U.S. patent application number 16/298818 was filed with the patent office on 2019-08-22 for small molecule therapeutic compounds that reduce the incidence of intracerebral hemorrhage and brain microhemmorhages.
The applicant listed for this patent is ZebraPeutics Inc.. Invention is credited to Andrew Baker, R. Loch MacDonald, Tom A. Schweizer, Xiao-Yan Wen.
Application Number | 20190255076 16/298818 |
Document ID | / |
Family ID | 61073723 |
Filed Date | 2019-08-22 |
![](/patent/app/20190255076/US20190255076A1-20190822-C00001.png)
![](/patent/app/20190255076/US20190255076A1-20190822-C00002.png)
![](/patent/app/20190255076/US20190255076A1-20190822-C00003.png)
![](/patent/app/20190255076/US20190255076A1-20190822-C00004.png)
![](/patent/app/20190255076/US20190255076A1-20190822-C00005.png)
![](/patent/app/20190255076/US20190255076A1-20190822-C00006.png)
![](/patent/app/20190255076/US20190255076A1-20190822-C00007.png)
![](/patent/app/20190255076/US20190255076A1-20190822-C00008.png)
![](/patent/app/20190255076/US20190255076A1-20190822-C00009.png)
![](/patent/app/20190255076/US20190255076A1-20190822-D00001.png)
![](/patent/app/20190255076/US20190255076A1-20190822-D00002.png)
View All Diagrams
United States Patent
Application |
20190255076 |
Kind Code |
A1 |
Wen; Xiao-Yan ; et
al. |
August 22, 2019 |
SMALL MOLECULE THERAPEUTIC COMPOUNDS THAT REDUCE THE INCIDENCE OF
INTRACEREBRAL HEMORRHAGE AND BRAIN MICROHEMMORHAGES
Abstract
The described invention relates to small molecule therapeutic
compounds capable of reducing the incidence of intracerebral
hemorrhage and brain microhemorrhages identified using zebrafish
and mouse models of intracerebral hemorrhage and brain
microhemorrhages.
Inventors: |
Wen; Xiao-Yan; (Toronto,
CA) ; MacDonald; R. Loch; (Scottsdale, AZ) ;
Baker; Andrew; (Toronto, CA) ; Schweizer; Tom A.;
(Oakville, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
ZebraPeutics Inc. |
Toronto |
|
CA |
|
|
Family ID: |
61073723 |
Appl. No.: |
16/298818 |
Filed: |
March 11, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15667423 |
Aug 2, 2017 |
10292991 |
|
|
16298818 |
|
|
|
|
62370077 |
Aug 2, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 31/357 20130101;
A61K 31/366 20130101; A61K 31/4545 20130101; A61K 31/567 20130101;
C07J 1/0096 20130101; A61P 9/00 20180101; A61K 31/4422 20130101;
A61K 31/58 20130101; A61P 9/14 20180101; A61K 31/585 20130101; C07J
73/003 20130101 |
International
Class: |
A61K 31/585 20060101
A61K031/585; A61P 9/00 20060101 A61P009/00; A61P 9/14 20060101
A61P009/14; A61K 31/58 20060101 A61K031/58; A61K 31/567 20060101
A61K031/567; C07J 1/00 20060101 C07J001/00; A61K 31/4422 20060101
A61K031/4422; A61K 31/366 20060101 A61K031/366; A61K 31/357
20060101 A61K031/357; C07J 73/00 20060101 C07J073/00; A61K 31/4545
20060101 A61K031/4545 |
Claims
1. A method for reducing incidence of vascular leakage in the brain
comprising administering to a subject in need thereof a
pharmaceutical composition containing a small molecule therapeutic
compound selected from the group consisting of artemisinin or a
derivative of artemisinin, a therapeutic amount of which is
effective to reduce incidence of bleeding in the brain, wherein the
brain vascular leakage is an induced brain microhemorrhage or a
spontaneous intracerebral hemorrhage.
2. The method according to claim 1, wherein the derivative of
artemisinin is dihydroartemisinin, artemether, or artesunate.
3. The method according to claim 1, wherein the small molecule
therapeutic compound is selected from the group consisting of
benidipine, lacidipine, ethynylestradiol or triptolide.
4. The method according to claim 1, wherein the vascular leakage is
an induced vascular leakage, an induced brain hemorrhage or a brain
microhemorrhage.
5. The method according to claim 1, wherein the vascular leakage is
induced by a statin, by a lipopolysaccharide, or both.
6. The method according to claim 4, wherein the statin is
atorvastatin.
7. The method according to claim 1, wherein the vascular leakage is
a spontaneous intracerebral hemorrhage.
8. The method according to claim 1, wherein the brain vascular
leakage is aging-related or related to a neural degenerative
disease.
9. The method according to claim 6, wherein the spontaneous
intracerebral hemorrhage occurs in association with a mutation of
one or more genes selected from beta-pix, Pak2a, cdh5, ccm1, ccm2,
ccm3, and Rap1b.
10. The method according to claim 1, wherein the vascular leakage
includes a brain microhemorrhage.
11. The method according to claim 8, wherein the brain
microhemorrhage occurs in association with administration of a
statin.
12. The method according to claim 1, wherein the vascular leakage
comprises a brain vascular malformation.
13. The method according to claim 10, wherein the brain vascular
malformation is a cerebral cavernous malformation.
14. The method according to claim 1, wherein the brain hemorrhage
or brain microhemorrhage is induced by dysfunction of .beta.3
integrin signaling.
15. The method according to claim 14, wherein the dysfunction of
.beta.3 integrin signaling is associated with a disease state
selected from the group consisting of a spontaneous intracerebral
hemorrhage, an aging-related vascular leakage, an aging-related
hemorrhage, an aging-related microhemorrhage, a vascular leakage
from a neural degenerative disease, a hemorrhage from a neural
degenerative disease, a microhemorrhage from a neural degenerative
disease, a brain vascular malformation, or a cerebral cavernous
malformation.
16. A method for screening compounds effective to reduce incidence
of a vascular leakage in brain comprising (i) administering to a
zebrafish embryo a pharmaceutical composition containing a statin
or LPS; (ii) inducing in the zebrafish embryo a vascular leakage or
a brain hemorrhage; and (iii) administering to the zebrafish embryo
a compound effective to reduce incidence of the vascular leakage or
brain hemorrhage.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of copending application
number 15/667,423 (filed Aug. 2, 2017), which claims the benefit of
priority to U.S. provisional application No. 62/370,077 (filed Aug.
2, 2016), entitled SMALL MOLECULE THERAPEUTIC COMPOUNDS THAT REDUCE
THE INCIDENCE OF INTRACEREBRAL HEMORRHAGE AND BRAIN
MICROHEMORRHAGES. Each of these applications is incorporated by
reference herein in its entirety
FIELD OF THE INVENTION
[0002] The described invention relates to small molecule
therapeutic compounds capable of reducing the incidence of
intracerebral hemorrhage and brain microhemorrhages.
BACKGROUND
[0003] Many pathologic conditions cause a destabilization of the
vascular network resulting in endothelial hyperpermeability,
excessive vascular sprouting, and angiogenesis. (Smith VICP, Li,
DY, Whitehead, KJ (2010) "Mechanisms of vascular stability and the
relationship to human disease," Curr. Opin. Hematol. 17(30:
237-44).
Basal Vascular permeability (BVP)
[0004] Vascular permeability is an extremely complex process that,
in different settings, involves distinctly different types of blood
vessels and makes use of different anatomic and molecular
pathways.
[0005] While the vascular system of higher organisms is often
described as "closed", it needs to be sufficiently "open" (i.e.,
"permeable") to allow the ready exchange of small molecules (gases,
nutrients, waste products) with the tissues. (Nagy, J. A.,
Benjamin, L., Zeng, H , Dvorak, A. M., Dvorak, H. F. (2008)
"Vascular permeability, vascular hyperpermeability and
angiogenesis," Angiogenesis 11(2): 109-119). Plasma proteins also
need to cross the normal vascular barrier, at least in small
amounts.
[0006] Permeability, meaning the net amount of a solute, typically
a macromolecule, that has crossed a vascular bed and accumulated in
the interstitium in response to a vascular permeabilizing agent or
at a site of pathological angiogenesis, is an extremely complicated
process that is affected by many different variables. Id. These
include the intrinsic properties of the different types of
microvessels involved (capillaries, venules, mother vessels (MV));
the size, shape, and charge of extravasating molecules; the
anatomic pathways molecules take in crossing the endothelial cell
barrier; the time course over which permeability is measured; and
the animals and vascular beds that are being investigated. Id.
[0007] Basal Vascular Permeability (BVP)
[0008] Molecular exchange in normal tissues takes place primarily
in capillaries, largely by diffusion. The molecules exchanged
consist largely of gases (O.sub.2 and CO.sub.2), water, small
molecules such as salts and sugars, and only small amounts of
plasma proteins. Id. The extent of BVP varies considerably in
different normal tissues and is subject to substantial change in
response to changes in hydrostatic pressure, opening of closed
vessels, surface area available for exchange, blood flow, etc.
Id.
[0009] Water and lipophilic solutes (e.g., gases such as O.sub.2
and CO.sub.2) are able to diffuse through endothelial cells; they
also pass readily through inter-endothelial cell junctions and
through endothelial fenestrae. Id. Small lipophilic molecules can
also dissolve in endothelial cell membranes and so pass from the
vascular lumen to the interstitium. Id. Capillary endothelial cells
contain large numbers of small (about 70 nm diameter) vesicles
(caveolae) the majority of which are found connected to the luminal
and abluminal plasma membranes by means of stomata that are
generally closed by thin diaphragms containing plasmalemmal vesicle
associated protein (PV-1), an endothelial-specific integral
membrane glycoprotein associated with the stomatal diaphragms of
vaveolae, transendothelial channels, and vesiculo-vacuolar
organelles and the diaphragms of endothelial fenestrae. (Stan, R V,
Tkachenko, E., Niesman, I R, (2004), "PV1 is a key structural
component for the formation of the stomatal and fenestral
diaphragms," Mol. Biol. Cell 15(8): 3615-30). Others are in the
cytoplasm.
[0010] Acute Vascular Hyperpermeability (AVH)
[0011] A rapid increase in vascular permeability occurs when the
microvasculature is exposed acutely to any of a number of vascular
permeabilizing factors, for example, VEGF-A, histamine, serotonin,
PAF, etc. Some of these agents (e.g., histamine, serotonin, VEGF-A)
are normally stored in tissue mast cells (Nagy, J. A., Benjamin,
L., Zeng, H., Dvorak, A. M., Dvorak, H. F. (2008) "Vascular
permeability, vascular hyperpermeability and angiogenesis,"
Angiogenesis 11(2): 109-119, citing Boesiger J, Tsai M, Maurer M et
al (1998) Mast cells can secrete vascular permeability
factor/vascular endothelial cell growth factor and exhibit enhanced
release after immunoglobulin E-dependent upregulation of fc epsilon
receptor I expression. J Exp Med 188:1135-1145; Galli S J (2000)
Mast cells and basophils. Curr Opin Hematol 7:32-39; Galli S J
(1997) The Paul Kallos Memorial Lecture. The mast cell: a versatile
effector cell for a challenging world. Int Arch Allergy Immunol
113:14-22) and so may be released by agents that cause mast cell
degranulation, e.g., allergy, insect bites, etc. Single exposure to
any of these permeability factors results in a rapid but
self-limited (complete by 20-30 min) influx of plasma into the
tissues.
[0012] The quantity of extravasated fluid in AVH is greatly
increased above that found in BVP and its composition is greatly
changed. The fluid that extravasates in AVH is rich in plasma
proteins, approaching the levels found in plasma, and is referred
to as an exudate. Id. Among the plasma proteins that extravasate
are fibrinogen and various members of the blood clotting cascade.
Id. When these come into contact with tissue factor, a protein that
is normally expressed by many interstitial cells, the clotting
system is activated and the exudate clots to deposit fibrin (Id.
Citing Dvorak H F, Quay S C, Orenstein N S et al (1981) Tumor
shedding and coagulation. Science 212:923-924; VanDeWater L, Tracy
P B, Aronson D et al (1985) Tumor cell generation of thrombin via
functional prothrombinase assembly. Cancer Res 45:5521-5525).
Fibrin forms a gel that traps water and other solutes, restraining
their clearance by lymphatics or capillaries and resulting in
tissue swelling (edema). Id. As long as the permeability stimulus
is not continuous, the deposited fibrin is rapidly degraded without
further consequences. Id.
[0013] AVH also differs from BVP in that the vascular leakage takes
place from post-capillary venules, highly specific vessels just
downstream of capillaries (Id. Citing Majno G, Palade G E, Schoefl
G I (1961) Studies on inflammation. II. The site of action of
histamine and serotonin along the vascular tree: a topographic
study. J Biophys Biochem Cytol 11:607-626; Majno G, Shea S M,
Leventhal M (1969) Endothelial contraction induced by
histamine-type mediators: an electron microscopic study. J Cell
Biol 42:647-672). It has been proposed that histamine and other
vascular permeabilizing agents induce endothelial cells to contract
and pull apart to form intercellular (paracellular) gaps of
sufficient size to permit plasma-protein extravasation. Id. In
addition, venular epithelium contains a structure, the
vesiculo-vacuolar organelle (VVO), that offers an alternative,
trans-endothelial cell route for plasma extravasation in response
to permeability factors (Id. citing Kohn S, Nagy J A, Dvorak H F et
al (1992) Pathways of macromolecular tracer transport across
venules and small veins. Structural basis for the hyperpermeability
of tumor blood vessels. Lab Invest 67:596-607; Dvorak A M, Kohn S,
Morgan E S et al (1996) The vesiculo-vacuolar organelle (VVO): a
distinct endothelial cell structure that provides a transcellular
pathway for macromolecular extravasation. J Leukoc Biol 59:100-115;
Feng D, Nagy J, Dvorak A et al (2000) Different pathways of
macromolecule extravasation from hyperpermeable tumor vessels.
Microvascular Research 59:24-37; Feng D, Nagy J A, Hipp J et al
(1996) Vesiculo-vacuolar organelles and the regulation of venule
permeability to macromolecules by vascular permeability factor,
histamine, and serotonin. J Exp Med 183:1981-1986; Feng D, Nagy J
A, Hipp J et al (1997) Reinterpretation of endothelial cell gaps
induced by vasoactive mediators in guinea-pig, mouse and rat: many
are transcellular pores. J Physiol 504(Pt 3):747-761). VVOs, which
are grape-like clusters comprised of hundreds of uncoated,
cytoplasmic vesicles and vacuoles that together form an organelle
that traverses venular endothelial cytoplasm, often extend to
inter-endothelial cell interfaces and their individual vesicles
(unlike caveolae) commonly open to the inter-endothelial cell
cleft. Id. The vesicles and vacuoles comprising VVOs vary in size
from those the size of caveolae to vacuoles with volumes as much as
10-fold larger (Feng D, Nagy J A, Pyne K et al (1999) Pathways of
macromolecular extravasation across microvascular endothelium in
response to VPF/VEGF and other vasoactive mediators.
Microcirculation 6:23-44). These vesicles and vacuoles are linked
to each other and to the luminal and abluminal plasma membranes by
stomata that are normally closed by thin diaphragms that appear
similar to those found in caveolae. Id. It has been proposed that
vascular permeability inducing agents cause the diaphragms
interconnecting vesicles and vacuoles to open, thereby providing a
transcellular pathway for plasma and plasma-protein extravasation.
Id.
[0014] Chronic Vascular Hyperpermeability (CVH)
[0015] Chronic exposure to permeability factors results in profound
changes in venular structure and function that lead to the chronic
hyperpermeability of pathological angiogenesis as found in tumors,
healing wounds, and chronic inflammatory diseases such as
rheumatoid arthritis, psoriasis, cellular immunity, etc. (Id.
Citing Dvorak H F (2003) Rous-Whipple award lecture. How tumors
make bad blood vessels and stroma. Am J Pathol 162:1747-1757; Nagy
J A, Masse E M, Herzberg K T et al (1995) Pathogenesis of ascites
tumor growth: vascular permeability factor, vascular
hyperpermeability, and ascites fluid accumulation. Cancer Res
55:360-368). As in AVH, the fluid that extravasates is an exudate
that approaches the overall composition of plasma. In tumors fluid
accumulation is generally associated with increased interstitial
pressure (Id. Citing Jain R K (1988) Determinants of tumor blood
flow: a review. Cancer Res 48:2641-2658); this increased pressure
results from persistent vascular hyperpermeability, clotting of the
exudate with deposition of a fluid-trapping fibrin gel, inadequate
lymphatic drainage, and the restraints imposed by surrounding
tissues that together limit fluid dissipation. Id. These restraints
are nearly absent when tumors grow in or around body cavities such
as the peritoneum where massive amounts of ascites fluid can
accumulate. Id.
[0016] In contrast to BVP and AVH, fluid leakage in CVH does not
take place from any type of normal blood vessel. Instead, whether
in tumors or wounds, the blood vessels that leak are newly formed,
angiogenic blood vessels; these are primarily mother vessels (MV),
and also, to a lesser extent, glomeruloid microvascular
proliferations (GMP) that form from MV (Id. Citing Nagy J A, Feng
D, Vasile E et al (2006) Permeability properties of tumor surrogate
blood vessels induced by VEGF-A. Lab Invest 86:767-780; Pettersson
A, Nagy J A, Brown L F et al (2000) Heterogeneity of the angiogenic
response induced in different normal adult tissues by vascular
permeability factor/vascular endothelial growth factor. Lab Invest
80:99-115; Sundberg C, Nagy J A, Brown L F et al (2001) Glomeruloid
microvascular proliferation follows adenoviral vascular
permeability factor/vascular endothelial growth factor-164 gene
delivery. Am J Pathol 158:1145-1160; Brown L F, Detmar M, Claffey K
et al (1997) Vascular permeability factor/vascular endothelial
growth factor: a multifunctional angiogenic cytokine. Exs
79:233-269; Brown L F, Yeo K T, Berse B et al (1992) Expression of
vascular permeability factor (vascular endothelial growth factor)
by epidermal keratinocytes during wound healing. J Exp Med
176:1375-1379; Ren G, Michael L H, Entman M L et al (2002)
Morphological characteristics of the microvasculature in healing
myocardial infarcts. J Histochem Cytochem 50:71-79. Mother Vessels
are greatly enlarged sinusoids that arise from preexisting normal
venules by a process that involves pericyte detachment, vascular
basal lamina degradation, and a 4-5-fold increase in lumen size
that is accompanied by extensive endothelial cell thinning. Id.
Notwithstanding that Poiseuille's law indicates that blood flow
(flow rate) is proportional to the fourth power of the vascular
radius, MV exhibit sluggish blood flow because of their
hyperpermeability to plasma which results in a striking increase in
hematocrit. Id. The protein-rich exudates in CVH interact with
tissue factor to trigger the clotting system and deposit fibrin
(Id. Citing Dvorak H F, Quay S C, Orenstein N S et al (1981) Tumor
shedding and coagulation. Science 212:923-924; VanDeWater L, Tracy
P B, Aronson D et al (1985) Tumor cell generation of thrombin via
functional prothrombinase assembly. Cancer Res 45:5521-5525).
[0017] Tissue factor is expressed on many tumor cells as well as
host interstitial cells and is induced in endothelial cells by
VEGF-A (Id). In addition to its fluid trapping properties, fibrin
also has a number of other properties when it persists over time as
in tumors and healing wounds. It provides a pro-angiogenic
provisional stroma that induces and is later replaced by the
ingrowth of new blood vessels and fibroblasts and the laying down
of mature fibro-vascular stroma (Id. Citing Dvorak H F (2003)
Rous-Whipple award lecture. How tumors make bad blood vessels and
stroma. Am J Pathol 162:1747-1757; Dvorak H F, Orenstein N S,
Carvalho A C et al (1979) Induction of a fibrin-gel investment: an
early event in line 10 hepatocarcinoma growth mediated by
tumor-secreted products. J Immunol 122:166-174; Dvorak H F, Dvorak
A M, Manseau E J et al (1979) Fibrin gel investment associated with
line 1 and line 10 solid tumor growth, angiogenesis, and
fibroplasia in guinea pigs. Role of cellular immunity,
myofibroblasts, microvascular damage, and infarction in line 1
tumor regression. J Natl Cancer Inst 62:1459-1472). Fibrin
interacts with integrins expressed by multiple cell types, thereby
supporting the migration of tumor cells as well as host mesenchymal
cells (endothelial cells, pericytes, fibroblasts) and inflammatory
cells (neutrophils, monocytes). Id. Fibrin also sequesters growth
factors, protecting them from degradation, and induces the
expression of proangiogenic molecules such as IL-8 and tissue
factor. Id. Fragment E, a fibrin breakdown product, is directly
pro-angiogenic (Id.). Macromolecules extravasate from MV and GMP
largely via a transcellular route (Id. Citing Nagy J A, Feng D,
Vasile E et al (2006) Permeability properties of tumor surrogate
blood vessels induced by VEGF-A. Lab Invest 86:767-780).
[0018] In short, while agents such as VEGF-A have long been known
to induce AVH and CVH, apart from hemodynamic factors, much less is
known about the molecular events that are responsible for the
normal permeability of BVP, and even less is known about the
molecules that are involved in regulating permeability, and the
molecular mechanisms that govern each of the different types of
permeability may well be different. The signaling pathways by which
even such well-studied molecules as eNOS and caveolin-1 act to
induce permeability are poorly understood. Id. Little is known
about the molecular mechanisms that regulate such critical events
as caveolar shuttling, the opening of VVO diaphragms, the formation
of fenestrae, changes in endothelial cell junctions, etc. (Id.
Citing Dejana E (2004) Endothelial cell-cell junctions: happy
together. Nat Rev Mol Cell Biol 5:261-270; Oh P, Borgstrom P,
Witkiewicz H et al (2007) Live dynamic imaging of caveolae pumping
targeted antibody rapidly and specifically across endothelium in
the lung. Nat Biotechnol 25:327-337; Ioannidou S, Deinhardt K,
Miotla J et al (2006) An in vitro assay reveals a role for the
diaphragm protein PV-1 in endothelial fenestra morphogenesis. Proc
Natl Acad Sci USA 103:16770-16775).
[0019] Angiogenesis
[0020] Angiogenesis is a process of neovascular formation from
pre-existing blood vessels during embryogenesis, adult tissue
homeostasis and carcinogenesis. (Katoh, M., (2013) "Therapeutics
targeting angiogenesis: genetics and epigenetics, extracellular
miRNAs and signaling networks," Intl J. Mol. Med. 32(4): 763-67,
citing Carmeliet P. (2005) Angiogenesis in life, disease and
medicine. Nature. 438:932-936; Ferrara N, Kerbel R S. (2005)
Angiogenesis as a therapeutic target. Nature. 438:967-974; Folkman
J. (2007) Angiogenesis: an organizing principle for drug discovery?
Nat Rev Drug Discov. 6:273-286; Carmeliet P, Jain R K. (2011)
Molecular mechanisms and clinical applications of angiogenesis.
Nature. 473:298-307). It is distinct from vasculogenesis which is
the developmental in situ differentiation and growth of blood
vessels from mesodermal derived hemangioblasts.
[0021] Angiogenesis occurs in multiple steps as follows: i)
vascular destabilization induced by degradation of the basement
membrane and decreased adhesion of endothelial cells; ii)
angiogenic sprouting resulting from the migration of endothelial
tip cells and the proliferation of endothelial stalk cells; iii)
lumen formation by endothelial cells and the recruitment of
pericytes to the surrounding region of the endothelial lumen; iv)
vascular stabilization depending on tight junctions and basement
membrane. (Katoh, M., (2013) "Therapeutics targeting
angiogenesis--genetics and epigenetics, extracellular miRNAs and
signaling networks," Intl J. Mol. Med. 32(4): 763-67, citing
Carmeliet P. (2005) Angiogenesis in life, disease and medicine.
Nature. 438:932-936).
[0022] Vascular endothelial growth factor (VEGF), fibroblast growth
factor (FGF2), angiopoietins (ANGPT1 and ANGPT2), Notch ligands
[jagged 1 (JAG1) and Delta like ligand 4 (DLL4)] and transforming
growth factor-.beta. (TGF-.beta.) regulate angiogenesis through
their receptors on vascular endothelial cells. VEGF activates the
endothelial nitric acid oxide synthase (eNOS), SRC, RAS-ERK and
PI3K-AKT signaling cascades through VEGFR2 receptor on endothelial
cells, which induce vascular permeability, endothelial migration,
proliferation and survival, respectively (Id. Citing Coultas L,
Chawengsaksophak K, Rossant J. (2005) "Endothelial cells and VEGF
in vascular development." Nature. 438:937-945; Olsson A K, Dimberg
A, Kreuger J, Claesson-Welsh L. (2006) "VEGF receptor signaling-in
control of vascular function." Nat Rev Mol Cell Biol. 7:359-371).
FGF2 promotes angiogenesis directly through FGFR1 receptor on
endothelial cells via signaling cascades similar to VEGF, or
indirectly through VEGF secretion from endothelial cells,
cardiomyocytes and stromal cells (Id. Citing Presta M, Dell'Era P,
Mitola S, et al. (2005) "Fibroblast growth factor/fibroblast growth
factor receptor system in angiogenesis." Cytokine Growth Factor
Rev. 16:159-178). ANGPT1, secreted from pericytes, activates
TEK/TIE2 receptor to maintain endothelial quiescence or
stabilization, whereas ANGPT2, secreted from endothelial cells
themselves by VEGF or hypoxia signaling, inhibits TEK to promote
endothelial activation or sprouting (Id. Citing Fagiani E,
Christofori G. (2013) "Angiopoietins in angiogenesis." Cancer Lett.
328:18-26). JAG1-Notch signaling promotes angiogenic sprouting,
whereas DLL4-Notch signaling inhibits angiogenic sprouting (Id.
Citing Bridges E, Oon C E, Harris A. (2011) "Notch regulation of
tumor angiogenesis." Future Oncol. 7:569-588). TGF-.beta. signaling
through TGFBR1/ALK5 receptor to the Smad2/3 cascade inhibits
endothelial cell activation, maintaining endothelial quiescence,
whereas TGF-.beta. signaling through the ACVRL1/ALK1 receptor to
the Smad1/5 cascade promotes the migration and proliferation of
endothelial cells (Id. Citing Gaengel K, Genove G, Armulik A,
Betsholtz C. (2009) "Endothelial-mural cell signaling in vascular
development and angiogenesis." Arterioscler Thromb Vasc Biol.
29:630-638). The VEGF, FGF, Notch and TGF-.beta. signaling cascades
are directly involved in the angiogenic signaling of endothelial
cells (Id).
