cells, differentiated cells, and terminally
differentiated cells.
[0075] "Derived from" as used herein refers to the process of
obtaining a daughter cell.
[0076] "Engraft" refers to the process of cellular contact and
incorporation into an existing tissue of interest (e.g., ovary) in
vivo.
[0077] "Agents" refer to cellular (e.g., biologic) and
pharmaceutical factors, preferably growth factors, cytokines,
hormones or small molecules, or to genetically-encoded products
that modulate cell function (e.g., induce lineage commitment,
increase expansion, inhibit or promote cell growth and survival).
For example, "expansion agents" are agents that increase
proliferation and/or survival of peripheral blood derived germline
stem cells. "Differentiation agents" are agents that induce
peripheral blood derived germline stem cells to differentiate into
committed cell lineages, such as oocytes or sperm cells.
[0078] A "follicle" refers to an ovarian structure consisting of a
single oocyte surrounded by somatic (granulosa without or with
theca-interstitial) cells. Somatic cells of the gonad enclose
individual oocytes to form follicles. Each fully formed follicle is
enveloped in a complete basement membrane. Although some of these
newly formed follicles start to grow almost immediately, most of
them remain in the resting stage until they either degenerate or
some signal(s) activate(s) them to enter the growth phase. For
reviews on ovarian structure, function and physiology, see Gougeon,
A., (1996) Endocr Rev. 17:121-55; Anderson, L. D., and Hirshfield,
A. N. (1992) Md Med J. 41: 614-20; and Hirshfield, A. N. (1991) Int
Rev Cytol. 124: 43-101.
[0079] A "sperm cell" refers to a male germ cell, in either a
pre-meiotic (i.e., mitotically competent) or post-meiotic state of
development, including a fully mature spermatozoan.
"Spermatogenesis" is the developmental process by which a sperm
cell is formed.
[0080] "Mitotically competent" refers to a cell that is capable of
mitosis, the process by which a cell divides and produces two
daughter cells from a single parent cell.
[0081] A "non-embryonic" cell refers to a cell that is obtained
from a post-natal source (e.g., infant, child or adult tissue).
[0082] A "subject" is a vertebrate, preferably a mammal, more
preferably a primate and still more preferably a human. Mammals
include, but are not limited to, primates, humans, farm animals,
sport animals, and pets.
[0083] The term "obtaining" as in "obtaining the agent" is intended
to include purchasing, synthesizing or otherwise acquiring the
agent (or indicated substance or material).
[0084] The terms "comprises", "comprising", and are intended to
have the broad meaning ascribed to them in U.S. Patent Law and can
mean "includes", "including" and the like.
EMBODIMENTS OF THE INVENTION
I. Peripheral Blood Derived Germline Stem Cells
[0085] Methods of the invention relate to the use of peripheral
blood derived germline stem cells, or progenitors of peripheral
blood derived germline stem cells, to restore or increase germ cell
production. Methods of the invention can be used to, among other
things, enhance or restore fertility, and in females, to ameliorate
symptoms and consequences of menopause.
[0086] Without wanting to be bound by theory, it is understood that
one or more mechanisms can be involved with the ability of
peripheral blood derived germline stem cells to repopulate the germ
cell population. Female germline stem cells have been detected in
the peripheral blood, which may therefore serve as a reservoir for
stem cells having the capacity to repopulate and/or expand the germ
cell supply of reproductive organs. Male germline stem cells can
also exist in the peripheral blood of male subjects. Other
sub-populations of cells in the peripheral blood, such as
hematopoietic stem cells, may likewise have the ability to
repopulate and/or expand the germ cell supply of reproductive
organs, for example, through de-differentiation into a multipotent
progenitor cell (see U.S. Pat. No. 6,090,625; Herzog, E. L., et
al., (2004) Blood 102(10): 3483) which in turn migrates through
peripheral blood to the reproductive tract, engrafts into an organ
(e.g., ovary or testes) as a germline stem cell or a progenitor of
a germline stem cell and differentiates into a germ cell.
[0087] As described herein, germline stem cells have been detected
in the peripheral blood (including cord blood) of male and female
subjects. Peripheral blood derived female germline stem cells
express markers including Vasa, Dazl, and Stella. Peripheral blood
derived female germline stem cells are mitotically competent (i.e.,
capable of mitosis) and accordingly, do not express GDF-9, zona
pellucida proteins (e.g., ZP3), HDAC6 or SCP3.
[0088] The present invention also provides peripheral blood derived
female germline stem cell progenitors. Peripheral blood derived
female germline stem cell progenitors of the invention can
circulate throughout the body and most preferably can be localized
in bone marrow, peripheral blood and ovary. Progenitor cells of the
invention express Vasa, Dazl, and Stella but do not express GDF-9,
zona pellucida proteins (e.g., ZP3), HDAC6 or SCP3.
[0089] Peripheral blood derived female germline stem cells and
their progenitor cells have functional distinctions. Upon
transplantation into a host, peripheral blood derived female
germline stem cells of the invention can produce oocytes after a
duration of at least 1 week, more preferably 1 to about 2 weeks,
about 2 to about 3 weeks, about 3 to about 4 weeks or more than
about 5 weeks post transplantation. Peripheral blood derived female
germline stem cell progenitors have the capacity to generate
oocytes more rapidly than peripheral blood derived female germline
stem cells. Upon transplantation into a host, peripheral blood
derived female germline stem cell progenitors of the invention can
produce oocytes after a duration of less than 1 week, preferably
about 24 to about 48 hours post transplantation.
[0090] Stella is a gene expressed in peripheral blood derived
female germline stem cells and their progenitor cells. Stella is a
novel gene specifically expressed in primordial germ cells and
their descendants, including oocytes (Bortvin et al. (2004) BMC
Developmental Biology 4(2):1-5). Stella encodes a protein with a
SAP-like domain and a splicing factor motif-like structure. Embryos
deficient in Stella expression are compromised in preimplantation
development and rarely reach the blastocyst stage. Thus, Stella is
a maternal factor implicated in early embryogenesis.
[0091] Dazl is a gene expressed in peripheral blood derived female
germline stem cells and their progenitor cells. The autosomal gene
Dazl is a member of a family of genes that contain a consensus RNA
binding domain and are expressed in germ cells. Loss of expression
of an intact Dazl protein in mice is associated with failure of
germ cells to complete meiotic prophase. Specifically, in female
mice null for Dazl, loss of germ cells occurs during fetal life at
a time coincident with progression of germ cells through meiotic
prophase. In male mice null for Dazl, germ cells were unable to
progress beyond the leptotene stage of meiotic prophase I. Thus, in
the absence of Dazl, progression through meiotic prophase is
interrupted (Saunders et al. (2003), Reproduction,
126:589-597).
[0092] Vasa is a gene expressed in peripheral blood derived female
germline stem cells and their progenitor cells. Vasa is a component
of the germplasm that encodes a DEAD-family ATP-dependent RNA
helicase (Liang et al. (1994) Development, 120:1201-1211; Lasko et
al. (1988) Nature, 335:611-167). The molecular function of Vasa is
directed to binding target mRNAs involved in germ cell
establishment (e.g., Oskar and Nanos), oogenesis, (e.g., Gruken),
and translation onset (Gavis et al. (1996) Development, 110:
521-528). Vasa is required for pole cell formation and is
exclusively restricted to the germ cell lineage throughout the
development. Thus, Vasa is a molecular marker for the germ cell
lineage in most animal species (Toshiaki et al. (2001) Cell
Structure and Function 26:131-136). Because Vasa has been
associated with inhibition of cell migration, expression of Vasa in
progenitor cells of the invention may be differentially regulated,
depending on the migratory state of the progenitor. For example,
while in the bone marrow, the progenitor may express Vasa, and
while migrating to the reproductive tract, the progenitor may down
regulate expression.
[0093] Peripheral blood derived female germline stem cells and
their progenitor cells do not express GDF-9, a gene expressed in
cells that have already started to differentiate into oocytes.
Growth/differentiation factor-9 (GDF-9) is a member of the
transforming growth factor-.beta. superfamily, expressed
specifically in ovaries. GDF-9 mRNA can be found in neonatal and
adult oocytes from the primary one-layer follicle stage until after
ovulation (Dong, J. et al (1996) Nature 383: 531-5). Analysis of
GDF-9 deficient mice reveals that only primordial and primary
one-layer follicles can be formed, but a block beyond the primary
one-layer follicle stage in follicular development occurs,
resulting in complete infertility.
[0094] Peripheral blood derived female germline stem cells and
their progenitor cells do not express ZP3, ZP1, ZP2, and ZP3, which
are gene products that comprise the zona pellucida of the oocyte.
Their expression is regulated by a basic helix-loop-helix (bHLH)
transcription factor, FIG.alpha.. Mice null in FIG.alpha. do not
express the Zp genes and do not form primordial follicles (Soyal,
S. M., et al (2000) Development 127: 4645-4654). Individual
knockouts of the ZP genes result in abnormal or absent zonae
pellucidae and decreased fertility (Zp1; Rankin T, et al (1999)
Development. 126: 3847-55) or sterility (Zp2, Rankin T L, et al.
(2001) Development 128: 1119-26; ZP3, Rankin T et al (1996)
Development 122: 2903-10). The ZP protein products are
glycosylated, and subsequently secreted to form an extracellular
matrix, which is important for in vivo fertilization and
pre-implantation development. Expression of the ZP proteins is
precisely regulated and restricted to a two-week growth phase of
oogenesis. Zp mRNA transcripts are not expressed in resting
oocytes, however once the oocytes begin to grow, all three Zp
transcripts begin to accumulate.
[0095] Peripheral blood derived female germline stem cells and
their progenitor cells do not express HDAC6. HDACs, or histone
deacetylases are involved in ovarian follicle development. HDAC6 in
particular can be detected in resting germinal vesicle-stage
(primordial) oocytes (Verdel, A., et al. (2003) Zygote 11: 323-8;
FIG. 16). HDAC6 is a class II histone deacetylase and has been
implicated as a microtubule-associated deactylase (Hubbert, C. et
al, (2002) Nature 417: 455-8). HDACs are the target of inhibitors
including, but not limited to, trichostatin A and trapoxin, both of
which are microbial metabolites that induce cell differentiation,
cell cycle arrest, and reversal of the transformed cell
morphology.
[0096] Peripheral blood derived female germline stem cells and
their progenitor cells do not express SCP3, consistent with
observations that they are pre-meiotic stem cells (i.e., diploid).
The synaptonemal complex protein SCP3 is part of the lateral
element of the synaptonemal complex, a meiosis-specific protein
structure essential for synapsis of homologous chromosomes. The
synaptonemal complex promotes pairing and segregation of homologous
chromosomes, influences the number and relative distribution of
crossovers, and converts crossovers into chiasmata. SCP3 is
meiosis-specific and can form multi-stranded, cross-striated
fibers, forming an ordered, fibrous core in the lateral element
(Yuan, L. et al, (1998) J. Cell. Biol. 142: 331-339). The absence
of SCP3 in mice can lead to female germ cell aneuploidy and embryo
death, possibly due to a defect in structural integrity of meiotic
chromosomes (Yuan, L. et al, (2002) Science 296: 1115-8).
[0097] Peripheral blood derived female germline stem cells and
their progenitor cells can be isolated by standard means known in
the art for the separation of stem cells from the blood (e.g., cell
sorting). Preferably, the isolation protocol includes generation of
a kit.sup.+/lin.sup.- fraction that is depleted of hematopoietic
cells. Additional selection means based on the unique profile of
gene expression (e.g., Vasa, Dazl and Stella) can be employed to
further purify populations of cells comprising peripheral blood
derived female germline stem cells and their progenitor cells.
Compositions comprising peripheral blood derived female germline
stem cells and their progenitor cells can be isolated and
subsequently purified to an extent where they become substantially
free of the biological sample from which they were obtained (e.g.
peripheral blood, including umbilical cord blood).
[0098] Peripheral blood derived female germline stem cell
progenitors can be obtained from peripheral blood female germline
stem cells by, for example, expansion in culture. Thus, the
progenitor cells can be cells having an "expansion phenotype."
II. Administration
[0099] Compositions comprising peripheral blood derived germline
stem cells or their progenitors can be provided directly to the
reproductive organ of interest (e.g., ovary or testes).
Alternatively, compositions comprising peripheral blood derived
germline stem cells or their progenitors can be provided indirectly
to the reproductive organ of interest, for example, by
administration into the circulatory system (e.g., to extra-ovarian
circulation). Following transplantation or implantation, the cells
can engraft and differentiate into germ cells (e.g., oocytes or
sperm cells). "Engraft" refers to the process of cellular contact
and incorporation into an existing tissue of interest (e.g., ovary)
in vivo. Expansion and differentiation agents can be provided prior
to, during or after administration to increase production of germ
cells in vivo.
[0100] Compositions of the invention include pharmaceutical
compositions comprising peripheral blood derived germline stem
cells or their progenitors and a pharmaceutically acceptable
carrier. Administration can be autologous or heterologous. For
example, peripheral blood derived germline stem cells, or
progenitors derived from peripheral blood derived germline stem
cells, can be obtained from one subject, and administered to the
same subject or a different, compatible subject.
[0101] Peripheral blood derived germline stem cells of the
invention or their progeny (e.g., in vivo, ex vivo or in vitro
derived) can be administered via localized injection, including
catheter administration, systemic injection, localized injection,
intravenous injection, intrauterine injection or parenteral
administration. When administering a therapeutic composition of the
present invention (e.g., a pharmaceutical composition), it will
generally be formulated in a unit dosage injectable form (solution,
suspension, emulsion).
[0102] Compositions of the invention can be conveniently provided
as sterile liquid preparations, e.g., isotonic aqueous solutions,
suspensions, emulsions, dispersions, or viscous compositions, which
may be buffered to a selected pH. Liquid preparations are normally
easier to prepare than gels, other viscous compositions, and solid
compositions. Additionally, liquid compositions are somewhat more
convenient to administer, especially by injection. Viscous
compositions, on the other hand, can be formulated within the
appropriate viscosity range to provide longer contact periods with
specific tissues. Liquid or viscous compositions can comprise
carriers, which can be a solvent or dispersing medium containing,
for example, water, saline, phosphate buffered saline, polyol (for
example, glycerol, propylene glycol, liquid polyethylene glycol,
and the like) and suitable mixtures thereof.
[0103] Sterile injectable solutions can be prepared by
incorporating the cells utilized in practicing the present
invention in the required amount of the appropriate solvent with
various amounts of the other ingredients, as desired. Such
compositions may be in admixture with a suitable carrier, diluent,
or excipient such as sterile water, physiological saline, glucose,
dextrose, or the like. The compositions can also be lyophilized.
The compositions can contain auxiliary substances such as wetting,
dispersing, or emulsifying agents (e.g., methylcellulose), pH
buffering agents, gelling or viscosity enhancing additives,
preservatives, flavoring agents, colors, and the like, depending
upon the route of administration and the preparation desired.
Standard texts, such as "REMINGTON'S PHARMACEUTICAL SCIENCE", 17th
edition, 1985, incorporated herein by reference, may be consulted
to prepare suitable preparations, without undue
experimentation.
[0104] Various additives which enhance the stability and sterility
of the compositions, including antimicrobial preservatives,
antioxidants, chelating agents, and buffers, can be added.
Prevention of the action of microorganisms can be ensured by
various antibacterial and antifungal agents, for example, parabens,
chlorobutanol, phenol, sorbic acid, and the like. Prolonged
absorption of the injectable pharmaceutical form can be brought
about by the use of agents delaying absorption, for example,
aluminum monostearate and gelatin. According to the present
invention, however, any vehicle, diluent, or additive used would
have to be compatible with the peripheral blood derived germline
stem cells or their progenitors.
