Nucleic Acid Constructs, Plants With Increased Tuber Yield, And Methods For Increasing Tuber Yield In A Plant

Abstract

The present invention relates to a nucleic acid construct. The nucleic acid construct includes a nucleic acid molecule configured to silence or reduce the expression of StBEL11 and/or StBEL29 and variants thereof, a 5' DNA promoter sequence, and a 3' terminator sequence, where the first nucleic acid molecule, the promoter sequence, and the terminator sequence are operatively coupled to permit transcription of the first nucleic acid molecule. The present invention is also directed to vectors, host cells, transgenic plants, and transgenic plant seeds, as well as non-transgenic mutant plants, and methods for altering tuber yield in a plant.

Description

[0001] This application claims the benefit of U.S. Provisional Patent Application Ser. No. 62/616,565, filed Jan. 12, 2018, which is hereby incorporated by reference in its entirety.

FIELD OF THE INVENTION

[0003] The present invention relates to nucleic acid constructs, transgenic and non-transgenic plants with increased tuber yield, and methods for increasing tuber yield in a plant.

BACKGROUND OF THE INVENTION

[0004] There are thirteen functional BELL-like genes in potato (Solanum tuberosum L.) that encode for a family of transcription factors ("TF") ubiquitous in the plant kingdom. These BEL1 TFs work in tandem with KNOTTED1-types to regulate the expression of numerous target genes involved in hormone metabolism and growth processes. One of the StBELs, StBEL5, functions as a long-distance mRNA signal that is transcribed in leaves and moves into roots and stolons to stimulate growth. The two most closely related StBELs to StBEL5 are StBEL11 and StBEL29. Together, these three genes make up more than 70% of all StBEL transcripts present throughout the potato plant. They share a number of common features, suggesting they may be co-functional in tuber development. Upstream sequence driving GUS expression in transgenic potato lines demonstrated that both StBEL11 and StBEL29 promoter activity is robust in leaf veins, petioles, stems, and vascular tissues and induced by short-days in leaves and stolons. Steady-state levels of their mRNAs were also enhanced by short-day conditions in specific organs.

[0005] Numerous plant developmental processes are known to be regulated by the three amino acid loop extension ("TALE") family of proteins. The TALE family includes BEL1-like ("BELL") and KNOTTED1-like homeobox ("KNOX") transcription factors (TFs) (Burglin et al., "Analysis of TALE Superclass Homeobox Genes (MEIS, PBC, KNOX, Iroquois, TGIF) Reveals a Novel Domain Conserved Between Plants and Animals," Nucleic Acids Research 25:4173-4180 (1997)). Both BELL and KNOX proteins have characteristic proline-tyrosine-proline (P--Y--P) residues between helix I and II of their homeodomain (Passner et al., "Structure of DNA-Bound Ultrabithorax-Extradenticle Homeodomain Complex," Nature 397:714-19 (1999)). BELL proteins have a DNA-binding homeodomain, a conserved SKY box, a KNOX protein-interacting BELL domain, and a conserved VSLTLGL motif. Both TALE types are ubiquitous in plants, and during evolution of a number of gene family members have increased in correlation with enhanced complexity. Red and green algal species have only one or two KNOX and BELL genes, whereas land plant genomes contain several genes of both (Mukherjee et al., "A Comprehensive Classification and Evolutionary Analysis of Plant Homeobox Genes," Mol. Biol. Evol. 26:2775-94 (2009)).

[0006] The BEL1 TF from Arabidopsis, the first BEL1 protein discovered, functions in ovule and integument development (Ray et al., "Arabidopsis Floral Homeotic Gene BELL (BELT) Controls Ovule Development Through Negative Regulation of AGAMOUS Gene," Proc. Nat'l. Acad. Sci. U.S.A. 97:5761-65 (1994); Reiser et al., "The BELL1 Gene Encodes a Homeodomain Protein Involved in Pattern Formation in the Arabidopsis Ovule Primordium," Cell 83:735-42 (1995)). BEL1 TFs regulate numerous processes in plants such as development of the shoot apical meristem ("SAM") (Byrne et al., "Phyllotactic Pattern and Stem Cell Fate are Determined by the Arabidopsis Homeobox Gene BELLRINGER," Development 130:3941-50 (2003); Rutjens et al., "Shoot Apical Meristem Function in Arabidopsis Requires the Combined Activities of Three BEL1-Like Homeodomain Proteins," Plant J. 58:641-54 (2009)), control of inflorescence architecture (Bhatt et al., "VAAMANA-a BEL1-Like Homeodomain Protein, Interacts With KNOX Proteins BP and STM and Regulates Inflorescence Stem Growth in Arabidopsis," Gene 328:103-11 (2004); Ragni et al., "Interaction of KNAT6 and KNAT2 with BREVIPEDICELLUS and PENNYWISE in Arabidopsis Inflorescences," Plant Cell 20:888-900 (2008)), leaf patterning (Kumar et al., "The Arabidopsis BEL1-LIKE HOMEODOMAIN Proteins SAW1 and SAW2 Act Redundantly to Regulate KNOX Expression Spatially in Leaf Margins," Plant Cell 19:2719-35 (2007)), the high-irradiance response of phytochrome A (Staneloni et al., "Bell-Like Homeodomain Selectively Regulates the High-Irradiance Response of Phytochrome A," Proc. Nat'l. Acad. Sci. U.S.A. 106:13624-29 (2009)), regulation of tuberization (Chen et al., "Interacting Transcription Factors From the Three Amino Acid Loop Extension Superclass Regulate Tuber Formation," Plant Physiol. 132:1391-1404 (2003); Banerjee et al., "Efficient Production of Transgenic Potato (S. tuberosum L. ssp. andigena) Plants via Agrobacterium Tumefaciens-Mediated Transformation," Plant Sci. 170:732-38 (2006)) and fruit development (Dong et al., "MDH1: An Apple Homeobox Gene Belonging to the BEL1 Family," Plant Mol. Biol. 42:623-33 (2000)).

[0007] The BEL1-KNOX tandem complex functions as a transcriptional switch that regulates various developmental pathways in plants (Hay & Tsiantis, "KNOX Genes: Versatile Regulators of Plant Development and Diversity," Development 137:3153-65 (2010)). For example, the BELLRINGER and shoot meristemless (STM) heterodimer in Arabidopsis maintains SAM and inflorescence patterning (Byrne et al., "Phyllotactic Pattern and Stem Cell Fate are Determined by the Arabidopsis Homeobox Gene BELLRINGER," Development 130:3941-50 (2003); Roeder et al., "The Role of the REPLUMLESS Homeodomain Protein in Patterning the Arabidopsis Fruit," Curr. Biol. 13:1630-35 (2003)). The BLH1 and KNAT3 heterodimer regulates seed germination and early seedling development in Arabidopsis (Kim et al., "BLH1 and KNAT3 Modulate ABA Responses During Germination and Early Seedling Development in Arabidopsis," Plant J. 75:755-66 (2013)). In potato, the BEL1-KNOX interaction is functional in regulating the tuberization process and root growth (Chen et al., "Interacting Transcription Factors From the Three Amino Acid Loop Extension Superclass Regulate Tuber Formation," Plant Physiol. 132:1391-1404 (2003); Lin et al., "The Impact of the Long-Distance Transport of a BEL1-Like mRNA on Development," Plant Physiol. 161:760-72 (2013)). Specifically, the StBEL5-POTH1 heterodimer appears to regulate tuber formation in potato by regulating transcription of target genes that are involved in hormone metabolism. These include genes involved in auxin, cytokinin, and gibberellic acid ("GA") synthesis and activity (Chen et al., "Interacting Transcription Factors From the Three Amino Acid Loop Extension Superclass Regulate Tuber Formation," Plant Physiol. 132:1391-1404 (2003); Hannapel et al., "Phloem-Mobile Messenger RNAs and Root Development," Front. Plant. Sci. 4:257 (2013); Lin et al., "The Impact of the Long-Distance Transport of a BEL1-Like mRNA on Development," Plant Physiol. 161:760-72 (2013)). GA levels are reduced in newly formed tubers, whereas cytokinin and auxin levels are enhanced (Machackova et al., "Photo-Periodic Control of Growth, Development and Phytohormone Balance in Solanum tuberosum," Physiol. Plant 102:272-78 (1998); Xu et al., "The Role of Gibberellin, Abscisic Acid, and Sucrose in the Regulation of Potato Tuber Formation In Vitro," Plant Physiol. 117:575-84 (1998); Bou-Torrent et al., "Gibberellin A1 Metabolism Contributes to the Control of Photo-Period-Mediated Tuberization in Potato," PLoS One 6:e24458 (2011); Roumeliotis et al., "A Crosstalk of Auxin and GA During Tuber Development," Plant Signal. Behav. 7:1360-63 (2012); Abelenda et al., "Flowering and Tuberization: A Tale of Two Nightshades," Trends Plant Sci. 19:115-22 (2014)). Included among these target genes are StPIN1, -2, and -4; several AUX/IAA types; StLONELYGUY1, -2, and -3; StGA2 oxidase1; and StGA20 oxidase1 (Chen et al., "Interacting Transcription Factors From the Three Amino Acid Loop Extension Superclass Regulate Tuber Formation," Plant Physiol. 132:1391-1404 (2003); Hannapel et al., "Phloem-Mobile Messenger RNAs and Root Development," Front. Plant. Sci. 4:257 (2013); Lin et al., "The Impact of the Long-Distance Transport of a BEL1-Like mRNA on Development," Plant Physiol. 161:760-72 (2013); Sharma et al., "Targets of the StBEL5 Transcription Factor Include the FT Ortholog StSP6A," Plant Physiol. 170:310-24 (2016)). The StBEL5-POTH1 complex binds to tandem TTGAC motifs present in upstream sequence of these target genes. As an example, StGA2ox1, which is strongly induced during early tuber formation (Kloosterman et al., "StGA2ox1 is Induced Prior to Stolon Swelling and Controls GA Levels During Potato Tuber Development," Plant J. 52:362-73 (2007)), contains four sets of tandem TTGAC elements in its upstream sequence and two in its first intron (Lin et al., "The Impact of the Long-Distance Transport of a BEL1-Like mRNA on Development," Plant Physiol. 161:760-72 (2013)). Each of the two TFs binds to one of the TTGAC core motifs and both are required to affect transcription (Chen et al., "The Tandem Complex of BEL and KNOX Partners is Required for Transcriptional Repression of ga20ox1," Plant J. 38:276-84 (2004)).

[0008] Both StBEL5 and POTH1 transcripts were detected in phloem cells (Banerj ee et al., "Dynamics of a Mobile RNA of Potato Involved in a Long-Distance Signaling Pathway," Plant Cell 18:3443-57 (2006); Yu et al., "Tissue Integrity and RNA Quality of Laser Microdissected Phloem of Potato," Planta 226:797-803 (2007); Lin et al., "Transcriptional Analysis of Phloem-Associated Cells of Potato," BMC Genom. 16:665 (2015)). Both RNAs have been proposed to act as long-distance signals (Banerjee et al., "Dynamics of a Mobile RNA of Potato Involved in a Long-Distance Signaling Pathway," Plant Cell 18:3443-57 (2006); Mahajan et al., "The mRNA of a Knotted1-Like Transcription Factor of Potato is Phloem Mobile," Plant Mol. Biol. 79:595-608 (2012)) and move freely throughout the plant with enhanced movement of StBEL5 into stolons under short-days (Banerjee et al., "Dynamics of a Mobile RNA of Potato Involved in a Long-Distance Signaling Pathway," Plant Cell 18:3443-57 (2006)). Overexpression, movement, and accumulation of StBEL5 RNA have been consistently associated with increased earliness and enhanced tuber yields even under non-inductive long-day conditions (Chen et al., "Interacting Transcription Factors From the Three Amino Acid Loop Extension Superclass Regulate Tuber Formation," Plant Physiol. 132:1391-1404 (2003); Banerjee et al., "Untranslated Regions of a Mobile Transcript Mediate RNA Metabolism," Plant Physiol. 151:1831-43 (2009)). Movement of its mRNA to stolon tips in over-expressing plants is facilitated by the presence of the untranslated regions of its RNA (Banerjee et al., "Dynamics of a Mobile RNA of Potato Involved in a Long-Distance Signaling Pathway," Plant Cell 18:3443-57 (2006); Banerjee et al., "Untranslated Regions of a Mobile Transcript Mediate RNA Metabolism," Plant Physiol. 151:1831-43 (2009)). RNA binding proteins that bind to sequences in the 3' untranslated region (UTR) of its transcript facilitate localized StBEL5 movement and enhance tuberization. These RNA-binding proteins are induced by short-day (SD) conditions (Cho et al., "Polypyrimidine Tract-Binding Proteins of Potato Mediate Tuberization Through an Interaction With StBEL5 RNA," J Expt. Bot. 66:6835-47 (2015)).

[0009] Other tuberization signals like the FT-ortholog StSP6A in potato also accumulate in stolons of plants grown under SD (Navarro et al., "Control of Flowering and Storage Organ Formation in Potato by FLOWERING LOCUS T," Nature 478:119-22 (2011); Gonzalez-Schain et al., "Potato CONSTANS is Involved in Photoperiodic Tuberization in a Graft-Transmissible Manner," Plant J. 70:678-90 (2012)). The microRNA, miR172, promotes tuber formation and accumulates in stolons at the onset of tuberization (Martin et al., "Graft-Transmissible Induction of Potato Tuberization by the MicroRNA miR172," Development 136:2873-81 (2009)). Moreover, Bhogale et al., "MicroRNA156: A Potential Graft-Transmissible MicroRNA That Modulates Plant Architecture and Tuberization in Solanum tuberosum ssp. andigena," Plant Physiol. 164:1011-27 (2014) suggested that miR156 acts as a phloem-mobile signal and regulates aerial tuber formation in potato.

[0010] Recent work on transcription profiling of StBEL5 suggests that it is positioned upstream of the regulatory network that controls the onset of tuber formation (Sharma et al., "Targets of the StBEL5 Transcription Factor Include the FT Ortholog StSP6A," Plant Physiol. 170:310-24 (2016)). Signaling targets of StBEL5 include the gene for earliness, StCDF1 (Kloosterman et al., "Naturally Occurring Allele Diversity Allows Potato Cultivation in Northern Latitudes," Nature 495:246-50 (2013)), and the tuber signal StSP6A (Navarro et al., "Control of Flowering and Storage Organ Formation in Potato by FLOWERING LOCUS T," Nature 478:119-22 (2011)). Through its transcriptional activity in conjunction with its KNOX partner, StBEL5 front-loads the tuber signals, StSP6A and StCDF1, in the leaf and then follows this with a doubling-down of the two key tuber signals, StSP6A and StBEL5, in stolons during the onset of tuber formation. Auto-regulation of its own gene is also occurring in the stolons. Site mutagenesis in tandem TTGAC motifs (specific for the StBEL5/KNOX complex) located in the upstream sequence of both StBEL5 and StSP6A suppressed the SD-induced activity of their promoters in young tubers (Lin et al., "The Impact of the Long-Distance Transport of a BEL1-Like mRNA on Development," Plant Physiol. 161:760-72 (2013); Sharma et al., "Targets of the StBEL5 Transcription Factor Include the FT Ortholog StSP6A," Plant Physiol. 170:310-24 (2016)). Suppression of StBEL5 activity repressed the accumulation of RNA for StSP6A, whereas induction of StBEL5 had the opposite effect (Sharma et al., "Targets of the StBEL5 Transcription Factor Include the FT Ortholog StSP6A," Plant Physiol. 170:310-24 (2016)).

[0011] Thirteen BEL1-like genes have been identified in the potato genome and were organized into five clades based on amino-acid sequence (Sharma et al., "The BEL1-Like Family of Transcription Factors in Potato," J. Expt. Bot. 65:709-23 (2014)). StBEL5, -11, and -29 are phylogenetically related and exhibit very close sequence matches within their conserved domains. In addition, the transcripts of these three StBEL genes make up more than 70% of the total transcripts in the StBEL family (Xu et al., "Genome Sequence and Analysis of the Tuber Crop Potato," Nature 475:189-95 (2011); Sharma et al., "The BEL1-Like Family of Transcription Factors in Potato," J. Expt. Bot. 65:709-23 (2014)). All three are present in phloem cells and exhibit very high transcript levels in petioles, a key organ for transporting RNAs into the stem. Similar to StBEL5, these data suggest that StBEL11 and -29 might function as phloem-mobile developmental signals. Although recent results have demonstrated the dramatic effect that suppression of StBEL5 RNA had on tuberization (Sharma et al., "Targets of the StBEL5 Transcription Factor Include the FT Ortholog StSP6A," Plant Physiol. 170:310-24 (2016)), it is conceivable that StBEL11 and -29 are also involved in some aspect of tuber formation. Other than StBEL5, very little is known about the functional roles played by other members of the StBEL family.

[0012] The present invention is directed to overcoming deficiencies in the art.

SUMMARY OF THE INVENTION

[0013] One aspect of the present invention is directed to a nucleic acid construct comprising a first nucleic acid molecule comprising a nucleotide sequence configured to silence or reduce expression of StBEL11 and variants thereof; a 5' DNA promoter sequence; and a 3' terminator sequence, where the first nucleic acid molecule, the promoter sequence, and the terminator sequence are operatively coupled to permit transcription of the first nucleic acid molecule.

[0014] Another aspect of the present invention is directed to a nucleic acid construct comprising a first nucleic acid molecule comprising a nucleotide sequence configured to silence or reduce expression of StBEL29 and variants thereof; a 5' DNA promoter sequence; and a 3' terminator sequence, where the first nucleic acid molecule, the promoter sequence, and the terminator sequence are operatively coupled to permit transcription of the first nucleic acid molecule.

[0015] A further aspect of the present invention is directed to an expression vector comprising a nucleic acid construct of the present invention.

[0016] Another aspect of the present invention is directed to a host cell transformed with a nucleic acid construct of the present invention.

[0017] A further aspect of the present invention is directed to a transgenic plant seed transformed with a nucleic acid construct of the present invention.

[0018] Another aspect of the present invention is directed to a transgenic plant transformed with a nucleic acid construct of the present invention, where the plant has increased tuber yield compared to a plant not transformed with the nucleic acid construct.

[0019] A further aspect of the present invention relates to a transgenic cell of a plant of the present invention.

[0020] Another aspect of the present invention relates to a transgenic plant seed produced from a plant of the present invention.

[0021] A further aspect of the present invention is directed to a method of increasing tuber yield in a plant. This method involves providing a transgenic plant or plant seed comprising a nucleic acid construct comprising one or more nucleic acid molecules configured to reduce or silence expression of (i) StBEL11 and variants thereof, (ii) StBEL29 and variants thereof, or (iii) both (i) and (ii); and growing the transgenic plant or plant grown from the transgenic plant seed under conditions effective to express the one or more nucleic acid molecules in said transgenic plant or said plant grown from the transgenic plant seed.

[0022] Another aspect of the present invention is directed to a potato plant comprising one or more mutations in one or both of StBEL11 and StBEL29, where the potato plant has increased tuber yield compared to the tuber yield of a wild type potato plant.

[0023] A further aspect of the present invention relates to potato seed from the potato plant comprising one or more mutations in one or both of StBEL11 and StBEL29 of the present invention.

[0024] Using a transgenic approach and heterografting experiments, it is shown herein that both StBEL11 and StBEL29 inhibit growth in correlation with the long distance transport of their mRNAs from leaves to roots and stolons, whereas suppression lines of these two RNAs exhibited enhanced tuber yields. These results indicate that the RNAs of StBEL11 and StBEL29 are phloem-mobile and function antagonistically to the growth-promoting characteristics of StBEL5. Both these RNAs appear to inhibit growth in tubers by repressing the activity of target genes of StBEL5.

[0025] As is demonstrated herein, RNAs of StBEL11 and StBEL29 are phloem-mobile and function antagonistically to the growth-promoting characteristics of StBEL5 in potato. Both these RNAs appear to inhibit tuber growth by repressing the activity of target genes of StBEL5 in potato. Moreover, upstream sequence driving GUS expression in transgenic potato lines demonstrated that both StBEL11 and StBEL29 promoter activity is robust in leaf veins, petioles, stems, and vascular tissues and induced by short days in leaves and stolons. Steady-state levels of their mRNAs were also enhanced by short-day conditions in selective organs.

[0026] To expand the understanding of long-distance signaling and to determine if they have any relationship with plant growth and tuberization, expression profiles and functional analyses of StBEL11 and StBEL29, which are closely related to StBEL5, were undertaken as part of the present invention. Similar to StBEL5, the results described herein suggest that the RNAs of StBEL11 and StBEL29 function as long-distance signals that regulate growth of tubers in potato.

BRIEF DESCRIPTION OF THE DRAWINGS

[0027] FIGS. 1A-1B depict the screening of StBEL11 (FIG. 1A) and StBEL29 (FIG. 1B) CaMV 35S transgenic overexpression lines using RT-qPCR off RNA from in vitro plantlets. GAPDH RNA was used as an internal control. The lines designated with arrows were used for phenotypic analysis. Values shown in the bar graphs are relative to wild-type andigena levels.

[0028] FIGS. 2A-2B depict the screening of GAS:StBEL11 and GAS:StBEL29 transgenic lines. RNA was extracted from transgenic in vitro plantlets and one-step RTPCR (FIG. 2A) or RT-qPCR (FIG. 2B) with GSPs were performed for StBEL11 and StBEL29, respectively. Only transgenic StBEL11 RNA was assayed in FIG. 2A. Values shown in FIG. 2B are relative to WT andigena levels. Lines 11a, b, c, and e (FIG. 2A) and StBEL29 lines 9 and 19 (FIG. 2B) were identified as high expressers with significant phenotypes and were used in subsequent experiments.

[0029] FIGS. 3A-3D show 35S:antisense RNA lines screened for StBEL11 or StBEL29 RNA from either leaves of one-month old soil-grown plants or stolons from 21 day short-day plants. Lines designated 11-1 (C-72), 11-2 (C-75), 29-1 (C-9A), and 29-2 (C-1B) were used for further analyses. RT-qPCR with gene-specific primers was used for the quantification. Each sample was measured in duplicate. Details of the transformation and screening protocols are described in the examples infra.

[0030] FIGS. 4A-4B depict shoot (FIG. 4A) and tuber (FIG. 4B) yields in 7540 (WT), 35S:StBEL11 (lines 7, 11) and 35S:StBEL29 (lines 6, 11) overexpression lines. Error bars represent.+-.standard deviation of seven biological replicates. A Student's t test was performed to check significance with one, two, and three asterisks indicating p<0.05, p<0.01, and p<0.001, respectively. Plants were grown under long-days for 4-weeks, followed by 4-weeks under short-day conditions. ns indicates not significant.

[0031] FIGS. 5A-5C are graphs showing phenotypes of antisense lines for StBEL11 (11-1, 11-2) and StBEL29 (29-1, 29-2). After screening, selected independent lines were grown for 8-weeks under long-days and then 21 days under short-day conditions. Ten independent plants for each transgenic line, including wild-type, were used for evaluating shoot growth (FIG. 5A) and tuber yields (FIG. 5B) at 21 days under short-days. Error bars represent.+-.SD (n=10). 7540 is a non-transformed WT line. For analysis of the tuber marker gene StSP6A (FIG. 5C), RNA was harvested from stolons of plants grown under short-days for 21 days and StSP6A was quantified using RT-qPCR with gene-specific primers in selected lines for both types. Stolons were pooled from three plants off ten independent plants per transgenic line forming three biological replicates per line for RT-qPCR analysis. Three technical replicates were performed for each biological replicate for RT-qPCR. Error bars represent.+-.standard deviation from n=3. A Student's t test was performed to check significance with one, two, and three asterisks indicating p values of <0.05, <0.01, and <0.001, respectively. ns indicates not significant.

[0032] FIGS. 6A-6C show results of tubers from 35S:antisense RNA lines for StBEL11 and StBEL29 (FIG. 6A). Plants were grown in a growth chamber for eight weeks under long days and then 21 days under short-day conditions before harvest. 7540 is a non-transformed wild-type line. For each line, tubers are pooled from three plants. White bar=1.0 cm. The mean number of tubers per plant are shown for antisense lines of StBEL11 (FIG. 6B) and StBEL20 (FIG. 6C). The arrows in FIGS. 6B-6C indicate the lines shown in the photo (FIG. 6A).

[0033] FIGS. 7A-7I show Promoter:GUS constructs of upstream sequence of StBEL11 and StBEL29. The scale bar in FIG. 7A is equivalent to 200 bp. GUS expression driven by promStBEL11 (FIGS. 7B, 7D, and 7E) and promStBEL29 (FIGS. 7F-7H) in 2 week old in vitro transgenic plants. GUS expression was observed in the midvein, petioles, and stems. Both promoter fusion lines were also grown in soil for 8-weeks in growth chambers under long-days and were then subjected to short-day conditions for 15 more days. GUS expression is shown in stolon from promStBEL11 (FIG. 7C, arrow) and swollen stolon from prom-StBEL29 (FIG. 7I, arrows). Scale bar equivalent to 0.5 cm in FIGS. 7B and 7H, and 500 .mu.m for FIGS. 7D-7G.

[0034] FIGS. 8A-8D show GUS activity in 8-week soil-grown proStBEL11:GUS (FIGS. 8A and 8C) and proStBEL29:GUS transgenic lines (FIGS. 8B and 8D) cultured under long-day conditions for 6 weeks and then under short-day conditions for two-weeks. Transverse sections of petioles (FIGS. 8A and 8B) and stems (FIGS. 8C and 8D) of proBEL11:GUS (FIGS. 8A and 8C) and proBEL29:GUS (FIGS. 8B and 8D) transgenic lines. The arrows in FIGS. 8A and 8B designate external phloem cells. The arrows in FIG. 8C designate xylem cells and the epidermis. The arrow in FIG. 8D designates vascular bundles. X indicates xylem cells.

[0035] FIGS. 9A-9D show relative accumulation of total (FIGS. 9A and 9B) and polysomal (FIGS. 9C and 9D) RNA of StBEL11 (FIGS. 9A and 9C) and StBEL29 (FIGS. 9B and 9D) in WT potato (Solanum tuberosum ssp. andigena) plants under short-day and long-day photoperiods. RT-qPCR was performed on RNA from leaves, petioles, stem, roots, and stolons from 8-week soil-grown plants incubated under short-day (white bar) and long-day (black bar) for 15 days. Data represented is normalized with GAPDH. Ct value for long-day leaves set at 1.0. The values shown are the average of three biological replicates.+-.standard deviation. A Student's t test was performed to check significance with one and two asterisks indicating p<0.05 and p<0.01, respectively.

[0036] FIGS. 10A-10B show the effect of photoperiod on promoter activity of StBEL11 (FIG. 10A) and -29 (FIG. 10B). Tissue specific GUS activity in proStBEL11:GUS and proStBEL29:GUS lines was measured under both long-day (16 h light, 8 h dark) and short-day (8 h light, 16 h dark) conditions. Both promoter fusion lines were grown in soil for 8 weeks in growth chambers under long days and were then subjected to either long-day (black bars) or short-day (open bars) conditions for 15 more days. Quantification was performed using a fluorometric assay with 4-methylumbelliferyl-.beta.-D-glucuronide as substrate. Data represent the mean.+-.standard deviation of GUS activity measured in three biological replicates. GUS activity is expressed as nmol 4-methylumbelliferone .mu.g protein.sup.-1 hr.sup.-1. A Student's t test was performed to check significance with one and two asterisks indicating p<0.05 and p<0.01, respectively. Quantitative GUS activity in respective tissues (long-day) were used as a reference in statistical analyses of both panels (FIGS. 10A and 10B).

[0037] FIGS. 11A-11D show movement of StBEL11 (FIG. 11A) and StBEL29 (FIG. 11B) mRNA across heterografts of soil-grown plants. For heterografts, micrografts were performed with four replicates of GAS:StBEL11 (line 11b), GAS:StBEL29 (line 29-9) and GAS: GUS scions on wild-type andigena stocks. After 2 weeks in culture, grafts were moved to soil and grown under long-days for three weeks and then under short-days for 2 weeks before harvest of leaves, secondary roots, and stolons. Following RNA extraction, gene-specific primers (GSP) were used with a non-plant DNA tag specific for the transgenic RNA (designated NT-2 in the examples herein) to perform one-step RTPCR on 250 ng of total RNA from wild-type secondary roots and stolons of all four heterografts (FIGS. 11A and 11B). RNA from scion leaf samples was used as a positive control (scion samples). All PCR products detected in scion (positive control) and stock (test for movement) RNA samples represent transgenic RNA. GSPs for transgenic StBEL11 (FIG. 11A), transgenic StBEL29 (FIG. 11B), and transgenic GUS (FIG. 11C) were used. Heterografts are designated R1-4 (root stock RNA) and St1-4 (stolon stock RNA). RNA from secondary roots and stolons of wild-type/wildtype (andigena) autografts was used in the RT-PCR with transgenic StBEL11 and -29 gene-specific primers as a negative control (FIG. 11D). Similar negative results were obtained with RNA from wild-type leaves.

[0038] FIG. 12 is a graph showing the photoperiod effect on the movement of transgenic StBEL29 and StBEL11 mRNA into stolons. Movement of transgenic mRNA from leaf to stolon was quantified in transgenic lines expressing full length StBEL11 and -29. Expression was driven by the galactinol synthase (GAS) promoter of melon (Cucumis melo). This promoter is selectively active in the minor veins of leaf mesophyll (Ayre et al., "Functional and Phylogenetic Analyses of A Conserved Regulatory Program in the Phloem of Minor Veins," Plant Physiol. 133:1229-39 (2003) and Banerjee et al., "Untranslated Regions of a Mobile Transcript Mediate RNA Metabolism," Plant Physiol. 151:1831-43 (2009), which are hereby incorporated by reference in their entirety). Relative levels of transgenic RNA were quantified from RNA extracted from 0.5 cm samples from the tip of the stolon. GAS:StBEL11 and -29 plants were grown under long-day conditions for 4 weeks and then transferred to either short-days (SD) for two-weeks or maintained under long-days (LD). RT-qPCR with gene-specific primers was used to measure the relative amounts of transgenic RNA in stolons. Each of the stolon values has been calculated relative to a value of 1.0 for the amount of transgenic RNA measured in either LD or SD leaves from the same plant. Stolons from two plants off four independent plants for each construct were pooled forming two biological replicates. Each biological replicate was measured with two technical replicates and normalized against StActin8 mRNA. The fold change in RNA levels was calculated as the 2.sup.-.DELTA..DELTA.ct value. Standard errors of the means of two biological replicates are shown with one, two and three asterisks indicating significant differences (p<0.05, p<0.01, p<0.001, respectively) using a Student's t test.

[0039] FIGS. 13A-13B show shoot (FIG. 13A) and tuber (FIG. 13B) yields in 7540 (WT) and GAS:StBEL11 and -29 transgenic lines grown under short-day conditions. Data represent the mean of four biological replicates (n=4). One or three asterisks indicate significance (p<0.05 and p<0.001, respectively) using a Student's t test. Plants were grown under long-days for 4 weeks, followed by 3 weeks under short-day conditions.

[0040] FIG. 14 shows tuber yields of StBEL29 overexpression lines 9 and 19. Both transgenic lines expressed StBEL29 using the leaf-specific GAS promoter. Six replicates per line were assessed for tuber production after 21d short-day conditions. The data represent the mean.+-.SD. Line 7540 is untransformed Solanum tuberosum ssp andigena.

[0041] FIGS. 15A-15B show relative levels of StSP6A and StPIN1 RNA in tuberizing stolons of WT 7540 andigena (open bars), or GAS:StBEL11 and -29 transgenic lines (black bars) grown under short-day conditions. Plants were grown under long-days for 4 weeks, followed by 2 weeks under short-day conditions. Stolons from two plants off four independent plants for each construct were pooled forming two biological replicates (n=2). Each biological replicate was quantified using two technical replicates.

[0042] FIG. 16 shows relative levels of StBEL5 RNA in tuberizing stolons of 7540 andigena (WT), GAS:StBEL11 (G:B11), and -29 (G:B29) transgenic lines grown under short-day conditions. Data represent the mean.+-.standard deviation of two biological reps and two technical reps. Plants were grown under long days for four weeks followed by two weeks under short-day conditions.

[0043] FIGS. 17A-17D show RNA movement assays for StBEL11 (FIGS. 17A and 17B) and StBEL29 (FIGS. 17C and 17 D) into roots (FIGS. 17A and 17C) and stolons (FIGS. 17B and 17D) using the PVX-based system with over-expression lines of the RNA-binding proteins, StPTB1 and StPTB6, 8 days post-inoculation of leaves. RNA was extracted and RT-qPCR with gene-specific primers was used to calculate the relative amounts of StBEL11 or StBEL29 RNA. Each sample was measured and normalized against StACtin8 RNA. RNA values were calculated as the 2.sup..DELTA..DELTA.Ct value relative to the mean values obtained from WT samples. Standard deviations of the means of two biological replicates with two technical replicates are shown with one, two, and three asterisks indicating significant differences (p<0.05, p<0.01, p<0.001, respectively) using a Student's t-test. This system was used previously to monitor StBEL5 RNA movement (Cho et al., "Polypyrimidine Tract-Binding Proteins of Potato Mediate Tuberization Through an Interaction With StBEL5 RNA," J. Expt. Bot. 66:6835-47 (2015), which is hereby incorporated by reference in its entirety). Movement is facilitated in the StPTB overexpression lines.

