U.S. patent application number 16/297166 was filed with the patent office on 2019-09-05 for compositions, methods, and kits for detecting and identifying mycobacteria.
The applicant listed for this patent is Brandeis University. Invention is credited to John E. Rice, Lawrence J. Wangh.
Application Number | 20190271026 16/297166 |
Document ID | / |
Family ID | 46051567 |
Filed Date | 2019-09-05 |
![](/patent/app/20190271026/US20190271026A1-20190905-D00001.png)
![](/patent/app/20190271026/US20190271026A1-20190905-D00002.png)
![](/patent/app/20190271026/US20190271026A1-20190905-D00003.png)
![](/patent/app/20190271026/US20190271026A1-20190905-D00004.png)
![](/patent/app/20190271026/US20190271026A1-20190905-D00005.png)
![](/patent/app/20190271026/US20190271026A1-20190905-D00006.png)
![](/patent/app/20190271026/US20190271026A1-20190905-D00007.png)
![](/patent/app/20190271026/US20190271026A1-20190905-D00008.png)
![](/patent/app/20190271026/US20190271026A1-20190905-D00009.png)
![](/patent/app/20190271026/US20190271026A1-20190905-D00010.png)
![](/patent/app/20190271026/US20190271026A1-20190905-D00011.png)
View All Diagrams
United States Patent
Application |
20190271026 |
Kind Code |
A1 |
Wangh; Lawrence J. ; et
al. |
September 5, 2019 |
COMPOSITIONS, METHODS, AND KITS FOR DETECTING AND IDENTIFYING
MYCOBACTERIA
Abstract
Provided herein are methods for detecting and identifying
strains of mycobacteria, and compositions and kits for performing
such methods. In particular, nucleic acid amplification and
fluorescence detection methods are provided for the detection and
differentiation of mycobacteria based on, for example,
pathogenicity, species, and antibiotic resistance or sensitivity.
Compositions and methods are provided herein to identify and
differentiate mycobacteria in mixtures of different mycobacteria
and mycobacteria and non-mycobacteria.
Inventors: |
Wangh; Lawrence J.;
(Auburndale, MA) ; Rice; John E.; (Quincy,
MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Brandeis University |
Waltham |
MA |
US |
|
|
Family ID: |
46051567 |
Appl. No.: |
16/297166 |
Filed: |
March 8, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13884873 |
Jul 17, 2013 |
10273525 |
|
|
PCT/US11/60224 |
Nov 10, 2011 |
|
|
|
16297166 |
|
|
|
|
61412190 |
Nov 10, 2010 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 2600/106 20130101;
C12Q 1/689 20130101; C12Q 1/6818 20130101; C12Q 2600/16 20130101;
C12Q 2527/107 20130101; C12Q 1/6818 20130101; C12Q 2537/143
20130101; C12Q 2537/101 20130101 |
International
Class: |
C12Q 1/6818 20060101
C12Q001/6818; C12Q 1/689 20060101 C12Q001/689 |
Claims
1. A method for amplification and identification of one or more
types of mycobacteria in a sample, comprising: a) providing: i) a
sample suspected of comprising one or more mycobacteria, and ii) at
least one pair of primers, wherein said primers are configured to
hybridize to regions of mycobacteria nucleic acid conserved between
two or more types of mycobacteria, and wherein said primers are
configured to amplify a region of mycobacteria nucleic acid that
varies between the two or more types of mycobacteria; and iii) at
least two detectably distinguishable probe sets, wherein each set
of the at least two detectably distinguishable probe sets comprises
a signaling probe and an associated quencher probe which hybridize
to adjacent nucleic acid sequences in an amplified region of
mycobacteria nucleic acid amplified by the primers in (a), wherein
each set of the at least two detectably distinguishable probe sets
contains at least one identical probe, such that at least one
identical probe is shared between each set of the at least two
detectably distinguishable probe sets, and the at least one
identical probe is adjacent to two other probes in the at least two
detectably distinguishable probe sets on the amplified region of
the mycobacteria nucleic acid amplified by the primers in (ii),
wherein the at least two detectably distinguishable probe sets
hybridize to the mycobacteria nucleic acid amplified by the primers
in (ii) such that there are no unhybridized nucleic acid bases
between the at least one identical probe and the two other probes
on the amplified region of mycobacteria nucleic acid amplified by
the primers in (ii); the signaling probe comprising a
fluorescence-emitting fluorophore with a quencher of the
fluorescence-emitting fluorophore adjacent to the
fluorescence-emitting fluorophore on the signaling probe such that
said signaling probe does not emit a fluorescent signal above
background fluorescence when not hybridized to its target sequence,
the quencher probe comprising a non-fluorescent quencher such that
when both the quencher probe and the signaling probe are hybridized
to the adjacent nucleic acid sequences in the amplified region of
the mycobacteria nucleic acid amplified by the primers in (ii), the
non-fluorescent quencher of the quencher probe quenches the
fluorescent signal emitted by the fluorescence-emitting fluorophore
of the signaling probe, wherein said at least one identical probe
is the quencher probe, wherein each end of the quencher probe is
labeled with a non-fluorescent quencher, the non-fluorescent
quencher on one end of the quencher probe interacts with the
fluorescence-emitting fluorophore of said signaling probe from one
set of the at least two detectably distinguishable probe sets and
the non-fluorescent quencher on other end of the quencher probe
interacts with said fluorescence-emitting fluorophore of the
signaling probe from another set of the at least two detectably
distinguishable probe sets when the at least two detectably
distinguishable probe sets hybridize to the amplified mycobacteria
nucleic acid amplified by the primers in (ii), or said at least one
identical probe is either the signal probe or the quencher probe,
said at least one identical probe has a fluorophore on its one end
and a fluorophore quencher on its other end, the fluorophore of
said at least one identical probe interacts with the
non-fluorescent quencher of said quencher probe from one set of the
at least two detectably distinguishable probe sets and the
fluorophore quencher of said at least one identical probe interacts
with the fluorescence-emitting fluorophore of said signaling probe
from another set of the at least two detectably distinguishable
probe sets when the at least two detectably distinguishable probe
sets hybridize to the amplified region of mycobacteria nucleic acid
amplified by the primers in (ii), b) amplifying nucleic acid from
said one or more mycobacteria with the primers in (ii); c)
detecting the fluorescence of the fluorescence-emitting fluorophore
of from each signaling probe in the at least two detectably
distinguishable probe sets over a range of temperatures; d)
generating a temperature-dependent fluorescence signature for each
fluorescence emitting fluorophore; and e) analyzing said
temperature-dependent fluorescence signatures to identify one or
more mycobacterium in said sample.
2. The method of claim 1, wherein said amplification is LATE-PCR
amplification.
3. The method of claim 1, wherein identifying one or more
mycobacterium in a sample comprises: a) differentiating between NTM
and MTBC; b) differentiating between different species of MTBC; c)
differentiating between isoniazid-resistant and isoniazid-sensitive
mycobacteria; d) differentiating between fluoroquinolone-resistant
and fluoroquinolone-sensitive mycobacteria; e) differentiating
between ethambutol-resistant and ethambutol-sensitive mycobacteria;
or f) differentiating between rifampin-resistant and
rifampin-sensitive mycobacteria.
4. The method of claim 1, wherein, in each set of the at least two
detectably distinguishable probe sets, the melting temperature of
the signaling probe in the at least two detectably distinguishable
probe sets is higher than the melting temperature[s] of the
associated quencher probe.
5. The method of claim 1, wherein said at least one pair of primers
comprises a Limiting Primer and an Excess Primer, wherein the
Limiting Primer and Excess Primer have initial concentrations and
melting temperatures that allow amplification of a region of
mycobacteria nucleic acid that varies between the two or more types
of mycobacteria by Linear-After-The-Exponential-PCR.
6. The method of claim 3, wherein one or more sets of the at least
two detectably distinguishable probe sets are configured to
hybridize to a region of mycobacteria nucleic acid to differentiate
between different species of MTBC.
7. The method of claim 6, wherein one or more primer pairs of the
at least one pair of primers are configured to amplify a region of
mycobacteria gyrB gene.
8. The method of claim 7, wherein said reagents comprise one or
more of SEQ ID NOS: 58-62.
9. The method of claim 1, wherein three or more detectably
distinguishable probe sets of the at least two detectably
distinguishable probe sets are configured to hybridize to a region
of mycobacteria nucleic acid to differentiate between
rifampin-resistant mycobacteria and rifampin-sensitive
mycobacteria.
10. The method of claim 9, wherein one or more primer pairs of the
at least one pair of primers are configured to amplify a region of
mycobacteria rpoB gene.
11. The method of claim 10, wherein said three or more detectably
distinguishable probe sets comprise SEQ ID NO:30-35.
12. The method of claim 3, wherein one or more detectably
distinguishable probe sets of the at least two detectably
distinguishable probe sets are configured to amplify a region of
mycobacteria nucleic embB gene to differentiate between
ethambutol-resistant mycobacteria and ethambutol-sensitive
mycobacteria.
13. The method of claim 3, wherein one or more detectably
distinguishable probe sets of the at least two detectably
distinguishable probe sets are configured to hybridize to a region
of mycobacteria nucleic acid to differentiate between
isoniazid-resistant mycobacteria and isoniazid-sensitive
mycobacteria.
14. The method of claim 13, wherein one or more primer pairs of the
at least one pair of primers are configured to amplify a region of
mycobacteria mabA promoter region.
15. The method of claim 14, wherein said reagents comprise one or
more of SEQ ID NOS: 45-48.
16. The method of claim 13, wherein one or more primer pairs of the
at least one pair of primers are configured to amplify a region of
mycobacteria ahpC gene.
17. The method of claim 13, wherein one or more primer pairs of the
at least one pair of primers are configured to amplify a region of
mycobacteria katG gene.
18. The method of claim 3, wherein one or more detectably
distinguishable probe sets of the at least two detectably
distinguishable probe sets are configured to hybridize to a region
of mycobacteria nucleic acid to differentiate between
fluoroquinolone-resistant mycobacteria and
fluoroquinolone-sensitive mycobacteria.
19. The method of claim 18, wherein one or more primer pairs of the
at least one pair of primers are configured to amplify a region of
mycobacteria gyrA gene.
20. The method of claim 1, wherein said at least two detectably
distinguishable probe sets comprise five or fewer optically
distinguishable labels.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] The present application is a divisional of U.S. patent
application Ser. No. 13/884,873, filed Jul. 17, 2013, which is a
national phase application of PCT International Application No.
PCT/US2011/060224, filed Nov. 10, 2011, which published as
International Publication No. WO/2012/064978, which claims priority
to U.S. Provisional Patent Application Ser. No. 61/412,190 filed
Nov. 10, 2010, each of which are hereby incorporated by reference
in its entirety.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Sep. 7, 2017, is named BUG-053_01(22247_05301)_SL.txt and is
30,082 bytes in size.
FIELD
[0003] Provided herein are methods for detecting and identifying
strains of mycobacteria, and compositions and kits for performing
such methods. In particular, nucleic acid amplification and
fluorescence detection methods are provided for the detection and
differentiation of mycobacteria based on, for example,
pathogenicity, species, and antibiotic resistance or sensitivity.
Compositions and methods are provided herein to identify and
differentiate mycobacteria in mixtures of different mycobacteria
and non-mycobacteria.
BACKGROUND
[0004] Mycobacterium is a genus of Actinobacteria, given its own
family, the Mycobacteriaceae. The genus includes pathogens known to
cause serious diseases in mammals, including tuberculosis (TB) and
leprosy (Ryan & Ray (editors) (2004). Sherris Medical
Microbiology (4th ed.). McGraw Hill; herein incorporated by
reference in its entirety). Mycobacteria can colonize their hosts
without the hosts showing any adverse signs. For example, billions
of people around the world have asymptomatic infections of M
tuberculosis. Mycobacteria are naturally resistant to a number of
antibiotics, such as penicillin, and many other
antibiotic-resistant strains have emerged. Mycobacteria are
classified as M tuberculosis complex (MTBC) or non-tuberculosis
mycobacteria (NTM) for the purposes of diagnosis and treatment.
MTBC comprises species which can cause tuberculosis: M
tuberculosis, M. bovis, M. africanum, M canetti, and M microti. NTM
are all the other mycobacteria, which can cause pulmonary disease
resembling tuberculosis, lymphadenitis, skin disease, disseminated
disease, Hansen's disease, and leprosy. Of the MTBC and NTM,
different species are more or less common in different regions of
the world, and exhibit different pathogenic and virulence
characteristics.
[0005] The presence of antibiotic resistant TB, and
multidrug-resistant TB (MDR TB) and extensively drug resistant TB
(XDR TB) in particular, is of great concern to the medical
community. MDR TB is TB that is resistant to two first-line anti-TB
drugs, isoniazid and rifampicin, which are typically are used to
treat all persons with TB disease. XDR TB is currently a relatively
rare type of MDR TB, defined as TB that is resistant to isoniazid
and rifampin, plus resistant to any fluoroquinolone and at least
one of three injectable second-line drugs (e.g., amikacin,
kanamycin, or capreomycin). Because XDR TB is resistant to
first-line and second-line drugs, patients are left with treatment
options that are much less effective. Resistant forms of TB raise
concerns of a future TB epidemic with restricted treatment options,
and jeopardize the progress made in worldwide TB treatment and
control.
[0006] Mycobacteria infection can commonly consist of a mixed
infection of: mycobacteria in the presence of other infectious
agents, NTM and MTBC, different species of NTM or MTBC, and/or
mycobacteria with different antibiotic resistance profiles.
SUMMARY
[0007] In some embodiments, provided herein are methods for
identifying one or more types of mycobacteria in a sample,
comprising (a) providing: (i) a sample suspected of comprising one
or more mycobacteria, and (ii) detection reagents comprising at
least one pair of primers and at least one detectably
distinguishable probe set of two hybridization probes which
hybridize to adjacent target nucleic acid sequences in one or more
mycobacteria, each probe set comprising: (A) a quencher probe
labeled with a non-fluorescent quencher, and (B) a signaling probe
labeled with a fluorescence-emitting dye and a non-fluorescent
quencher, wherein the signal probe does not emit fluorescence above
background when not hybridized to its target sequence, but emits a
fluorescence signal above background upon hybridization to its
target sequence in the absence of bound quencher probe, wherein, if
both signaling and quencher probes are hybridized to their adjacent
target nucleic acid sequences, the non-fluorescent quencher of the
quencher probe quenches the signal from the signaling probe; (b)
amplifying nucleic acid from one or more mycobacteria with the
primers; (c) detecting the fluorescence of the
fluorescence-emitting dye from each detectably distinguishable
probe set at a range of temperatures; (d) generating
temperature-dependent fluorescence signatures for each
fluorescence-emitting dye; and (e) analyzing the
temperature-dependent fluorescence signatures to identify one or
more mycobacterium in the sample.
[0008] In some embodiments, the melting temperature of the
signaling probe in a probe set is higher than the melting
temperature of the associated quencher probe. In some embodiments,
the quencher probe and/or signaling probe are configured to
hybridize to a variable region of mycobacteria nucleic acid. In
some embodiments, the fluorescence-emitting dye and the
non-fluorescent quenchers of each probe set are capable of
interacting by FRET. In some embodiments, the detection reagents
comprise two or more probe sets. In some embodiments, two or more
probe sets comprise different fluorescence-emitting dyes that emit
at detectably different wavelengths. In some embodiments, two or
more probe sets comprise the same fluorescence-emitting dyes. In
some embodiments, the probes sets comprising the same
fluorescence-emitting dyes hybridize to their target nucleic acid
sequences at detectably different melting temperatures with their
target nucleic acid sequences. In some embodiments, the each of the
two or more probe sets are detectably distinguishable from all
other probe sets in said detection reagents by (1) melting
temperature, (2) emission wavelength of said fluorescence-emitting
dye, or (3) a combination thereof. In some embodiments, the
detection reagents comprise 5 or more probe sets. In some
embodiments, the detection reagents comprise 10 or more probe sets.
In some embodiments, a probe set is used to differentiate between
myobacteria of different pathogenicity, species, or antibiotic
resistance. In some embodiments, one or both probes of said probe
set comprise different degrees of complementarity to their target
sequences in two or more different myobacteria. In some
embodiments, the different degrees of complementarity result in
different temperature-dependent fluorescent signatures generated by
a probe set and its target sequences. In some embodiments, the
different temperature dependent fluorescent signatures are used to
differentiate different mycobacteria in a sample. In some
embodiments, the temperature-dependent fluorescence signature
comprises a melt curve or an annealing curve. In some embodiments,
the analyzing the temperature-dependent fluorescence signature
comprises comparison to a previously established melting curve or
annealing curve. In some embodiments, analyzing is performed by a
computer. In some embodiments, amplification is by a non-symmetric
amplification method that includes extension of primers and a mean
primer annealing temperature after the first few amplification
cycles. In some embodiments, amplification is by LATE-PCR
amplification. In some embodiments, the probes in at least one
detectably distinguishable probe set have melting temperatures with
their target nucleic acid sequences below the annealing temperature
of at least one primer of the amplification reaction.
[0009] In some embodiments, one or more detectably distinguishable
probe sets are configured to hybridize to a region of mycobacteria
nucleic acid to differentiate between NTM and MTBC. In some
embodiments, the one or more primer pairs are configured to amplify
a region of mycobacteria nucleic acid that varies between NTM and
MTBC. In some embodiments, the region of mycobacteria nucleic acid
comprises 16s rRNA. In some embodiments, the one or more detectably
distinguishable probe sets comprise SEQ ID NO:53 and SEQ ID NO:54
or have 70% or greater identity therewith (e.g., 75%, 80%, 85%,
90%, 95%). In some embodiments, the one or more primer pairs
comprise SEQ ID NO:51 and SEQ ID NO:52 or have 70% or greater
identity therewith (e.g., 75%, 80%, 85%, 90%, 95%).
[0010] In some embodiments, one or more detectably distinguishable
probe sets are configured to hybridize to a region of mycobacteria
nucleic acid to differentiate between different species of MTBC. In
some embodiments, the one or more primer pairs are configured to
amplify a region of mycobacteria nucleic acid that varies between
different species of MTBC. In some embodiments, the region of
mycobacteria nucleic acid comprises the gyrB gene. In some
embodiments, one or more detectably distinguishable probe sets
comprise SEQ ID NO:61 and SEQ ID NO:62 or have 70% or greater
identity therewith (e.g., 75%, 80%, 85%, 90%, 95%). In some
embodiments, the one or more detectably distinguishable probe sets
further comprise SEQ ID NO:59 or have 70% or greater identity
therewith (e.g., 75%, 80%, 85%, 90%, 95%). In some embodiments, the
one or more detectably distinguishable probe sets further comprise
SEQ ID NO:60 or have 70% or greater identity therewith (e.g., 75%,
80%, 85%, 90%, 95%). In some embodiments, the one or more primer
pairs comprise SEQ ID NO:57 and SEQ ID NO:58 or have 70% or greater
identity therewith (e.g., 75%, 80%, 85%, 90%, 95%).
