U.S. patent application number 16/301167 was filed with the patent office on 2019-09-26 for airway mucus impaction.
The applicant listed for this patent is The Regents of the University of California, Wisconsin Alumni Research Foundation. Invention is credited to Eleanor Dunican, Brett Elicker, John Fahy, David Gierada, Scott Nagle, John Newell, Mark Schiebler.
Application Number | 20190290225 16/301167 |
Document ID | / |
Family ID | 60267688 |
Filed Date | 2019-09-26 |
View All Diagrams
United States Patent
Application |
20190290225 |
Kind Code |
A1 |
Dunican; Eleanor ; et
al. |
September 26, 2019 |
AIRWAY MUCUS IMPACTION
Abstract
Provided herein are, inter alia, methods and systems for
detecting mucus in the lungs of a subject. Aspects provide methods
and systems for the diagnosis, prognosis, characterization,
detection, and treatment of asthma, chronic obstructive pulmonary
disease, and type 2 inflammation.
Inventors: |
Dunican; Eleanor; (San
Francisco, CA) ; Fahy; John; (San Francisco, CA)
; Elicker; Brett; (San Francisco, CA) ; Newell;
John; (Iowa City, IA) ; Nagle; Scott;
(Madison, WI) ; Schiebler; Mark; (Madison, WI)
; Gierada; David; (St. Louis, MO) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Regents of the University of California
Wisconsin Alumni Research Foundation |
Oakland
Madison |
CA
WI |
US
US |
|
|
Family ID: |
60267688 |
Appl. No.: |
16/301167 |
Filed: |
May 12, 2017 |
PCT Filed: |
May 12, 2017 |
PCT NO: |
PCT/US17/32550 |
371 Date: |
November 13, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62336376 |
May 13, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Y 301/21001 20130101;
A61K 31/443 20130101; A61K 45/06 20130101; A61B 6/4208 20130101;
A61B 6/032 20130101; A61B 6/5205 20130101; C12Q 1/06 20130101; A61K
31/137 20130101; A61K 31/381 20130101; A61K 31/47 20130101; A61K
2300/00 20130101; A61K 31/47 20130101; A61K 31/215 20130101; A61K
2300/00 20130101; A61K 31/198 20130101; A61K 38/465 20130101; A61K
31/443 20130101 |
International
Class: |
A61B 6/03 20060101
A61B006/03; A61B 6/00 20060101 A61B006/00; A61K 38/46 20060101
A61K038/46; A61K 31/137 20060101 A61K031/137; A61K 31/198 20060101
A61K031/198; A61K 31/381 20060101 A61K031/381; A61K 31/215 20060101
A61K031/215; A61K 45/06 20060101 A61K045/06 |
Goverment Interests
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED
RESEARCH AND DEVELOPMENT
[0002] This invention was made with government support under grant
no. U10 HL109146, awarded by the National Institutes of Health. The
government has certain rights in the invention.
Claims
1. A method of treating a subject who has asthma or chronic
obstructive pulmonary disease (COPD), the method comprising:
detecting an airway mucus occlusion in a lung segment of the
subject; and administering to the subject a therapeutically
effective amount of a mucolytic agent or a type 2 inflammation
inhibitor, wherein the subject has an airway mucus occlusion in at
least one lung segment.
2. The method of claim 1, wherein an anticholinergic agent, a
bronchodilator, or a corticosteroid is not administered to the
subject.
3. The method of claim 1, wherein the airway mucus occlusion is an
airway mucus plug.
4. The method of any one of claims 1 to 3, wherein detecting the
airway mucus occlusion in a lung segment of the subject comprises
performing multidetector computed tomography (MDCT) scan.
5. The method of claim 4, further comprising applying iterative
reconstruction (IR) to produce images from the MDCT scan.
6. The method of any one of claims 1 to 5, wherein the airway mucus
occlusion is farther than about 2 cm from a diaphragmatic pleura
and/or a costal pleura in the subject.
7. The method of any one of claims 1 to 6, wherein the subject is a
human subject.
8. The method of any one of claims 1 to 7, wherein (a) the subject
has 20 lung segments, and the lung segment is the apical segment of
the upper lobe of the right lung, the posterior segment of the
upper lobe of the right lung, the anterior segment of the upper
lobe of the right lung, the lateral segment of the middle lobe of
the right lung, the medial segment of the middle lobe of the right
lung, the superior segment of the lower lobe of the right lung, the
medial segment of the lower lobe of the right lung, the anterior
segment of the lower lobe of the right lung, the lateral segment of
the lower lobe of the right lung, the posterior segment of the
lower lobe of the right lung, the apical segment of the upper lobe
of the left lung, the posterior segment of the upper lobe of the
left lung, the anterior segment of the upper lobe of the left lung,
the superior lingular segment of the upper lobe of the left lung,
the inferior lingular segment of the upper lobe of the left lung,
the superior segment of the lower lobe of the left lung, the
anterior segment of the lower lobe of the left lung, the medial
segment of the lower lobe of the left lung, the lateral segment of
the lower lobe of the left lung, or the posterior segment of the
lower lobe of the left lung; (b) the subject has 19 lung segments,
and the lung segment is the apical segment of the upper lobe of the
right lung, the posterior segment of the upper lobe of the right
lung, the anterior segment of the upper lobe of the right lung, the
lateral segment of the middle lobe of the right lung, the medial
segment of the middle lobe of the right lung, the superior segment
of the lower lobe of the right lung, the medial segment of the
lower lobe of the right lung, the anterior segment of the lower
lobe of the right lung, the lateral segment of the lower lobe of
the right lung, the posterior segment of the lower lobe of the
right lung, the apicoposterior segment of the upper lobe of the
left lung, the anterior segment of the upper lobe of the left lung,
the superior lingular segment of the upper lobe of the left lung,
the inferior lingular segment of the upper lobe of the left lung,
the superior segment of the lower lobe of the left lung, the
anterior segment of the lower lobe of the left lung, the medial
segment of the lower lobe of the left lung, the lateral segment of
the lower lobe of the left lung, or the posterior segment of the
lower lobe of the left lung; or (c) the subject has 18 lung
segments and the lung segment is the apical segment of the upper
lobe of the right lung, the posterior segment of the upper lobe of
the right lung, the anterior segment of the upper lobe of the right
lung, the lateral segment of the middle lobe of the right lung, the
medial segment of the middle lobe of the right lung, the superior
segment of the lower lobe of the right lung, the medial segment of
the lower lobe of the right lung, the anterior segment of the lower
lobe of the right lung, the lateral segment of the lower lobe of
the right lung, the posterior segment of the lower lobe of the
right lung, the apicoposterior segment of the upper lobe of the
left lung, the anterior segment of the upper lobe of the left lung,
the superior lingular segment of the upper lobe of the left lung,
the inferior lingular segment of the upper lobe of the left lung,
the superior segment of the lower lobe of the left lung, the
anteromedial segment of the lower lobe of the left lung, the
lateral segment of the lower lobe of the left lung, or the
posterior segment of the lower lobe of the left lung.
9. The method of claim 7 or 8, wherein the subject has 18, 19, or
20 lung segments.
10. The method of claim 9, wherein the subject has an airway mucus
occlusion in at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, or 18 lung segments.
11. The method of claim 10, wherein the subject has an airway mucus
occlusion in at least 4 lung segments.
12. The method of claim 10 or 11, wherein each of the airway mucus
occlusion is an airway mucus plug.
13. The method of any one of claims 9 to 12, wherein (a) the
subject has 20 lung segments, and the lung segments are any
combination of the apical segment of the upper lobe of the right
lung, the posterior segment of the upper lobe of the right lung,
the anterior segment of the upper lobe of the right lung, the
lateral segment of the middle lobe of the right lung, the medial
segment of the middle lobe of the right lung, the superior segment
of the lower lobe of the right lung, the medial segment of the
lower lobe of the right lung, the anterior segment of the lower
lobe of the right lung, the lateral segment of the lower lobe of
the right lung, the posterior segment of the lower lobe of the
right lung, the apical segment of the upper lobe of the left lung,
the posterior segment of the upper lobe of the left lung, the
anterior segment of the upper lobe of the left lung, the superior
lingular segment of the upper lobe of the left lung, the inferior
lingular segment of the upper lobe of the left lung, the superior
segment of the lower lobe of the left lung, the anterior segment of
the lower lobe of the left lung, the medial segment of the lower
lobe of the left lung, the lateral segment of the lower lobe of the
left lung, and/or the posterior segment of the lower lobe of the
left lung; (b) the subject has 19 lung segments, and the lung
segments are any combination of the apical segment of the upper
lobe of the right lung, the posterior segment of the upper lobe of
the right lung, the anterior segment of the upper lobe of the right
lung, the lateral segment of the middle lobe of the right lung, the
medial segment of the middle lobe of the right lung, the superior
segment of the lower lobe of the right lung, the medial segment of
the lower lobe of the right lung, the anterior segment of the lower
lobe of the right lung, the lateral segment of the lower lobe of
the right lung, the posterior segment of the lower lobe of the
right lung, the apicoposterior segment of the upper lobe of the
left lung, the anterior segment of the upper lobe of the left lung,
the superior lingular segment of the upper lobe of the left lung,
the inferior lingular segment of the upper lobe of the left lung,
the superior segment of the lower lobe of the left lung, the
anterior segment of the lower lobe of the left lung, the medial
segment of the lower lobe of the left lung, the lateral segment of
the lower lobe of the left lung, and/or the posterior segment of
the lower lobe of the left lung; or (c) the subject has 18 lung
segments, and the lung segments are any combination of the apical
segment of the upper lobe of the right lung, the posterior segment
of the upper lobe of the right lung, the anterior segment of the
upper lobe of the right lung, the lateral segment of the middle
lobe of the right lung, the medial segment of the middle lobe of
the right lung, the superior segment of the lower lobe of the right
lung, the medial segment of the lower lobe of the right lung, the
anterior segment of the lower lobe of the right lung, the lateral
segment of the lower lobe of the right lung, the posterior segment
of the lower lobe of the right lung, the apicoposterior segment of
the upper lobe of the left lung, the anterior segment of the upper
lobe of the left lung, the superior lingular segment of the upper
lobe of the left lung, the inferior lingular segment of the upper
lobe of the left lung, the superior segment of the lower lobe of
the left lung, the anteromedial segment of the lower lobe of the
left lung, the lateral segment of the lower lobe of the left lung,
and/or the posterior segment of the lower lobe of the left
lung.
14. The method of any one of claims 1 to 13, wherein the asthma is
chronic severe asthma.
15. The method of any one of claims 1 to 14, wherein the subject is
incompletely responsive to a bronchodilator or a
corticosteroid.
16. The method of any one of claims 1 to 15, wherein the mucolytic
agent is a thiol-based drug, a thiosaccharide, a recombinant human
DNAse, hypertonic saline, ambroxol, or an airway epithelial cell
ion channel modulator.
17. The method of claim 16, wherein the thiol-based drug is
n-acetylcysteine, carbocisteine, erdosteine, mecysteine, or a thiol
saccharide.
18. A method of treating a subject in need thereof, the method
comprising administering a therapeutically effective amount of a
mucolytic agent or a type 2 inflammation inhibitor to the subject,
wherein the subject has an airway mucus occlusion in at least four
lung segments.
19. The method of claim 18, wherein the subject has asthma or
COPD.
20. A method of detecting type 2 inflammation in a subject, the
method comprising: detecting an airway mucus occlusion in a lung
segment of the subject; and identifying the subject as having type
2 inflammation if subject has an airway mucus occlusion in a lung
segment.
21. The method of claim 20, further comprising administering a
therapeutically effective amount of a type 2 inflammation inhibitor
to the subject.
22. A diagnostic method comprising detecting an airway mucus
occlusion in a lung segment of a subject.
23. A method for identifying whether a subject is likely to respond
or responsive to treatment with a mucolytic agent or a type 2
inflammation inhibitor, the method comprising: detecting an airway
mucus occlusion in a lung segment of a subject; and identifying the
subject as likely to respond or responsive to treatment with a
mucolytic agent or a type 2 inflammation inhibitor if the subject
has an airway mucus occlusion in a lung segment.
24. A method for identifying whether a subject is unlikely to
respond, incompletely responsive, or unresponsive to treatment with
an anticholinergic agent, a bronchodilator, or a corticosteroid,
the method comprising: detecting an airway mucus occlusion in a
lung segment of a subject; and identifying the subject as unlikely
to respond, incompletely responsive, or unresponsive to treatment
with an anticholinergic agent, a bronchodilator, or a
corticosteroid if the subject has an airway mucus occlusion in a
lung segment.
25. The method of any one of claims 20 to 24, wherein the subject
has asthma or COPD.
26. The method of any one of claims 18 to 25, wherein the airway
mucus occlusion is an airway mucus plug.
27. The method of any one of claims 18 to 26, wherein detecting an
airway mucus occlusion in a lung segment of the subject comprises
performing a multidetector computed tomography (MDCT) scan.
28. The method of claim 27, further comprising applying iterative
reconstruction (IR) to produce images from the MDCT scan.
29. The method of any one of claims 22 to 28, wherein the airway
mucus occlusion is farther than about 2 cm from a diaphragmatic
pleura and/or a costal pleura in the subject.
30. A system, comprising: a scanner configured to capture one or
more lung images of a subject; at least one data processor; and at
least one memory storing instructions which, when executed by the
at least one data processor, result in operations comprising:
determining, based at least on the one or more lung images, a
quantification of mucus plugging for the subject; determining,
based at least on the quantification of mucus plugging, a diagnosis
for the subject, the diagnosis comprising a detection of an airway
mucus occlusion in at least one lung segment of the subject; and
identifying, based at least on the diagnosis, one or more
treatments for the subject, the one or more treatments including a
therapeutically effective amount of a mucolytic agent and/or a type
2 inflammation inhibitor.
31. The system of claim 30, wherein an anticholinergic agent, a
bronchodilator, and a corticosteroid are excluded from the one or
more treatments.
32. The system of claim 30, wherein the airway mucus occlusion
comprises an airway mucus plug.
33. The system of any one of claims 30 to 32, wherein the scanner
is configured to perform a multidetector computed tomography (MDCT)
scan of the subject.
34. The system of claim 33, wherein an iterative reconstruction
(IR) is applied to produce the one or more lung images from the
MDCT scan.
35. The system of any one of claims 30 to 34, wherein the airway
mucus occlusion is farther than about 2 centimeters (cm) from a
diaphragmatic pleura and/or a costal pleura in the subject.
36. The system of any of claims 30-35, wherein the subject is a
human subject.
37. The system of any of claims 30 to 36, wherein (a) the subject
has 20 lung segments, and the at least one lung segment is any one
of or any combination of the apical segment of the upper lobe of
the right lung, the posterior segment of the upper lobe of the
right lung, the anterior segment of the upper lobe of the right
lung, the lateral segment of the middle lobe of the right lung, the
medial segment of the middle lobe of the right lung, the superior
segment of the lower lobe of the right lung, the medial segment of
the lower lobe of the right lung, the anterior segment of the lower
lobe of the right lung, the lateral segment of the lower lobe of
the right lung, the posterior segment of the lower lobe of the
right lung, the apical segment of the upper lobe of the left lung,
the posterior segment of the upper lobe of the left lung, the
anterior segment of the upper lobe of the left lung, the superior
lingular segment of the upper lobe of the left lung, the inferior
lingular segment of the upper lobe of the left lung, the superior
segment of the lower lobe of the left lung, the anterior segment of
the lower lobe of the left lung, the medial segment of the lower
lobe of the left lung, the lateral segment of the lower lobe of the
left lung, and/or the posterior segment of the lower lobe of the
left lung; (b) the subject has 19 lung segments, and the at least
one lung segment is any one of or any combination the apical
segment of the upper lobe of the right lung, the posterior segment
of the upper lobe of the right lung, the anterior segment of the
upper lobe of the right lung, the lateral segment of the middle
lobe of the right lung, the medial segment of the middle lobe of
the right lung, the superior segment of the lower lobe of the right
lung, the medial segment of the lower lobe of the right lung, the
anterior segment of the lower lobe of the right lung, the lateral
segment of the lower lobe of the right lung, the posterior segment
of the lower lobe of the right lung, the apicoposterior segment of
the upper lobe of the left lung, the anterior segment of the upper
lobe of the left lung, the superior lingular segment of the upper
lobe of the left lung, the inferior lingular segment of the upper
lobe of the left lung, the superior segment of the lower lobe of
the left lung, the anterior segment of the lower lobe of the left
lung, the medial segment of the lower lobe of the left lung, the
lateral segment of the lower lobe of the left lung, and/or the
posterior segment of the lower lobe of the left lung; or (c) the
subject has 18 lung segments, and the at least one lung segment is
any one of or any combination of the apical segment of the upper
lobe of the right lung, the posterior segment of the upper lobe of
the right lung, the anterior segment of the upper lobe of the right
lung, the lateral segment of the middle lobe of the right lung, the
medial segment of the middle lobe of the right lung, the superior
segment of the lower lobe of the right lung, the medial segment of
the lower lobe of the right lung, the anterior segment of the lower
lobe of the right lung, the lateral segment of the lower lobe of
the right lung, the posterior segment of the lower lobe of the
right lung, the apicoposterior segment of the upper lobe of the
left lung, the anterior segment of the upper lobe of the left lung,
the superior lingular segment of the upper lobe of the left lung,
the inferior lingular segment of the upper lobe of the left lung,
the superior segment of the lower lobe of the left lung, the
anteromedial segment of the lower lobe of the left lung, the
lateral segment of the lower lobe of the left lung, and/or the
posterior segment of the lower lobe of the left lung.
38. The system of claim 36 or 37, wherein the at least one lung
segment comprises one of 18, 19, or 20 lung segments.
39. The system of claim 38, wherein the airway mucus occlusion is
present in at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, or 18 lung segments.
40. The system of claim 39, wherein the airway mucus occlusion is
present in at least 4 lung segments.
41. The system of any one of claims 30 to 40, wherein the mucolytic
agent is a thiol-based drug, a thiosaccharide, a recombinant human
DNAse, hypertonic saline, ambroxol, or an airway epithelial cell
ion channel modulator.
42. The system of claim 41, wherein the thiol-based drug is
n-acetylcysteine, carbocisteine, erdosteine, mecysteine, or a thiol
saccharide.
43. The system of any of claims 30 to 42, wherein the diagnosis
includes that the subject is unlikely to respond, incompletely
responsive, or unresponsive to treatment with an anticholinergic
agent, a bronchodilator, or a corticosteroid.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of priority to U.S.
Provisional Application No. 62/336,376, filed May 13, 2016, which
is hereby incorporated in its entirety and for all purposes.
INCORPORATION-BY-REFERENCE OF SEQUENCE LISTING
[0003] The content of the text file named
"48536-587001WO_SequenceListing.txt", which was created on May 12,
2017, and is 9,807 bytes in size, is hereby incorporated by
reference in its entirety.
BACKGROUND
[0004] Asthma and chronic obstructive pulmonary disease (COPD) are
common lung diseases that cause a large public health burden. The
treatments available for asthma and COPD are suboptimal and many
patients have unmet treatment needs. The pathologic mechanisms in
asthma and COPD include the accumulation of thick mucus in the
airways (mucus "plugs") that restrict airflow. Detecting mucus
plugs in the airways is difficult because they are not visible on
chest x rays and they are frequently not associated with any
symptoms of cough or sputum production. Because of the difficulty
in identifying patients with mucus plugs in their lungs, it has
been difficult to direct mucoactive treatments to this patient
subgroup. The inability to easily identify patients with lung mucus
plugs has also made it difficult to design clinical trials to test
mucoactive drugs in lung disease.
[0005] Biomarkers are needed to direct treatment in asthma, but
blood measures of inflammatory proteins have yielded limited
results.
BRIEF SUMMARY
[0006] Provided herein, inter alia, are methods and compositions
for the detection, diagnosis and treatment of asthma and COPD. Also
provided herein are systems and methods for the detection,
diagnosis and treatment of asthma and COPD. In embodiments, the
methods and systems allow for consistent quantification of lung
mucus plugging utilizing, for example, lung imaging thereby
providing non-invasive, accurate diagnosis and personalized
treatment strategies. In embodiments, the methods, systems, and
compositions described herein utilize imaging of the lungs as a
test to personalize treatment for patients with asthma or COPD who
have airflow obstruction from mucus plugging.
[0007] In an aspect, provided herein is a method of treating a
subject who has asthma or COPD. The method includes detecting an
airway mucus occlusion in a lung segment of the subject; and
administering to the subject a therapeutically effective amount of
a mucolytic agent or a type 2 inflammation inhibitor, wherein the
subject has an airway mucus occlusion in at least one lung
segment.
[0008] In an aspect, provided herein is a method of treating a
subject in need thereof. The method includes administering a
therapeutically effective amount of a mucolytic agent or a type 2
inflammation inhibitor to the subject, wherein the subject has an
airway mucus occlusion in at least four lung segments.
[0009] In an aspect, provided herein is a method of detecting type
2 inflammation in a subject. The method includes detecting an
airway mucus occlusion in a lung segment of the subject; and
identifying the subject as having type 2 inflammation if subject
has an airway mucus occlusion in a lung segment.
[0010] In an aspect, provided herein is a diagnostic method
comprising detecting an airway mucus occlusion in a lung segment of
a subject.
[0011] In an aspect, provided herein is a method for identifying
whether a subject is likely to respond or responsive to treatment
with a mucolytic agent or a type 2 inflammation inhibitor. The
method includes detecting an airway mucus occlusion in a lung
segment of a subject; and identifying the subject as likely to
respond or responsive to treatment with a mucolytic agent or a type
2 inflammation inhibitor if the subject has an airway mucus
occlusion in a lung segment.
[0012] In an aspect, provided herein is a method for identifying
whether a subject is unlikely to respond, incompletely responsive,
or unresponsive to treatment with an anticholinergic agent, a
bronchodilator, or a corticosteroid. The method includes detecting
an airway mucus occlusion in a lung segment of a subject; and
identifying the subject as unlikely to respond, incompletely
responsive, or unresponsive to treatment with an anticholinergic
agent, a bronchodilator, or a corticosteroid if the subject has an
airway mucus occlusion in a lung segment.
[0013] In an aspect, provided herein is a system, comprising: a
scanner configured to capture one or more lung images of a subject;
at least one data processor; and at least one memory storing
instructions which, when executed by the at least one data
processor, result in operations comprising: determining, based at
least on the one or more lung images, a quantification of mucus
plugging for the subject; determining, based at least on the
quantification of mucus plugging, a diagnosis for the subject, the
diagnosis comprising a detection of an airway mucus occlusion in at
least one lung segment of the subject; and identifying, based at
least on the diagnosis, one or more treatments for the subject, the
one or more treatments including a therapeutically effective amount
of a mucolytic agent and/or a type 2 inflammation inhibitor.
[0014] In aspects, provided herein are methods of treating a
subject with asthma or COPD. In embodiments, the method includes
identifying extensive airway mucus plugging; and administering a
therapeutically effective amount of a mucolytic agent or a type 2
inflammation inhibitor. In embodiments, the subject has extensive
airway mucus plugging. In embodiments, identifying extensive airway
mucus plugging includes performing a multidetector computed
tomography (MDCT) scan. In embodiments, the MDCT scan is a low dose
radiation MDCT. In embodiments, the method further includes
applying iterative reconstruction (IR) to produce images from an
MDCT scan. In embodiments, thin sections are used for IR. In
embodiments, the sections are less than about 2 mm thick, e.g.,
equal or less than 1.5, 1.25, 1, 0.75, 0.5, 0.25, 0.25-1.25,
0.5-1.25, 0.75-1.25, 0.75-1.5, or 1-1.25 mm thick. In embodiments,
the sections are equal to or less than 1.25 mm thick.
[0015] In aspects, the subject has complete mucus occlusion of an
airway lumen. In embodiments, the subject has complete mucus
occlusion of an airway lumen in at least one bronchopulmonary
segment. In embodiments, the subject has complete mucus occlusion
of an airway lumen in at least three bronchopulmonary segments. In
embodiments, the subject has 20 lung segments, and there is a
complete mucus occlusion in any 1 of, or any combination of 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 of, or
all 20 of the following: the apical segment of the upper lobe of
the right lung, the posterior segment of the upper lobe of the
right lung, the anterior segment of the upper lobe of the right
lung, the lateral segment of the middle lobe of the right lung, the
medial segment of the middle lobe of the right lung, the superior
segment of the lower lobe of the right lung, the medial segment of
the lower lobe of the right lung, the anterior segment of the lower
lobe of the right lung, the lateral segment of the lower lobe of
the right lung, the posterior segment of the lower lobe of the
right lung, the apical segment of the upper lobe of the left lung,
the posterior segment of the upper lobe of the left lung, the
anterior segment of the upper lobe of the left lung, the superior
lingular segment of the upper lobe of the left lung, the inferior
lingular segment of the upper lobe of the left lung, the superior
segment of the lower lobe of the left lung, the anterior segment of
the lower lobe of the left lung, the medial segment of the lower
lobe of the left lung, the lateral segment of the lower lobe of the
left lung, and/or the posterior segment of the lower lobe of the
left lung. In embodiments, the subject has 190 lung segments, and
there is a complete mucus occlusion in any 1 of, or any combination
of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18
of, or all 19 of the following: the apical segment of the upper
lobe of the right lung, the posterior segment of the upper lobe of
the right lung, the anterior segment of the upper lobe of the right
lung, the lateral segment of the middle lobe of the right lung, the
medial segment of the middle lobe of the right lung, the superior
segment of the lower lobe of the right lung, the medial segment of
the lower lobe of the right lung, the anterior segment of the lower
lobe of the right lung, the lateral segment of the lower lobe of
the right lung, the posterior segment of the lower lobe of the
right lung, the apicoposterior segment of the upper lobe of the
left lung, the anterior segment of the upper lobe of the left lung,
the superior lingular segment of the upper lobe of the left lung,
the inferior lingular segment of the upper lobe of the left lung,
the superior segment of the lower lobe of the left lung, the
anterior segment of the lower lobe of the left lung, the medial
segment of the lower lobe of the left lung, the lateral segment of
the lower lobe of the left lung, and/or the posterior segment of
the lower lobe of the left lung. In embodiments, the subject has 18
lung segments, and there is a complete mucus occlusion in any 1 of,
or any combination of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, or 17 of, or all 18 of the following: the apical segment of
the upper lobe of the right lung, the posterior segment of the
upper lobe of the right lung, the anterior segment of the upper
lobe of the right lung, the lateral segment of the middle lobe of
the right lung, the medial segment of the middle lobe of the right
lung, the superior segment of the lower lobe of the right lung, the
medial segment of the lower lobe of the right lung, the anterior
segment of the lower lobe of the right lung, the lateral segment of
the lower lobe of the right lung, the posterior segment of the
lower lobe of the right lung, the apicoposterior segment of the
upper lobe of the left lung, the anterior segment of the upper lobe
of the left lung, the superior lingular segment of the upper lobe
of the left lung, the inferior lingular segment of the upper lobe
of the left lung, the superior segment of the lower lobe of the
left lung, the anteromedial segment of the lower lobe of the left
lung, the lateral segment of the lower lobe of the left lung,
and/or the posterior segment of the lower lobe of the left lung. In
some aspects, the bronchopulmonary segments include the right or
left of any of the segments selected from the group consisting of
the upper lobe apical segment, upper lobe posterior segment, the
upper lobe anterior segment, the lateral/superior segment of the
middle lobe, or the medial/inferior segment of the middle lobe, the
superior segment of the lower lobe, the medial basal segment of the
lower lobe, the anterior basal segment of the lower lobe, the
lateral basal segment of the lower lobe, and/or the posterior basal
segment of the lower lobe.
[0016] In embodiments, the asthma is chronic severe asthma. In
embodiments, a subject is incompletely responsive to
bronchodilators (e.g., the subject has incompletely or not
responded to at least 1, 2, 3, 4, or 5 bronchodilators) and/or
corticosteroids (e.g., the subject has incompletely or not
responded to at least 1, 2, 3, 4, or 5 corticosteroids). In
embodiments, a mucolytic agent is a thiol-based drug, a recombinant
human DNAse, hypertonic saline, ambroxol, or an airway epithelial
cell ion channel modulator. In embodiments, the thiol-based drug is
n-acetylcysteine, carbocisteine, erdosteine, mecysteine, or a thiol
saccharide.
[0017] Each of the aspects and embodiments described herein are
capable of being used together, unless excluded either explicitly
or clearly from the context of the embodiment or aspect.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIGS. 1A-1I: Development and distribution of the CT mucus
score in asthma and healthy subjects. (FIG. 1A) Intraluminal mucus
plug with branching seen in longitudinal section (coronal plane).
Mucus is identified as a tubular opacification (white arrow) that
bifurcates distal to a patent airway. (FIG. 1B) Intraluminal mucus
plug with extensive branching seen in longitudinal section (white
arrow) extending to the lung periphery (transverse plane). The
mucus impaction is not associated with bronchial wall dilatation.
(FIG. 1C) Intraluminal mucus plug seen in cross-section (transverse
plane). Mucus is identified as rounded opacification (white arrow)
that is visible on sequential MDCT slices. (FIG. 1D) Schematic
representation showing how MDCT's were evaluated to generate the
mucus score. Airways within the 2-cm peripheral zone on MDCT
(arrow) or airways that were partially occluded were excluded from
assessment. Mucus plugs were defined as complete occlusion of an
airway. Each bronchopulmonary segment was assessed and scored for
the presence or absence of >1 mucus plug(s) and the segment
scores were summed to generate the mucus score. (FIG. 1E) Segment
score in healthy patients and patients with asthma. (FIG. 1F)
Frequency distribution of segment score in patients with asthma.
The code above the x-axis defines three mucus groups: "Zero"
indicates patients with a mucus score of 0 (zero-mucus group); the
"Low" indicates patients with mucus scores between 0.5 and 3.5
(low-mucus group) and "High" indicates patients with mucus scores
.gtoreq.4.0 (high-mucus group). (FIG. 1G) Sankey bar graph showing
frequency of zero, low and high mucus score in 25 asthmatics in
SARP-1/SARP-2 on the left and in the same asthmatics in SARP-3 on
the right, and the proportional change in the mucus score from
initial scan to rescan 2-9 years later. (FIG. 1H) Pie-chart of
segments with no mucus plugging on baseline scan; 79% of these
segments had no mucus plugging on re-scan. Pie. chart of segments
with mucus plugging on baseline scan; 65% of these segments had
mucus plugging on re-scan. (I) MDCTs showing a mucus plug occluding
the airway (yellow arrow) of the right lower lobe in 2010 and a
mucus plug occluding the same airway, visible more proximally
(yellow arrow) and branching into the adjacent airway, in the same
patient in 2013. *** Indicates p<0.001.
[0019] FIGS. 2A and 2B: High mucus scores in asthma patients with
airflow obstruction. (FIG. 2A) Segment scores in asthma patients
whose pre bronchodilator FEV1% predicted was >80%, 60-80%, and
<60%. *** Indicates significant difference compared to
FEV1%>80%, p<0.001. The green dashed boxes represent the
patients with a high mucus score. (FIG. 2B) High mucus score is
associated with lower FEV1% predicted, FVC % predicted and FEV1/FVC
predicted. *** Indicates significant difference compared to zero
mucus group, p<0.001. ** Indicates significant difference
compared to zero mucus group, p<0.01.
[0020] FIG. 3A-3D: High mucus score is associated with type 2
inflammation and altered airway mucin gene expression. (FIG. 3A)
Sputum eosinophil % was higher in the high mucus group than the low
and zero mucus groups. (FIG. 3B) Blood eosinophil counts were
higher in the high and low mucus groups than the zero mucus group.
