U.S. patent application number 16/267194 was filed with the patent office on 2019-08-22 for rnai agents for hepatitis b virus infection.
This patent application is currently assigned to Arrowhead Pharmaceuticals, Inc.. The applicant listed for this patent is Arrowhead Pharmaceuticals, Inc.. Invention is credited to Lauren J. Almeida, Bruce D. Given, David L. Lewis, Zhen Li, Tao Pei, David B. Rozema, Darren H. Wakefield, Christine I. Wooddell, Rui Zhu.
Application Number | 20190255091 16/267194 |
Document ID | / |
Family ID | 61073185 |
Filed Date | 2019-08-22 |
![](/patent/app/20190255091/US20190255091A1-20190822-C00001.png)
![](/patent/app/20190255091/US20190255091A1-20190822-C00002.png)
![](/patent/app/20190255091/US20190255091A1-20190822-C00003.png)
![](/patent/app/20190255091/US20190255091A1-20190822-C00004.png)
![](/patent/app/20190255091/US20190255091A1-20190822-C00005.png)
![](/patent/app/20190255091/US20190255091A1-20190822-C00006.png)
![](/patent/app/20190255091/US20190255091A1-20190822-C00007.png)
![](/patent/app/20190255091/US20190255091A1-20190822-C00008.png)
![](/patent/app/20190255091/US20190255091A1-20190822-C00009.png)
![](/patent/app/20190255091/US20190255091A1-20190822-C00010.png)
![](/patent/app/20190255091/US20190255091A1-20190822-C00011.png)
View All Diagrams
United States Patent
Application |
20190255091 |
Kind Code |
A1 |
Li; Zhen ; et al. |
August 22, 2019 |
RNAi AGENTS FOR HEPATITIS B VIRUS INFECTION
Abstract
Described are compositions and methods for inhibition of
Hepatitis B virus gene expression. RNA interference (RNAi) agents
for inhibiting the expression of Hepatitis B virus gene are
described. The HBV RNAi agents disclosed herein may be targeted to
cells, such as hepatocytes, for example, by using conjugated
targeting ligands. Pharmaceutical compositions comprising one or
more HBV RNAi agents optionally with one or more additional
therapeutics are also described. Delivery of the described HBV RNAi
agents to infected liver in vivo provides for inhibition of HBV
gene expression and treatment of diseases and conditions associated
with HBV infection.
Inventors: |
Li; Zhen; (Madison, WI)
; Zhu; Rui; (Madison, WI) ; Wooddell; Christine
I.; (Madison, WI) ; Given; Bruce D.; (Madison,
WI) ; Pei; Tao; (Madison, WI) ; Lewis; David
L.; (Madiosn, WI) ; Almeida; Lauren J.;
(Madison, WI) ; Rozema; David B.; (Cross Plains,
WI) ; Wakefield; Darren H.; (Fitchburg, WI) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Arrowhead Pharmaceuticals, Inc. |
Pasadena |
CA |
US |
|
|
Assignee: |
Arrowhead Pharmaceuticals,
Inc.
Pasadena
CA
|
Family ID: |
61073185 |
Appl. No.: |
16/267194 |
Filed: |
February 4, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/US2017/045446 |
Aug 4, 2017 |
|
|
|
16267194 |
|
|
|
|
62370754 |
Aug 4, 2016 |
|
|
|
62534733 |
Jul 20, 2017 |
|
|
|
62540639 |
Aug 3, 2017 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 9/0019 20130101;
C12N 2310/11 20130101; C12N 15/113 20130101; C12N 2310/14 20130101;
A61P 1/16 20180101; A61P 31/14 20180101; A61K 31/7105 20130101;
A61K 31/675 20130101; C12N 2310/321 20130101; C12N 15/1131
20130101; C12N 2310/322 20130101; C12N 2310/3515 20130101; A61P
31/20 20180101; A61P 31/12 20180101; C12N 2310/314 20130101; A61K
31/7088 20130101; A61P 35/00 20180101; C12N 2310/315 20130101; C12N
2310/321 20130101; C12N 2310/3521 20130101; C12N 2310/322 20130101;
C12N 2310/3533 20130101 |
International
Class: |
A61K 31/7105 20060101
A61K031/7105; C12N 15/113 20060101 C12N015/113; A61K 31/675
20060101 A61K031/675; A61P 31/14 20060101 A61P031/14; A61K 9/00
20060101 A61K009/00 |
Claims
1-66. (canceled)
67. A composition comprising one or more RNAi agents, wherein the
one or more RNAi agents comprise: (a) an antisense strand
comprising a nucleotide sequence of any one of the following: SEQ
ID NO:100, SEQ ID NO:126, SEQ ID NO:127, SEQ ID NO:128, SEQ ID
NO:171, SEQ ID NO:179 and SEQ ID NO:180; and (b) a sense strand
comprising a nucleotide sequence of any one of the following: SEQ
ID NO:229, SEQ ID NO:252, SEQ ID NO:253, SEQ ID NO:273, SEQ ID
NO:302 and SEQ ID NO:319.
68. The composition of claim 67, wherein the one or more RNAi
agents comprise at least one modified nucleotide or at least one
modified inter-nucleoside linkage.
69. The composition of claim 68, wherein substantially all of the
nucleotides in the one or more RNAi agents are modified
nucleotides.
70. The composition of claim 67, wherein the one or more RNAi
agents further comprise a targeting ligand that is conjugated to
the one or more RNAi agents.
71. The composition of claim 70, wherein the targeting ligand
comprises N-acetyl-galactosamine.
72. The composition of claim 71, wherein the targeting ligand
comprises an N-acetyl-galactosamine trimer or an
N-acetyl-galactosamine tetramer.
73. The composition of claim 72, wherein the targeting ligand is
selected form the group consisting of (NAG13), (NAG13)s, (NAG18),
(NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s,
(NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30),
(NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s,
(NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37),
(NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s.
74. The composition of claim 73, wherein the targeting ligand is
(NAG25), (NAG25)s, (NAG31), (NAG31)s, (NAG37), or (NAG37)s.
75. The composition of claim 70, wherein the targeting ligand is
conjugated to the sense strand of the one or more RNAi agents.
76. The composition of claim 70, wherein the targeting ligand is
conjugated to the antisense strand of the one or more RNAi
agents.
77. The composition of claim 75, wherein the targeting ligand is
conjugated to the 5' terminus of the sense strand of the one or
more RNAi agents.
78. The composition of claim 76, wherein the targeting ligand is
conjugated to the 3' terminus of the antisense strand of the one or
more RNAi agents.
79. The composition of claim 67, wherein the sense strand further
comprises one or more inverted abasic nucleosides.
80. The composition of claim 67 further comprising a
pharmaceutically acceptable excipient, carrier, or diluent.
81. The composition of claim 67 further comprising an additional
RNAi agent, wherein the additional RNAi agent comprises: an
antisense strand comprising a nucleotide sequence of any one of the
following: SEQ ID NO:140, SEQ ID NO:137, SEQ ID NO:102, SEQ ID
NO:162 and SEQ ID NO:188, and a sense strand comprising a
nucleotide sequence of any one of the following: SEQ ID NO:248, SEQ
ID NO:294, SEQ ID NO:262, SEQ ID NO:271, SEQ ID NO:274, and SEQ ID
NO:328.
82. The composition of claim 81, wherein the composition comprises
two or more RNAi agents independently selected from the group
consisting of: AD04571 (SEQ ID NO: 100 and SEQ ID NO:229), AD04776
(SEQ ID NO: 102 and SEQ ID NO:248), AD04872 (SEQ ID NO: 126 and SEQ
ID NO:252), AD04873 (SEQ ID NO: 127 and SEQ ID NO:252), AD04874
(SEQ ID NO: 128 and SEQ ID NO:253), AD04982 (SEQ ID NO: 137 and SEQ
ID NO:248), AD05070 (SEQ ID NO:140 and SEQ ID NO:262), AD05148 (SEQ
ID NO:140 and SEQ ID NO:271), AD05164 (SEQ ID NO:126 and SEQ ID
NO:273) and AD05165 (SEQ ID NO:140 and SEQ ID NO:274).
83. The composition of claim 82, wherein the ratio of the one or
more RNAi agents to the additional RNAi agent by weight is in the
range of about 1:2 to about 5:1.
84. The composition of claim 83, wherein the ratio of the one or
more RNAi agents to the additional RNAi agent by weight is about
2:1 or about 3:1.
85. The composition of claim 84, wherein the one or more RNAi
agents comprise an antisense strand comprising SEQ ID NO: 126 and a
sense strand comprising SEQ ID NO: 252, the additional RNAi agent
comprises an antisense strand comprising SEQ ID NO: 140 and a sense
strand comprising SEQ ID NO: 262.
86. The composition of claim 84, wherein the one or more RNAi
agents comprise an antisense strand comprising SEQ ID NO: 126 and a
sense strand comprising SEQ ID NO: 252, the additional RNAi agent
comprises an antisense strand comprising SEQ ID NO:102 and a sense
strand comprising SEQ ID NO: 248.
87. The composition of claim 84, wherein the one or more RNAi
agents comprise an antisense strand comprising SEQ ID NO: 126 and a
sense strand comprising SEQ ID NO: 252, the additional RNAi agent
comprises an antisense strand comprising SEQ ID NO:137 and a sense
strand comprising SEQ ID NO: 248.
88. The composition of claim 82, wherein the two or more RNAi
agents are each independently conjugated to a targeting ligands
comprising N-acetyl-galactosamine.
89. The composition of claim 85, wherein the sense strand of the
one or more RNAi agents or the additional RNAi agent further
comprises one or more inverted abasic nucleosides.
90. A pharmaceutical composition comprising the composition of
claim 67 and a pharmaceutically acceptable excipient, carrier, or
diluent.
91. A kit comprising the pharmaceutical composition of claim
90.
92. The kit of claim 91 further comprising a syringe or a vial.
93. A composition comprising one or more RNAi agents, wherein the
one or more RNAi agents comprise: (a) an antisense strand
comprising a nucleotide sequence of any one of the following: SEQ
ID NO:140, SEQ ID NO:102, SEQ ID NO:137, SEQ ID NO:162 and SEQ ID
NO:188; and (b) a sense strand comprising a nucleotide sequence of
any one of the following: SEQ ID NO:248, SEQ ID NO:294, SEQ ID
NO:262, SEQ ID NO:271, SEQ ID NO:274, and SEQ ID NO:328.
94. The composition of claim 93, wherein the one or more RNAi
agents comprise at least one modified nucleotide or at least one
modified inter-nucleoside linkage.
95. The composition of claim 94, wherein substantially all of the
nucleotides in the one or more RNAi agents are modified
nucleotides.
96. The composition of claim 93, wherein the one or more RNAi
agents further comprise a targeting ligand that is conjugated to
the one or more RNAi agents.
97. The composition of claim 96, wherein the targeting ligand is
selected form the group consisting of (NAG13), (NAG13)s, (NAG18),
(NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s,
(NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30),
(NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s,
(NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37),
(NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s.
98. The composition of claim 96, wherein the targeting ligand is
conjugated to the sense strand of the one or more RNAi agents.
99. The composition of claim 96, wherein the targeting ligand is
conjugated to the antisense strand of the one or more RNAi
agents.
100. The composition of claim 93, wherein the sense strand further
comprises one or more inverted abasic nucleosides.
101. A pharmaceutical composition comprising the composition of
claim 93 and a pharmaceutically acceptable excipient, carrier, or
diluent.
102. A kit comprising the pharmaceutical composition of claim
101.
103. A method of reducing or inhibiting the expression of at least
one Hepatitis B Virus gene in a subject in need thereof, comprising
administering to the subject an effective amount of one or more
RNAi agents according to claim 67.
104. The method of claim 103, wherein the one or more RNAi agents
are administered in the amount of about 0.25-5 mg/kg.
105. The method of claim 104, wherein the one or more RNAi agents
are formulated for subcutaneous or intravenous injection.
106. The method of claim 103 further comprising administering to
the subject one or more additional therapeutics.
107. The method of claim 106, wherein the additional therapeutic is
lamivudine, tenofovir, tenofovir alafenamide, tenofovir disoproxil,
or entecavir.
108. A method of treating a disease or disorder associated with
Hepatitis B Virus infection in a subject in need thereof,
comprising administering to the subject an effective amount of one
or more RNAi agents according to claim 67.
109. The method of claim 108, wherein the one or more RNAi agents
are administered in the amount of about 0.25-5 mg/kg.
110. The method of claim 109, wherein the one or more RNAi agents
are formulated for subcutaneous or intravenous injection.
111. The method of claim 110, wherein the subject has an infection
caused by the Hepatitis B Virus.
112. The method of claim 108 further comprising administering to
the subject one or more additional therapeutics.
113. The method of claim 112, wherein the additional therapeutic is
lamivudine, tenofovir, tenofovir alafenamide, tenofovir disoproxil,
or entecavir.
114. A combination of at least two RNAi agents comprising a first
RNAi agent and a second RNAi agent, wherein: (a) the first RNAi
agent comprising: an antisense strand comprising a nucleotide
sequence of any one of the following: SEQ ID NO:100, SEQ ID NO:126,
SEQ ID NO:127, SEQ ID NO:128, SEQ ID NO:171, SEQ ID NO:179, and SEQ
ID NO:180, and a sense strand comprising a nucleotide sequence of
any one of the following: SEQ ID NO:229, SEQ ID NO:252, SEQ ID
NO:253, SEQ ID NO:273, SEQ ID NO:302, and SEQ ID NO:319; and (b)
the second RNAi agent comprising: an antisense strand comprising a
nucleotide sequence of any one of the following: SEQ ID NO:140, SEQ
ID NO:102, SEQ ID NO:137, SEQ ID NO:162 and SEQ ID NO:188, and a
sense strand comprising a nucleotide sequence of any one of the
following: SEQ ID NO:248, SEQ ID NO:294, SEQ ID NO:262, SEQ ID
NO:271, SEQ ID NO:274, and SEQ ID NO:328.
115. The combination of claim 114, wherein the first or the second
RNAi agent comprises at least one modified nucleotide or at least
one modified inter-nucleoside linkage.
116. The combination of claim 114, wherein the first or the second
RNAi agent further comprises a targeting ligand that is conjugated
to the first or the second RNAi agent.
117. The combination of claim 116, wherein the targeting ligand is
selected form the group consisting of (NAG13), (NAG13)s, (NAG18),
(NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s,
(NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30),
(NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s,
(NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37),
(NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s.
118. The combination of claim 117, wherein the targeting ligand is
conjugated to the 5' terminus of the sense strand of the one or
more RNAi agents.
119. The combination of claim 114, wherein the sense strand in the
first or the second RNAi agents further comprises one or more
inverted abasic nucleosides.
120. The combination of claim 114 further comprising a
pharmaceutically acceptable excipient, carrier, or diluent.
121. The combination of claim 114, wherein the ratio of the first
RNAi agent to the second RNAi agent by weight is in the range of
about 1:2 to about 5:1.
122. The combination of claim 114, wherein the first and the second
RNA agents are formulated in a single pharmaceutical
composition.
123. The combination of claim 114, wherein the first and the second
RNA agents are formulated in separate pharmaceutical
compositions.
124. The combination of claim 114, wherein the first and the second
RNA agents are formulated for subcutaneous or intravenous
injection.
125. A cell, tissue or non-human organism comprising one or more
RNAi agents according to claim 67.
126. A method of preparing an RNAi agent comprising conjugating a
targeting group to a reactive group at the 5'- or 3'-terminus of
the RNAi agent, wherein: the RNAi agent comprises: (a) an antisense
strand comprising a nucleotide sequence of any one of the
following: SEQ ID NO:100, SEQ ID NO:126, SEQ ID NO:127, SEQ ID
NO:128, SEQ ID NO:171, SEQ ID NO:179 and SEQ ID NO:180; and (b) a
sense strand comprising a nucleotide sequence of any one of the
following: SEQ ID NO:229, SEQ ID NO:252, SEQ ID NO:253, SEQ ID
NO:273, SEQ ID NO:302 and SEQ ID NO:319; the reactive group at the
5'- or 3'-terminus of the RNAi agent is selected from the group
consisting of amine, alkyne, alkyl, abasic nucleoside, ribitol and
PEG; and the targeting group comprises N-acetyl-galactosamine.
127. The method of claim 126, wherein the reactive group is an
amine.
128. The method of claim 126, wherein the targeting group is
selected from the group consisting of (NAG13), (NAG13)s, (NAG18),
(NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s,
(NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30),
(NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s,
(NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37),
(NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s.
129. The method of claim 126, wherein the sense strand further
comprises one or more inverted abasic nucleosides.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority from U.S. Provisional
Patent Application Ser. No. 62/540,639, filed on Aug. 3, 2017, U.S.
Provisional Patent Application Ser. No. 62/534,733, filed on Jul.
20, 2017, and U.S. Provisional Patent Application Ser. No.
62/370,754, filed on Aug. 4, 2016, the contents of each of which
are incorporated herein by reference in their entirety.
FIELD OF THE INVENTION
[0002] Disclosed herein are RNA interference (RNAi) agents for
inhibition of Hepatitis B Virus gene expression, compositions that
include HBV RNAi agents, and methods of use thereof.
BACKGROUND
[0003] The Hepatitis B Virus (HBV) is a strict hepatotrophic,
double-stranded DNA containing virus. Although DNA is the genetic
material, the replication cycle involves a reverse transcription
step to copy a pregenomic RNA into DNA. Hepatitis B Virus is
classified as one member of the Hepadnaviruses and belongs to the
family of Hepadnaviridae. The primary infection of adult humans
with Hepatitis B Virus causes an acute hepatitis with symptoms of
organ inflammation, fever, jaundice and increased liver
transaminases in blood. Those patients that are not able to
overcome the virus infection suffer a chronic disease progression
over many years with increased risk of developing cirrhotic liver
or liver cancer. Perinatal transmission from Hepatitis B
Virus-infected mothers to newborns also leads to chronic
hepatitis.
[0004] Upon uptake by hepatocvtes, the nucleocapsid is transferred
to the nucleus and DNA is released. There, the DNA strand synthesis
is completed and gaps repaired to give the covalently closed
circular (ccc) supercoiled DNA of 3.2 kb. The cccDNA serves as a
template for transcription of five major viral mRNAs, which are
3.5, 3.5, 2.4, 2.1 and 0.7 kb long. All mRNAs are 5'-capped and
polyadenylated at the 3'-end. There is sequence overlap at the
3'-end between all five mRNAs.
[0005] One 3.5 kb mRNA serves as template for core protein and
polymerase production. In addition, the same transcript serves as a
pre-genomic replication intermediate and allows the viral
polymerase to initiate the reverse transcription into DNA. Core
protein is needed for nucleocapsid formation. The other 3.5 kb mRNA
encodes pre-core, the secretable e-antigen (HBeAg). In the absence
of replication inhibitors, the abundance of e-antigen in blood
correlates with Hepatitis B Virus replication in liver and serves
as an important diagnostic marker for monitoring the disease
progression.
[0006] The 2.4 and 2.1 kb mRNAs carry the open reading frames
("ORF") pre-S1, pre-S2 and S for expression of viral large, medium
and small surface antigen. The s-antigen is associated with
infectious, complete particles. In addition, blood of infected
patients also contain non-infectious particles derived from
s-antigen alone, free of genomic DNA or polymerase. The function of
these particles is not fully understood. The complete and lasting
depletion of detectable s-antigen in blood is considered as a
reliable indicator for Hepatitis B Virus clearance.
[0007] The 0.7 kb mRNA encodes the X protein. This gene product is
important for efficient transcription of viral genes and also acts
as a transactivator on host gene expression. The latter activity
seems to be important for hepatocyte transformation during
development of liver cancer.
[0008] Patients with detectable s-antigen, e-antigen, and/or viral
DNA in the blood for more than 6 months are considered chronically
infected. Nucleoside analogs as inhibitors of reverse transcriptase
activity are typically the first treatment option for many
patients. Administration of lamivudine, tenofovir, and/or entecavir
has been shown to suppress Hepatitis B Virus replication, sometimes
to undetectable levels, with improvement of liver function and
reduction of liver inflammation typically seen as the most
important benefits. However, only few patients achieve complete and
lasting remission after the end of treatment. Furthermore, the
Hepatitis B Virus develops drug resistance with increasing duration
of treatment. This is especially difficult for patients co-infected
with Hepatitis B and Human Immunodeficiency Virus (HIV). Both
viruses are susceptible to nucleoside analogue drugs and may
co-develop resistance.
[0009] A second treatment option is the administration of
interferon-alpha. Here, patients receive high doses of
interferon-alpha over a period of 6 months. The Asian genotype B
gives very poor response rates. Co-infection with Hepatitis D Virus
(HDV) or Human Immunodeficiency Virus has been shown to render
interferon-alpha therapy completely ineffective. Patients with
strong liver damage and heavy fibrotic conditions are not qualified
for interferon-alpha therapy.
[0010] Certain Hepatitis B Virus-specific RNA interference (RNAi)
agents have been previously shown to inhibit expression of HBV gene
expression. For example, U.S. Patent Application Publication No.
2013/0005793, to Chin et al., which is incorporated herein by
reference in its entirety, discloses certain double-stranded
ribonucleic acid (dsRNA) molecules for inhibiting the expression of
Hepatitis B Virus gene.
SUMMARY
[0011] There exists a need for novel Hepatitis B Virus
(HBV)-specific RNA interference (RNAi) agents (also herein termed
RNAi agent, RNAi trigger, or trigger) that are able to selectively
and efficiently inhibit the expression of an Hepatitis B Virus
(HBV) gene. Further, there exists a need for combinations of novel
HBV-specific RNAi agents for the treatment of HBV infection and
prevention of diseases associated with HBV.
[0012] Described herein are HBV gene-specific RNAi agents able to
selectively and efficiently decrease expression of an HBV gene. The
described HBV RNAi agents can be used in methods for therapeutic
treatment and/or prevention of symptoms and diseases associated
with HBV infection, including but not limited to chronic liver
diseases/disorders, inflammations, fibrotic conditions,
proliferative disorders (including cancers, such as hepatocellular
carcinoma), Hepatitis D Virus (HDV) infection, and acute HBV
infection. In some embodiments, the HBV RNAi agents can be used in
methods for therapeutic treatment and/or prevention of symptoms and
diseases associated with chronic HBV infection and/or HDV
infection. Such methods comprise administration of one or more HBV
RNAi agents as described herein to a subject, e.g., a human or
animal subject.
[0013] Additionally, described herein are compositions comprising
one or more of the disclosed HBV RNAi agents that are able to
selectively and efficiently decrease expression of an HBV gene. The
compositions comprising one or more HBV RNAi agents can be
administered to a subject, such as a human or animal subject, for
the treatment and/or prevention of symptoms and diseases associated
with HBV infection.
[0014] Each HBV RNAi agent disclosed herein includes at least a
sense strand and an antisense strand. The sense strand and the
antisense strand can be partially, substantially, or fully
complementary to each other. The length of the RNAi agent sense and
antisense strands described herein each can be 16 to 30 nucleotides
in length. In some embodiments, the sense and antisense strands are
independently 17 to 26 nucleotides in length. In some embodiments,
the sense and antisense strands are independently 19 to 26
nucleotides in length. In some embodiments, the sense and antisense
strands are independently 21 to 26 nucleotides in length. In some
embodiments, the sense and antisense strands are independently 21
to 24 nucleotides in length. The sense and antisense strands can be
either the same length or different lengths. The HBV RNAi agents
disclosed herein have been designed to include antisense strand
sequences that are at least partially complementary to a sequence
in the HBV genome that is conserved across the majority of known
serotypes of HBV. The RNAi agents described herein, upon delivery
to a cell expressing HBV, inhibit the expression of one or more HBV
genes in vivo or in vitro.
[0015] An HBV RNAi agent includes a sense strand (also referred to
as a passenger strand) that includes a first sequence, and an
antisense strand (also referred to as a guide strand) that includes
a second sequence. A sense strand of the HBV RNAi agents described
herein includes a core stretch having at least about 85% identity
to a nucleotide sequence of at least 16 consecutive nucleotides in
an HBV mRNA. In some embodiments, the sense strand core nucleotide
stretch having at least about 85% identity to a sequence in an HBV
mRNA is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. An
antisense strand of an HBV RNAi agent comprises a nucleotide
sequence having at least about 85% complementary over a core
stretch of at least 16 consecutive nucleotides to a sequence in an
HBV mRNA and the corresponding sense strand. In some embodiments,
the antisense strand core nucleotide sequence having at least about
85% complementarity to a sequence in an HBV mRNA or the
corresponding sense strand is 16, 17, 18, 19, 20, 21, 22, or 23
nucleotides in length.
[0016] Examples of HBV RNAi agent sense strands and antisense
strands that can be used in HBV RNAi agents are provided in Tables
3 and 4. Examples of HBV RNAi agent duplexes are provided in Table
5. Examples of 19-nucleotide core stretch sequences that consist of
or are included in the sense strands and antisense strands of HBV
RNAi agents disclosed herein, are provided in Table 2.
[0017] In some embodiments, one or more HBV RNAi agents are
delivered to target cells or tissues using any oligonucleotide
delivery technology known in the art. Nucleic acid delivery methods
include, but are not limited to, by encapsulation in liposomes, by
iontophoresis, or by incorporation into other vehicles, such as
hydrogels, cyclodextrins, biodegradable nanocapsules, and
bioadhesive microspheres, proteinaceous vectors or Dynamic
Polyconjugates (DPCs) (see, for example WO 2000/053722, WO
2008/0022309, WO 2011/104169, and WO 2012/083185, each of which is
incorporated herein by reference). In some embodiments, an HBV RNAi
agent is delivered to target cells or tissues by covalently linking
the RNAi agent to a targeting group. In some embodiments, the
targeting group can include a cell receptor ligand, such as an
asialoglycoprotein receptor (ASGPr) ligand. In some embodiments, an
ASGPr ligand includes or consists of a galactose derivative
cluster. In some embodiments, a galactose derivative cluster
includes an N-acetyl-galactosamine trimer or an
N-acetyl-galactosamine tetramer. In some embodiments, a galactose
derivative cluster is an N-acetyl-galactosamine trimer or an
N-acetyl-galactosamine tetramer.
[0018] A targeting group can be linked to the 3' or 5' end of a
sense strand or an antisense strand of an HBV RNAi agent. In some
embodiments, a targeting group is linked to the 3' or 5' end of the
sense strand. In some embodiments, a targeting group is linked to
the 5' end of the sense strand. In some embodiments, a targeting
group is linked to the RNAi agent via a linker.
[0019] A targeting group, with or without a linker, can be linked
to the 5' or 3' end of any of the sense and/or antisense strands
disclosed in Tables 2, 3, and 4. A linker, with or without a
targeting group, can be attached to the 5' or 3' end of any of the
sense and/or antisense strands disclosed in Tables 2, 3, and 4.
[0020] In some embodiments, described herein are compositions that
include one or more HBV RNAi agents having the duplex sequences
disclosed in Table 5.
[0021] In some embodiments, described herein are compositions that
include a combination or cocktail of at least two HBV RNAi agents
having different nucleotide sequences. In some embodiments, the two
or more different HBV RNAi agents are each separately and
independently linked to targeting groups. In some embodiments, the
two or more different HBV RNAi agents are each linked to targeting
groups comprised of N-acetyl-galactosamines. In some embodiments,
when two or more RNAi agents are included in a composition, each of
the RNAi agents is linked to the same targeting group. In some
embodiments, when two or more RNAi agents are included in a
composition, each of the RNAi agents is linked to different
targeting groups, such as targeting groups having different
chemical structures.
[0022] In some embodiments, targeting groups are linked to the HBV
RNAi agents without the use of an additional linker. In some
embodiments, the targeting group is designed having a linker
readily present to facilitate the linkage to an HBV RNAi agent. In
some embodiments, when two or more RNAi agents are included in a
composition, the two or more RNAi agents may be linked to the
targeting groups using the same linkers. In some embodiments, when
two or more RNAi agents are included in a composition, the two or
more RNAi agents are linked to the targeting groups using different
linkers.
[0023] In some embodiments, described herein are compositions that
include a combination of at least two HBV RNAi agents having
different sequences, wherein each HBV RNAi agent targets a
different location or different region of an HBV gene. In some
embodiments, described herein are compositions that include a
combination of at least two HBV RNAi agents, wherein each HBV RNAi
agent is designed to target a different HBV transcript (for
example, a composition that includes two HBV RNAi agents, wherein
the first HBV RNAi agent includes an antisense strand that is at
least partially complementary to a nucleotide sequence located in
the S ORF of an HBV gene, while the second HBV RNAi agent includes
an antisense strand that is at least partially complementary to a
nucleotide sequence located in the X ORF of an HBV gene). As used
herein, an RNAi agent that includes an antisense strand at least
partially complementary to a nucleotide sequence located in the S
ORF targets a portion of the HBV genome of SEQ ID NO: 1 between
positions 1-1307 and 3185-3221. As used herein, an RNAi agent that
includes an antisense strand at least partially complementary to a
nucleotide sequence located in the X ORF targets a portion of the
HBV genome of SEQ ID NO: 1 between positions 1308-1930.
[0024] HBV mRNA is known to be polycistronic, resulting in the
translation of multiple polypeptides, and separate mRNAs overlap in
RNA sequence, therefore a single RNAi agent targeting an HBV gene
may result in inhibition of most or all HBV transcripts. However,
while not wishing to be bound to any theory, it is hypothesized
that a composition that includes two or more HBV RNAi agents
targeting different locations or regions of an HBV gene (and, in
particular, two or more HBV RNAi agents wherein one HBV RNAi agent
targets the S ORF and a second HBV RNAi agent targets the X ORF)
may provide for additional advantages over a composition that
includes only a single HBV RNAi agent, such as (a) ensuring that
all HBV viral transcripts are targeted (i.e., 3.5 kb pre-genomic
RNA; 3.5 kb pre-core mRNA; 2.4 kb pre-S1 mRNA; 2.1 kb pre-S2/S
mRNA; 0.7 kb.times.mRNA; as well as any S-antigen expressing mRNAs
produced from integrated HBV DNA); (b) serving to expand the
genotype coverage to potentially address a larger patient
population; and/or (c) potentially decreasing the viral resistance
due to mutations in the siRNA binding site.
[0025] In some embodiments, described herein are compositions that
include a combination of one HBV RNAi agent that targets the S ORF
of an HBV RNA (i.e., having an antisense strand that targets the S
transcripts (S, pre-S1, and pre-S2), the pregenomic RNA (core and
polymerase), and the pre-core transcripts (HBeAg) of an HBV
genome), and one HBV RNAi agent that targets the X ORF of an HBV
RNA (i.e., having an antisense strand that targets the X transcript
of an HBV genome, the S transcripts (S, pre-S1, and pre-S2), the
pregenomic RNA (core and polymerase), and the pre-core transcripts
(HBeAg) of an HBV genome). In some embodiments, the compositions
described herein include at least one HBV RNAi agent that contains
a sequence that targets the S ORF of an HBV gene, and a second HBV
RNAi agent that contains a sequence that targets the X ORF of an
HBV gene.
[0026] Disclosed herein are methods for inhibiting expression of an
HBV gene, the method comprising administering one or more HBV RNAi
agents having an antisense strand comprising the sequence of any of
the sequences in Table 3.
[0027] Disclosed herein are methods for inhibiting expression of an
HBV gene, the method comprising administering one or more HBV RNAi
agents having a sense strand comprising the sequence of any of the
sequences in Table 4.
[0028] Disclosed herein are methods for inhibiting expression of an
HBV gene, the method comprising administering one or more HBV RNAi
agents having an antisense strand comprising the sequence of any of
the sequences in Table 3, and a sense strand comprising the
sequence of any of the sequences in Table 4 that is at least
partially complementary to the antisense strand.
[0029] Disclosed herein are methods for inhibiting expression of an
HBV gene, the method comprising administering one or more HBV RNAi
agents having an antisense strand that consists of the sequence of
any of the sequences in Table 3, and a sense strand that consists
of the sequence of any of the sequences in Table 4 that is at least
partially complementary to the antisense strand.
[0030] Disclosed herein are methods for inhibiting expression of an
HBV gene in a cell, the method comprising administering one or more
HBV RNAi agents having the duplex structure of Table 5.
[0031] Disclosed herein are methods of treatment of an HBV
infection or prevention of disease or symptoms caused by an HBV
infection, the method comprising administering one or more HBV RNAi
agents having an antisense strand comprising the sequence of any of
the sequences in Table 3.
[0032] Disclosed herein are methods of treatment of an HBV
infection or prevention of disease or symptoms caused by an HBV
infection, the method comprising administering one or more HBV RNAi
agents having a sense strand comprising the sequence of any of the
sequences in Table 4.
[0033] Disclosed herein are methods of treatment of an HBV
infection or prevention of disease or symptoms caused by an HBV
infection, the method comprising administering one or more HBV RNAi
agents having an antisense strand comprising the sequence of any of
the sequences in Table 3, and a sense strand comprising the
sequence of any of the sequences in Table 4 that is at least
partially complementary to the antisense strand.
[0034] Disclosed herein are methods of treatment of an HBV
infection or prevention of disease or symptoms caused by an HBV
infection, the method comprising administering one or more HBV RNAi
agents having an antisense strand that consists of the sequence of
any of the sequences in Table 3, and a sense strand that consists
of the sequence of any of the sequences in Table 4 that is at least
partially complementary to the antisense strand.
[0035] Disclosed herein are methods of treatment of an HBV
infection or prevention of disease or symptoms caused by an HBV
infection, the method comprising administering one or more HBV RNAi
agents having the duplex structure of Table 5.
[0036] Disclosed herein are methods for inhibiting expression of an
HBV gene, the method comprising administering (i) an HBV RNAi agent
having an antisense strand comprising or consisting of the sequence
of any of the sequences in Table 2 or Table 3, and (ii) a second
HBV RNAi agent having an antisense strand comprising or consisting
of the sequence of any of the sequences in Table 2 or Table 3.
[0037] Disclosed herein are methods of treatment of an HBV
infection or prevention of disease or symptoms caused by an HBV
infection, the method comprising administering (i) an HBV RNAi
agent having an antisense strand comprising or consisting of the
sequence of any of the sequences in Table 2 or Table 3, and (ii) a
second HBV RNAi agent having an antisense strand comprising or
consisting of the sequence of any of the sequences in Table 2 or
Table 3.
[0038] Disclosed herein are methods for inhibiting expression of an
HBV gene, the method comprising administering (i) a first HBV RNAi
agent having an antisense strand comprising or consisting of the
sequence of any of the sequences in Table 2 or Table 3 and a sense
strand comprising or consisting of the sequence of any of the
sequences in Table 2 or Table 4 that is at least partially
complementary to the antisense strand of the first HBV RNAi agent,
and (ii) a second HBV RNAi agent having an antisense strand
comprising or consisting of the sequence of any of the sequences in
Table 2 or Table 3 and a sense strand comprising or consisting of
the sequence of any of the sequences in Table 2 or Table 4 that is
at least partially complementary to the antisense strand of the
second HBV RNAi agent.
[0039] Disclosed herein are methods of treatment of an HBV
infection or prevention of disease or symptoms caused by an HBV
infection, the method comprising administering (i) a first HBV RNAi
agent having an antisense strand comprising or consisting of the
sequence of any of the sequences in Table 2 or Table 3 and a sense
strand comprising or consisting of the sequence of any of the
sequences in Table 2 or Table 4 that is at least partially
complementary to the antisense strand of the first HBV RNAi agent,
and (ii) a second HBV RNAi agent having an antisense strand
comprising or consisting of the sequence of any of the sequences in
Table 2 or Table 3 and a sense strand comprising or consisting of
the sequence of any of the sequences in Table 2 or Table 4 that is
at least partially complementary to the antisense strand of the
second HBV RNAi agent.
[0040] In some embodiments, an HBV RNAi agent disclosed herein
comprises: [0041] a. an antisense strand that comprises the
nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the
sequence (5'.fwdarw.3') AUUGAGAGAAGUCCACCAC (SEQ ID NO: 7), and a
sense strand that comprises the nucleobase sequence differing by 0,
1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
GUGGUGGACUUCUCUCAAU (SEQ ID NO: 34); or [0042] b. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UUUGAGAGAAGUCCACCAC (SEQ ID NO: 8), and a sense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') GUGGUGGACUUCUCUCAAA
(SEQ ID NO: 35); or [0043] c. an antisense strand that comprises
the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from
the sequence (5'.fwdarw.3') AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12),
and a sense strand that comprises the nucleobase sequence differing
by 0, 1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39); or [0044] d. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13), and a sense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') UGGUGGACUUCUCUCAAUA
(SEQ ID NO: 40); or [0045] e. an antisense strand that comprises
the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from
the sequence (5'.fwdarw.3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17),
and a sense strand that comprises the nucleobase sequence differing
by 0, 1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44); or [0046] f. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18), and a sense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') GGACUUCUCUCAAUUUUCA
(SEQ ID NO: 45); or [0047] g. an antisense strand that comprises
the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from
the sequence (5'.fwdarw.3') ACCAAUUUAUGCCUACAGC (SEQ ID NO: 22),
and a sense strand that comprises the nucleobase sequence differing
by 0, 1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
GCUGUAGGCAUAAAUUGGU (SEQ ID NO: 49); or [0048] h. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UCCAAUUUAUGCCUACAGC (SEQ ID NO: 23), and a sense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') GCUGUAGGCAUAAAUUGGA
(SEQ ID NO: 50); or [0049] i. an antisense strand that comprises
the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from
the sequence (5'.fwdarw.3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27),
and a sense strand that comprises the nucleobase sequence differing
by 0, 1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54); or [0050] j. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
AACCAAUUUAUGCCUACAG (SEQ ID NO: 28), and a sense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') CUGUAGGCAUAAAUUGGUU
(SEQ ID NO: 55); or [0051] k. an antisense strand that comprises
the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from
the sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29),
and a sense strand that comprises the nucleobase sequence differing
by 0, 1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).
[0052] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising an HBV RNAi agent.
[0053] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising two or more HBV RNAi agents, wherein a first HBV RNAi
agent comprises: [0054] i) an antisense strand that comprises the
nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the
sequence (5'.fwdarw.3') AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12), and a
sense strand that comprises the nucleobase sequence differing by 0,
1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39); or [0055] ii) an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13), and a sense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') UGGUGGACUUCUCUCAAUA
(SEQ ID NO: 40); and wherein a second HBV RNAi agent comprises:
[0056] i) an antisense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27), and a sense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54); or [0057] ii) an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
AACCAAUUUAUGCCUACAG (SEQ ID NO: 28), and a sense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') CUGUAGGCAUAAAUUGGUU
(SEQ ID NO: 55); or [0058] iii) an antisense strand that comprises
the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from
the sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29),
and a sense strand that comprises the nucleobase sequence differing
by 0, 1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).
[0059] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising two or more HBV RNAi agents, wherein a first HBV RNAi
agent comprises: [0060] i) an antisense strand that comprises the
nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the
sequence (5'.fwdarw.3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17), and a
sense strand that comprises the nucleobase sequence differing by 0,
1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44); or [0061] ii) an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18), and a sense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') GGACUUCUCUCAAUUUUCA
(SEQ ID NO: 45); and wherein a second HBV RNAi agent comprises:
[0062] i) an antisense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27), and a sense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54); or [0063] ii) an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
AACCAAUUUAUGCCUACAG (SEQ ID NO: 28), and a sense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') CUGUAGGCAUAAAUUGGUU
(SEQ ID NO: 55); or [0064] iii) an antisense strand that comprises
the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from
the sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29),
and a sense strand that comprises the nucleobase sequence differing
by 0, 1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).
[0065] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising two or more HBV RNAi agents, wherein a first HBV RNAi
agent comprises: [0066] i) an antisense strand that comprises the
nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the
sequence (5'.fwdarw.3') AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12), and a
sense strand that comprises the nucleobase sequence differing by 0,
1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39); or [0067] ii) an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13), and a sense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') UGGUGGACUUCUCUCAAUA
(SEQ ID NO: 40); and wherein a second HBV RNAi agent comprises an
antisense strand having a sequence that is at least partially
complementary to a portion of the X ORF of an HBV mRNA.
[0068] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising two or more HBV RNAi agents, wherein a first HBV RNAi
agent comprises: [0069] i) an antisense strand that comprises the
nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the
sequence (5'.fwdarw.3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17), and a
sense strand that comprises the nucleobase sequence differing by 0,
1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44); or [0070] ii) an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18), and a sense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') GGACUUCUCUCAAUUUUCA
(SEQ ID NO: 45); and wherein a second HBV RNAi agent comprises an
antisense strand having a sequence that is at least partially
complementary to a portion of the X ORF of an HBV mRNA:
[0071] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising two or more HBV RNAi agents, wherein a first HBV RNAi
agent comprises an antisense strand having a sequence that is at
least partially complementary to a portion of the S ORF of an HBV
mRNA, and wherein a second HBV RNAi agent comprises: [0072] i) an
antisense strand that comprises the nucleobase sequence differing
by 0, 1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
GACCAAUUUAUGCCUACAG (SEQ ID NO: 27), and a sense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.93') CUGUAGGCAUAAAUUGGUC
(SEQ ID NO: 54); or [0073] ii) an antisense strand that comprises
the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from
the sequence (5'.fwdarw.3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28),
and a sense strand that comprises the nucleobase sequence differing
by 0, 1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or [0074] iii) an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UACCAAUUUAUGCCUACAG (SEQ ID NO: 29), and a sense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') CUGUAGGCAUAAAUUGGUA
(SEQ ID NO: 56).
[0075] In some embodiments, an HBV RNAi agent disclosed herein
comprises: [0076] a. an antisense strand that comprises the
nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the
sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAGGCCUUAU (SEQ ID NO:
149); or [0077] b. an antisense strand that comprises the
nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the
sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAGGCCU (SEQ ID NO: 150);
or [0078] c. an antisense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UACCAAUUUAUGCCUACAGGC (SEQ ID NO: 151); or [0079] d.
an antisense strand that comprises the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence (5'3')
UGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 152); or [0080] e. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154); or [0081] f. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UAUUGAGAGAAGUCCACCACG (SEQ ID NO: 160); or [0082] g. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162); or [0083] h. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 163); or [0084] i. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UAUUGAGAGAAGUCCACCACGA (SEQ ID NO: 170); or [0085] j. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171); or [0086] k. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 172); or [0087] l. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 173); or [0088] m. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UAUUGAGAGAAGUCCACCAUU (SEQ ID NO: 174); or [0089] n. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175); or [0090] o. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
AGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 178); or [0091] p. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
AGAAAAUUGAGAGAAGUCCACUU (SEQ ID NO: 179); or [0092] q. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
AGAAAAUUGAGAGAAGUCCACC (SEQ ID NO: 180); or [0093] r. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 181); or [0094] s. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
ACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 182); or [0095] t. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
ACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 183); or [0096] u. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
ACCAAUUUAUGCCUACAGCCUC (SEQ ID NO: 184); or [0097] v. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UCCAAUUUAUGCCUACAGCUU (SEQ ID NO: 185); or [0098] w. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UCCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 186); or [0099] x. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UACCAAUUUAUGCCUACAGCU (SEQ ID NO: 187); or [0100] y. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188); or [0101] z. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
AACCAAUUUAUGCCUACAGCC (SEQ ID NO: 189); or [0102] aa. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
ACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 190); or [0103] bb. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UCCAAUUUAUGCCUACAGCCU (SEQ ID NO: 191); or [0104] cc. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
ACCAAUUUAUGCCUACAGCCG (SEQ ID NO: 192); or [0105] dd. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UCCAAUUUAUGCCUACAGCCG (SEQ ID NO: 193); or [0106] ee. an antisense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
UACCAAUUUAUGCCUACAGGG (SEQ ID NO: 194): and wherein the HBV RNAi
agent further comprises a sense strand at least partially
complementary to the respective antisense strand.