[0044] FIG. 18 shows that StBEL5 induces StBEL11 and StBEL29 in stolons from GAS:BEL5 transgenic lines grown under short-day conditions for 12 days. RT-qPCR in replicate was performed on the RNA extracted from the 12 day stolons. StBEL5 RNA levels are included as a control. The GAS promoter is specific to the minor veins of the leaf mesophyll (Ayre et al., "Functional and Phylogenetic Analyses of A Conserved Regulatory Program in the Phloem of Minor Veins," Plant Physiol. 133:1229-39 (2003), which is hereby incorporated by reference in its entirety) and enhanced levels of StBEL5 RNA in stolons are the result of movement of StBEL5 RNA from leaves to stolons (Banerjee et al., "Dynamics of a Mobile RNA of Potato Involved in a Long-Distance Signaling Pathway," Plant Cell 18:3443-57 (2006); Banerjee et al., "Untranslated Regions of a Mobile Transcript Mediate RNA Metabolism," Plant Physiol. 151:1831-43 (2009); and Lin et al., "The Impact of the Long-Distance Transport of a BEL1-Like mRNA on Development," Plant Physiol. 161:760-72 (2013), which are hereby incorporated by reference in their entirety). In this model, mobile StBEL11 and StBEL29 contain the tandem TGAC motif specific for the BEL/KNOX complex in their upstream sequence. Data represent the mean.+-.standard deviation of two biological reps and two technical reps. One or three asterisks indicate a significant difference at a 0.05 or 0.001 level, respectively, using a Student's t test.

[0045] FIG. 19 shows an amino acid sequence alignment of StBEL5 (SEQ ID NO:51), StBEL11 (SEQ ID NO:52), and StBEL29 (SEQ ID NO:53). Black- and gray-boxed letters represent identical or similar residues, respectively. The conserved BELL domain and the N-terminal Sky and C-terminal VSLTLGL boxes have been underlined. The homeodomain is marked by a dashed line. The amino acids for conserved domains are aligned in relation to the BEL5 protein. Ovals highlight areas of eight residues or more of unique sequence.

DETAILED DESCRIPTION OF THE INVENTION

[0046] Generally, the present invention relates to nucleic acid molecules encoding BEL transcription factors from potato (Solanum tuberosum L.), BEL transcription factor is a general term used herein to mean a member of the BEL-1-like family of transcription factors, which includes a BELL domain (Bellaoui et al., "The Arabidopsis BELL1 and KNOX TALE Homeodomain Proteins Interact Through a Domain Conserved Between Plants and Animals," Plant Cell 13(10:2455-70 (2001), which is hereby incorporated by reference in its entirety) and which regulates growth, in particular, floral development.

[0047] A description of the BEL mobile mRNA and their regulation of tuber development in potato including the mechanisms mediating their mobility are further described in Hannapel and Banerjee, "Multiple Mobile mRNA Signals Regulate Tuber Development in Potato," Plants 2017: 6, S (2017), which is hereby incorporated by reference in its entirety.

[0048] One aspect of the present invention is directed to a nucleic acid construct comprising a first nucleic acid molecule comprising a nucleotide sequence configured to silence or reduce expression of StBEL11 and variants thereof; a 5' DNA promoter sequence; and a 3' terminator sequence, where the first nucleic acid molecule, the promoter sequence, and the terminator sequence are operatively coupled to permit transcription of the first nucleic acid molecule.

[0049] The mRNA of StBEL11 has a nucleotide sequence of SEQ ID NO:1, as follows, where the 5' UTR and 3' UTR are shown in italics, preceding and following the CDS, which is shown in regular font:

TABLE-US-00001 tttaagaaaa tctctcactt tctctttctc ccaattataa taagaaaact ttctttcctc 60 cttgttttta tttttaaaaa aatatttcag tttagtttat ggttgaagat atttgatata 120 gccttcatat atgtcactca tgttccatca tcagccaagt gttagaagtc actttcttta 180 acaagatttt cttgaaaaat atttaaaaaa ttgaactcca aaaaaaagaa aaaaaggagt 240 gtagttttct tgattggttg tgaaatttat ggctatgtac tatcaaggag gctcagaaat 300 ccaagctgat ggtctgcaga cactttattt gatgaaccct aactatatag gctacactga 360 cacacatcat catcatcatc aacaccaaca acaatcagcc aacatgtttt tcttgaattc 420 tgtggcggcg gggaattttc cccacgtgtc cctccctttg caagcacatg cgcaggggca 480 cttggttgga gtgcccctgc cagctggttt tcaagatcct aaccgccctt ccattcagga 540 aattccgacc tctcatcatg gccttttatc gcgtttgtgg acttctggtg accaaaatac 600 ccctagaggt ggtggaggag gaggagaagg aaatggaagt caatcacata taccgtcttc 660 cacggtggtt tctcccaact caggtagtgg gggaggcacc accacggact ttgcttccca 720 attagggttc caaagaccgg ggttggtgtc accaacacag gcgcaccatc aaggtctttc 780 tctaagcctt tctccacaac aacaaatgaa tttcaggtct agtcttccac tagaccaccg 840 cgatatttca acaacaaatc atcaagttgg aatactatca tcatcaccat taccatcacc 900 aggaacaaat accaatcata ctcgaggatt aggggcatca tcgtcttttt cgatttctaa 960 tgggatgata ttgggttcta agtacctaaa agttgcacaa gatcttcttg atgaagttgt 1020 taatgttgga aaaaacatca aattatcaga ggttggtgca aaggagaaac acaaattgga 1080 caatgaatta atatctttgg ctagtgatga tgttgaaagt agcagccaaa aaaatagtgg 1140 tgttgaactt actacagctc aaagacaaga acttcaaatg aagaaagcaa agcttgttag 1200 catgcttgat gaggtggatc aaaggtatag acaataccat caccaaatgc aaatgattgc 1260 aacatcattt gagcaaacaa caggaattgg atcatcaaaa tcatacacac aacttgcttt 1320 gcacacaatt tcaaagcaat ttagatgttt aaaagatgca atttctgggc aaataaagga 1380 cactagcaaa actttagggg aagaagagaa cattggaggc aaaattgaag gatcaaagtt 1440 gaaatttgtg gatcatcatt tacgccaaca acgtgcacta caacaattag ggatgatgca 1500 aaccaatgca tggaggccac aaagaggttt gcccgaaaga gcggtttcgg ttctccgtgc 1560 ttggcttttc gagcattttc ttcatccgta tcccaaagat tcagataaaa tcatgcttgc 1620 taagcaaaca gggctaacaa ggagccaggt atcaaattgg tttataaatg ctagagttag 1680 actatggaag ccaatggtag aagaaatgta catggaagaa gtgaagaaaa acaatcaaga 1740 acaaaatatt gagcctaata acaatgaaat tgttggttca aaatcaagtg ttccacaaga 1800 gaaattacca attagtagca atattattca taatgcttct ccaaatgata tttctacttc 1860 caccatttca acatctccga cgggcggcgg cggttcgatt ccggctcaga cggttgcagg 1920 tttctccttc attaggtcat taaacatgga gaacattgat gatcaaagga acaacaaaaa 1980 ggcaagaaat gagatgcaaa attgttcaac tagtactatt ctctcaatgg aaagagaaat 2040 catgaataaa gttgtgcaag atgagacaat caaaagtgaa aagttcaaca acacacaaac 2100 aagagaatgt tattctctaa tgactccaaa ttacacaatg gatgatcaat ttggaacaag 2160 gttcaacaat caaaatcatg aacaattggc aacaacaaca acaacttttc atcaaggaaa 2220 tggtcatgtt tctcttactc tagggcttcc accaaattct gaaaaccaac acaattacat 2280 tggattggaa aatcattaca atcaacctac acatcatcca aatattagct atgaaaacat 2340 tgattttcag agtggaaagc gatacgccac tcaactatta caagattttg tttcttgatg 2400 atatatataa tttgcaggta aatcagcttg aaattacatc atgaaaggcc ttgaataaaa 2460 gaaggggagt tgagatctag tgatcatata aatatgtata ggtagaaagt ttagttagta 2520 tatataggtt atacttctag tttcttaaat ggagatacaa tttttgttgt tatttttgta 2580 ttgagataac tagctagctt ggattattta aagttgttgc atgcaaccaa agaagaagaa 2640 aaaataatct atatatgcaa actatagtat gttgtaaatt ttgtgcgtct ttttgtttca 2700 atttgcatat atgtaaac 2718

[0050] The mRNA of StBEL11 described above is derived from StBEL11, having a nucleotide sequence of SEQ ID NO:2, as follows, where the upstream sequence is shown in italics, introns are shown in regular font, and exons are shown in bold:

TABLE-US-00002 ttttttttat gtatatatac atttgatgaa gataatgttc tcttaagtga aaatcttgct 60 tttatcatta gttagtactt acaattcttt ctgtcttatt ttatatgata tttttttaaa 120 tttagtttac cccgaaaata aatgatatgt ttttatatat ttaactaatt caatttaact 180 aattcaattt taaacttctt tgaatctcaa tcgaattgcc tcatttttga gaaggagttc 240 gatttcaaac ccagattcga tccactccaa gaaaaagaga aaagaaaaac aaatcaacta 300 cgaaccccca ccccacccca ccccaccccc caccatcgga aaaagggtca taagtagaaa 360 taaagaaaaa ttgagggact tctagcaact aatgtaatca attatgtatt atatatggac 420 ccaacaaatt ggtggaaaaa gacgtttcct catttttcat atatctatgg cctacttcct 480 ttaagttaat gttttttttc ttcatctaat tttaagtcga gtatttattt tgagactcgg 540 attaatttaa attgatgttt tcaggaaaat ttatcaaaag tgaaaatcta acttattgag 600 aattttctta tttgtatgat ttaaatttgt aacctctaaa taaagatgaa aaatcttaat 660 catttcatca ttactcgtaa ttattttctt cttgttagtg ttcactatac tctctctttc 720 tctctaaaga tatttttgaa aaaaaatatc taaattatgc cagcatcaaa tcattttata 780 atagtgaaat taagattggg tctatttatt ttttccatca cacgtatgta gaacccccca 840 cccccaccct cgccgccacc ccaccccctt actatcgagt ttaactaata tttattagta 900 taaaaattat atttatctgt tataacaagt aaaatgtctt atttttaaaa ggataaaggt 960 atgagaaata tcccaacttt gatcggattt actgttgcga tactaaactt tcatgaggat 1020 ctattacctc cttcgactat ttaataccgt atttttatcc ccctgaacta tttaatattg 1080 tattttaaag gtatatatga ttatatgtgc caacgtggac acattactat ttataatttt 1140 gcattatttt ttatgtccac gtggacaaat atatatgttt aaaatacggt attaaatagt 1200 ctagggagct aataggtcct catgaaagtt tagtatcgca acaacaaatt cgatcaaagt 1260 tgagatattt ttcaggccct tatccctatt tttaaaattg aaagtttaca tttttatgaa 1320 gggttaaaac atgtaacatc atttaggtaa cttgatatag tataaaaaat tatttacatt 1380 atatataaat taaattcatg attactaaaa gaattcaatc atcaggtcat ctttatctat 1440 gaaatgtttt atttgtaaaa ttacaaacct cacatttaaa aaagtttatc tataaatata 1500 tttttaaata accttcctga taatgtaaaa atatttatac tgacgattct tactgatttt 1560 ttttttactg tgtttttgag gggtggggtg ggggtgaggg taagggggat atgttgggag 1620 acttacacta aataaacatg tcttctttat tcatattccc ctttatgtgt tgtggagttt 1680 taagaaaatc tctcactttc tctttctccc aattataata agaaaacttt ctttcttcct 1740 tgtttttatt tttaaaaaaa tatttcagtt tagtacatgg ttgaagatat ttgatatagc 1800 cttcatatat gtcactcatg tgagtacaac ttttctccat atatatcaaa atcaagattt 1860 tcatagttga gtgattaatt aattgtatat aactcatcat atattatttg aattttcttt 1920 gttaaaaatg ttttctatct ttagggtatt gcatggattt attataattt ttttctatct 1980 tactttctaa tttcaggttc catcatcagc caagtgttag aagtcacttt ctttaacaag 2040 attttcttaa aaaatattta aaaacttgaa ctccaaaaaa aagaagaaaa ggagtgtaat 2100 tttcttgatt ggttgtgaaa tttatggcta tgtactatca aggaggctca gaaatccaag 2160 ctgatggtct gcagacactt tatttgatga accctaatta tataggctat actgacacac 2220 atcatcatca tcaacaacac caacaacaat cagccaacat gtttttcttg aattctgtgg 2280 cggcggggaa ttttccccac gtgtccctcc ctttgcaagc acatgcgcag gggcacttgg 2340 ttggagtgcc cctgccagct ggttttcaag atcctaaccg cccttccatt ccggaaattc 2400 cgacctctca tcatggcctt ttatcacgtt tgtggacttc tggtgaccaa aataccccta 2460 gaggtggtgg aggaggagga gaaggaaatg gaagtcaatc acatataccg tcttccacgg 2520 tggtttctcc caactcaggt agtgggggag gcaccaccac ggactttgct tcccaattag 2580 ggttccaaag accggggttg gtgtcaccaa cacaggcgca ccatcaaggt ctttctctaa 2640 gcctttctcc acaacaacaa atgaatttca ggtctagtct tccactagac caccgcgata 2700 tttcaacaac aaatcatcaa gttggaatac tatcaccatc accattacca tcaccaggaa 2760 caaataccaa tcatactcga ggattagggg catcatcgtc tttttcgatt tctaatggga 2820 tgataatggg ttctaagtac ctaaaagttg cacaagatct tcttgatgaa gttgttaatg 2880 ttggaaaaaa catcaaatta tcagagggtg gtgcaaagga gaaacacaaa ttggacaatg 2940 aattaatctc tttggctagt gatgatgttg aaagtagcag ccaaaaaaat attgttgttg 3000 aacttactac agctcaaaga caagaacttc aaatgaagaa agccaagctt gttagcatgc 3060 ttgatgaggt atatatactt ctaattattc atatattaat taattaatca tatatatata 3120 ttaatcaaat tattcatata ttaattaatt aatcaatacc aagtttcttg atttggagtt 3180 tgatcattta ggcaaatttc actactatat ataaaacaca aattctaacg gatgtttggt 3240 cagtaagaaa ttctcaattt tcaatcaaac atctattaga atttcacgtt ttttagtagt 3300 gaaattaatt aaataatcta aaaattgttc aatcgaattt acaacaaaac atccattgaa 3360 attttacttt cttttcaata gcgaaaccaa ttaaatagga ttgactaccc aattaatagt 3420 tattatctta tcttcttctt gatttcaatc ttttttcaat aaaaagagta attttaatta 3480 tgagataata aactactgat tagttatgac aatctgaaaa atcaactcct attaaatgat 3540 ccaaaaagtg tacaaatttg tatatcttaa tgttaatttc attgttttat ttatttattt 3600 agttgctttt ttttccttct tgggaagggg gaggggtcaa gttgctattg attcatatac 3660 tagcaataat tattgattta tttcaaaggt acaattttgt tcatcatgaa actataagct 3720 agacaatata tgtggttcta agcttttttc tattgggggt ccaactaaag ttaaagataa 3780 tacacctaat atgtcttgtt gagttgacaa aaaatcaaag gcacgtggtc ttattcaatc 3840 actttattag aacctttcaa atttggaaat attcttacct ttcttttgag ataatcacat 3900 aaaaataaac ctttggaata atttatattt ttggtattcc tattgatatt tgatatctgt 3960 tttgaagctt aactaatata aatatgcgtc gaaaagttat ctcactttag gagattaaaa 4020 tgcttcttag taaaagtgac ttcatattca ggactcgaat aatattactt gatgatcatt 4080 tggacacaat tgatcaattg ggaaataatg aaatattatt ttgcaaatca agttttattt 4140 tataatttca ttagttattt cgacttgaac ttgaaataaa gaatctgaag tttgaaaaat 4200 tgatttaaag agtatttttt tccactctaa gaacttcaaa caatttcaac ttcaacttca 4260 tataatcata ttttttttca acttcaatca gatatcgtcg tgatatgatc aatatcaatc 4320 tacttatttt tattttattg tttgtatttt tttttgaatt ttttataggt ggatcaaagg 4380 tatagacaat accatcacca aatgcaaatg attgcaacat catttgagca aacaacagga 4440 attggatcat caaaatcata cacacaactt gctttgcaca caatttcaaa gcaatttaga 4500 tgtttaaaag atgcaatttt tgggcaaata aaggacacaa gtaaaacttt aggggaagaa 4560 gagaacattg gaggcaaaat tgaaggatca aagttgaaat ttgtggatca tcatttacgc 4620 caacaacgtg cactacaaca attagggatg atgcaaacca atgcatggag gccacaaaga 4680 ggtttgcccg aaagagcggt ttcggttctc cgcgcttggc ttttcgagca ttttcttcat 4740 ccgtaagtat ttgttgaaga cataattaag taaattaata tgcatgtctt ttaatagttt 4800 aagattttaa acaaagcaat cacaacatcc tacatgtttc accgcttgtt ctccttatta 4860 ggaaaaataa ccaattgttc tagagtatat gagaaagaat cagactcgca atctagcatt 4920 tgaagtggca aatacaagac taattaagta aatacaattt ttttttttaa aataacagtt 4980 taaacttttg aatgagatag atttaattaa caccttatat tacctataag aaatgaactt 5040 caatctctat ttttttttta aaaacaattt tatacaccat gtagaaacct ttataaagaa 5100 attaaattaa atcactcata ccatttcttt taaatttcaa taaataaatt atatatttct 5160 tgtcttgcag gtatcccaaa gattcagata aaatcatgct tgctaagcaa acagggctaa 5220 caaggagcca ggttcttgaa aaattcatca tctcaattta tatgacgcat tttttaacat 5280 atctaaaaaa gacgttttat ttctaattta gaaacaataa aattttaaaa ttctcaacaa 5340 tcatagtacc tctctatata actgtaacaa catcttatta taacaaccaa ttttttgaat 5400 atgccgtaaa aaagacatta tattttcaat ttaggaacaa tataacttta aaattctcaa 5460 caatcatagt acctctctat ataactgtaa caacatctta ttataacaac caattttttg 5520 aatatgccgt aaaaaagaca ttatattttc aatttaggaa caatataact ttaaaattct 5580 caacaatcat agtacctctc tatataacag taacaacatc ttgttataac aaactaagtt 5640 cttttttaaa ccaactttca ctacaacaaa gataactttt agcggcaata tacatattaa 5700 taaagaatac taaagctttt accggcatta gttaatttca ttggatccat tatcgctata 5760 gactgtagat acatttacaa aaagtattaa ttaccactaa aaacacatat gtagtggcaa 5820 ttttgctatt gctattaatt aattaatgtt ataaatataa tttttaatgt agtgtttcat 5880 gttatgttaa agtcatgtag tatatgttct ctacgaataa tatttcacta tatcagacaa 5940 aaaatatcta gaataaacaa tgatgttata gaaagatttg acagcaagtc acacaaatat 6000 gtacttaaga gtacttattt tagactacaa gttttaaaag tcgatcgtct gttctttctt 6060 aaaatacttt tgaaaatgca ggtatcaaat tggtttataa atgctagagt tagactatgg 6120 aagccaatgg tagaagaaat gtacatggaa gaagtgaaga aaaacaatca agaacaaaat 6180 attgagccta ataacaatga aattgttggt tcaaaatcaa gtgttccaca agagaaatta 6240 ccaattagta gcaatattat tcataatgct tctccaaatg atatttctac ttccaccatt 6300 tcaacatctc cgacgggtgg cggcggttcg attccggctc agacggttgc aggttagttg 6360 gaatataaag aaagtcattt taaaagttgt cgttgtttga cctataatag gttttgagtc 6420 gtggaaggca tcactaattt gcataaaggt aggttgtccc cttggggtat ggtcttttca 6480 tggagtaacg gtagagttgt ttccactgac ctatataagt tacaggttcg agttgtggaa 6540 ttggttgcgt tgttgatgct catgtcgggg tagactgtct acaacacaca ccttgagata 6600 caacctttta ttgtacccta catgaatgtg aaatacttca cgcaccaaac tgcctaataa 6660 ctcttagaaa agaacacact tgactcacac atctatatat ctacgtagta cctcaattga 6720 taaataatct aggatgatta gatggttaca catatcaaac atataatagg ttcaagtcgt 6780 agaaggcgtc actaatttgc atcaaggtag gttgtcccct tggggtatga tcctttcatg 6840 gaccatgtag acactcttga agttgagtct tgaagtaaca gtaaagtcat ctccacgtga 6900 cctatatata taagtcacaa cttcgagttg tggagttggc taggctctca tcaggataga 6960 ctgtcgacat cacacttctt gaaatgcaac cttttttcga accttatgtg aatgtgagac 7020 tacactcttg actaacatct atataactac tatacctcaa ttaataaaca atctaggata 7080 attagatggt ctcacactct aaacacctag gttagatcaa aagacaataa aactagctag 7140 agtacatttt tatttattgt aacaagtgtt acttatcaaa gtgtgactct atattgttta 7200 actaattaac atgtttaatt tgtctaaaca ggtttctcct tcattaggtc attaaacatg 7260 gagaacattg atgatcaaag gaacaacaaa aaggcaagaa atgagatgca aaattgttca 7320 actagtacta ttctctcaat ggaaagagaa atcatgaata aagttgtcca agatgagaca 7380 atcaaaagtg aaaagttcaa caacacacaa acaagagaat gctattctct aatgactcca 7440 aattacacaa tggatgatca atttggaaca aggttcaaca atcaaaatca tgaacaattg 7500

gcaacaactt ttcatcaagg aaatggtcat gtttctctta ctctagggct tccaccaaat 7560 tctgaaaacc aacacaatta cattggattg gaaaatcatt acaatcaacc tacacatcat 7620 ccaaatatta gctatgaaaa cattgatttt cagagtggaa agcgatacgc cactcaacta 7680 ttacaagatt ttgtttcttg atgatatata taatttccag gtaaatcaac ttgaaattac 7740 atcatgaaag gccttgaata aaagaagggg agttgagatc tagtgatcat atatatatgt 7800 ataggtagaa agtttagtta gtatatatag gttatacttc tagtttctta aatggagata 7860 caatttttgt tgttgttttt gtattgagat aactagctag cttgggttat ttaaagttgt 7920 tgcatgcaac caaagaagaa gaaaaaataa tctatatatg caaactatag tatgttgtaa 7980 attttgtgct tcttttaatt agtttcaatt tgcatatatg taaac 8025

[0051] According to one embodiment, the nucleic acid construct of the present invention comprises DNA heterologous to the first nucleic acid molecule. In one particular embodiment, the DNA heterologous to the first nucleic acid molecule is the 5' DNA promoter sequence.

[0052] In one embodiment, the first nucleic acid molecule comprising a nucleotide sequence configured to silence or reduce expression of StBEL11 has a nucleotide sequence of SEQ ID NO:3, as follows:

TABLE-US-00003 gaaatttatg gctatgtact atcaaggagg ctcagaaatc caagctgatg gtctgcagac 60 actttatttg atgaacccta actatatagg ctacactgac acacatcatc atcatcatca 120 acaccaacaa caatcagcca acatgttttt cttgaattct gtggcggcgg ggaattttcc 180 ccacgtgtcc ctccctttgc aagcacatgc gcaggggcac ttggttggag tgcccctgcc 240 agctggtttt caagatccta accgcccttc cattcaggaa attccgacct ctcatcatgg 300 ccttttatcg cgtttgtgga cttctggtga ccaaaatacc cctagaggtg gtggaggagg 360 aggagaagga aatggaagtc aatcacatat accgtcttcc a 401

[0053] Other nucleic acid molecules may also be used as the first nucleic acid molecule comprising a nucleotide sequence configured to silence or reduce expression of StBEL11. For example, in certain embodiments, the first nucleic acid molecule has a nucleotide sequence that is at least about 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO:3.

[0054] By way of other examples, the first nucleic acid molecule has a nucleotide sequence that is at least about is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, or 94% identical to the nucleotide sequence of SEQ ID NO:3.

[0055] In certain embodiments, the first nucleic acid molecule comprises at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, or 400 contiguous bp of SEQ ID NO:3.

[0056] In certain embodiments, the first nucleic acid molecule comprises at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, or 400 contiguous bp of SEQ ID NO:2 which are less than 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, or 1% identical to any portion of SEQ ID NO:8, where the portion of SEQ ID NO:8 has the same length as the first nucleic acid molecule.

[0057] According to this embodiment, one can silence or reduce expression of StBEL11 without silencing or reducing the expression of StBEL5.

[0058] Methods for identifying nucleic acid molecules capable of silencing or reducing expression of genes and/or related RNA molecules are well known in the art and are discussed in more detail infra.

[0059] Nucleic acid molecules capable of silencing or reducing expression of StBEL11, using any of the methods described infra are contemplated.

[0060] In a further embodiment, the nucleic acid construct according to this aspect of the present invention further comprises a second nucleic acid molecule comprising a nucleotide sequence configured to silence or reduce expression of StBEL29 and variants thereof.

[0061] The mRNA of StBEL29 has a nucleotide sequence of SEQ ID NO:4, as follows, where the 5' UTR and 3' UTR are shown in italics, and the CDS is shown in regular font:

TABLE-US-00004 ttctttcttt ctttctcctc tctctctctc taaaaagttg agtactttta ttagctctca 60 tcacttcaca cagaagaaga tggtattttt atttctttct gctgatggct gcatcaaatg 120 atttgaaaag ctgagtcaaa tcagaagaag aaaaagaaag ttataataat aataatgata 180 atatcaaaaa tattattttc agattagttg gtgttatttg tttattgtgg agaaaaaata 240 aattaaaaag gaagaaaaaa tggcatctta ttttcatgga aattcagaaa tacatgaagg 300 aaatgatgga ttacaaactc taatactaat gaatcctgga tatgttggat tttctgaaac 360 acaacatcac cacgcgccac cgccgccgcc gccaggtggc agcagcagca acatagtttt 420 cttcaactcc aatcctattg gaaattcaat gaacttatct cacgcgccac cacctcctcc 480 accgcctcaa caacaattca tcggtatacc cctcgccacc gccgccttca ccgccccatc 540 ccaagactcc ggtaacaaca acaacaacga gtcaatctcc gcccttcacg gcttcctagc 600 tcgatcgtct cagtacgggt tttacaaccc ggcaaacgac ctcacggcgg cgcgtgacgt 660 cacacgcgct catcatcatc atcagcagcc aagggctttc acttacctgt cctcgtccca 720 gcagccgggg tttgggaact tcacggcggc gcgtgagctt gtttcttcgc cttcgggttc 780 ggcttcagct tcagggatac aacaacaaca acagcaacaa cagagtatta gtagtgtgcc 840 tttgagttct aagtacatga aggctgcaca agagctactt gatgaagttg taaatgttgg 900 aaaatcaatg aaaagtacta atagtactga tgttgttgtt aataatgatg tcaagaaatc 960 gaagaatatg ggcgatatgg acggacagtt agacggagtt ggagcagaca aagacggagc 1020 tccaacaact gagctaagta caggggagag acaagaaatt caaatgaaga aagcaaaact 1080 tgttaacatg cttgacgagg tggagcagag gtatagacat tatcatcacc aaatgcagtc 1140 agtgatacat tggttagagc aagctgctgg cattggatca gcaaaaacat atacagcatt 1200 ggctttgcag acgatttcga agcaatttag gtgtcttaag gacgcgataa ttggtcaaat 1260 acgatcagca agccagacgt taggcgaaga agatagtttg ggagggaaga ttgaaggttc 1320 aaggcttaaa tttgttgata atcagctaag acagcaaagg gctttgcaac aattgggaat 1380 gatccagcat aatgcttgga gacctcagag aggattgccc gaacgagctg tttctgttct 1440 tcgcgcttgg ctttttgaac atttcctcca tccttatccc aaggattcag acaaaatgat 1500 gctagcaaaa caaacaggac taactaggag tcaggtgtcg aattggttca tcaatgctcg 1560 agttcgtctt tggaagccaa tggtggaaga gatgtacttg gaagagataa aagaacacga 1620 acagaatggg ttgggtcaag aaaagacgag caaattaggt gaacagaacg aagattcaac 1680 aacatcaaga tccattgcta cacaagacaa aagccctggt tcagatagcc aaaacaagag 1740 ttttgtctca aaacaggaca atcatttgcc tcaacacaac cctgcttcac caatgcccga 1800 tgtccaacgc cacttccata cccctatcgg tatgaccatc cgtaatcagt ctgctggttt 1860 caacctcatt ggatcaccag agatcgaaag catcaacatt actcaaggga gtccaaagaa 1920 accgaggaac aacgagatgt tgcattcacc aaacagcatt ccatccatca acatggatgt 1980 aaagcctaac gaggaacaaa tgtcgatgaa gtttggtgat gataggcagg acagagatgg 2040 attctcacta atgggaggac cgatgaactt catgggagga ttcggagcct atcccattgg 2100 agaaattgct cggtttagca ccgagcaatt ctcagcacca tactcaacca gtggcacagt 2160 ttcactcact cttggcctac cacataacga aaacctctca atgtctgcaa cacaccacag 2220 tttccttcca attccaacac aaaacatcca aattggaagt gaaccaaatc atgagtttgg 2280 tagcttaaac acaccaacat cagctcactc aacatcaagc gtctatgaaa ccttcaacat 2340 tcagaacaga aagaggttcg ccgcaccctt gttaccagat tttgttgcct gatcacaaaa 2400 acaaaaacag gttttggcaa cagacaaact tctgtcgcta aacaaggaca tgatttagcg 2460 acagataact tcagtcgcta acttagcgac tgaaaacttc tgtcgctaag catgaacatg 2520 tattagcgac atacagtatg caactgtatg tcactaaaca agaacatgat gaattagtga 2580 cggacaactt ctgtcgctaa acaacaaaaa aaaatccatg ttttagtata ttgtttctca 2640 ttctatcata tcatggtagt gtaaagaatc aagaaacaag ttttacatag taacagtctt 2700 tatacattgg agatgaagaa ccatttaagt tcttcaaaat agatagattt tctaggttac 2760 ttctacaaga tatatatatg gttgagggtt tgtatattaa ttttgggatt gttatattgg 2820 atgtggaaaa aaagtagtta ttttgggtgg tataaataaa ataatactcc atccatttta 2880 gccaaaaaaa aaaaaaaa 2898

[0062] The mRNA of StBEL29 described above is derived from StBEL29, having a nucleotide sequence of SEQ ID NO:5, as follows, where the upstream sequence is shown in italics, introns are shown in regular font, and exons are shown in bold:

