U.S. patent application number 16/419940 was filed with the patent office on 2019-09-12 for human antibodies that bind lymphocyte activation gene-3 (lag-3), and uses thereof.
This patent application is currently assigned to E.R. Squibb & Sons, L.L.C.. The applicant listed for this patent is E.R. Squibb & Sons, L.L.C.. Invention is credited to Alan J. Korman, Heidi N. Leblanc, Mark J. Selby, Kent B. Thudium, Mark Yamanaka, Kyra D. Zens.
Application Number | 20190276539 16/419940 |
Document ID | / |
Family ID | 41669613 |
Filed Date | 2019-09-12 |
![](/patent/app/20190276539/US20190276539A1-20190912-C00001.png)
![](/patent/app/20190276539/US20190276539A1-20190912-D00001.png)
![](/patent/app/20190276539/US20190276539A1-20190912-D00002.png)
![](/patent/app/20190276539/US20190276539A1-20190912-D00003.png)
![](/patent/app/20190276539/US20190276539A1-20190912-D00004.png)
![](/patent/app/20190276539/US20190276539A1-20190912-D00005.png)
![](/patent/app/20190276539/US20190276539A1-20190912-D00006.png)
![](/patent/app/20190276539/US20190276539A1-20190912-D00007.png)
![](/patent/app/20190276539/US20190276539A1-20190912-D00008.png)
![](/patent/app/20190276539/US20190276539A1-20190912-D00009.png)
![](/patent/app/20190276539/US20190276539A1-20190912-D00010.png)
View All Diagrams
United States Patent
Application |
20190276539 |
Kind Code |
A1 |
Thudium; Kent B. ; et
al. |
September 12, 2019 |
HUMAN ANTIBODIES THAT BIND LYMPHOCYTE ACTIVATION GENE-3 (LAG-3),
AND USES THEREOF
Abstract
The present disclosure provides isolated monoclonal antibodies
that specifically bind to LAG-3 with high affinity, particularly
human monoclonal antibodies. Preferably, the antibodies bind human
LAG-3. In certain embodiments, the antibodies bind both human and
monkey LAG-3 but do not bind mouse LAG-3. The invention provides
anti-LAG-3 antibodies that can inhibit the binding of LAG-3 to MHC
Class II molecules and that can stimulate antigen-specific T cell
responses. Nucleic acid molecules encoding the antibodies of the
invention, expression vectors, host cells and methods for
expressing the antibodies of the invention are also provided.
Immunoconjugates, bispecific molecules and pharmaceutical
compositions comprising the antibodies of the invention are also
provided. This disclosure also provides methods for detecting
LAG-3, as well as methods for treating stimulating immune responses
using an anti-LAG-3 antibody of the invention. Combination therapy,
in which an anti-LAG-3 antibody is co-administered with at least
one additional immunostimulatory antibody, is also provided.
Inventors: |
Thudium; Kent B.; (Oakland,
CA) ; Selby; Mark J.; (San Francisco, CA) ;
Zens; Kyra D.; (San Mateo, CA) ; Yamanaka; Mark;
(Pleasanton, CA) ; Korman; Alan J.; (Piedmont,
CA) ; Leblanc; Heidi N.; (Mountain View, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
E.R. Squibb & Sons, L.L.C. |
Princeton |
NJ |
US |
|
|
Assignee: |
E.R. Squibb & Sons,
L.L.C.
Princeton
NJ
|
Family ID: |
41669613 |
Appl. No.: |
16/419940 |
Filed: |
May 22, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15730363 |
Oct 11, 2017 |
10344089 |
|
|
16419940 |
|
|
|
|
13058492 |
Feb 10, 2011 |
|
|
|
PCT/US2009/053405 |
Aug 11, 2009 |
|
|
|
15730363 |
|
|
|
|
61188548 |
Aug 11, 2008 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 2039/507 20130101;
A61P 31/18 20180101; C07K 2317/34 20130101; C07K 2317/21 20130101;
A61P 37/04 20180101; A61P 31/12 20180101; C07K 16/2827 20130101;
C07K 2317/73 20130101; A61K 2039/505 20130101; A61P 35/02 20180101;
A61P 37/00 20180101; C07K 2317/92 20130101; A61P 35/00 20180101;
C07K 2317/76 20130101; C07K 16/2803 20130101; A61P 43/00
20180101 |
International
Class: |
C07K 16/28 20060101
C07K016/28 |
Claims
1-62. (canceled)
63. A method for treating cancer in a subject comprising
administering to the subject an anti-LAG-3 antibody and an
anti-CTLA4 antibody.
64. The method of claim 63, wherein the anti-LAG-3 antibody
inhibits binding of LAG-3 to major histocompatibility (MHC) class
II molecules.
65. The method of claim 63, wherein the anti-LAG-3 antibody
stimulates interleukin-2 (IL-2) production in an antigen-specific T
cell response.
66. The method of claim 63, wherein the anti-LAG-3 antibody is a
human antibody.
67. The method of claim 63, wherein the anti-LAG-3 antibody is a
chimeric or humanized antibody.
68. The method of claim 63, wherein the anti-LAG-3 antibody and the
anti-CTLA4 antibody are comprised in a bispecific molecule.
69. The method of claim 63, wherein the anti-CTLA4 antibody is a
human antibody.
70. The method of claim 63, wherein the anti-CTLA4 antibody is a
chimeric or humanized antibody.
71. The method of claim 63, wherein the anti-LAG-3 antibody and the
anti-CTLA4 antibody are administered concurrently as separate
compositions with each antibody in a pharmaceutically acceptable
carrier.
72. The method of claim 63, wherein the anti-LAG-3 antibody and the
anti-CTLA4 antibody are administered concurrently in the same
composition.
73. The method of claim 63, wherein the anti-LAG-3 antibody and the
anti-CTLA4 antibody are administered sequentially.
74. The method of claim 63, further comprising administering a
chemotherapeutic agent.
75. The method of claim 63, further comprising administering an
angiogenesis inhibitor.
76. The method of claim 63, wherein the subject is a human.
77. A method for inhibiting growth of tumor cells in a subject
comprising administering to the subject an anti-LAG-3 antibody and
an anti-CTLA4 antibody.
78. The method of claim 77, wherein the anti-LAG-3 antibody is a
human antibody.
79. The method of claim 77, wherein the anti-CTLA4 antibody is a
human antibody.
80. The method of claim 77, further comprising administering a
chemotherapeutic agent.
81. The method of claim 77, further comprising administering an
angiogenesis inhibitor.
82. The method of claim 77, wherein the subject is a human.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is divisional of U.S. application Ser. No.
15/730,363, filed Oct. 11, 2017, which is a divisional of U.S.
application Ser. No. 13/058,492, 371(c) date Feb. 10, 2011, which
is the National Stage of international Application No.
PCT/US2009/053405, filed Aug. 11, 2009, which claims the benefit
under 35 U.S.C. .sctn. 119(e) of U.S. Provisional Application No.
61/188,548, filed Aug. 11, 2008; the disclosures of each of which
are incorporated herein by reference.
REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY VIA
EFS-WEB
[0002] The content of the electronically submitted sequence listing
(Name: 3338_0770004_Seqlisting_ST25.txt; Size: 50,533 bytes; and
Date of Creation: May 22, 2019) is herein incorporated by reference
in its entirety.
BACKGROUND OF THE INVENTION
[0003] Lymphocyte Activation Gene-3, or LAG-3 (also know as CD223),
is a member of the immunoglobulin supergene family and is
structurally and genetically related to CD4. LAG-3 is not expressed
on resting peripheral blood lymphocytes but is expressed on
activated T cells and NK cells. LAG-3 is a membrane protein encoded
by a gene located on the distal part of the short arm of chromosome
12, near the CD4 gene, suggesting that the LAG-3 gene may have
evolved through gene duplication (Triebel et al. (1990) J. Exp.
Med. 171:1393-1405).
[0004] Similar to CD4, LAG-3 has been demonstrated to interact with
MHC Class II molecules but, unlike CD4, LAG-3 does not interact
with the human immunodeficiency virus gp120 protein (Baixeras et
al. (1992) J. Exp. Med. 176:327-337). Studies using a soluble LAG-3
immunoglobulin fusion protein (sLAG-3Ig) demonstrated direct and
specific binding of LAG-3 to MHC class II on the cell surface
(Huard et al. (1996) Eur. J. Immunol. 26:1180-1186).
[0005] In in vitro studies of antigen-specific T cell responses,
the addition of anti-LAG-3 antibodies led to increased T cell
proliferation, higher expression of activation antigens such as
CD25, and higher concentrations of cytokines such as
interferon-gamma and interleukin-4, supporting a role for the
LAG-/MHC class II interaction in down-regulating antigen-dependent
stimulation of CD4.sup.+ T lymphocytes (Huard et al. (1994) Eur. J.
Immunol. 24:3216-3221). The intra-cytoplasmic region of LAG-3 has
been demonstrated to interact with a protein termed LAP, which is
thought to be a signal transduction molecule involved in the
downregulation of the CD3/TCR activation pathway (Iouzalen et al.
(2001) Eur. J. Immunol. 31:2885-2891). Furthermore,
CD4.sup.+CD25.sup.+ regulatory T cells (T.sub.reg) have been shown
to express LAG-3 upon activation and antibodies to LAG-3 inhibit
suppression by induced T.sub.reg cells, both in vitro and in vivo,
suggesting that LAG-3 contributes to the suppressor activity of
T.sub.reg cells (Huang, C. et al. (2004) Immunity 21:503-513).
Still further, LAG-3 has been shown to negatively regulate T cell
homeostasis by regulatory T cells in both T cell-dependent and
independent mechanisms (Workman, C. J. and Vignali, D. A. (2005) J.
Immunol. 174:688-695).
[0006] In certain circumstances, LAG-3 also has been shown to have
immunostimulatory effects. For example, LAG-3 transfected tumor
cells transplanted into syngeneic mice showed marked growth
reduction or complete regression as compared to untransfected tumor
cells, suggesting that LAG-3 expression on the tumor cells
stimulated an anti-tumor response by triggering antigen presenting
cells via MHC class II molecules (Prigent et al. (1999) Eur. J.
Immunol. 29:3867-3876). Additionally, soluble LAG-3 Ig fusion
protein has been shown to stimulate both humoral and cellular
immune responses when administered to mice together with an
antigen, indicating that soluble LAG-3Ig can function as a vaccine
adjuvant (El Mir and Triebel (2000) J. Immunol. 164:5583-5589).
Furthermore, soluble human LAG-3Ig has been shown to amplify the in
vitro generation of type I tumor-specific immunity (Casati et al.
(2006) Cancer Res. 66:4450-4460). The functional activity of LAG-3
is reviewed further in Triebel (2003) Trends Immunol. 24:619-622.
In view of the above, additional agents for modulating the activity
of LAG-3 are of interest.
SUMMARY
[0007] The present disclosure provides isolated monoclonal
antibodies, in particular human monoclonal antibodies, that
specifically bind LAG-3 and that have desirable functional
properties. These properties include high affinity binding to human
LAG-3, binding to human and monkey LAG-3 (e.g., cynomolgus and/or
rhesus monkey LAG-3) but not to mouse LAG-3, the ability to inhibit
binding of LAG-3 to major histocompatibility (MHC) Class II
molecules and/or the ability to stimulate antigen-specific T cell
responses. The antibodies of the invention can be used, for
example, to detect LAG-3 protein or to stimulate antigen-specific T
cell responses, such as in a tumor-bearing subject or a
virus-bearing subject.
[0008] In one aspect, the invention pertains to an isolated human
monoclonal antibody, or an antigen-binding portion thereof, wherein
the antibody binds human LAG-3 and exhibits at least one of the
following properties:
[0009] (a) binds monkey LAG-3;
[0010] (b) does not bind mouse LAG-3;
[0011] (c) inhibits binding of LAG-3 to major histocompatibility
(MHC) class II molecules; and
[0012] (d) stimulates an immune response.
Preferably, the antibody exhibits at least two of properties (a),
(b), (c) and (d). More preferably, the antibody exhibits at least
three of properties (a), (b), (c) and (d). Even more preferably,
the antibody exhibits all four of properties (a), (b), (c) and
(d).
[0013] In a preferred embodiment, the antibody stimulates an
antigen-specific T cell response, such as interleukin-2 (IL-2)
production in an antigen-specific T cell response. In other
embodiments, the antibody stimulates an immune response such as an
anti-tumor response (e.g., inhibits tumor growth in an in vivo
tumor graft model) or an autoimmune response (e.g., promotes the
development of diabetes in NOD mice). In another preferred
embodiment, the antibody binds an epitope of human LAG-3 comprising
the amino acid sequence PGHPLAPG (SEQ ID NO: 76). In yet another
preferred embodiment, the antibody binds an epitope of human LAG-3
comprising the amino acid sequence HPAAPSSW (SEQ ID NO: 77) or
PAAPSSWG (SEQ ID NO: 78). In still other embodiments, the antibody
binds to human LAG-3 with a K.sub.D of 1.times.10.sup.-7 M or less,
or binds to human LAG-3 with a K.sub.D of 1.times.10.sup.-8 M or
less, or binds to human LAG-3 with a K.sub.D of 5.times.10.sup.-9 M
or less, or binds to human LAG-3 with a K.sub.D of
1.times.10.sup.-9 M or less. In one embodiment, the antibody stains
pituitary tissue by immunohistochemistry, whereas in another
embodiment, the antibody does not stain pituitary tissue by
immunohistochemistry.
[0014] In another aspect, the invention pertains to an isolated
human monoclonal antibody, or antigen binding portion thereof,
wherein the antibody cross-competes for binding to human LAG-3 with
a reference antibody, wherein the reference antibody comprises:
[0015] (a) a heavy chain variable region comprising the amino acid
sequence of SEQ ID NO: 37 and a light chain variable region
comprising the amino acid sequence of SEQ ID NO: 43;
[0016] (b) a heavy chain variable region comprising the amino acid
sequence of SEQ ID NO: 38 and a light chain variable region
comprising the amino acid sequence of SEQ ID NO:
[0017] 44;
[0018] (c) a heavy chain variable region comprising the amino acid
sequence of SEQ ID NO: 39 and a light chain variable region
comprising the amino acid sequence of SEQ ID NO: 45;
[0019] (d) a heavy chain variable region comprising the amino acid
sequence of SEQ ID NO: 40 and a light chain variable region
comprising the amino acid sequence of SEQ ID NO: 46;
[0020] (e) a heavy chain variable region comprising the amino acid
sequence of SEQ ID NO: 41 and a light chain variable region
comprising the amino acid sequence of SEQ ID NO: 47; or
[0021] (f) a heavy chain variable region comprising the amino acid
sequence of SEQ ID NO: 42 and a light chain variable region
comprising the amino acid sequence of SEQ ID NO: 48.
[0022] In a preferred embodiment, the reference antibody comprises
a heavy chain variable region comprising the amino acid sequence of
SEQ ID NO: 37 and a light chain variable region comprising the
amino acid sequence of SEQ ID NO: 43. In another preferred
embodiment, the reference antibody comprises a heavy chain variable
region comprising the amino acid sequence of SEQ ID NO: 38 and a
light chain variable region comprising the amino acid sequence of
SEQ ID NO: 44. In another preferred embodiment, the reference
antibody comprises a heavy chain variable region comprising the
amino acid sequence of SEQ ID NO: 39 and a light chain variable
region comprising the amino acid sequence of SEQ ID NO: 45. In
another preferred embodiment, the reference antibody comprises a
heavy chain variable region comprising the amino acid sequence of
SEQ ID NO: 40 and a light chain variable region comprising the
amino acid sequence of SEQ ID NO: 46. In another preferred
embodiment, the reference antibody comprises a heavy chain variable
region comprising the amino acid sequence of SEQ ID NO: 41 and a
light chain variable region comprising the amino acid sequence of
SEQ ID NO: 47. In another preferred embodiment, the reference
antibody comprises a heavy chain variable region comprising the
amino acid sequence of SEQ ID NO: 42 and a light chain variable
region comprising the amino acid sequence of SEQ ID NO: 48.
[0023] In another aspect, the invention pertains to an isolated
monoclonal antibody, or an antigen-binding portion thereof,
comprising a heavy chain variable region that is the product of or
derived from a human V.sub.H 3-20 gene, a human V.sub.H 4-34 gene,
a human V.sub.H 3-33 gene or a human V.sub.H 1-24 gene, wherein the
antibody specifically binds human LAG-3. In another aspect, the
invention pertains to an isolated monoclonal antibody, or an
antigen-binding portion thereof, comprising a light chain variable
region that is the product of or derived from a human V.sub.K L18
gene, a human V.sub.K L6 gene or a human V.sub.K A27 gene, wherein
the antibody specifically binds human LAG-3. In a preferred
embodiment, the invention provides an isolated monoclonal antibody,
or an antigen-binding portion thereof, comprising:
[0024] (a) a heavy chain variable region that is the product of or
derived from a human V.sub.H 4-34 gene and a light chain variable
region that is the product of or derived from a human V.sub.K L6
gene;
[0025] (b) a heavy chain variable region that is the product of or
derived from a human V.sub.H 3-33 gene and a light chain variable
region that is the product of or derived from a human V.sub.K A27
gene;
[0026] (c) a heavy chain variable region that is the product of or
derived from a human V.sub.H 3-20 gene and a light chain variable
region that is the product of or derived from a human V.sub.K L18
gene;
[0027] (d) a heavy chain variable region that is the product of or
derived from a human V.sub.H 1-24 gene and a light chain variable
region that is the product of or derived from a human V.sub.K L6
gene; or
[0028] (e) a heavy chain variable region that is the product of or
derived from a human V.sub.H 3-33 gene and a light chain variable
region that is the product of or derived from a human V.sub.K L6
gene;
[0029] wherein the antibody specifically binds human LAG-3.
[0030] In another aspect, the invention pertains to an isolated
monoclonal antibody, or antigen binding portion thereof,
comprising:
[0031] (a) a heavy chain variable region comprising an amino acid
sequence selected from the group consisting of SEQ ID NOs:
37-42;
[0032] (b) a light chain variable region comprising an amino acid
sequence selected from the group consisting of SEQ ID NOs:
43-48;
[0033] wherein the antibody specifically binds human LAG-3.
[0034] A preferred combination comprises:
[0035] (a) a heavy chain variable region comprising the amino acid
sequence of SEQ ID NO: 37; and
[0036] (b) a light chain variable region comprising the amino acid
sequence of SEQ ID NO: 43.
[0037] Another preferred combination comprises:
[0038] (a) a heavy chain variable region comprising the amino acid
sequence of SEQ ID NO: 38; and
[0039] (b) a light chain variable region comprising the amino acid
sequence of SEQ ID NO: 44.
[0040] Another preferred combination comprises:
[0041] (a) a heavy chain variable region comprising the amino acid
sequence of SEQ ID NO: 39; and
[0042] (b) a light chain variable region comprising the amino acid
sequence of SEQ ID NO: 45.
[0043] Another preferred combination comprises:
[0044] (a) a heavy chain variable region comprising the amino acid
sequence of SEQ ID NO: 40; and
[0045] (b) a light chain variable region comprising the amino acid
sequence of SEQ ID NO: 46.
[0046] Another preferred combination comprises:
[0047] (a) a heavy chain variable region comprising the amino acid
sequence of SEQ ID NO: 41; and
[0048] (b) a light chain variable region comprising the amino acid
sequence of SEQ ID NO: 47.
[0049] Another preferred combination comprises:
[0050] (a) a heavy chain variable region comprising the amino acid
sequence of SEQ ID NO: 42; and
[0051] (b) a light chain variable region comprising the amino acid
sequence of SEQ ID NO: 48.
[0052] The antibodies of the invention can be, for example,
full-length antibodies, for example of an IgG1, IgG2 or IgG4
isotype. In a preferred embodiment, the antibody is an IgG4
isotype. In another preferred embodiment, the antibody is an IgG4
isotype having a serine to proline mutation in the heavy chain
constant region hinge region (at a position corresponding to
position 241 as described in Angal et al. (1993) Mol. Immunol.
30:105-108), such that inter-heavy chain disulfide bridge
heterogeneity is reduced or abolished. Alternatively, the
antibodies can be antibody fragments, such as Fab, Fab' or Fab'2
fragments, or single chain antibodies.
[0053] This disclosure also provides an immunoconjugate comprising
an antibody of the invention, or antigen-binding portion thereof,
linked to a therapeutic agent, e.g., a cytotoxin or a radioactive
isotope. This disclosure also provides a bispecific molecule
comprising an antibody, or antigen-binding portion thereof, of the
invention, linked to a second functional moiety having a different
binding specificity than said antibody, or antigen binding portion
thereof Compositions comprising an antibody, or antigen-binding
portion thereof, or immunoconjugate or bispecific molecule of the
invention and a pharmaceutically acceptable carrier are also
provided.
[0054] Nucleic acid molecules encoding the antibodies, or
antigen-binding portions thereof, of the invention are also
encompassed by this disclosure, as well as expression vectors
comprising such nucleic acids and host cells comprising such
expression vectors. Methods for preparing anti-LAG-3 antibodies
using the host cells comprising such expression vectors are also
provided and can include the steps of (i) expressing the antibody
in the host cell and (ii) isolating the antibody from the host
cell.
[0055] In another aspect, the invention pertains to methods of
stimulating immune responses using the anti-LAG-3 antibodies of the
invention. For example, in one embodiment, the invention provides a
method of stimulating an antigen-specific T cell response
comprising contacting said T cell with an antibody of the invention
such that an antigen-specific T cell response is stimulated. In a
preferred embodiment, interleukin-2 production by the
antigen-specific T cell is stimulated. In another embodiment, the
invention provides a method of stimulating an immune response
(e.g., an antigen-specific T cell response) in a subject comprising
administering an antibody of the invention to the subject such that
an immune response (e.g., an antigen-specific T cell response) in
the subject is stimulated. In a preferred embodiment, the subject
is a tumor-bearing subject and an immune response against the tumor
is stimulated. In another preferred embodiment, the subject is a
virus-bearing subject and an immune response against the virus is
stimulated.
[0056] In yet another aspect, the invention provides a method for
inhibiting growth of tumor cells in a subject comprising
administering to the subject an antibody of the invention such that
growth of the tumor is inhibited in the subject. In still another
aspect, the invention provides a method for treating viral
infection in a subject comprising administering to the subject an
antibody of the invention such that the viral infection is treated
in the subject.
[0057] In yet another aspect, the invention provides a method for
stimulating an immune response in a subject comprising
administering to the subject an anti-LAG-3 antibody and at least
one additional immunostimulatory antibody, such as an anti-PD-1
antibody, an anti-PD-L1 antibody and/or an anti-CTLA-4 antibody,
such that an immune response is stimulated in the subject, for
example to inhibit tumor growth or to stimulate an anti-viral
response. In one embodiment, the subject is administered an
anti-LAG-3 antibody and an anti-PD-1 antibody. In another
embodiment, the subject is administered an anti-LAG-3 antibody and
an anti-PD-L1 antibody. In yet another embodiment, the subject is
administered an anti-LAG-3 antibody and an anti-CTLA-4 antibody. In
one embodiment, the anti-LAG-3 antibody is a human antibody, such
as an antibody of the disclosure. Alternatively, the anti-LAG-3
antibody can be, for example, a chimeric or humanized antibody. In
another embodiment, the at least one additional immunostimulatory
antibody (e.g., anti-PD-1, anti-PD-L1 and/or anti-CTLA-4 antibody)
is a human antibody. Alternatively, the at least one additional
immunostimulatory antibody can be, for example, a chimeric or
humanized antibody.
[0058] In yet another aspect, the invention pertains to a method
for preparing an anti-LAG-3 antibody. The method comprises:
[0059] (a) providing: (i) a heavy chain variable region antibody
sequence comprising a CDR1 sequence selected from the group
consisting of SEQ ID NOs: 1-6, a CDR2 sequence selected from the
group consisting of SEQ ID NOs: 7-12, and/or a CDR3 sequence
selected from the group consisting of SEQ ID NOs: 13-14, GGY and
16-18; and/or (ii) a light chain variable region antibody sequence
comprising a CDR1 sequence selected from the group consisting of
SEQ ID NOs: 19-24, a CDR2 sequence selected from the group
consisting of SEQ ID NOs: 25-30, and/or a CDR3 sequence selected
from the group consisting of SEQ ID NOs: 31-36;
[0060] (b) altering at least one amino acid residue within the
heavy chain variable region antibody sequence and/or the light
chain variable region antibody sequence to create at least one
altered antibody sequence; and
[0061] (c) expressing the altered antibody sequence as a
protein.
[0062] Other features and advantages of the instant disclosure will
be apparent from the following detailed description and examples,
which should not be construed as limiting. The contents of all
references, Genbank entries, patents and published patent
applications cited throughout this application are expressly
incorporated herein by reference.
BRIEF DESCRIPTION OF THE DRAWINGS
[0063] FIG. 1A shows the nucleotide sequence (SEQ ID NO: 49) and
amino acid sequence (SEQ ID NO: 37) of the heavy chain variable
region of the 25F7 human monoclonal antibody. The CDR1 (SEQ ID NO:
1), CDR2 (SEQ ID NO: 7) and CDR3 (SEQ ID NO: 13) regions are
delineated and the V, D and J germline derivations are
indicated.
[0064] FIG. 1B shows the nucleotide sequence (SEQ ID NO: 55) and
amino acid sequence (SEQ ID NO: 43) of the kappa light chain
variable region of the 25F7 human monoclonal antibody. The CDR1
(SEQ ID NO: 19), CDR2 (SEQ ID NO: 25) and CDR3 (SEQ ID NO: 31)
regions are delineated and the V and J germline derivations are
indicated.
[0065] FIG. 2A shows the nucleotide sequence (SEQ ID NO: 50) and
amino acid sequence (SEQ ID NO: 38) of the heavy chain variable
region of the 26H10 human monoclonal antibody. The CDR1 (SEQ ID NO:
2), CDR2 (SEQ ID NO: 8) and CDR3 (SEQ ID NO: 14) regions are
delineated and the V, D and J germline derivations are
indicated.
[0066] FIG. 2B shows the nucleotide sequence (SEQ ID NO: 56) and
amino acid sequence (SEQ ID NO: 44) of the kappa light chain
variable region of the 26H10 human monoclonal antibody. The CDR1
(SEQ ID NO: 20), CDR2 (SEQ ID NO: 26) and CDR3 (SEQ ID NO: 32)
regions are delineated and the V and J germline derivations are
indicated.
[0067] FIG. 3A shows the nucleotide sequence (SEQ ID NO: 51) and
amino acid sequence (SEQ ID NO: 39) of the heavy chain variable
region of the 25E3 human monoclonal antibody. The CDR1 (SEQ ID NO:
3), CDR2 (SEQ ID NO: 9) and CDR3 regions are delineated and the V,
D and J germline derivations are indicated.
[0068] FIG. 3B shows the nucleotide sequence (SEQ ID NO: 57) and
amino acid sequence (SEQ ID NO: 45) of the kappa light chain
variable region of the 25E3 human monoclonal antibody. The CDR1
(SEQ ID NO: 21), CDR2 (SEQ ID NO: 27) and CDR3 (SEQ ID NO: 33)
regions are delineated and the V and J germline derivations are
indicated.
[0069] FIG. 4A shows the nucleotide sequence (SEQ ID NO: 52) and
amino acid sequence (SEQ ID NO: 40) of the heavy chain variable
region of the 8B7 human monoclonal antibody. The CDR1 (SEQ ID NO:
4), CDR2 (SEQ ID NO: 10) and CDR3 (SEQ ID NO: 16) regions are
delineated and the V, D and J germline derivations are
indicated.
[0070] FIG. 4B shows the nucleotide sequence (SEQ ID NO: 58) and
amino acid sequence (SEQ ID NO: 46) of the kappa light chain
variable region of the 8B7 human monoclonal antibody. The CDR1 (SEQ
ID NO: 22), CDR2 (SEQ ID NO: 28) and CDR3 (SEQ ID NO: 34) regions
are delineated and the V and J germline derivations are
indicated.
[0071] FIG. 5A shows the nucleotide sequence (SEQ ID NO: 53) and
amino acid sequence (SEQ ID NO: 41) of the heavy chain variable
region of the 11F2 human monoclonal antibody. The CDR1 (SEQ ID NO:
5), CDR2 (SEQ ID NO: 11) and CDR3 (SEQ ID NO: 17) regions are
delineated and the V, D and J germline derivations are
indicated.
[0072] FIG. 5B shows the nucleotide sequence (SEQ ID NO: 59) and
amino acid sequence (SEQ ID NO: 47) of the kappa light chain
variable region of the 11F2 human monoclonal antibody. The CDR1
(SEQ ID NO: 23), CDR2 (SEQ ID NO: 29) and CDR3 (SEQ ID NO: 35)
regions are delineated and the V and J germline derivations are
indicated.
[0073] FIG. 6A shows the nucleotide sequence (SEQ ID NO: 54) and
amino acid sequence (SEQ ID NO: 42) of the heavy chain variable
region of the 17E5 human monoclonal antibody. The CDR1 (SEQ ID NO:
6), CDR2 (SEQ ID NO: 12) and CDR3 (SEQ ID NO: 18) regions are
delineated and the V, D and J germline derivations are
indicated.
[0074] FIG. 6B shows the nucleotide sequence (SEQ ID NO: 60) and
amino acid sequence (SEQ ID NO: 48) of the kappa light chain
variable region of the 17E5 human monoclonal antibody. The CDR1
(SEQ ID NO: 24), CDR2 (SEQ ID NO: 30) and CDR3 (SEQ ID NO: 36)
regions are delineated and the V and J germline derivations are
indicated.
[0075] FIG. 7 shows the alignment of the amino acid sequence of the
heavy chain variable regions of 25F7 (SEQ ID NO: 37) with the human
germline V.sub.H 4-34 and JH5b amino acid sequences (SEQ ID NOS: 61
and 62, respectively).
[0076] FIG. 8 shows the alignment of the amino acid sequence of the
light chain variable region of 25F7 (SEQ ID NO: 43) with the human
germline V.sub.k L6 and JK2 amino acid sequences (SEQ ID NOS: 63
and 64, respectively).
[0077] FIG. 9 shows the alignment of the amino acid sequence of the
heavy chain variable regions of 26H10 (SEQ ID NO: 38) with the
human germline V.sub.H 3-33 and JH6B amino acid sequences (SEQ ID
NOS: 65 and 66, respectively).
[0078] FIG. 10 shows the alignment of the amino acid sequence of
the light chain variable region of 26H10 (SEQ ID NO: 44) with the
human germline V.sub.k A27 and JK3 amino acid sequences (SEQ ID NO:
67 and 68, respectively).
[0079] FIG. 11 shows the alignment of the amino acid sequence of
the heavy chain variable regions of 25E3 (SEQ ID NO: 39) with the
human germline V.sub.H 3-20 and JH4b amino acid sequences (SEQ ID
NOS: 69 and 70, respectively).
[0080] FIG. 12 shows the alignment of the amino acid sequence of
the light chain variable region of 25E3 (SEQ ID NO: 45) with the
human germline V.sub.k L18 and JK2 amino acid sequences (SEQ ID
NOS: 71 and 64, respectively).
[0081] FIG. 13 shows the alignment of the amino acid sequence of
the heavy chain variable regions of 8B7 (SEQ ID NO: 40) with the
human germline V.sub.H 4-34 and JH5b amino acid sequences (SEQ ID
NOS: 61 and 62, respectively).
[0082] FIG. 14 shows the alignment of the amino acid sequence of
the light chain variable region of 8B7 (SEQ ID NO: 46) with the
human germline V.sub.k L6 and JK4 amino acid sequences (SEQ ID NOS:
63 and 72, respectively).
[0083] FIG. 15 shows the alignment of the amino acid sequence of
the heavy chain variable regions of 11F2 (SEQ ID NO: 41) with the
human germline V.sub.H 1-24 and JH4b amino acid sequences (SEQ ID
NOS: 73 and 70, respectively).
[0084] FIG. 16 shows the alignment of the amino acid sequence of
the light chain variable region of 11F2 (SEQ ID NO: 47) with the
human germline V.sub.k L6 and JK1 amino acid sequences (SEQ ID NOS:
63 and 74, respectively).
[0085] FIG. 17 shows the alignment of the amino acid sequence of
the heavy chain variable regions of 17E5 (SEQ ID NO: 42) with the
human germline V.sub.H 3-33 and 2-2 amino acid sequences (SEQ ID
NOS: 65 and 70, respectively).
[0086] FIG. 18 shows the alignment of the amino acid sequence of
the light chain variable region of 17E5 (SEQ ID NO: 48) with the
human germline V.sub.k L6 amino acid sequence (SEQ ID NOS: 63 and
75, respectively).
[0087] FIGS. 19A and B show the alignment of the protein sequence
encoded by the monkey LAG-3 cDNA clone pa23-5 (SEQ ID NO: 93) with
the Genbank deposited rhesus monkey LAG-3 protein sequence (SEQ ID
NO: 94) (Genbank Accession No. XM_001108923). The extra loop
peptide region and transmembrane domain are underlined. The one
amino acid difference between the two sequences (amino acid
position 419) is highlighted in bold.
DETAILED DESCRIPTION OF THE INVENTION
[0088] The present disclosure relates to isolated monoclonal
antibodies, particularly human monoclonal antibodies, which bind to
human LAG-3 and that have desirable functional properties. In
certain embodiments, the antibodies of the invention are derived
from particular heavy and light chain germline sequences and/or
comprise particular structural features such as CDR regions
comprising particular amino acid sequences. This disclosure
provides isolated antibodies, methods of making such antibodies,
immunoconjugates and bispecific molecules comprising such
antibodies and pharmaceutical compositions containing the
antibodies, immunoconjugates or bispecific molecules of the
invention. This disclosure also relates to methods of using the
antibodies, such as to detect LAG-3 protein, as well as to methods
of using the anti-LAG-3 antibodies of the invention to stimulate
immune responses, alone or in combination with other
immunostimulatory antibodies. Accordingly, this disclosure also
provides methods of using the anti-LAG-3 antibodies of the
invention to, for example, inhibit tumor growth or treat viral
infection.