[0105] The compositions can be isotonic, i.e., they can have the
same osmotic pressure as blood and lacrimal fluid. The desired
isotonicity of the compositions of this invention may be
accomplished using sodium chloride, or other pharmaceutically
acceptable agents such as dextrose, boric acid, sodium tartrate,
propylene glycol or other inorganic or organic solutes. Sodium
chloride is preferred particularly for buffers containing sodium
ions.
[0106] Viscosity of the compositions, if desired, can be maintained
at the selected level using a pharmaceutically acceptable
thickening agent. Methylcellulose is preferred because it is
readily and economically available and is easy to work with. Other
suitable thickening agents include, for example, xanthan gum,
carboxymethyl cellulose, hydroxypropyl cellulose, carbomer, and the
like. The preferred concentration of the thickener will depend upon
the agent selected. The important point is to use an amount that
will achieve the selected viscosity. Obviously, the choice of
suitable carriers and other additives will depend on the exact
route of administration and the nature of the particular dosage
form, e.g., liquid dosage form (e.g., whether the composition is to
be formulated into a solution, a suspension, gel or another liquid
form, such as a time release form or liquid-filled form).
[0107] A method to potentially increase cell survival when
introducing the cells into a subject in need thereof is to
incorporate peripheral blood derived germline stem cells or their
progeny (e.g., in vivo, ex vivo or in vitro derived) of interest
into a biopolymer or synthetic polymer. Depending on the subject's
condition, the site of injection might prove inhospitable for cell
seeding and growth because of scarring or other impediments.
Examples of biopolymer include, but are not limited to, cells mixed
with fibronectin, fibrin, fibrinogen, thrombin, collagen, and
proteoglycans. This could be constructed with or without included
expansion or differentiation factors. Additionally, these could be
in suspension, but residence time at sites subjected to flow would
be nominal. Another alternative is a three-dimensional gel with
cells entrapped within the interstices of the cell biopolymer
admixture. Again, expansion or differentiation factors could be
included with the cells. These could be deployed by injection via
various routes described herein.
[0108] Those skilled in the art will recognize that the components
of the compositions should be selected to be chemically inert and
will not affect the viability or efficacy of the peripheral blood
derived germline stem cells or their progenitors as described in
the present invention. This will present no problem to those
skilled in chemical and pharmaceutical principles, or problems can
be readily avoided by reference to standard texts or by simple
experiments (not involving undue experimentation), from this
disclosure and the documents cited herein.
[0109] One consideration concerning the therapeutic use of
peripheral blood derived germline stem cells of the invention is
the quantity of cells necessary to achieve an optimal effect. In
current human studies of autologous mononuclear peripheral blood
cells, empirical doses ranging from 1 to 4.times.10.sup.7 cells
have been used with encouraging results. However, different
scenarios may require optimization of the amount of cells injected
into a tissue of interest. Thus, the quantity of cells to be
administered will vary for the subject being treated. In a
preferred embodiment, between 10.sup.4 to 10.sup.8, more preferably
10.sup.5 to 10.sup.7, and still more preferably, 3.times.10.sup.7
stem cells of the invention can be administered to a human
subject.
[0110] Less cells can be administered directly to the ovary or
testes. Preferably, between 10.sup.2 to 10.sup.6, more preferably
10.sup.3 to 10.sup.5, and still more preferably, 10.sup.4
peripheral blood derived germline stem cells can be administered to
a human subject. However, the precise determination of what would
be considered an effective dose may be based on factors individual
to each patient, including their size, age, sex, weight, and
condition of the particular patient. As few as 100-1000 cells can
be administered for certain desired applications among selected
patients. Therefore, dosages can be readily ascertained by those
skilled in the art from this disclosure and the knowledge in the
art.
[0111] Peripheral blood derived germline stem cells of the
invention can comprise a purified population of female germline
stem cells. Those skilled in the art can readily determine the
percentage of female germline stem cells in a population using
various well-known methods, such as fluorescence activated cell
sorting (FACS). Preferable ranges of purity in populations
comprising female germline stem cells are about 50 to about 55%,
about 55 to about 60%, and about 65 to about 70%. More preferably
the purity is about 70 to about 75%, about 75 to about 80%, about
80 to about 85%; and still more preferably the purity is about 85
to about 90%, about 90 to about 95%, and about 95 to about 100%.
Purity of female germline stem cells can be determined according to
the genetic marker profile within a population. Dosages can be
readily adjusted by those skilled in the art (e.g., a decrease in
purity may require an increase in dosage).
[0112] The skilled artisan can readily determine the amount of
cells and optional additives, vehicles, and/or carrier in
compositions and to be administered in methods of the invention.
Typically, any additives (in addition to the active stem cell(s)
and/or agent(s)) are present in an amount of 0.001 to 50% (weight)
solution in phosphate buffered saline, and the active ingredient is
present in the order of micrograms to milligrams, such as about
0.0001 to about 5 wt %, preferably about 0.0001 to about 1 wt %,
still more preferably about 0.0001 to about 0.05 wt % or about
0.001 to about 20 wt %, preferably about 0.01 to about 10 wt %, and
still more preferably about 0.05 to about 5 wt %. Of course, for
any composition to be administered to an animal or human, and for
any particular method of administration, it is preferred to
determine therefore: toxicity, such as by determining the lethal
dose (LD) and LD.sub.50 in a suitable animal model e.g., rodent
such as mouse; and, the dosage of the composition(s), concentration
of components therein and timing of administering the
composition(s), which elicit a suitable response. Such
determinations do not require undue experimentation from the
knowledge of the skilled artisan, this disclosure and the documents
cited herein. And, the time for sequential administrations can be
ascertained without undue experimentation.
III. Oocyte Production
[0113] In one embodiment, the present invention provides a method
for oocyte production, comprising providing a peripheral blood
derived female germline stem cell, or its progenitor, to a female
subject, and more preferably to the ovary of said subject, wherein
the cell engrafts into the a tissue of the subject (e.g., ovary)
and differentiates into an oocyte.
[0114] Preferably, the engrafted cells undergo folliculogenesis,
wherein the cells differentiate into an oocyte within a follicle.
Folliculogenesis is a process in which an ovarian structure
consisting of a single oocyte is surrounded by somatic (granulosa
without or with theca-interstitial) cells. Somatic cells of the
gonad enclose individual oocytes to form follicles. Each fully
formed follicle is enveloped in a complete basement membrane.
Although some of these newly formed follicles start to grow almost
immediately, most of them remain in the resting stage until they
either degenerate or some signal(s) activate(s) them to enter the
growth phase. A method of the invention can induce ovarian
folliculogenesis by providing a peripheral blood derived female
germline stem cell, or its progenitor, to the ovary by any one of
several routes of administration. The peripheral blood derived
female germline stem cell, or its progenitor, can engraft into the
ovary and differentiate into an oocyte within a follicle of the
ovary.
[0115] The number of peripheral blood derived female germline stem
cells, or their progenitor cells can be increased by increasing the
survival or proliferation of existing peripheral blood derived
female germline stem cells, or their progenitor cells.
[0116] Agents (e.g., expansion agents) which increase proliferation
or survival of peripheral blood derived female germline stem cells,
or progenitors derived from peripheral blood derived female
germline stem cells, include, but are not limited to, a hormone or
growth factor (e.g., a IGF, TGF, BMP, Wnt protein or FGF), a
cell-signaling molecule (e.g., S1P or RA), or a pharmacological or
pharmaceutical compound (e.g., an inhibitor of GSK-3, an inhibitor
of apoptosis such as a Bax inhibitor or caspase inhibitor, an
inhibitor of nitric oxide production, or an inhibitor of HDAC
activity).
[0117] Agents comprising growth factors are known in the art to
increase proliferation or survival of stem cells. For example, U.S.
Pat. Nos. 5,750,376 and 5,851,832 describe methods for the in vitro
culture and proliferation of neural stem cells using TGF. An active
role in the expansion and proliferaion of stem cells has also been
described for BMPs (Zhu, G. et al, (1999) Dev. Biol. 215: 118-29
and Kawase, E. et al, (2001) Development 131: 1365) and Wnt
proteins (Pazianos, G. et al, (2003) Biotechniques 35: 1240 and
Constantinescu, S. (2003) J. Cell Mol. Med. 7: 103). U.S. Pat. Nos.
5,453,357 and 5,851,832 describe proliferative stem cell culture
systems that utilize FGFs. The contents of each of these references
are specifically incorporated herein by reference for their
description of expansion agents known in the art.
[0118] Agents comprising growth factors are also known in the art
to increase mobilization of stem cells from the bone marrow or
ovary into the peripheral blood. Mobilizing agents include but are
not limited to GCSF or GMCSF. An agent that increases mobilization
of stem cells into the blood can be provided before peripheral
blood harvest or alternatively, to augment or supplement other
methods of the invention where it would be desirable to increase
circulating levels of female germline stem cells (e.g., to increase
targeting of the cells to the ovary).
[0119] Agents comprising cell-signaling molecules are also known in
the art to increase proliferation or survival of stem cells. For
example, Sphingosine-1-phosphate is known to induce proliferation
of neural progenitor cells (Harada, J. et al, (2004) J. Neurochem.
88: 1026). U.S. Patent Application No. 20030113913 describes the
use of retinoic acid in stem cell self renewal in culture. The
contents of each of these references are specifically incorporated
herein by reference for their description of expansion agents known
in the art.
[0120] Agents comprising pharmacological or pharmaceutical
compounds are also known in the art to increase production or
survival of stem cells. For example, inhibitors of glycogen
synthase kinase maintain pluripotency of embryonic stem cells
through activation of Wnt signaling (Sato, N. et al, (2004) Nat.
Med. 10: 55). Inhibitors of apoptosis (Wang, Y. et al, (2004) Mol.
Cell. Endocrinol. 218: 165), inhibitors of nitric oxide/nitric
oxide synthase (Matarredona, E. R. et al, (2004) Brain Res. 995:
274) and inhibitors of histone deacetylases (Lee, J. H. et al,
(2004) Genesis 38: 32) are also known to increase proliferation
and/or pluripotency. For example, the peptide humanin is an
inhibitor of Bax function that suppresses apoptosis (Guo, B. et al,
(2003) Nature 423: 456). The contents of each of these references
are specifically incorporated herein by reference for their
description of expansion agents known in the art.
[0121] Oocyte production can be further increased by contacting
compositions comprising peripheral blood derived female germline
stem cells, or progenitors derived from peripheral blood derived
female germline stem cells, with an agent that differentiates
peripheral blood derived female germline stem cells or their
progenitors into oocytes (e.g., differentiation agents). Such
differentiation agents include, but are not limited to, a hormone
or growth factor (e.g., TGF, BMP, Wnt protein, SCF or LIF), a
signaling molecule (e.g., meiosis-activating sterol, "FF-MAS"), or
a pharmacologic or pharmaceutical agent (e.g., a modulator of Id
protein function or Snail/Slug transcription factor function).
[0122] Agents comprising growth factors are known in the art to
differentiate stem cells. For example, TGF-.beta. can induce
differentiation of hematopoietic stem cells (Ruscetti, F. W. et al,
(2001) Int. J. Hematol. 74: 18). U.S. Patent Application No.
2002142457 describes methods for differentiation of cardiomyocytes
using BMPs. Pera et al describe human embryonic stem cell
differentiation using BMP-2 (Pera, M. F. et al, (2004) J. Cell Sci.
117: 1269). U.S. Patent Application No. 20040014210 and U.S. Pat.
No. 6,485,972 describe methods of using Wnt proteins to induce
differentiation. U.S. Pat. No. 6,586,243 describes differentiation
of dendritic cells in the presence of SCF. U.S. Pat. No. 6,395,546
describes methods for generating dopaminergic neurons in vitro from
embryonic and adult central nervous system cells using LIF. The
contents of each of these references are specifically incorporated
herein by reference for their description of differentiation agents
known in the art.
[0123] Agents comprising signaling molecules are also known to
induce differentiation of oocytes. FF-Mas is known to promote
oocyte maturation (Marin Bivens, C. L. et al, (2004) BOR papers in
press). The contents of each of these references are specifically
incorporated herein by reference for their description of
differentiation agents known in the art.
[0124] Agents comprising pharmacological or pharmaceutical
compounds are also known in the art to induce differentiation of
stem cells. For example, modulators of Id are involved in
hematopoietic differentiation (Nogueria, M. M. et al, (2000) 276:
803) and Modulators of Snail/Slug are known to induce stem cell
differentiation (Le Douarin, N. M. et al, (1994) Curr. Opin. Genet.
Dev. 4: 685-695; Plescia, C. et al, (2001) Differentiation 68:
254). The contents of each of these references are specifically
incorporated herein by reference for their description of
differentiation agents known in the art.
[0125] The present invention also provides methods for reducing
peripheral blood derived female germline stem cells, or their
progenitor cells, in vivo, ex vivo or in vitro, comprising
contacting peripheral blood derived female germline stem cells or
their progenitor cells with an agent that reduces cell
proliferation, inhibits cell survival or promotes cell death.
Unwanted proliferation of the cells of the invention can give rise
to cancerous and pre-cancerous phenotypes (e.g., germ cell tumors,
ovarian cancer, testicular cancer). Such methods can be used to
control unwanted proliferation (e.g., cancer) or for contraceptive
measures by reducing the numbers of germline stem cells, and
optionally their progenitors or oocytes.
[0126] Agents that reduce cell proliferation include, but are not
limited to, a hormone or growth factor (e.g., TGF-.beta.), a
peptide antagonist of mitogenic hormones or growth factors (e.g.,
the BMP antagonists, PRDC and Gremlin), or a pharmacological or
pharmaceutical compound (e.g., a cell cycle inhibitor, or an
inhibitor of growth factor signaling).
[0127] Agents that inhibit cell survival include, but are not
limited to, a hormone, growth factor or cytokine (e.g., a
pro-apoptotic TNF super family member such as TNF-.alpha., FasL and
TRAIL), an antagonist of pro-survival Bcl-2 family member function,
a signaling molecule (e.g., a ceramide), or a pharmacological or
pharmaceutical compound (e.g., an inhibitor of growth factor
signaling). Pro-survival Bcl-2 family members include Bcl-2, Bcl-x1
(Cory, S. and Adams, J. M. (2000) Nat Rev Cancer 2(9):647-656;
Lutz, R. J. (2000) Cell Survival Apoptosis 28:51-56), Bcl-W
(Gibson, L., et al. (1996) Oncogene 13, 665-675; Cory, S. and
Adams, J. M. (2000) Nat Rev Cancer 2(9):647-656), Mcl-1 (Kozopas,
K. M., et al. (1993) Proc. Natl. Acad. Sci. U.S.A. 90:3516-3520;
Reynolds, J. E., et al. (1994) Cancer Res. 54:6348-6352; Cory, S.
and Adams, J. M. (2000) Nat Rev Cancer 2(9):647-656) and A1 (Cory,
S. and Adams, J. M. (2000) Nat Rev Cancer 2(9):647-656; Gonzales,
J., et al. (2003) Blood 101(7):2679-2685; Reed, J. C. (1997) Nature
387:773-776).
[0128] Agents that promote cell death include, but are not limited
to, a pro-apoptotic tumor necrosis factor superfamily member (e.g.,
TNF-.alpha., FasL and TRAIL), agonist of pro-apoptotic Bcl-2 family
member function and ceramide. Pro-apoptotic Bcl-2 family members
include Bax (Oltvai, Z N, et al. (1993): Cell 74: 609-619), Bak
(Chittenden, T, et al. (1995) Nature 374:733-736), Bid (Luo, X., et
al. (1998) Cell 94:481-490), Hrk (Inohara, N. et al. (1997) EMBO J
16(7):1686-1694), Bod (Hsu, et al. (1998) Mol Endocrinol.
