U.S. patent application number 16/135428 was filed with the patent office on 2019-08-08 for substituted indazole derivatives active as kinase inhibitors.
This patent application is currently assigned to NERVIANO MEDICAL SCIENCES S.R.L.. The applicant listed for this patent is NERVIANO MEDICAL SCIENCES S.R.L.. Invention is credited to Andrea Lombardi Borgia, Chiara Marchionni, Maria Menichincheri, Marcella Nesi, Paolo Orsini, Achille Panzeri, Ettore Perrone, Ermes Vanotti.
Application Number | 20190241546 16/135428 |
Document ID | / |
Family ID | 39764856 |
Filed Date | 2019-08-08 |
![](/patent/app/20190241546/US20190241546A1-20190808-C00001.png)
![](/patent/app/20190241546/US20190241546A1-20190808-C00002.png)
![](/patent/app/20190241546/US20190241546A1-20190808-C00003.png)
![](/patent/app/20190241546/US20190241546A1-20190808-C00004.png)
![](/patent/app/20190241546/US20190241546A1-20190808-C00005.png)
![](/patent/app/20190241546/US20190241546A1-20190808-C00006.png)
![](/patent/app/20190241546/US20190241546A1-20190808-C00007.png)
![](/patent/app/20190241546/US20190241546A1-20190808-C00008.png)
![](/patent/app/20190241546/US20190241546A1-20190808-C00009.png)
![](/patent/app/20190241546/US20190241546A1-20190808-C00010.png)
![](/patent/app/20190241546/US20190241546A1-20190808-C00011.png)
View All Diagrams
United States Patent
Application |
20190241546 |
Kind Code |
A1 |
Lombardi Borgia; Andrea ; et
al. |
August 8, 2019 |
SUBSTITUTED INDAZOLE DERIVATIVES ACTIVE AS KINASE INHIBITORS
Abstract
Substituted indazole derivatives of formula (I) and
pharmaceutically acceptable salts thereof, as defined in the
specification; the compounds of the invention may be useful in
therapy in the treatment of diseases associated with a deregulated
protein kinase activity, like cancer.
Inventors: |
Lombardi Borgia; Andrea;
(Paullo (MI), IT) ; Menichincheri; Maria; (Milan,
IT) ; Orsini; Paolo; (Legnano (MI), IT) ;
Panzeri; Achille; (Merate, (LC), IT) ; Perrone;
Ettore; (Boffalora Sopra Ticino (MI), IT) ; Vanotti;
Ermes; (Milan, IT) ; Nesi; Marcella; (Saronno
(VA), IT) ; Marchionni; Chiara; (Milan, IT) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
NERVIANO MEDICAL SCIENCES S.R.L. |
Nerviano (MI) |
|
IT |
|
|
Assignee: |
NERVIANO MEDICAL SCIENCES
S.R.L.
Nerviano (MI)
IT
|
Family ID: |
39764856 |
Appl. No.: |
16/135428 |
Filed: |
September 19, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15438872 |
Feb 22, 2017 |
10081622 |
|
|
16135428 |
|
|
|
|
14971372 |
Dec 16, 2015 |
9616059 |
|
|
15438872 |
|
|
|
|
14534617 |
Nov 6, 2014 |
9255087 |
|
|
14971372 |
|
|
|
|
14212256 |
Mar 14, 2014 |
9029356 |
|
|
14534617 |
|
|
|
|
13611679 |
Sep 12, 2012 |
8673893 |
|
|
14212256 |
|
|
|
|
12668745 |
Feb 8, 2010 |
8299057 |
|
|
PCT/EP2008/058861 |
Jul 8, 2008 |
|
|
|
13611679 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 11/00 20180101;
C07D 405/14 20130101; C07D 405/12 20130101; A61P 35/00 20180101;
A61P 3/00 20180101; A61P 9/00 20180101; C07D 231/56 20130101; A61P
17/06 20180101; A61P 13/12 20180101; A61P 3/10 20180101; A61P 27/02
20180101; A61P 35/04 20180101; C07D 403/14 20130101; A61P 41/00
20180101; C07D 401/14 20130101; A61P 13/08 20180101; A61K 31/496
20130101; C07D 403/12 20130101; C07D 405/04 20130101; A61P 39/06
20180101; C07D 401/12 20130101; A61P 19/02 20180101; A61K 45/06
20130101; A61P 3/04 20180101; A61P 29/00 20180101; A61P 43/00
20180101; A61P 9/10 20180101; A61P 21/00 20180101 |
International
Class: |
C07D 405/14 20060101
C07D405/14; A61K 45/06 20060101 A61K045/06; C07D 405/04 20060101
C07D405/04; C07D 403/14 20060101 C07D403/14; C07D 401/14 20060101
C07D401/14; A61K 31/496 20060101 A61K031/496; C07D 405/12 20060101
C07D405/12; C07D 231/56 20060101 C07D231/56; C07D 403/12 20060101
C07D403/12; C07D 401/12 20060101 C07D401/12 |
Foreign Application Data
Date |
Code |
Application Number |
Jul 20, 2007 |
EP |
07112881.3 |
Claims
1.-20. (canceled)
21. A compound of the formula: ##STR00132## wherein: Ar is group of
formula: ##STR00133## R is aryl substituted with one or more
halogen; R1, R2, and R3 are hydrogen; Ra is hydrogen, halogen,
nitro, NHCOR4or NR5R6; Rb is hydrogen, nitro, NR5R6, OR7, or
R8R9N--C.sub.1-C.sub.6 alkyl; R4 is hydrogen, C.sub.2-C.sub.6
alkenyl, C.sub.2-C.sub.6 alkynyl, NR5R6, OR7, SR7,
R8R9N--C.sub.1-C.sub.6 alkyl, R8O--C.sub.1-C.sub.6 alkyl, an
optionally further substituted straight or branched C.sub.1-C.sub.6
alkyl, C.sub.3-C.sub.6 cycloalkyl, heterocyclyl, aryl or
heteroaryl; R5 and R6 are independently hydrogen, C.sub.2-C.sub.6
alkenyl, C.sub.2-C.sub.6 alkynyl, R8R9N--C.sub.2-C.sub.6 alkyl,
R8O--C.sub.2-C.sub.6 alkyl, an optionally further substituted
straight or branched C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.6
cycloalkyl, heterocyclyl, aryl or heteroaryl; or R5 and R6, taken
together with the nitrogen atom to which they are bonded, form an
optionally substituted heterocyclyl group; R7 is hydrogen,
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, SOR10,
SO.sub.2R10, R8R9N--C.sub.2-C.sub.6 alkyl, R8O--C.sub.2-C.sub.6
alkyl, an optionally further substituted straight or branched
C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.6 cycloalkyl, heterocyclyl,
aryl or heteroaryl; R8 and R9 are independently hydrogen,
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, an optionally
further substituted straight or branched C.sub.1-C.sub.6 alkyl,
C.sub.3-C.sub.6 cycloalkyl, heterocyclyl, aryl or heteroaryl; or R8
and R9, taken together with the nitrogen atom to which they are
bonded, may form an optionally substituted heterocyclyl group; and
R10 is hydrogen, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl,
an optionally further substituted straight or branched
C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.6 cycloalkyl, heterocyclyl,
aryl, or heteroaryl; or a pharmaceutically acceptable salt
thereof.
22. A compound according to claim 21, wherein R is phenyl
substituted with one or more fluoro, or a pharmaceutically
acceptable salt thereof.
23. A compound according to claim 21, wherein: Ar is group of
formula ##STR00134## or a pharmaceutically acceptable salt
thereof.
24. A compound according to claim 23, wherein R is phenyl
substituted with one or more fluoro, or a pharmaceutically
acceptable salt thereof.
25. A compound according to claim 21, wherein Ra and Rb are NR5R6,
or a pharmaceutically acceptable salt thereof.
26. A compound according to claim 22, wherein Ra and Rb are NR5R6,
or a pharmaceutically acceptable salt thereof.
27. A compound according to claim 23, wherein Ra and Rb are NR5R6,
or a pharmaceutically acceptable salt thereof.
28. A compound according to claim 25, wherein Ra is NR5R6, wherein
R5 is hydrogen and R6 is heterocyclyl, or a pharmaceutically
acceptable salt thereof.
29. A compound according to claim 25, wherein Rb is NR5R6, wherein
R5 and R6, taken together with the nitrogen atom to which they are
bonded, form an optionally substituted heterocyclyl group, or a
pharmaceutically acceptable salt thereof.
30. A compound according to claim 21, wherein: R is phenyl
substituted with one or more fluoro; Ar is group of formula
##STR00135## and Ra and Rb are NR5R6, or a pharmaceutically
acceptable salt thereof.
31. A compound according to claim 30, wherein: Ra is NR5R6, wherein
R5 is hydrogen and R6 is heterocyclyl; and Rb is NR5R6, wherein R5
and R6, taken together with the nitrogen atom to which they are
bonded, form an optionally substituted heterocyclyl group, or a
pharmaceutically acceptable salt thereof.
32. A compound according to claim 30, wherein R is difluorophenyl,
or a pharmaceutically acceptable salt thereof.
33. A compound according to claim 31, wherein R is difluorophenyl,
or a pharmaceutically acceptable salt thereof.
34. A compound according to claim 21, wherein: R is phenyl
substituted with one or more fluoro; Ar is group of formula
##STR00136## and Ra and Rb are NR5R6, or a pharmaceutically
acceptable salt thereof.
35. A compound according to claim 34, wherein: Ra is NR5R6, wherein
R5 is hydrogen and R6 is heterocyclyl; and Rb is NR5R6, wherein R5
and R6, taken together with the nitrogen atom to which they are
bonded, form an optionally substituted heterocyclyl group, or a
pharmaceutically acceptable salt thereof.
36. A compound according to claim 34, wherein R is difluorophenyl,
or a pharmaceutically acceptable salt thereof.
37. A compound according to claim 35, wherein R is difluorophenyl,
or a pharmaceutically acceptable salt thereof.
38. A pharmaceutical composition comprising a therapeutically
effective amount of a compound according to claim 21, or a
pharmaceutically acceptable salt thereof, and at least one
pharmaceutically acceptable excipient carrier or diluent.
39. A method of treating cancer in a mammal in need thereof,
comprising administering to the mammal a therapeutically effective
of a compound according to claim 21, or a pharmaceutically
acceptable salt thereof.
40. A method of treating cancer in a mammal in need thereof,
comprising administering to the mammal a therapeutically effective
of a pharmaceutical composition according to claim 38.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation of co-pending
application having U.S. Ser. No. 15/438,872, filed on Feb. 22,
2017, which is a continuation of a co-pending application having
U.S. Ser. No. 14/971,372, filed on Dec. 16, 2015, now U.S. Pat. No.
9,616,059, which is a continuation of a co-pending application
having U.S. Ser. No, 14/534,617, filed on Nov. 6, 2014, now U.S.
Pat. No. 9,255,087, which is a continuation of a co-pending
application having U.S. Ser. No. 14/212,256, filed on Mar. 14,
2014, now U.S. Pat. No. 9,029,356, which is a continuation of a
co-pending application having U.S. Ser. No. 13/611,679, filed on
Sep. 12, 2012, now U.S. Pat. No. 8,673,893, which is a continuation
of the application having U.S. Ser. No. 12/668,745, filed on Feb.
8, 2010, now U.S. Pat. No. 8,299,057, which is a 371 of
International application having Serial No. PCT/EP2008/058861,
filed on Jul. 8, 2008, which claims benefit of European Patent
Application No. 07112881.3, filed on Jul. 20, 2007, the contents of
all of which are incorporated herein by reference.
INCORPORATION BY REFERENCE OF SEQUENCE LISTING
[0002] The Sequence Listing in the ASCII text file, named as
24846_sequencelisting.txt of 2 KB, created on May 25, 2010, and
submitted to the United States Patent and Trademark Office via
EFS-Web, is incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0003] The present invention relates to certain substituted
indazole compounds, which modulate the activity of protein kinases.
The compounds of this invention are therefore useful in treating
diseases caused by deregulated protein kinase activity. The present
invention also provides methods for preparing these compounds,
pharmaceutical compositions comprising these compounds, and methods
of treating diseases utilizing pharmaceutical compositions
comprising these compounds.
[0004] The malfunctioning of protein kinases (PKs) is the hallmark
of numerous diseases. A large share of the oncogenes and
proto-oncogenes involved in human cancers encode for PKs. The
enhanced activities of PKs are also implicated in many
non-malignant diseases, such as benign prostate hyperplasia,
familial adenomatosis, polyposis, neuro-fibromatosis, psoriasis,
vascular smooth cell proliferation associated with atherosclerosis,
pulmonary fibrosis, arthritis glomerulonephritis and post-surgical
stenosis and restenosis.
[0005] PKs are also implicated in inflammatory conditions and in
the multiplication of viruses and parasites. PKs may also play a
major role in the pathogenesis and development of neurodegenerative
disorders.
[0006] For a general reference to PKs malfunctioning or
deregulation see, for instance, Current Opinion in Chemical Biology
1999, 3, 459-465. A subset of PK is a group of membrane receptors
with intrinsic protein-tyrosine kinase activity (RPTK). Upon
binding of grow factors, RPTKs become activated and phosphorylate
themselves and a series of substrates in the cytoplasm. Through
this mechanism, they can transduce intracellular signalings for
proliferation, differentiation or other biological changes.
Structural abnormalities, over-expression and activation of RTPKs
are frequently observed in human tumors, suggesting that
constitutive ignition of the signal transduction leading to cell
proliferation can result in malignant transformation. Anaplastic
lymphoma kinase (ALK) is a tyrosine kinase receptor belonging to
the insulin receptor subfamily of RTKs: the ALK gene is located on
cromosome 2 and is expressed mainly in neuronal cells, especially
during development. The ALK gene is involved in a balanced
chromosomal translocation with the Nucleophosmin (NPM) gene on
cromosome 5 in a large subset of Anaplastic Large Cell Lymphomas
(ALCL). In the ALK+ALCL, as a result of the translocation, the NPM
ubiquitous promoter drives an ectopic expression of the fusion
protein in which the NPM moiety dimerizes and the ALK kinase domain
undergoes auto-phosphorylation and becomes constitutively
active.
[0007] Many data from the literature have demonstrated that the
NPM-ALK fusion protein has a strong oncogenic potential and its
ectopic expression is responsible for cellular transformation.
Moreover, the constitutive expression of human NPM-ALK in mouse
T-cell lymphocytes is sufficient for the development of lymphoid
neoplasia in transgenic animals with a short period of latency.
[0008] ALCL is a defined disease characterized by the surface
expression of the CD30 antigen (Ki-1), and accounts for of adult
and 13% of pediatric non-Hodgkin's lymphomas, affecting
predominantly young male patients. ALK+ALCL accounts for 70% of all
ALCLs and is an aggressive disease with systemic signs, and
frequent extranodal involvement (bone marrow, skin, bone, soft
tissues).
[0009] About 15-20% of ALK-expressing ALCLs were found to bear a
different chromosomal translocation, involving the cytoplasmic
portion of ALK, with different N-terminal moieties, all resulting
in constitutive activation of the ALK kinase domain. Moreover, cell
lines established from solid tumors of ectodermal origin like
melanomas, breast carcinomas, as well as neuroblastomas,
glioblastomas, Ewings sarcomas, retinoblastomas, were found to
express the ALK receptor.
[0010] In conclusion, interfering with the ALK signalling likely
represents a specific and effective way to block tumor cell
proliferation in ALCL and possibly other indications.
[0011] The insulin-like growth factor 1 receptor (IGF-1R, IGF1R) is
also a member of the insulin receptor subfamily of RTKs.
[0012] There exist several lines of evidence suggesting that IGF-1R
signaling can contribute to tumorigenesis, and that interfering
with IGF-1R function represents a valid therapeutic option in
cancer. For an overview of IGFs and IGF-1R signalling,
physiological function, and detailed description of the evidence
supporting involvement of this system in human cancer that is
summarised above, as well as in other pathologies, the reader is
directed to the many reviews on the subject and references
contained therein, for example Baserga R. et al; Biochim Biophys
Acta vol. 1332, pages F105-F126, 1997; Khandwala H. M. et al,
Endocr Rev vol. 21, pages 215-44, 2000; Le Roith D. et al, Endocr
Rev vol. 22, pages 53-74, 2001; Valentinis B. et al, Mol Pathol
vol. 54, pages 133-7, 2001; Wang Y. et al, Curr Cancer Drug Targets
vol. 2, pages 191-207, 2002; Laron, Z. J Clin Endocrinol Metab vol.
89, pages 1031-1044; 2004; Hofmann F et al, Drug Disco); Today vol.
10, pages 1041-7, 2005.
SUMMARY OF THE INVENTION
[0013] 3-Amino and 3-acylamino indazole derivatives for the
treatment of neurodegenerative diseases, cerebrovascular accidents,
obesity, cardiovascular diseases and cancer are disclosed in
WO2006003276, WO2004022544 and WO 2003078403 in the name of Aventis
Pharma SA.
[0014] Indazolylamide derivatives for the treatment of diabetes,
neurodegenerative conditions such as Alzheimer's disease and
Parkinson's disease are disclosed in WO2003051847 in the name of
SmithKline Beecham P.L.C.
[0015] Indazole derivatives for the treatment of tumor disease,
viral disease, immunosuppression in transplantation, cystic
fibrosis and diseases acciciated with angiogenesis are disclosed in
WO2008003396 in the name of Merck GMBH. Despite these developments,
there is still a need for more effective agents for the treatment
of such diseases
[0016] We have now discovered that a series of indazoles are potent
protein kinase inhibitors and are thus useful in anticancer
therapy.
[0017] Accordingly, a first object of the present invention s to
provide a substituted indazole compound represented by formula
(I),
##STR00001##
[0018] wherein:
[0019] X is --CH.sub.2--, --CH(OH)--, --CH(OR')-- or --C(R'R'')--,
wherein:
[0020] R' is an optionally further substituted straight or branched
C.sub.1-C.sub.6 alkyl and R'' is hydrogen or an optionally further
substituted straight or branched C.sub.1-C.sub.6 alkyl;
[0021] Ar is aryl or heteroaryl optionally substituted with one or
more substituents independently selected from halogen,
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, cyano, nitro,
NHCOR4, COR4, NR5R6, NR5COR4, OR7, SR7, SOR10, SO.sub.2R10,
NHSOR10, NHSO.sub.2R10, R8R9N--C.sub.1-C.sub.6 alkyl,
R8O--C.sub.1-C.sub.6 alkyl, an optionally further substituted
straight or branched C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.6
cycloalkyl, heterocyclyl, aryl and heteroaryl, wherein:
[0022] R4 is hydrogen, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6
alkynyl, NR5R6, OR7, SR7, R8R9N--C.sub.1-C.sub.6 alkyl
R8O--C.sub.1-C.sub.6 alkyl, an optionally further substituted
straight or branched C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.6
cycloalkyl heterocyclyl, aryl or heteroaryl;
[0023] R5 and R6 are independently hydrogen, C.sub.2-C.sub.6
alkenyl, C.sub.2-C.sub.6 alkynyl, R8R9N--C.sub.2-C.sub.6 alkyl,
R8O-C.sub.2-C.sub.6 alkyl, an optionally further substituted
straight or branched C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.6
cycloalkyl, heterocyclyl, aryl or heteroaryl, or R5 and R6, taken
together with the nitrogen atom to which they are bonded, may form
an optionally substituted heterocyclyl group;
[0024] R7 is hydrogen, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6
alkynyl, COR4, SOR10, SO.sub.2R10, R8R9N--C.sub.2-C.sub.6 alkyl,
R8O--C.sub.2-C.sub.6 alkyl, an optionally further substituted
straight or branched C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.6
cycloalkyl, heterocyclyl, aryl or heteroaryl, wherein R4 is as
defined above;
[0025] R8 and R9 are independently hydrogen, C.sub.2-C.sub.6
alkenyl, C.sub.2-C.sub.6 alkynyl, COR4, an optionally further
substituted straight or branched C.sub.1-C.sub.6 alkyl,
C.sub.3-C.sub.6 cycloalkyl, heterocyclyl, aryl or heteroaryl, or R8
and R9, taken together with the nitrogen atom to which they are
bonded, may form an optionally substituted heterocyclyl group,
wherein R4 is as defined above;
[0026] R10 is hydrogen, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6
alkynyl, NR5R6, OR7, R8R9N--C.sub.1-C.sub.6 alkyl,
R8O--C.sub.1-C.sub.6 alkyl; an optionally further substituted
straight or branched C.sub.1-C.sub.6 alkyl; C.sub.3-C.sub.6
cycloalkyl, heterocyclyl, aryl or heteroaryl, wherein R5, R6, R7,
R8 and R9 are as defined above;
[0027] R is an optionally substituted straight or branched.
C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.6 cycloalkyl, heterocyclyl,
aryl or heteroaryl;
[0028] R1, R2 and R3 are independently hydrogen, halogen, nitro, an
optionally substituted straight or branched C.sub.1-C.sub.6 alkyl,
NR5R6, or OR7, wherein R5, R6 and R7 are as defined above;
[0029] or isomers, tautomers, prodrugs or pharmaceutically
acceptable salt thereof.
[0030] The present invention also provides methods of synthesizing
the substituted indazole derivatives of formula (I) prepared
through a process consisting of standard synthetic
transformations.
[0031] The present invention also provides a method for treating
diseases caused by and/or associated with deregulated protein
kinase activity, particularly PLK family, protein kinase C in
different isoforms, Met, PAK-4, PAK-5, ZC-1, STLK-2, DDR-2, Aurora
1, Aurora 2, Bub-1, Chk1, Chk2, HER2, raf1, MEK1, MAPK, EGF-R,
PDGF-R, FGF-R, FLT3, JAK2, IGF-R, ALK , PI3K, weel kinase, Src,
Abl, Akt, MAPK, ILK, MK-2, IKK-2, Cdc7, Nek, Cdk/cyclin kinase
family, more particularly Aurora 2, IGF-1R and ALK activity, and
further more particularly ALK activity, which comprises
administering to a mammal in need thereof an effective amount of a
substituted indazole compound represented by formula (I) as defined
above.
[0032] A preferred method of the present invention is to treat a
disease caused by and/or associated with dysregulated protein
kinase activity selected from the group consisting of cancer and
cell proliferative disorders.
[0033] Another preferred method of the present invention, is to
treat specific types of cancer including carcinoma, squamous cell
carcinoma, hematopoietic tumors of myeloid or lymphoid lineage,
tumors of mesenchymal origin, tumors of the central and peripheral
nervous system, melanoma, seminoma, teratocarcinoma, osteosarcoma,
xeroderma pigmentosum, keratocanthomas, thyroid follicular cancer
and Kaposi's sarcoma.
[0034] Another preferred method of the present invention, is to
treat specific types of cancer such as, but not restricted to,
breast cancer, lung cancer, colorectal cancer, prostate cancer,
ovarian cancer, endometrial cancer, gastric cancer, clear cell
renal cell carcinoma, uveal melanoma, multiple myeloma,
rhabdomyosarcoma, Ewing's sarcoma, Kaposi's sarcoma, and
medulloblastoma.
[0035] Another preferred method of the present invention, is to
treat ALK+ Anaplastic Large Cell Lymphomas (ALCL) and possibly
other indications in which the ALK activity might play a role, like
Neuroblastoma, Rhabdomyosarcoma, Glioblastoma, Inflammatory
MyofibroblasticTumor, and some kind of Melanomas, Breast
Carcinomas, Ewings sarcomas, Retinoblastomas and Non Small Cell
Lung Carcinomas (NSCLC).
[0036] Another preferred method of the present invention, is to
treat cell proliferative disorders such as, but not restricted to,
benign prostate hyperplasia, familial adenomatosis polyposis,
neuro-fibromatosis, psoriasis, atherosclerosis and conditions
involving vascular smooth muscle proliferation or neointimal
formation such as restenosis following angioplasty or surgery,
pulmonary fibrosis, arthritis, glomerulonephritis, retinopathies
including diabetic and neonatal retinopathies and age related
macular degeneration, graft vessel disease, such as can occur
following vessel or organ transplantation, acromegaly and disorders
secondary to acromegaly as well as other hypertrophic conditions in
which IGF/IGF-1R signalling is implicated, such as fibrotic lung
disease, pathologies related to chronic or acute oxidative stress
or hyperoxia induced tissue damage, and metabolic disorders in
which elevated IGF levels or IGF-1R activity are implicated, such
as obesity.
[0037] In addition, the method of the present invention also
provides tumor angiogenesis and metastasis inhibition.
[0038] In a further preferred embodiment, the method of the present
invention further comprises subjecting the mammal in need thereof
to a radiation therapy or chemotherapy regimen in combination with
at least one cytostatic or cytotoxic agent.
[0039] Moreover the invention provides a method for inhibiting the
activity ALK protein which comprises contacting the said protein
with an effective amount of a compound of formula (I).
[0040] The present invention also provides a pharmaceutical
composition comprising one or more compounds of formula (I) or a
pharmaceutically acceptable salt thereof and a pharmaceutically
acceptable excipient, carrier or diluent.
[0041] The present invention further provides a pharmaceutical
composition comprising a compound of formula (I) in combination
with one or more chemotherapeutic agents or radiotherapy. Such
agents can include, but are not limited to, antihormonal agents
such as antiestrogens, antiandrogens and aromatase inhibitors,
topoisomerase I inhibitors, topoisomerase II inhibitors, agents
that target microtubules, platin-based agents, alkylating agents,
DNA damaging or intercalating agents, antineoplastic
antimetabolites, other kinase inhibitors, other anti-angiogenic
agents, inhibitors of kinesins, therapeutic monoclonal antibodies,
inhibitors of mTOR, histone deacetylase inhibitors, farnesyl
transferase inhibitors, and inhibitors of hypoxic response.
[0042] Additionally, the invention provides a product or kit
comprising a compound of formula (I) or a pharmaceutically
acceptable salt thereof, as defined above, or pharmaceutical
compositions thereof and one or more chemotherapeutic agents, as a
combined preparation for simultaneous, separate or sequential use
in anticancer therapy.
[0043] In yet another aspect the invention provides a compound of
formula (I) or a pharmaceutically acceptable salt thereof, as
defined above, for use as a medicament. Moreover the invention
provides the use of a compound of formula (I) or a pharmaceutically
acceptable salt thereof, as defined above, in the manufacture of a
medicament with antitumor activity.
[0044] Finally, the invention provides a compound of formula (I) or
a pharmaceutically acceptable salt thereof, as defined above, for
use in a method of treating cancer.
DETAILED DESCRIPTION OF THE INVENTION
[0045] The compounds of formula (I) may have one or more asymmetric
centres, and may therefore exist as individual optical isomers or
racemic mixtures. Accordingly, all the possible isomers, and their
mixtures, of the compounds of formula (I) are within the scope of
the present invention.
[0046] Derivatives of compounds of formula (I) originating from
metabolism in a mammal, and the pharmaceutically acceptable
bio-precursors (otherwise referred to as pro-drugs) of the
compounds of formula (I) are also within the scope of the present
invention.
[0047] In addition to the above, as known to those skilled in the
art, the unsubstituted nitrogen on the pyrazole ring of the
compounds of formula (I) rapidly equilibrates in solution to form a
mixture of tautomers, as depicted below:
##STR00002##
[0048] wherein X, Ar, R, R1, R2 and R3 are as defined above.
[0049] Accordingly, in the present invention, where only one
tautomer is indicated for the compounds of formula (I), the other
tautomer (Ia) is also within the scope of the present invention,
unless specifically noted otherwise.
[0050] The general terms as used herein, unless otherwise
specified, have the meaning reported below.
[0051] The term "straight or branched C.sub.1-C.sub.6 alkyl" refers
to a saturated aliphatic hydrocarbon radical, including straight
chain and branched chain groups of from 1 to 6 carbon atoms, e.g.
methyl, ethyl, propyl, 2-propyl, n-butyl, iso-butyl, tert-butyl,
pentyl and the like. The alkyl group may be substituted or
unsubstituted. When substituted, the substituent groups are
preferably one to three, independently selected from the group
consisting of halogen, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6
alkynyl, cyano, nitro, NHCOR4, COR4, NR5R6, NR5COR4, OR7, SR7,
SOR10, SO.sub.2R10, NHSOR10, NHSO.sub.2R.sub.10,
R8R9N--C.sub.1-C.sub.6 alkyl, R8O--C.sub.1-C.sub.6 alkyl, an
optionally further substituted C.sub.3-C.sub.6, cycloalkyl,
heterocyclyl and aryl, wherein R4, R5, R6, R7, R8, R9 and R10 are
as defined above.
[0052] The term "C.sub.3-C.sub.6 cycloalkyl" refers to a 3- to
6-membered all-carbon monocyclic ring, which may contain one or
more double bonds but does not have a completely, conjugated
.pi.-electron system. Examples of cycloalkyl groups, without
limitation, are cyclopropyl, cyclobutyl, cyclopentyl,
cyclopentenyl, cyclohexyl, cyclohexenyl and cyclohexadienyl. A
cycloalkyl group may be substituted or unsubstituted. When
substituted, the substituent groups are preferably one or two
substituents, independently selected from the group consisting of
halogen, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, cyano,
nitro, NHCOR4, COR4, NR5R6, NR5COR4, OR7, SR7, SOR10, SO.sub.2R10,
NHSOR10, NHSO.sub.2R10, R8R9N--C.sub.1-C.sub.6 alkyl,
R8O--C.sub.1-C.sub.6 alkyl, an optionally further substituted
straight or branched C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.6
cycloalkyl,heterocyclyl and aryl, wherein R4, R5, R6, R7, R8, R9
and R10 are as defined above.
[0053] The term "heterocyclyl" refers to a 3- to 7-membered,
saturated or partially unsaturated carbocyclic ring where one or
more carbon atoms are replaced by heteroatoms such as nitrogen,
oxygen and sulfur. Not limiting examples of heterocyclyl groups
are, for instance, oxiranyl, aziridinyl, oxetanyl, azetidinyl,
tetrahydrofuranyl, dihydrofuranyl, tetrahydrothiophenyl,
dihydrothiophenyl, pyrrolidinyl, dihydropyrrolyl, pyranyl,
dihydropyranyl, tetrahydropyranyl, tetrahydrothiopyranyl,
piperidinyl, pyrazolinyl, isoxazolidinyl, isoxazolinyl,
thiazolidinyl, thiazolinyl, isothiazolinyl, dioxanyl, piperazinyl,
morpholinyl, thiomorpholinyl, examethyleneiminyl, homopiperazinyl
and the like. A heterocyclyl group may be substituted or
unsubstituted. When substituted, the substituent groups are
preferably one or two substituents, independently selected from the
group consisting of halogen, C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl, cyano, nitro, NHCOR4, COR4, NR5R6,
NR5COR4, OR7, SR7, SOR10, SO.sub.2R10, NHSOR10, NHSO.sub.2R10,
R8R9N--C.sub.1-C.sub.6 alkyl, R8O--C.sub.1-C.sub.6 alkyl, an
optionally further substituted straight or branched C.sub.1-C.sub.6
alkyl, C.sub.3-C.sub.6 cycloalkyl, heterocyclyl and aryl, wherein
R4, R5, R6, R7, R8, R9 and R10 are as defined above.
[0054] The term "aryl" refers to a mono-, bi- or poly-carbocyclic
hydrocarbon with from 1 to 4 ring systems, optionally further fused
or linked to each other by single bonds, wherein at least one of
the carbocyclic rings is "aromatic", wherein the term "aromatic"
refers to completely conjugated pi-electron bond system. Non
limiting examples of such aryl groups are phenyl, .alpha.- or
.beta.-naphthyl or biphenyl groups.
[0055] The term "heteroaryl" refers to aromatic heterocyclic rings,
typically 5- to 7-membered heterocycles with from 1 to 3
heteroatoms selected among N, O or S; the heteroaryl ring can be
optionally further fused or linked to aromatic and non-aromatic
carbocyclic and heterocyclic rings. Not limiting examples of such
heteroaryl groups are, for instance, pyridyl, pyrazinyl,
pyrimidinyl, pyridazinyl, indolyl, imidazolyl, thiazolyl,
isothiazolyl, pyrrolyl, phenyl-pyrrolyl, furyl, phenyl-furyl,
oxazolyl, isoxazolyl, pyrazolyl, thienyl, benzothienyl,
isoindolinyl, benzoimidazolyl, quinolinyl, isoquinolinyl,
1,2,3-triazolyl, 2,3-dihydroindolyl, 2,3-dihydrobenzofuranyl,
2,3-dihydrobenzothiophenyl; benzopyranyl, 2,3-dihydrobenzoxazinyl,
2,3-dihydroquinoxalinyl and the like.
[0056] The aryl and heteroaryl groups can be optionally substituted
by one or more, preferably one, two or three substituents
independently selected from halogen, C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl, cyano, nitro, NHCOR4, COR4, NR5R6,
NR5COR4, OR7, SR7, SOR10, SO.sub.2R10, NHSOR10, NHSO.sub.2R10,
R8R9N--C.sub.1-C.sub.6 alkyl, R8O-C.sub.1-C.sub.6 alkyl, an
optionally further substituted straight or branched C.sub.1-C.sub.6
alkyl, C.sub.3-C.sub.6 cycloalkyl, heterocyclyl and aryl, wherein
R4, R5, R6, R7, R8, R9 and R10 are as defined above.
[0057] The term "halogen" indicates fluorine, chlorine, bromine or
iodine.
[0058] The term "C.sub.2-C.sub.6 alkenyl" indicates an aliphatic
C.sub.2-C.sub.6 hydrocarbon chain containing at least one
carbon-carbon double cloud and which can be straight or branched.
Representative examples include, but are not limited to, ethenyl,
1-propenyl, 2-propenyl, 1- or 2-butenyl, and the like.
[0059] The term "C.sub.2-C.sub.6 alkynyl" indicates an aliphatic
C.sub.2-C.sub.6 hydrocarbon chain containing at least one
carbon-carbon double dond and which can be straight or branched.
Representative examples include, but are not limited to, ethynyl,
1-propynyl, 2-propynyl, 1- or 2-butynyl, and the like.
[0060] The term "cyano" indicates a --CN residue.
[0061] The term "nitro" indicates a --NO.sub.2 group.
[0062] The term "pharmaceutically acceptable salt" of compounds of
formula (I) refers to those salts that retain the biological
effectiveness and properties of the parent compound. Such salts
include acid addition salts with inorganic acids such as
hydrochloric, hydrobromic, nitric; phosphoric, sulfuric; perchloric
acid and the like, or with organic acids such as acetic,
trifluoroacetic, propionic, glycolic, lactic, (D) or (L) malic,
maleic, methanesulfonic, ethanesulfonic, benzoic,
p-toluenesulfonic, salicylic, cinnamic, mandelic, tartaric, citric,
succinic, malonic acid and the like; salts formed when an acidic
proton present in a compound of formula (I) is either replaced by a
metal ion, e.g., an alkali metal ion such as sodium or potassium,
or an alkaline earth ion such as calcium or magnesium, or
coordinates with an organic base such as ethanolamine,
diethanolamine, triethanolamine, tromethamine, N-methylglucamine,
and the like.
[0063] Compounds of formula (I) wherein X is --CH.sub.2--, are
represented by the general formula (I.sub.A):
##STR00003##
[0064] Compounds of formula (I) wherein X is --CH(OH)--, are
represented by the general formula (I.sub.B):
##STR00004##
[0065] Compounds of formula (I) wherein X is --CH(OR')--, are
represented by the general formula (I.sub.C):
##STR00005##
[0066] Compounds of formula (I) wherein X is --C(R'R'')--, are
represented general formula (I.sub.D):
##STR00006##
[0067] A preferred class of compounds of formula (I) are the
compounds wherein:
[0068] X is --CH.sub.2--, --CH(OH)--, --CH(OR')-- or C(R'R'')--,
wherein R' is C.sub.1-C.sub.3 alkyl and R'' is hydrogen or
C.sub.1-C.sub.3 alkyl;
[0069] R is an optionally substituted C.sub.3-C.sub.6 cycloalkyl,
heterocyclyl, aryl or heteroaryl, and
[0070] R1, R2 and R3 are independently hydrogen, halogen or
hydroxy.
[0071] Another preferred class of compounds of formula (I) are the
compounds wherein:
[0072] X is --CH.sub.2--, --CH(OH)--, --CH(OR')-- or --C(R'R'')--,
wherein R' is methyl and R'' is hydrogen or methyl, and
[0073] R1, R2 and R3 are hydrogen.
[0074] A further preferred class of compounds of formula (I) are
the compounds wherein
[0075] R is an optionally substituted aryl or heteroaryl.
[0076] A more preferred class of compounds of formula are the
compounds wherein
[0077] Ar is a group of formula:
##STR00007##
[0078] wherein Ra, Rb and Rc are independently hydrogen, halogen,
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, cyano, nitro,
NHCOR4, COR4, NR5R6, NR5COR4, OR7, SR7, SOR10, SO.sub.2R10,
NHSOR10, NHSO.sub.2R10, R8R9N--C.sub.1-C.sub.6 alkyl,
R8O--C.sub.1-C.sub.6 alkyl, an optionally further substituted
straight or branched C.sub.1-C.sub.6 alkyl, C.sub.3-C.sub.6
cycloalkyl, heterocyclyl, aryl or heteroaryl, wherein R4, R5, R6,
R7, R8, R9 and R10 are as defined above and
[0079] R is an optionally substituted aryl.
[0080] A further more preferred class of compounds of formula (I)
are the compounds wherein:
[0081] Ar is a group of formula:
##STR00008##
[0082] wherein Ra and Rb are as defined above.
[0083] A most preferred class of compounds of formula (I) are the
compounds wherein:
[0084] Ar is a group of formula:
##STR00009##
[0085] wherein Ra is hydrogen, halogen, nitro; NHCOR4 or NR5R6 and
Rb is hydrogen, nitro, NR5R6, OR7 or R8R9N--C.sub.1-C.sub.6 alkyl
wherein R4, R5, R6, R7, R8 and R9 are as defined above.
[0086] Specific compounds (cpd.) of the invention are listed
below:
[0087] 1.
N-(5-benzyl-1H-indazol-3-yl)-4-(4-methyl-piperazin-1-yl)-benzami-
de;
[0088] 2.
N-[5-(3-fluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-1--
yl)-benzamide;
[0089] 3.
N-[5-(2,5-difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazi-
n-1-yl)benzamide;
[0090] 4.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazi-
n-1-yl)benzamide;
[0091] 5. N-[5-(3-fluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl
-piperazin-1-yl)-2-nitrobenzamide;
[0092] 6. N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl
-piperazin-1-yl)-2-nitro-benzamide;
[0093] 7.
2-Amino-N-[5-(3-fluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-pipe-
razin-1-yl)-benzamide;
[0094] 8.
2-Amino-N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl--
piperazin-1-yl)-benzamide;
[0095] 9.
N-[5-(3-fluoro-benzyl)-1H-indazol-3-yl]-4-(4methyl-piperazin-1-y-
l)-2-(tetrahydro-pyran-4-ylamino)-benzamide;
[0096] 10.
N-[5-(2,5-difluoro-benzyl)-1H-indazol-3-yl]-4(4-methyl-piperazi-
n-1-yl)-2-(tetrahydro-pyran-4-ylamino)-benzamide;
[0097] 11.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperaz-
in-1-yl)-2-(tetrahydro-pyran-4-ylamino)-benzamide;
[0098] 12.
N-[5-(3-fluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-
-yl)-2-(1-methyl-piperidin-4-ylamino)-benzamide;
[0099] 13.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperaz-
in-1-yl)-2(1-methyl-piperidin4-ylamino)-benzamide;
[0100] 14.
N-[5-(3-fluoro-benzyl)-1H-indazol-3-yl]-2-(2-methoxy-1-methoxym-
ethyl-ethylamino)-4-(4-methyl -piperazin-1-yl)-benzamide;
[0101] 15.
N-[5-(2,5-difluoro-benzyl)-1H-indazol-3-yl]-2(2-methoxy-1-metho-
xymethyl-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0102] 16.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-2-(2-methoxy-1-meth-
oxymethyl-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0103] 17.
2-cyclohexylamino-N-[5-(3-fluoro-benzyl)-1H-indazol-3-yl]-4-(4--
methyl-piperazin-1-yl)-benzamide;
[0104] 18.
2-cyclohexylamino-N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-
-(4-methyl-piperazin-1-yl)-benzamide;
[0105] 19.
N-[5-(3-fluoro-benzyl)-1H-indazol-3-yl]-2-(4-hydroxy-cyclohexyl-
amino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0106] 20.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-2-(4-hydroxy-cycloh-
exylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0107] 21.
N-[5-(3-fluoro-benzyl)-1H-indazol-3-yl]-2-isobutylamino-4-(4-me-
thyl-piperazin-1-yl)-benzamide;
[0108] 22.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-2-isobutylamino-4-(-
4-methyl-piperazin-1-yl)-benzamide;
[0109] 23.
2-benzylamino-N-[5-(3-fluoro-benzyl)-1H-indazol-3yl]-4-(4-methy-
l-piperazin-1-yl)-benzamide;
[0110] 24.
2-benzylamino-N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-(4--
methyl-piperazin-1-yl)-benzamide;
[0111] 25.
N-[5-(3-fluoro-benzyl)-1H-indazol-3-yl]-2-(2-methoxy-ethylamino-
)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0112] 26.
N-[5-(3.5-difluoro-benzyl)-1H-indazol-3-yl]-2-(2-methoxy-ethyla-
mino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0113] 27.
N-[5-(3-fluoro-benzyl)-1H-indazol-3-yl]-2-(2-methoxy-1-methyl-e-
thylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0114] 28.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-2-(2-methoxy-1-meth-
yl-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0115] 29.
N-[5-(3-fluoro-benzyl)-1H-indazol-3-yl]-2-((S)-2-methoxy-1-meth-
yl-ethylamino)-4-(4-methyl -piperazin-1-yl)-benzamide;
[0116] 30.
N[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-2-((S)-2-methoxy-1-m-
ethyl-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0117] 31.
N-[5-(3-fluoro-benzyl)-1H-indazol-3-yl]-2-((R)-2-methoxy-1-meth-
yl-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0118] 32.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-2-((R)-2-methoxy-1--
methyl-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0119] 33.
N-[5-(3-fluoro-benzyl)-1H-indazol-3-yl]-2(2-methoxy-1,1-dimethy-
l-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0120] 34.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-2-(2-methoxy-1,1-di-
methyl-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0121] 35.
N-[5-(3-fluoro-benzyl)-1H-indazol-3-yl]-2(3-methoxy-propylamino-
)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0122] 36.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-2-(3-methoxy-propyl
amino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0123] 37.
N-[5-(3-fluoro-benzyl)-1H-indazol-3-yl]-2-(2-fluoro-ethylamino)-
-4-(4-methyl-piperazin-1-yl)-benzamide;
[0124] 38.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3yl]-2(2-fluoro-ethylamin-
o)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0125] 39.
N-[5-(3-fluoro-benzyl)-1H-indazol-3-yl]-2-(3-fluoro-propylamino-
)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0126] 40.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-2-(3-fluoro-propyla-
mino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0127] 41.
N-[5-(3-fluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-
-yl)-2-phenylamino-benzamide;
[0128] 42.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperaz-
in-1-yl)-2-phenylamino-benzamide;
[0129] 43. 1H-pyrrole-2-carboxylic acid
[2-[5-(3-fluoro-benzyl)-1H-indazol-3-ylcarbamoyl]-5-(4-methyl-piperazin-1-
-yl)-phenyl]-amide;
[0130] 44. 1H-pyrrole-2-carboxylic acid
[2-[5-(3,5-difluoro-benzyl)-1H-indazol-3-ylcarbamoyl]-5-(4-methyl-piperaz-
in-1-yl)-phenyl]-amide;
[0131] 45. 1H-pyrrole-3-carboxylic acid
[2-[5-(3-fluoro-benzyl)-1H-indazol-3-ylcarbamoyl]-5-(4-methyl-piperazin-1-
-yl)-phenyl]-amide;
[0132] 46. 1H-pyrrole-3-carboxylic acid
[2-[5-(3,5-difluoro-benzyl)-1H-indazol-3-ylcarbamoyl]-5-(4-methyl-piperaz-
in-1-yl)-phenyl]-amide;
[0133] 47.
N-[5-(3-fluoro-benzyl)-1H-indazol-3-yl]-2-methanesulfonylamino--
4-(4-methyl-piperazin-1-yl)-benzamide;
[0134] 48.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-2-methanesulfonylam-
ino-4-(4-methyl-piperazin-1-yl)-benzamide;
[0135] 49.
2-fluoro-N-[5-(3-fluoro-benzyl)-1H-indazol-3-yl]-5-(tetrahydro--
pyran-4-ylamino)-benzamide;
[0136] 50.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-2-fluoro-5-(tetrahy-
dro-pyran-4-ylamino)-benzamide;
[0137] 51.
2-fluoro-N-[5-(3-fluoro-benzyl)-1H-indazol-3-yl]-5-(2-methoxy-e-
thylamino)-benzamide;
[0138] 52.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-2-fluoro-5-(2-metho-
xy-ethylamino)-benzamide;
[0139] 53.
4-[(3-dimethylamino-propyl)-methyl-amino]-N-[5-(3-ethoxy-benzyl-
)-1H-indazol-3-yl]-2-nitro-benzamide;
[0140] 54.
2-amino-4-[(3-dimethylamino-propyl)-methyl-amino]-N-[5-(3-ethox-
y-benzyl)-1H-indazol-3-yl]-benzamide;
[0141] 55.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-[(3-dimethylamino-
-propyl)-methyl-amino]-2-(tetrahydro-pyran-4-ylamino)-benzamide;
[0142] 56.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-[(3-dimethylamino-
-propyl)-methyl-amino]-2-(2-methoxy-1-methoxymethyl-ethylamino)-benzamide;
[0143] 57.
2-amino-N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-[(3-dimet-
hylamino-propyl)-methyl-amino]-benzamide;
[0144] 58.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-[(3-dimethylamino-
-propyl)-methyl-amino]-benzamide;
[0145] 59.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-[(3-dimethylamino-
-propyl)-methyl-amino]-2-nitro-benzamide;
[0146] 60.
N-{5-[(3,5-difluoro-phenyl)-hydroxy-methyl]-1H-indazol-3-yl}-4--
(4-methyl-piperazin-1-yl)-2-(tetrahydro-pyran-4-ylamino)-benzamide;
[0147] 61.
N-{5-[(3,5-difluoro-phenyl)-hydroxy-methyl]-1H-indazol-3-yl}-2--
(2-methoxy-1-methoxymethyl-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzami-
de;
[0148] 62.
N-{5-[(3,5-difluoro-phenyl)-hydroxy-methyl]-1H-indazol-3-yl}-4--
(4-methyl-piperazin-1-yl)-benzamide;
[0149] 63.
N-{5-[(3,5-difluoro-phenyl)-hydroxy-methyl]-1H-indazol-3-yl}-2--
(2-methoxy-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0150] 64.
N-{5-[(3,5-difluoro-phenyl)-hydroxy-methyl]-1H-indazol-3-yl}-2--
(3-methoxy-propylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0151] 65.
N-{5-[(3,5-difluoro-phenyl)-hydroxy-methyl]-1H-indazol-3-yl}-2--
(2-methoxy-1,1-dimethyl-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0152] 66.
N-{5-[(3,5-difluoro-phenyl)-hydroxy-methyl]-1H-indazol-3-yl}-2--
(2-fluoro-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0153] 67.
N-{5-[(3-ethoxy-phenyl)-hydroxy-methyl]-1H-indazol-3-yl}-4-(4-m-
eth-piperazin-1-yl)-2-nitro-benzamide;
[0154] 68.
N-{5-[(3,5-difluoro-phenyl)-methoxy-methyl]-1H-indazol-3-yl}-4--
(4-methyl-piperazin-1-yl)-2-(tetrahydro-pyran-4-ylamino)-benzamide;
[0155] 69.
N-{5-[(3,5-difluoro-phenyl)-methoxy-methyl]-1H-indazol-3-yl}-2--
(2-methoxy-1-methoxymethyl-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzami-
de;
[0156] 70.
N-{5-[(3,5-difluoro-phenyl)-methoxy-methyl]-1H-indazol-3-yl}-4--
(4-methyl-piperazin-1-yl)-benzamide;
[0157] 71.
N-{5-[(3,5-difluoro-phenyl)-methoxy-methyl]-1H-indazol-3-yl}-2-- (2
-methoxy-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0158] 72.
N-{5-[(3,5-difluoro-phenyl)-methoxy-methyl]-1H-indazol-3-yl}-2--
(3-methoxy-propylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0159] 73.
N-{5-[(3,5-difluoro-phenyl)-methoxy-methyl]-1H-indazol-3-yl}-2--
(2-methoxy-1,1-dimethyl-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0160] 74.
N-{5-[(3,5-difluoro-phenyl)-methoxy-methyl]-1H-indazol-3-yl}-2--
(2-fluoro-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0161] 75.
N-{5-[1-(3,5-difluoro-phenyl)-ethyl]-1H-indazol-3-yl}-4-(4-meth-
yl-piperazin-1-yl)-2-(tetrahydro-pyran-4-ylamino)-benzamide;
[0162] 76.
N-{5-[1-(3,5-difluoro-phenyl)-ethyl]-1H-indazol-3-yl}-2-(2-meth-
oxy-1-methoxymethyl-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0163] 77.
N-{5-[(3,5-difluoro-phenyl)-ethyl]-1H-indazol-3-yl}-4-(4-methyl-
-piperazin-1yl)-benzamide;
[0164] 78.
N-{5-[(3,5-difluoro-phenyl)-ethyl]-1H-indazol-3-yl}-2-(2-methox-
y-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0165] 79.
N-{5-[(3,5-difluoro-phenyl)-ethyl]-1H-indazol-3-yl}-2-(3methoxy-
-propylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0166] 80.
N-{5-[(3,5-difluoro-phenyl)-ethyl]-1H-indazol-3-yl}-2-(2-methox-
y-1,1-dimethyl-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0167] 81.
N-{5-[(3,5-difluoro-phenyl)-ethyl]-1H-indazol-3-yl}-1-(2-(2-flu-
oro-ethylamino)-4-(4-methyl -piperazin-1-yl)-benzamide;
[0168] 82.