[0023] The VEGF, FGF, Notch and TGF-.beta. signaling cascades
cross-talk with WNT and Hedgehog signaling cascades to constitute
the stem-cell signaling network (Id. Citing Katoh M, Katoh M.
(2007) "WNT signaling pathway and stem cell signaling network."
Clin Cancer Res. 13:4042-4045; Katoh Y, Katoh M. (2008) "Hedgehog
signaling, epithelial-to-mesenchymal transition and miRNA," Int J
Mol Med. 22:271-275). DVL2-binding deubiquitinase FAM105B regulates
WNT signaling and angiogenesis (Id. Citing Rivkin E, Almeida S M,
Ceccarelli D F, et al. (2013) "The linear ubiquitin-specific
deubiquitinase gumby regulates angiogenesis." Nature 498:318-324),
while Hedgehog signaling is involved in the regulation of liver
sinusoidal endothelial cells (Id. Citing Diehl A M. (2012)
"Neighborhood watch orchestrates liver regeneration." Nat Med.
18:497-499). FGF, Notch and canonical WNT signaling are involved in
cell-fate determination based on mutual transcriptional regulation,
whereas FGF, Notch, TGF-.beta., Hedgehog and non-canonical WNT
signaling are involved in epithelial-to-mesenchymal transition
(EMT) due to the upregulation of SNAI1 (Snail), SNAI2 (Slug), ZEB1,
ZEB2 and TWIST (Katoh, M., Nakagama, H., (2014) "FGF receptors:
cancer biology and therapeutics," Med. Res. Rev. 34(2): 280-300).
EMT is a cellular process similar to endothelial-to-mesenchymal
transition (EndMT). Hypoxia induces angiogenesis as a result of
VEGF upregulation (Dewhirst M W, Cao Y, Moeller B. (2008) "Cycling
hypoxia and free radicals regulate angiogenesis and radiotherapy
response." Nat Rev Cancer. 8:425-437). Angiogenesis is orchestrated
by the VEGF, FGF, Notch, TGF-.beta., Hedgehog and WNT signaling
cascades, which directly or indirectly regulate the quiescence,
migration and proliferation of endothelial cells.
[0024] During the earliest stages of angiogenesis, such as in
response to the angiogenic cytokine VEGF induced by wounding and
ischemia, vascular basement membrane is degraded (Senger, D R, and
David, G E, (2011) "Angiogenesis," Cold Spring Harb. Perspect.
Biol. August 3(8): a005090 citing Sundberg, C. et al. (2001)
"Glomeruloid microvascular proliferation follows adenoviral
vascular permeability factor/VEGF-164 gene delivery," Am J Pathol
158: 1145-1160; Rowe, R G and Weiss, S J (2008) "Breaching the
basement membrane: Who, when and how?" Trends Cell Biol 18:
560-574; Chang S H et al. (2009) "VEGF-A induces angiogenesis by
perturbing the cathepsin-cysteine protease inhibitor balance in
venules, causing basement membrane degradation and mother vessel
formation," Cancer Res 69: 4537-4544). Following disruption of
basement membrane, and with the ensuing stage known as vascular
sprouting (Id. Citing Nicosia, R F and Madri, J A (1987) "The
microvascular extracellular matrix. Developmental changes during
angiogenesis in the aortic ring-plasma clot model." Am J Pathol
128: 78-90)), vessels become leaky and hyperpermeable to blood
plasma proteins (Id. Citing Sundberg, C. et al. (2001) "Glomeruloid
microvascular proliferation follows adenoviral vascular
permeability factor/vascular endothelial growth factor-164 gene
delivery." Am J Pathol 158: 1145-1160). This vascular
hyperpermeability causes leakage of the plasma proteins fibrinogen,
vitronectin, and fibronectin from the blood (Id. Citing Senger, D R
(1996) "Cell migration promoted by a potent GRGDS-containing
thrombin-cleavage fragment of osteopontin." Biochim Biophys Acta
1314: 13-24; Sundberg, C. et al. (2001) "Glomeruloid microvascular
proliferation follows adenoviral vascular permeability
factor/vascular endothelial growth factor-164 gene delivery." Am J
Pathol 158: 1145-1160). Fibrinogen is subsequently converted to
fibrin through enzymatic coagulation, and together with
extravasated vitronectin and fibronectin instantly transform the
interstitial collagen matrix to form a new, provisional ECM. Thus,
the early stages of sprouting angiogenesis are generally believed
to proceed in an environment rich in preexisting interstitial
collagens in combination with fibrin, vitronectin, and fibronectin
derived from the blood plasma. As vascular morphogenesis proceeds
and vascular sprouts acquire lumens and mature, neovessels are
again enshrouded in vascular basement membrane with associated
pericytes and thereby achieve stability (Id. Citing Grant, D S and
Kleinman, H K (1997) "Regulation of capillary formation by laminin
and other components of the extracellular matrix." EXS 79: 317-333;
Benjamin, L E et al. (1999) "Selective ablation of immature blood
vessels in established human tumors follows vascular endothelial
growth factor withdrawal." J Clin Invest 103: 159-165). Pericyte
recruitment to vascular tubes directly controls this basement
membrane assembly step in vitro and in vivo (Id. Citing Stratman, A
N et al. (2009) "Pericyte recruitment during vasculogenic tube
assembly stimulates endothelial basement membrane matrix
formation." Blood 114: 5091-5101; Stratman, A N et al. (2010)
"Endothelial-derived PDGF-BB and HB-EGF coordinately regulate
pericyte recruitment during vasculogenic tube assembly and
stabilization." Blood 116: 4720-4730). Thus, in response to
stimulation with angiogenic cytokines, angiogenesis in the adult is
generally believed to proceed through the following basic stages:
(1) degradation of vascular basement membrane and activation of
quiescent endothelial cells (ECs); (2) sprouting and proliferation
of ECs within provisional ECM; (3) lumen formation within the
vascular sprouts, thereby creating vascular tubes; and (4) coverage
of vascular tubes with mature vascular basement membrane in
association with supporting pericytes.
[0025] Neovascularization
[0026] While often considered synonymous with angiogenesis
(formation of new vessels from existing vessels),
neovascularization involves a much broader series of temporally
controlled vascular processes beginning with angiogenesis and
progressing through multiple phases resulting in the formation of a
new functional circulatory network (LeBlanc, A J et al, (2012)
"Microvascular repair--post-angiogenesis vascular dynamics,"
Microcirculation 19(8): 10.1111/j.1549-8719.2012.00207.x). At the
onset of neovascularization, relevant microvessel segments relax
their stable vessel structure and initiate vessel sprouting leading
to the formation of new vessel segments. (Id). Subsequently, the
newly formed neovessels remodel via vascular cell differentiation
and incorporation of perivascular cells into the newly formed
vessel walls resulting in the appropriate density and distribution
of arterioles, venules, and capillaries. (Id). Finally, the newly
formed vascular network matures and remodels into a more efficient
perfusion circuit that meets tissue perfusion needs and function.
(Id).
[0027] Effective adult tissue neovascularization, whether by native
or therapeutic means, results in an expanded vascular network and
increased blood perfusion pathway length resulting in the
appropriate delivery of more blood to tissues (Id).
[0028] While there is no one stereotypical vascular architecture,
microvascular networks generally involve a branched network of
progressively smaller caliber small arteries/arterioles at the
inflow side delivering blood to the distal capillaries which
subsequently drain into a branched network of increasingly larger
caliber outflow venules/small veins, although there are variations
of this basic network organization, often reflecting tissue and/or
organ specific function (Id). Each of the three general vascular
compartments (arterioles, capillaries, and venules) performs
different functions in the microcirculation due to their structural
and functional characteristics and their locations within the
vasculature (Id). Arterioles provide the greatest resistance to
blood flow in the vascular circuit with most of this resistance
attributed to 1st and 2nd branch order arterioles (Id. Citing
Mayrovitz H N, Wiedeman M P, Noordergraaf A. (1975) "Microvascular
hemodynamic variations accompanying microvessel dimensional
changes." Microvasc Res. 10:322-29 Box 1). This is primarily due to
the relative larger diameter differences between the feeding
arteries and the smaller arterioles and the relative fewer numbers
of these proximal arterioles. The more prevalent downstream and
terminal arterioles act to broadly distribute blood throughout the
tissue and control, via vessel tone dynamics, blood flow into the
most distal capillaries. The very small diameters and large numbers
of capillaries make them ideal for supporting effective
blood-tissue exchange of oxygen and other blood nutrients and
molecules. Finally, venules, due in part to a relatively more
compliant wall, serve as a high capacitance drainage system.
Importantly, in a competent microcirculatory bed, as vessel
diameters reduce within a vascular compartment the number of
vessels in that compartment increase due to branching. This results
in a sufficiently large enough cross-sectional area to keep
resistance to blood flow across the compartment relatively low even
though resistance within a single vessel segment might be high (due
to the inverse relationship between resistance and the 4th power of
the radius). Thus, to maintain proper resistances across the
microvasculature, and therefore effective perfusion, proper branch
ordering is critical. In addition, blood flow distribution in a
tissue depends on the extent of branching in a logarithmic fashion
(Mayrovitz H N, Tuma R F, Wiedeman M P. (1977) "Relationship
between microvascular blood velocity and pressure distribution." Am
J Physiol.; 232:H400-5). This normalized relationship between
vessel caliber and vessel numbers (i.e. branching) is a critical
feature of functional microvascular network architectures.
Mismatches in this relationship lead to poor hemodynamic function
typically observed as hypo-perfusion and/or hypoxia within the
tissue. Deficits in blood perfusion (e.g. ischemia, hypoxia) are a
cause of and/or complication associated with a number of disease
states including tissue infarction, necrosis, wound healing, tissue
grafting, and organ dysfunction.
[0029] Microvascular Stability: Rho GTPase Cdc42 has been
Implicated in the Mediation of Endothelial Barrier Function
[0030] Endothelial adherens junctions (AJs) consist of
trans-oligomers of membrane spanning vascular endothelial
(VE)-cadherin proteins, which bind .beta.-catenin through their
cytoplasmic domain (Broman, M T et al (2006) "Cdc42 regulates
adherens junction stability and endothelial permeability by
inducing alpha-catenin interaction with the vascular endothelial
cadherin complex," Cir. Res. 98: 73-80). .beta.-catenin in turn
binds .alpha.-catenin and connects the AJ complex with the actin
cytoskeleton (Id). Rho GTPase Cdc42 regulates AJ permeability by
controlling the binding of .alpha.-catenin with .beta.-catenin and
the consequent interaction of the VE-cadherin/catenin complex with
the actin cytoskeleton (Id). .beta.-catenin and the associated
.alpha.-catenin may then serve as support sites for actin
polymerization, leading to formation of long endothelial plasma
membrane protrusions (Kouklis, P. et al (2003) VE-cadherin-induced
Cdc42 signaling regulates formation of membrane protrusions in
endothelial cells," J. Biol. Chem. 278: 16230-36). Non-junctional
VE-cadherin thus actively participates in inside-out signaling at
the plasma membrane, leading to the development of endothelial
membrane protrusions (Id).
[0031] During inflammation, inflammatory mediators increase
vascular permeability primarily by formation of intercellular gaps
between endothelial cells of post-capillary venules. Spindler, V.
et al (2010) "Role of GTPases in control of microvascular
permeability," Cardiovasc. Res. 87(2): 243-53). Adherens junctions
of endothelial cells need to be dynamic when endothelial junctions
transiently open to allow passage of leukocytes from the blood into
tissues. Rac1 and Cdc42 are the main GTPases required for barrier
maintenance and stabilization. RhoA negatively regulates barrier
properties (i.e., renders the barrier more permeable) under both
resting and inflammatory conditions (Id). Rho GTPases (RhoA, Rac1
and Cdc42) or Rap1 are known to regulate cell adhesion in part by
reorganization of the junction-associated cortical actin
cytoskeleton (Id). Activated Cdc42 functions by counteracting the
canonical RhoA-mediated mechanism of endothelial hyperpermeability
(Ramchandran, R. et al (2008) "Critical role of Cdc42 in mediating
endothelial barrier protection in vivo," Am. J. Physiol. Lung Cell
Mol. Physiol. 295: 363-69), while Rac1-mediated barrier
destabilization in microvascular endothelium appears to be largely
restricted to conditions of enhanced endothelial cell migration and
thus to be more closely related to angiogenesis rather than to
inflammation. (Spindler, V. et al (2010) "Role of GTPases in
control of microvascular permeability," Cardiovasc. Res. 87(2):
243-53)). Recent studies revealed that cAMP signaling, which is
well known to be barrier protective, enhances barrier functions in
part via Rap1-mediated activation of Rac1 and Cdc42 as well as by
inhibition of RhoA. Moreover, barrier-stabilizing mediators
directly activate Rac1 and Cdc42 or increase cAMP levels (Id). On
the other hand, several barrier-disruptive components appear to
increase permeability by reduced formation of cAMP, leading to both
inactivation of Rac1 and activation of RhoA (Id).
[0032] The Cholesterol Biosynthesis Pathway
[0033] The mevalonate arm of the cholesterol biosynthesis pathway,
which includes enzymatic activity in the mitochondria, peroxisome,
cytoplasm and endoplasmic reticulum, starts with the consumption of
acetyl-CoA, which occurs in parallel in 3 cell compartments (the
mitochondria, cytoplasm, and peroxisome) and terminates with the
production of squalene in the endoplasmic reticulum (Mazein, A. et
al. (2013) "A comprehensive machine-readable view of the mammalian
cholesterol biosynthesis pathway," Biochemical Pharmacol. 86:
56-66). The following are enzymes of the mevalonate arm:
[0034] Acetyl-CoA acetyltransferase (ACAT1; ACAT2; acetoacetyl-CoA
thiolase; EC 2.3.1.9) catalyzes the reversible condensation of two
molecules of acetylcoA and forms acetoacetyl-CoA (Id).
[0035] Hydroxymethylglutaryl-CoA synthase (HMGCS1 (cytoplasmic);
HMGCS2 (mitochondria and peroxisome); EC 2.3.3.10 catalyzes the
formation of 3-hydroxy-3-methylglutaryl CoA (3HMG-CoA) from acetyl
CoA and acetoacetyl Co A (Id).
[0036] Hydroxymethylglutaryl-CoA lysase (mitochondrial, HMGCL; EC
4.1.3.4) transforms HMG-CoA into Acetyl-CoA and acetoacetate.
[0037] 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCR; EC
1.1.34) catalyzes the conversion of 3HMG-CoA into mevalonic acid.
This step is the committed step in cholesterol formation. HMGCR is
highly regulated by signaling pathways, including the SREBP pathway
(Id).
[0038] Mevalonate kinase (MVK; ATP: mevalonate
5-phosphotransferase; EC 2.7.1.36) catalyzes conversion of
mevalonate into phosphomevalonate (Id).
[0039] Phosphomevalonate kinase (PMVK; EC 2.7.4.2) catalyzes
formation of mevalonate 5-diphosphate from mevalonate 5-phosphate
(Id).
[0040] Diphosphomevalonate decarboxylase (MVD; mevalonate
(diphospho) decarboxylase; EC 4.1.1.33) decarboxylates mevalonate
5-diphosphate, forming isopentenyldiphosphate while hydrolyzing ATP
(Id).
[0041] Isopentenyl-diphosphate delta-isomerases (ID11; ID12; EC
5.3.3.2) isomerize isopentenyl diphosphate into dimethylallyl
diphosphate, the fundamental building blocks of isoprenoids
(Id).
[0042] Farnesyl diphosphate synthase (FDPS; EC2.5.1.10; EC 2.5.1.1;
dimethylallyltranstransferase) catalyzes two reactions that lead to
farnesyl diphosphate formation. In the first (EC 2.5.1.1 activity),
isopentyl diphosphate and dimethylallyl diphosphate are condensed
to form geranyl disphosphate. Next, geranyl diphosphate and
isopentenyl diphosphate are condensed to form farnesyl diphosphate
(EC 2.5.1.10 activity) (Id).
[0043] Geranylgeranyl pyrophosphate synthase (GGPS1; EC 1.5.1.29;
EC 2.5.1.10; farnesyl diphosphate synthase; EC 2.5.1.1;
dimethylallyltranstransferase) catalyzes the two reactions of
farnesyl diphosphate formation and the addition of three molecules
of isopentenyl diphosphate to dimethylallyl diphosphate to form
geranylgeranyl diphosphate (Id).
[0044] Farnesyl-diphosphate farnesyltransferase 1 (FDFT1; EC
2.5.1.21; squalene synthase) catalyzes a two-step reductive
dimerization of two farnesyl diphosphate molecules (C15) to form
squalene (C30). The FDFT1 expression level is regulated by
cholesterol status; the human FDFT1 gene has a complex promoter
with multiple binding sites for SREBP-1a and SREBP-2 (Id).
[0045] The sterol arms of the pathway start with Squalene and
terminate with cholesterol production on the Bloch and
Kandutsch-Russell pathways and with 24 (S),25-epoxycholesterol on
the shunt pathway (Id). The following are enzymes of the sterol
arms:
[0046] Squalene epoxidase (SQLE; EC 1.14.13.132, squalene
monooxygenase) catalyzes the conversion of squalene into
squalene-2,3-epoxide and the conversion of squalene-2,3-epoxide
(2,3-oxidosqualene) into 2,3:22,23-diepoxysqualene
(2,3:22,23-dioxidosqualene). The first reaction is the first
oxygenation step in the cholesterol biosynthesis pathway. The
second is the first step in 24(S),25-epoxycholesterol formation
from squalene 2,3-epoxide (Id).
[0047] Lanosterol synthase (LSS; OLC; OSC;
2,3-oxidosqualene:lanosterol cyclase; EC 5.4.99.7) catalyzes
cyclization of squalene-2,3-epoxide to lanosterol and
2,3:22,23-depoxysqualene to 24(S),25-epoxylanosterol (Id).
[0048] .DELTA.(24)-sterol reductase (DHCR24; 24-dehydrocholesterol
reductase; EC 1.3.1.72) catalyzes the reduction of the .DELTA.-24
double bond of intermediate metabolites. In particular it converts
lanosterol into 24, 25-dihydrolanosterol, the initial metabolite of
the Kandutsch-Russel pathway and also provides the last step of the
Bloch pathway converting desmosterol into cholesterol.
Intermediates of the Bloch pathway are converted by DHCR24 into
intermediates of the Kandutsch-Russell pathway (Id).
[0049] Lanosterol 14-.alpha. demethylase (CYP51A1; cytochrome P450,
family 51, subfamily A, polypeptide 1; EC 1.14.13.70) converts
lanosterol into
4,4-dimethyl-5.alpha.-cholesta-8,14,24-trien-3.beta.-ol and
24,25-dihydrolanosterol into
4,4-dimethyl-5.alpha.-cholesta-8,14-dien-3.beta.-ol in three steps
(Id).
[0050] Delta (14)-sterol reductase (TM7F2; transmembrane 7
superfamily member 2, EC 1.3.1.70) catalyzes reactions on the three
branches of the cholesterol and 24(S),25-epoxycholesterol pathways
(Id).
[0051] Methylsterol monooxygenase 1 (MSM01; SC4MOL; C-4
methylsterol oxidase; EC 1.14.13.72) catalyzes demethylation of C4
methylsterols (Id).
[0052] Sterol-4-alpha-carboxylate 3-dehydrogenase, decarboxylating
(NSDHL; NAD(P) dependent steroid dehydrogenase-like; EC 1.1.1.170)
participates in several steps of post-squalene cholesterol and
24(S),25-epoxycholeseterol synthesis (Id).
[0053] 3-keto-steroid reductase (HSD17B7; 17-beta-hydroxysteroid
dehydrogenase 7; EC 1.1.1.270) converts zymosterone into zymosterol
in the Bloch pathway (Id).
[0054] 3-.beta.-hydroxysteroid-.DELTA.(8), .DELTA.(7)-isomerase
(EBP; emopamil-binding protein; EC5.3.3.5) catalyzes the conversion
of .DELTA.(8)-sterols into .DELTA.(7)-sterols (Id).
[0055] Lathosterol oxidase (SC5DL; sterol-C5-desaturase (ERG3
.DELTA.-5-desaturase homolog, S. cerevisiae-like; EC 1.14.21.6)
catalyzes the production of 7-dehydrocholesterol,
7-dehydrodesmosterol and 24(S),25-epoxy-7-dehydrocholesterol
(Id).
[0056] 7-dehydrocholesterol reductase (DHCR7; EC 1.3.1.21)
catalyzes reduction of the C7-C8 double bond of
7-dehydrocholesterol and formation of cholesterol, and produces
desmosterol from 7-dehydrodesmosterol and 24(S),25-epoxycholesterol
from 24(S),25-epoxy-7-dehydrocholesterol (Id).
[0057] Cytochrome P450, family 3, subfamily A, polypeptide 4
(CYP3A4; 1,8-cineole 2-exo-monooxygenase; taurochenodeoxycholate
6.alpha.-hydroxylase; EC 1.14.13.97)) catalyzes the hydroxylation
of cholesterol leading to 25-hydroxycholesterol and
4.beta.-hydroxycholesterol (Id).
[0058] Cholesterol 25-hydroxylase (CH25H; cholesterol
25-monooxygenase; EC 1.14.99.38) uses di-iron cofactors to catalyze
the hydroxylation of cholesterol to produce 25-hydroxycholesterol,
and has the capacity to catalyze the transition of
24-hydroxycholesterol to 24, 25-dihydroxycholesterol (Id).
[0059] Cytochrome P450, family 7, subfamily A, polypeptide 1
(CYP7A1; cholesterol 7-alpha-hydroxylase; EC 1.14.13.17) is
responsible for introducing a hydrophilic moiety at position 7 of
cholesterol to form 7.alpha.-hydroxycholesterol (Id).
[0060] Cytochrome P450, family 27, subfamily A, polypeptide 1
(CYP27A1; Sterol 27-hydroxylase; EC 1.14.13.15) catalyzes the
transition of mitochondrial cholesterol to 27-hydroxycholesterol
and 25-hydroxycholesterol (Id).
[0061] Cytochrome P450 46A1 (CYP46A1, cholesterol 24-hydroxylase,
EC 1.14.13.98) catalyzes transformation of cholesterol into
24(S)-hydroxycholesterol (Id).
[0062] Statins
[0063] The term "statin" as used herein refers to a competitive
inhibitor of HMG-CoA reductase in the mevalonate arm of the
cholesterol biosynthesis pathway. Exemplary statins include,
without limitation, mevastatin, lovastatin, simvastatin, and
pravastatin, which are fungal metabolites, and fluvastatin,
atorvastatin, and verivastatin, which are synthetic compounds.
Statins exert their major effect--reduction of low density
lipoprotein cholesterol levels--through a mevalonic acid-like
moiety that competitively inhibits HMGCR by product inhibition.
Higher doses of the more potent statins (e.g., atorvastatin and
simvastatin) also can reduce triglyceride levels caused by elevated
very low density lipoprotein levels (Goodman & Gilman's The
Pharmacological Basis of Therapeutics, Ed. Joel G. Hardman, Lee E.
Limbird, Eds., 10th Ed., McGraw Hill, New York (2001), p. 984).
[0064] HMG-CoA reductase inhibition by the statins cerivastatin and
atorvastatin has been shown to have a biphasic dose-dependent
effect on angiogenesis that is lipid independent and associated
with alterations in endothelial apoptosis and VEGF signaling.
(Weis, M. et al (2002) "Statins have biphasic effects on
angiogenesis," Cir. Res. 105: 739-45). Endothelial cell
proliferation, migration, and differentiation of an immortalized
human dermal microvascular endothelial cell line (HMEC-1) in vitro
were enhanced at low statin concentrations (0.005 to 0.01
.mu.mol/L) but significantly inhibited at high statin
concentrations (0.05 to 1 .mu.mol/L). Antiangiogenic effects at
high concentrations were associated with decreased endothelial
release of VEGF and increased endothelial apoptosis and were
reversed by geranylgeranyl pyrophosphate (GGP). GGP is required for
the membrane localization of Rho family members. Other
antiangiogenic effects of statins may include inhibition of the
expression or activity of monocyte chemoattractant protein-1,
metalloproteinase and angiotensin-2, preproendothelin gene, and
actin filament and focal adhesion formation. In a zebrafish
anti-angiogenic drug screen, a number of statins (simvastatin,
mevastatin, lovastatin, and rosuvastatin) were identified to
inhibit angiogenesis in developing zebrafish embryos. The
anti-angiogenic effect of rosuvastatin was confirmed in a mouse
xenograft prostate cancer model. (Wang, C. et al, (2010)
"Rossuvastatin, identified from a zebrafish chemical genetic screen
for anti-angiogenic compounds, suppresses the growth of prostate
cancer," Eur. Urol. 58: 418-26). In other murine models,
inflammation-induced angiogenesis was enhanced with low-dose statin
therapy (0.5 mg/kg/d) but significantly inhibited with high
concentrations of cerivastatin or atorvastatin (2.5 mg/kg/d).
Despite the fact that high-dose statin treatment was effective at
reducing lipid levels in hyperlipidemic apolipoprotein E-deficient
mice, it impaired, rather than enhanced angiogenesis.
[0065] Prenylation
[0066] Prenylation is a class of lipid modification involving
covalent addition of either farnesyl (15-carbon) or geranylgeranyl
(20-carbon) isoprenoids to conserved cysteine residues at or near
the C-terminus of proteins (Zhang, F. L. and Casey, P J (1996)
"Protein Prenylation: Molecular Mechanisms and Functional
Consequences," Ann. Rev. Biochem. 65: 241-69). Prenylation promotes
membrane interactions of prenylated proteins, and plays a major
role in several protein-protein interactions involving them.
[0067] Both the 15-carbon isoprenoid FPP and the 20-carbon
isoprenoid GGP are products of the MVA metabolic pathway; it
follows that regulation of HMGCR, FTase and GGTase-I, the key
enzymes of the mevalonate pathway, can significantly affect the
protein prenylation process. Zhang, F. L. and Casey, P J (1996)
"Protein Prenylation: Molecular Mechanisms and Functional
Consequences," Ann. Rev. Biochem. 65: 241-69).
[0068] Prenylated proteins can be grouped into two major classes:
those containing the CAAX motif and the so-called CC- or
CxC-containing proteins. CAAX proteins are defined as a group of
proteins with a specific amino acid sequence at C-terminal that
directs their post translational modification. Gao, J. et al (2009)
"CAAX-box protein, prenylation process and carcinogenesis," Am. J.
