U.S. patent application number 16/197164 was filed with the patent office on 2019-09-12 for optimization of determinants for successful genetic correction of diseases, mediated by hematopoietic stem cells.
This patent application is currently assigned to Children's Hospital Medical Center. The applicant listed for this patent is Children's Hospital Medical Center. Invention is credited to Punam Malik.
Application Number | 20190276844 16/197164 |
Document ID | / |
Family ID | 45022439 |
Filed Date | 2019-09-12 |
![](/patent/app/20190276844/US20190276844A1-20190912-D00001.png)
![](/patent/app/20190276844/US20190276844A1-20190912-D00002.png)
![](/patent/app/20190276844/US20190276844A1-20190912-D00003.png)
![](/patent/app/20190276844/US20190276844A1-20190912-D00004.png)
![](/patent/app/20190276844/US20190276844A1-20190912-D00005.png)
![](/patent/app/20190276844/US20190276844A1-20190912-D00006.png)
![](/patent/app/20190276844/US20190276844A1-20190912-D00007.png)
![](/patent/app/20190276844/US20190276844A1-20190912-D00008.png)
![](/patent/app/20190276844/US20190276844A1-20190912-D00009.png)
![](/patent/app/20190276844/US20190276844A1-20190912-D00010.png)
![](/patent/app/20190276844/US20190276844A1-20190912-D00011.png)
View All Diagrams
United States Patent
Application |
20190276844 |
Kind Code |
A1 |
Malik; Punam |
September 12, 2019 |
OPTIMIZATION OF DETERMINANTS FOR SUCCESSFUL GENETIC CORRECTION OF
DISEASES, MEDIATED BY HEMATOPOIETIC STEM CELLS
Abstract
Methods and compositions disclosed herein generally relates to
methods of determining minimum hematopoietic stem cell (HSC)
chimerism and gene dosage for correction of a hematopoietic
disease; in particular, in in vivo models. The invention also
relates to modified lentiviral expression vectors for increase a
viral titer and various methods for increasing such titers as well
as expression vectors capable of enhancing such titers. The
invention also relates to CHS4 chromatin insulator-derived
functional insulator sequences. The invention further relates to
methods for genetic correction of diseases or reducing symptoms
thereof, such as sickle cell anemia, a lysosomal storage disease.
The invention futher relates to a method of improving and/or
correcting one or more central nervous system (CNS) abnormalities
caused by one or more lysosomal storage disease. The invention
futher relates to methods of improving titer in transfection-based
bioreactor culture production or transfection-based production
systems using eukaryotic cells.
Inventors: |
Malik; Punam; (Cincinnati,
OH) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Children's Hospital Medical Center |
Cincinnati |
OH |
US |
|
|
Assignee: |
Children's Hospital Medical
Center
Cincinnati
OH
|
Family ID: |
45022439 |
Appl. No.: |
16/197164 |
Filed: |
November 20, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14707557 |
May 8, 2015 |
|
|
|
16197164 |
|
|
|
|
12928302 |
Dec 6, 2010 |
|
|
|
14707557 |
|
|
|
|
61267008 |
Dec 4, 2009 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/63 20130101;
C12N 2830/48 20130101; C12N 15/86 20130101; C12N 15/85 20130101;
C12N 2740/15043 20130101 |
International
Class: |
C12N 15/86 20060101
C12N015/86; C12N 15/85 20060101 C12N015/85; C12N 15/63 20060101
C12N015/63 |
Goverment Interests
GOVERNMENT RIGHTS
[0002] This invention was made with government support under
HL073104, HL70135, HL070595, HL060008, HL079574, AI061703, and
NS064330 awarded by the National Institutes of Health. The
government has certain rights in the invention.
Claims
1-26. (canceled)
27. A modified self-inactivating (SIN) lentiviral vector,
comprising: (a) a lentiviral vector backbone comprising: (1)
lentiviral cis elements, which consist essentially of (i) a
packaging signal (.psi.), (ii) a gag fragment, (iii) an env
fragment containing a rev response element (RRE) and a splice
acceptor sequence (SA), and (iv) a central polypurine tract (cPPT),
wherein the gag fragment comprises a 5' fragment of gag that is
about 300 bp; and (b) a transgene of interest.
28. The modified SIN lentiviral vector of claim 1, wherein the gag
fragment consists of the 5' fragment of gag that is about 630 bp in
length.
29. The modified SIN lentiviral vector of claim 1, wherein the gag
fragment consists of the 5' fragment of gag that is about 360 bp in
length.
30. The modified SIN lentiviral vector of claim 1, wherein the
lentiviral vector backbone of (a) further comprises: (2) a 3'-long
terminal repeat (LTR), which comprises an upstream polyadenylation
(polyA) enhancer signal sequence; and (3) one or more copies of a
heterologous polyA signal sequence downstream from the 3'-LTR;
31. The modified SIN lentiviral vector of claim 30, wherein the
heterologous polyA signal sequence is a13-growth hormone polyA
signal sequence.
32. The modified SIN lentiviral vector of claim 30, wherein the U3
region of the 3'-LTR is deleted.
33. The modified SIN lentiviral vector of claim 32, wherein the U3
region is replaced with the upstream polyadenylation (polyA)
enhancer signal sequence, which is an upstream sequence element
(USE) derived from an SV40 late polyA signal sequence.
34. The modified SIN lentiviral vector of claim 27, wherein the
lentiviral vector backbone further comprises one or more chromatin
insulator elements.
35. The modified SIN lentiviral vector of claim 34, wherein the
chromatin insulator elements include a chicken hypersensitive
site-4 element (cHS4).
36. The modified SIN lentiviral vector of claim 35, wherein the
cHS4 element contains an about 250-base pair core sequence of a
cHS4 insulator linked to a distal element of the cHS4, which is
about 400 base pair or less.
37. The modified SIN lentiviral vector of claim 36, wherein the
cHS4 element is inside the 3'-LTR.
38. The modified SIN lentiviral vector of claim 27, wherein the
lentiviral cis elements consists essentially of the packaging
signal (.psi.), the env fragment, and the gag fragment, which
consists of the 5' fragment of gag that is about 360 bp, and
wherein the lentiviral vector backbone further comprises an
upstream sequence element (USE) derived from an SV40 late polyA
signal sequence, a .beta.-growth hormone polyA signal sequence, and
one or more chicken hypersensitive site-4 elements (cHS4s).
39. The modified SIN lentiviral vector of claim 27, wherein the
transgene of interest is a gamma-globin gene.
40. The modified SIN lentiviral vector of claim 39, wherein the
gamma-globin gene is a human gamma-globin gene.
41. The modified SIN lentiviral vector of claim 39, wherein the
gamma-globin gene is in a reverse orientation to a viral
transcription unit in the lentiviral vector backbone.
42. The modified SIN lentiviral vector of claim 1, wherein the
transgene of interest is in operable linkage to a lineage-specific
promoter.
43. The modified SIN lentiviral vector of claim 42, wherein the
transgene of interest is in further operable linkage to a
lineage-specific enhancer.
44. The modified SIN lentiviral vector of claim 43, wherein the
enhancer is an erythroid lineage specific enhancer element and the
transgene of interest is a gamma-globin gene.
45. The modified SIN lentiviral vector of claim 39, wherein the
gamma-globin gene is a hybrid gene comprising gamma-globin coding
sequences and beta-globin non-coding and regulatory sequences.
46. The modified SIN lentiviral vector of claim 45, wherein the
beta-globin non-coding and regulatory sequences comprises one or
more of HS2, HS3, and HS4 of the locus control region of
beta-globin gene.
47. The modified SIN lentiviral vector of claim 46, wherein the
gamma-globin gene is under the control of the beta-globin
regulatory sequences.
48. A host cell comprising the modified SIN lentiviral vector of
claim 1.
49. The host cell of claim 48, wherein the host cell is a
hematopoietic stem cell.
50. A method for preparing a transgenic host cell, comprising
transfecting the modified SIN lentiviral vector of claim 1 into a
host cell.
51. A method for genetically correct sickle cell anemia or
.beta.-thalassemia or reduce symptoms thereof, the method
comprising: providing the host cell of claim 50, wherein the host
cell is a hematopoietic stem cell and wherein the transgene gene of
interest in the modified SIN lentiviral vector is a gamma-globin
gene, and transplanting the host cell into a subject in need
thereof.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 12/928,302, filed on Dec. 6, 2010, and is also a continuation
of U.S. application Ser. No. 13/946,746, filed on Jul. 19, 2013,
which is a continuation of U.S. application Ser. No. 12/928302,
filed on Dec. 6, 2010, which claims priority from U.S. Provisional
Application No. 61/267,008, filed on Dec. 4, 2009, the contents of
each of which are herein incorporated by reference in their
entirety.
FIELD OF THE INVENTION
[0003] The invention disclosed herein generally relates to methods
of determining minimum hematopoietic stem cell (HSC) chimerism and
gene dosage for correction of a hematopoietic disease; in
particular, in an in vivo model. The invention also relates to the
use of modified SIN lentiviral expression vectors to increase a
viral titer and various methods for increasing such titers as well
as expression vectors capable of enhancing such titers. The
invention also relates to CHS4 chromatin insulator-derived
functional insulator sequences. The invention further relates to
methods for genetic correction of diseases or reducing symptoms
thereof, such as sickle cell anemia, a lysosomal storage disease.
The invention further relates to various expression vectors capable
of genetically correcting sickle cell anemia or reducing symptoms
thereof. The invention further relates to a method of improving
and/or correcting one or more central nervous system (CNS)
abnormalities caused by one or more lysosomal storage disease. The
invention further relates to methods of improving titer in
transfection-based bioreactor culture production or
transfection-based production systems using a eukaryotic cell.
BACKGROUND
[0004] All publications herein are incorporated by reference to the
same extent as if each individual publication or patent application
was specifically and individually indicated to be incorporated by
reference. The following description includes information that may
be useful in understanding the present invention. It is not an
admission that any of the information provided herein is prior art
or relevant to the presently claimed invention, or that any
publication specifically or implicitly referenced is prior art.
[0005] Genetic Correction and Vector Design
[0006] Successful genetic correction of diseases, mediated by
hematopoietic stem cells (HSCs), depends upon stable, safe,
targeted gene expression of therapeutic quantities. Expression
vectors are central to the process of genetic correction and
consequently the subject of considerable research. Although
significant advances in vector design have improved the efficacy of
gene therapy, certain key obstacles have emerged as barriers to
successful clinical application. Among those obstacles, vector
genotoxicity is among the most formidable, as evidenced by the
occurrence of gene therapy related leukemia in patients in X-SCID
trials, as disclosed herein. As a result, gamma-retroviral vectors
and lentiviral vectors have been modified to a self-inactivating
(SIN) design to delete ubiquitously active enhancers in the U3
region of the long terminal repeats (LTR) (as disclosed herein).
Several methods of improving transgene expression have been
subsequently employed.
[0007] As an added measure of stabilizing expression, many vectors
are now designed with chromatin insulating elements that reduce
chromatin position effects. While these insulators can improve the
safety and expression profiles of certain vectors, in some cases an
undesirable side effect is decreased titers compared to
non-inactivated versions.
[0008] Thus, there is a need in the art for improved expression
vector design, aimed at safely stabilizing the expression of
transgenes, while maintaining clinically relevant viral titers.
[0009] Reprogramming Erythroid Cells
[0010] Healthy individuals can produce 2.4.times.10.sup.11 RBC per
day with a daily output of 7.2 g of hemoglobin. Redirecting a
portion of the formidable protein synthesis machinery in maturing
erythroid cells toward the expression of a transgene can provide an
efficient approach for long-term protein delivery into circulation.
Moreover, the high efficiency of protein synthesis can compensate
for the generally low hematopoietic (HSC) gene transfer frequency.
Finally, expulsion of the nucleus by erythroid cells upon
maturation to reticulocytes is arguably one of the most radical and
effective safety measures imaginable. Thus, there is a need in the
art to determine methods of using erythroid cells as a depot to
deliver corrective proteins.
[0011] Treatment of Lysosomal Storage Diseases
[0012] Lysosomal storage disorders (LSD) include about 50 metabolic
diseases that collectively affect approximately 1 in 5000 live
births with .about.65% affecting the CNS. Treatment modalities for
LSDs are currently limited to bone marrow transplantation (BMT) and
enzyme replacement therapy (ERT). These approaches while providing
significant promise for treatment of the visceral manifestations of
LSDs, do little to address CNS pathologies for this group of
disorders. Moreover, BMT is limited by procedure-related mortality
between 20 and 30%, late complications such as graft versus host
disease, and by the need to find an HLA-matched donor.
Pharmaceutical lysosomal enzyme products are available for several
LSDs and are being used to ameliorate visceral manifestations in
some LSD patients. However, it is limited by poor penetration of
the CNS, the need for frequent intravenous infusion for a lifetime
and by tremendous costs. Thus, there is a need in the art to
develop a novel therapeutic approach for treatment of LSDs with
lower mortality and morbidity, and with the capacity to correct CNS
deterioration.
[0013] Determining Critical Parameters of Correction in Sickle Cell
Anemia
[0014] Expressing a tremendous amount of fetal/antisickling
hemoglobin will undoubtedly correct disease, as has been
demonstrated, but is not practically possible in a clinical
setting. As an example, an initial gene therapy for adenosine
deaminase (ADA) deficiency was performed using no conditioning, and
was not therapeutic, even though few gene-marked stem cells
engrafted, and a selective advantage to gene-corrected lymphocytes
was evident upon withdrawal of ADA (as disclosed herein). In a
subsequent trial, 4 mg/kg busulfan was used before transplantation,
as conditioning, resulting in adequate gene-corrected stem cell
dose and gene-modified T cells (as disclosed herein). Thus, there
is a need in the art to establish methods of determining thresholds
for genetic correction before embarking on clinical studies.
[0015] Improvement of Viral Titer
[0016] Significant research has been devoted to improving viral
titer by manipulating the parameters of production in closed system
bioreactors. Increases in titer translate into practical benefits,
including decreased costs and the related potential for expanding
the patient base for clinical trials. Thus, there is a continued
need in the art for improving titer by optimizing the parameters of
bioreactor vector production.
SUMMARY OF THE INVENTION
[0017] Methods and composistion described herein are provided by
way of example and should not in any way limit the scope of the
invention.
[0018] In one aspect, a method of determining minimum hematopoietic
stem cell (HSC) chimerism and gene dosage for correction of a
hematopoietic disease in an in vivo model is provided. The method
comprises: inducing various levels of chimerism and gene dosage
post-transplantation, wherein various levels of chimerism and gene
dosage are induced by applying reduced intensity conditioning prior
to transplantation; transducing cells at a range of multiplicity of
infection (MOI), where MOI is 30-100; and inducing varying levels
of chimerism and gene dosage results in determining minimum HSC
chimerism and gene dosage for correction of a hematopoietic disease
in an in vivo model.
[0019] In another aspect, a modified SIN lentiviral expression
vector is provided, which is capable of enhanced viral titer in
comparison with a standard SIN lentiviral expression vector. More
specifically, the vector comprises: a gutted/minimal Cis lentiviral
vector backbone devoid of Cis elements, except the packaging signal
(.psi.); and a small therapeutic transgene of interest (GOI), where
the modified SIN lentiviral expression vector containing devoid of
Cis elements, except a .psi. Cis element, enhances viral titer in
comparison with a standard SIN lentiviral expression vector.
[0020] In another aspect, a cHS4 chromatin insulator-derived
functional insulator sequence is provided. The functional insulator
sequence comprises: a proximal core region of the cHS4 insulator
sequence comprising 250 base pairs (bp) or less; and a distal
element of the cHS4 insulator sequence, comprising 400 bp or less,
where the functional insulator sequence is at least 80% as
effective as an unmodified cHS4 chromatin insulator, and where the
functional insulator sequence permits a higher titer of expression
of a vector carrying such a sequence, in comparison with a vector
carrying the unmodified cHS4 chromatin insulator.
[0021] In another aspect, a method of increasing a titer of a
modified SIN lentiviral vector, when compared to a standard SIN
lentiviral vector, is provided. The method comprises: inserting one
or more copies of a heterologous polyadenylation (polyA) signal
sequence downstream from a viral 3' long terminal repeat sequence
in a standard SIN lentiviral vector backbone, resulting in a
polyA-modified SIN lentiviral vector; and transfecting a eukaryotic
cell with the polyA-modified vector, where insertion of the
heterologous polyA signal sequence and subsequent transfection of
the eukaryotic cell increases the viral titer of the modified
vector, when compared to the standard SIN lentiviral vector. In
some embodiments, the insertion of the heterologous polyA signal
sequence and subsequent transfection of the eukaryotic cell reduces
transcriptional read-through of vector transcripts, improves
packaging efficiency and increases the viral titer of the modified
vector, when compared to the standard SIN lentiviral vector.
[0022] In another aspect, a method of increasing titer of a
modified SIN lentiviral vector, when compared to a standard SIN
lentiviral vector, is provided. The method comprises: inserting one
or more of an upstream polyA enhancer signal into a 3' LTR of a
standard SIN lentiviral vector backbone, resulting in a polyA
enhancer-modified lentiviral vector; and transfecting a eukaryotic
cell with the polyA enhancer-modified lentiviral vector, where
transfection with the polyA enhancer-modified vector results in an
increased titer as compared to titer of a standard SIN lentiviral
vector. In some embodiments, the polyA enhancer is a USE sequence
derived from an SV40 late polyA signal. In some embodiments,
transfection with the USE sequence derived vector increases titer
by reducing transcriptional read-through of vector transcripts and
improving packaging efficiency. In some embodiments, three upstream
polyA enhancer signal sequences are inserted into the 3' LTR of a
standard SIN lentiviral vector backbone.
[0023] In another aspect, a method of increasing titer of a
multiply modified SIN lentiviral vector, when compared to a
standard SIN lentiviral vector is provided. The method comprises:
providing a standard SIN lentiviral vector, wherein a backbone of
the vector comprises a viral 3' long terminal repeat (LTR) sequence
and a U3 deletion; obtaining a multiply modified SIN lentiviral
vector and transfecting a eukaryotic cell with the multiply
modified vector, where the multiply modified vector permits an
increase of viral titer, compared to a standard SIN lentiviral
vector. In some embodiments, the multiply modified SIN lentiviral
vector is created, for example, by inserting, in any order: a
heterologous polyA signal sequence downstream from the viral 3' LTR
sequence; and an upstream sequence derived from an SV40 late polyA
signal into the U3 deletion.
[0024] In another aspect, an expression vector capable of enhanced
titer in comparison with a corresponding lentiviral vector is
provided. The expression vector compries at least one of: a
.beta.-growth hormone polyA signal sequence downstream from a viral
3' LTR sequence in a standard SIN lentiviral vector backbone; and a
USE sequence derived from an SV40 late polyA signal, inserted into
a U3 deletion region of a standard SIN lentiviral vector
backbone.
[0025] In another aspect, an expression vector capable of enhancing
stability and safety of gene expression while maintaining a
clinically useful titer of a lentiviral vector is provided. The
expression vector comprises: a heterologous polyA signal sequence
downstream from a viral 3' LTR sequence in a standard SIN
lentiviral vector backbone; a USE sequence derived from an SV40
late polyA signal in a U3 deletion region of a standard SIN
lentiviral vector backbone; one or more flanking cHS4-derived
reduced-length functional insulator sequences; and a
lineage-specific promoter and/or enhancer selected for restricted
activation in cells in which expression is desired.
[0026] In another aspect, an expression vector capable of enhancing
stability and safety of transgene expression while maintaining a
clinically useful titer of a lentiviral vector is provided. The
expression vector comprises: a transgene of interest; a
heterologous polyA signal sequence downstream from a viral 3' LTR
sequence in a standard SIN lentiviral vector backbone; a USE
sequence derived from an SV40 late polyA signal in a U3 deletion
region of a standard SIN lentiviral vector backbone; one or more
flanking cHS4-derived reduced-length functional insulator
sequences; a lineage-specific promoter and/or enhancer selected for
restricted activation in cells in which expression is desired; and
one or more lentivirus non-coding cis sequences, selected from: R,
U5, a packaging signal, rev response element, env splice acceptor
site, and an extended gag sequence.
[0027] In another aspect, a method for genetic correction of sickle
cell anemia or reducing symptoms thereof vector is provided. The
method comprises: treating a subject with reduced intensity
conditioning; and transplanting autologous hematopoietic stem cells
(HSCs) transfected with a modified lentivirus where the modified
lentivirus comprises: a gamma-globin gene and beta-globin locus
control region; wherein: post-transplantation fetal hemoglobin
exceeds at least 20%; F cells constitute at least 2/3 of the
circulating red blood cells; fetal hemoglobin per F cells account
for at least 1/3 of total hemoglobin in sickle red blood cells; and
at least 20% gene-modified HSCs re-populate bone marrow of the
subject.
[0028] In another aspect, a human gamma-globin lentiviral
expression vector capable of genetically correcting sickle cell
anemia or reducing symptoms thereof is provided, The exopression
vector comprises: a gamma-globin gene cloned in reverse orientation
to a viral transcriptional unit; one or more elements of a
beta-globin locus control region cloned in reverse orientation to
the viral transcriptional unit; a heterologous polyA signal
sequence downstream from a viral 3' LTR sequence in a standard SIN
lentiviral vector backbone; one or more USE sequences derived from
an SV40 late polyA signal in a U3 deletion region of a standard SIN
lentiviral vector backbone; and one or more flanking CHS4-derived
reduced-length functional insulator sequences.
[0029] In another aspect, a human gamma-globin lentiviral
expression vector capable of genetically correcting sickle cell
anemia or reducing symptoms thereof is provided, The expression
vector comprises: a gamma-globin gene cloned in reverse orientation
to a viral transcriptional unit; an erythroid lineage specific
enhancer element; a heterologous polyA signal sequence downstream
from a viral 3' LTR sequence in a standard SIN lentiviral vector
backbone; a USE sequence derived from an SV40 late polyA signal in
a U3 deletion region of a standard SIN lentiviral vector backbone;
and one or more flanking CHS4-derived reduced-length functional
insulator sequences.
[0030] In another aspect, a lentiviral expression vector capable of
genetically correcting beta-thalassemia or reducing symptoms
thereof is provided. The expression vector comprises: a beta-globin
gene cloned in reverse orientation to the viral transcript; one or
more elements of a beta-globin locus control region cloned in
reverse orientation to the viral transcriptional unit; a
heterologous polyA signal sequence downstream from a viral 3' LTR
sequence in a standard SIN lentiviral vector backbone; a USE
sequence derived from an SV40 late polyA signal in a U3 deletion
region of a standard SIN lentiviral vector backbone; and one or
more flanking cHS4-derived reduced-length functional insulator
sequences.
[0031] In another aspect, a method of genetically modifying an
erythroid cell for utilization as a depot to produce and expel
proteins non-native to blood and/or not conventionally secreted
into blood circulation is provided. The method comprises:
transducing an HSC with a vector, the vector comprising: an
erythroid specific promoter; a gene of interest (GOI) operably
linked to the promoter, the GOI encoding a protein non-native to
blood and/or not conventionally secreted into blood circulation,
where activation of the erythroid specific promoter leads to
expression and expulsion by an erythroid cell of a protein or
proteins non-native to blood and/or not conventionally secreted
into blood circulation.
[0032] In another aspect, a method of genetically correcting
Mucopolysaccharidosis type I (MPS I) and/or reducing symptoms
thereof is provided. The method comprises: transducing a HSC with a
vector, which vector comprises: an erythroid specific promoter; and
a gene encoding alpha-L-iduronidase (IDUA), wherein activation of
the erythroid specific promoter leads to the expression and
expulsion of IDUA by an erythroid cell; and introducing the HSC
into an individual with MPS I, where the expression and explusion
of IDUA from erythroid offspring of genetically modified HSC leads
to high IDUA levels in blood stream, and results in a correction of
MPS I or a reduction of symptoms thereof.
[0033] In another aspect, an expression vector capable of
genetically correcting MPS type I and/or reducing symptoms thereof
is provided. The expression vector comprises: an erythroid specific
promoter; and a gene encoding IDUA, wherein activation of the
erythroid specific promoter leads to sustained expression and
expulsion of IDUA by developing erythroid cells and the genetic
correction of MPS I and/or reduction of symptoms thereof.
[0034] In another aspect, an expression vector capable of
genetically correcting or reducing symptoms of a disease is
provided. The expression vector is characterized by insufficient
expression of a least one functional protein non-native to blood
and/or not conventionally secreted and comprises: an erythroid
specific promoter; and a GOI encoding a protein non-native to blood
and/or not conventionally secreted, where activation of the
erythroid specific promoter leads to the expression and expulsion
by an erythroid cell of a protein or proteins non-native to
erythroid cells and/or not conventionally secreted by cells.
[0035] In another aspect, a method of genetically correcting a
lysosomal storage disease is provided. The method is characterized
by deficiency of one or more lysosomal enzymes that can be imported
into a cell through mannose 6-phosphate receptor mediated
endocytosis and comprises: transducing an HSC with a vector and
introducing the HSC into an individual with a lysosomal storage
disease, wherein the expression and explusion of a lysosomal enzyme
from erythroid offspring of genetically modified HSCs leads to
normal or high sustained lysosomal enzyme levels in an individual's
blood stream; and the enzyme is endocytosed into cells through
mannose 6-phosphate mediated endocytosis, resulting in correction
of a lysosomal storage disease and/or a reduction of symptoms
thereof. The vector comprises: an erythroid specific promoter; and
a gene encoding a lysosomal enzyme that can be released when
over-expressed in a cell, where activation of the erythroid
specific promoter leads to the expression and expulsion of a
lysosomal enzyme by an erythroid cell.
[0036] In another aspect, a method of improving and/or correcting
one or more central nervous system (CNS) abnormalities caused by
one or more lysosomal storage disease is provided. The method
comprises: transducing an HSC with a vector, and introducing the
HSC into an individual with a lysosomal storage disease, where the
expression and explusion of a lysosomal enzyme from erythroid
offspring of genetically modified HSCs leads to sustained normal or
above normal lysosomal enzyme levels in an individual's blood
stream, and correction or improvement of one or more CNS
abnormalities caused by one or more lysosomal storage diseases. The
vector comprises: an erythroid specific promoter; and a gene
encoding a lysosomal enzyme that can be released when
over-expressed in a cell, wherein activation of the erythroid
specific promoter leads to the expression and expulsion of a
lysosomal enzyme by an erythroid cell.
[0037] In another aspect, a method of improving viral titer in
transfection-based production system using a eukaryotic cell is
provided. The method comprises at least one of: harvesting a
population of eukaryotic cells prior to transfection that have
progressed beyond log phase of cell growth to a state of confluency
for at least 24 hours; mixing the population with transfection
reagents and plasmid DNA at the time of re-seeding into a new
culture vessel, where the harvesting and mixing steps, alone or in
combination, results in an improved viral titer, by at least
2-fold, in a transfection-based production using a eukaryotic cell.
In another aspect, a method of improving titer in
transfection-based production using a eukaryotic cell is provided.
The method comprises at least one of: harvesting of a confluent
population of eukaryotic cells for transfection that have
progressed beyond log phase of growth; mixing the population with
transfection reagents and plasmid DNA at the time of seeding; and
seeding cells at a cell density of at least 5.times.10.sup.4
cells/cm.sup.2 4 to 5 days prior to cell harvest and transfection,
where any of the harvesting, mixing, and/or seeding, alone or in
any combination, results in an improved titer, by at least 2-fold,
in a transfection-based production using a eukaryotic cell.
[0038] In another aspect, a method of improving titer in
transfection-based bioreactor culture production using a eukaryotic
cell is provided. The method comprises at least one of: harvesting
of a confluent population of eukaryotic cells for transfection that
have progressed beyond log phase of growth; mixing the population
with transfection reagents and plasmid DNA at the time of seeding;
seeding cells at a cell density of at least 5.times.10.sup.4
cells/cm.sup.2 4 to 5 days prior to cell harvest and transfection;
and transfecting of cells with at least 9.2 .mu.g/ml of plasmid
DNA, using either suspension cells or cells to be plated onto
carriers or microcarriers, wherein any of the harvesting, mixing,
seeding, and/or transfecting steps, alone or in any combination,
results in an improved titer, by at least 2-fold, in
transfection-based bioreactor culture production using a eukaryotic
cell.
BRIEF DESCRIPTION OF THE FIGURES
[0039] Those of skill in the art will understand that the drawings,
described below, are for illustrative purposes only. The drawings
are not intended to limit the scope of the present teachings in any
way.
[0040] FIGS. 1A and 1B depict titers from the standard and gutted
SIN-LV (a) A schematic representation of SIN lenti-proviruses.
sSIN-GFP, sBG-6 and sFIG are SIN-LV carrying GFP, BG or the Fanconi
Anemia A cDNA,-IRES-GFP respectively. dsSIN-GFP, sBG-1 and ds-FIG
are their gutted counterparts. SD=splice donor. SA=splice acceptor.
.psi. packaging sequence. cPPT: central poly purine tract. The gag
(360 bp) and the env fragment containing the RRE (.about.850 bp)
are indicated. (b) The viral obtained after infection of MEL cells
and analysis for GFP and h.beta.-globin expressing cells. Titers
are expressed as IU/mL of concentrated supernatant (n=3).
[0041] FIG. 2 depicts BG SIN-LV constructs. A schematic
representation of 10 SIN-lentiviral proviral forms (sBG-1 to
sBG-10). All the vectors contain BG (HS2, 3, and 4 elements of the
LCR, the .beta.-promoter and gene) and cPPT. Gag (630 bp or 360
bp), RRE, env fragments are shown. * indicates a point mutation
that disrupts the SA.
[0042] FIGS. 3A and 3B depict viral titers of BG SIN-LV (a) Viral
supernatants of sBG-1 to sBG-10 SIN lentiviral vectors were
concentrated 1400-fold and titered on MEL cells by monitoring for
.beta.-globin positive cells by flow cytometry (n=4). (b) Fold
increase in titers with inclusion of cis-elements. The titers were
normalized to that of the completely gutted vector (sBG-1), which
was considered 1.
[0043] FIGS. 4A and 4B depict effect of LV cis-elements on the
provirus stability and expression. (a) Proviral integrity: Southern
blot analysis of MEL cells transduced with sBG-127 to sBG-10,
restricted with AflII that cuts in the viral LTRs, and probed with
a h.beta.-globin fragment. (b) Expression of h.beta.-globin in MEL
cells: dot plot analysis of sBG-1 to sBG-10 transduced MEL cells
from one representative experiment; MFI are indicated in the upper
right corner of the dot-plot.
[0044] FIGS. 5A and 5B depict vRNA transcripts in packaging cells.
Northern blot analysis of (A) total RNA from 293T packaging cells
transfected with SIN LV plasmids and probed with a .sup.32P labeled
h.beta.-globin fragment. Lower panel shows the same blot hybridized
with an 18S probe as loading control. A full length band of the
expected size is visible for all the vectors. * indicate vectors in
which SA is present and both full length and spliced bands are
visible. A small schematic of the vector cis-sequences are shown
above the vector lanes to depict the .psi. packaging sequence; R:
RRE; SA: Splice Acceptor in the env fragment; SG: short gag
fragment (360 bp); LG: long gag fragment (630 bp) in vectors. (B)
Cytoplasmic RNA for vectors with and without RRE from the same
experiment shown in panel A, showing the efficiency of vRNA export
into the cytoplasm. The phosphoimager quantified ratios
cytoplasmic/total are shown in FIG. 6E.
[0045] FIGS. 6A through 6E depict packaging of vRNA into virons (a)
A representative dot blot analysis on vRNA extracted from sBG
series of virus supernatants showing that the amount of vRNA is
proportional to infectious titers. Virus was made from all ten
vectors and concentrated identically as described and the dot-blot
was probed with a .beta.-globin fragment. NC=negative control. Four
different dilutions for each vector were loaded in duplicate in the
representative experiment shown. A total of three experiments were
performed (B) Phosphoimager counts obtained on the 28 dot blot
shown in panel (A). (C) Relative quantification of vRNA from all
three experiments. (D) p24 activity in concentrated virus from all
vectors (n=2). (E) Ratio of Cytoplasmic/Total RNA from 2 Northern
Blot Analysis (NB) in Packaging Cells (The ratio cytoplasmic/total
RNA was normalized to the value for the completely gutted vector
lacking the RRE (SBG-1) and to 18S RNA (for loading) in two
independent experiments. Analogous vectors with and without RRE are
marked as I, II and III to allow ready comparisons).
[0046] FIGS. 7A and 7B depict vector constructs and experimental
design. A. Self-inactivating (SIN) lentiviral vector carrying the
h.beta.-globin gene and the HS2, HS3 and HS4 of the locus control
region is shown as sBG. Using this backbone, a series of vectors
were generated to incorporate either the cHS4 59 250 bp core, 2
tandem repeats of the core, 5' 400 bp or 59 800 bp of cHS4, and the
full-length 1.2 Kb cHS4 insulator. Vectors sBG400Sand sBG800S carry
in addition to the core inert DNA spacers from 1 bacteriophage. B.
Schema of In vitro and in vivo analyses: MEL cells were transduced
with various vectors to derive single copy MEL clones and
h.beta.-globin expression and ChIP analysis was performed in
differentiated clones. In vivo analysis was done using vector
transduced Hbb.sup.th3/+ donor LSK cells transplanted into lethally
irradiated Hbb.sup.th3/+ recipients and analyzed at 6 months post
transplant. Secondary transplants were performed for CFU-S
analysis. C. Representative FACS plot showing
h.beta.-globin-expressing cells (% h.beta.+) for uninsulated (sBG,
green) and insulated (sBG-I, Pink) single copy MEL clone with
coefficient of variation (CV) of expression shown by arrows.
[0047] FIGS. 8A and 8B depict human .beta.-globin expressing cells
in MEL clones. A. Proportion of h.beta.-globin-expressing cells (%
h.beta.+) in MEL clones. Each circle represents an individual
single copy MEL clone. B. CV values of h.beta.-globin expression of
each clone. The means are represented with a horizontal line and
the mean 6 SEM of %h.beta.+ MEL cells and CV of h.beta.-globin
expression for each vector are indicated in the box above. Filled
circles represent representative clones picked for ChIP analysis. *
P<0.05 by ANOVA, as compared to sBG.
[0048] FIGS. 9A through 9E depict human .beta.-globin expression in
RBCs and single copy secondary CFU-S. A. Representative FACS
histograms showing (% h.beta.+ RBC are indicated within the
histogram). B. Cumulative data on the percentage of h.beta.+ RBCs
normalized to vector copy. C. The coefficient of variation (CV) of
h.beta. expression in RBCs. D. Cumulative data on % h.beta.+
cells/CFU-S. Each circle represents an individual single integrant
CFU-S. E. The CV of h.beta. expression in the individual CFU-S.
Numbers above bar diagrams represent mean 6 SEM and values
significantly different from controls by ANOVA are marked by an
asterisk. *P<0.05; ** P<0.01.
[0049] FIGS. 10A through 10F depict chIP analysis showing the
active and repressive histone marks on the 5' 250 bp cHS4 core and
the h.beta. promoter in MEL cell clones. A. Map of the proviral
form of the vector. Arrows show the position of the primer pairs
used for PCR and qPCR; and the lines represent insulator fragments.
B-C. ChIP with antibodies against control IgG, acH3, acH4,
H3K4-me2, H3K9-me3 and H3K27-me3 and semiquantitative PCR primers
to the .beta.-globin promoter region D-F ChIP with antibodies to
AcH3 and AcH4 (D), H3K4-me2 (E); H3K9-me3 and H3K27-me3 (F)
followed by qPCR using primers amplifying cHS4 core (left panels)
and h.beta.-globin promoter (right panel) on pooled clones (shown
in FIG. 2). *P<0.05; **P<0.01.
[0050] FIGS. 11A and 11B depict human .beta.-globin expression in
mice. A. RBC parameters, reticulocytes and vector copies. Values
represent means .+-.SEM. Hb=hemoglobin, MCV=mean corpuscular
volume, MCHC=mean corpuscular hemoglobin concentration, vector
copy=vector copies in leukocytes by qPCR. B. HPLC analysis of human
.beta.-globin protein in blood lysates as a percentage of total
hemoglobin [h.beta.-m.alpha./(h.beta.-m.alpha.+m.beta.-m.alpha.)].
Data is normalized to vector copy/cell in leukocytes. *P<0.05;
**P<0.01.
[0051] FIGS. 12A through 12G depict effect of 3'400 bp region of
the cHS4 insulator. A. Vector design of sBG.sup.3'400 vector. The
full length cHS4 is shown for comparison. B-C. Proportion of
h.beta.+ cells (B) and the coefficient of variation of h.beta.
expression of sBG.sup.3'400 (C.) in MEL clones. Each circle
represents a single integrant MEL clone. The means are represented
with a horizontal line and the mean .+-.SEM are represented in the
figure. D-E. The percentage of h.beta.-globin+RBC (D), and the CV
of h.beta. expression (E) in mice. F-G. h.beta.-globin-expressing
cells (F) and the CV of hb expression (G) in single copy CFU-S
following secondary transplant. Each circle represents individual
CFU-S. Mean .+-.SEM and P-values are shown. * P<0.05;
**P<0.01; *** P<0.001.
[0052] FIGS. 13A through 13G depict effect of the combination of
the 5' core with the 3' 400 bp regions of the cHS4 insulator. A.
Vector design of sBG.sup.650. The full length cHS4 is shown for
comparison. B. Proportion of h.beta.+ cells and C. CV of
h.beta.-globin expression in sBG.sup.65.degree. MEL clones. Each
circle represents a single copy MEL clone. The means are
represented with a horizontal line and the mean .+-.SEM is
indicated above each group. D. Percentage of hbglobin expressing
RBC in ransplanted mice. E. Percentage h.beta.-globin expressing
cells in single copy CFU-S from secondary mice. F-G. ChIP active
and repressive chromatin followed by semiquantitative PCR (F) or
qPCR (G) of the cHS4 core region or the h.beta.-globin promoter
region.
[0053] FIGS. 14A through 14J depict chromatin patterns over the
3'400 bp and its interaction with the 5' core region. A. A map of
3'LTR showing location of full length 1.2 kb insulator and the
position of primers used in ChIP analysis. Vectors tested with the
indicated regions of the cores are depicted beneath map B ChIP with
antibodies to AcH3 and AcH4, H3K4-me2 and H3K9-me3 and H3K27-me3
followed by a semiquantitative PCR of the 3'400 region in
sBG.sup.3'400, sBG.sup.650, sBG-I provirus. C-D ChIP with
antibodies to USF-1 and CTCF followed by semi-quantitative PCR (C)
or qPCR (D) for the core region. E-F ChIP with antibodies to USF-1
and CTCF followed by semi-quantitative PCR (C) or qPCR (D) for the
3/400 bp region of the sBGC, sBG.sup.3'400, sBG.sup.650 and sBG-I
provirus in pools of three single copy MEL clones. (G)
Representative histograms (FACS) showing hb expressing cells in
mock, sBG, sBGC, sBG2C, sBG400 and sBGI sBGI single copy CFU-S. The
% of h.beta.+ cells are indicated within the histogram. (H) Human
.beta.-globin messenger RNA (mRNA) expressionin single copy
secondary CFU-S of sBG, sBGC, sBG2C,sBG400 and sBG-I by qPCR.
Murine .alpha.-globin expression servedas the internal control
against which h.beta.-globin expression wasnormalized. P values are
shown in the figure. ** indicates P<0.01. (I) The primers and
probes (SEQ ID NOs: 19-30) used in chromatin immunoprecipitation
(ChIP) is shown. `F` represents forward primer and `R` represents
reverse primer. (J) Insertional site analysis on single copy MEL
clones from uninsulated sBG and insulated sBG-I vector with gene
hits according to genome.ucsc.edu.
