U.S. patent application number 16/361164 was filed with the patent office on 2019-09-12 for constitutive photomorphogenesis 1 (cop1) nucleic acid sequence from zea mays and its use thereof.
The applicant listed for this patent is MONSANTO TECHNOLOGY LLC. Invention is credited to Nordine Cheikh, Molian Deng, Philip W. Miller, Nanfei Xu.
Application Number | 20190276835 16/361164 |
Document ID | / |
Family ID | 23225146 |
Filed Date | 2019-09-12 |
![](/patent/app/20190276835/US20190276835A1-20190912-D00001.png)
![](/patent/app/20190276835/US20190276835A1-20190912-D00002.png)
![](/patent/app/20190276835/US20190276835A1-20190912-D00003.png)
![](/patent/app/20190276835/US20190276835A1-20190912-D00004.png)
![](/patent/app/20190276835/US20190276835A1-20190912-D00005.png)
![](/patent/app/20190276835/US20190276835A1-20190912-D00006.png)
![](/patent/app/20190276835/US20190276835A1-20190912-D00007.png)
![](/patent/app/20190276835/US20190276835A1-20190912-D00008.png)
![](/patent/app/20190276835/US20190276835A1-20190912-D00009.png)
![](/patent/app/20190276835/US20190276835A1-20190912-D00010.png)
![](/patent/app/20190276835/US20190276835A1-20190912-D00011.png)
View All Diagrams
United States Patent
Application |
20190276835 |
Kind Code |
A1 |
Cheikh; Nordine ; et
al. |
September 12, 2019 |
CONSTITUTIVE PHOTOMORPHOGENESIS 1 (COP1) NUCLEIC ACID SEQUENCE FROM
ZEA MAYS AND ITS USE THEREOF
Abstract
The present invention relates to an isolated COP1 nucleic acid
sequence from a maize plant and the isolated COP1 nucleic acid
sequence is named as ZmCOP1. The present invention also relates to
a method of using the ZmCOP1 nucleic acid sequence to control the
shade avoidance response of a crop plant for high density farming
and yield enhancement.
Inventors: |
Cheikh; Nordine;
(Chesterfield, MO) ; Deng; Molian; (Grover,
MO) ; Miller; Philip W.; (Ballwin, MO) ; Xu;
Nanfei; (Wildwood, MO) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
MONSANTO TECHNOLOGY LLC |
ST. LOUIS |
MO |
US |
|
|
Family ID: |
23225146 |
Appl. No.: |
16/361164 |
Filed: |
March 21, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15610241 |
May 31, 2017 |
|
|
|
16361164 |
|
|
|
|
14315012 |
Jun 25, 2014 |
9695437 |
|
|
15610241 |
|
|
|
|
11683281 |
Mar 7, 2007 |
8785616 |
|
|
14315012 |
|
|
|
|
10229436 |
Aug 28, 2002 |
7208652 |
|
|
11683281 |
|
|
|
|
60315593 |
Aug 29, 2001 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K 14/415 20130101;
C12N 15/8261 20130101; C12N 15/8269 20130101; Y02A 40/146
20180101 |
International
Class: |
C12N 15/82 20060101
C12N015/82; C07K 14/415 20060101 C07K014/415 |
Claims
1. A recombinant DNA construct comprising a COP1 nucleotide
sequence encoding a polypeptide having an amino acid sequence that
has at least 90% sequence identity to the amino acid sequence of
SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID
NO:26, or a functionally equivalent fragment thereof; or wherein
said COP1 nucleotide sequence has at least 90% sequence identity to
a nucleotide sequence selected from the group consisting of SEQ ID
NO:19, SEQ ID NO:20, and a functionally equivalent fragment
thereof; said COP1 nucleotide sequence being operably linked to a
heterologous promoter, wherein upon its transformation into a plant
said construct causes reduction of functional endogenous COP1
protein level.
2. A method for increasing yield of a crop, comprising the steps
of: transforming a cell of a crop plant with a nucleic acid
molecule comprising a heterologous promoter that functions in the
cells of said crop plant, said promoter operably linked to a
structural nucleic acid sequence, wherein the structural nucleic
acid sequence encodes a constitutive photomorphogenesis 1 protein
that comprises an amino acid sequence that has at least about 90%
sequence identity to an amino acid sequence selected from the group
consisting of SEQ ID NOs: 22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID
NO:25, SEQ ID NO:26, and a functionally equivalent fragment
thereof; or wherein the structural nucleic acid sequence has at
least 90% sequence identity to a nucleotide sequence selected from
the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21,
and a functionally equivalent fragment thereof; regenerating from
said transformed plant cell a transformed crop plant, wherein
expression of the structural nucleic acid sequence in cells of the
transformed crop plant causes reduction of functional endogenous
COP1 protein level; obtaining seeds from said transformed crop
plant or progeny of said transformed crop plant; and planting said
seeds at a population density that is at least 10% higher than
normal.
3. A transgenic plant comprising the recombinant DNA construct of
claim 1.
4. The transgenic plant of claim 3, wherein said plant is selected
from the group consisting of maize, wheat, rye, barley, oats,
buckwheat, sorghum, rice, sunflower, canola, peas, beans, soybeans,
cotton, linseed, cauliflower, asparagus, lettuce, tobacco mustard,
sugar beet, potato, sweet potato, carrot, turnip, celery, tomato,
egg plant, cucumber, squash, apple, apricot, peach, pear, plum,
orange, blackberry, blueberry, strawberry, cranberry and lemon.
5. The transgenic plant of claim 3, wherein said plant is a maize
plant.
6. Progeny or seeds of the transgenic plant of claim 4, wherein the
progeny or seeds comprise the recombinant DNA construct.
7. Progeny or seeds of the transgenic plant of claim 5, wherein the
progeny or seeds comprise the recombinant DNA construct.
8. A plant cell comprising the recombinant DNA construct of claim
1.
9. The recombinant DNA construct of claim 1, wherein said promoter
comprises a light-inducible promoter.
10. The recombinant DNA construct of claim 1, wherein said promoter
is selected from the group consisting of a cab promoter, an ATHB-2
promoter, and a far red light inducible promoter.
11. The recombinant DNA construct of claim 1, wherein said promoter
comprises a cab promoter.
12. The recombinant DNA construct of claim 1, wherein the COP1
nucleotide sequence encodes a polypeptide having an amino acid
sequence that has at least 95% sequence identity to the amino acid
sequence of SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25,
SEQ ID NO:26, or a functionally equivalent fragment thereof; or
wherein said COP1 nucleotide sequence has at least 95% sequence
identity to a nucleotide sequence selected from the group
consisting of SEQ ID NO:19, and SEQ ID NO:20 or a functionally
equivalent fragment thereof.
13. The recombinant DNA construct of claim 1, wherein the COP1
nucleotide sequence encodes a polypeptide having the amino acid
sequence of SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25,
or SEQ ID NO:26, or a functionally equivalent fragment thereof; or
wherein said COP1 nucleotide sequence comprises the nucleotide
sequence of SEQ ID NO:19, SEQ ID NO:20, or a functionally
equivalent fragment thereof.
14. The method of claim 2, wherein said constitutive
photomorphogenesis 1 protein comprises a protein binding domain and
wherein said protein binding domain binds to a COP1 protein.
15. The method of claim 2, wherein said structural nucleic acid
sequence is overexpressed in the cells of said crop plant.
16. The method of claim 2, wherein the population density is at
least 40% higher than the average prevailing density for said crop
in said growing region.
17. The method of claim 2, wherein the population density is at
least 70% higher than the average prevailing density for said crop
in said growing region.
18. The method of claim 2, wherein the population density is at
least 100% higher than the average prevailing density for said crop
in said growing region.
19. The method of claim 2, wherein said crop plant is selected from
the group consisting of maize, wheat, rye, barley, oats, buckwheat,
sorghum, rice, sunflower, canola, peas, beans, soybeans, cotton,
linseed, cauliflower, asparagus, lettuce, tobacco mustard, sugar
beet, potato, sweet potato, carrot, turnip, celery, tomato, egg
plant, cucumber, squash, apple, apricot, peach, pear, plum, orange,
blackberry, blueberry, strawberry, cranberry and lemon.
20. The method of claim 2, wherein said crop plant is a maize
plant.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This Application claims benefit of under 35 USC 119(e) of
U.S. provisional application Ser. No. 60/315,593 filed Aug. 29,
2001. This Application is a divisional of the non-provisional
application with Ser. No. 10/229,436 filed Aug. 28, 2002. Both of
these Applications are herein incorporated by reference.
INCORPORATION OF SEQUENCE LISTING
[0002] A paper copy of the Sequence Listing and a computer readable
form of the sequence listing are provided. They contains 17
nucleotide and protein sequences and are herein incorporated by
reference. This sequence listing is identical in content to the
listing in the Ser. No. 10/229,436 case which is also incorporated
by reference.
INTRODUCTION
[0003] The present invention is in the field of plant molecular
biology. More specifically the present invention relates to an
isolated nucleic acid molecule, a protein and fragments of the
protein that the isolated nucleic acid molecule encodes. Most
specifically, the present invention relates to a constitutive
photomorphogenesis 1 (COP1) nucleic acid sequence from Zea mays
that encodes a COP1 protein and fragments of the COP1 protein
associated with plant photomorphogenesis. The present invention
also relates to a method of using the isolated COP1 nucleic acid
molecules, the COP1 proteins and fragments of the COP1 proteins for
molecular manipulation of shade avoidance responses of crop plants
to light for improving their density tolerance and thereafter for
enhancing their yield when planted at a high population
density.
BACKGROUND OF THE INVENTION
[0004] Plant growth is a highly malleable process that is strongly
influenced by environmental factors, especially light. Light plays
a vital role in plants' photomorphogenesis and affects almost all
aspects of plant growth and development. The effects of light on
plant development are especially prominent at the seedling stage.
Under normal light conditions with unobstructed direct light, a
plant seedling develops according to a characteristic
photomorphogenic pattern, that is, it has open, expanded cotyledons
and a short hypocotyl. This developmental pattern rapidly
establishes the seedling as a photoautotrophic organism, and most
of the plant's energy is devoted to cotyledon and leaf development
while longitudinal extension growth is minimized. A seedling
growing in darkness, however, will etiolate, displaying elongated
hypocotyls and closed and unexpanded cotyledons. Under low light
conditions where light quality and intensity are reduced by
shading, obstruction or high population density, a seedling
develops according to a different pattern as a shade-avoiding
seedling that displays reduced cotyledon expansion relative to the
seedling grown in unobstructed light, and hypocotyl extension is
greatly increased. During this developmental response of the
seedling to the low light conditions, the hypocotyl is elongated
which couples with reduction in cotyledon and leaf expansion.
[0005] Thus, a significant problem for crop fainting is created
when crop plants are grown at high population density as it often
results in a low light level for each individual plant. To compete
for this light, plants have to re-distribute their energy and
nutrition towards height extension, often called a shade avoidance
response, resulting in an accelerated stem elongation and thin
stems. This shade avoidance response to poor light conditions in a
populated environment often results in crop yield loss. For
example, in maize plants, accumulating evidence suggests that the
stem elongation process itself may be linked to suppression of ear
development. Corn prolificacy and ear establishment are sensitive
to light intensity. High population density may cause abortion of
ear development at lower nodes, even at all nodes. High density
leads to most of the red and blue spectra of the sunlight being
absorbed by the upper leaves, leaving the far-red light filtered or
reflected to the lower canopy. The red/far-red ratio is a function
of canopy density. If the density is high, the red/far-red ratio is
low. This low ratio triggers the shade avoidance response, in which
the plants distribute resources for stem elongation in a
competition for sunlight (Quail et al, Science 268, 675-680, 1995).
Reduction or elimination of the shade avoidance response has been
shown to improve harvest index or yield (Maliakal et al, Critic.
Rev. Plant Sci. 17, 465-539,1999; Thiele et al, Plant Physiol. 120,
73-81, 1999; Robson et al, Nature Tech. 14, 995-998, 1996). Thus,
the shade avoidance response is relevant to the harvest index, for
example at high population density.
[0006] Various attempts have been made to overcome the shade
avoidance problem in crop farming. Breeding efforts usually result
in shorter plants and, in the case of corn, smaller tassels to save
energy and nutrition for kernel development (Duvick and Cassman,
Crop Sci. 39, 1622-1630, 1999; Chapman and Edmeades, Crop Sci. 39,
1315-1324, 1999). Molecular and biotechnological approaches have
also been tried to identify a gene or a set of genes that
manipulate the photomorphogenesis pathway in a manner modifying the
plant architecture to have shorter internodes. Such a plant, when
growing in a dense population, would have the ability to respond to
low light environment without extending its stem, thereby
minimizing the shade avoidance response and enhancing yield (see,
for example, Smith, U.S. Pat. No. 5,945,579; Hershey and Keller,
U.S. Pat. No. 5,268,526; Deng et al., PCT Application
WO00/18940).
[0007] In recent decades, many genes or gene mutants in
light-signal transduction and shade avoidance response pathways
have been identified and studied (Chory, Plant Cell 9: 1225-1234,
1997; Chory et al., Cell 58: 991-999, 1989; Deng et al., Genes Dev.
5: 1172-1182, 1991; Karlin-Neumann et al., Plant Physiol. 88:
1323-1331, 1988; Lissemore and Quail, Mol. Cell Biol. 8: 4840-4850,
1988; U.S. Pat. No. 5,945,579; McNellis and Deng, Plant Cell 7:
1749-1761, 1995; Nagatani et al., Plant Physiol. 102: 269-277,
1993; Osterlund et al., Trends Cell Bio. 9: 113-118, 1999; Parks
and Quail, Plant Cell 5: 39-48, 1993). Among these genes, a
constitutive photomorphogenesis 1 gene (COP1) from Arabidopsis has
been studied and demonstrated to be regulated by light during plant
development in response to different light conditions (Osterlund et
al., Trends Cell Bio. 9: 113-118, 1999; Deng et al., Cell 71:
791-801, 1992; McNellis et al., Plant Cell 6: 1391-1400, 1995;
McNellis et al., Plant Cell 8: 1491-1503, 1996; Osterlund and Deng,
Plant Journal 16 (2): 201-208, 1998; Stacey et al., Plant Cell 11:
349-363; Torii et al., EMBO 17: 5577-5587, 1998; von Arnim and
Deng, Cell 79: 1035-1045; Yamamoto et al., Plant Cell 10:
1083-1094, 1998; Deng et al., PCT Application WO00/18940). The COP1
gene was initially identified through recessive loss-of-function
mutations in Arabidopsis that display a constitutively
photomorphogenic phenotype regardless of light conditions (Deng et
al., Genes Dev. 5: 1172-1182, 1991). The constitutively
photomorphogenie phenotype and recessive nature of cop1 mutations
indicate that COP1 may act as a negative regulator, or
light-inactivated repressor, of photomorphogenesis. The COP1 gene
in Arabidopsis encodes a protein that contains three recognizable
domains: a ring finger domain (zinc-binding motif), a coiled-coil
domain and multiple WD-40 repeats characteristic of the B subunit
of trimeric G-proteins (Deng et al., Cell 71: 791-801, 1992; PCT
Application WO00/18940). These protein domains have been implicated
in protein-protein interactions, and thus COP1 might interact with
multiple partners via these interactive domains to regulate plant
morphogenic development and the shade avoidance response.
Overexpression of a full-length COP1 results in quantitative
hypersuppression of photomorphogenic development (McNellis et al.,
Plant Cell 6: 1391-1400, 1995), which suggests that COP1 plays a
role in a regulatory step in mediating the repression of
photomorphogenic development (Osterlund et al., Trends Cell Bio. 9:
113-118, 1999; Deng et al., PCT Application WO 00/18940). The
wild-type COP1 protein normally acts to repress the
photomorphogenic pathway in darkness and light reverses this
repression. COP1 appears to be a downstream light-signaling
component (Deng et al., Cell 71: 791-801, 1992; PCT Application WO
00/18940). Overexpression of a fragment of COP1 in Arabidopsis is
hypothesized to down regulate native COP1, this has also resulted
in shorter stems of transgenic plants growing under low light
conditions in comparison with those of wild-type plants (see, Deng
et al., PCT Application WO 0018940).
[0008] Thus, the COP1 proteins in plants growing at low light
conditions such as in a highly populated environment will act to
repress normal photomorphogenic development of these plants and
help activate shade avoidance response pathway to stimulate stem
elongation. Therefore, reducing the level of functional COP1
proteins in plants might produce a phenotype typical of plants
growing at high light intensity conditions even when the plants are
under low light conditions. This phenotype could include well
developed leaves, more chloroplasts, shorter and thicker stems.
[0009] Although some studies have been done to understand the role
of COP1 proteins in plant morphogenesis and development, there is
little reported effort on utilizing COP1 to deal with an unsolved,
common problem in crop farming; that is the shade avoidance
response of plants. Deng and his colleagues (Deng et al, PCT
application WO 00/18940) disclosed an isolated COP1 nucleic acid
from Arabidopsis and use of said COP1 Their publication was
directed to improved seedling emergence characteristics and not to
a solution to shade avoidance related problems in crop plants grown
at high population density.
[0010] Thus, there exists a need in the field for a new and
different approach to reduce or diminish the shade avoiding
response of crop plants growing at high population density. There
exists a need, through use of a different light transduction
component, i.e., COP1 gene, to improve some of crop plants'
agronomic traits such as reduced stem length and increased shade
tolerance that are closely associated with crop yield.
SUMMARY OF THE INVENTION
[0011] Therefore, the present invention, in one aspect, relates to
an isolated nucleic acid molecule from a maize plant (Zea mays)
comprising a full-length nucleic acid sequence from a cDNA
identified as ZmCOP1 and having the function of improving crop
plants' agronomic traits that are associated with the crop yield.
ZmCOP1 comprises 2230 nucleotides coding a polypeptide with 693
amino acid residues. The sequence of ZmCOP1 comprises SEQ ID NO:
12.
[0012] The present invention, in another aspect, provides an
isolated nucleic acid from Zea mays comprising a nucleotide
sequence, wherein the nucleotide sequence is defined as follows:
(1) the nucleotide sequence has at least 80% sequence identity to a
sequence comprising SEQ ID NO: 12; (2) the nucleotide sequence
hybridizes under stringent conditions to the complement of a second
isolated nucleic acid, wherein the nucleotide sequence of the
second isolated nucleic acid comprising SEQ ID NO: 12; or (3) the
nucleotide sequence is complementary to (1) or (2).
[0013] The present invention, in still another aspect, provides an
isolated nucleic acid from Zea mays comprising a nucleotide
sequence, wherein the nucleotide sequence is defined as follows:
(1) the nucleotide sequence encodes a polypeptide having an amino
acid sequence that has at least 90% sequence identity to a sequence
comprising SEQ ID NO: 13; (2) the nucleotide sequence hybridizes
under stringent conditions to the complement of a second isolated
nucleic acid, wherein the nucleotide sequence of the second
isolated nucleic acid encodes a polypeptide having an amino acid
sequence comprising SEQ ID NO: 13; or (3) the nucleotide sequence
is complementary to (1) or (2).
[0014] The present invention, in yet another aspect, also relates
to a recombinant DNA construct for producing high-density tolerant
crop plants. The construct comprises a light inducible promoter, a
COP1 structural nucleic acid sequence that comprises a sequence at
least 80% identical to SEQ ID NO: 12 or a fragment thereof, and a
transcription terminator. The recombinant DNA construct causes
reduction of the indigenous COP1 protein level upon its
transformation into a crop plant through introduction of the COP1
structural nucleic acid sequence in an antisense orientation
wherein an antisense COP1 mRNA is transcribed and base-paired with
the indigenous COP1 mRNA. The recombinant DNA construct also causes
the reduction of the indigenous COP1 protein level upon its
transformation into a crop plant by overexpressing a full length or
a fragment of the COP1 protein that binds to a native COP1 protein
and makes the COP1 protein complex non-functional. With the
reduction of the native COP1 protein level in the crop plants the
density tolerance of the crop plants is improved and the crop
plants may be overplanted at a high population density to achieve
enhanced yield.
[0015] The light inducible promoter used in the recombinant DNA
construct may be, but may not be limited to, a cab promoter, an
ATHB-2 promoter, or a far-red light inducible promoter for the
antisense approach or overexpression of the COP1 nucleic acid
sequence or a fragment thereof.
[0016] The present invention, in yet another aspect, also relates
to transgenic crop plants that demonstrate a high-density tolerant
trait. These transgenic crop plants contain exogenous COP1 nucleic
acid sequences that may be in an "antisense" orientation or may be
overexpressed. The exogenous COP1 nucleic acid sequences are at
least 80% identical to SEQ ID NO: 12 or fragments thereof. In a
preferred embodiment, the crop plants contain a full-length ZmCOP1
nucleic acid sequence having SEQ ID NO: 12 or a fragment thereof.
In one example of the present invention when a fragment is
considered, the fragment contains about 1233 nucleotides from the
5' end of the ZmCOP1 having SEQ ID NO: 14. In another example of
the present invention, the fragment contains about 906 nucleotides
from the 5' end having SEQ ID NO: 16. The transgenic crop plants
have reduced levels of the native COP1 proteins from their native
COP1 nucleic acid sequences. The transgenic crop plants also
demonstrate a number of other desirable agronomic traits over
wild-type crop plants in that they have shorter stems and more
sturdy architecture.
[0017] The present invention, in yet still another aspect, also
provides a method of overplanting crop plants at a high population
density for yield enhancement by producing the transgenic crop
plants with reduced COP1 protein level in comparison to that of the
wild crop plants. Through reduction of the COP1 protein levels in
the transgenic crop plants the architecture of the transgenic
plants is modified and their shade avoidance responses to light are
minimized. In a preferred embodiment, the levels of the functional
endogenous COP1 proteins in the transgenic crop plants may be
reduced by binding an endogenous COP1 mRNA with an antisense ZmCOP1
sequence that comprises the full-length ZmCOP1 nucleic acid
sequence of the present invention encoding SEQ ID NO: 13. The
levels of the functional endogenous COP1 proteins in the transgenic
plants may also be reduced by binding the endogenous COP1 mRNA with
an antisense ZmCOP1 sequence that only comprises a fragment of the
COP1 nucleic acid sequence. The level of the functional endogenous
COP1 proteins may also be reduced by overexpressing a full length
unaltered or mutated ZmCOP1 protein or a fragment thereof with
binding domains that binds to a native endogenous COP1 protein and
thus rendering the endogenous COP1 protein complex non-functional.