Trans. Res. 1(3): 312-25). C is cysteine residue, AA are two
aliphatic residues, and X represents any C-terminal amino acid
depending on different substrate specificity. The CAAX proteins
encompass a wide variety of molecules that include nuclear lamins
(intermediate filaments), Ras and a multitude of GTP-binding
proteins (G proteins), and several protein kinases and
phosphatases. Most CAAX proteins are found primarily at the
cytoplasmic surface of cell membranes and are involved in a
tremendous number of cellular signaling processes and regulatory
events that play various roles in cell biological functions. These
activities include cell proliferation, differentiation, nuclear
stability, embryogenesis, spermatogenesis, metabolism, and
apoptosis. The proteins that have a CAAX box at the end of the
C-terminal always need a prenylation process before the proteins
can be sent to plasma membrane or nuclear membrane and thereby
exert their different functions.
[0069] Prenylation of CAAX proteins includes 3 steps:
polyisoprenylation, proteolysis, and carboxyl methylation. Zhang,
F. L. and Casey, P J (1996) "Protein Prenylation: Molecular
Mechanisms and Functional Consequences," Ann. Rev. Biochem. 65:
241-69). First, an isoprenoid lipid is attached to the CAAX box by
a prenyltransferase, for example, FTase or GGTase-I. When the C
terminal amino acid "X" is serine, methionine or glutamine,
proteins are recognized by FTase, whereas a leucine at this
position results in modification by GGTase I. FTase and GGTase-I
recognize the CAAX box in the protein, and then add the 15-carbon
isoprenoid farnesyl pyrophosphate by FTase or the 20-carbon
isoprenoid by GGTase-I to the cysteine residue of the CAAX box.
Second, following prenylation, the aaX residues are cleaved by an
endoprotease. Third, the carboxyl group of the modified cysteine is
methylated by a specific methyl transferase.
[0070] GGTase II transfers geranylgeranyl groups from GGPP to both
cysteine residues of CC- or CxC-containing proteins in a process
mechanistically distinct from that of CAAX proteins. Additionally,
proteins containing the CxC motif are methylated at the C-terminal
prenylcysteine, whereas CC-containing proteins are not.
[0071] HMGCR mediated GGPP biosynthesis regulates Cdc42
prenylation. (Eisa-Beygi S, Hatch G, Noble S, Ekker M, Moon T W
(2013) "The 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR)
pathway regulates developmental cerebral-vascular stability via
prenylation-dependent signaling pathway," Dev Biol 373:258-266).
Cdc42 regulates adherens junction stability and endothelial barrier
function.
[0072] Intracerebral Hemorrhage (ICH)
[0073] Spontaneous intracerebral hemorrhage (ICH) is a severe and
debilitating form of stroke that is most commonly due to
hypertension, amyloid angiopathy, brain vascular malformations or
secondary to medications including antiplatelet and anticoagulant
drugs. Spontaneous ICH comprises 10% of strokes and is associated
with death or disability in more than 50% of the approximately
90,000 patients affected each year in North America. (Roger V L, Go
A S, Lloyd-Jones D M, Adams R J, Berry J D, Brown T M, et al (2011)
"Heart disease and stroke statistics-2011 update: a report from the
American Heart Association," Circulation 123:e18-e209). Clinical
studies also have disclosed a link between cholesterol-lowering
HMGCR inhibitors (statins) and increased risk of ICH. (Collins R,
Armitage J, Parish S, Sleight P, Peto R: (2004) "Effects of
cholesterol-lowering with simvastatin on stroke and other major
vascular events in 20536 people with cerebrovascular disease or
other high-risk conditions," Lancet 363:757-767); Flaster M,
Morales-Vidal S, Schneck M J, Biller J (2011) "Statins in
hemorrhagic stroke," Expert Rev Neurother 11:1141-1149; Goldstein L
B, Amarenco P, Szarek M, Callahan A, III, Hennerici M, Sillesen H,
et al (2008) "Hemorrhagic stroke in the Stroke Prevention by
Aggressive Reduction in Cholesterol Levels study," Neurology
70:2364-2370). Another type of brain hemorrhage is brain
microhemorrhages (BMH), which are small, usually multiple, ICHs. A
systematic review found that 5% of healthy adults, 34% of patients
with ischemic stroke and 60% of patients with nontraumatic ICH had
BMH. (Cordonnier C, Klijn C J, van B J, Al-Shahi S R (2010)
"Radiological investigation of spontaneous intracerebral
hemorrhage: systematic review and trinational survey," Stroke
41:685-690). They are more common in patients with hypertension and
diabetes mellitus. Other than treatment of hypertension, there is
no prophylactic treatment to prevent ICH or BMH.
[0074] Intracerebral Hemorrhage, Brain Microhemorrhages and Other
Causes of Intracerebral Hemorrhage
[0075] Spontaneous ICH accounts for 10% of strokes. There are about
90,000 per year in the U.S. and Canada. Mortality is 30-50%. The
most common cause is hypertension, and ICH due to hypertension can
be partly reduced by treating hypertension. However, other factors
contribute to ICH from hypertension, such as low serum cholesterol
(Sutherland G R, Auer R N (2006) "Primary intracerebral
hemorrhage," J Clin Neurosci 13:511-517). The second main cause of
ICH is amyloid angiopathy, for which there is no specific
treatment. The pathophysiology of ICH from amyloid blood vessels is
unknown, although it is highly associated with amyloid deposition
in brain arteries and arterioles.
[0076] Brain microhemorrhages (BMH) are another form of ICH (Fisher
M J (2013) "Brain regulation of thrombosis and hemostasis: from
theory to practice," Stroke 44:3275-3285). They are associated with
increasing age, amyloid angiopathy, hypertension,
ischemic/hemorrhagic stroke (mixed cerebrovascular disease) and
Alzheimer disease. They are usually attributed to localized
bleeding from tears in small arterioles but Fisher proposed that
they may be age-dependent, inflammation-mediated leakage from small
brain blood vessels (Id). This hypothesis is supported by BMH
induced by lipopolysaccharide (LPS) in zebrafish and mice (FIGS. 5,
6 and 9) (Liu S, Vasilevko V, Cribbs D H, Fisher M (2013) "A mouse
model of cerebral microhemorrhages," Stroke 44:AWP297 (Abstract)).
Furthermore, patients with BMH are at increased risk of ICH and
that risk is increased further if they take antiplatelet or
anticoagulant drugs (Cordonnier C, Klijn C J, van B J, Al-Shahi S R
(2010) "Radiological investigation of spontaneous intracerebral
hemorrhage: systematic review and trinational survey," Stroke
41:685-690; Greenberg S M, Eng J A, Ning M, Smith E E, Rosand J
(2004) "Hemorrhage burden predicts recurrent intracerebral
hemorrhage after lobar hemorrhage," Stroke 35:1415-1420; Imaizumi
T, Horita Y, Hashimoto Y, Niwa J (2004) "Dotlike hemosiderin spots
on T2*-weighted magnetic resonance imaging as a predictor of stroke
recurrence: a prospective study," J Neurosurg 101:915-920). BMHs
also are associated with cognitive impairment (Yakushiji Y, Noguchi
T, Hara M, Nishihara M, Eriguchi M, Nanri Y, et al (2012)
"Distributional impact of brain microhemorrhages on global
cognitive function in adults without neurological disorder," Stroke
43:1800-1805).
[0077] While statins reduce the long-term risk of myocardial
infarction and ischemic stroke, they increase the risk of ICH
(Collins R, Armitage J, Parish S, Sleight P, Peto R (2004) "Effects
of cholesterol-lowering with simvastatin on stroke and other major
vascular events in 20536 people with cerebrovascular disease or
other high-risk conditions," Lancet 363:757-767; Flaster M,
Morales-Vidal S, Schneck M J, Biller J (2011) "Statins in
hemorrhagic stroke," Expert Rev Neurother 11:1141-1149; Goldstein L
B, Amarenco P, Szarek M, Callahan A, III, Hennerici M, Sillesen H,
et al (2008) "Hemorrhagic stroke in the Stroke Prevention by
Aggressive Reduction in Cholesterol Levels study," Neurology
70:2364-2370, Haussen D C, Henninger N, Kumar S, Selim M (2012)
"Statin use and microhemorrhages in patients with spontaneous
intracerebral hemorrhage," Stroke 43:2677-2681); Eisa-Beygi S, Wen
X Y, Macdonald R L. (2014) "A Call for Rigorous Study of Statins in
Resolution of Cerebral Cavernous Malformation Pathology." Stroke
45(6):1859-61. According to the American Heart Association
guidelines, statins may not be indicated in these patients.
(Morgenstem L B, Hemphill J C, III, Anderson C, Becker K, Broderick
J P, Connolly E S, Jr., et al (2010) "Guidelines for the management
of spontaneous intracerebral hemorrhage: a guideline for healthcare
professionals from the American Heart Association/American Stroke
Association," Stroke 41:2108-2129). Statins inhibit cholesterol
synthesis, and low serum cholesterol also is an independent risk
factor for ICH. (Sutherland G R, Auer R N (2006) "Primary
intracerebral hemorrhage," J Clin Neurosci 13:511-517).
[0078] Cerebral cavernous malformations (CCM) are the most common
brain vascular malformation. They are found in 0.5% of the
population and are a cause of spontaneous ICH (Richardson B T,
Dibble C F, Borikova A L, Johnson G L (2013) "Cerebral cavernous
malformation is a vascular disease associated with activated RhoA
signaling," Biol Chem 394:35-42). The hemorrhages tend to cluster
in time so a drug that reduced this risk during times of increased
hemorrhage risk is actively being sought and is greatly needed
(Barker F G, Amin-Hanjani S, Butler W E, Lyons S, Ojemann R G,
Chapman P H, et al (2001) "Temporal clustering of hemorrhages from
untreated cavernous malformations of the central nervous system,"
Neurosurgery 49:15-24, Li Q, Mattingly R R (2008) "Restoration of
E-cadherin cell-cell junctions requires both expression of
E-cadherin and suppression of ERK MAP kinase activation in
Ras-transformed breast epithelial cells," Neoplasia 10:1444-1458).
CCM may be sporadic or inherited in association with
loss-of-function mutations in genes encoding 3 structurally
distinct proteins, CCM1 (KRIT1), CCM2 (Osmosensing scaffold for
MEKK3 or OSM, MALCAVERIN, or MGC4607), and CCM3 (programmed cell
death 10 (PDCD10)(Li D Y, Whitehead K J (2010) "Evaluating
strategies for the treatment of cerebral cavernous malformations,"
Stroke 41:S92-S94). All 3 CCM proteins are involved in cytoskeleton
and AJ and the mutations have to be in endothelial cells in order
for CCMs to form. Mutations in CCM1 and CCM2 lead to increased RhoA
activity, which led to the hypothesis that increased RhoA activity
affects the cell cytoskeleton and causes vascular instability, CCMs
and possibly ICH/BMH in humans. Drugs that inhibit RhoA activity,
such as statins and fasudil, are theorized to reduce the risk of
ICH based on data from mouse models of CCMs. (Li D Y, Whitehead K J
(2010) "Evaluating strategies for the treatment of cerebral
cavernous malformations," Stroke 41:S92-S94; Richardson B T, Dibble
C F, Borikova A L, Johnson G L (2013) "Cerebral cavernous
malformation is a vascular disease associated with activated RhoA
signaling," Biol Chem 394:35-42). This hypothesis is in contrast to
studies in zebrafish showing that statins impair vascular stability
and give rise to ICH/BMH (Eisa-Beygi S, Hatch G, Noble S, Ekker M,
Moon T W (2013) "The 3-hydroxy-3-methylglutaryl-CoA reductase
(HMGCR) pathway regulates developmental cerebral-vascular stability
via prenylation-dependent signaling pathway," Dev Biol
373:258-266). These effects were shown to be due to defective
prenylation of Rho GTPases, particularly Cdc42, a Rho GTPase
involved in the regulation of vascular stability, leading to the
question as to the cause of the discrepancy between zebrafish and
mouse models. In fact, statin treatment of zebrafish induces
cerebrovascular defects typified by leaky, dilated cranial vessels
with sluggish blood flow, which are analogous to CCMs. Without
being limited by theory, it is hypothesized herein that the
difference is due to relative degrees of inhibition of RhoA and
Cdc42, since the balance of vascular destabilizing RhoA to vascular
stabilizing Cdc42 may differ depending on dose and species.
[0079] Models of ICH and BMH
[0080] Zebrafish are emerging as useful model organism for
large-scale, phenotype-based chemical and genetic screening.
Zebrafish are genetically very similar to humans, easy and fast to
breed for high-throughput screening, transparent early on for easy
imaging and relatively easy to modify genetically. Some compounds
discovered in zebrafish are effective in mammals and already in
human studies (Peterson R T, Fishman M C (2011) "Designing
zebrafish chemical screens," Methods Cell Biol 105:525-541). Since
the screening is performed in vivo, general drug toxicity can be
evaluated at the same time as drug efficacy, allowing for a higher
success rate as compared to an in vitro drug screens on cultured
cells (Miscevic F, Rotstein O, Wen X Y (2012) "Advances in
zebrafish high content and high throughput technologies," Comb Chem
High Throughput Screen 15:515-521, 2012). Furthermore, an in vivo
screen system such as zebrafish can measure the efficacy of the
drug as well as its metabolites. The ability to perform high
throughput screening of compound libraries in zebrafish is an
advantage over testing compounds in rodents where high throughput
screening is not possible.
[0081] Several models of ICH/BMH have been identified in zebrafish.
First, statins cause ICH/BMH in zebrafish (FIG. 7, 9) (Eisa-Beygi
S, Hatch G, Noble S, Ekker M, Moon T W (2013) "The
3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) pathway regulates
developmental cerebral-vascular stability via prenylation-dependent
signaling pathway," Dev Biol 373:258-266). The mechanism is due to
inhibition of protein prenylation since ICH/BMH can also be induced
by MO-induced depletion of the .beta. subunit of
geranylgeranyltransferase 1 (GGTase 1, pggtl.beta.) and prevented
by downstream metabolic rescue with the product of HMGCR,
geranylgeranyl pyrophosphate (GGPP, FIGS. 3, 4 and 8). GGPP is a 20
carbon lipid molecule required for post-translational prenylation
of Rho GTPase proteins. The BMH temporal and spatial distribution
is similar to ICH/BMH seen in zebrafish bubblehead (bbhm292) and
redhead (rhdmi149) mutants. (Buchner D A, Su F, Yamaoka J S, Kamei
M, Shavit J A, Barthel L K, et al (2007) "pak2a mutations cause
cerebral hemorrhage in redhead zebrafish," Proc Natl Acad Sci USA
104:13996-14001; Butler M G, Gore A V, Weinstein B M (2011)
"Zebrafish as a model for hemorrhagic stroke," Methods Cell Biol
105:137-161; Liu J, Fraser S D, Faloon P W, Rollins E L, Vom B J,
Starovic-Subota O, et al (2007) "A betaPix Pak2a signaling pathway
regulates cerebral vascular stability in zebrafish," Proc Natl Acad
Sci USA 104:13990-13995).
[0082] Bubblehead (bbh.sup.m292) develops ICH and brain edema 36 to
52 hours postfertilization (hpf) whereas redhead (rhd.sup.mi149)
develops ICH 2 to 3 days postfertilization. The bbh.sup.m292
mutation is in the .beta.pix (pak-interacting exchange factor
.beta.) gene, whereas the rhd.sup.mi149 mutation is in pak2a (p21
protein [Cdc42/Rac]-activated kinase 2a) gene. These genes encode
proteins that regulate activity of Rho GTPases, Rac and Cdc42. That
both of these changes are associated with ICH/BMH is consistent
with Rac and Cdc42 requiring GGTase 1-mediated prenylation. GGTase
1 post-translationally modifies Rac and Cdc42 by adding a
mevalonate-derived GGPP which is required to activate these
GTPases. (Peterson Y K, Kelly P, Weinbaum C A, Casey P J (2006) "A
novel protein geranylgeranyltransferase-I inhibitor with high
potency, selectivity, and cellular activity," J Biol Chem
281:12445-12450) There are also zebrafish mutants corresponding to
the orthologous human CCM1, CCM2 and CCM3 genes (Butler M G, Gore A
V, Weinstein B M (2011) "Zebrafish as a model for hemorrhagic
stroke," Methods Cell Biol 105:137-161). These develop cardiac
dilation and progressively enlarged, dilated blood vessels and it
has been suggested the genes have similar function in both species.
No ICH phenotype is described in these zebrafish mutants but
combined MO-induced reduction in a Ras GTPase effector protein, rap
lb and zebrafish ccml did cause ICH (Gore A V, Lampugnani M G, Dye
L, Dejana E, Weinstein B M (2008) "Combinatorial interaction
between CCM pathway genes precipitates hemorrhagic stroke," Dis
Model Mech 1:275-281). In mice, the gene defects for CCMs are
suggested to be required in endothelial cells in order for
malformations to develop (Chan A C, Li D Y, Berg M J, Whitehead K J
(2010) "Recent insights into cerebral cavernous malformations:
animal models of CCM and the human phenotype," FEBS J
277:1076-1083).
[0083] Mouse models of ICH include direct injection of blood into
the brain, or injection of elastase, which degrades vascular
collagen and causes bleeding. These models would not be useful for
detecting therapeutic agents that stabilize the vasculature. There
are two models of spontaneous ICH in mice. One is a model of acute
and chronic hypertension induced by a combination of angiotensin 2
and NOS inhibition in mice (Wakisaka Y, Chu Y, Miller J D,
Rosenberg G A, Heistad D D (2010) "Spontaneous intracerebral
hemorrhage during acute and chronic hypertension in mice,". J Cereb
Blood Flow Metab 30:56-69). The mechanism of ICH in hypertension,
however, may differ from what we are investigating with statins and
CCM genes.
[0084] A second model of BMH involves transgenic mice (e.g. Tg2576)
that spontaneously overexpress P-amyloid, mimicking cerebral
amyloid angiopathy (Herzig M C, Winkler D T, Burgermeister P,
Pfeifer M, Kohler E, Schmidt S D, et al. Abeta is targeted to the
vasculature in a mouse model of hereditary cerebral hemorrhage with
amyloidosis. Nat Neurosci. 2004; 7(9):954-60, Fisher M, Vasilevko
V, Passos G F, Ventura C, Quiring D, Cribbs D H. Therapeutic
modulation of cerebral microhemorrhage in a mouse model of cerebral
amyloid angiopathy. Stroke. 2011; 42(11):3300-3). There are other
similar models. (Alharbi B M, Tso M K, Macdonald R L. (2016) Animal
models of spontaneous intracerebral hemorrhage. Neurol Res
38:448-455). The limitation is that it takes up to 2 years for
animals to develop BMH.
[0085] LPS has been used to induce BMH in mice (Tang, A T, et al,
"Endothelial TLR4 and the microbiome drive cerebral cavernous
malformations," Nature (2017) 545 (7654): 305-310. Doi:
10.1038/nature22075; Liu S, Vasilevko V, Cribbs D H, Fisher M
(2013) "A mouse model of cerebral," Stroke 44:AWP297 [Abstract]);
Liu S, Grigoryan M M, Vasilevko V, Sumbria R K, Paganini-Hill A,
Cribbs D H, et al. (2014) "Comparative analysis of H & E and
prussian blue staining in a mouse model of cerebral microbleeds." J
Histochem Cytochem. 62:767-773). LPS or vehicle (phosphate buffered
saline [PBS]) was injected at baseline and again at 24 hours, and
the mice were sacrificed 2 days after the first injection (FIGS. 6
and 9). When the brains were examined, multiple small fresh
hemorrhages were found in mice treated with LPS, as was increased
blood brain barrier permeability. It has been suggested that this
model might be useful to study mechanisms of and interventions for
BMH.
[0086] Anti-.beta.3 Integrin Mouse Model of Intracerebral
Hemorrhage (ICH)
[0087] The integrin .alpha.IIb.beta.3 is the most abundant
glycoprotein on platelets. The .beta.3 subunit also is coexpressed
with the .alpha.V subunit (i.e., .alpha.V.beta.3) on proliferating
endothelial cells (ECs) during angiogenesis (Yougbare, I. et al.,
"Maternal anti-platelet .beta.3 integrins impair angiogenesis and
cause intracranial hemorrhage," (2015) J. Clin. Invest. 125(4):
1545-56 citing Brooks, P C et al, "Requirement of vascular integrin
alpha v beta 3 for angiogenesis," Science (1994) 264 (5158):
569-71; Brooks, P C et al, "Integrin .alpha.v.beta.3 antagonists
promote tumor regression by inducing apoptosis of angiogenic blood
vessels," (1994) Cell 79(7): 1157-64; Di Q, et al, "Impaired
cross-activation of .beta.3 integrin and VEGFR-2 on endothelial
progenitor cells with aging decreases angiogenesis in response to
hypoxia," Intl J. Cardiol. (2013) 168(3): 2167-76; Stupack, D C,
Cheresh, D A, "Integrins and angiogenesis," Curr. Top. Dev. Bio.
(2004) 64: 207-38. Several studies have demonstrated that .beta.3
plays an important role in angiogenesis. For example, it has been
shown that .alpha.Vb3 was required for angiogenesis (Id. diting
Brooks, P C et al, "Requirement of vascular integrin alpha v beta 3
for angiogenesis," Science (1994) 264 (5158): 569-71), and that
.alpha.Vb3 antagonists promoted tumor regression by inducing
apoptosis of angiogenic blood vessels (Id. citing Brooks, P C et
al, "Integrin .alpha.v.beta.3 antagonists promote tumor regression
by inducing apoptosis of angiogenic blood vessels," (1994) Cell
79(7): 1157-64). Evidence has also shown that integrin
.alpha.V.beta.3 cooperated with VEGFR2 in pro-angiogenic signaling
(Id., citing Robinson, S D, et al, ".alpha.v.beta.3 integrin limits
the contribution of neuropilin-1 to vascular endothelial growth
factor-induced angiogenesis," J. Biol. Chem. (2009) 284(49):
33966-81; Soldi, R. et all, "Role of .alpha.v.beta.3 integrin in
the activation of vascular endothelial growth factor receptor-2,"
EMBO J. (1999) 18(4): 882-92) and that AKT phosphorylation was
essential in VEGF-mediated post-natal angiogenesis (Id. citing
Kitamura, T et al, "Regulation of VEGF-mediated angiogenesis by the
Akt/PKB substrate Girdin," Nat. Cell Biol. (2008): 10(3):
329-337).
[0088] An established murine model of fetal and neonatal autoimmune
thrombocytopenia (FNAIT) has been used to investigate the mechanism
of ICH in affected fetuses and neonates (Id., citing Chen, P. et
al., "Animal model of fetal and neonatal immune thrombocytopenia:
role of neonatal Fc receptor in the pathogenesis and therapy,"
Blood (2010) 116 (18): 3660-68; Li, C. et al, "The maternal immune
response to fetal platelet GpIb.alpha. causes frequent miscarriage
in mice that can be prevented by intravenous IgG and anti-FcRn
therapies," J. Clin. Invest. (2011) 121(11): 4537-47; Ni H, et al,
"A novel murine model of fetal and neonatal alloimmune
thrombocytopenia: response to intravenous IgG therapy," Blood
(2006) 107(7): 2976-83). Itgb3.sup.-/- and Gp1ba.sup.-/- mice
(referred to hereinafter as .beta.3.sup.-/- and
GPIb.alpha..sup.-/-) were transfused with WT platelets to mimic
exposure to .beta.3 or to GPIb.alpha. during conception. Id.
Anti-.beta.3 or anti-GPIb.alpha. antibodies were detected; these
immunized mice were subsequently bred with WT males. Id. Similar
severity of thrombocytopenia in the heterozygote (-/+) neonates
delivered from immunized .beta.3.sup.-/- and GPIB.alpha..sup.-/-
mice was found. Id. ICH was found in the .beta.3.sup.-/- fetuses
starting around EC15.5 as well as in neonates using a
high-frequency ultrasound imaging system to detect in utero ICH in
pregnant mice, and performing H & E staining of brain sections.
Id. Hemorrhage was observed in different areas of the brain, and
the frequency of ICH increased in fetuses in accordance with the
number of material immunizations. Id. ICH was never found in
anti-GPIb.alpha.-mediated FNAIT fetuses or neonates. Id.
[0089] The following experiments showed that anti-.beta.3
antibodies, but not anti-GPIb.alpha. antibodies or thrombocytopenia
alone, were the cause of ICH. To confirm that ICH was indeed
antibody mediated, .beta.3.sup.-/- and GPIB.alpha..sup.-/- neonates
delivered from naive mice were passively injected with antisera at
P2. Postnatal injection of anti-.beta.3 sera into .beta.3.sup.-/-
neonates induced ICH, but anti-GPIb.alpha. sera did not induce any
ICH in GPIB.alpha..sup.-/- neonates (P<0.01). Id. To further
determine whether platelet-mediate cytotoxicity (Id. Citing
Nieswandt, B. et al., "Identification of critical antigen-specific
mechanisms in the development of immune thrombocytopenic purpura in
mice," Blood (2000) 96(7): 2520-27; Nieswandt, B. et al, "Targeting
of platelet integrin 011433 determines systemic reaction and
bleeding in murine thrombocytopenia regulated by activating and
inhibitory Fc.gamma.R," Intl Immunol. (2003) 15(3): 341-49) might
be involved in the mechanism of ICH, anti-.beta.3 sera were
injected into .alpha.IIb integrin-deficient pups that did not
express .alpha.IIb.beta.3 integrin on their platelets. Id. ICH was
observed in Itga2b.sup.-/- pups with normal platelet counts, and
postnatal injection of anti-.beta.3 sera into .beta.3.sup.-/-
neonates failed to induce ICH and impair retinal vascular
development in these antigen-negative pups. Id.
[0090] Mouse models that combine Ccm heterozygotes on a background
of homozygous deletion of the mismatch repair complex protein Msh2
(<Ccm1.sup.+/-Msh.sup.-/- and Ccm2+/`Msh.sup.-/-) develop CCMs.
(McDonald D A, Shi C, Shenkar R, Stockton R A, Liu F, Ginsberg M H,
et al, (2012) "Fasudil decreases lesion burden in a murine model of
cerebral cavernous malformation disease," Stroke 43:571-574.
Another important gene is Rap1b, mouse mutants of which develop
normally until embryonic day 12.5, at which point 50% die due to
hemorrhage (Id); Chrzanowska-Wodnicka M (2013) "Distinct functions
for Rap1 signaling in vascular morphogenesis and dysfunction," Exp
Cell Res 319:2350-2359). Subphenotypic levels of reduction of ccml
and rap lb in zebrafish cause brain hemorrhage.
