U.S. patent application number 16/389565 was filed with the patent office on 2019-08-08 for method for detecting a genomic fusion event.
The applicant listed for this patent is Inivata Ltd.. Invention is credited to Michael Epstein, Tim Forshew, Karen Howarth, Stefanie Lensing, Vincent Plagnol, Matthew Edward Smith, Samuel Woodhouse.
Application Number | 20190241974 16/389565 |
Document ID | / |
Family ID | 59462439 |
Filed Date | 2019-08-08 |
![](/patent/app/20190241974/US20190241974A1-20190808-D00000.png)
![](/patent/app/20190241974/US20190241974A1-20190808-D00001.png)
![](/patent/app/20190241974/US20190241974A1-20190808-D00002.png)
![](/patent/app/20190241974/US20190241974A1-20190808-D00003.png)
![](/patent/app/20190241974/US20190241974A1-20190808-D00004.png)
![](/patent/app/20190241974/US20190241974A1-20190808-D00005.png)
![](/patent/app/20190241974/US20190241974A1-20190808-D00006.png)
![](/patent/app/20190241974/US20190241974A1-20190808-D00007.png)
![](/patent/app/20190241974/US20190241974A1-20190808-D00008.png)
United States Patent
Application |
20190241974 |
Kind Code |
A1 |
Woodhouse; Samuel ; et
al. |
August 8, 2019 |
Method for Detecting a Genomic Fusion Event
Abstract
The present disclosure relates to methods for detecting and
targeting genomic rearrangements, in particular gene fusion events,
by targeting a DNA molecule of interest with a set or pool of
primers, wherein the forward primers and reverse primers produce a
PCR amplification product when a genomic rearrangement is present.
The present disclosure also relates to methods of bioinformatic
analysis to determine whether or not the detection of an
amplification product from the selective PCR is actually indicative
of the presence of a gene fusion. The present disclosure also
related to related methods of diagnosis and treatment of diseases
and conditions associated with such genomic rearrangements, in
particular cancers, such as lung cancer.
Inventors: |
Woodhouse; Samuel;
(Cambridge, GB) ; Lensing; Stefanie; (Cambridge,
GB) ; Forshew; Tim; (Stevenage, GB) ; Plagnol;
Vincent; (Cambridge, GB) ; Smith; Matthew Edward;
(Cambridge, GB) ; Howarth; Karen; (Cambridge,
GB) ; Epstein; Michael; (Cambridge, GB) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Inivata Ltd. |
Cambridge |
|
GB |
|
|
Family ID: |
59462439 |
Appl. No.: |
16/389565 |
Filed: |
April 19, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/GB2018/051688 |
Jun 18, 2018 |
|
|
|
16389565 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6853 20130101;
C12Q 1/6806 20130101; C12Q 1/686 20130101; C12Q 2535/122 20130101;
C12Q 2537/159 20130101; C12Q 2531/113 20130101; C12Q 2525/155
20130101; C12Q 2600/106 20130101; C12Q 1/6853 20130101; G16B 20/00
20190201; C12Q 1/6886 20130101; C12Q 2600/156 20130101; C12Q
2600/16 20130101; C12Q 2525/161 20130101; G16B 30/00 20190201 |
International
Class: |
C12Q 1/6886 20060101
C12Q001/6886; C12Q 1/6806 20060101 C12Q001/6806; C12Q 1/686
20060101 C12Q001/686 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 16, 2017 |
GB |
1709675.1 |
Claims
1. A method of detecting a genomic fusion event, comprising: (a)
combining a test sample comprising cell-free DNA (cfDNA) from the
bloodstream of a human subject with at least 20 forward primers, at
least 20 reverse primers, and a polymerase to produce a reaction
mix, wherein: i. the forward primers specifically hybridize to the
same strand of a first region in a reference human genome, wherein
the average interval between adjacent binding sites for the forward
primers in the first region is no more than 100 bases; ii. the
reverse primers specifically hybridize to the same strand in a
second region of the reference human genome, wherein the average
interval between adjacent binding sites for the reverse primers in
the second region is no more than 100 bases; and iii. the first and
second regions are on different chromosomes or are on the same
chromosome but spaced apart by at least 10 kb; and (b)
thermocycling the reaction mix to produce fusion-specific PCR
products only if there is a genomic rearrangement that fuses the
first region with the second region in a tumor in the subject.
2. The method of claim 1, wherein the method comprises sequencing
the product of step (b), or an amplification product thereof, to
identify the fusion-specific PCR products and differentiate them
from non fusion-specific PCR products.
3. The method of claim 2, further comprising identifying the fusion
junction in the fusion-specific PCR products.
4. The method of claim 2, wherein the forward primers have a first
5' tail and the reverse primers have a second 5' tail, and the
method comprises amplifying the product of step (b) using universal
primers that hybridize to the first or second 5' tails or their
complement prior to sequencing.
5. The method of claim 1, further comprising identifying a patient
as being a candidate for therapy if step (b) produces the
fusion-specific PCR products.
6. The method of claim 1, wherein one of the first and second
regions is the ALK gene and the other of the first and second
regions is the EML4 gene.
7. The method of claim 1, wherein one of the first and second
regions is the RET gene and the other of the first and second
regions is the TRIM33, CCDC6, KIF5B or NCOA4 genes.
8. The method of claim 1, wherein one of the first and second
regions is the ROS1 gene and the other of the first and second
regions is the CD74, SLC34A2 or SDC4 gene.
9. The method of claim 1, wherein one of the first and second
regions is the NTRK1 gene and the other of the first and second
regions is the TPM3, SQSTM1, CD74 or MPRIP gene.
10. The method of claim 1, wherein the intervals between adjacent
binding sites for the forward primers in the first region are in
the range of 10 to 250 base pairs and the intervals between the
adjacent binding sites for the reverse primers in the second region
are in the range of 10 to 250 base pairs.
11. The method of claim 1, wherein the reaction mix comprises
multiple sets of said forward primers and multiple sets of said
reverse primers, each set targeting a different region in the
reference human genome.
12. The method of claim 1, wherein the human subject is human
cancer patient.
13. The method of claim 1, wherein cfDNA contains DNA contributed
by cells that have the genomic rearrangement of (b) and DNA
contributed by cells that do not have the genomic of (b).
Description
CROSS-REFERENCING
[0001] This application claims the benefit of GB1709675.1, filed on
Jun. 16, 2018, which application is incorporated herein in its
entirety for all purposes.
BACKGROUND
[0002] The present disclosure relates to methods for detecting
genomic rearrangements, in particular gene fusion events, as well
as related methods of diagnosis and treatment of diseases and
conditions associated with such genomic rearrangements, in
particular cancers, such as lung cancer.
[0003] Genetic or chromosomal rearrangements are a type of
chromosomal abnormality in which the normal order of the genetic
code has been altered. A common genomic rearrangement that is
associated with cancer is genetic fusion. A gene fusion event may
occur in cancerous or pre-cancerous cells and can be detected in
patients to help classify the cancer and determine appropriate
treatments.
[0004] Existing methods for detecting gene fusions include
fluorescence in situ hybridization (FISH), RT-PCR, long range PCR
and hybridisation capture followed by next generation sequencing.
FISH uses DNA or RNA probes, tagged with targets for antibodies,
with fluorophores or with biotin. These probes are applied to an
interphase or metaphase chromosome preparation in order to detect
either the co-localisation of two genes typically separate in a
nuclei or the breaking apart of a genes signal, indicating its
fusion to another region of the genome. An example of this approach
is the detection of the BCR/ABL fusion by FISH and the use of this
to monitor response to therapy in chronic myeloid leukemia (Dewald
G W et al. Blood. American Society of Hematology; 1998; 91:
3357-65). FISH can only be applied to cells or tissue and therefore
cannot be used to detect gene fusions in cell free circulating
nucleic acids or in DNA already extracted from tissue. FISH also
requires intact nuclei, the need to visually assess individual
cells and cannot give the sequence of the breakpoint.
[0005] RT-PCR can be used to amplify the messenger RNA (mRNA)
transcript of a fusion gene and specifically detect its presence.
Reverse transcription is used to convert RNA to cDNA followed by
PCR using fusion specific primers to amplify the fusion of
interest. As intronic sequences are spliced out in the generation
of mRNA this is relatively simple and typically requires just one
pair of primers or a small multiplex of primers. The products of
such a PCR can then be detected in multiple ways such as through
gel electrophoresis with intercalating agents like ethidium bromide
or using a fluorescent probe with real time or digital PCR. For
example (U.S. Pat. No. 4,874,853). However, this approach can only
be applied to mRNA and it is not feasible to identify the
breakpoints that have occurred in the genome (DNA). mRNA typically
has a short half-life and is therefore a challenging biomarker in
heavily degraded samples such as FFPE and circulating RNA
(ctRNA).
[0006] An alternative is to directly detect the fusion in genomic
DNA. A significant challenge with this approach is that the fusions
will often occur throughout large intronic spaces. One solution to
this is long range PCR. By using a limited number of primers tiled
typically 500 bp to 10,000 bp apart throughout each gene of
interest it is possible to setup multiple singleplex PCR reactions
in order to amplify the fusion genes (Lawson A R J et al. Genome
Res. 2011; 21:505-14; EP1914240; Duployez N et al. Am J Hematol.
2014; 89: 610-615). To reduce the number of reactions required it
has been shown that this long-range PCR can be performed in
multiplex. Metzler et al developed a multiplex of 25 forward
primers and 5 biotinylated reverse primers used to amplify the
translocation t (4; 11) followed by positive selection for PCR
products containing one of the biotin-labelled primers then a
second PCR using additional target specific primers in a method
called Asymmetric multiplex PCR (Metzler M et al. Br J Haematol.
2004; 124: 47-54). In this method their primers were typically
1,000 bp apart or greater. The limitation with these approaches is
the requirement for DNA greater than 500 bp in length and therefore
they are not suitable for fragmented DNA such as FFPE or cfDNA.
These long-range PCR methodologies are also not compatible with
Next Generation Sequencing Technologies due to the short-read
length (<500 bp) of most next generation sequencing platforms
without further complex steps such as fragmenting the DNA then
ligating on adaptors. This methodology also requires a potentially
large number of individual PCR reactions to assess each sample or
complex steps such as positive selection using biotin-labelled
primers in order to multiplex such a reaction.
[0007] Alternatively, targeted enrichment and detection of fusions
can be achieved by hybridisation, whereby a biotinylated probe
(.about.120 bases) with complementarity to the target of interest,
is hybridised to the DNA under investigation to selectively recover
and thus enrich for regions of interest with the use of
streptavidin coated magnetic beads. In this case, regions of
interest are genomic regions that are known to undergo gene
fusions. With this hybridisation approach, genomic regions of
interest are recovered whether or not they have undergone a gene
fusion event. Thus, significant sequencing capacity is expended
decoding such regions even when no fusion event has occurred.
Additionally, with this approach, prior to enrichment, DNA has to
be extensively processed (consisting of end-repair, A-tailing and
ligation). As these steps are highly inefficient .about.70% of
starting material is lost prior to hybridisation, limiting the
ability to detect fusions present at low allelic frequencies.
Finally, this approach is time consuming, normally requiring
overnight incubation of target and probe to enable
hybridisation.
[0008] Target enrichment by primer extension enables fusion gene
detection with knowledge of only one of the two fusion partners.
However, this approach is time consuming and requires the ligation
of universal adapters to DNA ends. The inefficiency of ligation
limits the ability to detect fusions present at low allelic
frequencies. As with a hybridisation approach, genomic regions of
interest are recovered whether or not they have undergone a gene
fusion event with this approach and thus, significant sequencing
capacity is needed to assess these large regions if high
sensitivity is required.
[0009] US20160319365 discloses methods for detecting chromosomal
rearrangements using hybridisation probes. However, such techniques
require probes to be designed for the target region, in addition to
PCR primers for the target region. Therefore, the likelihood of
detecting a fusion event is diminished as an additional enrichment
step is performed. It also increases complexity and cost of the
workflow as an additional hybridisation probe is required.
[0010] There remains in the art a need for a method of detecting
gene fusions in an efficient manner, such that gene fusion events
can be detected even when they occur at a low allelic frequency,
particularly when such fusions occur in highly fragmented genomic
DNA.
[0011] These and other features of the present teachings are set
forth herein.
SUMMARY OF THE INVENTION
[0012] The present disclosure relates to methods for targeting
genomic rearrangement, in particular gene fusion events, by
targeting a DNA molecule of interest with a set or pool of primers,
wherein the forward primers and reverse primers produce a PCR
amplification product when a genomic rearrangement is present. This
is achieved by targeting a first region with the forward primers
and targeting a second, different, region with the reverse primers.
The forward and reverse primers produce an amplification product
when they anneal in sufficient proximity to each other. Hence, an
amplification product will be produced when a genomic rearrangement
has occurred to bring the first and second regions into sufficient
proximity. The amplification product is then sequenced to identify
the presence and position of the genomic rearrangement. By
combining selective amplification and sequence determination it is
possible to identify a genomic rearrangement at low allelic
fraction even if the PCR produces off-target amplification. The
methods disclosed herein do not require a further enrichment step,
such as enrichment comprising hybridisation to a probe. The
sequence of a reaction product is indicative of the presence of a
genomic rearrangement, since the sequence read can be used to
directly detect (and characterise) the fusion. Multiple genomic
rearrangements can be detected in a single reaction by using
multiple sets or pools of primers to detect the genomic
rearrangements, wherein each paired set or pool of primers is
designed to amplify a different genomic rearrangement (if present).
The methods can also be combined with methods to determine the
presence or absence of genetic alterations that are not genomic
rearrangements, such as single nucleotide polymorphisms (SNPs).
This can be achieved by using additional primer pairs that act both
as a positive control and to further characterise a disease or
disorder or a patient from whom a sample has been taken and
analysed. The present disclosure does not require end repair or
ligation to enrich for targets of interest and therefore a further
advantage is that there is no loss of starting material due to
processing prior to fusion detection.
[0013] The methods disclosed herein generally comprise: [0014] a.
contacting a sample comprising a DNA molecule of interest (DMOI)
with one or more forward primers and one or more reverse primers,
wherein the or each of the forward primers is specific for a first
region of interest, and the or each of the reverse primers is
specific for a second, different, region of interest; and [0015] b.
conducting PCR.
[0016] In a first aspect, there is provided a method of detecting a
genomic fusion event, comprising: [0017] a. contacting a sample
comprising DNA molecules of interest (DMOIs) with a pool of at
least 20 region-specific forward primers and a pool of at least 20
region-specific reverse primers, wherein: [0018] i. each of the
forward primers in the forward primer pool comprises a sequence
specific for a first region of interest and a first primer binding
site; and [0019] ii. each of the reverse primers in the reverse
primer pool comprises a sequence specific for a second, different,
region of interest and a second primer binding site; [0020] b.
amplifying the DMOIs using the region-specific primers; [0021] c.
conducting PCR using forward primers that target the first primer
binding site and reverse primers that target the second primer
binding site; [0022] d. sequencing the PCR amplification product to
provide a library of sequence reads, wherein the sequence reads
comprise the sequence of a forward and/or reverse primer used in
step (a); [0023] e. using the sequence reads provided in step (d)
to determine the sequence of the genomic fusion between the first
and second regions of interest.
[0024] In some embodiments, the first primer binding site is the
same in each of the at least 20 region-specific forward primers and
the second primer binding site is the same in each of the at least
20 region-specific reverse primers. The first and second primer
binding sites may be different from each other. The first and
second primer binding sites act as universal primer bindings sites
in a subsequent PCR.
[0025] Step (b) may comprise multiplex PCR, which is also a
selective PCR, since an exponential amplification product will be
produced in the presence of a genomic rearrangement event that
brings the first and second regions into sufficient proximity to
each other. Generally, the genomic rearrangement is a gene
fusion.
[0026] The methods comprise sequencing the final amplification
product. Hence in some embodiments the methods comprise decoding
the genomic rearrangement (e.g. gene fusion) by sequencing. In some
embodiments, the method comprises multiple PCR reactions, for
example a first PCR using the region-specific primers and a second
PCR using primers specific for sequences introduced into the
amplicons by the primers used in a first PCR.
[0027] In a second aspect, there is provided a method, comprising:
[0028] a. providing a sample from a patient, said sample comprising
one or more DMOIs; and [0029] b. determining the presence or
absence of a genomic rearrangement event according to a method
disclosed herein.
[0030] The method may be a method of diagnosing or characterising
cancer, a method of determining cancer prognosis, a method of
determining cancer remission or relapse, a method of characterising
cancer, a method of detecting progression of cancer, or a method of
determining the presence or absence of residual cancer. The method
may comprise extracting, isolating or enriching for the DMOI from
the patient sample prior to determining the presence or absence of
a genomic rearrangement. However, an advantage of the methods and
kits disclosed herein is that enrichment of the sample for the DMOI
is not required, and so the methods do not involve the loss of
sensitivity due to inefficient enrichment methods.
[0031] In a third aspect there is provided a method of treating a
disease, such as cancer, comprising [0032] a. providing a sample
from a patient, said sample comprising one or more cell-free DNA
molecules of interest (DMOIs); [0033] b. determining the presence
or absence of a genomic rearrangement event according to a method
disclosed herein; and [0034] c. administering a therapy to the
patient, such as a cancer therapy.
[0035] In a fourth aspect there is provided a method of determining
a treatment regimen for a patient, such as a cancer patient or a
patient suspected of having cancer, comprising: [0036] a. providing
a sample from a patient, said sample comprising one or more
cell-free DNA molecules of interest (DMOIs); [0037] b. determining
the presence or absence of a genomic rearrangement event according
to a method disclosed herein; and [0038] c. selecting a treatment
regimen for the patient according to the presence or absence of a
genomic rearrangement in the one or more DMOIs.
[0039] The method may further comprise administering said treatment
regimen to the patient.
[0040] In a fifth aspect there is provided a method of predicting a
patient's responsiveness to a cancer treatment, comprising [0041]
a. providing a sample from a patient, said sample comprising one or
more cell-free DNA molecules of interest (DMOIs); [0042] b.
determining the presence or absence of a genomic rearrangement
event according to a method disclosed herein; [0043] c. predicting
a patient's responsiveness to a cancer treatment according to the
presence or absence of a genomic rearrangement in the one or more
DMOIs.
[0044] In another embodiment, there is provided a method of early
cancer detection/diagnosis of cancer, comprising: [0045] a.
providing a sample from a patient, said sample comprising one or
more cell-free DNA molecules of interest (DMOIs); [0046] b.
determining the presence or absence of a genomic rearrangement
event according to a method disclosed herein; [0047] c. diagnosing
a patient as having cancer if a genomic rearrangement event is
detected.
[0048] The methods disclosed herein are combined with sequencing of
the amplification product of the forward and reverse primers to
detect the genomic rearrangement.