(FIG. 3C) The "Th2 gene mean" (a composite metric of airway type-2
inflammation) in induced sputum cells was higher in the high mucus
than the zero mucus group. (FIG. 3D) The ratio of MUC5AC to MUC5B
gene expression was higher in the high mucus compared to the zero
mucus group. * Indicates significant difference compared to zero
mucus group, p<0.05. ** Indicates significant difference
compared to zero mucus group, p<0.01. *** Indicates significant
difference compared to zero mucus group, p<0.001.
[0021] FIG. 4A-4D: Airflow obstruction and sputum eosinophilia
persist after bronchodilator (BD) treatment and steroid treatment
in asthma patients with high mucus scores. (FIG. 4A) The absolute
change in FEV1% after maximum BD is similar in the three mucus
subgroups. The absolute change in FEV1% after intramuscular
corticosteroid tends to be higher in the high mucus group than the
zero mucus group. The absolute change in FEV1% after both maximum
bronchodilation and intramuscular corticosteroid is significantly
higher in the high mucus group than the zero mucus group (FIG. 4B)
The FEV1% predicted in the subjects with a high mucus score was
significantly lower than in subjects with a low mucus score
pre-treatment. The FEV1% predicted in the subjects with a high
mucus score remained significantly decreased post maximal
bronchodilator (BD) reversibility treatment and post steroid
(intramuscular triamcinolone acetonide) treatment. The FEV1%
predicted in the subjects with a high mucus score remained
significantly decreased post maximal BD and steroid treatment
combined. (FIG. 4C) The sputum eosinophil percentage was higher in
the high mucus group than the low and zero mucus groups both before
and after corticosteroid treatment (data also shown in FIG. 10A).
(FIG. 4D) The Th2 gene mean was higher in the high mucus group than
the zero mucus group both before and after corticosteroid
treatment. ** Indicates significant difference compared to zero
mucus group, p<0.001. *** Indicates significant difference
compared to zero mucus group, p<0.0001. (FIG. 4E) Bar graphs
representing the proportion of patients with a high mucus score
across three categories of FEV1% predicted at baseline
(pre-treatment), post maximal BD reversibility, post steroid
treatment and finally post maximal BD and steroid treatment
combined. (FIG. 4F) Bar graphs representing the proportion of
patients with an FEV1% predicted less than 80, across the three
categories of mucus score at baseline (pre-treatment), post maximal
BD reversibility, post steroid treatment and finally post maximal
BD and steroid treatment combined. **Indicates significantly
different to the zero-mucus group, p<0.01, ***Indicates
significantly different to the zero-mucus group, p<0.001.
[0022] FIG. 5: Visit procedures for patient characterization at
baseline in SARP. Eligibility was determined by maximum
bronchodilator reversibility test (MBRT) or methacholine challenge
on visit 1. If MBRT was performed more than 6 weeks before visit 2
it was repeated at visit 2. Visit 3 was 18.+-.3 days after visit
2.
[0023] FIG. 6: Development of the CT mucus score. The CT mucus
score was developed sequentially in 3 versions by consensus.
Version 1 scored both the central and peripheral airways and both
partial and complete airway occlusion by mucus. Version 2 excluded
the peripheral lung and required partial or complete occlusion of
segmental bronchi or complete occlusion of sub-segmental bronchi.
Version 3 excluded the peripheral lung to the mediastinal interface
and required complete occlusion of segmental and sub-segmental
bronchi. Version 3 was the scoring system used in this study. ICC
refers to the intraclass correlation coefficient.
[0024] FIG. 7: Exemplary web-based data capture tool. The figure
shows a screen capture of the web based survey form. The scoring
criteria are displayed at the top of the form and the radiologists
entered the data into the data fields shown at the bottom of the
form. The data capture shown in for the right upper
lobe--additional filed were available in the tool for other lung
lobes.
[0025] FIGS. 8A and 8B: Bronchiectasis and Mucus Score on CT. (FIG.
8A) Distribution of Bronchiectasis Score in asthmatics. Each lobe
was systematically examined for the presence or absence of
bronchiectasis defined by a bronchoarterial ratio .gtoreq.1.5. Only
20% of asthmatics had bronchiectasis (score >0) on CT. All
healthy subjects had a bronchiectasis score=0. (FIG. 8B)
Distribution of mucus plugging within the lung. Mucus burden in
each lobe is shown here as the number of segments with mucus
plugging (i.e. the segment score) in a given lobe as a percentage
of the total number of segments in that lobe. RUL=right upper lobe;
RML=right middle lobe, RLL=right lower lobe, LUL=left upper lobe;
LLL=left lower lobe. There was no significant difference in mucus
plugging across the lung lobes.
[0026] FIG. 9A-9C: Outline of method for determining Mucus Score.
FIG. 9A maps bronchopulmonary segments. FIG. 9B is a schematic of
the scoring method. FIG. 9C provides example MDCT images identify
mucus plugging.
[0027] FIGS. 10A-10D: High mucus score is associated with markers
of type 2 inflammation. (FIG. 10A) Sputum eosinophil % is
significantly increased in patients with a high mucus score and
remains significantly increased in patients with a high mucus score
following treatment with intramuscular steroid (triamcinolone
acetonide). (FIG. 10B) Gene expression for interleukin 13 is
significantly increased in patients with a high mucus score and
remains significantly increased in patients with a high mucus score
following treatment with intramuscular steroid. (FIG. 10C) Gene
expression for interleukin 5 is significantly increased in patients
with a high mucus score and remains significantly increased in
patients with a high mucus score following treatment with
intramuscular steroid. (FIG. 10D) The MUCSAC/MUCSB ratio is
significantly increased in patients with high mucus scores.
*Indicates p<0.05. **Indicates p<0.01. ***Indicates
p<0.001.
[0028] FIGS. 11A-H: Marked eosinophilia in a bronchopulmonary
segment with mucus plugs. (FIG. 11A) A low dose MDCT showing an
airway with mucus plug (arrow head) in anterior segment of the left
upper lobe (LB3b). (FIG. 11B) Kwik-Diff stain (ThermoFisher) of
cytospin from bronchoalveolar lavage from LB3b (20.times.
magnification) showing mucin that is densely infiltrated with
eosinophils. (FIG. 11C) Higher magnification image of the cytospin
region from panel B. (FIG. 11D) A schematic representation of a
transwell with airway epithelial cells in culture at air liquid
interface (ALI). Eotaxin-3 being secreted apically into the mucus
layer in response to IL-13 stimulation. (FIG. 11E) Bar graphs
representing the apical concentration of Eotaxin-3 collected from
airway epithelial cells grown at ALI stimulated with IL-13 or
untreated (control) in each donor and the average of the donors.
(FIG. 11F) A Schematic representation of the cysteine-linking assay
showing two cysteine monomers labeled with BODIPY FL fluorophore,
which fluoresces green when bound to a cysteine monomer but
quenches when two cysteines are oxidized to a cysteine dimer. (FIG.
11G) Effect of eosinophils, isolated from peripheral venous blood,
on cysteine crosslinking. BODIPY labeled cysteines undergo a minor
amount of time-dependent oxidation and cross-linking in the absence
of eosinophils, but cysteines exposed to eosinophils undergo much
more oxidation and cross-linking, especially when the eosinophils
are activated with phorbol-12-myristate-13-acetate (PMA). (FIG.
11H) Effect of eosinophils, isolated from peripheral venous blood,
on cysteine-crosslinking in the absence and presence of catalase.
Catalase attenuates the cysteine crosslinking seen in response to
unstimulated and PMA stimulated eosinophils compared to control.
Data in (FIG. 11E) represent 4 tracheal donors, in duplicate, (FIG.
11G) represent 3 asthmatic donors, in triplicate and (FIG. 11H)
represent data from an individual asthmatic donor, in triplicate.
The data are presented as means+SD. * Indicates p<0.05, t
indicates p<0.01, and .dagger-dbl. indicates p<0.001 for the
statistical difference between experimental condition(s) and
IL-13-free control in (FIG. 11E), cell-free control in (FIG. 11G)
and catalase-free control in (FIG. 11H).
[0029] FIG. 12: Conceptual model for how type 2 inflammation
promotes mucin plugs formation in asthma. IL-13 activated the
airway epithelium to secrete high concentrations of cysteine-rich
MUC5AC mucin and upregulates CCL26 to chemoattract eosinophils to
the airway lumen; IL-5 promotes survival of airway eosinophils,
which are activated to release reactive oxygen species (ROS) that
promote oxidation of mucin cysteine residues and mucin disulfide
crosslinking.
[0030] FIG. 13: Persistence of mucus phenotype by bronchopulmonary
segment. Persistent presence or absence of mucus plugs from first
to second scan, while very variable, were seen with similar
frequency across all bronchopulmonary segments. There was no apical
or basal pattern of involvement.
[0031] FIG. 14: Logistic regression of the effects of mucus score
on lung function. Logistic regression of the effects of mucus score
on lung function outcomes in asthma. Adjusted odds ratio for
effects of mucus score (ranging 0-20) on lung function before and
after triamcinolone therapy. The logistic models were adjusted for
age, gender, and wall thickness.
[0032] FIG. 15: Logistic regression of mucus score on markers of
type 2 inflammation. Adjusted odds ratio for effects of mucus score
(ranging 0-20) on type 2 markers before and after steroid
(triamcinolone acetate) treatment. The logistic models were
adjusted for age, gender, and wall thickness (surrogate for airway
remodeling).
[0033] FIG. 16: Airway measures by MDCT scan. The specific MDCT
scan measurements used included airway wall thickness (WT),
percentage of WT (WT %), luminal area (LA) and percentage of LA (LA
%).
[0034] FIG. 17: Modified web-based data capture tool used for
longitudinal measurements in a subset of the SARP cohort with
repeat MDCT scans. The figure shows a screen capture of the web
based survey form that was modified from the original data capture
tool to measure mucus plugging at a segmental level for comparison
within the same patient over time. The same scoring criteria were
displayed at the top of the form and the radiologists entered the
data into the data fields as shown here. The data capture shown
here is for each segment of right upper lobe--additional fields
were available in the tool for the segments in other lung
lobes.
[0035] FIG. 18: Asthma and COPD treatment system. The figure shows
a block diagram illustrating a system that is configured to treat
asthma and COPD.
[0036] FIG. 19: Method for treating asthma and COPD. The figure
shows a flowchart illustrating a process for treatment asthma and
COPD that may be performed by an asthma and COPD treatment
system.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0037] While various embodiments and aspects of the present
invention are shown and described herein, it will be obvious to
those skilled in the art that such embodiments and aspects are
provided by way of example only. Numerous variations, changes, and
substitutions will now occur to those skilled in the art without
departing from the invention. It should be understood that various
alternatives to the embodiments of the invention described herein
may be employed in practicing the invention.
[0038] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described. All documents, or portions of documents, cited in
the application including, without limitation, patents, patent
applications, articles, books, manuals, and treatises are hereby
expressly incorporated by reference in their entirety for any
purpose.
[0039] Unless defined otherwise herein, all technical and
scientific terms used herein have the same meaning as commonly
understood by one of ordinary skill in the art to which this
invention pertains.
[0040] "Asthma" is used herein according to its plain, ordinary
meaning and refers to a lung disease (typically a chronic lung
disease) that inflames and narrows the airways. In embodiments,
asthma includes reversible airflow obstruction and bronchospasms.
Asthma can cause recurring periods of wheezing (a whistling sound
when you breathe), chest tightness, shortness of breath, and/or
coughing. The coughing often occurs at night or early in the
morning. Additional examples of asthma symptoms include chest pain
and a sensation of chest tightness. Severe asthma is differentiated
from mild-moderate disease by age of onset, duration of disease,
degree of airflow impairment, cellular inflammation, presence of
sinusitis and history pneumonia.
[0041] "COPD" or "chronic obstructive pulmonary disease" is used
herein according to its plain, ordinary meaning and refers to an
inflammatory lung disease (often chronic inflammatory lung disease)
that causes obstructed airflow from the lungs. COPD may be a
progressive disease and symptoms may include breathing difficulty,
wheezing, cough, chest discomfort, respiratory distress, tachypnea,
cyanosis, use of accessory respiratory muscles, peripheral edema,
hyperinflation, chronic wheezing, abnormal lung sounds, prolonged
expiration, elevated jugular venous pulse, and sputum production.
COPD can cause coughing that produces large amounts of mucus,
wheezing, shortness of breath, chest tightness, and other symptoms.
In embodiments, a subject has been affirmatively diagnosed as
having COPD. In embodiments, a subject is suspected of having COPD.
In embodiments, a subject has at least 1, 2, 3, or 4 grandparents,
aunts, uncles, cousins, parents, or siblings who have COPD. In
embodiments, a subject's COPD has been worsening. In embodiments, a
subject has smoked cigarettes for at least about 1, 2, 3, 4, 5, 10,
15, 20, 25, or 30 years.
[0042] Asthma and COPD may have similar symptoms including
inflammation and mucus within the lungs. In embodiments,
identification of and quantification of mucus plugging within the
lungs aids in diagnosis, determining prognosis and individually
catering treatment protocols.
[0043] The term "subject" as used herein is interchangeable with
individual or patient, and may refer to a subject to be treated,
evaluated or assessed (e.g., diagnosed) using a method,
composition, or system provided herein. In some embodiments, the
subject is a mammal. In other embodiments, the mammal is a human.
In some cases, the methods of the invention find use in
experimental animals, in veterinary application, and in the
development of animal models for disease, including, but not
limited to, rodents including mice, rats, and hamsters, and
primates. In embodiments, a subject or "subject in need thereof" is
a living member of the animal kingdom suffering from or that may
suffer from the indicated disorder. In embodiments, the subject is
a member of a species comprising individuals who naturally suffer
from the disease. In embodiments, the subject is a mammal.
Non-limiting examples of mammals include rodents (e.g., mice and
rats), primates (e.g., lemurs, bushbabies, monkeys, apes, and
humans), rabbits, dogs (e.g., companion dogs, service dogs, or work
dogs such as police dogs, military dogs, race dogs, or show dogs),
horses (such as race horses and work horses), cats (e.g.,
domesticated cats), livestock (such as pigs, bovines, donkeys,
mules, bison, goats, camels, and sheep), and deer. In embodiments,
the subject is a human. In embodiments, the subject is a
non-mammalian animal such as a turkey, a duck, or a chicken. In
embodiments, a subject is a living organism suffering from or prone
to a disease or condition that can be treated by administration of
a composition or pharmaceutical composition as provided herein.
[0044] As used herein "extensive airway mucus plugging" refers to a
large number of occluded airways (e.g. completely occluded airways)
in one or more segments of the lungs. Identification of extensive
airway mucus plugging may be determined by assessing the quantity
of mucus in an airway within the lung of the subject. In
embodiments, a subject has 18 lung segments. In embodiments, a
subject has 19 lung segments. In embodiments, a subject has 20 lung
segments. In embodiments, extensive airway mucus plugging can
indicate complete occlusion of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, or 18 lung segments when a subject has
a bronchopulmonary system that is divided into 18 segments. In
embodiments, extensive airway mucus plugging can indicate complete
occlusion of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, or 19 lung segments when a subject has a
bronchopulmonary system that is divided into 19 segments. In
embodiments, extensive airway mucus plugging can indicate complete
occlusion of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, or 20 lung segments when a subject has a
bronchopulmonary system that is divided into 20 segments. In
embodiments, extensive airway mucus plugging can indicate complete
occlusion of about 5-10%, about 10-20%, about 20-30%, about 30-40%,
about 40-50%, about 50-60%, about 60-70%, about 70-80%, about
80-90%, about 90-100%, or about 5%, 10%, 15%, 20%, 30%, 40%, 50%,
60%, 70%, 80%, 90%, or 95% of segments.
[0045] As used herein, "complete mucus occlusion of an airway
lumen" indicates a complete opacification of an airway by mucus
with or without bronchial dilatation as indicated by, e.g., lung
imaging. In embodiments, mucus plugs can be detected (e.g. seen) in
sections (such as longitudinal sections) as tubular structures with
or without branching or in cross-section as rounded opacities.
[0046] As used herein "bronchopulmonary segment" and "lung segment"
refer to segments of the lung and airway. Bronchopulmonary segments
can segregate based on volumetric, functional, or anatomical
distinctions. Bronchopulmonary segments can be distinguished
between the right and left lungs and anterior or posterior side of
the lungs. The trachea divides at the carina forming the left and
right main stem bronchi which enter the lung substance to divide
further. This initial division is into secondary or lobar bronchi,
but subsequent divisions give rise to smaller and smaller bronchi
and bronchioles until the smallest bronchioles connect to alveoli.
In embodiments, each segment has its own pulmonary arterial branch
and thus, the bronchopulmonary segment is a portion of lung
supplied by its own bronchus and artery. In embodiments, each
segment is functionally and anatomically discrete allowing a single
segment to be surgically resected without affecting its neighboring
segments. In embodiments, a subject with COPD has some ventilator
communication between 2 or more segments. In embodiments, the
bronchopulmonary segments are classified using the Boyden
classification of bronchi, which is known in the art and provides a
standard nomenclature used to describe bronchopulmonary segmental
anatomy. See, e.g., Boyden, E. A. (1961) The nomenclature of the
bronchopulmonary segments and their blood supply. Dis. Chest
39:1-6, the entire content of which is incorporated herein by
reference. In embodiments, bronchopulmonary segmental anatomy
describes the division of the lungs into segments based on the
tertiary or segmental bronchi.
[0047] In embodiments, there are 20 total bronchopulmonary
segments. In embodiments, each lung has 10 segments: the upper
lobes contain 3 segments, the middle lobe/lingula 2 and the lower
lobes 5. In embodiments, bilaterally, the upper lobes have apical,
posterior and anterior segments and the lower lobes superior
(apical) and 4 basal segments (anterior, medial, posterior and
lateral). In embodiments in which there are 20 total
bronchopulmonary segments, the segments include the following 20
segments: (1) the apical segment of the upper lobe of the right
lung, (2) the posterior segment of the upper lobe of the right
lung, (3) the anterior segment of the upper lobe of the right lung,
(4) the lateral segment of the middle lobe of the right lung, (5)
the medial segment of the middle lobe of the right lung, (6) the
superior segment of the lower lobe of the right lung, (7) the
medial segment of the lower lobe of the right lung, (8) the
anterior segment of the lower lobe of the right lung, (9) the
lateral segment of the lower lobe of the right lung, (10) the
posterior segment of the lower lobe of the right lung, (11) the
apical segment of the upper lobe of the left lung, (12) the
posterior segment of the upper lobe of the left lung, (13) the
anterior segment of the upper lobe of the left lung, (14) the
superior lingular segment of the upper lobe of the left lung, (15)
the inferior lingular segment of the upper lobe of the left lung,
(16) the superior segment of the lower lobe of the left lung, (17)
the anterior segment of the lower lobe of the left lung, (18) the
medial segment of the lower lobe of the left lung, (19) the lateral
segment of the lower lobe of the left lung, and (20) the posterior
segment of the lower lobe of the left lung.
[0048] In embodiments, there are 19 total bronchopulmonary
segments. In embodiments in which there are 19 total
bronchopulmonary segments, the segments include the following 19
segments: (1) the apical segment of the upper lobe of the right
lung, (2) the posterior segment of the upper lobe of the right
lung, (3) the anterior segment of the upper lobe of the right lung,
(4) the lateral segment of the middle lobe of the right lung, (5)
the medial segment of the middle lobe of the right lung, (6) the
superior segment of the lower lobe of the right lung, (7) the
medial segment of the lower lobe of the right lung, (8) the
anterior segment of the lower lobe of the right lung, (9) the
lateral segment of the lower lobe of the right lung, (10) the
posterior segment of the lower lobe of the right lung, (11) the
apicoposterior segment of the upper lobe of the left lung, (12) the
anterior segment of the upper lobe of the left lung, (13) the
superior lingular segment of the upper lobe of the left lung, (14)
the inferior lingular segment of the upper lobe of the left lung,
(15) the superior segment of the lower lobe of the left lung, (16)
the anterior segment of the lower lobe of the left lung, (17) the
medial segment of the lower lobe of the left lung, (18) the lateral
segment of the lower lobe of the left lung, and (19) the posterior
segment of the lower lobe of the left lung.
[0049] In embodiments, there are 18 total bronchopulmonary
segments. In embodiments in which there are 18 total
bronchopulmonary segments, the segments include the following 18
segments: (1) the apical segment of the upper lobe of the right
lung, (2) the posterior segment of the upper lobe of the right
lung, (3) the anterior segment of the upper lobe of the right lung,
(4) the lateral segment of the middle lobe of the right lung, (5)
the medial segment of the middle lobe of the right lung, (6) the
superior segment of the lower lobe of the right lung, (7) the
medial segment of the lower lobe of the right lung, (8) the
anterior segment of the lower lobe of the right lung, (9) the
lateral segment of the lower lobe of the right lung, (10) the
posterior segment of the lower lobe of the right lung, (11) the
apicoposterior segment of the upper lobe of the left lung, (12) the
anterior segment of the upper lobe of the left lung, (13) the
superior lingular segment of the upper lobe of the left lung, (14)
the inferior lingular segment of the upper lobe of the left lung,
(15) the superior segment of the lower lobe of the left lung, (16)
the anteromedial segment of the lower lobe of the left lung, (17)
the lateral segment of the lower lobe of the left lung, and (18)
the posterior segment of the lower lobe of the left lung.
[0050] In embodiments, there are 10 segments in the right lung and
8 segments in the left lung. In embodiments, there are 10 segments
in the right lung and 8 segments in the left lung. In embodiments,
there are 10 bronchopulmonary segments in the left lung and 10
bronchopulmonary segments in the right lung. In embodiments, one or
more bronchopulmonary segments span the anterior and posterior of
the lung. In embodiments, one or more bronchopulmonary segments are
exclusive to the anterior or posterior of the lung. Examples of
bronchopulmonary segments include the upper lobe apical segment,
upper lobe posterior segment, the upper lobe anterior segment, the
lateral/superior segment of the middle lobe, or the medial/inferior
segment of the middle lobe, the superior segment of the lower lobe,
the medial basal segment of the lower lobe, the anterior basal
segment of the lower lobe, the lateral basal segment of the lower
lobe, and the posterior basal segment of the lower lobe of each of
the left and right lung. FIG. 9A indicates the location of
bronchopulmonary segments in subjects with 20 lung segments.
[0051] As used herein, "multidetector computed tomography (MDCT)
scan" is a method of computed tomography (CT) technology for
diagnostic imaging. Multidetector computed tomography (MDCT) may
also be referred to as multidetector CT, multidetector-row computed
tomography, multidetector-row CT, multisection CT, multislice
computed tomography, and multislice CT. MDCT scanning is a rapid,
painless diagnostic procedure that combines the use of computers
and, e.g., X-rays. In MDCT, a two-dimensional array of detector
elements replaces the linear array of detector elements used in
typical conventional and helical CT scanners. The two-dimensional
detector array permits CT scanners to acquire multiple slices or
sections simultaneously and greatly increase the speed of CT image
acquisition.
[0052] In embodiments, a multiplanar reconstruction of a CT scan is
created. In embodiments, the reconstruction is a multiplanar
reconstruction (MPR). In embodiments, a volume is built by stacking
axial slices from a CT scan. In embodiments, software then
reformats slices through the volume in a different plane (e.g.,
orthogonal). In embodiments, a projection method such as
maximum-intensity projection (MIP) or minimum-intensity projection
(mIP/MinIP), may be used to build the reconstructed slices.
[0053] In light of the subject matter disclosed herein, persons
skilled in the art will readily be able to apply the appropriate
dose of radiation for MDCT. In embodiments, the dose may vary
significantly (e.g., by 5%, 10%, 20%, 30%, 40%, 50% or more) from
patient to patient. In embodiments, the dose of radiation is
effective to reveal the presence of (e.g., produce an image of) one
or more mucus plugs and/or airway lumens in a lung. In embodiments,
no specific radiation dose is required. In embodiments, the dose is
adjusted based on patient size. In non-limiting examples, the dose
may comprise a mean effective dose (E) value of about 0.1-15 mSv,
about 3-12 mSv, about 0.1-5.0 mSv, about 0.5-4.0 mSv, about 0.1-3.0
mSv, about 0.1-2.5 mSv, about 0.1-2.0 mSv, about 0.1-1.5 mSv, about
0.1-1.0 mSv, about 0.1-0.9 mSv, about 0.1-0.8 mSv, about 0.1-0.7
mSv, about 0.1-0.6 mSv, about 0.1-0.5 mSv, about 0.1-0.4 mSv, about
0.1-0.3 mSv, about 12 mSv, about 11 mSv, about 10 mSv, about 9 mSv,
about 8 mSv, about 7 mSv, about 6 mSv, about 5 mSv, about 4 mSv,
about 3 mSv, about 2 mSv, about 1 mSv, about 0.5 mSv, about 0.3
mSv, or about 0.2 mSv. In a non-limiting example, low dose
radiation MDCT may be used. As used herein, "low dose radiation
MDCT" refers to MDCT protocols that utilize a lower dose than
standard radiographic images. Low dose radiation MDCT may comprise
a mean effective dose (E) value of about 0.3-2 mSv, e.g., about 0.1
mSv, about 0.4 mSv, about 0.5 mSv, about 0.6 mSv, about 0.7 mSv,
about 0.8 mSv, about 0.9 mSv, about 1 mSv, about 1.1 mSv, about 1.2
mSv, about 1.3 mSv, about 1.4 mSv, about 1.5 mSv, about 1.6 mSv,
about 1.7 mSv, about 1.8 mSv, about 1.9 mSv, or 2 mSv.
[0054] Image reconstruction in MDCT can more complicated than that
in single section CT. In embodiments, iterative reconstruction (IR)
is used to produce images from MDCT scans. IR is a method to
reconstruct 2-D and 3-D images from measured projections of an
object. IR of MDCT images is discussed in Jingyan Xu et al., J Am
Coll Radiol. 2009 April; 6(4): 274-276. and Frederic A. Mieville et
al., Eur. J. Med. Phys. January 2013Volume 29, Issue 1, Pages
99-110. included herein by reference in their entireties.
[0055] "Treatment," "treat," or "treating," as used herein covers
any treatment of a disease or condition of an individual and
includes, without limitation: (a) preventing the disease or
condition from occurring in an individual which may be predisposed
to the disease or condition but has not yet been diagnosed as
having it; (b) inhibiting the disease or condition, e.g., arresting
its development; (c) relieving and or ameliorating the disease or
condition, e.g., causing regression of the disease or condition; or
(d) curing the disease or condition, e.g., stopping its development
or progression. In embodiments, the population of individuals
treated by the methods of provided herein includes individuals
suffering from the undesirable condition or disease, as well as
individuals at risk for development of the condition or disease. In
embodiments, "treating" is in reference to a subject with asthma or
COPD.
[0056] As used herein, "therapeutically effective amount" refers to
an amount which is effective in reducing, eliminating, treating,
preventing or controlling a symptom (e.g., one or more symptoms) of
a disease or condition (such as, COPD or asthma). The term
"controlling" is intended to refer to all processes wherein there
may be a slowing, interrupting, arresting, or stopping of the
progression of a diseases and condition, but does not necessarily
indicate a total elimination of all disease and condition symptoms,
and is intended to include prophylactic treatment.
[0057] As used herein, the term "incompletely responsive" refers to
a treatment which has shown no symptomatic improvement or
symptomatic improvement but with at least some amount of one or
more symptoms remaining. In embodiments, the treatment has shown no
symptomatic improvement. In embodiments, the improvement is less
than is typically observed in subjects whose symptoms improve after
the treatment is administered. In embodiments, the improvement is
suboptimal. Suboptimal symptomatic improvement may, for example, be
short-lived, or may be to a degree insubstantial to provide a
subject in need relief of pain or discomfort. In embodiments, an
incomplete response is a lack of improvement or a suboptimal
improvement of any 1 of, or any combination of 2 or more of, the
following symptoms: shortness of breath, an abnormal lung sound
(such as wheezing), cough, chest discomfort (e.g., chest pain or a
sensation of chest tightness), tachypnea, cyanosis, use of
accessory respiratory muscles, peripheral edema, hyperinflation,
prolonged expiration, elevated jugular venous pulse, or sputum
production.
[0058] As used herein, the term "mucolytic agent" refers to an
agent (e.g. a pharmaceutical agent) that is used to dissolve or
breakdown mucus. In embodiments, a mucolytic agent acts to reduce
the viscosity of mucus so that it may be cleared from the
respiratory tract. In embodiments, a mucolytic agent reduces the
elasticity of mucus, such that the mucous may more readily be
cleared from the respiratory tract. In embodiments, a mucolytic
agent reduces both the viscosity and the elasticity of mucus.
Example mucolytic agents include, but are not limited to,
thiol-based drugs, recombinant human DNAse, hypertonic saline,
ambroxol, or an airway epithelial cell ion channel modulator.
[0059] As used herein, "thiol-based drugs" or "thiol donors" are
small molecule pharmaceuticals containing a thiol group. Mucolytic
thiol-based drugs include, for example, n-acetylcysteine,
Carbocisteine, Erdosteine, Mecysteine, or a thiol saccharide.
[0060] N-acetylcysteine is a mucolytic agent having the structure
below:
##STR00001##
[0061] Carbocisteine is a mucolytic agent having the structure
below:
##STR00002##
[0062] Erdosteine is a mucolytic agent having the structure
below:
##STR00003##
[0063] Mecysteine is a mucolytic agent having the structure
below:
##STR00004##
[0064] In embodiments, the mucolytic agent is a thiosaccharide. In
embodiments, the mucolytic agent is a thiol saccharide. In
embodiments, the mucolytic agent is a thioacetyl saccharide. The
term "thiosaccharide" as used herein refers to a compound
containing at least one tetrahydropyrane ring substituted with at
least one thiol (--SH) containing moiety or at least one thioacetyl
(--SAc) moiety (and optionally further substituted for example,
with hydroxyl moieties or additional tetrahydropyrane rings
tetrahydropyrane rings or tetrahydrofuran rings via ether linkers)
or at least one tetrahydrofuran ring substituted with at least one
thiol containing moiety (and optionally further substituted for
example, with hydroxyl moieties or additional tetrahydropyranee
rings or tetrahydrofuran rings via ether linkers). Thus, the term
"thiol saccharide" refers to a thiosaccharide with at least one
thiol (--SH) moiety, and the term "thioacetyl saccharide" refers to
a thiosaccharide with at least one thioacetyl (--SAc) moiety. The
tetrahydropyrane ring may be a pyranose ring or pyranoside ring in
which one or more hydroxyl groups are replaced with a thiol
containing moiety (referred to herein as a "thiol pyranose" or
"thiol pyranoside", respectively). The tetrahydropyrane ring may be
a pyranose ring or pyranoside ring in which one or more hydroxyl
groups are replaced with a thioacetyl containing moiety (referred
to herein as a "thioacetyl pyranose" or "thioacetyl pyranoside",
respectively). The tetrahydrofuran ring may be a furanose ring or
furanoside ring in which one or more hydroxyl groups are replaced
with a thiol containing moiety (referred to herein as a "thiol
pyranose" or "thiol pyranoside", respectively). The tetrahydrofuran
ring may be a furanose ring or furanoside ring in which one or more
hydroxyl groups are replaced with a thioacetyl containing moiety
(referred to herein as a "thioacetyl pyranose" or "thioacetyl
pyranoside", respectively). A "thiol monosaccharide" (e.g., thiol
monopyranose, thiol monopyranoside, thiol monofuranose, thiol
monofuranoside) as used herein refers to compound containing one
tetrahydropyrane ring substituted with at least one thiol (--SH)
containing moiety or one tetreahydrofuran ring substituted with at
least one thiol (--SH) containing moiety. A "thioacetyl
monosaccharide" (e.g., thioacetyl monopyranose, thioacetyl
monopyranoside, thioacetyl monofuranose, thioacetyl monofuranoside)
as used herein refers to compound containing one tetrahydropyrane
ring substituted with at least one thioacetyl (--SAc) containing
moiety or one tetreahydrofuran ring substituted with at least one
thioacetyl (--SAc) containing moiety. A "thiol disaccharide" (e.g.,
thiol dipyranoside, thiol dipyranoside, thiol difuranose, thiol
difuranoside) as used herein refers to a compound containing two
tetrahydropyrane rings substituted with at least one thiol (--SH)
containing moiety. A "thioacetyl disaccharide" (e.g., thioacetyl
dipyranoside, thioacetyl dipyranoside, thioacetyl difuranose,
thioacetyl difuranoside) as used herein refers to compound
containing two tetrahydropyrane rings substituted with at least one
thioacetyl (--SAc) containing moiety. A "thiol trisaccharide"
(e.g., thiol tripyranoside, thiol tripyranoside, thiol trifuranose,
thiol trifuranoside) as used herein refers to a compound containing
three tetrahydropyrane rings substituted with at least one thiol
(--SH) containing moiety. A "thioacetyl trisaccharide" (e.g.,
thioacetyl tripyranoside, thioacetyl tripyranoside, thioacetyl
trifuranose, thioacetyl trifuranoside) as used herein refers to
compound containing three tetrahydropyrane rings substituted with
at least one thioacetyl (--SAc) containing moiety. A "thiol
oligosaccharide" (e.g., thiol oligopyranoside, thiol
oligopyranoside, thiol oligofuranose, thiol oligofuranoside) as
used herein refers to a compound containing more than three
tetrahydropyrane rings substituted with at least one thiol (--SH)
containing moiety. A "thioacetyl oligosaccharide" (e.g., thioacetyl
oligopyranoside, thioacetyl oligopyranoside, thioacetyl
oligofuranose, thioacetyl oligofuranoside) as used herein refers to
a compound containing more than three tetrahydropyrane rings
substituted with at least one thioacetyl (--SAc) containing moiety.
