U.S. patent application number 16/398226 was filed with the patent office on 2019-09-05 for soluble tcr molecules and methods of use.
The applicant listed for this patent is Altor Bioscience Corporation. Invention is credited to Heather J. Belmont, Kimberlyn F. Card, Shari A. Price-Schiavi, Hing C. Wong, Xiaoyun Zhu.
Application Number | 20190269807 16/398226 |
Document ID | / |
Family ID | 34590303 |
Filed Date | 2019-09-05 |
![](/patent/app/20190269807/US20190269807A1-20190905-D00001.png)
![](/patent/app/20190269807/US20190269807A1-20190905-D00002.png)
![](/patent/app/20190269807/US20190269807A1-20190905-D00003.png)
![](/patent/app/20190269807/US20190269807A1-20190905-D00004.png)
![](/patent/app/20190269807/US20190269807A1-20190905-D00005.png)
![](/patent/app/20190269807/US20190269807A1-20190905-D00006.png)
![](/patent/app/20190269807/US20190269807A1-20190905-D00007.png)
![](/patent/app/20190269807/US20190269807A1-20190905-D00008.png)
![](/patent/app/20190269807/US20190269807A1-20190905-D00009.png)
![](/patent/app/20190269807/US20190269807A1-20190905-D00010.png)
![](/patent/app/20190269807/US20190269807A1-20190905-D00011.png)
View All Diagrams
United States Patent
Application |
20190269807 |
Kind Code |
A1 |
Price-Schiavi; Shari A. ; et
al. |
September 5, 2019 |
SOLUBLE TCR MOLECULES AND METHODS OF USE
Abstract
Disclosed are compositions and methods for detecting cells or
tissue comprising a peptide antigen presented in the context of an
MHC or HLA complex. The invention has a wide range of applications
including providing a highly sensitive method for detecting cancer
cells.
Inventors: |
Price-Schiavi; Shari A.;
(Westminster, MD) ; Belmont; Heather J.; (North
Miami Beach, FL) ; Card; Kimberlyn F.; (Pembroke
Pines, FL) ; Zhu; Xiaoyun; (Weston, FL) ;
Wong; Hing C.; (Weston, FL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Altor Bioscience Corporation |
Miramar |
FL |
US |
|
|
Family ID: |
34590303 |
Appl. No.: |
16/398226 |
Filed: |
April 29, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15040724 |
Feb 10, 2016 |
|
|
|
16398226 |
|
|
|
|
14182888 |
Feb 18, 2014 |
9290560 |
|
|
15040724 |
|
|
|
|
10985271 |
Nov 10, 2004 |
8772451 |
|
|
14182888 |
|
|
|
|
60518790 |
Nov 10, 2003 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 47/665 20170801;
G01N 33/57492 20130101; C07K 14/7051 20130101; G01N 2333/7051
20130101; A61K 47/6425 20170801; G01N 33/6875 20130101; C07K
2319/32 20130101; G01N 33/57484 20130101; A61K 47/6415 20170801;
C07K 14/55 20130101; C07K 2319/00 20130101; C07K 2319/20 20130101;
G01N 2333/70539 20130101; C07K 2319/30 20130101; B82Y 5/00
20130101; A61K 51/1027 20130101; A61K 47/642 20170801 |
International
Class: |
A61K 51/10 20060101
A61K051/10; A61K 47/66 20060101 A61K047/66; C07K 14/725 20060101
C07K014/725; A61K 47/64 20060101 A61K047/64; G01N 33/574 20060101
G01N033/574; B82Y 5/00 20060101 B82Y005/00; C07K 14/55 20060101
C07K014/55; G01N 33/68 20060101 G01N033/68 |
Goverment Interests
STATEMENT OF U.S. GOVERNMENT INTEREST
[0002] Funding for the present invention was provided in part by
the Government of the United States by virtue of Grant Nos.:
1R43CA88615-01 and 1R43CA105816-01 from the National Institutes of
Health. Accordingly, the Government of the United States has
certain rights in and to the invention claimed herein.
Claims
1-38. (canceled)
39. A soluble single-chain T cell receptor fusion molecule
comprising a T cell receptor and a biologically active polypeptide
or fragment thereof connected by a first peptide linker, wherein
the soluble single-chain T cell receptor has one recognition
binding site and the biologically active polypeptide or fragment
thereof has a different recognition binding site, wherein the
soluble single-chain T cell receptor comprises an .alpha. variable
chain and a .beta. variable chain T cell receptor (TCR) covalently
linked together by a second peptide linker and a .beta. constant
domain covalently linked to the .beta. variable chain, wherein the
soluble single-chain T cell receptor specifically binds to SEQ ID
NO: 1; and wherein the biologically active polypeptide or fragment
thereof is an IL-2 cytokine or a fragment thereof.
40. The soluble single chain T cell receptor fusion molecule of
claim 39 wherein the fusion molecule comprises a sequence of
covalently linked subunits comprising the sequence:
(NH2)-TCR-V.alpha.-second peptide
linker-TCR-V.beta.-TCR-C.beta.-first peptide linker-biologically
active polypeptide or fragment thereof.
41. The soluble T cell receptor fusion molecule of claim 39 wherein
the biologically active polypeptide or fragment thereof is specific
for recognition of an effector cell.
42. The soluble single-chain T cell receptor fusion molecule of
claim 39 wherein at least one of the first and second peptide
linkers includes from about 7 to 20 amino acids.
43. The soluble single-chain T cell receptor fusion molecule of
claim 39 wherein the first and second peptide linkers includes from
about 8 to 16 amino acids.
44. The soluble single-chain T cell receptor fusion molecule of
claim 43, wherein at least one of the first and second peptide
linkers consist of alanine, serine and glycine to provide for
flexibility.
45. A therapeutic composition for treatment of disorders comprising
a therapeutically effective amount of the T cell receptor fusion
molecule of claim 39 and a sterile, pharmaceutically acceptable
carrier vehicle.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of priority of copending
U.S. application Ser. No. 15/040,724, filed Feb. 10, 2016, which
claims priority of U.S. application Ser. No. 14/182,888, filed Feb.
18, 2014, now issued as U.S. Pat. No. 9,290,560, which claims
priority of U.S. application Ser. No. 10/985,271, filed Nov. 10,
2004, now issued as U.S. Pat. No. 8,772,451, which claims the
benefit of U.S. Provisional Application No. 60/518,790, filed Nov.
10, 2003, all of which application as are incorporated herein by
reference. This application also claims the benefit of priority of
copending U.S. application Ser. No. 15/585,956, filed May 3, 2017,
which claims priority of U.S. application Ser. No. 13/612,178,
filed Sep. 12, 2012, now abandoned, which claims priority of U.S.
application Ser. No. 09/874,907, filed Jun. 5, 2001, now abandoned,
which claims the benefit of U.S. Provisional Application No.
60/209,536, filed Jun. 5, 2000, all of which application as are
incorporated herein by reference.
FIELD OF THE INVENTION
[0003] The invention features compositions and methods for
detecting cells or tissue comprising a peptide antigen presented in
the context of an MHC or HLA complex. The invention has a wide
range of applications including providing a highly sensitive method
for detecting cancer cells.
BACKGROUND
[0004] There is increasing recognition that immunotherapy is a
promising approach to treat cancer. Various strategies have been
proposed including treatment with cytokines such as interleukin-2
(IL-2). IL-2 impacts various immune cell types including T and B
cells, monocytes, macrophages, lymphokine activated killer cells
(LAK) and NK cells [10, 40].
[0005] There have been proposals to concentrate cytokines at the
site of tumors to help increase efficacy. Typical methods include
direct injection of the cytokine or gene encoding same into the
tumor, or targeted delivery of the cytokine by fusing it to a tumor
antigen specific antibody [20]. However, these methods have
drawbacks.
[0006] For example, most direct injection methods are difficult to
use especially at early stages of cancer when tumors are typically
small (micrometastases). Moreover, such methods are usually
labor-intensive with little guarantee of therapeutic success. This
makes treatment of large patient populations impractical and
costly.
[0007] Antibody-cytokine fusion constructs have been used in an
approach to treat cancer. However, the methods are limited to the
extent that the antibody has a limited binding spectrum. That is,
the antibodies can only recognize certain cell surface antigens.
Unfortunately, many tumor antigens are not displayed appropriately
for antibody recognition, thereby limiting potential of antibody
based approaches. Moreover, there are reports that many tumor
specific antigens are derived from aberrant expression of cell type
specific proteins. These may exist only with a small number of
tumor types. This drawback limits the potential of antibody based
therapies even further.
[0008] The p53 protein is an intracellular tumor suppressor that
has been reported to act by arresting abnormal cells at the G1/S
phase of the cell cycle. Over expression of the protein is believed
to be a significant tumor marker for a large number of human
malignancies and there is recognition that it is a good target for
broad spectrum targeted tumor immunotherapy. The p53 protein is
usually displayed on the cell surface in the context of major
histocompatibility complex proteins (MHC). Such protein complexes
are known to be the binding targets of T-cell receptors (TCRs).
[49].
[0009] There have been attempts to use certain TCRs to detect
MHC/peptide complexes containing peptide (Epel et al., 2002; Holler
et al., 2003; Lebowitz et al., 1999; Plaksin et al., 1997; Wataya
et al., 2001; O'Herron et al., 1997). However, these and related
methods have significant shortcomings.
[0010] For instance, many of the methods require that TCR
constructs be multimerized (i.e., designed to have multiple TCR
copies) presumably to enhance peptide antigen binding with peptide
antigen artificially. Target (antigen presenting) cells are often
manipulated by the methods to express relatively large amounts of
peptide antigen. Sometimes the density of peptide antigen is as
high as 10.sup.4 to 10.sup.5 complexes per cell (Wataya et al.,
2001). Such a high peptide antigen density is believed to
facilitate binding and detection by the TCRs. However, these levels
of peptide antigen are artificial and typically much greater than
the level of MHC/peptide complexes that include most
tumor-associated antigens (TAAs). For some TAAs, less than about 50
HLA/peptide complexes per cell are present (Pascolo et al., 2001;
Schirle et al., 2000). Thus, there has been recognition that the
prior methods are not sensitive enough to detect most if not all
TAAs.
[0011] There have been attempts to use certain TCRs to detect cells
expressing particular peptide antigens. Like many antibody based
methods, these approaches have either lacked enough sensitivity to
detect peptide antigen or failed to detect such antigen
completely.
[0012] For example, Holler et al. (2003) reported the development
of certain soluble TCRs that were reported to react with
MHC/peptide complexes. Although the TCRs were able to detect
antigen with cells artificially "loaded" with the antigen, the
molecules were unable to detect endogenous antigen on tumor cells.
Holler et al. concluded that when the antigen is present at a
density of less than 600 copies per cell, TCR based methods are not
sensitive or reliable enough to detect antigen.
[0013] Particular TCR based methods have been used to detect viral
peptides in the context of MHC molecules. (Strominger, et al.,
WO9618105). However, these and related methods suffer from
drawbacks. For instance, there is general recognition that viral
infection often produces exceptionally high densities of
MHC/peptide complexes, typically approaching from >1000 to
>10.sup.5 complexes per cell. See Herberts et al., 2001; van Els
et al., 2000. Thus like most other peptide antigen detection
methods, TCR based approaches to detect viral antigens have so far
relied on the relatively large number of antigen targets to drive
the detection method.
[0014] Although some TCR based methods have been used to detect
relatively large amounts of peptide antigen, it is less certain if
the methods will work when the TCR is fused to other molecules such
as a cytokine, an immunoglobin domain such as IgG1, biotin or
streptavidin. That is, it is not certain how the resulting fusion
molecule will impact the TCR peptide binding groove particularly
when low densities of TAA need to be analyzed. Small distortions in
the TCR peptide binding groove, while not necessarily problematic
when relatively large amounts of peptide antigen are to be
analyzed, could reduce TAA binding specificity and selectivity.
Even small changes in the TCR peptide binding groove function could
jeopardize detection of cancer cells that express low TAA
densities.
[0015] It would be useful to have methods for detecting TAAs that
are sensitive, selective and reproducible especially when the
peptide antigens are present in low densities. It would be
especially useful if such methods could be used with a variety of
soluble TCRs including molecules such as those fused to a
detectable label or a cytokine.
SUMMARY OF THE INVENTION
[0016] The invention generally features a method for detecting
cells or tissue comprising a peptide antigen presented on the cells
or tissue in the context of an MHC or HLA complex. In one
embodiment, the invention includes at least one and preferably all
of the following steps: [0017] a) contacting the cells or tissue
with at least one soluble TCR molecule or functional fragment
thereof under conditions that form a specific binding complex
between the presented peptide antigen and the soluble TCR or
fragment, [0018] b) washing the cells or tissue under conditions
appropriate to remove any soluble TCR molecule or fragment not
bound to the presented peptide antigen; and [0019] c) detecting the
specific binding complex as being indicative of cells or tissue
comprising the presented peptide antigen.
[0020] In preferred practice, the invention is used to detect an
amount of peptide antigen on the cells or tissue that is less than
about 100,000 copies, preferably less than about 1000 copies such
as about 100 to about 800 copies.
[0021] Use of the invention has several advantages. For instance,
the invention is highly sensitive and can be used to detect and
optionally quantitate very low-density MHC/peptide complexes
including those containing endogenous peptide, more particularly
tumor-associated peptide antigens presented on unmanipulated tumor
cells. In contrast, prior methods for detecting MHC/peptide
complexes are reported to be capable of detecting relatively higher
density complexes.
[0022] Additionally, the invention can be used to detect and
optionally quantitate fixed cells and tissues such as those
routinely found in histoarrays, for example tumor histoarrays. The
ability to detect MHC/peptide complexes (sometimes called
"staining") is advantageous, especially in clinical or other
medical settings where it is typical practice to fix cells, tissues
or other biological samples taken from patients. In contrast, many
prior TCR-based detection methods are not able to accommodate fixed
tissue since noncovalently associated peptide is routinely lost
during the tissue processing steps.
[0023] The invention provides still further advantages. For
instance, the methods are intended to be flexible and compatible
with use of monomeric and/or multimeric soluble TCR molecules.
Unfortunately, past practice has relied heavily on use of
multimeric TCRs which has limited flexibility and sensitivity. In
particular, such multimeric TCRs may be difficult to use for in
vivo imaging due to their potential for breakdown or aggregation,
lack of accessibility to the target site, increased immunogenicity
and clearance.
[0024] Practice of the invention addresses a long-felt need in the
field by providing an ability to detect endogenous peptide antigen
presented in the context of the MHC/peptide complex on the surface
of cells. The method has a variety of important uses such as
helping to monitor cell activity, pathology and infection. For
example, detection of endogenous tumor-associated peptide antigens
on cells or tissues by the invention can provide a means of
detecting and optionally quantitating the presence/extent of a
cancer. Past practice has often relied on antibodies as a
diagnostic tool to detect protein antigens on the surface of cancer
cells. However, antibodies typically are limited in detection of
cell-membrane proteins. In addition, detection with antibodies is
often compromised by antigen shedding or secretion of the antigenic
protein into the circulation. Antibodies also have limited target
recognition. Practice of the invention avoids these and other
difficulties by providing a sensitive and reliable detection method
that uses soluble TCRs and fragments thereof to detect target
peptide antigens.
[0025] Such uses and advantages of the invention can be employed to
detect peptide antigen in a variety of settings including in vivo
(e.g., as an imaging or diagnostic method) or in vitro (e.g., in a
histoarray or FACS analysis).
[0026] Other aspects of the invention are discussed infra.
BRIEF DESCRIPTION OF THE DRAWINGS
[0027] FIGS. 1A-B are drawings showing the schematic structure
(FIG. 1A) and the amino acid sequence (FIG. 1B) of a 264scTCR/IL-2
fusion protein (SEQ ID NO: 16). (G.sub.4S).sub.4 linker disclosed
as SEQ ID NO: 17.
[0028] FIG. 2 is a representation of a sizing gel showing
production of 264scTCR/IL-2 fusion protein in transfected CHO
cells.
[0029] FIG. 3A, FIG. 3B, and FIG. 3C are graphs showing MHC/peptide
binding ability of the TCR portion of 264scTCR/IL-2 fusion
protein.
[0030] FIG. 4A-FIG. 4B are graphs showing IL-2 receptor binding
ability of the IL-2 portion of 264scTCR/IL-2 fusion protein.
[0031] FIG. 5A-FIG. 5B are graphs showing biological activity of
264scTCR/IL-2 fusion protein.
[0032] FIG. 6A, FIG. 6B, FIG. 6C, and FIG. 6D are graphs showing
conjugation of CTLL-2 cells with peptide-loaded T2 cells mediated
by 264scTCR/IL-2 fusion protein.