12(9):1432-1440), Bim (O'Connor, L., et al. (1998) EMBO J.
17(2):385-395), Noxa (Oda, E., et al. (2000) Science 288,
1053-1058; Yakovlev, A. G., et al. (2004) J Biol Chem
279(27):28367-28374), puma (Nakano, K. and Vousden, K. H. (2001)
Mol Cell 7(3):683-694), Bok (Yakovlev, A. G., et al. (2004) J Biol
Chem 279(27):28367-28374; Hsu, S Y, et al. (1997) Proc Natl Acad
Sci USA. 94(23):12401-6) and Bcl-xs (Boise, L. H., et al. (1993)
Cell 74:597-608).
[0129] Several agents are known in the art to inhibit cell
proliferation or survival or promote cell death, including PRDC
(Sudo et al, (2004) J. Biol. Chem., advanced publication), TNF
(Wong, G. et al, (2004) Exp. Neurol. 187: 171), FasL (Sakata, S. et
al, (2003) Cell Death Differ. 10: 676) and TRAIL (Pitti, R M, et
al. (1996) J Biol Chem 271: 12687-12690; Wiley, S R, et al. (1995)
Immunity 3: 673-682). Ceramide mediates the action of tumor
necrosis factor on primitive human hematopoietic cells
(Maguer-Satta, V. et al, (2000) Blood 96: 4118-23).
Agonist/antagonist of Bcl-2 family members, such as Bcl-2, Bcl-XL,
Bcl-W, Mcl-1, A1, Bax, Bak, Bid, Hrk, Bod, Bim, Noxa, Puma, Bok and
Bcl-xs, are known to inhibit stem cell survival (Lindsten, T. et
al, (2003) J. Neurosci. 23: 11112-9). Agents comprising
pharmacological or pharmaceutical compounds are also known in the
art to inhibit cell survival. For example, inhibitors of growth
factor signaling, such as QSulf1, a heparan sulfate
6-O-endosulfatase that inhibits fibroblast growth factor signaling,
can inhibit stem cell survival (Wang, S. et al, (2004) Proc. Natl.
Acad. Sci. USA 101: 4833). The contents of each of these references
are specifically incorporated herein by reference for their
description of agents known in the art to inhibit cell
survival.
[0130] Agents can be provided directly to the reproductive organ of
interest. Alternatively, agents can be provided indirectly to the
reproductive organ of interest, for example, by administration into
the circulatory system.
[0131] Agents can be administered to subjects in need thereof by a
variety of administration routes. Methods of administration,
generally speaking, may be practiced using any mode of
administration that is medically acceptable, meaning any mode that
produces effective levels of the active compounds without causing
clinically unacceptable adverse effects. Such modes of
administration include oral, rectal, topical, intraocular, buccal,
intravaginal, intracisternal, intracerebroventricular,
intratracheal, nasal, transdermal, within/on implants, e.g., fibers
such as collagen, osmotic pumps, or grafts comprising appropriately
transformed cells, etc., or parenteral routes. The term
"parenteral" includes subcutaneous, intravenous, intramuscular,
intraperitoneal, intragonadal or infusion. Intravenous or
intramuscular routes are not particularly suitable for long-term
therapy and prophylaxis. A particular method of administration
involves coating, embedding or derivatizing fibers, such as
collagen fibers, protein polymers, etc. with therapeutic proteins.
Other useful approaches are described in Otto, D. et al., J.
Neurosci. Res. 22: 83 and in Otto, D. and Unsicker, K. J. Neurosci.
10: 1912.
[0132] In vitro and ex vivo applications can involve culture of the
peripheral blood derived female germline stem cells or their
progenitors with the selected agent to achieve the desired result.
Cultures of cells (from the same individual and from different
individuals) can be treated with differentiation agents of interest
to stimulate the production of oocytes, which can then be used for
a variety of therapeutic applications (e.g., in vitro
fertilization, implantation).
[0133] Differentiated cells derived from cultures of the invention
can be implanted into a host. The transplantation can be
autologous, such that the donor of the stem cells from which organ
or organ units are derived is the recipient of the engineered
tissue. The transplantation can be heterologous, such that the
donor of the stem cells from which organ or organ units are derived
is not that of the recipient of the engineered-tissue. Once
transferred into a host, the differentiated cells the function and
architecture of the native host tissue.
[0134] Peripheral blood derived germline stem cells and the progeny
thereof can be cultured, treated with agents and/or administered in
the presence of polymer scaffolds. Polymer scaffolds are designed
to optimize gas, nutrient, and waste exchange by diffusion. Polymer
scaffolds can comprise, for example, a porous, non-woven array of
fibers. The polymer scaffold can be shaped to maximize surface
area, to allow adequate diffusion of nutrients and growth factors
to the cells. Taking these parameters into consideration, one of
skill in the art could configure a polymer scaffold having
sufficient surface area for the cells to be nourished by diffusion
until new blood vessels interdigitate the implanted
engineered-tissue using methods known in the art. Polymer scaffolds
can comprise a fibrillar structure. The fibers can be round,
scalloped, flattened, star-shaped, solitary or entwined with other
fibers. Branching fibers can be used, increasing surface area
proportionately to volume.
[0135] Unless otherwise specified, the term "polymer" includes
polymers and monomers that can be polymerized or adhered to form an
integral unit. The polymer can be non-biodegradable or
biodegradable, typically via hydrolysis or enzymatic cleavage. The
term "biodegradable" refers to materials that are bioresorbable
and/or degrade and/or break down by mechanical degradation upon
interaction with a physiological environment into components that
are metabolizable or excretable, over a period of time from minutes
to three years, preferably less than one year, while maintaining
the requisite structural integrity. As used in reference to
polymers, the term "degrade" refers to cleavage of the polymer
chain, such that the molecular weight stays approximately constant
at the oligomer level and particles of polymer remain following
degradation.
[0136] Materials suitable for polymer scaffold fabrication include
polylactic acid (PLA), poly-L-lactic acid (PLLA), poly-D-lactic
acid (PDLA), polyglycolide, polyglycolic acid (PGA),
polylactide-co-glycolide (PLGA), polydioxanone, polygluconate,
polylactic acid-polyethylene oxide copolymers, modified cellulose,
collagen, polyhydroxybutyrate, polyhydroxpriopionic acid,
polyphosphoester, poly(alpha-hydroxy acid), polycaprolactone,
polycarbonates, polyamides, polyanhydrides, polyamino acids,
polyorthoesters, polyacetals, polycyanoacrylates, degradable
urethanes, aliphatic polyester polyacrylates, polymethacrylate,
acyl substituted cellulose acetates, non-degradable polyurethanes,
polystyrenes, polyvinyl chloride, polyvinyl flouride, polyvinyl
imidazole, chlorosulphonated polyolifins, polyethylene oxide,
polyvinyl alcohol, Teflon.RTM., nylon silicon, and shape memory
materials, such as poly(styrene-block-butadiene), polynorbornene,
hydrogels, metallic alloys, and oligo(.epsilon.-caprolactone)diol
as switching segment/oligo(p-dioxyanone)diol as physical crosslink.
Other suitable polymers can be obtained by reference to The Polymer
Handbook, 3rd edition (Wiley, N.Y., 1989).
[0137] Factors, including but not limited to nutrients, growth
factors, inducers of differentiation or de-differentiation,
products of secretion, immunomodulators, inhibitors of
inflammation, regression factors, hormones, or other biologically
active compounds can be incorporated into or can be provided in
conjunction with the polymer scaffold.
[0138] Agents of the invention may be supplied along with
additional reagents in a kit. The kits can include instructions for
the treatment regime or assay, reagents, equipment (test tubes,
reaction vessels, needles, syringes, etc.) and standards for
calibrating or conducting the treatment or assay. The instructions
provided in a kit according to the invention may be directed to
suitable operational parameters in the form of a label or a
separate insert. Optionally, the kit may further comprise a
standard or control information so that the test sample can be
compared with the control information standard to determine if
whether a consistent result is achieved.
IV. Spermatogenesis
[0139] Methods of the present invention can be used in the
production of other reproductive cell types. Accordingly, in one
embodiment, the present invention provides a method for restoring
or enhancing spermatogenesis, comprising providing a peripheral
blood derived male germline stem cell, or its progenitor, to the
testes of a male subject, wherein the cell engrafts into the
seminiferous epithelium and differentiates into a sperm cell.
Administration of a peripheral blood derived male germline stem
cell, or its progenitor, to the testes is preferably carried out by
testicular injection. Direct injection into the testes
advantageously circumvents the blood barrier, and provides cells to
suitable locations, such as the seminiferous epithelium.
[0140] Spermatogenesis can be further increased by contacting
compositions comprising peripheral blood derived male germline stem
cells, or progenitors derived from peripheral blood derived male
germline stem cells, with an agent that increases the
differentiation of peripheral blood derived male germline stem
cells or their progenitors into oocytes (e.g., differentiation
agents). Such differentiation agents can be, but are not limited
to, those described herein.
[0141] Spermatogenesis, or the formation of spermatocytes from
spermatogonia, can be regulated by numerous factors. Regulators of
apoptosis, including Bax, Bcl.sub.XL family members, and caspase
family members, can modulate spermatogenesis and affect male
fertility (Said, T. M., et al. (2004) Hum. Reprod. Update 10:
39-51; Yan, W. et al, (2003) Mol. Endocrinol. 17: 1868). Caspases
have been implicated in the pathogenesis of multiple andrological
pathologies, such as, inter alia, impaired spermatogenesis,
decreased sperm motility, and increased levels of sperm DNA
fragmentation. Caspase inhibitors, such as survivin and FLIP, can
be used to regulate apoptotic events during spermatogenesis
(Weikert S., (2004) Int. J. Androl. 27: 161; Giampietri, C. et al,
(2003) Cell Death Differ. 10: 175). Similarly, Bax inhibitors such
as humanin, are also implicated in spermatogenic apoptosis (Guo, B.
et al., (2003) Nature 423: 456).
[0142] Growth factors, such as fibroblast growth factor-4 (Hirai,
K. et al, (2004) Exp. Cell Res. 294: 77) can also influence
spermatogenesis. FGF-4 can play a critical role as a survival
factor for germ cells by protecting them from apoptosis. Upon FGF-4
stimulation in Sertoli cells, lactate production was induced, which
is indispensable for germ cell survival. FGF-4 stimulation can also
reduce DNA fragmentation in Sertoli cells.
[0143] Bone morphogenetic protein (BMP) signaling pathways have
also been implicated in maintenance of germline stem cells in
Drosophila (Kawase, E. et al, (2004) Development 131: 1365-75;
Pellegrini, M. et al, (2003) J. Cell Sci. 116: 3363). BMP4
stimulation of cultured spermatogonia can induce Smad-mediated
proliferation, as well as differentiation through the c-kit gene.
Additionally, BMP signals from somatic cells were shown to be
essential for maintaining germline stem cells through repression of
the bam expression, indicating that Bmp signals from the somatic
cells maintain germline stem cells at least in part, by repressing
bam expression in the testis.
[0144] Transforming growth factor (TGF) can also repress bam
expression in testis. Maintenance and proliferation of germline
stem cells and their progeny depends upon the ability of these
cells to transduce the activity of a somatically expressed
TGF-.beta. ligand, known in Drosophila as the BMP5/8 ortholog Glass
Bottom Boat (Shivdasani, A. A. and Ingham, P. W. (2003) Curr. Biol.
13: 2065). TGF-.beta. signaling represses the expression of bam,
which is necessary and sufficient for germ cell differentiation,
thereby maintaining germline stem cells and spermatogonia in their
proliferative state.
[0145] Sphingosine-1-phosphate (S1P) is also known to affect the
survival and proliferation of germline stem cells and
spermatogonia. In a study where irradiated testicular tissue was
treated with S1P, the numbers of primary spermatocytes and
spermatogonia were higher than untreated tissues, indicating that
S1p treatment can protect germline stem cells against cell death
induced by radiation.
[0146] Glial-derived neurotrophic factor was found to markedly
amplify germline stem cells in murine testis (Kubota, H. et al,
(2004) Biol. Reprod. April 28 Epub ahead of print). Transplantation
analysis demonstrated not only germline stem cells enrichment, but
also differentiation from stem cells into sperm (Yomogida, K. et
al, (2003) Biol. Reprod. 69: 1303).
[0147] The present invention also provides methods for reducing
peripheral blood derived male germline stem cells, or their
progenitor cells, in vivo, ex vivo or in vitro, comprising
contacting peripheral blood derived male germline stem cells or
their progenitor cells with an agent that reduces cell
proliferation, inhibits cell survival or promotes cell death.
Unwanted proliferation of the cells of the invention can give rise
to cancerous and pre-cancerous phenotypes (e.g., germ cell tumors).
Such methods can be used to control unwanted proliferation (e.g.,
cancer) or for contraceptive measures by reducing the numbers of
germline stem cells, and optionally their progenitors or sperm
cells.
[0148] Agents that reduce cell proliferation include, but are not
limited to, a hormone or growth factor (e.g., TGF-.beta.), a
peptide antagonist of mitogenic hormones or growth factors (e.g.,
the BMP antagonists, PRDC and Gremlin), or a pharmacological or
pharmaceutical compound (e.g., a cell cycle inhibitor, or an
inhibitor of growth factor signaling).
[0149] Agents that inhibit cell survival include, but are not
limited to, a hormone, growth factor or cytokine (e.g., a
pro-apoptotic TNF super family member such as TNF-.alpha., FasL and
TRAIL), an antagonist of pro-survival Bcl-2 family member function,
a signaling molecule (e.g., a ceramide), or a pharmacological or
pharmaceutical compound (e.g., an inhibitor of growth factor
signaling).
[0150] Agents that promote cell death include, but are not limited
to, a pro-apoptotic tumor necrosis factor superfamily member (e.g.,
TNF-.alpha., FasL and TRAIL), agonist of pro-apoptotic Bcl-2 family
member function and ceramide.
V. Screening Assays
[0151] The invention provides methods for identifying modulators,
i.e., candidate or test compounds or agents (e.g., proteins,
peptides, peptidomimetics, peptoids, small molecules or other
drugs) which modulate peripheral blood derived germline stem cells
or the progenitors thereof. Agents thus identified can be used to
modulate, for example, proliferation, survival and differentiation
of a peripheral blood derived germline stem cell or its progenitor
e.g., in a therapeutic protocol.
[0152] The test agents of the present invention can be obtained
singly or using any of the numerous approaches in combinatorial
library methods known in the art, including: biological libraries;
peptoid libraries (libraries of molecules having the
functionalities of peptides, but with a novel, non-peptide backbone
which are resistant to enzymatic degradation but which nevertheless
remain bioactive; see, e.g., Zuckermann, R. N. (1994) et al., J.
Med. Chem. 37:2678-85); spatially addressable parallel solid phase
or solution phase libraries; synthetic library methods requiring
deconvolution; the `one-bead one-compound` library method; and
synthetic library methods using affinity chromatography selection.
The biological library and peptoid library approaches are limited
to peptide libraries, while the other four approaches are
applicable to peptide, non-peptide oligomer or small molecule
libraries of compounds (Lam (1997) Anticancer Drug Des.
12:145).
[0153] Examples of methods for the synthesis of molecular libraries
can be found in the art, for example in: DeWitt et al. (1993) Proc.
Natl. Acad. Sci. U.S.A. 90:6909; Erb et al. (1994) Proc. Natl.
Acad. Sci. USA 91:11422; Zuckermann et al. (1994) J. Med. Chem.
37:2678; Cho et al. (1993) Science 261:1303; Carrell et al. (1994)
Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al (1994) Angew.
Chem. Int. Ed. Engl. 33:2061; and Gallop et al. (1994) J. Med.