[0054] FIGS. 15A through 15E depict viral titers of lentiviral
vectors with inserts into the 3'LTR were inversely proportional to
the length of the LTR insert. (A) Schematic representation of the
lentiviral vectors. All vectors were based on sBG, a SIN lentiviral
vector carrying the .beta.-globin gene, .beta.-globin promoter and
the locus control region elements HS2, HS3 and HS4. Different
fragments of the cHS4 site were inserted in the U3 region of the
sBG 3'LTR (shown above the sBG vector). Similar sized inserts were
made by replacing the region downstream of cHS4 core with inert DNA
spacers from the lambda phage DNA (shown below the sBG vector).(B)
Viral titers of insulated vectors decreased as the length of the
insulator insert increased. Titers reflect concentrated virus made
concurrently for all vectors in each experiment (n=4). All titers
were significantly lower than the titers of the control vector sBG
(p<0.01; 1-way ANOVA). (C) Titers fell with insertion of
increasing length of an inert DNA spacer downstream of the core.
Titers of insulated lentivirus vectors (hatched bars) are similar
to those containing inert DNA spacers in the LTR (open bar) in four
independent experiments. The titers of sBG with a 400 bp spacer
were slightly higher (* p<0.05). (D) The sBG.sup.2C vector,
carrying tandem repeats of the cHS4 core recombined with high
frequency. A schematic representation of the vectors sBG-I and
sBG.sup.2C proviruses, when intact, or when the core elements
recombine with loss of one or two cores with the region probed and
restriction site of the enzyme used (AflII) is shown. The size of
the expected band is shown adjacent to each vector cartoon. The
right panel is the Southern blot analysis showing a single 8 Kb
expected band for sBG-I transduced MEL cell population, and two
bands in the sBG.sup.2.c transduced MEL cell population,
representing sBG.sup.2C with either loss of one or both cores.
[0055] FIG. 16 depicts similar amounts of viral RNA were produced
from the insulated and uninsulated vectors in packaging cells.
Northern blot analysis on the 293T packaging cels after
transfection with sBG and sBG-I vectors showed the expected length
viral RNA. The membrane was hybridized with a .sup.32P labeled
p-globin probe (top panel) and 18S (bottom panel) as a loading
control. An expected 7.3 Kb and 8.5 Kb band corresponds to sBG and
sBG-I viral RNA were detected. The 18S and 28S rRNA was
non-specifically probed with this probe. No extraneous recombined
bands were detected with either vector. The phosphoimager
quantified ratios of viral RNA and 18S rRNA of both vectors are
listed below the lanes and show no difference in the amount of
v-RNA between the two vectors.
[0056] FIGS. 17A through 17D depict virus production was not
impaired by insertion of cHS4 in the 3'LTR (A) Reverse
transcriptase activity in sBG and sBG-I viral supernatants is
similar (23.+-.5 vs. 27.+-.3; n=3, p>0.5). (B) p24 levels
detected in the concentrated viral preparation is the same with sBG
and sBG-I. (2.9.+-.0.5.times.10.sup.5 versus
1.7.+-.0.5.times.10.sup.5; n=3, p>0.1) (C) Dot-Blot analysis of
viral RNA extracted from sBG and sBG-I viral supernatant shows
similar amounts of viral RNA packaged into virions in both vectors.
Note that 4 different dilutions of viral RNA were loaded in
duplicate for the two vectors. The membrane was hybridized with a
.sup.32P labeled p-globin probe. Only one of two representative
experiments is shown. (D) Phosphoimager quantification of two
independent experiments was plotted and showed similar amounts of
viral RNA in sBG and sBG-I virions (1.9.+-.0.7.times.10.sup.6 vs.
1.9.+-.0.6.times.10.sup.6n=2, p>0.5).
[0057] FIGS. 18A through 18D depict kinetic of reverse
transcription and nuclear translocation in lentivirus vector
carrying insulator element in the LTR. In panel (A) a schema of the
lentivirus reverse transcription and nuclear translocation process
is illustrated. On the right a summary of q-PCR assays performed to
analyze several steps of the process. Thin line: RNA; thick line:
DNA. Open boxes: polypurine tract (PPT). Open circle: priming
binding site (PBS).The 3' LTR DNA insert is illustrated in the
first strand transfer diagram. The positions of the q-PCR assays
are shown. DNA from MEL cells after infection with sBG and sBG-I
virus was collected at different time points after infection and
analyzed by qPCR. Solid line: sBG. Dashed line: sBGI. (B) Kinetic
of reverse transcription before the first strand transfer (R/U5)
shows no difference between the two viruses. (C-D) After the first
strand transfer (U3/R and Psi) there is a decrease in reverse
transcription efficiency in presence of the insulator. (n=3).
[0058] FIGS. 19A through 19C depict insertion of cHS4 in the LTR
affected viral integration. Linear viral cDNA circularizes and is
the form that integrates; 1-LTR and 2-LTR circles represent
abortive integration products from homologous recombination and
non-homologous end joining, respectively. The 1- and 2-LTR circles
are therefore used as markers of nuclear translocation. (A) There
are reduced 2-LTR circles, analyzed by qPCR on DNA extracted from
MEL cells infected at different times after infection with virus
suggesting reduced nuclear translocation or non-homolgous
end-joining. (B) Southern blot analysis of MEL cells 72 h after
infection with same amount of sBG and sBG-I virus. StuI digestion
of genomic DNA allows identification of 1-LTR circles, 2-LTR
circles, linear DNA and integrated DNA (a smear) for sBG and sBG-I.
Expected band sizes are shown for both vectors. While linear, 1-
and 2-LTR circles are seen in the sBG lane, no linear DNA or 2-LTR
circles are detected in the sBG-I lane. However, 1-LTR circles are
almost as prominent as in the sBG lane. The relative ratios of
linear, 1- and 2-LTR circles suggest increased recombined abortive
integration products with the sBG-I vector, and hence result in
inefficient integration. (C) sBG and sBGI transduced MEL cells show
intact proviral integrants (7.5 Kb and 8.0 Kb respectively). There
was an 8-fold difference in phosphoimager counts of the two bands.
Vector copy number per cell was also quantified by qPCR and is
depicted below the lanes.
[0059] FIGS. 20A through 20E depict hypothesis of mechanism by
which insulator sequence decrease viral titer. In wild type HIV,
linear cDNA molecules translocate to the nucleus where a small
percentage undergoes recombination and end-joining ligation to form
1- and 2-LTR circles, respectively. Only the linear form is the
immediate precursor to the integrated provirus. In the case of
insulated LV vectors, it is shown an increase in 1LTR circle
formation, due to the presence of a larger U3 sequence that could
facilitate an increase in homologous recombination. This process
depletes the amount of viral DNA available for integration as well
as the amount of 2-LTR circle formation, as shown herein. The
decreased amount of DNA available for integration could explain the
loss in titers for lentivirus vector carrying large inserts in the
LTR. (B) A further addition of a 1.2 Kb PGK-MGMT internal cassette
to the BG-I vector, termed BGM-I, did not reduce the titers any
further (C) An optimized vector design results in reasonable virus
titers without loss of insulator activity. A 650 bp sequence of
cHS4, optimized for insulator activity through a structure function
analysis. A vector containing this 650 bp fragment (sBG650), was
found to have .about.2-fold lower titers than the uninsulated
vector sBG (n=3). (D) PCR for Presence of 3'LTR Inserts in
Proviruses Derived from Single Copy MEL Clones Shows Stable
Transmission of all Inserts Except those Present as Tandem Repeats
MEL cells were cloned from pools with<5% gene transfer. Single
copy clones were detected using .beta.-globin primers and confirmed
by a qPCR using primers spanning the .psi. region. PCR with primers
spanning the 250 bp core was performed in the single copy clones,
as these core sequences were common to all vectors. The 1.2 Kb cHS4
insert in the sBG-I vector was further confirmed by PCR primers
spanning the 5' core and the 3' end of cHS4. (E) PCR primers (SEQ
ID NOs: 31-43).
[0060] FIGS. 21A through 21C depict transgene expression and
release during erythroid induction in MEL cells. (A) Illustration
of lentiviral vectors. P.sub.IEK, erythroid specific hybrid
promoter/enhancer containing intron 8 erythroid specific enhancer
of human ALAS2 (.sub.I), HS40 core element from human alpha LCR
(.sub.H) and human ankyrin-1 promoter (.sub.K); PEF, human EF
1.alpha. promoter; P.sub.SF, LTR of SFFV; IRES, internal ribosome
entry site. (B) Representative FACS plots (left panel), and
quantitative analysis (right panel), of GFP expression in
transduced MEL before and after inductive culture. Solid bar
represents the mean of MFI derived from 2-3 experiments. (C)
Intracellular IDUA activities (left panel) and extracellular IDUA
release (right panel). Culture media were harvested 24 hr after
inoculation of cells at 10.sup.5 cells/100 ul. All enzyme levels
were normalized by transduction efficiency (TE) determined by FACS
analysis for GFP.+-.% (mean of 48% for KIiG, 75% for EIiG, and 67%
for SIiG). Data were derived from 2-3 experiments in duplicate
wells and shown as mean .+-.SEM.
[0061] FIGS. 22A and 22B depict in vitro erythroid differentiation
of MEL cells during HMBA-induction. (A) Morphology changes in MEL
cells during inductive culture with 1 mg/ml HMBA. Cytospin slides
were counterstained with Wright's dye, demonstrating a gradual
reduction of cell volume. (B) Detection of hemoglobin-expressing
cells by histochemical staining with Benzidine-hydrogen peroxide
solution.
[0062] FIGS. 23A and 23B depict erythroid derived IDUA is
functional in correcting patient's cells. Lymphoblastoid cells
derived from a MPS I patient (LCLmps) were exposed for 3 hr to
medium preconditioned by 24 hr culture of enzyme-overexpressing
MEL-KIiG at Day 7 of induction (30 U/ml IDUA), with or without the
presence of 1 mM M6P inhibitor. (A) IDUA specific activity in cell
lysate. Data were derived from 2 experiments in triplicate. (B)
Normalization of lysosomal abundancy in treated LCLmps. Cells were
labeled with lysosome-specific probe (red), and countered stained
with DAPI (blue) for nuclei.
[0063] FIGS. 24A through 24D depict long-term expression of IDUA in
LV-KEG-transduced MPS I chimeras and gene transfer efficiency. (A)
Plasma IDUA levels over 5 months after BMT in primary MPS I
recipients. MPS I mice were transplanted at 8-9 weeks of age with
wild-type BM (MPS/WT), or LV-KIiG-transduced MPS Lin.sup.- cells
(MPS/KIiG), or LV-EEG-transduced MPS Lin.sup.- cells (MPS/EEG). UD,
undetectable level of IDUA was found in MPS I mice. Data were
derived from 5-7 mice per group. (B) Plasma IDUA levels in
secondary MPS I chimeras harboring LV-KIiG or wild-type marrow.
Each symbol represents a 2.degree. MPS I BMT recipient, and solid
line presents the mean. (C) Transgene frequencies determined by
real-time qPCR in PBL and BM from primary and secondary BMT
recipients 4-5 months after transplantation. CFU-Spleen assay was
conducted with BM from 5 primary donors each into 6-7 secondary
mice. (D) IDUA levels in GFP.+-.CFU-S colonies in correlation with
vector copy number. Mean of IDUA levels from CFU-S colonies derived
from heterozygous (Het) or wild-type (WT) HSCs are also shown.
[0064] FIG. 25 (a table) despicts erythrocyte parameters in primary
or secondary MPS I chimeras 5-6 months after transplantation, as
well as in age-matched MPS I or normal control mice. Complete blood
count was performed in primary or secondary MPS I chimeras 5-6
months after transplantation, as well as in age-matched MPS I or
normal controls. Data are presented as mean .+-.SD. .sup.a p=0.074,
.sup.b p=0.065 and .sup.c p=0.055, in comparison to normal
controls.
[0065] FIGS. 26A through 26D depict transgene expression pattern in
erythroid precursors of primary MPS I BMT recipients. (A) Top
panel: representative flow cytogram of BM cells immunostained for
Ter119 and CD71, showing gating for various stages of erythroid
cells (subpopulation I-IV). Bottom panel: representative histograms
for GFP expression in gated sub-populations of treated MPS I mice.
Neg, Ter119.sup.-CD71.sup.- fraction. Background GFP levels in
MPS/WT controls are 0.9-1.3% in all subpopulations. (B) Frequency
of detectable GFP+cells in various erythroid progenitors.
*P<0.05; **P<0.01. (C) Relative expression is shown as fold
increase of mean MFI in GFP+cells over GFP.sup.- cells in the same
subpopulation. N=5 for MPS/KIiG, and n=3 for MPS/WT. (D) Results of
GFP analysis.
[0066] FIGS. 27A through 27C depict cellular composition of CFU-S
colonies and GFP expression in clonal progeny of GFP+CFU-S. (A)
Discrete CFU-S colonies were collected from 6 mice (one KIiG donor
into 5 recipients, and one normal donor into 1 control recipient)
12-days after transplantation, followed by immunostaining with
erythroid markers CD71 (as C) and Ter119 (as T). Representative
cytogram is shown to define non-erythroid cells (C.sup.-T.sup.-),
early stage erythroblasts (C.sup.+T.sup.-), mid/late stage of
erythroblasts (C.sup.30 T.sup.+) and reticulocytes/mature RBC
(C.sup.-T.sup.+). (B) Cellular compositions of all individual
colonies collected (except one lost colony with significantly fewer
amounts of cells) are shown. (C) GFP expression in four
subpopulations of a GFP.sup.+ FU-S colony (dark lines) and a colony
from control animal (light dotted lines). Arrows indicate MFI of
GFP.
[0067] FIGS. 28A through 28M depict long-term systemic correction
in treated MPS I mice. (A) Urinary GAG levels were determined by
direct DMB dye-binding assay 3-months or 5-months after
transplantation. N=4-6 for all groups. ** p<0.002 between MPS I
mice and all other groups. (B-M) Representative views of
histopathology of liver, spleen and heart from epon-embedded tissue
sections (0.5-1 um-thick) with Toluidine blue staining. H,
hepatocytes; K, Kupffer cell; P, perisinusoidal cells; I,
interstitial cells. For MPS/KIiG and MPS/WT groups, sections of
peripheral organs from the animal that exhibited the lowest plasma
IDUA among the group are shown.
[0068] FIGS. 29A and 29B depict supra-physiological plasma IDUA
levels leads to partial CNS correction in MPS I mice. (A) Repeated
open-field test. Age-matched untreated MPS I (n=8), KIiG-treated
MPS I (n=5), MPS I transplanted with wild-type morrow (n=6) and
normal littermates (n=8) were evaluated 5-months after
transplantation. Data is presented as mean .+-.SEM. (B)
Histopathology of cerebral cortex in epon-embedded tissue sections
(0.5 um) with Toluidine blue staining. Representative brain
micro-vessels (Mv) (arrowhead) and perivascular cells (Pr) (arrow)
are shown in top panel. Bottom panel shows the percentages of Mv
that is associated with vacuolated Pr in the brain (%Vac.sup.+).
The mean of scoring data from 6 slides (of two animals) is shown
for each group. P<0.01 by Student t-test among all groups.
[0069] FIGS. 30A through 30E depict GDG mice that underwent
transplantation after myeloablative conditioning have high HbF
production that is stable and sustained in primary and secondary
mice. G.sup.bG mice that were fully chimeric for donor RBCs were
analyzed at different time points. The proportion of HbF (A) and F
cells (B) in blood of individual mice, as determined by
ion-exchange HPLC and FACS analysis, respectively, is shown at
different time points after primary and secondary transplantations.
(C) The amount of HbF in blood directly correlated with the
proportion of F cells. (D) The amount of IMF produced was directly
in proportion to the vector copy number in bone marrow. Each symbol
represents one mouse (and consistently depicts the same particular
mouse in all the panels). (E) Hematologic parameters of G.sup.hG
mice that underwent transplantation after myeloablative
conditioning. Hb indicates hemoglobin; MCV, mean corpuscular
volume; MCH, mean corpuscular hemoglobin; RDW, red cell
distribution width; Plt, platelets; pri, primary mice; and sec,
secondary mice. *P values represent comparison of primary mock mice
with the G.sup.bG group. Statistical comparisons of secondary mice
were not made as only one secondary mock mouse was alive at the
time of analysis.
[0070] FIGS. 31A through 31H depict G.sup.bG mice that underwent
transplantation after myeloablative conditioning, which resulted in
correction of hematologic parameters that correlated with the HbF
expression. There was sustained reduction in reticulocytes (A),
and. increase in hematocrit (B) and RBC numbers (C) over time. (D)
Leukocytosis decreased with normalization of WBC counts. Data shown
represent mean (.+-.SEM) values of G.sup.bG mice=.cndot.) and mice
that underwent mock transplantation (n=10; O). A star represents
mean values in BERK mice that were HSC donors for the G.sup.bG and
mock transplantations. (E-G) Decrease in reticulocytes, and
increased hematocrit and RBC numbers correlated with the proportion
of F cells in individual mice. (H) WBC counts decreased but
normalized when the F cells exceeded 60%. WBC counts, counted on an
automated analyzer, were representative of circulating leukocytes,
since only occasional nucleated RBCs were seen in peripheral
smears. Each data point/symbol in panels E-H represents one
G.sup.bG mouse and symbols for individual mice have been kept
consistent, to trace individual mice. A star represents mean values
in BERK mice that were HSC donors for the G.sup.bG and mock
transplantations.
[0071] FIGS. 32A through 32G depict G.sup.bG mice that underwent
transplantation after myeloablative conditioning, which resulted in
correction of functional RBC parameters in primary and secondary
mice. (A) Peripheral blood smears showing numerous irreversibly
sickled cells (ISCs) in a mouse that underwent mock transplantation
and a paucity of ISCs in a G.sup.bG mouse. (B) Quantification of
ISCs in peripheral blood smears of BERK mice that did not undergo
transplantation (n=5), mock mice (n=3), and G.sup.bG mice (n=5).
(*P<.05; **P<.01). (C) Deoxygenation of blood induces
sick-ling of RBCs in a mock mouse; sickling is largely absent in a
G.sup.bG mouse. (D) Quantification of sickle RBCs upon graded
hypoxia (by tonometry) in the G.sup.bG mice (.cndot.), compared
with mock mice (O). (E) RBC deformability by LORCA analysis in
G.sup.bG, mock, and normal mice (C57, circle with x in center)
analyzed at 18 weeks in primary transplant recipients. Similar data
were seen in secondary recipients. Flow at low (3 Pa) and high (28
Pa) shear stress is represented by shaded areas. (F) RBC half-life
(determined by in vivo biotin labeling) in the G.sup.bG mice,
mock/BERK mice, and normal mice after primary transplantations.
Similar results were seen in secondary recipients. (G) Correction
of organ pathology in G.sup.bG mice that underwent transplantation
with myeloablative conditioning. 2+ lliver infarction indicates 2
to 3 infarctions/section; 3+ lliver infarction, more than 3
infarctions/section; and E-M, extramedullary. Mild congestion of
the spleen vessels with sickle RBCs is seen when splenic
architecture is restored. This is not noted when the splenic
architecture is effaced by extramedullary erythropoiesis. Splenic
erythroid hyperplasia: severe is complete obliteration of splenic
follicles; moderate, more than 1 follicle present/section; and
mild, preservation of follicles with evidence of erythroid islands.
Bone marrow: normal erythropoiesis indicates M/E=5:2; mild
erythroid hyperplasia, M/E=2:1; moderate erythroid hyperplasia,
M/E=1:1; and severe erythroid hyperplasia, M/E=1:3. Bone marrow
erythropoiesis expressed as myeloid-erythroid ratio (M/E). Numbers
in parentheses indicate the histologic feature seen in the number
of mice/total number of mice analyzed in that group.
[0072] FIGS. 33A through 33H depict HbF expression and functional
correction in (PG mice that underwent transplantation after
reduced-intensity conditioning, separated into 2 groups: mice with
HbF of 10% or more (G.sup.bG>10) and mice with HbF of less than
10% (G.sup.bG<10). (A) HbF in individual BERK mice 18 weeks
after transplantation of sG.sup.bG-transduced BERK HSCs, after
reduced-intensity conditioning. (B-C) Stable and high HbF
expression and IF-cell repopulation in long-term survivors analyzed
at 11 months. (D) Box and whisker plot showing vector copy numbers
in G.sup.bG<10 and G.sup.bG>10 mice, with mean vector copy
number denoted by the line. Symbols in panels A through C represent
mouse groups: 0=mock (HbF 0%), =G.sup.bG<10 (HbF<10%), and
.circle-solid.=G.sup.bG>10 (HbF >10%). (E) The proportion of
ISCs was reduced (P<0.04) in G.sup.bG<10 mice, but was
markedly reduced in G.sup.bCi>10 mice (P<0.001), compared
with mock mice. (F) Graded deoxygenation via tonometry demonstrates
significant reduction in sickling at physiologically relevant
partial oxygen pressures (PO2) in G.sup.bG>10 mice, whereas
G.sup.bG<10 mice RBC sickled similar to controls. (G-H) RBC
deformability showed highly variable improvement in deformability
in G.sup.bG<1.0 mice. In contrast, RBC deforrnability in
G.sup.bG>10 mice was highly significantly improved at low and
high shear stress (P<0.001). Symbols represent mouse groups: 0,
mock; , G.sup.bG<10; .circle-solid., G.sup.bG>10; and (circle
with x in center), wild-type mice (C57BL/6). Gray shaded rectangles
are representative of low and high shear stress through
microvessels and large vessels, respectively. Error bars indicate
SEM,
[0073] FIGS. 34A through 34D depict correction of organ pathology
in G.sup.bG 10 mice that underwent transplantation after
reduced-intensity conditioning and improved overall survival. (A)
Representative hematoxylin-eosin-stained sections of a kidney,
liver, and spleen of G.sup.bG>10 and G.sup.bG<10 mice 48 to
50 weeks after reduced-intensity conditioning transplantation and a
3-month-old BERK control. Image acquisition nforrnation is
available in supplemental. data. (B) Kaplan-Meier survival curve
showed significantly improved survival of the G.sup.hG>10 mice
compared with mock/G.sup.bG<10 mice at 50 weeks. Survival at 24
weeks is denoted by a dashed vertical line to compare with survival
of the G.sup.hG mice in the myeloablative transplantation model.
(C) Hematologic parameters of G.sup.bG mice that underwent
transplantation following reduced-intensity conditioning.
Hematologic parameters and abbreviations as stated in the figure. P
values represent comparisons of mock mice with G.sup.bG.gtoreq.10
at 12(*), 18 (.dagger.), and 24(). (D) Organ pathology in G.sup.bG
mice that underwent transplantation after reduced-intensity
transplantation. E-M indicates extramedullary; and 1+ liver
infarction. 1 infarction/section. *Congestion of vessels and
presence of sickle RBC in vessels. Notably, congested vessels were
visible in spleens only when erythroid hyperplasia effecting
splenic architecture was reduced. The terminology used to quantify
organ pathology is the same as documented in the figure.
[0074] FIGS. 35A through 35C depict effect of HbF, F cells, and
percentage HbF/F cell required for functional improvement in RBC
survival and deformability. (A) RBC half-life. Left panel shows a
representative G.sup.bG mouse injected with biotin with
biotin-labeled F cells (upper right quadrants) and non-F cells
(lower right quadrants) determined by FACS. Right panel shows
survival of F cells (hollow square with solid circle in center),
compared with the non-F cells (Hollow circle with solid circle in
center)in G.sup.bG mice (n=4); wild-type mice (A); and Berkeley
mice (O). (B) A cohort of G.sup.bG mice analyzed for RBC survival
in vivo, based upon the percentage of HbF/Fcell. Each symbol
represents a mouse group with HbF percentage and number of mice
isted in the adjacent table legend. (C) All G.sup.bG and mock mice
(n=34) that were analyzed for RBC deformability were divided into
groups based on proportion of F cells 0%, I% to 33%, 33% to 66%,
and more than 66%, and deformability of total RBC in these mice was
plotted at low (3 Pa, A) and high (28 Pa, upside down hollow
triangle) shear stress. Significantly mproved deformability over
mock controls is denoted by *(1')<0.05) and **(1)<0.01).
Error bars indicate SEM
[0075] FIGS. 36A and 36B depict proportion of transduced HSCs in
G.sup.bG mice. Proportions in the myeloablative (A) and
reduced-intensity (B) transplantation models are shown. The
proportion of sG.sup.6G-transduced HSCs was determined by spleen
colonies (30-36 colonies/mouse) by intracellular staining with HbF
and HbS. Each bar represents an individual mouse. (A) In the
myeloablative transplantation model, symbols beneath each bar
(representing one mouse) are consistent with the symbols in mice
labeled. (B) In the reduced-intensity group, bone marrow was
successfully aspirated from 8 mice at 24 weeks and mice were
followed for an additional 24 weeks. The HbF expression in
peripheral blood by HPLC and bone marrow copy number of the
respective mice at 24 weeks are labeled under each bar.
[0076] FIGS. 37A and 37B depict expansion (A) and cell viability
(B) of 293F cell suspension culture over time when initiated at
6.times.10.sup.5, 8.times.10.sup.5, and 1.5.times.10.sup.6 c/mL;
mean .+-.SD (n=3).
[0077] FIGS. 38A and 38B depict titer of MIEG3 (RD114) produced on
293T and 293F cells transfected using different transfection
methods (A); and relative titer of a lentivirus and
gamma-retrovirus (LTR and SIN configuration) transfected with
lipofectamine (B); mean .+-.SD (n=2). ND, not detected.
[0078] FIG. 39 depicts 293T cells (2.5.times.10.sup.8) were
transfected in a 500 mL FibraStage culture system (New Brunswick
Scientific; disposable 500 mL bottle with FibraCel mounted on a
movable stage) with 500 microgram of SRS11.SF.GFP.pre*SE, 450
microgram of pCDNA3.MLV.g/p and 200 microgram of GALV envelope
plasmid using Calcium Phosphate. One group was transfected at the
time of seeding (4 hours post-seeding), the other group was
transfected the day after seeding.
[0079] FIG. 40 depicts 293T cells were transfected on tissue
culture plastic (2.times.10.sup.7 cells per T75 in 10 mL D10) or on
FibraCel (2.times.10.sup.8 cells per 2 gram in 100 mL D10) with
SRS11.SF.DsRed2.pre*, pCDNA3.MLV.gp, and Eco-env using different
amounts of plasmid DNA (total amount expressed as .mu.g per mL of
media). Vector was harvested at 12-hour intervals and titered on
NIH 3T3.
[0080] FIGS. 41A and 41B depict 293T cells were plated at a cell
density of 2.5.times.10.sup.4, 5.times.10.sup.4, and
1.times.10.sup.5 cells/cm.sup.2 4 days prior to transfection. At
the day of transfection, cells were harvested and 2.times.10.sup.8
cells from each group were transfected with a GALV pseudotyped
SIN11.SF.eGFP.pre* (A) and SRS11.EFS.IL2RGpre* (B). Vector was
harvested at 12-hour intervals and titered on HT1080.
[0081] FIGS. 42A and 42B depict 293T cells were transfected T75
(2.times.10.sup.7 cells per flask in 10 mL D10) with
SERS11.EGFP.pre*, pCDNA3.MLV.gp, and GALV-env. Post-transfection,
media was changed at various time points (A). Comparison of PBS
rinse followed by 5 min exposure of TrypLESelect and exposure to
PBS for 20 min and exposure to TrypLESelect for 30 min, all groups
showed >95% viability (B). Average .+-.SD (n=2).
DESCRIPTION OF THE INVENTION
[0082] All references cited herein are incorporated by reference in
their entirety as though fully set forth. Also incorporated herein
by reference in their entirety are: 1) A description of a
determination of the functional portions of the Chicken
hypersensitivity site 4 and applications of that determination as
described in, "The 3' Region of the Chicken Hypersensitivity Site-4
Insulator Has Properties Similar to its Core and Is Required for
Full Insulator Activity". (2009) PLoS ONE 4(9): e6995, Arumugam P,
Urbinati F, Velu C, Higashimoto T, Grimes HL, et al. 2) A
description of the relationship between reduction in titer and the
size of insert into the 3' LTR in Lentivirus as described in,
"Mechanism of Reduction in Titers From Lentivirus Vectors Carrying
Large Inserts in the 3'LTR". Molecular Therapy (2009) 17 9,
1527-1536. Urbinati F, Arumugam P, Higashimoto T, Perumbeti A,
Mitts K, et al. 3) A novel human gamma-globin gene vector for
genetic correction of sickle cell anemia in a humanized mouse model
and critical determinants for successful correction thereof as
described in, "A novel human gamma-globin gene vector for genetic
correction of sickle cell anemia in a humanized mouse model:
critical determininants for successful correction". Blood (2009)
114: 1174-1185 Perumbeti A, Higashimoto T, Urbinati F, Franco R,
Meiselman H et al. 4) The use of erythroid cells as a depot for
expressing and excreting corrective enzymes into the blood as
described in, "Reprogramming erythroid cells for lysosomal enzyme
production leads to visceral and CNS cross-correction in mice with
Hurler syndrome." (2009) PNAS vol. 106 no. 47 19958-19963 (online
ahead of print) Wang D, Zhang W, Kalfa T, Grabowski G, Davies S, et
al.
[0083] Unless defined otherwise, technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs.
Singleton et al., Dictionary of Microbiology and Molecular Biology
3.sup.rd ed., J. Wiley & Sons (New York, N.Y. 2001); March,
Advanced Organic Chemistry Reactions, Mechanisms and Structure
5.sup.th ed., J. Wiley & Sons (New York, NY 2001); and Sambrook
and Russel, Molecular Cloning: A Laboratory Manual 3.sup.rd ed.,
Cold Spring Harbor Laboratory Press (Cold Spring Harbor, N.Y.
2001), provide one skilled in the art with a general guide to many
of the terms used in the present application. One skilled in the
art will recognize many methods and materials similar or equivalent
to those described herein, which could be used in the practice of
the present invention. Indeed, the present invention is in no way
limited to the methods and materials described.
[0084] As used herein, the term "SIN" is an abbreviation of
self-inactivating.
[0085] As used herein, the term "HIV" is an abbreviation of human
immunodeficiency virus.
[0086] As used herein, the term "GFP" is an abbreviation of green
fluorescent protein.
[0087] As used herein, the term "cDNA" is an abbreviation of
complimentary DNA.
[0088] As used herein, the term "LTR" is an abbreviation of long
terminal repeat.
[0089] As used herein, the term "USE sequence" refers to an
upstream sequence element.
[0090] As used herein, the term "polyA" is an abbreviation of
polyadenylation.
[0091] As used herein, the term "cHS4" is an abbreviation of
chicken hypersensitive site-4 element.
[0092] As used herein, the term "MPS" is an abbreviation of
Mucopolysaccharidosis.
[0093] As used herein, the term "HSC" is an abbreviation of
hematopoietic stem cells.
[0094] As used herein, the term "GOT" is an abbreviation of gene of
interest.
[0095] As used herein, the term "HbF" is an abbreviation of fetal
hemoglobin.
[0096] As used herein, the term "RBC" is an abbreviation of red
blood cell.As used herein, the term "IDUA" is an abbreviation of
alpha-L-iduronidase.
[0097] As used herein, the term "c-GMP" as it relates to virus
production is an abbreviation of current good manufacturing
practice.
[0098] As used herein, the term "MPR" is an abbreviation of mannose
6-phosphate receptor.
[0099] As used herein, the term "NTP" is an abbreviation of
national toxicology program.
[0100] As used herein, the term "MEL Cells" is an abbreviation of
murine erythroleukemia cells.
[0101] As used herein, the term "LCR" is an abbreviation of locus
control region.
[0102] Essential Cis Elements and the Optimization of Vector
Design
[0103] As described herein, experimentation was conducted to
determine whether lentivirus non-coding cis-sequences played a
specific role in the RNA export, packaging or expression of
.beta.-globin. The vector life-cycle was studied in
self-inactivating (SIN)-lentiviruses, carrying the .beta.-globin
gene and locus control region (BG), or GFP cDNA. Systematic
analysis started with a completely `gutted` minimal SIN-lentivirus
carrying only the packaging region; and SIN-lentiviruses containing
increasing HIV cis-elements, along with a SIN-gamma-retrovirus. To
clone the sSIN-GFP vector, the 3'LTR of a standard SIN-LV backbone
previously used, as described herein, was modified to improve
transcript termination. Specifically, (3-growth hormone
polyadenylation signal was added downstream of the 3'LTR and a USE
sequence derived from SV40 late polyadenylation signal was added in
the U3 deletion.
[0104] As further described herein, SIN-gamma-retrovirus or a
gutted/minimal SIN-lentivirus encoding GFP generated high titers
and mediated high GFP expression. However, SIN-gamma-retrovirus or
the gutted SIN-lentivirus encoding either BG or a similar sized
large transgene had barely detectable titers compared to the
SIN-lentivirus carrying cis-elements. Systematic addition of
cis-elements demonstrated that Rev/RRE was most essential, followed
by gag and env splice acceptor sequences, for efficient
assembly/packaging of lentivirus particles, not mRNA export.
However, these HIV cis-sequences were dispensable for smaller
transgenes. These studies identify key lentivirus cis-elements and
the role they play in vectors carrying large inserts, and have
important implications for gene therapy.
[0105] In one embodiment, the present invention provides a method
of increasing titer of a modified SIN lentiviral expression vector
compared to a standard SIN lentiviral expression vector. In another
embodiment, the SIN lentiviral expression vector is modified by
inserting a heterologous polyadenylation (polyA) signal sequence
downstream from a viral 3' long terminal repeat sequence in a
standard SIN lentiviral vector backbone. In another embodiment, the
polyA signal is the bovine growth hormone polyA signal sequence. In
another embodiment, the SIN lentiviral vector is modified by
inserting one or more of an upstream polyA-enhancer sequence (USE
sequence) into a 3'LTR of a standard SIN lentiviral vector
backbone. In another embodiment, the USE sequence is derived from
the SV40 late polyA signal. In another embodiment, 2-10 copies of
the USE sequence are inserted into a 3'LTR of a standard SIN
lentiviral vector backbone. In another embodiment, 3-5 copies of
the USE sequence are inserted into a 3'LTR of a standard SIN
lentiviral vector backbone. In another embodiment, one or more
copies of the USE sequence is inserted into the U3 region. In
another embodiment, the 0-growth hormone polyA signal and one or
more copies of the USE sequence derived from the SV40 late polyA
signal are both incorporated into the expression vector. In another
embodiment, the expression vector contains a gene of interest
(GOI). In another embodiment, the gene is operably linked to a
promoter. In another embodiment, the promoter is a lineage-specific
promoter. In another embodiment, the promoter is an erythroid
specific promoter. In another embodiment, of the the GOI is
.beta.-globin. In another embodiment, the GOI is gamma-globin. In
another embodiment of the invention the gamma-globin gene is under
the control of .beta.-globin regulatory elements. In another
embodiment, the vector is used to treat sickle cell anemia via gene
therapy. In another embodiment, the vector is used in conjunction
with reduced intensity conditioning to treat sickle cell anemia. In
another embodiment, the SIN lentivirus comprises a bovine, equine,
feline, ovine/caprine or primate derived variety of lentivirus. In
another embodiment, the SIN lentivirus is an HIV derived SIN
lentivirus. In another embodiment the modified SIN lentiviral
vector is introduced into a eukaryotic cell by transfection.
[0106] In one embodiment, the present invention provides a method
of designing a gutted/minimal, and thus less recombinigenic and
safer SIN lentiviral vector for the expression of small therapeutic
transgenes that do not require extensive Cis elements for
efficiency. In another embodiment the small therapeutic transgenes
are equal in size or smaller than green fluorescent protein (GFP).
In another embodiment the small therapeutic transgenes are smaller
than human .beta.-globin.
[0107] Chromatin Insulator Elements
[0108] As described herein, chromatin insulator elements prevent
the spread of heterochromatin and silencing of genes, reduce
chromatin position effects and have enhancer blocking activity.
These properties are desirable for consistent predictable
expression and safe transgene delivery with randomly integrating
vectors. Overcoming chromatin position effects can reduce the
number of copies required for a therapeutic effect and reduce the
risk of genotoxicity of vectors. Vector genotoxicity has become an
area of intense study since the occurrence of gene therapy related
leukemia in patients in the X-SCID trials. Gamma-retroviral vectors
and lentiviral vectors have been modified to a self-inactivating
(SIN) design to delete ubiquitously active enhancers in the U3
region of the long terminal repeats (LTR). A 1.2 Kb DNAse
hypersensitive site-4 (cHS4) from the chicken p-globin locus has
been inserted in the 3'LTR to allow its duplication into the 5'LTR
in gamma-retrovirus and lentivirus vectors. Insulated vectors have
reduced chromatin position effects and, provide consistent, and
therefore improved overall expression. A side-by-side comparison of
cHS4 insulated and uninsulated lentivirus vectors carrying
h.beta.-globin and the locus control region was performed, and
resulted in the discovery that insulated vectors showed consistent,
predictable expression, regardless of integration site in the
differentiated progeny of hematopoietic stem cells, resulting in a
2-4 fold higher overall expression. Recent evidence also suggests
that cHS4 insulated lentivirus vectors may reduce the risk of
insertional activation of cellular oncogenes. Despite the
beneficial effects of insulated vectors, they also lead to a
significant reduction in titers with insertion of the full-length
1.2 Kb cHS4 insulator element in the 3'LTR of lentivirus vectors.
There are similar reports of lowering of viral titers or unstable
transmission with gamma-retrovirus vectors containing insertions in
the 3' LTR. This reduction in titers becomes practically limiting
for scale up of vector production for clinical trials, especially
with vectors carrying relatively large expression cassettes, such
as the human .beta.-globin gene (h.beta.) and locus control region
(LCR), that have moderate titers even without insulator
elements.
[0109] The effects of insertions of exogenous fragments into the
LTR on viral life cycle have not been addressed. The mechanism by
which insertion of cHS4, or other inserts in the viral 3'LTR lower
titers of lentiviral vectors was therefore studied. Large LTR
inserts lower titers via a post-entry restriction in reverse
transcription, and increased homologous recombination in the LTRs
of viral cDNA, thus reducing the amount of virus DNA available for
integration. These results have important implications for vector
design for clinical gene therapy. Studies on the chicken
hypersensitive site-4 (cHS4) element, a prototypic insulator, have
identified CTCF and USF-1/2 motifs in the proximal 250 bp of cHS4,
termed the "core", which provide enhancer blocking activity and
reduce position effects. However, the core alone does not insulate
viral vectors effectively. While the full-length cHS4 has excellent
insulating properties, its large size severely compromises vector
titers. A structure-function analysis of cHS4 flanking
lentivirus-vectors was performed and transgene expression in the
clonal progeny of hematopoietic stem cells and epigenetic changes
in cHS4 and the transgene promoter were analyzed.
[0110] As further described herein, the core only reduced the
clonal variegation in expression. Unique insulator activity resided
in the distal 400 bp cHS4 sequences, which when combined with the
core, restored full insulator activity and open chromatin marks
over the transgene promoter and the insulator. These data
consolidate the known insulating activity of the canonical 5' core
with a novel 3' 400 bp element with properties similar to the core.
Together, they have excellent insulating properties and viral
titers. This data has important implications with respect to
understanding the molecular basis of insulator function and design
of gene therapy vectors.
[0111] In one embodiment, the present invention provides a method
of increasing the titer of lentiviral vectors by incorporating one
or more reduced-length chromatin insulators containing functional
portions of a full-length chromatin insulator. In another
embodiment, the functional portions are derived from a single type
of full length chromatin insulator. In another embodiment, the
reduced-length functional insulator comprises functional portions
of two or more separate varieties of chromatin insulators. In
another embodiment, the functional reduced-length chromatin
insulator is derived from a chicken hypersensitive site-4 (cHS4)
element. In another embodiment, the functional reduced-length
insulator is a cHS4-derived insulator of 650 base pairs or less. In
another embodiment, one or more reduced-length cHS4-derived
insulators is combined with other modifications to a SIN lentivirus
expression vector in order to increase titer and improve stability
of transgene expression. In another embodiment, one or more
reduced-length cHS4-derived insulators is added to a vector
containing a heterologous polyadenylation (polyA) signal sequence
downstream from a viral 3'LTR and a USE sequence in the U3
deletion.