[0089] In order that the present disclosure may be more readily
understood, certain terms are first defined. Additional definitions
are set forth throughout the detailed description.
[0090] The term "LAG-3" refers to Lymphocyte Activation Gene-3. The
term "LAG-3" includes variants, isoforms, homologs, orthologs and
paralogs. For example, antibodies specific for a human LAG-3
protein may, in certain cases, cross-react with a LAG-3 protein
from a species other than human. In other embodiments, the
antibodies specific for a human LAG-3 protein may be completely
specific for the human LAG-3 protein and may not exhibit species or
other types of cross-reactivity, or may cross-react with LAG-3 from
certain other species but not all other species (e.g., cross-react
with monkey LAG-3 but not mouse LAG-3). The term "human LAG-3"
refers to human sequence LAG-3, such as the complete amino acid
sequence of human LAG-3 having Genbank Accession No. NP_002277. The
term "mouse LAG-3" refers to mouse sequence LAG-3, such as the
complete amino acid sequence of mouse LAG-3 having Genbank
Accession No. NP_032505. LAG-3 is also known in the art as, for
example, CD223. The human LAG-3 sequence may differ from human
LAG-3 of Genbank Accession No. NP_002277 by having, e.g., conserved
mutations or mutations in non-conserved regions and the LAG-3 has
substantially the same biological function as the human LAG-3 of
Genbank Accession No. NP_002277. For example, a biological function
of human LAG-3 is having an epitope in the extracellular domain of
LAG-3 that is specifically bound by an antibody of the instant
disclosure or a biological function of human LAG-3 is binding to
MHC Class II molecules.
[0091] The term "monkey LAG-3" is intended to encompass LAG-3
proteins expressed by Old World and New World monkeys, including
but not limited to cynomolgus monkey LAG-3 and rhesus monkey LAG-3.
A representative amino acid sequence for monkey LAG-3 is the rhesus
monkey LAG-3 amino acid sequence shown in FIG. 19 and SEQ ID NO:
85, which is also deposited as Genbank Accession No. XM_001108923.
Another representative amino acid sequence for monkey LAG-3 is the
alternative rhesus monkey sequence of clone pa23-5 shown in FIG. 19
and SEQ ID NO: 84, isolated as described in Example 3A, subsection
3. This alternative rhesus sequence exhibits a single amino acid
difference, at position 419, as compared to the Genbank-deposited
sequence.
[0092] A particular human LAG-3 sequence will generally be at least
90% identical in amino acids sequence to human LAG-3 of Genbank
Accession No. NP_002277 and contains amino acid residues that
identify the amino acid sequence as being human when compared to
LAG-3 amino acid sequences of other species (e.g., murine). In
certain cases, a human LAG-3 can be at least 95%, or even at least
96%, 97%, 98%, or 99% identical in amino acid sequence to LAG-3 of
Genbank Accession No. NP_002277. In certain embodiments, a human
LAG-3 sequence will display no more than 10 amino acid differences
from the LAG-3 sequence of Genbank Accession No. NP_002277. In
certain embodiments, the human LAG-3 can display no more than 5, or
even no more than 4, 3, 2, or 1 amino acid difference from the
LAG-3 sequence of Genbank Accession No. NP_002277. Percent identity
can be determined as described herein.
[0093] The term "immune response" refers to the action of, for
example, lymphocytes, antigen presenting cells, phagocytic cells,
granulocytes, and soluble macromolecules produced by the above
cells or the liver (including antibodies, cytokines, and
complement) that results in selective damage to, destruction of, or
elimination from the human body of invading pathogens, cells or
tissues infected with pathogens, cancerous cells, or, in cases of
autoimmunity or pathological inflammation, normal human cells or
tissues.
[0094] An "antigen-specific T cell response" refers to responses by
a T cell that result from stimulation of the T cell with the
antigen for which the T cell is specific. Non-limiting examples of
responses by a T cell upon antigen-specific stimulation include
proliferation and cytokine production (e.g., IL-2 production).
[0095] The term "antibody" as referred to herein includes whole
antibodies and any antigen binding fragment (i.e., "antigen-binding
portion") or single chains thereof Whole antibodies are
glycoproteins comprising at least two heavy (H) chains and two
light (L) chains inter-connected by disulfide bonds. Each heavy
chain is comprised of a heavy chain variable region (abbreviated
herein as V.sub.H) and a heavy chain constant region. The heavy
chain constant region is comprised of three domains, C.sub.H1,
C.sub.H2 and C.sub.H3. Each light chain is comprised of a light
chain variable region (abbreviated herein as V.sub.L) and a light
chain constant region. The light chain constant region is comprised
of one domain, C.sub.L. The V.sub.H and V.sub.L regions can be
further subdivided into regions of hypervariability, termed
complementarity determining regions (CDR), interspersed with
regions that are more conserved, termed framework regions (FR).
Each V.sub.H and V.sub.L is composed of three CDRs and four FRs,
arranged from amino-terminus to carboxy-terminus in the following
order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions
of the heavy and light chains contain a binding domain that
interacts with an antigen. The constant regions of the antibodies
can mediate the binding of the immunoglobulin to host tissues or
factors, including various cells of the immune system (e.g.,
effector cells) and the first component (Clq) of the classical
complement system.
[0096] The term "antigen-binding portion" of an antibody (or simply
"antibody portion"), as used herein, refers to one or more
fragments of an antibody that retain the ability to specifically
bind to an antigen (e.g., a LAG-3 protein). It has been shown that
the antigen-binding function of an antibody can be performed by
fragments of a full-length antibody. Examples of binding fragments
encompassed within the term "antigen-binding portion" of an
antibody include (i) a Fab fragment, a monovalent fragment
consisting of the V.sub.L, V.sub.H, C.sub.L and C.sub.H1 domains;
(ii) a F(ab').sub.2 fragment, a bivalent fragment comprising two
Fab fragments linked by a disulfide bridge at the hinge region;
(iii) a Fab' fragment, which is essentially an Fab with part of the
hinge region (see, FUNDAMENTAL IMMUNOLOGY (Paul ed., 3.sup.rd ed.
1993); (iv) a Fd fragment consisting of the V.sub.H and C.sub.H1
domains; (v) a Fv fragment consisting of the V.sub.L and V.sub.H
domains of a single arm of an antibody, (vi) a dAb fragment (Ward
et al., (1989) Nature 341:544-546), which consists of a V.sub.H
domain; (vii) an isolated complementarity determining region (CDR);
and (viii) a nanobody, a heavy chain variable region containing a
single variable domain and two constant domains. Furthermore,
although the two domains of the Fv fragment, V.sub.L and V.sub.H,
are coded for by separate genes, they can be joined, using
recombinant methods, by a synthetic linker that enables them to be
made as a single protein chain in which the V.sub.L and V.sub.H
regions pair to form monovalent molecules (known as single chain Fv
(scFv); see e.g., Bird et al. (1988) Science 242:423-426; and
Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883). Such
single chain antibodies are also intended to be encompassed within
the term "antigen-binding portion" of an antibody. These antibody
fragments are obtained using conventional techniques known to those
with skill in the art, and the fragments are screened for utility
in the same manner as are intact antibodies.
[0097] An "isolated antibody", as used herein, is intended to refer
to an antibody that is substantially free of other antibodies
having different antigenic specificities (e.g., an isolated
antibody that specifically binds a LAG-3 protein is substantially
free of antibodies that specifically bind antigens other than LAG-3
proteins). An isolated antibody that specifically binds a human
LAG-3 protein may, however, have cross-reactivity to other
antigens, such as LAG-3 proteins from other species. Moreover, an
isolated antibody can be substantially free of other cellular
material and/or chemicals. The terms "monoclonal antibody" or
"monoclonal antibody composition" as used herein refer to a
preparation of antibody molecules of single molecular composition.
A monoclonal antibody composition displays a single binding
specificity and affinity for a particular epitope.
[0098] The term "human antibody", as used herein, is intended to
include antibodies having variable regions in which both the
framework and CDR regions are derived from human germline
immunoglobulin sequences. Furthermore, if the antibody contains a
constant region, the constant region also is derived from human
germline immunoglobulin sequences. The human antibodies of the
invention can include amino acid residues not encoded by human
germline immunoglobulin sequences (e.g., mutations introduced by
random or site-specific mutagenesis in vitro or by somatic mutation
in vivo). However, the term "human antibody", as used herein, is
not intended to include antibodies in which CDR sequences derived
from the germline of another mammalian species, such as a mouse,
have been grafted onto human framework sequences.
[0099] The term "human monoclonal antibody" refers to antibodies
displaying a single binding specificity, which have variable
regions in which both the framework and CDR regions are derived
from human germline immunoglobulin sequences. In one embodiment,
the human monoclonal antibodies are produced by a hybridoma which
includes a B cell obtained from a transgenic nonhuman animal, e.g.,
a transgenic mouse, having a genome comprising a human heavy chain
transgene and a light chain transgene fused to an immortalized
cell.
[0100] The term "recombinant human antibody", as used herein,
includes all human antibodies that are prepared, expressed, created
or isolated by recombinant means, such as (a) antibodies isolated
from an animal (e.g., a mouse) that is transgenic or
transchromosomal for human immunoglobulin genes or a hybridoma
prepared therefrom (described further below), (b) antibodies
isolated from a host cell transformed to express the human
antibody, e.g., from a transfectoma, (c) antibodies isolated from a
recombinant, combinatorial human antibody library, and (d)
antibodies prepared, expressed, created or isolated by any other
means that involve splicing of human immunoglobulin gene sequences
to other DNA sequences. Such recombinant human antibodies have
variable regions in which the framework and CDR regions are derived
from human germline immunoglobulin sequences. In certain
embodiments, however, such recombinant human antibodies can be
subjected to in vitro mutagenesis (or, when an animal transgenic
for human Ig sequences is used, in vivo somatic mutagenesis) and
thus the amino acid sequences of the V.sub.H and V.sub.L regions of
the recombinant antibodies are sequences that, while derived from
and related to human germline V.sub.H and V.sub.L sequences, may
not naturally exist within the human antibody germline repertoire
in vivo.
[0101] The term "isotype" refers to the antibody class (e.g., IgM
or IgG1) that is encoded by the heavy chain constant region
genes.
[0102] The phrases "an antibody recognizing an antigen" and "an
antibody specific for an antigen" are used interchangeably herein
with the term "an antibody which binds specifically to an
antigen."
[0103] The term "human antibody derivatives" refers to any modified
form of the human antibody, e.g., a conjugate of the antibody and
another agent or antibody.
[0104] The term "humanized antibody" is intended to refer to
antibodies in which CDR sequences derived from the germline of
another mammalian species, such as a mouse, have been grafted onto
human framework sequences. Additional framework region
modifications can be made within the human framework sequences.
[0105] The term "chimeric antibody" is intended to refer to
antibodies in which the variable region sequences are derived from
one species and the constant region sequences are derived from
another species, such as an antibody in which the variable region
sequences are derived from a mouse antibody and the constant region
sequences are derived from a human antibody.
[0106] As used herein, an antibody that "specifically binds human
LAG-3" is intended to refer to an antibody that binds to human
LAG-3 protein (and possibly a LAG-3 protein from one or more
non-human species) but does not substantially bind to non-LAG-3
proteins. Preferably, the antibody binds to a human LAG-3 protein
with "high affinity", namely with a K.sub.D of 1.times.10.sup.-7 M
or less, more preferably 5.times.10.sup.-8 M or less, more
preferably 3.times.10.sup.-8 M or less, more preferably
1.times.10.sup.-8 M or less, more preferably 5.times.10.sup.-9 M or
less or even more preferably 1.times.10.sup.-9 M or less.
[0107] The term "does not substantially bind" to a protein or
cells, as used herein, means does not bind or does not bind with a
high affinity to the protein or cells, i.e. binds to the protein or
cells with a K.sub.D of 1.times.10.sup.-6 M or more, more
preferably 1.times.10.sup.-5 M or more, more preferably
1.times.10.sup.4 M or more, more preferably 1.times.10.sup.-3 M or
more, even more preferably 1.times.10.sup.-2 M or more.
[0108] The term "K.sub.assoc" or "K.sub.a", as used herein, is
intended to refer to the association rate of a particular
antibody-antigen interaction, whereas the term "K.sub.dis" or
"K.sub.d," as used herein, is intended to refer to the dissociation
rate of a particular antibody-antigen interaction. The term
"K.sub.D," as used herein, is intended to refer to the dissociation
constant, which is obtained from the ratio of K.sub.d to K.sub.a
(i.e., K.sub.d/K.sub.a) and is expressed as a molar concentration
(M). K.sub.D values for antibodies can be determined using methods
well established in the art. A preferred method for determining the
K.sub.D of an antibody is by using surface plasmon resonance,
preferably using a biosensor system such as a Biacore.RTM.
system.
[0109] The term "high affinity" for an IgG antibody refers to an
antibody having a K.sub.D of 1.times.10.sup.-7 M or less, more
preferably 5.times.10.sup.-8 M or less, even more preferably
1.times.10.sup.-8 M or less, even more preferably 5.times.10.sup.-9
M or less and even more preferably 1.times.10.sup.-9 M or less for
a target antigen. However, "high affinity" binding can vary for
other antibody isotypes. For example, "high affinity" binding for
an IgM isotype refers to an antibody having a K.sub.D of 10.sup.-6
M or less, more preferably 10.sup.-7 M or less, even more
preferably 10.sup.-8 M or less.
[0110] The term "subject" includes any human or nonhuman animal.
The term "nonhuman animal" includes all vertebrates, e.g., mammals
and non-mammals, such as non-human primates, sheep, dogs, cats,
cows, horses, chickens, amphibians, and reptiles, although mammals
are preferred, such as non-human primates, sheep, dogs, cats, cows
and horses.
[0111] Various aspects of the invention are described in further
detail in the following subsections.
Anti-LAG-3 Antibodies Having Particular Functional Properties
[0112] The antibodies of the invention are characterized by
particular functional features or properties of the antibodies. For
example, the antibodies specifically bind to human LAG-3 and may
bind to LAG-3 from certain other species, e.g., monkey LAG-3 (e.g.,
cynomolgus monkey, rhesus monkey), but do not substantially bind to
LAG-3 from certain other species, e.g., mouse LAG-3. Preferably, an
antibody of the invention binds to human LAG-3 with high
affinity.
[0113] The ability of the antibody to stimulate an immune response,
such as an antigen-specific T cell response, can be indicated by,
for example, the ability of the antibody to stimulate interleukin-2
(IL-2) production in an antigen-specific T cell response. In
certain embodiments, an antibody of the invention binds to human
LAG-3 and exhibits an ability to stimulate an antigen-specific T
cell response. In other embodiments, an antibody of the invention
binds to human LAG-3 but does not exhibit an ability to stimulate
an antigen-specific T cell response. Other means by which to
evaluate the ability of the antibody to stimulate an immune
response include the ability of the antibody to inhibit tumor
growth, such as in an in vivo tumor graft model (see, e.g., Example
6) or the ability of the antibody to stimulate an autoimmune
response, such as the ability to promote the development of an
autoimmune disease in an autoimmune model, such as the ability to
promote the development of diabetes in the NOD mouse model (see,
e.g., Example 7).
[0114] The binding of an antibody of the invention to LAG-3 can be
assessed using one ore more techniques well established in the art.
For example, in a preferred embodiment, an antibody can be tested
by a flow cytometry assay in which the antibody is reacted with a
cell line that expresses human LAG-3, such as CHO cells that have
been transfected to express LAG-3 (e.g., human LAG-3, or monkey
LAG-3 (e.g., rhesus or cynomolgus monkey) or mouse LAG-3) on their
cell surface (see, e.g., Example 3A for a suitable assay). Other
suitable cells for use in flow cytometry assays include
anti-CD3-stimulated CD4.sup.+ activated T cells, which express
native LAG-3. Additionally or alternatively, the binding of the
antibody, including the binding kinetics (e.g., K.sub.D value) can
be tested in BIAcore binding assays (see, e.g., Example 3B for
suitable assays). Still other suitable binding assays include ELISA
assays, for example using a recombinant LAG-3 protein (see, e.g.,
Example 1 for a suitable assay).
[0115] Preferably, an antibody of the invention binds to a LAG-3
protein with a K.sub.D of 5.times.10.sup.-8 M or less, binds to a
LAG-3 protein with a K.sub.D of 2.times.10.sup.-8 M or less, binds
to a LAG-3 protein with a K.sub.D of 5.times.10.sup.-9 M or less,
binds to a LAG-3 protein with a K.sub.D of 4.times.10.sup.-9 M or
less, binds to a LAG-3 protein with a K.sub.D of 3.times.10.sup.-9
M or less, binds to a LAG-3 protein with a K.sub.D of
2.times.10.sup.-9 M or less, binds to a LAG-3 protein with a
K.sub.D of 1.times.10.sup.-9 M or less, binds to a LAG-3 protein
with a K.sub.D of 5.times.10.sup.-10 M or less, or binds to a LAG-3
protein with a K.sub.D of 1.times.10.sup.-10 M or less.
[0116] Typically, an antibody of the invention binds to LAG-3 in
lymphoid tissues, such as tonsil, spleen or thymus, which can be
detected by immunohistochemistry. Additionally, as described
further in Example 8, certain anti-LAG-3 antibodies of the
invention stain pituitary tissue (e.g., are retained in the
pituitary) as measured by immunohistochemistry, whereas other
anti-LAG-3 antibodies of the invention do not stain pituitary
tissue (e.g., are not retained in the pituitary) as measured by
immunohistochemistry. Thus, in one embodiment, the invention
provides a human anti-LAG-3 antibody that stains pituitary tissue
by immunohistochemistry, whereas in another embodiment, the
invention provides a human anti-LAG-3 antibody that does not stain
pituitary tissue by immunohistochemistry.
[0117] Preferred antibodies of the invention are human monoclonal
antibodies. Additionally or alternatively, the antibodies can be,
for example, chimeric or humanized monoclonal antibodies.
Monoclonal Antibodies 25F7, 26H10, 25E3, 8B7, 11F2 and 17E5
[0118] Preferred antibodies of the invention are the human
monoclonal antibodies 25F7, 26H10, 25E3, 8B7, 11F2 and 17E5
isolated and structurally characterized as described in Examples 1
and 2. The V.sub.H amino acid sequences of 25F7, 26H10, 25E3, 8B7,
11F2 and 17E5 are shown in SEQ ID NOs: 37-42, respectively. The
V.sub.K amino acid sequences of 25F7, 26H10, 25E3, 8B7, 11F2 and
17E5 are shown in SEQ ID NOs: 43-48, respectively.
[0119] Given that each of these antibodies can bind to human LAG-3,
the V.sub.H and V.sub.L sequences can be "mixed and matched" to
create other anti-LAG-3 binding molecules of the invention.
Preferably, when V.sub.H and V.sub.L chains are mixed and matched,
a V.sub.H sequence from a particular V.sub.H/V.sub.L pairing is
replaced with a structurally similar V.sub.H sequence. Likewise,
preferably a V.sub.L sequence from a particular V.sub.H/V.sub.L
pairing is replaced with a structurally similar V.sub.L
sequence.
[0120] Accordingly, in one aspect, this disclosure provides an
isolated monoclonal antibody, or antigen binding portion thereof
comprising:
[0121] (a) a heavy chain variable region comprising an amino acid
sequence selected from the group consisting of SEQ ID NOs: 37-42;
and
[0122] (b) a light chain variable region comprising an amino acid
sequence selected from the group consisting of SEQ ID NOs:
43-48;
[0123] wherein the antibody specifically binds human LAG-3.
Preferred heavy and light chain combinations include:
[0124] (a) a heavy chain variable region comprising the amino acid
sequence of SEQ ID NO: 37 and a light chain variable region
comprising the amino acid sequence of SEQ ID NO: 43;
[0125] (b) a heavy chain variable region comprising the amino acid
sequence of SEQ ID NO: 38 and a light chain variable region
comprising the amino acid sequence of SEQ ID NO: 44;
[0126] (c) a heavy chain variable region comprising the amino acid
sequence of SEQ ID NO: 39 and a light chain variable region
comprising the amino acid sequence of SEQ ID NO: 45;
[0127] (d) a heavy chain variable region comprising the amino acid
sequence of SEQ ID NO: 40 and a light chain variable region
comprising the amino acid sequence of SEQ ID NO: 46;
[0128] (e) a heavy chain variable region comprising the amino acid
sequence of SEQ ID NO: 41 and a light chain variable region
comprising the amino acid sequence of SEQ ID NO: 47; or
[0129] (f) a heavy chain variable region comprising the amino acid
sequence of SEQ ID NO: 42 and a light chain variable region
comprising the amino acid sequence of SEQ ID NO: 48.
[0130] In another aspect, this disclosure provides antibodies that
comprise the heavy chain and light chain CDR1s, CDR2s and CDR3s of
25F7, 26H10, 25E3, 8B7, 11F2 or 17E5, or combinations thereof. The
amino acid sequences of the V.sub.H CDR1s of 25F7, 26H10, 25E3,
8B7, 11F2 and 17E5 are shown in SEQ ID NOs: 37-42, respectively.
The amino acid sequences of the V.sub.H CDR2s of 25F7, 26H10, 25E3,
8B7, 11F2 and 17E5 are shown in SEQ ID NOs: 43-48, respectively.
The amino acid sequences of the V.sub.H CDR3s of 25F7, 26H10, 25E3,
8B7, 11F2 and 17E5 are shown in SEQ ID NOs: 13-14, GGY and 16-18,
respectively. The amino acid sequences of the V.sub.K CDR1s of
25F7, 26H10, 25E3, 8B7, 11F2 and 17E5 are shown in SEQ ID NOs:
19-24 respectively. The amino acid sequences of the V.sub.K CDR2s
of 25F7, 26H10, 25E3, 8B7, 11F2 and 17E5 are shown in SEQ ID NOs:
25-30. The amino acid sequences of the V.sub.K CDR3s of 25F7,
26H10, 25E3, 8B7, 11F2 and 17E5 are shown in SEQ ID NOs: 31-36,
respectively. The CDR regions are delineated using the Kabat system
(Kabat et al. (1991) Sequences of Proteins of Immunological
Interest, Fifth Edition, U.S. Department of Health and Human
Services, NIH Publication No. 91-3242).
[0131] Given that each of these antibodies can bind to human LAG-3
and that antigen-binding specificity is provided primarily by the
CDR1, CDR2, and CDR3 regions, the V.sub.H CDR1, CDR2, and CDR3
sequences and V.sub.L CDR1, CDR2, and CDR3 sequences can be "mixed
and matched" (i.e., CDRs from different antibodies can be mixed and
match, although each antibody must contain a V.sub.H CDR1, CDR2,
and CDR3 and a V.sub.L CDR1, CDR2, and CDR3) to create other
anti-LAG-3 binding molecules of the invention. LAG-3 binding of
such "mixed and matched" antibodies can be tested using the binding
assays described above and in the Examples (e.g., ELISAs,
Biacore.RTM. analysis). Preferably, when V.sub.H CDR sequences are
mixed and matched, the CDR1, CDR2 and/or CDR3 sequence from a
particular V.sub.H sequence is replaced with a structurally similar
CDR sequence(s). Likewise, when V.sub.L CDR sequences are mixed and
matched, the CDR1, CDR2 and/or CDR3 sequence from a particular
V.sub.L sequence preferably is replaced with a structurally similar
CDR sequence(s). It will be readily apparent to the ordinarily
skilled artisan that novel V.sub.H and V.sub.L sequences can be
created by substituting one or more V.sub.H and/or V.sub.L CDR
region sequences with structurally similar sequences from the CDR
sequences disclosed herein for monoclonal antibodies 25F7, 26H10,
25E3, 8B7, 11F2 and 17E5.
[0132] Accordingly, in another aspect, this disclosure provides an
isolated monoclonal antibody, or antigen binding portion thereof
comprising:
[0133] (a) a heavy chain variable region CDR1 comprising an amino
acid sequence selected from the group consisting of SEQ ID NOs:
1-6;
[0134] (b) a heavy chain variable region CDR2 comprising an amino
acid sequence selected from the group consisting of SEQ ID NOs:
7-12;
[0135] (c) a heavy chain variable region CDR3 comprising an amino
acid sequence selected from the group consisting of SEQ ID NOs:
13-14, GGY and 16-18;
[0136] (d) a light chain variable region CDR1 comprising an amino
acid sequence selected from the group consisting of SEQ ID NOs:
19-24;
[0137] (e) a light chain variable region CDR2 comprising an amino
acid sequence selected from the group consisting of SEQ ID NOs:
25-30; and
[0138] (f) a light chain variable region CDR3 comprising an amino
acid sequence selected from the group consisting of SEQ ID NOs:
31-36;
[0139] wherein the antibody specifically binds human LAG-3.
In a preferred embodiment, the antibody comprises:
[0140] (a) a heavy chain variable region CDR1 comprising SEQ ID NO:
1;
[0141] (b) a heavy chain variable region CDR2 comprising SEQ ID NO:
7;
[0142] (c) a heavy chain variable region CDR3 comprising SEQ ID NO:
13;
[0143] (d) a light chain variable region CDR1 comprising SEQ ID NO:
19;
[0144] (e) a light chain variable region CDR2 comprising SEQ ID NO:
25; and
[0145] (f) a light chain variable region CDR3 comprising SEQ ID NO:
31.
[0146] In another preferred embodiment, the antibody comprises:
[0147] (a) a heavy chain variable region CDR1 comprising SEQ ID NO:
2;
[0148] (b) a heavy chain variable region CDR2 comprising SEQ ID NO:
8;
[0149] (c) a heavy chain variable region CDR3 comprising SEQ ID NO:
14;
[0150] (d) a light chain variable region CDR1 comprising SEQ ID NO:
20;
[0151] (e) a light chain variable region CDR2 comprising SEQ ID NO:
26; and
[0152] (f) a light chain variable region CDR3 comprising SEQ ID NO:
32.
In another preferred embodiment, the antibody comprises:
[0153] (a) a heavy chain variable region CDR1 comprising SEQ ID NO:
3;
[0154] (b) a heavy chain variable region CDR2 comprising SEQ ID NO:
9;
[0155] (c) a heavy chain variable region CDR3 comprising GGY;
[0156] (d) a light chain variable region CDR1 comprising SEQ ID NO:
21;
[0157] (e) a light chain variable region CDR2 comprising SEQ ID NO:
27; and
[0158] (f) a light chain variable region CDR3 comprising SEQ ID NO:
33.
In another preferred embodiment, the antibody comprises:
[0159] (a) a heavy chain variable region CDR1 comprising SEQ ID NO:
4;
[0160] (b) a heavy chain variable region CDR2 comprising SEQ ID NO:
10;
[0161] (c) a heavy chain variable region CDR3 comprising SEQ ID NO:
16;
[0162] (d) a light chain variable region CDR1 comprising SEQ ID NO:
22;
[0163] (e) a light chain variable region CDR2 comprising SEQ ID NO:
28; and
[0164] (f) a light chain variable region CDR3 comprising SEQ ID NO:
34.
In another preferred embodiment, the antibody comprises:
[0165] (a) a heavy chain variable region CDR1 comprising SEQ ID NO:
5;
[0166] (b) a heavy chain variable region CDR2 comprising SEQ ID NO:
11;
[0167] (c) a heavy chain variable region CDR3 comprising SEQ ID NO:
17;
[0168] (d) a light chain variable region CDR1 comprising SEQ ID NO:
23;
[0169] (e) a light chain variable region CDR2 comprising SEQ ID NO:
29; and
[0170] (f) a light chain variable region CDR3 comprising SEQ ID NO:
35.
In another preferred embodiment, the antibody comprises:
[0171] (a) a heavy chain variable region CDR1 comprising SEQ ID NO:
6;
[0172] (b) a heavy chain variable region CDR2 comprising SEQ ID NO:
12;
[0173] (c) a heavy chain variable region CDR3 comprising SEQ ID NO:
18;
[0174] (d) a light chain variable region CDR1 comprising SEQ ID NO:
24;
[0175] (e) a light chain variable region CDR2 comprising SEQ ID NO:
30; and
[0176] (f) a light chain variable region CDR3 comprising SEQ ID NO:
36.
[0177] It is well known in the art that the CDR3 domain,
independently from the CDR1 and/or CDR2 domain(s), alone can
determine the binding specificity of an antibody for a cognate
antigen and that multiple antibodies can predictably be generated
having the same binding specificity based on a common CDR3
sequence. See, e.g., Klimka et al., British J. of Cancer
83(2):252-260 (2000); Beiboer et al., J. Mol. Biol. 296:833-849
(2000); Rader et al., Proc. Natl. Acad. Sci. U.S.A. 95:8910-8915
(1998); Barbas et al., J. Am. Chem. Soc. 116:2161-2162 (1994);
Barbas et al., Proc. Natl. Acad. Sci. U.S.A. 92:2529-2533 (1995);
Ditzel et al., J. Immunol. 157:739-749 (1996); Berezov et al.,
BIAjournal 8:Scientific Review 8 (2001); Igarashi et al., J.
Biochem (Tokyo) 117:452-7 (1995); Bourgeois et al., J. Virol
72:807-10 (1998); Levi et al., Proc. Natl. Acad. Sci. U.S.A.
90:4374-8 (1993); Polymenis and Stoller, J. Immunol. 152:5218-5329
(1994) and Xu and Davis, Immunity 13:37-45 (2000). See also, U.S.
Pat. Nos. 6,951,646; 6,914,128; 6,090,382; 6,818,216; 6,156,313;
6,827,925; 5,833,943; 5,762,905 and 5,760,185. Each of these
references is hereby incorporated by reference in its entirety.
[0178] Accordingly, the present disclosure provides monoclonal
antibodies comprising one or more heavy and/or light chain CDR3
domains from an antibody derived from a human or non-human animal,
wherein the monoclonal antibody is capable of specifically binding
to human LAG-3. Within certain aspects, the present disclosure
provides monoclonal antibodies comprising one or more heavy and/or
light chain CDR3 domain from a non-human antibody, such as a mouse
or rat antibody, wherein the monoclonal antibody is capable of
specifically binding to LAG-3. Within some embodiments, such
inventive antibodies comprising one or more heavy and/or light
chain CDR3 domain from a non-human antibody (a) are capable of
competing for binding with; (b) retain the functional
characteristics; (c) bind to the same epitope; and/or (d) have a
similar binding affinity as the corresponding parental non-human
antibody.
[0179] Within other aspects, the present disclosure provides
monoclonal antibodies comprising one or more heavy and/or light
chain CDR3 domain from a human antibody, such as, e.g., a human
antibody obtained from a non-human animal, wherein the human
antibody is capable of specifically binding to human LAG-3. Within
other aspects, the present disclosure provides monoclonal
antibodies comprising one or more heavy and/or light chain CDR3
domain from a first human antibody, such as, for example, a human
antibody obtained from a non-human animal, wherein the first human
antibody is capable of specifically binding to human LAG-3 and
wherein the CDR3 domain from the first human antibody replaces a
CDR3 domain in a human antibody that is lacking binding specificity
for LAG-3 to generate a second human antibody that is capable of
specifically binding to human LAG-3. Within some embodiments, such
inventive antibodies comprising one or more heavy and/or light
chain CDR3 domain from the first human antibody (a) are capable of
competing for binding with; (b) retain the functional
characteristics; (c) bind to the same epitope; and/or (d) have a
similar binding affinity as the corresponding parental first human
antibody.
Antibodies Having Particular Germline Sequences
[0180] In certain embodiments, an antibody of the invention
comprises a heavy chain variable region from a particular germline
heavy chain immunoglobulin gene and/or a light chain variable
region from a particular germline light chain immunoglobulin
gene.
[0181] For example, in a preferred embodiment, this disclosure
provides an isolated monoclonal antibody, or an antigen-binding
portion thereof, comprising a heavy chain variable region that is
the product of or derived from a human V.sub.H 3-20 gene, a human
V.sub.H 4-34 gene, a human V.sub.H 3-33 gene or a human V.sub.H
1-24 gene, wherein the antibody specifically binds human LAG-3. In
another preferred embodiment, this disclosure provides an isolated
monoclonal antibody, or an antigen-binding portion thereof,
comprising a light chain variable region that is the product of or
derived from a human V.sub.K L18 gene, a human V.sub.K L6 gene or a
human V.sub.K A27 gene, wherein the antibody specifically binds
human LAG-3. In yet another preferred embodiment, this disclosure
provides an isolated monoclonal antibody, or antigen-binding
portion thereof, wherein the antibody comprises a heavy chain
variable region that is the product of or derived from a human
V.sub.H 3-20 gene and comprises a light chain variable region that
is the product of or derived from a human V.sub.K L18 gene, wherein
the antibody specifically binds human LAG-3. In yet another
preferred embodiment, this disclosure provides an isolated
monoclonal antibody, or antigen-binding portion thereof, wherein
the antibody comprises a heavy chain variable region that is the
product of or derived from a human V.sub.H 4-34 gene and comprises
a light chain variable region that is the product of or derived
from a human V.sub.K L6 gene, wherein the antibody specifically
binds human LAG-3. In yet another preferred embodiment, this
disclosure provides an isolated monoclonal antibody, or
antigen-binding portion thereof, wherein the antibody comprises a
heavy chain variable region that is the product of or derived from
a human V.sub.H 3-33 gene and comprises a light chain variable
region that is the product of or derived from a human V.sub.K A27
gene, wherein the antibody specifically binds human LAG-3. In yet
another preferred embodiment, this disclosure provides an isolated
monoclonal antibody, or antigen-binding portion thereof, wherein
the antibody comprises a heavy chain variable region that is the
product of or derived from a human V.sub.H 1-24 gene and comprises
a light chain variable region that is the product of or derived
from a human V.sub.K L6 gene, wherein the antibody specifically
binds human LAG-3. In yet another preferred embodiment, this
disclosure provides an isolated monoclonal antibody, or
antigen-binding portion thereof, wherein the antibody comprises a
heavy chain variable region that is the product of or derived from
a human V.sub.H 3-33 gene and comprises a light chain variable
region that is the product of or derived from a human V.sub.K L6
gene, wherein the antibody specifically binds human LAG-3.