The fragment of the ZmCOP1 protein used in the present invention as
an example may comprise 411 amino acid residues from the N terminal
end having SEQ ID NO: 15 that comprises a protein-binding domain.
The fragment of the COP1 protein in another example may also
comprise 301 amino acid residues from the N terminal end having SEQ
ID NO: 17 that comprises a protein-binding domain.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1A-C. Nucleotide sequence alignment of Arabidopsis COP1
(AtCOP1_gi-402684) and maize (Zea mays) COP1 (ZmCOP1). The homology
comparison indicates that these two nucleotide sequences have a 50%
sequence identity.
[0019] FIG. 2A-D. Nucleotide sequence alignment of the rice (Oryza
sativa) COP1 (OsCOP1, gi7592844) and maize (Zea mays) COP1
(ZmCOP1). The homology comparison indicates that these two
nucleotide sequences have a 77% sequence identity.
[0020] FIG. 3A-B. Peptide sequence alignment of maize (Zea mays)
COP1 (ZmCOP1) and selected COP1 peptide sequences from other
plants. ZmCOP1 is from maize (Zea mays), PsCOP1 from pea (Pisum
sativum), At COP1 from Arabidopsis thaliana, COP1 from Japanese
morning glory (Ipomoea nil), OsCOP1 from rice (Oryza sativa), and
LeCOP1 from tomato (Lycopersicon esculentum).
[0021] FIG. 4. A plasmid map of pMON47119. The coding sequence of
the N-terminal end 411 amino acid residues of ZmCOP1 was placed
under the control of a cab promoter.
[0022] FIG. 5. A plasmid map of pMON47118. The coding sequence of
the N-terminal end 301 amino acid residues of ZmCOP1 was placed
under the control of a cab promoter.
[0023] FIG. 6. A plasmid map of pMON47120. ZmCOP1 was cloned in the
vector in reverse orientation and placed under the control of a cab
promoter.
[0024] FIG. 7. A plasmid map of pMON47130. The coding sequence of
the N-terminal end 301 amino acid residues of ZmCOP1 was placed
under the control of a rice-actin promoter (RACT) promoter.
[0025] FIG. 8. A plasmid map of pMON47131. The coding sequence of
the full length ZmCOP1 was cloned in the vector in reverse
orientation and was placed under the control of a rice-actin
promoter (RACT) promoter.
[0026] FIG. 9. The height comparison of the transformed R1 plants
with the wild type plants at maturity. The average height and
growth rate of some R1 transformed plants from pMON47118 in several
events were lower compared to those of the wild type plants growing
nearby. LH172 is a wild type inbred used for transformation; ZM is
a transformed R1 plant; LH172/ZM represents a F1 plant obtained by
crossing LH172 plant with a transformed R0 plant. Each number under
each bar in the figure, e.g., ZM 535321, represents one event.
[0027] FIG. 10. Western analysis of YAA plants
[0028] FIG. 11. Plant height of some YAA events at V11 stage
[0029] FIG. 12. Western analysis of Kyle plants grown under normal
(full green house) light and weak light.
[0030] FIG. 13. Western blot analysis to determine protein
expression levels in Kyle 17 and Kyle 50 events. Both Kyle positive
(Pos) and negative (Neg) events are shown at different growth
stages. Stage 1 represents the V3-V4 stage, 2 represents the V5-V7
stage, and 3 the VT stage. P is a positive control.
[0031] FIG. 14. Mesocotyl lengths of Kyle seedlings grown under 1
micromole per meter squared of light.
[0032] FIG. 15. Plant height of 5 Kyle events four weeks after
transplanting.
[0033] FIG. 16. Picture of positive (on both sides) and negative
(center) lines from the Kyle 77 event.
[0034] FIG. 17. Height of plants from the Kurt R1/F1 plants grown
in the field. Shown below is the expression level of their
transgene by Western analysis.
DETAILED DESCRIPTION
[0035] Provided below are the following definitions to aid those
skilled in the art in understanding the detailed description of the
present invention.
[0036] As used herein, "antisense technology" refers to a method to
introduce into cells a RNA or single-stranded DNA molecule that is
complementary to the mRNA of the target gene. This antisense
molecule may base-pair with the endogenous mRNA, preventing
translation of the mRNA into a protein.
[0037] As used herein, a "coding sequence", "structural nucleotide
sequence" or "structural gene" is a nucleotide sequence that is
translated into a polypeptide, usually via mRNA, when placed under
the control of appropriate regulatory sequences. The boundaries of
the coding sequence are determined by a translation start codon at
the 5'-terminus and a translation stop codon at the 3'-terminus. A
coding sequence may include, but may not be limited to, genomic
DNA, cDNA, and recombinant nucleotide sequences.
[0038] As used herein, a constitutive photomorphogenesis 1 nucleic
acid, or "COP1 nucleic acid", refers to a nucleic acid encoding all
or part of a specific constitutive photomorphogenesis 1 protein, or
"COP1 protein". A COP1 nucleic acid may be defined functionally by
its ability to confer a modulated photomorphogenic response upon
transformation into a plant. The COP1 nucleic acids may include any
COP1 nucleic acids from any source. The exemplary COP1 nucleic acid
is the COP1 nucleic acid as disclosed in the present invention.
[0039] As used herein, a "C-terminal region" refers to the region
of a peptide, polypeptide, or protein chain from the middle thereof
to the end that carries the amino acid having a free carboxyl
group. A "N-terminal region" refers to the region of a peptide,
polypeptide, or protein chain from the amino acid having a free
amino group to the middle of the chain.
[0040] As used herein, "expression" refers to the transcription and
stable accumulation of sense (mRNA) or antisense RNA derived from
the nucleic acid of the invention. Expression may also refer to
translation of mRNA into a polypeptide. Also as used herein,
"overexpression" refers to the production of a gene product in
transgenic organisms that exceeds levels of production in normal or
non-transformed organisms.
[0041] As used herein, a "genotype" refers to the genetic
constitution, latent or expressed, of a plant, the sum total of all
genes present in an individual. As used herein, a "phenotype" of a
plant is any of one or more characteristics of a plant (e.g. male
sterility, yield, quality improvements, etc.), as contrasted with
the genotype. A change in genotype or phenotype may be transient or
permanent.
[0042] As used herein, a "homolog" of a nucleotide sequence refers
to an isolated nucleic acid sequence which is substantially the
same as the COP1 nucleic acid sequence of the present invention or
its complementary nucleotide sequence. A "homolog" of the COP1
nucleic acid sequence is a polynucleotide sequence from a plant
species that encodes a polypeptide that is functionally similar to
COP1 and that preferably has substantial amino acid sequence
identity or similarity to COP1 from maize.
[0043] Planting or population density varies from a crop to a crop,
from a growing region to another region and from a year to another
year. As used herein, the term "high population density" is defined
as a density at least 10% to 100% higher than the average
prevailing density for a given crop in a given growing region.
Preferably, the high population density is at least 10% higher,
more preferably at least 40% higher, more preferably at least 70%
higher, and most preferably at least 100% higher than the average
prevailing density for the given crop in the given growing region.
The "average prevailing density" is defined as the average of the
planting density used by the majority of farmers in a region. Taken
corn as an example, the average prevailing density is 20,000 plants
per acre in Missouri, USA. The higher population density is
preferably at least 22,000 plants per acre, more preferably at
least 28,000 plants per acre, more preferably at least 34,000
plants per acre, and most preferably at least 40,000 plants per
acre.
[0044] The average prevailing densities of a few crop plants in the
USA in 2000 are listed below (Table 1). The examplery crop species
are just examples and, therefore, may not be construed as
limitations to the scope of the present invention. Similarly, the
country selected above, i.e., USA, is also an example in which the
average prevailing densities of these few crop plants can be
demonstrated. It may not be construed as a limitation of the
present invention.
TABLE-US-00001 TABLE 1 The average prevailing densities of a few
crop plants in the USA (per acre) Crop Name Density Corn
20,000-25,000 Wheat 1,000,000-1,500,000 Rice 650,000-900,000
soybean 150,000-200,000 Canola 260,000-350,000 Sunflower
17,000-23,000 Cotton 28,000-55,000
[0045] As used herein, "hybridization" refers to the ability of a
strand of nucleic acid to join with a complementary strand via base
pairing. Hybridization occurs when complementary sequences in the
two nucleic acid strands bind to one another.
[0046] As used herein, "identical" nucleotide or protein sequences
are determined by using programs such as a BLAST program (Altschul
et al., Nucleic Acids Res. 25:3389-3402; 1997) using the default
parameters (Expectation value (E): blank; Alignment view options:
pairwise; Filter query sequence: no; Cost to open a gap: 0; Cost to
extend a gap: 0; X dropoff value for gapped alignment: 0; Show GI's
in deflines: no; Penalty for a nucleotide mismatch: -3; Reward for
a nucleotide match: 1; Threshold for extending hits: 0; Perform
gapped alignment: yes; Query Genetic code to use: standard; DB
Genetic code: standard; Believe the query define: no; Matrix:
BLOSUM62; Word size: 0; Effective length of the database: 0; Query
strand Use: both).
[0047] As used herein, an "isolated" nucleic acid is one that has
been substantially separated or purified away from other nucleic
acid sequences in the cell of the organism in which the nucleic
acid naturally occurs, i.e., other chromosomal and extrachromosomal
DNA and RNA, by conventional nucleic acid-purification methods. The
term also embraces recombinant nucleic acids and chemically
synthesized nucleic acids.
[0048] The term "polypeptide" or "protein", as used herein, refers
to a polymer composed of amino acids connected by peptide bonds.
The term "polypeptide" or "protein" also applies to any amino acid
polymers in which one or more amino acid residue is an artificial
chemical analogue of a corresponding naturally occurring amino
acid, as well as to any naturally occurring amino acid polymers.
The essential nature of such analogues of naturally occurring amino
acids is that, when incorporated into a protein, that protein is
specifically reactive to antibodies elicited to the same protein
but consisting entirely of naturally occurring amino acids. It is
well known in the art that proteins or polypeptides may undergo
modification, including but not limited to, disulfide bond
formation, gamma-carboxylation of glutamic acid residues,
glycosylation, lipid attachment, phosphorylation, oligomerization,
hydroxylation and ADP-ribosylation. Exemplary modifications are
described in most basic texts, such as, for example,
Proteins--Structure and Molecular Properties, 2nd ed. (Creighton,
Freeman and Company, N. Y., 1993). Many detailed reviews are
available on this subject, such as, for example, those provided by
Wold (In: Post-translational Covalent Modification of Proteins,
Johnson, Academic Press, N. Y., pp. 1-12, 1983), Seifter et al.
(Meth. Enzymol. 182: 626, 1990) and Rattan et al. (Ann. N.Y. Acad.
Sci. 663: 48-62, 1992). Modifications can occur anywhere in a
polypeptide, including the peptide backbone, the amino acid side
chains and the amino or carboxyl termini. In fact, blockage of the
amino or carboxyl group in a polypeptide, or both, by a covalent
modification, is common in naturally occurring and synthetic
polypeptides and such modifications may be present in polypeptides
of the present invention, as well. For instance, the amino terminal
residue of polypeptides made in E. coli or other cells, prior to
proteolytic processing, almost invariably will be
N-formylmethionine. During post-translational modification of the
polypeptide, a methionine residue at the NH.sub.2 terminus may be
deleted. Accordingly, this invention contemplates the use of both
the methionine containing and the methionine-less amino terminal
variants of the protein of the invention. Thus, as used herein, the
term "protein" or "polypeptide" includes any protein or polypeptide
that is modified by any biological or non-biological process. The
terms "amino acid" and "amino acids" refer to all naturally
occurring amino acids and, unless otherwise limited, known analogs
of natural amino acids that can function in a similar manner as
naturally occurring amino acids.
[0049] As used herein, the term "isolated polypeptide" refers
primarily to a polypeptide produced by expression of an isolated
nucleic acid molecule of the present invention or by chemically
synthesizing process. Alternatively, this term may refer to a
polypeptide which has been sufficiently separated from other
polypeptides or proteins with which it would naturally be
associated, so as to exist in substantially pure form. Also as used
herein, a "functionally equivalent fragment" of the isolated
polypeptide refers to a polypeptide that lacks at least one residue
a native full length COP1 polypeptide. Such a fragment retains COP1
activity when expressed in a transgenic plant or possesses a
characteristic functional domain or an immunological determinant
characteristic of a native COP1 polypeptide. Immunologically active
fragments typically have a minimum size of 7 or 17 or more amino
acids. Preferably, COP1 fragments are at least 10 amino acids in
length.
[0050] As used herein, the term "native" refers to a naturally
occurring ("wild type") nucleic acid or polypeptide.
[0051] As used herein, a "percentage of sequence identity" is
determined by comparing two optimally aligned sequences over a
comparison window, wherein the portion of the polynucleotide
sequence in the comparison window may comprise additions or
deletions (i.e., gaps) as compared to the reference sequence (which
does not comprise additions or deletions) for optimal alignment of
the two sequences. The percentage is calculated by determining the
number of positions at which the identical nucleic acid base or
amino acid residue occurs in both sequences to yield the number of
matched positions, dividing the number of matched positions by the
total number of positions in the window of comparison and
multiplying the result by 100 to yield the percentage of sequence
identity. The percentage of sequence identity may be determined by
using programs such as a BLAST program (Altschul et al., Nucleic
Acids Res. 25:3389-3402; 1997) using the default parameters.
[0052] As used herein, a "promoter" refers to a DNA sequence
capable of controlling the expression of a coding sequence or
functional RNA. In general, a coding sequence is located 3' to a
promoter sequence. The promoter sequence consists of proximal and
more distal upstream elements, the later elements often referred to
as enhancers. Accordingly, an "enhancer" is a DNA sequence which
can stimulate promoter activity and may be an innate element of the
promoter or a heterologous element inserted to enhance the level or
tissue-specificity of a promoter. Promoters may be derived in their
entirety from a native gene, or be composed of different elements
derived from different promoters found in nature, or even comprise
synthetic DNA segments. It is understood by those skilled in the
art that different promoters may direct the expression of a gene in
different tissues or cell types, or at different stages of
development, or in response to different environmental conditions.
Promoters which cause a gene to be expressed in most cell types at
most times are commonly referred to as "constitutive promoters".
Promoters which cause conditional expression of a structural
nucleotide sequence under the influence of changing environmental
conditions or developmental conditions are commonly referred to as
"inducible promoter".
[0053] "Promoter" refers to a DNA sequence that binds an RNA
polymerase (and often other transcription factors as well) and
promotes transcription of a downstream DNA sequence. Said sequence
can be an RNA that has function, such as rRNA (ribosomal RNA) or
tRNA (transfer RNA). Often, the RNA produced is a hetero-nuclear
(hn) RNA that has introns which are spliced out to produce an mRNA
(messenger RNA). A "plant promoter" is a native or non-native
promoter that is functional in plant cells. Constitutive promoters
are functional in most or all tissues of a plant throughout plant
development. Tissue-, organ- or cell-specific promoters are
expressed only or predominantly in a particular tissue, organ, or
cell type, respectively "Specifically" expressed and "enhanced"
expression are not distinguishable and are used inter-changeably
herein. Often, a promoter discussed as "specifically" expressed in
one paper or patent is found to only offer "enhanced" expression in
that tissue as the number of tissues studied for expression is
increased, or more sensitive techniques are used to study
expression in the same tissues. "Enhanced expression" is used
herein to refer to any promoter that provides an increased
expression in a single tissue or developmental stage, or under a
particular environmental condition, but causes expression, even
significant expression, in other tissue(s), or developmental
stage(s), or environmental condition(s).
[0054] Temporally regulated promoters are functional only or
predominantly during certain periods of plant development or at
certain times of day, as in the case of genes associated with
circadian rhythm, for example. Inducible promoters selectively
express an operably linked DNA sequence in response to the presence
of an endogenous or exogenous stimulus, for example by chemical
compounds (chemical inducers) or in response to environmental,
hormonal, chemical, and/or developmental signals. Inducible or
regulated promoters include, for example, promoters regulated by
light, heat, stress, flooding or drought, phytohormones, wounding,
cold, or chemicals such as ethanol, jasmonate, salicylic acid, or
safeners.
[0055] Any plant promoter can be used as a 5' regulatory sequence
for modulation expression of a particular gene or genes. One
preferred promoter would be a plant RNA polymerase II promoter.
Plant RNA polymerase II promoters, like those of other higher
eukaryotes, have complex structures and are comprised of several
distinct elements. One such element is the TATA box or
Goldberg-Hogness box, which is required for correct expression of
eukaryotic genes in vitro and accurate, efficient initiation of
transcription in vivo. The TATA box is typically positioned at
approximately -25 to -35, that is, at 25 to 35 basepairs (bp)
upstream (5') of the transcription initiation site, or cap site,
which is defined as position+1 (Breathnach and Chambon, Ann. Rev.
Biochem. 50:349-383, 1981; Messing et al., In: Genetic Engineering
of Plants, Kosuge et al., eds., pp. 211-227, 1983). Another common
element, the CCAAT box, is located between -70 and -100 bp. In
plants, the CCAAT box may have a different consensus sequence than
the functionally analogous sequence of mammalian promoters (the
plant analogue has been teinied the "AGGA box" to differentiate it
from its animal counterpart; Messing et al., In: Genetic
Engineering of Plants, Kosuge et al., eds., pp. 211-227, 1983). In
addition, virtually all promoters include additional upstream
activating sequences or enhancers (Benoist and Chambon, nature
290:304-310, 1981; Gruss et al., Proc. Nat. Acad. Sci. USA
78:943-947, 1981; and Khoury and Gruss, Cell 27:313-314, 1983)
extending from around 100 bp to 1,000 bp or more upstream of the
transcription initiation site.
[0056] When fused to heterologous DNA sequences, such promoters
typically cause the fused sequence to be transcribed in a manner
that is similar to that of the gene sequence with which the
promoter is normally associated. Promoter fragments that include
regulatory sequences can be added (for example, fused to the 5' end
of, or inserted within, an active promoter having its own partial
or complete regulatory sequences (Fluhr, et al., Science
232:1106-1112, 1986; Ellis et al., EMBO J. 6:11-16, 1987;
Strittmatter and Chua, Proc. Nat. Acad. Sci. USA 84:8986-8990,
1987; Poulsen and Chua, Mol. Gen. Genet. 214:16-23, 1988; Comai et
al., Plant Mol. Biol. 15:373-381, 1991). Alternatively,
heterologous regulatory sequences can be added to the 5' upstream
region of an inactive, truncated promoter, e.g., a promoter
including only the core TATA and, sometimes, the CCAAT elements
(Fluhr, et al., Science 232:1106-1112, 1986; Strittmatter and Chua,
Proc. Nat. Acad. Sci. USA 84:8986-8990, 1987; Aryan et al., Mol.
Gen. Genet. 225:65-71, 1991).
[0057] Promoters are typically comprised of multiple distinct
"cis-acting transcriptional regulatory elements," or simply
"cis-elements," each of which can confer a different aspect of the
overall control of gene expression (Strittmatter and Chua, Proc.
Nat. Acad. Sci. USA 84:8986-8990, 1987; Ellis et al., EMBO J.
6:11-16, 1987; Benfey et al., EMBO J. 9:1677-1684, 1990). "cis
elements" bind trans-acting protein factors that regulate
transcription. Some cis elements bind more than one factor, and
trans-acting transcription factors may interact with different
affinities with more than one cis element (Johnson and McKnight,
Ann. Rev. Biochem. 58:799-839, 1989). Plant transcription factors,
corresponding cis elements, and analysis of their interaction are
discussed, for example, in: Martin, Curr. Opinions Biotech.
7:130-138, 1996; Murai, In: Methods in Plant Biochemistry and
Molecular Biology, Dashek, ed., CRC Press, 1997, pp. 397-422; and
Methods in Plant Molecular Biology, Maliga et al., eds., Cold
Spring Harbor Press, 1995, pp. 233-300. The promoter sequences of
the present invention can contain "cis elements" which can modulate
gene expression. Cis elements can be part of the promoter, or can
be upstream or downstream of said promoter. Cis elements (or groups
thereof) acting at a distance from a promoter are often referred to
as repressors or enhancers. Enhancers act to upregulate the
transcriptional initiation rate of RNA polymerase at a promoter,
repressors act to decrease said rate. In some cases the same
elements can be found in a promoter and an enhancer or repressor.
Cis elements are generally sites where transcription factors bind
to the DNA and modulate the rate at which RNA polymerase binds to
the promoter.
[0058] The term "constitutive promoter" means a regulatory sequence
that causes expression of a structural nucleotide sequence in most
cells or tissues at most times. Constitutive promoters are active
under many environmental conditions and states of development or
cell differentiation. A variety of constitutive promoters are well
known in the art. Examples of constitutive promoters that are
active in plant cells include but are not limited to the nopaline
synthase (NOS) promoters; the cauliflower mosaic virus (CaMV) 19S
and 35S (sometimes called 35S herein, or a derivative of which is
called e35S {U.S. Pat. Nos. 5,359,142, 5,196,525, 5,322,938,
5,164,316, and 5,424,200}); the tobacco mosaic virus promoter; the
figwort mosaic virus promoters; and actin promoters, such as the
Arabidopsis actin gene promoter (see, e.g., Huang et al., Plant
Mol. Biol. 33:125-139 (1997).