Chem. 37:1233.
[0154] Libraries of compounds may be presented in solution (e.g.,
Houghten (1992), Biotechniques 13:412-421), or on beads (Lam
(1991), Nature 354:82-84), chips (Fodor (1993) Nature 364:555-556),
bacteria (Ladner, U.S. Pat. No. 5,223,409), spores (Ladner U.S.
Pat. No. 5,223,409), plasmids (Cull et al. (1992) Proc Natl Acad
Sci USA 89:1865-1869) or on phage (Scott and Smith (1990) Science
249:386-390; Devlin (1990) Science 249:404-406; Cwirla et al.
(1990) Proc. Natl. Acad. Sci. 87:6378-6382; Felici (1991) J. Mol.
Biol. 222:301-310; Ladner supra.).
[0155] Chemical compounds to be used as test agents (i.e.,
potential inhibitor, antagonist, agonist) can be obtained from
commercial sources or can be synthesized from readily available
starting materials using standard synthetic techniques and
methodologies known to those of ordinary skill in the art.
Synthetic chemistry transformations and protecting group
methodologies (protection and deprotection) useful in synthesizing
the compounds identified by the methods described herein are known
in the art and include, for example, those such as described in R.
Larock (1989) Comprehensive Organic Transformations, VCH
Publishers; T. W. Greene and P. G. M. Wuts, Protective Groups in
Organic Synthesis, 2nd ed., John Wiley and Sons (1991); L. Fieser
and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis,
John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of
Reagents for Organic Synthesis, John Wiley and Sons (1995), and
subsequent editions thereof.
[0156] In one aspect the compounds are organic small molecules,
that is, compounds having molecular weight less than 1,000 amu,
alternatively between 350-750 amu. In other aspects, the compounds
are: (i) those that are non-peptidic; (ii) those having between 1
and 5, inclusive, heterocyclyl, or heteroaryl ring groups, which
may bear further substituents; (iii) those in their respective
pharmaceutically acceptable salt forms; or (iv) those that are
peptidic.
[0157] The term "heterocyclyl" refers to a nonaromatic 3-8 membered
monocyclic, 8-12 membered bicyclic, or 11-14 membered tricyclic
ring system having 1-3 heteroatoms if monocyclic, 1-6 heteroatoms
if bicyclic, or 1-9 heteroatoms if tricyclic, said heteroatoms
selected from O, N, or S (e.g., carbon atoms and 1-3, 1-6, or 1-9
heteroatoms of N, O, or S if monocyclic, bicyclic, or tricyclic,
respectively), wherein 0, 1, 2 or 3 atoms of each ring can be
substituted by a substituent.
[0158] The term "heteroaryl" refers to an aromatic 5-8 membered
monocyclic, 8-12 membered bicyclic, or 11-14 membered tricyclic
ring system having 1-3 heteroatoms if monocyclic, 1-6 heteroatoms
if bicyclic, or 1-9 heteroatoms if tricyclic, said heteroatoms
selected from O, N, or S (e.g., carbon atoms and 1-3, 1-6, or 1-9
heteroatoms of N, O, or S if monocyclic, bicyclic, or tricyclic,
respectively), wherein 0, 1, 2, 3, or 4 atoms of each ring can be
substituted by a substituent.
[0159] The term "substituents" refers to a group "substituted" on
an alkyl, cycloalkyl, aryl, heterocyclyl, or heteroaryl group at
any atom of that group. Suitable substituents include, without
limitation, alkyl, alkenyl, alkynyl, alkoxy, halo, hydroxy, cyano,
nitro, amino, SO.sub.3H, perfluoroalkyl, perfluoroalkoxy,
methylenedioxy, ethylenedioxy, carboxyl, oxo, thioxo, imino (alkyl,
aryl, aralkyl), S(O).sub.nalkyl (where n is 0-2), S(O).sub.n aryl
(where n is 0-2), S(O).sub.n heteroaryl (where n is 0-2),
S(O).sub.n heterocyclyl (where n is 0-2), amine (mono-, di-, alkyl,
cycloalkyl, aralkyl, heteroaralkyl, and combinations thereof),
ester (alkyl, aralkyl, heteroaralkyl), amide (mono-, di-, alkyl,
aralkyl, heteroaralkyl, and combinations thereof), sulfonamide
(mono-, di-, alkyl, aralkyl, heteroaralkyl, and combinations
thereof), unsubstituted aryl, unsubstituted heteroaryl,
unsubstituted heterocyclyl, and unsubstituted cycloalkyl. In one
aspect, the substituents on a group are independently any one
single, or any subset of the aforementioned substituents.
[0160] Combinations of substituents and variables in compounds
envisioned by this invention are only those that result in the
formation of stable compounds. The term "stable", as used herein,
refers to compounds which possess stability sufficient to allow
manufacture and which maintains the integrity of the compound for a
sufficient period of time to be useful for the purposes detailed
herein (e.g., transport, storage, assaying, therapeutic
administration to a subject).
[0161] The compounds described herein can contain one or more
asymmetric centers and thus occur as racemates and racemic
mixtures, single enantiomers, individual diastereomers and
diastereomeric mixtures. All such isomeric forms of these compounds
are expressly included in the present invention. The compounds
described herein can also be represented in multiple tautomeric
forms, all of which are included herein. The compounds can also
occur in cis- or trans- or E- or Z-double bond isomeric forms. All
such isomeric forms of such compounds are expressly included in the
present invention.
[0162] Test agents of the invention can also be peptides (e.g.,
growth factors, cytokines, receptor ligants).
[0163] Screening methods of the invention can involve the
identification of an agent that increases the proliferation or
survival of peripheral blood derived germline stem cells or the
progenitors thereof. Such methods will typically involve contacting
a population of the germline stem or progenitor cells with a test
agent in culture and quantitating the number of new stem or
progenitor cells produced as a result. Comparison to an untreated
control can be concurrently assessed. Where an increase in the
number of stem or progenitor cells is detected relative to the
control, the test agent is determined to have the desired
activity.
[0164] In practicing the methods of the invention, it may be
desirable to employ a purified population of peripheral blood
derived germline stem cells or the progenitors thereof. A purified
population of peripheral blood derived germline stem cells or the
progenitors thereof have about 50-55%, 55-60%, 60-65% and 65-70%
purity. More preferably the purity is about 70-75%, 75-80%, 80-85%;
and still more preferably the purity is about 85-90%, 90-95%, and
95-100%.
[0165] Increased amounts of peripheral blood derived germline stem
cells or the progenitors thereof can also be detected by an
increase in gene expression of genetic markers including an Dazl,
Stella and Vasa. The level of expression can be measured in a
number of ways, including, but not limited to: measuring the mRNA
encoded by the genetic markers; measuring the amount of protein
encoded by the genetic markers; or measuring the activity of the
protein encoded by the genetic markers.
[0166] The level of mRNA corresponding to a genetic marker can be
determined both by in situ and by in vitro formats. The isolated
mRNA can be used in hybridization or amplification assays that
include, but are not limited to, Southern or Northern analyses,
polymerase chain reaction analyses and probe arrays. One diagnostic
method for the detection of mRNA levels involves contacting the
isolated mRNA with a nucleic acid molecule (probe) that can
hybridize to the mRNA encoded by the gene being detected. The
nucleic acid probe is sufficient to specifically hybridize under
stringent conditions to mRNA or genomic DNA. The probe can be
disposed on an address of an array, e.g., an array described below.
Other suitable probes for use in the diagnostic assays are
described herein.
[0167] In one format, mRNA (or cDNA) is immobilized on a surface
and contacted with the probes, for example by running the isolated
mRNA on an agarose gel and transferring the mRNA from the gel to a
membrane, such as nitrocellulose. In an alternative format, the
probes are immobilized on a surface and the mRNA (or cDNA) is
contacted with the probes, for example, in a two-dimensional gene
chip array described below. A skilled artisan can adapt known mRNA
detection methods for use in detecting the level of mRNA encoded by
the genetic markers described herein.
[0168] The level of mRNA in a sample can be evaluated with nucleic
acid amplification, e.g., by rtPCR (Mullis (1987) U.S. Pat. No.
4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad.
Sci. USA 88:189-193), self sustained sequence replication (Guatelli
et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878),
transcriptional amplification system (Kwoh et al. (1989) Proc.
Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi et
al. (1988) Bio/Technology 6:1197), rolling circle replication
(Lizardi et al., U.S. Pat. No. 5,854,033) or any other nucleic acid
amplification method, followed by the detection of the amplified
molecules using techniques known in the art. As used herein,
amplification primers are defined as being a pair of nucleic acid
molecules that can anneal to 5' or 3' regions of a gene (plus and
minus strands, respectively, or vice-versa) and contain a short
region in between. In general, amplification primers are from about
10 to 30 nucleotides in length and flank a region from about 50 to
200 nucleotides in length. Under appropriate conditions and with
appropriate reagents, such primers permit the amplification of a
nucleic acid molecule comprising the nucleotide sequence flanked by
the primers.
[0169] For in situ methods, a cell or tissue sample can be
prepared/processed and immobilized on a support, typically a glass
slide, and then contacted with a probe that can hybridize to mRNA
that encodes the genetic marker being analyzed.
[0170] Screening methods of the invention can involve the
identification of an agent that increases the differentiation of
peripheral blood derived germline stem cells or the progenitors
thereof into oocytes. Such methods will typically involve
contacting the germline stem or progenitor cells with a test agent
in culture and quantitating the number of new oocytes produced as a
result. Comparison to an untreated control can be concurrently
assessed. Where an increase in the number of oocytes is detected
relative to the control, the test agent is determined to have the
desired activity. The test agent can also be assayed using a
biological sample (e.g., ovarian tissue); subsequent testing using
a population of stem or progenitor cells may be conducted to
distinguish the functional activity of the agent (e.g.,
differentiation rather then increase in proliferation or survival)
where the result is ambiguous.
[0171] Increased amounts of oocytes be detected by a decrease in
gene expression of stem or progenitor genetic markers including an
Dazl, Stella and Vasa or an increase in oocyte markers, such as
HDAC6, GDF9 and ZP3.
[0172] Screening methods of the invention can involve the
identification of an agent that decreases the proliferation or
survival of peripheral blood derived germline stem cells or the
progenitors thereof. Such methods will typically involve contacting
a population of the stem or progenitor cells, or a biological
sample (e.g., ovarian tissue) with a test agent in culture and
quantitating the number of stem or progenitor cells lost as a
result. Comparison to an untreated control can be concurrently
assessed. Where a decrease in the number of stem or progenitor
cells is detected relative to the control, the test agent is
determined to have the desired activity.
VI. Methods of Treatment and Diagnosis
[0173] Peripheral blood derived germline stem cells of the
invention or their progenitors can be used in a variety of
therapeutic applications (e.g., oocyte generation for in vivo
restoration or ex vivo procedures including in vitro fertilization
and somatic cell nuclear transfer). Accordingly, methods of the
invention relate to, among other things, the use of peripheral
blood derived germline stem cells, or their progenitor cells, to
provide germ cells in the treatment of reproductive disorders.
[0174] Thus, the present invention provides methods for treating
infertility comprising providing a peripheral blood derived female
germline stem cell, or its progenitor, to a female subject in need
thereof, wherein the cell engrafts into a tissue and differentiates
into an oocyte, which can later be provided for fertilization
(e.g., following ovulation or in vitro fertilization in the
subject). Preferably, the tissue is ovarian tissue, however, other
tissues in the body may host the engrafted cell that in turn
generates an oocyte. Oocytes harbored in extra-ovarian tissues can
be harvested and used for procedures including in vitro
fertilization.
[0175] The present invention also provides methods for treating
infertility comprising administering an agent that increases the
production or survival of peripheral blood derived female germline
stem cells or their progenitors. Such agents may also promote cell
proliferation or survival, thereby enhancing oocyte production.
[0176] Agents can be provided directly to the reproductive organ of
interest. Alternatively, agents can be provided indirectly to the
reproductive organ of interest, for example, by administration into
the circulatory system.
[0177] The present invention also provides methods for repairing
damaged ovarian tissue, comprising providing a peripheral blood
derived female germline stem cell, or its progenitor, to the
ovarian tissue, wherein the cell engrafts into the ovarian tissue
and differentiates into an oocyte. Except where expressly stated
herein, the ovarian tissue was not damaged by chemotherapy or
radiotherapy.
[0178] Damage can be caused, for example, by exposure to cytotoxic
factors, hormone deprivation, growth factor deprivation, cytokine
deprivation, cell receptor antibodies, and the like. Where damage
may be caused by an anticipated course of chemotherapy and/or
radiotherapy, administration of an agent that protects against
reproductive injury prior to or concurrently with chemotherapy
and/or radiotherapy can protect fertility and enhance the
restoration methods described herein. The protective agent can
include but is not limited to S1P, Bax, or any agent that increases
SDF-1 activity (i.e., SDF-1 mediated migration and homing of stem
cells). For a description of the use of S1P in protecting
reproductive systems, see U.S. application Ser. No. 10/217,259,
filed on Aug. 12, 2002 and published as 20030157086 on Aug. 21,
2003, the contents of which are herein incorporated by
reference.
[0179] The present invention also provides methods for restoring
ovarian function in a menopausal female subject, comprising
providing a peripheral blood derived female germline stem cell, or
its progenitor, to the subject, wherein the cell engrafts into the
ovary and differentiates into an oocyte. The menopausal female
subject can be in a stage of either peri- or post-menopause, with
said menopause caused by either normal (e.g., aging) or
pathological (e.g., surgery, disease, ovarian damage)
processes.
[0180] Ovarian function in a post-menopausal female can also be
restored by administering an an agent that increases the amount of
peripheral blood derived female germline stem cells or their
progenitors and/or their differentiation into oocytes (e.g., by
increasing the number or life span of peripheral blood derived
female germline stem cells, as well as by increasing the
differentiation of peripheral blood derived female germline stem
cells into oocytes).
[0181] Restoration of ovarian function can relieve adverse symptoms
and complications associated with menopausal disorders, including,
but not limited to, somatic disorders such as osteoporosis,
cardiovascular disease, somatic sexual dysfunction, hot flashes,
vaginal drying, sleep disorders, depression, irritability, loss of
libido, hormone imbalances, and the like, as well as cognitive
disorders, such as loss of memory; emotional disorders, depression,
and the like.
[0182] Peripheral blood derived germline stem cells of the
invention, their progenitors or their in vitro-derived progeny, can
be administered as previously described, and obtained by all
methods known in the art.
[0183] Peripheral blood can be isolated by standard methods known
in the art, which include methods for harvesting umbilical cord
blood. In general, peripheral blood mononuclear cells (PBMCs) are
taken from a patient using standard techniques. By "peripheral
blood mononuclear cells" or "PBMCs" herein is meant lymphocytes
(including T-cells, B-cells, NK cells, etc.) monocytes and stem
cells. In some embodiments of the invention, only PBMCs are taken,
either leaving or returning red blood cells and polymorphonuclear
leucocytes to the patient. This is done as is known in the art, for
example using leukophoresis techniques. In general, a 5 to 7 liter
leukophoresis step it done, which essentially removes PBMCs from a
patient, returning the remaining blood components. Collection of
the cell sample is preferably done in the presence of an
anticoagulant such as heparin, as is known in the art.
[0184] In general, the sample comprising the PBMCs can be
pretreated in a wide variety of ways. Generally, once collected,
the cells can be additionally concentrated, if this was not done
simultaneously with collection or to further purify and/or
concentrate the cells. The cells may be washed, counted, and
resuspended in buffer transferred to a sterile, closed system for
further purification and activation.
