U.S. patent application number 16/178129 was filed with the patent office on 2019-07-11 for compositions and methods for treatment of spinal muscular atrophy.
This patent application is currently assigned to Ionis Pharmaceuticals, Inc.. The applicant listed for this patent is Cold Spring Harbor Laboratory, Ionis Pharmaceuticals, Inc.. Invention is credited to C. Frank Bennett, Yimin Hua, Adrian R. Krainer, Frank Rigo.
Application Number | 20190211330 16/178129 |
Document ID | / |
Family ID | 47362558 |
Filed Date | 2019-07-11 |
United States Patent
Application |
20190211330 |
Kind Code |
A1 |
Hua; Yimin ; et al. |
July 11, 2019 |
COMPOSITIONS AND METHODS FOR TREATMENT OF SPINAL MUSCULAR
ATROPHY
Abstract
Disclosed herein are compounds, compositions and methods for
treatment of diseases and disorders, including spinal muscular
atrophy.
Inventors: |
Hua; Yimin; (Miami, FL)
; Krainer; Adrian R.; (East Northport, NY) ; Rigo;
Frank; (Carlsbad, CA) ; Bennett; C. Frank;
(Carlsbad, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Ionis Pharmaceuticals, Inc.
Cold Spring Harbor Laboratory |
Carlsbad
Cold Spring Harbor |
CA
NY |
US
US |
|
|
Assignee: |
Ionis Pharmaceuticals, Inc.
Carlsbad
CA
Cold Spring Harbor Laboratory
Cold Spring Harbor
NY
|
Family ID: |
47362558 |
Appl. No.: |
16/178129 |
Filed: |
November 1, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14129029 |
Jul 29, 2014 |
|
|
|
PCT/US2012/043946 |
Jun 25, 2012 |
|
|
|
16178129 |
|
|
|
|
61501135 |
Jun 24, 2011 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61B 2017/00623
20130101; A61B 2017/00676 20130101; A61B 2017/22069 20130101; A61B
17/0057 20130101; C12N 2310/321 20130101; C12N 2310/321 20130101;
C12N 2320/33 20130101; A61B 2017/00455 20130101; A61B 2017/22072
20130101; A61K 38/27 20130101; A61B 2017/00601 20130101; C12N
15/113 20130101; C12N 2310/346 20130101; A61K 38/30 20130101; C12N
2310/11 20130101; C12N 2310/315 20130101; C12N 2310/3525 20130101;
A61B 2017/00575 20130101; A61B 2017/00893 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; A61K 38/27 20060101 A61K038/27; A61B 17/00 20060101
A61B017/00; A61K 38/30 20060101 A61K038/30 |
Claims
1-70. (canceled)
71. A method of modulating the GF/IGF-1 axis, comprising
administering at least one GF/IGF-1 axis modulator, wherein the
GF/IGF-1 axis modulator is a GF/IGF-1 axis molecule selected from
among: IGF-1 and insulin-like growth factor binding acid labile
subunit (IGFALS), to a human subject having spinal muscular atrophy
(SMA).
72. The method of claim 71, wherein at least one GF/IGF-1 axis
modulator is IGF-binding-protein acid labile subunit (IGFALS).
73. The method of claim 71, wherein at least one GF/IGF-1 axis
modulator is IGF-1.
74. The method of claim 71, wherein the at least one GF/IGF-1 axis
modulator is administered systemically.
75. The method of claim 71, wherein at least one growth hormone
axis modulator is administered by intraperitoneal injection.
76. The method of claim 71, wherein at least one growth hormone
axis modulator is administered by subcutaneous injection.
77. The method of claim 71, wherein at least one growth hormone
axis modulator is administered by intramuscular injection.
78. The method of claim 71, wherein at least one growth hormone
axis modulator is administered into the cerebrospinal fluid.
79. The method of claim 71, comprising administering at least one
antisense oligonucleotide to the subject having spinal muscular
atrophy.
80. The method of claim 79, wherein the antisense compound
comprises an antisense oligonucleotide complementary to a nucleic
acid encoding human SMN2.
81. The method of claim 80, wherein the oligonucleotide is
complementary to a portion of intron 7 of the nucleic acid encoding
human SMN2.
82. The method of claim 80, wherein the antisense oligonucleotide
is at least 90% complementary to the nucleic acid encoding human
SMN2.
83. The method of claim 80, wherein the antisense oligonucleotide
is fully complementary to the nucleic acid encoding human SMN2.
84. The method of claim 80, wherein the oligonucleotide has a
nucleobase sequence comprising at least 10 contiguous nucleobases
of the nucleobase sequence SEQ ID NO: 1.
85. The method of claim 80, wherein the oligonucleotide has a
nucleobase sequence comprising at least 15 contiguous nucleobases
of the nucleobase sequence SEQ ID NO: 1.
86. The method of claim 80, wherein the oligonucleotide has a
nucleobase sequence comprising the nucleobase sequence SEQ ID NO:
1.
87. The method of claim 80, wherein the oligonucleotide has a
nucleobase sequence consisting of the nucleobase sequence SEQ ID
NO: 1.