[0091] 3. Mechanisms of ICH and BMH
[0092] In patients with hypertension, the cause of ICH is
arteriolosclerosis of the small penetrating arteries that tend to
arise from large conducting cerebral arteries. (Auer, R N,
Sutherland, G R (2005) "Primary intracerebral hemorrhage:
pathophysiology," Can. J. Neurol. Sci. 32 Suppl. 2: 3-12). The only
currently available treatment is prophylactic treatment of
hypertension. Guidelines for management of patients once they have
a hypertensive ICH are published, and recommend surgical evacuation
of space-occupying cerebellar ICH and general medical supportive
care. (Hemphill J C, 3rd, Greenberg S M, Anderson C S, Becker K,
Bendok B R, Cushman M, et al. Guidelines for the management of
spontaneous intracerebral hemorrhage: A guideline for healthcare
professionals from the American Heart Association/American Stroke
Association. Stroke. 2015; 46:2032-2060).
[0093] There are different theories as to why statins increase the
risk of ICH. For example, statin-associated ICH and other types of
ICH/BMH may be due to defects in the HMGCR pathway (Eisa-Beygi S,
Hatch G, Noble S, Ekker M, Moon T W (2013) "The
3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) pathway regulates
developmental cerebral-vascular stability via prenylation-dependent
signaling pathway," Dev Biol 373:258-266). Inhibition of HMGCR or
of other downstream molecules such as geranylgeranyltransferase 1
(GGTase 1) causes ICH/BMH in zebrafish embryos (Id). Flaster and
colleagues suggested that statins could cause changes in platelets
or in the interactions between clotting and fibrinolytic cascades
that could promote ICH, although there is no evidence for this thus
far (Flaster M, Morales-Vidal S, Schneck M J, Biller J (2011)
"Statins in hemorrhagic stroke," Expert Rev Neurother
11:1141-1149).
[0094] There are at least 2 mutations that cause ICH in zebrafish.
Bubblehead is a loss of function mutation of .beta.pix (p isoform
of the p21-activating kinase (Pak)-interacting exchange factor)
(Liu J, Zeng L, Kennedy R M, Gruenig N M, Childs S J (2012)
"betaPix plays a dual role in cerebral vascular stability and
angiogenesis, and interacts with integrin alphavbeta8," Dev Biol
363:95-105). .beta.pix regulates vascular stability and .beta.pix
mutation is the cause of vascular fragility and ICH in the
bbh.sup.m292 mutant. (Liu J, Fraser S D, Faloon P W, Rollins E L,
Vom B J, Starovic-Subota O, et al (2007) "A betaPix Pak2a signaling
pathway regulates cerebral vascular stability in zebrafish," Proc
Natl Acad Sci USA 104:13990-13995). .beta.pix also is involved in
focal adhesion complexes, which contain integrins and cadherins
(Frank S R, Hansen S H (2008) "The PIX-GIT complex: a G protein
signaling cassette in control of cell shape," Semin Cell Dev Biol
19:234-244). Another zebrafish mutant, redhead, is rhd.sup.mi149
that has a mutation pak2a (p21 protein [Cdc42/Rac]--activated
kinase 2a) Liu J, Fraser S D, Faloon P W, Rollins E L, Vom B J,
Starovic-Subota O, et al (2007) "A betaPix Pak2a signaling pathway
regulates cerebral vascular stability in zebrafish," Proc Natl Acad
Sci USA 104:13990-13995). pak2a is a kinase acting downstream of
Cdc42 and Rac, and may be involved in a complex with .beta.Pix,
paxillin and GIT1. Since Cdc42 also is required for interaction of
VE-cadherin and the actin cytoskeleton, the defect in the
bbh.sup.m292 mutant could also be due to defects in this latter
interaction. In mice, germ-line or endothelial cell specific Pak2
knockout is embryonic lethal likely due to impaired blood vessel
formation. (Radu M, Semenova G, Kosoff R, Chemoff J (2014) "PAK
signalling during the development and progression of cancer," Nat
Rev Cancer 14:13-25). Both are transmembrane proteins that connect
the intracellular cytoskeleton to the extracellular matrix (Frank S
R, Hansen S H (2008) "The PIX-GIT complex: a G protein signaling
cassette in control of cell shape," Semin Cell Dev Biol 19:234-244;
van der Flier A, Sonnenberg A (2001) "Function and interactions of
integrins," Cell Tissue Res 305:285-298). They are important in
angiogenesis and vascular stability. For example, homozygous
integrin .alpha..sub.v or .beta..sub.8 null mice die perinatally or
before from ICH (Zhu J, Motejlek K, Wang D, Zang K, Schmidt A,
Reichardt L F (2002) ".beta..sub.8 integrins are required for
vascular morphogenesis in mouse embryos," Development
129:2891-2903). Targeted inactivation of VE-cadherin and truncation
of the .beta.-catenin-binding cytosolic domain of VE-cadherin in
mice induces endothelial cell-specific apoptosis, in addition to
defective remodeling and maturation of the vasculature and early
lethality (Carmeliet P, Lampugnani M G, Moons L, Breviario F,
Compemolle V, Bono F, et al (1999) "Targeted deficiency or
cytosolic truncation of the VE-cadherin gene in mice impairs
VEGF-mediated endothelial survival and angiogenesis," Cell
98:147-157). Most recently, we demonstrated that by delivering
anti-.beta..sub.3 integrin antibody into pregnant mice could induce
ICH in mouse embryos and neonatal mice. (Yougbare I, Lang S, Yang
H, Chen P, Zhao X, Tai W S, Zdravic D, Vadasz B, Li C, Piran S,
Marshall A, Zhu G, Tiller H, Killie M K, Boyd S, Leong-Poi H, Wen X
Y, Skogen B, Adamson S L, Freedman J and Ni H (2015) "Maternal
anti-platelet .beta.3 integrin antibodies impair angiogenesis and
cause intracranial hemorrhage in fetal and neonatal alloimmune
thrombocytopenia," J. Clinical Investigation (JCI), 125:1545-56).
Morpholino-induced reduction of cdh5, the zebrafish homologue of
the VE-cadherin gene in humans, causes vascular instability,
defective lumen formation and ICH by 48 hpf (Montero-Balaguer M,
Swirsding K, Orsenigo F, Cotelli F, Mione M, Dejana E (2009)
"Stable vascular connections and remodeling require full expression
of VE-cadherin in zebrafish embryos," PLoS ONE 4:e5772). It is
known that integrins are linked to .beta.Pix in focal adhesions by
proteins including G protein-coupled receptor kinase interacting
target (GIT1), which is an Arf GTPase activating protein (GAP) (Liu
J, Zeng L, Kennedy R M, Gruenig N M, Childs S J (2012) "betaPix
plays a dual role in cerebral vascular stability and angiogenesis,
and interacts with integrin alphavbeta8," Dev Biol 363:95-105).
Mice without GIT1 have increased pulmonary vascular density and
pulmonary hemorrhage. In zebrafish GIT1 is initially ubiquitously
expressed but it becomes restricted to the head by 48 hpf. Knock
down of GIT1 expression with MOs causes increases in ICH. Liu, et
al., conducted a series of experiments in zebrafish that suggest
that .beta.Pix interacts with .alpha..sub.v and .beta..sub.8
integrins and GIT1 to stabilize the cerebral vasculature, and
inhibiting expression of any of the components causes ICH (Liu J,
Zeng L, Kennedy R M, Gruenig N M, Childs S J (2012) "betaPix plays
a dual role in cerebral vascular stability and angiogenesis, and
interacts with integrin alphavbeta8," Dev Biol 363:95-105).
[0095] CCM1, 2 and 3 may form a multiprotein complex that also
includes integrin .beta.1-binding protein (ICAP-1), the GTPases Rac
and Rap1 and MAPK kinase kinase MEKX3 Chrzanowska-Wodnicka M (2013)
"Distinct functions for Rap1 signaling in vascular morphogenesis
and dysfunction," Exp Cell Res 319:2350-2359; Liu J, Fraser S D,
Faloon P W, Rollins E L, Vom B J, Starovic-Subota O, et al (2007)
"A betaPix Pak2a signaling pathway regulates cerebral vascular
stability in zebrafish. Proc Natl Acad Sci USA 104:13990-13995).
This complex modulates adherens junctions by interacting with
.beta. catenin and VE-cadherin mainly in endothelial cells (but
probably other perivascular cells) and achieving vascular
stability. Effects of knockouts of the ccm genes in zebrafish and
mice are not fully explored but show that embryonic germ-line
knockouts tend not to resemble the human phenotype, although in
some cases, conditional, endothelial cell specific knockouts do. In
zebrafish, knockdown of rap1b leads to ICH, but also sub-phenotype
levels of reduction in rap1b combined with ccm1 leads to ICH.
[0096] It is likely that the cellular localization and other
factors influence the effect of GTPase signaling on vascular
stability and ICH/BMH because in mice with mutations in germ-line
or endothelial cell-specific mutations in CCM2, statin inhibition
of HMGCR, which reduces Rho GTPase prenylation, improves
endothelial integrity and prevents the increased vascular
permeability. In zebrafish, however, inhibition of HMGCR with
statins or mutation and MO-induced loss of function of proteins
that activate Rho GTPase signaling increase vascular permeability
(Liu J, Fraser S D, Faloon P W, Rollins E L, Vom B J,
Starovic-Subota O, et al (2007) "A betaPix Pak2a signaling pathway
regulates cerebral vascular stability in zebrafish," Proc Natl Acad
Sci USA 104:13990-13995). The discrepancy is likely due to
cell-specific effects, age of the organisms, species differences,
differential effects on RhoA and cdc42 (that tend to have opposing
effects, RhoA destabilizing cdc42 stabilizing vasculature) or
differences between wild-type and CCM2 animals.
[0097] Statement of the Problem
[0098] Intracerebral hemorrhage, BMH and cavernous malformations
share common elements of vascular instability in blood vessels in
the brain that lead to intracranial hemorrhage, to brain injury and
to death and disability. Intracerebral hemorrhage is the most
lethal and devastating type of stroke. There is no pharmacologic
treatment available to reduce this and there is a high unmet
medical need. Therefore, a need exists for a pharmaceutical
composition comprising a therapeutic amount of a vascular
stabilizing agent, in some embodiments formulated as a sustained
release preparation, that when administered, is effective to
prevent or reduce the incidence ICH, BMH and ICH from various
causes including brain cavernous malformations.
SUMMARY OF THE INVENTION
[0099] According to one aspect, the described invention provides a
method for reducing incidence of vascular leakage comprising
administering a pharmaceutical composition containing a small
molecule therapeutic compound, a therapeutic amount of which is
effective to reduce incidence of bleeding in the brain by at least
30% relative to a control.
[0100] According to one embodiment, the small molecule therapeutic
compound is selected from the group consisting of artemether or a
derivative of artemether. According to another embodiment, the
derivative of artemisinin is dihydroartemisinin, artemisinin, or
artesunate. According to another embodiment, the small molecule
therapeutic compound is selected from the group consisting of
benidipine, lacidipine, ethynylestradiol or triptolide.
[0101] According to one embodiment, the vascular leakage is induced
by a statin, by a lipopolysaccharide, or both. According to another
embodiment, the statin is atorvastatin.
[0102] According to one embodiment, the vascular leakage is a
spontaneous intracerebral hemorrhage. According to another
embodiment, the spontaneous intracerebral hemorrhage occurs in
association with a mutation of one or more genes selected from
beta-pix, Pak2a, cdh5, ccm1, ccm2, ccm3, Rap1b, Pggt1b, Hmgcrb, and
beta3 integrin.
[0103] According to one embodiment, the vascular leakage includes a
brain microhemorrhage. According to another embodiment, the brain
microhemorrhage occurs in association with administration of a
statin.
[0104] According to one embodiment, the vascular leakage comprises
a brain vascular malformation. According to another embodiment, the
brain vascular malformation is a cerebral cavernous
malformation.
BRIEF DESCRIPTION OF THE DRAWINGS
[0105] The patent or application file contains at least one drawing
executed in color.
[0106] Copies of this patent or patent application publication with
color drawing(s) will be provided by the Office upon request and
payment of the necessary fee.
[0107] FIG. 1 shows the results of experiments using an
atorvastatin-induced intracerebral hemorrhage (ICH) model in
zebrafish for chemical screening. Panel (A) is a schematic diagram
showing the molecular pathway where statins act. Panels B-G: ICH
was induced by application of 1 .mu.M atorvastatin at 2 hours post
fertilization (hpf) of embryos from adult wild type or Tg
(flk-1:eGFP) and Tg (gata-1:DsRed) zebrafish, and arrayed into
96-well plates that contain the drug compounds. Panels B, D and F
(embryos treated with DMSO control); panels C, E and G, (embryos
treated with atorvastatin). Panels B, D and F show no
extravasations of red blood cells in vehicle DMSO-treated control
embryos. Atorvastatin treated embryos show hemorrhage in the brain
(.apprxeq.80% panels C and G), and increased junction between
endothelial cells (compare Panel E to panel D). Panel H is a
schematic showing the scheme of the screening process. Panels I to
L show EC50 experiments for four compounds from the ART family, two
of which were identified from the NCC library. Data is expressed as
mean.+-.SEM from 3 to 4 experiments. ARM, artemether; DHA,
dihydro-artemisinin; ARS, artemisinin; ART, artesunate.
[0108] FIG. 2 shows inhibition of brain hemorrhage induced by 1
.mu.M atorvastatin in zebrafish for four active compounds
identified from NCC libraries. Plots are % hemorrhage (y axis) vs.
drug concentration (Ig nmol/L) (x-axis). EC50 is concentration of
the drug at 50% of efficacy. Data is expressed as mean.+-.SEM from
3 to 4 experiments. B is benidipine; E is ethynylestradiol; L is
lacidipine, and T is triptolide.
[0109] FIG. 3 shows the relationship between the HMGCR-mediated
metabolic pathway, the Rho GTPase (Cdc42)-cadherin signaling
pathway, and cerebral cavernous malformation (Ccm) pathways in
zebrafish. By inhibiting HMG-CoA, statin treatment may lead to
vascular instability and brain hemorrhage in zebrafish through the
CDC42-cadherin pathway. ART family compounds are shown to be
effective in rescuing brain hemorrhage caused by genetic knockdown
of several key molecules of this pathway (e.g., pak2, .beta.pix).
This suggests that ART compounds act on a downstream target that is
vital for vascular stability in the brain.
[0110] FIG. 4 shows examples of results from drug efficacy assays
in the zebrafish bbh model for two compounds, ART, artesunate; and
ARM, artemether. Results are plotted as percent hemorrhage (y-axis)
vs. log (drug nmol/L); n=30 larvae per condition.
[0111] FIG. 5 shows examples of results from drug efficacy assays
in zebrafish hmgcrb morphants using artesunate (ART), and
artemether (ARM). Results are plotted as percent hemorrhage
(y-axis) vs. log (drug nmol/L); n=15-20 larvae per condition.
[0112] FIG. 6 shows mRNA changes upon treatment with atorvastatin
(ATV) and with atorvastatin plus artemether (ATV+ARM). qRT-PCR
analysis was used to evaluate the mRNA level of gene expression of
VE-cadherin (panel A), .beta.3-integrin (panel B), and CCM3 (Panel
C), in zebrafish treated with 1 .mu.M atorvastatin (ATV), with ATV
plus 500 nmol/L of artemether (ARM) as shown, n=3.
[0113] FIG. 7 shows the results of toxicity assays for artesunate
(ART (GMP)) on heart beat, blood flow and heart edema. Heart beat
and blood flow were ranked from 3 (normal heart beat or blood flow)
to 0 (no heart beat or blood flow). Cardiac edema was ranked from 0
(normal heart without edema) to -3 (severe cardiac edema). TC50 is
the concentration of the drug at 50% of maximum toxicity. Data is
expressed as mean.+-.SEM from 3 experiments.
[0114] FIG. 8 shows that artemether (ARM) rescues LPS-induced brain
microbleeds in mice. Panel A shows data from a stereomicroscope
count of surface microbleeds in brains from LPS treated mice (n=8)
or LPS+artemether-treated mice (n=8). The left panel shows
representative images from each of the two groups; arrows indicate
microbleeds. The right panel shows a statistical analysis
(*P<0.05, two-tailed t-test with Welch correction); data is
expressed as mean.+-.SD. As compared to LPS treated animals, brains
from ARM treated mice showed a robust reduction in total surface
microbleeds. Panel B shows data from quantification of microbleeds
on brain slices stained by hematoxylin and eosin. The left panel
shows representative images of stained brain slices from each of
the two groups; the arrows indicate microbleeds on the slices; the
right panel chart shows a statistical analysis of microbleeds count
(**P<0.01, unpaired two-tailed t-test with Welch's correction).
Data is expressed as mean.+-.SD, n=8 for both LPS treated and
LPS+ARM treated groups. Similar to the surface microbleed counts,
ARM treatment significantly reduced the total number of microbleeds
inside the mouse brains.
[0115] FIG. 9 shows that artemether (ARM) rescues microbleeding
induced by lipopolysaccharide (LPS) in mice. Panel (A) shows
representative 3-D reconstructed images from T2*-Weighted Gradient
Echo (GRE) MRI sequence with high resolution detection, in mouse
cerebral cortex two days after LPS injection or in LPS+ARM treated
brains. Arrows indicate microbleeds. (B) is a bar graph showing the
number of microbleedings per brain in a vehicle control group and a
group treated with artemether (ARM). Quantification of total
microbleed volume was calculated using semi-automated software
(Display), normalized to total brain volume, and expressed as total
voxel in 10000 counts. Data is expressed as mean.+-.SD (*P<0.05,
two-tailed t-test with Welch correction); n=8 for both LPS treated
and LPS+ARM treated groups, 2 for naive controls.
[0116] FIG. 10 shows that artemether (ARM) reduces ICH in an
anti-.beta.3 integrin mouse model of intracerebral hemorrhage.
Panel A shows representative raw T2*-Weighted Gradient Echo (GRE)
MRI images of brains of mice injected with anti-.beta.3 integrin
serum at post-natal day 2 alone (left) or treated with ARM (right).
Panel B shows paraffin-embedded blocks of coronally-cut whole
brains from anti-.beta.3 serum injected mice without (left) or with
(right) ARM treatment, respectively. Panel C shows quantification
of frequency of intracerebral hemorrhage in mice injected with
anti-.beta.3 integrin serum alone or with ARM treatment. Data is
expressed as mean.+-.SD (**P<0.01, two-tailed t-test with Welch
correction); n=29 and 24 for anti-.beta.3 integrin serum injected
mice without or with ARM treatment, respectively.
[0117] FIG. 11 shows a plot of blood hemoglobin (g/dl) (y-axis) for
controls, and for mice treated with artemether (ARM) (Treatment
Dose, and 4.times. Treatment Dose). ARM treatment for 3 days did
not cause anemia in mice. Bloods were tested for hemoglobin
concentration after ARM treatment. Blood hemoglobin concentration
was assessed using Drabkins' method. Spectrophotometer data was
compared to a standard curve from standard cyanmethemoglobin
concentrations. The control group received no drug. The Treatment
Dose group received 3 days injection of low dose ARM (25 mg/kg);
4.times. Treatment Dose group received 3 days injection of high
dose ARM (100 mg/kg). Data is expressed as mean.+-.SD (nsP>0.05,
one-way ANOVA, n=4).
[0118] FIG. 12 shows the pharmacological and genetic induction of
loss of cerebrovascular stabilization in developing zebrafish. (A)
Schematic representation of genetic pathways involved in
cerebrovascular stabilization. (B) Schematic representation of
VE-cadherin-mediated cell-cell adhesion regulated in part by Cdc42.
(C) Schematic representation illustrating that unprenylated Cdc42
remains inactive (GDP-bound) and associated with guanine nucleotide
dissociation inhibitor (GDI). (D) Photograph depicting un-injected
embryos. (E) Photograph depicting embryos injected with MOs
targeting hmgcrb (E). (F) Photograph depicting embryos injected
with MOs targeting pggt1b. (G) Photograph depicting embryos
injected with MOs targeting .beta.pix. (H) Photograph depicting
embryos injected with MOs targeting pak2a. Arrows denote the sites
of abnormal accumulation of blood. (I, K) are representative
photomicrographs of Tg(fli1:EGFP);(gata-1:DsRed) embryos incubated
in DMSO. (J, L) are representative photomicrographs of
Tg(fli1:EGFP);(gata-1:DsRed) embryos incubated in atorvastatin. The
arrows in (J) indicate areas where stagnant DsRed-positive
erythrocyte accumulation is observed. The arrows in (L) denote
distended cerebral vessels in the same fish. (M, P) are photographs
depicting hemorrhages associated with the fragmentation of the
underlying vasculature. (N, O) depict representative bright-field
photomicrographs of Tg (fli1:EGFP); (gata-1:DsRed) embryos
incubated in DMSO. (Q, R) depict representative bright-field
photomicrographs of Tg (fli1:EGFP);(gata-1:DsRed) embryos incubated
in atorvastatin. The asterisk denotes the hemorrhage and the black
dotted area shows the field of interest. Z-stack projections of the
black dotted area in the same Tg(fli1:EGFP);(gata-1:DsRed) embryos.
The white asterisk denotes DsRed-positive erythrocytes and the
white arrows show regions where vascular disintegration is
observed. Anterior is to the left as shown in (I-R).
[0119] FIG. 13 shows the HMGCR molecular pathway that leads to
vascular stability in zebrafish. Panels A & B: Schematics
illustrating stable EC junctions are maintained by a
Cdc42-dependent and VE-cadherin-mediated cell-cell adhesion. Panel
C shows that splice-inducing morpholinos designed against cdh5
induced intracerebral hemorrhage in zebrafish at 36-48 hpf (lateral
images are shown).
[0120] FIG. 14 Panels (A-B) shows that artesunate dose-dependently
rescues hemorrhage phenotype induced by morpholinos targeting
membrane stability of brain vessels in zebrafish. (A) Schematic
diagram showing the target sites of the three morpholinos studied.
(B) Artesunate dose-dependently rescues all three
morpholinos-induced brain hemorrhage in zebrafish. Panels (C-D)
Artesunate rescues the ICH phenotype underlying the bbh.sup.m292
mutation. (C) Upper panel, partial exon-intron organization of bPix
gene showing the point mutation effecting splicing of the gene.
Lower panel, RT-PCR analysis of wild-type and bbh.sup.m292 mutant
cDNA with primers flanking exon-14. (D) Upper panel, the phenotypes
of bbh.sup.m292 mutants treated with DMSO or artesunate and imaged
at 48 hpf. The arrows denote sites of hemorrhage. Lower panel,
percentages of bbh.sup.m292 embryos with brain hemorrhage rescued
by artesunate.
[0121] FIG. 15 shows that LPS induces brain hemorrhage in
developing zebrafish embryo and artemether have protective effects
on LPS-induced mortality. (A) Survival curves of developing
zebrafish embryos when LPS is delivered in fish water at 24 hours
post fertilization (hpf). (B) shows that artemether in fish water
had a protective effect on fish survival. (C) shows that LPS
treatment of 24 hpf embryos resulted in 52% of embryos (n=120) with
brain hemorrhage (arrow points to hemorrhage). (D) Bar graph
representing percent (%) cerebral hemorrhage in (C).
[0122] FIG. 16 shows that statin exacerbates LPS-induced
intracerebral hemorrhage in mice. (A) Atorvastatin (50 mg/kg)
treatment in addition to LPS (5 mg/kg), resulted in 100% mortality
24 hours after the treatments, while LPS treatment alone only
result in 25% mortality at the same time examined, and statin alone
did not cause any mortality (n=5). (B) Atorvastatin treatment
significantly increased the number of large hemorrhages caused by
LPS.
DETAILED DESCRIPTION OF THE INVENTION
Glossary
[0123] The term "active" as used herein refers to the ingredient,
component or constituent of the compositions of the described
invention responsible for the intended therapeutic effect. The term
"administer" as used herein means to give or to apply. The term
"administering" as used herein includes in vivo administration, as
well as administration directly to cells or a tissue ex vivo.
[0124] The term "agonist" as used herein refers to a chemical
substance capable of activating a receptor to induce a full or
partial pharmacological response. Receptors can be activated or
inactivated by either endogenous or exogenous agonists and
antagonists, resulting in stimulating or inhibiting a biological
response. A physiological agonist is a substance that creates the
same bodily responses, but does not bind to the same receptor. An
endogenous agonist for a particular receptor is a compound
naturally produced by the body which binds to and activates that
receptor. A superagonist is a compound that is capable of producing
a greater maximal response than the endogenous agonist for the
target receptor, and thus an efficiency greater than 100%. This
does not necessarily mean that it is more potent than the
endogenous agonist, but is rather a comparison of the maximum
possible response that can be produced inside a cell following
receptor binding. Full agonists bind and activate a receptor,
displaying full efficacy at that receptor. Partial agonists also
bind and activate a given receptor, but have only partial efficacy
at the receptor relative to a full agonist. An inverse agonist is
an agent which binds to the same receptor binding-site as an
agonist for that receptor and reverses constitutive activity of
receptors. Inverse agonists exert the opposite pharmacological
effect of a receptor agonist. An irreversible agonist is a type of
agonist that binds permanently to a receptor in such a manner that
the receptor is permanently activated. It is distinct from a mere
agonist in that the association of an agonist to a receptor is
reversible, whereas the binding of an irreversible agonist to a
receptor is believed to be irreversible. This causes the compound
to produce a brief burst of agonist activity, followed by
desensitization and internalization of the receptor, which with
long-term treatment produces an effect more like an antagonist. A
selective agonist is specific for one certain type of receptor.
[0125] The term "amplification" as used herein refers to a
replication of genetic material that results in an increase in the
number of copies of that genetic material.
[0126] Anatomical Terms:
[0127] When referring to animals, that typically have one end with
a head and mouth, with the opposite end often having the anus and
tail, the head end is referred to as the cranial end, while the
tail end is referred to as the caudal end. Within the head itself,
rostral refers to the direction toward the end of the nose, and
caudal is used to refer to the tail direction. The surface or side
of an animal's body that is normally oriented upwards, away from
the pull of gravity, is the dorsal side; the opposite side,
typically the one closest to the ground when walking on all legs,
swimming or flying, is the ventral side. On the limbs or other
appendages, a point closer to the main body is "proximal"; a point
farther away is "distal". Three basic reference planes are used in
zoological anatomy. A "sagittal" plane divides the body into left
and right portions. The "midsagittal" plane is in the midline, i.e.
it would pass through midline structures such as the spine, and all
other sagittal planes are parallel to it. A "coronal" plane divides
the body into dorsal and ventral portions. A "transverse" plane
divides the body into cranial and caudal portions.
[0128] When referring to humans, the body and its parts are always
described using the assumption that the body is standing upright.
Portions of the body which are closer to the head end are
"superior" (corresponding to cranial in animals), while those
farther away are "inferior" (corresponding to caudal in animals).