[0033] FIG. 7A, FIG. 7B, and FIG. 7C are graphs showing serum half
life of 264scTCR/IL-2 fusion protein.
[0034] FIG. 8 is a graph showing tumor cell staining with
264scTCR/IL-2 fusion protein.
[0035] FIG. 9 is a graph showing anti-tumor effect of 264scTCR/IL-2
fusion protein.
[0036] FIG. 10A and FIG. 10B are graphs showing staining of T2
cells loaded with non-specific p53 peptide (FIG. 10A) or specific
p53 peptide (FIG. 10B) with 264scTCR reagents.
[0037] FIG. 11A, FIG. 11B, FIG. 11C, and FIG. 11D are graphs
showing staining of tumor cells with various 264scTCR reagents and
secondary reagents.
[0038] FIG. 12A and FIG. 12B are graphs showing staining of fixed
A375 (FIG. 12A) or T2 cells (FIG. 12B) with 264scTCR/IgG1 and
CMVscTCR/IgG1 (control) reagents, with and without the addition of
competing soluble peptide-MHC molecules (labeled 264-Tet).
[0039] FIG. 13 is a series of photomicrographs showing staining
patterns of fixed tumor cell types (A375, HT29 and Saos2) for A2
and p53 antigens and with 264scTCR/IgG1 and CMVscTCR/IgG1 fusion
proteins.
[0040] FIG. 14 is a graph showing quantitative staining of T2 cells
reacted with 264scTCR/BirA tetramers.
[0041] FIG. 15 is a graph showing quantitative staining of T2 cells
reacted with 264scTCR/IgG1 fusion protein.
[0042] FIG. 16 is a graph showing numbers of complexes per cell
with increasing amounts of loaded p53 peptide, for cells reacted
with 264scTCR/BirA tetramer or 264scTCR/IgG fusions.
[0043] FIG. 17A and FIG. 17B are graphs showing quantitative
staining of A375 tumor cells reacted with 264scTCR/BirA tetramers
(FIG. 17A) or 264scTCR/IgG1 fusion protein (FIG. 17B).
[0044] FIG. 18 is a graph showing quantitative staining (number of
complexes per cell) of three tumor cell lines reacted with
264scTCR/BirA tetramers.
[0045] FIG. 19 is a graph as in FIG. 18 showing quantitative
staining of three tumor cell lines reacted with 264scTCR/IgG1
fusion protein.
[0046] FIG. 20 is three photomicrographs showing fixed sections of
A375 tumor stained with secondary antibody, CVMscTCR/IgG1 (control)
or 264TCR/IgG1 fusion protein, at 200.times..
[0047] FIG. 21 is three photomicrographs showing tumor sections as
in FIG. 20, at higher magnification (400.times.).
DETAILED DESCRIPTION
[0048] As discussed, the invention generally involves a method for
detecting cells or tissue comprising a peptide antigen presented on
the cells or tissue in the context of an MHC complex. In one
embodiment, the invention includes contacting the cells or tissue
with at least one soluble TCR molecule or functional fragment
thereof under conditions that form a specific binding complex
between the presented peptide antigen and the soluble TCR or
fragment; washing the cells or tissue under conditions appropriate
to remove any soluble TCR molecule or fragment not bound to the
presented peptide antigen; and detecting the specific binding
complex as being indicative of cells or tissue comprising the
presented peptide antigen.
[0049] In general, preparation of the present soluble TCRs can be
accomplished by procedures disclosed herein and by recognized
recombinant DNA techniques. For example, preparation of plasmid
DNA, DNA cleavage with restriction enzymes, ligation of DNA,
introduction of DNA into a cell, culturing the cell, and isolation
and purification of the expressed protein are known techniques. See
generally Sambrook et al. in Molecular Cloning: A Laboratory Manual
(2d ed. 1989); and Ausubel et al. (1989), Current Protocols in
Molecular Biology, John Wiley & Sons, New York.
[0050] The general structure of a variety of soluble TCR constructs
and methods of making and using same have been disclosed in pending
U.S. application Ser. Nos. 08/813,781 and 08/943,086.
[0051] For instance, a particular soluble TCR is a heterodimer in
which transmembrane sequence in at least one of and preferably both
of the V chains has been deleted. However for convenience, it will
often be preferred to use single-chain ("sc-") constructs such as
those reported by the pending Ser. Nos. 08/813,781 and 08/943,086
applications.
[0052] Briefly stated, a single-chain ("sc-") TCR molecule includes
V-.alpha. and V-.beta. chains covalently linked through a suitable
peptide linker sequence. For example, the V-.alpha. chain can be
covalently linked to the V-.beta. chain through a suitable peptide
linker sequence fused to the C-terminus of the V-.alpha. chain and
the N-terminus of the V-.beta. chain. The V-.alpha. and V-.beta.
chains of the sc-TCR fusion protein are generally about 200 to 400
amino acids in length, preferably about 300 to 350 amino acids in
length, and will be at least 90% identical, and preferably 100%
identical to the V-.alpha. and V-.beta. chains of a
naturally-occurring TCR. By the term "identical" is meant that the
amino acids of the V-.alpha. or V-.beta. chain are 100% homologous
to the corresponding naturally-occurring TCR V-.beta. or V-.alpha.
chains.
[0053] As disclosed in the Ser. No. 08/943,086 application, the
V-.alpha. chain of the sc-TCR molecule can further include a
C-.beta. chain or fragment thereof fused to the C-terminus of the
V-.beta. chain. Further, the V-.alpha. chain can include a
C-.alpha. chain or fragment thereof fused to the C-terminus of the
V-.alpha. chain and the N-terminus of the peptide linker sequence.
Generally, in those fusion proteins including a C-.beta. chain
fragment, the fragment will have a length of approximately 50 to
130 amino acids and will usually not include the last cysteine
residue (at position 127 in the mouse or at position 131 in the
human) of the C-.beta. chain. For those fusion proteins comprising
a C-.alpha. chain, the length can vary between approximately 1 to
90 amino acids (i.e. the C-.alpha. chain up to but not including
the final cysteine). For example, in one embodiment, the fusion
protein includes a C-.alpha. chain fragment between about 1 to 72
amino acids starting from amino acid 1 to 72. In another
embodiment, the C-.alpha. chain fragment is between about 1 to 22
amino acids starting from the first amino acid to 22 (leucine). The
C-.alpha. chain fragment typically does not include any cysteine
resides except the C.sub..varies.90 variant which includes two cys
residues and the C.sub..varies.72 variant which includes one cys
residue. In most cases, choice of C.alpha. and C.beta. chain length
will be guided by several parameters including the particular V
chains selected and intended use of the soluble fusion
molecule.
[0054] As further disclosed by the Ser. No. 08/943,086 application,
additional sc-TCR proteins of the invention include e.g., two
peptide linker sequences, where the first peptide linker sequence
is fused between the C-terminus of the V-.alpha. chain and the
N-terminus of the V-.beta. chain. The C-terminus of the V-.beta.
chain can be fused to the N-terminus of a C-.beta. chain fragment.
The second peptide linker is then fused to the C-terminus of the
V-.beta. chain or C-.beta. chain fragment or, if desired, to a tag
molecule as explained below. In other illustrative embodiments,
sc-TCR proteins can be made by fusing the V-.beta. chain to the
V-.alpha. chain through a suitable peptide linker in which the
C-terminus of the V-.beta. chain or C-.beta. chain fragment thereof
and the N-terminus of the V-.alpha. chain are covalently
linked.
[0055] A soluble TCR protein according to the invention can include
one or more fused protein tags. In embodiments in which such tags
are "detectable", the soluble TCR will be referred to as being
"detectably labeled". For example, with respect to a soluble fusion
protein, a protein tag can be fused to the C-terminus of the sc-TCR
V-.beta. chain (or C-.beta. chain fragment). If desired, such
soluble TCR proteins can be fused to immunoglobin chains as has
been reported by the pending Ser. No. 08/943,086 application, and
further illustrated in Examples below.
[0056] Preferred soluble fusion proteins for use with the invention
are fully functional and soluble. By the term "fully functional" or
similar term is meant that the fusion protein specifically binds
ligand. Assays for detecting such specific binding are disclosed
herein and include standard immunoblot techniques such as Western
blotting. Functional fragments of such soluble TCRs are able to
bind antigen with at least 70% of the affinity of the corresponding
full-length TCR, preferably about 80% to 90% or more as determined
by Western blot or Surface Plasma Resonance analysis.
[0057] The nucleic acid and protein sequences of suitable TCR
chains have been disclosed. See e.g., Fundamental Immunology,
(1993) 3.sup.rd Edi. W. Paul. Ed. Rsen Press Ltd. New York; and
Kabat, E. A., et al., (1991) Sequences of Proteins of Immunological
Interest (5.sup.th Ed.) Public Health Services, National Institutes
of Health. See also the pending Ser. Nos. 08/813,781 and 08/943,086
applications as well as the Examples that follow.
[0058] In a particular embodiment of the invention, the method
further includes contacting the cells or tissue with at least one
blocking agent. The contacting step can be performed at any point
in the method including before, during or after step a) to reduce
non-specific binding between the soluble TCR or fragment and the
cells. The invention is compatible with use of nearly any standard
blocking agent such as peroxide, serum protein, antibody or an
antigen-binding fragment thereof.
[0059] In certain embodiments, it will often be useful to confirm
the binding specificity of the TCR to the MHC complex on the cells
or tissues to be detected. In such instances, the invention can
further include contacting the specific complex (formed between the
soluble TCR and the MHC complex residing on the cells or tissue)
with a competing MHC (or HLA) molecule or fragment thereof under
conditions that compete with and specifically bind the soluble TCR
or fragment bound to the complex. A variety of suitable MHC
molecules have been disclosed.
[0060] In one embodiment of the method, specific binding of the
soluble TCR or fragment is reduced or essentially eliminated by the
addition of a competing MHC molecule or fragment thereof, such that
the soluble TCR or fragment is bound to the competing MHC molecule
or fragment thereof to form a competition complex. In one
particular embodiment of the method, the competing MHC molecule is
added at a range of concentrations between a 0.01 to 1000 fold, or
preferably a 1 to 100 fold, molar excess over the soluble TCR. In
another embodiment, the competing MHC molecule is added at a single
concentration (i.e. 1-fold, 10 fold, or 100-fold molar excess over
the soluble TCR) sufficient to reduce specific binding of the
soluble TCR. If desired, that competition complex can be detected
and binding specificity of the MHC molecule or the soluble TCR
determined by one or a combination of conventional strategies.
Particular MHC molecules or fragments can be single-chain but in
most instances will be soluble heterodimeric molecules such as
those disclosed in U.S. Pat. Nos. 5,869,270; 6,309,645; and pending
application Ser. No. 09/848,164. See also PCT application
PCT/US95/09816 for additional disclosure, as well as the Examples
provided below. Typical MHC molecules or fragments will be loaded
with peptide antigen.
[0061] See also the following published U.S. Patent applications
for disclosure relating to other soluble TCR and MHC molecules that
can be used to practice the invention: 20020198144; 20020091079;
20020034513; 20030171552; 20030144474; 20030082719; and references
cited therein.
[0062] In a typical method in which confirmation of binding
specificity is desired, the TCR molecule or fragment is
detectably-labeled with one or more tags. Suitable tags include EE
or myc epitopes which are specifically bound by commercially
available monoclonal antibodies. In general, a wide variety of
epitopes capable of being specifically bound by an antibody, e.g.,
a monoclonal antibody, are capable of serving as a protein tag.
Other suitable synthetic matrices include those with a bound
antibody capable of specifically binding the molecules. Further
tags include those with an enterokinase, Factor Xa, snake venom or
thrombin cleavage site. See e.g., published PCT application WO
96/13593.
[0063] Other suitable tags for detectably-labeling the TCR
molecules or fragments include biotin, streptavidin, a cell toxin
of, e.g., plant or bacterial origin such as, e.g., diphtheria toxin
(DT), shiga toxin, abrin, cholera toxin, ricin, saporin,
pseudomonas exotoxin (PE), pokeweed antiviral protein, or gelonin.
Biologically active fragments of such toxins are well known in the
art and include, e.g., DT A chain and ricin A chain. Additionally,
the toxin can be an agent active at the cell surface such as, e.g.,
phospholipase enzymes (e.g., phospholipase C). See e.g., Moskaug,
et al. J. Biol. Chem. 264, 15709 (1989); Pastan, I. et al. Cell 47,
641, 1986; Pastan et al., Recombinant Toxins as Novel Therapeutic
Agents, Ann. Rev. Biochem. 61, 331, (1992); "Chimeric Toxins"
Olsnes and Phil, Pharmac. Ther., 25, 355 (1982); published PCT
application no. WO 94/29350; published PCT application no. WO
94/04689; and U.S. Pat. No. 5,620,939 for disclosure relating to
making and using proteins comprising effectors or tags. An example
of a tag that performs a biotin acceptor function is a BirA tag, as
described in Beckett, D. et al. Protein Sci. 1999 April;
8(4):921-9. As further described in Examples below, a BirA tag
sequence can be included in a TCR molecule to promote biotinylation
of the protein. Further, a tag can be a chemotherapeutic drug such
as, e.g., vindesine, vincristine, vinblastin, methotrexate,
adriamycin, bleomycin, or cisplatin.
[0064] Additionally, a tag can be a radionuclide or chelate,
suitable for diagnostic or imaging studies such as iodine-131,
yttrium-90, rhenium-188, iodine-123, indium-111, technetium-99m,
gallium-67, thallium-201, or bismuth-212. Among the radionuclides
used, gamma-emitters, positron-emitters, x-ray emitters and
fluorescence-emitters are suitable for localization, while
beta-emitters and alpha-emitters may also be used. Other suitable
radioisotopes for the methods of the present invention include but
are not limited to, cadmiun-109, actinium-225, actinium-227,
astatine-211, iodine-125, iodine-126, iodine-133, dysprosium-165,
dysprosium-166, bismuth-212, bismuth-213, bromine-77, indium-113m,
gallium-67, gallium-68, ruthenium-95, ruthenium-97, ruthenium-101,
ruthenium-103, ruthenium-105, mercury-107, mercury-203,
rhenium-186, rhenium-188, tellurium-99m, tellurium-121m,
tellurium-122m, tellurium-125m, thulium-165, thulium-167,
thulium-168, fluorine-18, silver-111, platinum-197, palladium-109,
copper-67, phosphorus-32, phosphorus-33, yttrium-90, scandium-47,
samarium-153, lutetium-177, rhodium-105, praseodymium-142,
praseodymium-143, promethium-149, terbium-161, holmium-166,
gold-198, gold-199, cobalt-57, cobalt-58, chromium-51, iron-59,
selenium-75, and ytterbium-169. Preferably the radioisotope will
emit in the 10-5,000 key range, more preferably 50-1,500 key, most
preferably 50-500 key.
[0065] Suitable positron emitters and other useful radionuclides
include, but are not limited to, .sup.11C, .sup.13N, .sup.15O,
.sup.18F, .sup.51Mn, .sup.52Fe, .sup.55Co, .sup.60Cu, .sup.61Cu,
.sup.62Cu, .sup.64Cu, .sup.62Zn, .sup.63Zn, .sup.70AS, .sup.71AS,
.sup.72AS, .sup.76Br, .sup.82Rb, .sup.86Y, .sup.89Zr, .sup.94mTC,
.sup.110In, .sup.120I, .sup.124I, .sup.122Xe, .sup.128Ba,
.sup.131Ba, .sup.7Be, .sup.204Bi, .sup.205Bi, .sup.206Bi, .sup.14C,
.sup.36Cl, .sup.48Cr, .sup.51Cr, .sup.155Eu, .sup.153Gd, .sup.66Ga,
.sup.72Ga, .sup.3H, .sup.115mIn, .sup.189Ir, .sup.191mIr,
.sup.192Ir, .sup.194Ir, .sup.55Fe, .sup.59Fe, .sup.119mOs,
.sup.42K, .sup.226Ra, .sup.186Re, .sup.188Re, .sup.82mRb,
.sup.46Sc, .sup.47Sc, .sup.72Se, .sup.105Ag, .sup.22Na, .sup.24Na,
.sup.89Sr, .sup.35S, .sup.38S, .sup.177Ta, .sup.96Tc, .sup.201Tl,
.sup.202Tl, .sup.113Sn, .sup.117mSn, .sup.121Sn, .sup.166Yb,
.sup.174Yb, .sup.88Y, .sup.90Y, .sup.62Zn and .sup.65Zn.