[0011] In some embodiments, three or more detectably
distinguishable probe sets are configured to hybridize to a region
of mycobacteria nucleic acid to differentiate between
rifampin-resistant and rifampin-sensitive mycobacteria. In some
embodiments, one or more primer pairs are configured to amplify a
region of mycobacteria nucleic acid that varies between
rifampin-resistant and rifampin-sensitive mycobacteria. In some
embodiments, the region of mycobacteria nucleic acid comprises the
rpoB gene. In some embodiments, the three or more detectably
distinguishable probe sets comprise SEQ ID NO:30, SEQ ID NO:31, SEQ
ID NO:32, SEQ ID NO:33, SEQ ID NO:34, and SEQ ID NO:35 or have 70%
or greater identity therewith (e.g., 75%, 80%, 85%, 90%, 95%). In
some embodiments, the one or more primer pairs comprise SEQ ID
NO:28 and SEQ ID NO:29 or have 70% or greater identity therewith
(e.g., 75%, 80%, 85%, 90%, 95%).
[0012] In some embodiments, one or more detectably distinguishable
probe sets are configured to hybridize to a region of mycobacteria
nucleic acid to differentiate between ethambutol-resistant and
ethambutol-sensitive mycobacteria. In some embodiments, the one or
more primer pairs are configured to amplify a region of
mycobacteria nucleic acid that varies between ethambutol-resistant
and ethambutol-sensitive mycobacteria. In some embodiments, the
region of mycobacteria nucleic acid comprises the embB gene. In
some embodiments, the one or more detectably distinguishable probe
sets comprise SEQ ID NO:69 and SEQ ID NO:70 or have 70% or greater
identity therewith (e.g., 75%, 80%, 85%, 90%, 95%). In some
embodiments, the one or more primer pairs comprise SEQ ID NO:67 and
SEQ ID NO:68 or have 70% or greater identity therewith (e.g., 75%,
80%, 85%, 90%, 95%).
[0013] In some embodiments, one or more detectably distinguishable
probe sets are configured to hybridize to a region of mycobacteria
nucleic acid comprising the tlyA gene. In some embodiments, the one
or more primer pairs are configured to amplify a region of the
mycobacteria tlyA nucleic acid that varies between species of
mycobacteria. In some embodiments, the one or more primer pairs
comprise SEQ ID NO:71 and SEQ ID NO:72 or have 70% or greater
identity therewith (e.g., 75%, 80%, 85%, 90%, 95%).
[0014] In some embodiments, the one or more detectably
distinguishable probe sets are configured to hybridize to a region
of mycobacteria nucleic acid to differentiate between
isoniazid-resistant and isoniazid-sensitive mycobacteria. In some
embodiments, the one or more primer pairs are configured to amplify
a region of mycobacteria nucleic acid that varies between
isoniazid-resistant and isoniazid-sensitive mycobacteria. In some
embodiments, the region of mycobacteria nucleic acid comprises the
mabA promoter region. In some embodiments, the one or more
detectably distinguishable probe sets comprise SEQ ID NO:47 and SEQ
ID NO:48 or have 70% or greater identity therewith (e.g., 75%, 80%,
85%, 90%, 95%). In some embodiments, the one or more primer pairs
comprise SEQ ID NO:45 and SEQ ID NO:46 or have 70% or greater
identity therewith (e.g., 75%, 80%, 85%, 90%, 95%).
[0015] In some embodiments, one or more detectably distinguishable
probe sets are configured to hybridize to a region of mycobacteria
nucleic acid comprising the ahpC gene. In some embodiments, the one
or more primer pairs are configured to amplify a region of the
mycobacteria ahpC nucleic acid that varies between species of
mycobacteria. In some embodiments, the one or more primer pairs
comprise SEQ ID NO:73 and SEQ ID NO:74 or have 70% or greater
identity therewith (e.g., 75%, 80%, 85%, 90%, 95%).
[0016] In some embodiments, one or more detectably distinguishable
probe sets are configured to hybridize to a region of mycobacteria
nucleic acid comprising the katG gene. In some embodiments, the one
or more primer pairs are configured to amplify a region of the
mycobacteria katG nucleic acid that varies between species of
mycobacteria. In some embodiments, the one or more detectably
distinguishable probe sets comprise SEQ ID NO:41 and SEQ ID NO:42
or have 70% or greater identity therewith (e.g., 75%, 80%, 85%,
90%, 95%). In some embodiments, the one or more primer pairs
comprise SEQ ID NO:39 and SEQ ID NO:40 or have 70% or greater
identity therewith (e.g., 75%, 80%, 85%, 90%, 95%).
[0017] In some embodiments, one or more detectably distinguishable
probe sets are configured to hybridize to a region of mycobacteria
nucleic acid to differentiate between fluoroquinolone-resistant and
fluoroquinolone-sensitive mycobacteria. In some embodiments, the
one or more primer pairs are configured to amplify a region of
mycobacteria nucleic acid that varies between
fluoroquinolone-resistant and fluoroquinolone-sensitive
mycobacteria. In some embodiments, the region of mycobacteria
nucleic acid comprises the gyrA gene.
[0018] In some embodiments, identifying one or more mycobacterium
in a sample comprises: (a) differentiating between NTM and MTBC;
(b) differentiating between different species of MTBC; (c)
differentiating between isoniazid-resistant and isoniazid-sensitive
mycobacteria; (d) differentiating between fluoroquinolone-resistant
and fluoroquinolone-sensitive mycobacteria; (e) differentiating
between ethambutol-resistant and ethambutol-sensitive mycobacteria;
and/or (f) differentiating between rifampin-resistant and
rifampin-sensitive mycobacteria. In some embodiments, a multiplex
reaction is conducted (e.g., in a single closed tube or other
reaction vessel) using a plurality of primers and probes to achieve
any one or more or all of (a) through (f). In some such
embodiments, four or fewer (three, two, or one) optically
distinguishable labels are employed in the multiplex reaction. For
example, in some embodiments, each of (a) through (f) is achieved
using four or fewer "colors," such that an instrument configured to
detect up to four colors may be employed to collect and analyze the
data.
[0019] In some embodiments, the desired target to be detected
(e.g., a specific drug-resistant strain of mycobacterium) is
present in a sample comprising a substantial amount of nucleic acid
from non-target sources. Such non-target sources include, but are
not limited to, human genomic nucleic acid, nucleic acid from
non-mycobacterium pathogenic organisms, other mycobacterium, and
mycobacterium having a different drug-resistance profile. In some
embodiments the target is present at less than 20% of the total
nucleic acid in the sample (by copy number) (e.g., less than 10%,
less than 5%, less than 1%, less than 0.5%, or less than 0.1%).
[0020] In some embodiments, provided herein are reagent kits for
identifying one or more types of mycobacterium in a sample
comprising: (a) at least one pair of primers, wherein said primers
are configured bind to regions of mycobacteria nucleic acid
conserved between two or more types of mycobacteria, and wherein
primers are configured to amplify a variable region of mycobacteria
nucleic acid; and (b) at least one detectably distinguishable probe
set of two hybridization probes which hybridize to adjacent target
nucleic acid sequences within the variable region of mycobacteria
nucleic acid, comprising: (i) a quencher probe labeled with a
non-fluorescent quencher, and (ii) a signaling probe labeled with a
fluorescence-emitting dye and a non-fluorescent quencher, wherein
the signal probe does not emit fluorescence above background when
not hybridized to its target sequence, but emits a fluorescence
signal above background upon hybridization to its target sequence
in the absence of bound quencher probe, wherein, if both signaling
and quencher probes are hybridized to their adjacent target nucleic
acid sequences, the non-fluorescent quencher of the quencher probe
quenches the signal from the signaling probe. In some embodiments,
the melting temperature of the signaling probe in a probe set is
higher than the melting temperature of the associated quencher
probe. In some embodiments, the fluorescence-emitting dye and said
non-fluorescent quenchers of each probe set are capable of
interacting by FRET. In some embodiments, each probe set is
detectably distinguishable from all other probe sets in said
detection reagent kit by (1) melting temperature, (2) emission
wavelength of said fluorescence-emitting dye, or (3) a combination
thereof. In some embodiments, the detection reagents comprise 5 or
more probe sets. In some embodiments, the detection reagents
comprise 10 or more probe sets. In some embodiments, a probe set is
used to differentiate between myobacteria of different
pathogenicity, species, or antibiotic resistance. In some
embodiments, the primers are provided in the proper ration for
amplification by LATE-PCR. In some embodiments, probes in at least
one detectably distinguishable probe set have melting temperatures
with their target nucleic acid sequences below the annealing
temperature of at least one primer of the amplification reaction.
In some embodiments, reagent kits comprise one or more detectably
distinguishable probe sets are configured to hybridize to a region
of mycobacteria nucleic acid to differentiate between NTM and MTBC.
In some embodiments, reagent kits comprise one or more detectably
distinguishable probe sets configured to hybridize to a region of
mycobacteria nucleic acid to differentiate between different
species of MTBC. In some embodiments, reagent kits comprise three
or more detectably distinguishable probe sets configured to
hybridize to a region of mycobacteria nucleic acid to differentiate
between rifampin-resistant and rifampin-sensitive mycobacteria. In
some embodiments, reagent kits comprise one or more detectably
distinguishable probe sets configured to hybridize to a region of
mycobacteria nucleic acid to differentiate between
ethambutol-resistant and ethambutol-sensitive mycobacteria. In some
embodiments, reagent kits comprise one or more detectably
distinguishable probe sets configured to hybridize to a region of
mycobacteria nucleic acid to differentiate between
fluoroquinolone-resistant and fluoroquinolone-sensitive
mycobacteria. In some embodiments, reagent kits comprise primers
and probes configured for: differentiating between NTM and MTBC;
(b) differentiating between different species of MTBC; (c)
differentiating between isoniazid-resistant and isoniazid-sensitive
mycobacteria; (d) differentiating between fluoroquinolone-resistant
and fluoroquinolone-sensitive mycobacteria; (e) differentiating
between ethambutol-resistant and ethambutol-sensitive mycobacteria;
and/or (f) differentiating between rifampin-resistant and
rifampin-sensitive mycobacteria. In some embodiments, reagent kits
comprise one or more additional oligonucleotides. In some
embodiments, additional oligonucleotides are configured to suppress
mis-priming during amplification reactions. In some embodiments,
additional oligonucleotides are configured to disrupt structural
elements within target nucleic acid sequences during amplification
reactions or during probing of amplified sequences.
[0021] In some embodiments, reagent kits may comprise probe sets,
primers, amplification reagents (e.g., amplification buffer, DNA
polymerase, control reagents (e.g., positive and negative controls)
or any other components that are useful, necessary, or sufficient
for practicing any of the methods described herein, as well as
instructions, analysis software (e.g., that facilitates data
collection, analysis, display, and reporting), computing devices,
instruments, or other systems or components. In some embodiments,
provided herein is a homogeneous assay method for analyzing at
least one single-stranded nucleic acid mycobacteria target sequence
in a sample, comprising: (a) providing a sample comprising at least
one mycobacteria nucleic acid target sequence in single-stranded
form and for each nucleic acid target sequence at least one
detectably distinguishable set of two interacting hybridization
probes, each of which hybridizes to the at least one target,
comprising: (i) a quencher probe labeled with a non-fluorescent
quencher, and (ii) a signaling probe that upon hybridization to the
at least one target sequence in the sample in the absence of the
quencher probe emits a signal above background, wherein, if both
probes are hybridized to the at least one target sequence, the
non-fluorescent quencher of the quencher probe quenches the signal
from the signaling probe; and (b) analyzing hybridization of the
signaling and quenching probes to the at least one mycobacteria
target sequence as a function of temperature, the analysis
including an effect on each signaling probe due to its associated
quencher probe, including but not limited to analyzing signal
increase, signal decrease, or both, from each signaling probe.
[0022] In some embodiments, signaling probes comprise quenched
fluorophores. In some embodiments, the melting temperature of the
signaling probe in a probe set is higher than the melting
temperature of an associated quenching probe.
[0023] In some embodiments, methods provided herein are performed
in a single reaction vessel. In some embodiments, methods provided
herein are performed in single-vessel (e.g., tube, well, etc.)
screening assays to identify which mycobacteria nucleic acid target
sequence or sequences from a group of multiple possible target
sequences is or are present in a sample. In some embodiments, the
group of multiple target sequences comprises a variable sequence
flanked by conserved, or at least relatively conserved sequences.
In some embodiments, a sample of target sequence in single-stranded
form is generated by an amplification method that generates
single-stranded amplicons, for example, a non-symmetric polymerase
chain reaction (PCR) method, most preferably LATE-PCR. In some
embodiments, only a few pairs of primers are used, generally not
more than three pairs, preferably not more than two pairs and more
preferably only a single pair of primers that hybridize to the
flanking sequences. In some embodiments, the primers and at least
one set of signaling and quencher probes (e.g., two sets, three
sets, etc.) are included in the amplification reaction mixture.
[0024] In some embodiments, probe sets (e.g., signaling and
quencher probes) are configured to hybridize to mycobacteria
variable sequence and to differentiate between multiple
mycobacteria target sequences (e.g., in a single sample or
mixture). In some embodiments, probes hybridize with different Tm
to the variable sequences of the different target sequences. In
some embodiment, one or both probes of a probe set (e.g., signaling
and/or quencher probes) comprise different degrees of
complementarity to the variable regions of the different target
sequences. In some embodiments, a signaling probe and/or quencher
probe is configured to hybridize to the variable sequence (e.g.,
overlapping the actual sequence difference) of multiple target
sequences (e.g., with different Tm to the different target
sequences). In some embodiments, a signaling probe is configured to
hybridize to the variable sequence of multiple target sequences
(e.g., with different Tm to the different target sequences). In
some embodiments, a quencher probe is configured to hybridize to
the variable sequence of multiple target sequences (e.g., with
different Tm to the different target sequences).
[0025] In some embodiments, primers and probes are provided for use
in the methods provided herein. In some embodiments, primers
provided herein include: SEQ ID NOs: 28, 29, 39, 40, 45, 51, 52,
57, 58, 67, 71, 72, 73, 74, portions thereof and sequences
complementary thereto. In some embodiments, primers provided herein
include oligonucleotides with 70% or greater sequence identity with
SEQ ID NOs: 28, 29, 39, 40, 45, 46, 51, 52, 57, 58, 67, 68, 71, 72,
73, or 74 (e.g., an oligonucleotide with 70% . . . 75% . . . 80% .
. . 90% . . . 95% . . . 98% . . . 99% sequence identity), portions
thereof, and sequences complementary thereto. In some embodiments,
the present invention provides primers that function substantially
similarly to primers provided herein. In some embodiments, probes
provided herein include: SEQ ID NOs: 30, 31, 32, 33, 34, 35, 41,
42, 47, 48, 53, 54, 59, 60, 61, 62, 69, 70, portions thereof, and
sequences complementary thereto. In some embodiments, probes
provided herein include oligonucleotides with 70% or greater
sequence identity with SEQ ID NOs: 30, 31, 32, 33, 34, 35, 41, 42,
47, 48, 53, 54, 59, 60, 61, 62, 69, 70, portions thereof, and
sequences complementary thereto. In some embodiments, the present
invention provides probes that function substantially similarly to
probes provided herein. In some embodiments, target sequences for
primers and probes provided herein comprise: SEQ ID NOs:36, 37, 38,
43, 44, 49, 50, 55, 56, 63, 64, 75, 76, 77, 78, 79, 80, 81, 82, 83,
84, portions thereof, and sequences complementary thereto. In some
embodiments, target sequences comprise sequences 70% or greater
sequence identity with SEQ ID NOs:36, 37, 38, 43, 44, 49, 50, 55,
56, 63, 64, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, portions
thereof, and sequences complementary thereto. In some embodiments,
target sequences comprise regions of mycobacteria nucleic acid
comprising conserved regions flanking a variable region in the
genes or promoters of: rpoB, embB, mabA, ahpC, katG, gyrA, 16s
rRNA, and gyrB. In some embodiments, primers and probes hybridize
to targets in mycobacteria including, but not limited to: M.
tuberculosis, M. africanum, M. intracellulare, M. microti, M.
bovis, M. chelonae, M. asiaticum, M. avium, M. fortuitum. In some
embodiments, compostions, methods, and kits provided herein find
use in identification, and differentiation of species including: M
tuberculosis, M africanum, M. intracellulare, M. microti, M. bovis,
M. chelonae, M. asiaticum, M. avium, M. fortuitum.
[0026] In some embodiments, probing and analysis methods provided
herein apply to samples containing single-stranded mycobacteria
nucleic acid target sequences. Methods include analysis of a single
sequence, analysis of two or more sequences in the same strand,
analysis of sequences in different strands, and to combinations of
the foregoing. A single-stranded nucleic acid target sequence may
be a control sequence added to a sample. A nucleic acid target
sequence may be DNA, RNA or a mixture of DNA and RNA. It may come
from any source. For example, it may occur naturally, or the target
sequence may occur in double-stranded form, in which case the
single-stranded target sequence is obtained by strand separation
and purification. If the single-stranded nucleic acid target
sequence is a cDNA sequence, it is obtained from an RNA source by
reverse transcription.
[0027] In many instances a natural source will not contain a target
sequence in sufficient copy number for probing and analysis. In
such instances the single-stranded target sequence is obtained by
amplification, generally an amplification method that includes
exponential amplification. In some embodiments an amplification
reaction generates the single-stranded nucleic acid target sequence
directly. In some embodiments an amplification reaction generates
the target sequence in double-stranded form, in which event the
single-stranded target sequence is obtained by strand separation
and purification. Useful amplification methods that may be employed
include, the polymerase chain reaction (PCR), including symmetric
PCR, asymmetric PCR and LATE-PCR, any of which can be combined with
reverse transcription for amplifying RNA sequences, NASBA, SDA,
TMA, and rolling circle amplification. If the single-stranded
nucleic acid target sequence is a cDNA sequence, the amplification
method will include reverse transcription, for example, RT-PCR. In
some embodiments, when non-symmetric amplification is utilized
(e.g., LATE-PCR), probe sets are included in the amplification
reaction mixture prior to amplification to avoid contamination.
[0028] In some embodiments, probe sets useful in methods provided
herein include a signaling probe and an associated quencher probe.
The signaling probe is a hybridization probe that emits a
detectable signal, preferably a fluorescent signal, when it
hybridizes to a single-stranded nucleic acid target sequence in a
sample, wherein the signal is quenchable by the associated quencher
probe. The quencher probe does not emit visible light energy.