[0185] The PBMCs are generally concentrated for treatment, using
standard techniques in the art in a preferred embodiment, the
leukophoresis collection step results in a concentrated sample of
PBMCs, in a sterile leukopak, that may contain reagents or doses of
the suppressive composition, as is more fully outlined below.
Generally, an additional concentration/purification step is done,
such as Ficoil-Hypaque density gradient centrifugation as is known
in the art. Separation or concentration procedures include but are
not limited to magnetic separation, using antibody-coated magnetic
beads, affinity chromatography, cytotoxic agents, either joined to
a monoclonal antibody or used with complement, "panning", which
uses a monoclonal antibody a to a solid matrix. Antibodies attached
to solid matrices, such as magnetic beads, agarose beads,
polystyrene beads, follow fiber membranes and plastic surfaces,
allow for direct separation. Cells bound by, antibody can be
removed or concentration by physically separating the solid support
from the cell suspension. The exact conditions a and procedure
depend on factors specific to the system employed. The selection of
appropriate conditions is well within the skill in the art.
[0186] Antibodies may be conjugated to biotin, which then can be
removed with avidin or streptavidin bound to a support, or
fluorochromes, which can be used with a fluorescence activated cell
sorter (FACS), to enable cell separation. Any technique may be
employed as long as it is not detrimental to the viability of the
desired cells.
[0187] In a preferred embodiment, the PBMCs are separated in a
automated, closed system such as the Nexell Isolex 300i Magnetic
Cell Selection System. Generally, this is done to maintain
sterility and to insure standardization of the methodology used for
cell separation, activation and development of suppressor cell
function.
[0188] Once purified or concentrated the cells may be aliquoted and
frozen, preferably, in liquid nitrogen or used immediately as
described below. Frozen cells may be thawed and used as needed.
Cryoprotective agents, which can be used, include but are not
limited to dimethyl sulfoxide (DMSO) (Lovelock, J. E. and Bishop,
M. W. H., 1959, Nature 183:1394-1395; Ashwood-Smith, M. J., 1961,
Nature 190:1204-1205), hetastarch, glycerol, polyvinylpyrrolidine
(Rinfret, A. P., 1960, Ann. N.Y. Acad. Sci. 85:576), polyethylene
glycol (Sloviter, H. A. and Ravdin, R. G., 1962, Nature 196:548),
albumin, dextran, sucrose, ethylene glycol, i-erythritol,
D-ribitol, D-mannitol (Rowe, A. W., et al., 1962, Fed. Proc.
21:157), D-sorbitol, i-inositol, D-lactose, choline chloride
(Bender, M. A., et al., 1960, J. Appl. Physiol. 15:520), amino
acids (Phan The Tran and Bender, M. A, 1960, Exp. Cell Res.
20:851), methanol, acetamide, glycerol monoacetate (Lovelock. J.
E., 1954, Biochem. J. 56:265), and inorganic salts (Phan The Tran
and Bender, M. A., 1960, Proc. Soc. Exp. Biol. Med. 104:388; Phan
The Tran and Bender, M. A., 1961, in Radiobiology Proceedings of
the Third Australian Conference on Radiobiology, Ilbery, P. L. T.,
ed., Butterworth, London, p. 59). Typically, the cells may be
stored in 10% DMSO, 50% serum, and 40% RPMI 1640 medium. Methods of
cell separation and purification are found in U.S. Pat. No.
5,888,499, which is expressly incorporated by reference.
[0189] In a preferred embodiment, the PBMCs are then washed to
remove serum proteins and soluble blood components, such as
autoantibodies, inhibitors, etc., using techniques well known in
the art Generally, this involves addition of physiological media or
buffer, followed by centrifugation. This may be repeated as
necessary. They can be resuspended in physiological media,
preferably AIM-V serum free medium (Life Technologies) (since serum
contains significant amounts of inhibitors of TGF-.beta.) although
buffers such as Hanks balanced salt solution (HBBS) or
physiological buffered saline (PBS) can also be used.
[0190] Generally, the cells are then counted; in general from
1.times.10.sup.9 to 2.times.10.sup.9 white blood cells are
collected from a 5-7 liter leukophoresis step. These cells are
brought up roughly 200 mls of buffer or media.
[0191] Prior to harvest, patients may be treated with agents known
in the art to increase mobilization of stem cells from the bone
marrow or ovary into the peripheral blood. Mobilizing agents
include but are not limited to GCSF or GMCSF.
[0192] Peripheral blood derived germline stem cells of the
invention can, if needed, be purified from peripheral blood,
including umbilical cord blood. Therefore, peripheral blood derived
germline stem cells that can be used in the methods of the
invention can comprise a purified sub-population of cells
including, but not limited to female and male germline stem cells.
Purified cells can be collected and separated, for example, by flow
cytometry.
[0193] Peripheral blood derived germline stem cells of the
invention can be autologous (obtained from the subject) or
heterologous (e.g., obtained from a donor). Heterologous cells can
be provided together with immunosuppressive therapies known in the
art to prevent immune rejection of the cells.
[0194] According to methods of the invention, peripheral blood can
be harvested during the lifetime of the subject, but a
pre-menopausal harvest is recommended. Furthermore, harvest prior
to illness (e.g., cancer) is desirable, and harvest prior to
treatment by cytotoxic means (e.g., radiation or chemotherapy) will
improve yield and is therefore also desirable. For increased yield
from female donors, it may be desirable to coordinate isolation
with appropriate stages of the female reproductive cycle that
exhibit higher levels of female germline stem cells in the
peripheral blood, as described in Example 4.
[0195] In some embodiments, it is beneficial to quantify the number
of female germline stem cells or their progenitors present in a
sample of peripheral blood. Where the amount of female germline
stem cells or their progenitors in a subject is substantially
reduced (e.g., less than 100) in comparison to that of a healthy
subject, she can have, or be at risk of developing, premature
ovarian failure. The quantity of female germline stem cells or
their progenitors circulating in the peripheral blood can be
highest during particular stages of the female reproductive cycle.
Thus, it may be desirable to coordinate the timing of sample
extraction and diagnosis with the timing of such a stage of the
female reproductive cycle.
[0196] Purified peripheral blood derived female germline stem cells
or their progenitors can be obtained by standard methods known in
the art, including cell sorting by FACs. Isolated peripheral blood
can be sorted using flow cytometers known in the art (e.g., a BD
Biosciences FACScalibur cytometer) based on cell surface expression
of Sca-1 (van de Rijn et al., (1989) Proc. Natl. Acad. Sci. USA 86,
4634-4638) and/or c-Kit (Okada et al., (1991) Blood 78, 1706-1712);
(Okada et al., (1992) Blood 80, 3044-3050) following an initial
immunomagnetic bead column-based fractionation step to obtain
lineage-depleted (lin) cells (Spangrude et al., (1988) Science 241,
58-62); (Spangrude and Scollay, (1990) Exp. Hematol. 18, 920-926),
as described (Shen et al., (2001) J. Immunol. 166, 5027-5033);
(Calvi et al., (2003) Nature 425, 841-846).
[0197] For serial passage-based enrichment of peripheral blood
derived female germline stem cells or their progenitors in-vitro
(Meirelles and Nardi, (2003) Br. J. Haematol. 123, 702-711);
(Tropel et al., (2004) Exp. Cell Res. 295, 395-406), isolated
peripheral blood can be plated on plastic in Dulbecco's modified
Eagle's medium (Fisher Scientific, Pittsburgh, Pa.) with 10% fetal
bovine serum (Hyclone, Logan, Utah), penicillin, streptomycin,
L-glutamine and amphotericin-B. About forty-eight hours after the
initial plating, the supernatants containing non-adherent cells can
be removed and replaced with fresh culture medium after gentle
washing. The cultures can then be maintained and passed once
confluence is reached (e.g., for a total of about three times over
the span of about 6 weeks) at which time the cultures can be
terminated to collect adherent cells for analysis.
[0198] Compositions comprising peripheral blood derived germline
stem cells or their progenitors can be provided directly to the
reproductive organ of interest (e.g., ovary or testes).
Alternatively, compositions comprising peripheral blood derived
germline stem cells or their progenitors can be provided indirectly
to the reproductive organ of interest, for example, by
administration into the circulatory system (e.g., to extra-ovarian
circulation).
[0199] Prior to administration, peripheral blood derived germline
stem cells, their progenitors or their progeny, described herein
can optionally be genetically modified, in vitro, in vivo or ex
vivo, by introducing heterologous DNA or RNA or protein into the
cell by a variety of recombinant methods known to those of skill in
the art. These methods are generally grouped into four major
categories: (1) viral transfer, including the use of DNA or RNA
viral vectors, such as retroviruses (including lentiviruses),
Simian virus 40 (SV40), adenovirus, Sindbis virus, and bovine
papillomavirus, for example; (2) chemical transfer, including
calcium phosphate transfection and DEAE dextran transfection
methods; (3) membrane fusion transfer, using DNA-loaded membranous
vesicles such as liposomes, red blood cell ghosts, and protoplasts,
for example; and (4) physical transfer techniques, such as
microinjection, electroporation, or direct "naked" DNA
transfer.
[0200] The peripheral blood derived germline stem cells of the
invention, their progenitors or their in progeny, can be
genetically altered by insertion of pre-selected isolated DNA, by
substitution of a segment of the cellular genome with pre-selected
isolated DNA, or by deletion of or inactivation of at least a
portion of the cellular genome of the cell. Deletion or
inactivation of at least a portion of the cellular genome can be
accomplished by a variety of means, including but not limited to
genetic recombination, by antisense technology (which can include
the use of peptide nucleic acids, or PNAs), or by ribozyme
technology, for example. The altered genome may contain the genetic
sequence of a selectable or screenable marker gene that is
expressed so that the cell with altered genome, or its progeny, can
be differentiated from cells having an unaltered genome. For
example, the marker may be a green, red, yellow fluorescent
protein, .beta.-galactosidase, the neomycin resistance gene,
dihydrofolate reductase (DHFR), or hygromycin, but are not limited
to these examples.
[0201] In some cases, the underlying defect of a pathological state
is a mutation in DNA encoding a protein such as a metabolic
protein. Preferably, the polypeptide encoded by the heterologous
DNA lacks a mutation associated with a pathological state. In other
cases, a pathological state is associated with a decrease in
expression of a protein. A genetically altered peripheral blood
derived germline stem cell, or its progeny, may contain DNA
encoding such a protein under the control of a promoter that
directs strong expression of the recombinant protein.
Alternatively, the cell may express a gene that can be regulated by
an inducible promoter or other control mechanism where conditions
necessitate highly controlled regulation or timing of the
expression of a protein, enzyme, or other cell product. Such stem
cells, when transplanted into a subject suffering from abnormally
low expression of the protein, produce high levels of the protein
to confer a therapeutic benefit. For example, the peripheral blood
derived germline stem cell of the invention, its progenitor or its
in vitro-derived progeny, can contain heterologous DNA encoding
genes to be expressed, for example, in gene therapy. Peripheral
blood derived germline stem cells of the invention, their
progenitors or their in vitro-derived progeny, can contain
heterologous DNA encoding Atm, the gene responsible for the human
disease Ataxia-telangiectasia in which fertility is disrupted.
Providing Atm via peripheral blood derived germline stem cells,
their progenitors or their in vitro-derived progeny, can further
relieve defects in ovarian function. DNA encoding a gene product
that alters the functional properties of peripheral blood derived
germline stem cells in the absence of any disease state is also
envisioned. For example, delivery of a gene that inhibits
apoptosis, or that prevents differentiation would be
beneficial.
[0202] Insertion of one or more pre-selected DNA sequences can be
accomplished by homologous recombination or by viral integration
into the host cell genome. The desired gene sequence can also be
incorporated into the cell, particularly into its nucleus, using a
plasmid expression vector and a nuclear localization sequence.
Methods for directing polynucleotides to the nucleus have been
described in the art. The genetic material can be introduced using
promoters that will allow for the gene of interest to be positively
or negatively induced using certain chemicals/drugs, to be
eliminated following administration of a given drug/chemical, or
can be tagged to allow induction by chemicals (including but not
limited to the tamoxifen responsive mutated estrogen receptor)
expression in specific cell compartments (including but not limited
to the cell membrane).
[0203] Calcium phosphate transfection can be used to introduce
plasmid DNA containing a target gene or polynucleotide into
isolated or cultured peripheral blood derived germline stem cells
or their progenitors and is a standard method of DNA transfer to
those of skill in the art. DEAE-dextran transfection, which is also
known to those of skill in the art, may be preferred over calcium
phosphate transfection where transient transfection is desired, as
it is often more efficient. Since the cells of the present
invention are isolated cells, microinjection can be particularly
effective for transferring genetic material into the cells. This
method is advantageous because it provides delivery of the desired
genetic material directly to the nucleus, avoiding both cytoplasmic
and lysosomal degradation of the injected polynucleotide. This
technique has been used effectively to accomplish peripheral blood
derived modification in transgenic animals. Cells of the present
invention can also be genetically modified using
electroporation.
[0204] Liposomal delivery of DNA or RNA to genetically modify the
cells can be performed using cationic liposomes, which form a
stable complex with the polynucleotide. For stabilization of the
liposome complex, dioleoyl phosphatidylethanolamine (DOPE) or
dioleoyl phosphatidylcholine (DOPA) can be added. Commercially
available reagents for liposomal transfer include Lipofectin (Life
Technologies). Lipofectin, for example, is a mixture of the
cationic lipid N-[1-(2, 3-dioleyloxy)propyl]-N--N--N-- trimethyl
ammonia chloride and DOPE. Liposomes can carry larger pieces of
DNA, can generally protect the polynucleotide from degradation, and
can be targeted to specific cells or tissues. Cationic
lipid-mediated gene transfer efficiency can be enhanced by
incorporating purified viral or cellular envelope components, such
as the purified G glycoprotein of the vesicular stomatitis virus
envelope (VSV-G). Gene transfer techniques which have been shown
effective for delivery of DNA into primary and established
mammalian cell lines using lipopolyamine-coated DNA can be used to
introduce target DNA into the peripheral blood derived germline
stem cells described herein.
[0205] Naked plasmid DNA can be injected directly into a tissue
mass formed of differentiated cells from the isolated peripheral
blood derived germline stem cells or their progenitors. This
technique has been shown to be effective in transferring plasmid
DNA to skeletal muscle tissue, where expression in mouse skeletal
muscle has been observed for more than 19 months following a single
intramuscular injection. More rapidly dividing cells take up naked
plasmid DNA more efficiently. Therefore, it is advantageous to
stimulate cell division prior to treatment with plasmid DNA.
Microprojectile gene transfer can also be used to transfer genes
into stem cells either in vitro or in vivo. The basic procedure for
microprojectile gene transfer was described by J. Wolff in Gene
Therapeutics (1994), page 195. Similarly, microparticle injection
techniques have been described previously, and methods are known to
those of skill in the art. Signal peptides can be also attached to
plasmid DNA to direct the DNA to the nucleus for more efficient
expression.
[0206] Viral vectors are used to genetically alter peripheral blood
derived germline stem cells of the present invention and their
progeny. Viral vectors are used, as are the physical methods
previously described, to deliver one or more target genes,
polynucleotides, antisense molecules, or ribozyme sequences, for
example, into the cells. Viral vectors and methods for using them
to deliver DNA to cells are well known to those of skill in the
art. Examples of viral vectors that can be used to genetically
alter the cells of the present invention include, but are not
limited to, adenoviral vectors, adeno-associated viral vectors,
retroviral vectors (including lentiviral vectors), alphaviral
vectors (e. g., Sindbis vectors), and herpes virus vectors.