N-{5-[1-(3,5-difluoro-phenyl)-1-methyl-ethyl]-1H-indazol-3-yl}--
4-(4-methyl-piperazin-1-yl)-2-(tetrahydro-pyran-4-ylamino)-benzamide;
[0169] 83.
N-{5-[1-(3,5-difluoro-phenyl)-1-methyl-ethyl]-1H-indazol-3-yl}--
2-(2-methoxy-1-methoxymethyl-ethylamino)-4-(4-methyl-piperazin-1-yl)-benza-
mide;
[0170] 84.
N-{5-[1-(3,5-difluoro-phenyl)-1-methyl-ethyl]-1H-indazol-3-yl}--
4-(4-methyl-piperazin-1-yl)-benzamide;
[0171] 85.
N-{5-[1-(3,5-difluoro-phenyl)-1-methyl-ethyl]-1H-indazol-3-yl}--
2-(2-methoxy-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0172] 86.
N-{5-[1-(3,5-difluoro-phenyl)-1-methyl-ethyl]-1H-indazol-3-yl}--
2-(3-methoxy-propylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0173] 87.
N-{5-[1-(3,5-difluoro-phenyl)-1-methyl-ethyl]-1H-indazol-3-yl}--
2-(2-methoxy-1,1-dimethyl-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzamid-
e;
[0174] 88.
N-{5-[1-(3,5-difluoro-phenyl)-1-methyl-ethyl]-1H-indazol-3-yl}--
2-(2-fluoro-ethylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0175] 89.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(4-methyl-1,4-diaz-
epan-1-yl)-2-(tetrahydro-2H-pyran-4-ylamino)benzamide;
[0176] 90.
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-4-[(2-dimethylamino-
-ethyl)-methyl-amino]-2-(tetrahydro-pyran-4-ylamino)-benzamide;
[0177] 91.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-[4-(dimethylamino)-
piperidin1-yl]-2-(tetrahydro-2H-pyran-4-ylamino)benzamide;
[0178] 92.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-[(2S)-2-(pyrrolidi-
n-1-ylmethyl)pyrrolidin-1-yl]-2-(tetrahydro-2H-pyran-4-ylamino)benzamide;
[0179] 93.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-3-(4-methylpiperazin-
-1-yl)benzamide;
[0180] 94.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[(2S)-1-methylpyr-
rolidin-2-yl]methoxy}-2-(tetrahydro-2H-pyran-4-ylamino)benzamide;
[0181] 95.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-[(1-methylpiperidi-
n-4-yl)oxy]-2-(tetrahydro-2H-pyran-4-ylamino)benzamide;
[0182] 96.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-[2-(dimethylamino)-
ethoxy]-2-(tetrahydro-2H-pyran-4-ylamino)benzamide;
[0183] 97.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[(3S)-1-methylpyr-
rolidin-3-yl]oxy}-2-(tetrahydro-2H-pyran-4-ylamino)benzamide;
[0184] 98.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(piperazin-1-yl)-2-
-(tetrahydro-2H-pyran-4-ylamino)benzamide;
[0185] 99.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(4-methylpiperazin-
-1-yl)-2-{[trans-4-(trifluoromethyl)cyclohexyl]amino}benzamide;
[0186] 100.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4(4-methylpiperazin-1-yl)-2-{[-
trans-4-(trifluoromethyl)cyclohexyl]amino}benzamide;
[0187] 101.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-fluoro-4-(4-methylpiperazin--
1-yl)benzamide;
[0188] 102.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-1-(piperidin-4-yl)-1H-pyrazole-
-4-carboxamide;
[0189] 103.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-[(cis-4-hydroxycyclohexyl)am-
ino]-4-(4-methylpiperazin-1-yl)benzamide;
[0190] 104.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-[(trans-4-hydroxycyclohexyl)-
amino]-4-(4-methylpiperazin-1-yl)benzamide;
[0191] 105.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-[(2-hydroxyethyl)amino]-4-(4-
-methylpiperazin-1-yl)benzamide;
[0192] 106.
2-[(azetidin-3-ylmethyl)amino]-N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-
-4-(4-methylpiperazin-1-yl)benzamide;
[0193] 107.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-{[(1-methylazetidin-3-yl)met-
hyl]amino}-4-(4-methylpiperazin-1-yl)benzamide;
[0194] 108.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-[(1-methylpiperidin-4-yl)ami-
no]-2-[tetrahydro-2H-pyran-4-ylamino]benzamide;
[0195] 109.
4-[(azetidin-3-ylmethyl)amino]-N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-
-2-(tetrahydro-2H-pyran-4-ylamino)benzamide;
[0196] 110.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-[(1-methylpiperidin-4-yl)ami-
no]benzamide;
[0197] 111.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-[(1-methylpiperidin-4-yl)ami-
no]-4-(morpholin-4-yl)benzamide;
[0198] 112.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-methoxy-4-(4-methylpiperazin-
-1-yl)benzamide;
[0199] 113.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-5-(4-methylpiperazin-1-yl)-3-(-
tetrahydro-2H-pyran-4-ylamino)pyridine-2-carboxamide;
[0200] 114. N-[5-(3,5-difluorobenzyl)-1H-indazol
-3-yl]-6-(4-methylpiperazin-1-yl)-2-(tetrahydro-2H-pyran-4-ylamino)pyridi-
ne-3-carboxamide;
[0201] 115.
1-[4-{[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]carbamoyl}3-(tetrahydro-2H--
pyran-4-ylamino)benzyl]piperidine;
[0202] 116.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[(2-methoxyethyl)(methyl)am-
ino]methyl}-2-(tetrahydro-2H-pyran-4-ylamino)benzamide;
[0203] 117.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(pyrrolidin-1-ylmethyl)-2-(t-
etrahydro-2H-pyran-4-ylamino)benzamide;
[0204] 118.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(morpholin-4-ylmethyl)-2-(te-
trahydro-2H-pyran-4-ylamino)benzamide;
[0205] 119.
4-(azetidin-1-ylmethyl)-N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-(tet-
rahydro-2H-pyran-4-ylamino)benzamide;
[0206] 120.
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-2-fluoro-5-(4-methyl-piperazi-
n-1-ylmethyl)-benzamide;
[0207] 121.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-fluoro-5-{[(2S)-2-(pyrrolidi-
n-1-ylmethyl)pyrrolidin-1-yl]methyl}benzamide;
[0208] 122.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-fluoro-5-(morpholin-4-ylmeth-
yl)benzamide;
[0209] 123.
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-2-fluoro-5-((S)-2-pyrrolidin--
1-ylmethyl-pyrrolidine-1-carbonyl)-benzamide;
[0210] 124.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[(2R)-2-(pyrrolidin-1-ylmet-
hyl)pyrrolidin-1-yl]carbonyl}benzamide;
[0211] 125.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[(2S)-2-(pyrrolidin-1-ylmet-
hyl)pyrrolidin-1-yl]carbonyl}benzamide;
[0212] 126.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[4-(pyrrolidin-1-yl)piperid-
in-1-yl]carbonyl}benzamide;
[0213] 127.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[(2S)-2-(pyrrolidin-1-ylmet-
hyl)pyrrolidin-1-yl]carbonyl}-2-(tetrahydro-2H-pyran-4-ylamino)benzamide;
[0214] 128.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[(2R)-2-(pyrrolidin-1-ylmet-
hyl)pyrrolidin-1-yl]carbonyl}-2-(tetrahydro-2H-pyran-4-ylamino)benzamide;
[0215] 129. N.sup.1-[5-(3,5-difluorobenzyl)-1H-indazol
-3-yl]-N.sup.4-[2-(dimethylamino)ethyl]-N.sup.4-methyl-2-(tetrahydro-2H-p-
yran-4-ylamino)benzene-1,4-dicarboxamide;
[0216] 130.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[4-(propan-2-yl)piperazin-1-
]carbonyl}-2-(tetrahydro-2H-pyran-4-ylamino)benzamide;
[0217] 131.
N.sup.1-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-N.sup.4-[2-(dimethylamin-
o)ethyl]-2-(tetrahydro-2H-pyran-4-ylamino)benzene-1,4-dicarboxamide;
[0218] 132.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-[(4-methylpiperazin-1-yl)car-
bonyl]-2-(tetrahydro-2H-pyran-4-ylamino)benzamide;
[0219] 133. N-[5-(3,5-difluorobenzyl)-1H-indazol
-3-yl]-4-{[4-(dimethylamino)piperidin-1-yl]carbonyl}-2-(tetrahydro-2H-pyr-
an-4-ylamino)benzamide;
[0220] 134.
N.sup.1-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-N.sup.4-(1-methyl
piperidin-4-yl)-2-(tetrahydro-2H-pyran-4-ylamino)benzene-1,4-dicarboxamid-
e;
[0221] 135. N-[5-(2-methyl-5-fluoro-benzyl)-1H-indazol
-3-yl]-4-(4-methyl-piperazin-1-yl)-2(tetrahydro-pyran-4-ylamino)-benzamid-
e;
[0222] 136.
4-(4-methylpiperazin-1-yl)-N-[5-(pyridin-3-ylmethyl)-1H-indazol-3-yl]-2-(-
tetrahydro-2H-pyran-4-ylamino)benzamide;
[0223] 137.
N-[5-benzyl-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-yl)-2-(tetrahydro-py-
ran-4-ylamino)-benzamide;
[0224] 138. ethyl
4-{[2-{[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]carbamoyl}-5-(4-methylpipe-
razin-1-yl)phenyl]amino}piperidine-1-carboxylate;
[0225] 139.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4(4-methylpiperazin-1-yl)-2-(p-
iperidin-4-ylamino)benzamide;
[0226] 140. ethyl
5-(3,5-difluorobenzyl)-3-({[4-(4-methylpiperazin-1-yl)-2-(tetrahydro-2H-p-
yran-4-ylamino)phenyl]carbonyl}amino)-1H-indazole-1-carboxylate;
[0227] 141.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-2-((S)-2-methoxy-1-methyl-eth-
ylamino)-4-(4-methyl-piperazin-1-yl)-benzamide;
[0228] 142.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-[(2R)-2-(pyrrolidin-1-ylmeth-
yl)pyrrolidin-1-yl]-2-(tetrahydro-2H-pyran-4-ylamino)benzamide;
[0229] 143.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[(2R)-1-methylpyrrolidin-2--
yl]methoxy}-2-(tetrahydro-2H-pyran-4-ylamino)benzamide;
[0230] 144.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[(3R)-1-methylpyrrolidin-3--
yl]oxy}-2-(tetrahydro-2H-pyran-4-ylamino)benzamide;
[0231] 145.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-fluoro-5-{[(2R)-2-(pyrrolidi-
n-1-ylmethyl)pyrrolidin-1-yl]methyl}benzamide, and
[0232] 146.
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-2-fluoro-5-((R)-2-pyrrolidin--
1-ylmethyl-pyrrolidine-1-carbonyl)-benzamide.
[0233] Preferred specific compound of the invention is:
[0234]
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-
-0)-2-(tetrahydro-pyran-4-ylamino)-benzamide.
[0235] The present invention also provides a process for the
preparation of a compound of formula (I) as defined above,
characterized in that the process comprises:
[0236] i) reducing a carbonyl compound of formula (II):
##STR00010##
[0237] wherein Ar, R, R1, R2, and R3 are as defined above, to give
a compound of formula (I.sub.A), (I.sub.B) or (I.sub.C):
##STR00011##
[0238] wherein Ar; R, R1, R2, R3 and R' are as defined above;
or
[0239] i') reacting a compound of formula (III.sub.A), (III.sub.B),
(III.sub.C) or (III.sub.D):
##STR00012##
[0240] wherein R, R1 ; R2, R3, R' and R'' are as defined above,
with a compound of formula (IV):
##STR00013##
[0241] wherein Ar is as defined above and Y represents hydroxy, or
a suitable leaving group such as halogen; to give a compound of
formula (I), as defined above;
[0242] or
[0243] i'') deprotecting a compound of formula (XXII.sub.A),
(XXII.sub.C) or (XXII.sub.D):
##STR00014##
[0244] wherein Ar, R, R1, R2, R3, R' and R'' are as defined above
and PG is a suitable protecting group such as benzyl,
p-methoxybenzyl, o,p-dimethoxybenzyl, or triphenylmethyl, to give a
compound of formula (I.sub.A), (I.sub.C) or (I.sub.D):
##STR00015##
[0245] wherein Ar, R, R1, R2, R3, R' and R'' are as defined above,
optionally separating the resulting compound into the single
isomers, converting the compound of formula (I) into a different
compound of formula (I), and/or into a pharmaceutically acceptable
salt if desired.
[0246] The present invention further provides a process for the
preparation of a compound of formula (I.sub.A),(I.sub.B) or
(I.sub.C) as defined above, characterized in that the compound of
formula (II) as defined above, is prepared according to the
following steps:
[0247] a) reacting a compound of formula (XII):
##STR00016##
[0248] wherein R1, R2 and R3 are as defined above, with an
organometallic compound of formula RMgZ (XIII), namely a Grignard
reagent, wherein R is as defined above and Z is halogen, to give a
compound of formula (XI):
##STR00017##
[0249] wherein R, R1, R2 and R3 are as defined above;
[0250] b) oxydizing the resulting compound of formula (XI), to give
a compound of formula (X):
##STR00018##
[0251] wherein R, R1, R2 and R3 are as defined above;
[0252] c) reacting the resulting compound of formula (X) with
hydrazine hydrate, to give a compound of formula (IX):
##STR00019##
[0253] wherein R, R1, R2 and R3 are as defined above;
[0254] d) protecting the resulting compound of formula (IX), to
give a compound of is formula (VIII):
##STR00020##
[0255] wherein R, R1, R2 and R3 are as defined above, and PG.sub.1
is a suitable protecting group such as trifluoroacetyl group;
[0256] e) protecting the resulting compound of formula (VIII), to
give a compound of formula (VII):
##STR00021##
[0257] wherein R, R1, R2, R3, PG and PG.sub.1 are as defined
above;
[0258] f) removing the protecting group PG.sub.1 from the resulting
compound of formula (VII), to give a compound of formula (VI):
##STR00022##
[0259] wherein R, R1, R2, R3 and PG are as defined above;
[0260] g) reacting the resulting compound of formula (VI) with a
compound of formula (IV) as defined above, to give a compound of
formula (V):
##STR00023##
[0261] wherein Ar, R, R1, R2, R3 and PG are as defined above;
[0262] h) deprotecting the resulting compound of formula (V), to
give a compound of formula (II) as defined above.
[0263] The present invention further provides a process for the
preparation of a compound of formula (I.sub.A) as defined above,
characterized in that the compound of formula (III.sub.A) as
defined above, is prepared according to the following steps:
[0264] j) reducing a compound of formula (XI) as defined above, in
the presence of a suitable reagent like for example NaI and
Me.sub.3SiCl, to give a compound of formula (XIV):
##STR00024##
[0265] wherein R, R1, R2 and R3 are as defined above;
[0266] or
[0267] k) reacting a boronic acid compound of formula (XV):
##STR00025##
[0268] wherein R1, R2 and R3 are as defined above, with a compound
of formula (XVI):
##STR00026##
[0269] wherein R is as defined above and W represents a halogen
atom, such as bromine or iodine, or a suitable leaving group like
sulphonates such as methanesulphonate or
trifluoromethanesulphonate, or phosphates in the presence of a
suitable catalyst such as a Palladium catalyst, to give a compound
of formula (XIV) as defined above;
[0270] l) reacting the resulting compound of formula (XIV) with
hydrazine hydrate, to give a compound of formula (III.sub.A) as
defined above.
[0271] The present invention further provides a process for the
preparation of a compound of formula (I.sub.B) as defined above,
characterized in that the compound of formula (III.sub.B) as
defined above, is prepared according to the following steps:
[0272] l') reacting a compound of formula (XI) as defined above
with hydrazine hydrate, to give a compound of formula (III.sub.B)
as defined above.
[0273] The present invention further provides a process for the
preparation of a compound of formula (I.sub.C) as defined above,
characterized in that the compound of formula (III.sub.C) as
defined above, is prepared according to the following steps:
[0274] m) reacting a compound of formula (XI) as defined above with
an electrophilic alkylating agent of formula (XVIII):
R'-W' (XVIII)
[0275] wherein R' is as defined above and W' represents a halogen
atom such as chlorine, bromine or iodine or a suitable leaving
group like sulphonates, such as methanesulphonate or
trifluoromethanesulphonate, to give a compound of formula
(XVII):
##STR00027##
[0276] wherein R, R1, R2, R3 and R' are as defined above;
[0277] l') reacting the resulting compound of formula (XVIII) with
hydrazine hydrate, to give a compound of formula (III.sub.C) as
defined above.
[0278] The present invention further provides a process for the
preparation of a compound of formula (I.sub.D) as defined above,
characterized in that the compound of formula (III.sub.D1) wherein
R'' is hydrogen, having the formula:
##STR00028##
[0279] wherein R, R1, R2, R3 and R' are as defined above, is
prepared according to the following steps:
[0280] n) reacting a compound of formula (XIV) as defined above,
with a compound of formula (XVIII) as defined above;
[0281] l''') reacting the resulting of formula (XIX.sub.D1):
##STR00029##
[0282] wherein R, R1, R2, R3 and R' are as defined above, with
hydrazine hydrate, to give a compound of formula (III.sub.D1) as
defined above; or
[0283] o) reacting a compound of formula (XXI):
##STR00030##
[0284] wherein R1, R2, R3 and R' are as defined above, with a
compound of formula (XIII) as defined above, to give a compound of
formula (XX):
##STR00031##
[0285] wherein R, R1, R2, R3 and R' are as defined above;
[0286] p) reducing the resulting compound of formula (XX), to give
a compound of formula XIX.sub.D1 as defined before.
[0287] The present invention further provides a process for the
preparation of a compound of formula (I.sub.D) as defined above,
characterized in that the compound of formula (III.sub.D2) wherein
R'' is as defined above but not hydrogen, having the formula:
##STR00032##
[0288] wherein R, R1, R2, R3 and R' are as defined above, is
prepared according to the following steps:
[0289] q) reacting a compound of formula (XIX.sub.D1) as defined
above, with an electrophilic alkylating agent of formula
(XXIII):
R''-W' (XXIII)
[0290] wherein R'' and W' are as defined above, to give a compound
of formula (XIX.sub.D1):
##STR00033##
[0291] wherein R, R1R2, R3 and R' are as defined above and R'' is
as defined above but not hydrogen;
[0292] l.sup.iv) reacting the resulting compound of formula
(XIX.sub.D2) with hydrazine hydrate, to give a compound of formula
(III.sub.D2) as defined above.
[0293] The present invention further provides a process for the
preparation of a compound of formula (I.sub.A),(I.sub.C) or
(I.sub.D) as defined above, characterized in that a compound of
formula (XXII.sub.A), (XXII.sub.C) or (XXII.sub.D) as defined
above, is prepared according to the following steps:
[0294] r) protecting a compound of formula (III.sub.A), (III.sub.C)
or (III.sub.D) as defined above, to give a compound of formula
(XXIV.sub.A), (XXIV.sub.C) or (XXIV.sub.D):
##STR00034##
[0295] wherein R, R1, R2,R3, R, R'' and PG.sub.1 are as defined
above;
[0296] s) protecting the resulting compound of formula
(XXIV.sub.A), (XXIV.sub.C ) or (XXIV.sub.D), to give a compound of
formula (XXV.sub.A), (XXV.sub.C) or (XXV.sub.D):
##STR00035##
[0297] wherein R, R1, R2,R3, R, R'', PG and PG.sub.1 are as defined
above;
[0298] t) removing the protecting group PG.sub.1 from the resulting
compound of formula (XXV.sub.A), (XXV.sub.C) or (XXV.sub.D), to
give a compound of formula (XXVI.sub.A), (XXVI.sub.C) or
(XXVI.sub.D).
##STR00036##
[0299] wherein R, R1, R2, R3, R, R'' and PG are as defined
above;
[0300] u) reacting the resulting compound of formula (XXVI.sub.A),
(XXVI.sub.C) or (XXVI.sub.D) with a compound of formula (IV) as
defined above, to give a compound of formula (XXII.sub.A),
(XXII.sub.C) or (XXII.sub.D) as defined above.
[0301] It is to be noted that a compound of formula (V), as defined
above can be in any one of its isomeric forms a or b or a mixture
of both:
##STR00037##
[0302] Analogously, a compound of formula (XXII.sub.A),
(XXII.sub.C), (XXII.sub.D), (XXV.sub.A), (XXV.sub.C), (XXV.sub.D),
(XXVI.sub.A) , (XXVI.sub.C) and (XXVI.sub.D) as defined above, can
be in any one of theirs isomeric forms a or b.
[0303] A compound of formula (II), (V), (XXII.sub.A), (XXII.sub.C),
and (XXII.sub.D), may be converted into another compound of formula
(II), (V), (XXII.sub.A), (XXII.sub.C), and (XXII.sub.D), said
conversion is carried out by one or more of the following
reactions:
[0304] 1) reducing a compound of formula (II), (V), (XXII.sub.A),
(XXII.sub.C) and (XXII.sub.D) wherein Ar is a substituted aryl and
one of the substituents is NO.sub.2, for obtaining a compound of
formula (II), (V), (XXII.sub.A), (XXII.sub.C), and (XXII.sub.D)
wherein such substituent is NH.sub.2;
[0305] 2) acylating a compound of formula (V), (XXII.sub.A),
(XXII.sub.C), and (XXII.sub.D), wherein Ar is a substituted aryl
and one of the substituents is NH.sub.2, by reaction with an
acylating agent of formula (XXVII) or (XXVIII):
##STR00038##
[0306] wherein R4 and Y are as defined above, for obtaining a
compound of formula (II), (V), (XXII.sub.A), (XXII.sub.C), and
(XXII.sub.D) wherein such substituent is a NHCOR4 or NHSO.sub.2R4
residue, wherein R4 is as defined above;
[0307] 3) reacting a compound of formula (II), (V), (XXII.sub.A),
(XXII.sub.C), and (XXII.sub.D), wherein Ar is a substituted aryl
and one of the substituents is NH.sub.2, with a suitable aldehyde
or ketone in the presence of a reducing agent, for obtaining a
compound of formula (II), (V), (XXII.sub.A), (XXII.sub.C) and
(XXII.sub.D), wherein such substituent is a NR5R6 group, wherein
one of the R5 or R6 is hydrogen and the other is an optionally
further substituted straight or branched C.sub.1-C.sub.6 alkyl,
C.sub.3-C.sub.6 cycloalkyl, heterocyclyl, aryl,
R8R9N--C.sub.2-C.sub.6 alkyl, R8O--C.sub.2-C.sub.6 alkyl, wherein
R8 and R9 are as defined above.
[0308] A compound of formula (I) may be converted into another
compound of formula (I), said conversion is carried out by one or
more of the following reactions:
[0309] 4) reducing a compound of formula (I) wherein Ar is a
substituted aryl and one of the substituents is NO.sub.2, for
obtaining a compound of formula (I) wherein such substituent is
NH.sub.2;
[0310] 5) acylating a compound of formula (I), wherein Ar is a
substituted aryl and one of the substituents is NH.sub.2, by
reaction with a compound of formula (XXVII) or (XXVIII) as defined
above, followed by selective deprotection of the acyl group on the
pyrazole ring for obtaining a compound of formula (I) wherein such
substituent is a NHCOR4 or NHSO.sub.2R4 residue, wherein R4 is as
defined above;
[0311] 6) reacting a compound of formula (I), wherein Ar is a
substituted aryl and one of the substituents is NH.sub.2, with a
suitable aldehyde or ketone in the presence of a reducing agent,
for obtaining a compound of formula (I), wherein such substituent
is a NR5R6 group, wherein one of the R5 or R6 are defined as in
conversion 3).
[0312] The synthesis of a compound of formula (I), according to the
synthetic process described above, can be conducted in a stepwise
manner, whereby each intermediate is isolated and purified by
standard purification techniques, like, for example, column
chromatography, before carrying out the subsequent reaction.
Alternatively, two or more steps of the synthetic sequence can be
carried out in a so-called "one-pot" procedure, as known in the
art, whereby only the compound resulting from the two or more steps
is isolated and purified.
[0313] Schemes 1-4 below show the preparation of a compound of
formula (I) wherein X, Ar, R, R1, R2 and R3 have the above
meanings.
##STR00039##
##STR00040## ##STR00041##
##STR00042##
##STR00043## ##STR00044##
[0314] According to step i), a compound of formula (I.sub.A),
(I.sub.B) or (I.sub.C) can be obtained by reducing a compound of
formula (II) in a variety of ways and experimental conditions known
in the art. Preferably this reduction is conducted in the presence
of sodium borohydride, sodium cyanoborohydride, sodium
borohydride/trifluoracetic acid, zinc/hydrochloric acid, tin
chloride/acetic acid, in a suitable solvent, such as toluene,
dichloromethane, chloroform, diethyl ether, tetrahydrofuran,
1,4-dioxan, methanol, ethanol, isopropanol, acetic acid at a
temperature ranging from about -10.degree. C. to reflux and for a
period of time varying from about 1 hour to about 96 hours.
According to the experimental conditions, a compound of formula
(I.sub.A), (I.sub.B) or (I.sub.C) can be isolated as major
product.
[0315] According to step i') a compound of formula (I.sub.A),
(I.sub.B), (I.sub.C) or (I.sub.D) can be obtained by reacting a
compound of formula (III.sub.A), (III.sub.B), (III.sub.C) or
(III.sub.D) with a compound of formula (IV) in a variety of ways
and experimental conditions, which are widely known in the art for
condensation reactions. Preferably a compound of formula (IV)
wherein Y is hydroxy is converted into its corresponding acyl
chloride wherein Y is chlorine in the presence of thionyl chloride
or oxalyl chloride, in a suitable solvent, such as toluene,
dichloromethane, chloroform, diethyl ether, tetrahydrofuran,
1,4-dioxane, at a temperature ranging from about -10.degree. C. to
reflux and for a period of time varying from about 1 hour to about
96 hours. The acyl chloride is isolated by evaporation of the
solvent and further reacted with (III.sub.A), (III.sub.B),
(III.sub.C) or (III.sub.D) in the presence of a base such a
pyridine, triethylamine or N-ethyldiisopropylamine in a suitable
solvent, such as toluene, dichloromethane, chloroform, diethyl
ether, tetrahydrofuran, 1,4-dioxane, at a temperature ranging from
about -40.degree. C. to reflux and for a period of time varying
from about 1 hour to about 96 hours. Alternatively, a compound of
formula (IV) is reacted with a compound of formula (III.sub.A),
(III.sub.B), (III.sub.C) or (III.sub.D) in the presence of an
activating agent such as hydroxybenzotriazole, dicyclohexyl
carbodiimide, diisopropyl carbodiimide,
1-ethyl-3-(3'-dimethylamino)carbodiimide hydrochloric acid salt.
Preferably, this reaction is carried out in a suitable solvent such
as, for instance, tetrahydrofuran, dichloromethane, toluene,
1,4-dioxane, and in the presence of a proton scavenger such as, for
example, pyridine, triethylamine, N,N-diisopropylethylamine, at a
temperature ranging from room temperature to reflux, for a time
ranging from about 30 min. to about 96 hours.
[0316] According to step i'') a compound of formula (I.sub.A),
(I.sub.C) or (I.sub.D) can he obtained by deprotecting a compound
of formula (XXII.sub.A), (XXII.sub.C) or (XXII.sub.D) in a variety
of ways and experimental conditions, which are widely known in the
art. Preferably in the case of an acyl residue, this reaction is be
carried out under basic conditions, for instance in the presence of
sodium hydroxide, potassium hydroxide, lithium hydroxide or barium
hydroxide, or of a tertiary amine such as triethylamine or
diisopropylethylamine, or of hydrazine, and in a suitable solvent
such as methanol, ethanol, tetrahydrofuran, N,N-dimethylformamide,
water and mixtures thereof. Typically, the reaction is carried out
at a temperature ranging from room temperature to reflux and for a
time varying from about 30 minutes to about 96 hours. In the case
of PG represents a suitable protecting group such as benzyl,
p-methoxybenzyl, o,p-dimethoxybenzyl, or triphenylmethyl the
transformation can be carried out under conditions analogous to
that reported in step h).
[0317] According to step a), the transformation of a compound of
formula (XII) into a compound of formula (XI) can be accomplished
in a variety of ways and experimental conditions, according to
conventional methods, which are widely known in the literature by
using Grignard reagents of formula (XIII). Preferably the reaction
of a compound of formula (XII) with organometallic reagents is
carried out in a suitable solvent such as, for instance,
tetrahydrofuran, 1,4-dioxane, and diethylether at a temperature
ranging from -78.degree. C. to room temperature and for a time
varying from about 30 minutes to about 96 hours.
[0318] According to step b), the oxidation of a compound of formula
(XI) to a compound of formula (X) can be carried out in a variety
of ways, according to conventional methods for oxidizing alcohols
to ketones. Preferably this reaction is carried out in a suitable
solvent such as, for instance, methanol, ethanol, tert-butanol,
water, tetrahydrofuran, 1,4-dioxane, toluene, acetic acid,
trifluoroacetic acid, dichloromethane, dichloroethane,
acetonitrile, dimethylsulfoxide, or a mixture thereof, in the
presence of a suitable oxidizing agent, such as, for instance,
3-chloroperbenzoic acid, hydrogen peroxide, Dess-Martin
periodinane, oxone, potassium permanganate, sodium periodate,
periodic acid and catalytic chromium(VI) oxide, tetrapropylammonium
perrutenate, ruthenium chloride. Typically, the reaction is carried
out at a temperature ranging from -78.degree. C. to reflux and for
a time varying from about 30 minutes to about 96 hours.
[0319] According to step c), the transformation of a compound of
formula (X) into a compound of formula (IX) can be accomplished in
a variety of ways and experimental conditions, which are widely
known in the art for the preparation of 3-aminoindazoles.
Preferably the reaction of a compound of formula (X) with hydrazine
is carried out in a suitable solvent such as, for instance,
toluene, tetrahydrofuran, 1,4-dioxane, dimethyl sulfoxide,
acetonitrile, methanol, ethanol or n-butanol at a temperature
ranging from 0.degree. C. to reflux and for a period of time
varying from about 1 hour to about 96 hours. The addition of an
acid such as, preferably, hydrochloric acid or acetic acid, may be
required in order to catalyse the reaction.
[0320] According to step d), a compound of formula (IX) may be
transformed into a compound of formula (VIII) in a variety of ways
and experimental conditions which are widely known in the art for
protection of the primary amino group. Preferably the reaction is
carried out by treatment with an excess of trifluoroacetic
anhydride or trifluoroacetyl chloride in a suitable solvent such as
acetonitrile, tetrahydrofuran, toluene, dichloromethane. Typically,
the reaction is carried out at a temperature ranging from 0.degree.
C. to about 110.degree. C. and for a time varying from about 30
minutes to about 96 hours. Work-up of the reaction mixture with a
erotic solvent, such as, for instance, water, methanol, ethanol or
mixtures thereof, or with a water solution of sodium
hydrogenocarbonate leads to selective hydrolysis of the
trifluoroacetyl group on the indazole ring. In the case of the
preparation of phthalimido derivative, the reaction is carried out
by treatment with phthalic anhydride, under basic conditions, for
instance in the presence of 1,8-diazabicyclo[5.4.0]undec-7-ene,
N,N-dimethylaminopyridine, pyridine, triethylamine, and in a
suitable solvent such as acetonitrile, tetrahydrofuran,
N,N-dimethylformamide, toluene, dichloromethane, water and mixtures
thereof. Typically, the reaction is carried out at a temperature
ranging from room temperature to about 110.degree. C. and for a
time varying from about 30 minutes to about 96 hours.
[0321] According to step e), the reaction of a compound of formula
(VIII) to obtain a compound of formula (VII) may be carried out in
a variety of ways and experimental conditions. Preferably when PG
is a triphenylmethyl group the reaction is carried out by treatment
with trityl chloride in a suitable solvent such as, for instance,
tetrahydrofuran, dichloromethane, toluene, 1,4-dioxane, and in the
presence of a proton scavenger such as, preferably,
1,8-diazabicyclo[5.4.0]undec-7-ene, triethylamine,
N,N-diisopropylethylamine, pyridine, at a temperature ranging from
room temperature to reflux, for a time ranging from about 30 min.
to about 96 hours.
[0322] According to step f) a compound of formula (VII) can he
transformed into a compound of formula (VI) by removal of a
suitable protecting group such as the trifluoroacetyl group,
according to conventional methods. Preferably the reaction is
carried out by treatment with an organic or inorganic base such as
potassium carbonate, sodium hydroxide, ammonia, triethylamine,
N,N-diisopropylethylamine in a suitable solvent such as, for
instance, tetrahydrofuran, dichloromethane, toluene, 1,4-dioxane,
methanol, ethanol, water or mixtures thereof at a temperature
ranging from room temperature to reflux, for a time ranging from
about 30 min. to about 96 hours.
[0323] According to step g) a compound of formula (VI) can be
transformed into a compound of formula (V) in a variety of ways and
experimental conditions, which are widely known in the art for
condensation reactions. Preferably it is carried out in a way
analogous to that reported for step i').
[0324] According to step h), a compound of formula (V) can be
transformed into a compound of formula (II) by deprotection of the
endocyclic indazole nitrogen atom according to conventional methods
enabling the selective hydrolysis of benzyl, 4-methoxybenzyl,
2,4-dimethoxybenzyl and triphenylmethyl protecting groups.
Preferably this reaction is run under acidic conditions, preferably
in the presence of an inorganic or organic acid such as
hydrochloric, trifluoroacetic or methanesulfonic acid, in a
suitable solvent such as dichloromethane, 1,4-dioxane, a lower
alcohol, such as methanol or ethanol, at a temperature ranging from
room temperature to about 80.degree. C. and for a period of time
varying from about 1 hour to about 48 hours. In alternative, this
reactionis is carried out under reducting condition, such as, for
instance, in the presence of hydrogen and a hydrogenation catalyst
in a suitable solvent such as ethanol, methanol, ethyl acetate, or
a mixture thereof. The catalyst is usually a metal, most often a
palladium derivative such as, for instance, palladium hydroxide or
palladium black.
[0325] According to step j), the reduction of a compound of formula
(XI) to a compound of formula (XIV) can be carried out in a variety
of ways, according to conventional methods for reducing alcohols to
alkane. Preferably this reaction is carried out in a suitable
solvent such as, for instance, methanol, ethanol, tetrahydrofuran,
1,4-dioxane, acetic acid, dichloromethane, acetonitrile, or a
mixture thereof, in the presence of a suitable reducing system,
such as, for instance, trimethylsilyl chloride/sodium iodide,
dichlorodimethylsilane/sodium iodide,
triethylsilane/trifluoroacetic anhydride,
sodiumborohydride/trifluoroacetic acid. Typically, the reaction is
carried out at a temperature ranging from -10.degree. C. to reflux
and for a time varying from about 30 minutes to about 96 hours.
[0326] According to step k), the transformation of a compound of
formula (XV) into a compound of formula (XIV) in the presence of a
compound of formula (XVI), can be carried out in a variety of ways,
according to conventional methods for boron-derivatives coupling,
namely Suzuki-like reactions. Preferably, this reaction is carried
out in a suitable solvent such as, for instance, ethanol, water,
tetrahydrofuran, dioxane, acetone, N,N-dimethylformamide,
dimethoxyethane, toluene, xylene, or a mixture thereof, in the
presence of a suitable base, such as, for instance, triethylamine,
diisopropylethylamine, sodium, potassium or cesium carbonate,
potassium phosphate, sodium hydroxide or cesium fluoride, at a
temperature ranging from -20.degree. C. to reflux and for a time
varying from about 1 hour to about 96 hours. The catalyst is
usually a metal, most often a palladium derivative such as, for
instance, palladium chloride or palladium acetate in the presence
of a suitable ligand such as, for instance, triphenylphosphine.
[0327] According to step 1), the transformation of a compound of
formula (XIV) into a compound of formula (III.sub.A) can be carried
out in a variety of ways and experimental conditions. Preferably it
is carried out in a way analogous to that reported for step c).
According to step 1') the transformation of a compound of formula
(XI) into a compound of formula (III.sub.B) can be carried out in a
variety of ways and experimental conditions. Preferably it is
carried out in a way analogous to that reported for step c).
According to step m), the transformation of a compound of formula
(XI) into a compound of formula (XVII) in the presence of a
compound of formula (XVIII) can be carried out in a variety of
ways, according to conventional methods for O-alkylation reactions.
Preferably, this reaction is carried out in a suitable solvent such
as, for instance, tetrahydrofuran, dioxane, N,N-dimethylformamide,
dimethoxyethane, in the presence of a suitable base, such as, for
instance, triethylamine, diisopropylethylamine, sodium, potassium
or cesium carbonate, sodium hydride, at a temperature ranging from
-78.degree. C. to reflux and for a time varying from about 1 hour
to about 96 hours. Alkylating agent is usually a halogen or a
sulphonates derivative; most often the leaving group is iodo,
bromo, triflate or mesylate.
[0328] According to step l'') the transformation of a compound of
formula (XVII) into a compound of formula (III.sub.C) can be
carried out in a variety of ways and experimental conditions.
Preferably it is carried out in a way analogous to that reported
for step c).
[0329] According to step n), the transformation of a compound of
formula (XIV) into a compound of formula (XIX.sub.D1) in the
presence of a compound of formula (XVIII) can be carried out in a
variety of ways, according to conventional methods for C-alkylation
reactions. Preferably it is carried out in a way analogous to that
reported for step m).
[0330] According to step l''') the transformation of a compound of
formula (XIX.sub.D1) into a compound of formula (III.sub.D1) can be
carried out in a variety of ways and experimental conditions.
Preferably it is carried out in a way analogous to that reported
for step c).
[0331] According to step o), the transformation of a compound of
formula (XXI) into a compound of formula (XX) in the presence of a
compound of formula (XIII) can be carried out in a variety of ways
and experimental conditions. Preferably it is carried out in a way
analogous to that reported for step a).
[0332] According to step p), the transformation of a compound of
formula (XX) into a compound of formula (XIX.sub.D1 can be carried
out in a variety of ways and experimental conditions. Preferably it
is carried out in a way analogous to that reported for step j).
[0333] According to step q) the transformation of a compound of
formula (XIX.sub.D1) into a compound of formula (XIX.sub.D2) in the
presence of a compound of formula (XXIII) can be carried out in a
variety of ways and experimental conditions. Preferably it is
carried out in a way analogous to that reported for step m).
[0334] According to Step l.sup.IV), the transformation of a
compound of formula (XIX.sub.D2) into a compound of formula
(III.sub.D2) can be carried out in a variety of ways and
experimental conditions. Preferably it is carried out in a way
analogous to that reported for step c).
[0335] According to step r), a compound of formula. (III.sub.A),
(II.sub.C) or (III.sub.D) may be transformed into a compound of
formula (XXIV.sub.A), (XXIV.sub.C)or (XXIV.sub.D) in a variety of
ways and experimental conditions which are widely known in the art
for protection of the primary amino group. Preferably it is carried
out in a way analogous to that reported for step d). According to
step s), the reaction of a compound of formula (XXIV.sub.A),
(XXIV.sub.C) or (XXIV.sub.D) to obtain a compound of formula
(XXV.sub.A), (XXV.sub.C) or (XXV.sub.D) may be carried out in a
variety of ways and experimental conditions. Preferably it is
carried out in a way analogous to that reported for step e).
[0336] According to step t) a compound of formula (XXV.sub.A),
(XXV.sub.C) or (XXV.sub.D) can be transformed into a compound of
formula (XXVI.sub.A), (XXVI.sub.C) or (XXVI.sub.D) by removal of a
suitable protecting group such as the trifluoroacetyl group,
according to conventional methods. Preferably it is carried out in
a way analogous to that reported for step f).
[0337] According to step u) a compound of formula (XXVI.sub.A),
(XXVI.sub.C) or (XXVI.sub.D) can be transformed into a compound of
formula (XXII.sub.A), (XXII.sub.C) or (XXII.sub.D) in a variety of
ways and experimental conditions, which are widely known in the art
for condensation reactions. Preferably it is carried out in a way
analogous to that reported for step i').
[0338] According to the conversion described under 1) the reduction
of a compound of formula (II), (V), (XXII.sub.A), (XXII.sub.C) or
(XXII.sub.D), wherein Ar is a substituted aryl and one of the
substituents is nitro, to a compound of formula (II), (V),
(XXII.sub.A), (XXII.sub.C) or (XXII.sub.D), wherein such
substituent is amino, can be carried out in a variety of ways,
according to conventional methods well known in the literature.
Preferably this conversion is carried out in a suitable solvent
such as, for instance, methanol, ethanol, water, tetrahydrofuran,
1,4-dioxane, N,N-dimethylformamide, acetic acid, or a mixture
thereof, in the presence of a suitable reducing agent, such as, for
instance, hydrogen and a hydrogenation catalyst, or by treatment
with cyclohexene or cyclohexadiene, or formic acid or ammonium
formate and a hydrogenation catalyst, or a metal such as iron or
zinc in the presence of an inorganic acid, such as hydrochloric
acid, or by treatment with tin (II) chloride, at a temperature
ranging from 0.degree. C. to reflux and for a time varying from
about 1 hour to about 96 hours. The hydrogenation catalyst is
usually a metal, most often palladium, which can be used as such or
supported on carbon.
[0339] According to the conversion described under 2) the acylation
of a compound of formula (II), (V), (XXII.sub.A), (XXII.sub.C)or
(XXII.sub.D), wherein Ar is a substituted aryl and one of the
substituents is amino, by reaction with an acetylating agent of
formula (XXVII) or (XXVIII) to give a compound of formula (II),
(V), (XXII.sub.A), (XXII.sub.C) or (XXII.sub.D), wherein such
substituent is a NHCOR4 or NHSO.sub.2R4 residue, can be carried out
in a variety of ways, according to conventional methods well known
in the literature. Preferably this conversion is carried out under
conditions analogous to that reported for step i').
[0340] According to the conversion described under 3) the reductive
amination of a compound of formula (II), (V), (XXII.sub.A),
(XXII.sub.C)or (XXII.sub.D), wherein Ar is a substituted aryl and
one of the substituents is amino, by reaction with a suitable
aldehyde or ketone can be conducted in a variety of ways, according
to conventional methods for carrying out reductive alkylations.
Preferably, this reaction is carried out in a suitable solvent such
as, for instance, methanol, N,N-dimethylformamide, dichloromethane,
tetrahydrofuran, or a mixture thereof, in the presence of a
suitable reducing agent such as, for instance, sodium borohydride,
tetra-alkylammonium borohydride, sodium cyano borohydride, sodium
triacetoxyborohydride, tetramethylammonium triacetoxy borohydride
and in presence of an acid catalyst, such as, for instance, acetic
acid or trifluoroacetic acid, at a temperature ranging from about
0.degree. C. to reflux and for a time varying from about 1 hour to
about 96 hours.
[0341] According to the conversion described under 4) the reduction
of a compound of formula (I), wherein Ar is a substituted aryl and
one of the substituents is nitro, to a compound of formula (I)
wherein such substituent is amino, can be carried out in a variety
of ways, according to conventional methods well known in the
literature. Preferably this conversion is carried out under
conditions analogous to that reported for conversion 1).
[0342] According to the conversion described under 5) the acylation
of a compound of formula (I) wherein Ar is a substituted aryl and
one of the substituents is amino, by reaction with an acetylating
agent of formula (XXVII) or (XXVIII) to give a compound of formula
(I) wherein such substituent is a NHCOR4 or NHSO.sub.2R4 residue,
can be carried out in a variety of ways, according to conventional
methods well known in the literature. Preferably this conversion is
carried out under conditions analogous to that reported for
conversion 2).
[0343] According to the conversion described under 6) the reductive
ammination of a compound of formula (I) wherein Ar is a substituted
aryl and one of the substituents is amino, by reaction with a
suitable aldehyde or ketone can be conducted in a variety of ways,
according to conventional methods for carrying out reductive
alkylations. Preferably, this reaction is carried out under
conditions analogous to that reported for conversion 3).
[0344] It is known to the skilled person that when a compound of
formula (IV) or formula (XXVII) carries functional groups that may
interfere in acylation reactions, such groups have to be protected
before carrying out the reaction. In particular, when a compound of
formula (IV) or formula (XXVII) is substituted by residues of
general formula NR5R6, OR7, SR7, R8R9N--C.sub.1-C.sub.6 alkyl, or
R8O--C.sub.1-C.sub.6 alkyl wherein R7 or at least one of R5 and R6
or at least one of R8 and R9 represent hydrogen, such groups may be
protected as known in the art. It is also known to the skilled
person that such protecting group may be removed just after the
reaction or at a later stage in the synthetic process.
[0345] The deprotection of a compound of formula (I), (XXII.sub.A),
(XXII.sub.C or (XXII.sub.D) wherein Ar is a substituted aryl and
one of the substituents is a protected amino group can be made in a
variety of ways according to conventional methods for deprotecting
amino groups. Depending on the amino protecting group, this
reaction can be conducted in different ways. In one aspect, such
reaction can be carried out by treatment with an inorganic acid,
such as hydrochloric, sulphuric or perchloric acid, or an organic
acid, such as trifluoroacetic or methanesulfonic acid, in a
suitable solvent, such as water, methanol, ethanol, 1,4-dioxane,
tetrahydrofuran, diethyl ether, diisopropyl ether, acetonitrile,
N,N-dimethylformamide, dichloromethane or mixtures thereof, at a
temperature ranging from -10.degree. C. to 80.degree. C., and for a
period of time ranging from 30 minutes to 48 hours. In another
aspect, such reaction can be carried out by treatment with an
inorganic base, such as lithium or sodium or potassium hydroxide,
or sodium or potassium or caesium carbonate, or with an organic
base, such as triethylamine or N,N-diisopropylethylamine, or with
anhydrous hydrazine or hydrazine hydrate in a suitable solvent such
as water, methanol, ethanol, 1,4-dioxane, tetrahydrofuran, diethyl
ether, diisopropyl ether, acetonitrile, N,N-dimethylformamide,
dichlorometane or mixtures thereof, at a temperature ranging from
-10.degree. C. to 80.degree. C., and for a period of time ranging
from 30 minutes to 72 hours.
[0346] Substituted indazole derivatives can be prepared using
standard procedures in organic synthesis as reported, for instance,
in Smith, Michael--March's Advanced Organic Chemistry: reactions
mechanisms and structure--5.sup.th Edition, Michael B. Smith and.
Jerry March, John Wiley & Sons Inc., New York (N.Y.), 2001. It
is known to the skilled person that transformation of a chemical
function into another may require that one or more reactive centers
in the compound containing this function be protected in order to
avoid undesired side reactions. Protection of such reactive
centers, and subsequent deprotection at the end of the synthetic
transformations, can be accomplished following standard procedures
described, for instance, in: Green, Theodora W. and Wuts, Peter G.
M.--Protective Groups in Organic Synthesis, Third Edition, John
Wiley & Sons Inc., New York (N.Y.), 1999.
[0347] In cases where a compound of formula (I) contains one or
more asymmetric centers, said compound can be separated into the
single isomers by procedures known to those skilled in the art.
Such procedures comprise standard chromatographic techniques,
including chromatography using a chiral stationary phase, or
crystallization. General methods for separation of compounds
containing one or more asymmetric centers are reported, for
instance, in Jacques, Jean; Collet, Andr{acute over (3)}; Wilen,
Samuel H.,--Enantiomers, Racemates, and Resolutions, John Wiley
& Sons Inc., New York (N.Y.), 1981.
[0348] A compound of formula (I) can also be transformed into a
pharmaceutically acceptable salt according to standard procedures
that are known to those skilled in the art. Alternatively, a
compound of formula (I) that is obtained as a salt can be
transformed into the free base or the free acid according to
standard procedures that are known to the skilled person.
[0349] The starting materials of the process of the present
invention, i.e. compounds of formula (XII), (XIII), (XV), (XVI),
(XVIII),(XXIII), and (XXI) are either commercially available or can
be prepared by using well-known methods.
[0350] For example, the compounds of formula (XIII) can be easily
obtained according to conventional procedures, which are widely
known in the art for Grignard reagents formation, as reported in
the following scheme:
RZ+Mg.fwdarw.RMgZ (XIII)
[0351] For example, the compounds of formula (XV) can be easily
prepared from the corresponding halogen derivatives, as reported in
the following scheme (see for example WANG, X.-J. et al.; Org Lett
2006, 8 (2), 305-307):
##STR00045##
[0352] For example, the compounds of formula (XVI) can be easily
obtained by elaboration of the corresponding alcohols derivatives
by working according to conventional synthetic methods.
[0353] For example, the compounds of formula (XXI) can be easily
obtained by oxidation of the corresponding alcohols derivatives by
working according to conventional synthetic methods.
[0354] Another object of the present invention is to provide an
intermediate of formula (III.sub.A'), (III.sub.B'), (III.sub.C'),
or (III.sub.D'):
##STR00046##
[0355] wherein R is an optionally substituted C.sub.3-C.sub.6
cycloalkyl, aryl or heteroaryl, and
[0356] R1, R2, R3, R' and R'' are as defined above, with the
proviso that the following compounds are excluded:
[0357]
6-(3-amino-1H-indazol-5-ylmethyl)-3-isopropyl-1-(2,4,6-trichloro-ph-
enyl-1,7-dihydro-pyrazolo[3,4-d]pyrimidin-4-one and
[0358]
1-[(3-amino-1H-indazol-5-yl)methyl]-3-({1-[2-(dimethylamino)ethyl]--
1H-benzimidazol-2-yl}methyl)-1,3-dihydro-2H-benzimidazol-2-one.
[0359] Another object of the present invention is to provide an
intermediate of formula of the formula (XII.sub.A), (XXII.sub.C)or
(XXII.sub.D):
##STR00047##
[0360] wherein Ar, R, R1, R2, R3, R', R'' and PG are as defined
above.
[0361] Another object of the present invention is to provide a
compound of formula (XXVII):
##STR00048##
[0362] wherein Ar, R, R1, R2 and R3 are as defined above and
PG.sub.2 is ethoxycarbonyl or 2-methoxyethylcarbonyl.
[0363] The present invention further provides a process for the
preparation of a compound of formula (XXVII) as defined above,
characterized in that the process comprises:
[0364] v) protecting a compound of formula (I) as defined above, to
give a compound of formula (XXVII)
##STR00049##
[0365] wherein R, R1, R2, R3 and PG.sub.2 are as defined above.