Generally, a signaling probe has a covalently bound fluorescent
moiety. Signaling probes include probes labeled with fluorophores
or other fluorescent moieties, for example, quantum dots. In some
embodiments, fluorophore-labeled probes are preferred. One type of
signaling probe is a ResonSense.RTM. probe. A ResonSense.RTM. probe
is a single-stranded oligonucleotide labeled with a fluorophore
that accepts fluorescence from a DNA dye and reemits visible light
at a longer wavelength. Use of a ResonSense.RTM. probe involves use
of a double-stranded DNA dye, a molecule that becomes fluorescent
when it associates with double-stranded DNA, which in this case is
the hybrid formed when the probe hybridizes to the single-stranded
nucleic acid target sequence. For use of a ResonSense.RTM. probe, a
DNA dye, for example, SYBR Green or SYBR Gold, is included in the
sample containing the single-stranded nucleic acid target sequence
along with the probe set or sets. Analysis includes exciting the
dye and detection emission from the ResonSense.RTM. probe or
probes. Unbound signaling probes need not be removed, because they
are not directly excited and remain single-stranded. In some
embodiments, preferred signaling probes are quenched probes; that
is, probes that emit little or no signal when in solution, even if
stimulated, but are unquenched and so emit a signal when they
hybridize to a single-stranded nucleic acid sequence in a sample
being analyzed. Yin-yang probes are quenched signaling probes. A
yin-yang probe is a double-stranded probe containing a fluorophore
on one strand and an interacting non-fluorescent quencher on the
other strand, which is a shorter strand. When a yin-yang probe is
in solution at the detection temperature, the fluorophore is
quenched. The single-stranded nucleic acid target sequence
out-competes the quencher-labeled strand for binding to the
fluorophore-labeled strand.
[0029] Consequently, the fluorophore-labeled strand hybridizes to
the single-stranded nucleic acid target sequence and signals.
Signaling probes for some embodiments provided herein are molecular
beacon probes, single-stranded hairpin-forming oligonucleotides
bearing a fluorescer, typically a fluorophore, on one end, and a
quencher, typically a non-fluorescent chromophore, on the other
end. In some embodiments, provided herein are single stranded
oligonucleotides with any suitable type of secondary structure,
bearing a fluorescence-emitting dye on one end and a quencher on
the other end (molecular-beacon-type probes). Various signaling
probes for use in embodiments herein comprise varying degrees of
secondary structure (e.g., different lengths of hairpin (e.g., 2
base pairs, 3, base pairs, 4 base pairs, 5 base pairs, etc.). When
molecular beacon probes, and other similar types of probes, are in
solution, they assume a conformation wherein the quencher interacts
with the fluorescer, and the probe is dark (e.g., hairpin
conformation, closed conformation). When the probe hybridizes to
its target, however, it is forced into an open conformation in
which the fluorescer is separated from the quencher, and the probe
signals.
[0030] In quenched signaling probes, quenching may be achieved by
any mechanism, typically by FRET (Fluorescence Resonance Energy
Transfer) between a fluorophore and a non-fluorescent quenching
moiety or by contact quenching. In some embodiments, preferred
signaling probes are dark or very nearly dark in solution to
minimize background fluorescence. Contact quenching more generally
achieves this objective, although FRET quenching is adequate with
some fluorophore-quencher combinations and probe constructions.
[0031] The quencher probe of a probe set comprises of consists of a
nucleic acid strand comprising a non-fluorescent quencher. In some
embodiments, the quencher is, for example, a non-fluorescent
chromophore such a dabcyl or a Black Hole Quencher (Black Hole
Quenchers, available from Biosearch Technologies, are a suite of
quenchers, one or another of which is recommended by the
manufacturer for use with a particular fluorophore). In some
embodiments, preferred quenching probes include a non-fluorescent
chromophore. In some embodiments, quenchers are Black Hole
Quenchers. The quencher probe of a set hybridizes to the
single-stranded nucleic acid target sequence adjacent to or near
the signaling probe such that when both are hybridized, the
quencher probe quenches, or renders dark, the signaling probe.
Quenching may be by fluorescence resonance energy transfer (FRET)
or by touching ("collisional quenching" or "contact
quenching").
[0032] FIG. 1 depicts an embodiment that illustrates the
functioning of probe sets in analytical methods provided herein. In
this embodiment there are two probe sets, probes 2, 4 and probes 6,
8. Probe 2 is a signaling probe, a molecular-beacon-type probe
bearing fluorophore 3. Probe 6 is also a signaling probe, a
molecular-beacon-type probe bearing fluorophore 7. Fluorophores 3,
7 are the same. Probes 4, 8 are quencher probes labeled only with
Black Hole Quenchers 5 and 9, respectively. The melting
temperatures (Tm's) of the probe-target hybrids (probes hybridized
to single-stranded nucleic acid target sequence 1) are as follows:
Tm probe 2>Tm probe 4>Tm probe 6>Tm probe 8. As the
temperature of the sample is lowered from a high temperature at
which no probes are bound, probes 2, 4, 6 and 8 bind to
single-stranded nucleic acid target sequence 1 according to their
hybridization characteristics. Probe 2, a signaling probe, binds
first. FIG. 1, Panel A depicts probe 2 hybridized to sequence 1. As
the temperature of the sample continues to be lowered, quencher
probe 4 binds next, adjacent to probe 2 such that quencher 5 and
fluorophore 3 are near to one another or touching. FIG. 1, Panel B
depicts probe 4 hybridized to single-stranded nucleic acid sequence
1 adjacent to probe 2. At this point probe 2 is dark, or at least
nearly dark. If, however, signaling probe 6 has begun to bind, it
will emit fluorescence independently of probes 2, 4. FIG. 1, Panel
C depicts probe 6 hybridized to single-stranded target sequence 1
adjacent to probe 4. Finally as the temperature continues to be
lowered, probe 8 will bind, and its quencher 9 will quench
fluorescence emission from fluorophore 7 of probe 6. FIG. 1, Panel
D depicts probe 8 hybridized adjacent to probe 6. Analysis by
hybridization is shown in FIG. 1, Panel E, which depicts the
increase and decrease of fluorescence from fluorophores 3, 7 as a
function of temperature. Such curves can be obtained as annealing
(hybridization) curves as the temperature is lowered, or can be
obtained as melting curves as the temperature is increased. As the
sample temperature is lowered from 70.degree. C., fluorescence
curve 10 in Panel E first rises as probe 2 hybridizes to
single-stranded nucleic acid sequence 1, then decreases as probe 4
binds, then increases again as probe 6 hybridizes, and finally
decreases to a very low level as probe 8 hybridizes. One can deduce
from curve 10 that each signaling probe has a higher Tm than its
associated quencher probe.
[0033] Signaling and quenching probes useful in methods provided
herein are typically mismatch tolerant (capable of hybridizing to
single-stranded nucleic acid target sequences containing one or
more mismatched nucleotides, or deletions or additions). In some
embodiments, mycobacteria are differentiated by the unique
temperature-dependent fluorescence signatures generated by
mismatches between probes and target sequences. In some
embodiments, probes may be allele-specific (capable of hybridizing
only to a perfectly complementary single-stranded nucleic acid
target sequence in the method). In some embodiments, one probe of a
set may be allele-specific; and the other probe, mismatch tolerant.
Experiments conducted during development of embodiments provided
herein demonstrated that secondary structure of a target strand
outside the sequences to which probes hybridize can affect the
results of annealing or melting analysis. Accordingly, in some
embodiments, not every nucleotide in a nucleic acid target sequence
needs to be hybridized to a probe. For example, if the target
sequence contains a hairpin, the corresponding probe can be
designed in some cases to hybridize across the base of the hairpin,
excluding the hairpin sequence. In preferred embodiments, both the
signaling and quencher probes of a probe set are mismatch tolerant.
In some embodiments, a probe set may include an allele-specific
signaling probe and an allele-specific quencher probe, a
mismatch-tolerant signaling probe and a mismatch-tolerant quencher
probe, an allele-specific signaling probe and a mismatch-tolerant
quencher probe, or a mismatch-tolerant signaling probe and an
allele-specific quencher probe. A mismatch-tolerant probe may be
perfectly complementary to one variant of a variable target
sequence, or it may be a consensus probe that is not perfectly
complementary to any variant. Multiple probe sets may include
combinations of sets of any of the foregoing types. Additionally,
analytical methods provided herein may utilize one or more
signaling/quenching probe sets in combination with one or more
conventional probes that signal upon hybridization to their target,
for example, molecular beacon probes.
[0034] In some embodiments, unlabeled oligonucleotides configured
to bind to regions at or near the target sequences for primers,
signaling probes, or quencher probes. In some embodiments, these
silent probes disrupt secondary structure within or near the target
sequences and assist other probes in binding to target sequences at
suitable Tm for subsequent analysis. In some embodiments, unlabeled
oligonucleotides which serve as "openers" of structural elements
(e.g., secondary structural elements) are provided.
[0035] Probes useful in the methods provided herein may be DNA,
RNA, or a combination of DNA and RNA. They may include non-natural
nucleotides, for example, PNA, LNA, or 2' o-methyl ribonucleotides.
They may include non-natural internucleotide linkages, for example,
phosphorothioate linkages. The length of a particular probe depends
upon its desired melting temperature (Tm), whether it is to be
allele-specific or mismatch tolerant, and its composition, for
example, the GC content of a DNA probe.
[0036] In some embodiments, each signaling probe has a separate
quenching probe associated with it. In some embodiments, however
one probe may be a part of two probe sets. For example, a quencher
probe may be labeled with a quencher at each end, whereby the ends
interact with different signaling probes, in which case three
probes comprise two probe sets. Also, some embodiments may utilize
both ends of a quenched signaling probe, for example, a molecular
beacon signaling probe having a fluorophore on one end and a
quencher on the other end. The fluorophore interacts with a
quencher probe, comprising one set, and the quencher interacts with
a signaling probe, comprising another set.
[0037] For analysis of a sample containing one or more types of
mycobacteria or suspected of containing one or more types of
mycobacteria, the probe sets that are used are detectably
distinguishable, for example by emission wavelength (color) or
melting temperature (Tm). Making a probe set distinguishable by Tm
from other probe sets is accomplished in any suitable way. For
example, in some embodiments, all signaling probes in an assay have
different Tm's. Alternatively, in some embodiments, all signaling
probes have the same Tm, but the quencher probes have different
Tm's. In some embodiments, probe sets are distinguishable by a
combination of the signaling probe Tm and quenching probe Tm.
Fluorescence detectors can commonly resolve 1-10 differently
colored fluorophores. Therefore assays utilizing method provided
herein can make use of up to 10 fluorophores (e.g., 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, or more if fluorescence detectors allow). The same
fluorescence emitter, for example, the same fluorophore, can be
used on more than one signaling probe for a sample, if the
signaling probe's can be differentiated for detection by their
melting temperatures. In assays provided herein, Tm's should be
separated by at least 2.degree. C., preferably by at least
5.degree. C. and, in certain embodiments by at least 10.degree. C.
Available temperature space constrains the use of multiple
signaling probes having the same fluorophore. If an assay is
designed for annealing and/or melt analysis over a range of
80.degree. C. to 20.degree. C., for example, one can utilize more
probe sets sharing a color than one can use in an assay designed
for such analysis over a range of 70.degree. C. to 40.degree. C.,
for which one may be able to use only 3-5 probe sets sharing a
color. Using four colors and only two probe sets sharing each
color, a four-color detector becomes equivalent to an eight-color
detector used with eight probes distinguishable by color only. Use
of three probe sets sharing each of four colors, twelve different
probes sets become distinguishable.
[0038] In some embodiments, it is preferred that quencher probes
have lower Tm's than their associated signaling probes. With that
relationship, the signaling probe emits a temperature-dependent
signal through the annealing temperature range of both probes of
the set as the temperature of the solution is lowered for an
annealing curve analysis, and through the melting temperature range
of both probes of the set as the temperature of the solution is
raised for a melting curve analysis. If, on the other hand, the
quencher probe of a probe set has a higher Tm than its associated
signaling probe, the signaling probe's emission is quenched through
the annealing temperature range and melting temperature range of
both probes of the set, and no fluorescent signal is emitted for
detection. This can be ascertained by examination of the annealing
curve or the melting curve. The lack of signal provides less
information about the single-stranded nucleic acid target sequence
than does a curve of the probe's fluorescence as a function of
temperature. In some embodiments, when mismatch-tolerant probes are
used for analysis of a variable sequence, quencher probes with
lower Tm's than their associated signaling probes are used with
respect to all or all but one of the target sequence variants. If a
quencher probe has a higher Tm against only one variant, signal
failure will reveal that variant, as long as failure of the sample
to include the single-stranded nucleic acid target sequence
(particularly failure of an amplification reaction) is otherwise
accounted for by a control or by another probe set for the
single-stranded nucleic acid target sequence. Similarly, if not all
variants are known, such signal failure will reveal the presence of
an unknown variant. In some embodiments, it is preferred that in an
assay utilizing multiple probe sets for at least one nucleic acid
target sequence, the quencher probe of at least one probe set has a
lower Tm than its associated signaling probe.
[0039] Melting temperature, Tm, means the temperature at which a
nucleic acid hybrid, for example, a probe-target hybrid or
primer-target hybrid, is 50% double-stranded and 50%
single-stranded. For a particular assay the relevant Tm's may be
measured. Tm's may also be calculated utilizing known techniques.
In some embodiments, preferred techniques are based on the "nearest
neighbor" method (Santa Lucia, J. (1998), PNAS (USA) 95: 1460-1465;
and Allawi, H. T. and Santa Lucia, J. (1997), Biochem. 36:
10581-10594; herein incorporated by reference in their entireties).
Computer programs utilizing the "nearest neighbor" formula are
available for use in calculating probe and primer Tm's against
perfectly complementary target sequences and against mismatched
target sequences. In this application the Tm of a primer or probe
is sometimes given with respect to an identified sequence to which
it hybridizes. However, if such a sequence is not given, for
mismatch-tolerant probes that are perfectly complementary to one
variant of a single-stranded nucleic acid target sequence, the Tm
is the Tm against the perfectly complementary variant. In many
embodiments there will be a target sequence that is perfectly
complementary to the probe. However, methods may utilize one or
more mismatch-tolerant primer or probes that are "consensus
primers" or "consensus probes." A consensus primer or probe is a
primer or probe that is not complementary to any variant target
sequence or, if not all possible target sequences are, to any
expected or known sequence. A consensus primer is useful to prime
multiple variants of a target sequence at a chosen amplification
annealing temperature. A consensus probe is useful to shrink the
temperature space needed for analysis of multiple variants. For a
consensus primer or probe, if no corresponding target sequence is
given, the Tm refers to the highest Tm against known variants,
which allows for the possibility that an unknown variant may be
more complementary to the primer or probe and, thus, have higher
primer-target Tm or probe-target Tm.
[0040] Assays provided herein may utilize probe concentrations that
are greater than or less than target nucleic acid concentration.
The probe concentrations are known on the basis of information
provided by the probe manufacturer. In the case of target sequences
that are not amplified, target concentrations are known on the
basis of direct or indirect counting of the number of cells,
nuclei, chromosomes, or molecules are known to be present in the
sample, as well as by knowing the expected number of targets
sequences usually present per cell, nucleus, chromosome, or
molecule. In the case of target sequences that are amplified, there
are a number of ways to establish how many copies of a target
sequence have been generated over the course of an amplification
reaction. For example, in the case of a LATE-PCR amplification
reaction the number of single-stranded amplicons can be calculated
as follows: using a signaling probe without a quencher (in the case
of quenched signaling probe that means the probe minus the
quencher) in a limiting concentration such as 50 nM and its
corresponding quencher probe in excess amount such as 150 nM, the
number of cycles it takes to decrease the fluorescence to zero (or,
in practical terms, to its minimal background level) is
proportional to the rate of amplification of single-stranded
amplicons. When fluorescence reaches zero (minimal background
level), all of the signaling probes have found their target, and
the concentration of the amplicons exceeds that of the signaling
probe. In certain embodiments an amplification reaction may be
continued until the amplicon being produced reaches a "terminal
concentration." Experiments conducted during development of
embodiments provided herein demonstrated that a LATE-PCR
amplification begun with differing amounts of target tends to
produce eventually the same maximum concentration of amplicon (the
"terminal concentration"), even though amplification begun with a
high starting amount of target reaches that maximum in fewer cycles
than does the amplification begun with a low starting amount of
target. To achieve the terminal concentration beginning with a low
amount of target may require extending the amplification through 70
or even 80 cycles.
[0041] Some embodiments utilize probe sets in which the
concentration of the signaling probe is lower than the
concentration of its associated quencher probe. This ensures that,
when both probes are hybridized to their at least one nuclei acid
target sequence, the signaling probe is quenched to the greatest
possible degree, thereby minimizing background fluorescence. It
will be appreciated that background fluorescence in an assay is the
cumulated background of each signaling probe of a given color and
that probes of a different color may contribute further to
background signal.
[0042] Methods provided herein include analyzing the hybridization
of probe sets to single-stranded mycobacteria nucleic acid target
sequences. In methods provided herein, hybridization of signaling
probes and quencher probes as a function of temperature are
analyzed for the purpose of identifying, characterizing or
otherwise analyzing at least one mycobacteria nucleic acid target
sequence in a sample. In some embodiments analysis includes
obtaining a curve or, if multiple colors are used, curves of
signals from signaling probes as the temperature of a sample is
lowered (see FIG. 1, Panel E) or obtaining a curve or curves of
signals as the sample temperature is raised, or both. It is known
that the shapes of the two types of curves are not necessarily
identical due to secondary structures. Either or both of those
curves can be compared to a previously established curve for a
known single-stranded nucleic acid target sequence as part of the
analysis, for example, identifying the single-stranded nucleic acid
target sequence being probed. Derivative curves can also be
utilized to obtain, for example, the Tm of a signaling probe
against a nucleic acid target sequence. It is not always necessary,
and it may not be desirable, to utilize entire fluorescence curves
or their derivatives. In certain embodiments analysis of the
hybridization of signaling probes and quencher probes includes
obtaining fluorescence readings at one or several temperatures as
the sample temperature is lowered or raised, where those readings
reflect an effect on each signaling probe due to its associated
quencher probe. For example, if it is desired to distinguish among
known variants of a target sequence, and one learns from
hybridization curves of variants that fluorescence at two
temperatures distinguishes the variants, one need acquire
fluorescence at only those two temperatures for either direct
comparison or for calculation of ratios that can be compared. In
most embodiments the analysis will include signal increase, signal
decrease, or both, from each signaling probe.