[0182] Such antibodies can also possess one or more of the
functional characteristics described in detail above, such as high
affinity binding to human LAG-3, binding to monkey LAG-3, lack of
binding to mouse LAG-3, the ability to inhibit binding of LAG-3 to
MHC Class II molecules and/or the ability to stimulate
antigen-specific T cell responses.
[0183] An example of an antibody having V.sub.H and V.sub.L of
V.sub.H 3-20 and V.sub.K L18, respectively, is the 25E3 antibody.
Examples of antibodies having V.sub.H and V.sub.L of V.sub.H 4-34
and V.sub.K L6, respectively, are the 25F7 and 8B7 antibodies. An
example of an antibody having V.sub.H and V.sub.L of V.sub.H 3-33
and V.sub.K A27, respectively, is the 26H10 antibody. An example of
an antibody having V.sub.H and V.sub.L of V.sub.H 1-24 and V.sub.K
L6, respectively, is the 11F2 antibody. An example of an antibody
having V.sub.H and V.sub.L of V.sub.H 3-33 and V.sub.K L6,
respectively, is the 17E5 antibody.
[0184] As used herein, a human antibody comprises heavy or light
chain variable regions that is "the product of" or "derived from" a
particular germline sequence if the variable regions of the
antibody are obtained from a system that uses human germline
immunoglobulin genes. Such systems include immunizing a transgenic
mouse carrying human immunoglobulin genes with the antigen of
interest or screening a human immunoglobulin gene library displayed
on phage with the antigen of interest. A human antibody that is
"the product of" or "derived from" a human germline immunoglobulin
sequence can be identified as such by comparing the amino acid
sequence of the human antibody to the amino acid sequences of human
germline immunoglobulins and selecting the human germline
immunoglobulin sequence that is closest in sequence (i.e., greatest
% identity) to the sequence of the human antibody. A human antibody
that is "the product of" or "derived from" a particular human
germline immunoglobulin sequence can contain amino acid differences
as compared to the germline sequence, due to, for example,
naturally-occurring somatic mutations or intentional introduction
of site-directed mutation. However, a selected human antibody
typically is at least 90% identical in amino acids sequence to an
amino acid sequence encoded by a human germline immunoglobulin gene
and contains amino acid residues that identify the human antibody
as being human when compared to the germline immunoglobulin amino
acid sequences of other species (e.g., murine germline sequences).
In certain cases, a human antibody can be at least 95%, or even at
least 96%, 97%, 98%, or 99% identical in amino acid sequence to the
amino acid sequence encoded by the germline immunoglobulin gene.
Typically, a human antibody derived from a particular human
germline sequence will display no more than 10 amino acid
differences from the amino acid sequence encoded by the human
germline immunoglobulin gene. In certain cases, the human antibody
can display no more than 5, or even no more than 4, 3, 2, or 1
amino acid difference from the amino acid sequence encoded by the
germline immunoglobulin gene.
Homologous Antibodies
[0185] In yet another embodiment, an antibody of the invention
comprises heavy and light chain variable regions comprising amino
acid sequences that are homologous to the amino acid sequences of
the preferred antibodies described herein, and wherein the
antibodies retain the desired functional properties of the
anti-LAG-3 antibodies of the invention. For example, this
disclosure provides an isolated monoclonal antibody, or antigen
binding portion thereof, comprising a heavy chain variable region
and a light chain variable region, wherein:
[0186] (a) the heavy chain variable region comprises an amino acid
sequence that is at least 80% homologous to an amino acid sequence
selected from the group consisting of SEQ ID NOs: 37-42;
[0187] (b) the light chain variable region comprises an amino acid
sequence that is at least 80% homologous to an amino acid sequence
selected from the group consisting of SEQ ID NOs: 43-48; and
[0188] (c) the antibody specifically binds to human LAG-3.
[0189] Additionally or alternatively, the antibody can possess one
or more of the following functional properties discussed above,
such as high affinity binding to human LAG-3, binding to monkey
LAG-3, lack of binding to mouse LAG-3, the ability to inhibit
binding of LAG-3 to MHC Class II molecules and/or the ability to
stimulate antigen-specific T cell responses.
[0190] In various embodiments, the antibody can be, for example, a
human antibody, a humanized antibody or a chimeric antibody.
[0191] In other embodiments, the V.sub.H and/or V.sub.L amino acid
sequences can be 85%, 90%, 95%, 96%, 97%, 98% or 99% homologous to
the sequences set forth above. An antibody having V.sub.H and
V.sub.L regions having high (i.e., 80% or greater) homology to the
V.sub.H and V.sub.L regions of the sequences set forth above, can
be obtained by mutagenesis (e.g., site-directed or PCR-mediated
mutagenesis) of nucleic acid molecules encoding SEQ ID NOs: 49-54
or 55-60, followed by testing of the encoded altered antibody for
retained function (i.e., the functions set forth above) using the
functional assays described herein.
[0192] As used herein, the percent homology between two amino acid
sequences is equivalent to the percent identity between the two
sequences. The percent identity between the two sequences is a
function of the number of identical positions shared by the
sequences (i.e., % homology=# of identical positions/total # of
positions.times.100), taking into account the number of gaps, and
the length of each gap, which need to be introduced for optimal
alignment of the two sequences. The comparison of sequences and
determination of percent identity between two sequences can be
accomplished using a mathematical algorithm, as described in the
non-limiting examples below.
[0193] The percent identity between two amino acid sequences can be
determined using the algorithm of E. Meyers and W. Miller (Comput.
Appl. Biosci., 4:11-17 (1988)) which has been incorporated into the
ALIGN program (version 2.0), using a PAM120 weight residue table, a
gap length penalty of 12 and a gap penalty of 4. In addition, the
percent identity between two amino acid sequences can be determined
using the Needleman and Wunsch (J. Mol. Biol. 48:444-453 (1970))
algorithm which has been incorporated into the GAP program in the
GCG software package (available at http://www.gcg.com), using
either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of
16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or
6.
[0194] Additionally or alternatively, the protein sequences of the
present disclosure can further be used as a "query sequence" to
perform a search against public databases to, e.g., to identify
related sequences. Such searches can be performed using the XBLAST
program (version 2.0) of Altschul et al. (1990) J. Mol. Biol.
215:403-10. BLAST protein searches can be performed with the XBLAST
program, score=50, wordlength=3 to obtain amino acid sequences
homologous to the antibody molecules of the invention. To obtain
gapped alignments for comparison purposes, Gapped BLAST can be
utilized as described in Altschul et al., (1997) Nucleic Acids Res.
25(17):3389-3402. When utilizing BLAST and Gapped BLAST programs,
the default parameters of the respective programs (e.g., XBLAST and
NBLAST) are useful. See www.ncbi.nlm.nih.gov.
Antibodies with Conservative Modifications
[0195] In certain embodiments, an antibody of the invention
comprises a heavy chain variable region comprising CDR1, CDR2 and
CDR3 sequences and a light chain variable region comprising CDR1,
CDR2 and CDR3 sequences, wherein one or more of these CDR sequences
comprise specified amino acid sequences based on the preferred
antibodies described herein (e.g., 25F7, 26H10, 25E3, 8B7, 11F2,
17E5), or conservative modifications thereof, and wherein the
antibodies retain the desired functional properties of the
anti-LAG-3 antibodies of the invention. It is understood in the art
that certain conservative sequence modification can be made which
do not remove antigen binding. See, e.g., Brummell et al. (1993)
Biochem 32:1180-8; de Wildt et al. (1997) Prot. Eng. 10:835-41;
Komissarov et al. (1997) J. Biol. Chem. 272:26864-26870; Hall et
al. (1992) J. Immunol. 149:1605-12; Kelley and O'Connell (1993)
Biochem. 32:6862-35; Adib-Conquy et al. (1998) Int. Immunol.
10:341-6 and Beers et al. (2000) Clin. Can. Res. 6:2835-43.
Accordingly, this disclosure provides an isolated monoclonal
antibody, or antigen binding portion thereof, comprising a heavy
chain variable region comprising CDR1, CDR2, and CDR3 sequences and
a light chain variable region comprising CDR1, CDR2, and CDR3
sequences, wherein:
[0196] (a) the heavy chain variable region CDR3 sequence comprises
an amino acid sequence selected from the group consisting of amino
acid sequences of SEQ ID NOs: 13-14, GGY and 16-18, and
conservative modifications thereof,
[0197] (b) the light chain variable region CDR3 sequence comprises
an amino acid sequence selected from the group consisting of amino
acid sequence of SEQ ID NOs: 31-36, and conservative modifications
thereof, and
[0198] (c) the antibody specifically binds human LAG-3.
[0199] Additionally or alternatively, the antibody can possess one
or more of the following functional properties described above,
such as high affinity binding to human LAG-3, binding to monkey
LAG-3, lack of binding to mouse LAG-3, the ability to inhibit
binding of LAG-3 to MHC Class II molecules and/or the ability to
stimulate antigen-specific T cell responses.
[0200] In a preferred embodiment, the heavy chain variable region
CDR2 sequence comprises an amino acid sequence selected from the
group consisting of amino acid sequences of SEQ ID NOs: 7-12, and
conservative modifications thereof; and the light chain variable
region CDR2 sequence comprises an amino acid sequence selected from
the group consisting of amino acid sequences of SEQ ID NOs: 25-30,
and conservative modifications thereof. In another preferred
embodiment, the heavy chain variable region CDR1 sequence comprises
an amino acid sequence selected from the group consisting of amino
acid sequences of SEQ ID NOs: 1-6, and conservative modifications
thereof, and the light chain variable region CDR1 sequence
comprises an amino acid sequence selected from the group consisting
of amino acid sequences of SEQ ID NOs: 19-24, and conservative
modifications thereof
[0201] In various embodiments, the antibody can be, for example,
human antibodies, humanized antibodies or chimeric antibodies.
[0202] As used herein, the term "conservative sequence
modifications" is intended to refer to amino acid modifications
that do not significantly affect or alter the binding
characteristics of the antibody containing the amino acid sequence.
Such conservative modifications include amino acid substitutions,
additions and deletions. Modifications can be introduced into an
antibody of the invention by standard techniques known in the art,
such as site-directed mutagenesis and PCR-mediated mutagenesis.
Conservative amino acid substitutions are ones in which the amino
acid residue is replaced with an amino acid residue having a
similar side chain. Families of amino acid residues having similar
side chains have been defined in the art. These families include
amino acids with basic side chains (e.g., lysine, arginine,
histidine), acidic side chains (e.g., aspartic acid, glutamic
acid), uncharged polar side chains (e.g., glycine, asparagine,
glutamine, serine, threonine, tyrosine, cysteine, tryptophan),
nonpolar side chains (e.g., alanine, valine, leucine, isoleucine,
proline, phenylalanine, methionine), beta-branched side chains
(e.g., threonine, valine, isoleucine) and aromatic side chains
(e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, one
or more amino acid residues within the CDR regions of an antibody
of the invention can be replaced with other amino acid residues
from the same side chain family and the altered antibody can be
tested for retained function (i.e., the functions set forth above)
using the functional assays described herein.
Antibodies that Bind to the Same Epitope as Anti-LAG-3
Antibodies
[0203] In another embodiment, this disclosure provides antibodies
that bind to the same epitope on LAG-3 as any of the anti-LAG-3
monoclonal antibodies of the invention (i.e., antibodies that have
the ability to cross-compete for binding to human LAG-3 with any of
the monoclonal antibodies of the invention). In preferred
embodiments, the reference antibody for cross-competition studies
can be the monoclonal antibodies 25F7, 26H10, 25E3, 8B7, 11F2 or
17E5.
[0204] Such cross-competing antibodies can be identified based on
their ability to cross-compete with 25F7, 26H10, 25E3, 8B7, 11F2
and/or 17E5 in standard LAG-3 binding assays. For example, standard
ELISA assays can be used in which a recombinant human LAG-3 protein
is immobilized on the plate, one of the antibodies is fluorescently
labeled and the ability of non-labeled antibodies to compete off
the binding of the labeled antibody is evaluated. Additionally or
alternatively, BIAcore analysis can be used to assess the ability
of the antibodies to cross-compete. The ability of a test antibody
to inhibit the binding of, for example, 25F7, 26H10, 25E3, 8B7,
11F2 and/or 17E5, to human LAG-3 demonstrates that the test
antibody can compete with 25F7, 26H10, 25E3, 8B7, 11F2 and/or 17E5
for binding to human LAG-3 and thus binds to the same epitope on
human LAG-3 as 25F7, 26H10, 25E3, 8B7, 11F2 and/or 17E5. In a
preferred embodiment, the antibody that binds to the same epitope
on human LAG-3 as 25E3, 25F7, 8B7, 26H10, 11F2 or 17E5 is a human
monoclonal antibody. Such human monoclonal antibodies can be
prepared and isolated as described in the Examples.
[0205] As discussed further in Example 3C, the binding of 25E3,
25F7 and 8B7 to human LAG-3 has been mapped to an "extra loop"
region within the first extracellular domain of human LAG-3. The
sequence of the extra loop region is set forth in SEQ ID NO: 79.
Using a peptide scan experiment, the binding of 25E3 to the extra
loop region has been mapped to the following amino acid sequence:
PGHPLAPG (SEQ ID NO: 76), whereas the binding of 25F7 to the extra
loop region has been mapped to the following amino acid sequence:
HPAAPSSW (SEQ ID NO: 77) and the binding of 8B7 to the extra loop
region has been mapped to the following amino acid sequence:
PAAPSSWG (SEQ ID NO: 78). Accordingly, in a preferred embodiment,
the invention provides an anti-LAG-3 antibody that binds an epitope
of human LAG-3 comprising the amino acid sequence PGHPLAPG (SEQ ID
NO: 76). In another preferred embodiment, the invention provides an
anti-LAG-3 antibody that binds an epitope of human LAG-3 comprising
the amino acid sequence HPAAPSSW (SEQ ID NO: 77) or PAAPSSWG (SEQ
ID NO: 78).
Engineered and Modified Antibodies
[0206] An antibody of the invention further can be prepared using
an antibody having one or more of the V.sub.H and/or V.sub.L
sequences disclosed herein as starting material to engineer a
modified antibody, which modified antibody may have altered
properties from the starting antibody. An antibody can be
engineered by modifying one or more residues within one or both
variable regions (i.e., V.sub.H and/or V.sub.L), for example within
one or more CDR regions and/or within one or more framework
regions. Additionally or alternatively, an antibody can be
engineered by modifying residues within the constant region(s), for
example to alter the effector function(s) of the antibody.
[0207] In certain embodiments, CDR grafting can be used to engineer
variable regions of antibodies. Antibodies interact with target
antigens predominantly through amino acid residues that are located
in the six heavy and light chain complementarity determining
regions (CDRs). For this reason, the amino acid sequences within
CDRs are more diverse between individual antibodies than sequences
outside of CDRs. Because CDR sequences are responsible for most
antibody-antigen interactions, it is possible to express
recombinant antibodies that mimic the properties of specific
naturally occurring antibodies by constructing expression vectors
that include CDR sequences from the specific naturally occurring
antibody grafted onto framework sequences from a different antibody
with different properties (see, e.g., Riechmann et al. (1998)
Nature 332:323-327; Jones et al. (1986) Nature 321:522-525; Queen
et al. (1989) Proc. Natl. Acad. See. U.S.A. 86:10029-10033; U.S.
Pat. Nos. 5,225,539; 5,530,101; 5,585,089; 5,693,762 and
6,180,370.)
[0208] Accordingly, another embodiment of the invention pertains to
an isolated monoclonal antibody, or antigen binding portion
thereof, comprising a heavy chain variable region comprising CDR1,
CDR2, and CDR3 sequences comprising an amino acid sequence selected
from the group consisting of SEQ ID NOs: 1-6, SEQ ID NOs: 7-12, and
SEQ ID NOs: 13-14, GGY and 16-18, respectively, and a light chain
variable region comprising CDR1, CDR2, and CDR3 sequences
comprising an amino acid sequence selected from the group
consisting of SEQ ID NOs: 19-24, SEQ ID NOs: 25-30, and SEQ ID NOs:
31-36, respectively. Thus, such antibodies contain the V.sub.H and
V.sub.L CDR sequences of monoclonal antibodies 25F7, 26H10, 25E3,
8B7, 11F2 or 17E5 can contain different framework sequences from
these antibodies.
[0209] Such framework sequences can be obtained from public DNA
databases or published references that include germline antibody
gene sequences. For example, germline DNA sequences for human heavy
and light chain variable region genes can be found in the "VBase"
human germline sequence database (available on the Internet at
www.mrc-cpe.cam.ac.uk/vbase), as well as in Kabat et al. (1991),
cited supra; Tomlinson et al. (1992) "The Repertoire of Human
Germline V.sub.H Sequences Reveals about Fifty Groups of V.sub.H
Segments with Different Hypervariable Loops" J. Mol. Biol.
227:776-798; and Cox et al. (1994) "A Directory of Human Germ-line
V.sub.H Segments Reveals a Strong Bias in their Usage" Eur. J.
Immunol. 24:827-836; the contents of each of which are expressly
incorporated herein by reference. As another example, the germline
DNA sequences for human heavy and light chain variable region genes
can be found in the Genbank database. For example, the following
heavy chain germline sequences found in the HCo7 HuMAb mouse are
available in the accompanying Genbank Accession Nos.: 1-69
(NG_0010109, NT_024637 & BC070333), 3-33 (NG_0010109 &
NT_024637) and 3-7 (NG_0010109 & NT_024637). As another
example, the following heavy chain germline sequences found in the
HCo12 HuMAb mouse are available in the accompanying Genbank
Accession Nos.: 1-69 (NG_0010109, NT_024637 & BC070333), 5-51
(NG_0010109 & NT_024637), 4-34 (NG_0010109 & NT_024637),
3-30.3 (CAJ556644) & 3-23 (AJ406678).
[0210] Antibody protein sequences are compared against a compiled
protein sequence database using one of the sequence similarity
searching methods called the Gapped BLAST (Altschul et al. (1997),
supra), which is well known to those skilled in the art.
[0211] Preferred framework sequences for use in the antibodies of
the invention are those that are structurally similar to the
framework sequences used by selected antibodies of the invention,
e.g., similar to the V.sub.H 3-20 (SEQ ID NO: 69), V.sub.H 4-34
(SEQ ID NO: 61), V.sub.H 3-33 (SEQ ID NO: 65) or V.sub.H 1-24 (SEQ
ID NO: 73) framework sequences and/or the V.sub.K L18 (SEQ ID NO:
71), V.sub.K L6 (SEQ ID NO: 63) or V.sub.K A27 (SEQ ID NO: 67)
framework sequences used by preferred monoclonal antibodies of the
invention. The V.sub.H CDR1, CDR2, and CDR3 sequences, and the
V.sub.K CDR1, CDR2, and CDR3 sequences, can be grafted onto
framework regions that have the identical sequence as that found in
the germline immunoglobulin gene from which the framework sequence
derive, or the CDR sequences can be grafted onto framework regions
that contain one or more mutations as compared to the germline
sequences. For example, it has been found that in certain instances
it is beneficial to mutate residues within the framework regions to
maintain or enhance the antigen binding ability of the antibody
(see e.g., U.S. Pat. Nos. 5,530,101; 5,585,089; 5,693,762 and
6,180,370).
[0212] Another type of variable region modification is to mutate
amino acid residues within the V.sub.H and/or V.sub.L CDR1, CDR2
and/or CDR3 regions to thereby improve one or more binding
properties (e.g., affinity) of the antibody of interest.
Site-directed mutagenesis or PCR-mediated mutagenesis can be
performed to introduce the mutation(s) and the effect on antibody
binding, or other functional property of interest, can be evaluated
in in vitro or in vivo assays as described herein and provided in
the Examples. Preferably conservative modifications (as discussed
above) are introduced. The mutations can be amino acid
substitutions, additions or deletions, but are preferably
substitutions. Moreover, typically no more than one, two, three,
four or five residues within a CDR region are altered.
[0213] Accordingly, in another embodiment, the instant disclosure
provides isolated anti-LAG-3 monoclonal antibodies, or antigen
binding portions thereof, comprising a heavy chain variable region
comprising: (a) a V.sub.H CDR1 region comprising an amino acid
sequence selected from the group consisting of SEQ ID NOs: 1-6, or
an amino acid sequence having one, two, three, four or five amino
acid substitutions, deletions or additions as compared to SEQ ID
NOs: 1-6; (b) a V.sub.H CDR2 region comprising an amino acid
sequence selected from the group consisting of SEQ ID NOs: 7-12, or
an amino acid sequence having one, two, three, four or five amino
acid substitutions, deletions or additions as compared to SEQ ID
NOs: 7-12; (c) a V.sub.H CDR3 region comprising an amino acid
sequence selected from the group consisting of SEQ ID NOs: 13-14,
GGY and 16-18, or an amino acid sequence having one, two, three,
four or five amino acid substitutions, deletions or additions as
compared to SEQ ID NOs: 13-14, GGY and 16-18; (d) a V.sub.L CDR1
region comprising an amino acid sequence selected from the group
consisting of SEQ ID NOs: 19-24, or an amino acid sequence having
one, two, three, four or five amino acid substitutions, deletions
or additions as compared to SEQ ID NOs: 19-24; (e) a V.sub.L CDR2
region comprising an amino acid sequence selected from the group
consisting of SEQ ID NOs: 25-30, or an amino acid sequence having
one, two, three, four or five amino acid substitutions, deletions
or additions as compared to SEQ ID NOs: 25-30; and (0 a V.sub.L
CDR3 region comprising an amino acid sequence selected from the
group consisting of SEQ ID NOs: 31-36, or an amino acid sequence
having one, two, three, four or five amino acid substitutions,
deletions or additions as compared to SEQ ID NOs: 31-36.
[0214] Engineered antibodies of the invention include those in
which modifications have been made to framework residues within
V.sub.H and/or V.sub.L, e.g. to improve the properties of the
antibody. Typically such framework modifications are made to
decrease the immunogenicity of the antibody. For example, one
approach is to "backmutate" one or more framework residues to the
corresponding germline sequence. More specifically, an antibody
that has undergone somatic mutation can contain framework residues
that differ from the germline sequence from which the antibody is
derived. Such residues can be identified by comparing the antibody
framework sequences to the germline sequences from which the
antibody is derived.
[0215] For example, Table A shows regions where a framework region
amino acid position (using Kabat numbering system) differs from the
germline and how this position can be backmutated to the germline
by the indicated substitutions:
TABLE-US-00001 TABLE A Exemplary Backmutations Framework Amino Acid
Region Position (Kabat Numbering) Backmutation 25E3 V.sub.H 72 G72R
25E3 V.sub.H 95 Y95H 25E3 V.sub.H 97 T97A 25E3 V.sub.H 98 T98R 25F7
V.sub.H 69 L69I 25F7 V.sub.H 71 L71V 25F7 V.sub.H 83 R83S 25F7
V.sub.H 97 F97R 8B7 V.sub.H 76 K76N 8B7 V.sub.H 79 A79S 8B7 V.sub.H
83 N83S 8B7 V.sub.H 112 P112Q 11F2 V.sub.H 3 D3A 17E5 V.sub.H 3 H3Q
8B7 V.sub.H 59 C59Y 8B7 V.sub.H 59 C59S
[0216] Another type of framework modification involves mutating one
or more residues within the framework region, or even within one or
more CDR regions, to remove T cell epitopes to thereby reduce the
potential immunogenicity of the antibody. This approach is also
referred to as "deimmunization" and is described in further detail
in U.S. Patent Publication No. 20030153043.
[0217] In addition or alternative to modifications made within the
framework or CDR regions, antibodies of the invention can be
engineered to include modifications within the Fc region, typically
to alter one or more functional properties of the antibody, such as
serum half-life, complement fixation, Fc receptor binding, and/or
antigen-dependent cellular cytotoxicity. Furthermore, an antibody
of the invention can be chemically modified (e.g., one or more
chemical moieties can be attached to the antibody) or be modified
to alter its glycosylation, again to alter one or more functional
properties of the antibody. Each of these embodiments is described
in further detail below. The numbering of residues in the Fc region
is that of the EU index of Kabat.
[0218] In a preferred embodiment, the antibody is an IgG4 isotype
antibody comprising a Serine to Proline mutation at a position
corresponding to position 228 (S228P; EU index) in the hinge region
of the heavy chain constant region. This mutation has been reported
to abolish the heterogeneity of inter-heavy chain disulfide bridges
in the hinge region (Angal et al. supra; position 241 is based on
the Kabat numbering system). For example, in various embodiments,
an anti-LAG-3 antibody of the invention can comprise the heavy
chain variable region of 25F7 (SEQ ID NO: 37) or 26H10 (SEQ ID NO:
38) linked to a human IgG4 constant region in which the Serine at a
position corresponding to position 241 as described in Angal et
al., supra, has been mutated to Proline. Thus, for the 25F7 and
26H10 heavy chain variable regions linked to a human IgG4 constant
region, this mutation corresponds to an S228P mutation by the EU
index.
[0219] In one embodiment, the hinge region of CH1 is modified such
that the number of cysteine residues in the hinge region is
altered, e.g., increased or decreased. This approach is described
further in U.S. Pat. No. 5,677,425. The number of cysteine residues
in the hinge region of CH1 is altered to, for example, facilitate
assembly of the light and heavy chains or to increase or decrease
the stability of the antibody.
[0220] In another embodiment, the Fc hinge region of an antibody is
mutated to decrease the biological half life of the antibody. More
specifically, one or more amino acid mutations are introduced into
the CH2-CH3 domain interface region of the Fc-hinge fragment such
that the antibody has impaired Staphylococcyl protein A (SpA)
binding relative to native Fc-hinge domain SpA binding. This
approach is described in further detail in U.S. Pat. No.
6,165,745.
[0221] In another embodiment, the antibody is modified to increase
its biological half life. Various approaches are possible. For
example, one or more of the following mutations can be introduced:
T252L, T254S, T256F, as described in U.S. Pat. No. 6,277,375.
Alternatively, to increase the biological half life, the antibody
can be altered within the CH1 or CL region to contain a salvage
receptor binding epitope taken from two loops of a CH2 domain of an
Fc region of an IgG, as described in U.S. Pat. Nos. 5,869,046 and
6,121,022.
[0222] In yet other embodiments, the Fc region is altered by
replacing at least one amino acid residue with a different amino
acid residue to alter the effector function(s) of the antibody. For
example, one or more amino acids selected from amino acid residues
234, 235, 236, 237, 297, 318, 320 and 322 can be replaced with a
different amino acid residue such that the antibody has an altered
affinity for an effector ligand but retains the antigen-binding
ability of the parent antibody. The effector ligand to which
affinity is altered can be, for example, an Fc receptor or the C1
component of complement. This approach is described in further
detail in U.S. Pat. Nos. 5,624,821 and 5,648,260. In another
example, one or more amino acids selected from amino acid residues
329, 331 and 322 can be replaced with a different amino acid
residue such that the antibody has altered C1q binding and/or
reduced or abolished complement dependent cytotoxicity (CDC). This
approach is described in further detail in U.S. Pat. No.
6,194,551.
[0223] In another example, one or more amino acid residues within
amino acid positions 231 and 239 are altered to thereby alter the
ability of the antibody to fix complement. This approach is
described further in PCT Publication WO 94/29351.
[0224] In yet another example, the Fc region is modified to
increase the ability of the antibody to mediate antibody dependent
cellular cytotoxicity (ADCC) and/or to increase the affinity of the
antibody for an Fc.gamma. receptor by modifying one or more amino
acids at the following positions: 238, 239, 248, 249, 252, 254,
255, 256, 258, 265, 267, 268, 269, 270, 272, 276, 278, 280, 283,
285, 286, 289, 290, 292, 293, 294, 295, 296, 298, 301, 303, 305,
307, 309, 312, 315, 320, 322, 324, 326, 327, 329, 330, 331, 333,
334, 335, 337, 338, 340, 360, 373, 376, 378, 382, 388, 389, 398,
414, 416, 419, 430, 434, 435, 437, 438 or 439. This approach is
described further in PCT Publication WO 00/42072. Moreover, the
binding sites on human IgG1 for Fc.gamma.R1, Fc.gamma.RII,
Fc.gamma.RIII and FcRn have been mapped and variants with improved
binding have been described (see Shields et al. (2001) J. Biol.
Chem. 276:6591-6604). Specific mutations at positions 256, 290,
298, 333, 334 and 339 were shown to improve binding to
Fc.gamma.RIII. Additionally, the following combination mutants were
shown to improve Fc.gamma.RIII binding: T256A/S298A, S298A/E333A,
S298A/K224A and S298A/E333A/K334A.
[0225] In still another embodiment, the glycosylation of an
antibody is modified. For example, an aglycoslated antibody can be
made (i.e., the antibody lacks glycosylation). Glycosylation can be
altered to, for example, increase the affinity of the antibody for
antigen. Such carbohydrate modifications can be accomplished by,
for example, altering one or more sites of glycosylation within the
antibody sequence. For example, one or more amino acid
substitutions can be made that result in elimination of one or more
variable region framework glycosylation sites to thereby eliminate
glycosylation at that site. Such aglycosylation may increase the
affinity of the antibody for antigen. See, e.g., U.S. Pat. Nos.
5,714,350 and 6,350,861.
[0226] Additionally or alternatively, an antibody can be made that
has an altered type of glycosylation, such as a hypofucosylated
antibody having reduced amounts of fucosyl residues or an antibody
having increased bisecting GlcNac structures. Such altered
glycosylation patterns have been demonstrated to increase the ADCC
ability of antibodies. Such carbohydrate modifications can be
accomplished by, for example, expressing the antibody in a host
cell with altered glycosylation machinery. Cells with altered
glycosylation machinery have been described in the art and can be
used as host cells in which to express recombinant antibodies of
the invention to thereby produce an antibody with altered
glycosylation. For example, the cell lines Ms704, Ms705, and Ms709
lack the fucosyltransferase gene, FUT8 (.alpha.
(1,6)-fucosyltransferase), such that antibodies expressed in the
Ms704, Ms705, and Ms709 cell lines lack fucose on their
carbohydrates. The Ms704, Ms705, and Ms709 FUT8.sup.-/- cell lines
were created by the targeted disruption of the FUT8 gene in
CHO/DG44 cells using two replacement vectors (see U.S. Patent
Publication No. 20040110704 and Yamane-Ohnuki et al. (2004)
Biotechnol Bioeng 87:614-22). As another example, EP 1,176,195
describes a cell line with a functionally disrupted FUT8 gene,
which encodes a fucosyl transferase, such that antibodies expressed
in such a cell line exhibit hypofucosylation by reducing or
eliminating the .alpha.-1,6 bond-related enzyme. EP 1,176,195 also
describes cell lines which have a low enzyme activity for adding
fucose to the N-acetylglucosamine that binds to the Fc region of
the antibody or does not have the enzyme activity, for example the
rat myeloma cell line YB2/0 (ATCC CRL 1662). PCT Publication WO
03/035835 describes a variant CHO cell line, Lec13 cells, with
reduced ability to attach fucose to Asn(297)-linked carbohydrates,
also resulting in hypofucosylation of antibodies expressed in that
host cell (see also Shields et al. (2002) J. Biol. Chem.
277:26733-26740). Antibodies with a modified glycosylation profile
can also be produced in chicken eggs, as described in PCT
Publication WO 06/089231. Alternatively, antibodies with a modified
glycosylation profile can be produced in plant cells, such as
Lemna. Methods for production of antibodies in a plant system are
disclosed in the U.S. patent application corresponding to Alston
& Bird LLP attorney docket No. 040989/314911, filed on Aug. 11,
2006. PCT Publication WO 99/54342 describes cell lines engineered
to express glycoprotein-modifying glycosyl transferases (e.g.,
.beta.(1,4)-N-acetylglucosaminyltransferase III (GnTIII)) such that
antibodies expressed in the engineered cell lines exhibit increased
bisecting GlcNac structures which results in increased ADCC
activity of the antibodies (see also Umana et al. (1999) Nat.
Biotech. 17:176-180). Alternatively, the fucose residues of the
antibody can be cleaved off using a fucosidase enzyme; e.g., the
fucosidase .alpha.-L-fucosidase removes fucosyl residues from
antibodies (Tarentino et al. (1975) Biochem. 14:5516-23).
[0227] Another modification of the antibodies herein that is
contemplated by this disclosure is pegylation. An antibody can be
pegylated to, for example, increase the biological (e.g., serum)
half life of the antibody. To pegylate an antibody, the antibody,
or fragment thereof, typically is reacted with polyethylene glycol
(PEG), such as a reactive ester or aldehyde derivative of PEG,
under conditions in which one or more PEG groups become attached to
the antibody or antibody fragment. Preferably, the pegylation is
carried out via an acylation reaction or an alkylation reaction
with a reactive PEG molecule (or an analogous reactive
water-soluble polymer). As used herein, the term "polyethylene
glycol" is intended to encompass any of the forms of PEG that have
been used to derivatize other proteins, such as mono (C1-C10)
alkoxy- or aryloxy-polyethylene glycol or polyethylene
glycol-maleimide. In certain embodiments, the antibody to be
pegylated is an aglycosylated antibody. Methods for pegylating
proteins are known in the art and can be applied to the antibodies
of the invention. See, e.g., EP 0 154 316 and EP 0 401 384.
Antibody Physical Properties
[0228] Antibodies of this disclosure can be characterized by their
various physical properties, to detect and/or differentiate
different classes thereof.
[0229] Antibodies of the present disclosure can contain one or more
glycosylation sites in either the light or heavy chain variable
region. Such glycosylation sites may result in increased
immunogenicity of the antibody or an alteration of the pK of the
antibody due to altered antigen binding (Marshall et al (1972) Annu
Rev Biochem 41:673-702; Gala and Morrison (2004) J Immunol
172:5489-94; Wallick et al (1988) J Exp Med 168:1099-109; Spiro
(2002) Glycobiology 12:43R-56R; Parekh et al (1985) Nature
316:452-7; Mimura et al. (2000) Mol Immunol 37:697-706).
