U.S. patent application number 16/137408 was filed with the patent office on 2019-08-08 for systems and methods for biological analysis and computation.
The applicant listed for this patent is GenapSys, Inc.. Invention is credited to Meysam R. Baemi, Hesaam Esfandyarpour, Saurabh Paliwal, kosar B. Parizi, Amirhossein Samakar, Seth Stern.
Application Number | 20190241951 16/137408 |
Document ID | / |
Family ID | 53371819 |
Filed Date | 2019-08-08 |
View All Diagrams
United States Patent
Application |
20190241951 |
Kind Code |
A1 |
Esfandyarpour; Hesaam ; et
al. |
August 8, 2019 |
SYSTEMS AND METHODS FOR BIOLOGICAL ANALYSIS AND COMPUTATION
Abstract
Provided herein are devices and methods suitable for sequencing,
detecting, amplifying, analyzing, and performing sample preparation
procedures for nucleic acids and other molecules. In some cases,
the devices and methods provided herein are used for
computation.
Inventors: |
Esfandyarpour; Hesaam;
(Redwood City, CA) ; Baemi; Meysam R.; (Menlo
Park, CA) ; Parizi; kosar B.; (Redwood City, CA)
; Paliwal; Saurabh; (Mountain View, CA) ; Samakar;
Amirhossein; (Fremont, CA) ; Stern; Seth;
(Palo Alto, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
GenapSys, Inc. |
Redwood City |
CA |
US |
|
|
Family ID: |
53371819 |
Appl. No.: |
16/137408 |
Filed: |
September 20, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15028899 |
Apr 12, 2016 |
10125393 |
|
|
PCT/US2014/069624 |
Dec 10, 2014 |
|
|
|
16137408 |
|
|
|
|
61914659 |
Dec 11, 2013 |
|
|
|
61914937 |
Dec 11, 2013 |
|
|
|
61914830 |
Dec 11, 2013 |
|
|
|
61914787 |
Dec 11, 2013 |
|
|
|
61914902 |
Dec 11, 2013 |
|
|
|
61914826 |
Dec 11, 2013 |
|
|
|
61915276 |
Dec 12, 2013 |
|
|
|
61915438 |
Dec 12, 2013 |
|
|
|
61940343 |
Feb 14, 2014 |
|
|
|
62047583 |
Sep 8, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
B01L 2300/088 20130101;
B01L 2400/0415 20130101; G01N 33/66 20130101; B01L 2300/0848
20130101; B01L 2200/0605 20130101; B01L 2300/1822 20130101; B01L
2300/02 20130101; B01L 2400/0427 20130101; B01L 2200/04 20130101;
B01L 2300/0819 20130101; B01L 2300/161 20130101; B01L 2400/043
20130101; B01L 2300/0627 20130101; B01L 2200/16 20130101; B01L
7/525 20130101; C12Q 1/6825 20130101; C12Q 1/6825 20130101; G01N
33/68 20130101; B01L 3/502784 20130101; B01L 2300/023 20130101;
C12Q 2565/629 20130101; G16B 25/00 20190201; B01L 3/502761
20130101; B01L 2400/0481 20130101; B01L 3/50273 20130101; C12Q
1/6874 20130101; B01L 2300/0636 20130101; B01L 3/502715 20130101;
B01L 2200/0647 20130101; B01L 2200/142 20130101 |
International
Class: |
C12Q 1/6874 20060101
C12Q001/6874; B01L 3/00 20060101 B01L003/00; G16B 25/00 20060101
G16B025/00 |
Claims
1.-198. (canceled)
199. A device comprising a well-less sensing array comprising a
plurality of sensors in a housing, wherein at least a subset of
said plurality of sensors is individually addressable, wherein a
sensor of said plurality of sensors is configured to directly
measure an electronic signature associated with a biological
species in solution, wherein said housing has a footprint that is
less than or equal to about 250,000 mm.sup.2, and wherein said
device has a weight that is less than or equal to about 25
pounds.
200. The device of claim 199, further comprising a fluid flow path
in fluid communication with said plurality of sensors.
201. The device of claim 200, wherein said fluid flow path is in
fluid communication with a repository comprising one or more
reagent for nucleic acid sequencing.
202. The device of claim 199, wherein said plurality of sensors is
configured for nucleic acid sequencing.
203. The device of claim 199, wherein said well-less sensing array
is part of a chip, and wherein said chip is removable from said
housing.
204. The device of claim 199, wherein said weight is less than or
equal to about 10 pounds.
205. The device of claim 199, wherein said footprint is less than
or equal to about 100,000 mm.sup.2.
206. The device of claim 199, further comprising a computer
processor coupled to said well-less sensing array, which computer
processor is configured to receive signals from said sensor
indicative of said electronic signature associated with said
biological species.
207. The device of claim 199, wherein said electronic signature is
an impedance or change in impedance associated with said biological
species.
208. A method for biological detection, comprising: (a) providing a
device comprising a well-less sensing array comprising a plurality
of sensors in a housing, wherein at least a subset of said
plurality of sensors is individually addressable, wherein a sensor
of said plurality of sensors directly measures an electronic
signature associated with a biological species in solution, wherein
said housing has a footprint that is less than or equal to about
250,000 mm.sup.2, and wherein said device has a weight that is less
than or equal to about 25 pounds; (b) directing a solution
comprising said biological species to said plurality of sensors;
and (c) directly measuring an electronic signature associated with
said biological species using said sensor.
209. The method of claim 208, further comprising using a fluid flow
path in fluid communication with said well-less sensing array to
direct said solution.
210. The method of claim 208, wherein said biological species is a
polypeptide or a protein.
211. The method of claim 208, wherein said biological species is
nucleic acid molecule.
212. The method of claim 211, wherein said electronic signature is
indicative of a sequence of said nucleic acid molecule.
213. The method of claim 208, wherein said well-less sensing array
is a part of a chip, and wherein said chip is removable from said
housing.
214. The method of claim 208, wherein said electronic signature is
an impedance or change in impedance associate with said biological
species.
215. The method of claim 214, wherein said impedance or change in
impedance is associated with (i) said biological species
immobilized to a bead disposed adjacent to said sensor, (ii) said
biological species coupled to an electrode of said sensor, or (iii)
said biological species in a fluid adjacent to said sensor.
Description
CROSS-REFERENCE
[0001] This application is a continuation of U.S. application Ser.
No. 15/028,899, filed on Apr. 12, 2016, which is a national state
entry of International Application No. PCT/US2014/069624, filed
Dec. 10, 2014, which application claims the benefit of U.S.
Provisional Patent Application No. 61/914,937, filed Dec. 11, 2013,
U.S. Provisional Patent Application No. 61/914,830, filed Dec. 11,
2013, U.S. Provisional Patent Application No. 61/915,276, filed
Dec. 12, 2013, U.S. Provisional Patent Application No. 61/915,438,
filed Dec. 12, 2013, U.S. Provisional Patent Application No.
61/914,659, filed Dec. 11, 2013, U.S. Provisional Patent
Application No. 61/914,826, filed Dec. 11, 2013, U.S. Provisional
Patent Application No. 61/914,902, filed Dec. 11, 2013, U.S.
Provisional Patent Application No. 61/914,787, filed Dec. 11, 2013,
U.S. Provisional Patent Application No. 61/940,343, filed Feb. 14,
2014, and U.S. Provisional Patent Application No. 62/047,583, filed
Sep. 8, 2014, each of which applications is incorporated herein by
reference in its entirety and for all purposes.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been filed electronically in ASCII format and is hereby
incorporated by reference in its entirety. The ASCII copy, created
on Nov. 17, 2016, is named 42808715831SL.txt and is 910 bytes in
size.
BACKGROUND
[0003] The goal to elucidate the entire human genome has created
interest in technologies for rapid nucleic acid (e.g., DNA)
sequencing, both for small and large scale applications. Important
parameters are sequencing speed, length of sequence that can be
read during a single sequencing run, and amount of nucleic acid
template required to generate sequencing information. Large scale
genome projects are currently too expensive to realistically be
carried out for a large number of subjects (e.g., patients).
Furthermore, as knowledge of the genetic basis for human diseases
increases, there will be an ever-increasing need for accurate,
high-throughput DNA sequencing that is affordable for clinical
applications. Practical methods for determining the base pair
sequences of single molecules of nucleic acids, preferably with
high speed and long read lengths, may provide measurement
capability.
[0004] Nucleic acid sequencing is a process that can be used to
provide sequence information for a nucleic acid sample. Such
sequence information may be helpful in diagnosing and/or treating a
subject with a condition. For example, the nucleic acid sequence of
a subject may be used to identify, diagnose and potentially develop
treatments for genetic diseases. As another example, research into
pathogens may lead to treatment for contagious diseases.
Unfortunately, though, existing sequencing technology of the status
quo is expensive and may not provide sequence information within a
time period and/or at an accuracy that may be sufficient to
diagnose and/or treat a subject with a condition.
[0005] Computer data storage is a technology that has computer
components and recording media used to retain data electronically.
The most commonly used data storage technologies are semiconductor,
magnetic, and optical. Data may be stored in data storage media,
which data in a data storage device.
[0006] A modern digital computer represents data using the binary
numeral system. Text, numbers, pictures, audio, and nearly any
other form of information can be converted into a string of bits,
or binary digits, each of which has a value of 1 or 0. The most
common unit of storage is the byte, equal to 8 bits. A piece of
information can be handled by any computer or device whose storage
space is large enough to accommodate the binary representation of
the piece of information, or simply data.
[0007] Data may be electronically encoded by assigning a bit
pattern to each character, digit, or multimedia object. Many
standards exist for encoding (e.g., character encodings like ASCII,
image encodings like JPEG, video encodings like MPEG-4).
[0008] DNA computing is a form of computing that uses DNA,
biochemistry and molecular biology to store data, access data
and/or perform computations. One of potential advantage of DNA
computing is that, similar to parallel computing, it can try many
different possibilities at once owing to having many different
molecules of DNA.
SUMMARY
[0009] Recognized herein is the need for improved devices and
methods for performing computation with, sequencing, amplifying,
analyzing, and/or performing sample preparation procedures for
nucleic acids and other biomolecules.
[0010] An aspect of the disclosure provides a device comprising a
well-less sensing array with a plurality of sensors in a housing.
At least a subset of the plurality of sensors can be individually
addressable and each sensor of the plurality can be adapted to
directly measure an electronic signature associated with a
biological species in solution. The housing can have a footprint
that is less than or equal to about 250,000 mm.sup.2 and the device
can have a weight that is less than or equal to about 10
pounds.
[0011] In some embodiments, the device can further comprise a fluid
flow path in fluid communication with the sensing array. The fluid
flow path can be in communication with a repository comprising one
or more reagents for nucleic acid sequencing. In some embodiments,
the fluid flow path can provide beads to the sensing array in an
emulsion. In some embodiments, the biological species can be a
nucleic acid such as, for example, a circular nucleic acid.
[0012] In some embodiments, the footprint can be less than or equal
to about 100,000 mm.sup.2. In some embodiments, the footprint can
be greater than or equal to about 500 mm.sup.2. In some
embodiments, the weight can be less than or equal to about 5
pounds. In some embodiments, the weight can be greater than or
equal to about 0.1 pounds. In some embodiments, the sensing array
can provide a single-pass bead loading fill factor of at least
about 50%. In some embodiments, the sensing array can provide a
nucleic acid sequencing read length of at least about 20 base pairs
(bp) with a non-linearity of less than or equal to about 10 bases.
In some embodiments, the read length may be for a nucleic acid
homopolymer.
[0013] In some embodiments, the sensing array may be part of a chip
that is removable from the housing. The chip can be a single-use
chip and can be disposable. In some embodiments, the sensing array
may be substantially planar. In some embodiments, the sensing array
can provide a nucleic acid sequencing throughput of at least about
100 base pairs (bp) in a time period that is less than or equal to
about 2 days. The nucleic acid sequencing can be, for example,
targeted sequencing and/or whole genome sequencing.
[0014] In some embodiments, the device can further comprise a
computer processor coupled to the sensing array. The computer
processor can be programmed to receive signals from the sensing
array that are indicative of a direct electrical signature of the
species. In some embodiments, the sensing array may be adapted for
nucleic acid sequencing, proton detection, protein detection, or
pathogen detection. In some embodiments, the sensing array may be
adapted for nucleic acid amplification. In some embodiments, the
device can be transportable by a user.
[0015] In some embodiments, the electronic signature can be an
impedance or a change in impedance. The impedance or change in
impedance can be associated with a bead adjacent to the sensor, an
electrode of the sensor and/or a species in a fluid adjacent to the
sensor. In some embodiments, the electronic signature can be a
charge or a change in charge. The charge or change in charge can be
associated with a bead adjacent to the sensor, an electrode of the
sensor and/or a species in a fluid adjacent to the sensor. In some
embodiments, a system may comprise a device.
[0016] An additional aspect of the disclosure provides a method for
biological detection. The method can comprise providing a device
comprising a sensing array with a plurality of sensors in a
housing. At least a subset of the plurality of sensors can be
individually addressable and each sensor of the plurality can be
adapted to directly measure an electronic signature associated with
a biological species in solution. The housing can have a footprint
that is less than or equal to about 250,000 mm.sup.2 and the device
can have a weight that is less than or equal to about 10 pounds.
Moreover, the method can further comprise directing a solution
comprising the biological species to the sensing array and directly
measuring an electronic signature associated with the biological
species using the sensor.
[0017] In some embodiments, the device may further comprise a fluid
flow path in fluid communication with the sensing array. The fluid
flow path can be in communication with a repository comprising one
or more reagents for nucleic acid sequencing and/or can provide
beads to the sensing array in an emulsion. In some embodiments, all
or substantially all of the plurality of sensors may be
individually addressable. In some embodiments, the biological
species may be a nucleic acid such as, for example, a circular
nucleic acid.
[0018] In some embodiments, the footprint may be less than or equal
to about 100,000 mm.sup.2. In some embodiments, the footprint may
be greater than or equal to about 500 mm.sup.2. In some
embodiments, the weight may be less than or equal to about 5
pounds. In some embodiments, the weight may be greater than or
equal to about 0.1 pounds. In some embodiments, the sensing array
can provide a single-pass bead loading fill factor of at least
about 50%. In some embodiments, the sensing array can provide a
nucleic acid sequencing read length of at least about 20 base pairs
(bp) with a non-linearity of less than or equal to about 10 bases.
In some embodiments, the read length may be for a nucleic acid
homopolymer.
[0019] In some embodiments, the sensing array may be part of a chip
that is removable from the housing. The chip can be a single-use
chip and/or can be disposable. In some embodiments, the sensing
array may be substantially planar. In some embodiments, the sensing
array provides a nucleic acid sequencing throughput of at least
about 100 base pairs (bp) in a time period that is less than or
equal to about 2 days. In some embodiments, the nucleic acid
sequencing may be targeted sequencing and/or whole genome
sequencing.
[0020] In some embodiments, the device may further comprise a
computer processor coupled to the sensing array. The computer
processor can be programmed to receive signals from the sensing
array that are indicative of a direct electrical signature of the
species. In some embodiments, the sensing array can be adapted for
nucleic acid sequencing, proton detection, protein detection, or
pathogen detection. In some embodiments, the sensing array may be
adapted for nucleic acid amplification and/or fluid enrichment. In
some embodiments, the device may be transportable by a user.
[0021] In some embodiments, the electronic signature may be an
impedance or a change in impedance. The impedance or change in
impedance may be associated with a bead adjacent to the sensor, an
electrode of the sensor or a species in a fluid adjacent to the
sensor. In some embodiments, the electronic signature may be a
charge or a change in charge. The charge or change in charge may be
associated with a bead adjacent to the sensor, an electrode of the
sensor or a species in a fluid adjacent to the sensor.
[0022] An additional aspect of the disclosure provides a method for
data storage. The method can comprise receiving bits encoding at
least one computer-executable directive for storing data and, using
a computer processor, generating a nucleic acid sequence that
encodes the data. The nucleic acid sequence can comprise nucleic
acid subunits that correspond to the bits. Moreover, the method can
further comprise using an array of individually addressable nucleic
acid synthesis sites, generating a nucleic acid molecule having the
nucleic acid sequence at a first site of the array at the exclusion
of generating an additional nucleic acid molecule having the
nucleic acid sequence at a second site of the array.
[0023] In some embodiments, the bits can encode a plurality of
computer-executable directives. In some embodiments, the data can
be stored in computer memory. In some embodiments, the nucleic acid
subunits can be selected from at least two distinct subunits. A
subset of the at least two distinct subunits can correspond to a 1
or 0. In some embodiments, an individual site of the nucleic acid
synthesis sites may comprise a pair of electrodes.
[0024] In some embodiments, generating a nucleic acid molecule
having the nucleic acid at a first site of the array at the
exclusion of generating an additional nucleic acid molecule having
the nucleic acid sequence at a second site the array can comprise
alternately and sequentially directing to the first site nucleic
acid subunits or precursors thereof that are selected based on the
nucleic acid sequence. In some embodiments, the method can further
comprise excluding from the second site the nucleic subunits or
precursors thereof that are alternately and sequentially directed
to the first site. In some embodiments, the method can further
comprise attracting a given nucleic acid subunit or precursor
thereof to the first site or not repelling the given nucleic acid
subunit or precursor thereof from the first site. In some
embodiments, the method can further comprise repelling the given
nucleic acid subunit or precursor thereof from the second site or
not attracting the given nucleic acid subunit or precursor thereof
to the second site.
[0025] In some embodiments, the given nucleic acid subunit or
precursor thereof can be attracted to the first site and/or
repelled from the second site using an electric field generated at
each of the first and second sites. In some embodiments, the
electric field can be generated by one or more electrodes at the
first and second sites. In some embodiments, the given nucleic acid
subunit or precursor thereof can be attracted to the first site
and/or repelled from the second site using a magnetic field
generated at each of the first and second sites. In some
embodiments, the magnetic field may be generated by one or more
magnetic elements at the first and second sites. In some
embodiments, the given nucleic acid subunit or precursor thereof
may be attached to a magnetic bead.
[0026] In some embodiments, the nucleic acid subunits or precursors
can be alternately and sequentially directed to the first site via
fluid flow. The fluid flow may be fluid flow in at least one
microfluidic channel. In some embodiments, the method can further
comprise removing the nucleic acid molecule from the array after
the nucleic acid molecule is generated. In some embodiments, the
nucleic acid molecule may be generated at more than one site of the
array. In some embodiments, the nucleic acid molecule may be
generated at only one site of the array. In some embodiments, a
plurality of the nucleic acid molecules is generated at the first
site. In some embodiments, the nucleic acid molecule may be
generated in the absence of a nucleic acid template.
[0027] In some embodiments, the nucleic acid molecule can be
generated on a reaction surface at the first site. The reaction
surface may be, for example, a particle or surface of a well at the
first site. In some embodiments, the nucleic acid molecule can be
generated on the reaction surface via covalent coupling of a
nucleic acid subunit or precursor thereof of the nucleic acid
molecule to the reaction surface. In some embodiments, the nucleic
acid molecule can be generated on the reaction surface via coupling
of a nucleic acid subunit or precursor thereof of the nucleic acid
molecule to a linker coupled to the reaction surface. In some
embodiments, the nucleic acid molecule can be generated on the
reaction surface via non-covalent coupling of a nucleic acid
subunit or precursor thereof of the nucleic acid molecule to the
reaction surface. The non-covalent coupling can be, for example, a
binding interaction between members of a binding pair.
[0028] In some embodiments, the array may be substantially planar.
In some embodiments, the first site can further comprise a sensor
capable of detecting signals indicative of an impedance change, a
charge change, a change in pH, or a change in temperature
associated with the generating of the nucleic acid molecule. In
some embodiments, the sensor may comprise a pair of electrodes. In
some embodiments, the sensor may be electrically coupled to the
Debye layer of a surface of the sensor, a surface of the nucleic
acid molecule, or a reaction surface coupled to the nucleic acid
molecule. In some embodiments, the method can further comprise
removing a given nucleic acid subunit or precursor thereof of the
nucleic acid molecule from the first site if the sensor detects
that the given nucleic acid subunit or precursor thereof of the
nucleic acid molecule is incorrectly incorporated to the nucleic
acid molecule during the generating.
[0029] An additional aspect of the disclosure provides a method for
accessing data. The method can comprise providing an array of
individually addressable sites, where a given site of the array has
a nucleic acid molecule with a sequence of nucleic acid subunits
that corresponds to bits encoding at least one computer-executable
directive for storing data. The method can further comprise, at the
given site, identifying the sequence of nucleic acid subunits by
measuring an impedance, conductance and/or charge associated with
the nucleic acid molecule. The method can further comprise, using a
computer processor, identifying the bits from the sequence of
nucleic acid subunits, and generating the data from the bits.
[0030] In some embodiments, an additional site of the array may not
have an additional nucleic acid molecule with the sequence of
nucleic acid subunits. In some embodiments, an additional site of
the array may have an additional nucleic acid molecule with the
sequence of nucleic acid subunits. In some embodiments, the
identifying can comprise sequencing the nucleic acid molecule. In
some embodiments, the sequencing can comprise performing a nucleic
acid extension reaction using a primer that hybridizes to the
nucleic acid molecule. In some embodiments, the impedance,
conductance and/or charge associated with the nucleic acid molecule
can be indicative of nucleotide incorporation events during the
nucleic acid extension reaction.
[0031] In some embodiments, the identifying may comprise
hybridizing an oligonucleotide that comprises a sequence at least
partially complementary to the sequence of nucleic acid subunits to
the nucleic acid molecule. In some embodiments, the impedance,
conductance and/or charge associated with the nucleic acid molecule
may be indicative of the hybridizing the oligonucleotide to the
nucleic acid molecule.
[0032] In some embodiments, the sequence of nucleic acid subunits
that is identified may be stored in computer memory. In some
embodiments, the method may further comprise storing the data in
computer memory. In some embodiments, the nucleic acid subunits may
comprise at least two distinct subunits. A subset of the at least
two distinct subunits can correspond to a 1 or 0. In some
embodiments, the given site may comprise a plurality of the nucleic
acid molecules.
[0033] In some embodiments, the method can further comprise
assembling generated data into a larger piece of data. In some
embodiments, the nucleic acid molecule may comprise a primer
binding sequence. In some embodiments, the primer binding sequence
can function as a searchable index.
[0034] In some embodiments, a sensor at the given site can detect
signals indicative of the impedance, conductance and/or charge
during the measuring. In some embodiments, the sensor can comprise
a pair of electrodes. In some embodiments, the sensor may be
electrically coupled to the Debye layer of a surface of the sensor,
the nucleic acid molecule, or a surface coupled to the nucleic acid
molecule.
[0035] In some embodiments, the nucleic acid molecule may be
coupled to a surface at the given site. The surface may be, for
example, a particle or a surface of a well at the site. In some
embodiments, the surface may be removable from the site. In some
embodiments, the nucleic acid molecule may be coupled to the
surface via hybridization with another nucleic acid molecule
coupled to the surface. In some embodiments, the nucleic acid
molecule may be coupled to the surface via a covalent bond. In some
embodiments, the nucleic acid molecule may be coupled to the
surface via a non-covalent interaction.
[0036] An additional aspect of the disclosure provides a system for
data storage. The system can comprise an array of individually
addressable nucleic acid synthesis sites, where an individual
synthesis site of the array synthesizes a nucleic acid molecule
from individual nucleic acid subunits or precursors thereof. The
system can also include a computer processor. The computer
processor can receive bits encoding at least one
computer-executable directive for storing data and can generate a
nucleic acid sequence that encodes the data. The nucleic acid
sequence can comprise nucleic acid subunits that correspond to the
bits. The computer processor can also transmit electrical signals
to the array to generate a nucleic acid molecule having the nucleic
acid sequence at a first site of the array at the exclusion of
generating an additional nucleic acid molecule having the nucleic
acid sequence at a second site of the array.
[0037] In some embodiments, the system can further comprise
computer memory that stores the data and/or the nucleic acid
sequence. In some embodiments, the individual nucleic acid subunits
can be selected from at least two distinct subunits. A subset of
the at least two distinct subunits can correspond to a 1 or 0. In
some embodiments, the individual synthesis site may comprise a pair
of electrodes.
[0038] In some embodiments, the computer processor can transmit
electrical signals to the array to alternately and sequentially
direct the individual nucleic acid subunits or precursors thereof
to the individual synthesis site based on the nucleic acid
sequence. In some embodiments, the computer processor can transmit
electrical signals to the array that exclude the individual nucleic
subunits or precursors from an additional individual synthesis site
of the array. In some embodiments, the individual synthesis site
can be configured to attract a given nucleic acid subunit or
precursor thereof to the individual synthesis site or not repel the
given nucleic acid subunit or precursor thereof from the individual
synthesis site. In some embodiments, an additional individual
synthesis site of the array can be configured to repel the given
nucleic acid subunit or precursor thereof from the additional
individual synthesis site or not attract the given nucleic acid
subunit or precursor thereof to the additional individual synthesis
site.
[0039] In some embodiments, the individual synthesis site can
attract the given nucleic acid subunit or precursor thereof and/or
an additional individual synthesis site of the array can repel the
given nucleic acid subunit or precursor thereof by generating an
electric field. In some embodiments, the system can further
comprise one or more electrodes at the individual synthesis site
and/or the additional individual synthesis site that generate the
electric field.
[0040] In some embodiments, the individual synthesis site can
attract the given nucleic acid subunit or precursor thereof and/or
an additional individual site of the array repels the given nucleic
acid subunit or precursor thereof by generating a magnetic field.
In some embodiments, the system can further comprise one or more
magnetic elements at the individual synthesis site and/or the
additional individual synthesis site that generate the magnetic
field.
[0041] In some embodiments, the system can further comprise a fluid
flow apparatus that can alternately and sequentially direct the
individual nucleic acid subunits or precursors to the individual
synthesis site. In some embodiments, the fluid flow apparatus can
comprise at least one microfluidic channel.
[0042] In some embodiments, the system may further comprise a
reaction surface at the individual synthesis site on which the
nucleic acid molecule can be synthesized. The reaction surface can
be, for example, a particle or a surface of a well at the
individual synthesis site. In some embodiments, the reaction
surface may be removable from the individual synthesis site. In
some embodiments, the reaction surface may be magnetically
immobilized at the individual synthesis site. In some embodiments,
the array may be substantially planar.
[0043] In some embodiments, the individual synthesis site may
comprise a sensor capable of detecting signals indicative of an
impedance change, a charge change, a change in pH, or a change in
temperature associated with one or more nucleic acid molecules at
the individual synthesis site. In some embodiments, the sensor may
comprise a pair of electrodes. In some embodiments, during sensing,
the sensor may be electrically coupled to the Debye layer of a
surface of the sensor, a surface of the one or more nucleic acid
molecules, or a reaction surface coupled to the one or more nucleic
acid molecules.
[0044] An additional aspect of the disclosure provides a system for
accessing data. The system may comprise an array of individually
addressable sites. An individual site of the array can have a
nucleic acid molecule with a sequence of nucleic acid subunits that
corresponds to bits encoding at least one computer-executable
directive for storing data. The system can further comprise a
sensor at the given site that measures signals indicative of an
impedance, conductance and/or charge associated with the nucleic
acid molecule and a computer processor coupled to the sensor. The
computer process can identify the sequence of nucleic acid subunits
from signals received from the sensor; identify the bits from the
sequence of nucleic acid subunits; generate the data from the bits;
and store the data in a memory location.
[0045] In some embodiments, an additional individual site of the
array may not have an additional nucleic acid molecule with the
sequence of nucleic acid subunits. In some embodiments, an
additional individual site of the array may have an additional
nucleic acid molecule with the sequence of nucleic acid subunits.
In some embodiments, the sensor can measure signals indicative of
nucleotide incorporation events during a nucleic acid extension
reaction associated with the nucleic acid molecule. In some
embodiments, the sensor can measure signals indicative of one or
more hybridization events associated with the nucleic acid
molecule.
[0046] In some embodiments, the memory location or an additional
memory location can store the sequence of nucleic acid subunits
identified by the computer processor. In some embodiments, the
nucleic acid subunits may comprise at least two distinct subunits.
A subset of the at least two distinct subunits can correspond to a
1 or 0. In some embodiments, the individual site may comprise a
plurality of nucleic acid molecules comprising the sequence of
nucleic acid subunits. In some embodiments, the computer processor
can assemble the data into a larger piece of data.
[0047] In some embodiments, the nucleic acid molecule may comprise
a primer binding sequence. In some embodiments, the primer binding
sequence can be configured to function as a searchable index. In
some embodiments, the sensor may comprise a pair of electrodes. In
some embodiments, during sensing, the sensor may be electrically
coupled to the Debye layer of a surface of the sensor, the nucleic
acid molecule, or a surface coupled to the nucleic acid
molecule.
[0048] In some embodiments, the nucleic acid molecule may be
coupled to a surface at the individual site. The surface may be,
for example, a particle or a surface of a well at the individual
site. It some embodiments, the surface may be removable from the
individual site. In some embodiments, the nucleic acid molecule may
be coupled to the surface via hybridization with another nucleic
acid molecule coupled to the surface. In some embodiments, the
nucleic acid molecule may be coupled to the surface via a covalent
bond. In some embodiments, the nucleic acid molecule may be coupled
to the surface via a non-covalent interaction.
[0049] An additional aspect of the disclosure provides a method for
managing a database of polynucleotides. The method can comprise
assigning a higher level metadata to each polynucleotide in the
database of polynucleotides. The higher level metadata can be based
on a first unique segment for each polynucleotide. The method can
also include assigning a lower level metadata to polynucleotides in
the database of polynucleotides that have a common higher level
metadata. The lower level metadata can be based on a second unique
segment of the polynucleotides that have a common higher level
metadata.
[0050] An additional aspect of the disclosure provides a system.
The system can comprise a chamber and an input funnel. The chamber
can comprise a first surface having a width (W) and a length (L); a
second surface parallel to the first surface; and a space between
the first surface and the second surface having a height (H). The
space between the first and second surfaces can be configured to
direct fluid flow and H can be less than about 3 millimeters (mm).
The input funnel can have a wide end in fluid communication with
the space between the first surface and the second surface. In
addition, the input funnel can have a narrow end medial to the wide
end and in fluid communication with the wide end. The wide end can
have a first thickness (t.sub.o) at its mid-point, a second
thickness (t.sub.1) at its edges, and a height (h) between the wide
end to the narrow end. In some embodiments, (t.sub.o) may be less
than (t.sub.1).