[0043] In some embodiments, fluorescence readings using a
particular probe set over a range of temperatures generates a
temperature-dependent fluorescence signature. A
temperature-dependent fluorescence signature may comprise curves,
data points, peaks, or other means of displaying and/or analyzing
an assay or sample. In some embodiments, analysis of
temperature-dependent fluorescence signatures identifies and/or
differentiates mycobacteria. In some embodiments, analysis is
performed by a user. In some embodiments, analysis is performed by
analysis software on a computer or other device.
[0044] In some embodiments, methods provided herein include nucleic
acid amplification. Some preferred methods are those which generate
the target sequence or sequences in single-stranded form. LATE-PCR
amplification of DNA sequences or RNA sequences (RT-LATE-PCR) is
especially preferred in some embodiments. LATE-PCR amplifications
and amplification assays are described in, for example, European
patent EP 1,468,114 and corresponding U.S. Pat. No. 7,198,897;
published European patent application EP 1805199 A2; Sanchez et al.
(2004) Proc. Nat. Acad. Sci. (USA) 101: 1933-1938; and Pierce et
al. (2005) Proc. Natl. Acad. Sci. (USA) 102: 8609-8614. All of
these references are hereby incorporated by reference in their
entireties. LATE-PCR is a non-symmetric DNA amplification method
employing the polymerase chain reaction (PCR) process utilizing one
oligonucleotide primer (the "Excess Primer") in at least five-fold
excess with respect to the other primer (the "Limiting Primer"),
which itself is utilized at low concentration, up to 200 nM, so as
to be exhausted in roughly sufficient PCR cycles to produce
fluorescently detectable double-stranded amplicon. After the
Limiting Primer is exhausted, amplification continues for a desired
number of cycles to produce single-stranded product using only the
Excess Primer, referred to herein as the Excess Primer strand.
LATE-PCR takes into account the concentration-adjusted melting
temperature of the Limiting Primer at the start of amplification,
Tm.sub.[o].sup.L, the concentration-adjusted melting temperature of
the Excess Primer at the start of amplification, Tm.sub.[o]x, and
the melting temperature of the single-stranded amplification
product ("amplicon"), TmA. For LATE-PCR primers, Tm.sub.[o].sup.L
can be determined empirically, as is necessary when non-natural
nucleotides are used, or calculated according to the "nearest
neighbor" method (Santa Lucia, J. (1998), PNAS (USA) 95: 1460-1465;
and Allawi, H. T. and Santa Lucia, J. (1997), Biochem. 36:
10581-10594) using a salt concentration adjustment, which in our
amplifications is generally 0.07 M monovalent cation concentration.
For LATE-PCR the melting temperature of the amplicon is calculated
utilizing the formula: Tm=81.5+0.41 (% G+% C)-500/L+16.6 log
[M]/(1+0.7 [M]), where L is the length in nucleotides and [M] is
the molar concentration of monovalent cations. Melting temperatures
of linear, or random-coil, probes can be calculated as for primers.
Melting temperatures of structured probes, for example molecular
beacon probes, can be determined empirically or can be approximated
as the Tm of the portion (the loop or the loop plus a portion of
the stem) that hybridizes to the amplicon. In a LATE-PCR
amplification reaction Tm.sub.[o].sup.L is preferably not more than
5.degree. C. below Tm.sub.[o]x, more preferably at least as high
and even more preferably 3-10.degree. C. higher, and Tm.sub.A is
preferably not more than 25.degree. C. higher than Tm.sub.[o]x, and
for some preferred embodiments preferably not more than about
18.degree. C. higher.
[0045] LATE-PCR is a non-symmetric PCR amplification that, among
other advantages, provides a large "temperature space" in which
actions may be taken. See WO 03/054233 and Sanchez et al. (2004),
cited above. Certain embodiments of LATE-PCR amplifications include
the use of hybridization probes, in this case sets of signaling and
quencher probes, whose Tm's are below, more preferably at least
5.degree. C. below, the mean primer annealing temperature during
exponential amplification after the first few cycles. Sets of
signaling and quencher probes are included in LATE-PCR
amplification mixtures prior to the start of amplification. A DNA
dye, if used, can also be incorporated into the reaction mixture
prior to the start of amplification.
[0046] In some embodiments, samples which find use in the present
invention include clinical samples, diagnostic samples, research
samples, environmental samples, etc. are provided. In some
embodiments, samples require processing by one or more techniques
understood in the art prior to use in methods described herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0047] FIG. 1, Panels A-D are schematics showing hybridization of
two sets of signaling and quencher probes to a single-stranded
nucleic acid target sequence in a sample as a function of
temperature; and FIG. 1, Panel E, shows the fluorescence versus
temperature of the sample.
[0048] FIG. 2 illustrates possible neutral mutations which may
exist in the rpoB gene target. Figure discloses SEQ ID NOS 96 and
85 and bases 22-90 of SEQ ID NOS 96 and 85, respectively, in order
of appearance.
[0049] FIG. 3 illustrates drug resistance mutations in the rpoB
gene target. FIG. 3 discloses the first full-length oligonucleotide
as SEQ ID NO: 86, the corresponding coded protein described beneath
as SEQ ID NO: 87, the second full length oligonucleotide as SEQ ID
NO: 88 and the corresponding coded protein described beneath as SEQ
ID NO: 89.
[0050] FIG. 4 illustrates the phylogenetic relationship of some NTM
species and the MTBC species.
[0051] FIG. 5 illustrates endpoint target detection using four, or
optionally five, dyes at a range of temperatures.
[0052] FIG. 6 has two panels. Panel A illustrates the location of
the probe sets utilized for the rpoB gene target described in Table
1. Panel B illustrates the location of an alternate group of probe
sets in which most mutations within the rpoB gene target fall
beneath the quencher probes.
[0053] FIG. 7, Panels A and B illustrate the fluorescent signatures
of the rpoB gene target for probe sets 5A and 5B, respectively FIG.
8 illustrates that detection of amplification of 1000, 100, or 10
molecules of the rpoB target in the presence of 10,000 human
genomes.
[0054] FIG. 9 is a schematic representation of a single-stranded
nucleic acid sequence (SEQ ID NO: 38) from Example 1 showing probe
binding locations and primer binding locations. FIG. 9 discloses
Probe 1 as SEQ ID NO: 6, Probe 2 as SEQ ID NO: 7, Probe 3 as SEQ ID
NO: 8, Probe 4 as SEQ ID NO: 9, Probe 5 as SEQ ID NO: 10, Probe 6
as SEQ ID NO: 11, the underlined portion of the full-length
sequence SEQ ID NO: 38 as SEQ ID NO: 2 and the sequence aligned
with the last portion of the full-length sequence SEQ ID NO: 38 as
SEQ ID NO: 28.
[0055] FIG. 10, Panels A and 10B present melt-curve analyses from
amplifications described in Example 1 for several strains.
[0056] FIG. 11, Panels A-D present derivative melting curves for
mixtures of TB strains in various proportions as described in
Example 2.
[0057] FIG. 12 is a schematic representation of a single-stranded
nucleic acid sequence (SEQ ID NO: 14) from Example 3 showing probe
binding locations and primer binding locations. FIG. 12 discloses
Probe 1 as SEQ ID NO: 16, Probe 2 as SEQ ID NO: 17, Probe 3 as SEQ
ID NO: 18, Probe 4 as SEQ ID NO: 19, the underlined portion of the
full-length sequence SEQ ID NO: 14 as SEQ ID NO: 13 and the
sequence aligned with the last portion of the full-length sequence
SEQ ID NO: 14 as SEQ ID NO: 12.
[0058] FIG. 13 is a schematic representation of another
single-stranded nucleic acid sequence (SEQ ID NO: 22) from Example
3 showing probe binding locations and primer binding locations.
FIG. 13 discloses Probe 1 as SEQ ID NO: 25, Probe 2 as SEQ ID NO:
26, the underlined portion of the full-length sequence SEQ ID NO:
22 as SEQ ID NO: 95 and the sequence aligned with the last portion
of the full-length sequence SEQ ID NO: 22 as SEQ ID NO: 20.
[0059] FIG. 14, Panels A-C are graphs of fluorescence versus
temperature for each of the fluorophores in the sample of Example
3.
[0060] FIG. 15 shows exemplary sequence alignments used in primer,
probe, and target sequence design. FIG. 15 discloses the 16s MTC
sequence as SEQ ID NO: 55, 16s M. intra sequence as SEQ ID NO: 56,
rpoB Mtb sequence as SEQ ID NO: 90, rpoB Mavium sequence as SEQ ID
NO: 91, katG Mtb sequence as SEQ ID NO: 92, katG Mavium sequence as
SEQ ID NO: 93, gyrB Mtb sequence as SEQ ID NO: 63 and gyrB Mintra
sequence as SEQ ID NO: 94.
[0061] FIG. 16, Panels A-D show graphs demonstrating species
differentiation and detection of drug resistance among members of
the genus Myobacterium.
[0062] FIG. 17, Panels A-D show graphs demonstrating multi-drug
resistance and species identification of M. tuberculosis in a mixed
sample with non-Mycobacterium.
[0063] FIG. 18 has three panels showing average melt derivatives.
Panel A-shows gyrase B probes set with members of the Mycobacterium
tuberculosis complex (MTBC), Panel B shows 16s probes in which MTBC
and NTM species, Panel C-shows gyrase B and 16s probes.
DETAILED DESCRIPTION
[0064] Provided herein are compositions (e.g., reagents, reactions
mixtures, etc.), methods (e.g., research, screening, diagnostic),
and systems (e.g., kits, data collection and analysis) for analysis
of mycobacteria. In particular, provided herein are compositions,
methods, and systems that permit sensitive and specific detection
of one or more desired mycobacterium nucleic acid molecules in
simple and complex samples, including samples containing multiple
different species of mycobacterium of mixed drug resistance
profiles. In some embodiments, multiplex, single-tube reactions are
provided that can simultaneously identify and distinguish multiple
different mycobacterium species and drug resistance profiles in
complex samples using fast and efficient assays and detection
equipment.
[0065] For example, provided herein is a set of single-tube
homogeneous multiplexed assays for detection and analysis of
various species of mycobacteria, including various strains of M
tuberculosis, as well as whether such species and strains are
sensitive or resistant to a variety of antibiotics. In some
embodiments, assays provided herein utilize LATE-PCR (U.S. Pat. No.
7,198,897; incorporated herein by reference in its entirety),
PRIMESAFE II (PRIMESAFE is a trademark of Smiths Detection
Inc.)(U.S. Patent Application No. 20080193934; incorporated herein
by reference in its entirety), and Lights-On/Lights-Off probe sets
(International Publication No. WO/2011/050173; incorporated herein
by reference in its entirety).
[0066] The methods, compositions, and kits provided herein provide
diagnostically relevant information as well as a basis for
treatment of patients who exhibit pulmonary infections that may due
to mycobacterial infections. In some embodiments, assays provided
herein determine whether a sample contains mycobacterium. In some
embodiments, assays provided herein determine whether a pulmonary
infection contains mycobacterium. In some embodiments, assays
provided herein determine whether a mycobacterium in a sample or
infection is a member of the Mycobacterium Tuberculosis Complex
(MTBC) or is a non-Tuberculosis Mycobacterium (NTM). In some
embodiments, assays provided herein determine if an NTM is M
intracellulare, M avium, M. kansasii, or M. leprae or some other
species. In some embodiments, assays provided herein determine if
an MTBC is M. africanum, M. bovis, M. canettii, M microti, or M.
tuberculosis. In some embodiments, assays provided herein determine
if a sample contains, or an infection is due to, a mixture of NTMs
and MTBCs. In some embodiments, assays provided herein determine if
a sample contains antibiotic-sensitive M. tuberculosis,
antibiotic-resistant M. tuberculosis, or both. In some embodiments,
assays provided herein determine which antibiotics M. tuberculosis
in a sample resistant to, and at what dose.
[0067] Compositions, kits, and methods provided herein provide
sensitive and robust amplification starting with low initial
numbers of target sequences (e.g., either absolute numbers or
relative to non-target sequences). In some embodiments, amplified
target sequences which are substantially longer than individual
fluorescent hybridization probes are analyzed using sets of probes
which use the same colored fluorophore. In some embodiments,
neutral mutations which do not cause drug resistance are
distinguished from mutations which do cause drug resistance. In
some embodiments, each of the different possible mutations that
cause drug resistance is distinguished from the others. In some
embodiments, drug resistance mutants are detected in genomic DNA
mixtures comprised wild type drug sensitive genomes and mutant drug
resistant mutants.
[0068] In some embodiments, signaling probes and quenching probes
for use with mycobacteria-identification assays are provided.
Signaling probes and quenching probes are typically mismatch
tolerant. A mismatch-tolerant probe hybridizes in the assay, not
only to a target sequence that is perfectly complementary to the
probe, but also to variations of the target sequence that contain
one or more mismatches due to substitutions, additions or
deletions. For mismatch-tolerant probes, the greater the variation
of the target from perfect complementarity, the lower the Tm of the
probe-target hybrid. In some embodiments, sequence-specific probes
are employed. A sequence-specific probe hybridizes in the assay
only to a target sequence that is perfectly complementary to the
probe (e.g., at a given temperature). In some embodiments,
combinations of sequence-specific and mismatch-tolerant probes are
employed in an assay. If a probe is sequence-specific, its lack of
hybridization will be apparent in the melt curve and the derivative
curve. For example, if a signaling probe hybridizes, causing an
increase in fluorescence, but its associated quencher probe does
not hybridize, fluorescence will not decrease as the temperature is
lowered through the Tm of the quencher probe, revealing that the
quencher probe did not hybridize and indicating a target mutation
in the sequence complementary to the quencher probe. While this
result indicates a mutation in the target sequence for the quencher
probe, it does not allow for determination of which one of several
possible mutations of that sequence is present. In some
embodiments, it is preferable that the associated quencher probe be
mismatch tolerant, if the assay is to provide differentiation of
different mutations, distinguished by their different effects on
the melting curve (and derivative curve) due to differing Tm
effects of different mutations.
[0069] In some embodiments, a signaling probe of a set has a higher
Tm with respect to the single-stranded nucleic acid target sequence
than does its associated quencher probe. With that relationship, as
a sample is subjected to melt analysis, for example, as temperature
is increased signal first increases as the quencher probe melts off
and then decreases as the signaling probe melts off. With the
opposite relationship, signal remains quenched as the lower Tm
signaling probe melts off and does not then increase as the higher
Tm quencher probe melts off. The preferred relationship thus
provides more information. In some embodiments, it is preferred
that the quencher probe of a set reduces the signal from its
associated signaling probe to a very large extent. In such
embodiments, it is preferred that the concentration of the quencher
probe equal or exceed the concentration of the signaling probe. In
order to maximize signal amplitude, certain embodiments utilize
probe concentrations that are in excess with respect to the
single-stranded nucleic acid target sequence, thereby ensuring that
all or nearly all copies of the target sequence will have
hybridized probes.
[0070] Methods provided herein include the use of a single set of
interacting signaling and quencher probes. Methods also include the
use multiple sets of interacting signaling and quencher probes,
wherein each signaling probe is detectably distinguishable from the
others. Distinction of fluorescent probes may be by color (emission
wavelength), by Tm, or by a combination of color and Tm. Multiple
sets of interacting probes may be used to interrogate a single
target sequence or multiple target sequences in a sample, including
multiple target sequences on the same target strand or multiple
target sequences on different strands. Multiplex detection of
multiple target sequences may utilize, for example, one or more
sets of signaling/quencher probes specific to each target sequence.
In some embodiments, multiplex methods utilize a different
fluorescent color for each target sequence. Certain embodiments
utilize the same color for two different target sequences,
available temperature space permitting.
[0071] In some embodiments, methods comprise analyzing
hybridization of signaling/quencher probe sets to one or more
single-stranded mycobacteria nucleic acid target sequences as a
function of temperature. Signal, preferably fluorescent signal,
from the signaling probe or probes may be acquired as the
temperature of a sample is decreased (annealing) or increased
(melting). Analysis may include acquisition of a complete annealing
or melting curve, including both increasing and decreasing signals
from each signaling probe, as is illustrated in FIG. 1, Panel E.
Alternatively, analysis can be based only on signal increase or
signal decrease. Analysis may utilize only signals at select
temperatures rather than at all temperatures pertinent to annealing
or melting. Analysis may include comparison of the hybridization of
an unknown single-stranded nucleic acid target sequence to
hybridization of known target sequences that have been previously
established, for example, a compilation of melting curves for known
species or a table of digitized data for known species.
[0072] In methods provided herein, one or more single-stranded
mycobacteria nucleic acid target sequences to be analyzed may be
provided by nucleic acid amplification, generally exponential
amplification. Any suitable nucleic amplification method may be
used. Preferred amplification methods are those that generate
amplified product (amplicon) in single-stranded form so that
removal of complementary strands from the single-stranded target
sequences to be analyzed is not required. Probe sets may be
included in such amplification reaction mixtures prior to the start
of amplification so that reaction vessels containing amplified
product need not be opened. When amplification proceeds in the
presence of probe sets, it is preferred that the system be designed
such that the probes do not interfere with amplification. In some
embodiments a non-symmetric PCR method such as asymmetric PCR or,
LATE-PCR is utilized to generate single-stranded copies. PCR
amplification may be combined with reverse transcription to
generate amplicons from RNA targets. For example, reverse
transcription may be combined with LATE-PCR to generate DNA
amplicons corresponding to RNA targets or the complements of RNA
targets. In some embodiments, amplification methods that generate
only double-stranded amplicons are not preferred, because isolation
of target sequences in single-stranded form is required, and
melt-curve analysis is more difficult with double-stranded
amplicons due to the tendency of the two amplicons to collapse and
eject hybridization probes. In some embodiments, methods provided
herein do not utilize generation of detectable signal by digestion
of signaling probes, such as occurs in 5' nuclease amplification
assays. In a PCR amplification reaction, for example, avoidance of
probe digestion may be accomplished either by using probes whose
Tm's are below the primer-extension temperature, by using probes
such as those comprising 2' 0-methyl ribonucleotides that resist
degradation by DNA polymerases, or by using DNA polymerases that
lack 5' exonuclease activity. Avoidance of probe interference with
amplification reactions is accomplished by utilizing probes whose
Tm's are below the primer-extension temperature such that the
probes are melted off their complementary sequences during primer
extension and, most preferably, during primer annealing, at least
primer annealing after the first few cycles of amplification. For
example, in the amplification assay method of Example 1, the
LATE-PCR amplification method utilized two-step PCR with a
primer-annealing/primer-extension temperature of 75.degree. C. in
the presence of a set of mismatch-tolerant molecular beacon probes
having Tm's against the wild-type target sequence (to which the
probes were perfectly complementary) ranging from 75.degree. C. to
50.degree. C., which ensured that none of the probes interfered
significantly with amplification of the target sequence.