Objects near the front of the body are referred to as "anterior"
(corresponding to ventral in animals); those near the rear of the
body are referred to as "posterior" (corresponding to dorsal in
animals). A transverse, axial, or horizontal plane is an X-Y plane,
parallel to the ground, which separates the superior/head from the
inferior/feet. A coronal or frontal plane is a Y-Z plane,
perpendicular to the ground, which separates the anterior from the
posterior. A sagittal plane is an X-Z plane, perpendicular to the
ground and to the coronal plane, which separates left from right.
The midsagittal plane is the specific sagittal plane that is
exactly in the middle of the body.
[0129] Structures near the midline are called medial and those near
the sides of animals are called lateral. Therefore, medial
structures are closer to the midsagittal plane, lateral structures
are further from the midsagittal plane. Structures in the midline
of the body are median. For example, the tip of a human subject's
nose is in the median line.
[0130] Ipsilateral means on the same side, contralateral means on
the other side and bilateral means on both sides. Structures that
are close to the center of the body are proximal or central, while
ones more distant are distal or peripheral. For example, the hands
are at the distal end of the arms, while the shoulders are at the
proximal ends.
[0131] The term "antagonist" as used herein refers to a substance
that counteracts the effects of another substance.
[0132] The terms "apoptosis" or "programmed cell death" refer to a
highly regulated and active process that contributes to biologic
homeostasis comprised of a series of biochemical events that lead
to a variety of morphological changes, including blebbing, changes
to the cell membrane, such as loss of membrane asymmetry and
attachment, cell shrinkage, nuclear fragmentation, chromatin
condensation and chromosomal DNA fragmentation, without damaging
the organism.
[0133] Apoptotic cell death is induced by many different factors
and involves numerous signaling pathways, some dependent on caspase
proteases (a class of cysteine proteases) and others that are
caspase independent. It can be triggered by many different cellular
stimuli, including cell surface receptors, mitochondrial response
to stress, and cytotoxic T cells, resulting in activation of
apoptotic signaling pathways.
[0134] The caspases involved in apoptosis convey the apoptotic
signal in a proteolytic cascade, with caspases cleaving and
activating other caspases that then degrade other cellular targets
that lead to cell death. The caspases at the upper end of the
cascade include caspase-8 and caspase-9. Caspase-8 is the initial
caspase involved in response to receptors with a death domain (DD)
like Fas.
[0135] Receptors in the tumor necrosis factor receptor family are
associated with the induction of apoptosis, as well as inflammatory
signaling. The Fas receptor (CD95) mediates apoptotic signaling by
Fas-ligand expressed on the surface of other cells. The Fas-FasL
interaction plays an important role in the immune system and lack
of this system leads to autoimmunity, indicating that Fas-mediated
apoptosis removes self-reactive lymphocytes. Fas signaling also is
involved in immune surveillance to remove transformed cells and
virus infected cells. Binding of Fas to oligomerized FasL on
another cell activates apoptotic signaling through a cytoplasmic
domain termed the death domain (DD) that interacts with signaling
adaptors including FAF, FADD and DAX to activate the caspase
proteolytic cascade. Caspase-8 and caspase-10 first are activated
to then cleave and activate downstream caspases and a variety of
cellular substrates that lead to cell death.
[0136] Mitochondria participate in apoptotic signaling pathways
through the release of mitochondrial proteins into the cytoplasm.
Cytochrome c, a key protein in electron transport, is released from
mitochondria in response to apoptotic signals, and activates
Apaf-1, a protease released from mitochondria. Activated Apaf-1
activates caspase-9 and the rest of the caspase pathway.
Smac/DIABLO is released from mitochondria and inhibits IAP proteins
that normally interact with caspase-9 to inhibit apoptosis.
Apoptosis regulation by Bcl-2 family proteins occurs as family
members form complexes that enter the mitochondrial membrane,
regulating the release of cytochrome c and other proteins. Tumor
necrosis factor family receptors that cause apoptosis directly
activate the caspase cascade, but can also activate Bid, a Bcl-2
family member, which activates mitochondria-mediated apoptosis.
Bax, another Bcl-2 family member, is activated by this pathway to
localize to the mitochondrial membrane and increase its
permeability, releasing cytochrome c and other mitochondrial
proteins. Bcl-2 and Bcl-xL prevent pore formation, blocking
apoptosis. Like cytochrome c, AIF (apoptosis-inducing factor) is a
protein found in mitochondria that is released from mitochondria by
apoptotic stimuli. While cytochrome C is linked to
caspase-dependent apoptotic signaling, AIF release stimulates
caspase-independent apoptosis, moving into the nucleus where it
binds DNA. DNA binding by AIF stimulates chromatin condensation,
and DNA fragmentation, perhaps through recruitment of
nucleases.
[0137] The mitochondrial stress pathway begins with the release of
cytochrome c from mitochondria, which then interacts with Apaf-1,
causing self-cleavage and activation of caspase-9. Caspase-3, -6
and -7 are downstream caspases that are activated by the upstream
proteases and act themselves to cleave cellular targets.
[0138] Granzyme B and perforin proteins released by cytotoxic T
cells induce apoptosis in target cells, forming transmembrane
pores, and triggering apoptosis, perhaps through cleavage of
caspases, although caspase-independent mechanisms of granzyme B
mediated apoptosis have been suggested.
[0139] Fragmentation of the nuclear genome by multiple nucleases
activated by apoptotic signaling pathways to create a nucleosomal
ladder is a cellular response characteristic of apoptosis. One
nuclease involved in apoptosis is DNA fragmentation factor (DFF), a
caspase-activated DNAse (CAD). DFF/CAD is activated through
cleavage of its associated inhibitor ICAD by caspases proteases
during apoptosis. DFF/CAD interacts with chromatin components such
as topoisomerase II and histone H1 to condense chromatin structure
and perhaps recruit CAD to chromatin. Another apoptosis activated
protease is endonuclease G (EndoG). EndoG is encoded in the nuclear
genome but is localized to mitochondria in normal cells. EndoG may
play a role in the replication of the mitochondrial genome, as well
as in apoptosis. Apoptotic signaling causes the release of EndoG
from mitochondria. The EndoG and DFF/CAD pathways are independent
since the EndoG pathway still occurs in cells lacking DFF.
[0140] Hypoxia, as well as hypoxia followed by reoxygenation can
trigger cytochrome c release and apoptosis. Glycogen synthase
kinase (GSK-3) a serine-threonine kinase ubiquitously expressed in
most cell types, appears to mediate or potentiate apoptosis due to
many stimuli that activate the mitochondrial cell death pathway
(Loberg, R D, et al. (2002) J. Biol. Chem. 277 (44): 41667-673). It
has been demonstrated to induce caspase 3 activation and to
activate the proapoptotic tumor suppressor gene p53. It also has
been suggested that GSK-3 promotes activation and translocation of
the proapoptotic Bcl-2 family member, Bax, which, upon aggregation
and mitochondrial localization, induces cytochrome c release. Akt
is a critical regulator of GSK-3, and phosphorylation and
inactivation of GSK-3 may mediate some of the antiapoptotic effects
of Akt.
[0141] The term "appearance" as used herein refers to an outward
aspect or presentation of oneself.
[0142] The term "apply" as used herein refers to placing in contact
with or to lay or spread on.
[0143] The term "assay marker" or "reporter gene" (or "reporter")
refers to a gene that can be detected, or easily identified and
measured. The expression of the reporter gene may be measured at
either the RNA level, or at the protein level. The gene product,
which may be detected in an experimental assay protocol, includes,
but is not limited to, marker enzymes, antigens, amino acid
sequence markers, cellular phenotypic markers, nucleic acid
sequence markers, and the like. Researchers may attach a reporter
gene to another gene of interest in cell culture, bacteria,
animals, or plants. For example, some reporters are selectable
markers, or confer characteristics upon on organisms expressing
them allowing the organism to be easily identified and assayed. To
introduce a reporter gene into an organism, researchers may place
the reporter gene and the gene of interest in the same DNA
construct to be inserted into the cell or organism. For bacteria or
eukaryotic cells in culture, this may be in the form of a plasmid.
Commonly used reporter genes may include, but are not limited to,
fluorescent proteins, luciferase, .beta.-galactosidase, and
selectable markers, such as chloramphenicol and kanomycin.
[0144] The term "associate" and its various grammatical forms as
used herein refers to joining, connecting, or combining to, either
directly, indirectly, actively, inactively, inertly, non-inertly,
completely or incompletely.
[0145] The term "in association with" as used herein refers to a
relationship between two substances that connects, joins or links
one substance with another
[0146] The term "biomarkers" (or "biosignatures") as used herein
refers to peptides, proteins, nucleic acids, antibodies, genes,
metabolites, or any other substances used as indicators of a
biologic state. It is a characteristic that is measured objectively
and evaluated as a cellular or molecular indicator of normal
biologic processes, pathogenic processes, or pharmacologic
responses to a therapeutic intervention. The term "indicator" as
used herein refers to any substance, number or ratio derived from a
series of observed facts that may reveal relative changes as a
function of time; or a signal, sign, mark, note or symptom that is
visible or evidence of the existence or presence thereof. Once a
proposed biomarker has been validated, it may be used to diagnose
disease risk, presence of disease in an individual, or to tailor
treatments for the disease in an individual (choices of drug
treatment or administration regimes). In evaluating potential drug
therapies, a biomarker may be used as a surrogate for a natural
endpoint, such as survival or irreversible morbidity. If a
treatment alters the biomarker, and that alteration has a direct
connection to improved health, the biomarker may serve as a
surrogate endpoint for evaluating clinical benefit. Clinical
endpoints are variables that can be used to measure how patients
feel, function or survive. Surrogate endpoints are biomarkers that
are intended to substitute for a clinical endpoint; these
biomarkers are demonstrated to predict a clinical endpoint with a
confidence level acceptable to regulators and the clinical
community.
[0147] The term "cDNA" refers to DNA synthesized from a mature mRNA
template. cDNA most often is synthesized from mature mRNA using the
enzyme reverse transcriptase. The enzyme operates on a single
strand of mRNA, generating its complementary DNA based on the
pairing of RNA base pairs (A, U, G, C) to their DNA complements (T,
A, C, G). There are several methods known for generating cDNA to
obtain, for example, eukaryotic cDNA whose introns have been
spliced. Generally, these methods incorporate the following steps:
a) a eukaryotic cell transcribes the DNA (from genes) into RNA
(pre-mRNA); b) the same cell processes the pre-mRNA strands by
splicing out introns, and adding a poly-A tail and 5'
methyl-guanine cap; c) this mixture of mature mRNA strands are
extracted from the cell; d) a poly-T oligonucleotide primer is
hybridized onto the poly-A tail of the mature mRNA template
(reverse transcriptase requires this double-stranded segment as a
primer to start its operation); e) reverse transcriptase is added,
along with deoxynucleotide triphosphates (A, T, G, C); f) the
reverse transcriptase scans the mature mRNA and synthesizes a
sequence of DNA that complements the mRNA template. This strand of
DNA is complementary DNA (see also Current Protocols in Molecular
Biology, John Wiley & Sons, incorporated in its entirety
herein).
[0148] The term "cell" is used herein to refer to the structural
and functional unit of living organisms and is the smallest unit of
an organism classified as living.
[0149] The term "cell culture" as used herein refers to
establishment and maintenance of cultures derived from dispersed
cells taken from original tissues, primary culture, or from a cell
line or cell strain.
[0150] The term "cell line" as used herein refers to an
immortalized cell, which have undergone transformation and can be
passed indefinitely in culture.
[0151] The term "compatible" as used herein means that the
components of a composition are capable of being combined with each
other in a manner such that there is no interaction that would
substantially reduce the efficacy of the composition under ordinary
use conditions.
[0152] The terms "composition" and "formulation" are used
interchangeably herein to refer to a product of the described
invention that comprises all active and inert ingredients. The
terms "pharmaceutical composition" or "pharmaceutical formulation"
as used herein refer to a composition or formulation that is
employed to prevent, reduce in intensity, cure or otherwise treat a
target condition or disease.
[0153] The term "contacting" as used herein refers to bring or put
in contact, to be in or come into contact. The term "contact" as
used herein refers to a state or condition of touching or of
immediate or local proximity. Contacting a composition to a target
destination, such as, but not limited to, an organ, a tissue, or a
cell, may occur by any means of administration known to the skilled
artisan.
[0154] The terms "deletion" and "deletion mutation" are used
interchangeably herein to refer to that in which a base or bases
are lost from the DNA.
[0155] The term "derivative" as used herein means a compound that
may be produced from another compound of similar structure in one
or more steps. A "derivative" or "derivatives" of a peptide or a
compound retains at least a degree of the desired function of the
peptide or compound. Accordingly, an alternate term for
"derivative" may be "functional derivative." Derivatives can
include chemical modifications of the peptide, such as akylation,
acylation, carbamylation, iodination or any modification that
derivatizes the peptide. Such derivatized molecules include, for
example, those molecules in which free amino groups have been
derivatized to form amine hydrochlorides, p-toluene sulfonyl
groups, carbobenzoxy groups, t-butyloxycarbonyl groups,
chloroacetyl groups or formal groups. Free carboxyl groups can be
derivatized to form salts, esters, amides, or hydrazides. Free
hydroxyl groups can be derivatized to form O-acyl or O-alkyl
derivatives. The imidazole nitrogen of histidine can be derivatized
to form N-im-benzylhistidine. Also included as derivatives or
analogues are those peptides that contain one or more naturally
occurring amino acid derivative of the twenty standard amino acids,
for example, 4-hydroxyproline, 5-hydroxylysine, 3-methylhistidine,
homoserine, ornithine or carboxyglutamiate, and can include amino
acids that are not linked by peptide bonds. Such peptide
derivatives can be incorporated during synthesis of a peptide, or a
peptide can be modified by well-known chemical modification methods
(see, e.g., Glazer et al. (1975), Chemical Modification of
Proteins, Selected Methods and Analytical Procedures, Elsevier
Biomedical Press, New York).
[0156] The term "detectable marker" encompasses both selectable
markers and assay markers. The term "selectable markers" refers to
a variety of gene products to which cells transformed with an
expression construct can be selected or screened, including
drug-resistance markers, antigenic markers useful in
fluorescence-activated cell sorting, adherence markers such as
receptors for adherence ligands allowing selective adherence, and
the like. When a nucleic acid is prepared or altered synthetically,
advantage can be taken of known codon preferences of the intended
host where the nucleic acid is to be expressed.
[0157] The term "detectable response" refers to any signal or
response that may be detected in an assay, which may be performed
with or without a detection reagent. Detectable responses include,
but are not limited to, radioactive decay and energy (e.g.,
fluorescent, ultraviolet, infrared, visible) emission, absorption,
polarization, fluorescence, phosphorescence, transmission,
reflection or resonance transfer. Detectable responses also include
chromatographic mobility, turbidity, electrophoretic mobility, mass
spectrum, ultraviolet spectrum, infrared spectrum, nuclear magnetic
resonance spectrum and x-ray diffraction. Alternatively, a
detectable response may be the result of an assay to measure one or
more properties of a biologic material, such as melting point,
density, conductivity, surface acoustic waves, catalytic activity
or elemental composition. A "detection reagent" is any molecule
that generates a detectable response indicative of the presence or
absence of a substance of interest. Detection reagents include any
of a variety of molecules, such as antibodies, nucleic acid
sequences and enzymes. To facilitate detection, a detection reagent
may comprise a marker.
[0158] The term "differentiation" as used herein refers to a
property of cells to exhibit tissue-specific differentiated
properties in culture.
[0159] The term "effective amount" refers to the amount necessary
or sufficient to realize a desired biologic effect.
[0160] The term "EC50" as used herein refers to the concentration
(expressed in molar units or g/L) of a drug that produces 50% of
the maximal possible effect of that drug.
[0161] The term "expression system" refers to a genetic sequence,
which includes a protein encoding region operably linked to all of
the genetic signals necessary to achieve expression of the protein
encoding region. Traditionally, the expression system will include
a regulatory element such as, for example, a promoter or enhancer,
to increase transcription and/or translation of the protein
encoding region, or to provide control over expression. The
regulatory element may be located upstream or downstream of the
protein encoding region, or may be located at an intron (non-coding
portion) interrupting the protein encoding region. Alternatively,
it also is possible for the sequence of the protein encoding region
itself to comprise regulatory ability.
[0162] The term "hpf" as used herein refers to hours post
fertilization.
[0163] The term "hybridization" refers to the process of combining
complementary, single-stranded nucleic acids into a single
molecule. Nucleotides will bind to their complement under normal
conditions, so two perfectly complementary strands will bind (or
`anneal`) to each other readily. However, due to the different
molecular geometries of the nucleotides, a single inconsistency
between the two strands will make binding between them more
energetically unfavorable. Measuring the effects of base
incompatibility by quantifying the rate at which two strands anneal
can provide information as to the similarity in base sequence
between the two strands being annealed. The term "specifically
hybridizes" as used herein refers to the process whereby a nucleic
acid distinctively or definitively forming base pairs with
complementary regions of at least one strand of DNA that was not
originally paired to the nucleic acid. A nucleic acid that
selectively hybridizes undergoes hybridization, under stringent
hybridization conditions, of the nucleic acid sequence to a
specified nucleic acid target sequence to a detectably greater
degree (e.g., at least 2-fold over background) than its
hybridization to non-target nucleic acid sequences and to the
substantial exclusion of non-target nucleic acids. Selectively
hybridizing sequences typically have about at least 70%, at least
75%, at least 80%, at least 85%, at least 90%, at least 95%, at
least 96%, at least 97%, at least 98%, or at least 99% sequence
identity, or 100% sequence identity (i.e., complementary) with each
other.
[0164] The term "hypomorphic mutation" as used herein refers to a
type of mutation in which the altered gene product possesses a
reduced level of activity, or in which the wild-type gene product
is expressed at a reduced level.
[0165] The terms "inhibiting", "inhibit" or "inhibition" are used
herein to refer to reducing the amount or rate of a process, to
stopping the process entirely, or to decreasing, limiting, or
blocking the action or function thereof. Inhibition may include a
reduction or decrease of the amount, rate, action function, or
process of a substance by at least 5%, at least 10%, at least 15%,
at least 20%, at least 25%, at least 30%, at least 40%, at least
45%, at least 50%, at least 55%, at least 60%, at least 65%, at
least 70%, at least 75%, at least 80%, at least 85%, at least 90%,
at least 95%, at least 98%, or at least 99%.
[0166] The term "inhibitor" as used herein refers to a molecule
that binds to an enzyme thereby decreasing enzyme activity. Enzyme
inhibitors are molecules that bind to enzymes thereby decreasing
enzyme activity. The binding of an inhibitor may stop substrate
from entering the active site of the enzyme and/or hinder the
enzyme from catalyzing its reaction. Inhibitor binding is either
reversible or irreversible. Irreversible inhibitors usually react
with the enzyme and change it chemically, for example, by modifying
key amino acid residues needed for enzymatic activity. In contrast,
reversible inhibitors bind non-covalently and produce different
types of inhibition depending on whether these inhibitors bind the
enzyme, the enzyme-substrate complex, or both. Enzyme inhibitors
often are evaluated by their specificity and potency.
[0167] An "isolated molecule" is a molecule that is substantially
pure and is free of other substances with which it is ordinarily
found in nature or in vivo systems to an extent practical and
appropriate for its intended use. In particular, the compositions
are sufficiently pure and are sufficiently free from other
biological constituents of host cells so as to be useful in, for
example, producing pharmaceutical preparations or sequencing if the
composition is a nucleic acid, peptide, or polysaccharide. Because
compositions may be admixed with a pharmaceutically-acceptable
carrier in a pharmaceutical preparation, the compositions may
comprise only a small percentage by weight of the preparation. The
composition is nonetheless substantially pure in that it has been
substantially separated from the substances with which it may be
associated in living systems or during synthesis. As used herein,
the term "substantially pure" refers purity of at least 75%, at
least 80%, at least 85%, at least 90%, at least 95% or at least 99%
pure as determined by an analytical protocol. Such protocols may
include, for example, but are not limited to, fluorescence
activated cell sorting, high performance liquid chromatography, gel
electrophoresis, chromatography, and the like.
[0168] The term "minimizing progression" as used herein refers to
reducing the amount, extent, size, or degree of development of a
sequence or series of events.
[0169] The term "modulate" as used herein means to regulate, alter,
adapt, or adjust to a certain measure or proportion.
[0170] The term "morpholino oligonucleotides (MO)" as used herein
refer to nonionic DNA analogs with a phosphorodiamidate molecular
backbone, which blocks access of other molecules to specific
sequences within antisense nucleic acid sequences. Although they
possess altered backbone linkages compared with DNA or RNA,
morpholinos bind to complementary nucleic acid sequences by
Watson-Crick base-pairing. This binding is no tighter than binding
of analogous DNA and RNA oligomers, necessitating the use of
relatively long 25-base morpholinos for antisense gene inhibition.
The backbone makes morpholinos resistant to digestion by nucleases.
Also, because the backbone lacks negative charge, it is thought
that morpholinos are less likely to interact nonselectively with
cellular proteins; such interactions often obscure the observation
of informative phenotypes (Corey, D. R. and J. M. Abrams (2001)
"Morpholino antisense oligonucleotides: tools for investigating
vertebrate development," Genome Biol. 2(5): 1015.1-1015.3). Duplex
formation between MOs and mRNA prevents translation through MO
hybridization near the mRNA translation initiation codon and
disrupts correct splicing by targeting the splice donor site Wada,
T. et al (2012) "Antisense morpholino targeting just upstream from
a poly(A) tail junction of material mRNA removes the tail and
inhibits translation," Nucleic Acids Res. 40 (22): e173).
[0171] The term "mutation" as used herein refers to a change of the
DNA sequence within a gene or chromosome of an organism resulting
in the creation of a new character or trait not found in the
parental type, or the process by which such a change occurs in a
chromosome, either through an alteration in the nucleotide sequence
of the DNA coding for a gene or through a change in the physical
arrangement of a chromosome. Three mechanisms of mutation include
substitution (exchange of one base pair for another), addition (the
insertion of one or more bases into a sequence), and deletion (loss
of one or more base pairs).
[0172] The term "nucleic acid" is used herein to refer to a DNA or
RNA polymer in either single- or double-stranded form, and unless
otherwise limited, encompasses known analogues having the essential
nature of natural nucleotides in that they hybridize to
single-stranded nucleic acids in a manner similar to naturally
occurring nucleotides (e.g., MO oligonucleotides).
[0173] The term "nucleotide" is used herein to refer to a chemical
compound that consists of a heterocyclic base, a sugar, and one or
more phosphate groups. In the most common nucleotides, the base is
a derivative of purine or pyrimidine, and the sugar is the pentose
deoxyribose or ribose. Nucleotides are the monomers of nucleic
acids, with three or more bonding together in order to form a
nucleic acid. Nucleotides are the structural units of RNA, DNA, and
several cofactors, including, but not limited to, CoA, FAD, DMN,
NAD, and NADP. Purines include adenine (A), and guanine (G);
pyrimidines include cytosine (C), thymine (T), and uracil (U).
[0174] The phrase "operably linked" refers to a first sequence(s)
or domain being positioned sufficiently proximal to a second
sequence(s) or domain so that the first sequence(s) or domain can
exert influence over the second sequence(s) or domain or a region
under control of that second sequence or domain.
[0175] The term "polynucleotide" refers to a DNA, RNA or analogs
thereof that have the essential nature of a natural ribonucleotide
in that they hybridize, under stringent hybridization conditions,
to substantially the same nucleotide sequence as naturally
occurring nucleotides and/or allow translation into the same amino
acid(s) as the naturally occurring nucleotide(s). A polynucleotide
may be full-length or a subsequence of a native or heterologous
structural or regulatory gene. Unless otherwise indicated, the term
includes reference to the specified sequence as well as the
complementary sequence thereof. Thus, DNAs or RNAs with backbones
modified for stability or for other reasons are "polynucleotides"
as that term is intended herein. Moreover, DNAs or RNAs comprising
unusual bases, such as inosine, or modified bases, such as
tritylated bases, to name just two examples, are polynucleotides as
the term is used herein. It will be appreciated that a great
variety of modifications have been made to DNA and RNA that serve
many useful purposes known to those of skill in the art. The term
polynucleotide as it is employed herein embraces such chemically,
enzymatically or metabolically modified forms of polynucleotides,
as well as the chemical forms of DNA and RNA characteristic of
viruses and cells, including among other things, simple and complex
cells.
[0176] The term "pharmaceutical composition" as used herein refers
to a composition that is employed to prevent, reduce in intensity,
cure or otherwise treat a target condition, syndrome, disorder or
disease.
[0177] The term "pharmaceutically acceptable carrier" as used
herein refers to any substantially non-toxic carrier conventionally
useable for administration of pharmaceuticals in which the isolated
polypeptide of the present invention will remain stable and
bioavailable. The pharmaceutically acceptable carrier must be of
sufficiently high purity and of sufficiently low toxicity to render
it suitable for administration to the mammal being treated. It
further should maintain the stability and bioavailability of an
active agent. The pharmaceutically acceptable carrier can be liquid
or solid and is selected, with the planned manner of administration
in mind, to provide for the desired bulk, consistency, etc., when
combined with an active agent and other components of a given
composition.