Glycosylation has been known to occur at motifs containing an
N--X-S/T sequence. In some instances, it is preferred to have an
anti-LAG-3 antibody that does not contain variable region
glycosylation. This can be achieved either by selecting antibodies
that do not contain the glycosylation motif in the variable region
or by mutating residues within the glycosylation region.
[0230] In a preferred embodiment, the antibodies of the present
disclosure do not contain asparagine isomerism sites. The
deamidation of asparagine may occur on N-G or D-G sequences and
result in the creation of an isoaspartic acid residue that
introduces a kink into the polypeptide chain and decreases its
stability (isoaspartic acid effect).
[0231] Each antibody will have a unique isoelectric point (pI),
which generally falls in the pH range between 6 and 9.5. The pI for
an IgG1 antibody typically falls within the pH range of 7-9.5 and
the pI for an IgG4 antibody typically falls within the pH range of
6-8. There is speculation that antibodies with a pI outside the
normal range may have some unfolding and instability under in vivo
conditions. Thus, it is preferred to have an anti-LAG-3 antibody
that contains a pI value that falls in the normal range. This can
be achieved either by selecting antibodies with a pI in the normal
range or by mutating charged surface residues.
[0232] Each antibody will have a characteristic melting
temperature, with a higher melting temperature indicating greater
overall stability in vivo (Krishnamurthy R and Manning M C (2002)
Curr Pharm Biotechnol 3:361-71). Generally, it is preferred that
the T.sub.M1 (the temperature of initial unfolding) be greater than
60.degree. C., preferably greater than 65.degree. C., even more
preferably greater than 70.degree. C. The melting point of an
antibody can be measured using differential scanning calorimetry
(Chen et al (2003) Pharm Res 20:1952-60; Ghirlando et al (1999)
Immunol Lett 68:47-52) or circular dichroism (Murray et al. (2002)
J. Chromatogr Sci 40:343-9).
[0233] In a preferred embodiment, antibodies are selected that do
not degrade rapidly. Degradation of an antibody can be measured
using capillary electrophoresis (CE) and MALDI-MS (Alexander A J
and Hughes D E (1995) Anal Chem 67:3626-32).
[0234] In another preferred embodiment, antibodies are selected
that have minimal aggregation effects, which can lead to the
triggering of an unwanted immune response and/or altered or
unfavorable pharmacokinetic properties. Generally, antibodies are
acceptable with aggregation of 25% or less, preferably 20% or less,
even more preferably 15% or less, even more preferably 10% or less
and even more preferably 5% or less. Aggregation can be measured by
several techniques, including size-exclusion column (SEC), high
performance liquid chromatography (HPLC), and light scattering.
Methods of Engineering Antibodies
[0235] As discussed above, the anti-LAG-3 antibodies having V.sub.H
and V.sub.L sequences disclosed herein can be used to create new
anti-LAG-3 antibodies by modifying the V.sub.H and/or V.sub.L
sequences, or the constant region(s) attached thereto. Thus, in
another aspect of the invention, the structural features of an
anti-LAG-3 antibody of the invention, e.g. 25F7, 26H10, 25E3, 8B7,
11F2 or 17E5, are used to create structurally related anti-LAG-3
antibodies that retain at least one functional property of the
antibodies of the invention, such as binding to human LAG-3. For
example, one or more CDR regions of 25F7, 26H10, 25E3, 8B7, 11F2 or
17E5, or mutations thereof, can be combined recombinantly with
known framework regions and/or other CDRs to create additional,
recombinantly-engineered, anti-LAG-3 antibodies of the invention,
as discussed above. Other types of modifications include those
described in the previous section. The starting material for the
engineering method is one or more of the V.sub.H and/or V.sub.L
sequences provided herein, or one or more CDR regions thereof. To
create the engineered antibody, it is not necessary to actually
prepare (i.e., express as a protein) an antibody having one or more
of the V.sub.H and/or V.sub.L sequences provided herein, or one or
more CDR regions thereof Rather, the information contained in the
sequence(s) is used as the starting material to create a "second
generation" sequence(s) derived from the original sequence(s) and
then the "second generation" sequence(s) is prepared and expressed
as a protein.
[0236] Accordingly, in another embodiment, this disclosure provides
a method for preparing an anti-LAG-3 antibody comprising:
[0237] (a) providing: (i) a heavy chain variable region antibody
sequence comprising a CDR1 sequence selected from the group
consisting of SEQ ID NOs: 1-6, a CDR2 sequence selected from the
group consisting of SEQ ID NOs: 7-12, and/or a CDR3 sequence
selected from the group consisting of SEQ ID NOs: 13-14, GGY and
16-18; and/or (ii) a light chain variable region antibody sequence
comprising a CDR1 sequence selected from the group consisting of
SEQ ID NOs: 19-24, a CDR2 sequence selected from the group
consisting of SEQ ID NOs: 25-30, and/or a CDR3 sequence selected
from the group consisting of SEQ ID NOs: 31-36;
[0238] (b) altering at least one amino acid residue within the
heavy chain variable region antibody sequence and/or the light
chain variable region antibody sequence to create at least one
altered antibody sequence; and
[0239] (c) expressing the altered antibody sequence as a
protein.
[0240] Standard molecular biology techniques can be used to prepare
and express the altered antibody sequence.
[0241] Preferably, the antibody encoded by the altered antibody
sequence(s) is one that retains one, some or all of the functional
properties of the anti-LAG-3 antibodies described herein, which
functional properties include, but are not limited to:
[0242] (i) high affinity binding to human LAG-3;
[0243] (ii) binding to monkey LAG-3;
[0244] (iii) lack of binding to mouse LAG-3
[0245] (iv) an ability to inhibit binding of LAG-3 to MHC Class II
molecules; and/or (v) an ability to stimulate an immune response
(e.g., an antigen-specific T cell response).
[0246] The functional properties of the altered antibodies can be
assessed using standard assays available in the art and/or
described herein, such as those set forth in the Examples.
[0247] In certain embodiments of the methods of engineering
antibodies of the invention, mutations can be introduced randomly
or selectively along all or part of an anti-LAG-3 antibody coding
sequence and the resulting modified anti-LAG-3 antibodies can be
screened for binding activity and/or other functional properties as
described herein. Mutational methods have been described in the art
(see, e.g., PCT Publications WO 02/092780 and WO 03/074679).
Nucleic Acid Molecules Encoding Antibodies of the Invention
[0248] Another aspect of the invention pertains to nucleic acid
molecules that encode the antibodies of the invention. The nucleic
acids can be present in whole cells, in a cell lysate, or in a
partially purified or substantially pure form. A nucleic acid is
"isolated" or "rendered substantially pure" when purified away from
other cellular components or other contaminants, e.g., other
cellular nucleic acids or proteins, by standard techniques,
including alkaline/SDS treatment, CsCl banding, column
chromatography, agarose gel electrophoresis and others well known
in the art. See, Ausubel, et al., ed. (1987) Current Protocols in
Molecular Biology, Greene Publishing and Wiley Interscience, New
York. A nucleic acid of the invention can be, e.g., DNA or RNA and
may or may not contain intronic sequences. In a preferred
embodiment, the nucleic acid is a cDNA molecule.
[0249] Nucleic acids of the invention can be obtained using
standard molecular biology techniques. For antibodies expressed by
hybridomas (e.g., hybridomas prepared from transgenic mice carrying
human immunoglobulin genes as described further below), cDNAs
encoding the light and heavy chains of the antibody made by the
hybridoma can be obtained by standard PCR amplification or cDNA
cloning techniques. For antibodies obtained from an immunoglobulin
gene library (e.g., using phage display techniques), a nucleic acid
encoding such antibodies can be recovered from the gene
library.
[0250] Preferred nucleic acids molecules of the invention are those
encoding the V.sub.H and V.sub.L sequences of the 25E3, 25F7, 8B7,
26H10, 11F2 and 17E5 monoclonal antibodies. DNA sequences encoding
the V.sub.H sequences of 25E3, 25F7, 8B7, 26H10, 11F2 and 17E5 are
shown in SEQ ID NOs: 49-54, respectively. DNA sequences encoding
the V.sub.L sequences of 25E3, 25F7, 8B7, 26H10, 11F2 and 17E5 are
shown in SEQ ID NOs: 55-60, respectively.
[0251] Once DNA fragments encoding V.sub.H and V.sub.L segments are
obtained, these DNA fragments can be further manipulated by
standard recombinant DNA techniques, for example to convert the
variable region genes to full-length antibody chain genes, to Fab
fragment genes or to a scFv gene. In these manipulations, a
V.sub.L- or V.sub.H-encoding DNA fragment is operatively linked to
another DNA fragment encoding another protein, such as an antibody
constant region or a flexible linker. The term "operatively
linked", as used in this context, is intended to mean that the two
DNA fragments are joined such that the amino acid sequences encoded
by the two DNA fragments remain in-frame. The isolated DNA encoding
the V.sub.H region can be converted to a full-length heavy chain
gene by operatively linking the VH-encoding DNA to another DNA
molecule encoding heavy chain constant regions (CH1, CH2 and CH3).
The sequences of human heavy chain constant region genes are known
in the art (see e.g., Kabat et al. (1991), supra) and DNA fragments
encompassing these regions can be obtained by standard PCR
amplification. The heavy chain constant region can be an IgG1,
IgG2, IgG3, IgG4, IgA, IgE, IgM or IgD constant region, but most
preferably is an IgG1 or IgG4 constant region. For a Fab fragment
heavy chain gene, the V.sub.H-encoding DNA can be operatively
linked to another DNA molecule encoding only the heavy chain CH1
constant region.
[0252] The isolated DNA encoding the V.sub.L region can be
converted to a full-length light chain gene (as well as a Fab light
chain gene) by operatively linking the V.sub.L-encoding DNA to
another DNA molecule encoding the light chain constant region, CL.
The sequences of human light chain constant region genes are known
in the art (see e.g., Kabat et al., supra) and DNA fragments
encompassing these regions can be obtained by standard PCR
amplification. In preferred embodiments, the light chain constant
region can be a kappa or lambda constant region.
[0253] To create a scFv gene, the V.sub.H- and V.sub.L-encoding DNA
fragments are operatively linked to another fragment encoding a
flexible linker, e.g., encoding the amino acid sequence
(Gly.sub.4-Ser).sub.3, such that the V.sub.H and V.sub.L sequences
can be expressed as a contiguous single-chain protein, with the
V.sub.L and V.sub.H regions joined by the flexible linker (see
e.g., Bird et al. (1988) Science 242:423-426; Huston et al. (1988)
Proc. Natl. Acad. Sci. USA 85:5879-5883; McCafferty et al., (1990)
Nature 348:552-554).
Production of Monoclonal Antibodies of the Invention
[0254] Monoclonal antibodies (mAbs) of the present disclosure can
be produced using the well-known somatic cell hybridization
(hybridoma) technique of Kohler and Milstein (1975) Nature 256:
495. Other embodiments for producing monoclonal antibodies include
viral or oncogenic transformation of B lymphocytes and phage
display techniques. Chimeric or humanized antibodies are also well
known in the art. See e.g., U.S. Pat. Nos. 4,816,567; 5,225,539;
5,530,101; 5,585,089; 5,693,762 and 6,180,370, the contents of
which are specifically incorporated herein by reference in their
entirety.
[0255] In a preferred embodiment, the antibodies of the invention
are human monoclonal antibodies. Such human monoclonal antibodies
directed against human LAG-3 can be generated using transgenic or
transchromosomic mice carrying parts of the human immune system
rather than the mouse system. These transgenic and transchromosomic
mice include mice referred to herein as the HuMAb Mouse.RTM. and KM
Mouse, respectively, and are collectively referred to herein as
"human Ig mice."
[0256] The HuMAb Mouse.RTM. (Medarex.RTM., Inc.) contains human
immunoglobulin gene miniloci that encode unrearranged human heavy
(.mu. and .gamma.) and .kappa. light chain immunoglobulin
sequences, together with targeted mutations that inactivate the
endogenous .mu. and .kappa. chain loci (see e.g., Lonberg et al.
(1994) Nature 368(6474): 856-859). Accordingly, the mice exhibit
reduced expression of mouse IgM or .kappa., and in response to
immunization, the introduced human heavy and light chain transgenes
undergo class switching and somatic mutation to generate high
affinity human IgG.kappa. monoclonal antibodies (Lonberg et al.
(1994), supra; reviewed in Lonberg (1994) Handbook of Experimental
Pharmacology 113:49-101; Lonberg, N. and Huszar, D. (1995) Intern.
Rev. Immunol. 13: 65-93, and Harding and Lonberg (1995) Ann. N.Y.
Acad. Sci. 764:536-546). Preparation and use of the HuMAb
Mouse.RTM., and the genomic modifications carried by such mice, is
further described in Taylor et al. (1992) Nucleic Acids Research
20:6287-6295; Chen et al. (1993) International Immunology 5:
647-656; Tuaillon et al. (1993) Proc. Natl. Acad. Sci. USA
90:3720-3724; Choi et al. (1993) Nature Genetics 4:117-123; Chen et
al. (1993) EABO J. 12: 821-830; Tuaillon et al. (1994) J. Immunol.
152:2912-2920; Taylor et al. (1994) International Immunology 6:
579-591; and Fishwild et al. (1996) Nature Biotechnology 14:
845-851, the contents of all of which are hereby specifically
incorporated by reference in their entirety. See further, U.S. Pat.
Nos. 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,789,650;
5,877,397; 5,661,016; 5,814,318; 5,874,299; 5,770,429; and
5,545,807; PCT Publication Nos. WO 92/03918; WO 93/12227; WO
94/25585; WO 97/13852; WO 98/24884; WO 99/45962 and WO 01/14424,
the contents of which are incorporated herein by reference in their
entirety.
[0257] In another embodiment, human antibodies of the invention can
be raised using a mouse that carries human immunoglobulin sequences
on transgenes and transchomosomes, such as a mouse that carries a
human heavy chain transgene and a human light chain
transchromosome. This mouse is referred to herein as a "KM
Mouse.RTM.," and is described in detail in PCT Publication WO
02/43478. A modified form of this mouse, which further comprises a
homozygous disruption of the endogenous Fc.gamma.RIIB receptor
gene, is also described in PCT Publication WO 02/43478 and referred
to herein as a "KM/FCGR2D Mouse.RTM.." In addition, mice with
either the HCo7 or HCo12 heavy chain transgenes or both can be
used.
[0258] Additional transgenic animal embodiments include the
Xenomouse (Abgenix, Inc., U.S. Pat. Nos. 5,939,598; 6,075,181;
6,114,598; 6,150,584 and 6,162,963). Further embodiments include
"TC mice" (Tomizuka et al. (2000) Proc. Natl. Acad. Sci. USA
97:722-727) and cows carrying human heavy and light chain
transchromosomes (Kuroiwa et al. (2002) Nature Biotechnology
20:889-894; PCT Publication WO 02/092812). The contents of these
patents and publications are specifically incorporated herein by
reference in their entirety.
[0259] In one embodiment, human monoclonal antibodies of the
invention are prepared using phage display methods for screening
libraries of human immunoglobulin genes. See, e.g. U.S. Pat. Nos.
5,223,409; 5,403,484; 5,571,698; 5,427,908; 5,580,717; 5,969,108;
6,172,197; 5,885,793; 6,521,404; 6,544,731; 6,555,313; 6,582,915;
and 6,593,081, the contents of which are incorporated herein by
reference in their entirety.
[0260] Human monoclonal antibodies of the invention can also be
prepared using SCID mice into which human immune cells have been
reconstituted such that a human antibody response can be generated
upon immunization. See, e.g., U.S. Pat. Nos. 5,476,996 and
5,698,767, the contents of which are incorporated herein by
reference in their entirety.
[0261] In another embodiment, human anti-LAG-3 antibodies are
prepared using phage display where the phages comprise nucleic
acids encoding antibodies generated in transgenic animals
previously immunized with LAG-3. In a preferred embodiment, the
transgenic animal is a HuMab, KM, or Kirin mouse. See, e.g. U.S.
Pat. No. 6,794,132, the contents of which are incorporated herein
by reference in its entirety.
Immunization of Human Ig Mice
[0262] In one embodiment of the invention, human Ig mice are
immunized with a purified or enriched preparation of a LAG-3
antigen, recombinant LAG-3 protein, or cells expressing a LAG-3
protein. See, e.g., Lonberg et al. (1994), supra; Fishwild et al.
(1996), supra; PCT Publications WO 98/24884 or WO 01/14424, the
contents of which are incorporated herein by reference in their
entirety. In a preferred embodiment, 6-16 week old mice are
immunized with 5-50 .mu.g of LAG-3 protein. Alternatively, a
portion of LAG-3 fused to a non-LAG-3 polypeptide is used.
[0263] In one embodiment, the transgenic mice are immunized
intraperitoneally (IP) or intravenously (IV) with LAG-3 antigen in
complete Freund's adjuvant, followed by subsequent IP or IV
immunizations with antigen in incomplete Freund's adjuvant. In
other embodiments, adjuvants other than Freund's or whole cells in
the absence of adjuvant are used. The plasma can be screened by
ELISA and cells from mice with sufficient titers of anti-LAG-3
human immunoglobulin can be used for fusions.
Generation of Hybridomas Producing Human Monoclonal Antibodies of
the Invention
[0264] To generate hybridomas producing human monoclonal antibodies
of the invention, splenocytes and/or lymph node cells from
immunized mice can be isolated and fused to an appropriate
immortalized cell line, such as a mouse myeloma cell line. The
resulting hybridomas can be screened for the production of
antigen-specific antibodies. Generation of hybridomas is well-known
in the art. See, e.g., Harlow and Lane (1988) Antibodies, A
Laboratory Manual, Cold Spring Harbor Publications, New York.
Generation of Transfectomas Producing Monoclonal Antibodies of the
Invention
[0265] Antibodies of the invention also can be produced in a host
cell transfectoma using, for example, a combination of recombinant
DNA techniques and gene transfection methods as is well known in
the art (e.g., Morrison, S. (1985) Science 229:1202). In one
embodiment, DNA encoding partial or full-length light and heavy
chains obtained by standard molecular biology techniques is
inserted into one or more expression vectors such that the genes
are operatively linked to transcriptional and translational
regulatory sequences. In this context, the term "operatively
linked" is intended to mean that an antibody gene is ligated into a
vector such that transcriptional and translational control
sequences within the vector serve their intended function of
regulating the transcription and translation of the antibody
gene.
[0266] The term "regulatory sequence" is intended to include
promoters, enhancers and other expression control elements (e.g.,
polyadenylation signals) that control the transcription or
translation of the antibody chain genes. Such regulatory sequences
are described, e.g., in Goeddel (Gene Expression Technology.
Methods in Enzymology 185, Academic Press, San Diego, Calif.
(1990)). Preferred regulatory sequences for mammalian host cell
expression include viral elements that direct high levels of
protein expression in mammalian cells, such as promoters and/or
enhancers derived from cytomegalovirus (CMV), Simian Virus 40
(SV40), adenovirus, (e.g., the adenovirus major late promoter
(AdMLP) and polyoma. Alternatively, nonviral regulatory sequences
can be used, such as the ubiquitin promoter or .beta.-globin
promoter. Still further, regulatory elements composed of sequences
from different sources, such as the SR.alpha. promoter system,
which contains sequences from the SV40 early promoter and the long
terminal repeat of human T cell leukemia virus type 1 (Takebe et
al. (1988) Mol. Cell. Biol. 8:466-472). The expression vector and
expression control sequences are chosen to be compatible with the
expression host cell used.
[0267] The antibody light chain gene and the antibody heavy chain
gene can be inserted into the same or separate expression vectors.
In preferred embodiments, the variable regions are used to create
full-length antibody genes of any antibody isotype by inserting
them into expression vectors already encoding heavy chain constant
and light chain constant regions of the desired isotype such that
the V.sub.H segment is operatively linked to the C.sub.H segment(s)
within the vector and the V.sub.L segment is operatively linked to
the C.sub.L segment within the vector. Additionally or
alternatively, the recombinant expression vector can encode a
signal peptide that facilitates secretion of the antibody chain
from a host cell. The antibody chain gene can be cloned into the
vector such that the signal peptide is linked in-frame to the amino
terminus of the antibody chain gene. The signal peptide can be an
immunoglobulin signal peptide or a heterologous signal peptide
(i.e., a signal peptide from a non-immunoglobulin protein).
[0268] In addition to the antibody chain genes and regulatory
sequences, the recombinant expression vectors of the invention can
carry additional sequences, such as sequences that regulate
replication of the vector in host cells (e.g., origins of
replication) and selectable marker genes. The selectable marker
gene facilitates selection of host cells into which the vector has
been introduced (see, e.g., U.S. Pat. Nos. 4,399,216; 4,634,665 and
5,179,017). For example, typically the selectable marker gene
confers resistance to drugs, such as G418, hygromycin or
methotrexate, on a host cell into which the vector has been
introduced. Preferred selectable marker genes include the
dihydrofolate reductase (DHFR) gene (for use in dhfr-host cells
with methotrexate selection/amplification) and the neo gene (for
G418 selection).
[0269] For expression of the light and heavy chains, the expression
vector(s) encoding the heavy and light chains is transfected into a
host cell by standard techniques. The various forms of the term
"transfection" are intended to encompass a wide variety of
techniques commonly used for the introduction of exogenous DNA into
a prokaryotic or eukaryotic host cell, e.g., electroporation,
calcium-phosphate precipitation, DEAE-dextran transfection and the
like. Although it is theoretically possible to express the
antibodies of the invention in either prokaryotic or eukaryotic
host cells, expression of antibodies in eukaryotic cells, and most
preferably mammalian host cells, is the most preferred because such
eukaryotic cells, and in particular mammalian cells, are more
likely than prokaryotic cells to assemble and secrete a properly
folded and immunologically active antibody.
[0270] Preferred mammalian host cells for expressing the
recombinant antibodies of the invention include Chinese Hamster
Ovary (CHO cells) (including dhfr.sup.- CHO cells, described in
Urlaub and Chasin, (1980) Proc. Natl. Acad. Sci. USA 77:4216-4220,
used with a DHFR selectable marker, e.g., as described in R. J.
Kaufman and P. A. Sharp (1982) J. Mol. Biol. 159:601-621), NSO
myeloma cells, COS cells and SP2 cells. In particular, for use with
NSO myeloma cells, another preferred expression system is the GS
gene expression system disclosed in WO 87/04462, WO 89/01036 and EP
338,841. When recombinant expression vectors encoding antibody
genes are introduced into mammalian host cells, the antibodies are
produced by culturing the host cells for a period of time
sufficient to allow for expression of the antibody in the host
cells or, more preferably, secretion of the antibody into the
culture medium in which the host cells are grown. Antibodies can be
recovered from the culture medium using standard protein
purification methods.
Characterization of Antibody Binding to Antigen
[0271] Antibodies of the invention can be tested for binding to
human LAG-3 by, for example, standard ELISA. Anti-LAG-3 human IgGs
can be further tested for reactivity with a LAG-3 antigen by
Western blotting. The binding specificity of an antibody of the
invention can also be determined by monitoring binding of the
antibody to cells expressing a LAG-3 protein, e.g., flow cytometry.
These methods are known in the art. See, e.g., Harlow and Lane
(1988), cited supra.
Immunoconjugates
[0272] Antibodies of this invention can be conjugated to a
therapeutic agent to form an immunoconjugate such as an
antibody-drug conjugate (ADC). Suitable therapeutic agents include
antimetabolites, alkylating agents, DNA minor groove binders, DNA
intercalators, DNA crosslinkers, histone deacetylase inhibitors,
nuclear export inhibitors, proteasome inhibitors, topoisomerase I
or II inhibitors, heat shock protein inhibitors, tyrosine kinase
inhibitors, antibiotics, and anti-mitotic agents. In the ADC, the
antibody and therapeutic agent preferably are conjugated via a
linker cleavable such as a peptidyl, disulfide, or hydrazone
linker. More preferably, the linker is a peptidyl linker such as
Val-Cit, Ala-Val, Val-Ala-Val, Lys-Lys, Pro-Val-Gly-Val-Val (SEQ ID
NO:15), Ala-Asn-Val, Val-Leu-Lys, Ala-Ala-Asn, Cit-Cit, Val-Lys,
Lys, Cit, Ser, or Glu. The ADCs can be prepared as described in
U.S. Pat. Nos. 7,087,600; 6,989,452; and 7,129,261; PCT
Publications WO 02/096910; WO 07/038658; WO 07/051081; WO
07/059404; WO 08/083312; and WO 08/103693; U.S. Patent Publications
20060024317; 20060004081; and 20060247295; the disclosures of which
are incorporated herein by reference.
Bispecific Molecules
[0273] In another aspect, the present disclosure features
bispecific molecules comprising an anti-LAG-3 antibody linked to at
least one other functional molecule, e.g., another peptide or
protein (e.g., another antibody or ligand for a receptor) to
generate a bispecific molecule that binds to at least two different
binding sites or target molecules. Thus, as used herein,
"bispecific molecule" includes molecules that have three or more
specificities. In a preferred embodiment, the bispecific molecule
comprises a first binding specificity for LAG-3 and a second
binding specificity for a triggering molecule that recruits
cytotoxic effector cells that can kill a LAG-3 expressing target
cell. Examples of suitable triggering molecules are CD64, CD89,
CD16, and CD3. See, e.g., Kufer et al., TRENDS in Biotechnology, 22
(5), 238-244 (2004).
[0274] In an embodiment, a bispecific molecule has, in addition to
an anti-Fc binding specificity and an anti-LAG-3 binding
specificity, a third specificity. The third specificity can be for
an anti-enhancement factor (EF), e.g., a molecule that binds to a
surface protein involved in cytotoxic activity and thereby
increases the immune response against the target cell. For example,
the anti-enhancement factor can bind a cytotoxic T-cell (e.g. via
CD2, CD3, CD8, CD28, CD4, CD40, or ICAM-1) or other immune cell,
resulting in an increased immune response against the target
cell.
[0275] Bispecific molecules can come in many different formats and
sizes. At one end of the size spectrum, a bispecific molecule
retains the traditional antibody format, except that, instead of
having two binding arms of identical specificity, it has two
binding arms each having a different specificity. At the other
extreme are bispecific molecules consisting of two single-chain
antibody fragments (scFv's) linked by a peptide chain, a so-called
Bs(scFv).sub.2 construct. Intermediate-sized bispecific molecules
include two different F(ab) fragments linked by a peptidyl linker.
Bispecific molecules of these and other formats can be prepared by
genetic engineering, somatic hybridization, or chemical methods.
See, e.g., Kufer et al, cited supra; Cao and Suresh, Bioconjugate
Chemistry, 9 (6), 635-644 (1998); and van Spriel et al., Immunology
Today, 21 (8), 391-397 (2000), and the references cited
therein.
Pharmaceutical Compositions
[0276] In another aspect, the present disclosure provides a
pharmaceutical composition comprising an antibody of the present
disclosure formulated together with a pharmaceutically acceptable
carrier. It may optionally contain one or more additional
pharmaceutically active ingredients, such as another antibody or a
drug. The pharmaceutical compositions of the invention also can be
administered in a combination therapy with, for example, another
immunostimulatory agent, anti-cancer agent, an anti-viral agent, or
a vaccine, such that the anti-LAG-3 antibody enhances the immune
response against the vaccine.
[0277] The pharmaceutical composition can comprise any number of
excipients. Excipients that can be used include carriers, surface
active agents, thickening or emulsifying agents, solid binders,
dispersion or suspension aids, solubilizers, colorants, flavoring
agents, coatings, disintegrating agents, lubricants, sweeteners,
preservatives, isotonic agents, and combinations thereof. The
selection and use of suitable excipients is taught in Gennaro, ed.,
Remington: The Science and Practice of Pharmacy, 20th Ed.
(Lippincott Williams & Wilkins 2003), the disclosure of which
is incorporated herein by reference.
[0278] Preferably, a pharmaceutical composition is suitable for
intravenous, intramuscular, subcutaneous, parenteral, spinal or
epidermal administration (e.g., by injection or infusion).
Depending on the route of administration, the active compound can
be coated in a material to protect it from the action of acids and
other natural conditions that may inactivate it. The phrase
"parenteral administration" as used herein means modes of
administration other than enteral and topical administration,
usually by injection, and includes, without limitation,
intravenous, intramuscular, intraarterial, intrathecal,
intracapsular, intraorbital, intracardiac, intradermal,
intraperitoneal, transtracheal, subcutaneous, subcuticular,
intraarticular, subcapsular, subarachnoid, intraspinal, epidural
and intrasternal injection and infusion. Alternatively, an antibody
of the invention can be administered via a non-parenteral route,
such as a topical, epidermal or mucosal route of administration,
e.g., intranasally, orally, vaginally, rectally, sublingually or
topically.
[0279] The pharmaceutical compounds of the invention can be in the
form of pharmaceutically acceptable salts. A "pharmaceutically
acceptable salt" refers to a salt that retains the desired
biological activity of the parent compound and does not impart any
undesired toxicological effects. Examples of such salts include
acid addition salts and base addition salts. Acid addition salts
include those derived from nontoxic inorganic acids, such as
hydrochloric, nitric, phosphoric, sulfuric, hydrobromic,
hydroiodic, phosphorous and the like, as well as from nontoxic
organic acids such as aliphatic mono- and dicarboxylic acids,
phenyl-substituted alkanoic acids, hydroxy alkanoic acids, aromatic
acids, aliphatic and aromatic sulfonic acids and the like. Base
addition salts include those derived from alkaline earth metals,
such as sodium, potassium, magnesium, calcium and the like, as well
as from nontoxic organic amines, such as
N,N'-dibenzylethylenediamine, N-methylglucamine, chloroprocaine,
choline, diethanolamine, ethylenediamine, procaine and the
like.
[0280] Pharmaceutical compositions can be in the form of sterile
aqueous solutions or dispersions. They can also be formulated in a
microemulsion, liposome, or other ordered structure suitable to
high drug concentration.
[0281] The amount of active ingredient which can be combined with a
carrier material to produce a single dosage form will vary
depending upon the subject being treated and the particular mode of
administration and will generally be that amount of the composition
which produces a therapeutic effect. Generally, out of one hundred
percent, this amount will range from about 0.01% to about
ninety-nine percent of active ingredient, preferably from about
0.1% to about 70%, most preferably from about 1% to about 30% of
active ingredient in combination with a pharmaceutically acceptable
carrier.
[0282] Dosage regimens are adjusted to provide the optimum desired
response (e.g., a therapeutic response). For example, a single
bolus can be administered, several divided doses can be
administered over time or the dose can be proportionally reduced or
increased as indicated by the exigencies of the therapeutic
situation. It is especially advantageous to formulate parenteral
compositions in dosage unit form for ease of administration and
uniformity of dosage. Dosage unit form as used herein refers to
physically discrete units suited as unitary dosages for the
subjects to be treated; each unit contains a predetermined quantity
of active compound calculated to produce the desired therapeutic
effect in association with the required pharmaceutical carrier.
Alternatively, antibody can be administered as a sustained release
formulation, in which case less frequent administration is
required.
[0283] For administration of the antibody, the dosage ranges from
about 0.0001 to 100 mg/kg, and more usually 0.01 to 5 mg/kg, of the
host body weight. For example dosages can be 0.3 mg/kg body weight,
1 mg/kg body weight, 3 mg/kg body weight, 5 mg/kg body weight or 10
mg/kg body weight or within the range of 1-10 mg/kg. An exemplary
treatment regime entails administration once per week, once every
two weeks, once every three weeks, once every four weeks, once a
month, once every 3 months or once every three to 6 months.
Preferred dosage regimens for an anti-LAG-3 antibody of the
invention include 1 mg/kg body weight or 3 mg/kg body weight via
intravenous administration, with the antibody being given using one
of the following dosing schedules: (i) every four weeks for six
dosages, then every three months; (ii) every three weeks; (iii) 3
mg/kg body weight once followed by 1 mg/kg body weight every three
weeks. In some methods, dosage is adjusted to achieve a plasma
antibody concentration of about 1-1000 .mu.g/ml and in some methods
about 25-300 .mu.g/ml.
[0284] A "therapeutically effective dosage" of an anti-LAG-3
antibody of the invention preferably results in a decrease in
severity of disease symptoms, an increase in frequency and duration
of disease symptom-free periods, or a prevention of impairment or
disability due to the disease affliction. For example, for the
treatment of tumor-bearing subjects, a "therapeutically effective
dosage" preferably inhibits tumor growth by at least about 20%,
more preferably by at least about 40%, even more preferably by at
least about 60%, and still more preferably by at least about 80%
relative to untreated subjects. A therapeutically effective amount
of a therapeutic compound can decrease tumor size, or otherwise
ameliorate symptoms in a subject, which is typically a human or can
be another mammal.
[0285] The pharmaceutical composition can be a controlled release
formulation, including implants, transdermal patches, and
microencapsulated delivery systems. Biodegradable, biocompatible
polymers can be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and
polylactic acid. See, e.g., Sustained and Controlled Release Drug
Delivery Systems, J. R. Robinson, ed., Marcel Dekker, Inc., New
York, 1978.
[0286] Therapeutic compositions can be administered via medical
devices such as (1) needleless hypodermic injection devices (e.g.,
U.S. Pat. Nos. 5,399,163; 5,383,851; 5,312,335; 5,064,413;
4,941,880; 4,790,824; and 4,596,556); (2) micro-infusion pumps
(U.S. Pat. No. 4,487,603); (3) transdermal devices (U.S. Pat. No.
4,486,194); (4) infusion apparati (U.S. Pat. Nos. 4,447,233 and
4,447,224); and (5) osmotic devices (U.S. Pat. Nos. 4,439,196 and
4,475,196); the disclosures of which are incorporated herein by
reference.
[0287] In certain embodiments, the human monoclonal antibodies of
the invention can be formulated to ensure proper distribution in
vivo. For example, to ensure that the therapeutic compounds of the
invention cross the blood-brain barrier, they can be formulated in
liposomes, which may additionally comprise targeting moieties to
enhance selective transport to specific cells or organs. See, e.g.