[0207] Peptide or protein transfection is another method that can
be used to genetically alter peripheral blood derived germline stem
cells of the invention and their progeny. Peptides including, but
not limited to, Pep-1 (commercially available as Chariot.TM.) and
MPG, can quickly and efficiently transport biologically active
proteins, peptides, antibodies, and nucleic acids directly into
cells, with an efficiency of about 60% to about 95% (Morris, M. C.
et al, (2001) Nat. Biotech. 19: 1173-1176). Without wishing to be
bound by theory, the peptide forms a non-covalent bond with the
macromolecule of interest (i.e., protein, nucleic acid). The
binding reaction stabilizes the protein and protects it from
degradation. Upon delivery into the cell of interest, such as stem
cells of the invention, the peptide-macromolecule complex
dissociates, leaving the macromolecule biologically active and free
to proceed to its target organelle. Delivery can occur in the
presence of absence of serum. Uptake and delivery can occur at
4.degree. C., which eliminates endosomal processing of incoming
macromolecules. Movement of macromolecules through the endosomal
pathway can modify the macromolecule upon uptake. Peptides such as
Pep-1, by directly delivering a protein, antibody, or peptide of
interest, bypass the transcription-translation process.
[0208] Methods of the invention can provide oocyte reserves for use
in ex vivo procedures, such as somatic cell nuclear transfer.
Employing recombinant techniques prior to nuclear transfer will
allow for the design of customized oocytes and ultimately produce
embryos from which embryonic stem cells can be derived. In
addition, genetic manipulation of donor DNA prior to nuclear
transfer will result in embryos that possess the desired
modification or genetic trait.
[0209] Methods of somatic cell nuclear transfer are well known in
the art. See U.S. application Ser. No. 10/494,074, filed on Mar.
24, 2004 and published as 20050064586; Wilmut et al. (1997) Nature,
385, 810-813; Wakayama, et al. (1998) Nature 394: 369-374; and
Teruhiko et al., (1999) PNAS 96:14984-14989. Nuclear
transplantation involves the transplantation of donor cells or cell
nuclei into enucleated oocytes. Enucleation of the oocyte can be
performed in a number of manners well known to those of ordinary
skill in the art. Insertion of the donor cell or nucleus into the
enucleated oocyte to form a reconstituted cell is usually by
microinjection of a donor cell under the zona pellucida prior to
fusion. Fusion may be induced by application of a DC electrical
pulse across the contact/fusion plane (electrofusion), by exposure
of the cells to fusion-promoting chemicals, such as polyethylene
glycol, or by way of an inactivated virus, such as the Sendai
virus. A reconstituted cell is typically activated by electrical
and/or non-electrical means before, during, and/or after fusion of
the nuclear donor and recipient oocyte. Activation methods include
electric pulses, chemically induced shock, penetration by sperm,
increasing levels of divalent cations in the oocyte, and reducing
phosphorylation of cellular proteins (as by way of kinase
inhibitors) in the oocyte. The activated reconstituted cells, or
embryos, are typically cultured in medium well known to those of
ordinary skill in the art and then transferred to the womb of an
animal.
[0210] Methods for the generation of embryonic stem cells from
embryos are also well known in the art. See Evans, et al. (1981)
Nature, 29:154-156; Martin, et al. (1981) PNAS, 78:7634-7638;
Smith, et al. (1987) Development Biology, 121:1-9; Notarianni, et
al. (1991) J. Reprod. Fert., Suppl. 43:255-260; Chen R L, et al.
(1997) Biology of Reproduction, 57 (4):756-764; Wianny, et al.
(1999) Theriogenology, 52 (2):195-212; Stekelenburg-Hamers, et al.
(1995) Mol. Reprod. 40:444-454; Thomson, et al. (1995) PNAS, 92
(17):7844-8 and Thomson (1998) Science, 282 (6):1145-1147.
Accordingly, embryos produced from oocytes of the invention can be
genetically modified, either through manipulation of the oocyte in
vitro prior to fertilization or manipulation of donor DNA prior to
nuclear transfer into the enucleated oocyte, to produce embryos
having a desired genetic trait.
VII. In Vitro Fertilization
[0211] Oocytes produced from peripheral blood derived female
germline stem cells of the invention, or progenitors derived from
peripheral blood derived female germline stem cells of the
invention, as described herein can also be used for methods of in
vitro fertilization. Accordingly, the invention provides methods
for in vitro fertilization of a female subject, comprising the
steps of: [0212] a) producing an oocyte by culturing a peripheral
blood derived female germline stem cell, or its progenitor, in the
presence of an oocyte differentiation agent; [0213] b) fertilizing
the oocyte in vitro to form a zygote; [0214] c) implanting the
zygote into the uterus of a female subject.
[0215] Methods of in vitro fertilization are well known in the art,
and are now rapidly becoming commonplace. Couples are generally
first evaluated to diagnose their particular infertility
problem(s). These may range from unexplained infertility of both
partners to severe problems of the female (e.g., endometriosis
resulting in nonpatent oviducts with irregular menstrual cycles or
polycystic ovarian disease) or the male (e.g., low sperm count with
morphological abnormalities, or an inability to ejaculate normally
as with spinal peripheral lesions, retrograde ejaculation, or
reversed vasectomy). The results of these evaluations also
determine the specific procedure to be performed for each
couple.
[0216] Procedures often begin with the administration of a drug to
down-regulate the hypothalamic/pituitary system (LHRH agonist).
This process decreases serum concentrations of the gonadotropins,
and developing ovarian follicles degenerate, thereby providing a
set of new follicles at earlier stages of development. This permits
more precise control of the maturation of these new follicles by
administration of exogenous gonadotropins in the absence of
influences by the hypothalamic pituitary axis. The progress of
maturation and the number of growing follicles (usually four to ten
stimulated per ovary) are monitored by daily observations using
ultrasound and serum estradiol determinations. When the follicles
attain preovulatory size (18-21 mm) and estradiol concentrations
continue to rise linearly, the ovulatory response is initiated by
exogenous administration of human chorionic gonadotropins
(hCG).
[0217] Oocytes can be obtained from peripheral blood derived female
germline stem cells, or progenitors derived from peripheral blood
derived female germline stem cells, as previously described herein.
Peripheral blood derived female germline stem cells, or progenitors
derived from peripheral blood derived female germline stem cells,
can be cultured in the presence of an oocyte differentiation agent
which induces differentiation into oocytes. The differentiation
agent can be supplied exogenously (e.g., added to the culture
medium) or from endogenous sources during co-culture with allogenic
or heterogenic ovarian tissue. Peripheral blood derived female
germline stem cells of the invention can also be cultured in a
tissue-engineered structure wherein the differentiation agent is
either exogenously or endogenously supplied and oocytes are
obtained.
[0218] Individual oocytes can be evaluated morphologically and
transferred to a petri dish containing culture media and
heat-inactivated serum. A semen sample is provided by the male
partner and processed using a "swim up" procedure, whereby the most
active, motile sperm will be obtained for insemination. If the
female's oviducts are present, a procedure called GIFT (gamete
intrafallopian transfer) can be performed at this time. By this
approach, oocyte-cumulus complexes surrounded by sperm are placed
directly into the oviducts by laproscopy. This procedure best
simulates the normal sequences of events and permits fertilization
to occur within the oviducts. Not surprisingly, GIFT has the
highest success rate with 22% of the 3,750 patients undergoing ova
retrieval in 1990 having a live delivery. An alternative procedure
ZIFT (zygote intrafallopian transfer) permits the selection of in
vitro fertilized zygotes to be transferred to oviducts the day
following ova retrieval. Extra zygotes can be cryopreserved at this
time for future transfer or for donation to couples without female
gametes. Most patients having more serious infertility problems,
however, will require an additional one to two days incubation in
culture so that preembryos in the early cleavage states can be
selected for transfer to the uterus. This IVF-UT (in vitro
fertilization uterine transfer) procedure entails the transcervical
transfer of several 2-6 cell (day 2) or 8-16 (day 3) preembryos to
the fundus of the uterus (4-5 preembryos provides optimal
success).
[0219] Procedures for in vitro fertilization are also described in
U.S. Pat. Nos. 6,610,543 6,585,982, 6,544,166, 6,352,997,
6,281,013, 6,196,965, 6,130,086, 6,110,741, 6,040,340, 6,011,015,
6,010,448, 5,961,444, 5,882,928, 5,827,174, 5,760,024, 5,744,366,
5,635,366, 5,691,194, 5,627,066, 5,563,059, 5,541,081, 5,538,948,
5,532,155, 5,512,476, 5,360,389, 5,296,375, 5,160,312, 5,147,315,
5,084,004, 4,902,286, 4,865,589, 4,846,785, 4,845,077, 4,832,681,
4,790,814, 4,725,579, 4,701,161, 4,654,025, 4,642,094, 4,589,402,
4,339,434, 4,326,505, 4,193,392, 4,062,942, and 3,854,470, the
contents of which are specifically incorporated by reference for
their description of these procedures.
[0220] The following examples are put forth for illustrative
purposes only, and are not intended to limit the scope of what the
inventors regard as their invention.
EXAMPLES
Example 1: Female Germline Stem Cells in Peripheral Blood
[0221] It has recently been determined that bone marrow serves as a
germline stem cell reservoir for the maintenance of oocyte
production in adult females. See U.S. application Ser. No.
11/131,153, filed on May 17, 2005, the contents of which are
incorporated herein by reference. It was therefore proposed that
germline stem cell-derived progeny utilize the peripheral blood
supply as a conduit for travel to the ovaries. As shown herein,
peripheral blood contains germline stem cells and thus, peripheral
blood cell transplantation (PBCT) can be used to rescue oocyte
production in female recipients.
[0222] For the first of these experiments, a doxorubicin insult
model was utilized, in which there occurs a rapid and spontaneous
regeneration of the primordial follicle pool following doxorubicin
insult, presumably through germline stem cell-derived progeny
arriving to the ovaries via the general circulation. Accordingly,
such a model lends itself well to rapidly assessing the
contribution of peripheral blood-derived germ cells to de-novo
oocyte production in adult females.
[0223] To distinguish between those new oocytes derived from the
host versus the donor, peripheral blood mononuclear cells were
collected from adult transgenic female mice with ubiquitous
expression of green fluorescent protein (GFP). For PBCT, peripheral
blood was collected and layered on Ficoll-Paque Plus (Amersham
Biosciences). The samples were centrifuged at 800.times.g for 15
minutes at 4 C, and mononuclear cells were collected from the
Ficoll-buffer interface. After collection, the cells were washed
and resuspended in PBS at a final concentration of
3-6.times.10.sup.6 cell ml.sup.-1. Recipient adult (6-7 weeks of
age) wild-type female mice were injected with doxorubicin (5 mg
kg.sup.-1), followed by PBCT (0.5 ml of cells per mouse, via the
tail vein) 25 hours later. Twenty-four hours after PBCT, ovaries
were collected and analyzed for GFP expression by
immunohistochemistry.
[0224] As controls for the experiment, GFP expression was
detectable in primordial and primary oocytes of transgenic females
(FIG. 1a) but was not observed in oocytes of wild-type females
prior to PBCT (FIG. 1b). However, primordial and early primary
follicles with GFP-positive oocytes were detected in the ovaries of
adult wild-type female mice within 24 hours of PBCT (FIG. 1c-e). As
expected, GFP-negative primordial and primary oocytes were also
found in the same ovaries of mice receiving PBCT (FIG. 1f),
representing either those oocytes not destroyed by doxorubicin
treatment or new oocytes formed from host germline stem
cell-derived progeny following the insult.
[0225] Next, transgenic female mice with GFP expression driven by
an 18-kb fragment of the Oct4 promoter in which the proximal
enhancer region has been inactivated (GOF18-APE or TgOG2) (Yeom et
al., (1996) Development 122, 881-894); (Yoshimizu et al., (1999)
Dev. Growth Differ. 41, 675-684); (Szabo et al., (2002) Mech. Dev.
115, 157-160); were used as donors for peripheral blood cell
transplantation (PBCT). Past studies have shown that endogenous
Oct4 expression in adult animals is restricted to germ cells
(Scholer et al., (1989); EMBO J. 8, 2543-2550); Yoshimizu et al.,
(1999), and the introduction of deletions in the proximal enhancer
of the Oct4 promoter (APE) leads to exclusive expression of the
transgene in the germline even during embryogenesis (Yeom et al.,
1996).
[0226] Peripheral blood was harvested from adult (7-10 weeks of
age) transgenic female mice with Oct4-specific expression of GFP,
or from adult male Oct4-GFP transgenic mice, and layered on
Ficoll-Paque Plus (Amersham Biosciences/GE Healthcare, Piscataway,
N.J.). The samples were centrifuged at 800.times.g for 15 min at 4
C, and mononuclear cells were collected from the Ficoll-buffer
interface. The cells were then washed and resuspended in PBS at a
final concentration of 2-4.times.10.sup.7 cells/ml. In some
experiments described below, recipient adult (6-7 weeks of age)
wild-type or Atm-null female mice were conditioned with
chemotherapy as described above for BMT, followed by PBCT (0.5 ml
of cells per mouse, via the tail vein) 24 hr later. In all cases,
ovaries were collected 28-30 hr after PBCT and analyzed for GFP
expression by immunohistochemistry. For the experiments involving
PBCT using males as donors, recipient ovaries were fixed, serially
sectioned and screened in their entirety for GFP-expressing
oocytes. As positive controls, testicular and ovarian tissues from
Oct4-GFP (TgOG2) mice were analyzed in parallel to confirm
transgene expression in males as well as antigen detection in
ovaries.
[0227] As controls, GFP expression was detected only in primordial
and growing oocytes of transgenic females (FIGS. 2A-2B), and the
GFP signal was absent in oocytes of wild-type females prior to PBCT
(FIG. 2C). However, primordial follicles with highly GFP-positive
(GFP.sup.+) oocytes were detected in the ovaries of chemo-ablated
adult wild-type female mice within 28-30 hr of PBCT (FIGS. 2D-2F;
see also FIG. 4).
[0228] Similar findings were obtained when the experiments were
repeated using chemo-ablated Atm-null female mice as recipients
(FIGS. 2G-2H), thus excluding the possibility of a non-specific
`restorative` effect of PBCT on endogenous oocyte production in the
host females. Moreover, transplantation of peripheral blood-derived
mononuclear cells harvested from adult male TgOG2 mice, which also
exhibit abundant expression of the transgene in germ cells (FIGS.
3A-3C), did not result in the production of GFP.sup.+ oocytes in
chemotherapy-conditioned female recipients (FIGS. 3D-3F), ruling
out the possibility that the oocytes observed following
transplantation of female peripheral blood developed as a result of
fusion between GFP-expressing donor cells and any residual host
germ cells not destroyed by the chemo-ablation protocol.
[0229] The ability of peripheral blood derived female germline stem
cells and their progenitors collected from Oct-4 GFP transgenic
female donors to generate oocytes following transplantation into
adult wildtype female mice was further evaluate by
immunohistochemical analysis using antibodies specific for MVH
(generously provided by T. Noce; Fujiwara et al., 1994), HDAC6
(2162; Cell Signaling Technology, Beverly, Mass.), NOBOX (A.
Rajkovic; Suzumori et al., 2002), GDF-9 (AF739; R&D Systems,
Minneapolis, Minn.) or GFP (sc-9996; Santa Cruz Biotechnology,
Santa Cruz, Calif.) after high temperature antigen unmasking, as
recommended by each supplier. For the PBCT studies involving
transgenic mice with ubiquitous expression of GFP as donors,
antigen detection was visualized after tyramide amplification
(PerkinElmer, Boston, Mass.) due to the low basal level of GFP
expression in primordial oocytes in this line of mice (unpublished
findings). In those experiments using immunofluorescence-based
antigen detection, the sections were mounted with propidium iodide
(Vectashield; Vector Laboratories, Burlingame, Calif.) or TO-PRO-3
iodide (Molecular Probes, Eugene, Oreg.) to visualize nuclei, and
images were captured using a Zeiss LSM 5 Pascal Confocal
Microscope. GFP.sup.+ cells contained within follicles of hosts
following transplantation of peripheral blood collected from adult
female TgOG2 mice expressed MVH (FIGS. 4A-4F), HDAC6 (FIGS. 4G-4L),
NOBOX (FIGS. 4M-4O) and GDF9 (FIGS. 4P-4R), supporting their status
as germ cells (MVH: Noce et al., 2001) and oocytes (HDAC6; NOBOX:
Suzumori et al., 2002; GDF9: McGrath et al., 1995).