[0366] According to step v), the protection of a compound of
formula (I) into a compound of formula (XXVII) can be accomplished
in a variety of ways and experimental conditions. Preferably the
reaction is carried out by treatment with a base such as lithium
diisopropylamide, sodium hydride or lithium, sodium or potassium
bis(trimethylsilyl)amide in a suitable solvent such as, for
instance, toluene, tetrahydrofurane, 1,4-dioxane, diethylether,
N,N-dimethylformamide, dimethoxyethane at a temperature ranging
from -78.degree. C. to room temperature and for a period of time
varying from about 10 minutes to about 96 hours. The electrophile
is usually a cloroformate derivative such as, for instance, ethyl
chloroformate or 2-methoxyethyl chloroformate.
Pharmacology
[0367] The short forms and abbreviations used herein have the
following meaning:
[0368] Ci Curie
[0369] DMSO dimethylsulfoxide
[0370] ID identity
[0371] KDa kiloDalton
[0372] microCi microCurie
[0373] mg milligram
[0374] microg microgram
[0375] mL milliliter
[0376] microL microliter
[0377] M molar
[0378] mM millimolar
[0379] microM micromolar
[0380] nM nanomolar
Assays
[0381] Compounds of the present invention were tested in
biochemical assays, as described below.
[0382] Preparation of ALK Cytoplasmic, Domain for Use in
Biochemical Assay Cloning and Expression
[0383] ALK cytoplasmic domain, corresponding to the residue
1060-4620 (the numbers of the amino acid residues refer to the
Genbank accession number NP 004295.2) was PCR amplified from a
human testis cDNA library.
[0384] Amplification was performed using the forward
oligonucleotide:
TABLE-US-00001 (SEQ ID NO: 1)
5'GGGGACAAGTTTGTACAAAAAAGCAGGCTTACTGGAAGTTCTGTTCCA
GGGGCCCCGCCGGAAGCACCAGGAGCTG-3'
and the reverse oligonucleotide:
TABLE-US-00002 (SEQ ID NO: 2)
5'GGGGACCACTTTGTACAAGAAAGCTGGGTTTCAGGGCCCAGGCTGGTT
CATGCTATT-3'.
[0385] For cloning purposes, the oligonucleotides included attB
sites in order to obtain an attB-flanked PCR product suitable for
cloning using the Gateway technology (Invitrogen). Furthermore, for
purification purposes, forward primer included a PreScission
cleavage site (Amersham Biosciences). The resulting PCR product was
cloned in the baculovirus expression vector pVL1393 (Invitrogen)
Gateway-modified. For expression and purification purpose, a GST
tag was added N-terminal to the ALK cytoplasmic domain. Cloning was
performed according to the protocols described in the Gateway
manual (Invitrogen).
[0386] Baculovirus was generated by cotransfecting Sf9 insect cells
with expression vector and the viral DNA using the BaculoGold.TM.
tranfection kit (Pharmingen). Viral supernatant was recovered after
5 days and subjected to 3 rounds of amplification to increase viral
titer.
[0387] Recombinant protein was produced by infecting Sf21 insect
cells at the density of 1.times.10.sup.6 cells/mL with 30 mL viral
supernatant per billion cells with shaking at 27.degree. C. After
48 hours of infections the cells were recovered, pelletted and
freezed at -80.degree. C.
Protein Purification
[0388] Cells were resuspended in lysis buffer (Tris-HCl50 mM pH8,
NaCl 150 mM, CHAPS 0.2%, DTT 20 mM, glycerol 20%, "Complete"
protease inhibitor cocktail (Roche Diagnostics), Na.sub.3VO.sub.4 1
mM and lysed by liquid extrusion with a Gaulin homogenizer (Niro
Soavi Italy). The lysate was cleared by centrifugation at 20000 g
for 30 minutes and loaded on a Glutathione Sepharose 4B (Amersham
Biosciences) column.
[0389] After extensive wash, recombinant protein was eluted with 10
mM Glutathione in 100 mM Tris-HCl p118, 10% glycerol.
[0390] Affinity purified GST-ALK was loaded on a Heparin
Sepharose.TM. FF (Amersham Biosciences) column and eluted with 50
mM NaCl, 25 mM TRIS pH 7.5, 2 mM DTT, 20% glycerol.
[0391] The eluted fractions were pooled and dialyzed against 150 mM
NaCl, 50 mM Tris-HCl pH 7.4, 2 mM DTT, 20% glycerol.
[0392] Purified protein was stored at -80.degree. C. prior its use
in biochemical assay.
Biochemical Assay for Inhibitors of ALK Kinase Activity
[0393] ALK enzyme needs pre-activation in order to linearize
reaction kinetics.
[0394] i. Kinase Buffer (KB) for ALK
[0395] Kinase buffer was composed of 50 mM HEPES pH 7.5 containing
1 mM MnCl.sub.2, 5 mM MgCl.sub.2, 1 mM DTT, 3 microM
Na.sub.3VO.sub.4, and 0.2 mg/mL BSA. 3.times. KB is buffer of the
same composition and pH as KB, but with three times the
concentration of each component.
[0396] ii. Assay Conditions
[0397] The kinase assay was run with a final enzyme concentration
of 20 nM, in the presence of 8 microM ATP, 1 nM
.sup.33P-.gamma.-ATP and 2 microM MBP. The MPB was purchased from
Sigma-Aldrich, St. Louis, Mo., USA.
Cell-Based Assays for Inhibitors of ALK Kinase Activity
Western Blot Analysis of ALK and STAT3 Phosphorylation in
Karpas-299. SR-786 and SUP-M2 Anaplastic Large Cell Lymphoma Cell
Lines
[0398] Karpas-299, SR-786 and SUP-M2 cells (DSMZ, Braunschwiegh,
Germany) were seeded in 6-well tissue culture plates at
5.times.10.sup.5 cells/MI- in RPMI-1640 medium+2 mM glutamine+10%
to 15% FCS (EuroClone, Italy), and incubated overnight at
37.degree. C., 5% CO.sub.2, 100% relative humidity. After this
incubation, cells were treated with desired concentrations of
compound for 2 hours at 37.degree. C. Cells were collected by
centrifugation at 248.times.g for 5 minutes, washed with cold PBS,
centrifuged again at 248.times.g for 5 minutes and then lysed in
100 mM Tris-HCl pH 7.4, 2% SDS, 1 mM Na.sub.3VO.sub.4, protease
inhibitor cocktail [Sigma-Aldrich product #P8340], phosphatase
inhibitor cocktail [Sigma-Aldrich products #P2850+#P5726]). After
brief sonication, cell lysates were cleared by centrifugation at
10,000.times.g for 20 minutes at room temperature and 20
microg/lane of cleared lysate protein were run on NuPAGE gels
(NuPAGE 4-12% 10-lane Bis-Tris gels, Invitrogen) with MOPS running
buffer, then transferred onto Hybond-ECL nitrocellulose filters
(Amersham Biosciences, Little Chalfont, Buckinghamshire, UK) using
Mini PROTEAN II chambers (Bio-Rad Laboratories, Hercules, Calif.,
USA). Filters bearing transferred protein were incubated for 1 hour
in blocking buffer (TBS+5% Non-fat Dry Milk [#1706404 Bio-rad,
Hercules, Calif., USA]+0.1% Tween 20), and probed over-night in
TBS+5% BSA+0.1% Tween 20 at 4.degree. C. containing 1/500
anti-phosho-ALK Tyr 1604 antibody (product #3341 Cell Signaling
Technology, Beverly, Mass, USA) for detection of phosphorylated ALK
or 1/500 mouse anti-ALK antibody (product #35-4300, Zymed
Laboratories, South San Francisco, Calif., USA) for the detection
of total ALK or 1/500 mouse anti-phospho STAT3 Tyr 705 antibody
(product #612357, BD Transduction Laboratories, Canada) for
detection of phosphorylated STAT3 or 1/1000 mouse anti-STAT3
antibody (product #610190 BD Transduction Laboratories, Canada) for
detection of total STAT3.
[0399] In all cases, filters were then washed for 20 minutes with
several changes of TBS+0.1% Tween 20, and incubated for 1 hour in
TBS+5% Non-fat Dry Milk+0.1% Tween 20 containing 1/10000 dilution
of horseradish peroxidase conjugated anti-rabbit or mouse IgG
(Amersham, product #NA934), then were washed again and developed
using the ECL chemiluminescence system (Amersham) according to
manufacturer's recommendations. Unless otherwise stated, reagents
used were from Sigma-Aldrich, St. Louis, Mo., USA.
In Vitro Cell Proliferation Assay for Inhibitors of ALK Kinase
Activity
[0400] The human ALCL cell lines Karpas-299, SR-786 and SUP-M2 were
seeded in 96 well plate (PerkinElmer, Wellesley, Mass., USA)
1.times.10.sup.5 cells/mL in RPMI-1640 medium+2 mM glutamine+10% to
15% FCS (EuroClone, Italy), (100 microL/well) and maintained at
37.degree. C., 5% CO.sub.2 , 100% relative humidity. The following
day, plates were treated in duplicates with an appropriate dilution
of compounds starting from a 10 mM stock solution in DMSO (final
DMSO concentration: 0.1%). Eight untreated control wells were
included in each plate. After 72 hours of treatment, 50 microL, of
CellTiter-Glo Assay (Promega, Madison, Wis., USA) were added to
each well and after agitation the luminescence signal is measured
using Envision Detector (PerkinElmer Wellesley, Mass., USA).
[0401] IC.sub.50 values were calculated by LSW/Data Analysis using
Microsoft Excel sigmoidal curve fitting.
Preparation of IGF-1R for Use in Biochemical Assay
Cloning and Expression
[0402] Human cDNA was used as template for amplification by
polymerase chain reaction (PCR) of the predicted cytoplasmic
portion of IGF-1R (amino acid residues 960-1367 of precursor
protein; see NCBI Entrez Protein Accession #P08069) which includes
the entire kinase domain. PCR was conducted using the forward
primer sequence 5'-CTCGGATCCAGAAAGAGAAATAACAGCAGGCTG-3' (SEQ ID
NO:3) and the reverse primer sequence
5'-CTCGGATCCTCAGCAGGTCGAAGACTGGGGCAGCGG-3' (SEQ ID NO:4). In order
to facilitate subsequent cloning steps, both primers comprise a
BamHI restriction endonuclease site sequence. This PCR product was
cloned in frame using BamHI sticky ends into a transfer vector for
the baculovirus expression system, pVL1392 (Pharmingen), previously
modified by insertion into the pVL1392 multiple cloning site of
sequences encoding Glutathione S-transferase (GST) fusion protein,
PreScission protease cleavage site and partial MCS cassette derived
from the pGex-6P plasmid (Amersham BioSciences). Insertion of the
IGF-1R PCR product described above into the pGex-6P derived BamHI
site of the modified pVL1392 vector results in an open reading
frame corresponding to the pGEX-6P GST protein and PreScission
peptide fused with the human IGF-1R cytoplasmic domain. In order to
obtain fusion protein, Sf21 insect cells (Invitrogen) are
cotransfected with 2 microg of purified plasmid and 1 microg of
virus DNA (BaculoGold.TM. Transfection Kit, Pharmingen), as
described in the Baculovirus Instruction manual (Pharmingen). A
first amplification of the virus is performed using 600 microL of
cotransfected virus on 6.times.10.sup.6 Sf21 in a monolayer
culture, in 12 mL of medium (TNM-FH Grace's medium Pharmingen).
After 3 days the medium is collected, centrifuged and transferred
to a sterile tube. A second amplification is prepared with the same
method using 2 mL on 3.times.10.sup.7 cells, diluted in 40 mL of
medium. For the third amplification of virus, 1 mL of supernatant
from the second round are used per 3.times.10.sup.7 cells diluted
in 40 mL of medium.
[0403] Protein expression is performed in H5 insect cells infected
with 14 mL virus/1.times.10.sup.9 insect cells (MOI=1.5) for 65 h
with shaking at 27.degree. C. Cells are harvested by centrifugation
at 1200.times.g for 10 minutes.
Protein Purification
[0404] Cells were resuspended in phosphate buffered saline solution
(PBS), 20 mM dithiothreitol (DTT), 0.2% CHAPS, 20% glycerol, 1 mM
OVA, "Complete" protease inhibitor cocktail (1 tablet/50 mL buffer;
Roche Diagnostics, Milan, Italy) and lysed by liquid extrusion with
a Gaulin homogenizer (Niro Soavi, Italy). The lysate was
centrifuged at 14000.times.g for 45 minutes and the supernatant was
loaded onto a column containing 10 mL Glutathione Sepharose
(Amersham Biosciences). The column was first washed with PBS buffer
for 5 column volumes, then with 100 mM Tris pH 8.0, 20% glycerol
for 5 column volumes, and lastly eluted with 10 mM glutathione in
100 mM Iris pH 8.0, 20% glycerol. Fractions of 10 mL were
collected, and protein-rich fractions were pooled. Typically, 20 mg
of fusion protein were recovered from 1.times.10.sup.9 cells, and
this was typically >85% pure as judged by SDS-PAGE followed by
Coomassie staining. Purified protein was stored at -80.degree. C.
prior to its use in biochemical assays.
Biochemical Assay for Inhibitors of IGF-1 R Kinase Activity
[0405] The inhibitory activity of putative kinase inhibitors and
the potency of selected compounds were determined using a
trans-phosphorylation assay.
[0406] A specific substrate was incubated with the kinase in
appropriate buffer conditions in the presence of ATP traced with
.sup.33P-.gamma.-ATP (gamma phosphate-labeled, Redivue.TM. Code
Number AH9968, 1000-3000Ci/mmole, Amersham Biosciences Piscataway,
N.J., USA), optimal cofactors and test compound.
[0407] At the end of the phosphorylation reaction, more than 98%
cold and radioactive ATP were captured by an excess of Dowex ion
exchange resin. The resin was allowed to settle to the bottom of
reaction wells by gravity. Supernatant, containing substrate
peptide, was subsequently withdrawn and transferred into a counting
plate, and radioactivity (corresponding to phosphate incorporated
into peptide) was evaluated by .beta.-counting.
Reagents/Assay Conditions
[0408] i. Dowex Resin Preparation
[0409] 500 g of wet resin (SIGMA, custom prepared DOWEX resin
1.times.8 200-400 mesh, 2.5 Kg) were weighed out and diluted to 2 L
in 150 mM sodium formate, pH 3.00.
[0410] The resin was allowed to settle for several hours and then
the supernatant was discarded. This washing procedure was repeated
three times over two days. Finally, the resin was allowed to
settle, supernatant was discarded and two volumes (with respect to
the resin volume) of 150 mM sodium formate buffer were added. The
final pH was circa 3.0. The washed resin was kept at 4.degree. C.
before use, and was stable for more than one week.
[0411] Kinase Buffer (KB)
[0412] Kinase buffer was composed of 50 mM HEPES pH 7.9 containing
3 mM MnCl.sub.2, 1 mM DTT, 3 microM Na.sub.3VO.sub.4, and 0.2 mg/mL
BSA. 3.times. KB is buffer of the same composition and pH as KB,
but with three times the concentration of each component.
[0413] iii. Enzyme Pre-Activation and Preparation of 3.times.
Enzyme Mix.
[0414] Prior to starting the kinase inhibition assay, IGF-1R was
pre-phosphorylated in order to linearize reaction kinetics. To
achieve this, the desired total quantity of enzyme was prepared at
an enzyme concentration of 360 nM in KB containing 100 microM ATP,
and this preparation was incubated for 30 min at 28.degree. C.
3.times. Enzyme Mix was obtained by diluting this preactivated
enzyme 20-fold in 3.times. KB.
[0415] iv. Assay Conditions
[0416] The kinase assay was run with a final enzyme concentration
of 6 nM, in the presence of 6 microM ATP, 1 nM .sup.33P-.gamma.-ATP
and 10 microM substrate, a carboxy-terminally biotinylated peptide
of the following sequence: KKKSPGEYVNIEFGGGGGK-biotin (SEQ ID
No:5). The peptide was obtained in batches of >95% peptide
purity from American Peptide Company, Inc. (Sunnyvale, Calif.,
USA).
Robotized Dowex Assay
[0417] Test reactions were performed in a total final volume of 21
microL consisting of:
[0418] a) 7 microL/well of 3.times. Enzyme Mix (18 nM preactivated
enzyme in 3.times. kinase buffer),
[0419] b) 7 microL/well of 3.times. substrate/ATP mix (30 microM
substrate, 18 microM ATP, 3 nM .sup.33P-.gamma.-ATP in
double-distilled water (ddH.sub.2O),
[0420] c) 7 microL/well 3.times. test compounds diluted into
ddH.sub.2O-3% DMSO.
Compound Dilution and Assay Scheme is Reported Below.
[0421] i. Dilution of Compounds
[0422] 10 mM stock solutions of test compounds in 100% DMSO were
distributed into 96 well 12.times.8 format microliter plates.
[0423] For % inhibition studies, dilution plates at 1 mM, 100
microM and 10 microM were prepared in 100% DMSO, then diluted to
3.times. final desired concentration (30, 3 and 0.3 microM) in
ddH.sub.2O, 3% DMSO. A Multimek 96 (Beckman Coulter, Inc. 4300 N.
Harbor Boulevard, P.O. Box 3100 Fullerton, Calif. 92834-3100 USA)
was used for compound pipetting into test plates.
[0424] For IC50 determination, starting solutions of 30 microM
compound in 3% DMSO were derived from 1 mM/100% DMSO stock
solutions. These 30 microM starting solutions were used for
generation of a further 9 serial 1/3 dilutions in ddH.sub.2O, 3%
DMSO, so as to generate a 10-point dilution curve at 3.times. the
final assay concentration. Serial dilution was conducted in 96-well
plates using a Biomek 2000 (Beckman Coulter) system. Dilution
curves of 7 compounds/plate were prepared, and each plate also
included a 10-point dilution curve of Staurosporine, as well as
several negative and positive control wells.
[0425] ii. Assay Scheme
[0426] microL of each test compound dilution (or control) in
ddH.sub.2O, 3% DMSO were pipetted into each well of a 384-well,
V-bottom assay plate, which was then transferred to a PlateTrak 12
robotized station (Perkin Elmer, 45 William Street Wellesley, Mass.
02481-4078, USA) equipped with one 384-tip pipetting head for
starting the assay, plus one 96-tip head for dispensing the resin)
prepared with reservoirs containing sufficient 3.times. Enzyme mix
and 3.times. ATP mix (3.times.) to complete the assay run.
[0427] At the start of the assay the liquid handling system
aspirates 7 microL of ATP mix, introduces an air gap inside the
tips (5 microL) and then aspirates 7 microL of 3.times. Enzyme Mix.
To start the reaction, tips contents were dispensed into the test
wells already containing 7 microL test compound (at 3.times.
desired final concentration), followed by 3 cycles of mixing, so as
to restore desired final concentration for all reaction
components.
[0428] Plates were incubated for 60 minutes at room temperature,
and then the reaction was stopped by pipetting 70 microL of Dowex
resin suspension into the reaction mix, followed by three cycles of
mixing. After stopping the reaction, plates were allowed to rest
for one hour in order to maximize ATP capture. At this point, 20
microL of supernatant were transferred from each well into wells of
384-Optiplates (Perkin Elmer) containing 70 microL/well of
Microscint 40 (Perkin Elmer); after 5 min of orbital shaking the
plates were read on a Perkin-Elmer Top Count radioactivity
counter.
[0429] iii. Data Analysis
[0430] Data were analysed using a customized version of the "Assay
Explorer" software package (Elsevier MDL, San Leandro, Calif.
94577). For single compound concentrations, inhibitory activity was
typically expressed as % inhibition obtained in presence of
compound, compared to total activity of enzyme obtained when
inhibitor is omitted.
[0431] Compounds showing desired inhibition were further analysed
in order to study the potency of the inhibitor through IC.sub.50
calculation. In this case, inhibition data obtained using serial
dilutions of the inhibitor were fitted by non-linear regression
using the following equation:
v = v 0 + ( v 0 - v b ) 1 + 10 n ( lo gIC 50 - lo g [ I ] )
##EQU00001##
[0432] where v.sub.b is the baseline velocity, v is the observed
reaction velocity, v.sub.o is the velocity in the absence of
inhibitors, and [I] is the inhibitor concentration.
[0433] Cell-based assays f.COPYRGT.r inhibitors of IGF-1R kinase
activity
Western Blot Analysis of Receptor Phosphorylation Following
Stimulation with IGF-1 in MCF-7 Human Breast Cancer Cells
[0434] MCF-7 cells (ATCC#HTB-22) were seeded in 12-well tissue
culture plates at 2.times.10.sup.5 cells/well in E-MEM medium
(MEM+Earle's BSS+2 mM glutamine+0.1 mM non-essential amino
acids)+10% FCS, and incubated overnight at 37.degree. C., 5% CO2,
100% relative humidity. Cells were then starved by replacing
E-MEM+10% FCS with E-MEM+0.1% BSA, and incubating overnight. After
this incubation, wells were treated with desired concentrations of
compound for 1 hour at 37.degree. C., and were then stimulated with
10 nM recombinant human IGF-1 (Invitrogen, Carlsbad, Calif., USA)
for 10 minutes at 37.degree. C. Cells were then washed with PBS and
lysed in 100 microL/well cell lysis buffer (M-PER Mammalian Protein
Extraction Reagent [Product #78501, Pierce, Rockford, Ill., USA]+10
mM EDTA+Protease inhibitor cocktail [Sigma-Aldrich product
#P83401]+phosphatase inhibitor cocktail [Sigma-Aldrich products
#P2850+#P5726]). Cell lysates were cleared by centrifugation at
10,000.times.g for 5 minutes, and 10 microg/lane of cleared lysate
protein were run on NuPAGE gels (NuPAGE 4-12% 10-lane Bis-Tris
gels, Invitrogen) with MOPS running buffer, then transferred onto
Hybond-ECL nitrocellulose filters (Amersham Biosciences, Little
Chalfont, Buckinghamshire, UK) using Mini PROTEAN II chambers
(Bio-Rad Laboratories, Hercules, Calif., USA). Filters bearing
transferred protein were incubated for 1 hour in blocking buffer
(TBS+5% BSA+0.15% Tween 20), and probed for 2 hours in the same
buffer containing 1/1000 rabbit anti-phospho IGF-1R Tyr1131/InsR
Tyr 1146 antibody (product #3021, Cell Signaling Technology,
Beverly, Mass., USA) for the detection of phosphorylated IGF-1R, or
1/1000 dilution of rabbit IGF-Ir.beta.(H-60) antibody (product
#sc-9038, Santa Cruz Biotechnology, Inc., Santa Cruz, Calif., USA)
for detecting total IGF-1R .beta. chain. In either case, filters
were then washed for 30 minutes with several changes of TBS +0.15%
Tween 20, and incubated for 1 hour in washing buffer containing
1/5000 dilution of horseradish peroxidase conjugated anti-rabbit
IgG (Amersham, product #NA934), then were washed again and
developed using the ECL chemiluminescence system (Amersham)
according to manufacturer's recommendations. Unless otherwise
stated, reagents used were from Sigma-Aldrich, St. Louis, Mo.,
USA.
[0435] Growth Factor Induced S6 Ribosomal Protein Phosphorylation
in Primary Human Fibroblasts
[0436] Phosphorylation of S6 ribosomal protein in response to
growth factor stimulation of normal human dermal fibroblasts (NHDF)
was used to assess compound potency in inhibiting IGF-1 induced
signal transduction in cells, and selectivity towards EGF and PDGF
stimulus. NHDF cells obtained from PromoCell (Heidelberg, Germany),
were maintained at 37.degree. C. in a humidified atmosphere with 5%
CO.sub.2 in complete Fibroblast Growth Medium (PromoCell). For
assay, NHDF were seeded in 384-well tissue culture plates (clear-
and flat-bottomed black plates; Matrix Technologies Inc., Hudson,
N.H., USA) at a density of 5000 cells/well in serum-free medium
containing 0.1% bovine serum albumin (BSA) and incubated for 5
days. Starved cells were treated for 1 hour with desired doses of
compounds and then stimulated for a further 2 hours with either 10
nM IGF-1 (Invitrogen Corp., CA, USA), 10 nM EGF (Gibco BRL, USA) or
1 nM PDGF-B/B (Roche Diagnostics GmbH, Germany). Cells were then
fixed in PBS/3.7% paraformaldehyde for 20 minutes at room
temperature, washed .times.2 with PBS, and permeabilized with
PBS/0.3% Triton X-100 for 15 minutes. Wells were then saturated
with PBS/1% non-fat dry milk (Bio-Rad Laboratories, Hercules,
Calif., USA) for 1 hour, and then probed for 1 hour at 37.degree.
C. with anti-phospho-S6 (Ser 235/236) antibody (Cell Signaling
Technology, Beverly, Mass., USA, cat. #2211) at 1/200 dilution in
PBS/1% milk/0.3% Tween 20. Wells were then washed twice with PBS,
and incubated for 1 hour at 37.degree. C. with PBS/1% milk/0.3(4)
Tween 20+1 microgrmL DAPI (4,6-diamidino-2-phenylindole)+1/500 Goat
anti-rabbit Cy5.TM.-conjugated secondary antibody (Amersham
Biosciences, Little Chalfont, Buckinghamshire, UK). Wells were then
washed .times.2 with PBS, and 40 microL PBS are left in each well
for immunofluorescence analysis. Fluorescence images in the DAPI
and Cy5.TM. channels were automatically acquired, stored and
analysed using a Cellomics ArrayScan.TM. IV instrument (Cellomics,
Pittsburgh, USA); the Cellomics Cytotoxicity Algorithm was used to
quantify cytoplasmic fluorescence associated with phospho-S6
(Cy5.TM. signal parameter: "Mean Lyso Mass-pH") for each cell in 10
fields/well, and eventually expressed as a mean population value.
Unless otherwise stated, reagents were obtained from Sigma-Aldrich,
St. Louis, Mo., USA.
[0437] Biochemical Assay for Inhibitors of Aurora-2 Kinase
Activity
[0438] The in vitro kinase inhibition assay was conducted in the
same way as described for IGF-1R. At variance with IGF-1R, Aurora-2
enzyme does not need pre-activation.
[0439] i. Kinase Buffer (KB) for Aurora-2
[0440] The kinase buffer was composed of 50 mM HEPES, pH 7.0, 10 mM
MnCl.sub.2, 1 mM DTT, 3 microM Na.sub.3VO.sub.4, and 0.2 mg/mL
BSA.
[0441] ii. Assay Conditions for Aurora-2 (Final Concentrations)
[0442] The kinase assay was run with an enzyme concentration of 2.5
nM, 10 microM ATP, 1 nM .sup.33P-.gamma.-ATP, and 8 microM
substrate, composed of 4 LRRWSLG repeats.
Cell-Based Assays for Inhibitors of Aurora-2 Kinase Activity
In Vitro Cell Proliferation Assay for Inhibitors of Aurora-2 Kinase
Activity
[0443] The human colon cancer cell line HCT-116 was seeded at 5000
cells/cm.sup.2 in 24 wells plate (Costar) using F12 medium (Gibco)
supplemented with 10% FCS (EuroClone, Italy) 2 mM L-glutamine and
1% penicillin/streptomycin and maintained at 37.degree. C., 5%
CO.sub.2 and 96% relative humidity. The following day, plates were
treated in duplicates with 5 mL of an appropriate dilution of
compounds starting from a 10 mM stock in DMSO. Two untreated
control wells were included in each plate. After 72 hours of
treatment, medium was withdrawn and cells detached from each well
using 0.5 mL of 0.05% (w/v) Trypsin, 0.02% (w/v) EDTA (Gibco).
Samples were diluted with 9.5 mL of Isoton (Coulter) and counted
using a Multisizer 3 cell counter (Beckman Coulter). Data were
evaluated as percent of the control wells: [0444] % of
CTR=(Treated--Blank)/(Control--Blank),
[0445] IC.sub.50 values were calculated by LW/Data Analysis using
Microsoft Excel sigmoidal curve fitting.
[0446] Given the above assays, the compounds of formula (I) of the
invention resulted to possess a remarkable protein kinase
inhibitory activity, typically with IC.sub.50 lower than 10
.mu.M.
[0447] See, as an example, the following Table 1 reporting the
experimental data of some representative compounds of the invention
being tested in biochemical assay as ALK, IGF-1R and Aurora-2
kinase inhibitors (IC.sub.50 .mu.M).
TABLE-US-00003 TABLE 1 Cpd ALK IC.sub.50 (.mu.M) IGF-1R IC.sub.50
(.mu.M) Aur2 IC.sub.50 (.mu.M) No. Biochemical assay Biochemical
assay Biochemical assay 11 0.055 0.263 0.338 4 0.207 2.350 0.484 26
0.411 1.103 0.568 18 1.771 6.070 3.234
[0448] From all of the above, the novel compounds of formula (I) of
the invention appear to be particularly advantageous in the therapy
of diseases caused by deregulated protein kinase activity such as
cancer.
[0449] The compounds of the present invention can be administered
either as single agents or, alternatively, in combination with
known anticancer treatments such as radiation therapy or
chemotherapy regimen in combination with, for example, antihormonal
agents such as antiestrogens, antiandrogens and aromatase
inhibitors, topoisomerase I inhibitors, topoisomerase II
inhibitors, agents that target microtubules, platin-based agents,
alkylating agents, DNA damaging or intercalating agents,
antineoplastic antimetabolites, other kinase inhibitors, other
anti-angiogenic agents, inhibitors of kinesins, therapeutic
monoclonal antibodies, inhibitors of mTOR, hi stone deacetylase
inhibitors, farnesyl transferase inhibitors, and inhibitors of
hypoxic response.
[0450] If formulated as a fixed dose, such combination products
employ the compounds of this invention within the dosage range
described below and the other pharmaceutically active agent within
the approved dosage range.
[0451] Compounds of formula (I) may be used sequentially with known
anticancer agents when a combination formulation is
inappropriate.
[0452] The compounds of formula (I) of the present invention,
suitable for administration to a mammal, e.g., to humans, can be
administered by the usual routes and the dosage level depends upon
the age, weight, and conditions of the patient and administration
route.
[0453] For example, a suitable dosage adopted for oral
administration of a compound of formula (I) may range from about 10
to about 500 mg per dose, from 1 to 5 times daily, The compounds of
the invention can be administered in a variety of dosage forms,
e.g., orally, in the form tablets, capsules, sugar or film coated
tablets, liquid solutions or suspensions; rectally in the form
suppositories; parenterally, e.g., intramuscularly, or through
intravenous and/or intrathecal and/or intraspinal injection or
infusion.
[0454] The present invention also includes pharmaceutical
compositions comprising a compound of formula (I) or a
pharmaceutically acceptable salt thereof in association with a
pharmaceutically acceptable excipient, which may be a carrier or a
diluent.
[0455] The pharmaceutical compositions containing the compounds of
the invention are usually prepared following conventional methods
and are administered in a suitable pharmaceutical form.
[0456] For example, the solid oral forms may contain, together with
the active compound, diluents, e.g., lactose, dextrose saccharose,
sucrose, cellulose, corn starch or potato starch; lubricants, e.g.,
silica, talc, stearic acid, magnesium or calcium stearate, and/or
polyethylene glycols; binding agents, e.g., starches, arabic gum,
gelatine methylcellulose, carboxymethylcellulose or polyvinyl
pyrrolidone; disintegrating agents, e.g., starch, alginic acid,
alginates or sodium starch glycolate; effervescing mixtures;
dyestuffs; sweeteners; wetting agents such as lecithin,
polysorbates, laurylsulphates, and, in general, non-toxic and
pharmacologically inactive substances used in pharmaceutical
formulations. These pharmaceutical preparations may be manufactured
in known manner, for example, by means of mixing, granulating,
tabletting, sugar-coating, or film-coating processes.
[0457] The liquid dispersions for oral administration may be, e.g.,
syrups, emulsions and suspensions.
[0458] As an example the syrups may contain, as a carrier,
saccharose or saccharose with glycerine and/or mannitol and
sorbitol.
[0459] The suspensions and the emulsions may contain, as examples
of carriers, natural gum, agar, sodium alginate, pectin,
methylcellulose, carboxymethylcellulose, or polyvinyl alcohol.
[0460] The suspension or solutions for intramuscular injections may
contain, together with the active compound, a pharmaceutically
acceptable carrier, e.g., sterile water, olive oil, ethyl oleate,
glycols, e.g., propylene glycol and, if desired, a suitable amount
of lidocaine hydrochloride.
[0461] The solutions for intravenous injections or infusions may
contain, as a carrier, sterile water or preferably they may be in
the form of sterile, aqueous, isotonic, saline solutions or they
may contain propylene glycol as a carrier.
[0462] The suppositories may contain, together with the active
compound, a pharmaceutically acceptable carrier, e.g., cocoa
butter, polyethylene glycol, a polyoxyethylene sorbitan fatty acid
ester surfactant or lecithin.
Experimental Section
[0463] For a reference to any specific compound of formula (I) of
the invention, optionally in the form of a pharmaceutically
acceptable salt, see the experimental section and claims. Referring
to the examples that follow, compounds of the present invention
were synthesized using the methods described herein, or other
methods, which are well known in the art.
[0464] The short forms and abbreviations used herein have the
following meaning: [0465] g (grams) mg (milligrams) [0466] ml
(milliliters) mM (millimolar) [0467] (micromolar) mmol (millimoles)
[0468] h (hours) MHz (Mega-Hertz) [0469] mm (millimetres) Hz
(Hertz) [0470] M (molar) min (minutes) [0471] mol (moles) TLC (thin
layer chromatography) [0472] r.t. (room temperature) TEA
(triethylamine) [0473] (trifluoroacetic acid) DMF (N,N-dimethyl
formamide) [0474] DIPEA (N,N-diisopropyl-N-ethylamine) DCM
(dichloromethane) [0475] THF (tetrahydrofuran) Hex (hexane) [0476]
MeOH (Methanol) DMSO (dimethylsulfoxide) [0477] TIPS
(triisopropylsilyl) bs (broad singlet) [0478] TBDMS
(dimethyl-tert-butylsilyl) Ac (acetyl) [0479] BOC
(tert-butyloxycarbonyl) Ac.sub.2O acetic anhydride [0480]
NaH=sodium hydride, 60% in mineral oil ESI=electrospray ionization
[0481] TBTU (2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium
tetrafluoroborate [0482] RP-HPLC (reverse phase high performance
liquid chromatography) With the aim to better illustrate the
present invention, without posing any limitation to it, the
following examples are now given.
[0483] As used herein the symbols and conventions used in the
processes, schemes and examples are consistent with those used in
the contemporary scientific literature, for example, the Journal of
the American Chemical Society or the Journal of Biological
Chemistry.
[0484] Unless otherwise noted, all materials were obtained from
commercial suppliers, of the best grade and used without further
purification. Anhydrous solvent such as DMF, THF, CH.sub.2Cl.sub.2
and toluene were obtained from the Aldrich Chemical Company. All
reactions involving air- or moisture-sensitive compounds were
performed under nitrogen or argon atmosphere.
General Purification and Analytical Methods
[0485] Flash Chromatography was performed on silica gel (Merck
grade 9395, 60A). HPLC was performed on Waters X Terra RP 18
(4.6.times.50 mm, 3.5 .mu.m) column using a Waters 2790 HPLC system
equipped with a 996 Waters PDA detector and Micromass mod. ZQ
single quadrupole mass spectrometer, equipped with an electrospray
(ESI) ion source. Mobile phase A was ammonium acetate 5 mM buffer
(pH 5.5 with acetic acid-acetonitrile 95:5), and Mobile phase B was
water-acetonitrile (5:95). Gradient from 10 to 90% B in 8 minutes,
hold 90% B 2 minutes. UV detection at 220 nm and 254 nm. Flow rate
1 mL/min. Injection volume 10 microL. Full scan, mass range from
100 to 800 amu. Capillary voltage was 2.5 KV; source temperature
was 120.degree. C.; cone was 10 V. Retention times (HPLC r.t.) are
given in minutes at 220 nm or at 254 nm. Mass are given as m/z
ratio.
[0486] When necessary, compounds were purified by preparative HPLC
on a Waters Symmetry C18 (19.times.50 mm, 5 um) column or on a
Waters X Terra RP 18 (30.times.150 mm, 5 .mu.m) column using a
Waters preparative HPLC 600 equipped with a 996 Waters PDA detector
and a Micromass mod. ZMD single quadrupole mass spectrometer,
electron spray ionization, positive mode. Mobile phase A was
water-0.01% trifluoroacetic acid, and mobile phase B was
acetonitrile. Gradient from 10 to 90% B in 8 min, hold 90% B 2 min.
Flow rate 20 mL/min. In alternative, mobile phase A was water-0.1%
NH.sub.3, and mobile phase B was acetonitrile. Gradient from 10 to
100% B in 8 min, hold 100% B 2 min. Flow rate 20 mL/min.
[0487] .sup.1-NMR spectrometry was performed on a Mercury VX 400
operating at 400.45 MHz equipped with a 5 mm double resonance probe
[1H (15N-31P) ID_PFG Varian].
EXAMPLE 1
Step a
5-[(3,5-Difluoro-phenyl)-hydroxy-methyl]-2-fluoro-benzonitrile
[(XI), R1=R2=R3=H, R=3,5-difluorophenyl]
[0488] To a stirred suspension of magnesium turnings (2.6 g, 109
mmol) in anhydrous tetrahydrofuran under argon (10 mL), a solution
of 1-bromo-3,5-difluoro-benzene (21 g, 109 mmol) in dry
tetrahydrofuran (90 mL) was slowly added. The reaction mixture was
stirred and heated at 90.degree. C. until all magnesium was
consumed (1 hour). Thereafter, the reaction was cooled at
-10.degree. C. and a solution of 2-fluoro-5-formyl-benzonitrile
(13.5 g, 90.6 mmol) in 100 mL of anhydrous tetrahydrofuran was
added during 30 min. After 1 hour, the reaction mixture was
quenched by adding dropwise 200 mL of 20% ammonium chloride
solution. Ethyl acetate was added, the layers were separated, and
the aqueous layer was extracted twice with ethyl acetate. Organic
layers were collected, washed with brine, dried and evaporated.
Crude was triturated with isopropyl ether/hexane 1:1 (100 mL),
filtered and washed with the same mixture (50 mL) to afford 16 gr
of final product. Purification of the resulting organic phase by
chromatography over silica gel (hexane/EtOAc 4:1) afforded 4.5 g of
the title compound (total amount 20.5 g, 87% yield).
[0489] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 5.82 (d, J=4.02
Hz, 1H) 6.41 (d, J=4.02 Hz, 1H) 7.05-7.12 (m, 1H) 7.12-7.18 (m, 2H)
7.46-7.50 (m, 1H 7.80 (td, J=5.76, 2.62 Hz, 1H) 7.97 (dd, J=6.34,
2.19 Hz, 1H)
[0490] Operating in an analogous way, the following compound was
obtained:
5-(phenyl-hydroxy-methyl)-2-fluoro-benzonitrile [(XI), R1=R2=R3=H,
R=phenyl]
[0491] ESI(+) MS: m/z 245 (MNH.sub.4.sup.+).
Step b
5-(3,5-Difluoro-benzoyl)-2-fluoro-benzonitrile [(X), R1=R2=R3=H,
R=3,5-difluorophenyl]
[0492] A mixture of
5-[(3,5-Difluoro-phenyl)-hydroxy-methyl]-2-fluoro-benzonitrile
(2.68 g, 10.2 mmol), 4-methylmorpholine N-oxide monohydrate (2.02
g, 15 mmol) and tetrapropylammonium perruthenate (35 mg, 0.1 mmol)
in dry dichloromethane (50 mL) was stirred at room temperature for
2 hours. The reaction mixture was evaporated and the residue
redissolved in ethyl acetate. The organic phase was washed with 10%
sodium bisulphite and saturated ammonium chloride, dried and
evaporated. Purification of the crude by chromatography over silica
gel (EtOAc/hexane) afforded 2.05 g of the title compound (77%
yield).
[0493] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 7.43-7.50 (m, 2H)
7.61-7.68 (m, 1H) 7.72 (t, J=9.02 Hz, 1H) 8.17 (ddd, J=8.84, 5.30,
2.32 Hz, 1H) 8.35 (dd, J=6.22, 2.20 Hz, 1H)
[0494] Operating in an analogous way, the following compound was
obtained:
5-Benzoyl-2-fluoro-benzonitrile [(X), R1=R2=R3=H, R=phenyl]
[0495] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 7.59 (t, J=7.81
Hz, 2H) 7.72 (m, 2H) 7.78 (dd, J=8.30, 1.46 Hz, 2H) 8.13 (ddd,
J=8.79, 5.37, 2.20 Hz, 1H) 8.28 (dd, J=6.10, 2.20 Hz, 1H)
Step c
(3-Amino-1H-indazol-5-yl)-(3,5-difluoro-phenyl)-methanone [(IX),
R1=R2=R3=H, R=3,5-difluorophenyl]
[0496] A mixture of 5-(3,5-difluoro-benzoyl)-2-fluoro-benzonitrile
(2.05 g, 7.84 mmol) and hydrazine hydrate (0.73 mL, 15.7 mmol) in
dry tetrahydrofuran (100 mL) was stirred at room temperature for 2
hours. The reaction mixture was treated with 37% hydrochloric acid
(1.3 mL, 15.7 mmol) for 30 min and then the volatiles were
partially evaporated. The reaction mixture was then diluted with
water (.100 mL) and aqueous NH.sub.3 was added to reach neutral pH.
The resulting solid was filtered, washed thoroughly with water and
dried under vacuum at 60.degree. C. The title compound was obtained
as yellow solid (1.75 g, 80% yield).
[0497] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 5.75 (br. s., 2H)
7.33-7.36 (m, 1H) 7.36-7.40 (m, 2H) 7.52-7.59 (m, 1H) 7.75 (dd,
J=8.84, 1.65 Hz, 1H) 8.27 (dd, J=1.59, 0.73 Hz, 1H) 11.95 (br. s.,
1H)
[0498] Operating in an analogous way, the following compounds were
obtained:
(3-Amino-1H-indazol-5-yl)-(3-ethoxy-phenyl)-methanone [(IX),
R1=R2=R3=H, R=3-ethoxyphenyl]
[0499] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.36 (t, J=7.01
Hz, 3H) 4.11 (q, J=6.95 Hz, 2H) 7.20-7.24 (m, 2H) 7.25-7.28 (m, 1H)
7.41 (dd, J=8.84, 0.55 Hz, 1H) 7.48 (td, J=7.68, 0.61 Hz, 1H) 7.80
(dd, J=8.78, 1.59 Hz, 1H) 8.34 (d, J=0.85 Hz, 1H) 12.24 (br. s.,
1H)
(3-Amino-1H-indazol-5-yl)-phenyl-methanone [(IX), R1=R2=R3H,
R=phenyl]
[0500] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 7.40 (dd, J=8.78,
0.61 Hz, 1H) 7.57 (tt, J=7.68, 1.59 Hz, 2H) 7.66 (tt, J=7.32, 2.07
Hz, 1H) 7.72 (dt, J=6.83, 1.34 Hz, 2H) 7.78 (dd, J=8.78, 1.59 Hz,
1H) 8.31 (m, 1H) 12.15 (br. s., 1H)
Step d
N-[5-(3,5-Difluoro-benzoyl)-1H-indazol-3-yl]-2,2,2-trifluoro-acetamide
[(VIII), R1=R2=R3=H, R=3,5-difluorophenyl,
PG.sub.1=trifluoroacethyl]
[0501] A suspension of
(3-amino-1H-indazol-5-yl)-(3,5-difluoro-phenyl)-methanone (2.73 g,
10 mmol) in dry tetrahydrofuran (120 mL) was treated with
trifluoroacetic anhydride (4.2 mL, 30 mmol) and stirred 1 hour at
room temperature. The solution was evaporated, treated with
methanol and further evaporated to dryness. The residue was
redissolved in ethyl acetate and washed with aqueous bicarbonate.
The organic phase was separated, dried and evaporated. The solid
was triturated with a small amount of dichloromethane and filtered
affording 3.25 g (88% yield) of title compound.
[0502] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 7.39-7.46 (m, 2H)
7.56-7.64 (m, 1H) 7.68 (dd, J=8.84, 0.67 Hz, 1H) 7.86 (dd, J=8.84,
1.65 Hz, 1H) 8.28-8.32 (m, 1H) 12.16 (s, 1H) 13.50 (s, 1H)
[0503] Operating in an analogous way, the following compound was
obtained:
N-[5-(3-Ethoxy-benzoyl)-1H-indazol-3-yl]-2,2,2-trifluoro-acetamide
[(VIII), R1=R2=R3=H, R=3-ethoxyphenyl,
PG.sub.1=trifluoroacethyl]
[0504] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.34 (t, J=6.95
Hz, 3H) 4.10 (q, J=6.95 Hz, 2H) 7.19-7.25 (m, 2H) 7.28 (d, J=7.56
Hz, 1H) 7.43-7.50 (m, 1H) 7.67 (d, J=8.90 Hz, 1H) 7.85 (dd, J=8.84,
1.52 Hz, 1H) 8.26 (s, 1H) 12.14 (s, 1H) 13.46 (s, 1H)
Step e
N-[5-(3,5-Difluoro-benzoyl)-1-trityl-1H-indazol-3-yl]-2,2,2-trifluoro-acet-
amide [(VII), R1=R2=R3=H, R=3,5-difluorophenyl, PG=triphenylmethyl,
PG.sub.1=trifluoroacethyl]
[0505]
N-[5-(3,5-Difluoro-benzoyl)-1H-indazol-3-yl]-2,2,2-trifluoro-acetam-
ide (19.11 g, 51.76 mmol) in dry dichloromethane (300 mL) was
treated with chlorotriphenylmethane (14.72 g, 52.8 mmol) and
triethylamine (14.55 mL, 103.5 mmol). After stirring at room
temperature for two days, the reaction was washed with a solution
of NH.sub.4Cl, dried and evaporated. Purification of the crude by
chromatography over silica gel (DCM/MeOH) afforded 27.32 g of the
title compound (86% yield).
[0506] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 6.57 (d, J=8.90
Hz, 1ff 7.20 (m, 6H) 7.29-7.40(m, 11H) 7.58 (m, 2H) 8.22 (d, J=1.10
Hz, 1H) 12.27 (s, 1H) Operating in an analogous way, the following
compound was obtained:
N-[5-(3-Ethoxy-benzoyl)-1-trityl-1H-indazol-3-yl]-2,2,2-trifluoro-acetamid-
e [(VII), R1=R2=R3=H, R=3-ethoxyphenyl, PG=triphenylmethyl,
PG.sub.1=trifluoroacethyl]
[0507] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.33 (t, J=6.95
Hz, 3H) 4.10 (q, J=6.95 Hz, 2H) 6.56 (d, J=9.02 Hz, 1H) 7.17-7.39
(m, 18H) 7.41-7.47 (m, 1H) 7.54 (dd, J=19.08, 1.65 Hz, 1H) 8.18 (d,
J=0.98 Hz, 1H) 12.25 (s, 1H)
Step f
(3-Amino-1-trityl-1H-indazol-5-yl)-(3,5-difluoro-phenyl)-methanone
[(VI), R1=R2=R3=H, R=3,5-difluorophenyl, PG=triphenylmethyl]
[0508]
N-[5-(3,5-Difluoro-benzoyl)-1-trityl-1H-indazol-3-yl]-2,2,2-trifluo-
ro-acetamide (6.12 g, 10 mmol) was heated at 100.degree. C. in a
mixture isopropanol/tetrahydrofuran 8:2 (100 mL) and triethylamine
(12.2 mL) for 48 hours. The volatiles were partially evaporated and
the resulting mixture cooled and filtered. The solid was washed
with diethyl ether. After drying under vacum at 70.degree. C. the
title compound was obtained as a white solid (5.1 g, 99%
yield).
[0509] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 5.98 (br. s., 2H)
6.35 (d, J=8.90 Hz, 1H) 7.20-7.37 (m, 17H) 7.48 (dd, J=9.08, 1.77
Hz, 1H) 7.50-7.57 (m, 1H) 8.23 (d, J=1.10 Hz, 1H)
[0510] Operating in an analogous way, the following compound was
obtained:
(3-Amino-1-trityl-1H-indazol-5-yl)-(3-ethoxy-phenyl)-methanone
[(VI), R1=R2=R3=H, R=3-ethoxyphenyl, PG=triphenylmethyl]
[0511] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.33 (t, J=6.95
Hz, 3H) 4.07 (q, J=6.95 Hz, 2H) 5.93 (s, 2H) 6.36 (d, J=9.02 Hz,
1H) 7.12-7.34 (m, 18H) 7.40-7.46 (m, 2H) 8.22 (d, J=1.10 Hz,
1H)
Step g
N-[5-(3,5-Difluoro-benzoyl)-1-trityl-1H-indazol-3-yl]-4-(4-methyl-piperazi-
n-1-yl)-2-nitro-benzamide [(V), R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-nitro-phenyl,
PG=triphenylmethyl]
[0512] To a suspension of
4-(4-methyl-piperazin-1-yl)-2-nitro-benzoic acid hydrochloride (1.5
g, 4.97 mmol) in dry tetrahydrofuran (80 mL) were added oxalyl
chloride (1.4 mL, 19.9 mmol) and N,N-dimethylformamide (1-2 drops).
The mixture was stirred at room temperature overnight and then
evaporated to dryness. The resulting crude acyl chloride was
taken-up with toluene and evaporated again then dissolved in dry
tetrahydrofuran (180 mL). A solution of
(3-amino-1-trityl-1H-indazol-5-yl)-(3,5-difluoro-phenyl)-methanone
(1.83 g, 3.55 mmol) and N,N-diisopropylethylamine (2.5 mL, 14.22
mmol) in dry tetrahydrofuran (15 mL) was added to the reaction
mixture. The mixture was stirred at room temperature overnight and
then at 75.degree. C. for 2 hours. The volatiles were evaporated
and the residue taken up with dichloromethane and washed with
brine. The organic phase was dried over sodium sulfate and
evaporated to dryness. Purification of the crude by chromatography
over silica gel (DCM/MeOH) afforded 2.51 g of the title compound as
yellow powder (92% yield).