[0107] In some embodiments, an HBV RNAi agent disclosed herein
comprises: [0108] a. an antisense strand that consists of the
nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the
sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAGGCCUUAU (SEQ ID NO:
149); or [0109] b. an antisense strand that consists of the
nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the
sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAGGCCU (SEQ ID NO: 150);
or [0110] c. an antisense strand that consists of the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UACCAAUUUAUGCCUACAGGC (SEQ ID NO: 151); or [0111] d.
an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 152); or [0112] e.
an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154); or [0113] f.
an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UAUUGAGAGAAGUCCACCACG (SEQ ID NO: 160); or [0114] g.
an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162); or [0115] h.
an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 163); or [0116]
i. an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UAUUGAGAGAAGUCCACCACGA (SEQ ID NO: 170); or [0117]
j. an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171); or [0118] k.
an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 172); or [0119]
l. an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 173); or [0120]
m. an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UAUUGAGAGAAGUCCACCAUU (SEQ ID NO: 174); or [0121] n.
an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175); or [0122]
o. an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') AGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 178); or [0123] p.
an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') AGAAAAUUGAGAGAAGUCCACUU (SEQ ID NO: 179); or [0124]
q. an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') AGAAAAUUGAGAGAAGUCCACC (SEQ ID NO: 180); or [0125]
r. an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 181); or [0126] s.
an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') ACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 182); or [0127] t.
an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') ACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 183); or [0128]
u. an antisense strand that comprises the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') ACCAAUUUAUGCCUACAGCCUC (SEQ ID NO: 184); or [0129]
v. an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UCCAAUUUAUGCCUACAGCUU (SEQ ID NO: 185); or [0130] w.
an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UCCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 186); or [0131]
x. an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UACCAAUUUAUGCCUACAGCU (SEQ ID NO: 187); or [0132] y.
an antisense strand that comprises the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188); or [0133] z.
an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') AACCAAUUUAUGCCUACAGCC (SEQ ID NO: 189); or [0134]
aa. an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') ACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 190); or [0135]
bb. an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UCCAAUUUAUGCCUACAGCCU (SEQ ID NO: 191); or [0136]
cc. an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') ACCAAUUUAUGCCUACAGCCG (SEQ ID NO: 192); or [0137]
dd. an antisense strand that comprises the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UCCAAUUUAUGCCUACAGCCG (SEQ ID NO: 193); or. [0138]
ee. an antisense strand that consists of the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UACCAAUUUAUGCCUACAGGG (SEQ ID NO: 194); and wherein
the HBV RNAi agent further comprises a sense strand at least
partially complementary to the respective antisense strand.
[0139] In some embodiments, an HBV RNAi agent disclosed herein
comprises: [0140] i. an antisense strand that comprises the
sequence differing by 0, 1, 2 or 3 nucleotides from the sequence
(5'.fwdarw.3') usAfscCfaAfuUfuAfuGfcCfuAfcAfgGfccsusuAu (SEQ ID NO:
61); or [0141] ii. an antisense strand that comprises the sequence
differing by 0, 1, 2 or 3 nucleotides from the sequence
(5'.fwdarw.3') usAfscCfaAfuUfuAfuGfcCfuAfcAfgGfcscsu (SEQ ID NO:
62); or [0142] iii. an antisense strand that comprises the sequence
differing by 0, 1, 2 or 3 nucleotides from the sequence
(5'.fwdarw.3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfccsu (SEQ ID NO:
63); or [0143] iv. an antisense strand that comprises the sequence
differing by 0, 1, 2 or 3 nucleotides from the sequence
(5'.fwdarw.3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfsc (SEQ ID NO: 64);
or [0144] v. an antisense strand that comprises the sequence
differing by 0, 1, 2 or 3 nucleotides from the sequence
(5'.fwdarw.3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu (SEQ ID NO: 68);
or [0145] vi. an antisense strand that comprises the sequence
differing by 0, 1, 2 or 3 nucleotides from the sequence
(5'.fwdarw.3') usAfscscaauUfuAfuGfcCfuacagcsc (SEQ ID NO: 85); or
[0146] vii. an antisense strand that comprises the sequence
differing by 0, 1, 2 or 3 nucleotides from the sequence
(5'.fwdarw.3') usAfsusugagAfgAfaGfuCfcaccacsg (SEQ ID NO: 94); or
[0147] viii. an antisense strand that comprises the sequence
differing by 0, 1, 2 or 3 nucleotides from the sequence (5' 3')
usAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfgsa (SEQ ID NO: 98); or [0148] ix.
an antisense strand that comprises the sequence differing by 0, 1,
2 or 3 nucleotides from the sequence (5'.fwdarw.3')
usAfscsCfaAfuuuauGfcCfuAfcAfgcsc (SEQ ID NO: 102); or [0149] x. an
antisense strand that comprises the sequence differing by 0, 1, 2
or 3 nucleotides from the sequence (5'.fwdarw.3')
usAfscsCfaAfuuuauGfcCfuAfcAfgcusu (SEQ ID NO: 103); or [0150] xi.
an antisense strand that comprises the sequence differing by 0, 1,
2 or 3 nucleotides from the sequence (5'.fwdarw.3')
usAfscsCfaAfuuuauGfcCfuAfcAfgccsu (SEQ ID NO: 104); or [0151] xii.
an antisense strand that comprises the sequence differing by 0, 1,
2 or 3 nucleotides from the sequence (5'.fwdarw.3')
usAfscsCfaAfuuuauGfcCfuAfcAfgccusu (SEQ ID NO: 105); or [0152]
xiii. an antisense strand that comprises the sequence differing by
0, 1, 2 or 3 nucleotides from the sequence (5'43')
cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu (SEQ ID NO: 107); or [0153]
xiv. an antisense strand that comprises the sequence differing by
0, 1, 2 or 3 nucleotides from the sequence (5'.fwdarw.3')
cPrpusAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfsg (SEQ ID NO: 108); or [0154]
xv. an antisense strand that comprises the sequence differing by 0,
1, 2 or 3 nucleotides from the sequence (5'.fwdarw.3')
usAfsusUfgAfgagaaGfuCfcAfcCfausu (SEQ ID NO: 109); or [0155] xvi.
an antisense strand that comprises the sequence differing by 0, 1,
2 or 3 nucleotides from the sequence (5'.fwdarw.3')
usAfsusUfgAfgagaaGfuCfcAfcCfacsg (SEQ ID NO: 110); or [0156] xvii.
an antisense strand that comprises the sequence differing by 0, 1,
2 or 3 nucleotides from the sequence (5'.fwdarw.3')
usAfsusUfgAfgagaaGfuCfcAfcCfacsusu (SEQ ID NO: 111); or [0157]
xviii. an antisense strand that comprises the sequence differing by
0, 1, 2 or 3 nucleotides from the sequence (5'.fwdarw.3')
usAfsusUfgAfgagaaGfuCfcAfcCfacsgsa (SEQ ID NO: 112); or [0158] xix.
an antisense strand that comprises the sequence differing by 0, 1,
2 or 3 nucleotides from the sequence (5'.fwdarw.3')
usAfsusUfgAfgagaaGfuCfcAfcCfacusu (SEQ ID NO: 120); or [0159] xx.
an antisense strand that comprises the sequence differing by 0, 1,
2 or 3 nucleotides from the sequence (5'.fwdarw.3')
asGfsasAfaAfuUfgAfgAfgAfaGfuCfcusu (SEQ ID NO: 125); [0160] xxi. an
antisense strand that comprises the sequence differing by 0, 1, 2
or 3 nucleotides from the sequence (5'.fwdarw.3')
asGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID NO: 126); or [0161]
xxii. an antisense strand that comprises the sequence differing by
0, 1, 2 or 3 nucleotides from the sequence (5'.fwdarw.3')
asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacusu (SEQ ID NO: 127); or [0162]
xxiii. an antisense strand that comprises the sequence differing by
0, 1, 2 or 3 nucleotides from the sequence (5'.fwdarw.3')
asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacsc (SEQ ID NO: 128); or [0163]
xxiv. an antisense strand that comprises the sequence differing by
0, 1, 2 or 3 nucleotides from the sequence (5'.fwdarw.3')
usGfsasAfaAfuUfgAfgAfgAfaGfuCfcusu (SEQ ID NO: 129); or [0164] xxv.
an antisense strand that comprises the sequence differing by 0, 1,
2 or 3 nucleotides from the sequence (5'.fwdarw.3')
usGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID NO: 130); or [0165]
xxvi. an antisense strand that comprises the sequence differing by
0, 1, 2 or 3 nucleotides from the sequence (5'.fwdarw.3')
asCfscsAfaUfuUfaUfgCfcUfaCfaGfcusu (SEQ ID NO: 131); or [0166]
xxvii. an antisense strand that comprises the sequence differing by
0, 1, 2 or 3 nucleotides from the sequence (5'.fwdarw.3')
asCfscsAfaUfuUfaUfgCfcUfaCfaGfccusu (SEQ ID NO: 132); or [0167]
xxviii. an antisense strand that comprises the sequence differing
by 0, 1, 2 or 3 nucleotides from the sequence (5'.fwdarw.3')
asCfscsAfaUfuUfaUfgCfcUfaCfaGfccusc (SEQ ID NO: 133); or [0168]
xxix. an antisense strand that comprises the sequence differing by
0, 1, 2 or 3 nucleotides from the sequence (5'.fwdarw.3')
usCfscsAfaUfuUfaUfgCfcUfaCfaGfcusu (SEQ ID NO: 134); or [0169] xxx.
an antisense strand that comprises the sequence differing by 0, 1,
2 or 3 nucleotides from the sequence (5'.fwdarw.3')
usCfscsAfaUfuUfaUfgCfcUfaCfaGfccusu (SEQ ID NO: 135); or [0170]
xxxi. an antisense strand that comprises the sequence differing by
0, 1, 2 or 3 nucleotides from the sequence (5'.fwdarw.3')
cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc (SEQ ID NO: 136); or [0171]
xxxii. an antisense strand that comprises the sequence differing by
0, 1, 2 or 3 nucleotides from the sequence (5'.fwdarw.3')
usAfscsCfaAfuUfuAfuGfcCfuAfcAfgscsc (SEQ ID NO: 137); or [0172]
xxxiii. an antisense strand that comprises the sequence differing
by 0, 1, 2 or 3 nucleotides from the sequence (5'.fwdarw.3')
cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgscsc (SEQ ID NO: 138); or [0173]
xxxiv. an antisense strand that comprises the sequence differing by
0, 1, 2 or 3 nucleotides from the sequence (5'.fwdarw.3')
usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsu (SEQ ID NO: 139); or [0174]
xxxv. an antisense strand that comprises the sequence differing by
0, 1, 2 or 3 nucleotides from the sequence (5'.fwdarw.3')
usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsg (SEQ ID NO: 140); or [0175]
xxxvi. an antisense strand that comprises the sequence differing by
0, 1, 2 or 3 nucleotides from the sequence (5'.fwdarw.3')
asAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc (SEQ ID NO: 141); or [0176]
xxxvii. an antisense strand that comprises the sequence differing
by 0, 1, 2 or 3 nucleotides from the sequence (5'.fwdarw.3')
usAfscsCfaAfuUfUfAfuGfcCfuAfcAfgusu (SEQ ID NO: 142); or [0177]
xxxviii. an antisense strand that comprises the sequence differing
by 0, 1, 2 or 3 nucleotides from the sequence (5'.fwdarw.3')
usAfscsCfaAfuUfuAfuGfcCfuAfcAfgCfsc (SEQ ID NO: 143); or [0178]
xxxix. an antisense strand that comprises the sequence differing by
0, 1, 2 or 3 nucleotides from the sequence (5'.fwdarw.3')
asCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu (SEQ ID NO: 144); or [0179] xl.
an antisense strand that comprises the sequence differing by 0, 1,
2 or 3 nucleotides from the sequence (5'.fwdarw.3')
usCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu (SEQ ID NO: 145); or [0180] xli.
an antisense strand that comprises the sequence differing by 0, 1,
2 or 3 nucleotides from the sequence (5'.fwdarw.3')
asCfscAfaUfuUfaUfgCfcUfaCfaGfccsg (SEQ ID NO: 146); or [0181] xlii.
an antisense strand that comprises the sequence differing by 0, 1,
2 or 3 nucleotides from the sequence (5'.fwdarw.3')
usCfscAfaUfuUfaUfgCfcUfaCfaGfccsg (SEQ ID NO: 147); or [0182]
xliii. an antisense strand that comprises the sequence differing by
0, 1, 2 or 3 nucleotides from the sequence (5'.fwdarw.3')
usAfscsCfaAfuUfuAfuGfcCfuAfcAfggsg (SEQ ID NO: 148); wherein a, g,
c and u are 2'-O-methyl (2'-OMe) modified nucleotides; Af, Cf, Gf,
and Uf are 2'-fluoro modified nucleotides; s is a phosphorothioate
internucleoside linkage and the remaining nucleotide monomers are
linked by phosphodiester bonds; and cPrpu is 5'-cyclopropyl
phosphonate-2'-O-methyl modified nucleotide; and wherein the HBV
RNAi agent further comprises a sense strand at least partially
complementary to the respective antisense strand.
[0183] In some embodiments, an HBV RNAi agent disclosed herein
comprises: [0184] i. an antisense strand that consists of the
sequence (5'.fwdarw.3') usAfscCfaAfuUfuAfuGfcCfuAfcAfgGfccsusuAu
(SEQ ID NO: 61); or [0185] ii. an antisense strand that consists of
the sequence (5'.fwdarw.3') usAfscCfaAfuUfuAfuGfcCfuAfcAfgGfcscsu
(SEQ ID NO: 62); or [0186] iii. an antisense strand that consists
of the sequence (5'.fwdarw.3')
usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfccsu (SEQ ID NO: 63); or [0187]
iv. an antisense strand that consists of the sequence
(5'.fwdarw.3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfsc (SEQ ID NO: 64);
or [0188] v. an antisense strand that consists of the sequence
(5'.fwdarw.3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu (SEQ ID NO: 68);
or [0189] vi. an antisense strand that consists of the sequence
(5'.fwdarw.3') usAfscscaauUfuAfuGfcCfuacagcsc (SEQ ID NO: 85); or
[0190] vii. an antisense strand that consists of the sequence
(5'.fwdarw.3') usAfsusugagAfgAfaGfuCfcaccacsg (SEQ ID NO: 94); or
[0191] viii. an antisense strand that consists of the sequence
(5'.fwdarw.3') usAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfgsa (SEQ ID NO:
98); or [0192] ix. an antisense strand that consists of the
sequence (5'.fwdarw.3') usAfscsCfaAfuuuauGfcCfuAfcAfgcsc (SEQ ID
NO: 102); or [0193] x. an antisense strand that consists of the
sequence (5'.fwdarw.3') usAfscsCfaAfuuuauGfcCfuAfcAfgcusu (SEQ ID
NO: 103); or [0194] xi. an antisense strand that consists of the
sequence (5'.fwdarw.3') usAfscsCfaAfuuuauGfcCfuAfcAfgccsu (SEQ ID
NO: 104); or [0195] xii. an antisense strand that consists of the
sequence (5'.fwdarw.93') usAfscsCfaAfuuuauGfcCfuAfcAfgccusu (SEQ ID
NO: 105); or [0196] xiii. an antisense strand that consists of the
sequence (5'.fwdarw.3') cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu (SEQ
ID NO: 107); or [0197] xiv. an antisense strand that consists of
the sequence (5'.fwdarw.3') cPrpusAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfsg
(SEQ ID NO: 108); or [0198] xv. an antisense strand that consists
of the sequence (5'.fwdarw.3') usAfsusUfgAfgagaaGfuCfcAfcCfausu
(SEQ ID NO: 109); or [0199] xvi. an antisense strand that consists
of the sequence (5'.fwdarw.3') usAfsusUfgAfgagaaGfuCfcAfcCfacsg
(SEQ ID NO: 110); or [0200] xvii. an antisense strand that consists
of the sequence (5'.fwdarw.3') usAfsusUfgAfgagaaGfuCfcAfcCfacsusu
(SEQ ID NO: 111); or [0201] xviii. an antisense strand that
consists of the sequence (5'.fwdarw.3')
usAfsusUfgAfgagaaGfuCfcAfcCfacsgsa (SEQ ID NO: 112); or [0202] xix.
an antisense strand that consists of the sequence (5'.fwdarw.3')
usAfsusUfgAfgagaaGfuCfcAfcCfacusu (SEQ ID NO: 120); or [0203] xx.
an antisense strand that consists of the sequence (5'.fwdarw.3')
asGfsasAfaAfuUfgAfgAfgAfaGfuCfcusu (SEQ ID NO: 125); [0204] xxi. an
antisense strand that consists of the sequence (5'.fwdarw.3')
asGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID NO: 126); or [0205]
xxii. an antisense strand that consists of the sequence
(5'.fwdarw.3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacusu (SEQ ID NO:
127); or [0206] xxiii. an antisense strand that consists of the
sequence (5'.fwdarw.3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacsc (SEQ ID
NO: 128); or [0207] xxiv. an antisense strand that consists of the
sequence (5'.fwdarw.3') usGfsasAfaAfuUfgAfgAfgAfaGfuCfcusu (SEQ ID
NO: 129); or [0208] xxv. an antisense strand that consists of the
sequence (5'.fwdarw.3') usGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID
NO: 130); or [0209] xxvi. an antisense strand that consists of the
sequence (5'.fwdarw.3') asCfscsAfaUfuUfaUfgCfcUfaCfaGfcusu (SEQ ID
NO: 131); or [0210] xxvii. an antisense strand that consists of the
sequence (5'.fwdarw.3') asCfscsAfaUfuUfaUfgCfcUfaCfaGfccusu (SEQ ID
NO: 132); or [0211] xxviii. an antisense strand that consists of
the sequence (5'.fwdarw.3') asCfscsAfaUfuUfaUfgCfcUfaCfaGfccusc
(SEQ ID NO: 133); or [0212] xxix. an antisense strand that consists
of the sequence (5'.fwdarw.3') usCfscsAfaUfuUfaUfgCfcUfaCfaGfcusu
(SEQ ID NO: 134); or [0213] xxx. an antisense strand that consists
of the sequence (5'.fwdarw.3') usCfscsAfaUfuUfaUfgCfcUfaCfaGfccusu
(SEQ ID NO: 135); or [0214] xxxi. an antisense strand that consists
of the sequence (5'.fwdarw.3')
cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc (SEQ ID NO: 136); or [0215]
xxxii. an antisense strand that consists of the sequence
(5'.fwdarw.3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgscsc (SEQ ID NO:
137); or [0216] xxxiii. an antisense strand that consists of the
sequence (5'.fwdarw.3') cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgscsc
(SEQ ID NO: 138); or [0217] xxxiv. an antisense strand that
consists of the sequence (5'.fwdarw.3')
usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsu (SEQ ID NO: 139); or [0218]
xxxv. an antisense strand that consists of the sequence
(5'.fwdarw.3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsg (SEQ ID NO: 140);
or [0219] xxxvi. an antisense strand that consists of the sequence
(5'.fwdarw.3') asAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc (SEQ ID NO: 141);
or [0220] xxxvii. an antisense strand that consists of the sequence
(5'.fwdarw.3') usAfscsCfaAfuUfUfAfuGfcCfuAfcAfgusu (SEQ ID NO:
142); or [0221] xxxviii. an antisense strand that consists of the
sequence (5'.fwdarw.3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgCfsc (SEQ ID
NO: 143); or [0222] xxxix. an antisense strand that consists of the
sequence (5'.fwdarw.3') asCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu (SEQ ID
NO: 144); or [0223] xl. an antisense strand that consists of the
sequence (5'.fwdarw.3') usCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu (SEQ ID
NO: 145); or [0224] xli. an antisense strand that consists of the
sequence (5'.fwdarw.3') asCfscAfaUfuUfaUfgCfcUfaCfaGfccsg (SEQ ID
NO: 146); or [0225] xlii. an antisense strand that consists of the
sequence (5'.fwdarw.3') usCfscAfaUfuUfaUfgCfcUfaCfaGfccsg (SEQ ID
NO: 147); or [0226] xliii. an antisense strand that consists of the
sequence (5'.fwdarw.3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfggsg (SEQ ID
NO: 148); wherein a, g, c and u are 2'-O-methyl (2'-OMe) modified
nucleotides; Af, Cf, Of, and Uf are 2'-fluoro modified nucleotides;
s is a phosphorothioate internucleoside linkage and the remaining
nucleotide monomers are linked by phosphodiester bonds; and cPrpu
is 5'-cyclopropyl phosphonate-2'-O-methyl modified nucleotide; and
wherein the HBV RNAi agent further comprises a sense strand at
least partially complementary to the respective antisense
strand.
[0227] In some embodiments, an HBV RNAi agent disclosed herein
comprises: [0228] a. a sense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UUGCCUGUAGGCAUAAAUUGGUAUT (SEQ ID NO: 275); or
[0229] b. a sense strand that comprises the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UAUAUGCCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 276); or
[0230] c. a sense strand that comprises the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') CUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 278); or [0231] d.
a sense strand that comprises the nucleobase sequence differing by
0, 1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
CGUGGUGGACUUCUCUCAAUU (SEQ ID NO: 285); or [0232] e. a sense strand
that comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') CGUGGUGGACUUCUCUCAAUA
(SEQ ID NO: 289); or [0233] f. a sense strand that comprises the
nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the
sequence (5'.fwdarw.3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292); or
[0234] g. a sense strand that comprises the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294); or [0235] h.
a sense strand that comprises the nucleobase sequence differing by
0, 1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
UCGUGGUGGACUUCUCUCAAUU (SEQ ID NO: 300); or [0236] i. a sense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); or [0237] j. a sense strand
that comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') GCUGUAGGCAUAAAUUGGUAUU
(SEQ ID NO: 303); or [0238] k. a sense strand that comprises the
nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the
sequence (5'.fwdarw.3') GGCUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 304);
or [0239] l. a sense strand that comprises the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 306); or [0240] m.
a sense strand that comprises the nucleobase sequence differing by
0, 1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); or [0241] n. a sense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
AAUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 308); or [0242] o. a sense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
GGACUUCUCUCAAUUUUCU (SEQ ID NO: 318); or [0243] p. a sense strand
that comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') GGUGGACUUCUCUCAAUUUUCU
(SEQ ID NO: 319); or [0244] q. a sense strand that comprises the
nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the
sequence (5'.fwdarw.3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 320); or
[0245] r. a sense strand that comprises the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') GUGGACUUCUCUCAAUUUUCA (SEQ ID NO: 321); or [0246] s.
a sense strand that comprises the nucleobase sequence differing by
0, 1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
GCUGUAGGCAUAAAUUGGU (SEQ ID NO: 322); or [0247] t. a sense strand
that comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') GGCUGUAGGCAUAAAUUGGU
(SEQ ID NO: 323); or [0248] u. a sense strand that comprises the
nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the
sequence (5'.fwdarw.3') GAGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 324); or
[0249] v. a sense strand that comprises the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') GCUGUAGGCAUAAAUUGGA (SEQ ID NO: 325); or [0250] w. a
sense strand that comprises the nucleobase sequence differing by 0,
1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
GGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 326); or [0251] x. a sense strand
that comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') AGCUGUAGGCAUAAAUUGGUA
(SEQ ID NO: 327); or [0252] y. a sense strand that comprises the
nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the
sequence (5'.fwdarw.3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328); or
[0253] z. a sense strand that comprises the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') GGCUGUAGGCAUAAAUUGGUU (SEQ ID NO: 329); or [0254]
aa. an antisense strand that comprises the nucleobase sequence
differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') AGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 330); or [0255]
bb. a sense strand that comprises the nucleobase sequence differing
by 0, 1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
AGGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 331); or [0256] cc. a sense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
CGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 332); or [0257] dd. a sense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
CGGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 333); or [0258] ee. a sense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
CCCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 334); and wherein the HBV RNAi
agent further comprises an antisense strand at least partially
complementary to the respective antisense strand.
[0259] In some embodiments, an HBV RNAi agent disclosed herein
comprises: [0260] a. a sense strand that consists of the nucleobase
sequence (5'.fwdarw.3') UUGCCUGUAGGCAUAAAUUGGUAUT (SEQ ID NO: 275);
or [0261] b. a sense strand that consists of the nucleobase
sequence (5'.fwdarw.3') UAUAUGCCUGUAGGCAUAAAUUGGUA (SEQ ID NO:
276); or [0262] c. a sense strand that consists of the nucleobase
sequence (5'.fwdarw.3') CUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 278); or
[0263] d. a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') CGUGGUGGACUUCUCUCAAUU (SEQ ID NO: 285); or [0264] e.
a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') CGUGGUGGACUUCUCUCAAUA (SEQ ID NO: 289); or [0265] f.
a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292); or [0266] g. a
sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294); or [0267] h.
a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') UCGUGGUGGACUUCUCUCAAUU (SEQ ID NO: 300); or [0268]
i. a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); or [0269] j.
a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') GCUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 303); or [0270]
k. a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') GGCUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 304); or [0271]
l. a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') UGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 306); or [0272] m.
a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); or [0273]
n. a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') AAUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 308); or [0274]
o. a sense strand that comprises the nucleobase sequence
(5'.fwdarw.3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 318); or [0275] p. a
sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') GGUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 319); or [0276]
q. a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 320); or [0277] r. a
sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') GUGGACUUCUCUCAAUUUUCA (SEQ ID NO: 321); or [0278] s.
a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') GCUGUAGGCAUAAAUUGGU (SEQ ID NO: 322); or [0279] t. a
sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') GGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 323); or [0280] u.
a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') GAGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 324); or [0281]
v. a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') GCUGUAGGCAUAAAUUGGA (SEQ ID NO: 325); or [0282] w. a
sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') GGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 326); or [0283] x.
a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') AGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 327); or [0284] y.
a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328); or [0285] z.
a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') GGCUGUAGGCAUAAAUUGGUU (SEQ ID NO: 329); or [0286]
aa. an antisense strand that comprises the nucleobase sequence
(5'.fwdarw.3') AGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 330); or [0287]
bb. a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') AGGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 331); or [0288]
cc. a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') CGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 332); or [0289]
dd. a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') CGGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 333); or [0290]
ee. a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') CCCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 334); and wherein
the HBV RNAi agent further comprises an antisense strand at least
partially complementary to the respective antisense strand.
[0291] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising two HBV RNAi agents, wherein a first HBV RNAi agent
comprises an antisense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175), and a sense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); and wherein a second HBV
RNAi agent comprises an antisense strand that comprises the
nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the
sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154), and
a sense strand that comprises the nucleobase sequence differing by
0, 1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292).
[0292] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising two HBV RNAi agents, wherein a first HBV RNAi agent
comprises an antisense strand that consists of the nucleobase
sequence (5'.fwdarw.3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175),
and a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); and wherein
a second HBV RNAi agent comprises an antisense strand that consists
of the nucleobase sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAGUU
(SEQ ID NO: 154), and a sense strand that consists of the
nucleobase sequence (5'.fwdarw.3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO:
292).
[0293] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising two HBV RNAi agents, wherein a first HBV RNAi agent
comprises an antisense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein a second HBV
RNAi agent comprises an antisense strand that comprises the
nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the
sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188), and
a sense strand that comprises the nucleobase sequence differing by
0, 1, 2 or 3 nucleobases from the sequence (5'43')
CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328).
[0294] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising two HBV RNAi agents, wherein a first HBV RNAi agent
comprises an antisense strand that consists of the nucleobase
sequence (5'.fwdarw.3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and
a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein
a second HBV RNAi agent comprises an antisense strand that consists
of the nucleobase sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAGCG
(SEQ ID NO: 188), and a sense strand that consists of the
nucleobase sequence (5'.fwdarw.3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID
NO: 328).
[0295] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising two HBV RNAi agents, wherein a first HBV RNAi agent
comprises an antisense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein a second HBV
RNAi agent comprises an antisense strand that comprises the
nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the
sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and
a sense strand that comprises the nucleobase sequence differing by
0, 1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294).
[0296] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising two HBV RNAi agents, wherein a first HBV RNAi agent
comprises an antisense strand that consists of the nucleobase
sequence (5'.fwdarw.3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and
a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein
a second HBV RNAi agent comprises an antisense strand that consists
of the nucleobase sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAGCC
(SEQ ID NO: 162), and a sense strand that consists of the
nucleobase sequence (5'.fwdarw.3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID
NO: 294).
[0297] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising two HBV RNAi agents, wherein a first HBV RNAi agent
comprises an antisense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense
strand that comprises the nucleobase sequence differing by 0, 1, 2
or 3 nucleobases from the sequence (5'.fwdarw.3')
GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein a second HBV
RNAi agent comprises an antisense strand that comprises the
nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the
sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and
a sense strand that comprises the nucleobase sequence differing by
0, 1, 2 or 3 nucleobases from the sequence (5'.fwdarw.3')
GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307).
[0298] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising two HBV RNAi agents, wherein a first HBV RNAi agent
comprises an antisense strand that consists of the nucleobase
sequence (5'.fwdarw.3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and
a sense strand that consists of the nucleobase sequence
(5'.fwdarw.3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein
a second HBV RNAi agent comprises an antisense strand that consists
of the nucleobase sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAGCC
(SEQ ID NO: 162), and a sense strand that consists of the
nucleobase sequence (5'.fwdarw.3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID
NO: 307).
[0299] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising two HBV RNAi agents, wherein all or substantially all of
the nucleotides in the sense strand are modified and/or all or
substantially all of the nucleotides in the antisense strand in the
first and/or second HBV RNAi agent are modified nucleotides, and
wherein the first HBV RNAi agent comprises an antisense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') UAUUGAGAGAAGUCCACCACUU
(SEQ ID NO: 175), and a sense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); and wherein
the second HBV RNAi agent comprises an antisense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAGUU
(SEQ ID NO: 154), and a sense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292).
[0300] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising two HBV RNAi agents, wherein all or substantially all of
the nucleotides in the sense strand are modified and/or all or
substantially all of the nucleotides in the antisense strand in the
first and/or second HBV RNAi agent are modified nucleotides, and
wherein the first HBV RNAi agent comprises an antisense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') AGAAAAUUGAGAGAAGUCCAC
(SEQ ID NO: 171), and a sense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein
the second HBV RNAi agent comprises an antisense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAGCG
(SEQ ID NO: 188), and a sense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328).
[0301] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising two HBV RNAi agents, wherein all or substantially all of
the nucleotides in the sense strand are modified and/or all or
substantially all of the nucleotides in the antisense strand in the
first and/or second HBV RNAi agent are modified nucleotides, and
wherein the first HBV RNAi agent comprises an antisense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') AGAAAAUUGAGAGAAGUCCAC
(SEQ ID NO: 171), and a sense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein
the second HBV RNAi agent comprises an antisense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAGCC
(SEQ ID NO: 162), and a sense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294).
[0302] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising two HBV RNAi agents, wherein all or substantially all of
the nucleotides in the sense strand are modified and/or all or
substantially all of the nucleotides in the antisense strand in the
first and/or second HBV RNAi agent are modified nucleotides, and
wherein the first HBV RNAi agent comprises an antisense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') AGAAAAUUGAGAGAAGUCCAC
(SEQ ID NO: 171), and a sense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein
the second HBV RNAi agent comprises an antisense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAGCC
(SEQ ID NO: 162), and a sense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307).
[0303] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising two HBV RNAi agents, wherein all or substantially all of
the nucleotides in the sense strand are modified and/or all or
substantially all of the nucleotides in the antisense strand in the
first and/or second HBV RNAi agent are modified nucleotides, and
wherein the first HBV RNAi agent comprises an antisense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') UAUUGAGAGAAGUCCACCACUU
(SEQ ID NO: 175), and a sense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); and wherein
the second HBV RNAi agent comprises an antisense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAGUU
(SEQ ID NO: 154), and a sense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292), and wherein
the sense strand of the first HBV RNAi agent and the second HBV
RNAi agent are conjugated to a targeting ligand comprising
N-acetyl-galactosamine.
[0304] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising two HBV RNAi agents, wherein all or substantially all of
the nucleotides in the sense strand are modified and/or all or
substantially all of the nucleotides in the antisense strand in the
first and/or second HBV RNAi agent are modified nucleotides, and
wherein the first HBV RNAi agent comprises an antisense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') AGAAAAUUGAGAGAAGUCCAC
(SEQ ID NO: 171), and a sense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein
the second HBV RNAi agent comprises an antisense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAGCG
(SEQ ID NO: 188), and a sense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328), and wherein
the sense strand of the first HBV RNAi agent and the second HBV
RNAi agent are conjugated to a targeting ligand comprising
N-acetyl-galactosamine.
[0305] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising two HBV RNAi agents, wherein all or substantially all of
the nucleotides in the sense strand are modified and/or all or
substantially all of the nucleotides in the antisense strand in the
first and/or second HBV RNAi agent are modified nucleotides, and
wherein the first HBV RNAi agent comprises an antisense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') AGAAAAUUGAGAGAAGUCCAC
(SEQ ID NO: 171), and a sense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein
the second HBV RNAi agent comprises an antisense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAGCC
(SEQ ID NO: 162), and a sense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294), and wherein
the sense strand of the first HBV RNAi agent and the second HBV
RNAi agent are conjugated to a targeting ligand comprising
N-acetyl-galactosamine.
[0306] In some embodiments, disclosed herein are compositions for
inhibiting expression of an HBV gene in a cell, the composition
comprising two HBV RNAi agents, wherein all or substantially all of
the nucleotides in the sense strand are modified and/or all or
substantially all of the nucleotides in the antisense strand in the
first and/or second HBV RNAi agent are modified nucleotides, and
wherein the first HBV RNAi agent comprises an antisense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') AGAAAAUUGAGAGAAGUCCAC
(SEQ ID NO: 171), and a sense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein
the second HBV RNAi agent comprises an antisense strand that
comprises the nucleobase sequence differing by 0, 1, 2 or 3
nucleobases from the sequence (5'.fwdarw.3') UACCAAUUUAUGCCUACAGCC
(SEQ ID NO: 162), and a sense strand that comprises the nucleobase
sequence differing by 0, 1, 2 or 3 nucleobases from the sequence
(5'.fwdarw.3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307), and wherein
the sense strand of the first HBV RNAi agent and the second HBV
RNAi agent are conjugated to a targeting ligand comprising
N-acetyl-galactosamine.
[0307] In some embodiments, disclosed herein are methods of
treatment of an HBV infection or prevention of disease or symptoms
caused by an HBV infection comprising administering to a subject in
need thereof an effective amount of AD04872 and an effective amount
of AD05070. In some embodiments, the ratio of AD04872 to AD05070
administered to a subject in need thereof is about 2:1. In some
embodiments, the ratio of AD04872 to AD05070 administered to a
subject in need thereof is about 3:1. In some embodiments, the
ratio of AD04872 to AD05070 administered to a subject in need
thereof is about 1:1. In some embodiments, the ratio of AD04872 to
AD05070 administered to a subject in need thereof is about 4:1. In
some embodiments, the ratio of AD04872 to AD05070 administered to a
subject in need thereof is about 5:1. In some embodiments, the
ratio of AD04872 to AD05070 administered to a subject in need
thereof is about 1:2.
[0308] In some embodiments, about 1 mg/kg (mpk) of AD04872 and
about 1 mg/kg of AD05070 are administered to a subject in need
thereof. In some embodiments, about 1.5 mg/kg of AD04872 and about
1.5 mg/kg of AD05070 are administered to a subject in need thereof.
In some embodiments, about 2.0 mg/kg of AD04872 and about 1.0 mg/kg
of AD05070 are administered to a subject in need thereof. In some
embodiments, about 3.0 mg/kg of AD04872 and about 1.0 mg/kg of
AD05070 are administered to a subject in need thereof. In some
embodiments, about 3.2 mg/kg of AD04872 and about 0.8 mg/kg of
AD05070 are administered to a subject in need thereof. In some
embodiments, about 2.7 mg/kg of AD04872 and about 1.3 mg/kg of
AD05070 are administered to a subject in need thereof. In some
embodiments, about 4.0 mg/kg of AD04872 and about 1.0 mg/kg of
AD05070 are administered to a subject in need thereof. In some
embodiments, about 3.3 mg/kg of AD04872 and about 1.7 mg/kg of
AD05070 are administered to a subject in need thereof. In some
embodiments, between about 0.05 and about 5 mg/kg of AD04872 and
between about 0.05 and about 5 mg/kg of AD05070 are administered to
a subject in need thereof. In some embodiments, about AD04872 and
about AD05070 are administered separately (e.g., in separate
injections). In some embodiments, the respective dose of AD04872
and the respective dose of AD05070 are administered together (e.g.,
in the same injection). In some embodiments, the respective dose of
AD04872 and the respective dose of AD05070 are prepared in a single
pharmaceutical composition.
[0309] In some embodiments, disclosed herein are methods of
treatment of an HBV infection or prevention of diseases or symptoms
caused by an HBV infection comprising administering to a subject in
need thereof an effective amount of AD04872 and an effective amount
of AD04776. In some embodiments, the ratio of AD04872 to AD04776
administered to a subject in need thereof is about 2:1. In some
embodiments, the ratio of AD04872 to AD04776 administered to a
subject in need thereof is about 3:1. In some embodiments, the
ratio of AD04872 to AD04776 administered to a subject in need
thereof is about 4:1. In some embodiments, the ratio of AD04872 to
AD04776 administered to a subject in need thereof is about 1:1. In
some embodiments, the ratio of AD04872 to AD04776 administered to a
subject in need thereof is 5:1. In some embodiments, the ratio of
AD04872 to AD04776 administered to a subject in need thereof is
1:2.
[0310] In some embodiments, about 1 mg/kg (mpk) of AD04872 and
about 1 mg/kg of AD04776 are administered to a subject in need
thereof. In some embodiments, about 1.5 mg/kg of AD04872 and about
1.5 mg/kg of AD04776 are administered to a subject in need thereof.
In some embodiments, about 2.0 mg/kg of AD04872 and about 1.0 mg/kg
of AD04776 are administered to a subject in need thereof. In some
embodiments, about 3.0 mg/kg of AD04872 and about 1.0 mg/kg of
AD04776 are administered to a subject in need thereof. In some
embodiments, about 3.2 mg/kg of AD04872 and about 0.8 mg/kg of
AD04776 are administered to a subject in need thereof. In some
embodiments, about 2.7 mg/kg of AD04872 and about 1.3 mg/kg of
AD04776 are administered to a subject in need thereof. In some
embodiments, about 4.0 mg/kg of AD04872 and about 1.0 mg/kg of
AD04776 are administered to a subject in need thereof. In some
embodiments, about 3.3 mg/kg of AD04872 and about 1.7 mg/kg of
AD04776 are administered to a subject in need thereof. In some
embodiments, between about 0.05 and about 5 mg/kg of AD04872 and
between about 0.05 and about 5 mg/kg of AD04776 are administered to
a subject in need thereof. In some embodiments, the respective
doses of AD04872 and AD04776 are administered separately (e.g., in
separate injections). In some embodiments, the respective doses of
AD04872 and AD04776 are administered together (e.g., in the same
injection). In some embodiments, the respective doses of AD04872
and AD04776 are prepared in a single pharmaceutical
composition.
[0311] In some embodiments, disclosed herein are methods of
treatment of an HBV infection or prevention of disease or symptoms
caused by an HBV infection comprising administering to a subject in
need thereof an effective amount of AD04872 and an effective amount
of AD04982. In some embodiments, the ratio of AD04872 to AD04982
administered to a subject in need thereof is about 2:1. In some
embodiments, the ratio of AD04872 to AD04982 administered to a
subject in need thereof is about 3:1. In some embodiments, the
ratio of AD04872 to AD04982 administered to a subject in need
thereof is about 4:1. In some embodiments, the ratio of AD04872 to
AD04982 administered to a subject in need thereof is about 1:1. In
some embodiments, the ratio of AD04872 to AD04982 administered to a
subject in need thereof is about 5:1. In some embodiments, the
ratio of AD04872 to AD04982 administered to a subject in need
thereof is 1:2.
[0312] In some embodiments, about 1 mg/kg (mpk) of AD04872 and
about 1 mg/kg of AD04982 are administered to a subject in need
thereof. In some embodiments, about 1.5 mg/kg of AD04872 and about
1.5 mg/kg of AD04982 are administered to a subject in need thereof.
In some embodiments, about 2.0 mg/kg of AD04872 and about 1.0 mg/kg
of AD04982 are administered to a subject in need thereof. In some
embodiments, about 3.0 mg/kg of AD04872 and about 1.0 mg/kg of
AD04982 are administered to a subject in need thereof. In some
embodiments, about 3.2 mg/kg of AD04872 and about 0.8 mg/kg of
AD04982 are administered to a subject in need thereof. In some
embodiments, about 2.7 mg/kg of AD04872 and about 1.3 mg/kg of
AD04982 are administered to a subject in need thereof. In some
embodiments, about 4.0 mg/kg of AD04872 and about 1.0 mg/kg of
AD04982 are administered to a subject in need thereof. In some
embodiments, about 3.3 mg/kg of AD04872 and about 1.7 mg/kg of
AD04982 are administered to a subject in need thereof. In some
embodiments, between about 0.05 and about 5 mg/lg of AD04872 and
between about 0.05 and about 5 mg/kg of AD04982 are administered to
a subject in need thereof. In some embodiments, the respective
doses of AD04872 and AD04982 are administered separately (e.g., in
separate injections). In some embodiments, the respective doses of
AD04872 and AD04982 are administered together (e.g., in the same
injection). In some embodiments, the respective doses of AD04872
and AD04982 are prepared in a single pharmaceutical
composition.
[0313] In some embodiments, disclosed herein are methods of
treatment of an HBV infection or prevention of disease or symptoms
caused by an HBV infection comprising administering to a subject in
need thereof an effective amount of AD04580 and an effective amount
of AD04585. In some embodiments, the ratio of AD04580 to AD04585
administered to a subject in need thereof is about 2:1. In some
embodiments, the ratio of AD04580 to AD04585 administered to a
subject in need thereof is about 3:1. In some embodiments, the
ratio of AD04580 to AD04585 administered to a subject in need
thereof is about 4:1. In some embodiments, the ratio of AD04580 to
AD04585 administered to a subject in need thereof is about 5:1. In
some embodiments, the ratio of AD04580 to AD04585 administered to a
subject in need thereof is about 1:1. In some embodiments, the
ratio of AD04580 to AD04585 administered to a subject in need
thereof is about 1:2. In some embodiments, about 1 mg/kg (mpk) of
AD04580 and about 1 mg/kg of AD04585 are administered to a subject
in need thereof. In some embodiments, about 1.5 mg/kg of AD04580
and about 1.5 mg/kg of AD04585 are administered to a subject in
need thereof. In some embodiments, between about 0.05 and about 5
mg/kg of AD04580 and between about 0.05 and about 5 mg/kg of
AD04585 are administered to a subject in need thereof.