In embodiments, the thiosaccharide is a thiosaccharide (e.g., a
thiol saccharide or a thioacetyl saccharide) as described in U.S.
Patent Application Publication No. 2016/0060284, published Mar. 3,
2016, the entire contents of which are incorporated herein by
reference. In embodiments, the thiolsaccharide has one of the
following structures:
##STR00005## ##STR00006## ##STR00007## ##STR00008##
##STR00009##
[0065] As used herein "thiol saccharides" or "thiol-modified
carbohydrates" include for example, methyl
6-thio-6-deoxy-.alpha.-D-galactopyranoside (TDG) (shown below) and
are further discussed in U.S. Patent Application Publication No.
2016/0060284, published Mar. 3, 2016 included by reference herein
in its entirety.
##STR00010##
[0066] In embodiments, a human DNase (hDNase) such as recombinant
human DNase (rhDNase) can be utilized to reduce the viscosity of
mucus and sputum in lung disorders. Without wishing to be bound to
any particular theory, it is believed that the viscosity of mucus
or sputum may be increased by large quantities of DNA which can be
alleviated by administration of recombinant human DNase. The term
"hDNase" as used herein includes any of the recombinant or
naturally-occurring forms of the hDNase or variants or homologs
thereof that maintain DNase activity (e.g. within at least 50%,
80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to
hDNase). In embodiments, the variants or homologs have at least
90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity
across the whole sequence or a portion of the sequence (e.g. a 50,
100, 150 or 200 continuous amino acid portion) compared to a
naturally occurring hDNase polypeptide. In embodiments, hDNase is
the protein encoded by the sequence identified by the GenBank
Accession No. M55983.1, or an isoform, a homolog or functional
fragment thereof.
[0067] In embodiments, a hypertonic saline is a saline solution
with a concentration of sodium chloride (NaCl) higher than
physiologic (e.g. 0.9%). In embodiments, a hypertonic saline
comprises a concentration of NaCl of about 1%, 1.5%, 2%, 2.5%, 3%,
3.5%, 4%, 4.5%, 5%, 0.9-3%, or 0.9-5% (w/v). In embodiments, a
hypertonic saline can be utilized in the treatment of asthma or
COPD. In embodiments, a hypertonic saline can be inhaled or
administered by nebulizer.
[0068] Ambroxol is an example of a mucolytic agent with
secretolytic and secretomotoric actions having the structure shown
below. Ambroxol is the active ingredient of Mucosolvan.RTM.,
Mucobrox.RTM., Mucol.RTM., Lasolvan.RTM., Mucoangin.RTM.,
Surbronc.RTM., Ambolar.RTM., and Lysopain.RTM.
##STR00011##
[0069] As used herein, an "airway epithelial cell ion channel
modulator" is an agent (e.g. pharmaceutical agent) that modulates
an ion channel in the airway epithelium. In embodiments, a
modulated ion channel include cystic fibrosis transmembrane
conductance regulator (CFTR). Non-limiting examples of modulators
of CFTR include ivacaftor (Kalydeco.RTM.) and lumacaftor. In
embodiments, these drugs can be used in a combination of ivacaftor
and lumacaftor (Orkambi.RTM.).
[0070] As used herein, a "type 2 inflammation inhibitor" is an
agent (e.g. a pharmaceutical agent) that target molecules within
the type 2 inflammation pathway to inhibit the type 2 inflammation
pathway. Non-limiting examples of type 2 inflammation inhibitors
include inhibitors of IgE, IL-4, IL-5 and IL-13. In embodiments, a
type 2 inflammation inhibitor is a prostaglandin D.sub.2 receptor 2
antagonist. Non-limiting examples of type 2 inflammation inhibitors
include Omalizumab, Mepolizumab, Benralizumab, Reslizumab,
Lebrikizumab, GSK679586, Tralokinumab, Dupilumab, and Fevipiprant.
Fevipiprant has the following structure:
##STR00012##
[0071] As used herein, the term "bronchodilator" refers to a
substance that dilates the bronchi and bronchioles, decreasing
resistance in the respiratory airway and increasing airflow to the
lungs. Bronchodilators are used in the treatment of lung disorders,
including COPD and asthma. In embodiments, a bronchodilator is
long-acting. In embodiments, a bronchodilator is short-acting.
Non-limiting examples of bronchodilators include albuterol
(Proventil HFA.RTM., ProAir.RTM., Ventolin HFA.RTM.), levalbuterol
(Xopenex.RTM.), ipratropium (Atrovent.RTM.), indacaterol
(Arcapta.RTM.), umeclidinium (Incruse.RTM.), tiotropium
(Spiriva.RTM.), olodaterol (Stiverdi.RTM.), formoterol
(Foradil.RTM.), aclidinium (Tudorza.RTM.), and salmeterol
(Serevent.RTM.). In embodiments, a bronchodilator is used alone or
and in combination with another medication (such as an
anti-inflammatory medication).
[0072] As used herein, the term "anticholinergic agent" refers to a
substance that blocks the activities of acetylcholine. In
embodiments, an anticholinergic agent is a muscarinic antagonist
with effects in the lung to dilate airway smooth muscle or decrease
mucus secretion from mucus cells. Non-limiting examples of short
acting muscarinic antagonist include atropine, glycopyrrolate,
oxitropium, and ipratropium. Non-limiting examples of long acting
muscarinic antagonists as include tiotropium, glycopyrronium
bromide, umeclidinium, and aclidinium bromide. In embodiments, an
anticholinergic agent prevents acetylcholine from binding to one or
more muscarinic receptors. In embodiments, the muscarinic receptors
are located on airway smooth muscle. In embodiments, an
anticholinergic agent prevents airway smooth muscle contraction
through muscarinic receptor blockade, thus acting as a
bronchodilator. In embodiments, an anticholinergic agent may be
used as a bronchodilator in the treatment of, e.g., asthma, chronic
bronchitis, and/or chronic obstructive pulmonary disease (COPD). A
general description of ipratropium and methods of production and
use may be found in U.S. Pat. No. 6,299,861, which is incorporated
by reference herein in its entirety and for all purposes. A general
description of tiotropium and methods of production and use may be
found in U.S. Pat. No. 5,610,163 and US20040132759 which are
incorporated by reference herein in their entirety and for all
purposes. A general description of aclidinium and methods of
production and use may be found in US Patent application
US20150093374 A1, which is incorporated by reference herein in its
entirety and for all purposes. A general description of
glycopyrronium and methods of production and use may be found in
U.S. Pat. No. 6,307,060 B1, which is incorporated by reference
herein in its entirety and for all purposes. Anticholinergic agents
may be used in combination and in combination with other
medications including anti-inflammatory medications and
bronchodilators.
[0073] As used herein the term "corticosteroid" includes adrenal
cortical steroids and derivatives thereof that possess local
anti-inflammatory activity, particularly on the mucous membranes.
These corticosteroids include for example, hydrocortisone, and
cortisone. Inhaled corticosteroids are used in the treatment of
asthma. Corticosteroid used in the treatment of COPD or asthma
include beclomethasone (QVAR.RTM.), budesonide (Pulmicort.RTM.),
ciclesonide (Alvesco.RTM.), flunisolide (Aerospan.RTM.),
fluticasone (Flovent.RTM.), and mometasone (Asmanex
Twisthaler.RTM.). In embodiments, a corticosteroids is used alone
or and in combination with another medication (such as a
bronchodilator).
[0074] In embodiments, a small molecule is a compound that is less
than 2000 daltons in mass. In embodiments, the molecular mass of
the small molecule is preferably less than 1000 daltons, more
preferably less than 600 daltons, e.g., the compound is less than
500 daltons, 400 daltons, 300 daltons, 200 daltons, or 100
daltons.
[0075] The transitional term "comprising," which is synonymous with
"including," "containing," or "characterized by," is inclusive or
open-ended and does not exclude additional, unrecited elements or
method steps. By contrast, the transitional phrase "consisting of"
excludes any element, step, or ingredient not specified in the
claim. The transitional phrase "consisting essentially of" limits
the scope of a claim to the specified materials or steps "and those
that do not materially affect the basic and novel
characteristic(s)" of the claimed invention.
[0076] As used herein, the singular terms "a," "an," and "the"
include the plural reference unless the context clearly indicates
otherwise.
[0077] Implementations of the present disclosure can include, but
are not limited to, methods consistent with the descriptions
provided herein as well as articles that comprise a tangibly
embodied machine-readable medium operable to cause one or more
machines (e.g., computers, etc.) to result in operations
implementing one or more of the described features. Similarly,
computer systems are also described that can include one or more
processors and one or more memories coupled to the one or more
processors. A memory, which can include a computer-readable storage
medium, can include, encode, store, or the like one or more
programs that cause one or more processors to perform one or more
of the operations described herein. Computer implemented methods
consistent with one or more implementations of the current subject
matter can be implemented by one or more data processors residing
in a single computing system or multiple computing systems. Such
multiple computing systems can be connected and can exchange data
and/or commands or other instructions or the like via one or more
connections, including but not limited to a connection over a
network (e.g. the Internet, a wireless wide area network, a local
area network, a wide area network, a wired network, or the like),
via a direct connection between one or more of the multiple
computing systems, etc.
[0078] One or more aspects or features of the subject matter
described herein can be realized in digital electronic circuitry,
integrated circuitry, specially designed application specific
integrated circuits (ASICs), field programmable gate arrays (FPGAs)
computer hardware, firmware, software, and/or combinations thereof.
These various aspects or features can include implementation in one
or more computer programs that are executable and/or interpretable
on a programmable system including at least one programmable
processor, which can be special or general purpose, coupled to
receive data and instructions from, and to transmit data and
instructions to, a storage system, at least one input device, and
at least one output device. The programmable system or computing
system can include clients and servers. A client and server are
generally remote from each other and typically interact through a
communication network. The relationship of client and server arises
by virtue of computer programs running on the respective computers
and having a client-server relationship to each other.
[0079] These computer programs, which can also be referred to
programs, software, software applications, applications,
components, or code, include machine instructions for a
programmable processor, and can be implemented in a high-level
procedural language, an object-oriented programming language, a
functional programming language, a logical programming language,
and/or in assembly/machine language. As used herein, the term
"machine-readable medium" refers to any computer program product,
apparatus and/or device, such as for example magnetic discs,
optical disks, memory, and Programmable Logic Devices (PLDs), used
to provide machine instructions and/or data to a programmable
processor, including a machine-readable medium that receives
machine instructions as a machine-readable signal. The term
"machine-readable signal" refers to any signal used to provide
machine instructions and/or data to a programmable processor. The
machine-readable medium can store such machine instructions
non-transitorily, such as for example as would a non-transient
solid-state memory or a magnetic hard drive or any equivalent
storage medium. The machine-readable medium can alternatively or
additionally store such machine instructions in a transient manner,
such as for example as would a processor cache or other random
access memory associated with one or more physical processor
cores.
[0080] To provide for interaction with a user, one or more aspects
or features of the subject matter described herein can be
implemented on a computer having a display device, such as for
example a cathode ray tube (CRT) or a liquid crystal display (LCD)
or a light emitting diode (LED) monitor for displaying information
to the user and a keyboard and a pointing device, such as for
example a mouse or a trackball, by which the user may provide input
to the computer. Other kinds of devices can be used to provide for
interaction with a user as well. For example, feedback provided to
the user can be any form of sensory feedback, such as for example
visual feedback, auditory feedback, or tactile feedback; and input
from the user can be received in any form, including, but not
limited to, acoustic, speech, or tactile input. Other possible
input devices include, but are not limited to, touch screens or
other touch-sensitive devices such as single or multi-point
resistive or capacitive trackpads, voice recognition hardware and
software, optical scanners, optical pointers, digital magnetic
resonance image (MRI) capture devices and associated interpretation
software, and the like.
[0081] In the descriptions herein and in the claims, phrases such
as "at least one of" or "one or more of" may occur followed by a
conjunctive list of elements or features. The term "and/or" may
also occur in a list of two or more elements or features. Unless
otherwise implicitly or explicitly contradicted by the context in
which it used, such a phrase is intended to mean any of the listed
elements or features individually or any of the recited elements or
features in combination with any of the other recited elements or
features. For example, the phrases "at least one of A and B;" "one
or more of A and B;" and "A and/or B" are each intended to mean "A
alone, B alone, or A and B together." A similar interpretation is
also intended for lists including three or more items. For example,
the phrases "at least one of A, B, and C;" "one or more of A, B,
and C;" and "A, B, and/or C" are each intended to mean "A alone, B
alone, C alone, A and B together, A and C together, B and C
together, or A and B and C together." Use of the term "based on,"
above and in the claims is intended to mean, "based at least in
part on," such that an unrecited feature or element is also
permissible.
[0082] The subject matter described herein can be embodied in
systems, apparatus, methods, and/or articles depending on the
desired configuration. The implementations set forth herein do not
represent all implementations consistent with the subject matter
described herein. Instead, they are merely some examples consistent
with aspects related to the described subject matter. Although a
few variations have been described in detail herein, other
modifications or additions are possible. In particular, further
features and/or variations can be provided in addition to those set
forth herein. For example, the implementations described herein can
be directed to various combinations and subcombinations of the
disclosed features and/or combinations and subcombinations of
several further features disclosed herein. In addition, the logic
flows depicted in the accompanying figures and/or described herein
do not necessarily require the particular order shown, or
sequential order, to achieve desirable results. Other
implementations can be within the scope of the claims.
Diagnostic and Treatment Methods
[0083] In an aspect, provided herein is a diagnostic method
comprising detecting an airway mucus occlusion in a lung segment of
a subject.
[0084] In an aspect, provided herein is a method for identifying
whether a subject is likely to respond or responsive to treatment
with a mucolytic agent or a type 2 inflammation inhibitor. The
method includes detecting an airway mucus occlusion in a lung
segment of a subject; and identifying the subject as likely to
respond or responsive to treatment with a mucolytic agent or a type
2 inflammation inhibitor if the subject has an airway mucus
occlusion in a lung segment.
[0085] In an aspect, provided herein is a method for identifying
whether a subject is unlikely to respond, incompletely responsive,
or unresponsive to treatment with an anticholinergic agent, a
bronchodilator, or a corticosteroid. The method includes detecting
an airway mucus occlusion in a lung segment of a subject; and
identifying the subject as unlikely to respond, incompletely
responsive, or unresponsive to treatment with an anticholinergic
agent, a bronchodilator, or a corticosteroid if the subject has an
airway mucus occlusion in a lung segment.
[0086] In an aspect, provided herein is a method of detecting type
2 inflammation in a subject. The method includes detecting an
airway mucus occlusion in a lung segment of the subject; and
identifying the subject as having type 2 inflammation if subject
has an airway mucus occlusion in a lung segment.
[0087] In an aspect, provided herein is a method of treating a
subject who has asthma or COPD. The method includes detecting an
airway mucus occlusion in a lung segment of the subject; and
administering to the subject a therapeutically effective amount of
a mucolytic agent or a type 2 inflammation inhibitor, wherein the
subject has an airway mucus occlusion in at least one lung
segment.
[0088] In an aspect, provided herein is a method of treating a
subject in need thereof. The method includes administering a
therapeutically effective amount of a mucolytic agent or a type 2
inflammation inhibitor to the subject, wherein the subject has an
airway mucus occlusion in at least four lung segments.
[0089] In an aspect, a method is provided for treating a subject
with asthma or COPD. In embodiments, the method includes
identifying airway mucus plugging in the subject. In embodiments,
the method further includes administering a therapeutically
effective amount of a mucolytic agent or a type 2 inflammation
inhibitor. In embodiments, the subject has extensive airway mucus
plugging.
[0090] In embodiments, an anticholinergic agent, a bronchodilator,
or a corticosteroid is not administered to the subject. In
embodiments, the subject has been administered an anticholinergic
agent, a bronchodilator, or a corticosteroid and one or more
symptoms of asthma or COPD have not improved after administration
of the anticholinergic agent, bronchodilator, or corticosteroid. In
embodiments, the subject is incompletely responsive to an
anticholinergic agent, a bronchodilator, or a corticosteroid.
[0091] In embodiments, the airway mucus occlusion is an airway
mucus plug.
[0092] In embodiments, detecting the airway mucus occlusion in a
lung segment of the subject comprises performing multidetector
computed tomography (MDCT) scan.
[0093] In embodiments, the method further comprises applying
iterative reconstruction (IR) to produce images from the low dose
MDCT scan.
[0094] In embodiments, the airway mucus occlusion is farther than
about 2 cm from a diaphragmatic pleura and/or a costal pleura in
the subject.
[0095] In embodiments, the subject is a human subject.
[0096] In embodiments, the subject has 20 lung segments, and the
lung segment is the apical segment of the upper lobe of the right
lung, the posterior segment of the upper lobe of the right lung,
the anterior segment of the upper lobe of the right lung, the
lateral segment of the middle lobe of the right lung, the medial
segment of the middle lobe of the right lung, the superior segment
of the lower lobe of the right lung, the medial segment of the
lower lobe of the right lung, the anterior segment of the lower
lobe of the right lung, the lateral segment of the lower lobe of
the right lung, the posterior segment of the lower lobe of the
right lung, the apical segment of the upper lobe of the left lung,
the posterior segment of the upper lobe of the left lung, the
anterior segment of the upper lobe of the left lung, the superior
lingular segment of the upper lobe of the left lung, the inferior
lingular segment of the upper lobe of the left lung, the superior
segment of the lower lobe of the left lung, the anterior segment of
the lower lobe of the left lung, the medial segment of the lower
lobe of the left lung, the lateral segment of the lower lobe of the
left lung, or the posterior segment of the lower lobe of the left
lung.
[0097] In embodiments, the subject has 19 lung segments, and the
lung segment is the apical segment of the upper lobe of the right
lung, the posterior segment of the upper lobe of the right lung,
the anterior segment of the upper lobe of the right lung, the
lateral segment of the middle lobe of the right lung, the medial
segment of the middle lobe of the right lung, the superior segment
of the lower lobe of the right lung, the medial segment of the
lower lobe of the right lung, the anterior segment of the lower
lobe of the right lung, the lateral segment of the lower lobe of
the right lung, the posterior segment of the lower lobe of the
right lung, the apicoposterior segment of the upper lobe of the
left lung, the anterior segment of the upper lobe of the left lung,
the superior lingular segment of the upper lobe of the left lung,
the inferior lingular segment of the upper lobe of the left lung,
the superior segment of the lower lobe of the left lung, the
anterior segment of the lower lobe of the left lung, the medial
segment of the lower lobe of the left lung, the lateral segment of
the lower lobe of the left lung, or the posterior segment of the
lower lobe of the left lung.
[0098] In embodiments, the subject has 18 lung segments and the
lung segment is the apical segment of the upper lobe of the right
lung, the posterior segment of the upper lobe of the right lung,
the anterior segment of the upper lobe of the right lung, the
lateral segment of the middle lobe of the right lung, the medial
segment of the middle lobe of the right lung, the superior segment
of the lower lobe of the right lung, the medial segment of the
lower lobe of the right lung, the anterior segment of the lower
lobe of the right lung, the lateral segment of the lower lobe of
the right lung, the posterior segment of the lower lobe of the
right lung, the apicoposterior segment of the upper lobe of the
left lung, the anterior segment of the upper lobe of the left lung,
the superior lingular segment of the upper lobe of the left lung,
the inferior lingular segment of the upper lobe of the left lung,
the superior segment of the lower lobe of the left lung, the
anteromedial segment of the lower lobe of the left lung, the
lateral segment of the lower lobe of the left lung, or the
posterior segment of the lower lobe of the left lung
[0099] In embodiments, the lung segment is the right or left of any
of the segments selected from the group consisting of the upper
lobe apical segment, upper lobe posterior segment, the upper lobe
anterior segment, the lateral/superior segment of the middle lobe,
or the medial/inferior segment of the middle lobe, the superior
segment of the lower lobe, the medial basal segment of the lower
lobe, the anterior basal segment of the lower lobe, the lateral
basal segment of the lower lobe, and the posterior basal segment of
the lower lobe.
[0100] In embodiments, the subject has 18, 19, or 20 lung segments.
In embodiments, the subject has 18 lung segments. In embodiments,
the subject has 19 lung segments. In embodiments, the subject has
20 lung segments.
[0101] In embodiments, the subject has an airway mucus occlusion
(such as an airway mucus plug) in at least 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 lung segments. In
embodiments, the subject has an airway mucus occlusion (such as an
airway mucus plug) in at least 2 lung segments. In embodiments, the
subject has an airway mucus occlusion (such as an airway mucus
plug) in at least 3 lung segments. In embodiments, the subject has
an airway mucus occlusion (such as an airway mucus plug) in at
least 4 lung segments. In embodiments, the subject has an airway
mucus occlusion (such as an airway mucus plug) in at least 5 lung
segments. In embodiments, the subject has an airway mucus occlusion
(such as an airway mucus plug) in at least 6 lung segments. In
embodiments, the subject has an airway mucus occlusion (such as an
airway mucus plug) in at least 7 lung segments. In embodiments, the
subject has an airway mucus occlusion (such as an airway mucus
plug) in at least 8 lung segments. In embodiments, the subject has
an airway mucus occlusion (such as an airway mucus plug) in at
least 9 lung segments. In embodiments, the subject has an airway
mucus occlusion (such as an airway mucus plug) in at least 10 lung
segments. In embodiments, the subject has an airway mucus occlusion
(such as an airway mucus plug) in at least 11 lung segments. In
embodiments, the subject has an airway mucus occlusion (such as an
airway mucus plug) in at least 12 lung segments. In embodiments,
the subject has an airway mucus occlusion (such as an airway mucus
plug) in at least 13 lung segments. In embodiments, the subject has
an airway mucus occlusion (such as an airway mucus plug) in at
least 14 lung segments. In embodiments, the subject has an airway
mucus occlusion (such as an airway mucus plug) in at least 15 lung
segments. In embodiments, the subject has an airway mucus occlusion
(such as an airway mucus plug) in at least 16 lung segments. In
embodiments, the subject has an airway mucus occlusion (such as an
airway mucus plug) in at least 17 lung segments. In embodiments,
the subject has an airway mucus occlusion (such as an airway mucus
plug) in at least 18 lung segments. In embodiments, the subject has
an airway mucus occlusion (such as an airway mucus plug) in at
least 19 lung segments. In embodiments, the subject has an airway
mucus occlusion (such as an airway mucus plug) in at least 20 lung
segments.
[0102] In embodiments, subject has an airway mucus occlusion in at
least 4 lung segments.
[0103] In embodiments, each of the airway mucus occlusion is an
airway mucus plug.
[0104] In embodiments, the subject has 20 lung segments, and the
lung segments are any combination of 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, or 19 of, or all 20 of: the apical
segment of the upper lobe of the right lung, the posterior segment
of the upper lobe of the right lung, the anterior segment of the
upper lobe of the right lung, the lateral segment of the middle
lobe of the right lung, the medial segment of the middle lobe of
the right lung, the superior segment of the lower lobe of the right
lung, the medial segment of the lower lobe of the right lung, the
anterior segment of the lower lobe of the right lung, the lateral
segment of the lower lobe of the right lung, the posterior segment
of the lower lobe of the right lung, the apical segment of the
upper lobe of the left lung, the posterior segment of the upper
lobe of the left lung, the anterior segment of the upper lobe of
the left lung, the superior lingular segment of the upper lobe of
the left lung, the inferior lingular segment of the upper lobe of
the left lung, the superior segment of the lower lobe of the left
lung, the anterior segment of the lower lobe of the left lung, the
medial segment of the lower lobe of the left lung, the lateral
segment of the lower lobe of the left lung, and/or the posterior
segment of the lower lobe of the left lung.
[0105] In embodiments, the subject has 19 lung segments, and the
lung segments are any combination of 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, or 18 of, or all 19 of: the apical
segment of the upper lobe of the right lung, the posterior segment
of the upper lobe of the right lung, the anterior segment of the
upper lobe of the right lung, the lateral segment of the middle
lobe of the right lung, the medial segment of the middle lobe of
the right lung, the superior segment of the lower lobe of the right
lung, the medial segment of the lower lobe of the right lung, the
anterior segment of the lower lobe of the right lung, the lateral
segment of the lower lobe of the right lung, the posterior segment
of the lower lobe of the right lung, the apicoposterior segment of
the upper lobe of the left lung, the anterior segment of the upper
lobe of the left lung, the superior lingular segment of the upper
lobe of the left lung, the inferior lingular segment of the upper
lobe of the left lung, the superior segment of the lower lobe of
the left lung, the anterior segment of the lower lobe of the left
lung, the medial segment of the lower lobe of the left lung, the
lateral segment of the lower lobe of the left lung, and/or the
posterior segment of the lower lobe of the left lung.
[0106] In embodiments, the subject has 18 lung segments, and the
lung segments are any combination of 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, or 17 of, or all 18 of: the apical segment
of the upper lobe of the right lung, the posterior segment of the
upper lobe of the right lung, the anterior segment of the upper
lobe of the right lung, the lateral segment of the middle lobe of
the right lung, the medial segment of the middle lobe of the right
lung, the superior segment of the lower lobe of the right lung, the
medial segment of the lower lobe of the right lung, the anterior
segment of the lower lobe of the right lung, the lateral segment of
the lower lobe of the right lung, the posterior segment of the
lower lobe of the right lung, the apicoposterior segment of the
upper lobe of the left lung, the anterior segment of the upper lobe
of the left lung, the superior lingular segment of the upper lobe
of the left lung, the inferior lingular segment of the upper lobe
of the left lung, the superior segment of the lower lobe of the
left lung, the anteromedial segment of the lower lobe of the left
lung, the lateral segment of the lower lobe of the left lung,
and/or the posterior segment of the lower lobe of the left
lung.
[0107] In embodiments, the lung segments are the right or left of
any of the segments selected from the group consisting of the upper
lobe apical segment, upper lobe posterior segment, the upper lobe
anterior segment, the lateral/superior segment of the middle lobe,
or the medial/inferior segment of the middle lobe, the superior
segment of the lower lobe, the medial basal segment of the lower
lobe, the anterior basal segment of the lower lobe, the lateral
basal segment of the lower lobe, and/or the posterior basal segment
of the lower lobe.
[0108] In embodiments, the asthma is chronic severe asthma.
[0109] In embodiments, the subject is incompletely responsive to a
bronchodilator or a corticosteroid.
[0110] In embodiments, the mucolytic agent is a thiol-based drug, a
thiosaccharide, a DNase (such as a recombinant human DNAse),
hypertonic saline, ambroxol, or an airway epithelial cell ion
channel modulator.
[0111] In embodiments, the thiol-based drug is n-acetylcysteine,
carbocisteine, erdosteine, mecysteine, or a thiosaccharide (such as
a thiol saccharide or a thioacetyl saccharide).