[0513] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.22 (s, 3H)
2.40-2.45 (m, 4H) 3.26-3.36 (m, 4H) 6.50 (d, J=8.17 Hz, 1H)
7.19-7.50 (m, 21H) 7.56 (dd, J=9.15, 1.71 Hz, 1H) 8.28-8.30 (m, 1H)
11.22 (br. s., 1H)
[0514] Operating in an analogous way, the following compound was
obtained:
N-[5-(3-Ethoxy-benzoyl)-1-trityl-1H-indazol-3-yl]-4-(4-methyl-piperazin-1--
yl)-2-nitro-benzamide [(V), R1=R2=R3=H, R=3-ethoxyphenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-nitro-phenyl,
PG=triphenylmethyl]
[0515] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.34 (t, J=6.95
Hz, 3H) 2.24 (m, 3H) 2.45 (m, 4H) 3.27 (m, 4H) 4.08 (q, J=6.95 Hz,
2H) 6.51 (d, J=8.17 Hz, 1H) 7.20-7.46 (m, 2H) 7.53 (dd, J=9.15,
1.71 Hz, 1H) 8.30 (m, 1H) 11.22 (br. s., 1H)
Step h
N-[5-(3,5-Difluoro-benzoyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-yl)-2-
-nitro-benzamide [(II), R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-nitro-phenyl]
[0516] A mixture of
N-[5-(3,5-Difluoro-benzoyl)-1-trityl-1H-indazol-3-yl]-4-(4-methyl-piperaz-
in-1-yl)-2-nitro-benzamide (2.76 g, 3.62 mmol), trifluoroacetic
acid (5.6 mL) and dichloromethane (56 mL) was stirred at room
temperature for 2 hours. The volatiles were evaporated and the
residue taken up with dichloromethane and washed with a saturated
solution of sodium hydrogen-carbonate. The organic phase was
evaporated to dryness. The residue was redissolved in ethyl acetate
and washed twice with brine. The resulting organic phase was dried
over sodium sulfate and evaporated to dryness. Purification of the
crude by chromatography over silica gel (DCM/MeOH) and trituration
of the so obtained compound from diethyl ether afforded 1.47 g of
the title compound (78% yield).
[0517] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.25 (br. s., 3H)
2.47 (br. s., 4H) 3.29-3.38 (m, 4H) 7.26 (dd, J=8.84, 2.50 Hz, 1H)
7.37-7.43 (m, 2H) 7.45 (d, J=2.44 Hz, 1H) 7.51-7.59 (m, 1H) 7.63
(dd, J=8.84, 0.55 Hz, 1H) 7.66 (br. s., 1H) 7.86 (dd, J=8.84, 1.65
Hz, 1H) 8.36 (s, 1H) 11.13 (s, 1H) 13.21 (s, 1H)
[0518] Operating in an analogous way, the following compounds were
obtained:
N-[5-(3-Ethoxy-benzoyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-yl)-2-nit-
ro-benzamide [(II), R1=R2=R3=H, R=3-ethoxyphenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-nitro-phenyl]
[0519] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.34 (t, J=6.95
Hz, 3H) 2.26-2.34 (m, 3H) 2.46-2.59 (m, 4H) 3.28-3.35 (m, 4H) 4.10
(q, J=6.95 Hz, 2H) 7.18-7.2.1 (m, 1H) 7.24-7.26 (m, 1H) 7.27 (dd,
J=9.33, 1.89 Hz, 1H) 7.29-7.32 (m, 1H) 7.45 (t, J=7.87 Hz, 1H) 7.46
(d, J=2.32 Hz, 1H) 7.62 (d, J=9.02 Hz, 1H) 7.66 (d, J=9.88 Hz, 1H)
7.84 (dd, J=8.78, 1.59 Hz, 1H) 8.39 (s, 1H) 11.13 (br. s., 1H)
13.17 (s, 1R)
4-[(3-Dimethylamino-propyl)-methyl-amino]-N-[5-(3-ethoxy-benzoyl)-1H-indaz-
ol-3-yl]-2-nitro-benzamide [(II), R1=R2=R3=H, R=3-ethoxyphenyl,
Ar=4[(3-dimethylamino-propyl)-methyl-amino]-2-nitro-phenyl]
[0520] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.33 (t, J=6.95
Hz, 3H) 1.60-1.78 (m, 2H) 2.22 (s, 6H) 2.29-2.37 (m, 2H) 3.01 (s,
3H) 3.48 (t, J=7.01 Hz, 2H) 4.09 (q, J=6.99 Hz, 2H) 6.98 (dd,
J=8.84, 2.50 Hz, 1H) 7.16-7.21 (m, 2H) 7.22-7.25 (m, 1H) 7.27-7.32
(m, 1H) 7.45 (t, J=7.93 Hz, 1H) 7.58-7.66 (m, 2H) 7.83 (dd, J=8.78,
1.59 Hz, 1H) 8.36 (s, 1H) 11.04 (s, 1H) 13.14 (s, 1H)
Step i
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-yl)-2--
nitro-benzamide [(I.sub.A), R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-nitro-phenyl] cpd. 6
##STR00050##
[0522]
N-[5-(3,5-Difluoro-benzoyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin--
1-yl)-2-nitro-benzamide (3.61 g, 6.9.3 mmol) was dissolved in DCM
(150 mL) in argon atmosphere and trifluoroacetic acid (150 mL) is
added under stirring. Sodium borohydride pellets (2.62 gr, 69.3
mmol) is gradually added over a period of 72 hours. The reaction
mixture was evaporated, taken up with a mixture MeOH/acetone and
stirred for 1 hour. The resulting mixture was evaporated to
dryness, redissolved in MeOH and NaOH 8N was added till basic pH
was reached. Crude was evaporated and ice/water was added, the
solid thus formed was filtered, washed with water and dried under
vacuum at 80.degree. C. affording 3.22 g of title compound (92%
yield).
[0523] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.23 (s, 3H)
2.42-2.47 (m, 4H) 3.33-3.38 (m, 4H) 4.05 (s, 2H) 6.91-6.97 (m, 2H)
6.97-7.05 (m, 1H) 7.24 (dd, J=8.60, 1.52 Hz, 1H) 7.27 (br. s., 1H)
7.41 (d, J=8.66 Hz, 1H) 7.44 (br. s., 1H) 7.63 (s, 1H) 7.66-7.73
(m, 1H) 10.81 (br. s., 1H) 12.70 (s, 1H)
[0524] Operating in an analogous way, the following compounds were
obtained:
4-[(3-Dimethylamino-propyl)-methyl-amino]-N-[5-(3-ethoxy-benzyl)-1H-indazo-
l-3-yl]-2-nitro-benzamide [(I.sub.A), R1=R2=R3=H, R=3-ethoxyphenyl,
Ar=4-[(3-dimethylamino-propyl)-methyl-amino]-2-nitro-phenyl] cpd.
53
##STR00051##
[0526] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.26-1.31 (m, 3H)
1.69 (t, J=6.77 Hz, 2H) 2.19 (s, 6H) 2.28 (br. s., 2H) 3.02 (s, 3H)
3.45-3.51 (m, 2H) 3.93-4.00 (m, 2H) 3.96 (s, 2H) 6.70-6.73 (m, 1H)
6.76-6.80 (m, 1H) 6.77 (d, J=1.59 Hz, 1H) 6.98 (d, J=8.90 Hz, 1H)
7.14-7.19 (m, 1H) 7.19-7.23 (m, 2H) 7.38 (d, J=8.66 Hz, 1H) 7.61
(s, 1H) 7.67 (d, J=10.00 Hz, 1H) 10.72 (br. s., 1H) 12.65 (s,
1H)
N-{5-[(3,5-Difluoro-phenyl)-hydroxy-methyl]-1
H-indazol-3-yl}-4-(4-methyl-piperazin-1-yl)-2-(tetrahydro-pyran-4-ylamino-
)-benzamide [(I.sub.B), R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-(tetrahydro-pyran4-ylamino)-phenyl]
cpd. 60
##STR00052##
[0528] A mixture of
N-[5-(3,5-Difluoro-benzoyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-yl)--
2-(tetrahydro-pyran-4-ylamino)-benzamide (130 mg, 0.226 mmol) and
sodium borohydride (15 mg, 0.39 mmol) was dissolved at room
temperature in i-propanol (20 mL). The reaction mixture was stirred
for 4 hours, quenched with methanol and evaporated to dryness.
Crude material was redissolved in DCM and washed with brine. After
trituration with diethyl ether, 59 mg of the title compound were
recovered (45% yield).
[0529] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.26-1.41 (m, 2H)
1.89-1.,99 (m, 2H) 2.23 (s, 3H) 2.39-2.47 (m, 4H) 3.21-3.29 (m, 4H)
3.45-3.55 (m, 2H) 3.63-3.74 (m, 1H) 3.76-3.86 (m, 2H) 5.81 (d,
J=4.15 Hz, 1H) 6.12 (d, J=1.15 Hz, 1H) 6.14 (d, J=2.07 Hz, 1H) 6.24
(dd, J=9.08, 2.26 Hz, 1H) 6.96-7.04 (m, 1H) 7.05-7.12 (m, 2H)
7.27-7.36 (m, 1H) 7.37-7.43 (m, 1H) 7.64 (s, 1H) 7.80 (d, J=9.15
Hz, 1H) 8.31 (d, J=7.56 Hz, 1H) 10.09 (s, 1H) 12.63 (s, 1H)
N-{5-[(3-Ethoxy-phenyl)-hydroxy-methyl]-1H-indazol-3-yl}-4-(4-methyl-piper-
azin-1-yl)-2-nitro-benzamide [(I.sub.B), R1=R2=R3=H,
R=3-ethoxyphenyl, Ar=4-(4-methyl-piperazin-1-yl)-2-nitro-phenyl]
cpd. 67
##STR00053##
[0531] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.29 (t, J=6.95
Hz, 3H) 2.24 (s, 3H) 2.42-2.47 (m, 4H) 3.36 (m, 4H) 3.97 (q, J=6.95
Hz, 2H) 5.70 (d, J=3.90 Hz, 1H) 5.85 (d, J=3.90 Hz, 1H) 6.72 (ddd,
J=8.17, 2.56, 0.73 Hz, 1H) 6.90 (d, J=7.68 Hz, 1H) 6.93 (dd,
J=2.20, 1.46 Hz, 1H) 7.17 (t, J=7.87 Hz, 1H) 7.26 (d, J=8.78 Hz,
1H) 7.28 (dd, J=8.72, 1.40 Hz, 1H) 7.36 (d, J=8.78 Hz, 1H) 7.44 (d,
J=2.07 Hz, 1H) 7.70 (d, J=6.71 Hz, 1H) 7.81 (br. s., 10.80 (br. s.,
1H) 12.65 (s, 1H).
EXAMPLE 2
Step j
5-(3,5-Difluoro-benzyl)-2-fluoro-benzonitrile [(XIV), R1=R2=R3=H,
R32 3,5-difluorophenyl]
[0532]
5-[(3,5-Difluoro-phenyl)-hydroxy-methyl]-2-fluoro-benzonitrile (3.5
g, 13.3 mmol) and sodium iodide (20 g, 133 mmol) are stirred in
acetonitrile (50 mL) under nitrogen at 60.degree. C. To the
reaction mixture is gradually added chlorotrimethylsilane (17 mL,
134 mmol) over a period of 8 hours. The mixture is diluted with
ethyl acetate and washed with water, saturated aquoeus sodium
bicarbonate, 10% aquoeus sodium thiosulfate and brine. Purification
of the crude by chromatography over silica gel (EtOAc/hexane 5:100)
afforded 3.1 g of the title compound (88% yield).
[0533] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 4.02 (s, 2H)
7.02-7.11 (m, 3H) 7.47 (t, J=9.08 Hz, 1H) 7.68-7.74 (m, 1H) 7.90
(dd, J=6.22, 2.19 Hz, 1H)
[0534] Operating in an analogous way, the following compound was
obtained:
5-benzyl-2-fluoro-benzonitrile [(XIV), R1=R2=R3=H, R=phenyl]
[0535] ESI(+) MS: m/z 229 (MNH.sup.+).
Step k
5-(3,5-Difluoro-benzyl)-2-fluoro-benzonitrile [(XIV), R1=R2=R3=H,
R=3,5-difluorophenyl]
[0536] 3-Cyano-4-fluorophenylboronic acid (1.649 g, 10 mmol),
powdered potassium phosphate (4.254 g, 20 mmol) and
Pd(PPh.sub.3).sub.4 (231 mg, 0.2 mmol) were charged in an
oven-dried flask under argon atmosphere. The flask was evacuated
and back-filled with argon thrice and then toluene (30 mL) and
3,5-difluorobenzyl bromide (1.295 mL, 10 mmol) were added by means
of a syringe through a lattice stopper, under good stirring.
[0537] The reaction mixture was heated to 100.degree. C. in half an
hour and maintained at that temperature for 1.5 hours. The black
mixture was taken up with diethylether (200 mL), washed with
saturated aqueous amonium chloride (2.times.20 mL), brine
(3.times.30 mL), dried over sodium sulphate and evaporated to
dryness to afford 3.21 g of yellow oil. The crude was purified by
flash chromatography on silica gel eluting with n-hexane/ethyl
acetate 95:5 to yield 1.89 g (yield 76.4%) of whitish solid.
[0538] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 4.02 (s, 2H)
7.02-7.11 (m, 3H) 7.47 (t, J=9.08 Hz, 1H) 7.68-7.74 (m, 1H) 7.90
(dd, J=6.22, 2.19 Hz, 1H)
[0539] Following an analogous procedure the compounds listed below
were prepared:
5-(2,5-Difluoro-benzyl)-2-fluoro-benzonitrile
[0540] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 4.01 (s, 2H),
7.09-7.17 (m, 1H), 7.20-7.27 (m, 2H), 7.46 (t, J=9.08 Hz, 1H), 7.64
(m, 1H), 7.82 (dd, J=6.22, 2.19 Hz, 1H)
2-Fluoro-5-(5-fluoro-2-methyl-benzyl)-benzonitrile
[0541] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.18 (s, 3H), 4.01
(s, 2H), 7.00(m, 2H), 7.22 (m, 1H), 7.48 (t, J=9.08 Hz, 1H), 7.56
(m, 1H), 7.75 (dd, J=6.22, 2.19 Hz, 1H)
2-Fluoro-5-(3-fluoro-benzyl)-benzonitrile
[0542] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 3.98 (s, 2H),
6.95-7.15 (m, 3H), 7.27-7.38 (m, 1H), 7.38-7.48 (t, 1H), 7.61-7.70
1H), 7.81-7.87 (dd, J=6.22, 2.19 Hz, 1H).
2-Fluoro-5-pyridin-3-ylmethyl-benzonitrile
[0543] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 4.03 (s, 2H) 7.33
(ddd, J=7.83, 4.79, 0.79 Hz, 1H) 7.47 (t, J=9.02 Hz, 1H) 7.65-7.68
(m, 1H) 7.68-7.72 (m, 1H) 7.89 (dd, J=6.28, 2.01 Hz, 1H) 8.44 (dd,
J=4.76, 1.59 Hz, 1H) 8.54 (d, J=1.71 Hz, 1H)
Step l
5-(3,5-Difluoro-benzyl)-1H-indazol-3-ylamine [(III.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl]
[0544] A mixture of 5-(3,5-difluoro-benzyl)-2-fluoro-benzonitrile
(20 g, 80.9 mmol) and hydrazine hydrate (19.6 mL, 404 mmol) in
n-butanol (200 mL) was heated at 120.degree. C. overnight. The
reaction mixture was diluted with water/ethyl acetate and the
organic phase washed twice with brine, dried and evaporated. Crude
was triturated with diethyl ether and filtered to afford 13 gr of
final product. Purification of the resulting organic phase by
chromatography over silica gel (DCM/EtOH 95:5) afforded further 6.3
g of the title compound (total amount 19.2 g, 92% yield).
[0545] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 4.01 (s, 2H) 5.23
(s, 2H) 6.89-6.98 (m, 2H) 7.03 (tt, J=9.43, 2.33 Hz, 1H) 7.11-7.15
(m, 1H) 7.16-7.20 (m, 1H) 7.53 (s, 1H) 11.30 (s, 1H)
[0546] Following an analogous procedure the compounds listed below
were prepared:
5-(2,5-Difluoro-benzyl)-1H-indazol-3-ylamine
[0547] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 3.99 (s, 2H),
5.28(m, 2H), 7.05-7.25 (m, 5H), 7.51 (s, 1H), 11.30 (bs, 1H).
5-(5-Fluoro-2-methyl-benzyl)-1H-indazol-3-ylamine
[0548] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.21 (s, 3H), 3.97
(s, 2H), 5.22 (bs, 2H), 7.43 (s, 1H), 7.14-7.20 (m, 2H), 7.06 (dd,
1H), 6.87-6.97 (m, 2H), 11.27 (bs, 1H).
5-(3-Fluoro-benzyl)-1H-indazol-3-ylamine
[0549] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 4.00 (s, 2H), 5.22
(bs, 2H), 6.96-7.09 (m, 3H), 7.11 (m, 1H), 7.15 (m, 1H), 7.29-7.37
(m, 1H), 7.53 (s, 1H), 11.27 (s, 1H).
5-Pyridin-3-ylmethyl-1H-indazol-3-ylamine
[0550] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 4.01 (s, 2H) 5.23
(br. s., 2H) 7.08-7.15 (m, 1H) 7.15-7.19 (m, 1H) 7.25-7.34 (m, 1H)
7.53 (s, 1H) 7.60 (dt, J=7.86, 1.92 Hz, 1H) 8.40 (dd, J=4.69, 1.65
Hz, 1H) 8.51 (d, J=1.83 Hz, 1H) 11.28 (s, 1H)
5-benzyl-1H-indazol-3-ylamine
[0551] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 3.97 (s, 2H) 5.21
(s, 2H) 7.07-7.11 (m, 1H) 7.13-7.16 (m, 1H) 7.16-7.20 (m, 1H)
7.20-7.24 (m, 2H) 7.25-7.31 (m, 2H) 7.52 (s, 1H) 11.25 (s, 1H).
Step n
5-[1-(3,5-Difluoro-phenyl)-ethyl]-2-fluoro-benzonitrile
[(XIXD.sub.1), R1=R2=R3=H, R=3,5-difluorophenyl, R'=methyl]
[0552] 5-3,5-Difluoro-benzyl)-2-fluoro-benzonitrile (450 mg, 1.82
mmol) was dissolved in THF dry (14 mL) in nitrogen atmosphere at
-20.degree. C. and methyl iodide (0.17 mL, 2.73 mmol) was added
under stirring. Bis-(trimethylsilyl)-lithiumamid, 1.0 M in THF
(0.684 ml, 3.64 mmol) was gradually added. After 20 minutes the
reaction was quenched by adding a solution of KHSO.sub.4 10% and
extracted with ethyl acetate. The organic phase was washed with
aqueous KHSO.sub.4 10% and brine, dried over sodium sulfate and
evaporated to dryness. The crude was purified by flash
chromatography on silica gel using hexane/ethyl acetate 98/2 as the
eluant. The title product was isolated as an oil (400 mg, 84%
yield).
[0553] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.59 (d, J=7.32
Hz, 3H) 4.31 (q, J=7.19 Hz, 1H) 7.08 (m, 3H) 7.46 (t, J=9.15 Hz,
1H) 7.73 (m, 1H) 7.95 (dd, J=6.22, 2.44 Hz, 1H)
Step l'''
5-[1-(3,5-Difluoro-phenyl)-ethyl]-1H-indazol-3-ylamine
[(IIID.sub.1), R1=R2=R3=H, R=3,5-difluorophenyl, R'=methyl]
[0554] 5-[1-(3,5-Difluoro-phenyl)-ethyl]-2-fluoro-benzonitrile (324
mg, 1.24 mmol) was dissolved in n-butanol (3 mL) and hydrazine
hydrate (0.301 mL, 6.20 mmol) was added. The reaction mixture was
stirred at 120.degree. C. for 22 hours then quenched by adding
water/ethyl acetate. The organic phase separated was washed with
water and brine, dried over sodium sulfate and evaporated to
dryness. The crude was purified by chromatography on silica gel
with a gradient elution of DCM/EtOH from 99/1 to 98/2. Title
product was isolated as an oil (96 mg, 39% yield).
[0555] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.61 (d, J=7.19
Hz, 3H) 4.25 (q, J=7.32 Hz, 1H) 5.26 (br. s, 5.26, 2H) 6.99 (m, 3H)
7.12 (dd, J=8.66, 1.59 Hz, 1H) 7.16 (dd, J=8.54, 0.73 Hz, 1H) 7.62
(br. s, 1H) 11.29 (s, 1H)
step i'
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-yl)-2--
(tetrahydro-pyran-4-ylamino)-benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-(tetrahydro-pyran-4-ylamino)-phenyl]
cpd. 11
##STR00054##
[0557] To a suspension of
4-(4-methyl-piperazin-1-yl)-2-[(tetrahydro-pyran-4-yl)-(2,2,2-trifluoro-a-
cetyl)-amino]-benzoic acid trifluoroacetate (10 g, 22.1 mmol) in
dry dichloromethane (300 mL) oxalyl chloride (3.58 mL, 42.3 mmol)
and N,N-dimethylformamide (1-2 drops) were added. The mixture was
stirred at room temperature for 2 hours then evaporated to dryness.
The resulting crude acyl chloride was taken-up with toluene and
evaporated again then dissolved in dry tetrahydrofuran (130 mL) at
-20.degree. C. A solution of
5-(3,5-difluoro-benzyl)-1H-indazol-3-ylamine (5 g, 19.28 mmol) and
N,N-diisopropylethylamine (12.8 mL, 73.3 mmol) in dry THF (40 mL)
was added to the cooled reaction mixture. The mixture was stirred
at -20.degree. C. for 4 hours then quenched by adding water/ethyl
acetate. The organic phase was washed with a saturated solution of
sodium hydrogenocarbonate, dried over sodium sulfate and evaporated
to dryness.
[0558] The crude can be purified by flash chromatography on silica
gel using dichloromethane/ethanol 100:10 as the eluant, affording
intermediate
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-yl)-2-
-[(tetrahydro-pyran-4-yl)-(2,2,2-trifluoro-acetyl)-amino]-benzamide
as a pale yellow solid.
##STR00055##
[0559] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.25-1.41 (m, 1H)
1.48-1.61 (m, 1H) 1.66 (d, J=9.02 Hz, 1H) 1.92 (d, J=9.15 Hz, 1H)
2.25 (s, 3H) 2.43-2.49 (m, 4H) 3.23-3.41 (m, 6H) 3.77 (dd, J=10.91,
4.21 Hz, 1H) 3.87 (dd, J=11.65, 3.96 Hz, 1H) 4.02 (s, 2H) 4.37-4.49
(m, 1H) 6.89 (d, J=2.44 Hz, 1H) 6.90-6.98 (m, 2H) 7.02 (tt, J=9.42,
2.29 Hz, 1H) 7.09 (dd, J=8.78, 2.44 Hz, 1H) 7.27 (dd, J=8.72, 1.40
Hz, 1H) 7.41-7.43 (m, 2H) 7.83 (d, J=8.78 Hz, 1H) 10.52 (s, 1H)
12.69 (s, 1H)
[0560] Alternatively, not previously purified crude reaction
mixture can be dissolved in methanol (375 mL) in the presence of
triethylamine (60 mL) and stirred at 65.degree. C. for 2 hours. The
solvents were removed under reduced pressure and the residue
treated with water/ethyl acetate. Organic phase was dried over
sodium sulfate and evaporated to dryness. Purification of the crude
by chromatography over silica gel (DCM/EtOH/NH.sub.3 5N in
MeOH=1000/50/5) and crystallisation of the so obtained compound
from EtOAc/hexane afforded 8.4 g of the title compound as a white
solid (78% yield).
[0561] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.26-1.43 (m, 2H)
1.86-2.02 (m, 2H) 2.23 (s, 3H) 2.42-2.46 (m, 4H) 3.23-3.29 (m, 4H)
3.45-3.54 (m, 2H) 3.62-3.75 (m, 1H) 3.82 (dt, J=11.61, 3.83 Hz, 2H)
4.05 (s, 2H) 6.14 (d, J=2.07 Hz, 1H) 6.24 (dd, J=8.90, 2.19 Hz, 1H)
6.94-7.06 (m, 3H) 7.26 (dd, J=8.66, 1.46 Hz, 1H) 7.41 (d, J=8.66
Hz, 1H) 7.50 (d, 1H) 7.80 (d, J=9.15 Hz, 1H) 8.29 (d, J=7.68 Hz,
1H) 10.08 (s, 1H) 12.63 (s, 1H).
[0562] Operating in an analogous way, the following compounds were
obtained:
N-[5-(3,5-Dilfluoro-benzyl)-1H-indazol-3-yl]-2-(3-methoxy-propylamino)-4-(-
4-methyl-piperazin-1-yl)-benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-(3-methoxy-propylamino)-phenyl]
cpd. 36
##STR00056##
[0564] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.80 (quin, J=6.49
Hz, 2H) 2.24 (s, 3H) 2.42-2.47 (m, 4H) 3.16-3.21 (m, 2H) 3.23 (s,
3H) 3.26-3.32 (m, 4H) 3.41 (t, J=6.16 Hz, 2H) 4.04 (s, 2H) 6.07 (d,
J=2.19 Hz, 1H) 6.24 (dd, J=9.02, 2.19 Hz, 1H) 6.95-7.00 (m, 2H)
6.99-7.04 (m, 1H) 7.24 (dd, J=8.66, 1.59 Hz, 1H) 7.41 (d, J=8.54
Hz, 1H) 7.51 (s, 1H) 7.80 (d, J=9.15 Hz, 1H) 8.19 (t, J=5.12 Hz,
1H) 10.07 (s, 1H) 12.62 (s, 1H)
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-yl)-be-
nzamide [(I.sub.A), R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-phenyl] cpd. 4
##STR00057##
[0566] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.23 (s, 3H)
2.44-2.49 (m, 4H) 3.28-3.32 (m, 4H) 4.05 (s, 2H) 6.90-7.00 (m, 3H)
7.02 (d, J=9.15 Hz, 2H) 7.24 (dd, J=8.66, 1.59 Hz, 1H) 7.41 (d,
J=0.49 Hz, 1H) 7.59 (s, 1H) 7.97 (d, J=9.02 Hz, 2H) 10.39 (s, 1H)
12.67 (s, 1H)
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-2-((R)-2-methoxy-1-methyl-ethy-
lamino)-4-(4-methyl-piperazin-1-yl)-benzamide [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2((R)-2-methoxy-1-methyl-ethylamino)-pheny-
l] cpd. 32
##STR00058##
[0568] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.14 (d, J=6.34
Hz, 3H) 2.2.3 (s, 3H) 2.41-2.47 (m, 4H) 3.24-3.31 (m, 4H) 3.27 (s,
3H) 3.32-3.40 (m, 2H) 3.74-3.83 (m, 1H) 4.05 (s, 2H) 6.13 (d,
J=12.19 Hz, 1H) 6.24 (dd, J=9.02, 2.20 Hz, 1H) 6.94-7.04 (m, 3H)
7.2.5 (dd, J=8.66, 1.59 Hz, 1H) 7.41 (d, J=8.54 Hz, 1H) 7.49 (s,
1H) 7.78 (d, J=9.02 Hz, 1H) 8.20 (d, J=7.68 Hz, 1H) 10.04 (s, 1H)
12.63 (s, 1H)
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-2-(2-methoxy-ethylamino)-4-(4--
methyl-piperazin-1-yl)-benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-(2-methoxy-ethylamino)-phenyl]
cpd. 26
##STR00059##
[0570] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.25 (s, 3H)
2.44-2.49 (m, 4H) 3.26 (s, 3H) 3.27-3.31 (m, 6H) 3.54 (t, J=5.37
Hz, 2H) 4.05 (s, 2H) 6.09 (d, J=1.95 Hz, 1H) 6.25 (dd, J=8.96, 2.01
Hz, 1H) 6.94-7.00 (m, 2H) 6.99-7.05 (m, 1H) 7.24 (dd, J=8.60, 1.52
Hz, 1H) 7.41 (d, J=8.66 Hz, 1H) 7.51 (s, 1H) 7.79 (d, J=9.15 Hz,
1H) 8.23 (t, J=5.12 Hz, 1H) 10.06 (s, 1H) 12.63 (s, 1H)
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-4-[(3-dimethylamino-propyl)-me-
thyl-amino]-2-nitro-benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4[(3-dimethylamino-propyl)-methyl-amino]-2-nitro-phenyl] cpd.
59
##STR00060##
[0572] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.68 (m, 2H) 2.15
(m, 6H) 2.25 (t, J=6.58 Hz, 2H) 3.02 (s, 3H) 3.48 (t, J=7.07 Hz,
2H) 4.05 (s, 2H) 6.93-7.05 (m, 4H) 7.19 (d, J=2.44 Hz, 1H) 7.26
(dd, J=8.54, 1.46 Hz, 1H) 7.42 (d, J=8.54 Hz, 1H) 7.62 (s, 1H) 7.68
(bs, 1H) 10.73 (s, 1H) 12.69 (s, 1H)
2-Cyclohexylamino-N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl--
piperazin-1-yl)-benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-cyclohexylamino-phenyl] cpd.
18
##STR00061##
[0574] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 12.61 (s, 1H)
10.04 (s, 1H) 8.26 (d, 1H) 7.77 (d, 1H) 7.48 (s, 1H) 7.40 (d, 1H)
7.25 (dd, 1H) 6.90-7.00 (m, 3H) 6.21 (dd, 1H) 6.08 (d, 1H) 4.03 (s,
2H) 3.45 (m, 1H) 3.25 (m, 4H) 2.45 (bs, 4H) 2.24 (s, 3H) 1.88-1.23
(m, 10H)
N-{5-[1-(3,5-Difluoro-phenyl)-ethyl]-1H-indazol-3-yl}-4-(4-methyl-piperazi-
n-1-yl)-2-(tetrahydro-pyran-4-ylamino)-benzamide [(ID),
R1=R2=R3=R'=H, R=3,5-difluorophenyl, R'=methyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-(tetrahydro-pyran-4-ylamino)-phenyl]
cpd. 75
##STR00062##
[0576] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.29-1.43 (m, 2H)
1.60 (d, J=7.19 Hz, 3H) 1.89-1.99 (m, 2H) 2.29 (br. s., 3H)
2.45-2.57 (m, 4H) 3.22-3.38 (m, 4H) 3.45-3.55 (m, 2H) 3.64-3.76 (m,
1H) 3.78-3.85 (m, 2H) 4.31 (q, J=7.40 Hz, 1H) 6.15 (d, J=1.95 Hz,
1H) 6.25 (dd, J=8.90, 2.19 Hz, 1H) 6.94-7.06 (m, 3H) 7.28 (dd,
J=8.78, 1.59 Hz, 1H) 7.40 (d, J=8.54 Hz, 1H) 7.52 (s, 1H) 7.81 (d,
J=9.15 Hz, 1H) 8.32 (d, J=7.68 Hz, 1H) 10.09 (s, 1H) 12.62 (s,
1H)
[0577] Single enantiomers have been obtained by preparative
chiral-HPLC by using Daicel Chiralpak AD 250.times.20 mm 10 .mu.m
as column system and hexane/2-propanol 40:60 as eluant.
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-[(1-methoxy-2-methylpropan-2--
yl)amino]-4-(4-methylpiperazin-1-yl)benzamide [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-[(1-methoxy-2-methylpropan-2-yl)amino]-p-
henyl] cpd. 34
##STR00063##
[0579] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.31 (s, 6H) 2.27
(br. s., 3H) 2.50 (m, 4H) 3.26 (m, 7H) 3.35 (s, 2H) 4.05 (s, 2H)
6.27 (dd, J=9.02, 2.32 Hz, 1H) 6.31 (d, J=2.32 Hz, 1H) 6.93-7.05
(m, 3H) 7.25 (dd, J=8.60, 1.52 Hz, 1H) 7.41 (d, J=8.54 Hz, 1H)
7.51-7.53 (m, 1H) 7.76 (d, J=8.90 Hz, 1H) 8.26 (s, 1H) 10.14 (s,
1H) 12.63 (s, 1H)
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-2(2-methoxy-1-methoxymethyl-et-
hylamino)-4-(4-methyl-piperazin-1-yl)-benzamide [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-(2-methoxy-1-methoxymethyl-ethylamino)-p-
henyl] cpd. 16
##STR00064##
[0581] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.42 (br. s., 3H)
4.70 (br. s., 4H) 3.26 (s, 6H) 3.30 (m, 4H) 3.41 (d, J=5.00 Hz, 4H)
3.85 (m, J=8.17, 5.00, 5.00, 5.00, 5.00 Hz, 1H) 4.04 (s, 2H) 6.20
(d, J=1.95 Hz, 1H) 6.26 (dd, J=8.96, 2.01 Hz, 1H) 6.94-7.04 (m, 3H)
7.24 (dd, J=8.66, 1.46 Hz, 1H), 7.41 (d, J=8.54 Hz, 1H) 7.48 (br.
s., 1H) 7.79 (d, J=9.02 Hz, 1H) 8.32 (d, J=8.29 Hz, 1H) 10.06 (s,
1H) 12.64 (s, 1H)
2-Benzylamino-N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-pipe-
razin-1-yl)-benzamide [(I.sub.A), R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2benzylamino-phenyl] cpd. 24
##STR00065##
[0583] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.22 (s, 3H) 2.41
(br. s., 4H) 3.19-3.24 (m, 4H) 4.04 (s, 2H) 4.39 (d, J=5.49 Hz, 2H)
6.09 (d, J=2.19 Hz, 1H) 6.26 (dd, J=9.02, 2.32 Hz, 1H) 6.92-6.98
(m, 2H) 6.98-7.04 (m, 1H) 7.21-7.27 (m, 2H) 7.30-7.36 (m, 2H)
7.36-7.39 (m, 2H) 7.40 (d, J=9.02 Hz, 1H) 7.51 (s, 1H) 7.81 (d,
J=9.02 Hz, 1H) 8.60 (t, J=5.55 Hz, 1H) 10.11 (s, 1H) 12.63 (s,
1H)
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-2-(2-fluoro-ethylamino)-4-(4-m-
ethyl-piperazin-1-yl)-benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2(2-fluoro-ethylamino)-phenyl] cpd.
38
##STR00066##
[0585] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.24 (s, 3H)
2.43-2.48 (m, 4H) 3.26-3.31 (m, 4H) 3.49 (dq, J=27.68, 5.12 Hz, 2H)
4.04 (s, 2H) 4.60 (dt, J=47.68, 4.76 Hz, 2H) 6.12 (d, J=2.23 Hz,
1H) 6.28 (dd, J=8.99, 2.23 Hz, 1H) 6.94-7.00 (m, 2H) 6.99-7.04 (m,
1H) 7.24 (dd, J=8.57, 1.52 Hz, 1H) 7.41 (d, J=8.57 Hz, 1H) 7.51 (s,
1H) 7.81 (d, J=8.99 Hz, 1H) 8.37 (t, J=5.43 Hz, 1H) 10.11 (s, 1H)
12.63 (s, 1H)
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-2-(2-fluoro-propylamino)-4-(4--
methyl-piperazin-1-yl)-benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-(2-fluoro-propylamino)-phenyl]
cpd. 40
##STR00067##
[0587] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.86-2.04 (m, 2H)
2.26 (br. s., 3H) 2.48 (br. s., 4H) 3.21-3.37 (m, 6H) 4.04 (s, 2H)
4.44-4.66 (dt, J=47.43, 5.73 Hz, 2H) 6.09 (d, J=1.95 Hz, 1H) 6.26
(dd, J=9.02, 2.20 Hz, 1H) 6.94-7.05 (m, 3H) 7.25 (dd, J=8.60, 1.40
Hz, 1H) 7.41 (d, J=8.66 Hz, 1H) 7.50 (d, J=1.71 Hz, 1H) 7.81 (d,
J=9.02 Hz, 1H) 8.22 (t, J=5.24 Hz, 1H) 10.09 (s, 1H) 12.63 (s,
1H)
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-4-[(3-dimethylamino-propyl)-me-
thyl-amino]-2-(tetrahydro-pyran-4-ylamino)-benzamide [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-[(3-dimethylamino-propyl)-methyl-amino]-2-(tetrahydro-pyran-4-ylamin-
o)-phenyl] cpd. 55
##STR00068##
[0589] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.32-1.44 (m, 2H)
1.67 (quin, J=6.98 Hz, 2H) 1.93-1.98 (m, 2H) 2.17 (s, 6H) 2.26 (t,
J=6.65 Hz, 2H) 2.96 (s, 3H) 3.36-3.43 (m, 2H) 3.44-3.53 (m, 2H)
3.58-3.69 (m, 1H) 3.79-3.87 (m, 2H) 4.05 (s, 2H) 5.87 (d, J=2.19
Hz, 1H) 6.04 (dd, J=9.02, 2.32 Hz, 1H) 6.96-7.05 (m, 3H) 7.25 (dd,
J=8.60, 1.52 Hz, 1H) 7.41 (d, J=8.54 Hz, 1H) 7.49 (s, 1H) 7.77 (d,
J=9.15 Hz, 1H) 8.35 (d, J=7.32 Hz, 1H) 9.96 (s, 1H) 12.60 (s,
1H)
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-yl)-2--
phenylamino-benzamide [(I.sub.A), R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-phenylamino-phenyl] cpd. 42
##STR00069##
[0591] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.24 (s, 3H) 2.46
(br. s., 4H) 3.22 (br. s., 4H) 4.05 (s, 2H) 6.53 (dd, J=9.02, 2.19
Hz, 1H) 6.74 (d, J=2.32 Hz, 1H) 6.95-7.02 (m, 4H) 7.19 (d, J=7.56
Hz, 2H) 7.25 (dd, J=8.66, 1.46 Hz, 1H) 7.29-7.35 (m, 2H) 7.40-7.44
(m, 1H) 7.55 (s, 1H) 7.91 (d, J=9.15 Hz, 1H) 10.03 (s, 1H) 10.39
(s, 1H) 12.69 (s, 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(4-methyl-1,4-diazepan-1-yl)--
2-(tetrahydro-2H-pyran-4-ylamino)benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(4-methyl-1,4-diazepan-1-yl)-2-(tetrahydro-pyran-4-ylamino)-phenyl]
cpd. 89
##STR00070##
[0593] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.31-1.42. (m, 2H)
1.83-1.98 (m, 4H) 2.28 (s, 3H) 2.44-2.49 (m, 2H) 2.63 (d, J=4.51
Hz, 2H) 3.44-3.59 (m, 6H) 3.65 (d, J=11.46 Hz, 1H) 3.78-3.85 (m,
2H) 4.04 (s, 2H) 5.87 (d, J=2.32 Hz, 1H) 6.05 (dd, J=9.08, 2.26 Hz,
1H) 6.96-7.04 (m, 3H) 7.25 (dd, J=8.59, 1.52 Hz, 1H) 7.41 (d,
J=8.53 Hz, 1H) 7.49 (s, 1H) 7.77 (d, J=9.14 Hz, 1H) 8.36 (d, J=7.68
Hz, 1H) 9.96 (s, 1H) 12.60 (s, 1H)
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-4-[(2-dimethylamino-ethyl)-met-
hyl-amino]-2-(tetrahydro-pyran-4-ylamino)-benzamide [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-[(2-dimethylamino-ethyl)-methyl-amino]-2-(tetrahydro-pyran-4-ylamino-
)-phenyl] cpd. 90
##STR00071##
[0595] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.32-1.43 (m, 2H)
1.96 (d, 1H) 2.19-2.22 (m, 6H) 2.40 (t, J=7.19 Hz, 2H) 2.98 (s, 3H)
3.41-3.51 (m, 4H) 3.56-3.65 (m, 1H) 3.80-3.87 (m, 2H) 4.04 (s, 2H)
5.87 (d, J=2.32 Hz, 1H) 6.02 (dd, J=9.08, 2.38 Hz, 1H) 6.96-7.04
(m, 3H) 7.25 (dd, J=8.59, 1.52 Hz, 1H) 7.41 (d, J=8.53 Hz, 1H) 7.49
(s, 1H) 7.78 (d, J=9.14 Hz, 1H) 8.35 (d, J=7.31 Hz, 1H) 9.97 (s,
1H) 12.60 (s, 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-[4-(dimethylamino)piperidin-1-
-yl]-2-(tetrahydro-2H-pyran-4-ylamino)benzamide [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-[4-(dimethylamino)piperidin-1-yl]-2-(tetrahydro-pyran-4-ylamino)-phe-
nyl] cpd. 91
##STR00072##
[0597] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.43 (m, 4H) 1.82
(d, J=12.32 Hz, 2H) 1.93 (dq, J=12.74, 2.77 Hz, 2H) 2.20 (s, 6H)
2.29 (m, 1H) 2.78 (td, J=12.38, 2.19 Hz, 2H) 3.49 (ddd, J=11.86,
9.91, 2.26 Hz, 2H) 3.62-3.72 (m, 1H) 3.81 (dt, J=11.74, 4.07 Hz,
2H) 3.87 (d, J=12.56 Hz, 2H) 4.04 (s, 2H) 6.12 (d, J=2.19 Hz, 1H)
6.23 (dd, J=8.96, 2.26 Hz, 1H) 6.99 (m, 3H) 7.25 (dd, J=8.60, 1.52
Hz, 1H) 7.40 (d, J=8.54 Hz, 1H) 7.48 (br. s., 1H) 7.78 (d, J=9.15
Hz, 1H) 8.28 (d, J=7.56 Hz, 1H) 10.05 (s, 1H) 12.61 (s, 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-[(2S)-2-(pyrrolidin-1-ylmethy-
l)pyrrolidin-1-yl]-2-(tetrahydro-2H-pyran-4-ylamino)benzamide
[(I.sub.A), R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-[(2S)-2-(pyrrolidin-1-ylmethyl)pyrrolidin-1-yl]-2-(tetrahydro-pyran--
4-ylamino)-phenyl] cpd. 92
##STR00073##
[0599] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.36 (m, 2H) 1.72
(m, 4H) 1.99 (m, 6H) 2.43 (m, 3H) 2.63 (m, 2H) 3.16 (m, 2H)
3.39-3.47 (m, 3H) 3.58 (br. s., 1H) 3.82-3.90 (m, 2H) 3.90 (br. s.,
1H) 4.04 (s, 2H) 5.82 (d, J=1.59 Hz, 1H) 5.90 (dd, J=8.90, 2.07 Hz,
1H) 6.98 (m, 3H) 7.24 (dd, J=8.60, 1.52 Hz, 1H) 7.40 (d, J=8.90 Hz,
1H) 7.48 (br. s., 1H) 7.77 (d, J=9.02 Hz, 1H) 8.36 (d, J=7.32 Hz,
1H) 9.95 (s, 1H) 12.60 (s, 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-3-(4-methylpiperazin-1-yl)benza-
mide [(I.sub.A), R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=3-(4-methylpiperazin-1-yl)phenyl] cpd. 93
##STR00074##
[0601] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.26 (s, 3H)
2.47-2.54 (m, 4H) 3.22-3.27 (m, 4H) 4.06 (s, 2H) 6.92-6.99 (m, 2H)
6.99-7.06 (m, 1H) 7.15-7.20 (m, 1H) 7.26 (dd, J=8.66, 1.59 Hz, 1H)
7.36 (t, J=7.93 Hz, 1H) 7.42-7.45 (m, 1H) 7.47 (d, J=7.80 Hz, 1H)
7.60-7.63 (m, 2H) 10.65 (s, 1H) 12.73 (s, 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(piperazin-1-yl)-2-(tetrahydr-
o-2H-pyran-4-ylamino)benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(piperazin-1-yl)-2-(tetrahydro-2H-pyran-4-ylamino)phenyl] cpd.
98
##STR00075##
[0603] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.30-1.41 (m, 2H)
1.88-2.01 (m, 2H) 2.81-2.88 (m, 4H) 3.17-3.22 (m, 4H) 3.45-3.54 (m,
2H) 3.62-3.73 (m, 1H) 3.78-3.85 (m, 2H) 4.05 (s, 2H) 6.12 (d,
J=2.19 Hz, 1H) 6.23 (dd, J=8.96, 2.26 Hz, 1H) 6.94-7.04 (m, 3H)
7.26 (dd, J=8.65, 1.58 Hz, 1H) 7.39-7.43 (m, 1H) 7.49 (s, 1H) 7.80
(d, J=9.02 Hz, 1H) 8.29 (d, J=7.68 Hz, 1H) 10.07 (s, 1H) 12.63 (s,
1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(4-methylpiperazin-1-yl)-2-{[-
cis-4-(trifluoromethyl)cyclohexyl]amino}benzamide [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-{[cis-4-(trifluoromethyl)cyclohexyl]amin-
o}phenyl] cpd. 99
##STR00076##
[0605] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.39-1.53 (m, 2H)
1.58-1.73 (m, 4H) 1.84-1.91 (m, 2H) 2.25 (s, 3H) 2.28-2.40 (m, 1H)
2.47 (br. s., 4H) 3.25-3.33 (m, 4H) 3.82-3.90 (m, 1H) 4.01 (s, 2H)
6.10 (d, J=1.95 Hz, 1H) 6.24 (dd, J=9.15, 2.19 Hz, 1H) 6.90-6.96
(m, 2H) 6.96-7.03 (m, 1H) 7.24 (dd, J=8.60, 1.52 Hz, 1H) 7.42 (d,
J=8.54 Hz, 1H) 7.52 (s, 1H) 7.83 (d, J=9.02 Hz, 1H) 8.69 (d, J=7.80
Hz, 1H) 10.10 (s, 1H) 12.65 (s, 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(4-methylpiperazin-1-yl)-2-{[-
trans-4-(trifluoromethyl)cyclohexyl]amino}benzamide [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-{[trans-4-(trifluoromethyl)cyclohexyl]am-
ino}phenyl] cpd. 100
##STR00077##
[0607] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.10-1.23 (m, 2H)
1.44-1.57 (m, 2H) 1.86-1.94 (m, 2H) 2.06-2.15 (m, 2H) 2.25 (s, 3H)
2.29-2.34 (m, 1H) 2.46 (br. s., 4H) 3.24-3.31 (m, 4H) 3.39-3.51 (m,
1H) 4.05 (s, 2H) 6.15 (d, J=2.07 Hz, 1H) 6.23 (dd, J=8.90, 2.07 Hz,
1H) 6.95-7.00 (m, 2H) 7.00-7.06 (m, 1H) 7.25 (dd, J=8.60, 1.52 Hz,
1H) 7.41 (d, J=8.54 Hz, 1H) 7.48 (s, 1H) 7.78 (d, J=9.02 Hz, 1H)
8.14 (d, J=8.05 Hz, 1H) 10.05 (s, 1H) 12.62 (s, 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-fluoro-4-(4-methylpiperazin-1-
-yl)benzamide [(I.sub.A), R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-fluoro-phenyl] cpd. 101
##STR00078##
[0609] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.26 (s, 3H)
2.45-2.50 (m, 4H) 3.29-3.36 (m, 4H) 4.06 (s, 2H) 6.78-6.89 (m, 2H)
6.94-6.98 (m, 2H) 6.98-7.06 (m, 1H) 7.25 (dd, J=8.54, 1.59 Hz, 1H)
7.42 (d, J=8.66 Hz, 1H) 7.64 (s, 1H) 7.68 (t, J=8.90 Hz, 1H) 10.08
(d, J=3.41 Hz, 1H) 12.68 (s, 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-[(1-methylpiperidin-4-yl)amin-
o]benzamide [(I.sub.A), R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=2-[(1-methylpiperidin-4-yl)amino]-phenyl] cpd. 110
##STR00079##
[0611] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.35-1.49 (m, H)
1.94 (d, H) 2.20 (br. s., 5H) 2.60-2.73 (m, 2H) 3.38-3.47 (m, 1H)
4.05 (s, 2H) 6.58-6.64 (m, 1H) 6.80 (d, J=8.29 Hz, 1H) 6.95-7.00
(m, 2H) 7.00-7.05 (m, 1H) 7.27 (dd, J=8.65, 1.58 Hz, 1H) 7.32-7.37
(m, 1H) 7.44 (d, J=8.53 Hz, 1H) 7.53 (s, 1H) 7.85-7.88 (m, 1H) 7.89
(dd, J=8.05, 1.34 Hz, 1H) 10.44 (s, 1H) 12.72 (s, 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-[(1-methylpiperidin-4-yl)amin-
o]-4-(morpholin-4-yl)benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(morpholin-4-yl)-2-[(1-methylpiperidin-4-yl)amino]-phenyl]
cpd. 111
##STR00080##
[0613] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.38-1.50 (m, 2H)
1.91-2.01 (m, 2H) 2.27 (m, 5H) 2.72 (m, 2H) 3.20-3.26 (m, 4H) 3.50
(br. s., 1H) 3.72-3.78 (m, 4H) 4.05 (s, 2H) 6.11 (d, J=2.19 Hz, 1H)
62.5 (dd, J=9.08, 2.13 Hz, 1H) 6.92-7.08 (m, 3H) 7.26 (dd, J=8.59,
1.52 Hz, 1H) 7.42 (d, J=8.53 Hz, 1H) 7.50 (s, 1H) 7.8 (d, J=9.02
Hz, 1H) 8.28 (d, J=7.31 Hz, 1H) 10.10 (s, 1H) 12.64 (s, 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-methoxy-4-(4-methylpiperazin--
1-yl)benzamide [(I.sub.A), R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin1-yl)-2-methoxy-amino}phenyl] cpd. 112
##STR00081##
[0615] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.25 (s, 3H) 2.47
(br. s., 4H) 3.33-3.38 (m, 4H) 4.02 (s, 3H) 4.06 (s, 2H) 6.63 (d,
J=195 Hz, 1H) 6.67 (dd, J=8.96, 2.13 Hz, 1H) 6.96 (dd, J=8.72, 2.13
Hz, 2H) 6.99-7.05 (m, 1H) 7.24 (dd, J=8.66, 1.59 Hz, 1H) 7.40 (d,
J=8.66 Hz, 1H) 7.76 (s, 1H) 7.88 (d, J=8.78 Hz, 1H) 9.99 (s, 1H)
12.65 (s, 1H)
N-[5-(2,5-Difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-yl)-2--
(tetrahydro-pyran-4-ylamino)-benzamide [(I.sub.A), R1=R2=R3=H,
R=2,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-(tetrahydro-pyran-1-ylamino)-phenyl]
cpd. 10
##STR00082##
[0617] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.29-1.42 (m, 2H)
1.90-1.98 (m, 2H) 2.27 (br. s., 3H) 2.49 (br. s., 4H) 3.24-3.32 (m,
4H) 3.45-3.56 (m, 2H) 3.64-3.74 (m, 1H) 3.82 (ddd, J=11.80, 3.96,
3.75 Hz, 2H) 4.04 (s, 2H) 6.14 (d, J=1.83 Hz, 1H) 6.24 (dd, J=8.90,
1.95 Hz, 1H) 7.04-7.12 (m, 1H) 7.15-7.23 (m, 2H) 7.24-7.27 (m, 1H)
7.41 (d, J=8.66 Hz, 1H) 7.46 (s, 1H) 7.80 (d, J=9.02 Hz, 1H) 8.30
(d, J=7.68 Hz, 1H) 10.08 (s, 1H) 12.63 (s, 1H)
N-[5-(2-methyl-5-fluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-y-
l)-2-(tetrahydro-pyran-4-ylamino)-benzamide [(I.sub.A), R1=R2=R3=H,
R=2-methyl-5-fluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-(tetrahydro-pyran-4-ylamino)-phenyl]
cpd. 135
##STR00083##
[0619] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.29-1.41 (m, 2H)
1.94 (dd, J=13.35, 2.86 Hz, 2H) 2.22 (s, 3H) 2.25 (s, 3H) 2.46 (br.
s., 4H) 3.24-3.30 (m, 4H) 3.46-3.54 (m, 2H) 3.63-3.73 (m, 1H)
3.78-3.86 (m, 2H) 4.03 (s, 2H) 6.13 (d, J=1.95 Hz, 1H) 6.23 (dd,
J=9.02, 2.07 Hz, 1H) 6.89-6.98 (m, 2H) 7.14-7.21 (m, 2H) 7.38 (s,
1H) 7.41 (d, J=8.65 Hz, 1H) 7.79 (d, J=9.02 Hz, 1H) 8.31 (d, J=7.80
Hz, 1H) 10.07 (s, 1H) 12.61 (s, 1H)
N-[5-(2-fluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-yl)-2-(tet-
rahydro-pyran-4-ylamino)-benzamide [(I.sub.A), R1=R2=R3=H,
R=2-fluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-(tetrahydro-pyran-4-ylamino)-phenyl]
cpd. 9
##STR00084##
[0621] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.29-1.42 (m, 2H)
1.89-1.98 (m, 2H) 2.24 (s, 3H) 2.45 (br. s., 4H) 3.24-3.30 (m, 4H)
3.47-3.55 (m, 2H) 3.64-3.74 (m, 1H) 3.77-3.87 (m, 2H) 4.04 (s, 2H)
6.14 (d, J=2.19 Hz, 1H) 6.24 (dd, J=8.96, 2.26 Hz, 1H) 6.95-7.02
(m, 1H) 7.04-7.09 (m, 1H) 7.10 (d, J=7.56 Hz, 1H) 7.24 (dd, J=8.66,
1.46 Hz, 1H) 7.31 (td, J=7.80, 6.34 Hz, 1H) 7.40 (d, J=8.53 Hz, 1H)
7.46 (s, 1H) 7.79 (d, J=9.02 Hz, 1H) 8.28 (d, J=7.80 Hz, 1H) 10.07
(s, 1H) 12.61 (s, 1H)
4-(4-methylpiperazin-1-yl)-N-[5-(pyridin-3-ylmethyl)-1H-indazol-3-yl]-2-(t-
etrahydro-2H-pyran-4-ylamino)benzamide [(I.sub.A), R1=R2=R3=H,
R=pyridin-3-yl,
Ar=4-(4-methyl-piperazin-1-yl)-2-(tetrahydro-pyran-4-ylamino)-phenyl]
cpd. 136
##STR00085##
[0623] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.30-1.42(m, 2H)
1.95 (d, 2H) 2.26 (s, 3H) 2.47 (br. s., 4H) 3.25-3.30 (m, 4H)
3.47-3.54 (m, 2H) 3.64-3.74 (m, 1H) 3.79-3.86 (m, 2H) 4.05 (s, 2H)
6.14 (d, J=2.07 Hz, 1H) 6.24 (dd, J=8.90, 2.19 Hz, 1H) 7.24 (dd,
J=8.60, 1.52 Hz, 1H) 7.29 (ddd, J=7.80, 4.76, 0.73 Hz, 1H) 7.41 (d,
J=8.90 Hz, 1H) 7.47 (s, 1H) 7.63 (dt, J=7.87, 1.92 Hz, 1H) 7.79 (d,
J=9.15 Hz, 1H) 8.27 (d, J=7.80 Hz, 1H) 8.39 (dd, J=4.76, 1.59 Hz,
1H) 8.52 (d, J=1.71 Hz, 1H) 10.07 (s, 1H) 12.62 (s, 1H)
N-[5-benzyl-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-yl)-2-(tetrahydro-pyr-
an-4-ylamino)-benzamide [(I.sub.A), R1=R2=R3=H, R=phenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-(tetrahydro-pyran-4-ylamino)-phenyl]
cpd. 137
##STR00086##
[0625] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.31-1.42 (m, 2H)
1.90-1.99 (m, 2H) .2.24 (s, 3H) 2.42-2.47 (m, 4H) 3.24-3.31 (m, 4H)
3.46-3.55 (m, 2H) 3.64-3.76 (m, 1H) 3.78-3.87 (m, 2H) 4.01 (s, 2H)
6.14 (d, J=2.07 Hz, 1H) 6.24 (dd, J=8.96, 2.26 Hz, 1H) 7.17-7.27
(m, 6H) 7.38 (d, J=8.90 Hz, 1H) 7.44 (s, 1H) 7.79 (d, J=9.02 Hz,
1H) 8.28 (d, J=7.68 Hz, 1H) 10.05 (s, 1H) 12.59 (s, 1H).