[0314] In some embodiments, an HBV RNAi agent disclosed herein
consists of or comprises AD05070 linked to (NAG37)s shown as a
sodium salt having the structure represented by the following:
[0315] In some embodiments, an HBV RNAi agent disclosed herein
consists of or comprises AD05070 linked to (NAG25)s shown as a
sodium salt having the structure represented by the following:
[0316] In some embodiments, an HBV RNAi agent disclosed herein
consists of or comprises AD05070 linked to (NAG37)s shown as a free
acid having the structure represented by the following:
[0317] In some embodiments, an HBV RNAi agent disclosed herein
consists of or comprises AD04580 linked to (NAG31)s shown as a
sodium salt having the structure represented by the following:
[0318] In some embodiments, an HBV RNAi agent disclosed herein
consists of or comprises AD04585 linked to (NAG25)s shown as a
sodium salt having the structure represented by the following:
[0319] In some embodiments, an HBV RNAi agent disclosed herein
consists of or comprises AD04872 linked to (NAG37)s shown as a
sodium salt having the structure represented by the following:
[0320] In some embodiments, an HBV RNAi agent disclosed herein
consists of or comprises AD04872 linked to (NAG25)s shown as a
sodium salt having the structure represented by the following:
[0321] In some embodiments, an HBV RNAi agent disclosed herein
consists of or comprises AD04872 linked to (NAG37)s shown as a free
acid having the structure represented by the following:
[0322] In some embodiments, the described HBV RNAi agent(s) are
optionally combined with one or more additional (i.e., second,
third, etc.) therapeutics. A second therapeutic can be another HBV
RNAi agent (e.g., a HBV RNAi agent which targets a different
sequence within an HBV genome). An additional therapeutic can also
be a small molecule drug, antibody, antibody fragment, and/or
vaccine. The HBV RNAi agents, with or without the one or more
additional therapeutics, can be combined with one or more
excipients to form pharmaceutical compositions.
[0323] In some embodiments, the described HBV RNAi agent(s) are
optionally combined with one or more additional therapeutics,
wherein the additional therapeutic is a nucleoside inhibitor or
nucleotide inhibitor. In some embodiments, the described HBV RNAi
agent(s) are optionally combined with one or more additional
therapeutics, wherein the additional therapeutic entecavir,
tenofovir, tenofovir alafenamide, tenofovir disoproxil, lamivudine,
or another antiviral therapeutic. In some embodiments, the
described HBV RNAi agent(s) are optionally combined with one or
more additional therapeutics, wherein the additional therapeutic is
an interferon. In some embodiments, the described HBV RNAi agent(s)
are optionally combined with one or more additional therapeutics,
wherein the additional therapeutic is interferon-alpha. In some
embodiments, the described HBV RNAi agent(s) are optionally
combined with one or more HBV additional therapeutics, wherein the
additional therapeutic is an HBV vaccine.
[0324] In some embodiments, the described HBV RNAi agent(s) are
optionally combined with one or more additional therapeutics in a
single dosage form (i.e., a cocktail included in a single
injection). In some embodiments, the described HBV RNAi agent(s)
may be administered separately from one or more optional additional
therapeutics. In some embodiments, the described HBV RNAi agent(s)
are administered to a subject in need thereof via subcutaneous
injection, and the one or more optional additional therapeutics are
administered orally, which together provide for a treatment regimen
for diseases and conditions associated with HBV infection. In some
embodiments, the described HBV RNAi agent(s) are administered to a
subject in need thereof via subcutaneous injection, and the one or
more optional additional therapeutics are administered via a
separate subcutaneous injection.
[0325] In some embodiments, disclosed herein are compositions for
delivering an HBV RNAi agent to a liver cell in vivo, the
composition including an HBV RNAi agent conjugated or linked to a
targeting group. In some embodiments, the targeting group is an
asialoglycoprotein receptor ligand. In some embodiments,
compositions for delivering an HBV RNAi agent to a liver cell in
vivo are described, the composition including an HBV RNAi agent
linked to an N-acetyl-galactosamine targeting ligand.
[0326] In some embodiments, one or more of the described HBV RNAi
agents are administered to a mammal in a pharmaceutically
acceptable carrier or diluent. In some embodiments, the mammal is a
human.
[0327] The use of Hepatitis B Virus RNAi agent(s) provides methods
for therapeutic and/or prophylactic treatment of diseases/disorders
which are associated with HBV infection. The described HBV RNAi
agents mediate RNA interference to inhibit the expression of one or
more genes necessary for replication and/or pathogenesis of
Hepatitis B Virus. In particular, for example, HBV RNAi agents may
inhibit viral polymerase, core protein, surface antigen, e-antigen
and/or the X protein, in a cell, tissue or mammal. HBV RNAi agents
can be used to treat HBV infection. HBV RNAi agents can also be
used to treat or prevent chronic liver diseases/disorders,
inflammations, fibrotic conditions and proliferative disorders,
like cancers, associated with HBV infection. In some embodiments,
the methods further comprise treatment of Hepatitis D Virus (HDV)
in the subject. Such methods comprise administration of HBV RNAi
agent to a human being or animal infected with HBV. Further,
compositions for delivery of HBV RNAi agents to liver cells in vivo
are described.
[0328] The pharmaceutical compositions comprising one or more HBV
RNAi agents can be administered in a number of ways depending upon
whether local or systemic treatment is desired. Administration can
be, but is not limited to, intravenous, intraarterial,
subcutaneous, intraperitoneal, subdermal (e.g., via an implanted
device), and intraparenchymal administration. In some embodiments,
the pharmaceutical compositions described herein are administered
by subcutaneous injection.
[0329] The described HBV RNAi agents and/or compositions can be
used in methods for therapeutic treatment of HBV infection or
disease or conditions caused by HBV infection. Such methods include
administration of an HBV RNAi agent as described herein to a
subject, e.g., a human or animal subject.
[0330] As used herein, the terms "oligonucleotide" and
"polynucleotide" mean a polymer of linked nucleosides each of which
can be independently modified or unmodified.
[0331] As used herein, an "RNAi agent" or "RNAi trigger" means a
composition that contains an RNA or RNA-like (e.g., chemically
modified RNA) oligonucleotide molecule that is capable of degrading
or inhibiting translation of messenger RNA (mRNA) transcripts of a
target mRNA in a sequence specific manner. As used herein. RNAi
agents may operate through the RNA interference mechanism (i.e.,
inducing RNA interference through interaction with the RNA
interference pathway machinery (RNA-induced silencing complex or
RISC) of mammalian cells), or by any alternative mechanism(s) or
pathway(s). While it is believed that RNAi agents, as that term is
used herein, operate primarily through the RNA interference
mechanism, the disclosed RNAi agents are not bound by or limited to
any particular pathway or mechanism of action. RNAi agents
disclosed herein are comprised of a sense strand and an antisense
strand, and include, but are not limited to: short interfering RNAs
(siRNAs), double-stranded RNAs (dsRNA), micro RNAs (miRNAs), short
hairpin RNAs (shRNA), and dicer substrates. The antisense strand of
the RNAi agents described herein is at least partially
complementary to the mRNA being targeted. RNAi agents may be
comprised of modified nucleotides and/or one or more
non-phosphodiester linkages.
[0332] As used herein, the terms "silence," "reduce," "inhibit,"
"down-regulate," or "knockdown" when referring to expression of a
given gene, mean that the expression of the gene, as measured by
the level of RNA transcribed from the gene or the level of
polypeptide, protein or protein subunit translated from the mRNA in
a cell, group of cells, tissue, organ, or subject in which the gene
is transcribed, is reduced when the cell, group of cells, tissue,
organ, or subject is treated with oligomeric compounds, such as
RNAi agents, described herein as compared to a second cell, group
of cells, tissue, organ, or subject that has not or have not been
so treated.
[0333] As used herein, the term "sequence" or "nucleotide sequence"
mean a succession or order of nucleobases or nucleotides, described
with a succession of letters using standard nomenclature.
[0334] As used herein, a "nucleotide base," or "`nucleobase`" is a
heterocyclic pyrimidine or purine compound, which is a standard
constituent of all nucleic acids, and includes the bases that form
the nucleotides adenine (A), guanine (G), cytosine (C), thymine
(T), and uracil (U). A nucleobase may further be modified to
include, without limitation, universal bases, hydrophobic bases,
promiscuous bases, size-expanded bases, and fluorinated bases.
[0335] As used herein, and unless otherwise indicated, the term
"complementary," when used to describe a first nucleotide sequence
(e.g., RNAi agent sense strand or targeted mRNA) in relation to a
second nucleotide sequence (e.g., RNAi agent antisense strand or a
single-stranded antisense oligonucleotide), means the ability of an
oligonucleotide or polynucleotide including the first nucleotide
sequence to hybridize (form base pair hydrogen bonds under
mammalian physiological conditions (or similar conditions in
vitro)) and form a duplex or double helical structure under certain
conditions with an oligonucleotide or polynucleotide including the
second nucleotide sequence. Complementary sequences include
Watson-Crick base pairs or non-Watson-Crick base pairs and include
natural or modified nucleotides or nucleotide mimics, at least to
the extent that the above hybridization requirements are fulfilled.
Sequence identity or complementarity is independent of
modification. For example, a and Af are complementary to U (or T)
and identical to A for the purposes of determining identity or
complementarity.
[0336] As used herein, "perfectly complementary" or "fully
complementary" means that all (100%) of the bases in a contiguous
sequence of a first polynucleotide will hybridize with the same
number of bases in a contiguous sequence of a second
polynucleotide. The contiguous sequence may comprise all or a part
of a first or second nucleotide sequence.
[0337] As used herein, "partially complementary" means that in a
hybridized pair of nucleobase sequences, at least 70%, but not all,
of the bases in a contiguous sequence of a first polynucleotide
will hybridize with the same number of bases in a contiguous
sequence of a second polynucleotide.
[0338] As used herein, "substantially complementary" means that in
a hybridized pair of nucleobase sequences, at least about 85%, but
not all, of the bases in a contiguous sequence of a first
polynucleotide will hybridize with the same number of bases in a
contiguous sequence of a second polynucleotide. The terms
"complementary," "fully complementary," and "substantially
complementary" herein may be used with respect to the base matching
between the sense strand and the antisense strand of a
double-stranded RNAi agent, between the antisense strand of an RNAi
agent and a sequence of a target mRNA, or between a single-stranded
antisense oligonucleotide and a sequence of a target mRNA.
[0339] As used herein, the term "substantially identical"
or"substantially identity" as applied to nucleic acid sequence
means that a nucleic acid sequence comprises a sequence that has at
least about 85% sequence identity or more, preferably at least 90%,
at least 95%, or at least 99%, compared to a reference sequence.
Percentage of sequence identity is determined by comparing two
optimally aligned sequences over a comparison window. The
percentage is calculated by determining the number of positions at
which the identical nucleic acid base occurs in both sequences to
yield the number of matched positions, dividing the number of
matched positions by the total number of positions in the window of
comparison and multiplying the result by 100 to yield the
percentage of sequence identity. The inventions disclosed herein
encompasses nucleotide sequences substantially identical to those
disclosed herein. e.g., in Tables 2, 3, and 4. In some embodiments,
the sequences disclosed herein are exactly identical, or at least
about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, or 99% percent identical to those disclosed herein, e.g.,
in Tables 1, 2, 3 and 4.
[0340] As used herein, the terms "treat," "treatment," and the
like, mean the methods or steps taken to provide relief from or
alleviation of the number, severity, and/or frequency of one or
more symptoms of a disease or condition in a subject.
[0341] As used herein, the phrase "introducing into a cell," when
referring to an oligomeric compound, means functionally delivering
the oligomeric compound into a cell. The phrase "functional
delivery," means that delivering the oligomeric compound to the
cell in a manner that enables the oligomeric compound to have the
expected biological activity, e.g., sequence-specific inhibition of
gene expression.
[0342] Unless stated otherwise, use of the symbol as used herein
means that any group or groups may be linked thereto that is in
accordance with the scope of the inventions described herein.
[0343] As used herein, the term "isomers" refers to compounds that
have identical molecular formulae, but that differ in the nature or
the sequence of bonding of their atoms or in the arrangement of
their atoms in space. Isomers that differ in the arrangement of
their atoms in space are termed "stereoisomers." Stereoisomers that
are not mirror images of one another are termed "diastereoisomers,"
and stereoisomers that are non-superimposable mirror images are
termed "enantiomers," or sometimes optical isomers. A carbon atom
bonded to four non-identical substituents is termed a "chiral
center."
[0344] As used herein, unless specifically identified in a
structure as having a particular conformation, for each structure
in which asymmetric centers are present and thus give rise to
enantiomers, diastereomers, or other stereoisomeric configurations,
each structure disclosed herein is intended to represent all such
possible isomers, including their optically pure and racemic forms.
For example, the structures disclosed herein are intended to cover
mixtures of diastereomers as well as single stereoisomers.
[0345] As used in a claim herein, the phrase "consisting of"
excludes any element, step, or ingredient not specified in the
claim. When used in a claim herein, the phrase "consisting
essentially of" limits the scope of a claim to the specified
materials or steps and those that do not materially affect the
basic and novel characteristic(s) of the claimed invention.
[0346] The person of ordinary skill in the art would readily
understand and appreciate that the compounds and compositions
disclosed herein may have certain atoms (e.g., N, O, or S atoms) in
a protonated or deprotonated state, depending upon the environment
in which the compound or composition is placed. Accordingly, as
used herein, the structures disclosed herein envisage that certain
functional groups, such as, for example, OH, SH, or NH, may be
protonated or deprotonated. The disclosure herein is intended to
cover the disclosed compounds and compositions regardless of their
state of protonation based on the environment (such as pH), as
would be readily understood by the person of ordinary skill in the
art.
[0347] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art. Although methods and materials similar
or equivalent to those described herein can be used in the practice
or testing of the present invention, suitable methods and materials
are described below. All publications, patent applications,
patents, and other references mentioned herein are incorporated by
reference in their entirety. In case of conflict, the present
specification, including definitions, will control. In addition,
the materials, methods, and examples are illustrative only and not
intended to be limiting.
[0348] Other features and advantages of the invention will be
apparent from the following detailed description, and from the
claims.
DETAILED DESCRIPTION
[0349] Described herein are RNAi agents for inhibiting expression
of Hepatitis B Virus (HBV) (referred to herein as HBV RNAi agents
or HBV RNAi triggers). Each HBV RNAi agent comprises a sense strand
and an antisense strand. The sense strand and the antisense strand
each can be 16 to 30 nucleotides in length. In some embodiments,
the sense and antisense strands each can be 17 to 26 nucleotides in
length. The sense and antisense strands can be either the same
length or they can be different lengths. In some embodiments, the
sense and antisense strands are each independently 17 to 26
nucleotides in length. In some embodiments, the sense and antisense
strands are each independently 17-21 nucleotides in length. In some
embodiments, both the sense and antisense strands are each 21-26
nucleotides in length. In some embodiments, the sense strand is
about 19 nucleotides in length while the antisense strand is about
21 nucleotides in length. In some embodiments, the sense strand is
about 21 nucleotides in length while the antisense strand is about
23 nucleotides in length. In some embodiments, both the sense and
antisense strands are each 26 nucleotides in length. In some
embodiments, the RNAi agent sense and antisense strands are each
independently 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides
in length. In some embodiments, a double-stranded RNAi agent has a
duplex length of about 16, 17, 18, 19, 20, 21, 22, 23 or 24
nucleotides. This region of perfect or substantial complementarity
between the sense strand and the antisense strand is typically
15-25 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25)
nucleotides in length and occurs at or near the 5' end of the
antisense strand (e.g., this region may be separated from the 5'
end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that
are not perfectly or substantially complementary).
[0350] The sense strand and antisense strand each contain a core
stretch sequence that is 16 to 23 nucleobases in length. An
antisense strand core stretch sequence is 100% (perfectly)
complementary or at least about 85% (substantially) complementary
to a nucleotide sequence (sometimes referred to, e.g., as a target
sequence) present in the HBV mRNA target. A sense strand core
stretch sequence is 100% (perfectly) complementary or at least
about 85% (substantially) complementary to a core stretch sequence
in the antisense strand, and thus the sense strand core stretch
sequence is perfectly identical or at least about 85% identical to
a nucleotide sequence (target sequence) present in the HBV mRNA
target. A sense strand core stretch sequence can be the same length
as a corresponding antisense core sequence or it can be a different
length. In some embodiments, the antisense strand core stretch
sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in
length. In some embodiments, the sense strand core stretch sequence
is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.
[0351] Examples of sense and antisense strand nucleotide sequences
used in forming HBV RNAi agents are provided in Tables 3 and 4.
Examples of RNAi agent duplexes, that include the nucleotide
sequences in Tables 3 and 4, are provided in Table 5.
[0352] The HBV RNAi agent sense and antisense strands anneal to
form a duplex. A sense strand and an antisense strand of an HBV
RNAi agent may be partially, substantially, or fully complementary
to each other. Within the complementary duplex region, the sense
strand core stretch sequence is at least about 85% complementary or
100% complementary to the antisense core stretch sequence. In some
embodiments, the sense strand core stretch sequence contains a
sequence of at least 16, at least 17, at least 18, at least 19, at
least 20, or at least 21 nucleotides that is at least about 85% or
100% complementary to a corresponding 16, 17, 18, 19, 20, or 21
nucleotide sequence of the antisense strand core stretch sequence
(i.e., the sense strand and antisense core stretch sequences of an
HBV RNAi agent have a region of at least 16, at least 17, at least
18, at least 19, at least 20, or at least 21 nucleotides that is at
least 85% base paired or 100% base paired.).
[0353] In some embodiments, the antisense strand of an HBV RNAi
agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from
any of the antisense strand sequences in Table 2 or Table 3. In
some embodiments, the sense strand of an HBV RNAi agent disclosed
herein differs by 0, 1, 2, or 3 nucleotides from any of the sense
strand sequences in Table 2 or Table 4.
[0354] The length of the HBV RNAi agent sense and antisense strands
described herein are independently 16 to 30 nucleotides in length.
In some embodiments, the sense and antisense strands are
independently 17 to 26 nucleotides in length. In some embodiments,
the sense and antisense strands are 19-26 nucleotides in length. In
some embodiments, the described RNAi agent sense and antisense
strands are independently 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26
nucleotides in length. The sense and antisense strands can be
either the same length or they can be different lengths. In some
embodiments, a sense strand and an antisense strand are each 26
nucleotides in length. In some embodiments, a sense strand is 23
nucleotides in length and an antisense strand is 21 nucleotides in
length. In some embodiments, a sense strand is 22 nucleotides in
length and an antisense strand is 21 nucleotides in length. In some
embodiments, a sense strand is 21 nucleotides in length and an
antisense strand is 21 nucleotides in length. In some embodiments,
a sense strand is 19 nucleotides in length and an antisense strand
is 21 nucleotides in length.
[0355] The sense strand and/or the antisense strand may optionally
and independently contain an additional 1, 2, 3, 4, 5, or 6
nucleotides (extension) at the 3' end, the 5' end, or both the 3'
and 5' ends of the core sequences. The antisense strand additional
nucleotides, if present, may or may not be complementary to the
corresponding sequence in an HBV mRNA. The sense strand additional
nucleotides, if present, may or may not be identical to the
corresponding sequence in an HBV mRNA. The antisense strand
additional nucleotides, if present, may or may not be complementary
to the corresponding sense strand's additional nucleotides, if
present.
[0356] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6
nucleotides at the 5' and/or 3' end of the sense strand core
stretch sequence and/or antisense strand core stretch sequence. The
extension nucleotides on a sense strand may or may not be
complementary to nucleotides, either core stretch sequence
nucleotides or extension nucleotides, in the corresponding
antisense strand. Conversely, the extension nucleotides on an
antisense strand may or may not be complementary to nucleotides,
either core stretch sequence nucleotides or extension nucleotides,
in the corresponding sense strand. In some embodiments, both the
sense strand and the antisense strand of an RNAi agent contain 3'
and 5' extensions. In some embodiments, one or more of the 3'
extension nucleotides of one strand base pairs with one or more 5'
extension nucleotides of the other strand. In other embodiments,
one or more of 3' extension nucleotides of one strand do not base
pair with one or more 5' extension nucleotides of the other strand.
In some embodiments, an HBV RNAi agent has an antisense strand
having a 3' extension and a sense strand having a 5' extension.
[0357] In some embodiments, an HBV RNAi agent comprises an
antisense strand having a 3' extension of 1, 2, 3, 4, 5, or 6
nucleotides in length. In other embodiments, an HBV RNAi agent
comprises an antisense strand having a 3' extension of 1, 2, or 3
nucleotides in length. In some embodiments, one or more of the
antisense strand extension nucleotides comprise uracil or thymidine
nucleotides or nucleotides which are complementary to a
corresponding HBV mRNA sequence. In some embodiments, a 3'
antisense strand extension includes or consists of, but is not
limited to: AUA, UGCUU, CUG, UG, UGCC, CUGCC, CGU, CUU. UGCCUA,
CUGCCU, UGCCU, UGAUU, GCCUAU, T, TT, U, UU (each listed 5' to
3').
[0358] In some embodiments, the 3' end of the antisense strand may
include additional abasic nucleosides (Ab). In some embodiments, Ab
or AbAb may be added to the 3' end of the antisense strand.
[0359] In some embodiments, an HBV RNAi agent comprises an
antisense strand having a 5' extension of 1, 2, 3, 4, or 5
nucleotides in length. In other embodiments, an HBV RNAi agent
comprises an antisense strand having a 5' extension of 1 or 2
nucleotides in length. In some embodiments, one or more of the
antisense strand extension nucleotides comprises uracil or
thymidine nucleotides or nucleotides which are complementary to a
corresponding HBV mRNA sequence. In some embodiments, the 5'
antisense strand extension includes or consists of, but is no
limited to, UA, TU, U. T, UU, TT, CUC (each listed 5' to 3'). An
antisense strand may have any of the 3' extensions described above
in combination with any of the 5' antisense strand extensions
described, if present.
[0360] In some embodiments, an HBV RNAi agent comprises a sense
strand having a 3' extension of 1, 2, 3, 4, or 5 nucleotides in
length. In some embodiments, one or more of the sense strand
extension nucleotides comprises adenosine, uracil, or thymidine
nucleotides, AT dinucleotide, or nucleotides which correspond to
nucleotides in the HBV mRNA sequence. In some embodiments, the 3'
sense strand extension includes or consists of, but is not limited
to: T, UT, TT, UU, UUT, TTT, or TTIT (each listed 5' to 3').
[0361] In some embodiments, the 3' end of the sense strand may
include additional abasic nucleosides. In some embodiments, UUAb,
UAb, or Ab may be added to the 3' end of the sense strand. In some
embodiments, the one or more abasic nucleosides added to the 3' end
of the sense strand may be inverted (invAb). In some embodiments,
one or more inverted abasic nucleosides may be inserted between the
targeting ligand and the nucleobase sequence of the sense strand of
the RNAi agent. In some embodiments, the inclusion of one or more
inverted abasic nucleosides at or near the terminal end or terminal
ends of the sense strand of an RNAi agent may allow for enhanced
activity or other desired properties of an RNAi agent.
[0362] In some embodiments, an HBV RNAi agent comprises a sense
strand having a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in
length. In some embodiments, one or more of the sense strand
extension nucleotides comprise uracil or adenosine nucleotides or
nucleotides which correspond to nucleotides in the HBV mRNA
sequence. In some embodiments, the sense strand 5' extension can
be, but is not limited to: CA, AUAGGC, AUAGG, AUAG. AUA. A, AA, AC,
GCA, GGCA, GGC, UAUCA, UAUC, UCA. UAU, U, UU (each listed 5' to
3'). A sense strand may have a 3' extension and/or a 5'
extension.
[0363] In some embodiments, the 5' end of the sense strand may
include an additional abasic nucleoside (Ab) or nucleosides (AbAb).
In some embodiments, the one or more abasic nucleosides added to
the 5' end of the sense strand may be inverted (invAb). In some
embodiments, one or more inverted abasic nucleosides may be
inserted between the targeting ligand and the nucleobase sequence
of the sense strand of the RNAi agent. In some embodiments, the
inclusion of one or more inverted abasic nucleosides at or near the
terminal end or terminal ends of the sense strand of an RNAi agent
may allow for enhanced activity or other desired properties of an
RNAi agent.
[0364] Examples of nucleotide sequences used in forming HBV RNAi
agents are provided in Tables 3 and 4. In some embodiments, an HBV
RNAi agent antisense strand includes a nucleotide sequence of any
of the sequences in Table 3. In some embodiments, an HBV RNAi agent
antisense strand includes the sequence of nucleotides 1-17, 2-15,
2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22,
1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2-26 of any of the
sequences in Table 3. In some embodiments, an HBV RNAi agent sense
strand includes the nucleotide sequence of any of the sequences in
Table 4. In some embodiments, an HBV RNAi agent sense strand
includes the sequence of nucleotides 1-18, 1-19, 1-20, 1-21, 1-22,
1-23, 1-24, 1-25, 1-26, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 2-25,
2-26, 3-20, 3-21, 3-22, 3-23, 3-24, 3-25, 3-26, 4-21, 4-22, 4-23,
4-24, 4-25, 4-26, 5-22, 5-23, 5-24, 5-25, 5-26, 6-23, 6-24, 6-25,
6-26, 7-24, 7-25, 7-25, 8-25, 8-26 of any of the sequences in Table
4.
[0365] In some embodiments, the sense and antisense strands of the
RNAi agents described herein contain the same number of
nucleotides. In some embodiments, the sense and antisense strands
of the RNAi agents described herein contain different numbers of
nucleotides. In some embodiments, the sense strand 5' end and the
antisense strand 3' end of an RNAi agent form a blunt end. In some
embodiments, the sense strand 3' end and the antisense strand 5'
end of an RNAi agent form a blunt end. In some embodiments, both
ends of an RNAi agent form blunt ends. In some embodiments, neither
end of an RNAi agent is blunt-ended. As used herein a blunt end
refers to an end of a double stranded RNAi agent in which the
terminal nucleotides of the two annealed strands are complementary
(form a complementary base-pair). In some embodiments, the sense
strand 5' end and the antisense strand 3' end of an RNAi agent form
a frayed end. In some embodiments, the sense strand 3' end and the
antisense strand 5' end of an RNAi agent form a frayed end. In some
embodiments, both ends of an RNAi agent form a frayed end. In some
embodiments, neither end of an RNAi agent is a frayed end. As used
herein a frayed end refers to an end of a double stranded RNAi
agent in which the terminal nucleotides of the two annealed strands
from a pair (i.e. do not form an overhang) but are not
complementary (i.e. form a non-complementary pair). As used herein,
an overhang is a stretch of one or more unpaired nucleotides at the
end of one strand of a double stranded RNAi agent. The unpaired
nucleotides may be on the sense strand or the antisense strand,
creating either 3' or 5' overhangs. In some embodiments, the RNAi
agent contains: a blunt end and a frayed end, a blunt end and 5'
overhang end, a blunt end and a 3' overhang end, a frayed end and a
5' overhang end, a frayed end and a 3' overhang end, two 5'
overhang ends, two 3' overhang ends, a 5' overhang end and a 3'
overhang end, two frayed ends, or two blunt ends.
[0366] A nucleotide base (or nucleobase) is a heterocyclic
pyrimidine or purine compound which is a constituent of all nucleic
acids and includes adenine (A), guanine (G), cytosine (C), thymine
(T), and uracil (U). As used herein, the term "nucleotide" can
include a modified nucleotide (such as, for example, a nucleotide
mimic, abasic site (Ab), or a surrogate replacement moiety).
Modified nucleotides, when used in various polynucleotide or
oligonucleotide constructs, may preserve activity of the compound
in cells while at the same time increasing the serum stability of
these compounds, and can also minimize the possibility of
activating interferon activity in humans upon administering of the
polynucleotide or oligonucleotide construct.
[0367] In some embodiments, an HBV RNAi agent is prepared or
provided as a salt, mixed salt, or a free-acid. In some
embodiments, an HBV RNAi agent is prepared as a sodium salt. Such
forms are within the scope of the inventions disclosed herein.
Modified Nucleotides
[0368] In some embodiments, an HBV RNAi agent contains one or more
modified nucleotides. As used herein, a "modified nucleotide" is a
nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In
some embodiments, at least 50% (e.g., at least 600/%, at least 70%,
at least 80%, at least 90%, at least 95%, at least 97%, at least
98%, at least 99%, or 100%) of the nucleotides are modified
nucleotides. As used herein, modified nucleotides include, but are
not limited to, deoxyribonucleotides, nucleotide mimics, abasic
nucleotides (represented herein as Ab), 2'-modified nucleotides, 3'
to 3' linkages (inverted) nucleotides (represented herein as invdN,
invN, invn, invAb), non-natural base-comprising nucleotides,
bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seco
nucleotide mimics (unlocked nucleobase analogues, represented
herein as N.sub.UNA or NUNA), locked nucleotides (represented
herein as N.sub.LNA or NLNA), 3'-O-methoxy (2' internucleoside
linked) nucleotides (represented herein as 3'-OMen), 2'-F-Arabino
nucleotides (represented herein as NfANA or Nf.sub.ANA), 5'-Me,
2'-fluoro nucleotide (represented herein as 5Me-Nf), morpholino
nucleotides, vinyl phosphonate deoxyribonucleotides (represented
herein as vpdN), vinyl phosphonate containing nucleotides, and
cyclopropyl phosphonate containing nucleotides (cPrpN). 2'-modified
nucleotides (i.e. a nucleotide with a group other than a hydroxyl
group at the 2' position of the five-membered sugar ring) include,
but are not limited to, 2'-O-methyl nucleotides (represented herein
as a lower case letter `n` in a nucleotide sequence),
2'-deoxy-2'-fluoro nucleotides (represented herein as Nf, also
represented herein as 2'-fluoro nucleotide), 2'-deoxy nucleotides
(represented herein as dN), 2'-methoxyethyl (2'-O-2-methoxylethyl)
nucleotides (represented herein as NM or 2'-MOE), 2'-amino
nucleotides, and 2'-alkyl nucleotides. It is not necessary for all
positions in a given compound to be uniformly modified. Conversely,
more than one modification may be incorporated in a single HBV RNAi
agent or even in a single nucleotide thereof. The HBV RNAi agent
sense strands and antisense strands may be synthesized and/or
modified by methods known in the art. Modification at one
nucleotide is independent of modification at another nucleotide.
Modified nucleobases include synthetic and natural nucleobases,
such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6
and 0-6 substituted purines, (e.g., 2-aminopropyladenine,
5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine
(5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine,
2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or
6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g.,
2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl
derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine,
2-thiocytosine, 5-halouracil, cytosine, 5-propynyl uracil,
5-propynyl cytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine,
5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino,
8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted
adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl,
and other 5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine,
7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.
[0369] In some embodiments, all or substantially all of the
nucleotides of an RNAi agent are modified nucleotides. As used
herein, an RNAi agent wherein substantially all of the nucleotides
present are modified nucleotides is an RNAi agent having four or
fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand
and the antisense strand being ribonucleotides. As used herein, a
sense strand wherein substantially all of the nucleotides present
are modified nucleotides is a sense strand having two or fewer
(i.e., 0, 1, or 2) nucleotides in the sense strand being
ribonucleotides. As used herein, an antisense sense strand wherein
substantially all of the nucleotides present are modified
nucleotides is an antisense strand having two or fewer (i.e., 0, 1,
or 2) nucleotides in the sense strand being ribonucleotides. In
some embodiments, one or more nucleotides of an RNAi agent is a
ribonucleotide.
Modified Internucleoside Linkages
[0370] In some embodiments, one or more nucleotides of an HBV RNAi
agent are linked by non-standard linkages or backbones (i.e.,
modified internucleoside linkages or modified backbones). In some
embodiments, a modified internucleoside linkage is a
non-phosphate-containing covalent internucleoside linkage. Modified
internucleoside linkages or backbones include, but are not limited
to, 5'-phosphorothioate groups (represented herein as a lower case
"s"), chiral phosphorothioates, thiophosphates,
phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters,
alkyl phosphonates (e.g., methyl phosphonates or 3'-alkylene
phosphonates), chiral phosphonates, phosphinates, phosphoramidates
(e.g., 3'-amino phosphoramidate, aminoalkylphosphoramidates, or
thionophosphoramidates), thionoalkyl-phosphonates,
thionoalkylphosphotriesters, morpholino linkages, boranophosphates
having normal 3'-5' linkages, 2'-5' linked analogs of
boranophosphates, or boranophosphates having inverted polarity
wherein the adjacent pairs of nucleoside units are linked 3'-5' to
5'-3' or 2'-5' to 5'-2'. In some embodiments, a modified
internucleoside linkage or backbone lacks a phosphorus atom.
Modified internucleoside linkages lacking a phosphorus atom
include, but are not limited to, short chain alkyl or cycloalkyl
inter-sugar linkages, mixed heteroatom and alkyl or cycloalkyl
inter-sugar linkages, or one or more short chain heteroatomic or
heterocyclic inter-sugar linkages. In some embodiments, modified
internucleoside backbones include, but are not limited to, siloxane
backbones, sulfide backbones, sulfoxide backbones, sulfone
backbones, formacetl and thioformacetyl backbones, methylene
formacetyl and thioformacetyl backbones, alkene-containing
backbones, sulfamate backbones, methyleneimino and
methylenehydrazino backbones, sulfonate and sulfonamide backbones,
amide backbones, and other backbones having mixed N, O, S, and
CH.sub.2 components.
[0371] In some embodiments, a sense strand of an HBV RNAi agent can
contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, an antisense
strand of an HBV RNAi agent can contain 1, 2, 3, 4, 5, or 6
phosphorothioate linkages, or both the sense strand and the
antisense strand independently can contain 1, 2, 3, 4, 5, or 6
phosphorothioate linkages. In some embodiments, a sense strand of
an HBV RNAi agent can contain 1, 2, 3, or 4 phosphorothioate
linkages, an antisense strand of an HBV RNAi agent can contain 1,
2, 3, or 4 phosphorothioate linkages, or both the sense strand and
the antisense strand independently can contain 1, 2, 3, or 4
phosphorothioate linkages.
[0372] In some embodiments, an HBV RNAi agent sense strand contains
at least two phosphorothioate internucleoside linkages. In some
embodiments, the at least two phosphorothioate internucleoside
linkages are between the nucleotides at positions 1-3 from the 3'
end of the sense strand. In some embodiments, the at least two
phosphorothioate internucleoside linkages are between the
nucleotides at positions 1-3, 2-4, 3-5, 4-6, 4-5, or 6-8 from the
5' end of the sense strand. In some embodiments, an HBV RNAi agent
antisense strand contains four phosphorothioate internucleoside
linkages. In some embodiments, the four phosphorothioate
internucleoside linkages are between the nucleotides at positions
1-3 from the 5' end of the sense strand and between the nucleotides
at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the
5' end. In some embodiments, an HBV RNAi agent contains at least
two phosphorothioate internucleoside linkages in the sense strand
and three or four phosphorothioate internucleoside linkages in the
antisense strand.
[0373] In some embodiments, an HBV RNAi agent contains one or more
modified nucleotides and one or more modified internucleoside
linkages. In some embodiments, a 2'-modified nucleoside is combined
with modified internucleoside linkage.
HBV RNAi Agents
[0374] In some embodiments, the HBV RNAi agents disclosed herein
target an HBV gene at or near the positions of the HBV genome shown
in the following Table 1. In some embodiments, the antisense strand
of an HBV RNAi agent disclosed herein includes a core stretch
sequence that is fully, substantially, or at least partially
complementary to a target HBV 19-mer sequence disclosed in Table
1.
TABLE-US-00001 TABLE 1 Example 19-mer HBV cDNA target sequences for
HBV RNAi agents (taken from Hepatitis B virus (subtype ADW2),
genotype A, complete genome GenBank AM282986.1 (SEQ ID NO: 1)). HBV
19-mer Genome Region of SEQ Target Sequence Position of HBV Gene ID
No. (5'.fwdarw.3') SEQ ID NO: 1 Targeted 2 GTGGTGGACTTCTCTCAAT
256-274 S ORF 3 TGGTGGACTTCTCTCAATT 257-275 S ORF 4
GGACTTCTCTCAATTTTCT 261-279 S ORF 5 GCTGTAGGCATAAATTGGT 1780-1798 X
ORF 6 CTGTAGGCATAAATTGGTC 1781-1799 X ORF
[0375] In some embodiments, an HBV RNAi agent includes an antisense
strand wherein position 19 of the antisense strand (5'.fwdarw.3')
is capable of forming a base pair with position 1 of a 19-mer
target sequence disclosed in Table 1. In some embodiments, an HBV
RNAi agent includes an antisense strand wherein position 1 of the
antisense strand (5'.fwdarw.3') is capable of forming a base pair
with position 19 of the 19-mer target sequence disclosed in Table
1.
[0376] In some embodiments, an HBV RNAi agent includes an antisense
strand wherein position 2 of the antisense strand (5'.fwdarw.3') is
capable of forming a base pair with position 18 of the 19-mer
target sequence disclosed in Table 1. In some embodiments, an HBV
RNAi agent includes an antisense strand wherein positions 2 through
18 of the antisense strand (5'.fwdarw.3') are capable of forming
base pairs with each of the respective complementary bases located
at positions 18 through 2 of the 19-mer target sequence disclosed
in Table 1.
[0377] In some embodiments, the HBV RNAi agents include core 19-mer
nucleotide sequences shown in the following Table 2.
TABLE-US-00002 TABLE 2 HBV RNAi agent antisense strand and sense
strand core stretch sequences (N = any nucleotide). Genome SEQ
Antisense Sequence SEQ Sense Sequence Position of ID NO:
(5'.fwdarw.3') (19-mer) ID NO: (5'.fwdarw.3') (19-mer) SEQ ID NO: 1
7 AUUGAGAGAAGUCCACCAC 34 GUGGUGGACUUCUCUCAAU 256-274 8
UUUGAGAGAAGUCCACCAC 35 GUGGUGGACUUCUCUCAAA 256-274 9
AUUGAGAGAAGUCCACCAN 36 NUGGUGGACUUCUCUCAAU 256-274 10
UUUGAGAGAAGUCCACCAN 37 NUGGUGGACUUCUCUCAAA 256-274 11
NUUGAGAGAAGUCCACCAN 38 NUGGUGGACUUCUCUCAAN 256-274 12
AAUUGAGAGAAGUCCACCA 39 UGGUGGACUUCUCUCAAUU 257-275 13
UAUUGAGAGAAGUCCACCA 40 UGGUGGACUUCUCUCAAUA 257-275 14
AAUUGAGAGAAGUCCACCN 41 NGGUGGACUUCUCUCAAUU 257-275 15
UAUUGAGAGAAGUCCACCN 42 NGGUGGACUUCUCUCAAUA 257-275 16
NAUUGAGAGAAGUCCACCN 43 NGGUGGACUUCUCUCAAUN 257-275 17
AGAAAAUUGAGAGAAGUCC 44 GGACUUCUCUCAAUUUUCU 261-279 18
UGAAAAUUGAGAGAAGUCC 45 GGACUUCUCUCAAUUUUCA 261-279 19
AGAAAAUUGAGAGAAGUCN 46 NGACUUCUCUCAAUUUUCU 261-279 20
UGAAAAUUGAGAGAAGUCN 47 NGACUUCUCUCAAUUUUCA 261-279 21
NGAAAAUUGAGAGAAGUCN 48 NGACUUCUCUCAAUUUUCN 261-279 22
ACCAAUUUAUGCCUACAGC 49 GCUGUAGGCAUAAAUUGGU 1780-1798 23
UCCAAUUUAUGCCUACAGC 50 GCUGUAGGCAUAAAUUGGA 1780-1798 24
ACCAAUUUAUGCCUACAGN 51 NCUGUAGGCAUAAAUUGGU 1780-1798 25
UCCAAUUUAUGCCUACAGN 52 NCUGUAGGCAUAAAUUGGA 1780-1798 26
NCCAAUUUAUGCCUACAGN 53 NCUGUAGGCAUAAAUUGGN 1780-1798 27
GACCAAUUUAUGCCUACAG 54 CUGUAGGCAUAAAUUGGUC 1781-1799 28
AACCAAUUUAUGCCUACAG 55 CUGUAGGCAUAAAUUGGUU 1781-1799 29
UACCAAUUUAUGCCUACAG 56 CUGUAGGCAUAAAUUGGUA 1781-1799 30
GACCAAUUUAUGCCUACAN 57 NUGUAGGCAUAAAUUGGUC 1781-1799 31
AACCAAUUUAUGCCUACAN 58 NUGUAGGCAUAAAUUGGUU 1781-1799 32
UACCAAUUUAUGCCUACAN 59 NUGUAGGCAUAAAUUGGUA 1781-1799 33
NACCAAUUUAUGCCUACAN 60 NUGUAGGCAUAAAUUGGUN 1781-1799
[0378] The HBV RNAi agent sense strands and antisense strands that
comprise or consist of the nucleotide sequences in Table 2 can be
modified nucleotides or unmodified nucleotides. In some
embodiments, the HBV RNAi agents having the sense and antisense
strand sequences that comprise or consist of the nucleotide
sequences in Table 2 are all or substantially all modified
nucleotides.
[0379] In some embodiments, the antisense strand of an HBV RNAi
agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from
any of the antisense strand sequences in Table 2. In some
embodiments, the sense strand of an HBV RNAi agent disclosed herein
differs by 0, 1, 2, or 3 nucleotides from any of the sense strand
sequences in Table 2.
[0380] Modified HBV RNAi agent antisense strand sequences, as well
as their underlying unmodified sequences, are provided in Table 3.
Modified HBV RNAi agent sense strands, as well as their underlying
unmodified sequences, are provided in Table 4. In forming HBV RNAi
agents, each of the nucleotides in each of the unmodified sequences
listed in Tables 3 and 4 may be a modified nucleotide.
[0381] As used herein (including in Tables 3 and 4), the following
notations are used to indicate modified nucleotides, targeting
groups, and linking groups. As the person of ordinary skill in the
art would readily understand, unless otherwise indicated by the
sequence, that when present in an oligonucleotide, the monomers are
mutually linked by 5'-3'-phosphodiester bonds: [0382]
A=adenosine-3'-phosphate; [0383] C=cytidine-3'-phosphate; [0384]
G=guanosine-3'-phosphate; [0385] U=uridine-3'-phosphate [0386]
n=any 2'-OMe modified nucleotide [0387]
a=2'-O-methyladenosine-3'-phosphate [0388] as
=2'-O-methyladenosine-3'-phosphorothioate [0389]
c=2'-O-methylcytidine-3'-phosphate [0390]
cs=2'-O-methylcytidine-3'-phosphorothioate [0391]
g=2'-O-methylguanosine-3'-phosphate [0392]
gs=2'-O-methylguanosine-3'-phosphorothioate [0393]
t=2'-O-methyl-5-methyluridine-3'-phosphate [0394]
ts=2'-O-methyl-5-methyluridine-3'-phosphorothioate [0395]
u=2'-O-methyluridine-3'-phosphate [0396]
us=2'-O-methyluridine-3'-phosphorothioate [0397] Nf=any 2'-fluoro
modified nucleotide [0398] Af=2'-fluoroadenosine-3'-phosphate
[0399] Afs=2'-fluoroadenosine-3'-phosporothioate [0400]
Cf=2'-fluorocytidine-3'-phosphate [0401]
Cfs=2'-fluorocytidine-3'-phosphorothioate [0402]
Gf=2'-fluoroguanosine-3'-phosphate [0403]
Gfs=2'-fluoroguanosine-3'-phosphorothioate [0404]
Tf=2'-fluoro-5'-methyluridine-3'-phosphate [0405]
Tfs=2'-fluoro-5'-methyluridine-3'-phosphorothioate [0406]
Uf=2'-fluorouridine-3'-phosphate [0407]
Ufs=2'-fluorouridine-3'-phosphorothioate [0408] dN=any
2'-deoxyribonucleotide [0409] dT=2'-deoxythymidine-3'-phosphate
[0410] N.sub.UNA=2',3'-seco nucleotide mimics (unlocked nucleobase
analogs) [0411] N.sub.LNA=locked nucleotide [0412]
Nf.sub.ANA=2'-F-Arabino nucleotide [0413] NM=2'-methoxyethyl
nucleotide [0414] AM=2'-methoxyethyladenosine-3'-phosphate [0415]
AMs=2'-methoxyethyladenosine-3'-phosphorothioate [0416]
TM=2'-methoxyethylthymidine-3'-phosphate [0417]
TMs=2'-methoxyethylthymidine-3'-phosphorothioate [0418] R=ribitol
[0419] (invdN)=any inverted deoxyribonucleotide (3'-3' linked
nucleotide) [0420] (invAb)=inverted (3'-3' linked) abasic
deoxyribonucleotide, see Table 6 [0421] (invAb)s=inverted (3'-3'
linked) abasic deoxyribonucleotide-5'-phosphorothioate, see Table 6
[0422] (invn)=any inverted 2'-OMe nucleotide (3'-3' linked
nucleotide) [0423] s=phosphorothioate linkage [0424] vpdN=vinyl
phosphonate deoxyribonucleotide [0425] (5Me-Nf)=5'-Me, 2'-fluoro
nucleotide [0426] cPrp=cyclopropyl phosphonate, see Table 6 [0427]
epTcPr=see Table 6 [0428] epTM=see Table 6
[0429] The person or ordinary skill in the art would readily
understand that the terminal nucleotide at the 3' end of a given
oligonucleotide sequence would typically have a hydroxyl (--OH)
group at the respective 3' position of the given monomer instead of
a phosphate moiety ex vivo. Thus, for example, as shown above in
the structure representation of AD05070, above, the "g" modified
nucleotide on the terminal 3' end of the antisense strand of
AM06606-AS has a hydroxyl group positioned at its 3' position.