[0073] In LATE-PCR amplification, for example, the Excess Primer
strand is the single-stranded amplicon to which probe sets
hybridize. It therefore is or contains the single-stranded nucleic
acid sequence that is analyzed. Its 5' end is the Excess Primer,
and its 3' end is the complement of the Limiting Primer. If the
sequence to be analyzed lies between the Excess Primer and the
Limiting Primer, the starting sequence that is amplified and the
Excess Primer strand both contain that sequence. If in the starting
sequence to be amplified the sequence desired to be analyzed
includes a portion of either priming region, it is required that
the primer be perfectly complementary to that portion so that the
Excess Primer strand contain the desired sequence. Primers need not
be perfectly complementary to other portions of the priming
regions. Certain embodiments of methods provide single-stranded
nucleic acid target sequence to be analyzed by amplification
reactions that utilize "consensus primers` that are not perfectly
complementary to the starting sequence to be amplified, and care is
taken to ensure that the Excess Primer strand, which is or contains
the single-stranded target sequence that is actually analyzed,
contains the desired sequence.
[0074] In some embodiments, assays provided herein utilize
PRIMESAFE II (described in U.S. Patent Application No. 20080193934;
herein incorporated by reference in its entirety). PRIMESAFE II is
a class of reagents added to PCR reactions to suppress mis-priming.
PRIMESAFE II reagents are comprised of linear oligonucleotides that
are chemically modified at their 5' and or 3' ends. In some
embodiments, primesafe reagents used herein include SEQ ID NO: 65
and SEQ ID NO:66. In some embodiments, the assays described here
make use of a formulation of PRIMESAFE II that has two strands, the
first strand of which is modified at both the 5'end and the 3'end
by covalent linkage of dabcyl moieties, the second strand of which
is complementary to said first strand and is chemically modified by
addition of dabcyl moieties at both the 5'end and the 3'end.
[0075] An aspect of embodiments provided herein is the capability
to identify drug resistant strains of mycobacterium,
differentiating from drug-sensitive strains which may contain
neutral mutations. FIG. 2 illustrates the possible neutral
mutations which may exist in the rpoB gene target M. tuberculosis,
but does not cause drug resistance. FIG. 3 illustrates some of the
mutations in the rpoB gene target which are known to cause drug
resistance. Information about additional genes and their mutations
that cause drug resistance in M. tuberculosis can be found at
Sandgren A, Strong M, Muthukrishnan P, Weiner B K, Chruch, G M,
Murray M B. (2009) Tuberculosis Drug Resistance Mutation Database.
PLoS Med 6(2); herein incorporated by reference in its
entirety.
[0076] The phylogenetic relationship of some NTM species and the
MTBC species is illustrated in FIG. 4. In some embodiments, the
LATE-PCR limiting primers and excess primers employed in the assays
described here were constructed to be complementary to DNA targets
from the M. tuberculosis genome. Given the evolutionary divergence
observed in among mycobacterial species said limiting and excess
primers are imperfectly complementary to related target sequences
in some other species of NTMs. Said primers are most likely to be
fully complementary to the gene targets among other MTBC species
whose members are most closely related to M. tuberculosis. The MTBC
includes M africanum, M. bovis, M. canettii, M. microti, and M
tuberculosis.
[0077] Table 1 summarizes the targets and probes employed in a
nine-plex assay in terms of the purpose of each amplicon, the
specific gene targets, the lengths of the target regions probed,
and the number of probes utilized.
TABLE-US-00001 TABLE 1 Antibiotics Gene Target Target Length Number
of Probes Rifampin rpoB 101 3 On/3 Off Ethambutol embB 29 1 On/1
Off + 1 unlabeled oligo. Isoniazid inhA 36 1 On/1 Off Isoniazid
ahpC 93 2 On/2 Off Isoniazid katG 40 1 On/1 Off Fluoroquinolone
gyrA 45 1 On/1 Off + 1 unlabeled oligo. NTM vs MTBC 16s rRNA 63 2
On/2 Off MTBC Species gyrB 31 2 On/1 Off + 1 unlabeled oligo.
Systems ?? -30 1 On/1 Off Control
[0078] The amplicons of gyrA, gyrB, and embB have significant
hairpins which tend to prevent probe-target interactions. In these
cases an unlabeled oligonucleotide of high Tm (e.g., silent probe)
is added to inhibit hairpin formation and thus binding of the
signaling and/or quencher probes. The 16s rRNA target used to
distinguish MTBC from NTMs. In the embodiments described in Table
1, one probe set is employed to distinguish all MTBC from all NTMs,
as well as to distinguish many of the NTMs from each other.
[0079] FIG. 5 illustrates how the targets of Table 1 are end-point
detected using four colors (e.g., Quasar 670, Cal Red 610, Cal
Orange 570, and FAM) over a range of temperatures between
25.degree. C. and 75.degree. C. As one versed in the art will
appreciate, some fluorescent thermocyclers have capacities for more
than four fluorescent colors. It is contemplated that one or more
additional colors could be utilized for amplification and detection
of one or more additional amplicons that are detected with one or
more additional probes or sets of probes. Such additional amplicons
could be built into assays at the request of an end-user who wishes
to detect a particular target sequence which has a particular
clinical significance. In some embodiments, amplicons detected or
analyzed by other methods are multiplexed with the assays described
herein. In some embodiments, such amplicons are analyzed by
sequencing use a procedure such as "Dilute-N-Go" sequencing which
is convenient for sequencing on or more strands of DNA generated in
a multiplex LATE-PCR assay (Jia, Y., Osborne, A., Rice, J. E., and
Wangh, L. J. (2010) Dilute-`N`-Go Dideoxy Sequencing of All DNA
Strands Generated in Multiplex LATE-PCR Assays, Nucleic Acids
Research; herein incorporated by reference in its entirety).
[0080] FIG. 5 demonstrates an embodiments in which a single target
(rpoB) is analyzed with multiple probe sets that together generate
a composite fluorescent signals over a wide temperature range,
hereafter referred to as a temperature-dependent fluorescence
signature.
[0081] FIG. 5 further illustrates an embodiments, in which more
than one target is visualized using probe sets of the same color by
designing the signals for one set of probes in a temperature range
that is different from the temperature range for a separate target
(e.g., gyrB and 16s). The signals from the two targets fuse into
one composite temperature-dependent fluorescence signature which is
informative as to the presence/absence or characteristics of more
than one target.
[0082] In some embodiments, probe sets for each target in a
multiplex assay are employed to achieve maximum coverage of all
possible sequence differences among related sequences, as well as
maximum resolution among such sequence variants.
[0083] FIG. 6A illustrates the location of the probe sets utilized
for the rpoB gene target described in Table 1 and FIG. 5. Most
mutations within the rpoB gene target fall within signaling probes
and thereby decrease the corresponding Tm of the signaling probe to
the target. As a consequence the fluorescent signal from signaling
probe is observed at lower temperature. FIG. 6B illustrates the
location of an alternate probe set in which most mutations within
the rpoB gene target fall beneath quencher probes. As a
consequence, the fluorescent signal from adjacent on probe is only
quenched by its paired off-probe at lower temperature. FIGS. 7A and
7B illustrate the fluorescent signatures of the rpoB gene target
for probe sets in FIGS. 6A and 6B, respectively. In this example,
the probe set in FIG. 6B exhibited higher resolving power than
probe set in 6A.
[0084] Sputum samples are the most commonly used source of samples
for TB analysis because human sputum has a high concentration of
human genomic DNA.
[0085] The LATE-PCR assays, used to illustrate exemplary
embodiments herein, are highly specific for their intended targets,
despite the presence of high concentrations of human DNA for the
following reasons: 1) LATE-PCR chemistry is inherently more
specific that standard PCR chemistry; 2) Mycobacterial genomes have
a very high GC content which means that high Tm primers can be
employed for amplification together with high temperatures for
annealing and extension; 3) PRIMESAFE II with four dabcyls and a
high Tm can be employed to suppress mis-priming at all temperatures
below the annealing-extension temperature. In some embodiments,
primers are used which exhibit a bias for amplification of the
desired sequences (e.g., a tuberculosis bias). FIG. 8 illustrates
that 1000, 100, or 10 molecules of the rpoB target are all
efficiently amplified in the presence of 10,000 human genomes.
Table 2 illustrates the design of a multiplex reaction in which
10,000 human genomes and PRIMESAFE II were added to all
reactions.
TABLE-US-00002 TABLE 2 M. intracellulare M. tuberculosis rpoB Wild
Type Mutant mabA Wild Type Wild Type katG Wild Type Mutant 16s NTM
MTBC gyrB -- TB 100.0 0.00 20,000 0 99.9 0.10 19,980 20 99.5 0.50
19,900 100 99.0 1.00 19,800 200 95.0 5.00 19,000 1000 90.0 10.00
18,000 2000 0.00 100.0 0 20.000 H. Genome 10,000 copies in all
reactions PrimeSafe Yes
[0086] TB infections and clinical samples are commonly comprised of
more than one strain of a mycobacteria as well as other organisms,
for instance a drug-resistant strain mixed with a drug-sensitive
strain, or two different species of mycobacteria. In either case,
the separate components of such a mixture may be present over a
wide range of proportions, for instance from as little as 0.1% to
99.9%, up to 50% to 50%. In some embodiments, the assay described
in Table 2 provides a penta-plex reaction capable of detecting low
levels of M. tuberculosis in the presence of excess levels of an
NTM, M. intracellulare. The results summarized in Table 3
demonstrate that as little as 0.1-0.5% M. tuberculosis can be
detected in the presence of 99.9-99.5% of M. intracellular. In some
embodiments, similar results are obtained in assays configured to
detect other sub-groups of mycobacteria (e.g., rifampin-resistant
M. tuberculosis among excess rifampin-sensitive M. tuberculosis).
The sensitivity of this assay extends to any MTBC in the presence
of an excess of any NTM because the primers utilized for each of
the amplified targets are fully complementary to the MTBC genotypes
but only partially complementary to the NTM genotypes.
TABLE-US-00003 TABLE 3 Relative Relative Amplification
Amplification for Efficiency for Efficiency Mutant or vs M. Mutant
vs W. Type Species* rpoB To Be To Be rpoB 1 10% Determined
Determined 0.1-0.5% 1 10% 0.1-0.5% 1 10% > 0.1-0.5% 1 10% 1 10
mol. 1 10%
[0087] Table 3 also summarizes findings for the sensitivity of such
an assay to detect a drug resistant strain of an MTBC in the
presence of an excess of a wild type drug sensitive strain of said
MTBC in this case the primers are equally complementary to both
target genomes and the discrimination of drug resistance in the
presence of drug sensitivity entirely depends on the probes used to
visualize the fluorescent signatures of the drug resistant and drug
sensitive strains. The estimate of 10% drug resistance in the
presence of 90% drug sensitivity in Table 3 is based on empirical
observation employing the probes shown in FIG. 6A for the
rifampicin target. Based on the results illustrated in FIG. 7, it
is likely that the lower limit of detection will be 1% drug
resistance in 99% drug sensitive using the probe set shown in FIG.
6B.
EXPERIMENTAL
[0088] Features and embodiments of methods provided herein are
illustrated in the Examples set forth below in conjunction with the
accompanying Figures. The Examples should be viewed as exemplary
and not limiting in scope.
Example 1
Detection of Drug Resistance in the rpoB Gene for Strains of M.
tuberculosis
[0089] A LATE-PCR amplification was performed using a single pair
of primers to amplify a 150 base pair region of the rpoB gene for
each of several strains of Mycobacterium tuberculosis. The
amplification provided a 101 base-pair region of the gene, which is
known to contain mutations responsible for drug resistance for
rifampicin, as a single-stranded nucleic acid target sequence (the
Excess Primer strand of each LATE-PCR amplification). Following
amplification, each single-stranded nucleic acid target sequence
was probed using six separate probes that were included in the
original amplification reaction mixture.
[0090] The probes in combination spanned the 101 base pairs of the
single-stranded nucleic acid target sequence. Three of the probes
were signaling probes. The signaling probes were quenched molecular
beacon probes with two-nucleotide-long stems. Each included
covalently bound labels: the fluorophore Quasar 670 on one end and
a Black Hole Quencher 2, BHQ2, (Biosearch Technologies, Novato
Calif.), on the other end. The other three probes were quencher
probes terminally labeled with BHQ2 only, with no fluorophore. In
this example the Tm's of the signaling probes with respect to the
drug-sensitive strain differed from one another, and the Tm's of
the quencher probes with respect to the drug-sensitive strain
differed from one another. The three probe sets were detectably
distinguishable.
[0091] At the end of amplification, probe-target hybridizations
were analyzed as a function of temperature. In this example,
hybridizations were characterized by the use of melt profile
analysis. Reaction components and conditions were as follows:
TABLE-US-00004 Limiting Primer: (SEQ ID No. 1) 5'
CTCCAGCCAGGCACGCTCACGTGACAGACCG Excess Primer: (SEQ ID No. 2)
5'CCGGTGGTCGCCGCGATCAAGGAG Target: Strain 13545 (SEQ ID No. 3)
5'CCGGTGGTCGCCGCGATCAAGGAGTTCTTCGGCACCAGCCAGCTGAG
CCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCG
CCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCG GGCTGGAG Target:
Strain 18460 (SEQ ID No. 4)
5'CCGGTGGTCGCCGCGATCAAGGAGTTCTTCGGCACCAGCCAGCTGA
GCCAATTCATGGTCCAGAACAACCCGCTGTCGGGGTTGACCCACAAGC
GCCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCC GGGCTGGAG Target:
Strain 9249 (SEQ ID No. 5)
5'CCGGTGGTCGCCGCGATCAAGGAGTTCTTCGGCACCAGCCAGCTG
AGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAG
CGCCGACTGTTGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGC CGGGCTGGAG The
underline in the sequence of each of strains 18460 and 9249 denotes
the location of the nucleotide change from the drug-sensitive
strain 13545. Probe 1: (SEQ ID No. 6)
5'-BHQ2-CTGGTTGGTGCAGAAG-C.sub.3 Probe 2: (SEQ ID No. 7)
5'-BHQ2-TCAGGTCCATGAATTGGCTCAGA-Quasar 670 Probe 3: (SEQ ID No. 8)
5'-BHQ2-CAGCGGGTTGTT-C.sub.3 Probe 4: (SEQ ID No. 9)
5'-BHQ2-ATGCGCTTGTGGATCAACCCCGAT-Quasar 670 Probe 5: (SEQ ID No.
10) 5'-Quasar 670-AAGCCCCAGCGCCGACAGTCGTT BHQ2 Probe 6: (SEQ ID No.
II) 5'-ACAGACCGCCGG BHQ2 A three carbon linker is denoted with
C.sub.3 while a Black Hole Quencher 2 is denoted with BHQ2
(Biosearch Technologies, Novato CA).
[0092] LATE PCR amplifications were carried out in a 25 .mu.l
volume consisting of IX PCR buffer (Invitrogen, Carlsbad, Calif.),
2 mM MgCl2, 200 nM dNTPs, 50 nM Limiting Primer, 1000 nM Excess
Primer, 1.25 units of Platinum Taq DNA Polymerase (Invitrogen,
Carlsbad, Calif.), 500 nM of probes 1, 3 and 6, and 200 nM of
probes 2, 4 and 5. For each strain tested approximately 1000
genomes equivalents were used. Amplification reactions for each
strain were run in triplicate.
[0093] The thermal profile for the amplification reaction was as
follows: 98.degree. C./3 min for 1 cycle, followed by 98.degree.
Cil Os-75.degree. C./40 s for 50 cycles, followed by fluorescent
acquisition at each degree starting with an anneal at 75.degree. C.
with 1.degree. C. decrements at 30 s intervals to 34.degree. C.
followed by 10 min at 34.degree. C. This was followed by a melt
starting at 34.degree. C. with 1.degree. C. increments at 30 s
intervals to 81.degree. C.
[0094] The melting temperatures of the probes was performed
utilizing the computer program Visual OMP 7.0 with the
concentrations of target, signaling probes, and quencher probes at
100 nM, 200 nM and 500 nM respectively. The Tm's were as follows:
Probe 1, 50.degree. C.; Probe 2, 63.degree. C.; Probe 3, 56.degree.
C.; Probe 4, 67.degree. C.; Probe 5, 75.degree. C.; and Probe 6,
63.degree. C. Analysis of the probe target hybridizations following
amplification was by melt curve analysis using the first derivative
for Quasar 670 fluorescence for temperatures between 35.degree. C.
to 78.degree. C. From this data set the highest fluorescent value
was used to normalize the data to one. If the value used was
negative, it was multiplied by (-15); if it was a positive number,
it was multiplied by fifteen.
[0095] FIG. 9 illustrates binding of the three prose sets (Probes
1/Probe 2, Probe 3/Probe 4, and Probe 5/Probe 6) to the
single-stranded nucleic acid target sequence utilizing
drug-susceptible strain 13545 as the target. In FIG. 9, strand 21
is the target strand, strand 23 is the Excess Primer, and strand 22
is the Limiting Primer. For the purpose of illustration probes 1-6
are shown hybridized to strand 21 in a 3' to 5' orientation with
their mismatched ends above. Mismatches between the probes and
strand 21 and between the Limiting Primer and strand 21 are bolded.
Fluorophore and quencher labels are omitted from FIG. 9 but are
given above in the sequence descriptions. Some of the nucleotides
in the probe sequences were deliberately mismatched to the
sensitive strain 13545 such as Probe 1, which contains mismatches
in positions 31(A to G) and 38(T to G) relative to the 5' end of
strand 21. Other mismatches are in Probe 2, position 62(A to A),
Probe 4, position 86 (A to C). Within the Limiting Primer at
position 142(A to G) is a mismatch which was included to reduce a
hairpin that occurred in the original target strand. In addition to
these mismatches in the sensitive strain 13545, strains 18460 has a
nucleotide mismatch at position 59 (T to T) while strain 9249 has a
mismatch at position 104 (G to T).
[0096] It will be appreciated that LATE-PCR amplification provides
a sample containing the Excess Primer strand, which comprises the
single-stranded nucleic acid target sequence that is actually
probed. The Excess Primer strand includes the Excess Primer
sequence at one end and the complement of the Limiting Primer
sequence at the other end. In this case, due to the mismatch
between the Limiting Primer and strand 21, the Excess Primer strand
will differ from strand 21 at position 142, which will be a T
rather than a G. As to the region of strand 21 complementary to
probes 1-6, the Excess Primer strand is identical to strand 21.