EXAMPLE 3
Step r
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-2,2,2-trifluoro-acetamide
[(XXIV.sub.A), R1=R2=R3=H, R=3,5-difluorophenyl,
PG.sub.1=trifluoroacethyl]
[0626] To a suspension of
5-(3,5-difluoro-benzyl)-1H-indazol-3-ylamine (0.5 g, 1.93 mmol) in
anhydrous dichloromethane (20 mL), under vigorous stirring and
cooled to 0.degree. C., trifluoroacetic anhydride was added
dropwise and the dense slurry was stirred for 3.5 hours. The
reaction mixture was poured into 3% NaHCO.sub.3 solution and
extracted with dichloromethane. The organic layer was washed with
brine, dried over Na.sub.2SO.sub.4 and concentrated to yield a
crude white solid that was directly used in the next step.
[0627] ESI (+) MS m/z 356 (100, MH.sup.+); HRMS (ESI) calcd for
C.sub.16H.sub.10F.sub.5N.sub.3O+H.sup.+356,0817 found 356.0820
Step s
N-[5-(3,5-Difluoro-benzyl)-1-trityl-1H-indazol-3-yl]-2,2,2-trifluoro-aceta-
mide [(XXV.sub.A), R1=R2=R3=H, R=3,5-difluorophenyl,
PG=triphenylmethyl, PG.sub.1=trifluoroacethyl]
[0628] Crude
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-2,2,2-trifluoro-acetamide
was suspended in dichloromethane (25 mL) and treated with trityl
chloride (0.72 g, 2.58 mmol) under stirring. The suspension was
cooled to 0.degree. C. and neat 1,8-diazabicyclo[5.4.0]undec-7-ene
(0.42 mL, 2.78 mmol) was added, producing immediate solubilization.
After stirring at 0.degree. C. for 3 hours the reaction mixture was
poured into 50 mL of ice containing 1N HCl (5 mL) and extracted
with dichloromethane. The organic layer was washed with
NaHCO.sub.3, brine, dried and concentrated to a crude material that
was purified by flash chromatography (eluant: DCM). The desired
product was obtained as a white solid (450 mg, yield 40% over two
steps)
[0629] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 3.98 (s, 2H) 6.34
(d, J=8.78 Hz, 1H) 6.93-7.07 (m, 4H) 7.16-7.20 (m, 6H) 7.25-7.39
(m, 9H) 7.52 (s, 1H) 11.99 (s, 1H)
Step t
5-(3,5-Difluoro-benzyl)-1-trityl-1H-indazol-3-ylamine
[(XXVI.sub.A), R1=R2=R3=H, R=3,5-difluorophenyl,
PG=triphenylmethyl]
[0630]
N-[5-(3,5-Difluoro-benzyl)-1-trityl-1H-indazol-3-yl]-2,2,2-trifluor-
o-acetamide (450 mg, 0.75 mmol) was dissolved in methanol (6 mL)
and triethylamine (1.5 mL) and the solution was refluxed for 3
hours. The solvents were removed under reduced pressure and the
residue was purified by flash chromatography (eluant: DCM). Title
compound was isolated as white foam (300 mg, yield 80%).
[0631] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 3.91 (s, 2H) 5.53
(s, 2H) 6.24 (d, J=8.78 Hz, 1H) 6.87-6.93 (m, 3H) 6.97-7.07 (m, 1H)
7.17-7.23 (m, 3H) 7.27 (t, J=7.50 Hz, 6H) 7.34 (d, J=1.59 Hz, 6H)
7.48 (s, 1H)
Step u
N-[5-(3,5-Difluoro-benzyl)-1-trityl-1H-indazol-3-yl]-4-(4-methyl-piperazin-
-1-yl)-2-nitro-benzamide [(XXII.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-nitro-phenyl,
PG=triphenylmethyl]
[0632] 4-(4-Methyl-piperazin-1-yl)-2-nitro-benzoic acid (150 mg,
0.5 mmol) was suspended in anhydrous dichloromethane (10 mL), a
drop of DMF was added, followed by oxalyl chloride (0.2 mL, 2
mmol). After stirring at room temperature for 2 hours the mixture
was thoroughly dried under reduced pressure to give the acyl
chloride as a white powder. 120 mg of the acyl chloride (0.4 mmol)
were dissolved in anhydrous tetrahydrofuran (3 mL) and
5-(3,5-difluoro-benzyl)-1-trityl-1H-indazol-3-ylamine (200 mg, 0.4
mmol) was added. The resulting solution was cooled to 0.degree. C.
under stifling. After addition of diisopropyethylamine (0.2 mL, 1.2
mmol), the reaction mixture was stirred for 18 hours, while
temperature was gradually increasing from 0.degree. C. to room
temperature. After evaporation of the volatiles, the crude residue
was purified by flash chromatography (eluant: DCM/MeOH 10:1). Title
compound was isolated as a bright yellow solid (200 mg, yield
67%).
[0633] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.24 (s, 3H) 2.45
(br. s., 4H) 3.31-3.39 (m, 4H) 3.96 (s, 2H) 6.29 (br. s., 1H) 6.98
(m, 4H) 7.29 (m, 17H) 7.58 (s, 1H) 7.70 (br. s., 1H) 10.96 (br. s.,
1H)
Step i''
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-yl)-2--
nitro-benzamide hydrochloride [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-nitro-phenyl] cpd. 6
##STR00087##
[0635] To a solution of
N-[5-(3,5-difluoro-benzyl)-1-trityl-1H-indazol-3-yl]-4-(4-methyl-piperazi-
n-1yl)-2-nitro-benzamide (28.5 mg, 0.04 mmol) in dioxane (1 mL), 4
M HCl in dioxane (0.1 mL) was added and the mixture was stirred at
room temperature for 1 hour. After concentration the residue was
suspended in diethyl ether/MeOH 1:1, stirred for 20 min., filtered,
washed with the same solvent mixture and dried. The desired product
was obtained as hydrochloride derivative (19 mg, 87%).
[0636] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.85 (d, J=4.02
Hz, 3H) 3.08-3.31 (m, 4H) 3.53 (d, J=11.71 Hz, 2H) 4.06 (s, 2H)
4.13 (d, J=13.17 Hz, 2H) 6.91-6.99 (m, 2H) 6.99-7.08 (m, 1H) 7.26
(dd, J=8.54, 1.34 Hz, 1H) 7.37 (d, J=6.95 Hz, 1H) 7.43 (d, J=8.66
Hz, 1H) 7.58 (br. s., 1H) 7.64 (s, 1H) 7.78 (d, J=7.44 Hz, 1H)
10.39 (br. s., 1H) 10.91 (br. s., 1H) 12.74 (br. s., 1H)
[0637] Operating in an analogous way, the following compound was
obtained:
2-Amino-N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin--
1-yl)-benzamide hydrochloride [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-amino-phenyl] cpd. 8
##STR00088##
[0639] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.84 (d, J=4.39
Hz, 3H) 3.05-3.20 (m, 4H) 3.44-3.53 (m, 2H) 3.85-3.94 (m, 2H) 4.05
(s, 2H) 6.30 (d, J=1.95 Hz, 1H) 6.36 (dd, J=8.96, 2.13 Hz, 1H)
6.93-7.00 (m, 2H) 6.99-7.05 (m, 1H) 7.24 (dd, J=8.66, 1.46 Hz, 1H)
7.41 (d, J=8.41 Hz, 1H) 7.53 (s, 1H) 7.81 (d, J=9.02 Hz, 1H) 10.11
(br. s., 1H) 10.37 (br. s., 1H) 12.66 (br. s., 1H)
EXAMPLE 4
[0640] Conversion 1
2-Amino-N-[5-(3,5-difluoro-benzyl)-1-trityl-1H-indazol-3-yl)]-4-(4-methyl--
piperazin-1-yl)-benzamide [(XXII.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-amino-phenyl,
PG=triphenylmethyl]
[0641] A mixture of
N-[5-(3,5-difluoro-benzyl)-1-trityl-1H-indazol-3-yl]-4-(4-methyl-piperazi-
n-1-yl)-2-nitro-benzamide (170 mg, 0.236 mmol), 10% Pd-C (10 mg)
and ammonium formate (25 mg, 0.4 mmol) in methanol (5 mL) was
stirred for 18 hours at room temperature. The catalyst was filtered
off and the solution was concentrated. The residue was dissolved in
dichloromethane, washed with aqueous solution of NaHCO.sub.3, dried
and concentrated to yield title compound (145 mg, 87%).
[0642] ESI (+) MS m/z 243 (100, trityl.sup.+), 719 (16, MH.sup.-);
HRMS (ESI) calcd for
C.sub.45H.sub.40F.sub.2N.sub.6O+H.sup.+719.3304 found 719.3309
[0643] Operating in an analogous way, the following compounds were
obtained:
2-Amino-N-[5-(3-ethoxy-benzoyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-y-
l)-benzamide [(II), R1=R2=R3=H, R=3-ethoxyphenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-amino-phenyl]
[0644] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.33 (t, J=6.95
Hz, 3H) 2.22 (s, 3H) 2.40-2.45 (m, 4H) 3.16-3.22 (m, 4H) 4.09 (q,
J=6.95 Hz, 2H) 6.17 (d, J=2.44 Hz, 1H) 6.23 (dd, J=9.02, 2.44 Hz,
1H) 6.53 (s, 2H) 7.18 (ddd, J=8.23, 2.62, 0.85 Hz, 1H) 7.24 (dd,
J=2.44, 1.46 Hz, 1H) 7.29 (dt, J=7.68, 1.10 Hz, 1H) 7.44 (t, J=7.93
Hz, 1H) 7.59 (dd, J=8.84, 0.55 Hz, 1H) 7.71 (d, J=9.15 Hz, 1H) 7.83
(dd, J=8.78, 1.59 Hz, 1H) 8.20 (br. s., 1H) 10.30 (s, 1H) 13.05 (s,
1H)
2-Amino-N-[5-(3,5-difluoro-benzoyl)-4H-indazol-3-yl]-4-(4-methyl-piperazin-
-1-yl)-benzamide [(II), R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-amino-phenyl]
[0645] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.30 (br. s., 3H)
2.56 (m, 4H) 3.22 (m, 4H) 6.18 (d, J=2.32 Hz, 1H) 6.24 (dd, J=9.08,
2.38 Hz, 1H) 6.57 (s, 2H) 7.42 (m, 2H) 7.54 (tt, J=9.15, 2.38 Hz,
1H) 7.61 (dd, J=8.90, 0.61 Hz, 1H) 7.73 (d, J=9.02 Hz, 1H) 7.83
(dd, J=8.84, 1.65 Hz, 1H) 8.26 (d, J=0.98 Hz, 1H) 10.36 (s, 1H)
13.11 (s, 1H)
EXAMPLE 5
[0646] Conversion 2+step i''
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-2-methanesulfonylamino-4-(4-me-
thyl-piperazin-1-yl)-benzamide hydrochloride [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-methanesulfonylamino-phenyl] cpd.
48
##STR00089##
[0648] To a solution of
2-amino-N-[5-(3,5-difluoro-benzyl)-1-trityl-1H-indazol-3-yl]-4-(4-methyl--
piperazin-1-yl)-benzamide (29 mg, 0.04 mmol) in anhydrous
dichloromethane mL) and dry pyridine (0.05 mL), methanesulfonyl
chloride (14.7 mg, 0.01 mL, 0.13 mmol) was added and the reaction
mixture was stirred at room temperature for 8 hours. The mixture
was poured into ice and was extracted with dichloromethane. The
organic layer was washed with 0.1N HCl, then with water, dried over
anhydrous Na.sub.2SO.sub.4 and concentrated to yield a crude
whitish solid that was suspended in dioxane (1 mL). After adding 4M
HCl in dioxane (0.1 mL) the suspension was stirred overnight. After
concentration the residue was suspended in diethyl ether/MeOH 1:1,
stirred for 20 min., filtered, washed with the same solvent mixture
and dried. The desired product was obtained as the hydrochloride
(15 mg, 0.025 mmol, 63%).
[0649] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.86 (d, J=4.27
Hz, 3H) 3.17 (s, 3H) 3.14-3.27 (m, 4H) 3.55 (m, 2H) 4.02 (m, 2H)
4.06 (s, 2H) 6.92 (dd, J=9.02, 2.32 Hz, 1H) 6.97-7.03 (m, 3H) 7.05
(d, J=2.56 Hz, 1H) 7.28 (dd, J=8.66, 1.46 Hz, 1H) 7.45 (d, J=8.54
Hz, 1H) 7.55 (s, 1H) 8.12 (d, J=9.15 Hz, 1H) 10.56 (s, 1H) 10.76
(s, 1H) 11.42 (s, 1H) 12.84 (s, 1H)
[0650] Operating in an analogous way, the following compounds were
obtained:
N-[2-{[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]carbamoyl}-5-(4-methylpipera-
zin-1-yl)phenyl]-1H-pyrrole-2-carboxamide hydrochloride [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-(4-methylpiperazin-1-yl)-2-(1H-pyrrole-2-carbamoyl)-phenyl]
cpd. 44
##STR00090##
[0652] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.74 (br. s., 3H)
4.04 (s, 2H) 6.09 (dt, J=3.60, 2.41 Hz, 1H) 6.65 (dt, J=3.87, 1.78
Hz, 1H) 6.82 (dd, J=9.02, 2.32 Hz, 1H) 6.97 (m, 4H) 7.2.8 (dd,
J=8.66, 1.46 Hz, 1H) 7.46 (d, J=8.66 Hz, 1H) 7.59 (br. s., 1H) 8.09
(d, J=9.15 Hz, 1H) 8.38 (d, J=2.44 Hz, HI) 9.99 (br. s., 1H) 10.71
(s, 1H) 11.69 (br. s., 1H) 12.51 (s, 1H) 12.82. (s, 1H)
EXAMPLE 6
[0653] Conversion 4
2-Amino-N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin--
1-yl)-benzamide [(I.sub.A), R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin1-yl)-2-amino-phenyl] cpd. 8
##STR00091##
[0655] A mixture of
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-yl)-2-
-nitro-benzamide (3.21 g, 6.33 mmol), cyclohexene (20 mL), dioxane
(200 mL) and 10% Pd/C (0.8 g) was stirred at 100.degree. C. for 2
hours. The reaction mixture was filtered over a celite pad washing
thoroughly with THF and MeOH. After evaporation of the organic
phase, purification of the crude by chromatography over silica gel
(DCM/MeOH 95/5) gave 2.51 g of title compound (83% yield).
[0656] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.23 (s, 3H) 2.44
(br. s., 4H) 3.20 (t, J=4.76 Hz, 4H) 4.04 (s, 2H) 6.18 (d, J=2.44
Hz, 1H) 6.24 (dd, J=8.96, 2.38 Hz, 1H) 6.53 (s, 2H) 6.97 (m, 3H)
7.22 (dd, J=8.66, 1.59 Hz, 1H) 7.39 (d, J=8.66 Hz, 1H) 7.52 (br.
s., 1H) 7.72 (d, J=9.02 Hz, 1H) 10.01 (s, 1H) 12.60 (s, 1H)
[0657] Operating in an analogous way, the following compounds were
obtained:
2-Amino-4-[(3-dimethylamino-propyl)-methyl-amino]-N-[5-(3-ethoxy-benzyl)-1-
H-indazol-3-yl]-benzamide [(I.sub.A), R1=R2=R3=H, R=3-ethoxyphenyl,
Ar=4-[(3-dimethylamino-propyl)-methyl-amino]-2-amino-phenyl]
cpd.54
##STR00092##
[0659] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.27 (t, J=6.95
Hz, 3H) 1.67 (d, J=7.19 Hz, 2H) 2.19 (s, 6H) 2.28 (t, J=6.04 Hz,
2H) 2.90 (s, 3H) 3.24-3.40 (m, 2H) 3.96 (q, J=6.95 Hz, 2H) 3.95 (s,
2H) 5.94 (d, J=2.56 Hz, 1H) 6.04 (dd, J=9.02, 2.56 Hz, 1H) 6.52 (s,
2H) 6.68-6.72 (m, 1H) 6.76-6.79 (m, 1H) 6.77 (s, 1H) 7.13-7.17 (m,
1H) 7.18 (dd, J=8.60, 1.65 Hz, 1H) 7.33-7.38 (m, 1H) 7.47 (s, 1H)
7.69 (d, J=9.02 Hz, 1H) 9.88 (s, 1H) 12.53 (s, 1H)
2-amino-N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[(2S)-2-(pyrrolidin--
1-ylmethyl)pyrrolidin-1-yl]carbonyl}benzamide
[0660] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 3.29-3.48 (m, 2H)
4.06 (s, 2H) 4.29 (br. s., 1H) 6.63 (br. s., 3H) 6.85 (br. s.,
6.92-7.05 (m, 3H) 7.26 (dd, J=8.66, 1.34 Hz, 1H) 7.43 (d, J=8.54
Hz, 1H) 7.57 (s, 1H) 7.85 (d, J=8.17 Hz, 1H) 10.46 (s, 1H) 12.72
(s, 1H)
2-amino-N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[(2R)-2-(pyrrolidin--
1-ylmethyl)pyrrolidin-4-yl]carbonyl}benzamide
[0661] ESI(+) MS: m/z 559 (MH.sup.+).
2-amino-N.sup.1-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-N.sup.4-[2-(dimet-
hylamino)ethyl]-N.sup.4-methylbenzene-1,4-dicarboxamide
[0662] ESI(+) MS: m/z 507 (MH.sup.+).
2-amino-N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[4-(propan-2-yl)pipe-
razin-1-yl]carbonyl}benzamide
[0663] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 0.99 (d, J=6.46
Hz, 6H) 2.43 (m, 4H) 2.70 (d, 1H) 3.58 (m, 4H) 4.06 (s, 2H) 6.54
(dd, J=8.05, 1.46 Hz, 1H) 6.65 (s, 2H) 6.75 (d, J=1.46 Hz, 1H)
6.92-7.01 (m, 2H) 6.99-7.05 (m, 1H) 7.2.6 (dd, J=8.59, 1.52 Hz, 1H)
7.43 (d, J=8.65 Hz, 1H) 7.57 (s, 1H) 7.85 (d, J=8.17 Hz, 1H) 10.45
(s, 1H) 12.71 (s, 1H)
2-amino-N.sup.1-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-N.sup.4-[2-(dimet-
hylamino)ethyl]benzene-1,4-dicarboxamide
[0664] ESI(+) MS: m/z 493 (MH.sup.+).
2-amino-N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-[(4-methylpiperazin-1-
-yl)carbonyl]benzamide
[0665] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 4.06 (s, 2H) 6.60
(d, J=8.29 Hz, 1H) 6.68 (s, 2H) 6.80 (d, J=1.46 Hz, 1H) 6.93-7.00
(m, 2H) 7.00-7.06 (m, 1H) 7.2.6 (dd, J=8.53, 1.58 Hz, 7.44 (d,
J=8.65 Hz, 1H) 7.55 (s, 1H) 7.88 (d, J=8.17 Hz, 1H) 10.48 (s, 1H)
12.73 (s, 1H)
2-amino-N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[4-(dimethylamino)pi-
peridin-1-yl]carbonyl}benzamide
[0666] ESI(+) MS: m/z 533 (MH.sup.+).
2-amino-N.sup.1-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-N.sup.4-(1-methyl-
piperidin-4-yl)benzene-1,4-dicarboxamide
[0667] ESI(+) MS: m/z 519 (MH.sup.+).
EXAMPLE 7
[0668] Conversion 6
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-yl)-2--
(tetrahydro-pyran-4-ylamino)-benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-(tetrahydro-pyran-4-ylamino)-phenyl]
cpd. 11
##STR00093##
[0670] To a solution of
2-amino-N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-
-1-yl)-benzamide (1.9 g, 3.98 mmol) in dichloromethane (80 mL) were
added tetrahydro-pyran-4-one (0.55 mL, 5.98 mmol), trifluoroacetic
acid (4 mL) and tetramethylammonium triacetoxyborohydride (1.57 g,
5.98 mmol). The mixture was stirred at room temperature overnight,
and then more tetramethylammonium triacetoxyborohydride (1.57 g)
was added. After stirring for additional 3 hours at room
temperature the mixture was diluted with dichloromethane, washed
with 2N sodium hydroxide and brine, dried over sodium sulfate and
evaporated to dryness. The crude was purified by flash
chromatography on silica gel using
dichloromethane/methanol/NH.sub.3 5N in MeOH 96:4:0.5 as the
eluant, affording 1.61 g of the title compound (72% yield).
[0671] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.26-1.43 (m, 2H)
1.86-2.02 (m, 2H) 2.2.3 (s, 3H) 2.42-2.46 (m, 4H) 3.23-3.29 (m, 4H)
3.45-3.54 (m, 2H) 3.62-3.75 (m, 1H) 3.82 (dt, J=11.61, 3.83 Hz, 2H)
4.05 (s, 2H) 6.14 (d, J=2.07 Hz, 1H) 6.24 (dd, J=8.90, 2.19 Hz, 1H)
6.94-7.06 (m, 3H) 7.26 (dd, J=8.66, 1.46 Hz, 1H) 7.41 (d, J=8.66
Hz, 1H) 7.50 (d, 1H) 7.80 (d, J=9.15 Hz, 1H) 8.29 (d, J=7.68 Hz,
1H) 10.08 (s, 1H) 12.63 (s, 1H)
N-{5-[(3,5-Difluoro-phenyl)-methoxy-methyl]-1H-indazol-3-yl}-4-(4-methyl-p-
iperazin-1-yl)-2-(tetrahydro-pyran-4-ylamino)-benzamide [(I.sub.C),
R1=R2=R3=H, R=3,5-difluorophenyl, R'=methyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-(tetrahydro-pyran-4-ylamino)-phenyl]
cpd. 68
##STR00094##
[0673] Title compound was isolated as a by-product (about 15%)
during preparative HPLC purification of the mixed fractions
resulted from column chromatography purification of the previously
reported preparation of
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-yl)-2-
-(tetrahydro-pyran-4-ylamino)-benzamide
[0674] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.31-1.44 (m, 2H)
1.91-2.01 (m, 2H) 2.79 (br. s., 3H) 3.32 (m, 11H) 3.45-3.56 (m, 2H)
3.68-3.78 (m, 1H) 3.80-3.88 (m, 2H) 5.48 (s, 1H)) 6.22 (d, J=2.07
Hz, 1H) 6.30 (d, J=9.02 Hz, 1H) 7.04-7.12 (m, 3H) 7.32 (dd, J=8.78,
1.46 Hz, 1H) 7.45 (d, J=8.90 Hz, 1H) 7.64 (s, 1H) 7.86 (d, J=9.02
Hz, 1H) 8.35 (d, J=7.80 Hz, 1H) 10.20 (s, 1H) 12.73 (s, 1H)
[0675] Operating in an analogous way, the following compounds were
obtained:
2-[(2-{[tert-butyl
(dimethyl)silyl]oxy}ethyl)amino]-N-[5-(3,5-difluorobenzyl)-1H-indazol-3-y-
l]-4-(4-methylpiperazin-1-yl)benzamide
[0676] ESI(+) MS: m/z 635 (MH.sup.+).
tert-butyl
3-({[2-{[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]carbamoyl}-5-(4-
-methylpiperazin-1-yl)phenyl]amino}methyl)azetidine-1-carboxylate
[0677] ESI(+) MS: m/z 646 (MH.sup.+).
1-[4-{[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]carbamoyl}-3-(tetrahydro-2H--
pyran-4-ylamino)benzyl]piperidine trifluoroacetate [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-piperidin-1-ylmethyl-2-(tetrahydro-pyran-4-ylamino)-phenyl]
cpd. 115
##STR00095##
[0679] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.32-1.46 (m, 3H)
1.65-1.93 (m, 5H) 1.96-2.04 (m, 2H) 2.81-2.96 (m, 2H) 3.32 (br. s.,
2H) 3.44-3.54 (m, 2H) 3.63-3.74 (m, 1H) 3.82-3.91 (m, 2H) 4.06 (s,
2H) 4.23 (d, J=5.37 Hz, 2H) 6.75-6.81 (m, 1H) 6.94-7.06 (m, 2H)
7.13 (s, 1H) 7.29 (dd, J=8.66, 1.46 Hz, 1H) 7.45 (d, J=8.54 Hz, 1H)
7.50 (s, 1H) 7.96 (d, J=8.05 Hz, 1H) 8.00 (br. s., 1H) 10.14 (br.
s., 1H) 10.54 (s, 1H) 12.77 (br. s., 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[(2-methoxyethyl)(methyl)ami-
no]methyl}-2-(tetrahydro-2H-pyran-4-ylamino)benzamide [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-{[(2-methoxyethyl)(methyl)amino]methyl)-2-(tetrahydro-pyran-4-ylamin-
o)-phenyl] cpd. 116
##STR00096##
[0681] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.31-1.45 (m, 2H)
1.95 (d, J=11.83 Hz, 2H) 2.22. (s, 3H) 2.52-2.57 (m, 2H) 3.26 (s,
3H) 3.43-3.53 (m, 6H) 3.64 (dd, J=6.95, 2.93 Hz, 1H) 3.80-3.88 (m,
2H) 4.05 (s, 2H) 6.58 (d, J=7.93 Hz, 1H) 6.79 (s, 1H) 6.95-7.06 (m,
3H) 7.27 (dd, J=8.66, 1.46 Hz, 1H) 7.43 (d, J=8.54 Hz, 1H) 7.52 (s,
1H) 7.86 (d, J=8.05 Hz, 1H) 7.96 (d, J=7.56 Hz, 1H) 10.39 (s, 1H)
12.71 (s, 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(pyrrolidin-1-ylmethyl)-2-(te-
trahydro-2H-pyran-4-ylamino)benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(pyrrolidin-1-ylmethyl)-2-(tetrahydro-pyran-4-ylamino) phenyl]
cpd. 117
##STR00097##
[0683] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.31-1.45 (m, 2H)
1.67-1.78 (m, 4H) 1.90-1.98 (m, 2H) 2.47 (br. s., 2H) 3.44-3.54 (m,
2H) 3.56 (br. s., 4H) 3.59-3.71 (m, 1H) 3.83 (dt, J=11.65, 3.69 Hz,
2H) 4.05 (s, 2H) 6.59 (d, J=8.66 Hz, 1H) 6.77 (s, 1H) 6.92-7.07 (m,
3H) 7.27 (dd, J=8.66, 1.59 Hz, 1H) 7.42 (d, J=0.49 Hz, 1H) 7.52 (s,
1H) 7.85 (d, J=8.17 Hz, 1H) 7.95 (d, J=7.80 Hz, 1H) 10.39 (s, 1H)
12.71 (s, 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(morpholin-4-ylmethyl)-2-(tet-
rahydro-2H-pyran-4-ylamino)benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(morpholin-4-ylmethyl)-2-(tetrahydro-pyran-4-ylamino)-phenyl]
cpd. 118
##STR00098##
[0685] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.30-1.44 (m, 2H)
1.88-2.01 (m, 2H) 2.39 (br. s., 4H) 3.45-3.46 (m, 2H) 3.46-3.54 (m,
2H) 3.61 (br. s., 4H) 3.65 (d, 1H) 3.84 (d, J=12.32 Hz, 2H) 4.05
(s, 2H) 6.60 (d, J=8.41 Hz, 1H) 6.79 (s, 1H) 6.89-7.09 (m, 3H) 7.28
(dd, J=8.72, 1.16 Hz, 1H) 7.43 (d, J=8.78 Hz, 1H) 7.51 (s, 1H) 7.87
(d, J=8.05 Hz, 1H) 7.95 (d, J=7.80 Hz, 1H) 10.40 (s, 1H) 12.71 (s,
1H)
b
4-(azetidin-1-ylmethyl)-N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-(te-
trahydro-2H-pyran-4-ylamino)benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(azetidin-1-ylmethyl)-2-(tetrahydro-pyran-4-ylamino)-phenyl]
cpd. 119
##STR00099##
[0687] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.31-1.43 (m, 2H)
1.90-1.98 (m, 2H) 1.98-2.06 (m, 2H) 3.15 (t, J=6.95 Hz, 4H)
3.46-3.54 (m, 4H) 3.61-3.70 (m, 1H) 3.79-3.88 (m, 2H) 4.05 (s, 2H)
6.53 (dd, J=8.11, 1.16 Hz, 1H) 6.72 (s, 1H) 6.94-7.05 (m, 3H) 7.27
(dd, J=8.60, 1.52. Hz, 1H) 7.43 (d, J=8.66 Hz, 1H) 7.51 (s, 1H)
7.83 (d,
[0688] J=8.17 Hz, 1H) 7.94 (d, J=7.80 Hz, 1H) 10.38 (s, 1H) 12.70
(s, 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[(2S)-2-(pyrrolidin-1-ylmeth-
yl)pyrrolidin-1-yl]carbonyl)-2-(tetrahydro-2H-pyran-4-ylamino)benzamide
[(I.sub.A), R1=R2=R3=H, R=3,5difluorophenyl,
Ar=4-{[(2S)-2-(pyrrolidin-1-ylmethyl)pyrrolidin-1-yl]carbonyl}-2-(tetrahy-
dro-pyran-4-ylamino)-phenyl] cpd. 127
##STR00100##
[0690] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): ppm 3.44-3.56 (m,
2H) 3.61-3.75 (m, 1H) 3.78-3.88 (m, 2H) 4.06 (s, 2H) 4.26 (br. s.,
1H) 6.66 (s, 1H) 6.83 (s, 6.95-7.06 (m, 3H) 7.2.8 (dd, J=8.66, 1.46
Hz, 1H) 7.44 (d, J=8.78 Hz, 1H) 7.53 (s, 1H) 7.93 (d, J=8.17 Hz,
1H) 7.97 (br. s., 1H) 10.55 (s, 1H) 12.75 (s, 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[(2R)-2-(pyrrolidin-1-ylmeth-
yl)pyrrolidin-1-yl]carbonyl}-2-(tetrahydro-2H-pyran-1-ylamino)benzamide
[(I.sub.A), R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-{[(2R)-2-(pyrrolidin-1-ylmethyl)pyrrolidin-1-yl]carbonyl}-2-(tetrahy-
dro-pyran-4-ylamino)-phenyl] cpd. 128
##STR00101##
[0692] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): ppm 3.44-3.56 (m,
2H) 3.61-3.75 (m, 1H) 3.78-3.88 (m, 2H) 4.06 (s, 2H) 4.26 (br. s.,
1H) 6.66 (s, 1H) 6.83 (s, 1H) 6.95-7.06 (m, 3H) 7.28 (dd, J=8.66,
1.46 Hz, 1H) 7.44 (d, J=8.78 Hz, 1H) 7.53 (s, 1H) 7.93 (d, J=8.17
Hz, 1H) 7.97 (br. s., 1H) 10.55 (s, 1H) 12.75 (s, 1H)
N.sup.1-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-N-.sup.4-[2-(dimethylamin-
o)ethyl]-N.sup.4-methyl-2-(tetrahydro-2H-pyran-4-ylamino)benzene-1,4-dicar-
boxamide [(I.sub.A), R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-({N-[2-(dimethylamino)ethyl]-N-methyl}carbonyl)-2-(tetrahydro-pyran--
4-ylamino)-phenyl] cpd. 129
##STR00102##
[0694] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): mixture of
rotamers 1.31-1.44 (m, 2H) 1.87-1.97 (m, 2H) 3.45-3.52 (m, 2H)
3.62-3.72 (m, 1H) 3.79-3.88 (m, 2H) 406 (s, 2H) 6.56 (d, J=7.68 Hz,
1H) 6.76 (br. s., 1H) 6.95-7.05 (m, 3H) 7.28 (dd, J=8.59, 1.52 Hz,
1H) 7.44 (d, J=8.65 Hz, 1H) 7.54 (s, 1H) 7.91-7.99 (m, 2H) 10.56
(s, 1H) 12.75 (s, 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[4-(propan-2-yl)piperazin-1--
yl]carbonyl}-2-(tetrahydro-2H-pyran-4-ylamino)benzamide [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-{[4-(propan-2-yl)piperazin-1-yl]carbonyl}-2-(tetrahydro-pyran-4-ylam-
ino)-phenyl] cpd. 130
##STR00103##
[0696] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 0.99 (d, J=6.46
Hz, 6H) 1.32-1.43 (m, 2H) 1.89-1.97 (m, 2H) 2.36-2.54 (m, 4H)
2.66-2.75 (m, 1H) 3.28-3.37 (m, 2H) 3.49 (td, J=11.18, 2.13 Hz, 2H)
3.61 (br. s., 2H) 3.65-3.74 (m, 1H) 3.80-3.87 (m, 2H) 4.06 (s, 2H)
6.58 (dd, J=7.98, 1.28 Hz, 1H) 6.77 (d, J=0.85 Hz, 1H) 6.95-7.05
(m, 3H) 7.28 (dd, J=8.59, 1.52 Hz, 1H) 7.44 (d, J=8.65 Hz, 1H) 7.53
(s, 1H) 7.91-7.95 (m, 1H) 7.94-7.96 (m, 1H) 10.56 (s, 1H) 12.75 (s,
1H)
N.sup.1-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-N.sup.4-[2-(dimethylamino-
)ethyl]-2-(tetrahydro-2H-pyran-4-ylamino)benzene-1,4-dicarboxamide
[(I.sub.A), R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-({N-[2-(dimethylamino)ethyl]}carbonyl)-2-(tetrahydro-pyran-4-ylamino-
)-phenyl] cpd. 131
##STR00104##
[0698] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.33-1.47 (m, 2H)
1.93-2.00 (m, 2H) 2.30 (br. s., 6H) 2.51-2.60 (m, 2H) 3.37-3.44 (m,
2H) 3.46-3.54 (m, 2H) 3.73 (d, 1H) 3.85 (dt, J=11.61, 3.76 Hz, 2H)
4.06 (s, 2H) 6.95-7.05 (m, 3H) 7.07 (dd, J=8.17, 1.46 Hz, 1H) 7.23
(d, J=1.22 Hz, 1H) 7.28 (dd, J=8.65, 1.58 Hz, 1H) 7.44 (d, J=8.53
Hz, 1H) 7.54 (s, 1H) 7.93 (d, J=7.68 Hz, 1H) 7.96 (d, J=8.29 Hz,
1H) 8.47 (t, J=4.94 Hz, 1H) 10.60 (s, 1H) 12.76 (s, 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-[(4-methylpiperazin-1-yl)carb-
onyl]-2-(tetrahydro-2H-pyran-4-ylamino)benzamide [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-[(4-methylpiperazin-1-yl)carbonyl]-2-(tetrahydro-pyran-4-ylamino)-ph-
enyl] cpd. 132
##STR00105##
[0700] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.32-1.43 (m, 2H)
1.93 (d, J=11.70 Hz, 2H) 2, (s, 3H) 2.33 (m, 4H) 3.45-3.53 (m, 2H)
3.65-3.73 (m, 1H) 3.80-3.86 (m, 2H) 4.06 (s, 2H) 6.57 (dd, J=7.98,
1.28 Hz, 1H) 6.77 (d, J=0.98 Hz, 1H) 6.96-7.05 (m, 3H) 7.28 (dd,
J=8.59, 1.52 Hz, 1H) 7.44 (d, J=8.53 Hz, 1H) 7.52 (s, 1H) 7.92-7.95
(m, 1H) 7.94-7.97 (m, 1H) 10.56 (s, 1H) 12.75 (s, 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[4-(dimethylamino)piperidin--
1-yl]carbonyl}-2-(tetrahydro-2H-pyran-4-ylamino)benzamide
[(I.sub.A), R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-{[4-(dimethylamino)piperidin-1-yl]carbonyl}-2-(tetrahydro-pyran-4-yl-
amino)-phenyl] cpd. 133
##STR00106##
[0702] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.25-1.46 (m, 4H)
1.73 (m, 1H) 1.84 (m, 1H) 1.93 (d, J=11.46 Hz, 2H) 2.20 (s, 6H)
2.34 (m, 1H) 2.82 (m, 1H) 3.04 (m, 1H) 3.42-3.55 (m, 2H) 3.65-3.76
(m, 2H) 3.78-3.88 (m, 2H) 4.06 (s, 2H) 4.43 (m, 1H) 6.58 (dd,
J=8.05, 1.34 Hz, 1H) 6.78 (d, J=0.85 Hz, 1H) 6.94-7.06 (m, 3H) 7.28
(dd, J=8.65, 1.58 Hz, 1H) 7.44 (d, J=8.53 Hz, 1H) 7.53 (s, 1H)
7.90-7.96 (m, 2H) 10.55 (s, 1H) 12.74 (s, 1H)
N.sup.1-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-N.sup.4-(1-methylpiperidi-
n-4-yl)-2-(tetrahydro-2H-pyran-4-ylamino)benzene-1,4-dicarboxamide
[(I.sub.A), R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-[N-(1-methylpiperidin-4-yl)-carbonyl]-2-(tetrahydro-pyran-4-ylamino)-
-phenyl] cpd. 134
##STR00107##
[0704] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.32-1.47 (m,
1.56-1.70 (m, 2H) 1.74-1.83 (m, 2H) 1.92-1.99 (m, 2H) 2.02 (br. s.,
2H) 2.21 (s, 3H) 2.82 (d, J=13.17 Hz, 2H) 3.46-3.54 (m, 2H)
3.67-3.80 (m, 2H) 3.79-3.88 (m, 2H) 4.06 (s, 2H) 6.96-7.05 (m, 3H)
7.08 (dd, J=8.17, 1.46 Hz, 1H) 7.21 (d, J=1.22 Hz, 1H) 7.28 (dd,
J=8.65, 1.46 Hz, 1H) 7.42-7.46 (m, 1H) 7.54 (s, 1H) 7.92-7.97 (m,
2H) 8.26 (d, J=7.80 Hz, 1H) 10.60 (s, 1H) 12.77 (s, 1H).
EXAMPLE 8
Preparation of tert-butyl
4-1[(28)-1-methylpyrrolidin-2-yl]methoxy)-2-nitrobenzoate
[0705] In a round bottomed three neck flask under argon atmosphere
were added toluene (15 ml), CsCO.sub.3 (1.6 gr, 5 mmol), phosphine
ligand 2-(di-tert-butylphosphino)-1,1'-binaphthyl (331 mg, 0.83
mmol) and Pd(dba).sub.2 (380 mgr, 0.66 mmol). The mixture was
degassed bubbling argon for five minutes. Then
4-bromo-2-nitrobenzoic acid tert butyl ester (1 gr, 3.31 mmol) and
(S)-(+)-1-methyl-2-pyrrolidinemethanol (0.78 ml, 6.62 mmol) were
added and the mixture was heated to 100.degree. C. for 18 hr. The
reaction was cooled to room temperature, quenched with 30 ml of
water and extracted twice with 25 ml of AcOEt. The organic phases
were collected, dried over Na.sub.2SO.sub.4 and the solvents
evaporated to obtain a red oil which was subjected to
chromatography purification on a Biotage SP1 automated system
(90:10 DCM/MeOH (isocratic) to yield the pure title compound as a
yellowish oil (460 mgr, 1.36 mmol, 41% yield).
[0706] ESI(+) MS: m/z 337 (MH.sup.+).
[0707] Operating in an analogous way, the following compounds were
obtained:
tert-butyl 4-[(1-methylpiperidin-4-yl)oxy]-2-nitrobenzoate
[0708] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.48 (9H, s) 1.68
(m, 2H) 1.95 (m, 2H) 2.20 (m, 5H) 2.61 (m, 2H) 4.60 (m, 1H) 7.30
(dd, J=8.78, 2.56 Hz, 1H) 7.54 (d, J=2.56 Hz, 1H) 7.79 (d, J=8.78
Hz, 1H)
tert-butyl 4-[2-(dimethylamino)ethoxy]-2-nitrobenzoate
[0709] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.49 (9H, s) 2.22
(s, 6H) 2.65 (t, J=5.61 Hz, 2H) 4.21 (t, J=5.63 Hz, 2H) 7.30 (dd,
J=8.78, 2.56 Hz, 1 7.52 (d, J=2.56 Hz, 1H) 7.80 (d, J=8.78 Hz,
1H)
tert-butyl
4-{[(3S)-1-methylpyrrolidin-3-yl]oxy}-2-nitrobenzoate
[0710] ESI(+) MS: m/z 323 (MH.sup.+).
Preparation of tert-butyl
2-amino-4-{[(2S)-1-methylpyrrolidin-2-yl]methoxy}benzoate
[0711] Nitro-derivative tert-butyl
4-{[(2S)-1-methylpyrrolidin-2-yl]methoxy}-2-nitrobenzoate (460 mgr,
1.37 mmol) was dissolved in 20 ml of MeOH, 130 mg of Pd/C 5% and
700 mg (6.3 mmol) of HCOONH.sub.4 were added under argon
atmosphere. The mixture was refluxed at 80.degree. C. for 1 hr then
cooled to room temperature and filtered through a small pad of
celite washing with MeOH. The solvent was then distilled off and
the residue was dissolved in 20 ml of DCM and washed twice with 20
ml of NaHCO.sub.3 (10%). The collected organic extracts were dried
over Na.sub.2SO.sub.4, filtered and evaporated to dryness to yield
a brown oil (400 mgr, 1.31 mmol, 95% yield), which was used in the
next step without any further purification.
[0712] ESI(+) MS: m/z 307 (MH.sup.+).
[0713] Operating in an analogous way, the following compounds were
obtained:
tert-butyl 2-amino-4-[(1-methylpiperidin-4-yl)oxy]benzoate
[0714] ESI(+) MS: m/z 307 (MH.sup.+).
tert-butyl 2-amino-4-[2-(dimethylamino)ethoxy]benzoate
[0715] 1NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.51 (s, 9H) 2.21
(s, 6H) 2.61 (t, J=5.79 Hz, 2H) 4.00 (t, J=5.79 Hz, 2H) 6.11 (dd,
J=8.96, 2.50 Hz, 1H) 6.25 (d, J=2.56 Hz, 1H) 6.60 (s, 2H) 7.56 (d,
J=8.90 Hz, 1H)
tert-butyl
2-amino-4-{[(3S)-1-methylpyrrolidin-3-yl]oxy}benzoate
[0716] ESI(+) MS: m/z 293 (MH.sup.+).
Preparation of tert-butyl
4-{[(2S)-1-methylpyrrolidin-2-yl]methoxy}-2-(tetrahydro-2H-pyran-4-ylamin-
o)benzoate
[0717] Tert-butyl
2-amino-4-{[(2S)-1-methylpyrrolidin-2-yl]methoxy}benzoate (400 mg,
1.3 mmol) was dissolved in 20 ml of DCM under argon atmosphere.
Tetrahydro-4H-pyran-4-one (0.19 ml, 2.05 mmol), TFA (0.29 ml, 3.69
mmol) and Me.sub.4BH(OAc).sub.3, (540 mg, 2.05 mmol) were added.
The resulting slurry was stirred overnight at room temperature then
quenched with 15 ml of NaHCO.sub.3 10% and extracted twice with 20
ml of DCM. The organic layers were then dried over
Na.sub.2SO.sub.4, filtered off and concentrated to yield a yellow
oil (448 mg, 1.15 mmol, 88%) which was used in the next step
without any further purification.
[0718] ESI(+) MS: m/z 391 (MH.sup.+).
[0719] Operating in an analogous way, the following compounds were
obtained:
tert-butyl
4-[(1-methylpiperidin-4-yl)oxy]-2-(tetrahydro-2H-pyran-4-ylamin-
o)benzoate
[0720] ESI(+) MS: m/z 391 (MH.sup.+).
tert-butyl
4-[2-(dimethylamino)ethoxy]-2-(tetrahydro-2H-pyran-4-ylamino)be-
nzoate
[0721] ESI(+) MS: m/z 365 (MH.sup.+).
tert-butyl
4-{[(4S)-1-methylpyrrolidin-3-yl]oxy}-2-(tetrahydro-2H-pyran-4--
ylamino)benzoate
[0722] ESI(+) MS: m/z 377 (MH.sup.+).
Preparation of tert-butyl
4-{[(2S)-1-methylpyrrolidin-2-yl]methoxy}-2-[tetrahydro-2H-pyran-4-yl(tri-
fluoroacetyl)amino]benzoate
[0723] Tert-butyl
4-{[(2S)-1-methylpyrrolidin-2-yl]methoxy}-2-(tetrahydro-2H-pyran-4-ylamin-
o)benzoate (448 mg, 1.15 mmol) was dissolved in 20 ml of DCM. TEA
(0.18 ml, 1.3 mmol) and TFAA (0.27 ml, 1.7 mmol) were added and the
reaction mixture was stirred at room temperature for 2 hours and
quenched with 15 ml of NaHCO.sub.3 10%. The resulting mixture was
extracted twice with 20 ml of DCM, dried over Na.sub.2SO.sub.4,
filtered and concentrated under vacuum. The crude product was
subjected to silica gel chromatographic purification (DCM/MeOH
95:5) to yield a yellow oil (481mg, 1 mmol, 87%).