[0230] These findings, along with the expression of germline
markers in peripheral blood (Example 2), indicate that adult female
mice possess circulating germline stem cells that support new
oocyte production.
Example 2: Expression of Female Germline Stem Cell Marker Genes in
Peripheral Blood
[0231] Expression of Dazl and Stella were detected in peripheral
blood of mice and humans by RT-PCR (FIG. 5). Total RNA was
extracted from each sample and 1 mg was reverse transcribed
(Superscript II RT; Invitrogen, Carlsbad, Calif.) using oligo-dT
primers. Amplification via 28-40 cycles of PCR was then performed
using Taq polymerase and Buffer-D (Epicentre, Madison, Wis.) with
primer sets specific for each gene (Supplemental Table 51). For
each sample, RNA encoded by the ribosomal gene L7 (mouse studies),
beta-actin (mouse studies) or the glyceraldehyde-3-phosphate
dehydrogenase gene (GAPDH; human studies) was amplified and used as
a loading control (`house-keeping` gene). All PCR products were
isolated, subcloned and sequenced for confirmation.
Example 3: Female Germline Stem Cells in Peripheral Blood Derived
from the Umbilical Cord
[0232] Human cord blood was evaluated to determine whether cells
that express the germ cell marker Dazl were present. Dazl has
previously been detected in germ cells of both human fetal females
(Brekhman et al., 2000 Mol Hum Reprod 6: 465-468; Tsai et al., 2000
Fertil Steril 73: 627-630) and human males (Brekhman et al., 2000
Mol Hum Reprod 6: 465-468). A single human cord blood sample was
split into two replicate samples and RNA was extracted from each.
The replicates were then reverse-transcribed, with mock-reverse
transcribed negative control samples prepared in parallel. Samples
were then used in polymerase chain reaction amplification reactions
(RT-PCR) using primers specific for Dazl and the housekeeping gene
GAPDH. As shown, the cord blood sample used is positive for Dazl in
both replicates (FIG. 6). Human cord blood is therefore a novel
source of germline stem cells, or their progenitors, for oocyte and
sperm production in humans.
Example 4: Modulation of Peripheral Blood Derived Female Germline
Stem Cells and their Progenitors During the Estrous Cycle
[0233] One aspect of the PBCT procedure that may impact the number
of donor-derived oocytes generated is the stage of the donor
female's reproductive cycle during which blood is harvested for
transplantation. To begin testing whether the number of circulating
genii cells fluctuates as a consequence of the estrous cycle,
peripheral blood was collected from adult female mice during
estrus, metestrus, diestrus and proestrus, and then analyzed by
real-time PCR for Mvh expression. For quantitative analysis of Mvh
levels, PCR was performed using a Cepheid Smart Cycler II and
primers specific for amplification of Mvh (FAM-labeled LUX.TM.
Fluorogenic Custom Primers, Invitrogen; forward (SEQ ID NO: 1):
cacctcagagggttttccaagcgaggg; reverse (SEQ ID NO: 2):
cctcttctgaacgggcctga and beta-actin (LUX.TM. Primer Sets for
Housekeeping Genes I0IM-01; Invitrogen). Expression ratios were
calculated using the method of Pfaffl (2001), with Mvh levels in
bone marrow at estrus set as the reference point (1.0) for
comparisons. The levels of this germline marker in peripheral blood
were affected by the estrous cycle (FIG. 7). These results and
those provided earlier in Examples 1-3 collectively indicate that
adult female mice possess circulating germline stem cells, and
their progenitor cells, that can generate oocytes, and suggest that
the stage of the reproductive cycle during which blood is collected
may impact the number of germline stem cells, and their progenitor
cells, available for engraftment following transplantation.
REFERENCES
[0234] Allen, E. (1923). Ovogenesis during sexual maturity. Am. J.
Anat. 31, 439-470. [0235] Attar, E. C., and Scadden, D. T. (2004).
Regulation of hematopoietic stem cell growth. Leukemia 18,
1760-1768. [0236] Barlow, C., Hirotsune, S., Paylor, R., Liyanage,
M., Eckhaus, M., Collins, F., Shiloh, Y., Crawley, J. N., Ried, T.,
Tagle, D., and Wynshaw-Boris, A. (1996). Atm-deficient mice: a
paradigm of ataxia telangiectasia. Cell 86, 159-171. [0237] Barlow,
C., Liyanage, M., Moens, P. B., Tarsounas, M., Nagashima, K.,
Brown, K., Rottinghaus, S., Jackson, S. P., Tagle, D., Ried, T.,
and Wynshaw-Boris, A. (1998). Atm deficiency results in severe
meiotic disruption as early as leptonema of prophase I. Development
125, 4007-4017. [0238] Benson, D. A., Karsch-Mizrachi, I., Lipman,
D. J., Ostell, J., and Wheeler, D. L. (2004). GenBank: update.
Nucleic Acids Res. 32 Database issue, D23-D26. [0239] Bonadonna,
G., and Valagussa, P. (1985). Adjuvant systemic therapy for
resectable breast cancer. J. Clin. Oncol. 3, 259-275. [0240] Borum,
K. Oogenesis in the mouse. (1961). A study of meiotic prophase.
Exp. Cell Res. 24, 495-507.
[0241] Braat, A. K., Zandbergen, T., van de Water, S., Goos, H. J.,
and Zivkovic, D. (1999). Charatcerization of zebrafish primordial
germ cells: morphology and early distribution of vasa RNA. Dev.
Dyn. 216, 153-167. [0242] Brinster, C. J., Ryu, B. Y., Avarbock, M.
R., Karagenc, L., Brinster, R. L., and Orwig, K. E. (2003).
Restoration of fertility by germ cell transplantation requires
effective recipient preparation. Biol. Reprod. 69, 412-420. [0243]
Brinster, R. L. (2002). Germline stem cell transplanation and
transgenesis. Science 296, 2174-2176. [0244] Bucci, L. R., and
Meistrich, M. L. (1987). Effects of busulfan on murine
spermatogenesis: cytotoxicity, sterility, sperm abnormalities, and
dominant lethal mutations. Mutat. Res. 176, 259-268. [0245] Calvi,
L. M., Adams, G. B., Weibrecht, K. W., Weber, J. M., Olson, D. P.,
Knicht, M. C., Martin, R. P., Schipani, E., Divietti, P.,
Bringhurst, F. R., Milner, L. A., Kronenberg, H. M., and Scadden,
D. T. (2003). Osteoblastic cells regulate the haematopoietic stem
cell niche. Nature 425, 841-846. [0246] Canning, J., Takai, Y., and
Tilly, J. L. (2003). Evidence for genetic modifiers of ovarian
follicular endowment and development from studies of five inbred
mouse strains. Endocrinology 144, 9-12. [0247] Capela, A., and
Temple, S. (2002). LeX/ssea-1 is expressed by adult mouse CNS stem
cells, identifying them as nonependymal. Neuron 35, 865-875. [0248]
Castrillon, D. H., Quade, B. J., Wang, T. Y., Quigley, C., and
Crum, C. P. (2000). The human VASA gene is specifically expressed
in the germ cell lineage. Proc. Natl. Acad. Sci. USA 97, 9585-9590.
[0249] Cohen, P., and Pollard, J. W. (2001). Regulation of meiotic
recombination and prophase I progression in mammals. BioEssays 23,
996-1009. [0250] Cooke, H. J., Lee, M., Kerr, S., and Ruggiu, M.
(1996). A murine homologue of the human DAZ gene is autosomal and
expressed only in male and female gonads. Hum. Mol. Genet. 5,
513-516. [0251] Cooper R. L., Goldman, J., and Vandenbergh, J. G.
(1993). Monitoring of estrous cyclicity in the laboratory rodent by
vaginal lavage. In Methods in Reproductive Toxicology, R. E. Chapin
and J. J. Heindel, eds. (Orlando, Fla.: Academic Press), pp. 45-56.
[0252] Dearden, P., Grbic, M., and Donly, C. (2003). Vasa
expression and germ-cell specification in the spider mite
Tetranychus urticae. Dev. Genes Evol. 212, 599-603. [0253] Deng,
W., and Lin, H. (2001). Asymmetric germ cell division and oocyte
determination during Drosophila oogenesis. Int. Rev. Cytol. 203,
93-138. [0254] Dialynas, D. P., Quan, Z. S., Wall, K. A., Pierres,
A., Quintans, J., Loken, M. R., Pierres, M., and Fitch, F. W.
(1984). Characterization of the murine T cell surface molecule
designated L3T4, identified by monoclonal antibody GK1.5:
similarity of L3T4 to the human Leu 3/T4 molecule. J. Immunol. 131,
2445-2451. [0255] Dias Neto, E., Correa, R. G., Verjovski-Almeida,
S., Briones, M. R., Nagai, M. A., da Silva, W. Jr., Zago, M. A.,
Bordin, S., Costa, F. F., Goldman, G. H., Carvalho, A. F.,
Matsukuma, A., Baia, G. S., Simpson, D. H., Brunstein, A., de
Oliveira, P. S., Bucher, P., Jongeneel, C. V., O'Hare, M. J.,
Soares, F., Brentani, R. R., Reis, L. F., de Souza, S. J., and
Simpson, A. J. (2000). Shotgun sequencing of the human
transcriptome with ORF expressed sequence tags. Proc. Natl. Acad.
Sci. USA 97, 3491-3496. [0256] Di Giacomo, M., Barchi, M., Baudet,
F., Edelman, W., Keeney, S., and Jasin, M. (2005). Distinct
DNA-damage-dependent and -independent responses drive the loss of
oocytes in recombination-defective mouse mutants. Proc. Natl. Acad.
Sci. USA 102, 737-742. [0257] Dong, J., Albertini, D. F.,
Nishimori, K., Kumar, T. R., Lu, N., and Matzuk, M. M. (1996).
Growth differentiation factor-9 is required during early ovarian
folliculogenesis. Nature 383, 531-535. [0258] Erickson, G. F., and
Shimasaki, S. (2000). The role of the oocyte in folliculogenesis.
Trends Endocrinol. Metab. 11, 193-198. [0259] Fabioux, C., Huvet,
A., Lelong, C., Robert, R., Pouvereau, S., Daniel, J. Y., Minguant,
C., Le Pennec, M. (2004). Oyster vasa-like gene as a marker of the
germline cell development in Crassostrea gigas. Biochem. Biophys.
Res. Commun. 320, 592-598. [0260] Faddy, M. J., Gosden, R. G.,
Gougeon, A., Richardson, S. J., and Nelson, J. F. (1992).
Accelerated disappearance of ovarian follicles in mid-life:
implications for forecasting menopause. Hum. Reprod. 7, 1342-1346.
[0261] Fox, M., Damjanov, I., Martinez-Hernandez, A., Knowles, B.
B., and Solter, D. (1981). Immunohistochemical localization of the
early embryonic antigen (SSEA-1) in post-implantation mouse embryos
and fetal and adult tissues. Dev. Biol. 83, 391-398. [0262]
Franchi, L. L., Mandl, A. M., and Zuckerman, S. (1962). The
development of the ovary and the process of oogenesis. In The
Ovary, S. Zuckerman, ed. (New York, N.Y.: Academic Press), pp.
1-88. [0263] Fujiwara, Y., Komiya, T., Kawabata, H., Sato, M.,
Fujimoto, H., Furusawa, M., and Noce, T. (1994). Isolation of a
DEAD-family protein gene that encodes a murine homolog of
Drosophila vasa and its specific expression in germ cell lineage.
Proc. Natl. Acad. Sci. USA 91, 12258-12262. [0264] Geijsen, N.,
Horoschak, M., Kim, K., Gribnau, J., Eggan, K., and Daley, G. Q.
(2004). Derivation of embryonic germ cells and male gametes from
embryonic stem cells. Nature 427, 148-154. [0265] Generoso, W. M.,
Stout, S. K. & Huff, S. W. (1971). Effects of alkylating agents
on reproductive capacity of adult female mice. Mutat. Res. 13,
171-184. [0266] Gilboa, L., and Lehmann, R. (2004). Repression of
primordial germ cell differentiation parallels germline stem cell
maintenance. Curr. Biol. 14, 981-986. [0267] Gosden, R. G. (1996).
The vocabulary of the egg. Nature 383, 485-486. [0268] Gosden, R.
G. (2004). Germline stem cells in the postnatal ovary: is the ovary
more like a testis? Hum. Reprod. Update 10, 193-195. [0269] Gosden,
R. G., Laing, S. C., Felicio, L. S., Nelson, J. F., and Finch, C.
E. (1983). Imminent oocyte exhaustion and reduced follicular
recruitment mark the transition to acyclicity in aging C57BL/6J
mice. Biol. Reprod. 28, 255-260. [0270] Green, E. L., and
Bernstein, S. E. (1970). Do cells outside the testes participate in
repopulating the germinal epithelium after irradiation? Negative
results. Int. J. Radiat. Biol. Relat. Stud. Phys. Chem. Med. 17,
87-92. [0271] Grove, J. E., Bruscia, E., and Krause, D. S. (2004).
Plasticity of bone marrow-derived stem cells. Stem Cells 22,
487-500. [0272] Hadjantonakis, A. K., Gertsenstein, M., Ikawa, M.,
Okabe, M., and Nagy, A. (1998). Generating green fluorescent mice
by germline transmission of green fluorescent ES cells. Mech. Dev.
76, 79-90. [0273] Heike, T., and Nakahata, T. (2004). Stem cell
plasticity in the hematopoietic system. Int. J. Hematol. 79, 7-14.
[0274] Hershlag, A., and Schuster, M. W. (2004). Return of
fertility after autologous stem cell transplantation. Fertil.
Steril. 77, 419-421. [0275] Herzog, E. L., Chai, L., and Krause, D.
S. (2003). Plasticity of marrow-derived stem cells. Blood 102,
3483-3493. [0276] Hirshfield, A. N. (1991). Development of
follicles in the mammalian ovary. Int. Rev. Cytol. 124, 43-101.
[0277] Ikenishi, K. (1998). Germ plasm in Caenorhabditis elegans,
Drosophila and Xenopus. Dev. Growth Differ. 40, 1-10. [0278]
Johnson, J., Canning, J., Kaneko, T., Pru, J. K., and Tilly, J. L.
(2004). Germline stem cells and follicular renewal in the postnatal
mammalian ovary. Nature 428, 145-150. [0279] Kanatsu-Shinohara, M.,
Inoue, K., Lee, J., Yoshimoto, M., Ogonuki, N., Miki, H., Baba, S.,
Kato, T., Kazuki, Y., Toyokuni, S., Toyoshima, M., Niwa, O.,
Oshimura, M., Heike, T., Nakahata, T., Ishino, F., Ogura, A., and
Shinohara, T. (2004). Generation of pluripotent stem cells from
neonatal mouse testis. Cell 119, 1001-1012. [0280] Komiya, T.,
Itoh, K., Ikenishi, K., and Furusawa, M. (1994). Isolation and
characterization of a novel gene of the DEAD box protein family
which is specifically expressed in germ cells of Xenopus laevis.
Dev. Biol. 162, 354-363. [0281] Lawson, K. A., and Hage, W. J.