TABLE-US-00005 tgagaagaaa acccaaagaa acttatgatt tataataaat tattagaaat ttctatggat 60 ataaaatggt aaaaagtaag ttttattaaa tataaaaata tgtttttttt aatggaataa 120 aaagcaaaaa aaaatcacat aaattagaat aaagatcgga gaaagtaaat tataaataaa 180 gacaagatga aaaacaaggc gataatgtaa atcatactaa tcaatcgtta tacatattaa 240 aaaatatcca gcgttacaac aacaaattta acaatataat ataataaaat ttaactaaaa 300 atcaaaataa aatgacattt atcataacaa taattaacaa ccatccaaat atgatgtatg 360 gataaaaggt gaagagtatt agtatctttt gtttaaatct tatatattaa aattataaat 420 ttaattatta ttttaaaaat tcttatataa attttaaatt ctgaatttgt ccgacggcta 480 atctaaagtc aaaagtaaat tttcataaat gtaggtccta aattttttcc cacaattatc 540 ttcttccaag ttgccaacac aaatcaataa tgacaatagg gccctctccc ctatctcttc 600 aaccctacct ctctttttct ttctttatca cttcaagttc atatcatatt tcatactctc 660 tcattttctt ctggtctccg ttgtaattta tatgatatat tttttaatat ttaaaataat 720 ttaattttaa attttttata ctctttaaaa aattattata atcataagtt ataaaaaaaa 780 ttaacttttt tttattcagt caaatactat catataaatt aaaaaagaaa aagtatatgt 840 taaatcctta taattattat tgttaaagaa gaaaaaaggg aggttagtgg aagtggacgt 900 tacctcgttt ttcatctgtc tgttttttct gacacacctt tgatctttga tgatggatac 960 gtcgctccgt tcatatttag gtgatactat attaatttca agagttaaat aatgataaat 1020 cacctaagac cgctaatgtt ccatctaatt caagaacaag cccttctcaa tgtcttgcct 1080 ttcgcatgtg ttttctttga aattggaatt ccaaccaagt tcccttccca aagcgggaac 1140 aagttggtgc gaccgattaa agaagaagga caaagagtta aataatgaaa ttataattat 1200 tttatattaa ttattataat ttataatatt ttttaaaaac taaatgttct aatttaaagg 1260 caaagtccaa atatttattt tataaatttt gaagcataat tgggttttga ttaattattt 1320 atatcaaatt aaatttattt taatacaaat acataattta agacaaagct attgagttaa 1380 agttatgtca aattaaatcc gtaactttat aagctcaagg ggagaaagag agaaggattg 1440 ttcattcctt ataacgagtc tagagatctc atcctttatc gatgtaaggt tctttccatt 1500 catcactccc ttgcgttaga accttttttt tttagactgg agcgtgcaca ttcatggacc 1560 attcttccca ttcgtcaatc cctcgtgtta gaatttttat ttctcgaact agagtgtgtg 1620 cattaacaga taccagatac cgatattttc accctcattc aagccgtctc tggaagagct 1680 atattggatg agcctgactt tgataccata tcaaattaac tcttcaacct aattcataca 1740 tcaaaagcta gctcgcctta taagaagtct ttccattcgt cactccctcg tgttacaact 1800 tacaagacta gctcaataaa aaattatcgt ccaaatttta taagaagtcc attcatcaat 1860 agcacctttc ctatttgtat ttgcacttaa aaaaaaaaag gtgacttttg aaatttgaat 1920 tatgccacat aaattatcct tcggtatagc ccaatgattt gaccttggta ctttcatatt 1980 ggaggtctca aatttgaaat tccttaccag taaaaataaa aaatttacct tcctgaatcg 2040 aacttatcgc gccagacttc cttagacaca caaattagaa taaaaaaagt atattttatt 2100 tttatatata agcaaaaaca cacactaact cacattcaca catccacatc tttctttctt 2160 tctttctcct ctctctctct ctaaaaagtt gagtactttt attagctctc atcacttcac 2220 acagaagaag atggtatttt tatttctttc tgctgatggc tgcatcaaat gatttgaaaa 2280 gctgagtcaa atcagaagaa gaaaaagaaa gttataataa taataataat aatatcaaaa 2340 atattatttt caggtatggt acttctttac tcattaacaa tgtaaatata gaatttgaag 2400 tttacgagct agttttctct tcttttttat tttgactagc agaaacagag tcagagtcag 2460 aatttgaagt ttataagtct tgaattctga ttttgtttga gttcttgagt tctgaattga 2520 taatttatac atgttgaatg aattttgtaa gtatactttg aaacaaatct attgagttcg 2580 attgaattca taaccgacac tttagttccg ccacttttca gaggcggatc cagaatatga 2640 aggttatgac ttatgagtat tgtaaccttt tgagttactg aattctaaat taattttata 2700 agtgagtaaa tacaaaattt gaaacaaaat tagctattga gttcagttga attcgtataa 2760 ccgacactct agctttgtca ctgctcaaag actgatctag aatttgaagt ttatgagttt 2820 tgaattctaa attgataatt tctacatgtt agatggaatt tttaagataa atataaatta 2880 aaattattga gttcgatcga attcgatttg tgttttcctt tttcttcacc ttatttatca 2940 agagaaatta ttttaatttt tttttatcat tactgattca taaatctata tagatatata 3000 tagatggata cattagagtt cctaaaaaat gttataaaga gtattttgtt tttccctttc 3060 ttgatttttt ttcgaaacta agatttcaat tttatcattt ctgaatttta taacaacgat 3120 tatcatagaa ttctaaattt actagttata catatttatt taacgaatta ttaacataaa 3180 tgcattattt gaataaaatt tattagattt gaccgaactc gtatatgaac tttctctctc 3240 atgtaatttc agccgtaact gtgtgtattt cctttctctc tctaaaaaat ctgttatggt 3300 gttctgtgtc actctaacaa aaaataaatt attcttcatt tcttccattg tcagattata 3360 atacaccacg tgcacttaca aattttgtga aaaccatatt ttaatttaca aatccttttc 3420 ataattcttt tttttaatca agaaaattaa atttaattac attaagtatt ttttacaata 3480 atattaacat attactaaat aaattttcag gtttatttta ccatttttgt gattttgaag 3540 tgttacaaag tgtgaatggg ttggactttt tggacctcag ctaggtagct tcttgtcttc 3600 aacacaaaag gtacatataa aaattacaat aaaattataa ccacttttac ttaggaattt 3660 taccatattt aggtaaaaaa aataaatcac tcgcctagtc gtaataatca gtagcagagc 3720 tagaggaacg aaaggcttca tctgaatctt ctttatctga aatcatactg tatataaggt 3780 caaaattcat tttttatgaa cacttttgat gaaaatcatg tctctgccac taaagtcgta 3840 atttgtaggc atcaacaata tgtatatata tatatatata gtgattattg attatatacg 3900 gtatatattg gttaaaagtt ttgaaaaata aggattaaag ttaatttcca ttgtgtgttt 3960 tcttgggatc aggggcggag ctagataagt gtaaaaaggg tttatctaga cttcttccga 4020 ccaaaaatta tacttatata catatacata gtagatactg aatcccttgc ttttttcgta 4080 tatgtacttc cgcatatttt aaatttcttt aatgaaaatt ctgactcata tactgtttga 4140 atgtttttgt atttaatata tgtatgtttt gcctttttat tttggaaaaa atgatatatg 4200 tggacttact tgacttgact ttaacttatt tttttttatt tttcagatta gttggtgtta 4260 tttgtttata gtggagaaaa aataaattaa aaaagaagag aaaatggcat cttattttca 4320 tggaaattca gaaatacaag aaggaaatga tggattacaa actctaatac taatgaatcc 4380 tggatatgtt ggattttctg aaacacaaca tcaccacgcg ccgccgccgc caggtggcag 4440 cagcaacaac atagttttct tcaactccaa tcctcttgga aattcaataa acttatctca 4500 cgcgccacca cctccgccac cgccacaaca acatttcgtc ggtatacctc tcgccaccgc 4560 cgccttcacc gccccatccc aagactccgg taacaacaac aacaacgagt caatctccgc 4620 ccttcacggc ttcctagctc gatcgtctca gtacgggttt tacaacccgg ctaacgacat 4680 cacggcggcg cgtgaggtca cacgcgctca tcatcagcag cagcaagggc tttcacttag 4740 cctgtcctca tcccagcagc ctgggtttgg gaacttcacg gcggcgcgtg agattgtttc 4800 ttcgcctacg cgttcggctt cggcttccgg gatacaacaa caacaacagc aacaacaaag 4860 tattagtagt gtgcctttga gttctaagta catgaaggct gcacaagagc tacttgatga 4920 agttgtaaat gttggaaaat caatgagaag tactaatagt actgaagttg ttgttaataa 4980 tgatgtcaag aaatcgaaga ttatgaccga tatggatgga cagatagatg gaggagcaga 5040 caaagacgga actccaacaa ctgagctaag taccgcagag aggcaagaaa ttcaaatgaa 5100 gaaagcaaaa cttgttaaca tgcttgacga ggtaaccttg ttgtcttttt ctcagtaatg 5160 ttgttgcatt cgtgtcagat cagagtctta aaattagtca atagaagaaa cttcatttcc 5220 tcgagtacgt gtaattgtgg ccttttcgac ttccaactag tatttacaat agtgcactct 5280 acattgataa gcttgacgac aagtaggcaa agcgatggcc ttgttggttg ttatagtttt 5340 ttggttatgt tgctcggact ctgcaaaatt attgtcatac tcaagtcaga ttctccaaaa 5400 tgcactattt ttggagtatc cgacttgcag tctgacattt attttttccg aagagtctga 5460 gcaacatagg ttttcttggc tttccaagat agtaagagaa tggtctctat caaaaaaagt 5520 tacatcatat cattactgaa aataagagca aaaaagtatc tgtcaaatga taaagaccag 5580 aacttcaaaa ctgttacttt cgtcagggca ctgtcttgac aattgtaaac aaaaaatgaa 5640 agaatttttc gaaaataatt tcttcgaaat ctttgatcta aagctaaata tcggttcgat 5700 tttgggtgtt gttatatagg tggagcagag gtatagacat tatcatcacc aaatgcagtc 5760 agtgatacac tggttggagc aagctgctgg tattggatca gcaagaacat atacagcatt 5820 ggctttgcag acgatttcga agcaatttag gtgtcttaag gacgcgataa ttggtcaaat 5880 acgatcagca ggcaagacgt taggcgaaga agatagtttg ggagggaaga ttgaaggttc 5940 aaggcttaaa tttgttgaca atcagctaag acagcaaagg gctttgcaac aattgggaat 6000 gatccagcat aatgcttgga gacctcagag aggattgccc gaacgagctg tttctgttct 6060 tcgcgcttgg ctttttgaac atttcctcca tccgtaagca cgaaacaacc ctttttcatc 6120 agctatgttg ctcggacttt tcaaaaacgt tgtcgcacca gtgttggatc ctcgcagaat 6180 gcattgattt tttgaggatc cgacacatac ctgacgatat ttttgaagag tctgaacaac 6240 atagcttagt taaaagtact gtattttgat atattgtggc aatttgtttt gtatagctat 6300 cccaaggatt cagacaaaat gatgctagca aaacaaacag ggctaactag gagtcaggtc 6360 agtgatatct gataacaaca ttgtcatttt tgattctcga gttgatttct cagatggtca 6420 cttaactgta gttattatat cagaaagtcg ccttacttca acaaagagag tgacattctg 6480 agataataac tgtgagttga gtgaccatct gagaaatcaa ctcttggatt ctccgttttt 6540 ggtttttact aagttttgtt tttggacaat tcaggtgtcg aattggttca tcaatgctcg 6600 agttcgtctt tggaagccaa tggtggaaga gatgtacttg gaagagataa aagaacagaa 6660 cggattgggt caagaaaaga cgagcaaatt aggcgaacag aacgaagatt caacaacatc 6720 aagatccatt gctacacaag acaaaagccc tggttcagat agccaaaaca agagttttgt 6780 ctcaaaacag gacaatcatt tgccccaaca caaccctgct tcaccaatgc cgatgtccaa 6840 caccacttcc atacctccta tcggtatgaa catccgtaat cagtctgctg gtttcaacct 6900 cattggatca ccagagatcg aaagcatcaa cattactcaa gggagtccaa agaaaccaag 6960 gaacaacgag atgttgcatt caccaaacag cattccatcc atcaacattg atgtaaagcc 7020 taacgagcaa caaatgtcga tgaagtttgg tgatgatagg caagacagag atggattctc 7080 actaatggga ggaccgatga acttcatggg aggattcgga gcctatccca ttggagaaat 7140 tgctcggttt agcaccgagc aattctcagc accatactca accagtggca cagtttcact 7200 cactcttggc ctaccacata acgaaaacct ctcaatgtca gcaacacacc acagtttcct 7260 tccaattcca acacaaaaca tccaaattgg aagtgaacca aatcatgagt ttggtagctt 7320 aaacacacca acatcagctc actcaacatc aagcgtctac gaaaatttca acattcagaa 7380 cagaaagagg ttcgccgcac ccttgttacc agattttgtt gcctgatcac aaaaacaaaa 7440 acaggattta gcgacagaca aacttctgtc gctaaacaag aacatgattt agcgacagat 7500

aacttcagtc gctaacttag cgactgaaaa cttctgtcgc taaacatgaa catgtattag 7560 cgacatacag tatacaactg tatgtcgcta aacaagaaca tgatgaatta gtgacggaca 7620 acttctgtcg ctaaacaaca aaaaaagatc catgttttag tatattgttt ctcattctat 7680 catatcatgg tagtgtaaag aatcaagaaa caagttttac atagttacat agtctttata 7740 cattggagat gaagaaccat ttaagttctt caaaatagat agattttcta ggttacttct 7800 agaagatata tatatggttg agggtttgta tattaatttt gggattgtta tattggatgt 7860 ggaaaaaaag tagttatttt gggtggtata aataaaataa tactccatcc attttagcca 7920 a 7921

[0063] In one embodiment, the second nucleic acid molecule comprising a nucleotide sequence configured to silence or reduce expression of StBEL29 has a nucleotide sequence of SEQ ID NO:6, as follows:

TABLE-US-00006 gtgttatttg tttattgtgg agaaaaaata aattaaaaag gaagaaaaaa tggcatctta 60 ttttcatgga aattcagaaa tacatgaagg aaatgatgga ttacaaactc taatactaat 120 gaatcctgga tatgttggat tttctgaaac acaacatcac cacgcgccac cgccgccgcc 180 gccaggtggc agcagcagca acatagtttt cttcaactcc aatcctattg gaaattcaat 240 gaacttatct cacgcgccac cacctcctcc accgcctcaa caacaattca tcggtatacc 300 cctcgccacc gccgccttca ccgccccatc ccaagactcc ggtaacaaca acaacaacga 360 gtcaatctcc gcccttcacg gcttcctagc tcgatcgtct cagtacgggt tttacaaccc 420 ggcaaacgac ctcacggcgg cgcgtgacgt cacacgcgct catcatcatc atcagcagcc 480 aagggctttc acttacctgt cctcgtccca gcagccgggg tttgggaact tcacggcggc 540 gcgtgagctt gtttcttcgc cttcgggttc ggcttcagct tcagggatac aacaacaaca 600 acagcaacaa cagagtatta gtagtgtgcc tttgagttct aagtacatga aggctgcaca 660 agagctactt gatgaagttg taaatgttgg aaaatcaatg aaaagtacta atagtactga 720 tgttgttgtt aataatgatg tcaagaaatc gaagaatatg ggcgatatgg acggacagtt 780 agacggagtt ggagcagac 799

[0064] Other nucleic acid molecules may also be used as the second nucleic acid molecule comprising a nucleotide sequence configured to silence or reduce expression of StBEL29. For example, in certain embodiments, the second nucleic acid molecule has a nucleotide sequence that is at least about 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO:6.

[0065] By way of other examples, the second nucleic acid molecule has a nucleotide sequence that is at least about is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, or 94% identical to the nucleotide sequence of SEQ ID NO:6.

[0066] In certain embodiments, the first nucleic acid molecule comprises at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, or 400 contiguous bp of SEQ ID NO:6.

[0067] In certain embodiments, the first nucleic acid molecule comprises at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, or 400 contiguous by of SEQ ID NO:5 which are less than 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, or 1% identical to any portion of SEQ ID NO:8, where the portion of SEQ ID NO:8 has the same length as the first nucleic acid molecule.

[0068] According to this embodiment, one can silence or reduce expression of StBEL29 without silencing or reducing the expression of StBEL5.

[0069] Nucleic acid molecules capable of silencing or reducing expression of StBEL29, using any of the methods described infra are contemplated.

[0070] In one embodiment, the first nucleic acid molecule comprises a nucleotide sequence configured to silence or reduce expression of both StBEL11 and StBEL29. This is possible because of the similarity in sequence between StBEL11 and StBEL29.

[0071] In yet another embodiment of this aspect of the present invention, the nucleic acid construct further comprises a further nucleic acid molecule comprising a nucleotide sequence configured to enhance the expression of StBEL5 and variants thereof. This additional nucleic acid molecule may be included in the nucleic acid construct of this aspect of the present invention in addition to the second nucleic acid molecule (described supra) or in place of the second nucleic acid molecule.

[0072] The mRNA of StBEL5 has a nucleotide sequence of SEQ ID NO:7, as follows, where 5' UTR and 3' UTR sequences are shown in italics, and the CDS is shown in regular font:

TABLE-US-00007 catgcagaga taaaaatata gatcagtctg acaagaaggc aacttctcaa agcttagaga 60 gctaccaccc gaagatagac agttagttac atgtactgtt atagataaaa ggagaaatcc 120 gaagaagaaa gaattttttt tgcagatatg tactatcaag gaacctcgga taatactaat 180 atacaagctg atcatcaaca acgtcataat catgggaata gtaataataa taatattcag 240 acactttatt tgatgaaccc taacaattat atgcaaggct acactacttc tgacacacag 300 cagcagcagc agttactttt cctgaattct tcaccagcag caagcaacgc gctttgccat 360 gcgaatatac aacacgcgcc gctgcaacag cagcactttg tcggtgtgcc tcttccggca 420 gtaagtttgc acgatcagat caatcatcat ggacttttac agcgcatgtg gaacaaccaa 480 gatcaatctc agcaggtgat agtaccatcg tcgacggggg tttctgccac gtcatgtggc 540 gggatcacca cggacttggc gtctcaattg gcgtttcaga ggccgattcc gacaccacaa 600 caccgacagc agcaacaaca gcaaggcggt ctatctctaa gcctttctcc tcagctacaa 660 cagcaaatta gtttcaataa caatatttca tcctcatcac caaggacaaa taatgttact 720 attaggggaa cattagatgg aagttctagc aacatggttt taggctctaa gtatctgaaa 780 gctgcacaag agcttcttga tgaagttgtt aatattgttg gaaaaagcat caaaggagat 840 gatcaaaaga aggataattc aatgaataaa gaatcaatgc ctttggctag tgatgtcaac 900 actaatagtt ctggtggtgg tgaaagtagc agcaggcaga aaaatgaagt tgctgttgag 960 cttacaactg ctcaaagaca agaacttcaa atgaaaaaag ccaagcttct tgccatgctt 1020 gaagaggtgg agcaaaggta cagacagtac catcaccaaa tgcaaataat tgtattatca 1080 tttgagcaag tagcaggaat tggatcagcc aaatcataca ctcaattagc tttgcatgca 1140 atttcgaagc aattcagatg cctaaaggat gcaattgctg agcaagtaaa ggcgacgagc 1200 aagagtttag gtgaagagga aggcttggga gggaaaatcg aaggctcaag actcaaattt 1260 gtggaccatc atctaaggca acaacgcgcg ctgcaacaga taggaatgat gcaaccaaat 1320 gcttggagac cccaaagagg tttacctgaa agagctgtct ctgtccttcg tgcttggctt 1380 ttcgagcatt ttcttcatcc ttacccaaag gattcagaca aaatcatgct tgctaagcaa 1440 acggggctaa caaggagcca ggtgtctaac tggttcataa atgctcgagt tcgattatgg 1500 aagccaatgg tagaagaaat gtacttggaa gaagtgaaga atcaagaaca aaacagtact 1560 aatacttcag gagataacaa aaacaaagag accaatataa gtgctccaaa tgaagagaaa 1620 catccaatta ttactagcag cttattacaa gatggtatta ctactactca agcagaaatt 1680 tctacctcaa ctatttcaac ttcccctact gcaggtgctt cacttcatca tgctcacaat 1740 ttctccttcc ttggttcatt caacatggat aatactacta ctactgttga tcatattgaa 1800 aacaacgcga aaaagcaaag aaatgacatg cacaagtttt ctccaagtag tattctttca 1860 tctgttgaca tggaagccaa agctagagaa tcatcaaata aagggtttac taatccttta 1920 atggcagcat acgcgatggg agattttgga aggtttgatc ctcatgatca acaaatgacc 1980 gcgaattttc atggaaataa tggtgtctct cttactttag gacttcctcc ttctgaaaac 2040 ctagccatgc cagtgagcca acaaaattac ctttctaatg acttgggaag taggtctgaa 2100 atggggagtc attacaatag aatgggatat gaaaacattg attttcagag tgggaataag 2160 cgatttccga ctcaactatt accagatttt gttacaggta atctaggaac atgaatacca 2220 gaaagtctcg tattgatagc tgaaaagata aaaggaagtt agggatactc ttatattgtg 2280 tgaggccttc tggcccaagt cggaggaccc aatttgatac aacctatcat aggagaaaag 2340 aagtggagac taaattaaag taacaaaatt ttaaagcaca ctttctagta tatatacttc 2400 ttttttttat agtatagaaa agaagagatt ttgtgcttta gtgtatagat agagtctact 2460 tagtataggt tatacttcta gttccttgag aagattgata caactagtag tatttttttt 2520 cttttgggtt ggcttggagt actattttaa gttattggaa actagctata gtaaatgttg 2580 taaagttgtg atattgttcc tctcaatttg catataattt gaaatatttt gtacctacta 2640 gctagtctct aaattatgtt tccattgctt gtaattgcaa ttttatttga attttgtgct 2700 atcattatta gattagcaaa aaaaaaaaaa aaaaa 2735

[0073] The mRNA of StBEL5 described above is derived from StBEL5, having a nucleotide sequence of SEQ ID NO:8, as follows, which includes UTR, exons, and intronic sequence:

TABLE-US-00008 gtaggtacaa aatatttcaa attatatgca aattgagagg aacaatatca caactttaca 60 acatatacta tagctagttt ccatattaac ttaaaatagt actccaagcc aacccagaaa 120 gaaaaaaaat actactagtt gtatcaatct tctcaaggaa ctagaagtat aacctatact 180 aagtagactc tatctataca ctaaagcaca aaatctcttc ttttctatac tataaaaaaa 240 agaagtatat atactagaaa gtgtgcttta aaattttgtt actttaattt tgtctccact 300 tcttttctcc tatgataggt tgtatcaaat tgggtcctcc gacttgggcc agaaggcctc 360 acacaatata agagtatccc taacttcctt ttatcttttc agctatcaat acgagacttt 420 ctggtattca tgttcctaga ttacctgtaa caaaatctgg taatagttga gtcggaaatc 480 gcttattccc actctgaaaa tcaatgtttt catatcccat tctattgtaa tgactcccca 540 tttcaggcct acttcccaag tcattagaaa ggtaattttg ttggctcact ggcatggcta 600 ggttttcaga aggaggaagt cctaaagtaa gagagacacc attatttcca tgaaaattcg 660 cggtgatttg ttgatcatga ggatcaaacc ttccaaaatc tcccatcgcg tatgctgcca 720 ttaaaggatt agtaaaccct ttatttgatg attctctagc tttggcttcc atgtcaacag 780 atgaaagaat actacttgga gaaaacttgt gcatgtcatt tctttgcttt ttcgcgttgt 840 tttcaatatg atcaacagta gtagtagtag tattatccat gttgaatgaa ccaaggaagg 900 agaaattgtg agcatgatga agtgaagcac ctgcagtagg ggaagttgaa atagttgagg 960 tagaaatttc tgcttgagta gtagtaatac catcttgtaa taagctgcta gtaataattg 1020 gatgtttctc ttcatttgga gcctctttgt ttttgttatc tcctgaagta ttagtactgt 1080 tttgttcttg attcttcact tcttccaagt acatttcttc taccattggc ttccataatc 1140 gaactcgagc atttatgaac cagttagaga cctgcatttt catatatatt aagaattttt 1200 ttataaagaa aagaaaggaa ttaatccaag aattatagta aaatgtgtgt ctaagaacct 1260 ggctccttgt tagccccgtt tgcttagcaa gcatgatttt gtctgaatcc tttgggtaac 1320 tgcaatataa aaatatatta agaaaaaaaa aattatagtt aaaaacatac tcctatatta 1380 gagaagaatg ggcgaattca gaatttagaa taataatgtg atcttattat atacatgaac 1440 atattttatt ttttgtgtgt atgcatatat agtttgagtt aaaagtaagt gtctttttaa 1500 ccgtccaaac gaaagtttca aaataactgg cgttgctcta aaaatcactt aatttgttcc 1560 taatggatgg acatgttaaa accatataaa agacacttag taaaatatag gacgacaggc 1620 gtatatatga cgcaaaaatt ggttagaata atcaattttc tatctactac tccgtagata 1680 tttttcacat tgttaaattt ttcaaagaaa taaatagttt aggagtactc acggatgaag 1740 aaaatgctcg aaaagccaag cacgaaggac agagacagct ctttcaggta aacctctttg 1800 gggtctccaa gcatttggtt gcatcattcc tagctgttgc agcgcgcgtt gttgccttag 1860 atgatggtcc acaaatttga gtcttgagcc ttcgattttc cctactaagc cttcctcttc 1920 acctaaactc ttgctcgtcg cctttacttg ctcagcaatt gcatccttta ggcatctgaa 1980 ttgcttcgaa attgcatgca aagctaattg agtgtatgat ttggctgaac caattcctgc 2040 tacttgctca aatgatgata caattatttg catttggtga tggtactgtc tgtacctttg 2100 ctccacctga acaaaaaaaa gggagtaata ttaaactttt accagtctgt cgttttacaa 2160 catgaagtta tcttatgttg gctactattg aaattaaaga attttatttc agttaaaaga 2220 tcatatatat atatatatat atattccaag tgagaaataa attgagtagt atattttgca 2280 aaattttgta aaccaacgaa tttttgagag tcattagatt gaggacacat ctgagtggac 2340 attatgcgtg gtgtaaaaaa ggtgaataag agatagtggt ttgaattttg gtgcagcgga 2400 agacatttca ggttcgtagc taactttggt gtattatctt tatagcttta gttggacccg 2460 cagaagaaaa tttaagagcc acacattgtc agtttgtttt aatatcaacg tacgtgattg 2520 gtctcttgtt cttcaactaa ttaacaaaac ctgtacattt catttaccaa ctactattgt 2580 tgcaaacata tataaatcaa cagtttcatc cattcaattt tttatgagaa aaattacagt 2640 tttgaatcat ttgaaaataa aattttaaat atatatgtcg aattcagtag ttttagtgtt 2700 aagaatccga aattcataga ctcaaaattc aggatcatac ctcttcaagc atggcaagaa 2760 gcttggcttt tttcatttga agttcttgtc tttgagcagt tgtaagctca atagcaactt 2820 catttttctg cctgctgcta ctttcaccac caccaccacc accagaacta ttagtgttga 2880 catcactagc caaaggcatt gaattatcct tcttttgatc atctcctttg atgctttttc 2940 caacaatatt aacaacttca tcaagaagct cttgtgcagc tttcagatac ttagagccta 3000 aaaccatgtt gctagaactt ccatctaatg ttcctctaat agtaacatta tttgtccttg 3060 gtgatgagga tgaaatattg ttattgaaac taatttgctg ttgttgctga ggagaaaggc 3120 ttagagatag accgccttgc tgttgttgct gctgctgtcg gtgttgtggt gtcggaatcg 3180 gcctctgaaa cgccaattga gacgccaagt ccgtggtgat cccgccacat gacgtggcag 3240 aaacccccgt cgacgatggt actatcacct gctgagattg atcttggttg ttccacatac 3300 gctgtaaaag tccatgatga ttgatctgat cgtgcaaact tactgccgga agaggcacac 3360 cgacaaagtg ctgctgttgc agcggcgcgt gttgtatatt cgcatggcaa agcgcgttgc 3420 ttcctgctgg tgaagaattc aggaaaagta actgctgctg ctgctgtgtg tcagaagtag 3480 tgtagccttg catataattg ttagggttca tcaaataaag cgtctgaata ttattattat 3540 tactactatt cccatgatta tgatgttgtt gatgatcagc ttgtatatta ttatccgagg 3600 ttccttgata gtacatatct gcaaaaaaaa atctttcttc ttcgaatttc tccttttatc 3660 tacaacagta cctgtaaaca gaaagtaaca aaggagaaaa ggcttcaaat aagtccacac 3720 aaacattttt ataagtaaac ggaagggaat tctttatagt gaaaaattaa attttgttta 3780 cagagatctt caactataaa taaaaaaaac aggaaaatga tataaaagaa agagaaagag 3840 atgaaaggag ctttagcaaa aaaatcagtc actcacacat acacacatgt aactaactgt 3900 ctatcttcgg gtggtagctc tctaagcttt gagaagttgc cttcttgtca gactgatcta 3960 tatttttctc tctgcattct catctcttca accacaaaaa ggaaatatga ataaa 4015

[0074] In one embodiment, the further nucleic acid molecule comprises a nucleotide sequence of SEQ ID NO:7 or a nucleic acid molecule that is at least about 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO:8. Alternatively, the further nucleic acid molecule comprises a nucleotide sequence capable of expressing active and/or functional StBEL5 to enhance the expression of StBEL5. A description of enhancing the expression of StBEL5 is provided infra.

[0075] Another aspect of the present invention is directed to a nucleic acid construct comprising a first nucleic acid molecule comprising a nucleotide sequence configured to silence or reduce expression of StBEL29 and variants thereof; a 5' DNA promoter sequence; and a 3' terminator sequence, where the first nucleic acid molecule, the promoter sequence, and the terminator sequence are operatively coupled to permit transcription of the first nucleic acid molecule.

[0076] According to one embodiment, the nucleic acid construct of the present invention comprises DNA heterologous to the first nucleic acid molecule. In one particular embodiment, the DNA heterologous to the first nucleic acid molecule is the 5' DNA promoter sequence.

[0077] In one embodiment, the first nucleic acid molecule comprising a nucleotide sequence configured to silence or reduce expression of StBEL29 has a nucleotide sequence of SEQ ID NO:6.

[0078] Other nucleic acid molecules may also be used as the first nucleic acid molecule comprising a nucleotide sequence configured to silence or reduce expression of StBEL29. For example, in certain embodiments, the second nucleic acid molecule has a nucleotide sequence that is at least about 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO:6.

[0079] By way of other examples, the first nucleic acid molecule has a nucleotide sequence that is at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, or 94% identical to the nucleotide sequence of SEQ ID NO:6.

[0080] In certain embodiments, the first nucleic acid molecule comprises at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, or 400 contiguous bp of SEQ ID NO:6.

[0081] In certain embodiments, the first nucleic acid molecule comprises at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, or 400 contiguous by of SEQ ID NO:5 which are less than 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, or 1% identical to any portion of SEQ ID NO:8, where the portion of SEQ ID NO:8 has the same length as the first nucleic acid molecule.

[0082] According to this embodiment, one can silence or reduce expression of StBEL29 without silencing or reducing the expression of StBEL5.

[0083] In yet another embodiment of this aspect of the present invention, the nucleic acid construct further comprises a further nucleic acid molecule comprising a nucleotide sequence configured to enhance the expression of StBEL5 and variants thereof.

[0084] In one embodiment, the further nucleic acid molecule comprises a nucleotide sequence of SEQ ID NO:7 or a nucleic acid molecule that is at least about 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO:5. Alternatively, the further nucleic acid molecule comprises a nucleotide sequence capable of expressing active and/or functional StBEL5 to enhance the expression of StBEL5. A description of enhancing the expression of StBEL5 is provided infra.

[0085] Methods for identifying nucleic acid molecules capable of silencing or reducing expression of genes and/or related RNA molecules are well known in the art and are discussed in more detail infra.

[0086] As discussed supra, the nucleic acid constructs of the present invention comprise, in one embodiment, one or more nucleic acid molecules comprising a nucleotide sequence configured to silence or reduce expression of mRNA molecules and/or genes. In some embodiments, the nucleic acid constructs include a nucleic acid molecule comprising a nucleotide sequence configured to enhance expression of mRNA molecules and/or genes.

[0087] General strategies for silencing or reducing expression and enhancing expression are known in the art. Up-regulation, down-regulation, ectopic expression, gene editing, or gene silencing are well known.

[0088] Silencing or reducing gene expression means the interruption or suppression of the expression of a gene at the level of transcription or translation. In the present invention, silencing of StBEL gene expression may be carried out, according to one embodiment, by a nucleic acid molecule of the construct containing a dominant mutation and encoding a non-functional StBEL, resulting in suppression or interference of endogenous mRNA encoding the StBEL or variant thereof.

[0089] In another embodiment, the nucleic acid construct results in interference of StBEL gene expression by sense or co-suppression in which the nucleic acid molecule of the construct is in a sense (5'->3') orientation. Co-suppression has been observed and reported in many plant species and may be subject to a transgene dosage effect or, in another model, an interaction of endogenous and transgene transcripts that results in aberrant mRNAs (Senior, "Uses of Plant Gene Silencing," Biotechnology and Genetic Engineering Reviews 15:79-119 (1998); Waterhouse et al., "Exploring Plant Genomes by RNA-Induced Gene Silencing," Nature Review: Genetics 4:29-38 (2003), which are hereby incorporated by reference in their entirety). A construct with the nucleic acid molecule in the sense orientation may also give sequence specificity to RNA silencing when inserted into a vector along with a construct of both sense and antisense nucleic acid orientations as described infra (Wesley et al., "Construct Design for Efficient, Effective and High-Throughput Gene Silencing in Plants," Plant Journal 27(6):581-590 (2001), which is hereby incorporated by reference in its entirety).

[0090] In yet another embodiment, the nucleic acid construct results in interference of StBEL gene expression by the use of antisense suppression in which the nucleic acid molecule of the construct is an antisense (3'.fwdarw.5') orientation. The use of antisense RNA to down-regulate the expression of specific plant genes is well known (van der Krol et al., "An Anti-sense Chalcone Synthase Gene in Transgenic Plants Inhibits Flower Pigmentation," Nature 333:866-869 (1988) and Smith et al., "Antisense RNA Inhibition of Polygalacturonase Gene Expression in Transgenic Tomatoes," Nature 334:724-726 (1988), which are hereby incorporated by reference in their entirety). Antisense nucleic acids are DNA or RNA molecules that are complementary to at least a portion of a specific mRNA molecule (Weintraub, "Antisense RNA and DNA," Scientific American 262:40 (1990), which is hereby incorporated by reference in its entirety). In the target cell, the antisense nucleic acids hybridize to a target nucleic acid and interfere with transcription, and/or RNA processing, transport, translation, and/or stability. The overall effect of such interference with the target nucleic acid function is the disruption of protein expression (Baulcombe, "Mechanisms of Pathogen-Derived Resistance to Viruses in Transgenic Plants," Plant Cell 8:1833-44 (1996); Dougherty, et al., "Transgenes and Gene Suppression: Telling us Something New?," Current Opinion in Cell Biology 7:399-05 (1995); Lomonossoff, "Pathogen-Derived Resistance to Plant Viruses," Ann. Rev. Phytopathol. 33:323-43 (1995), which are hereby incorporated by reference in their entirety). Accordingly, one embodiment involves a nucleic acid construct which contains the StBEL gene encoding nucleic acid molecule being inserted into the construct in antisense orientation.

[0091] Interfering with endogenous StBEL gene expression may involve an RNA-based form of gene-silencing known as RNA interference ("RNAi") (also known as siRNA for short, interfering RNAs). RNAi is a form of post-transcriptional gene silencing ("PTGS"). PTGS is the silencing of an endogenous gene caused by the introduction of a homologous double-stranded RNA ("dsRNA"), transgene, or virus. In PTGS, the transcript of the silenced gene is synthesized, but does not accumulate because it is degraded. RNAi is a specific form of PTGS, in which the gene silencing is induced by the direct introduction of dsRNA. Numerous reports have been published on critical advances in the understanding of the biochemistry and genetics of both gene silencing and RNAi (Matzke et al., "RNA-Based Silencing Strategies in Plants," Curr. Opin. Genet. Dev. 11(2):221-227 (2001), Hammond et al., "Post-Transcriptional Gene Silencing by Double-Stranded RNA," Nature Rev. Gen. 2:110-119 (Abstract) (2001); Hamilton et al., "A Species of Small Antisense RNA in Posttranscriptional Gene Silencing in Plants," Science 286:950-952 (Abstract) (1999); Hammond et al., "An RNA-Directed Nuclease Mediates Post-Transcriptional Gene Silencing in Drosophila Cells," Nature 404:293-298 (2000); Hutvagner et al., "RNAi: Nature Abhors a Double-Strand," Curr. Opin. Genetics & Development 12:225-232 (2002), which are hereby incorporated by reference in their entirety).