[0112] Erythroid Cells Function as an Effective Depot
[0113] As disclosed herein, restricting transgene expression to
maturing erythroid cells can reduce the risk of activating
oncogenes in hematopoietic stem cells (HSCs) and their progeny,
while taking advantage of their robust protein-synthesis machinery
for high-level protein production. An erythroid-specific hybrid
promoter can provide inducible expression and release of a
lysosomal enzyme, alpha-L-iduronidase (IDUA), during in vitro
erythroid differentiation in murine erythroleukemia cells. The
erythroid released IDUA can use the MPR lysosomal enzyme
trafficking system and can lead to phenotypic cross-correction in
an enzyme-deficient lymphoblastoid cell line derived from patients
with Mucopolysaccharidosis (MPS) Type I. Stable and higher than
normal plasma IDUA levels were achieved in vivo in primary and
secondary MPS I chimeras for at least 9 months after
transplantation of HSCs transduced with the erythroid-specific
IDUA-containing lentiviral vector (LV). Moreover, long-term
metabolic correction was demonstrated by normalized urinary
glycosaminoglycan accumulation in all treated MPS I mice. Complete
normalization of tissue pathology was observed in heart, liver and
spleen. Notably, neurological function and brain pathology were
significantly improved in MPS I mice by erythroid-derived,
higher-than-normal peripheral IDUA protein.
[0114] As further disclosed herein, these data are the first to
demonstrate that late-stage erythroid cells, transduced with a
tissue-specific LV, can deliver a lysosomal enzyme continuously at
supra-physiological levels to the bloodstream, and can correct the
disease phenotype in both viscera and CNS of MPS I mice. This
approach provides a paradigm for the utilization of red blood cell
precursors as a depot for efficient and potentially safer systemic
delivery of non-secreted proteins by ex vivo HSC gene transfer.
[0115] In one embodiment, the present invention provides a method
of genetically modifying an erythroid cell for utilization as a
depot to produce and expel proteins non-native to blood and/or not
conventionally secreted into blood circulation. In another
embodiment, modification is accomplished by transduction of an HSC
with a vector capable of providing long-term gene transfer. In
another embodiment, the vector comprises an erythroid specific
promoter and a gene of interest (GOI) operably linked to the
promoter. In another embodiment, the GOI encodes a protein
non-native to erythroid cells and/or not conventionally secreted.
In another embodiment, activation of the erythroid specific
promoter leads to expression and expulsion by an erythroid cell
offspring of a protein or proteins non-native to erythroid cells
and/or not conventionally secreted by erythroid cells. In another
embodiment, the expression results in a sustained release of high
levels of the protein in the blood circulation.
[0116] In one embodiment, the present invention provides a method
of genetically correcting a lysosomal storage disease and/or
reducing symptoms thereof. In another embodiment, the genetic
correction and/or reduction in symptoms is accomplished by
transducing a HSC with a vector comprising an erythroid specific
promoter and a gene encoding a corrective enzyme in an individual
with the lysosomal storage disease, wherein the gene is operably
linked to the promoter. In another embodiment, activation of the
erythroid specific promoter leads to expression and expulsion of
the corrective protein by an erythroid cell offspring, resulting in
correction of the disease and/or a reduction in symptoms. In
another embodiment, the lysosomal storage disease is MPS Type I. In
another embodiment, the lysosomal storage disease is Hurler
Syndrome. In another embodiment of the invention the GOI encodes
IDUA. In another embodiment, the expelled protein is a variety
imported into cells via receptor-mediated endocytosis. In another
embodiment, the mannose 6-phosphate receptor (MPR) pathway mediates
trafficking of the corrective enzyme. In another embodiment,
release of the corrective enzyme into the bloodstream corrects or
improves CNS abnormalities associated with a lysosomal storage
disease.
[0117] Determining Critical Parameters of Disease
Correction--Sickle Cell Anemia
[0118] As disclosed herein, lentiviral delivery of human
.gamma.-globin under .beta.-globin regulatory control elements in
HSCs results in sufficient postnatal HbF expression to correct SCA
in mice. The amount of HbF and transduced HSCs was then de-scaled,
using reduced-intensity conditioning and varying multiplicity of
infection (MOI), to assess critical parameters needed for
correction. A systematic quantification of functional and
hematologic RBC indices, organ pathology, and life span were
critical to determine the minimal amount of HbF, F cells, HbF/F
cell, and gene-modified HSCs required for reversing the sickle
phenotype.
[0119] As further disclosed herein, amelioration of disease
occurred when HbF exceeded 10%, F cells constituted two-thirds of
the circulating RBCs, and HbF/F cell was one-third of the total
hemoglobin in RBCs; and when approximately 20% sG.sup.bG modified
HSCs repopulated the marrow. Genetic correction was sustained in
primary or secondary transplant recipients followed long-term. The
present study describes a method of determining minimum HSC
chimerism for correction of a hematopoietic disease in an in vivo
model, which would contribute to design of cell dose and
conditioning regimens to achieve equivalent genetically corrected
HSCs in human clinical trials. Moreover, this study addresses, for
the first time, the gene dosage and the gene-modified hematopoietic
stem cell dosage required for correction of a genetic defect.
[0120] In one embodiment, the present invention provides a method
of determining minimum HSC chimerism for correction of a
hematopoeitic disease in an in vivo model. In another embodiment,
reduced intensity conditioning prior to transplantation is used as
a method of varying HSC chimerism. In another embodiment, the
proportion of transduced HSCs and vector copy/cell is varied by
transducing the cells at a range of MOI (30-100). In another
embodiment, the MOI is 20-120. In another embodiment, the minimum
determined chimerism and gene dosage can be used to design cell
dose and conditioning regimens to achieve equivalent genetically
corrected HSCs in human clinical trials. In another embodiment,
reduced intensity conditioning is used prior to transplantation in
a clinical setting to reduce transplantion-related morbidity. In
another embodiment, the hematopoeitic disease is sickle cell
anemia. In another embodiment, the hematopoeitic disease is
0-thalassemia.
[0121] Improved Vector Production
[0122] As disclosed herein, the need for clinical grade
gamma-retroviral vectors with self-inactivating (SIN) long terminal
repeats has prompted a shift in the method with which large scale
cGMP-grade vectors are produced, from the use of stable producer
lines to transient transfection-based techniques. A method was
developed based on the Wave Bioreactor.RTM. (GE Healthcare)
production platform. This platform allows for large-scale
closed-system production of high-titer retroviral vectors for
clinical trials using transient transfection up to 25 Liters per
harvest using closed system processing. The present study describes
the development and scale-up procedures and reports on the
successful use of the Wave Bioreactor in the production of six cGMP
grade retroviral vectors in support of the FDA's National
Toxicology Program (NTP).
[0123] As further disclosed herein, in order to determine the
optimal time of transfection, 293T cells were seeded onto FibraCel
and exposed to transfection reagents and plasmid DNA within hours
of seeding as compared to cells that were transfected the following
day. The data show a titer of less than 10.sup.4 IU/mL from cells
that were transfected one day post-seeding as compared to cells
that were transfected the same day. It has now been determined that
optimal titers are achieved when cells are mixed with transfection
reagents and plasmid DNA at the time of seeding onto FibraCel.
Cells were plated at different cell densities, harvested and tested
for virus production in five separate experiments using GALV
pseudotyped gamma-retroviral vectors. Although the same number of
cells was used for each group, titers varied greatly based on the
plating density and were higher when cells were harvested from
plates that had been seeded with a higher cell density. For
scale-up, several parameters were tested including the time of
media change post-transfection and the length of time the cells
were exposed to PBS and TrypLESelect prior to transfection. To
establish the amount of plasmid DNA necessary to improve titer,
293T cells were transfected side-by-side on tissue culture plastic
as well as FibraCel. Where increasing plasmid DNA in static
cultures produced a lower titer, increasing the DNA concentration
on FibraCel increased titer.
[0124] In one embodiment, the present invention provides a method
of improving viral titer in a transfection-based production system
using eukaryotic cells. In another embodiment, the cells harvested
prior to transfection have progressed beyond log phase of cell
growth. In another embodiment the cells have achieved a state of
confluency for at least 24 hours. In another embodiment, the cells
are seeded at a cell density of at least 5.times.10.sup.4 4 to 5
days prior to cell harvest and transfection. In another embodiment
the cells are mixed with transfection reagents and plasmid DNA at
the time of re-seeding into a new culture vessel. In another
embodiment, the plasmid concentration used for transfection is at
least 7 .mu.g/ml of plasmid DNA. In another embodiment, the plasmid
concentration used for transfection is at least 9.2 .mu.g/ml of
plasmid DNA. In another embodiment, the media is changed 12-24
hours post-transfection. In another embodiment, the media is
changed 14-20 hours post-transfection. In another embodiment, the
media is changed 19 hours post-transfection. In another embodiment,
cells are rinsed with PBS followed by 3-8 minute exposure to
TrypLESelect prior to transfection. In another embodiment, cells
are rinsed with PBS followed by 4-7 minute exposure to TrypLESelect
prior to transfection. In another embodiment, cells are rinsed with
PBS followed by 5 minute exposure to TrypLESelect prior to
transfection. In another embodiment, the harvesting, mixing,
re-seeding, and/or transfection steps, alone or in combination,
results in improved viral titer compared to traditional protocols
of transfection-based production using eukaryotic cells. In another
embodiment, the cells are 293T cells. In another embodiment, the
vector is a SIN lentiviral vector. In another embodiment, the
vector is a Gamma-Retroviral vector. In another embodiment, the
vector is a SIN Gamma-retroviral vector. In another embodiment, the
retroviral vectors produced are cGMP grade vectors. In another
embodiment, the vectors are produced in a closed system
bioreactor.
[0125] One skilled in the art will recognize many methods and
materials similar or equivalent to those described herein, which
could be used in the practice of the present invention. Indeed, the
present invention is in no way limited to the methods and materials
described. For purposes of the present invention, the following
terms are defined below.
EXAMPLES
[0126] The following examples are provided to better illustrate the
claimed invention and are not to be interpreted as limiting the
scope of the invention. To the extent that specific materials are
mentioned, it is merely for purposes of illustration and is not
intended to limit the invention. One skilled in the art may develop
equivalent means or reactants without the exercise of inventive
capacity and without departing from the scope of the invention.
Example 1
Lentivirus Cis elements Required for Efficient Packaging of Large
Transgenes Cassettes Like/.beta.-Globin
[0127] This study investigated whether lentivirus non-coding
cis-sequences played a specific role in the RNA export, packaging
or expression of .beta.-globin. The vector life-cycle was studied
in self-inactivating (SIN)-lentiviruses, carrying the .beta.-globin
gene and locus control region (BG), or GFP cDNA. Systematic
analysis started with a completely `gutted` minimal SIN-lentivirus
carrying only the packaging region; and SIN-lentiviruses containing
increasing HIV cis-elements, along with a SIN-gamma-retrovirus. It
was discovered that (i) SIN-gamma-retrovirus or a gutted/minimal
SIN-lentivirus encoding GFP generated high titers and mediated high
GFP expression. (ii) However, SIN-gamma-retrovirus or the gutted
SIN-lentivirus encoding either BG or a similar sized large
transgene had barely detectable titers compared to the
SIN-lentivirus carrying cis-elements. (iii) Systematic addition of
cis-elements demonstrated that Rev/RRE was most essential, followed
by gag and env splice acceptor sequences, for efficient
assembly/packaging of lentivirus particles, not mRNA export.
However, these HIV cis-sequences were dispensable for smaller
transgenes. These studies identify key lentivirus cis-elements and
the role they play in vectors carrying large inserts, and have
important implications for gene therapy.
Example 2
BG Expression from Gutted SIN-.gamma.RV
[0128] It has been postulated that .gamma.RV are unable to
successfully express h.beta.-globin due to transcriptional
interference between the strong .gamma.RV LTR promoter/enhancer
elements and the internal LCR enhancer. SRS11 .SF is a
SIN-.gamma.RV that encodes the GFP cDNA under control of an
internal Spleen Focus-Forming Virus (SFFV) promoter/enhancer. The
SFFV-GFP in SRS11.SF was replaced with BG, an expression cassette
that was successfully utilized in a standard SIN-LV to achieve
therapeutic h .beta.-globin expression in thalassemia, to generate
SRS11.BG. The rationale for using SRS.11, despite the notoriety of
.beta.-globin .gamma.RV was: (i) it contains the minimal packaging
region (.psi.), lacks gag sequences and can carry a larger vector
payload, yet retains extremely high titers; (ii) it carries a large
400 bp U3 deletion of the 3'LTR, comparable to the deletion in
SIN-LV. (iii) Large LCR elements have never been tested in
.gamma.RV due to restrictions on vector payload.
[0129] Infectious titers and expression of SRS11.BG and SRS11 .SF
.gamma.RV vectors were compared on the murine erythroleukemia (MEL)
cell line. Human p-globin protein expression was almost
undetectable from SRS11.BG-transduced MEL cells, in contrast to the
high expression of GFP in cells transduced with SRS.11 SF. The
unconcentrated viral titers of SRS11 BG versus SRS11.SF vector were
6.8.+-.5.times.10.sup.3 IU/mL versus 4.+-.0.2.times.10.sup.6 IU/mL.
Viral RNA (vRNA) transcripts were barely detectable in 293T cells
with the SRS11.BG via northern blot analysis (data not shown).
Therefore, production of BG vRNA and viral particles from
.gamma.RV, even those optimized for a SIN design and high vector
payload was severely impaired.
Example 3
Expression of Large/Small Transgenes from Standard or
Gutted/Minimal LV
[0130] In contrast to the SIN-.gamma.RV used herein, the "standard"
SIN-LV commonly used retains relatively large portions of viral
sequences amounting to about 20-25% of the HIV genome. These cis
elements are: the LTR (634 bp for wt HIV LTR or 235 bp for SIN-LV
LTR), the packaging signal .psi.(150 bp), 5' portion of the gag
gene (300 or 600 bp), env sequences including the rev response
element (RRE, 840 bp) and the central flap/polypurine tract (cPPT)
from the pol gene (120 bp).
[0131] To examine the requirement of cis-sequences for GFP versus
BG, the CMV-GFP cassette was cloned in a) the "standard" SIN-LV
containing cis sequences listed above (sSIN-GFP), and b) a `gutted`
minimal SIN-LV where the gag, RRE and the rest of the env sequences
were deleted and only the .psi. region was retained (dsSIN-GFP;
FIG. 1A). The titers of the minimal dsSIN-GFP LV were only 2-times
lower than the titers of the "standard" LV sSIN-GFP FIG. 1B;
p<0.01; n=3. In sharp contrast to the GFP vectors, the
difference in titers of the analogous standard and gutted BG
SIN-LV, sBG-6 and sBG-1 vectors was 1100-fold p<0.01; n=4; (FIG.
1B). Clearly, the LV non-coding sequences are necessary either for
production of LV particles and/or for .beta.-globin expression; and
these sequences have a pronounced effect on infectious titers of LV
encoding the .beta.-globin gene, but not those encoding GFP. Next,
vectors were constructed with a similar size transgene cassette,
CMV-FANCA-IRES-GFP (FIG) as sBG (FIG. 1A) in the "standard" (sFIG)
or the gutted (dsFIG) SIN LV. The same dependence of FIG on LV cis
sequences: titers of dsFIG vector were three orders of magnitude
lower than those of sFIG were observed (FIG. 1B). Therefore LV cis
elements are dispensable for small inserts, but necessary for high
titers of large inserts.
Example 4
LV Constructs Designed to Study the Role of Cis-Sequences
[0132] To study which particular LV cis sequences were important
for this effect, and what step of the vector life cycle they
affected, aseries of ten SIN-LV vectors were cloned; all of them
carrying the BG cassette but carrying different lentiviral
non-coding cis elements (FIG. 2). The rationale for studying
specific env (RRE and SA) and gag sequences in the context of BG
was: (i) The RRE element in the env fragment in a "standard" LV
facilitate transport of unspliced/singly spliced transcripts from
the nucleus following binding with the Rev protein. (ii) The env
splice sites play a fundamental role in the stability of vRNA and
its availability for packaging, and absence of known downstream
splice acceptor (SA) sequences results in cis-acting repressor
sequence (CRS) activity, which hinders cytoplasmic accumulation of
HIV-1 RNA. (iii) A portion of the gag gene is retained in vectors
to help vRNA packaging. Gag sequences promote folding of the RNA
secondary structure of the packaging signal, facilitate the
interaction of vRNA with Gag proteins during particle formation,
and are important for the dimerization of the vRNA. Sequences
mapped to the 5' splice donor site and the first 360 bp of the gag
gene direct unspliced and singly spliced viral mRNA to specific
subnuclear compartments from where it is exported with the help of
Rev/RRE.
[0133] The first vector (sBG-1) maintained only the packaging
signal (containing the 5' splicing donor site) and the cPPT/flap
(FIG. 2). Starting from this vector, the RRE, the rest of the env
fragment containing the SA, and two different size gag fragments
(360 bp and 630 bp) were sequentially cloned into sBG-2, sBG-3,
sBG-5 and sBG-6. To verify the activity of the splicing acceptor
(SA) the sequence in the env fragment was mutated by PCR
site-specific mutagenesis (sBG-4). In the last four vectors, the
entire env fragment including the RRE was first removed, leaving
only the long and short version of the gag fragments (sBG-9,
sBG-10); or additionally added RRE (sBG-7, sBG-8) downstream of the
long and short gag fragments.
Example 5
Viral Titers with Inclusion of Different HIV Cis Sequences
[0134] The vectors without the RRE element (sBG-1, sBG-9 and
sBG-10) had a concentrated titer ranging from
5.5.+-.2.1.times.10.sup.5 IU/mL to 1.7.+-.1.4.times.10.sup.6 IU/mL,
which was 2-3 orders of magnitude lower than vectors that carry the
RRE sequence (sBG-2 to sBG-8; p<0.01). Indeed when only the RRE
sequence was added to sBG-1 to generate sBG-2, the titer increased
by more than a 100-fold (5.5 .+-.2.1.times.10.sup.5 IU/mL versus
8.7 .+-.6.5.times.10.sup.7 IU/mL; p<0.01; FIG. 3).
[0135] Addition of the env fragment containing the SA site
increased vector titers 3-5 fold: 2.9.+-.0.9.times.10.sup.8 IU/mL
for sBG-3 versus 8.7.+-.0.7.times.10.sup.7 IU/mL for sBG-2
(p<0.01). This effect was specific to the SA, since titers of
sBG-4 vector, which contains the env sequence with a mutated SA
were 1.1 .+-.0.61.times.10.sup.8 IU/mL, and were similar to that of
sBG-2 carrying only the RRE (sBG4 vs. sBG-3 p<0.01). The
addition of a long and short fragment of gag to env (RRE and SA)
containing vectors sBG-5 and sBG-6, respectively, showed a further
increase in titers by .about.4-5 fold, with titers from sBG-6
reaching 6.3.times.10.sup.8 IU/mL (sBG-4 vs. sBG-5 and sBG-6
p<0.01). The data suggested that the longer portion of gag was
not necessary for high BG titers. However, titers of vectors
carrying only the short/long gag fragments, without the RRE and env
SA were low (sBG-9 and sBG-10), as compared to those containing the
RRE as well (sBG-7 and sBG-8; p<0.01). Titers of sBG-7, 8, 9,
and 10 ranged from 9.4.+-.4.7.times.10.sup.5 IU/mL to
1.4.+-.0.4.times.10.sup.8 IU/mL. Titers improved further by 3-5
fold with the inclusion of env SA. Thus, the gag fragment alone, or
the combination gag/RRE was not sufficient to confer optimal titers
to BG vectors, suggesting HIV-1 cis sequences acted
cooperatively.
[0136] To study whether the strong effect of the RRE on viral
titers was Rev-dependent, the sBG-6 vector was packaged with and
without Rev. In these experiments, the packaging system was changed
from 3-plasmid to a 4-plasmid system, wherein Rev and Gag-Pol were
provided from different plasmids. The titers of sBG-6 were
approximately 400-fold higher with Rev (3.8.+-.0.3.times.10.sup.7
IU/mL) than without the Rev protein
(9.4.times..+-.5.8.times.10.sup.4 IU/ml; p<0.01), showing that
interaction of Rev with RRE was necessary for high titers.
[0137] Taken together, these data indicate that HIV-1 Rev/RRE, gag
and env SA were critical for high titers of LV carrying a large
cargo such as BG or FIG, although they are dispensable for small
GFP based cassettes.
Example 6
Role of LV Cis-Elements In the Vector Life Cycle
[0138] In order to assess the role of LV cis-elements in proviral
stability and expression a genomic Southern blot analysis on
transduced MEL cells was performed.
[0139] Surprisingly, given previous difficulties with genomic
rearrangements of h.beta.-globin-containing .gamma.RV, only one
proviral band of the expected size was detected in most of the LV
FIG. 4A. Some low titer vectors were undetectable at the level of
sensitivity of a Southern blot. Subsequent northern blot analysis
in packaging cells confirmed that the expected full-length vRNA
transcripts were generated from all LV (FIG. 5A), confirming that
LV carrying the large BG cassette do not require cis-sequences for
stable transmission.
[0140] In order to determine whether LV cis-sequences affected the
level of expression of integrated BG proviruses, MEL cells were
transduced with vectors sBG-1 through sBG-10 at a range of
multiplicity of infection. Mean fluorescence intensity (MFI) was
compared in MEL cell pools with a similar percentage of
h.beta.-globin expressing cells (15-20%), except in vectors with
low titers, where only a small percentage of gene transfer could be
achieved. The MFI of the transduced MEL cell population was
comparable among all the vectors (ranging from 62 to 110 arbitrary
units), including that of the low titer vectors (FIG. 4B). Thus, LV
cis-elements did not play a major role in regulating the expression
of BG.
[0141] In order to determine the role of RRE, gag and env SA in
vRNA production and cytoplasmic export the steps of vector life
cycle that could impair generation of full-length vRNA in the
packaging cells, its subsequent cytoplasmic export, assembly and
packaging into vector particles was studied.
[0142] Total, cytoplasmic and nuclear RNA was fractionated from
293T packaging cells transfected with sBG-1 through sBG-10. FIG. 5A
shows a northern blot analysis on total RNA probed with
h.beta.-globin probe. Correctly size bands of intact vRNA from all
the vectors, including the vectors without the RRE were determined
(sBG-1, sBG-9 and SBG-10). The spliced and unspliced vRNA
transcripts were only present for the vectors sBG-3, sBG-5 and
sBG-6, since these vectors carry the env SA site. Thus, no
appreciable aberrant splicing occurred in any of the LV backbones,
confirming lack of recombination of the h.beta.-globin gene and LCR
elements, and contrasting results reported with .gamma.RV.
[0143] Significantly, all vectors with very low titers, including
sBG-1, sBG-9 and sBG-10 that do not contain RRE, produced vRNA in
quantities that were comparable to, or higher than the highest
titer vectors (sBG-5 and sBG-6). Since this finding was unexpected,
the northern blot was repeated in a separate experiment, with
fractionation of total and cytoplasmic RNA, with identical
results.
[0144] Rev/RRE has been best characterized for export of
full-length vRNA to the cytoplasm. Therefore, the next step was to
determine if RRE contributed to high titers via vRNA export.
Northern blot analysis showed similar amounts of vRNA in the
cytoplasm of analogous vectors without or with RRE (sBG-1 versus
sBG-2, sBG10 versus sBG-8, and sBG-9 versus sBG-7; FIGS. 5B). The
ratio of cytoplasmic RNA to total RNA in northern blots from two
separate experiments is shown in 6E. The cytoplasmic vRNA
transcripts were only 2-fold higher in sBG-2, when compared to
sBG-1. The converse was seen with sBG-10 and sBG-9 vectors, where
cytoplasmic vRNA transcripts were .about.2-fold higher than
analogous vectors sBG-8 and sBG-7, which contained the RRE. Since
the difference in titers between vectors with and without the RRE
was 2-3 orders of magnitude, RRE likely played a minimal role in
increasing nuclear export of vRNA transcripts via these
vectors.
Example 7
LV Cis-Elements, Including RRE Improve Packaging
[0145] The effect of cis sequences on the packaging efficiency was
next determined by analyzing vRNA, p24 levels and viral associated
reverse transcriptase (RT) in purified virus particles from all ten
vectors processed identically. FIG. 6A shows a representative dot
blot analysis of sBG1 through sBG-10 LV. The amount of vRNA
detected is proportional to the vector titer for most of the
vectors, as determined by phospho-imager analysis, indicating a
block in packaging efficiency in vectors lacking cis-sequences
(FIGS. 6B-C).
[0146] There were some exceptions that suggested cis-sequences may
have some effect on steps following target cell entry: RNA in 293T
cells and the infectious titers of sBG-2 and sBG-4 were comparable,
although sBG-4 vRNA was 4-times higher. It seems that sBG-4 vRNA,
even when packaged more efficiently, may not be stable post-target
cell entry due to the absence of env SA, which is known to
stabilize RNA. sBG-6 and sBG-7 had the same amount of vRNA but the
titer of sBG-7 was 4-5 times lower; here again sBG-7 did not have
the env SA. sBG-5, containing the inhibitory region of gag, had
higher vRNA, but lower titers.
[0147] Overall, the amount of BG vRNA packaged in viral particles
correlated with the transduction/infectious titers in target cells,
despite high levels of mRNA produced in packaging cells with all 10
vectors. The p24 activity was similar in all the concentrated virus
preparations (FIG. 6D), suggesting that viral like particles
(containing no vRNA) were formed efficiently with all vectors.
Example 8
.gamma.RV and LV Size, Payload and Titer
[0148] Titers of the standard LV carrying BG are low to begin with,
and require extensive concentration. However, the titers fall
precipitously (by three orders of magnitude) with the removal of LV
cis-elements. Perhaps these LV sequences protect large vRNA from
degradation in packaging cells while promoting assembly, while the
short GFP vRNA gets efficiently packaged without such requirements.
The low titer of the `gutted` BG LV are not from anti-sense RNA
arising from the .beta.-globin gene promoter inserted in the
reverse orientation with respect to the 5'LTR vRNA transcript in
293T cells. There was no antisense transcript in the northern blot
with any of the vectors. Besides, .beta.-globin transcripts are
erythroid-specific, and are not produced in 293T cells.
Furthermore, the FIG cassette that was similar in size to BG, but
in sense orientation also had the same effect on titers as BG.
Example 9
Cis Elements and Vector Life-Cycle
[0149] Several unique, rather unexpected results emerged from this
study: (i) in packaging cells, large amounts of transcripts were
produced with all BG LV in contrast to barely detectable RNA with
BG .gamma.RV. One possibility is that LV minimal sequences (R, U5
and .psi. regions) confer stability to BG vRNA in specific
sub-cellular compartments. Therefore, high amounts of vRNA are seen
in 293T cells even from the gutted LV, an essential difference from
the BG .gamma.RV. (ii) BG vRNA was of the expected size and
efficiently exported into the cytoplasm even in the absence of
Rev/RRE, contradicting the belief that the success of `globin
genes` in LV is secondary to the archetypal functions of RRE of
preventing splicing and vRNA export. (iv) vRNA was efficiently
packaged into virions when the gutted LV encoded a small transgene
such as GFP. This data confirms LV cis-sequences, other than the
minimal packaging sequence, are dispensable for small
transgenes.
Example 10
Role of RRE in Packaging
[0150] Rev/RRE interaction was most critical for packaging and high
titer virus production, while the well-established function of
Rev/RRE in the export of the genomic vRNA and suppression of
spliced message was not prominent in BG LV. In wild type HIV virus,
the presence of Rev/RRE is required along the entire mRNA transport
and utilization pathway for the stabilization, correct subcellular
localization, and efficient translation of RRE-containing mRNA. The
data presented here confirms and extends a recent study that shows
that RRE had a minor effect on cytoplasmic vRNA levels, but reduced
viral titers approximately 100-fold. It further shows that Rev/RRE
requirement is specific for large transgenes, but dispensable for
small expression cassettes. Unlike a previous report in the
literature, the present research did not see a role of RRE in vRNA
stabilization, since equal or higher amounts of vRNA was seen with
vectors without RRE. The likely mechanism is the capacity of RRE to
be involved in viral assembly and packaging.
Example 11
Role of env SA and gag Sequences
[0151] Presence of the env SA has been shown to stabilize the viral
genome, resulting in a higher virus production. Presence of SA may
also stabilize the vRNA at a post-entry level, since some vectors
without the env SA, when compared to analogous vectors with the env
SA had the same v-RNA but had lower transduction/titer in target
cells The gag sequence, with a start codon mutation to prevent the
translation of the gag protein, helps the production of LV during
viral packaging. In this study it was determined that this
requirement was specific to large transgene cassettes. It was also
demonstrated that removal of an inhibitory sequence present between
414 bp and 631 bp of the gag gene that has been previously shown to
decrease the stability of gag-containing RNAs, increased titers by
3.5-fold.
[0152] In conclusion, this research describes the steps in the
viral life-cycle affected by the non-coding cis-sequences when LV
encodes large transgene cassettes; and their dispensability for
smaller transgenes such as GFP. These results provide new insight
in the design of LV vectors. Gutted/minimal LV could be designed
for small therapeutic transgenes, which would be less
recombinogenic and safer in gene therapy applications.
Example 12
Viral Vector Design
[0153] LV: To clone the sSIN-GFP vector, the 3'LTR of a standard
SIN-LV backbone previously used was modified to improve transcript
termination: 0-growth hormone polyadenylation signal was added
downstream the 3'LTR and a USE sequence derived from SV40 late
polyadenylation signal was added in the U3 deletion. The dsSIN-GFP
was obtained by removing the ClaI-Nrul fragment from the sSIN-GFP
plasmid. A multi-cloning site (MCS-ClaI-Eco47III, XhoI, SmaI, SalI,
EcoRI: CCATCGATAGCGCTCTCGAGCCCGGGGTCGACGAATTCC (SEQ ID NO: 1)) was
cloned in the ClaI and EcoRI sites of sSIN. The .beta.-globin-LCR
(BG) cassette was cloned in reverse orientation into the XhoI and
SmaI sites and this parent construct was termed sSIN-BG. sBG-0 was
obtained removing the region between Eco47III and Nrul, leaving
behind only HIV-1 packaging sequence (.psi.) following the 5'LTR
from sSIN-BG. cPPT was cloned into sBG-0 Clal site (sBG-1). PCR
fragments for RRE, RRE-env, short gag (360 bp), long gag (630 bp)
were cloned in XhoI blunted site, and these vectors were termed
sBG-2, sBG-3, sBG-10, sBG-9, respectively. Primers sequences, where
F denotes forward primers and R denotes reverse primers:
TABLE-US-00001 RRE_F: (SEQ ID NO: 2) ATAAACCCGGGAGCAGTGGGAATA;
RRE_R: (SEQ ID NO: 3) ACATGATATCGCAAATGAGTTTTCC; ENV_R: (SEQ ID NO:
4) ACATGATATCATACCGTCGAGATCC; GAG_F: (SEQ ID NO: 5)
ACTGCTCTCGAGCAATGGGAAAAAATTCGGT; GAG_1R: (SEQ ID NO: 6)
ACTGCTCTCGAGGCAGCTTCCTCATTGATG; GAG_2R: (SEQ ID NO: 7)
ACTGCTCTCGAGATCAGCGGCCGCTTGCTGT.
[0154] A frame-shift mutation was inserted in the 5' sequence of
gag in the start codon to disable the gag start site, using the
primer Gag F that inserts the dinucleotide CA in the gag ATG.
Vectors sBG-7 and sBG-8 were obtained cloning long gag and short
gag PCR fragments into XhoI site of sBG-2. A point mutation to
disrupt the SA site in the env sequence was performed using MutSA_F
(TATCGTTTCGAACCCACCTCC (SEQ ID NO: 8)) and MutSA_R
(GGAGGTGGGTTCGAAACGATA (SEQ ID NO: 9)) primers to generate sBG-4
(the wt SA sequence CAG inside the Env fragment was mutated into
CGA). sBG-5 was obtained cloning the long gag PCR fragment into the
XhoI site of sBG-3. .gamma.RV: SRS11.SF .gamma.RV plasmid was
kindly provided by Drs. Axel Schambach and Christopher Baum,
(Hannover, Germany). In SRS11.BG vector, the human
.beta.-globin-LCR (BG), was cloned in reverse orientation into the
PstI site of SRS11.SF retroviral vector plasmid. All vector
cartoons are depicted in FIG. 2.
Example 13
Virus Production
[0155] LV was produced by transient co-transfection of 293T cells,
as previously described using the vector plasmids, the packaging
(48.9) and the envelope (VSV-G) plasmids; virus-containing
supernatant was collected at 60 hours after transfection and
concentrated by ultracentrifugation. All vectors in an experiment
were packaged simultaneously and the virus was concentrated
1400-fold from all viral supernatants by ultracentrifugation at
25,000 rpm. Viral titers were determined by infecting mouse
erythroleukemia (MEL) cellsor HT1080 cells with serial dilution of
concentrated virus, differentiating them, and analyzing them for
HbA or GFP expression by fluorescence-activated cell-sorter (FACS)
as previously described. .gamma.RV were produced similarly but not
concentrated. All transfections and subsequent titration were
performed in triplicate. Packaging of vectors, with and without
Rev, was performed following a similar method, except that the
packaging plasmid .DELTA.8.9 was replaced with pMDLg/pRRE and
pRSV-Rev. The ratio of vector plasmid:pMDLg/pRRE:pRSV-Rev:VSV-G was
4:4:3:1.
Example 14
Cell Lines
[0156] Murine erythroleukemia cell (MEL) line and 293T cells were
maintained in Dulbecco modified Eagle Medium (DMEM, Mediatech, Inc,
Herndon, Va.) supplemented with 10% heat inactivated fetal bovine
serum (FBS) (U.S. Bio-technologies, Inc, Parker Ford, Pa.). MEL
cells were induced to differentiate in DMEM containing 20%FBS and 5
mM N,N'-hexamethylene bisacetamide (Sigma), as previously described
in the art.
Example 15
HbA Staining and FACS Analysis
[0157] The methodology used to label human .beta.-globin using the
anti-human HbA antibody was as previously described. Briefly, cells
were fixed in 4% paraformaldehyde for 60 minutes at room
temperature, washed once with phosphate-buffered saline (PBS), and
the pellet resuspended in 100% methanol for 5 minutes. The fixed
cells were then washed with PBS, and nonspecific antibody (Ab)
binding was blocked using 5% nonfat dry milk for 10 minutes at room
temperature. Subsequently, cells were washed in PBS, pelleted, and
permeabilized. The cells were divided into 2 tubes and stained with
either anti-zeta globin-fluorescein isothiocyanate (FITC) Ab (1
.mu.g/10.sup.6 cells) as a negative control or anti-HbA-FITC Ab
(0.1 .mu.g/10.sup.6 cells) (Perkin Elmer, Waltham, Mass.) for 30
minutes at room temperature in the dark. Unbound Ab was removed by
a final wash with PBS before they were analyzed on FACS Calibur
(Becton Dickinson, Franklin Lakes, N.J.).
Example 16
Total and Cytoplasmic RNA Northern Blot
[0158] 293T cells were harvested and washed in PBS 72 hours after
transfection. Isolation of nuclear and cytoplasmic RNA is obtained
with a 7 minutes incubation on ice with NEB buffer (10 Mm Tris-HCl
pH 7.4; 10 mM NaCl, 3 mM MgCl.sub.2; 5% IGEPAL). After
centrifugation RNA-STAT (Tel-Test, INC, Texas) was added to the
supernatant that contains cytoplasmic RNA, and proceeded with RNA
extraction following manufacturer's instructions. Total RNA was
extracted from 293T cells using RNA-STAT. Northern Blot was then
performed according to standard protocol. The blot was hybridized
with a .sup.32P labeled .beta.-globin probe. To normalize the
loading of the RNA, membranes were then stripped and re-probed with
a .sup.32P labeled 18S probe. To test the purity of cytoplasmic RNA
membranes were stripped and re-probed with a .sup.32P labeled probe
specific for GAPDH intron probe that detected no intronic
transcript in the cytoplasmic preparation.
Example 17
Genomic Southern Blot
[0159] Genomic DNA was performed on DNA isolated from transduced
MEL cells and 10 .mu.g of genomic DNA was digested with AflII
enzyme and Southern Blot performed according to standard protocol.
The blot was hybridized with a HS2 fragment of the .beta.-globin
LCR probe. RNA dot blot vRNA was extracted from same volumes of
concentrated viruses using the QIAamp vRNA Mini Kit (Qiagen)
following the manufacturer's instructions. Briefly the virus was
lysed under highly denaturing conditions and then bound to a
silica-gel-based membrane. Two washing steps efficiently washed
away contaminants and vRNA was eluted in 30 .mu.l of DEPC-water.
After elution vRNA was treated for 20 min at room temperature with
DNAse I, amplification grade DNase I (Invitrogen, Carlsbad, Calif.)
was inactivated by incubating the sample at 65.degree.. vRNA was
then denatured in 3 vol of denaturation buffer (65% formamide, 8%
formaldehyde, MOPS 1.times.) for 15 min at 65.degree.. After
denaturation 2 vol. of ice-cold 20.times. SSC were added and the
RNA was bound to a nylon membrane by aspiration through a dot-blot
apparatus. The blot was hybridized with a .sup.32P labeled
.beta.-globin specific probe and an X-ray film was exposed
overnight.
Example 18
Chromatin Insulators--Generally
[0160] Chromatin insulators separate active transcriptional domains
and block the spread of heterochromatin in the genome. Studies on
the chicken hypersensitive site-4 (cHS4) element, a prototypic
insulator, have identified CTCF and USF-1/2 motifs in the proximal
250 bp of cHS4, termed the "core", which provide enhancer blocking
activity and reduce position effects. However, the core alone does
not insulate viral vectors effectively. The full-length cHS4 has
excellent insulating properties, but its large size severely
compromises vector titers. A structure-function analysis of cHS4
flanking lentivirus-vectors was performed and transgene expression
in the clonal progeny of hematopoietic stem cells and epigenetic
changes in cHS4 and the transgene promoter were analyzed. The core
only reduced the clonal variegation in expression. Unique insulator
activity resided in the distal 400 bp cHS4 sequences, which when
combined with the core, restored full insulator activity and open
chromatin marks over the transgene promoter and the insulator.
These data consolidate the known insulating activity of the
canonical 5' core with a novel 3' 400 bp element with properties
similar to the core. Together, they have excellent insulating
properties and viral titers. This data has important implications
with respect to understanding the molecular basis of insulator
function and design of gene therapy vectors.
Example 19
Vector Constructs and Experimental Design
[0161] Self-inactivating lentivirus vectors were designed to
incorporate either the 5' 250 bp "core" (sBGC), two tandem repeats
of the core (sBG2C), 5' 400 bp (sBG400), 5' 800 bp (sBG800) or the
full-length 1.2 Kb cHS4 insulator (sBG-I). All vectors carried the
human (h) .beta.-globin gene and promoter and the locus control
region enhancer. The different insulator fragments were cloned in
the forward orientation into the U3 region of 3' LTR, so that upon
reverse transcription, integrated provirus in target cells has the
insulated 3' LTR copied to the 5'LTR, and flanks the h.beta.-globin
expression cassette at both ends. To assess whether elements
outside the 5' 250 bp core merely provided a spatial scaffold,
vectors with inert DNA spacers downstream of the core, sBG400S and
sBG800S, were also tested. All vectors were compared to the
uninsulated control, sBG (FIG. 7A).
[0162] First, MEL cells were infected with each of the lentivirus
vectors and single integrant MEL clones were identified (FIG. 7B).