[0097] FIG. 10A presents the results of the analysis for two
different strains of M. tuberculosis, strain 13545 and strain
18460. Data from analysis of the triplicate samples of the separate
amplifications of the two strains are superimposed for the purpose
of illustration. Circle 311 represents the drug-resistant strain
18460 (D516V, an aspartic acid located at amino acid position 516
changed to a valine), while, circle 312 shows the replicates from
the drug-sensitive strain 13545 (V146F, a valine located at amino
acid position 146 changed to a phenylalanine). FIG. 10B presents
the results for drug-resistant strain 9249 and drug-sensitive
strain 13545, where circle 313 shows the replicates for
drug-resistant strain 9249 (S531L, a serine located at amino acid
position 513 changed to a leucine) and circle 314 shows the
replicates from the drug-sensitive strain 13545 (V146F).
Example 2
The Detection of a Drug Resistance Strain of M. tuberculosis in a
Mixed Sample
[0098] LATE PCR amplifications were performed to provide
single-stranded nucleic acid target sequences using resistant M.
tuberculosis strain 18640 (D516V, an aspartic acid located at amino
acid 516 changed to a valine) and the sensitive strain 13545 in
different ratios to determine the level of sensitivity within a
mixed sample. Reaction components and conditions are described in
Example 1, except for the starting target sequences included in the
reaction mixtures. Amplicons generated from strain 18640 and strain
13545 using the primers from Example 1 comprise a single nucleotide
variation within the hybridization sequence of probe 2. In this
embodiment, probe 2 is a signaling probe. Alternatively, in some
embodiments, a quencher probe that hybridizes to the region of the
amplicon containing the variable nucleotide may be employed, and a
corresponding signaling probe is design to hybridize adjacently.
One reaction mixture contained only strain 18460, and another
reaction mixture contained only strain 13545. Each of these 100%
controls contained approximately 100,000 genomic DNA copies of the
pertinent strain. Reaction mixtures for a first mixed sample
contained 20% (approximately 20,000 genomes) of resistant strain
18460 with 80% (approximately 80,000 genomes) of sensitive strain
13545. The reaction mixture for a second mixed sample contained 10%
of strain 18460 (10,000 genomes) with 90% of strain 13545 (90,000
genomes). The reaction mixture for a third mixed sample contained
5% of strain 18460 (5,000 genomes) with 95% of strain 13545 (95,000
genomes). The reaction mixture for a fourth mixed sample contained
1% of strain 18460 (1,000 genomes) with 99% of strain 13545 (99,000
genomes). Amplification reactions were run in triplicate.
[0099] The thermal profile for the amplification reaction was as
follows: 98.degree. C./3 min for 1 cycle, followed by 98.degree.
C./10 s-75.degree. C./40 s for 50 cycles, followed by fluorescent
acquisition at each degree starting with an anneal at 75.degree. C.
with 1.degree. C. decrements at 30 s intervals to 34.degree. C.
then a hold for 10 min at 34.degree. C. This is followed by a melt
starting at 34.degree. C. with 1.degree. C. increments at 30 s
intervals to 81.degree. C. followed by an anneal starting at
75.degree. C. with 1.degree. C. decrements at 30 s intervals to
34.degree. C. This melt/anneal profile was repeated three more
times.
[0100] The data used for graphical analysis of the hybridization of
the six probes was the average of each replicate from the last
three melt profiles. From these average values the fluorescence at
35.degree. C. was subtracted, and the resulting values were
normalized by division of all values with the fluorescence at
78.degree. C. The first derivative of the resulting data were then
generated and normalized by dividing all values using the largest
positive value.
[0101] In order to remove the contribution of the sensitive strain
DNA from mixtures containing both sensitive and resistant strain
DNA's, replicates of the pure sensitive strain DNA samples (100%
controls) were used to generate average-derived-values at every
temperature, as described above. These values were then subtracted
from the derived-average-values of each mixture to arrive at the
contribution of the resistant strain. In addition, the scatter
among separate samples of pure sensitive DNA was established by
subtracting the derived-average-values of pure sensitive DNA from
each of the individual samples of pure sensitive DNA.
[0102] FIGS. 11A-11D show the resulting analysis. They display the
signal from various percentages of the resistant strain 18460 in an
increasing background of sensitive strain 13545. FIG. 11A shows
this signal with a mixed sample of 20% resistant strain 18460 in a
background of 80% sensitive strain 13545, where circle 410
identifies the contribution of the resistant strain in replicates
of the mixture, and circle 411 identifies the scatter among
replicates for the pure sensitive strain. FIG. 11B shows this
signal with the 10% mixture, with circle 412 representing the
contribution of the resistant strain in replicates of the mixture,
and circle 413 representing scatter among replicates for the pure
sensitive strain. FIG. 11C shows the signal from the mixture of 5%
resistant strain replicates (circle 414 identifying the
contribution of the resistant strain in replicates of the mixture,
and circle 415 identifying scatter among replicates for the pure
sensitive strain). FIG. 11D shows the signal from the mixture of 1%
resistant strain. Circle 416 identifies the contribution of the
resistant strain in replicates of the mixture, and circle 417
identifies the scatter among replicates of the pure sensitive
strain.
Example 3
Multi-Drug Resistance Detection in Strains of M. tuberculosis
[0103] A multiplex LATE-PCR assay was used to provide multiple
single-stranded target nucleic acids to detect drug resistance in
the three genes, gyrA (fluoroquinolones), katG (isoniazid), and
rpoB (rifampicin), of each of three strains, 13545, 202626 and
15552. For the gyrA gene the strains 13545 and 202626 were
drug-sensitive while strain 15552 (A90V, an aspartic acid located
at amino acid position 90 changed to a valine) was drug-resistant.
For the katG gene the strain 202626 was drug-sensitive, while
strain 13545 (S315T, a serine located at amino acid position 315
changed to a tyrosine) and strain 15552 (S315N, a serine located at
amino acid position 315 changed to an asparagine) were resistant.
For the rpoB gene strain 13545 was a sensitive strain while strain
15552 (S531L, a serine located at amino acid position 513 changed
to a leucine) and strain 202626 (H526D, a histidine located at
amino acid position 513 changed to an aspartic acid) were
resistant.
[0104] Reaction components and conditions were as follows:
TABLE-US-00005 For the gyrA gene Limiting Primer: (SEQ ID No. 12)
5' ACCAGGGCTGGGCCATGCGCACCA Excess Primer: (SEQ ID No. 13) 5'
GGACCGCAGCCACGCCAAGTC Target: Strain 13545 (SEQ ID No. 14)
5'GGACCGCAGCCACGCCAAGTCGGCCCGGTCGGTTGCCGAGACCATGGG
CAACTACCACCCGCACGGCGACGCGTCGATCTACGACAGCCTGGTGCGCA TGGCCCAGCCCTGGT
Target: Strain 202626 Identical to strain 13545 Target: Strain
15552 (SEQ ID No. 15)
5'GGACCGCAGCCACGCCAAGTCGGCCCGGTCGGTTGCCGAGACCATGGG
CAACTACCACCCGCACGGCGACGTGTCGATCTACGACAGCCTGGTGCGCA TGGCCCAGCCCTGGT
Probe 1: (SEQ ID No. 16) 5' CGACCGGGCC-BHQ2 Probe 2: (SEQ ID No.
17) 5' Cal Red 610-AACCCATGGTCTCGGCAACTT-BHQ2 Probe 3: (SEQ ID No.
18) 5' Cal Red 610-AATCGCCGTGCGGGTGGTAGTT-BHQ2 Probe 4: (SEQ ID No.
19) 5'GCTGTCGTAGATCGACGCG-BHQ2 For the katG gene Limiting Primer:
(SEQ ID No. 20) 5' AGCGCCCACTCGTAGCCGTACAGGATCTCGAGGAAAC Excess
Primer: (SEQ ID No. 21) 5' TCTTGGGCTGGAAGAGCTCGTATGGCAC Target:
Strain 202626 (SEQ ID No. 22)
GCTTGGGCTGGAAGAGCTCGTATGGCACCGGAACCGGTAAGGACGCGATC
ACCAGCGGCATCGAGGTCGTATGGACGAACACCCCGACGAAATGGGACA
ACAGTTTCCTCGAGATCCTGTACGGCTACGAGTGGGAGCT Target: Strain 13545 (SEQ
ID No. 23) GCTTGGGCTGGAAGAGCTCGTATGGCACCGGAACCGGTAAGGACGCGATC
ACCACCGGCATCGAGGTCGTATGGACGAACACCCCGACGAAATGGGACA
ACAGTTTCCTCGAGATCCTGTACGGCTACGAGTGGGAGCT Target: Strain 15552 (SEQ
ID No. 24) GCTTGGGCTGGAAGAGCTCGTATGGCACCGGAACCGGTAAGGACGCGATC
ACCAACGGCATCGAGGTCGTATGGACGAACACCCCGACGAAATGGGACA
ACAGTTTCCTCGAGATCCTGTACGGCTACGAGTGGGAGCT Probe 1: (SEQ ID No. 25)
5' Cal Orange 560-AAGTGATCGCGTCCTTACCTT-BHQ2 Probe 2: (SEQ ID No.
26) 5' GACCTCGATGCAGCTG-BHQ2 For the rpoB gene Limiting Primer:
same as in Example 1 Excess Primer: same as in Example 1 Target:
Strain 202626 (SEQ ID No. 27)
5'CCGGTGGTCGCCGCGATCAAGGAGTTCTTCGGCACCAGCCAGCTGAGC
CAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCGACAAGCGCCG
ACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGG AG Target:
Strain 15552 Same as strain 9249 set forth in Example 1 Target:
Strain 13545 Set forth in Example 1 Probes used for rpoB gene:
Probes 1-6 set forth in Example 1 The underline in a target
sequence denotes the location of the nucleotide change from the
drug sensitive strain.
[0105] LATE-PCR amplifications were performed in triplicate carried
out in a 25 ul volume consisting of IX PCR buffer (Invitrogen,
Carlsbad, Calif.), 2 mM MgCl2, 200 nM dNTPs, 50 nM Limiting Primer
and 1000 nM Excess Primer for each primer set, 1.25 units of
Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, Calif.), for the
gyrA probes 500 nM of probes 1 and 3 with 200 nM of probes 2 and 4,
for the katG probes 200 nM of probe 1 and 500 nM of probe 2, and
for the rpoB probes the concentrations set forth in Example 1. For
all strains tested approximately 1000 genomes equivalents of
pre-amplification target were used, and amplification reactions for
each strain were run in triplicate.
[0106] The thermal profile for the amplification reaction was as
follows: 98.degree. C./3 min for 1 cycle, followed by 98.degree.
C./10 s-75.degree. C./40 s for 50 cycles, followed by an anneal
starting at 75.degree. C. with 1.degree. C. decrements at 30 s
intervals to 34.degree. C., followed by 10 min at 34.degree. C.
This was followed by a melt starting at 34.degree. C. with
1.degree. C. increments at 30 s intervals to 81.degree. C.
[0107] Probe-target hybridizations were analyzed by the melt curve
analysis using the first derivative for each fluor separately for
the temperatures between 35.degree. C. to 78.degree. C. From each
data set the highest fluorescent value was used to normalize the
data to one. If the value used is negative then it is multiplied by
-15 (minus fifteen), if it was a positive number then it is
multiplied by +15 (plus fifteen). Each of the strains tested
differs in respect to drug resistance. See Table 1 below. For
example, strain 13545 is resistant to isoniazid drugs while
sensitive to both fluorquinolones and rifampicin while strain 15552
is resistant to all three drugs.
TABLE-US-00006 TABLE 1 Drug Gene Strain 13545 Strain 202626 Strain
15552 Fluorquinolones gyrA Sensitive Sensitive Resistant Isoniazid
katG Resistant Sensitive Resistant Rifampicin rpoB Sensitive
Resistant Resistant
[0108] FIG. 12 illustrates probe binding of primers and probes to
strand 51, the gyrA target of strain 13545, which, because the
primers were perfectly complementary to the original target strand,
is identical to the Excess Primer strand. In FIG. 12 the underlined
portion 53 of sequence 51 are the nucleotides of the Excess Primer
and sequence 52 is the Limiting Primer. Probes 1-4 are shown
hybridized to strand 51 in a 3' to 5' orientation with their
unmatched ends above. The probes are labeled with their respective
quenchers or fluorophores (not shown) as described above. Strain
15552 differs relative to the 5' end at position 72, a T nucleotide
from that of both strains 13545 and 202626 which has a C nucleotide
in that position.
[0109] FIG. 13 illustrates probe binding of primers and probes to
strand 61, the katG target of strain 202626, which, because the
primers were perfectly complementary to the original target strand,
is identical to the Excess Primer strand; that is, one of the three
single-stranded products of the LATE-PCR amplification reaction. In
FIG. 13, underlined sequence 63 is the nucleotides of the Excess
Primer, and underlined sequence 62 is the Limiting Primer. Probes
1, 2 are shown hybridized to strand 61 in the 3' to 5' orientation
with their mismatched ends above. Relative to the 5' end of strand
61, all three strains differ at position 56 (G, in bold) to Probe
2. At position 54 is a "G" as shown for strain 202626, but it is a
"C" in strain 13545 and an "A" in strain 15552. The Excess Primer
contains a deliberate mismatch at the 5' end (a "T" rather than the
"G" in each of the targets) to reduce potential mispriming during
the linear phase of LATE-PCR amplification.
[0110] The thermal profile for the amplification reaction was as
follows: 98.degree. C./3 min for 1 cycle, followed by 98.degree.
C./10 s-75.degree. C./40 s for 50 cycles, followed by an anneal
starting at 75.degree. C. with 1.degree. C. decrements at 30 s
intervals to 34.degree. C. followed by 10 min at 34.degree. C. This
is followed by a melt starting at 34.degree. C. with 1.degree. C.
increments at 30 s intervals to 81.degree. C.
[0111] FIG. 14A presents the normalized fluorescence readings of
all six probes for the rpoB gene in three different strains of M.
tuberculosis as a function of the temperature. Circle 711
represents the replicates for strain 202626, while circle 712 shows
the replicates for strain 15552 and circle 713 are the replicates
for strain 13545.
[0112] FIG. 14B shows the results for the gyrA probes, which
distinguish the sensitive strains 202626 and 13545 (circle 714)
from the drug resistant strain 15552 (circle 715). The results for
the katG gene probes are shown in FIG. 14C, in which all three melt
derivatives are different, circle 716 are replicates of the
sensitive strain 202626, while the resistant strains 13545 and
15552 are represented by circle 717 and circle 718,
respectively.
Example 4
Species Differentiation and Detection of Drug Resistance Among
Members of the Genus Myobacterium
[0113] A multiplex LATE-PCR assay was used to provide multiple
single-stranded target nucleic acids to detect drug resistance for
isoniazid using katG plus the promoter region of the mabA gene and
resistance for rifampin determined with the rpoB gene. Also the
assay uniquely identifies M. tuberculosis from other members of the
genus Mycobacterium by using a combination of two genes, the 16s
ribosomal and the gyrase B genes.
[0114] Primers, probes, and target sequences were the result of
extensive analysis of sequence alignments (SEE FIG. 15) and
empirical testing to yield sequences that, when used in assays
provide information-rich results. Reaction components and
conditions were as follows:
The Primer Sequences for the rpoB Gene;
TABLE-US-00007 rpoB Limiting Primer: (SEQ ID No. 28) 5'
CTCCAGCCAGGCACGCTCACGTGACAGACCG rpoB Excess Primer: (SEQ ID No. 29)
5'CCGGTGGTCGCCGCGATCAAGGAG
The Probe Sequences for the rpoB Gene:
TABLE-US-00008 rpoB Off Probe 1 (SEQ ID No. 30)
5'-BHQ2-CTGGTTGGTGCAGAAG-C.sub.3 rpoB On Probe 1 (SEQ ID No. 31)
5'-Quasar 670-TCAGGTCCATGAATTGGCTCAGA BHQ2 rpoB Off Probe 2 (SEQ ID
No. 32) 5'-BHQ2-CAGCGGGTTGTT-C.sub.3 rpoB On Probe 2 (SEQ ID No.
33) 5'-Quasar 670-ATGCGCTTGTGGATCAACCCCGAT BHQ2 rpoB On Probe 3
(SEQ ID No. 34) 5'-Quasar 670-AAGCCCCAGCGCCGACAGTCGTT BHQ2 rpoB Off
Probe 3 (SEQ ID No. 35) 5'-ACAGACCGCCGG BHQ2
rpoB Target Sequences:
TABLE-US-00009 M. tuberculosis strain 8094; (SEQ ID No. 36)
5'CCGGTGGTCGCCGCGATCAAGGAGTTCTTCGGCACCAGCCAGCTG
AGCCAATTCATGGGCCAGAACAACCCGCTGTCGGGGTTGACCCAC
AAGCGCCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAG CGTGCCTGGCTGGAG M.
tuberculosis strain 8545; (SEQ ID No. 37)
5'CCGGTGGTCGCCGCGATCAAGGAGTTCTTCGGCACCAGCCAGCTG
AGCCCATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACA
AGCGCCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGC GTGCCTGGCTGGAG M.
africanum; (SEQ ID No. 38)
5'CCGGTGGTCGCCGCGATCAAGGAGTTCTTCGGCACCAGCCAGCTG
AGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCAC
AAGCGCCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAG CGTGCCGGGCTGGAG M.
intracellulare; Not available
The Probe Sequences for the katG Gene:
TABLE-US-00010 katG Limiting Primer: (SEQ ID No. 39) 5'
AGCGCCCACTCGTAGCCGTACAGGATCTCGAGGAAAC katG Excess Primer: (SEQ ID
No. 40) 5' TCTTGGGCTGGAAGAGCTCGTATGGCAC
The Probe Sequences for the katG Gene:
TABLE-US-00011 katG On Probe (SEQ ID No. 41) 5' Cal Orange
560-GTATCGCGTCCTTACCGGTTCCAC-BHQ2 katG Off Probe (SEQ ID No. 42) 5'
CTCGATGCTGCTGGTG-BHQ2
katG Target Sequences:
TABLE-US-00012 M. tuberculosis strains 8545 and 8094; (SEQ ID No.