Unless expressly indicated otherwise herein, such understandings of
the person of ordinary skill in the art are used when describing
the HBV RNAi agents and compositions of HBV RNAi agents disclosed
herein.
[0430] Targeting groups and linking groups include the following,
for which their chemical structures are provided below in Table 6:
(PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s,
(NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28),
(NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s,
(NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35),
(NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s,
(NAG39), (NAG39)s. Each sense strand and/or antisense strand can
have any targeting groups or linking groups listed above, as well
as other targeting or linking groups, conjugated to the 5' and/or
3' end of the sequence.
TABLE-US-00003 TABLE 3 HBV RNAi Agent antisense strand sequences.
SEQ SEQ AS Strand ID Modified sequence (5'.fwdarw.3') ID NO.
Unmodified sequence (5'.fwdarw.3') ID NO. AM03508-AS
usAfscCfaAfuUfuAfuGfcCfuAfcAfgGgccsusuAu 61
UACCAAUUUAUGCCUACAGGCCUUAU 149 AM04441-AS
usAfscCgaAfuUfuAfuGfcCfuAfcAfgGfcscsu 62 UACCAAUUUAUGCCUACAGGCCU
150 AM04442-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfccsu 63
UACCAAUUUAUGCCUACAGGCCU 150 AM04443-AS
usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfsc 64 UACCAAUUUAUGCCUACAGGC 151
AM04661-AS usGfsugaAfgCfGfaaguGfcAfcacsusu 65 UGUGAAGCGAAGUGCACACUU
152 AM04768-AS usAfscCfaAfuUfuAfuGfcCfuAfcAfgCfcsusccgc 66
UACCAAUUUAUGCCUACAGCCUCCGC 153 AM04769-AS
vpusAfscCfaAfuUfuAfuGfcCfuAfcAfgCfcsusccgc 67
UACCAAUUUAUGCCUACAGCCUCCGC 153 AM05011-AS
usAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu 68 UACCAAUUUAUGCCUACAGUU 154
AM05012-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfggsc 69
UACCAAUUUAUGCCUACAGGU 151 AM05013-AS
vpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfsc 70 UACCAAUUUAUGCCUACAGGC 151
AM05014-AS vpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu 71
UACCAAUUUAUGCCUACAGUU 154 AM05052-AS
asUfsusGfaGfaGfaAfgUfcCfaCfcAfcGfsa 72 AUUGAGAGAAGUCCACCACGA 155
AM05053-AS asUfsusGfaGfaGfaAfgUfcCfaCfcAfcgsa 73
AUUGAGAGAAGUCCACCACGA 155 AM05054-AS
asUfsusGfaGfaGfaAfgUfcCfaCfcAfcusu 74 AUUGAGAGAAGUCCACCACUU 156
AM05055-AS vpusUfsusGfaGfaGfaAfgUfcCfaCfcAfcGfsa 75
UUUGAGAGAAGUCCACCACGA 157 AM05056-AS
asAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfsg 76 AAUUGAGAGAAGUCCACCACG 158
AM05057-AS asAfsusUfgAfgAfgAfaGfuCfcAfcCfacsg 77
AAUUGAGAGAAGUCCACCACG 158 AM05058-AS
asAfsusUfgAfgAfgAfaGfuCfcAfcCfausu 78 AAUUGAGAGAAGUCCACCAUU 159
AM05060-AS vpusAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfsg 79
UAUUGAGAGAAGUCCACCACG 160 AM05351-AS
usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfsu 80 UACCAAUUUAUGCCUACAGGU 161
AM05608-AS usAfscCfaAfuUfuAfuGfcCfuAfcAfgsusu 81
UACCAAUUUAUGCCUACAGUU 154 AM05609-AS
usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc 82 UACCAAUUUAUGCCUACAGCC 162
AM05610-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfgccusu 83
UACCAAUUUAUGCCUACAGCCUU 163 AM05611-AS
usAfscsCfaAfuUfuAfuGfcCfuAfcAfgccusc 84 UACCAAUUUAUGCCUACAGCCUC 164
AM05612-AS usAfscscasuUfuAfuGfcCfuacagcsc 85 UACCAAUUUAUGCCUACAGGC
162 AM05613-AS usAfscscaauUfuAfuGfcCfuacagccusu 86
UACCAAUUUAUGCCUACAGCCUU 163 AM05614-AS
usAfscscaauUfuAfuGfcCfuacagccusc 87 UACCAAUUUAUGCCUACAGCCUU 164
AM05618-AS asUfsusgagaGfaAfgUfcCfaccacusu 88 AUUGAGAGAAGUCCACCACUU
156 AM05621-AS usUfsusGfaGfaGfaAfgUfcCfaCfcAfcusu 89
UUUGAGAGAAGUCCACCACUU 165 AM05623-AS
asUfsusGfaGfaGfaAfgUfcCfaCfcAfcggusu 90 AUUGAGAGAAGUCCACCACGGUU 166
AM05626-AS asUfsusgagaGfaAfgUfcCfaccacggusu 91
AUUGAGAGAAGUCCACCACGGUU 166 AM05628-AS
asUfsusGfaGfaGfaAfgUfcCfaCfcAfcgagsu 92 AUUGAGAGAAGUCCACCACGAGU 167
AM05631-AS usAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfsg 93
UAUUGAGAGAAGUCCACCACG 160 AM05632-AS usAfsusugagAfgAfaGfuCfcaccacsg
94 UAUUGAGAGAAGUCCACCACG 160 AM05633-AS
usAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfgusu 95 UAUUGAGAGAAGUCCACCACGUU
168 AM05634-AS usAfsusugagAfgAfaGfuCfcaccacgasg 96
UAUUGAGAGAAGUCCACCACGAG 169 AM05635-AS
usAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfgasg 97 UAUUGAGAGAAGUCCACCACGAG
169 AM05637-AS usAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfgsa 98
UAUUGAGAGAAGUCCACCACGA 170 AM05638-AS
usAfsusugagAfgAfaGfuCfcaccacgsa 99 UAUUGAGAGAAGUCCACCACGA 170
AM05747-AS asGfsasAfaAfuugagAfgAfaGfuCfcAfsc 100
AGAAAAUUGAGAGAAGUCCAC 171 AM05849-AS
usAfscsCfaAfuuuauGfcCfuAfcAfgusu 101 UACCAAUUUAUGCCUACAGUU 154
AM05850-AS usAfscsCfaAfuuuauGfcCfuAfcAfgcsc 102
UACCAAUUUAUGCCUACAGCC 162 AM05851-AS
usAfscsCfaAfuuuauGfcCfuAfcAfgcusu 103 UACCAAUUUAUGCCUACAGCUU 172
AM05852-AS usAfscsCfaAfuuuauGfcCfuAfcAfgccsu 104
UACCAAUUUAUGCCUACAGCCU 173 AM05853-AS
usAfscsCfaAfuuuauGfcCfuAfcAfgccusu 105 UACCAAUUUAUGCCUACAGCCUU 163
AM05854-AS usAfscsCfaAfuuuauGfcCfuAfcAfgccusc 106
UACCAAUUUAUGCCUACAGCCUC 164 AM05855-AS
cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu 107 UACCAAUUUAUGCCUACAGUU
154 AM05860-AS cPrpusAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfsg 108
UAUUGAGAGAAGCUUACCACG 160 AM05862-AS
usAfsusUfgAfgagaaGfuCfcAfcCfausu 109 UAUUGAGAGAAGUCCACCAUU 174
AM05863-AS usAfsusUfgAfgagaaGfuCfcAfcCfacsg 110
UAUUGAGAGAAGUCCACCACG 160 AM05864-AS
usAfsusUfgAfgagaaGfuCfcAfcCfacsusu 111 UAUUGAGAGAAGUCCACCACUU 175
AM05865-AS usAfsusUfgAfgagaaGfuCfcAfcCfacsgsa 112
UAUUGAGAGAAGUCCACCACGA 170 AM05867-AS
vpusAfsusUfgAfgagaaGfuCfcAfcCfaCfsg 113 UAUUGAGAGAAGUCCACCACG 160
AM05873-AS usUfsusGfaGfagaagUfcCfaCfcAfcusu 114
UUUGAGAGAAGUCCACCACUU 165 AM05874-AS
usUfsusGfaGgagaagUfcCfaCfcAfcgsa 115 UUUGAGAGAAGUCCACCACGA 157
AM05875-AS usUfsusGfaGfagaagUfcCfaCfcAfcgusu 116
UUUGAGAGAAGUCCACCACGUU 176 AM05876-AS
usUfsusGfaGfagaagUfcCfaCfcAfcgasg 117 UUUGAGAGAAGUCCACCACGAG 177
AM05877-AS cPrpusUfsusGfaGfaGfaAfgUfcCfaCfcAfcusu 118
UUUGAGAGAAGUCCACCACUU 165 AM06074-AS
cPrpusAfsusUfgAfgagaaGfuCfcAfcCfacsusu 119 UAUUGAGAGAAGUCCACCACUU
175 AM06142-AS usAfsusUfgAfgagaaGfuCfcAfcCfacusu 120
UAUUGAGAGAAGUCCACCACUU 175 AM06143-AS
usAfsusUfgAfgagaaGfuCfcAfcCfacgusu 121 UAUUGAGAGAAGUCCACCACGUU 168
AM06144-AS usAfsusUfgAfgagaaGfuCfuAfcCfacuus(invAb) 122
UAUUGAGAGAAGUCCACCACUU 175 AM06145-AS
usAfsusUfgAfgagaaGfuCfcAfcCfacgasg 123 UAUUGAGAGAAGUCCACCACGAG 169
AM06222-AS usAfsusUfgAfgAfgAfaGfuCfcAfcCfacusu 124
UAUUGAGAGAAGUCCACCACUU 175 AM06281-AS
asGfsasAfaAfuUfgAfgAfgAfaGfuCfcusu 125 AGAAAAUUGAGAGAAGUCCUU 178
AM06282-AS asGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc 126
AGAAAAUUGAGAGAAGUCCAC 171 AM06283-AS
asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacusu 127 AGAAAAUUGAGAGAAGUCCACUU
179 AM06284-AS asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacsc 128
AGAAAAUUGAGAGAAGUCCACC 180 AM06285-AS
usGfsasAfaAfuUfgAfgAfgAfaGfuCfcusu 129 UGAAAAUUGAGAGAAGUCCUU 152
AM06286-AS usGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc 130
UGAAAAUUGAGAGAAGUCCAC 181 AM06299-AS
asCfscsAfaUfuUfaUfgCfcUfaCfaGfcusu 131 ACCAAUUUAUGCCUACAGCUU 182
AM06300-AS asCfscsAfaUfuUfaUfgCfcUfaCfaGfccusu 132
ACCAAUUUAUGCCUACAGCCUU 183 AM06301-AS
asCfscsAfaUfuUfaUfgCfcUfaCfaGfccusc 133 ACCAAUUUAUGCCUACAGCCUC 184
AM06302-AS usCfscsAfaUfuUfaUfgCfcUfaCfaGfcusu 134
UCCAAUUUAUGCCUACAGCUU 185 AM06303-AS
usCfscsAfaUfuUfaUfgCfcUfaCfaGfccusu 135 UCCAAUUUAUGCCUACAGCCUU 186
AM06463-AS cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc 136
UACCAAUUUAUGCCUACAGCC 162 AM06464-AS
usAfscsCfaAfuUfuAfuGfcCfuAfcAfgscsc 137 UACCAAUUUAUGCCUACAGCC 162
AM06465-AS cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgscsc 138
UACCAAUUUAUGCCUACAGCC 162 AM06604-AS
usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsu 139 UACCAAUUUAUGCCUACAGCU 187
AM06606-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsg 140
UACCAAUUUAUGCCUACAGCG 188 AM06608-AS
asAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc 141 AACCAAUUUAUGCCUACAGCC 189
AM06611-AS usAfscsCfaAfuUfUfAfuGfcCfuAfcAgfusu 142
UACCAAUUUAUGCCUACAGUU 154 AM06612-AS
usAfscsCfaAfuUfuAfuGfcCfuAfcAfgCfsc 143 UACCAAUUUAUGCCUACAGCC 152
AM06614-AS asCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu 144
ACCAAUUUAUGCCUACAGCCU 190 AM06616-AS
usCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu 145 UCCAAUUUAUGCCUACAGCCU
191
AM06618-AS asCfscAfaUfuUfaUfgCfvUfaCfaGfccsg 146
ACCAAUUUAUGCCUACAGCCG 192 AM06620-AS
usCfscAfaUfuUfaUfgCfcUfaCfaGfccsg 147 UCCAAUUUAUGCCUACAGCCG 193
AM06751-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfggsg 148
UACCAAUUUAUGCCUACAGGG 194
TABLE-US-00004 TABLE 4 HBV RNAi agent sense strand sequences. SEQ
SEQ ID ID Strand ID Modified sequence (5'.fwdarw.3') NO. Unmodified
sequence (5'.fwdarw.3') NO. AM04444-SS
(NAG25)uusgsccuguagGfCfAfuaaauugguaus(invdT) 195
UUGCCUGUAGGCAUAAAUUGGUAUT 275 AM04445-SS
(NAG25)uauausgsccuguagGfCfAfuaaauuggu(invdA) 196
UAUAUGCCUGUAGGCAUAAAUUGGUA 276 AM04767-SS
(NAG25)gcggagsgcuguagGfCfAfuaaauuggTM(invdA) 197
GCGGAGGCUGUAGGCAUAAAUUGGTA 277 AM05010-SS
(NAG25)scsuguagGfCfAfuaaauugguauus(invAb) 198 CUGUAGGCAUAAAUUGGUAUU
278 AM05015-SS (NAG25)sgsccuguagGfCfAfuaaauugguas(invAb) 199
GCCUGUAGGCAUAAAUUGGUA 279 AM05016-SS
(NAG25)sgsccuguagGfCfAfuaaauuggus(invdA) 200 GCCCUGUAGGCAUAAAUUGGUA
279 AM05017-SS (NAG25)sgsccuguagGfCfAfuaaauugguAMs(invAb) 201
GCCUGUAGGCAUAAAUUGGUA 279 AM05018-SS
(NAG25)sgsccuguagGfCfAfuaaauuggTMAMs(invAb) 202
GCCUGUAGGCAUAAAUUGGTA 280 AM05019-SS
(NAG25)sasacuguagGfCfAfuaaauugguas(invAb) 203 AACUGUAGGCAUAAAUUGGUA
281 AM05034-SS (NAG25)suscguggugGfAfCfuucucucaaus(invAb) 204
UCGUGGUGGACUUCUCUCAAU 282 AM05046-SS
(NAG25)sasaguggugGfAfCfuucucucaaus(invAb) 205 AAGUGGUGGACUUCUCUCAAU
283 AM05047-SS (NAG25)suscguggugGfAfCfuucucucaAMTMs(invAb) 206
UCGUGGUGGACUUCUCUCAAT 284 AM05048-SS
(NAG25)scsgugguggAfCfUfucucucaauus(invAb) 207 CGUGGUGGACUUCUCUCAAUU
285 AM05049-SS (NAG25)sasaugguggAfCfUffucucucaauus(invAb) 208
AAUGGUGGACUUCUCUCAAUU 286 AM05050-SS
(NAG25)scsgugguggAfCfUfucucucaaTMTMs(invAb) 209
CGUGGUGGACUUCUCUCAATT 287 AM05051-SS
(NAG25)sgsgacuucuCfUfCffaauuuucuaas(invAb) 210
GGACUUCUCUCAAUUUUCUAA 288 AM05063-SS
(NAG25)scsgugguggAfCfUfucucucaauas(invAb) 211 CGUGGUGGACUUCUCUCAAUA
289 AM05064-SS (NAG25)suscguggugGfAfCffuucucucaaas(invAb) 212
UCGUGGUGGACUUCUCUCAAA 290 AM05346-SS
(NAG31)sasccuguagGfCfAfuaaauugguas(invAb) 213 ACCUGUAGGCAUAAAUUGGUA
291 AM05347-SS (NAG31)s(invAb)scuguagGfCfAfuaaauugguas(invAb) 214
CUGUAGGCAUAAAUUGGUA 292 AM05606-SS
(NAG25)s(invAb)scuguagGfCfAfuaaauugguas(invAb) 215
CUGUAGGCAUAAAUUGGUA 292 AM05607-SS
(NAG37)s(invAb)scuguagGfCfAfuaaauugguas(invAb) 216
CUGUAGGCAUAAAUUGGUA 292 AM05615-SS
(NAG25)s(invAb)sacuguagGfCfAfuaaauugguas(invAb) 217
ACUGUAGGCAUAAAUUGGUA 293 AM05616-SS
(NAG25)sgsgcuguagGfCfAfuaaauugguas(invAb) 218 GGCUGUAGGCAUAAAUUGGUA
294 AM05617-SS (NAG37)sasaguggugGfAfCffuucucucaaus(invAb) 219
AAGUGGUGGACUUCUCUCAAU 283 AM05620-SS
(NAG25)sasaguggugGfAfCfuucucucaas(invAb) 220 AAGUGGUGGACUUCUCUCAAA
295 AM05622-SS (NAG25)scsguggugGfAfCfuucucucaaus(invAb) 221
CCGUGGUGGACUUCUCUCAAU 296 AM05624-SS
(NAG25)s(invAb)sccguggugGfAfCfuucucucaaus(invAb) 222
CCGUGGUGGACUUCUCUCAAU 296 AM05627-SS
(NAG25)scsucguggugGfAfCfuucucucaaus(invAb) 223
CUCGUGGUGGACUUCUCUCAAU 297 AM05629-SS
(NAG25)s(invAb)sguggugGfAfCfuucucucaaus(invAb) 224
GUGGUGGACUUCUCUCAAU 298 AM05630-SS
(NAG25)s(invAb)sguggugGfAfCfuucucucaauusu(invAb) 225
GUGGUGGACUUCUCUCAAUUU 299 AM05636-SS
(NAG25)suscgugguggAfCfUfucucucaauus(invAb) 226
UCGUGGUGGACUUCUCUCAAUU 300 AM05639-SS
(NAG25)s(invAb)sugguggAfCfUfucucucaauus(invAb) 227
UGGUGGACUUCUCUCAAUU 301 AM05640-SS
(NAG37)s(invAb)sugguggAfCfUfucucucaauus(invAb) 228
UGGUGGACUUCUCUCAAUU 301 AM05746-SS
(NAG25)sgsuggacuuCfUfCfucaauuuucus(invAb) 229 GUGGACUUCUCUCAAUUUUCU
302 AM05856-SS (NAG25)s(invAb)scuguagGfCfAfuaaauugguausu(invAb) 230
CUGUAGGCAUAAAUUGGUAUU 278 AM05857-SS
(NAG25)s(invAb)sgcuguagGfCfAfuaaauugguausu(invAb) 231
GCUGUAGGCAUAAUUGGUAUU 303 AM05858-SS
(NAG25)s(invAb)sggcuguagGfCfAfuaaauugguausu(invAb) 232
GGCUGUAGGCAUAAAUUGGUAUU 304 AM05859-SS
(NAG25)s(invAb)saacuguagGfCfAfuaaauugguausu(invAb) 233
AACUGUAGGCAUAAAUUGGUAUU 305 AM05868-SS
(NAG25)s(invAb)ugguggAfCfUfucucucaauausu(invAb) 234
UGGUGGACUUCUCUCAAUAUU 306 AM05869-SS
(NAG25)s(invAb)sgugguggAfCfUfucucucaauausu(invAb) 235
GUGGUGGACUUCUCUCAAUAUU 307 AM05870-SS
(NAG25)sasaugguggAfCfUfucucucaauausu(invAb) 236
AAUGGUGGACUUCUCUCAAUAUU 308 AM05871-SS
(NAG25)scsgugguggAfCfUfucucucaauausu(invAb) 237
CGUGGUGGACUUCUCUCAAUAUU 309 AM05872-SS
(NAG31)scsgugguggAfCfUfucucucaauas(invAb) 238 CGUGGUGGACUUCUCUCAAUA
289 AM05879-SS (NAG25)s(invAb)saaguggugGfAfCfuucucucaaus(invAb) 239
AAGUGGUGGACUUCUCUCAAU 283 AM05880-SS
(NAG25)s(invAb)sguggugGfAfCfuucucucaaausu(invAb) 240
GUGGUGGACUUCUCUCAAAUU 310 AM05881-SS
(NAG25)s(invAb)scguggugGfAfCfuucucucaausu(invAb) 241
CGUGGUGGACUUCUCUCAAAUU 311 AM05882-SS
(NAG25)sasaguggugGfAfCfuucucucaausu(invAb) 242
AAGUGGUGGACUUCUCUCAAAUU 312 AM05883-SS
(NAG25)sucuguggugGfAfCfuucucucaausu(invAb) 243
UCGUGGUGGACUUCUCUCAAAUU 313 AM06146-SS
(NAG37)s(invAb)sgugguggAfCfUfucucucaauausu(invAb) 244
GUGGUGGACUUCUCUCAAUAUU 307 AM06147-SS
(NAG37)s(invAb)scgugguggAfCfUfucucucaauausu(invAb) 245
CGUGGUGGACUUCUCUCAAUAUU 309 AM06148-SS
(NAG37)s(invAb)scucgugguggAfCfUfucucucaauas(invAb) 246
CUCGUGGUGACUUCUCUCAAUA 314 AM06149-SS
(NAG37)s(invAb)scucgugguggAfCfUfucucucaauausu(invAb) 247
CUCGUGGUGGACUUCUCUCAAUAUU 315 AM06150-SS
(NAG37)s(invAb)sggcuguagGfCfAfuaaauugguas(invAb) 248
GGCUGUAGGCAUAAAUUGGUA 294 AM06151-SS
(NAG37)s(invAb)sgaggcuguagGfCfAfuaaauugguas(invAb) 249
GAGGCUGUAGGCAUAAAUUGGUA 316 AM06152-SS
(NAG37)s(invAb)sgaggcuguagGfCfAfuaaauugguausu(invAb) 250
GAGGCUGUAGGCAUAAAUUGGUAUU 317 AM06287-SS
(NAG37)s(invAb)sggacuuCfUfCfucaauuuucuc(invAb) 251
GGACUUCUCUCAAUUUUCU 318 AM06288-SS
(NAG37)s(invAb)sguggacuuCfUfCfucaauuuucus(invAb) 252
GUGGACUUCUCUCAAUUUUCU 302 AM06289-SS
(NAG37)s(invAb)sgguggacuuCfUfCfucaauuuucus(invAb) 253
GGUGGACUUCUCUCAAUUUUCU 319 AM06290-SS
(NAG37)s(invAb)sggacuuCfUfCfucaauuuucas(invAb) 254
GGACUUCUCUCAAUUUUCA 320 AM06291-SS
(NAG37)s(invAb)sguggacuuCfUfCfucaauuuucas(invAb) 255
GUGGACUUCUCUCAAUUUUCA 321 AM06304-SS
(NAG37)s(invAb)sgcuguaGfGfCfauaaauuggus(invAb) 256
GCUGUAGGCAUAAAUUGGU 322 AM06305-SS
(NAG37)s(invAb)sggcuguaGfGfCfauaaauuggus(invAb) 257
GGCUGUAGGCAUAAAUUGGU 323 AM06306-SS
(NAG37)s(invAb)sgaggcuguaGfGfCfauaaauuggus(invAb) 258
GAGGCUGUAGGCAUAAAUUGGU 324 AM06307-SS
(NAG37)s(invAb)sgcuguaGfGfCfauaaauuggas(invAb) 259
GCUGUAGGCAUAAAUUGGA 325 AM06308-SS
(NAG37)s(invAb)sggcuguaGfGfCfauaaauuggas(invAb) 260
GGCUGUAGGCAUAAAUUGGA 326 AM06603-SS
(NAG37)s(invAb)sagcuguagGfCfAfuaaauugguas(invAb) 261
AGCUGUAGGCAUAAAUUGGUA 327 AM06605-SS
(NAG37)s(invAb)scgcuguagGfCfAfuaaauugguas(invAb) 262
CGCUGUAGGCAUAAAUUGGUA 328 AM06607-SS
(NAG37)s(invAb)sggcuguagGfCfAfuaaauugguus(invAb) 263
GGCUGUAGGCAUAAAUUGGUU 329 AM06609-SS
(NAG37)s(invAb)scuguagGfCfAfuaaauugguasuus(invAb) 264
CUGUAGGCAUAAAUUGGUAUU 278 AM06610-SS
(NAG37)s(invAb)scuGfuAfgGfCfAfuAfaAfuUfgGfuasuus 265
CUGUAGGCAUAAAUUGGUAUU 278 (invAb) AM06613-SS
(NAG37)s(invAb)saggcuguaGfGfCfauaaauuggus(invAb) 266
AGGCUGUAGGCAUAAAUUGGU 330 AM06615-SS
(NAG37)s(invAb)saggcuguaGfGfCfauaaauuggas(invAb) 267
AGGCUGUAGGCAUAAAUUGGA 331 AM06617-SS
(NAG37)s(invAb)scggcuguaGfGfCfauaaauuggus(invAb) 268
CGGCUGUAGGCAUAAAUUGGU 332 AM06691-SS
(NAG37)s(invAb)scggcuguaGfGfCfauaaauuggas(invAb) 269
CGGCUGUAGGCAUAAAUUGGA 333 AM06750-SS
(NAG37)s(invAb)scccuguagGfGfAfuaaauugguas(invAb) 270
CCCUGUAGGCAUAAAUUGGUA 334 AM06752-SS
(NAG37)csgcuguagGfCfAfuaaauugguas(invAb) 271 CGCUGUAGGCAUAAAUUGGUA
328 AM06753-SS (NAG37)csccuguagGfCfAfuaaauugguas(invAb) 272
CCCUGUAGGCAUAAAUUGGUA 334 AM06776-SS
(NAG25)s(invAb)sguggacuuCfUfCfucaauuuucus(invAb) 273
GUGGACUUCUCUCAAUUUUCU 302 AM06777-SS
(NAG25)s(invAb)scgcuguagGfCfAfuaaauugguas(invAb) 274
CGCUGUAGGCAUAAAUUGGUA 328
[0431] The HBV RNAi agents described herein are formed by annealing
an antisense strand with a sense strand. A sense strand containing
a sequence listed in Table 4 can be hybridized to any antisense
strand containing a sequence listed in Table 3, provided the two
sequences have a region of at least about 85% complementarity over
a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.
[0432] In some embodiments, the antisense strand of an HBV RNAi
agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from
any of the antisense strand sequences in Table 3. In some
embodiments, the sense strand of an HBV RNAi agent disclosed herein
differs by 0, 1, 2, or 3 nucleotides from any of the sense strand
sequences in Table 4.
[0433] In some embodiments, an HBV RNAi agent antisense strand
comprises a nucleotide sequence of any of the sequences in Table 3.
In some embodiments, an HBV RNAi agent antisense strand comprises
the sequence of nucleotides (from 5' end.fwdarw.3' end) 1-17, 2-17,
1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23,
2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2-26 of any of the sequences
in Table 3.
[0434] In some embodiments, an HBV RNAi agent sense strand
comprises the nucleotide sequence of any of the sequences in Table
4. In some embodiments, an HBV RNAi agent sense strand comprises
the sequence of nucleotides (from 5' end.fwdarw.3' end) 1-17, 2-17,
3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20,
2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22,
1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, 4-24, 1-25, 2-25, 3-25,
4-25, 1-26, 2-26, 3-26, or 4-26 of any of the sequences in Table
4.
[0435] For the HBV RNAi agents disclosed herein, the nucleotide at
position 1 of the antisense strand (from 5' end.fwdarw.3' end) can
be perfectly complementary to an HBV gene, or can be
non-complementary to an HBV gene. In some embodiments, the
nucleotide at position 1 of the antisense strand (from 5'
end.fwdarw.3' end) is a U, A, or dT. In some embodiments, the
nucleotide at position 1 of the antisense strand (from 5'
end.fwdarw.3' end) forms an A:U or U:A base pair with the sense
strand.
[0436] In some embodiments, an HBV RNAi agent antisense strand
comprises the sequence of nucleotides (from 5' end.fwdarw.3' end)
2-18 or 2-19 of any of the antisense strand sequences in Table 3.
In some embodiments, an HBV RNAi sense strand comprises the
sequence of nucleotides (from 5' end.fwdarw.3' end) 1-17 or 1-18 of
any of the sense strand sequences in Table 4.
[0437] In some embodiments, an HBV RNAi agent includes (i) an
antisense strand comprising the sequence of nucleotides (from 5'
end.fwdarw.3' end) 2-18 or 2-19 of any of the antisense strand
sequences in Table 3, and (ii) a sense strand comprising the
sequence of nucleotides (from 5' end.fwdarw.3' end) 1-17 or 1-18 of
any of the sense strand sequences in Table 4.
[0438] A sense strand containing a sequence listed in Table 4 can
be hybridized to any antisense strand containing a sequence listed
in Table 3 provided the two sequences have a region of at least
about 85% complementarity over a contiguous 16, 17, 18, 19, 20, or
21 nucleotide sequence. Representative sequence pairings are
exemplified by the Duplex ID Nos. shown in Table 5.
[0439] In some embodiments, an HBV RNAi agent comprises of any of
the Duplex ID Nos. presented herein. In some embodiments, an HBV
RNAi agent consists of any of the Duplex ID Nos. presented herein.
In some embodiments, an HBV RNAi agent comprises the sense strand
and/or the antisense strand nucleotide sequences of any of the
Duplex ID Nos. presented herein. In some embodiments, an HBV RNAi
agent comprises the sense strand and antisense strand nucleotide
sequences of any of the Duplex ID Nos. presented herein and a
targeting group and/or linking group wherein the targeting group
and/or linking group is covalently linked (i.e. conjugated) to the
sense strand or the antisense strand. In some embodiments, an HBV
RNAi agent comprises the sense strand and antisense strand modified
nucleotide sequences of any of the Duplex ID Nos. presented herein.
In some embodiments, an HBV RNAi agent comprises the sense strand
and antisense strand modified nucleotide sequences of any of the
Duplex ID Nos. presented herein and a targeting group and/or
linking group wherein the targeting group and/or linking group is
covalently linked to the sense strand or the antisense strand.
[0440] In some embodiments, an HBV RNAi agent comprises an
antisense strand and a sense strand having the nucleotide sequences
of any of the antisense strand/sense strand duplexes of Table 5,
and further comprises an asialoglycoprotein receptor ligand
targeting group.
[0441] In some embodiments, an HBV RNAi agent comprises an
antisense strand and a sense strand having the nucleotide sequences
of any of the antisense strand and/or sense strand nucleotide
sequences of any of the duplexes of Table 5, and further comprises
a targeting group selected from the group consisting of (PAZ),
(NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25),
(NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s,
(NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32),
(NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s,
(NAG36), (NAG36)s, (NAG37), (NAG37)s.
[0442] In some embodiments, an HBV RNAi agent comprises an
antisense strand and a sense strand having the modified nucleotide
sequences of any of the antisense strand and/or sense strand
nucleotide sequences of any of the duplexes of Table 5.
[0443] In some embodiments, an HBV RNAi agent comprises an
antisense strand and a sense strand having the modified nucleotide
sequences of any of the antisense strand and/or sense strand
nucleotide sequences of any of the duplexes of Table 5, and further
comprises an asialoglycoprotein receptor ligand targeting
group.
[0444] In some embodiments, an HBV RNAi agent comprises any of the
duplexes of Table 5.
[0445] In some embodiments, an HBV RNAi agent consists of any of
the duplexes of Table 5.
TABLE-US-00005 TABLE 5 Examples of HBV RNAi agent duplexes.
Antisense Sense Strand Duplex ID Strand ID ID AD03498 AM03508-AS
AM04445-SS AD03499 AM04441-AS AM04444-SS AD03500 AM04442-AS
AM04444-SS AD03501 AM04443-AS AM04444-SS AD03738 AM04768-AS
AM04767-SS AD03739 AM04769-AS AM04767-SS AD03967 AM04443-AS
AM05010-SS AD03968 AM05011-AS AM05010-SS AD03969 AM04443-AS
AM05015-SS AD03970 AM05011-AS AM05019-SS AD03971 AM05012-AS
AM05015-SS AD03972 AM04443-AS AM05016-SS AD03973 AM04443-AS
AM05017-SS AD03974 AM04443-AS AM05018-SS AD03975 AM05013-AS
AM05015-SS AD03976 AM05014-AS AM05019-SS AD03977 AM05013-AS
AM05017-SS AD03978 AM05013-AS AM04444-SS AD04001 AM05052-AS
AM05034-SS AD04002 AM05053-AS AM05034-SS AD04003 AM05054-AS
AM05046-SS AD04004 AM05052-AS AM05047-SS AD04005 AM05055-AS
AM05064-SS AD04006 AM05056-AS AM05048-SS AD04007 AM05057-AS
AM05048-SS AD04008 AM05058-AS AM05049-SS AD04009 AM05056-AS
AM05050-SS AD04010 AM05060-AS AM05063-SS AD04176 AM05351-AS
AM05346-SS AD04177 AM04443-AS AM05347-SS AD04178 AM05011-AS
AM05347-SS AD04412 AM05011-AS AM05606-SS AD04413 AM05011-AS
AM05607-SS AD04414 AM05608-AS AM05606-SS AD04415 AM05011-AS
AM05615-SS AD04416 AM05609-AS AM05616-SS AD04417 AM05610-AS
AM05616-SS AD04418 AM05611-AS AM05616-SS AD04419 AM05612-AS
AM05616-SS AD04420 AM05613-AS AM05616-SS AD04421 AM05614-AS
AM05616-SS AD04422 AM05054-AS AM05617-SS AD04423 AM05618-AS
AM05046-SS AD04425 AM05621-AS AM05620-SS AD04426 AM05623-AS
AM05622-SS AD04427 AM05623-AS AM05624-SS AD04428 AM05626-AS
AM05622-SS AD04429 AM05626-AS AM05624-SS AD04430 AM05628-AS
AM05627-SS AD04431 AM05054-AS AM05629-SS AD04432 AM05054-AS
AM05630-SS AD04433 AM05631-AS AM05048-SS AD04434 AM05632-AS
AM05048-SS AD04435 AM05633-AS AM05048-SS AD04436 AM05635-AS
AM05048-SS AD04437 AM05634-AS AM05048-SS AD04438 AM05637-AS
AM05636-SS AD04439 AM05638-AS AM05636-SS AD04440 AM05058-AS
AM05639-SS AD04441 AM05057-AS AM05639-SS AD04442 AM05057-AS
AM05640-SS AD04511 AM05747-AS AM05746-SS AD04570 AM05011-AS
AM05856-SS AD04571 AM05849-AS AM05856-SS AD04572 AM05850-AS
AM05856-SS AD04573 AM05851-AS AM05857-SS AD04574 AM05852-AS
AM05857-SS AD04575 AM05853-AS AM05858-SS AD04576 AM05854-AS
AM05858-SS AD04577 AM05011-AS AM05859-SS AD04578 AM05850-AS
AM05858-SS AD04579 AM05014-AS AM05347-SS AD04580 AM05855-AS
AM05347-SS AD04581 AM05860-AS AM05063-SS AD04583 AM05862-AS
AM05868-SS AD04584 AM05863-AS AM05868-SS AD04585 AM05864-AS
AM05869-SS AD04586 AM05865-AS AM05869-SS AD04587 AM05862-AS
AM05870-SS AD04588 AM05863-AS AM05871-SS AD04590 AM05867-AS
AM05063-SS AD04591 AM05860-AS AM05872-SS AD04592 AM05054-AS
AM05879-SS AD04593 AM05873-AS AM05880-SS AD04594 AM05874-AS
AM05880-SS AD04595 AM05875-AS AM05881-SS AD04596 AM05876-AS
AM05881-SS AD04597 AM05873-AS AM05882-SS AD04598 AM05874-AS
AM05883-SS AD04599 AM05877-AS AM05620-SS AD04734 AM06074-AS
AM05869-SS AD04771 AM06142-AS AM06146-SS AD04772 AM06143-AS
AM06147-SS AD04773 AM06144-AS AM06146-SS AD04774 AM06145-AS
AM06148-SS AD04775 AM06145-AS AM06149-SS AD04776 AM05850-AS
AM06150-SS AD04777 AM05854-AS AM06151-SS AD04778 AM05854-AS
AM06152-SS AD04822 AM06222-AS AM06146-SS AD04823 AM05609-AS
AM06150-SS AD04871 AM06281-AS AM06287-SS AD04872 AM06282-AS
AM06288-SS AD04873 AM06283-AS AM06288-SS AD04874 AM06284-AS
AM06289-SS AD04875 AM06285-AS AM06290-SS AD04876 AM06286-AS
AM06291-SS AD04881 AM06299-AS AM06304-SS AD04882 AM06300-AS
AM06305-SS AD04883 AM06301-AS AM06306-SS AD04884 AM06302-AS
AM06307-SS AD04885 AM06303-AS AM06308-SS AD04962 AM05864-AS
AM06146-SS AD04963 AM05855-AS AM05607-SS AD04981 AM06463-AS
AM06150-SS AD04982 AM06464-AS AM06150-SS AD04983 AM06465-AS
AM06150-SS AD05069 AM06604-AS AM06603-SS AD05070 AM06606-AS
AM06605-SS AD05071 AM06608-AS AM06607-SS AD05072 AM05011-AS
AM06609-SS AD05073 AM06611-AS AM06610-SS AD05074 AM06612-AS
AM06150-SS AD05075 AM06614-AS AM06613-SS AD05076 AM06616-AS
AM06615-SS AD05077 AM06618-AS AM06617-SS AD05078 AM06620-AS
AM06619-SS AD05147 AM06751-AS AM06750-SS AD05148 AM06606-AS
AM06752-SS AD05149 AM06751-AS AM06753-SS AD05164 AM06282-AS
AM06776-SS AD05165 AM06606-AS AM06777-SS
[0446] In some embodiments, an HBV RNAi agent is prepared or
provided as a salt, mixed salt, or a free-acid. The RNAi agents
described herein, upon delivery to a cell expressing an HBV gene,
inhibit or knockdown expression of one or more HBV genes in
vivo.
Targeting Groups, Linking Groups, and Delivery Vehicles
[0447] In some embodiments, an HBV RNAi agent is conjugated to one
or more non-nucleotide groups including, but not limited to a
targeting group, linking group, delivery polymer, or a delivery
vehicle. The non-nucleotide group can enhance targeting, delivery
or attachment of the RNAi agent. Examples of targeting groups and
linking groups are provided in Table 6. The non-nucleotide group
can be covalently linked to the 3' and/or 5' end of either the
sense strand and/or the antisense strand. In some embodiments, an
HBV RNAi agent contains a non-nucleotide group linked to the 3'
and/or 5' end of the sense strand. In some embodiments, a
non-nucleotide group is linked to the 5' end of an HBV RNAi agent
sense strand. A non-nucleotide group may be linked directly or
indirectly to the RNAi agent via a linker/linking group. In some
embodiments, a non-nucleotide group is linked to the RNAi agent via
a labile, cleavable, or reversible bond or linker.
[0448] In some embodiments, a non-nucleotide group enhances the
pharmacokinetic or biodistribution properties of an RNAi agent or
conjugate to which it is attached to improve cell- or
tissue-specific distribution and cell-specific uptake of the
conjugate. In some embodiments, a non-nucleotide group enhances
endocytosis of the RNAi agent.
[0449] Targeting groups or targeting moieties enhance the
pharmacokinetic or biodistribution properties of a conjugate to
which they are attached to improve cell-specific distribution and
cell-specific uptake of the conjugate. A targeting group can be
monovalent, divalent, trivalent, tetravalent, or have higher
valency. Representative targeting groups include, without
limitation, compounds with affinity to cell surface molecule, cell
receptor ligands, hapten, antibodies, monoclonal antibodies,
antibody fragments, and antibody mimics with affinity to cell
surface molecules. In some embodiments, a targeting group is linked
to an RNAi agent using a linker, such as a PEG linker or one, two,
or three abasic and/or ribitol (abasic ribose) groups. In some
embodiments, a targeting group comprises a galactose derivative
cluster.
[0450] The HBV RNAi agents described herein may be synthesized
having a reactive group, such as an amine group, at the
5'-terminus. The reactive group may be used to subsequently attach
a targeting moiety using methods typical in the art.
[0451] In some embodiments, a targeting group comprises an
asialoglycoprotein receptor ligand. In some embodiments, an
asialoglycoprotein receptor ligand includes or consists of one or
more galactose derivatives. As used herein, the term galactose
derivative includes both galactose and derivatives of galactose
having affinity for the asialoglycoprotein receptor that is equal
to or greater than that of galactose. Galactose derivatives
include, but are not limited to: galactose, galactosamine,
N-formylgalactosamine, N-acetyl-galactosamine,
N-propionyl-galactosamine, N-n-butanoyl-galactosamine, and
N-iso-butanoylgalactos-amine (see for example: Iobst. S. T. and
Drickamer, K. J.B.C. 1996, 271, 6686). Galactose derivatives, and
clusters of galactose derivatives, that are useful for in vivo
targeting of oligonucleotides and other molecules to the liver are
known in the art (see, for example, Baenziger and Fiete, 1980.
Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257,
939-945). Galactose derivatives have been used to target molecules
to hepatocytes in vivo through their binding to the
asialoglycoprotein receptor (ASGPr) expressed on the surface of
hepatocytes. Binding of ASGPr ligands to the ASGPr(s) facilitates
cell-specific targeting to hepatocytes and endocytosis of the
molecule into hepatocytes. ASGPr ligands can be monomeric (e.g.,
having a single galactose derivative) or multimeric (e.g., having
multiple galactose derivatives). The galactose derivative or
galactose derivative cluster may be attached to the 3' or 5' end of
the RNAi polynucleotide using methods known in the art. The
preparation of targeting groups, such as galactose derivative
clusters, is described in, for example, U.S. patent application
Ser. Nos. 15/452,324 and 15/452,423, the contents of both of which
are incorporated herein in their entirety.