U.S. Pat. Nos. 4,522,811; 5,374,548; 5,416,016; and 5,399,331; V.
V. Ranade (1989) J. Clin. Pharmacol. 29:685; Umezawa et al., (1988)
Biochem. Biophys. Res. Commun. 153:1038; Bloeman et al. (1995) FEBS
Lett. 357:140; M. Owais et al. (1995) Antimicrob. Agents Chemother.
39:180; Briscoe et al. (1995) Am. J. Physiol. 1233:134; Schreier et
al. (1994) J. Biol. Chem. 269:9090; Keinanen and Laukkanen (1994)
FEBS Lett. 346:123; and Killion and Fidler (1994) Immunomethods
4:273.
Uses and Methods of the Invention
[0288] The antibodies, antibody compositions and methods of the
present invention have numerous in vitro and in vivo utilities
involving, for example, detection of LAG-3 or enhancement of immune
response by blockade of LAG-3. In a preferred embodiment, the
antibodies of the present invention are human antibodies. For
example, these molecules can be administered to cells in culture,
in vitro or ex vivo, or to human subjects, e.g., in vivo, to
enhance immunity in a variety of situations. Accordingly, in one
aspect, the invention provides a method of modifying an immune
response in a subject comprising administering to the subject the
antibody, or antigen-binding portion thereof, of the invention such
that the immune response in the subject is modified. Preferably,
the response is enhanced, stimulated or up-regulated.
[0289] Preferred subjects include human patients in need of
enhancement of an immune response. The methods are particularly
suitable for treating human patients having a disorder that can be
treated by augmenting an immune response (e.g., the T-cell mediated
immune response). In a particular embodiment, the methods are
particularly suitable for treatment of cancer in vivo. To achieve
antigen-specific enhancement of immunity, the anti-LAG-3 antibodies
can be administered together with an antigen of interest or the
antigen may already be present in the subject to be treated (e.g.,
a tumor-bearing or virus-bearing subject). When antibodies to LAG-3
are administered together with another agent, the two can be
administered in either order or simultaneously.
[0290] The invention further provides methods for detecting the
presence of human LAG-3 antigen in a sample, or measuring the
amount of human LAG-3 antigen, comprising contacting the sample,
and a control sample, with a human monoclonal antibody, or an
antigen binding portion thereof, which specifically binds to human
LAG-3, under conditions that allow for formation of a complex
between the antibody or portion thereof and human LAG-3. The
formation of a complex is then detected, wherein a difference
complex formation between the sample compared to the control sample
is indicative the presence of human LAG-3 antigen in the sample.
Moreover, the anti-LAG-3 antibodies of the invention can be used to
purify human LAG-3 via immunoaffinity purification.
[0291] Given the ability of anti-LAG-3 antibodies of the invention
to inhibit the binding of LAG-3 to MHC Class II molecules and to
stimulate antigen-specific T cell responses, the invention also
provides in vitro and in vivo methods of using the antibodies of
the invention to stimulate, enhance or upregulate antigen-specific
T cell responses. For example, the invention provides a method of
stimulating an antigen-specific T cell response comprising
contacting said T cell with the antibody of the invention such that
an antigen-specific T cell response is stimulated. Any suitable
indicator of an antigen-specific T cell response can be used to
measure the antigen-specific T cell response. Non-limiting examples
of such suitable indicators include increased T cell proliferation
in the presence of the antibody and/or increase cytokine production
in the presence of the antibody. In a preferred embodiment,
interleukin-2 production by the antigen-specific T cell is
stimulated.
[0292] The invention also provides a method of stimulating an
immune response (e.g., an antigen-specific T cell response) in a
subject comprising administering an antibody of the invention to
the subject such that an immune response (e.g., an antigen-specific
T cell response) in the subject is stimulated. In a preferred
embodiment, the subject is a tumor-bearing subject and an immune
response against the tumor is stimulated. In another preferred
embodiment, the subject is a virus-bearing subject and an immune
response against the virus is stimulated.
[0293] In another aspect, the invention provides a method for
inhibiting growth of tumor cells in a subject comprising
administering to the subject an antibody of the invention such that
growth of the tumor is inhibited in the subject. In yet another
aspect, the invention provides a method of treating viral infection
in a subject comprising administering to the subject an antibody of
the invention such that the viral infection is treated in the
subject.
[0294] These and other methods of the invention are discussed in
further detail below.
Cancer
[0295] Blockade of LAG-3 by antibodies can enhance the immune
response to cancerous cells in the patient. In one aspect, the
present invention relates to treatment of a subject in vivo using
an anti-LAG-3 antibody such that growth of cancerous tumors is
inhibited. An anti-LAG-3 antibody can be used alone to inhibit the
growth of cancerous tumors. Alternatively, an anti-LAG-3 antibody
can be used in conjunction with other immunogenic agents, standard
cancer treatments, or other antibodies, as described below.
[0296] Accordingly, in one embodiment, the invention provides a
method of inhibiting growth of tumor cells in a subject, comprising
administering to the subject a therapeutically effective amount of
an anti-LAG-3 antibody, or antigen-binding portion thereof.
Preferably, the antibody is a human anti-LAG-3 antibody (such as
any of the human anti-human LAG-3 antibodies described herein).
Additionally or alternatively, the antibody can be a chimeric or
humanized anti-LAG-3 antibody.
[0297] Preferred cancers whose growth may be inhibited using the
antibodies of the invention include cancers typically responsive to
immunotherapy. Non-limiting examples of preferred cancers for
treatment include melanoma (e.g., metastatic malignant melanoma),
renal cancer (e.g. clear cell carcinoma), prostate cancer (e.g.
hormone refractory prostate adenocarcinoma), breast cancer, colon
cancer and lung cancer (e.g. non-small cell lung cancer).
Additionally, the invention includes refractory or recurrent
malignancies whose growth may be inhibited using the antibodies of
the invention.
[0298] Examples of other cancers that can be treated using the
methods of the invention include bone cancer, pancreatic cancer,
skin cancer, cancer of the head or neck, cutaneous or intraocular
malignant melanoma, uterine cancer, ovarian cancer, rectal cancer,
cancer of the anal region, stomach cancer, testicular cancer,
carcinoma of the fallopian tubes, carcinoma of the endometrium,
carcinoma of the cervix, carcinoma of the vagina, carcinoma of the
vulva, Hodgkin's Disease, non-Hodgkin's lymphoma, cancer of the
esophagus, cancer of the small intestine, cancer of the endocrine
system, cancer of the thyroid gland, cancer of the parathyroid
gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer
of the urethra, cancer of the penis, chronic or acute leukemias
including acute myeloid leukemia, chronic myeloid leukemia, acute
lymphoblastic leukemia, chronic lymphocytic leukemia, solid tumors
of childhood, lymphocytic lymphoma, cancer of the bladder, cancer
of the kidney or ureter, carcinoma of the renal pelvis, neoplasm of
the central nervous system (CNS), primary CNS lymphoma, tumor
angiogenesis, spinal axis tumor, brain stem glioma, pituitary
adenoma, Kaposi's sarcoma, epidermoid cancer, squamous cell cancer,
T-cell lymphoma, environmentally induced cancers including those
induced by asbestos, and combinations of said cancers. The present
invention is also useful for treatment of metastatic cancers,
especially metastatic cancers that express PD-L1 (Iwai et al.
(2005) Int. Immunol. 17:133-144).
[0299] Optionally, antibodies to LAG-3 can be combined with an
immunogenic agent, such as cancerous cells, purified tumor antigens
(including recombinant proteins, peptides, and carbohydrate
molecules), cells, and cells transfected with genes encoding immune
stimulating cytokines (He et al (2004) J. Immunol. 173:4919-28).
Non-limiting examples of tumor vaccines that can be used include
peptides of melanoma antigens, such as peptides of gp100, MAGE
antigens, Trp-2, MART1 and/or tyrosinase, or tumor cells
transfected to express the cytokine GM-CSF (discussed further
below).
[0300] In humans, some tumors have been shown to be immunogenic
such as melanomas. By raising the threshold of T cell activation by
LAG-3 blockade, the tumor responses in the host can be
activated.
[0301] LAG-3 blockade is likely to be more effective when combined
with a vaccination protocol. Many experimental strategies for
vaccination against tumors have been devised (see Rosenberg, S.,
2000, Development of Cancer Vaccines, ASCO Educational Book Spring:
60-62; Logothetis, C., 2000, ASCO Educational Book Spring: 300-302;
Khayat, D. 2000, ASCO Educational Book Spring: 414-428; Foon, K.
2000, ASCO Educational Book Spring: 730-738; see also Restifo, N.
and Sznol, M., Cancer Vaccines, Ch. 61, pp. 3023-3043 in DeVita et
al. (eds.), 1997, Cancer: Principles and Practice of Oncology,
Fifth Edition). In one of these strategies, a vaccine is prepared
using autologous or allogeneic tumor cells. These cellular vaccines
have been shown to be most effective when the tumor cells are
transduced to express GM-CSF. GM-CSF has been shown to be a potent
activator of antigen presentation for tumor vaccination (Dranoff et
al. (1993) Proc. Natl. Acad. Sci U.S.A. 90: 3539-43).
[0302] The study of gene expression and large scale gene expression
patterns in various tumors has led to the definition of so called
tumor specific antigens (Rosenberg, S A (1999) Immunity 10: 281-7).
In many cases, these tumor specific antigens are differentiation
antigens expressed in the tumors and in the cell from which the
tumor arose, for example melanocyte antigens gp100, MAGE antigens,
and Trp-2. More importantly, many of these antigens can be shown to
be the targets of tumor specific T cells found in the host. LAG-3
blockade can be used in conjunction with a collection of
recombinant proteins and/or peptides expressed in a tumor in order
to generate an immune response to these proteins. These proteins
are normally viewed by the immune system as self antigens and are
therefore tolerant to them. The tumor antigen can include the
protein telomerase, which is required for the synthesis of
telomeres of chromosomes and which is expressed in more than 85% of
human cancers and in only a limited number of somatic tissues (Kim
et al. (1994) Science 266: 2011-2013). (These somatic tissues may
be protected from immune attack by various means). Tumor antigen
can also be "neo-antigens" expressed in cancer cells because of
somatic mutations that alter protein sequence or create fusion
proteins between two unrelated sequences (i.e., bcr-abl in the
Philadelphia chromosome), or idiotype from B cell tumors.
[0303] Other tumor vaccines can include the proteins from viruses
implicated in human cancers such a Human Papilloma Viruses (HPV),
Hepatitis Viruses (HBV and HCV) and Kaposi's Herpes Sarcoma Virus
(KHSV). Another form of tumor specific antigen which can be used in
conjunction with LAG-3 blockade is purified heat shock proteins
(HSP) isolated from the tumor tissue itself. These heat shock
proteins contain fragments of proteins from the tumor cells and
these HSPs are highly efficient at delivery to antigen presenting
cells for eliciting tumor immunity (Suot & Srivastava (1995)
Science 269:1585-1588; Tamura et al. (1997) Science
278:117-120).
[0304] Dendritic cells (DC) are potent antigen presenting cells
that can be used to prime antigen-specific responses. DC's can be
produced ex vivo and loaded with various protein and peptide
antigens as well as tumor cell extracts (Nestle et al. (1998)
Nature Medicine 4: 328-332). DCs can also be transduced by genetic
means to express these tumor antigens as well. DCs have also been
fused directly to tumor cells for the purposes of immunization
(Kugler et al. (2000) Nature Medicine 6:332-336). As a method of
vaccination, DC immunization can be effectively combined with LAG-3
blockade to activate more potent anti-tumor responses.
[0305] LAG-3 blockade can also be combined with standard cancer
treatments. LAG-3 blockade can be effectively combined with
chemotherapeutic regimes. In these instances, it may be possible to
reduce the dose of chemotherapeutic reagent administered (Mokyr et
al. (1998) Cancer Research 58: 5301-5304). An example of such a
combination is an anti-LAG-3 antibody in combination with
decarbazine for the treatment of melanoma. Another example of such
a combination is an anti-LAG-3 antibody in combination with
interleukin-2 (IL-2) for the treatment of melanoma. The scientific
rationale behind the combined use of LAG-3 blockade and
chemotherapy is that cell death, that is a consequence of the
cytotoxic action of most chemotherapeutic compounds, should result
in increased levels of tumor antigen in the antigen presentation
pathway. Other combination therapies that may result in synergy
with LAG-3 blockade through cell death are radiation, surgery, and
hormone deprivation. Each of these protocols creates a source of
tumor antigen in the host. Angiogenesis inhibitors can also be
combined with LAG-3 blockade. Inhibition of angiogenesis leads to
tumor cell death which may feed tumor antigen into host antigen
presentation pathways.
[0306] LAG-3 blocking antibodies can also be used in combination
with bispecific antibodies that target Fc.alpha. or Fc.gamma.
receptor-expressing effectors cells to tumor cells (see, e.g., U.S.
Pat. Nos. 5,922,845 and 5,837,243). Bispecific antibodies can be
used to target two separate antigens. For example anti-Fc
receptor/anti tumor antigen (e.g., Her-2/neu) bispecific antibodies
have been used to target macrophages to sites of tumor. This
targeting may more effectively activate tumor specific responses.
The T cell arm of these responses would be augmented by the use of
LAG-3 blockade. Alternatively, antigen may be delivered directly to
DCs by the use of bispecific antibodies which bind to tumor antigen
and a dendritic cell specific cell surface marker.
[0307] Tumors evade host immune surveillance by a large variety of
mechanisms. Many of these mechanisms may be overcome by the
inactivation of proteins which are expressed by the tumors and
which are immunosuppressive. These include among others TGF-.beta.
(Kehrl et al. (1986)J. Exp. Med. 163: 1037-1050), IL-10 (Howard
& O'Garra (1992) Immunology Today 13: 198-200), and Fas ligand
(Hahne et al. (1996) Science 274: 1363-1365). Antibodies to each of
these entities can be used in combination with anti-LAG-3 to
counteract the effects of the immunosuppressive agent and favor
tumor immune responses by the host.
[0308] Other antibodies which activate host immune responsiveness
can be used in combination with anti-LAG-3. These include molecules
on the surface of dendritic cells which activate DC function and
antigen presentation. Anti-CD40 antibodies are able to substitute
effectively for T cell helper activity (Ridge et al. (1998) Nature
393: 474-478) and can be used in conjunction with LAG-3 antibodies
(Ito et al. (2000) Immunobiology 201 (5) 527-40). Activating
antibodies to T cell costimulatory molecules such as CTLA-4 (e.g.,
U.S. Pat. No. 5,811,097), OX-40 (Weinberg et al. (2000) Immunol
164: 2160-2169), 4-1BB (Melero et al. (1997) Nature Medicine 3:
682-685 (1997), and ICOS (Hutloff et al. (1999) Nature 397:
262-266) may also provide for increased levels of T cell
activation.
[0309] Bone marrow transplantation is currently being used to treat
a variety of tumors of hematopoietic origin. While graft versus
host disease is a consequence of this treatment, therapeutic
benefit may be obtained from graft vs. tumor responses. LAG-3
blockade can be used to increase the effectiveness of the donor
engrafted tumor specific T cells.
[0310] There are also several experimental treatment protocols that
involve ex vivo activation and expansion of antigen specific T
cells and adoptive transfer of these cells into recipients in order
to stimulate antigen-specific T cells against tumor (Greenberg
& Riddell (1999) Science 285: 546-51). These methods can also
be used to activate T cell responses to infectious agents such as
CMV. Ex vivo activation in the presence of anti-LAG-3 antibodies
can increase the frequency and activity of the adoptively
transferred T cells.
Infectious Diseases
[0311] Other methods of the invention are used to treat patients
that have been exposed to particular toxins or pathogens.
Accordingly, another aspect of the invention provides a method of
treating an infectious disease in a subject comprising
administering to the subject an anti-LAG-3 antibody, or
antigen-binding portion thereof, such that the subject is treated
for the infectious disease. Preferably, the antibody is a human
anti-human LAG-3 antibody (such as any of the human anti-LAG-3
antibodies described herein). Additionally or alternatively, the
antibody can be a chimeric or humanized antibody.
[0312] Similar to its application to tumors as discussed above,
antibody mediated LAG-3 blockade can be used alone, or as an
adjuvant, in combination with vaccines, to stimulate the immune
response to pathogens, toxins, and self-antigens. Examples of
pathogens for which this therapeutic approach can be particularly
useful, include pathogens for which there is currently no effective
vaccine, or pathogens for which conventional vaccines are less than
completely effective. These include, but are not limited to HIV,
Hepatitis (A, B, & C), Influenza, Herpes, Giardia, Malaria,
Leishmania, Staphylococcus aureus, Pseudomonas aeruginosa. LAG-3
blockade is particularly useful against established infections by
agents such as HIV that present altered antigens over the course of
the infections. These novel epitopes are recognized as foreign at
the time of anti-human LAG-3 administration, thus provoking a
strong T cell response that is not dampened by negative signals
through LAG-3.
[0313] Some examples of pathogenic viruses causing infections
treatable by methods of the invention include HIV, hepatitis (A, B,
or C), herpes virus (e.g., VZV, HSV-1, HAV-6, HSV-II, and CMV,
Epstein Barr virus), adenovirus, influenza virus, flaviviruses,
echovirus, rhinovirus, coxsackie virus, coronavirus, respiratory
syncytial virus, mumps virus, rotavirus, measles virus, rubella
virus, parvovirus, vaccinia virus, HTLV virus, dengue virus,
papillomavirus, molluscum virus, poliovirus, rabies virus, JC virus
and arboviral encephalitis virus.
[0314] Some examples of pathogenic bacteria causing infections
treatable by methods of the invention include chlamydia,
rickettsial bacteria, mycobacteria, staphylococci, streptococci,
pneumonococci, meningococci and gonococci, klebsiella, proteus,
serratia, pseudomonas, legionella, diphtheria, salmonella, bacilli,
cholera, tetanus, botulism, anthrax, plague, leptospirosis, and
Lymes disease bacteria.
[0315] Some examples of pathogenic fungi causing infections
treatable by methods of the invention include Candida (albicans,
krusei, glabrata, tropicalis, etc.), Cryptococcus neoformans,
Aspergillus (fumigatus, niger, etc.), Genus Mucorales (mucor,
absidia, rhizopus), Sporothrix schenkii, Blastomyces dermatitidis,
Paracoccidioides brasiliensis, Coccidioides immitis and Histoplasma
capsulatum.
[0316] Some examples of pathogenic parasites causing infections
treatable by methods of the invention include Entamoeba
histolytica, Balantidium coli, Naegleriafowleri, Acanthamoeba sp.,
Giardia lambia, Cryptosporidium sp., Pneumocystis carinii,
Plasmodium vivax, Babesia microti, Trypanosoma brucei, Trypanosoma
cruzi, Leishmania donovani, Toxoplasma gondii, Nippostrongylus
brasiliensis.
[0317] In all of the above methods, LAG-3 blockade can be combined
with other forms of immunotherapy such as cytokine treatment (e.g.,
interferons, GM-CSF, G-CSF, IL-2), or bispecific antibody therapy,
which provides for enhanced presentation of tumor antigens (see,
e.g., Holliger (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448;
Poljak (1994) Structure 2:1121-1123).
Autoimmune Reactions
[0318] Anti-LAG-3 antibodies may provoke and amplify autoimmune
responses. Indeed, induction of anti-tumor responses using tumor
cell and peptide vaccines reveals that many anti-tumor responses
involve anti-self reactivities (van Elsas et al. (2001) J Exp. Med.
194:481-489; Overwijk, et al. (1999) Proc. Natl. Acad. Sci. U.S.A.
96: 2982-2987; Hurwitz, (2000) supra; Rosenberg & White (1996)
J. Immunother Emphasis Tumor Immunol 19 (1): 81-4). Therefore, it
is possible to consider using anti-LAG-3 blockade in conjunction
with various self proteins in order to devise vaccination protocols
to efficiently generate immune responses against these self
proteins for disease treatment. For example, Alzheimer's disease
involves inappropriate accumulation of A.beta. peptide in amyloid
deposits in the brain; antibody responses against amyloid are able
to clear these amyloid deposits (Schenk et al., (1999) Nature 400:
173-177).
[0319] Other self proteins can also be used as targets such as IgE
for the treatment of allergy and asthma, and TNF.alpha. for
rheumatoid arthritis. Finally, antibody responses to various
hormones may be induced by the use of anti-LAG-3 antibody.
Neutralizing antibody responses to reproductive hormones can be
used for contraception.
[0320] Neutralizing antibody response to hormones and other soluble
factors that are required for the growth of particular tumors can
also be considered as possible vaccination targets.
[0321] Analogous methods as described above for the use of
anti-LAG-3 antibody can be used for induction of therapeutic
autoimmune responses to treat patients having an inappropriate
accumulation of other self-antigens, such as amyloid deposits,
including A.beta. in Alzheimer's disease, cytokines such as
TNF.alpha., and IgE.
Vaccines
[0322] Anti-LAG-3 antibodies can be used to stimulate
antigen-specific immune responses by coadministration of an
anti-LAG-3 antibody with an antigen of interest (e.g., a vaccine).
Accordingly, in another aspect the invention provides a method of
enhancing an immune response to an antigen in a subject, comprising
administering to the subject: (i) the antigen; and (ii) an
anti-LAG-3 antibody, or antigen-binding portion thereof, such that
an immune response to the antigen in the subject is enhanced.
Preferably, the antibody is a human anti-human LAG-3 antibody (such
as any of the human anti-LAG-3 antibodies described herein).
Additionally or alternatively, the antibody can be a chimeric or
humanized antibody. The antigen can be, for example, a tumor
antigen, a viral antigen, a bacterial antigen or an antigen from a
pathogen. Non-limiting examples of such antigens include those
discussed in the sections above, such as the tumor antigens (or
tumor vaccines) discussed above, or antigens from the viruses,
bacteria or other pathogens described above.
[0323] Suitable routes of administering the antibody compositions
(e.g., human monoclonal antibodies, multispecific and bispecific
molecules and immunoconjugates) of the invention in vivo and in
vitro are well known in the art and can be selected by those of
ordinary skill. For example, the antibody compositions can be
administered by injection (e.g., intravenous or subcutaneous).
Suitable dosages of the molecules used will depend on the age and
weight of the subject and the concentration and/or formulation of
the antibody composition.
[0324] As previously described, human anti-LAG-3 antibodies of the
invention can be co-administered with one or other more therapeutic
agents, e.g., a cytotoxic agent, a radiotoxic agent or an
immunosuppressive agent. The antibody can be linked to the agent
(as an immuno-complex) or can be administered separate from the
agent. In the latter case (separate administration), the antibody
can be administered before, after or concurrently with the agent or
can be co-administered with other known therapies, e.g., an
anti-cancer therapy, e.g., radiation. Such therapeutic agents
include, among others, anti-neoplastic agents such as doxorubicin
(adriamycin), cisplatin bleomycin sulfate, carmustine,
chlorambucil, dacarbazine and cyclophosphamide hydroxyurea which,
by themselves, are only effective at levels which are toxic or
subtoxic to a patient. Cisplatin is intravenously administered as a
100 mg/ml dose once every four weeks and adriamycin is
intravenously administered as a 60-75 mg/ml dose once every 21
days. Co-administration of the human anti-LAG-3 antibodies, or
antigen binding fragments thereof, of the present invention with
chemotherapeutic agents provides two anti-cancer agents which
operate via different mechanisms which yield a cytotoxic effect to
human tumor cells. Such co-administration can solve problems due to
development of resistance to drugs or a change in the antigenicity
of the tumor cells which would render them unreactive with the
antibody.
[0325] Also within the scope of the present invention are kits
comprising the antibody compositions of the invention (e.g., human
antibodies, bispecific or multispecific molecules, or
immunoconjugates) and instructions for use. The kit can further
contain at least one additional reagent, or one or more additional
human antibodies of the invention (e.g., a human antibody having a
complementary activity which binds to an epitope in LAG-3 antigen
distinct from the first human antibody). Kits typically include a
label indicating the intended use of the contents of the kit. The
term label includes any writing, or recorded material supplied on
or with the kit, or which otherwise accompanies the kit.
Combination Therapy
[0326] In another aspect, the invention provides methods of
combination therapy in which an anti-LAG-3 antibody is
coadministered with one or more additional antibodies that are
effective in stimulating immune responses to thereby further
enhance, stimulate or upregulate immune responses in a subject. For
example, the invention provides a method for stimulating an immune
response in a subject comprising administering to the subject an
anti-LAG-3 antibody and one or more additional immunostimulatory
antibodies, such as an anti-PD-1 antibody, an anti-PD-L1 antibody
and/or an anti-CTLA-4 antibody, such that an immune response is
stimulated in the subject, for example to inhibit tumor growth or
to stimulate an anti-viral response. In one embodiment, the subject
is administered an anti-LAG-3 antibody and an anti-PD-1 antibody.
In another embodiment, the subject is administered an anti-LAG-3
antibody and an anti-PD-L1 antibody. In yet another embodiment, the
subject is administered an anti-LAG-3 antibody and an anti-CTLA-4
antibody. In one embodiment, the anti-LAG-3 antibody is a human
antibody, such as an antibody of the disclosure. Alternatively, the
anti-LAG-3 antibody can be, for example, a chimeric or humanized
antibody (e.g., prepared from a mouse anti-LAG-3 mAb). In another
embodiment, the at least one additional immunostimulatory antibody
(e.g., anti-PD-1, anti-PD-L1 and/or anti-CTLA-4 antibody) is a
human antibody. Alternatively, the at least one additional
immunostimulatory antibody can be, for example, a chimeric or
humanized antibody (e.g., prepared from a mouse anti-PD-1,
anti-PD-L1 and/or anti-CTLA-4 antibody).
[0327] In one embodiment, the present invention provides a method
for treating a hyperproliferative disease (e.g., cancer),
comprising administering a LAG-3 antibody and a CTLA-4 antibody to
a subject. In further embodiments, the anti-LAG-3 antibody is
administered at a subtherapeutic dose, the anti-CTLA-4 antibody is
administered at a subtherapeutic dose, or both are administered at
a subtherapeutic dose. In another embodiment, the present invention
provides a method for altering an adverse event associated with
treatment of a hyperproliferative disease with an immunostimulatory
agent, comprising administering an anti-LAG-3 antibody and a
subtherapeutic dose of anti-CTLA-4 antibody to a subject. In
certain embodiments, the subject is human. In certain embodiments,
the anti-CTLA-4 antibody is human sequence monoclonal antibody 10D1
(described in PCT Publication WO 01/14424) and the anti-LAG-3
antibody is human sequence monoclonal antibody, such as 25F7,
26H10, 25E3, 8B7, 11F2 or 17E5 described herein. Other anti-CTLA-4
antibodies encompassed by the methods of the present invention
include, for example, those disclosed in: WO 98/42752; WO 00/37504;
U.S. Pat. No. 6,207,156; Hurwitz et al. (1998) Proc. Natl. Acad.
Sci. USA 95(17):10067-10071; Camacho et al. (2004) J. Clin.
Oncology 22(145): Abstract No. 2505 (antibody CP-675206); and Mokyr
et al. (1998) Cancer Res. 58:5301-5304. In certain embodiments, the
anti-CTLA-4 antibody binds to human CTLA-4 with a K.sub.D of
5.times.10.sup.-8 M or less, binds to human CTLA-4 with a K.sub.D
of 1.times.10.sup.-8 M or less, binds to human CTLA-4 with a
K.sub.D of 5.times.10.sup.-9 M or less, or binds to human CTLA-4
with a K.sub.D of between 1.times.10.sup.-8M and 1.times.10.sup.-10
M or less.
[0328] In one embodiment, the present invention provides a method
for treating a hyperproliferative disease (e.g., cancer),
comprising administering a LAG-3 antibody and a PD-1 antibody to a
subject. In further embodiments, the anti-LAG-3 antibody is
administered at a subtherapeutic dose, the anti-PD-1 antibody is
administered at a subtherapeutic dose, or both are administered at
a subtherapeutic dose. In another embodiment, the present invention
provides a method for altering an adverse event associated with
treatment of a hyperproliferative disease with an immunostimulatory
agent, comprising administering an anti-LAG-3 antibody and a
subtherapeutic dose of anti-PD-1 antibody to a subject. In certain
embodiments, the subject is human. In certain embodiments, the
anti-PD-1 antibody is a human sequence monoclonal antibody and the
anti-LAG-3 antibody is human sequence monoclonal antibody, such as
25F7, 26H10, 25E3, 8B7, 11F2 or 17E5 described herein. Examples of
human sequence anti-PD-1 antibodies include 17D8, 2D3, 4H1, 5C4 and
4A11, which are described in PCT Publication WO 06/121168. In
certain embodiments, the anti-PD-1 antibody binds to human PD-1
with a K.sub.D of 5.times.10.sup.-8 M or less, binds to human PD-1
with a K.sub.D of 1.times.10.sup.-8 M or less, binds to human PD-1
with a K.sub.D of 5.times.10.sup.-9 M or less, or binds to human
PD-1 with a K.sub.D of between 1.times.10.sup.-8M and
1.times.10.sup.-10 M or less.
[0329] In one embodiment, the present invention provides a method
for treating a hyperproliferative disease (e.g., cancer),
comprising administering a LAG-3 antibody and a PD-L1 antibody to a
subject. In further embodiments, the anti-LAG-3 antibody is
administered at a subtherapeutic dose, the anti-PD-L1 antibody is
administered at a subtherapeutic dose, or both are administered at
a subtherapeutic dose. In another embodiment, the present invention
provides a method for altering an adverse event associated with
treatment of a hyperproliferative disease with an immunostimulatory
agent, comprising administering an anti-LAG-3 antibody and a
subtherapeutic dose of anti-PD-L1 antibody to a subject. In certain
embodiments, the subject is human. In certain embodiments, the
anti-PD-L1 antibody is a human sequence monoclonal antibody and the
anti-LAG-3 antibody is human sequence monoclonal antibody, such as
25F7, 26H10, 25E3, 8B7, 11F2 or 17E5 described herein. Examples of
human sequence anti-PD-L1 antibodies include 3G10, 12A4, 10A5, 5F8,
10H10, 1B12, 7H1, 11E6, 12B7 and 13G4, which are described in PCT
Publication WO 07/005874. In certain embodiments, the anti-PD-L1
antibody binds to human PD-L1 with a K.sub.D of 5.times.10.sup.-8 M
or less, binds to human PD-L1 with a K.sub.D of 1.times.10.sup.-8 M
or less, binds to human PD-L1 with a K.sub.D of 5.times.10.sup.-9 M
or less, or binds to human PD-L1 with a K.sub.D of between
1.times.10.sup.-8 M and 1.times.10.sup.-10 M or less.
[0330] Blockade of LAG-3 and one or more second target antigens
such as CTLA-4 and/or PD-1 and/or PD-L1 by antibodies can enhance
the immune response to cancerous cells in the patient. Cancers
whose growth may be inhibited using the antibodies of the instant
disclosure include cancers typically responsive to immunotherapy.
Representative examples of cancers for treatment with the
combination therapy of the instant disclosure include those cancers
specifically listed above in the discussion of monotherapy with
anti-LAG-3 antibodies.
[0331] In certain embodiments, the combination of therapeutic
antibodies discussed herein can be administered concurrently as a
single composition in a pharmaceutically acceptable carrier, or
concurrently as separate compositions with each antibody in a
pharmaceutically acceptable carrier. In another embodiment, the
combination of therapeutic antibodies can be administered
sequentially. For example, an anti-CTLA-4 antibody and an
anti-LAG-3 antibody can be administered sequentially, such as
anti-CTLA-4 antibody being administered first and anti-LAG-3
antibody second, or anti-LAG-3 antibody being administered first
and anti-CTLA-4 antibody second. Additionally or alternatively, an
anti-PD-1 antibody and an anti-LAG-3 antibody can be administered
sequentially, such as anti-PD-1 antibody being administered first
and anti-LAG-3 antibody second, or anti-LAG-3 antibody being
administered first and anti-PD-1 antibody second. Additionally or
alternatively, an anti-PD-L1 antibody and an anti-LAG-3 antibody
can be administered sequentially, such as anti-PD-L1 antibody being
administered first and anti-LAG-3 antibody second, or anti-LAG-3
antibody being administered first and anti-PD-L1 antibody
second.
[0332] Furthermore, if more than one dose of the combination
therapy is administered sequentially, the order of the sequential
administration can be reversed or kept in the same order at each
time point of administration, sequential administrations can be
combined with concurrent administrations, or any combination
thereof. For example, the first administration of a combination
anti-CTLA-4 antibody and anti-LAG-3 antibody can be concurrent, the
second administration can be sequential with anti-CTLA-4 first and
anti-LAG-3 second, and the third administration can be sequential
with anti-LAG-3 first and anti-CTLA-4 second, etc. Additionally or
alternatively, the first administration of a combination anti-PD-1
antibody and anti-LAG-3 antibody can be concurrent, the second
administration can be sequential with anti-PD-1 first and
anti-LAG-3 second, and the third administration can be sequential
with anti-LAG-3 first and anti-PD-1 second, etc. Additionally or
alternatively, the first administration of a combination anti-PD-L1
antibody and anti-LAG-3 antibody can be concurrent, the second
administration can be sequential with anti-PD-L1 first and
anti-LAG-3 second, and the third administration can be sequential
with anti-LAG-3 first and anti-PD-L1 second, etc. Another
representative dosing scheme can involve a first administration
that is sequential with anti-LAG-3 first and anti-CTLA-4 (and/or
anti-PD-1 and/or anti-PD-L1) second, and subsequent administrations
may be concurrent.