All analysis was performed only on single-copy MEL clones that
carried h.beta.-globin and verified to have intact insulator
sequences by PCR, and subjected to qPCR for vector copy number;
h.beta.-globin expression was analyzed by FACS: 1) the percentage
of h.beta.-globin expressing cells (% h.beta.+ cells) was used to
determine chromosomal position effects, and 2) the variation of
expression of h.beta.-globin expression in cells within a clone, as
determined by the coefficient of variation (CV), was used to
determine the clonal variegation in expression (FIGS. 7A and 7B).
ChIP analysis was performed on the histones over the insulator
regions and h.beta.-globin gene promoter in the different
proviruses to study epigenetic modifications. Chromatin position
effects of these vectors were confirmed in vivo, in RBC of Hbbth3/+
thalassemia mice transplanted with vector-transduced HSCs 24 weeks
after transplant. Secondary transplants were then performed and
single-integrant CFU-S following transplants were analyzed for
h.beta.-globin protein and mRNA. In mice, hematological analysis,
and HPLC for h.beta.-globin protein were additionally performed to
quantify expression.
Example 20
Regions of cHS4 Necessary to Protect from Chromatin Position
Effects
[0163] Consistent with previous results, a very high % of h.beta.+
cells were present in the sBG-I single-integrant clones compared to
control sBG clones (P<0.01); the % of h.beta.+ cells in sBGC,
sBG2C, sBG400 and sBG800 clones were not significantly different
from the sBG control clones (FIG. 8A) In order to ensure that the
presence of cHS4 in the LTR did not bias integration, and that the
analysis was performed on distinct clones, by LM PCR and
integration site sequencing on ten randomly selected sBG or sBG-I
MEL clones. Insertions occurred near/in distinct genes between
uninsulated and insulated clones, with no apparent bias. The
presence of the cHS4 core (sBGC), or extended sequences of the
insulator downstream to the core, up to 800 bp, did not increase
the % h.beta.+ cells further; neither did tandem repeats of the
core sequence, even though the latter has been shown to confer
enhancer blocking effect in plasmid-based systems.
[0164] Another phenomenon seen with transgene expression is clonal
variegation, defined as varying levels of expression in daughter
cells with the same integration site. A quantitative way to
determine clonal variegation is by FACS analysis of transduced
clones and calculation of the coefficient of variation (CV) of
expression of the transgene around the average expression of the
transgene in the clone. The CV is a unit-less measure of
variability calculated as ratio between sample standard deviation
(SD) and the sample average. A high CV was observed in the
uninsulated sBG clones (FIG. 2). The CV was significantly reduced
in all vectors that contained the 5' 250 bp core. These results
were confirmed in clones derived from vectors that carried inert
DNA spacers downstream of the core: sBG400S and sBG800S, showing
that the reduction in CV was specific to the insulator core, and in
contrast to the data on % of h.beta.+ cells, which required the
full-length insulator to be present.
[0165] It was notable that PCR for insulator sequences showed
absence of the insulator sequences only in sBG2C proviruses, with 6
of 24 clones (25%) MEL clones having both copies of the core
deleted from both LTRs. There was no observed deletion of the
insulator sequences in clones from all other vectors. Southern blot
analysis of sBG2C MEL pools confirmed deletion of one/both copies
of the core in the majority of cells. Reverse transcription of
repeat sequences, known to result in recombination events in
retroviral vectors likely caused unstable transmission of the
vector with repeat core sequences. This effect of the core versus
the full-length cHS4 was confirmed in vivo, in thalassemia mice.
Peripheral blood RBC were analyzed for h.beta.-globin expression 6
months following transplant. FACS analysis in RBC from sBG, sBGC,
sBG2C, sBG400 and sBG-I groups of mice (representative plots shown
in FIG. 9A) shows that the % h.beta.+ RBC were significantly higher
only in the sBG-I group of mice, compared to sBG group of mice,
like the data in MEL cells; and the CV was significantly lower in
all vectors that carried the core (P<0.01; FIGS. 9B-C). Taken
together, this data indicates that the full-length cHS4 is required
to shield against chromosomal position effects.
Example 21
Chromatin Position Effects In the Clonal Progeny of Murine HSC
Following Secondary Transplants
[0166] The chromatin position effects were next confirmed in single
copy secondary CFU-S. The secondary colony forming units-spleen
(CFU-S) assay is considered the most stringent assay that is a
`gold-standard` for studying epigenetic effects of chromatin
insulator elements in cells derived from hematopoietic stem cells.
Notably, no transduced CFU-S that was positive by PCR for
vector-specific sequences that did not express h.beta.-globin by
FACS were observed, consistent with results reported on lack of
transgene silencing with erythroid-specific SIN lentivirus vectors.
FACS analysis for (1) % h.beta.+ cells and (2) TER-119 positive
erythroblasts showed no difference in the percentage of TER-119+
cells between different vector groups (not shown). However,
significantly higher % of h.beta.+ cells were only present in
secondary CFU-S with the sBG-I vector. Again, the CV was
significantly lower in CFU-S transduced with all the vectors
carrying the core, compared to uninsulated sBG transduced CFU-S
(FIGS. 3A and 3B). Real-time RT-PCR analysis on six randomly
selected CFU-S from each group of mice showed that compared to the
sBG vector, mRNA expression from the sBG-I CFU-S was approximately
2-fold higher. However, expression from sBGC, sBG2C and sBG400
transduced CFU-S was not significantly different from that of sBG
CFU-S. Taken together, these data indicate that the 5' 250 bp core
sequences in sBGC, sBG400, sBG400S, sBG800 and sBG800S specifically
reduced the clonal variegation of h.beta.-globin expression.
However, the full-length cHS4 element was required for improved
probability of expression from different integration events.
Example 22
Patterns of Histone Acetylation and Methylation In the Core Region
and the .beta.-Globin Promoter Region In Insulated Vectors
[0167] Next the epigenetic modifications that accompany the
specific effects seen with the various insulator regions were
determined by comparing the relative levels of active histone marks
acH3, acH4 and H3K4me2 and repressive histone marksH3K9me3 and
H3K27me3 between different proviruses in MEL clones. ChIP analysis
was performed on the cHS4 core in three representative clones that
were pooled together for each vector (clones chosen are shown as
filled circles in FIG. 8A) by semi-quantitative PCR (FIGS. 10B-C)
and real-time PCR) (FIGS. 10D-F). Clones carrying the sBG-I vector
integrants showed approximately 6-fold enrichment of the active
chromatin marks and decreased repressive chromatin marks over the
cHS4 "core" fragment, compared to sBGC, sBG400 and sBG800, three
vectors that carried the "core".
[0168] Histone modifications were analyzed over the h.beta.-globin
promoter in the uninsulated vector (sBG) and all other vectors,
which carried the "core", to assess whether differences in histone
patterns over the transgene promoter in vectors may have
contributed to the reduced clonal variegation. There was a small
but significant reduction in repressive chromatin patterns H3K27me3
with sBGC, sBG400 and sBG800 proviruses, compared to the
uninsulated sBG provirus (FIG. 10F, right panel). However, with the
sBG-I provirus, where maximal insulator activity was present, the
h.beta.-globin promoter region had markedly reduced repressive
chromatin patterns.
[0169] These data show that the "core" sequences and extension of
the core up to the 5' 800 bp of cHS4 reduced activation marks over
the transgene promoter to a small extent. However, a major
reduction in repressed histone modifications over cHS4 and the
transgene promoter region only occurred when the distal 3' 400 bp
sequences of cHS4 were present in addition.
Example 23
Hematological Parameters In Thalassemia Mice Transplanted with HSCs
Transduced with Uninsulated and Insulated Vectors
[0170] The anemia, reticulocytosis and other RBC indices were
improved even with the sBG vector (FIG. 11A), consistent with
published reports with uninsulated h.beta.-globin lentivirus
vectors. Hemoglobin of mock-transplanted mice was 7.7.+-.0.2 gm/dL
and the sBG group of mice was 10.4.+-.0.7, with 1.2 vector copy per
cell. It was noteworthy that the sBG-I group of mice had higher
hemoglobin and the lowest reticulocyte count, despite having half
the vector copies per cell compared to the sBG group of mice
(hemoglobin 11.+-.0.2 gm/dL; 0.6 vector copies per cell). When
normalized for transduction efficiency, this amounts to a 5.2 gm
increase in hemoglobin per vector copy in sBG-I mice over mock
mice, in contrast to a 2.3 gm increase in hemoglobin per vector
copy in the sBG mice. RBC parameters from the experimental mice
showed significant improvement (FIG. 11A; note that these data are
not normalized for number of vector copies). Improvement in these
indices was highest with the sBG-I mice, albeit not significantly
different unless normalized for vector copy.
[0171] HPLC analysis for h.beta.-globin protein in blood confirmed
significantly higher h.beta.-globin expression only in the sBG-I
mice: 43.+-.3% of the total hemoglobin in RBC was derived from
h.beta.-globin (h.beta.2m.alpha.2) in sBG-I mice as compared to
19.+-.6% in the sBG mice, while that in sBGC, sBG400 and sBG2C
group of mice was not significantly different from control (FIG.
11B). Human h.beta.-globin expression and hematological parameters
in the sBG2C group of mice were similar those seen in the
uninsulated control group.
Example 24
Insulator Activity In the 3'400 cHS4 Region
[0172] Since the 5' 800 bp of cHS4 only reduced the CV, while full
insulator activity was restored with the full-length 1.2 Kb
insulator. A vector was generated carrying only the distal/3' 400
bp region of the cHS4 (sBG3'400) derived MEL clones and mice were
transplanted with sBG3'400-transduced LSK cells. Note that unlike
vectors described earlier, this vector does not contain the 5'250
bp "core" sequences (FIG. 12A). The sBG3'400 vector had no effect
on % of h.beta.+ cells in MEL clones or the % h.beta.+ RBC in mice
(FIGS. 6B,D), an effect comparable to sBG clones, or those carrying
the 5' 250 bp "core" (sBGC). However, like all vectors carrying the
5' core, sBG3'400 significantly reduced the CV of h.beta.-globin
expression in MEL clones and in RBC (FIGS. 12C,E).
[0173] The amount of h.beta.-globin protein in the sBG3'400 mice,
determined by HPLC analysis, was not significantly different from
sBG (17.5.+-.3% versus 19.5.+-.5.6%), but was at least 2-fold lower
than that seen in the sBG-I mice (43.+-.3%; P<0.01) (FIG. 12F).
Overall, the 3' 400 bp of cHS4 had activity that was very similar
to the 5' 250 bp core (FIG. 9): it reduced clonal variegation,
reflected in a reduced CV of h.beta.-globin expression in MEL
clones and in RBC, but had no effect on the proportion of
h.beta.-globin expressing red cells. "Core-like" effects of the 3'
400 bp in individual single copy secondary CFU-S (FIG. 12G), were
confirmed, with results similar to those with the sBGC vector
(FIGS. 9D-E). The 3' 400 region has no known consensus sequences
for CTCF or USF-1, and this region has not been previously
analyzed. It was noteworthy that neither the 5' core, nor the 3'
400 bp, when present alone, were able to improve the probability of
expression of integrants/protect from position effects.
Example 25
Insulator Activity of the 5' "core" combined with the 3' 400 bp
[0174] When the 5' 250 bp core and the 3' 400 bp sequences of cHS4
insulator (sBG650 vector; FIG. 13A) were combined, this vector
performed similarly to the sBG-I vector--in MEL clones, in RBCs of
transplanted mice and in secondary CFU-S. The proportion of
h.beta.-globin expressing cells in sBG650 MEL clones and RBC (FIGS.
13B-D) was significantly higher compared to sBG clones
(P<0.001), and was similar to sBG-I clones. Likewise, the CV of
the sBG650 clones was comparable to sBG-I clones (FIG. 13C). The
h.beta.-globin expression in the RBC of primary mice was comparable
to sBG-I mice (FIG. 13D). The amount of h.beta.-globin protein in
the sBG650 mice, determined by HPLC analysis, was not significantly
different from sBG-I mice (41.+-.2.6% versus 43.+-.3%,
respectively), but was at least 2-fold higher than that seen in the
sBG mice (19.+-.6%; P<0.01). Five months after transplant,
secondary transplants were performed to generate CFU-S, which
confirmed that the sBG650 vector restored insulator activity
similar to that seen with sBG-I vector (FIG. 13E). The chromatin
configuration over the core in sBG650 proviruses (FIG. 13F) showed
restoration of open chromatin patterns both over the insulator core
and the .beta.-globin promoter, identical to those seen in the
sBG-I proviruses (FIG. 10).
Example 26
Epigenetic Modifications In the 3'400 bp Region of cHS4 and its
Interaction with the Core
[0175] The chromatin configuration of the distal 3' 400 bp portion
of cHS4 have not been previously studied. The histone patterns were
first analyzed over the 3' 400 bp region (sBG3'400) when present
alone (sBG3'400), or when in combination with the 5' core (in
sBG650 and sBG-I) (FIG. 14). The acetylation and methylation
patterns of the histones in the 3'400 region of sBG3'400 provirus
(FIG. 14B) were similar to those seen in the 250 bp core region in
the sBGC provirus (FIG. 10). However, in sBG650 and sBG-I
proviruses, the 3' 400 bp sequences had increased acetylation marks
and reduced repressive, showing once again, that the combination of
the proximal and distal ends of cHS4 is necessary for open
chromatin patterns. This effect was remininscent of the ChIP
analysis over the 5' core region or the .beta.-globin promoter
region in sBG-I (FIGS. 10D and F) or sBG650 (FIGS. 13F and G).
Taken together, the genetic and epigenetic analysis indicated that
the 5' and 3' ends of the insulator were functioning as two cores,
which interacted for epigenetic modifications of chromatin on the
insulator and promoter, to impart adequate insulator activity.
[0176] The 3' 400 bp region, however, has no known CTCF or USF-1
motifs, that have been shown to impart enhancer blocking and
barrier activity, respectively, to cHS4. It is conceivable; however
that CTCF and/or USF-1 may perhaps be recruited to the 3'400
region. Using antibodies to USF-1 and CTCF, chromatin was
immunoprecipitated from sBGC, sBG3'400, sBG650 and sBG-I proviruses
from MEL clones. ChIP analysis was performed using
semi-quantitative PCR and qPCR. When primers to the core region
were used to amplify ChIP products, CTCF and USF-1 recruitment to
the 5' core region was evident (FIGS. 14C-D), as anticipated and
shown previously. Interestingly, when 3'400 region primers were
used to amplify the ChIP products, the sBG3'400 provirus showed
enrichment for CTCF, albeit at somewhat lower levels than that seen
over the core region. More notably, however, the sBG650 and sBG-I
proviruses showed enrichment both USF-1 at the 3' 400 bp region, an
effect seen when both the proximal core and the distal 400 bp
sequences were present. The 3' 400 bp region, when present alone in
sBG3'400, did not bind USF-1 (FIGS. 14E-F). These data indicate
that the 3' 400 bp region interacts with CTCF despite lack of the
CCCTC consensus, which may explain the "core-like"activity in this
region and the interaction between the 5' core region and the 3'
400 region of the cHS4 insulator (in sBG-I or sBG650) likely occurs
via USF-1.
Example 27
Vector Titers with the 650 bp cHS4 Insulator
[0177] The 1.2 Kb cHS4 remarkably lowers titers of SIN-lentivirus
vectors, limiting large-scale virus production for human trials. It
has been recently shown that the mechanism of reduction in titers
is specifically due to the length of the insert in the 3 'LTR.
Compared to sBG, sBG650 had very reasonable titers that were only
2.5.+-.0.9 fold lower than sBG, in contrast to 10.4.+-.2 fold lower
titers of sBG-I (n=3). Therefore, this optimized insulator can be
used for the design of safer gene therapy vectors which would
provide uniform and therefore higher expression and be scalable to
large-scale production.
[0178] The full-length cHS4 insulator has been previously shown by
us and by others to protect viral vectors against chromosomal
position effects. The profound deleterious effects on viral titers
however, have precluded its utility. Attempts to use only the 5'
250 bp of cHS4, characterized to be the core of the insulator, have
failed in viral vectors despite significant activity of the core in
plasmid based systems, and loss of insulator activity with
mutations in these regions.
[0179] Regions surrounding the cHS4 insulator and .beta.-globin
promoter have been shown to constitutively higher marks of active
chromatin in the native location. The cHS4 prevents the spread of
heterochromatin to the .beta.-globin domain, even when adjacent
heterochromatin domains have high repressive histone marks, H3K9me3
and H3K27me3. Clones carrying the sBG-I vector integrants showed an
enrichment of the active chromatin marks and a striking decrease in
repressive chromatin marks over the cHS4 core compared to sBGC,
sBG400 and sBG800 vectors, where no significant differences in
these epigenetic marks were observed.
[0180] Mechanistically, the USF-1/2 element in the insulator has
been shown to recruit histone modifying enzymes to the core, and
interact with histone lysine methyl transferase SETT/9 and
p300/CREB-binding protein-associated factor (PCAF), thus increasing
active chromatin marks. However, No such increase was observed in
acH3, acH4 and H3K4me2 over the core or the 3' 400 bp when they
flanked the transgene in the sBGC, sBG400, sBG800 and sBG3'400
vectors. This effect required the vector carrying the full length
cHS4 (sBG-I, FIGS. 10 and 14) or both the core and 3'400 bp
combined sBG650 vector (FIGS. 13 and 14). ChIP analysis over the
h.beta.-globin promoter showed that compared to an uninsulated
vector, the core alone reduced repressive chromatin marks over the
promoter to some extent (FIG. 10F), which may account for the
reduction in CV from vectors carrying the core. However, the core
was dependent on the 3' 400 bp region and conversely, the 3' 400 bp
region dependent on the core for the high degree of histone
acetylation and absent to minimal repressive marks over both these
regions.
[0181] Models proposed to explain the effect of the cHS4 on
surrounding chromatin include protection against transgene
silencing by exclusion of methyl-CpG-binding proteins; indeed, cHS4
has been shown to block silencing by retroviral vectors. No
extinction of .beta.-globin expression over time was observed, even
with the uninsulated vector in mice, or MEL clones maintained up to
6 months in culture (data not shown) This may be due to several
USF-1 elements in the .beta.-globin LCR hypersensitive sites, that
have been shown to interact with the E-box elements located in HS2
and in the .beta.-globin gene promoter. It is conceivable that this
resistance to silencing conferred by the LCR may override any
activity seen with the cHS4 core. These results contrast those by
Panell et al that retroviruses including those derived from HIV-1,
dominantly silence a linked locus control region (LCR) beta-globin
reporter gene in transgenic mice. Methylation was analyzed and it
was subsequently reported that there was a lack of CpG methylation
and extinction in expression with erythroid-specific SIN-lentivirus
vectors in vivo, in primary and secondary recipients. This data
suggests that in erythroid vectors, which otherwise resist
silencing via promoter methylation, the full-length cHS4 was able
to modify the histone patterns over the transgene promoter, and
over itself to reduce position effects.
[0182] Intriguingly, the in silico analysis of the 3' 400 bp region
revealed no CTCF or USF1 binding sites, but sites for multiple
known transcription factors. Any of these transcription factors, or
perhaps a novel protein may be the interacting partner with the
CTCF and/or USF-1. CTCF directly regulates the balance between
active and repressive chromatin marks via binding to the cohesin
complex. This data reveals that the 3' 400 bp region can also
interact with CTCF: although co-immunoprecipitate the 3'400 bp and
CTCF from the sBG3'400 provirus (FIGS. 14C-F) was unsuccessful.
[0183] Interestingly, the 3'400 bp co-immunoprecipated with USF-1
antibody only when the 5' core sequences were additionally present,
suggesting that USF-1 likely forms a bridge between the 5' and 3'
end of cHS4 to reduce position effects. Whether elements within the
3' 400 bp recruit histone acetylases that bind USF-1 or cohesin
and/or nucleophosphmin complexes to affect position effects would
be important to determine.
[0184] Ultimately, a systematic genetic and epigenetic analysis of
insulator activity of the cHS4 in vitro and in vivo was performed
and novel "core-like" activity in the 3' 400 bp was identified. The
3' 400 bp of cHS4, which contains no consensus sites for USF or
CTCF, nevertheless binds CTCF, while USF-1 appears to bind and
bridge the 5' core and the 3' 400 bp of cHS4. New vector systems
flanked by the optimized `650 bp` cHS4 sequence, can provide
excellent insulation of the transgene without significant loss in
viral titers and have important safety and efficacy implications
for gene therapy.
Example 28
Materials and Methods-Lentivirus Vectors
[0185] All vectors were obtained by cloning the different insulator
fragments into NheI/EcoRV sites in the U3 3'LTR region of the
lentivirus plasmid, as described. This plasmid carried the human
(h) .beta.-globin gene and its regulatory elements (BG). All
insulator fragments were amplified by PCR using the insulator
plasmid pJCI3-1 (kindly provided by Dr. Gary Felsenfeld, NIH, MD)
and verified by sequencing, as described. Cloning of the
h.beta.-globin vector with and without the 1.2 kb cHS4 insulator
has been described previously. The sBG1C vector was cloned by
inserting EcoRI/XbaI 250 bp core insulator PCR product into sBG
into BamHI/EcoRI restriction sites of the pBS plasmid. A second
copy of the 250 bp core was then added into the pBS 1-core plasmid
into EcoRI/KpnI sites, thus obtaining the pBS 2-core plasmid. The
two tandem copies of the 250 bp core were then isolated digesting
the pBS-2core plasmid with KpnI/XbaI, and then cloned into the sBG
vector, obtaining sBG2C. The sBG400 and sBG800 vectors were
obtained by cloning the 2 PCR products into the sBG NheI/EcoRV
sites. The vectors containing DNA spacers were obtained amplifying
different sizes of k-phage DNA using the following primer
combinations: spacerF1 and spacerR1, spacerF1 and spacerR2,
amplifying 150 bp, 550 bp k-DNA, respectively. ClaI/EcoRI digested
PCR fragments were ligated into EcoRI/ClaI sites in the pBS-1 core
plasmid, and 400 bp and 800 bp fragments from the pBS-1 core
plasmid were restricted with HincII/XbaI and XbaI/XhoI,
respectively, and cloned into NheI/EcoRV sites of sBG. Virus was
produced by transient co-transfection of 293T cells and titrated on
MEL cells.
Example 29
Materials and Methods-Cell Lines
[0186] MEL cells and 293T cells were maintained in DMEM (Mediatech,
Inc) supplemented with 10% heat-inactivated fetal bovine serum
(FBS; U.S. Bio-technologies, Inc.) and differentiated as described.
MEL cells were transduced to achieve less than 5% transduction
efficiency for each of the vectors tested and cloned. Approximately
400 clones, derived from three independent transductions from each
vector were screened by PCR for h.beta.-globin gene; positive
clones were screened for an intact insulator region. Clones thus
identified were then subjected to qPCR for single integrants,
expanded and cryopreserved. An entire set of clones was thawed,
differentiated and analyzed concurrently by FACS.
Example 30
Materials and Methods-Murine Hematopoietic Stem Cell Transduction
and Transplants
[0187] Hbbth3/+ thalassemia mice were used for transplants. All
animal studies were done using protocols approved by the
Institutional Animal Use and Care Committee. Enrichment of
lineage--Sca-1+c-kit+(LSK) hematopoietic stem/progenitor cells was
performed on single cell suspension of bone marrow by
immunomagnetic separation and FACS sorting (details in
supplementary Materials and Methods S1) LSK cells were transduced
in Stem Span (Stem Cell Technologies Inc, Vancouver, BC) with
concentrated vector supernatants at an MOI of 10, twice at 12 h
intervals as previously described. 10,000 transduced LSK cells were
co-transplanted with 2.times.105 LK cells into 10.75Gy irradiated
thalassemia recipients. CFU-S assay: Discrete spleen colony forming
units (CFU-S) were dissected at day 12 after transplant of bone
marrow cells from primary mice 24wk after transplant, as described
earlier.
Example 31
Materials and Methods-Analysis for h.beta.-Globin Expression
[0188] Complete blood counts were performed on a Hemavet (Drew
Scientific, Inc, Oxford, Conn., USA). Reticulocyte count was
analyzed by staining 10 of whole blood with 2000 of Retic-COUNT
reagent (BD Biosciences, CA) and enumerated on the FACSCalibur
(BD). Quantitative analysis of h.beta.-globin protein in RBC was
performed on hemolysates of blood by high performance liquid
chromatography (HPLC), as previously described and mRNA analysis
quantified by real-time RT-PCR using validated primers and probes
specific to h.beta.-globin (ABI Biosystems) using murine
.alpha.-globin for normalization. FACS analysis following
intracellular staining for h.beta.-globin was done as described
before.
Example 32
Materials and Methods--Chromatin Immunoprecipitation (ChIP)
[0189] ChIP analysis was performed on MEL clones as described with
minor modifications. Briefly, DNA samples from input and
antibody-bound chromatin fraction were analyzed by qPCR using SYBR
green (Applied Biosystems) using primer sets in triplicate, and
data analyzed as previously described. The enrichment ratio was
determined by calculating the ratio of DNA-ChIP to DNA-input and
histone modification data normalized to the "no antibody" (IgG)
control and primers corresponding to the necdin 5' region and
promoter region, as controls for repressed chromatin, to normalize
the efficiency of immunoprecipitation. All the DNA-ChIP to
DNA-input ratios were calculated as: 2[Ct (Input)-Ct (ChIP)]
divided with [dilution rate (ChIP)/dilution rate (Input)]. Ct
values of all PCR products were determined by the SDS 1.2 software
(Applied Biosystems). Mean and SEM values were determined for the
fold difference, and two-tailed paired t tests to determine
statistical significance (p<0.05).
Example 33
Materials and Methods-Integration Site Analysis
[0190] Ligation-mediated (LM) polymerase chain reaction was
performed as described by Modlich et al to map integration sites
using primers and conditions described (Arumugam, Mol Ther 2009, in
press citation).
Example 34
Materials and Methods-Statistical Analysis
[0191] Vectors were compared to the sBG vector Student's `t` test
(unpaired and two tailed). ANOVA (Dunnett multiple comparison test)
was also performed between groups for multiple comparisons. Data
was expressed as mean .+-.SEM. P<0.05 was considered
significant.
Example 35
Self-Inactivating Lentiviruses Flanked By the 1.2 Kb Chicken
Hypersensitive Site-4 Insulator Element (cHS4) Provide Consistent,
Improved Expression of Transgenes, but have Significantly Lower
Titers
[0192] Self-inactivating lentiviruses flanked by the 1.2 Kb chicken
hypersensitive site-4 insulator element (cHS4) provide consistent,
improved expression of transgenes, but have significantly lower
titers. Lengthening the lentivirus transgene cassette by an
additional 1.2 Kb by an internal cassette caused no further
reduction in titers. However, when cHS4 sequences or inert DNA
spacers of increasing size were placed in the 3'LTR, infectious
titers decreased proportional to the length of the insert. The
stage of vector life-cycle affected by vectors carrying the large
cHS4 3'LTR insert was compared to a control vector: There was no
increase in read-through transcription with insertion of the 1.2 Kb
cHS4 in the 3'LTR. Equal amount of full-length viral mRNA was
produced in packaging cells and viral assembly/packaging was
unaffected, resulting in comparable amounts of intact virus
particles produced by either vectors. However, lentiviruses
carrying cHS4 in the 3'LTR were inefficiently processed following
target-cell entry, with reduced reverse transcription and
integration efficiency, and hence lower transduction titers.
Therefore, vectors with large insertions in the 3'LTR are
transcribed and packaged efficiently, but the LTR insert hinders
viral-RNA processing and transduction of target cells. These
studies have important implications in design of integrating
vectors.
Example 36
Increased Length of the Vector Genome by 1.2 Kb Does Not Affect
Viral Titers
[0193] One objective of the study was to determine if reduction in
titers by cHS4 was secondary to additional lengthening of the viral
genomes in the otherwise large hp-LCR (BG) lentivirus vector. Large
viral RNA genomes are known to be packaged less efficiently in
integrating vectors. Replication competent gamma-retroviruses
delete added sequences and recombine to revert back to their
original viral size. In gamma-retrovirus vectors that exceed the
natural size of the virus, reduction in titers occurs at multiple
steps of the viral life cycle--generation of full length genome,
viral encapsidation/release and post-entry recombination events.
Notably, BG lentiviruses contain transgene inserts of .about.7 Kb,
and therefore do not produce viral-RNA genomes larger than the
natural size/packaging capacity of the wild type HIV-1 virus. In
lentivirus vectors, however, lowering of viral titers from
transgene inserts 6 Kb or larger has been shown to occur from
reduced packaging efficiency.
[0194] Uninsulated vectors BG and BGM were recently compared with
analogous insulated vectors BG-I and BGM-I for position effects.
The BG lentivirus vector carries the h.beta. and LCR, while a
similar vector BGM additionally carries a PGK promoter driven
methylguanine methyl transferase (P140K) cDNA (PGK-MGMT) insert
downstream of the hp-LCR. The PGK-MGMT cassette is 1.2 Kb in size.
The BG-I and BGM-I vectors carry the 1.2 Kb cHS4 insulator in the
3'LTR in addition. Virus was produced and processed identically
from all four vectors and infectious titers were determined, as
previously described. The titers of the concentrated BG vector were
2.+-.0.5.times.10.sup.8 IU/mL, while that of BGM, carrying an
additional 1.2 Kb internal cassette were slightly higher at
5.+-.0.8.times.10.sup.8 IU/mL (n=4). In contrast, addition of the
1.2 Kb cHS4 in the 3'LTR to the BG vector, termed BG-I resulted in
reduction in titers by nearly 6-fold to 3.8.+-.0.8.times.10.sup.7
IU/mL. A further addition of a 1.2 Kb PGK-MGMT internal cassette to
the BG-I vector, termed BGM-I, did not reduce the titers any
further (FIG. 20B). These data indicate that cHS4 insertion into
the LTR, and not overall viral genome size reduced viral titers.
Ramezani et al observed a 3-fold reduction in lentivirus titers
when the 1.2 Kb cHS4 was inserted in lentivirus vectors encoding
relatively small transgene expression cassettes (2 Kb in size or
less). The present data is consistent with their results, although
indicating a 6-10 fold reduction in titers with the addition of
cHS4. It was additionally observed in the present study that
reduction in titers by insertion of insulator elements in the LTR
occurred by a distinct mechanism that was not dependent on the
increased size of the viral genome.
Example 37
The Size of the Insert in the 3'LTR is Responsible for Reduction in
Titers
[0195] Although the LV vectors used did not exceed the natural size
of the HIV-1 virus, the size of the cHS4 insert (1.2 Kb) exceeded
the natural size of the wild type LTR (note that the wt LTR carries
an additional 400 bp U3 enhancer, which is deleted from the
self-inactivating 3'LTR). Experimentation was conducted to
determine whether lowering of viral titers was due to lengthening
of the SIN LTR beyond its natural capacity (400 bp), or whether
titers were lower due to specific sequences in the insulator, which
may potentially affect viral-RNA folding/binding to cellular
proteins and thus limit packaging. A series of p-globin vectors
were constructed in a self-inactivating lentivirus backbone, sSIN,
carrying different length fragments of cHS4 in the 3'LTR (FIG.
15a): the first 250 bp of the insulator, also called the core, a
400 bp cHS4 fragment, matching the size of the U3 promoter/enhancer
deletion in the 3' SIN LTR, and a 800 bp cHS4 fragment, to generate
sBG.sup.C, sBG.sup.400, sBG.sup.800 vectors, respectively. These
vectors were compared to an analogous `uninsulated` vector, sBG,
and a vector carrying the full-length 1.2 Kb insulator, sBG-I. In
addition, a vector was cloned with two copies of the core as tandem
repeats (250 bpx2), sBG.sup.2C. The cHS4 core has been shown to
have 50% of enhancer blocking activity of the full length (1.2 Kb)
insulator; the effect of the core has been shown to be copy
number-dependent, with tandem repeats of cHS4 core reported to have
the same insulating capacity as the full length 1.2 Kb cHS4.
[0196] Virus was generated from sBG, sBG.sub.C, sBG.sup.400,
sBG.sup.2C, sBG.sup.800, sBG-I plasmids by concurrent transient
transfections and concentration, and titered by flow cytometry of
mouse erythroleukemia (MEL) cells infected with serial dilutions of
the viruses, as described. MEL cells support adult type globin
production. Each experiment was replicated four times.
[0197] It was determined that as the size of the cHS4 insert in the
3'LTR increased, viral titers dropped (FIG. 15b). There was a
slight, but statistically significant reduction in titers with
inserts of 250 bp and 400 bp. However, titers fell sharply
thereafter, proportional to the length of the insulator fragment
(FIG. 15b). The titers of the vector with a 1.2 Kb full-length cHS4
insulator, sBG-I were an order of magnitude lower than the
uninsulated control vector, sBG. Of note, sBG.sup.2C vector, with a
tandem repeat of two cHS4 core sequences (500 bp insert) had titers
similar to sBG.sup.800.
[0198] To ensure that reduction in titers was not from specific
cHS4 sequences but an effect of the size of the LTR insert, three
additional vectors were constructed, sBG.sup.400-S, sBG.sup.800-S
and sBG.sup.1200-S. These vectors were analogous to sBG.sup.400,
sBG.sup.800 and sBG-I, except that they contained spacer elements
from the A phage DNA downstream of the cHS4 core to generate 3' LTR
inserts of 400 bp, 800 bp and 1.2 Kb, respectively (FIG. 15a). The
core cHS4 sequences were retained as the reduction in titers was
minimal (and not observed in initial experiments) with the core;
and it was important to determine if additional sequences
downstream of the core are necessary for optimal insulator
activity. The titers of the vectors containing DNA spacers were
identical to those containing similar sized cHS4 fragments, and
decreased with increasing size of the fragment in the 3'LTR (FIG.
15d). These data show that lengthening of the 3' LTR lowered titers
and this effect was not from specific sequences in cHS4. It has
been reported that HIV-1 RT is not a strongly processive
polymerase; it dissociates from its template frequently and the
viral DNA is synthesized in relatively short segments. Therefore,
it is likely that as the size of insert in the U3 LTR increased,
there was reduced processivity through the 3' LTR.
Example 38
Recombination Occur with Repeat Elements In the 3 'LTR
[0199] In order to detect if recombination events occurred in the
LTRs from insertion of 2 copies of the core or different size
fragments in the LTR, .about.12-20 MEL cell clones transduced with
the entire series of insulated vectors (sBG.sup.C, sBG.sup.400,
sBG.sup.2C, sBG.sup.800 and sBG-I) were generated. All clones that
had a single copy of integrated provirus were identified using
qPCR, as previously described. The 250 bp core from the genomic DNA
of each clone was then amplified, by a standard PCR. The insulator
core sequences could be amplified from clones derived from all
vectors except those derived from sBG.sup.2C transduced cells. In
sBG.sup.2C MEL clones, the insulator core was undetectable in 6 of
24 (25%) single copy clones by PCR, suggesting deletion of both
tandem repeats of cHS4 core sequences in the 5' and 3' LTR of the
provirus (FIG. 20D). To further analyze the frequency of recombined
proviruses, a genomic Southern blot analysis on sBG.sup.2C
transduced MEL cell pools was performed. Genomic DNA from
sBG.sup.2C and sBG-I MEL cell populations was restricted with an
enzyme that cut within the LTRs. FIG. 15E shows the expected
lengths of the provirus with the sBG.sup.2C vector and the sBG-I
vector, used as a control. While a single proviral band was seen in
sBG-I transduced MEL cells, the sBG.sup.2C provirus in MEL cells
showed loss of one or both copies of the cHS4 core sequences.
Indeed, proviral bands containing two intact copies of the core
were not detected at the level of sensitivity of Southern blot
analysis. These data show that tandem repeats in sBG.sup.2C
recombined at a high frequency. The sBG.sup.2C vector, therefore,
had lower viral titers from recombination events during reverse
transcription, rather than the size of the LTR insert. These
results were not unexpected, since repeat elements within
gamma-retrovirus and lentivirus vectors have been shown to
recombine frequently.
Example 39
Steps in Vector Life-Cycle Affected by Large Inserts into the
3'LTR
[0200] Large viral genomes in RNA vectors have been shown to be
limited at the level of RNA packaging. In the present study, there
was no effect on titers with increasing the virus payload by 1.2
Kb, but titers decreased with increasing length of the insert in
the LTR. Next, the mechanism by which this affected viral titers
was explored. The following steps in the viral life cycle were
studied: 1) characteristics of viral-RNA produced in packaging
cells, 2) virus particle production, 3) post-entry steps: reverse
transcription, nuclear translocation, integration and proviral
integrity. For all of these studies, the vector with the largest
insert, sBG-I was compared to the vector without the insulator,
sBG.
Example 40
Insertion of cHS4 in the 3'LTR Does not Alter the Quantity or
Quality of Viral-RNA In Packaging Cells
[0201] Northern blot analysis was performed on RNA derived from the
293T packaging cells after transient transfection with sBG, sBG-I
vector plasmids, along with packaging plasmids (D8.9 and VSV-G).
The blot was probed with hp fragment. FIG. 16 shows similar
intensity viral-RNA transcripts of the expected lengths of sBG and
sBG-I vectors. The probe non-specifically probed the 28S and 18S
RNA. Nevertheless, there were no additional bands other than the
full length-viral RNA of expected length, suggesting that no
recombination or aberrant splicing occurred with insertion of the
insulator. Thus, viral-RNA was produced efficiently in packaging
cells, independent of the presence of an insert in the LTR.
Example 41
Insertion of cHS4 in the 3'LTR Does not Increase Read-Through
Transcription
[0202] Experimentation was conducted to determine if the cHS4
insert upstream of the viral polyadenylation signal in the LTR
could impair transcript termination of the viral RNA. Read-through
transcripts have been shown to be excluded from encapsidation, and
can lower viral titers. Although the northern blot in FIG. 16
showed the expected size viral-RNA band and no extraneous
transcripts, it has been shown that transcriptional read-through is
much less in lentivirus vectors, as compared to gamma-retrovirus
vectors, that may not be readily detectable via a northern blot.
Therefore a sensitive enzyme based assay was used to study
read-through transcription.
[0203] Plasmid constructs were cloned, in which the wild type HIV-1
LTR, the SIN HIV-1 3'LTR with or without the insulator (from sBG-I
or sBG vectors, respectively) were placed downstream of EF1-.alpha.
promoter. A promoter-less IRES-cre cassette was placed downstream
of the LTRs, so that cre expression would occur only from
transcriptional read-through from the LTR. An EF la-IRES-cre
plasmid served as a positive control. Equal amounts of these
plasmids were transfected into the reporter cell line, TE26, which
expresses f.beta.-galactosidase proportional to cre expression. A
GFP plasmid was co-transfected with the read-through plasmid
constructs to normalize .beta.-galactosidase activity for
transfection efficiency. A plasmid carrying the truncated rat nerve
growth factor receptor served as a negative control. A standard
curve was generated that showed a linear correlation of the amount
of the positive control IRES-cre plasmid transfected into cells and
the .beta.-galactosidase activity measured by spectrophotometer. No
significant increase was observed in .beta.-galactosidase activity
from transfected constructs containing the insulated SIN lentivirus
LTR, as compared to those carrying the SIN LTR without the cHS4
insulator. The results from the .beta.-galactosidase assay were
identical when confirmed by Lac-Z staining of TE26 cells plated on
cover slips. These results showed that the insertion of cHS4
element upstream of the viral polyadenylation signal did not
increase read-through transcription from the LTR.
Example 42
Production of Viral particles Containing Viral Genomes is not
Affected by cHS4
[0204] To determine whether viral-RNA was encapsidated effectively
into virions, p24 levels, virus associated reverse transcriptase
(RT) activity and viral-RNA levels (FIGS. 17a-c) were measured.
Virus was generated in an identical manner concurrently with the
two vectors, and concentrated similarly in three separate
experiments. To ensure purity of the viral preparation and lack of
protein or plasmid contamination, virus was pelleted on a sucrose
cushion and subjected to DNAse digestion for these experiments.