[0051] In some embodiments, the system can further comprise an
output funnel having a wide end in fluid communication with the
space between the first surface and the second surface. The output
funnel can also include a narrow end in fluid communication with
the wide end. The wide end can have a third thickness (t.sub.2) at
its mid-point and a fourth thickness (t.sub.3) at its edges, and a
height (h.sub.2) between the wide end and the narrow end.
[0052] In some embodiments, the device can be configured to direct
fluid flow through the narrow end of the input funnel, through the
space between the first surface and the second surface, and out of
the narrow end of the output funnel. In some embodiments, the input
funnel may be oriented perpendicularly to the first surface and the
second surface. In some embodiments, the space may be configured to
direct fluid flow such that the fluid flow has a Reynolds number of
less than about 2100. In some embodiments, the space may be
configured to direct fluid flow such that the linear flow rate of
the fluid flow at any two points within the space varies by at most
about 20%. In some embodiments, the space may be configured to
direct fluid flow such that the volumetric flow rate of the fluid
flow at any two points within the space varies by at most about
20%.
[0053] In some embodiments, (H) may be less than about 100
micrometers. In some embodiments, (h) may be about 10 mm. In some
embodiments, the ratio of (t.sub.o)/(t.sub.1) may be less than
about 0.95. In some embodiments, (H) can be about 100 .mu.m,
(t.sub.1) can be about 500 .mu.m, (t.sub.o) can be about 300 .mu.m
and (h) can be about 2 mm. In some embodiments, the chamber can
comprise walls and the walls can be curved. In some embodiments, a
distance from the first surface to the second surface may be
greater proximate to the center of the chamber than at the edges of
the chamber. In some embodiments, the ratio of a distance from the
first surface to the second surface at a point proximate to the
center of the chamber to a distance from the first surface to the
second surface at a point proximate to the edge of the chamber may
be less than about 0.8. In some embodiments, the ratio of a
distance from the first surface to the second surface proximate to
the center of the chamber to (t.sub.o) or (t.sub.1) may be less
than about 0.8. In some embodiments, at least one of (W) or (L) can
be at least about 1 mm.
[0054] An additional aspect of the disclosure provides a system.
The system can comprise a hydrophobic substrate comprising an array
of hydrophilic regions; a plurality of sensors, with at least one
sensor located within or adjacent to each of the hydrophilic
regions; and a magnetic array. At least one magnet of the magnetic
array can be located within, or adjacent to each of the hydrophilic
regions. The sensors can be used for detecting a chemical
reaction.
[0055] In some embodiments, the hydrophobic substrate can be
created by depositing one or more layers of alkylsilane, silicone,
teflon, fluoroalkylsilane, hydrophobic phosophonates, hydrophobic
carboxylates, hydrophobic polycarboxylates, hydrophobic polythiols
or any combination thereof on a surface of a substrate. In some
embodiments, the hydrophilic regions may comprise silicon oxide,
silanes, PEGylated silanes, proteins, dextrans, polysaccharides,
hydrophilic polymers, polyphosponic acids, polyacrylic acids,
zwitterionic polymers or any combination thereof. In some
embodiments, the hydrophilic regions may be ozonized. In some
embodiments, the hydrophilic regions may be patterned by a
photoresist. In some embodiments, the hydrophilic regions may
comprise gold or platinum.
[0056] In some embodiments, the sensors may comprise electrodes. In
some embodiments, there may be at least one electrode per
hydrophilic region. In some embodiments, the system may further
comprise a module for generating droplets of reagents for the
chemical reaction. Such a module, for example, may generate
droplets comprising magnetic beads. In some embodiments, the module
for generating droplets may comprise a single static spray nozzle,
a single movable spray nozzle, a static array of spray nozzles, a
movable array of spray nozzles, an original printer head, or a
modified printer head. In some embodiments, the hydrophobic
substrate may be configured to transport the droplets to the
hydrophilic regions. In some embodiments, the array of hydrophilic
regions may comprise an array of wells. An individual well of the
array of wells can comprise a hydrophilic region.
[0057] An additional aspect of the disclosure provides a method.
The method can comprise providing a chamber comprising an array of
sensors and magnets associated with the sensors. The array can
comprise hydrophobic and hydrophilic regions and the sensors and
magnets can be located within or adjacent to the hydrophilic
regions. The method can further comprise flowing a plurality of
magnetic particles over the array, such that the particles are
immobilized by the magnets to provide immobilized particles. The
method can further comprise flowing a solution containing reagents
over the immobilized particles and generating droplets of the
reagents adjacent to the hydrophilic regions by introducing an
immiscible fluid into the chamber. The method can further comprise
detecting a species in each droplet using the sensors.
[0058] In some embodiments, the immiscible fluid may be air or oil.
In some embodiments, the method may further comprise using a
Peltier device to control a temperature of the chamber and/or
array. In some embodiments, the droplet can have a volume of at
least about 10 picoliters (pL). In some embodiments, droplets can
be placed in a corner of the chamber with a heat source proximate
to the droplets. In some embodiments, the droplets may be isolated
from each other. In some embodiments, the droplets can be generated
by flowing in the solution containing reagents from a first inlet
and flowing in the immiscible fluid from a second inlet. In some
embodiments, flowing the reagents over the particles, generating
droplets of the reagents and detecting a species in the droplets
using the sensors may be repeated for one or more cycles.
[0059] In some embodiments, the reagents may comprise DNA and
repeated flows of solutions comprising DNA and immiscible fluids
may increase the fraction of array locations having DNA. In some
embodiments, the reagents may comprise nucleotides and repeated
flows of nucleotides can result in sequencing of a DNA template at
each array location. In some embodiments, after droplet generation,
the method may further comprise performing a reaction (e.g.,
nucleic acid amplification, nucleic acid sequencing) within each
droplet. In some embodiments, the method may further comprise
detecting the reaction in each droplet using one or more of the
sensors. In some embodiments, the droplets may be transportable by
electrowetting (EW) or by electrowetting on dielectric (EWOD).
[0060] Additional aspects and advantages of the present disclosure
will become readily apparent to those skilled in this art from the
following detailed description, wherein only illustrative
embodiments of the present disclosure are shown and described. As
will be realized, the present disclosure is capable of other and
different embodiments, and its several details are capable of
modifications in various obvious respects, all without departing
from the disclosure. Accordingly, the drawings and description are
to be regarded as illustrative in nature, and not as
restrictive.
INCORPORATION BY REFERENCE
[0061] All publications, patents, and patent applications mentioned
in this specification are herein incorporated by reference to the
same extent as if each individual publication, patent, or patent
application was specifically and individually indicated to be
incorporated by reference. Systems and methods for biological
analysis that can be combined with the present disclosure to yield
additional embodiments of the present disclosure are described in
PCT Patent Application No. PCT/US2011/054769, PCT Patent
Application No. PCT/US2012/039880, PCT Patent Application No.
PCT/US2012/067645, PCT Patent Application No. PCT/US2014/027544,
and U.S. Patent application Ser. No. 13/481,858, each of which is
incorporated herein by reference in its entirety.
BRIEF DESCRIPTION OF THE DRAWINGS
[0062] The novel features of the invention are set forth with
particularity in the appended claims. A better understanding of the
features and advantages of the present invention will be obtained
by reference to the following detailed description that sets forth
illustrative embodiments, in which the principles of the invention
are utilized, and the accompanying drawings (also "figure" and
"FIG." herein), of which:
[0063] FIG. 1 is a schematic of an integrated sequencing
platform.
[0064] FIG. 2A shows a schematic of an example sensor array.
[0065] FIG. 2B shows a schematic of an example sensor array with
carriers immobilized to the array.
[0066] FIG. 2C shows a schematic of an example sensor array with
carriers immobilized to the array and in contact with reagents
suitable for nucleic acid amplification.
[0067] FIG. 2D shows a schematic of an example sensor array where
nucleic acid amplification occurs at each array pixel.
[0068] FIG. 2E shows a schematic example of removing reagents from
an example sensor array.
[0069] FIG. 2F shows a schematic of an example sensor array where
nucleic acids are sequenced at each pixel of the array.
[0070] FIG. 3 shows a biological detection device comprising a
housing, a removable chip and a removable reagent reservoir.
[0071] FIG. 4 is a plot of change in signal (mV, y-axis) versus
nucleic acid bases added (x-axis) during a nucleic acid sequencing
reaction. The data shows a homopolymer read length of about 33 base
pairs.
[0072] FIG. 5 shows a computer system that is programmed or
otherwise configured to control or implement devices, systems and
methods of the present disclosure.
[0073] FIG. 6A shows an array of individually addressable
pixels.
[0074] FIG. 6B shows a close up view of a pixel of FIG. 6A.
[0075] FIG. 6C shows a sorting function via individually
addressable pixels.
[0076] FIG. 7 shows an electric "gate" associated with a pixel.
[0077] FIG. 8A shows primer labels and associated DNA for DNA
indexing.
[0078] FIG. 8B shows a DNA molecule with primer labels bound to
beads for DNA indexing and the injection of C', a complimentary
sequence to Primer C.
[0079] FIG. 8C shows the detection of a DNA of interest via
hybridization of a complimentary primer.
[0080] FIG. 9A shows sequences I, II, and III used for
sub-indexing.
[0081] FIG. 9B shows a DNA molecule with sub-index sequences I, II,
and III with primer labels bound to beads for DNA sub-indexing and
the injection of a complimentary sequence to sequence II (II').
[0082] FIG. 9C shows the detection and DNA "reading" associated
with a sequence sub-index and the portion of interest of the
DNA.
[0083] FIG. 10A shows DNA from an array being stored in a tube.
[0084] FIG. 10B shows DNA from an array being stored in an array of
wells.
[0085] FIG. 10C shows an overview of a DNA writing, DNA storage,
and DNA reading system.
[0086] FIG. 11A shows one embodiment of a microfluidic
semiconductor package.
[0087] FIG. 11B shows a top view of the embodiment of FIG. 11A of a
microfluidic semiconductor package.
[0088] FIG. 11C shows a top view of a cut-out printed circuit board
and associated heat sink in the embodiment of FIG. 11A.
[0089] FIG. 11D shows another embodiment of a microfluidic
semiconductor package with a heat sink that includes fins.
[0090] FIG. 12 shows a diagram of an exemplary reagent input device
including a cartridge that houses reagent bags.
[0091] FIG. 13A shows a diagram of a close-up side view of the
exemplary reagent input device of FIG. 12.
[0092] FIG. 13B illustrates a close-up, expanded view of one
embodiment of a seal contained in the reagent input device.
[0093] FIG. 14 shows a top view of a reagent input cartridge with a
double chamber configuration.
[0094] FIG. 15 shows a diagram of an exemplary reagent input device
with a cartridge that houses flexible reagent containers.
[0095] FIG. 16 shows a diagram of an exemplary reagent input device
with a cartridge that houses flexible reagent containers or reagent
bags where each container and/or bag contains a balloon for mixing
reagents.
[0096] FIG. 17 shows four different embodiments of a manifold
design for transporting reagents and other moieties through a
microfluidic device.
[0097] FIG. 18 shows a photograph of one embodiment of a
manifold.
[0098] FIG. 19 shows one embodiment of a manifold design with
associated valves.
[0099] FIG. 20 shows one embodiment of a tubeless system where
there is a direct connection between a manifold and a cartridge by
use of o-rings.
[0100] FIG. 21A shows an example of sequencing data acquired from a
run without a washing script.
[0101] FIG. 21B shows an example of sequencing data acquired from a
run with a washing script.
[0102] FIG. 22 shows an exemplary embodiment of a push-to-connect
connector system for fluid (or gas) transfer.
[0103] FIG. 23A shows a more detailed view of the push-to-connect
connector system of FIG. 22.
[0104] FIG. 23B shows one step in the process of using the
exemplary push-to-connect connector system of FIG. 22.
[0105] FIG. 23C shows another step in the process of using the
exemplary push-to-connect connector system of FIG. 22 such that the
fluid (or gas) is transferred.
[0106] FIG. 23D shows one embodiment of a cross section of a fluid
transfer pin.
[0107] FIG. 24A shows on embodiment of a fluid cartridge integrated
with female connectors.
[0108] FIG. 24B shows an embodiment of reservoirs located in a
fluid cartridge.
[0109] FIG. 25 shows an example of a lid device for a microfluidic
system.
[0110] FIG. 26 shows another example of a lid device for a
microfluidic system.
[0111] FIG. 27A shows an exemplary embodiment of a substantially
planar nano-sensor array where the nano-sensors are electrodes.
[0112] FIG. 27B shows the array of FIG. 27A where the electrodes
generate air bubbles due to an applied voltage.
[0113] FIG. 27C shows the array of FIG. 27B after some time has
passed and the air bubble has grown.
[0114] FIG. 27D shows the collapse of the air bubble proximate to a
bead, thereby displacing the bead.
[0115] FIG. 27E shows the displaced bead travelling through the
microfluidic device as a result of the collapse.
[0116] FIG. 28A shows an exemplary pixel in the array and potential
components.
[0117] FIG. 28B shows the out electrodes of an exemplary pixel
generating air bubbles for pixel isolation and/or confinement of
reagents/moieties.
[0118] FIG. 29A shows one embodiment of an air bubble generated by
an electrode used as a "gate" for an array of wells.
[0119] FIG. 29B shows a vertical embodiment of FIG. 29A.
[0120] FIG. 30A shows a charged protein structure attached to an
upper electrode proximate to an array of wells.
[0121] FIG. 30B shows an electrically activated charged protein
structure used to "gate" a well.
[0122] FIG. 31A shows one embodiment of an asymmetric bead and the
resulting electric field lines.
[0123] FIG. 31B shows another embodiment of an asymmetric bead and
the resulting electric field lines where there is an associated
combined electrode-magnet structure.
[0124] FIG. 32A shows an exemplary embodiment of a top view of a
reactor-sensor array according to the systems described herein.
[0125] FIG. 32B shows one embodiment of a zoomed out view of a
reactor-sensor array.
[0126] FIG. 32C shows a photograph of the reactor-sensor array
shown in FIGS. 32A-32B.
[0127] FIG. 32D shows a zoomed in view of the photograph of the
reactor-sensor array
[0128] FIG. 33A shows one embodiment of a side view of the
beginning of the droplet-based emulsion-free amplification
process.
[0129] FIG. 33B illustrates in one embodiment the amplicons
generated as a result of multiple cycles of a droplet-based
emulsion-free amplification process.
[0130] FIG. 34 shows a diagram of the droplet diameter and
associated contact angle.
[0131] FIG. 35 shows one embodiment of droplet creation using a
spray nozzle device where the sprayed fluid accumulates into
droplets in the hydrophilic pixels locations.
[0132] FIG. 36 shows another embodiment of droplet creation using a
spray nozzle device where the device sprays uniformly sized
droplets onto each hydrophilic pixel location.
[0133] FIG. 37A shows an embodiment of a device for "printing"
droplets that moves along the chamber and places one droplet in
each pixel.
[0134] FIG. 37B shows an embodiment of a device for "printing"
droplets, each of which contain reaction materials as well as
beads, that moves along the chamber and places one droplet (with
beads) in each pixel.
[0135] FIG. 37C shows an embodiment of a device for "printing"
droplets, each of which contain reaction materials as well as
beads, that moves along the chamber and places one droplet in each
pixel, where there is no need for patterned hydrophilic pixels.
[0136] FIG. 38 shows an embodiment where each pixel has a
corresponding droplet "printer".
[0137] FIG. 39 shows an embodiment where droplets may be created by
pushing fluid from a channel perpendicular to the chamber where the
chamber has air or oil flowing against the fluid to create
droplets, which then get deposited on different pixel locations on
the array which have the beads or other amplifying surface.
[0138] FIG. 40A shows an embodiment where each pixel has a magnet
and bead on the hydrophilic region, and the chamber volume is
filled with a aqueous solution (e.g., containing reaction
material).
[0139] FIG. 40B shows a step following FIG. 40A, where air or an
immiscible liquid such as oil is flown through the chamber, leading
to droplets of the aqueous solution, (e.g., containing reaction
material), to form on the hydrophilic pixels.
[0140] FIG. 41 shows one embodiment of a single pixel of the
reactor-sensor array, where there are electronic sensors and/or
magnets placed on the chip surface and a bead is deposited on top
of the magnet and electrodes.
[0141] FIG. 42A shows one embodiment where droplets, (e.g.,
containing reaction material and beads), are generated in one
region of the chip and the droplets are moved to a specific
location of the chip using an electrowetting mechanism.
[0142] FIG. 42B shows the intermediated state following several
rounds of droplet movement as described in FIG. 42A, resulting in
the deposition of an array of droplets at the different pixel
locations.
[0143] FIG. 43A shows the side view of an embodiment where the chip
surface contains a number of wells, with a bead and reaction
materials inside each well and reaction materials are flowed into
the chip chamber and air (e.g., water-saturated air) or an
immiscible fluid like oil is flowed through the chamber to remove
all but the materials inside the wells.
[0144] FIG. 43B shows the top view of one embodiment of FIG. 43A,
where the wells are circular in cross-section.
[0145] FIG. 43C shows the top view of one embodiment of FIG. 43A,
where the wells are square-shaped in cross-section.
[0146] FIG. 43D shows the top view of one embodiment of FIG. 43A,
where the wells have a polygonal cross-section, in particular
hexagonal in this figure.
[0147] FIG. 44A shows an array of reactors that can be used for
amplification of a DNA template as well as sequencing on the same
chip.
[0148] FIG. 44B shows a method for generating clonally amplified
templates using the array of FIG. 44A.
[0149] FIG. 44C shows a method for sequencing by synthesis using
the array of FIG. 44A.
[0150] FIG. 45 shows a diagram of an exemplary microfluidic chamber
device.
[0151] FIG. 46A shows variations on possibilities for sloping the
height of the chamber ceiling.
[0152] FIG. 46B shows, in one embodiment, two side view of a
chamber with a sloping ceiling.
[0153] FIG. 46C shows a top view of the flow profile of
microfluidic chambers with varying chamber heights near the middle
of the chamber.
[0154] FIG. 46D shows one embodiment where the inlet and outlet are
located proximate to the sides of the chamber.
[0155] FIG. 47 shows a simulation, after particles are introduced
through inlet into the microfluidic chamber, where the height of
the chamber at or around the midpoint is 60 microns (um).
[0156] FIG. 48 shows a simulation, after particles are introduced
into the microfluidic chamber through an inlet, where the height of
the chamber at the midpoint is 120 um.
[0157] FIG. 49A shows an alternative embodiment of a microfluidic
chamber where an inlet and an outlet have a funnel shape.
[0158] FIG. 49B shows the microfluidic chamber of FIG. 49A with the
associated flow lines.
[0159] FIG. 49C illustrates, one embodiment of a microfluidic
chamber with a funnel shaped inlet and outlet, where the funnel
portion is placed horizontally.
[0160] FIG. 49D shows another embodiment of a microfluidic chamber
with a funnel shaped inlet and outlet, where the funnel portion is
placed vertically.
[0161] FIG. 50 illustrates the relationship between chamber height
at the center and the ratio between the maximum and minimum
velocity within the chamber.
[0162] FIG. 51 shows three different exemplary embodiments with
chamber of differing heights at or around the middle portion of the
chamber.
[0163] FIG. 52 shows a diagram of a microfluidic chamber device
with dimensions.
[0164] FIG. 53A shows two flow profiles along the channel width for
a microfluidic chamber having a funnel of uniform thickness.
[0165] FIG. 53B shows two flow profiles along the channel length
for a microfluidic chamber having a funnel of uniform
thickness.
[0166] FIG. 54A shows two flow profiles along the channel width for
a microfluidic chamber having a funnel of non-uniform
thickness.
[0167] FIG. 54B shows two flow profiles along the channel length
for a microfluidic chamber having a funnel of non-uniform
thickness.
[0168] FIG. 55 shows a schematic drawing of a device for testing
electrical properties and hermeticity of a microfluidic device.
[0169] FIG. 56 shows a device for testing electrical properties and
hermeticity of a microfluidic device.
DETAILED DESCRIPTION
[0170] While various embodiments of the invention have been shown
and described herein, it will be obvious to those skilled in the
art that such embodiments are provided by way of example only.
Numerous variations, changes, and substitutions may occur to those
skilled in the art without departing from the invention. It should
be understood that various alternatives to the embodiments of the
invention described herein may be employed.
[0171] The term "adjacent to," as used herein, generally means next
to, in proximity to, or in sensing or electronic vicinity (or
proximity) of. For example, a first object adjacent to a second
object can be in contact with the second object, or may not be in
contact with the second object but may be in proximity to the
second object. In some examples, a first object adjacent to a
second object is within about 0 micrometers ("microns"), 0.001
microns, 0.01 microns, 0.1 microns, 0.2 microns, 0.3 microns, 0.4
microns, 0.5 microns, 1 micron, 2 microns, 3 microns, 4 microns, 5
microns, 10 microns, or 100 microns of the second object.
[0172] The present disclosure provides a system that can employ the
use of nucleic acid molecules for data storage. The system can
include a solid state substrate with locations on the substrate for
containing biological and/or chemical matter. The locations on the
substrate may be referred to as "pixels" and each individual pixel
is arranged such that the substrate has an array of pixels.
[0173] The term "nucleic acid," as used herein, generally refers to
a molecule comprising one or more nucleic acid subunits. A nucleic
acid may include one or more subunits selected from adenosine (A),
cytosine (C), guanine (G), thymine (T) and uracil (U), or variants
thereof. A nucleotide can include A, C, G, T or U, or variants
thereof. A nucleotide can include any subunit that can be
incorporated into a growing nucleic acid strand. Such subunit can
be an A, C, G, T, or U, or any other subunit that is specific to
one or more complementary A, C, G, T or U, or complementary to a
purine (i.e., A or G, or variant thereof) or a pyrimidine (i.e., C,
T or U, or variant thereof). In some examples, a nucleic acid is
deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or derivatives
or variants thereof. A nucleic acid may be single-stranded or
double stranded. In some cases, a nucleic acid molecule is
circular.
[0174] The terms "nucleic acid molecule," "nucleic acid sequence,"
"nucleic acid fragment," "oligonucleotide" and "polynucleotide," as
used herein, generally refer to a polymeric form of nucleotides
that may have various lengths, either deoxyribonucleotides (DNA) or
ribonucleotides (RNA), or analogs thereof. An oligonucleotide is
typically composed of a specific sequence of four nucleotide bases:
adenine (A); cytosine (C); guanine (G); and thymine (T) (uracil (U)
for thymine (T) when the polynucleotide is RNA). Thus, the term
"oligonucleotide sequence" is the alphabetical representation of a
polynucleotide molecule; alternatively, the term may be applied to
the polynucleotide molecule itself. This alphabetical
representation can be input into databases in a computer having a
central processing unit and used for bioinformatics applications
such as functional genomics and homology searching.
Oligonucleotides may include one or more non-standard
nucleotide(s), nucleotide analog(s) and/or modified
nucleotides.
[0175] Examples of modified nucleotides include, but are not
limited to diaminopurine, 5-fluorouracil, 5-bromouracil,
5-chlorouracil, 5-iodouracil, hypoxanthine, xantine,
4-acetylcytosine, 5-(carboxyhydroxylmethyl)uracil,
5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-D46-isopentenyladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, 2,6-diaminopurine
and the like. Nucleic acid molecules may also be modified at the
base moiety (e.g., at one or more atoms that typically are
available to form a hydrogen bond with a complementary nucleotide
and/or at one or more atoms that are not typically capable of
forming a hydrogen bond with a complementary nucleotide), sugar
moiety or phosphate backbone. Nucleic acid molecules may also
contain amine -modified groups, such as aminoallyl-dUTP (aa-dUTP)
and aminohexhylacrylamide-dCTP (aha-dCTP) to allow covalent
attachment of amine reactive moieties, such as N-hydroxy
succinimide esters (NHS). Alternatives to standard DNA base pairs
or RNA base pairs in the oligonucleotides of the present disclosure
can provide higher density in bits per cubic mm, higher safety
(resistant to accidental or purposeful synthesis of natural
toxins), easier discrimination in photo-programmed polymerases, or
lower secondary structure. Such alternative base pairs compatible
with natural and mutant polymerases for de novo and/or
amplification synthesis are described in Betz K, Malyshev D A,
Lavergne T, Welte W, Diederichs K, Dwyer T J, Ordoukhanian P,
Romesberg F E, Marx A (2012).
[0176] The term "polymerase,' as used herein, generally refers to
any enzyme capable of catalyzing a polymerization reaction.
Examples of polymerases include, without limitation, a nucleic acid
polymerase. A polymerase can be a polymerization enzyme. In some
cases, a transcriptase or a ligase is used (i.e., enzymes which
catalyze the formation of a bond).
Integrated Sequencing Platforms
[0177] An integrated sequencing platform may include a nucleic acid
(e.g., DNA) extraction system, a library construction system, an
amplification system, an enrichment system, and a sequencing
system. In some embodiments the systems may be separate and/or in
modular format. In some embodiments, the integrated sequencing
platform can include one, two, three, four, or all five of these
systems. In some cases, the systems can be integrated within a
single microfluidic device and/or a single array (e.g., a re-usable
array). An example of such an integrated platform is depicted in
FIG. 1. Additional examples of such integrated sequencing platforms
can be found in PCT Patent Application No. PCT/US2011/054769, PCT
Patent Application No. PCT/US2012/039880, PCT Patent Application
No. PCT/US2012/067645, PCT Patent Application No.
PCT/US2014/027544, and U.S. patent application Ser. No. 13/481,858,
each of which is incorporated herein by reference in its
entirety.
[0178] An integrated system may comprise a library construction
system (e.g., nucleic acid library construction system), which may
include a fragmentation and/or size selection element. An example
of a library construction system is shown in FIG. 1. As shown in
FIG. 1, a library construction system may include a nucleic acid
(e.g., DNA) fragmentation and size selection element 116. The
fragmentation and size selection element 116 can be configured to
produce double-stranded nucleic acid fragments, which may or may
not have blunted ends, via the elements and methods described
below. The fragmentation and size selection element 116 can include
one or more microfluidic channels 122 within which nucleic acid may
be disposed along with a set of fragmentation beads 124. Nucleic
acid 112 collected in a nucleic acid (e.g., DNA) extraction system
(shown for example in FIG. 1) can be conveyed or "injected" into
the nucleic acid (e.g., DNA) fragmentation and size selection
element 116 by any suitable method (e.g., pressurized injection,
electrophoretic movement, gravity feed, heat-induced movement,
ultrasonic movement and/or the like). Similarly, fragmentation
beads 124 can be conveyed into the nucleic acid (e.g., DNA)
fragmentation element and size selection element 116 by any
suitable method.
[0179] The fragmentation element and/or size selection element 116
may include a pump 126 to produce movement of a fluid (e.g., a
fluid comprising nucleic acid (e.g., DNA) and fragmentation beads
124) within a microfluidic channel 122. The pump 126 can be, for
example, a peristaltic pump. In some embodiments, the pump 126 can
include one or more microfluidic elements in fluid communication
with the microfluidic channel 122, and may have a flexible
side-wall that, when deformed, produces a flow within the
microfluidic channel 122. In other embodiments, however, any other
suitable mechanism can be used as an alternative or in addition to
produce movement fluid within the microfluidic channel 122, with
non-limiting examples, that include selective heating and cooling
of the fluid, pneumatic pressurization of the microfluidic channel,
electrophoretic motion, or the like.
[0180] The fragmentation beads 124 can be constructed from any
material suitable for separating, cutting and/or otherwise dividing
a nucleic acid (e.g., DNA) into nucleic acid fragments (e.g., DNA
fragments). In some embodiments, the fragmentation beads 124 can be
constructed from glass, polydimethylsiloxane (PDMS), ceramic or the
like. Moreover, the fragmentation beads 124 can have any suitable
size and/or geometry such that the fragmentation element produces
fragments having the desired characteristics (e.g., length, strand
characteristics, or the like). For example, in some embodiments,
the fragmentation beads 124 can be substantially spherical and can
have a diameter of 50 .mu.m or less. In other embodiments, the
fragmentation beads can have a diameter of 500 nm or less, or any
diameter between 50 .mu.m and 500 nm.
[0181] Moreover, the size and/or geometry of the microfluidic
channel 122 (e.g., cross-sectional shape, aspect ratio or the like)
can be selected such that the movement of the nucleic acid (e.g.,
DNA) within the microfluidic channel 122 and contact of the nucleic
acid with the fragmentation beads 124 fragments (e.g., via
shearing) the nucleic acid as desired. In some embodiments, the
microfluidic channel 122 may be in the range of 1 to 500 .mu.m in
hydraulic diameter (i.e., the cross-sectional area of the
microfluidic channel 122 can be substantially rectangular, thus the
size can be represented as a hydraulic diameter). In other
embodiments, the hydraulic diameter of the microfluidic channel 122
can be in the range of 10 to 200 .mu.m. In yet other embodiments,
the hydraulic diameter of the microfluidic channel 122 can be in
the range of 500 nm or less. In other embodiments, the microfluidic
channel 122 can have any suitable shape, such as semi-circular,
oval, tapered or the like. In some embodiments enzymatic polishing
of sheared nucleic acid (e.g., DNA) ends can be done such that the
ends are blunt ends.
[0182] In other embodiments, an enzymatic solution can be conveyed
into the microfluidic channel 122 to, at least partially, produce
enzymatic fragmentation of nucleic acid (e.g., DNA).
[0183] In some embodiments, nucleic acid (e.g., deoxyribonucleic
acid (DNA)) amplification and sequencing may be performed
sequentially within the same system. In such cases, sample nucleic
acid may be associated with a plurality of carriers, such as, for
example, beads or other types of particles. In some cases, the
carriers may be magnetic carriers, such as, for example, magnetic
beads or paramagnetic beads. In some cases, the magnetic carriers
can be entered into an array (e.g., a substantially planar array
comprising a substantially planar substrate) of magnetic features
such that the magnetic carriers are held in place by a localized
magnetic field at each position (e.g., pixel) of the array. In some
embodiments, carriers (including magnetic carriers) can be held in
place at each position of an array (e.g., a substantially planar
array) by electrostatic force via one or more electrodes due to the
charge of the carrier or the associated nucleic acid. In other
embodiments, the carriers can be held in place at each position of
the array by physical trenches or wells. In some embodiments, the
carriers can be held in place at each position of the array by
interaction of a species bound to the carrier with a species bound
to the array (e.g., hybridization of oligonucleotides or via
ligand-capture moiety pairs). Upon immobilization of the carriers
to an array, amplification of the associated nucleic acid and
sequencing of the amplified nucleic acid can be completed
sequentially or simultaneously.