43) 5'GCTTGGGCTGGAAGAGCTCGTATGGCACCGGAACCGGTAAGGAC
GCGATCACCACCGGCATCGAGGTCGTATGGACGAACACCCCGACG
AAATGGGACAACAGTTTCCTCGAGATCCTGTACGGCTACGAGTGGG AGCT M.
intracellulare; (SEQ ID No. 44)
5'GGCTGGGCTGGAAGAGCTCGTACGGCACCGGTTCGGGCAAGGAT
GCGATCACCAGCGGCCTCGAGGTGGTCTGGACGCCCACCCCGACG
AAGTGGGACAACAGCTTCCTGGAGACGCTGTACGGCTACGAATGG GAGCT M. africanum;
Not available
The Probe Sequences for the mabA Promoter Region:
TABLE-US-00013 mabA Limiting Primer: (SEQ ID No. 45)
5'TTCCGGTAACCAGGACTGAACGGGATACGAATGGGGGTTTGG mabA Excess Primer:
(SEQ ID No. 46) 5' TCGCAGCCACGTTACGCTCGTGGACATAC
The Primer Sequences for the mabA Promoter Region:
TABLE-US-00014 mabA On Probe (SEQ ID No. 47) 5'Cal Red
610-TTACAACCTATCGTCTCGCCGCAA-BHQ2 SG-31685/WO-1/ORD mabA Off Probe
(SEQ ID No. 48) 5'GCAGTCACCCCG-BHQ2
mabA Promoter Target Sequences:
TABLE-US-00015 M. tuberculosis strain 8094; (SEQ ID No. 49)
5'TCGCAGCCACGTTACGCTCGTGGACATACCGATTTCGGCCCGGCC
GCGGCGAGACGATAGGTTGTCGGGGTGACTGCCACAGCCACTGAA
GGGGCCAAACCCCCATTCGTATCCCGTTCAGTCCTGGTTACCGGAG
GAAACCGGGGGATCGGGCTGGCGATCGCACAGCGGCTGGCTGCCG A M. tuberculosis
strain 8545; (SEQ ID No. 50)
5'TCGCAGCCACGTTACGCTCGTGGACATACCGATTTCGGCCCGGCC
GCGGCGAGATGATAGGTTGTCGGGGTGACTGCCACAGCCACTGAA
GGGGCCAAACCCCCATTCGTATCCCGTTCAGTCCTGGTTACCGGAG
GAAACCGGGGGATCGGGCTGGCGATCGCACAGCGGCTGGCTGCCG A M. intracellulare;
Not available M. africanum; Not available
The Primer Sequences for 16s:
TABLE-US-00016 [0115] 16s Limiting Primer: (SEQ ID No. 51)
5'-ACACCCTCTCAGGCCGGCTACCCGTCG 16s Excess Primer: (SEQ ID No. 52)
5'-GAGTGGCGAACGGGTGAGTAACACG
The Probe Sequences for 16s:
TABLE-US-00017 [0116] 16s On Probe: (SEQ ID No. 53) 5'-BHQ1
TTGGCTCATCCCACACCGCTAAAGTGCTTTAA-FAM 16s OffProbe: (SEQ ID No. 54)
5'-BHQ1 CCACCACAAGATATGCGTCTCGTGTTCCTAT-C3
16s Target Sequences:
TABLE-US-00018 [0117] M. tuberculosis strains 8545, 8094 and M.
africanum; (SEQ ID No. 55)
5'GAGTGGCGAACGGGTGAGTAACACGTGGGTGATCTGCCCTGCAC
TTCGGGATAAGCCTGGGAAACTGGGTCTAATACCGGATAGGACCA
CGGGATGCATGTCTTGTGGTGGAAAGCGCTTTAGCGGTGTGGGATG
AGCCCGCGGCCTATCAGCTTGTTGGTGGGGTGACGGCCTACCAAGG
CGACGACGGGTAGCCGGCCTGAGAGGGTGT M. intracellulare (SEQ ID No. 56)
5'GAGTGGCGAACGGGTGAGTAACACGTGGGCAATCTGCCCTGCAC
TTCGGGATAAGCCTGGGAAACTGGGTCTAATACCGGATAGGACCTT
TAGACGCATGTCTTTTGGTGGAAAGCTTTTGCGGTGTGGGATGGGC
CCGCGGCCTATCAGCTTGTTGGTGGGGTGACGGCCTACCAAGGCGA
CGACGGGTAGCCGGCCTGAGAGGGTGT
The Primer Sequences for the Gyrase B Gene:
TABLE-US-00019 [0118] gyrase B Excess Primer: (SEQ ID No. 57) 5'
ATACGGGCTTGCGCCGAGGACAC gyrase B Limiting Primer: (SEQ ID No. 58)
5' GTCAGCGAACCGCAGTTCGAGGGCCAGACCAAGACC
The Unlabeled Oligo for the Gyrase B Gene:
TABLE-US-00020 [0119] Oligo-gyrB: (SEQ ID No. 59)
5'-CCACTGGTTTGAAGCCAACCCCA-C3
The Probe Sequences for the Gyrase B Gene:
TABLE-US-00021 [0120] gyrase B On Probe: (SEQ ID No. 61) 5' BHQ 1
AGGACGCGAAAGTCGTTGCT-C3-FAM gyrase B Off Probe: (SEQ ID No. 62) 5'
BHQ1 TGAACAAGGCT-C3
Gyrase B Target Sequences:
TABLE-US-00022 [0121] M. tuberculosis strains 8545 and 8094; (SEQ
ID No. 63) 5'GTCAGCGAACCGCAGTTCGAGGGCCAGACCAAGACCAAGTTGGG
CAACACCGAGGTCAAATCGTTTGTGCAGAAGGTCTGTAACGAACA
GCTGACCCACTGGTTTGAAGCCAACCCCACCGACGCGAAAGTCGTT
GTGAACAAGGCTGTGTCCTCGGCGCAAGCCCGTAT M. africanum; (SEQ ID No. 64)
5'GTCAGCGAACCGCAGTTCGAGGGCCAGACCAAGACCAAGTTGGG
CAACACCGAGGTCAAATCGTTTGTGCAGAAGGTCTGTAACGAACA
GCTGACCCACTGGTTTGAAGCCAACCCCACCGACTCGAAAGTCGTT
GTGAACAAGGCTGTGTCCTCGGCGCAAGCCCGTAT M. intracellulare Not
available.
The Sequence for PRIMESAFE 046:
TABLE-US-00023 [0122] (SEQ ID No. 65)
5'Dabcyl-GGAGCAGACTAGCACTGAGGTA-Dabcyl (SEQ ID No. 66)
5'Dabcyl-TACCTCAGTGCTAGTCTGCTCC-Dabcyl
A three carbon linker is denoted with C.sub.3 while black hole
quenchers 1 or 2 are denoted with BHQ1 or BHQ2 respectively.
(Biosearch Technologies, Novato Calif.)
[0123] LATE-PCR amplifications were performed in triplicate, and
carried out in a 25 .mu.l volume consisting of 1.times.PCR buffer
(Invitrogen, Carlsbad, Calif.), 2 mM MgCl2, 300 nM dNTPs, 50 nM
limiting primer, 1000 nM excess primer, 1.5 units of Platinum Taq
DNA Polymerase (Invitrogen, Carlsbad, Calif.), 500 nM of each off
probe, 200 nM of each on probe, and 100 nM of PRIMESAFE 046.
[0124] The thermal profile for the amplification reaction was as
follows: 98.degree. C./3 min for 1 cycle, followed by 98.degree.
C./10 s-75.degree. C./45 s for 60 cycles, followed by 10 min at
75.degree. C., followed by 10 min at 25.degree. C. with a melt
starting at 25.degree. C. with 1.degree. C. increments at 45 s
intervals to 81.degree. C. with fluorescent acquisition at each
degree. Probe-target hybridizations were analyzed by the melt curve
analysis using the first derivative for each fluorophore separately
for the temperatures between 25.degree. C. to 80.degree. C.
[0125] The above assay provides means for differentiation of
mycobacteria, as evidenced by derivative graphs of
temperature-dependent fluorescence signatures in FIG. 16A-D.
Example 5
Detection of a Multi-Drug Resistance and Species Identification of
M. tuberculosis in a Mixed Sample with Non-Mycobacterium
[0126] LATE PCR amplifications were performed to provide
single-stranded nucleic acid target sequences using multi-drug
resistant M. tuberculosis strain 8094 (rpoB gene has D516G, an
aspartic acid located at amino acid 516 changed to a glycine, katG
gene has S315T, an serine located at amino acid 315 changed to a
threonine, the mabA promoter has no mutation thus a wild type
sequence) and the M. intracellulare (which had not been
characterized for these genes) in different ratios to determine the
level of sensitivity within a mixed sample. One reaction mixture
contained only strain 8094, and another reaction mixture contained
only M. intracellulare. Each of these 100% controls contained
approximately 20,000 genomic DNA copies of the pertinent strain.
Reaction mixtures for a first mixed sample contained 10%
(approximately 2,000 genomes) of resistant strain 8094 with 80%
(approximately 18,000 genomes) of M. intracellulare. The reaction
mixture for a second mixed sample contained 5% of strain 8094
(1,000 genomes) with 95% of M. intracellulare (19,000 genomes). The
reaction mixture for a third mixed sample contained 1% of strain
8094 (200 genomes) with 99% of M. intracellulare (19,800 genomes).
The reaction mixture for a fourth mixed sample contained 0.5% of
strain 8094 (100 genomes) with 99.5% of M. intracellulare (19,900
genomes). The reaction mixture for a fifth mixed sample contained
0.1% of strain 8094 (20 genomes) with 99.9% of M. intracellulare
(19,980 genomes). Reaction components and PCR conditions are
described in Example 1 and amplification reactions were run in
triplicate.
[0127] The data used for graphical analysis of the hybridization
for all five genes and their respective probe sets was the average
first derivative of the three replicates from the melt profile.
[0128] FIGS. 17A-17D shows the resulting analysis. They display the
signal from each of the various percentages of the resistant strain
8094 in an increasing background of M. intracellulare as well as
the no template controls. FIG. 17A shows the combined fluorescent
derivatives of 16s and gyrase B genes in which 100% M.
intracellulare and 100% of resistant strain 8094 are distinctly
different. As the mixture of strain 8094 decreases from 10%, 5%,
1%, 0.5% these fluorescent signatures becomes more similar to the
100% M. intracellulare however, even at 0.1% of strain 8094 the
difference is discernable. FIG. 17B shows the melt derivatives for
katG gene where the 100% M. intracellulare is divergent from 100%
of resistant strain 8094. For katG this distinctive pattern
difference provides an unambiguous detection for all percentages of
resistant strain 8094. FIG. 17C shows the mabA promoter region
derivatives and is the case in which both the M. intracellulare and
100% of resistant strain 8094 have the same signature shape. The
decreasing percentages of strain 8094 show a similar decrease in
signal towards the 100% M. intracellulare. FIG. 17D shows the rpoB
gene derivatives with distinct fluorescent signatures for M.
intracellulare and 100% of resistant strain 8094. As is the case of
16s and gyrase B the different percentages of strain 8094 from 10%,
5%, 1%, 0.5%, and 0.1% these fluorescent signatures becomes more
similar to the 100% M. intracellulare but are still distinct and
remain unique.
Example 6
Species Identification of M. tuberculosis from Other
Mycobacterium
[0129] The primer and probe sequences for gyrase B are the same as
Example 4 with addition of:
TABLE-US-00024 gyrase B On Probe: (SEQ ID No. 60) 5' FAM
CGTGTAATGAATAGCTGCG-BHQ1
gyrB Target Sequences:
TABLE-US-00025 M. tuberculosis (SEQ ID No. 63)
5'GTCAGCGAACCGCAGTTCGAGGGCCAGACCAAGACCAAGTTGGG
CAACACCGAGGTCAAATCGTTTGTGCAGAAGGTCTGTAACGAACA
GCTGACCCACTGGTTTGAAGCCAACCCCACCGACGCGAAAGTCGTT
GTGAACAAGGCTGTGTCCTCGGCGCAAGCCCGTAT M. microti (SEQ ID No. 75)
5'GTCAGCGAACCGCAGTTCGAGGGCCAGACCAAGACCAAGTTGGG
CAACACCGAGGTCAAATCGTTTGTGCAGAAGGTCTGTAACGAACA
GCTGACCCACTGGTTTGAAGCCAACCCCACCGACTCGAAAGTCGTT
GTGAACAAGGCTGTGTCCTCGGCGCAAGCCCGTAT M. bovis (SEQ ID No. 76)
5'GTCAGCGAACCGCAGTTCGAGGGCCAGACCAAGACCAAGTTGGG
CAACACCGAGGTCAAATCGTTTGTGCAGAAGGTCTGTAATGAACAG
CTGACCCACTGGTTTGAAGCCAACCCCACCGACTCGAAAGTCGTTG
TGAACAAGGCTGTGTCCTCGGCGCAAGCCCGTAT M. chelonae (SEQ ID No. 77)
5'GTCGGCGAACCTCAGTTCGAGGGTCAAACCAAGACCAAGCTGGG
CAACACCGAGGTCAAGTCGTTTGTGCAGAAGGTGTGCAACGAGCA
GCTGCAGCACTGGTTCGACTCGAACCCCGCCGA M. intracellulare (SEQ ID No. 78)
5'GTCAGCGAACCGCAGTTCGAGGGTCAGACCAAGACCAAGCTGGG
CAACACCGAAGTGAAGTCGTTCGTGCAGAAGGTCTGCAACGAACA
GCTCACCCACTGGTTCGAGGCCAACCCCGCGGA M. asiaticum (SEQ ID No. 79)
5'GTCGCCGAACCCCAGTTCGAGGGCCAGACAAAGACCAAGCTGGG
CAACACCGAGGTCAAGTCGTTCGTGCAGAAGGTGTGCAACGAACA
GCTCACCCACTGGTTCGAGGCCAATCCGTCGGA M. avium (SEQ ID No. 80)
5'GTGAGCGAACCGCAGTTCGAGGGCCAGACCAAGACCAAACTGGG
CAACACCGAGGTGAAGTCGTTCGTGCAGAAGGTGTGCAACGAACA
GCTCACCCACTGGTTCGAAGCCAACCCCGCAG
The primer and probe sequences for 16s are the same as Example
4.
16s Target Sequences:
TABLE-US-00026 [0130] M. chelonae (SEQ ID No. 81)
5'GAGTGGCGAACGGGTGAGTAACACGTGGGTGATCTGCCCTGCAC
TCTGGGATAAGCCTGGGAAACTGGGTCTAATACCGGATAGGACCA
CACACTTCATGGTGAGTGGTGCAAAGCTTTTGCGGTGTGGGATGAG
CCCGCGGCCTATCAGCTTGTTGGTGGGGTAATGGCCCACCAAGGCG
ACGACGGGTAGCCGGCCTGAGAGGGTGA M. asiaticum (SEQ ID No. 82)
5'GAGTGGCGAACGGGTGAGTAACACGTGGGTGATCTGCCCTGCAC
TTCGGGATAAGCCTGGGAAACTGGGTCTAATACCGGATAGGACCA
CGGGATGCATGTCCTGTGGTGGAAAGCTTTTGCGGTGTGGGATGGG
CCCGCGGCCTATCAGCTTGTTGGTGGGGTGACGGCCTACCAAGGCG
ACGACGGGTAGCCGGCCTGAGAGGGTGT M. avium (SEQ ID No. 83)
5'GAGTGGCGAACGGGTGAGTAACACGTGGGCAATCTGCCCTGCAC
TTCGGGATAAGCCTGGGAAACTGGGTCTAATACCGGATAGGACCTC
AAGACGCATGTCTTCTGGTGGAAAGCTTTTGCGGTGTGGGATGGGC
CCGCGGCCTATCAGCTTGTTGGTGGGGTGACGGCCTACCAAGGCGA
CGACGGGTAGCCGGCCTGAGAGGGTGT M. intracellulare Same as Example 4 M.
fortuitum (SEQ ID No. 84)
5'GAGTGGCGAACGGGTGAGTAACACGTGGGTGATCTGCCCTGCAC
TCTGGGATAAGCCTGGGAAACTGGGTCTAATACCGAATAGGACCG
CGCTCTTCATGTGGGGTGGTGGAAAGCTTTTGCGGTGTGGGATGGG
CCCGCGGCCTATCAGCTTGTTGGTGGGGTAATGGCCTACCAAGGCG
ACGACGGGTAGCCGGCCTGAGAGGGTGT Members of Mycobacterium tuberculosis
complex (M. tuberculosis, M. microti, M. bovis) Same as Example
4
[0131] LATE-PCR amplifications were performed in triplicate carried
out in a 25 pl volume consisting of Ix PCR buffer (Invitrogen,
Carlsbad, Calif.), 2 mM MgCl2, 200 nM dNTPs, 50 nM limiting
primers, 1000 nM excess primers and 1.25 units of Platinum Taq DNA
Polymerase (Invitrogen, Carlsbad, Calif.). Three separate mixtures
were made; the first had 200 nM of each gyrase B On probe, 500 nM
of gyrase B Off probe and 1 uM of unlabeled gyrB oligo, the second
mixture had 200 nM of the 16s On probe and 500 nM of 16s Off probe,
while the third combined all probes and unlabeled oligos for both
gyrase B and 16s.
[0132] The thermal profile for the amplification reaction was as
follows: 98.degree. C./3 min for 1 cycle, followed by 98.degree.
C./10 s-75.degree. C./45 s for 60 cycles, followed by 10 min at
75.degree. C., followed by 10 min at 25.degree. C. with a melt
starting at 25.degree. C. with 1.degree. C. increments at 45 s
intervals to 81.degree. C. with fluorescent acquisition at each
degree. Probe-target hybridizations were analyzed by the melt curve
analysis using the first derivative for each fluor separately for
the temperatures between 25.degree. C. to 80.degree. C.
[0133] FIG. 18A-C shows the results of the average melt derivatives
for each mixture set. FIG. 18A are fluorescent signatures of the
gyrase B probes set with members of the Mycobacterium tuberculosis
complex (MTBC); M. tuberculosis strain 10460, strain 15601, M.
bovis, M. mircoti. The non-tuberculosis mycobacterium (NTM) species
are M. fortuitum, M. avium, M. chelonae, M. intracellulare, M.
asiaticum, and no template controls. The results of fluorescent
signatures clearly separate the NTM's from members of the MTBC with
all NTM's showing similar results as the NTC. For members within
the MTBC the signatures are also distinct for each; M. tuberculosis
has a sharp peak at 61 C then a negative peak at 49.degree. C., M.
microti has a peak at 54.degree. C. and minor peak at 49.degree.
C., and M. bovis positive peaks at 54.degree. C. and 42.degree. C.
with a minor negative peak at 49.degree. C. FIG. 18B shows the
results from the 16s probes in which all MTBC members have
identical fluorescent signatures while all NTM species have their
own unique signatures. In FIG. 18C, both probe sets are combined
and the results show that all species tested have their own unique
fluorescent signatures.
[0134] All publications and patents mentioned in the present
application are herein incorporated by reference in their
entireties. Various modification, recombination, and variation of
the described features and embodiments will be apparent to those
skilled in the art without departing from the scope and spirit of
the invention. Although specific embodiments have been described,
it should be understood that the claims should not be unduly
limited to such specific embodiments. Indeed, various modifications
of the described modes and embodiments can be made without
departing from the inventive concepts described herein.