[0333] Optionally, the combination of anti-LAG-3 and one or more
additional antibodies (e.g., anti-CTLA-4 and/or anti-PD-1 and/or
anti-PD-L1 antibodies) can be further combined with an immunogenic
agent, such as cancerous cells, purified tumor antigens (including
recombinant proteins, peptides, and carbohydrate molecules), cells,
and cells transfected with genes encoding immune stimulating
cytokines (He et al. (2004) J. Immunol. 173:4919-28). Non-limiting
examples of tumor vaccines that can be used include peptides of
melanoma antigens, such as peptides of gp100, MAGE antigens, Trp-2,
MART1 and/or tyrosinase, or tumor cells transfected to express the
cytokine GM-CSF (discussed further below). A combined LAG-3 and
CTLA-4 and/or PD-1 and/or PD-L1 blockade can be further combined
with a vaccination protocol, such as any of the vaccination
protocols discussed in detail above with respect to monotherapy
with anti-LAG-3 antibodies.
[0334] A combined LAG-3 and CTLA-4 and/or PD-1 and/or PD-L1
blockade can also be further combined with standard cancer
treatments. For example, a combined LAG-3 and CTLA-4 and/or PD-1
and/or PD-L1 blockade can be effectively combined with
chemotherapeutic regimes. In these instances, it is possible to
reduce the dose of other chemotherapeutic reagent administered with
the combination of the instant disclosure (Mokyr et al. (1998)
Cancer Research 58: 5301-5304). An example of such a combination is
a combination of anti-LAG-3 and anti-CTLA-4 antibodies and/or
anti-PD-1 antibodies and/or anti-PD-L1 antibodies further in
combination with decarbazine for the treatment of melanoma. Another
example is a combination of anti-LAG-3 and anti-CTLA-4 antibodies
and/or anti-PD-1 antibodies and/or anti-PD-L1 antibodies further in
combination with interleukin-2 (IL-2) for the treatment of
melanoma. The scientific rationale behind the combined use of LAG-3
and CTLA-4 and/or PD-1 and/or PD-L1 blockade with chemotherapy is
that cell death, which is a consequence of the cytotoxic action of
most chemotherapeutic compounds, should result in increased levels
of tumor antigen in the antigen presentation pathway. Other
combination therapies that may result in synergy with a combined
LAG-3 and CTLA-4 and/or PD-1 and/or PD-L1 blockade through cell
death include radiation, surgery, or hormone deprivation. Each of
these protocols creates a source of tumor antigen in the host.
Angiogenesis inhibitors can also be combined with a combined LAG-3
and CTLA-4 and/or PD-1 and/or PD-L1 blockade. Inhibition of
angiogenesis leads to tumor cell death, which can be a source of
tumor antigen fed into host antigen presentation pathways.
[0335] A combination of LAG-3 and CTLA-4 and/or PD-1 and/or PD-L1
blocking antibodies can also be used in combination with bispecific
antibodies that target Fc.alpha. or Fc.gamma. receptor-expressing
effector cells to tumor cells (see, e.g., U.S. Pat. Nos. 5,922,845
and 5,837,243). Bispecific antibodies can be used to target two
separate antigens. The T cell arm of these responses would be
augmented by the use of a combined LAG-3 and CTLA-4 and/or PD-1
and/or PD-L1 blockade.
[0336] In another example, a combination of anti-LAG-3 and
anti-CTLA-4 and/or anti-PD-1 antibodies and/or anti-PD-L1
antibodies can be used in conjunction with anti-neoplastic
antibodies, such as Rituxan.RTM. (rituximab), Herceptin.RTM.
(trastuzumab), Bexxar.RTM. (tositumomab), Zevalin.RTM.
(ibritumomab), Campath.RTM. (alemtuzumab), Lymphocide.RTM.
(eprtuzumab), Avastin.RTM. (bevacizumab), and Tarceva.RTM.
(erlotinib), and the like. By way of example and not wishing to be
bound by theory, treatment with an anti-cancer antibody or an
anti-cancer antibody conjugated to a toxin can lead to cancer cell
death (e.g., tumor cells) which would potentiate an immune response
mediated by CTLA-4, PD-1, PD-L1 or LAG-3. In an exemplary
embodiment, a treatment of a hyperproliferative disease (e.g., a
cancer tumor) can include an anti-cancer antibody in combination
with anti-LAG-3 and anti-CTLA-4 and/or anti-PD-1 and/or anti-PD-L1
antibodies, concurrently or sequentially or any combination
thereof, which can potentiate an anti-tumor immune responses by the
host.
[0337] Tumors evade host immune surveillance by a large variety of
mechanisms. Many of these mechanisms may be overcome by the
inactivation of proteins, which are expressed by the tumors and
which are immunosuppressive. These include, among others,
TGF-.beta. (Kehrl et al. (1986)J Exp. Med. 163: 1037-1050), IL-10
(Howard & O'Garra (1992) Immunology Today 13: 198-200), and Fas
ligand (Hahne et al. (1996) Science 274: 1363-1365). In another
example, antibodies to each of these entities can be further
combined with an anti-LAG-3 and anti-CTLA-4 and/or anti-PD-1 and/or
anti-PD-L1 antibody combination to counteract the effects of
immunosuppressive agents and favor anti-tumor immune responses by
the host.
[0338] Other antibodies that can be used to activate host immune
responsiveness can be further used in combination with an
anti-LAG-3 and anti-CTLA-4 and/or anti-PD-1 and/or anti-PD-L1
antibody combination. These include molecules on the surface of
dendritic cells that activate DC function and antigen presentation.
Anti-CD40 antibodies (Ridge et al., supra) can be used in
conjunction with an anti-LAG-3 and anti-CTLA-4 and/or anti-PD-1
and/or anti-PD-L1 combination (Ito et al., supra). Other activating
antibodies to T cell costimulatory molecules Weinberg et al.,
supra, Melero et al. supra, Hutloff et al., supra) may also provide
for increased levels of T cell activation.
[0339] As discussed above, bone marrow transplantation is currently
being used to treat a variety of tumors of hematopoietic origin. A
combined LAG-3 and CTLA-4 and/or PD-1 and/or PD-L1 blockade can be
used to increase the effectiveness of the donor engrafted tumor
specific T cells.
[0340] Several experimental treatment protocols involve ex vivo
activation and expansion of antigen specific T cells and adoptive
transfer of these cells into recipients in order to
antigen-specific T cells against tumor (Greenberg & Riddell,
supra). These methods can also be used to activate T cell responses
to infectious agents such as CMV. Ex vivo activation in the
presence of anti-LAG-3 and anti-CTLA-4 and/or anti-PD-1 and/or
anti-PD-L1 antibodies can be expected to increase the frequency and
activity of the adoptively transferred T cells.
[0341] In certain embodiments, the present invention provides a
method for altering an adverse event associated with treatment of a
hyperproliferative disease (e.g., cancer) with an immunostimulatory
agent, comprising administering a anti-LAG-3 antibody and a
subtherapeutic dose of anti-CTLA-4 and/or anti-PD-land/or
anti-PD-L1 antibody to a subject. For example, the methods of the
present invention provide for a method of reducing the incidence of
immunostimulatory therapeutic antibody-induced colitis or diarrhea
by administering a non-absorbable steroid to the patient. Because
any patient who will receive an immunostimulatory therapeutic
antibody is at risk for developing colitis or diarrhea induced by
such an antibody, this entire patient population is suitable for
therapy according to the methods of the present invention. Although
steroids have been administered to treat inflammatory bowel disease
(IBD) and prevent exacerbations of IBD, they have not been used to
prevent (decrease the incidence of) IBD in patients who have not
been diagnosed with IBD. The significant side effects associated
with steroids, even non-absorbable steroids, have discouraged
prophylactic use.
[0342] In further embodiments, a combination LAG-3 and CTLA-4
and/or PD-1 and/or PD-L1 blockade (i.e., immunostimulatory
therapeutic antibodies anti-LAG-3 and anti-CTLA-4 and/or anti-PD-1
antibodies and/or anti-PD-L1 antibodies) can be further combined
with the use of any non-absorbable steroid. As used herein, a
"non-absorbable steroid" is a glucocorticoid that exhibits
extensive first pass metabolism such that, following metabolism in
the liver, the bioavailability of the steroid is low, i.e., less
than about 20%. In one embodiment of the invention, the
non-absorbable steroid is budesonide. Budesonide is a
locally-acting glucocorticosteroid, which is extensively
metabolized, primarily by the liver, following oral administration.
ENTOCORT EC.RTM. (Astra-Zeneca) is a pH- and time-dependent oral
formulation of budesonide developed to optimize drug delivery to
the ileum and throughout the colon. ENTOCORT EC.RTM. is approved in
the U.S. for the treatment of mild to moderate Crohn's disease
involving the ileum and/or ascending colon. The usual oral dosage
of ENTOCORT EC.RTM. for the treatment of Crohn's disease is 6 to 9
mg/day. ENTOCORT EC.RTM. is released in the intestines before being
absorbed and retained in the gut mucosa. Once it passes through the
gut mucosa target tissue, ENTOCORT EC is extensively metabolized by
the cytochrome P450 system in the liver to metabolites with
negligible glucocorticoid activity. Therefore, the bioavailability
is low (about 10%). The low bioavailability of budesonide results
in an improved therapeutic ratio compared to other glucocorticoids
with less extensive first-pass metabolism. Budesonide results in
fewer adverse effects, including less hypothalamic-pituitary
suppression, than systemically-acting corticosteroids. However,
chronic administration of ENTOCORT EC.RTM. can result in systemic
glucocorticoid effects such as hypercorticism and adrenal
suppression. See PDR 58.sup.th ed. 2004; 608-610.
[0343] In still further embodiments, a combination LAG-3 and CTLA-4
and/or PD-1 and/or PD-L1 blockade (i.e., immunostimulatory
therapeutic antibodies anti-LAG-3 and anti-CTLA-4 and/or anti-PD-1
and/or anti-PD-L1 antibodies) in conjunction with a non-absorbable
steroid can be further combined with a salicylate. Salicylates
include 5-ASA agents such as, for example: sulfasalazine
(AZULFIDINE.RTM., Pharmacia & UpJohn); olsalazine
(DIPENTUM.RTM., Pharmacia & UpJohn); balsalazide (COLAZAL.RTM.,
Salix Pharmaceuticals, Inc.); and mesalamine (ASACOL.RTM., Procter
& Gamble Pharmaceuticals; PENTASA.RTM., Shire US; CANASA.RTM.,
Axcan Scandipharm, Inc.; ROWASA.RTM., Solvay).
[0344] In accordance with the methods of the present invention, a
salicylate administered in combination with anti-LAG-3 and
anti-CTLA-4 and/or anti-PD-1 and/or anti-PD-L1 antibodies and a
non-absorbable steroid can includes any overlapping or sequential
administration of the salicylate and the non-absorbable steroid for
the purpose of decreasing the incidence of colitis induced by the
immunostimulatory antibodies. Thus, for example, methods for
reducing the incidence of colitis induced by the immunostimulatory
antibodies according to the present invention encompass
administering a salicylate and a non-absorbable concurrently or
sequentially (e.g., a salicylate is administered 6 hours after a
non-absorbable steroid), or any combination thereof. Further,
according to the present invention, a salicylate and a
non-absorbable steroid can be administered by the same route (e.g.,
both are administered orally) or by different routes (e.g., a
salicylate is administered orally and a non-absorbable steroid is
administered rectally), which may differ from the route(s) used to
administer the anti-LAG-3 and anti-CTLA-4 and/or anti-PD-1 and/or
anti-PD-L1 antibodies.
[0345] The present disclosure is further illustrated by the
following examples, which should not be construed as further
limiting. The contents of all figures and all references, Genbank
sequences, patents and published patent applications cited
throughout this application are expressly incorporated herein by
reference. In particular, the disclosures of PCT publications WO
09/045957, WO 09/073533, WO 09/073546, and WO 09/054863 are
expressly incorporated herein by reference.
Example 1: Generation of Human Monoclonal Antibodies Against
LAG-3
[0346] Anti-LAG-3 human monoclonal antibodies were generated using
transgenic mice that express human antibody genes, as follows.
[0347] Antigens
[0348] Recombinant human LAG-3 fusion proteins were used as the
immunogen to raise anti-human LAG-3 antibodies. In certain
immunizations, a fusion protein comprising the entire extracellular
region (domains 1-4) of human LAG-3 fused to a human immunoglobulin
Fc domain (R&D Systems, Catalog #2319-L3) (D1-D4 hFc) or a
mouse immunoglobulin Fc domain (D1-D4 mFc) was used as the
immunogen. For other immunizations, a fusion protein comprising
only the first two extracellular domains of human LAG-3 fused to a
mouse immunoglobulin Fc domain (D1-D2 mFc) was used as the
immunogen. The LAG-3 fusion proteins were prepared using standard
recombinant DNA techniques.
[0349] Transgenic Transchromosomic KM Mouse.TM. and KM/FCGR2D
Mouse.TM. Strains
[0350] Fully human monoclonal antibodies to human LAG-3 were
prepared using mice of the transgenic transchromosomic KM Mouse.TM.
and KM/FCGR2D Mouse.TM. strains, which expresses human antibody
genes.
[0351] In the KM Mouse.TM. strain, the endogenous mouse kappa light
chain gene has been homozygously disrupted as described in Chen et
al. (1993) EMBO J. 12:811-820 and the endogenous mouse heavy chain
gene has been homozygously disrupted as described in Example 1 of
PCT Publication WO 01/09187. Furthermore, this mouse strain carries
a human kappa light chain transgene, KCo5, as described in Fishwild
et al., supra. The strain also contains the SC20 transchromosome,
which carries the human Ig heavy chain locus, as described in PCT
Publication WO 02/43478. The KM/FCGR2D Mouse.TM. strain is the same
as the KM Mouse.TM. strain except that its genome also comprises a
homozygous disruption of the endogenous Fc.gamma.RIIB gene. The KM
Mouse.TM. and KM/FCGR2D Mouse.TM. strains are also described in
detail in U.S. Application Publication No. 20020199213.
[0352] KM Mouse.TM. and KM/FCGR2D Mouse.TM. Immunizations:
[0353] To generate fully human monoclonal antibodies to LAG-3, mice
of the KM Mouse.TM. and KM/FCGR2D Mouse.TM. strains were immunized
with one of the three different recombinant LAG-3 fusion protein
described above (D1-D4 hFc, D1-D4 mFc, D1-D2, mFc). General
immunization schemes are described in Lonberg et al. (1994) supra;
Fishwild et al., supra and PCT Publication WO 98/24884. The mice
were 6-16 weeks of age upon the first infusion of antigen. Mice
were immunized intraperitoneally (IP) and/or subcutaneously (SC).
The mice were immunized biweekly four times with 10 .mu.g of the
recombinant LAG-3 fusion protein, followed by immunization twice
with 20 .mu.g of the same immunogen in Ribi as an adjuvant. The
immune response was monitored by retroorbital bleeds. The plasma
was screened by ELISA (as described below), and mice with
sufficient titers of anti-LAG-3 human immunoglobulin were used for
fusions. Prior to sacrifice and removal of the spleens, the mice
were boosted intravenously and intraperitoneally with 20 .mu.g of
antigen followed by a subsequent intravenous boost with 20 .mu.g of
antigen.
[0354] Selection of KM and KM/FCGR2D Mice Producing Anti-LAG-3
Antibodies
[0355] To select mice producing antibodies that bound LAG-3
protein, sera from mice immunized with the D1-D4 hFc fusion protein
were tested by a modified ELISA as originally described by Fishwild
et al. (1996). Briefly, microtiter plates were coated with purified
recombinant LAG-3 fusion protein at 1 .mu.g/ml in PBS, 50
.mu.l/wells incubated 4.degree. C. overnight, then blocked with 200
.mu.l/well of 5% BSA in PBS. Dilutions of plasma from
LAG-3-immunized mice were added to each well and incubated for 1-2
hours at ambient temperature. The plates were washed with PBS/Tween
and then incubated with a goat-anti-human kappa light chain
polyclonal antibody conjugated with Horse Radish Peroxidase (HRP)
for 1 hour at room temperature. After washing, the plates were
developed with ABTS substrate and analyzed by spectrophotometer at
OD 405.
[0356] For mice immunized with the D1-D4 mFc or D1-D2 mFc fusion
proteins, sera from these mice with were tested by indirect ELISA
using goat anti-mouse IgG to coat the plates for one hour prior to
coating with the antigen to eliminate nonspecific binding to the
mouse Fc part. Then the same ELISA steps as described above were
carried out.
[0357] Mice that developed the highest titers of anti-LAG-3
antibodies were used for fusions. Fusions were performed as
described below and hybridoma supernatants were tested for
anti-LAG-3 activity by ELISA.
[0358] Generation of Hybridomas Producing Human Monoclonal
Antibodies to LAG-3 Proteins
[0359] The mouse splenocytes, isolated from the KM or KM/FCGR2D
mice, were fused by electric field based electrofusion using a Cyto
Pulse large chamber cull fusion electroporator (Cyto Pulse
Sciences, Inc., Glen Burnie, Md.) to a mouse myeloma cell line. The
resulting hybridomas were then screened for the production of
antigen-specific antibodies. Single cell suspensions of splenic
lymphocytes from immunized mice were fused to one-fourth the number
of P3X63 Ag8.6.53 (ATCC CRL 1580) nonsecreting mouse myeloma cells.
Cells were plated at approximately 1.times.10.sup.5/well in flat
bottom microtiter plate, followed by about two week incubation in
selective medium containing 10% fetal calf serum, supplemented with
origen (IGEN) in RPMI, L-glutamine, sodium pyruvate, HEPES,
penicillin, streptamycin, gentamycin, 1.times. HAT, and
.beta.-mercaptoethanol. After 1-2 weeks, cells were cultured in
medium in which the HAT was replaced with HT. Individual wells were
then screened by ELISA (described above) for human anti-LAG-3
monoclonal IgG antibodies. Once extensive hybridoma growth
occurred, medium was monitored usually after 10-14 days. The
antibody secreting hybridomas were replated, screened again and, if
still positive for human IgG, anti-LAG-3 monoclonal antibodies were
subcloned at least twice by limiting dilution. The stable subclones
were then cultured in vitro to generate small amounts of antibody
in tissue culture medium for further characterization.
[0360] Hybridoma clones 25F7, 26H10, 25E3, 8B7, 11F2 and 17E5 were
selected for further analysis and sequencing.
Example 2: Structural Characterization of Human Anti-LAG-3
Monoclonal Antibodies 25F7, 26H10, 25E3, 8B7, 11F2 and 17E5
[0361] The cDNA sequences encoding the heavy and light chain
variable regions of the mAbs expressed by the 25F7, 26H10, 25E3,
8B7, 11F2 and 17E5 clones, as described in Example 1, were
sequenced using the following protocol. Total RNA was prepared from
5.times.10.sup.6 hybridoma cells using the RNeasy Mini Kit (Qiagen,
Valencia, Calif.). cDNA was prepared by the 5'-RACE protocol with
the SMART RACE cDNA Amplification Kit (Clontech Laboratories, Inc.,
Mountain View, Calif.) and SuperScript II Reverse Transcriptase
(Invitrogen, Carlsbad, Calif.). V-regions of each antibody were
amplified using a 3' human-specific constant region primer, paired
with the 5' RACE universal primer mix. PCR products containing the
V-region were cloned into the pCR4-TOPO vector (Invitrogen,
Carlsbad, Calif.) and transformed into E. coli strain TOP10
(Invitrogen, Carlsbad, Calif.). Either miniprep DNA or Templiphi
(GE Healthcare Biosciences, Piscataway, N.J., USA) samples were
prepared, and subjected to DNA sequencing (Sequetech, Mountain
View, Calif.). The resultant DNA sequences were analyzed for
in-frame rearrangements and other antibody characteristics. The
expressed proteins were characterized by standard protein chemistry
analysis. The 25E3, 25F7 and 26H10 clones were found to express an
antibody comprising an IgG1 heavy chain and a kappa light chain,
whereas the 8B7 and 17E5 clones were found to express an antibody
comprising an IgG4 heavy chain and a kappa light chain and the 11F2
clone was found to express an antibody comprising an IgG2 heavy
chain and a kappa light chain.
[0362] The nucleotide and amino acid sequences of the heavy chain
variable region of 25F7 are shown in FIGS. 1A and 1n SEQ ID NO: 49
and 37, respectively. The nucleotide and amino acid sequences of
the kappa light chain variable region of 25F7 are shown in FIGS. 1B
and 1n SEQ ID NO: 55 and 43, respectively. Comparison of the 25F7
heavy chain immunoglobulin sequence to the known human germline
immunoglobulin heavy chain sequences (FIG. 7) showed that the 25F7
heavy chain utilizes a V.sub.H segment from human germline V.sub.H
4-34 (SEQ ID NO:61), and a JH segment from human germline JHSb (SEQ
ID NO:62). Further analysis of the 25F7 V.sub.H sequence using the
Kabat system of CDR region determination led to the delineation of
the heavy chain CDR1, CDR2 and CDR3 regions as shown in FIGS. 1A
and 1n SEQ ID NOs: 1, 7 and 13, respectively. Comparison of the
25F7 light chain immunoglobulin sequence to the known human
germline immunoglobulin light chain sequences (FIG. 8) showed that
the 25F7 kappa light chain utilizes a V.sub.K segment from human
germline V.sub.K L6 (SEQ ID NO:63) and a J.sub.K segment from human
germline JK 2 (SEQ ID NO:64). Further analysis of the 25F7 V.sub.K
sequence using the Kabat system of CDR region determination led to
the delineation of the light chain CDR1, CDR2 and CDR3 regions as
shown in FIGS. 1B and 1n SEQ ID NOs: 19, 25 and 31,
respectively.
[0363] The nucleotide and amino acid sequences of the heavy chain
variable region of 26H10 are shown in FIG. 2A and in SEQ ID NO: 50
and 38, respectively. The nucleotide and amino acid sequences of
the light chain variable region of 26H10 are shown in FIG. 2B and
in SEQ ID NO: 56 and 44, respectively. Comparison of the 26H10
heavy chain immunoglobulin sequence to the known human germline
immunoglobulin heavy chain sequences (FIG. 9) showed that the 26H10
heavy chain utilizes a V.sub.H segment from human germline V.sub.H
3-33 (SEQ ID NO:65), and a JH segment from human germline JH 6B
(SEQ ID NO:66). Further analysis of the 26H10 V.sub.H sequence
using the Kabat system of CDR region determination led to the
delineation of the heavy chain CDR1, CDR2 and CDR3 regions as shown
in FIG. 2A and in SEQ ID NOs: 2, 8 and 14, respectively. Comparison
of the 26H10 light chain immunoglobulin sequence to the known human
germline immunoglobulin light chain sequences (FIG. 10) showed that
the 26H10 kappa light chain utilizes a V.sub.k segment from human
germline V.sub.K A27 (SEQ ID NO:67) and a J.sub.K segment from
human germline JK 3 (SEQ ID NO:68). Further analysis of the 26H10
V.sub.k sequence using the Kabat system of CDR region determination
led to the delineation of the light chain CDR1, CDR2 and CDR3
regions as shown in FIG. 2B and in SEQ ID NOs: 20, 26 and 32,
respectively.
[0364] The nucleotide and amino acid sequences of the heavy chain
variable region of 25E3 are shown in FIG. 3A and in SEQ ID NO: 51
and 39, respectively. The nucleotide and amino acid sequences of
the light chain variable region of 25E3 are shown in FIG. 3B and in
SEQ ID NO: 57 and 45, respectively. Comparison of the 25E3 heavy
chain immunoglobulin sequence to the known human germline
immunoglobulin heavy chain sequences (FIG. 11) showed that the 25E3
heavy chain utilizes a V.sub.H segment from human germline V.sub.H
3-20 (SEQ ID NO:69), and a JH segment from human germline JH 4b
(SEQ ID NO:70). Further analysis of the 25e3 V.sub.H sequence using
the Kabat system of CDR region determination led to the delineation
of the heavy chain CDR1, CDR2 and CDR3 regions as shown in FIG. 3A
and in SEQ ID NOs: 3, 9 and GGY, respectively. Comparison of the
25E3 light chain immunoglobulin sequence to the known human
germline immunoglobulin light chain sequences (FIG. 12) showed that
the 25E3 kappa light chain utilizes a V.sub.k segment from human
germline V.sub.K L18 (SEQ ID NO:71) and a J.sub.K segment from
human germline JK 2 (SEQ ID NO:64). Further analysis of the 25E3
V.sub.k sequence using the Kabat system of CDR region determination
led to the delineation of the light chain CDR1, CDR2 and CDR3
regions as shown in FIG. 3B and in SEQ ID NOs: 21, 27 and 33,
respectively.
[0365] The nucleotide and amino acid sequences of the heavy chain
variable region of 8B7 are shown in FIG. 4A and in SEQ ID NO: 52
and 40, respectively. The nucleotide and amino acid sequences of
the light chain variable region of 8B7 are shown in FIG. 4B and in
SEQ ID NO: 58 and 46, respectively. Comparison of the 8B7 heavy
chain immunoglobulin sequence to the known human germline
immunoglobulin heavy chain sequences (FIG. 13) showed that the 8B7
heavy chain utilizes a V.sub.H segment from human germline V.sub.H
4-34 (SEQ ID NO:61), and a JH segment from human germline JH 5B
(SEQ ID NO:62). Further analysis of the 8B7 V.sub.H sequence using
the Kabat system of CDR region determination led to the delineation
of the heavy chain CDR1, CDR2 and CDR3 regions as shown in FIG. 4A
and in SEQ ID NOs: 4, 10 and 16, respectively. Comparison of the
8B7 light chain immunoglobulin sequence (FIG. 14) to the known
human germline immunoglobulin light chain sequences showed that the
8B7 kappa light chain utilizes a V.sub.k segment from human
germline V.sub.K L6 (SEQ ID NO:63) and a J.sub.K segment from human
germline JK 4 (SEQ ID NO:72). Further analysis of the 26H10 V.sub.k
sequence using the Kabat system of CDR region determination led to
the delineation of the light chain CDR1, CDR2 and CDR3 regions as
shown in FIG. 4B and in SEQ ID NOs: 22, 28 & 34,
respectively.
[0366] The nucleotide and amino acid sequences of the heavy chain
variable region of 11F2 are shown in FIG. 5A and in SEQ ID NO: 53
and 41, respectively. The nucleotide and amino acid sequences of
the light chain variable region of 11F2 are shown in FIG. 5B and in
SEQ ID NO: 59 and 47, respectively. Comparison of the 11F2 heavy
chain immunoglobulin sequence to the known human germline
immunoglobulin heavy chain sequences (FIG. 15) showed that the 11F2
heavy chain utilizes a V.sub.H segment from human germline V.sub.H
1-24 (SEQ ID NO:73), a D segment from the human germline 2-15, and
a JH segment from human germline JH 4B (SEQ ID NO:70). Further
analysis of the 11F2 V.sub.H sequence using the Kabat system of CDR
region determination led to the delineation of the heavy chain
CDR1, CDR2 and CDR3 regions as shown in FIG. 13A and in SEQ ID NOs:
5, 11 and 17, respectively. Comparison of the 11F2 light chain
immunoglobulin sequence to the known human germline immunoglobulin
light chain sequences (FIG. 16) showed that the 11F2 kappa light
chain utilizes a V.sub.k segment from human germline V.sub.K L6
(SEQ ID NO:63) and a J.sub.K segment from human germline JK 1 (SEQ
ID NO:74). Further analysis of the 11F2 V.sub.k sequence using the
Kabat system of CDR region determination led to the delineation of
the light chain CDR1, CDR2 and CDR3 regions as shown in FIG. 5B and
in SEQ ID NOs: 23, 29 and 35, respectively.
[0367] The nucleotide and amino acid sequences of the heavy chain
variable region of 17E5 are shown in FIG. 6A and in SEQ ID NO: 54
and 42, respectively. The nucleotide and amino acid sequences of
the light chain variable region of 17E5 are shown in FIG. 6B and in
SEQ ID NO: 60 and 48, respectively. Comparison of the 17E5 heavy
chain immunoglobulin sequence to the known human germline
immunoglobulin heavy chain sequences (FIG. 17) showed that the 17E5
heavy chain utilizes a V.sub.H segment from human germline V.sub.H
3-33 (SEQ ID NO:65), a D segment from the human germline 2-2, and a
JH segment from human germline JH 4B (SEQ ID NO:70). Further
analysis of the 17E5 V.sub.H sequence using the Kabat system of CDR
region determination led to the delineation of the heavy chain
CDR1, CDR2 and CDR3 regions as shown in FIG. 6A and in SEQ ID NOs:
6, 12 and 18, respectively. Comparison of the 17E5 light chain
immunoglobulin sequence to the known human germline immunoglobulin
light chain sequences (FIG. 18) showed that the 17E5 kappa light
chain utilizes a V.sub.k segment from human germline V.sub.K L6
(SEQ ID NO:63) and a J.sub.K segment from human germline JK 5 (SEQ
ID NO:75). Further analysis of the 17E5 V.sub.k sequence using the
Kabat system of CDR region determination led to the delineation of
the light chain CDR1, CDR2 and CDR3 regions as shown in FIG. 6B and
in SEQ ID NOs: 24, 30 and 36, respectively.
[0368] The 25F7, 26H10, 25E3, 8B7, 11F2 and 17E5 variable regions
can be converted to full-length antibodies of any desired isotype
using standard recombinant DNA techniques. For example, DNA
encoding the V.sub.H and V.sub.L regions can be cloned into an
expression vector that carries the heavy and light chain constant
regions such that the variable regions are operatively linked to
the constant regions. Alternatively, separate vectors can be used
for expression of the full-length heavy chain and the full-length
light chain. Non-limiting examples of expression vectors suitable
for use in creating full-length antibodies include the pIE vectors
described in U.S. Patent Publication No. 20050153394.
Example 3: Characterization of Binding Properties of LAG-3
Monoclonal Antibodies
[0369] In this example, the binding of human anti-LAG-3 antibodies
to cell surface LAG-3 (human, monkey and mouse LAG-3) was examined
by flow cytometry.
[0370] Furthermore, binding kinetics to LAG-3 were analyzed by
BIACORE analysis. Still further epitope mapping was conducted using
a peptide scan experiment.
[0371] A. Flow Cytometry Studies
[0372] 1. CHO-human LAG-3 Cell Binding To test the ability of the
antibodies to bind to cell surface LAG-3 protein, the antibodies
were incubated with a CHO cell line that had been transfected to
express human LAG-3 on the cell surface. The 25F7, 26H10, 25E3,
8B7, 11F2 and 17E5 monoclonal antibodies were serially diluted with
cold 1.times.PFAE buffer (1.times.PBS+2% FBS, 0.02% sodium azide, 2
mM Na EDTA). For the binding reaction, 50 .mu.l of diluted antibody
solution was added to a 50 .mu.l cell suspension containing
2.times.10.sup.5 cells and the mixture was incubated on ice for 30
minutes. The cells were then washed two times with 1.times.PFAE
buffer. A 1:100 dilution of FITC-labeled goat anti-human kappa
light chain antibody (Bethyl Laboratories, Inc., Cat. # A80-115F)
was added and the mixture was incubated for 30 minutes at 4.degree.
C., followed by washing twice with cold 1.times.PFAE buffer. After
the final wash, 150 .mu.l of cold 1.times.PFAE containing 10
.mu.g/mL propidium iodide (Roche Applied Science, Cat #1 348 639)
was added to each solution and analysis of antibody binding was
carried out by flow cytometry using a FACScalibur flow cytometer
(BD Bioscience).
[0373] The results of the flow cytometry analysis are summarized
below in Table 1, which shows EC.sub.50 for binding to CHO-human
LAG-3, demonstrating that 25F7, 26H10, 25E3, 8B7, 11F2 and 17E5
bind effectively to cell-surface human LAG-3, with 25F7 having
approximately a 20 fold lower EC.sub.50 than 25E3 but approximately
equivalent EC.sub.50 to that of 8B7 and 26H10. The EC.sub.50
results for 11F2 and 17E5 were in the same range as for 25E3.
TABLE-US-00002 TABLE 1 Binding of Anti-LAG-3 Antibodies to CHO
Cells Expressing Human LAG-3 Antibody EC.sub.50 (nM) 25F7 0.45-2.52
8B7 1.93-4.44 26H10 1.81-3.64 11F2 15.12 25E3 14.9-25.39 17E5
12.3
[0374] 2. Activated human CD4.sup.+ T Cell Binding
[0375] To test the ability of the antibodies to bind to native
human LAG-3 on the surface of activated human T cells, resting
CD4.sup.+ T cells were isolated from purified peripheral blood
mononuclear cells and subjected to three days of stimulation with a
combination of anti-CD3 and anti-CD28 antibodies affixed to
polystyrene beads. The 25F7, 8B7 and 26H10 monoclonal antibodies
were serially diluted with cold 1.times.PFAE buffer (1.times.PBS+2%
FBS, 0.02% sodium azide, 2 mM Na EDTA). For the binding reaction,
50 .mu.l of diluted antibody solution was mixed with 50 .mu.l of
PE-labeled anti-human CD4 (BD Bioscience, Cat #555347). Activated T
cells were processed by the same protocol described above. The
analysis of antibody binding was conducted as described above.
[0376] The results of the flow cytometry analysis are summarized
below in Table 2, which shows EC.sub.50 for binding to activated
human CD4.sup.+ T cells, demonstrating that all three antibodies
bind similarly to cell-surface human LAG-3.
TABLE-US-00003 TABLE 2 Binding of Anti-LAG-3 Antibodies to
Activated human CD4.sup.+ T cells Antibody EC.sub.50 (nM) 25F7
0.27-0.45 26H10 0.41-0.84 8B7 0.69-1.80
[0377] 3. Monkey LAG-3 Antigen Binding
[0378] To determine whether the anti-LAG-3 antibodies cross-react
with monkey LAG-3, a cDNA sequence was cloned by RT-PCR from a
preparation of pooled cDNA prepared by reverse transcription of
RNAs from a collection of cynomolgus and rhesus monkey tissue
samples. The sequence was first amplified from the cDNA pool using
primers (5' forward primer: 5Mcyn1408; 5'-atgtgggaggctcagttcctg-3'
(SEQ ID NO: 91) & 3' reverse primer: 3Mcyn1408a;
5'-gtcagagctgctccggctc-3' (SEQ ID NO: 92)) using a GC-rich PCR
amplification system (Roche) and was cloned into a recipient TOPO
cloning vector (Invitrogen) for sequence analysis. Clones matching
the reference Genbank rhesus monkey LAG-3 sequence (Genbank
Accession No. XM_001108923) were subsequently re-amplified from the
TOPO-cloning vector DNA utilizing a second set of primers that
incorporated restriction enzyme sites for directional cloning in a
mammalian cell expression vector.