Lack of plasmid contamination was confirmed by a qPCR for the
ampicillin resistance gene, present in the plasmid backbone. The
same volumes of virus preparation were then subjected to p24 ELISA
and virus-associated RT assays; and viral-RNA was extracted for a
dot-blot analysis. FIG. 17a shows that there was no difference in
the amount virus-associated RT between the two vectors. The p24
levels in the sBG and sBG-I virus preparations were also similar
(FIG. 17b). In order to ensure sBG-I virions contained viral
genomes, and were not empty viral like particles; virus was
subjected to RNA dot-blot analysis. FIGS. 17c-d shows one of two
representative experiments. Viral RNA from sBG and sBG-I was loaded
in duplicate in 4 different dilutions of p24 (FIG. 17c); and the
intensity of the dots quantified by phosphoimager (FIG. 17d). There
were similar amount of viral mRNA encapsidated from either vector.
These data suggest that insertion of a 1.2 Kb fragment in the LTR
did not affect packaging efficiency of viral mRNA or production of
viral particles.
[0205] The present results with large inserts into the LTR are in
contrast to those by Sutton and colleagues where lentivirus vectors
with lengthened internal transgene cassettes are inefficiently
packaged into virions. Equal amounts of virus particles produced
from the sBG and sBG-I vectors, but significantly lower
infectious/transduction titers suggests a post-entry block of large
LTR insert bearing viruses, resulting in less integrated units.
Example 43
Large LTR Inserts Affect Reverse Transcription and Integration of
Viral cDNA
[0206] Post-entry steps were investigated; including reverse
transcription, nuclear translocation, integration and proviral
integrity. Reverse Transcription: the steps of reverse
transcription, location of qPCR primers and probes and the viral
DNA products are summarized in FIG. 18a. Reverse transcription
initiates from the primer binding site near the 5' end of the
genomic RNA, and minus strand synthesis proceeds to the 5' end of
the genome (minus strand strong stop DNA (-sssDNA)). The newly
formed -sssDNA anneals to the 3'R region of the genome (first
strand transfer), minus-strand DNA synthesis resumes, accompanied
by RNase H digestion of the viral RNA template. It has been shown
that the secondary structure of viral RNA at the 3' end is a
critical determinant for the -sssDNA transfer, for the reverse
transcription process to be efficient. Therefore, it is likely that
presence of the insulator/an insert in the U3 region of the 3' LTR
would alter the secondary structure of the region involved in this
complex process, resulting in overall decreased reverse
transcription efficiency.
[0207] To assess reverse transcription efficiency, MEL cells were
infected with equal amounts of sBG and sBG-I viral particles, based
upon p24 levels, and cells collected at different time points post
infection. Absence of plasmid contamination was confirmed by a qPCR
for the ampicillin resistance gene present in the plasmid backbone
(data not shown). Kinetics of early reverse transcription
(production of -sssDNA) were studied using primers and probe
spanning the R/U5 region (FIG. 18b). As expected, there was no
difference detected in the kinetics between the two viruses, since
the 5' ends of sBG or sBG-I viral RNA were identical. Nevertheless,
the data validated that qPCR accurately determined viral reverse
transcription.
[0208] It is conceivable, however, that when RT switches templates
(minus strand jump) to reverse transcribe the 3' LTR, alteration of
secondary structure from the presence of an insert in the U3 region
would reduce reverse transcription products. Quantitative PCRs
amplifying the U3/R and .psi. regions were performed to quantify
the amount of intermediate and late reverse transcribed viral cDNA
in cells infected with sBG and sBG-I vectors, respectively (FIGS.
18c-d). It was discovered that RT efficiency soon after the first
strand transfer was impaired. Notably, the U3/R primers amplified
viral DNA that was reverse transcribed before the insulator
sequences, suggesting that insert in the 3'LTR affected reverse
transcription by altering or "poisoning" the 3'LTR. Indeed, the
inefficiency in intermediate RT product formation was similar to
that seen with late RT products. In both analysis, the peak of
viral cDNA synthesis occurred at 12 h for the uninsulated vector
sBG and then gradually decreased, consistent with integration of
viral cDNA, and previously reported kinetics of reverse
transcription. The amount of viral DNA from the insulated vector
sBG-I was lower post-entry compared to sBG by about 2-fold at all
time points, as early as 6 hours post-target cell entry. These data
strongly suggest that reverse transcription after the minus strand
jump was rate-limiting in the sB G-I vector.
[0209] Nuclear translocation: After the viral DNA is synthesized in
the cytoplasm, it is translocated into the nucleus of infected
cells, where it can be found as linear DNA or circular DNA (1-LTR
and 2-LTR circles) (FIG. 18a). The linear form is circularized at
the LTRs and is the direct precursor of the integration process;
1-LTR and 2-LTR circles, instead, are abortive products of
homologous recombination and non-homologous DNA end joining,
respectively. However, 1LTR and 2LTR circles are specifically
localized in the nucleus, and are used as a marker for nuclear
translocation. Presence of an insert in the LTR of lentiviruses can
possibly interfere with the pre-integration complex (PIC) formation
and the nuclear translocation of the viral DNA can lower
transduction titers. It has been shown indeed that PIC complexes
bind HIV LTR in the cytoplasm, and they are responsible for the
transport to the nucleus and the integration of the cDNA into the
genome of infected cells.
[0210] In order to detect the nuclear translocation, the amount of
2-LTR circles in both vectors were analyzed using a qPCR on DNA
from infected MEL cells at different time points in sBG versus
sBG-I infected cells. As shown in FIG. 19a, the amounts of 2-LTR
circles were not significantly different between the two vectors at
early time points. However, at 48 h after infection, the peak at
which 2-LTR circles are normally detected, 2-LTR circles were 6.7
times higher in sBG infected cells, but were barely at the
detection limit in sBG-I infected cells. Later time points (72 and
96 hours) were also analyzed, but no delay was determined in the
kinetics of 2LTR circle formation in the insulated vectors. Indeed,
the 2-LTR circles were barely detectable by qPCR in the sBG-I
infected cells after 24 hours. These data suggested that nuclear
translocation was likely reduced due to presence of the large U3
insert.
[0211] Integration: It is also conceivable, however, that two
copies of large U3 inserts provide a template for homologous
recombination, and the rate of homologous recombination between the
two LTRs prior to integration increases, resulting in more 1-LTR
circles and reduced 2-LTR circles (as proposed in the cartoon in
FIG. 20). This would decrease the amount of template available for
integration. Due to the nature of reverse transcribed viral cDNA
with an insulated and uninsulated vector, 1LTR circles cannot be
quantified by a PCR-based technique. Therefore, a Southern blot
analysis was performed to detect linear viral cDNA, 1-LTR and 2-LTR
circles at 72 hours post infection with equal amounts of sBG and
sBG-I (quantified using p24 levels) (FIG. 19b). The Southern blot
analysis showed that (i) the linear form of reverse transcribed
viral cDNA, the form that integrates, was undetectable in the sBG-I
lane at the sensitivity of Southern blot analysis, while it was
readily detectable in the sBG lane. (ii) The 2-LTR circles were
also undetectable in the Southern analysis in the sBG-I lane, but
detectable in the sBG lane, corroborating the qPCR data on 2-LTR
circles. (iii) However, large amount of 1-LTR circles were present
in sBG-I lane, similar in amount to those seen in the sBG lane. The
relative ratios of linear, 1- and 2-LTR circles in sBG versus sBG-I
lanes suggested that there was increased homologous recombination
of the sBG-I viral DNA. Indeed, these data indicated that nuclear
translocation was not affected to any major extent by the U3
insert. But after the reverse transcribed cDNA entered the nucleus,
increased 1-LTR circles, representing abortive recombinant
integration products were formed due to the large LTR insert and
therefore, integration was reduced.
[0212] It is conceivable that the integration machinery is also
directly affected by the presence of foreign sequences in the LTR.
Therefore, sBG and sBG-I viruses were packaged using an integrase
defective packaging plasmid, so that effect of the insulator on
reverse transcription, nuclear localization, and 1LTR circle
formation could be studied independent of integration. The same
analysis was performed as with active integrase containing viruses:
a q-PCR to study the late reverse transcription product (using psi
primers), 2LTR circles and a genomic Southern blot analysis to
determine 1LTR circles and other forms of viral cDNA. The results
were identical to those seen with sBG and sBG-I packaged with
active integrase (shown in FIG. 19b): the same reduction was
observed in late RT products and 2LTR circles by qPCR, but
increased 1LTR circles by genomic Southern analysis (data not
shown). Therefore, sequences inserted into the lentivirus LTR
interfered mainly with the reverse transcription process, and
increased the frequency of homologous recombination by a mechanism
independent of the integrase machinery.
[0213] Finally, the integrated sBG and sBG-I provirus were analyzed
for stability of transmission and efficiency of integration. The
Southern blot analysis in FIG. 19b shows the integrated DNA as a
smear, that is of higher intensity in the sBG than the sBG-I lane.
In order to confirm and quantify integration, MEL cells were
transduced with same amount of p24 levels of sBG or sBG-I virus,
cultured for 21 days and a qPCR and Southern blot analysis were
performed to compare proviral integration efficiency and stability
(FIG. 19c). There were 6.2 proviral copies per cell in sBG MEL cell
population by qPCR, while only 0.8 proviral copies were detected in
sBG-I MEL cells, a 7.8-fold difference which is consistent with
differences seen in transduction titers between the two vectors.
Next, DNA was restricted with Afl-II, an enzyme that cuts within
the LTRs (FIG. 19c, left panel). Consistent with transduction
titers and qPCR, the amount of integrated sBG-I provirus was 8-fold
less than sBG, as indicated by phosphoimager quantification of the
Southern blot bands (FIG. 19c). The sBG-I vector did not recombine,
as shown by the single proviral band of the expected size. Next,
the full length insulator was detected by PCR in all single copy
clones of sBG-I transduced MEL cells (FIG. 20D). Therefore, the
linear sBG-I cDNA, albeit inefficiently formed, integrated as an
intact provirus.
[0214] The overall reduced viral integration was primarily from a
combination of inefficient reverse transcription and increased
homologous recombination that hinder the availability of proviral
DNA for integration. Since insulators are important for generating
viral vectors that would be safe and provide consistent predictable
expression, it is important to find a solution to the problem of
low viral titers with insulated viruses. One way to overcome the
problem would be to flank the internal expression cassette with
cHS4 on either end, since further lengthening of the internal
cassette did not decrease titers. However, this approach was not
tried because repeat elements within retroviruses are known to
result in recombination. Since HIV RT is known to have low
processivity and frequently dissociate from its template, an
attempt was made to increase the amount of RT delivered per vector
particle, to assess if that would improve reverse transcription
from large LTR inserts. RT was co-packaged in the virions as vpr-RT
fusion protein. No significant increase in titers was observed when
providing more RT in the virion. The next step was an attempt to
increase the integrase (IN) per virion using the same strategy, and
copackaged RT-IN-vpr fusion protein in the virion. There was a
slight increase in titers providing RT-IN in the viral particle,
but the difference was not significant.
[0215] Next, a detailed structure-function analysis of the 1.2 Kb
cHS4 insulator was performed and a defined 650 bp sequences were
determined as the minimum necessary sequences for full insulation
effect. The titers of sBG.sup.650 were 3.6.times.10.sup.8IU/mL,
compared to a titer of 8.2.times.10.sup.8 IU/mL and
9.8.times.10.sup.7 IU/mL of the sBG and sBG-I vectors (FIG. 20C).
Vectors with the 650 bp insert had very reasonable viral titers
(2.2-fold lower titers than the uninsulated vector sBG, as compared
to 9-10-fold lower titers of sBG-I) with no loss of insulator
activity.
[0216] Ultimately it was determined that low transduction titers
were not from an increase in size of the provirus, but increased
length of the 3'LTR. The quantity and quality of viral RNA genomes
produced were unaffected and viral-RNA encapsidation/packaging was
comparable in vectors with and without a 1.2 Kb LTR insert. Reduced
viral titers occurred from post-entry steps, from inefficient
reverse transcription, increased homologous recombination in the
LTRs of viral DNA, making less viral DNA available for integration.
Improvements in vector design were made by including smaller
insulator inserts that contained essential elements necessary for
optimal insulator activity.
[0217] The present studies have important implications for future
design of vectors with inserts within the 3'LTR, given the
usefulness of chromatin insulator elements, customized lineage
specific LTR vectors or double copy vectors.
Example 44
Vector Constructs
[0218] The cloning of the BG, BGM, BG-I and BGM-I vectors has been
previously described. All other vectors were cloned into the sSIN
backbone (details provided in Urbinati F, Xia P and Malik P,
manuscript in review). All the vectors were obtained cloning the
different insulator fragments into a unique Nhe I/EcoR V site was
inserted in the U3 3'LTR region of the sSIN LV vector plasmid,
which carried the human beta-globin gene and the hypersensitive
site 2, 3 and 4 fragments, as previously described. Insulator
fragments were amplified by PCR using the insulator plasmid pJCI3-1
as a template. All amplicons were sequenced following the PCR, and
after insertion into the 3'LTR. The cloning of the uninsulated
beta-globin vector and one that carrying the full length 1.2 Kb
cHS4 insulator has been described previously. Briefly, the 1.2 Kb
insulator fragment was obtained by digesting pJCI3-1 plasmid with
Xba I and cloned into the Nhe I/EcoR V restriction site of sBG.
sBG.sup.C was cloned inserting into sBG vector the fragment EcoR
I/Xba I containing the 250 bp core from the pBS lcore plasmid. The
latter was obtained cloning the 250 bp core Insulator PCR product
(using Core 1F and Core 1R primers, as described herein) into BamH
I/EcoR I restriction sites of a pBS plasmid. A second copy of the
250 bp core was then added into the pBS 1 core plasmid, cloning
into EcoR I/Kpn I sites the PCR product (Core 2F and Core 2R),
obtaining the pBS 2 core plasmid. 2 tandem copies of the 250 bp
core were then isolated digesting the latter plasmid with Kpn I/Xba
I, and then cloned into the sBG vector, obtaining sBG.sup.2C. The
sBG.sup.400 and sBG.sup.800 vectors were obtained cloning the 2 PCR
products (using InsF and Ins400R primers and InsF and Ins800R
primers, respectively) into the sBG Nhe I/EcoR V sites. sBG650
vector was obtained cloning the 3' 400 fragment of the insulator in
EcoRV/BspEI sites of sBG.sup.1c vector. The 3' 400 fragment was PCR
amplified from the plasmid pJCI3-1 using the following primers: 3'
400 R (BspEI) and 3' 400 F (EcoRV).
[0219] The vectors containing the .lamda. DNA spacers were obtained
amplifying different size .lamda. phage DNA using the following
primer combinations: spacerF1 and spacerR1, spacerF1 and spacerR2
and spacerF1 and spacerR3 amplifying a 150 bp, 550 bp and 950 bp
2\., DNA fragments, respectively. The three PCR fragments were
digested with Cla I and EcoR I restriction enzymes and ligated into
EcoR I/Cla I sites in the pBS-1 core plasmid, The 400 bp, 800 bp
and 1200 bp fragments were digested from the pBS-1 core plasmid
with HincII and Xbal for the 400 bp fragment, and with Xba I and
Xho I for the remaining two fragments, and cloned into the EcoR
V/Nhe I restriction sites in the sBG vector. All the vectors cloned
were confirmed by sequencing. The list of all the primers is
available in (FIG. 20E).
Example 45
Cell Lines
[0220] Murine erythroleukemia cell (MEL) line and 293T cells were
maintained in Dulbecco modified Eagle Medium (DMEM, Mediatech, Inc)
supplemented with 10% heat inactivated fetal bovine serum (FBS)
(U.S. Bio-technologies, Inc.). MEL cells were induced to
differentiate in DMEM containing 20%FBS and 5 mM N,
N'-hexamethylene bisacetamide (Sigma), as previously described. To
derive single integrant clones, transduced MEL cells were cloned
and clones were screened for .beta.-globin sequences by PCR to
identify transduced clones. Single copy clones were identified by
qPCR for lentivirus .gamma.-sequences, and a PCR for the cHS4 core
sequences was performed on the single integrant clones to confirm
presence of insulator sequences in the provirus.
[0221] Example 46
HbA Staining and FACS Analysis
[0222] The staining using the anti-human HbA antibody was as
previously described. Briefly, cells were fixed in 4%
paraformaldehyde for 60 minutes at room temperature, washed once
with phosphate-buffered saline (PBS), and the pellet resuspended in
100% methanol for 5 minutes. The fixed cells were then washed with
PBS, and nonspecific antibody (Ab) binding was blocked using 5%
nonfat dry milk for 10 minutes at room temperature. Subsequently,
cells were washed in PBS, pelleted, and permeabilized. The cells
were divided into 2 tubes and stained with either anti-Zeta
globin-fluorescein isothiocyanate (FITC) (1 .mu.g/10.sup.6 cells)
as a negative control or anti-HbA-FITC (0.1 .mu.g/10.sup.6 cells)
(Perkin Elmer) for 30 minutes at room temperature in the dark.
Unbound Ab was removed by a final wash with PBS before they were
analyzed on FACS Calibur (Becton Dickinson).
Example 47
Virus Production
[0223] Virus was produced by transient cotransfection of 293T
cells, as previously described, using the vector plasmids, the
packaging (A8.9 or A8.2 for active or inactive integrase
respectively) and the VSV-G envelope plasmids; virus-containing
supernatant was collected at 60 hours after transfection and
concentrated by ultracentrifugation. All vectors in an experiment
were packaged simultaneously. Virus was treated with DNase and/or
Dpnl to remove plasmid DNA contamination and layered on a 20%
sucrose cushion to obtain purified viral particles for specific
experiments on vector life cycle indicated in the results. Virus
was concentrated 1400-fold from all viral supernatants after
ultracentrifugation at 25,000 rpm for 90 minutes. Viral titers were
determined by infecting mouse erythroleukemia (MEL) cells with
serial dilutions of concentrated virus, differentiating them, and
analyzing them for HbA expression by fluorescence-activated
cell-sorter scanner (FACS).
Example 48
Northern Blot
[0224] Total RNA was extracted from 293T cells using RNA-STAT
(Tel-Test, INC, Texas), 72 hours after transfection. Northern Blot
was then performed according to standard protocol. The blot was
hybridized with a .sup.32-P labeled .beta.-globin probe.
Example 49
RNA Dot Blot
[0225] Viral-RNA was extracted from same volumes of concentrated
viruses using the QIAamp Viral RNA Mini Kit (Qiagen, Valencia,
Calif.) following the manufacturer's instructions. Briefly the
virus was lysed under a highly denaturing condition and then bound
to a silica-gel-based membrane. Two washing steps efficiently
washed away contaminants and v-RNA was eluted in 30 .mu.l of
DEPC-H20. After elution viral-RNA was treated for 20 min. at room
temperature with amplification grade DNAse I (Invitrogen). DNase
was inactivated incubating the sample at 65.degree.. Viral RNA was
then denatured in 3 volumes of denaturation buffer (65% formamide,
8% formaldehyde, MOPS 1.times.) for 15 min at 65.degree.. After
denaturation 2 volumes of ice-cold 20.times.SSC were added and the
RNA was bound to a nylon membrane by aspiration through a dot-blot
apparatus. The blot was hybridized with a .sup.32-P labeled
.beta.-globin specific probe and a film was exposed overnight.
Quantification of the dots was performed with a phosphoimager
(Biorad, Hercules, Calif.).
Example 50
Reverse Transcriptase Assay
[0226] Concentrated virus (1 .mu.L), and serial dilutions (1:10, 1;
100, 1:1000) were lysed and processed following the "Reverse
transcriptase (RT) assay, colorimetric" Kit (Roche) protocol.
Briefly concentrated viral particles were lysed with lysis buffer
and viral-RNA reverse transcribed using digoxigenin and
biotin-labeled nucleotides. The detection and quantification of
synthesized DNA as a parameter of RT activity followed a sandwich
ELISA protocol: biotin-labeled DNA was bound to the surface of
microplate modules that were pre-coated with streptavidin. In the
next step, an antibody to digoxigenin, conjugated to peroxidase
(anti-DIG-POD), was bound to the digoxigenin-labeled DNA. In the
final step, the peroxidase substrate ABTS was added, that resulted
in a colored reaction product that was quantified using an ELISA
reader at a wavelength of 405 nm. The amount of colored product
directly correlated to the level of RT activity in the sample.
Example 51
P24 Assay
[0227] P24 antigen concentration was determined by HIV-1 p24
Antigen EIA Kit (Beckman Coulter). Briefly, serially diluted virus
was lysed and incubated onto p24 antigen coated microwells, and
washed following manufacturer's protocol. Color absorbance was
measured using a spectrophotometer at a wavelength of 450 nm. p24
assay was performed in duplicate.
Example 52
Southern Blot
[0228] To analyze the integrity of the provirus we infected MEL
cells, expanded them for 21 days and extracted DNA using Qiagen
Blood and Cell culture DNA Mini Kit (Qiagen). 10 .mu.g of DNA was
digested with Afl II, an enzyme that cuts in the LTRs. To determine
presence of viral linear DNA, genomic DNA was extracted 72 h after
infection of MEL cells and restricted with Stu I, an enzyme that
cuts twice within the provirus. The DNA was separated on a 0.8%
agarose gel, transfer to a nylon membrane, and probed overnight
with a .beta.-globin fragment.
Example 53
Real Time PCR for RT Products and 2LTR Circle
[0229] The same amount of p24 was used to transduce MEL cells with
sBG and sBG-I vectors, in DMEM media, in the presence of 8 .mu.g/mL
polybrene. Cells were harvested at different time point (0.5 h, 3
h, 6 h, 8 h,12 h, 24 h, 48 h, 72 h) and DNA extracted using Qiagen
Blood and Cell culture DNA Mini Kit (Qiagen). Genomic DNA (50 ng)
from a single copy MEL clone (confirmed by Southern for a single
integrant) was diluted with untransduced DNA to generate copy
number standards (1-0.016 copies/cell). The primers and the probe
for RT product were designed using the Primer Express Sofware from
Applied Biosystems, Foster City, CA. Primers and probe sequence for
early RT products (R/U5) qPCR assay are forward primer
5'-GAACCCACTGCTTAAGCCTCAA-3' (SEQ ID NO: 10), reverse primer:
5'-ACAGACGGGCACACACTACTTG-3' (SEQ ID NO: 11) The reaction was
carried out with TaqMan MGB Probe: 5'-AAAGCTTGCCTTGAGTGC-3' (SEQ ID
NO: 12). Primers and probe sequence for intermidiate RT products
(U3/R) qPCR assay are:forward primer 5'-CCCAGGCTCAGATCTGGTCTAA-3'
(SEQ ID NO: 13), reverse primer: 5'-TGTGAAATTTGTGATGCTATTGCTT-3'
(SEQ ID NO: 14) The reaction was carried out with TaqMan MGB Probe:
5'-AGACCCAGTACAAGCAAAAAGCAGACCGG-3' (SEQ ID NO: 15). For the late
RT product assay (psi) the primers were designed to recognize the
.psi. region of the provirus: forward primer:
5'-ACCTGAAAGCGAAAGGCAAAC-3' (SEQ ID NO: 16), reverse primer:
5'-AGAAGGAGAGAGATGGGTGCG-3' (SEQ ID NO: 17). The reaction was
carried out with TaqMan Probe: 5'-AGCTCTCTCGACGCAGGACTCGGC-3' (SEQ
ID NO: 18) with TAMRA dye as quencher. Normalization for loading
was carried out using mouse apoB gene controls. The cycling
conditions were 2 min at 50.degree. C. and 10 min at 95.degree. C.,
then 40 cycles of 95.degree. C. for 15 s and 60.degree. C. for
lmin. The primers and probe for 2LTR circle were as previously
described. The PCR mixture was thermo cycled according to the
thermal cycler protocol for 96 well plates in Applied Biosystems
7900HT Fast Real-Time PCR System Base Unit.
Example 54
LSDs and Treatments--Generally
[0230] Lysosomal storage disorders (LSD) include about 50 metabolic
diseases that collectively affect approximately 1 in 5000 live
births with .about.65% affecting the CNS. Mucopolysaccharidosis
type I (MPS I, or Hurler Syndrome for its severe form), one of the
most common LSD, is caused by defective IDUA and consequent
systemic accumulation of the unprocessed glycosaminoglycans (GAG)
(1). Treatment modalities for LSDs are currently limited to bone
marrow transplantation (BMT) and enzyme replacement therapy (ERT).
These approaches while providing significant promise for treatment
of the visceral manifestations of LSDs, do little to address CNS
pathologies for this group of disorders. Moreover, BMT is limited
by procedure-related mortality between 20 and 30%, late
complications such as graft versus host disease, and by the need to
find an HLA-matched donor. Pharmaceutical lysosomal enzyme products
are available for several LSDs and are being used to ameliorate
visceral manifestations in some LSD patients. However, it is
limited by poor penetration of the CNS, the need for frequent
intravenous infusion for a lifetime and by tremendous costs. A new
therapeutic approach to treatment of LSDs with lower mortality and
morbidity, and with the capacity to correct CNS deterioration is
needed.
Example 55
HSC and Erythroid Cell Gene Transfer--General
[0231] Ex vivo HSC gene transfer followed by autologous
transplantation is an attractive alternative for LSD treatment that
could provide life-long therapeutic effects without the morbidity
and mortality of allogeneic transplantation. However, in general
the frequencies of transduced and successfully engrafted HSC have
been low in gene therapy clinical trials. In addition, inadvertent
activation of cellular proto-oncogenes by ubiquitous LTR promoters
resulted in secondary leukemogenesis in two otherwise successful
clinical trials (11-13).
[0232] Healthy individuals can produce 2.4.times.10.sup.11 RBC per
day with a daily output of 7.2 g of hemoglobin. Redirecting a
portion of the formidable protein synthesis machinery in maturing
erythroid cells toward the expression of a transgene can provide an
efficient approach for long-term protein delivery into the
circulation. Moreover, the high efficiency of protein synthesis can
compensate for the generally low HSC gene transfer frequency in
gene therapy clinical trials. Restricting transgene expression to a
subset of HSC offsring can also reduce the risk of insertional
oncogenesis. To that end, an ankyrin-1 based erythroid specific
hybrid promoter/enhancer (IHK) can introduce high
erythroid-specific expression in vivo in primary and secondary
murine BMT recipients (17).
Example 56
Reprogramming Erythroid Cells for Production of Alpha-L-Iduronidase
(IDUA)
[0233] Restricting transgene expression to maturing erythroid cells
can reduce the risk of activating oncogenes in hematopoietic stem
cells (HSCs) and their progeny, yet take advantage of their robust
protein-synthesis machinery for high-level protein production. This
study indicates that an erythroid-specific hybrid promoter can
provide inducible IDUA expression and release during in vitro
erythroid differentiation in murine erythroleukemia cells,
resulting in phenotypical cross-correction in an enzyme-deficient
lymphoblastoid cell line derived from patients with
Mucopolysaccharidosis (MPS) Type I. Stable and higher-than normal
plasma IDUA levels were achieved in vivo in primary and secondary
MPS I chimeras for at least 9 months after transplantation of HSCs
transduced with the erythroid-specific IDUA-containing lentiviral
vector (LV). Moreover, long-term metabolic correction was
demonstrated by normalized urinary glycosaminoglycan accumulation
in all treated MPS I mice. Complete normalization of tissue
pathology was observed in heart, liver and spleen. Notably,
neurological function and brain pathology were significantly
improved in MPS I mice by erythroid-derived, higher-than-normal
peripheral IDUA protein. These data are the first to demonstrate
that late-stage erythroid cells, transduced with a tissue-specific
LV, can deliver a lysosomal enzyme continuously at
supra-physiological levels to the bloodstream, and can correct the
disease phenotype in both viscera and CNS of MPS I mice. This
approach provides a paradigm for the utilization of red blood cell
precursors as a depot for efficient and potentially safer, systemic
delivery of non-secreted proteins by ex vivo HSC gene transfer.
Example 57
Inducible IDUA Expression and Enzyme Release from IHK Promoter
During In Vitro Erythroid Differentiation in MEL Cells
[0234] To determine if cells from the erythroid lineage could
produce and release lysosomal IDUA during erythroid
differentiation, an erythroid MEL cell line was used to compare
IDUA expression and enzyme release from three LV constructs
containing the same expression cassette with three different
promoters, i.e., erythroid specific IHK, ubiquitous cellular
promoter of human elongation factor-1a (EF) and LTR promoter of
spleen focus-forming virus (SF) (FIG. 21A). Progressive erythroid
differentiation during HMBA-induction of MEL cells was confirmed by
morphologic evaluation, and by histochemical staining with
Benzidine showing an increasing number of hemoglobin-expressing
cells (FIG. 22). The mean fluorescent intensity (MFI) of GFP in
stably transduced MEL-KIiG increased from mean of 27 to 78 by Day 8
of inductive culture; while the MFI in MEL-EIiG decreased from 228
to 84 and no significant change of MFI was observed in MEL-SIiG
during erythroid induction (FIG. 21B). IDUA expression from IHK was
relatively low (5% of SF and 8% of EF) in un-induced MEL-KIiG, but
increased 15-fold following induction, reaching an intracellular
level similar to that obtained with the strong LTR promoter of SF
(FIG. 21C). After erythroid induction, IDUA expression from the EF
promoter decreased to 17% of the un-induced levels, while the
levels from SF promoter remained unchanged. A similar pattern was
found in IDUA activity in the media from transduced MEL cells
during induction. The endogenous IDUA levels of un-transduced MEL
control cells were very low (1.1 .+-.0.7 U/mg) and decreased to
negligible levels during erythroid induction; no IDUA activity was
ever found in culture medium. These results demonstrate that
maturing erythroid cells can increasingly overexpress IDUA during
differentiation to levels comparable to strong SF promoter, and a
portion of the IDUA can be released from these cells.
Example 58
Erythroid Released Enzyme Cross-Corrected Lysosomal Defect In Cells
Derived from a MPS I Patient
[0235] IDUA is synthesized in the endoplasmic reticulum as a
653-amino-acid precursor that undergoes post-translational
glycosylation and extensive proteolytic processing to produce at
least 10 polypeptides during passage through the endosome-lysosome
compartments (18). The enzyme is normally targeted to the lysosome
via the cation-independent mannose 6-phosphate (M6P) receptor (MPR)
(19). To test if this endogenous uptake pathway remains effective
for IDUA protein released by erythroid cells, lymphoblastoid cells
derived from an MPS I patient were exposed to medium preconditioned
by induced MEL-KIiG (FIG. 23). The intracellular IDUA levels
increased from undetectable to 0.8 U/mg or about 10% of wild-type
levels (FIG. 23A). This uptake process was inhibitable by the
presence of M6P competitor.
[0236] The increased abundance of lysosomes and the abnormal
lysosomal morphology in MPS I cells are direct consequence of GAG
accumulation. To determine the functional integrity of IDUA
generated by erythroid cells, in situ immunostaining was performed
using a fluorescent dye that could be endocytosed into lysosomes
(FIG. 23B). In contrast to normal LCL cells, untreated LCLmps cells
contained more lysosomes, i.e., stronger fluorescent intensity, and
these compartments might be smaller in size, as suggested by more
uniform staining. The majority of LCLmps cells exposed to
erythroid-released IDUA exhibited a normalized lysosomal pattern
and this was not seen in the presence of M6P. These data
demonstrate that IDUA released from maturing red cells can use the
MPR lysosomal enzyme trafficking system, and also can restore a
normal pattern of lysosomal distribution and morphology in cells
derived from MPS I patients.
Example 59
Long-Term, Supra Physiological Levels of IDUA were Achieved In
Plasma of MPS I Mice Transplanted with LV-KIiG Transduced
Enzyme-Deficient HSCs
[0237] In vivo systemic IDUA production by erythroid-specific LV in
MPS I mice (FIG. 24) was evaluated. HSC-enriched Lin bone marrow
cells from MPS I mice were isolated by lineage depletion with
92-97% purity, followed by transduction twice with LV-KIiG or
LV-EliG for a total MOI of 20 or 18, respectively. Starting 2 weeks
after BMT, plasma IDUA activity levels increased from undetectable
levels to 27.+-.9 U/ml, and persisted at supra-physiological IDUA
activity levels (4-fold higher than wild-type) till the end of the
5-month observation period (FIG. 24A). Only 0.7.+-.0.2 U/ml of
plasma IDUA was present in MPS I mice that received wild-type
marrow, and 7.+-.4 U/ml were found in those receiving LV-EIiG
transduced Lin.sup.- cells. These results show that a lysosomal
enzyme can be produced and released into the circulation in vivo by
erythroid cells using tissue-specific LV, even through erythroid
cells are not normally regarded as cells that secrete plasma
proteins.
[0238] To determine whether gene transfer had occurred in primitive
HSCs and could sustain long-term erythroid IDUA "secretion",
secondary transplantation in MPS I mice was conducted using bone
marrow from primary recipients of LV-KIiG transduced cells 5 months
after primary BMT (FIG. 24B). Stable IDUA erythroid expression
derived from primary transduced HSCs was attained in all secondary
recipients sampled 8 weeks and 16 weeks after transplantation.
Long-term plasma IDUA levels achieved in the secondary MPS I
recipients were about 8-fold higher than wild-type levels.
[0239] To determine transgene frequency in primary and secondary
BMT recipients, GFP transgene frequency by real-time qPCR in
peripheral blood leukocytes and total bone marrow 4-5 months after
transplantation was evaluated (FIG. 24C). Similar levels of
transgene frequency were obtained with both EIiG and KIiG vectors
in primary recipients, averaging 22.+-.7% and 23.+-.8% in PBL, and
24.+-.12% and 28.+-.16% in bone marrow, respectively. Stable gene
transfer in HSCs was ascertained in secondary recipients for KIiG
with 22.+-.3% GFP in PBL and 24.+-.9% in BM.
[0240] Five months after primary transplantation, spleen
colony-forming unit assays were carried out to determine transgene
frequency and functional IDUA expression in the clonal progeny of
LV-KIiG transduced pluripotent hematopoietic stem/progenitor cells
after secondary transplants (FIGS. 24, C and D). Of 112 CFU-S
analyzed for the KIiG group of mice, 35 CFU-S were positive for the
provirus determined by real-time qPCR (31%), and all expressed
elevated IDUA determined by enzyme assay. Of these, 32 colonies
contained a single copy and 3 colonies contained 2 copies of
provirus. The IDUA activity levels in MPS I CFU-S harboring
single-copy KIiG insertion were 100.+-.59 U/mg, which were 9-fold
higher than those derived from heterozygous mice (11.+-.6). The
mean IDUA levels in LV-KIiG transduced 2-copy CFU-Ss was 299.+-.86
U/mg, i.e., 12.5-fold higher than those derived from wild-type mice
(24.+-.16). These observations were consistent with robust levels
of IDUA detected in plasma of secondary MPS I recipients
transplanted with primary LV-KIiG transduced HSCs.
[0241] To determine whether erythroid specific IDUA expression may
affect normal erythropoiesis, complete blood count was performed in
primary or secondary MPS I chimeras 5-6 months after
transplantation. Erythrocyte parameters, such as hemoglobin levels,
RBC counts, hematocrit values and red blood cell distribution width
etc., were indistinguishable between MPS I chimeras receiving
KIiG-transduced HSC and those receiving WT bone marrow (FIG. 25).
These results indicate that no significant perturbation of
erythropoiesis occurred from IDUA transgene expression in these
animals.
Example 60
Erythroid-Specific Expression of IDUA Predominantly In Late Stages
of Erythroblasts
[0242] To investigate whether IDUA expression from LV-KIiG is
erythroid specific and define its expression pattern during
erythroid differentiation in vivo, GFP expression (as bicistronic
gene downstream from IDUA) was evaluated in fresh bone marrow cells
stained with the erythroid-specific cell surface makers Ter119
(glycophorin A-associated protein) and CD71 (transferrin receptor)
(FIG. 26). The progressive maturation in erythroid precursor
subpopulations, labeled as I-IV on the histograms, has been
examined previously by us (20) and others (21, 22). Population I
corresponded mainly to proerythroblasts and early basophilic
erythroblasts. Population II contained a mixture of basophilic,
polychromatophilic, and orthochromatic erythroblasts. Population
III contained reticulocytes and a fraction of mature RBC, while
Population IV was mostly RBC. GFP-expressing cells became
detectable, i.e., significantly higher than background levels,
starting from subpopulation II and further increased with greater
percentage representation in later stages of erythroid
differentiation (FIG. 26B). Only background levels of expression
were observed in non-erythroid populations (Ter119.sup.- CD71.sup.-
fraction). The GFP expression levels, as determined by MFI,
increased in population II, peaked in population III, while it
decreased again in population IV consisting of enucleated, mature
red blood cells (FIG. 26C). These results demonstrate predominant
transgene expression in late stages of erythroid differentiation,
and confirm the erythroid restriction imparted by the IHK promoter
as previously found with related .beta.-globin-encoding vectors
(17).
[0243] To evaluate transgene expression in the clonal progeny of
HSC, the cellular composition of individual CFU-S, and GFP
expression pattern in transduced colonies were examined (FIG. 27).
Twenty CFU-S colonies were immunostained with erythroid markers
CD71 and Ter119, and all of them contained 48-91%
erythroblasts/reticulocytes (CD71.+-.) (FIGS. 27A and 27B),
suggesting that 12-day CFU-S colonies were either erythroid or
multi-lineage colonies. Moreover, GFP expression was restricted in
mid/late stages of erythroblasts and reticulocytes
(Ter119+subpopulations) (FIG. 27C).
Example 61
Long-Term Systemic Metabolic Correction In MPS I Mice
[0244] To evaluate the therapeutic effect of transduction, the GAG
levels, a parameter for systemic metabolic accumulation, were
determined in urine of treated MPS I groups, in comparison with
age-matched untreated MPS I and normal mice (FIG. 28). At 3-months
and 5-months after transplantation, the mean GAG levels for all
transplanted groups were not different from those in normal
controls. Untreated MPS I mice had significantly higher urinary GAG
accumulation than all other groups (p<0.01). These data indicate
that significant systemic metabolic correction of storage disease
can be achieved in MPS I chimeras receiving MPS I HSCs transduced
with an erythroid specific LV or receiving wild-type HSCs.
[0245] To evaluate the potential therapeutic effects of
erythroid-derived IDUA on multi-organ deficits in MPS I mice,
histological examinations of liver, spleen and heart were performed
on two mice from the KIiG group (one with the highest plasma IDUA
and the other with the lowest), two from MPS I mice transplanted
with WT marrow, and compared with untreated MPS I and wild-type
animals (FIGS. 28B to M). Cytoplasmic vacuoles, which represent
distended lysosomes from which the GAG contents have been leached
by fixation, are the pathognomonic feature of
Mucopolysaccharidoses. In age-matched untreated MPS I mice (7-8
months old), lysosomal inclusions were most marked in Kupffer cells
that were distended by massive vacuoles, as well as in hepatocytes
(FIG. 28E). Extensive pathological vacuoles were also observed in
scattered perisinusoidal cells of the spleen (FIG. 28F). The
interstitial space between myocardial cells was distended by
aggregates of vacuolated interstitial cells in the heart of
untreated MPS I mice (FIG. 28G). In contrast, tissues of all tested
peripheral organs from MPS I mice transplanted with MPS HSC that
were transduced by LV-KIiG, or those transplanted with WT HSC
contained no vacuolated cells (see Material and Methods for
details), and were indistinguishable in regions examined from those
of age-matched wild-type controls. These results indicate that
erythroid-generated recombinant IDUA enzyme can correct lysosomal
storage pathology completely in the liver, spleen and heart.
Example 62
Significant Improvement In Neurological Function and Brain
Pathology In MPS I Mice with Higher-Than-Normal IDUA Activities In
Peripheral Blood
[0246] To determine if the supra-physiological levels of IDUA in
the circulation could lead to functional neurological improvement
in MPS I mice, a repeated open-field test was conducted (FIG. 29).