[0066] Suitable chelates include, but are not limited to,
diethylenetriamine pentaacetic acid (DTPA),
1,4,7,10-tetraazacyclotetradecane-1,4,7,10-tetraacetic acid (DOTA),
1-substituted 1,4,7, -tricarboxymethyl 1,4,7,10
teraazacyclododecane triacetic acid (DO3A),
ethylenediaminetetraacetic acid (EDTA), and
1,4,8,11-tetraazacyclotetradecane-1,4,8,11-tetraacetic acid (TETA).
Additional chelating ligands are
ethylenebis-(2-hydroxy-phen-ylglycine) (EHPG), and derivatives
thereof, including 5-C1-EHPG, 5Br-EHPG, 5-Me-EHPG, 5t-Bu-EHPG, and
5 sec-Bu-EHPG; benzodiethylenetriamine pentaacetic acid
(benzo-DTPA) and derivatives thereof, including dibenzo-DTPA,
phenyl-DTPA, diphenyl-DTPA, benzyl-DTPA, and dibenzyl DTPA; bis-2
(hydroxybenzyl)-ethylene-diaminediacetic acid (HBED) and
derivatives thereof; the class of macrocyclic compounds which
contain at least 3 carbon atoms, more preferably at least 6, and at
least two heteroatoms (O and/or N), which macrocyclic compounds can
consist of one ring, or two or three rings joined together at the
hetero ring elements, e.g., benzo-DOTA, dibenzo-DOTA, and
benzo-NOTA, where NOTA is 1,4,7-triazacyclononane
N,N',N''-triacetic acid, benzo-TETA, benzo-DOTMA, where DOTMA is
1,4,7,10-tetraazacyclotetradecane-1,4,7,10-tetra(methyl tetraacetic
acid), and benzo-TETMA, where TETMA is
1,4,8,11-tetraazacyclotetradecane-1,4,8,11-(methyl tetraacetic
acid); derivatives of 1,3-propylenediaminetetraacetic acid (PDTA)
and triethylenetetraaminehexaacetic acid (TTHA); derivatives of
1,5,10-N,N',N''-tris(2,3-dihydroxybenzoyl)-tricatecholate (LICAM)
and 1,3,5-N,N',N''-tris(2,3-dihydroxybenzoyl) aminomethylbenzene
(MECAM).
[0067] Other suitable tags include polyhistidine, fluorescent
label, chemiluminescent label, nuclear magnetic resonance active
label, chromophore label, positron emitting isotope detectable by a
positron emission tomography ("PET") scanner, enzymatic markers
such as beta-galactosidase and peroxidase including horse radish
peroxidase, a nanoparticle, a paramagnetic metal ion, a contrast
agent or an antigenic tag.
[0068] A suitable fluorescent label could include, but is not
limited to, a .sup.152Eu label, a fluorescein label, an
isothiocyanate label, a rhodamine label, a phycoerythrin label, a
phycocyanin label, an allophycocyanin label, an o-phthaldehyde
label, a Texas Red label, a fluorescamine label, a lanthanide
phosphor label, a fluorescent protein label, for example a green
fluorescent protein (GFP) label, or a quantum dot label. Examples
of chemiluminescent labels include a luminal label, an isoluminal
label, an aromatic acridinium ester label, an imidazole label, an
acridinium salt label, an oxalate ester label, a luciferin label, a
luciferase label, an aequorin label, etc.
[0069] Suitable paramagnetic metal ions include, but are not
limited to, Mn.sup.2+, Cu.sup.2+, Fe.sup.2+, Co.sup.2+, Ni.sup.2+,
Gd.sup.3+, Eu.sup.3+, Dy.sup.3+, Pr.sup.3+, Cr.sup.3+, Co.sup.3+,
Fe.sup.3+, Ti.sup.3+, Tb.sup.3+, Nd.sup.3+, Sm.sup.3+, Ho.sup.3+,
Er.sup.3+, Pa.sup.4+, and Eu.sup.2+.
[0070] Enzyme markers that may be used include any readily
detectable enzyme activity or enzyme substrate. Such enzymes
include malate dehydrogenase, staphylococcal nuclease,
delta-5-steroid isomerase, alcohol dehydrogenase, aglycerol
phosphate dehydrogenase, triose phosphate isomerase, peroxidase,
alkaline phosphatase, asparaginase, glucose oxidase,
beta-galactosidase, ribonuclease, urease, catalase,
glucose-6-phosphate dehydrogenase, glucoamylase, acetylcholine
esterase, luciferase, and DNA polymerase.
[0071] Suitable nanoparticles include, but are not limited to,
solid colloidal particles, dendrimers, liposomes, micelles, ceramic
particles, alumina capsules, emulsifying wax or Brij 72 particles,
ferromagnetic particles, gold or silver particles, biodegradable
particles comprising poly(lactic-co-glycolic) acid, polyglycolic
acid, poly D- or L-lactic acid, polycaprolactone or serum albumin
and particles comprising poly(vinyl pyrrolidone), polystyrene,
polyacrylamide, or poly(butyl cyanoacrylate) or derivative thereof.
In some applications of the invention, nanoparticles coated with
agents such a polyethylene glycol, polysaccharide, polypeptides,
lipids, silica, etc. can be used. Such coated nanoparticles may
have improved absorbance, bioavailability, tissue distribution,
tissue cross-reactivity, toxicity, pharmacokinetics/dynamics, or
tumor localization. Methods for attaching targeting ligands to
nanoparticles have been described that can be applied to soluble
TCR-based reagents (see, for example, Nob et al. 2004. J Pharm Sci.
93:1980-92).
[0072] The soluble TCRs of the invention include monomeric and
multimeric TCRs. Multimeric TCR molecules include those in which
the TCR protein is fused to polypeptide domains or tags that
facilitate multimerization. Such domains include immunoglobin,
leucine zipper, helix-turn-helix, and barrel-barrel motifs that
facilitate protein dimerization. Such tags include antibody-binding
epitopes, streptavidin-binding peptides, 6xHis motif, biotin ligase
target motif, and the like. Multimeric TCR molecules also include
those generated through chemically crosslinking reactive amino
acids or polysaccharides. Such amino acids (or polysaccharides) can
be inherent in the TCR structure or can be added through genetic
modification. Multimeric TCRs also include those generated through
attachment to another molecule (or molecules) that may or may not
include a detectable label as described herein. Such attachment
molecules include streptavidin, biotin, antibodies, protein A or
scaffolds that include protein-, lipid- and polysaccharide-coated
or uncoated beads, nanoparticles, solid-phase surfaces, arrays,
matrices, as described. For example, in various embodiments in
which the detectable label is biotin, the method further comprises
combining the TCR molecule with streptavidin to multimerize the TCR
molecule.
[0073] It will be appreciated that any one of the tags disclosed
herein can be used to detectablylabel the soluble TCRs used in the
invention method, particularly to detect the cells or tissue
expressing the peptide antigen of interest.
[0074] It is an object of the invention to provide peptide antigen
detection methods that perform using cells or tissue contacted with
a denaturing agent sufficient to "fix" the cells or tissue.
Examples of such agents are known in the field and include
formaldehyde (formalin), glutaraldehyde, alcohols such as methanol,
proponal, etc, and organic solvents such as benzene and xylene. As
has been discussed, it has been found that the invention methods do
not substantially disturb interaction between the MHC molecule on
the cells and its cognate peptide antigen even when the cells or
tissue are fixed. Thus, the invention can be used on fixed cells or
tissue, thereby helping to preserve structural integrity and
enhancing reliability of the method.
[0075] Accordingly, and in one embodiment, the invention further
comprises contacting the cells or tissue with at least one
denaturing agent. Such contact can be performed at nearly any time
including before step a) and denaturing (fixing) the cells or
tissue.
[0076] As also discussed, the invention is compatible with use of
cells or tissue in an array such as what is referred to in the
field as a histoarray. That is, the invention has the sensitivity
and reliability needed to screen cell or tissue samples (such as
those encountered in a clinic) in a repetitive fashion. Many such
arrays are known in the field such as those described by U.S. Pat.
Nos. 6,466,690; 4,384,193; 6,602,661; 6,594,432; 6,566,063;
6,406,840; 6,246,785; and references cited therein.
[0077] Accordingly, and in one embodiment, the method of the
present invention further includes placing a plurality of cells or
tissue in an array. Preferably, such cells or tissues are known or
suspected of including (or consisting of) tumor cells. The method
can be performed in each element of the array comprising cells or
tissue. If desired, the method is performed substantially
simultaneously in each element of the array. In one embodiment, the
step c) of the method further includes scanning the array and
generating image signals indicative of presence of the specific
binding complex. If needed, that step can further include
outputting the signals in real-time to a user and optionally
indexing stored images of the image signal.
[0078] The invention can be used to detect a wide variety of
peptide antigens including those referred to as tumor-associated
peptide antigens or TAAs. Cells or tissues may be suspended,
semi-suspended, or fixed according to the method.
[0079] As discussed, the soluble TCR molecule or fragment can
include at least one single-chain TCR or it may be a heterodimeric
construct such as those that have been manipulated recombinantly to
remove transmembrane domains. See the pending Ser. Nos. 08/813,781
and 08/943,086 applications as well as the Examples that follow.
Such soluble TCR molecules or fragments can be detectably labeled
by one or a combination of strategies as outlined herein including
labeling with biotin, streptavidin, an enzyme or catalytically
active fragment thereof, radionuclide, or a fluorescent,
phosphorescent, or chemiluminescent molecule. Examples include the
well-known green (or red) fluorescent protein or fragments
thereof.
[0080] In certain embodiments, the soluble TCR is a single-chain
TCR which molecule is covalently bound to at least one cytokine.
Examples of such cytokines include, but are not limited to, IL-2,
colony stimulating factors such as GM-CSF, IFN.gamma., IFN-.alpha.
and the like. As an example, the soluble TCR molecule or fragment
is a single-chain TCR that includes at least one and preferably one
covalently bound cytokine or fragment thereof.
[0081] In certain other variations, the soluble TCR is a single
chain TCR or fragment that includes at least one covalently bound
immunoglobulin domain or fragment thereof. In some embodiments the
single chain TCR or fragment is fused to sequence comprising an
IgG1 domain or fragment.
[0082] In yet another embodiment, the MHC complex is HLA-A2
restricted.
[0083] It will often be useful to include a control with the
method, for example, by detecting any binding between the soluble
TCR or fragment to cells that do not comprise the peptide
antigen.
[0084] A particular peptide antigen for use with the invention
includes p53 (aa 149-157) or p53 (aa 264-272).
[0085] The present invention methods can be performed in vivo, ex
vivo, or in vitro.
[0086] For instance, HLA typing (see, e.g., A. K. Abbas, Cellular
and Molecular Immunology, page 328 (W.B. Saunders Co. 1991) can be
practiced with the invention. For in vivo imaging applications, the
soluble TCR will desirably include a radionuclide (e.g., 125I, 32P,
99Tc) or other detectable tag which can be administered to a mammal
and the subject scanned by known procedures for binding of the TCR
or fragment thereof. Such an analysis of the mammal could aid in
the diagnosis and treatment of a number of disorders including e.g.
undesired expression of APCs accompanying immune system disorders
and cancer.
[0087] The invention can also be used for in vivo imaging of tumors
bearing tumor-associated peptide antigens in a subject having or
suspected of having such a tumor. In the practice of this method, a
composition is administered to the subject that comprises a
detectably labeled soluble TCR molecule or fragment thereof that
specifically binds the tumor-associated peptide antigen in the
context of a peptide/MHC complex on the tumor. The composition is
administered in vivo for a period of time sufficient to permit its
accumulation at the tumor site. The accumulated composition is then
detected so as to image the tumor.
[0088] The composition comprising the TCR can be administered
parenterally (such as intravenously, intramuscularly,
subcutaneously, intratumorally, etc.) at a locus and/or by a route
providing access to the tissue, organ or cells of interest. In
other applications, the composition comprising the TCR can be
administered intranasally, orally or transdermally.
[0089] The accumulated composition of the soluble TCR can be
detected by a variety of means. These include detection by a
detector selected from the group consisting of a conventional
scintillation camera, a gamma camera, a rectilinear scanner, a PET
scanner, a SPECT scanner, a MRI scanner, a NMR scanner, an
ultrasound machine, an X-ray machine, a luminescence imaging
system, and a fluorescence imaging system.
[0090] The imaging methods of the present invention further
encompass pretargeting methods which in some applications may
improve the detection of a tumor cell or tissue. This approach uses
a multi-step protocol. For example, a targeting TCR is conjugated
with either avidin or biotin and then is administered, for example
by injection, whereupon it localizes in the tumor of interest.
Thereafter, either biotin or avidin (depending on which was coupled
to the targeting antibody), bearing a label, is injected and
becomes localized at the site of the primary antibody by binding to
avidin or biotin respectively. Alternatively other pairs of
interacting molecules can substitute the biotin/streptavidin
molecules. Several pretargeting approaches have been developed for
antibodies (see Chang et al 2002. Mol. Cancer Therap. 1:553-563)
that could be used to pretarget TCR-based reagents.
[0091] The invention can also be employed in applications that
involve fluorescence activated cell sorting (FACS). FACS can be
used to detect interactions between the soluble TCRs or fragments
thereof and target cells. For example, the soluble TCR can be
biotinylated in accordance with standard methods and combined with
streptavidin-phycoerythrin (PE) to form labeled sc-TCR tetramers,
for instance. However, as mentioned multimerization will often not
be needed. FACS can be used to qualitatively measure the
interaction of the soluble TCR and a suitable target cell such as
T2 cells and tumor cell lines.
[0092] The following Examples show the construction and
characterization of a novel fusion protein comprising a soluble
single chain HLA-A2.1 restricted TCR that recognizes an unmutated
p53 peptide spanning p53 amino acid residues 264-272, genetically
linked to human IL-2. The peptide specific binding of the TCR
portion of the molecule to peptide loaded HLA-A2 as well as the
specific IL-2 receptor binding capability and bioactivity of the
IL-2 portion of the molecule was investigated. The Examples show
that these types of TCR based fusion proteins can serve as an
alternative to antibody based targeted tumor therapies or as an
addition to other targeted tumor therapies such as antibody based
immunocytokines. Separate and distinct approaches to targeting a
tumor may demonstrate additive or synergistic antitumor
effects.
[0093] The Examples further show construction and expression of a
soluble three domain mouse scTCR which recognizes human p53 peptide
(aa 264-272) in the context of HLA-A2.1. The three domain scTCR is
fused to human IL-2 yielding a soluble 264scTCR/IL-2 fusion protein
which is expressed at high levels and secreted from mammalian
cells. The TCR portion of the 264scTCR/IL-2 fusion protein retains
its MHC-restricted, peptide specific antigen binding properties,
and the IL-2 portion binds to IL-2 receptor and is biologically
active. Moreover, the Examples further show that this fusion
protein is capable of conjugating target and effector cells,
exhibits favorable pharmacokinetics in mice, can bind to target
tumor cells and has anti-tumor effects. Therefore, soluble scTCR
fusion proteins will provide access to another repertoire of
antigens for targeted immunotherapy, which are not recognizable by
antibody based immunotherapies. TCR-based therapies will serve as
an alternative to antibody based treatments or as a useful addition
to other targeted tumor therapies.
[0094] The present disclosure shows that soluble TCR has sufficient
affinity for peptide antigen to allow good detection. In
particular, the affinity of the 264scTCR is sufficient to bind to
unmanipulated tumor cells and effectively conjugate target and
effector cells.
[0095] A reported problem surrounding systemic administration of
cytokines to treat tumors is the short serum half life and toxicity
of these proteins. Importantly, the 264scTCR/IL-2 fusion protein of
the invention has an apparent serum half life of about 3 hours and
appears to remain intact in the blood. Thus, the 264scTCR/IL-2
fusion protein effectively increases the half life of IL-2 and
survives intact in the blood, suggesting that it is a new agent for
immunomodulatory cancer therapy. At higher doses than used in the
Example, the serum half life of the present fusion protein should
increase [3, 25, 37, 38], thereby further improving the efficacy of
the molecule against tumors.
[0096] There is recognition that IL-2 concentrated at the tumor
site should activate local T-cells as well as other IL-2 responsive
cells, thereby recruiting effector cells to the site of the tumor.
Thus, by concentrating IL-2 at the site of a tumor, the present TCR
fusion molecules may help potentiate a robust immune response
including activation and proliferation of a variety of T-cell
clones as well as activation of NK cells or other members of the
innate immune system. Such a multifaceted anti-tumor response will
be more effective for the eradication of primary tumors as well as
distant metastases.