[0379] Monkey LAG-3 clone pa23-5 was isolated and sequenced. The
isolated monkey sequence exhibited 99.6% identity to the reference
Genbank rhesus monkey LAG-3 sequence. A comparison of the amino
acid sequence of cDNA clone pa23-3 (SEQ ID NO: 93) with rhesus
monkey LAG-3 (SEQ ID NO: 94) from Genbank (Accession No.
XM_001108923) is shown in FIG. 19. The two sequences are identical
except for a one amino acid difference at position 419 (arginine in
clone pa23-5 versus threonine in the Genbank rhesus sequence) and
on this basis it is concluded that cDNA clone pa23-5 represents the
rhesus LAG-3 gene sequence.
[0380] The cDNA of clone pa23-5 was inserted into an expression
construct, which was transfected into CHO-S suspension cells by
nucleofection (Amaxa). Rhesus LAG-3 expression by sorted, selection
drug-resistant clones was verified by FACS analysis. This clonal
CHO cell line over-expressing rhesus LAG-3 was used in similar FACS
assays to those described above to measure antibody cross
reactivity to the monkey protein. Briefly, the 25F7, 8B7 and 26H10
monoclonal antibodies were serially diluted with cold 1.times.PFAE
buffer (1.times.PBS+2% FBS, 0.02% sodium azide, 2 mM Na EDTA). For
the binding reaction, 50 .mu.l of diluted antibody solution was
added to a 50 .mu.l cell suspension containing 2.times.10.sup.5
cells and the mixture was incubated on ice for 30 minutes. The
cells were processed by the same protocol described above. The
analysis of antibody binding was conducted as described above.
[0381] In a separate experiment, the antibodies were tested for
binding to cynomolgus monkey LAG-3 using activated cynomolgus
monkey T cells. In vitro activation of these monkey T cells was
achieved through anti-CD.sup.3/anti-CD28 treatment of the T cells
by essentially the same protocol described above for the in vitro
activation of human T cells, followed by flow cytometry analysis
performed as described above for staining of in vitro activated
human CD4.sup.+ T cells.
[0382] The results of the flow cytometry analyses using the
CHO-rhesus LAG-3 cells and the activated cynomolgus T cells are
summarized below in Table 3, which shows EC.sub.50 for binding to
the two different types of cells expressing monkey LAG-3. These
results showed that all antibodies bind effectively to both LAG-3
on the activated cynomolgus T cells and the rhesus LAG-3 (SEQ ID
NO: 93) transfected into CHO cells.
[0383] There is a hierarchy, however, of binding affinities, with
clone 26H10 showing the highest affinity, which is approximately
2.5 and 6-fold better than that of clones 8B7 and 25F7,
respectively. Difference in binding hierarchy between the two cell
types may reflect amino acid sequence differences between the
rhesus and cynomolgus LAG-3 proteins.
TABLE-US-00004 TABLE 3 Binding of Anti-LAG-3 Antibodies to Monkey
LAG-3 Activated Cyno Antibody CD4.sup.+ T cells EC.sub.50 (nM)
CHO-rhesus LAG3 EC.sub.50 (nM) 26H10 5.19 4.684 25F7 14.18 22.72
8B7 30.45 10.01
[0384] 4. Mouse LAG-3 Antigen Binding
[0385] To determine whether the antibodies cross-reacted with mouse
LAG-3, similar flow cytometry studies to those described above were
performed using as the target cell a mouse T cell hybridoma cell
line (3A9) that had been transfected to express mouse LAG-3 on its
cell surface, followed by FACS analysis to detect antibody binding.
The results indicated that, in contrast to a control anti-mouse
LAG3 control antibody which showed strong staining, none of the
human antibodies 25E3, 25F7, 8B7 or 26H10 exhibited binding above
background levels to cell surface mouse LAG-3, demonstrating that
none of these antibodies cross-react with mouse LAG-3.
[0386] B. BIACORE Analysis
[0387] The binding of the 25E3, 25F7, 8B7, 26H10 and 17E5
antibodies to recombinant LAG-3 protein was examined by BIAcore.TM.
using a capture method. The 25E3, 25F7, 8B7, 26H10 and 17E5
antibodies each were captured using anti-CH1, a reagent antibody
that is specific towards the heavy chain constant region 1 of human
antibody (Zymed, Clone HP6045, Stock conc. 1.0 mg/mL). Anti-CH1 was
coated on a CMS chip (BR-1000-14, Research Grade) at high density
(9700-11500RUs). The coating was carried out based on the standard
immobilization procedure recommended by the manufacturer. The 25E3,
25F7, 8B7, 26H10 or 17E5 purified antibody, with concentrations
ranging from 0.5-3 .mu.g/mL, was then captured on the anti-CH1
coated surface at the flow-rate of 10 uL/min for 1 minute. A single
concentration of recombinant human LAG-3 fusion protein (20 nM) was
injected over captured antibody for 3 minutes at a flow rate of 25
.mu.g/mL. The antigen was allowed to dissociate for 7.5 minutes.
The chip surface was regenerated after each cycle with 25 .mu.l, of
25 mM NaOH followed by 30 .mu.l, of HBS-EP wash. Isotype controls
were run on the chip, and the data used to subtract non-specific
binding. All the experiments were carried out on a Biacore 3000
surface plasmon resonance instrument, using BIAcore Control
software v 3.2. Data analysis was carried out using BiaEvaluation
v3.2 software. The results are shown in Table 4 below. The BIAcore
results for 25E3, 25F7, 8B7, 26H10 and 17E5 confirm the flow
cytometry results that all five antibodies are capable of binding
with high affinity to human LAG-3.
TABLE-US-00005 TABLE 4 Binding Kinetics of Anti-LAG-3 Antibody to
Recombinant Human LAG-3 Antibody K.sub.D .times. 10.sup.-9 (M) 25E3
0.09 8B7 0.09 26H10 0.10 25F7 0.47 17E5 4.53
[0388] C. Epitope Mapping
[0389] In the LAG-3 protein, the immunoglobulin-like first domain
of the extracellular region contains an exposed "extra loop" having
the amino acid sequence: GPPAAAPGHPLAPGPHPAAPSSWGPRPRRY (SEQ ID NO:
79). To examine the binding of 25E3, 25F7, 8B7 and 26H10 to this
region of LAG-3, and map the epitope bound by each antibody, a
peptide scan experiment was performed across this region. A series
of 10 overlapping peptides that scanned across the full length of
the extra loop sequence were prepared and conjugated to biotin. For
ELISA analysis, microtiter plates pre-coated with streptavidin
(Sigma-Aldrich, Cat # M5432) were used to capture the biotinylated
loop peptide-conjugates applied in a 100 .mu.l volume at a
concentration of 2 .mu.g/mL and incubated 18 hours at 4.degree. C.,
after which the plates were washed 3 times and blocked at room
temperature for 1 hour with blocking buffer (1.times.PBS+10% FBS).
Next, human anti-LAG-3 antibodies serially diluted 3-fold in
blocking buffer from 10 .mu.g/mL were applied and the plates were
incubated at room temperature for 2 hours and then washed three
times. To detect bound human antibody a HRP-conjugated goat
anti-human kappa light chain antibody (Bethyl Laboratories, Cat
#A80-115P) was diluted to 1 pg/mL in blocking buffer and applied to
assay wells for 1 hour followed by three washes and application of
TMB substrate (eBioscience, Cat #00-4201-56). Optical density
readings at 650 nm wavelength were made on a Spectramax 340PC
spectrophotometer (Molecular Dynamics, Inc.). The results of the
peptide scan experiment are summarized below in Table 5.
TABLE-US-00006 TABLE 5 Anti-LAG Antibody Binding to Peptide Scan of
LAG-3 Extra Loop LAG-3 Extra Loop Peptide Scan SEQ
GPPAAAPGHPLAPGPHPAAPSSWGPRPRRY 79 25E3 8B7 25F7 26H10 GPPAAAPGHPLA
80 - - - - PAAAPGHPLAPG 81 ++ - - - AAPGHPLAPGPH 82 ++ - - -
PGHPLAPGPHPA 83 + - - - HPLAPGPHPAAP 84 .+-. - - - LAPGPHPAAPSS 85
- - - - PGPHPAAPSSWG 86 - ++ ++ - PHPAAPSSWGPR 87 - ++ ++ -
PAAPSSWGPRPR 88 - ++ + - APSSWGPRPRRY 89 - - - -
Based on these results, it was determined that the 25E3 antibody
recognized a region within the extracellular loop comprising the
amino acid sequence PGHPLAPG (SEQ ID NO: 76), whereas the 25F7
antibody recognized a region within the extra loop comprising the
amino acid sequence HPAAPSSW (SEQ ID NO: 77) and 8B7 appeared to
recognize a region within the extracellular loop comprising the
amino acid sequence PAAPSSWG (SEQ ID NO: 78). In contrast, no
binding of the full length extra loop peptide or any of the shorter
scanning peptides by the 26H10 antibody could be detected.
[0390] The regions identified in this study are underlined in the
full-length extra loop sequence:
##STR00001##
Thus, the peptide scan results indicate that the 25E3, 25F7 and 8B7
antibodies bind to different although closely located epitopes
within human LAG-3.
[0391] To further examine binding of these antibodies to the extra
loop peptide region, additional ELISA assays were performed. In an
ELISA assay using the human full-length extra loop peptide (SEQ ID
NO: 79), EC.sub.50 values for binding were determined for 25E3,
25F7 and 8B7. Additionally, a similar peptide ELISA was conducted
using the full length extra loop peptide sequence from rhesus
monkey LAG-3, having the sequence GPPAPAPGHPPAPGHRPAAPYSWGPRPRRY
(SEQ ID NO: 90), and EC.sub.50 values for binding were determined
for 25F7 and 8B7. The results are summarized below in Table 6. The
results confirm that antibodies 25E3, 25F7 and 8B7 are capable of
recognizing the human LAG-3 extra loop peptide region. Moreover,
antibodies 25F7 and 8B7 also bind to the rhesus LAG-3 extra loop
peptide region, albeit less well compared to the human sequence,
which may be due to the species sequence divergence in this
polypeptide. The results also confirm that the 26H10 antibody is
not capable of recognizing the LAG-3 extra loop peptide.
TABLE-US-00007 TABLE 6 Binding of Anti-LAG-3 Antibodies to Human
and Rhesus LAG-3 Extra Loop Peptide Antibody Human Extra Loop
EC.sub.50 (nM) Rhesus Extra Loop EC.sub.50 (nM) 25E3 0.55 Not
tested 25F7 0.29-0.95 13.09 8B7 0.28-1.35 0.60 26H10 No binding No
binding
Example 4: Inhibition of Binding of LAG-3 to MHC Class II by
Anti-LAG-3 mAbs
[0392] To test the ability of the anti-LAG-3 antibodies to inhibit
binding of LAG-3 to MHC Class II molecules, an in vitro binding
assay was performed in which a LAG-3 fusion protein, comprising
human LAG-3 extracellar domain fused to mouse Fc (hLAG-3-mIg), was
reacted with Daudi cells, which express human MHC Class II
molecules.
[0393] To test antibody inhibition of LAG-3 binding to MHC Class
II, 25E3, 25F7, 8B7 and 26H10 were serially diluted from 20 pg/mL
in PFAE buffer and to these serial dilutions was added 1 .mu.g/ml
of hLAG-3-mIg fusion protein. This mixture was incubated for 20
minutes at room temperature prior to adding to 2.times.10.sup.5
1.times.PFAE-washed Daudi cells. The mixture was applied to Daudi
cells and incubated at 4.degree. C. for 30 minutes. The cells were
pelleted (three minutes, 400.times.g), washed once with
1.times.PFAE buffer and re-pelleted, and binding of hLAG-3-mIg to
the Daudi cells was detected using a recombinant PE-labeled
anti-mIgG Fc.gamma. secondary reagent. Analysis of LAG-3-mIg
binding was carried out with the FACScalibur flow cytometer (BD
Bioscience). The results are summarized in Table 7 below, which
shows IC.sub.50 values in nM.
TABLE-US-00008 TABLE 7 Inhibition of LAG-3 Binding to MHC Class II
by Anti-LAG-3 Antibodies Antibody IC.sub.50 (nM) 25E3 0.8-6.78 25F7
0.12-0.92 8B7 0.19-0.95 26H10 0.10
The results demonstrate that all four antibodies are effective in
inhibiting binding of LAG-3 to MHC Class II antibodies, with 25F7,
8B7 and 26H10 exhibiting IC.sub.50 values approximately 7 to
13-fold lower than that of 25E3.
Example 5: Stimulation of Antigen-Specific T Cell Response by
Anti-LAG-3 mAbs
[0394] To test the ability of the anti-LAG-3 antibodies to
stimulate an antigen-specific T cell response, a 3A9 T Cell Peptide
Stimulation Assay (see e.g., Workman et al. (2003) J. Immunol.
169:5392-5395; Workman et al. (2002) Eur. J. Immunol. 32:2255-2263)
was used.
[0395] In this assay, a mouse T cell hybridoma, 3A9, specific for
the peptide HEL.sub.48-62, was used as the responder T cell. The
responder 3A9 T cell was retrovirally transduced to express either
human LAG-3 or mouse LAG-3 on its cell surface. The antigen
presenting cell (APC) used to present the HEL.sub.48-62 peptide
antigen to the 3A9 cells was the mouse MHC Class II positive cell
line LK35.2. Separate studies determined that a human LAG-3 fusion
protein was capable of binding to mouse MHC Class II molecules,
thereby validating the use of LK35.2 mouse APCs in this assay.
Antigen-specific stimulation of the 3A9 cells was indicated by
production of interleukin-2 (IL-2), the secretion of which was
measured by ELISA (mouse IL-2 OptEIA kit, BD Bioscience, Cat
#555148 according to manufacturer's recommendations).
[0396] Ectopic expression of human or mouse LAG-3 on the 3A9 T
cells, in the absence of any antibodies, led to an inhibitory
effect on antigen-specific responses when the transfected T cells
were incubated with the LK35.2 APCs presenting the HEL.sub.48-62
peptide antigen, as indicated by an increase in the amount of
peptide antigen needed to stimulate IL-2 production by the 3A9
cells in comparison to the peptide dose response profile of control
3A9 T cells.
[0397] To test antibody stimulation of the antigen-specific T cell
response, the APC (2.5.times.10.sup.4 cells) was first preincubated
with the antigenic peptide (200 nM) for 30 minutes at 37.degree. C.
and the 3A9 T cells (5.0.times.10.sup.4 cells expressing either
mLAG-3, hLAG-3 or control cells) were preincubated with an
anti-hLAG-3 antibody (25E3, 25F7, 8B7, 26H10, 11F2, 17E5), serially
diluted in three fold dilution from 25 .mu.g/mL) for 15 minutes at
37.degree. C. The 3A9 T cells were then added to the antigen-pulsed
APCs and the culture incubated for 24 hours at 37.degree. C. The
supernatants were then harvested and measured for production of
mouse IL-2. The results for the 3A9 T cells expressing human LAG-3
are in Table 8, which shows IC.sub.50 values in nM.
TABLE-US-00009 TABLE 8 Stimulation of Antigen-Specific T Cell
Responses by Anti-LAG-3 Antibodies Antibody 3A9-hLAG-3 Peptide
Assay IC.sub.50 (nM) 25F7 0.14-1.94 26H10 1.45-6.49 8B7 3.25-13.90
25E3 3.88-70.78 11F2 81.50-240 17E5 No inhibition
[0398] The results show that antibodies 25F7, 8B7 and 26H10, and to
a lesser extent 25E3, were able to stimulate IL-2 production in an
antigen-specific T cell response assay, whereas antibody 11F2
exhibited minimal ability to inhibit and antibody 17E5 was not
functional in this assay. None of the antibodies altered the
measured IL-2 production by control 3A9 T cells or 3A9 T cells
transfected with mouse LAG-3 protein, demonstrating the specificity
of the stimulatory effect.
Example 6: Tumor Growth Inhibition by Anti-LAG-3 mAb, Alone or in
Combination
[0399] To test the ability of anti-LAG-3 antibody, alone or in
combination with another immunostimulatory antibody, to inhibit the
growth of tumor cells in vivo, two different syngeneic mouse tumor
graft models were used. The first model used murine Sa1N
fibrosarcoma cells. The second model used the murine MC38 colon
cancer cell line.
[0400] In a first experiment, mice (A/J strain) were each implanted
with 2.times.10.sup.6 Sa1N fibrosarcoma cells on day 0 and the
tumor cells were allowed to grow for seven days. On day 7, day 10
and day 12 post-implantation, the mice were treated with 10 mg/kg
of either an anti-LAG-3 mAb alone (the rat anti-mouse LAG-3 mAb
C9B7W; eBioscience, Cat. No. 14-2231), an anti-PD-L1 antibody alone
(an anti-mouse PD-L1 mAb 14D8), the anti-LAG-3 and anti-PD-L1
antibodies in combination, or an IgG1 isotype control antibody. The
14D8 mAb is a rat anti-mouse PD-L1 antibody that has been
chimerized to contain the mouse IgG1 and mouse kappa constant
regions.
[0401] Tumor volumes in the mice were measured for over 50 days
post-implantation and mean and median tumor volumes were
determined. Mean tumor growth inhibition was calculated (based on
treatment with the isotype control IgG1 antibody being 0%
inhibition). The results for day 24 post-implantation are
summarized below in Table 9:
TABLE-US-00010 TABLE 9 Mean Tumor Growth Inhibition in Sa1N Tumor
Model Day IgG1 LAG-3 PD-L1 Combo 24 -- 68 74.9 95.8
[0402] Thus, anti-LAG3 antibody alone, or anti-PD-L1 antibody
treatment alone, resulted in tumor growth inhibition, while the
combination of both antibodies led to even greater tumor growth
inhibition. With respect to the treatment groups, by the end of the
experiment the results were that 4 of 10 mice treated with
anti-LAG3 alone became tumor free, whereas only 1 of 10 mice
treated with the control IgG1 antibody became tumor free.
Similarly, 4 of 11 mice treated with anti-PD-L1 alone were rendered
tumor free. Treatment of mice with the combination of anti-LAG3 and
anti-PD-L1 resulted in 9 of 10 mice becoming tumor free; the
remaining mouse not tumor free had an indolent tumor that remained
small throughout the study.
[0403] Two additional studies used mice implanted with cells of the
murine MC38 colon cancer cell line. In the first experiment,
C57Bl/6 mice were each implanted with 2.times.10.sup.6 MC38 cells
on day 0, and were treated on day 7, day 10 and day 12
post-implantation with 200 .mu.g/dose of anti-LAG-3 alone (C9B7W
mAb), anti-PD-1 alone (the 4H2 mAb) or anti-LAG-3 and anti-PD-1 in
combination. An IgG1 isotype matched antibody, at 400 .mu.g/dose,
was used as a control. The 4H2 mAb is a rat anti-mouse PD-1
antibody that has been chimerized to contain the mouse IgG1 and
mouse kappa constant regions.
[0404] Mean tumor volume, median tumor volume and % survival was
determined at 80 days post-implantation. The results showed that
LAG-3 monotherapy in this tumor model (MC38) showed little or no
activity in inhibiting tumor growth and none of the treated mice
survived the duration of the experiment. In contrast, anti-PD-1
monotherapy showed significant activity, with 4 of 10 mice tumor
free at the end of the experiment. Moreover, similar to the results
with the Sa1N model, the combination therapy of anti-LAG-3 plus
anti-PD-1 was more effective than either treatment alone, with 7 of
8 mice being tumor free at the end of the experiment.
[0405] In a second experiment with the MC38 model, C57Bl/6 mice
were each implanted with 2.times.10.sup.6 MC38 cells on day 0, and
were treated on day 5, day 8 and day 11 post-implantation with 200
.mu.g/dose of test antibody and/or 400 .mu.g/dose control IgG
antibody, as follows: (i) an anti-IgG1 control antibody; (ii) an
anti-LAG-3 mAb (C9B7W mAb) together with the control IgG1; (iii) an
anti-PD-1 antibody (4H2) together with the control IgG1; (iv) an
anti-CTLA-4 antibody (the 9D9 mouse anti-mouse CTLA-4 mAb) together
with the control IgG1; (v) the anti-LAG-3 mAb together with the
anti-PD-1 mAb; or (vi) the anti-LAG-3 mAb together with the
anti-CTLA-4 mAb. The 9D9 mAb is a mouse anti-mouse CTLA-4 antibody
that was raised in a mouse in which the endogenous mouse CTLA-4 had
been knocked out.
[0406] Mean tumor volume, median tumor volume and % survival was
determined for over 100 days post-implantation. The results were
similar to the first experiment in that LAG-3 monotherapy showed
little or no activity in inhibiting MC38 tumor growth and none of
the treated mice survived the duration of the experiment. CTLA-4
monotherapy also showed little or no activity in inhibiting MC38
tumor growth and none of the treated mice survived the duration of
the experiment. In contrast, anti-PD-1 monotherapy again showed
significant activity, with 4 of 10 mice tumor free at the end of
the experiment. Moreover, again combination therapy was more
effective than monotherapy. For mice treated with the combination
of anti-LAG-3 and anti-CTLA-4, 3 of 10 mice were tumor free at the
end of the experiment and for the mice treated with the combination
of anti-LAG-3 and anti-PD-1, 8 of 10 mice were tumor free at the
end of the experiment.
[0407] Thus, the above-described in vivo tumor graft studies
demonstrated that, for at least certain tumor models, anti-LAG
antibody treatment alone resulted in significant inhibition of
tumor growth in vivo. Furthermore, for multiple tumor models, the
combination therapy of anti-LAG-3 antibody together with either
anti-PD-1 antibody, anti-PD-L1 antibody or anti-CTLA-4 antibody
resulted in even greater anti-tumor activity than monotherapy
alone.
Example 7: Promotion of Autoimmunity in NOD Mice by Inhibition by
Anti-LAG-3 mAb
[0408] To test the ability of anti-LAG-3 antibody to stimulate an
immune response, as indicated by the development of autoimmunity,
the NOD mouse model of diabetes was utilized. NOD mice are known to
be prone to developing autoimmune diabetes. Progression of diabetes
can be followed in female NOD mice by measuring serum glucose.
Thus, the effect of anti-LAG-3 treatment, alone or in combination
with either immunostimulatory antibodies, on the development of
diabetes in female NOD mice was examined.
[0409] Female NOD mice were treated on day 0, day 2 and day 5 with
250 .mu.g/dose of either: (i) an IgG1 isotype control antibody;
(ii) anti-LAG-3 mAb alone (C9B7W mAb); (iii) anti-PD-1 mAb alone
(4H2 mAb); (iv) anti-CTLA-4 mAb alone (9D9 mAb); (v) anti-LAG-3 mAb
together with anti-PD-1 mAb; or (vi) anti-LAG-3 mAb together with
anti-CTLA-4. The results demonstrated with anti-LAG-3 treatment
alone or anti-PD-1 treatment alone (but not anti-CTLA-4 treatment
alone) increased the number of mice converting to the diabetic
phenotype. Moreover, the combination treatment of anti-LAG-3 plus
anti-PD-1, or anti-LAG-3 plus anti-CTLA-4, was even more effective
in converting mice to the diabetic phenotype.
[0410] Thus, these results demonstrate that blockade of LAG-3
interaction with its receptor interfered with a negative
immunoregulatory signal that allowed for greater immunological
activity in the NOD mice, and this greater immunological activity
in the LAG-3 treated mice could be enhanced by combination
treatment with either anti-PD-1 or anti-CTLA-4 antibody.
Example 8: Immunohistochemistry Using Anti-LAG-3 mAbs
[0411] In this experiment, fluorescently-labeled anti-LAG-3 human
antibodies were used in immunohistochemistry experiments. The
following FITC-labeled, human anti-LAG-3 antibodies were used:
25F7-FITC (F:P=2.9; IgG1 version); 25F7-G4-FITC (F:P=2.7; IgG4
version); 8B7-FITC (F:P=2.6) and 26H10-FITC (F:P=3.4). A panel of
lymphoid tissues, specifically tonsil (two samples), spleen (two
samples) and thymus (two samples), was examined, along with
pituitary tissue (four samples). LAG-3 transfected CHO cells also
were used as a control. Acetone-fixed cryostat sections were used.
The sections were stained with FITC-labeled anti-LAG-3 antibody
(0.2-5 .mu.g/ml), followed by staining with a rabbit anti-FITC
antibody as a bridge antibody and then visualization using the
rabbit EnVision.TM.+System Kit (Dako USA, Carpinteria, Calif.). The
results are summarized below in Table 10.
TABLE-US-00011 TABLE 10 Immunohistochemistry using Anti-LAG-3 mAbs
Tissue 25F7-FITC 25F7-G4-FITC 8B7-FITC 26H10-FITC CHO/LAG-3 + + + +
Cells (strong) (strong) (strong) (strong) Tonsil + + + + (n = 2)
(strong; rare in (strong; rare in (strong; rare in (strong; rare in
scattered LC, scattered LC, scattered LC, scattered LC, 2/2) 2/2)
2/2) 2/2) Spleen + + + + (n = 2) (very weak, (very weak, (weak,
mainly in (very weak, mainly in red mainly in red red pulp, 2/2)
mainly in red pulp, 2/2) pulp, 2/2) pulp, 2/2) Thymus + + + + (n =
2) (strong; very rare (strong; very rare (strong; very (strong;
very rare in scattered LC, in scattered LC, rare in scattered in
scattered LC, 1/2) 1/2) LC, 1/2) 1/2) Pituitary + + - + (n = 4)
(strong; (strong; (strong; occasional in occasional in occasional
in adeno- adeno- adeno- hypophysis, 3/4) hypophysis, 3/4)
hypophysis, 3/4; weak moderate, rare, 1/4) LC = lymphocyte; + =
positive staining; - = negative staining
[0412] As expected, LAG-3 expression was detected in the panel of
lymphoid tissue. Additionally, two of the three anti-LAG-3
antibodies examined, 25F7 (IgG1 and IgG4 versions) and 26H10,
exhibited retention in pituitary tissue, whereas one antibody
examined, 8B7, did not show this retention in the pituitary tissue.
Thus, the immunohistochemistry experiment identified two subsets of
anti-LAG-3 antibodies, wherein one subset is retained in pituitary
tissue and the other subset is not retained in pituitary
tissue.
TABLE-US-00012 SUMMARY OF SEQUENCE LISTING SEQ ID NO: SEOUENCE SEQ
ID NO: SEOUENCE 1 V.sub.H CDR1 a.a. 25F7 49 V.sub.H n.t. 25F7 2
V.sub.H CDR1 a.a. 26H10 50 V.sub.H n.t. 26H10 3 V.sub.H CDR1 a.a.
25E3 51 V.sub.H n.t. 25E3 4 V.sub.H CDR1 a.a. 8B7 52 V.sub.H n.t.
8B7 5 V.sub.H CDR1 a.a. 11F2 53 V.sub.H n.t. 11F2 6 V.sub.H CDR1
a.a. 17E5 54 V.sub.H n.t. 17E5 7 V.sub.H CDR2 a.a. 25F7 55 V.sub.K
n.t. 25F7 8 V.sub.H CDR2 a.a. 26H10 56 V.sub.K n.t. 26H10 9 V.sub.H
CDR2 a.a. 25E3 57 V.sub.K n.t. 25E3 10 V.sub.H CDR2 a.a. 8B7 58
V.sub.K n.t. 8B7 11 V.sub.H CDR2 a.a. 11F2 59 V.sub.K n.t. 11F2 12
V.sub.H CDR2 a.a. 17E5 60 V.sub.K n.t. 17E5 13 V.sub.H CDR3 a.a.
25F7 61 V.sub.H 4-34 germline a.a. 14 V.sub.H CDR3 a.a. 26H10 62
V.sub.H JH5b germline a.a. 15 PVGVV 63 V.sub.k L6 germline a.a. 16
V.sub.H CDR3 a.a. 8B7 64 V.sub.k JK2 germline a.a. 17 V.sub.H CDR3
a.a. 11F2 65 V.sub.H 3-33 germline a.a. 18 V.sub.H CDR3 a.a. 17E5
66 V.sub.H JH6b germline a.a. 67 V.sub.k A 27 germline a.a. 19
V.sub.K CDR1 a.a. 25F7 68 V.sub.k JK3 germline a.a. 20 V.sub.K CDR1
a.a. 26H10 69 V.sub.H 3-20 germline a.a. 21 V.sub.K CDR1 a.a. 25E3
22 V.sub.K CDR1 a.a. 8B7 70 V.sub.H JH4b germline a.a. 23 V.sub.K
CDR1 a.a. 11F2 71 V.sub.k L-18 germline a.a. 24 V.sub.K CDR1 a.a.
17E5 72 V.sub.k JK4 germline a.a. 73 V.sub.H 1-24 germline a.a. 25
V.sub.K CDR2 a.a. 25F7 74 V.sub.k JK1 germline a.a. 26 V.sub.K CDR2
a.a. 26H10 75 V.sub.k JK5 germline a.a. 27 V.sub.K CDR2 a.a. 25E3
28 V.sub.K CDR2 a.a. 8B7 76 PGHPLAPG 29 V.sub.K CDR2 a.a. 11F2 77
HPAAPSSW 30 V.sub.K CDR2 a.a. 17E5 78 PAAPSSWG 79
GPPAAAPGHPLAPGPHPAAPSSW GPRPRRY 31 V.sub.K CDR3 a.a. 25F7 80
GPPAAAPGHPLA 32 V.sub.K CDR3 a.a. 26H10 81 PAAAPGHPLAPG 33 V.sub.K
CDR3 a.a. 25E3 82 AAPGHPLAPGPH 34 V.sub.K CDR3 a.a. 8B7 83
PGHPLAPGPHPA 35 V.sub.K CDR3 a.a. 11F2 84 HPLAPGPHPAAP 36 V.sub.K
CDR3 a.a. 17E5 85 LAPGPHPAAPSS 86 PGPHPAAPSSWG 37 V.sub.H a.a. 25F7
87 PHPAAPSSWGPR 38 V.sub.H a.a. 26H10 88 PAAPSSWGPRPR 39 V.sub.H
a.a. 25E3 89 APSSWGPRPRRY 40 V.sub.H a.a. 8B7 90
GPPAPAPGHPPAPGHRPAA PYSWGPRPRRY 41 V.sub.H a.a. 11F2 42 V.sub.H
a.a. 17E5 91 atgtgggaggctcagttcctg 92 gtcagagctgctccggctc 43
V.sub.K a.a. 25F7 93 Rhesus LAG-3 clone pa23-5 a.a. 44 V.sub.K a.a.