[0184] In some embodiments, carriers may be first entered into an
array (e.g., via flow through microfluidic channels associated with
the array) and captured by the array. After carrier capture, sample
nucleic acid may be contacted with the array (e.g., via flow
through microfluidic channels associated with the array) and
subsequently captured by the carriers. Capture may occur, for
example, via nucleic acids associated with the carriers and capable
of hybridizing with the sample nucleic acid. Such nucleic acids may
also be used as primers for amplification reactions described
elsewhere herein. In some embodiments, nucleic acid to be amplified
and/or sequenced is associated with carriers prior to their capture
by an array.
[0185] Alternatively, a surface of the array (e.g., sensor surface,
array substrate surface, etc.) may comprise elements suitable for
capturing sample nucleic acid, including nucleic acids capable of
hybridizing with the sample nucleic acid. Such nucleic acids may
also be capable of serving as primers for amplification reactions
described elsewhere herein. Such a configuration may be suitable
for amplifying and sequencing a nucleic acid in the absence of a
carrier.
[0186] In some embodiments, the sample nucleic acid may be provided
to an array at extremely dilute concentrations in order to obtain a
desired ratio of molecules of sample nucleic acid to carrier. For
example, ratios of one molecule of nucleic acid for one carrier
(e.g., bead), one molecule of nucleic acid for two carriers, one
molecule of nucleic acid for three carriers, one molecule of
nucleic acid for five beads, or less, etc may be desired.
[0187] During amplification reactions, one or more electrodes at a
sensor position of the array may be used for concentration of
reagents useful for nucleic acid amplification, forming a "virtual
well" associated with a carrier, sensor, or substrate at the array
position via an electric field. Virtual wells can permit
amplification of nucleic acids at a sensor position without
cross-contamination of reactants with those of other sensors of the
array. In certain embodiments, amplification within a virtual well
can generate a clonal population of nucleic acid associated with a
carrier, sensor surface, or substrate associated with the virtual
well.
[0188] Nucleic acid amplification may be performed in multiple
cycles if desired. Once a first round of amplification is completed
after contacting an array with sample nucleic acid, an array may be
washed in order to remove any unbound amplicons and other reagents
in solution. Following washing, a second round of amplification may
be completed, by contacting the array with sample nucleic acid and
subjecting captured sample nucleic acid to appropriate conditions.
Where clonal populations are generated, the sample may bind only to
sites (e.g., carriers, sensor surfaces, etc.) not already
comprising amplicons, as sites with amplicons from first round of
amplification may be fully loaded amplicons. The process may be
repeated for any number of amplification cycles until capture sites
are exhausted. Utilizing multiple rounds of amplification may help
eliminate double Poisson distribution problems and help ensure that
each sensor site is associated with only nucleic acid sequence,
such as a clonal population of amplicons attached to a carrier.
Moreover, multiple rounds of amplification may also help maximize
the use of an array, as each round of amplification can better
ensure that all of the pixels of the array of occupied with
amplicons for sequencing.
[0189] Moreover, during sequencing reactions, one or more of the
same electrodes and/or different electrodes may be used to detect a
reaction of interest, such as nucleotide incorporation. In some
cases, sensing may be completed using a NanoNeedle and/or
NanoBridge sensor, or other electrical or optical sensors suitable
for detection. A NanoBridge sensor may function as a pH or charge
sensor, as described in U.S. Published Patent Application No. US
2012/0138460, titled "BIOSENSOR DEVICES, SYSTEMS AND METHODS
THEREFOR", which is incorporated herein by reference in its
entirety. A sensor (e.g., NanoNeedle sensor) may function as a
charge, conductivity and/or impedance sensor, as described in PCT
Patent Application No. PCT/US2011/054769, PCT Patent Application
No. PCT/US2012/039880, PCT Patent Application No.
PCT/US2012/067645, PCT Patent Application No. PCT/US2014/027544,
and U.S. patent application Ser. No. 13/481,858, each of which is
incorporated herein by reference in its entirety. In some
embodiments, a sequencing reaction of interest may be DNA
sequencing.
[0190] The detection may be based on at least one of local pH
change, local impedance change, local heat detection, local
capacitance change, local charge concentration (or change thereof),
and local conductivity change. In some embodiments, detection may
be based on a local conductivity change, local impedance change,
local capacitance change, local charge concentration (or change
thereof) of a carrier, a nucleic acid, or other analyte associated
with the carrier and/or a sensor. Such measurements may be made by
directly detecting (or detecting signals that are indicative of) a
local pH change, local impedance change, local heat detection,
local capacitance change, local charge concentration (or change
thereof), and local conductivity change, such as local conductivity
change of a carrier, a nucleic acid (or other analyte) associated
with the carrier and/or a sensor. In some cases, detection occurs
within the Debye length (e.g., Debye layer) of (i) a carrier, (ii)
a nucleic acid associated with a carrier or sensor, and/or (iii) a
sensor. Such a sensor configuration is described, for example, in
PCT Patent Application No. PCT/US2011/054769, PCT Patent
Application No. PCT/US2012/039880, PCT Patent Application No.
PCT/US2012/067645, PCT Patent Application No. PCT/US2014/027544,
and U.S. patent application Ser. No. 13/481,858, each of which is
incorporated herein by reference in its entirety.
[0191] Following the completion of sequencing, carriers/nucleic
acids may be dissociated from the array, the carriers and array
optionally separated from bound species and washed, and either or
both of the carriers and array subsequently re-used for another
round of amplification and/or sequencing. Dissociation of a carrier
from the array may be completed, for example, by removal/reversal
of a magnetic and/or electric field used to hold the carrier in
place. In addition or as an alternative, fluid flow and/or other
type of field (e.g., external magnetic field, external electric
field) capable of exerting forces sufficient for overcoming
magnetic and/or electrostatic forces used to hold a carrier in
place may also be used to dissociate the carrier from an array.
Where nucleic acids are directly associated with the array, in the
absence of a carrier, the array may be treated with appropriate
reagents or energy (e.g., enzymatic reagents, chemical reagents,
thermal energy, etc.) to remove bound nucleic acids from the array.
In some cases, though, it may be desirable to remove a carrier or
nucleic acid from an array prior to amplification and/or
sequencing. Such removal can be achieved in analogous fashion as
described herein.
[0192] In some embodiments, a combined amplification and sequencing
system may comprise a magnetic array that can trap a magnetic bead
or particle by magnetic force at a plurality of the array
positions. In some cases, a magnetic bead may be a paramagnetic
bead. Each of the array positions may also comprise electrodes
capable of producing electric fields and/or functioning as sensors.
Each magnetic bead or particle can comprise a nucleic acid (e.g.,
DNA) segment that may be clonally amplified, for example, with the
aid of electric fields generated by one or more of the electrodes
at each array position.
[0193] In some embodiments, a combined amplification and sequencing
system may comprise an array of electrodes that can trap a magnetic
bead or particle by electrostatic force at a plurality of the array
positions. In some cases, a magnetic bead may be a paramagnetic
bead. One or more of the same electrodes or different electrodes at
each of the array positions may also be capable of producing
electric fields and/or functioning as sensors. Each magnetic bead
or particle can comprise a nucleic acid (e.g., DNA) segment that
may be clonally amplified, for example, with the aid of electric
fields generated by one or more of the electrodes at each array
position.
[0194] An example of a combined amplification and sequencing system
and use of the example system is depicted in FIG. 2. As shown in
FIG. 2A, the system 200 may include an array on a substrate 201
that can comprise sensors (e.g., nanosensors) 205 sometimes in
communication with microfluidic channels defined within the
platform. Sensors 205 may be associated with substrate 201, and
substrate 201 may also be associated with magnetic 210 and
electrode 205 and 207 elements. Magnetic beads may be positioned
over the sensors 205 by magnetic 210 or electrode 205 and 207
elements. The magnetic elements may form localized magnetic fields
and the electrode elements may form localized electric fields in
order to position a carrier at each sensor 205 of the array.
Moreover, the magnetic and/or electric fields may create an area of
confinement for carriers at each position of the array.
[0195] As shown in FIG. 2B, a sample comprising DNA 240 (e.g., DNA
fragments) may be conveyed into the system 200. As can be
appreciated, DNA 240 is shown as an example and could be any
suitable type of nucleic acid, including types of nucleic acids
described elsewhere herein. In some cases, introduction of the DNA
240 may be via microfluidic channels associated with the array. As
shown, the array may be configured with pre-localized magnetic
beads 220 and the magnetic beads may be associated with primers
capable of hybridizing with DNA 240, such that DNA 240 is captured
by and becomes associated with the beads 220. The magnetic beads
220 may be positioned on the array via the magnetic elements 210
and/or electrode 205 and 207 elements. Alternatively or in
addition, primers may be attached, bound, or associated with a
sensor at a position of the array and used to trap DNA 240 at the
sensor.
[0196] As shown in FIG. 2C, reagents 260 (e.g., polymerase,
deoxyribonucleotides (dNTPs), and additional primers) may be
simultaneously, previously, or subsequently introduced to the
array. In some cases, introduction of the reagents 260 may be via
flow through microfluidic channels associated with the array, such
that the reagents 260 are contacted with the magnetic beads 220 via
flow. Via magnetic and/or electrostatic forces from the appropriate
array elements, the magnetic beads 220 can be maintained in the
desired position as reagents 260 make contact with the magnetic
beads 220 via flow.
[0197] As shown in FIG. 2D, the DNA 240 associated with magnetic
beads 220 can be clonally amplified to produce amplified DNA 245
and 255 on the surface of the magnetic beads 220. Clonal
amplification may be completed using any suitable method including
a polymerase chain reaction (PCR), a primer extension reaction,
isothermal amplification, or other techniques.
[0198] As shown in FIG. 2E, the magnetic beads 220 in the array may
be washed 280, removing unbound amplicons 245 and reagents 260 in
solution following amplification of DNA 240. The result can be
magnetic beads 220 comprising clonal sets of amplified DNA 255
associated with array positions. Washing 280 may be completed by
any suitable method, such as, for example, washing with a buffer
solution at a flow rate sufficient to remove the unbound amplicons
245 and reagents 260 in solution, but insufficient to detach the
magnetic beads 220 from their respective positions on the
array.
[0199] As shown in FIG. 2F, another aliquot of reagents 260 (e.g.,
polymerase, primers, etc.) and sequential cycles of individual
dNTPs 285 may then be contacted (e.g., via flow) with the sensor
array, permitting incorporation of the dNTPs into the amplified DNA
255 of magnetic beads 220. dNTPs may be introduced in individual
cycles, (e.g., cycle 1=A, cycle 2=T, etc). where there may be a
wash step with buffer in between each cycle to help reduce the
chance of contamination from unincorporated nucleotides. Polymerase
used for the sequencing reaction, may be the same type of
polymerase that is used for the amplification reaction, or may be a
different type of polymerase, and can be introduced prior to or
with introduction of the dNTPs. Detection of the incorporated dNTPs
during each cycle can be used to sequence the amplified DNA 255,
and, thus, the original sample DNA 240. Detection may occur, for
example, via one or both of electrodes 205 and 207. In some cases,
electrodes 205 and 207 can detect nucleotide incorporation events
by measuring local impedance changes of the magnetic beads 220
and/or the amplified DNA (or other nucleic acid) 255 associated
with the magnetic beads 220. Such measurement can be made, for
example, by directly measuring local impedance change or measuring
a signal that is indicative of local impedance change. In some
cases, detection of impedance occurs within the Debye length (e.g.,
Debye layer) of the magnetic beads 220 and/or the amplified DNA 255
associated with the magnetic beads 220. Nucleotide incorporation
events may also be measured by directly measuring a local charge
change or local conductivity change or a signal that is indicative
of one or more of these as described elsewhere herein. Detection of
charge change or conductivity change can occur within the Debye
length (e.g., Debye layer) of the magnetic beads 220 and/or
amplified DNA 255 associated with the magnetic beads 220.
[0200] Additional examples of combined amplification and sequencing
systems, for example, may be found in PCT Patent Application No.
PCT/US2011/054769, PCT Patent Application No. PCT/US2012/039880,
PCT Patent Application No. PCT/US2012/067645, PCT Patent
Application No. PCT/US2014/027544, and U.S. patent application Ser.
No. 13/481,858, which are incorporated herein by reference in their
entireties.
[0201] In some embodiments, after amplification of sample nucleic
acid onto carriers, but before sequencing, the carriers subjected
to amplification conditions may be sorted in an enrichment system,
such as, for example, an electrophoretic sorter, where sorting is
achieved via electrophoretic force applied to carriers. The
electrophoretic sorter may be part of a system used to conduct
amplification and sequencing, or it may be part of a different
system. In the electrophoretic sorter, null carriers (e.g.,
carriers without amplicons), as well as carriers subject to
incomplete amplification or those comprising overly short
amplicons, can be sorted from carriers comprising the desired
amplicons. Additional examples of enrichment systems and
electrophoretic sorters are described in PCT Patent Application No.
PCT/US2011/054769, PCT Patent Application No. PCT/US2012/039880,
PCT Patent Application No. PCT/US2012/067645, PCT Patent
Application No. PCT/US2014/027544, and U.S. patent application Ser.
No. 13/481,858, which are incorporated herein by reference in their
entireties.
[0202] An electrophoretic sorter may comprise channels capable of
accepting sorted carriers. Carriers (e.g., beads) with appropriate
amounts of amplified product and with amplicons of adequate length
may have sufficient charge to be pulled off to an outlet channel.
Where the electrophoretic sorter is a separate system, such
carriers can be collected from the outlet channel and provided back
into the amplification/sequencing system for sequencing, where the
steps of introducing reagents and detecting nucleotide
incorporation events may occur as described above.
[0203] Carriers (e.g., beads) without appropriate amounts of
amplified product and/or without amplicons of adequate length may
flow through the electrophoretic sorter and, instead, be directed
into a waste channel. The carriers may be collected from the waste
channel and may be reused for another cycle of amplification or
other purpose upon appropriate cleaning to remove any undesirable
species. For example, carriers may be washed with a bleaching
agent, such as hydrogen peroxide, to help ensure that no
contaminants remain on the carriers so that they may be reused.
[0204] The arrays and methods described herein can be used for a
variety of applications and detection of different biological or
biochemical moieties in addition to nucleic acids, such as
antibody-antigen detection, protein detection, cell analysis,
drug-discovery or screening, ligand, small molecules or other types
of analysis. Moreover, the devices and methods described herein are
not limited to DNA applications, and may be used for reactions and
analysis of interest for RNA, protein detection, small molecules,
etc. or other biomolecules.
[0205] In addition to sequencing reactions and/or nucleotide
incorporation events, arrays and associated sensors may also be
useful in sensing other biomolecules (e.g., oligonucleotides,
proteins, small molecules, peptides, etc.) and/or reactions of
interest using any of the methods and devices described herein,
including directly measuring local impedance change, local charge
change or local change in conductivity or measuring a signal that
is indicative of local impedance change, local charge change or
local change in conductivity.
[0206] In some embodiments, a sensor may detect a nucleic acid
hybridization reaction. For example, a carrier (e.g., a bead) may
be linked to a nucleic acid and hybridization of the nucleic acid
with another nucleic acid (e.g., a primer or oligonucleotide probe)
may be detected. In some embodiments, a sensor may detect a
protein-protein interaction. For example, a carrier (e.g., a bead)
may be coupled to a protein species (e.g., antibody, antibody
fragment, peptide, etc.) capable of binding with an additional
protein (e.g., a ligand). Binding of the additional protein to the
protein species coupled to the carrier may be detected. Binding of
small molecules to species linked to carriers may also be detected.
In some cases, a plurality of detection methods may be employed to
detect a biomolecule or a biological reaction of interest.
Non-limiting examples of additional detection methods include an
enzyme-linked immunosorbent assay (ELISA), detection of a tag
(e.g., optical dyes, fluorescent dyes), detection of a released or
generated species during a biological reaction of interest,
etc.
[0207] A sensor (e.g., an individual sensor) described herein may
be independently addressable. An independently addressable sensor
as used herein, can refer to an individual sensor in an array whose
response can be independently detected from the responses of other
sensors in the array. An independently addressable sensor can also
refer to an individual sensor in an array that can be controlled
independently from other sensors in the array.
[0208] In some embodiments, the nucleic acids are not on carriers
(e.g., beads). The nucleic acid can be immobilized directly onto a
surface, such as a chip and/or sensor surface. For example, in
order to integrate detection on-chip, various types of biomolecules
may be patterned on-chip. Methods described herein may be used to
covalently immobilize nucleic acids (e.g., DNA) directly onto a
microchannel surface, a configuration which may be useful, for
example, for an enzyme-linked DNA hybridization assay. In some
embodiments, DNA or other nucleic acids can be directly attached to
PDMS (polydimethylsiloxane) microfluidic channels, and the use of
these PDMS-immobilized capture probes can be used for further
immobilization of proteins. Such an approach may be used with other
approaches for controlling surface properties of PDMS and the use
of surface modifications for immobilization of DNA, RNA, and
proteins, such as those described in D. Liu, R. K. Perdue, L. Sun,
R. M. Crooks, Langmuir 20, 5905, which is entirely incorporated
herein by reference.
[0209] In some embodiments, the immobilization of nucleic acid
(e.g., DNA) onto a PDMS surface may involve a plurality of steps
which can include: plasma-induced oxidation of the PDMS surface,
functionalization of the oxidized surface with a silane coupling
agent bearing a distal thiol group (mercaptopropylsilane, MPS), and
subsequent reaction of the thiol groups with acrylamide-modified
DNA. The silanization step can be carried out using a vapor-phase
reaction method. The plasma-treated PDMS may be exposed to acid
(e.g., HCl) vapor before the MPS vapor, as the acid can act as a
catalyst that increases the rate of MPS immobilization on the PDMS
surface. Subsequent exposure of the PDMS-linked DNA to its
biotinylated complement can provide a platform for immobilization
of a protein (e.g., alkaline phosphatase (AP)). PDMS immobilization
of species can be compatible with a variety of species, including
those described herein. In some cases, PDMS immobilization can
provide for immobilizing any suitable oligonucleotide or
streptavidin-modified protein onto a PDMS surface.
Devices for Biological Detection
[0210] The methods and systems described herein can be performed in
a device. The device can perform any one or more of the operations
of a method, including but not limited to nucleic acid extraction,
fragmentation, library preparation, immobilization (e.g., on a
carrier), amplification, confinement, bead enrichment, sequencing,
or data analysis and communication.
[0211] FIG. 3 shows a biological detection device 301, a removable
chip 302 with an array of sensors, and a reagent reservoir 303 that
can be inserted into and removed from the biological detection
device 301. In some examples, the reagent reservoir 303 includes
primers, nucleotides and polymerase enzymes for nucleic acid
sequencing.
[0212] The biological detection device 301 can include a screen 304
that can include a user interface, such as a graphical user
interface. The screen 304 can enable a user to operate the device
301, such as for nucleic acid sequencing.
[0213] The biological detection device 301 can include a port 305
that is configured to accept the removable chip 302. In some
examples, upon insertion of the removable chip 302 into the device
301, nucleic acid sequencing can be performed using the array of
sensors of the chip 302 and the reagents in the reagent reservoir
303.
[0214] An aspect of the present disclosure provides a sensing
device comprising a sensing array with a plurality of sensors in a
housing, where at least a subset of the plurality of sensors is
individually addressable, where each sensor of the plurality is
adapted to directly measure an electronic signature associated with
a biological species in solution, where the housing has a footprint
that is less than or equal to about 250,000 mm.sup.2, and where the
device has a weight that is less than or equal to about200 pounds,
175 pounds, 150 pounds, 125 pounds, 100 pounds, 75 pounds, 50
pounds, 25 pounds, 10 pounds or less. In some embodiments, the
sensing device does not include wells. As an alternative, the
sensing device can include wells. The sensing array can be
removable from the housing.
[0215] In an embodiment, the device further can comprise a fluid
flow path in fluid communication with the sensing array. The fluid
flow path can be in communication with a repository comprising one
or more reagents for nucleic acid sequencing. In some cases, the
fluid flow path can provide beads to the sensing array in an
emulsion or, alternatively, without an emulsion.
[0216] In some situations, at least some, all or substantially all
of the plurality of sensors can be individually addressable. For
instance, each sensor of the array can be addressed (e.g., read)
separately from other sensors in the array. Each sensor can have
one or more electrodes for measuring the electronic signature.
Examples of electrodes and electrode configurations that may be
employed for use with sensors of the present disclosure are
provided in PCT Patent Application No. PCT/US2011/054769, PCT
Patent Application No. PCT/US2012/039880, PCT Patent Application
No. PCT/US2012/067645, PCT Patent Application No.
PCT/US2014/027544, and U.S. patent application Ser. No. 13/481,858,
each of which applications is entirely incorporated herein by
reference for all purposes.
[0217] In some embodiments, the biological species can be molecular
species such as biomolecule, with non-limiting examples that
include nucleic acids, polypeptides, proteins, carbohydrates and
fatty acids. In some examples, the biological species is a nucleic
acid, including any type of nucleic acid described elsewhere
herein. In some embodiments, the nucleic acid can be single
stranded or double stranded. In some examples, the nucleic acid is
circular.
[0218] The device can have a footprint that is less than or equal
to about 200,000 mm.sup.2, 150,000 mm.sup.2, 100,000 mm.sup.2,
50,000 mm.sup.2, 10,000 mm.sup.2, 5,000 mm.sup.2, or 1,000
mm.sup.2. In some cases, the footprint is greater than or equal to
about 50 mm.sup.2, 100 mm.sup.2, 200 mm.sup.2, 300 mm.sup.2, 400
mm.sup.2, or 500 mm.sup.2. The device can have a footprint that is
less than that of a personal computer (PC), such as a laptop or
tablet PC.
[0219] The weight of the device can be less than or equal to about
9 pounds, 8 pounds, 7 pounds, 6 pounds, 5 pounds, 4 pounds, 3
pounds, 2 pounds, 1 pounds, or 0.5 pounds. In some cases, the
weight of the device is greater than or equal to about 0.1 pounds,
0.2 pounds, 0.3 pounds,0.4 pounds, 0.5 pounds, 0.6 pounds, 0.7
pounds, 0.8 pounds, 0.9 pounds, 1 pound, 2 pounds, 3 pounds, 4
pounds, 5 pounds, 6 pounds, 7 pounds, 8 pounds or 9 pounds.
[0220] In some embodiments, the sensing array can provide a
single-pass bead loading fill factor of at least about 50%, 60%,
70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.9% (i.e., the fill
factor is the percentage of the array having a bead). In some
embodiments, the sensing array can provide a nucleic acid
sequencing read length of at least about 20 base pairs (bp), 25 bp,
30 bp, 31 bp, 32 bp, 33 bp, 34 bp, 35 bp, 40 bp, 50 bp, 100 bp, 500
bp, 1000 bp, 5000 bp, 10,000 bp, or 100,000 bp with a non-linearity
of less than or equal to about 10 bases, 5 bases, 4 bases, 3 bases,
2 bases, 1 base, or 0.5 bases. The read length can be for a nucleic
acid homopolymer (e.g., all A, C, T or G). FIG. 2 is an example
plot of change in signal (mV, y-axis) versus nucleic acid bases
added (x-axis) during a nucleic acid sequencing reaction. The data
shows a homopolymer read length of about 33 base pairs
[0221] The sensing array can be part of a chip that is removable
from the housing. The chip can be a single-use chip or multi-use
chip. The chip can be disposable (e.g., formed of an
environmentally friendly material) and/or can be reusable. The
sensing array can be substantially planar.
[0222] The sensing array can provide a nucleic acid sequencing
throughput of at least about 100 base pairs (bp), 500 bp, 1000 bp,
20,000 bp, or 100,000 bp, in a time period that is less than or
equal to about 2 days, 1 day, 12 hours, 6 hours, 3 hours, 2 hours,
1 hour, 45 minutes, 30 minutes, 15 minutes, 10 minutes, or 5
minutes. In some cases, a sensing array can be used to perform
targeted sequencing and/or whole genome sequencing.
[0223] In some situations, the device further comprises a computer
processor (or other electronic logic) coupled to the sensing array.
The computer processor can be programmed to receive signals from
the sensing array that are indicative of a direct electrical
signature of the species.
[0224] In some cases, the sensing array is adapted for nucleic acid
sequencing, proton detection, protein detection, or pathogen
detection. The sensing array can be adapted for nucleic acid
amplification and/or fluid enrichment.
[0225] The device can be portable such that it can be readily
transported by a user or a machine. For example, the machine may be
transportable on a vehicle. In some examples, the vehicle is an
automobile, motorcycle, scooter, helicopter, airplane, truck,
military vehicle, spacecraft, or robot.
[0226] The measured electronic signature can be an impedance or a
change in impedance associated with (i) a bead adjacent to the
sensor, (ii) an electrode of the sensor or (iii) a species in a
fluid adjacent to the sensor. As an alternative or in addition to,
the electronic signature can be a charge or a change in charge
associated with (i) a bead or other type of particle adjacent to
the sensor, (ii) an electrode of the sensor or (iii) a species in a
fluid adjacent to the sensor. As an alternative or in addition to,
the electronic signature can be a conductivity or a change in
conductivity associated with (i) a bead or other type of particle
adjacent to the sensor, (ii) an electrode of the sensor or (iii) a
species in a fluid adjacent to the sensor. Various details for
measuring an electronic signature can be as described in PCT Patent
Application No. PCT/US2011/054769, PCT Patent Application No.
PCT/US2012/039880, PCT Patent Application No. PCT/US2012/067645,
PCT Patent Application No. PCT/US2014/027544, and U.S. patent
application Ser. No. 13/481,858, each of which applications is
entirely incorporated herein by reference for all purposes.
[0227] In some cases, the device is part of a system for biological
detection. The system can include a single device of multiple
devices. Each device can be for the same biological detection or
different biological detection. The devices can be in communication
with each other through any suitable type of connectivity,
including, for example, wireless connectivity.
[0228] Another aspect of the present disclosure provides a method
for biological detection, comprising providing a sensing device
comprising a sensing array with a plurality of sensors in a
housing, where at least a subset of the plurality of sensors is
individually addressable, where each sensor of the plurality is
adapted to directly measure an electronic signature associated with
a biological species in solution, where the housing has a footprint
that is less than or equal to about 250,000 mm.sup.2, 200,000
mm.sup.2, 150,000 mm.sup.2, 100,000 mm.sup.2, 50,000 mm.sup.2,
10,000 mm.sup.2, 5,000 mm.sup.2, or 1,000 mm.sup.2 and where the
device has a weight that is less than or equal to about 200 pounds,
175 pounds, 150 pounds, 125 pounds,100 pounds, 75 pounds, 50
pounds, 25 pounds or 10 pounds. Next, a solution comprising the
biological species can be directed to the sensing array. The
solution can be directed using a fluid flow system comprising, for
example, one or more pumps and/or flow actuators. In some
embodiments, an electronic signature associated with the biological
species can be directly measured using the sensor, as described
elsewhere herein. The sensing device can be as described above or
elsewhere herein.
[0229] In some cases, the sensing device can be provided on a
vehicle. The vehicle can be an automobile, motorcycle, scooter,
helicopter, airplane, truck, military vehicle, spacecraft, or
robot. The vehicle can be moved from a first location to a second
location that can be different than the first location. In some
situations, while the vehicle is moving from the first location to
the second location, (i) the solution is directed to the sensing
array and (ii) an electronic signature associated with the
biological species is directly measured using the sensor.
[0230] The device can be transportable by a user. In some
situations, while the user is moving from a first location to a
second location, (i) the solution is directed to the sensing array
and (ii) an electronic signature associated with the biological
species is directly measured using the sensor.
Control Systems
[0231] The present disclosure provides computer control systems
that are programmed to implement methods of the disclosure. FIG. 5
shows a computer system 501 that is programmed or otherwise
configured for biological detection. The computer system 501 can
regulate various aspects of sensing devices, systems and methods of
the present disclosure, such as, for example, methods for
biological detection. In some embodiments, the computer system 501
can receive signals from a sensor and determine a change in local
impedance, local charge and/or local conductivity as described
elsewhere herein.
[0232] For example, FIG. 4 is an example plot of change in signal
(mV, y-axis) versus nucleic acid bases added (x-axis) during a
nucleic acid sequencing reaction. The data shows a homopolymer read
length of about 33 base pairs.
[0233] The computer system 501 can be part of or separate from a
device or system for biological detection. In some examples, the
system 501 is integrated with a device or system for biological
detection, such as a nucleic acid sequencing device. For example,
the system 501 can be included in a housing that also contains a
sensing array, which can be provided via a removable chip.
[0234] The computer system 501 includes a central processing unit
(CPU, also "processor" and "computer processor" herein) 505, which
can be a single core or multi core processor, or a plurality of
processors for parallel processing. The computer system 501 also
includes memory or memory location 510 (e.g., random-access memory,
read-only memory, flash memory), electronic storage unit 515 (e.g.,
hard disk), communication interface 520 (e.g., network adapter) for
communicating with one or more other systems, and peripheral
devices 525, such as cache, other memory, data storage and/or
electronic display adapters. The memory 510, storage unit 515,
interface 520 and peripheral devices 525 are in communication with
the CPU 505 through a communication bus (solid lines), such as a
motherboard. The storage unit 515 can be a data storage unit (or
data repository) for storing data. The computer system 501 can be
operatively coupled to a computer network ("network") 530 with the
aid of the communication interface 520. The network 530 can be the
Internet, an internet and/or extranet, or an intranet and/or
extranet that is in communication with the Internet. The network
530 in some cases is a telecommunication and/or data network. The
network 530 can include one or more computer servers, which can
enable distributed computing, such as cloud computing. The network
530, in some cases with the aid of the computer system 501, can
implement a peer-to-peer network, which may enable devices coupled
to the computer system 501 to behave as a client or a server.
[0235] The CPU 505 can execute a sequence of machine-readable
instructions, which can be embodied in a program or software. The
instructions may be stored in a memory location, such as the memory
510. Examples of operations performed by the CPU 505 can include
fetch, decode, execute, and writeback.