[0452] As used herein, a galactose derivative cluster comprises a
molecule having two to four terminal galactose derivatives. A
terminal galactose derivative is attached to a molecule through its
C-1 carbon. In some embodiments, the galactose derivative cluster
is a galactose derivative trimer (also referred to as tri-antennary
galactose derivative or tri-valent galactose derivative). In some
embodiments, the galactose derivative cluster comprises
N-acetyl-galactosamines. In some embodiments, the galactose
derivative cluster comprises three N-acetyl-galactosamines. In some
embodiments, the galactose derivative cluster is a galactose
derivative tetramer (also referred to as tetra-antennary galactose
derivative or tetra-valent galactose derivative). In some
embodiments, the galactose derivative cluster comprises four
N-acetyl-galactosamines.
[0453] As used herein, a galactose derivative trimer contains three
galactose derivatives, each linked to a central branch point. As
used herein, a galactose derivative tetramer contains four
galactose derivatives, each linked to a central branch point. The
galactose derivatives can be attached to the central branch point
through the C-1 carbons of the saccharides. In some embodiments,
the galactose derivatives are linked to the branch point via
linkers or spacers. In some embodiments, the linker or spacer is a
flexible hydrophilic spacer, such as a PEG group (see, for example,
U.S. Pat. No. 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol. 39
p. 1538-1546). In some embodiments, the PEG spacer is a PEG.sub.3
spacer. The branch point can be any small molecule which permits
attachment of three galactose derivatives and further permits
attachment of the branch point to the RNAi agent. An example of
branch point group is a di-lysine or di-glutamate. Attachment of
the branch point to the RNAi agent can occur through a linker or
spacer. In some embodiments, the linker or spacer comprises a
flexible hydrophilic spacer, such as, but not limited to, a PEG
spacer. In some embodiments, the linker comprises a rigid linker,
such as a cyclic group. In some embodiments, a galactose derivative
comprises or consists of N-acetyl-galactosamine. In some
embodiments, the galactose derivative cluster is comprised of a
galactose derivative tetramer, which can be, for example, an
N-acetyl-galactosamine tetramer.
[0454] In some embodiments, pharmaceutical compositions for
delivering an HBV RNAi agent to a liver cell in vivo are described.
Such pharmaceutical compositions can include, for example, an HBV
RNAi agent conjugated to a galactose derivative cluster. In some
embodiments, the galactose derivative cluster is comprised of a
galactose derivative trimer, which can be, for example, an
N-acetyl-galactosamine trimer, or galactose derivative tetramer,
which can be, for example, an N-acetyl-galactosamine tetramer.
[0455] Targeting groups include, but are not limited to, (PAZ),
(NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25),
(NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s,
(NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32),
(NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s,
(NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39),
and (NAG39)s. Other targeting groups, including galactose cluster
targeting ligands, are known in the art.
[0456] In some embodiments, a linking group is conjugated to the
RNAi agent. The linking group facilitates covalent linkage of the
agent to a targeting group or delivery polymer or delivery vehicle.
The linking group can be linked to the 3' or the 5' end of the RNAi
agent sense strand or antisense strand. In some embodiments, the
linking group is linked to the RNAi agent sense strand. In some
embodiments, the linking group is conjugated to the 5' or 3' end of
an RNAi agent sense strand. In some embodiments, a linking group is
conjugated to the 5' end of an RNAi agent sense strand. Examples of
linking groups, include, but are not limited to: reactive groups
such a primary amines and alkynes, alkyl groups, abasic
nucleosides, ribitol (abasic ribose), and/or PEG groups.
[0457] A linker or linking group is a connection between two atoms
that links one chemical group (such as an RNAi agent) or segment of
interest to another chemical group (such as a targeting group or
delivery polymer) or segment of interest via one or more covalent
bonds. A labile linkage contains a labile bond. A linkage may
optionally include a spacer that increases the distance between the
two joined atoms. A spacer may further add flexibility and/or
length to the linkage. Spacers may include, but are not be limited
to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups,
aralkyl groups, aralkenyl groups, and aralkynyl groups; each of
which can contain one or more heteroatoms, heterocycles, amino
acids, nucleotides, and saccharides. Spacer groups are well known
in the art and the preceding list is not meant to limit the scope
of the description.
[0458] Any of the HBV RNAi agent nucleotide sequences listed in
Tables 3 and 4, whether modified or unmodified, may contain 3' or
5' targeting group and/or linking group. Any of the HBV RNAi agent
sequences listed in Table 3 and 4 which contain a 3' or 5'
targeting group and/or linking group, may alternatively contain no
3' or 5' targeting group and/or linking group, or may contain a
different 3' or 5' targeting group and/or linking group including,
but not limited to, those depicted in Table 3. Any of the HBV RNAi
agent duplexes listed in Table 5, whether modified or unmodified,
may further comprise a targeting group and/or linking group,
including, but not limited to, those depicted in Table 3, and the
targeting group or linking group may be attached to the 3' or 5'
terminus of either the sense strand or the antisense strand of the
HBV RNAi agent duplex.
[0459] Examples of targeting groups and linking groups are provided
in Table 6. Table 4 provides several embodiments of HBV RNAi agent
sense strands having a targeting group or linking group linked to
the 5' or 3' end.
TABLE-US-00006 TABLE 6 Structures representing various modified
nucleotides, targeting groups, and linking groups. ##STR00001##
##STR00002## ##STR00003## ##STR00004## ##STR00005## ##STR00006##
When positioned internally on oligonucleotide: ##STR00007## When
positioned internally on oligonucleotide: ##STR00008## When
positioned internally on oligonucleotide: ##STR00009## ##STR00010##
##STR00011## ##STR00012## ##STR00013## ##STR00014## ##STR00015##
##STR00016## ##STR00017## ##STR00018## ##STR00019## ##STR00020##
##STR00021## ##STR00022## ##STR00023## ##STR00024## ##STR00025##
##STR00026## ##STR00027## ##STR00028## ##STR00029## ##STR00030##
##STR00031## ##STR00032## ##STR00033## ##STR00034## ##STR00035##
##STR00036## ##STR00037## ##STR00038## ##STR00039## ##STR00040##
##STR00041## ##STR00042## ##STR00043## ##STR00044## ##STR00045##
##STR00046##
[0460] In each of the above structures in Table 6, NAG comprises an
N-acetyl-galactosamine or another ASGPr ligand, as would be
understood by a person of ordinary skill in the art to be attached
in view of the structures above and description provided herein.
For example, in some embodiments, NAG in the structures provided in
Table 6 is represented by the following structure:
##STR00047##
[0461] Each (NAGx) may be attached to an HBV RNAi agent via a
phosphate group (as in (NAG25), (NAG30), and (NAG31)), or a
phosphorothioate group, (as is (NAG25)s, (NAG29)s, (NAG30)s,
(NAG31)s, or (NAG37)s), or another linking group.
##STR00048##
Other linking groups known in the art may be used.
Delivery Vehicles
[0462] In some embodiments, a delivery vehicle may be used to
deliver an RNAi agent to a cell or tissue. A delivery vehicle is a
compound that improves delivery of the RNAi agent to a cell or
tissue. A delivery vehicle can include, or consist of, but is not
limited to: a polymer, such as an amphipathic polymer, a membrane
active polymer, a peptide, a melittin peptide, a melittin-like
peptide (MLP), a lipid, a reversibly modified polymer or peptide,
or a reversibly modified membrane active polyamine.
[0463] In some embodiments, the RNAi agents can be combined with
lipids, nanoparticles, polymers, liposomes, micelles, DPCs or other
delivery systems available in the art. The RNAi agents can also be
chemically conjugated to targeting groups, lipids (including, but
not limited to cholesterol and cholesteryl derivatives),
nanoparticles, polymers, liposomes, micelles, DPCs (see, for
example WO 2000/053722, WO 2008/0022309, WO 2011/104169, and WO
2012/083185, WO 2013/032829, WO 2013/158141, each of which is
incorporated herein by reference), or other delivery systems
available in the art.
Pharmaceutical Compositions and Formulations
[0464] The HBV RNAi agents disclosed herein may be prepared as
pharmaceutical compositions or formulations. In some embodiments,
pharmaceutical compositions include at least one HBV RNAi agent.
These pharmaceutical compositions are particularly useful in the
inhibition of the expression of the target mRNA in a target cell, a
group of cells, a tissue, or an organism. The pharmaceutical
compositions can be used to treat a subject having a disease or
disorder that would benefit from reduction in the level of the
target mRNA, or inhibition in expression of the target gene. The
pharmaceutical compositions can be used to treat a subject at risk
of developing a disease or disorder that would benefit from
reduction of the level of the target mRNA or an inhibition in
expression the target gene. In one embodiment, the method includes
administering an HBV RNAi agent linked to a targeting ligand as
described herein, to a subject to be treated. In some embodiments,
one or more pharmaceutically acceptable excipients (including
vehicles, carriers, diluents, and/or delivery polymers) are added
to the pharmaceutical compositions including an HBV RNAi agent,
thereby forming a pharmaceutical formulation suitable for in vivo
delivery to a human.
[0465] The pharmaceutical compositions that include an HBV RNAi
agent and methods disclosed herein may decrease the level of the
target mRNA in a cell, group of cells, group of cells, tissue, or
subject, including: administering to the subject a therapeutically
effective amount of a herein described HBV RNAi agent, thereby
inhibiting the expression of a target mRNA in the subject.
[0466] In some embodiments, the described pharmaceutical
compositions including an HBV RNAi agent are used for treating or
managing clinical presentations associated with HBV infection. In
some embodiments, a therapeutically or prophylactically effective
amount of one or more of pharmaceutical compositions is
administered to a subject in need of such treatment, prevention or
management. In some embodiments, administration of any of the
disclosed HBV RNAi agents can be used to decrease the number,
severity, and/or frequency of symptoms of a disease in a
subject.
[0467] The described pharmaceutical compositions including an HBV
RNAi agent can be used to treat at least one symptom in a subject
having a disease or disorder that would benefit from reduction or
inhibition in expression of HBV mRNA. In some embodiments, the
subject is administered a therapeutically effective amount of one
or more pharmaceutical compositions including an HBV RNAi agent
thereby treating the symptom. In other embodiments, the subject is
administered a prophylactically effective amount of one or more HBV
RNAi agents, thereby preventing the at least one symptom.
[0468] The route of administration is the path by which an HBV RNAi
agent is brought into contact with the body. In general, methods of
administering drugs and nucleic acids for treatment of a mammal are
well known in the art and can be applied to administration of the
compositions described herein. The HBV RNAi agents disclosed herein
can be administered via any suitable route in a preparation
appropriately tailored to the particular route. Thus, herein
described pharmaceutical compositions can be administered by
injection, for example, intravenously, intramuscularly,
intracutaneously, subcutaneously, intraarticularly, or
intraperitoneally. In some embodiments, there herein described
pharmaceutical compositions via subcutaneous injection.
[0469] The pharmaceutical compositions including an HBV RNAi agent
described herein can be delivered to a cell, group of cells, tumor,
tissue, or subject using oligonucleotide delivery technologies
known in the art. In general, any suitable method recognized in the
art for delivering a nucleic acid molecule (in vitro or in vivo)
can be adapted for use with a herein described compositions. For
example, delivery can be by local administration, (e.g., direct
injection, implantation, or topical administering), systemic
administration, or subcutaneous, intravenous, intraperitoneal, or
parenteral routes, including intracranial (e.g., intraventricular,
intraparenchymal and intrathecal), intramuscular, transdermal,
airway (aerosol), nasal, oral, rectal, or topical (including buccal
and sublingual) administration. In certain embodiments, the
compositions are administered by subcutaneous or intravenous
infusion or injection.
[0470] Accordingly, in some embodiments, the herein described
pharmaceutical compositions may comprise one or more
pharmaceutically acceptable excipients. In some embodiments, the
pharmaceutical compositions described herein can be formulated for
administration to a subject.
[0471] As used herein, a pharmaceutical composition or medicament
includes a pharmacologically effective amount of at least one of
the described therapeutic compounds and one or more
pharmaceutically acceptable excipients. Pharmaceutically acceptable
excipients (excipients) are substances other than the Active
Pharmaceutical ingredient (API, therapeutic product, e.g., HBV RNAi
agent) that are intentionally included in the drug delivery
system.
[0472] Excipients do not exert or are not intended to exert a
therapeutic effect at the intended dosage. Excipients may act to a)
aid in processing of the drug delivery system during manufacture,
b) protect, support or enhance stability, bioavailability or
patient acceptability of the API, c) assist in product
identification, and/or d) enhance any other attribute of the
overall safety, effectiveness, of delivery of the API during
storage or use. A pharmaceutically acceptable excipient may or may
not be an inert substance.
[0473] Excipients include, but are not limited to: absorption
enhancers, anti-adherents, anti-foaming agents, anti-oxidants,
binders, buffering agents, carriers, coating agents, colors,
delivery enhancers, delivery polymers, dextran, dextrose, diluents,
disintegrants, emulsifiers, extenders, fillers, flavors, glidants,
humectants, lubricants, oils, polymers, preservatives, saline,
salts, solvents, sugars, suspending agents, sustained release
matrices, sweeteners, thickening agents, tonicity agents, vehicles,
water-repelling agents, and wetting agents.
[0474] Pharmaceutical compositions suitable for injectable use
include sterile aqueous solutions (where water soluble) or
dispersions and sterile powders for the extemporaneous preparation
of sterile injectable solutions or dispersion. For intravenous
administration, suitable carriers include physiological saline,
bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.) or
phosphate buffered saline. It should be stable under the conditions
of manufacture and storage and should be preserved against the
contaminating action of microorganisms such as bacteria and fungi.
The carrier can be a solvent or dispersion medium containing, for
example, water, ethanol, polyol (for example, glycerol, propylene
glycol, and liquid polyethylene glycol), and suitable mixtures
thereof. The proper fluidity can be maintained, for example, by the
use of a coating such as lecithin, by the maintenance of the
required particle size in the case of dispersion and by the use of
surfactants. In many cases, it will be preferable to include
isotonic agents, for example, sugars, polyalcohols such as
mannitol, sorbitol, and sodium chloride in the composition.
Prolonged absorption of the injectable compositions can be brought
about by including in the composition an agent which delays
absorption, for example, aluminum monostearate and gelatin.
[0475] Sterile injectable solutions can be prepared by
incorporating the active compound in the required amount in an
appropriate solvent with one or a combination of ingredients
enumerated above, as required, followed by filter sterilization.
Generally, dispersions are prepared by incorporating the active
compound into a sterile vehicle which contains a basic dispersion
medium and the required other ingredients from those enumerated
above. In the case of sterile powders for the preparation of
sterile injectable solutions, methods of preparation include vacuum
drying and freeze-drying which yields a powder of the active
ingredient plus any additional desired ingredient from a previously
sterile-filtered solution thereof.
[0476] Formulations suitable for intra-articular administration can
be in the form of a sterile aqueous preparation of the drug that
can be in microcrystalline form, for example, in the form of an
aqueous microcrystalline suspension. Liposomal formulations or
biodegradable polymer systems can also be used to present the drug
for both intra-articular and ophthalmic administration.
[0477] The active compounds can be prepared with carriers that will
protect the compound against rapid elimination from the body, such
as a controlled release formulation, including implants and
microencapsulated delivery systems. Biodegradable, biocompatible
polymers can be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and
polylactic acid. Methods for preparation of such formulations will
be apparent to those skilled in the art. Liposomal suspensions can
also be used as pharmaceutically acceptable carriers. These can be
prepared according to methods known to those skilled in the art,
for example, as described in U.S. Pat. No. 4,522,811.
[0478] The HBV RNAi agents can be formulated in compositions in
dosage unit form for ease of administration and uniformity of
dosage. Dosage unit form refers to physically discrete units suited
as unitary dosages for the subject to be treated; each unit
containing a predetermined quantity of active compound calculated
to produce the desired therapeutic effect in association with the
required pharmaceutical carrier. The specification for the dosage
unit forms of the disclosure are dictated by and directly dependent
on the unique characteristics of the active compound and the
therapeutic effect to be achieved, and the limitations inherent in
the art of compounding such an active compound for the treatment of
individuals.
[0479] A pharmaceutical composition can contain other additional
components commonly found in pharmaceutical compositions. Such
additional components include, but are not limited to:
anti-pruritics, astringents, local anesthetics, or
anti-inflammatory agents (e.g., antihistamine, diphenhydramine,
etc.). It is also envisioned that cells, tissues or isolated organs
that express or comprise the herein defined RNAi agents may be used
as "pharmaceutical compositions." As used herein,
"pharmacologically effective amount," "therapeutically effective
amount," or simply "effective amount" refers to that amount of an
RNAi agent to produce a pharmacological, therapeutic or preventive
result.
[0480] Generally, an effective amount of an active compound will be
in the range of from about 0.1 to about 100 mg/kg of body
weight/day, e.g., from about 1.0 to about 50 mg/kg of body
weight/day. In some embodiments, an effective amount of an active
compound will be in the range of from about 0.25 to about 5 mg/kg
of body weight per dose. In some embodiments, an effective amount
of an active ingredient will be in the range of from about 0.5 to
about 3 mg/kg of body weight per dose. The amount administered will
also likely depend on such variables as the overall health status
of the patient, the relative biological efficacy of the compound
delivered, the formulation of the drug, the presence and types of
excipients in the formulation, and the route of administration.
Also, it is to be understood that the initial dosage administered
can be increased beyond the above upper level in order to rapidly
achieve the desired blood-level or tissue level, or the initial
dosage can be smaller than the optimum.
[0481] For treatment of disease or for formation of a medicament or
composition for treatment of a disease, the pharmaceutical
compositions described herein including an HBV RNAi agent can be
combined with an excipient or with a second therapeutic agent or
treatment including, but not limited to: a second or other RNAi
agent, a small molecule drug, an antibody, an antibody fragment,
and/or a vaccine.
[0482] The described HBV RNAi agents, when added to
pharmaceutically acceptable excipients or adjuvants, can be
packaged into kits, containers, packs, or dispensers. The
pharmaceutical compositions described herein may be packaged in
pre-filled syringes or vials.
Methods of Treatment and Inhibition of Expression
[0483] The HBV RNAi agents disclosed herein can be used to treat a
subject (e.g., a human or mammal) having a disease or disorder that
would benefit from administration of the compound. In some
embodiments, the RNAi agents disclosed herein can be used to treat
a subject (e.g., a human) having a disease or disorder that would
benefit from reduction or inhibition in expression of HBV mRNA. The
subject is administered a therapeutically effective amount of any
one or more RNAi agents. The subject can be a human, patient, or
human patient. The subject may be an adult, adolescent, child, or
infant. The described pharmaceutical compositions including an HBV
RNAi agent can be used to provide methods for the therapeutic
treatment of diseases. Such methods include administration of a
pharmaceutical composition described herein to a human being or
animal.
[0484] In some embodiments, the HBV RNAi agents described herein
are used to treat a subject infected with HBV. In some embodiments,
the described HBV RNAi agents are used to treat at least one
symptom in a subject having a HBV infection. The subject is
administered a therapeutically effective amount of any one or more
of the described RNAi agents.
[0485] In some embodiments, the subject has both a HBV infection
and a HDV infection. In some embodiments, the HBV RNAi agents
described herein are used to treat a subject infected with both HBV
and HDV. In some embodiments, the described HBV RNAi agents are
used to treat at least one symptom in a subject having a HBV or a
HDV infection. The subject is administered a therapeutically
effective amount of any one or more of the described RNAi
agents.
[0486] In some embodiments, the HBV RNAi agents are used to treat
or manage a clinical presentation wherein a subject infected with
HBV. The subject is administered a therapeutically or effective
amount of one or more of the HBV RNAi agents or HBV RNAi
agent-containing compositions described herein. In some
embodiments, the method comp rises administering a composition
comprising an HBV RNAi agent described herein to a subject to be
treated.
[0487] In some embodiments, the gene expression level and/or mRNA
level of an HBV gene in a subject to whom a described HBV RNAi
agent is administered is reduced by at least about 5%, 10%, 15%,
20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%,
85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to
the subject prior to being administered the HBV RNAi agent or to a
subject not receiving the HBV RNAi agent. The gene expression level
and/or mRNA level in the subject may be reduced in a cell, group of
cells, and/or tissue of the subject. In some embodiments, the
expressed protein level of an HBV gene in a subject to whom a
described HBV RNAi agent has been administered is reduced by at
least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or
greater than 99% relative to the subject prior to being
administered the HBV RNAi agent or to a subject not receiving the
HBV RNAi agent. The protein level in the subject may be reduced in
a cell, group of cells, tissue, blood, and/or other fluid of the
subject. For example, in some embodiments, the amount or level of
Hepatitis B surface antigen (HBsAg) in a subject to whom a
described HBV RNAi agent has been administered is reduced by at
least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or
greater than 99% relative to the subject prior to being
administered the HBV RNAi agent or to a subject not receiving the
HBV RNAi agent. In some embodiments, the amount or level of
Hepatitis B e-antigen (HBeAg) in a subject to whom a described HBV
RNAi agent has been administered is reduced by at least about 5%,
10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%
relative to the subject prior to being administered the HBV RNAi
agent or to a subject not receiving the HBV RNAi agent. In some
embodiments, the amount or level of serum HBV DNA in a subject to
whom a described HBV RNAi agent has been administered is reduced by
at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%,
55%, 60%, 65%, 70%, 75%, 80%, 85%/0, 90%, 95%, 96%, 97%, 98%, 99%,
or greater than 99% relative to the subject prior to being
administered the HBV RNAi agent or to a subject not receiving the
HBV RNAi agent. A reduction in the presence of serum HBV DNA, HBV
gene expression, HBV mRNA, or HBV protein amounts or levels may be
assessed by methods known in the art. Reduction or decrease in HBV
mRNA amount or level, expressed protein amount or level, and/or
serum HBV DNA amount or level, are collectively referred to herein
as a reduction or decrease in HBV or inhibiting or reducing the
expression of HBV.
Cells and Tissues and Non-Human Organisms
[0488] Cells, tissues, and non-human organisms that include at
least one of the HBV RNAi agents described herein is contemplated.
The cell, tissue, or non-human organism is made by delivering the
RNAi agent to the cell, tissue, or non-human organism.
[0489] The above provided embodiments and items are now illustrated
with the following, non-limiting examples.
EXAMPLES
Example 1. Synthesis of HBV RNAI Agents
[0490] HBV RNAi agent duplexes shown in Table 5 were synthesized in
accordance with the following:
A. Synthesis.
[0491] The sense and antisense strands of the HBV RNAi agents were
synthesized according to phosphoramidite technology on solid phase
used in oligonucleotide synthesis. Depending on the scale, either a
MerMade96E.RTM. (Bioautomation), a MerMade12.RTM. (Bioautomation),
or an OP Pilot 100 (GE Healthcare) was used. Syntheses were
performed on a solid support made of controlled pore glass (CPG,
500 .ANG. or 600 .ANG., obtained from Prime Synthesis, Aston, Pa.,
USA). All RNA and 2'-modified phosphoramidites were purchased from
Thermo Fisher Scientific (Milwaukee, Wis., USA). Specifically, the
following 2'-O-methyl phosphoramidites were used:
(5'-O-dimethoxytrityl-N.sup.6-(benzoyl)-2'-O-methyl-adenosine-3'-O--
(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite,
5'-O-dimethoxy-tritvl-N.sup.4-(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyano-
ethyl-N,N-diisopropyl-amino) phosphoramidite,
(5'-O-dimethoxytrityl-N.sup.2-(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2--
cyanoethyl-N,N-diisopropylamino) phosphoramidite, and
5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisoprop-
ylamino) phosphoramidite. The 2'-deoxy-2'-fluoro-phosphoramidites
carried the same protecting groups as the 2'-O-methyl amidites. The
abasic
(3'-O-dimethoxytrityl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylan-
ino) phosphoramidites were purchased from ChemGenes (Wilmington,
Mass., USA). Targeting ligand containing phosphoramidites were
dissolved in anhydrous dichloromethane or anhydrous acetonitrile
(50 mM), while all other amidites were dissolved in anhydrous
acetonitrile (50 mM) and molecular sieves (3 .ANG.) were added.
5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or
5-Ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as
activator solution. Coupling times were 12 min (RNA), 15 min
(targeting ligand), 90 sec (2'OMe), and 60 sec (2'F). In order to
introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl
1,2,4-dithiazoline-5-one (POS, obtained from PolyOrg, Inc.,
Leominster, Mass., USA) in anhydrous Acetonitrile was employed.
B. Cleavage and Deprotection of Support Bound Oligomer.
[0492] After finalization of the solid phase synthesis, the dried
solid support was treated with a 1:1 volume solution of 40 wt. %
methylamine in water and 28% ammonium hydroxide solution (Aldrich)
for 1.5 hours at 30.degree. C. The solution was evaporated and the
solid residue was reconstituted in water (see below).
C. Purification.
[0493] Crude oligomers were purified by anionic exchange HPLC using
a TSKgel SuperQ-5PW 13 .mu.m column and Shimadzu LC-8 system.
Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0 and contained
20%0/Acetonitrile and buffer B was the same as buffer A with the
addition of 1.5 M sodium chloride. UV traces at 260 nm were
recorded. Appropriate fractions were pooled then run on size
exclusion HPLC using a GE Healthcare XK 26/40 column packed with
Sephadex G-25 fine with a running buffer of filtered DI water or
100 mM ammonium bicarbonate, pH 6.7 and 20% Acetonitrile.
D. Annealing.
[0494] Complementary strands were mixed by combining equimolar RNA
solutions (sense and antisense) in 1.times.Phosphate-Buffered
Saline (Corning, Cellgro) to form the RNAi agents. Some RNAi agents
were lyophilized and stored at -15 to -25.degree. C. Duplex
concentration was determined by measuring the solution absorbance
on a UV-Vis spectrometer in 1.times. Phosphate-Buffered Saline. The
solution absorbance at 260 nm was then multiplied by a conversion
factor and the dilution factor to determine the duplex
concentration. Unless otherwise stated, all conversion factor was
0.037 mg/(mL-cm). For some experiments, a conversion factor was
calculated from an experimentally determined extinction
coefficient.
Example 2 pHBV Model Mice
[0495] Six to eight-week-old female NOD.CB17-Prkdscid/NcrCrl
(NOD-SCID) mice were transiently transfected in vivo with MC-HBV1.3
by hydrodynamic tail vein injection (Yang P L et al. "Hydrodynamic
injection of viral DNA: a mouse model of acute hepatitis B virus
infection," PNAS USA 2002 Vol. 99: p. 13825-13830), administered 30
to 45 days prior to administration of an HBV RNAi agent or control.
MC-HBV1.3 is a plasmid-derived minicircle that contains the same
terminally redundant human hepatitis B virus sequence HBV1.3 as in
plasmid pHBV1.3 and in the HBV1.3.32 transgenic mice (GenBank
accession #V01460) (Guidotti L G et al., "High-level hepatitis B
virus replication in transgenic mice," J Virol 1995 Vol. 69, p
6158-6169.). 5 or 10 .mu.g MC-HBV1.3 in Ringer's Solution in a
total volume of 10% of the animal's body weight was injected into
mice via tail vein to create pHBV model of chronic HBV infection.
The solution was injected through a 27-gauge needle in 5-7 seconds
as previously described (Zhang G et al., "High levels of foreign
gene expression in hepatocytes after tail vein injection of naked
plasmid DNA." Human Gene Therapy 1999 Vol. 10, p 1735-1737.). At
pre-dose (either day 1 pre-dose, day -1, or day -2), Hepatitis B
surface antigen (HBsAg) HBsAg expression levels in serum were
measured by ELISA and the mice were grouped according to average
HBsAg expression levels.
Analyses:
[0496] At various times, before and after administration of HBV
RNAi agents, serum HBsAg, serum HBeAg, serum HBV DNA, or liver HBV
RNA may be measured. HBV expression levels were normalized to
pre-administration expression levels and to control mice injected
with phosphate buffered saline ("PBS").
[0497] 1) Serum Collection:
[0498] Mice were anesthetized with 2-3% isoflurane and blood
samples were collected from the submandibular area into serum
separation tubes (Sarstedt AG & Co., Numbrecht, Germany). Blood
was allowed to coagulate at ambient temperature for 20 min. The
tubes were centrifuged at 8,000.times.g for 3 min to separate the
serum and stored at 4.degree. C.
[0499] ii) Serum Hepatitis B Surface Antigen (HBsAg) Levels:
[0500] Serum was collected and diluted 10 to 8000-fold in PBS
containing 5% nonfat dry milk. Secondary HBsAg standards diluted in
the nonfat milk solution were prepared from serum of ICR mice
(Harlan Sprague Dawley) that had been transfected with 10 .mu.g
HBsAg-expressing plasmid pRcCMV-HBs (Aldevron, Fargo, N. Dak.).
HBsAg levels were determined with a GS HBsAg EIA 3.0 kit (Bio-Rad
Laboratories, Inc., Redmond, Wash.) as described by the
manufacturer. Recombinant HBsAg protein, ayw subtype, also diluted
in nonfat milk in PBS, was used as a primary standard
(Aldevron).
[0501] HBsAg expression for each animal was normalized to the
control group of mice injected with PBS in order to account for the
non-treatment related decline in expression of MC-HBV1.3. First,
the HBsAg level for each animal at a time point was divided by the
pre-treatment level of expression in that animal in order to
determine the ratio of expression "normalized to pre-treatment".
Expression at a specific time point was then normalized to the
control group by dividing the "normalized to pre-treatment" ratio
for an individual animal by the average "normalized to
pre-treatment" ratio of all mice in the normal PBS control
group.
[0502] iii) Serum Hepatitis B e-Antigen (HBeAg) Levels:
[0503] HBeAg analysis was performed with the HBeAg enzyme linked
immunosorbent assay (ELISA) as described by the manufacturer
(DiaSorin) using serum diluted 4- to 20-fold in 5% nonfat dry milk.
The amount of antigen was determined in the linear range of the
assay and quantitated against HBeAg protein standards (Fitzgerald
Industries International, catalog #30-AH18, Acton, Mass.).
[0504] HBeAg expression for each animal was normalized to the
control group of mice injected with PBS in order to account for the
non-treatment related decline in expression of MC-HBV1.3. For
evaluation of HBeAg in serum, HBeAg is analyzed from pooled group
or subgroup serum samples. First, the HBeAg level for each pooled
group or subgroup was divided by the pre-treatment level of
expression in the same group or subgroup in order to determine the
ratio of expression "normalized to pre-treatment". Expression at a
specific time point was then normalized to the control group by
dividing the "normalized to pre-treatment" ratio for a group or
subgroup by the average "normalized to pre-treatment" ratio of all
samples from the normal PBS control group.
[0505] iv) Serum HBV DNA Levels:
[0506] Equal volumes of serum from mice in a group or subgroup were
pooled to a final volume of 100 .mu.L. DNA was isolated from serum
samples using the QIAamp MinElute Virus Spin Kit (Qiagen, Valencia,
Calif.) following the manufacturer's instructions. Sterile 0.9%
saline was added to each sample to a final volume of 200 .mu.L.
Serum samples were added to tubes containing buffer and protease.
Carrier RNA was added to aid in the isolation of small amounts of
DNA. 1 ng of pHCR/UbC-SEAP plasmid DNA (Wooddell C I, et al.
"Long-term RNA interference from optimized siRNA expression
constructs in adult mice." Biochem Biophys Res Commun (2005) 334,
117-127) was added as a recovery control. After incubating 15 min
at 56.degree. C., nucleic acids were precipitated from the lysates
with ethanol and the entire solution applied to a column. After
washing, the samples were eluted into a volume of 50 .mu.L Buffer
AVE.
[0507] The number of copies of HBV genomes in DNA isolated from the
pHBV mouse model serum was determined by qPCR. Plasmid
pSEAP-HBV353-777, encoding a short segment of the HBV genome within
the S gene (bases 353-777 of GenBank accession #V01460), was used
to create a six log standard curve. Samples with recovery of DNA
below 2 standard deviations from the average, based on detection of
pHCR/UbC-SEAP were omitted. TaqMan chemistry-based primers and
probes with fluor/ZEN/IBFQ are utilized.
[0508] qPCR assays were performed on a 7500 Fast or StepOne Plus
Real-Time PCR system (Life Technologies). For evaluation of HBV DNA
in serum, DNA was isolated from singlet or duplicate purification
steps from pooled group serum samples. Quantitations of HBV DNA and
recovery control plasmid were determined by qPCR reactions
performed in triplicate. The probes to quantitate HBV and
pHCR/UbC-SEAP were included in each reaction.
Example 3. HBV RNAi Agents in pHBV Model Mice
[0509] The pHBV mouse model described in Example 2, above, was
used. At day 1, each mouse was administered a single subcutaneous
injection of 200 .mu.l containing 2 mg/kg (mpk) of an HBV RNAi
agent formulated in phosphate buffered saline ("PBS"), or 200 .mu.l
of phosphate buffered saline without an HBV RNAi agent, to be used
as a control. Each of the HBV RNAi agents included
N-acetyl-galactosamine targeting ligands conjugated to the
5'-terminal end of the sense strand, as shown in Tables 4 and 5.
The HBV RNAi agents tested included those having the duplex numbers
shown in Table 7, below. The injections were performed between the
skin and muscle (i.e. subcutaneous injections) into the loose skin
over the neck and shoulder area. Three (3) mice in each group were
tested (n=3).
[0510] Serum was collected on day 8, day 15, day 22, and day 29,
and serum Hepatitis B surface antigen (HBsAg) levels were
determined pursuant to the procedure set forth in Example 2, above.
Data from the experiment is shown in the following Table:
TABLE-US-00007 TABLE 7 Average HBsAg levels normalized to
pre-treatment and PBS control in pHBV mice following administration
of HBV RNAi agents from Example 3 (standard deviation reflected as
(+/-)). Group Day 8 Day 15 Day 22 Day 29 PBS 1.000 .+-. 0.185 1.000
.+-. 0.288 1.000 .+-. 0.540 1.000 .+-. 0.326 AD04178 0.164 .+-.
0.043 0.206 .+-. 0.044 0.293 .+-. 0.050 0.348 .+-. 0.099 AD04579
0.083 .+-. 0.028 0.099 .+-. 0.022 0.112 .+-. 0.022 0.138 .+-. 0.056
AD04580 0.048 .+-. 0.007 0.073 .+-. 0.012 0.085 .+-. 0.012 0.126
.+-. 0.014 AD04570 0.241 .+-. 0.076 0.294 .+-. 0.071 0.276 .+-.
0.068 0.474 .+-. 0.092 AD04572 0.190 .+-. 0.040 0.279 .+-. 0.011
0.323 .+-. 0.049 0.441 .+-. 0.046 AD04573 0.333 .+-. 0.143 0.505
.+-. 0.106 0.361 .+-. 0.060 0.444 .+-. 0.068 AD04574 0.291 .+-.
0.032 0.650 .+-. 0.056 0.388 .+-. 0.048 0.485 .+-. 0.070 AD04575
0.397 .+-. 0.189 0.514 .+-. 0.234 0.574 .+-. 0.204 0.689 .+-. 0.207
AD04419 0.262 .+-. 0.038 0.174 .+-. 0.042 0.258 .+-. 0.064 0.311
.+-. 0.089 AD04578 0.21 .+-. 0.056 0.235 .+-. 0.033 0.298 .+-.
0.035 0.336 .+-. 0.049
[0511] RNAi agents AD04178, AD04579, AD04580, AD04570, AD04572,
AD04573, AD04574, AD04575, AD04419, and AD04578 were each designed
to have antisense strand sequences at least partially complementary
to the X open reading frame at positions 1781-1789 of the HBV
genome shown in Tables 1 and 2, above. Each of the HBV RNAi agents
showed substantial reduction in HBsAg as compared to the PBS
control across all measured time points. For example, AD04580
showed greater than 95% reduction in s-antigen levels at day 8
(0.048.+-.0.007 HBsAg level) when normalized to pre-treatment and
PBS control.
[0512] Additionally, serum HBV DNA levels were determined for the
PBS, AD04579, and AD04580 groups from serum samples collected on
days 8, 15, 22, 29, 36, 43 and 50, pursuant to the procedure set
forth in Example 2, above. Serum from each group was pooled and
then DNA was isolated from the serum in duplicate isolations. Data
are presented in the following Table:
TABLE-US-00008 TABLE 8 Average Serum HBV DNA levels normalized to
pre-treatment and PBS control in pHBV mice following administration
of HBV RNAi agents from Example 3 (standard deviation reflected as
(+/-)). Group Day 8 Day 15 Day 22 Day 29 PBS 1.0000 .+-. 0.1185
1.0000 .+-. 0.0591 1.0000 .+-. 0.0322 1.0000 .+-. 0.0597 AD04579
0.1541 .+-. 0.0070 0.1776 .+-. 0.0027 0.1810 .+-. 0.0450 0.3738
.+-. 0.0302 AD04580 0.0921 .+-. 0.0253 0.0869 .+-. 0.0117 0.1444
.+-. 0.0755 0.0950 .+-. 0.0026 Group Day 36 Day 43 Day 50 PBS
1.0000 .+-. 0.1625 1.0000 .+-. 0.0055 1.0000 .+-. 0.1484 AD04579
0.9670 .+-. 0.1247 0.7643 .+-. 0.1334 0.6299 .+-. 0.1319 AD04580
0.4949 .+-. 0.0096 0.4350 .+-. 0.0344 0.6819 .+-. 0.0266
[0513] The data in Table 8 indicate that both RNAi agents examined
provided a substantial reduction in HBV DNA levels compared to the
PBS group, with AD04580 achieving slightly greater than 1 log
knockdown at nadir (e.g., 0.0869.+-.0.0117 average serum DNA level
at day 15).
Example 4. HBV RNAi Agents in pHBV Model Mice
[0514] The pHBV mouse model described in Example 2, above, was
used. At day 1, each mouse was given a single subcutaneous
administration of 200 .mu.l containing 2 mg/kg (mpk) of an HBV RNAi
agent formulated in phosphate buffered saline, or 200 .mu.l of
phosphate buffered saline without an HBV RNAi agent to be used as a
control. Each of the HBV RNAi agents included
N-acetyl-galactosamine targeting ligands conjugated to the
5'-terminal end of the sense strand, as shown in Tables 4 and 5.
The HBV RNAi agents administered included those listed in Table 9,
below. The injections were performed between the skin and muscle
(i.e. subcutaneous injections) into the loose skin over the neck
and shoulder area. Three (3) mice in each group were tested
(n=3).
[0515] Serum was collected on day 8, day 15, day 22, and day 29,
and serum Hepatitis B surface antigen (HBsAg) levels were
determined pursuant to the procedure set forth in Example 2, above.
Data from the experiment is shown in the following Table:
TABLE-US-00009 TABLE 9 Average HBsAg levels normalized to
pre-treatment and PBS control in pHBV mice following administration
of HBV RNAi agents from Example 4 (standard deviation reflected as
(+/-)). Group Day 8 Day 15 Day 22 Day 29 PBS 1.000 .+-. 0.085 1.000
.+-. 0.235 1.000 .+-. 0.171 1.000 .+-. 0.099 AD04010 0.229 .+-.
0.141 0.165 .+-. 0.091 0.142 .+-. 0.085 0.116 .+-. 0.076 AD04581
0.379 .+-. 0.042 0.221 .+-. 0.066 0.135 .+-. 0.040 0.112 .+-. 0.050
AD04591 0.285 .+-. 0.101 0.145 .+-. 0.064 0.086 .+-. 0.024 0.081
.+-. 0.026 AD04434 0.295 .+-. 0.041 0.191 .+-. 0.008 0.147 .+-.
0.016 0.187 .+-. 0.049 AD04583 0.488 .+-. 0.018 0.545 .+-. 0.037
0.511 .+-. 0.086 0.663 .+-. 0.112 AD04584 0.392 .+-. 0.136 0.337
.+-. 0.073 0.364 .+-. 0.075 0.515 .+-. 0.155 AD04585 0.099 .+-.
0.016 0.042 .+-. 0.014 0.030 .+-. 0.009 0.044 .+-. 0.014 AD04586
0.222 .+-. 0.056 0.107 .+-. 0.034 0.074 .+-. 0.016 0.106 .+-. 0.039
AD04588 0.255 .+-. 0.065 0.205 .+-. 0.021 0.185 .+-. 0.021 0.207
.+-. 0.024 AD04438 0.265 .+-. 0.106 0.113 .+-. 0.045 0.091 .+-.
0.031 0.130 .+-. 0.038
[0516] RNAi agents AD04010, AD04581, AD04591, AD04434, AD04583,
AD04584, AD04585, AD04586, AD04588, and AD04438 were designed to
have antisense strand sequences that are at least partially
complementary to the S open reading frame at positions 257-275 of
the HBV genome, as shown in Tables 1 and 2. The HBV RNAi agents
shown in Table 9, directly above, each showed substantial reduction
in HBsAg as compared to the PBS control across all measured time
points. For example, AD04585 exhibited approximately a 900/o
reduction of HBsAg at day 8, a 95% reduction at day 15, a 97%
reduction at day 22, and a 95% reduction at day 29.
[0517] Additionally, serum HBV DNA levels were determined for the
PBS, AD04585 groups from serum samples collected on days 8, 15, 22,
29, 36, 43 and 50, pursuant to the procedure set forth in Example
2, above. Serum from each group was pooled and then DNA was
isolated from the serum in duplicate isolations. Data are presented
in the following Table:
TABLE-US-00010 TABLE 10 Average Serum HBV DNA levels normalized to
pre-treatment and PBS control in pHBV mice following administration
of HBV RNAi agents from Example 4 (standard deviation reflected as
(+/-)). Group Day 8 Day 15 Day 22 Day 29 PBS 1.000 .+-. 0.248 1.000
.+-. 0.089 1.000 .+-. 0.195 1.000 .+-. 0.180 AD04585 0.901 .+-.
0.183 0.225 .+-. 0.003 0.187 .+-. 0.023 0.191 .+-. 0.004 Group Day
36 Day 43 Day 50 PBS 1.000 .+-. 0.018 1.000 .+-. 0.033 1.000 .+-.
0.778 AD04585 0.209 .+-. 0.017 0.171 .+-. 0.019 0.305 .+-.
0.010
[0518] The data in Table 10 indicates that HBV RNAi agent AD04585
provided a reduction in HBV DNA levels compared to the PBS
group.
Example 5. Dose Response and Combinations of HBV RNAI Agents in
pHBV Model Mice
[0519] The pHBV mouse model described in Example 2, above, was
used. The mice were divided into various groups including those set
forth in Table 11, below, and the mice were given 200 .mu.l
subcutaneous injections pursuant to the dosing regimen set forth in
Table 11:
TABLE-US-00011 TABLE 11 Dosing groups of pHBV mice for Example 5.
Group RNAi Agent and Dose Dosing Regimen A PBS (no RNAi agent)
Single injection on day 1 B 3.0 mg/kg AD04585 Single injection on
day 1 C 3.0 mg/kg AD04585 Injection on day 1, day 8, and day 15
(i.e., three weekly injections) D 3.0 mg/kg AD04580 Single
injection on day 1 E 3.0 mg/kg AD04580 Injection on day 1, day 8,
and day 15 (i.e., three weekly injections) F 1.0 mg/kg AD4585 +
Injection on day 1, and another injection 1.0 mg/kg AD04580 on day
22 G 1.0 mg/kg AD4585 + Injection on day 1, day 8, day 15, 1.0
mg/kg AD04580 and day 43 H 1.5 mg/kg AD4585 + Injection on day 1,
day 22, and day 43 1.5 mg/kg AD04580 I 1.5 mg/kg AD4585 + Injection
on day 1, day 8, day 15, 1.5 mg/kg AD04580 and day 43
[0520] Each mouse was given a subcutaneous administration of 200
.mu.l containing the amount of HBV RNAi agent(s) formulated in
phosphate buffered saline, or 200 .mu.l of phosphate buffered
saline without an HBV RNAi agent, as set forth in Table 11. Each of
the HBV RNAi agents included N-acetyl-galactosamine targeting
ligands conjugated to the 5'-terminal end of the sense strand, as
shown in Tables 4 and 5. The injections were performed between the
skin and muscle (i.e. subcutaneous injections) into the loose skin
over the neck and shoulder area. Three (3) mice in each group were
tested (n=3).