[0049] The methods disclosed herein therefore comprise sequencing
the amplification product and determining the sequence of the DNA
that has been amplified (decoding the DMOI by sequencing). This
enables non-specific (off-target) amplification to be discounted
and true genomic rearrangements (such as gene fusions) to be
identified and characterised. The methods allow the identification
of a gene breakpoint in a gene fusion and enable a disease, in
particular cancer, to be characterised. The methods can also be
used to assess and/or monitor cancer progression in a subject,
optionally a subject that has received or is receiving treatment
for the cancer. The methods can also predict whether or not a
patient will respond to a given cancer treatment.
[0050] In a further aspect there is provided a kit of parts
comprising a plurality of forward primers and a plurality of
reverse primers, wherein the forward primers are each specific for
a first region of interest, and the reverse primers are each
specific for a second, different, region of interest.
[0051] In a still further aspect there is provided a pool of
forward and reverse primers, comprising a plurality of forward
primers specific for a first region of interest and a plurality of
reverse primers specific for a second region of interest, wherein
the first and second regions of interest are different to each
other. The kits and primer pools disclosed herein can be used in
the methods disclosed herein to determine the presence or absence
of a genomic rearrangement.
[0052] In a further embodiment there is provided a reaction mixture
comprising: [0053] a. a kit or pool of primers disclosed herein;
and [0054] b. a sample from a patient containing a DMOI derived
from a neoplasm or a cancer.
[0055] In a further embodiment there is provided the kits or primer
pools disclosed herein for use in the diagnosis of a disease such
as cancer.
[0056] In a still further embodiment, there is provided a method
for determining the presence or absence of a gene fusion in a DMOI,
the method comprising: [0057] a. providing the sequence of a DMOI
as a sequence read; [0058] b. identifying in the sequence read the
presence of at least one forward primer binding site and the
presence of at least one reverse primer binding site from a
population of forward and reverse primers; [0059] c. determine the
corresponding genomic locations of the forward and reverse primer
binding sites by reference to the sequences of the forward and
reverse primer binding sites and the sequences downstream and
adjacent to the forward and reverse primer binding sites in the
sequence read: determining the presence or absence of a gene fusion
in the DMOI.
BRIEF DESCRIPTION OF THE FIGURES
[0060] The skilled artisan will understand that the drawings,
described below, are for illustration purposes only. The drawings
are not intended to limit the scope of the present teachings in any
way.
[0061] FIG. 1: Cell line fusion mix (custom product Horizon
Discovery Group) consisting of a mixture of EML4-ALK
fusion-positive DNA and normal (fusion-negative) DNA was serially
diluted to achieve allelic fractions of 1%, 0.5%, 0.25%, 0.125% and
0.0625%. Fusion-negative human placental DNA (bioline) was added to
maintain the genome input copy number constant at 4000 input
copies. Fusion enrichment is achieved by selective PCR and a second
PCR ensures the addition of barcoded illumina adapters. Fusion
genes are decoded by next-generation sequencing e.g. on the NextSeq
500 Illumina platform. Sequencing data is screened for the presence
of fusion genes using the described bioinformatic pipeline and data
is published in a fusion detection report.
[0062] FIG. 2: The sequence of the EML4-ALK gene fusion in the
fusion-positive material from Horizon is known (expected EML4-ALK
breakpoint). A. Different combinations of adjacent primers are able
to amplify the gene fusion. Two types of reads, containing the
fusion breakpoint, are obtained as a result of amplification of the
fusion by different primer pairs. Both reads contain the expected
fusion gene sequence as well as flanking DNA sequences of different
lengths. From top to bottom: SEQ ID NOS: 1, 2, and 3. B. Fusion
detection was performed on three replicates at each of the allelic
frequencies. Fusions were detected at all allelic fractions in all
replicates.
[0063] FIG. 3: Median read depth obtained for an ALK-EM L4 fusion
at 0.0625, 0.125, 0.25, 0.5 and 1% allelic fraction. The median of
the number of fusion reads detected in the three replicates was
calculated and plotted against the different allelic fractions.
[0064] FIG. 4: Experiment determining ROS1 Fusion. To test the
detection of fusion genes between ROS1 and CD74, a 500 bp fragment
of synthetic DNA (gblock) that contains the sequence of a published
ROS1-CD74 gene fusion was synthesized by IDT. The synthetic gblock
was fragmented by sonication (Covaris) to an average of 150 bp and
added to sheared fusion-negative human placental DNA to achieve an
allelic fraction of 1% at 4000 input copies. The fusion gene was
amplified by selective PCR and decoded on the NextSeq500
(Illumina). Sequencing data is screened for the presence of fusion
genes using the described bioinformatic pipeline and data is
published in a fusion detection report.
[0065] FIG. 5: The sequence of the synthesised ROS1-CD74 fusion
containing gblock is depicted. The gblock was fragmented to an
average of 150 bp prior to inputting into the assay. SEQ ID NO:
5.
[0066] FIG. 6: Next Generation sequencing reads obtained from
ROS1-CD74 gBlock. A. Two combinations of forward and reverse
primers amplified the fusion gene (SEQ ID NOS: 5 and 6). B. The
sequence of the read detected for each is shown. The sequence of
the read is shown in bold letters within the geneblock sequence
(SEQ ID NOS: 7 and 8).
[0067] FIG. 7: Example 2-step workflow showing multiplex PCR
conducted with primers that tile genes of interest at intervals (75
bp in this example). Gene A is tiled only with forward primers and
Gene B is tiled only with reverse primers. The primers contain a
universal primer site (UPS) (for example part of an Illumina
adaptor sequence) at the 5' end and a gene specific sequence at the
3' end. A. in normal cells that do not have a gene fusion, PCR
amplification does not occur as the distance between the genes is
too great. B. in fusion-positive cancer cells, Genes A and B are
brought into close proximity with one another (for example within
150 bp) so a product is generated by PCR amplification C. The
presence of the UPSs (such as UPSs incorporated in partial
sequencing adaptors, such as partial Illumina adaptors) allows the
construction of complete sequencing adaptors (such as Illumina
adaptors) in a second round of PCR. This second round of PCR uses
primers that anneal to the UPS element of the original primers (at
the 3' end of the primer) and contain the rest of the sequencing
adaptor (at the 5' end of the primer).
[0068] FIG. 8: Bioinformatic method for calling gene fusions:
Amplicons are generated by two primer pairs amplifying a fusion
event which are then sequenced (dotted line indicates read) by NGS
(Black Arrows indicate sequencing primers). The analysis method
involves determining the minimum number of base pairs that need to
be sequenced (for each primer site) to uniquely match a target
region. A strong anchor has sufficient base pairs sequenced to
uniquely match a target region, a weak anchor does match a target
region but also matches other regions in the reference genome, it
therefore does not uniquely match the target region. The method
uses the known primer binding locations to determine the expected
sequence within the reads which removes the need for aligning reads
to the entire reference genome. A. An amplicon has two strong
anchors with both the ALK and EML4 portions of read uniquely
matching an ALK or EML4 reference sequence. B. An amplicon has one
strong anchor and one weak anchor. ALK portion of read uniquely
matches a target region, EML4 does not uniquely match the reference
genome.
DETAILED DESCRIPTION OF THE INVENTION
[0069] Before the various embodiments are described, it is to be
understood that the teachings of this disclosure are not limited to
the particular embodiments described, and as such can, of course,
vary. It is also to be understood that the terminology used herein
is for the purpose of describing particular embodiments only, and
is not intended to be limiting, since the scope of the present
teachings will be limited only by the appended claims.
[0070] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described in any way. While the present teachings are
described in conjunction with various embodiments, it is not
intended that the present teachings be limited to such embodiments.
On the contrary, the present teachings encompass various
alternatives, modifications, and equivalents, as will be
appreciated by those of skill in the art.
[0071] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this disclosure belongs.
Although any methods and materials similar or equivalent to those
described herein can also be used in the practice or testing of the
present teachings, some exemplary methods and materials are now
described.
[0072] The citation of any publication is for its disclosure prior
to the filing date and should not be construed as an admission that
the present claims are not entitled to antedate such publication by
virtue of prior invention. Further, the dates of publication
provided can be different from the actual publication dates which
can need to be independently confirmed.
[0073] As will be apparent to those of skill in the art upon
reading this disclosure, each of the individual embodiments
described and illustrated herein has discrete components and
features which can be readily separated from or combined with the
features of any of the other several embodiments without departing
from the scope or spirit of the present teachings. Any recited
method can be carried out in the order of events recited or in any
other order which is logically possible. All patents and
publications, including all sequences disclosed within such patents
and publications, referred to herein are expressly incorporated by
reference.
[0074] Numeric ranges are inclusive of the numbers defining the
range. Unless otherwise indicated, nucleic acids are written left
to right in 5' to 3' orientation; amino acid sequences are written
left to right in amino to carboxy orientation, respectively.
[0075] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs.
Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR
BIOLOGY, 2D ED., John Wiley and Sons, New York (1994), and Hale
& Markham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper
Perennial, N.Y. (1991) provide one of skill with the general
meaning of many of the terms used herein. Still, certain terms are
defined below for the sake of clarity and ease of reference.
[0076] It must be noted that as used herein and in the appended
claims, the singular forms "a", "an", and "the" include plural
referents unless the context clearly dictates otherwise. For
example, the term "a primer" refers to one or more primers, i.e., a
single primer and multiple primers. It is further noted that the
claims can be drafted to exclude any optional element. As such,
this statement is intended to serve as antecedent basis for use of
such exclusive terminology as "solely," "only" and the like in
connection with the recitation of claim elements, or use of a
"negative" limitation.
[0077] The present disclosure provides novel methods for detecting
and determining the sequence of genomic rearrangements, in
particular gene fusions, by using primers to target regions that
are usually too far apart in a genome, chromosome or gene for an
amplification product to be produced in a normal PCR. This is
achieved by conducting a selective PCR comprising providing a
forward primer (or preferably a pool of at least 20 forward
primers) specific for a first region of interest and a reverse
primer (or preferably a pool of at least 20 reverse primers)
specific for a second region of interest, wherein the first and
second regions of interest are different. In particular, the two
regions of interest are located at distinct positions in a genome,
chromosome or gene such that in a normal sample (i.e. a sample
comprising DNA molecules in which a genomic rearrangement has not
occurred) the two regions are too far apart for an amplification
product to be produced in a normal PCR (for example, more than 1 kb
apart or on different chromosomes). For example, the two regions
could be two different genes. If a genomic rearrangement event
occurs, such as a gene fusion event, it brings the two regions of
interest into proximity with each other such that at least one pair
of the forward and reverse primers are sufficiently close to each
other to produce an amplification product in a PCR, even when the
PCR only amplifies small DNA fragments (for example fragments up to
500 bp in length). The sequence of the amplification product is
then determined to confirm the location of the primers used in the
amplification reaction and therefore the presence and location of
the genomic rearrangement in the sample. Multiple regions and
multiple genomic rearrangements can be targeted in a single
reaction. In preferred embodiments the primers are designed to
target DNA sequences in the respective regions of interest that are
not overlapping. Regions of interest can be large and span several
kilobases, or even megabases, without impacting sequencing cost, as
sequencing products will only be generated in a small number of
cases (samples in which a genomic rearrangement has occurred, i.e.
fusion-positive samples) as well as from a small region of the
genome (where the fusion event occurred), no matter how large the
regions of interest covered by the forward and reverse primers
are.
[0078] The term "primer binding site" in the context of a forward
primer or a reverse primer indicates that the forward primer or
reverse primer 5' tail that is not specific for the region of
interest and that, when copied, provides a sequence to which
another primer can bind. Such a primer binding site is typically
8-30 nucleotides in length, although a primer binding site can be
longer or shorter in some instances. Likewise, the site to which a
forward or reverse primer binds is typically at least 8-30
contiguous nucleotides in length.
[0079] The term "primer binding site" can also be used in the
context of the sequence read of the DMOI to denote the sequence to
which the corresponding forward or reverse primer can bind. For
example, in the context of analysis of the sequence reads, the
forward and reverse primer binding sites refers to the
region-specific sequence in the region-specific primers. The at
least one forward primer binding site and the at least one reverse
primer binding site could be the complement of the region-specific
sequence from the corresponding forward or reverse region-specific
primer or could have the same sequence as the region-specific
sequence of a corresponding forward or reverse region-specific
primer, depending on the direction of the sequence read. The
skilled person is able to take such variations into account when
conducting their analysis.
[0080] In any embodiments, all of the primers in a "pool of
region-specific forward primers" can bind to the same strand, i.e.,
the top strand or the bottom strand, but not both strands, of a
region of interest in a reference genome, where the term "reference
genome", refers to a genome whose sequence is at least partially
known. The sequences of several reference genomes, including the
human genome, have been deposited at NCBI's GenBank database and
other databases. A reference genome can be a "wild type" sequence.
Likewise, all of the primers in a "pool of region-specific reverse
primers" can bind also to the same strand, i.e., the top strand or
the bottom strand, but not both strands, of a region of interest in
the reference genome. The forward primers may bind to the same or
different strand to the reverse primers.
[0081] The first region of interest and the second region of
interest should be on different chromosomes or sufficiently
distanced in the reference genome so that no amplification products
are expected unless there is a rearrangement in which the first
region of interest and the second region of interest become closely
linked to one another. In some embodiments, the first and second
regions of interest should be on different chromosomes in the
reference genome, or distanced by at least 10 kb, at least 50 kb,
or at least 100 kb if those regions are on the same chromosome in
the reference genome. In embodiments in which cfDNA isolated from
blood is analysed, the distance between the first and second
regions of interest can be much shorter, e.g., at least 1 kb or at
least 5 kb, because cfDNA is heavily fragmented (having a median
size that is well below 1 kb, e.g., in the range of 50 bp to 500
bp) and, as such, no amplification products would be expected if
the first and second regions are 1 kb or 5 kb apart.
[0082] In any embodiment, all of the forward primers in the forward
primer pool may comprise: i. a sequence at the 3' end that is
complementary to a binding site in a first region of interest and
ii. a 5' tail that is not complementary to a sequence in the first
region of interest, where the sequences at the 3' end of the
forward primer are complementary to different sites in the first
region of interest, and all of the reverse primers in the reverse
primer pool may comprise: i. a sequence at the 3' end that is
complementary to a binding site in the second region of interest
and ii. a 5' tail that is not complementary to a sequence in the
second region of interest, where the sequences at the 3' end of the
reverse primer are complementary to different sites in the second
region of interest.
[0083] In some embodiments, methods disclosed herein are used to
exponentially amplify small stretches of DNA, for example DNA
molecules that are up to 500 nucleotides in length. This be
achieved in a number of ways. Usually, the DNA will be fragmented
prior to carrying out the method. Fragmentation may have occurred
already, for example in the body of a patient such that the sample
obtained already contains fragmented DNA. Alternatively, a step of
DNA fragmentation may be included in the method itself.
[0084] In one embodiment, there is provided a method of detecting a
genomic rearrangement event, comprising: [0085] a. contacting a
sample comprising a DNA molecule of interest (DMOI) with one or
more forward primers and one or more reverse primers, wherein the
or each of the forward primers is specific for a first region of
interest, and the or each of the reverse primers is specific for a
second, different, region of interest; and [0086] b. conducting
PCR.
[0087] In one embodiment there is provided a method of detecting a
genomic rearrangement event, comprising: [0088] a. contacting a
sample comprising a DNA molecule of interest (DMOI) with a pool of
forward primers specific for a first region of interest and a pool
reverse primers specific for a second, different, region of
interest; [0089] b. conducting PCR; [0090] c. determining the
sequence of the amplification product of the PCR.
[0091] In a preferred embodiment, the method comprises all of the
following steps: [0092] a. contacting a sample comprising DNA
molecules of interest (DMOIs) with a pool of at least 20
region-specific forward primers and a pool of at least 20
region-specific reverse primers, wherein: [0093] i. each of the
forward primers in the forward primer pool comprises a sequence
specific for a first region of interest and a first primer binding
site; and [0094] ii. each of the reverse primers in the reverse
primer pool comprises a sequence specific for a second, different,
region of interest and a second primer binding site; [0095] b.
amplifying the DMOIs using the region-specific primers; [0096] c.
conducting PCR using forward primers that target the first primer
binding site and reverse primers that target the second primer
binding site; [0097] d. sequencing the PCR amplification product to
provide a library of sequence reads, wherein the sequence reads
comprise the sequence of a forward and/or reverse primer used in
step (a); [0098] e. using the sequence reads provided in step (d)
to determine the sequence of a genomic fusion between the first and
second regions of interest.
[0099] In some embodiments, the first primer binding site is the
same in each of the at least 20 region-specific forward primers and
the second primer binding site is the same in each of the at least
20 region-specific reverse primers. The first and second primer
binding sites may be different from each other. The first and
second primer binding sites may also be universal primer bindings
sites.
[0100] The combination of the selective PCR with the step of
sequencing allows non-specific and off-target amplification
products to be ruled out and genuine genomic rearrangement events
to be identified.
[0101] The genomic rearrangement event can be an unknown genomic
rearrangement event, since no prior knowledge of the exact nature
of the genomic rearrangement is needed for the methods disclosed
herein to be able to detect and characterise the genomic
rearrangement.
[0102] The first and second regions of interest may be in different
genes. The different regions of interest or different genes are
located at different places in a given genome when a genomic
rearrangement has not occurred, and may even be located on
different chromosomes when a genomic rearrangement event has not
occurred.
[0103] The forward primers and reverse primers are present in a
pool of forward and reverse primers. The forward primers in the
pool of forward primers are specific to a first region of interest
(such as a first gene), and the reverse primers in the pool of
reverse primers are specific to a second, different, region of
interest (such as a second gene). Given the normal location of the
first and second regions or first and second genes, when PCR is
conducted, a PCR product is produced when a genomic rearrangement
event has occurred. Therefore, the PCR can be referred to as a
selective PCR.
[0104] In some embodiments, the first and second regions of
interest are located on the same chromosome but are located such
that no PCR amplification product is generated in the absence of a
genomic rearrangement event. In some embodiments, the first and
second regions of interest are located on the same chromosome but
are separated by a number of base pairs that prevents a PCR
occurring under normal conditions. For example, the first and
second regions may be at least 100 base pairs, or at least 250 base
pairs, or at least 500 base pairs, preferably at least about 1000
base pairs apart.
[0105] In some embodiments, each of the first and second region of
interest are at least 1 kilobase in length and the first and second
regions are separated by at least 1 kilobase when no genomic
rearrangement event has occurred.