[0236] The storage unit 515 can store files, such as drivers,
libraries and saved programs. The storage unit 515 can store user
data, e.g., user preferences and user programs. The computer system
501 in some cases can include one or more additional data storage
units that are external to the computer system 501, such as located
on a remote server that is in communication with the computer
system 501 through an intranet or the Internet.
[0237] The computer system 501 can communicate with one or more
remote computer systems through the network 530. For instance, the
computer system 501 can communicate with a remote computer system
of a user (e.g., operator). Examples of remote computer systems
include personal computers (e.g., portable PC), slate or tablet
PC's (e.g., Apple.RTM. iPad, Samsung.RTM. Galaxy Tab), telephones,
Smart phones (e.g., Apple.RTM. iPhone, Android-enabled device,
Blackberry.RTM.), or personal digital assistants. The user can
access the computer system 501 via the network 530.
[0238] Methods as described herein can be implemented by way of
machine (e.g., computer processor) executable code stored on an
electronic storage location of the computer system 501, such as,
for example, on the memory 510 or electronic storage unit 515. The
machine executable or machine readable code can be provided in the
form of software. During use, the code can be executed by the
processor 505. In some cases, the code can be retrieved from the
storage unit 515 and stored on the memory 510 for ready access by
the processor 505. In some situations, the electronic storage unit
515 can be precluded, and machine-executable instructions are
stored on memory 510.
[0239] The code can be pre-compiled and configured for use with a
machine have a processer adapted to execute the code, or can be
compiled during runtime. The code can be supplied in a programming
language that can be selected to enable the code to execute in a
pre-compiled or as-compiled fashion.
[0240] Aspects of the systems and methods provided herein, such as
the computer system 501, can be embodied in programming. Various
aspects of the technology may be thought of as "products" or
"articles of manufacture" typically in the form of machine (or
processor) executable code and/or associated data that is carried
on or embodied in a type of machine readable medium.
Machine-executable code can be stored on an electronic storage
unit, such memory (e.g., read-only memory, random-access memory,
flash memory) or a hard disk. "Storage" type media can include any
or all of the tangible memory of the computers, processors or the
like, or associated modules thereof, such as various semiconductor
memories, tape drives, disk drives and the like, which may provide
non-transitory storage at any time for the software programming.
All or portions of the software may at times be communicated
through the Internet or various other telecommunication networks.
Such communications, for example, may enable loading of the
software from one computer or processor into another, for example,
from a management server or host computer into the computer
platform of an application server. Thus, another type of media that
may bear the software elements includes optical, electrical and
electromagnetic waves, such as used across physical interfaces
between local devices, through wired and optical landline networks
and over various air-links. The physical elements that carry such
waves, such as wired or wireless links, optical links or the like,
also may be considered as media bearing the software. As used
herein, unless restricted to non-transitory, tangible "storage"
media, terms such as computer or machine "readable medium" refer to
any medium that participates in providing instructions to a
processor for execution.
[0241] Hence, a machine readable medium, such as
computer-executable code, may take many forms, including but not
limited to, a tangible storage medium, a carrier wave medium or
physical transmission medium. Non-volatile storage media include,
for example, optical or magnetic disks, such as any of the storage
devices in any computer(s) or the like, such as may be used to
implement the databases, etc. shown in the drawings. Volatile
storage media include dynamic memory, such as main memory of such a
computer platform. Tangible transmission media include coaxial
cables; copper wire and fiber optics, including the wires that
comprise a bus within a computer system. Carrier-wave transmission
media may take the form of electric or electromagnetic signals, or
acoustic or light waves such as those generated during radio
frequency (RF) and infrared (IR) data communications. Common forms
of computer-readable media therefore include for example: a floppy
disk, a flexible disk, hard disk, magnetic tape, any other magnetic
medium, a CD-ROM, DVD or DVD-ROM, any other optical medium, punch
cards paper tape, any other physical storage medium with patterns
of holes, a RAM, a ROM, a PROM and EPROM, a FLASH-EPROM, any other
memory chip or cartridge, a carrier wave transporting data or
instructions, cables or links transporting such a carrier wave, or
any other medium from which a computer may read programming code
and/or data. Many of these forms of computer readable media may be
involved in carrying one or more sequences of one or more
instructions to a processor for execution.
[0242] The computer system 501 can include or be in communication
with an electronic display 535 that comprises a user interface (UI)
for providing, for example, an output or readout of a sensing
device of system coupled to the computer system 501. Such readout
can include a nucleic acid sequencing readout, such as a sequence
of nucleic acid bases that comprise a given nucleic acid sample.
Examples of UI's include, without limitation, a graphical user
interface (GUI) and web-based user interface. The electronic
display 535 can be a computer monitor, or a capacitive or resistive
touchscreen.
[0243] Devices, methods and systems of the present disclosure can
be combined with or modified by other devices, systems and/or
methods, such as, for example, those described in PCT Patent
Application No. PCT/US2011/054769, PCT Patent Application No.
PCT/US2012/039880, PCT Patent Application No. PCT/US2012/067645,
PCT Patent Application No. PCT/US2014/027544, and U.S. patent
application Ser. No. 13/481,858, each of which applications is
entirely incorporated herein by reference for all purposes. These
applications provide example devices and methods for directly
measuring an electronic signature associated with a biological
species in solution, such as impedance or charge measurement, and
for making biological measurements for use in, for example, nucleic
acid sequencing, including targeted sequencing and whole genome
sequencing.
[0244] Devices, systems and methods of the present disclosure may
be used for various types of measurements, such as pathogen
detection, protein detection and nucleic acid sequencing, including
measuring a nucleic acid sequence and single-nucleotide
polymorphism (SNP) detection. Such methods may be used by a
subject, a healthcare provide to diagnose and/or treat the subject,
or in forensics analysis.
Systems and Methods for Computation
[0245] While there are systems and methods presently available to
store information electronically, recognized herein are various
issues with such methods. Current systems and methods may not be
capable of meeting the ever growing need for increased storage. As
digital information continues to accumulate, higher density and
longer-term storage solutions may be necessary, and current methods
for storing information may not be capable of meeting the demand
for higher density and longer-term storage.
[0246] Recognized herein is the need for improved methods and
systems of storing data, accessing data and/or performing
computations. Nucleic acid based data storage is an alternative to
current systems and methods presently available to store data
electronically. Deoxyribonucleic acid (DNA) computing is a form of
computing that uses DNA, biochemistry and molecular biology to
store data, access data and/or perform computations. One potential
advantage of DNA computing is that, similar to parallel computing,
it can try many different possibilities at once owing to having
many different molecules of DNA. In some embodiments, the devices
and methods of the present disclosure have individually addressable
arrays that can be used to perform computation using nucleic acid
molecules.
[0247] The present disclosure provides devices, systems and methods
that employ the use of nucleic acid molecules, such as
deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or variants
thereof, for data storage and computing. The systems and methods
described herein have an array of sites referred to as pixels at
which DNA can be synthesized, degraded, sequenced, attached,
detached and/or hybridized. The pixels can be independently
addressed, that is, each site can perform any one of DNA synthesis,
degradation, sequencing, attachment, detachment and/or
hybridization irrespective of such actions being performed at any
other site of the array. In some cases, an electrical field can be
formed around each pixel to attract molecules to or repel molecules
from the vicinity of the pixel as described in PCT Patent
Application Serial No. PCT/US2014/027544, which is incorporated
herein by reference in its entirety. The present disclosure
provides systems and methods for DNA based computing that can be
performed by the independent actions of an array of a large number
of pixels (e.g., at least about 100, 1000, 10000, 50000, 100000,
500000, 1000000, 5000000, or 10000000 pixels).
Individually Addressable Arrays
[0248] In an aspect of the present disclosure, as shown in the
example system of FIG. 6A, the system can include an array of
pixels 600 where each pixel 605 is individually addressable.
[0249] FIG. 6B shows a close up view of one of the pixels 605 of
FIG. 6A. The components associated with each pixel 605 may include
detection sensor components, such as electrodes 620 for the
detection of reactions of interest and/or detection of the state of
biological/chemical matter, and dedicated voltage delivery
components for enabling electrical control of each pixel via the
application of a voltage function. The pixels may also contain
magnets 640 (shown by dashed lines) for binding magnetic particles
610 (located above magnets 640), wells etched into the substrate
(not shown), binding sites for binding biological and/or chemical
targets, etc. The content of each pixel 605 will depend on the
contemplated use for the system.
[0250] In some embodiments, the system has individually addressable
pixels where the data readout associated with each pixel may be
accessed. As reactions of interest occur in each pixel, the data
associated with each individual pixel may be accessed. For example,
in the case of DNA sequencing, the data associated with the
detection of a nucleotide incorporation event may be accessed for
the individual pixel where the incorporation event is occurring.
This access may occur in real-time and there may be data readout
for the particular pixel of interest as the reaction is happening
and as the data is being generated. In other embodiments, the data
may be accessed sometime after the data has been generated and
sometime after the reaction of interest has occurred.
[0251] In other embodiments, individually addressable pixels can
contain a dedicated voltage delivery component where biological
and/or chemical matter of interest can be manipulated via the
application of a voltage function to the individual pixel. The
voltage function can be applied by a computer processor or circuit
that is programmed or otherwise configured to apply a voltage
function or a plurality of voltage functions. The voltage function
may be an alternating current (AC) or direct current (DC) voltage
function. For example, if the pixel includes electrodes the voltage
function may be applied to the electrodes in order to establish an
electric field. Biological matter, such as nucleotides, proteins,
DNA, RNA, etc. can be attracted or repelled depending on the
properties of the electric field. In some embodiments, the electric
field can act as a "gate" for each pixel, either confining
biological and/or chemical matter in the pixel or facilitating the
removal of the matter either by charge repulsion and/or diffusion
in solution. As shown in FIG. 6C, this can allow for the selective
retention or removal of the contents of certain pixels 605 based on
the contents of individual pixels 605. For example, in the case of
nucleic acid (e.g., DNA) amplification on magnetic beads, there may
be null pixels 607 (shown in the figure as grey pixels) where
amplification has not occurred and the magnetic beads associated
with the null pixels 607 can be removed by magnetic repulsion
through an electromagnet in the pixel, by charge repulsion via the
"electric gate," or a combination of both methods. This function
may be considered a "sorting" function where the individually
addressable pixels can selectively remove beads and thus "sort"
through very large numbers of beads and samples.
[0252] The type of voltage function and its properties can depend
on the particular reaction of interest as well as the type of
biological and/or chemical matter. For example, a different voltage
function may be used during nucleic acid (e.g., DNA) amplification
versus nucleic acid (e.g., DNA) sequencing.
[0253] In some embodiments, the system may be used in conjunction
with carrier particles, such as beads. In an embodiment, the beads
may be magnetic and may bind to one or more magnets associated with
individual pixels. In other embodiments, the system may not use
carrier particles, but may bind biological and/or chemical targets
of interest to each pixel in an alternate configuration. For
example, the targets may be bound through a biotin-streptavidin
bond, or contained in wells in the substrate.
[0254] In some embodiments of the system, there may be combined
amplification and sequencing systems and methods on the same
chip.
Systems and Methods for Accessing Data
[0255] An aspect of the present disclosure provides a method for
accessing data. The method can comprise providing an array of
individually addressable sites, where a given site of the array has
a nucleic acid molecule with a sequence of nucleic acid subunits
that corresponds to bits encoding at least one computer-executable
directive for storing data. The method can include, at the given
site, identifying the sequence of nucleic acid subunits by
measuring an impedance, conductance, or charge (or change thereof)
associated with the nucleic acid molecule, an environment adjacent
or in proximity to the nucleic acid molecule, or a bead (or
particle) coupled to the nucleic acid molecule. The method can use
a computer processor to identify the bits from the sequence of
nucleic acid subunits and generate the data from the bits.
[0256] In such a method, according to some embodiments, there may
be a substrate having a plurality of locations, or pixels, for
containing biological matter. The biological matter can for
instance be a nucleic acid (e.g., DNA) or a variant thereof.
Nucleic acid (e.g., DNA) can be delivered to specific pixels on the
substrate of a single chip and these pixels can also be referred to
as "nano-reactors."
[0257] FIG. 7 shows an exemplary embodiment of polynucleotide
sequencing based on selective containment of nucleotides 750 and
detection of a hybridization event by detector sensors, in this
embodiment "inner detection electrodes" 720. A pixel 705 may
contain inner detection electrodes 720, a magnet 740 (shown by
dashed lines), a magnetic bead 710 (located above magnet 740),
nucleic acid (e.g., DNA) 715, and outer electrodes 725. The outer
electrodes 725 may generate an electric field 760 in order to
contain one or more nucleotides 750 of interest within the pixel
705. This electric field 760 can act as an "electric gate" and
either contain or repel moieties in the system. The inner detection
electrodes 720 can detect the state of hybridization and whether or
not an incorporation event has occurred in a template nucleic acid
(e.g., DNA) strand 770. If the incorrect nucleotide has been
introduced into the pixel 705 and there is no incorporation, the
electric gate can reverse the electric field to repel the
nucleotide or nucleotides in the pixel 705. Then next cycle of
nucleotides can then be introduced and the process can be repeated
until the entire length of the template nucleic acid (e.g., DNA)
770 is sequenced. There can be a single nucleic acid type or more
than one type according to a particular application.
[0258] Another aspect of the present disclosure provides a system
for accessing data. The system can comprise an array of
individually addressable sites, where an individual site of the
array has a nucleic acid molecule with a sequence of nucleic acid
subunits that corresponds to bits encoding at least one
computer-executable directive for storing data. The system can
include a sensor at the given site that measures signals indicative
of an impedance, conductance and/or charge (or change thereof)
associated with the nucleic acid molecule and a computer processor
coupled to the sensor. The computer processor can identify the
sequence of nucleic acid subunits from signals received from the
sensor, identifies the bits from the sequence of nucleic acid
subunits, generate the data from the bits, and store the data in a
memory location.
[0259] In some cases, an additional site of the array does not have
an additional nucleic acid molecule with the sequence of nucleic
acid subunits. In some cases, an additional site of the array can
have an additional nucleic acid molecule with the sequence of
nucleic acid subunits.
[0260] Identifying the nucleic acid sequence of the nucleic acid
subunits can comprise sequencing the nucleic acid molecule. In some
cases, the sequencing comprises performing a nucleic acid extension
reaction using a primer that hybridizes to the nucleic acid
molecule. The impedance, conductance and/or charge (or change
thereof) associated with the nucleic acid molecule, environment in
proximity to the nucleic acid molecule, and/or bead (or particle)
coupled to the nucleic acid molecule can be indicative of
nucleotide incorporation events during the nucleic acid extension
reaction.
[0261] Identifying the nucleic acid sequence of the nucleic acid
subunits can comprise hybridizing an oligonucleotide that comprises
a sequence at least partially complementary to the sequence of
nucleic acid subunits to the nucleic acid molecule. In some
embodiments, the impedance, conductance and/or charge (or change
thereof) associated with the nucleic acid molecule, environment in
proximity to the nucleic acid molecule, and/or bead (or particle)
coupled to the nucleic acid molecule is indicative of the
hybridizing the oligonucleotide to the nucleic acid molecule.
[0262] The sequence of nucleic acid subunits can be stored in
computer memory. In some cases, the method further comprises
storing the data in computer memory.
[0263] In some embodiments, the nucleic acid subunits can comprise
at least two distinct subunits, where a subset of the at least two
distinct subunits corresponds to a 1 or 0. In some cases, a given
site comprises a plurality of the nucleic acid molecules. The
method can further comprise assembling generated data into a larger
piece of data.
[0264] In some instances, the nucleic acid molecule can comprise a
primer binding sequence. The primer binding sequence can function
as a searchable index.
[0265] In some cases, a sensor at the given site can detect signals
indicative of the impedance conductance and/or charge (or change
thereof) during the measuring. In some embodiments, the sensor can
comprise a pair of electrodes. The sensor can be electrically
coupled to the Debye layer of a surface of the sensor, the nucleic
acid molecule, or a surface (e.g., bead) coupled to the nucleic
acid molecule. For examples, if the sensor includes at least 1, 2,
3, 4, 5, 6, 7, 8, 9, or 10 electrodes, at least some, most or all
of the electrodes can be in a Debye layer of the nucleic acid
molecule, a Debye layer of the environment in proximity to the
nucleic acid molecule, and/or a Debye layer or a bead (or particle)
coupled to the nucleic acid molecule during sensing. In some cases,
the nucleic acid molecule can be coupled to a surface at the given
site. The surface can be, without limitation, a particle or a
surface of a well at the site. In some cases, the surface can be
removable from the site. In some cases, the nucleic acid molecule
can be coupled to the surface via hybridization with another
nucleic acid molecule coupled to the surface. In some embodiments,
the nucleic acid molecule can be coupled to the surface via a
covalent bond. The nucleic acid molecule can be coupled to the
surface via a non-covalent interaction.
[0266] In some cases, the sensor can measure signals indicative of
nucleotide incorporation events during a nucleic acid extension
reaction associated with the nucleic acid molecule. The sensor can
measure signals indicative of one or more hybridization events
associated with the nucleic acid molecule. In some embodiments, the
memory location or an additional memory location can store the
sequence of nucleic acid subunits identified by the computer
processor.
[0267] In an embodiment, a route for delivering a nucleic acid
(e.g., DNA) sample may be via magnetic beads that can be secured in
place using a local magnetic field. In other embodiments, there may
be no beads or particles, but nucleic acid (e.g., DNA) may be bound
within the pixel in an alternate configuration. For example, the
nucleic acid (e.g., DNA) may be bound through a biotin-streptavidin
bond, or contained in wells in the substrate.
[0268] In some embodiments, amplification of nucleic acid (e.g.,
DNA) on a bead in a pixel can be achieved via an amplification
process. A bead may be covered in primers and a first single
stranded nucleic acid template may bind to a first primer. The
first single stranded nucleic acid template may be formed into
double stranded nucleic acid by the addition of nucleotides and
reagents. These nucleotides and reagents may be directed into a
pixel by local voltages. Once the double stranded nucleic acid
template is formed, a strand of the double stranded nucleic acid
can be separated through heating and may be contained in the same
pixel by local voltages, preventing diffusion into a neighboring
pixel and potential cross-contamination of different nucleic acid
samples. This single strand may then hybridize to another primer on
the same bead and the amplification process may begin again. This
process can be repeated until all the primers on the bead are
occupied by amplified nucleic acid. The flow of separated single
strand nucleic acid, nucleotides, and reagents can be influenced by
local voltages applied at each nano-rector.
[0269] In some embodiments, there may be more than one type of
template nucleic acid on the same bead.
[0270] In an alternative embodiment, a strand of double stranded
template nucleic acid may be separated via heating and can be
directed by local voltages to land on a different bead in another
pixel where it can hybridize to another primer. This process can be
repeated and the flow of separated single strand nucleic acid can
be influenced by local voltages applied at each pixel.
[0271] In some embodiments, the amplification reaction may be
assisted by directing moieties such as polymerases and nucleotides
to targeted specific nano-reactors or beads. The dedicated voltage
delivery system can be used to control the flow of these moieties
into specific pixels. A dedicated sensor system, such as an array
of electrodes, can be used in some embodiments to sense the state
of amplification. For instance, once the population of a specific
type of strand grows above a certain limit, the corresponding
growth in the electrical signal can be monitored in order to
determine which pixels have the most amplification or which beads
are null beads with no amplification.
[0272] In some embodiments, the sensor data can be used to identify
pixels with the desired amplicons. The voltage delivery system
which delivers dedicated voltages to individually addressable
pixels may be used to retain the amplified nucleic acid and repel
or release the non-amplified or suspect nucleic acid population,
for instance by releasing a bead or the nucleic acid itself from
select pixels.
[0273] In a further embodiment, after amplification is complete,
the voltage delivery system may be used to release some or all of
the contents of each pixel and the system may wash the amplicons,
reagents, nucleotides, and beads to an outlet or sorting
system.
[0274] In another embodiment, after amplification is complete,
nucleic acid (e.g., DNA) sequencing may commence in pixels with
amplified nucleic acid. The system can allow for both amplification
and sequencing on the same pixel array. Nucleotides and other
sequencing reagents may be flowed into the array and the electric
gate can be used to contain them in individual pixels. The detector
components in the pixel, such as, for example, electrodes, can be
used to detect incorporation events. For example, a known (or
predetermined) nucleotide base or precursor can be pulsed and
brought into contact with a single stranded nucleic acid molecule
having a primer and polymerization enzyme coupled thereto. If the
base is incorporated during a primer extension reaction, the
impedance, conductance and or charge of the nucleic acid molecule,
environment in proximity to the nucleic acid molecule, and/or bead
(or particle) coupled to the nucleic acid molecule is changed,
which change is detectable by individual pixel and is indicative of
an incorporation event. In some embodiments, the cyclical addition
and removal of nucleotides can allow for sequencing by synthesis on
the system. The sequencing may occur in pixels that are filled with
amplicons, allowing for a stronger signal and better sequencing
results. When sequencing has been completed, the voltage delivery
system may be used to remove the contents of target pixels,
allowing for a reusable array.
[0275] Amplification and sequencing methods described herein can be
useful for a number of forms of biological matter, such as for
example proteins, peptides, nucleic acids (DNA, RNA and cDNA), etc.
In all cases, the dedicated sensor system data may be used to
selectively contain certain biological matter in target pixels and
release biological matter and/or carrier particles from other
pixels.
[0276] In some embodiments, different voltage functions can be used
for combined nucleic acid (e.g., DNA) amplification and subsequent
nucleic acid sequencing on the same substrate. For instance, a
first voltage function is used to contain amplified nucleic acid
and a second voltage function is used to repel or release
non-amplified nucleic acid.
[0277] In other embodiments, during the sequencing of a
polynucleotide on a plurality of locations on the substrate,
individual voltages can be used to control and confine the reaction
and reaction byproducts at each location. In some embodiments, this
is possible by using a dedicated sensor at each location to sense
the state of hybridization.
[0278] In some embodiments, a dedicated moieties delivery scheme
may be used for phase detection and rephasing. The state of
hybridization at each location can be measured. If measurements
indicate that a threshold of out-of-phase sequences are present at
certain locations, nucleotides or nucleotide segments may be
delivered to the certain locations to bring the out-of-phase
sequences back into phase.
[0279] In some embodiments, competitive reactions including
delivery of nucleotide bases or nucleotide derivative to specific
locations can be used for rephasing.
[0280] In some embodiments, repair proteins can be delivered to
out-of-phase locations using a dedicated voltage delivery system.
Since these moieties have electric charge, they can be repelled
from the in-phase locations and attracted to out-of-phase locations
by properly modulating the voltage based on the sensing data from
each location.
[0281] In some embodiments, based on sensing data, an ideal base
position in a sequencing process can be identified. Once ideal base
positions are identified, nucleotides can be incorporated to
rephase polynucleotides that lag by two bases, and then nucleotides
can be incorporated to rephase polynucleotides that lag by one
base. Alternatively multiple-base combinations can be used for
rephasing.
[0282] In some embodiments, more than one type of polynucleotide
can be sequenced. The dedicated individual sensing data can be used
to examine and differentiate polynucleotide sequences on different
locations. The voltage delivery system can then be used to
individually select and deliver moieties to different locations.
The sensing system, in return, can measure the incorporation of
further nucleotides or other segments, onto each location. This can
be used as a feedback loop for planning delivery of certain
moieties like nucleotides to each location separately. In this
manner, a parallel sequencing of different types of polynucleotides
can be performed on the same substrate.
[0283] In some embodiments, the reaction of interest that is
detected by the dedicated detection sensor can be a nucleotide
hybridization reaction for polynucleotide sequencing. In some
embodiments, primers may be confined in the pixels. In an
embodiment, a primer can be bound to a magnetic bead in a pixel.
Single stranded template nucleic acid (e.g., DNA) may be flowed
into the system such that there is on average one nucleic acid per
pixel. The voltage of each pixel may be selectively controlled such
that only a nucleotide of interest may be contained within the
pixel via an "electric gate" formed by the voltage associated with
the pixel. In some examples, this may be generated by associated
electrodes. The determination of whether or not to allow a
particular nucleotide to enter an individual pixel may depend on
whether or not the nucleotide is the next complementary base pair
in the desired sequence.
Systems and Methods for Storing Data
[0284] An aspect of the present disclosure provides a method for
data storage. The method can comprise receiving bits encoding at
least one computer-executable directive for storing data. The
method can use a computer processor to generate a nucleic acid
sequence that encodes the data, where the nucleic acid sequence
comprises nucleic acid subunits that correspond to the bits. The
method can include using an array of individually addressable
nucleic acid synthesis sites to generate a nucleic acid molecule
having the nucleic acid sequence at a first site of the array at
the exclusion of generating an additional nucleic acid molecule
having the nucleic acid sequence at a second site of the array.
[0285] In some embodiments, the system may also have the capability
to allow for the synthesis of nucleic acid (e.g., DNA), or allow
for "nucleic acid writing." In some embodiments, the user may wish
to create a particular nucleic acid sequence and/or slight
variations of a known nucleic acid sequence. In some embodiments, a
single stranded template nucleic acid with a known sequence may be
located inside an individual pixel. The single stranded template
nucleic acid may be held in a location in the pixel by a primer, a
chemical bond, or a bead (e.g., magnetically attractable bead). In
other embodiments, there may be a plurality of primers in various
locations in the pixels and they can be confined by the use of
dedicated voltage delivery to each pixel.
[0286] In further embodiments, there may be a template nucleotide
or the template nucleic acid may be partially or fully double
stranded and synthesis may occur by chemical methods, such as for
example ligation.
[0287] The electrical gating capabilities of the individually
addressable pixels may be used to selectively allow or prevent the
entry of nucleotides into a pixel. The determination of whether or
not to allow nucleotides to enter an individual pixel may depend on
whether or not the nucleotide is the next complementary base pair
in the desired sequence. Correct incorporation can be determined by
the measurement of nucleotide hybridization in each pixel. A
correct base pair addition will register as an electrical signal
and can be detected by a detection sensor component, such as for
example an electrode. In some embodiments, this electrical signal
may be a change in impedance or charge. In other embodiments, this
electric signal may be a change in conductivity.
[0288] In some embodiments, in order to avoid or minimize incorrect
incorporation of homopolymers (e.g., adding an incorrect string of
AAAA nucleotides to the sequence instead of only one "A" simply
because there are many "A" nucleotides in the pixel at the time),
enzymes used in nucleotide incorporation reactions can be
engineered such that they can only add one nucleotide at a time.
This can be achieved by, for example, adding a terminator to
nucleotides. In other embodiments, nucleic acid (e.g., DNA)
synthesis can also be achieved by using synthetic nucleic acid and
ligase methods.
[0289] Another aspect of the present disclosure provides a system
for data storage. The system can comprise an array of individually
addressable nucleic acid synthesis sites, where an individual
synthesis site of the array synthesizes a nucleic acid molecule
from individual nucleic acid subunits or precursors thereof. The
system can include a computer processor that receives bits encoding
at least one computer-executable directive for storing data;
generates a nucleic acid sequence that encodes the data, where the
nucleic acid sequence comprises nucleic acid subunits that
correspond to the bits; and transmits electrical signals to the
array to generate a nucleic acid molecule having the nucleic acid
sequence at a first site of the array at the exclusion of
generating an additional nucleic acid molecule having the nucleic
acid sequence at a second site of the array.
[0290] In some embodiments, the bits can encode a plurality of
computer-executable directives. The data can be stored in computer
memory. In some cases, the nucleic acid sequence can be stored in
computer memory. In some instances, the nucleic acid subunits can
be selected from at least two distinct subunits, where a subset of
the at least two distinct subunits corresponds to a 1 or 0.
[0291] In some cases, an individual site of the nucleic acid
synthesis sites can comprise a pair of electrodes. The method can
comprise alternately and sequentially directing to the first site
nucleic acid subunits or precursors thereof that are selected based
on the nucleic acid sequence.
[0292] In some cases, the method can further comprise excluding
from the second site the nucleic subunits or precursors thereof
that are alternately and sequentially directed to the first site.
In some instances, the method can further comprise attracting a
given nucleic acid subunit or precursor thereof to the first site
or not repelling the given nucleic acid subunit or precursor
thereof from the first site. In some cases, the method can further
comprise repelling the given nucleic acid subunit or precursor
thereof from the second site or not attracting the given nucleic
acid subunit or precursor thereof to the second site. The given
nucleic acid subunit or precursor thereof can be attracted to the
first site and/or repelled from the second site using an electric
field generated at each of the first and second sites. The electric
field can be generated by one or more electrodes at the first and
second sites. In some cases, the given nucleic acid subunit or
precursor thereof can be attracted to the first site and/or
repelled from the second site using a magnetic field generated at
each of the first and second sites. The magnetic field can be
generated by one or more magnetic elements at the first and second
sites.
[0293] The given nucleic acid subunit or precursor thereof can be
attached to a magnetic bead.
[0294] In some embodiments, the nucleic acid subunits or precursors
can be alternately and sequentially directed to the first site via
fluid flow. The fluid flow can be fluid flow in at least one
microfluidic channel.
[0295] The method can further comprise removing the nucleic acid
molecule from the array.
[0296] In some cases, the nucleic acid molecule can be generated at
more than one site of the array. In some embodiments, the nucleic
acid molecule can be generated at only one site of the array. In
some instances, a plurality of the nucleic acid molecules can be
generated at the first site.
[0297] The nucleic acid molecule can be generated in the absence of
a nucleic acid template.
[0298] In some cases, the nucleic acid molecule can be generated on
a reaction surface at the first site. The reaction surface can be a
particle or a surface of a well at the first site.
[0299] In some cases, the nucleic acid molecule can be generated on
the reaction surface via covalent coupling of a nucleic acid
subunit or precursor thereof of the nucleic acid molecule to the
reaction surface. In some instances, the nucleic acid molecule can
be generated on the reaction surface via coupling of a nucleic acid
subunit or precursor thereof of the nucleic acid molecule to a
linker coupled to the reaction surface. The linker can comprise a
nucleic acid.
[0300] In some instances, the nucleic acid molecule can be
generated on the reaction surface via non-covalent coupling of a
nucleic acid subunit or precursor thereof of the nucleic acid
molecule to the reaction surface. The non-covalent coupling can be
a binding interaction between members of a binding pair.