[0178] The term "pharmaceutically acceptable salt" as used herein
refers to those salts which are, within the scope of sound medical
judgment, suitable for use in contact with the tissues of humans
and lower animals without undue toxicity, irritation, allergic
response and the like and are commensurate with a reasonable
benefit/risk ratio. When used in medicine the salts should be
pharmaceutically acceptable, but non-pharmaceutically acceptable
salts may conveniently be used to prepare pharmaceutically
acceptable salts thereof. Such salts include, but are not limited
to, those prepared from the following acids: hydrochloric,
hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic,
salicylic, p-toluene sulphonic, tartaric, citric, methane
sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and
benzene sulphonic. Also, such salts may be prepared as alkaline
metal or alkaline earth salts, such as sodium, potassium or calcium
salts of the carboxylic acid group. By "pharmaceutically acceptable
salt" is meant those salts which are, within the scope of sound
medical judgment, suitable for use in contact with the tissues of
humans and lower animals without undue toxicity, irritation,
allergic response and the like and are commensurate with a
reasonable benefit/risk ratio. Pharmaceutically acceptable salts
are well-known in the art. For example, P. H. Stahl, et al.
describe pharmaceutically acceptable salts in detail in "Handbook
of Pharmaceutical Salts: Properties, Selection, and Use" (Wiley
VCH, Zurich, Switzerland: 2002). The salts may be prepared in situ
during the final isolation and purification of the compounds
described within the present invention or separately by reacting a
free base function with a suitable organic acid. Representative
acid addition salts include, but are not limited to, acetate,
adipate, alginate, citrate, aspartate, benzoate, benzenesulfonate,
bisulfate, butyrate, camphorate, camphorsulfonate, digluconate,
glycerophosphate, hemisulfate, heptanoate, hexanoate, fumarate,
hydrochloride, hydrobromide, hydroiodide,
2-hydroxyethansulfonate(isethionate), lactate, maleate,
methanesulfonate, nicotinate, 2-naphthalenesulfonate, oxalate,
pamoate, pectinate, persulfate, 3-phenylpropionate, picrate,
pivalate, propionate, succinate, tartrate, thiocyanate, phosphate,
glutamate, bicarbonate, p-toluenesulfonate and undecanoate. Also,
the basic nitrogen-containing groups may be quaternized with such
agents as lower alkyl halides such as methyl, ethyl, propyl, and
butyl chlorides, bromides and iodides; dialkyl sulfates like
dimethyl, diethyl, dibutyl and diamyl sulfates; long chain halides
such as decyl, lauryl, myristyl and stearyl chlorides, bromides and
iodides; arylalkyl halides like benzyl and phenethyl bromides and
others. Water or oil-soluble or dispersible products are thereby
obtained. Examples of acids which may be employed to form
pharmaceutically acceptable acid addition salts include such
inorganic acids as hydrochloric acid, hydrobromic acid, sulphuric
acid and phosphoric acid and such organic acids as oxalic acid,
maleic acid, succinic acid and citric acid. Basic addition salts
may be prepared in situ during the final isolation and purification
of compounds described within the invention by reacting a
carboxylic acid-containing moiety with a suitable base such as the
hydroxide, carbonate or bicarbonate of a pharmaceutically
acceptable metal cation or with ammonia or an organic primary,
secondary or tertiary amine. Pharmaceutically acceptable salts
include, but are not limited to, cations based on alkali metals or
alkaline earth metals such as lithium, sodium, potassium, calcium,
magnesium and aluminum salts and the like and nontoxic quaternary
ammonia and amine cations including ammonium, tetramethylammonium,
tetraethylammonium, methylamine, dimethylamine, trimethylamine,
triethylamine, diethylamine, ethylamine and the like. Other
representative organic amines useful for the formation of base
addition salts include ethylenediamine, ethanolamine,
diethanolamine, piperidine, piperazine and the like.
Pharmaceutically acceptable salts also may be obtained using
standard procedures well known in the art, for example, by reacting
a sufficiently basic compound such as an amine with a suitable acid
affording a physiologically acceptable anion. Alkali metal (for
example, sodium, potassium or lithium) or alkaline earth metal (for
example calcium or magnesium) salts of carboxylic acids may also be
made.
[0179] The term "primer" refers to a nucleic acid which, when
hybridized to a strand of DNA, is capable of initiating the
synthesis of an extension product in the presence of a suitable
polymerization agent. The primer is sufficiently long to uniquely
hybridize to a specific region of the DNA strand. A primer also may
be used on RNA, for example, to synthesize the first strand of
cDNA.
[0180] The term "promoter" refers to a region of DNA upstream,
downstream, or distal, from the start of transcription and involved
in recognition and binding of RNA polymerase and other proteins to
initiate transcription. For example, T7, T3 and Sp6 are RNA
polymerase promoter sequences. In RNA synthesis, promoters are a
means to demarcate which genes should be used for messenger RNA
creation and by extension, control which proteins the cell
manufactures. Promoters represent critical elements that can work
in concert with other regulatory regions (enhancers, silencers,
boundary elements/insulators) to direct the level of transcription
of a given gene.
[0181] The term "reduced" or "to reduce" as used herein refer to a
diminishment, a decrease, an attenuation or abatement of the
degree, intensity, extent, size, amount, density or number of.
[0182] The term "refractory" as used herein refers to the state of
being unaffected, unresponsive, resistant or not fully
responsive.
[0183] The term "restriction digestion" refers to a procedure used
to prepare DNA for analysis or other processing. Also known as DNA
fragmentation, it uses a restriction enzyme to selectively cleave
strands of DNA into shorter segments.
[0184] The term "restriction enzyme" (or restriction endonuclease)
refers to an enzyme that cuts double-stranded DNA.
[0185] The term "restriction sites" or "restriction recognition
sites" refer to particular sequences of nucleotides that are
recognized by restriction enzymes as sites to cut a DNA molecule.
The sites are generally, but not necessarily, palindromic, (because
restriction enzymes usually bind as homodimers) and a particular
enzyme may cut between two nucleotides within its recognition site,
or somewhere nearby.
[0186] The term "Rho" as used herein refers to a subfamily of
proteins related to the RAS subgroup thought to be involved in cell
transformation and the regulation of morphology and function of
dendritic cells. Non-limiting examples of Rho proteins include
RhoA, RhoB and RhoC, RhoG, RhoH, RhoQ, RhoU RhoV, Rnd1, 2 and 3
(e.g., RhoE), and RAC1, 2, 3 and 4.
[0187] Sequence:
[0188] The following terms are used herein to describe the sequence
relationships between two or more nucleic acids or polynucleotides:
(a) "reference sequence", (b) "comparison window", (c) "sequence
identity", (d) "percentage of sequence identity", and (e)
"substantial identity".
[0189] The term "reference sequence" refers to a sequence used as a
basis for sequence comparison. A reference sequence may be a subset
or the entirety of a specified sequence; for example, as a segment
of a full-length cDNA or gene sequence, or the complete cDNA or
gene sequence.
[0190] The term "comparison window" refers to a contiguous and
specified segment of a polynucleotide sequence, wherein the
polynucleotide sequence may be compared to a reference sequence and
wherein the portion of the polynucleotide sequence in the
comparison window may comprise additions or deletions (i.e., gaps)
compared to the reference sequence (which does not comprise
additions or deletions) for optimal alignment of the two sequences.
Generally, the comparison window is at least 20 contiguous
nucleotides in length, and optionally can be at least 30 contiguous
nucleotides in length, at least 40 contiguous nucleotides in
length, at least 50 contiguous nucleotides in length, at least 100
contiguous nucleotides in length, or longer. Those of skill in the
art understand that to avoid a high similarity to a reference
sequence due to inclusion of gaps in the polynucleotide sequence, a
gap penalty typically is introduced and is subtracted from the
number of matches.
[0191] Methods of alignment of sequences for comparison are
well-known in the art. Optimal alignment of sequences for
comparison may be conducted by the local homology algorithm of
Smith and Waterman (1981), Adv. Appl. Math. 2:482; by the homology
alignment algorithm of Needleman and Wunsch (1970), J. Mol. Biol.
48:443; by the search for similarity method of Pearson and Lipman
(1988), Proc. Natl. Acad. Sci. 85:2444; by computerized
implementations of these algorithms, including, but not limited to:
CLUSTAL in the PC/Gene program by Intelligenetics, Mountain View,
Calif.; GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin
Genetics Software Package, Genetics Computer Group (GCG), 575
Science Dr., Madison, Wis., USA; the CLUSTAL program is well
described by Higgins and Sharp (1988), Gene 73:237-244; Higgins and
Sharp (1989) CABIOS 5:151-153; Corpet, et al. (1988) Nucleic Acids
Research 16:10881-90; Huang, et al. (1992) Computer Applications in
the Biosciences 8:155-65, and Pearson, et al. (1994) Methods in
Molecular Biology 24:307-331. The BLAST family of programs, which
can be used for database similarity searches, includes: BLASTN for
nucleotide query sequences against nucleotide database sequences;
BLASTX for nucleotide query sequences against protein database
sequences; BLASTP for protein query sequences against protein
database sequences; TBLASTN for protein query sequences against
nucleotide database sequences; and TBLASTX for nucleotide query
sequences against nucleotide database sequences. See, Current
Protocols in Molecular Biology, Chapter 19, Ausubel, et al., Eds.,
Greene Publishing and Wiley-Interscience, New York (1995).
[0192] Unless otherwise stated, sequence identity/similarity values
provided herein refer to the value obtained using the BLAST 2.0
suite of programs using default parameters (Altschul et al. (1997)
Nucleic Acids Res. 25:3389-3402). Software for performing BLAST
analyses is publicly available, e.g., through the National Center
for Biotechnology-Information (http://www.hcbi.nlm.nih.gov/). This
algorithm involves first identifying high scoring sequence pairs
(HSPs) by identifying short words of length W in the query
sequence, which either match or satisfy some positive-valued
threshold score T when aligned with a word of the same length in a
database sequence. T is referred to as the neighborhood word score
threshold (Altschul et al., supra). These initial neighborhood word
hits act as seeds for initiating searches to find longer HSPs
containing them. The word hits then are extended in both directions
along each sequence for as far as the cumulative alignment score
can be increased. Cumulative scores are calculated using, for
nucleotide sequences, the parameters M (reward score for a pair of
matching residues; always>0) and N (penalty score for
mismatching residues; always<0). For amino acid sequences, a
scoring matrix is used to calculate the cumulative score. Extension
of the word hits in each direction are halted when: the cumulative
alignment score falls off by the quantity X from its maximum
achieved value; the cumulative score goes to zero or below, due to
the accumulation of one or more negative-scoring residue
alignments; or the end of either sequence is reached. The BLAST
algorithm parameters W, T, and X determine the sensitivity and
speed of the alignment. The BLASTN program (for nucleotide
sequences) uses as defaults a word length (W) of 11, an expectation
(E) of 10, a cutoff of 100, M=5, N=-4, and a comparison of both
strands. For amino acid sequences, the BLASTP program uses as
defaults a word length (W) of 3, an expectation (E) of 10, and the
BLOSUM62 scoring matrix (see Henikoff & Henikoff (1989) Proc.
Natl. Acad. Sci. USA 89:10915).
[0193] In addition to calculating percent sequence identity, the
BLAST algorithm also performs a statistical analysis of the
similarity between two sequences (see, e.g., Karlin & Altschul
(1993) Proc. Natl. Acad. Sci. USA 90:5873-5787). One measure of
similarity provided by the BLAST algorithm is the smallest sum
probability (P(N)), which provides an indication of the probability
by which a match between two nucleotide or amino acid sequences
would occur by chance. BLAST searches assume that proteins may be
modeled as random sequences. However, many real proteins comprise
regions of nonrandom sequences which may be homopolymeric tracts,
short-period repeats, or regions enriched in one or more amino
acids. Such low-complexity regions may be aligned between unrelated
proteins even though other regions of the protein are entirely
dissimilar. A number of low-complexity filter programs may be
employed to reduce such low-complexity alignments. For example, the
SEG (Wooten and Federhen (1993), Comput. Chem., 17:149-163) and XNU
(Claverie and States (1993) Comput. Chem., 17:191-201)
low-complexity filters may be employed alone or in combination.
[0194] The term "sequence identity" or "identity" in the context of
two nucleic acid or polypeptide sequences is used herein to refer
to the residues in the two sequences that are the same when aligned
for maximum correspondence over a specified comparison window. When
percentage of sequence identity is used in reference to proteins it
is recognized that residue positions that are not identical often
differ by conservative amino acid substitutions, i.e., where amino
acid residues are substituted for other amino acid residues with
similar chemical properties (e.g. charge or hydrophobicity) and
therefore do not change the functional properties of the molecule.
Where sequences differ in conservative substitutions, the percent
sequence identity may be adjusted upwards to correct for the
conservative nature of the substitution. Sequences that differ by
such conservative substitutions are said to have "sequence
similarity" or "similarity". Means for making this adjustment are
well-known to those of skill in the art. Typically this involves
scoring a conservative substitution as a partial rather than a full
mismatch, thereby increasing the percentage sequence identity.
Thus, for example, where an identical amino acid is given a score
of 1 and a non-conservative substitution is given a score of zero,
a conservative substitution is given a score between zero and 1.
The scoring of conservative substitutions is calculated, e.g.,
according to the algorithm of Meyers and Miller (1988) Computer
Applic. Biol. Sci., 4:11-17, e.g., as implemented in the program
PC/GENE (Intelligenetics, Mountain View, Calif., USA).
[0195] The term "percentage of sequence identity" as used herein
means the value determined by comparing two optimally aligned
sequences over a comparison window, wherein the portion of the
polynucleotide sequence in the comparison window may comprise
additions or deletions (i.e., gaps) as compared to the reference
sequence (which does not comprise additions or deletions) for
optimal alignment of the two sequences. The percentage is
calculated by determining the number of positions at which the
identical nucleic acid base or amino acid residue occurs in both
sequences to yield the number of matched positions, dividing the
number of matched positions by the total number of positions in the
window of comparison, and multiplying the result by 100 to yield
the percentage of sequence identity.
[0196] The term "substantial identity" of polynucleotide sequences
means that a polynucleotide comprises a sequence that has at least
70% sequence identity, at least 80% sequence identity, at least 90%
sequence identity and at least 95% sequence identity, compared to a
reference sequence using one of the alignment programs described
using standard parameters. One of skill will recognize that these
values may be adjusted appropriately to determine corresponding
identity of proteins encoded by two nucleotide sequences by taking
into account codon degeneracy, amino acid similarity, reading frame
positioning and the like. Substantial identity of amino acid
sequences for these purposes normally means sequence identity of at
least 60%, or at least 70%, at least 80%, at least 90%, or at least
95%. Another indication that nucleotide sequences are substantially
identical is if two molecules hybridize to each other under
stringent conditions. However, nucleic acids that do not hybridize
to each other under stringent conditions are still substantially
identical if the polypeptides that they encode are substantially
identical. This may occur, e.g., when a copy of a nucleic acid is
created using the maximum codon degeneracy permitted by the genetic
code. One indication that two nucleic acid sequences are
substantially identical is that the polypeptide that the first
nucleic acid encodes is immunologically cross reactive with the
polypeptide encoded by the second nucleic acid.
[0197] The terms "substantial identity" in the context of a peptide
indicates that a peptide comprises a sequence with at least 70%
sequence identity to a reference sequence, at least 80%, at least
85%, at least 90% or 95% sequence identity to the reference
sequence over a specified comparison window. Optionally, optimal
alignment is conducted using the homology alignment algorithm of
Needleman and Wunsch (1970) J. Mol. Biol. 48:443. An indication
that two peptide sequences are substantially identical is that one
peptide is immunologically reactive with antibodies raised against
the second peptide. Thus, a peptide is substantially identical to a
second peptide, for example, where the two peptides differ only by
a conservative substitution. Peptides which are "substantially
similar" share sequences as noted above except that residue
positions that are not identical may differ by conservative amino
acid changes.
[0198] The term "subject" or "individual" or "patient" are used
interchangeably to refer to a member of an animal species of
vertebrate origin, e.g., a zebrafish, to mammalian origin,
including but not limited to, mouse, rat, cat, goat, sheep, horse,
hamster, ferret, pig, dog, platypus, guinea pig, rabbit and a
primate, such as, for example, a monkey, ape, or human.
[0199] The phrase "subject in need thereof" as used herein refers
to a patient that (i) susceptible to ICH, BMH or CCM that will be
administered a therapeutic agent according to the described
invention to treat the ICH, BMH or CCM, (ii) is receiving a
therapeutic agent according to the described invention to treat
ICH/BMH or CCM; or (iii) has received a therapeutic agent according
to the described invention to treat ICH/BMH or CCM, unless the
context and usage of the phrase indicates otherwise.
[0200] The term "substitution" is used herein to refer to that in
which a base or bases are exchanged for another base or bases in
DNA. Substitutions may be synonymous substitutions or nonsynonymous
substitutions. As used herein, "synonymous substitutions" refer to
substitutions of one base for another in an exon of a gene coding
for a protein, such that the amino acid sequence produced is not
modified. The term "nonsynonymous substitutions" as used herein
refer to substitutions of one base for another in an exon of a gene
coding for a protein, such that the amino acid sequence produced is
modified.
[0201] The term "susceptible" as used herein refers to a member of
a population at risk.
[0202] The term "therapeutic agent" as used herein refers to a
drug, molecule, nucleic acid, protein, composition or other
substance that provides a therapeutic effect. The term "active" as
used herein refers to the ingredient, component or constituent of
the compositions of the present invention responsible for the
intended therapeutic effect. The terms "therapeutic agent" and
"active agent" are used interchangeably herein. The active agent
may be a therapeutically effective amount of at least one of an
active agent itself, a mimic, a derivative, an agonist of that
active agent, or a pharmaceutically acceptable salt thereof.
[0203] The term "therapeutic component" as used herein refers to a
therapeutically effective dosage (i.e., dose and frequency of
administration) that eliminates, reduces, or prevents the
progression of a particular disease manifestation in a percentage
of a population. An example of a commonly used therapeutic
component is the ED.sub.50, which describes the dose in a
particular dosage that is therapeutically effective for a
particular disease manifestation in 50% of a population.
[0204] The term "therapeutic effect" as used herein refers to a
consequence of treatment, the results of which are judged to be
desirable and beneficial. A therapeutic effect may include,
directly or indirectly, the arrest, reduction, or elimination of a
disease manifestation. A therapeutic effect also may include,
directly or indirectly, the arrest reduction or elimination of the
progression of a disease manifestation.
[0205] The terms "therapeutic amount", an "amount effective", or
"pharmaceutical amount" of one or more of the active agents and
used interchangeably to refer to an amount that is sufficient to
provide the intended benefit of treatment.
[0206] The intensity of effect of a drug (y-axis) can be plotted as
a function of the dose of drug administered (X-axis) (Goodman &
Gilman's The Pharmacological Basis of Therapeutics, Ed. Joel G.
Hardman, Lee E. Limbird, Eds., 10th Ed., McGraw Hill, New York
(2001), p. 25, 50). These plots are referred to as dose-effect
curves. Such a curve can be resolved into simpler curves for each
of its components. These concentration-effect relationships can be
viewed as having four characteristic variables: potency, slope,
maximal efficacy, and individual variation.
[0207] The location of the dose-effect curve along the
concentration axis is an expression of the potency of a drug
(Id).
[0208] The slope of the dose-effect curve reflects the mechanism of
action of a drug. The steepness of the curve dictates the range of
doses useful for achieving a clinical effect.
[0209] The terms "maximal efficacy" or "clinical efficacy" as used
interchangeably herein refer to the maximal effect that can be
produced by a drug. Maximal efficacy is determined principally by
the properties of the drug and its receptor-effector system and is
reflected in the plateau of the curve. In clinical use, a drug's
dosage may be limited by undesired effects.
[0210] The term "biological variability" as used herein refers to
an effect of varying intensity that may occur in different
individuals at a specified concentration of a drug. It follows that
a range of concentrations may be required to produce an effect of
specified intensity in all subjects.
[0211] Lastly, different individuals may vary in the magnitude of
their response to the same concentration of a drug when the
appropriate correction has been made for differences in potency,
maximal efficacy and slope.
[0212] The duration of a drug's action is determined by the time
period over which concentrations exceed the minimum effective
concentration (MEC). Following administration of a dose of drug,
its effects usually show a characteristic temporal pattern. A plot
of drug effect versus time illustrates the temporal characteristics
of drug effect and its relationship to the therapeutic window. A
lag period is present before the drug concentration exceeds the MEC
for the desired effect. Following onset of the response, the
intensity of the effect increases as the drug continues to be
absorbed and distributed. This reaches a peak, after which drug
elimination results in a decline in the effect's intensity that
disappears when the drug concentration falls back below the MEC.
The therapeutic window reflects a concentration range that provides
efficacy without unacceptable toxicity. Accordingly another dose of
drug should be given to maintain concentrations within the
therapeutic window.
[0213] The term "transcription termination signal" refers to a
section of genetic sequence that marks the end of gene or operon on
genomic DNA for transcription. In prokaryotes, two classes of
transcription termination signals are known: 1) intrinsic
transcription termination signals where a hairpin structure forms
within the nascent transcript that disrupts the mRNA-DNA-RNA
polymerase ternary complex; and 2) Rho-dependent transcription
termination signal that require Rho factor, an RNA helicase protein
complex to disrupt the nascent mRNA-DNA-RNA polymerase ternary
complex. In eukaryotes, transcription termination signals are
recognized by protein factors that co-transcriptionally cleave the
nascent RNA at a polyadenylation signal (i.e, "poly-A signal" or
"poly-A tail") halting further elongation of the transcript by RNA
polymerase. The subsequent addition of the poly-A tail at this site
stabilizes the mRNA and allows it to be exported outside the
nucleus. Termination sequences are distinct from termination codons
that occur in the mRNA and are the stopping signal for translation,
which also may be called nonsense codons.
[0214] The term "treat" or "treating" includes abrogating,
substantially inhibiting, slowing or reversing the progression of a
disease, condition or disorder, substantially ameliorating clinical
or esthetical symptoms of a condition, substantially preventing the
appearance of clinical or esthetical symptoms of a disease,
condition, or disorder, and protecting from harmful or annoying
symptoms. Treating further refers to accomplishing one or more of
the following: (a) reducing the severity of the disorder; (b)
limiting development of symptoms characteristic of the disorder(s)
being treated; (c) limiting worsening of symptoms characteristic of
the disorder(s) being treated; (d) limiting recurrence of the
disorder(s) in patients that have previously had the disorder(s);
and (e) limiting recurrence of symptoms in patients that were
previously asymptomatic for the disorder(s).
[0215] The terms "variants", "mutants", and "derivatives" are used
herein to refer to nucleotide sequences with substantial identity
to a reference nucleotide sequence. The differences in the
sequences may by the result of changes, either naturally or by
design, in sequence or structure. Natural changes may arise during
the course of normal replication or duplication in nature of the
particular nucleic acid sequence. Designed changes may be
specifically designed and introduced into the sequence for specific
purposes. Such specific changes may be made in vitro using a
variety of mutagenesis techniques. Such sequence variants generated
specifically may be referred to as "mutants" or "derivatives" of
the original sequence.
[0216] The term "vascular leakage" as used herein refers to a
pathologic increase in vascular permeability.
[0217] The term "vascular permeability" as used herein refers to
the net amount of a solute, typically a macromolecule that has
crossed a vascular bed and accumulated in the interstitium in
response to a vascular permeabilizing agent or at a site of
pathological angiogenesis.
[0218] The term "vascular stability" as used herein includes the
control of endothelial cell cytoskeleton and junction proteins and
the interaction of endothelial cells with mural cells.
[0219] The term "wild-type" as used herein refers to the typical
form of an organism, strain, gene, protein, nucleic acid, or
characteristic as it occurs in nature. Wild-type refers to the most
common phenotype in the natural population. The terms "wild-type"
and "naturally occurring" are used interchangeably.
[0220] According to one aspect, the described invention provides a
method for reducing incidence of bleeding in the brain by
administering a pharmaceutical composition containing a small
molecule therapeutic compound, a therapeutic amount of which is
effective to reduce incidence of bleeding in the brain by at least
30%, at least 35%, at least 40%, at least 45%, at least 50%, at
least 55%, by 60% or less, by 55% or less, by 50% or less, by 45%
or less, by 40% or less, by 35% or less, by 30% or less, relative
to a control.
[0221] According to some embodiments, the small molecule
therapeutic compound is selected from the group consisting of
artemether or a derivative of artemether. According to some
embodiments, the derivative of artemisinin is dihydroartemisinin,
artemisinin, or artesunate.
[0222] According to some embodiments, the small molecule
therapeutic compound is selected from the group consisting of
benidipine, lacidipine, ethynylestradiol or triptolide.
[0223] According to some embodiments, the bleeding in the brain is
induced by a statin, by a lipopolysaccharide, or both.
[0224] According to some embodiments, the statin is
atorvastatin.
[0225] According to some embodiments the bleeding in the brain is a
spontaneous intracerebral hemorrhage.
[0226] According to some embodiments, the spontaneous intracerebral
hemorrhage occurs in association with administration of a
statin.
[0227] According to some embodiments, the bleeding in the brain is
a brain microhemorrhage.
[0228] According to some embodiments, the brain microhemorrhage
occurs in association with administration of a statin.
[0229] According to some embodiments, the bleeding in the brain
comprises a brain vascular malformation.
[0230] According to some embodiments, the brain vascular
malformation is a cerebral cavernous malformation.
[0231] Where a range of values is provided, it is understood that
each intervening value, to the tenth of the unit of the lower limit
unless the context clearly dictates otherwise, between the upper
and lower limit of that range and any other stated or intervening
value in that stated range is encompassed within the invention. The
upper and lower limits of these smaller ranges which may
independently be included in the smaller ranges is also encompassed
within the invention, subject to any specifically excluded limit in
the stated range. Where the stated range includes one or both of
the limits, ranges excluding either both of those included limits
are also included in the invention.
[0232] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can also be used in the practice or testing of the present
invention, exemplary methods and materials have been described. All
publications mentioned herein are incorporated herein by reference
to disclose and described the methods and/or materials in
connection with which the publications are cited.
[0233] It must be noted that as used herein and in the appended
claims, the singular forms "a", "and", and "the" include plural
references unless the context clearly dictates otherwise.
[0234] The publications discussed herein are provided solely for
their disclosure prior to the filing date of the present
application and each is incorporated by reference in its entirety.
Nothing herein is to be construed as an admission that the present
invention is not entitled to antedate such publication by virtue of
prior invention. Further, the dates of publication provided may be
different from the actual publication dates which may need to be
independently confirmed.
EXAMPLES
[0235] The following examples are put forth so as to provide those
of ordinary skill in the art with a complete disclosure and
description of how to make and use the present invention, and are
not intended to limit the scope of what the inventors regard as
their invention nor are they intended to represent that the
experiments below are all or the only experiments performed.
Efforts have been made to ensure accuracy with respect to numbers
used (e.g. amounts, temperature, etc.) but some experimental errors
and deviations should be accounted for. Unless indicated otherwise,
parts are parts by weight, molecular weight is weight average
molecular weight, temperature is in degrees Centigrade, and
pressure is at or near atmospheric.
[0236] Materials and Methods
[0237] Zebrafish Husbandry
[0238] All zebrafish (Danio rerio) experiments were conducted under
St. Michael's Hospital Animal Care Committee (Toronto, Ontario,
Canada) approved protocol ACC403. The zebrafish were housed in the
Li Ka Shing Knowledge Institute (St. Michael's Hospital, Toronto,
Ontario, Canada) research vivarium and maintained and staged as
previously described (Avdesh A, Chen M, Martin-Iverson M T et al.
Regular care and maintenance of a zebrafish (Danio rerio)
laboratory: an introduction. J Vis Exp 2012;e4196). In short, the
fish were housed under a 14 h light:10 h dark cycle at 28.degree.
C. Embryos were produced by pair mating and raised in 1.times.E3
embryo medium (5 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl.sub.2, 0.33 mM
MgSO.sub.4. Strains used in this study included Tg(Flk:GFP;
Gata:dsRed) and bbh(m292); kdrl:mCherry -/-). The collection of
fertilized eggs was obtained through pair-wise breeding according
to the standard method previously described (Id.).