[0092] In iRNA, the introduction of double stranded RNA (dsRNA) into animal or plant cells leads to the destruction of the endogenous, homologous mRNA, phenocopying a null mutant for that specific gene. In siRNA, the dsRNA is processed to short interfering molecules of 21-, 22- or 23-nucleotide RNAs (siRNA), which are also called "guide RAs," (Hammond et al., "Post-Transcriptional Gene Silencing by Double-Stranded RNA," Nature Rev. Gen. 2:110-119 (Abstract) (2001); Sharp, "RNA Interference-2001," Genes Dev. 15:485-490 (2001); Hutvagner et al., "RNAi: Nature Abhors a Double-Strand," Curr. Opin. Genetics & Development 12:225-232 (2002), which are hereby incorporated by reference in their entirety) in vivo by the Dicer enzyme, a member of the RNAse III-family of dsRNA-specific ribonucleases (Hutvagner et al., "RNAi: Nature Abhors a Double-Strand," Curr. Opin. Genetics & Development 12:225-232 (2002); Bernstein et al., "Role for a Bidentate Ribonuclease in the Initiation Step of RNA Interference," Nature 409:363-366 (2001); Tuschl, "RNA Interference and Small Interfering RNAs," Chembiochem 2:239-245 (2001); Zamore et al., "RNAi: Double Stranded RNA Directs the ATP-Dependent Cleavage of mRNA at 21 to 23 Nucleotide Intervals," Cell 101:25-3 (2000); U.S. Pat. No. 6,737,512 to Wu et al., which are hereby incorporated by reference in their entirety). Successive cleavage events degrade the RNA to 19-21 bp duplexes, each with 2-nucleotide 3' overhangs (Hutvagner et al., "RNAi: Nature Abhors a Double-Strand," Curr. Opin. Genetics & Development 12:225-232 (2002); Bernstein et al., "Role for a Bidentate Ribonuclease in the Initiation Step of RNA Interference," Nature 409:363-366 (2001), which are hereby incorporated by reference in their entirety). The siRNAs are incorporated into an effector known as the RNA-induced silencing complex (RISC), which targets the homologous endogenous transcript by base pairing interactions and cleaves the mRNA approximately 12 nucleotides from the 3' terminus of the siRNA (Hammond et al., "Post-Transcriptional Gene Silencing by Double-Stranded RNA," Nature Rev. Gen. 2:110-119 (Abstract) (2001); Sharp, "RNA Interference-2001," Genes Dev. 15:485-490 (2001); Hutvagner et al., "RNAi: Nature Abhors a Double-Strand," Curr. Opin. Genetics & Development 12:225-232 (2002); Nykanen et al., "ATP Requirements and Small Interfering RNA Structure in the RNA Interference Pathway," Cell 107:309-321 (2001), which are hereby incorporated by reference in their entirety).

[0093] There are several methods for preparing siRNA, including chemical synthesis, in vitro transcription, siRNA expression vectors, and PCR expression cassettes. In one embodiment, dsRNA for the nucleic acid molecule used in the present invention can be generated by transcription in vivo. This involves modifying the nucleic acid molecule for the production of dsRNA, inserting the modified nucleic acid molecule into a suitable expression vector having the appropriate 5' and 3' regulatory nucleotide sequences operably linked for transcription and translation, as described supra, and introducing the expression vector having the modified nucleic acid molecule into a suitable host or subject. Using siRNA for gene silencing is a rapidly evolving tool in molecular biology, and guidelines are available in the literature for designing highly effective siRNA targets and making antisense nucleic acid constructs for inhibiting endogenous protein (U.S. Pat. No. 6,737,512 to Wu et al.; Brown et al., "RNA Interference in Mammalian Cell Culture: Design, Execution, and Analysis of the siRNA Effect," Ambion TechNotes 9(1):3-5(2002); Sui et al., "A DNA Vector-Based RNAi Technology to Suppress Gene Expression in Mammalian Cells," Proc. Nat'l. Acad. Sci. USA 99(8):5515-5520 (2002); Yu et al., "RNA Interference by Expression of Short-Interfering RNAs and Hairpin RNAs in Mammalian Cells," Proc. Nat'l. Acad. Sci. U.S.A. 99(9):6047-6052 (2002); Paul et al., "Effective Expression of Small Interfering RNA in Human Cells," Nature Biotechnology 20:505-508 (2002); Brummelkamp et al., "A System for Stable Expression of Short Interfering RNAs in Mammalian Cells," Science 296:550-553 (2002), which are hereby incorporated by reference in their entirety). There are also commercially available sources for custom-made siRNAs.

[0094] As noted supra, interference of StBEL gene expression is also achieved in the present invention by the generation of double-stranded RNA ("dsRNA") through the use of inverted-repeats, segments of gene-specific sequences oriented in both sense and antisense orientations. In one embodiment, sequences in the sense and antisense orientations are linked by a third segment, and inserted into a suitable expression vector having the appropriate 5' and 3' regulatory nucleotide sequences operably linked for transcription. The expression vector having the modified nucleic acid molecule is then inserted into a suitable host cell or subject. In the present invention, the third segment linking the two segments of sense and antisense orientation may be any nucleotide sequence such as a fragment of the .beta.-glucuronidase ("GUS") gene. In another embodiment, a functional (splicing) intron of the StBEL gene may be used for the third (linking) segment or, in yet another embodiment of the present invention, other nucleotide sequences without complementary components in the StBEL gene may be used to link the two segments of sense and antisense orientation (Chuang et al., "Specific and Heritable Genetic Interference by Double-Stranded RNA in Arabidopsis thaliana," Proc. Nat'l. Academy of Sciences USA 97(9):4985-4990 (2000); Smith et al., "Total Silencing by Intron-Spliced Hairpin RNAs," Nature 407:319-320 (2000); Waterhouse et al., "Exploring Plant Genomes by RNA-Induced Gene Silencing," Nature Review: Genetics 4:29-38 (2003); Wesley et al., "Construct Design for Efficient, Effective and High-Throughput Gene Silencing in Plants," Plant Journal 27(6):581-590 (2001), which are hereby incorporated by reference in their entirety). In any of the embodiments with inverted repeats of the StBEL gene, the sense and antisense segments may be oriented either head-to-head or tail-to-tail in the construct.

[0095] In another embodiment, silencing or reducing expression of an StBEL using a nucleic acid construct of the present invention involves using hairpin RNA ("hpRNA"), which may also be characterized as dsRNA. This involves RNA hybridizing with itself to form a hairpin structure that comprises a single-stranded loop region and a base-paired stem. Though a linker may be used between the inverted repeat segments of sense and antisense sequences to generate hairpin or double-stranded RNA, the use of intron-free hpRNA can also be used to achieve silencing of StBEL gene expression.

[0096] Alternatively, in another embodiment, a plant may be transformed with constructs encoding both sense and antisense orientation molecules having separate promoters and no third segment linking the sense and antisense sequences (Chuang et al., "Specific and Heritable Genetic Interference by Double-Stranded RNA in Arabidopsis thaliana," Proc. Nat'l. Academy of Sciences USA 97(9):4985-4990 (2000); Waterhouse et al., "Exploring Plant Genomes by RNA-Induced Gene Silencing," Nature Review: Genetics 4:29-38 (2003); Wesley et al., "Construct Design for Efficient, Effective and High-Throughput Gene Silencing in Plants," Plant Journal 27(6):581-590 (2001), which are hereby incorporated by reference in their entirety).

[0097] Other means of altering gene expression, including silencing, are being developed and are also contemplated. For example, epigenetics is the study of heritable changes in gene expression or cellular phenotype caused by mechanisms other than changes in the underlying DNA sequence. Epigenetics refers to functionally relevant modifications to the genome that do not involve a change in the nucleotide sequence. Examples of such changes are DNA methylation and histone deacetylation, both of which serve to suppress gene expression without altering the sequence of the silenced genes.

[0098] Enhancing gene expression means increasing the natural or normal expression of a gene at the level of transcription or translation. In the present invention, enhancement of StBEL gene expression may be carried out, according to one embodiment, by a nucleic acid molecule of the construct containing a functional StBEL, resulting in increased expression relative to endogenous StBEL mRNA levels.

[0099] Thus, the constructs of the present invention also include an operable 3' regulatory region, selected from among those which are capable of providing correct transcription termination and polyadenylation of mRNA for expression in the host cell of choice, operably linked to a DNA molecule which encodes for a protein of choice. A number of 3' regulatory regions are known in the art. Virtually any 3' regulatory region known to be operable in the host cell of choice would suffice for proper expression of the coding sequence of the nucleic acid designed to enhance expression.

[0100] In one embodiment, the nucleic acid construct of the present invention has a nucleic acid incorporated into an appropriate vector to enhance expression, and is positioned in the sense direction, such that the open reading frame is properly oriented for the expression of the encoded protein under control of a promoter of choice. This involves the inclusion of the appropriate regulatory elements into the DNA-vector construct. These include non-translated regions of the vector, useful promoters, and 5' and 3' untranslated regions which interact with host cellular proteins to carry out transcription and translation. Such elements may vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, as described infra, may be used.

[0101] A further aspect of the present invention is directed to an expression vector comprising a nucleic acid construct of the present invention.

[0102] Another aspect of the present invention is directed to a host cell transformed with a nucleic acid construct of the present invention.

[0103] A further aspect of the present invention is directed to a transgenic plant seed transformed with a nucleic acid construct of the present invention.

[0104] Another aspect of the present invention is directed to a transgenic plant transformed with a nucleic acid construct of the present invention, where the plant has increased tuber yield compared to a plant not transformed with the nucleic acid construct.

[0105] A further aspect of the present invention relates to a transgenic cell of a plant of the present invention.

[0106] Another aspect of the present invention relates to a transgenic plant seed produced from a plant of the present invention.

[0107] The nucleotide sequences used in the present invention may be inserted into any of the many available expression vectors and cell systems using reagents that are well known in the art. Suitable vectors include, but are not limited to, the following viral vectors such as lambda vector system gt11, gt WES.tB, Charon 4, and plasmid vectors such as pG-Cha, p35S-Cha, pBR322, pBR325, pACYC177, pACYC1084, pUC8, pUC9, pUC18, pUC19, pLG339, pR290, pKC37, pKC101, SV 40, pBluescript II SK+/- or KS+/-(see "Stratagene Cloning Systems" Catalog (1993) from Stratagene, La Jolla, Calif., which is hereby incorporated by reference in its entirety), pQE, pIH821, pGEX, pET series (see Studier et al., "Use of T7 RNA Polymerase to Direct Expression of Cloned Genes," Gene Expression Technology vol. 185 (1990), which is hereby incorporated by reference in its entirety), and any derivatives thereof. Recombinant molecules can be introduced into cells via transformation, particularly transduction, conjugation, mobilization, or electroporation. The DNA sequences are cloned into the vector using standard cloning procedures in the art, as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y.:Cold Spring Harbor Press (1989), and Ausubel et al., Current Protocols in Molecular Biology, New York, N.Y.:John Wiley & Sons (1989), which are hereby incorporated by reference in their entirety.

[0108] In preparing a nucleic acid construct for expression, the various nucleic acid sequences may normally be inserted or substituted into a bacterial plasmid. Any convenient plasmid may be employed, which will be characterized, for example and without limitation, by having a bacterial replication system, a marker which allows for selection in a bacterium, and generally one or more unique, conveniently located restriction sites. Numerous plasmids, referred to as transformation vectors, are available for plant transformation. The selection of a vector will depend on the preferred transformation technique and target species for transformation. A variety of vectors are available for stable transformation using Agrobacterium tumefaciens, a soilborne bacterium that causes crown gall. Crown gall is characterized by tumors or galls that develop on the lower stem and main roots of the infected plant. These tumors are due to the transfer and incorporation of part of the bacterium plasmid DNA into the plant chromosomal DNA. This transfer DNA (T-DNA) is expressed along with the normal genes of the plant cell. The plasmid DNA, pTi, or Ti-DNA, for "tumor inducing plasmid," contains the vir genes necessary for movement of the T-DNA into the plant. The T-DNA carries genes that encode proteins involved in the biosynthesis of plant regulatory factors, and bacterial nutrients (opines). The T-DNA is delimited by two 25 bp imperfect direct repeat sequences called the "border sequences." By removing the oncogene and opine genes, and replacing them with a gene of interest, it is possible to transfer foreign DNA into the plant without the formation of tumors or the multiplication of Agrobacterium tumefaciens (Fraley et al., "Expression of Bacterial Genes in Plant Cells," Proc. Nat'l Acad. Sci. 80:4803-4807 (1983), which is hereby incorporated by reference in its entirety).

[0109] Further improvement of this technique led to the development of the binary vector system (Bevan, "Binary Agrobacterium Vectors for Plant Transformation," Nucleic Acids Res. 12:8711-8721 (1984), which is hereby incorporated by reference in its entirety). In this system, all the T-DNA sequences (including the borders) are removed from the pTi, and a second vector containing T-DNA is introduced into Agrobacterium tumefaciens. This second vector has the advantage of being replicable in E. coli as well as A. tumefaciens, and contains a multiclonal site that facilitates the cloning of a transgene. An example of a commonly-used vector is pBin19 (Frisch et al., "Complete Sequence of the Binary Vector Bin19," Plant Mol. Biol. 27:405-409 (1995), which is hereby incorporated by reference in its entirety). Any appropriate vectors now known or later described for genetic transformation are suitable for use with the present invention.

[0110] U.S. Pat. No. 4,237,224 to Cohen and Boyer, which is hereby incorporated by reference in its entirety, describes the production of expression systems in the form of recombinant plasmids using restriction enzyme cleavage and ligation with DNA ligase. These recombinant plasmids are then introduced by means of transformation and replicated in unicellular cultures including prokaryotic organisms and eukaryotic cells grown in tissue culture.

[0111] Certain "control elements" or "regulatory sequences" are also incorporated into the vector-construct. These include non-translated regions of the vector, promoters, and 5' and 3' untranslated regions which interact with host cellular proteins to carry out transcription and translation. Such elements may vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, may be used. Tissue-specific and organ-specific promoters can also be used. Native promoters can also be used.

[0112] A constitutive promoter is a promoter that directs expression of a gene throughout the development and life of an organism. Examples of some constitutive promoters that are widely used for inducing expression of transgenes include the nopaline synthase (NOS) gene promoter, from Agrobacterium tumefaciens (U.S. Pat. No. 5,034,322 to Rogers et al., which is hereby incorporated by reference in its entirety), the cauliflower mosaic virus (CaMV) 35S and 19S promoters (U.S. Pat. No. 5,352,605 to Fraley et al., which is hereby incorporated by reference in its entirety), those derived from any of the several actin genes, which are known to be expressed in most cells types (U.S. Pat. No. 6,002,068 to Privalle et al., which is hereby incorporated by reference in its entirety), and the ubiquitin promoter, which is a gene product known to accumulate in many cell types.

[0113] An inducible promoter is a promoter that is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer, the DNA sequences or genes will not be transcribed. The inducer can be a chemical agent, such as a metabolite, growth regulator, herbicide, or phenolic compound, or a physiological stress directly imposed upon the plant such as cold, heat, salt, toxins, or through the action of a pathogen or disease agent such as a virus or fungus. A plant cell containing an inducible promoter may be exposed to an inducer by externally applying the inducer to the cell or plant such as by spraying, watering, heating, or by exposure to the operative pathogen. An example of an appropriate inducible promoter is a glucocorticoid-inducible promoter (Schena et al., "A Steroid-Inducible Gene Expression System for Plant Cells," Proc. Natl. Acad. Sci. 88:10421-5 (1991), which is hereby incorporated by reference in its entirety). Expression of the transgene-encoded protein is induced in the transformed plants when the transgenic plants are brought into contact with nanomolar concentrations of a glucocorticoid, or by contact with dexamethasone, a glucocorticoid analog (Schena et al., "A Steroid-Inducible Gene Expression System for Plant Cells," Proc. Natl. Acad. Sci. USA 88:10421-5 (1991); Aoyama et al., "A Glucocorticoid-Mediated Transcriptional Induction System in Transgenic Plants," Plant J. 11:605-612 (1997); McNellis et al., "Glucocorticoid-Inducible Expression of a Bacterial Avirulence Gene in Transgenic Arabidopsis Induces Hypersensitive Cell Death," Plant J. 14(2):247-57 (1998), which are hereby incorporated by reference in their entirety). In addition, inducible promoters include promoters that function in a tissue specific manner to regulate the gene of interest within selected tissues of the plant. Examples of such tissue specific or developmentally regulated promoters include seed, flower, fruit, or root specific promoters as are well known in the field (U.S. Pat. No. 5,750,385 to Shewmaker et al., which is hereby incorporated by reference in its entirety).

[0114] A number of tissue- and organ-specific promoters have been developed for use in genetic engineering of plants (Potenza et al., "Targeting Transgene Expression in Research, Agricultural, and Environmental Applications: Promoters used in Plant Transformation," In Vitro Cell. Dev. Biol. Plant 40:1-22 (2004), which is hereby incorporated by reference in its entirety). Examples of such promoters include those that are floral-specific (Annadana et al., "Cloning of the Chrysanthemum UEP1 Promoter and Comparative Expression in Florets and Leaves of Dendranthema grandiflora," Transgenic Res. 11:437-445(2002), which is hereby incorporated by reference in its entirety), seed-specific (Kluth et al., "5' Deletion of a gbss1 Promoter Region Leads to Changes in Tissue and Developmental Specificities," Plant Mol. Biol. 49:669-682 (2002), which is hereby incorporated by reference in its entirety), root-specific (Yamamoto et al., "Characterization of cis-acting Sequences Regulating Root-Specific Gene Expression in Tobacco," Plant Cell 3:371-382 (1991), which is hereby incorporated by reference in its entirety), fruit-specific (Fraser et al., "Evaluation of Transgenic Tomato Plants Expressing an Additional Phytoene Synthase in a Fruit-Specific Manner," Proc. Natl. Acad. Sci. USA 99:1092-1097 (2002), which is hereby incorporated by reference in its entirety), and tuber/storage organ-specific (Visser et al., "Expression of a Chimaeric Granule-Bound Starch Synthase-GUS gene in transgenic Potato Plants," Plant Mol. Biol. 17:691-699 (1991), which is hereby incorporated by reference in its entirety). Targeted expression of an introduced gene (transgene) is necessary when expression of the transgene could have detrimental effects if expressed throughout the plant. On the other hand, silencing a gene throughout a plant could also have negative effects. However, this problem could be avoided by localizing the silencing to a region by a tissue-specific promoter. In certain embodiments, the DNA promoter sequence is a constitutive, inducible, developmentally-regulated, organelle-specific, tissue-specific, cell-specific, seed (or grain)-specific, or germination-specific promoter.

[0115] The nucleic acid constructs of the present invention may also include an operable 3' regulatory region, selected from among those which are capable of providing correct transcription termination and polyadenylation of mRNA for expression in the host cell of choice, operably linked to a modified trait nucleic acid molecule of the present invention. A number of 3' regulatory regions are known to be operable in plants. Exemplary 3' regulatory regions include, without limitation, the nopaline synthase ("nos") 3' regulatory region (Fraley et al., "Expression of Bacterial Genes in Plant Cells," Proc. Nat'l Acad. Sci. USA 80:4803-4807 (1983), which is hereby incorporated by reference in its entirety) and the cauliflower mosaic virus ("CaMV") 3' regulatory region (Odell et al., "Identification of DNA Sequences Required for Activity of the Cauliflower Mosaic Virus 35S Promoter," Nature 313(6005):810-812 (1985), which is hereby incorporated by reference in its entirety). Virtually any 3' regulatory region known to be operable in plants would be suitable for use in conjunction with the present invention.

[0116] As discussed supra, components of nucleic acid constructs according to the present invention may be heterologous. A polynucleotide sequence is "heterologous to" an organism or a second polynucleotide sequence if it is synthetic or originates from a foreign species or, if from the same species, is modified from its original form. For example, a promoter operably linked to a heterologous coding sequence (or vice versa) refers to a coding sequence from a species different from that from which the promoter was derived or, if from the same species, a coding sequence which is not naturally associated with the promoter (e.g., a genetically engineered coding sequence or an allele from a different ecotype or variety).

[0117] The different components described above can be ligated together to produce the expression systems which contain the nucleic acid constructs used in the present invention, using well known molecular cloning techniques as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition Cold Spring Harbor, N.Y.:Cold Spring Harbor Press (1989), and Ausubel et al. Current Protocols in Molecular Biology, New York, N.Y.:John Wiley & Sons (1989), which are hereby incorporated by reference in their entirety.

[0118] Once the nucleic acid construct has been prepared, it is ready to be incorporated into a host cell. Basically, this method is carried out by transforming a host cell with the nucleic acid construct under conditions effective to achieve transcription of the nucleic acid molecule in the host cell. This is achieved with standard cloning procedures known in the art, such as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1989), which is hereby incorporated by reference in its entirety. Suitable host cells are plant cells. Suitable host cells also include bacterial cells. Methods of transformation may result in transient or stable expression of the nucleic acid under control of the promoter. In one embodiment, the nucleic acid construct of the present invention is stably inserted into the genome of the recombinant plant cell as a result of the transformation, although transient expression can serve an important purpose, particularly when the plant under investigation is slow-growing.

[0119] Plant tissue suitable for transformation includes leaf tissue, root tissue, meristems, zygotic and somatic embryos, callus, protoplasts, tassels, pollen, embryos, anthers, and the like. The means of transformation chosen is that most suited to the tissue to be transformed.

[0120] Transient expression in plant tissue can be achieved by particle bombardment (Klein et al., "High-Velocity Microprojectiles for Delivering Nucleic Acids Into Living Cells," Nature 327:70-73 (1987), which is hereby incorporated by reference in its entirety), also known as biolistic transformation of the host cell, as disclosed in U.S. Pat. Nos. 4,945,050; 5,036,006; and 5,100,792, all to Sanford et al., and in Emerschad et al., "Somatic Embryogenesis and Plant Development from Immature Zygotic Embryos of Seedless Grapes (Vitis vinifera)," Plant Cell Reports 14:6-12 (1995), which are hereby incorporated by reference in their entirety.

[0121] In particle bombardment, tungsten or gold microparticles (1 to 2 .mu.m in diameter) are coated with the DNA of interest and then bombarded at the tissue using high pressure gas. In this way, it is possible to deliver foreign DNA into the nucleus and obtain a temporal expression of the gene under the current conditions of the tissue. Biologically active particles (e.g., dried bacterial cells containing the vector and heterologous DNA) can also be propelled into plant cells. Other variations of particle bombardment, now known or hereafter developed, can also be used.

[0122] An appropriate method of stably introducing a nucleic acid construct into plant cells is to infect a plant cell with Agrobacterium tumefaciens or Agrobacterium rhizogenes previously transformed with the nucleic acid construct. As described supra, the Ti (or RI) plasmid of Agrobacterium enables the highly successful transfer of a foreign nucleic acid molecule into plant cells. A variation of Agrobacterium transformation uses vacuum infiltration in which whole plants are used (Senior, "Uses of Plant Gene Silencing," Biotechnology and Genetic Engineering Reviews 15:79-119 (1998), which is hereby incorporated by reference in its entirety).

[0123] Yet another method of introduction is fusion of protoplasts with other entities, either minicells, cells, lysosomes, or other fusible lipid-surfaced bodies (Fraley et al., "Liposome-mediated Delivery of Tobacco Mosaic Virus RNA Into Tobacco Protoplasts: A Sensitive Assay for Monitoring Liposome-protoplast Interactions," Proc. Natl. Acad. Sci. U.S.A. 79:1859-63 (1982), which is hereby incorporated by reference in its entirety). The nucleic acid molecule may also be introduced into the plant cells by electroporation (Fromm et al., "Expression of Genes Transferred into Monocot and Dicot Plant Cells by Electroporation," Proc. Natl. Acad. Sci. USA 82:5824 (1985), which is hereby incorporated by reference in its entirety). In this technique, plant protoplasts are electroporated in the presence of plasmids containing the expression cassette. Electrical impulses of high field strength reversibly permeabilize biomembranes allowing the introduction of the plasmids. Electroporated plant protoplasts reform the cell wall, divide, and regenerate. Other methods of transformation include polyethylene-mediated plant transformation, micro-injection, physical abrasives, and laser beams (Senior, "Uses of Plant Gene Silencing," Biotechnology and Genetic Engineering Reviews 15:79-119 (1998), which is hereby incorporated by reference in its entirety). The precise method of transformation is not critical to the practice of the present invention. Any method that results in efficient transformation of the host cell of choice is appropriate for practicing the present invention.

[0124] Yet a further method for introduction is by use of known techniques for genome editing or alteration. Such techniques for targeted genomic insertion involve, for example, inducing a double stranded DNA break precisely at one or more targeted genetic loci followed by integration of a chosen transgene or nucleic acid molecule (or construct) during repair. Such techniques or systems include, for example, zinc finger nucleases ("ZFNs") (Urnov et al., "Genome Editing with Engineered Zinc Finger Nucleases," Nat. Rev. Genet. 11: 636-646 (2010), which is hereby incorporated by reference in its entirety), transcription activator-like effector nucleases ("TALENs") (Joung & Sander, "TALENs: A Widely Applicable Technology for Targeted Genome Editing," Nat. Rev. Mol. Cell Biol. 14: 49-55 (2013), which is hereby incorporated by reference in its entirety), clustered regularly interspaced short palindromic repeat ("CRISPR")-associated endonucleases (e.g., CRISPR/CRISPR-associated ("Cas") 9 systems) (Wiedenheft et al., "RNA-Guided Genetic Silencing Systems in Bacteria and Archaea," Nat. 482:331-338 (2012); Zhang et al., "Multiplex Genome Engineering Using CRISPR/Cas Systems," Science 339(6121): 819-23 (2013); and Gaj et al., "ZFN, TALEN, and CRISPR/Cas-based Methods for Genome Engineering," Cell 31(7):397-405 (2013), each of which is hereby incorporated by reference in its entirety).

[0125] In certain embodiments, transformation described herein is carried out by Agrobacterium-mediated transformation, whisker method transformation, vacuum infiltration, biolistic transformation, electroporation, micro-injection, polyethylene-mediated transformation, or laser-beam transformation.

[0126] After transformation, the transformed plant cells must be regenerated. Plant regeneration from cultured protoplasts is described in Evans et al., Handbook of Plant Cell Cultures, Vol. 1, New York, New York: MacMillan Publishing Co. (1983); Vasil, ed., Cell Culture and Somatic Cell Genetics of Plants, Vol. I (1984) and Vol. III (1986), Orlando: Acad. Press; and Fitch et al., "Somatic Embryogenesis and Plant Regeneration from Immature Zygotic Embryos of Papaya (Carica papaya L.)," Plant Cell Rep. 9:320 (1990), which are hereby incorporated by reference in their entirety.

[0127] Means for regeneration vary from species to species of plants, but generally a suspension of transformed protoplasts or a petri plate containing explants is first provided. Callus tissue is formed and shoots may be induced from callus and subsequently rooted. Alternatively, embryo formation can be induced in the callus tissue. These embryos germinate as natural embryos to form plants. The culture media will generally contain various amino acids and hormones, such as auxin and cytokinins. Efficient regeneration will depend on the medium, on the genotype, and on the history of the culture. If these three variables are controlled, then regeneration is usually reproducible and repeatable.

[0128] In one embodiment, transformed cells are first identified using a selection marker simultaneously introduced into the host cells along with the nucleic acid construct of the present invention. Suitable selection markers include, without limitation, markers encoding for antibiotic resistance, such as the neomycin phosphotransferae II ("nptII") gene which confers kanamycin resistance (Fraley et al., "Expression of Bacterial Genes in Plant Cells," Proc. Natl. Acad. Sci. U.S.A. 80:4803-4807 (1983), which is hereby incorporated by reference in its entirety), and the genes which confer resistance to gentamycin, G418, hygromycin, streptomycin, spectinomycin, tetracycline, chloramphenicol, and the like. Cells or tissues are grown on a selection medium containing the appropriate antibiotic, whereby generally only those transformants expressing the antibiotic resistance marker continue to grow. Other types of markers are also suitable for inclusion in the expression cassette of the present invention. For example, a gene encoding for herbicide tolerance, such as tolerance to sulfonylurea is useful, or the dhfr gene, which confers resistance to methotrexate (Bourouis et al., "Vectors Containing a Prokaryotic Dihydrofolate Reductase Gene Transform Drosophila Cells to Methotrexate-resistance," EMBO J. 2:1099-1104 (1983), which is hereby incorporated by reference in its entirety). Similarly, "reporter genes," which encode for enzymes providing for production of an identifiable compound are suitable. The most widely used reporter gene for gene fusion experiments has been uidA, a gene from Escherichia coli that encodes the .beta.-glucuronidase protein, also known as GUS (Jefferson et al., "GUS Fusions: .beta. Glucuronidase as a Sensitive and Versatile Gene Fusion Marker in Higher Plants," EMBO J. 6:3901-3907 (1987), which is hereby incorporated by reference in its entirety). Similarly, enzymes providing for production of a compound identifiable by luminescence, such as luciferase, are useful. The selection marker employed will depend on the target species; for certain target species, different antibiotics, herbicide, or biosynthesis selection markers are preferred.

[0129] Plant cells and tissues selected by means of an inhibitory agent or other selection marker are then tested for the acquisition of the transgene (Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York:Cold Spring Harbor Press (1989), which is hereby incorporated by reference in its entirety).

[0130] After the fusion gene containing a nucleic acid construct is stably incorporated in transgenic plants, the transgene can be transferred to other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed. Once transgenic plants of this type are produced, the plants themselves can be cultivated in accordance with conventional procedure so that the nucleic acid construct is present in the resulting plants. Alternatively, transgenic seeds are recovered from the transgenic plants. These seeds can then be planted in the soil and cultivated using conventional procedures to produce transgenic plants.

[0131] Plants of the present invention (i.e., having a nucleic acid construct of the present invention, as discussed supra, or one or more mutations, as discussed infra) have increased tuber yield.

[0132] In certain embodiments, the transgenic plant transformed with the nucleic acid construct or plant grown from transgenic seed, has increased tuber yield compared to a plant not transformed with the nucleic acid construct. In some embodiments the yield increase is by at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, or 300% compared to a plant not transformed with the nucleic acid construct.

[0133] In some embodiments, the overall shoot fresh weight of the transgenic plant transformed with the nucleic acid construct or plant grown from transgenic seed is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% compared to a plant not transformed with the nucleic acid construct.

[0134] In one embodiment, the transgenic plant comprises an expression level of StBEL11 less than 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, or 1% compared to a plant not transformed with the nucleic acid construct.

[0135] In some embodiments, the transgenic plant comprises an expression level of StBEL29 less than 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, or 1% compared to a plant not transformed with the nucleic acid construct.

[0136] In some embodiments, the transgenic plant comprises an expression level of StBEL11 and StBEL29 less than 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, or 1% compared to a plant not transformed with the nucleic acid construct.

[0137] In some embodiments, the transgenic plant comprises an expression level of StBEL5 greater than 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 5%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, or 200% compared to a plant not transformed with the nucleic acid construct.

[0138] In some embodiments, the transgenic plant comprises an expression level of StBEL11 and/or StBEL29 less than 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, or 1% compared to a plant not transformed with the nucleic acid construct, and an expression level of StBEL5 greater than 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 5%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, or 200% compared to a plant not transformed with the nucleic acid construct.

[0139] Expression level, as applied to BEL mRNAs, is defined herein as the level of transcription of the BEL gene. Expression levels may be quantified by any method known in the art. In one embodiment accumulation level of BEL is measured in leaves of a young tissue culture plant using RT-qPCR. In another embodiment, accumulation level of BEL is measured in stolons of a plant using RT-qPCR. In another embodiment, accumulation level of BEL is measured in both the leaves and stolon.

[0140] A person of ordinary skill in the art will understand that expression levels may be quantified at different developmental times or in different tissues or cells depending on the nature of the promoter driving gene expression (e.g. native, constitutive, inducible, developmentally-regulated, organelle-specific, tissue-specific, cell-specific, seed specific, or germination-specific).

[0141] In one embodiment, StBEL 11 and/or StBEL29 is driven by its natural promoter, and expression levels are measured first in leaves of a young tissue culture plant using RT-qPCR and subsequently in stolons of the plant using RT-qPCR.

[0142] In one embodiment, the transgenic plant is selected from the group consisting of potato, dahlia, caladium, Jerusalem artichoke (Helianthus tuberosus), yarn (Dioscorea alta), sweet potato (Impomoea batatus), cassava (Manihot esculenta), tuberous begonia, cyclamen, other solanum species (e.g., wild potato), sugar beet (Beta vulgaris), carrot (Daucus carota), and radish (Raphanus sativus).

[0143] In one embodiment, the transgenic plant is selected from the group consisting of Solanum tuberosum spp. andigena and Solanum tuberosum spp. tuberosum.

[0144] Another aspect of the present invention is directed to a method of increasing tuber yield in a plant. This method involves providing a transgenic plant or plant seed comprising a nucleic acid construct comprising one or more nucleic acid molecules configured to reduce or silence expression of (i) StBEL11 RNA and variants thereof, (ii) StBEL29 RNA and variants thereof, or (iii) both (i) and (ii); and growing the transgenic plant or plant grown from the transgenic plant seed under conditions effective to express the one or more nucleic acid molecules in said transgenic plant or said plant grown from the transgenic plant seed.