[0112] In embodiments, the subject is not administered an
anticholinergic agent, a bronchodilator, or a corticosteroid is not
administered if 1 or more airway mucus plugs is detected. In
embodiments, the subject is administered a mucolytic agent or a
type 2 inflammation inhibitor if 1 or more airway mucus plugs is
detected. In embodiments, the subject is not administered an
anticholinergic agent, a bronchodilator, or a corticosteroid is not
administered if 2 or more airway mucus plugs are detected. In
embodiments, the subject is administered a mucolytic agent or a
type 2 inflammation inhibitor if 2 or more airway mucus plugs are
detected. In embodiments, the subject is not administered an
anticholinergic agent, a bronchodilator, or a corticosteroid is not
administered if 3 or more airway mucus plugs are detected. In
embodiments, the subject is administered a mucolytic agent or a
type 2 inflammation inhibitor if 3 or more airway mucus plugs are
detected. In embodiments, the subject is not administered an
anticholinergic agent, a bronchodilator, or a corticosteroid is not
administered if 4 or more airway mucus plugs are detected. In
embodiments, the subject is administered a mucolytic agent or a
type 2 inflammation inhibitor if 4 or more airway mucus plugs are
detected. In embodiments, the subject is not administered an
anticholinergic agent, a bronchodilator, or a corticosteroid is not
administered if 5 or more airway mucus plugs are detected. In
embodiments, the subject is administered a mucolytic agent or a
type 2 inflammation inhibitor if 5 or more airway mucus plugs are
detected. In embodiments, the subject is not administered an
anticholinergic agent, a bronchodilator, or a corticosteroid is not
administered if 6 or more airway mucus plugs are detected. In
embodiments, the subject is administered a mucolytic agent or a
type 2 inflammation inhibitor if 6 or more airway mucus plugs are
detected. In embodiments, the subject is not administered an
anticholinergic agent, a bronchodilator, or a corticosteroid is not
administered if 7 or more airway mucus plugs are detected. In
embodiments, the subject is administered a mucolytic agent or a
type 2 inflammation inhibitor if 7 or more airway mucus plugs are
detected. In embodiments, the subject is not administered an
anticholinergic agent, a bronchodilator, or a corticosteroid is not
administered if 8 or more airway mucus plugs are detected. In
embodiments, the subject is administered a mucolytic agent or a
type 2 inflammation inhibitor if 8 or more airway mucus plugs are
detected. In embodiments, the subject is not administered an
anticholinergic agent, a bronchodilator, or a corticosteroid is not
administered if 9 or more airway mucus plugs are detected. In
embodiments, the subject is administered a mucolytic agent or a
type 2 inflammation inhibitor if 9 or more airway mucus plugs are
detected. In embodiments, the subject is not administered an
anticholinergic agent, a bronchodilator, or a corticosteroid is not
administered if 10 or more airway mucus plugs are detected. In
embodiments, the subject is administered a mucolytic agent or a
type 2 inflammation inhibitor if 10 or more airway mucus plugs are
detected. In embodiments, the subject is not administered an
anticholinergic agent, a bronchodilator, or a corticosteroid is not
administered if 11 or more airway mucus plugs are detected. In
embodiments, the subject is administered a mucolytic agent or a
type 2 inflammation inhibitor if 11 or more airway mucus plugs are
detected. In embodiments, the subject is not administered an
anticholinergic agent, a bronchodilator, or a corticosteroid is not
administered if 12 or more airway mucus plugs are detected. In
embodiments, the subject is administered a mucolytic agent or a
type 2 inflammation inhibitor if 12 or more airway mucus plugs are
detected. In embodiments, the subject is not administered an
anticholinergic agent, a bronchodilator, or a corticosteroid is not
administered if 13 or more airway mucus plugs are detected. In
embodiments, the subject is administered a mucolytic agent or a
type 2 inflammation inhibitor if 13 or more airway mucus plugs are
detected. In embodiments, the subject is not administered an
anticholinergic agent, a bronchodilator, or a corticosteroid is not
administered if 14 or more airway mucus plugs are detected. In
embodiments, the subject is administered a mucolytic agent or a
type 2 inflammation inhibitor if 14 or more airway mucus plugs are
detected. In embodiments, the subject is not administered an
anticholinergic agent, a bronchodilator, or a corticosteroid is not
administered if 15 or more airway mucus plugs are detected. In
embodiments, the subject is administered a mucolytic agent or a
type 2 inflammation inhibitor if 15 or more airway mucus plugs are
detected. In embodiments, the subject is not administered an
anticholinergic agent, a bronchodilator, or a corticosteroid is not
administered if 16 or more airway mucus plugs are detected. In
embodiments, the subject is administered a mucolytic agent or a
type 2 inflammation inhibitor if 16 or more airway mucus plugs are
detected. In embodiments, the subject is not administered an
anticholinergic agent, a bronchodilator, or a corticosteroid is not
administered if 17 or more airway mucus plugs are detected. In
embodiments, the subject is administered a mucolytic agent or a
type 2 inflammation inhibitor if 17 or more airway mucus plugs are
detected. In embodiments, the subject is not administered an
anticholinergic agent, a bronchodilator, or a corticosteroid is not
administered if 18 or more airway mucus plugs are detected. In
embodiments, the subject is administered a mucolytic agent or a
type 2 inflammation inhibitor if 18 or more airway mucus plugs are
detected. In embodiments, the subject is not administered an
anticholinergic agent, a bronchodilator, or a corticosteroid is not
administered if 19 or more airway mucus plugs are detected. In
embodiments, the subject is administered a mucolytic agent or a
type 2 inflammation inhibitor if 19 or more airway mucus plugs are
detected. In embodiments, the subject is not administered an
anticholinergic agent, a bronchodilator, or a corticosteroid is not
administered if 20 or more airway mucus plugs are detected. In
embodiments, the subject is administered a mucolytic agent or a
type 2 inflammation inhibitor if 20 or more airway mucus plugs are
detected. In embodiments, the airway mucus plugs are in different
lung segments.
[0113] In embodiments, identification of extensive airway mucus
plugging is determined by assessing the quantity of mucus in an
airway within the lung of the subject. The quantity of mucus may be
measured using a variety of techniques. Useful techniques include
quantification of lung images from a subject (e.g. a patient with
asthma or COPD). In embodiments, based on the lung images, the
quantity of mucus plugging may be assess in one or more
sub-segmental lung airways. Mucus plugs are a complete
opacification of an airway by mucus with or without bronchial
dilatation. Mucus plugs can be seen in, e.g., longitudinal sections
as tubular structures with or without branching or in cross-section
as rounded opacities. In embodiments, a visual scoring system is
utilize to assess the quantity of mucus in an airway within the
lung of the subject. In embodiments, the visual scoring system is
based on a lung scan image (i.e. an image based on a lung
scan).
[0114] In embodiments, the lung scan may be performed using a
non-invasive imaging procedure such as a computerized tomography
(CT) scan. In embodiments, the CT scan is an ultralow-dose CT scan.
In embodiments, lung images are captured using a computed
tomography technology (e.g. Multidetector Computed Tomography
(MDCT)).
[0115] In embodiments, the system and methods included herein
provide detailed methodologies of quantifying mucus plugging by
identifying occluded airways in segments of the lungs. In
embodiments, the airways in each segment are systematically
examined for the presence or absence of a mucus plug. In
embodiments, a segment is given a score of 1 if an airway within
the segment contains a mucus plug. In embodiments, partial
occlusion of an airway is not scored. In embodiments, the scores of
each segment are summed to give a score (e.g., the Dunican Score,
also called the Dunican Mucus Score).
[0116] In embodiments, the scoring method can be used to quantify
the number of mucus occluded airways in each of 18, 19, or 20
bronchopulmonary lung segments on MDCT lung scans (see, e.g., FIG.
9). In embodiments, the lung is divided anatomically into 18
segments, each with its own airway (that branches further) and
blood vessel(s). In embodiments, the lung is divided anatomically
into 19 segments, each with its own airway (that branches further)
and blood vessel(s). In embodiments, the lung is divided
anatomically into 20 segments, each with its own airway (that
branches further) and blood vessel (s). In embodiments,
bronchopulmonary segments include the upper lobe apical segment,
upper lobe posterior segment, upper lobe anterior segment, the
lateral/superior segment of the middle lobe, the medial/inferior
segment of the middle lobe, the superior segment of the lower lobe,
the medial basal segment of the lower lobe, the anterior basal
segment of the lower lobe, the lateral basal segment of the lower
lobe, or the posterior basal segment of the lower lobe.
[0117] In embodiments, the scoring method measures the burden of
intraluminal mucus on Multi Detector Computerized Tomography (MDCT)
by quantifying the number of bronchopulmonary segments that are
completely occluded with mucus. Using post bronchodilator CT lung
images captured when the subject has inhaled to total lung
capacity, the segments of each lobe are systematically examined for
the presence (score 1) or absence (score 0) of mucus plugs. In
embodiments, the segment scores of each lobe are summed to generate
a total mucus score for both lungs ranging from 0 to 20 (for human
subjects having 20 segments). In embodiments, the segment scores of
each lobe are summed to generate a total mucus score for both lungs
ranging from 0 to 19 (for human subjects having 19 segments). In
embodiments, the segment scores of each lobe are summed to generate
a total mucus score for both lungs ranging from 0 to 18 (for human
subjects having 18 segments)
[0118] In embodiments, peripheral airways within about 2 cm (e.g.,
within 1.8, 1.9, 2, 2.1, or 2.2) of the diaphragmatic pleura and
costal pleura (the latter extending from the midline anteriorly to
the transverse process of the thoracic spine posteriorly) are
excluded from evaluation as the small caliber of these peripheral
airways makes occlusion by mucus difficult to ascertain. In
embodiments, mucus plugs are defined as complete occlusion of an
airway lumen by mucus. In embodiments, mucus plugs are identified
as tubular structures with or without branching in longitudinal
section or as rounded opacities in cross-section and differentiated
from blood vessels by their position relative to adjacent bronchi
and blood vessels. In embodiments, in cases where the plugs are
difficult to differentiate from normal blood vessels, they are
traced cephalad or caudad on adjacent lung slices to confirm their
continuity with bronchi.
[0119] In embodiments, in applying the scoring methods of the
present invention (score range: 0-20, or 0-19 or 1-18) to MDCT lung
scans from patients with asthma and COPD, a subgroup with mucus
scores >3 (e.g., at least 4) can be identified. These
"mucus-high" patients are characterized by more severe airflow
obstruction, high levels of airway and systemic type 2
inflammation, and relative resistance to usual asthma and COPD
treatments. Notably, this "mucus-high" disease subtype is not
revealed by mucus symptoms or by specific tests of lung function.
Therefore, these asthma.sup.mucus-high and COPD.sup.mucus-high
patient subgroups represent new disease phenotypes that require
treatment interventions that specifically target mucus plugging of
the airways.
[0120] In embodiments, the scoring method utilizes a simple 18, 19,
or 20-point visual scoring system. The system was developed by
application to MDCT scans from asthmatics and healthy controls. In
embodiments, the scoring system assigns a score of 1 to any lung
segment with an airway within it completely occluded with mucus. In
embodiments, MDCT reveals mucus plugging in subsegmental airways in
at least one of 18, 19, or 20 lung segments in asthmatics. In
embodiments, a subject has a mucus plug in a subsegmental airway in
at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, or 18) of 18, 19, or 20 lung segments. In embodiments,
a subject has a mucus plug in a subsegmental airway in at least one
(e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
or 18) of 18 lung segments. In embodiments, a subject has a mucus
plug in a subsegmental airway in at least one (e.g., 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) of 19 lung
segments. In embodiments, a subject has a mucus plug in a
subsegmental airway in at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) of 20 lung
segments. In embodiments, a high mucus score (plugging in at least
4 segments) is indicative of asthma with severe airflow
obstruction. In embodiments, a high mucus score is a biomarker
indicating need for treatment with a mucolytic drug.
[0121] In embodiments, the presence of a mucus plug in a
subsegmental airway is a marker of type 2 inflammation. In
embodiments, a subject with type 2 inflammation is identified as
likely to respond to (e.g., be treated by) a type 2 inflammation
inhibitor. In embodiments, a subject with type 2 inflammation has a
mucus plug in a subsegmental airway in at least one (e.g., 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18) of 18, 19,
or 20 lung segments. In embodiments, a subject with type 2
inflammation has a mucus plug in a subsegmental airway in at least
one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, or 18) of 18 lung segments. In embodiments, a subject with type
2 inflammation has a mucus plug in a subsegmental airway in at
least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, or 19) of 19 lung segments. In embodiments, a subject
with type 2 inflammation has a mucus plug in a subsegmental airway
in at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, or 20) of 20 lung segments. In embodiments,
a high mucus score (plugging in at least 4 segments) is indicative
of type 2 inflammation. In embodiments, a subject with type 2
inflammation in administered a type 2 inflammation inhibitor. In
embodiments, the type 2 inflammation inhibitor is a prostaglandin
D.sub.2 receptor 2 antagonist. In embodiments, the type 2
inflammation inhibitor is Omalizumab, Mepolizumab, Benralizumab,
Reslizumab, Lebrikizumab, GSK679586, Tralokinumab, Dupilumab, or
Fevipiprant.
[0122] Imaging of the lungs has been previously utilized in the
diagnosis of lung diseases. Previous methods of quantifying lung
mucus occlusion, including the Bhalla scoring system, have not been
robust in their applicability to multiple lung diseases. These
prior scoring methods quantified mucus based on few lung lobes, or
used arbitrary zones and often utilized lower resolution imaging.
In embodiments, methods provided herein allow for consistent
scoring utilizing low-radiation, high resolution imaging (e.g.
Multidetector Computed Tomography (MDCT)). Additional assays for
the detection and diagnosis of lung disorders include spirometry,
flow assays, methacholine challenges, nitric oxide exhalation
studies, chest x-ray, sputum eosinophil evaluation, and provocative
testing with either exercise or cold-induced asthma. These tests
can be used in addition to the methods provided herein for further
diagnostic clarity. In embodiments, a method provided herein is
part of a battery of diagnostic testing for a lung disorder such as
COPD or asthma.
[0123] In an aspect, provided herein is a method of treating a
subject who has asthma or COPD. The method includes detecting an
airway mucus occlusion in a lung segment of the subject; and
administering to the subject a therapeutically effective amount of
a mucolytic agent or a type 2 inflammation inhibitor, wherein the
subject has an airway mucus occlusion in at least one lung
segment.
[0124] In an aspect, provided herein is a method of treating a
subject in need thereof. The method includes administering a
therapeutically effective amount of a mucolytic agent or a type 2
inflammation inhibitor to the subject, wherein the subject has an
airway mucus occlusion in at least four lung segments.
[0125] In embodiments, methods provided herein may be used to
identify patients with excessive airway mucus plugging. In
embodiments, this disease subset can be better served by treatment
particular to airway mucus plugging. In embodiments, treatments may
include mucoactive drugs that hasten mucus clearance or drugs that
suppress type 2 inflammation (an upstream cause of mucus plugs).
Non-limiting categories of potentially useful mucoactive drugs
include mucolytics that target the polymers that impart abnormal
biophysical properties to airway mucus. In embodiments, mucolytics
include thiol-based drugs such as N-acetycysteine that lyse mucin
polymers, and rhDNAse drugs that cleave DNA polymers. In
embodiments, N-acetyl cysteine (NAC) can be used as a nebulized
mucolytic treatment to improve airflow, as it liquefies asthma
mucus. Other mucoactive drugs that improve mucociliary clearance
include hypertonic saline and drugs that affect the function of
airway epithelial cell ion channels. Non-limiting categories of
type 2 inflammation inhibitors include small molecule and protein
therapeutics that inhibit molecular members of the type 2
inflammation cascade (e.g. inhibitors of IL-4, IL-5, IL-13, IL-25,
IL-33, and TSLP, as well as inhibitors of CRTH2 and Siglec-8). In
embodiments, treatment may include a mucolytic agent such as a
thiol-based drug (n-acetylcysteine, carbocisteine, erdosteine,
mecysteine, or thiol saccharides), a DNase such as a recombinant
human DNAse, hypertonic saline, ambroxol, or an airway epithelial
cell ion channel modulator.
Device Assisted Identification of Mucus Plugging
[0126] In an aspect is provided an application to facilitate the
generation of a mucus score for an individual with asthma or COPD
by a clinical radiologist to aid in the proper and accurate
assessment of airway mucus plugging on MDCT lung scans. In
embodiments, an application (e.g., a computer or smart phone app)
can provide training or an outline in the scoring of mucus plugs in
MDCT images. In embodiments, an application can facilitate or
record the generation of an accurate Mucus Score to specifically
diagnose patients who have a high mucus subset of asthma or
COPD.
Asthma and COPD Treatment System and Method
[0127] FIG. 18 depicts a block diagram illustrating an asthma and
COPD treatment system 1800, in accordance with some example
embodiments. Referring to FIG. 18, the asthma and COPD treatment
system 1800 can be configured to diagnose and treat asthma and
COPD. As shown in FIG. 1800, the asthma and COPD treatment system
1800 can include a scanner 1810, a scoring module 1820, a
diagnostic module 1830, a treatment module 1840, and a user
interface module 1850. It should be appreciated that the asthma and
COPD treatment system 1800 can include additional and/or different
modules than shown.
[0128] In some embodiments, the scanner 1810 can be configured to
perform a non-invasive imaging procedure in order to capture, for
example, one or more lung images. For example, the scanner 1810 can
be a CT scanner and/or a MDCT scanner.
[0129] In some embodiments, the scoring module 1820 can be
configured to quantify mucus plugging based on the images captured
by the scanner 1810. The scoring module 1820 may quantify mucus
plugging by at least identifying, in the images captured by the
scanner 1810, occluded airways in one or more segments of the
lungs. It should be appreciated that the lung may be divided
anatomically into 18 segments, 19 segments, and/or 20 segments. As
such, the scoring module 1820 can quantify mucus plugging by
identifying occluded airways in each of 18 lung segments, 19 lung
segments, and/or 20 lung segments. For example, the scoring module
1820 can identify occluded airways in an upper lobe apical segment,
an upper lobe posterior segment, an upper lobe anterior segment, a
lateral/superior segment of the middle lobe, a medial/inferior
segment of the middle lobe, a superior segment of the lower lobe, a
medial basal segment of the lower lobe, an anterior basal segment
of the lower lobe, a lateral basal segment of the lower lobe,
and/or a posterior basal segment of the lower lobe of a lung.
[0130] The scoring module 1820 can examine the airways in a lung
segment for the presence and/or absence of a mucus plug in the lung
segment. The scoring module 1820 may further determine an overall
score that quantifies mucus plugging based on the presence and/or
absence of mucus plugs in various lung segments. It should be
appreciated that this overall score can be a Dunican Score and/or a
Dunican Mucus Score. To determine the overall score for the
subject, the scoring module 1820 can assign an individual score to
each lung segment. For example, an individual score can be a binary
value, such as a "1" or a "0," corresponding to the presence and/or
absence of a mucus plug within a lung segment. The overall score
can include a summation of the individual scores assigned to each
lung segment. For instance, in a human subject having 20 lung
segments, the overall score can range from 0 to 20. Alternately
and/or additionally, in a human subject having 19 lung segments,
the overall score can range from 0 to 19. Meanwhile, in a human
subject having 18 lung segments, the overall score can range from 0
to 18.
[0131] In some embodiments, the diagnostic module 1830 may be
configured to determine a diagnosis based on the overall score
quantifying mucus plugging. For example, the diagnostic module 1830
can identify "mucus-high" subjects whose overall score exceeds a
threshold value (e.g., 3). As noted earlier, "mucus-high" subjects
exhibit more severe airflow obstruction, high levels of airway and
systemic type 2 inflammation, and relative resistance to usual
asthma and COPD treatments. Thus, the diagnostic module 1830 may
identify these subjects as having new disease phenotypes that
require treatment interventions that specifically target mucus
plugging of the airways.
[0132] In some embodiments, the treatment module 1840 can be
configured to determine one or more treatments for subjects
identified (e.g., by the diagnostic module 1830) as "mucus-high"
subjects. For example, the one or more treatments can include
mucoactive drugs that hasten mucus clearance and/or drugs that
suppress type 2 inflammation. Alternately and/or additionally, the
one or more treatments can include a mucolytic agent such as a
thiol-based drug (n-acetylcysteine, carbocisteine, erdosteine,
mecysteine, or thiol saccharides), a DNase such as a recombinant
human DNAse, hypertonic saline, ambroxol, or an airway epithelial
cell ion channel modulator.
[0133] It should be appreciated that the treatment module 1840 may
identify mucoactive drugs including, for example, mucolytics that
target the polymers that impart abnormal biophysical properties to
airway mucus. Such mucolytics can include thiol-based drugs such as
N-acetycysteine that lyse mucin polymers, and rhDNAse drugs that
cleave DNA polymers. The N-acetyl cysteine (NAC) can be used as a
nebulized mucolytic treatment to improve airflow, as it liquefies
asthma mucus. Alternately and/or additionally, the treatment module
1840 can also identify mucoactive drugs that improve mucociliary
clearance include hypertonic saline and drugs that affect the
function of airway epithelial cell ion channels. Non-limiting
categories of type 2 inflammation inhibitors include small molecule
and protein therapeutics that inhibit molecular members of the type
2 inflammation cascade (e.g. inhibitors of IL-4, IL-5, IL-13,
IL-25, IL-33, and TSLP, as well as inhibitors of CRTH2 and
Siglec-8).
[0134] In some embodiments, the user interface module 1850 can be
configured to generate one or more user interfaces, such as graphic
user interfaces (GUIs), for interacting with the asthma and COPD
treatment system 1800. For example, the user interface module 1850
can generate user interfaces configured for receiving inputs from a
user such as, for example, a physician, a laboratory technician,
and/or any other medical professional. Alternately and/or
additionally, the user interface module 1850 can generate user
interfaces for displaying outputs from the asthma and COPD
treatment system 1800. These outputs may include, for example, the
diagnosis determined by the diagnostic module 1830 and/or the
treatments identified by the treatment module 1840.
[0135] FIG. 19 depicts a flowchart illustrating a process 1900 for
treating asthma and COPD, in accordance with some example
embodiments. Referring to FIGS. 18-19, the process 1900 may be
performed by the asthma and COPD treatment system 1800.
[0136] The asthma and COPD treatment system 1800 can capture one or
more lung images of a subject (1902). For example, the asthma and
COPD treatment system 1800 (e.g., the scanner 1810) can perform a
non-invasive imaging procedure, such as a CT scan and/or an MDCT
scan, in order to capture the one or more lung images.
[0137] The asthma and COPD treatment system 1800 can determine,
based on the one or more lung images, a quantification of mucus
plugging for the subject (1904). For example, the asthma and COPD
treatment system 1800 (e.g., the scoring module 1820) can quantify
mucus plugging by at least identifying, in the one or more lung
images, occluded airways in one or more segments of the lungs. In
some embodiments, the asthma and COPD treatment system 1800 can
examine the airways in each lung segment for the presence and/or
absence of mucus plugs. Furthermore, the scoring module 1820 can
determine an overall score that quantifies mucus plugging based on
the presence and/or absence of mucus plugs in various lung
segments. This overall score can be a summation of the individual
scores assigned to each lung segment. As noted earlier, the
individual score assigned to a lung segment may be a binary value
(e.g., a 1 or a 0) indicative of whether a mucus plug is present or
absent in that lung segment.
[0138] The asthma and COPD treatment system 1800 can determine,
based on the quantification of mucus plugging, a diagnosis for the
subject (1906). For example, in some embodiments, the asthma and
COPD treatment system 1800 (e.g., the diagnostic module 1830) can
diagnose a subject as being "mucus-high" when the overall score for
the subject exceeds a threshold value (e.g., 3).
[0139] The asthma and COPD treatment system 1800 can determine,
based on the diagnosis, one or more treatments for the subject
(1908). For example, the asthma and COPD treatment system 1800
(e.g., the treatment module 1840) can identify treatments for a
subject diagnosed as being "mucus-high." The treatments can
include, for example, mucoactive drugs that hasten mucus clearance,
drugs that suppress type 2 inflammation, mucolytic agents (e.g., a
thiol-based drug), a DNase (e.g., recombinant human DNAse),
hypertonic saline, ambroxol, and/or an airway epithelial cell ion
channel modulator.
[0140] The asthma and COPD treatment system 1800 can generate a
user interface displaying the diagnosis and/or the one or more
treatments for the subject (1910). In some example, embodiments,
the asthma and COPD treatment system 1800 (e.g., the user interface
module 1850) can generate one or more user interfaces (e.g., GUIs)
for displaying the diagnosis and/or the treatments for the
subject.
EMBODIMENTS
[0141] Embodiments include P1 to P12 following.
Embodiment P1
[0142] A method of treating a subject with asthma or COPD, the
method comprising: [0143] identifying extensive airway mucus
plugging; and administering a therapeutically effective amount of a
mucolytic agent or a type 2 inflammation inhibitor, wherein said
subject has extensive airway mucus plugging.
Embodiment P2
[0144] The method of embodiment 1, wherein identifying extensive
airway mucus plugging comprises performing a multidetector computed
tomography (MDCT) scan.
Embodiment P3
[0145] The method of embodiment 2, wherein said MDCT is a low dose
radiation MDCT.
Embodiment P4
[0146] The method of embodiment 3, further comprising applying
iterative reconstruction (IR) to produce images from said low dose
MDCT scan.
Embodiment P5
[0147] The method of embodiment 1, wherein said subject has
complete mucus occlusion of an airway lumen.
Embodiment P6
[0148] The method of embodiment 1, wherein said subject has
complete mucus occlusion of an airway lumen in at least one
bronchopulmonary segment.
Embodiment P7
[0149] The method of embodiment 1, wherein said subject has
complete mucus occlusion of an airway lumen in at least three
broncopulmonary segments.
Embodiment P8
[0150] The method of embodiment 6 or embodiment 7, wherein said
bronchopulmonary segments include the right or left of any of the
segments selected from the group consisting of the upper lobe
apical segment, upper lobe posterior segment, the upper lobe
anterior segment, the lateral/superior segment of the middle lobe,
or the medial/inferior segment of the middle lobe, the superior
segment of the lower lobe, the medial basal segment of the lower
lobe, the anterior basal segment of the lower lobe, the lateral
basal segment of the lower lobe, and the posterior basal segment of
the lower lobe.
Embodiment P9
[0151] The method of embodiment 1, wherein said asthma is chronic
severe asthma.
Embodiment P10
[0152] The method of embodiment 1, wherein said subject is
incompletely responsive to bronchodilators and corticosteroids.
Embodiment P11
[0153] The method of embodiment 1, wherein the mucolytic agent is a
thiol-based drug, a recombinant human DNAse, hypertonic saline,
ambroxol, or an airway epithelial cell ion channel modulator.
Embodiment P12
[0154] The method of embodiment 11, wherein the thiol-based drug is
n-acetylcysteine, carbocisteine, erdosteine, mecysteine, or a thiol
saccharide.
Additional Embodiments
[0155] Embodiments include E1 to E46 following.
Embodiment E1
[0156] A method of treating a subject who has asthma or chronic
obstructive pulmonary disease (COPD), the method comprising: [0157]
detecting an airway mucus occlusion in a lung segment of the
subject; and administering to the subject a therapeutically
effective amount of a mucolytic agent or a type 2 inflammation
inhibitor, wherein the subject has an airway mucus occlusion in at
least one lung segment.
Embodiment E2
[0158] The method of Embodiment E1, wherein an anticholinergic
agent, a bronchodilator, or a corticosteroid is not administered to
the subject.
Embodiment E3
[0159] The method of Embodiment E1, wherein the airway mucus
occlusion is an airway mucus plug.
Embodiment E4
[0160] The method of any one of Embodiments E1 to E3, wherein
detecting the airway mucus occlusion in a lung segment of the
subject comprises performing multidetector computed tomography
(MDCT) scan.
Embodiment 5
[0161] The method of Embodiment E4, wherein the MDCT is a low dose
radiation MDCT.
Embodiment 6
[0162] The method of Embodiment E5, further comprising applying
iterative reconstruction (IR) to produce images from the low dose
MDCT scan.
Embodiment 7
[0163] The method of any one of Embodiments E1 to E6, wherein the
airway mucus occlusion is farther than about 2 cm from a
diaphragmatic pleura and/or a costal pleura in the subject.
Embodiment E8
[0164] The method of any one of Embodiments E1 to E7, wherein the
subject is a human subject.
Embodiment E9
[0165] The method of any one of Embodiments E1 to E8, wherein
[0166] (a) the subject has 20 lung segments, and the lung segment
is the apical segment of the upper lobe of the right lung, the
posterior segment of the upper lobe of the right lung, the anterior
segment of the upper lobe of the right lung, the lateral segment of
the middle lobe of the right lung, the medial segment of the middle
lobe of the right lung, the superior segment of the lower lobe of
the right lung, the medial segment of the lower lobe of the right
lung, the anterior segment of the lower lobe of the right lung, the
lateral segment of the lower lobe of the right lung, the posterior
segment of the lower lobe of the right lung, the apical segment of
the upper lobe of the left lung, the posterior segment of the upper
lobe of the left lung, the anterior segment of the upper lobe of
the left lung, the superior lingular segment of the upper lobe of
the left lung, the inferior lingular segment of the upper lobe of
the left lung, the superior segment of the lower lobe of the left
lung, the anterior segment of the lower lobe of the left lung, the
medial segment of the lower lobe of the left lung, the lateral
segment of the lower lobe of the left lung, or the posterior
segment of the lower lobe of the left lung; [0167] (b) the subject
has 19 lung segments, and the lung segment is the apical segment of
the upper lobe of the right lung, the posterior segment of the
upper lobe of the right lung, the anterior segment of the upper
lobe of the right lung, the lateral segment of the middle lobe of
the right lung, the medial segment of the middle lobe of the right
lung, the superior segment of the lower lobe of the right lung, the
medial segment of the lower lobe of the right lung, the anterior
segment of the lower lobe of the right lung, the lateral segment of
the lower lobe of the right lung, the posterior segment of the
lower lobe of the right lung, the apicoposterior segment of the
upper lobe of the left lung, the anterior segment of the upper lobe
of the left lung, the superior lingular segment of the upper lobe
of the left lung, the inferior lingular segment of the upper lobe
of the left lung, the superior segment of the lower lobe of the
left lung, the anterior segment of the lower lobe of the left lung,
the medial segment of the lower lobe of the left lung, the lateral
segment of the lower lobe of the left lung, or the posterior
segment of the lower lobe of the left lung; or [0168] (c) the
subject has 18 lung segments and the lung segment is the apical
segment of the upper lobe of the right lung, the posterior segment
of the upper lobe of the right lung, the anterior segment of the
upper lobe of the right lung, the lateral segment of the middle
lobe of the right lung, the medial segment of the middle lobe of
the right lung, the superior segment of the lower lobe of the right
lung, the medial segment of the lower lobe of the right lung, the
anterior segment of the lower lobe of the right lung, the lateral
segment of the lower lobe of the right lung, the posterior segment
of the lower lobe of the right lung, the apicoposterior segment of
the upper lobe of the left lung, the anterior segment of the upper
lobe of the left lung, the superior lingular segment of the upper
lobe of the left lung, the inferior lingular segment of the upper
lobe of the left lung, the superior segment of the lower lobe of
the left lung, the anteromedial segment of the lower lobe of the
left lung, the lateral segment of the lower lobe of the left lung,
or the posterior segment of the lower lobe of the left lung.
Embodiment E10
[0169] The method of Embodiment E8 or E9, wherein the subject has
18, 19, or 20 lung segments.
Embodiment E11
[0170] The method of Embodiment E10, wherein the subject has an
airway mucus occlusion in at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, or 18 lung segments.
Embodiment E12
[0171] The method of Embodiment E11, wherein the subject has an
airway mucus occlusion in at least 4 lung segments.
Embodiment E13
[0172] The method of Embodiment E11 or E12, wherein each of the
airway mucus occlusion is an airway mucus plug.
Embodiment E14
[0173] The method of any one of Embodiments E10 to E13, wherein
[0174] (a) the subject has 20 lung segments, and the lung segments
are any combination of the apical segment of the upper lobe of the
right lung, the posterior segment of the upper lobe of the right
lung, the anterior segment of the upper lobe of the right lung, the
lateral segment of the middle lobe of the right lung, the medial
segment of the middle lobe of the right lung, the superior segment
of the lower lobe of the right lung, the medial segment of the
lower lobe of the right lung, the anterior segment of the lower
lobe of the right lung, the lateral segment of the lower lobe of
the right lung, the posterior segment of the lower lobe of the
right lung, the apical segment of the upper lobe of the left lung,
the posterior segment of the upper lobe of the left lung, the
anterior segment of the upper lobe of the left lung, the superior
lingular segment of the upper lobe of the left lung, the inferior
lingular segment of the upper lobe of the left lung, the superior
segment of the lower lobe of the left lung, the anterior segment of
the lower lobe of the left lung, the medial segment of the lower
lobe of the left lung, the lateral segment of the lower lobe of the
left lung, and/or the posterior segment of the lower lobe of the
left lung; [0175] (b) the subject has 19 lung segments, and the
lung segments are any combination of the apical segment of the
upper lobe of the right lung, the posterior segment of the upper
lobe of the right lung, the anterior segment of the upper lobe of
the right lung, the lateral segment of the middle lobe of the right
lung, the medial segment of the middle lobe of the right lung, the
superior segment of the lower lobe of the right lung, the medial
segment of the lower lobe of the right lung, the anterior segment
of the lower lobe of the right lung, the lateral segment of the
lower lobe of the right lung, the posterior segment of the lower
lobe of the right lung, the apicoposterior segment of the upper
lobe of the left lung, the anterior segment of the upper lobe of
the left lung, the superior lingular segment of the upper lobe of
the left lung, the inferior lingular segment of the upper lobe of
the left lung, the superior segment of the lower lobe of the left
lung, the anterior segment of the lower lobe of the left lung, the
medial segment of the lower lobe of the left lung, the lateral
segment of the lower lobe of the left lung, and/or the posterior
segment of the lower lobe of the left lung; or [0176] (c) the
subject has 18 lung segments, and the lung segments are any
combination of the apical segment of the upper lobe of the right
lung, the posterior segment of the upper lobe of the right lung,
the anterior segment of the upper lobe of the right lung, the
lateral segment of the middle lobe of the right lung, the medial
segment of the middle lobe of the right lung, the superior segment
of the lower lobe of the right lung, the medial segment of the
lower lobe of the right lung, the anterior segment of the lower
lobe of the right lung, the lateral segment of the lower lobe of
the right lung, the posterior segment of the lower lobe of the
right lung, the apicoposterior segment of the upper lobe of the
left lung, the anterior segment of the upper lobe of the left lung,
the superior lingular segment of the upper lobe of the left lung,
the inferior lingular segment of the upper lobe of the left lung,
the superior segment of the lower lobe of the left lung, the
anteromedial segment of the lower lobe of the left lung, the
lateral segment of the lower lobe of the left lung, and/or the
posterior segment of the lower lobe of the left lung.