[0059] The term "tissue-specific promoter" means a regulatory
sequence that causes an enhancement of transcription from a
downstream gene in specific cells or tissues at specific times
during plant development, such as in vegetative tissues or
reproductive tissues. Examples of tissue-specific promoters under
developmental control include promoters that initiate transcription
only (or primarily only) in certain tissues, such as vegetative
tissues, e.g., roots, leaves or stems, or reproductive tissues,
such as fruit, ovules, seeds, pollen, pistols, flowers, or any
embryonic tissue. Reproductive tissue specific promoters may be,
e.g., ovule-specific, embryo-specific, endosperm-specific,
integument-specific, seed coat-specific, pollen-specific,
petal-specific, sepal-specific, or some combination thereof. One
skilled in the art will recognize that a tissue-specific promoter
may drive expression of operably linked sequences in tissues other
than the target tissue. Thus, as used herein a tissue-specific
promoter is one that drives expression preferentially in the target
tissue, but may also lead to expression in other tissues as
well.
[0060] Suitable seed-specific (inclusive of seed enhanced
promoters) can be derived from the following genes: MAC1 from maize
(Sheridan et al., Genetics 142:1009-1020 (1996); Cat3 from maize
(GenBank No. L05934, Abler et al., Plant Mol. Biol. 22:10131-1038
(1993); vivparous-1 from Arabidopsis (Genbank No. U93215); Atimycl
from Arabidopsis (Urao et al., Plant Mol. Biol. 32:571-57 (1996);
Conceicao et al., Plant 5:493-505 (1994), herein incorporated by
reference in their entireties); napA from Brassica napus (GenBank
No. J02798); the napin gene family from Brassica napus (Sjodahl et
al., Planta 197:264-271 (1995)). Seed specific promoters are an
integral part of the current invention. It should be noted that a
seed specific promoter can often cause the expression of a gene in
more than just seeds, or in more than one portion or tissue of a
seed. Thus seed specific can be read as seed enhanced and is meant
to be inclusive of any promoter that preferentially drives
expression in any tissue in seed.
[0061] Promoters derived from genes encoding embryonic storage
proteins, which includes the gene encoding the 2S storage protein
from Brassica napus (Dasgupta et al, Gene 133:301-302 (1993); the
2s seed storage protein gene family from Arabidopsis; the gene
encoding oleosin 20 kD from Brassica napus (GenBank No. M63985);
the genes encoding oleosin A (GenBank No. U09118) and oleosin B
(GenBank No. U09119) from soybean; the gene encoding oleosin from
Arabidopsis (GenBank No. Z17657); the gene encoding oleosin 18 kD
from maize (GenBank No. J05212, Lee, Plant Mol. Biol. 26:1981-1987
(1994)); and the gene encoding low molecular weight sulphur rich
protein from soybean (Choi et al., Mol. Gen. Genet. 246:266-268
(1995)), can also be used.
[0062] Promoters can also be induceable under particular
environmental conditions. For example a promoter could be
upregulated, or even turned on, by far-red light, cold, heat,
drought, blue light (or any other mix of wavelengths), day length,
or myriad other environmental conditions. These promoters could be
isolated by the use of general molecular biology techniques
including transcription profiling of possible genes, and then
isolation of the promoters of those genes through cloning and
PCR.
[0063] As noted above, the present invention provides a recombinant
DNA construct or expression vector that facilitates the expression
of the COP1 nucleic acid sequence discussed herein in plants. As
used herein, the term "recombinant DNA construct" refer to
assemblies of DNA fragments through genetic engineering operatively
linked in a functional manner that direct the expression of the
COP1 nucleic acid sequence discussed herein, as well as any
additional sequence(s) or gene(s) of interest in the plants.
[0064] As used herein, "regeneration" refers to the process of
growing a plant from a plant cell or tissue (e.g., plant protoplast
or explant).
[0065] As used herein, "sequence homology" refers to nucleic acid
or polypeptide sequence that has certain percentage of nucleotide
or amino acid similarity, as used in the present invention, to a
native COP1 nucleic acid or polypeptide sequence or COP1 nucleic
acid or polypeptide sequence. Ordinarily, if a COP1 nucleic acid or
polypeptide sequence encompassed by the present invention has at
least about 70% nucleotide or amino acid similarity to a native
COP1 nucleic acid or polypeptide sequence or to a COP1 nucleic
acid, preferably at least 80%, more preferably at least about 90%,
and most preferably at least about 95% similarity, such sequence
homology is considered to be substantial homology.
[0066] As used herein, the term "sequence identity" refers to amino
acid or nucleic acid sequences that when compared using the local
homology algorithm of Smith and Waterman in the BestFit program
(Wisconsin Package Version 10.0, Genetics Computer Group (GCG),
Madison, Wis., 1981) are exactly alike.
[0067] As used herein, the term "sequence similarity" refers to
amino acid sequences that when compared using the local homology
algorithm of Smith and Waterman in the BestFit program (Wisconsin
Package Version 10.0, Genetics Computer Group (GCG), Madison, Wis.,
1981) match when conservative amino acid substitutions are
considered.
[0068] As used herein, "shade avoidance responses" refer to plants
that, when growing at a high density condition or other shading
environments, will compete for light by elongating their stems
unlimitedly. These plants will usually be taller with thinner stems
and have reduced photosynthesis rate and reduced allocation of
resource to fruits.
[0069] As used herein, a "stringent condition" is functionally
defined with regard to hybridization of a nucleic-acid probe to a
target nucleic acid (i.e., to a particular nucleic acid sequence of
interest) by the specific hybridization procedure discussed in
Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory Press, Cold Spring Hobart, 1989, at
9.52-9.55). Regarding the amplification of a target nucleic acid
sequence (e.g., by PCR) using a particular amplification primer
pair, "stringent conditions" are conditions that permit the primer
pair to hybridize substantially only to the target nucleic acid
sequence to which a primer having the corresponding wild-type
sequence (or its complement) would bind so as to produce a unique
amplification product. For hybridization of a probe or primer to a
polynucleotide of another plant species in order to identify
homologs, preferred hybridization and washing conditions are as
discussed in Sambrook et al. (supra, at 9.47-9.57, wherein "high
stringent conditions" include hybridization at 65.degree. C. in a
hybridization solution that includes 6.times.SSC and washing for 1
hour at 65.degree. C. in a wash solution that include
0.5.times.SSC, 0.5% SDS. "Moderate stringency" conditions are
similar except that the temperature for the hybridization and
washing steps are performed at a lower temperature at which the
probe is specific for a target sequence, preferably at least
42.degree. C., more preferably at least 50.degree. C., more
preferably at least 55.degree. C., and more preferably at least
60.degree. C. As used herein, a "tissue sample" is any sample that
comprises more than one cell. In a preferred aspect, a tissue
sample comprises cells that share a common characteristic (e.g.,
derived from a leaf, an ear or a stem, etc.).
[0070] As used herein, a "3' untranslated region" or "3'
untranslated nucleic acid sequence" refers to a piece of
transcribed but untranslated nucleic acid sequence at the 3' end
that functions in a plant cell to cause transcriptional termination
and the addition of polyadenylate nucleotides to the 3' end of said
RNA sequence. Typically, a DNA sequence located from four to a few
hundred base pairs downstream of the polyadenylation site serves to
terminate transcription. The region is required for efficient
polyadenylation of transcribed messenger RNA (mRNA). RNA polymerase
transcribes a coding DNA sequence through a site where
polyadenylation occurs.
[0071] As used herein, "transformation" refers to the transfer of a
nucleic acid fragment into the genome of a host organism such as a
host plant, resulting in genetically stable inheritance. Host
plants containing the transformed nucleic acid fragments are
referred to as "transgenic plants".
[0072] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs.
[0073] Although methods and materials similar or equivalent to
those described herein can be used in the practice or testing of
the present invention, suitable methods and materials are described
below. Standard recombinant DNA and molecular cloning techniques
used herein are well known in the art and are described in detail
in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, 1989).
Constitutive Photomorphogenesis 1 (COP1) Gene and Protein
[0074] The present invention is directed to an isolated
constitutive photomorphogenesis 1 (COP1) nucleic acid that encodes
a COP1 protein. As disclosed in the present invention, the COP1
nucleic acid disclosed herein is isolated from a maize plant and is
a full length COP1 cDNA sequence comprising 2230 nucleotides. Its
COP1 protein comprises 693 amino acid residues.
[0075] In a preferred embodiment, an isolated nucleic acid molecule
of the present invention may comprise a nucleotide sequence or
complement thereof, wherein the nucleotide sequence encodes a
polypeptide having an amino acid sequence that has at least 90%
sequence identity to SEQ ID NO: 13.
[0076] In a further preferred embodiment, an isolated nucleic acid
molecule of the present invention may comprise a nucleotide
sequence or complement thereof, wherein the nucleotide sequence
encodes a polypeptide having an amino acid sequence that has at
least 93% sequence identity to SEQ ID NO: 13.
[0077] In a more preferred embodiment, an isolated nucleic acid
molecule of the present invention may comprise a nucleotide
sequence or complement thereof, wherein the nucleotide sequence
encodes a polypeptide having an amino acid sequence that has at
least 96% sequence identity to SEQ ID NO: 13.
[0078] In a most preferred embodiment, an isolated nucleic acid
molecule of the present invention may comprise a nucleotide
sequence or complement thereof, wherein the nucleotide sequence
encodes a polypeptide having an amino acid sequence that has at
least 98% sequence identity to SEQ ID NO: 13.
[0079] The isolated nucleic acid of the present invention may also
comprise a nucleotide sequence or complement thereof, wherein the
nucleotide sequence encodes a polypeptide having an amino acid
sequence set forth in SEQ ID NO: 13 with conservative amino acid
substitutions.
[0080] The present invention is directed to a method for
manipulating COP1 gene expression in transgenic plants to overcome
shade avoidance responses when they grow in a highly populated
environment. For this purpose, the COP1 nucleic acid used in the
present invention is not necessarily the maize COP1 nucleic acid
disclosed herein. It can be any COP1 nucleic acids available in the
art and these COP1 nucleic acids may include the sequences from
Arabidopsis (Deng et al., Cell 27, 791-801, 1992), rice
(gi7592844), tomato (gi4090943), pea (Zhao et al., Biochimica et
Biophysica Acta-Gene Structure and Expression 1395, 326-328, 1998)
and Japanese morning glory (Ipomoea nil). The species provided
herein are just a few examples of COP1 sequences that can be
readily available for use in the present invention and thus should
not be interpreted in any way to limit the scope of the present
invention. The COP1 nucleotide sequence used in the present
invention can be a full length or a fragment of any of the COP1
nucleotide sequences from any species. Those skilled in the art
will be able to identify other COP1 sequences from different
species and alterations that can be made to the COP1 sequences and
method disclosed herein while not departing from the scope of the
present invention.
Preparation of cDNA Libraries for Isolation of COP1 Gene
[0081] Complementary DNA (cDNA) libraries from a plant may be
prepared and screened for COP1 nucleic acids. Using a maize plant
as an example herein and throughout the detailed descriptions of
the preferred embodiments, cDNA libraries from the maize plant may
be prepared according to standard techniques known to those skilled
in the art, for instance, in Sambrook et al., Molecular Cloning--A
Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring
Harbor, N.Y., (1989). Using conventional methodologies, cDNA
libraries can be constructed from the mRNA of a given tissue sample
or an organ using poly dT primers and reverse transcriptase
(Efstratiadis et al., Cell 7:279-288, 1976; Higuchi et al., Proc.
Natl. Acad. Sci. (U.S.A.) 73:3146-3150, 1976; Maniatis et al., Cell
8:163, 1976; Land et al., Nucleic Acids Res. 9:2251-2266, 1981;
Okayama et al., Mol. Cell. Biol. 2:161-170, 1982; Gubler et al.,
Gene 25:263, 1983). Several methods may be employed to obtain
full-length cDNA constructs. For example, terminal transferase can
be used to add homopolymeric tails of dC residues to the free 3'
hydroxyl groups (Land, et al., Nucleic Acids Res. 9:2251-2266,
1981). This tail can then be hybridized by a poly dG oligo which
can act as a primer for the synthesis of full length second strand
cDNA. A simplified method has been developed by using synthetic
primer-adapters that have both homopolymeric tails for priming the
synthesis of the first and second strands and restriction sites for
cloning into plasmids (Coleclough et al., Gene 34:305-314, 1985)
and bacteriophage vectors (Krawinkel et al., Nucleic Acids Res.
14:1913, 1986; and Han et al., Nucleic Acids Res. 15: 6304,
1987).
[0082] A method to enrich preparations of mRNA is to fractionate by
size. One such method is to fractionate by electrophoresis through
an agarose gel (Pennica et al., Nature 301:214-221, 1983). Another
such method employs sucrose gradient centrifugation in the presence
of an agent, such as methylmercuric hydroxide, that denatures
secondary structure in RNA (Schweinfest, et al., Proc. Natl. Acad.
Sci. (U.S.A.) 79:4997-5000, 1982).
[0083] In one of the preferred embodiments, preparation of
appropriately enriched cDNA libraries from tissue of interest such
as a tissue sample from the stem or ear of the maize plant may be
described as below. The maize plants may be grown in a greenhouse
and, when they reach a desired developmental stage, they may be
used for collection of the tissue samples. The cDNA library may be
constructed using techniques known to those skilled in the art.
Briefly, mRNA from the tissue sample may be isolated and cDNA
prepared. Short chains of oligo d-T nucleotides may be hybridized
with the poly-A tails of the mRNA and serve as a primer for the
enzyme, reverse transcriptase, which synthesizes a complementary
DNA (cDNA) strand. The cDNA may be enriched for the desired
sequences using subtraction hybridization procedures following
Davis et al. (Proc. Natl. Acad. Sci. USA 81: 2194-2198, 1984). The
quality of the cDNA library may be determined by examining the cDNA
insert size, and also by sequence analysis of a random selection of
an appropriate number of clones from the library.
Amplification of the COP1 Gene from the cDNA Library
[0084] As described herein, COP1 nucleic acid molecules from the
cDNA from the maize plant may be amplified through use of many
available methods. The most preferred method of achieving such a
goal may employ the polymerase chain reaction, i.e., "PCR" (Mullis
et al., Cold Spring Harbor Symp. Quant. Biol. 51:263-273, 1986;
Erlich et al., European Patent Application 50,424; European Patent
Application 84,796, European Patent Application 258,017, European
Patent Application 237,362; Mullis, European Patent Application
201,184; Mullis et al., U.S. Pat. No. 4,683,202; Erlich., U.S. Pat.
No. 4,582,788; and Saiki et al., U.S. Pat. No. 4,683,194), using
primer pairs that are capable of hybridizing to the proximal
sequences that define the COP1 nucleic acid of the cDNA library in
its double-stranded form.
[0085] The COP1 nucleic acid molecules may also be amplified by
alternative methods, such as the "Ligase Chain Reaction", i.e., LCR
(Barany, Proc. Natl. Acad. Sci, (U.S.A.) 88:189-193, 1991). LCR
uses two pairs of oligonucleotide probes to exponentially amplify a
specific target. The sequences of each pair of oligonucleotides are
selected to permit the pair to hybridize to abutting sequences of
the same strand of the target. Such hybridization forms a substrate
for a template-dependent ligase. As with PCR, the resulting
products thus serve as a template in subsequent cycles and an
exponential amplification of the desired sequence is obtained.
[0086] Other known nucleic acid amplification procedures, such as
allele-specific oligomers, branched DNA technology,
transcription-based amplification systems, oligonucleotide ligation
assay, or isothermal amplification methods may also be used to
amplify and analyze the COP1 nucleic acid molecules from the cDNA
library of a plant such as the maize plant (Malek et al., U.S. Pat.
No. 5,130,238; Davey et al., European Patent Application 329,822;
Schuster et al., U.S. Pat. No. 5,169,766; Miller et al., PCT
Application WO 89/06700; Kwoh et al., Proc. Natl. Acad. Sci.
(U.S.A.) 86:1173-1177, 1989; Landegren et al., Science 241:
1077-1080, 1988; Gingeras et al., PCT Application WO 88/10315;
Walker et al., Proc. Natl. Acad. Sci. (U.S.A.) 89:392-396,
1992).
Sequencing of the COP1 Nucleic Acid from the cDNA Library
[0087] The COP1 nucleic acid molecule of the cDNA library from the
maize plant may be sequenced after its amplification through use of
many available methods. The most preferred method of achieving such
a goal may employ the polymerase chain reaction ("PCR"), as
described above, using primer pairs that are capable of hybridizing
to the proximal sequences that define the COP1 cDNA library in its
double-stranded form.
Antibody Production
[0088] In one of the preferred embodiments, antibodies to the maize
COP1 of the present invention may be produced using standard
immunological techniques for production of polyclonal antisera and,
if desired, immortalizing the antibody-producing cells of the
immunized host for sources of monoclonal antibody production.
Techniques for producing antibodies to any substance of interest
are well known, e.g., as in Harlow and Lane (Antibodies: A
Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring
Harbor, N.Y., 1988) and as in Goding (Monoclonal Antibodies:
Principles and Practice, 2.sup.nd eds, Academic Press, N Y, 1986).
The antibodies produced in the present invention are useful in
immunoassays for determining the amount or presence of the COP1
protein. Such assays are also useful in quality controlled
production of compositions containing COP1 of the present
invention. In addition, the antibodies can be used to assess the
efficacy of recombinant production of the COP1, as well as for
screening expression libraries for the presence of COP1 encoding
gene. They may also be used as affinity ligands for purifying
and/or isolating the COP1 proteins. The COP1 antigens may be
obtained by over expressing the full or partial length of the COP1
gene.
Promoter Selection and Vector Construction
[0089] Exogenous genetic material such as the wild type COP1
nucleic acid or its fragment thereof may be transferred into a
plant cell by use of a DNA vector or construct designed for such a
purpose. Design of such a vector is generally within the skill of
the art (See, Plant Molecular Biology: A Laboratory Manual, Clark
eds, Springer, New York, 1997).
[0090] In one of the preferred embodiments, the construct may be an
antisense construct comprising the COP1 nucleic acid that is
complementary to, and is capable of pairing, with the native COP1
mRNA and thus prevent translation of the native COP1 mRNA. See Mol
et al. (FEBS Lett. 268: 427-430, 1990) and Green et al. (Annu. Rev.
Biochem. 55: 569-597, 1986) for general description of the
technique. An antisense vector may be constructed by standard
procedures and introduced into cells.
[0091] In another preferred embodiment, the construct may be a
regular transformation vector and the process involves a
"dominant-negative" approach to reduce the functions of native COP1
proteins. In such a method, part or all of the COP1 normal nucleic
acid sequence is placed under the control of a promoter so that a
partial or whole sequence of a protein similar to the targeted
native protein is produced in small or large quantity. These
partial or whole sequence of the expressed COP1 proteins may
interact with the native COP1 proteins in such a way that the
expression level and function of the native COP1 proteins be
reduced. Because of the dominant-negative response of the
endogenous cop1 alleles, this process will modify the
shade-avoidance response to cause production of dominant-negative
transgenic plants.
[0092] A construct or vector may include a plant promoter to
express a COP1 nucleic acid or a fragment thereof. Promoters which
are known or found to cause transcription of nucleic acid molecules
can be used for DNA transcription in the maize plants. Such
promoters may be obtained from a variety of sources such as plants
and plant viruses. The promoter selected should not cause any
potential problems for plant's growth and development. For example,
the promoter selected should not cause any seed germination
problems. A number of promoters which are active in plant cells
have been described in the literature and have been used to create
DNA constructs which have been expressed in plants (see, e.g., PCT
publication WO 84/02913). For the purpose of the present invention,
it is preferred that the particular promoter selected should be a
light-inducible promoter. This light-inducible promoter should be,
in the case of overexpressing the COP1 binding domains, capable of
causing sufficient expression of the exogenous COP1 so that the
exogenous COP1 proteins that include the protein-binding domains
will be produced at a higher level to cause the binding activities
in the transformants to result in the inactivity of the indigenous
COP1 proteins. This light-inducible promoter should be, in the case
of using the antisense technology, capable of producing an
effective amount of mRNA from the exogenous COP1. Thus the
effective amount of mRNA so produced will bind to the indigenous
mRNA in the "antisense" orientation and cause suppression of the
COP1. In either of the above two events, since the indigenous COP1
expression is suppressed, the desired phenotype will in expectation
have shorter internodes. The promoters suitable for the present
invention may include a cab promoter, an ATHB-2 promoter, a rice
HB-2 promoter and a corn HB-2 promoter. In one of the preferred
embodiments, the promoter may be the cab promoter. The methods for
identifying and isolating a light-inducible promoter for the
present invention can be readily available (e.g., Sheen, Plant Cell
2: 1027-1038, 1990).
[0093] In addition to promoters which are known to cause
transcription of COP1 in plants as described above, other promoters
may be identified for use in the present invention by screening a
plant cDNA library for nucleic acids which are selectively or
preferably expressed in the target tissues or cells.
[0094] The vector or construct may also include a structural gene
or a fragment of the structural gene thereof. The "structural gene"
or a fragment of the "structural gene" as used herein in the
present invention comprises the COP1 gene or a fragment of the COP1
gene. The COP1 gene may be operatively linked downstream to a
promoter as described above. In one of the preferred embodiments,
the COP1 gene may be a wild type COP1 nucleic acid or a portion of
the COP1 nucleic acid from any source. The COP1 nucleic acid may be
from a maize plant and may be the ZmCOP1 nucleic acid as disclosed
in the present invention having SEQ ID NO: 12.
[0095] The vector or construct may also include, within the coding
region of interest, a nucleic acid sequence that acts, in whole or
in part, to terminate transcription of that region. For example,
such sequences that have been isolated include the Tr7 3' sequence
and the nos 3' sequence (Ingelbrecht et al., The Plant Cell
1:671-680, 1989; Bevan et al., Nucleic Acids Res. 11:369-385, 1983)
or the like.
[0096] The vector or construct may also include regulatory
elements. Examples of such regulatory elements may include the Adh
intron 1 (Callis et al., Genes and Develop. 1:1183-1200, 1987), the
sucrose synthase intron (Vasil et al., Plant Physiol. 91:1575-1579,
1989), the TMV omega element (Gallie et al., The Plant Cell
1:301-311, 1989), and maize heat shock protein 70 (hsp70) intron
(Brown and Santino, PCT Application WO93/19189). These and other
regulatory elements may be included when appropriate.