[0106] Given that the sequence of an amplification product is
indicative of genomic rearrangement event, the methods disclosed
herein comprise determining the sequence of a PCR amplification
product. In particular, the relevant PCR amplification product to
detect is the amplification product resulting from the PCR of one
or more pairs of forward and reverse primers targeting the two
regions of interest. Determining the sequence of a PCR
amplification product allows the definitive detection of genomic
rearrangements as non-specific or off-target amplification can be
discounted. Therefore, it is the sequence of the DMOI that is
indicative of the presence of a genomic rearrangement event between
the first and second region of interest.
[0107] As noted above, the forward and reverse primers are present
in pools of primers. In such embodiments, the primers preferably
tile the regions of interest. The forward primers tile the first
region of interest and the reverse primers tile the second region
of interest. Tiling the regions involves providing primers that
target different stretches of DNA in the respective regions of
interest. Primers in the same pool of forward or reverse primers
target different stretches of DNA in the respective regions of
interest.
[0108] In a preferred embodiment, the DNA sequences in the regions
of interest that are targeted by the pool of forward or reverse
primers do not overlap. In other words, the region-specific tract
of each member of a primer pool is different and does not overlap
with the region-specific tract of any other member of the primer
pool. However, in a given pool multiple copies of the same primer
are of course possible, and indeed are preferred. In some
embodiments, the pool of primers (either forward or reverse)
comprises a set of primers each targeting a different,
non-overlapping, DNA tract of the region of interest, but the pool
comprises multiple copies of each member of the set.
[0109] As noted above, when a pool of primers tile a region of
interest, the tiling is such that the primers do not target
overlapping DNA stretches of the region of interest, and more
preferably the primers tile at intervals, with gaps between the
stretches of DNA in the region of interest being targeted by the
primers. In some embodiments, the forward and/or reverse primers
tile the first and/or second region of interest at intervals of
from about 10 to about 2000 base pairs, from about 10 to about 1000
base pairs, from about 10 to about 500 base pairs, from about 10 to
about 250 base pairs, from about 10 to about 150 base pairs, from
about 25 to about 125 base pairs, from about 50 to about 100 base
pairs, or from about 60 to about 90 base pairs. An appropriate
frequency for tiling the regions of interest at certain intervals
can be determined by the skilled person. However, tiling at
intervals of from about 60 to about 90 base pairs (or up to about
100 base pairs) can be particularly useful for targeting DNA that
is approximately 150-160 base pairs in length, such as circulating
tumour DNA.
[0110] Similarly, the size of the gaps between sequences of the
regions of interest targeted by the primers in a primer pool may be
from 1 to 150 bases, from 10 to 100 bases, from 25 to 100 bases or
preferably from 50 to 100 bases. Such intervals are particularly
useful for ctDNA, which are approximately 160 base pairs in length.
Hence intervals of 50 to 100 bases (e.g. 75 bases) helps to ensure
that a ctDNA derived from a region of interest will be targeted by
at least one of the forward or reverse primers in the pool.
[0111] In some embodiments the pool of forward primers comprises at
least 20, at least 50 or at least 100 different forward primers.
Preferably the different primers target stretches of DNA in the
region of interest that are not overlapping with each other.
Multiple copies of each primer may be present in the pool.
[0112] In some embodiments, the pool of reverse primers, wherein
the pool of reverse primers comprises at least 20, at least 50 or
at least 100 different reverse primers. Preferably the different
primers target stretches of DNA in the region of interest that are
not overlapping with each other. Multiple copies of each primer may
be present in the pool.
[0113] In one embodiment, the method comprises contacting a sample
containing the DMOI with a pool of forward and a pool of reverse
primers, wherein the pool of forward primers comprises at least 20,
at least 50 or at least 100 different forward primers and a pool of
reverse primers comprising at least 20, at least 50 or at least 100
different reverse primers. Preferably the different primers target
stretches of DNA in the region of interest that are not
overlapping. Multiple copies of each primer may be present in the
pool.
[0114] Preferably at least 100 forward and reverse primers are
used, although the total number could be higher (for example at
least 500 or at least 1000 forward and reverse primers) to enable
larger and more regions of interest to be targeted in a single
reaction.
[0115] The pool of forward primers may comprise at least 20
different forward primers and the pool of reverse primers may
comprise at least 20 different reverse primers.
[0116] In some embodiments, the methods comprise contacting a
sample comprising a DMOI with a pool of at least 20 different
forward primers (for example at least 100 different forward
primers) specific for a first region of interest and a pool of at
least 20 different reverse primers (for example at least 100
different reverse primers) specific for a second region of
interest, wherein each of the first and second region of interest
are at least 1 kilobase in length and the first and second regions
are separated by at least 1 kilobase when no genomic rearrangement
event has occurred, and further wherein the primers tile their
respective regions of interest at intervals of from 50 to 100
bases. The first and second regions may be different genes.
[0117] The primers may be of any suitable length, for example they
may be from 5 to 50 base pairs in length, for example from 10 to 40
base pairs in length, or from 18 to 35 base pairs in length. The
skilled person is familiar with the use of primers in PCR and would
be able to determine appropriate size of a primer.
[0118] To assist in the analysis, the sequences of all the PCR
primers used to target the first and second regions of interest
(the selective PCR primers) are known.
[0119] The methods disclosed herein are useful for detecting the
sequence of multiple types of genomic rearrangement events. Of
particular significance are gene fusion events, which may be
associated with a disease or condition. In some embodiments, the
method comprises determining the presence or absence of a genomic
rearrangement that is known or is suspected to be associated with a
disease or disorder. In some embodiments, the methods determine the
presence or absence of a gene fusion event that is known, or is
suspect to be, associated with cancer. One advantage of the methods
and kits disclosed herein is that they can detect any gene fusion
even between two genes, without the need for prior knowledge of the
precise fusion event that has occurred. The methods and kits
disclosed herein can also significantly reduce the amount of
sequencing required since the gene rearrangement is selectively
enriched. The step of sequencing the amplification product provides
information on the precise fusion or genomic rearrangement event
that has occurred and ensures that only a true gene rearrangement
is detected/reported.
[0120] When a genomic rearrangement event has occurred, at least
one pair of forward and reverse primers anneals to the DMOI within
500 base pairs from each other, or within 400 base pairs from each
other, or within 300 base pairs from each other, or within 200 base
pairs from each other, or within 175 base pairs from each
other.
[0121] The primers themselves may be gene specific primers, with
each of the forward primers being specific for a first gene (i.e. a
first region of interest) and each of the reverse primers being
specific for a second, different, gene (i.e. a second region of
interest). The primers comprise a region-specific sequence that
enables the primer to anneal to a region of interest.
[0122] The primers used in the selective PCR may also comprise
other features. For example, the primers may comprise sequencing
adaptors or partial sequencing adaptors that allow the
amplification product (if one is produced) to be sequenced without
the need for ligating on adaptors separately (see, for example,
Weaver et al., Nat Genet., 2014; 46: 837-843 and Forshew et al.,
Sci Transl Med., 2012; 4). Adaptors are moieties that allow
sequencing of DNA, in particular using high-throughput sequencing
(i.e. next generation sequencing, NGS), and they are familiar to
the skilled person. Most commonly, and potentially in addition to
sequencing adaptors, the region-specific primers may comprise one
or more primer binding sites, in particular universal primer
binding sites (UPS). The incorporation of the UPSs into the
amplification product allows the amplification product of a first
reaction to be targeted again with a further pair of primers that
are specific for the UPS. The primers used in the second PCR may
themselves comprise the sequencing adaptors or partial sequencing
adaptors that allow the amplification product of the second PCR to
be sequenced using NGS. When two or more PCR reactions are used,
the methods may comprise a step of purification of the amplicons
from the first PCR before conducting the second PCR. The first PCR
is a multiplex PCR, whereas the second PCR is not multiplex PCR,
since only primers specific for the universal primer sites
introduced in the first round of PCR are used in the second PCR.
However, this second PCR step may still act to selectively amplify
DMOIs that represent genomic rearrangement events, since only those
DMOIs will have been amplified in the first PCR (apart from some
possible non-specific PCR amplification), although in itself this
is not a selective amplification step.
[0123] PCR can be used to introduce a number of features into the
DMOI. For example, PCR may incorporate a universal primer binding
site (or sequencing adapter, as discussed above), a molecular
barcode and/or index sequence into the PCR product. Index sequences
may be a sequence that identifies the DNA as deriving from a
particular sample or patient, and so may be a patient or
sample-specific index sequence. A molecular barcode may be used to
identify different starting DMOI in a given sample, and so may be
DMOI-specific molecular barcodes. Typically, a molecular barcode
and universal primer binding sites may be introduced in the first
PCR using the region-specific primers. An index sequence may
typically be incorporated in a second PCR using primers that target
the universal primer binding sites introduced in the first PCR.
[0124] Sequencing adaptors may be incorporated in the first or
second PCR. Alternatively, partial sequencing adaptors may be
incorporated into the first PCR and partial sequencing adaptors may
be incorporated in a second PCR, subsequently completing the
sequencing adaptors. The universal primer binding sites that are
incorporated in the method may make up a first portion of a
sequencing adaptor that is completed with a second portion of the
sequencing adaptor when a subsequent PCR takes place. Therefore,
the sequencing adaptors may comprise the universal primer binding
sites. Such an embodiment is described in FIG. 7. However, the
precise method used to incorporate the sequencing adaptors is not
crucial and the incorporation of sequencing adaptors to allow the
amplification product to be sequenced is familiar to the skilled
person and appropriate PCR based methods may be used. Preferably
the sequencing adaptors are not incorporated or attached by
ligation.
[0125] The step of "amplifying the DMOIs using the region-specific
primers" may be achieved in a number of ways. A key aspect is to
incorporate the first and second universal primer binding sites
from the region-specific primers into a reaction product to allow a
subsequent PCR targeting those first and second primer binding
sites.
[0126] For example, amplification of the DMOIs using the
region-specific primers may comprise extension reactions (as in the
sequential methods, discussed below) and/or PCR. There are
therefore several appropriate workflows for the methods disclosed
herein. In some embodiments, the sample comprising the DMOIs is
contacted with the forward and reverse region-specific primers and
PCR conducted with forward and reverse primers present. The PCR
incorporates universal primer binding sites into the PCR product,
which is then targeted in a second PCR using universal primers to
incorporate sequencing adaptors. For example, as follows: [0127] a.
contacting a sample comprising DNA molecules of interest (DMOIs)
with a pool of at least 20 region-specific forward primers and a
pool of at least 20 region-specific reverse primers, wherein:
[0128] i. each of the forward primers in the forward primer pool
comprises a sequence specific for a first region of interest and a
first primer binding site; and [0129] ii. each of the reverse
primers in the reverse primer pool comprises a sequence specific
for a second, different, region of interest and a second primer
binding site; [0130] b. amplifying the DMOIs using the
region-specific primers by PCR to incorporate the first and second
primer binding sites into the amplification product; [0131] c.
conducting a further PCR using forward primers that target the
first primer binding site and reverse primers that target the
second primer binding site to incorporate sequencing adaptors into
the amplification product; [0132] d. sequencing the PCR
amplification product to provide a library of sequence reads,
wherein the sequence reads comprise the sequence of a forward
and/or reverse primer used in step (a); [0133] e. using the
sequence reads provided in step (d) to determine the sequence of a
genomic fusion between the first and second regions of
interest.
[0134] In some embodiments, the first primer binding site is the
same in each of the at least 20 region-specific forward primers and
the second primer binding site is the same in each of the at least
20 region-specific reverse primers. The first and second primer
binding sites may be different from each other. The first and
second primer binding sites may also be universal primer bindings
sites.
[0135] It is possible to even conduct the entire method using a
single PCR, in which the incorporation of universal primer binding
sites is not required, for example as follows: [0136] a. contacting
a sample comprising DNA molecules of interest (DMOIs) with a pool
of at least 20 region-specific forward primers and a pool of at
least 20 region-specific reverse primers, wherein: [0137] i. each
of the forward primers in the forward primer pool comprises a
sequence specific for a first region of interest and a first primer
binding site and a sequencing adaptor; and [0138] ii. each of the
reverse primers in the reverse primer pool comprises a sequence
specific for a second, different, region of interest and a second
primer binding site, and a sequencing adaptor; [0139] b. amplifying
by PCR the DMOIs using the region-specific primers, wherein the
sequencing adaptors are incorporated into the amplification product
by the PCR; [0140] c. sequencing the PCR amplification product to
provide a library of sequence reads, wherein the sequence reads
comprise the sequence of a forward and/or reverse primer used in
step (a); [0141] d. using the sequence reads provided in step (d)
to determine the sequence of the genomic fusion between the first
and second regions of interest.
[0142] In some embodiments, the first primer binding site is the
same in each of the at least 20 region-specific forward primers and
the second primer binding site is the same in each of the at least
20 region-specific reverse primers. The first and second primer
binding sites may be different from each other. The first and
second primer binding sites may also be universal primer binding
sites. The forward and reverse primers may also comprise a
molecular barcode and/or an index sequence.
[0143] Alternatively, the method can be conducted sequentially,
which requires the use of one or more extension reactions followed
by one or more PCR amplifications. For example, the sample
comprising the DMOIs may be contacted with the forward
region-specific primers, and one or more extension reactions
conducted to extend the annealed primers along the DMOI. The
forward primers comprise a region-specific sequence and a first
primer binding sequence for use in a subsequent PCR. The one or
more extension reactions incorporate the first primer binding site
into the daughter molecules and also amplifies a first strand of
the DMOI. Subsequently, one or more extension reactions are
conducted using the reverse region-specific primers to incorporate
a second primer binding site into the daughter molecules and also
amplify the second strand of the DMOI. A PCR can then be conducted
using primers that target the first and second primer binding sites
incorporated by the one or more extension reactions. That PCR may
also incorporate sequencing adaptors to allow the reaction product
to be sequenced and the genomic rearrangement to be characterised.
Note that the method may comprise conducting a single extension
reaction for the forward primer and/or a single extension reaction
for the reverse primer. However, in preferred embodiments, the
method comprises a plurality of extension reactions for both the
forward and reverse primers. Conducting a plurality of extension
reactions means: [0144] a) contacting the DMOIs with the forward
region-specific primers; [0145] b) allowing the forward
region-specific primers to anneal to the DMOIs; [0146] c)
conducting an extension reaction to extend annealed forward
region-specific primers along the DMOI; [0147] d) denaturing the
resulting double-stranded DNA molecule; and [0148] e) repeating
steps (b) to (d) a plurality of times.
[0149] The same steps can be undertaken for the reverse
region-specific primers.
[0150] The skilled person will be aware of suitable reaction
conditions to allow the components of the reaction to anneal,
extend or denature, as appropriate.
[0151] Accordingly, in one embodiment, the method comprises: [0152]
a. contacting the sample comprising the DMOIs with the pool of at
least 20 region-specific forward primers; [0153] b. conducting one
or more extension reactions to extend annealed forward primers
along the DMOIs and to introduce the first primer binding site into
the extension product; [0154] c. optionally removing or
deactivating the region-specific forward primers from the reaction
mixture; [0155] d. contacting a sample obtained in step (c) with
the pool of at least 20 region-specific reverse primers; [0156] e.
conducting one or more extension reactions to extend annealed
reverse primers along the DMOIs and to introduce the second primer
binding site into the extension product; [0157] f. optionally
removing or deactivating the region-specific reverse primers from
the reaction mixture; and [0158] g. conducting PCR using forward
primers that target the first priming binding site introduced in
step (b) and reverse primers that target the second priming binding
site introduced in step (e) to amplify a genomic fusion event
between the first and second regions of interest.
[0159] The forward primers used in step (a) comprise a sequence
specific for a first region of interest and a first primer binding
site, and in some embodiments the first primer binding site is the
same in each of the forward primers in the forward primer pool. The
reverse primers used in step (d) comprise a sequence specific for a
second, different, region of interest and a second primer binding
site, and in some embodiments the second primer binding site is the
same in each of the reverse primers in the reverse primer pool.
[0160] The one or more extension reactions of steps (b) and (e)
incorporate the first and second primer sites present in the
forward and reverse region-specific primers into the extension
products. The first and second primer sites introduced in steps (b)
and (e) therefore act as a forward and reverse primer sites for the
primer pair used in step (g) to amplify a genomic rearrangement
between the first and second regions of interest. A fusion specific
exponential reaction product will only be produced when a genomic
rearrangement has occurred to situate the first and second primers
sites sufficiently close together in a single molecule, hence
allowing a genomic rearrangement between the first and second
regions to be identified.
[0161] In any methods disclosed herein that comprise the
incorporation of first and second universal primer binding sites
into the amplification product, the first and second universal
primer binding sites are different from each other.
[0162] It is also noted that the use of "forward" and "reverse" as
used throughout is simply for the purposes of orientation and
explanation. The skilled person will be aware that the "forward"
and "reverse" designation could be switched, without affecting the
method in any way.
[0163] In another embodiment, the method may comprise: [0164] a.
contacting the sample comprising the DMOIs with the pool of at
least 20 forward primers; [0165] b. conducting one or more
extension reactions to extend annealed forward primers along the
DMOIs and to introduce the first primer binding site into the
extension product; [0166] c. optionally removing or deactivating
the forward primers from the reaction mixture; [0167] d. contacting
a sample obtained in step (c) with: [0168] i. the pool of at least
20 reverse primers; and [0169] ii. primers targeting the first
primer binding site added in step (a); and [0170] e. conducting PCR
to amplify a genomic fusion event between the first and second
regions of interest.
[0171] Again, the forward primers used in step (a) comprise a
sequence specific for a first region of interest and a first primer
binding site, and in some embodiments the first primer binding site
is the same in each of the forward primers in the forward primer
pool. The reverse primers used in step (d)(i) comprise a sequence
specific for a second, different, region of interest and a second
primer binding site, and in some embodiments the second primer
binding site is the same in each of the reverse primers in the
reverse primer pool.
[0172] Similarly, the one or more extension reactions of step (b)
incorporates the first primer site into extension products arising
from DMOIs that comprise the first region of interest. In step (d),
fusion-specific exponential PCR will occur where the second region
of interest is sufficiently close to the first priming site
introduced in the one or more extension reactions of step (b). The
first primer site introduced in step (b) and the second region of
interest targeting in step (d)(i) therefore act as a forward and
reverse primer sites for the primer pair used in step (e) to
amplify a genomic rearrangement between the first and second
regions of interest.
[0173] In the two sequential methods described above using one or
more extension reactions, it is still possible to use primer pools
that target multiple first and second regions of interest,
including using panels of primers that tile the regions of
interest. Also, the priming sites incorporated into the extension
and/or PCR products can be universal primer binding sites.
[0174] Methods of removal or deactivation of primers are well known
to persons of skill in the art. For example, the step of removing
the primers may comprise removal by size selection, size exclusion
columns, gel extraction, or silica membrane columns. The step of
deactivating the primers may comprise enzymatic digestion of the
primers. The steps of removal and/or deactivation of primers are
optional. However, they may be present in preferred
embodiments.