[0521] Serum was collected on day 8, day 15, day 22, day 29, day
36, day 43, day 50, and day 57, and serum Hepatitis B surface
antigen (HBsAg) levels were determined pursuant to the procedure
set forth in Example 2, above. Data from the experiment is shown in
the following Table:
TABLE-US-00012 TABLE 12 Average HBsAg levels normalized to
pre-treatment and PBS control in pHBV mice following administration
of HBV RNAi agents from Example 5 (standard deviation reflected as
(+/-)). Group Day 8 Day 15 Day 22 Day 29 A 1.000 .+-. 0.162 1.000
.+-. 0.138 1.000 .+-. 0.083 1.000 .+-. 0.204 B 0.060 .+-. 0.015
0.010 .+-. 0.003 0.006 .+-. 0.002 0.007 .+-. 0.002 C 0.087 .+-.
0.014 0.004 .+-. 0.001 0.001 .+-. 0.0003 0.0002 .+-. 0.0001 D 0.026
.+-. 0.009 0.035 .+-. 0.013 0.037 .+-. 0.014 0.046 .+-. 0.006 E
0.023 .+-. 0.005 0.002 .+-. 0.001 0.001 .+-. 0.0003 0.001 .+-.
0.0004 F 0.063 .+-. 0.046 0.083 .+-. 0.051 0.086 .+-. 0.016 0.027
.+-. 0.006 G 0.062 .+-. 0.011 0.022 .+-. 0.008 0.009 .+-. 0.003
0.008 .+-. 0.002 H 0.055 .+-. 0.015 0.062 .+-. 0.002 0.072 .+-.
0.013 0.011 .+-. 0.001 I 0.031 .+-. 0.006 0.008 .+-. 0.001 0.003
.+-. 0.0004 0.003 .+-. 0.0003 Group Day 36 Day 43 Day 50 Day 57 A
1.000 .+-. 0.211 1.000 .+-. 0.189 1.000 .+-. 0.179 1.000 .+-. 0.062
B 0.013 .+-. 0.005 0.027 .+-. 0.004 0.026 .+-. 0.004 0.057 .+-.
0.012 C 0.001 .+-. 0.0002 0.002 .+-. 0.001 0.008 .+-. 0.004 0.020
.+-. 0.015 D 0.116 .+-. 0.019 0.214 .+-. 0.056 0.263 .+-. 0.046
0.404 .+-. 0.030 E 0.003 .+-. 0.0001 0.007 .+-. 0.001 0.012 .+-.
0.002 0.033 .+-. 0.011 F 0.029 .+-. 0.003 0.065 .+-. 0.005 0.064
.+-. 0.004 0.161 .+-. 0.033 G 0.014 .+-. 0.008 0.039 .+-. 0.011
0.018 .+-. 0.008 0.046 .+-. 0.008 H 0.017 .+-. 0.005 0.039 .+-.
0.008 0.007 .+-. 0.001 0.013 .+-. 0.003 I 0.007 .+-. 0.001 0.020
.+-. 0.002 0.005 .+-. 0.001 0.011 .+-. 0.002
[0522] HBV RNAi agents AD04580 and AD04585 each individually showed
a reduction in HBsAg as compared to the PBS control across all
measured time points. Furthermore, combination treatment of AD04585
and AD04580, which as noted in the Examples above target different
regions of the HBV genome, also showed reduction in HBsAg as
compared to the PBS control across all measured time points.
[0523] Additionally, serum HBV DNA levels were determined for each
of the groups in Table 11 from serum samples collected on days 8,
15, 22, 29, and 36, pursuant to the procedure set forth in Example
2, above. Serum from each group was pooled and then DNA was
isolated from the serum in duplicate reactions. Data are presented
in the following Table:
TABLE-US-00013 TABLE 13 Average Serum HBV DNA levels normalized to
pre-treatment and PBS control in pHBV mice following administration
of HBV RNAi agents from Example 5 (standard deviation reflected as
(+/-)) Group Day 8 Day 15 Day 22 Day 29 Day 36 A 1.000 .+-. 0.063
1.000 .+-. 0.059 1.000 .+-. 0.372 1.000 .+-. 0.237 1.000 .+-. 0.024
B 0.267 .+-. 0.003 0.043 .+-. 0.016 0.038 .+-. 0.008 0.044 .+-.
0.004 0.046 .+-. 0.007 C 0.236 .+-. 0.016 0.023 .+-. 0.001 0.004
.+-. 0.001 0.002 .+-. 0.000 0.003 .+-. 0.000 D 0.058 .+-. 0.016
0.085 .+-. 0.017 0.252 .+-. 0.071 0.217 .+-. 0.009 0.319 .+-. 0.034
E 0.056 .+-. 0.002 0.0009 .+-. 0.0004 0.0005 .+-. 0.0002 0.003 .+-.
0.002 0.002 .+-. 0.000 F 0.298 .+-. 0.013 0.351 .+-. 0.032 0.823
.+-. 0.127 0.217 .+-. 0.007 0.122 .+-. 0.004 G 0.276 .+-. 0.035
0.112 .+-. 0.020 0.061 .+-. 0.002 0.073 .+-. 0.002 0.047 .+-. 0.006
H 0.232 .+-. 0.012 0.213 .+-. 0.028 0.403 .+-. 0.047 0.079 .+-.
0.005 0.056 .+-. 0.003 I 0.092 .+-. 0.026 0.055 .+-. 0.000 0.002
.+-. 0.003 0.010 .+-. 0.004 0.021 .+-. 0.007
[0524] The data in Table 13 indicate that the RNAi agents examined,
both individually and in combination, provided a reduction in HBV
DNA levels compared to the PBS group. Re-dosing or increasing the
dose amount yielded additional HBV DNA reductions.
Example 6. HBV RNAI Agents in pHBV Mice: Dose Response and
Combination Studies
[0525] The pHBV mouse model described in Example 2, above, was
used. Mice were divided into various groups as set forth in Table
14, below, and each mouse was administered a single 200 .mu.l
subcutaneous injection pursuant to the dosing regimen set forth in
Table 14:
TABLE-US-00014 TABLE 14 Dosing groups of pHBV mice for Example 6.
Group RNAi Agent and Dose Dosing Regimen A PBS (no RNAi agent)
Single injection on day 1 B 4.0 mg/kg AD04981 Single injection on
day 1 C 1.0 mg/kg AD04981 Single injection on day 1 D 2.0 mg/kg
AD04981 Single injection on day 1 E 1.0 mg/kg AD04963 Single
injection on day 1 F 2.0 mg/kg AD04963 Single injection on day 1 G
3.0 mg/kg AD04872 Single injection on day 1 H 3.0 mg/kg AD04872 +
Single injection on day 1 1.0 mg/kg AD04981 I 3.0 mg/kg AD04872 +
Single injection on day 1 1.0 mg/kg AD04963 J 3.0 mg/kg AD04872 +
Single injection on day 1 2.0 mg/kg AD04981
[0526] Each mouse was given a subcutaneous administration of 200
.mu.l containing the amount of HBV RNAi agent(s) formulated in
phosphate buffered saline, or 200 .mu.l of phosphate buffered
saline without an HBV RNAi agent, as set forth in Table 14. Each of
the HBV RNAi agents included N-acetyl-galactosamine targeting
ligands conjugated to the 5'-terminal end of the sense strand, as
shown in Tables 4 and 5. The injections were performed between the
skin and muscle (i.e. subcutaneous injections) into the loose skin
over the neck and shoulder area. Three (3) mice in each group were
tested (n=3).
[0527] Serum was collected on day -1 prior to administration, and
then on day 8, day 15, day 22, day 29, and day 36, and serum HBsAg
levels were determined pursuant to the procedure set forth in
Example 2, above. Data from the experiment is shown in the
following Table 15, with Average HBsAg reflecting the normalized
average value of HBsAg:
TABLE-US-00015 TABLE 15 Average HBsAg levels normalized to
pre-treatment and PBS control in pHBV mice following administration
of HBV RNAi agents from Example 6 (standard deviation reflected as
(+/-)). Group Day 8 Day 15 Day 22 A 1.000 .+-. 0.068 1.000 .+-.
0.183 1.000 .+-. 0.181 B 0.085 .+-. 0.020 0.068 .+-. 0.005 0.089
.+-. 0.014 C 0.283 .+-. 0.039 0.343 .+-. 0.055 0.436 .+-. 0.004 D
0.161 .+-. 0.052 0.137 .+-. 0.036 0.190 .+-. 0.068 E 0.182 .+-.
0.040 0.233 .+-. 0.023 0.436 .+-. 0.029 F 0.078 .+-. 0.024 0.093
.+-. 0.015 0.167 .+-. 0.028 G 0.066 .+-. 0.030 0.013 .+-. 0.002
0.010 .+-. 0.002 H 0.033 .+-. 0.012 0.016 .+-. 0.005 0.020 .+-.
0.005 I 0.040 .+-. 0.011 0.028 .+-. 0.003 0.032 .+-. 0.007 J 0.035
.+-. 0.010 0.019 .+-. 0.002 0.021 .+-. 0.001 Group Day 29 Day 36 A
1.000 .+-. 0.032 1.000 .+-. 0.141 B 0.148 .+-. 0.016 0.194 .+-.
0.047 C 0.622 .+-. 0.041 0.741 .+-. 0.132 D 0.234 .+-. 0.055 0.280
.+-. 0.071 E 0.623 .+-. 0.116 0.782 .+-. 0.114 F 0.259 .+-. 0.014
0.368 .+-. 0.068 G 0.010 .+-. 0.003 0.009 .+-. 0.004 H 0.022 .+-.
0.005 0.024 .+-. 0.009 I 0.065 .+-. 0.014 0.087 .+-. 0.015 J 0.031
.+-. 0.0001 0.044 .+-. 0.002
[0528] The HBV RNAi agents tested showed a reduction in HBsAg as
compared to the PBS control across all measured time points.
Furthermore, combination treatment of AD04872 (which includes an
antisense strand sequence that is at least partially complementary
to the S ORF at positions 261-279 of the HBV genome, as shown in
Tables 1 and 2) and either AD04981 or AD04963 (both of which
include antisense strand sequences that are at least partially
complementary to the X ORF at positions 1781-1799 of the HBV
genome, as shown in Tables 1 and 2), which are shown in Groups H,
I, and J of Example 6, illustrate that combination treatment of two
RNAi agents targeting, one which targets in the S ORF, and the
other which targets in the X ORF of the HBV genome, similarly
showed reduction in HBsAg compared to the PBS control across all
measured time points.
[0529] Additionally, Serum Hepatitis B e-antigen (HBeAg) levels
were also assessed. Samples from the mice in each respective group
were first pooled, and the resulting serum samples were assayed in
singlet. Data from the experiment is shown in the following
Table:
TABLE-US-00016 TABLE 16 Average HBeAg levels normalized to
pre-treatment and PBS control in pHBV mice following administration
of HBV RNAi agents from Example 6. Group Day 8 Day 15 Day 22 Day 29
Day 36 A 1.000 1.000 1.000 0.183 1.000 B 0.138 0.180 0.274 0.005
0.089 C 0.316 0.376 0.588 0.055 0.436 D 0.167 0.250 0.262 0.036
0.190 E 0.301 0.327 0.447 0.023 0.436 F 0.167 0.172 0.305 0.015
0.167 G 0.275 0.135 0.158 0.002 0.010 H 0.080 0.053 0.094 0.005
0.020 I 0.165 0.124 0.185 0.003 0.032 J 0.120 0.057 0.101 0.002
0.021
[0530] As shown in Table 16, the combination AD04872 (which targets
the S ORF of the HBV genome) with either AD04981 or AD04963 (both
of which target the X ORF of the HBV genome), showed a further
reduction in HBeAg levels relative to administering AD04872
alone.
Example 7. HBV RNAi Agents in pHBV Mice: Additional Dose Response
and Combination Studies
[0531] The pHBV mouse model described in Example 2, above, was
used. Mice were divided into various groups as set forth in Table
17, below, and each mouse was administered a single 200 .mu.l
subcutaneous injection pursuant to the dosing regimen set forth in
Table 17:
TABLE-US-00017 TABLE 17 Dosing groups of pHBV mice for Example 7.
Group RNAi Agent and Dose Dosing Regimen A PBS (no RNAi agent)
Single injection on day 1 B 4.0 mg/kg AD04776 Single injection on
day 1 C 1.0 mg/kg AD04982 Single injection on day 1 D 2.0 mg/kg
AD04982 Single injection on day 1 E 1.0 mg/kg AD04776 Single
injection on day 1 F 2.0 mg/kg AD04776 Single injection on day 1 G
3.0 mg/kg AD04872 Single injection on day 1 H 3.0 ma/kg AD04872 +
Single injection on day 1 1.0 mg/kg AD04982 I 3.0 mg/kg AD04872 +
Single injection on day 1 2.0 mg/kg AD04982
[0532] Each mouse was given a subcutaneous administration of 200
.mu.l containing the amount of HBV RNAi agent(s) formulated in
phosphate buffered saline, or 200 .mu.l of phosphate buffered
saline without an HBV RNAi agent, as set forth in Table 17. Each of
the HBV RNAi agents included N-acetyl-galactosamine targeting
ligands conjugated to the 5'-terminal end of the sense strand, as
shown in Tables 4 and 5. The injections were performed between the
skin and muscle (i.e. subcutaneous injections) into the loose skin
over the neck and shoulder area. Four (4) mice in each group were
tested on day -1 and day 8 (n=4), and then one mouse per group was
euthanized for histological evaluation. Three (3) mice in each
group were tested at day 22 and day 29 (n=3).
[0533] Serum was collected on day -1 prior to administration, and
then on day 8, day 15, day 22, and day 29, and serum Hepatitis B
surface antigen (HBsAg) levels were determined pursuant to the
procedure set forth in Example 2, above. Data from the experiment
is shown in the following Table 18:
TABLE-US-00018 TABLE 18 Average HBsAg levels normalized to
pre-treatment (day -1) and PBS control in pHBV mice following
administration of HBV RNAi agents from Example 7 (standard
deviation reflected as (+/-)). Group Day 8 Day 15 Day 22 Day 29 A
1.000 .+-. 0.347 1.000 .+-. 0.278 1.000 .+-. 0.194 1.000 .+-. 0.318
B 0.117 .+-. 0.069 0.085 .+-. 0.039 0.148 .+-. 0.045 0.198 .+-.
0.049 C 0.519 .+-. 0.058 0.375 .+-. 0.012 0.422 .+-. 0.046 0.525
.+-. 0.037 D 0.342 .+-. 0.062 0.255 .+-. 0.046 0.272 .+-. 0.122
0.314 .+-. 0.068 E 0.279 .+-. 0.057 0.245 .+-. 0.032 0.374 .+-.
0.121 0.304 .+-. 0.035 F 0.224 .+-. 0.018 0.161 .+-. 0.009 0.310
.+-. 0.016 0.482 .+-. 0.053 G 0.029 .+-. 0.010 0.005 .+-. 0.001
0.004 .+-. 0.001 0.006 .+-. 0.001 H 0.016 .+-. 0.005 0.004 .+-.
0.001 0.010 .+-. 0.006 0.015 .+-. 0.008 I 0.026 .+-. 0.012 0.008
.+-. 0.001 0.010 .+-. 0.002 0.015 .+-. 0.005
[0534] The HBV RNAi agents tested showed a reduction in HBsAg as
compared to the PBS control across all measured time points.
[0535] Additionally, Serum Hepatitis B e-antigen (HBeAg) levels
were also assessed. Samples from the mice in each respective group
were first pooled, and the resulting serum samples were assayed in
singlet. Data from the experiment is shown in the following
Table:
TABLE-US-00019 TABLE 19 Average HBeAg levels normalized to
pre-treatment and PBS control in pHBV mice following administration
of HBV RNAi agents from Example 7. Group Day 8 Day 15 Day 22 Day 29
Day 36 A 1.000 1.000 1.000 1.000 1.000 B 0.193 0.213 0.260 0.307
0.464 C 0.471 0.424 0.562 0.513 0.705 D 0.335 0.310 0.411 0.442
0.500 E 0.381 0.368 0.355 0.564 0.483 F 0.275 0.255 0.370 0.495
0.449 G 0.323 0.218 0.205 0.250 0.190 H 0.124 0.102 0.099 0.156
0.156 I 0.081 0.059 0.045 0.063 0.086
TABLE-US-00020 TABLE 19-1 Average HBeAg fold knockdown normalized
to pre-treatment and PBS control in pHBV mice following
administration of HBV RNAi agents from Example 7. Day 8 Day 15 Day
22 Day 29 Day 36 Group (Fold KD) (Fold KD) (Fold KD) (Fold KD)
(Fold KD) A 1.0 1.0 1.0 1.0 1.0 B 5.2 4.7 3.8 3.3 2.2 C 2.1 2.4 1.8
2.0 1.4 D 3.0 3.2 2.4 2.3 2.0 E 2.6 2.7 2.8 1.8 2.1 F 3.6 3.9 2.7
2.0 2.2 G 3.1 4.6 4.9 4.0 5.3 H 8.1 9.8 10.1 6.4 6.4 I 12.3 17.0
22.3 15.7 11.6
[0536] Table 19-1 reflects the fold knockdown ratio of HBeAg
compared to control, which is calculated as normalized HBeAg level
of the control (PBS) group/normalized HBeAg level of the respected
RNAi agent(s) group (i.e., 1.000/HBeAg level). The data in Table
19-1 indicate that the combination of AD04872 (which, as noted
above, includes an antisense strand sequence that is at least
partially complementary to the S ORF at positions 261-279 of the
HBV genome) with AD04982 (which includes an antisense strand
sequence that is at least partially complementary to the X ORF at
positions 1781-1799 of the HBV genome), showed a further reduction
in HBeAg levels relative to administering the individual RNAi
agents alone (See. e.g., Tables 19 and 19-1 for Groups H and I).
Further, the data from this Example also show that the combination
of AD04872 with AD04982 resulted in fold decrease of HBeAg greater
than the sum of the fold decrease of HBeAg in AD04872 and AD04982
administered individually. For example, Group I (which is the
administration of 3.0 mg/kg AD04872+2.0 mg/kg AD04982) resulted in
a fold decrease of HBeAg at day 15 of 17.0, which is greater than
the sum of the fold decrease for Group G (3.0 mg/kg AD04872) of 4.6
plus the fold decrease for Group D (2.0 mg/kg AD04982) of 3.2.
[0537] Further, serum HBV DNA levels were determined for each of
the groups in Table 17 from serum samples collected on days -1, 8,
15, 22, 29, and 36, pursuant to the procedure set forth in Example
2, above. Serum HBV DNA was isolated from each animal at each time
point. Data are presented in the following Table:
TABLE-US-00021 TABLE 20 Average Serum HBV DNA levels normalized to
pre-treatment and PBS control in pHBV mice following administration
of HBV RNAi agents from Example 7 (standard deviation reflected as
(+/-)). Group Day 8 Day 15 Day 22 Day 29 Day 36 A 1.000 .+-. 0.493
1.000 .+-. 0.358 1.000 .+-. 0.424 1.000 .+-. 0.387 1.000 .+-. 0.326
B 0.224 .+-. 0.150 0.263 .+-. 0.185 0.335 .+-. 0.204 0.449 .+-.
0.108 0.603 .+-. 0.068 C 0.358 .+-. 0.207 0.428 .+-. 0.073 0.433
.+-. 0.220 0.474 .+-. 0.090 0.509 .+-. 0.163 D 0.516 .+-. 0.163
0.523 .+-. 0.264 0.244 .+-. 0.123 0.241 .+-. 0.085 0.543 .+-. 0.079
E 0.601 .+-. 0.388 0.319 .+-. 0.125 0.279 .+-. 0.138 0.506 .+-.
0.525 0.444 .+-. 0.407 F 0.363 .+-. 0.128 0.374 .+-. 0.197 0.275
.+-. 0.146 0.385 .+-. 0.141 0.721 .+-. 0.043 G 0.071 .+-. 0.032
0.022 .+-. 0.009 0.015 .+-. 0.015 0.025 .+-. 0.005 0.058 .+-. 0.030
H 0.069 .+-. 0.070 0.018 .+-. 0.014 0.019 .+-. 0.020 0.022 .+-.
0.001 0.047 .+-. 0.021 I 0.044 .+-. 0.024 0.033 .+-. 0.016 0.017
.+-. 0.012 0.022 .+-. 0.014 0.058 .+-. 0.051
[0538] The data in Table 20 indicate that the RNAi agents examined,
both individually and in combination, provided a reduction in HBV
DNA levels compared to the PBS group, and further show that the
combination of AD04872 (which targets the S ORF) and AD04982 (which
targets the X ORF) reduces serum HBV DNA to a similar degree as an
equal amount of AD04872 alone.
Example 8. HBV RNAI Agents in pHBV Mice: Further Dose Response and
Combination Studies
[0539] The pHBV mouse model described in Example 2, above, was
used. Mice were divided into various groups as set forth in Table
21, below, and each mouse was administered a single 200 .mu.l
subcutaneous injection pursuant to the dosing regimen set forth in
Table 21:
TABLE-US-00022 TABLE 21 Dosing groups of pHBV mice for Example 8.
Number of Group RNAi Agent and Dose Dosing Regimen Animals (n) 1
PBS (no RNAi agent) Single injection on day 1 4 2A 4.0 mg/kg
AD04872 + Single injection on day 1 4 1.0 mg/kg AD05070 2B 4.0
mg/kg AD04872 + Single injection on day 1 4 1.0 mg/kg AD05070 3A
3.3 mg/kg AD04872 + Single injection on day 1 4 1.7 mg/kg AD05070
3B 3.3 mg/kg AD04872 + Single injection on day 1 4 1.7 mg/kg
AD05070 4A 3.2 mg/kg AD04872 + Single injection on day 1 4 0.8
mg/kg AD05070 4B 3.2 mg/kg AD04872 + Single injection on day 1 4
0.8 mg/kg AD05070 5A 2.7 mg/kg AD04872 + Single injection on day 1
4 1.3 mg/kg AD05070 5B 2.7 mg/kg AD04872 + Single injection on day
1 4 1.3 mg/kg AD05070 6A 4.0 mg/kg AD05070 Single injection on day
1 4 6B 4.0 mg/kg AD05070 Single injection on day 1 4 7A 1.7 mg/kg
AD05070 Single injection on day 1 4 7B 1.7 mg/kg AD05070 Single
injection on day 1 4 8A 0.8 mg/kg AD05070 Single injection on day 1
4 8B 0.8 mg/kg AD05070 Single injection on day 1 4 9 1.7 mg/kg
AD05148 Single injection on day 1 4 10 2.7 mg/kg AD04872 Single
injection on day 1 3 11 1.7 mg/kg AD05147 Single injection on day 1
3 12 4.0 mg/kg AD04872 Single injection on day 1 3 13 1.7 mg/kg
AD05149 Single injection on day 1 3
[0540] Additionally, the mice are scheduled to be euthanized
pursuant to the following schedule: [0541] Day 11: Euthanize 2 mice
from groups 2A, 3A, 4A, 5A, 6A, 7A and 8A, and euthanize one mouse
from group 9. [0542] Day 14: Euthanize 2 mice from groups 2A, 3A,
4A, 5A, 6A, 7A, and 8A. [0543] Day 21: Euthanize 2 mice from groups
2B, 3B, 4B, 5B, 6B, 7B, and 8B. [0544] Day 28: Euthanize 2 mice
from groups 1, 2B, 3B, 4B, 5B, 6B, 7B, and 8B, and all mice (4)
from groups 10 and 12.
[0545] Each mouse was given a subcutaneous administration of 200
.mu.l containing the amount of HBV RNAi agent(s) formulated in
phosphate buffered saline, or 200 .mu.l of phosphate buffered
saline without an HBV RNAi agent, as set forth in Table 21. Each of
the HBV RNAi agents included N-acetyl-galactosamine targeting
ligands conjugated to the 5'-terminal end of the sense strand, as
shown in Tables 4 and 5. The injections were performed between the
skin and muscle (i.e. subcutaneous injections) into the loose skin
over the neck and shoulder area. As shown in Table 14 above, four
(4) mice in each group were tested (n=4), except for groups 10, 11,
12 and 13, in which three mice were tested (n=3).
[0546] Serum was collected on day -1 prior to administration, and
on days 8, 14, 21 and 28, and serum Hepatitis B surface antigen
(HBsAg) levels were determined pursuant to the procedure set forth
in Example 2, above. Data from the experiment is shown in the
following Table:
TABLE-US-00023 TABLE 22 Average HBsAg levels normalized to
pre-treatment and PBS control in pHBV mice following administration
of HBV RNAi agents from Example 8 (standard deviation reflected as
(+/-)). Group Number Day 8 Day 14 Day 21 Day 28 1 1.000 .+-. 0.089
1.000 .+-. 0.087 1.000 .+-. 0.132 1.000 .+-. 0.138 2A 0.009 .+-.
0.003 0.005 .+-. 0.001 2B 0.006 .+-. 0.003 0.002 .+-. 0.001 0.004
.+-. 0.001 0.005 .+-. 0.001 3A 0.032 .+-. 0.021 0.009 .+-. 0.004 3B
0.028 .+-. 0.027 0.008 .+-. 0.006 0.012 .+-. 0.005 0.015 .+-. 0.005
4A 0.036 .+-. 0.020 0.012 .+-. 0.006 4B 0.029 .+-. 0.025 0.010 .+-.
0.008 0.015 .+-. 0.005 0.022 .+-. 0.004 5A 0.027 .+-. 0.014 0.008
.+-. 0.002 5B 0.027 .+-. 0.013 0.007 .+-. 0.003 0.019 .+-. 0.004
0.031 .+-. 0.005 6A 0.058 .+-. 0.035 0.069 .+-. 0.039 6B 0.117 .+-.
0.058 0.079 .+-. 0.047 0.145 .+-. 0.082 0.135 .+-. 0.061 7A 0.189
.+-. 0.100 0.084 .+-. 0.029 7B 0.099 .+-. 0.010 0.147 .+-. 0.025
0.267 .+-. 0.048 0.345 .+-. 0.063 8A 0.355 .+-. 0.099 0.366 .+-.
0.069 8B 0.271 .+-. 0.058 0.334 .+-. 0.060 0.464 .+-. 0.055 0.624
.+-. 0.053 9 0.239 .+-. 0.148 0.179 .+-. 0.127 0.309 .+-. 0.213
0.345 .+-. 0.225 10 0.018 .+-. 0.009 0.005 .+-. 0.003 0.005 .+-.
0.002 0.007 .+-. 0.003 11 0.129 .+-. 0.068 0.138 .+-. 0.060 0.239
.+-. 0.092 0.315 .+-. 0.119 12 0.033 .+-. 0.022 0.002 .+-. 0.001
0.002 .+-. 0.001 0.002 .+-. 0.0004 13 0.200 .+-. 0.093 0.239 .+-.
0.114 0.367 .+-. 0.123 0.477 .+-. 0.125
[0547] The HBV RNAi agents tested, both alone and in combination,
showed a substantial reduction in HBsAg as compared to the PBS
control across all measured time points.
Example 9. RNAi Agent Delivery
[0548] The pHBV mouse model described in Example 2, above, was
used. At day 1, each mouse was administered a single subcutaneous
injection of 200 .mu.l containing 10 mg/kg (mpk) of an HBV RNAi
agent formulated in phosphate buffered saline, or 200 .mu.l of
phosphate buffered saline without an HBV RNAi agent, to be used as
a control. The HBV RNAi agents tested included those having the
duplex numbers shown in Table 23, below, which each included
N-acetyl-galactosamine targeting ligands conjugated to the
5'-terminal end of the sense strand, as shown in Tables 4 and 5.
The injections were performed between the skin and muscle (i.e.
subcutaneous injections) into the loose skin over the neck and
shoulder area. Three (3) mice in each group were tested (n=3).
[0549] Serum was collected prior to administration, and then on day
8, day 15, day 22, and day 29, and serum Hepatitis B surface
antigen (HBsAg) levels were determined pursuant to the procedure
set forth in Example 2, above. Data from the experiment is shown in
the following Table:
TABLE-US-00024 TABLE 23 Average HBsAg levels normalized to
pre-treatment and PBS control in pHBV mice following administration
of HBV RNAi agents from Example 9 (standard deviation reflected as
(+/-)). HBsAg in serum at nadir Day of RNAi agent (norm. fraction)
% KD at nadir nadir PBS 1.000 N/A N/A AD03498 0.087 .+-. 0.016
91.3% 8 AD03499 0.069 .+-. 0.011 93.1% 15 AD03500 0.095 .+-. 0.031
90.5% 8 AD03501 0.046 .+-. 0.020 95.4% 15
[0550] Each of the HBV RNAi agents shown in Table 23, above,
included an antisense strand sequence that is at least partially
complementary to the X ORF at positions 1781-1799 of the HBV
genome. Each of the RNAi agents showed a significant knockdown
compared to PBS control.
Example 10. HBV RNAI Agents in pHBV Mice: Further Combination
Studies
[0551] The pHBV mouse model described in Example 2, above, was
used. Mice were divided into various groups as set forth in Table
24, below, and each mouse was administered a single 200 .mu.l
subcutaneous injection pursuant to the dosing regimen set forth in
Table 24:
TABLE-US-00025 TABLE 24 Dosing groups of pHBV mice for Example 10.
Group RNAi Agent and Dose Dosing Regimen A PBS Group I (no RNAi
Single injection on day 1 and day 22 agent) B PBS Group II (no RNAi
Single injection on day 1 and day 22 agent) C 3.0 mg/kg AD04585
Single injection on day 1, day 22, day 50, and day 64 D 3.0 mg/kg
AD04771 Single injection on day 1 and day 22 E 3.0 mg/kg AD04580
Single injection on day 1, day 22, day 50, and day 64 F 3.0 mg/kg
AD04776 Single injection on day 1 and day 22 G 1.5 mg/kg AD04585 +
Single injection on day 1, day 22, 1.5 mg/kg AD04580 day 50, and
day 64 H 1.5 mg/kg AD04771 + Single injection on day 1 and day 22
1.5 mg/kg AD04776 I 2.0 mg/kg AD04771 + Single injection on day 1
and day 22 1.0 mg/kg AD04776 J 2.25 mg/kg AD04771 + Single
injection on day 1 and day 22 0.75 mg/kg AD04776
[0552] Each mouse was given a subcutaneous administration of 200
.mu.l containing the amount of HBV RNAi agent(s) formulated in
phosphate buffered saline, or 200 .mu.l of phosphate buffered
saline without an HBV RNAi agent, as set forth in Table 24. Each of
the HBV RNAi agents included N-acetyl-galactosamine targeting
ligands conjugated to the 5'-terminal end of the sense strand, as
shown in Tables 4 and 5. The injections were performed between the
skin and muscle (i.e. subcutaneous injections) into the loose skin
over the neck and shoulder area. Three (3) mice in each group were
tested (n=3).
[0553] Serum was collected prior to administration, and then on day
-1, day 8, day 15, day 22, day 29, day 36, day 43, day 50, day 57,
and day 64. Serum Hepatitis B surface antigen (HBsAg) levels were
determined pursuant to the procedure set forth in Example 2, above.
Data from the experiment is shown in the following:
TABLE-US-00026 TABLE 25 Average HBsAg levels normalized to
pre-treatment and PBS control (Group A used as control) in pHBV
mice following administration of HBV RNAi agents from Example 10
(standard deviation reflected as (+/-)). Group Day 8 Day 15 Day 22
A 1.000 .+-. 0.146 1.000 .+-. 0.095 1.000 .+-. 0.202 B 0.931 .+-.
0.161 1.091 .+-. 0.156 1.132 .+-. 0.259 C 0.071 .+-. 0.050 0.031
.+-. 0.022 0.024 .+-. 0.013 D 0.134 .+-. 0.035 0.130 .+-. 0.024
0.119 .+-. 0.028 E 0.015 .+-. 0.001 0.041 .+-. 0.012 0.087 .+-.
0.015 F 0.197 .+-. 0.081 0.308 .+-. 0.138 0.476 .+-. 0.156 G 0.029
.+-. 0.015 0.069 .+-. 0.029 0.094 .+-. 0.016 H 0.191 .+-. 0.057
0.315 .+-. 0.094 0.420 .+-. 0.126 I 0.153 .+-. 0.050 0.194 .+-.
0.076 0.233 .+-. 0.116 J 0.155 .+-. 0.059 0.177 .+-. 0.067 0.316
.+-. 0.117 Group Day 29 Day 36 Day 43 A 1.000 .+-. 0.182 1.000 .+-.
0.287 1.000 .+-. 0.298 B 1.417 .+-. 0.414 1.166 .+-. 0.248 C 0.007
.+-. 0.005 0.004 .+-. 0.003 0.006 .+-. 0.001 D 0.048 .+-. 0.023
0.036 .+-. 0.020 0.052 .+-. 0.027 E 0.014 .+-. 0.006 0.021 .+-.
0.011 0.026 .+-. 0.011 F 0.246 .+-. 0.081 0.244 .+-. 0.097 0.179
.+-. 0.061 G 0.023 .+-. 0.009 0.027 .+-. 0.009 0.037 .+-. 0.013 H
0.200 .+-. 0.080 0.185 .+-. 0.081 0.194 .+-. 0.055 I 0.141 .+-.
0.082 0.133 .+-. 0.051 0.151 .+-. 0.082 J 0.133 .+-. 0.064 0.102
.+-. 0.039 0.129 .+-. 0.050 Group Day 50 Day 57 Day 64 A 1.000 .+-.
0.296 1.000 .+-. 0.394 1.000 .+-. 0.395 B C 0.015 .+-. 0.0001 0.002
.+-. 0.001 0.004 .+-. 0.001 D E 0.052 .+-. 0.015 0.009 .+-. 0.002
0.018 .+-. 0.007 F G 0.076 .+-. 0.020 0.012 .+-. 0.003 0.020 .+-.
0.007 H I J
[0554] HBV RNAi agents AD04585 and AD04771 were designed to have
antisense strand sequences that are at least partially
complementary to the S open reading frame at positions 257-275 of
the HBV genome, as shown in Tables 1 and 2. HBV RNAi agents AD04580
and AD04776 were designed to have antisense strand sequences that
are at least partially complementary to the X open reading frame at
positions 1781-1799 of the HBV genome, as shown in Tables 1 and 2
The HBV RNAi agents tested, both alone and in combination, showed a
reduction in HBsAg as compared to the PBS control across all
measured time points. Each subsequent dose further reduced the
nadir of HBsAg reduction.
[0555] Additionally, serum HBV DNA levels were determined for Group
C (3.0 mg/kg AD04585), Group E (3.0 mg/kg AD04580), and Group G
(1.5 mg/kg AD04585+1.5 mg/kg AD04580) in Table 24, from serum
samples collected on days -1, 8, 15, 22, 29, and 36, 43 and 50
pursuant to the procedure set forth in Example 2, above. Serum HBV
DNA was isolated for each animal at each of these time points. Data
are presented in the following Table:
TABLE-US-00027 TABLE 26 Average Serum HBV DNA levels normalized to
pre-treatment and PBS controls (both PBS groups A and B) in pHBV
mice following administration of HBV RNAi agents from Example 10
(standard deviation reflected as (+/-)). Group Day 8 Day 15 Day 22
Day 29 A/B 1.000 .+-. 0.316 1.000 .+-. 0.427 1.000 .+-. 0.428 1.000
.+-. 0.475 (PBS) C 0.172 .+-. 0.151 0.142 .+-. 0.079 0.252 .+-.
0.132 0.072 .+-. 0.086 E 0.024 .+-. 0.015 0.042 .+-. 0.037 0.449
.+-. 0.184 0.053 .+-. 0.048 G 0.093 .+-. 0.053 0.083 .+-. 0.037
0.370 .+-. 0.153 0.211 .+-. 0.060 Group Day 36 Day 43 Day 50 A/B
1.000 .+-. 0.623 1.000 .+-. 0.532 1.000 .+-. 0.532 (PBS) C 0.044
.+-. 0.020 0.104 .+-. 0.033 0.156 .+-. 0.016 E 0.012 .+-. 0.004
0.061 .+-. 0.031 0.161 .+-. 0.019 G 0.048 .+-. 0.022 0.147 .+-.
0.010 0.295 .+-. 0.041
[0556] The data in Table 26 indicate that the HBV RNAi agents
examined, both individually and in combination, provided a
reduction in HBV DNA levels compared to the PBS group.
Example 11. HBV RNAi Agents in pHBV Mice: Combination Studies
[0557] The pHBV mouse model described in Example 2, above, was
used. Mice were divided into various groups as set forth in Table
27, below, and each mouse was administered a single 200 .mu.l
subcutaneous injection pursuant to the dosing regimen set forth in
Table 27:
TABLE-US-00028 TABLE 27 Dosing groups of pHBV mice for Example 11.
Group RNAi Agent and Dose Dosing Regimen A PBS (no RNAi agent)
Single injection on day 1 B 3.0 mg/kg AD04962 Single injection on
day 1 C 3.0 mg/kg AD04963 Single injection on day 1 D 1.5 mg/kg
AD04962 + Single injection on day 1 1.5 mg/kg AD04963 E 2.0 mg/kg
AD04962 + Single injection on day 1 1.0 mg/kg AD04963 F 2.25 mg/kg
AD04962 + Single injection on day 1 0.75 mg/kg AD04963 G 1.5 mg/kg
AD04962 + Single injection on day 1 1.5 mg/kg AD04963 H 3.0 mg/kg
AD04962 + Single injection on day 1 3.0 mg/kg AD04963 I 1.5 mg/kg
AD04962 + Single injection on day 1 1.5 mg/kg AD04963 J 4.5 mg/kg
AD04962 + Single injection on day 1 4.5 mg/kg AD04963 K 3.0 mg/kg
AD04872 Single injection on day 1 L 3.0 mg/kg AD04882 Single
injection on day 1 M 3.0 mg/kg AD04885 Single injection on day
1
[0558] Each mouse was given a subcutaneous administration of 200
.mu.l containing the amount of HBV RNAi agent(s) formulated in
phosphate buffered saline, or 200 .mu.l of phosphate buffered
saline without an HBV RNAi agent, as set forth in Table 24. Each of
the HBV RNAi agents included N-acetyl-galactosamine targeting
ligands conjugated to the 5'-terminal end of the sense strand, as
shown in Tables 4 and 5. The injections were performed between the
skin and muscle (i.e. subcutaneous injections) into the loose skin
over the neck and shoulder area. Three (3) mice in each group were
tested (n=3).
[0559] Serum was collected on day -1 prior to administration, and
then on day 8, day 15, day 22, day 29, and day 36 (except for Group
L (AD04882) and Group M (AD04885), and serum Hepatitis B surface
antigen (HBsAg) levels were determined pursuant to the procedure
set forth in Example 2, above. Data from the experiment is shown in
the following Table:
TABLE-US-00029 TABLE 28 Average HBsAg normalized to pre-treatment
and PBS control in pHBV mice following administration of HBV RNAi
agents from Example 11 (standard deviation reflected as (+/-)).
Group Day 8 Day 15 Day 22 A 1.000 .+-. 0.048 1.000 .+-. 0.144 1.000
.+-. 0.083 B 0.125 .+-. 0.025 0.083 .+-. 0.014 0.063 .+-. 0.016 C
0.019 .+-. 0.005 0.035 .+-. 0.008 0.052 .+-. 0.009 D 0.054 .+-.
0.013 0.079 .+-. 0.009 0.108 .+-. 0.021 E 0.099 .+-. 0.025 0.098
.+-. 0.053 0.142 .+-. 0.050 F 0.070 .+-. 0.015 1.103 .+-. 0.036
0.140 .+-. 0.020 G 0.041 .+-. 0.021 0.012 .+-. 0.008 0.021 .+-.
0.013 H 0.020 .+-. 0.006 0.044 .+-. 0.010 0.062 .+-. 0.019 I 0.077
.+-. 0.017 0.019 .+-. 0.004 0.004 .+-. 0.001 J 0.012 .+-. 0.002
0.021 .+-. 0.001 0.032 .+-. 0.002 K 0.045 .+-. 0.014 0.013 .+-.
0.005 0.008 .+-. 0.005 L 0.106 .+-. 0.020 0.176 .+-. 0.044 0.215
.+-. 0.082 M 0.275 .+-. 0.029 0.378 .+-. 0.080 0.572 .+-. 0.043
Group Day 29 Day 36 A 1.000 .+-. 0.209 1.000 .+-. 0.270 B 0.079
.+-. 0.020 0.096 .+-. 0.007 C 0.087 .+-. 0.014 0.164 .+-. 0.026 D
0.176 .+-. 0.014 0.292 .+-. 0.030 E 0.223 .+-. 0.082 0.373 .+-.
0.150 F 0.213 .+-. 0.020 0.328 .+-. 0.034 G 0.031 .+-. 0.013 0.078
.+-. 0.064 H 0.97 .+-. 0.028 0.160 .+-. 0.060 I 0.008 .+-. 0.001
0.002 .+-. 0.0003 J 0.044 .+-. 0.008 0.069 .+-. 0.009 K 0.011 .+-.
0.007 0.011 .+-. 0.009 L 0.299 .+-. 0.009 M 0.792 .+-. 0.057
[0560] RNAi agent AD04962 was designed to have an antisense strand
sequence that is at least partially complementary to the S open
reading frame at positions 257-275 of the HBV genome, as shown in
Tables 1 and 2. RNAi agent AD04872 was designed to have an
antisense strand sequence that is at least partially complementary
to the S open reading frame at positions 261-279 of the HBV genome,
as shown in Tables 1 and 2. RNAi agent AD04963 was designed to have
an antisense strand sequence that is at least partially
complementary to the X open reading frame at positions 1781-1799 of
the HBV genome, as shown in Tables 1 and 2. RNAi agents AD04882 and
AD04885 were designed to have antisense strand sequences that are
at least partially complementary to the X open reading frame at
positions 1780-1798 of the HBV genome, as shown in Tables 1 and 2.
The HBV RNAi agents shown in Table 9, directly above, each showed a
reduction in HBsAg as compared to the PBS control across all
measured timepoints, both individually and in combination.
Re-dosing yielded additional HBsAg reduction.
[0561] Additionally, Serum Hepatitis B e-antigen (HBeAg) levels
were also assessed for all groups except Groups L and M. Samples
from the mice in each respective group were first pooled, and the
resulting serum samples were assayed in singlet. Data from the
experiment is shown in the following Table:
TABLE-US-00030 TABLE 29 Average HBeAg levels normalized to
pre-treatment and PBS control in pHBV mice following administration
of HBV RNAi agents from Example 11. Group Day 8 Day 22 Day 29 Day
36 A 1.000 1.000 1.000 1.000 B 0.425 0.291 0.371 0.365 C 0.152
0.170 0.328 0.356 D 0.266 0.249 0.456 0.440 E 0.278 0.295 0.589
0.561 F 0.306 0.291 0.718 0.522 G 0.183 0.138 0.291 0.249 H 0.091
0.131 0.315 0.238 I 0.183 0.052 0.069 0.036 J 0.089 0.114 0.190
0.236 K 0.458 0.172 0.322 0.207
[0562] Further, serum HBV DNA levels were determined for each of
the groups in Table 27 from serum samples collected on days 8, 15,
22, and 29, pursuant to the procedure set forth in Example 2,
above. Serum HBV DNA was isolated from each animal at each time
point. Data are presented in the following Table:
TABLE-US-00031 TABLE 30 Average Serum HBV DNA levels normalized to
pre-treatment and PBS control in pHBV mice following administration
of HBV RNAi agents from Example 7 (standard deviation reflected as
(+/-)). Group Day 8 Day 15 Day 22 Day 29 A 1.000 .+-. 0.232 1.000
.+-. 0.463 1.000 .+-. 0.272 1.000 .+-. 0.205 B 0.577 .+-. 0.219
0.222 .+-. 0.064 0.196 .+-. 0.055 0.261 .+-. 0.117 C 0.165 .+-.