26H10 94 Rhesus LAG-3 a.a. (XM_001108923) 45 V.sub.K a.a. 25E3 46
V.sub.K a.a. 8B7 47 V.sub.K a.a. 11F2 48 V.sub.K a.a. 17E5
Sequence CWU 1
1
9515PRTHomo sapiens 1Asp Tyr Tyr Trp Asn1 525PRTHomo sapiens 2Ser
Tyr Gly Met His1 535PRTHomo sapiens 3Asp Tyr Gly Met Ser1
545PRTHomo sapiens 4Gly Tyr Tyr Trp Ser1 555PRTHomo sapiens 5Glu
Val Ser Met His1 565PRTHomo sapiens 6Ser Tyr Gly Met His1
5716PRTHomo sapiens 7Glu Ile Asn His Asn Gly Asn Thr Asn Ser Asn
Pro Ser Leu Lys Ser1 5 10 15817PRTHomo sapiens 8Val Ile Trp Tyr Asp
Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val Lys1 5 10 15Gly917PRTHomo
sapiens 9Gly Ile Asn Trp Asn Gly Gly Ser Thr Tyr Tyr Ala Asp Ser
Val Lys1 5 10 15Gly1016PRTHomo sapiens 10Glu Ile Asn His Arg Gly
Asn Thr Asn Cys Asn Pro Ser Leu Lys Ser1 5 10 151117PRTHomo sapiens
11Gly Phe Asp Pro Glu Asp Gly Glu Thr Ile Tyr Ala Gln Lys Phe Gln1
5 10 15Gly1217PRTHomo sapiens 12Val Ile Trp Tyr Asp Gly Ser Asn Lys
Tyr Tyr Ala Asp Ser Val Lys1 5 10 15Gly1312PRTHomo sapiens 13Gly
Tyr Ser Asp Tyr Glu Tyr Asn Trp Phe Asp Pro1 5 101413PRTHomo
sapiens 14Glu Trp Ala Val Ala Ser Trp Asp Tyr Gly Met Asp Val1 5
10155PRTHomo sapiens 15Pro Val Gly Val Val1 51612PRTHomo sapiens
16Gly Tyr Asp Ile Leu Thr Gly Tyr Tyr Glu Asp Ser1 5 101711PRTHomo
sapiens 17Ala Phe Val Val Val Val Ala Ala Ser Asp Tyr1 5
101814PRTHomo sapiens 18Asp Pro His Cys Ser Ser Thr Asn Cys Tyr Leu
Phe Asp Tyr1 5 101911PRTHomo sapiens 19Arg Ala Ser Gln Ser Ile Ser
Ser Tyr Leu Ala1 5 102012PRTHomo sapiens 20Arg Ala Ser Gln Ser Val
Ser Ser Ser Tyr Leu Ala1 5 102111PRTHomo sapiens 21Arg Ala Ser Gln
Gly Ile Arg Ser Ala Leu Ala1 5 102211PRTHomo sapiens 22Arg Ala Ser
Gln Ser Val Ser Ser Tyr Leu Ala1 5 102311PRTHomo sapiens 23Arg Ala
Ser Gln Ser Val Ser Ser Tyr Leu Ala1 5 102411PRTHomo sapiens 24Arg
Ala Ser Gln Ser Val Ser Ser Tyr Leu Ala1 5 10257PRTHomo sapiens
25Asp Ala Ser Asn Arg Ala Thr1 5267PRTHomo sapiens 26Gly Ala Ser
Ser Arg Ala Thr1 5277PRTHomo sapiens 27Asp Ala Ser Ser Leu Glu Ser1
5287PRTHomo sapiens 28Asn Ala Ser Asn Arg Ala Thr1 5297PRTHomo
sapiens 29Asp Ala Ser Asn Arg Ala Thr1 5307PRTHomo sapiens 30Asp
Ala Ser Asn Arg Ala Thr1 5319PRTHomo sapiens 31Gln Gln Arg Ser Asn
Trp Pro Leu Thr1 5329PRTHomo sapiens 32Gln Gln Tyr Gly Ser Ser Pro
Phe Thr1 5339PRTHomo sapiens 33Gln Gln Phe Asn Ser Tyr Pro Tyr Thr1
5349PRTHomo sapiens 34Gln Gln Arg Ser Asn Trp Pro Leu Thr1
5359PRTHomo sapiens 35Gln Gln Arg Ser Asn Trp Pro Trp Thr1
5369PRTHomo sapiens 36Gln Gln Arg Ser Asn Trp Pro Ile Thr1
537120PRTHomo sapiens 37Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu
Leu Lys Pro Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Tyr Gly
Gly Ser Phe Ser Asp Tyr 20 25 30Tyr Trp Asn Trp Ile Arg Gln Pro Pro
Gly Lys Gly Leu Glu Trp Ile 35 40 45Gly Glu Ile Asn His Asn Gly Asn
Thr Asn Ser Asn Pro Ser Leu Lys 50 55 60Ser Arg Val Thr Leu Ser Leu
Asp Thr Ser Lys Asn Gln Phe Ser Leu65 70 75 80Lys Leu Arg Ser Val
Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95Phe Gly Tyr Ser
Asp Tyr Glu Tyr Asn Trp Phe Asp Pro Trp Gly Gln 100 105 110Gly Thr
Leu Val Thr Val Ser Ser 115 12038122PRTHomo sapiens 38Gln Val Gln
Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly
Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Ala Val Ile Trp Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val
50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu
Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr Cys 85 90 95Ala Arg Glu Trp Ala Val Ala Ser Trp Asp Tyr Gly
Met Asp Val Trp 100 105 110Gly Gln Gly Thr Thr Val Thr Val Ser Ser
115 12039112PRTHomo sapiens 39Glu Val Gln Leu Val Glu Ser Gly Gly
Gly Val Val Arg Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30Gly Met Ser Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Gly Ile Asn Trp Asn
Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr
Ile Ser Gly Asp Asn Ala Lys Asn Ser Leu Tyr65 70 75 80Leu Gln Met
Asn Ser Leu Arg Ala Glu Asp Thr Ala Leu Tyr Tyr Cys 85 90 95Thr Thr
Gly Gly Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 100 105
11040120PRTHomo sapiens 40Gln Val Gln Leu Gln Gln Trp Gly Ala Gly
Leu Leu Lys Pro Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Tyr
Gly Gly Ser Phe Ser Gly Tyr 20 25 30Tyr Trp Ser Trp Ile Arg Gln Pro
Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45Gly Glu Ile Asn His Arg Gly
Asn Thr Asn Cys Asn Pro Ser Leu Lys 50 55 60Ser Arg Val Thr Ile Ser
Gly Asp Thr Ser Lys Lys Gln Phe Ala Leu65 70 75 80Lys Leu Asn Ser
Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95Arg Gly Tyr
Asp Ile Leu Thr Gly Tyr Tyr Glu Asp Ser Trp Gly Pro 100 105 110Gly
Thr Leu Val Thr Val Ser Ser 115 12041123PRTHomo sapiens 41Thr His
Asp Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys1 5 10 15Pro
Gly Ala Ser Val Lys Val Ser Cys Lys Val Ser Gly Tyr Thr Leu 20 25
30Thr Glu Val Ser Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu
35 40 45Glu Trp Met Gly Gly Phe Asp Pro Glu Asp Gly Glu Thr Ile Tyr
Ala 50 55 60Gln Lys Phe Gln Gly Arg Val Thr Met Thr Glu Asp Thr Ser
Thr Asp65 70 75 80Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu
Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Thr Ala Phe Val Val Val Val
Ala Ala Ser Asp Tyr 100 105 110Trp Gly Gln Gly Thr Leu Val Thr Val
Ser Ser 115 12042123PRTHomo sapiens 42Gln Val His Leu Val Glu Ser
Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys
Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val
Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Val Ile Trp
Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg
Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90
95Ala Arg Asp Pro His Cys Ser Ser Thr Asn Cys Tyr Leu Phe Asp Tyr
100 105 110Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115
12043107PRTHomo sapiens 43Glu Ile Val Leu Thr Gln Ser Pro Ala Thr
Leu Ser Leu Ser Pro Gly1 5 10 15Glu Arg Ala Thr Leu Ser Cys Arg Ala
Ser Gln Ser Ile Ser Ser Tyr 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro
Gly Gln Ala Pro Arg Leu Leu Ile 35 40 45Tyr Asp Ala Ser Asn Arg Ala
Thr Gly Ile Pro Ala Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro65 70 75 80Glu Asp Phe Ala
Val Tyr Tyr Cys Gln Gln Arg Ser Asn Trp Pro Leu 85 90 95Thr Phe Gly
Gln Gly Thr Asn Leu Glu Ile Lys 100 10544108PRTHomo sapiens 44Glu
Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly1 5 10
15Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Ser
20 25 30Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu
Leu 35 40 45Ile Tyr Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg
Phe Ser 50 55 60Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser
Arg Leu Glu65 70 75 80Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln
Tyr Gly Ser Ser Pro 85 90 95Phe Thr Phe Gly Pro Gly Thr Lys Val Asp
Ile Lys 100 10545107PRTHomo sapiens 45Ala Ile Gln Leu Thr Gln Ser
Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr
Cys Arg Ala Ser Gln Gly Ile Arg Ser Ala 20 25 30Leu Ala Trp Tyr Gln
Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Asp Ala Ser
Ser Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser
Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu
Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Phe Asn Ser Tyr Pro Tyr 85 90
95Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 10546107PRTHomo
sapiens 46Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser
Pro Gly1 5 10 15Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val
Ser Ser Tyr 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro
Arg Leu Leu Ile 35 40 45Tyr Asn Ala Ser Asn Arg Ala Thr Gly Ile Pro
Ala Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr
Ile Ser Ser Leu Glu Pro65 70 75 80Glu Asp Phe Ala Val Tyr Tyr Cys
Gln Gln Arg Ser Asn Trp Pro Leu 85 90 95Thr Phe Gly Gly Gly Thr Lys
Val Glu Ile Lys 100 10547107PRTHomo sapiens 47Glu Ile Val Leu Thr
Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly1 5 10 15Glu Arg Ala Thr
Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Tyr 20 25 30Leu Ala Trp
Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile 35 40 45Tyr Asp
Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly 50 55 60Ser
Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro65 70 75
80Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Arg Ser Asn Trp Pro Trp
85 90 95Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100
10548107PRTHomo sapiens 48Glu Ile Val Leu Thr Gln Ser Pro Ala Thr
Leu Ser Leu Ser Pro Gly1 5 10 15Glu Arg Ala Thr Leu Ser Cys Arg Ala
Ser Gln Ser Val Ser Ser Tyr 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro
Gly Gln Ala Pro Arg Leu Leu Ile 35 40 45Tyr Asp Ala Ser Asn Arg Ala
Thr Gly Ile Pro Ala Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro65 70 75 80Glu Asp Phe Ala
Val Tyr Tyr Cys Gln Gln Arg Ser Asn Trp Pro Ile 85 90 95Thr Phe Gly
Gln Gly Thr Arg Leu Glu Ile Lys 100 10549360DNAHomo sapiens
49caggtgcagc tacagcagtg gggcgcagga ctgttgaagc cttcggagac cctgtccctc
60acctgcgctg tctatggtgg gtccttcagt gattactact ggaactggat ccgccagccc
120ccagggaagg ggctggagtg gattggggaa atcaatcata atggaaacac
caactccaac 180ccgtccctca agagtcgagt caccctatca ctagacacgt
ccaagaacca gttctccctg 240aagctgaggt ctgtgaccgc cgcggacacg
gctgtgtatt actgtgcgtt tggatatagt 300gactacgagt acaactggtt
cgacccctgg ggccagggaa ccctggtcac cgtctcctca 36050366DNAHomo sapiens
50caggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc
60tcctgtgcag cgtctggatt caccttcagt agctatggca tgcactgggt ccgccaggct
120ccaggcaagg ggctggagtg ggtggcagtt atatggtatg atggaagtaa
taaatactat 180gcagactccg tgaagggccg attcaccatc tccagagaca
attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agccgaggac
acggctgtgt attactgtgc gagagaatgg 300gcagtggcct cctgggacta
cggtatggac gtctggggcc aagggaccac ggtcaccgtc 360tcctca
36651336DNAHomo sapiens 51gaggtgcagt tggtggagtc tgggggaggt
gtggtacggc ctggggggtc cctgagactc 60tcctgtgcag cctctggatt cacctttgat
gattatggca tgagctgggt ccgccaagct 120ccagggaagg ggctggagtg
ggtctctggt attaattgga atggtggtag cacatattat 180gcagactctg
tgaagggccg attcaccatc tccggagaca acgccaagaa ctccctgtat
240ctgcaaatga acagtctgag agccgaggac acggccttgt attactgtac
cactgggggc 300tactggggcc agggaaccct ggtcaccgtc tcctca
33652360DNAHomo sapiens 52caggtgcagc tacagcagtg gggcgcagga
ctgttgaagc catcggaaac cctgtccctc 60acctgcgctg tctatggtgg gtccttcagt
ggttactact ggagctggat ccgccagccc 120ccagggaagg ggctggagtg
gattggggaa atcaatcatc gtggaaacac caactgcaac 180ccgtccctca
agagtcgagt caccatatca ggagatacgt ccaagaaaca gttcgccctg
240aagctgaact ctgtgaccgc cgcggacacg gctgtctatt actgtgcgag
aggatacgat 300attttgactg gttattatga ggactcctgg ggcccgggaa
ccctggtcac cgtctcctca 36053369DNAHomo sapiens 53acccacgacc
aggtccagct ggtacagtct ggggctgagg tgaagaagcc tggggcctca 60gtgaaggtct
cctgcaaggt ttccggatac accctcactg aagtatccat gcactgggtg
120cgacaggctc ctggaaaagg gcttgagtgg atgggaggtt ttgatcctga
agatggtgaa 180acaatctacg cacagaagtt ccagggcaga gtcaccatga
ccgaggacac atctacagac 240acagcctaca tggagctgag cagcctgaga
tctgaggaca cggccgtgta ttactgtgca 300acagcctttg tagtggtggt
agctgcttct gactactggg gccagggaac cctggtcacc 360gtctcctca
36954369DNAHomo sapiens 54caggtgcacc tggtggagtc tgggggaggc
gtggtccagc ctgggaggtc cctgagactc 60tcctgtgcag cgtctggatt caccttcagt
agctatggca tgcactgggt ccgccaggct 120ccaggcaagg ggctggagtg
ggtggcagtt atatggtatg atggaagtaa taaatactat 180gcagactccg
tgaagggccg attcaccatc tccagagaca attccaagaa cacgctgtat
240ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc
gagagatccc 300cattgtagta gtaccaactg ctaccttttt gactactggg
gccagggaac cctggtcacc 360gtctcctca 36955321DNAHomo sapiens
55gaaattgtgt tgacacagtc tccagccacc ctgtctttgt ctccagggga aagagccacc
60ctctcctgca gggccagtca gagtattagc agctacttag cctggtacca acagaaacct
120ggccaggctc ccaggctcct catctatgat gcatccaaca gggccactgg
catcccagcc 180aggttcagtg gcagtgggtc tgggacagac ttcactctca
ccatcagcag cctagagcct 240gaagattttg cagtttatta ctgtcagcag
cgtagcaact ggcctctcac ttttggccag 300gggaccaacc tggagatcaa a
32156324DNAHomo sapiens 56gaaattgtgt tgacgcagtc tccaggcacc
ctgtctttgt ctccagggga aagagccacc 60ctctcctgca gggccagtca gagtgttagc
agcagctact tagcctggta ccagcagaaa 120cctggccagg ctcccaggct
cctcatctat ggtgcatcca gcagggccac tggcatccca 180gacaggttca
gtggcagtgg gtctgggaca gacttcactc tcaccatcag cagactggag
240cctgaagatt ttgcagtgta ttactgtcag cagtatggta gctcaccatt
cactttcggc 300cctgggacca aagtggatat caaa 32457321DNAHomo sapiens
57gccatccagt tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc
60atcacttgcc gggcaagtca gggcattagg agtgctttag cctggtatca gcagaaacca
120gggaaagctc ctaagctcct gatctatgat gcctccagtt tggaaagtgg
ggtcccatca 180aggttcagcg gcagtggatc tgggacagat ttcactctca
ccatcagcag cctgcagcct 240gaagattttg caacttatta ctgtcaacag
tttaatagtt acccgtacac ttttggccag 300gggaccaagc tggagatcaa a
32158321DNAHomo sapiens 58gaaattgtgt tgacacagtc tccagccacc
ctgtctttgt ctccagggga aagagccacc 60ctctcctgca gggccagtca gagtgttagc
agctacttag cctggtacca acagaaacct 120ggccaggctc ccaggctcct
catctataat gcatccaaca gggccactgg catcccagcc 180aggttcagtg
gcagtgggtc tgggacagac ttcactctca ccatcagcag cctagagcct
240gaagattttg cagtttatta ctgtcagcag cgtagcaact
ggccgctcac tttcggcgga 300gggaccaagg tggagatcaa a 32159321DNAHomo
sapiens 59gaaattgtgt tgacacagtc tccagccacc ctgtctttgt ctccagggga
aagagccacc 60ctctcctgca gggccagtca gagtgttagc agctacttag cctggtacca
acagaaacct 120ggccaggctc ccaggctcct catctatgat gcatccaaca
gggccactgg catcccagcc 180aggttcagtg gcagtgggtc tgggacagac
ttcactctca ccatcagcag cctagagcct 240gaagattttg cagtttatta
ctgtcagcag cgtagcaact ggccgtggac gttcggccaa 300gggaccaagg
tggaaatcaa a 32160321DNAHomo sapiens 60gaaattgtgt tgacacagtc
tccagccacc ctgtctttgt ctccagggga aagagccacc 60ctctcctgca gggccagtca
gagtgttagc agctacttag cctggtacca acagaaacct 120ggccaggctc
ccaggctcct catctatgat gcatccaaca gggccactgg catcccagcc
180aggttcagtg gcagtgggtc tgggacagac ttcactctca ccatcagcag
cctagagcct 240gaagattttg cagtttatta ctgtcagcag cgtagcaact
ggcctatcac cttcggccaa 300gggacacgac tggagattaa a 3216198PRTHomo
sapiensMISC_FEATURE(98)..(98)Residue 98 is presented only in a
subset of figures. 61Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu
Leu Lys Pro Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys Ala Val Tyr Gly
Gly Ser Phe Ser Gly Tyr 20 25 30Tyr Trp Ser Trp Ile Arg Gln Pro Pro
Gly Lys Gly Leu Glu Trp Ile 35 40 45Gly Glu Ile Asn His Ser Gly Ser
Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60Ser Arg Val Thr Ile Ser Val
Asp Thr Ser Lys Asn Gln Phe Ser Leu65 70 75 80Lys Leu Ser Ser Val
Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95Arg
Gly6216PRTHomo sapiensMISC_FEATURE(1)..(3)Residues 1-3 are
presented only in a subset of figures. 62Asn Trp Phe Asp Pro Trp
Gly Gln Gly Thr Leu Val Thr Val Ser Ser1 5 10 156395PRTHomo sapiens
63Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly1
5 10 15Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser
Tyr 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu
Leu Ile 35 40 45Tyr Asp Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg
Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser
Ser Leu Glu Pro65 70 75 80Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln
Arg Ser Asn Trp Pro 85 90 956412PRTHomo
sapiensMISC_FEATURE(1)..(1)Residue 1 is presented only in a subset
of figures. 64Tyr Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys1 5
106598PRTHomo sapiens 65Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val
Val Gln Pro Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
Phe Thr Phe Ser Ser Tyr 20 25 30Gly Met His Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val 35 40 45Ala Val Ile Trp Tyr Asp Gly Ser
Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser
Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser
Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala
Arg6616PRTHomo sapiens 66Tyr Gly Met Asp Val Trp Gly Gln Gly Thr
Thr Val Thr Val Ser Ser1 5 10 156796PRTHomo sapiens 67Glu Ile Val
Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly1 5 10 15Glu Arg
Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Ser 20 25 30Tyr
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu 35 40
45Ile Tyr Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser
50 55 60Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu
Glu65 70 75 80Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Gly
Ser Ser Pro 85 90 956812PRTHomo sapiens 68Phe Thr Phe Gly Pro Gly
Thr Lys Val Asp Ile Lys1 5 106998PRTHomo sapiens 69Glu Val Gln Leu
Val Glu Ser Gly Gly Gly Val Val Arg Pro Gly Gly1 5 10 15Ser Leu Arg
Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30Gly Met
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser
Gly Ile Asn Trp Asn Gly Gly Ser Thr Gly Tyr Ala Asp Ser Val 50 55
60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr65
70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Leu Tyr His
Cys 85 90 95Ala Arg7014PRTHomo sapiensMISC_FEATURE(1)..(2)Residues
1-2 are only presented in a subset of figures. 70Phe Asp Tyr Trp
Gly Gln Gly Thr Leu Val Thr Val Ser Ser1 5 107195PRTHomo sapiens
71Ala Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1
5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser
Ala 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu
Leu Ile 35 40 45Tyr Asp Ala Ser Ser Leu Glu Ser Gly Val Pro Ser Arg
Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser
Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln
Phe Asn Ser Tyr Pro 85 90 957212PRTHomo sapiens 72Leu Thr Phe Gly
Gly Gly Thr Lys Val Glu Ile Lys1 5 1073101PRTHomo sapiens 73Thr His
Ala Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys1 5 10 15Pro
Gly Ala Ser Val Lys Val Ser Cys Lys Val Ser Gly Tyr Thr Leu 20 25
30Thr Glu Leu Ser Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu
35 40 45Glu Trp Met Gly Gly Phe Asp Pro Glu Asp Gly Glu Thr Ile Tyr
Ala 50 55 60Gln Lys Phe Gln Gly Arg Val Thr Met Thr Glu Asp Thr Ser
Thr Asp65 70 75 80Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu
Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Thr 1007412PRTHomo sapiens
74Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys1 5 107512PRTHomo
sapiens 75Ile Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys1 5
10768PRTHomo sapiens 76Pro Gly His Pro Leu Ala Pro Gly1 5778PRTHomo
sapiens 77His Pro Ala Ala Pro Ser Ser Trp1 5788PRTHomo sapiens
78Pro Ala Ala Pro Ser Ser Trp Gly1 57930PRTHomo sapiens 79Gly Pro
Pro Ala Ala Ala Pro Gly His Pro Leu Ala Pro Gly Pro His1 5 10 15Pro
Ala Ala Pro Ser Ser Trp Gly Pro Arg Pro Arg Arg Tyr 20 25
308012PRTHomo sapiens 80Gly Pro Pro Ala Ala Ala Pro Gly His Pro Leu
Ala1 5 108112PRTHomo sapiens 81Pro Ala Ala Ala Pro Gly His Pro Leu
Ala Pro Gly1 5 108212PRTHomo sapiens 82Ala Ala Pro Gly His Pro Leu
Ala Pro Gly Pro His1 5 108312PRTHomo sapiens 83Pro Gly His Pro Leu
Ala Pro Gly Pro His Pro Ala1 5 108412PRTHomo sapiens 84His Pro Leu
Ala Pro Gly Pro His Pro Ala Ala Pro1 5 108512PRTHomo sapiens 85Leu
Ala Pro Gly Pro His Pro Ala Ala Pro Ser Ser1 5 108612PRTHomo
sapiens 86Pro Gly Pro His Pro Ala Ala Pro Ser Ser Trp Gly1 5
108712PRTHomo sapiens 87Pro His Pro Ala Ala Pro Ser Ser Trp Gly Pro
Arg1 5 108812PRTHomo sapiens 88Pro Ala Ala Pro Ser Ser Trp Gly Pro
Arg Pro Arg1 5 108912PRTHomo sapiens 89Ala Pro Ser Ser Trp Gly Pro
Arg Pro Arg Arg Tyr1 5 109030PRTMacaca sp. 90Gly Pro Pro Ala Pro
Ala Pro Gly His Pro Pro Ala Pro Gly His Arg1 5 10 15Pro Ala Ala Pro
Tyr Ser Trp Gly Pro Arg Pro Arg Arg Tyr 20 25
309121DNAArtificial5Mcyn1408 primer 91atgtgggagg ctcagttcct g
219219DNAArtificial3Mcyn1408a primer 92gtcagagctg ctccggctc
1993532PRTMacaca mulatta 93Met Trp Glu Ala Gln Phe Leu Gly Leu Leu
Phe Leu Gln Pro Leu Trp1 5 10 15Val Ala Pro Val Lys Pro Pro Gln Pro
Gly Ala Glu Ile Ser Val Val 20 25 30Trp Ala Gln Glu Gly Ala Pro Ala
Gln Leu Pro Cys Ser Pro Thr Ile 35 40 45Pro Leu Gln Asp Leu Ser Leu
Leu Arg Arg Ala Gly Val Thr Trp Gln 50 55 60His Gln Pro Asp Ser Gly
Pro Pro Ala Pro Ala Pro Gly His Pro Pro65 70 75 80Ala Pro Gly His
Arg Pro Ala Ala Pro Tyr Ser Trp Gly Pro Arg Pro 85 90 95Arg Arg Tyr
Thr Val Leu Ser Val Gly Pro Gly Gly Leu Arg Ser Gly 100 105 110Arg
Leu Pro Leu Gln Pro Arg Val Gln Leu Asp Glu Arg Gly Arg Gln 115 120
125Arg Gly Asp Phe Ser Leu Trp Leu Arg Pro Ala Arg Arg Ala Asp Ala
130 135 140Gly Glu Tyr Arg Ala Thr Val His Leu Arg Asp Arg Ala Leu
Ser Cys145 150 155 160Arg Leu Arg Leu Arg Val Gly Gln Ala Ser Met
Thr Ala Ser Pro Pro 165 170 175Gly Ser Leu Arg Thr Ser Asp Trp Val
Ile Leu Asn Cys Ser Phe Ser 180 185 190Arg Pro Asp Arg Pro Ala Ser
Val His Trp Phe Arg Ser Arg Gly Gln 195 200 205Gly Arg Val Pro Val
Gln Gly Ser Pro His His His Leu Ala Glu Ser 210 215 220Phe Leu Phe
Leu Pro His Val Gly Pro Met Asp Ser Gly Leu Trp Gly225 230 235
240Cys Ile Leu Thr Tyr Arg Asp Gly Phe Asn Val Ser Ile Met Tyr Asn
245 250 255Leu Thr Val Leu Gly Leu Glu Pro Ala Thr Pro Leu Val Tyr
Ala Gly 260 265 270Ala Gly Ser Arg Val Glu Leu Pro Cys Arg Leu Pro
Pro Ala Val Gly 275 280 285Thr Gln Ser Phe Leu Thr Ala Lys Trp Ala
Pro Pro Gly Gly Gly Pro 290 295 300Asp Leu Leu Val Ala Gly Asp Asn
Gly Asp Phe Thr Leu Arg Leu Glu305 310 315 320Asp Val Ser Gln Ala
Gln Ala Gly Thr Tyr Ile Cys His Ile Arg Leu 325 330 335Gln Gly Gln
Gln Leu Asn Ala Thr Val Thr Leu Ala Ile Ile Thr Val 340 345 350Thr
Pro Lys Ser Phe Gly Ser Pro Gly Ser Leu Gly Lys Leu Leu Cys 355 360
365Glu Val Thr Pro Ala Ser Gly Gln Glu His Phe Val Trp Ser Pro Leu
370 375 380Asn Thr Pro Ser Gln Arg Ser Phe Ser Gly Pro Trp Leu Glu
Ala Gln385 390 395 400Glu Ala Gln Leu Leu Ser Gln Pro Trp Gln Cys
Gln Leu His Gln Gly 405 410 415Glu Arg Leu Leu Gly Ala Ala Val Tyr
Phe Thr Glu Leu Ser Ser Pro 420 425 430Gly Ala Gln Arg Ser Gly Arg
Ala Pro Gly Ala Leu Arg Ala Gly His 435 440 445Leu Pro Leu Phe Leu
Ile Leu Gly Val Leu Phe Leu Leu Leu Leu Val 450 455 460Thr Gly Ala
Phe Gly Phe His Leu Trp Arg Arg Gln Trp Arg Pro Arg465 470 475
480Arg Phe Ser Ala Leu Glu Gln Gly Ile His Pro Pro Gln Ala Gln Ser
485 490 495Lys Ile Glu Glu Leu Glu Gln Glu Pro Glu Leu Glu Pro Glu
Pro Glu 500 505 510Leu Glu Arg Glu Leu Gly Pro Glu Pro Glu Pro Gly
Pro Glu Pro Glu 515 520 525Pro Glu Gln Leu 53094533PRTMacaca
mulatta 94Met Trp Glu Ala Gln Phe Leu Gly Leu Leu Phe Leu Gln Pro
Leu Trp1 5 10 15Val Ala Pro Val Lys Pro Pro Gln Pro Gly Ala Glu Ile
Ser Val Val 20 25 30Trp Ala Gln Glu Gly Ala Pro Ala Gln Leu Pro Cys
Ser Pro Thr Ile 35 40 45Pro Leu Gln Asp Leu Ser Leu Leu Arg Arg Ala
Gly Val Thr Trp Gln 50 55 60His Gln Pro Asp Ser Gly Pro Pro Ala Pro
Ala Pro Gly His Pro Pro65 70 75 80Ala Pro Gly His Arg Pro Ala Ala
Pro Tyr Ser Trp Gly Pro Arg Pro 85 90 95Arg Arg Tyr Thr Val Leu Ser
Val Gly Pro Gly Gly Leu Arg Ser Gly 100 105 110Arg Leu Pro Leu Gln
Pro Arg Val Gln Leu Asp Glu Arg Gly Arg Gln 115 120 125Arg Gly Asp
Phe Ser Leu Trp Leu Arg Pro Ala Arg Arg Ala Asp Ala 130 135 140Gly
Glu Tyr Arg Ala Thr Val His Leu Arg Asp Arg Ala Leu Ser Cys145 150
155 160Arg Leu Arg Leu Arg Val Gly Gln Ala Ser Met Thr Ala Ser Pro
Pro 165 170 175Gly Ser Leu Arg Thr Ser Asp Trp Val Ile Leu Asn Cys
Ser Phe Ser 180 185 190Arg Pro Asp Arg Pro Ala Ser Val His Trp Phe
Arg Ser Arg Gly Gln 195 200 205Gly Arg Val Pro Val Gln Gly Ser Pro
His His His Leu Ala Glu Ser 210 215 220Phe Leu Phe Leu Pro His Val
Gly Pro Met Asp Ser Gly Leu Trp Gly225 230 235 240Cys Ile Leu Thr
Tyr Arg Asp Gly Phe Asn Val Ser Ile Met Tyr Asn 245 250 255Leu Thr
Val Leu Gly Leu Glu Pro Ala Thr Pro Leu Thr Val Tyr Ala 260 265
270Gly Ala Gly Ser Arg Val Glu Leu Pro Cys Arg Leu Pro Pro Ala Val
275 280 285Gly Thr Gln Ser Phe Leu Thr Ala Lys Trp Ala Pro Pro Gly
Gly Gly 290 295 300Pro Asp Leu Leu Val Ala Gly Asp Asn Gly Asp Phe
Thr Leu Arg Leu305 310 315 320Glu Asp Val Ser Gln Ala Gln Ala Gly
Thr Tyr Ile Cys His Ile Arg 325 330 335Leu Gln Gly Gln Gln Leu Asn
Ala Thr Val Thr Leu Ala Ile Ile Thr 340 345 350Val Thr Pro Lys Ser
Phe Gly Ser Pro Gly Ser Leu Gly Lys Leu Leu 355 360 365Cys Glu Val
Thr Pro Ala Ser Gly Gln Glu His Phe Val Trp Ser Pro 370 375 380Leu
Asn Thr Pro Ser Gln Arg Ser Phe Ser Gly Pro Trp Leu Glu Ala385 390
395 400Gln Glu Ala Gln Leu Leu Ser Gln Pro Trp Gln Cys Gln Leu His
Gln 405 410 415Gly Glu Thr Leu Leu Gly Ala Ala Val Tyr Phe Thr Glu
Leu Ser Ser 420 425 430Pro Gly Ala Gln Arg Ser Gly Arg Ala Pro Gly
Ala Leu Arg Ala Gly 435 440 445His Leu Pro Leu Phe Leu Ile Leu Gly
Val Leu Phe Leu Leu Leu Leu 450 455 460Val Thr Gly Ala Phe Gly Phe
His Leu Trp Arg Arg Gln Trp Arg Pro465 470 475 480Arg Arg Phe Ser
Ala Leu Glu Gln Gly Ile His Pro Pro Gln Ala Gln 485 490 495Ser Lys
Ile Glu Glu Leu Glu Gln Glu Pro Glu Leu Glu Pro Glu Pro 500 505
510Glu Leu Glu Arg Glu Leu Gly Pro Glu Pro Glu Pro Gly Pro Glu Pro
515 520 525Glu Pro Glu Gln Leu 53095525PRTHomo sapiens 95Met Trp
Glu Ala Gln Phe Leu Gly Leu Leu Phe Leu Gln Pro Leu Trp1 5 10 15Val
Ala Pro Val Lys Pro Leu Gln Pro Gly Ala Glu Val Pro Val Val 20 25
30Trp Ala Gln Glu Gly Ala Pro Ala Gln Leu Pro Cys Ser Pro Thr Ile
35 40 45Pro Leu Gln Asp Leu Ser Leu Leu Arg Arg Ala Gly Val Thr Trp
Gln 50 55 60His Gln Pro Asp Ser Gly Pro Pro Ala Ala Ala Pro Gly His
Pro Leu65 70 75 80Ala Pro Gly Pro His Pro Ala Ala Pro Ser Ser Trp
Gly Pro Arg Pro 85 90 95Arg Arg Tyr Thr Val Leu Ser Val Gly Pro Gly
Gly Leu Arg Ser Gly 100 105 110Arg Leu Pro Leu Gln Pro Arg Val Gln
Leu Asp Glu Arg Gly Arg Gln 115
120 125Arg Gly Asp Phe Ser Leu Trp Leu Arg Pro Ala Arg Arg Ala Asp
Ala 130 135 140Gly Glu Tyr Arg Ala Ala Val His Leu Arg Asp Arg Ala
Leu Ser Cys145 150 155 160Arg Leu Arg Leu Arg Leu Gly Gln Ala Ser
Met Thr Ala Ser Pro Pro 165 170 175Gly Ser Leu Arg Ala Ser Asp Trp
Val Ile Leu Asn Cys Ser Phe Ser 180 185 190Arg Pro Asp Arg Pro Ala
Ser Val His Trp Phe Arg Asn Arg Gly Gln 195 200 205Gly Arg Val Pro
Val Arg Glu Ser Pro His His His Leu Ala Glu Ser 210 215 220Phe Leu
Phe Leu Pro Gln Val Ser Pro Met Asp Ser Gly Pro Trp Gly225 230 235
240Cys Ile Leu Thr Tyr Arg Asp Gly Phe Asn Val Ser Ile Met Tyr Asn
245 250 255Leu Thr Val Leu Gly Leu Glu Pro Pro Thr Pro Leu Thr Val
Tyr Ala 260 265 270Gly Ala Gly Ser Arg Val Gly Leu Pro Cys Arg Leu
Pro Ala Gly Val 275 280 285Gly Thr Arg Ser Phe Leu Thr Ala Lys Trp
Thr Pro Pro Gly Gly Gly 290 295 300Pro Asp Leu Leu Val Thr Gly Asp
Asn Gly Asp Phe Thr Leu Arg Leu305 310 315 320Glu Asp Val Ser Gln
Ala Gln Ala Gly Thr Tyr Thr Cys His Ile His 325 330 335Leu Gln Glu
Gln Gln Leu Asn Ala Thr Val Thr Leu Ala Ile Ile Thr 340 345 350Val
Thr Pro Lys Ser Phe Gly Ser Pro Gly Ser Leu Gly Lys Leu Leu 355 360
365Cys Glu Val Thr Pro Val Ser Gly Gln Glu Arg Phe Val Trp Ser Ser
370 375 380Leu Asp Thr Pro Ser Gln Arg Ser Phe Ser Gly Pro Trp Leu
Glu Ala385 390 395 400Gln Glu Ala Gln Leu Leu Ser Gln Pro Trp Gln
Cys Gln Leu Tyr Gln 405 410 415Gly Glu Arg Leu Leu Gly Ala Ala Val
Tyr Phe Thr Glu Leu Ser Ser 420 425 430Pro Gly Ala Gln Arg Ser Gly
Arg Ala Pro Gly Ala Leu Pro Ala Gly 435 440 445His Leu Leu Leu Phe
Leu Ile Leu Gly Val Leu Ser Leu Leu Leu Leu 450 455 460Val Thr Gly
Ala Phe Gly Phe His Leu Trp Arg Arg Gln Trp Arg Pro465 470 475
480Arg Arg Phe Ser Ala Leu Glu Gln Gly Ile His Pro Pro Gln Ala Gln
485 490 495Ser Lys Ile Glu Glu Leu Glu Gln Glu Pro Glu Pro Glu Pro
Glu Pro 500 505 510Glu Pro Glu Pro Glu Pro Glu Pro Glu Pro Glu Gln
Leu 515 520 525
* * * * *
References