[0145] In one embodiment, a transgenic plant is provided.

[0146] In another embodiment, a transgenic seed is provided.

[0147] In a further embodiment, providing comprises transforming a non-transgenic plant or a non-transgenic plant seed with the nucleic acid construct to yield the transgenic plant or plant seed.

[0148] Providing a transgenic plant or plant seed may include transforming a non-transgenic plant or a non-transgenic plant seed with the nucleic acid construct to yield said transgenic plant or plant seed. Suitable methods of transformation are described supra.

[0149] Tuber yield as used herein can be measured as fresh weight of tubers per plant or dry weight of tubers per plant.

[0150] The increased tuber yield may be by any amount. For example, the increased tuber yield may be by about (or by at least about) 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, or 300% compared to a plant not transformed with the nucleic acid construct.

[0151] Increased tuber yield, as well as any other trait described herein (e.g., overall shoot fresh weight, etc.) in a plant as described herein may be determined in comparison to a control plant. The choice of suitable control plants is a routine part of an experimental setup and may include corresponding wild type plants, corresponding plants without the gene of interest (e.g., those not transformed with the subject nucleic acid molecule). The control plant is typically of the same plant species or even of the same variety as the plant to be assessed. The control plant may also be a nullizygote of the plant to be assessed. A "control plant" as used herein refers not only to whole plants, but also to plant parts, including inflorescence, seeds, and seed parts.

[0152] Yet another aspect of the present invention is directed to a potato plant comprising one or more mutations in one or both of StBEL11 and StBEL29, wherein said potato plant has increased tuber yield compared to the tuber yield of a wild type potato plant.

[0153] In one embodiment, the potato plant further comprising one or more mutations in StBEL5.

[0154] In one embodiment, the potato plant is non-transgenic. Accordingly, it is contemplated that mutations leading to increased tuber yield may be introduced via gene editing techniques or induced mutation techniques. Alternatively, naturally occurring mutations may be combined via traditional breeding to produce high tuber yield plants.

[0155] In one embodiment, the mutated potato plant is obtained by subjecting at least one cell of a potato plant to a chemical mutagenizing agent under conditions effective to yield at least one mutant plant cell containing an inactive or partially inactive StBEL gene or variant thereof. A suitable chemical mutagenizing agent can include, for example, ethylmethanesulfonate.

[0156] In another embodiment, the mutated potato plant is obtained by subjecting at least one cell of a potato plant to a radiation source under conditions effective to yield at least one mutant plant cell containing an StBEL gene or variant thereof with altered expression. Suitable radiation sources can include, for example, sources that are effective in producing ultraviolet rays, gamma rays, or fast neutrons.

[0157] In another embodiment, the mutated potato plant is obtained by inserting an inactivating nucleic acid molecule into the gene encoding the functional StBEL gene or its promoter under conditions effective to inactivate the gene. Suitable inactivating nucleic acid molecules can include, for example, a transposable element. Examples of such transposable elements include, but are not limited to, an Activator (Ac) transposon, a Dissociator (Ds) transposon, or a Mutator (Mu) transposon.

[0158] In yet another embodiment, the mutated potato plant is obtained by subjecting at least one cell of a potato plant to Agrobacterium transformation under conditions effective to insert an Agrobacterium T-DNA sequence into the gene, thereby inactivating the gene. Suitable Agrobacterium T-DNA sequences can include, for example, those sequences that are carried on a binary transformation vector of pAC106, pAC161, pGABI1, pADIS1, pCSA110, pDAP101, derivatives of pBIN19, or pCAMBIA plasmid series.

[0159] In yet another embodiment, the mutated potato plant is obtained by subjecting at least one cell of a potato plant to site-directed mutagenesis of the StBEL gene or its promoter under conditions effective to yield at least one mutant plant cell containing an StBEL gene with altered expression. See, e.g., Baker, "Gene-editing Nucleases," Nature Methods 9(1):23-26 (2012), which is hereby incorporated by reference in its entirety. The treating step may also involve subjecting the at least one cell of the potato plant to site-directed mutagenesis of the StBEL gene under conditions effective to yield at least one mutant plant cell containing a variant StBEL gene associated with increased tuber yield as described herein above. The various plants that can be used in this method are the same as those described supra with respect to the transgenic plants and mutant plants.

[0160] In yet another embodiment, the mutated potato plant is obtained by subjecting at least one cell of a potato plant to gene editing, as described supra, to yield at least one mutant plant cell containing a modified (or variant) sequence of the StBEL gene associated with tuber yield as described herein above. Propagating the at least one mutant plant cell into a mutant plant results in a mutant plant having an altered level of StBEL protein or variant thereof associated with tuber production as described herein above compared to that of the nonmutant plant and displays an altered (e.g., increased) tuber yield phenotype relative to a nonmutant plant at the levels or amounts discussed supra.

[0161] In one embodiment, the potato plant comprises a reduced expression level of StBEL11 compared to a wild type potato plant at the levels discussed supra.

[0162] In another embodiment, the expression level of StBEL11 is measured by quantifying accumulation levels of StBEL11 in leaves of a young tissue culture plant using RT-qPCR.

[0163] In a further embodiment, the potato plant comprises a reduced expression level of StBEL29 compared to a wild type potato plant at the levels discussed supra.

[0164] In one embodiment, the expression level of StBEL29 is measured by quantifying accumulation levels of StBEL11 in leaves of a young tissue culture plant using RT-qPCR, as discussed supra.

[0165] In one embodiment, the potato plant comprises a tuber yield at a level discussed supra.

[0166] In one embodiment, the potato plant comprises an increased expression level of StBEL5 compared to a wild type potato plant at the levels discussed supra.

[0167] The present invention is also directed to potato seed from the potato plants described herein.

EXAMPLES

Example 1--Cloning Strategies and Whole-Plant Transformation

[0168] Partial cDNA sequences of both StBEL11 (GenBank: AF406698, which is hereby incorporated by reference in its entirety) and StBEL29 (GenBank: AF406702, which is hereby incorporated by reference in its entirety) were obtained from NCBI. Putative upstream sequences were identified using the potato genome database (http://potato.plantbiology.msu.edu). Genomic DNA from leaves of wild-type potato (Solanum tuberosum ssp. andigena) was isolated using DNeasy plant mini kit (QIAGEN). Upstream regulatory sequences of both StBEL11 and StBEL29 genes were isolated using the Universal Genome Walker kit (Clontech). Both these sequences were verified using the online potato genome database. Upstream sequences of 1678 bp for StBEL11 and 2151 bp for StBEL29 were isolated from the genomic DNA of Solanum tuberosum ssp. andigena through genome walking. The upstream sequences of both genes were amplified using gene-specific primers (Table 1) and were verified by sequencing. Both sequences were fused to the .beta.-glucoronidase (GUS) gene and cloned into the binary vector pBI121 to generate the proStBEL11:GUS and proStBEL29:GUS constructs.

[0169] Full-length sequences of StBEL11 (2718 bp) (SEQ ID NO:2) and StBEL29 (2898 bp) (SEQ ID NO:5) were PCR amplified with gene-specific primers (Table 1) and were cloned into the binary vectors pBI121 and pCAMBIA1300 respectively, under the CaMV 35S promoter to generate the 35S:StBEL11 and 35S:StBEL29 constructs. These constructs were then transformed into Agrobacterium tumefaciens strain GV2260. Stably transformed lines were generated and ten lines of each type were selected for further expression and phenotypic analyses (FIGS. 1A-1B).

[0170] The GAS:GUS construct created in pBI101.2 was described previously (Banerjee et al., "Dynamics of a Mobile RNA of Potato Involved in a Long-Distance Signaling Pathway," Plant Cell 18:3443-57 (2006), which is hereby incorporated by reference in its entirety).

[0171] For generating the GAS:StBEL11 construct, the full-length StBEL11 cDNA was cloned into the XmaI/SacI site downstream from the GAS promoter, cloned previously into pBI101.2 (Banerjee et al., "Dynamics of a Mobile RNA of Potato Involved in a Long-Distance Signaling Pathway," Plant Cell 18:3443-57 (2006), which is hereby incorporated by reference in its entirety).

[0172] The GAS:StBEL29 construct was generated by cloning the full-length StBEL29, which was PCR amplified with primers flanking the 5' XmaI and 3' EcoRV sites, into the XmaI/SacI (blunt-ended) sites of pBI101.2 with the GAS promoter inserted previously (Banerjee et al., "Dynamics of a Mobile RNA of Potato Involved in a Long-Distance Signaling Pathway," Plant Cell 18:3443-57 (2006), which is hereby incorporated by reference in its entirety).

[0173] All constructs were confirmed via sequencing at the DNA Facility at Iowa State University.

[0174] These constructs were transformed into Agrobacterium tumefaciens strain GV2260. Wild-type potato leaves were transformed and transgenic plants were generated by Agrobacterium-mediated transformation as reported previously (Banerjee et al., "Efficient Production of Transgenic Potato (S. tuberosum L. ssp. andigena) Plants via Agrobacterium Tumefaciens-Mediated Transformation," Plant Sci. 170:732-38 (2006), which is hereby incorporated by reference in its entirety). Transgenic lines for each of the four constructs were screened for level of transgene expression in at least ten independent transgenic lines, except in the case of the GAS:StBEL11 construct, where 6 lines were screened (FIGS. 1A-1B and 2A-2B). The in vitro transgenic potato plants were maintained in a growth chamber (Percival Scientific Inc.) at 27.degree. C. with a photoperiod of 16 h light, 8 h dark and a fluence rate of 40 .mu.mol m.sup.-2 s.sup.-1. Soil-grown plants were maintained in a growth chamber under either a long-day (16 h light at 22.degree. C., 8 h dark at 18.degree. C.) or short-day (8 h light at 22.degree. C., 16 h dark at 18.degree. C.) photoperiod with a fluence rate of 400 .mu.mol m.sup.-2 s.sup.-1.

TABLE-US-00009 TABLE 1 Primers Cloning full-length sequences of StBEL11 and StBEL29 under 35S SEQ ID constitutive promoter NO: BEL11F CATCTAGAGTAGGGGGGGAGGCACC 9 BEL11R GAGAGCTCGAAGCACAAAATTTACAATATAC 10 BEL29F ACATCTAGATTAGCTCTCATCACTTCACA 11 BEL29R AGAGGTACCTACCACCCAAAATACTAC 12 SEQ ID Primers for generating StBEL11 and StBEL29 suppression lines NO: StBEL11AS FP GAGCTCGAAATTTATGGCTATGTACTATC 13 StBEL11AS RP TCTAGAGTGGAAGACGGTATATGTGAT 14 StBEL29AS FP GAGCTCGTGTTATTTGTTTATTGTGGAGA 15 StBEL29AS RP TCTAGAGTCTGCTCCAACTCCGTCTA 16 SEQ ID StBEL11 and StBEL29 promoter cloning NO: PBEL11F TATAAGCTTAACTAACTAACTAACTGTCCC 17 PBEL11R GAGTCTAGAACTCCACAACACATAAAGGG 18 PBEL29F CACAAGCTTTGAGAAGAAAACCAAAGAAAC 19 PBEL29R AACGGATCCAGATGTGGATGTGTGAATGTG 20 SEQ ID Cloning of StBEL11 and StBEL29 under GAS promoter NO: GASBEL11f TATATTATATCCCGGGTTTAAGAAAATCTCTCACTTTC 21 TCT GASBEL11r TATATTATATGAGCTCGTTTACATATATGCAAATTGA 22 AACA GASBEL29f TATATTATATCCCGGGTTCTTTCTTTCTTTCTCCTCTCT 23 CT GASBEL29r TATATTATATGATATCGGCTAAAATGGATGGAGTATT 24 ATTT SEQ ID RT-qPCR of StBEL11, StBEL29 and GAPDH NO: 11F AGGACACTAGCAAAACTTTAGG 25 11R CTTTGAGGC TTCCATGCATTG 26 29F CATTTGCCTCAACACAACCC 27 29R TGATGCTTTCGATCTCTGGTG 28 GAPDH-F GAAGGACTGGAGAGGTGGA 29 GAPDH-R GACAAC AGAAACATCAGCAGT 30 SEQ ID Transgenic-specific primers used for heterografts and screening NO: NT-142 GCGGGACTCTAATCATAAAAAC 31 GUS-GSP1 TGGAAACGGCAGAGAAGGTAC 32 29-GSP1 ATTAGTGACGGACAACTTCTGTC 33 11-GSP1 GTAAATCAGCTTGAAATTACATCATG 34 SEQ ID Primers for confirming StBEL11 and StBEL29 suppression lines NO: StBEL11AS RP TCTAGAGTGGAAGACGGTATATGTGAT 35 StBEL29AS RP CAGAAAATCCAACATATCCAG 36 NOST RPscr GCAACAGGATTCAATCTTAAG 37 KanR FP GGATTGCACGCAGGTTCT 38 KanR RP CGTCAAGAAGGCGATAGAA 39 SEQ ID Transgene-specific primers used for RT-qPCR in RNA movement assays NO: B11MqRT (GSP) CTATATATGCAAACTATAGTATGTTG 40 B29MqRT (GSP) CTTCTAGAAGATATATATATGGTTGAG 41 NTR (vector specific) GCAACAGGATTCAATCTTAAGAAACT 42 SEQ ID RT-qPCR (Analysis of target genes) NO: StACTqRTf GGAAAAGCTTGCCTATGTGG 43 StACTqRTr CTGCTCCTGGCAGTTTCAA 44 StPIN2qRTf TCATCTAAAGGGCCAACACC 45 StPIN2qRTr GTTGTATAGCTCCCCGCTCA 46 StGA2ox1qRTf TTCTCTACAATGAGTTCACATGGTC 47 StGA2ox1qRTr GGGACAACCTATTATCACCAAGC 48 StIAA3qRTf CTGATCTTCGATCAATTTCATGG 49 StIAA3qRTr GACCTATTGCTGCCTTGTGCTA 50

Example 2--RNA Suppression Analysis

[0175] To generate transgenic suppression lines for StBEL11 and StBEL29, non-conserved antisense sequences were used to design constructs. The antisense fragments (401 and 799 bp of StBEL11 and StBEL29 cDNAs, corresponding to SEQ ID NO:3 and SEQ ID NO:6, respectively) contained coding sequence and a small portion of the 5' UTR. These were amplified and cloned in the antisense direction into the binary vector pCB201 driven by the CaMV 35S promoter (Xiang et al., "A Mini Binary Vector Series for Plant Transformation," Plant Mol. Biol. 40:711-17 (1999), which is hereby incorporated by reference in its entirety).

[0176] Potato (Solanum tuberosum ssp. andigena) leaf transformation was performed with these two constructs as described above. Stable transformants were confirmed using PCR of genomic DNA of in vitro plantlets using gene-specific primers (Table 1). At least nine independent transgenic lines (ten plants per transgenic line) for each construct were screened for a reduction in StBEL11 and StBEL29 transcript levels in both the leaves of one-month old soilgrown long-day plants and stolons from select transgenic lines grown under short-days for 21 days (FIGS. 3A-D). Soil-grown plants (ten plants per transgenic line) were maintained in a growth chamber under a short-day (8 h light at 22.degree. C., 16 h dark at 18.degree. C.) photoperiod with a fluence rate of 400 .mu.mol m.sup.-2 s.sup.-1. Two lines for each construct, designated 11-1, 11-2, 29-1, 29-2, were selected for further analyses.

[0177] Expression of the tuber marker gene StSP6A was quantified from stolons of the two selected lines per construct. For RT-qPCR analysis, stolons were pooled from three independent plants off ten plants per transgenic line forming three biological replicates per line. Total RNA was isolated from ground tissues using RNAiso Plus (Takara-Clontech) and two micrograms of RNA (DNase treated with RQ1 RNase-Free DNase; Cat.# M6101; Promega) were reverse-transcribed using oligo(dT) primer and SuperScript-III reverse transcriptase (Invitrogen). qPCR was performed on a CFX96 Real-Time System (BIO-RAD) using gene-specific primers (Table 1). The reactions were carried out using KAPA SYBR.RTM. green master mix (KAPA Biosystems) and incubated at 95.degree. C. for 2 min, followed by 40 cycles of 95.degree. C. for 15 s and 60.degree. C. for 30 s. GAPDH was used for normalization for all the reactions (Table 1). PCR specificity was checked by melting curve analysis, and data were analyzed using the 2.sup.-.DELTA..DELTA.ct method (Livak & Schmittgen, "Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-delta delta C(T)) Method," Methods 25:402-08 (2001), which is hereby incorporated by reference in its entirety). Shoot growth and tuber yield from these antisense lines were also measured. Statistical analysis was carried out with the Student's t test using GraphPad Prism (6.07 version).

Example 3--Histochemical and Fluorometric Assay

[0178] For qualitative GUS assays, samples were incubated in GUS staining buffer containing (1.0 M NaPO.sub.4 pH 7, 0.25 M EDTA pH 8, 0.05 mM potassium ferricyanide, 0.05 mM potassium ferrocyanide and 1.0 mM X-gluc) for 16 h at 37.degree. C. Samples were then washed with 100% ethanol. For histology, stained petioles and stems were cut into 0.5 cm long pieces and imbedded into 4% agarose blocks. Sections were obtained using a Leica vibratome VT1200. All samples were visualized using a Leica microscope (S8AP0). For fluorometric analysis, frozen tissue samples were ground in GUS extraction buffer (50 mM NaPO.sub.4 pH 7, 10 mM EDTA pH 8.0, 10 mM .beta.-mercaptoethanol, 0.1% Triton.TM. X-100 0.1% SDS) as described by Jefferson et al., "Assaying Chimeric Genes in Plants: The GUS Gene Fusion System," Plant Mol. Biol. Rep. 5:387-405 (1987), which is hereby incorporated by reference in its entirety. Samples were centrifuged at 17,000 rpm for 5 min. This was followed by protein quantification using the Bradford assay (Bradford et al., "A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding," Anal. Biohem. 72:248-254 (1976), which is hereby incorporated by reference in its entirety. Approximately 10 .mu.s of the total protein was aliquoted with 5 .mu.l of GUS assay buffer (50 mM MUG) and samples were incubated at 37.degree. C. for 16 h. The reaction was stopped by adding stop buffer (0.2 M Na.sub.2CO.sub.3). GUS activity was monitored at emission wavelength 365 nm and excitation wavelength 455 nm using a Varioskan flash plate reader (Thermo Scientific).

Example 4--Heterografts

[0179] Simple splice micrografts under sterile conditions were made using material from 4-week old GAS:StBEL11, GAS:StBEL29, or GAS:GUS transgenic lines for scion material (shoots with 3-5 leaves) and 4-week old wildtype andigena for stocks (rooted stems approximately 1.5 cm in length). The micrografts were grown in vitro for 2 weeks before transfer to soil. In soil, the heterografts were then grown for 3 weeks under long-day conditions (16 h of light, 8 h of dark, 25.degree. C.), followed by 2 weeks under short-days (8 h of light, 16 h of dark, 25.degree. C.) before sample harvest, RNA extraction, and a single round of gel-based RT-PCR using transgenic gene-specific primers (Table 1).

Example 5--RT-qPCR Analysis

[0180] Eight-week old soil-grown wild-type andigena potato plants were grown under either SD or LD conditions for 15 days in a growth chamber (Percival Scientific). Leaf, petiole, stem, root, and stolon samples were then harvested in liquid nitrogen, ground and stored at -80.degree. C. RNA was isolated from frozen samples using the RNeasy plant mini kit (QIAGEN). To avoid genomic DNA contamination, total RNA was treated with RNase-free DNase Set (QIAGEN) and quantified.

[0181] Gene-specific cDNAs for StBEL11, StBEL29, and GAPDH were prepared with 2.0 .mu.g of total RNA using MMLV reverse transcriptase (Promega). RTqPCR was performed in a 10 .mu.l reaction volume with primer concentrations of 0.3 .mu.M and 1 .mu.l of cDNA and KAPA SYBR.RTM. mastermix. The reaction mix was incubated at 95.degree. C. for 3 min, followed by 40 cycles at 95.degree. C. for 10 s, 55.degree. C. for 20 s, and 60.degree. C. for 20 s.

[0182] PCR specificity was confirmed by melting curve analysis and data were analyzed using 2.sup..DELTA..DELTA.ct method (Livak & Schmittgen, "Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-delta delta C(T)) Method," Methods 25:402-08 (2001), which is hereby incorporated by reference in its entirety). GAPDH or StActin8 were used as internal controls. Gene specific primers for StBEL11, StBEL29, and GAPDH genes were used (Table 1).

[0183] Polysomal RNA extraction was performed as previously described (Mignery et al., "Isolation and Sequence Analysis of cDNAs for the Major Potato Tuber Protein, Patatin," Nucleic Acids Res. 12:7987-8000 (1984), which is hereby incorporated by reference in its entirety). Gene-specific primers (Table 1) with RT-qPCR were also used for the target gene assays. For all RT-qPCR analyses, the average of two or three technical replicates was first taken into consideration, followed by the statistical analyses of two or three biological replicates.

Example 6--Phenotypes of StBEL11 and StBEL29 in Both Overexpression and Suppression Lines

[0184] Because of the close sequence similarity among StBEL5, StBEL11, and StBEL29 (Sharma et al., "The BEL1-Like Family of Transcription Factors in Potato," J. Expt. Bot. 65:709-23 (2014), which is hereby incorporated by reference in its entirety), the possibility that StBEL11 and StBEL29 may be co-functional with StBEL5 in tuber formation was considered. To better understand the function of StBEL11 and StBEL29, approximately ten transgenic CaMV-35S over-expression (OE) lines of S. tuberosum ssp. andigena were generated for both StBEL types, screened and evaluated (FIGS. 1A-1B). Two independent lines that exhibited substantial levels of transcripts of StBEL11 and StBEL29 were used in evaluating effects on phenotypes of soil-grown plants (FIGS. 4A-4B). Overall shoot fresh weight was not affected in any of the OE lines (FIG. 4A), but a significant reduction in tuber yields was observed in all four transgenic lines (FIG. 4B).

[0185] To further validate the phenotype produced by the expression of StBEL11 and StBEL29, antisense constructs specific for each respective gene were transformed into S. tuberosum ssp. andigena. Independent lines were double screened in both leaves and stolons for suppression (FIGS. 3A-3D). Suppression levels in stolons relative to WT (wild-type) ranged from 0.3 to no suppression (FIGS. 3A-3D). From this group, two lines per construct were selected, designated as 29-1, 29-2 for StBEL29 and 11-1, 11-2 for StBEL11, and were evaluated for shoot growth and tuber yields (FIGS. 5A-5C). Whereas, there was very little difference in shoot growth between WT and the antisense lines (FIG. 5A), tuber yields increased substantially under the short-day conditions (FIG. 5B). Among these four lines, increases in tuber yields ranged from two- to three-fold.

[0186] Overall tuber numbers per plant increased in these transgenic lines but the morphology of the tubers from the antisense lines appeared to be comparable to WT (FIGS. 6A-6C). To verify that this yield effect was mediated through the tuberization signaling pathway, expression of the tuber signal gene, StSP6A, was quantified in stolons of all four lines (FIG. 5C). Mean transcript levels of StSP6A increased by as much as five-fold relative to the control, and were closely correlated to overall tuber yield increase (FIGS. 5B, 5C). These results suggest that similar to StBEL5 (Sharma et al., "Targets of the StBEL5 Transcription Factor Include the FT Ortholog StSP6A," Plant Physiol. 170:310-24 (2016), which is hereby incorporated by reference in its entirety), StSP6A is targeted by StBEL11 and StBEL29 to control its transcriptional activity and regulate the tuberization pathway.

Example 7--Transcriptional Activity of StBEL11 and StBEL29

[0187] To assess expression patterns in whole plants, upstream sequences of the StBEL11 and StBEL29 genes were isolated and fused to .beta.-glucoronidase gene (GUS) and cloned into the binary vector pBI121 to generate proStBEL11:GUS and proStBEL29:GUS constructs (FIG. 7A). These were transformed into potato, S. tuberosum ssp. andigena, and ten lines for each construct were screened through histochemical GUS expression assays. Robust GUS activity was observed in primary leaf veins, petioles, and stems of both proStBEL11:GUS (FIGS. 7B, 7D, 7E, arrows) and proStBEL29:GUS (FIGS. 7F-7H, arrows) lines. GUS expression was not observed in roots of any of the in vitro grown transgenic lines tested (FIGS. 7B, 7H), and only faint GUS staining was observed in stolons from 21 day SD-induced plants (FIGS. 7C, 7I). Previous studies had shown the presence of StBEL11 and StBEL29 transcripts in phloem cells of potato (Yu et al., "Tissue Integrity and RNA Quality of Laser Microdissected Phloem of Potato," Planta 226:797-803 (2007), which is hereby incorporated by reference in its entirety). RNA-seq data from phloem-associated cells of petioles and stems (Lin et al., "Transcriptional Analysis of Phloem-Associated Cells of Potato," BMC Genom. 16:665 (2015), which is hereby incorporated by reference in its entirety) revealed substantial amounts of RNA from several StBEL genes accumulating in these cells (Table 2). The greatest levels were observed for the mobile RNA, StBEL5, and for StBEL29 (Table 2).

TABLE-US-00010 TABLE 2 Accumulation of Known Mobile mRNAs (*) and Selected StBELs in Petiole and Stem Phloem-Associated Cells Petiole Stem Annotation Gene ID phloem phloem Function Citation StGAI* PGSC0003DMG400015692 531 422 Leaf .sup.aHaywood morphology POTH1* PGSC0003DMG400013493 267 24 Vegetative .sup.bMahajan growth StBEL5* PGSC0003DMG400005930 2089 1234 Tuber/root .sup.cBanerjee growth StBEL11* PGSC0003DMG400019635 92 85 Tuber growth This report StBEL29* PGSC0003DMG400021323 1282 2591 Tuber growth This report StBEL33 PGSC0003DMG400024267 464 812 Unknown .sup.eSharma StBEL34 PGSC0003DMG400008057 199 66 Unknown .sup.eSharma StBEL35 PGSC0003DMG400019142 301 453 Unknown .sup.eSharma *indicates known mobile mRNAs. .sup.aHaywood et al., "Phloem Long-Distance Trafficking of GIBBERELLIC ACID-INSENSITIVE RNA Regulates Leaf Development," Plant J. 42: 49-68 (2005), which is hereby incorporated by reference in its entirety. .sup.bMahajan et al., "The mRNA of a Knotted1-Like Transcription Factor of Potato is Phloem Mobile," Plant Mol. Biol. 79: 595-608 (2012), which is hereby incorporated by reference in its entirety. .sup.cBanerjee et al., "Dynamics of a Mobile RNA of Potato Involved in a Long-Distance Signaling Pathway," Plant Cell 18: 3443-57 (2006), which is hereby incorporated by reference in its entirety. .sup.dSharma et al., "The BEL1-Like Family of Transcription Factors in Potato," J. Expt. Bot. 65: 709-23 (2014), which is hereby incorporated by reference in its entirety.

[0188] The values for petiole and stem phloem are the means of the number of reads for three replicates of RNA-seq data from Lin et al., "Transcriptional Analysis of Phloem-Associated Cells of Potato," BMC Genom. 16:665 (2015), which is hereby incorporated by reference in its entirety. After sequencing, reads were processed and aligned to the potato genome. The number of concordant unique reads in each library was counted with HTseq, and the three libraries were normalized with the 0.75 quantile to eliminate the differences caused by the sample scale and sequencing depth.

[0189] To assess the cellular location of promoter activity for StBEL11 and StBEL29 in vascular cells of petioles and stems, histochemical analysis was performed on samples taken from soil-grown proStBEL11:GUS and proStBEL29:GUS transgenic lines grown under short-day conditions. GUS activity was visually assessed in transverse sections of both tissue types (FIGS. 8A-8D). Strong GUS activity was observed for both promoter lines in external phloem cells and in xylem cell walls in petioles for both StBEL11 and StBEL29 promoter transgenic lines (FIGS. 8A, 8B, arrows). GUS signal was also specifically observed in xylem cell walls and in double layers of the epidermis in stems of StBEL11 (FIG. 8C, arrows) and in phloem and xylem cell walls of stems for StBEL29 (FIG. 8D, arrows).

Example 8--Effect of Photoperiod on StBEL11 and StBEL29 mRNA Accumulation Patterns

[0190] Phylogenetic analysis of the thirteen BEL TFs identified from potato revealed that StBEL11 and StBEL29 exhibited a very close amino acid sequence match with StBEL5 (Chen et al., "Interacting Transcription Factors From the Three Amino Acid Loop Extension Superclass Regulate Tuber Formation," Plant Physiol. 132:1391-1404 (2003) and Sharma et al., "The BEL1-Like Family of Transcription Factors in Potato," J. Expt. Bot. 65:709-23 (2014), which are hereby incorporated by reference in their entirety). StBEL5 mRNA accumulation and mobility were enhanced by short-days in a transport-mediated process (Banerjee et al., "Dynamics of a Mobile RNA of Potato Involved in a Long-Distance Signaling Pathway," Plant Cell 18:3443-57 (2006) and Cho et al., "Polypyrimidine Tract-Binding Proteins of Potato Mediate Tuberization Through an Interaction With StBEL5 RNA," J. Expt. Bot. 66:6835-47 (2015), which are hereby incorporated by reference in their entirety).

[0191] Because photoperiod is an important cue for regulating the onset of tuberization, and to determine if photoperiod had any effect on the steady-state levels of StBEL11 and StBEL29 mRNAs, total and polysomal RNA levels for both were measured in leaves, petioles, stem, roots, and stolons from LD and SD andigena plants (FIGS. 9A-9D). Transcript accumulation of both StBEL11 and StBEL29 occurred throughout the plant under both LD and SD photoperiods, but organ-specific differential accumulation of mRNAs was observed when plants were grown under SD conditions (FIGS. 9A, 9B).

[0192] Significant differences in mRNA levels were observed for petioles, stems, and stolons for both StBEL types. In the tested samples, RNA levels were less in leaves in comparison to petiole and stems. RNA levels of both StBEL11 and StBEL29 were similar in roots under both photoperiodic conditions. Among all the organs evaluated, stolons exhibited the greatest RNA accumulation under SD conditions for both StBEL11 and StBEL29 RNAs. Similar patterns of accumulation were also observed for polysomal RNA fractions for both of the StBEL1-types (FIGS. 9C, 9D).

[0193] In theory, polysomal RNA is a measure of mRNAs that are being actively translated in these organs. This analysis indicates that transcript accumulation patterns varied among the organs tested, but that levels in petioles, stems, and stolons were significantly affected by photoperiod. Levels of total RNA in stolons from SD plants increased 7.6- and 10-fold for StBEL11 and StBEL29, respectively. Similar enhancement levels were observed in the polysomal fractions (FIGS. 9C, 9D). To better understand, the effect of photoperiod on StBEL11 and StBEL29 patterns of transcript accumulation, promoter activity of both types were quantified under both LD and SD conditions in several organs (FIGS. 10A, 10B). Both StBEL1-types responded to photoperiod in a similar fashion. Promoter activity was induced by SD in leaves, petioles, and stolons. Activity in roots was slightly enhanced by LD conditions. No difference in promoter activity was observed in stems (FIGS. 10A, 10B).

Example 9--StBEL11 and StBEL29 RNAs are Phloem Mobile

[0194] Because StBEL11 and StBEL29 transcription occurs in vascular cells of both stems and petioles and in light of the liberal mobility of StBEL5 RNA, heterografts were implemented to assess the capacity of these RNAs for long-distance transport. Heterografts were composed of transgenic scions with a GAS (galactinol synthase) promoter driving full-length StBEL11 or -29 expression and wild-type (WT) stocks (FIGS. 11A-11C). The GAS promoter is specifically expressed in minor veins of the leaf (Ayre et al., "Functional and Phylogenetic Analyses of A Conserved Regulatory Program in the Phloem of Minor Veins," Plant Physiol. 133:1229-39 (2003), which is hereby incorporated by reference in its entirety). After grafts formed in vitro and several weeks of growth in soil, RTPCR with transgene-specific primers was performed in secondary roots and stolons of the WT andigena stock. In all four replicates for both StBEL11 and StBEL29, transgenic RNA was detected in stolons tips and secondary roots of the WT stock (FIGS. 11A, 11B). No GUS transcripts were detected in WT stocks of the GAS:GUS/WT heterografts and no transgenic RNAs were detected in WT/WT grafts (FIGS. 11C, 11D). These results clearly demonstrate that the leaf-derived transcripts of both StBEL11 and StBEL29 move down into secondary roots and stolon tips through the sieve element system when expressed from the GAS promoter.

[0195] To assess the effect of photoperiod on StBEL11 and StBEL29 mobility, levels of transgenic RNAs were measured in stolon tips of GAS:StBEL11 and GAS:StBEL29 lines grown under either LD or SD conditions using RTqPCR (FIG. 12). In all four transgenic lines for StBEL11 and StBEL29, more transgenic RNA arising from the leaf accumulated in stolon tips from plants grown under short-days than long-days. These results suggest that movement of the transgenic StBEL11 and StBEL29 RNAs is enhanced under SD conditions. Consistent with StBEL5 RNA (Cho et al., "Polypyrimidine Tract-Binding Proteins of Potato Mediate Tuberization Through an Interaction With StBEL5 RNA," J. Expt. Bot. 66:6835-47 (2015), which is hereby incorporated by reference in its entirety), however, enhanced stability mediated by SDs may also contribute to these steady-state level increases. Whereas shoot fresh weight from these GAS lines was generally not affected by the enhanced levels of StBEL11 and StBEL29 RNA (FIG. 13A), tuber growth was significantly reduced in these lines grown under SD conditions (FIG. 13B; FIG. 14). This reduction appears to be positively correlated with the efficient movement and stability of both RNAs into stolons under SD conditions (FIG. 12).