(1994). Clonal analysis of the origin of primordial germ cells in
the mouse. Ciba Found. Symp. 182, 68-84, 84-91. [0282] Lin, H.
(2002). The stem-cell niche theory: lessons from flies. Nat. Rev.
Genet. 3, 931-940. Marani, E., van Oers, J. W., Tetteroo, P. A.,
Poelmann, R. E., van der Veeken, J., and Deenen, M. G. (1986).
Stage specific embryonic carbohydrate surface antigens of
primordial germ cells in mouse embryos: FAL (S.S.E.A.-1) and
globoside (S.S.E.A.-3). Acta Morphol. Neerl. Scand. 24, 103-110.
[0283] Matzuk, M. M., Burns, K. H., Viveiros, M. M., and Eppig, J.
J. (2002). Intercellular communication in the mammalian ovary:
oocytes carry the conversation. Science 296, 2178-2180. [0284]
McGrath, S. A., Esquela, A. F., and Lee, S. J. (1995).
Oocyte-specific expression of growth/differentiation factor-9. Mol.
Endocrinol. 9, 131-136. [0285] McLaren, A. (1984). Meiosis and
differentiation of mouse germ cells. Symp. Soc. Exp. Biol. 38,
7-23. [0286] McLaren, A. (2003). Primordial germ cells in the
mouse. Dev. Biol. 262, 1-15. [0287] Medvinsky, A., and Dzierzak, E.
(1996). Definitive hematopoiesis is autonomously initiated by the
AGM region. Cell 86, 897-906. [0288] Meirelles, L. da S., and
Nardi, N. B. (2003). Murine marrow-derived mesenchymal stem cell:
isolation, in vitro expansion, and characterization. Br. J.
Haematol. 123, 702-711. [0289] Milhem, M., Mahmud, N., Lavelle, D.,
Araki, H., DeSimone, J., Saunthararajah, Y., and Hoffman, R.
(2004). Modification of hematopoietic stem cell fate by 5aza 2'
deoxycytidine and trichostatin A. Blood 103, 4102-4110. [0290]
Mintz, B., and Russell, E. S. (1957). Gene-induced embryological
modification of primordial germ cells in the mouse. J. Exp. Zool.
134, 207-230. [0291] Molyneaux, K., and Wylie, C. (2004).
Primordial germ cell migration. Int. J. Dev. Biol. 48, 537-544.
[0292] Morita, Y., Perez, G. I., Paris, F., Miranda, S., Ehleiter,
D., Haimovitz-Friedman, A., Fuks, Z., Xie, Z., Reed, J. C.,
Schuchman, E. H., Kolesnick, R. N., and Tilly, J. L. (2000). Oocyte
apoptosis is suppressed by disruption of the acid sphingomyelinase
gene or by sphingosine-1-phosphate therapy. Nat. Med. 6, 1109-1114.
[0293] Morrison, S. J., Uchida, N., Weissman, I. L. (1995). The
biology of hematopoietic stem cells. Annu. Rev. Cell Dev. Biol. 11,
35-71. [0294] Noce, T., Okamoto-Ito, S., and Tsunekawa, N. (2001).
Vasa homolog genes in mammalian germ cell development. Cell Struct.
Funct. 26, 131-136. [0295] Okada, S., Nakauchi, H., Nagayoshi, K.,
Nishikawa, S., Nishikawa, S., Miura, Y., and Suda, T. (1991).
Enrichment and characterization of murine hematopoietic stem cells
that express c-kit molecule. Blood 78, 1706-1712. [0296] Okada, S.,
Nakauchi, H., Nagayoshi, K., Nishikawa, S., Miura, Y., and Suda, T.
(1992). In vivo and in vitro stem cell function of c-kit- and
Sca-1-positive murine hematopoietic cells. Blood 80, 3044-3050.
[0297] Perez, G. I., Knudson, C. M., Leykin, L., Korsmeyer, S. J.
& Tilly, J. L. (1997). Apoptosis-associated signaling pathways
are required for chemotherapy-mediated female germ cell
destruction. Nat. Med. 3, 1228-1232. [0298] Perez, G. I., Robles,
R., Knudson, C. M., Flaws, J. A., Korsmeyer, S. J., and Tilly, J.
L. (1999). Prolongation of ovarian lifespan into advanced
chronological age by Bax-deficiency. Nat. Genet. 21, 200-203 [0299]
Peters, H. (1969). The development of the mouse ovary from birth to
maturity. Acta Endocrinol. 62, 98-116. [0300] Peters, H. (1970).
Migration of gonocytes into the mammalian gonad and their
differentiation. Phil. Trans. Roy. Soc. Lond. B. 259, 91-101.
[0301] Philpott, C. C., Ringuette, M. J., and Dean, J. (1987).
Oocyte-specific expression and developmental regulation of ZP3, the
sperm receptor of the mouse zona pellucida. Dev. Biol. 121,
568-575. [0302] Pfaffl, M. W. (2001). A new mathematical model for
relative quantification in real-time RT-PCR. Nucleic Acids Res. 29,
e45. [0303] Rajkovic, A., Pangas, S. A., Ballow, D., Suzumori, N.,
and Matzuk, M. M. (2004). NOBOX deficiency disrupts early
folliculogenesis and oocyte-specific gene expression. Science 305,
1157-1159. [0304] Rich, I. N. (1995). Primordial germ cells are
capable of producing cells of the hematopoietic system in vitro.
Blood 86, 463-472. [0305] Richardson, S. J., Senikas, V., and
Nelson, J. F. (1987). Follicular depletion during the menopausal
transition: evidence for accelerated loss and ultimate exhaustion.
J. Clin. Endocrinol. Metab. 65, 1231-1237. [0306] Rongo, C.,
Broihier, H. T., Moore, L., Van Doren, M., Forbes, A., and Lehmann,
R. (1997). Germ plasm assembly and germ cell migration in
Drosophila. Cold Spring Harb. Symp. Quant. Biol. 62, 1-11. [0307]
Roussell, D. L., and Bennett, K. L. (1993). glh-1, a germ-line
putative RNA helicase from Caenorhabditis, has four zinc fingers.
Proc. Natl. Acad. Sci. USA 90, 9300-9304. [0308] Ryu, B. Y., Orwig,
K. E., Avarbock, M. R., and Brinster, R. L. (2003). Stem cell and
niche development in the postnatal rat testis. Dev. Biol. 263,
253-263. [0309] Saitou, M., Barton, S. C., and Surani, M. A.
(2002). A molecular programme for the specification of germ cell
fate in mice. Nature 418, 293-300. [0310] Salooja, N., Chatterjee,
R., McMillan, A. K., Kelsey, S. M., Newland, A. C., Milligan, D.
W., Franklin, I. M., Hutchinson, R. M., Linch, D. C., and
Goldstone, A. H. (1994). Successful pregnancies in women following
single autotransplant for acute myeloid leukemia with a
chemotherapy ablation protocol. Bone Marrow Transplant. 13,
431-435. [0311] Salooja, N., Szydlo, R. M., Socie, G., Rio, B.,
Chatterjee, R., Ljungman, P., Van Lint, M. T., Powles, R., Jackson,
G., Hinterberger-Fischer, M., Kolb, H. J., and Apperley, J. F; Late
Effects Working Party of the European Group for Blood and Marrow
Transplantation. (2001). Pregnancy outcomes after peripheral blood
or bone marrow transplantation: a retrospective study. Lancet 358,
271-276. [0312] Salustri, A., Fulop, C., Camaioni, A., and Hascall,
V. C. (2004). Oocyte-granulosa cell interactions. In The Ovary, 2nd
Edition, P. C. K. Leung and E. Y. Adashi, eds. (San Diego: Elsevier
Academic Press), pp. 131-143. [0313] Samuelsson, A., Fuchs, T.,
Simonsson, B., and Bjorkholm, M. (1993). Successful pregnancy in a
28-year-old patient autografted for acute lymphoblastic leukemia
following myeloablative treatment including total body irradiation.
Bone Marrow Transplant. 12, 659-660. [0314] Sanders, J. E., Hawley,
J., Levy, W., Gooley, T., Buckner, C. D., Deeg, H. J., Doney, K.,
Storb, R., Sullivan, K., Witherspoon, R., and Appelbaum, F. R.
(1996). Pregnancies following high-dose cyclophosphamide with or
without high-dose busulfan or total-body irradiation and bone
marrow transplantation. Blood 87, 3045-3052. [0315] Sarmiento, M.,
Glasebrook, A. L., and Fitch, F. W. (1980). IgG or IgM monoclonal
antibodies reactive with different determinants on the molecular
complex bearing Lyt2 antigen block T cell-mediated cytolysis in the
absence of complement. J. Immunol. 125, 2665-2672.
[0316] Scholer, H. R., Hatzopoulos, A. K., Balling, R., Suzuki, N.,
and Gruss, P. (1989). A family of octamer-specific proteins present
during mouse embryogenesis: evidence for germline-specific
expression of an Oct factor. EMBO J. 8, 2543-2550. [0317] Sette,
C., Dolci, S., Geremia, R., and Rossi, P. (2000). The role of stem
cell factor and of alternative c-kit gene products in the
establishment, maintenance and function of germ cells. Int. J. Dev.
Biol. 44, 599-608. [0318] Shen, H., Cheng, T., Olszak, I.,
Garcia-Zepeda, E., Lu, Z., Herrmann, S., Falon, R., Luster, A. D.,
and Scadden, D. T. (2001). CXCR-4 desensitization is associated
with tissue localization of hematopoietic progenitor cells. J.
Immunol. 166, 5027-5033. [0319] Shiromizu, K., Thorgeirsson, S. S.,
and Mattison, D. R. (1984). Effect of cyclophosphamide on oocyte
and follicle number in Sprague-Dawley rats, C57BL/6N and DBA/2N
mice. Pediatr. Pharmacol. 4, 213-221. [0320] Soyal, S. M., Amleh,
A., and Dean. J. (2000). FIG.quadrature., a germ cell-specific
transcription factor required for ovarian follicle formation.
Development 127, 4645-4654. [0321] Spangrude, G. J., and Scollay,
R. (1990). A simplified method for enrichment of mouse
hematopoietic stem cells. Exp. Hematol. 18, 920-926. [0322]
Spangrude, G. J., Heimfeld, S., and Weissman, I. L. (1988).
Purification and characterization of mouse hematopoietic stem
cells. Science 241, 58-62. [0323] Spradling, A. C. (1993).
Developmental genetics of oogenesis. In The Development of
Drosophila melanogaster, Volume I, M. Bate and A. Martinez Arias,
eds. (Cold Spring Harbor, N.Y.: Cold Spring Harbor Press), pp.
1-70. [0324] Spradling, A. H., Drummond-Barbosa, D., and Kai, T.
(2001). Stem cells find their niche. Nature 414, 98-104. [0325] Su,
A. I., Cooke, M. P., Ching, K. A., Hakak, Y., Walker, J. R.,
Wiltshire, T., Orth, A. P., Vega, R. G., Sapinoso, L. M., Moqrich,
A., Patapoutian, A., Hampton, G. M., Schultz, P. G., and Hogenesch,
J. B. (2004). A gene atlas of the mouse and human protein-encoding
transcriptomes. Proc. Natl. Acad. Sci. USA 101, 6062-6067. [0326]
Suzumori, N., Yan, C., Matzuk, M. M., and Rajkovic, A. (2002).
Nobox is a homeobox-encoding gene preferentially expressed in
primordial and growing oocytes. Mech. Dev. 111, 137-141. [0327]
Szabo, P. E., Hubner, K., Scholer, H., and Mann, J. R. (2002).
Allele-specific expression of imprinted genes in mouse migratory
primordial germ cells. Mech. Dev. 115, 157-160. [0328] te Velde, E.
R., and Pearson, P. L. (2002). The variability of female
reproductive ageing. Hum. Reprod. Update 8, 141-154. [0329] Telfer,
E. E. (2004). Germline stem cells in the postnatal mammalian ovary:
a phenomenon of prosimian primates and mice? Reprod. Biol.
Endocrinol. 2, 24. [0330] Tilly, J. L. (2001). Commuting the death
sentence: how oocytes strive to survive. Nat. Rev. Mol. Cell Biol.
2, 838-848. [0331] Tilly, J. L. (2003). Ovarian follicle
counts--not as simple as 1, 2, 3. Reprod. Biol. Endocrinol. 1, 11.
[0332] Tropel, P., Noel, D., Platet, N., Legrand, P., Benabid,
A.-L., and Berger, F. (2004). Isolation and characterisation of
mesenchymal stem cells from adult mouse bone marrow. Exp. Cell Res.
295, 395-406. [0333] Tsuda, M., Sasaoka, Y., Kiso, M., Abe, K.,
Haraguchi, S., Kobayashi, S., and Saga, Y. (2003). Conserved roles
of nanos proteins in germ cell development. Science 301, 1239-1241.
[0334] Van de Rijn, M., Heimfeld, S., Spangrude, G. J., and
Weissman, I. L. (1989). Mouse hematopoietic stem-cell antigen Sca-1
is a member of the Ly-6 antigen family. Proc. Natl. Acad. Sci. USA
86, 4634-4638. [0335] van den Hurk, R., and Zhao, J. (2005).
Formation of mammalian oocytes and their growth, differentiation
and maturation within ovarian follicles. Theriogenology 63,
1717-1751. [0336] Williams, D. E., de Vries, P., Namen, A. E.,
Widmer, M. B., and Lyman, S. D. (1992). The Steel factor. Dev.
Biol. 151, 368-376. [0337] Wognum, A. W., Eaves, A. C., and Thomas,
T. E. (2003). Identification and isolation of hematopoietic stem
cells. Arch. Med. Res. 34, 461-475. [0338] Xu, Y., Ashley, T.,
Brainerd, E. E., Bronson, R. T., Meyn, M. S., and Baltimore, D.
(1996). Targeted disruption of ATM leads to growth retardation,
chromosomal fragmentation during meiosis, immune defects, and
thymic lymphoma. Genes Dev. 10, 2411-2422. [0339] Yeom, Y. I.,
Fuhrmann, G., Ovitt, C. E., Brehm, A., Ohbo, K., Gross, M., Hailer,
K., and Scholer, H. R. (1996). Germline regulatory element of Oct-4
specific for the totipotent cycle of embryonal cells. Development
122, 881-894. [0340] Yoshimizu, T., Sugiyama, N., De Felice, M.,
Yeom, Y. I., Ohbo, K., Masuko, K., Obinata, M., Abe, K., Scholer,
H. R., and Matsui, Y. (1999). Germline-specific expression of the
Oct-4/green fluorescent protein (GFP) transgene in mice. Dev.
Growth Differ. 41, 675-684. [0341] Yuan, L., Liu, J. G., Hoja, M.
R., Wilbertz, J., Nordqvist, K., and Hoog, C. (2002). Female germ
cell aneuploidy and embryo death in mice lacking the
meiosis-specific protein SCP3. Science 296, 1115-1118. [0342] Zhu,
C. H., and Xie, T. (2003). Clonal expansion of ovarian germline
stem cells during niche formation in Drosophila. Development 130,
2579-258. [0343] Zuckerman, S. (1951). The number of oocytes in the
mature ovary. Recent Prog. Horm. Res. 6, 63-108. [0344] Zuckerman,
S., and Baker, T. G. (1977). The development of the ovary and the
process of oogenesis. In The Ovary, S. Zuckerman and B. J. Weir,
eds. (New York, N.Y.: Academic Press), pp. 41-67.
Sequence CWU 1
1
2127DNAArtificial SequencePrimer 1cacctcagag ggttttccaa gcgaggg
27221DNAArtificial SequencePrimer 2cctccttctg aacgggcctg a 21
* * * * *