[0724] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.00 (qd, J=12.25
, 4.82 Hz, 1H) 1.47 (s, 9h) 1.51-1.64 (m, 1H) 1.98 (d, J=12.68 Hz,
2H) 3.83 (ddd, J=31.46, 11.34, 4.02 Hz, 2H) 4.51 (tt, J=11.95, 3.90
Hz, 1H) 7.02 (br. s., 1H) 7.21 (d, J=6.95 Hz, 1H) 7.95 (d, J=8.78
Hz, 1H)
[0725] Operating in an analogous way, the following compounds were
obtained:
tert-butyl
4-[(1-methylpiperidin-4-yl)oxy]-2-[tetrahydro-2H-pyran-4-yl(tri-
fluoroacetyl)amino]benzoate
[0726] ESI(+) MS: m/z 487 (MH.sup.+).
tert-butyl
4-[2-(dimethylamino)ethoxy]-2-[tetrahydro-2H-pyran-4-yl(trifluo-
roacetyl)amino[benzoate
[0727] ESI(+) MS: m/z 461 (MH.sup.+).
tert-butyl
4-{[(3S)-1-methylpyrrolidin-3-yl]oxy}-2-[tetrahydro-2H-pyran-4--
yl(trifluoroacetyl)amino]benzoate
[0728] ESI(+) MS: m/z 473 (MH.sup.+).
Preparation of
4-{[(2S)-1-methylpyrrolidin-2-yl]methoxy}-2-(tetrahydro-2H-pyran-4-yl(tri-
fluoroacetyl)amino]benzoic acid trifluoroacetate
[0729] Tert-butyl
4-{[(2S)-1-methylpyrrolidin-2-yl]methoxy}-2-[tetrahydro-2H-pyran-4-yl(tri-
fluoroacetyl)amino]benzoate (480 mg, 1 mmol) was dissolved in 20 ml
of DCM. Anhydrous HCl 4M in dioxane was added (2.5 ml, 10 mmol).
The reaction was stirred at room temperature for 5 days after that
the HPLC analysis showed the formation of the desired product but
with almost 30% of the detrifluoroacetylated by-product. Solvents
were removed under vacuum and the resulting yellow powder was
suspended in 15 ml of DCM and TFAA (0.28 ml, 2 mmol) was added. The
solid immediately dissolved and the mixture was stirred for 2 hours
after that the HPLC analysis showed the complete disappearance of
the by product. Solvents were evaporated to dryness to yield a dark
yellow solid which was used in the next synthetic step without any
further purification.
[0730] ESI(+) MS: m/z 431 (MH.sup.+).
[0731] Operating in an analogous way, the following compounds were
obtained:
tert-butyl
4-[(1-methylpiperidin-4-yl)oxy]-2-[tetrahydro-2H-pyran-4-yl(tri-
fluoroacetyl)amino]benzoic acid trifluoroacetate
[0732] ESI(+) MS: m/z 431 (MH.sup.+).
tert-butyl
4-[2-(dimethylamino)ethoxy]2-[tetrahydro-2H-pyran-4-yl(trifluor-
oacetyl)amino]benzoic acid trifluoroacetate
[0733] ESI(+) MS: m/z 405 (MH.sup.+).
tert-butyl
4-{[(3S)-1-methylpyrrolidin-3-yl]oxy}-2-[tetrahydro-2H-pyran-4--
yl(trifluoroacetyl)amino]benzoic acid trifluoroacetate
[0734] ESI(+) MS: m/z 417 (MH.sup.+).
Step i'
Preparation of
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[(2S)-1-methylpyrrolidin-2--
yl]methoxy}-2-(tetrahydro-2H-pyran-4-ylamino)benzamide [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-{[(2S)-1-methylpyrrolidin-2-yl]methoxy)-2-(tetrahydro-2H-pyran-4-yla-
mino)-phenyl] cpd. 94
##STR00108##
[0736]
4-{[(2S)-1-methylpyrrolidin-2-yl]methoxy}-2-[tetrahydro-2H-pyran-4--
yl(trifluoroacetyl)amino]benzoic acid trifluoroacetate (1 mmol, 531
mg) was dissolved in DCM and two drops of anhydrous DMF under
nitrogen atmosphere. Oxalyl chloride (0.17 ml, 2 mmol) was added
and the mixture was stirred at room temperature for 2 hours.
Solvents were evaporated to obtain a yellow powder. The solid was
redissolved in THF under an argon atmosphere and cooled at
-20.degree. C. DIPEA (0.56 ml, 3.2 mmol) was added.
5-(3,5-Difluorobenzyl)-1H-indazol-3-amine, dissolved in 10 mL of
dry THF was then added dropwise in 15'. The reaction mixture was
kept at -20.degree. C. for 6 hours then the temperature was allowed
to raise at room temperature overnight. The reaction was quenched
with 15 mL of NaHCO.sub.3 5% and extracted twice with AcOEt (15
ml). Solvents were then evaporated and the residue was redissolved
in 20 ml of MeOH. TEA (10 mmol, 1.5 ml) was added and the mixture
was heated to 65.degree. C. for 3hr. Then the reaction was cooled
to room temperature and the solvents removed to yield the crude
product which was purificated by means of silica gel flash
chromatography (AcOEt/MeOH/NH.sub.3Aq. 85:15:05) to yield the title
compound as a white powder (258 mg, 0.45 mmol, 45%).
[0737] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.28-1.44 (m, 2H)
1.94 (d, J=12.07 Hz, 2H) 3.44-3.56 (m, 3H) 3.59-3.73 (m, 1H)
3.77-3.87 (m, 2H) 4.05 (s, 1H) 6.23 (dd, 1H) 6.28 (d, J=2.19 Hz,
1H) 6.92-7.06 (m, 3H) 7.27 (dd, J=8.66, 1.59 Hz, 1H) 7.42 (d,
J=8.90 Hz, 1H) 7.50 (s, 1H) 7.88 (d, J=8.90 Hz, 1H) 8.27 (d, J=7.80
Hz, 1H) 10.24 (s, 1H) 12.68 (s, 1H)
[0738] Operating in an analogous way, the following compounds were
obtained:
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-[(1-methylpiperidin-4-yl)oxy]-
-2-(tetrahydro-2H-pyran-4-ylamino)benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-[(1-methylpiperidin-4-yl)oxy]-2-(tetrahydro-2H-pyran-4-ylamino)-phen-
yl] cpd. 95
##STR00109##
[0740] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.36 (ddd, J=9.82,
3.66, 3.48 Hz, 2H) 1.70 (m, 2H) 1.85-2.00 (m, 4H) 2.22-2.30 (m, 5H)
2.64-2.79 (m, 2H) 3.44-3.54 (m, 2H) 3.58-3.72 (m, 1H) 3.82 (dt,
J=11.65, 3.69 Hz, 2H) 4.05 (s, 2H) 4.51 (br. s., 1H) 6.20-6.30 (m,
2H) 6.94-7.07 (m, 3H) 7.27 (dd, J=8.60, 1.52 Hz, 1H) 7.42 (d,
J=8.54 Hz, 1H) 7.50 (d, J=2.32 Hz, 1H) 7.88 (d, J=9.51 Hz, 1H) 8.22
(d, J=7.68 Hz, 1H) 10.24 (s, 1H) 12.68 (s, 1H)
N[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-[2-(dimethylamino)ethoxy]-2-(t-
etrahydro-2H-pyran-4-ylamino)benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-[2-(dimethylamino)ethoxy]-2-(tetrahydro-2H-pyran-4-ylamino)-phenyl]
cpd. 96
##STR00110##
[0742] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.31-1.44 (m, 2H)
1.94 (d, J=10.73 Hz, 2H) 2.42 (br. s., 6H) 2.89 (br. s., 2H) 3.49
(t, J=9.88 Hz, 2H) 3.60-3.73 (m, 1H) 3.78-3.88 (m, 2H) 4.05 (s, 2H)
4.19 (t, J=5.24 Hz, 2H) 6.25 (dd, J=8.84, 2.38 Hz, 1H) 6.29 (d,
J=2.32 Hz, 1H) 6.93-7.06 (m, 3H) 7.27 (dd, J=8.60, 1.52 Hz, 1H)
7.43 (d, J=8.78 Hz, 1H) 7.50 (s, 1H) 7.90 (d, J=8.78 Hz, 1H) 8.27
(d, J=7.44 Hz, 1H) 10.26 (s, 1H) 12.68 (s, 1H).
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[(3S)-1-methylpyrrolidin-3-y-
l]oxy}-2-(tetrahydro-2H-pyran-4-ylamino)benzamide [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-{[(3S)-1-methylpyrrolidin-3-yl]oxy}-2-(tetrahydro-2H-pyran-4-ylamino-
)-phenyl] cpd. 97
##STR00111##
[0744] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.29-1.44 (m, 2H)
1.75-1.86 (m, 1H) 1.93 (d, J=10.49 Hz, 2H) 2.32 (s, 4H) 2.44 (br.
s., 1H) 2.65-2.78 (m, 2H) 2.79-2.88 (m, 1H) 3.44-3.54 (m, 2H)
3.58-3.71 (m, 1H) 3.82 (d, J=11.58 Hz, 2H) 4.05 (s, 2H) 4.96-5.01
(m, 1H) 6.15-6.19 (m, 1H) 6.19-6.20 (m, 1H) 6.94-7.06 (m, 3H) 7.26
(dd, J=8.66, 1.59 Hz, 1H) 7.42 (d, J=8.54 Hz, 1H) 7.50 (d, J=1.59
Hz, 1H) 7.87 (d, J=8.90 Hz, 1H) 8.23 (d, J=7.68 Hz, 1H) 10.24 (s,
1H) 12.67 (s, 1H).
EXAMPLE 9
Step u
Preparation of
N-[5-(3,5-Difluoro-benzyl)-1-trityl-1H-indazol-3-yl]-2-fluoro-5-formyl-be-
nzamide
[0745] 2-Fluoro-5-formyl-benzoic acid (368 mg, 2.187 mmol) in
toluene (22 mL) was treated with thionyl chloride (1.59 mL, 21.87
mmol) and stirred under reflux temperature for 4 hours. The
volatiles were evaporated, the residue was taken up with toluene (4
mL) and evaporated to dryness leaving an off white solid which was
dissolved in dry THF (5 mL) and added drop-wise to a solution of
5-(3,5-difluoro-benzyl)-1-trityl-1H-indazol-3-ylamine (843 mg, 1.68
mmol) and DIPEA (0.88 mL, 5.04 mmol) in THF (10 mL), cooled to
4.degree. C. The reaction was gradually brought to room
temperature. After one night, the volatiles were evaporated. The
crude was dissolved in DCM (150 mL) and washed with aqueous NaHCO
.sub.3 (100 mL) then with water and finally with brine. After
drying over sodium sulphate, evaporation and purification over
silica gel (eluent: DCM) 868 mg of title compound as a white solid
in 79% yield were obtained.
[0746] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 3.98 (s, 2H) 6.34
(d, J=8.66 Hz, 1H) 6.89-7.09 (m, 3H) 7.22-7.34 (m, 15H) 7.53-7.64
(m, 1H) 7.66 (s, 1H) 8.14 (br. s., 1H) 8.32 (d, J=4.51 Hz, 1H)
10.05 (s, 1H) 11.08 (br. s., 1H).
Step i''
Preparation of
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-2-fluoro-5-formyl-benzamide
[0747]
N-[5-(3,5-Difluoro-benzyl)-1-trityl-1H-indazol-3-yl]-2-fluoro-5-for-
myl-benzamide (740 mg, 1.137 mmol) in dry dioxan (25 mL) was
treated with 4N HCl in dioxan (2.8 mL). The reaction was stirred at
room temperature for two days. The volatile components were
evaporated to dryness and the residue was taken up with Et.sub.2O
(10 mL), stirred for 1 hour, filtered with suction, washed with
Et.sub.2O (10 mL), dried at 50.degree. C. under vacuum to afford
358 mg of title compound as a white solid in 77% yield.
[0748] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 4.08 (s, 2H)
6.88-7.09 (m, 3H) 7.22-7.31 (m, 1H) 7.45 (d, J=8.41 Hz, 1H) 7.62
(t, J=9.57 Hz, 1H) 7.71 (s, 1H) 8.12-8.19 (m, 1H) 8.35 (d, J=5.61
Hz, 1H) 10.08 (s, 1H) 10.92 (s, 1H) 12.80 (br. s., 1H)
Preparation of
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-2-fluoro-5-(4-methyl-piperazi-
n-1-ylmethyl)-benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=2-fluoro-5-(4-methyl-piperazin-1-ylmethyl)-phenyl] cpd. 120
##STR00112##
[0750]
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-2-fluoro-5-formyl-benza-
mide (150 mg, 0.367 mmol) in THF (4 mL), under a nitrogen
atmosphere, at room temperature was treated with N-methylpiperazine
((0.039 mL, 0.367 mmol) and then with acetic acid (0.024 mL, 0.422
mmol). After 0.5 hours sodium triacetoxyborohydride was added and
the reaction was stirred over night. EtOAc (25 mL) and water (25
mL) were added, pH was adjusted to 11 with concentrated NH.sub.4OH.
The organic layer was separated and the aqueous layer was extracted
twice with EtOAc (2.times.10 mL). The combines organic extracts
were dried over sodium sulphate, evaporated to dryness and purified
over silica gel (Eluent: DCM: 7N NH.sub.3 in MeOH 96:4) affording
177 mg of title compound.
[0751] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.18 (br. s., 3H)
2.30-2.46 (m, 8H) 3.51 (br. s., 2H) 4.07 (s, 2H) 6.92-7.00 (m, 2H)
6.99-7.06 (m, 1H) 7.28 (s, 1H) 7.28-7.35 (m, 1H) 7.44 (d, J=8.53
Hz, 1H) 7.47-7.54 (m, 1H) 7.65 (br. s., 1H) 7.67 (br. s., 1H) 10.66
(br. s., 1H) 12.75 (br. s., 1H)
[0752] Operating in an analogous way, the following compounds were
obtained:
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-fluoro-5-{[(2S)-2-(pyrrolidin-
-1-ylmethyl)pyrrolidin-1-yl]methyl}benzamide [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=2-fluoro-5{[(2S)-2-(pyrrolidin-1-ylmethyl)pyrrolidin-1-yl]methyl}-phen-
yl] cpd. 121
##STR00113##
[0754] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.67 (m, 6H) 1.92
(m, 1H) 2.14 (m, 1H) 2.63 (m, 2H) 2.82 (m, 1H) 3.23-3.37 (m, 2H)
4.07 (s, 2H) 4.17 (d, J=14.26 Hz, 1H) 6.93-6.99 (m, 2H) 6.99-7.07
(m, 1H) 7.25-7.28 (m, 1H) 7.28-7.33 (m, 1H) 7.44 (d, J=8.65 Hz, 1H)
7.50 (br. s., 1H) 7.66 (br. s., 2H) 10.64 (br. s., 12.75 (br. s.,
1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-fluoro-5-(morpholin-4-ylmethy-
l)benzamide [(I.sub.A), R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=2-fluoro-5-(morpholin-4-ylmethyl)-phenyl] cpd. 122
##STR00114##
[0756] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 2.40 (br. s., 4H)
3.52 (br. s., 2H) 3.60 (br. s., 4H) 4.07 (s, 2H) 6.94-6.99 (m, 2H)
6.99-7.07 (m, 1H) 7.27 (d, J=8.65 Hz, 1H) 7.33 (d, J=8.53 Hz, 1H)
7.44 (d, J=8.53 Hz, 1H) 7.53 (br. s., 1H) 7.67 (br. s., 2H) 10.67
(br. s., 1H) 12.75 (br. s., 1H).
EXAMPLE 10
Preparation of
N-[5-(3,5-Difluoro-benzyl)-1-trityl-1H-indazol-3-yl]-4-fluoro-isophthalam-
ic acid
[0757]
N[5-(3,5-Difluoro-benzyl)-1-trityl-1H-indazol-3-yl]-2-fluoro-5-form-
yl-benzamide (88 mg, 0.135mmol) in tert-butanol (1.8 mL) at room
temperature was treated first with 2-methyl-2-butene (0.079 mL,
1.082 mmol) and then with sodium chlorite (37 mg, 0.405 mmol) and
sodium dihydrogenphosphate in water (0.8 mL) drop-wise. The
reaction was stirred over-night, EtOAc was then added (30 mL) and
washed with water (25 mL). The aqueous layer was extracted twice
with EtOAc (2.times.10 mL). The combined organic layers were washed
with brine, evaporated to dryness to leave 106 mg of title compound
which was employed in the following step with no need of further
purification.
[0758] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 3.98 (s, 2H) 6.33
(d, J=8.53 Hz, 1H) 6.78 (br. s., 1H) 6.90-7.07 (m, 3H) 7.20-7.35
(m, 15H) 7.43-7.54 (m, 1H) 7.65 (br. s., 1H) 8.13 (br. s., 1H) 8.29
(d, J=3.66 Hz, 1H) 11.01 (s, 1H) 13.12 (br. s., 1H)
Preparation of
N-[5-(3,5-Difluoro-benzyl)-1-trityl-1H-indazol-3-yl]-2-fluoro-5-((S)-2-py-
rrolidin-1-ylmethyl-pyrrolidine-1-carbonyl)-benzamide
[0759]
N-[5-(3,5-Difluoro-benzyl)-1-trityl-1H-indazol-3-yl]-4-fluoro-isoph-
thalamic acid (93 mg, 0.139 mmol) in DCM (1.4 mL) was treated with
1-hydroxybenzotriazole (25 mg, 0.181 mmol), EDCI (35 mg, 0.181
mmol) and (S)-(+)-1-(2-pyrrolidinylmethyl)pyrrolidine (0.03 mL,
0.1813 mmol). After 1 hour the reaction was diluted with DCM (25
mL) and washed with aqueous NaHCO.sub.3 (5 mL), water (5 mL) and
finally with brine. After drying over sodium sulphate, evaporation
of the solvent and purification over silica gel (eluent: DCM, 7N
NH.sub.3 in MeOH 95:5) 92 mg of title compound were obtained in 85%
yield over two steps.
[0760] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 3.97 (s, 2H) 4.26
(br. s., 1H) 6.33 (d, J=8.41 Hz, 1H) 686-7.09 (m, 4H) 7.15-7.35 (m,
15H) 7.38-7.46 (m, 15H) 7.63 (s, 1H) 7.68 (br. s., 1H) 7.82 (br.
s., 1H) 10.96 (br. s., 1H)
Step i''
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-2-fluoro-5((S)-2-pyrrolidin-1--
ylmethyl-pyrrolidine-1-carbonyl)-benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=2-fluoro-5-((S)-2-pyrrolidin-1-ylmethyl-pyrrolidine-1-carbonyl)-phenyl-
] cpd. 123
##STR00115##
[0762] N-[5-(3,5-Difluoro-benzyl)-1-trityl-1H-indazol
-3-yl]-2-fluoro-5-((S)-2-pyrrolidin-1-ylmethyl-pyrrolidine-1-carbonyl)-be-
nzamide (90 mg, 0.112 mmol) in DCM (1 mL) was treated with TFA
(0.17 mL, 2.24 mmol). After two hours at room temperature, DCM was
added (25 mL) and the organic phase was washed with aqueous
NaHCO.sub.3, water and brine. Drying over sodium sulphate,
evaporation and purification of the crude over silica gel (eluent:
DCM, MeOH, 7N NH.sub.3 in MeOH 9:1:0.1) afforded 42 mg of title
compound.
[0763] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 4.07 (s, 2H) 4.29
(br. s., 1H) 6.93-6.99 (m, 2H) 6.99-7.06 (m, 1H) 7.2.7 (dd, J=8.53,
1.34 Hz, 1H) 7.42 (br. s., 1H) 7.65-7.74 (m, 2H) 7.85 (br. s., 1H)
10.80 (br. s., 1H) 12.77 (br. s., 1H).
EXAMPLE 11
[0764] Step i'
Preparation of methyl
4-{[5-(3-difluorobenzyl)-1H-indazol-3-yl]carbamoyl}-3-nitrobenzoate
[0765] 4-(methoxycarbonyl)-2-nitrobenzoic acid (4.8 gr, 21.3 mmol)
and thionyl chloride (15.5 mL) were stirred in THF dry (130 mL) at
70.degree. C. for 2 hours. Volatiles were evaporated and the
residue dissolved in dry pyridine (100 mL) at 0.degree. C. A
solution of 5-(3,5-difluoro-benzyl)-1H-indazol-3-ylamine (4.6 mg,
17.76 mmol) in dry pyridine (10 mL) was added to the cooled
reaction mixture. Temperature was allowed to reach room temperature
overnight. Reaction was quenched with NaHCO.sub.3 sat. sol and
extracted with ethyl acetate. Collected organic phases were dried
over Na SO.sub.4, filtered and evaporated to dryness. Residue was
purified by column chromatography over silica gel (DCM/EtOH/7N
NH.sub.3 in MeOH=95/5/0.5) affording 5.4 gr (65% yield) of the
title compound.
[0766] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 3.97 (s, 3H)
4.08 (s, 2H) 6.89-7.00 (m, 2H) 6.99-7.07 (m, 1H) 7.29 (dd, J=8.66,
1.46 Hz, 1H) 7.45 (d, J=8.66 Hz, 1H) 7.76 (s, 1H) 8.01 (d, J=7.93
Hz, 1H) 8.40 (dd, J=7.93, 1.59 Hz, 1H) 8.58 (d, J=1.46 Hz, 1H)
11.22 (s, 1H) 12.81 (s, 1H)
[0767] Operating in an analogous way, the following compound was
obtained:
methyl
4-{[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]carbamoyl}benzoate
[0768] ESI(+) MS: m/z 422 (MH.sup.+).
Preparation of
4-{[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]carbamoyl}-3-nitrobenzoic
acid
[0769] Methyl
4-{[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]carbamoyl}-3-nitrobenzoate
(5.4 gr, 11.6 mmol) was dissolved in THF (78 mL) and water (52 mL)
and treated at room temperature with LiOH hydrate (730 mg) for 24
hours. THF was evaporated and the resulting acqueous phase was
trated with 5% KHSO.sub.4 acqueous solution (100 mL). The so
obtained precipitated was filtered off and dried under vacuum at
60.degree. C. affording the title compound without any further
purification.
[0770] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 4.08 (s, 2H)
6.92-7.00 (m, 2H) 7.00-7.07 (m, 1H) 7.27 (dd, J=8.59, 1.40 Hz, 1H)
7.44 (d, J=8.65 Hz, 1H) 7.76 (s, 1H) 7.85 (d, J=7.68 Hz, 1H) 8.30
(dd, J=7.74, 1.28 Hz, 1H) 8.50 (d, J=1.22 Hz, 1H) 11.08 (s, 1H)
12.77 (s, 1H)
[0771] Operating in an analogous way, the following compound was
obtained:
4-{[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]carbamoyl) benzoic
acid
[0772] ESI(+) MS: m/z 408 (MH.sup.+).
Preparation of
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazine-1-carb-
onyl)-2-nitro-benzamide
[0773]
4-{[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]carbamoyl}-3-nitrobenzoi-
c acid (500 mg, 1.11 mmol) in DMF (10 mL) was treated with
1-hydroxybenzotriazole (195 mg, 1.44 mmol), EDCI (276 mg, 1.44
mmol) and 1-methylpiperazine (0.16 mL, 1.44 mmol). The reaction was
left at room temperature over night. The volatiles were removed by
evaporation, the residue was added drop-wise to iced-water (25 mL)
with stirring. A yellow solid was obtained which was extracted with
DCM (2.times.25 mL). The combined organic layers were dried over
sodium sulphate and evaporated leaving 590 mg of title compound
which was employed in the following step without any further
purification.
[0774] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 2.23 (s, 3H)
2.34 (m, 2H) 2.45 (m, 2H) 3.39 (m, 2H) 3.67 (m, 2H) 4.08 (s, 2H)
6.93-6.99 (m, 2H) 6.99-7.07 (m, 1H) 7.28 (dd, J=8.59, 1.40 Hz, 1H)
7.45 (d, J=8.53 Hz, 1H) 7.74 (s, 1H) 7.87-7.90 (m, 1H) 7.90-7.93
(m, 1H) 8.15 (d, J=0.85 Hz, 1H) 11.10 (s, 1H) 12.78 (s, 1H)
[0775] Operating in an analogous way, the following compounds were
obtained:
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[(2R)-2-(pyrrolidin-1-ylmeth-
yl)pyrrolidin-1-yl]carbonyl}benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-{[(2R)-2-(pyrrolidin-1-ylmethyl)pyrrolidin-1-yl]carbonyl}-phenyl]
cpd. 124
##STR00116##
[0777] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 4.06 (s, 2H) 4.30
(br. s., 1H) 6.94-7.00 (m, 2H) 6.99-7.06 (m, 1H) 7.27 (dd, J=8.66,
1.59 Hz, 1H) 7.44 (d, J=8.54 Hz, 1H) 7.61 (d, 2H) 7.63 (s, 1H) 8.11
(d, J=8.29 Hz, 2H) 10.81 (s, 1H) 12.77 (s, 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4{[(2S)-2-(pyrrolidin-1-ylmethy-
l)pyrrolidin-1-yl]carbonyl}benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-{[(2S)-2-(pyrrolidin-1-ylmethyl)pyrrolidin-1-yl]carbonyl}-phenyl]
cpd. 125
##STR00117##
[0779] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 4.06 (s, 2H) 4.30
(br. s., 1H) 6.94-7.00 (m, 2H) 6.99-7.06 (m, 1H) 7.27 (dd, J=8.60,
1.52 Hz, 1H) 7.44 (d, J=8.90 Hz, 1H) 7.59-7.65 (m, 3H) 8.11 (d,
J=8.17 Hz, 2H) 10.81 (s, 1H) 12.77 (s, 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[4-(pyrrolidin-1-yl)piperidi-
n-1-yl]carbonyl}benzamide [(I.sub.A), R1=R2=R3=H,
R=3.5-difluorophenyl,
Ar=4-{[4-(pyrrolidin-1-yl)piperidin-1-yl]carbonyl}-phenyl] cpd.
126
##STR00118##
[0781] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d6): 1.41 (m, 2H) 1.70
(m, 4H) 1.94 (m, 2H) 2.33 (m, 1H) 2.53 (m, 4H) 3.06 (m, 2H) 3.52
(m, 1H) 4.06 (s, 2H) 4.30 m, 1H) 6.94-7.00 (m, 2H) 7.00-7.05 (m,
1H) 7.27 (dd, J=8.66, 1.59 Hz, 1H) 7.42-7.46 (m, 1H) 7.54 (d,
J=8.29 Hz, 2H) 7.62 (s, 1H) 8.12 (d, J=8.17 Hz, 2H) 10.81 (s, 1H)
12.77 (s, 1H).
EXAMPLE 12
Preparation of 2-nitro-terephthalic acid 1-tert-butyl ester
4-methyl ester
[0782] Commercially available 2-nitro-terephthalic acid 4-methyl
ester (4.84 g, 21.49 mmol) in DCM (54 mL) was treated with
tert-butanol (4.05 mL, 42.99 mmol), di-tert-butyl dicarbonate
(12.19 g, 55.87 g) and DMAP (0.79 g, 6.45 mmol). After 4 days at
room temperature, the reaction was diluted with DCM (100 mL),
washed with 1N HCl (100 mL), aqueous NaHCO.sub.1 and finally with
water. After drying over sodium sulphate and evaporation of the
volatiles, the title compound was obtained as a brownish oil in
more than quantitative yield (6.51 g). The crude was employed in
the following step with no further purification.
[0783] ESI(+) MS: m/z 282 (MH.sup.+).
Preparation of 2-nitro-terephthalic acid 1-tert-butyl ester
[0784] 2-Nitro-terephthalic acid 1-tert-butyl ester 4-methyl ester
(21.49 mmol) was dissolved in THF (143 mL) and treated with lithium
hydroxide monohydrate (1.35 g, 32.24 mmol) in water (97 mL). The
reaction was stirred at room temperature for 2 hours then partially
evaporated, cooled with an ice/water bath and treated with 1N HCl
dropwise (35 mL). Precipitation of a solid occurred. The mixture
was then extracted with DCM (150 mL and 2.times.50 mL). The aqueous
phase was further treated with 1N HCl (10 mL) and extracted with
DCM (2.times.50 mL). The combined organic layers were then washed
with water and finally with brine. After drying over sodium
sulphate and evaporation, 5.34 g of title compound were obtained as
a reddish solid in 93% overall yield.
[0785] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.53 (s, 9H)
7.93 (d, J=7.92 Hz, 1H) 8.31 (dd, J=7.92, 1.58 Hz, 1H) 8.42 (d,
J=1.34 Hz, 1H) 13.78 (s, 1H)
Preparation of 2-Nitro-4-(piperidine-1-carbonyl)-benzoic acid
tert-butyl ester
[0786] 2-Nitro-terephthalic acid 1-tert-butyl ester (500 mg, 1.88
mmol) in DCM (18 mL), was treated with 1-hydroxybenzotriazole (0.39
g, 2.43 mmol), EDCI (0.47 g, 2.43 mmol) and piperidine (0.24 mL,
2.43 mmol). After 3 hours the reaction was diluted with DCM (50 mL)
and washed with aqueous NaHCO.sub.3(30 mL), water (30 mL) and
finally with brine. After drying over sodium sulphate and
evaporation of the solvent the title compound was obtained as a
colourless oil in quantitative yield. The crude was employed in the
following reaction without any further purification.
[0787] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.45 (br. s.,
6H) 1.51 (s, 9H) 3.19-3.27 (m, 2H) 3.59 (br. s., 2H) 7.76-7.81 (m,
1H) 7.85-7.89 (m, 1H) 8.01 (d, J=1.22 Hz, 1H)
[0788] Operating in a way analogous to that described above, the
following compounds were obtained:
tert-butyl
4-[(2-methoxyethyl)(methyl)carbamoyl]-2-nitrobenzoate
[0789] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): mixture of
rotamers 1.52 (s, 9H) 7.77-7.83 (m, 1H) 7.84-7.91 (m, 1H) 8.03 (d,
J=0.61 Hz, 1H)
tert-butyl 2-nitro-1-(pyrrolidin-1-ylcarbonyl)benzoate
[0790] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.52 (s, 9H)
1.78-1.94 (m, 4H) 3.37-3.43 (m, 2H) 3.49 (t, J=6.70 Hz, 2H)
7.84-7.90 (m, 1H) 7.91-7.96 (m, 1H) 8.12 (d, J=1.34 Hz, 1H)
tert-butyl 4-(azetidin-1-ylcarbonyl)-2-nitrobenzoate
[0791] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.52 (s, 9H)
2.29 (dt, J=15.51, 7.79 Hz, 2H) 4.06-4.12 (m, 2H) 4.31-4.38 (m, 2H)
7.88 (d, J=7.92 Hz, 1H) 8.01 (dd, J=7.92, 1.58 Hz, 1H) 8.16 (d,
J=1.34 Hz, 1H)
tert-butyl 4-(morpholin-4-ylcarbonyl)-2-nitrobenzoate
[0792] ESI(+) MS: m/z 337 (MH.sup.+).
Preparation of 2-nitro-4-piperidin-1-ylmethyl-benzoic acid
hydrochloride
[0793] 2-Nitro-4-(piperidine-1-carbonyl)-benzoic acid tert-butyl
ester (1.87 mmol) was dissolved in dry THF and added drop-wise to
3.7 mL of `borane tetrahydrofuran complex 1.0 M solution, at room
temperature, under nitrogen, with stirring. The reaction was then
refluxed for six hours, cooled to room temperature and treated
carefully with 2N HCl (10 mL). After stirring for 15 minutes, solid
K.sub.2CO.sub.3 was added in portions (1.75 g). The mixture was
extracted with EtOAc (3.times.25 mL). The combined organic layers
were dried over sodium sulphate and evaporated leaving an oil that
by HPLC-MS analysis resulted a 4:6 mixture of the tertiary amine
and the corresponding borane complex. The mixture was dissolved in
DCM (1 mL) and treated with 4N HCl in dioxane (7 mL). After 4 days
at room temperature, an off white was formed which was filtered,
washed with dioxane (5 mL) and dried at 50.degree. C. under vacuum.
0.40 g of title compound were obtained in 70% overall yield.
[0794] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.37-1.80 (m,
5H) 2.90 (br. s., 4H) 4.42 (s, 2H) 7.92-7.99 (m, 2H) 8.24 (d,
J=0.85 Hz, 1H) 9.99 (br. s., 1H)
4-{[(2-methoxyethyl)(methyl)amino]methyl}-2-nitrobenzoic acid
hydrochloride
[0795] ESI(+) MS: m/z 269 (MH.sup.+).
2-nitro-4-(pyrrolidin-1-ylmethyl)benzoic acid hydrochloride
[0796] ESI(+) MS: m/z 251 (MH.sup.+).
4-(morpholin-4-ylmethyl)-2-nitrobenzoic acid hydrochloride
[0797] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 2.39 (t,
J=4.51 Hz, 4H) 3.59 (t, J=4.63 Hz, 4H) 3.62 (s, 2H) 7.72 (dd,
J=7.87, 1.28 Hz, 1H) 7.82 (d, J=7.80 Hz, 1H) 7.87 (d, J=0.98 Hz,
1H)
4-(azetidin-1-ylmethyl)-2-nitrobenzoic acid hydrochloride
[0798] ESI(+) MS: m/z 237 (MH.sup.+).
Step i'
Preparation of
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-nitro-4-(piperidin-1-ylmethy-
l)benzamide
[0799] 2-Nitro-4-piperidin-1-ylmethyl-benzoic acid hydrochloride
(440 mg, 1.46 mmol) was treated with thionyl chloride (5 mL) and
refluxed for 1 hour. Excess of reagent was removed by evaporation
followed by evaporation from toluene (2.times.5 mL). The solid was
further died under vacuum. The acid chloride was treated with dry
pyridine (7 mL), cooled to 4.degree. C. and added with
5-(3,5-difluoro-benzyl)-1H-indazol-3-ylamine (315 mg, 1.22 mmol) in
dry pyridine (3 mL) under a nitrogen atmosphere, with stirring.
After stirring for a few hours the reaction was left at 0.degree.
C. over-night. EtOAc (50 mL) and water (50 mL) were added, pH was
adjusted to 9 with concentrated NH.sub.4OH. The organic layer was
separated, dried over sodium sulphate, evaporated to dryness and
purified over silica gel (DCM: MeOH 95:5) affording 266 mg of title
compound in 43% yield.
[0800] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.54 (br. s.,
6H) 2.39 (br. s., 4H) 3.61 (s, 2H) 4.07 (s, 2H) 6.92-6.99 (m, 2H)
6.99-7.06 (m, 1H) 7.26-7.29 (m, 1H) 7.44 (d, J=8.53 Hz, 1H) 7.73
(s, 1H) 7.79 (s, 2H) 8.04 (s, 1H) 11.01 (s, 1H) 12.75 (s, 1H)
[0801] Operating in a way analogous to that described above, the
following compounds were obtained:
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[(2-methoxyethyl)(methyl)ami-
no]methyl}-2-nitrobenzamide
[0802] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 2.24 (s, 3H)
2.60 (t, J=5.67 Hz, 2H) 3.26 (s, 3H) 3.50 (t, J=5.73 Hz, 2H) 3.70
(s, 2H) 4.07 (s, 2H) 6.96 (d, J=6.70 Hz, 2H) 6.99-7.07 (m, 1H)
7.24-7.30 (m, 1H) 7.44 (d, J=8.53 Hz, 1H) 7.73 (s, 1H) 7.80 (s, 2H)
8.07 (s, 1H) 11.02 (s, 1H) 12.75 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-nitro-4-(pyrrolidin-1-ylmethy-
l)benzamide
[0803] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.75 (br. s.,
4H) 2.46-2.56 (m, 4H) 3.77 (br. s., 2H) 4.07 (s, 2H) 6.96 (d,
J=6.58 Hz, 2H) 6.99-7.06 (m, 1H) 7.25-7.30 (m, 1H) 7.44 (d, J=8.54
Hz, 1H) 7.73 (s, 1H) 7.80 (s, 2H) 8.05 (s, 1H) 11.02 (s, 1H) 12.75
(s, 1H)
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(morpholin-4-ylmethyl)-2-nitr-
obenzamide
[0804] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 2.40-2.46 (m,
4H) 3.60-3.65 (m, 4H) 3.66 (s, 2H) 4.07 (s, 2H) 6.90-6.99 (m, 2H)
6.99-7.07 (m, 1H) 7.24-7.29 (m, 1H) 7.44 (d, J=8.54 Hz, 1H) 7.73
(s, 1H) 7.81 (s, 2H) 8.07 (s, 1H) 11.02 (s, 1H) 12.75 (s, 1H)
4-(azetidin-1-ylmethyl)-N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-nitro-
benzamide
[0805] ESI(+) MS: m/z 478 (MH.sup.+).
[0806] Conversion 4
Preparation of
2-Amino-N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-piperidin-1-ylmethy-
l benzamide
[0807]
N[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-2-nitro-4-piperidin-1-yl-
methyl-benzamide (255 mg, 0.505 mmol) was suspended in DCM (7 mL)
and treated with nBu.sub.4NCl (95 mg, 0.343 mmol),
Na.sub.2S.sub.2O.sub.4 (659 mg, 3.029 mmol) in water (3.4 mL) was
added drop-wise, with stirring. After 2 hours, the volatiles were
removed by evaporation, a solid was filtered from the aqueous phase
and dried under vacuum. The solid was treated with 4N HCl in
dioxane (12 mL) and the solvent was then removed by evaporation.
The solid was dissolved in DCM (100 mL), washed with aqueous
K.sub.2CO.sub.3 and then with brine. After drying over sodium
sulphate and removal of the solvent, 248 mg of title compound were
obtained in more than quantitative yield. The crude was employed in
the following step with no further purification.
[0808] ESI(+) MS: m/z 476 (MH.sup.+).
[0809] Operating in a way analogous to that described above, the
following compounds were obtained:
2-Amino-N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-{[(2-methoxyethyl)(me-
thyl)amino]methyl}-benzamide
[0810] ESI(+) MS: m/z 480 (MH.sup.+).
2-Amino-N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(pyrrolidin-1-ylmethy-
l)benzamide
[0811] ESI(+) MS: m/z 462 (MH.sup.+).
2-Amino-N-[5-(3,5-difluorobenzyl)-1
H-indazol-3-yl]-4-(morpholin-4-ylmethyl)-benzamide
[0812] ESI(+) MS: m/z 478 (MH.sup.+).
2-Amino-4-(azetidin-1-ylmethyl)-N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-
-benzamide
[0813] ESI(+) MS: m/z 448 (MH.sup.+).
EXAMPLE 13
Preparation of tert-butyl
4-(4-methylpiperazin-1-yl)-2-[(1-methylpiperidin-4-yl)amino]benzoate
[0814] tert-Butyl 2-amino-4-(4-methylpiperazin-1-y)benzoate (1.5 g,
5.15 mmol) was dissolved in dry dioxane (25 mL) under a nitrogen
atmosphere. N-methylpiperidone (0.72 g, 6.18 mmol, 1.2 eq) was
added, followed by trifluoroacetic acid (1.03 mL, 13.39 mmol, 2.6
eq) and sodium triacetoxyborohydride (1.72 g, 7.73 mmol, 1.5 eq).
The mixture was stirred at room temperature for 26 hours. During
this time extra portions of N-methylpiperidone (0.5 mL, 0.75 eq)
and sodium triacetoxyborohydride (1.72 g, 7.73 mmol, 1.5 eq) were
added. A saturated aqueous solution of NaHCO.sub.3 was then added
and the reaction mixture was concentrated under reduced pressure.
10% ammonium hydroxide was added until pH 10 and the aqueous phase
was extracted with dichloromethane. The organic phase was washed
with brine, dried over Na.sub.2SO.sub.4 and evaporated under
reduced pressure. After purification by chromatography over silica
gel (DCM/MeOH/NH.sub.3 7% in MeOH 90:8:2) 1.025 g of title compound
were obtained as off-white solid (51% yield).
[0815] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.36-1.47 (m,
2H) 1.50 (s, 9H) 1.88-1.98 (m, 2H) 2.09-2.16 (m, 2H) 2.18 (s, 3H)
2.21 (s, 3H) 2.38-2.44 (m, 4H) 2.59-2.68 (m, 2H) 3.20-3.26 (m, 4H)
3.37-3.50 (m, 1H) 6.01 (d, J=1.95 Hz, 1H) 6.18 (dd, J=9.08, 2.26
Hz, 1H) 7.56 (d, J=9.02 Hz, 1H) 7.68 (d, J=7.56 Hz, 1H)
[0816] Operating in an analogous way, the following compound was
obtained:
ethyl
4-{[2-(tert-butoxycarbonyl)-5-(4-methylpiperazin-1-yl)phenyl]amino}p-
iperidine-1-carboxylate
[0817] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.19 (t,
J=7.50 Hz, 3H) 1.24-1.34 (m, 2H) 1.50 (s, 9H) 1.89-2.00 (m, 2H)
2.22 (s, 3H) 2.39-2.45 (m, 4H) 3.03-3.16 (m, 2H) 3.20-3.29 (m, 4H)
3.66-3.76 (m, 1H) 3.80-3.90 (m, 2H) 4.05 (q, J=7.07 Hz, 2H) 6.07
(d, J=2.07 Hz, 1H) 6.20 (dd, J=9.15, 2.19 Hz, 1H) 7.57 (d, J=9.02
Hz, 1H) 7.70 (d, J=7.93 Hz, 1H)
Preparation of tert-butyl
4-(4-methylpiperazin-1-yl)-2-[(1-methylpiperidin-4-yl)(trifluoroacetyl)am-
ino]benzoate
[0818] tert-butyl
4-(4-methylpiperazin-1-yl)-2-[(1-methylpiperidin-4-yl)amino]benzoate
(1.02 g, 2.625 mmol) was dissolved in dry dichloromethane (10 mL)
under nitrogen atmosphere and the solution was cooled to 0.degree.
C. Triethylamine (0.548 mL, 3.938 mmol, 1.5 eq) was added, followed
by trifluoroacetic anhydride (0.445 mL, 3.15 mmol, 1.2 eq) and the
mixture was stirred at 0.degree. C. for 2 hours. It was then
diluted with dichloromethane and washed twice with water. The
aqueous phase was back-extracted with dichloromethane. The combined
organic layers were dried over Na.sub.2SO.sub.4 and concentrated
under reduced pressure to give 1.18 g of crude product (93% yield),
which was used in the following step without further
purification.
[0819] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 0.93-1.07 (m,
2H) 1.45 (s, 9H) 1.48-1.64 (m, 2H) 1.85-2.05 (m, 2H) 2.11 (s, 3H)
2.23 (s, 3H) 2.41-2.47 (m, 4H) 2.66-2.87 (2H) 3.27-3.35 (m, 4H)
4.10-4.26 (m, 1H) 6.78 (d, J=2.44 Hz, 1H) 7.05 (dd, J=9.02, 2.56
Hz, 1H) 7.81 (d, J=9.02 Hz, 1H)
[0820] Operating in an analogous way, the following compound was
obtained:
ethyl
4-{[2-(tert-butoxycarbonyl)-5-(4-methylpiperazin-1-yl)phenyl](triflu-
oroacetyl)amino}piperidine-1-carboxylate
[0821] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 0.77-0.93 (m,
1H) 1.13 (t, J=7.07 Hz, 3H) 1.34-1.44 (m, 1H) 1.46 (s, 9H)
1.56-1.63 (m, 1H) 2.01-2.10 (m, 1H) 2.22 (s, 3H) 2.40-2.44 (m, 4H)
2.78-2.97 (m, 2H) 3.27-3.36 (m, 4H) 3.91-4.06 (m, 2H) 3.94-4.01 (m,
2H) 4.37-4.47 (m, 6.78 (d, J=2.44 Hz, 1H) 7.04 (dd, J=9.02, 2.56
Hz, 1H) 7.81 (d, J=9.02 Hz, 1H)
Preparation of
4-(4-methylpiperazin-1-yl)-2-[(1-methylpiperidin-4-yl)(trifluoroacetyl)am-
ino]benzoic acid dihydrochloride
[0822] tert-Butyl
4-(4-methylpiperazin-1-yl)-2-[(1-methylpiperidin-4-yl)(trifluoroacetyl)am-
ino]benzoate (1.18 g, 2.435 mmol) was dissolved in dry
dichloromethane (3 mL) under nitrogen atmosphere. A 4 M solution of
HCl in dioxane (9.1 mL, 36.4 mmol, 15 eq) was then added dropwise
and the mixture was stirred for 1.5 hours. A sticky solid was
formed. 5 more equivalents of HCl were added and the mixture was
stirred for 2 more hours. The solid was filtered, washed with DCM
(10 mL) and diethyl ether (10 mL) and dried under vacuum at
60.degree. C. for 2 hours. 1.06 g of title compound were obtained
as a beige powder (87% yield).
[0823] ESI(+) MS: m/z 429 (MH.sup.+).
[0824] Operating in an analogous way, the following compound was
obtained:
2-{[1-(ethoxycarbonyl)piperidin-4-yl](trifluoroacetyl)amino}-4-(4-methylpi-
perazin-1-yl)benzoic acid hydrochloride
[0825] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 0.83-0.98 (m,
1H) 1.13 (t, J=7.01 Hz, 3H) 1.34-1.47 (m, 1H) 1.63 (d, J=10.85 Hz,
1H) 2.04 (d, J=13.66 Hz, 1H) 2.84 (s, 3H) 2.88 (m, 2H) 3.16 (m, 4H)
3.52 (m, 2H) 3.94-4.02 (m, 2H) 4.05 (m, 4H) 4.34-4.48 (m, 1H) 6.96
(d, J=2.32 Hz, 1H) 7.11 (dd, J=8.90, 2.56 Hz, 1H) 7.91 (d J=8.90
Hz, 1H) 10.26 (br. s., 1H) 12.79 (br. s., 1H)
Step i'
Preparation of
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(4-methylpiperazin-1-yl)-2-[-
(1-methylpiperidin4-yl)amino]benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(4-methylpiperazin-1-yl)-2-[(1-methylpiperidin-4-yl]amino)-phenyl]
cpd. 13
##STR00119##
[0827]
4-(4-Methylpiperazin-1-yl)-2-[(1-methylpiperidin-4-yl)(trifluoroace-
tyl)amino]benzoic acid dihydrochloride (251 mg, 0.501 mmol, 1.3 eq)
was suspended in dry THF (4 mL) under nitrogen atmosphere. Thionyl
chloride (0.365 mL, 1.0 mmol, 2.6 eq) was added and the mixture was
stirred at 70.degree. C. for 1.5 hours. The mixture was then
evaporated to dryness, taken up with toluene, evaporated to dryness
again and then left for 2 hours at room temperature under high
vacuum. The acid chloride was then suspended in dry pyridine (2 mL)
and cooled to 0.degree. C. A solution of
5-(3,5-difluorobenzyl)-1H-indazol-3-amine (100 mg, 0.386 mmol, 1
eq) in dry pyridine (1.2 mL) was added dropwise and the mixture was
stirred at 0.degree. C. for 2 hours and then left at 4.degree. C.
overnight. It was then diluted with water and ethyl acetate. The
aqueous phase was basified until pH 10 with 30% ammonium hydroxide
and extracted with ethyl acetate. The combined organic layers were
dried over Na.sub.2SO.sub.4 and evaporated to dryness to give 290
mg of crude trifluoroacetamide. The crude product was dissolved in
methanol (7 mL), triethylamine was added (1.3 mL, 9.34 mmol, 24 eq)
and the solution was refluxed for 1.5 hours. The reaction mixture
was evaporated to dryness and purified by chromatography on silica
gel (DCM/MeOH NH.sub.3 7% in MeOH 83:17:1). The product was then
slurried in diethyl ether (1 mL) for 30 minutes at room
temperature, then filtered and dried at 45.degree. C. under high
vacuum for 3 hours. 153 mg of title compound were obtained as pale
yellow powder (69% yield).
[0828] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.33-1.50 (m,
2H) 1.92 (dd, J=9.51, 4.02 Hz, 2H) 2.18 (br. s., 3H) 2.21 (br. s.,
2H) 2.23 (s, 3H) 2.44 (t, J=4.60 Hz, 4H) 2.61 (br. s., 2H) 3.25 (t,
J=4.90 Hz, 4H) 3.41-3.52 (m, 1H) 4.04 (s, 2H) 6.08 (d, J=1.95 Hz,
1H) 6.22 (dd, J=8.96, 2.13 Hz, 1H) 6.98 (m, 3H) 7.24 (dd, J=8.65,
1.46 Hz, 1H) 7.40 (d, J=8.53 Hz, 1H) 7.49 (s, 1H) 7.78 (d, J=9.02
Hz, 1H) 8.26 (d, J=7.44 Hz, 1H) 10.06 (s, 1H) 12.62 (s, 1H)
[0829] Operating in an analogous way, the following compound was
obtained:
ethyl
4-{[2-{[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]carbamoyl}-5-(4-methy-
lpiperazin-1-yl)phenyl]amino}piperidine-1-carboxylate [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-(4-methylpiperazin-1-yl)-2-{(1-(ethoxycarbonyl)piperidin-4-yl]amino}-
-phenyl] cpd. 138
##STR00120##
[0831] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.17 (t,
J=7.07 Hz, 3H) 1.21-1.34 (m, 2H) 1.87-1.98 (m, 2H) 2.26 (br. s.,
3H) 2.45-2.49 (m, 4H) 3.07-3.21 (m, 2H) 3.25-3.35 (m, 4H) 3.64-3.73
(m, 1H) 3.76 (ddd, J=13.57, 4.18, 3.96 Hz, 2H) 4.02 (q, J=7.03 Hz,
2H) 4.04 (s, 2H) 6.15 (d, J=2.10 Hz, 1H) 6.25 (dd, J=9.11, 2.10 Hz,
1H) 6.92.-7.05 (m, 3H) 7.25 (dd, J=8.57, 1.52 Hz, 1H) 7.41 (d,
J=8.57 Hz, 1H) 7.47 (s, 1H) 7.80 (d, J=9.11 Hz, 1H) 8.31 (d, J=7.93
Hz, 1H) 10.09 (s, 1H) 12.63 (s, 1H)
Preparation of
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(4-methylpiperazin-1-yl)-2-(-
piperidin-4-ylamino)benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(4-methylpiperazin-1-yl)-2-[(piperidin-4-yl)amino]-phenyl]
cpd. 139
##STR00121##
[0833] ethyl
4-{[2-{[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]carbamoyl}-5-(4-methylpipe-
razin-1-yl)phenyl]amino}piperidine-1-carboxylate (198 mg, 0.313
mmol) were dissolved in 62% aqueous HBr (4 mL) in a screw cap pirex
tube and stirred at 70.degree. C. for 1 hour. The mixture was then
diluted with water and 30% ammonium hydroxide and extracted with
ethyl acetate. The organic phase was dried over Na.sub.2SO.sub.4
and concentrated to dryness. After purification by chromatography
on silica gel (DCM/MeOH/NH.sub.3 7% in MeOH, 80:10:10) 127 mg of
pure product were obtained (72% yield). The product was slurried
with ethyl acetate, filtered, washed with n-hexane and dried at
45.degree. C. under high vacuum for 3 hours to give 88 mg of title
compound as white solid.