[0097] The vector or construct may also include a selectable
marker, a screenable marker and other elements as appropriate.
Examples of these elements and markers mentioned herein are known
in the art and may be readily used in the present invention. Those
of the skilled in the art should refer to the following art for
details (for selectable markers, see Potrykus et al., Mol. Gen.
Genet. 199:183-188, 1985; Hinchee et al., Bio. Technology
6:915-922, 1988; Stalker et al., J. Biol. Chem. 263:6310-6314,
1988; European Patent Application 154,204; Thillet et al., J. Biol.
Chem. 263:12500-12508, 1988; for screenable markers see, Jefferson,
Plant Mol. Biol. Rep. 5: 387-405, 1987; Jefferson et al., EMBO J.
6: 3901-3907, 1987; Sutcliffe et al., Proc. Natl. Acad. Sci.
(U.S.A.) 75: 3737-3741, 1978; Ow et al., Science 234: 856-859,
1986; Ikatu et al., Bio. Technol. 8: 241-242, 1990; and for other
elements see, European Patent Application Publication Number
0218571; Koziel et al., Plant Mol. Biol. 32: 393-405; 1996).
[0098] Methods and compositions for transforming bacteria and other
microorganisms are known in the art (see, for example, Sambrook et
al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
1989).
Plant Transformation
[0099] The COP1 nucleic acid molecules of the present invention may
be transferred into a plant cell and the plant cell regenerated
into a whole plant. The COP1 nucleic acid molecules may be from any
source, whether naturally occurring or otherwise obtained through
methodologies in the field that are readily known to those skilled
in the art, that are capable of being inserted into any plant
cells. The COP1 nucleic acid molecules may be transferred into
either monocotyledonous and dicotyledonous plants (See
specifically, Chistou, Particle Bombardment for Genetic Engineering
of Plants, Pp. 63-69 (Zea mays), Biotechnology Intelligence Unit.
Academic Press, San Diego, Calif., 1996), and generally Chistou,
Particle Bombardment for Genetic Engineering of Plants,
Biotechnology Intelligence Unit. Academic Press, San Diego, Calif.,
1996). As an example, the COP1 gene may be transformed into the
maize plant using any of the methods as described herein.
[0100] There are many methods for transforming the COP1 nucleic
acid molecules into plant cells such as the maize plant cells.
Suitable methods are believed to include virtually any methods by
which nucleic acid molecules may be introduced into the cells, such
as by Agrobacterium infection or direct delivery of nucleic acid
molecules that may include PEG-mediated transformation,
electroporation and acceleration of DNA coated particles, etc.
(Potrykus, Ann. Rev. Plant Physiol. Plant Mol. Biol. 42:205-225,
1991; Vasil, Plant Mol. Biol. 25: 925-937, 1994). For example,
electroporation has been used to transform Zea mays protoplasts
(Fromm et al., Nature 312:791-793, 1986). In general, the following
are four most commonly used general methods for delivering a gene
into cells: (1) chemical methods (Graham and van der Eb, Virology,
54:536-539, 1973); (2) physical methods such as microinjection
(Capecchi, Cell 22:479-488, 1980), electroporation (Wong and
Neumann, Biochem. Biophys. Res. Commun. 107:584-587, 1982); Fromm
et al., Proc. Natl. Acad. Sci. (USA) 82:5824-5828, 1985); U.S. Pat.
No. 5,384,253; and the gene gun (Johnston and Tang, Methods Cell
Biol. 43:353-365, 1994); (3) viral vectors (Clapp, Clin. Perinatol.
20:155-168, 1993; Lu et al., J. Exp. Med. 178:2089-2096, 1993;
Eglitis and Anderson, Biotechniques 6:608-614, 1988); and (4)
receptor-mediated mechanisms (Curiel et al., Hum. Gen. Ther. 3:
147-154, 1992; Wagner et al., Proc. Natl. Acad. Sci. (USA) 89:
6099-6103, 1992).
[0101] Transformation of plant protoplasts can be achieved using
methods based on calcium phosphate precipitation, polyethylene
glycol treatment, electroporation, and combinations of these
treatments. See for example (Potrykus et al., Mol. Gen. Genet.,
205:193-200, 1986; Lorz et al., Mol. Gen. Genet., 199:178, 1985;
Fromm et al., Nature, 319:791, 1986; Uchimiya et al., Mol. Gen.
Genet.: 204:204, 1986; Callis et al., Genes and Development, 1183,
1987; Marcotte et al., Nature, 335:454, 1988). Application of these
systems to different plant strains depends upon the ability to
regenerate that particular plant strain from protoplasts. Among
them are the methods for corn (U.S. Pat. Nos. 5,569,834, 5,416,011;
McCabe et al., Biotechnology 6:923, 1988; Christou et al., Plant
Physiol., 87:671-674, 1988). Illustrative methods for the
regeneration of cereals from protoplasts are also described
(Fujimura et al., Plant Tissue Culture Letters, 2:74, 1985;
Toriyama et al., Theor. Appl. Genet. 205:34, 1986; Yamada et al.,
Plant Cell Rep. 4: 85, 1986; Abdullah et al., Biotechnology,
4:1087, 1986).
[0102] In one of the preferred embodiments, the present invention
employs the Agrobacterium-mediated transformation technology to
introduce the COP1 nucleic acid into the maize plant and to achieve
a desired result. Agrobacterium-mediated transfer is a widely
applicable system for introducing genes such as the COP1 gene into
plant cells because the gene such as the COP1 gene can be
introduced into whole plant tissues, thereby bypassing the need for
regeneration of an intact plant from a protoplast. The use of
Agrobacterium-mediated plant integrating vectors to introduce a
nucleic acid into plant cells is well known in the art. See, for
example, Fraley et al. (Biotechnology 3:629-635, 1985), Hiei et al.
(U.S. Pat. No. 5,591,616), and Rogers et al. (Meth. In Enzymol 153:
253-277, 1987), Further, the integration of the Ti-DNA is a
relatively precise process resulting in few rearrangements. The
region of the COP1 nucleic acid to be transferred is defined by the
border sequences and is usually inserted into the plant genome as
described in Spielmann et al. (Mol. Gen. Genet., 205:34, 1986).
[0103] A transgenic plant such as a transgenic maize plant formed
using Agrobacterium transformation methods typically contains a
single added COP1 gene on one chromosome. Such a transgenic plant
can be referred to as being heterozygous for the added COP1 gene.
More preferred is a transgenic plant that is homozygous for the
added COP1 gene; i.e., a transgenic plant that contains two added
COP1 genes, one gene at the same locus on each chromosome of a
chromosome pair. A homozygous transgenic plant can be obtained by
sexually mating (selfing) an independent segregated transgenic
plant that contains a single added COP1 gene, germinating some of
the seeds produced and analyzing the resulting plants produced for
the COP1 gene.
[0104] It is understood that two different transgenic plants can
also be mated to produce offspring that contain two independently
segregating added, exogenous COP1 genes. Selfing of appropriate
progeny can produce plants that are homozygous for both added,
exogenous COP1 genes that encode a COP1 polypeptide. Back-crossing
to a parental plant and out-crossing with a non-transgenic plant
are also contemplated, as is vegetative propagation.
Regeneration of the Transformed Plants
[0105] The regeneration, development, and cultivation of plants
such as the maize plants from transformants or from various
transformed explants are well known in the art (Weissbach and
Weissbach, In: Methods for Plant Molecular Biology, Eds., Academic
Press, Inc. San Diego, Calif., 1988). This regeneration and growth
process may typically include the steps of selection of transformed
cells containing exogenous COP1 genes, culturing those
individualized cells through the usual stages of embryonic
development through the rooted plantlet stage. Transgenic embryos
and seeds are similarly regenerated. The resulting transgenic
rooted shoots are thereafter planted in an appropriate plant growth
medium such as soil.
[0106] The regeneration of plants containing the foreign, exogenous
gene that encodes a protein of interest is well known in the art.
As described in the present invention, the regenerated plants such
as the regenerated maize plants that contain the COP1 nucleic
acids, either wild type or chemically synthesized, that encode for
the COP1 proteins, may be preferably self-pollinated to provide
homozygous transgenic maize plants, as discussed before. Otherwise,
pollen obtained from the regenerated maize plants may be crossed to
seed-grown plants of agronomically important lines. Conversely,
pollen from plants of these important lines is used to pollinate
regenerated plants. A transgenic maize plant of the present
invention may be cultivated using methods well known to one skilled
in the art.
[0107] There are a variety of methods for the regeneration of
plants from plant tissue. The particular method of regeneration
will depend on the starting plant tissue and the particular plant
species to be regenerated. Monocotyledonous plants, or monocot
plants, may be transformed with a COP1 nucleic acid and then
regenerated. Transformation of monocot plants using
electroporation, particle bombardment, and Agrobacterium has also
been reported. Transformation and plant regeneration have been
achieved in many monocot plants that include maize, asparagus,
barley and wheat, etc. Dicotyledonous plants, or dicot plants, may
also be transformed with COP1 nucleic acid and regenerated. Methods
for transforming dicot plants, primarily by use of Agrobacterium
tumefaciens, and obtaining transgenic plants have been published.
Among them are the methods for soybean, cotton, and other dicot
plants.
[0108] Monocot and dicot plants to which the present invention may
be applied may include those agronomic and horticultural crop
plants. Examples of agronomic crop plants may include cereals such
as maize, wheat, rye, barley, oats, buckwheat, sorghum and rice;
non-cereals such as sunflower, canola, peas, beans, soybeans,
cotton and linseed; vegetables such cauliflower, asparagus,
lettuce, tobacco and mustard; and root crops such as sugarbeet,
potato, sweet potato, carrot and turnip. Horticultural crops may
include celery, tomato, egg plant, cucumber and squash. Fruit crops
may include apple, apricot, peach, pear, plum, orange, blackberry,
blueberry, strawberry, cranberry and lemon.
[0109] In addition to the above discussed procedures, practitioners
are familiar with the standard resource materials which describe
specific conditions and procedures for the construction,
manipulation and isolation of macromolecules (e.g., DNA molecules,
plasmids, etc.), generation of recombinant organisms and the
screening and isolating of clones (see, for example, Sambrook et
al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Press, 1989; Mailga et al., Methods in Plant Molecular Biology,
Cold Spring Harbor Press, 1995; Birren et al., Genome Analysis:
Analyzing DNA, 1, Cold Spring Harbor, N.Y., 1997).
[0110] The following examples further demonstrate several preferred
embodiments of the present invention. Those skilled in the art will
recognize numerous equivalents to the specific embodiments
described herein. Such equivalents are intended to be within the
scope of the present invention and claims.
EXAMPLES
Example 1. Computer-Aided Sequence Analysis
[0111] A COP1 protein sequence from Arabidopsis was retrieved from
GenBank (ID 402685) and used as query to BLAST search sequence
databases which identified clones in the databases that share high
degree homology to Arabidopsis COP1. These clones may be used in
cloning the full-length COP1 cDNA from these crop species from
which the clones were originally obtained including maize.
Example 2. COP1 cDNA Cloning
[0112] To obtain the full-length sequence of maize COP1 cDNA,
several RT-PCR, 5'race and 3'race polymerase chain reactions (PCR)
were performed. One microgram of kernel cDNA, recovered from
kernels 15 days after pollination (DAP) was used as template in all
PCR reactions. The cDNA library had previously been cloned into
pSPORT2. Two micromoles of maize COP1 gene specific forward primer
L3062COP IF (5'GTACGGACATTCAGAGGACAC3'; SEQ ID NO: 1) and reverse
primer L30623'COP1R (5'GTGTCCTCTGAATGTCCGTAC3'; SEQ ID NO: 2)
combined with 0.1 mM dNTPs and 5 Units of Taq DNA polymerase was
used in a 50 .mu.L PCR reaction to determine the presence of COP1
in the 15 DAP kernel cDNA pools. PCR cycling conditions and
parameters were as follows: 95.degree. C. for 5 minutes (min)
followed by 28 cycles at 95.degree. C. for 30 seconds (sec),
60.degree. C. for 30 sec and 72.degree. C. for 30 sec. To obtain
the most 5' sequences of COP1 cDNA, the complementary sequences of
M13 Forward primer (5'CCCAGTCACGACGTTGTAAAACG3'; SEQ ID NO: 3) in
pSPORT2 vector and the primer L3062cop1R, combined with 0.1 mM
dNTPs and 5 units of HotStart Taq.TM. polymerase (Qiagen, Valencia,
Calif.), were used in a 50 .mu.L in a 5'-race PCR. PCR cycling
conditions and parameters were as follows: 95.degree. C. for 15
min, then 28 cycles at 95.degree. C. for 30 sec, 60.degree. C. for
30 sec and 72.degree. C. for 3 min. An approximately 2 Kb PCR
product was obtained, cloned into PCR-blunt TOPO II cloning vector
(Invitrogen, Carlsbad, Calif.) and sequenced. In the meantime, COP1
gene specific primer L30624070F (5'AATGAAAAGAACTTTGTTGGC3'; SEQ ID
NO: 4) and M13 reverse primer (5'AGCGGATAACAATTTCACACAGG3'; SEQ ID
NO: 5) were mixed with 0.1 mM dNTPs and 5 Units Taq DNA
polymerasein a 50 .mu.L 3'race PCR to obtain the most 3'sequences
of the COP1 cDNA. PCR cycling conditions and parameters were as
follows: 95.degree. C. for 5 min, then 28 cycles at 95.degree. C.
for 30 sec, 60.degree. C. for 30 sec and 72.degree. C. for 40
seconds. A 650 base pair PCR product was obtained, cloned into
PCR-blunt TOPO II cloning vector, and sequenced. For subcloning
purposes, and for obtaining a more reliable cDNA clone, COP1 cDNA
was re-amplified from 15 DAP kernel cDNA library using forward
primer COP15-6 (5'CTGCGCCATGGGCGACTCCTCGGTGG3'; SEQ ID NO: 6)
containing NcoI site at the start codon of the COP1 open reading
frame and reverse primer L30623'COP1R (SEQ ID NO: 2). A 50 .mu.L of
PCR cocktail was made as follows: 1 .mu.g of 15 DAP kernel cDNA, 2
.mu.M of Cop15-6 and L30623'Cop1R primers, 0.1 mM dNTPs, 5% DMSO,
and 1.times.PCR reaction buffer (Mg++). Manual hot start PCR
cyclings were initiated at 95.degree. C. for 15 min. Then 2 units
of Expand.TM. High-Fidelity DNA Polymerase (Roche, 173264) was
added and PCR reaction was carried out under the following
conditions and parameters: at 95.degree. C. for 30 seconds,
60.degree. C. for 30 sec and 68.degree. C. for 6 min for a total of
28 cycles. A 2230 base pair maize COP1 cDNA sequence was obtained,
and cloned into PCR-Blunt TOPO II cloning vector. The full-length
COP1 cDNA sequence was confirmed by sequencing six independent
clones. The sequence was named as ZmCOP1 (SEQ ID NO: 12). ZmCOP1
represents a full length cDNA sequence containing a 388 base pair
5' UTR, a coding region that encodes 694 amino acids (see
translated amino acid sequence; SEQ ID NO: 13) and a 141 base pair
3' UTR. Based upon sequence homology analysis, the isolated maize
COP1 nucleotide sequence has 50% and 71% identity with those of
COP1 from Arabidopsis (g17446130, Deng et al., Cell 27, 791-801,
1992) and rice (gi7592844), respectively (FIGS. 1 and 2). The maize
COP1 protein sequence is also aligned with other COP1 protein
sequences from other species and shows 68% sequence identity to
that of pea (gi3121867, Zhao et al., Biochimica et Biophysica
Acta-Gene Structure and Expression 1395, 326-328, 1998), 69% to
Japanese morning glory (gi11127996), 70% to Arabidopsis (gi7446130,
Deng et al., Cell 27, 791-801, 1992), 71% to tomato (gi4090943),
and 89% to rice (g17592844), respectively (FIG. 3). The identity
levels were determined by BLAST program (Altschul et al., Nucleic
Acids Res. 25: 3389-3402, 1997) with default parameters
(Expectation value (E): blank; Alignment view options: pairwise;
Filter query sequence: no; Cost to open a gap: 0; Cost to extend a
gap: 0; X dropoff value for gapped alignment: 0; Show GI's in
defines: no; Penalty for a nucleotide mismatch: -3; Reward for a
nucleotide match: 1; Threshold for extending hits: 0; Perform
gapped alignment: yes; Query Genetic code to use: standard; DB
Genetic code: standard; Believe the query define: no; Matrix:
BLOSUM62; Word size: 0; Effective length of the database: 0; Query
strand Use: both).
Example 3. Northern Blot Analysis of COP1 from the cDNA Library
[0113] Northern Blot analysis of the expression of maize COP'
during ear development was performed. Total RNA (15 .mu.g each)
from different tissues were mixed with one volume of RNA Sample
Loading Buffer (Sigma, R-4268), heated at 65.degree. C. for 10
min., chilled on ice for one min. and loaded on a 1% formaldehyde
agarose gel. The RNA was separated on the gel under constant
voltage at 65 v for 4 to 5 hours and then transferred onto a piece
of nylon membrane at 4.degree. C. overnight using a Schleicher
& Schuell transfer system (Keene, N.H., USA 03431). A 157 base
pair 3'UTR fragment of COP1 was amplified by PCR using forward
primer 3'COP1 (5'TGCTCCTTGATGTTATGG3'; SEQ ID NO: 7) and reverse
primer L30623'COP1R. A 910 base pair 5' fragment was also amplified
by PCR using forward primer COP15-6 and COP301
(5'GATGAATTCATCAAGGAGGATCAGAAGAAG3'; SEQ ID NO:8). Purified PCR
products (25 ng each) were labeled with p32dCTP using Random Primed
DNA Labeling Kit (Boehringer Mannheim, Cat. #1004760). The membrane
was hybridized with both labeled 3'UTR and 5'COP1 probes.
Example 4. Construction of Maize Transformation Vectors
[0114] In an effort to identify an efficient way for reducing the
endogenous COP1 mRNA and protein level, three sequences of the COP1
gene with different lengths were created and dominant negative and
antisense strategies were employed. The dominant negative strategy
employed a fragment of the 5' nucleotide sequence encoding a
protein binding domain was cloned into an overexpression vector.
Two sequences employing COP1 were created for this purpose, one
containing the first 1233 nucleotide residues (SEQ ID NO: 14)
encoding 411 amino acids (SEQ ID NO: 15) in pMON47119 (FIG. 4), and
another containing the first 906 nucleotide residues (SEQ ID NO:
16) encoding 301 amino acids (SEQ ID NO: 17) in pMON47118 (FIG. 5).
A full length COP1 was used in the antisense approach. The
construct was pMON47120 and the detail of the vector was shown in
FIG. 6. Forward primer of COPantisense5'-end
(5'GATGAATTCCTGCGGCATGGGCGAC3'; SEQ ID NO: 9) and reverse primer of
COPantisense3'-end (5'AACCATGGACTGAACCTCTTGAACG3'; SEQ ID NO: 10)
were used to sub-clone full-length maize COP1 for the antisense
strategy. Primers COP15-6 and COP301 were used to sub-clone
N-terminal 301 (N301) amino acid protein domain of maize COP1. This
maize N301 protein domain was equivalent to N 282 protein
dimerization domain of Arabidopsis COP1 (Deng et al., PCT
Application WO 00/18940). Forward primer of COP15-6 and reverse
primer of COP411 (5'GATGAATTCATCATTTCGAGACTCCAGC3'; SEQ ID NO: 11)
with two stop codons (TGA) near EcoRI cleavage site were used to
sub-clone the N-terminal 411 (N411) amino acid protein domain of
the maize COP1. This N411 fragment was equivalent to the N392
fragment COP1 in Arabidopsis that contained the protein
dimerization domain and core sequences required for COP1 protein
translocation from cytoplasm to nucleus (PCT Application WO
00/18940). PCR mixture (50 .mu.L) was made as follows: 100 ng of
PCR-Blune-COP1 plasmid DNA, 2 .mu.M of primers, 0.1 mM dNTPs, 5%
DMSO, 1.times.PCR buffer, and 5 U Expand High Fidelity DNA
polymerase. PCR cycling conditions and parameters were as follows:
95.degree. C., 5 min., followed by 25 cycles at 95.degree. C. for
30 seconds, 60.degree. C. for 30 seconds, 68.degree. C., 6 min. for
antisense COP1 amplification, 2 min. for COPaa301 amplification,
and 3 min for COPaa411 amplification. The PCR products were gel
purified, cloned into PCR-Blunt TOPO II cloning vector, and
full-length sequenced.
[0115] To construct maize Agrobacterium-mediated transformation
vectors, pMON32502 plasmid DNA was digested with HindIII, EcoRI and
NcoI. A 3135 base pair HindIII and EcoRI vector backbone fragment
was isolated. Plasmid DNA of pMON24037 was digested with HindIII
and NcoI. A 1689 base pair of the HindIII and NcoI fragment
containing the promoter of maize chlorophyll alb binding protein
and the hsp70 intron was obtained. PCR-Blunt vector containing
antisense COP1, COP1aa301, and COP1aa411 were digested respectively
with NcoI and EcoRI to obtain the NcoI and EcoRI fragments of
antisense COP1, COP1aa301 and COP1aa411. The HindIII and EcoRI
vector backbone fragment was ligated with the HindIII and NcoI cab
promoter fragment, and NcoI and EcoRI antisense COP1, or COPaa301,
or COPaa411, respectively, to form pMON47120, pMON47118, and
pMON47119. The three constructs were then transformed individually
into Agrobacterium strain ABI. All these gene constructs were under
the control of cab promoter (light inducible) and were designed to
reduce the functional ZmCOP1 protein level in the above-ground part
of corn plants. The vector pMON47118 contained the coding sequence
for N-terminal 301 amino acid residues of the ZmCOP1 gene that
covered the dimmerization domain. The vector pMON47119 contained
the nucleotide sequence coding for the 411 amino acid residues. The
N-terminus of ZmCOP1 carried the dimerization and nuclear
localization domains. pMON47120 contained the full-length antisense
ZmCOP1 gene.