[0175] In both example sequential methods outlined above, the
method further comprises a step of sequencing the PCR product. This
may be achieved by conducting a further PCR amplification reaction,
for example to introduce sequencing adaptors into the DMOI, prior
to sequencing the DMOIs. The sequencing adaptors allow the
amplified DMOIs to be sequenced using next generation sequencing
techniques. Alternatively, the DMOIs can be prepared for sequencing
using a single PCR by using primers that incorporate sequencing
adaptors into the DMOIs during the first PCR. This can be achieved
by, for example, using primers in the first PCR that also
incorporate the sequencing adaptors, avoiding the need for an
additional PCR.
[0176] In one embodiment, the method comprises [0177] a. contacting
the sample comprising the DMOIs with the pool of at least 20
forward primers; [0178] b. conducting one or more extension
reactions to extend annealed forward primers along the DMOIs and to
introduce the first primer binding site into the extension product;
[0179] c. optionally removing or deactivating the forward primers
from the reaction mixture; [0180] d. contacting a sample obtained
in step (c) with the pool of at least 20 reverse primers; [0181] e.
conducting one or more extension reactions to extend annealed
reverse primers along the DMOIs and to introduce the second primer
binding site into the extension product; [0182] f. optionally
removing or deactivating the reverse primers from the reaction
mixture; and [0183] g. conducting PCR using forward primers that
target the first priming binding site introduced in step (b) and
reverse primers that target the second priming binding site
introduced in step (e) to amplify a genomic fusion event between
the first and second regions of interest, wherein either: [0184] i.
the primers used in step (g) comprise sequencing adaptors; or ii.
the method further comprises a second PCR amplification reaction to
incorporate sequencing adaptors into the reaction product; and
[0185] h. sequencing the reaction product of step (g).
[0186] In another embodiment the method comprises: [0187] a.
contacting the sample comprising the DMOIs with the pool of at
least 20 forward primers; [0188] b. conducting one or more
extension reactions to extend annealed forward primers along the
DMOIs and to introduce the first primer binding site into the
extension product; [0189] c. optionally removing or deactivating
the forward primers from the reaction mixture; [0190] d. contacting
a sample obtained in step (c) with: [0191] i. the pool of at least
20 reverse primers; and [0192] ii. primers targeting the first
primer binding site added in step (a); and [0193] e. conducting PCR
to amplify a genomic fusion event between the first and second
regions of interest, wherein either: [0194] i. the primers used in
step (d) comprise sequencing adaptors; or [0195] ii. the method
further comprises a second PCR amplification reaction to
incorporate sequencing adaptors; and [0196] f. sequencing the
reaction product of step (e).
[0197] As noted, the methods disclosed herein comprise sequencing
the amplification product from a PCR (either the first PCR, or a
second or subsequent PCR if a second or subsequent PCR is used).
Hence in some embodiments, the step of determining the presence or
absence of a genomic rearrangement event comprises determining the
sequence of the DMOI (or rather, the amplification product, which
corresponds to the portion of the DMOI that has been amplified).
The sequencing can be high-throughput sequencing (next generation
sequencing). In some embodiments, the high-throughput sequencing is
selected from the group consisting of sequence-by-synthesis (SBS),
sequencing-by-ligation (SBL) and long-read sequencing (LRS). In
some embodiments, the sequencing-by-synthesis is selected from the
group consisting of cyclic reversible termination SBS and
single-nucleotide addition SBS. In some embodiments, the long-read
sequencing is selected from the group consisting of single-molecule
LRS and synthetic long-read LRS. Specific methods include platforms
such as Illumina (e.g. Mi-Seq or Hi-Seq), Oxford Nanopore, Pacific
Biosciences, Roche 454, Ion torrent (Proton/PGM sequencing), SOLiD
sequencing etc.
[0198] Prior to sequencing of the amplicons generated from the
various PCR reactions used in the methods, the methods may comprise
a step of purification of the amplicons. Methods for purification
are known to the skilled person and commercial kits are available
for this purpose (for example SPRISelect from Beckman Coulter). The
same techniques can be used to purify the amplicons between PCR
reactions.
[0199] Other steps that may be undertaken prior to sequencing may
include size selection. For example, the methods may comprise a
step of selecting amplicons having a size of between 100 and 500
base pairs (for example between 200 and 350 base pairs).
Alternatively, or additionally, the amplicons may also be
quantified prior to sequencing.
[0200] Some embodiments also provide a method for determining the
sequence of a DNA molecule of interest (DMOI) or a portion thereof
(said portion comprising a junction of the genomic rearrangement or
the junction of a gene fusion), the method comprising: [0201] a.
providing a sample obtained from a patient, wherein the sample
comprises a DMOI; [0202] b. optionally processing the sample;
[0203] c. conducting a first PCR using a pool of at least 20
forward and a pool of at least 20 reverse primers disclosed herein,
wherein the first PCR incorporates universal primer binding sites;
[0204] d. conducting a second PCR using at least one pair of
forward and reverse primers that are specific for the universal
primer binding sites incorporated in the first PCR, wherein the
second PCR incorporates sequencing adaptors into the amplification
product of the PCR; and [0205] e. determining the sequence of the
DMOI or portion thereof.
[0206] The disclosure also provides a method for determining the
sequence of a DNA molecule of interest (DMOI) or a portion thereof
(said portion comprising a junction of the genomic rearrangement or
the junction of a gene fusion), the method comprising: [0207] a.
providing an amplicon prepared by a method disclosed herein (such
as method steps (a) to (d) above or any method of detecting genomic
fusions disclosed herein); and [0208] b. determining the sequence
of the DMOI or portion thereof.
[0209] The above methods can be used to characterise the genomic
rearrangement or gene fusion by determining its sequence.
[0210] Determining the sequence of the tagged and enriched DMOI can
be carried out according to any suitable method known to the
skilled person. However, given the benefits of such approaches,
next-generation sequencing (NGS) methods are preferred.
Next-generation sequencing is also referred to as high-throughput
sequencing and massively-parallel sequencing in the art and is
known and understood by the skilled person. A review of
next-generation sequencing techniques is provided in Goodwin et
al., "Coming of age: ten years of next-generation sequence
technologies", 2016, Nature Reviews, 17:333-351.
[0211] Methods disclosed herein may comprise paired-end sequencing,
so as to provide the complete sequence of the DMOI in the sequence
read, even if the sequence read length is shorter than the length
of the DMOIs. Paired-end sequence reads are known to the skilled
person. Preferably, the sequence reads include the sequence of both
the forward and reverse region-specific primers used in the
selective amplification step. Since the sequencing adaptors are
incorporated using primers that incorporate the sequencing adaptors
upstream (i.e. 5') of the forward and reverse region-specific
primers (in particular upstream of the first and second universal
primer binding sites incorporated in the first amplification step),
it will always be possible to provide sequence reads that comprise
the sequence of the forward and reverse region-specific primers
(or, at the very least, the component of the forward and reverse
region-specific primers that anneals to the first or second region
of interest, respectively).
[0212] In some embodiments comprising NGS, the method may further
comprise localising amplified DMOIs to discrete sites. The discrete
sites may comprise a solid or semi-solid substrate. The method may
also comprise hybridising or immobilising the DMOIs to the solid or
semi-solid substrate and clonally amplifying the localised
DMOIs.
[0213] In one embodiment, there is provided a method comprising:
[0214] a. contacting a sample comprising a DNA molecule of interest
(DMOI) with a pool of primers comprising at least 20 forward
primers and at least 20 reverse primers, wherein the forward
primers are specific for a first region of interest and the reverse
primers are specific for a second, different, region of interest,
and wherein the primers comprise a region-specific sequence and a
sequencing adaptor; [0215] b. conducting PCR; and [0216] c.
sequencing the amplification product or products of the PCR using
high-throughput sequencing.
[0217] It is also possible to use multiple pools of primers. For
example, in one embodiment, there is provided a method comprising:
[0218] a. contacting a sample comprising a DNA molecule of interest
(DMOI) with at least two pools of primers, wherein each pool of
primers comprises a set of at least 20 forward primers and at least
20 reverse primers, wherein each set of forward primers are
specific for a first region of interest and each set of reverse
primers are specific for a second, different, region of interest,
and wherein the primers comprise a region-specific sequence and a
sequencing adaptor; [0219] b. conducting PCR; and [0220] c.
sequencing the amplification product or products of the PCR using
high-throughput sequencing.
[0221] In one embodiment, there is provided a method comprising:
[0222] a. contacting a sample comprising a DNA molecule of interest
(DMOI) with a pool of primers comprising at least 20 forward
primers and at least 20 reverse primers, wherein forward primers
are specific for a first region of interest and the reverse primers
are specific for a second, different, region of interest, and
wherein the primers comprise a region-specific sequence and a
universal primer binding site; [0223] b. conducting PCR; [0224] c.
contacting the amplification product from step (b) with one or more
sets of forward and reverse primers that are specific for the
universal primer binding sites introduced by the first PCR, wherein
the primers comprise sequencing adaptors; [0225] d. conducting a
second PCR; and [0226] e. sequencing the amplification product or
products of the PCR using high-throughput sequencing.
[0227] In one embodiment, there is provided a method comprising:
[0228] a. contacting a DNA molecule of interest (DMOI) with at
least two pools of primers, wherein each pool of primers comprises
a set of at least 20 forward primers a set of at least 20 reverse
primers, wherein each set of forward primers are specific for a
first region of interest and each set of reverse primers are
specific for a second, different, region of interest, and wherein
the primers comprise a region-specific sequence and a universal
primer binding site; [0229] b. conducting PCR; [0230] c. contacting
the amplification product from step b. with one or more sets of
forward and reverse primers that are specific for the universal
primer binding sites introduced by the first PCR, wherein the
primers comprise sequencing adaptors; [0231] d. conducting a second
PCR; and [0232] e. sequencing the DMOI using high-throughput
sequencing.
[0233] In some embodiments it is advantageous to include a positive
control. This is to ensure the assay has been carried out correctly
to avoid false negative results. For example, the method may
comprise including one or more pairs of primers that are specific
to a genetic alteration that is different to the genomic
rearrangement targeted by the pool of forward and reverse primers.
For example, the "genetic alteration" may be a single nucleotide
polymorphism (SNP), INDEL, single nucleotide variants (mutations),
substitutions, duplications, insertions, deletions, gene copy
number variations, and structural variants, including inversions
and translocations, or another genetic alteration of interest. The
additional primer pair or primer pairs target a region known to
contain the genetic alteration of interest. The "genetic
alteration" targeted by the "control primers" is distinct from the
"genomic rearrangement event" targeted by the "genomic
rearrangement primers".
[0234] Additionally, the use of one or more pairs of primers that
are specific to a genetic alteration that is different to the
genomic rearrangement targeted by the pool of forward and reverse
primers may allow further characterisation of, for example, the
cancer being diagnosed using the assay. For example, the method
could be combined with primers that are selective for specific
cancer mutations, such as point mutations. Such embodiments would
not include the additional primers only as positive controls but
also to provide additional information about the nature of the
cancer.
[0235] If the method comprises one PCR (for example when the
region-specific primers already include sequencing adaptors for
sequencing the amplification products), the additional primer pair
or primer pairs targeting a different genetic alteration are
generally included in the first reaction mixture such that a single
PCR can amplify the genomic rearrangement DMOI (if present) and the
additional genetic alteration. If the method comprises two PCR
reactions (for example when the forward and reverse region-specific
primers include UPSs, and a second PCR introduces the sequencing
adaptors into the amplification product from the second PCR), the
additional primer pair or primer pairs targeting a different
genetic alteration may be included in either the first PCR mixture
or the second PCR mixture, but preferably will be included in the
first PCR mixture.
[0236] The control primer pair(s) target the same region of
interest. Hence they are different to the forward and reverse
primers that target different regions of interest. As such, an
amplification product should occur from the control primer pair(s)
regardless of the presence or absence of a genomic rearrangement
event. It is also possible that one member of the control primer
pair or pairs is contained within the pool of forward or reverse
primers targeting the genomic rearrangement event. Hence the region
containing the genetic alteration may be within or may overlap or
overlay with the first or second region of interest targeted by the
forward and reverse tiling primers. In other embodiments, the
control primer pair(s) target a region or gene that is different to
the regions or genes targeted by the genomic rearrangement
primers.
[0237] To take into account the need to detect an amplification
product arising from a genomic rearrangement event as being
distinct from an amplification product arising from a genetic
alteration, the genomic rearrangement primers may be present at a
higher concentration than the control primers. For example, each of
the control primers may be present at a concentration that is 50%
or lower than that of the genomic rearrangement primers.
[0238] Multiple "control" primer pairs can be included in the same
reaction, with each primer pair targeting a different genetic
alteration. For example, the set of control primers may comprise up
to 5, up to 10 or up to 20 or more primer pairs, each primer pair
targeting a different genetic alteration. Of course, multiple
copies of each primer pair will generally be added to the reaction
mixture to ensure the PCR takes place correctly.
[0239] As with the selective PCR, the control primer pairs may
incorporate adaptor sequences (also referred to herein as
sequencing adaptors) into the amplicon from the control PCR.
Alternatively, the control primer pairs may incorporate universal
primer binding sites into the amplicons from the control PCR, and
these are targeted using a further PCR using primers specific for
the universal primer binding sites and themselves incorporating the
sequencing adaptors.
[0240] In embodiments comprising the use of control primers, the
method may include detecting the presence or absence of the genetic
alteration. This may comprise sequencing a PCR amplification
product.
[0241] In one embodiment, the methods comprise: [0242] a. providing
a sample comprising a DMOI; [0243] b. optionally extracting the
DMOI from the sample; [0244] c. conducting a selective PCR on the
sample (or extracted DMOI) using a pool of at least 20 forward
primers specific for a first gene and a pool of at least 20 reverse
primers specific for a second gene, wherein the pool of forward
primers tiles the first gene (or a region thereof) and the pool of
reverse primers tile the second gene (or a region thereof), with
space of between 50 and 100 nucleotide bases between adjacent
primers in the pools, wherein the selective PCR is performed
concurrently with a control PCR using one or more primer pairs
specific to a genetic alteration (such as a SNP), and further
wherein the selective and control PCR reactions incorporate
universal primer binding sites into the amplicons that are
generated; [0245] d. optionally purifying the amplicons from step
(c); [0246] e. conducting a further PCR using primers specific for
the universal primer binding sites incorporated in step (c); [0247]
f. optionally purifying the amplicons from step (e); [0248] g.
sequencing the amplification product from step (f); and [0249] h.
determining the presence or absence of a genomic rearrangement. If
a genomic rearrangement is present, the nature of the arrangement
can be determined according to the sequence of the amplicons.
[0250] Importantly, further selective enrichment steps (beyond the
selective PCR step) are not necessary in the methods disclosed
herein, for example using hybridisation probes, since a step of
enrichment is inherently incorporated into the selective PCR.
Therefore, in preferred embodiments, the methods do not comprise
enrichment (for example enrichment of any sample, DNA or amplicon)
by hybridisation, for example enrichment using hybridisation
probes.
The DMOI and Genomic Rearrangements to be Detected
[0251] The DNA molecules of interest (DMOIs) may be single stranded
or double stranded, but they are preferably double stranded. In
some embodiments, the DMOI is DNA obtained by reverse transcription
of RNA. Hence in some embodiments, the method comprises converting
an RNA sequence to a DNA sequence to obtain the DMOI. Converting an
RNA sequence to a DNA sequence may be carried out using a reverse
transcriptase.
[0252] The DMOI may be cell-free DNA (cfDNA). In a preferred
embodiment, the DMOI is a circulating tumour DNA (ctDNA).
[0253] The DMOI are preferably fragmented. The methods may comprise
a step of fragmenting the DNA. Alternatively (and most commonly),
the DNA may already be fragmented in the sample that is obtained
from a patient.
[0254] In some embodiments, the DMOI are up to 500 base pairs in
length.
[0255] When the DMOIs are ctDNA molecules, the ctDNA may be from a
cancer selected from the group consisting of acute lymphoblastic
leukemia, acute or chronic lymphocyctic or granulocytic tumour,
acute myeloid leukemia, acute promyelocytic leukemia,
adenocarcinoma, adenoma, adrenal cancer, basal cell carcinoma, bone
cancer, brain cancer, breast cancer, bronchi cancer, cervical
dysplasia, chronic myelogenous leukemia, colon cancer, epidermoid
carcinoma, Ewing's sarcoma, gallbladder cancer, gallstone tumour,
giant cell tumour, glioblastoma multiforma, hairy-cell tumour, head
cancer, hyperplasia, hyperplastic corneal nerve tumour, in situ
carcinoma, intestinal ganglioneuroma, islet cell tumour, Kaposi's
sarcoma, kidney cancer, larynx cancer, leiomyomater tumour, liver
cancer, lung cancer, lymphomas, malignant carcinoid, malignant
hypercalcemia, malignant melanomas, marfanoid habitus tumour,
medullary carcinoma, metastatic skin carcinoma, mucosal neuromas,
mycosis fungoide, myelodysplastic syndrome, myeloma, neck cancer,
neural tissue cancer, neuroblastoma, osteogenic sarcoma,
osteosarcoma, ovarian tumour, pancreas cancer, parathyroid cancer,
pheochromocytoma, polycythemia vera, primary brain tumour, prostate
cancer, rectum cancer, renal cell tumour, retinoblastoma,
rhabdomyosarcoma, seminoma, skin cancer, small-cell lung tumour,
soft tissue sarcoma, squamous cell carcinoma, stomach cancer,
thyroid cancer, topical skin lesion, veticulum cell sarcoma, and
Wilm's tumour. In a preferred embodiment, the cancer is lung
cancer.
[0256] The DMOI may be derived from a fusion gene or a fragment of
a fusion gene. The fusion may be a fusion selected from the group
consisting of CD74-ROS1, SLC34A2-ROS1, SDC4-ROS1, EZR-ROS1,
GOPC-ROS1, LRIG3-ROS1, TPM3-ROS1, PPFIBP1-ROS1, EML4-ALK, BCR-ABL,
TCF3-PBX1, ETV6-RUNX1, MLL-AF4, SIL-TAL1, RET-NTRK1, PAX8-PPARG,
MECT1-MAML2, TFE3-TFEB, BRD4-NUT, ETV6-NTRK3, TMPRSS2-ERG,
TPM3-NTRK1, SQSTM1-NTRK1, CD74-NTRK1, MPRIP-NTRK1 and TRIM24-NTRK2.