Embodiment E15
[0177] The method of any one of Embodiments E1 to E14, wherein the
asthma is chronic severe asthma.
Embodiment E16
[0178] The method of any one of Embodiments E1 to E15, wherein the
subject is incompletely responsive to a bronchodilator or a
corticosteroid.
Embodiment E17
[0179] The method of any one of Embodiments E1 to E16, wherein the
mucolytic agent is a thiol-based drug, a thiosaccharide, a
recombinant human DNAse, hypertonic saline, ambroxol, or an airway
epithelial cell ion channel modulator.
Embodiment E18
[0180] The method of Embodiment E17, wherein the thiol-based drug
is n-acetylcysteine, carbocisteine, erdosteine, mecysteine, or a
thiol saccharide.
Embodiment E19
[0181] A method of treating a subject in need thereof, the method
comprising administering a therapeutically effective amount of a
mucolytic agent or a type 2 inflammation inhibitor to the subject,
wherein the subject has an airway mucus occlusion in at least four
lung segments.
Embodiment E20
[0182] The method of Embodiment E19, wherein the subject has asthma
or COPD.
Embodiment E21
[0183] A method of detecting type 2 inflammation in a subject, the
method comprising: [0184] detecting an airway mucus occlusion in a
lung segment of the subject; and identifying the subject as having
type 2 inflammation if subject has an airway mucus occlusion in a
lung segment.
Embodiment E22
[0185] The method of Embodiment E21, further comprising
administering a therapeutically effective amount of a type 2
inflammation inhibitor to the subject.
Embodiment E23
[0186] A diagnostic method comprising detecting an airway mucus
occlusion in a lung segment of a subject.
Embodiment E24
[0187] A method for identifying whether a subject is likely to
respond or responsive to treatment with a mucolytic agent or a type
2 inflammation inhibitor, the method comprising: [0188] detecting
an airway mucus occlusion in a lung segment of a subject; and
identifying the subject as likely to respond or responsive to
treatment with a mucolytic agent or a type 2 inflammation inhibitor
if the subject has an airway mucus occlusion in a lung segment.
Embodiment E25
[0189] A method for identifying whether a subject is unlikely to
respond, incompletely responsive, or unresponsive to treatment with
an anticholinergic agent, a bronchodilator, or a corticosteroid,
the method comprising: [0190] detecting an airway mucus occlusion
in a lung segment of a subject; and identifying the subject as
unlikely to respond, incompletely responsive, or unresponsive to
treatment with an anticholinergic agent, a bronchodilator, or a
corticosteroid if the subject has an airway mucus occlusion in a
lung segment.
Embodiment E26
[0191] The method of any one of Embodiments E21 to E25, wherein the
subject has asthma or COPD.
Embodiment E27
[0192] The method of any one of Embodiments E19 to E26, wherein the
airway mucus occlusion is an airway mucus plug.
Embodiment E28
[0193] The method of any one of Embodiments E19 to E27, wherein
detecting an airway mucus occlusion in a lung segment of the
subject comprises performing a multidetector computed tomography
(MDCT) scan.
Embodiment E29
[0194] The method of Embodiment E30, wherein the MDCT is a low dose
radiation MDCT.
Embodiment E30
[0195] The method of Embodiment E29, further comprising applying
iterative reconstruction (IR) to produce images from the low dose
MDCT scan.
Embodiment E31
[0196] The method of any one of Embodiments E23 to E30, wherein the
airway mucus occlusion is farther than about 2 cm from a
diaphragmatic pleura and/or a costal pleura in the subject.
Embodiment E32
[0197] A system, comprising: [0198] a scanner configured to capture
one or more lung images of a subject; [0199] at least one data
processor; and [0200] at least one memory storing instructions
which, when executed by the at least one data processor, result in
operations comprising: [0201] determining, based at least on the
one or more lung images, a quantification of mucus plugging for the
subject; [0202] determining, based at least on the quantification
of mucus plugging, a diagnosis for the subject, the diagnosis
comprising a detection of an airway mucus occlusion in at least one
lung segment of the subject; and [0203] identifying, based at least
on the diagnosis, one or more treatments for the subject, the one
or more treatments including a therapeutically effective amount of
a mucolytic agent and/or a type 2 inflammation inhibitor.
Embodiment E33
[0204] The system of Embodiment E32, wherein an anticholinergic
agent, a bronchodilator, and a corticosteroid are excluded from the
one or more treatments.
Embodiment E34
[0205] The system of Embodiment E32, wherein the airway mucus
occlusion comprises an airway mucus plug.
Embodiment E35
[0206] The system of any one of Embodiments E32 to E34, wherein the
scanner is configured to perform a multidetector computed
tomography (MDCT) scan of the subject.
Embodiment E36
[0207] The system of Embodiment E35, wherein the MDCT scan
comprises a low dose radiation MDCT scan.
Embodiment E37
[0208] The system of Embodiment E36, wherein an iterative
reconstruction (IR) is applied to produce the one or more lung
images from the low dose MDCT scan.
Embodiment E38
[0209] The system of any one of Embodiments E32 to E37, wherein the
airway mucus occlusion is farther than about 2 centimeters (cm)
from a diaphragmatic pleura and/or a costal pleura in the
subject.
Embodiment E39
[0210] The system of any of Embodiments E32 to E38, wherein the
subject is a human subject.
Embodiment E40
[0211] The system of any of Embodiments E32 to E39, wherein [0212]
(a) the subject has 20 lung segments, and the at least one lung
segment is any one of or any combination of the apical segment of
the upper lobe of the right lung, the posterior segment of the
upper lobe of the right lung, the anterior segment of the upper
lobe of the right lung, the lateral segment of the middle lobe of
the right lung, the medial segment of the middle lobe of the right
lung, the superior segment of the lower lobe of the right lung, the
medial segment of the lower lobe of the right lung, the anterior
segment of the lower lobe of the right lung, the lateral segment of
the lower lobe of the right lung, the posterior segment of the
lower lobe of the right lung, the apical segment of the upper lobe
of the left lung, the posterior segment of the upper lobe of the
left lung, the anterior segment of the upper lobe of the left lung,
the superior lingular segment of the upper lobe of the left lung,
the inferior lingular segment of the upper lobe of the left lung,
the superior segment of the lower lobe of the left lung, the
anterior segment of the lower lobe of the left lung, the medial
segment of the lower lobe of the left lung, the lateral segment of
the lower lobe of the left lung, and/or the posterior segment of
the lower lobe of the left lung; [0213] (b) the subject has 19 lung
segments, and the at least one lung segment is any one of or any
combination the apical segment of the upper lobe of the right lung,
the posterior segment of the upper lobe of the right lung, the
anterior segment of the upper lobe of the right lung, the lateral
segment of the middle lobe of the right lung, the medial segment of
the middle lobe of the right lung, the superior segment of the
lower lobe of the right lung, the medial segment of the lower lobe
of the right lung, the anterior segment of the lower lobe of the
right lung, the lateral segment of the lower lobe of the right
lung, the posterior segment of the lower lobe of the right lung,
the apicoposterior segment of the upper lobe of the left lung, the
anterior segment of the upper lobe of the left lung, the superior
lingular segment of the upper lobe of the left lung, the inferior
lingular segment of the upper lobe of the left lung, the superior
segment of the lower lobe of the left lung, the anterior segment of
the lower lobe of the left lung, the medial segment of the lower
lobe of the left lung, the lateral segment of the lower lobe of the
left lung, and/or the posterior segment of the lower lobe of the
left lung; or [0214] (c) the subject has 18 lung segments, and the
at least one lung segment is any one of or any combination of the
apical segment of the upper lobe of the right lung, the posterior
segment of the upper lobe of the right lung, the anterior segment
of the upper lobe of the right lung, the lateral segment of the
middle lobe of the right lung, the medial segment of the middle
lobe of the right lung, the superior segment of the lower lobe of
the right lung, the medial segment of the lower lobe of the right
lung, the anterior segment of the lower lobe of the right lung, the
lateral segment of the lower lobe of the right lung, the posterior
segment of the lower lobe of the right lung, the apicoposterior
segment of the upper lobe of the left lung, the anterior segment of
the upper lobe of the left lung, the superior lingular segment of
the upper lobe of the left lung, the inferior lingular segment of
the upper lobe of the left lung, the superior segment of the lower
lobe of the left lung, the anteromedial segment of the lower lobe
of the left lung, the lateral segment of the lower lobe of the left
lung, and/or the posterior segment of the lower lobe of the left
lung.
Embodiment E41
[0215] The system of Embodiment E39 or E40, wherein the at least
one lung segment comprises one of 18, 19, or 20 lung segments.
Embodiment E42
[0216] The system of Embodiment E41, wherein the airway mucus
occlusion is present in at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, or 18 lung segments.
Embodiment E43
[0217] The system of Embodiment E42, wherein the airway mucus
occlusion is present in at least 4 lung segments.
Embodiment E44
[0218] The system of any one of Embodiments E32 to E43, wherein the
mucolytic agent is a thiol-based drug, a thiosaccharide, a
recombinant human DNAse, hypertonic saline, ambroxol, or an airway
epithelial cell ion channel modulator.
Embodiment E45
[0219] The system of Embodiment E44, wherein the thiol-based drug
is n-acetylcysteine, carbocisteine, erdosteine, mecysteine, or a
thiol saccharide.
Embodiment E46
[0220] The system of any of Embodiments E32 to E45, wherein the
diagnosis includes that the subject is unlikely to respond,
incompletely responsive, or unresponsive to treatment with an
anticholinergic agent, a bronchodilator, or a corticosteroid.
[0221] It is understood that the examples and embodiments described
herein are for illustrative purposes only and that various
modifications or changes in light thereof will be suggested to
persons skilled in the art and are to be included within the spirit
and purview of this application and scope of the appended claims.
All publications, patents, and patent applications cited herein are
hereby incorporated by reference in their entirety for all
purposes.
EXAMPLES
Example 1: Link Between Eosinophilia and Mucus Plugs in the
Pathogenesis of Airflow Obstruction in Severe Asthma
[0222] The role of mucus plugs in mechanisms of airflow obstruction
in chronic severe asthma is uncertain. This example relates to a
mucus plug scoring system in multidetector computed tomography
(MDCT) lung images to quantify mucus plugs in asthmatics with and
without airflow obstruction. The data show that mucus plugs occur
commonly in multiple bronchopulmonary segments and persist for many
years, often in the same bronchopulmonary segment. Asthmatics with
a high mucus score are characterized by severe airflow obstruction,
marked sputum eosinophilia, and increases in sputum cell gene
expression for IL-5, IL-13, and cysteine-rich MUC5AC mucin. Lavage
of a bronchopulmonary segment with mucus plugs shows intense
infiltration of mucus with eosinophils, and ex-vivo studies show
that IL-13 activates airway epithelial cells to secrete eotaxin-3
into the apical mucus layer and that eosinophils can oxidize and
cross-link cysteines. Without being bound by any scientific theory,
mucus plugs are a plausible mechanism of airflow obstruction in
chronic severe asthma and form as a consequence of type 2 cytokine
activity that causes upregulation of MUC5AC and infiltration of
airway mucus with eosinophils. It is proposed that MDCT lung images
represent a biomarker of airway type 2 inflammation and mucus
plugging in asthma.
[0223] Despite the prominence of mucus plugs in the pathophysiology
of airflow obstruction in acute severe (fatal) asthma (Huber &
Koessler, Arch Intern Med 30, 689-760 (1922); Dunnill, M. S. J Clin
Pathol 13, 27-33 (1960)), the role of mucus plugs in the
pathophysiology of airflow obstruction in chronic severe asthma is
poorly understood. This limited understanding is a barrier to
rational treatment of airflow obstruction in severe asthma, because
mucus plugs represent a tractable treatment target if they can be
shown to be a significant cause of obstruction.
[0224] Understanding the role of mucus plugs as a mechanism of
airflow obstruction in chronic severe asthma has been held back by
methodologic difficulties. To date, imaging studies have not
systematically examined the airways in patients with asthma for
intraluminal mucus, and studies that have documented the
relationship between mucus pathology and airflow have relied on
chronic cough and sputum production, a symptom complex known as
chronic mucus hypersecretion (CMH) (Vestbo et al., Am J Respir Crit
Care Med 153, 1530-1535 (1996); Ulrik et al., Respir Med 99,
1576-1582 (2005)). Reliance on CMH symptoms to identify patients
with airway mucus plugs is problematic, because CMH symptoms are
often absent in patients with chronic obstructive pulmonary disease
who have pathologically proven mucus plugs (Burgel & Martin,
European respiratory review: an official journal of the European
Respiratory Society 19, 94-96 (2010)).
[0225] Pathology studies in small numbers of patients with
non-fatal asthma reveal airway mucus plugs (Boser et al., Am J
Respir Crit Care Med 172, 817-823 (2005)), but the relationship
between these plugs and airflow obstruction is unclear. Blood and
airway eosinophilia are strongly correlated with airflow
obstruction in asthma (Fabbri et al., Am J Respir Crit Care Med
167, 418-424 (2003); Bumbacea et al., Eur Respir J 24, 122-128
(2004)), but the relationship between eosinophils and mucus plugs
is unknown. In addition, it is known from in vitro studies of
airway epithelial cells that interleukin 13 (IL-13) alters the
expression of gel-forming mucins (MUC5AC and MUC5B) (Kuperman et
al., Nat Med 8, 885-889 (2002); Lachowicz-Scroggins et al., AJRCCM
In Press) and causes tethering of MUC5AC-rich mucus to airway
epithelial cells (Bonser et al., J Clin Invest 126, 2367-2371
(2016)), but the role of IL-13 and MUC5AC in the pathophysiology of
mucus plugs in vivo in asthma has not been studied to our
knowledge.
[0226] Without being bound by any scientific theory, it was
hypothesized that type 2 inflammation promotes formation of airway
mucus plugs in asthma to cause airflow obstruction. To test this
hypothesis, a novel scoring system was developed to quantify mucus
plugs in multidetector computed tomography (MDCT) scans of the
lungs. This MDCT-based scoring system was used to determine the
relationship between mucus plugs and airflow obstruction, links
between mucus plugs, airway eosinophilia, and the airway expression
of type 2 cytokines and gel-forming mucins were explored.
[0227] Materials and Methods
[0228] Subjects:
[0229] Subjects. Adult asthma patients were recruited as part of
the Severe Asthma Research Program 3 (SARP-3) cohort. The SARP-3
protocol includes three baseline visits in which asthma patients
undergo detailed characterization, including sputum questionnaires,
maximum bronchodilator reversibility tests, a systemic
corticosteroid responsiveness test, and an optional multi-detector
computed tomography (MDCT) scan of the lungs (FIG. 5). Data
reported here are from patients that had MDCT scans as part of
their baseline characterization. CT was not repeated after steroid
injection. Healthy subjects for MDCT scans were recruited at a
single center (Washington University in St Louis), and subjects for
sputum cell analyses were recruited from all SARP-3 centers (Table
4). Twenty-five asthma patients who had MDCT scans as part of the
SARP-3 protocol also had MDCT scans available from their
participation in SARP-1 or SARP-2 protocols. These patients were
enrolled at 3 sites: University of Pittsburgh, University of
Wisconsin, and Washington University in St. Louis (Table 9).
[0230] Systemic Corticosteroid Responsiveness Test (SCRT):
[0231] Patients were given an intramuscular injection of
triamcinolone acetonide (40 mg) following complete characterization
on visit 2. Repeat characterization post steroid injection
(excluding MDCT), was carried out on visit 3 (2-4 weeks later)
(FIG. 5).
[0232] Treatment Response to Bronchodilators and Systemic
Corticosteroids:
[0233] Maximum Bronchodilator Reversibility tests (MBRT's) were
performed on baseline visits 2 and 3. MBRT was determined by
measuring spirometry before and after 360-720 mcg of albuterol
sulfate delivered by metered-dose inhaler. Patients also underwent
a systemic corticosteroid response test (SCRT), which involved an
intramuscular injection of triamcinolone acetonide (40 mg) on visit
2 and repeat characterization including MBRT and blood draw on
visit 3 (2-4 weeks later).
[0234] Computerized Tomography of the Lung:
[0235] Patients underwent MDCT scans of the lungs on visit 2
following maximal bronchodilation according to a standard protocol
monitored by a SARP imaging center at the University of Iowa with
institutional review board approval. De-identified digital scan
data, obtained at total lung capacity, were distributed to the
radiologists for scoring. Evaluation for mucus was performed using
a standard window width of 1200 HU and level of -600 HU in scans
taken at total lung capacity (Bankier et al., Radiology 199,
831-836 (1996)). Additional details are provided herein and in
Tables 1 and 2. Quantitative measures of airway wall thickness and
lumen area were generated using Apollo 1.2 (VIDA diagnostics; Iowa
City, Iowa), as described herein.
[0236] Automated CT Analysis:
[0237] Quantitative airway morphology was measured from MDCT scans
using automated, quantitative software that was designed to
reliably label and segment the first five to six airway
generations, and to allow the accurate measurement of airway walls
and lumen diameters obtained perpendicular to the long axis of each
airway (Apollo 1.2; VIDA Diagnostics; Iowa City, Iowa). Airway
measurements of RB1, RB4, RB10, LB1, LB4, LB10 (4th generation)
were made at each centerline voxel and were averaged over the
middle third of the segment. The specific MDCT scan measurements
used included airway wall thickness (WT), percentage of WT (WT %),
wall area (WA), percentage of WA (WA %), luminal area (LA) and
percentage of LA (LA %) (FIG. 16). The calculations are as follows:
WT: average outer diameter-average inner diameter; WT %:
(WT/average outer diameter).times.100; WA: total area (TA)-LA; WA
%: (WA/TA).times.100; and LA %: (LA/TA).times.100. WA %, LA % and
WT % were used in analysis, as these account for differences in
airway size. Airway measurements of RB1, RB4, RB10, LB1, LB4, LB10
were averaged to give a summary estimate for each patient. WT % was
reported in results but all 3 measurements gave similar
results.
[0238] Flexible Bronchoscopy and Bronchoalveolar Lavage:
[0239] A low-dose CT scan was performed one week before
bronchoscopy and assessed jointly by both the radiologist and the
bronchoscopist. One segment with a mucus plug and one segment
without mucus plug were chosen for sampling. Segments with and
without mucus plugs were chosen from contralateral lungs.
Bronchoscopy was performed under conscious sedation.
Bronchoalveolar lavage fluid (BALF) was collected first from the
site with mucus, followed by the site without mucus. The
bronchoscope was flushed with normal saline between plugged and
non-plugged segment sampling. In processing the BALF, no straining
of fluid through gauze or wire mesh was performed, in order to
minimize loss of cells. Fluid was centrifuged at 450.times.g (10
min at 4.degree. C.) to recover cell pellet. The cell pellet was
re-suspended in 2 ml PBS and kept on ice. Total and differential
cell counts were then quantified using the same methods used in
sputum processing.
[0240] Apical Secretion of Eotaxin-3 (CCL26):
[0241] Human airway epithelial cells (AECs) were isolated from
tracheas collected from cadaveric lung donors from the California
Donor Network as a part of a separate study (Gordon et al., Proc
Natl Acad Sci USA. 113, 8765-8770. doi: 8710.1073/pnas.1601914113.
Epub 160191216 July 1601914118. (2016)). Cells were expanded in 5%
FCS in DMEM/F12 supplemented with a rho kinase inhibitor (Y-27632
SellekChem) to promote proliferation (Liu et al., Am J Pathol. 180,
599-607. doi: 510.1016/j.ajpath.2011.1010.1036. Epub 211 December
1018. (2012)). Once cells reached 90% confluency flasks were washed
and cells trypsinized with TrypLE (Gibco). Subconfluent cells were
plated to submerged transwell inserts, using the modified Schlegel
culture conditions previously described (Chu et al., Gene Ther. 22,
822-829. doi: 810.1038/gt.2015.1053. Epub 215 July 1032. (2015)).
Once cells reached confluence, the cultures were taken to
air-liquid interface (ALI) in PnuemaCult Maintenance media
(StemCell Technologies) and maintained for 21-days. At day 21,
cells were treated with 10 ng/mL recombinant human IL-13 (R&D
systems) in the basolateral media for 4 days. To measure eotaxins
secreted at the apical surface of ALI cultures, 300 L warmed PBS
was added to the surface of the cells. Cells were washed daily and
PBS washes were taken from 4 different trachea donors cultured in
duplicate. The cells were allowed to rest for 30 minutes at
37.degree. C. and PBS was removed, mixed with 1:100 HALT protease
inhibitor mix (ThermoFisher) and stored -20.degree. C. until
assayed using Duoset ELISA for human CCL26 (R&D systems).
[0242] Eosinophil Isolation and Stimulation of Respiratory
Burst:
[0243] Eosinophils were purified from the peripheral blood of 4
atopic asthmatic subjects (age 48.+-.23 years). Each subject
donated 100 mL of blood on one or more occasions. All subjects
signed consent forms and usage was approved by the UCSF Committee
on Human Research. Eosinophils were isolated from whole blood using
a three-step method in which we first pelleted the cells, followed
by water lysis to remove red blood cells and finally eosinophils
were purified using immunomagnetic beads (Human Eosinophil
Isolation kit, Miltenyi Biotec). Briefly, whole blood was collected
in EDTA (purple-top) tubs and pelleted at 1500 g for 15 minutes at
4.degree. C. The plasma on top was removed and cell pellet retained
for two cycles of water lysis. Water lysis of red blood cells was
scaled up based on methods previously described (Samoszuk, Am J
Hematol 81, 552-553 (2006)). Isolated leucocytes were washed in PBS
(Gibco) pH 7.2 containing 2 mM EDTA and 0.5% low-IgG BSA (Gemini)
and passed through a 70 .mu.m nylon filter to remove debris Cells
were incubated with biotin-antibody cocktail for 10 minutes at
4.degree. C. followed by incubation with anti-biotin microbeads for
15 additional minutes. Eosinophils were purified from labeled
granulocytes by passing the solution over a separation column in a
magnetic sorting field. Eosinophil purity of >99.8% was
confirmed by cytospin and staining with Diff-Quik (ThermoFisher
Scientific). Eosinophils were resuspended in Iscove's Modified
Dulbecco's Medium (IMDM) (Gibco)+10% fetal calf serum (FCS)
(Gibco), to adensity of 1 x106 cells/mL. Eosinophils were then
allowed to rest at 37.degree. C. in non-treated 6-well plates
(Corning Costar) for at least 20 min before
phorbol-12-myristate-13-acetate (PMA) (Sigma) stimulation. Prior to
stimulation, cells were pelleted at 300 g for 5 minutes at
4.degree. C. and the media was fully aspirated. Cells were
resuspended in 1 ml of Tyrode's salts (Sigma), pelleted again at
300 g for 5 min and the buffer was fully aspirated to remove any
residual FCS. The cells were resuspended in Tyrode's salts+/-PMA as
detailed below.
[0244] Cysteine cross-linking assay: To explore cystine formation
generated by eosinophil stimulation, BODIPY FL L-cysteine was
generated from 800 mM BODIPY FL L-Cystine (ThermoFisher Scientific)
in Tyrode's Salts by reduction with one quarter volume packed
TCEP-Gel (ThermoFisher Scientific) for 1 hour at 25.degree. C. The
reaction yields an 8 to 10-fold increase in fluorescence at 490
nm/520 nm Ex/Em. This reagent was diluted in 100 .mu.l Tyrode's
Salts to 4 M with and without PMA (100 ng) in 96 well round bottom
non-treated black polystyrene plates (Corning Costar). The decrease
in fluorescence at 490 nm/520 nm Ex/Em was monitored over 2 hours
at 37.degree. C. on a Synergy H1 plate reader (BioTek Instruments)
with the addition of 50,000 peripheral blood eosinophils in 100
.mu.l Tyrode's Salts. The plates were sealed with optical adhesive
film (Applied Biosystems) to prevent evaporation. The quenching of
BODIPY fluorescence by eosinophil stimulation was shown to reverse
to starting values by addition of DTT to the wells at the end of
incubation, indicating that this effect was due to reformation of
cystine, and not destruction or bleaching of the fluorophore.
[0245] MDCT Scoring System:
[0246] Mucus Plugs:
[0247] These were defined as complete occlusion of an airway lumen
by mucus, with or without bronchial dilatation. When parallel to
the scan plane, mucus plugs were recognized as tubular densities
with or without branching. When oriented obliquely or
perpendicularly to the scan plane, they were identified as oval or
rounded opacities seen on sequential slices and differentiated from
blood vessels by their continuity with non-impacted portions of the
bronchial lumen and their position relative to adjacent blood
vessels. The segments of each lobe were systematically examined for
the presence or absence of mucus plugs and given a score of 1 or 0
accordingly. The segment scores of each lobe were summed to
generate a total mucus score for both lungs, yielding a mucus score
ranging from 0-20 (in subjects with 20 segments). Peripheral
airways within 2 cm of the diaphragmatic pleura and costal pleura
were excluded from evaluation as the small caliber of these
peripheral airways makes occlusion by mucus difficult to ascertain.
Further details about the mucus score, including its development
and validation, are provided in herein and in FIGS. 7 and 8.
[0248] Bronchiectasis:
[0249] Each of the five lung lobes was systematically examined for
the presence or absence of bronchiectasis defined as a bronchial
arterial ratio >1.5; this yielded a bronchiectasis score ranging
from 0 to 5.
[0250] The CTs were independently reviewed and scored by five
radiologists with sub-specialty training in thoracic radiology
using the method described above. Each scan was randomly assigned
to 2 of 5 radiologists for scoring. The average score of both
raters was used to calculate the CT mucus score for each subject.
This generated a continuous score ranging from 0 to 20 increasing
in increments of 0.5.
[0251] Induced Sputum:
[0252] Sputum induction was done on visits 2 and 3. For safety,
induced sputum was only collected from patients whose FEV1 was
>50% predicted after albuterol pretreatment (360 .mu.g). Total
and differential cell counts were quantified in a central
laboratory (Wake Forest University) using methods previously
described 5,6. Gene expression for type 2 cytokines [interleukin
(IL)-4, IL-5, and IL-13] and for airway gel-forming mucins (MUC5AC,
MUC5B) were measured in RNA isolated from induced sputum cell
pellets using real-time Taqman-based quantitative PCR (qPCR)7 as
described herein (including Table 3). RNA isolation and qPCR were
done in a central laboratory (University of California at San
Francisco).
[0253] Questionnaires:
[0254] Questionnaires were completed by asthma patients at study
entry. Chronic mucus hypersecretion was defined using the ATS/WHO
definition of chronic bronchitis, which assesses chronic cough and
sputum production in the preceding 2 years.sup.8. The specific
question used was: "Have you had cough and sputum production on
most days for at least 3 months a year for at least 2 consecutive
years?." These questionnaires are further described herein.
[0255] Statistical Analysis:
[0256] Each scan was scored by two raters randomly drawn from the
group of five raters and agreement between raters was estimated
using the intraclass correlation coefficient (ICC) (FIG. 7).
One-way random effects analysis of variance was used to calculate
the ICC with subject as the random effect in the model. Within
rater agreement was calculated in a random subset of 14 scans that
were read twice by the same radiologists. Categorical variables are
presented as frequencies with percentages and evaluated using the
chi-square test. Continuous variables are presented as means.+-.1
SD or medians with quartiles. One-way analysis of variance was used
for multiple group comparison followed by a Bonferroni correction.
Kruskal-Wallis one-way analysis of variance was used for
non-parametric multiple group comparison. Correlation between
variables was evaluated using Spearman's correlation. Multivariable
analyses were calculated using linear regression models (with 95%
confidence intervals) for continuous outcomes. Statistical
significance was accepted for 2 sided p values of <0.05.
Statistical analysis was carried out using Stata 13.1 (StataCorp
College Station Tex.).
Study Design
[0257] SARP is a 3-Year Longitudinal Cohort Study.
[0258] Asthma patients and healthy controls were recruited as part
of the Severe Asthma Research Program (SARP)-3 cohort across 7
centers. The clinical centers in the network were Brigham and
Women's Hospital, The University of California at San Francisco,
the University of Pittsburgh, The University of Virginia, the
University of Wisconsin, Wake Forrest School of Medicine, and
Washington University in St Louis (with co-investigators at the
University of Iowa). All centers used the same characterization
procedures and all assessments adhered to standardized protocols
and techniques ensuring uniformity of data and adherence to safety
precautions. The protocol includes three baseline visits in which
asthma patients undergo detailed characterization, including sputum
questionnaires, maximum bronchodilator reversibility tests, a
systemic corticosteroid responsiveness test, and an optional
multi-detector computed tomography (MDCT) scan of the lungs (FIG.
5). Data reported here are from patients that had MDCT's as part of
their characterization. Healthy subjects for MDCT scans were
recruited at a single center (Washington University in St Louis)
and for sputum cell analyses were recruited from all SARP-3
centers.
[0259] SARP Asthma Patients:
[0260] 387 adult asthma patients were recruited to the Severe
Asthma Research Program (SARP) from Nov. 1, 2012 to Oct. 1, 2014 by
eleven clinical research centers across the United States. The SARP
protocol included 2-3 baseline characterization visits in which all
subjects underwent detailed characterization and provided samples
of venous blood and induced sputum. In addition, 146 of the 387
subjects underwent lung multidetector computerized tomography
(MDCT) of their lungs (Table 4). Among 146 asthma patients who had
MDCT scans as part of the SARP-3 protocol, 25 patients also had
MDCT lung scans available from their participation n SARP-1 or
SARP-2 protocols. These patients were enrolled at 3 sites
(University of Pittsburgh, University of Wisconsin and Washington
University) and scans were performed 2-9 years prior to the SARP-3
MDCT scans (Table 9).
[0261] Inclusion criteria for SARP mandated that at least 60% of
patients meet the American Thoracic Society/European Respiratory
Society (ATS/ERS) definition for severe asthma.sup.27. This was
defined as "asthma which requires treatment with either continuous
or near continuous systemic corticosteroids or high-dose ICS, plus
a second controller medication or systemic steroids to prevent it
from becoming uncontrolled or which remains uncontrolled despite
this therapy." For analysis, subjects were stratified into mild,
moderate, or severe asthma, according to the criteria developed by
SARP and outlined in FIG. 9.
[0262] All patients were non-smokers (<10 pack-years of tobacco
use if >30 y of age; <5 pack-years if <30 y of age) and
were required to have evidence of bronchial hyperresponsiveness
(defined as a PC20 methacholine <16 mg/mL) or reversible airflow
obstruction, as evidenced by an increase in FEV1 of .gtoreq.12%
following albuterol inhalation (up to 720 .mu.g) and/or ipratropium
bromide inhalation (136 mcg).
[0263] Patients were excluded if they were pregnant or
breastfeeding during the initial characterization period, had a
history of premature birth (<35 weeks gestation), or had a
diagnosis of any other chronic pulmonary disorder, which, in the
opinion of the investigator, contributed significantly to the
patient's respiratory symptoms.