[0116] To serve as a check for evaluation of ZmCOP1 functions in
corn, two additional ZmCOP1 constructs, i.e., pMON47130 and
pMON47131, were made for transformation. A fragment of ZmCOP1 gene
containing 903 nucleotide residues was driven by a constitutive
promoter, i.e., a rice-actin (RACT) promoter. In order to construct
pMON47130 transformation vector, a plasmid DNA of pMON47123 was
digested with NcoI and XhoI restriction enzymes. A 1404 base-pair
XhoI and NcoI fragment which contained rice-actin promoter (RACT)
was obtained from pMON47123. Plasmid DNA of pMON47118 was also
digested with NcoI and XhoI restriction enzymes. A fragment
containing 8458 bp from 4379 bp XhoI site to 2719 bp NcoI site was
obtained from pMON47118. Then, the 1404 bp fragment was ligated to
the 8458 bp fragment and pMON47130 construct was made (FIG. 7). In
order to make pMON47131 transformation vector, a plasmid DNA of
pMON47120 was digested with NcoI and XhoI restriction enzymes. A
fragment containing 9567 bp from 5594 bp XhoI site to 3934 bp Neal
site on pMON47120 was obtained. The RACT promoter fragment obtained
from pMON47123 as described above was ligated to the 9567 bp
fragment and the construct, i.e., pMON47131, was made (FIG. 8). The
vector contained the full length ZmCOP1 coding sequence in reverse
orientation.
Example 5. Overexpression of ZmCOP1 N301 Domain for Antibody
Production
[0117] In order to make polyclonal antibody for maize COP1 protein,
plasmid DNA of pMON47118 and pET30(a) (Novagen, Madison, Wis.) were
digested with NcoI and EcoRI The NcoI and EcoRI COPaa301 fragment
was directionally cloned into pET30(a) vector under the control of
the IPTG inducible T7 polymerase promoter and was transformed into
E. coli BL21(DE3) competent cells. E. coli BL21 (DE3) cells
containing pET30(a)-COPaa301 construct were induced with 3 mM IPTG
overnight at room temperature. Proteins were purified under
denaturing conditions using Ni-NTA Superflow resin (QIAGEN,
Valencia, Calif.) as described in the manufacturer's protocol. An
about 38 kDa His-tag COP301 protein was purified and confirmed by
Western Blot analysis using monoclonal antibody against S-tag
protein. About 1 mg purified COPaa301 protein was used to inoculate
two rabbits for antibody production following the standard protocol
of Pocono Rabbit Farm & Laboratory Inc. (Canadesis, Pa.). The
preimmune serum from these two rabbits showed no reactivity with
COPaa301 protein.
Example 6. Transformation of Corn Plant with the Vectors
1) Plant Materials
[0118] Ears from LH172 were obtained mostly from greenhouses and
were usually harvested about 10 to 11 days post pollination. Before
isolation, ears were stored from 0 to 5 days at 4.degree. C. Ears
were sterilized for 20 min in 50% (v/v) commercial bleach
(Clorox.RTM., with 5.25% sodium hypochlorite) followed by 3 rinses
with sterile water.
TABLE-US-00002 TABLE 2 Media used in corn transformation (per
liter). Co-culture Component 1/2 MS VI 1/2 MS PL medium LH172 MS
MS/BAP MSOD MS salts .1 g 0.1 g 2.2 g 4.4 g 4.4 g .1 g Sucrose 20 g
0.1 g 20 g 30 g 30 g -- Maltose -- -- -- -- -- 40 g Glucose 10 g 36
g 10 g -- -- 20 g 1-Proline 0.115 g 0.115 g 0.115 1.36 g 1.36 g --
Casamino Acids -- -- -- 0.05 g 0.05 g -- Glycine 2 mg 2 mg 2 mg --
-- -- 1-Asparagine -- -- -- -- -- 150 mg myo-Inositol 100 mg 100 mg
100 mg -- -- 100 mg Nicotinic Acid 0.5 mg 0.5 mg 0.5 mg 0.65 mg
0.65 mg 0.65 mg Pyridoxine-HCl 0.5 mg 0.5 mg 0.5 mg 0.125 mg 0.125
mg 0.125 mg Thiamine-HCl 0.1 mg 0.1 mg 0.6 mg 0.125 mg 0.125 mg
0.125 mg Ca Pantothenate -- -- -- 0.125 mg 0.125 mg 0.125 mg 2,4-D
-- -- 3 mg 0.5 mg 0.5 mg -- Picloram -- -- -- 2.2 mg .1 mg --
Silver Nitrate -- -- -- 3.4 mg -- -- Na-Thiosulfate -- -- -- -- --
-- Phytagar -- -- -- 7.0 g 7.0 g 7.0 g Low EEO agarose -- -- 5.5 g
-- -- --
2) Agrobacterium Induction and Inoculation
[0119] Agrobacterium tumefaciens (ABI strain) was grown in LB
liquid medium (50 mL medium per 250 mL flask) containing 100 mg/L
kanamycin and 50 mg/L spectinomycin for an initial overnight
propagation (on a rotary shaker at 150 to 160 rpm) at 27.degree. C.
Ten mL of the overnight Agrobacterium suspension was transferred to
50 mL of fresh LB in a 250 mL flask (same medium additives and
culture conditions as stated above) and grown for approximately 8
hours. Suspension was centrifuged around 3500 rpm and pellet
resuspended in AB minimal medium (now containing 1/2 the level of
spectinomycin and kanamycin used for LB) containing 100 .mu.M
acetosyringone (AS) for a final concentration of 0.2.times.10.sup.9
cfu/mL (or an OD of 0.2 at 660 nm). These Agrobacterium cultures
were allowed to incubate as described above for approximately 15 to
16 hours. The Agrobacterium suspension was harvested via
centrifugation and washed in 1/2 MS VI medium (Table 2) containing
AS. The suspension was then centrifuged again before being brought
up in the appropriate amount of 1/2 MS PL (Table 2) (also
containing AS) so that the final concentration of Agrobacterium was
1.times.10.sup.9 cfu/mL (which is equal to an OD of 1.0 at 660
run). Immature embryos from each ear of a LH172 plant (1.5 mm to
2.0 mm long) were directly dissected into a 1.5-mL eppendorf tube
with 1/2 MS PL containing Agrobacterium at an OD of 1.0. The
eppendorf tube was capped tightly and inverted 3 times so that
embryos inside were fully immersed. About half of the solution in
the tube was drained by using a sterile SAMCO transfer pipette. The
rest of the solution together with the embryos were poured into 2-3
layers of sterile Baxter filter paper (5.5 cm in diameter). Embryos
were removed from the filter paper by flipping the filter paper
over and slightly pressing it against the co-culture medium (Table
2) with the addition of 20 .mu.M silver thiosulfate in the petri
dish. The embryos were cultured at 23.degree. C. for 1 day and then
were transferred to the first selection medium (LH172MS; Table
2).
3) Callus Induction and Selection (in Dark)
[0120] Selection was performed in LH172 medium with 500 mg/L
carbenicillin and 100 mg/L paromomycin. Three transfers to new
plates containing the same medium were made every two weeks.
4) Regeneration (in Light)
[0121] Paromomycin resistant callus was first moved to MS/BAP
medium (Table 2) with with 3.5 mg/L 6-BA for 5 to 7 days. After the
6-BA pulse, callus with green shoot tips were moved to MSOD (Table
2) with 100 mg/L paromomycin plates and were cultured for another
10 to 12 days. After this stage, green shoots started to grow out
as well as white roots. Those small plantlets were transferred to
phytatray (1 event per phytatray) containing MSOD media with 100
mg/L paromomycin. After 2 to 3 weeks, plants were ready to be
transplanted into soil. Plants were acclimated in the growth
chamber for week and then moved to the greenhouse for hardening.
Plants were screened for the presence of nptII after 3 to 5 days of
the hardening process. Only nptII positive plants were considered
for further experimentation.
Example 7. RD and R1 Transgenic Plants
[0122] A total of 30 events from pMON47118 construct were selected
from 137 R0 plants (79 events) based on the expression levels of
gene of interest (GOI) by Northern and Western Blot analyses. Among
the 30 events, 8 events had only F1 seeds and 22 events had R1
seeds. Twenty R1 or F1 seeds of each of these events were planted
in a greenhouse. Phenotype observations were conducted weekly
including germination, leaf color, plant height, growth rate,
tassel morphology, ear morphology and ear number. The average
height and growth rate of several events were lower compared to the
wild type plants growing nearby (FIG. 9). In comparison of wild
type and transformed adult plants, several transformed R1 plants in
the event 535307 showed better ear growth, i.e., more and larger
ears at third and fourth nodes, and distinct ear morphology, i.e.,
longer husk leaves. These phenotypic changes may be attributed to
the COP1 transgene. Variations among individual plants in an event
will be examined for correlation to the presence and expression
level of the COP1 transgene, Cells transformed with a full length
or a fragment of ZmCOP1 is used to produce young corn plants using
standard protocols. These plants are called R0 generation plants.
R0 plants are generated from many transformation events. These
plants are grown in greenhouse and screened for the presence of
ZmCOP1 transgene by PCR. The messenger RNA and protein expression
level of the transgene in R0 plants are examined by Northern and
Western blotting techniques. Events are selected based on the
presence and expression level of the transgene in the R0 plants.
The selected events are planted as R1 plants. R1 plants are
examined for the presence of the transgene, the transgene
expression level and the expected phenotypic traits such as short
internodes and better ear development. All the data are used in
selecting R1 plants for R2 evaluation. Those R1 plants that show a
moderate to high level of transgene expression and a desired
phenotype (shorter internodes and better ear development at high
density) are chosen. R2 plants are planted in field as pedigree
lines. The zygosity of each line is determined by the presence of
the transgene in each plant in the line and by the
positive/negative segregation ratio of its R1 predecessor. A few
lines are selected based on their phenotype, transgene expression
and homozygosity. These lines are crossed with another one or more
inbred lines to make hybrid seeds. The hybrid seeds are planted at
different density (20,000, 30,000 and 40,000 plants/acre) side by
side with a control hybrid that is a best yield performer. The
lines that give the best hybrid yield and the best density regimes
are selected for further yield testing. The best line or lines
proven in these yield trails are bulked up and grown in a large
scale. For example, grow the new hybrid at 30,000 plants/acre,
resulting in a 10% increase in biomass. Because the ZmCOP1
transgene is able to reduce shade avoidance response and hold
harvest index the same, this results in a 10% yield gain. In some
selected lines, reduced shade avoidance response also enhances
harvest index; this increases yield even more.
Example 8. Constitutive Expression of ZmCOP1 in Corn
[0123] A construct harboring a rice actin promoter and ZmCOP1aa301
gene fragment (pMON47130, FIG. 7) was transformed into corn and the
events named YAA. Western blot analysis on the R0 plants showed
that some YAA events have quite high expression of the ZmCOP1aa301
protein (FIG. 10).
[0124] F1 seeds from eight events were selected for a dark and a
light experiment. The dark experiment was conducted in a growth
chamber with optimal conditions for corn seedling growth except
that no light was provided. At day 5 after shoot emerging from
soil, mesocotyl lengths of each seedling were measured. Positive
and negative segregants were identified by Western blotting.
Mesocotyl length data did not show a significant difference between
positive and negative segregants. This agrees with the results of a
similar experiment Arabidopsis. Eight events of YAA plants were
also grown in a growth chamber with 500 mmolm.sup.-2s.sup.-1 white
lights for 14 hours, and dark for 10 hours daily. Positive and
negative plants were identified by Western blot analysis of
ZmCOP1aa301 protein. Plant heights were measured weekly. The
comparisons of positive and negative plant height are shown in FIG.
2. The results indicated that expression of ZmCOP1aa301 in maize
using rice actin (RACT) promoter may have resulted shorter plants;
while 7 out of 8 event showed a trend of shorter stature in the
positive plants at V11 stage, the difference in two of these events
was statistically significant at p=0.05 and p=0.01 level this
sample size and in this growth conditions (FIG. 11).
Shorter Stature in Kyle R3 Plants
[0125] Kyle events are the transformants from construct pMON47118,
which contains a light inducible CAB promoter and ZmCOP1aa301 gene
fragment. Western analysis has shown that the ZmCOP1aa301 fragment
was expressed in the Kyle plants under normal light (FIGS. 12 and
13) but not in dark or weak light (FIG. 12). Also, the gene was
expressed at high level at different growth and developmental
stages.
[0126] Seeds from some Kyle events were germinated and seedlings
grown in dark and under 1 mmol/m2s dim light and under normal green
house light. Mesocotyl and coleoptile length were measured on day
10. Leaf samples were taken from each plant for DNA amplification
(PCR) of the gene of interest. Seedlings grown under full green
house light had virtually no mesocotyl, and their coleoptile length
is short and uniform among Kyle positive, negative and wildtype
plants. When seedlings were grown under 1 mmol/m2s light, their
coleoptile and mesocotyl were much longer, but no statistically
significant difference was detected between positive and negative
seedlings (FIG. 5).
[0127] A greenhouse experiment using R3 homozygous lines of Kyle
events was carried out. Five homozygous positive lines and 5 of
their corresponding negative lines were chosen and 100 seeds of
each were planted in the Jerseyville greenhouse. PCR results on 12
plants of each line were used to confirm homozygosity. Thirty-six
plants were transplanted for each line and the positions in the
rows were randomized. Plant height data is being recorded on a
weekly basis since transplanting. Positive plants were shorter
compared to their corresponding negative lines in all events tested
up to VT stage. The difference is statistically significant (Table
1). However, only event Kyle50 maintained this difference at
maturity.
TABLE-US-00003 TABLE 3 Plant height and t-test of 5 Kyle events
Height (cm) P-value of comparison Event POS NEG LH172 to NEG to
LH172 Kyle15 55.19 71.22* 85.83 3.7 .times. 10.sup.-09* 6.5 .times.
10.sup.-12 Kyle15 63.22 71.22* 85.83 8.1 .times. 10.sup.-05* 5.5
.times. 10.sup.-12 Kyle17 48.13 69.73 85.83 1.8 .times. 10.sup.-09
1.9 .times. 10.sup.-15 Kyle50 36.24 65.09 85.83 1.1 .times.
10.sup.-13 1.4 .times. 10.sup.-17 Kyle72 63.08 74.21 85.83 2.1
.times. 10.sup.-05 7.4 .times. 10.sup.-12 Kyle77 64.78 79.78 85.83
3.3 .times. 10.sup.-09 2.6 .times. 10.sup.-11 *Compared to the
average of all negative events
Plant Height of Kurt R1
[0128] Kurt events are the transformants from construct pMON47119,
which contains a light inducible CAB promoter and ZmCOP1aa411 gene
fragment. Western analysis of some Kurt events has shown that the
ZmCOP1aa411 fragment was expressed at high level in many of the
events tested (FIG. 8). Some R1 and F1 Kurt events were grown in
the field. Positive plants were identified by PCR. The height of
both positive and negative plants was measured on a weekly basis up
to VT stage. FIG. 8 summarizes data obtained at V10 stage, showing
that the positive plants were shorter than their negatives in many
events.
[0129] In summary, the above describes the present invention. It
will be understood by those skilled in the art that, without
departing from the scope and spirit of the present invention and
without undue experimentation, the present invention can be
performed within a wide range of equivalent parameters. While the
present invention has been described in connection with specific
embodiments thereof, it will be understood that it is capable of
further modifications. The present invention covers any uses,
variations, or adaptations of the invention following the
principles of the invention in general. Various permutations and
combination of the elements provided in all the claims that follow
are possible and fall within the scope of this invention.
[0130] All publications and patents mentioned in this specification
are herein incorporated by reference as if each individual
publication or patent was specially and individually stated to be
incorporated by reference.