In some embodiments, the fusion is a fusion between a gene selected
from the group consisting of ROS1, ALK, EML4, BCR, ABL, TCF3, PBX1,
ETV6, RUNX1, MLL, AF4, SIL, TAL1, RET, NTRK1, PAX8, PPARG, MECT1,
MAML2, TFE3, TFEB, BRD4, NUT, ETV6, NTRK3, TMPRSS2, NKRT2 and ERG
and at least one other gene. In preferred embodiments, the gene
fusion is a ROS1 fusion, an ALK fusion, a NTRK1 fusion or a RET
fusion. Fusion that are particular preferred are ROS1-CD74,
ROS1-SLC34A2, ROS1-SDC4, ROS1-EZR, ALK-EML4, KIF5B-RET, TRIM33-RET,
CCDC6-RET, NCO4A-RET, KIF5B-ALK, TPM3-NTRK1, SQSTM1-NTRK1,
CD74-NTRK1, MPRIP-NTRK1.
[0257] Accordingly, the region that is targeted by the forward or
reverse region-specific primers may be selected from the group
consisting of ROS1, ALK, EML4, BCR, ABL, TCF3, PBX1, ETV6, RUNX1,
MLL, AF4, SIL, TAL1, RET, NTRK1, PAX8, PPARG, MECT1, MAML2, TFE3,
TFEB, BRD4, NUT, ETV6, NTRK3, TMPRSS2, NKRT2 and ERG. In one
embodiment, the region that is targeted by the forward or reverse
region-specific primers may be selected from the group consisting
of ROS1, ALK, NTRK1 and RET. In one embodiment, the forward
region-specific primer targets a first fusion partner and the
reverse region-specific primer targets as second fusion partner,
wherein the fusion partners are selected from the group consisting
of CD74-ROS1, SLC34A2-ROS1, SDC4-ROS1, EZR-ROS1, GOPC-ROS1,
LRIG3-ROS1, TPM3-ROS1, PPFIBP1-ROS1, EML4-ALK, BCR-ABL, TCF3-PBX1,
ETV6-RUNX1, MLL-AF4, SIL-TAL1, RET-NTRK1, PAX8-PPARG, MECT1-MAML2,
TFE3-TFEB, BRD4-NUT, ETV6-NTRK3, TMPRSS2-ERG, TPM3-NTRK1,
SQSTM1-NTRK1, CD74-NTRK1, MPRIP-NTRK1 and TRIM24-NTRK2. In one
embodiment, the fusion partners are selected from the group
consisting of ROS1-CD74, ROS1-SLC34A2, ROS1-SDC4, ROS1-EZR,
ALK-EML4, KIF5B-RET, TRIM33-RET, CCDC6-RET, NCO4A-RET, KIF5B-ALK,
TPM3-NTRK1, SQSTM1-NTRK1, CD74-NTRK1, MPRIP-NTRK1.
[0258] In one embodiment, the method comprises the use of a pool of
primers that targets at least two genes selected from the group
consisting of ROS1, ALK, EML4, BCR, ABL, TCF3, PBX1, ETV6, RUNX1,
MLL, AF4, SIL, TAL1, RET, NTRK1, PAX8, PPARG, MECT1, MAML2, TFE3,
TFEB, BRD4, NUT, ETV6, NTRK3, TMPRSS2, NKRT2 and ERG. In one
embodiment, the method comprises the use of a pool of primers that
targets at least two genes selected from the group consisting of
ROS1, ALK, NTRK1 and RET. Of course, more than two primer pools can
be used. For example, in one embodiment, the method comprises the
use of a pool of primers that targets ROS1, a pool of primers that
targets ALK, a pool of primers that targets NTRK1 and a pool of
primers that targets RET. Alternatively, at least 5 genes, at least
10 genes or all of the genes ROS1, ALK, EML4, BCR, ABL, TCF3, PBX1,
ETV6, RUNX1, MLL, AF4, SIL, TAL1, RET, NTRK1, PAX8, PPARG, MECT1,
MAML2, TFE3, TFEB, BRD4, NUT, ETV6, NTRK3, TMPRSS2, NKRT2 and ERG
may be targeted in a single reaction. When a fusion between two
different genes is present, a first pool targeting a first gene in
the fusion acts as a pool of forward primers, and a second pool
targeting the second gene in the fusion acts as a pool of reverse
primers. The forward and reverse designations are arbitrary and can
be swapped and are provided herein for the sake of clarity.
[0259] The fusions may be intronic fusions (a fusion between two
introns), exonic fusion (a fusion between two exons) or it may be a
intron/exon fusion (a fusion between an intron from one region or
gene and an exon from another region or gene) or the fusion may be
between two intergenic regions, or the fusion may be an
intronic/intergenic or intergenic/exonic fusion. Most often the
fusion will be an intronic fusion.
Fusion Calls
[0260] The present disclosure is particularly useful in determining
the presence of genomic fusions. When determining the presence or
absence of a gene fusion, a bioinformatic analysis may need to be
undertaken to determine whether or not the detection of an
amplification product from the selective PCR is actually indicative
of the presence of a gene fusion. The decision on whether or not a
gene fusion is present is known as a "fusion call".
[0261] As discussed for FIG. 8, amplicons are generated by two
primers amplifying a fusion event which are then sequenced (dotted
line indicates read) by NGS (Black Arrows indicate sequencing
primers). The analysis method involves determining the minimum
number of base pairs that need to be sequenced (for each primer
site) to uniquely match a target region. A strong anchor has
sufficient base pairs sequenced to uniquely match a target region,
a weak anchor does not match only the target region but also
matches other regions in the reference genome, it therefore does
not uniquely match the target region. The method uses the known
primer binding locations to determine the expected sequence within
the reads which removes the need for aligning reads to the entire
reference genome. In the example of FIG. 8a, the amplicon has two
strong anchors with both the ALK and EML4 portions (in this
example) of the read uniquely matching a ALK and EML4 reference
sequences. In the example of FIG. 8b, the amplicon has one strong
anchor and one weak anchor. The ALK portion of the read uniquely
matches a target region, but the EML4 does not uniquely match the
reference genome.
[0262] In some embodiments, the method comprises sequencing the
reaction product from a first or subsequent PCR and matching the
sequences to a reference sequence or one or more databases of
reference sequences (also referred to herein as primer information
databases). The reference sequences may be a reference genomic
region or sequence, or one or more databases of reference genomic
regions or sequences. The art may refer to "mapping", however the
present methods do not entail "mapping" as it is understood in the
art, since the origin of the read is inferred by the presence of
sequence that matches the sequences of the primers, which have
known genomic locations; and the read is compared to the expected
sequences that lie downstream of the primer sequences. The term
mapping on the other hand is used to describe the comparison of a
sequence with a long genomic sequence, such as a human genome, and
the identification of its likely origin from within this large
sequence without prior knowledge. Therefore, in embodiments
described herein, the analysis of the sequence read comprises
matching one or more portions of the sequence read to one or primer
information databases comprising a plurality of reference
sequences. Since the technique is distinct from traditional mapping
techniques, the reference sequences contained in the one or more
primer information databases against which the one or more portions
of the sequences reads are matched have a maximum length of up to 1
kb.
[0263] Methods of the disclosure may comprise comparing at least
two portions of the sequence read with one or more databases of
reference sequences, wherein each portion comprises the sequence of
a primer binding site and an adjacent downstream (i.e. 5')
sequence. The one or more databases of reference sequences may
comprise the genomic location corresponding to each primer binding
site in the database.
[0264] Matching the relevant portion(s) of the sequence read to a
reference genomic sequence or, preferably, to one or more databases
of reference genomic sequences, allows the skilled person to
determine the precise genomic rearrangement event that has
occurred. An advantage of the methods and kits disclosed herein is
that neither prior knowledge of the presence of a genomic
rearrangement, nor details of the precise rearrangement that has
occurred, are needed for the method to be carried out. In addition,
unnecessary sequencing of reaction products not arising from a
genomic rearrangement event is not required, drastically reducing
the cost and effort required to determine the presence or absence
of the genomic rearrangement. Furthermore, computational power is
reduced, since the methods do not comprise mapping or aligning the
sequence reads or portions thereof to a reference genome, which may
be very long. Instead, the sequence reads, or portions thereof, are
matched to one or more databases comprising reference genomic
sequences, for example wherein the reference genomic sequences have
in the one or more databases have a maximum length of up to 1
kb.
[0265] Since the method is carried out on DMOIs that are derived
from more than one section of a genome (when a genomic
rearrangement event has occurred), methods disclosed herein may
comprise matching the DMOI to two or more regions from the
reference genome. For example, the method may comprise identifying
two genes from which the sequence of the DMOI is derived. In the
event of a genomic rearrangement, regions from each of these two
genes have been brought into sufficient proximity for a specific
PCR amplification product to be produced in the selective PCR
carried out using the pool of forward and reverse primers.
[0266] The methods disclosed herein may comprise identifying the
presence of a forward primer binding site and a reverse primer
binding site and uniquely matching both to their respective genomic
location. References to "uniquely matching" herein refer to being
able to match a sequence to a single genomic location in a
reference genome or reference genomic sequence (or database of
genomic sequences). Uniquely matching can therefore only occur when
there is sufficient sequence information to rule out any other
locations. The length of sequence required varies according from
location to location, depending on the heterogeneity of a given
region. Regions that include several repeats, for example, will
therefore require longer sequences to enable unique matching to
take place. Other locations will only need short sequences (perhaps
just the sequence of the primer itself) to uniquely match the
primer to a given genomic location.
[0267] A fusion call may be made if one, but preferably both, of
the forward and reverse primers and their downstream sequences can
be uniquely matched to a region in the genome. For example, a
fusion call may be made if the forward primer can be uniquely
matched to a sequence in the first region of interest and/or if the
reverse primer can be uniquely matched to a sequence in the second
region of interest.
[0268] Accordingly, in one embodiment there is provided a method
for determining the presence or absence of a gene fusion in a DMOI
(specifically, an amplicon, since the sequence that is provided is
the sequence of a product of a selective PCR), the method
comprising: [0269] a. providing the sequence of a DMOI; [0270] b.
determining, from a population of known primers, the location of at
least one forward primer binding site and the location of at least
one reverse primer binding site in the DMOI; [0271] c. matching the
sequence of the DMOI to at least one region of interest in a
reference genome; [0272] d. optionally determining the potential
location of a gene fusion between two different regions of interest
of the genome; and [0273] e. determining whether a gene fusion is
present in the DMOI.
[0274] The DMOI is the amplification product of a PCR using the
population of known forward and reverse primers (for example, the
primer pools or sets disclosed herein).
[0275] In some embodiments, the method comprises matching the
sequence of the DMOI to at least two different regions of interest
in a reference genome. The two regions may be suspected of having
undergone a genomic rearrangement or gene fusion event.
[0276] In one embodiment, there is provided a method for
determining the presence or absence of a gene fusion in a DMOI, the
method comprising: [0277] a. providing the sequence of a DMOI as a
sequence read; [0278] b. identifying in the sequence read the
presence of at least one forward primer binding site and the
presence of at least one reverse primer binding site from a
population of forward and reverse primers; [0279] c. determining
the corresponding genomic locations of the forward and reverse
primer binding sites by reference to the sequences of the forward
and reverse primer binding sites and the sequence downstream and
adjacent to the forward and reverse primer binding sites in the
sequence read; and [0280] d. determining the presence or absence of
a gene fusion in the DMOI.
[0281] The sequence read provided in step (a) is provided by
sequencing one or more DMOIs from a patient sample. For example,
the sequence read may provide the sequence of a ctDNA molecule
obtained from a patient. The sequence of the sequence read is
therefore derived from the genome of a patient, or more
specifically, the genome of a tumour or other cancer present in the
patient that gave rise to the ctDNA. Of course, the sequence may be
provided according to any of the methods described herein for
determining the presence of absence of a gene fusion event.
[0282] Step (b) comprises identifying in the sequence read the
presence of at least one forward primer binding site and the
presence of at least one reverse primer binding site from a
population of corresponding forward and reverse primers. The
forward and reverse primers correspond with the forward and reverse
primer binding sites in that one is the complement of the other,
such that a primer would anneal to a corresponding primer binding
site. The sequences of the primers and/or the primer binding sites
are known. The sequence of the primers and/or primer binding sites
may be contained in one or more databases. Since the sequence reads
can be provided by methods described herein, it will be apparent to
the reader that the forward and reverse primers can be the pool of
region-specific forward and reverse primers described above that
are used to selectively amplify a gene fusion between two regions
of interest.
[0283] When the presence of at least one forward and at least one
reverse primer binding site in the sequence read has been
identified, step (c) determines the corresponding genomic locations
of the forward and reverse primer binding sites by reference to the
sequences of the forward and reverse primer binding sites and the
sequence downstream and adjacent to the forward and reverse primer
binding sites in the sequence read. The corresponding genomic
location is the original genomic location in the patient's genome
or cancer that gave rise to the DMOI, which in turn gave rise to
the sequence read provided in step (a). This step is determining
the corresponding genomic locations for the forward and reverse
primer binding sites in the genome that gave rise to the ctDNA.
[0284] The downstream sequences are adjacent, meaning immediately
adjacent to the primer binding sites in the sequence read.
[0285] In step (d), when the genomic locations of the forward and
reverse primer binding sites are different, or are suspected of
being different, a gene fusion event is present. When the genomic
locations of the forward and reverse primer binding site are the
same, a gene fusion event is not present. By "different", this
refers to different first and second regions of interest that were
targeted by the pools of region-specific forward and reverse
primers. For example, when the genomic locations of the forward and
reverse primer binding sites identified in the sequence read are at
least 1 kb apart in a genome that has not undergone a gene fusion,
or are usually found on different chromosomes or in different
genes, a gene fusion event is present in the sequence read
(specifically, the DMOI that gives rise to the sequence read).
[0286] It may only be possible to uniquely match one of the forward
and reverse primer binding sites in the sequence read to a
corresponding location in a reference genome. However, even if it
is not possible to uniquely match both forward and reverse primer
binding sites in the sequence read to corresponding locations in a
reference genome, a gene fusion event can still be predicted. For
example, if a first primer binding site in a sequence read is
uniquely matched to a genomic location, the second primer binding
site may be matched to a plurality of different genomic locations.
If all of those locations are different to the location that has
been uniquely identified as giving rise to the first primer binding
site in the sequence read, then a gene fusion is still likely to be
present. Therefore, the step of determining the corresponding
genomic locations of the forward and reverse primer binding sites
by reference to the sequences downstream and adjacent to the
forward and reverse primer binding sites in the sequence read may
comprise matching at least one of the forward and reverse primer
binding sites in the sequence read to a unique genomic location.
The other primer binding site in the sequence read may be matched
to one or more genomic locations.
[0287] In one embodiment, the method comprises: [0288] a. providing
the sequence of a DMOI as a sequence read; [0289] b. identifying in
the sequence read the presence of at least one forward primer
binding site and the presence of at least one reverse primer
binding site from a population of corresponding forward and reverse
primers whose sequences are known; [0290] c. when the presence of
at least one forward and at least one reverse primer binding site
in the sequence read has been identified, determining the
corresponding genomic locations of the forward and reverse primer
binding sites by reference to the sequences of the forward and
reverse primer binding sites and the sequences downstream of and
adjacent to the forward and reverse primer binding sites in the
sequence read; and [0291] d. determining the presence or absence of
a gene fusion in the DMOI, wherein when the forward and reverse
primer binding sites are in different genes, a gene fusion event is
present.
[0292] The step of determining the corresponding genomic locations
of the forward and reverse primer binding sites refers to uniquely
identifying the genomic sequence in a reference genome that gave
rise to the sequence of at least one of the forward or reverse
primer binding sites. In one embodiment, the step of determining
the corresponding genomic locations of the forward and reverse
primer binding sites refers to uniquely identifying the genomic
sequence in a reference genome that gave rise to the sequence of
both the forward and reverse primer binding sites.
[0293] In some embodiments, the step of identifying the presence of
the at least one forward and at least one reverse primer binding
site in the sequence read and the step of determining the
corresponding genomic locations of the forward and reverse primer
binding sites comprises interrogating one or more databases. The
one or more databases may comprise: [0294] a. the genomic location
for each forward and reverse primer binding site in the primer
population; [0295] b. the sequence of each forward and reverse
primer binding site in the primer population; [0296] c. the
downstream sequence in the corresponding genomic location for each
of the forward and reverse primer binding sites in the primer
population (optionally wherein the length of the downstream
sequence is at least 1 base pair); and [0297] d. the minimum number
of base pairs downstream of each primer binding site required to
uniquely match a primer binding site from a sequence read to the
corresponding genomic location.
[0298] Accordingly, for each forward and reverse primer in the
primer population, the database or databases comprise: [0299] a.
the genomic location for the primer binding site; [0300] b. the
sequence of the primer binding site (and/or the sequence of the
corresponding primer); [0301] c. the sequence downstream of and
adjacent to the primer binding site in the corresponding genome (or
at the corresponding genomic location, optionally wherein the
length of the downstream sequence is at least 1 base pair) and
[0302] d. the minimum number of base pairs downstream of the primer
binding site required to uniquely match a primer binding site from
a sequence read to the corresponding location in the genome.
[0303] The database may further comprise the location and/or
identify of SNPs or other polymorphisms. For example, the
downstream sequence for each of the primers may take into account
the presence of polymorphisms (including SNPs, LTRs, STRs) to
assist accurate identification. The inclusion of polymorphisms
assists the use of the database across broader patient
populations.
[0304] In some embodiments, the step of interrogating the one or
more databases comprises comparing the sequence downstream of the
forward and reverse primer binding sites in the sequence read with
the corresponding downstream sequences in the one or more
databases. In other words, the method compares the sequences
downstream of the forward and reverse primer binding sites in the
sequence read with the downstream sequences provided in the
database(s) for the corresponding forward and reverse primers.
[0305] The database or databases may be referred to as primer
databases or primer information databases. The information may be
spread across multiple databases. For example, one database may
contain the sequence of each primer in the primer population and
assign each primer in the primer population a unique label. The
label can then be used to interrogate a separate database that
provides the remaining information (such as the downstream
sequences and length of downstream sequence required to uniquely
map the primer to a specific region in a corresponding genome)
arranged according to the unique labels of the primers. The
specific arrangement and storage of the information is therefore
not crucial.
[0306] The method may comprise determining the "anchor strength" of
the forward and reverse primer binding sites in the sequence read,
wherein: [0307] a. a weak anchor is defined as a primer binding
site in a sequence read having a downstream sequence in the
sequence read that matches the downstream sequence in the
corresponding primer in the primer database, but said matching
downstream sequence in the sequence read is shorter than the length
of the downstream sequence required in the database of reference
genomic sequences to uniquely match the sequence obtained to the
corresponding genomic location; and [0308] b. a strong anchor is
defined as a primer binding site in a sequence read having a
downstream sequence in the sequence read that matches the
downstream sequence in the corresponding primer in the primer
database, and said matching downstream sequence in the sequence
read is equal to or longer than the length of the downstream
sequence required in the database of reference genomic sequences to
uniquely match the sequence obtained to the corresponding genomic
location.