[0834] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.16-1.31 (m,
J=12.50, 10.20, 10.20, 3.66 Hz, 2H) 1.89 (dq, J=12.50, 3.40 Hz, 2H)
2.22 (s, 3H) 2.43 (t, J=4.76 Hz, 4H) 2.63 (ddd, J=12.59, 10.27,
2.62 Hz, 2H) 2.92 (dt, J=12.53, 3.92 Hz, 2H) 3.25 (t, J=4.63 Hz,
4H) 3.46-3.57 (m, 1H) 4.04 (s, 2H) 6.09 (d, J=2.07 Hz, 1H) 6.22
(dd, J=9.02, 2.07 Hz, 1H) 6.93-7.04 (m, 3H) 7.24 (dd, J=8.66, 1.59
Hz, 1H) 7.40 (d, J=8.66 Hz, 1H) 7.48 (br. s., 1H) 7.78 (d, J=9.02
Hz, 1H) 8.24 (d, J=7.80 Hz, 1H) 10.04 (s, 1H) 12.62 (s, 1H).
EXAMPLE 14
Preparation of
1-[1-(tert-butoxycarbonyl)piperidin-4-yl]-1H-pyrazole-4-carboxylic
acid
[0835] A mixture of ethyl 1H-pyrazole-4-carboxylate (700 mg, 5
mmol) and NaH 60% (6 mmol) was stirred under nitrogen at 0.degree.
C. for 1 hour in dry DMF (15 mL). tert-Butyl
4-[(methylsulfonyl)oxy]piperidine-1-carboxylate (1.53 gr, 5.5 mmol)
dissolved in 4 mL of dry DMF was added and the resulting solution
was heated at 100.degree. C. overnight. Reaction mixture was
quenched with water and extracted (.times.3) with ethyl acetate.
Collected organic phases were dried over Na.sub.2SO.sub.4, filtered
and evaporated to dryness. Residue was dissolved in MeOH (20 mL)
and water (5 mL) and KOH (1.12 gr, 20 mmol) was added. The
resulting solution was stirred at room temperature 24 hours, then
solvents removed under reduced pressure. The residue was taken-up
with AcOEt and KHSO.sub.4 5% solution. Acqueous phase was extracted
with EtOAc several times. Collected organic phases were dried with
Na.sub.2SO.sub.4, filtered and evaporated to dryness affording 600
mg of the title compound.
[0836] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.42 (s, 9H)
1.73-1.87 (m, 2H) 1.96-2.03 (m, 2H) 2.82-2.99 (m, 2H) 4.04 (d,
J=12.93 Hz, 2H) 4.34-4.47 (m, 1H) 7.81 (s, 1H) 8.29 (s, 1H) 12.2.6
(br. s., 1H)
Step i'
Preparation of
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-1-(piperidin-4-yl)-1H-pyrazole-
-4-carboxamide hydrochloride [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl, Ar=(piperidin-4-yl)-1H-pyrazole] cpd. 102
##STR00122##
[0838]
1-[1-(tert-butoxycarbonyl)piperidin-4-yl]-1H-pyrazole-4-carboxylic
acid (134 mg, 0.45 mmol) and oxalyl chloride (0.6 mmol) were
stirred in DCM dry (5 mL) at room temperature overnight. Volatiles
were evaporated and the residue dissolved in dry pyridine (5 mL) at
0.degree. C. A solution of
5-(3,5-difluoro-benzyl)-1H-indazol-3-ylamine (100 mg, 0.38 mmol) in
dry pyridine (2 mL) was added to the cooled reaction mixture. After
1 hour, reaction was quenched with NaHCO.sub.3 sat. sol and
extracted with ethyl acetate. Collected organic phases were dried
over Na.sub.2SO.sub.4, filtered and evaporated to dryness. Residue
was purified by column chromatography over silica gel
(DCM/EtOH/NH.sub.3 5N in MeOH=1000/50/1) affording 87 mg of
Boc-protected derivative which was dissolved in 2 mL of dioxane and
trated with 0.4 mL of 4M HCl in dioxane. Volatiles were evaporated
affording 65 mg of the title compound.
[0839] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 2.10-2.23 (m,
2H) 2.22-2.31 (m, 2H) 3.03-3.19 (m, 2H) 3.32-3.49 (m, 2H) 4.05 (s,
2H) 4.54-4.63 (m, 1H) 6.92-6.98 (m, 2H) 6.98-7.05 (m, 1H) 7.25 (dd,
J=8.59, 1.65 Hz, 1H) 7.40-7.44 (m, 1H) 7.63 (d, J=0.61 Hz, 1H) 8.16
(s, 1H) 8.49 (s, 1H) 8.65-8.77 (m, 1H) 8.82-8.96 (m, 1H) 10.44 (s,
1H) 12.71 (br. s., 1H)
EXAMPLE 15
[0840] Step i'
Preparation of
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2](cis-4-hydroxycyclohexyl)ami-
no]-4-(4-methylpiperazin-1-yl)benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-[(cis-4-hydroxycyclohexyl)amino]-phenyl]
cpd. 103
##STR00123##
[0842] 4-(4-methyl
piperazin-1-yl)-2-[{cis-4-[(phenylcarbonyl)oxy]cyclohexyl}(trifluoroacety-
l)amino]benzoic acid hydrochloride (1.03 gr, 1.94 mmol) and oxalyl
chloride (3.88 mmol) were stirred in DCM dry (20 mL) and a few
drops of dry DMF at 0.degree. C., temperature was allowed to reach
room temperature in 2 hours. Volatiles were evaporated and the
residue dissolved in dry pyridine (25 mL) at 0.degree. C. A
solution of 5-(3,5-difluoro-benzyl)-1H-indazol-3-ylamine (387 mg,
1.49 mmol) in dry pyridine (6 mL) was added to the cooled reaction
mixture. Temperature was allowed to reach room temperature
overnight. Reaction was quenched with NaHCO.sub.3 sat. sol and
extracted with ethyl acetate. Collected organic phases were dried
over Na.sub.2SO.sub.4, filtered and evaporated to dryness. Residue
was purified by column chromatography over silica gel
(DCM/AcOEt/EtOH=100/10/15). The so obtained derivative, was
dissolved in MeOH (200 mL) and water (20 mL) and treated at
60.degree. C. with LiOH hydrate (160 mg, 3.8 mmol) for 4 hours.
MeOH was evaporated and the resulting acqueous phase was extracted
with EtOAc. Collected organic phases were dried over
Na.sub.2SO.sub.4, filtered and evaporated to dryness. Residue was
purified by column chromatography over silica gel
(DCM/EtOH/NH.sub.3 5N in MeOH=100/10/2) affording 233 mg of title
compound.
[0843] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.41-1.70 (m,
8H) 2.24 (s, 3H) 2.45 (br. s., 4H) 3.22-3.29 (m, 4H) 3.58 (d,
J=10.61 Hz, 2H) 4.05 (s, 5H 4.43 (d, J=3.78 Hz, 1H) 6.09 (d, J=1.95
Hz, 1H) 6.22 (dd, J=8.96, 2.13 Hz, 1H) 6.94-7.04 (m, 3H) 7.25 (dd,
J=8.65, 1.58 Hz, 1H) 7.41 (d, J=8.53 Hz, 1H) 7.51 (s, 1H) 7.79 (d,
J=9.14 Hz, 1H) 8.39 (d, J=7.68 Hz, 1H) 10.04 (s, 1H) 12.63 (s,
1H)
[0844] Operating in a way analogous to that described above, the
following compound was obtained:
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-[(trans-4-hydroxycyclohexyl)a-
mino]-4-(4-methylpiperazin-1-yl)benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-[(trans-4-hydroxycyclohexyl)amino]-pheny-
l] cpd. 104
##STR00124##
[0846] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.10-1.22 (m,
2H) 1.29-1.41 (m, 2H) 1.78-1.83 (m, 2H) 1.94-2.03 (m, 2H) 2.24 (s,
3H) 2.42.-2.48 (m, 4H) 3.23-3.2.8 (m, 4H) 3.34-3.42 (m, 1H)
3.43-3.52 (m, 1H) 4.04 (s, 2H) 4.53 (d, J=4.14 Hz, 1H) 6.09 (d,
J=2.07 Hz, 1H) 6.2.1 (dd, J=9.02, 2.19 Hz, 1H) 6.95-7.04 (m, 3H)
7.25 (dd, J=8.53, 1.58 Hz, 1H) 7.40 (d, J=8.53 Hz, 1H) 7.48 (s, 1H)
7.77 (d, J=9.14 Hz, 1H) 8.17 (d, J=7.80 Hz, 1H) 10.04 (s, 1H) 12.61
(s, 1H)
EXAMPLE 16
Preparation of
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-[(2-hydroxyethyl)amino]-4-(4-
-methylpiperazin-1-yl)benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(1-methyl-piperazin-1-yl)-2-[(2-hydroxyethyl)amino]-phenyl]
cpd. 105
##STR00125##
[0848] 2-[(2-{[tert-butyl(dimethyl)silyl]oxy
ethyl)amino]-N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(4-methylpipera-
zin-1-yl)benzamide (126 mg, 0.2 mmol) was dissolved in dry THF (3
mL) and 1M TBAF in THF (0.24 mL) was added at 0.degree. C. The
resulting solution was stirred overnight at room temperature.
Reaction was quenched with water and extracted with ethyl acetate.
Collected organic phases were dried over Na.sub.2SO.sub.4, filtered
and evaporated to dryness. Residue was purified by column
chromatography over silica gel (DCM/EtOH/NH.sub.3 5N in
MeOH=85/15/1) affording 83 mg of title compound.
[0849] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 2.34 (br. s.,
3H) 2.51-2.65 (m, 4H) 3.20 (q, J=5.57 Hz, 2H) 3.25-3.36 (m, 4H)
3.60 (q, J=5.53 Hz, 2H) 4.05 (s, 2H) 4.74 (t, J=5.1.8 Hz, 1H) 6.09
(d, J=2.07 Hz, 1H) 6.25 (dd, J=8.90, 2.19 Hz, 1H) 6.94-6.99 (m, 2H)
6.99-7.04 (m, 1H) 7.23 (dd, J=8.66, 1.58 Hz, 1H) 7.41 (d, J=8.65
Hz, 1H) 7.51 (s, 1H) 7.79 (d, J=9.02 Hz, 1H) 8.22 (t, J=5.18 Hz,
1H) 10.06 (s, 1H) 12.62 (s, 1H).
EXAMPLE 17
Preparation of
2-[(azetidin-3-ylmethyl)amino]-N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-
-4-(4-methylpiperazin-1-yl)benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-2-[(azetidin-3-ylmethyl)amino]-phenyl]
cpd. 106
##STR00126##
[0851] tert-butyl
3-({[2-{[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]carbamoyl}-5-(4-methylpip-
erazin-1-yl)phenyl]amino}methyl)azetidine-1-carboxylate (289 mg,
0.45 mmol) was dissolved in DCM (3 mL) and TFA (0.7 mL) was added.
The resulting reaction solution was stirred overnight at room
temperature. The mixture was diluted with DCM and extracted with
10% acqueous NH.sub.3. Organic phase was evaporated. Reverse phase
column chromatography purification afforded 104 mg of the title
compound.
[0852] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 2.24 (s, 3H)
2.42-2.47 (m, 4H) 2.80-2.90 (m, 1H) 3.26-3.38 (m, 4H) 3.58 (t,
J=7.86 Hz, 2H) 4.04 (s, 2H) 6.08 (d, J=2.32 Hz, 1H) 6.25 (dd,
J=8.96, 2.13 Hz, 1H) 6.94-7.00 (m, 2H) 6.98-7.04 (m, 1H) 7.25 (dd,
J=8.65, 1.58 Hz, 1H) 7.39-7.43 (m, 1H) 7.49 (d, J=0.61 Hz, 1H) 7.80
(d, J=8.90 Hz, 1H) 8.16 (t, J=5.06 Hz, 1H) 10.07 (br. s., 1H) 12.63
(br. s., 1H)
Preparation of
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-{[(1-methylazetidin-3-yl)met-
hyl]amino}-4-(4-methylpiperazin-1-yl)benzamide [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-(4-methyl-piperazin-1-yl)-[(1-methylazetidin-3-ylmethyl)amino]-pheny-
l] cpd. 107
##STR00127##
[0854] To a solution of
2-[(azetidin-3-ylmethyl)amino]-N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-
-4-(4-methylpiperazin-1-yl)benzamide (100 mg, 0.14 mmol) in
dichloromethane (2 mL) were added formaldehyde 37 wt. % in water
(0.014 mL, 0.168 mmol), TEA (0.4 mmol) and sodium
triacetoxyborohydride (45 mg, 0.21 mmol). The mixture was stirred
at room temperature overnight, diluted with dichloromethane, washed
with acqueous NaHCO.sub.3 sat. sol., water and brine. Organic phase
was dried over sodium sulfate and evaporated to dryness. The crude
was purified by flash chromatography on silica gel using
dichloromethane/methanol/NH.sub.3 5N in MeOH 100:10:1 as the
eluant, affording 5 mg of the title compound.
[0855] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 2.26 (s, 3H)
2.47 (br. s., 4H) 2.62 (s, 3H) 2.84-2.99 (m, 1H) 3.27-3.34 (m, 4H)
3.36-3.46 (m, 2H) 3.52-3.62 (m, 2H) 3.80-3.90 (m, 2H) 4.04 (s, 2H)
6.09 (d, J=2.07 Hz, 1H) 6.28 (dd, J=9.02, 2.07 Hz, 1H) 6.93-6.99
(m, 2H) 6.99-7.05 (m, 1H) 7.25 (dd, J=8.59, 1.52 Hz, 1H) 7.41 (d,
J=8.65 Hz, 1H) 7.50 (s, 1H) 7.81 (d, J=9.14 Hz, 1H) 8.25 (t, J=5.49
Hz, 1H) 10.12 (s, 1H) 12.64 (s, 1H).
EXAMPLE 18
Preparation of 4-nitro-2-(tetrahydro-pyran-4-ylamino)-benzoic
acid
[0856] 4-Nitro-2-(tetrahydro-pyran-4-ylamino)-benzoic acid ethyl
ester (11.2 g, 38 mmol) was dissolved in 200 mL of ethanol at
60.degree. C. then 2N NaOH was added (40 mL, 80 mmol). The mixture
was stirred at 60.degree. C. for 4 hours, then the solvent removed
under reduced pressure. The residue was taken-up with 200 mL of
water and the mixture brought to acidic pH with 2N HCl (35 mL). The
precipitated yellow solid was filtered, washed with plenty of water
and dried in oven at 40.degree. C. affording the title compound
(9.3 g).
[0857] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 13.49 (bs,
1H), 8.17 (bd., 1H), 8.04 (d, J=8.7 Hz, 1H), 7.54 (d, J=2.2 Hz,
1H), 7.32 (dd, J1=8.7 Hz, J2=2.2 Hz, 1H), 3.90-3.78 (m, 3H), 3.54
(m, 2H), 1.98 (m, 2H), 1.46 (m, 2H).
Preparation of
4-nitro-2-[(tetrahydro-pyran-4-yl)-(2,2,2-trifluoro-acetyl)-amino]-benzoi-
c acid
[0858] To 30 mL of trifluoroacetic anhydride was added
4-nitro-2-(tetrahydro-pyran-4-ylamino)-benzoic acid (9.1 g, 34.2
mmol) in small portions, at room temperature. The mixture was
stirred at room temperature for 1 hour then evaporated to dryness.
The residue (brown oil) was treated with 200 mL of water and
vigorously stirred for 3 hours at room temperature. The white solid
thus formed was filtered, washed with plenty of water and dried in
oven at 40.degree. C. affording the title compound (11.8 g).
[0859] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 13.52 (bs,
1H), 8.45 (dd, J1=8.5 Hz, J2=2.3 Hz, 1H), 8.32 (d, J=2.3 Hz, 1H),
8.26 (d, J=8.5 Hz, 1H), 4.58 (m, 1H), 3.84 (m, 2H), 3.45-3.2 (m,
2H), 1.98 (m, 1H), 1.59 (m, 1H), 1.49 (m, 1H), 1.14 (m, 1H).
Step i'
Preparation of
N-[1-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-nitro-2-[tetrahydro-2H-pyran-
-4-yl(trifluoroacetyl)amino]benzamide
[0860]
4-nitro-2-[(tetrahydro-pyran-4-yl)-(2,2,2-trifluoro-acetyl)-amino]--
benzoic acid (3.62 g, 10 mmol) and oxalyl chloride (3.8 mL, 30
mmol) were stirred in DCM dry (120 mL) and a few drops of dry DMF
at room temperature for 2 hours Volatiles were evaporated and the
residue dissolved in dry pyridine (50 mL) at 0.degree. C. A
solution of 5-(3,5-difluoro-benzyl)-1H-indazol-3-ylamine (2 gr,
7.72 mmol) in dry pyridine (20 mL) was added to the cooled reaction
mixture under nitrogen atmosphere. The resulting mixture was
allowed to react overnight at room temperature, then the solvent
removed under reduced pressure. The residue was taken-up with EtOAc
and washed with acqueous NaHCO.sub.3 sat. sol., water and brine.
Organic phase was dried over sodium sulfate and evaporated to
dryness. The crude was purified by flash chromatography on silica
gel using AcOEt/Hexane 7:3 as the eluant, affording 3.9 g of the
title compound.
[0861] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.38-1.57 (m,
2H) 1.65-1.74 (m, 1H) 1.91-1.98 (m, 1H) 3.25-3.44 (m, 2H) 3.70-3.78
(m, 1H) 3.87 (dd, J=11.92, 4.09 Hz, 1H) 4.04 (s, 2H) 4.47-4.58 (m,
1H) 6.98 (d, J=1.34 Hz, 2H) 6.99-7.06 (m, 1H) 7.31 (dd, J=8.68,
1.47 Hz, 1H) 7.45 (d, J=8.56 Hz, 1H) 7.54 (s, 1H) 8.20 (d, J=8.56
Hz, 1H) 8.36 (d, J=2.32 Hz, 1H) 8.51 (dd, J=8.56, 2.08 Hz, 1H)
11.2.8 (s, 1H) 12.85 (s, 1H)
[0862] Conversion 4
Preparation of
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-amino-2-[tetrahydro-2H-pyran-
-4-yl(trifluoroacetyl)amino]benzamide
[0863] A mixture of
N[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-nitro-2-[tetrahydro-2H-pyran--
4-yl(trifluoroacetyl)amino]benzamide (3.86 g, 6.4 mmol),
cyclohexene (10 mL), dioxane (70 mL) and 10% Pd/C (0.42 g) was
stirred at 100.degree. C. for 4 hours. The reaction mixture was
filtered over a celite pad washing thoroughly with THF and MeOH.
After evaporation of the organic phase, purification of the crude
by chromatography over silica gel (DCM/EtOH 9/1) gave 2.75 g of
title compound (82% yield).
[0864] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.29 (qd,
J=12.28, 4.63 Hz, 1H) 1.56 (qd, J=-12.19, 4.51 Hz, 1H) 1.62 (ddd,
J=12.93, 3.47, 2.01 Hz, 1H) 1.84 (ddd, J=12.47, 3.93, 2.01 Hz, 1H)
3.33 (m, 2H) 3.77 (dd, J=11.58, 4.39 Hz, 1H) 3.88 (dd, J=11.65,
4.33 Hz, 1H) 4.00 (s, 2H) 4.43 (tt, J=11.93, 3.86 Hz, 1H) 5.96 (s,
2H) 6.50 (d, J=2.32 Hz, 1H) 6.68 (dd, J=8.47, 2.26 Hz, 1H)
6.89-6.97 (m, 2H) 7.01 (tt, J=9.43, 2.33 Hz, 1H) 7.25 (dd, 1H) 7.39
(m, 2H) 7.68 (d, J=8.54 Hz, 1H) 10.33 (s, 1H) 12.64 (s, 1H)
[0865] Conversion 6
Preparation of tert-butyl
3-{[(4-{[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]carbamoyl}-3-[tetrahydro--
2H-pyran-4-yl(trifluoroacetyl)amino]phenyl)amino]methyl}azetidine-1-carbox-
ylate
[0866] To a solution of
N[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-amino-2-[tetrahydro-2H-pyran--
4-yl(trifluoroacetyl)amino]benzamide (240 mg, 0.42 mmol)
dichloromethane (20 mL) were added tert-butyl
3-formylazetidine-1-carboxylate (116 mg, 0.63 mmol),
trifluoroacetic acid (0.32 mL) and tetramethylammonium
triacetoxyborohydride (165 mg g, 0.63 mmol). The mixture was
stirred at room temperature overnight, then diluted with
dichloromethane, washed with NaHCO.sub.3 sat. sol. and brine, dried
over sodium sulfate and evaporated to dryness.
[0867] ESI(+) MS: m/z 743 (MH.sup.+).
[0868] Operating in a way analogous to that described above, the
following compound was obtained:
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-[(1-methylpiperidin-4-yl)amin-
o]-2-[tetrahydro-2H-pyran-4-yl(trifluoroacetyl)amino]benzamide
[0869] ESI(+) MS: m/z 671 (MH.sup.-).
Preparation of tert-butyl
3-({[4-{[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]carbamoyl}-3-(tetrahydro--
2H-pyran-4-ylamino)phenyl]amino}methyl)azetidine-1-carboxylate
[0870] tert-butyl
3-{[(4-{[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]carbamoyl}-3-[tetrahydro--
2H-pyran-4-yl(trifluoroacetyl)amino]phenyl)amino]methyl}azetidine-1-carbox-
ylate (760 mg, 1.02 mmol) was dissolved in MeOH (12 mL) and TEA (4
mL) and stirred at room temperature overnight. Volatiles were
evaporated and the residue was taken-up with DCM and washed with
brine. Organic phase was dried over sodium sulfate and evaporated
to dryness.
[0871] ESI(+) MS: m/z 647 (MH.sup.+).
[0872] Operating in a way analogous to that described above, the
following compound was obtained:
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-[(1-methylpiperidin-4-yl)amin-
o]-2-[tetrahydro-2H-pyran-4-ylamino]benzamide [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=4-[(1-methylpiperidin-4-yl)amino]-2[tetrahydro-2H-pyran-4-ylamino]-phe-
nyl] cpd. 108
##STR00128##
[0874] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.28-1.50 (m,
4H) 1.80-1.99 (m, 4H) 2.06 (t, J=12.54 Hz, 2H) 2.19 (s, 3H) 2.75
(d, J=12.19 Hz, 2H) 3.40 (m, 1H) 3.45 (ddd, J=11.83, 10.12. 2.32
Hz, 2H) 3.83 (dt, J=11.68, 3.86 Hz, 2H) 4.03 (s, 2H) 5.87 (d,
J=1.71 Hz, 1H) 5.90 (dd, J=8.78, 1.95 Hz, 1H) 5.93 (d, J=7.93 Hz,
1H) 5.95 (s, 1H) 6.98 (m, 3H) 7.24 (dd, J=8.66, 1.59 Hz, 1H) 7.39
(d, J=8.54 Hz, 1H) 7.47 (br. s., 1H) 7.69 (d, J=8.90 Hz, 1H) 8.30
(d, J=7.44 Hz, 1H) 9.88 (s, 1H) 12.57 (s, 1H)
Preparation of
4-[(azetidin-3-ylmethyl)amino]-N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-
-2-(tetrahydro-2H-pyran-4-ylamino)benzamide [(I.sub.A), R1=R2=R3=H,
R=3,5-difluorophenyl,
Ar=4[(azetidin-3-ylmethyl)amino]-2-[tetrahydro-2H-pyran-4-ylamino]phenyl]
cpd. 109
##STR00129##
[0876] tert-butyl
3-({[4-{[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]carbamoyl
-3-(tetrahydro-2H-pyran-4-ylamino)phenyl]amino}methyl)azetidine-1-carboxy-
late (738 mg, 1.1 mmol) was dissolved in DCM (12 mL) and TFA (3 mL)
was added. The resulting reaction solution was stirred for 3 hours
at room temperature. The mixture was diluted with DCM and extracted
with 10% acqueous NH.sub.3. Acqueous phase was extracted several
time with DCM. Collected organic phases were washed with brine,
dried over sodium sulfate and evaporated to dryness. Column
chromatography purification on silica gel using
dichloromethane/methanol/NH.sub.3 5N in MeOH 70:30:1 as the eluant,
afforded 150 mg of the title compound.
[0877] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.30-1.42 (m,
2H) 1.87-2.00 (m, 2H) 2.77-2.88 (m, 1H) 3.24-3.33 (m, 4H) 3.42-3.53
(m, 2H) 3.53-3.60 (m, 3H) 3.78-3.88 (m, 2H) 4.05 (s, 2H) 5.86 (s,
1H) 5.90 (d, J=8.66 Hz, 1H) 6.07-6.13 (m, 1H) 6.95-7.04 (m, 3H)
7.25 (dd, J=8.60, 1.52 Hz, 1H) 7.40 (d, J=8.66 Hz, 1H) 7.48 (s, 1H)
7.70 (d, J=8.78 Hz, 1H) 8.35 (d, J=7.19 Hz, 1H) 9.90 (s, 1H) 12.59
(br. s., 1H).
EXAMPLE 19
[0878] Step i'
Preparation of
2,6-dichloro-N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]pyridine-3-carboxa-
mide
[0879] 2,6-dichloropyridine-3-carboxylic acid (480 mg, 2.5 mmol)
and thionyl chloride (0.28 mL, 3.75 mmol) were heated in toluene
dry (120 mL) and a few drops of dry DMF at 90.degree. C. for 2
hours Volatiles were evaporated and the residue dissolved in dry
pyridine (15 mL) at 0.degree. C. under nitrogen atmosphere. A
solution of 5-(3,5-difluoro-benzyl)-1H-indazol-3-ylamine (518 mg, 2
mmol) in dry pyridine (7 mL) was added to the cooled reaction
mixture. The resulting mixture was allowed to react overnight at
room temperature, then the solvent removed under reduced pressure.
The residue was taken-up with EtOAc and washed with acqueous
NaHCO.sub.3 sat. sol., water and brine. Organic phase was dried
over sodium sulfate and evaporated to dryness. The crude was
purified by flash chromatography on silica gel using DCM/EtOH 100:4
as the eluant, affording 300 mg of the title compound.
[0880] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 4.09 (s, 2H)
6.93-7.01 (m, 2H) 7.04 (tt, J=9.39, 2.32 Hz, 1H) 7.29 (dd, J=8.54,
1.34 Hz, 1H) 7.45 (d, J=8.54 Hz, 1H) 7.70 (s, 1H) 7.75 (d, J=8.05
Hz, 1H) 8.24 (d, J=7.93 Hz, 1H) 11.04 (s, 1H) 12.80 (s, 1H)
[0881] Operating in a way analogous to that described above, the
following compound was obtained:
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-3,5-difluoropyridine-2-carboxam-
ide
[0882] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 4.07 (s, 2H)
6.93-6.99 (m, 2H) 6.99-7.06 (m, 1H) 7.28 (dd, J=8.66, 1.46 Hz, 1H)
7.45 (d, J=8.41 Hz, 1H) 7.68 (s, 1H) 8.12-8.23 (m, 1H) 8.68 (s, 1H)
10.78 (s, 1H) 12.81 (s, 1H)
Preparation of
6-chloro-N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-2-(tetrahydro-2H-pyra-
n-4-ylamino)pyridine-3-carboxamide
[0883] A solution of
2,6-dichloro-N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]pyridine-3-carboxa-
mide (80 mg, 0.18 mmol) in dioxane (1 mL) was heated at 100.degree.
C. for 24 hours in the presence of DIPEA (0.1 mL, 0.55 mmol) and
tetrahydro-2H-pyran-4-amine. (28 mg, 0.28 mmol) Reaction mixture
was diluted with EtOAc and washed with water. The organic layer was
dried over sodium sulfate, filtered and evaporated. The crude was
purified by flash chromatography on silica gel using :DCM/EtOH 95:5
as the eluant, affording 57 mg of the title compound.
[0884] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.37-1.52 (m,
2H) 1.94 (dd, J=13.05, 2.80 Hz, 2H) 3.47 (td, J=11.16, 2.19 Hz, 2H)
3.80-3.87 (m, 2H) 4.06 (s, 2H) 4.07-4.15 (m, 1H) 6.73 (d, J=8.05
Hz, 1H) 6.93-7.07 (m, 3H) 7.28 (dd, J=8.66, 1.59 Hz, 1H) 7.44 (dd,
J=8.54, 0.49 Hz, 1H) 7.55 (s, 1H) 8.2.9 (d, J=8.17 Hz, 1H) 8.60 (d,
J=7.32 Hz, 1H) 10.74 (s, 1H) 12.79 (s, 1H)
[0885] Operating in a way analogous to that described above, the
following compound was obtained:
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-5-fluoro-3-(tetrahydro-2H-pyran-
-4-ylamino)pyridine-2-carboxamide
[0886] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.34-1.52 (m,
2H) 1.95 (d, J=10.36 Hz, 2H) 3.45-3.54 (m, 2H) 3.68-3.77 (m, 1H)
3.82-3.89 (m, 2H) 4.07 (s, 2H) 6.97-7.05 (m, 3H) 7.28 (dd, J=8.66,
1.59 Hz, 1H) 7.37 (dd, J=12.44, 2.32 Hz, 1H) 7.43 (d, J=8.54 Hz,
1H) 7.65 (s, 1H) 7.88 (d, J=2.32 Hz, 1H) 8.55 (d, J=6.95 Hz, 1H)
10.46 (s, 1H) 12.76 (s, 1H)
Preparation of
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-5-(4-methylpiperazin-1-yl)-3-(-
tetrahydro-2H-pyran-4-ylamino)pyridine-2-carboxamide [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=5-(4-methylpiperazin-1-yl)-3-(tetrahydro-2H-pyran-4-ylamino)pyridine]
cpd. 113
##STR00130##
[0888] A solution of
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-5-fluoro-3-(tetrahydro-2H-pyra-
n-4-ylamino)pyridine-2-carboxamide (92.5 mg, 1.92 mmol) and
N-methylpiperazine (20 was stirred at 60.degree. C. for 48 hours.
The reaction mixture was then diluted with EtOAc and washed with
NaHCO.sub.3 sat.sol. The organic layer was dried over sodium
sulfate, filtered and evaporated. The crude was purified by flash
chromatography on silica gel using DCM/EtOH/NH.sub.3 5N in MeOH
100:5:0.5 as the eluant, affording 600 mg of the title
compound.
[0889] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.34-1.47 (m,
2H) 1.92-2.00 (m, 2H) 2.25 (s, 3H) 2.44-2.49 (m, 4H) 3.34-3.40 (m,
4H) 3.48-3.56 (m, 2H) 3.72-3.81 (m, 1H) 3.82-3.88 (m, 2H) 4.07 (s,
2H) 6.54 (d, J=2.20 Hz, 1H) 6.95-7.07 (m, 3H) 7.26 (dd, J=8.66,
1.59 Hz, 1H) 7.41 (d, J=8.54 Hz, 1H) 7.72 (s, 1H) 7.73 (d, J=2.32
Hz, 1H) 8.32 (d, J=8.05 Hz, 1H) 10.19 (s, 1H) 12.66 (s, 1H)
[0890] Operating in an analogous way, the following compound was
obtained:
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-6-(4-methylpiperazin-1-yl)-2-(t-
etrahydro-2H-pyran-4-ylamino)pyridine-3-carboxamide [(I.sub.A),
R1=R2=R3=H, R=3,5-difluorophenyl,
Ar=6-(4-methylpiperazin-1-yl)-2-(tetrahydro-2H-pyran-4-ylamino)pyridine]
cpd. 114
##STR00131##
[0892] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.35-1.47 (m,
2H) 1.90-2.00 (m, 2H) 2.2.2 (s, 3H) 2.36-2.40 (m, 4H) 3.41-3.51 (m,
2H) 3.57-3.63 (m, 4H) 3.78-3.88 (m, 2H) 4.05 (s, 2H) 4.06-4.11 (m,
1H) 6.10 (d, J=8.90 Hz, 1H) 6.96-7.05 (m, 3H) 7.25 (dd, J=8.66,
1.59 Hz, 1H) 7.41 (d, J=8.66 Hz, 1H) 7.50 (s, 1H) 8.10 (d, J=9.02
Hz, 1H) 8.73 (d, J=6.95 Hz, 1H) 10.06 (s, 1H) 12.63 (s, 1H).
EXAMPLE 20
Step v
Preparation of tert-butyl
4-{[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]carbamoyl}-3-(tetrahydro-2H-py-
ran-4-ylamino)phenyl]piperazine-1-carboxylate
[0893] To a solution of
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-piperazin-1-yl-2-(tetrahydr-
o-pyran-4-ylamino)-benzamide (71.7 mg, 0.131 mmol) in anhydrous
dichloromethane (3.0 mL) and triethylamine (0.052 mL, 38.1 mg,
0.377 mmol) di-tert-butyl-dicathonate (34.5 mg, 0.157 mmol) was
added, and the solution was stirred at room temperature for 40
minutes. The mixture was evaporated to dryness and purified by
flash chromatography on silica gel eluting with
dichloromethane/methanol 9:1. affording 60 mg of title
compound.
[0894] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.28-1.41 (m,
2H) 1.44 (s, 9H) 1.90-1.99 (m, 2H) 3.24-3.30 (m, 4H) 3.46 (d,
J=1.88 Hz, 4H) 3.48-3.54 (m, 2H) 3.64-3.74 (m, 1H) 3.79-3.86 (m,
2H) 4.05 (s, 2H) 6.16 (d, J=2.19 Hz, 1H) 6.25 (dd, J=8.90, 2.19 Hz,
1H) 6.95-7.04 (m, 3H) 7.26 (dd, J=8.66, 1.46 Hz, 1H) 7.41 (d,
J=8.90 Hz, 1H) 7.49 (s, 1H) 7.82 (d, J=9.15 Hz, 1H) 8.29 (d, J=7.44
Hz, 1H) 10.10 (s, 1H) 12.64 (s, 1H)
Preparation of ethyl
5-(3,5-difluorobenzyl)-3-({[4-(piperazin-1-yl]-2-(tetrahydro-2H-pyran-4-y-
lamino)phenyl]carbonyl}amino)-1H-indazole-1-carboxylate
[0895] To a solution of tert-butyl
4-[4-{[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]carbamoyl}-3-(tetrahydro-2H-
-pyran-4-ylamino)phenyl]piperazine-1-carboxylate (0.013 mmol) in
anhydrous tetrahydrofurane (1.0 mL) maintained at -50.degree. C.
under argon atmosphere a 1M solution of LiHMSD in anhydrous
tetrahydrofurane(0.015 mL) was added. After stirring at that
temperature for 5 minutes ethyl chlorocarbonate (0.002 mL, 1.63 mg,
0.015 mmol) was added. After 30 minutes at -50.degree. C. the
reaction was completed. After diluting with dichloromethane, the
solution was washed with brine, dried over sodium sulphate and
evaporated to dryness. The crude was dissolved in dichloromethane
(1 mL), trifluoroacetic acid (0.1 mL) was added and the mixture was
stirred at room temperature overnight. After diluting with
dichloromethane, the solution was washed with sodium
hydrogencarbonate, with brine, dried over sodium sulphate and
evaporated to dryness.
[0896] The crude was purified by flash chromatography on silica gel
eluting with dichloromethane/methanol 9:1 and a 0.5% of aq. 33%
NH.sub.4OH affording the title compound.
[0897] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.30-1.38 (m,
2H) 1.40 (t, J=7.13 Hz, 3H) 1.90-1.99 (m, 2H) 2.79-2.86 (m, 4H)
3.18-3.23 (m, 4H) 3.47-3.54 (m, 2H) 3.63-3.76 (m, 1H) 3.79-3.86 (m,
2H) 4.11 (s, 2H) 4.48 (q, J=7.15 Hz, 2H) 6.11 (d, J=2.07 Hz, 1H)
6.24 (dd, J=9.15, 2.19 Hz, 1H) 6.97-7.07 (m, 3H) 7.55 (dd, J=8.66,
1.59 Hz, 1H) 7.67 (d, J=0.73 Hz, 1H) 7.80 (d, J=9.02 Hz, 1H) 8.07
(d, J=8.66 Hz, 1H) 8.24 (d, J=7.56 Hz, 1H) 10.65 (br. s., 1H)
Preparation of 1-(acetyloxy)ethyl
4-[4-{[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]carbamoyl}-3-(tetrahydro-2H-
-pyran-4-ylamino)phenyl]piperazine-1-carboxylate
[0898] To a solution of
N-[5-(3,5-Difluoro-benzyl)-1H-indazol-3-yl]-4-piperazin-1-yl-2-(tetrahydr-
o-pyran-4-ylamino)-benzamide in chloroform (5.0 mL), cooled to
0.degree. C. under nitrogen, 1,8-bis(dimethylamino)naphtalene (21.4
mg, 0.1 mmol) and (1-chloroethyl)chloroformate (0.011 mL, 14.3 mg,
0.1 mmol) were added. After stirring for 2 hours at room
temperature the mixture was diluted with dichloromethane (30 mL),
washed with saturated sodium hydrogencarbonate solution (3mL),
brine (3.times.5 mL), dried over sodium sulphate and evaporated to
dryness. The crude was dissolved in glacial acetic acid (2.0 mL),
mercury(II) acetate (31.9 mg, 0.1 mmol) was added and the mixture
was stirred at room temperature for 1.5 hours. After removing the
solvent, the crude was taken up with dichloromethane, washed with
saturated sodium hydrogencarbonate solution (3.times.3mL), brine
(3.times.5 mL), dried over sodium sulphate and evaporated to
dryness to yield 50 mg of yellowish foam that was purified by flash
chromatography on silica gel eluting with ethyl acetate and a 0.5%
of aq. 33'%.COPYRGT. NH.sub.4OH affording 35 mg of the title
compound.
[0899] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.29-1.42 (m,
2H) 1.46 (d, J=5.49 Hz, 3H) 1.90-1.98 (m, 2H) 2.03-2.06 (m, 3H)
3.30-3.50 (m, 8H) 3.45-3.52 (m, 2H) 3.64-3.74 (m, 1H) 3.79-3.86 (m,
2H) 4.05 (s, 2H) 6.16 (d, J=2.07 Hz, 1H) 6.25 (dd, J=9.02, 2.07 Hz,
1H) 6.67-6.73 (m, 1H) 6.94-7.05 (m, 3H) 7.26 (dd, J=8.66, 1.59 Hz,
1H) 7.41 (d, J=8.66 Hz, 1H) 7.49 (s, 1H) 7.82 (d, J=9.02 Hz, 1H)
8.30 (d, J=7.68 Hz, 1H) 10.11 (s, 1H) 12.64 (s, 1H)
Preparation of ethyl
5-(3,5-difluorobenzyl)-3-({[4-(4-methylpiperazin-1-yl)-2-(tetrahydro-2H-p-
yran-4-ylamino)phenyl]carbonyl}amino)-1H-indazole-1-carboxylate
[(XXVII), R1=R2=R3=H, R-3,5-difluorophenyl,
Ar=4-(4-methylpiperazin-1-yl)-2-(tetrahydro-2H-pyran-4-ylamino)phenyl,
PG=ethoxycarbonyl] cpd. 140
[0900] To a solution of
N-[5-(3,5-difluoro-benzyl)-1H-indazol-3-yl]-4-(4-methyl-piperazin-1-yl)-2-
-(tetrahydro-pyran-4-ylamino)-benzamide (200 mg, 0.356 mmol) in
anhydrous tetrahydrofurane (9 mL) maintained at -50.degree. C.
under nitrogen atmosphere a 1M solution of LiHMSD in anhydrous
tetrahydrofurane (0.374 mL) was added. After stifling at that
temperature for 5 minutes ethyl chloroformate (0.036 mL, 0.374
mmol) was added. After 1 hour at -50.degree. C. the reaction was
completed. Reaction mixture was diluted with water/EtOAc, washed
with brine, dried over sodium sulphate and evaporated to dryness.
The crude was purified by flash chromatography on silica gel
eluting with DCM/ethanol 100:5, affording 140 mg (62% yield) of the
title compound.
[0901] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.39 (t,
J=7.07 Hz, 3H) 2.25 (br. s., 3H) 2.46 (br. s., 4H) 3.50 (ddd,
J=11.83, 10.06, 2.26 Hz, 1H) 3.66-3.75 (m, 1H) 3.81 (dt, J=11.61,
3.76 Hz, 2H) 4.10 (s, 2H) 4.47 (q, J=7.15 Hz, 2H) 6.13 (d, J=1.95
Hz, 1H) 6.25 (dd, J=9.08, 2.13 Hz, 1H) 7.54 (dd, J=8.66, 1.59 Hz,
1H) 7.66 (dd, J=1.46, 0.73 Hz, 1H) 7.80 (d, J=9.15 Hz, 1H) 8.07 (d,
J=8.66 Hz, 1H) 8.24 (d, J=7.68 Hz, 1H) 10.65 (s, 1H)
[0902] Operating in a way analogous to that described above, the
following compounds were obtained:
2-methoxyethyl
5-(3,5-difluorobenzyl)-3-({[4-(4-methylpiperazin-1-yl)-2-tetrahydro-2H-py-
ran-4-ylamino)phenyl]carbonyl}amino)-1H-indazole4-carboxylate
[0903] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.30-1.43 (m,
2H) 1.90-2.00(m, 2H) 2.26 (br. s., 3H) 2.47 (br. s., 4H) 3.27-3.33
(m, 7H) 3.46-3.55 (m, 2H) 3.67-3.74 (m, 3H) 3.79-3.85 (m, 2H) 4.11
(s, 2H) 4.54-4.59 (m, 2H) 6.14 (d, J=1.71 Hz, 1H) 6.26 (dd, J=9.02,
2.19 Hz, 1H) 6.97-7.09 (m, 3H) 7.56 (dd, J=8.72, 1.52 Hz, 1H) 7.67
(d, J=0.85 Hz, 1H) 7.81 (d, J=9.15 Hz, 1H) 8.07 (d, J=8.54 Hz, 1H)
8.25 (d, J=7.56 Hz, 1H) 10.68 (s, 1H)
ethyl
5-(3,5-difluorobenzyl)-3[({4-[4-(ethoxycarbonyl)piperazin-1-yl]-2-(t-
etrahydro-2H-pyran-4-ylamino)phenyl}carbonyl)amino]-1H-indazole-1-carboxyl-
ate
[0904] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.22 (t,
J=7.07 Hz, 3H) 1.30-1.38 (m, 2H) 1.40 (t, J=7.07 Hz, 3H) 1.90-2.00
(m, 2H) 3.48-3.54 (m, 2H) 3.71 (d, 1H) 3.78-3.86 (m, 2H) 4.05-4.10
(m, 2H) 4.11 (s, 2H) 4.48 (q, J=7.03 Hz, 2H) 6.15 (d, J=2.07 Hz,
1H) 6.26 (dd, J=9.15, 2.19 Hz, 1H) 6.95-7.07 (m, 2H) 7.55 (dd,
J=8.66, 1.59 Hz, 1H) 7.67 (d, J=0.85 Hz, 1H) 7.83 (d, J=9.15 Hz,
1H) 8.08 (d, J=8.78 Hz, 1H) 8.25 (d, J=7.80 Hz, 1H) 10.68 (s,
1H)
EXAMPLE 21
Preparation of 4-fluoro-2-nitro-benzoic acid tert-butyl ester
[0905] A solution of 4-fluoro-2-nitro benzoic acid (10 g, 54 mmol),
(Boc).sub.2O (2 eq., 23.6 g, 108 mmol) and
4-(N,N-dimethylamino)pyridine (0.3 eq., 198 g, 16.2 mmol) in
tert-butanol (100 mL) and dichloromethane (100 mL) was stirred at
room temperature for 20 hours. The reaction mixture was then
diluted with ethyl acetate (500 mL), washed with 1N HCl (500 mL),
water (500 mL), brine (500 mL), dried over sodium sulfate and
evaporated to dryness. The title compound was obtained as pale
yellow oil (quantitative) and it was used in the next step without
any further purification.
[0906] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 8.04 (dd,
J=8.47, 2.50 Hz, 1H) 7.95 (dd, J=8.66, 5.37 Hz, 1H) 7.71 (ddd,
J=8.66, 8.17, 2.56 Hz, 1H) 1.51 (s, 9H).
Preparation of 4-(4-methyl-piperazin-1-yl)-2-nitro-benzoic acid
tert-butyl ester
[0907] A solution of 4-fluoro-2-nitro-benzoic acid tert-butyl ester
(13 g, 54 mmol) and N-methylpiperazine (17 mL) was stirred at room
temperature for 6 hours. The reaction mixture was then diluted with
water (800 mL) and maintained under magnetic stirring for 20 hours.
The resulting solid was filtered, washed thoroughly with water and
dried under vacuum at 40.degree. C. The title compound was obtained
as yellow solid (16.4 g, 94% yield) and it was used in the next
step without any further purification.
[0908] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 7.69 (d,
J=8.90 Hz, 1H) 7.29 (d, J=2.56 Hz, 1H), 7.15 (dd, J1=8.90 Hz,
J2=2.56 Hz, 1H), 3.37 (m, 4H), 2.44 (m, 4H), 1.46 (s, 9H).
[0909] Operating in an analogous way, the following compounds were
obtained:
4-[(2-Dimethylamino-ethyl)methyl-amino]-2-nitro-benzoic acid
tert-butyl ester
[0910] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 7.67 (d,
J=8.9 Hz, 1H), 6.98 (d, J=2.6 Hz, 1H), 6.89 (dd, J1=8.9 Hz, J2=2.6
Hz, 1H), 3.54 (m, 2H), 3.02 (s, 3H), 2.40 (m, 2H), 2.19 (s, 6H),
1.46 (s, 9H).
4-(4-Dimethylamino-piperidin-1-yl)-2-nitro-benzoic acid tert-butyl
ester
[0911] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 7.67 (d,
J=9.0 Hz, 1H), 7.26 (d, J=2.6 Hz, 1H), 7.13 (dd, J1=9.0 Hz, J2=2.6
Hz, 1H), 3.96 (m, 2H), 2.93 (m, 2H), 2.36 (m, 1H), 2.20 (s, 6H),
1.82 (m, 2H), 1.46 (s, 9H), 1.40 (m, 2H).
4-[(3-Dimethylamino-propyl)-methyl-amino]-2-nitro-benzoic acid
tert-butyl ester
[0912] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 7.67 (d,
J=9.0 Hz, 1H), 7.02 (d, J=2.6 Hz, 1H), 6.90 (dd, J1=9.0 Hz, J2=2.6
Hz, 1H), 3.46 (m, 2H), 3.00 (s, 3H), 2.22 (m, 2H), 2.14 (s, 6H),
1.65 (m, 2H), 1.45 (s, 9H).
tert-butyl 4-(4-methyl-1,4-diazepan-1-yl)-2-nitrobenzoate
[0913] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.44 (s, 9H)
1.85 (m, 2H) 2.25 (s, 3H) 2.43 (m, 2H) 2.60 (m, 2H) 3.51 (t, 2H)
3.60 (t, 2H) 6.91 (dd, J1=9.02 Hz, J2=2.66 Hz, 1H) 7.02 (d, J=2.56
Hz, 1H) 7.64 (d, J=8.90 Hz, 1H)
tert-butyl 2-nitro-4-(piperazin-1-yl)benzoate
[0914] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.46 (m, 9H)
2.81 (m, 4H) 3.33 (m, 4H) 7.12 (dd, J1=8.90 Hz, J2=2.56 Hz, 1H)
7.25 (d. J=2.56 Hz, 1H) 7.65 (d, J=8.90 Hz, 1H)
tert-butyl
2-nitro-4-[(2S)-2-(pyrrolidin-1-ylmethyl)pyrrolidin-1-yl]benzoa-
te
[0915] ESI(+) MS: m/z 376 (MH.sup.+).
Preparation of 2-amino-4-(4-methyl-piperazin-1-yl)-benzoic acid
tert-butyl ester
[0916] A mixture of 4-(4-methyl-piperazin-1-yl)-2-nitro-benzoic
acid tert-butyl ester (13.3 g, 41.5 mmol) cyclohexene (45 mL),
ethanol (300 mL) and 10% Pd/C (0.4 g) was stirred at 80.degree. C.
for 7 hours. More 10% Pd/C was added (0.9 g) and the mixture
stirred at 80.degree. C. for additional 4 hours. The reaction
mixture was filtered over a celite pad washing thoroughly with
ethanol and the filtrate was evaporated to dryness affording the
title compound as a pale yellow solid (11.5 g, 95% yield).
[0917] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 7.47 (d,
J=9.0 Hz, 1H), 6.40 (bs, 2H), 6.18 (dd, J1=9.0 Hz, J2=2.4 Hz, 1H),
6.11 (d, J=2.4 Hz, 1H), 3.16 (m, 4H), 2.41 (m, 4H), 2.21 (s, 3H),
1.49 (s, 9H).
[0918] Operating in an analogous way, the following compounds were
obtained:
2-Amino-4-[(2-dimethylamino-ethyl)-methyl-amino]-benzoic acid
tert-butyl ester
[0919] ESI(+) MS: m/z 294 (MH.sup.+).