Sequence CWU 1
1
27121DNAArtificial SequenceSynthetic primer 1gtacggacat tcagaggaca
c 21221DNAArtificial SequenceSynthetic primer 2gtgtcctctg
aatgtccgta c 21323DNAArtificial SequenceSynthetic primer
3cccagtcacg acgttgtaaa acg 23421DNAArtificial SequenceSynthetic
primer 4aatgaaaaga actttgttgg c 21523DNAArtificial
SequenceSynthetic primer 5agcggataac aatttcacac agg
23626DNAArtificial SequenceSynthetic primer 6ctgcgccatg ggcgactcct
cggtgg 26718DNAArtificial SequenceSynthetic primer 7tgctccttga
tgttatgg 18830DNAArtificial SequenceSynthetic primer 8gatgaattca
tcaaggagga tcagaagaag 30925DNAArtificial SequenceSynthetic primer
9gatgaattcc tgcggcatgg gcgac 251025DNAArtificial SequenceSynthetic
primer 10aaccatggac tgaacctctt gaacg 251128DNAArtificial
SequenceSynthetic primer 11gatgaattca tcatttcgag actccagc
28122230DNAZea mays 12ctgcgccatg ggcgactcct cggtggccgg cgcgctcgtg
ccgtctgtgc ccaagccgga 60gcccgcgccg tccggtgaca cctccgcggc ggccgcggcg
actacagcgg cgctggcgat 120gccggaggag gcgggtatgc gcgcggcgtc
ggcgtcgcct caggggcctg cggaggaggg 180ggagggcccc gccgataggg
accttctctg cccgatctgc atggccgtca tcaaggacgc 240cttcctcacc
gcatgcggcc acagcttctg ctacatgtgc atcgtcacgc atctcagcaa
300caagagcgac tgcccctgct gcggccacta ccttaccaag gcccagctct
accccaactt 360tctccttgac aaggttctga agaaaatatc agcccaacaa
atagcaaaaa cagcatcgcc 420gatcgatcaa tttcgatgtg cattgcaaca
gggaaatgaa atgggggtta aagagttgga 480tagccttatg actttgattg
ctgagaagaa gcggcaaatg gaacaacaag aatcagagac 540aaatatgcaa
atattgctag tcttcttaca ctgccttaga aagcaaaagc tagaagagtt
600gaatgagatt caaactgatc tacaatacat caaagaggat ataagttctg
tggagagaca 660tagggcagaa ttatatcgca caaaagaaag gtactccatg
aagctgcgca tgcttttaga 720tgagcctact gcgcaaaaaa tgtggccctc
tcctatagac aaagctagct gtcgctttct 780tcccaactct cggacaccac
ttagtggatc atgtccagga actttacaga ataagaagct 840tgatttgaaa
gctcaagtaa gccatcaagg atttcaaagg agagatgctc taacttcttc
900tgatcctcct aactccccta tacaatcggg taatgttatt gctaggaaga
ggcgagttca 960agcacagttc aatgagcttc aagaatacta cctgcaaaga
cgtcgtactg gagcacaggc 1020acgcagacag gaagaaagag atatagttgc
aatgaataga gaaggctatc atgcaggtct 1080tcaggatttc cagtctgtgc
taacaacgtt cactcgatac agtcgtctac gtgtcattgc 1140ggaactaaga
catggagact tgtttcactc tgccaatatt gtatccagta ttgaatttga
1200tcgtgatgat gaactatttg ctaccgctgg agtctcgaaa cgtattaaag
tcttcgaatt 1260ttccactgtt gttaatgaac catcagatgt gcattgccca
gttgttgaaa tggctaccag 1320atctaaactt agctgcctaa gctggaacaa
gtactcaaaa aatattattg caagcagtga 1380ctatgagggt atagtaactg
tgtgggatgt tcagacccgt cagagtgtga tggaatatga 1440agagcatgag
aagagagcat ggagtgttga tttttctcgc acagactctt caatgctagt
1500atctgggagt gatgattgca aggtgaaagt gtggtgcaca aatcaagaag
caagtgtgat 1560caatattgat atgaaagcaa atatttgctc ggttaaatat
aatcctggat caagcttcta 1620cgttgcagtc ggatctgctg atcaccatat
tcattacttt gatttacgta atccaagttc 1680gcctgtccat attttcgggg
ggcacaagaa agcagtatca tatgtgaaat tcttatctaa 1740caatgagctt
gcgtctgcat caacagatag cacattacgc ttatgggatg tcaaggataa
1800ctgcccggta cggacattca gaggacacaa aaatgaaaag aactttgttg
gcttgtctgt 1860gaacaatgaa tatattgctt gtggaagtga gacaaatgag
gtttttgttt atcacaaggc 1920tatctcgaaa ccggcagcaa gccatagatt
tgtatcttct gacccggatg atgccgatga 1980tgatcctggt tcttatttca
ttagtgctgt ctgctggaag agtgatagcc ctacgatgtt 2040aactgctaac
agtcagggga ccataaaagt tcttgtactt gctccttgat gttatggagg
2100gcgttcaaga ggttcacagt actgtccagt tgtttccttt cgtgtcatta
tattccccca 2160aaattgggaa cgggggcata attgatctcc ggttagggaa
tgaagttttg cagatggtca 2220gctgacgtag 223013693PRTZea mays 13Met Gly
Asp Ser Ser Val Ala Gly Ala Leu Val Pro Ser Val Pro Lys1 5 10 15Pro
Glu Pro Ala Pro Ser Gly Asp Thr Ser Ala Ala Ala Ala Ala Thr 20 25
30Thr Ala Ala Leu Ala Met Pro Glu Glu Ala Gly Met Arg Ala Ala Ser
35 40 45Ala Ser Pro Gln Gly Pro Ala Glu Glu Gly Glu Gly Pro Ala Asp
Arg 50 55 60Asp Leu Leu Cys Pro Ile Cys Met Ala Val Ile Lys Asp Ala
Phe Leu65 70 75 80Thr Ala Cys Gly His Ser Phe Cys Tyr Met Cys Ile
Val Thr His Leu 85 90 95Ser Asn Lys Ser Asp Cys Pro Cys Cys Gly His
Tyr Leu Thr Lys Ala 100 105 110Gln Leu Tyr Pro Asn Phe Leu Leu Asp
Lys Val Leu Lys Lys Ile Ser 115 120 125Ala Gln Gln Ile Ala Lys Thr
Ala Ser Pro Ile Asp Gln Phe Arg Cys 130 135 140Ala Leu Gln Gln Gly
Asn Glu Met Gly Val Lys Glu Leu Asp Ser Leu145 150 155 160Met Thr
Leu Ile Ala Glu Lys Lys Arg Gln Met Glu Gln Gln Glu Ser 165 170
175Glu Thr Asn Met Gln Ile Leu Leu Val Phe Leu His Cys Leu Arg Lys
180 185 190Gln Lys Leu Glu Glu Leu Asn Glu Ile Gln Thr Asp Leu Gln
Tyr Ile 195 200 205Lys Glu Asp Ile Ser Ser Val Glu Arg His Arg Ala
Glu Leu Tyr Arg 210 215 220Thr Lys Glu Arg Tyr Ser Met Lys Leu Arg
Met Leu Leu Asp Glu Pro225 230 235 240Thr Ala Gln Lys Met Trp Pro
Ser Pro Ile Asp Lys Ala Ser Cys Arg 245 250 255Phe Leu Pro Asn Ser
Arg Thr Pro Leu Ser Gly Ser Cys Pro Gly Thr 260 265 270Leu Gln Asn
Lys Lys Leu Asp Leu Lys Ala Gln Val Ser His Gln Gly 275 280 285Phe
Gln Arg Arg Asp Ala Leu Thr Ser Ser Asp Pro Pro Asn Ser Pro 290 295
300Ile Gln Ser Gly Asn Val Ile Ala Arg Lys Arg Arg Val Gln Ala
Gln305 310 315 320Phe Asn Glu Leu Gln Glu Tyr Tyr Leu Gln Arg Arg
Arg Thr Gly Ala 325 330 335Gln Ala Arg Arg Gln Glu Glu Arg Asp Ile
Val Ala Met Asn Arg Glu 340 345 350Gly Tyr His Ala Gly Leu Gln Asp
Phe Gln Ser Val Leu Thr Thr Phe 355 360 365Thr Arg Tyr Ser Arg Leu
Arg Val Ile Ala Glu Leu Arg His Gly Asp 370 375 380Leu Phe His Ser
Ala Asn Ile Val Ser Ser Ile Glu Phe Asp Arg Asp385 390 395 400Asp
Glu Leu Phe Ala Thr Ala Gly Val Ser Lys Arg Ile Lys Val Phe 405 410
415Glu Phe Ser Thr Val Val Asn Glu Pro Ser Asp Val His Cys Pro Val
420 425 430Val Glu Met Ala Thr Arg Ser Lys Leu Ser Cys Leu Ser Trp
Asn Lys 435 440 445Tyr Ser Lys Asn Ile Ile Ala Ser Ser Asp Tyr Glu
Gly Ile Val Thr 450 455 460Val Trp Asp Val Gln Thr Arg Gln Ser Val
Met Glu Tyr Glu Glu His465 470 475 480Glu Lys Arg Ala Trp Ser Val
Asp Phe Ser Arg Thr Asp Ser Ser Met 485 490 495Leu Val Ser Gly Ser
Asp Asp Cys Lys Val Lys Val Trp Cys Thr Asn 500 505 510Gln Glu Ala
Ser Val Ile Asn Ile Asp Met Lys Ala Asn Ile Cys Ser 515 520 525Val
Lys Tyr Asn Pro Gly Ser Ser Phe Tyr Val Ala Val Gly Ser Ala 530 535
540Asp His His Ile His Tyr Phe Asp Leu Arg Asn Pro Ser Ser Pro
Val545 550 555 560His Ile Phe Gly Gly His Lys Lys Ala Val Ser Tyr
Val Lys Phe Leu 565 570 575Ser Asn Asn Glu Leu Ala Ser Ala Ser Thr
Asp Ser Thr Leu Arg Leu 580 585 590Trp Asp Val Lys Asp Asn Cys Pro
Val Arg Thr Phe Arg Gly His Lys 595 600 605Asn Glu Lys Asn Phe Val
Gly Leu Ser Val Asn Asn Glu Tyr Ile Ala 610 615 620Cys Gly Ser Glu
Thr Asn Glu Val Phe Val Tyr His Lys Ala Ile Ser625 630 635 640Lys
Pro Ala Ala Ser His Arg Phe Val Ser Ser Asp Pro Asp Asp Ala 645 650
655Asp Asp Asp Pro Gly Ser Tyr Phe Ile Ser Ala Val Cys Trp Lys Ser
660 665 670Asp Ser Pro Thr Met Leu Thr Ala Asn Ser Gln Gly Thr Ile
Lys Val 675 680 685Leu Val Leu Ala Pro 690141233DNAZea mays
14actttatgtg acagcagacg tgcactggcc agggggatca ccatccgtcg ccccgggtgt
60caataatatc actctgtaca tccacaaaca gacgatacgg ctctctcttt tataggtgta
120aaccttaaac tgccgtacgt ataggctgcg caactgttgg gaagggcgat
cggtgcgggc 180ctcttcgcta ttacgccagc tggcgaaagg gggatgtgct
gcaaggcgat taagttgggt 240aacgccaggg ttttcccagt cacgacgttg
taaaacgacg gccagtgaat tgtaatacga 300ctcactatag ggcgaattgg
gccctctaga tgcatgctcg agcggccgcc agtgtgatgg 360atatctgcag
aattcgccct tctgcgccat gggcgactcc tcggtggccg gcgcgctcgt
420gccgtctgtg cccaagccgg agcccgcgcc gtccggtgac acctccgcgg
cggccgcggc 480gactacagcg gcgctggcga tgccggagga ggcgggtatg
cgcgcggcgt cggcgtcgcc 540tcaggggcct gcggaggagg gggagggccc
cgccgatagg gaccttctct gcccgatctg 600catggccgtc atcaaggacg
ccttcctcac cgcatgcggc cacagcttct gctacatgtg 660catcgtcacg
catctcagca acaagagcga ctgcccctgc tgcggccact accttaccaa
720ggcccagctc taccccaact ttctccttga caaggttctg aagaaaatat
cagcccaaca 780aatagcaaaa acagcatcgc cgatcgatca atttcgatgt
gcattgcaac agggaaatga 840aatgggggtt aaagagttgg atagccttat
gactttgatt gctgagaaga agcggcaaat 900ggaacaacaa gaatcagaga
caaatatgca aatattgcta gtcttcttac actgccttag 960aaagcaaaag
ctagaagagt tgaatgagat tcaaactgat ctacaataca tcaaagagga
1020tataagttct gtggagagac atagggcaga attatatcgc acaaaagaaa
ggtactccat 1080gaagctgcgc atgcttttag atgagcctac tgcgcaaaaa
atgtggccct ctcctataga 1140caaagctagc tgtcgctttc ttcccaactc
tcggacacca cttagtggat catgtccagg 1200aactttacag aataagaagc
ttgatttgaa agc 123315411PRTZea mays 15Met Gly Asp Ser Ser Val Ala
Gly Ala Leu Val Pro Ser Val Pro Lys1 5 10 15Pro Glu Pro Ala Pro Ser
Gly Asp Thr Ser Ala Ala Ala Ala Ala Thr 20 25 30Thr Ala Ala Leu Ala
Met Pro Glu Glu Ala Gly Met Arg Ala Ala Ser 35 40 45Ala Ser Pro Gln
Gly Pro Ala Glu Glu Gly Glu Gly Pro Ala Asp Arg 50 55 60Asp Leu Leu
Cys Pro Ile Cys Met Ala Val Ile Lys Asp Ala Phe Leu65 70 75 80Thr
Ala Cys Gly His Ser Phe Cys Tyr Met Cys Ile Val Thr His Leu 85 90
95Ser Asn Lys Ser Asp Cys Pro Cys Cys Gly His Tyr Leu Thr Lys Ala
100 105 110Gln Leu Tyr Pro Asn Phe Leu Leu Asp Lys Val Leu Lys Lys
Ile Ser 115 120 125Ala Gln Gln Ile Ala Lys Thr Ala Ser Pro Ile Asp
Gln Phe Arg Cys 130 135 140Ala Leu Gln Gln Gly Asn Glu Met Gly Val
Lys Glu Leu Asp Ser Leu145 150 155 160Met Thr Leu Ile Ala Glu Lys
Lys Arg Gln Met Glu Gln Gln Glu Ser 165 170 175Glu Thr Asn Met Gln
Ile Leu Leu Val Phe Leu His Cys Leu Arg Lys 180 185 190Gln Lys Leu
Glu Glu Leu Asn Glu Ile Gln Thr Asp Leu Gln Tyr Ile 195 200 205Lys
Glu Asp Ile Ser Ser Val Glu Arg His Arg Ala Glu Leu Tyr Arg 210 215
220Thr Lys Glu Arg Tyr Ser Met Lys Leu Arg Met Leu Leu Asp Glu
Pro225 230 235 240Thr Ala Gln Lys Met Trp Pro Ser Pro Ile Asp Lys
Ala Ser Cys Arg 245 250 255Phe Leu Pro Asn Ser Arg Thr Pro Leu Ser
Gly Ser Cys Pro Gly Thr 260 265 270Leu Gln Asn Lys Lys Leu Asp Leu
Lys Ala Gln Val Ser His Gln Gly 275 280 285Phe Gln Arg Arg Asp Ala
Leu Thr Ser Ser Asp Pro Pro Asn Ser Pro 290 295 300Ile Gln Ser Gly
Asn Val Ile Ala Arg Lys Arg Arg Val Gln Ala Gln305 310 315 320Phe
Asn Glu Leu Gln Glu Tyr Tyr Leu Gln Arg Arg Arg Thr Gly Ala 325 330
335Gln Ala Arg Arg Gln Glu Glu Arg Asp Ile Val Ala Met Asn Arg Glu
340 345 350Gly Tyr His Ala Gly Leu Gln Asp Phe Gln Ser Val Leu Thr
Thr Phe 355 360 365Thr Arg Tyr Ser Arg Leu Arg Val Ile Ala Glu Leu
Arg His Gly Asp 370 375 380Leu Phe His Ser Ala Asn Ile Val Ser Ser
Ile Glu Phe Asp Arg Asp385 390 395 400Asp Glu Leu Phe Ala Thr Ala
Gly Val Ser Lys 405 41016903DNAZea mays 16actttatgtg acagcagacg
tgcactggcc agggggatca ccatccgtcg ccccgggtgt 60caataatatc actctgtaca
tccacaaaca gacgatacgg ctctctcttt tataggtgta 120aaccttaaac
tgccgtacgt ataggctgcg caactgttgg gaagggcgat cggtgcgggc
180ctcttcgcta ttacgccagc tggcgaaagg gggatgtgct gcaaggcgat
taagttgggt 240aacgccaggg ttttcccagt cacgacgttg taaaacgacg
gccagtgaat tgtaatacga 300ctcactatag ggcgaattgg gccctctaga
tgcatgctcg agcggccgcc agtgtgatgg 360atatctgcag aattcgccct
tctgcgccat gggcgactcc tcggtggccg gcgcgctcgt 420gccgtctgtg
cccaagccgg agcccgcgcc gtccggtgac acctccgcgg cggccgcggc
480gactacagcg gcgctggcga tgccggagga ggcgggtatg cgcgcggcgt
cggcgtcgcc 540tcaggggcct gcggaggagg gggagggccc cgccgatagg
gaccttctct gcccgatctg 600catggccgtc atcaaggacg ccttcctcac
cgcatgcggc cacagcttct gctacatgtg 660catcgtcacg catctcagca
acaagagcga ctgcccctgc tgcggccact accttaccaa 720ggcccagctc
taccccaact ttctccttga caaggttctg aagaaaatat cagcccaaca
780aatagcaaaa acagcatcgc cgatcgatca atttcgatgt gcattgcaac
agggaaatga 840aatgggggtt aaagagttgg atagccttat gactttgatt
gctgagaaga agcggcaaat 900gga 90317301PRTZea mays 17Met Gly Asp Ser
Ser Val Ala Gly Ala Leu Val Pro Ser Val Pro Lys1 5 10 15Pro Glu Pro
Ala Pro Ser Gly Asp Thr Ser Ala Ala Ala Ala Ala Thr 20 25 30Thr Ala
Ala Leu Ala Met Pro Glu Glu Ala Gly Met Arg Ala Ala Ser 35 40 45Ala
Ser Pro Gln Gly Pro Ala Glu Glu Gly Glu Gly Pro Ala Asp Arg 50 55
60Asp Leu Leu Cys Pro Ile Cys Met Ala Val Ile Lys Asp Ala Phe Leu65
70 75 80Thr Ala Cys Gly His Ser Phe Cys Tyr Met Cys Ile Val Thr His
Leu 85 90 95Ser Asn Lys Ser Asp Cys Pro Cys Cys Gly His Tyr Leu Thr
Lys Ala 100 105 110Gln Leu Tyr Pro Asn Phe Leu Leu Asp Lys Val Leu
Lys Lys Ile Ser 115 120 125Ala Gln Gln Ile Ala Lys Thr Ala Ser Pro
Ile Asp Gln Phe Arg Cys 130 135 140Ala Leu Gln Gln Gly Asn Glu Met
Gly Val Lys Glu Leu Asp Ser Leu145 150 155 160Met Thr Leu Ile Ala
Glu Lys Lys Arg Gln Met Glu Gln Gln Glu Ser 165 170 175Glu Thr Asn
Met Gln Ile Leu Leu Val Phe Leu His Cys Leu Arg Lys 180 185 190Gln
Lys Leu Glu Glu Leu Asn Glu Ile Gln Thr Asp Leu Gln Tyr Ile 195 200
205Lys Glu Asp Ile Ser Ser Val Glu Arg His Arg Ala Glu Leu Tyr Arg
210 215 220Thr Lys Glu Arg Tyr Ser Met Lys Leu Arg Met Leu Leu Asp
Glu Pro225 230 235 240Thr Ala Gln Lys Met Trp Pro Ser Pro Ile Asp
Lys Ala Ser Cys Arg 245 250 255Phe Leu Pro Asn Ser Arg Thr Pro Leu
Ser Gly Ser Cys Pro Gly Thr 260 265 270Leu Gln Asn Lys Lys Leu Asp
Leu Lys Ala Gln Val Ser His Gln Gly 275 280 285Phe Gln Arg Arg Asp
Ala Leu Thr Ser Ser Asp Pro Pro 290 295 300182611DNAZea mays
18actttatgtg acagcagacg tgcactggcc agggggatca ccatccgtcg ccccgggtgt
60caataatatc actctgtaca tccacaaaca gacgatacgg ctctctcttt tataggtgta
120aaccttaaac tgccgtacgt ataggctgcg caactgttgg gaagggcgat
cggtgcgggc 180ctcttcgcta ttacgccagc tggcgaaagg gggatgtgct
gcaaggcgat taagttgggt 240aacgccaggg ttttcccagt cacgacgttg
taaaacgacg gccagtgaat tgtaatacga 300ctcactatag ggcgaattgg
gccctctaga tgcatgctcg agcggccgcc agtgtgatgg 360atatctgcag
aattcgccct tctgcgccat gggcgactcc tcggtggccg gcgcgctcgt
420gccgtctgtg cccaagccgg agcccgcgcc gtccggtgac acctccgcgg
cggccgcggc 480gactacagcg gcgctggcga tgccggagga ggcgggtatg
cgcgcggcgt cggcgtcgcc 540tcaggggcct gcggaggagg gggagggccc
cgccgatagg gaccttctct gcccgatctg 600catggccgtc atcaaggacg
ccttcctcac cgcatgcggc cacagcttct gctacatgtg 660catcgtcacg
catctcagca acaagagcga ctgcccctgc tgcggccact accttaccaa
720ggcccagctc taccccaact ttctccttga caaggttctg aagaaaatat
cagcccaaca 780aatagcaaaa acagcatcgc cgatcgatca
atttcgatgt gcattgcaac agggaaatga 840aatgggggtt aaagagttgg
atagccttat gactttgatt gctgagaaga agcggcaaat 900ggaacaacaa
gaatcagaga caaatatgca aatattgcta gtcttcttac actgccttag
960aaagcaaaag ctagaagagt tgaatgagat tcaaactgat ctacaataca
tcaaagagga 1020tataagttct gtggagagac atagggcaga attatatcgc
acaaaagaaa ggtactccat 1080gaagctgcgc atgcttttag atgagcctac
tgcgcaaaaa atgtggccct ctcctataga 1140caaagctagc tgtcgctttc
ttcccaactc tcggacacca cttagtggat catgtccagg 1200aactttacag
aataagaagc ttgatttgaa agctcaagta agccatcaag gatttcaaag
1260gagagatgct ctaacttctt ctgatcctcc taactcccct atacaatcgg
gtaatgttat 1320tgctaggaag aggcgagttc aagcacagtt caatgagctt
caagaatact acctgcaaag 1380acgtcgtact ggagcacagg cacgcagaca
ggaagaaaga gatatagttg caatgaatag 1440agaaggctat catgcaggtc
ttcaggattt ccagtctgtg ctaacaacgt tcactcgata 1500cagtcgtcta
cgtgtcattg cggaactaag acatggagac ttgtttcact ctgccaatat
1560tgtatccagt attgaatttg atcgtgatga tgaactattt gctaccgctg
gagtctcgaa 1620acgtattaaa gtcttcgaat tttccactgt tgttaatgaa
ccatcagatg tgcattgccc 1680agttgttgaa atggctacca gatctaaact