[0309] In some embodiments, a gene fusion is called when both the
forward and reverse primer binding sites are identified as strong
anchors. In other embodiments, a gene fusion is called when at
least one of the forward and reverse primer binding sites is
identified as a strong anchor.
[0310] In one embodiment, the method comprises [0311] a. providing
the sequence of a DMOI as a sequence read; [0312] b. interrogating
one or more primer information databases to: [0313] i. identify in
the sequence read the presence of at least one forward primer
binding site and the presence of at least one reverse primer
binding site from a population of forward and reverse primers; and
[0314] ii. determine the corresponding genomic locations of the
forward and reverse primer binding sites; [0315] c. wherein the one
or more primer information databases comprise: [0316] i. the
genomic location for each forward and reverse primer binding site
in the primer population; [0317] ii. the sequence of each forward
and reverse primer binding site in the primer population; [0318]
iii. the downstream sequence in the corresponding genomic location
for each of the forward and reverse primer binding sites in the
primer population; and [0319] iv. the minimum number of base pairs
downstream of each primer binding site required to uniquely match a
primer binding site from a sequence read to a given genomic
location; and [0320] c. determining the presence or absence of a
gene fusion in the DMOI.
[0321] The step of interrogating the database to identify in the
sequence read the presence of at least one forward primer binding
site and the presence of at least one reverse primer binding site
may comprise comparing the sequence of the sequence read (or
portions thereof) with the forward and reverse primer binding site
sequences in the primer information database. The sequence of each
forward and reverse primer binding site in the primer population
and their corresponding downstream sequences may be referred to as
the reference sequences (or reference genomic sequences). It is
against these reference sequences the sequence read (or portions
thereof) are matched. Specifically, the primer binding sites in the
sequence read may be compared to the sequences in the one or more
databases corresponding to the forward and reverse primer binding
sites in the primer population (part (ii) of the database above)
and the adjacent downstream sequence in the sequence read may be
compared to the corresponding downstream sequences in the matching
genomic location (part (iii) of the database above). In some
embodiments, the maximum length of the sequences in (ii) and (iii)
above is 1 kb.
[0322] The step of determining the corresponding genomic locations
of the forward and reverse primer binding sites may comprise
comparing the sequences downstream of the forward and reverse
primer binding sites in the sequence read with the downstream
sequences provided in the one or more primer information databases.
A unique genomic location may be assigned to the forward and/or
reverse primer binding site from the sequence read when the
downstream sequence in the sequence read is the same as the or a
downstream sequence for a corresponding primer in the primer
information database and the length of the downstream sequence in
the sequence read that is the same as the or a downstream sequence
for the corresponding primer in the primer information database is
equal to or greater than the minimum number of base pairs
downstream of the primer binding site required to uniquely match
the primer binding site from a sequence read to the corresponding
genomic location.
[0323] Of course, interrogation of the database may provide a
plurality of genomic locations for each of the primer binding sites
in the sequence reads, depending on the strength of the anchor.
Accordingly, in one embodiment, the method comprises identifying
all the possible genomic locations for both the forward and reverse
primer binding sites in the sequence read.
[0324] A fusion may be called when at least one of the forward or
reverse primers is uniquely matched to a genomic location that is
different to all of the possible genomic locations identified for
the other primer binding site in the sequence read.
[0325] In one embodiment, the method comprises [0326] a. providing
the sequence of a DMOI as a sequence read; [0327] b. providing one
or more primer information databases, wherein the one or more
primer information databases comprise: [0328] i. the genomic
location for each forward and reverse primer binding site in a
primer population; [0329] ii. the sequence of each forward and
reverse primer binding site in the primer population; [0330] iii.
the downstream sequence in the corresponding genomic location for
each of the forward and reverse primer binding sites in the primer
population; and [0331] iv. the minimum number of base pairs
downstream of each primer binding site required to uniquely match a
primer binding site from a sequence read to a given genomic
location; and [0332] c. comparing the sequence of the sequence read
with the forward and reverse primer binding site sequences in the
one or more primer information databases to identify in the
sequence read the presence and identity of at least one forward
primer binding site and the presence and identity of at least one
reverse primer binding site from the population of forward and
reverse primers; [0333] d. comparing the sequences downstream of
the forward and reverse primer binding sites in the sequence read
with the corresponding downstream sequences provided in the one or
more primer information databases; [0334] e. assigning to the
forward and/or reverse primer binding site from the sequence read
the corresponding genomic location of the primer binding site in
the one or more primer information databases when: [0335] i. the
downstream sequence in the sequence read is the same as the
downstream sequence for the corresponding primer in the primer
information database; and [0336] ii. the length of the downstream
sequence in the sequence read that is the same as the downstream
sequence for the corresponding primer in the primer information
database is equal to or greater than the minimum number of base
pairs downstream of the primer binding site required to uniquely
match the primer binding site from the sequence read to the
corresponding genomic location; [0337] f. determining the presence
or absence of a gene fusion in the DMOI, wherein a gene fusion is
present when the forward and reverse primer binding sites in the
sequence read are assigned different genomic locations.
[0338] In one embodiment, the method comprises [0339] a. providing
the sequence of a DMOI as a sequence read; [0340] b. providing one
or more primer information databases, wherein the one or more
primer information databases comprise: [0341] i. the genomic
location for each forward and reverse primer binding site in a
primer population; [0342] ii. the sequence of each forward and
reverse primer binding site in the primer population; [0343] iii.
the downstream sequence in the corresponding genomic location for
each of the forward and reverse primer binding sites in the primer
population; and [0344] iv. the minimum number of base pairs
downstream of each primer binding site required to uniquely match a
primer binding site from a sequence read to a given genomic
location; and [0345] c. comparing the sequence of the sequence read
with the forward and reverse primer binding site sequences in the
one or more primer information databases to identify in the
sequence read the presence and identity of at least one forward
primer binding site and the presence and identity of at least one
reverse primer binding site from the population of forward and
reverse primers; [0346] d. comparing the sequences downstream of
the forward and reverse primer binding sites in the sequence read
with the corresponding downstream sequences provided in the one or
more primer information databases; [0347] e. assigning to the
forward and/or reverse primer binding site from the sequence read
the corresponding genomic location of the primer binding site in
the one or more primer information databases when: [0348] i. the
downstream sequence in the sequence read is the same as the
downstream sequence for the corresponding primer in the primer
information database; and [0349] ii. the length of the downstream
sequence in the sequence read that is the same as the downstream
sequence for the corresponding primer in the primer information
database is equal to or greater than the minimum number of base
pairs downstream of the primer binding site required to uniquely
match the primer binding site from the sequence read to the
corresponding genomic location; [0350] f. determining the presence
or absence of a gene fusion in the DMOI, wherein a gene fusion is
present when at least one of the forward and reverse primer binding
sites in the sequence read is assigned to only one genomic location
(i.e. is a strong anchor). The other primer binding site in the
sequence read may be assignable to a plurality of genomic
locations, for example if the downstream sequence in the sequence
read does not match the expected downstream sequence in the one or
more primer information databases, or the downstream sequence in
the sequence read does match the excepted downstream in the one or
more primer information databases, but the matching downstream
sequence is not of sufficient length (i.e. it is a weak anchor).
However, one can still be confident of a fusion if all the genomic
locations for this weak anchor that are assignable to it are all
different from the genomic location assigned to the strong
anchor.
[0351] "Genomic locations" can also refer simply to genes. Hence, a
gene fusion may be present when at least one of the forward and
reverse primer binding sites in the sequence read is assigned to
only one gene and the other primer binding site in the sequence
read is assigned to a plurality of genes that are all different
from the gene assigned to the first primer binding site in the
sequence read.
[0352] The methods disclosed herein can be carried out without
having to align or map the sequence reads or portions thereof to a
reference genomic sequence. In some embodiments, the methods
disclosed herein can be carried out without having to align or map
the sequence reads or portions thereof to a reference genomic
sequence that is more than 10 kb in length, since only the
sequences in the one or more primer information databases need to
be interrogated.
[0353] The forward and reverse primer population includes the
primers used in the assays to detect the genomic rearrangement and
to provide the sequence reads. The one or more primer information
database therefore includes the corresponding information relating
to the primer pools of the present invention. The database also
takes into account polymorphisms in the different genomic locations
covered by the primer population. For example, a given primer in
the primer pool might have a plurality of downstream sequences that
differ according to the polymorphisms located at that region of the
genome. Accordingly, the database or databases may comprise the
sequence or at least one downstream sequence that is adjacent to
the primer binding site in the corresponding genome for each primer
in the one or more primer information databases.
[0354] The databases described herein contain sufficient
information to enable to skilled person to compare the potential
primer binding site identified in the sequence read with the primer
binding sites of the primers present in the pool of primers used to
generate the sequence read. If the sequence of the primer binding
site itself uniquely matches the genome (for example because the
primer binding site is of sufficient length and/or it is present in
a particularly heterogeneous section of the reference genome) then
the sequence of the primer itself may be sufficient to uniquely
match the corresponding region in the DMOI to a unique position in
the reference genome. However, if the primer binding site is not
sufficiently long (or is in a less heterogeneous section of the
reference genome), then additional downstream sequences (i.e. on
the 3' side of the primer binding site) are required to determine a
unique position in the genome. Hence for some (and indeed most)
primers it is necessary to include the downstream sequences. The
skilled person can make a comparison between the sequence that is
downstream of the primer binding site in the sequence to see if it
matches the expected downstream sequence for a given genomic
location.
[0355] In some embodiments, the primer information database or
database comprise the downstream sequences of at least 50% of the
primers in the primer pool. Preferably the reference database
includes the downstream sequence for all primers that do not
themselves uniquely match the reference genome. The length of the
downstream sequence can vary according to the primer and its
binding site. In some embodiments, the length of the downstream
sequences is at least 1 nucleotide. Preferably the length is at
least 10 nucleotides. The downstream sequences are generally
immediately adjacent to the primer binding sites (there are no
nucleotides between the last nucleotide of the primer binding site
and the first nucleotide of the downstream sequence).
[0356] In some embodiments a fusion call may be made when both
primer binding sites are strong anchors. However, a fusion call
still can be made with only one strong anchor. Nevertheless, when
the primer binding site is close to the location of the gene fusion
in the sequence read, there may only be a small number of
nucleotides that are the same between the sequence read and the
reference downstream genomic sequence. To make a fusion call for
only one strong anchor, it is preferred the match between the
downstream sequence in the DMOI and the downstream sequence in the
reference primer database is at least 5 nucleotides, optionally at
least 10 nucleotides. Therefore, in one embodiment, the method
comprises determining the distance of each of the primer binding
sites from the potential location of the gene fusion in the
sequence read.
[0357] The downstream sequences provided in the one or more primer
information databases will be derived from a reference genome. The
reference genome will be one that is suitable for the analysis that
is being undertaken. For example, for an analysis carried out on
sequences derived from a human sample, a human genome will be used
as a reference genome and the source for the downstream sequences
(a complete or partial human genome). "Reference genome" herein
includes fragments of a genome that correspond to the regions of
interest, for example specific genes that have undergone a genomic
rearrangement event (or are suspected of having undergone such a
rearrangement). The genomic locations that are determined are the
genomic locations in the reference genome or partial reference
genome.
[0358] The step of matching or comparing a sequence downstream of
the forward and reverse primer binding sites in the sequence read
to at least one downstream genomic location in a one or more
databases may comprise: for a given primer binding site,
interrogating the one or more primer databases for a corresponding
downstream sequence, and comparing the downstream sequence from the
primer database to the sequence downstream of the primer binding
site in the sequence read.
[0359] The method may comprise a step of determining the potential
location of a gene fusion between two different primer binding
sites in the sequence read. In one embodiment, the method therefore
comprises matching a portion of the sequence read (including the
sequence of a forward primer binding site) to a first genomic
location and matching a different portion of the sequence read
(including the sequence of a reverse primer binding site) to a
second genomic location.
[0360] Of course, the fusion call methods disclosed herein can be
combined with the methods of determining the presence of a genomic
rearrangement event (such as a gene fusion) disclosed herein. For
example, in one embodiment the method comprises: [0361] a.
contacting a sample comprising DNA molecules of interest (DMOIs)
with a pool of at least 20 region-specific forward primers and a
pool of at least 20 region-specific reverse primers, wherein:
[0362] i. each of the forward primers in the forward primer pool
comprises a sequence specific for a first region of interest and a
first primer binding site; and [0363] ii. each of the reverse
primers in the reverse primer pool comprises a sequence specific
for a second, different, region of interest and a second primer
binding site; [0364] b. amplifying the DMOIs using the
region-specific primers; [0365] c. conducting PCR using forward
primers that target the first primer binding site and reverse
primers that target the second primer binding site; [0366] d.
sequencing the PCR amplification product to provide a library of
sequence reads, wherein the sequence reads comprise the sequence of
a forward and/or reverse primer used in step (a); [0367] e.
identifying in at least one of the sequence reads the presence of
at least one region-specific forward primer binding site and the
presence of at least one region-specific reverse primer binding
site from the pool of forward and reverse primers; [0368] f.
determine the corresponding genomic locations of the forward and
reverse primer binding sites by reference to the sequences of the
forward and reverse primer binding sites and the sequences
downstream and adjacent to the forward and reverse primer binding
sites in the sequence read; [0369] g. determining the presence or
absence of a gene fusion in the DMOI.
[0370] Of course, the more detailed analysis methods can also be
combined with the different embodiments relating to the processing
and sequencing of the DMOIs.
[0371] For example, one embodiment provides: [0372] a. contacting a
sample comprising DNA molecules of interest (DMOIs) with a pool of
at least 20 region-specific forward primers and a pool of at least
20 region-specific reverse primers, wherein: [0373] i. each of the
forward primers in the forward primer pool comprises a sequence
specific for a first region of interest and a first primer binding
site; and [0374] ii. each of the reverse primers in the reverse
primer pool comprises a sequence specific for a second, different,
region of interest and a second primer binding site; [0375] b.
amplifying the DMOIs using the region-specific primers; [0376] c.
conducting PCR using forward primers that target the first primer
binding site and reverse primers that target the second primer
binding site; [0377] d. sequencing the PCR amplification product to
provide a library of sequence reads, wherein the sequence reads
comprise the sequence of a forward and/or reverse primer used in
step (a); [0378] e. providing one or more primer information
databases, wherein the one or more primer information databases
comprise: [0379] i. the genomic location for each forward and
reverse primer binding site in a primer population; [0380] ii. the
sequence of each forward and reverse primer binding site in the
primer population; [0381] iii. the downstream sequence in the
corresponding genomic location for each of the forward and reverse
primer binding sites in the primer population; and [0382] iv. the
minimum number of base pairs downstream of each primer binding site
required to uniquely match a primer binding site from a sequence
read to a given genomic location; and [0383] f. comparing the
sequence of the sequence reads with the forward and reverse primer
binding site sequences in the one or more primer information
databases to identify in at least one of the sequence reads the
presence and identity of at least one forward primer binding site
and the presence and identity of at least one reverse primer
binding site from the population of forward and reverse primers;
[0384] g. comparing the sequences downstream of the forward and
reverse primer binding sites in the sequence read with the
corresponding downstream sequences provided in the one or more
primer information databases; [0385] h. assigning to the forward
and/or reverse primer binding site from the sequence read the
corresponding genomic location of the primer binding site in the
one or more primer information databases when: [0386] i. the
downstream sequence in the sequence read is the same as the
downstream sequence for the corresponding primer in the primer
information database; and [0387] ii. the length of the downstream
sequence in the sequence read that is the same as the downstream
sequence for the corresponding primer in the primer information
database is equal to or greater than the minimum number of base
pairs downstream of the primer binding site required to uniquely
match the primer binding site from the sequence read to the
corresponding genomic location; [0388] i. determining the presence
or absence of a gene fusion in the DMOI, wherein a gene fusion is
present when the forward and reverse primer binding sites in the
sequence read are assigned different genomic locations.
[0389] Additional steps may also be taken to help identify fusion
calls. For example, an assessment may be made to determine if the
detected or suspected fusion is an in-frame fusion. If the detected
or suspected fusion is not an in-frame fusion, it may be discarded
and not called as a true fusion. More specifically, it has been
noted by the present inventors that the vast majority of true gene
fusion events, in particular in cancer patients, result in in-frame
products when the DNA is transcribed to RNA. Although most gene
fusion events occur between introns, the newly adjacent exons (i.e.
those brought into closer proximity as a result of the gene fusion)
are paired such that the coding frame matches. For example, one end
of an exon may end at the 3.sup.rd base of the codon reading frame,
and the adjacent end of the next exon still start at the 1.sup.st
base of the codon reading frame. Alternatively, one end of an exon
may end at the 2.sup.nd base of the codon reading frame, and the
adjacent end of the next exon still start at the 3.sup.rd base of
the codon reading frame, or one end of an exon may end at the
1.sup.st base of the codon reading frame, and the adjacent end of
the next exon still start at the 2.sup.nd base of the codon reading
frame. By reviewing the sequencing information provided by the
methods disclosed herein, and once the location of the genomic
breakpoint has been uniquely matched to a genome, the skilled
person can correlate the gene fusion with the newly adjacent exons
and determine if the resulting RNA transcript would produce an
in-frame product. If it would not, the call can be discarded as not
being a true gene fusion event. It is noted that the precise
location of a breakpoint in an intron is not relevant to
determining whether or not the breakpoint would produce an in-frame
product. This is because, when the introns are removed, the
adjacent exons are brought together, and the DNA is subsequently
transcribed into RNA. Therefore, it is simply the pairings of newly
adjacent exons that needs to be analysed when determining if an
in-frame product will be produced. Accordingly, one embodiment
comprises identifying the exons that are now adjacent as a result
of the gene fusion and determining if the fusion would result in an
in-frame product according to the last nucleotide base of one exon
and the first nucleotide base of the next exon.
[0390] For example, in one embodiment, the location of the genomic
breakpoint is used to predict whether a resulting RNA fusion
product would be spliced to produce an in-frame product. Only
fusion breakpoints predicted to produce an in-frame product are
called as a gene fusion event. Conducting such an additional
analysis step helps to further check for artefacts, such as
non-specific amplification and false positives and identify true
variants.
[0391] In one embodiment, the method comprises determining whether
the detected gene fusion would result in an in-frame product when
the DNA is translated to RNA. A fusion call is made when the
detected gene fusion would result in an in-frame product when the
fused DNA is translated to RNA.
[0392] The present disclosure also provides the primer information
databases described herein. In one aspect, the invention provides
one or more primer information databases, the one or more primer
databases comprising or collectively comprising, for a population
of primers: [0393] i. the genomic location for each forward and
reverse primer binding site in the primer population; [0394] ii.
the sequence of each forward and reverse primer binding site in the
primer population; [0395] iii. the downstream sequence in the
corresponding genomic location for each of the forward and reverse
primer binding sites in the primer population; and [0396] iv. the
minimum number of base pairs downstream of each primer binding site
required to uniquely match a primer binding site from a sequence
read to a given genomic location.