[0097] The data show that it is possible to construct a
biologically active bi-functional molecule comprised of a TCR and a
cytokine. This fusion protein is capable of binding to tumor cells,
mediating the conjugation of target and effector cells, and has
reasonable pharmacokinetic properties. Besides p53, other gene
products that are upregulated and presented in the context of MHC
on tumor or virally infected cells may be used as targets for the
present TCR-based immunotherapies. Further, other immunomodulatory
molecules such as GM-CSF, IFN.gamma., or IFN-.alpha. can be linked
to the TCR to activate other effector cells for an anti-tumor or
anti-viral response. These novel TCR fusions will form a new class
of immunotherapeutics for the treatment of cancer and viral
infection.
[0098] By the term "specific binding" or a similar term is meant a
molecule disclosed herein which binds another molecule, thereby
forming a specific binding pair. However, the molecule does not
recognize or bind to other molecules as determined by, e.g.,
Western blotting ELISA, RIA, mobility shift assay, enzyme-immuno
assay, competitive assays, saturation assays or other protein
binding assays know in the art. See generally, Ausubel, et al
supra; Harlow and Lane in, Antibodies: A Laboratory Manual (1988)
and references cited therein for examples of methods for detecting
specific binding between molecules.
[0099] By the term "fully soluble" or similar term as it is meant
to describe a TCR is meant that it is not readily sedimented under
low G-force centrifugation from an aqueous buffer e.g., cell media.
Further, a sc-TCR fusion protein is soluble if the fusion protein
remains in aqueous solution at a temperature greater than about
5-37.degree. C. and at or near neutral pH in the presence of low or
no concentration of an anionic or non-ionic detergent. Under these
conditions, a soluble protein will often have a low sedimentation
value e.g., less than about 10 to 50 svedberg units. Aqueous
solutions referenced herein typically have a buffering compound to
establish pH, typically within a pH range of about 5-9, and an
ionic strength range between about 2 mM and 500 mM. Sometimes a
protease inhibitor or mild non-ionic detergent is added and a
carrier protein may be added if desired such as bovine serum
albumin (BSA) to a few mg/ml. Exemplary aqueous buffers include
standard phosphate buffered saline, Tris-buffered saline, or other
known buffers and cell media formulations.
[0100] The following non-limiting examples are illustrative of the
invention.
Example 1--Generation of TCR Fusion Protein Constructs
[0101] A fusion protein comprising a three domain, HLA-A2.1
restricted mouse TCR specific for a p53 peptide antigen fused to
human IL-2 was made. For this TCR fusion protein construct, the Va
and V0/C0 regions were generated by RT-PCR from RNA isolated from a
mouse T cell clone that produces TCRs specific for human p53 (aa
264-272) peptide. The carboxyl-terminal end of the variable region
of the TCRa chain (Va3) was fused via a flexible linker
(G.sub.4S).sub.4 (SEQ ID NO: 17) [21] to the N-terminus of the V0
(V133) to generate the antigen binding portion of the TCR. The C0
domain, which is directly linked to the V0 domain, was truncated at
the amino acid residue just prior to the final cysteine, removing
the transmembrane and cytoplasmic domains, to generate a soluble
single-chain TCR molecule (FIGS. 1A and 1B). Human IL-2 was fused
to the TCR portion via a short linker (amino acid sequence
VNAKTTAPSVYPLAPV; SEQ ID NO:1). An EE tag (amino acid sequence
EEEEYMPME; SEQ ID NO:2) [11] was inserted just downstream of the
IL-2 portion of the fusion molecule to allow for detection of the
TCR/IL-2 fusion protein by an anti-EE tag mAb [11] if desired.
Mammalian cell expression is driven by a CMV promoter, secretion is
directed by an antibody light chain leader, and selection was
carried out by G418 resistance.
[0102] FIG. 1 is explained in more detail as follows. 1A) Schematic
representation of the domain structure of the 264scTCR/IL-2 fusion
protein. 1B) Amino acid sequence of 264scTCR/IL-2 fusion protein.
Amino acid numbers for each domain of the fusion protein are
indicated in the figure.
Example 2--Expression of TCR/IL-2 Fusion Protein in Mammalian
Cells
[0103] To characterize the 264scTCR/IL-2 fusion protein, the
264scTCR/IL-2 construct was stably transfected into CHO-K1 cells.
Stable transfectants secreting 264scTCR/IL-2 fusion protein were
selected using ELISA assays as described in Materials and Methods.
Positive signals for these ELISAs indicate that the transfected
cells secrete 264scTCR/IL-2 fusion protein that is recognized by
both anti-murine TCR and anti-human IL-2 antibodies suggesting that
the secreted 264scTCR/IL-2 is properly assembled and folded in the
transfected cells and that it remains intact when it is secreted
from the cells.
[0104] 264scTCR/IL-2 fusion protein was purified from cell
supernates by immunoaffinity chromatography with a yield of
approximately 1.8 mg/l of supernate. Purified fusion protein was
subjected to SDS-PAGE and Coomassie staining. Under either reducing
or non-reducing conditions, the predominant stained band migrated
at approximately 60 kDa (FIG. 2), which is consistent with the
predicted molecular mass for this protein and indicates that the
fusion protein remains intact with no unexpected intramolecular
disulfide bonds when it is secreted from the cells. The larger band
in the nonreducing gel may be a dimer form of the fusion protein.
This conclusion is based on the observation that the larger band
has the apparent molecular mass approximately twice that of the
fusion protein and this band is reduced to the size of the fusion
protein under reducing conditions. The data indicate that the
transfected CHO cells produce 264scTCR/IL-2 fusion protein of the
expected molecular mass and that it is properly folded, assembled,
and secreted as a soluble fusion protein.
[0105] FIG. 2 is explained in more detail as follows. CHO cells
were stably transfected with the 264scTCR/IL-2 expression vector.
The secreted fusion protein was purified by immunoaffinity
chromatography and subjected to SDS-PAGE under either reducing or
non-reducing conditions as indicated at the top of the figure.
SDS-PAGE gels were stained with Coomassie brilliant blue.
Example 3--MHC/Peptide Binding Ability of the TCR Portion of the
264scTCR/IL-2 Fusion Protein
[0106] The ability of the 264scTCR/IL-2 fusion protein to bind to
peptide loaded MHC was determined by flow cytometry. T2 cells were
loaded with p53 (aa 264-272) or p53 (aa 149-157) (control) peptide
and stained with 264scTCR/IL-2 fusion protein. Cells loaded with
p53 (aa 264-272) stained positively with 264scTCR/IL-2 when
detected with either the anti-TCR C.beta. mAb or the anti-IL-2
detection antibody (FIGS. 3A and 3B). Cells loaded with p53 (aa
149-157) control peptide did not stain with either the anti-TCR
C.beta. mAb or the anti-IL-2 detection antibodies. To demonstrate
that the lack of staining of p53 (aa 149-157) loaded T2 cells is
not due to an inability of the p53 (aa 149-157) peptide to bind to
HLA-A2, T2 cells loaded with no peptide, p53 (149-157), or p53
(264-272) peptide were stained with BB7.2 .alpha.-HLA-A2 monoclonal
antibody. Cells loaded with either p53 peptide stained stronger
than cells loaded with no peptide, suggesting that both peptides
are capable of binding to HLA-A2 molecules (FIG. 3C). T2 were also
stained for IL-2 receptor and were found not to express IL-2
receptor; thus, these data indicate that binding of the
264scTCR/IL-2 fusion protein is mediated by the TCR component of
the fusion protein. The lack of staining by the fusion protein when
T2 cells were loaded with the control peptide also indicates that
staining is mediated by the TCR component and that the staining is
specific for the appropriate peptide. These data indicate that the
TCR portion of the 264scTCR/IL-2 fusion protein is capable of
recognizing its specific peptide in the context of HLA-A2.
[0107] FIG. 3 is explained more fully as follows. T2 cells were
loaded with p53 (aa 264-272) peptide (gray line) or p53 (aa
149-157) peptide (black line), and stained with either 3A)
264scTCR/IL-2 fusion protein and anti-TCR C.beta. mAb or 3B)
264scTCR/IL-2 fusion protein and anti-IL-2 mAb. 3C): T2 cells
loaded with p53 (aa 264-272) peptide (dark grey line), p53 (aa
149-157) peptide (light grey line), or no peptide (black line) were
stained with anti-HLA-A2 BB7.2 mAb followed by FITC labeled goat
anti-mouse IgG. The shaded peak is unstained T2 cells.
Example 4-IL-2 Receptor Binding Ability of the IL-2 Portion of the
264scTCR/IL-2 Fusion Protein
[0108] The IL-2 receptor binding capability of the IL-2 portion of
the 264scTCR/IL-2 fusion protein was studied by flow cytometry.
Primary mouse splenocytes were isolated and stimulated with rIL-2
and anti-CD3 to generate T cell blasts. Stimulated splenocytes that
express IL-2 receptor stained positively with p53 (aa 264-272)
loaded HLA-A2 tetramers only in the presence of 264scTCR/IL-2
fusion protein (FIG. 4A). Likewise, CTLL-2 mouse cytotoxic T
lymphocytes, which constitutively express IL-2 receptor, stained
positively with the 264scTCR/IL-2 fusion protein but not with a
264scTCR/kappa fusion protein (FIG. 4B). When CTLL-2 cells were
incubated with .alpha.-human CD25 blocking antibody or isotype
control antibody followed by 264scTCR/IL-2, staining was
substantially reduced when the cells were incubated with the
blocking antibody but not with isotype control antibody. The lack
of signal from the CTLL-2 cells incubated with a 264scTCR/mouse
kappa chain fusion protein or with IL-2 receptor blocking antibody
indicates that staining of these cells is mediated by the IL-2
portion of the 264scTCR/IL-2 fusion protein. These data suggest
that the IL-2 portion of the 264scTCR/IL-2 fusion protein is
capable of binding to the IL-2 receptor.
[0109] FIG. 4 is explained in more detail as follows. 4A): Mouse
splenocytes were stimulated with IL-2 and anti-CD3.epsilon. mAb and
then incubated in the presence (gray line) or absence (black line)
of 264scTCR/IL-2 fusion protein. Bound fusion protein was detected
with PE labeled HLA-A2 p53 (aa 264-272) tetramers. 4B): CTLL-2
cells were incubated with .alpha.-human CD25 blocking antibody or
isotype control antibody followed by 264scTCR/IL-2 or
264scTCR/kappa fusion protein. Bound fusion protein was detected
with PE labeled .alpha.-TCR-V.beta.3 antibody. The shaded peak is
unstained CTLL-2 cells. Black line: CTLL-2 cells stained with
264scTCR/IL-2 only. Gray dotted line: CTLL-2 cells incubated with
control antibody followed by 264scTCR/IL-2. Light gray line: CTLL-2
cells incubated with .alpha.-human CD25 blocking antibody followed
by 264scTCR/IL-2. Dark gray line: CTLL-2 cells stained with
264scTCR/kappa fusion protein. Black dashed line: CTLL-2 cells
stained with .alpha.-TCR-V.beta..
Example 5-Biological Activity of 264scTCR/IL-2 Fusion Protein
[0110] To demonstrate biological activity of the IL-2 portion of
the 264scTCR/IL-2 fusion protein, IL-2 dependent CTLL-2 cells were
cultured with either 264scTCR/IL-2 or recombinant IL-2 at various
concentrations and cell viability was assessed using WST-1. As
shown in FIG. 5A, the ability of rIL-2 or 264scTCR/IL-2 to support
the growth of CTLL-2 cells was dose dependent, wherein there was
more cell proliferation at higher doses of either recombinant IL-2
or 264scTCR/IL-2. Further, there were similar levels of cell
proliferation when equivalent molar amounts of either recombinant
IL-2 or 264scTCR/IL-2 were used. As a further control for
specificity, CTLL-2 cells were incubated with 264scTCR/IL-2 with
.alpha.-human CD25 blocking antibody or isotype control. When the
blocking antibody was included in the culture, proliferation was
substantially decreased with both concentrations of blocking
antibody, but proliferation of the CTLL-2 cells was unaffected by
either concentration of control antibody (FIG. 5B). The data
indicate that the IL-2 portion of 264scTCR/IL-2 has similar
biological activity to recombinant IL-2 in vitro and that the
proliferation activity of the fusion protein is dependent on the
IL-2 portion of the molecule.
[0111] The dissociation constant of the 264scTCR for its cognate
MHC/peptide has been found to be approximately 10.sup.-7 M at
physiological conditions using surface plasmon resonance
detection.
[0112] FIG. 5 is explained more fully as follows. 5A): CTLL-2 cells
were cultured with 264scTCR/IL-2 (solid line) or recombinant IL-2
(dotted line) at various concentrations as indicated at the bottom
of the figure. 5B): CTLL-2 cells were incubated with 264scTCR/IL-2
and .alpha.-human CD25 blocking antibody or isotype control
antibody as indicated at the bottom of the figure. Cell viability
was measured by incubation with WST-1 and absorbance was read at
450 nm. Cab+5: 5 .mu.g control antibody; Cab+50: 50 .mu.g control
antibody; Bab+5: 5 .mu.g blocking antibody; Bab+50: 50 .mu.g
blocking antibody.
Example 6--Conjugation of Cells Mediated by 264scTCR/IL-2 Fusion
Protein
[0113] A useful property for the 264scTCR/IL-2 fusion protein would
be capacity to bring together target and effector cells through its
TCR and cytokine portions, respectively. To demonstrate that the
264scTCR/IL-2 fusion protein can effectively conjugate cells, T2
cells were loaded with either p53 (aa 264-272) or p53 (aa 149-157)
peptides and then labeled with dihydroethidium (HE). CTLL-2 cells
were labeled with calcein AM and the two labeled cell populations
were mixed and incubated in the presence or absence of
264scTCR/IL-2 fusion protein. Samples were analyzed by flow
cytometry. When the two cell populations were incubated in the
absence of the 264scTCR/IL-2 fusion protein (FIGS. 6A and 6B) or
when the T2 cells were loaded with control peptide and incubated
with the CTLL-2 cells in the presence of 264scTCR/IL-2 fusion
protein (FIG. 6C), the cells remained as two distinct populations
on the flow cytometry histograms representing approximately 45% of
the total population each (FIGS. 6A, 6B, and 6C, regions 1 and 3)
with only approximately 0.46% of the total population falling in
the double stained cell window (FIGS. 6A, 6B, and 6C, region 2).
However, when the T2 cells were loaded with p53 (aa 264-272)
peptide and incubated with the CTLL-2 cells in the presence of the
264scTCR/IL-2 fusion protein (FIG. 6D), a double staining
population of cells appears, representing 4.1% of the total
population (FIG. 6D, region 2, conjugated cells), suggesting that
T2 cells were conjugated to CTLL-2 cells via the 264scTCR/IL-2
fusion protein.
[0114] FIG. 6 is explained in more detail as follows. T2 cells were
loaded with either p53 (aa 264-272) (6B and 6D) or p53 (aa 149-157)
(control) peptides (6A and 6C) and then labeled with HE. CTLL-2
cells were labeled with calcein AM. Labeled cells were mixed and
incubated in the presence (6C and 6D) or absence (6A and 6B) of
264scTCR/IL-2 fusion protein and the samples were analyzed by flow
cytometry. Assay conditions including loading peptide used, and
presence or absence of fusion protein, are indicated beneath each
histogram. Single stained regions are marked 1 and 3 and the double
stained cell population is marked 2.
Example 7--Pharmacokinetics of 264scTCR/IL-2 in Mice
[0115] The pharmacokinetics of the 264scTCR/IL-2 fusion protein was
measured in BALB/c mice. Mice were injected intravenously and serum
samples were collected various time points. The serum levels of
264scTCR/IL-2 fusion protein were measured using ELISA. The ELISA
detection was performed using anti-TCR mAb capture/anti-IL-2 Ab
detection (FIG. 7A), anti-TCR mAb capture/anti-TCR mAb detection
(FIG. 7B), or anti-IL-2 mAb capture/anti-IL-2 polyclonal Ab
detection (FIG. 7C) to determine whether the fusion protein is
modified or cleaved in vivo. Mice injected with 264scTCR/IL-2
fusion protein showed no obvious signs of toxicity. In these assays
a maximum concentration of 0.75 to 2.5 .mu.g/ml of 264scTCR/IL-2
was detected with an apparent serum half-life of 1.6 to 3.0 hours
depending on the ELISA format used (FIG. 7). Since the reported
serum half-life of free IL-2 is only about 5 minutes [6], these
data indicate that the fusion protein is not cleaved in vivo but
instead remains intact for a relatively long period of time in the
blood. The small variability in the half-life of 264scTCR/IL-2
determined in these studies is most likely due to the differences
in the sensitivity of the ELISA assays.