tagctgccta agctggaaca agtactcaaa 1740aaatattatt gcaagcagtg
actatgaggg tatagtaact gtgtgggatg ttcagacccg 1800tcagagtgtg
atggaatatg aagagcatga gaagagagca tggagtgttg atttttctcg
1860cacagactct tcaatgctag tatctgggag tgatgattgc aaggtgaaag
tgtggtgcac 1920aaatcaagaa gcaagtgtga tcaatattga tatgaaagca
aatatttgct cggttaaata 1980taatcctgga tcaagcttct acgttgcagt
cggatctgct gatcaccata ttcattactt 2040tgatttacgt aatccaagtt
cgcctgtcca tattttcggg gggcacaaga aagcagtatc 2100atatgtgaaa
ttcttatcta acaatgagct tgcgtctgca tcaacagata gcacattacg
2160cttatgggat gtcaaggata actgcccggt acggacattc agaggacaca
aaaatgaaaa 2220gaactttgtt ggcttgtctg tgaacaatga atatattgct
tgtggaagtg agacaaatga 2280ggtttttgtt tatcacaagg ctatctcgaa
accggcagca agccatagat ttgtatcttc 2340tgacccggat gatgccgatg
atgatcctgg ttcttatttc attagtgctg tctgctggaa 2400gagtgatagc
cctacgatgt taactgctaa cagtcagggg accataaaag ttcttgtact
2460tgctccttga tgttatggag ggcgttcaag aggttcacag tactgtccag
ttgtttcctt 2520tcgtgtcatt atattccccc aaaattggga acgggggcat
aattgatctc cggttaggga 2580atgaagtttt gcagatggtc agctgacgta g
2611192332DNAArabidopsis thaliana 19caaaaaccaa aatcacaatc
gaagaaatct tttgaaagca aaatggaaga gatttcgacg 60gatccggttg ttccagcggt
gaaacctgac ccgagaacat cttcagttgg tgaaggtgct 120aatcgtcatg
aaaatgacga cggaggaagc ggcggttctg agattggagc accggatctg
180gataaagact tgctttgtcc gatttgtatg cagattatta aagatgcttt
cctcacggct 240tgtggtcata gtttctgcta tatgtgtatc atcacacatc
ttaggaacaa gagtgattgt 300ccctgttgta gccaacacct caccaataat
cagctttacc ctaatttctt gctcgataag 360ctattgaaga aaacttcagc
tcggcatgtg tcaaaaactg catcgccctt ggatcagttt 420cgggaagcac
tacaaagggg ttgtgatgtg tcaattaagg aggttgataa tcttctgaca
480cttcttgcgg aaaggaagag aaaaatggaa caggaagaag ctgagaggaa
catgcagata 540cttttggact ttttgcattg tctaaggaag caaaaagttg
atgaactaaa tgaggtgcaa 600actgatctcc agtatattaa agaagatata
aatgccgttg agagacatag aatagattta 660taccgagcta gggacagata
ttctgtaaag ttgcggatgc tcggagactg atccaagcac 720aagaaatgca
tggccacatg agaagaacca gattggtttc aactccaatt ctctcagcat
780aagaggagga aattttgtag gcaattatca aaacaaaaag gtagagggga
aggcacaagg 840aagctctcat gggctaccaa agaaggatgc gctgagtggg
tcagattcgc aaagtttgaa 900tcagtcaact gtctcaattg ctagaaagaa
acggattcat gctcagttca atgatttaca 960agaatgttac ctccaaaagc
ggcgtcagtt ggcagaccaa ccaaatagta aacaagaaaa 1020tgataagagt
gtagtacgga gggaaggcta tagcaacggc cttgcagatt ttcaatctgt
1080gttgactacc ttcactcgct acagtcgtct aagagttata gcagaaatcc
ggcatgggga 1140tatatttcat tcagccaaca ttgtatcaag catagagttt
gatcgtgatg atgagctgtt 1200tgccactgct ggtgtttcta gatgtataaa
ggtttttgac ttctcttcgt ttgtaaatga 1260accagcagat atgcagtgtc
cgattgtgga gatgtcaact cggtctaaac ttagttgctt 1320gagttggaat
aagcatgaaa aaaatcacat agcaagcagt gattatgaag gaatagtaac
1380agtgtgggat gtaactacta ggcagagtcg gatggagtat gaagagcacg
aaaaacgtgc 1440ctggagtgtt gacttttcac gaacagaacc atcaatgctt
gtatctggta gtgacgactg 1500caaggttaaa gtttggtgca cgaggcagga
agcaagtgtg attaatattg atatgaaagc 1560aaacatatgt tgtgtcaagt
acaatcctgg ctcaagcaac tacattgcgg tcggatcagc 1620tgatcatcac
atccattatt acgatctaag aaacataagc caaccacttc atgtcttcag
1680tggacacaag aaagcagttt cctatgttaa atttttgtcc aacaacgagc
tcgcttctgc 1740gtccacagat agcacactac gcttatggga tgtcaaagac
aacttgccag ttcgaacatt 1800cagaggacat actaacgaga agaactttgt
gggtctcaca gtgaacagcg agtatctcgc 1860ctgtggaagc gagacaaacg
aagtatatgt atatcacaag gaaatcacga gacccgtgac 1920atcgcacaga
tttggatcgc cagacatgga cgatgcagag gaagaggcag gttcctactt
1980tattagtgcg gtttgctgga agagtgatag tcccacgatg ttgactgcga
atagtcaagg 2040aaccatcaaa gttctggtac tcgctgcgtg attctagtag
acattacaaa agatcttata 2100gcttcgtgaa tcaataaaaa caaatttgcc
gtctatgttc tttagtggga gttacatata 2160gagagagaac aatttattaa
aagtagggtt catcatttgg aaagcaactt tgtattatta 2220tgcttgcctt
ggaacactcc tcaagaagaa tttgtatcag tgatgtagat atgtcttacg
2280gtttcttagc ttctacttta tataattaaa tgttagaatc aaaaaaaaaa aa
2332202434DNAOryza sativa 20ttattcacgc ccagtcgccg cctccaccgc
cgccgcctgc tcgactcacc accgcagggc 60ggcctcctcc tgccgcatgg gtgactcgac
ggtggccggc gcgctggtgc catcggtgcc 120gaagcaggag caggcgccgt
cgggggacgc gtccacggcg gcgttggcgg tggcggggga 180gggggaggag
gatgcggggg cgcgcgcctc cgcggggggc aacggggagg ccgcggccga
240cagggacctc ctctgcccga tctgcatggc ggtcatcaag gacgccttcc
tcaccgcctg 300cggccacagc ttctgctaca tgtgcatcgt cacgcatctc
agccacaaga gcgactgccc 360ctgctgcggc aactacctca ccaaggcgca
gctctacccc aacttcctcc tcgacaaggt 420cttgaagaaa atgtcagctc
gccaaattgc gaagacagca tcaccgatag accaatttcg 480atatgcactg
caacagggaa acgatatggc ggttaaagaa ctagatagtc ttatgacttt
540gatcgcggag aagaagcggc atatggaaca gcaagagtca gaaacaaata
tgcaaatatt 600gctggtcttc ttgcattgcc tcagaaagca aaagttggaa
gagctgaatg agattcaaac 660tgacctacag tacatcaaag aagatataag
tgctgtggag agacataggt tagaattata 720tcgaacaaaa gaaaggtact
caatgaagct ccgcatgctt ttggatgaac ctgctgcatc 780aaagatgtgg
ccttcaccta tggataaacc tagtggtctc tttcttccca actctcgggg
840accacttagt acatcaaatc cagggggttt acagaataag aagcttgact
tgaaaggtca 900aattagtcat caaggatttc aaaggagaga tgttctcact
tgctcggatc ctcctagtgc 960ccctattcaa tcaggcaacg ttattgctcg
gaagaggcga gttcaagctc agtttaacga 1020gcttcaagaa tactatcttc
aaagacggcg taccggagca caatcacgta ggctggagga 1080aagagacata
gtaacaataa ataaagaagg ttatcatgca ggacttgagg atttccagtc
1140tgtgctaaca acattcacac gatatagtcg cttgcgtgta attgcggagc
taagacatgg 1200agatctgttt cactctgcaa atatcgtatc aagtatcgaa
tttgaccgtg atgatgagct 1260atttgctact gctggagtct caaagcgcat
caaagtcttc gagttttcta cagttgttaa 1320tgaaccatca gatgtgcatt
gtccagttgt tgaaatggct actagatcta aactcagctg 1380ccttagctgg
aacaagtact caaaaaatgt tatagcaagc agcgactatg agggtatagt
1440aactgtttgg gatgtccaaa cccgccagag tgtgatggag tatgaagaac
atgaaaagag 1500agcatggagt gttgattttt ctcgaacaga accctcgatg
ctagtatctg ggagtgatga 1560ttgcaaggtc aaagtgtggt gcacaaagca
agaagcaagt gccatcaata ttgatatgaa 1620ggccaatatt tgctctgtca
aatataatcc tgggtcgagc cactatgttg cagtgggttc 1680tgctgatcac
catattcatt attttgattt gcgaaatcca agtgcgcctg tccatgtttt
1740tggtgggcac aagaaagctg tttcttatgt gaagttcctg tccaccaatg
agcttgcgtc 1800tgcatcaact gatagcacat tacggttatg ggatgtcaaa
gaaaattgcc ctgtaaggac 1860attcagaggg cacaagaatg aaaagaactt
tgttgggctg tctgtaaata acgagtacat 1920tgcctgcggg agtgaaacga
atgaggtttt tgtttaccac aaggctatct caaaacctgc 1980tgccaaccac
agatttgtat catctgatct cgatgatgca gatgatgatc ctggctctta
2040ttttattagc gcagtctgct ggaagagcga tagccctacc atgttaactg
ctaacagtca 2100gggcaccatt aaagttcttg tacttgctcc ttgatgaaat
cagtggtttt catgagatcc 2160ctagatagct tgtatatttg atgtatacag
ttgtttcctt ttcgtgccat tataccccaa 2220atgggagtgg aggtattact
gatctccaac atagggcgca aagttttgaa ggtaatcagc 2280tgacataggg
tttcgagggc tcgaaatgtg catagtccag aattctcatg tataggttta
2340aagcagtcaa gtaattgatt atacatatgt aacgtgagaa ttgagaaatg
aacatcaaat 2400aagcttgttt ggttgcataa aaaaaaaaaa aaaa
243421685PRTOryza sativa 21Met Gly Asp Ser Thr Val Ala Gly Ala Leu
Val Pro Ser Val Pro Lys1 5 10 15Gln Glu Gln Ala Pro Ser Gly Asp Ala
Ser Thr Ala Ala Leu Ala Val 20 25 30Ala Gly Glu Gly Glu Glu Asp Ala
Gly Ala Arg Ala Ser Ala Gly Gly 35 40 45Asn Gly Glu Ala Ala Ala Asp
Arg Asp Leu Leu Cys Pro Ile Cys Met 50 55 60Ala Val Ile Lys Asp Ala
Phe Leu Thr Ala Cys Gly His Ser Phe Cys65 70 75 80Tyr Met Cys Ile
Val Thr His Leu Ser His Lys Ser Asp Cys Pro Cys 85 90 95Cys Gly Asn
Tyr Leu Thr Lys Ala Gln Leu Tyr Pro Asn Phe Leu Leu 100 105 110Asp
Lys Val Leu Lys Lys Met Ser Ala Arg Gln Ile Ala Lys Thr Ala 115 120
125Ser Pro Ile Asp Gln Phe Arg Tyr Ala Leu Gln Gln Gly Asn Asp Met
130 135 140Ala Val Lys Glu Leu Asp Ser Leu Met Thr Leu Ile Ala Glu
Lys Lys145 150 155 160Arg His Met Glu Gln Gln Glu Ser Glu Thr Asn
Met Gln Ile Leu Leu 165 170 175Val Phe Leu His Cys Leu Arg Lys Gln
Lys Leu Glu Glu Leu Asn Glu 180 185 190Ile Gln Thr Asp Leu Gln Tyr
Ile Lys Glu Asp Ile Ser Ala Val Glu 195 200 205Arg His Arg Leu Glu
Leu Tyr Arg Thr Lys Glu Arg Tyr Ser Met Lys 210 215 220Leu Arg Met
Leu Leu Asp Glu Pro Ala Ala Ser Lys Met Trp Pro Ser225 230 235
240Pro Met Asp Lys Pro Ser Gly Leu Phe Leu Pro Asn Ser Arg Gly Pro
245 250 255Leu Ser Thr Ser Asn Pro Gly Gly Leu Gln Asn Lys Lys Leu
Asp Leu 260 265 270Lys Gly Gln Ile Ser His Gln Gly Phe Gln Arg Arg
Asp Val Leu Thr 275 280 285Cys Ser Asp Pro Pro Ser Ala Pro Ile Gln
Ser Gly Asn Val Ile Ala 290 295 300Arg Lys Arg Arg Val Gln Ala Gln
Phe Asn Glu Leu Gln Glu Tyr Tyr305 310 315 320Leu Gln Arg Arg Arg
Thr Gly Ala Gln Ser Arg Arg Leu Glu Glu Arg 325 330 335Asp Ile Val
Thr Ile Asn Lys Glu Gly Tyr His Ala Gly Leu Glu Asp 340 345 350Phe
Gln Ser Val Leu Thr Thr Phe Thr Arg Tyr Ser Arg Leu Arg Val 355 360
365Ile Ala Glu Leu Arg His Gly Asp Leu Phe His Ser Ala Asn Ile Val
370 375 380Ser Ser Ile Glu Phe Asp Arg Asp Asp Glu Leu Phe Ala Thr
Ala Gly385 390 395 400Val Ser Lys Arg Ile Lys Val Phe Glu Phe Ser
Thr Val Val Asn Glu 405 410 415Pro Ser Asp Val His Cys Pro Val Val
Glu Met Ala Thr Arg Ser Lys 420 425 430Leu Ser Cys Leu Ser Trp Asn
Lys Tyr Ser Lys Asn Val Ile Ala Ser 435 440 445Ser Asp Tyr Glu Gly
Ile Val Thr Val Trp Asp Val Gln Thr Arg Gln 450 455 460Ser Val Met
Glu Tyr Glu Glu His Glu Lys Arg Ala Trp Ser Val Asp465 470 475
480Phe Ser Arg Thr Glu Pro Ser Met Leu Val Ser Gly Ser Asp Asp Cys
485 490 495Lys Val Lys Val Trp Cys Thr Lys Gln Glu Ala Ser Ala Ile
Asn Ile 500 505 510Asp Met Lys Ala Asn Ile Cys Ser Val Lys Tyr Asn
Pro Gly Ser Ser 515 520 525His Tyr Val Ala Val Gly Ser Ala Asp His
His Ile His Tyr Phe Asp 530 535 540Leu Arg Asn Pro Ser Ala Pro Val
His Val Phe Gly Gly His Lys Lys545 550 555 560Ala Val Ser Tyr Val
Lys Phe Leu Ser Thr Asn Glu Leu Ala Ser Ala 565 570 575Ser Thr Asp
Ser Thr Leu Arg Leu Trp Asp Val Lys Glu Asn Cys Pro 580 585 590Val
Arg Thr Phe Arg Gly His Lys Asn Glu Lys Asn Phe Val Gly Leu 595 600
605Ser Val Asn Asn Glu Tyr Ile Ala Cys Gly Ser Glu Thr Asn Glu Val
610 615 620Phe Val Tyr His Lys Ala Ile Ser Lys Pro Ala Ala Asn His
Arg Phe625 630 635 640Val Ser Ser Asp Leu Asp Asp Ala Asp Asp Asp
Pro Gly Ser Tyr Phe 645 650 655Ile Ser Ala Val Cys Trp Lys Ser Asp
Ser Pro Thr Met Leu Thr Ala 660 665 670Asn Ser Gln Gly Thr Ile Lys
Val Leu Val Leu Ala Pro 675 680 68522693PRTZea mays 22Met Gly Asp
Ser Ser Val Ala Gly Ala Leu Val Pro Ser Val Pro Lys1 5 10 15Pro Glu
Pro Ala Pro Ser Gly Asp Thr Ser Ala Ala Ala Ala Ala Thr 20 25 30Thr
Ala Ala Leu Ala Met Pro Glu Glu Ala Gly Met Arg Ala Ala Ser 35 40
45Ala Ser Pro Gln Gly Pro Ala Glu Glu Gly Glu Gly Pro Ala Asp Arg
50 55 60Asp Leu Leu Cys Pro Ile Cys Met Ala Val Ile Lys Asp Ala Phe
Leu65 70 75 80Thr Ala Cys Gly His Ser Phe Cys Tyr Met Cys Ile Val
Thr His Leu 85 90 95Ser Asn Lys Ser Asp Cys Pro Cys Cys Gly His Tyr
Leu Thr Lys Ala 100 105 110Gln Leu Tyr Pro Asn Phe Leu Leu Asp Lys
Val Leu Lys Lys Ile Ser 115 120 125Ala Gln Gln Ile Ala Lys Thr Ala
Ser Pro Ile Asp Gln Phe Arg Cys 130 135 140Ala Leu Gln Gln Gly Asn
Glu Met Gly Val Lys Glu Leu Asp Ser Leu145 150 155 160Met Thr Leu
Ile Ala Glu Lys Lys Arg Gln Met Glu Gln Gln Glu Ser 165 170 175Glu
Thr Asn Met Gln Ile Leu Leu Val Phe Leu His Cys Leu Arg Lys 180 185
190Gln Lys Leu Glu Glu Leu Asn Glu Ile Gln Thr Asp Leu Gln Tyr Ile
195 200 205Lys Glu Asp Ile Ser Ser Val Glu Arg His Arg Ala Glu Leu
Tyr Arg 210 215 220Thr Lys Glu Arg Tyr Ser Met Lys Leu Arg Met Leu
Leu Asp Glu Pro225 230 235 240Thr Ala Gln Lys Met Trp Pro Ser Pro
Ile Asp Lys Ala Ser Cys Arg 245 250 255Phe Leu Pro Asn Ser Arg Thr
Pro Leu Ser Gly Ser Cys Pro Gly Thr 260 265 270Leu Gln Asn Lys Lys
Leu Asp Leu Lys Ala Gln Val Ser His Gln Gly 275 280 285Phe Gln Arg
Arg Asp Ala Leu Thr Ser Ser Asp Pro Pro Asn Ser Pro 290 295 300Ile
Gln Ser Gly Asn Val Ile Ala Arg Lys Arg Arg Val Gln Ala Gln305 310
315 320Phe Asn Glu Leu Gln Glu Tyr Tyr Leu Gln Arg Arg Arg Thr Gly
Ala 325 330 335Gln Ala Arg Arg Gln Glu Glu Arg Asp Ile Val Ala Met
Asn Arg Glu 340 345 350Gly Tyr His Ala Gly Leu Gln Asp Phe Gln Ser
Val Leu Thr Thr Phe 355 360 365Thr Arg Tyr Ser Arg Leu Arg Val Ile
Ala Glu Leu Arg His Gly Asp 370 375 380Leu Phe His Ser Ala Asn Ile
Val Ser Ser Ile Glu Phe Asp Arg Asp385 390 395 400Asp Glu Leu Phe
Ala Thr Ala Gly Val Ser Lys Arg Ile Lys Val Phe 405 410 415Glu Phe
Ser Thr Val Val Asn Glu Pro Ser Asp Val His Cys Pro Val 420 425
430Val Glu Met Ala Thr Arg Ser Lys Leu Ser Cys Leu Ser Trp Asn Lys
435 440 445Tyr Ser Lys Asn Ile Ile Ala Ser Ser Asp Tyr Glu Gly Ile
Val Thr 450 455 460Val Trp Asp Val Gln Thr Arg Gln Ser Val Met Glu
Tyr Glu Glu His465 470 475 480Glu Lys Arg Ala Trp Ser Val Asp Phe
Ser Arg Thr Asp Ser Ser Met 485 490 495Leu Val Ser Gly Ser Asp Asp
Cys Lys Val Lys Val Trp Cys Thr Asn 500 505 510Gln Glu Ala Ser Val
Ile Asn Ile Asp Met Lys Ala Asn Ile Cys Ser 515 520 525Val Lys Tyr
Asn Pro Gly Ser Ser Phe Tyr Val Ala Val Gly Ser Ala 530 535 540Asp
His His Ile His Tyr Phe Asp Leu Arg Asn Pro Ser Ser Pro Val545 550
555 560His Ile Phe Gly Gly His Lys Lys Ala Val Ser Tyr Val Lys Phe
Leu 565 570 575Ser Asn Asn Glu Leu Ala Ser Ala Ser Thr Asp Ser Thr
Leu Arg Leu 580 585 590Trp Asp Val Lys Asp Asn Cys Pro Val Arg Thr
Phe Arg Gly His Lys 595 600 605Asn Glu Lys Asn Phe Val Gly Leu Ser
Val Asn Asn Glu Tyr Ile Ala 610 615 620Cys Gly Ser Glu Thr Asn Glu
Val Phe Val Tyr His Lys Ala Ile Ser625 630 635 640Lys Pro Ala Ala
Ser His Arg Phe Val Ser Ser Asp Pro Asp Asp Ala 645 650 655Asp Asp
Asp Pro Gly Ser Tyr Phe Ile Ser Ala Val Cys Trp Lys Ser 660 665
670Asp Ser Pro Thr Met Leu Thr Ala Asn Ser Gln Gly Thr Ile Lys Val
675
680 685Leu Val Leu Ala Pro 69023677PRTIpomoea nil 23Met Gly Glu Arg
Glu Gly Glu Cys Glu Gly Glu Ser Ser Met Val Gly1 5 10 15Ala Val Val
Pro Ala Val Lys Ala Arg Asn Ala Glu Glu Pro Ser Ile 20 25 30Ser His
Arg Asp Glu Ala Thr Pro Ser Gly Met Glu Pro Glu Leu Asp 35 40 45Arg
Glu Leu Leu Cys Pro Ile Cys Met Gln Ile Ile Lys Asp Ala Phe 50 55
60Leu Thr Ser Cys Gly His Ser Phe Cys Tyr Met Cys Ile Val Thr His65
70 75 80Leu His Asn Lys Ser Asp Cys Pro Cys Cys Ser His Tyr Leu Thr
Thr 85 90 95Ala Gln Leu Tyr Pro Asn Phe Leu Leu Asp Lys Leu Leu Lys
Lys Thr 100 105 110Ser Ala His Gln Ile Ser Lys Thr Ala Ser Pro Val
Glu Gln Phe Arg 115 120 125His Ser Ile Glu Gln Gly Arg Glu Val Ser
Ile Lys Glu Leu Asp Val 130 135 140Leu Leu Thr Ile Leu Ala Glu Lys
Lys Arg Lys Leu Glu Gln Glu Glu145 150 155 160Ala Glu Arg Asn Met
Gln Ile Leu Leu Glu Phe Leu His Met Leu Lys 165 170 175Lys Lys Lys
Val Asp Glu Leu Asn Glu Val Gln Asn Asp Leu Gln Tyr 180 185 190Ile
Lys Glu Asp Ile Asn Ala Val Glu Arg His Arg Ile Asp Leu Tyr 195 200
205Arg Ala Arg Asp Arg Tyr Ser Met Lys Leu Arg Met Leu Ala Asp Asp
210 215 220Pro Leu Gly Ser Lys Ser Arg Ser Ser Ser Val Asp Arg Asn
Thr Ile225 230 235 240Gly Leu Phe Pro Ser Ser Arg Ser Ala His Gly
Gly Leu Ala Ser Gly 245 250 255Asn Leu Met Tyr Lys Lys Asn Asp Gly
Gly Ser Gln Arg Lys Asp Val 260 265 270Ser Val Thr Glu Leu Ser Leu
Asn Gly Ser Asp Ser Gln His Met Asn 275 280 285Gln Ser Gly Leu Ala