0.051 0.070 .+-. 0.042 0.142 .+-. 0.105 0.228 .+-. 0.174 D 0.343
.+-. 0.125 0.307 .+-. 0.091 0.300 .+-. 0.092 0.356 .+-. 0.032 E
0.262 .+-. 0.033 0.216 .+-. 0.018 0.227 .+-. 0.028 0.279 .+-. 0.090
F 0.320 .+-. 0.134 0.332 .+-. 0.208 0.344 .+-. 0.209 0.338 .+-.
0.211 G 0.231 .+-. 0.036 0.034 .+-. 0.024 0.069 .+-. 0.039 0.077
.+-. 0.020 H 0.229 .+-. 0.101 0.155 .+-. 0.121 0.148 .+-. 0.079
0.215 .+-. 0.035 I 0.281 .+-. 0.129 0.109 .+-. 0.071 0.023 .+-.
0.019 0.011 .+-. 0.009 J 0.078 .+-. 0.050 0.061 .+-. 0.020 0.074
.+-. 0.029 0.056 .+-. 0.030 K 0.314 .+-. 0.064 0.119 .+-. 0.043
0.076 .+-. 0.067 0.078 .+-. 0.095 L 0.295 .+-. 0.077 0.305 .+-.
0.101 0.213 .+-. 0.088 0.186 .+-. 0.084 M 0.515 .+-. 0.247 0.505
.+-. 0.293 0.488 .+-. 0.318 0.478 .+-. 0.267
[0563] The data in Table 30 indicate that the RNAi agents examined,
both individually and in combination, provided a reduction in HBV
DNA levels compared to the PBS group. Re-dosing yielded addition
reduction of HBV DNA.
Example 12. HBV RNAi Agents in pHBV Mice
[0564] The pHBV mouse model described in Example 2, above, was
used. Mice were divided into various groups as set forth in Table
31, below, and each mouse was administered a single 200 .mu.l
subcutaneous injection pursuant to the dosing regimen set forth in
Table 31:
TABLE-US-00032 TABLE 31 Dosing groups of pHBV mice for Example 12.
Group RNAi Agent and Dose Dosing Regimen A PBS (no RNAi agent)
Single injection on day 1 B 2.0 mg/kg AD04871 Single injection on
day 1 C 2.0 mg/kg AD04872 Single injection on day 1 D 2.0 mg/kg
AD04874 Single injection on day 1 E 2.0 mg/kg AD04875 Single
injection on day 1 F 2.0 mg/kg AD04876 Single injection on day 1 G
2.0 mg/kg AD04881 Single injection on day 1 H 2.0 mg/kg AD04883
Single injection on day 1 I 2.0 mg/kg AD04884 Single injection on
day 1
[0565] Each mouse was given a subcutaneous administration of 200
.mu.l containing the amount of HBV RNAi agent formulated in
phosphate buffered saline, or 200 .mu.l of phosphate buffered
saline without an HBV RNAi agent, as set forth in Table 24. Each of
the HBV RNAi agents included N-acetyl-galactosamine targeting
ligands conjugated to the 5'-terminal end of the sense strand, as
shown in Tables 4 and 5. The injections were performed between the
skin and muscle (i.e. subcutaneous injections) into the loose skin
over the neck and shoulder area. Three (3) mice in each group were
tested (n=3).
[0566] Serum was collected prior to administration, and then on day
8, day 15, and day 22. Group A (PBS), Group B (2.0 mg/kg AD04871),
Group C (2.0 mg/kg AD04872), Group D (2.0 mg/kg AD04874), Group E
(2.0 mg/kg AD04875), and Group F (2.0 mg/kg AD04876) also had serum
collected on day 29, day 36, day 43, and day 50. Serum Hepatitis B
surface antigen (HBsAg) levels were determined pursuant to the
procedure set forth in Example 2, above. Data from the experiment
is shown in the following Table:
TABLE-US-00033 TABLE 32 Average HBsAg normalized to pre-treatment
and PBS control in pHBV mice following administration of HBV RNAi
agents from Example 12 (standard deviation reflected as (+/-)).
Group Day 8 Day 15 Day 22 Day 29 A 1.000 .+-. 0.132 1.000 .+-.
0.089 1.000 .+-. 0.080 1.000 .+-. 0.098 B 0.102 .+-. 0.034 0.041
.+-. 0.021 0.049 .+-. 0.033 0.048 .+-. 0.031 C 0.153 .+-. 0.064
0.064 .+-. 0.032 0.063 .+-. 0.034 0.042 .+-. 0.017 D 0.123 .+-.
0.022 0.049 .+-. 0.017 0.039 .+-. 0.010 0.023 .+-. 0.001 E 0.190
.+-. 0.075 0.094 .+-. 0.038 0.107 .+-. 0.061 0.081 .+-. 0.051 F
0.190 .+-. 0.031 0.076 .+-. 0.035 0.084 .+-. 0.038 0.049 .+-. 0.024
G 0.159 .+-. 0.047 0.216 .+-. 0.057 0.235 .+-. 0.151 H 0.508 .+-.
0.078 0.666 .+-. 0.131 0.543 .+-. 0.048 I 0.279 .+-. 0.087 0.357
.+-. 0.078 0.614 .+-. 0.156 Group Day 36 Day 43 Day 50 A 1.000 .+-.
0.065 1.000 .+-. 0.242 1.000 .+-. 0.224 B 0.054 .+-. 0.038 0.064
.+-. 0.030 0.092 .+-. 0.025 C 0.049 .+-. 0.017 0.054 .+-. 0.015
0.085 .+-. 0.010 D 0.037 .+-. 0.004 0.037 .+-. 0.010 0.065 .+-.
0.012 E 0.126 .+-. 0.077 0.125 .+-. 0.063 0.170 .+-. 0.079 F 0.089
.+-. 0.044 0.082 .+-. 0.034 0.115 .+-. 0.028 G H I
[0567] HBV RNAi agents AD04871, AD04872, AD04874, AD04875, and
AD04876 were each designed to have antisense strand sequences that
are at least partially complementary to the S open reading frame at
positions 261-279 of the HBV genome, as shown in Tables 1 and 2.
Each of these HBV RNAi agents should a substantial reduction in
HBsAg compared to PBS control. For example, a single 2 mg/kg dose
of each of AD04871 (Group B), AD04872 (Group C) and AD04874 (Group
D), and AD04876 (Group F), exhibited a greater than 90% reduction
in HBsAg for each of the timepoints measured from day 15 through
day 43 compared to control. HBV RNAi agents AD04881, AD04883,
AD04884 were each designed to have antisense strand sequences that
are at least partially complementary to the X open reading frame at
positions 1780-1798 of the HBV genome, as shown in Tables 1 and
2.
Example 13. Dose Response and Combinations of HBV RNAI Agents in X
Region Knockout Model Mice
[0568] As an alternative means in assessing the effects of the
combination of an RNAi agent that includes an antisense strand
sequence that is at least partially complementary to a region
located in the S ORF of an HBV mRNA, and a second RNAi agent that
includes an antisense strand sequence that is at least partially
complementary to a region located in the X ORF of an HBV mRNA, a
plasmid was generated that included the HBV genome with a knockout
of the binding site for HBV RNAi agents that target positions 1780
and 1781, as shown in Tables 1 and 2 (hereinafter referred to as X
Region Knockout mice). This model was generated by mutating ten
(10) bases in the pHBV1.3 plasmid within the binding site of these
RNAi agents. The remainder of the HBV mRNA, including the S-region,
remained functional. Thus, in this HBV mouse model, inclusion of an
HBV RNAi agent having an antisense strand that targets positions
1780 and 1781 of the HBV genome disclosed herein is expected to be
ineffective in silencing expression.
[0569] The mice were divided into various groups including those
set forth in Table 33, below, and the mice were given 200 .mu.l
subcutaneous injections pursuant to the dosing regimen set forth in
the following Table:
TABLE-US-00034 TABLE 33 Dosing groups of X Region Knockout mice for
Example 13. Number of Group RNAi Agent and Dose Dosing Regimen
Animals (n) 1 PBS (no RNAi agent) Single injection 4 on day 1 2 2.0
mg/kg AD04585 + Single injection 4 1.0 mg/kg AD04963 on day 1 3 2.0
mg/kg AD04872 + Single injection 4 1.0 mg/kg AD04963 on day 1 4 2.5
mg/kg AD04585 + Single injection 4 0.5 mg/kg AD04963 on day 1 5 2.5
mg/kg AD04872 + Single injection 4 0.5 mg/kg AD04963 on day 1 6 3.0
mg/kg AD04963 Single injection 1 on day 15
[0570] Each mouse was given a subcutaneous administration of 200
.mu.l containing the amount of HBV RNAi agent(s) formulated in
phosphate buffered saline, or 200 .mu.l of phosphate buffered
saline without an HBV RNAi agent, as set forth in Table 33. Each of
the HBV RNAi agents included N-acetyl-galactosamine targeting
ligands conjugated to the 5'-terminal end of the sense strand, as
shown in Tables 4 and 5. The injections were performed between the
skin and muscle (i.e. subcutaneous injections) into the loose skin
over the neck and shoulder area. Three (3) mice in each group were
tested (n=3).
[0571] Serum was collected on day 5, day 8, day 15, day 22, and day
29 and serum Hepatitis B surface antigen (HBsAg) levels were
determined pursuant to the procedure set forth in Example 2, above.
Serum was also collected for Groups 1 through 5 on days 36 and 43.
Data from the experiment is shown in the following Table 34:
TABLE-US-00035 TABLE 34 Average HBsAg normalized to pre-treatment
and PBS control in X Region Knockout mice following administration
of HBV RNAi agents from Example 13 (standard deviation reflected as
(+/-)). Group Day 8 Day 15 Day 22 1 1.000 .+-. 0.186 1.000 .+-.
0.165 1.000 .+-. 0.132 2 0.061 .+-. 0.034 0.041 .+-. 0.035 0.030
.+-. 0.015 3 0.020 .+-. 0.011 0.007 .+-. 0.003 0.003 .+-. 0.002 4
0.063 .+-. 0.039 0.022 .+-. 0.011 0.029 .+-. 0.013 5 0.027 .+-.
0.014 0.003 .+-. 0.003 0.001 .+-. 0.001 6 0.948 1.360 1.652 Day 29
Day 36 Day 43 1 1.000 .+-. 0.059 1.000 .+-. 0.044 1.000 .+-. 0.045
2 0.051 .+-. 0.029 0.062 .+-. 0.029 3 0.004 .+-. 0.003 0.008 .+-.
0.003 0.018 .+-. 0.007 4 0.040 .+-. 0.022 0.061 .+-. 0.030 5 0.002
.+-. 0.001 0.003 .+-. 0.002 0.014 .+-. 0.006 6 1.831
[0572] As expected, Group 6, which was a single dose of 3.0 mg/kg
of HBV RNAi agent AD04963 and includes an antisense strand that is
at least partially complementary to the X open reading frame at
positions 1781-1799 of the HBV genome, was unable to provide
knockdown of HBsAg. Additionally, each of Groups 2 through 5
provided substantial knockdown of HBsAg compared to PBS control,
with both Group 3 and Group 5 exhibiting a greater than 2 log
reduction in HBsAg at nadir (day 22).
Example 14. Dose Response and Combinations of HBV RNAI Agents in X
Region Knockout Model Mice
[0573] The X Region Knockout mouse model described in Example 13,
above, was used. Mice were divided into various groups including
those set forth in Table 31, below, and each mouse was administered
a single 200 .mu.l subcutaneous injection pursuant to the dosing
regimen set forth in Table 35:
TABLE-US-00036 TABLE 35 Dosing groups of X Region Knockout mice for
Example 14. Group RNAi Agent and Dose Dosing Regimen 1 PBS (no RNAi
agent) Single injection on day 1 2 2.0 mg kg AD04872 Single
injection on day 1 3 2.0 mg/kg AD04872 + Single injection on day 1
0.7 mg/kg AD05070 4 2.0 mg/kg AD04872 + Single injection on day 1
1.0 mg/kg AD05070 5 2.0 mg/kg AD04872 + Single injection on day 1
2.0 mg/kg AD05070
[0574] Each mouse was given a subcutaneous administration of 200
.mu.l containing the amount of HBV RNAi agent(s) formulated in
phosphate buffered saline, or 200 .mu.l of phosphate buffered
saline without an HBV RNAi agent, as set forth in Table 35. Each of
the HBV RNAi agents included N-acetyl-galactosamine targeting
ligands conjugated to the 5'-terminal end of the sense strand, as
shown in Tables 4 and 5. The injections were performed between the
skin and muscle (i.e. subcutaneous injections) into the loose skin
over the neck and shoulder area. Three (3) mice in each group shown
in Table 35 were tested (n=3).
[0575] Serum was collected on day 1 (pre-dose), day 8, day 15, day
22, and day 29, and serum Hepatitis B surface antigen (HBsAg)
levels were determined pursuant to the procedure set forth in
Example 2, above. Data from the experiment is shown in the
following Table:
TABLE-US-00037 TABLE 36 Average HBsAg levels normalized to
pre-treatment and PBS control in X Region Knockout mice from
Example 14. Group Day 8 Day 15 Day 22 Day 29 1 1.000 .+-. 0.120
1.000 .+-. 0.255 1.000 .+-. 0.224 1.000 .+-. 0.143 2 0.104 .+-.
0.104 0.009 .+-. 0.009 0.005 .+-. 0.004 0.005 .+-. 0.003 3 0.076
.+-. 0.041 0.010 .+-. 0.009 0.006 .+-. 0.005 0.005 .+-. 0.005 4
0.036 .+-. 0.008 0.002 .+-. 0.001 0.001 .+-. 0.001 0.002 .+-. 0.001
5 0.019 .+-. 0.017 0.003 .+-. 0.002 0.003 .+-. 0.001 0.004 .+-.
0.000
[0576] Table 36 shows that HBV RNAi agent AD04872 administered
alone, and the combination of AD04872 (which includes an antisense
strand that is at least partially complementary to the S open
reading from at positions 261-279 of the HBV genome) and AD05070
(which includes an antisense strand that is at least partially
complementary to the X open reading frame at positions 1781-1799 of
the HBV genome), provided significant knockdown of HBsAg compared
to PBS control across each of the time points measured. Addition of
0.7 mg/kg to 2 mg/kg HBV RNAi agent AD05070 for which there was a
mutated target site in this X Region Knockout model did not
diminish the activity of the 2 mg/kg HBV RNAi agent AD04872.
[0577] Additionally, serum HBV DNA levels were determined from
serum samples collected on days 8, 15, and 22 pursuant to the
procedure set forth in Example 2, above. Serum from each group was
pooled and then DNA was isolated from the serum in singlet. Data
are presented in the following Table:
TABLE-US-00038 TABLE 37 Average Seram HBV DNA levels normalized to
pre-treatment and PBS controls in X Region Knockout mice following
administration of HBV RNAi agents from Example 14 (standard
deviation reflected as (+/-)). Group Day 8 Day 15 Day 22 1 1.000
.+-. 0.007 1.000 .+-. 0.011 1.000 .+-. 0.066 2 0.225 .+-. 0.019
0.022 .+-. 0.001 0.036 .+-. 0.001 3 0.151 .+-. 0.002 0.029 .+-.
0.001 0.042 .+-. 0.003 4 0.140 .+-. 0.006 0.016 .+-. 0.000 0.018
.+-. 0.000 5 0.069 .+-. 0.002 0.018 .+-. 0.003 0.043 .+-. 0.002
[0578] Addition of 0.7 mg/kg to 2 mg/kg HBV RNAi agent AD05070 for
which there was a mutated target site in this X Region Knockout
model did not diminish the activity of the 2 mg/kg HBV RNAi agent
AD04872.
Example 15. HBV RNAI Agents in pHBV Mice
[0579] The pHBV mouse model described in Example 2, above, was
used. Mice were divided into various groups including those set
forth in Table 38, below, and each mouse was administered a single
200 d subcutaneous injection pursuant to the dosing regimen set
forth in Table 38:
TABLE-US-00039 TABLE 38 Dosing groups of pHBV mice for Example 1.5.
Group RNAi Agent and Dose Dosing Regimen 1 PBS (no RNAi agent)
Single injection on day 1 2 2.0 mg/kg AD04776 Single injection on
day 1 3 2.0 mg/kg AD05069 Single injection on day 1 4 2.0 mg/kg
AD05070 Single injection on day 1 5 2.0 mg/kg AD05071 Single
injection on day 1 6 2.0 mg/kg AD05073 Single injection on day 1 7
2.0 mg/kg AD05074 Single injection on day 1 8 2.0 mg/kg AD05075
Single injection on day 1 9 2.0 mg/kg AD05076 Single injection on
day 1 10 2.0 mg/kg AD05077 Single injection on day 1 11 2.0 mg/kg
AD05078 Single injection on day 1 12 3.0 mg/kg AD04872 + Single
injection on day 1 1.0 mg/kg AD04776 13 3.0 mg/kg AD04872 + Single
injection on day 1 1.0 mg/kg AD05069 14 3.0 mg/kg AD04872 + Single
injection on day 1 1.0 mg/kg AD05070 15 3.0 mg/kg AD04872 + Single
injection on day 1 1.0 mg/kg AD05071 16 3.0 mg/kg AD04872 + Single
injection on day 1 1.0 mg/kg AD05073 17 3.0 mg/kg AD04872 + Single
injection on day 1 1.0 mg/kg AD05074 18 3.0 mg/kg AD04872 + Single
injection on day 1 1.0 mg/kg AD05075 19 3.0 mg/kg AD04872 + Single
injection on day 1 1.0 mg/kg AD05076 20 3.0 mg/kg AD04872 + Single
injection on day 1 1.0 mg/kg AD05077 21 3.0 mg/kg AD04872 + Single
injection on day 1 1.0 mg/kg AD05078
[0580] Each mouse was given a subcutaneous administration of 200
.mu.l containing the amount of HBV RNAi agent(s) formulated in
phosphate buffered saline, or 200 .mu.l of phosphate buffered
saline without an HBV RNAi agent, as set forth in Table 38. Each of
the HBV RNAi agents included N-acetyl-galactosamine targeting
ligands conjugated to the 5'-terminal end of the sense strand, as
shown in Tables 4 and 5. The injections were performed between the
skin and muscle (i.e. subcutaneous injections) into the loose skin
over the neck and shoulder area. Three (3) mice in each group were
tested (n=3).
[0581] Serum was collected on day -1 prior to administration, and
then on day 8, day 15, day 22, day 29, day 36, day 43, and day 50.
Serum Hepatitis B surface antigen (HBsAg) levels were determined
pursuant to the procedure set forth in Example 2, above. Data from
the experiment is shown in the following Table 39, with Average
HBsAg reflecting the normalized average value of HBsAg:
TABLE-US-00040 TABLE 39 Average HBsAg normalized to pre-treatment
and PBS control in pHBV mice following administration of HBV RNAi
agents from Example 15. Group Day 8 Day 15 Day 22 Day 29 1 1.000
.+-. 0.119 1.000 .+-. 0.047 1.000 .+-. 0.080 1.000 .+-. 0.027 2
0.339 .+-. 0.076 0.414 .+-. 0.126 0.385 .+-. 0.067 0.450 .+-. 0.075
3 0.240 .+-. 0.096 0.361 .+-. 0.078 0.446 .+-. 0.073 0.508 .+-.
0.114 4 0.081 .+-. 0.026 0.127 .+-. 0.031 0.223 .+-. 0.057 0.330
.+-. 0.112 5 0.452 .+-. 0.020 0.431 .+-. 0.126 0.373 .+-. 0.079
0.383 .+-. 0.080 6 0.375 .+-. 0.181 0.632 .+-. 0.192 0.463 .+-.
0.117 0.567 .+-. 0.159 7 0.325 .+-. 0.032 0.438 .+-. 0.125 0.393
.+-. 0.056 0.443 .+-. 0.096 8 0.155 .+-. 0.031 0.322 .+-. 0.019
0.333 .+-. 0.077 0.463 .+-. 0.043 9 0.245 .+-. 0.063 0.467 .+-.
0.090 0.477 .+-. 0.045 0.562 .+-. 0.049 10 0.120 .+-. 0.062 0.173
.+-. 0.029 0.289 .+-. 0.019 0.331 .+-. 0.042 11 0.128 .+-. 0.042
0.172 .+-. 0.046 0.179 .+-. 0.015 0.215 .+-. 0.049 12 0.040 .+-.
0.015 0.014 .+-. 0.004 0.014 .+-. 0.006 0.015 .+-. 0.004 13 0.050
.+-. 0.020 0.015 .+-. 0.011 0.017 .+-. 0.008 0.022 .+-. 0.009 14
0.020 .+-. 0.011 0.011 .+-. 0.006 0.015 .+-. 0.006 0.023 .+-. 0.004
15 0.043 .+-. 0.005 0.013 .+-. 0.005 0.010 .+-. 0.002 0.011 .+-.
0.004 16 0.021 .+-. 0.017 0.008 .+-. 0.004 0.012 .+-. 0.003 0.011
.+-. 0.001 17 0.032 .+-. 0.011 0.009 .+-. 0.003 0.007 .+-. 0.002
0.008 .+-. 0.0003 18 0.023 .+-. 0.014 0.010 .+-. 0.006 0.009 .+-.
0.006 0.009 .+-. 0.004 19 0.025 .+-. 0.006 0.010 .+-. 0.004 0.009
.+-. 0.002 0.010 .+-. 0.003 20 0.061 .+-. 0.013 0.027 .+-. 0.006
0.020 .+-. 0.003 0.029 .+-. 0.006 21 0.061 .+-. 0.050 0.013 .+-.
0.010 0.012 .+-. 0.005 0.018 .+-. 0.006 Group Day 36 Day 43 Day 50
1 1.000 .+-. 0.031 1.000 .+-. 0.114 1.000 .+-. 0.112 2 0.617 .+-.
0.116 0.643 .+-. 0.154 0.665 .+-. 0.199 3 0.638 .+-. 0.067 0.743
.+-. 0.015 0.792 .+-. 0.115 4 0.472 .+-. 0.121 0.515 .+-. 0.126
0.689 .+-. 0.167 5 0.591 .+-. 0.159 0.604 .+-. 0.086 0.709 .+-.
0.115 6 0.717 .+-. 0.136 0.686 .+-. 0.194 0.781 .+-. 0.301 7 0.586
.+-. 0.069 0.775 .+-. 0.143 0.747 .+-. 0.095 8 0.666 .+-. 0.066
0.803 .+-. 0.096 0.856 .+-. 0.180 9 0.801 .+-. 0.047 0.667 .+-.
0.055 0.765 .+-. 0.208 10 0.640 .+-. 0.059 0.667 .+-. 0.034 0.742
.+-. 0.133 11 0.429 .+-. 0.063 0.383 .+-. 0.005 0.497 .+-. 0.060 12
0.037 .+-. 0.013 0.044 .+-. 0.012 0.056 .+-. 0.014 13 0.046 .+-.
0.011 0.055 .+-. 0.010 0.070 .+-. 0.010 14 0.054 .+-. 0.016 0.070
.+-. 0.018 0.096 .+-. 0.012 15 0.029 .+-. 0.011 0.032 .+-. 0.015
0.051 .+-. 0.020 16 0.033 .+-. 0.005 0.038 .+-. 0.007 0.062 .+-.
0.004 17 0.021 .+-. 0.002 0.031 .+-. 0.004 0.061 .+-. 0.005 18
0.034 .+-. 0.014 0.047 .+-. 0.016 0.079 .+-. 0.017 19 0.028 .+-.
0.005 0.037 .+-. 0.006 0.060 .+-. 0.011 20 0.070 .+-. 0.009 0.063
.+-. 0.018 0.097 .+-. 0.018 21 0.040 .+-. 0.012 0.066 .+-. 0.007
0.120 .+-. 0.036
[0582] RNAi agents AD04776, AD05069, AD05070, AD05071, AD05073, and
AD05074 were each designed to have an antisense strand sequence
that is at least partially complementary to the X open reading
frame at positions 1781-1799 of the HBV genome, as shown in Tables
1 and 2. RNAi agents AD05075, AD05076. AD05077, and AD05078 were
each designed to have antisense strand sequences that are at least
partially complementary to the X open reading frame at positions
1780-1798 of the HBV genome, as shown in Tables 1 and 2.
[0583] Table 39 shows that HBV RNAi agents AD04776, AD05069,
AD05070, AD05071, AD05073, and AD05074 administered alone or their
combination with AD04872 (which includes an antisense strand that
is at least partially complementary to the S open reading from at
positions 261-279 of the HBV genome) provided significant knockdown
of HBsAg compared to PBS control across each of the time points
measured.
Example 16. HBV RNAI Agents in pHBV Mice: Dose Response and
Combination Studies
[0584] The pHBV mouse model described in Example 2, above, was
used. Mice were divided into various groups as set forth in Table
40, below, and each mouse was administered a single 200 .mu.l
subcutaneous injection pursuant to the dosing regimen set forth in
Table 40:
TABLE-US-00041 TABLE 40 Dosing groups of pHBV mice for Example 16.
Group RNAi Agent and Dose Dosing Regimen 1 PBS (no RNAi agent)
Single injection on day 1 2 3.2 mg/kg AD04872 Single injection on
day 1 3 3.2 mg/kg AD04872 Single injection on day 1 and day 22 4
3.0 mg/kg AD04872 + Single injection on day 1 0.8 mg/kg AD05070 5
3.0 mg/kg AD04872 + Single injection on day 1 and day 22 0.8 mg/kg
AD05070 6 3.0 mg/kg AD04872 + Single injection on day 1 1.0 mg/kg
AD05070 7 3.0 mg/kg AD04872 + Single injection on day 1 and day 22
1.0 mg/kg AD05070 8 2.7 mg/kg AD04872 + Single injection on day 1
1.3 mg/kg AD05070 9 2.7 mg/kg AD04872 + Single injection on day 1
and day 22 1.3 mg/kg AD05070 10 2.0 mg/kg AD04872 + Single
injection on day 1 and day 22 2.0 mg/kg AD04776 11 0.8 mg/kg
AD05070 Single injection on day 1 and day 22 12 1.3 mg/kg AD05070
Single injection on day 1 and day 22
[0585] Each mouse was given a subcutaneous administration of 200
.mu.l containing the amount of HBV RNAi agent(s) formulated in
phosphate buffered saline, or 200 .mu.l of phosphate buffered
saline without an HBV RNAi agent, as set forth in Table 40. Each of
the HBV RNAi agents included N-acetyl-galactosamine targeting
ligands conjugated to the 5'-terminal end of the sense strand, as
shown in Tables 4 and 5. The injections were performed between the
skin and muscle (i.e. subcutaneous injections) into the loose skin
over the neck and shoulder area. Six (6) mice in each group were
tested (n=6).
[0586] Serum was collected prior to administration, and then on day
8, day 15, day 22, and day 29, and serum Hepatitis B surface
antigen (HBsAg) levels were determined pursuant to the procedure
set forth in Example 2, above. Data from the experiment is shown in
the following Table 41:
TABLE-US-00042 TABLE 41 Average HBsAg levels normalized to
pre-treatment and PBS control in pHBV mice following administration
of HBV RNAi agents from Example 16 (standard deviation reflected as
(+/-)). Group Day 8 Day 15 Day 22 Day 29 1 1.000 .+-. 0.117 1.000
.+-. 0.213 1.000 .+-. 0.169 1.000 .+-. 0.130 2 0.050 .+-. 0.018
0.015 .+-. 0.007 0.011 .+-. 0.005 0.009 .+-. 0.006 3 0.051 .+-.
0.037 0.014 .+-. 0.011 0.010 .+-. 0.006 0.002 .+-. 0.001 4 0.029
.+-. 0.018 0.010 .+-. 0.006 0.011 .+-. 0.006 0.010 .+-. 0.005 5
0.022 .+-. 0.003 0.007 .+-. 0.001 0.009 .+-. 0.003 0.001 .+-. 0.001
6 0.027 .+-. 0.012 0.007 .+-. 0.004 0.008 .+-. 0.005 0.011 .+-.
0.005 7 0.028 .+-. 0.012 0.010 .+-. 0.005 0.009 .+-. 0.005 0.001
.+-. 0.000 8 0.033 .+-. 0.016 0.016 .+-. 0.008 0.020 .+-. 0.009
0.021 .+-. 0.011 9 0.034 .+-. 0.025 0.015 .+-. 0.011 0.018 .+-.
0.013 0.003 .+-. 0.002 10 0.038 .+-. 0.021 0.015 .+-. 0.005 0.019
.+-. 0.004 0.003 .+-. 0.001 11 0.446 .+-. 0.143 0.376 .+-. 0.120
0.474 .+-. 0.149 0.338 .+-. 0.123 12 0.307 .+-. 0.111 0.257 .+-.
0.122 0.236 .+-. 0.057 0.138 .+-. 0.031
The HBV RNAi agents tested, both individually and in combination,
showed a reduction in HBsAg as compared to the PBS control across
all measured time points. HBsAg expression was further reduced in
all groups that were re-dosed on day 22.
[0587] Additionally, Serum Hepatitis B e-antigen (HBeAg) levels
were also assessed. For the day 8 measurement, the serum samples
for all six mice in each group were pooled, and the resulting
samples were assayed in singlet. For the day -1, day 15, day 22,
and day 29 measurements, the six mice from each group were paired
within each group and their respective serum samples were pooled,
forming three subgroups for each group. The serum samples for each
of the three subgroups for each group were then assayed. Data from
the experiment is shown in the following Table 42:
TABLE-US-00043 TABLE 42 Average HBeAg levels normalized to
pre-treatment and PBS control in pHBV mice following administration
of HBV RNAi agents from Example 16 (standard deviation for days 15,
22, and 29 reflected as (+/-)). Group Day 8 Day 15 Day 22 Day 29 1
1.000 1.000 .+-. 0.011 1.000 .+-. 0.170 1.000 .+-. 0.173 2 0.510
0.308 .+-. 0.031 0.217 .+-. 0.021 0.226 .+-. 0.035 3 0.488 0.301
.+-. 0.065 0.283 .+-. 0.081 0.147 .+-. 0.030 4 0.213 0.216 .+-.
0.067 0.192 .+-. 0.029 0.141 .+-. 0.048 5 0.192 0.211 .+-. 0.053
0.216 .+-. 0.088 0.047 .+-. 0.016 6 0.176 0.163 .+-. 0.022 0.238
.+-. 0.069 0.117 .+-. 0.011 7 0.165 0.175 .+-. 0.046 0.215 .+-.
0.061 0.028 .+-. 0.012 8 0.128 0.166 .+-. 0.065 0.386 .+-. 0.284
0.167 .+-. 0.118 9 0.172 0.171 .+-. 0.037 0.244 .+-. 0.052 0.032
.+-. 0.010 10 0.180 0.211 .+-. 0.012 0.283 .+-. 0.034 0.034 .+-.
0.001 11 0.634 0.594 .+-. 0.082 0.840 .+-. 0.152 0.271 .+-. 0.029
12 0.486 0.441 .+-. 0.066 0.804 .+-. 0.096 0.214 .+-. 0.039
[0588] The HBV RNAi agents tested, both individually and in
combination, showed a reduction in HBeAg as compared to the saline
control across all measured time points. HBeAg expression was
further reduced in all groups that were re-dosed on day 22.
[0589] Further, serum HBV DNA levels were determined for each of
the groups in Table 40 from serum samples collected on days -1, 8,
15, and 22, pursuant to the procedure set forth in Example 2,
above. Serum from each pair of mice was pooled and then DNA was
isolated from each serum pool in a single isolation. Data are
presented in the following Table:
TABLE-US-00044 TABLE 43 Average Serum HBV DNA levels normalized to
pre-treatment and PBS control in pHBV mice following administration
of HBV RNAi agents from Example 16 (standard deviation reflected as
(+/-)). Group Day 8 Day 15 Day 22 1 1.000 .+-. 0.122 1.000 .+-.
0.299 1.000 .+-. 0.241 2 0.312 .+-. 0.016 0.126 .+-. 0.008 0.087
.+-. 0.018 3 0.264 .+-. 0.065 0.081 .+-. 0.023 0.073 .+-. 0.028 4
0.321 .+-. 0.254 0.120 .+-. 0.066 0.134 .+-. 0.101 5 0.319 .+-.
0.081 0.108 .+-. 0.038 0.098 .+-. 0.051 6 0.260 .+-. 0.095 0.068
.+-. 0.010 0.076 .+-. 0.031 7 0.170 .+-. 0.028 0.082 .+-. 0.013
0.062 .+-. 0.018 8 0.188 .+-. 0.020 0.192 .+-. 0.160 0.307 .+-.
0.309 9 0.242 .+-. 0.003 0.100 .+-. 0.042 0.075 .+-. 0.028 10 0.322
.+-. 0.028 0.159 .+-. 0.025 0.086 .+-. 0.016 11 1.124 .+-. 0.142
0.742 .+-. 0.127 0.807 .+-. 0.192 12 1.004 .+-. 0.144 0.541 .+-.
0.340 0.569 .+-. 0.060
[0590] The HBV RNAi agents tested, both individually and in
combination, showed a reduction in serum HBV DNA as compared to the
saline control across all measured time points except in groups 11
and 12 that had no reduction in serum HBV DNA at Day 8.
Example 17. HBV RNAi Agents in in pHBV Mice
[0591] The pHBV mouse model described in Example 2, above, was
used. Mice were divided into various groups as set forth in Table
44, below, and each mouse was administered a single 200 td
subcutaneous injection pursuant to the dosing regimen set forth in
Table 44:
TABLE-US-00045 TABLE 44 Dosing groups of pHBV mice for Example 17.
Group RNAi Agent and Dose Dosing Regimen 1 PBS (no RNAi agent)
Single injection on day 1 2 5 mg/kg AD04585 + Single injection on
day 1 1 mg/kg AD04963 3 5 mg/kg AD04872 + Single injection on day 1
1 mg/kg AD04963 4 5 mg/kg AD04585 + Single injection on day 1 1
mg/kg AD04963 and day 8 5 5 mg/kg AD04872 + Single injection on day
1 1 mg/kg AD04963 and day 8 6 2.5 mg/kg AD04585 + Single injection
on day 1 0.5 mg/kg AD04963 7 2.0 mg/kg AD04585 + Single injection
on day 1 1.0 mg/kg AD04963 8 2.5 mg/kg AD04872 + Single injection
on day 1 0.5 mg/kg AD04963 9 2.0 mg/kg AD04872 + Single injection
on day 1 1.0 mg/kg AD04963 10 5 mg/kg AD04872 + Single injection on
day 1 1 mg/kg AD04981 11 2.5 mg/kg AD04872 + Single injection on
day 1 0.5 mg/kg AD04981 and day 8 12 2.5 mg/kg AD04872 + Single
injection on day 1 0.5 mg/kg AD04981 13 2 mg/kg AD04872 + Single
injection on day 1 1 mg/kg AD04981 14 2.5 mg/kg AD04585 + Single
injection on day 1 0.5 mg/kg AD04981 15 2 mg/kg AD04585 + Single
injection on day 1 1 mg/kg AD04981 16 0.5 mg/kg AD04981 Single
injection on day 1
[0592] Each mouse was given a subcutaneous administration of 200
.mu.l containing the amount of HBV RNAi agent(s) formulated in
phosphate buffered saline, or 200 .mu.l of phosphate buffered
saline without an HBV RNAi agent, as set forth in Table 44. Each of
the HBV RNAi agents included N-acetyl-galactosamine targeting
ligands conjugated to the 5'-terminal end of the sense strand, as
shown in Tables 4 and 5. The injections were performed between the
skin and muscle (i.e. subcutaneous injections) into the loose skin
over the neck and shoulder area. Three (3) mice in each group were
tested (n=3).
[0593] Serum was collected prior to administration, and then on day
8, day 14, day 21, and day 29 and day 36, and serum Hepatitis B
surface antigen (HBsAg) levels were determined pursuant to the
procedure set forth in Example 2, above. Data from the experiment
is shown in the following Table 45:
TABLE-US-00046 TABLE 45 Average HBsAg levels normalized to
pre-treatment and PBS control in pHBV mice following administration
of HBV RNAi agents from Example 17 (standard deviation reflected as
(+/-)). Group Day 8 Day 14 Day 21 Day 29 1 1.000 .+-. 0.068 1.000
.+-. 0.125 1.000 .+-. 0.152 1.000 .+-. 0.110 2 0.058 .+-. 0.033
0.059 .+-. 0.022 0.085 .+-. 0.023 0.158 .+-. 0.021 3 0.025 .+-.
0.009 0.014 .+-. 0.006 0.015 .+-. 0.008 0.026 .+-. 0.015 4 0.032
.+-. 0.007 0.005 .+-. 0.001 0.006 .+-. 0.002 0.014 .+-. 0.002 5
0.024 .+-. 0.009 0.003 .+-. 0.001 0.001 .+-. 0.0004 0.001 .+-.
0.0005 6 0.063 .+-. 0.020 0.077 .+-. 0.013 0.131 .+-. 0.011 0.214
.+-. 0.026 7 0.041 .+-. 0.018 0.059 .+-. 0.017 0.091 .+-. 0.016
0.140 .+-. 0.045 8 0.070 .+-. 0.008 0.046 .+-. 0.016 0.043 .+-.
0.009 0.055 .+-. 0.012 9 0.043 .+-. 0.006 0.027 .+-. 0.003 0.064
.+-. 0.017 0.064 .+-. 0.014 10 0.015 .+-. 0.008 0.005 .+-. 0.003
0.005 .+-. 0.003 0.005 .+-. 0.003 11 0.047 .+-. 0.014 0.005 .+-.
0.003 0.003 .+-. 0.002 0.003 .+-. 0.003 12 0.062 .+-. 0.006 0.025
.+-. 0.007 0.027 .+-. 0.005 0.033 .+-. 0.005 13 0.092 .+-. 0.029
0.050 .+-. 0.021 0.050 .+-. 0.022 0.054 .+-. 0.0019 14 0.310 .+-.
0.180 0.056 .+-. 0.010 0.081 .+-. 0.010 0.112 .+-. 0.0018 15 0.304
.+-. 0.044 0.083 .+-. 0.021 0.115 .+-. 0.013 0.165 .+-. 0.025 16
1.667 .+-. 0.217 0.416 .+-. 0.163 0.341 .+-. 0.179 0.511 .+-.
0.0011 Group Day 36 1 1.000 .+-. 0.225 2 3 0.049 .+-. 0.019 4 5
0.004 .+-. 0.0004 6 7 8 0.081 .+-. 0.010 9 0.108 .+-. 0.026 10
0.009 .+-. 0.004 11 0.005 .+-. 0.003 12 0.060 .+-. 0.014 13 0.094
.+-. 0.027 14 15 16 0.634 .+-. 0.005
[0594] The HBV RNAi agent combinations tested showed a reduction in
HBsAg as compared to the saline control across all measured time
points. Combinations containing AD04872 showed greater reductions
than the equivalent combinations with AD04585 in place of
AD04872.
[0595] Additionally, serum HBV DNA levels were determined for serum
samples collected on days 8, 14, 21, and 29 pursuant to the
procedure set forth in Example 2, above. Serum HBV DNA was isolated
from each animal at each time point. Data are presented in the
following Table 46:
TABLE-US-00047 TABLE 46 Average Serum HBV DNA levels normalized to
pre-treatment and PBS control in pHBV mice following administration
of HBV RNAi agents from Example 17 (standard deviation reflected as
(+/-)). Group Day 8 Day 14 Day 21 Day 29 1 1.000 .+-. 0.280 1.000
.+-. 0.269 1.000 .+-. 0.418 1.000 .+-. 0.383 2 0.136 .+-. 0.068
0.192 .+-. 0.071 0.173 .+-. 0.032 0.292 .+-. 0.039 3 0.097 .+-.
0.034 0.068 .+-. 0.016 0.076 .+-. 0.034 0.131 .+-. 0.061 4 0.061
.+-. 0.039 0.002 .+-. 0.001 0.003 .+-. 0.001 0.019 .+-. 0.013 5
0.068 .+-. 0.025 0.003 .+-. 0.002 0.0009 .+-. 0.0003 0.0009 .+-.
0.0003 6 0.354 .+-. 0.299 0.345 .+-. 0.187 0.522 .+-. 0.234 0.509
.+-. 0.106 7 0.103 .+-. 0.064 0.291 .+-. 0.025 0.203 .+-. 0.043
0.203 .+-. 0.015 8 0.336 .+-. 0.142 0.185 .+-. 0.071 0.183 .+-.
0.065 0.162 .+-. 0.064 9 0.198 .+-. 0.055 0.093 .+-. 0.023 0.118
.+-. 0.054 0.143 .+-. 0.032 10 0.122 .+-. 0.071 0.024 .+-. 0.026
0.023 .+-. 0.020 0.014 .+-. 0.017 11 0.160 .+-. 0.069 0.016 .+-.
0.023 0.003 .+-. 0.001 0.005 .+-. 0.004 12 0.158 .+-. 0.039 0.120
.+-. 0.044 0.100 .+-. 0.049 0.091 .+-. 0.034 13 0.190 .+-. 0.038
0.169 .+-. 0.025 0.066 .+-. 0.015 0.081 .+-. 0.015 14 0.434 .+-.
0.136 0.318 .+-. 0.104 0.144 .+-. 0.094 0.240 .+-. 0.029 15 0.358
.+-. 0.185 0.287 .+-. 0.108 0.279 .+-. 0.080 0.303 .+-. 0.038 16
0.713 .+-. 0.085 0.674 .+-. 0.140 0.496 .+-. 0.128 0.590 .+-.
0.093
[0596] The HBV RNAi agent combinations tested showed a reduction in
serum HBV DNA as compared to the saline control across all measured
time points. Combinations containing AD04872 showed greater
reductions than the equivalent combinations with AD04585 in place
of AD04872. These greater reductions were observed at Day 22 and
Day 29.
Example 18. HBV RNAi Agents in a HBV-Infected Humanized Mouse
Model
[0597] For this study, Male FRG.RTM. (genotype
Fah-/-/Rag2-/-/Il2rg-/- triple knockout mice on a C57BL/6
background (Yecuris) were transplanted with human hepatocytes when
they were 1-2 months old. The human hepatocytes were allowed to
repopulate the liver for approximately 6 months with periodic NTBC
treatment to discourage growth of mouse hepatocytes. At 9 months of
age the mice were given an intravenous inoculation of
4.times.10.sup.8 genomes/kg HBV genotype C, which infected the
human hepatocytes. After 2-3 months, serum HBV DNA levels reached a
plateau indicating the human hepatocytes were maximally infected
(mouse hepatocytes cannot be infected by HBV). Mice were one year
old at the start of treatment with HBV RNAi agents, thus nearing
the end of their life span.
[0598] Pre-treatment serum samples were taken on day -10 and day
-3. Beginning on day 1, each mouse was administered an oral daily
gavage with 0.01 mg/kg Entecavir dissolved in water to inhibit HBV
replication. Daily dosing of Entecavir continued until the day mice
were euthanized. Entecavir administration was expected to reduce
serum HBV DNA in chronically infected human patients, but not
reduce HBsAg.