[0116] FIG. 7 is explained in more detail as follows. BALB/c mice
were injected with 264scTCR/IL-2 fusion protein and serum samples
were collected at 15 and 30 minutes, 1, 4, 8, and 24 hours post
injection. Serum concentrations of 264scTCR/IL-2 were determined by
ELISA using the following formats: 7A): Anti-TCR mAb
capture/anti-IL-2 Ab detection; 7B): Anti-TCR mAb capture/anti-TCR
mAb detection; and 7C): Anti-IL-2 mAb capture/anti-IL-2 Ab
detection.
Example 8--Tumor Cell Staining with 264scTCR/IL-2
[0117] It would be useful if the 264scTCR/IL-2 fusion protein could
recognize and bind to its target tumor cells. To test whether the
264scTCR/IL-2 is capable of binding to tumor cells, A375 human
melanoma cells, which express both HLA-A2.1 and p53, were stained
with either 264scTCR/IL-2 or 3C8, an irrelevant TCR/IL-2 fusion
protein. Cells not incubated with fusion protein and cells
incubated with 3C8 did not stain with the H57-597 detection
antibody, while cells incubated with 264scTCR/IL-2 stained
positively with the detection antibody (FIG. 8). This result
suggests that the 264scTCR/IL-2 fusion protein is capable of
recognizing and binding to its target tumor cell and is useful as
an anti-cancer therapeutic in vivo.
[0118] FIG. 8 is explained more fully as follows. A375 human
melanoma cells were incubated with no fusion protein (dashed black
line), 5 .mu.g 3C8 TCR/IL-2 fusion protein (control) (dotted line),
or 5 .mu.g 264scTCR/IL-2 fusion protein (solid black line) followed
by staining with H57-597 mAb. Unstained cells are represented by
the shaded area.
Example 9--Anti-Tumor Effects of 264scTCR/IL-2 Fusion Protein
[0119] To determine if the 264scTCR/IL-2 fusion protein has
anti-tumor activity in vivo, an experimental metastasis assay was
performed. Female athymic nude mice were injected with the highly
metastatic A375 human melanoma subclone, A375-C15N, and treated
with varying doses of either 264scTCR/IL-2 or recombinant IL-2.
Forty-two days after tumor cell injection, lung nodules were
counted. Both 264scTCR/IL-2 and recombinant IL-2 reduced lung
metastasis in a dose dependent manner (FIG. 9). However, at all
doses lung metastasis was reduced to a greater degree with the
264scTCR/IL-2 fusion protein, suggesting that targeting the
cytokine to the tumor may provide greater efficacy as a cancer
therapeutic.
[0120] Mice treated with either 264scTCR/IL-2 or recombinant IL-2
showed no obvious signs of toxicity. Both treatments resulted in
reduction of lung metastasis; however, at all doses treatment with
264scTCR/IL-2 was more effective than recombinant IL-2.
[0121] FIG. 9 is explained more fully as follows. Female athymic
nude mice were injected with highly metastatic A375-C15N cells and
treated with 264scTCR/IL-2, recombinant IL-2, or PBS. Forty-two
days after tumor cell injection, the lungs were removed, lung
nodules were counted, and the mean number of lung nodules relative
to the PBS treated control group was plotted.
Example 10--Flow Cytometric Analysis of Staining of Peptide-Loaded
T2 Cells by Monomeric and Multimeric 264scTCR Fusion Proteins
[0122] Monomeric or multimeric forms of various 264scTCR fusion
proteins were prepared and their binding to T2 cells was analyzed
by flow cytometry as described in Methods, sections 11 and 12,
below. The results, shown in FIG. 10, demonstrate that the 264scTCR
fusion proteins stained p53 (aa264-273)-loaded T2 cells (FIG. 10B)
to a greater degree than p53 (aa149-157)-loaded cells (FIG. 10A).
In the figures, unstained T2 cells are shown in the histogram
labeled T2 149 unstained.001; p53 (aa149-157)- and p53
(aa264-273)-loaded T2 cells stained with the secondary reagent
(H57-PE) are shown in the histograms labeled "T2 149 H57.002" and
"T2 264 H57.009", respectively; p53 (aa149-157)- and p53
(aa264-273)-loaded T2 cells stained with multimeric 264scTCR/IgG1
followed by H57-PE are shown in the histograms labeled "T2 149 IgG
H57.003" and "T2 264 IgG H57.010", respectively; p53 (aa149-157)-
and p53 (aa264-273)-loaded T2 cells stained with 264scTCR/IL-2
followed by H57-PE are shown in the histograms labeled "T2 149 IL2
H57.004" and "T2 264 IL2 H57.011", respectively; p53 (aa149-157)-
and p53 (aa264-273)-loaded T2 cells stained with monomeric
264scTCR/trunIgG1 followed by H57-PE are shown in the histograms
labeled "T2 149 trun H57.005" and "T2 264 trun H57.012",
respectively; and p53 (aa149-157)- and p53 (aa264-273)-loaded T2
cells stained with monomeric 264scTCR/BirA followed by H57-PE are
shown in the histograms labeled "T2 149 birA H57.006" and "T2 264
birA H57.013", respectively. This result confirmed that the
observed staining is peptide-specific.
[0123] Monomeric forms of the 264scTCR were able to stain to some
degree. For example, the mean channel fluorescence (MCF) for
staining with the 264scTCR/trunIgG form increased from 10.95 for
the p53 (aa149-157)-loaded cells to 55.34 for the p53
(aa264-273)-loaded cells. Similarly, the MCF for the 264scTCR/BirA
form increased from 13.41 for p53 (aa149-157)-loaded cells to 95.14
for the p53 (aa264-273)-loaded cells. Multimeric forms of the
264scTCR were able to specifically stain the peptide-loaded T2
cells to an even greater extent. For example, the MCF for the
264scTCR/IgG1 form increased from 119 for p53 (aa149-157)-loaded
cells to 863 for the p53 (aa264-273)-loaded cells.
Example 11--Staining of Tumor Cells by 264scTCR Fusion Proteins
[0124] The ability of the 264scTCR reagents to stain tumor cells
was also tested. Cultured A375 cells were detached with 10 mM EDTA
in PBS (pH7.4) and washed twice with washing buffer. Cell staining
was carried out using 4 .mu.g 264scTCR/IgG1 fusion protein for 45
minutes at 23.degree. C. The cells were washed once and stained
with 3 .mu.g FITC-conjugated F(ab')2 fragment of goat anti-human
IgG Fc (anti IgG-FITC). After washing twice, the stained cells were
resuspended and analyzed on a FACScan. A375 cells stained with anti
IgG-FITC alone were run as a control.
[0125] Referring to FIG. 11A, the results of this analysis show
that A375 tumor cells could be stained with the 264scTCR/IgG1
fusion protein. In this panel (11A), A375 cells stained with anti
IgG-FITC alone or 264scTCR/IgG1 followed by anti IgG-FITC are shown
in histograms labeled "A375-FITC.005" and "A375-264.FITC.006",
respectively. Additional experiments using A375 tumor cells were
performed to further characterize optimal staining conditions. For
example, PE-conjugated anti-human IgG antibody (anti IgG-PE) (FIG.
11B) or PE-conjugated H57 mAb (FIG. 11D) were used in place of the
FITC-conjugated antibody as a secondary reagent. In FIG. 11B, A375
cells stained with anti IgG-PE alone or 264scTCR/IgG1 followed by
anti IgG-PE are shown in histograms labeled "A375-PE.007" and
"A375-264.PE.008", respectively. In FIG. 11D, A375 cells stained
with H57-PE alone or 264scTCR/IgG1 followed by H57-PE are shown in
histograms labeled "A375-H57PE.009" and "A375-264.H57PE.010",
respectively. In each case, the 264scTCR/IgG1 stained the A375
tumor cells. Biotinylated 264scTCR/BirA that had been multimerized
with streptavidin-PE (SA-PE) was also used to stain A375 cells
(FIG. 11C), and showed increased staining compared with the cells
stained with streptavidin-PE alone. Referring to FIG. 11C, A375
cells stained with SA-PE alone or biotinylated 264scTCR/BirA
complexed with SA-PE are shown in histograms labeled
"A375-SAPE.001" and "A375-264BtnSaPE.002", respectively.
Example 12--Staining of Fixed Cells by 264scTCR Fusion Proteins
Detected by Flow Cytometry
[0126] As discussed, the ability to detect MHC/peptide complexes in
preserved or "fixed" samples is advantageous, especially in
clinical or other medical settings where it is typical practice to
fix cells, tissues or other biological samples taken from patients.
However, since the MHC/peptide complex represents a cell surface
antigen composed of three separate polypeptide chains, it is
uncertain that the structural integrity of the MHC/peptide complex
would remain sufficiently intact for detection by the soluble TCR
following typical fixation procedures. To assess whether soluble
TCR staining could be carried out on fixed cells, peptide-loaded T2
cells and unmanipulated A375 tumor cells were analyzed by flow
cytometry. Cultured A375 cells were detached with 10 mM EDTA in PBS
(pH 7.4) and washed twice with washing buffer. T2 cells were
incubated with 50 .mu.M p53 (aa264-273) for 3 hours and then washed
twice with washing buffer. Both cell types were fixed with 3.7%
formaldehyde for 5 minutes and washed twice. Cell staining was
carried out using 4 .mu.g 264scTCR/IgG1 or CMVscTCR/IgG1 fusion
protein in the presence or absence of 20 .mu.g HLA-A2.1/p53 (aa
264-272) tetramers for 45 minutes at 23.degree. C. The cells were
washed once and stained with 3 .mu.g FITC-conjugated F(ab')2
fragment of goat anti-human IgG Fc. After washing twice, the
stained cells were resuspended and analyzed on a FACScan.
[0127] Referring to FIG. 12A, the results showed that the
264scTCR/IgG1 fusion protein positively stained the
formaldehyde-fixed A375 cells (histogram labeled "A375F-264.006"),
while staining with CMVscTCR/IgG1 (histogram labeled
"A375F-CMV.005") was not detectable above background. Since the CMV
peptide is not present on A375 cells, use of the CMVscTCR/IgG1
control reagent provides a measure of any non-specific interactions
between the TCR or IgG1 domains with the tumor cells. By
determining the difference in tumor cell staining between the
264scTCR/IgG1 fusion protein and the CMVscTCR/IgG1 control, this
method allows direct measurement of the level of tumor antigen
presentation on the surface of the fixed tumor cell sample.
[0128] To confirm that A375 cell staining with 264scTCR/IgG1 fusion
protein was TCR-specific, HLA-A2.1/p53 (aa 264-272) tetramers were
used as blocking reagents. Staining of A375 cells with
264scTCR/IgG1 was reduced by the addition of HLA-A2.1/p53 (aa
264-272) tetramer blocking reagent (histogram labeled
"A375F-264TET.264.008"), further indicating that 264scTCR/IgG1 can
specifically bind to tumor cells. As expected, addition of
HLA-A2.1/pCMV tetramer reagent to A375 cells stained with
264scTCR/IgG1 did not have any effect on the specific staining of
the 264scTCR/IgG1 reagent (histogram labeled
"A375F-264TET.CMV.007"). Similar results were seen with the
peptide-loaded T2 cells (FIG. 12B).
[0129] These results demonstrate the monomeric and multimeric
soluble TCR reagents can specifically stain cells presenting a
peptide in the context of an MHC complex. Furthermore, soluble TCR
reagents can specifically stain unfixed and fixed tumor cells
presenting a tumor antigen in context of an MHC complex. In
addition, specific staining of the cells by the soluble TCR reagent
could be reduced by the addition of a completing MHC molecule that
binds the soluble TCR reagent. Addition of a 1 to 100 fold molar
excess of the completing MHC molecule over the soluble TCR reagent
in control staining reactions is particularly useful in
distinguishing the specific binding component (i.e. binding to
peptide-MHC) versus the non-specific binding component of soluble
TCR staining. This is relevant when comparing staining of different
cells and tissues that may exhibit different degrees of
non-specific and specific soluble TCR binding. For example,
variability between the non-specific binding of the soluble TCR in
different samples (cells or tissues) would make it extremely
difficult to determine the degree of specific soluble TCR binding
without the use of an appropriate completing MHC molecule in a
control staining reaction.
Example 13--Staining of Fixed Cells by 264scTCR Fusion Proteins
Detected by Immunofluorescent Microscopy
[0130] Several cell lines that vary with respect to HLA-A2 and p53
expression (i.e., A375, HT29 and Saos2) were chosen for analysis
and stained with either 264scTCR/IgG1 fusion protein or control
fusion protein CMVscTCR/IgG1. The cells were cultured on cover
slips for 24 hours and then fixed with 3.7% formaldehyde for 5
minutes and washed twice with washing buffer (0.5% BSA and 0.1%
sodium azide in PBS). The BSA represents a blocking agent to reduce
nonspecific protein binding. The cells were stained with 10 .mu.g
264scTCR/IgG1 or CMVscTCR/IgG1 fusion protein in 200 .mu.l of PBS
containing 5% normal goat serum (NGS) for 45 minutes at 23.degree.
C. The NGS represents a blocking agent to reduce nonspecific
binding. The cells were washed twice and stained with 3 .mu.g
FITC-conjugated F(ab')2 fragment of goat anti-human IgG
Fc.quadrature. (Jackson ImmunoResearch, West Grove, Pa.). The cells
were washed twice and then once with equilibration buffer
(Molecular Probes, Eugene, Oreg.). Cover slips were mounted on
glass slides with anti-fade reagent in glycerol buffer (Molecular
Probes, Eugene, Oreg.) and sealed with nail oil. The slides were
documented using a Nikon epi-fluorescence microscope (Nikon, Tokyo,
Japan) with a SPOT RT camera and SPOT RT software v3.2 (Diagnostic
Instrument, Sterling Heights, Mich.).
[0131] For HLA-A2 staining, the fixed cells were stained with 10
.mu.g BB7.2, a mouse anti-human HLA-A2 antibody, in 200 .mu.l of
PBS containing 5% normal goat serum (NGS) for 45 minutes at
23.degree. C. The cells were washed twice and stained with 4 .mu.g
FITC-conjugated F(ab')2 fragment of goat anti-mouse IgG
Fc.quadrature. (Jackson ImmunoResearch, West Grove, Pa.). The cells
were washed twice and then once with equilibration buffer
(Molecular Probes, Eugene, Oreg.). Cover slips were mounted and
documented as described above.
[0132] For p53 staining, the fixed cells were permeablized with
0.2% TrintonX-100 for 20 minutes and then stained with 10 .mu.g
PAb122, a mouse anti-p53 antibody, in 200 .mu.l of PBS containing
5% normal goat serum (NGS) for 45 minutes at 23.degree. C. The
cells were washed twice and stained with 4 .mu.g FITC-conjugated
F(ab')2 fragment of goat anti-mouse IgG Fc.quadrature. (Jackson
ImmunoResearch, West Grove, Pa.). The cells were washed twice and
then once with equilibration buffer (Molecular Probe, Eugene,
Oreg.). Cover slips were mounted and documented as described
above.
[0133] As shown in FIG. 13, A375 cells stained positively for
HLA-A2 and p53, HT29 stained positively for p53 but not HLA-A2 and
Saos2 cells stained positively for HLA-A2 but not p53.
Immunofluorescent staining with 264scTCR/IgG1 was only detected for
the A375 cells and none of the cells stained positively with the
CMVscTCR/IgG1. These results confirm that the presence of the
HLA-A2 and the p53 antigen are required for positive staining with
the 264scTCR reagents. No background staining was seen with the
non-specific CMVscTCR reagent in any of the tumor cell lines or
with the 264scTCR reagent when the HLA-A2 and p53 antigen were not
expressed.
Example 14--Quantitative Staining Using 264scTCR Fusion
Proteins
[0134] The number of 264scTCR complexes capable of binding
peptide-loaded T2 cells was determined. T2 cells were incubated
with various amounts of p53 (aa264-273) for 3 hours and then washed
twice with washing buffer. Cell staining was carried out using 3.7
.mu.g 264scTCR/BirA-streptavidin-PE tetramers for 45 minutes at
23.degree. C. After washing twice, the stained cells were
resuspended and analyzed on a FACScan. Alternatively, cell staining
was carried out using 3.76 .mu.g 264scTCR/IgG1 fusion protein for
45 minutes at 23.degree. C. The cells were washed once and stained
with 3 .mu.g PE-conjugated anti-human IgG antibody. After washing
twice, the stained cells were resuspended and analyzed on a
FACScan.
[0135] The results of this analysis are shown in FIG. 14 for
264scTCR/BirA tetramers, and in FIG. 15 for 264scTCR/IgG1 fusions.