2-Amino-4-[(3-dimethylamino-propyl)-methyl-amino]-benzoic acid
tert-butyl ester
[0920] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 7.45 (d,
J=9.0 Hz, 1H), 6.36 (bs, 2H), 5.99 (dd, J1=9.0 Hz, J2=2.6 Hz, 1H),
5.86 (d, J=2.6 Hz, 1H), 3.31 (m, 2H), 2.87 (s, 3H), 2.22 (m, 2H),
2.15 (s, 6H), 1.62 (m, 2H). 1.48 (s, 9H).
tert-butyl
2-amino-4-[4-(trifluoroacetyl)piperazin-1-yl]benzoate
[0921] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.51 (s, 9H)
3.28-3.35 (m, 4H) 3.66-3.74 (m, 4H) 6.15 (d, J=2.44 Hz, 1H) 6.21
(dd, J=9.14, 2.44 Hz, 1H) 6.47 (br. s., 2H) 7.50-7.53 (m, 1H)
tert-butyl 2-amino-4-[4-(dimethylamino)piperidin-1-yl]benzoate
[0922] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.31-1.45 (m,
2H) 1.49-1.52 (m, 9H) 1.75-1.81 (m, 2H) 2.17 (s, 6H) 2.20-2.30 (m,
1H) 2.69-2.79 (m, 2H) 3.71-3.80 (m, 2H) 6.12 (d, J=2.41 Hz, 1H)
6.18 (dd, J=9.14, 2.44 Hz, 1H) 6.39 (s, 2H) 7.46 (d, J=9.02 Hz,
1H)
tert-butyl 2-amino-4-(4-methyl-1,4-diazepan-1-yl)benzoate
[0923] ESI(+) MS: m/z 306 (MH.sup.+).
tert-butyl
2-amino-4-[(2S)-2-(pyrrolidin-1-ylmethyl)pyrrolidin-1-yl]benzoa-
te
[0924] ESI(+) MS: m/z 346 (MH.sup.+).
tert-butyl 2-amino-4-(morpholin-4-yl)benzoate
[0925] ESI(+) MS: m/z 279 (MH.sup.+).
Preparation of
4-(4-methyl-piperazin-1-yl)-2-(tetrahydro-pyran-4-ylamino)-benzoic
acid tert-butyl ester
[0926] To a solution of 2-amino-4-(4-methyl-piperazin-1-yl)-benzoic
acid tert-butyl ester (11.5 g, 39.5 mmol) in dichloromethane (340
mL) were added tetrahydro-pyran-4-one (4.5 mL, 49.3 mmol),
trifluoroacetic acid (8.2 mL) and tetramethylammonium
triacetoxyborohydride (15.57 g, 59.2 mmol). The mixture was stirred
at room temperature for 2 hours then washed with 0.5N hydrochloric
acid, with 0.5N NaOH and with a saturated solution of NaHCO.sub.3.
The organic layer was dried over sodium sulfate and evaporated to
dryness affording the title compound as a pale yellow solid (13.3
g, 90% yield).
[0927] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 7.72 (d,
J=7.7 Hz, 1H), 7.58 (d, J=9.1 Hz, 1H), 6.20 (dd, J1=9.1 Hz, J2=2.2
Hz, 1H), 6.08 (d, J=2.2 Hz, 1H), 3.85 (m, 2H), 3.70 (m, 1H), 3.50
(m, 2H), 3.27 (m, 4H), 2.47 (m, 4H), 2.26 (bt, 3H), 1.96 (m, 2H),
1.51 (s, 9H), 1.39 (m, 2H).
[0928] Operating in an analogous way, the following compounds were
obtained:
4[(2-Dimethylamino-ethyl)-methyl-amino]-2(tetrahydro-pyran-4-ylamino)-benz-
oic acid tert-butyl ester
[0929] ESI(+) MS: m/z 378 (MH.sup.+).
4-[(3-Dimethylamino-propyl)-methyl-amino]-2-(tetrahydro-pyran-4-ylamino)-b-
enzoic acid tert-butyl ester
[0930] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 7.70 (bd,
J=7.4 Hz, 1H), 7.54 (d, J=9.0 Hz, 1H), 5.99 (dd, J1=9.0 Hz, J2=2.3
Hz, 1H), 5.79 (d, J=2.3 Hz, 1H), 3.86 (m, 2H), 3.62 (m, 1H) 3.47
(m, 2H), 3.36 (m, 2H), 2.93 (s, 3H), 2.28 (m, 2H), 2.18 (bs, 6H),
1.97 (m, 2H), 1.64 (m,2H) 1.49 (s, 9H), 1.39 (m, 2H).
tert-butyl
2-(tetrahydro-2H-pyran-4-ylamino)-4-[4-(trifluoroacetyl)piperaz-
in-1-yl]benzoate
[0931] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.33-1.45 (m,
2H) 1.51 (s, 9H) 1.92-2.00 (m, 2H) 3.36-3.42 (m, 4H) 3.50 (td,
J=11.18, 2.13 Hz, 2H) 3.70 (d, J=3.05 Hz, 5H) 3.82-3.89 (m, 2H)
6.10 (d, J=2.32 Hz, 1H) 6.21 (dd, J=9.08, 2.26 Hz, 1H) 7.61 (d,
J=9.02 Hz, 1H) 7.73 (d. J=7.68 Hz, 1H)
tert-butyl
4-[4-(dimethylamino)piperidin-1-yl]-2-(tetrahydro-2H-pyran-4-yl-
amino)benzoate
[0932] ESI(+) MS: m/z 404 (MH.sup.+).
tert-butyl
4-(4methyl-1,4-diazepan-1-yl)-2-(tetrahydro-2H-pyran-4-ylamino)-
benzoate
[0933] ESI(+) MS: m/z 390 (MH.sup.+).
tert-butyl
4-[(2S)-2-(pyrrolidin-1-ylmethyl)pyrrolidin-1-yl]-2-(tetrahydro-
-2H-pyran-4-ylamino)benzoate
[0934] ESI(+) MS: m/z 430 (MH.sup.+).
tert-butyl
2-(cyclohexylamino)-4-(4-methylpiperazin-1-yl)benzoate
[0935] ESI(+) MS: m/z 374 (MH.sup.+).
tert-butyl
2-[(1,3-dimethoxypropan-2-yl)amino]-4-(4-methylpiperazin-1-yl)b-
enzoate
[0936] ESI(+) MS: m/z 394 (MH.sup.+).
tert-butyl 2-(benzylamino)-4-(4-methylpiperazin-1-yl)benzoate
[0937] ESI(+) MS: m/z 382 (MH.sup.+).
tert-butyl
4-(4-methylpiperazin-1-yl)-2-{[cis-4-(trifluoromethyl)cyclohexy-
l]amino}benzoate
[0938] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.40-1.50 (m,
2H) 1.51 (s, 9H) 1.57-1.69 (m, 2H) 1.70-1.78 (m, 2H) 1.87 (d,
J=14.27 Hz, 2H) 2.24 (s, 3H) 2.32-2.39 (m, 1H) 2.40-2.48 (m, 4H)
3.27 (br. s., 4H) 3.83-3.94 (m, 1H) 6.05 (d, J=1.95 Hz, 1H) 6.20
(dd, J=9.21, 2.26 Hz, 1H) 7.57 (d, J=9.02 Hz, 1H) 8.04 (d, J=8.05
Hz, 1H)
tert-butyl
4-(4-methylpiperazin-1-yl)-2-{[trans-4-(trifluoromethyl)cyclohe-
xyl]amino}benzoate
[0939] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.18-1.31 (m,
2H) 1.44-1.57 (m, 2H) 1.50 (s, 9H) 1.87-1.94 (m, 2H) 2.07-2.13 (m,
2H) 2.25 (s, 3H) 2.28-2.38 (m, 1H) 2.44 (br. s., 4H) 3.26 (br. s.,
4H) 3.40-3.53 (m, 1H) 6.07 (d, J=2.07 Hz, 1H) 6.18 (dd, J=9.08,
2.26 Hz, 1H) 7.54-7.58 (m, 1H) 7.62 (d, J=7.93 Hz, 1H)
tert-butyl
4-(4-methylpiperazin-1-yl)-2-({cis-4-[(phenylcarbonyl)oxy]cyclo-
hexyl}amino)benzoate
[0940] ESI(+) MS: m/z 494 (MH.sup.+).
tert-butyl
4-(4-methylpiperazin-1-yl)-2-({trans-4-[(phenylcarbonyl)oxy]cyc-
lohexyl}amino)benzoate
[0941] ESI(+) MS: m/z 494 (MH.sup.+).
tert-butyl 2-[(1-methylpiperidin-4-yl)amino]benzoate
[0942] ESI(+) MS: m/z 291 (MH.sup.+).
tert-butyl
2-[(1-methylpiperidin-4-yl)amino]-4-(morpholin-4-yl)benzoate
[0943] ESI(+) MS: m/z 376 (MH.sup.+).
Preparation of
4-(4-methyl-piperazin-1-yl)-2-[(tetrahydro-pyran-4-yl)-(2,2,2-trifluoro-a-
cetyl)-amino]-benzoic acid tert-butyl ester
[0944] To a solution of
4-(4-methyl-piperazin-1-yl)-2-(tetrahydro-pyran-4-ylamino)-benzoic
acid tert-butyl ester (13.3 g, 35.4 mmol) in dry dichloromethane
(350 mL), under argon, at 0.degree. C., were added triethylamine
(7.5 mL, 53.1 mmol) and trifluoroacetic anhydride (6.5 mL, 46.1
mmol). The mixture was stirred at 0.degree. C. for 20 minutes, then
water (350 mL) was dropped. The phases were separated and the
organic phase washed with brine, dried over sodium sulfate and
evaporated to dryness. The crude residue was purified by
chromatography on silica gel using dichloromethane/ethanol 95:5 as
the eluant, affording 12.1 g of the title compound as a pale yellow
solid (73% yield).
[0945] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 7.83 (d,
J=9.0 Hz, 1H), 7.06 (dd, J1=9.0 Hz, J2=2.5 Hz, 1H), 6.82 (J=2.5 Hz,
1H), 4.48 (m, 1H), 3.85 (m, 2H), 3.5-3.3 (m, 6H), 2.49 (m, 4H),
2.26 (bs, 3H), 2.0 (m, 1H), 1.59 (m, 1H), 1.51 (m, 1H), 1.46 (s,
9H), 1.03 (m, 1H).
[0946] Operating in an analogous way, the following compounds were
obtained:
4-[(2-Dimethylamino-ethyl)-methyl-amino]-2-[(tetrahydro-pyran-4-yl)-(2,2,2-
-trifluoro-acetyl)-amino]-benzoic acid tert-butyl ester
[0947] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 7.80 (d,
J=9.1 Hz, 1H), 6.79 (dd, J1=9.1 Hz, J2=2.6 Hz, 1H), 6.51 (d, J=2.6
Hz, 1H), 4.48 (m, 1H), 3.86 (m, 1H), 3.79 (m, 1H), 3.52 (m, 2H),
3.41-3.2.5 (m, 2H), 3.00 (s, 3H), 2.5-2.35 (m, 2H), 2.21 (s, 6H),
1.98 (m, 1H), 1.64-1.45 (m, 3H), 1.44 (s, 9H).
4[(3-Dimethylamino-propyl)-methyl-amino]-2-[(tetrahydro-pyran-4-yl)-(2,2,2-
-trifluoro-acetyl)-amino]-benzoic acid tert-butyl ester
[0948] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 7.79 (d,
J=9.1 Hz, 1H), 6.79 (dd, J1=9.1 Hz, J2=2.6 Hz, 1H), 6.52 (d, J=2.6
Hz, 1H), 4.48 (m, 1H), 3.87 (m, 1H), 3.79 (m, 1H), 3.51-3.32 (m,
4H), 2.98 (s, 3H), 2.22 (m 2H), 2.12 (s, 6H), 1.99 (m, 1H),
1.70-1.46 (m, 4H), 1.44 (s, 9H), 1.03 (m, 1H).
tert-butyl
2-[tetrahydro-2H-pyran-4-yl(trifluoroacetyl)amino]-4-[4-(triflu-
oroacetyl)piperazin-1-yl]benzoate
[0949] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.45 (s, 9H)
1.60 (qd, J=12.21, 4.94 Hz, 2H) 3.73 (t, J=5.12 Hz, 4H) 4.48 (tt,
J=11.96, 3.89 Hz, 1H) 6.84 (d, J=2.56 Hz, 1H) 7.07 (dd, J=8.96,
2.62 Hz, 1H) 7.85 (d, J=9.02 Hz, 1H)
tert-butyl
4-[4-(dimethylamino)piperidin-1-yl]-2-[tetrahydro-2H-pyran-4-yl-
(trifluoroacetyl)amino]benzoate
[0950] ESI(+) MS: m/z 500 (MH.sup.+).
tert-butyl
4-(4-methyl-1,4-diazepan-1-yl)-2-[tetrahydro-2H-pyran-4-yl)trif-
luoroacetyl)amino]benzoate
[0951] ESI(+) MS: m/z 486 (MH.sup.+).
tert-butyl
4-[(2S)-2-(pyrrolidin-1-ylmethyl)pyrrolidin-1-yl]-2-[tetrahydro-
-2H-pyran-4-yl(trifluoroacetyl)amino]benzoate
[0952] ESI(+) MS: m/z 526 (MH.sup.+).
tert-butyl
2-[cyclohexyl(trifluoroacetyl)amino]-4-(4-methylpiperazin-1-yl)-
benzoate
[0953] ESI(+) MS: m/z 470 (MH.sup.+).
tert-butyl
2[(1,3-dimethoxypropan-2-yl)(trifluoroacetyl)amino]-4-(4-methyl-
piperazin-1-yl)benzoate
[0954] ESI(+) MS: m/z 490 (MH.sup.+).
tert-butyl
2-[benzyl(trifluoroacetyl)amino]-4-(4-methylpiperazin-1-yl)benz-
oate
[0955] ESI(+) MS: m/z 478 (MH.sup.+).
tert-butyl
4-(4-methylpiperazin-1-yl)-2{(trifluoroacetyl)[cis-4-(trifluoro-
methyl)cyclohexyl]amino}benzoate
[0956] ESI(+) MS: m/z 538 (MH.sup.+).
tert-butyl
4-(4-methylpiperazin-1-yl)-2-{(trifluoroacetyl)[trans-4-(triflu-
oromethyl)cyclohexyl]amino}benzoate
[0957] ESI(+) MS: m/z 538 (MH.sup.+).
tert-butyl
4-(4-methylpiperazin-1-yl)-2[-{cis-4[(phenylcarbonyl)oxy]cycloh-
exyl}(trifluoroacetyl)amino]benzoate
[0958] ESI(+) MS: m/z 590 (MH.sup.+).
tert-butyl
4-(4-methylpiperazin-1-yl)-2-{trans-4-[(phenylcarbonyl)oxy]cycl-
ohexyl}(trifluoroacetyl)amino]benzoate
[0959] ESI(+) MS: m/z 590 (MH.sup.+).
tert-butyl2-[(1-methylpiperidin-4-yl)(trifluoroacetyl)amino]benzoate
[0960] ESI(+) MS: m/z 387 (MH.sup.+).
tert-butyl
2-[(1-methylpiperidin-4-yl)(trifluoroacetyl)amino]-4-(morpholin-
-4-yl)benzoate
[0961] ESI(+) MS: m/z 472 (MH.sup.+).
tert-butyl
4-(4-methylpiperazin-1-yl)-2-[(phenyl(trifluoroacetyl)amino]ben-
zoate
[0962] ESI(+) MS: m/z 464 (MH.sup.+).
Preparation of
4-(4-methyl-piperazin-1-yl)-2-[(tetrahydro-pyran-4-yl)-(2,2,2-trifluoro-a-
cetyl)-amino]-benzoic acid trifluoroacetate
[0963] A mixture of
4-(4-methyl-piperazin-1-yl)-2-[(tetrahydro-pyran-4-yl)-(2,2,2-trifluoro-a-
cetyl)-amino]-benzoic acid tert-butyl ester (12.1 g, 25.7 mmol),
trifluoroacetic acid (48.5 mL) and dichloromethane (195 mL) was
stirred at room temperature for 2 hours. The volatiles were then
evaporated, the residue taken up with diethylether and evaporated
again. The procedure was repeated for 5 times, then the solid was
triturated with diethylether, filtered and dried in oven at
40.degree. C. affording the title compound as a pale brown solid
(13.4 g).
[0964] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 12.78 (bs,
1H), 9.74 (bs, 1H), 7.93 (d, J=8.8 Hz, 1H), 7.13 (dd, J1=8.8 Hz,
J2=2.5 Hz, 1H), 6.98 (d, J=2.5 Hz, 1H), 4.49 (m, 1H), 4.11 (m, 2H),
3.84 (m, 2H), 3.6-3.0 (m, 8H), 2.89 (s, 3H), 1.98 (m, 1H), 1.59 (m,
1H), 1.53 (m, 1H), 1.08 (m, 1H).
[0965] Operating in an analogous way, the following compounds were
obtained:
4-[(2-Dimethylamino-ethyl)-methyl-amino]-2-[(tetrahydro-pyran-4-y)-(2,2,2--
trifluoro-acetyl)-amino]-benzoic acid trifluoroacetate
[0966] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 12.56 (bs,
1H), 9.49 (bs, 1H), 7.88 (d, J=8.9 Hz, 1H), 8.92 (dd, J1=8.9 Hz,
J2=2.6 Hz, 1H), 6.63 (d, J=2.6 Hz, 1H), 4.49 (m, 1H), 3.9-3.2 (m,
8H), 3.02 (s, 3H), 2.85 (s, 6H), 1.98 (m, 1H), 1.62-1.49 (m, 2H),
1.08 (m, 1H).
4-[(3-Dimethylamino-propyl)methyl-amino]-2-[(tetrahydro-pyran-4-yl)-(2,2,2-
-trifluoro-acetyl)-amino]-benzoic acid trifluoroacetate
[0967] ESI(+) MS: m/z 432 (MH.sup.+).
2-[tetrahydro-2H-pyran-4-yl(trifluoroacetyl)amino]-4-[4-(trifluoroacetyl)p-
iperazin-1-yl]benzoic acid
[0968] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.08 (m,
J=12.35, 12.24, 12.24, 4.76 Hz, 1H) 1.47-1.55 (m, 1H) 1.56-1.67 (m,
1H) 1.91-2.01 (m, 1H) 3.38-3.53 (m) 3.73 (t, J=5.12 Hz, 4H) 3.78
(dd, J=11.52 , 4.45 Hz, 1H) 3.86 (dd, J=11.40, 4.57 Hz, 1H) 4.46
(tt, J=11.87, 3.98 Hz, 1H) 6.85 (d, 1H) 7.06 (dd, J=8.90, 2.68 Hz,
1H) 7.89 (d, J=8.90 Hz, 1H) 12.67 (br. s., 1H)
4-(4-methyl-1,4-diazepan-1-yl)-2-[tetrahydro-2H-pyran-4-yl(trifluoroacetyl-
)amino]benzoic acid hydrochloride
[0969] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 4.42-4.55 (m,
1H) 6.91-6.96 (m, 1H) 7.89 (d, J=9.02 Hz, 1H) 10.14 (br. s., 12.56
(br. s., 1H)
4-[4-(dimethylamino)piperidin-1-yl]-2-[tetrahydro-2H-pyran-4-yl(trifluoroa-
cetyl)amino]benzoic acid hydrochloride
[0970] ESI(+) MS: m/z 444 (MH.sup.+).
4-[(2S)-2-(pyrrolidin-1-ylmethyl)pyrrolidin-1-yl]-2-[tetrahydro-2H-pyran-4-
-yl(trifluoroacetyl)amino]benzoic acid hydrochloride
[0971] ESI(+) MS: m/z 470 (MH.sup.+).
2-[cyclohexyl(trifluoroacetyl)amino]-4-(4-methylpiperazin-1-yl)benzoic
acid hydrochloride
[0972] ESI(+) MS: m/z 414 (MH.sup.+).
2-[(1,3-dimethoxypropan-2-yl)(trifluoroacetyl)amino]-4-(4-methylpiperazin--
1-yl)benzoic acid hydrochloride
[0973] ESI(+) MS: m/z 434 (MH.sup.+).
2-[benzyl(trifluoroacetyl)amino]-4-(4-methylpiperazin-1-yl)benzoic
acid hydrochloride
[0974] ESI(+) MS: m/z 422 (MH.sup.+).
4-(4-methylpiperazin-1-yl)-2-{(trifluoroacetyl)[cis-4-(trifluoromethyl)cyc-
lohexyl]amino}benzoic acid trifluoroacetate
[0975] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.09-1.90
(4m, 8H) 2.36-2.46 (m, 1H) 2.88 (br. s., 3H) 2.99-3.25 (m, 4H) 3.49
(br. s., 2H) 3.96-4.16 (m, 2H) 4.27-4.37 (m, 1H) 7.00 (d, J=2.32
Hz, 1H) 7.12 (dd, J=8.90, 2.44 Hz, 1H) 7.92 (d, J=8.90 Hz, 1H) 9.67
(br. s., 1H) 12.80 (s, 1H)
4-(41-methylpiperazin-1-yl)-2-{(trifluoroacetyl)[trans-4-(trifluoromethyl)-
cyclohexyl]amino}benzoic acid trifluoroacetate
[0976] ESI(+) MS: m/z 482 (MH.sup.+).
4(4-methylpiperazin-1-yl)-2[{cis-4-[(phenylcarbonyl)oxy]cyclohexyl}(triflu-
oroacetyl)amino]benzoic acid hydrochloride
[0977] ESI(+) MS: m/z 534 (MH.sup.+).
4-(4-methylpiperazin-1-yl)-2-{trans-4-[(phenylcarbonyl)oxy]cyclohexyl}(tri-
fluoroacetyl)amino]benzoic acid hydrochloride
[0978] ESI(+) MS: m/z 534 (MH.sup.+).
2-[(1-methylpiperidin-4-yl)(trifluoroacetyl)amino]benzoic acid
hydrochloride
[0979] ESI(+) MS: m/z 331 (MH.sup.+).
2-[(1-methylpiperidin-4-yl)(trifluoroacetyl)amino]-4-(morpholin-4-yl)benzo-
ic acid hydrochloride
[0980] ESI(+) MS: m/z 416 (MH.sup.+).
4-(4-methylpiperazin-1-yl)-2-[phenyl(trifluoroacetyl)amino]benzoic
acid hydrochloride
[0981] ESI(+) MS: m/z 408 (MH.sup.+).
EXAMPLE 22
Preparation of 2,4-difluoro-benzoic acid tert-butyl ester
[0982] To a solution of 2,4-difluorobenzoic acid (5 g, 31.62 mmol)
in a mixture of dichloromethane (100 mL) and t-BuOH (50 mL) were
added (Boc).sub.2O (13.8 g, 63.24 mmol) and
N,N-dimethylaminopyridine (1.16 g, 9.49 mmol). The solution was
stirred at room temperature for 24 hours then diluted with
dichloromethane and washed twice with IN HCl, NaHCO.sub.3 satured
solution, water (3 times) and brine. The organic phase was dried
over sodium sulfate, filtered and evaporated to give the title
compound (5.70 g, 84%) as yellowish oil.
[0983] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 7.91 (m, 1H),
7.36 (m, 1H) 7.20 (m, 1H), 1.53 (s, 9H).
Preparation of
4-fluoro-2-((S)-2-methoxy-1-methyl-ethylamino)-benzoic acid
tert-butyl ester
[0984] A mixture of 2,4-difluoro-benzoic acid tert-butyl ester (30
g, 140.05 mmol) and (S)-2-methoxy-1-methyl-ethylamine (100 mL) was
stirred at 65.degree. C. for 2 days. A satured solution of
NaHCO.sub.3 was added and the mixture was extracted with
dichloromethane (3 times). The organic phase was washed twice with
water then with brine, dried over sodium sulfate filtered and
evaporated to dryness to obtain a crude, which was purified by
column chromatography on silica gel (exane/ethyl acetate 9:1). The
title compound (33.38 g, 84%) was obtained as oil.
[0985] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 7.87 (d,
J=7.80 Hz, 1H), 7.80 (t, J=7.19 Hz, 1H), 6.60 (dd, J1=13.05 Hz,
J2=2.44 Hz, 1H), 6.36 (m, 1H), 3.80 (m, 3.40 (d, J=4.76 Hz, 2H),
3.30 (s, 3H), 1.53 (s, 9H), 1.17 (d, J=6.58 Hz, 3H).
[0986] Operating in a way analogous to that described above, the
following compounds were obtained:
4-Fluoro-2-((R)-2-methoxy-1-methyl-ethylamino)-benzoic acid
tert-butyl ester
[0987] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 7.87 (d,
J=7.80 Hz, 1H), 7.80 (t, J=7.19 Hz, 1H), 6.60 (dd, J1=13.05 Hz,
J2=2.44 Hz, 1H), 6.36 (m, 1H), 3.80 (m, 1H), 3.40 (d, J=4.76 Hz,
2H), 3.30 (s, 3H), 1.53 (s, 9H), 1.17 (d, J=6.58 Hz, 3H).
4-Fluoro-2-(2-methoxy-ethylamino)-benzoic acid tert-butyl ester
[0988] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 7.89 (t,
J=5.00 Hz, 1H), 7.80 (t, J=7.07 Hz, 1H), 6.56 (dd, J1=12.80 Hz,
J2=2.56 Hz, 1H), 6.37 (m, 1H), 3.55 (t, J=5.37 Hz, 2H), 3.33 (m,
2H), 3.29 (s, 3H), 1.53 (s, 9H).
tert-butyl 4-fluoro-2-[(3-methoxypropyl)amino]benzoate
[0989] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.51-1.53 (m,
9H) 1.76-1.85 (m, 2H) 3.18-3.23 (m, 2H) 3.25 (s, 3H) 3.38-3.44 (m,
2H) 6.32-6.39 (m, 1H) 6.49 (dd, J=12.80, 2.44 Hz, 1H) 7.79 (dd,
J=8.90, 7.07 Hz, 1H) 7.88 (br. s., 1H)
tert-butyl 4-fluoro-2-[(2-fluoroethyl)amino]benzoate
[0990] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.54 (s, 9H)
3.50 (dd, J=27.00, 5.00 Hz, 2H) 4.63 (dt, J=47.56, 4.88 Hz, 2H)
6.41 (td, J=8.57, 2.50 Hz, 1H) 6.62 (dd, J=12.62, 2.38 Hz, 1H) 7.82
(dd, J=8.90, 7.07 Hz, 1H) 8.05 (t, J=4.82 Hz, 1H)
tert-butyl 4-fluoro-2-[(3-fluoropropyl)amino]benzoate
[0991] ESI(+) MS: m/z 272 (MH.sup.+).
tert-butyl
4-fluoro-2-[(1-methoxy-2-methylpropan-2-yl)amino]benzoate
[0992] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.34 (s, 6H)
1.53 (s, 9H) 3.33 (br. s., 3H) 3.40 (s, 2H) 6.31-6.39 (m, 1H) 6.67
(dd, J=13.29, 2.44 Hz, 1H) 7.82 (dd, J=8.84, 7.38 Hz, 1H) 8.22 (s,
1H)
Preparation of
4-fluoro-2-[((S)-2-methoxy-1-methyl-ethyl)-(2,2,2-trifluoro-acetyl)-amino-
]-benzoic acid tert-butyl ester
[0993] A solution of
4-fluoro-2-((S)-2-methoxy-1-methyl-ethylamino)-benzoic acid
tert-butyl ester (1.54 g, 5.44 mmol) in dichloromethane (30 mL) was
cooled to 0.degree.-5.degree. C. Triethylamine (1.11 mL, 8.16 mmol)
and trifluoroacetic anhydride (1.15 mL, 8.16 mmol) were added.
After 3 hours at 0.degree.-5.degree. C. the mixture was washed with
NaHCO.sub.3 natured solution, water and brine. The organic layer
was dried over sodium sulfate, filtered and evaporated to give the
title compound as yellowish oil (2 g, 99%).
[0994] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): (mixture of
tautomers) 8.07 (m, 1H), 7.53 (m, 1H), 7.29 (dd, J1=9.39 Hz,
J2=2.68 Hz, 1H), 4.83 (m, 1H), 3.44 (m, 1H), 3.30 (s, 3H), 1.49 (s,
9H), 0.86 (d, 3H).
[0995] Operating in a way analogous to that described above, the
following compounds were obtained:
4-Fluoro-2-[((R)-2-methoxy-1-methyl-ethyl)-(2,2,2-trifluoro-acetyl)-amino]-
-benzoic acid tert-butyl ester
[0996] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): (mixture of
tautomers) 8.07 (m, 1H), 7.53 (m, 1H), 7.29 (dd, J1=9.39 Hz,
J2=2.68 Hz, 1H), 4.83 (m, 1H), 3.44 (m, 1H), 3.30 (s, 3H), 1.49 (s,
9H), 0.86 (d, 3H).
4-Fluoro-2-[(2-methoxy-ethyl)-(2,2,2-trifluoro-acetyl)-amino]-benzoic
acid tert-butyl ester
[0997] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 8.07 (m, 1H),
7.50 (m, 1H), 7.41 (dd, J1=9.39 Hz, J2=2.56 Hz, 1H), 4.28 (m, 1H),
3.55 (m, 1H), 3.46 (m, 1H), 3.38 (m, 1H), 3.18 (s, 3H), 1.49 (s,
9H).
tert-butyl
4-fluoro-2-[(3-methoxypropyl)(trifluoroacetyl)amino]benzoate
[0998] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.48 (s, 9H)
1.68-1.83 (m, 2H) 3.18 (s, 3H) 3.21-3.29 (m, 1H) 3.33-3.38 (m, 2H)
4.06-4.18 (m, 1H) 7.46-7.52 (m, 1H) 7.56 (dd, J=9.27, 2.68 Hz, 1H)
8.06 (dd, J=8.84, 6.40 Hz, 1H)
tert-butyl
4-fluoro-2-[(2-fluoroethyl)(trifluoroacetyl)amino]benzoate
[0999] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.50 (s, 9H)
3.54-3.74 (m, 1H) 4.26-4.45 (m, 1H) 4.50-4.80 (m, 2H) 7.47-7.55 (m,
2H) 8.08 (dd, J=9.27, 6.46 Hz, 1H)
tert-butyl
4-fluoro-2-[(3-fluoropropyl)(trifluoroacetyl)amino]benzoate
[1000] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.50 (s, 9H)
1.80-2.07 (m, 2H) 3.26-3.42 (m, 1H) 4.21 (ddd, J=13.78, 8.90, 6.71
Hz, 1H) 4.42-4.60 (m, 2H) 7.48-7.55 (m, 1H) 7.60 (dd, J=9.27, 2.44
Hz, 1H) 8.09 (dd, J=8.84, 6.40 Hz, 1H)
tert-butyl
4-fluoro-2-[(1-methoxy-2-methylpropan-2-yl)(trifluoroacetyl)ami-
no]benzoate
[1001] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.09 (s, 3H)
1.47 (s, 3H) 1.52 (s, 9H) 3.17 (s, 3H) 3.19 (d, J=9.75 Hz, 1H) 3.80
(d, J=9.63 Hz, 1H) 7.36 (dd, J=9.45, 2.62 Hz, 1H) 7.47 (td, J=8.41,
2.68 Hz, 1H) 7.93 (dd, J=8.78, 6.46 Hz, 1H)
Preparation of
2-[((S)-2-methoxy-1-methyl-ethyl)-(2,2,2-trifluoro-acetyl)-amino]-4-(4-me-
thyl-piperazin-1-yl)-benzoic acid tart-butyl ester
[1002] A solution of
4-fluoro-2-[((S)-2-methoxy-1-methyl-ethyl)-(2,2,2-trifluoro-acetyl)-amino-
]-benzoic acid tert-butyl ester (2 g, 5.28 mmol) and
N-methylpiperazine (5.86 mL, 52.8 mmol) in tetrahydrofuran (20 mL)
was stirred at 60.degree. C. for 7 days. The solution was then
evaporated, NaHCO.sub.3 satured solution was added and the mixture
extracted with dichloromethane (3 times). The organic layer was
washed with water, brine, dried over sodium sulfate filtered and
evaporated to obtain a crude, which was purified by column
chromatography on silica gel (dichloromethane-methanol 93:7). The
title compound (2.04 g, 84%) was obtained as yellowish solid.
[1003] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): (mixture of
tautomers) 7.81 (d, J=9.15 Hz, 1H), 7.06 (dd, J1=9.15 Hz, J2=2.56
Hz, 1H), 6.79 (d, J=2.56 Hz, 1H), 4.80 (m, 1H), 3.39 (m, 2H),
3.34-3.28 (m, 7H), 2.55 (m, 4H), 2.29 (bs, 3H), 1.46 (s, 9H), 0.83
(d, 3H).
[1004] Operating in a way analogous to that described above, the
following compounds were obtained:
2-[((R)-2-Methoxy-1-methyl-ethyl)-(2,2,2-trifluoro-acetyl)-amino]-4-(4-met-
hyl-piperazin-1-yl)-benzoic acid tert-butyl ester
[1005] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): (mixture of
tautomers) 7.81 (d, J=9.15 Hz, 1H), 7.06 (dd, J1=9.15 Hz, J2=2.56
Hz, 1H), 6.79 (d, J=2.56 Hz, 1H), 4.80 (m, 1H), 3.39 (m, 2H),
3.34-3.28 (m, 7H), 2.55 (m, 4H), 2.29 (bs, 3H), 1.46 (s, 9H), 0.83
(d, 3H).
2-[(2-Methoxy-ethyl)-(2,2,2-trifluoro-acetyl)-amino]-4-(4-methyl-piperazin-
-1-yl)-benzoic acid tert-butyl ester
[1006] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): (mixture of
tautomers) 7.83 (d, J=9.02 Hz, 1H), 7.05 (dd, J1=9.02 Hz, J2=2.68
Hz, 1H), 6.86 (d, J=2.68 Hz, 1H), 4.31 (m, 1H), 3.55 (m, 1H), 3.40
(m, 1H), 3.32 (m, 4H), 3.25 (m, 1H), 3.21 (s, 1H), 2.44 (t, J=5.12
Hz, 4H), 2.22 (bs, 3H), 1.46 (s, 9H).
4[(2-Dimethylamino-ethyl)-methyl-amino]-2-[(2-methoxy-ethyl)-(2,2,2-triflu-
oro-acetyl)-amino]-benzoic acid tert-butyl ester
[1007] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 7.81 (d,
J=8.9 Hz, 1H), 6.78 (dd, J1=8.9 Hz, J2=2.8 Hz, 1H), 6.60 (d, J=2.8
Hz, 1H), 4.40-4.31 (m, 1H), 3.59-3.39 (m, 4H), 3.23 (s, 3H),
3.22-3.15 (m, 1H), 3.00 (s, 3H), 2.40 (m, 2H), 2.19 (bs, 6H), 1.46
(s, 9H).
tert-butyl
2-[(3-methoxypropyl)(trifluoroacetyl)amino]-4-(4-methylpiperazi-
n-1-yl)benzoate
[1008] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.45 (s, 9H)
1.68-1.84 (m, 2H) 2.26 (br. s., 3H) 2.44-2.60 (m, 4H) 3.12-3.23 (m,
1H) 3.18 (s, 3H) 3.25-3.48 (m, 6H) 4.08 (d, J=22.92 Hz, 1H), 6.92
(d, J=2.19 Hz, 1H) 7.02 (dd, J=9.02, 2.44 Hz, 1H), 7.81 (d, J=9.02
Hz, 1H)
tert-butyl
2-[(2-fluoroethyl)(trifluoroacetyl)amino]-4-(4-methylpiperazin--
1-yl)benzoate
[1009] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.46 (s, 9H)
2.22 (s, 3H) 2.43 (t, J=4.76 Hz, 4H) 3.25-3.31 (m, 4H) 3.41-3.59
(m, 1H) 4.27-4.46 (m, 1H) 4.46-4.78 (m, 2H) 6.90 (d, J=2.07 Hz, 1H)
7.05 (dd, J=9.02, 2.68 Hz, 1H) 7.83 (d, J=9.02 Hz, 1H)
tert-butyl
2-[(3-fluoropropyl)(trifluoroacetyl)amino]1-4-(4-methylpiperazi-
n-1-yl)benzoate
[1010] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.46 (s, 9H)
1.80-2.05 (m, 2H) 2.25 (br. s., 3H) 2.46 (br. s., 4H) 3.18-3.37 (m,
5H) 4.10-4.24 (m, 1H) 4.38-4.60 (m, 2H) 6.95 (d, J=2.44 Hz, 1H)
7.04 (dd, J=8.96, 2.62 Hz, 1H) 7.84 (d, J=9.02 Hz, 1H)
tert-butyl
2-[(1-methoxy-2-methylpropan-2-yl)(trifluoroacetyl)amino]-4-(4--
methylpiperazin-1-yl)benzoate
[1011] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.04 (s, 3H)
1.45 (s, 31-1) 1.49 (s, 9H) 2.22 (s, 3H) 2.44 (t, J=4.94 Hz, 4H)
3.20 (d, J=9.51 Hz, 1H) 3.23 (s, 3H) 3.25-3.30 (m, 4H) 3.93 (d,
J=9.51 Hz, 1H) 6.89 (d, J=2.32 Hz, 1H) 7.00 (dd, J=8.96, 2.62 Hz,
1H) 7.70 (d, J=8.90 Hz, 1H)
Preparation of
2-[((S)-2-methoxy-1-methyl-ethyl)-(2,2,2-trifluoro-acetyl)-amino]-4-(4-me-
thyl-piperazin-1-yl)-benzoic acid trifluoroacetate
[1012] To a solution of
2-[((S)-2-methoxy-1-methyl-ethyl)-(2,2,2-trifluoro-acetyl)-amino]-4-(4-me-
thyl-piperazin-1-yl)-benzoic acid tert-butyl ester (2.03 g, 4.42
mmol) in dichloromethane (15 mL) trifluoroacetic acid (3.4 mL, 44.2
mmol) was added. The mixture was stirred at room temperature for 15
hours then the solution was evaporated to dryness affording the
title compound as oil that was used for the next step without any
further purification.
[1013] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): (mixture of
tautomers) 12.10 (bs, 1H), 9.74 (bs, 1H), 7.90 (d, J=8.90 Hz, 1H),
7.15 (dd, J1=8.90 Hz, J2=2.56 Hz, 1H), 6.89 (d, J=2.56 Hz, 1H),
4.76 (m, 1H), 4.03 (t, 2H), 3.55 (m, 2H), 3.37 (m, 2H), 3.30 (s,
3H), 3.18 (m, 2H), 2.88 (bs, 3H), 0.85 (d, 3H).
[1014] Operating in a way analogous to that described above, the
following compounds were obtained:
2-[((R)-2-Methoxy-1-methyl-ethyl)-(2,2,2-trifluoro-acetyl)-amino]-4-(4-met-
hyl-piperazin-1-yl)-benzoic acid trifluoroacetate
[1015] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): (mixture of
tautomers) 12.10 (bs, 1H), 9.74 (bs, 1H), 7.90 (d, J=8.90 Hz, 1H),
7.15 (dd, J1=8.90 Hz, J2=2.56 Hz, 1H), 6.89 (d, J=2.56 Hz, 1H),
4.76 (m, 1H), 4.03 (t, 2H), 3.55 (m, 2H), 3.37 (m, 2H), 3.30 (s,
3H), 3.18 (m, 2H), 2.88 (bs, 3H), 0.85 (d, 3H).
2-[(2-Methoxy-ethyl)-(2,2,2-trifluoro-acetyl)-amino]-4-(4-methyl-piperazin-
-1-yl)-benzoic acid trifluoroacetate
[1016] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): (mixture of
tautomers) 12.76 (bs, 1H), 9.73 (bs, 1H), 7.91 (d, J=8.78 Hz, 1H),
7.10 (dd, J1=8.78 Hz, J2=2.68 Hz, 1H), 7.01 (d, J=2.68 Hz, 1H),
4.15 (m, 1H), 4.04 (m, 2H), 3.54 (m, 2H), 3.42 (m, 2H), 3.38 (m,
2H), 3.33 (m, 2H), 3.19 (s, 3H), 3.14 (m, 2H), 2.86 (bs, 3H).
4-[(2-Dimethylamino-ethyl)-methyl-amino]-2-[(2-methoxy-ethyl)-(2,2,2-trifl-
uoro-acetyl)-amino]-benzoic acid hydrochloride
[1017] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 12.59 (bs,
1H), 10.00 (bs, 1H), 7.88 (d, J=8.9 Hz, 1H), 6.92 (dd, J1=8.9 Hz,
J2=2.8 Hz, 1H), 6.74 (8d, J=2.8 Hz, 1H), 4.18 (m, 1H), 3.79 (m,
2H), 3.56 (m, 1H), 3.47-3.36 (m, 2H), 3.24 (m, 2H), 3.21 (s, 3H),
3.01 (s, 3H), 2.84 (bd, 6H).
2-[(3-methoxypropyl)(trifluoroacetyl)amino]-4-(4-methylpiperazin-1-yl)benz-
oic acid hydrochloride
[1018] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.70-1.81 (m,
2H) 2.84 (d, J=2.93 Hz, 3H) 3.06-3.40 (m, 7H) 3.19 (s, 3H) 3.52 (d,
J=10.36 Hz, 2H) 3.96-4.06 (m, 1H) 4.09 (br. s., 2H) 7.07 (d, J=2.56
Hz, 1H) 7.10 (dd, J=8.90, 2.68 Hz, 1H) 7.93 (d, J=8.78 Hz, 1H)
10.27 (br. s., 1H) 12.76 (br. s., 1H)
2-[(2-fluoroethyl)(trifluoroacetyl)amino]-4-(4-methylpiperazin-1-yl)benzoi-
c acid hydrochloride
[1019] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 2.84 (br. s.,
31-1) 3.04-3.30 (m, 4H) 3.47-3.56 (m, 2H) 3.54-3.67 (m, 1H) 4.06
(d, 2H) 4.18-4.40 (m, 1H) 4.46-4.79 (m, 2H) 7.07 (d, J=2.19 Hz, 1H)
7.12 (dd, J=8.96, 2.62 Hz, 1H) 7.91-7.97 (m, 1H) 10.33 (br. s., 1H)
12.83 (br. s., 1H)
2-[(3-fluoropropyl)(trifluoroacetyl)amino]-4-(4-methylpiperazin-1-yl)benzo-
ic acid trifluoroacetate
[1020] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.82-2.02 (m,
2H) 2.87 (s, 3H) 3.14 (m, 5H) 3.44 (m) 4.09 (m, 3H) 4.40-4.59 (m,
2H) 7.08-7.15 (m, 2H) 7.95 (d. J=9.15 Hz, I H) 9.72 (br. s., 1H)
12.81 (br. s., 1H)
2-[(1-methoxy-2-methylpropan-2-yl)(trifluoroacetyl)amino]-4-(1-methylpiper-
azin-1-yl)benzoic acid hydrochloride
[1021] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.07 (s, 3H)
1.43 (s, 3H) 2.84 (s, 3H) 3.10-3.38 (m, 5H) 3.25 (s, 3H) 3.47-3.57
(m, 2H) 3.92 (d, J=9.51 Hz, 1H) 3.95-4.02 (m, 2H) 7.00 (d, J=2.41
Hz, 1H) 7.10 (dd, J=8.84, 2.50 Hz, 1H) 7.84 (d, J=8.78 Hz, 1H)
10.25 (br. s., 1H) 12.77 (br. s., 1H)
EXAMPLE 23
Preparation of tert-butyl
4-(1-acetylpiperazin-1-yl)-2-nitrobenzoate
[1022] To a solution of tert-butyl
2-amino-4-(piperazin-1-yl)benzoate (7.6 g, 24.7 mmol) in
dichloromethane (120 mL), triethylamine (13.46 mL, 98.7 mmol) and
trifluoroacetic anhydride (6.87 mL, 49.35 mmol) were added. After 1
hour the volatiles were evaporated and the crude was purified by
colum chromatography (EtOAc/hexane 3:7) affording 9.46 gr (yield
95%) of the title compound.
[1023] ESI(+) MS: m/z 404 (MH.sup.+).
EXAMPLE 24
Preparation of tert-butyl
4-(4-methylpiperazin-1-yl)-2-(phenylamino)benzoate
[1024] In a dry Schlenk tube under argon atmosphere tert-butyl
2-amino-4-(4-methylpiperazin-1-yl)benzoate (800 mg, 2.745 mmol) was
dissolved in dry toluene (14 mL). Argon was bubbled through the
mixture for a few minutes before adding bromobenzene (0.32 mL, 3.02
mmol, 1.1 eq), Cs.sub.2CO.sub.2 (1.34 g, 4.118 mmol, 1.5 eq),
Pd(OAc).sub.2 (16 mg, 0.069 mmol, 2.5 mol %) and Rac-BINAP (88 mg,
0.137 mmol, 5 mol %). The mixture was then stirred at 100.degree.
C. for 2.1 hours. The mixture was allowed to cool to room
temperature and diluted with dichloromethane. Salts were filtered
over a Celite pad and the filtrate was concentrated under reduced
pressure. The crude product was purified by chromatography over
silica gel (DCM/EtOH/NH.sub.3 7% in methanol 95:5:0.5) to give 1.13
g of title compound (quant. yield) as off-white solid
[1025] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 1.54 (s, 9H)
2.21 (s, 3H) 2.37-2.43 (m, 4H) 3.15-3.20 (m, 4H) 6.43 (dd, J=9.15,
2.44 Hz, 1H) 6.60 (d, J=2.44 Hz, 1H) 7.02-7.07 (m, 1H) 7.23-7.27
(m, 2H) 7.33-7.38 (m, 2H) 7.69 (d, J=9.02 Hz, 1H) 9.50 (s, 1H)
EXAMPLE 25
Preparation of methyl
2-methoxy-4-(4-methylpiperazin-1-yl)benzoate
[1026] Methyl 2-methoxy-4-fluoro-benzoate (1.6 gr, 9.7 mmol),
K.sub.2CO.sub.3 (1.3 gr, 9.7 mmol) and N-methyl piperazine (1.3 mL,
11.7 mmol) were heated at 100.degree. C. in DMSO (5 mL) for 20
hours. Reaction mixture was diluted with DCM and washed with water.
Organic phase was dried over sodium sulfate and evaporated to
dryness. Column chromatography purification on silica gel using
dichloromethane/methanol 95:5 as the eluant, afforded 1.7 g (yield
66%) of the title compound.
[1027] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 2.25 (s, 3H)
2.45 (br. s., 4H) 3.26-3.34 (m, 4H) 3.70 (s, 3H) 3.80 (s, 3H) 6.49
(d, J=2.32 Hz 1H) 6.53 (dd, J=8.84, 2.38 Hz, 1H) 7.61 (d, J=8.78
Hz, 1H)
Preparation of 2-methoxy-4-(4-methylpiperazin-1-yl)benzoic acid
hydrochloride
[1028] Methyl 2-methoxy-4-(4-methylpiperazin-1-yl)benzoate (1.9 gr,
7.2 mmol) was heated at 40.degree. C. in a mixture 2N NaOH (10 mL)
and MeOH (10 mL) for 2 hours. MeOH was evaporated and the acqueous
layer was acidified to pH=6 with 25% HCl and extracted with n-BuOH.
Organic phase was dried over sodium sulfate and evaporated to
dryness, affording 1.0 g (yield 61%) of the title compound.
[1029] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 2.82 (br. s.,
3H) 2.99-3.31 (m, 4H) 3.47 (br. s., 2H) 3.83 (s, 3H) 4.04 (br. s.,
2H) 6.61 (d, 1H) 6.59 (s, 1H) 7.66 (d, J=8.78 Hz, 1H) 10.49 (br.
s., 1H) 11.91 (br. s., 1H)
EXAMPLE 26
Preparation of 4-(4-methyl-piperazin-4-yl)-2-nitro benzoic acid
hydrochloride
[1030] A mixture of 4-(4-methyl-piperazin-1-yl)-2-nitro-benzoic
acid test-butyl ester (16.4 g, 51 mmol) and 37% HCl (100 mL) in
1,4-dioxane (200 mL) was stirred at room temperature for 4 hours.
The resulting solid was filtered, washed thoroughly with
1,4-dioxane and dried under vacuum at 45.degree. C. The title
compound was obtained as a pale yellow solid (13.45 g, 87.5%
yield), and it was used in the next step without any further
purification.
[1031] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 10.27 (bs,
1H), 7.81 (d, J=8.90 Hz, 1H), 7.40 (d, J=2.69 Hz, 1H), 7.24 (dd,
J1=8.90 Hz, J2=2.69 Hz, 1H), 4.13 (bs, 2H), 3.55-3.06 (bs, 6H),
2.83 (s, 3H).
[1032] Operating in an analogous way, the following compounds were
obtained:
4-[(3-Dimethylamino-propyl)methyl-amino]-2-nitro-benzoic acid
hydrochloride
[1033] 1H-NMR (400 MHz), .delta. (ppm, DMSO-d.sub.6): 13.07 (bs,
1H), 9.72 (bs, 1H), 7.76 (d, J=9.0 Hz, 1H), 7.03 (d, J=2.6 Hz, 1H),
6.93 (dd, J1=9.0 Hz, J2=2.6 Hz, 1H), 3.51 (m, 2H), 3.08 (m, 2H),
3.03 (s, 3H), 2.77 (s, 6H), 1.90 (m, 2H).
Sequence CWU 1
1
5176DNAArtificialForward primer 1ggggacaagt ttgtacaaaa aagcaggctt
actggaagtt ctgttccagg ggccccgccg 60gaagcaccag gagctg
76257DNAArtificialReverse primer 2ggggaccact ttgtacaaga aagctgggtt
tcagggccca ggctggttca tgctatt 57333DNAArtificialForward primer
3ctcggatcca gaaagagaaa taacagcagg ctg 33436DNAArtificialReverse
primer 4ctcggatcct cagcaggtcg aagactgggg cagcgg
36519PRTArtificialCarboxy-terminally biotinylated peptide enzyme
substrate 5Lys Lys Lys Ser Pro Gly Glu Tyr Val Asn Ile Glu Phe Gly
Gly Gly1 5 10 15Gly Gly Lys
* * * * *