[0599] Mice were divided into various groups including those set
forth in Table 47, below:
TABLE-US-00048 TABLE 47 Dosing groups of HBV-infected FRG humanized
model mice for Example 18. RNAi Agent and Terminal Group Dose
Dosing Regimen Day A- mouse PBS (no RNAi Single injection
Euthanized 1 agent) on day 1 day 21 (unhealthy animal) A- mouse PBS
(no RNAi Single injection Euthanized 2 agent) on day 1 and day day
36 29 B- mouse 4.0 mg/kg AD04872 + Single injection Euthanized 1
2.0 mg/kg AD05070 on day 1 and day day 36 29 B- mouse 4.0 mg/kg
AD04872 + Single injection Euthanized 2 2.0 mg/kg AD05070 on day 1
and day day 40 29 C- mouse 4.5 mg/kg AD04872 + Single injection
Euthanized 1 1.5 mg/kg AD05070 on day 1 day 15 C- mouse 4.5 mg/kg
AD04872 + Single injection Euthanized 2 1.5 mg/kg AD05070 on day 1
and day day 36 29 C- mouse 4.5 mg/kg AD04872 + Single injection
Euthanized 3 1.5 mg/kg AD05070 on day 1 and day 40 day 29
[0600] Each mouse was also given a subcutaneous administration of
100 .mu.l per 20 grams body weight containing the amount of HBV
RNAi agent(s) formulated in phosphate buffered saline, or an equal
volume of phosphate buffered saline without an HBV RNAi agent, on
day 1 and on day 29 (if still alive on day 29), pursuant to the
schedule as set forth in Table 47, directly above. Each of the HBV
RNAi agents included N-acetyl-galactosamine targeting ligands
conjugated to the 5'-terminal end of the sense strand, as shown in
Tables 4 and 5. The injections were performed between the skin and
muscle (i.e. subcutaneous injections) into the loose skin over the
neck and shoulder area.
[0601] Serum was collected on day 8, day 15, day 22, day 29, day
36, and day 40 and serum Hepatitis B surface antigen (HBsAg) levels
were determined pursuant to the procedure set forth in Example 2,
above. Data from the experiment is shown in the following
Table:
TABLE-US-00049 TABLE 48 Average HBsAg levels normalized to
pre-treatment (day -3) for each individual HBV-infected humanized
FRG model mouse from Example 18. Group Day 8 Day 15 Day 22 Day 29
Day 36 Day 40 A-1 0.830 0.828 0.932 0.858 1.107 A-2 1.303 1.328 B-1
0.548 0.314 0.272 0.207 0.138 B-2 0.592 0.337 0.243 0.215 0.160
0.175 C-1 0.643 0.460 0.415 0.251 0.164 C-2 0.353 0.228 0.182 0.172
0.224 0.216 C-3 0.814 0.674
[0602] Additionally, serum HBV DNA levels were determined from
serum samples collected on days -10, -3, 8, 15, 22, 29, 36, and 40,
pursuant to the procedure set forth in Example 2, above. Data are
presented in the following Table 49:
TABLE-US-00050 TABLE 49 Serum HBV DNA levels normalized to the
average of pre-treatment day -10 and day -3 for each HBV-infected
FRG humanized mouse following administration of HBV RNAi agents
from Example 14. Group Day -10 Day -3 Day 8 Day 15 Day 22 Day 29
Day 36 Day 40 A-1 0.883 1.117 0.072 0.038 0.015 0.027 0.060 A-2
1.070 0.930 0.130 0.075 B-1 1.538 0.462 0.032 0.017 0.011 0.006
0.010 B-2 1.350 0.650 0.042 0.018 0.012 0.007 0.008 0.007 C-1 1.348
0.652 0.041 0.020 0.016 0.005 0.004 C-2 1.030 0.970 0.031 0.015
0.006 0.011 0.008 0.008
[0603] As expected, administration of Entecavir reduced viral
replication in both the absence and presence of HBV RNAi
agents.
OTHER EMBODIMENTS
[0604] It is to be understood that while the invention has been
described in conjunction with the detailed description thereof, the
foregoing description is intended to illustrate and not limit the
scope of the invention, which is defined by the scope of the
appended claims. Other aspects, advantages, and modifications are
within the scope of the following claims.
Sequence CWU 1
1
33413221DNAArtificial sequenceHepatitis B virus (subtype ADW2),
genotype A, complete gene (AM282986.1) 1ttccactgcc ttccaccaag
ctctgcagga tcccaaagtc aggggtctgt attttcctgc 60tggtggctcc agttcaggaa
cagtaaaccc tgctccgaat attgcctctc acatctcgtc 120aatctccgcg
aggactgggg accctgtgac gaatatggag aacatcacat caggattcct
180aggacccctg ctcgtgttac aggcggggtt tttcttgttg acaagaatcc
tcacaatacc 240gcagagtcta gactcgtggt ggacttctct caattttcta
gggggatcac ccgtgtgtct 300tggccaaaat tcgcagtccc caacctccaa
tcactcacca acctcctgtc ctccaatttg 360tcctggttat cgctggatgt
gtctgcggcg ttttatcata ttcctcttca tcctgctgct 420atgcctcatc
ttcttgttgg ttcttctgga ttatcaaggt atgttgcccg tttgtcctct
480aattccagga acaacaacaa ccagtacggg accatgcaaa acctgcacga
ctcctgctca 540aggcaactct atgtttccct catgttgctg tacaaaacct
tcggatggaa attgcacctg 600tattcccatc ccatcgtctt gggctttcgc
aaaataccta tgggagtggg cctcagtccg 660tttctcttgg ctcagtttac
tagtgccatt tgttcagtgg ttcgtagggc tttcccccac 720tgtttggctt
tcagctatat ggatgatgtg gtattggggg ccaagtctgt acagcatcgt
780gagtcccttt ataccgctgt taccaatttt cttttgtctc tgggtataca
tttaaaccct 840aacaaaacaa aaagatgggg ttattcccta aacttcatgg
gttacataat tggaagttgg 900ggaacgttgc cacaggatca tattgtacaa
aagatcaaac actgttttag aaaacttcct 960gttaacaggc ctattgattg
gaaagtatgt caaagaattg tgggtctttt gggctttgct 1020gctccattta
cacaatgtgg atatcctgcc ttaatgcctt tgtatgcctg tatacaagct
1080aaacaggctt tcactttctc gccaacttac aaggcctttc taagtaaaca
gtacatgaac 1140ctttaccccg ttgctcggca acggcctggt ctgtgccaag
tgtttgctga cgcaaccccc 1200actggctggg gcttggccat aggccatcag
cgcatgcgtg gaacctttgt ggctcctctg 1260ccgatccata ctgcggaact
cctagccgct tgttttgctc gcagccggtc tggggcaaag 1320ctcatcggaa
ctgacaattc tgtcgtcctc tcgcggaaat atacatcgtt tccatggctg
1380ctaggttgta ctgccaactg gatccttcgc gggacgtcct ttgtttacgt
cccgtcggcg 1440ctgaatcccg cggacgaccc ctctcggggc cgcttgggac
tctctcgtcc ccttctccgt 1500ctgccgttcc agccgaccac ggggcgcacc
tctctttacg cggtctcccc gtctgtgcct 1560tctcatctgc cggtccgtgt
gcacttcgct tcacctctgc acgttgcatg gagaccaccg 1620tgaacgccca
tcagatcctg cccaaggtct tacataagag gactcttgga ctcccagcaa
1680tgtcaacgac cgaccttgag gcctacttca aagactgtgt gtttaaggac
tgggaggagc 1740tgggggagga gattaggtta aaggtctttg tattaggagg
ctgtaggcat aaattggtct 1800gcgcaccagc accatgcaac tttttcacct
ctgcctaatc atctcttgta catgtcccac 1860tgttcaagcc tccaagctgt
gccttgggtg gctttggggc atggacattg acccttataa 1920agaatttgga
gctactgtgg agttactctc gtttttgcct tctgactttt ttccttccgt
1980cagagatctc ctagacaccg cctcagctct gtatcgggaa gccttagagt
ctcctgagca 2040ttgctcacct caccatactg cactcaggca agcaattctc
tgctgggggg aattgatgac 2100tctagctacc tgggtgggta ataatttgga
agatccagca tccagggatc tagtagtcaa 2160ttatgttaat actaacatgg
gtttaaagat caggcaacta ttgtggtttc atatatcttg 2220ccttactttt
ggaagagaga ctgtacttga atatttggtc tctttcggag tgtggattcg
2280cactcctcca gcctatagac caccaaatgc ccctatctta tcaacacttc
cggaaactac 2340tgttgttaga cgacgggacc gaggcaggtc ccctagaaga
agaactccct cgcctcgcag 2400acgcagatct caatcgccgc gtcgcagaag
atctcaatct cgggaatctc aatgttagta 2460ttccttggac tcataaggtg
ggaaacttta ctgggcttta ttcctctaca gtacctatct 2520ttaatcctga
atggcaaact ccttcctttc ctaagattca tttacaagag gacattatta
2580ataggtgtca acaatttgtg ggccctctca ctgtaaatga aaagagaaga
ttgaaattaa 2640ttatgcctgc tagattctat cctacccaca ctaaatattt
gcccttagac aaaggaatta 2700aaccttatta tccagatcag gtagttaatc
attacttcaa aaccagacat tatttacata 2760ctctttggaa ggctggtatt
ctatataaga gggaaaccac acgtagcgca tcattttgcg 2820ggtcaccata
ttcttgggaa caagagctac agcatgggag gttggtcatc gaaacctcgc
2880aaaggcatgg ggacgaatct ttctgttccc aaccctctgg gattctttcc
cgatcatcag 2940ttggaccctg cattcggagc caactcaaac aatccagatt
gggacttcaa ccccatcaag 3000gaccactggc cagcagccaa ccaggtagga
gtgggagcat tcgggccagg gttcacccct 3060ccacacggcg gtgttttggg
gtggagccct caggctcagg gcatattgac cacagtgtca 3120acaattcctc
ctcctgcctc caccaatcgg cagtcaggaa ggcagcctac tcccatctct
3180ccacctctaa gagacagtca tcctcaggcc atgcagtgga a
3221219DNAArtificial sequenceHBV cDNA target sequence 2gtggtggact
tctctcaat 19319DNAArtificial sequenceHBV cDNA target sequence
3tggtggactt ctctcaatt 19419DNAArtificial sequenceHBV cDNA target
sequence 4ggacttctct caattttct 19519DNAArtificial sequenceHBV cDNA
target sequence 5gctgtaggca taaattggt 19619DNAArtificial
sequenceHBV cDNA target sequence 6ctgtaggcat aaattggtc
19719RNAArtificial sequenceHBV RNAi agent antisense strand core
stretch sequence 7auugagagaa guccaccac 19819RNAArtificial
sequenceHBV RNAi agent antisense strand core stretch sequence
8uuugagagaa guccaccac 19919RNAArtificial sequenceHBV RNAi agent
antisense strand core stretch sequencemodified_base19n = any
nucleotide 9auugagagaa guccaccan 191019RNAArtificial sequenceHBV
RNAi agent antisense strand core stretch sequencemodified_base19n =
any nucleotide 10uuugagagaa guccaccan 191119RNAArtificial
sequenceHBV RNAi agent antisense strand core stretch
sequencemodified_base1, 19n = any nucleotide 11nuugagagaa guccaccan
191219RNAArtificial sequenceHBV RNAi agent antisense strand core
stretch sequence 12aauugagaga aguccacca 191319RNAArtificial
sequenceHBV RNAi agent antisense strand core stretch sequence
13uauugagaga aguccacca 191419RNAArtificial sequenceHBV RNAi agent
antisense strand core stretch sequencemodified_base19n = any
nucleotide 14aauugagaga aguccaccn 191519RNAArtificial sequenceHBV
RNAi agent antisense strand core stretch sequencemodified_base19n =
any nucleotide 15uauugagaga aguccaccn 191619RNAArtificial
sequenceHBV RNAi agent antisense strand core stretch
sequencemodified_base1, 19n = any nucleotide 16nauugagaga aguccaccn
191719RNAArtificial sequenceHBV RNAi agent antisense strand core
stretch sequence 17agaaaauuga gagaagucc 191819RNAArtificial
sequenceHBV RNAi agent antisense strand core stretch sequence
18ugaaaauuga gagaagucc 191919RNAArtificial sequenceHBV RNAi agent
antisense strand core stretch sequencemodified_base19n = any
nucleotide 19agaaaauuga gagaagucn 192019RNAArtificial sequenceHBV
RNAi agent antisense strand core stretch sequencemodified_base19n =
any nucleotide 20ugaaaauuga gagaagucn 192119RNAArtificial
sequenceHBV RNAi agent antisense strand core stretch
sequencemodified_base1, 19n = any nucleotide 21ngaaaauuga gagaagucn
192219RNAArtificial sequenceHBV RNAi agent antisense strand core
stretch sequence 22accaauuuau gccuacagc 192319RNAArtificial
sequenceHBV RNAi agent antisense strand core stretch sequence
23uccaauuuau gccuacagc 192419RNAArtificial sequenceHBV RNAi agent
antisense strand core stretch sequencemodified_base19n = any
nucleotide 24accaauuuau gccuacagn 192519RNAArtificial sequenceHBV
RNAi agent antisense strand core stretch sequencemodified_base19n =
any nucleotide 25uccaauuuau gccuacagn 192619RNAArtificial
sequenceHBV RNAi agent antisense strand core stretch
sequencemodified_base1,19n = any nucleotide 26nccaauuuau gccuacagn
192719RNAArtificial sequenceHBV RNAi agent antisense strand core
stretch sequence 27gaccaauuua ugccuacag 192819RNAArtificial
sequenceHBV RNAi agent antisense strand core stretch sequence
28aaccaauuua ugccuacag 192919RNAArtificial sequenceHBV RNAi agent
antisense strand core stretch sequence 29uaccaauuua ugccuacag
193019RNAArtificial sequenceHBV RNAi agent antisense strand core
stretch sequencemodified_base19n = any nucleotide 30gaccaauuua
ugccuacan 193119RNAArtificial sequenceHBV RNAi agent antisense
strand core stretch sequencemodified_base19n = any nucleotide
31aaccaauuua ugccuacan 193219RNAArtificial sequenceHBV RNAi agent
antisense strand core stretch sequencemodified_base19n = any
nucleotide 32uaccaauuua ugccuacan 193319RNAArtificial sequenceHBV
RNAi agent antisense strand core stretch sequencemodified_base1,
19n = any nucleotide 33naccaauuua ugccuacan 193419DNAArtificial
sequenceHBV RNAi agent sense strand core stretch sequence
34gugguggacu ucucucaau 193519RNAArtificial sequenceHBV RNAi agent
sense strand core stretch sequence 35gugguggacu ucucucaaa
193619RNAArtificial sequenceHBV RNAi agent sense strand core
stretch sequencemodified_base1n = any nucleotide 36nugguggacu
ucucucaau 193719RNAArtificial sequenceHBV RNAi agent sense strand
core stretch sequencemodified_base1n = any nucleotide 37nugguggacu
ucucucaaa 193819RNAArtificial sequenceHBV RNAi agent sense strand
core stretch sequencemodified_base1, 19n = any nucleotide
38nugguggacu ucucucaan 193919RNAArtificial sequenceHBV RNAi agent
sense strand core stretch sequence 39ugguggacuu cucucaauu
194019RNAArtificial sequenceHBV RNAi agent sense strand core
stretch sequence 40ugguggacuu cucucaaua 194119RNAArtificial
sequenceHBV RNAi agent sense strand core stretch
sequencemodified_base1n = any nucleotide 41ngguggacuu cucucaauu
194219RNAArtificial sequenceHBV RNAi agent sense strand core
stretch sequencemodified_base1n = any nucleotide 42ngguggacuu
cucucaaua 194319RNAArtificial sequenceHBV RNAi agent sense strand
core stretch sequencemodified_base1, 19n = any nucleotide
43ngguggacuu cucucaaun 194419RNAArtificial sequenceHBV RNAi agent
sense strand core stretch sequence 44ggacuucucu caauuuucu
194519RNAArtificial sequenceHBV RNAi agent sense strand core
stretch sequence 45ggacuucucu caauuuuca 194619RNAArtificial
sequenceHBV RNAi agent sense strand core stretch
sequencemodified_base1n = any nucleotide 46ngacuucucu caauuuucu
194719RNAArtificial sequenceHBV RNAi agent sense strand core
stretch sequencemodified_base1n = any nucleotide 47ngacuucucu
caauuuuca 194819RNAArtificial sequenceHBV RNAi agent sense strand
core stretch sequencemodified_base1, 19n = any nucleotide
48ngacuucucu caauuuucn 194919RNAArtificial sequenceHBV RNAi agent
sense strand core stretch sequence 49gcuguaggca uaaauuggu
195019RNAArtificial sequenceHBV RNAi agent sense strand core
stretch sequence 50gcuguaggca uaaauugga 195119RNAArtificial
sequenceHBV RNAi agent sense strand core stretch
sequencemodified_base1n = any nucleotide 51ncuguaggca uaaauuggu
195219RNAArtificial sequenceHBV RNAi agent sense strand core
stretch sequencemodified_base1n = any nucleotide 52ncuguaggca
uaaauugga 195319RNAArtificial sequenceHBV RNAi agent sense strand
core stretch sequencemodified_base1, 19n = any nucleotide
53ncuguaggca uaaauuggn 195419RNAArtificial sequenceHBV RNAi agent
sense strand core stretch sequence 54cuguaggcau aaauugguc
195519RNAArtificial sequenceHBV RNAi agent sense strand core
stretch sequence 55cuguaggcau aaauugguu 195619RNAArtificial
sequenceHBV RNAi agent sense strand core stretch sequence
56cuguaggcau aaauuggua 195719RNAArtificial sequenceHBV RNAi agent
sense strand core stretch sequencemodified_base1n = any nucleotide
57nuguaggcau aaauugguc 195819RNAArtificial sequenceHBV RNAi agent
sense strand core stretch sequencemodified_base1n = any nucleotide
58nuguaggcau aaauugguu 195919RNAArtificial sequenceHBV RNAi agent
sense strand core stretch sequencemodified_base1n = any nucleotide
59nuguaggcau aaauuggua 196019RNAArtificial sequenceHBV RNAi agent
sense strand core stretch sequencemodified_base1, 19n = any
nucleotide 60nuguaggcau aaauuggun 196126RNAArtificial sequenceHBV
RNAi Agent antisense strand modified sequence 61uaccaauuua
ugccuacagg ccuuau 266223RNAArtificial sequenceHBV RNAi Agent
antisense strand modified sequence 62uaccaauuua ugccuacagg ccu
236323RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 63uaccaauuua ugccuacagg ccu 236421RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
64uaccaauuua ugccuacagg c 216521RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 65ugugaagcga agugcacacu u
216626RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 66uaccaauuua ugccuacagc cuccgc
266726RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 67uaccaauuua ugccuacagc cuccgc
266821RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 68uaccaauuua ugccuacagu u 216921RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
69uaccaauuua ugccuacagg c 217021RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 70uaccaauuua ugccuacagg c
217121RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 71uaccaauuua ugccuacagu u 217221RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
72auugagagaa guccaccacg a 217321RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 73auugagagaa guccaccacg a
217421RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 74auugagagaa guccaccacu u 217521RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
75uuugagagaa guccaccacg a 217621RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 76aauugagaga aguccaccac g
217721RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 77aauugagaga aguccaccac g 217821RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
78aauugagaga aguccaccau u 217921RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 79uauugagaga aguccaccac g
218021RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 80uaccaauuua ugccuacagg u 218121RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
81uaccaauuua ugccuacagu u 218221RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 82uaccaauuua ugccuacagc c
218323RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 83uaccaauuua ugccuacagc cuu
238423RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 84uaccaauuua ugccuacagc cuc 238521RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
85uaccaauuua ugccuacagc c 218623RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 86uaccaauuua ugccuacagc
cuu 238723RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 87uaccaauuua ugccuacagc cuc 238821RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
88auugagagaa guccaccacu u 218921RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 89uuugagagaa guccaccacu u
219023RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 90auugagagaa guccaccacg guu 239123RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
91auugagagaa guccaccacg guu 239223RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 92auugagagaa guccaccacg
agu 239321RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 93uauugagaga aguccaccac g 219421RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
94uauugagaga aguccaccac g 219523RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 95uauugagaga aguccaccac
guu 239623RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 96uauugagaga aguccaccac gag 239723RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
97uauugagaga aguccaccac gag 239822RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 98uauugagaga aguccaccac ga
229922RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 99uauugagaga aguccaccac ga 2210021RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
100agaaaauuga gagaagucca c 2110121RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 101uaccaauuua ugccuacagu u
2110221RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 102uaccaauuua ugccuacagc c 2110322RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
103uaccaauuua ugccuacagc uu 2210422RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 104uaccaauuua ugccuacagc
cu 2210523RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 105uaccaauuua ugccuacagc cuu 2310623RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
106uaccaauuua ugccuacagc cuc 2310721RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 107uaccaauuua ugccuacagu u
2110821RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 108uauugagaga aguccaccac g 2110921RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
109uauugagaga aguccaccau u 2111021RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 110uauugagaga aguccaccac g
2111122RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 111uauugagaga aguccaccac uu 2211222RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
112uauugagaga aguccaccac ga 2211321RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 113uauugagaga aguccaccac g
2111421RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 114uuugagagaa guccaccacu u 2111521RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
115uuugagagaa guccaccacg a 2111622RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 116uuugagagaa guccaccacg
uu 2211722RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 117uuugagagaa guccaccacg ag 2211821RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
118uuugagagaa guccaccacu u 2111922RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 119uauugagaga aguccaccac
uu 2212022RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 120uauugagaga aguccaccac uu 2212123RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
121uauugagaga aguccaccac guu 2312222RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 122uauugagaga aguccaccac
uu 2212323RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 123uauugagaga aguccaccac gag 2312422RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
124uauugagaga aguccaccac uu 2212521RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 125agaaaauuga gagaaguccu u
2112621RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 126agaaaauuga gagaagucca c 2112723RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
127agaaaauuga gagaagucca cuu 2312822RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 128agaaaauuga gagaagucca
cc 2212921RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 129ugaaaauuga gagaaguccu u 2113021RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
130ugaaaauuga gagaagucca c 2113121RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 131accaauuuau gccuacagcu u
2113222RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 132accaauuuau gccuacagcc uu 2213322RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
133accaauuuau gccuacagcc uc 2213421RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 134uccaauuuau gccuacagcu u
2113522RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 135uccaauuuau gccuacagcc uu 2213621RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
136uaccaauuua ugccuacagc c 2113721RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 137uaccaauuua ugccuacagc c
2113821RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 138uaccaauuua ugccuacagc c 2113921RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
139uaccaauuua ugccuacagc u 2114021RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 140uaccaauuua ugccuacagc g
2114121RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 141aaccaauuua ugccuacagc c 2114221RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
142uaccaauuua ugccuacagu u 2114321RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 143uaccaauuua ugccuacagc c
2114421RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 144accaauuuau gccuacagcc u 2114521RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
145uccaauuuau gccuacagcc u 2114621RNAArtificial sequenceHBV RNAi
Agent antisense strand modified sequence 146accaauuuau gccuacagcc g
2114721RNAArtificial sequenceHBV RNAi Agent antisense strand
modified sequence 147uccaauuuau gccuacagcc g 2114821RNAArtificial
sequenceHBV RNAi Agent antisense strand modified sequence
148uaccaauuua ugccuacagg g 2114926RNAArtificial sequenceHBV RNAi
Agent antisense strand unmodified sequence 149uaccaauuua ugccuacagg
ccuuau 2615023RNAArtificial sequenceHBV RNAi Agent antisense strand
unmodified sequence 150uaccaauuua ugccuacagg ccu
2315121RNAArtificial sequenceHBV RNAi Agent antisense strand
unmodified sequence 151uaccaauuua ugccuacagg c 2115221RNAArtificial
sequenceHBV RNAi Agent antisense strand unmodified sequence
152ugugaagcga agugcacacu u 2115326RNAArtificial sequenceHBV RNAi
Agent antisense strand unmodified sequence 153uaccaauuua ugccuacagc
cuccgc 2615421RNAArtificial sequenceHBV RNAi Agent antisense strand
unmodified sequence 154uaccaauuua ugccuacagu u 2115521RNAArtificial
sequenceHBV RNAi Agent antisense strand unmodified sequence
155auugagagaa guccaccacg a 2115621RNAArtificial sequenceHBV RNAi
Agent antisense strand unmodified sequence 156auugagagaa guccaccacu
u 2115721RNAArtificial sequenceHBV RNAi Agent antisense strand
unmodified sequence 157uuugagagaa guccaccacg a 2115821RNAArtificial
sequenceHBV RNAi Agent antisense strand unmodified sequence
158aauugagaga aguccaccac g 2115921RNAArtificial sequenceHBV RNAi
Agent antisense strand unmodified sequence 159aauugagaga aguccaccau
u 2116021RNAArtificial sequenceHBV RNAi Agent antisense strand
unmodified sequence 160uauugagaga aguccaccac g 2116121RNAArtificial
sequenceHBV RNAi Agent antisense strand unmodified sequence
161uaccaauuua ugccuacagg u 2116221RNAArtificial sequenceHBV RNAi
Agent antisense strand unmodified sequence 162uaccaauuua ugccuacagc
c 2116323RNAArtificial sequenceHBV RNAi Agent antisense strand
unmodified sequence 163uaccaauuua ugccuacagc cuu
2316423RNAArtificial sequenceHBV RNAi Agent antisense strand
unmodified sequence 164uaccaauuua ugccuacagc cuc
2316521RNAArtificial sequenceHBV RNAi Agent antisense strand
unmodified sequence 165uuugagagaa guccaccacu u 2116623RNAArtificial
sequenceHBV RNAi Agent antisense strand unmodified sequence
166auugagagaa guccaccacg guu 2316723RNAArtificial sequenceHBV RNAi
Agent antisense strand unmodified sequence 167auugagagaa guccaccacg
agu 2316823RNAArtificial sequenceHBV RNAi Agent antisense strand
unmodified sequence 168uauugagaga aguccaccac guu
2316923RNAArtificial sequenceHBV RNAi Agent antisense strand
unmodified sequence 169uauugagaga aguccaccac gag
2317022RNAArtificial sequenceHBV RNAi Agent antisense strand
unmodified sequence 170uauugagaga aguccaccac ga
2217121RNAArtificial sequenceHBV RNAi Agent antisense strand
unmodified sequence 171agaaaauuga gagaagucca c 2117222RNAArtificial
sequenceHBV RNAi Agent antisense strand unmodified sequence
172uaccaauuua ugccuacagc uu 2217322RNAArtificial sequenceHBV RNAi
Agent antisense strand unmodified sequence 173uaccaauuua ugccuacagc
cu 2217421RNAArtificial sequenceHBV RNAi Agent antisense strand
unmodified sequence 174uauugagaga aguccaccau u 2117522RNAArtificial
sequenceHBV RNAi Agent antisense strand unmodified sequence
175uauugagaga aguccaccac uu 2217622RNAArtificial sequenceHBV RNAi
Agent antisense strand unmodified sequence 176uuugagagaa guccaccacg
uu 2217722RNAArtificial sequenceHBV RNAi Agent antisense strand
unmodified sequence 177uuugagagaa guccaccacg ag
2217821RNAArtificial sequenceHBV RNAi Agent antisense strand
unmodified sequence 178agaaaauuga gagaaguccu u 2117923RNAArtificial
sequenceHBV RNAi Agent antisense strand unmodified sequence
179agaaaauuga gagaagucca cuu 2318022RNAArtificial sequenceHBV RNAi
Agent antisense strand unmodified sequence 180agaaaauuga gagaagucca
cc 2218121RNAArtificial sequenceHBV RNAi Agent antisense strand
unmodified sequence 181ugaaaauuga gagaagucca c 2118221RNAArtificial
sequenceHBV RNAi Agent antisense strand unmodified sequence
182accaauuuau gccuacagcu u 2118322RNAArtificial sequenceHBV RNAi
Agent antisense strand unmodified sequence 183accaauuuau gccuacagcc
uu 2218422RNAArtificial sequenceHBV RNAi Agent antisense strand
unmodified sequence 184accaauuuau gccuacagcc uc
2218521RNAArtificial sequenceHBV RNAi Agent antisense strand
unmodified sequence 185uccaauuuau gccuacagcu u 2118622RNAArtificial
sequenceHBV RNAi Agent antisense strand unmodified sequence
186uccaauuuau gccuacagcc uu 2218721RNAArtificial sequenceHBV RNAi
Agent antisense strand unmodified sequence 187uaccaauuua ugccuacagc
u 2118821RNAArtificial sequenceHBV RNAi Agent antisense strand
unmodified sequence 188uaccaauuua ugccuacagc g 2118921RNAArtificial
sequenceHBV RNAi Agent antisense strand unmodified sequence
189aaccaauuua ugccuacagc c 2119021RNAArtificial sequenceHBV RNAi
Agent antisense strand unmodified sequence 190accaauuuau gccuacagcc
u 2119121RNAArtificial sequenceHBV RNAi Agent antisense strand
unmodified sequence 191uccaauuuau gccuacagcc u 2119221RNAArtificial
sequenceHBV RNAi Agent antisense strand unmodified sequence
192accaauuuau gccuacagcc g 2119321RNAArtificial sequenceHBV RNAi
Agent antisense strand unmodified sequence 193uccaauuuau gccuacagcc
g 2119421RNAArtificial sequenceHBV RNAi Agent antisense strand
unmodified sequence 194uaccaauuua ugccuacagg g 2119525DNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 195uugccuguag
gcauaaauug guaut
2519626RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 196uauaugccug uaggcauaaa uuggua 2619726DNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 197gcggaggcug
uaggcauaaa uuggta 2619821RNAArtificial sequenceHBV RNAi Agent sense
strand modified sequence 198cuguaggcau aaauugguau u
2119921RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 199gccuguaggc auaaauuggu a 2120021RNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 200gccuguaggc
auaaauuggu a 2120121RNAArtificial sequenceHBV RNAi Agent sense
strand modified sequence 201gccuguaggc auaaauuggu a
2120221DNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 202gccuguaggc auaaauuggt a 2120321RNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 203aacuguaggc
auaaauuggu a 2120421RNAArtificial sequenceHBV RNAi Agent sense
strand modified sequence 204ucguggugga cuucucucaa u
2120521RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 205aaguggugga cuucucucaa u 2120621DNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 206ucguggugga
cuucucucaa t 2120721RNAArtificial sequenceHBV RNAi Agent sense
strand modified sequence 207cgugguggac uucucucaau u
2120821RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 208aaugguggac uucucucaau u 2120921DNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 209cgugguggac
uucucucaat t 2121021RNAArtificial sequenceHBV RNAi Agent sense
strand modified sequence 210ggacuucucu caauuuucua a
2121121RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 211cgugguggac uucucucaau a 2121221RNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 212ucguggugga
cuucucucaa a 2121321RNAArtificial sequenceHBV RNAi Agent sense
strand modified sequence 213accuguaggc auaaauuggu a
2121419RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 214cuguaggcau aaauuggua 1921519RNAArtificial sequenceHBV
RNAi Agent sense strand modified sequence 215cuguaggcau aaauuggua
1921619RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 216cuguaggcau aaauuggua 1921720RNAArtificial sequenceHBV
RNAi Agent sense strand modified sequence 217acuguaggca uaaauuggua
2021821RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 218ggcuguaggc auaaauuggu a 2121921RNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 219aaguggugga
cuucucucaa u 2122021RNAArtificial sequenceHBV RNAi Agent sense
strand modified sequence 220aaguggugga cuucucucaa a
2122121RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 221ccguggugga cuucucucaa u 2122221RNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 222ccguggugga
cuucucucaa u 2122322RNAArtificial sequenceHBV RNAi Agent sense
strand modified sequence 223cucguggugg acuucucuca au
2222419RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 224gugguggacu ucucucaau 1922521RNAArtificial sequenceHBV
RNAi Agent sense strand modified sequence 225gugguggacu ucucucaauu
u 2122622RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 226ucguggugga cuucucucaa uu 2222719RNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 227ugguggacuu
cucucaauu 1922819RNAArtificial sequenceHBV RNAi Agent sense strand
modified sequence 228ugguggacuu cucucaauu 1922921RNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 229guggacuucu
cucaauuuuc u 2123021RNAArtificial sequenceHBV RNAi Agent sense
strand modified sequence 230cuguaggcau aaauugguau u
2123122RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 231gcuguaggca uaaauuggua uu 2223223RNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 232ggcuguaggc
auaaauuggu auu 2323323RNAArtificial sequenceHBV RNAi Agent sense
strand modified sequence 233aacuguaggc auaaauuggu auu
2323421RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 234ugguggacuu cucucaauau u 2123522RNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 235gugguggacu
ucucucaaua uu 2223623RNAArtificial sequenceHBV RNAi Agent sense
strand modified sequence 236aaugguggac uucucucaau auu
2323723RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 237cgugguggac uucucucaau auu 2323821RNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 238cgugguggac
uucucucaau a 2123921RNAArtificial sequenceHBV RNAi Agent sense
strand modified sequence 239aaguggugga cuucucucaa u
2124021RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 240gugguggacu ucucucaaau u 2124122RNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 241cgugguggac
uucucucaaa uu 2224223RNAArtificial sequenceHBV RNAi Agent sense
strand modified sequence 242aaguggugga cuucucucaa auu
2324323RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 243ucguggugga cuucucucaa auu 2324422RNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 244gugguggacu
ucucucaaua uu 2224523RNAArtificial sequenceHBV RNAi Agent sense
strand modified sequence 245cgugguggac uucucucaau auu
2324623RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 246cucguggugg acuucucuca aua 2324725RNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 247cucguggugg
acuucucuca auauu 2524821RNAArtificial sequenceHBV RNAi Agent sense
strand modified sequence 248ggcuguaggc auaaauuggu a
2124923RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 249gaggcuguag gcauaaauug gua 2325025RNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 250gaggcuguag
gcauaaauug guauu 2525119RNAArtificial sequenceHBV RNAi Agent sense
strand modified sequence 251ggacuucucu caauuuucu
1925221RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 252guggacuucu cucaauuuuc u 2125322RNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 253gguggacuuc
ucucaauuuu cu 2225419RNAArtificial sequenceHBV RNAi Agent sense
strand modified sequence 254ggacuucucu caauuuuca
1925519RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 255ggacuucucu caauuuuca 1925619RNAArtificial sequenceHBV
RNAi Agent sense strand modified sequence 256gcuguaggca uaaauuggu
1925720RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 257ggcuguaggc auaaauuggu 2025822RNAArtificial sequenceHBV
RNAi Agent sense strand modified sequence 258gaggcuguag gcauaaauug
gu 2225919RNAArtificial sequenceHBV RNAi Agent sense strand
modified sequence 259gcuguaggca uaaauugga 1926020RNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 260ggcuguaggc
auaaauugga 2026121RNAArtificial sequenceHBV RNAi Agent sense strand
modified sequence 261agcuguaggc auaaauuggu a 2126221RNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 262cgcuguaggc
auaaauuggu a 2126321RNAArtificial sequenceHBV RNAi Agent sense
strand modified sequence 263ggcuguaggc auaaauuggu u
2126421RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 264cuguaggcau aaauugguau u 2126521RNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 265cuguaggcau
aaauugguau u 2126621RNAArtificial sequenceHBV RNAi Agent sense
strand modified sequence 266aggcuguagg cauaaauugg u
2126721RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 267aggcuguagg cauaaauugg a 2126821RNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 268cggcuguagg
cauaaauugg u 2126921RNAArtificial sequenceHBV RNAi Agent sense
strand modified sequence 269cggcuguagg cauaaauugg a
2127021RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 270cccuguaggc auaaauuggu a 2127121RNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 271cgcuguaggc
auaaauuggu a 2127221RNAArtificial sequenceHBV RNAi Agent sense
strand modified sequence 272cccuguaggc auaaauuggu a
2127321RNAArtificial sequenceHBV RNAi Agent sense strand modified
sequence 273guggacuucu cucaauuuuc u 2127421RNAArtificial
sequenceHBV RNAi Agent sense strand modified sequence 274cgcuguaggc
auaaauuggu a 2127525DNAArtificial sequenceHBV RNAi Agent sense
strand unmodified sequence 275uugccuguag gcauaaauug guaut
2527626RNAArtificial sequenceHBV RNAi Agent sense strand unmodified
sequence 276uauaugccug uaggcauaaa uuggua 2627726DNAArtificial
sequenceHBV RNAi Agent sense strand unmodified sequence
277gcggaggcug uaggcauaaa uuggta 2627821RNAArtificial sequenceHBV
RNAi Agent sense strand unmodified sequence 278cuguaggcau
aaauugguau u 2127921RNAArtificial sequenceHBV RNAi Agent sense
strand unmodified sequence 279gccuguaggc auaaauuggu a
2128021DNAArtificial sequenceHBV RNAi Agent sense strand unmodified
sequence 280gccuguaggc auaaauuggt a 2128121RNAArtificial
sequenceHBV RNAi Agent sense strand unmodified sequence
281aacuguaggc auaaauuggu a 2128221RNAArtificial sequenceHBV RNAi
Agent sense strand unmodified sequence 282ucguggugga cuucucucaa u
2128321RNAArtificial sequenceHBV RNAi Agent sense strand unmodified
sequence 283aaguggugga cuucucucaa u 2128421DNAArtificial
sequenceHBV RNAi Agent sense strand unmodified sequence
284ucguggugga cuucucucaa t 2128521RNAArtificial sequenceHBV RNAi
Agent sense strand unmodified sequence 285cgugguggac uucucucaau u
2128621RNAArtificial sequenceHBV RNAi Agent sense strand unmodified
sequence 286aaugguggac uucucucaau u 2128721DNAArtificial
sequenceHBV RNAi Agent sense strand unmodified sequence
287cgugguggac uucucucaat t 2128821RNAArtificial sequenceHBV RNAi
Agent sense strand unmodified sequence 288ggacuucucu caauuuucua a
2128921RNAArtificial sequenceHBV RNAi Agent sense strand unmodified
sequence 289cgugguggac uucucucaau a 2129021RNAArtificial
sequenceHBV RNAi Agent sense strand unmodified sequence
290ucguggugga cuucucucaa a 2129121RNAArtificial sequenceHBV RNAi
Agent sense strand unmodified sequence 291accuguaggc auaaauuggu a
2129219RNAArtificial sequenceHBV RNAi Agent sense strand unmodified
sequence 292cuguaggcau aaauuggua 1929320RNAArtificial sequenceHBV
RNAi Agent sense strand unmodified sequence 293acuguaggca
uaaauuggua 2029421RNAArtificial sequenceHBV RNAi Agent sense strand
unmodified sequence 294ggcuguaggc auaaauuggu a 2129521RNAArtificial
sequenceHBV RNAi Agent sense strand unmodified sequence
295aaguggugga cuucucucaa a 2129621RNAArtificial sequenceHBV RNAi
Agent sense strand unmodified sequence 296ccguggugga cuucucucaa u
2129722RNAArtificial sequenceHBV RNAi Agent sense strand unmodified
sequence 297cucguggugg acuucucuca au 2229819RNAArtificial
sequenceHBV RNAi Agent sense strand unmodified sequence
298gugguggacu ucucucaau 1929921RNAArtificial sequenceHBV RNAi Agent
sense strand unmodified sequence 299gugguggacu ucucucaauu u
2130022RNAArtificial sequenceHBV RNAi Agent sense strand unmodified
sequence 300ucguggugga cuucucucaa uu 2230119RNAArtificial
sequenceHBV RNAi Agent sense strand unmodified sequence
301ugguggacuu cucucaauu 1930221RNAArtificial sequenceHBV RNAi Agent
sense strand unmodified sequence 302guggacuucu cucaauuuuc u
2130322RNAArtificial sequenceHBV RNAi Agent sense strand unmodified
sequence 303gcuguaggca uaaauuggua uu 2230423RNAArtificial
sequenceHBV RNAi Agent sense strand unmodified sequence
304ggcuguaggc auaaauuggu auu 2330523RNAArtificial sequenceHBV RNAi
Agent sense strand unmodified sequence 305aacuguaggc auaaauuggu auu
2330621RNAArtificial sequenceHBV RNAi Agent sense strand unmodified
sequence 306ugguggacuu cucucaauau u 2130722RNAArtificial
sequenceHBV RNAi Agent sense strand unmodified sequence
307gugguggacu ucucucaaua uu 2230823RNAArtificial sequenceHBV RNAi
Agent sense strand unmodified sequence 308aaugguggac uucucucaau auu
2330923RNAArtificial sequenceHBV RNAi Agent sense strand unmodified
sequence 309cgugguggac uucucucaau auu 2331021RNAArtificial
sequenceHBV RNAi Agent sense strand unmodified sequence
310gugguggacu ucucucaaau u 2131122RNAArtificial sequenceHBV RNAi
Agent sense strand unmodified sequence 311cgugguggac uucucucaaa uu
2231223RNAArtificial sequenceHBV RNAi Agent sense strand unmodified
sequence 312aaguggugga cuucucucaa auu 2331323RNAArtificial
sequenceHBV RNAi Agent sense strand unmodified sequence
313ucguggugga cuucucucaa auu 2331423RNAArtificial sequenceHBV RNAi
Agent sense strand unmodified sequence 314cucguggugg acuucucuca aua
2331525RNAArtificial sequenceHBV RNAi Agent sense strand unmodified
sequence 315cucguggugg acuucucuca auauu 2531623RNAArtificial
sequenceHBV RNAi Agent sense strand unmodified sequence
316gaggcuguag gcauaaauug gua 2331725RNAArtificial sequenceHBV RNAi
Agent sense strand unmodified sequence 317gaggcuguag gcauaaauug
guauu 2531819RNAArtificial sequenceHBV RNAi Agent
sense strand unmodified sequence 318ggacuucucu caauuuucu
1931922RNAArtificial sequenceHBV RNAi Agent sense strand unmodified
sequence 319gguggacuuc ucucaauuuu cu 2232019RNAArtificial
sequenceHBV RNAi Agent sense strand unmodified sequence
320ggacuucucu caauuuuca 1932121RNAArtificial sequenceHBV RNAi Agent
sense strand unmodified sequence 321guggacuucu cucaauuuuc a
2132219RNAArtificial sequenceHBV RNAi Agent sense strand unmodified
sequence 322gcuguaggca uaaauuggu 1932320RNAArtificial sequenceHBV
RNAi Agent sense strand unmodified sequence 323ggcuguaggc
auaaauuggu 2032422RNAArtificial sequenceHBV RNAi Agent sense strand
unmodified sequence 324gaggcuguag gcauaaauug gu
2232519RNAArtificial sequenceHBV RNAi Agent sense strand unmodified
sequence 325gcuguaggca uaaauugga 1932620RNAArtificial sequenceHBV
RNAi Agent sense strand unmodified sequence 326ggcuguaggc
auaaauugga 2032721RNAArtificial sequenceHBV RNAi Agent sense strand
unmodified sequence 327agcuguaggc auaaauuggu a 2132821RNAArtificial
sequenceHBV RNAi Agent sense strand unmodified sequence
328cgcuguaggc auaaauuggu a 2132921RNAArtificial sequenceHBV RNAi
Agent sense strand unmodified sequence 329ggcuguaggc auaaauuggu u
2133021RNAArtificial sequenceHBV RNAi Agent sense strand unmodified
sequence 330aggcuguagg cauaaauugg u 2133121RNAArtificial
sequenceHBV RNAi Agent sense strand unmodified sequence
331aggcuguagg cauaaauugg a 2133221RNAArtificial sequenceHBV RNAi
Agent sense strand unmodified sequence 332cggcuguagg cauaaauugg u
2133321RNAArtificial sequenceHBV RNAi Agent sense strand unmodified
sequence 333cggcuguagg cauaaauugg a 2133421RNAArtificial
sequenceHBV RNAi Agent sense strand unmodified sequence
334cccuguaggc auaaauuggu a 21
* * * * *