Example 10--Target Gene Activity

[0196] Since GAS:StBEL11 and StBEL29 lines exhibited a reduction in tuber yield (FIG. 13B), the activity of select target genes was measured in tuberizing stolons of these transgenic lines. Although accumulation of RNAs for StSP6A and StPIN1 was enhanced in a GAS:StBEL5 line relative to the WT line (Sharma et al., "Targets of the StBEL5 Transcription Factor Include the FT Ortholog StSP6A," Plant Physiol. 170:310-24 (2016), which is hereby incorporated by reference in its entirety), levels of RNA for these same marker genes were reduced significantly for both GAS:StBEL11 and StBEL29 transgenic lines (FIGS. 15A, 15B). Both of these genes contain a tandem TTGAC element within 2.0 kb (from the start codon) of their upstream sequence, and both are strongly induced by StBEL5 activity (Hannapel et al., "Phloem-Mobile Messenger RNAs and Root Development," Front. Plant. Sci. 4:257 (2013) and Sharma et al., "Targets of the StBEL5 Transcription Factor Include the FT Ortholog StSP6A," Plant Physiol. 170:310-24 (2016), which are hereby incorporated by reference in their entirety). The suppressive effect of StBEL11 and StBEL29 on these target genes appears not to be mediated by a reduction in levels of StBEL5 activity. In an independent experiment examining stolons of GAS:StBEL11 and StBEL29 lines, StBEL5 RNA levels were essentially unchanged or increased only in transgenic line G:B11b (FIG. 16).

Example 11--StBEL11 and StBEL29 Function Antagonistically to StBEL5

[0197] Potato tuberization is controlled by signals that arise from the leaf under inductive conditions and are transported underground via the sieve element system to activate cell growth in the stolon meristem (Abelenda et al., "Flowering and Tuberization: A Tale of Two Nightshades," Trends Plant Sci. 19:115-22 (2014), which is hereby incorporated by reference in its entirety). Because of their transport capacity, the search for these activating signals has focused on primary products like miRNAs, full-length mRNAs, and less abundant proteins that move through phloem cells in a basipetal direction. In addition to full-length mRNAs, like StBEL5, other prominent mobile tuberization signals have been identified. These include like the FT-ortholog, StSP6A, a key regulator of tuberization (Navarro et al., "Control of Flowering and Storage Organ Formation in Potato by FLOWERING LOCUS T," Nature 478:119-22 (2011), which is hereby incorporated by reference in its entirety). StSP6A protein accumulates in stolons of plants grown under SD and its expression is closely correlated with tuber formation (Navarro et al., "Control of Flowering and Storage Organ Formation in Potato by FLOWERING LOCUS T," Nature 478:119-22 (2011) and Gonzalez-Schain et al., "Potato CONSTANS is Involved in Photoperiodic Tuberization in a Graft-Transmissible Manner," Plant J. 70:678-90 (2012), which are hereby incorporated by reference in their entirety).

[0198] Two important miRNAs, miR172 and miR156, have also been implicated in potato development (Martin et al., "Graft-Transmissible Induction of Potato Tuberization by the MicroRNA miR172," Development 136:2873-81 (2009) and Bhogale et al., "MicroRNA156: A Potential Graft-Transmissible MicroRNA That Modulates Plant Architecture and Tuberization in Solanum tuberosum ssp. andigena," Plant Physiol. 164:1011-27 (2014), which are hereby incorporated by reference in their entirety). Through transcript profiling of phloem sap, it is now known that hundreds of full-length mRNAs are present in the sieve element system (Omid et al., "Characterization of Phloem-Sap Transcription Profile in Melon Plants," J. Exp. Bot. 58:3645-56 (2007); Deeken et al., "Identification of Arabidopsis thaliana Phloem RNAs Provides a Search Criterion for Phloem-Based Transcripts Hidden in Complex Datasets of Microarray Experiments," Plant J. 55:746-59 (2008); Kehr et al, "Long Distance Transport and Movement of RNA Through the Phloem," J. Exp. Bot. 59:85-92 (2008); and Notaguchi et al., "Identification of mRNAs That Move Over Long Distances Using an RNA-Seq Analysis of Arabidopsis/Nicotiana benthamiana Heterografts," Plant Cell Physiol. 56:311-21 (2015), which are hereby incorporated by reference in their entirety).

[0199] Despite these insights, however, only a limited number of RNAs have been confirmed to move and even fewer have been associated with a phenotype. This latter group includes StBEL5 (Banerjee et al., "Dynamics of a Mobile RNA of Potato Involved in a Long-Distance Signaling Pathway," Plant Cell 18:3443-57 (2006), which is hereby incorporated by reference in its entirety) and POTH1 (Mahaj an et al., "The mRNA of a Knotted1-Like Transcription Factor of Potato is Phloem Mobile," Plant Mol. Biol. 79:595-608 (2012), which is hereby incorporated by reference in its entirety) of potato, CmGAI of pumpkin (Haywood et al., "Phloem Long-Distance Trafficking of GIBBERELLIC ACID-INSENSITIVE RNA Regulates Leaf Development," Plant J. 42:49-68 (2005), which is hereby incorporated by reference in its entirety), PFP-LeT6 from tomato (Kim et al., "Developmental Changes Due to Long-Distance Movement of a Homeobox Fusion Transcript in Tomato," Science 293:287-89 (2001), which is hereby incorporated by reference in its entirety), and AUX/IAA (Notaguchi et al., "Phloem-Mobile Aux/IAA Transcripts Target to the Root Tip and Modify Root Architecture," J. Int. Plant Biol. 54:760-72 (2012), which is hereby incorporated by reference in its entirety) and FLOWERING LOCUS T and CENTRORADIALIS (Li et al., "Mobile FT mRNA Contributes to the Systemic Florigen Signalling in Floral Induction," Sci. Rep. 1:73 (2011); Huang et al., "Arabidopsis CENTRO-RADIALIS Homologue Acts Systemically to Inhibit Floral Initiation in Arabidopsis," Plant J. 72:175-84 (2012); and Lu et al., "Long-Distance Movement of Arabidopsis FLOWERING LOCUS T RNA Participates in Systemic Floral Regulation," RNA Biol. 9(5):653-62 (2012), which are hereby incorporated by reference in their entirety) from Arabidopsis.

[0200] A recent report by Calderwood et al., "Transcript Abundance Explains mRNA Mobility Data in Arabidopsis thaliana," Plant Cell 28:610-15 (2016), which is hereby incorporated by reference in its entirety, indicated that movement of RNAs from phloem cells can be explained by transcript abundance and RNA stability. This study suggests that most of the identified transcripts that move from companion cells into sieve elements do so via non-sequence-specific transport. Whereas this study certainly establishes a strong case for a non-specific mechanism controlling RNA movement, there is also evidence that conserved RNA sequences that interact with specific RNA-binding proteins may mediate transcript mobility (Ham et al., "A Polypyrimidine Tract Binding Protein, Pumpkin RBP50, Forms the Basis of a Phloem-Mobile Ribonucleoprotein Complex," Plant Cell 21:197-215 (2009) and Cho et al., "Polypyrimidine Tract-Binding Proteins of Potato Mediate Tuberization Through an Interaction With StBEL5 RNA," J. Expt. Bot. 66:6835-47 (2015), which are hereby incorporated by reference in their entirety).

[0201] Because of the critical role that the polypyrimidine tract-binding (PTB) proteins play in controlling StBEL5 transcript movement and stability (Cho et al., "Polypyrimidine Tract-Binding Proteins of Potato Mediate Tuberization Through an Interaction With StBEL5 RNA," J. Expt. Bot. 66:6835-47 (2015), which is hereby incorporated by reference in its entirety), future work will be necessary to elucidate the processes that regulate mobility and stability for StBEL11 and StBEL29. Evidence for a more specific process is suggested, however, in the movement assays of this study. Using heterografts and the same source promoter, StBEL11 and StBEL29 RNAs moved liberally across the graft union into both roots and stolons, whereas, movement of GUS transcripts was not detected (FIGS. 11A-11C).

[0202] Whereas StBEL5 has been proposed to function as a mobile RNA signal in potato that activates tuber growth (Banerjee et al., "Dynamics of a Mobile RNA of Potato Involved in a Long-Distance Signaling Pathway," Plant Cell 18:3443-57 (2006) and Lin et al., "The Impact of the Long-Distance Transport of a BEL1-Like mRNA on Development," Plant Physiol. 161:760-72 (2013), which are hereby incorporated by reference in their entirety), here it is reported that the phylogenetically-related StBELs, StBEL11 and StBEL29, are also phloem-mobile, but act in opposition to StBEL5. Functional antagonism has been reported previously among the BEL1-like TFs, ARABIDOPSIS THALIANA HOMEOBOX 1, PENNYWISE and POUNDFOOLISH, in the maintenance of the SAM and in the control of flowering time (Rutjens et al., "Shoot Apical Meristem Function in Arabidopsis Requires the Combined Activities of Three BEL1-Like Homeodomain Proteins," Plant J. 58:641-54 (2009), which is hereby incorporated by reference in its entirety).

[0203] Despite their antagonistic relationship, however, StBEL5, StBEL11 and StBEL29 share a number of common features that are unique among StBEL family members. All three exhibit RNA accumulation and promoter activity associated with phloem cells (Table 2; FIGS. 8A-8D; Banerjee et al., "Dynamics of a Mobile RNA of Potato Involved in a Long-Distance Signaling Pathway," Plant Cell 18:3443-57 (2006); Yu et al., "Tissue Integrity and RNA Quality of Laser Microdissected Phloem of Potato," Planta 226:797-803 (2007); and Lin et al., "Transcriptional Analysis of Phloem-Associated Cells of Potato," BMC Genom. 16:665 (2015), which are hereby incorporated by reference in their entirety). Their RNAs are ubiquitous throughout the plant and both movement and accumulation of their RNAs are enhanced by a SD photoperiod. They are the only BELs of potato with transcript levels consistently affected by SDs in several organs (Chen et al., "Interacting Transcription Factors From the Three Amino Acid Loop Extension Superclass Regulate Tuber Formation," Plant Physiol. 132:1391-1404 (2003) and Sharma et al., "The BEL1-Like Family of Transcription Factors in Potato," J. Expt. Bot. 65:709-23 (2014), which are hereby incorporated by reference in their entirety), and all three exhibit enhanced accumulation of their transcripts in stolons under SD conditions.

[0204] This relationship with photoperiod suggests that their movement and stability could be controlled by a common factor. Recent work on the mobility of StBEL5 has shown that its RNA interacts with RNA-binding proteins from the PTB family, StPTB1 and StPTB6 (Cho et al., "Polypyrimidine Tract-Binding Proteins of Potato Mediate Tuberization Through an Interaction With StBEL5 RNA," J. Expt. Bot. 66:6835-47 (2015), which is hereby incorporated by reference in its entirety). This binding occurs on conserved cytosine/uracil motifs present in the 3' UTR of StBEL5 and facilitates stability as well as transport (Cho et al., "Polypyrimidine Tract-Binding Proteins of Potato Mediate Tuberization Through an Interaction With StBEL5 RNA," J. Expt. Bot. 66:6835-47 (2015), which is hereby incorporated by reference in its entirety). Similar motifs have been identified in the UTRs of StBEL11 and StBEL29 that may facilitate binding to the StPTB proteins. In over-expression lines of StPTB1 and StPTB6, movement of StBEL11 and StBEL29 from leaves to stolon tips was enhanced (FIGS. 17A-17D).

[0205] Polysomal RNA levels for StBEL11 and StBEL29 were positively correlated with overall RNA accumulation, suggesting functional activity of these TFs in those organs where they accumulate. In all three of these StBEL TFs, the effect on growth appears to be mediated by a similar set of target genes. For example, all three regulate StSP6A activity (FIGS. 5A-5C; FIGS. 15A-15B; Sharma et al., "Targets of the StBEL5 Transcription Factor Include the FT Ortholog StSP6A," Plant Physiol. 170:310-24 (2016), which is hereby incorporated by reference in its entirety). StBEL11 and StBEL29 appear to work on downstream target genes and have minimal effect on StBEL5 transcription (FIG. 16). StBEL5 functions upstream of a plethora of targets and induces the expression of six StBEL genes in stolons, including StBEL11 and StBEL29, and numerous genes involved in hormone metabolism (Sharma et al., "Targets of the StBEL5 Transcription Factor Include the FT Ortholog StSP6A," Plant Physiol. 170:310-24 (2016), which is hereby incorporated by reference in its entirety; FIG. 18). Cross-regulation by StBEL5 contributes to inducing the expression of StBEL11 and StBEL29 in stolons and other organs. In this way, all three may function jointly to maintain a balance of controlled, localized cell growth in these organs. The repressive transcription function observed for StBEL11 and StBEL29 could be the result of a unique BEL/KNOX interaction or it could be the effect of a novel sequence motif in their proteins that modulates critical structural dynamics. In an amino-acid sequence alignment of StBEL5, StBEL11, and StBEL29, eleven unique amino acid runs of eight or more residues were identified (FIG. 19). Among all three, there are very few sequence differences within the highly conserved protein/protein domains (BELL and SKY box) and the homeodomain.

Example 12--An Activator/Inhibitor Module for Tuberization

[0206] A system of activation and repression of growth is consistent with the development of a new tuber from the stolon tip. At the onset of tuber induction, the shoot apex ceases to elongate and growth is initiated in a specific layer of cells within the pith and cortex, resulting in swelling in the stolon tip that spreads throughout the subapical portion of the meristem (Xu et al., "Cell Division and Cell Enlargement During Potato Tuber Formation," J. Exp. Bot. 49:573-82 (1998), which is hereby incorporated by reference in its entirety). Further cell growth arises from cells between the pith and cortex designated the perimedullary zone just below the stolon apex and in close proximity to vascular tissue (Xu et al., "Cell Division and Cell Enlargement During Potato Tuber Formation," J. Exp. Bot. 49:573-82 (1998), which is hereby incorporated by reference in its entirety). The orientation of cell division changes from transverse to longitudinal leading to radial expansion. Most of the cell growth occurs in this localized sub-apical region of the stolon meristem (Xu et al., "Cell Division and Cell Enlargement During Potato Tuber Formation," J. Exp. Bot. 49:573-82 (1998), which is hereby incorporated by reference in its entirety) and changes in levels of hormones like gibberellins, auxin, and cytokinins play pivotal roles in regulating growth at this site (Xu et al., "The Role of Gibberellin, Abscisic Acid, and Sucrose in the Regulation of Potato Tuber Formation In Vitro," Plant Physiol. 117:575-84 (1998), which is hereby incorporated by reference in its entirety).

[0207] Growth below the apex creates a strong sink that subsequently accumulates storage proteins and large amounts of starch transported as sucrose via the phloem system. Control of these processes includes both activation and suppression of the growth of specific cell types unique to the tuberization program. Mobile TFs that are transported through sieve elements and can move cell-to-cell via plasmodesmata in the form of a full-length mRNA are ideal for the fine-tuning of cell growth and cell dormancy. Because of the high bioenergetic cost of this developing sink, the efficient coordination of cell growth is critical. Due to their mobility and specificity, this tripartite StBEL module could readily contribute to cell fate determination in the stolon apex during the transition process from stolon to tuber. Because StBEL11/29 function antagonistically to StBEL5 for tuberization, it is possible that these StBEL types function at different developmental stages or in different cell types during the stolon-to-tuber transition.

[0208] There are other examples of activation/suppression systems that regulate plant growth through maintenance of the apical meristem. One of the most widely studied systems is an activator/inhibitor process that controls flowering (Lifschitz et al., "Florigen and Anti-Florigen: A Systemic Mechanism for Coordinating Growth and Termination in Flowering Plants," Front. Plant. Sci. 5:465 (2014), which is hereby incorporated by reference in its entirety). Flowering locus T (FT) protein acts as a mobile florigen signal that moves into the apex and interacts with the basic leucine zipper transcription factor, FD, to induce flowering (Abe et al., "FD, A bZIP Protein Mediating Signals From the Floral Pathway Integrator FT at the Shoot Apex," Science 309:1052-56 (2005); Wigge et al., "Integration of Spatial and Temporal Information During Floral Induction in Arabidopsis," Science 309:1056-59 (2005); Corbesier et al., "FT Protein Movement Contributes To Long Distance Signaling In Floral Induction of Arabidopsis," Science 316:1030-33 (2007); Jaeger & Wigge, "FT Protein Acts as a Long Range Signal in Arabidopsis," Curr. Biol. 17:1050-54 (2007); and Mathieu et al., "Export of FT Protein From Phloem Companion Cells is Sufficient for Floral Induction in Arabidopsis," Curr. Biol. 17:1055-60 (2007), which are hereby incorporated by reference in their entirety).

[0209] TERMINAL FLOWER 1-like (TFL1) proteins function as floral inhibitors and are antagonistic to FT function (Shannon & Meeks-Wagner, "A Mutation in the Arabidopsis TFL1 Gene Affects Inflorescence Meristem Development," Plant Cell 3:877-92 (1991), which is hereby incorporated by reference in its entirety). A single amino acid change in the FT protein is sufficient to transform its function from an activator to a repressor (Hanzawa et al., "A Single Amino Acid Converts a Repressor to an Activator of Flowering," Proc. Nat'l. Acad. Sci. U.S.A. 102:7748-53 (2005), which is hereby incorporated by reference in its entirety). There have even been reports that the mRNAs of FT and CENTRORADIALIS, a TFL1 homologue in Arabidopsis, move long distance to the shoot apex via the phloem system (Huang et al., "Arabidopsis CENTRO-RADIALIS Homologue Acts Systemically to Inhibit Floral Initiation in Arabidopsis," Plant J. 72:175-84 (2012) and Lu et al., "Long-Distance Movement of Arabidopsis FLOWERING LOCUS T RNA Participates in Systemic Floral Regulation," RNA Biol. 9(5):653-62 (2012), which are hereby incorporated by reference in their entirety). Another report, however, indicated that FT mRNA movement is not required to induce flowering (Notaguchi et al., "Long-Distance, Graft-Transmissible Action of Arabidopsis FLOWERING LOCUS T Protein to Promote Flowering," Plant Cell Physiol. 49:1645-58 (2008), which is hereby incorporated by reference in its entirety).

[0210] In another example of an activator/repressor process that balances growth, the homeodomain TF, WUSCHEL (WUS), functions to maintain stem cells in the SAM in an undifferentiated state (Schoof et al., "The Stem Cell Population of Arabidopsis Shoot Meristems is Maintained by a Regulatory Loop Between the CLAVATA and WUSCHEL Genes," Cell 100:635-44 (2000) and Fletcher, "Shoot and Floral Meristem Maintenance in Arabidopsis," Annu. Rev. Plant Biol. 53:45-66 (2002), which are hereby incorporated by reference in their entirety). CLAVATA3 (CLV3), a peptide ligand, controls the size of the stem cell domain by repressing WUS ( adnikova & Simon, "How Boundaries Control Plant Development," Curr. Opin. Plant Biol. 17:116-25 (2014), which is hereby incorporated by reference in its entirety). In turn, the LATERAL ORGAN BOUNDARIES DOMAIN TF, LBD15, maintains the stem cell pool through upregulation of WUS (Sun et al., "Arabidopsis ASL11/LBD15 is Involved in Shoot Apical Meristem Development and Regulates WUS Expression," Planta 237:1367-78 (2013), which is hereby incorporated by reference in its entirety). The WUS-CLV feedback system forms a self-correcting mechanism for maintaining a constant number of stem cells and the SAM size at the shoot apex.

[0211] A model for tuber formation is currently arising that places StBEL5 upstream in a regulatory network involving hormonal metabolism and transcriptional controls that mediate tuber formation (Sharma et al., "Targets of the StBEL5 Transcription Factor Include the FT Ortholog StSP6A," Plant Physiol. 170:310-24 (2016), which is hereby incorporated by reference in its entirety). The observation that StBEL5 induces transcription of StSP6A, whereas StBEL11, and StBEL29 suppress its expression, is consistent with this premise. Overall, these data suggest that StBEL5, StBEL11, and StBEL29 could function collectively as phloem-mobile mRNA signals in a whole-plant network in potato that modulates storage organ development through the processes of cell growth activation and suppression in the subapical portion of the stolon tip.

[0212] Although preferred embodiments are depicted and described in detail herein, it will be apparent to those skilled in the relevant art that various modifications, additions, substitutions, and the like can be made without departing from the spirit of the invention and these are therefore considered to be within the scope of the invention as defined in the claims which follow.

Sequence CWU 1

1

5312718DNASolanum tuberosum L. 1tttaagaaaa tctctcactt tctctttctc ccaattataa taagaaaact ttctttcctc 60cttgttttta tttttaaaaa aatatttcag tttagtttat ggttgaagat atttgatata 120gccttcatat atgtcactca tgttccatca tcagccaagt gttagaagtc actttcttta 180acaagatttt cttgaaaaat atttaaaaaa ttgaactcca aaaaaaagaa aaaaaggagt 240gtagttttct tgattggttg tgaaatttat ggctatgtac tatcaaggag gctcagaaat 300ccaagctgat ggtctgcaga cactttattt gatgaaccct aactatatag gctacactga 360cacacatcat catcatcatc aacaccaaca acaatcagcc aacatgtttt tcttgaattc 420tgtggcggcg gggaattttc cccacgtgtc cctccctttg caagcacatg cgcaggggca 480cttggttgga gtgcccctgc cagctggttt tcaagatcct aaccgccctt ccattcagga 540aattccgacc tctcatcatg gccttttatc gcgtttgtgg acttctggtg accaaaatac 600ccctagaggt ggtggaggag gaggagaagg aaatggaagt caatcacata taccgtcttc 660cacggtggtt tctcccaact caggtagtgg gggaggcacc accacggact ttgcttccca 720attagggttc caaagaccgg ggttggtgtc accaacacag gcgcaccatc aaggtctttc 780tctaagcctt tctccacaac aacaaatgaa tttcaggtct agtcttccac tagaccaccg 840cgatatttca acaacaaatc atcaagttgg aatactatca tcatcaccat taccatcacc 900aggaacaaat accaatcata ctcgaggatt aggggcatca tcgtcttttt cgatttctaa 960tgggatgata ttgggttcta agtacctaaa agttgcacaa gatcttcttg atgaagttgt 1020taatgttgga aaaaacatca aattatcaga ggttggtgca aaggagaaac acaaattgga 1080caatgaatta atatctttgg ctagtgatga tgttgaaagt agcagccaaa aaaatagtgg 1140tgttgaactt actacagctc aaagacaaga acttcaaatg aagaaagcaa agcttgttag 1200catgcttgat gaggtggatc aaaggtatag acaataccat caccaaatgc aaatgattgc 1260aacatcattt gagcaaacaa caggaattgg atcatcaaaa tcatacacac aacttgcttt 1320gcacacaatt tcaaagcaat ttagatgttt aaaagatgca atttctgggc aaataaagga 1380cactagcaaa actttagggg aagaagagaa cattggaggc aaaattgaag gatcaaagtt 1440gaaatttgtg gatcatcatt tacgccaaca acgtgcacta caacaattag ggatgatgca 1500aaccaatgca tggaggccac aaagaggttt gcccgaaaga gcggtttcgg ttctccgtgc 1560ttggcttttc gagcattttc ttcatccgta tcccaaagat tcagataaaa tcatgcttgc 1620taagcaaaca gggctaacaa ggagccaggt atcaaattgg tttataaatg ctagagttag 1680actatggaag ccaatggtag aagaaatgta catggaagaa gtgaagaaaa acaatcaaga 1740acaaaatatt gagcctaata acaatgaaat tgttggttca aaatcaagtg ttccacaaga 1800gaaattacca attagtagca atattattca taatgcttct ccaaatgata tttctacttc 1860caccatttca acatctccga cgggcggcgg cggttcgatt ccggctcaga cggttgcagg 1920tttctccttc attaggtcat taaacatgga gaacattgat gatcaaagga acaacaaaaa 1980ggcaagaaat gagatgcaaa attgttcaac tagtactatt ctctcaatgg aaagagaaat 2040catgaataaa gttgtgcaag atgagacaat caaaagtgaa aagttcaaca acacacaaac 2100aagagaatgt tattctctaa tgactccaaa ttacacaatg gatgatcaat ttggaacaag 2160gttcaacaat caaaatcatg aacaattggc aacaacaaca acaacttttc atcaaggaaa 2220tggtcatgtt tctcttactc tagggcttcc accaaattct gaaaaccaac acaattacat 2280tggattggaa aatcattaca atcaacctac acatcatcca aatattagct atgaaaacat 2340tgattttcag agtggaaagc gatacgccac tcaactatta caagattttg tttcttgatg 2400atatatataa tttgcaggta aatcagcttg aaattacatc atgaaaggcc ttgaataaaa 2460gaaggggagt tgagatctag tgatcatata aatatgtata ggtagaaagt ttagttagta 2520tatataggtt atacttctag tttcttaaat ggagatacaa tttttgttgt tatttttgta 2580ttgagataac tagctagctt ggattattta aagttgttgc atgcaaccaa agaagaagaa 2640aaaataatct atatatgcaa actatagtat gttgtaaatt ttgtgcgtct ttttgtttca 2700atttgcatat atgtaaac 271828025DNASolanum tuberosum L. 2ttttttttat gtatatatac atttgatgaa gataatgttc tcttaagtga aaatcttgct 60tttatcatta gttagtactt acaattcttt ctgtcttatt ttatatgata tttttttaaa 120tttagtttac cccgaaaata aatgatatgt ttttatatat ttaactaatt caatttaact 180aattcaattt taaacttctt tgaatctcaa tcgaattgcc tcatttttga gaaggagttc 240gatttcaaac ccagattcga tccactccaa gaaaaagaga aaagaaaaac aaatcaacta 300cgaaccccca ccccacccca ccccaccccc caccatcgga aaaagggtca taagtagaaa 360taaagaaaaa ttgagggact tctagcaact aatgtaatca attatgtatt atatatggac 420ccaacaaatt ggtggaaaaa gacgtttcct catttttcat atatctatgg cctacttcct 480ttaagttaat gttttttttc ttcatctaat tttaagtcga gtatttattt tgagactcgg 540attaatttaa attgatgttt tcaggaaaat ttatcaaaag tgaaaatcta acttattgag 600aattttctta tttgtatgat ttaaatttgt aacctctaaa taaagatgaa aaatcttaat 660catttcatca ttactcgtaa ttattttctt cttgttagtg ttcactatac tctctctttc 720tctctaaaga tatttttgaa aaaaaatatc taaattatgc cagcatcaaa tcattttata 780atagtgaaat taagattggg tctatttatt ttttccatca cacgtatgta gaacccccca 840cccccaccct cgccgccacc ccaccccctt actatcgagt ttaactaata tttattagta 900taaaaattat atttatctgt tataacaagt aaaatgtctt atttttaaaa ggataaaggt 960atgagaaata tcccaacttt gatcggattt actgttgcga tactaaactt tcatgaggat 1020ctattacctc cttcgactat ttaataccgt atttttatcc ccctgaacta tttaatattg 1080tattttaaag gtatatatga ttatatgtgc caacgtggac acattactat ttataatttt 1140gcattatttt ttatgtccac gtggacaaat atatatgttt aaaatacggt attaaatagt 1200ctagggagct aataggtcct catgaaagtt tagtatcgca acaacaaatt cgatcaaagt 1260tgagatattt ttcaggccct tatccctatt tttaaaattg aaagtttaca tttttatgaa 1320gggttaaaac atgtaacatc atttaggtaa cttgatatag tataaaaaat tatttacatt 1380atatataaat taaattcatg attactaaaa gaattcaatc atcaggtcat ctttatctat 1440gaaatgtttt atttgtaaaa ttacaaacct cacatttaaa aaagtttatc tataaatata 1500tttttaaata accttcctga taatgtaaaa atatttatac tgacgattct tactgatttt 1560ttttttactg tgtttttgag gggtggggtg ggggtgaggg taagggggat atgttgggag 1620acttacacta aataaacatg tcttctttat tcatattccc ctttatgtgt tgtggagttt 1680taagaaaatc tctcactttc tctttctccc aattataata agaaaacttt ctttcttcct 1740tgtttttatt tttaaaaaaa tatttcagtt tagtacatgg ttgaagatat ttgatatagc 1800cttcatatat gtcactcatg tgagtacaac ttttctccat atatatcaaa atcaagattt 1860tcatagttga gtgattaatt aattgtatat aactcatcat atattatttg aattttcttt 1920gttaaaaatg ttttctatct ttagggtatt gcatggattt attataattt ttttctatct 1980tactttctaa tttcaggttc catcatcagc caagtgttag aagtcacttt ctttaacaag 2040attttcttaa aaaatattta aaaacttgaa ctccaaaaaa aagaagaaaa ggagtgtaat 2100tttcttgatt ggttgtgaaa tttatggcta tgtactatca aggaggctca gaaatccaag 2160ctgatggtct gcagacactt tatttgatga accctaatta tataggctat actgacacac 2220atcatcatca tcaacaacac caacaacaat cagccaacat gtttttcttg aattctgtgg 2280cggcggggaa ttttccccac gtgtccctcc ctttgcaagc acatgcgcag gggcacttgg 2340ttggagtgcc cctgccagct ggttttcaag atcctaaccg cccttccatt ccggaaattc 2400cgacctctca tcatggcctt ttatcacgtt tgtggacttc tggtgaccaa aataccccta 2460gaggtggtgg aggaggagga gaaggaaatg gaagtcaatc acatataccg tcttccacgg 2520tggtttctcc caactcaggt agtgggggag gcaccaccac ggactttgct tcccaattag 2580ggttccaaag accggggttg gtgtcaccaa cacaggcgca ccatcaaggt ctttctctaa 2640gcctttctcc acaacaacaa atgaatttca ggtctagtct tccactagac caccgcgata 2700tttcaacaac aaatcatcaa gttggaatac tatcaccatc accattacca tcaccaggaa 2760caaataccaa tcatactcga ggattagggg catcatcgtc tttttcgatt tctaatggga 2820tgataatggg ttctaagtac ctaaaagttg cacaagatct tcttgatgaa gttgttaatg 2880ttggaaaaaa catcaaatta tcagagggtg gtgcaaagga gaaacacaaa ttggacaatg 2940aattaatctc tttggctagt gatgatgttg aaagtagcag ccaaaaaaat attgttgttg 3000aacttactac agctcaaaga caagaacttc aaatgaagaa agccaagctt gttagcatgc 3060ttgatgaggt atatatactt ctaattattc atatattaat taattaatca tatatatata 3120ttaatcaaat tattcatata ttaattaatt aatcaatacc aagtttcttg atttggagtt 3180tgatcattta ggcaaatttc actactatat ataaaacaca aattctaacg gatgtttggt 3240cagtaagaaa ttctcaattt tcaatcaaac atctattaga atttcacgtt ttttagtagt 3300gaaattaatt aaataatcta aaaattgttc aatcgaattt acaacaaaac atccattgaa 3360attttacttt cttttcaata gcgaaaccaa ttaaatagga ttgactaccc aattaatagt 3420tattatctta tcttcttctt gatttcaatc ttttttcaat aaaaagagta attttaatta 3480tgagataata aactactgat tagttatgac aatctgaaaa atcaactcct attaaatgat 3540ccaaaaagtg tacaaatttg tatatcttaa tgttaatttc attgttttat ttatttattt 3600agttgctttt ttttccttct tgggaagggg gaggggtcaa gttgctattg attcatatac 3660tagcaataat tattgattta tttcaaaggt acaattttgt tcatcatgaa actataagct 3720agacaatata tgtggttcta agcttttttc tattgggggt ccaactaaag ttaaagataa 3780tacacctaat atgtcttgtt gagttgacaa aaaatcaaag gcacgtggtc ttattcaatc 3840actttattag aacctttcaa atttggaaat attcttacct ttcttttgag ataatcacat 3900aaaaataaac ctttggaata atttatattt ttggtattcc tattgatatt tgatatctgt 3960tttgaagctt aactaatata aatatgcgtc gaaaagttat ctcactttag gagattaaaa 4020tgcttcttag taaaagtgac ttcatattca ggactcgaat aatattactt gatgatcatt 4080tggacacaat tgatcaattg ggaaataatg aaatattatt ttgcaaatca agttttattt 4140tataatttca ttagttattt cgacttgaac ttgaaataaa gaatctgaag tttgaaaaat 4200tgatttaaag agtatttttt tccactctaa gaacttcaaa caatttcaac ttcaacttca 4260tataatcata ttttttttca acttcaatca gatatcgtcg tgatatgatc aatatcaatc 4320tacttatttt tattttattg tttgtatttt tttttgaatt ttttataggt ggatcaaagg 4380tatagacaat accatcacca aatgcaaatg attgcaacat catttgagca aacaacagga 4440attggatcat caaaatcata cacacaactt gctttgcaca caatttcaaa gcaatttaga 4500tgtttaaaag atgcaatttt tgggcaaata aaggacacaa gtaaaacttt aggggaagaa 4560gagaacattg gaggcaaaat tgaaggatca aagttgaaat ttgtggatca tcatttacgc 4620caacaacgtg cactacaaca attagggatg atgcaaacca atgcatggag gccacaaaga 4680ggtttgcccg aaagagcggt ttcggttctc cgcgcttggc ttttcgagca ttttcttcat 4740ccgtaagtat ttgttgaaga cataattaag taaattaata tgcatgtctt ttaatagttt 4800aagattttaa acaaagcaat cacaacatcc tacatgtttc accgcttgtt ctccttatta 4860ggaaaaataa ccaattgttc tagagtatat gagaaagaat cagactcgca atctagcatt 4920tgaagtggca aatacaagac taattaagta aatacaattt ttttttttaa aataacagtt 4980taaacttttg aatgagatag atttaattaa caccttatat tacctataag aaatgaactt 5040caatctctat ttttttttta aaaacaattt tatacaccat gtagaaacct ttataaagaa 5100attaaattaa atcactcata ccatttcttt taaatttcaa taaataaatt atatatttct 5160tgtcttgcag gtatcccaaa gattcagata aaatcatgct tgctaagcaa acagggctaa 5220caaggagcca ggttcttgaa aaattcatca tctcaattta tatgacgcat tttttaacat 5280atctaaaaaa gacgttttat ttctaattta gaaacaataa aattttaaaa ttctcaacaa 5340tcatagtacc tctctatata actgtaacaa catcttatta taacaaccaa ttttttgaat 5400atgccgtaaa aaagacatta tattttcaat ttaggaacaa tataacttta aaattctcaa 5460caatcatagt acctctctat ataactgtaa caacatctta ttataacaac caattttttg 5520aatatgccgt aaaaaagaca ttatattttc aatttaggaa caatataact ttaaaattct 5580caacaatcat agtacctctc tatataacag taacaacatc ttgttataac aaactaagtt 5640cttttttaaa ccaactttca ctacaacaaa gataactttt agcggcaata tacatattaa 5700taaagaatac taaagctttt accggcatta gttaatttca ttggatccat tatcgctata 5760gactgtagat acatttacaa aaagtattaa ttaccactaa aaacacatat gtagtggcaa 5820ttttgctatt gctattaatt aattaatgtt ataaatataa tttttaatgt agtgtttcat 5880gttatgttaa agtcatgtag tatatgttct ctacgaataa tatttcacta tatcagacaa 5940aaaatatcta gaataaacaa tgatgttata gaaagatttg acagcaagtc acacaaatat 6000gtacttaaga gtacttattt tagactacaa gttttaaaag tcgatcgtct gttctttctt 6060aaaatacttt tgaaaatgca ggtatcaaat tggtttataa atgctagagt tagactatgg 6120aagccaatgg tagaagaaat gtacatggaa gaagtgaaga aaaacaatca agaacaaaat 6180attgagccta ataacaatga aattgttggt tcaaaatcaa gtgttccaca agagaaatta 6240ccaattagta gcaatattat tcataatgct tctccaaatg atatttctac ttccaccatt 6300tcaacatctc cgacgggtgg cggcggttcg attccggctc agacggttgc aggttagttg 6360gaatataaag aaagtcattt taaaagttgt cgttgtttga cctataatag gttttgagtc 6420gtggaaggca tcactaattt gcataaaggt aggttgtccc cttggggtat ggtcttttca 6480tggagtaacg gtagagttgt ttccactgac ctatataagt tacaggttcg agttgtggaa 6540ttggttgcgt tgttgatgct catgtcgggg tagactgtct acaacacaca ccttgagata 6600caacctttta ttgtacccta catgaatgtg aaatacttca cgcaccaaac tgcctaataa 6660ctcttagaaa agaacacact tgactcacac atctatatat ctacgtagta cctcaattga 6720taaataatct aggatgatta gatggttaca catatcaaac atataatagg ttcaagtcgt 6780agaaggcgtc actaatttgc atcaaggtag gttgtcccct tggggtatga tcctttcatg 6840gaccatgtag acactcttga agttgagtct tgaagtaaca gtaaagtcat ctccacgtga 6900cctatatata taagtcacaa cttcgagttg tggagttggc taggctctca tcaggataga 6960ctgtcgacat cacacttctt gaaatgcaac cttttttcga accttatgtg aatgtgagac 7020tacactcttg actaacatct atataactac tatacctcaa ttaataaaca atctaggata 7080attagatggt ctcacactct aaacacctag gttagatcaa aagacaataa aactagctag 7140agtacatttt tatttattgt aacaagtgtt acttatcaaa gtgtgactct atattgttta 7200actaattaac atgtttaatt tgtctaaaca ggtttctcct tcattaggtc attaaacatg 7260gagaacattg atgatcaaag gaacaacaaa aaggcaagaa atgagatgca aaattgttca 7320actagtacta ttctctcaat ggaaagagaa atcatgaata aagttgtcca agatgagaca 7380atcaaaagtg aaaagttcaa caacacacaa acaagagaat gctattctct aatgactcca 7440aattacacaa tggatgatca atttggaaca aggttcaaca atcaaaatca tgaacaattg 7500gcaacaactt ttcatcaagg aaatggtcat gtttctctta ctctagggct tccaccaaat 7560tctgaaaacc aacacaatta cattggattg gaaaatcatt acaatcaacc tacacatcat 7620ccaaatatta gctatgaaaa cattgatttt cagagtggaa agcgatacgc cactcaacta 7680ttacaagatt ttgtttcttg atgatatata taatttccag gtaaatcaac ttgaaattac 7740atcatgaaag gccttgaata aaagaagggg agttgagatc tagtgatcat atatatatgt 7800ataggtagaa agtttagtta gtatatatag gttatacttc tagtttctta aatggagata 7860caatttttgt tgttgttttt gtattgagat aactagctag cttgggttat ttaaagttgt 7920tgcatgcaac caaagaagaa gaaaaaataa tctatatatg caaactatag tatgttgtaa 7980attttgtgct tcttttaatt agtttcaatt tgcatatatg taaac 80253401DNASolanum tuberosum L. 3gaaatttatg gctatgtact atcaaggagg ctcagaaatc caagctgatg gtctgcagac 60actttatttg atgaacccta actatatagg ctacactgac acacatcatc atcatcatca 120acaccaacaa caatcagcca acatgttttt cttgaattct gtggcggcgg ggaattttcc 180ccacgtgtcc ctccctttgc aagcacatgc gcaggggcac ttggttggag tgcccctgcc 240agctggtttt caagatccta accgcccttc cattcaggaa attccgacct ctcatcatgg 300ccttttatcg cgtttgtgga cttctggtga ccaaaatacc cctagaggtg gtggaggagg 360aggagaagga aatggaagtc aatcacatat accgtcttcc a 40142898DNASolanum tuberosum L. 4ttctttcttt ctttctcctc tctctctctc taaaaagttg agtactttta ttagctctca 60tcacttcaca cagaagaaga tggtattttt atttctttct gctgatggct gcatcaaatg 120atttgaaaag ctgagtcaaa tcagaagaag aaaaagaaag ttataataat aataatgata 180atatcaaaaa tattattttc agattagttg gtgttatttg tttattgtgg agaaaaaata 240aattaaaaag gaagaaaaaa tggcatctta ttttcatgga aattcagaaa tacatgaagg 300aaatgatgga ttacaaactc taatactaat gaatcctgga tatgttggat tttctgaaac 360acaacatcac cacgcgccac cgccgccgcc gccaggtggc agcagcagca acatagtttt 420cttcaactcc aatcctattg gaaattcaat gaacttatct cacgcgccac cacctcctcc 480accgcctcaa caacaattca tcggtatacc cctcgccacc gccgccttca ccgccccatc 540ccaagactcc ggtaacaaca acaacaacga gtcaatctcc gcccttcacg gcttcctagc 600tcgatcgtct cagtacgggt tttacaaccc ggcaaacgac ctcacggcgg cgcgtgacgt 660cacacgcgct catcatcatc atcagcagcc aagggctttc acttacctgt cctcgtccca 720gcagccgggg tttgggaact tcacggcggc gcgtgagctt gtttcttcgc cttcgggttc 780ggcttcagct tcagggatac aacaacaaca acagcaacaa cagagtatta gtagtgtgcc 840tttgagttct aagtacatga aggctgcaca agagctactt gatgaagttg taaatgttgg 900aaaatcaatg aaaagtacta atagtactga tgttgttgtt aataatgatg tcaagaaatc 960gaagaatatg ggcgatatgg acggacagtt agacggagtt ggagcagaca aagacggagc 1020tccaacaact gagctaagta caggggagag acaagaaatt caaatgaaga aagcaaaact 1080tgttaacatg cttgacgagg tggagcagag gtatagacat tatcatcacc aaatgcagtc 1140agtgatacat tggttagagc aagctgctgg cattggatca gcaaaaacat atacagcatt 1200ggctttgcag acgatttcga agcaatttag gtgtcttaag gacgcgataa ttggtcaaat 1260acgatcagca agccagacgt taggcgaaga agatagtttg ggagggaaga ttgaaggttc 1320aaggcttaaa tttgttgata atcagctaag acagcaaagg gctttgcaac aattgggaat 1380gatccagcat aatgcttgga gacctcagag aggattgccc gaacgagctg tttctgttct 1440tcgcgcttgg ctttttgaac atttcctcca tccttatccc aaggattcag acaaaatgat 1500gctagcaaaa caaacaggac taactaggag tcaggtgtcg aattggttca tcaatgctcg 1560agttcgtctt tggaagccaa tggtggaaga gatgtacttg gaagagataa aagaacacga 1620acagaatggg ttgggtcaag aaaagacgag caaattaggt gaacagaacg aagattcaac 1680aacatcaaga tccattgcta cacaagacaa aagccctggt tcagatagcc aaaacaagag 1740ttttgtctca aaacaggaca atcatttgcc tcaacacaac cctgcttcac caatgcccga 1800tgtccaacgc cacttccata cccctatcgg tatgaccatc cgtaatcagt ctgctggttt 1860caacctcatt ggatcaccag agatcgaaag catcaacatt actcaaggga gtccaaagaa 1920accgaggaac aacgagatgt tgcattcacc aaacagcatt ccatccatca acatggatgt 1980aaagcctaac gaggaacaaa tgtcgatgaa gtttggtgat gataggcagg acagagatgg 2040attctcacta atgggaggac cgatgaactt catgggagga ttcggagcct atcccattgg 2100agaaattgct cggtttagca ccgagcaatt ctcagcacca tactcaacca gtggcacagt 2160ttcactcact cttggcctac cacataacga aaacctctca atgtctgcaa cacaccacag 2220tttccttcca attccaacac aaaacatcca aattggaagt gaaccaaatc atgagtttgg 2280tagcttaaac acaccaacat cagctcactc aacatcaagc gtctatgaaa ccttcaacat 2340tcagaacaga aagaggttcg ccgcaccctt gttaccagat tttgttgcct gatcacaaaa 2400acaaaaacag gttttggcaa cagacaaact tctgtcgcta aacaaggaca tgatttagcg 2460acagataact tcagtcgcta acttagcgac tgaaaacttc tgtcgctaag catgaacatg 2520tattagcgac atacagtatg caactgtatg tcactaaaca agaacatgat gaattagtga 2580cggacaactt ctgtcgctaa acaacaaaaa aaaatccatg ttttagtata ttgtttctca 2640ttctatcata tcatggtagt gtaaagaatc aagaaacaag ttttacatag taacagtctt 2700tatacattgg agatgaagaa ccatttaagt tcttcaaaat agatagattt tctaggttac 2760ttctacaaga tatatatatg gttgagggtt tgtatattaa ttttgggatt gttatattgg 2820atgtggaaaa aaagtagtta ttttgggtgg tataaataaa ataatactcc atccatttta 2880gccaaaaaaa aaaaaaaa 289857921DNASolanum tuberosum L. 5tgagaagaaa acccaaagaa acttatgatt tataataaat tattagaaat ttctatggat 60ataaaatggt aaaaagtaag ttttattaaa tataaaaata tgtttttttt aatggaataa 120aaagcaaaaa aaaatcacat aaattagaat aaagatcgga gaaagtaaat tataaataaa 180gacaagatga aaaacaaggc gataatgtaa atcatactaa tcaatcgtta tacatattaa 240aaaatatcca gcgttacaac aacaaattta acaatataat ataataaaat ttaactaaaa 300atcaaaataa aatgacattt atcataacaa taattaacaa ccatccaaat atgatgtatg 360gataaaaggt gaagagtatt agtatctttt gtttaaatct tatatattaa aattataaat 420ttaattatta ttttaaaaat tcttatataa attttaaatt ctgaatttgt ccgacggcta 480atctaaagtc aaaagtaaat tttcataaat gtaggtccta aattttttcc cacaattatc 540ttcttccaag ttgccaacac aaatcaataa tgacaatagg gccctctccc ctatctcttc 600aaccctacct ctctttttct ttctttatca cttcaagttc atatcatatt tcatactctc 660tcattttctt ctggtctccg ttgtaattta tatgatatat tttttaatat ttaaaataat 720ttaattttaa attttttata ctctttaaaa