[0397] The one or more databases disclosed herein may be provided
on a computer readable storage medium. The present disclosure
therefore provides a computer readable storage comprising the one
or more primer information databases disclosed herein.
[0398] Interrogation of the one or more databases may be carried
out using a computer. Similarly, the methods of analysing the
sequence reads may be conducting using a computer.
Samples
[0399] The DMOIs may be contained in or derived from a sample from
a patient. In some embodiments, the sample is a biological sample
obtained from a subject, or a sample containing DMOIs that is
extracted from a biological sample obtained from a subject. The
patient sample can be a tissue sample, for example a surgical
sample. Preferably the sample is a liquid biopsy sample, such as
blood, plasma, serum, urine, seminal fluid, stool, sputum, pleural
fluid, ascetic fluid, synovial fluid, cerebrospinal fluid, lymph,
nipple fluid, cyst fluid, or bronchial lavage. In some embodiments
the sample is a cytological sample or smear or a fluid containing
cellular material, such as cervical smear, nasal brushing,
esophageal sampling by a sponge (cytosponge),
endoscopic/gastroscopic/colonoscopic biopsy or brushing, cervical
mucus or brushing.
[0400] Many of the above samples can be obtained non-invasively,
and can therefore be taken regularly without great risk or
discomfort to the subject. Methods disclosed herein may comprise a
step of obtaining a sample from a patient. Alternatively, the
methods may be carried out on samples previously obtained from a
patient (i.e., ex vivo/in vitro methods). In one embodiment,
samples and/or DMOIs of interest are obtained by an in vivo/ex vivo
nucleic acid harvesting technique--for example dialysis or
functionalised wire.
[0401] Samples may be obtained from patients suspected of having a
particular disease or condition, such as cancer. Such a disease or
condition can be diagnosed, prognosed, monitored and therapy can be
determined based on the methods, systems and kits described herein.
Samples may be obtained from humans or from animals, such as a
domesticated animal, for example a cow, chicken, pig, horse,
rabbit, dog, cat, or goat. Usually, a sample will be derived from a
human.
[0402] To obtain a blood sample, any technique known in the art may
be used, e.g., a syringe or other vacuum suction device. A blood
sample can be optionally pre-treated or processed prior to tagging
and analysis. Examples of pre-treatment steps include the addition
of a reagent such as a stabiliser, a preservative, a fixant, a
lysing reagent, a diluent, an anti-apoptotic reagent, an
anti-coagulation reagent, an anti-thrombotic reagent, magnetic
property regulating reagent, a buffering reagent, an osmolality
regulating reagent, a pH regulating reagent, and/or a crosslinking
reagent. In addition, plasma may be obtained from the blood sample,
and the plasma be used in the subsequent analysis.
[0403] When obtaining a sample from a human or an animal (e.g.,
blood sample), the amount can vary depending upon human or animal
size and the condition being screened. In some embodiments, up to
50, 40, 30, 20, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 mL of a sample is
obtained. In some embodiments, 1-50, 2-40, 3-30, or 4-20 mL of
sample is obtained. In some embodiments, more than 5, 10, 15, 20,
25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100
mL of a sample is obtained.
[0404] A sample may be processed prior to undergoing further
analysis. Such processing steps may comprise purification (for
example removal of cells and/or debris from the sample), extraction
or isolation of the DMOI. In the case of, for example, blood
samples, the DMOI may be extracted from the blood sample for
analysis. The amount of DNA present in the extracted sample may
also be quantified prior to analysis.
[0405] In some embodiments, the sample may be obtained from the
patient by an in vivo/ex vivo nucleic acid harvesting
technique--for example dialysis or functionalised wire.
[0406] In particular embodiments, the method comprises a step of
obtaining the sample from a patient. In other embodiments, the
sample or DMOI is simply provided, as a sample was obtained at a
prior point in time. The skilled person is aware of suitable
techniques for obtaining, storing, stabilising and/or transporting
samples prior to analysis.
[0407] In some embodiments, the DMOI is contained in or derived
from a patient sample, and the patient sample is processed prior to
analysis to determine the presence or absence of a genomic
rearrangement. In some embodiments, the method comprises: [0408] a.
purification of the sample to obtain a purified sample comprising
the DMOIs (for example removal of cells and/or debris from the
sample); and/or [0409] b. extraction or isolation of the DMOIs from
the patient sample.
[0410] In one embodiment, the method comprises obtaining a blood
sample from a patient, obtaining plasma from the blood sample, and
optionally extracting the DMOIs from the plasma sample.
[0411] Methods disclosed herein may also comprise a step of
purifying the amplicons from the amplification product after the or
each PCR step.
[0412] Additional steps may be taken to minimise false positives
and increase sensitivity of the methods. For example, in preferred
embodiments, methods disclosed herein can be carried out more than
once (e.g. at least twice) to minimise false positives or
negatives. In preferred embodiments, the methods disclosed herein
are carried out on two or more samples derived from a patient, or a
patient sample is split into two or more test samples (prior to or
after processing of the patient sample) and the methods are carried
out on the two or more test samples. Carrying out the methods in
duplicate can help to eliminate false positives, avoiding
unnecessary sequencing of nucleic acids, and also increases the
sensitivity of the assay. When the methods are repeated in this
way, the method may comprise comparing the analysis from the two
samples or two test samples. In some embodiments comprising this
comparison step, the presence of a PCR amplification product from
the selective PCR in both samples or both test samples is
indicative of a genomic rearrangement event. As such, a fusion call
is only made when a genomic rearrangement is detected in both
samples or both test samples. The presence of strong or weak
anchors may influence the decision on a fusion call, as discussed
above.
Other Methods of the Invention
[0413] The present disclosure provides a method, the method
comprising: [0414] a. providing a sample from a patient, said
sample comprising one or more DMOI (in particular cell-free DNA,
such as ctDNA); and [0415] b. determining the presence or absence
of a genomic rearrangement event according to a method disclosed
herein.
[0416] The method may further comprise processing of the sample
(for example extracting or isolating the DMOI from the patient
sample) prior to determining the presence or absence of a genomic
rearrangement.
[0417] Other such methods disclosed herein include a method of
diagnosing disease (such as cancer), a method of determining
disease prognosis (such as cancer prognosis), a method of
determining disease remission or relapse (such as cancer remission
or relapse), a method of detecting progression of disease (such as
cancer), or a method of determining the presence or absence of
residual disease (such as residual cancer, wherein the DMOI is
circulating tumour DNA (ctDNA)).
[0418] Regarding such methods, the methods may comprise determining
the presence or absence of a genomic rearrangement in a patient
using a method disclosed herein. For example, the method may
comprise providing a sample from a patient, said sample comprising
a plurality of cell-free DNA (cfDNA) molecules (DMOIs), optionally
processing the sample, and determining the presence or absence of
the genomic rearrangement. The nature and/or abundance of the
genomic rearrangement being detected may be indicative of the
presence of disease, the prognosis of the disease, disease
remission, disease relapse, disease progression, or the presence of
residual disease.
[0419] In preferred embodiments, the genomic rearrangement event is
a gene fusion event, such as a ROS1 fusion, ALK fusion, RET fusion
or NTRK1 fusion. The cancer may be any cancer, but of particular
interest is lung cancer.
[0420] In some embodiments, the methods comprise determining the
presence and/or abundance of a genomic rearrangement in a sample
from a patient who has previously had a sample analysed according
to a method disclosed herein.
[0421] The present disclosure also provides methods of treating
disease, such as cancer. The method may comprise the steps of:
[0422] a. providing a sample from a patient, said sample comprising
one or more cell-free DNA molecules of interest (DMOIs); [0423] b.
determining the presence or absence of a genomic rearrangement
event according to a method disclosed herein; and [0424] c.
administering a treatment, such as a therapy, to the patient, or
recommending a treatment to the patient.
[0425] The step of administering or recommending a
treatment/therapy will be dependent on the analysis in step b). For
example, it may be the case that no disease is detected and hence
no treatment is required. Alternatively, the method may detect
cancer relapse, and hence treatment would be necessary. In some
embodiments, the method may recommend the patient for treatment
based on the presence or absence of the genomic rearrangement
event. In some embodiments, the method comprises characterising the
patient's disease (such as cancer) and administering or
recommending the patient for an appropriate treatment.
[0426] When the disease is cancer, example treatments may include
chemotherapy, radiotherapy, immunotherapy, targeted therapy and/or
surgery.
[0427] Typical chemotherapeutic agents include alkylating agents
(for example nitrogen mustards (such as mechlorethamine,
cyclophosphamide, melphalan, chlorambucil, ifosfamide and
busulfan), nitrosoureas (such as N-Nitroso-N-methylurea (MNU),
carmustine (BCNU), lomustine (CCNU) and semustine (MeCCNU),
fotemustine and streptozotocin), tetrazines (such as dacarbazine,
mitozolomide and temozolomide), aziridines (such as thiotepa,
mytomycin and diaziquone), cisplatins and derivatives thereof (such
as carboplatin and oxaliplatin), and non-classical alkylating
agents (such as procarbazine and hexamethylmelamine)),
antimetabolites (for example anti-folates (such as methotrexate and
pemetrexed), fluoropyrimidines (such as fluorouracil and
capecitabine), deoxynucleoside analogues (such as cytarabine,
gemcitabine, decitabine, Vidaza, fludarabine, nelarabine,
cladribine, clofarabine and pentostatin) and thiopurines (such as
thioguanine and mercaptopurine)), anti-microtubule agents (for
example Vinca alkaloids (such as vincristine, vinblastine,
vinorelbine, vindesine, and vinflunine) and taxanes (such as
paclitaxel and docetaxel)), platins (such as cisplatin and
carboplatin), topoisomerase inhibitors (for example irinotecan,
topotecan, camptothecin, etoposide, doxorubicin, mitoxantrone,
teniposide, novobiocin, merbarone, and aclarubicin), and cytotoxic
antibiotics (for example anthracyclines (such as doxorubicin,
daunorubicin apirubicin, idarubicin, pirarubicin, aclarubicin,
mitoxantrone), bleomycins, mitomycin C, mitoxantrone, and
actinomycin), and combinations thereof.
[0428] For lung cancer patients, in particular non-small-cell lung
carcinoma (NSLC) patients, the treatment may include EGFR
Inhibitors (such as erlotinib (Tarceva), afatinib (Gilotrif),
gefitinib (Iressa) or osimertinib (Tagrisso)), Alk inhibitors (such
as crizotinib (Xalkori), ceritinib (Zykadia) or alectinib
(Alecensa), Met Inhibitors (such as tivantinib (ARQ197),
cabozantinib (XL184) or crizotinib), or ROS1 inhibitors (such as
Foretinib or crizotinib).
[0429] The treatment may comprise surgery, for example resection of
a tumour. In particular, resection may be recommended if metastasis
or disease progression has been predicted or is suspected.
[0430] The present disclosure also provides a method of determining
a treatment regimen for a patient or a patient suspected of having
disease (such as cancer), comprising: [0431] a. providing a sample
from a patient, said sample comprising one or more cell-free DNA
molecules of interest (DMOIs); [0432] b. determining the presence
or absence of a genomic rearrangement event according to a method
disclosed herein; and [0433] c. selecting a treatment regimen for
the patient according to the presence or absence of a genomic
rearrangement in the one or more DMOIs.
[0434] In one embodiment there is provided a method of predicting a
patient's responsiveness to a treatment, such as a cancer
treatment, comprising: [0435] a. providing a sample from a patient,
said sample comprising one or more cell-free DNA molecules of
interest (DMOIs); [0436] b. determining the presence or absence of
a genomic rearrangement event according to a method disclosed
herein; [0437] c. predicting a patient's responsiveness to a cancer
treatment according to the presence or absence of a genomic
rearrangement in the one or more DMOIs.
[0438] Methods of determining the present or absence of a genomic
rearrangement event include methods of characterising a genomic
rearrangement event or methods of characterising a patients'
disease.
[0439] The methods of the present disclosure also allow detection
of minimal residual disease in patients. For example, following
treatment for cancer, the methods disclosed herein may be used to
detect residual disease using a sample obtained from the patient.
The potential for relapse can therefore be detected early and
appropriate additional treatment steps be taken.
[0440] Methods of generating reports are also provided herein. For
example, in one embodiment there is provided a method of generating
a report, comprising: [0441] a. providing a sample from a patient,
said sample comprising one or more cell-free DNA molecules of
interest (DMOIs); [0442] b. determining the presence or absence of
a genomic rearrangement event according to a method as described
herein; [0443] c. generating a report comprising a listing of
genomic rearrangement events determined to be present in step
(b).
[0444] The report may additionally or alternatively provide the
genomic coordinates of a genomic rearrangement determining in step
(b). The report may further provide or suggest suitable treatments
for the patient according to the genomic rearrangements determined
in step (b).
[0445] A report may be generated in any of the diagnostic or
prognostic methods described herein. For example, the report may
include a prediction of a patient's responsiveness to a treatment,
a suitable treatment regimen for a patient, a diagnosis (for
example a cancer diagnosis), a disease prognosis (such as a cancer
prognosis), a determining of disease remission or relapse (for
example cancer remission or relapse), a responsiveness of a patient
to a therapy (for example to cancer therapy), a detection of
disease progression (such as cancer progression), a determination
of the present or absence of residual disease (such as residual
cancer), etc.
Kits and Primer Pools
[0446] The present disclosure also provides kits comprising
different components used in the methods disclosed herein. A kit of
parts disclosed herein may comprise a plurality of forward primers
and a plurality of reverse primers suitable for detecting a genomic
rearrangement event (such as a gene fusion). The forward primers
are each specific for a first region of interest, and the reverse
primers are each specific for a second, different, region of
interest. In one embodiment, the first and second regions of
interest are in different genes. The different regions of interest
or different genes are located on different chromosomes when a
genomic rearrangement event has not occurred. A plurality of
primers is referred to herein as a set or pool of primers.
References to "multiple" primers herein refer to a collection of at
least two primers, but preferably at least 20 forward and at least
20 reverse primers are used. Primers targeted to regions suspected
of being involved in a genomic rearrangement event are referred to
as the selective PCR primers or region-specific primers.
[0447] In some embodiments, the first and second regions of
interest are located on the same chromosome but are located such
that little PCR amplification product (or only non-specific PCR
amplification product) is generated in the absence of a genomic
rearrangement event when the forward and reverse primers are used
in a PCR. In some embodiments, the first and second regions of
interest are located on the same chromosome but are separated by at
least 160 base pairs. When more than two regions of interest are
targeted, each region is separated from all the other targeted
regions in the primer kit.
[0448] In certain embodiments, the forward primers tile the first
region of interest and/or the reverse primers tile the second
region of interest. The forward and/or reverse primers may tile the
first and/or second region of interest at intervals of from about
10 to about 2000 base pairs, from about 10 to about 1000 base
pairs, from about 10 to about 500 base pairs, from about 10 to
about 250 base pairs, from about 10 to about 150 base pairs, from
about 25 to about 125 base pairs, from about 50 to about 100 base
pairs, or from about 60 to about 90 base pairs. In one embodiment,
the forward and reverse primers tile the first and second region of
interest, respectively, at intervals from about 60 to about 90 base
pairs.
[0449] In some embodiments, the forward and reverse primers tile
the first and second region of interest, respectively, at intervals
of up to about 50, about 100, about 150, about 250, about 500,
about 1000, about 2000 or about 2500 base pairs. In one embodiment,
the forward and reverse primers tile the first and second region of
interest, respectively, at intervals of up to about 100 base
pairs.
[0450] When more than two regions of interest are targeted, each
region can be tiled using pools or sets of primers in the same
way.
[0451] The selective PCR primers can be specific to different
sequences in the corresponding regions of interest, wherein the
different sequences in a given region of interest do not overlap
with each other.
[0452] The disclosure also provides pools or sets of selective PCR
primers (optionally as part of a kit), wherein the pool or set
comprises at least 20, at least 50 or at least 100 different
forward primers and/or at least 20, at least 50 or at least 100
different reverse primers. In a preferred embodiment, the pool or
kit comprises at least 20 different selective PCR forward primers
and at least 20 different selective PCR reverse primers. More
primers can be included for targeting larger and/or multiple
regions of interest in a single reaction, for example at least 200
different forward and reverse selective PCR primers may be
present.
[0453] In one embodiment, the pool or kit of primers comprises:
[0454] a. a set of at least 20 forward primers, wherein the forward
primers are specific for a first region of interest, and wherein
each member of the set of primers targets a different DNA sequence
in the first region of interest, and optionally wherein there are
multiple copies of each member for the set of forward primers; and
[0455] b. a set of at least 20 reverse primers, wherein the reverse
primers are specific for a second region of interest, and wherein
each member of the set of primers targets a different DNA sequence
in the second region of interest, and optionally wherein there are
multiple copies of each member for the set of reverse primers;
wherein the first and second regions of interest are different.
Preferably, the forward primers further comprising a first
universal primer binding site and the reverse primers further
comprise a second universal primer binding site. The first and
second primer binding sites are different from each other.
[0456] Multiple copies of each type of primer may be present in the
pool or kit.
[0457] The kit may comprise multiple sets of selective PCR primers.
For example, in one embodiment, the kit comprises at least 3 sets
of primers, at least one of which is a set of forward primers and
at least one of which is a set of reverse primers. Each set of
primers comprises a plurality of primers that tile a region of
interest, as discussed elsewhere. Each region of interest may be
different. In some embodiments, the kits comprise at least 4, at
least 5, at least 6, at least 7, at least 9, at least 9 or at least
10 pools of primers, each specific for a different region of
interest. In one embodiment, the kit comprises at least 5 pools of
forward selective PCR primers and at least 5 pools of reverse
selective PCR primers.
[0458] The sets of selective PCR primers generally will target
regions of interest that are suspected of having undergone a
genomic rearrangement. In some cases, a set of forward selective
PCR primers in one pair of forward and reverse primer sets may act
as a set of reverse selective PCR primers in another pair of
forward and reverse primer sets.
[0459] In some embodiments, the selective PCR primers target a gene
fusion. At least one pair of forward and reverse primers may anneal
to a DMOI within 500 base pairs from each other, or within 400 base
pairs from each other, or within 300 base pairs from each other, or
within 200 or within 175 base pairs from each other when a genomic
rearrangement, such as a gene fusion, is present.
[0460] In one embodiment, there is provided a kit of primers
comprising at least one set of primers that target a region of
interest in the ROS1 gene, at least one set of primers that target
a region of interest that is a potential fusion partner for the
ROS1 gene, at least one set of primers that target the ALK gene,
and at least one set of primers that target a region of interest
that is a potential fusion partner for the ALK gene.