This test has been shown previously to characterize nonaversive and
non-associative memory deficits in MPS I mice without gender
differences (23). Mice were exposed to the same open-field for 3
repeated trials with a 30 min inter-trial interval. The normal mice
showed a 58% reduction in horizontal locomotor activity, whereas
the MPS I mice only showed a 9% reduction in activity (p<0.001).
Importantly, mice from the MPS/KIiG group exhibited an intermediate
level of habituation (39% reduction in locomotor activity), a
significant improvement toward normal behavior (p<0.05 compared
with MPS I). Whereas MPS/WT group showed no significant
improvement. In addition, the normal mice spent 41% more time
grooming in the final trial than in the first; however, the
untreated mice spent 39% less time in the final trial (p<0.001).
Both treated groups showed significantly normalized grooming
behavior with 20% more for MPS/KIiG mice and 4% more time grooming
for MPS/WT group. Treated mice also had a greater reduction in
rearing on the last trial compared to un-treated controls. These
observations indicated a significant improvement of the memory
deficit in MPS I mice by erythroid derived IDUA in peripheral
blood.
[0247] The histological appearance of forebrain tissues were then
compared (FIG. 29B). Cells that were distended with pathologic
vacuoles were still visible in cerebral cortex of KIiG treated mice
and MPS mice transplanted with WT marrow; however, there appeared
to be a reduction in the number of vacuolated cells. To evaluate
the change more objectively, more than 500 micro-vessels were
assessed for their association with vacuolated perivascular cells
from 9 sections randomly selected from 3 slides of each animal.
Significantly fewer brain capillaries were found to be associated
with vacuolated perivascular cells in both MPS/KIiG and MPS/WT
groups than those from slides of MPS I controls (p<0.01).
Interestingly, the MPS/KIiG mice exhibited significantly less
pathologic accumulation than MPS/WT group (p<0.01). Taken
together, these results demonstrate that behavioral deficits and
CNS pathology can be improved by long-term, supra-physiological
IDUA in peripheral blood derived from erythroid cells.
Example 63
Implications
[0248] This study demonstrated in depth a novel gene therapy
approach that leads to extremely efficient, long-term systemic
delivery of a non-secreted lysosomal enzyme at supra-physiological
levels in the circulation. This approach of restricting transgene
expression to maturing erythroid cells may reduce the risk of
activating oncogenes in hematopoietic stem cells (HSC) and their
progeny, yet take advantage of their robust protein-synthesis
machinery for efficient protein production. The data showed that a
lysosomal enzyme could be produced at high levels and "secreted" by
erythroid cells during in vitro and in vivo definitive erythroid
differentiation. Remarkably, with a relatively low vector copy
number (0.2-0.3 copy/cell), 4- or 8-fold higher than wild-type IDUA
levels were achieved in the blood circulation of primary or
secondary MPS I chimeras during the 9 months of observation. These
levels are at least 40-fold higher than those observed in MPS I
mice fully engrafted with normal donor cells. Considering 5% of
normal plasma IDUA levels is therapeutic based on allogeneic BMT
experience in MPS I patients (5), one can assess that only 0.3%
transduced hematopoietic stem cells would be needed by this
erythroid-specific gene therapy approach to achieve similar
therapeutic plasma level following autologous transplantation.
Thus, this highly efficient, erythroid specific gene expression
approach would make it substantially feasible to achieve clinical
benefits even with the generally low levels of HSC gene transfer
frequency (<1%) commonly obtained in most human HSC gene therapy
clinical trials.
[0249] Unlike intracellular IDUA polypeptides, the released form of
IDUA from normal or enzyme-overexpressing cells appears not to be
proteolytically processed and exhibits a unique molecular weight
that is not found in cell lysate (18, 24). This study indicates
that the IDUA levels were very low in the lysate of uninduced MEL
cells (5% of mouse fibroblasts) and declined to negligible levels
during erythroid induction, while undetectable levels were found in
culture medium. This is not surprising, because the number of
active genes decreases dramatically due to global transcriptional
repression during definitive erythropoiesis (25). In addition,
normal cells are known to release only a small portion of their
IDUA, although the molecular and cellular determinants for IDUA
release remain undefined. The data further showed in vitro that
induced, IDUA-overexpres sing MEL cells could release IDUA in a
similar pattern, but to a lesser extent than intracellular enzyme
production. Moreover, the released form of IDUA is fully functional
with normal lysosomal enzyme trafficking, and suitable for uptake
by other cells via receptor-mediated endocytosis, resulting in
cross-correction of phenotypic defects in cells from MPS I
patients. Importantly, experimentation demonstrated, in vivo, that
the IDUA produced by erythroid cells could lead to long-term
systemic metabolic correction, as well as complete normalization of
tissue pathology in all tested peripheral organs of treated MPS I
mice.
[0250] While proviral integration into hematopoietic stem cells by
randomly integrating viral vectors has the potential to provide a
life-long therapeutic effect, it also carries the risk of
insertional oncogenesis from the strong viral enhancers that can
ubiquitously activate transgene expression (26-28). Vector
genotoxicity has dampened the clinical success of ex vivo stem cell
gene therapy for children with severe X-linked combined
immunodeficiency (7, 8) and X-linked chronic granulomatous disease
(10). Subsequent studies have demonstrated that the ability of LTR
promoter/enhancers to trans-activate genes over large distances in
both directions largely attribute to the increased risk of
transforming potential of vectors (27, 29). Thus the use of vectors
with intact LTRs now has limited clinical utility, even through
many LTRs have been shown to provide robust transgene expression
with resistance to transcriptional silencing (30), such as the
consistent expression from SF promoter observed in this study
during erythroid differentiation. As an alternative, promoters from
cellular housekeeping genes may provide ubiquitous, multi-lineage
transgene expression, and reduce the frequency of transactivating
oncogenes. The EFla promoter is one of the strongest such promoters
in HSCs tested in vitro and in vivo (31). Yet, by restricting
transgene expression to a single lineage, the erythroid specific
hybrid promoter evaluated here generated 4-fold higher IDUA plasma
levels than those derived from EFla promoter. Moreover, this
tissue-specific vector may provide additional safety benefits
compared with ubiquitous promoters. First, the possibility of
transactivating neighboring genes is limited to a much smaller
number of integration sites in transgene-containing progeny of
transduced HSCs, reducing the risk of insertional oncogenesis.
Second, highly efficient IDUA expression and release by IHK would
reduce the demand for high vector copy numbers that are often
associated with increased risks of genotoxicity. Lastly, this
research demonstrates that IHK-derived transgene expression was
predominantly restricted to late stages of erythroid
differentiation. Thus, the timeframe for active transcription from
the IRK promoter during precursor maturation is relatively brief,
approximately 3-4 days (32). This is followed by expulsion of the
nucleus as the cells become reticulocytes, which is arguably one of
the most radical safety features imaginable.
[0251] Several factors may have contributed to the high efficiency
of erythroid cell-derived systemic lysosomal IDUA production
reported in this study. First, red blood cells are the most
abundant blood cells, and are constantly replenished at a rate of
more than 2.times.10.sup.6 per second under normal hematopoiesis
(33). The enormous cell mass and rapid turnover are likely to boost
IDUA production at any given time and contribute to the high plasma
enzyme levels. Second, Sadelain and colleges have demonstrated the
feasibility of introducing long-term secretion of a secreted
clotting factor, human factor IX, using a .beta.-globin promoter
and its locus control region (16). In this study the following
elements were used: a hybrid promoter/enhancer containing the core
sequence from human ankryin-1 gene promoter (34), a strong enhancer
HS40 variant upstream from human embryonic .zeta.-globin gene (35),
and the intron 8 enhancer of erythroid ALAS gene (36). This
promoter has been shown in vivo to drive high erythroid-specific
GFP expression, and to retain viral titers due to its relatively
small size in comparison to other erythroid promoters (17).
[0252] While reprogramming erythroid cells for highly efficient,
continuous lysosomal enzyme production in circulation with
phenotypic corrections is in itself an important finding, the
improvement in brain pathology and behavioral deficit in MPS I mice
after long-term peripheral IDUA delivery is one of the most
compelling observations of this study. It has been generally
believed that the blood-brain barrier (BBB) in the mature brain is
largely impermeable to lysosomal enzymes including IDUA; and that
the CNS benefits observed in some LSD patients receiving allogeneic
BMT treatment early in life (under 2-year old) may be dependent
upon diapedesis of donor HSC-derived macrophage-monocytes into the
brain (37). Recently, a study performed on mice with another LSD,
metachromatic leukodystrophy (MLD), showed that gene marked HSCs
overexpressing relatively high levels of the aryl sulfatase A
enzyme (ARSA) were far more efficient at reversing the pre-existing
CNS deficits (demyelination) than a bone marrow transplant using
normal HSCs (38). Higher than normal ARSA levels were achieved in
serum by transplantation of transduced HSC (using a LTR promoter).
The gene-modified, donor-derived, ARSA-overexpres sing microglia
cells were proposed to be the exclusive source of ARSA in the CNS.
However, it was demonstrated herein that CNS benefit could be
obtained when the sole source of IDUA was in the peripheral
circulation. One possible reason could be that migrating white
cells in the CNS were "super-charged" with IDUA by endocytosis from
constant, high enzyme levels in serum before crossing the BBB. It
has been suggested that CNS pathology in several MPS conditions
(including MPS I) contain an inflammatory component, which
encourages more diapedesis than that occurs under healthy condition
(39). On the other hand, several studies in some LSD models have
shown evidence of partial clearance of CNS storage after multiple
infusions of large doses of synthetic corrective enzyme in adult
mice (40, 41). Low levels of brain entry were implicated to count
for the effects, even through the disappearance of these proteins
from serum were reported to be in minutes. More recently, it has
been suggested that slowing clearance of the recombinant enzyme
from circulation could further improve CNS pathology in MPS VII
mice (42, 43). The LV-mediated erythroid-specific gene therapy
approach developed here could provide continuously higher than
normal IDUA in the circulation with potential life-long CNS
therapeutic benefits.
[0253] In summary, these results are the first to demonstrate that
late-stage erythroid cells, transduced with a tissue-specific LV,
not only can produce and release a lysosomal enzyme successfully
and continuously at supra-physiological levels in circulation, but
also can achieve phenotypic correction in peripheral organs and the
CNS of MPS I mice. This approach will break the conundrum of
achieving high-efficacy with high-copy numbers, thereby increasing
the risk of oncogenesis. This study has important practical
implications for treatment of many lysosomal storage diseases
involving neurological defects, although the efficacy of this
approach in large animal models remains to be assessed. These
studies could also open a door for the utilization of red blood
cell precursors as a depot for efficient, safer, systemic delivery
of non-secreted proteins by ex vivo HSC gene transfer.
Example 64
Lentiviral Vector Construction, Packaging and Concentration
[0254] Three bicistronic self-inactivating LV were constructed by
insertion into a 3.sup.rd-generation LV backbone pLV-TW(1) at the
Afe I restriction sites (between cppt and WPRE) with EF1
.quadrature..quadrature. (GenBank AF403737, 1-1192), or LTR
promoter/enhancer from SFFV (2), or an erythroid specific hybrid
promoter containing a human ALAS2 intron 8 erythroid specific
enhancer, HS40 core element from human alpha LCR and human
ankyrin-1 promoter (3). The expression cassette IDUA-ires-GFP,
containing human IDUA cDNA (4) and eGFP, was inserted into the Hpa
I site. The transfer LVs were packaged by co-transfection of 293T
cells with three helper plasmids: p2NRF for gag-pol, pEF1.Rev for
Rev and pMD.G for VSVG env function as previously described (1).
The potency of viral stocks (typical 10.sup.8-10.sup.9 TU/ml) was
determined by FACS analysis for GFP.sup.+ percentage on 293T cells
or MEL cells (for LV-KIiG vector) exposed to serial LV dilutions
using FACS Canto Flow Cytometer (Becton Dickinson, Lincoln Park,
N.J.). Less than 30% of GFP cells were considered reliable for
titer calculation when most transduced cells contained 1 copy
transgene.
Example 65
Cell Line Manipulation
[0255] MEL cells were cultured at the concentration of 0.5-2
.times.10.sup.6/ml in DMEM medium with 10% fetal bovine serum (FBS)
and antibiotics. Cells were transduced with each vector stock at
2-3 MOI. To induce erythroid differentiation, MEL cells were
subcultured at 10.sup.6/ml in DMEM containing 20% FBS and 1 mg/ml
hexamethylene bisacetamide (HMBA) with medium change every other
days for a total of 8 days. To monitor erythroid differentiation,
cytospins were prepared at 500 rpm.times.5 min in a Cytospin.RTM. 4
Cytocentrifuge (Thermo Shandon Inc, Pittsburgh, Pa.) and stained
with Wright stain (Harleco EMD).
[0256] LCL cell lines were prepared by transformation of PBL from a
normal individual or a MPS I patient with Epstein-Barr virus (5).
Cells were routinely cultured in RPMI medium with 10% FBS, 2 mM
glutamine and antibiotics. All cells were maintained at 37 .degree.
C. in a humidified atmosphere containing 5% CO.sub.2, and were
routinely tested for free of Mycoplasma infection.
Example 66
Uptake Assay and Lysosomal Staining In LCL Cells
[0257] To evaluate enzyme uptake in enzyme deficient cells,
1.times.10.sup.6 LCLmps cells were incubated for 3 hr at 37.degree.
C. with 5% CO.sub.2 with 1 ml of medium that has been
preconditioned by 24-hr culture of MEL-KIiG at Day 7 of induction
culture and contained 30 U/ml IDUA enzyme. Control medium, which
was preconditioned by 24-hr culture of MEL cells at Day 7 of
induction and contained undetectable IDUA, was applied to untreated
LCLmps and LCLnormal. To inhibit IDUA uptake, 1 mM mannose
6-phosphate (M6P) (Sigma) was added 30 minutes prior to subculture
with enzyme-containing medium, as well as during uptake incubation.
Each experiment was performed in triplicate wells.
[0258] To study lysosomal morphology change, an aliquot of treated
cells described above were washed three times and incubated for 1
hr with 75 nM LysoTracker Red (Invitrogen, NY). After three washing
steps with PBS and 1% FBS, we then fixed cells with 4%
paraformaldehyde, and followed by cytospin at 500rpm x 5 min in a
Cytospin.RTM. 4 at 1 .times.10.sup.5/spot. The slides were then
mounted using VECTASHIELD mounting medium with DAPI (Vector
Laboratories Inc., Burlingame, CA) and observed using an Olympus
inverted fluorescence microscope.
Example 67
Isolation, Transduction and Transplantation of Lin.sup.- Cells
[0259] To enrich HSC, low-density bone marrow cells were stained
with a set of biotinylated antibodies including anti-CD3e, B220,
CD4, CD8, CD11b, Gr-1 and Ter119, followed by lineage depletion
using anti-biotin microbead-mediated MACS LS column (Miltenyi
Biotec Inc). Ex vivo transduction of Lin.sup.- cells was conducted
by culturing cells for a 12-hr prestimulation period in serum-free
StemSpan medium (StemCell Technologies) supplemented with 40 ug/ml
LDL, 50 ng/ml stem cell factor (SCF), 20 ng/ml thrombopoietin
(TPO), 10 ng/ml IL3, 50 ng/ml IL6. Cells were then transduced twice
within 24-hr at the presence of 8 ug/ml protamine sulfate. Lin
cells were then injected into lethally irradiated (split dosage of
700 and 475 cGy) mice at 10.sup.5 cells/mouse. All animal
procedures were approved by Institutional Animal Care and Use
Committee of Cincinnati Children's Hospital Medical Center.
Example 68
Immunochemical Staining and Flow Cytometry Analysis
[0260] LCL cells were stained with LysoTracker Red (Invitrogen),
and evaluated using mounting medium with DAPI (Vector Laboratories
Inc.). Fresh bone marrow or CFU-S cells were immunostained with
PE-conjugated anti-CD71 and PE-Cy7-conjugated anti-Ter119 (BD
Biosciences) as previously described (6), with concurrent staining
for 7-amino-actinomycin D (BD Biosciences) to gate out apoptotic
cells. Single cell suspensions were analyzed using a FACS Canto
with FacsDiva software v6.1 (Becton Dickinson).
Example 69
Spleen Colony Forming Unit Assay
[0261] CFU-S assay was performed by transplanting 1.times.10.sup.5
bone marrow cells from a primary recipient into each irradiated
(950 cGy) C57BL/6J mouse. Discrete spleen colonies were collected
12 days after transplantation. Aliquots from each colony were
analyzed by enzyme assay for IDUA expression, and by qPCR for copy
number analysis.
Example 70
IDUA Enzyme Assay
[0262] The catalytic activity of IDUA was measured with a
fluorometric enzyme assay as previously described with
modifications (4). Cell pellets were homogenized in distill water
using Ultrasonic Processor (GE). Aliquots of cleared lysate, plasma
or culture medium were incubated with 2.5 mM fluorogenic substrate,
4-methylumbelliferyl (4MU) .alpha.-L-idopyranosiduronic acid sodium
salt (Toronto Research Chemicals Inc., North York, ON, Canada),
together with no sample blank controls in parallel. All samples
were assayed in duplicate reactions and each reaction was
quantified twice using a Fluorescent plate reader (SPECTRA MAX
GEMINIxS from Molecular Devices). Protein concentration was
measured by Coomassie blue dye-binding assay (BioRad, Hercules,
Calif.). One unit (U) of enzyme activity is defined as the release
of 1 nmol of 4MU in a 1-hr reaction at 37.degree. C. The
intracellular IDUA specific activity was calculated as U/mg
protein, and extracellular IDUA activity U/ml medium.
Example 71
Real-Time Quantitative PCR
[0263] GFP transgene and endogenous murine ApoB were both
quantified simultaneously in the same 250 reaction by real-time
PCR, as described previously with minor modification (7). Genomic
DNA was isolated from PBL, BM or CFU-S colonies with Gentra
Puregene Blood Kit (Qiagen, Valencia, CA). The multiplex reaction
contained 5-20 ng genomic DNA, 200 nM of each GFP primer, 200 nM
TaqMan GFP probe, 40 nM of each ApoB primer, 200 nM ApoB probe, and
12.5 .mu.l TaqMan 2.times. Universal Master Mix (Applied
Biosystem). Unknown samples were run in triplicate, and standard
samples were in duplicate. A standard curve (ranging from 0.1% to
100%) was established from a series of genomic DNA mixtures (10 ng)
of a murine myeloid cell line (32Dp210) with a GFP containing cell
line (32Dp210-LNChRGFP) (1 copy per genome as determined by
Southern blot analysis). The amplification conditions were 2 min at
50.degree. C. and 10 min at 95.degree. C. for the first cycle,
followed by 45 cycles of 95.degree. C. for 15 sec and 60.degree. C.
for 1 min.
Example 72
Quantification of Urinary GAG
[0264] Urine samples were obtained by bladder palpation. We
quantified GAG excretion based on methods previously described (8)
with modifications. Briefly, urine aliquots were serially diluted
with sodium formate buffer (pH3.0), and mixed in duplicate with
freshly prepared 1,9-dimethylmethylene blue (DMB) solution (0.35 uM
in sodium formate buffer, pH3.0). Absorbance of the color reaction
was measured at 535 nm within 30 min on DU50 spectrophotometer and
compared with standard curve generated with heparan sulfate
standard solutions (Sigma). To normalize urine concentration,
urinary creatinine was quantified by incubating diluted samples
with freshly made picric acid/sodium hydroxide solution (10%
saturated picric acid and 0.09M NaOH) for 20 min, measuring
absorbance at 535nm and calculated using standard curve established
with creatinine reference solutions (Sigma).
Example 73
Chemical Staining and Pathology Evaluation
[0265] At the end of observation period, mice were euthanized by
intraperitoneal administration of an overdose of sodium Nembutal
(Abbott Laboratories). After blood collection and removal of hind
legs for marrow harvest, each mouse was perfused transcardially
through the aorta with cold normal saline briefly, and followed by
4% paraformaldehyde. Tissue samples were fixed by 2% glutaraldehyde
in 0.175M sodium cacodylate buffer (pH7.4) at 4.degree. C. The
tissue is then treated with 1% osmium tetroxide, washed in 0.175M
sodium cacodylate buffer, dehydrated by a graded ethanol series and
embedded in LX112. Sections (0.5-1 .mu.m) were prepared and stained
with 1% Toluidine blue in 1% sodium borate, followed by examination
for the presence of pathologic storage vacuoles. Two animals per
groups were analyzed with 6 sections randomly selected from 3
slides for each organ. For brain pathologic scoring, cells
containing <5 cytoplasmic vacuoles were considered as normal
while those with >30 vacuoles as positive. More than 500
micro-vessels were scored for each animal from 9 sections randomly
picked from 3 slides. The mean of scoring data from 6 slides is
shown for each group.
Example 74
Behavioral Test
[0266] The repeated open-field test was performed 5 months after
BMT at the age of 7-months as described previously (9). The
open-field apparatus (60.times.60 cm) consisted of a white
Plexiglas box with 25 squares (12.times.12 cm) painted on the floor
(16 outer and 9 inner). Briefly, the mouse was placed in one of the
four corners of the apparatus and allowed to freely explore the
whole field for 5 min. Activity was monitored and quantified for
ambulation (number of inner and outer squares crossed), rearing
frequency and time spent grooming by two observers who did not know
the genotype or treatment of the animal during testing. Each mouse
was tested for three repeated trials with 30-minute inter-trial
intervals.
Example 75
Statistical Analysis
[0267] All quantitative assays were performed in duplicate or
triplicate from at least two individual experiments. Data are
presented as mean .+-.standard deviation unless specified.
Comparisons between two groups were performed using two-tailed
Student t-tests. P values of less than 0.05 were considered as
statistical significance.
Example 76
Generally
[0268] Sickle cell anemia (SCA) results from a point mutation in
the-globin gene .beta..sup.S), resulting in sickle hemoglobin
(HbS). HbS polymerizes upon deoxygenation resulting in
sickle-shaped RBCs that occlude microvasculature. Patients with SCA
have intermittent acute vascular occlusions and cumulative organ
damage, reducing the life span to 42 to 58.5 years. Besides
sickling, excessive hemolysis and a state of chronic inflammation
exist. SCA patients account for approximately 75,000
hospitalizations per year, resulting in an estimated annual
expenditure of $475 million dollars in the United States alone.3
Worldwide, SCA is second only to thalassemia in incidence of
monogenic disorders, with more than 200,000 children born annually
in Africa.
[0269] Current therapies include supportive care for episodic
sickling, chronic transfusions with iron chelation, and hydroxyurea
to induce fetal hemoglobin (HbF). These therapies impact disease
morbidity, but their effectiveness is variable and dependent on
compliance to an indefinite treatment regimen. A matched allogeneic
hematopoietic stem cell (HSC) transplantation is curative, but
restricted by the availability of matched related donors5 and has
potential serious complications. A meta-analysis of 187 SCA
transplantations shows 6% to 7% conditioning-related
peritransplantation mortality, 7% to 10% acute rejection, and 13%
to 20% chronic graft-versus host disease (GVHD) in recipients.
[0270] Gene therapy of autologous HSCs followed by transplantation
could result in a one-time cure, avoid adverse immunologic
consequences, and not be limited by availability of donors; it may
also not require myeloablative-conditioning regimens, and thereby
have lower toxicity. The amount of HbF/anti-sickling globin
required to correct SCA via a transgene is unknown.
[0271] Expression of HbF postnatally can be therapeutic, as is
evident by the protective effect of HbF in neonatal sickle RBCs and
in patients with hereditary persistence of HbF and SCA. The
proportion of genetically corrected HSCs, the amount of exogenously
expressed HbF, and the proportion of F cells that will correct the
pathophysiology are unknown. Complete correction of human
thalassemia major in vitro, and in xenografted mice in vivo, with a
lentivirus vector carrying the .beta.-globin gene and locus control
region (LCR) elements has been demonstrated. In this report, this
.beta.-globin lentivirus vector was modified to encode
.gamma.-globin exons and murine sickle HSCs were transduced.
Functional correction was characterized first, with a careful and
detailed quantification of RBC sickling, half-life, and
deformability, with sickle to normal transplantations and high HbF
production to define parameters of correction. Next, using
reduced-intensity conditioning and varying the percentage of
transduced HSCs, transplantations were performed on sickle mice
with significant organ damage and demonstrate the proportions of
(1) genetically corrected HSCs, (2) HbF, and (3) F cells, and (4)
percentage of HbF/F cell required for correction of the sickle RBC
and amelioration of organ damage in SCA.
Example 77
Vector
[0272] It has been demonstrated that a .beta.-.gamma.-globin hybrid
gene carrying lentivirus vector, I8H .beta./.gamma.W,11 expresses
high .gamma.-globin mRNA in erythroid cells expressing "adultlike"
globins. All .beta.-globin coding sequences were changed to
.gamma.-globin using site-directed mutagenesis and the
.gamma.-.beta.-globin hybrid gene, and LCR elements were cloned in
reverse orientation to the viral transcriptional unit to generate
sGbG lentivirus vector. Virus was made with cotransfection of 293T
cells.
Example 78
Murine HSC Enrichment
[0273] Bone marrow from 6- to 20-week-old BERK sickle mice was
harvested and lineage depleted with biotinylated CD5, CD8, B220,
Mac-1, CD11b,Gr-1, and TER-119 antibodies and magnetic beads. The
bead-free cells were stained with antibodies to Sca-1, c-kit. Cells
that were 7-AAD.sup.-,Lineage.sup.-, c-kit+then Sca-1.sup.+ (LSK
cells) were sorted on FACSVantage (BDBiosciences). All experiments
using Berkeley transgenic sickle mice and C57/BL6 mice were
performed according to protocols approved by the Cincinnati
Children's Hospital Medical Center.
Example 79
Gene Transfer and Bone Marrow Transplantation
[0274] Myeloablative transplantations were performed from
BERK3C57B1/6 mice because of ease of transplantation and ready
availability of normal recipients (9.5 .sup.30 /- 0.6 weeks old)
after 11.75 Gy radiation. Radiation control experiments showed that
BERK mice receiving 8 to 9 Gy radiation survived without receiving
LSK cells; and the lethal dose was lower than in C57B1/6 mice. BERK
mice receiving more than 10.5 Gy died when no LSK cells were given;
those given LSK rescue survived long term. BERK mice are difficult
to breed in large numbers at a given time, therefore 2
mice/radiation dose level were to determine the sublethal dose. All
BERK recipients (12.9 .sup.+/- 0.4 weeks old) received 3
peritransplantation RBC transfusions (days 1-7). Organ pathology in
BERK recipients 1 year after transplantation was compared with
12-week-old BERK mice that did not undergo transplantation. The
radiation was higher than classical reduced intensity radiation
dose of 4 Gy to allow a large degree of donor HSC chimerism. A
range of MOI was used to vary the proportion of transduced donor
HSCs in the graft. LSK cells were prestimulated overnight and
transduced twice at an MOI of 30 for BERK3C57BL/6 transplants and
MOI of 30 to 100 for BERK.fwdarw.BERK transplants for 22 to 24
hours; 10,000 to 24,000 LSK cells and untransduced LK cells were
cotransplanted into recipient C57BL/6 or BERK mice.
Example 80
Copy Number Analysis
[0275] Copy number analysis was done on genomic DNA by real-time
polymerase chain reaction using primers and probes described
previously.
Example 81
Hematologic Analysis
[0276] Hematologic analysis was obtained on Hemavet 950FS (Drew
Scientific) under mouse settings. Reticulocyte analysis was
performed as follows: 0.1 .mu.L blood and 200 .mu.L BD Retic-COUNT
Reagent were mixed (Becton Dickinson), incubated at room
temperature for 30 minutes, and analyzed by fluorescence-activated
cell sorting (FACS).
Example 82
Hemoglobin Analysis
[0277] Hemoglobin electrophoresis was performed on cellulose
acetate plates, as described previously. Ion exchange
high-performance liquid chromatography (HPLC) was performed with an
Alliance 2690 HPLC machine (Waters) using a PolyCATAcolumn (item
no. 3.54CT0510; Poly LC Inc).
Example 83
Red Blood Cell Functional Analysis
[0278] Irreversibly sickled cells (ISCs) were enumerated by scoring
500 RBCs in consecutive fields. Graded deoxygenation was performed
using tonometry. RBC deformability was determined using a
laser-assisted optical rotational cell analyzer (LORCA; RR
Mechatronics).
Example 84
RBC Half-Life
[0279] Mice were injected with 3 mg Sulfo-NHS biotin (Sigma) in 300
.mu.L PBS as 2 separate injections 1 hour apart; 2 to 5 .mu.L blood
was drawn at serial times, and stained with APC-Cy7-conjugated
streptavidin.
Example 85
Histology
[0280] Spleen, liver, bones, brain, and kidney were harvested and
placed in 5 mL of 10% formalin. Paraffin blocks were sectioned and
stained with hematoxylin and eosin.
Example 86
High HbF After Gene Therapy and Myeloablative Transplantation
Corrects SCA
[0281] The sG.sup.bG vector carries .gamma.-globin exons and
.beta.-globin noncoding and regulatory regions. Based upon a
previously studied sBG vector, which expresses high levels of human
.beta.-globin,13 sG.sup.bG-transduced LSK cells from Berkeley
sickle (BERK) mice were transplanted into lethally irradiated
(myeloablated) normal C57B1/6J mice (termed G.sup.bG mice). Mock
transductions on BERK LSK cells from the same bone marrow pool
followed by transplantation resulted in mice with SCA. The majority
of RBCs in G.sup.bG mice expressed HbF. Only G.sup.bG mice with
100% donor (HbS.sup.+) RBCs, with no evidence of residual recipient
murine hemoglobin by electrophoresis and HPLC, were analyzed for
hematologic, functional, and pathologic analysis. G.sup.bG mice
with a small proportion of recipient murine RBCs, were used only to
assess HbF/vector copy and frequency of transduced HSCs. The
percentage of HbF (HbF/HbS+HbF) in blood, quantified by FACS, was
approximately 40% in primary mice followed for 6 months and in
secondary recipients followed for 7.5 months (FIG. 30A). Two-thirds
of RBCs were F cells; their proportion was also stable in primary
and secondary recipients (FIG. 30B). The proportion of F cells and
vector copies correlated with HbF (FIGS. 31 C-D). Taken together,
these data show significant HbF expression from the sG.sup.bG
vector in the majority of RBC with stable long-term expression.
Example 87
High Levels of HbF Result In Sustained Hematologic Correction
[0282] FIG. 30E shows improvement of hematologic parameters in
G.sup.bG mice. The proportion of reticulocytes decreased from
approximately 50% in mock mice to approximately 15% in G.sup.bG
mice (P<.005; FIG. 31A). There was correction of anemia by 12
weeks, which persisted throughout the posttransplantation period
(FIGS. 31B-C)}.
[0283] High white blood cell (WBC) counts in humans with SCA and
BERK mice reflect the baseline inflammation in this disease. WBC
returned to normal levels in G.sup.bG mice (FIG. 31D; FIG.
30E).
[0284] Notably, WBC counts were lower in the mock mice compared
with BERK mice that did not undergo transplantation, likely because
in the former, sickle HSCs were transplanted into a normal
"noninflamed" C57/BL6 background. Indeed, 6 weeks after
transplantation, WBC counts in mock group of mice were nearly
normal, then gradually rose to high levels seen in SCA (FIG. 31D)
Overall, hematologic parameters showed marked improvement to near
normal levels, and improvement was stable over a prolonged period
in primary and secondary G.sup.bG mice. The degree of correction
correlated with the proportion of F cells (FIGS. 31E-H) and HbF
(data not shown). High levels of HbF improve the functional
parameters of RBCs in sickle mice. (1) Sickling: The irreversibly
sickled cells (ISCs) were significantly reduced to 2.3% plus or
minus 0.7% in G.sup.bG mice, compared with 12% plus or minus 0.8%
in BERK controls and 10.2% plus or minus 0.3% in mock mice (FIGS.
32A-B). Deoxygenation of blood from a representative G.sup.bG mouse
shows a dramatic reduction in sickling (FIG. 32C). A systematic
quantification showed a marked decrease in the proportion of sickle
RBCs in G.sup.bG mice with increasing hypoxia (FIG. 32D). (2) RBC
membrane deformability: Normal RBCs deform readily at low shear
stress (3 Pascals [Pa]), representative of shear stress in
smallvessels. Sickle RBCs have relatively rigid membranes with
remarkably reduced deformability even at high shear stress (28 Pa;
representative of shear stress in large vessels). There was
markedly improved deformability of RBCs of G.sup.bG mice, although
it did not achieve normal levels (FIG. 32E). This may reflect the
proportion of circulating sickle RBCs that did not contain HbF. (3)
RBC survival: Survival of human sickle RBCs is an order of
magnitude less than normal RBCs. The time to 50% reduction
(half-life) in G.sup.bG and mock/BERK sickle mice was measured. The
overall survival of the G.sup.bG RBCs was markedly improved, with
the time to 50% reduction approximately 4 times longer in RBCs from
G.sup.bG mice compared with BERK or mock mice (FIG. 32F). (4) RBC
hemolysis: RBC hemolysis detected by measuring lactate
dehydrogenase (LDH) in blood was reduced from 2706 plus or minus
148 mg/dL in mock mice to 1286 plus or minus 345 mg/mL in GbG mice
(n=5; P<0.004).
Example 88
High Levels of HbF Prevent Chronic Organ Damage Associated with
SCA
[0285] Bone marrow, spleen, liver, and kidneys at 24 weeks showed
complete prevention of organ pathology. There was reduced erythroid
hyperplasia in bone marrow and spleen, decreased spleen size, and
preservation of the splenic follicular architecture, compared with
obliterated follicular architecture from the severe erythroid
hyperplasia in mock mice. The focal tubular atrophy and segmental
glomerular infarction seen in mock mice were absent in the G.sup.bG
mouse kidneys. Infarctions and extramedullary hematopoiesis seen in
livers of mock mice were absent in livers of G.sup.bG mice (FIG.
32G summarizes the data in all groups of mice). Overall, except for
a mild erythroid hyperplasia no organ pathology was observed in the
G.sup.bG mice.
Example 89
High HbF Expression Improves Survival of Sickle Mice
[0286] The life span of BERK sickle mice is significantly reduced,
as in humans with SCA before modern treatment. Kaplan-Meier
survival curves showed a 100% survival of the G.sup.bG mice at 24
weeks, in contrast to 20% survival in mock mice (n=14,
P<0.001).
Example 90
Minimal Parameters Required Correction of SCA
[0287] Myeloablative conditioning allows noncompetitive
repopulation of gene-corrected donor HSCs, resulting in high
transgene-modified HSC engraftment and transgene expression. It was
hypothesized that high levels .gamma.-globin expression achieved by
myeloablative conditioning may not be necessary for correction, and
if so, would reduce transplantation-related morbidity.
[0288] Reduced-intensity transplantation was accomplished by
transplanting gene-modified BERK LSK cells into sublethally
irradiated, but with significantly high radiation dose, BERK mice.
The proportion of transduced HSCs and vector copy/cell in the graft
was varied by transducing LSK cells with at a range of MOI
(30-100). Since the half-life of BERK RBCs was 1.5 to 2 days (FIGS.
33G-H), mice were transfused in the peritransplantation period and
analyzed after 12 weeks. Three serial experiments were carried out
with mice followed for 1 year. G.sup.bG mice were analyzed by
separating them into 3 groups based upon percentage of HbF at 18
weeks: HbF=0% (mock, n=4), HbF less than 10% (termed
G.sup.bG<10; n=17), and HbF of 10% or more (termed
G.sup.bG>10; n=9); (FIG. 33A). The cutoff at 10% HbF was
selected as this appeared to be a threshold level of HbF that
reflected correction of disease: G.sup.bG<10 mice showed a
higher mortality and inconsistent hematologic correction, compared
with G.sup.bG.gtoreq.10 described in the following paragraph. The
mouse numbers in the groups changed with time primarily due to the
increased mortality related to SCA in mice with no/low HbF. The
GbG.gtoreq.10 group of mice had 16% (.+-.1.2%), 17% (.+-.1.8%), and
21% (.+-.2.3%) HbF, whereas the G.sup.bG<10 group of mice had 5%
(.+-.1.4%), 4% (.+-.0.6%), and 4% (.+-.0.5%) HbF at 12, 18, and 24
weeks, respectively, that was stable up to 1 year (FIG. 33B).
F-cell repopulation was significantly higher in G.sup.bG.gtoreq.10
mice (65% .+-.14%) compared with G.sup.bG<10 mice (30%.+-.9.4%;
(FIG. 33C). G.sup.bG.gtoreq.10 mice had 2 to 2.5 vector
copies/cell, whereas the G.sup.bG<10 mice had 1.4 copies/cell
(FIG. 33D).
Example 91
Hematologic Improvement Occurred with Reduced-Intensity
Transplantations
[0289] Hematologic parameters stabilized at 18 weeks, due to
persistent transfused RBCs in the early posttransplantation period.
There was a significant improvement in hematologic parameters in
the G.sup.bG.gtoreq.10 group of mice (FIG. 32G), in contrast to a
small and inconsistent improvement in G.sup.bG<10 mice.
Example 92
Improvement In RBC Function Occurs with Reduced-Intensity
Transplantations
[0290] Sickling: There was a very significant reduction in ISCs in
G.sup.bG.gtoreq.10 mice (P<0.005) and a small, but significant
reduction in ISCs in G.sup.bG<10 mice compared with mock/BERK
controls (P<0.05, FIG. 33E). RBCs from G.sup.bG.gtoreq.10 mice
showed reduced sickling when exposed to graded hypoxia, compared
with RBCs from G.sup.bG<10 or mock/BERK mice (n=20, P<0.01;
FIG. 33F). In contrast, there was no significant difference in
sickling between G.sup.bG<10 and mock/BERK mice. (2) RBC
membrane deformability: Surprisingly, despite similar degree of
sickling with hypoxia in RBCs from G.sup.bG<10 mice and
mock/BERK mice, there was slight improvement in RBC deformability
in the G.sup.bG<10 mice. However, these differences were not
statistically significant from the mock/BERK mice due to the high
variance (FIG. 33G). In contrast, there was a consistent
significant improvement in RBC deformability in G.sup.bG.gtoreq.10
mice (P<0.001, FIG. 33H). The deformability pattern suggested
improved RBC flow through large vessels and microvessels. (3) RBC
survival: RBC half-life of BERK mice was 1.5 days. RBCs of G.sup.bG
mice with 1%, 3%, and 7% HbF had a slightly higher half-life (2
days). Two G.sup.bG mice with 18% HbF showed an RBC half-life of 6
days, a 4-fold increase, similar to that seen in mice carrying 40%
HbF in the myeloablative transplantation model.
[0291] Taken together, the sG.sup.bG vector resulted in significant
and consistent hematologic and functional correction of SCA, when
the HbF production exceeded 10% of the total hemoglobin. Notably,
the improvement in phenotype was comparable with that achieved with
myeloablative conditioning.