aattattata atcataagtt ataaaaaaaa 780ttaacttttt tttattcagt caaatactat catataaatt aaaaaagaaa aagtatatgt 840taaatcctta taattattat tgttaaagaa gaaaaaaggg aggttagtgg aagtggacgt 900tacctcgttt ttcatctgtc tgttttttct gacacacctt tgatctttga tgatggatac 960gtcgctccgt tcatatttag gtgatactat attaatttca agagttaaat aatgataaat 1020cacctaagac cgctaatgtt ccatctaatt caagaacaag cccttctcaa tgtcttgcct 1080ttcgcatgtg ttttctttga aattggaatt ccaaccaagt tcccttccca aagcgggaac 1140aagttggtgc gaccgattaa agaagaagga caaagagtta aataatgaaa ttataattat 1200tttatattaa ttattataat ttataatatt ttttaaaaac taaatgttct aatttaaagg 1260caaagtccaa atatttattt tataaatttt gaagcataat tgggttttga ttaattattt 1320atatcaaatt aaatttattt taatacaaat acataattta agacaaagct attgagttaa 1380agttatgtca aattaaatcc gtaactttat aagctcaagg ggagaaagag agaaggattg 1440ttcattcctt ataacgagtc tagagatctc atcctttatc gatgtaaggt tctttccatt 1500catcactccc ttgcgttaga accttttttt tttagactgg agcgtgcaca ttcatggacc 1560attcttccca ttcgtcaatc cctcgtgtta gaatttttat ttctcgaact agagtgtgtg 1620cattaacaga taccagatac cgatattttc accctcattc aagccgtctc tggaagagct 1680atattggatg agcctgactt tgataccata tcaaattaac tcttcaacct aattcataca 1740tcaaaagcta gctcgcctta taagaagtct ttccattcgt cactccctcg tgttacaact 1800tacaagacta gctcaataaa aaattatcgt ccaaatttta taagaagtcc attcatcaat 1860agcacctttc ctatttgtat ttgcacttaa aaaaaaaaag gtgacttttg aaatttgaat 1920tatgccacat aaattatcct tcggtatagc ccaatgattt gaccttggta ctttcatatt 1980ggaggtctca aatttgaaat tccttaccag taaaaataaa aaatttacct tcctgaatcg 2040aacttatcgc gccagacttc cttagacaca caaattagaa taaaaaaagt atattttatt 2100tttatatata agcaaaaaca cacactaact cacattcaca catccacatc tttctttctt 2160tctttctcct ctctctctct ctaaaaagtt gagtactttt attagctctc atcacttcac 2220acagaagaag atggtatttt tatttctttc tgctgatggc tgcatcaaat gatttgaaaa 2280gctgagtcaa atcagaagaa gaaaaagaaa gttataataa taataataat aatatcaaaa 2340atattatttt caggtatggt acttctttac tcattaacaa tgtaaatata gaatttgaag 2400tttacgagct agttttctct tcttttttat tttgactagc agaaacagag tcagagtcag 2460aatttgaagt ttataagtct tgaattctga ttttgtttga gttcttgagt tctgaattga 2520taatttatac atgttgaatg aattttgtaa gtatactttg aaacaaatct attgagttcg 2580attgaattca taaccgacac tttagttccg ccacttttca gaggcggatc cagaatatga 2640aggttatgac ttatgagtat tgtaaccttt tgagttactg aattctaaat taattttata 2700agtgagtaaa tacaaaattt gaaacaaaat tagctattga gttcagttga attcgtataa 2760ccgacactct agctttgtca ctgctcaaag actgatctag aatttgaagt ttatgagttt 2820tgaattctaa attgataatt tctacatgtt agatggaatt tttaagataa atataaatta 2880aaattattga gttcgatcga attcgatttg tgttttcctt tttcttcacc ttatttatca 2940agagaaatta ttttaatttt tttttatcat tactgattca taaatctata tagatatata 3000tagatggata cattagagtt cctaaaaaat gttataaaga gtattttgtt tttccctttc 3060ttgatttttt ttcgaaacta agatttcaat tttatcattt ctgaatttta taacaacgat 3120tatcatagaa ttctaaattt actagttata catatttatt taacgaatta ttaacataaa 3180tgcattattt gaataaaatt tattagattt gaccgaactc gtatatgaac tttctctctc 3240atgtaatttc agccgtaact gtgtgtattt cctttctctc tctaaaaaat ctgttatggt 3300gttctgtgtc actctaacaa aaaataaatt attcttcatt tcttccattg tcagattata 3360atacaccacg tgcacttaca aattttgtga aaaccatatt ttaatttaca aatccttttc 3420ataattcttt tttttaatca agaaaattaa atttaattac attaagtatt ttttacaata 3480atattaacat attactaaat aaattttcag gtttatttta ccatttttgt gattttgaag 3540tgttacaaag tgtgaatggg ttggactttt tggacctcag ctaggtagct tcttgtcttc 3600aacacaaaag gtacatataa aaattacaat aaaattataa ccacttttac ttaggaattt 3660taccatattt aggtaaaaaa aataaatcac tcgcctagtc gtaataatca gtagcagagc 3720tagaggaacg aaaggcttca tctgaatctt ctttatctga aatcatactg tatataaggt 3780caaaattcat tttttatgaa cacttttgat gaaaatcatg tctctgccac taaagtcgta 3840atttgtaggc atcaacaata tgtatatata tatatatata gtgattattg attatatacg 3900gtatatattg gttaaaagtt ttgaaaaata aggattaaag ttaatttcca ttgtgtgttt 3960tcttgggatc aggggcggag ctagataagt gtaaaaaggg tttatctaga cttcttccga 4020ccaaaaatta tacttatata catatacata gtagatactg aatcccttgc ttttttcgta 4080tatgtacttc cgcatatttt aaatttcttt aatgaaaatt ctgactcata tactgtttga 4140atgtttttgt atttaatata tgtatgtttt gcctttttat tttggaaaaa atgatatatg 4200tggacttact tgacttgact ttaacttatt tttttttatt tttcagatta gttggtgtta 4260tttgtttata gtggagaaaa aataaattaa aaaagaagag aaaatggcat cttattttca 4320tggaaattca gaaatacaag aaggaaatga tggattacaa actctaatac taatgaatcc 4380tggatatgtt ggattttctg aaacacaaca tcaccacgcg ccgccgccgc caggtggcag 4440cagcaacaac atagttttct tcaactccaa tcctcttgga aattcaataa acttatctca 4500cgcgccacca cctccgccac cgccacaaca acatttcgtc ggtatacctc tcgccaccgc 4560cgccttcacc gccccatccc aagactccgg taacaacaac aacaacgagt caatctccgc 4620ccttcacggc ttcctagctc gatcgtctca gtacgggttt tacaacccgg ctaacgacat 4680cacggcggcg cgtgaggtca cacgcgctca tcatcagcag cagcaagggc tttcacttag 4740cctgtcctca tcccagcagc ctgggtttgg gaacttcacg gcggcgcgtg agattgtttc 4800ttcgcctacg cgttcggctt cggcttccgg gatacaacaa caacaacagc aacaacaaag 4860tattagtagt gtgcctttga gttctaagta catgaaggct gcacaagagc tacttgatga 4920agttgtaaat gttggaaaat caatgagaag tactaatagt actgaagttg ttgttaataa 4980tgatgtcaag aaatcgaaga ttatgaccga tatggatgga cagatagatg gaggagcaga 5040caaagacgga actccaacaa ctgagctaag taccgcagag aggcaagaaa ttcaaatgaa 5100gaaagcaaaa cttgttaaca tgcttgacga ggtaaccttg ttgtcttttt ctcagtaatg 5160ttgttgcatt cgtgtcagat cagagtctta aaattagtca atagaagaaa cttcatttcc 5220tcgagtacgt gtaattgtgg ccttttcgac ttccaactag tatttacaat agtgcactct 5280acattgataa gcttgacgac aagtaggcaa agcgatggcc ttgttggttg ttatagtttt 5340ttggttatgt tgctcggact ctgcaaaatt attgtcatac tcaagtcaga ttctccaaaa 5400tgcactattt ttggagtatc cgacttgcag tctgacattt attttttccg aagagtctga 5460gcaacatagg ttttcttggc tttccaagat agtaagagaa tggtctctat caaaaaaagt 5520tacatcatat cattactgaa aataagagca aaaaagtatc tgtcaaatga taaagaccag 5580aacttcaaaa ctgttacttt cgtcagggca ctgtcttgac aattgtaaac aaaaaatgaa 5640agaatttttc gaaaataatt tcttcgaaat ctttgatcta aagctaaata tcggttcgat 5700tttgggtgtt gttatatagg tggagcagag gtatagacat tatcatcacc aaatgcagtc 5760agtgatacac tggttggagc aagctgctgg tattggatca gcaagaacat atacagcatt 5820ggctttgcag acgatttcga agcaatttag gtgtcttaag gacgcgataa ttggtcaaat 5880acgatcagca ggcaagacgt taggcgaaga agatagtttg ggagggaaga ttgaaggttc 5940aaggcttaaa tttgttgaca atcagctaag acagcaaagg gctttgcaac aattgggaat 6000gatccagcat aatgcttgga gacctcagag aggattgccc gaacgagctg tttctgttct 6060tcgcgcttgg ctttttgaac atttcctcca tccgtaagca cgaaacaacc ctttttcatc 6120agctatgttg ctcggacttt tcaaaaacgt tgtcgcacca gtgttggatc ctcgcagaat 6180gcattgattt tttgaggatc cgacacatac ctgacgatat ttttgaagag tctgaacaac 6240atagcttagt taaaagtact gtattttgat atattgtggc aatttgtttt gtatagctat 6300cccaaggatt cagacaaaat gatgctagca aaacaaacag ggctaactag gagtcaggtc 6360agtgatatct gataacaaca ttgtcatttt tgattctcga gttgatttct cagatggtca 6420cttaactgta gttattatat cagaaagtcg ccttacttca acaaagagag tgacattctg 6480agataataac tgtgagttga gtgaccatct gagaaatcaa ctcttggatt ctccgttttt 6540ggtttttact aagttttgtt tttggacaat tcaggtgtcg aattggttca tcaatgctcg 6600agttcgtctt tggaagccaa tggtggaaga gatgtacttg gaagagataa aagaacagaa 6660cggattgggt caagaaaaga cgagcaaatt aggcgaacag aacgaagatt caacaacatc 6720aagatccatt gctacacaag acaaaagccc tggttcagat agccaaaaca agagttttgt 6780ctcaaaacag gacaatcatt tgccccaaca caaccctgct tcaccaatgc cgatgtccaa 6840caccacttcc atacctccta tcggtatgaa catccgtaat cagtctgctg gtttcaacct 6900cattggatca ccagagatcg aaagcatcaa cattactcaa gggagtccaa agaaaccaag 6960gaacaacgag atgttgcatt caccaaacag cattccatcc atcaacattg atgtaaagcc 7020taacgagcaa caaatgtcga tgaagtttgg tgatgatagg caagacagag atggattctc 7080actaatggga ggaccgatga acttcatggg aggattcgga gcctatccca ttggagaaat 7140tgctcggttt agcaccgagc aattctcagc accatactca accagtggca cagtttcact 7200cactcttggc ctaccacata acgaaaacct ctcaatgtca gcaacacacc acagtttcct 7260tccaattcca acacaaaaca tccaaattgg aagtgaacca aatcatgagt ttggtagctt 7320aaacacacca acatcagctc actcaacatc aagcgtctac gaaaatttca acattcagaa 7380cagaaagagg ttcgccgcac ccttgttacc agattttgtt gcctgatcac aaaaacaaaa 7440acaggattta gcgacagaca aacttctgtc gctaaacaag aacatgattt agcgacagat 7500aacttcagtc gctaacttag cgactgaaaa cttctgtcgc taaacatgaa catgtattag 7560cgacatacag tatacaactg tatgtcgcta aacaagaaca tgatgaatta gtgacggaca 7620acttctgtcg ctaaacaaca aaaaaagatc catgttttag tatattgttt ctcattctat 7680catatcatgg tagtgtaaag aatcaagaaa caagttttac atagttacat agtctttata 7740cattggagat gaagaaccat ttaagttctt caaaatagat agattttcta ggttacttct 7800agaagatata tatatggttg agggtttgta tattaatttt gggattgtta tattggatgt 7860ggaaaaaaag tagttatttt gggtggtata aataaaataa tactccatcc attttagcca 7920a 79216799DNASolanum tuberosum L. 6gtgttatttg tttattgtgg agaaaaaata aattaaaaag gaagaaaaaa tggcatctta 60ttttcatgga aattcagaaa tacatgaagg aaatgatgga ttacaaactc taatactaat 120gaatcctgga tatgttggat tttctgaaac acaacatcac cacgcgccac cgccgccgcc 180gccaggtggc agcagcagca acatagtttt cttcaactcc aatcctattg gaaattcaat 240gaacttatct cacgcgccac cacctcctcc accgcctcaa caacaattca tcggtatacc 300cctcgccacc gccgccttca ccgccccatc ccaagactcc ggtaacaaca acaacaacga 360gtcaatctcc gcccttcacg gcttcctagc tcgatcgtct cagtacgggt tttacaaccc 420ggcaaacgac ctcacggcgg cgcgtgacgt cacacgcgct catcatcatc atcagcagcc 480aagggctttc acttacctgt cctcgtccca gcagccgggg tttgggaact tcacggcggc 540gcgtgagctt gtttcttcgc cttcgggttc ggcttcagct tcagggatac aacaacaaca 600acagcaacaa cagagtatta gtagtgtgcc tttgagttct aagtacatga aggctgcaca 660agagctactt gatgaagttg taaatgttgg aaaatcaatg aaaagtacta atagtactga 720tgttgttgtt aataatgatg tcaagaaatc gaagaatatg ggcgatatgg acggacagtt 780agacggagtt ggagcagac 79972735DNASolanum tuberosum L. 7catgcagaga taaaaatata gatcagtctg acaagaaggc aacttctcaa agcttagaga 60gctaccaccc gaagatagac agttagttac atgtactgtt atagataaaa ggagaaatcc 120gaagaagaaa gaattttttt tgcagatatg tactatcaag gaacctcgga taatactaat 180atacaagctg atcatcaaca acgtcataat catgggaata gtaataataa taatattcag 240acactttatt tgatgaaccc taacaattat atgcaaggct acactacttc tgacacacag 300cagcagcagc agttactttt cctgaattct tcaccagcag caagcaacgc gctttgccat 360gcgaatatac aacacgcgcc gctgcaacag cagcactttg tcggtgtgcc tcttccggca 420gtaagtttgc acgatcagat caatcatcat ggacttttac agcgcatgtg gaacaaccaa 480gatcaatctc agcaggtgat agtaccatcg tcgacggggg tttctgccac gtcatgtggc 540gggatcacca cggacttggc gtctcaattg gcgtttcaga ggccgattcc gacaccacaa 600caccgacagc agcaacaaca gcaaggcggt ctatctctaa gcctttctcc tcagctacaa 660cagcaaatta gtttcaataa caatatttca tcctcatcac caaggacaaa taatgttact 720attaggggaa cattagatgg aagttctagc aacatggttt taggctctaa gtatctgaaa 780gctgcacaag agcttcttga tgaagttgtt aatattgttg gaaaaagcat caaaggagat 840gatcaaaaga aggataattc aatgaataaa gaatcaatgc ctttggctag tgatgtcaac 900actaatagtt ctggtggtgg tgaaagtagc agcaggcaga aaaatgaagt tgctgttgag 960cttacaactg ctcaaagaca agaacttcaa atgaaaaaag ccaagcttct tgccatgctt 1020gaagaggtgg agcaaaggta cagacagtac catcaccaaa tgcaaataat tgtattatca 1080tttgagcaag tagcaggaat tggatcagcc aaatcataca ctcaattagc tttgcatgca 1140atttcgaagc aattcagatg cctaaaggat gcaattgctg agcaagtaaa ggcgacgagc 1200aagagtttag gtgaagagga aggcttggga gggaaaatcg aaggctcaag actcaaattt 1260gtggaccatc atctaaggca acaacgcgcg ctgcaacaga taggaatgat gcaaccaaat 1320gcttggagac cccaaagagg tttacctgaa agagctgtct ctgtccttcg tgcttggctt 1380ttcgagcatt ttcttcatcc ttacccaaag gattcagaca aaatcatgct tgctaagcaa 1440acggggctaa caaggagcca ggtgtctaac tggttcataa atgctcgagt tcgattatgg 1500aagccaatgg tagaagaaat gtacttggaa gaagtgaaga atcaagaaca aaacagtact 1560aatacttcag gagataacaa aaacaaagag accaatataa gtgctccaaa tgaagagaaa 1620catccaatta ttactagcag cttattacaa gatggtatta ctactactca agcagaaatt 1680tctacctcaa ctatttcaac ttcccctact gcaggtgctt cacttcatca tgctcacaat 1740ttctccttcc ttggttcatt caacatggat aatactacta ctactgttga tcatattgaa 1800aacaacgcga aaaagcaaag aaatgacatg cacaagtttt ctccaagtag tattctttca 1860tctgttgaca tggaagccaa agctagagaa tcatcaaata aagggtttac taatccttta 1920atggcagcat acgcgatggg agattttgga aggtttgatc ctcatgatca acaaatgacc 1980gcgaattttc atggaaataa tggtgtctct cttactttag gacttcctcc ttctgaaaac 2040ctagccatgc cagtgagcca acaaaattac ctttctaatg acttgggaag taggtctgaa 2100atggggagtc attacaatag aatgggatat gaaaacattg attttcagag tgggaataag 2160cgatttccga ctcaactatt accagatttt gttacaggta atctaggaac atgaatacca 2220gaaagtctcg tattgatagc tgaaaagata aaaggaagtt agggatactc ttatattgtg 2280tgaggccttc tggcccaagt cggaggaccc aatttgatac aacctatcat aggagaaaag 2340aagtggagac taaattaaag taacaaaatt ttaaagcaca ctttctagta tatatacttc 2400ttttttttat agtatagaaa agaagagatt ttgtgcttta gtgtatagat agagtctact 2460tagtataggt tatacttcta gttccttgag aagattgata caactagtag tatttttttt 2520cttttgggtt ggcttggagt actattttaa gttattggaa actagctata gtaaatgttg 2580taaagttgtg atattgttcc tctcaatttg catataattt gaaatatttt gtacctacta 2640gctagtctct aaattatgtt tccattgctt gtaattgcaa ttttatttga attttgtgct 2700atcattatta gattagcaaa aaaaaaaaaa aaaaa 273584015DNASolanum tuberosum L. 8gtaggtacaa aatatttcaa attatatgca aattgagagg aacaatatca caactttaca 60acatatacta tagctagttt ccatattaac ttaaaatagt actccaagcc aacccagaaa 120gaaaaaaaat actactagtt gtatcaatct tctcaaggaa ctagaagtat aacctatact 180aagtagactc tatctataca ctaaagcaca aaatctcttc ttttctatac tataaaaaaa 240agaagtatat atactagaaa gtgtgcttta aaattttgtt actttaattt tgtctccact 300tcttttctcc tatgataggt tgtatcaaat tgggtcctcc gacttgggcc agaaggcctc 360acacaatata agagtatccc taacttcctt ttatcttttc agctatcaat acgagacttt 420ctggtattca tgttcctaga ttacctgtaa caaaatctgg taatagttga gtcggaaatc 480gcttattccc actctgaaaa tcaatgtttt catatcccat tctattgtaa tgactcccca 540tttcaggcct acttcccaag tcattagaaa ggtaattttg ttggctcact ggcatggcta 600ggttttcaga aggaggaagt cctaaagtaa gagagacacc attatttcca tgaaaattcg 660cggtgatttg ttgatcatga ggatcaaacc ttccaaaatc tcccatcgcg tatgctgcca 720ttaaaggatt agtaaaccct ttatttgatg attctctagc tttggcttcc atgtcaacag 780atgaaagaat actacttgga gaaaacttgt gcatgtcatt tctttgcttt ttcgcgttgt 840tttcaatatg atcaacagta gtagtagtag tattatccat gttgaatgaa ccaaggaagg 900agaaattgtg agcatgatga agtgaagcac ctgcagtagg ggaagttgaa atagttgagg 960tagaaatttc tgcttgagta gtagtaatac catcttgtaa taagctgcta gtaataattg 1020gatgtttctc ttcatttgga gcctctttgt ttttgttatc tcctgaagta ttagtactgt 1080tttgttcttg attcttcact tcttccaagt acatttcttc taccattggc ttccataatc 1140gaactcgagc atttatgaac cagttagaga cctgcatttt catatatatt aagaattttt 1200ttataaagaa aagaaaggaa ttaatccaag aattatagta aaatgtgtgt ctaagaacct 1260ggctccttgt tagccccgtt tgcttagcaa gcatgatttt gtctgaatcc tttgggtaac 1320tgcaatataa aaatatatta agaaaaaaaa aattatagtt aaaaacatac tcctatatta 1380gagaagaatg ggcgaattca gaatttagaa taataatgtg atcttattat atacatgaac 1440atattttatt ttttgtgtgt atgcatatat agtttgagtt aaaagtaagt gtctttttaa 1500ccgtccaaac gaaagtttca aaataactgg cgttgctcta aaaatcactt aatttgttcc 1560taatggatgg acatgttaaa accatataaa agacacttag taaaatatag gacgacaggc 1620gtatatatga cgcaaaaatt ggttagaata atcaattttc tatctactac tccgtagata 1680tttttcacat tgttaaattt ttcaaagaaa taaatagttt aggagtactc acggatgaag 1740aaaatgctcg aaaagccaag cacgaaggac agagacagct ctttcaggta aacctctttg 1800gggtctccaa gcatttggtt gcatcattcc tagctgttgc agcgcgcgtt gttgccttag 1860atgatggtcc acaaatttga gtcttgagcc ttcgattttc cctactaagc cttcctcttc 1920acctaaactc ttgctcgtcg cctttacttg ctcagcaatt gcatccttta ggcatctgaa 1980ttgcttcgaa attgcatgca aagctaattg agtgtatgat ttggctgaac caattcctgc 2040tacttgctca aatgatgata caattatttg catttggtga tggtactgtc tgtacctttg 2100ctccacctga acaaaaaaaa gggagtaata ttaaactttt accagtctgt cgttttacaa 2160catgaagtta tcttatgttg gctactattg aaattaaaga attttatttc agttaaaaga 2220tcatatatat atatatatat atattccaag tgagaaataa attgagtagt atattttgca 2280aaattttgta aaccaacgaa tttttgagag tcattagatt gaggacacat ctgagtggac 2340attatgcgtg gtgtaaaaaa ggtgaataag agatagtggt ttgaattttg gtgcagcgga 2400agacatttca ggttcgtagc taactttggt gtattatctt tatagcttta gttggacccg 2460cagaagaaaa tttaagagcc acacattgtc agtttgtttt aatatcaacg tacgtgattg 2520gtctcttgtt cttcaactaa ttaacaaaac ctgtacattt catttaccaa ctactattgt 2580tgcaaacata tataaatcaa cagtttcatc cattcaattt tttatgagaa aaattacagt 2640tttgaatcat ttgaaaataa aattttaaat atatatgtcg aattcagtag ttttagtgtt 2700aagaatccga aattcataga ctcaaaattc aggatcatac ctcttcaagc atggcaagaa 2760gcttggcttt tttcatttga agttcttgtc tttgagcagt tgtaagctca atagcaactt 2820catttttctg cctgctgcta ctttcaccac caccaccacc accagaacta ttagtgttga 2880catcactagc caaaggcatt gaattatcct tcttttgatc atctcctttg atgctttttc 2940caacaatatt aacaacttca tcaagaagct cttgtgcagc tttcagatac ttagagccta 3000aaaccatgtt gctagaactt ccatctaatg ttcctctaat agtaacatta tttgtccttg 3060gtgatgagga tgaaatattg ttattgaaac taatttgctg ttgttgctga ggagaaaggc 3120ttagagatag accgccttgc tgttgttgct gctgctgtcg gtgttgtggt gtcggaatcg 3180gcctctgaaa cgccaattga gacgccaagt ccgtggtgat cccgccacat gacgtggcag 3240aaacccccgt cgacgatggt actatcacct gctgagattg atcttggttg ttccacatac 3300gctgtaaaag tccatgatga ttgatctgat cgtgcaaact tactgccgga agaggcacac 3360cgacaaagtg ctgctgttgc agcggcgcgt gttgtatatt cgcatggcaa agcgcgttgc 3420ttcctgctgg tgaagaattc aggaaaagta actgctgctg ctgctgtgtg tcagaagtag 3480tgtagccttg catataattg ttagggttca tcaaataaag cgtctgaata ttattattat 3540tactactatt cccatgatta tgatgttgtt gatgatcagc ttgtatatta ttatccgagg 3600ttccttgata gtacatatct gcaaaaaaaa atctttcttc ttcgaatttc tccttttatc 3660tacaacagta cctgtaaaca gaaagtaaca aaggagaaaa ggcttcaaat aagtccacac 3720aaacattttt ataagtaaac ggaagggaat tctttatagt gaaaaattaa attttgttta 3780cagagatctt caactataaa taaaaaaaac aggaaaatga tataaaagaa agagaaagag 3840atgaaaggag ctttagcaaa aaaatcagtc actcacacat acacacatgt aactaactgt 3900ctatcttcgg gtggtagctc tctaagcttt gagaagttgc cttcttgtca gactgatcta 3960tatttttctc tctgcattct catctcttca accacaaaaa ggaaatatga ataaa 4015929DNAArtificialSolanum tuberosum L. 9rmrbcatcta gagtaggggg ggaggcacc 291036DNAArtificialSolanum