[0239] Statin-Induced Brain Hemorrhage in Zebrafish
[0240] Zebrafish as a model for hemorrhagic stroke has been
proposed previously (Butler M G, Gore A V, Weinstein B M. Zebrafish
as a model for hemorrhagic stroke. Methods Cell Biol 2011;
105:137-161). In addition to genetic models of brain hemorrhage,
statins have been used to induce brain hemorrhage in zebrafish
(Gjini E, Hekking L H, Kuchler A et al. Zebrafish Tie-2 shares a
redundant role with Tie-1 in heart development and regulates vessel
integrity. Dis Model Mech 2011; 4:57-66; Eisa-Beygi S, Hatch G,
Noble S, Ekker M, Moon T W. The 3-hydroxy-3-methylglutaryl-CoA
reductase (HMGCR) pathway regulates developmental cerebral-vascular
stability via prenylation-dependent signalling pathway. Dev Biol
2013; 373:258-266). A statin-induced model was adopted for our NIH
drug library screening project.
[0241] Zebrafish were set up the night before the experiment day.
In the morning of the experimental day, we put breeders together
for mating and fertilization. 6 hours postfertilization (hpf),
statins was added into a 96-well plate holding 100 .mu.l water with
7 to 8 fish eggs in each well, which was optimized through a serial
pilot experiments. Statins were dissolved in DMSO and diluted with
0.5% of DMSO water into a working solution. 100 .mu.l water
containing 0.5% of DMSO was the medium for all wells in the final
assessment.
[0242] Initially, we tested both simvastatin and atorvastatin for
induction of brain hemorrhage. Simvastatin was tested in final
concentrations of 10, 25, 50, 100, and 200 nmol/L, and atorvastatin
(ATV) was tested in concentrations of 50, 150, 300, 500 nmol/L and
1 .mu.M. After several batches of experiments, we found that ATV at
1 .mu.M gave the best reproducible brain hemorrhage in more than
80% of the larvae fish. Therefore, all subsequent screening work
was done with 1 .mu.M ATV to induce brain hemorrhage in larvae
zebrafish. Simvastatin (MW 558.6) was purchased from Cayman
Chemical (Ann Arbor, Mich.) and atorvastatin calcium salt (MW
604.69) was purchased from Sigma (St Louis, Mo.).
[0243] For screening NIH compound libraries, 5 .mu.M of each of the
drugs from the library was added at 24 hpf into wells containing
fish eggs treated with 1 .mu.M ATV since 6 hpf. Hemorrhage positive
control wells were treated with ATV but not treated with any drugs.
Negative controls were not treated with any chemicals (fish with
0.5% of DMSO water). Geranylgeranyl pyrophosphate (GGPP, 4 mg/L)
was used as positive rescue control.
[0244] Brain hemorrhage was assessed 72 hpf (66 hours after
addition of statins) using stereomicroscopy by two observers.
Percentage of brain hemorrhage was used as final readout. Compounds
showing more than 70% of rescue of the brain hemorrhages in the
initial test were re-tested to generate a final list of hits from
the library.
[0245] Four other compounds plus artesunate and artemether were
independently identified as positive hits from the library. Their
derivatives (artemisinin and dihydro-artemisinin) were acquired
(Sequoia Research Products, Pangbourne, UK) and tested positive in
the same ATV zebrafish model. All subsequent EC50 assays of
positive compounds were performed with protocols established and
optimized during the screening.
[0246] Morpholino Injection
[0247] Morpholino oligonucleotides (MOs) were custom-synthesized by
Gene Tools (Carvalis, Oreg.); their sequences are shown in Table
1.
TABLE-US-00001 TABLE 1 Morpholino sequences SEQ ID Morpholino
Sequence NO: Rap1bEx3 5'-AAATGATGCAGAACTT SEQ ID GCCTTTCTG-3' NO: 1
cdh5exon2 5'-TACAAGACCGTCTACC SEQ ID TTTCCAATC-3' NO: 2
.beta.Pixexon6 5'-GCGCATCTCTCTTACC SEQ ID ACATTATAG-3' NO: 3
pak2aexon8 5'-AATAGAGTACAACATA SEQ ID CCTCTTGGC-3' NO: 4 Hmgcrb-
5'-AACTGCATTCATAAAC SEQ ID splice TCACCCAGT-3' NO: 5 Pggtl-MO/
5'-CACGCGGTGTGTGGAC SEQ ID ggtasel TCACGGTCA-3' NO: 6 splice Liss
Std 5'-CCTCTTACCTCAGTTA SEQ ID Control CAATTTATA-3' NO: 7
[0248] Danieau buffer (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO.sub.4,
0.6 mM Ca(NO.sub.3).sub.2, 5.0 mM HEPES, pH 7.6) was used to dilute
the MO solutions to 0.2 mM final concentration. Individual wells
were placed on a 1.0% agarose plate, in which the embryos were
positioned. Afterwards, the MO solution was injected through the
cell yolk into embryos of 1 to 4 cell-stage. The injected
quantities varied from 0.5 to 15 ng.
[0249] bbhm292 zebrafish mutant has a hypomorphic mutation in
.beta.Pix, resulting in ICH/BMH and hydrocephalus. The MO is
.beta.Pixexon6-MO which blocks splicing of exon 6 and results in
premature protein termination. Injection of 0.2 ng of
.beta.Pixexon6-MO resulted in ICH in 61% of embryos. Higher doses
of .beta.Pixexon6-MO (up to 8 ng) result in a lack of blood
circulation, and therefore no ICH/BMH was detected. Injection of 8
ng results in complete missplicing of .beta.Pix and therefore a
null phenotype, whereas lower doses retain some normally spliced
.beta.Pix. The .beta.Pixexon6-MO sequence is
5'-GCGCATCTCTCTTACCACATTATAG-3' [SEQ ID NO: 1]. .beta.Pixexon6-MO
was injected into the embryos at the 1-2 cell stage, and compounds
were added 12 hpf. Artesunate, 5 .mu.mol/L, prevented ICH (FIG.
14).
[0250] Another MO was designed to block the splice-donor sites
after exon 8 in pak2a. Pak2a is the gene mutated in the rhdmi149
zebrafish mutant that develops ICH/BMH. The pak2a-MO sequence is
5'-AATAGAGTACAACATACCTCTTGGC-3' (SEQ ID NO: 2). Eight pg of
pak2a-MO was injected per embryo, resulting in -80% of embryos with
ICH/BMH with low mortality (FIGS. 12 and 14).
[0251] FIG. 12 depicts the pharmacological and genetic induction of
loss of cerebrovascular stabilization in developing zebrafish. (A)
The putative relationship between the HMGCR (hmgcrb)-mediated
metabolic pathway and Rho GTPase (CDC42) signalling in zebrafish is
shown. The process of geranylgeranylation, catalysed by GGTase I
(pggt1b), facilitates translocation of CDC42 to the plasma
membrane. The membrane-bound CDC42 functions as a molecular switch
by alternating between a GDP-bound (inactive) state and a GTP-bound
(active) state. .beta.pix is a guanine exchange factor (GEF), as it
activates CDC42 by stimulating GDP release and increasing enzyme
affinity for GTP. The p21-activated kinase 2a (pak2a) is a binding
partner for .beta.Pix. Pak2a is serine/threonine kinase acting
downstream of Rho GTPase signalling and are involved in the
transduction of this pathway. HMGCR function was inhibited using a
splice inducing anti-sense morpholino oligonucleotide (MO) or
water-borne exposure of embryos to statins (0.5 mg/L). The
functions of pggt1b, .beta.pix, or pak2a were reduced using
gene-specific MOs. (B) VE-cadherin-mediated cell-cell adhesion is
regulated in part by CDC42. When CDC42 is prenylated and in its
GTP-bound active form, it interacts with the .alpha. and
.beta.-catenins to maintain the VE-cadherin-catenin complex, hence
conferring stability. (C) By contrast, the unprenylated CDC42
remains inactive (GDP-bound) and associated with guanine nucleotide
dissociation inhibitor (GDI). This condition confers the weak
adhesive activity, hence disrupted cell-cell stability. (D-H) Loss
of the hmgcrb, pggt1b, .beta.pix or pak2a genes precipitate
cerebral hemorrhages. As compared with un-injected embryos in (D),
those injected with MOs targeting hmgcrb (E), pggt1b (F), .beta.pix
(G), or pak2a (H) exhibited ICH phenotype at 36-52 hpf. Arrows
denote the sites of abnormal accumulation of blood. Representative
images are shown. Anterior is to the left. (I-L) Hemorrhages arise
due to vascular defects in the brain. (I and J) Representative
photomicrographs of Tg(fli1:EGFP);(gata-1:DsRed) embryos incubated
in DMSO or 0.5 mg/L atorvastatin at 2 hpf and imaged at 36 hpf. The
arrows in (J) indicate areas where stagnant DsRed-positive
erythrocyte accumulation is observed. The arrows in (L) denote the
unusually distended cerebral vessels in the same fish. Anterior is
to the left. (M-R) Hemorrhages are associated with the
fragmentation of the underlying vasculature. (M and P)
Representative bright-field photomicrographs of Tg
(fli1:EGFP);(gata-1:DsRed) embryos incubated in DMSO or 0.5 mg/L
atorvastatin at 2 hpf and imaged at 48-52 hpf. The asterisk denotes
the hemorrhage and the black dotted area shows the field of
interest. Anterior is to the left and dorsal to the top. (N-R)
Representative composite confocal Z-stack projections of the black
dotted area in the same Tg(fli1:EGFP);(gata-1:DsRed) embryos. The
white asterisk denotes DsRed-positive erythrocytes and the white
arrows show regions where vascular disintegration is observed.
[0252] Measuring the Expression of Cellular Junction Proteins
[0253] qRT-PCR was used to assess relative expression of selected
genes (an average of two biological trial and three technical
replicates and each trial is a pool of 60 larvae/treatment), using
.beta.-actin as the housekeeping gene control. 3 dpf, Tg(Flk:GFP;
Gata:dsRed) zebrafish larvae were used for RNA extraction and cDNA
synthesis. Atorvastatin and drug treatment were performed as
previously mentioned in drug screening. Total RNA was extracted
from these larvae (a pool of 50-60 larvae/treatment) using the
RNeasy extraction kit (Qiagen, Mississauga, ON, CAN) and treated
with DNase. The concentration of total RNA was determined
spectrophotometrically at 260/280 nm using a NanoDrop.TM.
spectrophotometer. First-strand cDNA was synthesized from 1 .mu.g
of total RNA using random hexamer primers.
[0254] PCR Conditions:
[0255] The genes of interest and the primer pairs used are shown in
Table 2. In each case, forward primer is shown on the top and
reverse primer on the bottom.
TABLE-US-00002 TABLE 2 Primer sequences for selected genes to
perform qPCR. Protein Gene Primer Sequences SEQ ID name name
(5'-3') NO: VE- Cdh5 ACGATGTCTCCATCCTGTCT SEQ ID Cadherin NO: 8
TAGTGATTCGGTTCCCTCAT SEQ ID NO: 9 CCM1 Ccm1 TCACGCTATTCCTGCTCTGT
SEQ ID NO: 10 ACTGCAGATCTGAGCCGTAC SEQ ID NO: 11 CCM2 Ccm2
GGACAGCCAGCATTTTGAGA SEQ ID NO: 12 GTCTGAAATCATGCGGTCCC SEQ ID NO:
13 CCM3 Ccm3 CATGATTGACAGGCCCGAG SEQ ID NO: 14 TGATTGTCTGCAGGAATCGG
SEQ ID NO: 15 Integrin Itgb3 TCACTGTGGACTTTGCTTGC SEQ ID .beta.3
NO: 16 CACATTCACAGAACGGACCC SEQ ID NO: 17
[0256] Amplification of cDNA was achieved with an initial
denaturation at 94.degree. C. for 2 min followed by 40 cycles of
denaturation (94.degree. C. for 30 sec), annealing (60.degree. C.
for 30 sec) and extension (72.degree. C. for 1 min) followed by a
final extension period of 10 min at 72.degree. C. before
termination. PCR was carried out in a 20 .mu.l total volume and
included 1.times.PCR buffer, 1.25 mM MgCl.sub.2, 0.25 mM dNTP, 1 U
Taq polymerase, 0.5 .mu.mol/L forward, and reverse primers and 1
.mu.l cDNA.
[0257] Toxicity Assay
[0258] The embryos were collected and distributed into a 96-well
plate in 0.5% DMSO, similar to efficacy assays. Drugs were added at
24 hpf from a range of 50 nmol/L to 100 .mu.mol/L. 3 days
postfertilization (dpf), larvae were observed for heart beat, blood
flow and cardiac edema; the drug treated larvae were compared to
non-treated samples in 0.5% DMSO. Heart beat and blood flow were
ranked from 3 (normal heart beat or blood flow) to 0 (no heart beat
or blood flow). Cardiac edema was ranked from 0 (normal heart
without edema) to -3 (severe cardiac edema). TC50 is the
concentration of the drug at 50% of maximum toxicity. The ratio of
TC50/EC50 was calculated in each case.
[0259] Mouse Model Work
[0260] Animals and Animal Husbandry
[0261] All mice were housed in individually ventilated
microisolator cages at St.
[0262] Michael's Hospital vivarium facility. Rooms were kept at an
ambient temperature of 21.degree. C. and subjected to a 12 hour
light/dark cycles. Humidity was kept between 30-50%. All mice had
access to autoclaved food and water ad libitum. Virox was used as
disinfectant. Environmental Enrichment was provided for mice in
each cage. The Animal Care Committee at St. Michael's Hospital
approved all protocols and procedures in this study.
[0263] Lipopolysaccharide (LPS)-Induced Microbleeding Model
[0264] An LPS-mediated micro bleeding model was created similar to
that described in Lui et al (Liu S, Grigoryan M M, Vasilevko V et
al. Comparative analysis of H&E and Prussian blue staining in a
mouse model of cerebral microbleeds. J Histochem Cytochem 2014;
62:767-773). 9-10 week old C57BL/6 mice of both sexes were
purchased from Charles River, and randomly assigned to control or
treatment groups in equal numbers. LPS from Salmonella enterica
(Sigma Aldrich, St Louis, Mo.) was reconstituted with PBS to a
final concentration of 5 mg/ml. Both control (n=16) and drug
treatment (n=16) groups received injections of 5 mg/kg LPS at times
0 and 24 hrs. The drug treatment group, further divided into high
dose (n=4) and low dose (n=12), received intraperitoneal injections
of artemether (ARM) (25 mg/kg for Low dose and 100 mg/kg for High
dose) at time points -72, -48, -24, 0 and 24 hrs of LPS treatment.
All mice were sacrificed at 48 hrs after the first LPS
injection.
[0265] The brains were used for either histological studies or MRI
study.
[0266] Anti-.beta.3 Integrin Model of Intracerebral Hemorrhage
(ICH)
[0267] An anti-.beta.3 integrin model of intracerebral hemorrhage
(ICH) was generated according to our previously reported methods
(Yougbare I, Lang S, Yang H et al. Maternal anti-platelet beta3
integrins impair angiogenesis and cause intracranial hemorrhage. J
Clin Invest 2015; 125:1545-1556). Briefly, serum containing
anti-.beta.3 antibodies was generated by immunizing .beta.3-/-
female mice with gel-filtered wild type platelets via tail-vein
injections twice a week. To detect anti-.beta.3 antibody, blood was
collected from the saphenous vein of immunized female mice and left
to clot. Serum was extracted by centrifuging blood at 9600 g for 5
minutes, incubated with FITC-conjugated anti-mouse IgG, and assayed
by flow cytometer (FACSCalibur, BD Biosciences, Mississauga,
ON).
[0268] To generate .beta.3+/- mice, 6-8 week old .beta.3-/- female
mice were crossed with wild type male BALB/c. The resulting pups
were randomly assigned to either control (n=29, without any
treatment) or drug treatment group (n=24). To induce ICH in the
pups, each mouse was injected intraperitoneally with either 50
.mu.L of the anti-.beta.3 sera (the Control group) or 50 .mu.L
anti-.beta.3 sera with 25 mg/kg ARM (Drug Treatment group) at
postnatal day 2 (P2). All Neonates were sacrificed by decapitation
at P3.
[0269] Histological Studies on Mouse Brains
[0270] All histological studies are done according to our
established protocols (D'Abbondanza J A, Ai J, Lass E et al. Robust
effects of genetic background on responses to subarachnoid
hemorrhage in mice. J Cereb Blood Flow Metab 2016;
36:1942-19547-13; Sabri M, Kawashima A, Ai J, Macdonald R L.
Neuronal and astrocytic apoptosis after subarachnoid hemorrhage: a
possible cause for poor prognosis. Brain Res 2008; 1238:163-171;
Sabri M, Jeon H, Ai J et al. Anterior circulation mouse model of
subarachnoid hemorrhage. Brain Res 2009; 1295:179-185; Sabri M, Ai
J, Macdonald R L. Dissociation of vasospasm and secondary effects
of experimental subarachnoid hemorrhage by clazosentan. Stroke
2011; 42:1454-1460; Sabri M, Ai J, Marsden P A, Macdonald R L.
Simvastatin re-couples dysfunctional endothelial nitric oxide
synthase in experimental subarachnoid hemorrhage. PLoS One 2011;
6:e17062; Sabri M, Ai J, Lakovic K, D'Abbondanza J, Ilodigwe D,
Macdonald R L. Mechanisms of microthrombi formation after
experimental subarachnoid hemorrhage. Neuroscience 2012; 224:26-37;
Sabri M, Ai J, Lass E, D'Abbondanza J, Macdonald R L. Genetic
elimination of eNOS reduces secondary complications of experimental
subarachnoid hemorrhage. J Cereb Blood Flow Metab 2013;
33:1008-1014).
[0271] LPS-Induced Microbleeding Model:
[0272] All mice in the LPS study were deeply anesthetized with
ketamine and xylazine and perfused through the left cardiac
ventricle with NaCl, 0.9%, followed by 4% paraformaldehyde (PFA) in
1.times.PBS buffer and 2 mM Gadoteridol contrast agent for 24
hours. Each brain was transferred into a 1.times.PBS+0.02% sodium
azide and 2 mM Gadoteridol contrast agent. Brains were kept in this
immersion solution for 14 days before imaging to ensure proper
contrast diffusion in the brain for magnetic resonance imaging
(MRI) scan. For non-MRI scan brains, after gross examination,
brains were fixed with 4% paraformaldehyde (PFA) in 1.times.PBS
buffer for 24 hours and then transferred into a 1.times.PBS+0.02%
sodium azide for storage before processing for histology. For
histology, brains were cut in a mouse brain matrix (Zivic
Instruments, Pittsburgh, Pa.). Three (3) coronal cuts were made at
-6 mm from bregma, middle line of cerebellum), then 4 mm anterior
(-2 mm from bregma) and then 3 mm anterior to the second cut (+1
from bregma). Blocks were embedded in paraffin and 7 .mu.m sections
cut using a microtome.
[0273] Anti-.beta.3 ICH Model:
[0274] For a subset of mice (n=16) intended for MRI, the whole head
was severed from the neck and was immediately fixed with 4%
paraformaldehyde (PFA) in 1.times.PBS buffer and 2 mM Gadoteridol
contrast agent for 24 hours. Each brain was transferred into a
1.times.PBS+0.02% sodium azide and 2 mM Gadoteridol contrast agent.
Heads were kept in this immersion solution for 14 days before
imaging to ensure proper contrast diffusion in the brain. For
non-MRI brains, after gross examination, brains were fixed with 4%
paraformaldehyde (PFA) in 1.times.PBS buffer for 24 hours and then
transferred into a 1.times.PBS+0.02% sodium azide for storage
before processed for histology.
[0275] Hematoxylin and Eosin Staining
[0276] Brain blocks were processed and embedded in paraffin. Seven
micron sections were cut using a microtome. Sections were
deparaffinized in xylene and rehydrated through a decreasing
gradient of ethanol solutions. Slides were stained with hematoxylin
and eosin, coverslipped with xylene-based mounting medium
(Permount, Sigma Chemical Company, St. Louis, Mo.) and viewed under
a light microscope.
[0277] Fluoro-Jade Staining
[0278] Fluoro-jade B (Histo-Chem Inc., Jefferson, Ark.) was used to
assess neuronal degeneration. Brain sections were deparaffinized
and rehydrated. Following incubation with deionized water, the
slides were incubated in 0.06% potassium permanganate
(Sigma-Aldrich) for 15 minutes. Slides were then rinsed in
deionized water and immersed for 30 minutes in 0.001% Fluoro-jade B
working solution (0.1% acetic acid). Slides were washed and dried
(60.degree. C.) for 15 minutes, then cleared in xylene and
coverslipped with a non-aqueous, low fluorescence, styrene based
mounting media (DPX, Sigma-Aldrich). Slides were viewed under a
fluorescent light microscope (Olympus BX50, Olympus, Richmond Hill,
ON, Canada) and images were taken using constant parameters
(exposure time and contrast values).
[0279] Gross Examination
[0280] For the integrin ICH model, brains were taken out of the
skull, cut at the mid-coronal position and assessed in a binary
manner for whether or not there was any evidence of ICH. Brains
were immediately fixed following assessment. For the LPS model,
brains were extracted after perfusion fixation, and images were
taken for the whole brain to examine the appearance of
microbleeding spots.
[0281] Contrast Enhanced Magnetic Resonance Imaging
[0282] Brains were scanned using 7T Burker Mill with 16-channel
solenoid coils. Pulse sequence utilized was a FLASH T2* gradient
echo (GRE) sequence with the following parameters: TR=30.2 ms and
TE=12 ms. matrix=250.times.200.times.200.
FOV=FOV=2.5.times.2.0.times.2.0 gcrush=6 tcrush=0.002. FA was
11.degree.. (Liu S, Grigoryan M M, Vasilevko V et al. Comparative
analysis of H&E and Prussian blue staining in a mouse model of
cerebral microbleeds. J Histochem Cytochem 2014; 62:767-773). Voxel
size was 100*100*100 Following the reconstruction of images and
applying image distortion correction algorithms, all brains were
processed and analyzed for total volume of brain and total volume
of hemorrhage. Quantification was done using percentage of bleeding
(normalized to each brain size). Experimental blinding was done to
ensure unbiased work at all levels of preparation and analysis.
First, samples were prepared and coded not knowing which group they
belong to. Secondly, a separate technician blinded to groups
scanned the brains. Lastly, quantification was done in a blinded
fashion. All quantifications and 3D reconstructions were performed
using a combination of Display and Amira processing software.
[0283] Spectrophotometer Analysis of Hemoglobin Concentration
[0284] Drabkin's reagent (Sigma Aldrich) was used for calorimetric
quantification of hemoglobin concentration at 540 nm. C57BL/6 mice
were randomly assigned to three groups (each n=4): Control,
Low-dose ARM, and High-dose ARM. For ARM groups, three days of 25
mg/kg/day and 100 mg/kg/day ARM were administered for low and high
dose, respectively. Blood from saphenous vein were collected at day
4 and tested for hemoglobin concentration using UV 3600 Shimadzu
spectrophotometer. A standard curve was generated using a known
standard solution of cyanmethemoglobin, and blood concentrations of
Hb was compared to the standard curve.
[0285] Data Analysis and Statistics
[0286] A-priori power analysis was done to estimate the number of
samples in each group for a two-tailed, unpaired two-sample t-test
with a power of 0.8 and a of 0.05 to detect a 1 standard deviation
difference in bleeding volume. P values were determined by
unpaired, two-tailed t-test with Welch correction, analysis of
variance (ANOVA). All bar graphs and Dose-Response curves are
expressed as mean.+-.SEM or SD.
[0287] Chemicals
[0288] For all mouse model work, artemether (80 mgml-1) was
obtained from Dafra Pharma and diluted 1:15 in fractionated coconut
oil, and was administered intraperitoneally. For zebrafish work,
artesunate were purchased from Guilin Pharmaceutical (Guangxi,
China), together with artemether from Dafra are named GMP drugs.
Both ART compounds were also purchased from Sigma Aldrich (Sigma)
for comparison studies with GMP drugs.
Example 1. Zebrafish Screen to Identify Lead Compounds
[0289] Several models of ICH/BMH in zebrafish have been used,
including statins, bbh.sup.m292 and rhd.sup.mi149 mutants and MOs
to reduce expression of pak2a, .beta.Pix, Rap1b and cdh5. In
addition, low doses of LPS were determined to induce ICH in
zebrafish, consistent with the mouse BMH model. LPS destabilizes
the vasculature and causes vascular leakage throughout the fish,
including in the brain.
[0290] FIG. 1 shows the results of experiments conducted using an
atorvastatin-induced intracerebral hemorrhage (ICH) model in
zebrafish for chemical screening. Panel (A) is a schematic diagram
showing the molecular pathway where statins act. Panels (B)-(G):
ICH was induced by application of 1 .mu.mol/atorvastatin at 2 hours
post fertilization of embryos from adult wild type or Tg (flk-1:
eGFP) and Tg (gata-1:DsRed) zebrafish, and arrayed into 96-well
plates that contained the drug compounds. ICH phenotype rescue was
measured. No extravasation of red blood cells was observed in
vehicle DMSO treated control embryos (panels B, D and F).
Atorvastatin treated embryos show hemorrhage in the brain
(.apprxeq.80% panels C and G), and increased junction between
endothelial cells (panel E as compared to panel D). Panel H is a
schematic showing the scheme of the screening process. Panels I to
L show EC50 experiments for four compounds from the ART family, two
of which were identified from the NCC library. Data is expressed as
mean.+-.SEM from 3-4 experiments. ARM, artemether; DHA,
dihydro-artemisinin; ARS, artemisinin; ART, artesunate.
[0291] Screening of NCC libraries. The National Institutes of
Health (NIH) Clinical Collections 1 and 2 consist of 727 compounds
including many Food and Drug Administration-approved drugs for drug
repurposing (www.nihclinicalcollection.com). These compounds are
mostly drugs that have been in phase 1 to 3 clinical trials and are
not represented on other arrayed collections. They have favorable
properties such as purity, solubility and commercial availability.
Many have known safety profiles.
[0292] After optimizing the brain hemorrhage model with 1 .mu.mol/L
atorvastatin, 727 compounds in NIH compound libraries 1 and 2
(http://nihsmr.evotec.com/evotec/sets/ncc) were screened using the
conditions described (96 well plates with 7 embryos per well, and
atorvastatin, 1 .mu.mol/L). Six active compounds from four families
(two dihydropyridine calcium channel blockers (benidipine and
lacidipine), ethynylestradiol, triptolide, two anti-malaria drugs
(artesunate and artemether)) were identified independently from the
libraries. Chemical structure and properties of these six active
compounds plus two of the derivatives of ART family compounds are
summarized in Table 3 and FIGS. 1 and 2.