88. The method of claim 80, wherein at least one nucleoside of the
antisense oligonucleotide comprises a modified sugar moiety.
89. The method of claim 88, wherein the at least one modified sugar
moiety comprises a 2'-methoxyethyl sugar moiety.
90. The method of claim 88, wherein essentially each nucleoside of
the antisense oligonucleotide comprises a modified sugar
Description
[0001] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled CORE0096USC1SEQ_ST25.txt, created Nov. 1, 2018, which
is 8 Kb in size. The information in the electronic format of the
sequence listing is incorporated herein by reference in its
entirety.
BACKGROUND OF THE INVENTION
[0002] Proximal spinal muscular atrophy (SMA) is a genetic,
neurodegenerative disorder characterized by the loss of spinal
motor neurons. SMA is an autosomal recessive disease of early onset
and is currently the leading cause of death among infants. The
severity of SMA varies among patients and has thus been classified
into three types. Type I SMA is the most severe form with onset at
birth or within 6 months and typically results in death within 2
years. Children with type I SMA are unable to sit or walk. Type II
SMA is the intermediate form and patients are able to sit, but
cannot stand or walk. Patients with type III SMA, a chronic form of
the disease, typically develop SMA after 18 months of age (Lefebvre
et al., Hum. Mol. Genet., 1998, 7, 1531-1536).
[0003] The molecular basis of SMA is caused by the loss of both
copies of survival motor neuron gene 1 (SMN1), which may also be
known as SMN Telomeric, a protein that is part of a multi-protein
complex thought to be involved in snRNP biogenesis and recycling. A
nearly identical gene, SMN2, which may also be known as SMN
Centromeric, exists in a duplicated region on chromosome 5q13 and
modulates disease severity. Expression of the normal SMN1 gene
results solely in expression of survival motor neuron (SMN)
protein. Although SMN1 and SMN2 have the potential to code for the
same protein, SMN2 contains a translationally silent mutation at
position +6 of exon 7, which results in inefficient inclusion of
exon 7 in SMN2 transcripts. Thus, the predominant form of SMN2 is a
truncated version, lacking exon 7, which is unstable and inactive
(Cartegni and Krainer, Nat. Genet., 2002, 30, 377-384). Expression
of the SMN2 gene results in approximately 10-20% of the SMN protein
and 80-90% of the unstable/non-functional SMNdelta7 protein. SMN
protein plays a well-established role in assembly of the
spliceosome and may also mediate mRNA trafficking in the axon and
nerve terminus of neurons.
[0004] Antisense technology is an effective means for modulating
the expression of one or more specific gene products, including
alternative splice products, and is uniquely useful in a number of
therapeutic, diagnostic, and research applications. The principle
behind antisense technology is that an antisense compound, which
hybridizes to a target nucleic acid, modulates gene expression
activities such as transcription, splicing or translation through
one of a number of antisense mechanisms. The sequence specificity
of antisense compounds makes them extremely attractive as tools for
target validation and gene functionalization, as well as
therapeutics to selectively modulate the expression of genes
involved in disease.
[0005] Certain antisense compounds complementary to SMN2 are known
in the art. See for example, WO 2007/002390; U.S. 61/168,885; Hua
et al., American J. of Human Genetics (April 2008) 82, 1-15; Singh
et al., RNA Bio. 6:3, 1-10 (2009); WO2010120820 (2010). Chimeric
peptide nucleic acid molecules designed to modulate splicing of
SMN2 have been described (WO 02/38738; Cartegni and Krainer, Nat.
Struct. Biol., 2003, 10, 120-125).
SUMMARY OF THE INVENTION
[0006] In certain embodiments, the present invention provides
methods of treating a subject having spinal muscular atrophy. In
certain such embodiments, at least one GF/IGF-1 axis modulator is
administered to the subject. In certain embodiments, at least one
at least one GF/IGF-1 axis modulator and at least one antisense
compound that modulates splicing of SMN2 to increase the amount of
active exon 7 retained SMN protein is administered to the subject.
In certain embodiments, at least one of the GF/IGF-1 axis modulator
and the antisense compound is administered systemically. In certain
embodiments, at least one of the GF/IGF-1 axis modulator and the
antisense compound is administered into the CSF.
[0007] The present disclosure provides the following non-limiting
numbered embodiments.
[0008] Embodiment 1: A method comprising administering at least one
GF/IGF-1 axis modulator to a subject having spinal muscular atrophy
(SMA).
[0009] Embodiment 2: The method of embodiment 1, wherein at least
one GF/IGF-1 axis modulator is a GF/IGF-1 axis molecule.
[0010] Embodiment 3: The method of embodiment 1 or 2, wherein at
least one GF/IGF-1 axis modulator increases the activity and/or
amount of insulin-like growth factor 1 (IGF-1) in the subject.
[0011] Embodiment 4: The method of any of embodiments 1-3, wherein
at least one GF/IGF-1 axis modulator is insulin-like growth factor
1 (IGF-1).