tuberosum L. 10rmrbrgagag ctcgaagcac aaaatttaca atatac 361133DNAArtificialSolanum tuberosum L. 11rmrbacatct agattagctc tcatcacttc aca 331232DNAArtificialSolanum tuberosum L. 12rmrbragagg tacctaccac ccaaaatact ac 321337DNAArtificialSolanum tuberosum L. 13rmrstbasga gctcgaaatt tatggctatg tactatc 371436DNAArtificialSolanum tuberosum L. 14rmrstbasrt ctagagtgga agacggtata tgtgat 361537DNAArtificialSolanum tuberosum L. 15rmrstbasga gctcgtgtta tttgtttatt gtggaga 371635DNAArtificialSolanum tuberosum L. 16rmrstbasrt ctagagtctg ctccaactcc gtcta 351734DNAArtificialSolanum tuberosum L. 17rmrbtataag cttaactaac taactaactg tccc 341834DNAArtificialSolanum tuberosum L. 18rmrbrgagtc tagaactcca caacacataa aggg 341934DNAArtificialSolanum tuberosum L. 19rmrbcacaag ctttgagaag aaaaccaaag aaac 342035DNAArtificialSolanum tuberosum L. 20rmrbraacgg atccagatgt ggatgtgtga atgtg 352148DNAArtificialSolanum tuberosum L. 21rmrgasbtat attatatccc gggtttaaga aaatctctca ctttctct 482249DNAArtificialSolanum tuberosum L. 22rmrgasbrta tattatatga gctcgtttac atatatgcaa attgaaaca 492348DNAArtificialSolanum tuberosum L. 23rmrgasbtat attatatccc gggttctttc tttctttctc ctctctct 482449DNAArtificialSolanum tuberosum L. 24rmrgasbrta tattatatga tatcggctaa aatggatgga gtattattt 492525DNAArtificialSolanum tuberosum L. 25rmraggacac tagcaaaact ttagg 252625DNAArtificialSolanum tuberosum L. 26rmrrctttga ggcttccatg cattg 252723DNAArtificialSolanum tuberosum L. 27rmrcatttgc ctcaacacaa ccc 232825DNAArtificialSolanum tuberosum L. 28rmrrtgatgc tttcgatctc tggtg 252926DNAArtificialSolanum tuberosum L. 29rmrgadhgaa ggactggaga ggtgga 263029DNAArtificialSolanum tuberosum L. 30rmrgadhrga caacagaaac atcagcagt 293127DNAArtificialSolanum tuberosum L.misc_feature(4)..(4)n is a, c, g, or t 31rmrntgcggg actctaatca taaaaac 273228DNAArtificialSolanum tuberosum L. 32rmrgsgstgg aaacggcaga gaaggtac 283328DNAArtificialSolanum tuberosum L. 33rmrgsattag tgacggacaa cttctgtc 283431DNAArtificialSolanum tuberosum L. 34rmrgsgtaaa tcagcttgaa attacatcat g 313536DNAArtificialSolanum tuberosum L. 35rmrstbasrt ctagagtgga agacggtata tgtgat 363630DNAArtificialSolanum tuberosum L. 36rmrstbasrc agaaaatcca acatatccag 303731DNAArtificialSolanum tuberosum L.misc_feature(4)..(4)n is a, c, g, or t 37rmrnstrscr gcaacaggat tcaatcttaa g 313825DNAArtificialSolanum tuberosum L.misc_feature(6)..(6)n is a, c, g, or t 38rmrkanrgga ttgcacgcag gttct 253927DNAArtificialSolanum tuberosum L.misc_feature(6)..(6)n is a, c, g, or t 39rmrkanrrcg tcaagaaggc gatagaa 274035DNAArtificialSolanum tuberosum L. 40rmrbmrtgsc tatatatgca aactatagta tgttg 354136DNAArtificialSolanum tuberosum L. 41rmrbmrtgsc ttctagaaga tatatatatg gttgag 364239DNAArtificialSolanum tuberosum L.misc_feature(4)..(4)n is a, c, g, or t 42rmrntrvctr sccgcaacag gattcaatct taagaaact 394330DNAArtificialSolanum tuberosum L. 43rmrstactrt ggaaaagctt gcctatgtgg 304430DNAArtificialSolanum tuberosum L. 44rmrstactrt rctgctcctg gcagtttcaa 304528DNAArtificialSolanum tuberosum L.misc_feature(6)..(6)n is a, c, g, or t 45rmrstnrttc atctaaaggg ccaacacc 284629DNAArtificialSolanum tuberosum L.misc_feature(6)..(6)n is a, c, g, or t 46rmrstnrtrg ttgtatagct ccccgctca 294734DNAArtificialSolanum tuberosum L. 47rmrstgartt tctctacaat gagttcacat ggtc 344833DNAArtificialSolanum tuberosum L. 48rmrstgartr gggacaacct attatcacca agc 334932DNAArtificialSolanum tuberosum L. 49rmrstaartc tgatcttcga tcaatttcat gg 325032DNAArtificialSolanum tuberosum L. 50rmrstaartr gacctattgc tgccttgtgc ta 3251700PRTArtificialSolanum tuberosum L. 51Ser Leu Ala Asn Met Thr Asx Glu Arg Ser Met Leu Met Tyr Tyr Gln1 5 10 15Gly Thr Ser Asp Asn Thr Asn Ile Gln Ala Asp His Gln Gln Arg His 20 25 30Asn His Gly Asn Ser Asn Asn Asn Asn Ile Gln Thr Leu Tyr Leu Met 35 40 45Asn Pro Asn Asn Tyr Met Gln Gly Tyr Thr Thr Ser Asp Thr Gln Gln 50 55 60Gln Gln Gln Leu Leu Phe Leu Asn Ser Ser Pro Ala Ala Ser Asn Ala65 70 75 80Leu Cys His Ala Asn Ile Gln His Ala Pro Leu Gln Gln Gln His Phe 85 90 95Val Gly Val Pro Leu Pro Ala Val Ser Leu His Asp Gln Ile Asn His 100 105 110His Gly Leu Leu Gln Arg Met Trp Asn Asn Gln Asp Gln Ser Gln Gln 115 120 125Val Ile Val Pro Ser Ser Thr Gly Val Ser Ala Thr Ser Cys Gly Gly 130 135 140Ile Thr Thr Asp Leu Ala Ser Gln Leu Ala Phe Gln Arg Pro Ile Pro145 150 155 160Thr Pro Gln His Arg Gln Gln Gln Gln Gln Gln Gly Gly Leu Ser Leu 165 170 175Ser Leu Ser Pro Gln Leu Gln Gln Gln Ile Ser Phe Asn Asn Asn Ile 180 185 190Ser Ser Ser Ser Pro Arg Thr Asn Asn Val Thr Ile Arg Gly Thr Leu 195 200 205Asp Gly Ser Ser Ser Asn Met Val Leu Gly Ser Lys Tyr Leu Lys Ala 210 215 220Ala Gln Glu Leu Leu Asp Glu Val Val Asn Ile Val Gly Lys Ser Ile225 230 235 240Lys Gly Asp Asp Gln Lys Lys Asp Asn Ser Met Asn Lys Glu Ser Met 245 250 255Pro Leu Ala Ser Asp Val Asn Thr Asn Ser Ser Gly Gly Gly Glu Ser 260 265 270Ser Ser Arg Gln Lys Asn Glu Val Ala Val Glu Leu Thr Thr Ala Gln 275 280 285Arg Gln Glu Leu Gln Met Lys Lys Ala Lys Leu Leu Ala Met Leu Glu 290 295 300Glu Val Glu Gln Arg Tyr Arg Gln Tyr His His Gln Met Gln Ile Ile305 310 315 320Val Leu Ser Phe Glu Gln Val Ala Gly Ile Gly Ser Ala Lys Ser Tyr 325 330 335Thr Gln Leu Ala Leu His Ala Ile Ser Lys Gln Phe Arg Cys Leu Lys 340 345 350Asp Ala Ile Ala Glu Gln Val Lys Ala Thr Ser Lys Ser Leu Gly Glu 355 360 365Glu Glu Gly Leu Gly Gly Lys Ile Glu Gly Ser Arg Leu Lys Phe Val 370 375 380Asp His His Leu Arg Gln Gln Arg Ala Leu Gln Gln Ile Gly Met Met385 390 395 400Gln Pro Asn Ala Trp Arg Pro Gln Arg Gly Leu Pro Glu Arg Ala Val 405 410 415Ser Val Leu Arg Ala Trp Leu Phe Glu His Phe Leu His Pro Tyr Pro 420 425 430Lys Asp Ser Asp Lys Ile Met Leu Ala Lys Gln Thr Gly Leu Thr Arg 435 440 445Ser Gln Val Ser Asn Trp Phe Ile Asn Ala Arg Val Arg Leu Trp Lys 450 455 460Pro Met Val Glu Glu Met Tyr Leu Glu Glu Val Lys Asn Gln Glu Gln465 470 475 480Asn Ser Thr Asn Thr Ser Gly Asp Asn Lys Asn Lys Glu Thr Asn Ile 485 490 495Ser Ala Pro Asn Glu Glu Lys His Pro Ile Ile Thr Ser Ser Leu Leu 500 505 510Gln Asp Gly Ile Thr Thr Thr Gln Ala Glu Ile Ser Thr Ser Thr Ile 515 520 525Ser Thr Ser Pro Thr Ala Gly Ala Ser Leu His His Ala His Asn Phe 530 535 540Ser Phe Leu Gly Ser Phe Asn Met Asp Asn Thr Thr Thr Thr Val Asp545 550 555 560His Ile Glu Asn Asn Ala Lys Lys Gln Arg Asn Asp Met His Lys Gly 565 570 575Ser Pro Ser Ser Ile Leu Ser Ser Val Asp Met Glu Ala Lys Ala Arg 580 585 590Glu Ser Ser Asn Lys Gly Phe Thr Asn Pro Leu Met Ala Ala Tyr Ala 595 600 605Met Gly Asp Phe Gly Arg Phe Asp Pro His Asp Gln Gln Met Thr Ala 610 615 620Asn Phe His Gly Asn Asn Gly Val Ser Leu Thr Leu Gly Leu Pro Pro625 630 635 640Ser Glu Asn Leu Ala Met Pro Val Ser Gln Gln Asn Tyr Leu Ser Asn 645 650 655Asp Leu Gly Ser Arg Ser Glu Met Gly Ser His Tyr Asn Arg Met Gly 660 665 670Tyr Glu Asn Ile Asp Phe Gln Ser Gly Asn Lys Arg Phe Pro Thr Gln 675 680 685Leu Leu Pro Asp Phe Val Thr Gly Asn Leu Gly Thr 690 695 70052721PRTArtificialSolanum tuberosum L. 52Ser Leu Ala Asn Met Thr Asx Glu Arg Ser Met Leu Met Ala Met Tyr1 5 10 15Tyr Gln Gly Gly Ser Glu Ile Gln Ala Asp Gly Leu Gln Thr Leu Tyr 20 25 30Leu Met Asn Pro Asn Tyr Ile Gly Tyr Thr Asp Thr His His His His 35 40 45His Gln His Gln Gln Gln Ser Ala Asn Met Phe Phe Leu Asn Ser Val 50 55 60Ala Ala Gly Asn Phe Pro His Val Ser Leu Pro Leu Gln Ala His Ala65 70 75 80Gln Gly His Leu Val Gly Val Pro Leu Pro Ala Gly Phe Gln Asp Pro 85 90 95Asn Arg Pro Ser Ile Gln Glu Ile Pro Thr Ser His His Gly Leu Ile 100 105 110Ser Arg Leu Trp Thr Ser Gly Asp Gln Asn Thr Pro Arg Gly Gly Gly 115 120 125Gly Gly Gly Glu Gly Asn Gly Ser Gln Ser His Ile Pro Ser Ser Thr 130 135 140Val Val Ser Pro Asn Ser Gly Ser Gly Gly Gly Thr Thr Thr Asp Phe145 150 155 160Ala Ser Gln Leu Gly Phe Gln Arg Pro Gly Leu Val Ser Pro Thr Gln 165 170 175Ala His His Gln Gly Leu Ser Leu Ser Leu Ser Pro Gln Gln Gln Met 180 185 190Asn Phe Arg Ser Ser Leu Pro Leu Asp His Arg Asp Ile Ser Thr Thr 195 200 205Asn His Gln Val Gly Ile Leu Ser Ser Ser Pro Leu Pro Ser Pro Gly 210 215 220Thr Asn Thr Asn His Thr Arg Gly Leu Gly Ala Ser Ser Ser Phe Ser225 230 235 240Ile Ser Asn Gly Met Ile Leu Gly Ser Lys Tyr Leu Lys Val Ala Gln 245 250 255Asp Leu Leu Asp Glu Val Val Asn Val Gly Lys Asn Ile Lys Leu Ser 260 265 270Glu Val Gly Ala Lys Glu Lys His Lys Leu Asp Asn Glu Leu Ile Ser 275 280 285Leu Ala Ser Asp Asp Val Glu Ser Ser Ser Gln Lys Asn Ser Gly Val 290 295 300Glu Leu Thr Thr Ala Gln Arg Gln Glu Leu Gln Met Lys Lys Ala Lys305 310 315 320Leu Val Ser Met Leu Asp Glu Val Asp Gln Arg Tyr Arg Gln Tyr His 325 330 335His Gln Met Gln Met Ile Ala Thr Ser Phe Glu Gln Thr Thr Gly Ile 340 345 350Gly Ser Ser Lys Ser Tyr Thr Gln Leu Ala Leu His Thr Ile Ser Lys 355 360 365Gln Phe Arg Cys Leu Lys Asp Ala Ile Ser Gly Gln Ile Lys Asp Thr 370 375 380Ser Lys Thr Leu Gly Glu Glu Glu Asn Ile Gly Gly Lys Ile Glu Gly385 390 395 400Ser Lys Leu Lys Phe Val Asp His His Leu Arg Gln Gln Arg Ala Leu 405 410 415Gln Gln Leu Gly Met Met Gln Thr Asn Ala Trp Arg Pro Gln Arg Gly 420 425 430Leu Pro Glu Arg Ala Val Ser Val Leu Arg Ala Trp Leu Phe Glu His 435 440 445Phe Leu His Pro Tyr Pro Lys Asp Ser Asp Lys Ile Met Leu Ala Lys 450 455 460Gln Thr Gly Leu Thr Arg Ser Gln Val Ser Asn Trp Phe Ile Asn Ala465 470 475 480Arg Val Arg Leu Trp Lys Pro Met Val Glu Glu Met Tyr Met Glu Glu 485 490 495Val Lys Lys Asn Asn Gln Glu Gln Asn Ile Glu Pro Asn Asn Asn Glu 500 505 510Ile Val Gly Ser Lys Ser Ser Val Pro Gln Glu Lys Leu Pro Ile Ser 515 520 525Ser Asn Ile Ile His Asn Ala Ser Pro Asn Asp Ile Ser Thr Ser Thr 530 535 540Ile Ser Thr Ser Pro Thr Gly Gly Gly Gly Ser Ile Pro Ala Gln Thr545 550 555 560Val Ala Gly Phe Ser Phe Ile Arg Ser Leu Asn Met Glu Asn Ile Asp 565 570 575Asp Gln Arg Asn Asn Lys Lys Ala Arg Asn Glu Met Gln Asn Cys Ser 580 585 590Thr Ser Thr Ile Leu Ser Met Glu Arg Glu Ile Met Asn Lys Val Val 595 600 605Gln Asp Glu Thr Ile Lys Ser Glu Lys Phe Asn Asn Thr Gln Thr Arg 610 615 620Glu Cys Tyr Ser Leu Met Thr Pro Asn Tyr Thr Met Asp Asp Gln Phe625 630 635 640Gly Thr Arg Phe Asn Asn Gln Asn His Glu Gln Leu Ala Thr Thr Thr 645 650 655Thr Thr Phe His Gln Gly Asn Gly His Val Ser Leu Thr Leu Gly Leu 660 665 670Pro Pro Asn Ser Glu Asn Gln His Asn Tyr Ile Gly Leu Glu Asn His 675 680 685Tyr Asn Gln Pro Thr His His Pro Asn Ile Ser Tyr Glu Asn Ile Asp 690 695 700Phe Gln Ser Gly Lys Arg Tyr Ala Thr Gln Leu Ile Gln Asp Phe Val705 710 715 720Ser53722PRTArtificialSolanum tuberosum L. 53Ser Leu Ala Asn Met Thr Asx Glu Arg Ser Met Leu Met Ala Ser Tyr1 5 10 15Phe His Gly Asn Ser Glu Ile His Glu Gly Asn Asp Gly Leu Gln Thr 20 25 30Leu Ile Leu Met Asn Pro Gly Tyr Val Gly Phe Ser Glu Thr Gln His 35 40 45His His Ala Pro Pro Pro Pro Pro Pro Gly Gly Ser Ser Ser Asn Ile 50 55 60Val Phe Phe Asn Ser Asn Pro Ile Gly Asn Ser Met Asn Leu Ser His65 70 75 80Ala Pro Pro Pro Pro Pro Pro Pro Gln Gln Gln Phe Ile Gly Ile Pro 85 90 95Leu Ala Thr Ala Ala Phe Thr Ala Pro Ser Gln Asp Ser Gly Asn Asn 100 105 110Asn Asn Asn Glu Ser Ile Ser Ala Leu His Gly Phe Leu Ala Arg Ser 115 120 125Ser Gln Tyr Gly Phe Tyr Asn Pro Ala Asn Asp Leu Thr Ala Ala Arg 130 135 140Asp Val Thr Arg Ala His His His His Gln Gln Pro Arg Ala Phe Thr145 150 155 160Tyr Leu Ser Ser Ser Gln Gln Pro Gly Phe Gly Asn Phe Thr Ala Ala 165 170 175Arg Glu Leu Val Ser Ser Pro Ser Gly Ser Ala Ser Ala Ser Gly Ile 180 185 190Gln Gln Gln Gln Gln Gln Gln Gln Ser Ile Ser Ser Val Pro Leu Ser 195 200 205Ser Lys Tyr Met Lys Ala Ala Gln Glu Leu Leu Asp Glu Val Val Asn 210 215 220Val Gly Lys Ser Met Lys Ser Thr Asn Ser Thr Asp Val Val Val Asn225 230 235 240Asn Asp Val Lys Lys Ser Lys Asn Met Gly Asp Met Asp Gly Gln Leu 245 250 255Asp Gly Val Gly Ala Asp Lys Asp Gly Ala Pro Thr Thr Glu Leu Ser 260

265 270Thr Gly Glu Arg Gln Glu Ile Gln Met Lys Lys Ala Lys Leu Val Asn 275 280 285Met Leu Asp Glu Val Glu Gln Arg Tyr Arg His Tyr His His Gln Met 290 295 300Gln Ser Val Ile His Trp Leu Glu Gln Ala Ala Gly Ile Gly Ser Ala305 310 315 320Lys Thr Tyr Thr Ala Leu Ala Leu Gln Thr Ile Ser Lys Gln Phe Arg 325 330 335Cys Leu Lys Asp Ala Ile Ile Gly Gln Ile Arg Ser Ala Ser Gln Thr 340 345 350Leu Gly Glu Glu Asp Ser Leu Gly Gly Lys Ile Glu Gly Ser Arg Leu 355 360 365Lys Phe Val Asp Asn Gln Leu Arg Gln Gln Arg Ala Leu Gln Gln Leu 370 375 380Gly Met Ile Gln His Asn Ala Trp Arg Pro Gln Arg Gly Leu Pro Glu385 390 395 400Arg Ala Val Ser Val Leu Arg Ala Trp Leu Phe Glu His Phe Leu His 405 410 415Pro Tyr Pro Lys Asp Ser Asp Lys Met Met Leu Ala Lys Gln Thr Gly 420 425 430Leu Thr Arg Ser Gln Val Ser Asn Trp Phe Ile Asn Ala Arg Val Arg 435 440 445Leu Trp Lys Pro Met Val Glu Glu Met Tyr Leu Glu Glu Ile Lys Glu 450 455 460His Glu Gln Asn Gly Leu Gly Gln Glu Lys Thr Ser Lys Leu Gly Glu465 470 475 480Gln Asn Glu Asp Ser Thr Thr Ser Arg Ser Ile Ala Thr Gln Asp Lys 485 490 495Ser Pro Gly Ser Asp Ser Gln Asn Lys Ser Phe Val Ser Lys Gln Asp 500 505 510Asn His Leu Pro Gln His Asn Pro Ala Ser Pro Met Pro Asp Val Gln 515 520 525Arg His Phe His Thr Pro Ile Gly Met Thr Ile Arg Asn Gln Ser Ala 530 535 540Gly Phe Asn Leu Ile Gly Ser Pro Glu Ile Glu Ser Ile Asn Ile Thr545 550 555 560Gln Gly Ser Pro Lys Lys Pro Arg Asn Asn Glu Met Leu His Ser Pro 565 570 575Asn Ser Ile Pro Ser Ile Asn Met Asp Val Lys Pro Asn Glu Glu Gln 580 585 590Met Ser Met Lys Phe Gly Asp Asp Arg Gln Asp Arg Asp Gly Phe Ser 595 600 605Leu Met Gly Gly Pro Met Asn Phe Met Gly Gly Phe Gly Ala Tyr Pro 610 615 620Ile Gly Glu Ile Ala Arg Phe Ser Thr Glu Gln Phe Ser Ala Pro Tyr625 630 635 640Ser Thr Ser Gly Thr Val Ser Leu Thr Leu Gly Leu Pro His Asn Glu 645 650 655Asn Leu Ser Met Ser Ala Thr His His Ser Phe Leu Pro Ile Pro Thr 660 665 670Gln Asn Ile Gln Ile Gly Ser Glu Pro Asn His Glu Phe Gly Ser Leu 675 680 685Asn Thr Pro Thr Ser Ala His Ser Thr Ser Ser Val Tyr Glu Thr Phe 690 695 700Asn Ile Gln Asn Arg Lys Arg Phe Ala Ala Pro Leu Leu Pro Asp Phe705 710 715 720Val Ala

Claims

1. A nucleic acid construct comprising: a first nucleic acid molecule comprising a nucleotide sequence configured to silence or reduce expression of StBEL11 and variants thereof; a 5' DNA promoter sequence; and a 3' terminator sequence, wherein the first nucleic acid molecule, the promoter sequence, and the terminator sequence are operatively coupled to permit transcription of the first nucleic acid molecule.

2. The nucleic acid construct according to claim 1, wherein the nucleic acid construct comprises DNA heterologous to the first nucleic acid molecule.

3. The nucleic acid construct according to claim 2, wherein the DNA heterologous to the first nucleic acid molecule is the 5' DNA promoter sequence.

4. The nucleic acid construct according to claim 1, wherein the first nucleic acid molecule is SEQ ID NO:3 or a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO:3.

5. The nucleic acid construct according to claim 1 further comprising: a second nucleic acid molecule comprising a nucleotide sequence configured to silence or reduce expression of StBEL29 and variants thereof.

6. The nucleic acid construct according to claim 5, wherein the second nucleic acid molecule is SEQ ID NO:6 or a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO:6.

7. The nucleic acid construct according to claim 1 further comprising: a further nucleic acid molecule comprising a nucleotide sequence configured to enhance the expression of StBEL5 and variants thereof.

8. The nucleic acid construct according to claim 7, wherein the further nucleic acid molecule comprises a nucleotide sequence of SEQ ID NO:8 or a nucleic acid molecule that is at least 99% identical to the nucleotide sequence of SEQ ID NO:8.

9. A nucleic acid construct comprising: a first nucleic acid molecule comprising a nucleotide sequence configured to silence or reduce expression of StBEL29 and variants thereof; a 5' DNA promoter sequence; and a 3' terminator sequence, wherein the first nucleic acid molecule, the promoter sequence, and the terminator sequence are operatively coupled to permit transcription of the first nucleic acid molecule.

10. The nucleic acid construct according to claim 9, wherein the nucleic acid construct comprises DNA heterologous to the first nucleic acid molecule.

11. The nucleic acid construct according to claim 10, wherein the DNA heterologous to the first nucleic acid molecule is the 5' DNA promoter sequence.

12. The nucleic acid construct according to claim 9, wherein the first nucleic acid molecule comprises SEQ ID NO:6 or a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO:6.

13. The nucleic acid construct according to claim 9 further comprising: a further nucleic acid molecule comprising a nucleotide sequence configured to enhance the expression of StBEL5 and variants thereof.

14. The nucleic acid construct according to claim 13, wherein the further nucleic acid molecule comprises a nucleotide sequence of SEQ ID NO:8 or a nucleic acid molecule that is at least 99% identical to the nucleotide sequence of SEQ ID NO:8.

15. The nucleic acid construct according to claim 1, wherein the promoter sequence is one or more of the following: a native, constitutive, inducible, developmentally-regulated, organelle-specific, tissue-specific, cell-specific, seed specific, and germination-specific promoter.

16. An expression vector comprising the nucleic acid construct according to claim 1.

17. A host cell transformed with the nucleic acid construct according to claim 1.

18. The host cell according to claim 17, wherein the host cell is a bacterial cell or a plant cell.

19. A transgenic plant seed transformed with the nucleic acid construct according to claim 1.

20. A transgenic plant transformed with the nucleic acid construct according to claim 1, wherein the plant has increased tuber yield compared to a plant not transformed with the nucleic acid construct.

21. The transgenic plant of claim 20, wherein tuber yield is increased at least 20% compared to a plant not transformed with the nucleic acid construct.

22. The transgenic plant of claim 20, wherein overall shoot fresh weight is at least 80% compared to a plant not transformed with the nucleic acid construct.

23. The transgenic plant of claim 20, wherein the plant comprises an expression level of StBEL11 less than 60% compared to a plant not transformed with the nucleic acid construct.

24. The transgenic plant of claim 20, wherein the plant comprises an expression level of StBEL29 less than 60% compared to a plant not transformed with the nucleic acid construct.

25. The transgenic plant of claim 20, wherein the plant comprises an expression level of StBEL5 greater than 20% compared to a plant not transformed with the nucleic acid construct.

26. The transgenic plant according to claim 20, wherein the plant is selected from the group consisting of potato (Solanum tuberosum), dahlia, caladium, Jerusalem artichoke (Helianthus tuberosus), yam (Dioscorea alta), sweet potato (Impomoea batatus), cassaya (Manihot esculenta), tuberous begonia, cyclamen, other solarium species (e.g., wild potato), sugar beet (Beta vulgaris), carrot (Daucus carota), and radish (Raphanus sativus).

27. The transgenic plant according to claim 20, wherein the plant is selected from the group consisting of Solanum tuberosum spp. andigena and Solanum tuberosum spp. tuberosum.

28. A transgenic cell of the plant according to claim 20.

29. A transgenic plant seed produced from the plant according to claim 20.

30. A method of increasing tuber yield in a plant, said method comprising: providing a transgenic plant or plant seed comprising a nucleic acid construct comprising one or more nucleic acid molecules configured to reduce or silence expression of (i) StBEL11 and variants thereof, (ii) StBEL29 and variants thereof, or (iii) both (i) and (ii); and growing the transgenic plant or plant grown from the transgenic plant seed under conditions effective to express the one or more nucleic acid molecules in said transgenic plant or said plant grown from the transgenic plant seed.

31. The method according to claim 30, wherein a transgenic plant is provided.

32. The method according to claim 30, wherein a transgenic plant seed is provided.

33. The method according to claim 30, wherein said providing comprises transforming a non-transgenic plant or a non-transgenic plant seed with the nucleic acid construct to yield said transgenic plant or plant seed.

34. A potato plant comprising one or more mutations in one or both of StBEL11 and StBEL29, wherein said potato plant has increased tuber yield compared to the tuber yield of a wild type potato plant.

35. The potato plant of claim 34, wherein the potato plant comprises a reduced expression level of StBEL11 compared to a wild type potato plant.

36. The potato plant of claim 35, wherein the potato plant comprises an expression level of StBEL11 less than 60% compared to a wild type potato plant.

37. The potato plant of claim 35, wherein the expression level of StBEL11 is measured by quantifying accumulation levels of StBEL11 in leaves of a young tissue culture plant using RT-qPCR.

38. The potato plant of claim 34, wherein the potato plant comprises a reduced expression level of StBEL29 compared to a wild type potato plant.

39. The potato plant of claim 38, wherein the potato plant comprises an expression level of StBEL29 less than 60% compared to a wild type potato plant.

40. The potato plant of claim 38, wherein the expression level of StBEL29 is measured by quantifying accumulation levels of StBEL11 in leaves of a young tissue culture plant using RT-qPCR.

41. The potato plant of claim 34, wherein the potato plant comprises a tuber yield at least 20% greater than a wild type potato plant.

42. A potato plant according to claim 34, wherein the potato plant comprises an increased expression level of StBEL5 compared to a wild type potato plant.

43. The potato plant of claim 42 further comprising: one or more mutations in StBEL5.

44. The potato plant of claim 42, wherein the potato plant comprises an expression level of StBEL5 greater than 20% compared to a wild type potato plant.

45. The potato plant according to claim 34, wherein overall shoot fresh weight is at least 90% compared to a plant not transformed with the nucleic acid construct.

46. Potato seed from the potato plant of claim 34.

Images