[0264] Patients completed comprehensive phenotypic
characterization, including a physician-directed history, Asthma
Control Test, spirometry, maximum bronchodilator reversibility (see
below), complete blood count with cell differential, induced sputum
cell counts, serum IgE measurements, and FeNO measurement. In
addition, subjects completed extensive questionnaires that
characterized asthma symptoms, sputum symptoms, quality of life,
medication use, and health care utilization (FIG. 5). All subjects
signed informed consents approved by their local institutional
review boards.
[0265] Healthy Subjects:
[0266] Adult healthy subjects were recruited at Washington
University in St Louis (Table 4). Inclusion criteria were as
follows: non-smokers (<10 pack-years of tobacco use if >30 y
of age; <5 pack-years if <30 y of age), and normal lung
function (pre-bronchodilator FEV/FVC>0.70 and <12% increase
in FEV1 following 4 puffs of albuterol). Subjects were excluded if
they were pregnant or breastfeeding, or had a diagnosis of any lung
disease.
[0267] Procedures for Withholding Asthma and Allergy
Medications:
[0268] Subjects were asked to hold their bronchodilator medications
prior to spirometry testing. The medication holds for SARP were as
follows; short-acting beta agonists--4 hours; short-acting
anticholinergics--6 hours; LABA--12 hours; LAMA--24 hours; and
leukotriene modifiers--24 hours.
[0269] Maximum Bronchodilator Reversibility Test (MBRT):
[0270] Subjects were asked to hold their bronchodilator medications
prior to spirometry testing. Following baseline spirometry, 4 puffs
of albuterol (360 mcg) were administered. Spirometry was then
repeated 15 minutes later. If the change in FEV1 from the
spirometry maneuver performed after 4 puffs was greater than 5%, an
additional 2 puffs of albuterol (180 mcg) were then administered
and spirometry was repeated again 15 minutes later. If the change
in FEV1 after 6 puffs was greater than 5%, an additional 2 puffs of
albuterol were administered with repeat spirometry after an
additional 15 minutes. If the change was less than 5% after 4 or 6
puffs of albuterol, the procedure was stopped and the last maneuver
was taken to be the highest achievable measure. No more than 8
puffs of albuterol were administered as part of the MBRT procedure.
MBRT was measured on baseline visits 2 and 3 (FIG. 5).
[0271] Multi Detector Computerized Tomography (MDCT) Protocol:
[0272] MDCT was performed within 2 hours following maximal
bronchodilation according to a standard protocol monitored by a
SARP imaging center at the University of Iowa with institutional
review board approval. The same scanning protocol was used in both
asthma patients and healthy controls. Before beginning the MDCT
scan, patients were carefully coached using standardized breathing
instructions administered by the technologist and images of the
lungs at Total Lung Capacity (TLC) were obtained from a single
breath-hold at full inspiration. Sections were obtained at 0.5 mm
intervals and slice thickness was 0.625-0.75 mm based on scanner
model. The MDCT parameters for each scanner model used are listed
in Table 1. BMI (3 categories), lung volume (e.g. TLC) and scanner
model were used to determine the CTDIvol and subsequently the
effective mAs or mA settings appropriate for each subject (Table
1). Scanners at each center were regularly calibrated with a
phantom (COPDgene.RTM. Phantom Model CCT162, The Phantom
Laboratory--www.phantomlab.com/other-catphans/) and all scans were
evaluated for protocol adherence by the SARP Imaging Center at the
University of Iowa. De-identified image data (in standard digital
format) were distributed to the radiologists for scoring. To blind
the readers to the disease status of the subject, healthy subjects
were given a SARP identification number and the scan date of the
healthy scans were shifted forward 3 years to match the scanning
period of the asthmatic scans. Evaluation for mucus was performed
on scans taken at total lung capacity using a standard window width
of 1200 HU and level of -600 HU (Bankier et al., Radiology 199,
831-836 (1996)).
Development, Validation, and Application of the MDCT Mucus
Score
[0273] A scoring system to quantify mucus plugs in lung images
generated using multi-detector computerized tomography was
developed. The scoring system was based on bronchopulmonary
segmental anatomy. Each bronchopulmonary segment was given a score
of 1 (mucus plug present) or 0 (mucus plug absent). The segment
scores of each lobe were summed to generate a total mucus score for
both lungs, yielding a mucus score ranging from 0-20 (in subjects
having 20 segments). The score was initially tested and refined
using 10 scans from severe asthmatics recruited at UCSF for SARP.
The initial version of the score (Version 1) was modified twice to
yield the final version (Version 3) as shown in FIG. 6 and further
explained below.
[0274] Version 1: The initial mucus score counted mucus plugs in
both central and peripheral lung regions and defined a mucus plug
as either partial or complete occlusion of an airway by mucus.
Peripheral lung was defined as the portion of lung within 2 cm of
the mediastinal, costal or diaphragmatic pleura. The Intra-class
Correlation Coefficient (ICC) for agreement between 5 radiologists
independently scoring 10 scans was 0.3 (95% CI 0.0 to 0.64). This
ICC data was reviewed by the mucus score team, and the relatively
poor inter-rater agreement was judged to result from inconsistent
reads arising from two factors; (i) scoring mucus plugs in the
outer 2 cm of the lungs where airways are small and mucus plugs can
be hard to identify reliably and consistently; (ii) inconsistency
among radiologists in scoring mucus plugs in airways partially
occluded by mucus.
[0275] Version 2: This version was revised by consensus in two ways
(see FIG. 6): [0276] Mucus plugs were not evaluated in airways in
the outer 2 cm of the lungs. [0277] Mucus plugs were defined as
complete or partial occlusion of a segmental bronchus or complete
occlusion of a sub-segmental bronchus.
[0278] The revised score was applied to the 10 scans by 5
radiologists and the Intra-class Correlation Coefficient (ICC) for
agreement between the 5 raters was 0.67 (95% CI 0.43 to 0.92). This
data was reviewed and discussed by the mucus score team. Based on
this review and discussion, additional modifications were suggested
for a version 3 mucus score (below).
[0279] Version 3: This version was revised by consensus in three
ways (See FIG. 6): [0280] Mucus plugs were defined as complete
occlusion of a bronchus, irrespective of generation.
[0281] Mucus plugs were defined as complete occlusion of a
bronchus, irrespective of generation. When parallel to the scan
plane, mucus plugs were recognized as tubular densities with or
without branching. When oriented obliquely or perpendicularly to
the scan plane, they were identified as oval or rounded opacities
seen on sequential slices and differentiated from blood vessels by
their continuity with non-impacted portions of the bronchial lumen
and their position relative to adjacent blood vessels. [0282] The 2
cm peripheral exclusion zone was confined to the costal and
diaphragmatic pleura so as not to exclude the larger airways
adjacent to the mediastinum.
[0283] A 2 cm peripheral exclusion zone confined to the costal and
diaphragmatic pleura was excluded from evaluation as the small
caliber of these peripheral airways makes occlusion by mucus
difficult to ascertain. The 2 cm peripheral zone adjacent to the
mediastinal pleura was not excluded from evaluation owing to the
larger airways adjacent to the mediastinum. [0284] Use of a
standard window width of 1200 HU and level -600 HU for bronchial
wall evaluation.
[0285] Version 3 of the mucus score was agreed as the final version
to be used in the study (See FIG. 6), and it was implemented as
described below.
[0286] Application and validation of the CT Mucus Score:
[0287] Before application of the scoring system to the SARP cohort,
a teleconference was held which included a slide presentation with
detailed description of the final scoring system followed by a
1-hour consensus reading session using a training-set of 3 CT
scans. Five radiologists with sub-specialty training in thoracic
radiology scored the MDCT's. To generate the mucus score, two
radiologists were randomly assigned to independently score each
scan. Each radiologist was provided with their individual set of
scans in digital format. The radiologists entered the mucus score
data in real-time into a secure online survey (Research Electronic
Data Capture) (FIG. 17). The average score of both raters was used
to calculate the CT mucus score for each subject. This generated a
continuous score ranging from 0 to 20 increasing in increments of
0.5. The validity of the mucus score was tested by analyzing for
inter-rater bias followed by inter-rater and intra-rater agreement.
Bias between raters, where one rater consistently over- or
underscores relative to the other rater, was tested using paired
analyses. No significant bias and was found between any of the
pairs of raters (p>0.05). Once absence of bias was confirmed,
inter-rater agreement of the CT mucus score could be assessed by
intraclass correlation coefficient (ICC). An initial check of
inter-rater agreement was made after half of the scans were scored,
with a plan to recalibrate any rater(s) with outlying scores to the
group mean. The ICC at interim analysis was 0.69 and retraining was
provided in one instance. At the end of the study, the ICC for
agreement between readers was 0.80 (95% CI 0.74 to 0.85) for all
171 scans and 0.79 (95% CI 0.72 to 0.85) for the 146 asthma scans
alone. In addition, the intra-rater agreement for a random subset
of 14 scans (3 healthy, 11 asthma) that was scored twice by each of
the five radiologists was 0.99 (95% CI 0.99 to 1.00).
[0288] The mucus score for any one patient was the average of the
mucus scores from two readers (raters). To generate the score, each
scan was randomly assigned to 2 of 5 raters, and each rater was
provided with their individual set of 58 scans in digital format.
The raters entered the mucus score data in real-time into a secure
online survey (Research Electronic Data Capture) (FIG. 7).
[0289] Inter-rater reliability was assessed after half of the scans
were scored with a plan to recalibrate any rater(s) with outlying
scores to the group mean. Inter-rater agreement at interim analysis
was 0.69 and retraining was provided in one instance. Ultimately,
the ICC for intra-rater agreement for all 176 asthma scans was 0.80
(95% CI 0.74 to 0.85)(FIG. 6). In addition, the inter-rater
agreement for a random subset of 14 scans (3 healthy, 11 asthma)
that was scored twice by each of the five radiologists was 0.99
(95% CI 0.99 to 1.00).
[0290] Induced Sputum: Sputum induction was performed on visits 2
and 3 (FIG. 5). For safety, induced sputum was only performed in
patients with an FEV1 was >50% predicted after albuterol
pretreatment (360 .mu.g). Induced sputum was processed and analyzed
in two SARP centers. The Wake Forest University center generated
the sputum cell differential counts for SARP, and the University of
California at San Francisco center extracted the RNA and measured
gene expression for IL-4, IL-5, IL-13, MUC5AC, MUC5B and
housekeeping genes for SARP.
[0291] Total and differential cell counts were quantified in SARP
subjects using methods previously described.sup.28, 29. Gene
expression of IL-4, IL-5, IL-13, MUC5AC and MUC5B was measured from
RNA isolated from induced sputum cell pellets from 77 asthma
subjects using previously described methods of real-time
Taqman-based quantitative PCR (qPCR).sup.30. The details of the
specific design of the primers and probes are shown in Table 3.
[0292] Sputum Quality Systems:
[0293] Cell counts: Sputum samples were deemed of sufficient
quality if squamous cell count was <80%.
[0294] qPCR: Only sputum samples with adequate cell counts were
analyzed for qPCR. RNA quality was measured with the Agilent 2100
bioanalyzer (Biogen, Weston, Mass.), which performs electrophoretic
separations according to molecular weight. The RNA integrity number
(RIN) was measured for each samples.sup.31,32 and only samples
whose RIN value was >5 were considered adequate for gene
expression profiling.sup.30.
[0295] Sputum and Cough Questions:
[0296] Three questions were included in questionnaires that were
completed by asthma patients at study entry. These three questions
were:
[0297] Question 1 (chronic bronchitis): Chronic bronchitis was
defined using the ATS/WHO definition, which assesses chronic cough
and sputum production in the preceding 2 years.sup.32. The specific
question used was: "Have you had cough and sputum production on
most days for at least 3 months a year for at least 2 consecutive
years". The answer options were: Yes, No, or Don't Know. The
subjects that answered "Don't know" were recoded as "no".
[0298] Question 2 (Phlegm): The specific question used was: "How
often do you cough up phlegm from your chest?" The answer options
were: Never, Daily, Weekly, or Monthly. The data was analyzed as a
dichotomous variable and was therefore recoded into "no history of
sputum expectoration"="Never" and "history of sputum
expectoration"="Daily, Weekly or Monthly".
[0299] Question 3 (cough): The specific question used was: "How
often do you have a non-productive cough (coughing without bringing
up phlegm)?" The answer options were: Never, Daily, Weekly, or
Monthly. The data was analyzed as a dichotomous variable and was
therefore recoded into "no history of non-productive cough"="Never"
and "history of non-productive cough"="Daily, Weekly or
Monthly".
[0300] Some patients did not have data for the sputum and cough
questions, for the following reasons: Initially, the chronic
bronchitis and phlegm questions were sub-questions of another
question "Have you ever had bronchitis?" Patients who answered "no"
to this question were directed to skip the chronic bronchitis and
phlegm questions. This skip logic was removed in October 2013, and
these became independent questions going forward. For this reason
data for "chronic bronchitis" and "phlegm" is missing in 25
patients (17.1%). The question about "cough" was added in October
2013, and this late addition to the protocol meant that there is
missing data in 64 patients (43.8%).
[0301] Asthma Control Test (ACT):
[0302] This is a validated self-administered tool for identifying
poorly controlled asthma.sup.33,34. ACT assesses the frequency of
shortness of breath and general asthma symptoms, use of rescue
medications, the effect of asthma on daily functioning, and overall
self-assessment of asthma control in the previous 4 weeks rated
using a 5-point scale. The score ranges from 5 (poor control) to 25
(complete control of asthma. An ACT<20 indicates poor
control.
[0303] Bronchoscopy:
[0304] A low dose CT scan was performed a week before the scheduled
bronchoscopy and assessed by a radiologist, trained in the mucus
score, for presence and absence of mucus plugging. One segment with
a mucus plug and one segment without mucus plug were chosen to be
sampled.
1) Collection of BAL: BAL was collected first from the site with
mucus, followed by the site without mucus. The technique used
involved wedging the flexible bronchoscope into the chosen
sub-segmental bronchus, instilling sterile saline solution, and
retrieving as much fluid as possible back through the channel using
suction. Fluid was instilled using hand pressure on a syringe, and
the fluid will be recovered into the same syringe using hand
suction. BAL consisted of 100 mL total instillate, split into two
50 mL aliquots. The standard technique was instillation and
recovery of 1 aliquot, followed by instillation and recovery of the
second. The return from these syringes was pooled. The bronchoscope
was flushed with normal saline between segments. 2) Processing of
BAL: No straining of fluid through gauze or wire mesh was
performed, in order to minimize loss of cells. Fluid was
centrifuged at 450.times.g (10 min at 4 C) to recover cell pellet.
The cell pellet was re-suspended in 2 ml PBS and kept on ice. Total
and differential cell counts were then quantified using the same
methods used in sputum processing.
Results
[0305] Human Subjects
[0306] MDCT scans of 146 adults with asthma and 22 healthy controls
in the NHLBI Severe Asthma Research Program (SARP) were analyzed
(Table 4). Among the 146 patients with asthma, 68.5% qualified as
severe using ATS/ERS criteria (Chung et al., Eur Respir J 43,
343-373 (2014)), and the pre-bronchodilator FEV1 was less than 80%
predicted in 85 patients (58%) and less than 60% predicted in 35
patients (24%) (Table 14).
[0307] Airway Mucus Plugs can be Identified and Quantified Using
Multidetector Computed Tomography Imaging of the Lungs
[0308] In preliminary studies, it was discovered that mucus plugs
could be discerned in the lungs of asthmatics using MDCT scans.
Specifically, mucus plugs could be identified as areas of
opacification within the airway lumen, contiguous with patent
airway lumen across sequential CT slices. These opacities were less
radiodense than adjacent blood vessels, and occlusion of the lumen
by these opacities could be partial or complete. These mucus plugs
were predominantly seen in sub-segmental airways, appearing as
focal or branching opacities (FIGS. 1A, 1B, and 1C) and usually
occurred in the absence of bronchial dilatation. Based on these
findings, a visual scoring system was developed to formally
quantify mucus plugs in MDCT scans (FIG. 1D). Mucus plugs were
defined as complete occlusion of a bronchus, irrespective of
generation or size. When parallel to the scan plane, mucus plugs
were recognized as tubular densities with or without branching.
When oriented obliquely or perpendicularly to the scan plane, they
were identified as oval or rounded opacities seen on sequential
slices and differentiated from blood vessels by their continuity
with patent portions of the bronchial lumen and their position
relative to adjacent blood vessels. The segments of each lobe were
systematically examined for the presence or absence of mucus plugs
and given a score of 1 or 0 accordingly. The segment scores of each
lobe were summed to generate a total mucus score for both lungs,
yielding an aggregate score ranging from 0-20. Peripheral airways
within 2 cm of the diaphragmatic pleura and costal pleura were
excluded from evaluation as the small caliber of these peripheral
airways makes occlusion by mucus difficult to ascertain. Each of
the five lung lobes was also systematically examined for the
presence or absence of bronchiectasis, defined as bronchoarterial
ratio >1.5. Five radiologists with sub-specialty training in
thoracic radiology reviewed the MDCT scans. Two radiologists were
randomly assigned to score each scan, and the scores of both raters
were averaged to generate the CT mucus score of each subject. This
approach generated scores ranging from 0 to 20 in increments of
0.5. In this way, mucus plugging was found to be present in at
least one of 20 lung segments in 58% (85/146) of asthmatics and in
only 4.5% (1/22) of healthy controls (FIG. 1E). Only 20% of the
asthmatics had bronchiectasis (Table 14 and FIG. 8A). The
proportion of segments with mucus plugs did not differ by lobe
(FIG. 8B). The intra-class correlation coefficient for
between-rater mucus score agreement was 0.80 (95% CI 0.74 to 0.85)
for all 168 scans. In addition, the within-rater mucus score
agreement for a random subset of 14 scans (3 healthy, 11 asthma)
that was scored twice by each of the five radiologists was 0.99
(95% CI 0.99 to 1.00). Among asthmatics, the median value of the
mucus score in the "mucus present" group was 3.5, and we used this
value to divide the asthmatics into three mucus subgroups based on
mucus score. Asthmatics with a mucus score of 0 were assigned to
the zero-mucus group, while those with mucus scores between 0.5 and
3.5, and 4 and 20, were assigned to the low- and high-mucus groups,
respectively (FIG. 1F).
[0309] Twenty-five asthmatic subjects in SARP-3 also had HRCT scans
performed previously as part of SARP-1 or SARP-2 (Table 9). These
SARP-1 and SARP-2 scans were obtained 2-9 years prior to the SARP-3
MDCT scans. Two radiologists at the University of Wisconsin,
Madison center read the 50 scans together to identify and score the
mucus plugs. In a score-based analysis, a comparison was performed
between mucus scores assigned to the first and second scans; mucus
scores were unchanged in 7 patients (28%), increased in 10 patients
(40%), and decreased in 8 patients (32%) over an average of 5.2
years (SD 2.5). 90% of subjects with a high mucus score (=4) on the
first scan had a high score on the second scan (FIG. 1G). In a
segment-based analysis, individual lung segments in the first and
second scans were compared. Remarkably, 65% of lung segments that
had a mucus plug on the first scan had a mucus plug in the same
segment on the second scan. It was also found that 80% of lung
segments with no mucus plug on the first scan had no mucus plug in
the same segment on the second scan. (FIGS. 1H and 1I). Persistent
presence or absence of mucus plugs from first to second scan were
seen with similar frequency across all bronchopulmonary segments
(FIG. 13).
[0310] Airway Mucus Plugs Strongly Associate with Measures of
Airflow Obstruction in Asthma
[0311] To test the hypothesis that mucus plugs in the airway cause
airflow obstruction, the relationship between the mucus score and
spirometric measures of airflow obstruction in the asthma subgroup
was examined. It was found that the CT mucus scores in asthmatics
were strongly and inversely correlated with pre-bronchodilator
measures of FEV1% predicted (Spearman's rho=-0.52, p<0.001), FVC
% predicted (Spearman's rho=-0.33, p<0.001), and FEV1/FVC
predicted (Spearman's rho=-0.53, p<0.001). These associations
remained significant after controlling for age, gender, and
measures of airway wall thickness in regression analyses (Table
10). It was noted that the mean FEV1 was 26% lower in the
high-mucus subgroup than the zero-mucus subgroup (Table 14 and FIG.
4B). Furthermore, 65.7% of patients with a pre-bronchodilator
FEV1<60% predicted had a high mucus score compared to 24% of
patients with FEV1 60-80% predicted and 8.2% of patients with
FEV1>80% predicted (FIG. 4E). Notably, 88% of the high mucus
score subgroup had FEV1 values <80% predicted, whereas only 38%
of the zero-mucus group had FEV1 values <80% predicted FIG. 4F).
In addition, it was also explored if the strong association between
MDCT mucus scores and FEV1 is reflected in other asthma outcomes.
It was found that asthma medication requirements, Asthma Control
Test (ACT) and ATS/ERS criteria for severe asthma were worse in the
high-mucus group than in the zero-mucus group (Table 14). Notably,
only two patients in the cohort met criteria for a diagnosis of
allergic bronchopulmonary aspergillosis (ABPA) (Agarwal et al.,
Clin Exp Allergy 43, 850-873 (2013)), and both had mucus scores in
the low (0.5-3.5) range (Table 11). Sensitivity to other molds and
aeroallergens did not differ significantly among mucus groups
(Table 5).
[0312] Influence of Airway Mucus Plugs on Treatment Responses to
Beta Adrenergic Agonists and Systemic Corticosteroids.
[0313] To explore how airway mucus plugs may influence treatment
responses to beta adrenergic agonists and systemic corticosteroids,
data for maximum bronchodilator reversibility testing (MBRT) after
treatment with inhaled albuterol (540-720 mcg) in the study cohort
was first examined. It was found that the mean post-bronchodilator
FEV1 in the high mucus group was 24% lower than in the zero-mucus
group (Table 14 and FIG. 4B). Furthermore, 71% of patients with a
post-bronchodilator FEV1<60% predicted had a high mucus score
compared to 40% of patients with FEV1 60-80% predicted and 12% of
patients with FEV1>80% predicted (FIG. 4E). Remarkably, 73% of
patients with a high mucus score had residual abnormalities in FEV1
(FEV1<80% predicted) following maximum bronchodilator testing,
whereas only 20% of patients with a zero-mucus score had residual
FEV1 abnormalities after maximum bronchodilation testing (FIG.
4F).
[0314] Next, data was examined for systemic corticosteroid
responsiveness testing (SCRT) with intramuscular triamcinolone
acetonide (40 mg) in the study cohort. It was found that the mean
post steroid FEV1 was 21% lower in the high-mucus group than the
zero-mucus group (Table 14 and FIG. 4B). Furthermore, 58% of
patients with a post-steroid FEV1<60% predicted had high mucus
scores compared to 27% of patients with FEV1 60-80% predicted and
14% of patients with FEV1>80% predicted (FIG. 4E). Notably, 72%
of patients with high mucus scores had residual abnormalities in
FEV1 following the SCRT, whereas only 28% of patients with zero
mucus scores had residual FEV1 abnormalities (FIG. 4F). The CT
mucus score was an independent predictor of residual abnormalities
in FEV1 after systemic corticosteroids in regression models (FIG.
14). Finally, when bronchodilator reversibility testing was
repeated after intramuscular triamcinolone acetonide treatment in
the study cohort., the FEV1 remained below 80% in half of the
patients with high mucus scores (FIG. 4F).
[0315] Symptoms of Chronic Mucus Hypersecretion are Neither
Sensitive Nor Specific for Mucus Plugs
[0316] To determine whether asthmatics could have mucus plugs
without CMH symptoms, the frequency of symptoms of CMH in the three
mucus plug subgroups was examined. Among 121 patients who completed
the cough and sputum questionnaire, 41 (34%) satisfied World Health
Organization criteria for chronic mucus hypersecretion (CMH) (cough
and sputum production on most days for at least 3 months a year for
at least 2 consecutive years) (American Thoracic Society. Am Rev
Respir Dis 85, 762-768 (1962)). It was found that 16 (40%) of
patients in the high-mucus group did not have symptoms of CMH
(Table 14). Conversely, it was found that 18 (30%) of the patients
in the zero-mucus group had symptoms of CMH. Although the subgroup
of patients with CMH did not have higher mucus scores than patients
without CMH, the patients with CMH were characterized by other
clinical differences, such as older age, higher BMI and evidence of
more severe asthma (Table 12). Interestingly, patients with CMH did
not differ from patients without CMH in blood or sputum cell
differentials or in sputum cell gene expression of cytokines or
mucin genes (Table 12).
[0317] Mucus Plugging on MDCT Scans is Associated with Airway Type
2 Inflammation
[0318] To test the hypothesis that type 2 inflammation promotes
formation of mucus plugs in the airway, multiple outcomes of type 2
inflammation in the three mucus subgroups were analyzed. It was
found that eosinophils in blood and sputum and nitric oxide levels
in exhaled breath were significantly higher in the high-mucus group
than in the low- and zero-groups (FIG. 10A and Table 12). Among
patients with high mucus scores, 71% had sputum eosinophilia
(sputum eosinophils >2%) and 66% had systemic eosinophilia
(blood eosinophils >300.times.10-9/L). In addition, gene
expression for IL-13 and IL-5 in sputum cells was significantly
higher in the high mucus group than in the low- and zero-mucus
groups (FIGS. 10B and 10C). The relationship between mucus scores
and sputum eosinophil percentage (Spearman's rho=0.51, p<0.001)
remained significant in linear regression models that controlled
for age, gender and wall thickness percentage (Table 13). In
addition, sputum eosinophils and sputum cell gene expression of
IL-13 and IL-5 remained high in many patients with high mucus
scores following systemic corticosteroid treatment (FIGS. 10A, 10B
and 10C), and the CT mucus score was an independent predictor of
residual sputum eosinophilia after systemic corticosteroids in
regression models (FIG. 15). Finally, whether the pattern of mucin
gene expression for MUC5AC and MUC5B followed a profile typical of
IL-13 activation in the high mucus group was explored. Using sputum
cell gene expression, it was found that the ratio of expression of
MUC5AC to MUC5B was significantly higher in the high-mucus group
than in the low- and zero-mucus groups (FIG. 10D).
[0319] Marked Eosinophilia in a Bronchial Subsegment with Mucus
Plugs
[0320] The finding that patients with mucus plugs have much higher
sputum eosinophil levels than patients without mucus plugs (FIG.
10), coupled with the data showing that mucus plugs can persist in
the same bronchial subsegment for many years (FIG. 1), led us to
consider the possibility that regional heterogeneity in mucus plugs
reflects regional heterogeneity in type 2 inflammation. This
possibility was examined in an asthma patient whose MDCT scan
showed a mucus plug in the anterior segment of the left upper lobe
(proximally in the medial sub segment LB3b) (FIG. 11A), and no
mucus in the superior segment of the right lower lobe (RB6).
Bronchoscopy was performed in this subject to separately lavage the
LB3b and RB6b sub-segments. It was found that the eosinophil
percentage in the plugged segment was much higher than in the
non-plugged segment (11.8% vs. 2.4%). Notably, staining of the
lavage cell cytospin from the plugged segment showed mucus that was
densely infiltrated with intact eosinophils (FIGS. 11B and 11C),
despite the fact that this patient was taking high doses of inhaled
corticosteroids.
[0321] IL-13 Increases Eotaxin-3 in Apical Secretions of Airway
Epithelial Cells.
[0322] The increase in sputum eosinophils and in sputum cell IL-13
gene expression in the high mucus plug subgroup coupled with the
intense infiltration of mucus by eosinophils in the lavage sample
led us to consider mechanisms by which IL-13 might promote
eosinophil infiltration of mucus. It was previously reported that
eotaxin-3 (CCL26) is marked upregulated in the airway in type
2-high asthma (Peters et al., The Journal of allergy and clinical
immunology 133, 388-394 (2014); Choy et al., J Immunol 186,
1861-1869 (2011)), and it was explored here if IL-13 causes
secretion of eotaxin-3 into the mucus layer of airway epithelial
cells. Using primary human airway epithelial cells cultured at air
liquid interface (FIG. 11D), it was found that IL-13 causes marked
increases in the concentration of eotaxin-3 in apical mucus
secretions (FIG. 11E).
[0323] Activated Eosinophils Cause Cysteine Crosslinking Via
Respiratory Burst Reactive Oxygen Species.
[0324] The increase in gene expression for cysteine-rich MUC5AC and
the dense infiltration of mucus by eosinophils led to the
consideration mechanisms by which eosinophils could promote mucus
plug formation in asthma. It was recently reported that oxidation
increases mucin polymer cross-links to stiffen airway mucus gels in
cystic fibrosis, and the role of neutrophils as cellular sources of
reactive oxygen products was emphasized (Yuan et al., Sci Transl
Med 7, 276ra227 (2015)). However, it has been shown that
eosinophils activated with phorbol-12-myristate-13-acetate (PMA)
produce even greater amounts of reactive oxygen products than
neutrophils (Petreccia, & Clark, J Leukoc Biol 41, 283-288
(1987); Lacy et al., J Immunol 170, 2670-2679 (2003)), so whether
eosinophils might release hydrogen peroxide (H.sub.2O.sub.2),
superoxide anion (O.sub.2--), or hydroxide (HO) to oxidize
cysteines in mucins and generate covalent disulfide bridges was
considered. Prior studies have shown that reactive oxygen products
are released from resting eosinophils, but that eosinophils
activated with PMA produce even higher concentrations of reactive
oxygen species 18. To test whether resting eosinophils or
PMS-stimulated eosinophils convert cysteines to their oxidized
cysteine product (cystine), BODIPY labeled cysteine was exposed to
eosinophils from asthma donors. BODIPY fluoresces when cysteine is
in its monomeric form, but this fluorescence quenches completely
when cysteine is oxidized to form cystine dimers (FIG. 11F). A
small amount of cystine dimer formation was found when
BODIPY-labeled cysteine was maintained in buffer solution alone,
but dimer formation was significantly increased when the
BODIPY-labeled cysteine was exposed to either unstimulated or
PMA-stimulated eosinophils (FIG. 11G). To explore the role of
eosinophil-derived H.sub.2O.sub.2 in the mechanism of this cystine
formation, catalase was used to inhibit H.sub.2O.sub.2 and showed
significantly decreased cystine dimer formation in experiments
using both unstimulated and stimulated eosinophils (FIG. 11H).
Without being bound by any scientific theory, it is concluded that
eosinophil-derived H.sub.2O.sub.2 is a mediator of
eosinophil-driven cysteine oxidation and cystine dimer
formation.
[0325] Link Between Eosinophilia and Mucus Plugs in the
Pathogenesis of Airflow Obstruction in Severe Asthma
[0326] Among the 146 asthmatics that were studied, almost 60% had
physiologic evidence of airflow obstruction and 24% had severe
obstruction. The data provide strong evidence here that mucus plugs
are a mechanism of airflow obstruction in these patients. Using a
novel method of quantifying mucus plugs based on visual assessment
of MDCT scans by experienced chest radiologists, a strong inverse
relationship was found between the MDCT mucus score and FEV1
values. It was also found that the majority of patients with severe
obstruction had at least four bronchial sub-segments with one or
more airways completely occluded with mucus. Some of these patients
had mucus plugs in more than half of their bronchial subsegments.