Val Met Arg Lys Lys Arg Val His Ala Gln Phe 290 295 300Asn Asp Leu
Gln Glu Cys Tyr Leu Gln Lys Arg Arg Gln Leu Ala Asn305 310 315
320Gln Leu Gln Asn Lys Glu Glu Arg Asp Gln Asn Val Thr Arg Arg Glu
325 330 335Gly Tyr Ser Ala Gly Leu Ser Glu Phe Gln Ser Val Leu Ser
Thr Phe 340 345 350Thr Arg Tyr Ser Arg Leu Arg Val Ile Ala Glu Leu
Arg His Gly Asp 355 360 365Ile Phe His Ser Ala Asn Ile Val Ser Ser
Ile Glu Phe Asp Arg Asp 370 375 380Asp Glu Leu Phe Ala Thr Ala Gly
Val Ser Arg Arg Ile Lys Val Phe385 390 395 400Asp Phe Ser Ser Val
Val Asn Glu Pro Ala Asp Ala His Cys Pro Val 405 410 415Val Glu Met
Ser Thr Arg Ser Lys Leu Ser Cys Leu Ser Trp Asn Lys 420 425 430Tyr
Thr Lys Asn His Ile Ala Ser Ser Asp Tyr Asp Gly Ile Val Thr 435 440
445Val Trp Asp Val Thr Thr Arg Gln Ser Val Met Glu Tyr Glu Glu His
450 455 460Glu Lys Arg Ala Trp Ser Val Asp Phe Ser Arg Thr Asp Pro
Ser Met465 470 475 480Leu Val Ser Gly Ser Asp Asp Cys Lys Val Lys
Val Trp Cys Thr Lys 485 490 495Gln Glu Ala Ser Ala Leu Asn Ile Asp
Met Lys Ala Asn Ile Cys Cys 500 505 510Val Lys Tyr Asn Pro Gly Ser
Ser Phe His Val Ala Val Gly Ser Ala 515 520 525Asp His His Ile His
Tyr Tyr Asp Leu Arg Asn Thr Ser Ala Pro Leu 530 535 540His Ile Phe
Ser Gly His Lys Lys Ala Val Ser Tyr Val Lys Phe Leu545 550 555
560Ser Ser His Glu Leu Ala Ser Ala Ser Thr Asp Ser Thr Leu Arg Leu
565 570 575Trp Asp Val Lys Asp Asn Ser Pro Val Arg Val Phe Arg Gly
His Thr 580 585 590Asn Glu Lys Asn Phe Val Gly Leu Ser Val Ser Asn
Glu Phe Ile Ser 595 600 605Cys Gly Ser Glu Thr Asn Glu Val Phe Val
Tyr His Lys Ala Ile Ser 610 615 620Lys Pro Val Thr Trp His Arg Phe
Gly Ser Pro Asp Val Asp Glu Ala625 630 635 640Asp Glu Asp Val Thr
Ser Phe Phe Ile Ser Ala Val Cys Trp Lys Ser 645 650 655Asp Ser Pro
Thr Met Leu Ala Ala Asn Ser Gln Gly Thr Ile Lys Val 660 665 670Leu
Val Leu Ala Ala 67524677PRTLycopersicon esculentum 24Met Val Glu
Ser Ser Val Gly Gly Val Val Pro Ala Val Lys Gly Glu1 5 10 15Val Met
Arg Arg Met Gly Asp Lys Glu Glu Gly Gly Ser Val Thr Leu 20 25 30Arg
Asp Glu Glu Val Gly Thr Val Thr Glu Trp Glu Leu Asp Arg Glu 35 40
45Leu Leu Cys Pro Ile Cys Met Gln Ile Ile Lys Asp Ala Phe Leu Thr
50 55 60Ala Cys Gly His Ser Phe Cys Tyr Met Cys Ile Val Thr His Leu
His65 70 75 80Asn Lys Ser Asp Cys Pro Cys Cys Ser His Tyr Leu Thr
Thr Ser Gln 85 90 95Leu Tyr Pro Asn Phe Leu Leu Asp Lys Leu Leu Lys
Lys Thr Ser Ala 100 105 110Arg Gln Ile Ser Lys Thr Ala Ser Pro Val
Glu Gln Phe Arg His Ser 115 120 125Leu Glu Gln Gly Ser Glu Val Ser
Ile Lys Glu Leu Asp Ala Leu Leu 130 135 140Leu Met Leu Ser Glu Lys
Lys Arg Lys Leu Glu Gln Glu Glu Ala Glu145 150 155 160Arg Asn Met
Gln Ile Leu Leu Asp Phe Leu Gln Met Leu Arg Lys Gln 165 170 175Lys
Val Asp Glu Leu Asn Glu Val Gln His Asp Leu Gln Tyr Ile Lys 180 185
190Glu Asp Leu Asn Ser Val Glu Arg His Arg Ile Asp Leu Tyr Arg Ala
195 200 205Arg Asp Arg Tyr Ser Met Lys Leu Arg Met Leu Ala Asp Asp
Pro Ile 210 215 220Gly Lys Lys Pro Trp Ser Ser Ser Thr Asp Arg Asn
Phe Gly Gly Leu225 230 235 240Phe Ser Thr Ser Gln Asn Ala Pro Gly
Gly Leu Pro Thr Gly Asn Leu 245 250 255Thr Phe Lys Lys Val Asp Ser
Lys Ala Gln Ile Ser Ser Pro Gly Pro 260 265 270Gln Arg Lys Asp Thr
Ser Ile Ser Glu Leu Asn Ser Gln His Met Ser 275 280 285Gln Ser Gly
Leu Ala Val Val Arg Lys Lys Arg Val Asn Ala Gln Phe 290 295 300Asn
Asp Leu Gln Glu Cys Tyr Leu Gln Lys Arg Arg Gln Leu Ala Asn305 310
315 320Lys Ser Arg Val Lys Glu Glu Lys Asp Ala Asp Val Val Gln Arg
Glu 325 330 335Gly Tyr Ser Glu Gly Leu Ala Asp Phe Gln Ser Val Leu
Ser Thr Phe 340 345 350Thr Arg Tyr Ser Arg Leu Arg Val Ile Ala Glu
Leu Arg His Gly Asp 355 360 365Leu Phe His Ser Ala Asn Ile Val Ser
Ser Ile Glu Phe Asp Arg Asp 370 375 380Asp Glu Leu Phe Ala Thr Ala
Gly Val Ser Arg Arg Ile Lys Val Phe385 390 395 400Asp Phe Ser Ser
Val Val Asn Glu Pro Ala Asp Ala His Cys Pro Val 405 410 415Val Glu
Met Ser Thr Arg Ser Lys Leu Ser Cys Leu Ser Trp Asn Lys 420 425
430Tyr Thr Lys Asn His Ile Ala Ser Ser Asp Tyr Asp Gly Ile Val Thr
435 440 445Val Trp Asp Val Thr Thr Arg Gln Ser Val Met Glu Tyr Glu
Glu His 450 455 460Glu Lys Arg Ala Trp Ser Val Asp Phe Ser Arg Thr
Glu Pro Ser Met465 470 475 480Leu Val Ser Gly Ser Asp Asp Cys Lys
Val Lys Val Trp Cys Thr Lys 485 490 495Gln Glu Ala Ser Val Leu Asn
Ile Asp Met Lys Ala Asn Ile Cys Cys 500 505 510Val Lys Tyr Asn Pro
Gly Ser Ser Val His Ile Ala Val Gly Ser Ala 515 520 525Asp His His
Ile His Tyr Tyr Asp Leu Arg Asn Thr Ser Gln Pro Val 530 535 540His
Ile Phe Ser Gly His Arg Lys Ala Val Ser Tyr Val Lys Phe Leu545 550
555 560Ser Asn Asn Glu Leu Ala Ser Ala Ser Thr Asp Ser Thr Leu Arg
Leu 565 570 575Trp Asp Val Lys Asp Asn Leu Pro Val Arg Thr Leu Arg
Gly His Thr 580 585 590Asn Glu Lys Asn Phe Val Gly Leu Ser Val Asn
Asn Glu Phe Leu Ser 595 600 605Cys Gly Ser Glu Thr Asn Glu Val Phe
Val Tyr His Lys Ala Ile Ser 610 615 620Lys Pro Val Thr Trp His Arg
Phe Gly Ser Pro Asp Ile Asp Glu Ala625 630 635 640Asp Glu Asp Ala
Gly Ser Tyr Phe Ile Ser Ala Val Cys Trp Lys Ser 645 650 655Asp Ser
Pro Thr Met Leu Ala Ala Asn Ser Gln Gly Thr Ile Lys Val 660 665
670Leu Val Leu Ala Ala 67525675PRTArabidopsis thaliana 25Met Glu
Glu Ile Ser Thr Asp Pro Val Val Pro Ala Val Lys Pro Asp1 5 10 15Pro
Arg Thr Ser Ser Val Gly Glu Gly Ala Asn Arg His Glu Asn Asp 20 25
30Asp Gly Gly Ser Gly Gly Ser Glu Ile Gly Ala Pro Asp Leu Asp Lys
35 40 45Asp Leu Leu Cys Pro Ile Cys Met Gln Ile Ile Lys Asp Ala Phe
Leu 50 55 60Thr Ala Cys Gly His Ser Phe Cys Tyr Met Cys Ile Ile Thr
His Leu65 70 75 80Arg Asn Lys Ser Asp Cys Pro Cys Cys Ser Gln His
Leu Thr Asn Asn 85 90 95Gln Leu Tyr Pro Asn Phe Leu Leu Asp Lys Leu
Leu Lys Lys Thr Ser 100 105 110Ala Arg His Val Ser Lys Thr Ala Ser
Pro Leu Asp Gln Phe Arg Glu 115 120 125Ala Leu Gln Arg Gly Cys Asp
Val Ser Ile Lys Glu Val Asp Asn Leu 130 135 140Leu Thr Leu Leu Ala
Glu Arg Lys Arg Lys Met Glu Gln Glu Glu Ala145 150 155 160Glu Arg
Asn Met Gln Ile Leu Leu Asp Phe Leu His Cys Leu Arg Lys 165 170
175Gln Lys Val Asp Glu Leu Asn Glu Val Gln Thr Asp Leu Gln Tyr Ile
180 185 190Lys Glu Asp Ile Asn Ala Val Glu Arg His Arg Ile Asp Leu
Tyr Arg 195 200 205Ala Arg Asp Arg Tyr Ser Val Lys Leu Arg Met Leu
Gly Asp Asp Pro 210 215 220Ser Thr Arg Asn Ala Trp Pro His Glu Lys
Asn Gln Ile Gly Phe Asn225 230 235 240Ser Asn Ser Leu Ser Ile Arg
Gly Gly Asn Phe Val Gly Asn Tyr Gln 245 250 255Asn Lys Lys Val Glu
Gly Lys Ala Gln Gly Ser Ser His Gly Leu Pro 260 265 270Lys Lys Asp
Ala Leu Ser Gly Ser Asp Ser Gln Ser Leu Asn Gln Ser 275 280 285Thr
Val Ser Met Ala Arg Lys Lys Arg Ile His Ala Gln Phe Asn Asp 290 295
300Leu Gln Glu Cys Tyr Leu Gln Lys Arg Arg Gln Leu Ala Asp Gln
Pro305 310 315 320Asn Ser Lys Gln Glu Asn Asp Lys Ser Val Val Arg
Arg Glu Gly Tyr 325 330 335Ser Asn Gly Leu Ala Asp Phe Gln Ser Val
Leu Thr Thr Phe Thr Arg 340 345 350Tyr Ser Arg Leu Arg Val Ile Ala
Glu Ile Arg His Gly Asp Ile Phe 355 360 365His Ser Ala Asn Ile Val
Ser Ser Ile Glu Phe Asp Arg Asp Asp Glu 370 375 380Leu Phe Ala Thr
Ala Gly Val Ser Arg Cys Ile Lys Val Phe Asp Phe385 390 395 400Ser
Ser Val Val Asn Glu Pro Ala Asp Met Gln Cys Pro Ile Val Glu 405 410
415Met Ser Thr Arg Ser Lys Leu Ser Cys Leu Ser Trp Asn Lys His Glu
420 425 430Lys Asn His Ile Ala Ser Ser Asp Tyr Glu Gly Ile Val Thr
Val Trp 435 440 445Asp Val Thr Thr Arg Gln Ser Leu Met Glu Tyr Glu
Glu His Glu Lys 450 455 460Arg Ala Trp Ser Val Asp Phe Ser Arg Thr
Glu Pro Ser Met Leu Val465 470 475 480Ser Gly Ser Asp Asp Cys Lys
Val Lys Val Trp Cys Thr Arg Gln Glu 485 490 495Ala Ser Val Ile Asn
Ile Asp Met Lys Ala Asn Ile Cys Cys Val Lys 500 505 510Tyr Asn Pro
Gly Ser Ser Asn Tyr Ile Ala Val Gly Ser Ala Asp His 515 520 525His
Ile His Tyr Tyr Asp Leu Arg Asn Ile Ser Gln Pro Leu His Val 530 535
540Phe Ser Gly His Lys Lys Ala Val Ser Tyr Val Lys Phe Leu Ser
Asn545 550 555 560Asn Glu Leu Ala Ser Ala Ser Thr Asp Ser Thr Leu
Arg Leu Trp Asp 565 570 575Val Lys Asp Asn Leu Pro Val Arg Thr Phe
Arg Gly His Thr Asn Glu 580 585 590Lys Asn Phe Val Gly Leu Thr Val
Asn Ser Glu Tyr Leu Ala Cys Gly 595 600 605Ser Glu Thr Asn Glu Val
Tyr Val Tyr His Lys Glu Ile Thr Arg Pro 610 615 620Val Thr Ser His
Arg Phe Gly Ser Pro Asp Met Asp Asp Ala Glu Glu625 630 635 640Glu
Ala Gly Ser Tyr Phe Ile Ser Ala Val Cys Trp Lys Ser Asp Ser 645 650
655Pro Thr Met Leu Thr Ala Asn Ser Gln Gly Thr Ile Lys Val Leu Val
660 665 670Leu Ala Ala 67526672PRTPisum sativum 26Met Glu Glu His
Ser Val Gly Pro Leu Val Pro Ala Val Val Lys Pro1 5 10 15Glu Pro Ser
Lys Asn Phe Ser Thr Asp Thr Thr Ala Ala Gly Thr Phe 20 25 30Leu Leu
Val Pro Thr Met Ser Asp Leu Asp Lys Asp Phe Leu Cys Pro 35 40 45Ile
Cys Met Gln Ile Ile Lys Asp Ala Phe Leu Thr Ala Cys Gly His 50 55
60Ser Phe Cys Tyr Met Cys Ile Ile Thr His Leu Arg Asn Lys Ser Asp65
70 75 80Cys Pro Cys Cys Gly His Tyr Leu Thr Asn Ser Asn Leu Phe Pro
Asn 85 90 95Phe Leu Leu Asp Lys Leu Leu Lys Lys Thr Ser Asp Arg Gln
Ile Ser 100 105 110Lys Thr Ala Ser Pro Val Glu His Phe Arg Gln Ala
Val Gln Lys Gly 115 120 125Cys Glu Val Thr Met Lys Glu Leu Asp Thr
Leu Leu Leu Leu Leu Thr 130 135 140Glu Lys Lys Arg Lys Met Glu Gln
Glu Glu Ala Glu Arg Asn Met Gln145 150 155 160Ile Leu Leu Asp Phe
Leu His Cys Leu Arg Lys Gln Lys Val Asp Glu 165 170 175Leu Lys Glu
Val Gln Thr Asp Leu Gln Phe Ile Lys Glu Asp Ile Gly 180 185 190Ala
Val Glu Lys His Arg Met Asp Leu Tyr Arg Ala Arg Asp Arg Tyr 195 200
205Ser Val Lys Leu Arg Met Leu Asp Asp Ser Gly Gly Arg Lys Ser Arg
210 215 220His Ser Ser Met Asp Leu Asn Ser Ser Gly Leu Ala Ser Ser
Pro Leu225 230 235 240Asn Leu Arg Gly Gly Leu Ser Ser Gly Ser His
Thr Lys Lys Asn Asp 245 250 255Gly Lys Ser Gln Ile Ser Ser His Gly
His Gly Ile Gln Arg Arg Asp 260 265 270Pro Ile Thr Gly Ser Asp Ser
Gln Tyr Ile Asn Gln Ser Gly Leu Ala 275 280 285Leu Val Arg Lys Lys
Arg Val His Thr Gln Phe Asn Asp Leu Gln Glu 290 295 300Cys Tyr Leu
Gln Lys Arg Arg Gln Ala Ala Asp Lys Pro His Gly Gln305 310 315
320Gln Glu Arg Asp Thr Asn Phe Ile Ser Arg Glu Gly Tyr Ser Cys Gly
325 330 335Leu Asp Asp Phe Gln Ser Val Leu Thr Thr Phe Thr Arg Tyr
Ser Arg 340 345 350Leu Arg Val Ile Ala Glu Ile Arg His Gly Asp Ile
Phe His Ser Ala 355 360 365Asn Ile Val Ser Ser Ile Glu Phe Asp Arg
Asp Asp Asp Leu Phe Ala 370 375 380Thr Ala Gly Val Ser Arg Arg Ile
Lys Val Phe Asp Phe Ser Ala Val385 390 395 400Val Asn Glu Pro Thr
Asp Ala His Cys Pro Val Val Glu Met Thr Thr 405 410 415Arg Ser Lys
Leu Ser Cys Leu
Ser Trp Asn Lys Tyr Ala Lys Asn Gln 420 425 430Ile Ala Ser Ser Asp
Tyr Glu Gly Ile Val Thr Val Trp Thr Met Thr 435 440 445Thr Arg Lys
Ser Leu Met Glu Tyr Glu Glu His Glu Lys Arg Ala Trp 450 455 460Ser
Val Asp Phe Ser Arg Thr Asp Pro Ser Met Leu Val Ser Gly Ser465 470
475 480Asp Asp Cys Lys Val Lys Val Trp Cys Thr Asn Gln Glu Ala Ser
Val 485 490 495Leu Asn Ile Asp Met Lys Ala Asn Ile Cys Cys Val Lys
Tyr Asn Pro 500 505 510Gly Ser Gly Asn Tyr Ile Ala Val Gly Ser Ala
Asp His His Ile His 515 520 525Tyr Tyr Asp Leu Arg Asn Ile Ser Arg
Pro Val His Val Phe Thr Gly 530 535 540His Lys Lys Ala Val Ser Tyr
Val Lys Phe Leu Ser Asn Asp Glu Leu545 550 555 560Ala Ser Ala Ser
Thr Asp Ser Thr Leu Arg Leu Trp Asp Val Lys Gln 565 570 575Asn Leu
Pro Val Arg Thr Phe Arg Gly His Ala Asn Glu Lys Asn Phe 580 585
590Val Gly Leu Thr Val Arg Ser Glu Tyr Ile Ala Cys Gly Ser Glu Thr
595 600 605Asn Glu Val Phe Val Tyr His Lys Glu Ile Ser Lys Pro Leu
Thr Trp 610 615 620His Arg Phe Gly Thr Leu Asp Met Glu Asp Ala Glu
Asp Glu Ala Gly625 630 635 640Ser Tyr Phe Ile Ser Ala Val Cys Trp
Lys Ser Asp Arg Pro Thr Ile 645 650 655Leu Thr Ala Asn Ser Gln Gly
Thr Ile Lys Val Leu Val Leu Ala Ala 660 665 67027660PRTMus musculus
27Val Ser Gly Ser Ala Ser Ala Gly Gly Ala Val Ser Ala Gly Gln Ser1
5 10 15Arg Leu Ser Cys Ala Ala Arg Pro Ser Ala Gly Val Gly Gly Ser
Ser 20 25 30Ser Ser Leu Gly Ser Ser Ser Arg Lys Arg Pro Leu Leu Val
Pro Leu 35 40 45Cys Asn Gly Leu Leu Asn Ser Tyr Glu Asp Lys Ser Asn
Asp Phe Val 50 55 60Cys Pro Ile Cys Phe Asp Met Ile Glu Glu Ala Tyr
Met Thr Lys Cys65 70 75 80Gly His Ser Phe Cys Tyr Lys Cys Ile His
Gln Ser Leu Glu Asp Asn 85 90 95Asn Arg Cys Pro Lys Cys Asn Tyr Val
Val Asp Asn Ile Asp His Leu 100 105 110Tyr Pro Asn Phe Leu Val Asn
Glu Leu Ile Leu Lys Gln Lys Gln Arg 115 120 125Phe Glu Glu Lys Arg
Phe Lys Leu Asp His Ser Val Ser Ser Thr Asn 130 135 140Gly His Arg
Trp Gln Ile Phe Gln Asp Leu Leu Gly Thr Asp Gln Asp145 150 155
160Asn Leu Asp Leu Ala Asn Val Asn Leu Met Leu Glu Leu Leu Val Gln
165 170 175Lys Lys Lys Gln Leu Glu Ala Glu Ser His Ala Ala Gln Leu
Gln Ile 180 185 190Leu Met Glu Phe Leu Lys Val Ala Arg Arg Asn Lys
Arg Glu Gln Leu 195 200 205Glu Gln Ile Gln Lys Glu Leu Ser Val Leu
Glu Glu Asp Ile Lys Arg 210 215 220Val Glu Glu Met Ser Gly Leu Tyr
Ser Pro Val Ser Glu Asp Ser Thr225 230 235 240Val Pro Gln Phe Glu
Ala Pro Ser Pro Ser His Ser Ser Ile Ile Asp 245 250 255Ser Thr Glu
Tyr Ser Gln Pro Pro Gly Phe Ser Gly Thr Ser Gln Thr 260 265 270Lys
Lys Gln Pro Trp Tyr Asn Ser Thr Leu Ala Ser Arg Arg Lys Arg 275 280
285Leu Thr Ala His Phe Glu Asp Leu Glu Gln Cys Tyr Phe Ser Thr Arg
290 295 300Met Ser Arg Ile Ser Asp Asp Ser Arg Thr Ala Ser Gln Leu
Asp Glu305 310 315 320Phe Gln Glu Cys Leu Ser Lys Phe Thr Arg Tyr
Asn Ser Val Arg Pro 325 330 335Leu Ala Thr Leu Ser Tyr Ala Ser Asp
Leu Tyr Asn Gly Ser Ser Ile 340 345 350Val Ser Ser Ile Glu Phe Asp
Arg Asp Cys Asp Tyr Phe Ala Ile Ala 355 360 365Gly Val Thr Lys Lys
Ile Lys Val Tyr Glu Tyr Gly Thr Val Ile Gln 370 375 380Asp Ala Val
Asp Ile His Tyr Pro Glu Asn Glu Met Thr Cys Asn Ser385 390 395
400Lys Ile Ser Cys Ile Ser Trp Ser Ser Tyr His Lys Asn Leu Leu Ala
405 410 415Ser Ser Asp Tyr Glu Gly Thr Val Ile Leu Trp Asp Gly Phe
Thr Gly 420 425 430Gln Arg Ser Lys Val Tyr Gln Glu His Glu Lys Arg
Cys Trp Ser Val 435 440 445Asp Phe Asn Leu Met Asp Pro Lys Leu Leu
Ala Ser Gly Ser Asp Asp 450 455 460Ala Lys Val Lys Leu Trp Ser Thr
Asn Leu Asp Asn Ser Val Ala Ser465 470 475 480Ile Glu Ala Lys Ala
Asn Val Cys Cys Val Lys Phe Ser Pro Ser Ser 485 490 495Arg Tyr His
Leu Ala Phe Gly Cys Ala Asp His Cys Val His Tyr Tyr 500 505 510Asp
Leu Arg Asn Thr Lys Gln Pro Ile Met Val Phe Lys Gly His Arg 515 520
525Lys Ala Val Ser Tyr Ala Lys Phe Val Ser Gly Glu Glu Ile Val Ser
530 535 540Ala Ser Thr Asp Ser Gln Leu Lys Leu Trp Asn Val Gly Lys
Pro Tyr545 550 555 560Cys Leu Arg Ser Phe Lys Gly His Ile Asn Glu
Lys Asn Phe Val Gly 565 570 575Leu Ala Ser Asn Gly Asp Tyr Ile Ala
Cys Gly Ser Glu Asn Asn Ser 580 585 590Leu Tyr Leu Tyr Tyr Lys Gly
Leu Ser Lys Thr Leu Leu Thr Phe Lys 595 600 605Phe Asp Thr Val Lys
Ser Val Leu Asp Lys Asp Arg Lys Glu Asp Asp 610 615 620Thr Asn Glu
Phe Val Ser Ala Val Cys Trp Arg Ala Leu Ser Asp Gly625 630 635
640Glu Ser Asn Val Leu Ile Ala Ala Asn Ser Gln Gly Thr Ile Lys Val
645 650 655Leu Glu Leu Val 660
* * * * *