[0301] In some cases, the array can be substantially planar (e.g.,
deviates from a plane by no more than 0.1%, 0.5%, 1%, 5%, or 10% of
the longest dimension of the array at any one point of the
plane).
[0302] In some cases, the first site can further comprise a sensor
capable of detecting signals indicative of an impedance change, a
charge change, a change in conductivity, a change in pH, or a
change in temperature associated with the generating of the nucleic
acid molecule. The sensor can comprise a pair of electrodes. The
sensor can be electrically coupled to the Debye layer of a surface
of the sensor, a surface of the nucleic acid molecule, or a
reaction surface coupled to the nucleic acid molecule.
[0303] In some embodiments, the method can further comprise
removing a given nucleic acid subunit or precursor thereof of the
nucleic acid molecule from the first site if the sensor detects
that the given nucleic acid subunit or precursor thereof of the
nucleic acid molecule is incorrectly incorporated to the nucleic
acid molecule during the generating.
[0304] In some cases, the computer processor can transmit
electrical signals to the array to alternately and sequentially
direct the individual nucleic acid subunits or precursors thereof
to the individual synthesis site based on the nucleic acid
sequence. The computer processor can transmit electrical signals to
the array that exclude the individual nucleic subunits or
precursors from an additional individual synthesis site of the
array.
[0305] In some cases, the system can further comprise one or more
magnetic elements at the individual synthesis site and/or the
additional individual synthesis site that generates the magnetic
field.
[0306] The system can further comprise a fluid flow apparatus that
alternately and sequentially directs the individual nucleic acid
subunits or precursors to the individual synthesis site. The fluid
flow apparatus can comprise at least one microfluidic channel.
[0307] The individual synthesis site can comprise a sensor capable
of detecting signals indicative of an impedance change, a charge
change, a change in pH, or a change in temperature associated with
one or more nucleic acid molecules at the individual synthesis
site. During sensing, the sensor can be electrically coupled to the
Debye layer of a surface of the sensor, a surface of the one or
more nucleic acid molecules, or a reaction surface coupled to the
one or more nucleic acid molecules.
Computational Modules
[0308] The basic operations of nucleic acid (e.g., DNA) synthesis,
degradation, sequencing, attachment, detachment and/or
hybridization can be combined to create any number of computational
modules. A computational module can involve any combination of
storing, writing and manipulating a nucleic acid molecule (e.g.,
DNA) according to a programmed algorithm.
[0309] Examples of indexing storing, writing and manipulating
nucleic acid molecules using "folders" and "meta-data" are provided
herein.
[0310] Primer Indexing: In some embodiments, a system may be
searchable via primer indexing. A fully or partially single
stranded nucleic acid (e.g., DNA) sequence of interest may be
linked to a known primer sequence. If there are a variety of
different types of nucleic acid sequences of interest, each sample
may have its own specific primer sequence.
[0311] For example, as shown in FIG. 8A, single stranded nucleic
acid (e.g., DNA) may be in the system from four different sample
sources: nucleic acid from sample A 820, nucleic acid from sample B
830, nucleic acid from sample C 840, and nucleic acid from sample D
850. The nucleic acid from each sample may be indexed with its own
primer such that nucleic acid from sample A is linked to primer A
825, nucleic acid from sample B is linked to primer B 835, nucleic
acid from sample C is linked to primer C 845, nucleic acid from
sample D is linked to primer D 855, etc. These unique primers can
function as an "index" for a particular "folder." That is, the
primer is the "label" for naming the "folder" in order to keep
track of which nucleic acid came from which source. Although in
this example the biological compound of interest is nucleic acid,
this method may be applied to different compounds such as proteins,
peptides, carbohydrates, etc. and the label may be a known primer
or another biological molecule.
[0312] Searchable Indexing: A system may allow for methods of
"searching" a primer index in order to identify the location or
locations of biological material from a target sample. Examples
outlined below are shown with beads associated with nucleic acid
molecules, but direct attachment of nucleic acid molecules to
surfaces or other methods may also be used.
[0313] FIG. 8B illustrates an embodiment of the present system
where nucleic acid (e.g., DNA) is bound to a bead 800 labeled with
primer A 825, primer B 835, primer C 845, and primer D 855
according to the sample of origin--nucleic acid from sample A 820,
nucleic acid from sample B 830, nucleic acid from sample C 840, and
nucleic acid from sample D 850. Each nucleic acid is located in one
pixel and each pixel includes a detection sensor component for
sensing a nucleic acid hybridization event. Pixel A corresponds to
nucleic acid from sample A 820, Pixel B corresponds to nucleic acid
from sample B 830, Pixel C corresponds to nucleic acid from sample
C 840, and Pixel D corresponds to nucleic acid from sample D 850.
In this embodiment, the search to be performed is for the nucleic
acid from sample C. The compliment of primer C 845, complimentary
fragment C', can be flowed into the system. When complimentary
fragment C' binds to primer C 845, the detection sensor component
in pixel C can sense an incorporation event 890 and the
individually addressable pixels of the system will generate a
readout. This readout can indicate that an incorporation event 890
has occurred at pixel C and that the nucleic acid from sample C 845
is located in that pixel.
[0314] This search method may allow searching tens, hundreds,
thousands, or millions of pixels and can yield the location or
locations of biological components of interest based on the binding
of a complementary label. Although in this example the biological
compound of interest is nucleic acid, this method may be applied to
different compounds such as proteins, peptides, carbohydrates etc.
and the label may be a known primer or another biological
molecule.
[0315] Sub--Indexing: In a further embodiment, the system may have
searchable "sub-folders" in addition to the primers that act as
"folders." Examples outlined below are shown with beads associated
with nucleic acid molecules, but direct attachment of nucleic acid
molecules to surfaces or other methods may also be used FIG. 9A
shows a nucleic acid (e.g., DNA) fragment from sample A 920 that is
labeled with primer A 925. While labeling with primer A 925 allows
for the nucleic acid to be found using the search methods outlined
above, in certain situations it may be desirable to search for a
specific sequence within the nucleic acid. In some embodiments,
short known sequences can be incorporated into the nucleic acid to
act as "sub-folders".
[0316] For example, sequence I, sequence II, and sequence III can
be incorporated into nucleic acid shown in FIG. 9A, at desired
locations. Sequence I may be proximate to a location that codes for
protein of interest I, Sequence II may be proximate to a location
that codes for protein of interest II, and Sequence III may be
proximate to a location that codes for protein of interest III.
[0317] In an embodiment shown in FIG. 9B, the complement of
sequence I, sequence II, and sequence III may be injected in an
array where each nucleic acid (e.g., DNA) from each of four samples
may be bound to a bead 900. A pixel A corresponds to a nucleic acid
from sample A 920, a Pixel B corresponds to a nucleic acid from
sample B 930, a pixel C corresponds to a nucleic acid from sample C
940, and a pixel D corresponds to a nucleic acid from sample D 950.
If, for example, the sequence of interest is located around
sequence II, then complimentary sequence II' may be flowed into the
system and act as a primer. When complimentary sequence II' binds
to sequence II, it can become a primer and then nucleotides may be
cycled into the pixel. In this manner, the section of interest may
be "read" through sequencing by synthesis 990 as a correct
incorporation event can generate a measurable electrical signal
that can be detected by the detection sensors. In some embodiments,
the sequences I, II, and III can also have "stop" sequences coded
such that, for the example above, once all the nucleotides have
been incorporated from sequence II up to sequence III, the "stop"
coding portion of sequence III will stop the nucleotide
incorporation.
[0318] In other embodiments, the nucleic acid sequences, such as
sequences I, II, and III can be designed such that they occur every
"X" number of bases in a sequence. For example, the sub-index
sequences I, II, III, etc. can be integrated into the sequence
every 100, 200, 300, 500, 1000, etc. bases. In this manner, when
"reading" a section of interest, the nucleotide injection can be
stopped after the appropriate number of sequences since it is known
how many bases separate the sub-index sequences. For example, the
number of bases between sequences I, II, and III can be 300 bases
and thus if the section of interest is only between sequences II
and III, then the "reading" can be stopped after 300 nucleotides
have been incorporated.
[0319] In some embodiments, the system may be used to store
information, similar to a hard drive in a traditional computer.
Nucleotides (e.g., A, T, C, and G) and various combinations of
these in different lengths (e.g., ACTA, GCA, TTATAC, etc.) can be
used to "code" for information. In this manner, virtually any type
of information can be "stored" within the nucleic acid.
[0320] In a further embodiment, a nucleic acid can be considered to
have four "bits" (e.g., the nucleotide bases A, T, C, G), versus a
traditional computer transistor that only has two bits (the binary
0 and 1). Furthermore, nucleic acid molecules can be
three-dimensional (3D) and have directionality on the z-axis, where
the distance between each layer is about 3 angstroms or less. These
properties of nucleic acids can allow for very dense storage.
[0321] The combinations available for coding may be any combination
of the bases of a nucleic acid in either single stranded or double
stranded formation. In some embodiments, at least about 1, 2, 3, 4,
5, 10, 20, 50, 100, 1000, or 10000, etc. nucleotides comprising
bases can be used to code for a specific piece of information.
[0322] In some embodiments, DNA or other polynucleotides can be
stored and managed in a database. In other embodiments, there may
be metadata assigned to each polynucleotide where the metadata is
based on a known unique segment for each nucleotide. In other
embodiments, there may be a search scheme implemented to search
this database. A search scheme may include preparing a portion of
the polynucleotide for hybridization and hybridizing a
complementary segment to the known unique segment in the nucleotide
and measuring the resulting hybridization. In some embodiments,
there may be a higher level metadata assigned to each
polynucleotide. This higher level metadata may be based on a first
unique segment for each polynucleotide and then a lower level
metadata may be assigned where there is a common higher level
metadata. The lower level metadata may be based on another unique
segment different than the first unique segment.
[0323] FIGS. 10A-10C shows another example of nucleic acid (e.g.,
DNA) computing using the individually addressable arrays as
described herein. FIG. 10A shows, in an embodiment, that nucleic
acid 1020 associated with beads 1000 from an array 1010 of pixels
may be stored in a tube 1030. FIG. 10B shows, in another
embodiment, that nucleic acid 1020 associated with beads 1000 may
be stored in an array 1010 with wells 1040.
[0324] FIG. 10C shows, in an embodiment, an overview of a system
where there may be nucleic acid"writing" via injection of
nucleotides 1005. The nucleic acid 1020 may be written on beads
1000 and the beads 1000 are bound to an array 1010. Then, the
information in the nucleic acid 1020 may be stored via, for
example, an array 1010 of wells 1040 and/or a tube 1030. Finally,
when a user desires to access the stored data, the beads 1000 with
associated nucleic acid 1020 stored in the test tube 1030 and/or
array of wells 1040, the nucleic acid and associated beads may be
reintroduced onto an array 1010 such that nucleic acid "reading"
may occur by, for example, sequencing by synthesis or another
method. The cycle of nucleic acid writing, nucleic acid storage,
and nucleic acid reading may be repeated. The nucleic acid molecule
can be synthesized chemically and/or enzymatically. The individual
nucleotides can be introduced to the site of synthesis in the order
in which they are to be linked in the polynucleotide.
Code for Translating Nucleic Acid Sequence to Numerical Data
[0325] The present disclosure provides an example of a code for
translating a nucleic acid (e.g., DNA) sequence to numerical data.
For example, the following values from 1-10 can be mapped to the
following nucleotides and/or nucleotide sequences as shown in Table
1:
TABLE-US-00001 TABLE 1 Nucleotide Number T 1 G 2 C 3 TC 4 GC 5 CC 6
CTC 7 CGC 8 CCC 9 TTT 0 A Break
[0326] The "break", which corresponds to nucleotide A, indicates
the end of the nucleotide code for a number and the beginning of a
new number. Thus, for example, if the number of interest is:
471029402748350, then the corresponding nucleic acid sequence is as
follows (the bolded "A" has been added for emphasis for ease of
visual separation of the numbers):
TABLE-US-00002 (SEQ ID NO: 1)
TCACTCATATTTAGACCCATCATTTAGACTCATCACGCACAGCATTTA
[0327] One or more coded nucleic acids of interest may be stored in
the pixels. The exemplary embodiment describes a system where
nucleotides and their combinations correspond to digits 0-9 and a
break. In other embodiments, all types of data may be stored in any
variety of nucleotide combinations. In some embodiments, RNA, amino
acids in proteins, and other biological compounds can be used to
store various types of data.
[0328] Devices, systems and methods of the present disclosure may
be combined with and/or modified by other devices, systems, and
methods, such as those described in WO2014014991, which is entirely
incorporated herein by reference.
Biological Applications
[0329] The features of the system, namely individual control of
each pixel or group of pixels of the array, enable a broad range of
applications. In some embodiments, the system may be used for a
variety of purposes such as polynucleotide hybridization arrays,
drug screening, drug detection, detection of cells, protein assays,
and the like. These or other purposes can involve nucleic acid
sequencing and/or nucleic acid synthesis, but that is not
required.
[0330] As described herein, the systems and methods can have an
array of sites referred to as pixels. These pixels can be
individually addressed such that reagents and/or reaction products
can be delivered to or from any individual pixel by manipulating
the electrical field surrounding the pixel. Each pixel can be
coupled with a detection circuit and have instructions sent to it
and/or data collected from it on an individual basis. In some
cases, the data can include the impedance or resistance of the
material located at the pixel.
[0331] The systems and methods described herein can be used to
measure gene expression levels at the RNA or protein level. For
example, mRNA can be isolated from one or more populations of cells
and reverse-transcribed to cDNA with reverse transcriptase. Each of
the pixels of the array can have a different single stranded DNA
sequence that is complimentary to a cDNA sequence such that the
array has a binding partner for all of the open reading frames of
the cellular genome. The amount of cDNA hybridizing at each of the
pixel locations can be measured to determine the expression level
of the gene corresponding to that pixel. In some cases, the
expression level is relative to a reference population of cells
(e.g., a population of cells that have not been subjected to a
drug).
[0332] The systems and methods described herein can be used in a
drug screen. For example, a plurality of cells, such as cancer
cells can be dispersed amongst the pixels of the array. Each of the
pixels can comprise a mini-reactor that each has a different
candidate drug. In some cases, only a small portion of the
candidate drugs have the desired effect upon the cells, so it may
be impractical to screen them using conventional routes. In this
case, the volumes adjacent to each pixel are small and 10.sup.5,
10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, 10.sup.10, or more
candidate drugs can be screened in parallel. Each of the pixels can
be monitored for growth of the cells, death of the cells, or
production of a metabolite by the cells for example. Promising
candidate drugs can be released from their pixel and identified
using mass spectrometry for example.
[0333] Another aspect of the present disclosure provides a system
comprising a substrate having a plurality of locations for
containing biological matter (e.g., cells, proteins, nucleic acids,
or antibodies), each location having a detection sensor component
for detecting a state of the biological matter and a dedicated
voltage delivery component and being addressable via applying a
voltage function to individually manipulate the biological matter
based on the state of the biological material.
[0334] The system can be adapted to selectively contain certain
biological matter with a first state and release biological matter
with a second state. The first state can be a cell having an
antibody bound to it and the second state can be a cell not having
an antibody bound to it. In another example, the first state can be
a cell producing a metabolite and the second state can be a cell
not producing a metabolite.
[0335] In some embodiments, different voltage functions can be used
for combined (e.g., DNA) amplification and subsequent nucleic acid
(e.g., DNA) sequencing on the same solid state substrate. In some
cases, a first voltage function can be used to contain amplified
nucleic acid (e.g., DNA) and a second voltage function can be used
to repel or release non-amplified nucleic acid.
[0336] Another aspect of the present disclosure provides a method
comprising performing amplification and producing a clonal
population of a polynucleotide on a plurality of locations on a
substrate using dedicated voltage delivery to each location to
control and confine the reaction and reaction byproducts at each
location, using a dedicated sensor at each location to sense the
state of amplification, and performing polynucleotide sequencing on
the clonal population based on the sensed state of
amplification.
[0337] The method can further comprise sensing at each location if
polynucleotide has undergone proper amplification, using the
dedicated voltage delivery to retain correct copies of the
polynucleotide and to release or expel incorrect copies of the
polynucleotide. The dedicated voltage delivery can be used to
convey moieties to each location during sequencing. The moieties
can include at least one of nucleotide, polymerase, and nucleotide
segment.
[0338] Another aspect of the present disclosure provides a method
comprising confining a plurality of cells (e.g., prokaryotic or
eukaryotic) in specific locations, each location having a dedicated
detection sensor for detecting a state of a cell at the location
and a dedicated voltage delivery component, further measuring the
state of each cell via its dedicated detection sensor and using a
dedicated voltage function based on the state of the cell to
deliver certain moieties to specific cells.
[0339] Another aspect of the present disclosure provides a method
comprising confining a plurality of cells in specific locations,
each location having a dedicated detection sensor for detecting a
state of a cell at the location and a dedicate voltage delivery
component, further measuring the state of each cell via its
dedicated detection sensor and using a dedicated voltage function
based on the state of the cell to remove the contents of target
cells.
[0340] Another aspect of the present disclosure provides a method
for polynucleotide sequencing comprising confining a plurality of
primers and hybridizing a nucleotide onto the primer in specific
locations, each location having a detection sensor for detecting a
state of hybridization at that location and a dedicate voltage
delivery component, and individually controlling the voltage of
each location for selectively hybridizing nucleotides on each
location.
[0341] Another aspect of the present disclosure provides a method
for nucleic acid (e.g., DNA) synthesis by nucleotide hybridization,
the method comprising placing a plurality of primers on a plurality
of specific locations on a substrate, confining the primers with
dedicated voltage delivery to each of the plurality locations,
measuring a status of nucleotide hybridization in each location,
and selectively delivering nucleotides to specific locations based
on the status.
[0342] Another aspect of the present disclosure provides a method
for managing in a database of polynucleotides, the method
comprising assigning metadata to each polynucleotide, the metadata
being based on a known unique segment for each nucleotide.
[0343] The method can further comprise implementing a search scheme
to the database of polynucleotide, the search scheme comprising
preparing a portion of the polynucleotide for hybridization, and
attempting hybridizing a complementary segment to the known unique
segment in the nucleotide, and measuring the hybridization.
[0344] Another aspect of the present disclosure provides a method
for managing a database of polynucleotides, the method comprising
assigning a higher level metadata to each polynucleotide, the
higher level metadata being based on a first unique segment for
each polynucleotide, further assigning a lower level metadata to
polynucleotides that have a common higher level metadata, the lower
level metadata being based on a second unique segment.
[0345] In an embodiment, each location, or pixel, may have a
dedicated detection sensor, one or more electrodes, for detecting
the state of a cell of interest in the pixel. This state may be
monitored after the introduction of reagents that produce a
detectable reaction when in contact with the cell of interest. This
detectable reaction of interest may be monitored via a change in a
dedicated voltage function. The dedicated voltage function may also
be used to deliver or contain moieties of interest to specific
cells within a pixel. In some embodiments, the dedicated voltage
function may be changed such that the contents of a pixel are
released and removed from the system.
[0346] In some cases, biological cells may be used instead of beads
in the system. The cells may be grown in each pixel, with each
pixel having a single cell or more than one cell. Each cell may
have a nucleic acid (e.g., DNA) of interest inserted in it prior to
or after introduction into the system. In some embodiments, a drug
or compound of interest may be injected into the chamber with cells
and the state of the cell may be measured.
[0347] In some instances, the array may be used for detection of
proteins. Various tags may be attached to various antigens and then
the antigens may be introduced into the chamber. When a particular
antigen attached to a protein of interest, the tag may be used to
detect which antigen out of the group attached. In some
embodiments, if the tag cannot be attached to the antigen itself,
the tag may be attached to a secondary antibody. Detection of the
tag may be electrical (e.g., electrostatic or electrochemical)
using a detection sensor, optical, etc.
Chip Packaging
[0348] The devices, systems and methods described herein can use a
microfluidic platform that utilizes integrated circuit components
and semiconductor devices. In traditional semiconductor packaging,
heat is typically removed from the top of the silicon chip, that
is, the side away from the Printed Circuit Board (PCB). Typically
less than 10% of the heat is removed downward into the PCB.
[0349] In the case of the microfluidic integrated circuit (IC)
packages, heat may not be easily removed from a surface because of
the presence of a fluidic chamber or flow cell. For example, a flow
cell can be directly in the heat transfer path, between transistor
junctions and any topside heat sink. Furthermore, the flow cell can
be made of glass or plastic, which can be poor conductors of heat.
The flow cell can also have chambers containing liquids and/or gas
that can boil and be prevented from performing their function.
Also, flow in a flow cell can be temperature dependent.
[0350] Recognized herein is the need for improved systems for
microfluidic IC packages. In these cases, a semiconductor package
comprising a PCB can be modified in order to efficiently remove
heat through the backside (i.e., the bottom of the chip attached to
the PCB).
[0351] In an aspect, the present disclosure provides systems for
optimizing heat flow such that it is directed away from integrated
circuit components in a microfluidic semiconductor device. In an
aspect, the disclosure provides a microfluidic semiconductor
packaging system for establishing an efficient heat path. The
system can comprise (a) a package substrate; (b) a microfluidic
chip mounted onto the package substrate; (c) a microfluidic flow
cell proximate to the microfluidic chip and attached to the package
substrate; (d) a printed circuit board proximate to the package
substrate, where the printed circuit board has a cut-out; and (e) a
heat sink where at least a portion of the heat sink is placed
through the cut-out of the printed circuit board such that a heat
flow path is established from the microfluidic chip down to the
heat sink.
[0352] In some cases, the microfluidic chip may be mounted onto the
package substrate by one or more clamps. A clamp may secure the
microfluidic chip to the substrate by applying pressure to the
microfluidic chip such that it applies pressure to and contacts the
package substrate. Such a configuration may be useful in modulating
thermal contact resistance between the microfluidic chip and the
package substrate. In some cases, one or more clamps may aid in
minimizing the variation of pressure exerted on the microfluidic
chip in its contact with the package substrate. Minimizing such
pressure may be useful in minimizing the variability in thermal
contact resistance between the microfluidic chip and the package
substrate. In some embodiments, one or more clamps may be exert a
pressure on a microfluidic chip such that the pressure exerted by
the microfluidic device on the package substrate across the
microfluidic device's contact with the package substrate varies by
no more than 50%, 45%, 40%, 35%, 30%, 25%, 20%, 19%, 18%, 17%, 16%,
15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or
1%.
[0353] In some cases, the system further comprises fins attached to
the heat sink for the efficient transfer of heat. In some
instances, the heat sink is electrically isolated from the
substrate package by at least one of anodizing and chromate
conversion of the heat sink. In some embodiments, the heat sink is
composed at least in part of aluminum nitride. The system can
further comprise a heat slug proximate to the package substrate. In
some embodiments, the system can further comprise a Peltier device
or other similar device that can aid in temperature control inside
the system.
[0354] For example, in an aspect, the present disclosure provides a
system for achieving heat flow from the silicon chip to a die
attach pad within the semiconductor package. This system can
include metal-filled vias in a tight pitch array and also
power/ground planes directly below the chip shadow to spread the
heat laterally from chip hot spots.
[0355] The substrate can be made of any material used in
semiconductor packaging, such as for example, alumina, aluminum
nitride, and beryllium oxide. In order to achieve more effective
thermal conductance through the semiconductor package, the vias can
be filled with metal. Any suitable metal can be selected, such as
for example, gold or copper. The metal-filled vias can provide a
high thermal conductivity path through the substrate material.
[0356] The bottom layer of the package can have a metal heat
spreader in addition to any electrical contacts required by the
design. The die can be connected to the die paddle by a high
thermal conductivity die attach adhesive. Any suitable metal can be
used for the metal heat spreader. The high thermal conductivity die
attach adhesive can include glue adhesive or any other type of
adhesive suitable for this function.
[0357] In another aspect, the package substrate can contain a "heat
slug", which is a flat metal square built into the substrate. The
slug can be the same thickness as the substrate and can be placed
directly below the center of the silicon die. The slug can be made
of copper or another thermally conductive metal.
[0358] In another aspect, the PCB to which the package is mounted
can have a cut-out to allow a metal-to-metal contact between the
last layer of the package and a metal heat sink that is pushed
through the PCB. Electrical routing on the PCB including power and
ground can be routed clear of this cut out area to avoid exposed
metal. The cut out can be placed directly beneath the die area of
the package, such that there is a vertical connection from the back
of the silicon chip through the package, forming a connection to a
heat sink without intervening PCB material.
[0359] FIG. 11A illustrates one embodiment of a microfluidic
semiconductor package 1100. Microfluidic chip 1110 is covered by a
microfluidic flow cell 1120. Both microfluidic chip 1110 and
microfluidic flow cell 1120 are supported by a package substrate
1140. The package substrate 1140 is mounted onto a printed circuit
board 1160. The printed circuit board 1160 has a cut-out to allow
the metal heat 1180 to contact the package substrate 1140. FIG. 11B
shows a top view of microfluidic semiconductor package 1100. The
dashed lines in the figure indicate that the microfluidic flow cell
1120 covers microfluidic chip 1100. FIG. 11C shows a top view of
just the printed circuit board 1160 with the heat sink 1180
underneath in order to illustrate the cut-out in the printed
circuit board 1160.
[0360] In yet another aspect, it may be desirable for the contact
between the heat sink and the back of the package to be made
efficiently. Heat transfer efficiency can be improved by including
solder, thermal grease, thermal adhesive, and/or by maintaining
pressure between the heat sink and the back of the package with the
aid of one or more clamps as described elsewhere herein.
[0361] In another aspect, air gaps that may act as thermal
insulation are reduced or eliminated by having the heat sink and
the back of the package flat and/or flush to each other.
[0362] In another aspect, the heat sink (or Peltier or heat pipe or
other heat transfer device) can be configured to efficiently
transfer heat from the package to the air for convective heat
transfer. The heat sink can have a portion with fins in order to
increase the surface area for a more efficiently transfer of heat.
FIG. 11D shows the microfluidic semiconductor package 1100 of FIG.
11A with a heat sink 1180 including fins 1185. In a further
embodiment, the air can be driven at high velocity across the heat
sink by fans to increase heat transfer efficiency. In some
embodiments, a thermometer may be embedded inside the heat sink to
measure its temperature. A temperature control board can receive
such temperature measurements from the thermometer and can be used
to control the chip temperature. The temperature control board can
control the chip temperature such that its temperature is
maintained at a desired set point with accuracy of about
+/-5.degree. C., +/-4.degree. C., +/-3.degree. C., +/-2.degree. C.,
+/-1.degree. C., +/-0.9.degree. C., +/-0.8.degree. C.,
+/-0.7.degree. C., +/-0.6.degree. C., +/-0.5.degree. C.,
+/-0.4.degree. C., +/-0.3.degree. C., +/-0.2.degree. C.,
+/-0.1.degree. C., +/-0.05.degree. C., +/-0.01.degree. C.
+/-0.005.degree. C., +/-0.001.degree. C., or less. In some
embodiments, such temperature control can be useful in controlling
chip temperature in the ranges of 10.degree. C. to 100.degree. C.,
10.degree. C. to 75.degree. C., 10.degree. C. to 50.degree. C., or
10.degree. C. to 30.degree. C.
[0363] In another aspect, the heat sink can be electrically
isolated from the package. This can be accomplished by anodization
or chromate conversion of the heat sink. Alternatively, an
electrically insulative but thermally conductive material can be
used to construct the heat sink, such as for example, aluminum
nitride.
[0364] In another aspect, the use of heat pipe or other two-phase
cooling system can be used instead of a copper block or Peltier
device to remove heat from the back side of the chip. In one
embodiment, the heat pipe can be attached to the back of the chip
package. The heat pipe can remove the heat from the back of the
device (e.g., where the liquid can be condensed and heat can be
transferred to a heat sink). A heat pipe is a closed tube or other
shape that has a "hot end" and a "cold end". At the hot end, a
suitable liquid (preferably an inert, low boiling point,
non-corrosive, high heat capacity liquid) boils when the hot end is
placed in contact with the device that is to be cooled. At the cold
end, the vapors can be condensed, and transfer the heat from the
latent heat of condensation to a heat sink, radiator, or other
cooling device. Gravity can then transfer the liquid back from the
cold end to the hot end of the heat pipe. In order to use gravity,
the cool end of the heat pipe can be at the same level as, or above
the hot end.
[0365] In another aspect, the cooling technique can include a heat
pipe and spray cooling. This two-phase cooling technique can
involve spraying coolant in a fine aerosol mist onto the back side
of the chip package (where it may evaporate). This can take place
in a closed chamber to prevent any liquid from escaping. The liquid
can be an inert fluoro-hydrocarbon or other material that has a
boiling point at or near the temperature that is required to be
maintained on the backside of the chip. The latent heat of
condensation can be absorbed by the vapor and pumped away to a
condenser where the heat can be transferred to a heat sink. The
cooled liquid may then be returned to the chamber via a pump or
compressor.
Reagent Handling and Fluidic Systems
[0366] Recognized herein is the need for improved systems and
methods for inputting biological/chemical reagents into a
microfluidic system as well as storing these compounds.
[0367] The present disclosure provides systems and methods for the
storage of biological/chemical compounds as well as delivery into a
microfluidic system. These systems can be removable and/or
reusable.
[0368] The present disclosure provides integration of a reagent
input device with a microfluidic flow cell for the analysis of
biological and chemical reactions of interest. In some embodiments,
such a configuration includes various inputs, which can include
inputs for dNTPs (e.g., for sequencing reactions), and may also
contain buffers, salts, enzymes (e.g., polymerase or phosphatase)
or any other moieties (e.g., as required for incorporation of
nucleotides). In some embodiments, inputs for various buffers, wash
reagents, or polymerase containing buffers can be included. These
fluids may also contain salts and any other moieties for
polymerization, for stripping coatings from the flow cell, or for
re-coating the flow cell.
[0369] In an aspect, the present disclosure provides an apparatus
comprising: (a) a cartridge that holds a plurality of reagent bags,
where each reagent bag has an inner chamber and an outlet, where
the inner chamber is filled with a fluid; (b) a valve connected to
each reagent bag which regulates the outlet of the bag; and (c) a
plurality of needles connected to the valves and reagent bags,
where each needle is in contact with a seal proximate to the outlet
of the bag and each needle is at least partially in the inner
chamber of the bags for connecting the reagent bags with a manifold
of a microfluidic device.