Although strong associations do not prove causality, and without
being bound by any scientific theory, it is proposed that the
association between mucus plugs and airflow obstruction in these
asthmatics is causal, because mucus plugs that completely occlude
sub-segmental airways will cause regional airflow obstruction at a
minimum and more widespread airflow limitation when present in
multiple bronchopulmonary segments. Airway smooth muscle
contraction could be a mechanism of airflow obstruction in these
patients, but many did not normalize their lung function when they
were treated with high doses of inhaled bronchodilator. In
addition, although airway remodeling is considered a mechanism of
airflow obstruction in severe asthma (Fahy, Am J Respir Crit Care
Med 164, S46-51 (2001); Hartley et al., J Allergy Clin Immunol 137,
1413-1422 e1412 (2016)), it was found that the relationship between
mucus plugs and airflow obstruction remained very strong when
regression models were used to control for radiographic measures of
airway wall thickness. Importantly, it was also found that symptoms
of chronic mucus hypersecretion (CMH) were neither sensitive or
specific for the mucus plug phenotype uncovered here, perhaps
because the mucus plugs occur in sub-segmental airways that lack
large numbers of cough receptors (Berglund, E. Cough and
Expectoration, (Munksgaard, 1980); Jackson, J Am Med Assoc 79,
1399-1403 (1922); Widdicombe, Eur Respir J 8, 1193-1202 (1995)). It
is shown that the clinical and airway inflammation features of the
CMH phenotype are different from the features of mucus plug
phenotype. Thus, it is reveal here that not all mucus phenotypes in
asthma are the same, and the unique ability of MDCT lung imaging to
identify patients with a mucus plug phenotype is demonstrated.
[0327] Although the mucus plugs were heterogeneously distributed in
the 20 bronchopulmonary segments among patients, the plugs tended
to occur in the same bronchopulmonary segment in individual
patients studied repeatedly at intervals ranging from 2-9 years.
These plugs occurred in patients who had prominent airway type 2
inflammation despite use of high doses of inhaled corticosteroids
and protocol-mandated intramuscular corticosteroid treatment.
Indeed, in a case example, the mucus-positive bronchopulmonary
segment had mucus intensely infiltrated with eosinophils, whereas
the mucus-negative segment had a markedly lower eosinophil
percentage in the lavage fluid. Taken together, these data indicate
that mucus plugs on MDCT scans mark segments with type 2
inflammation and that type 2 inflammation is heterogeneously
distributed among lung segments. The reasons for this heterogeneity
are not revealed by our study, but we speculate that childhood
viral airway infections--known to infect some lung segments and not
others and to be a risk for lifelong asthma (Weiss et al., Am Rev
Respir Dis 131, 573-578 (1985); Frick et al., J Allergy Clin
Immunol 63, 228-241 (1979); Sigurs et al., Thorax 65, 1045-1052
(2010); Kusel et al., J Allergy Clin Immunol 119, 1105-1110
(2007))--may be a factor. Recent murine studies show that
infectious stressors no longer present in the host can cause
localized immune damage ("immunological scarring") that drive long
term immune alterations leading to chronic inflammatory disease
(Fonseca et al., Cell 163, 354-366 (2015); Kamdar et al., Cell Host
Microbe 19, 21-31 (2016)). Thus, it may be that childhood viral
infections variably damage airway epithelial cells in specific lung
segments to cause persistent type 2 inflammation and long-lasting
mucus pathology in these segments. In human lungs, each of the 20
bronchopulmonary segments develop and operate as discrete
anatomical and functional units with little collateral
communication between segments (Kaminsky, D. Netter Collection of
Medical Illustrations: Respiratory System. in Netter Collection of
Medical Illustrations: Respiratory System, Vol. 3 16 (Elsevier
Health Sciences, 2011)). Therefore, each of these segments could
emerge from childhood with its own distinct injury history and type
2-associated pathology that reflects previously sustained
immunological scars.
[0328] Airway mucus in health is normally a lightly cross-linked
mucus gel comprised of specific gel-forming mucins (MUC5AC and
MUC5B) (Innes et al., Am J Respir Crit Care Med 180, 203-210
(2009); Fahy & Dickey, N Engl J Med 363, 2233-2247 (2010)), and
it is normally easily transported by the mucociliary escalator and
does not form mucus plugs. Evidence is found here that the
mechanism of mucus plug formation in chronic severe asthma involves
pathologic interactions between airway eosinophils and
cysteine-rich mucins. For example, increased gene expression for
IL-5 and IL-13 is found in asthma sputum cells, and IL-13 greatly
increases secretion of eotaxin-3--a potent eosinophil
chemoattractant (Kitaura et al., J Biol Chem 274, 27975-27980
(1999); Li et al., J Immunol 162, 2477-2487 (1999); Shinkai et al.,
J Immunol 163, 1602-1610 (1999); Yuan et al., Eur J Immunol 36,
2700-2714 (2006))--by airway epithelial cells. Without being bound
by any theory, these data are interpreted to indicate that
eosinophil-rich mucus occurs in these patients because of
eotaxin-3-mediated accumulation of eosinophils, whose survival is
prolonged in the presence of high levels of IL-5. The fact that
sputum eosinophilia was a prominent feature of patients with mucus
plugs despite their treatment with high doses of corticosteroids
may also be attributable to IL-5, because steroid-induced
eosinophil apoptosis is known to be potently inhibited by IL-5
(Pazdrak et al., Apoptosis 21, 421-431 (2016)).
[0329] Cysteine (Cys) residues in mucins participate in
establishing disulfide linkages within and among mucin monomers,
and Cys domains are more prevalent in MUC5AC than in MUC5B
(Thornton et al., Annu Rev Physiol 70, 459-486 (2008)). It is found
here that MUC5AC is upregulated in sputum cells from patients with
a high mucus score, and that the number of eosinophils in sputum is
strongly correlated with the number of mucus plugs on MDCT scans.
Eosinophils are a rich source of reactive oxygen species (Lacy et
al., J Immunol 170, 2670-2679 (2003)), and it was recently reported
that oxidation of mucins in healthy airway mucus promotes cysteine
disulfide cross-links that stiffens the mucus gel to create
pathologic mucus (Yuan et al., Sci Transl Med 7, 276ra227 (2015)).
It is found here that eosinophils from asthma donors can convert
cysteine to cystine, its oxidized disulfide product. The
eosinophils did not need to be activated to catalyze this
conversion--which was mediated at least in part by hydrogen
peroxide--but activated eosinophils had larger effects. Taken
together, and without being bound by any scientific theory, these
data lead to the conclusion that mucus plugs in asthma form because
of airway type 2 inflammation and eosinophil-mediated cross-linking
of cysteine-rich mucins (FIG. 12).
[0330] In conclusion, it is shown that type 2 inflammation promotes
formation of airway mucus plugs in asthma to cause airflow
obstruction. It is also concluded that MDCT lung scans reveal the
heterogeneity of mucus plugs and airway type 2 inflammation among
bronchopulmonary segments in the lung, and that MDCT lung scans are
proposed to be useful as a biomarker (e.g., in clinical trials) to
test whether mucolytic treatments improve airflow in asthma.
TABLE-US-00001 TABLE 1 CT parameters: Total Lung Capacity (TLC)
protocol GE SIEMENS SIEMENS VCT GE Definition Definition SIEMENS 64
slice/ Discovery PHILIPS (AS Plus) (DS) Sensation Discovery CT
750HD Brilliance Scanner Model 128 slice 64 slice 64 slice STE 64
slice 64 slice Scan Type Spiral Spiral Spiral Helical Helical-
Spiral Helix Single Standard Source Scan FOV No selection No No
Large Large No selection Selection selection Rotation Time (s) 0.5
0.5 0.5 0.5 0.5 0.5 Det. Configuration 128 .times. 0.6 64 .times.
0.6 64 .times. 0.6 64 .times. 0.625 64 .times. 0.625 64 .times.
0.625 Pitch 1.0 1.0 1.0 0.984 0.984 0.923 kVp 120 120 120 120 120
120 Effective mAs S-90 S-85 S-80 S-145 S-145 S-105 M-110 M-105
M-100 M-180 M-180 M-130 L-165 L-150 L-145 L-270 L-270 L-190 Dose
modulation Care Dose Care Dose Care Dose Auto mA Auto mA Dose Right
OFF OFF OFF OFF OFF (ACS) OFF Std. Algorithm B35 B35 B35 Standard
Standard B Lung Algorithm B30 B31 None Detail Detail YB Additional
No Selection No No No IQ Enhance Adaptive Image filters Selection
Selection Selection OFF Filtering OFF Thickness (mm) 0.75 0.75 0.75
0.625 0.625 0.67 Interval (mm) 0.5 0.5 0.5 0.5 0.5 0.5 Iterative
IRIS IRIS No ASIR ASIR iDOSE reconstruction OFF OFF Selection OFF
OFF OFF Scan Time (Sec) <10 <10 <10 <10 <10 <10
30 cm length Recon Mode N/A N/A N/A Plus Plus N/A Smart mA N/A N/A
N/A OFF OFF N/A * Effective mAs: Siemens = Eff. mAs, GE = mA
setting, Philips = mAs. S = small, M = medium, and L = large. BMI
categories as defined in Table S9.
TABLE-US-00002 TABLE 2 CTDIvol as a function of BMI Body Size BMI
Range CTDIvol (mGy) Small 15 to 19 11.4 Medium 20 to 30 7.6 Large
>30 6.1
TABLE-US-00003 TABLE 3 Gene Primers and Probes SEQ Gene Primers
Sequence ID NO: PPIA-outer forward ATGAGAACTTCATCCTAAAGCAT 1 ACG
PPIA-outer reverse TTGGCAGTGCAGATGAAAAACT 2 PPIA-inner forward
ACGGGTCCTGGCATCTTGT 3 PPIA-probe ATGGCAAATGCTGGACCCAACAC 4 A
PPIA-inner reverse GCAGATGAAAAACTGGGAACCA 5 GAPDH-outer forward
CAATGACCCCTTCATTGACCTC 6 GAPDH-outer reverse CTCGCTCCTGGAAGATGGTGAT
7 GAPDH-inner forward GATTCCACCCATGGCAAATTC 8 GAPDH-probe
CGTTCTCAGCCTTGACGGTGCCA 9 GAPDH-inner reverse
GGGATTTCCATTGATGACAAGC 10 YWHAZ-outer forward
CTTCTGTCTTGTCACCAACCATTC 11 YWHAZ-outer reverse
CAACTAAGGAGAGATTTGCTGCA 12 G YWHAZ-inner forward
TGGAAAAAGGCCGCATGAT 13 YWHAZ-probe TGGCTCCACTCAGTGTCTAAGGCA 14 CCCT
YWHAZ-inner reverse TCTGTGGGATGCAAGCAAAG 15 PSMB2-outer forward
CCATATCATGTGAACCTCCTCCT 16 PSMB2-outer reverse
GTCGAGGATACTGAGAGTCAGGA 17 A PSMB2-inner forward
TCCTCCTGGCTGGCTATGAT 18 PSMB2-probe ACAGCGCTGGCCCTTCATGCTC 19
PSMB2-inner reverse GGCTGCCAGGTAGTCCATGT 20 IL4-outer forward
GGGTCTCACCTCCCAACTGC 21 IL4-outer reverse TGTCTGTTACGGTCAACTCGGT 22
IL4-inner forward GCTTCCCCCTCTGTTCTTCCT 23 IL4-probe
TCCACGGACACAAGTGCGATATC 24 ACC IL4-inner reverse
GCTCTGTGAGGCTGTTCAAAGTT 25 IL5-outer forward GCCATGAGGATGCTTCTGCA
26 IL5-outer reverse GAATCCTCAGAGTCTCATTGGCTA 27 TC IL5-inner
forward AGCTGCCTACGTGTATGCCA 28 IL5-probe CCCCACAGAAATTCCCACAAGTG
29 CA IL5-inner reverse GTGCCAAGGTCTCTTTCACCA 30 IL13-outer forward
CAACCTGACAGCTGGCATGT 31 IL13-outer reverse CCTTGTGCGGGCAGAATC 32
IL13-inner forward GCCCTGGAATCCCTGATCA 33 IL13-probe
TCGATGGCACTGCAGCCTGACA 34 IL13-inner reverse GCTCAGCATCCTCTGGGTCTT
35 IL17-outer forward ACTGCTACTGCTGCTGAGCCT 36 IL17-outer reverse
GGTGAGGTGGATCGGTTGTAGT 37 IL17-inner forward CAATCCCACGAAATCCAGGA
38 IL17-probe CCCAAATTCTGAGGACAAGAACT 39 TCCCC IL17-inner reverse
TTCAGGTTGACCATCACAGTCC 40 MUC5B-outer forward
TACATCTTGGCCCAGGACTACTGT 41 MUC5B-outer reverse
AGGATCAGCTCGTAGCTCTCCAC 42 MUC5B-inner forward CATCGTCACCGAGAACATCC
43 MUC5B-probe CTGTGGGACCACCGGCACCAC 44 MUC5B-inner reverse
AAGAGCTTGATGGCCTTGGA 45 MUC5AC-outer TGTGGCGGGAAAGACAGC 46 forward
MUC5AC-outer CCTTCCCATGGCTTAGCTTCAGC 47 reverse MUC5AC-inner
CGTGTTGTCACCGAGAACGT 48 forward MUC5AC-probe CTGCGGCACCACAGGGACCA
49 MUC5AC-inner ATCTTGATGGCCTTGGAGCA 50 reverse
TABLE-US-00004 TABLE 4 Characteristics of Healthy and Asthma
Subjects Healthy for Healthy for MDCT analysis Sputum analysis
Asthma Characteristics (n = 22) (n = 39) (n = 146) Mean age
(years)* 29.5 .+-. 11.5 39.2 .+-. 12.6 46.8 .+-. 16.0 Female sex -
no. (%) 15 (60.0) 21 (53.9) 91 (62.3) Race, no. (%) American Indian
or Alaska Native 0 (0) 0 (0) 0 (0) Asian 1 (4) 3 (7.7) 10 (6.9)
Black or African American 3 (12) 6 (15.4) 34 (23.3) Caucasian 17
(68) 25 (64.1) 90 (61.6) Native Hawaiian or Pacific Islander 0 (0)
0 (0) 0 (0) Mixed race 1 (4) 5 (12.8) 12 (8.2) Unknown/refused to
answer 3 (12) 0 (0) 0 (0) Spirometry data FEV1 (% predicted)* 98.2
.+-. 9.3 103 .+-. 12.1 75.5 .+-. 21.8 FVC (% predicted)* 100.1 .+-.
10.3 105.6 .+-. 14.3 90.0 .+-. 19.0 FEV1/FVC 0.84 .+-. 0.03 0.98
.+-. 5.6 0.83 .+-. 0.13 History of pulmonary disease 0 (0) (0) 146
(100) History of atopy* 4 (16) (0) 110 (75.3) History of
smoking.sup..dagger. 0 (0) (0) 0 (0) Data reported as mean and
standard deviation unless otherwise indicated. CT scans of healthy
controls from SARP II and SARP III. CT scans of asthma subjects
from SARP III. *p < 0.05 comparing asthma to healthy subjects
.sup..dagger.Predicted values could not be calculated in one
healthy male subject for sputum analysis (age 23 years; FEV1 4.65L,
FVC 5.81). .sup..dagger-dbl.Smoking history refers to >5 pack
years
TABLE-US-00005 TABLE 5 Aeroallergen Sensitivity Mucus Score All
Zero Low High Allergen (n = 144) (n = 61) (n = 44) (n = 39) Fungal
Aspergillus fumigatus, no. (%) 30 (20.8) 11 (18.0) 11 (25.0) 8
(20.5) Cladosporium herbarum,no. (%) 21 (13.9) 8 (13.1) 9 (20.5) 4
(10.3) Alternaria alternata, no. (%) 37 (25.7) 15 (24.6) 15 (34.1)
7 (18.0) Furred animal Cat dander, no. (%) 82 (56.6) 32 (52.5) 28
(62.2) 32 (56.4) Dog dander, no. (%) 78 (53.8) 33 (54.1) 26 (57.8)
19 (48.7) Mouse urine proteins, no. (%) 16 (11.0) 6 (9.84) 7 (15.6)
3 (7.7) Rat urine proteins, no. (%) 21 (14.5) 10 (16.4) 7 (15.6) 4
(10.3) Mites and insects Dermatoph pteronyssinus, no. (%) 70 (48.3)
31 (50.8) 23 (51.1) 16 (41.0) Dermatoph fariane, no. (%) 71 (49) 32
(52.5) 24 (53.3) 15 (38.5) Cockroach, no. (%) 29 (20.1) 16 (26.2) 7
(15.9) 6 (15.4) Plant Ragweed, no. (%)* 44 (30.6) 25 (41.0) 13
(29.6) 6 (15.4) Weed mix, no. (%) 41 (28.5) 23 (37.7) 12 (27.3) 6
(15.4) Grass mix, no. (%) 42 (29.0) 18 (29.5) 13 (29.0) 11 (28.2)
Tree mix, no. (%) 45 (31.3) 20 (32.8) 14 (31.8) 11 (28.2)
Aeroallergen sanitization defined as specific IgE > 0.35 IU on
Immunocap test (Phadia, Uppsala Sweden) Blood measurements were not
available for 2 subjects. *P < 0.05
TABLE-US-00006 TABLE 6 Linear regression coefficients of spirometry
and sputum eosinophils at baseline predicted by CT mucus score in
asthmatics Regression models .beta. coefficient adjusted for
covariates* (95% CI) P value Model predicting FEV1 % predicted
Mucus Score Zero (reference) -- -- Low -4.6 (-11.7, 2.4) 0.20 High
-22.4 (-29.9, -14.9) <0.001 Model predicting FVC % predicted
Mucus Score Zero (reference) -- -- Low 0.7 (-6.0, 7.5) 0.83 High
-9.8 (-16.9, -2.6) 0.008 Model predicting FEV1/FVC predicted Mucus
Score Zero (reference) -- -- Low -6.4 (-10.5, -2.3) 0.003 High
-17.1 (-21.5, -12.7) <0.001 Model predicting percent sputum
eosinophils Mucus Score Zero (reference) -- -- Low 1.3 (-2.4, 5.0)
0.49 High 10.8 (7.1, 14.5) <0.001 *Linear regression models
adjusted for age and gender. .beta. coefficients indicate the
change in dependent variables (e.g. FEV1 % predicted) for each
level of segment score compared to the zero mucus score.
MBRT--maximum bronchodilator reversibility test SCRT--Systemic
corticosteroid responsiveness test
Characteristics of Study Subjects
[0331] One hundred and forty six adults with asthma and 22 healthy
controls underwent multidetector computerized tomography (MDCT)
lung scans. Compared to the healthy subjects, patients with asthma
were older, had lower lung function, and had a higher prevalence of
atopy (Table 4). One hundred of the 146 asthma patients (68.5%) met
the ATS/ERS criteria for severe asthma.sup.4. Eighty five of the
146 asthmatics (58.2%) had a pre bronchodilator FEV1<80%
predicted, and 35 of these 84 subjects (41.2%) had FEV1<60%
predicted.
Clinical Characteristics of Asthmatics with High Mucus Scores
[0332] Patients in the high mucus subgroup were older, had
significantly lower scores on the Asthma Control Test, were more
likely to be on treatment with inhaled or oral corticosteroids,
were more likely to be classified as having severe asthma by
ATS/ERS criteria, and had much lower values for FEV1 and FVC (Table
7) than patients in the low and zero mucus subgroups. In addition,
patients in the high mucus subgroup were more likely to report a
history of nasal polyposis and to have undergone surgery for
removal of nasal polyps or for treatment of chronic sinusitis
(Table 1). Compared to patients with a zero mucus score, patients
with a high score did not have more frequent symptoms of cough or
sputum production and did not have a higher frequency of
exacerbation in the previous 12 months (Table 7). Two patients met
criteria for a diagnosis of allergic bronchopulmonary aspergillosis
(ABPA).sup.9, and both had mucus scores in the low (0.5-3.5) range.
Sensitivity to other molds and aeroallergens did not differ
significantly among mucus groups (Table 5).
TABLE-US-00007 TABLE 7 Characteristics of Subjects with Asthma
across Mucus Score Categories Mucus Score All Zero Low High
Characteristic (n = 146) (n = 61) (n = 45) (n = 40) Mucus score 0.5
(0-4.5) 0 (0) 1.5 (0.5-2.5) 9.5 (6-12) Mean age
(years).sup..dagger. 46.8 .+-. 16.0 43.2 .+-. 15.4 46.7 .+-. 15.6
52.3 .+-. 16.3 Male sex - no. (%) 55 (37.7) 18 (29.5) 19 (42.2) 18
(45.0) Body Mass Index (kg/m.sup.2) 32.7 .+-. 9.3 34.3 .+-. 9.9
32.5 .+-. 10.5 30.7 .+-. 6.3 Severe Asthma - no.
(%).sup..sctn..dagger. 100 (68.5) 33 (54.1) 31 (68.9) 36 (90.0)
Score on Asthma Control Test.sup..dagger. 18.0 (14-21) 19.0 (15-21)
18.0 (14-22) 16.5 (13-19) Maintenance corticosteroid use - no. (%)
Inhaled - any dose 142 (97.3) 57 (93.4) 45 (100.0) 40 (100.0)
Inhaled - high dose.sup..dagger. 103 (70.6) 36 (59.0) 31 (68.9) 36
(90.0) Systemic.sup..dagger. 15 (10.3) 3 (4.9) 3 (6.7) 9 (22.5)
Spirometry data.sup.|| FEV1 (% predicted).sup..dagger..dagger-dbl.
75.4 .+-. 21.7 85.4 .+-. 18.1 79.6 .+-. 21.4 58.7 .+-. 19.9 FVC (%
predicted).sup..dagger..dagger-dbl. 90.1 .+-. 19.0 95.0 .+-. 15.9
94.7 .+-. 19.7 79.4 .+-. 20.8 FEV1/FVC
(predicted)*.sup..dagger..dagger-dbl. 0.83 .+-. 0.13 0.89 .+-. 0.11
0.83 .+-. 0.11 0.73 .+-. 0.12 FEV 25-75 (%
predicted)*.sup..dagger..dagger-dbl. 55.2 .+-. 30.6 71.1 .+-. 34.5
56.3 .+-. 25.9 34.0 .+-. 15.3 Sputum cell counts (%)
Eosinophils.sup..dagger..dagger-dbl. 0.7 (0-4.4) 0.2 (0-0.9) 0.5
(0.2-1.6) 7.3 (1.5-21.4) Neutrophils 58 (35-78) 62 (37-83) 60
(35-79) 47 (31-70) Epithelial cells 4.7 (2-11.5) 4.3 (2.3-11.5) 4.3
(2.3-5.9) 6.9 (1.9-17) FENO (ppm)**.sup..dagger. 22 (12-33) 18
(10-27) 24 (13-38) 28 (19-40) Blood cell counts
(.times.10.sup.6/L).sup..dagger..dagger.
Eosinophils.sup..dagger..dagger-dbl. 306 .+-. 276 209 .+-. 153 309
.+-. 282 459 .+-. 349 Neutrophils 4286 .+-. 2350 4569 .+-. 2951
4030 .+-. 1934 4134 .+-. 1592 Total white blood cells 7279 .+-.
2548 7534 .+-. 3149 6953 .+-. 2138 7255 .+-. 1827 Total IgE
(IU/mL).sup..dagger..dagger. 150 (52-363) 126 (32-482) 150 (74-335)
181 (79-363) Nasal polyposis - no. (%).sup..dagger. 29 (19.9) 5
(8.2) 11 (24.5) 13 (32.5) Nasal polypectomy.sup..dagger. 21 (14.4)
1 (1.6) 8 (17.8) 12 (30.0) Chronic sinusitis - no. (%) 46 (31.5) 17
(27.9) 14 (31.1) 15 (37.5) Sinus surgery.sup..dagger. 19 (13.0) 3
(4.9) 8 (17.8) 8 (20.0) Chronic Bronchitis - no.
(%).sup..dagger-dbl..dagger-dbl. 41 (28.1) 18 (29.5) 10 (22.2) 13
(32.5) Sputum expectoration - no. 105 (71.9) 45 (73.8) 36 (80.0) 24
(60.0) (%).sup..dagger-dbl..dagger-dbl. Non-productive cough - no.
67 (45.9) 25 (41.0) 24 (53.3) 18 (45.0)
(%).sup..dagger-dbl..dagger-dbl. Exacerbations in previous 12 74
(50.7) 29 (47.5) 2 (51.1) 22 (55.0) mths - no. (%) Bronchiectasis
on CT - no. (%) 29 (19.9) 7 (11.5) 11 (24.4) 11 (27.5) ABPA - no.
(%).sup..sctn..sctn. 3 (2.1) 0 (0) 2 (1.4) 0 (0) Data reported as
mean .+-. standard deviation or median (interquartile range). Zero
represents the "mucus absent" group (mucus score = 0). Low
represents the group with mucus scores 0.5-3.5 and high represents
the group with mucus scores .gtoreq.4, based on the median score of
3.5 in the "mucus present" group. *p < 0.05 for comparison of
zero and low scores .sup..dagger.p <0.05 for comparison of zero
and high scores .sup..dagger-dbl.p <0.05 for comparison of low
and high scores .sup..sctn.The classification of asthma severity
was determined using criteria developed by SARP (FIG. 8B)
.sup.||Pre bronchodilator spirometry .sup. Sputum cell counts were
not available in 40 subjects due to ineligibility for sputum
induction or because the induced sputum not meet quality metrics.
**Fraction of nitric oxide in exhaled breath (FeNO) was not
measured in 4 subjects. .sup..dagger..dagger.Blood measurements
were not available for 2 subjects.
.sup..dagger-dbl..dagger-dbl.Questionnaire data is missing in 25
patients for chronic bronchitis and sputum expectoration and in 64
patients for non-productive cough .sup..sctn..sctn.Diagnosed using
elevated total IgE, specific IgE to Aspergillus fumigatus, systemic
eosinophilia, and radiographic changes consistent with ABPA
High Mucus Scores and Airflow Obstruction
[0333] In asthma patients the CT mucus scores were strongly and
inversely associated with pre bronchodilator measures of FEV1%
predicted (Spearman's rho=-0.52, p<0.001), FVC % predicted
(Spearman's rho=-0.33, p<0.001), and FEV1/FVC predicted
(Spearman's rho=-0.53, p<0.001), and these associations remained
significant in linear regression models that controlled for age and
gender (Table 6). Notably, 66% percent of patients with pre
bronchodilator FEV1<60% had high mucus scores compared to 24% of
patients with FEV1 60-80% and 8% of patients with FEV1>80% (FIG.
2A). In addition, the proportions of patients with abnormal values
for FEV1% predicted, FVC % predicted and FEV1/FVC predicted were
significantly higher in the high mucus group than the zero mucus
group (FIG. 2B).
High Mucus Scores and Airflow Inflammation
[0334] Patients in the high mucus subgroup had significantly higher
eosinophil percentages in induced sputum and higher eosinophil
counts in blood than patients in the low and zero mucus subgroups
(Table 7, FIG. 3A, 3B). CT mucus scores were strongly associated
with sputum eosinophil % (Spearman's rho=0.51, p<0.001), and
this association remained significant in linear regression models
that controlled for age and gender (Table 6). Among patients with a
high mucus score, 71% had sputum eosinophilia (sputum eosinophils
>2%) and 66% had systemic eosinophilia (blood eosinophils
>300.times.10-9/L). In addition, exhaled nitric oxide levels in
patients in the high mucus subgroup were significantly higher than
in the low and zero mucus subgroups (Table 7). Furthermore, a
composite metric of gene expression for Th2 cytokines (IL-4, IL-5,
and IL-13)("Th2 gene mean").sup.7 in sputum cells from patients in
the high mucus subgroup was significantly higher than in sputum
cells from patients in the low and zero mucus subgroups (FIG. 3C).
Finally, the ratio of expression of MUC5AC to MUC5B in sputum cells
from patients in the high mucus subgroup was significantly higher
than in sputum cells from patients in the low and zero mucus
subgroups (FIG. 3D).
CT Mucus Scores and Response of FEV1 to Treatment
[0335] The FEV1% was markedly lower in the high mucus group than
the low and zero mucus groups at baseline (Table 7), but the
absolute change in FEV1% following MBRT was not significantly
different across the 3 mucus groups on visit 2 (FIG. 4A).
Therefore, 73% of patients with a high mucus score had residual
abnormalities in FEV1 (FEV1 less than 80% predicted) following
MBRT, whereas only 20% of patients with a zero mucus score had
residual FEV1 defects (FIG. 4B). Notably, all patients whose FEV1
was less than 60% predicted following the MBRT had mucus plugs on
CT.
[0336] The absolute change in FEV1% following SCRT was not
significantly different across the 3 mucus groups on visit 3 (FIG.
4A), but 72% of patients with a high mucus score had residual
abnormalities in FEV1 following the SCRT, whereas only 28% of
patients with zero mucus score had residual FEV1 defects (FIG.
4B).
[0337] The absolute change in FEV1% following the combined SCRT and
MBRT was significantly higher in the high mucus group than the zero
group (FIG. 4A), but 50% of patients in the high mucus group had
residual abnormalities in FEV1 following the SCRT and MBRT, whereas
only 13% of patients with zero mucus score had residual FEV1
defects (FIG. 4B). A high mucus score CT mucus score was an
independent predictor of residual reduction in FEV1 after maximal
bronchodilation and systemic corticosteroids in regression models
that controlled for age and gender (Table 8).
CT Mucus Scores and Response of Sputum Measures to Treatment
[0338] Sputum eosinophil % was considerably higher in the high
mucus group than the low and zero mucus groups at baseline and did
not decrease significantly in the high mucus group following the
SCRT (FIG. 4C). Similarly, the Th2 gene mean in sputum cells was
higher in the high mucus group than the low and zero mucus groups
at baseline and did not decrease significantly in the high mucus
group following the SCRT (FIG. 4D). The high CT mucus score was an
independent predictor of residual sputum eosinophilia after
systemic corticosteroids in regression models that controlled for
age and gender (Table 8).
TABLE-US-00008 TABLE 8 Linear regression coefficients of residual
abnormalities in FEV1 % predicted and percentage sputum eosinophils
after treatment predicted by CT mucus score in asthmatics
Regression models adjusted for covariates* .beta. coefficient (95%
CI) P value Model predicting FEV1 % predicted Mucus Score Zero
(reference) -- -- Low -5.3 (-11.9, 1.4) 0.12 High -9.5 (-16.7,
-2.3) 0.01 Model predicting percentage sputum eosinophils Mucus
Score Zero (reference) -- -- Low -0.21 (-2.1, 1.7) 0.82 High 4.7
(2.8, 6.6) <0.001 *Linear regression models adjusted for age and
gender. .beta. coefficients indicate the change in dependent
variables (e.g. FEV1 % predicted) for each level of segment score
compared to the zero mucus score. MBRT--maximum bronchodilator
reversibility test SCRT--Systemic corticosteroid responsiveness
test
Identification and Quantification of Mucus Plugging
[0339] MDCT imaging of the lungs was used to explore the role of
airway occlusion with mucus in the pathophysiology of lung
dysfunction in chronic severe asthma. Using a simple and
reproducible visual scoring system, it was found that mucus plugs
frequently occlude subsegmental airways in patients with severe
asthma. The patients with airway mucus occlusion in four or more
bronchopulmonary segments had poor asthma control and much lower
FEV1 and FVC values than patients with no airway mucus occlusion.
Reductions in FEV1 and FVC are known physiologic characteristics of
severe asthma that result from air trapping at all levels of
airflow limitation.sup.10. The mechanisms of air trapping in severe
asthma include airway smooth muscle contraction.sup.11, airway
remodeling.sup.12-15, or loss of lung elastic recoil.sup.16,17 but
the data reveal and highlight the importance of airway occlusion
with mucus. Importantly, it was shown not only that airway mucus
occlusion is strongly associated with reductions in FEV1, but also
that high mucus scores are an independent predictor of residual
reductions in FEV1 after maximal brochodilation with albuterol and
systemic corticosteroids. These data provide a strong rationale to
use mucolytics as a strategy to improve FEV1 abnormalities that are
not fully responsive to current mainstay asthma treatments.