Increasing level of staining with increasing amount of p53 peptide
was observed for both the 264scTCR/BirA tetramers and the
264scTCR/IgG1 fusions. To quantitate the number of complexes
staining the cells, the level of fluorescence intensity on stained
cells was compared with the fluorescence intensities of calibration
beads having known numbers of PE molecules per bead (QuantiBRITE PE
beads; BD Biosciences), thus providing a means of quantifying
PE-stained cells using a flow cytometer.
[0136] The calculated number of complexes/cell with various
concentrations of peptide for the 264scTCR/BirA tetramers and the
264scTCR/IgG1 fusions are plotted in FIG. 16. The results show that
the binding of as few as 400 scTCR complexes could be detected on
the stained cells. In addition, staining with the 264scTCR/IgG1
fusion followed by PE-conjugated anti-human IgG antibody gave about
a 4-10 fold increase in staining compared to that seen with the
264scTCR/BirA tetramers. This increase is possibly the result of a
higher level of PE conjugation to the antibody and/or multiple
antibodies reacting with the same 264scTCR/IgG1 fusion.
[0137] From the foregoing it will be appreciated that methods such
as those described above to quantitatively detect TCR binding will
be beneficial in optimizing the detection of rare antigens. The
methods were applied to detect 264scTCR reagent binding to tumor
cells. Cells were prepared as described and stained with various
amounts of 264scTCR/BirA-streptavidin-PE tetramers for 45 minutes
at 23.degree. C. After washing twice, the stained cells were
resuspended and analyzed on a FACScan. Alternatively, cell staining
was carried out with various amounts of 264scTCR/IgG1 fusion
protein for 45 minutes at 23.degree. C. The cells were washed once
and stained with 2.5 .mu.g PE-conjugated H57 antibody. After
washing twice, the stained cells were resuspended and analyzed on a
FACScan.
[0138] In each case, the number of complexes staining the cells was
determined by comparing the level of fluorescence intensity on
stained cells with the fluorescence intensities of calibration
beads with known numbers of PE molecules per bead. FIGS. 17A and
17B show staining of A375 tumor cells with the increasing amounts
of 264scTCR reagents. FIGS. 18 and 19 respectively show the
quantitation of the staining observed for three tumor cell lines
(A375, HT29 and Saos2) with the increasing amounts of 264scTCR/BirA
and 264scTCR/IgG1 reagents. The HLA-A2/p53 positive A375 tumor cell
line stained with both reagents and bound 2-5 fold more 264scTCR
reagent than the HT29 (HLA-A2-negative) and Saos2 (p53-negative)
cell lines. In addition, specific staining of the A375 cells
increased as the amount of 264scTCR reagent was increased.
Differential detection of as few as 500 staining complexes could be
determined by comparing the staining of the A375 cells with that of
other tumor cell lines. The results of these quantitative staining
studies indicate that specific binding of the 264scTCR reagents to
as few as 300-500 HLA-A2/peptide complexes per cell can be readily
detected. In addition, the sensitivity of these staining reactions
could be increased and optimized with the use of different TCR and
secondary reagents.
Example 15--Immunohistochemical Staining of Unmanipulated Tumor
Tissue by 264scTCR Fusion Proteins
[0139] To produce subcutaneous tumors, A375 human melanoma cells
(1.times.10.sup.6) were injected subcutaneously into the left
shoulder of nude mice. Tumors were allowed to grow to 500 mm.sup.3
and the mice were humanely sacrificed. Tumors were excised with
overlying skin and fixed overnight in neutral buffered formalin.
For production of metastatic lung nodules, MDA-MB-231 cells
(1.times.10.sup.6) were injected into the lateral tail vein of nude
mice, and metastatic lung nodules were allowed to develop. After 18
days, mice were humanely sacrificed, and the lungs were removed and
fixed in neutral buffered formalin. Fixed tissue was dehydrated by
sequential 30 minute incubations in 70%, 90%, 95%, 100% (twice)
ethanol followed by two 30 minute incubations in xylene. Tissues
were then embedded in paraffin and 5 .mu.m sections were prepared
and mounted on microscope slides.
[0140] For immunohistochemical staining, sections were rinsed twice
for five minutes each in xylene followed by rehydration in
sequential incubations in 100% (twice), 95%, and 85% ethanol for
two minutes each. After two 5 minute washes with PBS and one 5
minute wash with the distilled water, slides were incubated in 3%
H.sub.2O.sub.2 for 5 minutes to deactivate endogenous peroxidases
followed by one five minute wash in the distilled water. Slides
were placed in antigen retrieval solution (Dako) and heated to
97.degree. C. for 20 minutes. The slides were allowed to cool in
the antigen retrieval solution at room temperature for 20 minutes
followed by two five minute washes in PBS.
[0141] If using a non-HRP labeled secondary reagent, slides were
incubated in avidin/biotin blocking solution (ten minutes in each
solution) followed by two five-minute washes in PBS. Slides were
blocked in 1% normal goat serum (NGS) in PBS for 30 minutes at room
temperature. This blocking step is necessary to reduce background
staining due to non-specific interaction of the secondary goat
antibody reagent. The slides were then incubated for 45 minutes at
room temperature in the presence or absence of 10 .mu.g (per 100
.mu.l in 1% NGS) 264scTCR/IgG1 fusion protein or control
CMVscTCR/IgG1 fusion protein. After two five minute washes in PBS,
slides were incubated in 1.6 .mu.g (per 200 .mu.l in 1% NGS)
HRP-labeled F(ab')2 fragment of goat anti-human IgG Fc.gamma. for
45 minutes at room temperature. Slides were washed twice for five
minutes each with PBS. Slides were incubated in DAB solution (Dako)
until a light background appeared. Slides were rinsed in tap water
and counterstained in hematoxylin for 15 seconds. After washing
with tap water, slides were rinsed in three baths of 100% ethanol
and three baths of xylene for 3 minutes each and then mounted with
Permount (Fisher). The level of tissue staining was assessed by
light microscropy and documented with a SPOT RT camera and SPOT RT
software v3.2 (Diagnostic Instrument, Sterling Heights, Mich.).
[0142] A typical immunohistochemical analysis using A375 tumor
sections is shown in FIGS. 20 and 21. The results showed that A375
tissue sections stained much more intensely (i.e., appeared more
darkly colored) when incubated with 264scTCR/IgG1 fusion protein
compared to the CMVscTCR/IgG1 fusion protein or the secondary
antibody alone. The background staining observed with the
CMVscTCR/IgG1 fusion protein is comparable to that seen following
incubation with a human IgG1 antibody followed by HRP-labeled
anti-human IgG antibody, indicating that the background staining is
likely due to interaction of the IgG1 domain with the tissue
sections. In addition, staining of the mouse stromal tissue by the
264scTCR/IgG1 fusion protein was considerably less than that seen
in the A375 tumor tissue present in the same section. These results
indicate that the 264scTCR reagent is capable of specifically
staining fixed human tumor tissue sections by immunohistochemical
methods typically used to characterize human tumor samples.
Example 16--Immunohistochemical Staining of Tumor Histoarrays with
264scTCR Fusion Proteins
[0143] Human tumor histoarrays are obtained from commercial sources
or from the Tissue Array Research Program (NCI). For staining, the
histoarray slides are rinsed twice for five minutes each in xylene
followed by rehydration in sequential incubations in 100% (twice),
95%, and 85% ethanol for two minutes each. After two 5 minute
washes with PBS and one 5 minute wash with the distilled water,
slides are incubated in 3% H.sub.2O.sub.2 for 5 minutes to
deactivate endogenous peroxidases, followed by one five minute wash
in the distilled water. Slides are placed in antigen retrieval
solution (Dako) and heated to 97.degree. C. for 20 minutes. The
slides are allowed to cool in the antigen retrieval solution for 20
minutes followed by two five-minute washes in PBS. If using a
non-HRP labeled secondary reagent, slides are incubated in
avidin/biotin blocking solution (ten minutes in each solution)
followed by two five minute washes in PBS. Slides are blocked in 1%
normal goat serum (NGS) in PBS for 30 minutes at room temperature
and then incubated for 45 minutes at room temperature in the
presence or absence of 264scTCR/IgG1 fusion protein or
CMVscTCR/IgG1 fusion protein (or other non-binding scTCR reagent).
After two five minute washes in PBS, slides are incubated in
secondary reagent (either HRP-labeled goat anti-human IgG or
biotinylated anti-TCR C.beta. antibody) for 45 minutes at room
temperature. Slides are washed twice for five minutes each with
PBS.
[0144] If a non-HRP secondary reagent is used, slides are incubated
with streptavidin peroxidase solution for 15 minutes at room
temperature followed by two five minute washes with PBS.
Alternatively, scTCR/BirA-streptavidin peroxidase reagents are used
as staining reagents in place of the reagents described above.
[0145] Slides are incubated in DAB solution (Dako) until a light
background appears. Slides are rinsed in tap water and
counterstained with hematoxylin for 15 seconds. After washing with
tap water, slides are rinsed in three changes of 100% ethanol and
three changes of xylene and then mounted with Permount (Fisher).
The level of tissue staining is assessed by light microscropy and
photographed, for example with a SPOT RT camera and SPOT RT
software v3.2 (Diagnostic Instrument, Sterling Heights, Mich.).
[0146] Tumors that express HLA-A2 and p53 are expected to be
differentially stained when incubated with the 264scTCR fusion
protein compared to the CMVscTCR fusion protein. Little or no
staining is expected when the histoarrays are incubated with no
fusion protein. In addition, tumor tissues that are negative for
HLA-A2 and/or p53 are expected to show reduced staining with
264scTCR fusion protein compared to HLA-A2/p53-positive tumor
tissue. This can give useful information about what types of
tumors, and the relative proportions thereof, that can be
recognized by 264scTCR fusion proteins, aiding decisions about the
advisability of treating a given type of tumor with a 264scTCR
based therapy.
Example 17--Imaging of Tumors In Vivo with Fluorescent TCR
Reagents
[0147] Expression vectors are constructed to generate 264scTCR
fused to GFP (green fluorescent protein) or Luc (firefly
luciferase). These vectors can be generated from the 264scTCR/IgG1
expression vector described herein by replacing the IgG1 gene
fragment with GFP or Luc coding sequences. Sources of these coding
sequences are commercially available (for example, pEGFP-C1
(Clontech) for the GFP gene, and pSP-Luc (Promega) for the Luc
gene. The vectors are used as a template to isolate the appropriate
DNA sequence by standard PCR methods. Expression vectors for
control TCR (i.e., CMVscTCR) fusions to GFP and Luc can be
generated by the same methods. In some applications these
expression vectors can be used to transfect cells such as CHO cells
and the resulting expressed proteins are purified as described
herein.
[0148] These purified proteins are used to image tumors in vivo.
Human tumor cells that vary with respect to HLA-A2 and p53
expression are implanted either subcutaneously or intravenously and
tumors or metastatic lung nodules are allowed to develop as
described in Example 15 above. For the scTCR/Luc fusions, mice are
injected intravenously with increasing amounts of the scTCR/Luc
fusion proteins. After a period of time necessary to allow the
fusion proteins to circulate throughout the body, the mice are
injected intraperitoneally with 2.0 mg D-luciferin substrate for
luciferase in 100 .mu.l PBS, then anesthetized with xylazine (3
mg/ml) and ketamine (7 mg/ml) in PBS at 120 .mu.l/20 g body weight.
For the scTCR/GFP fusions, mice are injected intravenously with
increasing amounts of the scTCR/Luc fusion proteins. After a period
of time necessary to allow the fusion proteins to circulate
throughout the body, the mice anesthetized with xylazine (3 mg/ml)
and ketamine (7 mg/ml) in PBS as described above.
[0149] For tumor detection in vivo, anesthetized mice are placed
inside a NightOwl LB 981 Molecular Light Imager. Imaging is
performed using a two-step process and WinLight software (Berthold
Technologies, Oak RidgeTN). First, a black and white photographic
image is acquired using a 15 ms exposure followed by luminescent
image acquisition using a 5-minute photon integration period with
background subtraction. The luminescent image is processed in the
software to colorize the luminescence intensity and then overlaid
onto the black and white photographic image for presentation. In
some cases mice are sacrificed and pathological assessment is
performed to determine the size, location and nature (i.e., antigen
positivity or negativity) of the tumors.
[0150] Results from imaging studies demonstrating differential
detection of the 264scTCR/Luc or 264scTCR/GFP reagents at tumor
sites bearing HLA-A2/p53 positive tumor cells compared with other
tissues indicate scTCR reagents capable of specifically detecting
tumors in vivo.
[0151] Additionally, results demonstrating differential detection
of the 264scTCR/Luc or 264scTCR/GFP reagents at tumor sites bearing
HLA-A2/p53 positive tumor cells compared with that of the
CMVscTCR/Luc or CMVscTCR/GFP (control) reagents would further
indicate those scTCR reagents capable of specifically detecting
tumors in vivo. Imaging results demonstrating differential
detection of the 264scTCR/Luc or 264scTCR/GFP reagents at tumor
sites bearing HLA-A2/p53 positive tumor cells compared with results
for tumor sites bearing HLA-A2-negative or p53-negative tumor cells
further indicate those scTCR reagents are capable of specifically
detecting tumors in vivo.
Example 18--Imaging of Tumors In Vivo with Radiolabeled TCR
[0152] In another embodiment, 264scTCR fusion proteins are
radiolabeled, for example by direct iodination with .sup.131I.
Iodination is carried out using standard methods. Human tumor cells
that vary with respect to HLA-A2 and p53 expression are implanted
either subcutaneously or intravenously and tumors or metastatic
lung nodules are allowed to develop as described. Mice are injected
intravenously or intraperitoneally with radiolabeled 264scTCR
fusion protein and imaged for example at 1, 2, 4, 8, and 12 hours
and 1 to 14 days after injection of radiolabeled 264scTCR fusion
protein. For whole body scans, mice are anesthetized with 100 mg/kg
sodium pentobarbital and imaged for example with a large
field-of-view Sopha DSX camera fitted with a 4 mm pinhole
collimator interfaced to a microcomputer. Results from imaging
studies demonstrating differential detection of the
radionucleotide-labeled 264scTCR reagents at tumor sites compared
with other tissue would indicate those radiolabelled scTCR reagents
useful for specifically detecting tumors in vivo.
[0153] The following materials and methods were used as needed to
conduct experiments outlined in the Examples.
1. Materials
[0154] A2.1 264 CTL clone #5 was derived by limiting dilution
cloning [50] from a CTL line specific for the human p53 264-272
peptide generated in HLA-A2.1 transgenic mice [49]. CHO.K1 Chinese
hamster ovary, Jurkat human T lymphocyte, CTLL-2 mouse cytotoxic T
lymphocyte, T2 human lymphoblast, A375 human melanoma, H57-597
hybridoma, and BB7.2 hybridoma cell lines were obtained from
American Type Culture Collection (Rockville, Md.). The T2 human
lymphblast cells are positive for HLA-A2.1 but deficient in TAP 1
and 2 proteins, which allows them to display empty MHC molecules
that can then be loaded with exogenous peptide [2]. The A375 human
melanoma cell line was tested in our laboratory for both HLA-A2.1
and p53 and was found to be positive for both antigens. The H57-597
hybridoma produces a monoclonal antibody that recognizes an epitope
in the murine TCR .beta. constant region, and the BB7.2 hybridoma
produces the BB7.2 monoclonal antibody that specifically recognizes
an epitope on the alpha 2 domain of HLA-A2. The highly metastatic
subclone of the human melanoma cell line A375, A375-C15N, which was
used only for in vivo metastasis studies was maintained as
previously reported [53]. Recombinant human IL-2 and biotinylated
anti-human IL-2 polyclonal antibodies used for the ELISA in the
pharmacokinetic study were purchased from R&D Systems, Inc.
(Minneapolis, Minn.). Anti-TCR C.beta. mAb H57-597, anti-murine TCR
V.beta.3 mAb, anti-murine CD3.epsilon. mAb, anti-human IL-2 mAb,
anti-human CD25 blocking antibody and isotype control antibody, and
FITC labeled goat anti-mouse IgG were obtained from Pharmingen (San
Diego, Calif.). All cell culture media and additives were purchased
from CellGro (Herndon, Va.), and all cell culture materials were
purchased from Nunc (Rochester, N.Y.) unless otherwise noted. All
mice were purchased from Harlan Labs (Indianapolis, Ind.).
2. Cell Culture
[0155] All cell lines were maintained in complete culture medium
comprised of IMDM supplemented with 10% heat inactivated FBS, 2 mM
L-glutamine, and 1 mg/ml G418 (for transfected CHO cells only) at
37.degree. C. and 5% CO.sub.2. CTLL-2 cells were maintained in the
same medium with the addition of 9 U/ml recombinant human IL-2.