[0370] In some embodiments, the reagent bags are held by a support
inside the cartridge.
[0371] The apparatus can further comprise an air inlet tube for
modulating pressure inside the cartridge. In some cases, the
reagent bags are shaped to be at least one of rectangular, folded
at the top with a flat bottom, triangular, and oval.
[0372] The seal can comprise a bottom layer, a middle layer, and a
top layer. The middle layer can be formed in a washer shape with a
cut out portion in order to prevent leakage of the fluid. The
apparatus can further comprise an additional outer layer associated
with the cartridge for collecting waste.
[0373] In another aspect, the present disclosure provides an
apparatus comprising a flexible container that has an inner chamber
and an outlet, where the inner chamber is filled with a fluid and a
valve regulates the outlet of the container, the flexible container
being used to deliver fluid to a channel connected to the outlet
via pressure applied to the container. The apparatus can further
comprise a balloon located inside the flexible container that may
be inflated and deflated for mixing the fluid in the container.
[0374] In one embodiment, as shown by a side view in FIG. 12, the
reagent input device can have a cartridge 1200 which holds multiple
bags filled with reagents, illustrated as reagent bags 1220. The
cartridge 1200 may be connected to the flow cell via needles 1260
that make contact with the reagents as well as the valving system,
or manifold 1290, of the flow cell. In one embodiment the cartridge
1200 houses reagent bags 1220 that may be held by a support 1240
where the support 1240 allows for a needle 1260 to pierce the bag
through a seal 1280. The needle 1260 makes a fluidic connection
between the reagents in reagent bags 1220 and the manifold 1290. In
some embodiments, there may be an air inlet tube 1265.
[0375] In some embodiments, the pressure in the cartridge 1200 is
larger than the pressure inside the manifold 1290, and this
pressure can be modulated in order to control the flow of reagents
from reagent bags 1220 into the microfluidic channels of manifold
1290. FIG. 12 shows, in an exemplary embodiment, six reagent bags
1220 which may correspond to the nucleotides A, T, C, and G or
other suitable nucleotides as well as buffer solutions 1 and 2 used
for nucleic acid (e.g., DNA) sequencing. In other embodiments,
there may be 1, 2, 5, 10, 50, 100, etc. reagent bags for any type
of experiment or procedure of interest.
[0376] The reagent bags 1220 may be folded at the top (as shown)
with a flat bottom, or they may be rectangular, oval, triangular,
or any other shape. The bags may be made of a polymer, plastic,
paper, metal, etc. or any other material. Likewise, the support
1240 may be rectangular with cut-outs to hold the reagent bags. In
the embodiment shown in FIG. 12, the perimeter of the cut-out is
equal to the circumference of the reagent bags in order to help
ensure a good fit and to help hold the bags upright. In other
embodiments, the support 1240 may have any other shape and
mechanism to help hold the reagent bags in place. In a further
embodiment, the reagent bags may be configured or shaped such that
there is no need for a support.
[0377] FIG. 13A shows, in another embodiment, a close-up side view
of the reagent input device with just one reagent bag (to better
illustrate one embodiment of the construction of the device--a
device can include more than one reagent bag). In this embodiment,
cartridge 1300 holds reagent bag 1300 which is held by support
1340. The needle 1360 is in fluidic contact with the reagent bag
1320 and seal 1380 forms and airtight/watertight interface between
reagent back 1300 and manifold 1390. The needle 1360 serves as the
conduit between reagent bag 1320 and a microfluidic channel 1395 of
the manifold. The flow of reagents into the manifold may be
controlled by valves in the manifold (not shown). In some
embodiments, the cartridge pressure 1305 may be higher than the
manifold pressure 1310.
[0378] FIG. 13B shows a close up, expanded view of seal 1380 in one
embodiment. The top layer 1382 and the bottom layer 1386 are shown
in this embodiment to be circular and may be comprised of any
material such as for example rubber, plastic, glass, etc. The
middle layer 1384 is shown to be formed in a washer shape with a
portion 1384A that is cut out in order to help ensure that if there
is any leakage, it will be air not fluid.
[0379] In a further embodiment, there may be a hard element, such
as a hard plastic material, incorporated into the bag so that the
needle does not pierce the bag as it becomes empty. Depending on
the use of a support structure and how the bag collapses as it
empties, there may or may not be a need for a hard element to
protect the bag from the needle. In a further embodiment, the bag
may be made of a material that cannot be pierced by the needle.
[0380] Although FIG. 13B shows the layers of the seal to be
circular, they may be any other shape such as for example
rectangular, oval, triangular, etc. The seal may only have one
layer, or it may have two, three, five, ten, etc. or any other
number of layers.
[0381] The pressure inside the cartridge and outside of the
cartridge may be less than 1, 1, 2, 5, 10, etc. atm so long as
there is a difference in pressure such that the input of the
reagents may be controlled and leakage of air/fluid may be
minimized or eliminated.
[0382] FIG. 14 shows, in another embodiment, a top view of the
cartridge 1400, but with a double chamber configuration. The inner
chamber 1410 holds the reagent bags and has inlets 1415 for the
needles and optionally for the air tube. The outer chamber 1420 may
be used to collect waste from the manifold and has a waste inlet
1425. As can be seen from this top view, the reagent bags are
placed according to the position of the inlets 1415 and they may be
arranged in a staggered configuration (shown), in a linear
configuration, in a circular configuration, or any other type of
configuration. In a further embodiment, the cartridge may have a
single chamber with a waste inlet such that the waste empties
directly into the same chamber that houses the reagent bags.
[0383] In some embodiments, the reagent input device and cartridge
may be fabricated such that they are "tamper proof". The device may
be sealed off such that the reagent bags cannot be easily accessed.
In one embodiment, for example, the cartridge may be welded
shut.
[0384] In another embodiment, as shown in FIG. 15, the reagent
input device may have flexible reagent containers, such as for
example balloons 1520, instead of or in addition to the reagent
bags that are housed inside a cartridge 1500. The liquid may enter
the reagent balloon 1520 and fill it up such that the balloon is
under pressure. The reagent balloon may be made of a variety of
materials, depending on the needs of the system and the type of
regent used. Some sample materials that may be used include rubber,
polyurethane, silicone, etc. or another material.
[0385] Then, the balloon may be sealed by any method known to those
skilled in the art, such as for example a valve or another type of
mechanism for controlling flow.
[0386] When the seal is opened at the appropriate time, the liquid
will flow out of the balloon 1520 and into the manifold 1590 due to
the pressurized environment inside the balloon 1520. The balloon
1520 may be in fluid contact with the manifold 1590 by any method
known to those skilled in the art. In some embodiments, the balloon
may be connected to a tube that leads into the manifold of the
system.
[0387] In another embodiment, as shown in FIG. 15 a balloon 1535
may be located inside reagent bags 1520 or another reagent
container. The balloon 1535 may be used to mix reagents 1520 inside
the reagent bags 1520 such that there are no or minimal bubbles
formed inside the liquid due to the mixing. The balloon 1535 may be
inflated and deflated by, for example, attaching the balloon 1535
to an air tube 1565 that is connected to a manifold 1590. Air may
rush in and out of the balloon 1535 during the desired time, such
that the balloon 1535 is inflated and deflated at a set frequency.
This inflation and deflation of the balloon 1535 will cause the
reagents 1520 inside the bag 1520 to mix.
[0388] In yet another embodiment, a reagent container may contain a
flat surface on a moveable mechanism, such as for example on
washers. The flat surface may be pushed either up or down, such
that the liquid is pushed out when the flat surface is pushed
down.
[0389] In some embodiments, the apparatuses described here can hold
fluids and/or gases. The apparatuses may hold reagents such as
nucleotides, buffers, polymerase, water, air, etc. or other
reagents known to those skilled in the art. In some embodiments,
the reagents may be reagents used for DNA sequencing and/or DNA
amplification.
[0390] In another aspect, the device does not use fluids in a bag.
The fluid can be stored in a cartridge that is connected to the
chip by a fluidic manifold. The fluidic manifold does not have any
hoses or pipes in some cases. The manifold can be designed such
that the system does not form gas bubbles (e.g., air) when
operated. In some cases, the system is operated for at least about
1 minute, at least about 20 minutes, at least about 1 hour, at
least about 5 hours, or at least about 10 hours without forming a
bubble. FIG. 17 shows four different embodiments of a manifold
design for transporting reagents and other moieties through a
microfluidic device. The lines interior to the device are fluidic
flow paths 1700. FIG. 18 shows a photograph of one embodiment of a
manifold. Valves can be in contact with the fluidic flow paths and
the openings thereto on the manifold. FIG. 19 shows one embodiment
of a manifold design with associated valves 1900. The valves can be
fluidically connected to the manifold in any suitable way. For
example, FIG. 20 shows one embodiment of a tubeless system where
there is a direct connection between a manifold and a cartridge by
use of o-rings 2000.
[0391] The manifold can be washed. In one embodiment, a software
script is used to wash a manifold of a microfluidic device between
nucleotide injection and buffer cycles (e.g., in order to prevent
contamination with respect to the reaction of interest, such as for
example nucleic acid (e.g., DNA) sequencing). The script below
shows how a "barrier" wash cycle can be initiated between
nucleotide and buffer injections during a sequencing run:
[0392] ;subscript that creates diffusive barrier|
[0393] ;before purging the next fluidic line|
[0394] ;Use B2 to keep chip pressurized between steps|
[0395] :Barrier|
[0396] Valve Preset:No Liquid Flow|0.25
[0397] Valve Preset:Prime B2|0.25
[0398] Valve Preset:Wash B2 BW S|0.50
[0399] Valve Preset:Wash B2 S and M|0.25
[0400] Valve Preset:Wash B2 B1 M|0.50
[0401] Valve Preset:Backflow B2 and B1 Nuc|1.00
[0402] Valve Preset:Backflow B2 Nuc|3.00
[0403] Valve Preset:Backflow Nuc and B2 Nuc|0.50
[0404] Valve Preset:Backflow B2 Nuc|2.00
[0405] Valve Preset:Wash B2 M|0.50
[0406] Valve Preset:Prime B2|0.25
[0407] Valve Preset:No Liquid Flow|0.25
[0408] |
[0409] |
[0410] ;subscript that creates diffusive barrier|
[0411] ;before purging the next fluidic line|
[0412] ;Use B2 to keep chip pressurized between steps|
[0413] :shortBarrier|
[0414] Valve Preset:Wash B2 S|0.25
[0415] Valve Preset:Wash B2 S and M|0.25
[0416] Valve Preset:Backflow B2 G|0.50
[0417] Valve Preset:Wash B2 B1 M|0.50
[0418] An example of the results of a washing of the manifold can
be seen by comparing the sequencing data of FIG. 21A and FIG. 21B.
There are relatively more peaks visible without the washing script
(FIG. 21A) than with the washing script (FIG. 21B).
Fluidic Connectors
[0419] The methods and devices described herein may be used to
sequence a nucleic acid. Such devices may utilize microfluidic
platforms for DNA sequencing or other associated testing of
biological matter. These systems can avoid contamination when
transferring fluid from a reagent package into the system manifold
via a connector system. This system can achieve substantially
contamination-free fluid transfer between devices (e.g., less than
about 1%, less than about 0.5%, less than about 0.1%, less than
about 0.05%, or less than about 0.01% contamination).
[0420] Recognized herein is the need for improved connector systems
for clean and effective fluid transfer. The present disclosure
provides a push-to-connect connector system for providing fluid
(liquid or gas) transfer between fluidic components.
[0421] In one embodiment, a push-to-connect connector system can be
used in conjunction with fluidic cartridges that may house reagents
for use in an associated device. This device may be, for example, a
DNA sequencing device and the push-to-connect connector system can
allow for the connection and transfer of biological reagents used
in DNA sequencing. Some exemplary biological reagents may include
nucleotides, buffers, and blood.
[0422] In some aspects, the present disclosure addresses the need
for a low-cost, leak-proof, multiple channel, quick-connect,
quick-disconnect and substantially contamination-free fluid flow
connector that transfers fluid between two fluidic components. This
connector may allow for a connection to disposable cartridges that
can house, for example, biological reagents. By adding a simple
latch mechanism, the system may also be used as an inline connector
to connect two flexible or rigid pipes. It also can be used to
connect two fluidic devices directly to each other. The connector
assembly allows not only a substantially leak-proof structure, but
also a way of delivering fluid such that there can be a lower risk
of contamination into the system from unwanted exposure to
contaminants from outside sources, such as air pollutants.
[0423] Moreover, the female side of the system can include plastic
and rubber injection-moldable parts that can be manufactured at a
low cost. The system may be connected and/or disconnected by a
simple push/pull action and as a result it can be used to connect
multiple fluid channels at the same time. The female connector can
be designed in such a way that it may include a removable seal to
be taken off before the first insertion. In some embodiments, the
female connector may be disposable.
[0424] In an aspect, provided herein is a push-to-connect connector
system for fluid transfer comprising: (a) a female connector
comprising a hollow cavity and multi-layer seals within a top
portion of the cavity, the multi-layer seals having a pin receiving
channel; (b) a male connector comprising a fluid transfer pin
having first and second ends, a pin inlet channel extending between
the first and second ends, and at least one fluidic transfer inlet
proximate to the first end, the fluid transfer pin being moveable
from a first position, where the pin is positioned in the interior
of the male connector, to a second position, where the pin extends
between the male connector and the female connector and into the
pin receiving channel; (c) a cover sleeve proximate to the male
connector, the cover sleeve being axially displaceable such that it
moves from a first position where it is flush with the first end of
the fluid transfer pin, to a second position where the cover sleeve
is located around the male connector, the cover sleeve and the pin
being coupled to move the pin from the first position to the second
position; and (d) a fluid cartridge connected to the female
connector such that there is fluid contact when the pin is in the
second position. In some embodiments, the connector system further
comprises at least two push-to-connect connector assemblies.
[0425] In some cases, the female connector further comprises a
removable protective cover. The female connector can be
disposable.
[0426] As shown in FIG. 22, in some embodiments, the
push-to-connect connector system 2200 may include two
sub-assemblies: a female connector 2201 and a male connector 2202.
The male connector 2202 may be configured to be mounted onto the
female connector 2201. In some embodiments, the female connector
2201 may be integrated with a fluid cartridge 2205 and the male
connector 2202 can be screwed into an associated device, product,
fluidic manifold, etc.
[0427] In one aspect, as shown in FIG. 23A, the push-to-connect
connector system 2300 may include a fluid cartridge 2305, a male
connector 2302 which comprises a fluidic transfer pin 2310 with
associated fluidic transfer inlets 2315, a spring holder 2320, and
a cover sleeve 2340. The cover sleeve 2340 can protect the sides of
fluidic transfer pin 2310 from potential contaminants. In some
embodiments, there may be a spring (not shown) inside the spring
holder 2320 to ensure that the cover sleeve 2340 covers the fluidic
transfer pin 2310. In another embodiment, the female connector 2301
may include a multi-layer flexible seal 2360 with an associated pin
receiving channel 2365, and a receiving chamber 2380. The female
connector may be proximate to outlet channel 2385 which may lead to
the fluidic reservoir of a cartridge 2305. The fluid transfer pin
2310, receiving chamber 2380, and other components of
push-to-connect connector system 2300 can be made of a wide variety
of materials known to those skilled in the art. For example, the
components may be made of metal and/or plastic. Examples of
potential materials include brass, stainless steel, and
polycarbonate. In some embodiments, the multi-layer flexible seal
2360 can be made of rubber and/or o-rings.
[0428] In another aspect, as shown in FIG. 23B, the male connector
2302 may be aligned with the female connector 2301. Then, the male
connector 2302 can be placed in physical contact with the female
connector 2301. If the female connector 2301 is disposable, it may
have a peel-off cover to protect it from potential contamination
before use. A force may be applied along the axis of the fluidic
transfer pin 2310 such that fluidic transfer pin 2310 is driven
through the multi-layer flexible seal 2360 and inside the receiving
channel 2365, thereby displacing cover sleeve 2340 in an upward
direction. At this stage the flat face of fluidic transfer pin 2310
is fully covered by one portion of multi-layer flexible seal 2360
in order to help avoid potential contamination.
[0429] In a further aspect, as shown in FIG. 23C, a force may be
further applied to the push-to-connect connector system 2300 such
that a portion of the multi-layer flexible seal 2360 enters the
receiving chamber 2380. At this stage, the fluidic transfer pin
2310 may be in fluidic contact with the outlet channel 2385. Thus,
the fluid from the fluid cartridge 2305 can pass through outlet
channel 2385 and into fluid transfer inlets 2315. The fluid may
then pass through a pin inlet channel (not shown) along the axis of
fluidic transfer pin 2310 and then reach the associated device (not
shown) in fluidic contact with male connector 2302.
[0430] FIG. 23D illustrates, in one embodiment, a cross section of
fluid transfer pin 2310, including a pin inlet channel 2317 for the
transfer of fluid from fluid transfer inlet 2315 to an associated
device (not shown).
[0431] FIG. 24A shows, in one embodiment, a fluid cartridge 2405
integrated with female connectors 2401.
[0432] FIG. 24B shows, in another embodiment, the reservoirs 2407
that can be located inside the fluid cartridge 2405. In some
embodiments, there may be two push-to-connect connector assemblies
(not shown) for each reservoir 2407: one connector assembly may
function as an inlet port for pressurized gas and the second
connector assembly can be the outlet port for liquid. In some
embodiments, when the pressurized gas is applied and passed through
the first connector system, the pressurized gas can drive the
liquid out of cartridge 2407, through the second push-to-connect
connector system, and into an associated device. One embodiment of
this type of configuration is shown in FIG. 22 where there are two
push-to-connect connectors (each with one female connector 2201 and
one male connector 2202) associated with one fluid cartridge
2205.
Lids for Microfluidic Systems
[0433] Recognized herein is the need for improved devices and lids
that prevent leakage of fluids from microfluidic devices. In an
aspect, the present disclosure provides lid devices for
microfluidic systems to minimize or eliminate leakage of fluid.
[0434] When designing a microfluidic semiconductor device, one
consideration can be the design of a lid for the system. The lid
can contain the fluid within the chamber, protect the semiconductor
device surface, maintain a uniform flow rate across the
semiconductor device surface, and allow users to visually inspect
its operation while in use.
[0435] The lid may be made out of a variety of materials. Some
examples include polycarbonate, glass and/or acrylic materials. The
lid may be entirely made out of one material, two materials, or a
variety of materials. The selection of the material or materials
may depend on the specifications of the system as well as its
intended purpose. For example, a lid may block Ultra-Violet light
at a certain wavelength, may be biocompatible, and may be optically
clear and/or withstand certain types of chemical treatments.
[0436] In addition to the composition of the lid, the shape and
attachment methods with respect to the lid may also be considered
when designing the system. Microfluidic semiconductor devices may
include liquid(s) contained therein. If the lid is not properly
designed and/or attached to the system, the liquid may leak out of
the microfluidic chamber and damage other portions of the
semiconductor device.
[0437] In an aspect, the present disclosure provides a device for
covering a microfluidic semiconductor device. The device can
comprise a lid, where the lid comprises a substantially planar top
portion, a first prong and a second prong, where the first and
second prongs support the lid on a substrate and define a
microfluidic chamber. The device can comprise a plurality of beads
where the first and second prongs are proximate to, and exert
pressure on, the beads for fluidically sealing the microfluidic
chamber and where the beads are in contact with the substrate. In
some cases, the lid comprises at least one of polycarbonate, glass,
and acrylic.
[0438] In another aspect, the present disclosure provides a device
for covering a microfluidic semiconductor device. The device can
comprise a lid, where the lid comprises a substantially planar top
portion, a first prong and a second prong, where the first and
second prongs support the lid on a substrate and define a
microfluidic chamber. The device can further comprise a tapered
portion on the lid or substrate contacting the lid where the
tapered portions are proximate to the prongs for holding an
adhesive in order to fluidically seal the microfluidic chamber. The
adhesive can hold the prongs to the substrate. The lid can comprise
at least one of polycarbonate, glass, and acrylic. In some cases,
the device can have a groove within the substrate into which a
gasket may be inserted.
[0439] In one embodiment, as shown in FIG. 25, a lid 2500 with a
substantially planar top portion 2505 rests on a base 2540 with
beads 2520 inside and the pressure of a first prong 2510 and a
second prong 2515 on the beads 2520 seals the microfluidic chamber
2560 of the device, to the height of the beads 2520, from the rest
of the system. The beads 2520 rest on base 2540. The beads can be
glass or any other rigid material.
[0440] In another embodiment, as shown in FIG. 26, a lid 2600 with
a substantially planar top portion 2605 is attached directly to a
base 2640 via a first prong 2610 and a second prong 2615 using an
adhesive 2625. In some embodiments, the adhesive 2625 may be an
epoxy that is either heat or UV cured. The width of the adhesive
may be about 10 micrometers (.mu.m), about 20 .mu.m, about 50
.mu.m, about 75 .mu.m, about 100 .mu.m, about 200 .mu.m, about 500
.mu.m, or more. The height of the adhesive can be about 10 .mu.m,
about 20 .mu.m, about 50 .mu.m, about 75 .mu.m, about 100 .mu.m,
about 200 .mu.m, about 500 .mu.m, or more.
[0441] In some embodiments, the sides of the lid 2600 may be
tapered 2680 such that the adhesive 2625 is pushed away from the
microfluidic chamber 2660. This creates a region that is filled
with adhesive 2625 in order to prevent leakage, yet this region is
not within the microfluidic chamber 2660 itself. In this manner,
the height of the microfluidic chamber 2660 is set by a first prong
2610 and a second prong 2615 of the lid 2600 and not by the
adhesive 2625 itself. Furthermore, this allows for wider tolerances
on the placement, width and height of the adhesive 2625 since the
adhesive 2625 does not need to rest on the prongs and it does not
set the chamber height.
[0442] In another embodiment, the lid may have a groove within the
substrate that is in contact with the semiconductor device surface
so that a gasket can be inserted. This gasket can act as the main
seal to prevent the fluid from leaking out and the adhesive may be
used to hold the lid and gasket in place. This can allow for a more
constant distance between the semiconductor device surface and the
lid as well as a more uniform seal.
Control of Microfluidic Systems
[0443] Recognized herein is the need for improved systems and
methods for controlling microfluidic devices in an efficient and
cost effective manner. The present disclosure provides systems and
methods for controlling microfluidic devices and their associated
biological samples, carrier particles, reagents, and other
moieties.
[0444] In an aspect, the present disclosure provides a system
comprising a substantially planar nano-sensor array where the array
can comprise electrodes for generating gas bubbles for controlling
the movement of moieties, with the nano-sensors being located
within pixels. In some cases, the gas is air.
[0445] In an aspect, the present disclosure provides a system,
comprising a substantially planar nano-sensor array where the array
can comprise electrodes proximate to electrically sensitive charged
protein structures for controlling the movement of moieties, with
the nano-sensors being located within pixels.
[0446] In some embodiments, a sample of interest, such as DNA or
another nucleic acid molecule, can be associated with a plurality
of magnetic carriers. For example, sample DNA can be fixed to
magnetic beads. The combined nano-magnetic-electronic platform can
include an array of magnetic features such that beads are held in
place by a localized magnetic field in each of a plurality of
regions. In some embodiments, the beads can be held by
electrostatic force due to the charge of the bead or nucleic acid
associated with the bead. In some cases, the beads can be held in
physical trenches or wells.
[0447] Described herein are modifications to the aforementioned
systems and various methods and systems for capturing and
controlling beads or other particles. Electrodes can be used to
generate a gas bubble, generate an electric field, and detect a
reaction of interest.
[0448] In some embodiments, electrodes can be used to create gas
bubbles. The gas bubbles can be formed by electrolysis of water
(e.g., to form O.sub.2 and H.sub.2 gas). The size and duration of
the gas bubbles can be controlled by modulating the voltage
associated with the electrodes. These gas bubbles can be created in
the electrodes of the pixels of the array, next to the magnets also
associated with these pixels.
[0449] In some embodiments, as shown in FIGS. 27A-27E, the voltage
to electrodes 2720 located on a substrate 2710 may be controlled
such that the creation of gas bubbles 2730 is timed to achieve a
desired function. For example, in order to help remove beads 2700
from a magnet 2740 once a desired reaction is complete, the gas
bubble 2730 may be generated on one or more electrodes 2720 near
the magnet 2740 and bead 2700. Then, the gas bubble 2730 may be
made to collapse 2735 through a variety of methods, including
voltage modulation, fluid degassing, and ultrasonic shock. The
collapse 2735 of the gas bubble 2730 in close proximity with the
bead 2700 may create enough force to dislodge the bead 2700 from
the magnet 2740. This can, as shown in FIGS. 27D-27E, thereby
release the bead 2700 from the magnet 2740 at a desired time.
[0450] In some embodiments, the position of the gas bubble can be
controlled via modulation of the voltage associated with the
electrodes. The gas bubble may then be used to help direct beads
and/or other particles in the system to a desired location.
[0451] In some embodiments, as shown in a top view in FIG. 28A, a
pixel 2890 in an array may include an outer electrode 2825, inner
electrodes 2820, a magnet 2840, and a bead 2800. FIG. 28B shows
that after a certain voltage is applied, outer electrodes 2825 may
generate gas bubbles 2830 around the perimeter of a pixel 2890.
This allows for an gas bubble "cage" around the pixel 2890, thereby
isolating it from neighboring pixels in an array. This isolation
can help to reduce cross-contamination between pixels and help
contain reagents and/or moieties within the pixel 2890.
[0452] In yet another embodiment, as shown in FIG. 29A, there may
be an array of wells 2955 in a substrate 2910 used to capture beads
2900 either in place of or in addition to magnets 2940. The gas
bubbles 2930 generated by the upper electrodes 2925 may be used to
cover the top of the well 2955 and control which reagents have
physical access to the well 2955 and at which time. Thus, the gas
bubble 2930 may act as a "gate" for the well 2955 and allow for an
additional layer of control of the system. The gas bubble 2930 may
be removed by modulating the voltage applied to upper electrodes
2925. There may also be detection electrodes 2920 for the detection
of reactions of interest on or proximate to a bead 2900 in a well
2955.
[0453] In a further example, as shown in FIG. 29B, the system of
FIG. 29A may be placed vertically in a device and the gas bubble
2930 may aid in containing a bead 2900 in the well until a desired
release time. In some embodiments, the array and a corresponding
chip may be placed vertically instead of horizontally. There may be
an array of wells 2955 where there are upper electrodes 2925 and
magnets 2940 associated with each well 2955. Gas bubbles 2930 may
be generated by the upper electrodes 2925 and can be used to "gate"
the wells 2955, thereby helping to control the flow of particles in
and out of the wells 2955. For example, the gas bubbles 2930 may be
generated to keep beads 2900 inside the wells 2955 and then may be
removed when beads 2900 are to be released. Since the array has a
vertical orientation, the beads 2900 can fall out of the wells in
the absence of the gas bubble "gate" due to gravity overcoming the
magnets 2940.
[0454] In some cases, in either vertically or horizontally oriented
arrays, there may be controllable electromagnets associated with
each well, where the modulation of the electromagnets can allow for
the capture or for the release of the magnetic beads. In some
instances, there may be no magnet and the movement of the beads can
be directed by generating and removing gas bubbles.
[0455] The disclosure also provides additional methods to control
flow into a well. In some cases, a circular electric ring can be
placed around the outside of a well. The electric ring can have an
electric field associated with it such that charged particles or
other charged species are directed into the well. This may enable
more efficient reactions as particles of interest reach the well
more quickly.
[0456] In some cases, as shown in FIG. 30A, a charged protein
structure 3030 may be used to gate an array of wells 3055 located
on a substrate 3010. This structure may be attached to upper
electrodes 3025 by any suitable method, such as ionic or covalent
bonds. The charged protein structure 3030 is shown with an outer
casing, but in some cases it may not have an outer casing. As shown
in FIG. 30B, the charged protein structure 3030 may be used as a
"gate" to cover the well 3055 when electrically activated in order
to retain a bead 3000 and any associated moieties or reagents. The
structure 3030 may respond to electrical signals by either moving
over the well 3055 and/or expanding to cover the well 3055. The
well 3055 may also contain magnets 3040 and detection electrodes
3020.
[0457] Once the electrical signals are terminated, the charged
structure can move to open the entrance to the well. In some
embodiments, this structure may also be used with a
vertically-configured array.
[0458] In another embodiment, a bead may have a hollow channel
running through its center. An electrode and/or magnet can be
inserted through this channel such that an electrical and/or
magnetic gradient is formed. This configuration can create regions
on the bead with desired electrical and/or magnetic properties.
[0459] In another embodiment, as shown in FIG. 31A, an asymmetric
bead 3100 may be configured such that there is an inner magnet 3145
located one side of the bead 3100. In this embodiment, the bead
3100 is "asymmetric" with respect to the placement of the inner
magnet 3145. The asymmetric bead 3100 may rest on a magnet 3140
located proximate to a substrate 3110 and can be proximate to
detection electrodes 3120. Electric field lines 3130 generated by
the detection electrodes 3120 through the bead 3100 are
illustrated. The resulting orientation of the electric field lines
3130 throughout bead 3100 may allow for greater sensitivity with
respect to the electrodes 3120 detecting electrical changes
associated with the bead 3100 when reactions of interest are
occurring on or proximate to the bead 3100.
[0460] In a further embodiment, as shown in FIG. 31B, the
asymmetric bead 3100 may rest on a combined electrode-magnet 3160
for combined detection and bead retention. This combined
electrode-magnet 3160 may include many alternating layers of
various materials, such as for example platinum and magnetized
layers. The asymmetric bead 3100 with inner magnet 3145 may act as
part of electrode-magnet 3160. The electrode-magnet 3160 may act as
a transmitter electrode and an electrode 3165 may act as a receiver
electrode. In some embodiments, there may be two receiver
electrodes. In other embodiments, the electrode-magnet may consist
of a magnet located directly on top of an electrode.
[0461] In some embodiments, low-curie temperature magnets may be
used in order to control the temperature associated with a given
pixel. This may be used in situations where there are a variety of
different reactions of interested happening in different pixels in
the same array.
Droplet-Based Amplification
[0462] Recognized herein is the need for improved methods of
amplifying a nucleic acid sample.
[0463] The present disclosure provides droplet-based methods and
systems for emulsion-free nucleic acid (e.g., DNA) amplification.