[0461] In one embodiment, there is provided a kit of primers
comprising at least four sets of primers, wherein the four sets of
primers target ALK, ROS1, RET and NTRK1. In another embodiment,
there is provided a kit of primers comprising at least 16 sets of
primers that target ALK, EML4, ROS1, CD74, SLC34A2, SDC4, EZR, RET,
KIF5b, CCDC6, NCOA4, TRIM33, NTRK1, MPRIP, SQSTM1 and TPM3. Each
set of primers targets a different gene.
[0462] In some embodiments, the selective PCR primers in the kit or
primer pools or sets are gene specific primers. The different sets
of selective PCR primers may be specific for different genes.
[0463] Each selective PCR primer of the kit or pool comprises a
region-specific sequence and may optionally comprise an adaptor
sequence and/or a UPS. The adaptor sequence is an adaptor sequence
for sequencing the amplicons from the PCR.
[0464] Preferably, each selective PCR primer of the kit or pool
comprises a region-specific sequence and a universal primer binding
site. In some embodiments, the kit or pool further comprises
additional forward and reverse primer pairs specific to the
universal primer sites on the selective PCR primers specific to the
regions of interest. In such embodiments, when provided as a kit,
the additional forward and reverse primer pairs may be disposed
separately from the selective PCR primers. Additionally, the
additional primers in the second PCR comprise a UPS-specific
sequence and an adaptor sequence for sequencing the amplicons from
the selective PCR.
[0465] As noted, the methods disclosed herein can be used to target
multiple regions of interest and hence multiple possible genomic
rearrangements. Not only can the methods be used to detect any kind
of possible fusion between two regions of interest (i.e. at any
point along their sequence, even without prior knowledge of the
location of the rearrangement), but fusions between different
regions (e.g. genes) can be detected in a single reaction by
including multiple sets of primers. Each primer set will tile a
given region of interest, with each primer set targeting a
different region. Multiple sets of forward and reverse primers can
be included. Whilst each set will generally target a different
region, what is considered a forward primer set for one possible
genomic rearrangement event could be a reverse primer set of a
different genomic rearrangement event.
[0466] In some embodiments, the kits include instructions for use,
in particular instructions relating to the methods disclosed
herein.
[0467] Of course, the kits and pools disclosed herein can be used
in the methods disclosed herein. Furthermore, the primer
information databases may comprise the relevant information for all
of the primers in the primer pools disclosed herein.
[0468] In a very specific embodiment there is provided a method
comprising the following steps: [0469] 1. 10 ml of blood is
collected into Cell-Free DNA BCT Streck blood tubes. [0470] 2.
Blood is processed to plasma using methods known in the art [0471]
3. DNA is extracted from plasma using QIAamp Circulating Nucleic
Acid Kit (Qiagen) following manufactures protocols [0472] 4. DNA is
quantified by digital droplet PCR to determine the copies of cfDNA
within the sample [0473] 5. Selective PCR with primer pools
targeting rearrangement (i.e. EML4-ALK) is performed on [0474] DNA
sample. Primer pool also contains 18 primer pairs targeting regions
with known population SNPs. [0475] Selective PCR is performed on
two replicates of the same sample. [0476] 6. Amplicons generated
from step 5 are purified using SPRISelect (Beckman Coulter)
following manufactures protocols. [0477] 7. A 2.sup.nd PCR is
performed using primers targeting the UPS attached in Step 5. These
primers also contain sample barcodes/indexes which are used for
sample identification. [0478] This step further amplifies the
products of Step 5 [0479] 8. Amplicons generated from Step 7 are
purified using SPRISelect [0480] 9. Samples are pooled together
into a single reaction tube to generate a pool library [0481] 10. A
region between 200-350 bp is size selected using the Pippin Prep
System (Sage Science) [0482] 11. Library from Step 10 is quantified
using Library Quantification Kit (KAPA Biosystems) [0483] 12.
Quantified pooled library is sequenced on NextSeq Platform using
300 Cycles of sequencing Analysis [0484] 13. Samples are
de-multiplexed--Indexes are used to identify unique samples [0485]
14. Analysis pipeline performed (details to follow) [0486] 15.
Fusion breakpoint is called depending on weak/strong anchor
methodology [0487] 16. Patient specific report is generated
indicating presence/absence of Fusion and indicating
treatments/trials relevant to the genetic alteration
[0488] The present disclosure provides a method for detecting
genomic rearrangements, including gene fusions, comprising: [0489]
a. providing a patient blood sample comprising ctDNA; [0490] b.
extracting the ctDNA from the sample; [0491] c. conducting a
selective multiplex PCR on the extracted ctDNA using a pool of at
least 20 forward primers specific for a first gene and a pool of at
least 20 reverse primers specific for a second gene, wherein the
pool of forward primers tiles a first gene (or a region thereof)
and the pool of reverse primers tile a second gene (or a region
thereof), with spaces of between 50 and 100 nucleotide bases
between adjacent primers in the pools, wherein the PCR incorporates
universal primer binding sites into the amplicons that are
generated; [0492] d. conducting a further PCR using primers
specific for the universal primer binding sites incorporated in
step c.; [0493] e. sequencing the amplification product from step
d.; and [0494] f. determining the presence or absence of a genomic
rearrangement according to the sequence of the amplification
product.
[0495] The preferred features for the second and subsequent aspects
are as provided for the first aspect, mutatis mutandis.
[0496] The present invention will now be further explained by
reference to a number of non-limiting examples.
EXAMPLES
[0497] Aspects of the present teachings can be further understood
in light of the following examples, which should not be construed
as limiting the scope of the present teachings in any way.
Example 1: Detection of EML4-ALK Variant at a Range of Allelic
Fractions
[0498] A custom cell free DNA reference standard containing an
EML4-ALK fusion of sequence GAAGTTCCTATACTTTCTAGAGAATAGGAACTTC (SEQ
ID NO: 1) at an allelic fraction of 2.5% was obtained from Horizon
Discoveries. This reference standard was diluted in sheared
(average 188 bp) human placental DNA (Bioline) to achieve allelic
fractions of 1%, 0.5%, 0.25%, 0.125% and 0.0625%. Three samples
were created at each allelic fraction.
[0499] Each sample was split into two replicates, each containing a
total of 4000 input copies. PCR amplification was performed on two
replicates using the ALK primer panel (table 1). Each PCR contained
25 uL DNA, 27.5 uL Platinum SuperFi 2.times. Master Mix
(Invitrogen) and 2.5 uL of the ALK primer pool (for primer
concentration see table 1). PCR cycling was followed using
manufacturer' instructions. The PCR product was cleaned up using
SPRIselect reagent (Beckman Coulter B23319) using the manufacturers
protocol. DNA was eluted in 18 uL and a second PCR using Indexed
illumina primers was performed. Each PCR contained 15 uL DNA, 17.5
uL Platinum SuperFi 2.times. Master Mix (Invitrogen) and 2.4 uL
Indexed illumina primers. PCR Cycling was followed using
manufactures instructions. The PCR product was cleaned up once
using SPRIselect reagent (Beckman Coulter B23319) using the
manufacturers protocol. indexes samples from different replicates
were pooled into a tube containing 10 uL 10 mM Tris-HCl pH 8.
Samples were selected for 195-350 bp using a 2% Agarose Dye Free
cassette and marker L on the Pippin Prep (Sage Science), following
the manufacturer's instructions. Size selected DNA was quantified
by qPCR using a KAPA Library quantification kit (KAPABIOSYSTEMS),
following the manufacturer's instructions. Quantified libraries
were sequenced on the NextSeq500 Illumina platform and data
analysis was performed.
[0500] EML4-ALK enrichment using Selective PCR and Next generation
sequencing (FIG. 1). The EML4-ALK fusion variant was detected at
all allelic fractions tested (FIG. 2); illustrating that selective
PCR consistently amplifies as little as 2.5 molecules of Fusion DNA
as indicated by 100% detection at 0.0625% AF (4000 input copies).
The sequence obtained by the selective PCR method matched the
expected breakpoint (FIG. 2A), indicating the selective nature of
the method. Specificity of the method is at 100% with no additional
Fusions detected in any of the samples tested and with no fusion
calls being made in samples that don't contain Fusion DNA (0% AF).
The median read depth of the ALK-EML4 fusion (FIG. 3), at a range
of AFs, shows a decrease in reads obtained by selective PCR that
correlates with a decrease in AF, indicating linear amplification
of the gene fusion.
Example 2: Detection of ROS1-CD74 Variant
[0501] A synthetic gBlock containing a ROS1 fusion sequence (based
on a sequence reported in the literature: Seki, Mizukami and Kohno,
Biomolecules, 2015, 5, 2464-2476) was synthesized by IDT and was
sheared using the covaris to achieve an average size of 150 bp. The
gBlock was added to sheared (average 188 bp) human placental DNA
(Bioline) to achieve an allelic fraction of 1%.
[0502] Each sample was split into two replicates, each containing a
total of 4000 input copies. PCR amplification was performed on two
of the replicates using the ROS1 primer panel (table 2). Each PCR
contained 25 uL DNA, 27.5 uL Platinum SuperFi 2.times. Master Mix
(Invitrogen) and 2.5 uL of the ROS1 primer pool (for primer
concentration see table 2). PCR Cycling was followed using
manufactures instructions. The PCR product was cleaned up using
SPRIselect reagent (Beckman Coulter B23319) using the manufacturers
protocol. DNA was eluted in 18 uL and a second PCR using Indexed
illumina primers was performed. Each PCR contained 15 uL DNA, 17.5
uL Platinum SuperFi 2.times. Master Mix (Invitrogen) and 2.4 uL
Indexed illumina primers. PCR Cycling was followed using
manufactures instructions. The PCR product was cleaned up once
using SPRIselect reagent (Beckman Coulter B23319) using the
manufacturers protocol. indexes samples from different replicates
were pooled into a tube containing 10 uL 10 mM Tris-HCl pH 8.
Samples were selected for 195-350 bp using a 2% Agarose Dye Free
cassette and marker L on the Pippin Prep (Sage Science), following
the manufacturer's instructions. Size selected DNA was quantified
by qPCR using a KAPA Library quantification kit (KAPABIOSYSTEMS),
following the manufacturer's instructions. Quantified libraries
were sequenced on the NextSeq500 Illumina platform and data
analysis was performed.
[0503] ROS1-CD74 enrichment using selective PCR and Sequencing on
the NextSeq platform (FIG. 4). The sequence of the ROS1-CD74 fusion
breakpoint is known in the field (Seki, Mizukami and Kohno,
Biomolecules, 2015, 5, 2464-2476) and was synthesised into a double
stranded DNA fragment (FIG. 5). The method detected the fusion
breakpoint with two primer pairs, CD74_E6-I6_10/ROS1_I32_E33_414
and CD74_E6-I6_9/ROS1_I32_E33_414 (FIG. 6A). The sequence read of
both primer pairs matched that of the synthesised published
ROS1-CD74 breakpoint (FIG. 6B). The sequence read obtained for each
primer pair is shown and is a 100% match with the published
breakpoint; highlighting that the selective PCR method can amplify
a fusion breakpoint with multiple primer combinations and can
accurately identify the sequence of a fusion breakpoint.
Example 3: Detection of ROS1-CD74 Variant Using Sequential
Amplification
[0504] The same synthetic ROS1 fusion gBlock at 1% allelic fraction
as was used in Example 2 was tested.
[0505] Each sample was split into two replicates, each containing a
total of 4000 input copies. Linear amplification of the template
was performed on two of the replicates using only the ROS1 forward
primer panel. Each reaction contained 25 uL DNA, 27.5 uL Platinum
SuperFi 2.times. Master Mix (Invitrogen) and 2.5 uL of the ROS1
forward primer pool. Cycling was followed using manufactures
instructions. The PCR product was cleaned up once using SPRIselect
reagent (Beckman Coulter B23319) using the manufacturers protocol.
DNA was eluted in 18 uL and a first PCR using a i5 adapter forward
primer and the ROS1 reverse primer pool was performed. Each PCR
contained 10 uL DNA, 25 uL Platinum SuperFi 2.times. Master Mix
(Invitrogen), 2.5 ul of the i5 adapter forward primer and 2.5 uL of
the ROS1 reverse primer pool. Cycling was followed using
manufactures instructions. The PCR product was cleaned up once
using SPRIselect reagent (Beckman Coulter B23319) using the
manufacturers protocol. DNA was eluted in 18 uL and a second PCR
using Indexed illumina primers was performed. Each PCR contained 15
uL DNA, 17.5 uL Platinum SuperFi 2.times. Master Mix (Invitrogen)
and 2.4 uL Indexed illumina primers. PCR Cycling was followed using
manufactures instructions. The PCR product was cleaned up once
using SPRIselect reagent (Beckman Coulter B23319) using the
manufacturers protocol. Indexed samples from different replicates
were pooled into a tube containing 10 uL 10 mM Tris-HCl pH 8.
Samples were selected for 195-350 bp using a 2% Agarose Dye Free
cassette and marker L on the Pippin Prep (Sage Science), following
the manufacturer's instructions. Size selected DNA was quantified
by qPCR using a KAPA Library quantification kit (KAPABIOSYSTEMS),
following the manufacturer's instructions. Quantified libraries
were sequenced on the NextSeq500 Illumina platform and data
analysis was performed.
Example 4: Matching Sequences to a Reference Database
[0506] Once sequence reads have been demultiplexed, adaptors have
been trimmed and reads have been merged, they are compared against
a database of all primers used in the fusion assay. Any sequencing
reads containing the sequence of a primer designed to a 5' partner
at the start and that of a 3' partner at the end are identified as
potential fusion reads and carried forward for further analysis.
The table of primers also contains a list of the expected sequences
downstream from each primer (based on the primer bind site in the
targeted region as opposed to another part of the genome) and the
number of bases that need to match following the end of the primer
in order to attain either low or high confidence that the sequence
being read belongs to the potential fusion partner. A fusion may be
called when the sequence from at least one side is identified with
high confidence as belonging to a possible fusion partner (e.g.
ELM4) and the other side is identified as belonging with at least
low confidence to a fusion partner (e.g. ALK). A fusion might be
only called if this is either detected in duplicate reactions or if
there are 2 or more reads where both sides are high confidence.
[0507] It will also be recognized by those skilled in the art that,
while the invention has been described above in terms of preferred
embodiments, it is not limited thereto. Various features and
aspects of the above described invention may be used individually
or jointly. Further, although the invention has been described in
the context of its implementation in a particular environment, and
for particular applications (e.g. cfDNA analysis) those skilled in
the art will recognize that its usefulness is not limited thereto
and that the present invention can be beneficially utilized in any
number of environments and implementations where it is desirable to
examine other samples. Accordingly, the claims set forth below
should be construed in view of the full breadth and spirit of the
invention as disclosed herein.
Sequence CWU 1
1
8134DNAArtificial SequenceEML4-ALK gene fusion 1gaagttccta
tactttctag agaataggaa cttc 342108DNAArtificial SequencePrimer Set 1
2ttaattaaat gtttttcaaa tccattcacc tgaatgtcta agcttggcag gaagttccta
60tactttctag agaataggaa cttcggaata ggaacttcat atggtgcc
108368DNAArtificial SequencePrimer Set 2 3aggaagttcc tatactttct
agagaatagg aacttcggaa taggaacttc atatggtgcc 60atccctca
684499DNAArtificial SequenceROS1-CD74 gBlock Sequence 4cgccaaggtc
acagctgctg ccaagagagc cttgggcgtt tcccacctca tggacaatgc 60agactaggat
gtttttagac ccaaagacag agtgctgttt ctatcccggt gctgtctcta
120atttgctatg taactttgga caagtcccct tccctctagg attcagggtc
ctgaagtaga 180aggtcaaagg gccaccctgc ctggggcctc agtttctgca
tcagattcat agaaggcacc 240ttacatgcta ttgtcatgta tattttctgt
atttattatt ttttgcagaa agagcacttc 300aaataattta cagaaccaga
atttaaggtg gagatgacat ttaatggatc ctgcagtagt 360gtttgcacat
ggaagtccaa aaacctgaaa ggaatatttc agttcagagt agtagctgca
420aataatctag ggtttggtga atatagtgga atcagtgaga atattatatt
agttggaggt 480atgttaccat gtctgtcta 4995104DNAArtificial
SequenceCD74_E6-I6_10 (fw) ROS1_I32_E33_414 (rv) sequence read
5ttacatgcta ttgtcatgta tattttctgt atttattatt ttttgcagaa agagcacttc
60aaataattta cagaaccaga atttaaggtg gaagatgaca ttta
1046110DNAArtificial SequenceCD74_E6-I6_9 (fw) ROS1_I32_E33_414
(rv) sequence read 6ccctgcctgg ggcctcagtt tctgcatcag attcatagaa
ggcaccttac atgctattgt 60catgtatatt ttctgtattt attatttttt gcagaaagag
cacttcaaat 1107499DNAArtificial
SequenceCD74_E6-I6_10/ROS1_I32_E33_414 Read 7cgccaaggtc acagctgctg
ccaagagagc cttgggcgtt tcccacctca tggacaatgc 60agactaggat gtttttagac
ccaaagacag agtgctgttt ctatcccggt gctgtctcta 120atttgctatg
taactttgga caagtcccct tccctctagg attcagggtc ctgaagtaga
180aggtcaaagg gccaccctgc ctggggcctc agtttctgca tcagattcat
agaaggcacc 240ttacatgcta ttgtcatgta tattttctgt atttattatt
ttttgcagaa agagcacttc 300aaataattta cagaaccaga atttaaggtg
gagatgacat ttaatggatc ctgcagtagt 360gtttgcacat ggaagtccaa
aaacctgaaa ggaatatttc agttcagagt agtagctgca 420aataatctag
ggtttggtga atatagtgga atcagtgaga atattatatt agttggaggt
480atgttaccat gtctgtcta 4998499DNAArtificial
SequenceCD74_E6-I6_9/ROS1_I32_E33_414 Read 8cgccaaggtc acagctgctg
ccaagagagc cttgggcgtt tcccacctca tggacaatgc 60agactaggat gtttttagac
ccaaagacag agtgctgttt ctatcccggt gctgtctcta 120atttgctatg
taactttgga caagtcccct tccctctagg attcagggtc ctgaagtaga
180aggtcaaagg gccaccctgc ctggggcctc agtttctgca tcagattcat
agaaggcacc 240ttacatgcta ttgtcatgta tattttctgt atttattatt
ttttgcagaa agagcacttc 300aaataattta cagaaccaga atttaaggtg
gagatgacat ttaatggatc ctgcagtagt 360gtttgcacat ggaagtccaa
aaacctgaaa ggaatatttc agttcagagt agtagctgca 420aataatctag
ggtttggtga atatagtgga atcagtgaga atattatatt agttggaggt
480atgttaccat gtctgtcta 499
* * * * *