Example 93
Remarkable Improvement In Organ Pathology when HbF Concentrations
Exceed 10%
[0292] One unique feature of this BERK.fwdarw.BERK transplantation
model was presence of significant sickle pathology in recipients at
the time of transplantation (determined using BERK controls of
comparable age as recipient mice when they underwent
transplantation). Therefore, the potential for reversal of organ
pathology after gene therapy could be assessed. Organ pathology in
the surviving mice at approximately 50 weeks after transplantation
was compared with 3-month-old BERK mice that did not undergo
transplantation (FIG. 34A; FIG. 34C). The G.sup.bG<10 group of
mice showed slight improvement in organ pathology: There was a
slight reduction in spleen weight (717.+-.162 mg in G.sup.bG<10
vs 870.+-.71 mg in BERK/mock mice; P value, NS). Bone marrow and
spleens showed moderate to severe erythroid hyperplasia; livers had
infarctions and extramedullary hematopoiesis; and the kidneys
showed occasional focal segmental lesions, focal tubular atrophy,
and vascular congestion (FIG. 34D). In contrast, a dramatic
reversal of organ pathology was seen in G.sup.bG.gtoreq.10 mice:
there was a 50% reduction in spleen weight to 363 plus or minus 85
mg, preservation of splenic follicles, and mild erythroid
hyperplasia in bone marrow and spleen. Remarkably, no liver
infarctions and no kidney pathology were detected, except in one
mouse with a single focus of focal tubular atrophy. Overall,
G.sup.bG .gtoreq.10 mice showed correction of organ pathology. The
lack of organ pathology in G.sup.bG mice at 15 months of age
compared with 3-month-old BERK controls demonstrates that gene
therapy with the sG.sup.bG vector in a reduced-intensity
transplantation setting prevents any further organ damage, and the
existent organ damage at the time of transplantation probably
reverses from regeneration.
Example 94
Survival
[0293] There was a significant improvement in overall survival in
the G.sup.bG.gtoreq.10 mice compared with G.sup.bG<10 or mock
mice (FIG. 34B; P<0.05). Indeed, at 24 weeks, survival of the
G.sup.bG .gtoreq.10 mice was comparable with survival in mice with
approximately 40% HbF in the myeloablative transplantation model
that were followed for 24 weeks. There was some improvement in
early survival in G.sup.bG<10 mice compared with mock mice
(P<0.05). However, by 1 year, there was no difference in
survival of G.sup.bG<10 mice over mock mice.
Example 95
F Cells and HbF/F Cell Critical for Improved RBC Survival and
Correction of SCA
[0294] Using biotin surface labeling and intracellular HbF
staining, the survival of F cells and non-F cells was studied in
the same animal, which allowed quantification of the HbF/F cell
necessary for improved sickle RBC survival and deformability. F
cells showed a selective prolonged survival, as anticipated (FIG.
35A). The average HbF/F ce1120 in G.sup.bG mice in the BERK3C57B1/6
model was 64% (in these mice, HbF was 41% .+-.5%, F cells were
64%.+-.6%). In the reduced-intensity transplantation model,
G.sup.bG 10 mice had 32% HbF/F cell (in these mice HbF was 21%
.+-.2%, F cells were 65% .+-.14%), and G.sup.bG<10 mice had 13%
HbF/F cell (HbF, 4%.+-.0.1%; F cells, 30%.+-.9.4%). Note that
G.sup.bG mice in the myeloablative model and G.sup.bG.gtoreq.10
mice had similar F-cell repopulation (64%-65%), suggesting that 32%
HbF/F cell was sufficient to correct the sickle phenotype. However
G.sup.bG<10 mice with 13% HbF/F cell and 30% F cells had
inconsistent and insignificant amelioration of the disease
phenotype.
[0295] Therefore, the half-life of F cells in mice was determined,
grouped by the percentage of HbF/F cell. G.sup.bG mice with low
(16%; n=2), intermediate (33%; n=4), and very high (89%; n=2) HbF/F
cell was injected with biotin and followed by periodic blood
sampling. It was determined that mice with low HbF/F cell had no
improvement in RBC half-life over BERK controls (FIG. 35B), those
with 33% HbF/F cell had a 3- to 4-fold improvement in half-life,
and mice with very high amounts of HbF/F cell showed RBC survival
similar to normal mice. These data demonstrate that if one-third of
the hemoglobin within a sickle RBC is HbF, there is significant
improvement in RBC survival. Mice with these levels of HbF/F cell
showed approximately 65% F cells, more than 10% HbF.
[0296] To confirm the impact of percentage of circulating F cells
on overall RBC deformability, mice from both the myeloablative and
reduced-intensity experiments (n=34) were grouped into 3 groups:
mice with less than 33% circulating F cells, 33% to 65% F cells,
and 66% or more F cells and measured RBC deformability. Only data
from the low (3 Pa) and high (28 Pa) shear rates are plotted in
FIG. 6C. Mice with more than 66% F cells had a highly significant
improvement in RBC deformability at both high and low shear stress
(P<0.01). Mice with 33% to 66% F cells had significantly
improved RBC deformability only at high shear stress (P<0.05).
Mice with less than 33% F cells showed inconsistent improvement in
RBC deformability at low or high shear stress, which was not
significantly different from mock controls. These data quantify the
critical amount of HbF/F cell, the proportion of F cells, and
overall HbF that are necessary for correction of sickle cell
disease.
Example 96
Proportion of Transduced HSCs Required for Phenotypic
Correction
[0297] The proportion of HSCs transduced with sG.sup.bG in G.sup.bG
mice was analyzed by the secondary spleen colony-forming unit
(CFU-S) assay performed at 6 months in both models (FIGS. 36A-B).
Bone marrow aspirates were performed at 6 months in the
BERK.fwdarw.BERK mice that were followed for 1 year. The proportion
of transduced CFU-S's was determined by HbF expression. It has been
previously shown that all vector-positive CFUs express the
transgene in an identical vector that encodes .beta.-globin.
G.sup.bG mice in the myeloablativeconditioning group had 16% to 87%
sG.sup.bG-transduced CFU-S's (average HSC transduction was
.about.50%), and those in the
[0298] reduced-intensity group had 5% to 60% transduced HSCs
(average HSC transduction was .about.30%). It is to be noted that
in the reduced-intensity model, HSC transduction is overestimated,
secondary to the higher mortality of G.sup.bG<10% mice in the
first 6 months.
[0299] Importantly, 3 mice with 16%, 20%, and 22% transduced
CFU-S's had more than 10% HbF (HbF was 20%, 11%, and 18%,
respectively) and showed complete phenotypic correction. A vector
copy number analysis was performed concurrently at 24 weeks on bone
marrow cells and showed 1 to 3 copies/cell and 1 to 2.5 copies/cell
in G.sup.bG mice that underwent transplantation using the
myeloablative conditioning and reduced-intensity conditioning
models, respectively. When corrected for HSC transduction, there
were 1.5 to 5 vector copies/cell.
Example 97
Transduction of Human CD34.sup.+ Cells
[0300] The percentage of gene-modified HSCs necessary for effective
gene therapy is critical in this disease. In vitro studies on SCA
marrow can be done only on a small scale, and would read out
correction in progenitors, not HSCs. HSC correction was shown in
humanized models of SCA with long-term analysis. The extremely
limited numbers of RBCs produced from injecting human thalassemia
bone marrow CD34.sup.+ cells are prohibitive for studies on
sickling. Therefore, lentivirus transduction into normal human
CD34.sup.+ cells was optimized for a preclinical scale-up, using a
GFP lentivirus vector and the severe combined immunodeficient
(SCID)-repopulating assay. Granulocyte colony-stimulating
factor-mobilized peripheral blood CD34.sup.+ cells transduced with
a GFP lentivirus vector were transplanted into nonobese diabetic
(NOD)/LtSz-scid IL2Rynull (NOG) mice. Here, mock mice were those
that received a transplant of untransduced CD34.sup.+ cells
immediately after selection, as controls for the effect of
transduction on engraftment and clonogenicity. At 6 weeks, CFUs
were plated from bone marrow derived from NOG mice, and 36
individual CFUs/mouse were analyzed for the percentage of
gene-marked colonies. The 18-hour transduction did not affect
engraftment or clonogenicity (data not shown). A 77% gene transfer
on average was observed in the SCID-repopulating cell assay,
similar to previous data in human thalassemia CD34.sup.+ cells.
[0301] The data from this study indicates that lentiviral delivery
human .gamma.-globin under .beta.-globin regulatory control
elements in HSCs results in sufficient postnatal HbF expression to
correct SCA in mice. The amount of HbF and transduced HSCs was then
de-scaled, using reduced-intensity conditioning and varying MOI, to
assess critical parameters needed for correction. A systematic
quantification of functional and hematologic RBC indices, organ
pathology, and life span were critical to determine the minimal
amount of HbF, F cells, HbF/F cell, and gene-modified HSCs required
for reversing the sickle phenotype.
[0302] Results indicate the following: (1) Amelioration of disease
occurred when HbF exceeded 10%, F cells constituted two-thirds of
the circulating RBCs, and HbF/F cell was one-third of the total
hemoglobin in RBCs; and when approximately 20% sG.sup.bG modified
HSCs repopulated the marrow. (2) Genetic correction was sustained
in primary or secondary transplant recipients followed long-term.
(3) There is a method of determining minimum HSC chimerism for
correction of a hematopoietic disease in an in vivo model, which
would contribute to design of cell dose and conditioning regimens
to achieve equivalent genetically corrected HSCs in human clinical
trials.
[0303] One novel aspect of this study is that it addresses, for the
first time, the gene dosage and the gene-modified hematopoietic
stem cell dosage required for correction of a genetic defect.
Expressing a tremendous amount of fetal/antisickling hemoglobin
will undoubtedly correct disease, as has been shown by others, but
is not practically possible in a clinical setting. As an example,
an initial gene therapy for adenosine deaminase (ADA) deficiency
was performed using no conditioning, and was not therapeutic, even
though few gene-marked stem cells engrafted, and a selective
advantage to gene-corrected lymphocytes was evident upon withdrawal
of ADA. In a subsequent trial, 4 mg/kg busulfan was used before
transplantation, as conditioning, resulting in adequate
gene-corrected stem cell dose and gene-modified T cells. Although
these pioneering studies provided us with invaluable information,
they underscore the critical importance of determining thresholds
for genetic correction before embarking on clinical studies.
[0304] Although disease has been corrected at 1 to 3 copies/cell,
the present study indicates that the percentage of transduced stem
cells in this setting of lethal irradiation/transplantation is very
high (average HSCs transduced are 50%, as analyzed by a stringent
secondary CFU-S assay). This level of HSC transduction would likely
not be achieved in the clinical setting unless myeloablation is
performed.
[0305] Therefore a novel model (BERK to BERK transplantation) was
developed to address the minimal gene transfer needed, and answer
questions of correction of SCA in a mouse with significant sickle
pathology at 12 weeks of life (FIG. 34). Notably, a sickle to
normal myeloablative transplantation, used by other groups showing
correction of SCD, is a disease prevention model, where there was
no underlying pathology at time of transplantation. The present
studies show that repair of preexisting pathology can occur, if
genetic correction results in more than 10% HbF.
[0306] BERK mice have some degree of thalassemia. Therefore one
concern in using this model for genetic therapy studies for sickle
cell anemia is that correction of thalassemia would obscure
[0307] Improvements made by the antisickling effects of HbF.
Surprisingly no significant change in MCH in G.sup.bG<10 or
G.sup.bG>10 mice, including mice with HbF/F cell as high as 89%
were seen (as disclosed herein). These results were surprising, but
showed that the correction of sickling in RBCs was not secondary to
correction of thalassemia, as seen in murine thalassemia model,
where increasing MCH was seen with increases in HbF of 4% or
higher. Conceivably, HbF is produced at the expense of HbS.
[0308] Although BERK mice exclusively carry human hemoglobin, the
total hemoglobin in the mouse RBCs is one-third of a human RBC.
Therefore, HbF and HbF/F cell were expressed as a percentage,
rather than in absolute amounts, to best compare murine data to
human. An increase of HbF from 3.6% to 13.6% has been shown to
reduce acute sickle events in patients on decitabine. Similar
improvement in sickle events occurs with 25% or more HbF/F cell in
patients responsive to hydroxyurea. Data presented here, indicating
improvement with 33% HbF/F cell, is concordant with these reports,
but more closely resemble RBCs in infants with SCA, where less than
one-third HbF/F cell at 10 to 12 months is considered a threshold
for intracellular sickle polymerization. The most remarkable effect
of .gamma.-globin production with the sG.sup.bG vector was a
dramatic absence of chronic organ damage and an improved survival
of the sickle mice when HbF exceeded 10%. Patients with high HbF
have an improved survival, confirmed by the multicenter study on
hydroxyurea. HbF expressed from the sG.sup.bG vector was comparable
with, or even better than, effective hydroxyurea treatment. The
potential of a one-time correction, where responsiveness to
hydroxyurea and compliance to daily life-long administration would
not be limiting factors, would be a tremendous advantage of gene
therapy. Indeed, we did not anticipate we would get the same
conclusion with gene therapy, as derived from collective knowledge
on (1) transgenic mice, in which every RBC has the same amount of
HbF although we were imposing HbF on SS RBCs; (2) chimeric
transplantations, in which normal amounts of HbA-producing RBCs (AA
RBC) are present mixed with SS RBCs17, 37, 38; or (3) SCD patients
on hydroxyurea, in whom macrocytosis induced by hydroxyurea would
dilute HbS and reduce the threshold for sickling. A much higher
threshold of genetically corrected sickle HSCs necessary for F-cell
repopulation and correction of SCA phenotype was expected, as HbF
was exogenously imposed into a sickle cell with normal amounts of
HbS. Noteably, despite these distinct differences in
transgenics/chimeras, conclusions were similar with exogenous
.gamma.-globin expression: Indeed expressing exogenous HbF in RBCs
at concentrations from 33% to as high as 89% resulted in no
significant increase in MCV or MCH, yet corrected sickling. This
data suggests that genetic delivery of HbF decreases endogenous
HbS.
[0309] The percentage of transduced HSCs in the setting of lethal
irradiation/transplantation is very high (50% on average, as
analyzed by a stringent secondary CFU-S assay at 24 weeks), a
number that would be difficult to achieve in a clinical setting.
The BERK.fwdarw.BERK transplantation model, however, shows that 20%
autologous HSC correction may suffice for a significant
amelioration of sickling, organ damage, and survival. However,
whether this percentage of gene-modified HSCs necessary for
effective gene therapy is achievable is critical to determine,
since there is no survival advantage to the gene-modified HSCs in
this disease. High human HSC transduction has been a limitation of
gene therapy with the traditional gammaretrovirus vectors.
Lentivirus vectors can overcome this barrier: a 20% long-term
transduction has been shown in adrenoleukodystrophy with a
lentivirus vector. Lentivirus transduction into human CD34.sup.+
cells was optimized, using the SCID-repopulating cell assay and
achieved approximately 75% gene transfer in SCID-repopulating cell,
on average, similar to previous data in human thalassemia
CD34.sup.+ cells, where 70% transduction was seen 3 to 4 months
after transplantation into immune-deficient mice. Notably, this
level of gene transfer in the SCID mice is encouraging, and indeed
higher than the gene transfer observed in NOD-SCID mice with the
adrenoleukodystrophy lentivirus vector in preclinical studies.
[0310] Gene therapy using this approach could also overcome the
toxicity and immunologic consequences of the traditional allogeneic
bone marrow transplantation/reduced-intensity transplantation.
Mismatched mixed chimerism of normal and sickle marrow in murine
transplantations shows that a near complete chimerism is typically
necessary for correction of organ damage. It is encouraging that,
in a clinical series, reduced-intensity conditioning (RIC)
transplantation with 8 mg/kg busulfan along with fludarabine,
antithymocyte globulin, and total lymphoid irradiation in SCA
patients has shown an average allogeneic engraftment of 78% at 2 to
8.5 years after transplantation, with correction of SCA phenotype.
This high level of donor chimerism even in an allogeneic RIC
setting, where immune rejection can occur, suggests that high gene
transfer efficiency into autologous CD34.sup.+ cells followed by
RIC may be a potentially safer alternative to myeloablative
conditioning. 77% gene transfer efficiency in human
stem/progenitors was demonstrated using a NOD-SCID repopulating
cell assay, as well a correction of phenotype in mice with 1.3 to
1.5 copies per cell and approximately 20% gene-marked CFU-Ss (FIG.
36).
[0311] Significantly, correction occurred at 1 to 3 vector copies
per cell, a clinically achievable goal. Flanking the GbG virus with
a chromatin insulator is expected to increase HbF/vector copy by 2-
to 4-fold. In experimental models, the insulator appears to reduce
clonal dominance, although whether the insulator element lowers the
risk of insertional oncogenesis is unknown. The risk of insertional
oncogenesis observed with randomly integrating vectors has been
shown to be lower with a lentivirus vector than a gammaretrovirus
vector. It would be further lowered when the enhancer element is
active only in a restricted erythroid lineage.
Example 98
Optimizing Closed-System Production of High-Titer Retroviral
Vectors
[0312] The need for clinical grade gamma-retroviral vectors with
self-inactivating (SIN) long terminal repeats has prompted a shift
in the method with which large scale cGMP-grade vectors are
produced, from the use of stable producer lines to transient
transfection-based techniques. The Vector Production Facility, an
academic cGMP manufacturing laboratory that is part of the
Translational Core Laboratories at the Cincinnati Children's
Research Foundation, has developed such a method based on the Wave
Bioreactor.RTM. (GE Healthcare) production platform. This platform
allows for large scale closed-system production of high-titer
retroviral vectors for clinical trials using transient transfection
up to 25 Liters per harvest using closed system processing.
[0313] The present study describes the development and scale-up
procedures and reports on the successful use of the Wave Bioreactor
in the production of six cGMP grade retroviral vectors in support
of the FDA's National Toxicology Program (NTP).
Example 99
Transfection
[0314] Adherent 293T cells were transfected in T75 or T225 flasks
or on 2 gram of FibraCel discs in ridged 850 cm.sup.2 roller
bottles (10 mL/T75; 30 mL/T225; 100 mL/roller bottle). Non-adherent
293F cells were grown in suspension culture and transfected in
either serum-free FreeStyle 293 media (non-adherent conditions), or
in FreeStyle media or DMEM supplemented with FBS (adherent
conditions) in tissue culture flasks. Transfections were done using
Calcium Phosphate (adherent conditions only), Lipofectamine 2000,
or Fecturin according to the manufacturer's instructions. Vector
was collected at 12 or 24 hour intervals, filtered at 0.45
.sub.1.tm, and frozen at or below -70.degree. C. In the Bioreactor
(suspension cells or adherent cells on Fibracel), higher titers
were obtained when a higher concentration of plasmid was utilized
(9.2 performed better than 6.9 or 4.6 microgram of total plasmid/mL
media). Higher concentrations were not tested but may result in
even further enhancements.
Example 100
Large Scale Virus Production
[0315] Cells from a certified 293T master cell bank (MCB) were
expanded on tissue culture plastic, harvested, mixed with calcium
phosphate transfection reagents and plasmid (4 g vector, 3.6 gram
gag/pol, 1.6 gram env per Liter), and pumped into a Wave Cell Bag
(GE Healthcare) containing FibraCel.RTM. discs (New Brunswick) in
DMEM with 10% FBS (D10). Cells were cultured at 37.degree. C., 5%
CO.sub.2 using a rocking speed of 22 rpm and 6.degree. angle. At
16-20 hours post-transfection, the media was exchanged; virus was
harvested at approximately 12-hour intervals, filtered through a
leukocyte reduction filter (Pall), aliquoted into Cryocyte freezing
containers using a closed system fluid path, placed in protective
freezing cassettes and frozen at or below -70.degree. C.
Example 101
Titration
[0316] Vector pseudotyped with an ecotropic envelope was titered on
NIH 3T3 cells, vector pseudotyped with the Gibbon Ape Leukemia
(GALV) or Feline Leukemia Virus (RD114) envelope was titered on
HT1080 cells. Titers were calculated based on the % GFP expression
as determined by FACS or based on copy number as determined by
vector specific quantitative PCR.
Example 102
Suspension Culture
[0317] Initial pilot studies and scale-up were done with
HEK293-derived 293F cells (Invitrogen) grown in serum-free (SF)
FreeStyle 293 media (Invitrogen) as suspension cells are easier to
manipulate in a bioreactor. Studies show up to 10-fold expansion
over 5 days with cell viability at or above 80% (FIG. 37). However,
293F cells produced a 20-fold lower titer when transfected under
adherent conditions in D10 with Ca-Phosphate (FIG. 38) and no
detectable titer with other transfection reagents or under
non-adherent conditions.
Example 103
Adherent Cell Culture
[0318] FibraCel disks (New Brunswick Scientific) are available as a
sterile pre-loaded substrate for the Wave Bioreactor (at 20 gram
per Liter) to support growth of adherent cells. Small scale pilot
studies using adherent 293T cells were performed in 850 cm.sup.2
ridged roller bottles with 2 gram FibraCel discs per
2.times.10.sup.8 293T cells per 100 mL of D10. Post-seeding, cells
migrate inside of the matrix and continue to expand as can be
determined by glucose consumption over time. Glucose levels in a 1
Liter bioreactor that had been seeded with 2.times.10.sup.9
transfected 293T cells showed that the media should be changed at
approximately 12 hour intervals to maintain a glucose level above
100 mg/dL. Treatment with TrypLESelect for up to 30 minutes allows
up to 20% of the post-production cells to be released and harvested
while the majority of cells maintain trapped in the matrix.
Example 104
Time of Transfection
[0319] To determine the optimal time of transfection, 293T cells
were seeded onto FibraCel and exposed to transfection reagents and
plasmid DNA within hours of seeding as compared to cells that were
transfected the following day. The data show a titer of less than
10.sup.4 IU/mL from cells that were transfected one day
post-seeding as compared to cells that were transfected the same
day (FIG. 39). It has now been determined that optimal titers are
achieved when cells are mixed with transfection reagents and
plasmid DNA at the time of seeding onto FibraCel.
Example 105
Plasmid DNA
[0320] To establish the amount of plasmid DNA needed for optimal
titer, 293T cells were transfected side-by-side on tissue culture
plastic as well as on FibraCel. Where increasing plasmid DNA in
static cultures produced a lower titer, increasing the DNA
concentration on FibraCel increased titer as shown in a
representative dataset (FIG. 40) our of a total of 3
experiments.
Example 106
Cell Culture
[0321] Cells were plated at different cell densities (from
2.5.times.10.sup.4 cells/cm.sup.2 through 1.times.10.sup.5
cells/cm.sup.2) 4 days prior to transfection, harvested and tested
for virus production in five separate experiments using GALV
pseudotyped gamma-retroviral vectors. Although the same number of
cells was used for each group, titers on plastic surface as well as
on Fibracel cultures in the bioreactor varied greatly based on the
plating density and were higher when cells were harvested from
plates that had been seeded with a higher cell density
(>2.5.times.10.sup.4 cells/cm.sup.2) (FIG. 41).
Example 107
Scale-Up
[0322] Several parameters were tested including the time of media
change post-transfection (FIG. 42A) and the length of time cells
were exposed to PBS and TrypLESelect prior to transfection (FIG.
42B). For media change, 19 hours was found to be optimal in two
separate experiments (representative experiment shown). Although
all cells had >95% viability after exposure to PBS and
TrypLESelect, cells exposed for a shorter period of time generated
higher titers.
[0323] The various methods and techniques described above provide a
number of ways to carry out the invention. Of course, it is to be
understood that not necessarily all objectives or advantages
described may be achieved in accordance with any particular
embodiment described herein. Thus, for example, those skilled in
the art will recognize that the methods can be performed in a
manner that achieves or optimizes one advantage or group of
advantages as taught herein without necessarily achieving other
objectives or advantages as may be taught or suggested herein. A
variety of advantageous and disadvantageous alternatives are
mentioned herein. It is to be understood that some preferred
embodiments specifically include one, another, or several
advantageous features, while others specifically exclude one,
another, or several disadvantageous features, while still others
specifically mitigate a present disadvantageous feature by
inclusion of one, another, or several advantageous features.
[0324] Furthermore, the skilled artisan will recognize the
applicability of various features from different embodiments.
Similarly, the various elements, features and steps discussed
above, as well as other known equivalents for each such element,
feature or step, can be mixed and matched by one of ordinary skill
in this art to perform methods in accordance with principles
described herein. Among the various elements, features, and steps
some will be specifically included and others specifically excluded
in diverse embodiments.
[0325] Although the invention has been disclosed in the context of
certain embodiments and examples, it will be understood by those
skilled in the art that the embodiments of the invention extend
beyond the specifically disclosed embodiments to other alternative
embodiments and/or uses and modifications and equivalents
thereof.
[0326] Many variations and alternative elements have been disclosed
in embodiments of the present invention. Still further variations
and alternate elements will be apparent to one of skill in the art.
Among these variations, without limitation, are the specific number
of antigens in a screening panel or targeted by a therapeutic
product, the type of antigen, the type of cancer, and the
particular antigen(s) specified. Various embodiments of the
invention can specifically include or exclude any of these
variations or elements.
[0327] In some embodiments, the numbers expressing quantities of
ingredients, properties such as molecular weight, reaction
conditions, and so forth, used to describe and claim certain
embodiments of the invention are to be understood as being modified
in some instances by the term "about." Accordingly, in some
embodiments, the numerical parameters set forth in the written
description and attached claims are approximations that can vary
depending upon the desired properties sought to be obtained by a
particular embodiment. In some embodiments, the numerical
parameters should be construed in light of the number of reported
significant digits and by applying ordinary rounding techniques.
Notwithstanding that the numerical ranges and parameters setting
forth the broad scope of some embodiments of the invention are
approximations, the numerical values set forth in the specific
examples are reported as precisely as practicable. The numerical
values presented in some embodiments of the invention may contain
certain errors necessarily resulting from the standard deviation
found in their respective testing measurements.
[0328] In some embodiments, the terms "a" and "an" and "the" and
similar references used in the context of describing a particular
embodiment of the invention (especially in the context of certain
of the following claims) can be construed to cover both the
singular and the plural. The recitation of ranges of values herein
is merely intended to serve as a shorthand method of referring
individually to each separate value falling within the range.
Unless otherwise indicated herein, each individual value is
incorporated into the specification as if it were individually
recited herein. All methods described herein can be performed in
any suitable order unless otherwise indicated herein or otherwise
clearly contradicted by context. The use of any and all examples,
or exemplary language (e.g. "such as") provided with respect to
certain embodiments herein is intended merely to better illuminate
the invention and does not pose a limitation on the scope of the
invention otherwise claimed. No language in the specification
should be construed as indicating any non-claimed element essential
to the practice of the invention.
[0329] Groupings of alternative elements or embodiments of the
invention disclosed herein are not to be construed as limitations.
Each group member can be referred to and claimed individually or in
any combination with other members of the group or other elements
found herein. One or more members of a group can be included in, or
deleted from, a group for reasons of convenience and/or
patentability. When any such inclusion or deletion occurs, the
specification is herein deemed to contain the group as modified
thus fulfilling the written description of all Markush groups used
in the appended claims.
[0330] Preferred embodiments of this invention are described
herein, including the best mode known to the inventors for carrying
out the invention. Variations on those preferred embodiments will
become apparent to those of ordinary skill in the art upon reading
the foregoing description. It is contemplated that skilled artisans
can employ such variations as appropriate, and the invention can be
practiced otherwise than specifically described herein.
Accordingly, many embodiments of this invention include all
modifications and equivalents of the subject matter recited in the
claims appended hereto as permitted by applicable law. Moreover,
any combination of the above-described elements in all possible
variations thereof is encompassed by the invention unless otherwise
indicated herein or otherwise clearly contradicted by context.
[0331] All patents, patent applications, publications of patent
applications, and other material, such as articles, books,
specifications, publications, documents, things, and/or the like,
referenced herein are hereby incorporated herein by this reference
in their entirety for all purposes, excepting any prosecution file
history associated with same, any of same that is inconsistent with
or in conflict with the present document, or any of same that may
have a limiting affect as to the broadest scope of the claims now
or later associated with the present document. By way of example,
should there be any inconsistency or conflict between the
description, definition, and/or the use of a term associated with
any of the incorporated material and that associated with the
present document, the description, definition, and/or the use of
the term in the present document shall prevail.
[0332] In closing, it is to be understood that the embodiments of
the invention disclosed herein are illustrative of the principles
of the present invention. Other modifications that can be employed
can be within the scope of the invention. Thus, by way of example,
but not of limitation, alternative configurations of the present
invention can be utilized in accordance with the teachings herein.
Accordingly, embodiments of the present invention are not limited
to that precisely as shown and described.
[0333] Description of the 3' Region of cHS4 Insulator can be found
in, for example, Felsenfeld et al. (2004) Chromatin boundaries and
chromatin domains. Cold Spring Harb Symp Quant Biol 69: 245-250;
Neff T, et al. (1997) Stem cell gene therapy, position effects and
chromatin insulators. Stem Cells 15: Suppl 1265-271; Challita and
Kohn (1994) Lack of expression from a retroviral vector after
transduction of murine hematopoietic stem cells is associated with
methylation in vivo. Proc Natl Acad Sci USA 91(7): 2567-71; Osborne
C S, et al. (1999) Amelioration of retroviral vector silencing in
locus control region beta-globin-transgenic mice and transduced F9
embryonic cells. J Virol 73: 5490-5496; Aker M, et al. (2007)
Extended core sequences from the cHS4 insulator are necessary for
protecting retroviral vectors from silencing position effects. Hum
Gene Ther 18: 333-343; Kalberer C P, et al. (2000) Preselection of
retrovirally transduced bone marrow avoids subsequent stem cell
gene silencing and age-dependent extinction of expression of human
beta-globin in engrafted mice. Proc Natl Acad Sci USA 97:
5411-5415; Hacein-Bey-Abina S, et al. (2003) LMO2-associated clonal
T cell proliferation in two patients after gene therapy for
SCID-X1. Science 302: 415-419. Ott MG; et al. (2006) Correction of
X-linked chronic granulomatous disease by gene therapy, augmented
by insertional activation of MDS1-EVI1, PRDM16 or SETBP1. Nat Med
12: 401-409; Cavazzana-Calvo M, et al. (2000) Gene therapy of human
severe combined immunodeficiency (SCID)-X1 disease. Science 288:
669-672; Zufferey R, et al. (1998) Self-inactivating lentivirus
vector for safe and efficient in vivo gene delivery. J Virol 72:
9873-9880; Miyoshi H, et al. (1998) Development of a
self-inactivating lentivirus vector. J Virol 72: 8150-8157; Kraunus
J, et al. (2004) Self-inactivating retroviral vectors with improved
RNA processing. Gene Ther 11: 1568-1578; Modlich U, et al. (2006)
Cell-culture assays reveal the importance of retroviral vector
design for insertional genotoxicity. Blood 108: 2545-2553;
Zychlinski D, et al. (2008) Physiological promoters reduce the
genotoxic risk of integrating gene vectors. Mol Ther 16: 718-725;
Evans-Galea M V, et al. (2007) Suppression of clonal dominance in
cultured human lymphoid cells by addition of the cHS4 insulator to
a lentiviral vector. Mol Ther 15: 801-809; Ryu B Y, et al. (2007) A
chromatin insulator blocks interactions between globin regulatory
elements and cellular promoters in erythroid cells. Blood Cells Mol
Dis 39: 221-228; Arumugam P I, et al. (2007) Improved human
beta-globin expression from self-inactivating lentiviral vectors
carrying the chicken hypersensitive site-4 (cHS4) insulator
element. Mol Ther 15: 1863-1871; Emery D W, et al. (2002)
Development of virus vectors for gene therapy of beta chain
hemoglobinopathies: flanking with a chromatin insulator reduces
gamma-globin gene silencing in vivo. Blood 100: 2012-2019; Imren S,
et al. (2002) Permanent and panerythroid correction of murine beta
thalassemia by multiple lentiviral integration in hematopoietic
stem cells. Proc Natl Acad Sci USA 99: 14380-14385; Puthenveetil G,
et al. (2004) Successful correction of the human beta-thalassemia
major phenotype using a lentiviral vector. Blood 104: 3445-3453;
Arumugam P I, et al. (2007) Improved human beta-globin expression
from self-inactivating lentiviral vectors carrying the chicken
hypersensitive site-4 (cHS4) insulator element. Mol Ther 15 (10):
1863-71; Rivella S, et al. (2000) The cHS4 insulator increases the
probability of retroviral expression at random chromosomal
integration sites. J Virol 74: 4679-4687; Ryu B Y, et al. (2008) An
experimental system for the evaluation of retroviral vector design
to diminish the risk for proto-oncogene activation. Blood 111:
1866-1875; Urbinati F, et al. (2009) Mechanism of Reduction in
Titers From Lentivirus Vectors Carrying Large Inserts in the 3'
LTR. Mol Ther [Epub ahead of print]; Chung J H, et al. (1997)
Characterization of the chicken beta-globin insulator. Proc Natl
Acad Sci USA 94: 575-580; Recillas-Targa F, et al. (2002)
Position-effect protection and enhancer blocking by the chicken
beta-globin insulator are separable activities. Proc Natl Acad Sci
USA 99: 6883-6888; Yusufzai T M, Felsenfeld G (2004) The 5'-HS4
chicken beta-globin insulator is a CTCF-dependent nuclear
matrix-associated element. Proc Natl Acad Sci USA 101: 8620-8624;
West A G, et al. (2004) Recruitment of histone modifications by USF
proteins at a vertebrate barrier element. Mol Cell 16: 453-463.
Huang S, et al. (2007) USF1 recruits histone modification complexes
and is critical for maintenance of a chromatin barrier. Mol Cell
Biol 27: 7991-8002; Parelho V, et al. (2008) Cohesins functionally
associate with CTCF on mammalian chromosome arms. Cell 132:
422-433; Xie X, et al. (2007) Systematic discovery of regulatory
motifs in conserved regions of the human genome, including
thousands of CTCF insulator sites. Proc Natl Acad Sci USA 104:
7145-7150; Yusufzai TM, et al. (2004) CTCF tethers an insulator to
subnuclear sites, suggesting shared insulator mechanisms across
species. Mol Cell 13: 291-298; Smith S T, et al. (2009) Genome wide
ChIP-chip analyses reveal important roles for CTCF in Drosophila
genome organization. Dev Biol 328: 518-528; Cuddapah S, et al.
(2009) Global analysis of the insulator binding protein CTCF in
chromatin barrier regions reveals demarcation of active and
repressive domains. Genome Res 19: 24-32; Kim T H, et al. (2007)
Analysis of the vertebrate insulator protein CTCF-binding sites in
the human genome. Cell 128: 1231-1245; Moreau-Gaudry F, et al.
(2001) High-level erythroid-specific gene expression in primary
human and murine hematopoietic cells with self-inactivating
lentiviral vectors. Blood 98: 2664-2672; Perumbeti A, et al. (2009)
A novel human gamma-globin gene vector for genetic correction of
sickle cell anemia in a humanized sickle mouse model: critical
determinants for successful correction. Blood [Epub ahead of
print]; Puthenveetil G, et al. (2004) Successful correction of the
human beta-thalassemia major phenotype using a lentiviral vector.
Blood 104: 3445-3453; Shang Y, et a; (2000) Cofactor dynamics and
sufficiency in estrogen receptor-regulated transcription. Cell 103:
843-852.; Mutskov V J , et al. (2002) The barrier function of an
insulator couples high histone acetylation levels with specific
protection of promoter DNA from methylation. Genes Dev 16:
1540-1554; Modlich U, et al. (2006) Cell-culture assays reveal the
importance of retroviral vector design for insertional
genotoxicity. Blood 108: 2545-2553; Carr J M, et al. (2001) Effect
of deletion and the site of insertion in double copy anti-tat
retroviral vectors: viral titers and production of anti-tat mRNA.
Arch Virol 146: 2191-2200; Junker U, et al. (1995) Genetic
instability of a MoMLV-based antisense double-copy retroviral
vector designed for HIV-1 gene therapy. Gene Ther 2: 639-646;
Pathak V K, et al. (1990) Broad spectrum of in vivo forward
mutations, hypermutations, and mutational hotspots in a retroviral
shuttle vector after a single replication cycle: deletions and
deletions with insertions. Proc Natl Acad Sci USA 87: 6024-6028;
Zhuang J, et al. (2002) Human immunodeficiency virus type 1
recombination: rate, fidelity, and putative hot spots. J Virol 76:
11273-11282; Mohamedali A, et al. (2004) Self-inactivating
lentiviral vectors resist proviral methylation but do not confer
position-independent expression in hematopoietic stem cells. Mol
Ther 10: 249-259; May C, et al. (2000) Therapeutic haemoglobin
synthesis in beta-thalassaemic mice expressing lentivirus-encoded
human beta-globin. Nature 406: 82-86; Bell A C, et al. (1999) The
protein CTCF is required for the enhancer blocking activity of
vertebrate insulators. Cell 98: 387-396; Yannaki E, et al. (2002)
Topological constraints governing the use of the chicken HS4
chromatin insulator in oncoretrovirus vectors. Mol Ther 5: 589-598;
Saitoh N, et al. (2000) Structural and functional conservation at
the boundaries of the chicken beta-globin domain. EMBO J 19:
2315-2322; Stumph W E, et al. (1984) Genomic structure and possible
retroviral origin of the chicken CR1 repetitive DNA sequence
family. Proc Natl Acad Sci USA 81: 6667-6671; Gerasimova T I, et
all. (2000) A chromatin insulator determines the nuclear
localization of DNA. Mol Cell 6: 1025-1035; Pant V, et al. (2004)
Mutation of a single CTCF target site within the H19 imprinting
control region leads to loss of Igf2 imprinting and complex
patterns of de novo methylation upon maternal inheritance. Mol Cell
Biol 24: 3497-3504; Kim A, et al. (2007) Distinctive signatures of
histone methylation in transcribed coding and noncoding human
beta-globin sequences. Mol Cell Biol 27: 1271-1279; Litt M D, et
al. (2001) Correlation between histone lysine methylation and
developmental changes at the chicken beta-globin locus. Science
293: 2453-2455; Litt M D, et al. (2001) Transitions in histone
acetylation reveal boundaries of three separately regulated
neighboring loci. EMBO J 20: 2224-2235; Li C L, et al. (2008) The
cHS4 chromatin insulator reduces gammaretroviral vector silencing
by epigenetic modifications of integrated provirus. Gene Ther 15:
49-53; Pikaart M J, et al. (1998) Loss of transcriptional activity
of a transgene is accompanied by DNA methylation and histone
deacetylation and is prevented by insulators. Genes Dev 12:
2852-2862; Bell A, et al. (1998) The establishment of active
chromatin domains. Cold Spring Harb Symp Quant Biol 63: 509-514;
Bell AC, et al. (2001) Insulators and boundaries: versatile
regulatory elements in the eukaryotic. Science 291: 447-450; Yao S,
et al. (2003) Retrovirus silencer blocking by the cHS4 insulator is
CTCF independent. Nucleic Acids Res 31: 5317-5323; Elnitski L, et
al. (1997) Conserved E boxes function as part of the enhancer in
hypersensitive site 2 of the beta-globin locus control region. Role
of basic helix-loop-helix proteins. J Biol Chem 272: 369-378;
Crusselle-Davis V J, et al. (2006) Antagonistic regulation of
beta-globin gene expression by helix-loop-helix proteins USF and
TFII-I. Mol Cell Biol 26: 6832-6843; Pannell D, et al. (2000)
Retrovirus vector silencing is de novo methylase independent and
marked by a repressive histone code. EMBO J 19: 5884-5894; Splinter
E, et al. (2006) CTCF mediates long-range chromatin looping and
local histone modification in the beta-globin locus. Genes Dev 20:
2349-2354; Kurukuti S, et al. (2006) CTCF binding at the H19
imprinting control region mediates maternally inherited
higher-order chromatin conformation to restrict enhancer access to
Igf2. Proc Natl Acad Sci USA 103: 10684-10689; Wendt K S, et al.
(2008) Cohesin mediates transcriptional insulation by CCCTC-binding
factor. Nature 451: 796-801; Wallace J A, et al. (2007) We gather
together: insulators and genome organization. Curr Opin Genet Dev
17: 400-407; Williams A, et al. (2008) The role of CTCF in
regulating nuclear organization. J Exp Med 205: 747-750; each of
which is hereby incorporated by reference in its entirety.
[0334] Description of reprogramming erythroid cells for lysosomal
enzyme production and the effects on visceral and CNS
cross-correction in mice with Hurler syndrome can be found in, for
example, Hopwood and Morris (1990) The mucopolysaccharidoses.