These methods may be used in conjunction with a high throughput
reactor and/or sensor array system that may be used for the
detection and analysis of biological and/or chemical reactions of
interest. The individual reactor volumes may be, for example in the
microliter range, nanoliter range, or picoliter range or at larger
or smaller dimensions depending upon the particular application.
The reactors and/or sensors may be placed at spatial distances of
micrometers or nanometer or at larger or smaller distances
depending upon the particular application. The sensor modules may
be of a micrometer size or nanometer size or of larger or smaller
sizes depending upon the particular application. Systems described
herein useful for droplet-based methods and system for
emulsion-free nucleic acid amplification can include a sensor array
that can be referred to as a `reactor-sensor array`. The location
of each reactor or sensor in the array can also be referred to as a
`pixel`.
[0464] In an aspect, the disclosure provides a system comprising a
reactor-sensor array where the array comprises hydrophobic and
hydrophilic portions, where the reactors and/or sensors are located
within the hydrophilic portions and are used for the performance
and/or sensing of a biological reaction of interest. In some cases,
the system further comprises a magnetic array for binding magnetic
particles where at least one magnet is located within, or adjacent
to, or corresponds to at least one hydrophilic portion of the
array. The pixels can be circular, oval, rectangular, and irregular
shape.
[0465] An additional aspect the disclosure provides a system
comprising a hydrophobic substrate that can comprise an array of
hydrophilic regions; a plurality of sensors, with at least one
sensor located within or adjacent to each of the hydrophilic
regions; and a magnetic array, where at least one magnet of the
magnetic array is located within, or adjacent to each of the
hydrophilic regions. In some embodiments, the sensors can be used
for detecting a chemical reaction (e.g., a nucleic acid
amplification reaction, a nucleic acid sequencing reaction). In
some embodiments, the system can further comprise a module for
generating droplets of reagents for the chemical reaction. The
module can for example, generate droplets that comprise particles
such as for example beads (e.g., magnetic beads). In some
embodiments, the array of hydrophilic regions comprises an array of
wells. An individual well of the array can comprise a hydrophilic
region.
[0466] In some embodiments, the hydrophobic substrate can be
created by depositing one or more layers of a suitable hydrophobic
material on a substrate (e.g., a chip surface), such as, for
example, at least one of alkylsilanes, silicones, teflon,
hydrophobic phosphonates, hydrophobic carboxylates and
polycarboxylates, hydrophobic polythiols, fluoroalkylsilanes or any
combination thereof. The hydrophobic regions can comprise a
super-hydrophobic region (e.g., more hydrophobic than other parts
of the hydrophobic region), or be functionalized on a chip surface.
Moreover, in some embodiments, the hydrophilic regions may comprise
any suitable hydrophilic material such as, for example, at least
one of silicon oxide, an ozonized surface, silanes, PEGylated
silanes, proteins, dextrans, polysaccharides, hydrophilic polymers
(e.g., polysulphonic acids), polyacrylic acids, and/or zwitterionic
polymers or another hydrophilic modification. In some cases, the
hydrophilic regions may be patterned by a photoresist. In some
embodiments, the hydrophilic regions can comprise gold or
platinum.
[0467] The pixels of the system can be any suitable size. In some
cases, the pixels are at least about 1 micron, at least about 3
microns, at least about 5 microns, at least about 10 microns, at
least about 20 microns, at least about 50 microns or at least about
100 microns in diameter. In some cases, the pixels are at most
about 1 micron, at most about 3 micron, at most about 5 microns, at
most about 10 microns, at most about 20 microns, at most about 50
microns or at most about 100 microns in diameter.
[0468] The reactor-sensor array or another system described herein
can have electrodes. In some cases, there is at one or more
electrodes per pixel or hydrophilic region. The electrodes can have
a square, rectangular, circular, or curved shape.
[0469] A module for generating droplets, including droplets with
particles may comprise one or more devices that generate the
droplets such as, for example, a static spray nozzle, a movable
spray nozzle, a static array of spray nozzles, a movable array of
spray nozzles, an original printer head, and/or a modified printer
head. In some cases, droplets containing reaction materials and/or
particles (e.g., beads) can be generated at one location and can be
transported close to the reactor-sensor array or hydrophobic array
by air and/or an immiscible liquid such as oil, where the droplets
deposit on the hydrophilic regions.
[0470] In some instances, the droplets containing reaction
materials and/or beads are generated at one location of a chip, and
are transported to the reactor-sensor array locations through the
process of electrowetting (EW) or electrowetting on dielectric
(EWOD).
[0471] In another aspect, the present disclosure provides a system
comprising a reactor-sensor array, where a movable spray nozzle or
an array of spray nozzles deposit droplets of reaction material
onto locations of the array, and the reactions at these locations
are used for the performance and/or sensing of a biological
reaction of interest.
[0472] In another aspect, the present disclosure provides a system
comprising a reactor-sensor array of wells, where the bottom and
side walls of the well are hydrophilic and the regions separating
the wells are hydrophobic, and the reactor solutions and/or sensors
are located within each well, and the reactors and/or sensors are
used for the performance and/or sensing of a biological reaction of
interest. The droplets within the wells can be created by flowing
humid air and/or an immiscible liquid such as oil through the
chamber of the system, thereby displacing the reaction materials
from the body of the chamber while retaining the reaction materials
within the wells.
[0473] In another aspect, the present disclosure provides a method
for detecting a biological reaction of interest. The method
comprises (a) providing an array within a chamber with a plurality
of reactors and sensors and magnets where the array comprises
hydrophobic and hydrophilic portions, with the reactors and sensors
and magnets being located within the hydrophilic portions; (b)
flowing in a plurality of magnetic particles such that the
particles are immobilized by the magnets; (c) flowing in a solution
containing reagents; (d) introducing saturated humid air or an
immiscible fluid such as oil into the chamber such that droplets
form on the hydrophilic regions; and (e) detecting a reaction of
interest in each droplet using the sensors. The method can further
comprise using a Peltier device for temperature control. In some
cases, the reaction of interest is nucleic acid (e.g., DNA)
amplification.
[0474] An additional aspect of the disclosure provides a method for
generating droplets and, in some cases, detecting species in the
droplets. The method can comprise providing a chamber comprising an
array of sensors and magnets associated with the sensors, where the
array comprises hydrophobic and hydrophilic regions. The sensors
and magnets can be located within or adjacent to the hydrophilic
regions. The method can further comprise flowing a plurality of
magnetic particles over the array, such that the particles are
immobilized by the magnets to provide immobilized particles.
Additionally, the method can further comprise flowing a solution
containing reagents over the immobilized particles and generating
droplets of the reagents adjacent to the hydrophilic regions by
introducing an immiscible fluid into the chamber. In some
embodiments, species (e.g., reagents, products of chemical
reactions, detection species, etc.) can be detected in each droplet
using the sensors. One or more steps of the method may be repeated,
including the flow of the solution over the immobilized particles,
the generation of droplets adjacent to hydrophilic regions by
introducing an immiscible fluid into the chamber, and the detection
of species in the droplets using the sensors. In some embodiments,
the immiscible fluid is air (e.g., water-saturated air) or oil. In
some embodiments, a Peltier device can be used to control a
temperature inside the chamber. In some embodiments, the droplets
can be generated by flowing in the solution containing the reagents
from a first inlet and flowing in the immiscible fluid from a
second inlet.
[0475] In some embodiments, volume of a droplet can be at least
about 10 picoliters, at least about 50 picoliters, at least about
100 picoliters, at least about 200 picoliters, or at least about
500 picoliters, or at least about 1 nanoliters, at least about 10
nanoliters, at least about 50 nanoliters, at least about 100
nanoliters, or at least about 200 nanoliters. In some embodiments,
the volume of a droplet can be at most about 10 picoliters, at most
about 50 picoliters, at most about 100 picoliters, at most about
200 picoliters, or at most about 500 picoliters, or at most about 1
nanoliter, at most about 10 nanoliters, at most about 50
nanoliters, at most about 100 nanoliters, or at most about 200
nanoliters.
[0476] In some cases, large droplets are placed in corners of the
chamber with a heat source underneath. The conditions in the
chamber can be controlled in order to isolate pixels and prevent
contamination. In some embodiments, droplets may be placed in a
corner of the chamber with a heat proximate to one or more of the
droplets. In some embodiments, the droplets may be isolated from
each other.
[0477] In some cases, the droplets can be generated in the chamber
by flowing in the solution (e.g., containing aqueous reaction
material) from one inlet and flowing in the immiscible fluid (e.g.,
oil, air) from another inlet. The droplets can be deposited on the
hydrophilic regions. In some embodiments, the droplets can be
transported via electrowetting (EW) or electrowetting on dielectric
(EWOD).
[0478] In some cases, sequential flows of template (e.g., such as
DNA or another nucleic acid) and an immiscible fluid such as oil
are flowed into the device, and an amplification reaction can be
performed after each flow of template, in some cases generating a
high fraction of array locations that have amplified template. In
some instances, sequential flows of nucleotides are used for
performing sequencing on nucleic acid (e.g., DNA) templates at each
array location. Nucleotide incorporations can be detected by the
sensors or other suitable mechanisms such as, for example,
fluorescence microscopy. In some embodiments, after droplets are
generated, one or more reactions (e.g., nucleic acid amplification
reactions, nucleic acid sequencing reactions, etc.) can be
performed in the droplets. One of more of the sensors can be used
to detect the one or more reactions (e.g., via species generated or
consumed in the reaction, etc.).
[0479] FIG. 32A shows an embodiment having a top view of a
nano-array according to the system described herein. The array
comprises both hydrophobic portions 3220 and hydrophilic portions
3200. In this embodiment, the hydrophilic portions 3200 are
patterned such that they form an array of circular hydrophilic
regions separated by hydrophobic portions 3220. Magnets 3250 are
located proximate to or within the hydrophilic portions 3200. While
the magnets 3250 in FIG. 32A are shown to be such that two magnets
are present within the hydrophilic region, there can also be a
single magnet located centrally within each hydrophilic region. The
magnets may be located in a way that one bead will be held in each
droplet. Magnets of different sizes, shapes (rectangular, square,
polygonal) and different magnetic strengths may be used to attract
and/or hold magnetic beads. In some embodiments, the reactor-sensor
array is substantially planar. In another embodiment, the
nano-array may be a reactor-sensor array for nucleic acid (e.g.,
DNA) sequencing.
[0480] FIG. 32B is a zoomed out view, in one embodiment, of a
reactor-sensor array (magnets 3250 not shown). The pitch size 3205
of the reactor-sensor array may be measured as the distance between
the center of each individual hydrophilic region 3210.
Droplet-based methods for emulsion free amplification are described
herein and the diameter of individual droplets can correspond with
the diameter of the pixel 3210.
[0481] Although the pixels 3210 that are hydrophilic are shown as
having a circular shape, the shape may be rectangular, oval,
irregular, or any other shape.
[0482] FIG. 32C and FIG. 32D are photographs of the reactor-sensor
array shown in FIGS. 32A-32B. The hydrophobic regions may be
created by depositing one or more layers of any suitable
hydrophobic material, such as, for example alkylsilanes, silicones,
teflons, hydrophobic phosphonates, hydrophobic carboxylates and
polycarboxylates, hydrophobic polythiols and fluoroalkylsilanes.
The hydrophilic regions may be comprised of any suitable
hydrophilic material such as, for example, one or more layers of
silicon oxide, an ozonized surface, silanes, PEGylated silanes,
proteins, dextrans, polysaccharides, hydrophilic polymers (e.g.,
polysulphonic acids), polyacrylic acids, and/or zwitterionic
polymers or a hydrophilic material coated on top of the surface. In
another embodiment, the hydrophobic region of the chip may comprise
a super-hydrophobic surface, (e.g., silica nano-coating, carbon
nanotube structures, precipitated calcium carbonate, Manganese
Oxide Polystyrene (MnO2/PS) nano-composite or Zinc Oxide
Polystyrene (ZnO/PS) nano-composite). In some cases, the surface
materials and modifications described here are meant to be only
representative, and any modifications that impart hydrophobic or
hydrophilic properties to the surfaces can be used. The surface of
the substrate may be patterned using any photoresist covering
hydrophilic regions. The hydrophobic material can then be applied
to the surface. Then, the photoresist may be stripped and surface
treatment performed to modify the hydrophilic surface.
Alternatively, another embodiment includes substrate patterning
where the photoresist initially covers the hydrophobic regions,
patterning of hydrophilic regions, removal of the photoresist,
followed by patterning of the hydrophobic regions.
[0483] In a further embodiment, calculations may be made such that
each droplet that surrounds the individual beads contains an
appropriate amount of reagents. The hydrophobic regions can serve
as a physical barrier between pixels having individual droplets
such that there is very little contamination between neighboring
pixels. In another embodiment, the temperature of the chamber may
be controlled such that the droplets do not evaporate by using, for
example, a Peltier device. Once a process such as polymerase chain
reaction or isothermal amplification is complete and amplification
has occurred, the final step may be a wash step to remove the beads
and amplicons.
[0484] FIG. 33A shows, in one embodiment, a side view of the
beginning of an example emulsion free amplification process.
Saturated humid air can bebeen injected into the chamber and fluid
(including reagents) can condense into droplets 3330 on the
hydrophilic areas 3300. The individual pixels are separated by
hydrophobic areas 3320 and the entire structure is supported by the
substrate 3390. The beads 3350 are immobilized on magnets 3370.
[0485] FIG. 33B illustrates, in a further embodiment, amplicons
3335 that can be generated as a result of multiple cycles of an
amplification process such as polymerase chain reaction (PCR) or an
isothermal amplification method. The thermal cycling steps of PCR
can cause droplets to shrink and grow according to an increase and
decrease in temperature and the resulting cycles of evaporation and
condensation of fluid. The droplets can serve as physical barriers
that prevent the reagents and amplicons from leaving the individual
pixels. This method allows for an emulsion-free type of
amplification.
[0486] As shown in FIG. 34, the droplet diameter may be based on
the amount of nucleotides and other reagents inside the droplet.
Droplet diameter may be calculated according to the volume and the
concentration of species inside the droplet. In some embodiments,
the contact angle on the surface may be about 65 degrees, 80
degrees, 95 degrees, 100 degrees, 105 degrees, or 115 degrees. In
some embodiments the volume of the droplet may be, for example,
about 50 nanoliters, 100 nanoliters, or 200 nanoliters. The
concentration of nucleotides may be, for example, about 100
micro-molar, 200 micro-molar, or 500 micro-molar. In some
embodiments, the pixel size may be about 10 microns, 20 microns, or
50 microns. In some embodiments, the volume of the droplet may be
in the picoliter range, the nanoliter range, the microliter range
or may be in a larger or smaller range depending upon the
particular application
[0487] In an embodiment, as shown in FIG. 35, a single spray nozzle
may spray a number of droplets containing reaction material onto a
chip surface that contains beads deposited on magnets situated in
hydrophilic pixels. These droplets can then preferentially move to
the hydrophilic regions and fuse together.
[0488] In an embodiment, as shown in FIG. 36, a single spray nozzle
may spray a number of large droplets containing reaction material
onto the chip surface that contains beads deposited on magnets
situated in the hydrophilic pixels. Each individual reaction
material droplet may land on the hydrophilic region directly or
preferentially move to the closest hydrophilic region due to
repulsion by the hydrophobic region.
[0489] In an embodiment, as shown in FIG. 37A, a single spray
nozzle may move along the whole reactor-sensor array, and deposit
appropriately sized droplets containing reaction materials on beads
contained within the hydrophilic pixels. Small misalignments in the
deposition of these droplets can be corrected by the droplets
themselves, due to preferential movement to a hydrophilic region as
a result of repulsive interactions with a hydrophobic region. The
spray nozzle may be a traditional spray nozzle fitted on a robotic
arm, or alternatively, an original or modified printer head, (e.g.,
an inkjet printer head), which deposits reaction materials.
[0490] In an embodiment, as shown in FIG. 37B, a single spray
nozzle may move along a reactor-sensor array, and deposit
appropriately sized droplets, which can contain aqueous reaction
materials as well as beads, onto the appropriate hydrophilic
pixels. The beads can be attracted to the magnet and the aqueous
phase can move preferentially to the hydrophilic pixels.
[0491] In another embodiment, as shown in FIG. 37C, the spray
nozzle or printer head may deposit individual droplets on a
hydrophobic surface (without the need for a patterned hydrophilic
pixels array). The hydrophobic nature of the surface can lead to
the aqueous droplet beading up and not spreading out and mixing
with each other. The array may be placed in a chamber with high
humidity, thus preventing evaporation of the droplets.
[0492] In an embodiment, as shown in FIG. 38, an array of spray
nozzles may deposit reaction materials on top of beads located
below the nozzle and within each hydrophilic pixel of the
reactor-sensor array. This array of spray nozzles could be static
or move around (e.g. with the aid of robotic movement).
[0493] In a further embodiment, if the size of the chamber where
the nano-array is located is sufficiently small, the injection of
saturated air (e.g., water-saturated air) may be optional since the
condensation/evaporation cycle of the droplets may be controlled
based on the temperature inside the small-volume chamber. If the
volume of the chamber is sufficiently small, the "micro-climate" of
the chamber may be more easily controlled and the saturated air
step may be unnecessary.
[0494] In some embodiments, droplets may be placed in the corners
of a chamber with a heat source underneath. Such a configuration
can control the introduction of saturated air and
evaporation/condensation cycles via control of the temperature.
[0495] The confinement of nucleic acid (e.g., DNA) or other species
in each pixel from neighboring pixels may be achieved by
controlling the temperature and relative humidity of a chamber
comprising the pixels. Droplets containing a bead (or other type of
particle), nucleic acid (e.g., DNA), and reagents may be isolated
from neighboring pixels in a chamber via a controlled environment.
An evaporation/condensation rate may go to zero or substantially
zero by controlling ambient conditions (e.g., temperature and
relative humidity) of the air inside of the chamber accurately. In
this manner, a droplet may confined a bead, nucleic acid (e.g.,
DNA), and other reagents and prevent contamination between
pixels.
[0496] In some embodiments, the droplets may be created by first
flowing a layer of fluid into a chamber such that there is
sufficient fluid to cover the bottom of the chamber that is
patterned with both hydrophilic and hydrophobic areas as shown in
FIG. 32A. Then, the chamber may be heated such that a portion of
the fluid evaporates into the chamber. This may result in droplets
forming on the hydrophilic areas of the chamber and the air in the
chamber being saturated with fluid material(s) (e.g.,water). The
heating that can induce evaporation of the fluid from the
hydrophobic regions may be obtained by selective heating of the
hydrophobic surfaces (e.g. by on-chip electronic heaters or laser
heating through a mask). Moreover, droplets may grow and diminish
in size according to heat cycling that may be used for applications
such as PCR amplification in each droplet. In other embodiments,
the droplets may stay a relatively constant size for applications
where heat cycling is not necessary.
[0497] In another embodiment, the droplets may be created by first
flowing a layer of fluid into a chamber such that there is
sufficient fluid to cover the bottom of the chamber that is
patterned with both hydrophilic and hydrophobic areas as shown in
FIG. 32A. In this embodiment, there may be electrodes located in
each hydrophilic region. The electrodes may each have voltage
generating components associated with them such that as the voltage
is modulated, bubbles form on or near the electrodes. These bubbles
may be used to form "cracks" or divisions in the layer of the
fluid. The chamber may or may not be heated. The bubbles may cause
the layer of fluid to be displaced such that droplets form on the
hydrophilic portions of the chamber. In a further embodiment, there
may be one or more electrodes at the top of the chamber for forming
bubbles from the top and displacing the layer of fluid onto the
hydrophilic portions for forming droplets.
[0498] In some embodiments of the systems and methods described
above, the droplet size may be large enough to create a "buffer
region" such that if evaporation occurs, there is enough fluid left
in the droplet to allow for the reaction of interest to occur
within the droplet.
[0499] In some embodiments, such as in FIG. 40A, FIG. 40B, and FIG.
41, droplet-based emulsion-free amplification of nucleic acid
(e.g., DNA) may be achieved. Particles, such as for example
magnetic beads, may be flowed into the fluidic chamber that houses
the reactor-sensor array. The reactor-sensor array may have both
hydrophobic regions 4020 and hydrophilic regions 4030. The magnetic
beads 4050 may come to rest in individual pixels, immobilized by
the magnets 4040 in the pixels. Next, a solution that contains
diluted nucleic acid may be flowed into the array such that the
single stranded nucleic acid binds to the beads in a one nucleic
acid per one bead distribution. Next, a buffer containing
amplification reagents 4060 may be injected into the chamber. To
finalize the confinement, saturated humid air 4070 may be injected
into the chamber such that any remaining fluid or reagents are
pushed out except the droplets 4080 formed upon the hydrophilic
pixels, leaving the hydrophobic regions dry. As alternatives to
saturated humid air, oil or another immiscible liquid may also be
used. The liquid in these droplets (or microreactors) can be
prevented from evaporation by the air saturated with moisture, by
oil or another immiscible liquid, by temperature or some
combination of materials. This method of amplification, examples of
which are shown in FIG. 40A, FIG. 40B, and FIG. 44 may be referred
to as emulsion free, in some cases, because of it does not result
in the generation of a traditional emulsion (e.g., by vortexing an
aqueous phase in oil (or vice-versa))despite that the method makes
use of aqueous phase droplets on the hydrophilic regions that are
surrounded by oil.
[0500] As shown in FIG. 44A-C, this approach can be used for
sequential introduction of nucleic acid (e.g., DNA) templates after
every round of amplification, so as to ensure that a high fraction
of hydrophilic pixels contain amplified nucleic acid material, such
as on a bead contained within that pixel. In particular, during
each round of dilute template introduction and amplification, only
a fraction of hydrophilic pixels may receive a nucleic acid
template and hence undergoes amplification (e.g., on a bead). Such
a configuration can maximize the usage of pixel locations within a
chip. Additionally, this approach can also be used for sequencing
the amplified material, by flowing in nucleotides in a sequential
manner, and detection of incorporation during sequencing, (e.g., by
electronic sensors contained within the pixel location or by any
other modality (e.g., fluorescence microscopy)).
[0501] In an embodiment shown in FIG. 44A, a hydrophobic surface
4400 has an array of aqueous droplets 4402, each arrayed onto a
hydrophilic surface adjacent 4404 to a pair of electrodes 4406.
FIG. 44B shows the array used for clonal amplification and
enrichment 4403. The process includes seeding of single templates
at array locations 4407 and then isolating the templates from each
other and amplifying the templates 4409. In this step, an aqueous
solution containing template 4408 or oil 4410 (immiscible with the
template solution) are flowed in an alternating fashion over the
array between a first hydrophobic/hydrophilic patterned array 4412
having the electrodes and a second hydrophobic/hydrophilic
patterned array 4414 to leave isolated aqueous droplets of
amplified template 4416. The amplified template can be sequenced on
the array as shown in FIG. 44C. Here, aqueous solutions 4418
containing one or more nucleotides (i.e., A, C, G, and T) are
alternately flowed over the array to do sequencing by synthesis at
the array positions 4420. Wash solutions can be used between
nucleotides to wash away any un-incorporated bases.
[0502] In another embodiment, as shown in FIG. 41, the fluidic chip
surface 4110 (containing the array of hydrophilic and hydrophobic
regions) may also contain a layer of electronic components,
including but not limited to metallic electrodes 4120, as well as
other electronics (e.g., transistors, amplifiers etc.) below the
microreactor (or droplet). There may be one, two, three, four,
five, six, seven, eight, nine, ten etc. or more electrodes per
pixel. In some embodiments, there may be one or more electrodes in
or near the center of each pixel. The electrodes may have any
shape, for example, square, rectangular, circular, curved, etc. or
any other shape. In a further embodiment, the nano-array may lack
electrodes but may have linker molecules deposited on the pixels
for immobilizing beads. Electronics could be used to help aid
on-chip amplification and/or for sequencing the amplified template
(e.g., by detecting the incorporation of nucleotides during
sequencing steps in an electronic fashion). Thus, the same chip
could be used for both clonal amplification as well as sequencing.
Additionally, the fluidic chip could contain magnets 4130 to hold
the bead 4150. The fluidic droplet 4160 containing the reagent
materials, including but not limited to DNA template, polymerases,
enzymes, nucleotides etc., can be contained between the hydrophobic
regions 4140. In another embodiment, the reactor-sensor array may
not have magnets and the hydrophilic portions may be comprised of a
material such as gold or platinum.
[0503] In another embodiment, as shown in FIG. 42A and FIG. 42B,
the droplets 4220 can be formed and manipulated using
electro-wetting (EW) or electrowetting on dielectric (EWOD). The
chip surface can be divided into pixels 4210, each of which
contains the electronic components needed for electrowetting.
Droplets containing the reaction materials, nucleic acid (e.g.,
DNA) templates and/or beads, can be generated in one location of a
chip, (e.g., by a spray mechanism, or any microfluidic droplet
generation mechanism), and then moved (4230) to the region
corresponding to the desired location on the chip. Such a method is
controllable allowing for manipulation of the droplets.
[0504] In another embodiment, as shown in the cross-sectional view
in FIG. 43A, the chip may contain an array of wells (e.g.,
microwells or nanowells). The chip may be first filled with a fluid
which contains reaction materials, nucleic acid (e.g., DNA)
templates, and/or beads 4340, and then saturated humid air or oil
or another immiscible liquid can be flown through the chip so as to
only leave the reaction mixture inside the wells. The walls of each
well may provide further physical confinement for amplification.
Additionally, the bottom and sides of each well can be coated with
a hydrophilic material 4310 and the region separating the wells
(e.g. the ceiling of the regions separating the wells) with a
hydrophobic material 4320, to further aid attachment of reaction
material inside the well, as removal of it outside the well. The
embodiment may also contain magnets 4330 inside each well to
capture and hold the beads in place inside the well. In some
embodiments, such microwells may be present on both the bottom and
top surface of a chip. In some embodiments of the system, the wells
may be circular in cross-section (FIG. 43B), square in
cross-section (FIG. 43C), or polygonal (in particular, hexagonal)
in cross-section (FIG. 43D). In some embodiments of the systems and
methods described above, the biological assays performed may
include nucleic acid (e.g., DNA, or RNA), proteins (e.g.,
antibodies, enzymes etc.), peptides, carbohydrates, etc. Such
biological assays may include detection, amplification, and/or
analytical reading of a biological sample of interest.
Fluid Flow
[0505] Recognized herein is the need for improved devices for
optimizing flow properties in microfluidic devices. The present
disclosure provides devices for optimizing flow properties in
microfluidic devices, such as rate and uniformity of fluid flow
across a microfluidic sensor array.
[0506] The size and shape of a microfluidic chamber, or
microfluidic cavity, of the device can have an impact on the rate
and uniformity of the flow across the sensor array.
[0507] An aspect of the disclosure provides a microfluidic device.
The microfluidic device can comprise a chamber comprising a first
surface having a width (W) and a length (L); a second surface
parallel to the first surface; and a space between the first
surface and the second surface having a height (H). The space
between the first and second surfaces can be configured to direct
fluid flow.
[0508] Moreover, (H) can have any suitable value. In some
embodiments, (H) may be less than about 10 millimeters (mm), less
than about 9 mm, less than about 8 mm, less than about 7 mm, less
than about 6 mm, less than about 5 mm, less than about 4 mm, less
than about 3 mm, less than about 2 mm, less than about 1 mm, less
than about 800 (.mu.m) micrometers, less than about 600 .mu.m, less
than about 400 .mu.m, less than about 200 .mu.m, less than about
100 .mu.m, less than about 50 .mu.m, less than about 20 .mu.m, less
than about 10 .mu.m, less than about 5 .mu.m, less than about 1
.mu.m, less than about 0.1 .mu.m or less than about 0.01 .mu.m or
less.
[0509] Moreover, (W) can have any suitable value. In some
embodiments, (W) may be at least about 1 mm, at least about 2 mm,
at least about 3 mm, at least about 4 mm, at least about 5 mm, at
least about 6 mm, at least about 7 mm, at least about 8 mm, at
least about 9 mm, at least about 10 mm, at least about 15 mm, at
least about 20 mm, at least about 25 mm, at least about 30 mm or
more. In some embodiments, (W) may be at most about 30 mm, at most
about 25 mm, at most about 20 mm, at most about 15 mm, at most
about 10 mm, at most about 9 mm, at most about 8 mm, at most about
7 mm, at most about 6 mm, at most about 5 mm, at most about 4 mm,
at most about 3 mm, at most about 2 mm, at most about 1 mm or less.
In some embodiments, (W) may be about 1 mm, about 2 mm, about 3 mm,
about 4 mm, about 5 mm, 6 mm, about 7 mm, about 8 mm, about 9 mm,
about 10 mm, about 15 mm, about 20 mm, about 25 mm, about 30 mm or
more.
[0510] Moreover, (L) can have any suitable value. In some
embodiments, (L) may be at least about 1 mm, at least about 2 mm,
at least about 3 mm, at least about 4 mm, at least about 5 mm, at
least about 6 mm, at least about 7 mm, at least about 8 mm, at
least about 9 mm, at least about 10 mm, at least about 15 mm, at
least about 20 mm, at least about 25 mm, at least about 30 mm or
more. In some embodiments, (L) may be at most about 30 mm, at most
about 25 mm, at most about 20 mm, at most about 15 mm, at most
about 10 mm, at most about 9 mm, at most about 8 mm, at most about
7 mm, at most about 6 mm, at most about 5 mm, at most about 4 mm,
at most about 3 mm, at most about 2 mm, at most about 1 mm or less.
In some embodiments, (L) may be about 1 mm, about 2 mm, about 3 mm,
about 4 mm, about 5 mm, 6 mm, about 7 mm, about 8 mm, about 9 mm,
about 10 mm, about 15 mm, about 20 mm, about 25 mm, about 30 mm or
more.
[0511] The device can further comprise an input funnel having a
wide end in fluid communication with the space between the first
surface and the second surface; and a narrow end medial to the wide
end and in fluid communication with the wide end. The wide end can
have a first thickness (t.sub.o) at its mid-point, a second
thickness (t.sub.1) at its edges, and a height (h) between the wide
end to the narrow end. In some cases, (t.sub.o) is less than
(t.sub.1). In some cases, (t.sub.o) is substantially the same as or
the same as (t.sub.1). In some cases, (t.sub.o) is greater than
(t.sub.1). In some cases, the ratio of (t.sub.o)/(t.sub.1) is less
than about 0.95, less than about 0.85, less than about 0.80, less
than about 0.75, less than about 0.70, less than about 0.65, less
than about 0.60, less than about 0.55, less than about 0.50, less
than about 0.45, less than about 0.40, less than about 0.35, less
than about 0.30, less than about 0.25, less than about 0.20, less
than about 0.15, less than about 0.10, less than about 0.05 or
less.