A375-C15N cells were maintained in RPMI-1640 with 10% heat
inactivated FBS, penicillin and streptomycin (Life
Technologies).
[0156] Mouse splenocytes were isolated by pressing spleens
aseptically dissected from BALB/c mice through a nylon mesh screen
and washing with culture medium. Red blood cells were lysed with
Gey's solution for 2 minutes followed by addition of culture medium
to stop the lysis. Single cell pellets were washed twice,
resuspended at 2.5.times.10.sup.6 cells per mL in culture medium
and cultured in complete culture medium containing 50 .mu.M 2-ME,
100 IU/mL recombinant human IL-2, and 50 ng/ml anti-murine
CD3.epsilon. mAb.
3. Constructs
[0157] Primers--Oligonucleotide primers were synthesized from
sequences matching or complementing the mouse T cell receptor and
human IL-2 genes:
TABLE-US-00001 KC228: (SEQ ID NO: 3)
5'-GAGGTGGCCCAGCCGGCCATGGCCCAGTCAGTGACGCAGC-3'; KC229: (SEQ ID NO:
4) 5'-GAGGTGACTAGTGTCTGGCTTTATAATTAG-3'; PRIB4: (SEQ ID NO: 5)
5'-GGGGGGCTCGAGCAATTCAAAAGTCATTCAGACTC-3'; KC176: (SEQ ID NO: 6)
5'-GAGGTGGAGCCCGGGGTCTGCTCGGCCCCAGGC-3'; ET-TCRF1: (SEQ ID NO: 7)
5'-CCCACCGGTCAGTCAGTGACGCAGCCC-3'; KC-170: (SEQ ID NO: 8)
5'-GTGGAGTTCGAAAAGGTGACTTACGTTTGTCTGCTCGGCCCCA G-3'; KC231: (SEQ ID
NO: 9) 5'CGATAAGTGTACTTACGTTTTCATTATTCCATCGGCATGTACTCTTC
TTCCTCTCG-3'; KC208: (SEQ ID NO: 10)
5'GTGGAGATCGATAAGTGTACTTACGTTTTCATTATCGCGATCCGGAG
TTAACGTCTGCTCGGCCCCAG-3'; KC327B: (SEQ ID NO: 11)
5'-TAGGTGTCCGGAGCACCTACTTCAAGTTCTAC-3'; KC328B: (SEQ ID NO: 12)
5'-TAGGTGTCGCGAAGTTAGTGTTGAGATGATG-3'; AP2: (SEQ ID NO: 13)
5'-ACTCACTATAGGGCTCGAGCGGC-3'; C.alpha. HYB: (SEQ ID NO: 14)
5'GCTGTCCTGAGACCGAGGATCTTTTAACTG3'; C.beta. HYB: (SEQ ID NO: 15)
5'-TTGTTTGTTTGCAATCTGTGCTTTTGATGG-3'.
[0158] The TCR gene was cloned from the T cell clone A2.1 264#5. We
designate the single-chain TCR derived from this T cell clone
264scTCR. Poly(A).sup.+ RNA was extracted from the cells using a
MicroFast Track kit (Invitrogen, Carlsbad, Calif.), and double
stranded cDNA was prepared and ligated to a double stranded adaptor
oligonucleotide using the Marathon cDNA Amplification Kit
(Clontech, Palo Alto, Calif.). To identify the V.alpha. and V.beta.
segments, 5'-RACE PCR was performed using the A2.1 264#5 cDNA
preparation and above-listed primers AP2 (specific for the adaptor
DNA) and C.alpha. HYB (specific for the constant domain of the
.alpha. chain) or C.beta. HYB (specific for the constant domain of
the .beta. chain). PCR fragments were cloned into the pCR2.1 vector
using the TA cloning kit (Invitrogen), and the sequence was
determined using M13 forward and reverse primers. The T cell
receptor V.alpha. chain was amplified using primers KC228 and KC229
to produce an SfiI/SpeI fragment, and the V.beta.C.beta. chain was
amplified using primers PRIB4 and KC176 to generate an XhoI/XmaI
fragment. The C.beta. chain was truncated just before the cysteine
residue at amino acid 127 of the full length C.beta. chain. The
SfiI/SpeI V.alpha. chain fragment was subcloned into SfiI/SpeI
digested pKC60, an E. coli expression vector that encodes an
irrelevant TCR, replacing the original TCR insert. The XhoI/XmaI
V.beta.C.beta. fragment was then ligated into an XhoI/XmaI digest
of this vector yielding a vector encoding a soluble three domain
264scTCR. The three domain T cell receptor from this construct was
amplified using primers ET-TCRF1 and KC170 to generate an AgeI/ClaI
DNA fragment, which was then used as a template for PCR with
primers KC231 and KC208 to produce an AgeI/HpaI fragment.
[0159] The human IL-2 coding sequence was cloned by RT-PCR from
total RNA isolated from Jurkat cells using a Mini Total RNA Kit
(Qiagen, Valencia Calif.) and Qiashredder (Qiagen, Valencia
Calif.). Reverse transcription was carried out using primer KC328B,
and PCR was carried out using primers KC327B and KC328B to produce
a BspEI/NruI human IL-2 fragment. The BspEI/NruI IL-2 fragment was
cloned into BspEI/NruI digested p149B1SP, a cloning vector encoding
an irrelevant TCR/antibody fusion protein, replacing the antibody
portion of the fusion protein. The IL-2 modified vector was
digested with AgeI and HpaI and the AgeI/HpaI 264scTCR fragment
described above was ligated into it. Finally, an AgeI/ClaI
264scTCR/IL-2 fusion protein fragment was cloned into AgeI/BstBI
digested pSUN27, a scTCR/mouse kappa fusion vector, replacing the
irrelevant TCR originally cloned in the vector, yielding the
264scTCR/IL-2 fusion protein expression vector, pSUN38. The
264scTCR/kappa fusion used as a negative control for some of the
flow cytometry analyses was generated by cloning an AgeI/BstBI
264scTCR fragment into AgeI/BstBI digested pSUN27, replacing the
original TCR.
[0160] For production of fusion protein in mammalian cells, CHO.K1
cells were electroporated using a Bio-Rad Gene Pulser, followed by
limiting dilution cloning and selection in medium containing 1
mg/mL G418.
4. Protein Purification
[0161] 264scTCR/IL-2 was purified from cell culture supernatant
fluid by immunoaffinity chromatography using the monoclonal
anti-murine TCR antibody H57-597, which recognizes an epitope in
the constant region of the TCR .beta. chain, coupled to a Sepharose
4B column (Amersham Pharmacia, Piscataway, N.J.). The purified
sample was then concentrated and buffer-exchanged into PBS using an
Ultrafree-15 centrifugal filter with a 30 kDa molecular weight
cutoff membrane (Millipore, Bedford, Mass.). The TCR fusion protein
samples were stored at 2-8.degree. C. (short term) or at
-80.degree. C. (long term) for biochemical and functional analysis.
SDS-PAGE was performed under either reducing or non-reducing
conditions using 4-12% Nu-PAGE polyacrylamide gels (Novex, San
Diego, Calif.) and the Novex EX-Cell II system. SDS-PAGE gels were
stained with Coomassie blue.
5. ELISA
[0162] All ELISAs were performed using Maxisorb 96 well plates
(Nunc, Rochester, N.Y.) coated with 100-200 ng/well anti-human IL-2
mAb or anti-murine TCR V.beta.3 mAb. Fusion protein was detected
with biotinylated anti-murine TCR H57 mAb, anti-murine TCR V.beta.3
mAb, or anti-IL-2 polyclonal Ab followed by streptavidin-HRP
(Kirkegaard and Perry Laboratories, Gaithersburg, Md.), TMB
substrate, and 0.18 M H2504 to quench the reaction (BioFX, Owings
Mills, Md.). Absorbance was measured at 450 nm using a 96 well
plate reader (Bio-Tek Instruments, Inc., Winooski, Vt.).
6. Cell Staining with TCR Fusion Proteins
[0163] T2 cells pulsed with either p53 (aa 149-157) or p53 (aa
264-272) peptide were incubated with 0.5 .mu.g of 264scTCR/IL-2
fusion protein in 1% FBS in PBS for 30 minutes at room temperature.
The cells were then incubated with 0.5 .mu.g anti-IL-2 Ab or 0.5
.mu.g biotinylated anti-TCR H57-597 mAb for 30 minutes at room
temperature followed by 1 .mu.g anti-murine kappa-PE or 5 ng
streptavidin-PE, respectively (both from Becton Dickenson, Franklin
Lakes, N.J.). Samples were washed with 1% FBS in PBS before FACScan
analysis (Becton Dickenson, Franklin Lakes, N.J.). To determine if
both p53 peptides bound to HLA-A2 similarly, peptide loaded cells
were stained with BB7.2 for 30 minutes at room temperature followed
by FITC labeled goat anti-mouse IgG and analyzed on a FACScan
instrument.
[0164] CTLL-2 cells were incubated with 0.5 .mu.g of fusion protein
for 30 minutes at room temperature. To detect the bound fusion
protein, 0.5 .mu.g biotinylated anti-TCR V.beta.3 mAb was added and
incubated for 30 minutes at room temperature followed by incubation
with 5 ng streptavidin-PE, or the protein was detected using 0.5
.mu.g PE-labeled HLA-A2.1 p53 (aa 264-272) tetramer for 30 minutes.
Conjugated HLA-A2 tetramers loaded with p53 peptides were produced
as described previously [1]. Samples were washed with 1% FBS in PBS
before FACScan analysis. For IL-2 receptor blocking experiments,
CTLL-2 cells were incubated with .alpha.-human CD25 blocking
antibody or isotype control antibody for 30 minutes before
incubation with 264scTCR/IL-2 or 264scTCR/kappa fusion protein. For
staining of BALB/c mouse splenocytes, staining was carried out as
described for the CTLL-2 cells using HLA-A2.1 p53 (aa 264-272)
tetramers to detect bound fusion protein.
[0165] A375 cells were harvested with enzyme-free cell dissociation
buffer (Sigma, St. Louis, Mo.). Samples of 5.times.10.sup.5 cells
were washed with 1% FBS in PBS and incubated with no fusion
protein, 5 .mu.g 3C8 (an irrelevant TCR/IL-2 fusion protein), or 5
.mu.g 264scTCR/IL-2 for 30 minutes at room temperature followed by
incubation with 1 .mu.g biotinylated H57-597 mAb. Cells were then
incubated with PE-labeled streptavidin for 15 minutes at room
temperature, washed, and analyzed by FACScan.
7. Cell Conjugation
[0166] T2 cells pulsed with either p53 (aa 264-272) peptide or p53
(aa 149-157) peptide were labeled with 7.88 ng/ml dihydroethidium
(HE) (Molecular Probes, Inc., Eugene, Oreg.), and CTLL-2 cells were
labeled with 50 ng/ml calcein AM (Molecular Probes, Inc., Eugene
Oreg.). After washing, the two populations of labeled cells were
mixed together at a 1:1 ratio in the presence or absence of 2 .mu.g
264scTCR/IL-2 fusion protein for 20 minutes at room temperature.
Cells were then analyzed by FACScan.
8. Bioassay
[0167] CTLL-2 cells were seeded at 4.times.10.sup.3 cells/well in
100 .mu.l culture medium containing various concentrations of
either recombinant IL-2 or 264scTCR/IL-2 and incubated for 21 hours
at 37.degree. C. and 5% CO.sub.2. As a control for specificity
CTLL-2 cells were incubated with 264scTCR/IL-2 in the presence or
absence of 5 or 50 .mu.g anti-human CD25 blocking antibody or
isotype control antibody and incubated for 21 hours at 37.degree.
C. and 5% CO.sub.2. Cell proliferation reagent WST-1 (Roche Inc.,
Indianapolis, Ind.) was added at 20 .mu.l/well and incubated for 4
hours at 37.degree. C. and 5% CO.sub.2. Absorbance was read at 450
nm on a 96-well plate reader.
9. Pharmacokinetics in Mice
[0168] For all experiments involving animals, principles of
laboratory animal care (NIH publication No. 85-23, revised 1985)
were followed, as well as specific national laws where applicable.
Female BALB/c mice were injected intravenously via the lateral tail
vein with 32 264scTCR/IL-2 fusion protein diluted with PBS to a
total volume of 100 .mu.l. Serum was collected from one group of
mice not injected with 264scTCR/IL-2 to establish background
levels. Serum was collected by tail bleed from the injected groups
at 15 and 30 minutes, 1, 2, 4, 8, and 24 hours. Blood samples were
centrifuged at 14,000.times.g at 4.degree. C. for 10 minutes, and
serum was collected and stored at -80.degree. C. until use.
264scTCR/IL-2 concentrations were determined by ELISA using
anti-TCR V.beta.3 or anti-IL-2 monoclonal antibodies for capture
and either biotinylated anti-TCR H57 monoclonal or anti-IL-2
polyclonal antibodies followed by streptavidin HRP for
detection.
10. In Vivo Studies
[0169] Female athymic nude mice (nu/nu) were injected with
5.0.times.10.sup.5 A375-C15N cells via the lateral tail vein.
Animals were injected with varying doses of either 264scTCR/IL-2
(32, 10, 3, 1, or 0.1 .mu.g in 100 .mu.l total volume) or
recombinant human IL-2 (8, 2.5, 0.75, 0.25, or 0.025 .mu.g in 100
.mu.l total volume) days 1, 2, 3, 4, 7, 10, 14, 17, 21, 28, and 35
post-tumor cell injection. Forty-two days after tumor cell
injection, all animals were humanely sacrificed, the lungs were
removed and fixed in Bouin's solution, and surface pulmonary tumor
nodules were counted. Tumor nodules on each lung were counted by
two observers and the average counts were recorded.
11. TCR Constructs and Fusion Proteins Comprising IgG and Bir a Tag
Sequence
[0170] The TCR gene was cloned from the T cell clone A2.1 264#5 as
described. The single-chain TCR derived from this T cell clone was
designated as 264scTCR. The three domain single chain 264scTCR was
amplified using a 264scTCR/IL-2 fusion protein construct as a
template. To generate the 264scTCR/IgG1 expression construct, the
single chain TCR fragment was ligated into an antibody heavy chain
expression vector, replacing the antibody variable region and
yielding a single chain TCR fused to a human IgG1 heavy chain
region. To generate the 264scTCR/trunIgG1, the TCR fragment was
ligated into an expression vector containing the IgG1 heavy domain
that was truncated prior to the hinge region that allows disulfide
bonding.
[0171] To generate the 264scTCR/BirA expression construct, the
single chain TCR fragment was ligated into an expression vector
containing the BirA tag sequence (Beckett, D. et al. Protein Sci.
1999 April; 8(4):921-9), such that the tag sequence was expressed
in frame at the C-terminus of the 264scTCR molecule.
[0172] The Cytomegalovirus single-chain TCR (CMVscTCR) was cloned
from CTLs stimulated with HLA-A2 restricted CMV-pp65 peptides. The
IgG1 fragment was amplified from 264scTCR/IgG1 DNA to create the
CMVscTCR/IgG1 construct.
[0173] For production of the fusion proteins in mammalian cells,
CHO.K1 cells were electroporated using a Bio-Rad Gene Pulser,
followed by limiting dilution cloning and selection in medium
containing 1 mg/ml G418.
[0174] Protein purification was carried out as follows.
264scTCR/IgG1, 264scTCR/BirA and 264scTCR/trunIgG1 were purified
from cell culture supernatant fluid by immunoaffinity
chromatography using the H57-597 monoclonal antibody coupled to a
Sepharose 4B column (Amersham Pharmacia, Piscataway, N.J.).
CMVscTCR/IgG1 was purified from cell culture supernatant fluid by
immunoaffinity chromatography using the BF1 monoclonal antibody
coupled to a Sepharose 4B column (Amersham Pharmacia, Piscataway,
N.J.). 264scTCR/BirA was biotinylated with biotin-protein ligase
(Avidity) under conditions recommended by the manufacturer.
12. Detection of Cell Staining by 264scTCR Reagents by Flow
Cytometry
[0175] The ability of 264scTCR reagents to stain fixed and unfixed
cells was characterized in several studies. Cell staining
strategies included use of 264scTCR fusions carrying various
detectable domains, and detecting the cellular interaction of these
fusions with various fluorescently labeled probes. Several controls
were used to assess specific staining. Controls included staining
cells that lacked the p53(aa264-273) antigen with the 264scTCR
reagents, staining p53-positive cells with the CMVscTCR reagents,
staining p53-positive cells with secondary staining reagents alone,
and staining p53-positive cells with the 264scTCR reagents with and
without competitive blocking reagents such as soluble HLA-A2/p53
multimers.