Diagnosis, molecular genetics and treatment. Mol Biol Med
7:381-4041; Souillet G, et al. (2003) Outcome of 27 patients with
Hurler's syndrome transplanted from either related or unrelated
haematopoietic stem cell sources. Bone Marrow Transplant
31:1105-1117; Staba S L, et al. (2004) Cord-blood transplants from
unrelated donors in patients with Hurler's syndrome. N Engl J Med
350:1960-1969; Grewal S, et al. (2003) Continued neurocognitive
development and prevention of cardiopulmonary complications after
successful BMT for I-cell disease: a long-term follow-up report.
Bone Marrow Transplant 32:957-960; Peters C, et al. (1996) Outcome
of unrelated donor bone marrow transplantation in 40 children with
Hurler syndrome. Blood 87:4894-4902; Pan D, et al. (2004) Improved
gene transfer and normalized enzyme levels in primitive
hematopoietic progenitors from patients with mucopolysaccharidosis
type I using a bioreactor. J Gene Med 6:1293-1303; Hacein-Bey-Abina
S, et al. (2002) Sustained correction of X-linked severe combined
immunodeficiency by ex vivo gene therapy. N Engl J Med
346:1185-1193; Aiuti A, et al. (2002) Correction of ADA-SCID by
stem cell gene therapy combined with nonmyeloablative conditioning.
Science 296:2410-2413; Gaspar H B, et al. (2006) Successful
reconstitution of immunity in ADA-SCID by stem cell gene therapy
following cessation of PEG-ADA and use of mild preconditioning.
(Translated from eng) Mol Ther 14:505-513; Ott M G, et al. (2006)
Correction of X-linked chronic granulomatous disease by gene
therapy, augmented by insertional activation of MDS1-EVI1, PRDM16
or SETBP1. Nat Med 12:401-409; Hacein-Bey-Abina S, et al. (2003)
LMO2-associated clonal T cell proliferation in two patients after
gene therapy for SCID-X1. Science 302:415-419; Howe S J, et al.
(2008) Insertional mutagenesis combined with acquired somatic
mutations causes leukemogenesis following gene therapy of SCID-X1
patients. (Translated from eng) J Clin Invest 118:3143-3150;
Hacein-Bey-Abina S, et al. (2008) Insertional oncogenesis in 4
patients after retrovirus-mediated gene therapy of SCID-X1. J Clin
Invest 118:3132-3142; Kohn D B, et al. (2003) Occurrence of
leukaemia following gene therapy of X-linked SCID. Nature reviews
3:477-488; von Kalle C, et al. (2004) Lenti in red: progress in
gene therapy for human hemoglobinopathies. J Clin Invest
114:889-891; Chang A H, et al. (2006) Stem cell-derived erythroid
cells mediate long-term systemic protein delivery. Nat Biotechnol
24:1017-1021; Moreau-Gaudry F, et al. (2001) High-level
erythroid-specific gene expression in primary human and murine
hematopoietic cells with self-inactivating lentiviral vectors.
Blood 98:2664-2672; Scott H S, et al. (1991) Human
alpha-L-iduronidase: cDNA isolation and expression. Proc Natl Acad
Sci USA 88:9695-9699; Zhao K W, et al. (1997) Carbohydrate
structures of recombinant human alpha-L-iduronidase secreted by
Chinese hamster ovary cells. J Biol Chem 272:22758-22765; Kalfa T
A, et al. (2009) Rac 1 and Rac2 GTPases are necessary for early
erythropoietic expansion in the bone marrow but not in the spleen.
Haematologica; McGrath K E, et al. (2008) Multispectral imaging of
hematopoietic cells: where flow meets morphology. J Immunol Methods
336:91-97; Socolovsky M, et al. (2001) Ineffective erythropoiesis
in Stat5a(-/-)5b(-/-) mice due to decreased survival of early
erythroblasts. Blood 98:3261-3273; Pan D, et al. (2008) Progression
of multiple behavioral deficits with various ages of onset in a
murine model of Hurler syndrome. Brain Res 1188:241-253; Brooks D
A, et al. (2001) Glycosidase active site mutations in human
alpha-L-iduronidase. Glycobiology 11:741-750; Ney P A (2006) Gene
expression during terminal erythroid differentiation. Curr Opin
Hematol 13:203-208; Baum C, et al. (2003) Side effects of
retroviral gene transfer into hematopoietic stem cells. Blood
101:2099-2114; Modlich U, et al. (2006) Cell-culture assays reveal
the importance of retroviral vector design for insertional
genotoxicity. Blood 108:2545-2553; Bushman F D (2007) Retroviral
integration and human gene therapy. J Clin Invest 117:2083-2086;
Metais J Y and Dunbar C E (2008) The MDS1-EVI1 gene complex as a
retrovirus integration site: impact on behavior of hematopoietic
cells and implications for gene therapy. Mol Ther 16:439-449; Ellis
J (2005) Silencing and variegation of gammaretrovirus and
lentivirus vectors. Hum Gene Ther 16:1241-1246; Chang A H and
Sadelain M (2007) The genetic engineering of hematopoietic stem
cells: the rise of lentiviral vectors, the conundrum of the ltr,
and the promise of lineage-restricted vectors. Mol Ther 15:445-456;
Geminard C, et al. (2002) Reticulocyte maturation: mitoptosis and
exosome release. Biocell 26:205-215; Chasis J A and Mohandas N
(2008) Erythroblastic islands: niches for erythropoiesis. Blood
112:470-478; Sabatino D E, et al. (2000) A minimal ankyrin promoter
linked to a human gamma-globin gene demonstrates erythroid specific
copy number dependent expression with minimal position or enhancer
dependence in transgenic mice. J Biol Chem 275:28549-28554; Huang B
L, et al. (1998) Derepression of human embryonic zeta-globin
promoter by a locus-control region sequence. Proc Natl Acad Sci USA
95:14669-14674; Surinya K H, et al. (1998) Identification and
characterization of a conserved erythroid-specific enhancer located
in intron 8 of the human 5-aminolevulinate synthase 2 gene. J Biol
Chem 273:16798-16809; Kennedy DW and Abkowitz J L (1998) Mature
monocytic cells enter tissues and engraft. Proc Natl Acad Sci USA
95:14944-14949; Biffi A, et al. (2006) Gene therapy of
metachromatic leukodystrophy reverses neurological damage and
deficits in mice. J Clin Invest 116:3070-3082; Ohmi K, et al.
(2003) Activated microglia in cortex of mouse models of
mucopolysaccharidoses I and IIIB. Proc Natl Acad Sci USA
100:1902-1907; Vogler C, et al. (2005) Overcoming the blood-brain
barrier with high-dose enzyme replacement therapy in murine
mucopolysaccharidosis VII. Proc Natl Acad Sci USA 102:14777-14782;
Roces D P, et al. (2004) Efficacy of enzyme replacement therapy in
alpha-mannosidosis mice: a preclinical animal study. Hum Mol Genet
13:1979-1988; Sly W S, et al. (2006) Enzyme therapy in mannose
receptor-null mucopolysaccharidosis VII mice defines roles for the
mannose 6-phosphate and mannose receptors. Proc Natl Acad Sci USA
103:15172-15177; Grubb J H, et al. (2008) Chemically modified
beta-glucuronidase crosses blood-brain barrier and clears neuronal
storage in murine mucopolysaccharidosis VII. Proc Natl Acad Sci USA
105:2616-2621; Worsham D N, et al. (2006) In vivo gene transfer
into adult stem cells in unconditioned mice by in situ delivery of
a lentiviral vector. Mol Ther 14:514-524; Baum C, et al. (1998)
cis-Active elements of Friend spleen focus-forming virus: from
disease induction to disease prevention. Acta Haematol 99:156-164;
Pan D, et al. (2000) Retroviral vector design studies toward
hematopoietic stem cell gene therapy for mucopolysaccharidosis type
I. Gene Ther 7:1875-1883; Pan D, et al. (2002) Biodistribution and
toxicity studies of VSVG-pseudotyped lentiviral vector after
intravenous administration in mice with the observation of in vivo
transduction of bone marrow. Mol Ther 6:19-29; Hartung S D, et al.
(2004) Correction of metabolic, craniofacial, and neurologic
abnormalities in MPS I mice treated at birth with adeno-associated
virus vector transducing the human alpha-1-iduronidase gene. Mol
Ther 9:866-875; each of which is hereby incorporated by reference
in its entirety.
[0335] Description of the Cis elements can be found for example,
Aiuti A, et al. Immune reconstitution in ADA-SCID after PBL gene
therapy and discontinuation of enzyme replacement. NatMed 2002; 8:
423-425; Cavazzana-Calvo M, et al. Gene therapy of human severe
combined immunodeficiency (SCID)-X1 disease. Science 2000; 288:
669-672; Ott M G, et al. Correction of X-linked chronic
granulomatous disease by gene therapy, augmented by insertional
activation of MDS1-EVI1, PRDM16 or SETBP1. NatMed 2006; 12:
401-409; Cone R D, et al. Regulated expression of a complete human
beta-globin gene encoded by a transmissible retrovirus vector. Mol
Cell Biol 1987; 7: 887-897; Karlsson S, et al. Expression of the
human beta-globin gene following retroviral-mediated transfer into
multipotential hematopoietic progenitors of mice. Proc Natl Acad
Sci USA 1988; 85: 6062-6066; Bender M A, et al. A majority of mice
show long-term expression of a human beta-globin gene after
retrovirus transfer into hematopoietic stem cells. Mol Cell Biol
1989; 9: 1426-1434; Dzierzak E, et al. Lineage-specific expression
of a human B-globin gene in murine bone marrow transplant
recipients reconstituted with retrovirus-transduced stem cells.
Nature 1988; 331: 35-41; Buchman A R, Berg P. Comparison of
intron-dependent and intron-independent gene expression. Mol Cell
Biol 1988; 8: 4395-4405; Huang Y, et al. Intronless mRNA transport
elements may affect multiple steps of pre-mRNA processing. EMBO J
1999; 18: 1642-1652; Leboulch P, et al. Mutagenesis of retroviral
vectors transducing human beta-globin gene and beta-globin locus
control region derivatives results in stable transmission of an
active transcriptional structure. EMBO J 1994; 13: 3065-3076;
Plavec I, et al. A human beta-globin gene fused to the human
beta-globin locus control region is expressed at high levels in
erythroid cells of mice engrafted with retrovirus-transduced
hematopoietic stem cells. Blood 1993; 81: 1384-1392; Chang J C, et
al. A 36-base-pair core sequence of locus control region enhances
retrovirally transferred human beta-globin gene expression. Proc
Natl Acad Sci USA 1992; 89: 3107-3110; Novak U, et al. High-level
beta-globin expression after retroviral transfer of locus
activation region-containing human beta-globin gene derivatives
into murine erythroleukemia cells. Proc Natl Acad Sci USA 1990; 87:
3386-3390; Sadelain M, et al. Generation of a high-titer retroviral
vector capable of expressing high levels of the human beta-globin
gene. Proc Natl Acad Sci USA 1995; 92: 6728-6732; May C, et al.
Therapeutic haemoglobin synthesis in beta-thalassaemic mice
expressing lentivirus-encoded human beta-globin. Nature 2000; 406:
82-86; Imren S, et al. Permanent and panerythroid correction of
murine beta thalassemia by multiple lentiviral integration in
hematopoietic stem cells. Proc Natl Acad Sci USA 2002; 99:
14380-14385; Persons D A, et al. The degree of phenotypic
correction of murine beta-thalassemia intermedia following
lentiviral-mediated transfer of a human gamma-globin gene is
influenced by chromosomal position effects and vector copy number.
Blood 2003; 101: 2175-2183; Puthenveetil and Malik. Gene therapy
for hemoglobinopathies: are we there yet? Curr Hematol Rep 2004; 3:
298-305; Schambach A, et al. Overcoming promoter competition in
packaging cells improves production of self-inactivating retroviral
vectors. Gene Ther Gene therapy 2006; 13: 1524-1533; Puthenveetil
G, et al. Successful correction of the human beta-thalassemia major
phenotype using a lentiviral vector. Blood 2004; 104: 3445-3453;
Arumugam P I, et al. Improved Human beta-globin Expression from
Self-inactivating Lentiviral Vectors Carrying the Chicken
Hypersensitive Site-4 (cHS4) Insulator Element. Mol Ther 2007; Dull
T, et al. A third-generation lentivirus vector with a conditional
packaging system. J Virol 1998; 72: 8463-8471; Cui Y, et al.
Contributions of viral splice sites and cis-regulatory elements to
lentivirus vector function. J Virol 1999; 73: 6171-6176; Richardson
J H, et al. Packaging of human immunodeficiency virus type 1 RNA
requires cis-acting sequences outside the 5' leader region. J Virol
Journal of virology 1993; 67: 3997-4005; Buchschacher G L, Jr.,
Panganiban A T. Human immunodeficiency virus vectors for inducible
expression of foreign genes. J Virol Journal of virology 1992; 66:
2731-2739; Parolin C, et al. Analysis in human immunodeficiency
virus type 1 vectors of cis-acting sequences that affect gene
transfer into human lymphocytes. J Virol Journal of virology 1994;
68: 3888-3895; Baudin F, et al. Functional sites in the 5' region
of human immunodeficiency virus type 1 RNA form defined structural
domains. J Mol Biol 1993; 229: 382-397; Luban J, Goff S P. Binding
of human immunodeficiency virus type 1 (HIV-1) RNA to recombinant
HIV-1 gag polyprotein. J Virol 1991; 65: 3203-3212; Sundquist W I,
Heaphy S. Evidence for interstrand quadruplex formation in the
dimerization of human immunodeficiency virus 1 genomic RNA. Proc
Natl Acad Sci USA 1993; 90: 3393-3397; Favaro J P, et al. Effect of
Rev on the intranuclear localization of HIV-1 unspliced RNA.
Virology 1998; 249: 286-296; Berthold E, Maldarelli F. cis-acting
elements in human immunodeficiency virus type 1 RNAs direct viral
transcripts to distinct intranuclear locations. J Virol 1996; 70:
4667-4682; Shin N H, et al. Replication of lengthened Moloney
murine leukemia virus genomes is impaired at multiple stages. J
Virol Journal of virology 2000; 74: 2694-2702; Hanenberg H, et al.
Phenotypic correction of primary Fanconi anemia T cells with
retroviral vectors as a diagnostic tool. Exp Hematol 2002; 30:
410-420; Kelly P F, et al. Stem cell collection and gene transfer
in fanconi anemia. Mol Ther 2007; 15: 211-219; Kumar M, et al.
Systematic determination of the packaging limit of lentiviral
vectors. Hum Gene Ther Human gene therapy 2001; 12: 1893-1905; Kohn
D B. Lentiviral vectors ready for prime-time. Nat Biotechnol Nature
biotechnology 2007; 25: 65-66; Hildinger M, et al. Design of 5'
untranslated sequences in retroviral vectors developed for medical
use. J Virol 1999; 73: 4083-4089; Yu S S, et al. Construction of a
retroviral vector production system with the minimum possibility of
a homologous recombination. Gene Ther 2003; 10: 706-711; Malim M H,
et al. The HIV-1 rev trans-activator acts through a structured
target sequence to activate nuclear export of unspliced viral mRNA.
Nature Nature 1989; 338: 254-257; Chang D D, Sharp P A. Messenger
RNA transport and HIV rev regulation. Science 1990; 249: 614-615;
Fischer U, et al., Luhrmann R, Rautmann G. Evidence that HIV-1 Rev
directly promotes the nuclear export of unspliced RNA. EMBO J 1994;
13: 4105-4112; Anson D S, Fuller M. Rational development of a HIV-1
gene therapy vector. J Gene Med 2003; 5: 829-838; Felber B K, et
al. rev protein of human immunodeficiency virus type 1 affects the
stability and transport of the viral mRNA. Proc Natl Acad Sci USA
1989; 86: 1495-1499; Brandt S, et al. Rev proteins of human and
simian immunodeficiency virus enhance RNA encapsidation. PLoS
Pathog 2007; 3: e54; Swanson C M, et al. Retroviral mRNA nuclear
export elements regulate protein function and virion assembly. Embo
J 2004; 23: 2632-2640; Kaye J F, et al. cis-acting sequences
involved in human immunodeficiency virus type 1 RNA packaging. J
Virol Journal of virology 1995; 69: 6588-6592; Schwartz S, et al.
Mutational inactivation of an inhibitory sequence in human
immunodeficiency virus type 1 results in Rev-independent gag
expression. J Virol Journal of virology 1992; 66: 7176-7182;
Moreau-Gaudry F, et al. High-level erythroid-specific gene
expression in primary human and murine hematopoietic cells with
self-inactivating lentiviral vectors. Blood 2001; 98: 2664-2672;
Kraunus J, et al. Murine leukemia virus regulates alternative
splicing through sequences upstream of the 5' splice site. J Biol
Chem 2006; 281: 37381-37390; each of which is hereby incorporated
by reference in its entirety.
[0336] Description of the relationship between titer and the insert
length into LTR can be found in, for example, Rivella, S, et al.
(2003). A novel murine model of Cooley anemia and its rescue by
lentiviral-mediated human beta-globin gene transfer. Blood 101:
2932-2939; Persons, D A, et al. (2003). The degree of phenotypic
correction of murine beta-thalassemia intermedia following
lentiviral-mediated transfer of a human gamma-globin gene is
influenced by chromosomal position effects and vector copy number.
Blood 101: 2175-2183; Modlich, U, et al. (2006). Cell-culture
assays reveal the importance of retroviral vector design for
insertional genotoxicity 108: 2545-2553; Imren, S, et al. (2002).
Permanent and panerythroid correction of murine beta thalassemia by
multiple lentiviral integration in hematopoietic stem cells 99:
14380-14385; Thrasher, A J, et al. (2006). Gene therapy: X-SCID
transgene leukaemogenicity 443: E5-E6; Fischer, A, Abina, S H,
Thrasher, A, von Kalle, C, and Cavazzana-Calvo, M (2004). LMO2 and
gene therapy for severe combined immunodeficiency 350: 2526-2527;
Hacein-Bey-Abina, S, et al. (2003). LMO2-associated clonal T cell
proliferation in two patients after gene therapy for SCID-X1.
Science 302: 415-419; Zufferey, R, et al. (1998). Self-inactivating
lentivirus vector for safe and efficient in vivo gene delivery 72:
9873-9880; Miyoshi, H, et al. (1998). Development of a
self-inactivating lentivirus vector 72: 8150-8157; Kraunus, J, et
al. (2004). Self-inactivating retroviral vectors with improved RNA
processing 11: 1568-1578; Chung, J H, et al. (1997).
Characterization of the chicken beta-globin insulator 94: 575-580;
Bell, A C, and Felsenfeld, G (1999). Stopped at the border:
boundaries and insulators 9: 191-198; Felsenfeld, G, et al. (2004).
Chromatin boundaries and chromatin domains 69:245-50.: 245-250;
Rivella, S, et al. (2000). The cHS4 insulator increases the
probability of retroviral expression at random chromosomal
integration sites 74: 4679-4687; Emery, D W, et al. (2002).
Development of virus vectors for gene therapy of beta chain
hemoglobinopathies: flanking with a chromatin insulator reduces
gamma-globin gene silencing in vivo. Blood 100: 2012-2019; Yannaki,
E, et al. (2002). Topological constraints governing the use of the
chicken HS4 chromatin insulator in oncoretrovirus vectors 5:
589-598; Ramezani, A, et al. (2003). Performance- and
safety-enhanced lentiviral vectors containing the human
interferon-beta scaffold attachment region and the chicken
beta-globin insulator. Blood 101: 4717-4724; Arumugam, P I, et al.
(2007). Improved Human beta-globin Expression from
Self-inactivating Lentiviral Vectors Carrying the Chicken
Hypersensitive Site-4 (cHS4) Insulator Element. Mol Ther;
Puthenveetil, G, et al. (2004). Successful correction of the human
beta-thalassemia major phenotype using a lentiviral vector. Blood
104: 3445-3453; Evans-Galea, et al. (2006). Supression of clonal
dominance in cultured human lymphoid cells by addition of 5' cHS4
insulator to a lentiviral vector. Molecular Therapy 13: 5405; Ryu,
B Y, et al. (2007). A chromatin insulator blocks interactions
between globin regulatory elements and cellular promoters in
erythroid cells. Blood Cells Mol Dis 39: 221-228; Carr, J M, et al.
(2001). Effect of deletion and the site of insertion in double copy
anti-tat retroviral vectors: viral titres and production of
anti-tat mRNA. Archives of virology 146: 2191-2200; Junker, U, et
al. (1995). Genetic instability of a MoMLV-based antisense
double-copy retroviral vector designed for HIV-1 gene therapy. Gene
Ther 2: 639-646; Shin, N H, et al. (2000). Replication of
lengthened Moloney murine leukemia virus genomes is impaired at
multiple stages. J Virol 74: 2694-2702; Gelinas, C, and Temin, H M
(1988). The v-rel oncogene encodes a cell-specific transcriptional
activator of certain promoters. Oncogene 3: 349-355; Coffin, J M
(1990). Retroviridae and their replication. In: Fields, B N (ed).
Feilds Virology, 2 ed. New York: Raven Press. pp 1437-1500; Kumar,
M, et al. (2001). Systematic determination of the packaging limit
of lentiviral vectors. Hum Gene Ther 12: 1893-1905; Recillas-Targa,
F, et al. (1999). Positional enhancer-blocking activity of the
chicken beta-globin insulator in transiently transfected cells 96:
14354-14359; Julias, J G, et al. (2001). Replication of
phenotypically mixed human immunodeficiency virus type 1 virions
containing catalytically active and catalytically inactive reverse
transcriptase. J Virol 75: 6537-6546; Brule, F, et al. (2000). In
vitro evidence for the interaction of tRNA(3)(Lys) with U3 during
the first strand transfer of HIV-1 reverse transcription. Nucleic
Acids Res 28: 634-640; Ohi, Y, and Clever, J L (2000). Sequences in
the 5' and 3' R elements of human immunodeficiency virus type 1
critical for efficient reverse transcription. J Virol 74:
8324-8334; Topping, R, et al. (1998). Cis-acting elements required
for strong stop acceptor template selection during Moloney murine
leukemia virus reverse transcription. J Mol Biol 281: 1-15; Pathak,
V K, and Temin, H M (1990). Broad spectrum of in vivo forward
mutations, hypermutations, and mutational hotspots in a retroviral
shuttle vector after a single replication cycle: deletions and
deletions with insertions. Proc Natl Acad Sci USA 87: 6024-6028;
Zhuang, J, et al. (2002). Human immunodeficiency virus type 1
recombination: rate, fidelity, and putative hot spots. J Virol 76:
11273-11282; Herman, S A, and Coffin, J M (1987). Efficient
packaging of readthrough RNA in ALV: implications for oncogene
transduction. Science 236: 845-848; Schambach, A, et al. (2007).
Improving transcriptional termination of self-inactivating
gamma-retroviral and lentiviral vectors. Mol Ther 15: 1167-1173;
Higashimoto, T, et al. (2007). The woodchuck hepatitis virus
post-transcriptional regulatory element reduces readthrough
transcription from retroviral vectors. Gene Ther. Zaiss, A K, et
al. (2002). RNA 3' readthrough of oncoretrovirus and lentivirus:
implications for vector safety and efficacy 76: 7209-7219;
Heilman-Miller, S L, et al. (2004). Alteration of nucleic acid
structure and stability modulates the efficiency of minus-strand
transfer mediated by the HIV-1 nucleocapsid protein. J Biol Chem
279: 44154-44165; Negroni, M, and Buc, H (2000). Copy-choice
recombination by reverse transcriptases: reshuffling of genetic
markers mediated by RNA chaperones. Proc Natl Acad Sci USA 97:
6385-6390; Wu, T, et al. (2007). Effects of nucleic acid local
structure and magnesium ions on minus-strand transfer mediated by
the nucleic acid chaperone activity of HIV-1 nucleocapsid protein.
Nucleic Acids Res 35: 3974-3987; Berkhout, B, et al. (2001).
Structural features in the HIV-1 repeat region facilitate strand
transfer during reverse transcription. RNA 7: 1097-1114; Butler, S
L, et al. (2001). A quantitative assay for HIV DNA integration in
vivo. Nat Med 7: 631-634; Brown, P O, et al. (1987). Correct
integration of retroviral DNA in vitro. Cell 49: 347-356;
Bukrinsky, M I, et al. (1992). Active nuclear import of human
immunodeficiency virus type 1 preintegration complexes. Proc Natl
Acad Sci USA 89: 6580-6584; Zennou, V, et al. (2000). HIV-1 genome
nuclear import is mediated by a central DNA flap. Cell 101:
173-185; Hansen, M S, et al. (1999). Integration complexes derived
from HIV vectors for rapid assays in vitro. Nat Biotechnol 17:
578-582; Miller, M D, et al. (1997). Human immunodeficiency virus
type 1 preintegration complexes: studies of organization and
composition. J Virol 71: 5382-5390; Grande, A, et al. (1999).
Transcriptional targeting of retroviral vectors to the
erythroblastic progeny of transduced hematopoietic stem cells.
Blood 93: 3276-3285; Wiznerowicz, M, et al. (1998). Development of
a double-copy bicistronic retroviral vector for human gene therapy.
Advances in experimental medicine and biology 451: 441-447;
Wiznerowicz, M, et al. (1997). Double-copy bicistronic retroviral
vector platform for gene therapy and tissue engineering:
application to melanoma vaccine development. Gene Ther 4:
1061-1068; Junker, U, et al. (1997). Antiviral potency of drug-gene
therapy combinations against human immunodeficiency virus type 1.
AIDS research and human retroviruses 13: 1395-1402; Ilves, H, et
al. (1996). Retroviral vectors designed for targeted expression of
RNA polymerase III-driven transcripts: a comparative study. Gene
171: 203-208; Sabatino, D E, et al. (2000). A Minimal Ankyrin
Promoter Linked to a Human gamma-Globin Gene Demonstrates Erythroid
Specific Copy Number Dependent Expression with Minimal Position or
Enhancer Dependence in Transgenic Mice 15: 28549-28554; Sabatino, D
E, et al. (2000). Long-term expression of gamma-globin mRNA in
mouse erythrocytes from retrovirus vectors containing the human
gamma-globin gene fused to the ankyrin-1 promoter 97: 13294-13299;
Moreau-Gaudry, F, et al. (2001). High-level erythroid-specific gene
expression in primary human and murine hematopoietic cells with
self-inactivating lentiviral vectors. Blood 98: 2664-2672;
Yanez-Munoz, R J, et al. (2006). Effective gene therapy with
nonintegrating lentiviral vectors. Nature medicine 12: 348-353;
each of which is hereby incorporated by reference in its
entirety.
[0337] Description of the Correction of Sickle Cell Anemia can be
found for example, Darbari D S, et al. Circumstances of death in
adult sickle cell disease patients. Am J Hematol. 2006;
81(11):858-863; Platt O S, et al. Mortalit in sickle cell disease:
life expectancy and risk factors for early death. N Engl J Med.
1994; 330(23):1639-1644; Davis H, et al. National trends in the
mortality of children with sickle cell disease, 1968 through 1992.
Am J Public Health. 1997; 87(8):1317-1322; World Health
Organization. Sickle-Cell Anaemia Fifty-Ninth World Health
Assembly, Provisional Agenda Item 11.4. 2006; A59:1; Walters M C,
et al. Barriers to bone marrow transplantation for sickle cell
anemia. Biol Blood Marrow Transplant. 1996; 2(2): 100-104; Fitzhugh
C D, et al. Late effects of myeloablative bone marrow
transplantation (BMT) in sickle cell disease (SCD) [letter]. Blood.
2008; 111(3):1742-1743; author reply 1744; Bernaudin F, et al.
Long-term results of related myeloablative stem-cell
transplantation to cure sickle cell disease. Blood. 2007;
110(7):2749-2756; Pawliuk R, et al.Correction of sickle cell
disease in transgenic mouse models by gene therapy. Science. 2001;
294(5550):2368-2371; Levasseur D N, et al. Correction of a mouse
model of sickle cell disease: lentiviral/antisickling beta-globin
gene transduction of unmobilized, purified hematopoietic stem
cells. Blood. 2003; 102(13):4312-4319; Puthenveetil G, et al.
Successful correction of the human betathalassemia major phenotype
using a lentiviral vector. Blood. 2004; 104(12):3445-3453;
Moreau-Gaudry F, et al. High-level erythroid-specific gene
expression in primary human and murine hematopoietic cells with
selfinactivating lentiviral vectors. Blood. 2001; 98(9): 2664-2672;
Rubin J E, et al. Locus control region activity by 5HS3 requires a
functional interaction with beta-globin gene regulatory elements:
expression of novel beta/gamma-globin hybrid transgenes. Blood.
2000; 95(10):3242-3249; Arumugam P I, et al. Improved human
beta-globin expression from self-inactivating lentiviral vectors
carrying the chicken hypersensitive site-4 (cHS4) insulator
element. Mol Ther. 2007; 15(10):1863-1871; Pa'szty C, et al.
Transgenic knockout mice with exclusively human sickle hemoglobin
and sickle cell disease. Science. 1997; 278(5339):876-878; Manci E
A, et al. Pathology of Berkeley sickle cell mice: similarities and
differences with human sickle cell disease. Blood. 2006;
107(4):1651-1658; Baskurt O K, et al. Blood rheology and
hemodynamics. Semin Thromb Hemost. 2003; 29(5):435-450; Iannone R,
et al. Effects of mixed hematopoietic chimerism in a mouse model of
bone marrow transplantation for sickle cell anemia. Blood. 2001;
97(12):3960-3965; Iannone R, et al. Results of minimally toxic
nonmyeloablative transplantation in patients with sickle cell
anemia and betathalassemia. Biol Blood Marrow Transplant. 2003;
9(8):519-528; Hardeman M R, Ince C. Clinical potential of in vitro
measured red cell deformability, a myth? Clin Hemorheol Microcirc.
1999; 21(3-4):277-284; Franco R S, et al. Time-dependent changes in
the density and hemoglobin F content of biotin-labeled sickle
cells. J Clin Invest. 1998; 101(12):2730-2740; Pestina T I, et al.
Correction of murine sickle cell disease using gamma-globin
lentiviral vectors to mediate high-level expression of fetal
hemoglobin. Mol Ther. 2009; 17(2):245-252; Kohn D B, et al. T
lymphocytes with a normal ADA gene accumulate after transplantation
of transduced autologous umbilical cord blood CD34.sub.-- cells in
ADA-deficient SCID neonates. Nat Med. 1998; 4(7):775-780; Aiuti A,
et al. Correction of ADASCID by stem cell gene therapy combined
with nonmyeloablative conditioning. Science. 2002;
296(5577):2410-2413; Aiuti A, et al. Gene therapy for
immunodeficiency due to adenosine deaminase deficiency. N Engl J
Med. 2009; 360(5):447-458; Noronha P A, et al. Hemoglobin-specific
antibody in a multiply transfused patient with sickle cell disease.
Blood. 1997; 89(6):2155-2158; Samakoglu S, et al. A genetic
strategy to treat sickle cell anemia by coregulating globin
transgene expression and RNA interference. Nat Biotechnol. 2006;
24(1):89-94; Trudel M, et al. Sickle cell disease of transgenic SAD
mice. Blood. 1994; 84(9):3189-3197; Blouin M J, et al. Genetic
correction of sickle cell disease: insights using transgenic mouse
models. Nat Med. 2000; 6(2):177-182; Fabry M E, et al. Second
generation knockout sickle mice: the effect of HbF. Blood. 2001;
97(2):410-418; Persons D A, et al. The degree of phenotypic
correction of murine beta-thalassemia intermedia following
lentiviral-mediated transfer of a human gamma-globin gene is
influenced by chromosomal position effects and vector copy number.
Blood. 2003; 101(6):2175-2183; Koshy M, et al. 2-deoxy
5-azacytidine and fetal hemoglobin induction in sickle cell anemia.
Blood. 2000; 96(7):2379-2384; Charache S, et al.
Hydroxyurea-induced augmentation of fetal hemoglobin production in
patients with sickle cell anemia. Blood. 1987; 69(1):109-116;
Maier-Redelsperger M, et al. Fetal hemoglobin and F-cell responses
to long-term hydroxyurea treatment in young sickle cell patients:
The French Study Group on Sickle Cell Disease. Blood. 1998;
91(12):4472-4479; Marcus S J, Ware R E. Physiologic decline in
fetal hemoglobin parameters in infants with sickle cell disease:
implications for pharmacological intervention. J Pediatr Hematol
Oncol. 1999; 21(5): 407-411; Maier-Redelsperger M, et al. Variation
in fetal hemoglobin parameters and predicted hemoglobin S
polymerization in sickle cell children in the first two years of
life: Parisian Prospective Study on Sickle Cell Disease. Blood.
1994; 84(9):3182-3188; Steinberg M H, et al. Effect of hydroxyurea
on mortality and morbidity in adult sickle cell anemia: risks and
benefits up to 9 years of treatment. JAMA. 2003; 289(13):1645-1651;
Kean L S, et al. Chimerism and cure: hematologic and pathologic
correction of murine sickle cell disease. Blood. 2003;
102(13):4582-4593; Walters M C, et al. Stable mixed hematopoietic
chimerism after bone marrow transplantation for sickle cell anemia.
Biol Blood Marrow Transplant. 2001; 7(12):665-673; Cavazzana-Calvo
M, et al. Hematopoietic stem cell gene therapy trial with
lentiviral vector in X-linked adrenoleukodystrophy. Blood (ASH
Annual Meeting Abstracts). 2008; (suppl)112. Abstract 821;
Benhamida S, et al. Transduced CD34.sub.-- cells from
adrenoleukodystrophy patients with HIV-derived vector mediate
long-term engraftment of NOD/SCID mice. Mol Ther. 2003;
7(3):317-324; Horan J T, et al. Hematopoietic stem cell
transplantation for multiply transfused patients with sickle cell
disease and thalassemia after low-dose total body irradiation,
fludarabine, and rabbit antithymocyte globulin. Bone Marrow
Transplant. 2005; 35(2):171-177; Krishnamurti L, et al. Bone marrow
transplantation without myeloablation for sickle cell disease. N
Engl J Med. 2001; 344(1): 68; Kean L S, et al. A cure for murine
sickle cell disease through stable mixed chimerism and tolerance
induction after nonmyeloablative conditioning and major
histocompatibility complex-mismatched bone marrow transplantation.
Blood. 2002; 99(5):1840-1849; Krishnamurti L, et al. Stable
long-term donor engraftment following reduced-intensity
hematopoietic cell transplantation for sickle cell disease. Biol
Blood Marrow Transplant. 2008; 14(11):1270-1278; Ryu B Y, et al. An
experimental system for the evaluation of retroviral vector design
to diminish the risk for proto-oncogene activation. Blood. 2008;
111(4):1866-1875; Ryu B Y, et al. A chromatin insulator blocks
interactions between globin regulatory elements and cellular
promoters in erythroid cells. Blood Cells Mol Dis. 2007;
39(3):221-228; Montini E, et al. Hematopoietic stem cell gene
transfer in a tumor-prone mouse model uncovers low genotoxicity of
lentiviral vector integration. Nat Biotechnol. 2006; 24(6):
687-696; von Kalle C, et al. Lenti in red: progress in gene therapy
for human hemoglobinopathies; each of which is hereby incorporated
by reference in its entirety.
Sequence CWU 1
1
43139DNAArtificial SequenceMulti-cloning site sequence
(ClaI-Eco47III, XhoI, Sma I, SalI, EcoRI) 1ccatcgatag cgctctcgag
cccggggtcg acgaattcc 39224DNAArtificial SequenceRRE forward primer
2ataaacccgg gagcagtggg aata 24325DNAArtificial SequenceRRE reverse
primer 3acatgatatc gcaaatgagt tttcc 25425DNAArtificial SequenceEnv
reverse primer 4acatgatatc ataccgtcga gatcc 25531DNAArtificial
SequenceGag forward primer 5actgctctcg agcaatggga aaaaattcgg t
31630DNAArtificial SequenceGag reverse primer 6actgctctcg
aggcagcttc ctcattgatg 30731DNAArtificial SequenceGag reverse primer
7actgctctcg agatcagcgg ccgcttgctg t 31821DNAArtificial
Sequencemutant SA forward primer 8tatcgtttcg aacccacctc c
21921DNAArtificial Sequencemutant SA reverse primer 9ggaggtgggt
tcgaaacgat a 211022DNAArtificial SequenceR/U5 forward primer
10gaacccactg cttaagcctc aa 221122DNAArtificial SequenceR/U5 reverse
primer 11acagacgggc acacactact tg 221218DNAArtificial SequenceqPCR
MGB probe 12aaagcttgcc ttgagtgc 181322DNAArtificial SequenceU3/R
forward primer 13cccaggctca gatctggtct aa 221425DNAArtificial
SequenceU3/R reverse primer 14tgtgaaattt gtgatgctat tgctt
251529DNAArtificial SequenceqPCR MGB probe 15agacccagta caagcaaaaa
gcagaccgg 291621DNAArtificial Sequenceprovirus forward primer
16acctgaaagc gaaaggcaaa c 211721DNAArtificial Sequenceprovirus
reverse primer 17agaaggagag agatgggtgc g 211824DNAArtificial
SequenceqPCR probe 18agctctctcg acgcaggact cggc 241919DNAArtificial
SequenceCore forward primer 19aagcccccag ggatgtaat
192020DNAArtificial SequenceCore reverse primer 20aaagcttttt
ccccgtatcc 202122DNAArtificial SequenceBG forward primer
21tgaacacagt tgtgtcagaa gc 222221DNAArtificial SequenceBG reverse
primer 22cacttgcaaa ggaggatgtt t 212320DNAArtificial SequenceIns 3'
400 forward primer 23tcaaatcatg aaggctggaa 202420DNAArtificial
SequenceIns 3' 400 reverse primer 24ctgactccgt cctggagttg
202520DNAArtificial SequenceIns 3' forward primer 25gtctgagcct
gcatgtttga 202620DNAArtificial SequenceIns 3' reverse primer
26gtccctggag gtgatgaaga 202720DNAArtificial SequenceNecdin promoter
forward primer 27ggtcctgctc tgatccgaag 202821DNAArtificial
SequenceNecdin promoter reverse primer 28gggtcgctca ggtccttact t
212921DNAArtificial SequenceNecdin 5' forward primer 29ttcagtagct
gatgcccagg t 213021DNAArtificial SequenceNecdin 5' reverse primer
30gggaggatac cagagatggg a 213129DNAArtificial SequenceIns forward
primer 31aatgatatct ctagagggac agccccccc 293230DNAArtificial
SequenceIns 400 reverse primer 32aatgatatcc ctgcaggcat tcaaggccag
303330DNAArtificial SequenceIns 800 reverse primer 33aatgatatca
ccatcaaaca tgcaggctca 303431DNAArtificial SequenceCore1 forward
primer 34cgggatcccg agctcacggg gacagccccc c 313534DNAArtificial
SequenceCore1 reverse primer 35ggaattccga tatcaagctt tttccccgta
tccc 343636DNAArtificial SequenceCore2 forward primer 36ggaattccga
tatcgagctc acggggacag cccccc 363734DNAArtificial SequenceCore2
reverse primer 37cggggtaccc cgaagctttt tccccgtatc cccc
343832DNAArtificial Sequence3' 400 forward primer 38actggatatc
atgtgtctga gcctgcatgt tt 323935DNAArtificial Sequence3' 400 reverse
primer 39tgactccgga agccccatcc tcactgactc cgtcc 354023DNAArtificial
Sequencespacer forward primer 40ggaattccgc ttgccaacga cat
234124DNAArtificial Sequencespacer reverse primer 41ccatcgatca
caccctgttt ctcc 244223DNAArtificial Sequencespacer reverse primer
42ccatcgatcg ctggcgttct cgc 234325DNAArtificial Sequencespacer
reverse primer 43ccatcgattt cgcactcaat ccgcc 25
* * * * *