[0340] Asthmatics with high mucus scores were found to have had
marked sputum eosinophilia.sup.14 and abnormal sputum cell gene
expression of type 2 cytokines (IL-4, IL-5, and IL-13) and mucins
(MUC5AC and MUC5B). Thus, mucus occlusion of the airways in severe
asthma occurs in the context of prominent type 2 inflammation. This
is plausible because interleukin 13 is a known regulator of mucin
genes and goblet cells.sup.18 19,20, and type 2 inflammation could
also promote mucus plug formation by reducing mucus clearance,
either through stiffening the mucus gel.sup.21 or by decreasing the
function of cilia on airway epithelial cells.sup.22,23. Notably,
prominent type 2 inflammation was found in asthmatic patients with
mucus plugs, because these patients were being treated with high
doses of inhaled steroids, and corticosteroids usually suppress
airway type 2 inflammation.sup.24. The airway type 2 inflammation
even persisted following protocol-directed treatment with systemic
corticosteroids, and it may be that patients with airway mucus
occlusion require adjunctive treatment with more specific
inhibitors of type 2 inflammation, such as the inhibitors of type 2
cytokines that are currently becoming available.
[0341] The data presented here show that MDCT identifies mucus
plugs in the lungs of a sizeable subgroup of patients with severe
asthma who have poor asthma control and persistent lung dysfunction
despite maximal treatment with bronchodilators and corticosteroids.
MDCT could be used to identify patients with mucus plugging and
that this patient subgroup could be enrolled in clinical trials to
test whether mucolytics and/or specific inhibitors of type 2
inflammation improve lung function and optimize disease
control.
TABLE-US-00009 TABLE 9 Characteristics of Asthma Subjects with
repeat CT scans across SARP studies Time points Characteristics
SARP-1/SARP-2 SARP-3 Mean age (years)* 44.3 .+-. 10.3 49.5 .+-.
11.7 Female sex - no. (%) 13 (52) 13 (52) Spirometry data* FEV1 (%
predicted) 67.7 .+-. 19.5 67.8 .+-. 20.8 FVC (% predicted) 80.4
.+-. 16.1 80.6 .+-. 17.5 FEV1/FVC 0.67 .+-. 0.11 0.82 .+-. 0.12 Max
FEV1 (% predicted) 81.4 .+-. 21.1 78.3 .+-. 20.8 Max FVC (%
predicted) 91.7 .+-. 15.5 88.5 .+-. 15.4 Sputum cell counts (%)
Eosinophils 0.3 (0.001, 3.2) 0.6 (0.2, 2.4) Neutrophils 62 (32.2,
76.3) 68.9 (42.9, 77.8) FeNO (ppm).sup..dagger-dbl. 22 (10.3, 39.6)
22 (14, 46) Blood cell counts (.times.10.sup.6/L).sup..dagger.
Eosinophils 259 .+-. 232 313.5 .+-. 409.6 Neutrophils 4782 .+-.
2819 4599 .+-. 2106 Mucus Score, segments 2 (0, 9) 6 (1, 12) Mucus
Score, categories Zero 10 (40) 5 (20.0) Low 4 (16) 4 (16.0) High 11
(44) 16 (64.0) Data reported as mean and standard deviation unless
otherwise indicated. *Age and spirometry data or SARP1-2 missing in
1 patient .sup..dagger.Spirometry data for SARP1-2 missing in 3
patients .sup..dagger-dbl.FeNO data for SARP1-2 missing in 8
patients .sup..sctn.Sputum cell count data for SARP1-2 missing in
15 patients and for SARP-3 in 5 patents.
TABLE-US-00010 TABLE 10 Mucus score and spirometry adjusted for
covariates Asthma outcome* Unadjusted Model 1 Model 2 Model 3 Model
4 FEV1, % predicted -2.3 (-2.9, -1.6) -2.1 (-2.8, -1.4) -2 (-2.7,
-1.3) -1.6 (-2.3, 0.9) -14 (-23.7, -6.0) R.sup.2 = 0.24, R.sup.2 =
0.28, R.sup.2 = 0.33, R.sup.2 = 0.37, R.sup.2 = 0.41, p < 0.001
p < 0.001 p < 0.001 p < 0.001 p = 0.001 FVC, % predicted
-1.3 (-2 to -0.7) -1.1 (-1.7, -0.5) -1 (-1.6, -0.4) -0.8 (-1.5,
-0.1) -8.6 (-17.1, -0.2) R.sup.2 = 0.11, R.sup.2 = 0.24, R.sup.2 =
0.25, R.sup.2 = 0.27, R.sup.2 = 0.29, p < 0.001 p = 0.001 p =
0.001 p = 0.02 p = 0.045 FEV1/FVC -1.4 (-1.8 -1.0) -1.4 (-1.9,
-1.0) -1.4 (-1.8, -1.0) -1.2 (1.7, -0.8) -7.8 (-12, -2.6) R.sup.2 =
0.26, R.sup.2 = 0.29, R.sup.2 = 0.34, R.sup.2 = 0.38, R.sup.2 =
0.41, p < 0.001 p < 0.001 p < 0.001 p < 0.001 p = 0.004
*Linear Regression model reports .beta. coefficient (95% confidence
interval) for asthma outcome. Model 1 adjusts for the covariate of
age at screening Model 2 adjusts for the covariates of age and
gender Model 3 adjusts for the covariates of age, gender and wall
thickness % Model 4 adjusts for the covariates of age, gender and a
mucus score-wall thickness interaction term
TABLE-US-00011 TABLE 11 Characteristics of Subjects with Asthma
across Mucus Score Categories Mucus Score All Zero Low High
Characteristic (n = 146) (n = 61) (n = 45) (n = 40) Mucus score 0.5
(0-4.5) 0 (0) 1.5 (0.5-2.5) 9.5 (6-12) Spirometry - pre
bronchodilator FEV1(% predicted).sup..dagger..dagger-dbl. 75.4 .+-.
21.7 84.8 .+-. 17.1 77.9 .+-. 21.8 58.5 .+-. 18.0 FVC (%
predicted).sup..dagger..dagger-dbl. 90.1 .+-. 19.0 94.3 .+-. 15.3
93.0 .+-. 20.2 80.4 .+-. 19.5 FEV1/FVC
(predicted)*.sup..dagger..dagger-dbl. 0.83 .+-. 0.13 0.89 .+-. 0.10
0.83 .+-. 0.11 0.72 .+-. 0.11 Spirometry - post bronchodilator FEV1
(% predicted).sup..dagger..dagger-dbl. 86.4 .+-. 22.0 94.9 .+-.
16.9 89.1 .+-. 22.5 70.5 .+-. 20.0 FVC (%
predicted).sup..dagger..dagger-dbl. 97.6 .+-. 19.5 100.2 .+-. 14.9
100.3 .+-. 18.7 90.7 .+-. 19.5 FEV1/FVC
(predicted).sup..dagger..dagger-dbl. 88.2 .+-. 12.1 95.1 .+-. 9.0
88.3 .+-. 10.3 77.9 .+-. 10.9 Sputum cell counts (%).sup.||
Neutrophils 58 (35, 78) 62 (37, 83) 60 (35, 79) 47 (31, 70)
Epithelial cells 4.7 (2, 11.5) 4.3 (2.3, 11.5) 4.3 (2.3, 5.9) 6.9
(1.9, 17) Blood cell counts (.times.10.sup.5/L).sup. Neutrophils
4286 .+-. 2350 4569 .+-. 2951 4030 .+-. 1934 4134 .+-. 1592 Total
white blood cells 7279 .+-. 2548 7534 .+-. 3149 6953 .+-. 2138 7255
.+-. 1827 Total IgE (IU/mL).sup. 150 (52,363) 126 (32,482) 150
(74,335) 181 (79,363) Exacerbations in last 12 months - no. (%) 74
(50.7) 29 (47.5) 23 (51.1) 22 (55.0) Nasal polypectomy - no.
(%).sup..dagger. 21 (14.4) 1 (1.6) 8 (17.8) 12 (30.0) Sinus surgery
- no. (%).sup..dagger. 19 (13.0) 3 (4.9) 8 (17.8) 8 (20.0) ABPA -
no. (%)** 3 (2.1) 0 (0) 2 (1.4) 0 (0) Data reported as mean .+-.
standard deviation or median (interquartile range). Zero represents
the "mucus absent" group (mucus score = 0). Low represents the
group with mucus scores 0.5-3.5 and high represents the group with
mucus scores .gtoreq.4, based on the median score of 3.5 in the
"mucus present" group. *p < 0.05 for comparison of zero and low
scores .sup..dagger.p < 0.05 for comparison of zero and high
scores .sup..dagger-dbl.p < 0.05 for comparison of low and high
scores .sup.||Sputum cell counts were not available in 40 subjects
due to ineligibility for sputum induction or because the induced
sputum not meet quality metrics. .sup. Blood measurements were not
available for 2 subjects. **Diagnosed using elevated total IgE,
specific IgE to Aspergilius fumigatus, systemic eosinophilia, and
radiographic changes consistent with ABPA.
TABLE-US-00012 TABLE 12 Characteristics stratified by chronic mucus
hypersecretion and mucus plugging Chronic mucus hypersecretion*
Mucus plugging Absent Present Zero High Characteristic (n = 80) (n
= 41) (n = 61) (n = 40) Anthropometrics Mean age (years) 44.3 .+-.
16.5 .sup. 52.4 .+-. 15.3.sup..dagger. 43.3 .+-. 15.4 .sup. 52.2
.+-. 16.5.sup..dagger. Female sex - no. (%) 53 (66.3) 27 (65.9) 43
(70.5) 22 (55.0) Body mass index (kg/m.sup.2) 31.2 .+-. 8.7 34.5
.+-. 9.4 34.3 .+-. 9.9 30.7 .+-. 6.3 Asthma control and
Exacerbations Asthma Control Test score 20 (16, 21) 15 (10,
19).sup..dagger-dbl. 19 (15, 21) 16.5 (13, 19).sup..dagger-dbl.
High dose inhaled steroids use - no. (%) 53 (66.3) 31 (75.6) 36
(59.0) 36 (90.0).sup..dagger-dbl. Chronic systemic steroids use -
no. (%) 6 (7.5) 5 (12.2) 3 (4.9) 8 (20.0).sup..dagger.
Exacerbations in last 12 months - no. (%).sup. 28 (35.0) 29
(70.7).sup..sctn. 28 (45.9) 40 (47.1) Spirometry.sup.|| FEV1 (%
predicted) 81.3 .+-. 19.8 .sup. 70.3 .+-. 22.7.sup..dagger-dbl.
.sup. 84.8 .+-. 17.1 .sup. 58.5 .+-. 18.0.sup..sctn. FVC (%
predicted) 95.1 .+-. 17.1 .sup. 86.0 .+-. 19.2.sup..dagger-dbl.
94.3 .+-. 15.3 .sup. 80.4 .+-. 19.5.sup..dagger-dbl. FEV1/FVC
(predicted) 0.84 .+-. 0.12 0.80 .+-. 0.14 0.89 .+-. 0.10 .sup. 0.72
.+-. 0.11.sup..sctn. Inflammation Airway measures FeNO (ppm)** 20
(12, 35) 20 (11, 29) 18 (10, 27) 28 (19, 40).sup..dagger-dbl.
Sputum eosinophil count (%).sup..dagger..dagger. 0.7 (0.2, 3.5) 0.6
(0, 4.5) 0.2 (0, 0.9) 7.3 (1.5, 21.4).sup..sctn. Sputum neutrophil
count (%).sup..dagger..dagger. 59 (33.77) 66 (42, 83) 62 (37, 83)
47 (31, 70) Blood measures.sup..dagger-dbl..dagger-dbl. Blood
eosinophil count (.times.10.sup.5/L) 284 .+-. 202 338 .+-. 347 209
.+-. 153 .sup. 459 .+-. 349.sup..sctn. Blood neutrophil count
(.times.10.sup.6/L) 4278 .+-. 2541 4450 .+-. 2258 4569 .+-. 2951
4134 .+-. 1592 Total IgE (IU/mL) 138 (46,306) 129 (35,406) 125
(32,482) 181 (79,363) Sputum cell gene expression IL-4 15 (13, 17)
15 (12, 17) 15 (14, 17) 17 (15, 18) IL-5 18 (16, 21) 18 (17, 20) 17
(15, 19) 20 (18, 22).sup..dagger-dbl. IL-13 20 (17, 21) 20 (18, 21)
19 (17, 21) 22 (20, 22).sup..dagger. IL-17 18 (18, 20) 19 (17, 20)
18 (17, 20) 18 (17, 19) MUC5AC/MUC58 0.99 (0.9, 1.1) 0.99 (0.9,
1.1) 0.95 (0.86, 1) 1.1 (1.0, 1.2).sup..dagger-dbl. CT Findings
Bronchiectasis on CT - no. (%) 15 (18.8) 9 (22.0) 7 (11.5) 11
(27.5) Data reported as mean .+-. standard deviation or median
(interquartile range). *Questionnaire date for chronic bronchitis
are available for 121 patients (see supplementary appendix)
.sup..dagger.p < 0.05 for comparison between absent and present
or zero and high groups .sup..dagger-dbl.p < 0.01 for comparison
between absent and present or zero and high groups .sup..sctn.p
< 0.001 for comparison between absent and present or zero and
high groups .sup.||Pre bronchodilator .sup. Exacerbations defined
as taking a short course of corticosteroids for asthma (min. 3
days) in the last year **Fraction of nitric oxide in exhaled breath
(FeNO) was not measured in 4 subjects. .sup..dagger..dagger.Sputum
cell counts were not available in 26 subjects due to ineligibility
for sputum induction or because the induced sputum not meet quality
metrics. .sup..dagger-dbl..dagger-dbl.Blood measurements were not
available for 1 subject
TABLE-US-00013 TABLE 13 Mucus score and eosinophilia adjusted for
covariates Asthma outcome* Unadjusted Model 1 Model 2 Model 3
Sputum Eosinophils %.sup..dagger-dbl. 0.96 (0.66, 1.3) 0.93 (0.61,
1.3) 0.94 (0.62, 1.3) 0.80 (0.45, 1.2) R.sup.2 = 0.28, R.sup.2 =
0.29, R.sup.2 = 0.30, R.sup.2 = 0.32, p < 0.001 p < 0.001 p
< 0.001 p < 0.001 Blood Eosinophils count 24.5 (15.5, 33.4)
24.8, (15.2 34.4) 24.6, (15.0, 34.2) 17.6 (7.3, 27.7) R.sup.2 =
0.17, R.sup.2 = 0.17, R.sup.2 = 0.18, R.sup.2 = 0.25, p < 0.001
p < 0.001 p < 0.001 p = 0.001 *Linear Regression model
reports .beta. coefficient (95% confidence interval) for asthma
outcome. .sup..dagger-dbl.Sputum cell counts were not measured in
40 subjects. Model one adjusts for the covariate of age at
screening Model two adjusts for the covariates of age and gender
Model three adjusts for the covariates age, gender and wall
thickness (%)
TABLE-US-00014 TABLE 14 Characteristics of Subjects with Asthma
across Mucus Score Categories Mucus Score All Zero Low High
Characteristic (n = 146) (n = 61) (n = 45) (n = 40) Mucus score 0.5
(0-4.5) 0 (0) 1.5 (0.5-2.5) 9.5 (6-12) Mean age
(years).sup..dagger. 46.8 .+-. 16.0 43.2 .+-. 15.4 46.7 .+-. 15.6
52.3 .+-. 16.3 Female sex - no. (%) 91 (62.3) 43 (70.5) 26 (57.8)
22 (55.0) Body Mass Index (kg/m.sup.2) 32.7 .+-. 9.3 34.3 .+-. 9.9
32.5 .+-. 10.5 30.7 .+-. 6.3 Maintenance corticosteroid use - no.
(%) Inhaled - any dose 142 (97.3) 57 (93.4) 45 (100.0) 40 (100.0)
Inhaled - high dose.sup..dagger. 103 (70.6) 36 (59.0) 31 (68.9) 36
(90.0) Systemic.sup..dagger. 15 (10.3) 3 (4.9) 3 (6.7) 9 (22.5)
Asthma Control Test.sup..dagger. 18 (14-21) 19 (15-21) 18 (14-22)
16.5 (13-19) Severe Asthma - no. (%).sup..sctn..dagger. 100 (68.5)
33 (54.1) 31 (68.9) 36 (90.0) Spirometry FEV1 - (%
predicted).sup..dagger..dagger-dbl. 75.4 .+-. 21.7 84.8 .+-. 17.1
77.9 .+-. 21.8 58.5 .+-. 18.0 Sputum eosinophil count (%).sup.
.dagger..dagger-dbl. 0.7 (0, 4.4) 0.2 (0, 0.9) 0.5 (0.2, 1.6) 7.3
(1.5, 21.4) Blood eosinophil count
(.times.10.sup.6/L).sup.||.dagger..dagger-dbl. 306 .+-. 276 209
.+-. 153 309 .+-. 282 459 .+-. 349 FeNO (ppm)**.sup..dagger. 22
(12, 33) 18 (10, 27) 24 (13, 38) 28 (19, 40) Chronic mucus
hypersecretion - no. (%).sup..dagger..dagger. 41 (34.0) 18 (29.5)
10 (22.2) 13 (32.5) Bronchiectasis on CT - no. (%) 29 (19.9) 7
(11.5) 11 (24.4) 11 (27.5) Data reported as mean .+-. standard
deviation or median (interquartile range). Zero represents the
"mucus absent" group (mucus score = 0). Low represents the group
with mucus scores 0.5-3.5 and high represents the group with mucus
scores .gtoreq.4, based on the median score of 3.5 in the "mucus
present" group. *p < 0.05 for comparison of zero and low scores
.sup..dagger.p < 0.05 for comparison of zero and high scores
.sup..dagger-dbl.p < 0.05 for comparison of low and high scores
.sup..sctn.The classification of asthma severity was determined
using ATS/ERS criteria .sup. Sputum cell counts were not available
in 40 subjects due to ineligibility for sputum induction or because
the induced sputum not meet quality metrics. .sup.||Blood
measurements were not available for 2 subjects. **Fraction of
nitric oxide in exhaled breath (FeNO) was not measured in 4
subjects. .sup..dagger..dagger.Defined by WHO. Questionnaire data
is missing in 25 patients (see supplementary appendix)
Example 11: App for Utilizing Scoring Method
[0342] An novel application (app) was designed to facilitate the
scoring method described herein. The app has a variety of utilities
including: [0343] (i) Use in clinical setting to stratify patients
as those who have or do not have mucus impaction of their airways
[0344] (ii) The score could be used to identify patient who would
benefit from specific treatments e.g. mucolytics or protein
therapeutics. [0345] (iii) The score could be used as a companion
diagnostic for use with muco-active drugs (e.g. mucolytics) or
anti-inflammatory drugs.
[0346] The (app) was designed to perform four coordinated functions
to allow a user to generate a mucus from images captured in a
multidetector computed tomography (MDCT) scan of the lungs: [0347]
(i) Provides the user with Mucus Score criteria. ("Criteria tab").
[0348] (ii). Provides the user with examples of mucus plugs in a
range of different MDCT images of the lungs. ("Examples tab").
[0349] (iii) Provides the user with a training set of MDCT images,
which the user scores to obtain certification in proper and
accurate Dunican mucus scoring. The app provides feedback on
incorrect scores to aid in education and training for correct mucus
plug identification and scoring. ("Training and Certification
tab"). [0350] (iv) Provides the user with a scoring tool to
generate a Dunican Mucus core for an individual patient's MDCT lung
scan. (Scoring Tool Tab").
REFERENCES
[0350] [0351] 1. Huber H C, Koessler K K. The pathology of
bronchial asthma. 1922; 30:689-760. [0352] 2. Cardell, B. S., Bruce
Pearson, R. S. Death in Asthmatics. Thorax 1959; 14:341-52. [0353]
3. Dunnill M S. The pathology of asthma, with special reference to
changes in the bronchial mucosa. 1960; 13:27-33. [0354] 4. Chung K
F, Wenzel S E, Brozek J L, et al. International ERS/ATS guidelines
on definition, evaluation and treatment of severe asthma. Eur
Respir J 2014; 43:343-73. [0355] 5. Gershman N H, Wong H H, Liu J
T, Mahlmeister M J, Fahy J V. Comparison of two methods of
collecting induced sputum in asthmatic subjects. Eur Respir J 1996;
9:2448-53. [0356] 6. Hastie A T, Moore W C, Li H, et al. Biomarker
surrogates do not accurately predict sputum eosinophil and
neutrophil percentages in asthmatic subjects. J Allergy Clin
Immunol 2013; 132:72-80. [0357] 7. Peters M C, Mekonnen Z K, Yuan
S, Bhakta N R, Woodruff P G, Fahy J V. Measures of gene expression
in sputum cells can identify TH2-high and TH2-low subtypes of
asthma. J Allergy Clin Immunol 2014; 133:388-94. [0358] 8. American
Thoracic Society (1962): Definitions and classification of chronic
bronchitis, asthma and pulmonary emphysema. Am Rev Respir Dis 1962;
85:762-8. [0359] 9. Agarwal R, Chakrabarti A, Shah A, et al.
Allergic bronchopulmonary aspergillosis: review of literature and
proposal of new diagnostic and classification criteria. Clin Exp
Allergy 2013; 43:850-73. [0360] 10. Sorkness R L, Bleecker E R,
Busse W W, et al. Lung function in adults with stable but severe
asthma: air trapping and incomplete reversal of obstruction with
bronchodilation. J Appl Physiol (1985) 2008; 104:394-403. [0361]
11. Fredberg J J, Inouye D, Miller B, et al. Airway smooth muscle,
tidal stretches, and dynamically determined contractile states. Am
J Respir Crit Care Med 1997; 156:1752-9. [0362] 12. Aysola R, de
Lange E E, Castro M, Altes T A. Demonstration of the heterogeneous
distribution of asthma in the lungs using C T and hyperpolarized
helium-3 MRI. J Magn Reson Imaging 2010; 32:1379-87. [0363] 13.
Cohen L, E X, Tarsi J, et al. Epithelial cell proliferation
contributes to airway remodeling in severe asthma. Am J Respir Crit
Care Med 2007; 176:138-45. [0364] 14. Roche W R, Beasley R,
Williams J H, Holgate S T. Subepithelial fibrosis in the bronchi of
asthmatics. Lancet 1989; 1:520-4. [0365] 15. Heard B E H S.
Hyperplasia of bronchial muscle in asthma. J Pathol 1973;
110:319-31. [0366] 16. Gold W M, Kaufman H S, Nadel J A. Elastic
recoil of the lungs in chronic asthmatic patients before and after
therapy. J Appl Physiol 1967; 23:433-8. [0367] 17. Gelb A F,
Licuanan J, Shinar C M, Zamel N. Unsuspected loss of lung elastic
recoil in chronic persistent asthma. Chest 2002; 121:715-21. [0368]
18. Fahy J V, Dickey B F. Airway mucus function and dysfunction. N
Engl J Med 2010; 363:2233-47. [0369] 19. Roy M G, Livraghi-Butrico
A, Fletcher A A, et al. Muc5b is required for airway defence.
Nature 2014; 505:412-6. [0370] 20. Evans C M, Raclawska D S,
Ttofali F, et al. The polymeric mucin Muc5ac is required for
allergic airway hyperreactivity. Nat Commun 2015; 6:6281. [0371]
21. Yuan S, Hollinger M, Lachowicz-Scroggins M E, et al. Oxidation
increases mucin polymer cross-links to stiffen airway mucus gels.
2015; 7:276ra27. [0372] 22. Erle D J, Sheppard D. The cell biology
of asthma. J Cell Biol 2014; 205:621-31. [0373] 23. Laoukili J,
Perret E, Willems T, et al. IL-13 alters mucociliary
differentiation and ciliary beating of human respiratory epithelial
cells. J Clin Invest 2001; 108:1817-24. [0374] 24. Fahy J V. Type 2
inflammation in asthma--present in most, absent in many. Nat Rev
Immunol 2015; 15:57-65. [0375] 25. Fleige S, Walf V, Huch S,
Prgomet C, Sehm J, Pfaffl M W. Comparison of relative mRNA
quantification models and the impact of RNA integrity in
quantitative real-time R T-PCR. Biotechnol Lett 2006; 28:1601-13.
[0376] 26. Fleige S, Pfaffl M W. RNA integrity and the effect on
the real-time qRT-PCR performance. Mol Aspects Med 2006; 27:126-39.
[0377] 27. Chung K F, Wenzel S E, Brozek J L, et al. International
ERS/ATS guidelines on definition, evaluation and treatment of
severe asthma. Eur Respir J 2014; 43:343-73. [0378] 28. Gershman N
H, Wong H H, Liu J T, Mahlmeister M J, Fahy J V. Comparison of two
methods of collecting induced sputum in asthmatic subjects. Eur
Respir J 1996; 9:2448-53. [0379] 29. Hastie A T, Moore W C, Li H,
et al. Biomarker surrogates do not accurately predict sputum
eosinophil and neutrophil percentages in asthmatic subjects. J
Allergy Clin Immunol 2013; 132:72-80. [0380] 30. Peters M C,
Mekonnen Z K, Yuan S, Bhakta N R, Woodruff P G, Fahy J V. Measures
of gene expression in sputum cells can identify TH2-high and
TH2-low subtypes of asthma. J Allergy Clin Immunol 2014;
133:388-94. [0381] 31. Fleige S, Walf V, Huch S, Prgomet C, Sehm J,
Pfaffl M W. Comparison of relative mRNA quantification models and
the impact of RNA integrity in quantitative real-time R T-PCR.
Biotechnol Lett 2006; 28:1601-13. [0382] 31. Fleige S, Pfaffl M W.
RNA integrity and the effect on the real-time qRT-PCR performance.
Mol Aspects Med 2006; 27:126-39. [0383] 32. American Thoracic
Society (1962): Definitions and classification of chronic
bronchitis, asthma and pulmonary emphysema. Am Rev Respir Dis 1962;
85:762-8. [0384] 33. Nathan R A, Sorkness C A, Kosinski M, et al.
Development of the asthma control test: a survey for assessing
asthma control. J Allergy Clin Immunol 2004; 113:59-65. [0385] 34.
Schatz M, Sorkness C A, Li J T, et al. Asthma Control Test:
reliability, validity, and responsiveness in patients not
previously followed by asthma specialists. J Allergy Clin Immunol
2006; 117:549-56.
Sequence CWU 1
1
50126DNAArtificial SequencePPIA-outer forward 1atgagaactt
catcctaaag catacg 26222DNAArtificial SequencePPIA-outer reverse
2ttggcagtgc agatgaaaaa ct 22319DNAArtificial SequencePPIA-inner
forward 3acgggtcctg gcatcttgt 19424DNAArtificial SequencePPIA-probe
4atggcaaatg ctggacccaa caca 24522DNAArtificial SequencePPIA-inner
reverse 5gcagatgaaa aactgggaac ca 22622DNAArtificial
SequenceGAPDH-outer forward 6caatgacccc ttcattgacc tc
22722DNAArtificial SequenceGAPDH-outer reverse 7ctcgctcctg
gaagatggtg at 22821DNAArtificial SequenceGAPDH-inner forward
8gattccaccc atggcaaatt c 21923DNAArtificial SequenceGAPDH-probe
9cgttctcagc cttgacggtg cca 231022DNAArtificial SequenceGAPDH-inner
reverse 10gggatttcca ttgatgacaa gc 221124DNAArtificial
SequenceYWHAZ-outer forward 11cttctgtctt gtcaccaacc attc
241224DNAArtificial SequenceYWHAZ-outer reverse 12caactaagga
gagatttgct gcag 241319DNAArtificial SequenceYWHAZ-inner forward
13tggaaaaagg ccgcatgat 191428DNAArtificial SequenceYWHAZ-probe
14tggctccact cagtgtctaa ggcaccct 281520DNAArtificial
SequenceYWHAZ-inner reverse 15tctgtgggat gcaagcaaag
201623DNAArtificial SequencePSMB2-outer forward 16ccatatcatg
tgaacctcct cct 231724DNAArtificial SequencePSMB2-outer reverse
17gtcgaggata ctgagagtca ggaa 241820DNAArtificial
SequencePSMB2-inner forward 18tcctcctggc tggctatgat
201922DNAArtificial SequencePSMB2-probe 19acagcgctgg cccttcatgc tc
222020DNAArtificial SequencePSMB2-inner reverse 20ggctgccagg
tagtccatgt 202120DNAArtificial SequenceIL4-outer forward
21gggtctcacc tcccaactgc 202222DNAArtificial SequenceIL4-outer
reverse 22tgtctgttac ggtcaactcg gt 222321DNAArtificial
SequenceIL4-inner forward 23gcttccccct ctgttcttcc t
212426DNAArtificial SequenceIL4-probe 24tccacggaca caagtgcgat
atcacc 262523DNAArtificial SequenceIL4-inner reverse 25gctctgtgag
gctgttcaaa gtt 232620DNAArtificial SequenceIL5-outer forward
26gccatgagga tgcttctgca 202726DNAArtificial SequenceIL5-outer
reverse 27gaatcctcag agtctcattg gctatc 262820DNAArtificial
SequenceIL5-inner forward 28agctgcctac gtgtatgcca
202925DNAArtificial SequenceIL5-probe 29ccccacagaa attcccacaa gtgca
253021DNAArtificial SequenceIL5-inner reverse 30gtgccaaggt
ctctttcacc a 213120DNAArtificial SequenceIL13-outer forward
31caacctgaca gctggcatgt 203218DNAArtificial SequenceIL13-outer
reverse 32ccttgtgcgg gcagaatc 183319DNAArtificial
SequenceIL13-inner forward 33gccctggaat ccctgatca
193422DNAArtificial SequenceIL13-probe 34tcgatggcac tgcagcctga ca
223521DNAArtificial SequenceIL13-inner reverse 35gctcagcatc
ctctgggtct t 213621DNAArtificial SequenceIL17-outer forward
36actgctactg ctgctgagcc t 213722DNAArtificial SequenceIL17-outer
reverse 37ggtgaggtgg atcggttgta gt 223820DNAArtificial
SequenceIL17-inner forward 38caatcccacg aaatccagga
203928DNAArtificial SequenceIL17-probe 39cccaaattct gaggacaaga
acttcccc 284022DNAArtificial SequenceIL17-inner reverse
40ttcaggttga ccatcacagt cc 224124DNAArtificial SequenceMUC5B-outer
forward 41tacatcttgg cccaggacta ctgt 244223DNAArtificial
SequenceMUC5B-outer reverse 42aggatcagct cgtagctctc cac
234320DNAArtificial SequenceMUC5B-inner forward 43catcgtcacc
gagaacatcc 204421DNAArtificial SequenceMUC5B-probe 44ctgtgggacc
accggcacca c 214520DNAArtificial SequenceMUC5B- inner reverse
45aagagcttga tggccttgga 204618DNAArtificial SequenceMUC5AC-outer
forward 46tgtggcggga aagacagc 184723DNAArtificial
SequenceMUC5AC-outer reverse 47ccttcccatg gcttagcttc agc
234820DNAArtificial SequenceMUC5AC-inner forward 48cgtgttgtca
ccgagaacgt 204920DNAArtificial SequenceMUC5AC-probe 49ctgcggcacc
acagggacca 205020DNAArtificial SequenceMUC5AC- inner reverse
50atcttgatgg ccttggagca 20
* * * * *