[0176] Monomeric or multimeric forms of the 264scTCR were tested
for their ability to specifically stain cells. T2 cells were loaded
with p53 (aa264-273) or p53 (aa149-157) at 100 .mu.g/ml for 2.5
hour at 37.degree. C. After a wash step to remove excess peptide,
the cells were incubated with 264scTCR/IL-2, 264scTCR/IgG1,
264scTCR/trIgG1 or 264scTCR/BirA (without biotinylation) at 125 pM
for 30-45 minutes. SDS-PAGE analysis of reduced and non-reduced
samples indicated that the 264scTCR/trunIgG1 and 264scTCR/BirA
proteins are monomeric and the 264scTCR/IgG1 protein is a dimer.
After another wash step, cells were incubated for 30 minutes with
2.5 .mu.g PE-conjugated H57 mAb (H57-PE). The cells were washed and
analyzed on a FACScan flow cytometry instrument (BD Sciences, San
Jose, Calif.) using CellQuest software (BD Biosciences, San Jose,
Calif.). Unstained and H57-PE stained T2 cells were also analyzed
to establish background staining.
[0177] The following documents are referred to (by a number as
shown below) throughout the present disclosure. Each document is
incorporated by reference. [0178] 1. Altman J D, Moss P A, Goulder
P J, Barouch D H, McHeyzer-Williams M G, Bell J I, McMichael A J,
Davis M M (1996) Phenotypic analysis of antigen-specific T
lymphocytes. Science 274: 94 [0179] 2. Anderson K S, Alexander J,
Wei M, Cresswell P (1993) Intracellular transport of class I MHC
molecules in antigen processing mutant cell lines. J Immunol 151:
3407 [0180] 3. Bauer R J, Dedrick R L, White M L, Murray M J,
Garovoy M R (1999) Population pharmacokinetics and pharmacodynamics
of the anti-CD11a antibody hu1124 in human subjects with psoriasis.
J Pharmacokinet Biopharm 27: 397 [0181] 4. Becker J C, Varki N,
Gillies S D, Furukawa K, Reisfeld R A (1996) Long-lived and
transferable tumor immunity in mice after targeted interleukin-2
therapy. J Clin Invest 98: 2801 [0182] 5. Chung S, Wucherpfennig K
W, Friedman S M, Hafler D A, Strominger J L (1994) Functional
three-domain single-chain T-cell receptors. Proc Natl Acad Sci USA
91: 12654 [0183] 6. Donohue J H, Rosenberg S A (1983) The fate of
interleukin-2 after in vivo administration. J Immunol 130: 2203
[0184] 7. Dummer R, Gore M E, Hancock B W, Guillou P J, Grobben H
C, Becker J C, Oskam R, Dieleman J P, Burg G (1995) A multicenter
phase I I clinical trial using dacarbazine and continuous infusion
interleukin-2 for metastatic melanoma. Clinical data and
immunomonitoring. Cancer 75: 1038 [0185] 8. Engel I, Ottenhoff T H,
Klausner R D (1992) High-efficiency expression and solubilization
of functional T cell antigen receptor heterodimers. Science 256:
1318 [0186] 9. Gregoire C, Rebai N, Schweisguth F, Necker A, Mazza
G, Auphan N, Millward A, Schmitt-Verhulst A M, Malissen B (1991)
Engineered secreted T-cell receptor alpha beta heterodimers. Proc
Natl Acad Sci USA 88: 8077 [0187] 10. Grimm E A, Mazumder A, Zhang
H Z, Rosenberg S A (1982) Lymphokine-activated killer cell
phenomenon. Lysis of natural killer-resistant fresh solid tumor
cells by interleukin 2-activated autologous human peripheral blood
lymphocytes. J Exp Med 155: 1823 [0188] 11. Grussenmeyer T,
Scheidtmann K H, Hutchinson M A, Eckhart W, Walter G (1985)
Complexes of polyoma virus medium T antigen and cellular proteins.
Proc Natl Acad Sci USA 82: 7952 [0189] 12. Hank J A, Albertini M R,
Schiller J, Sondel P M (1993) Activation of multiple effector
mechanisms to enhance tumor immunotherapy. J Immunother 14: 329
[0190] 13. Hank J A, Robinson R R, Surfus J, Mueller B M, Reisfeld
R A, Cheung N K, Sondel P M (1990a) Augmentation of antibody
dependent cell mediated cytotoxicity following in vivo therapy with
recombinant interleukin 2. Cancer Res 50: 5234 [0191] 14. Hank J A,
Sosman J A, Kohler P C, Bechhofer R, Storer B, Sondel P M (1990b)
Depressed in vitro T cell responses concomitant with augmented
interleukin-2 responses by lymphocytes from cancer patients
following in vivo treatment with interleukin-2. J Biol Response Mod
9: [0192] 15. Hank J A, Surfus J, Gan J, Chew T L, Hong R, Tans K,
Reisfeld R, Seeger R C, Reynolds C P, Bauer M, et al. (1994)
Treatment of neuroblastoma patients with antiganglioside GD2
antibody plus interleukin-2 induces antibody-dependent cellular
cytotoxicity against neuroblastoma detected in vitro. J Immunother
15: 29 [0193] 16. Harvill E T, Fleming J M, Morrison S L (1996) In
vivo properties of an IgG3-IL-2 fusion protein. A general strategy
for immune potentiation. J Immunol 157: 3165 [0194] 17. Harvill E
T, Morrison S L (1995) An IgG3-IL2 fusion protein activates
complement, binds Fc gamma RI, generates LAK activity and shows
enhanced binding to the high affinity IL-2R. Immunotechnology 1: 95
[0195] 18. Hilyard K L, Reyburn H, Chung S, Bell J I, Strominger J
L (1994) Binding of soluble natural ligands to a soluble human
T-cell receptor fragment produced in Escherichia coli. Proc Natl
Acad Sci USA 91: 9057 [0196] 19. Hinds P W, Finlay C A, Quartin R
S, Baker S J, Fearon E R., Vogelstein B, Levine A J (1990) Mutant
p53 DNA clones from human colon carcinomas cooperate with ras in
transforming primary rat cells: a comparison of the "hot spot"
mutant phenotypes. Cell Growth Differ 1: 571 [0197] 20. Hurford R K
Jr, Dranoff G, Mulligan R C, Tepper R I (1995) Gene therapy of
metastatic cancer by in vivo retroviral gene targeting. Nat Genet
10: 430 [0198] 21. Huston J S, Levinson D, Mudgett-Hunter M, Tai M
S, Novotny J, Margolies M N, Ridge R J, Bruccoleri R E, Haber E,
Crea R, et al (1988) Protein engineering of antibody binding sites:
recovery of specific activity in an anti-digoxin single-chain Fv
analogue produced in Escherichia coli. Proc Natl Acad Sci USA 85:
5879 [0199] 22. Iggo R, Gatter K, Bartek J, Lane D, Harris A L
(1990) Increased expression of mutant forms of p53 oncogene in
primary lung cancer. Lancet 335: 675 [0200] 23. Kendra K, Gan J,
Ricci M, Surfus J, Shaker A, Super M, Frost J D, Rakhmilevich A,
Hank J A, Gillies S D, Sondel P M (1999) Pharmacokinetics and
stability of the ch14.18-interleukin-2 fusion protein in mice.
Cancer Immunol Immunother 48: 219 [0201] 24. Klausner R D,
Lippincott-Schwartz J, Bonifacino J S (1990) The T cell antigen
receptor: insights into organelle biology. Annu Rev Cell Biol 6:
403 [0202] 25. Lewis L D, Cole B F, Wallace P K, Fisher J L, Waugh
M, Guyre P M, Fanger M W, Curnow R T, Kaufman P A, Ernstoff M S
(2001) Pharmacokinetic-pharmacodynamic relationships of the
bispecific antibody MDX-H210 when administered in combination with
interferon gamma: a multiple-dose phase-I study in patients with
advanced cancer which overexpresses HER-2/neu. J Immunol Methods
248: 149 [0203] 26. Lin A Y, Devaux B, Green A, Sagerstrom C,
Elliott J F, Davis M M (1990) Expression of T cell antigen receptor
heterodimers in a lipid-linked form. Science 249: 677 [0204] 27.
Lode H N, Xiang R, Dreier T, Varki N M, Gillies S D, Reisfeld R A
(1998) Natural killer cell-mediated eradication of neuroblastoma
metastases to bone marrow by targeted interleukin-2 therapy. Blood
91: 1706 [0205] 28. Lode H N, Xiang R, Varki N M, Dolman C S,
Gillies S D, Reisfeld R A (1997) Targeted interleukin-2 therapy for
spontaneous neuroblastoma metastases to bone marrow. J Natl Cancer
Inst 89: 1586 [0206] 29. Lustgarten J, Marks J, Sherman L A (1999)
Redirecting effector T cells through their IL-2 receptors. J
Immunol 162: 359 [0207] 30. McLaughlin R, O'Hanlon D, McHale T,
Connolly C E, Given H F (2001) Prognostic implications of p53 and
bc1-2 expression in 108 women with stage two breast cancer. Ir J
Med Sci 170: 11 [0208] 31. Motzer R J, Rakhit A, Ginsberg M,
Rittweger K, Vuky J, Yu R, Fettner S, Hooftman L (2001) Phase I
trial of 40-kd branched pegylated interferon alfa-2a for patients
with advanced renal cell carcinoma. J Clin Oncol 19: 1312 [0209]
32. Motzer R J, Rakhit A, Schwartz L H, Olencki T, Malone T M,
Sandstrom K, Nadeau R, Parmar H, Bukowski R (1998) Phase I trial of
subcutaneous recombinant human interleukin-12 in patients with
advanced renal cell carcinoma. Clin Cancer Res 4: 1183 [0210] 33.
Nastala C L, Edington H D, McKinney T G, Tahara H, Nalesnik M A,
Brunda M J, Gately M K, Wolf S F, Schreiber R D, Storkus W J, et
al. (1994) Recombinant IL-12 administration induces tumor
regression in association with IFN-gamma production. J Immunol 153:
1697 [0211] 34. Pardoll D M (1995) Paracrine cytokine adjuvants in
cancer immunotherapy. Annu Rev Immunol 13: 399 [0212] 35. Peng L S,
Penichet M L, Morrison S L (1999) A single-chain IL-12 IgG3
antibody fusion protein retains antibody specificity and IL-12
bioactivity and demonstrates antitumor activity. J Immunol 163: 250
[0213] 36. Penichet M L, Harvill E T, Morrison S L (1997)
Antibody-IL-2 fusion proteins: a novel strategy for immune
protection. Hum Antibodies 8: 106 [0214] 37. Posey J A, Raspet R,
Verma U, Deo Y M, Keller T, Marshall J L, Hodgson J, Mazumder A,
Hawkins M J (1999) A pilot trial of GM-CSF and MDX-H210 in patients
with erbB-2-positive advanced malignancies. J Immunother 22: 371
[0215] 38. Pullarkat V, Deo Y, Link J, Spears L, Marty V, Curnow R,
Groshen S, Gee C, Weber J S (1999) A phase I study of a HER2/neu
bispecific antibody with granulocyte-colony-stimulating factor in
patients with metastatic breast cancer that overexpresses HER2/neu.
Cancer Immunol Immunother 48: 9 [0216] 39. Reddy K R, Wright T L,
Pockros P J, Shiffman M, Everson G, Reindollar R, Fried M W, Purdum
P P 3rd, Jensen D, Smith C, et al. (2001) Efficacy and safety of
pegylated (40-kd) interferon alpha-2a compared with interferon
alpha-2a in noncirrhotic patients with chronic hepatitis C.
Hepatology 33: 433 [0217] 40. Rosenberg S A, Lotze M T, Muul L M,
Chang A E, Avis F P, Leitman S, Linehan W M, Robertson C N, Lee R
E, Rubin J T, et al (1987) A progress report on the treatment of
157 patients with advanced cancer using lymphokine-activated killer
cells and interleukin-2 or high-dose interleukin-2 alone. N Engl J
Med 316: 889 [0218] 41. Rosenberg S A, Lotze M T, Yang J C,
Aebersold P M, Linehan W M, Seipp C A, White D E (1989) Experience
with the use of high-dose interleukin-2 in the treatment of 652
cancer patients. Ann Surg 210: 474 [0219] 42. Rosenberg S A, Spiess
P J, Schwarz S (1983) In vivo administration of Interleukin-2
enhances specific alloimmune responses. Transplantation 35: 631
[0220] 43. Rosenberg S A, Yang J C, White D E, Steinberg S M (1998)
Durability of complete responses in patients with metastatic cancer
treated with high-dose interleukin-2: identification of the
antigens mediating response. Ann Surg 228: 307 [0221] 44. Royal R
E, Steinberg S M, Krouse R S, Heywood G, White D E, Hwu P,
Marincola F M, Parkinson D R, Schwartzentruber D J, Topalian S L,
et al. (1996) Correlates of Response to I L-2 Therapy in Patients
Treated for Metastatic Renal Cancer and Melanoma. Cancer J Sci Am
2: 91 [0222] 45. Sherman L A, Hesse S V, Irwin M J, La Face D,
Peterson P (1992) Selecting T cell receptors with high affinity for
self-MHC by decreasing the contribution of CD8. Science 258: 815
[0223] 46. Sondel P M, Kohler P C, Hank J A, Moore K H, Rosenthal N
S, Sosman J A, Bechhofer R, Storer B (1988) Clinical and
immunological effects of recombinant interleukin 2 given by
repetitive weekly cycles to patients with cancer. Cancer Res 48:
2561 [0224] 47. Sosman J A, Hank J A, Moore K H, Borchert A, Schell
K, Kohler P C, Goldstein D, Bechhofer R, Storer B, Albertini M R,
et al. (1991) Prolonged interleukin-2 (IL-2) treatment can augment
immune activation without enhancing antitumor activity in renal
cell carcinoma. Cancer Invest 9: 35 [0225] 48. Temmim L, Baker H,
Sinowatz F (2001) Immunohistochemical detection of p53 protein
expression in breast cancer in young Kuwaiti women. Anticancer Res
21: 743 [0226] 49. Theobald M, Biggs J, Dittmer D, Levine A J,
Sherman L A (1995) Targeting p53 as a general tumor antigen. Proc
Natl Acad Sci USA 92: 11993 [0227] 50. Theobald M, Biggs J,
Hernandez J, Lustgarten J, Labadie C, Sherman L A (1997) Tolerance
to p53 by A2.1-restricted cytotoxic T lymphocytes. J Exp Med 185:
833 [0228] 51. thor Straten P, Guldberg P, Schrama D, Andersen M A,
Moerch U, Seremet T, Siedel C, Reisfeld R A, Becker J C (2001) In
situ cytokine therapy: redistribution of clonally expanded T cells.
Eur J Immunol 31: 250 [0229] 52. Tsung K, Meko J B, Peplinski G R,
Tsung Y L, Norton J A (1997) IL-12 induces T helper 1-directed
antitumor response. J Immunol 158: 3359 [0230] 53. van Golen K L,
Risin S, Staroselsky A, Berger D, Tainsky M A, Pathak S, Price J E
(1996) Predominance of the metastatic phenotype in hybrids formed
by fusion of mouse and human melanoma clones. Clin Exp Metastasis.
14: 95 [0231] 54. Weber S, Traunecker A, Oliveri F, Gerhard W,
Karjalainen K (1992) Specific low-affinity recognition of major
histocompatibility complex plus peptide by soluble T-cell receptor.
Nature 356: 793 [0232] 55. Weil-Hillman G, Voss S D, Fisch P,
Schell K, Hank J A, Sosman J A, Sugamura K, Sondel P M (1990)
Natural killer cells activated by interleukin 2 treatment in vivo
respond to interleukin 2 primarily through the p75 receptor and
maintain the p55 (TAC) negative phenotype. Cancer Res 50: 2683
[0233] 56. Wiebke E A, Rosenberg S A, Lotze M T (1988) Acute
immunologic effects of interleukin-2 therapy in cancer patients:
decreased delayed type hypersensitivity response and decreased
proliferative response to soluble antigens. J Clin Oncol 6: 1440.
[0234] 57. O'Herron S M, Lebowitz M S, Bieler J G, al-Ramadi B K,
Utz U, Bothwell ALM and Schneck J P (1997) Analysis of the
expression of peptide-major histocompatibility complexes using high
affinity soluble divalent T cell receptors. J Exp Med 186:
1333.
[0235] The disclosures of all references mentioned herein are
incorporated herein by reference. The invention has been described
with reference to preferred embodiments thereof. However, it will
be appreciated that those skilled in the art, upon consideration of
this disclosure, may make modifications and improvements within the
spirit and scope of the invention.
* * * * *