Sequence CWU 1
1
96131DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1ctccagccag gcacgctcac gtgacagacc g
31224DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 2ccggtggtcg ccgcgatcaa ggag 243150DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
3ccggtggtcg ccgcgatcaa ggagttcttc ggcaccagcc agctgagcca attcatggac
60cagaacaacc cgctgtcggg gttgacccac aagcgccgac tgtcggcgct ggggcccggc
120ggtctgtcac gtgagcgtgc cgggctggag 1504150DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
4ccggtggtcg ccgcgatcaa ggagttcttc ggcaccagcc agctgagcca attcatggtc
60cagaacaacc cgctgtcggg gttgacccac aagcgccgac tgtcggcgct ggggcccggc
120ggtctgtcac gtgagcgtgc cgggctggag 1505150DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
5ccggtggtcg ccgcgatcaa ggagttcttc ggcaccagcc agctgagcca attcatggac
60cagaacaacc cgctgtcggg gttgacccac aagcgccgac tgttggcgct ggggcccggc
120ggtctgtcac gtgagcgtgc cgggctggag 150616DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
6ctggttggtg cagaag 16723DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 7tcaggtccat gaattggctc aga
23812DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 8cagcgggttg tt 12924DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
9atgcgcttgt ggatcaaccc cgat 241023DNAArtificial SequenceDescription
of Artificial Sequence Synthetic probe 10aagccccagc gccgacagtc gtt
231112DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 11acagaccgcc gg 121224DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
12accagggctg ggccatgcgc acca 241321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
13ggaccgcagc cacgccaagt c 2114113DNAArtificial SequenceDescription
of Artificial Sequence Synthetic polynucleotide 14ggaccgcagc
cacgccaagt cggcccggtc ggttgccgag accatgggca actaccaccc 60gcacggcgac
gcgtcgatct acgacagcct ggtgcgcatg gcccagccct ggt
11315113DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 15ggaccgcagc cacgccaagt cggcccggtc
ggttgccgag accatgggca actaccaccc 60gcacggcgac gtgtcgatct acgacagcct
ggtgcgcatg gcccagccct ggt 1131610DNAArtificial SequenceDescription
of Artificial Sequence Synthetic probe 16cgaccgggcc
101721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 17aacccatggt ctcggcaact t 211822DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
18aatcgccgtg cgggtggtag tt 221919DNAArtificial SequenceDescription
of Artificial Sequence Synthetic probe 19gctgtcgtag atcgacgcg
192037DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 20agcgcccact cgtagccgta caggatctcg aggaaac
372128DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 21tcttgggctg gaagagctcg tatggcac
2822139DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 22gcttgggctg gaagagctcg tatggcaccg
gaaccggtaa ggacgcgatc accagcggca 60tcgaggtcgt atggacgaac accccgacga
aatgggacaa cagtttcctc gagatcctgt 120acggctacga gtgggagct
13923139DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 23gcttgggctg gaagagctcg tatggcaccg
gaaccggtaa ggacgcgatc accaccggca 60tcgaggtcgt atggacgaac accccgacga
aatgggacaa cagtttcctc gagatcctgt 120acggctacga gtgggagct
13924139DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 24gcttgggctg gaagagctcg tatggcaccg
gaaccggtaa ggacgcgatc accaacggca 60tcgaggtcgt atggacgaac accccgacga
aatgggacaa cagtttcctc gagatcctgt 120acggctacga gtgggagct
1392521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 25aagtgatcgc gtccttacct t 212616DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
26gacctcgatg cagctg 1627150DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 27ccggtggtcg
ccgcgatcaa ggagttcttc ggcaccagcc agctgagcca attcatggac 60cagaacaacc
cgctgtcggg gttgaccgac aagcgccgac tgtcggcgct ggggcccggc
120ggtctgtcac gtgagcgtgc cgggctggag 1502831DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
28ctccagccag gcacgctcac gtgacagacc g 312924DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
29ccggtggtcg ccgcgatcaa ggag 243016DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
30ctggttggtg cagaag 163123DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 31tcaggtccat gaattggctc aga
233212DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 32cagcgggttg tt 123324DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
33atgcgcttgt ggatcaaccc cgat 243423DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
34aagccccagc gccgacagtc gtt 233512DNAArtificial SequenceDescription
of Artificial Sequence Synthetic probe 35acagaccgcc gg
1236150DNAMycobacterium tuberculosis 36ccggtggtcg ccgcgatcaa
ggagttcttc ggcaccagcc agctgagcca attcatgggc 60cagaacaacc cgctgtcggg
gttgacccac aagcgccgac tgtcggcgct ggggcccggc 120ggtctgtcac
gtgagcgtgc ctggctggag 15037150DNAMycobacterium tuberculosis
37ccggtggtcg ccgcgatcaa ggagttcttc ggcaccagcc agctgagccc attcatggac
60cagaacaacc cgctgtcggg gttgacccac aagcgccgac tgtcggcgct ggggcccggc
120ggtctgtcac gtgagcgtgc ctggctggag 15038150DNAMycobacterium
africanum 38ccggtggtcg ccgcgatcaa ggagttcttc ggcaccagcc agctgagcca
attcatggac 60cagaacaacc cgctgtcggg gttgacccac aagcgccgac tgtcggcgct
ggggcccggc 120ggtctgtcac gtgagcgtgc cgggctggag 1503937DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
39agcgcccact cgtagccgta caggatctcg aggaaac 374028DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
40tcttgggctg gaagagctcg tatggcac 284124DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
41gtatcgcgtc cttaccggtt ccac 244216DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
42ctcgatgctg ctggtg 1643139DNAMycobacterium tuberculosis
43gcttgggctg gaagagctcg tatggcaccg gaaccggtaa ggacgcgatc accaccggca
60tcgaggtcgt atggacgaac accccgacga aatgggacaa cagtttcctc gagatcctgt
120acggctacga gtgggagct 13944139DNAMycobacterium intracellulare
44ggctgggctg gaagagctcg tacggcaccg gttcgggcaa ggatgcgatc accagcggcc
60tcgaggtggt ctggacgccc accccgacga agtgggacaa cagcttcctg gagacgctgt
120acggctacga atgggagct 1394542DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 45ttccggtaac caggactgaa
cgggatacga atgggggttt gg 424629DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 46tcgcagccac gttacgctcg
tggacatac 294724DNAArtificial SequenceDescription of Artificial
Sequence Synthetic probe 47ttacaaccta tcgtctcgcc gcaa
244812DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 48gcagtcaccc cg 1249182DNAMycobacterium
tuberculosis 49tcgcagccac gttacgctcg tggacatacc gatttcggcc
cggccgcggc gagacgatag 60gttgtcgggg tgactgccac agccactgaa ggggccaaac
ccccattcgt atcccgttca 120gtcctggtta ccggaggaaa ccgggggatc
gggctggcga tcgcacagcg gctggctgcc 180ga 18250182DNAMycobacterium
tuberculosis 50tcgcagccac gttacgctcg tggacatacc gatttcggcc
cggccgcggc gagatgatag 60gttgtcgggg tgactgccac agccactgaa ggggccaaac
ccccattcgt atcccgttca 120gtcctggtta ccggaggaaa ccgggggatc
gggctggcga tcgcacagcg gctggctgcc 180ga 1825127DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
51acaccctctc aggccggcta cccgtcg 275225DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
52gagtggcgaa cgggtgagta acacg 255332DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
53ttggctcatc ccacaccgct aaagtgcttt aa 325431DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
54ccaccacaag atatgcgtct cgtgttccta t 3155211DNAUnknownDescription
of Unknown Mycobacterium tuberculosis or Mycobacterium africanum
55gagtggcgaa cgggtgagta acacgtgggt gatctgccct gcacttcggg ataagcctgg
60gaaactgggt ctaataccgg ataggaccac gggatgcatg tcttgtggtg gaaagcgctt
120tagcggtgtg ggatgagccc gcggcctatc agcttgttgg tggggtgacg
gcctaccaag 180gcgacgacgg gtagccggcc tgagagggtg t
21156209DNAMycobacterium intracellulare 56gagtggcgaa cgggtgagta
acacgtgggc aatctgccct gcacttcggg ataagcctgg 60gaaactgggt ctaataccgg
ataggacctt tagacgcatg tcttttggtg gaaagctttt 120gcggtgtggg
atgggcccgc ggcctatcag cttgttggtg gggtgacggc ctaccaaggc
180gacgacgggt agccggcctg agagggtgt 2095723DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
57atacgggctt gcgccgagga cac 235836DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 58gtcagcgaac cgcagttcga
gggccagacc aagacc 365923DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 59ccactggttt
gaagccaacc cca 236019DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 60cgtgtaatga atagctgcg
196120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 61aggacgcgaa agtcgttgct 206211DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
62tgaacaaggc t 1163170DNAMycobacterium tuberculosis 63gtcagcgaac
cgcagttcga gggccagacc aagaccaagt tgggcaacac cgaggtcaaa 60tcgtttgtgc
agaaggtctg taacgaacag ctgacccact ggtttgaagc caaccccacc
120gacgcgaaag tcgttgtgaa caaggctgtg tcctcggcgc aagcccgtat
17064170DNAMycobacterium africanum 64gtcagcgaac cgcagttcga
gggccagacc aagaccaagt tgggcaacac cgaggtcaaa 60tcgtttgtgc agaaggtctg
taacgaacag ctgacccact ggtttgaagc caaccccacc 120gactcgaaag
tcgttgtgaa caaggctgtg tcctcggcgc aagcccgtat 1706522DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 65ggagcagact agcactgagg ta 226622DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 66tacctcagtg ctagtctgct cc 226726DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 67atcctccggg ctgccgaacc agcgga 266830DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 68tgctctggca tgtcatcggc gcgaattcgt
306919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 69ttctcgggtc atgctcaaa
197010DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 70gggtgtagcc 107127DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 71gcttgaccgc cggcagcccg tcgatgc 277224DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 72agtcggcgga gaagggttga gtgc 247330DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 73gacaggtcgc cgccgatgag agcggtgagc
307435DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 74cgatatggtg tgatatatca cctttgcctg acagc
3575170DNAMycobacterium microti 75gtcagcgaac cgcagttcga gggccagacc
aagaccaagt tgggcaacac cgaggtcaaa 60tcgtttgtgc agaaggtctg taacgaacag
ctgacccact ggtttgaagc caaccccacc 120gactcgaaag tcgttgtgaa
caaggctgtg tcctcggcgc aagcccgtat 17076170DNAMycobacterium bovis
76gtcagcgaac cgcagttcga gggccagacc aagaccaagt tgggcaacac cgaggtcaaa
60tcgtttgtgc agaaggtctg taatgaacag ctgacccact ggtttgaagc caaccccacc
120gactcgaaag tcgttgtgaa caaggctgtg tcctcggcgc aagcccgtat
17077122DNAMycobacterium chelonae 77gtcggcgaac ctcagttcga
gggtcaaacc aagaccaagc tgggcaacac cgaggtcaag 60tcgtttgtgc agaaggtgtg
caacgagcag ctgcagcact ggttcgactc gaaccccgcc 120ga
12278122DNAMycobacterium intracellulare 78gtcagcgaac cgcagttcga
gggtcagacc aagaccaagc tgggcaacac cgaagtgaag 60tcgttcgtgc agaaggtctg
caacgaacag ctcacccact ggttcgaggc caaccccgcg 120ga
12279122DNAMycobacterium asiaticum 79gtcgccgaac cccagttcga
gggccagaca aagaccaagc tgggcaacac cgaggtcaag 60tcgttcgtgc agaaggtgtg
caacgaacag ctcacccact ggttcgaggc caatccgtcg 120ga
12280121DNAMycobacterium avium 80gtgagcgaac cgcagttcga gggccagacc
aagaccaaac tgggcaacac cgaggtgaag 60tcgttcgtgc agaaggtgtg caacgaacag
ctcacccact ggttcgaagc caaccccgca 120g 12181209DNAMycobacterium
chelonae 81gagtggcgaa cgggtgagta acacgtgggt gatctgccct gcactctggg
ataagcctgg 60gaaactgggt ctaataccgg ataggaccac acacttcatg gtgagtggtg
caaagctttt 120gcggtgtggg atgagcccgc ggcctatcag cttgttggtg
gggtaatggc ccaccaaggc 180gacgacgggt agccggcctg agagggtga
20982209DNAMycobacterium asiaticum 82gagtggcgaa cgggtgagta
acacgtgggt gatctgccct gcacttcggg ataagcctgg 60gaaactgggt ctaataccgg
ataggaccac gggatgcatg tcctgtggtg gaaagctttt 120gcggtgtggg
atgggcccgc ggcctatcag cttgttggtg gggtgacggc ctaccaaggc
180gacgacgggt agccggcctg agagggtgt 20983209DNAMycobacterium avium
83gagtggcgaa cgggtgagta acacgtgggc aatctgccct gcacttcggg ataagcctgg
60gaaactgggt ctaataccgg ataggacctc aagacgcatg tcttctggtg gaaagctttt
120gcggtgtggg atgggcccgc ggcctatcag cttgttggtg gggtgacggc
ctaccaaggc 180gacgacgggt agccggcctg agagggtgt
20984209DNAMycobacterium fortuitum 84gagtggcgaa cgggtgagta
acacgtgggt gatctgccct gcactctggg ataagcctgg 60gaaactgggt ctaataccga
ataggaccgc gctcttcatg tggggtggtg gaaagctttt 120gcggtgtggg
atgggcccgc ggcctatcag cttgttggtg gggtaatggc ctaccaaggc
180gacgacgggt agccggcctg agagggtgt 20985108DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
polynucleotidemodified_base(12)..(12)a, c, t or
gmodified_base(15)..(15)a, c, t or gmodified_base(18)..(18)a, c, t
or gmodified_base(24)..(24)a, c, t or gmodified_base(27)..(27)a, c,
t or gmodified_base(51)..(51)a, c, t or gmodified_base(54)..(54)a,
c, t or gmodified_base(57)..(57)a, c, t or
gmodified_base(60)..(60)a, c, t or gmodified_base(63)..(63)a, c, t
or gmodified_base(66)..(66)a, c, t or gmodified_base(75)..(75)a, c,
t or gmodified_base(78)..(78)a, c, t or gmodified_base(81)..(81)a,
c, t or gmodified_base(84)..(84)a, c, t or
gmodified_base(87)..(87)a, c, t or gmodified_base(90)..(90)a, c, t
or gmodified_base(93)..(93)a, c, t or gmodified_base(96)..(96)a, c,
t or gmodified_base(99)..(99)a, c, t or
gmodified_base(102)..(102)a, c, t or gmodified_base(105)..(105)a,
c, t or gmodified_base(108)..(108)a, c, t or g 85garttyttyg
gnacnwsnca rytnwsncar ttyatggayc araayaaycc nytnwsnggn 60ytnacncaya
armgnmgnyt nwsngcnytn rgnccnggng gnytnwsn 1088669DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideCDS(1)..(69) 86ctg agc caa ttc atg gac cag aac aac
ccg ctg tcg ggg ttg acc cac 48Leu Ser Gln Phe Met Asp Gln Asn Asn
Pro Leu Ser Gly Leu Thr His1 5 10 15aag cgc cga ctg tcg gcg ctg
69Lys Arg Arg Leu Ser Ala Leu 208723PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 87Leu
Ser Gln Phe Met Asp Gln Asn Asn Pro Leu Ser Gly Leu Thr His1 5 10
15Lys Arg Arg Leu Ser Ala Leu 208869DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotideCDS(1)..(69)modified_base(46)..(46)a, c, t, g,
unknown or other 88cbg msc mwa ttc atg kds cag aac aac ccg ctg tcg
ggg ttg acc ndm 48Xaa Xaa Xaa Phe Met Xaa Gln Asn Asn Pro Leu Ser
Gly Leu Thr Xaa1 5 10 15aag cgc cga ctg tbk gcg syg 69Lys Arg Arg
Leu Xaa Ala Xaa 208923PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptideMOD_RES(1)..(1)The 'Xaa' at
location 1 stands for Arg, Pro or LeuMOD_RES(2)..(2)The 'Xaa' at
location 2 stands for Ser, Thr or ArgMOD_RES(3)..(3)The 'Xaa' at
location 3 stands for Lys, Gln or LeuMOD_RES(6)..(6)The 'Xaa' at
location 6 stands for Glu, Asp, Gly, Val or TyrMOD_RES(16)..(16)The
'Xaa' at location 16 stands for Asn, Arg, Glu, Asp, His, Leu or
TyrMOD_RES(21)..(21)The 'Xaa' at location 21 stands for Trp, Cys,
Ser or LeuMOD_RES(23)..(23)The 'Xaa' at location 23 stands for Val,
Pro or Leu 89Xaa Xaa Xaa Phe Met Xaa Gln Asn Asn Pro Leu Ser Gly
Leu Thr Xaa1 5 10 15Lys Arg Arg Leu Xaa Ala Xaa
2090150DNAMycobacterium tuberculosis 90ctccagccag gcacgctcac
gtgacagacc gccgggcccc agcgccgaca gtcggcgctt 60gtgggtcaac cccgacagcg
ggttgttctg gtccatgaat tggctcagct ggctggtgcc 120gaagaactcc
ttgatcgcgg cgaccaccgg 15091150DNAMycobacterium avium 91ctccagcccg
gcccgctccc gggacagacc acccgggccc agcgccgaca ggcggcgctt 60gtgggtgagc
cccgacagcg ggttgttctg gtccatgaac tgggacagct ggctggtgcc
120gaagaactcc ttgatcgccg ccacgactgg 15092139DNAMycobacterium
tuberculosis 92agctcccact cgtagccgta caggatctcg aggaaactgt
tgtcccattt cgtcggggtg 60ttcgtccata cgacctcgat gccgctggtg atcgcgtcct
taccggttcc ggtgccatac 120gagctcttcc agcccaagc
13993139DNAMycobacterium avium 93agctcccact cgtagccgta cagggtctcc
aggaaggtgt tgtcccactt ggtcggggtg 60ggcgtccaga ccacctccag gccgctggtg
atggcgtcct tgcccacgcc ggtcccgtac 120gagctcttcc agcccagac
13994170DNAMycobacterium intracellulare 94gtcagcgaac cgcagttcga
gggtcagacc aagaccaagc tgggcaacac cgaagtgaag 60tcgttcgtgc agaaggtctg
caacgaacag ctcacccact ggttcgaggc caaccccgcg 120gacgccaagg
tggtggtcaa caaggcggtg tcgtcggcgc aggcccggat 1709528DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
95gcttgggctg gaagagctcg tatggcac 2896108DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
96gagttcttcg gcaccagcca gctgagccaa ttcatggacc agaacaaccc gctgtcgggg
60ttgacccaca agcgccgact gtcggcgctg gggcccggcg gtctgtca 108
* * * * *