[0293] FIG. 2 shows inhibition of brain hemorrhage induced by E 1
.mu.mol/L atorvastatin in zebrafish by four active compounds
identified from NCC libraries, where EC50 is the concentration of
the drug at 50% of efficacy. Data is expressed as mean.+-.SEM from
3 to 4 experiments. Data was normalized to that of vehicle-treated
controls, and fitted with sigmoidal fit with variable slope in
GraphPad Prism 4 software. B is benidipine; E is ethynylestradiol;
L is lacidipine, and T is triptolide.
TABLE-US-00003 TABLE 3 Active compounds identified from NIH
clinical collections (NGP-104 library). The ATV model was induced
by 1 .mu.mol/L atorvastatin. One + sign represents 20% inhibition
on 1 .mu.mol/L ATV or .beta.-Pix MO-induced hemorrhage. EC.sub.50
(in Property nmol/L) on Efficacy on Efficacy on or atorfvastatin
Name of Chemical atorvastatin .beta.-Pix MO Clinical model Compound
Structure Hemorrhage Hemorrhage Application (.mu.mol/L) Artemisinin
##STR00001## +++++ +++++ Anti- malaria 95 Dihydroartemisinin
##STR00002## +++++ +++++ Anti- malaria 67 Artemether (NGP-
104-6-F5) ##STR00003## +++++ +++++ Anti- malaria 64 Artesunate
(NGP- 104-2-E7) ##STR00004## +++++ +++++ Anti- malaria 211
Benidipine (NGP- 104-30B7) ##STR00005## ++++ ++++ Hyper- tension
Lacidipine (NGP- 104-6-C2) ##STR00006## ++++ Not tested Hyper-
tension Ethynylestadiol (NGP-104-1- E10) ##STR00007## +++ Not
tested Contra- ceptive Triptolide (NGP- 104-3-G7) ##STR00008## ++++
No effect Not used in clinic; anti- cancer, immuno- suppressive and
anti- inflammatory ##STR00009##
[0294] Three of the four ART compounds showed high potency with
EC50 less than 100 nmol/L. Due to the moderate potency of the other
four compounds (EC50 ranging 191 to 290 nmol/L), we did not
investigate them further.
Example 2. Studies on Mechanisms of Action of ART Compounds in
Zebrafish
[0295] Clinical studies have disclosed a link between
cholesterol--lowering 3-hydroxy-methylglutaryl-coenzyme A reductase
(HMGCR) inhibitors (statins) and increased risk of ICH. The HMGCR
pathway is connected to components of the Rho guanosine
triphosphatase (GTPase) signaling pathway by prenylation of
Cdc42/Rac (FIG. 3). Many proteins in this pathway are responsible
for vascular stability. We hypothesized that some ICH/BMB are
secondary to vascular instability that is mediated by impaired
protein prenylation; and that any defect induced in the proteins
(such as mutation or changes in expression) might cause hemorrhage.
To address the pathways and proteins that are involved and to
better understand the mechanism by which a drug rescues the
hemorrhage, we decided to induce hemorrhage by genetic modification
and to test whether it could be rescued by the ART drugs.
[0296] ART Compounds Rescued Bbh Genetic Model of Brain
Hemorrhage.
[0297] A specific zebrafish line with a gene mutation called
bubblehead (bbh) was used. This line has spontaneous ICH.
Bubblehead phenotype is caused by a mutation in .beta.Pix. Adult
homozygous zebrafish were viable and fertile. Bubblehead embryos
develop ICH and brain edema 36 to 52 hours postfertilization (hpf)
(Liu J, Zeng L, Kennedy R M, Gruenig N M, Childs S J. betaPix plays
a dual role in cerebral vascular stability and angiogenesis, and
interacts with integrin alphavbeta8. Dev Biol 2012; 363:95-105; Liu
J, Fraser S D, Faloon P W et al. A betaPix Pak2a signaling pathway
regulates cerebral vascular stability in zebrafish. Proc Natl Acad
Sci USA 2007; 104:13990-13995). More than 85% of zebrafish larvae
display an ICH phenotype. Interestingly, we found that treating
with the ART drugs could completely rescue the hemorrhage in bbh
mutants. FIG. 4 shows results from drug efficacy assays in the bbh
model for two compounds, artesunate (ART), and artemether (ARM).
Table 4 shows EC50 values measured for the various drugs.
TABLE-US-00004 TABLE 4 Comparison of efficacy (EC50 values) of
different drugs to rescue brain hemorrhage in statin and bbh
models. For the statin model, n = 15-20 larvae per condition; the
experiment was performed three times per compound. For the bbh
mutant model, n = 15-20 larvae per condition; the experiment was
performed 1-3 times per compound. bbh Mutant Model Drug Statin
Model (nmol/L) (nmol/L) ART (GMP) 182.2 126.9 ART (Sigma) 105.0
140.3 ARM (Sigma) 24.7 37.5 ARS (Sigma) 81.3 176.6 DHA (Sigma) 80.8
107.1
[0298] The obtained EC50 values of the ART drugs from the bbh
mutant model and from the atorvastatin-induced ICH model were
comparable. This confirms the validity of the statin model which
was used for initial screening (Table 3).
[0299] ART Compounds Rescued ICH Induced by Gene Knockdown of Key
Proteins in the HMBCR/Rho Kinase Pathway
[0300] Besides using bbh, the other method to induce ICH in
zebrafish is genetic gene knockdown. We used specific morpholinos
to knock down some key genes in both HMGCR and Rho guanosine
triphosphatase (GTPase) signaling pathways (FIG. 3). The
morpholinos for the following genes were used:
[0301] 1) Pak2a: p21 protein (Cdc42/Rac)-activated kinase 2a
regulates activity of Rho GTPases, Rac and Cdc42, and may be
involved in a complex with .beta.Pix.
[0302] 2) .beta.Pix: Pak-interacting exchange factor .beta.
facilitates conversion of GDP-Rho GTPases (Rac and Cdc42) to
GTP-RhoGTPase.
[0303] 3) HMGCR: 3-hydroxy-3-methylglutaryl-coenzyme A reductase
catalyzes conversion of HMG-Co A to mevalonate.
[0304] 4) VE-Cadherin: Vascular Endothelial Cadherin is a
transmembrane protein that connects the intracellular cytoskeleton
to the extracellular matrix.
[0305] 5) Rap1b: Ras GTPase effector protein facilitates recruiting
of CCM proteins to the cell membrane.
[0306] 6) GGTase 1: geranylgeranyltransferase 1
post-translationally modifies Rac and Cdc42 by adding a
mevalonate-derived GGPP which is required to activate these
GTPases.
[0307] FIG. 14 (A-B) shows that artesunate dose-dependently rescues
hemorrhage phenotype induced by morpholinos targeting membrane
stability of brain vessels in zebrafish. (A) Schematic diagram
showing the target sites of the three morpholinos studied. (B)
Artesunate dose-dependently rescues all three morpholinos-induced
brain hemorrhage in zebrafish. (C-D) Artesunate rescues the ICH
phenotype underlying the bbh.sup.m292 mutation. (C) Upper panel,
partial exon-intron organization of bPix gene showing the point
mutation effecting splicing of the gene. Lower panel, RT-PCR
analysis of wild-type and bbh.sup.m292 mutant cDNA with primers
flanking exon-14. (D) Upper panel, the phenotypes of bbh.sup.m292
mutants treated with DMSO or artesunate and imaged at 48 hpf. The
arrows denote sites of hemorrhage. Lower panel, percentages of
bbh.sup.m292 embryos with brain hemorrhage rescued by
artesunate.
[0308] Artesunate dose-dependently reduced ICH/BMH after treatment
with pak2a-MO (FIGS. 12 and 14). MO-mediated inhibition of hmgcrb,
the zebrafish enzyme inhibited by statins, caused embryos to have
ICH/BMH which also were prevented by artesunate (FIG. 14).
[0309] Finally, a role for the VE-cadherin homologue in zebrafish,
cdh5, was demonstrated in that MO-knockdown of cdh5 induced ICH in
zebrafish (FIG. 13). FIG. 13 shows the HMGCR molecular pathway that
leads to vascular stability in zebrafish. Panels A & B: Stable
EC junctions are maintained by a Cdc42-dependent and
VE-cadherin-mediated cell-cell adhesion. VE cadherins are found on
the surfaces of EC cell-cell junctions. VE-cadherins are associated
with .beta.- and .alpha.-catenins at their cytoplasmic domains,
which connect them to the actin-based cytoskeleton (blue circles).
Cdc42 belongs to the Rho-family of small guanosine triphosphatases
(GTPases), which are the main regulators of VE-cadherin-based
cell-cell adhesion. The functions of hmgcrb, .beta.Pix, and pak2a
in regulating junctional stability in zebrafish are shown. HNGCR
mediated GGPP biosynthesis regulates Cdc42 prenylation. .beta.Pix
is a GEF that increases CDC42 affinity for GTP. Pak2 is an effector
of Cdc42, which regulates actin filament organization. Panel C
shows that splice-inducing morpholinos designed against cdh5, the
zebrafish ortholog of the VE-cadherin gene, induced intracerebral
hemorrhage in zebrafish at 36-48 hpf (lateral images are
shown).
[0310] We found that injection of any of the above morpholinos
causes hemorrhage in 3 dpf zebrafish larvae indicating the
important roles these genes play in vascular stability. Next,
optimum amount of each morpholino was determined. The goal was to
induce an acceptable percentage of hemorrhage (ideally between
40-80%), without having toxicity from morpholino injection. The
results are summarized in Table 5.
TABLE-US-00005 TABLE 5 Optimizing the amount of injected
morpholinos, n = 150-250 larvae per condition; the experiment was
performed at least two times. Morpholino Optimum amount (ng)
Hemorrhage .beta.Pix - exon6 0.8 72.1% Pak2a - exon8 5.0 43.7%
Hmgcrb - splice 2.0 67.9% Cdh5 - exon2 1.0 39.4% 35.0% (Cardiac
Edema) Rap1b - exon3 9.0 30.8% (Faint) GGTasel 2.5 11.4%
(Faint)
[0311] The first three morpholino pairs were good for the efficacy
study. Efficacy assays were performed using Aartemether (ARM,
Sigma) and artemesunate (ART, GMP). The results showed that defects
induced by Pak2a, .beta.Pix, and HMGCR morpholinos could induce
hemorrhage in independent experiments. Treating these morphants
with the drugs rescued the ICH phenotype. FIG. 5 shows an example
of a drug efficacy study on hmgcrb morphants using artesunate
(ART), and artemether (ARM); n=15-20 larvae per condition; the
experiment was performed two times per compound. EC50 values
calculated for the first three aforementioned morphants are shown
in Table 6.
TABLE-US-00006 TABLE 6 Efficacy comparison (EC50) of ARM (Sigma)
and ART (GMP) to rescue the hemorrhage induced by different
morpholinos; n = 150-250 larvae per condition, and the experiment
was performed at least two times. Morpholino ARM (Sigma) (nmol/L)
ART (GMP) (nmol/L) .beta.Pix - exon6 51.6 .+-. 11.7 95.6 .+-. 27.9
Pak2a - exon8 39.1 .+-. 8.0 169.2 .+-. 39.5 Hmgcrb - splice 62.5
.+-. 8.3 166.7 .+-. 9.3 Cdh5 - exon2 Rescue effect Rescue
effect
[0312] Suppression of VE-cadherin induces hemorrhage. However,
cardiac edema was observed in some morphants. The efficacy assays
were performed using ARM and ART, and in both cases rescue was
observed.
[0313] Consistent with what we found in the atorvastatin-induced
ICH model and bbh mutant model, ARM showed the highest efficacy to
rescue the hemorrhage in morphants (Table 4 and Table 6).
[0314] Studies on Toxicity of ART Compounds in Zebrafish
[0315] Toxicity assays were performed to measure TC50 values
considering three parameters: heartbeat, blood flow and cardiac
edema As an example, FIG. 7 shows the results of toxicity assays
for ART (GMP). Heart beat and blood flow were ranked from 3 (normal
heart beat or blood flow) to 0 (no heart beat or blood flow).
Cardiac edema was ranked from 0 (normal heart without edema) to -3
(severe cardiac edema). TC50 is the concentration of the drug at
50% of maximum toxicity. Data is expressed as mean.+-.SEM from 3
experiments. TC50 values for all drugs as well as the TC50/EC50
ratio are summarized in Table 7.
TABLE-US-00007 TABLE 7 Comparison of toxicity (TC50 values) of
different drugs. TC50/EC50 ratio is in parenthesis; n = 15-20
larvae per condition, and the experiment was performed three times
per compound. TC50 TC50 TC50 (Heart beat) (Blood flow) (Edema) Drug
Company [nmol/L] [nmol/L] [nmol/L] Artemisinin (ARS) Sigma 8501
1058 34134 (104.5) (13) (419) Artesunate (ART) Sigma 8884 741.5
5367 (84.6) (7.1) (51.1) Artemether (ARM) Sigma 2328 975.3 19564
(94.3) (39.5) (87.1) Dihydroartemisinin Sigma 5.011e+0.11 890 748.5
(DHA) (6.2e+009) (11.0) (9..2) Artemisinin (ARS) Sequoia Rsearch
1.217e+010 5340 6347 (UK) .sup. 4.6e+007) (20.4) 24.2) Artesunate
(ART) Sequoia 9539 1036 937.8 Research (UK) (59.5) (6.5) (5.9)
Artemether (ARM) Sequoia 1.084e+013 746.3 5.253e+012 Research (UK)
(1.3e+011) (9.2) (6.5e+010) Dihydroartemisinin Sequoia 1.110e+008
979.5 1021 (DHA) Research (UK) (8.3e+005) (7.3) (7.6) Artesunate
(ART) GMP-Artesunate 2525 794.4 3196 (13.9) (4.4) (17.5) ZA102 Life
Chemicals 376 695.3 24444 (2.1) (3.8) (135) ZA113 Life Chemicals
2283 572.3 5883 (17.3) (4.3) (44.5) ZA123 Life Chemicals 6.491e+007
989.3 55912 (5.2e+005) (7.9) (445.5)
[0316] We found ARM to be a safe drug, as its EC50 is much lower
than TC50 (Table 7) in zebrafish embryos.
[0317] 3) ART Compounds Upregulate Key Proteins Vital for Vascular
Stability
[0318] We considered a list of 20 genes that are potentially
involved in ICH mechanism, and evaluated the changes in
transcription of five of them after in atorvastatin-induced brain
hemorrhage model and treated with ART drugs. These genes are:
VE-Cadherin (Cdh5), Integrin (Itgb3a) and three cerebral cavernous
malformation genes (ccm1, ccm2 and ccm3).
[0319] FIG. 6 shows the changes in gene transcription upon adding
statin (ATV) and artemether (ARM) at 500 nmol/L. qRT-PCR analysis
was used to evaluate the mRNA level of gene expression of A,
VE-Cadherin; B, .beta.3-Integrin, C CCM3, in zebrafish treated with
atorvastatin (ATV) and 500 nmol/L of Artemether (ARM), n=3. At this
concentration, no hemorrhage was observed. Each figure shows the
experiment results of 50-60 of 3 dpf embryos.
[0320] The results showed that in the statin-induced ICH model,
upregulation at the transcription level occurs for Integrin .beta.3
and VE-cadherin upon treatment with ARM. CCM3 showed a decrease
after inducing hemorrhage with atorvastatin. Upon treatment with
ARM, the transcription level returned to normal in parallel with
hemorrhage rescue in zebrafish larvae.
Example 3. Other Zebrafish Models to Validate Anti-ICH Efficacy of
Compounds Identified from Statin-Derived Embryonic Screens
[0321] Experiment 1: LPS-Induced ICH/BMH in Zebrafish Embryos.
[0322] The lead compounds will be tested in a LPS model of ICH/BMH
to determine if rescue of the ICH/BMH phenotype is a general
property of these compounds or it is specific to statin-induced
ICH/BMH. Preliminary data suggested that artemether reduced
mortality from LPS (FIG. 15). FIG. 15 shows that LPS induces brain
hemorrhage in developing zebrafish embryo and artemether have
protective effects on LPS-induced mortality. Panel A shows survival
curves of developing zebrafish embryos when LPS is delivered in
fish water at 24 hours post fertilization (hpf). Panel B shows that
1 .mu.mol/L artemether in fish water had a protective effect on
fish survival. LPS concentration used was 200 mg/mL. Panel C shows
that 25 mg/mL LPS treatment of 24 hpf embryos resulted in no
mortality but 52% of embryos (n=120) had brain hemorrhage.
Experiments are ongoing to define the rescuing effects of
artemether on LPS-induced brain hemorrhage. Double transgenic
zebrafish (Gata1:DsRed/Flk1:GFP) with green fluorescent vessel and
red fluorescent red blood cells are used. Arrow points to
hemorrhage.
Example 4. Work in Mouse Models of ICH
[0323] We employed two models of brain hemorrhage. Our results show
that in both LPS and Integrin models of ICH, ARM effectively
prevented or ameliorated hemorrhage.
[0324] LPS-Induced Microbleeding Mouse Model
[0325] ARM (GMP) Reduces Both Surface and Deep Brain Microbleeds
Induced by LPS
[0326] LPS and its main receptor TLR4 have been extensively
studied, and recent literature characterized a model of brain
micro-bleeds that are both present on the surface cortical areas
and in the deep lobar areas (Liu S, Grigoryan M M, Vasilevko V et
al. Comparative analysis of H&E and Prussian blue staining in a
mouse model of cerebral microbleeds. J Histochem Cytochem 2014;
62:767-773; Sumbria R K, Grigoryan M M, Vasilevko V et al. A murine
model of inflammation-induced cerebral microbleeds. J
Neuroinflammation 2016; 13:218). The number of surface micro-bleeds
of each brain was counted using a stereomicroscope, and an average
determined for LPS control and LPS+ARM treatment groups. FIG. 8
shows that artemether (ARM) rescues LPS-induced brain microbleeds
in mice. Panel A shows data from a stereomicroscope count of
surface microbleeds in brains from LPS treated mice (n=8) or
LPS+artemether-treated mice (n=8). The left panel shows
representative images from each of the two groups; arrows indicate
microbleeds. The right panel shows a statistical analysis
(*P<0.05, two-tailed t-test with Welch correction); data is
expressed as mean.+-.SD. As compared to LPS treated animals, brains
from ARM treated mice showed a robust reduction in total surface
microbleeds.
[0327] To further assess microbleeding inside the brains, we
quantified the numbers of microbleeds in H&E stained brain
slides. Panel B shows data from quantification of microbleeds on
brain slices stained by hematoxylin and eosin. The left panel shows
representative images of stained brain slices with microbleeds from
each of the two groups; the arrows indicate microbleeds on the
slices; the right panel chart shows a statistical analysis on
microbleeds count (**P<0.01, unpaired two-tailed t-test with
Welch's correction. Data is expressed as mean.+-.SD, n=8 for both
LPS treated and LPS+ARM treated groups.
[0328] Similar to the surface microbleed counts, ARM treatment
significantly reduced the total number of microbleeds inside the
mouse brains (FIG. 8B).
[0329] The Reduction of Total LPS-Induced Microbleeds in Mouse
Brains by ARM (GMP) is Verified by MRI
[0330] To confirm the result from gross anatomy and histology, we
examined the brains in the subsequent experiments using a Mill with
3D FLASH GRE sequence. Total volume of hemorrhage was quantified
and percent bleeding was calculated for each brain. FIG. 9 shows
that artemether (ARM) rescues microbleeding induced by
lipopolysaccharide (LPS) in mice. Panel A shows representative 3D
reconstructed images from T2*-Weighted Gradient Echo (GRE) MRI
sequence with high resolution detecting, showing microbleeds from
LPS or LPS+ARM treated mouse brains. Arrows indicate the
microbleeds. Panel B is a bar graph showing the number of
microbleedings per brain in a vehicle control group and a group
treated with artemether (ARM). Quantification of total microbleeds
volume was calculated using semi-automated software (Display),
normalized to total brain volume, and expressed as total voxel in
10000 counts. Data is expressed as mean.+-.SD (+P<0.05,
two-tailed t-test with Welch correction), n=8 for both LPS treated
and LPS+ARM treated groups, 2 for naive controls.
[0331] The data confirm that there is a significant reduction of
bleeding (about 2/3 reduction) in the ARM treated group in
comparison to the model control group (FIG. 9).
[0332] LPS Did not Induce Significant Neuronal Cell Death or
Hemosiderin Deposition
[0333] We did Fluoro-jade C and Perl's staining to detect neuronal
degeneration and hemosiderin deposition, respectively. The results
of both of these assays were negative for both control and
treatment groups, suggesting that the observed micro-bleeds induced
by LPS are acute and that the microbleeds did not cause neuronal
cell death, at least in the time scale we tested on this model.
[0334] Integrin ICH Mouse Model
[0335] ARM (GMP) Reduces the Incidence Rate of ICH
[0336] Previous studies suggested that by forming a heterodimer
with the .alpha.V subunit of integrin, .beta.3 integrin plays a
role in proliferating endothelial cells, specifically during
angiogenesis (Yougbare I, Lang S, Yang H et al. Maternal
anti-platelet beta3 integrins impair angiogenesis and cause
intracranial hemorrhage. J Clin Invest 2015; 125:1545-1556). It has
already been shown that using antibodies especially during the
developmental stage creates vascular instability and improper
angiogenesis and hence rapid ICH development. Id.
[0337] We employed two end points to examine the treatment effect
of ARM in the anti-.beta.3 integrin model of intracerebral
hemorrhage. FIG. 10 shows that artemether (ARM) reduces ICH in an
anti-.beta.3 integrin mouse model of intracerebral hemorrhage.
Panel A shows representative raw T2*-Weighted Gradient Echo (GRE)
MRI images of brains of mice injected with anti-.beta.3 integrin
serum at post-natal day 2 alone (left) or treated with ARM (right).
Panel B shows paraffin-embedded blocks of coronally-cut whole
brains from anti-.beta.3 serum injected mice without (left) or with
(right) ARM treatment, respectively. Panel C shows quantification
of frequency of intracerebral hemorrhage in mice injected with
anti-.beta.3 integrin serum alone or with ARM treatment. 77% of
neonates showed ICH in the ICH model control group. In comparison,
ARM reduced ICH incidence to 47%.Data is expressed as mean.+-.SD
(**P<0.01, two-tailed t-test with Welch correction), n=29 and 24
for anti-.beta.3 integrin serum injected mice without or with ARM
treatment, respectively.
[0338] ARM (GMP) Reduces the Total Volume of ICH Verified by
MRI
[0339] Preliminary data shows that ARM reduced total volume of ICH
as compared to controls. (data not shown).
[0340] To assess possible anemia effect from ARM treatment as some
previous studies speculated, blood samples were tested for
hemoglobin concentration after ARM treatment. Blood hemoglobin
concentration was assessed using Drabkins' method.
Spectrophotometer data was compared to a standard curve from
standard cyanmethemoglobin concentrations. The control group
received no drug. The Treatment Dose group received 3 days
injection of low dose ARM (25 mg/kg), 4.times. Treatment Dose group
received 3 days injection of high dose ARM (100 mg/kg).
[0341] FIG. 11 shows that ARM treatment for 3 days did not cause
anemia in mice. It is a plot of blood hemoglobin (g/dl) (y-axis)
for controls, and for mice treated with artemether (ARM) (Treatment
Dose, and 4.times. Treatment Dose). Bloods were tested for
hemoglobin concentration after ARM treatment. Blood hemoglobin
concentration was assessed using Drabkins' method.
Spectrophotometer data was compared to a standard curve from
standard cyanmethemoglobin concentrations. The control group
received no drug. The Treatment Dose group received 3 days
injection of low dose ARM (25 mg/kg); 4.times. Treatment Dose group
received 3 days injection of high dose ARM (100 mg/kg). Data is
expressed as mean.+-.SD (nsP>0.05, one-way ANOVA, n=4). We did
not find any statistical difference between the groups (FIG.
11).
[0342] FIG. 16 shows that statin exacerbates LPS-induced
intracerebral hemorrhage in mice. (A) Atorvastatin (50 mg/kg)
treatment in addition to LPS (5 mg/kg), resulted in 100% mortality
24 hours after the treatments, while LPS treatment alone only
result in 25% mortality at the same time examined, and statin alone
did not cause any mortality (n=5). (B) Atorvastatin treatment
significantly increased the number of large hemorrhages caused by
LPS. While the present invention has been described with reference
to the specific embodiments thereof it should be understood by
those skilled in the art that various changes may be made and
equivalents may be substituted without departing from the true
spirit and scope of the invention. In addition, many modifications
may be made to adopt a particular situation, material, composition
of matter, process, process step or steps, to the objective spirit
and scope of the present invention. All such modifications are
intended to be within the scope of the claims appended hereto.
Sequence CWU 1
1
17125DNAArtificial SequenceSynthetic sequence 1aaatgatgca
gaacttgcct ttctg 25225DNAArtificial SequenceSynthetic sequence
2tacaagaccg tctacctttc caatc 25325DNAArtificial SequenceSynthetic
sequence 3gcgcatctct cttaccacat tatag 25425DNAArtificial
SequenceSynthetic sequence 4aatagagtac aacatacctc ttggc
25525DNAArtificial SequenceSynthetic sequence 5aactgcattc
ataaactcac ccagt 25625DNAArtificial SequenceSynthetic sequence
6cacgcggtgt gtggactcac ggtca 25725DNAArtificial SequenceSynthetic
sequence 7cctcttacct cagttacaat ttata 25820DNAArtificial
SequenceSynthetic sequence 8acgatgtctc catcctgtct
20920DNAArtificial SequenceSynthetic sequence 9tagtgattcg
gttccctcat 201020DNAArtificial SequenceSynthetic sequence
10tcacgctatt cctgctctgt 201120DNAArtificial SequenceSynthetic
sequence 11actgcagatc tgagccgtac 201220DNAArtificial
SequenceSynthetic sequence 12ggacagccag cattttgaga
201320DNAArtificial SequenceSynthetic sequence 13gtctgaaatc
atgcggtccc 201419DNAArtificial SequenceSynthetic sequence
14catgattgac aggcccgag 191520DNAArtificial SequenceSynthetic
sequence 15tgattgtctg caggaatcgg 201620DNAArtificial
SequenceSynthetic sequence 16cacattcaca gaacggaccc
201720DNAArtificial SequenceSynthetic sequence 17cacattcaca
gaacggaccc 20
* * * * *
References