[0512] Additionally, (t.sub.0) can have any suitable value. In some
embodiments, (t.sub.0) may less than about 1 mm, less than about
900 .mu.m, less than about 800 .mu.m, less than about 700 .mu.m,
less than about 600 .mu.m, less than about 500 .mu.m, less than
about 400 .mu.m, less than about 300 .mu.m, less than about 200
.mu.m, less than about 100 .mu.m, less than about 50 .mu.m, less
than about 20 .mu.m, less than about 10 .mu.m, less than about 5
.mu.m, less than about 1 .mu.m, less than about 0.1 .mu.m or less
than about 0.01 .mu.m or less. In some embodiments, (t.sub.0) may
be about 1 mm, about 900 .mu.m, about 800 .mu.m, about 700 .mu.m,
about 600 .mu.m, about 500 .mu.m, about 400 .mu.m, about 300 .mu.m,
about 200 .mu.m, about 100 .mu.m, about 50 .mu.m, about 20 .mu.m,
about 10 .mu.m, about 5 .mu.m, about 1 .mu.m, about 0.1 .mu.m,
about 0.01 .mu.m or less.
[0513] Additionally, (t.sub.1) can have any suitable value. In some
embodiments, (t.sub.1) may less than about 1 mm, less than about
900 .mu.m, less than about 800 .mu.m, less than about 700 .mu.m,
less than about 600 .mu.m, less than about 500 .mu.m, less than
about 400 .mu.m, less than about 300 .mu.m, less than about 200
.mu.m, less than about 100 .mu.m, less than about 50 .mu.m, less
than about 20 .mu.m, less than about 10 .mu.m, less than about 5
.mu.m, less than about 1 .mu.m, less than about 0.1 .mu.m or less
than about 0.01 .mu.m or less. In some embodiments, (t.sub.1) may
be about 1 mm, about 900 .mu.m, about 800 .mu.m, about 700 .mu.m,
about 600 .mu.m, about 500 .mu.m, about 400 .mu.m, about 300 .mu.m,
about 200 .mu.m, about 100 .mu.m, about 50 .mu.m, about 20 .mu.m,
about 10 .mu.m, about 5 .mu.m, about 1 .mu.m, about 0.1 .mu.m,
about 0.01 .mu.m or less. In some embodiments, H is about 100
.mu.m, (t.sub.0) is about 300 .mu.m, (t.sub.1) is about 500 .mu.m
and h is about 2 millimeters.
[0514] Moreover, (h) can have any suitable value. In some
embodiments, (h) may be less than about 50 mm, less than about 40
mm, less than about 30 mm, less than about 20 mm, less than about
10 mm, less than about 9 mm, less than about 8 mm, less than about
7 mm, less than about 6 mm, less than about 5 mm, less than about 4
mm, less than about 3 mm, less than about 2 mm, less than about 1
mm, less than about 800 .mu.m, less than about 600 .mu.m, less than
about 400 .mu.m, less than about 200 .mu.m, less than about 100
.mu.m, less than about 50 .mu.m, less than about 20 .mu.m, less
than about 10 .mu.m, less than about 5 .mu.m, less than about 1
.mu.m, less than about 0.1 .mu.m or less than about 0.01 .mu.m or
less. In some embodiments, (h) may be about 50 mm, about 40 mm,
about 30 mm, about 20 mm, about 10 mm, about 9 mm, about 8 mm,
about 7 mm, about 6 mm, about 5 mm, about 4 mm, about 3 mm, about 2
mm, about 1 mm, about 800 .mu.m, about 600 .mu.m, about 400 .mu.m,
about 200 .mu.m, about 100 .mu.m, about 50 .mu.m, about 20 .mu.m,
about 10 .mu.m, about 5 .mu.m, about 1 .mu.m, about 0.1 .mu.m,
about 0.01 .mu.m or less.
[0515] In some embodiments, the device can further comprise an
output funnel having a wide end in fluid communication with the
space between the first surface and the second surface, and a
narrow end in fluid communication with the wide end. The wide end
can have a third thickness (t.sub.2) at its mid-point and a fourth
thickness (t.sub.3) at its edges, and a height (h.sub.2) between
its wide end and narrow end. In some embodiments, the device can be
configured to direct fluid flow through the narrow end of the input
funnel, through the space between the first surface and the second
surface, and out of the narrow end of the output funnel.
[0516] In some embodiments, an input funnel and/or an output funnel
can be oriented perpendicularly to the first surface and the second
surface. In some embodiments, an input funnel and/or an output
funnel can be oriented parallel to the first surface and the second
surface.
[0517] Additionally, (t.sub.2) can have any suitable value. In some
embodiments, (t.sub.2) may less than about 1 mm, less than about
900 .mu.m, less than about 800 .mu.m, less than about 700 .mu.m,
less than about 600 .mu.m, less than about 500 .mu.m, less than
about 400 .mu.m, less than about 300 .mu.m, less than about 200
.mu.m, less than about 100 .mu.m, less than about 50 .mu.m, less
than about 20 .mu.m, less than about 10 .mu.m, less than about 5
.mu.m, less than about 1 .mu.m, less than about 0.1 .mu.m or less
than about 0.01 .mu.m or less. In some embodiments, (t.sub.2) may
be about 1 mm, about 900 .mu.m, about 800 .mu.m, about 700 .mu.m,
about 600 .mu.m, about 500 .mu.m, about 400 .mu.m, about 300 .mu.m,
about 200 .mu.m, about 100 .mu.m, about 50 .mu.m, about 20 .mu.m,
about 10 .mu.m, about 5 .mu.m, about 1 .mu.m, about 0.1 .mu.m,
about 0.01 .mu.m or less.
[0518] Additionally, (t.sub.3) can have any suitable value. In some
embodiments, (t.sub.3) may less than about 1 mm, less than about
900 .mu.m, less than about 800 .mu.m, less than about 700 .mu.m,
less than about 600 .mu.m, less than about 500 .mu.m, less than
about 400 .mu.m, less than about 300 .mu.m, less than about 200
.mu.m, less than about 100 .mu.m, less than about 50 .mu.m, less
than about 20 .mu.m, less than about 10 .mu.m, less than about 5
.mu.m, less than about 1 .mu.m, less than about 0.1 .mu.m or less
than about 0.01 .mu.m or less. In some embodiments, (t.sub.3) may
be about 1 mm, about 900 .mu.m, about 800 .mu.m, about 700 .mu.m,
about 600 .mu.m, about 500 .mu.m, about 400 .mu.m, about 300 .mu.m,
about 200 .mu.m, about 100 .mu.m, about 50 .mu.m, about 20 .mu.m,
about 10 .mu.m, about 5 .mu.m, about 1 .mu.m, about 0.1 .mu.m,
about 0.01 .mu.m or less.
[0519] Moreover, (h.sub.2) can have any suitable value. In some
embodiments, (h.sub.2) may be less than about 50 mm, less than
about 40 mm, less than about 30 mm, less than about 20 mm, less
than about 10 mm, less than about 9 mm, less than about 8 mm, less
than about 7 mm, less than about 6 mm, less than about 5 mm, less
than about 4 mm, less than about 3 mm, less than about 2 mm, less
than about 1 mm, less than about 800 .mu.m, less than about 600
.mu.m, less than about 400 .mu.m, less than about 200 .mu.m, less
than about 100 .mu.m, less than about 50 .mu.m, less than about 20
.mu.m, less than about 10 .mu.m, less than about 5 .mu.m, less than
about 1 .mu.m, less than about 0.1 .mu.m or less than about 0.01
.mu.m or less. In some embodiments, (h.sub.2) may be about 50 mm,
about 40 mm, about 30 mm, about 20 mm, about 10 mm, about 9 mm,
about 8 mm, about 7 mm, about 6 mm, about 5 mm, about 4 mm, about 3
mm, about 2 mm, about 1 mm, about 800 .mu.m, about 600 .mu.m, about
400 .mu.m, about 200 .mu.m, about 100 .mu.m, about 50 .mu.m, about
20 .mu.m, about 10 .mu.m, about 5 .mu.m, about 1 .mu.m, about 0.1
.mu.m, about 0.01 .mu.m or less.
[0520] A device may be configured to direct fluid flow through the
space between the first surface and the second surface and/or any
input or output funnels of a device such that the directed flow is
laminar flow. In some embodiments, a device may be configured to
direct fluid flow through the space between the first surface and
the second surface and/or any input or output funnels of a device
such that the directed flow is turbulent flow or a transition flow
in between a laminar flow and a turbulent flow. One measure used to
characterize fluid flow is Reynolds number. In general, fluid flow
described by a Reynolds number of less than 2100 is considered
laminar flow and fluid flow described by a Reynolds number of
greater than 4000 is turbulent flow. Reynolds numbers that fall in
between 2100 and 4000 are generally considered transition
flows.
[0521] Accordingly, in some embodiments, a device may be configured
to direct fluid flow between the first surface and the second
surface an and the second surface and/or any input or output funnel
such that the fluid flow has a Reynolds number of less than about
4100, 4000, 3900, 3800, 3700, 3600, 3500, 3400, 3300, 3200, 3100,
3000, 2900, 2800, 2700, 2600, 2500, 2400, 2300, 2200, 2100, 2000,
1900, 1800, 1700, 1600, 1500, 1400, 1300, 1200, 1100, 1000, 900,
800, 700, 600, 500, 400, 300, 200, 100, 50, 25, 10, 1, 0.1, 0.01,
0.001 or less. In some embodiments, a device may be configured to
direct fluid flow between the first surface and the second surface
an and the second surface and/or any input or output funnel such
that the fluid flow has a Reynolds number of greater than about
4100, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000,
9500, 10000 or higher.
[0522] The linear flow rate of a directed fluid flow between any
two points within the space between the first surface and second
surface may vary and the device may be configured to minimize such
variability. For example, the linear flow rate of fluid flow at any
two points within the space between the first and second surfaces
may vary by at most about 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%,
10%, 5%, 1% or less. Additionally, the volumetric flow rate of a
directed fluid flow between any two points within the space between
the first surface and second surface may vary and the device may be
configured to minimize such variability. For example, the linear
flow rate of fluid flow at any two points within the space between
the first and second surfaces may vary by at most about 50%, 45%,
40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 1% or less.
[0523] In some embodiments, the chamber can comprise walls. The
walls may have any suitable shape. For example, the walls may be
curved.
[0524] In some embodiments, a distance from the first surface to
the second surface may be greater near the center of the chamber
than at the edges of the chamber. In some embodiments, the distance
from the first surface to the second surface may be less near the
center of the chamber than at the edges of the chamber. In some
embodiments, the distance from the first surface to the second
surface may be the same or substantially the same near the center
of the chamber than at the edges of the chamber. In some
embodiments, the ratio of the distance from the first surface to
the second surface at a point near the center of the chamber to a
distance from the first surface to the second surface at a point
near the edge of the chamber may be less than about 0.95, 0.90,
0.85, 0.80, 0.75, 0.70, 0.65, 0.60, 0.55, 0.50, 0.45, 0.40, 0.35,
0.30, 0.25, 0.20, 0.15, 0.10, 0.05 or less. In some embodiments,
the ratio of the distance from the first surface to the second
surface near the center of the chamber to (t.sub.0) or (t.sub.1) is
less than about 0.95, 0.90, 0.85, 0.80, 0.75, 0.70, 0.65, 0.60,
0.55, 0.50, 0.45, 0.40, 0.35, 0.30, 0.25, 0.20, 0.15, 0.10, 0.05 or
less.
[0525] In an aspect, the present disclosure provides a
semiconductor microfluidic device comprising a chamber with a
floor, walls and a ceiling, where the fluid passing through the
chamber is at substantially the same velocity throughout the
chamber and there is at least one of an inlet and an outlet. The
walls of the chamber can be curved.
[0526] The chamber can be shaped such that a height from the floor
to the ceiling at the middle of the chamber is less than the height
from the floor to the ceiling and the walls of the chamber. In some
cases, the chamber has a height of at least 60 .mu.m, 100 .mu.m or
120 .mu.m.
[0527] In some embodiments, a connection junction between at least
one of the inlets and the outlets as well as the floor is rounded.
The chamber can have rounded edges. The chamber can be shaped such
that a ratio between a height from the floor to the ceiling at the
middle of the chamber versus a height from the floor to the ceiling
and the walls of the chamber is about 0.05, 0.1, 0.15, 0.2, 0.25,
0.3, 0.35, 0.4, 0.45 or 0.5.
[0528] In some embodiments, at least one of an inlet and an outlet
has a funnel shape. The funnel can be oriented horizontally or
vertically. The height from the floor to the ceiling at the middle
of the chamber can be less than half of the width of the funnel. In
some embodiments, the height from the floor to the ceiling at the
middle of the chamber is at least 200 .mu.m, 300 .mu.m, 400 .mu.m
or 500 .mu.m.
[0529] To find the velocity field as well as the pressure drop in a
microfluidic cavity, the Navier-Stokes equations for incompressible
flow can be solved using steady state conditions. In an example,
the working fluid is water at a reference temperature and subject
to conditions described by the following equations:
( u .gradient. ) u = - 1 .rho. .gradient. p + v .gradient. 2 u
##EQU00001## .gradient. u = 0 ##EQU00001.2##
[0530] The above equations may be solved according to the following
boundary conditions: [0531] Walls: no slip boundary condition u=0
[0532] Inlets: u=u.sub.in [0533] Outlet: Reference pressure:
p=0
[0534] In this embodiment, the above model can describe movement of
spherical particles in the fluidic chamber based on the drag force
from the fluid flow and the gravity force. The spherical particles,
for the above example, can have 1 micron (.mu.m) diameter with a
density of 2.2 g/cm.sup.3, though it is understood that particles
of varying dimensions, shapes and densities may be used. In some
embodiments, the spherical particles are magnetic beads.
[0535] A uniform flow profile may be desirable for a uniform
distribution of beads and reagents within the chamber. It can be
preferable to have substantially the same velocity field over the
beads in the fluidic chamber in order to have approximately the
same sensing condition for all of the beads. In this manner, the
fluid passing through the fluidic chamber from the inlet to the
outlet can be at substantially the same velocity at all points in
the chamber. In some embodiments, there may be more than one inlet
and/or outlet.
[0536] The chamber can be shaped such that there are no sharp
corners. Sharp corners in the walls of the chamber may cause a
variety of problems. One issue may be that particles (e.g., beads)
may become trapped and/or clump together in the corners of the
chamber. Another issue may be that corners in the walls of the
chamber may not allow for a uniform flow profile. Sharp corners may
also introduce bubbles and/or turbulent flow inside the
chamber.
[0537] In some embodiments, as shown in FIG. 45, the microfluidic
chamber 4500 can be shaped such that there may be an inlet 4510 on
one end and the chamber walls 4515 may curve out away from the
inlet and then gradually curve back towards the outlet 4530 at the
opposite end of the chamber. There may be two "corners" between the
inlet and outlet in this configuration, but these corners can be
curved such that there is minimal impact on the profile of the flow
across the chamber. In some embodiments, there may be more than one
inlet and/or more than one outlet, with the chamber having the same
or a different shape.
[0538] FIG. 45 also shows two other aspects of the microfluidic
chamber 4500, namely, the height of the chamber wall 4520 and the
height of the chamber ceiling 4520. In some embodiments, the height
of the chamber ceiling may be sloped such that the height near the
edges of the chamber (the location by the chamber walls) is larger
than the height in the middle of the chamber. In some embodiments,
chamber ceiling may be sloped.
[0539] The ratio between the height near the walls and the height
near the center of the chamber may have an impact on the uniformity
and rate of the flow across the chamber.
[0540] An example of a simulation that can be run using an example
chamber includes a chamber with the dimensions as shown in FIG. 45,
namely, an inlet 4510 and outlet 4530 diameter (D) of 300
micrometers (.mu.m), a chamber size of 4.5 millimeters (mm) on each
side (i.e., an area of 20.25 mm.sup.2), a chamber wall height (H
.sub.wall) 4520 of 200 .mu.m, a chamber middle height (H.sub.m)
4540 of between about 20 and 200 .mu.m, and an active sensor area
of 3.6 mm by 3.6 mm (i.e., 12.96 mm.sup.2).
[0541] FIG. 46A shows options for sloping the height of the chamber
ceiling. In each case, the darker color indicates a larger chamber
height and a lighter color indicates a smaller chamber height. In
these situations, the transition from a large chamber to a small
chamber height may be a gradual, smooth slope. In some embodiments,
the chamber height is large on all outside edges of the chamber and
slopes downward to a smaller height towards the middle of the
chamber (e.g., 4600). In some embodiments, the chamber height is
relatively large on only two corners (e.g., the top and bottom
corners) and slopes down from those two corners to a smaller height
towards the middle of the chamber (e.g., 4605). In some
embodiments, the chamber height is relatively large on only two
corners (the left and right corners) and slopes down from those two
corners to a smaller height towards the middle of the chamber
(e.g., 4610).
[0542] FIG. 46B shows side views of a chamber where the chamber
ceiling is sloped from all sides of the chamber towards the middle
of the chamber where the ceiling height (h) is less that the height
of the chamber walls. Two views 4615 and 4620 show side views from
two different sides of the chamber.
[0543] FIG. 46C shows a top view of the flow profile of
microfluidic chambers 4600 with varying chamber heights near the
middle of the chamber. The top view of microfluidic chambers 4600
shows the velocity gradients from the inlet 4610 to the outlet
4630. In this example, the height of the chamber walls (H.sub.wall)
is 200 .mu.m. The chamber heights at or around the middle of the
chamber (H.sub.m) shown here are 20 .mu.m 40 .mu.m, 60 .mu.m, 80
.mu.m, 100 .mu.m, 120 .mu.m, 140 .mu.m, 160 .mu.m, 180 .mu.m, and
200 .mu.m. In other embodiments, the chamber height may be less
than or greater than these values, as these values are shown as an
example only. The various flow velocities are illustrated in this
figure with the faster flow velocities having a lighter color and
the slower flow velocities having a darker color. Thus, the varying
degrees of flow uniformity in the chambers are depicted with
chambers having uniform flow shown to be more uniform in color and
the chambers with non-uniform flow shown to have distinct,
different colored regions.
[0544] FIG. 46D shows one embodiment of a chamber where the inlet
and the outlet is located on the sides of the chamber as opposed to
proximate to the "corners" of the chamber (as shown, for example,
in FIG. 46C). Varying the location of the inlets and outlets of the
chamber may have an impact on both uniformity of flow and smooth
injection of beads into the chamber.
[0545] Depending on the height at or around the middle of the
chamber (H.sub.m), the flow can be more or less uniform throughout
the chamber and along the chamber walls 4615. For example, the flow
in a chamber where the height is 100 .mu.m is more uniform than in
a chamber where the height is 20 .mu.m. The height for ideal flow
can depend on a variety of factors including the dimensions of the
chamber and the type of liquid.
[0546] FIG. 47 shows an example simulation, after particles 4705
are introduced through inlet 4710 into the microfluidic chamber
4700, where the height of the chamber at or around the midpoint is
60 .mu.m. The darkness of the particle color corresponds with their
velocity where the darker color indicates a higher velocity. FIG.
47 illustrates that at this chamber height, the flow near the walls
of the chamber 4715 is faster than in the middle, thereby creating
a gap 4750 in the flow profile before the particles 4705 exist
through the outlet 4730.
[0547] FIG. 48 shows an example simulation, after particles 4805
are introduced into the microfluidic chamber 4800 through an inlet
4810, where the height of the chamber at the midpoint is 120 .mu.m.
In contrast with FIG. 47, this chamber height allows for a more
uniform flow throughout the chamber 4800 and along the chamber
walls 4815, but with a decrease in velocity as the particles 4805
move towards outlet 4830.
[0548] FIG. 49A shows an alternative embodiment of a microfluidic
chamber 4900 where an inlet 4910 and an outlet 4930 have a funnel
shape to permit a smooth transition of fluid flow from inlet 4910
toward the microfluidic chamber floor. The microfluidic chamber
floor may comprise a sensing area for the detection of biological
reactions of interest. Such a configuration can give rise to a flow
profile of particles 4905 with a laminar flow throughout the
microfluidic chamber 4900 and along chamber walls 4915. In some
cases, the edges of the microfluidic chamber 4900 shown in FIG. 49A
may be rounded both in the corner areas 4925 and the junction 4935
where the inlet/outlet connects with the chamber floor. Having a
sloped junction point at these areas may aid in creating a more
uniform flow profile. FIG. 49B shows the microfluidic chamber 4900
of FIG. 49A with the associated flow lines.
[0549] The funnel can be oriented horizontally or vertically with
respect to the microfluidic chamber. FIG. 49C illustrates, in one
embodiment of microfluidic chamber 4900, the funnel shaped inlet
4910 and outlet 4930, where the funnel portion is placed
horizontally. The funnel part of the channel maybe placed
horizontally or vertically based on the available space for an
optional fluidic lid (not shown) that may cover microfluidic
chamber 4900. FIG. 49D illustrates, in another embodiment of
microfluidic chamber 4900, the funnel shaped inlet 4910 and outlet
4930, where the funnel portion is placed vertically.
[0550] FIG. 50 illustrates an example relationship between chamber
height at its center and a ratio between the maximum and minimum
velocity within an example chamber. FIG. 50 shows that fluid flow
can be at its most uniform point 5000, (e.g., with the smallest
ratio between maximum and minimum velocity), at around 50 .mu.m for
the example chamber. In this embodiment, the following relationship
between the height at or around the middle of the chamber (H.sub.m)
and the height of the chamber walls (H.sub.wall) can be determined
in order to yield a minimum variation in flow velocity (e.g.,
minimum variation H.sub.m=0.25 X H.sub.wall for the example chamber
described above).
[0551] For the funnel shape chamber of FIGS. 49A-D, the height of
the microfluidic chamber at or around the middle may be less than
half of the width of the funnel to procure the uniformity of the
flow field, as illustrated in FIG. 51. When the height of the
chamber at or around the midpoint (H.sub.m) is less than the funnel
width (W.sub.funnel), the flow resistance in the chamber can be
higher than that of the funnel portions. Therefore, the fluid may
fill the funnel first and then flow into the chamber uniformly. In
this exemplary embodiment, the following relationship between the
height at or around the middle of the chamber (H.sub.m) and the
funnel width (W.sub.funnel) can be determined in order to yield a
minimum variation in flow velocity (e.g., minimum variation
H.sub.m<0.5 X W.sub.funnel for the funnel shape chamber
described above).
[0552] FIG. 51 illustrates three different exemplary embodiments
where the H.sub.m is 400 .mu.m, 300 .mu.m, and 200 .mu.m from left
to right. As in FIGS. 46A-D, the variation in shade illustrates the
variation in flow rate with the most uniform flow having the least
variation in shade throughout the microfluidic chamber and
straighter flow lines.
[0553] In some embodiments, a funnel has an inlet medial to a
fluidic chamber and an outlet spanning the width of the fluidic
chamber, as shown in FIG. 52. The funnel can be oriented vertically
(e.g., perpendicularly) to the fluidic chamber. The funnel and
chamber can have dimensions that result in a uniform fluid flow
over the fluidic chamber. Any dimension can be varied to achieve a
uniform flow, however provided herein are examples where the height
of the funnel (h) 5200, the thickness of the funnel (t) 5210 and
the height of the fluidic channel (H) 5220 are varied to achieve
uniform flow.
[0554] In some cases, the linear flow rate and/or volumetric flow
rate of fluid across the fluidic channel varies by about 25%, about
20%, about 15%, about 10%, about 5%, about 3%, or about 1%. In some
instances, the linear flow rate and/or volumetric flow rate of
fluid across the fluidic channel varies by at most about 25%, at
most about 20%, at most about 15%, at most about 10%, at most about
5%, at most about 3%, or at most about 1%. The flow variation can
be calculated between any two points on the fluidic channel,
including any point along width of the channel (e.g., W.sub.1 or
W.sub.2 of FIG. 52) or the length of the channel (e.g., L.sub.1 or
L.sub.2 of FIG. 52).
[0555] The thickness of the funnel (t) can be uniform, or change
(e.g., with the thickness being greater at the edges of the funnel
5210 than at the center of the funnel 5200). FIG. 53A shows the
flow profile for an example funnel of uniform thickness of 400 um,
having a funnel height (h) of 2 mm and a channel height (H) of 100
um. The flow is shown as simulated by computational fluid dynamics
across the width of the channel at the center (W.sub.1) 5300 and at
about 12% of the distance down the length of the channel (i.e.,
nearer the edge of the channel at W.sub.2) 5310. The horizontal
axis is distance along the channel cross section measured in
millimeters and ranging from 0 to 16.5 mm. The vertical axis is the
ratio of flow rate at the position to flow rate at the inlet
ranging from 0.05 to 0.065. As seen here, the flow rate is not
especially uniform near the edge of the channel 5310. FIG. 53B
shows similar results along the length of the channel. Here, the
flow profile at the center of the channel (L.sub.1) 5320 is
contrasted with the flow at the edge of the channel (L.sub.2)
5330.
[0556] In contrast, FIG. 54A and FIG. 54B show the enhanced
uniformity of flow that can be achieved using an example funnel of
varying thickness. Like the results shown in FIG. 53A and FIG. 53B,
the funnel height (h) is also 2 mm and the channel height (H) is
also 100 .mu.m. However, the funnel thickness (t) is varied (e.g.,
linearly) from 300 .mu.m at the center (t.sub.0) to 500 .mu.m at
the edges (t.sub.1). The results show a uniform flow across the
width of the chamber at the center line (W.sub.1) 5400 and near the
edge (W.sub.2) 5410, as well as a uniform flow across the length of
the chamber at the center line (L.sub.1) 5420 and near the edge
(L.sub.2) 5430.
[0557] Table 2 below shows the flow variation across a cell
(W.sub.1) and along a cell (W.sub.2) for various flow designs
having a channel height (H) of 100 .mu.m.
TABLE-US-00003 TABLE 2 Variation Variation Flow cell design across
cell (%) along cell (%) h = 1 mm, t = 400 .mu.m 12.50 29.73 h = 2
mm, t = 400 .mu.m 10.17 14.06 h = 3 mm, t = 400 .mu.m 5.17 8.33 h =
1 mm, t = 300-500 .mu.m 17.74 25.00 h = 2 mm, t = 300-500 .mu.m
6.78 6.67
Leak Tester
[0558] Recognized herein is the need for improved systems and
devices for measuring electrical properties and leakage (the
quality of a seal) in microfluidic devices. The present disclosure
provides such systems and devices.
[0559] As shown in an example system in FIG. 55, the system can
comprise a fluid connector 5500 and an electronic tester 5510. The
system is shown with a biochip 5520 loaded into the device for
testing. The system can have a pump 5530 and a pressure gauge 5540
in fluidic communication with the fluid connector and the
microfluidic device for testing for the presence of a fluid leak. A
valve 5550 can alternately allow the pump fluidic access to the
system or close the pump from the system. A photograph of the
system is shown in FIG. 56.
[0560] In an aspect, the system can test a hermetic seal between
the lid (as described herein) and the die. The degree of
hermeticity can be measured or quantified in any suitable way, such
as the amount of time that it takes for the pressure of a fluid
(e.g., air or water) that is pumped into the system to return to
atmospheric pressure (e.g., at least about 1 minute, at least about
1 hour, at least about 1 day, at least about 1 month, or at least
about 1 year).
[0561] In some cases, a hermetic seal is tested simultaneously with
testing of the electrical properties of a chip (e.g., via an
electronic tester). The electronic tester can be in contact with
pads of a biochip. The fluidic tester can be in contact with
inlet/outlet of a biochip lid through a fluidic manifold. The
contact between the fluidic manifold and the chip can be free of
leaks by using a rubber gasket.
[0562] The manifold can be connected to a pressurized air source
(e.g. air pump) through a pneumatic valve. In order to test the
hermetic seal between die and lid of biochip, the valve of fluidic
tester can be opened to pressurize the air inside a flowcell of a
biochip, and then closed. Then, the pressure drop of flow cell can
be monitored using a pressure gauge. If pressure drop is less than
a predefined level, the hermetic seal can be determined to be
acceptable.
[0563] Simultaneously, the electronic tester can send and receive
electrical signals to the chip to test its functionality. The chip
can be a complex electronic component that includes one or more
functions to collect sensor data (e.g., impedance data). The chip
can pass several tests before its functional ability is confirmed.
For example, in some cases, a chip may be capable of operating in a
sequencing instrument that collects dielectric spectroscopy data
(also known as impedance spectroscopy or electrochemical impedance
spectroscopy) and measures the dielectric properties of a medium as
a function of frequency.
[0564] In some cases, the tester may include a heat sink to keep a
biochip at appropriate temperature during a test. Also, a fluidic
leakage test can be automated by using a computer system, including
the computer systems described elsewhere herein.
[0565] In some embodiments, a system can be interfaced with an
instrument panel architected in user interface software, such as,
for example, LABVIEW NI. LABVIEW can make use of computer code
(e.g., Python code) adapted for the system.
[0566] While preferred embodiments of the present invention have
been shown and described herein, it will be obvious to those
skilled in the art that such embodiments are provided by way of
example only. It is not intended that the invention be limited by
the specific examples provided within the specification. While the
invention has been described with reference to the aforementioned
specification, the descriptions and illustrations of the
embodiments herein are not meant to be construed in a limiting
sense. Numerous variations, changes, and substitutions will now
occur to those skilled in the art without departing from the
invention. Furthermore, it shall be understood that all aspects of
the invention are not limited to the specific depictions,
configurations or relative proportions set forth herein which
depend upon a variety of conditions and variables. It should be
understood that various alternatives to the embodiments of the
invention described herein may be employed in practicing the
invention. It is therefore contemplated that the invention shall
also cover any such alternatives, modifications, variations or
equivalents. It is intended that the following claims define the
scope of the invention and that methods and structures within the
scope of these claims and their equivalents be covered thereby.
Sequence CWU 1
1
1148DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1tcactcatat ttagacccat catttagact
catcacgcac agcattta 48
* * * * *