[0012] Embodiment 5: The method of any of embodiments 1-4, wherein
at least one GF/IGF-1 axis modulator is IGF-binding-protein acid
labile subunit (IGFALS).
[0013] Embodiment 6: The method of any of embodiments 1-5, wherein
at least one GF/IGF-1 axis modulator is growth hormone (GH).
[0014] Embodiment 7: The method of any of embodiments 1-6, wherein
at least one GF/IGF-1 axis modulator is insulin-like growth factor
binding protein 3 (IGFBP3).
[0015] Embodiment 8: The method of any of embodiments 1-7 wherein
at least one GF/IGF-1 axis modulator is a gene encoding a GF/IGF-1
axis molecule.
[0016] Embodiment 9: The method of any of embodiments 1-7 wherein
at least one GF/IGF-1 axis modulator is a gene encoding
IGF-binding-protein acid labile subunit (IGFALS).
[0017] Embodiment 10: The method of any embodiments 1-9, wherein at
least one GF/IGF-1 axis modulator is administered systemically.
[0018] Embodiment 11: The method of any embodiments 1-10, wherein
at least one growth hormone axis modulator is administered by
intraperitoneal injection.
[0019] Embodiment 12: The method of any embodiments 1-11, wherein
at least one growth hormone axis modulator is administered by
subcutaneous injection.
[0020] Embodiment 13: The method of any embodiments 1-12, wherein
at least one growth hormone axis modulator is administered by
intramuscular injection.
[0021] Embodiment 14: The method of any embodiments 1-13, wherein
at least one growth hormone axis modulator is administered into the
cerebrospinal fluid.
[0022] Embodiment 15: The method of any of embodiments 1-14
comprising administering at least one antisense oligonucleotide to
the subject having spinal muscular atrophy.
[0023] Embodiment 16: The method of embodiment 15, wherein the
antisense compound comprises an antisense oligonucleotide
complementary to a nucleic acid encoding human SMN2.
[0024] Embodiment 17: The method of embodiment 15 or 16, wherein
the oligonucleotide is complementary to a portion of intron 7 of
the nucleic acid encoding human SMN2.
[0025] Embodiment 18: The method of any of embodiments 15-17,
wherein the antisense oligonucleotide is at least 90% complementary
to the nucleic acid encoding human SMN2.
[0026] Embodiment 19: The method of embodiment 18, wherein the
antisense oligonucleotide is fully complementary to the nucleic
acid encoding human SMN2.
[0027] Embodiment 20: The method of any of embodiments 15-19,
wherein the oligonucleotide has a nucleobase sequence comprising at
least 10 contiguous nucleobases of the nucleobase sequence SEQ ID
NO: 1.
[0028] Embodiment 21: The method of embodiment 20, wherein the
oligonucleotide has a nucleobase sequence comprising at least 15
contiguous nucleobases of the nucleobase sequence SEQ ID NO: 1.
[0029] Embodiment 22: The method of embodiment 20, wherein the
oligonucleotide has a nucleobase sequence comprising the nucleobase
sequence SEQ ID NO: 1.
[0030] Embodiment 23: The method of embodiment 20, wherein the
oligonucleotide has a nucleobase sequence consisting of the
nucleobase sequence SEQ ID NO: 1.
[0031] Embodiment 24: The method of any of embodiments 15-23,
wherein at least one nucleoside of the antisense oligonucleotide
comprises a modified sugar moiety.
[0032] Embodiment 25: The method of embodiment 24, wherein the at
least one modified sugar moiety comprises a 2'-methoxyethyl sugar
moiety.
[0033] Embodiment 26: The method of any of embodiments 15-25,
wherein essentially each nucleoside of the antisense
oligonucleotide comprises a modified sugar moiety.
[0034] Embodiment 27: The method of embodiment 26, wherein the
nucleosides comprising a modified sugar moiety all comprise the
same sugar modification.
[0035] Embodiment 28: The method of embodiment 29, wherein each
modified sugar moiety comprises a 2'-methoxyethyl sugar moiety.
[0036] Embodiment 29: The method of any of embodiments 15-28,
wherein each nucleoside of the antisense oligonucleotide comprises
a modified sugar moiety.
[0037] Embodiment 30: The method of embodiment 29, wherein the
nucleosides all comprise the same sugar modification.
[0038] Embodiment 31: The method of embodiment 30, wherein each
modified sugar moiety comprises a 2'-methoxyethyl sugar moiety.
[0039] Embodiment 32: The method of any of embodiments 15-31,
wherein at least one modified nucleoside is a morpholino
nucleoside.
[0040] Embodiment 33: The method of any of embodiments 15-32,
wherein at least one modified nucleoside is a F-HNA nucleoside.
[0041] Embodiment 34: The method of any of embodiments 15-33,
wherein at least one internucleoside linkage is a phosphorothioate
internucleoside linkage.
[0042] Embodiment 35: The method of embodiment 34, wherein each
internucleoside linkage is a phosphorothioate internucleoside
linkage.
[0043] Embodiment 36: The method of any of embodiments 15-35,
wherein the antisense oligonucleotide consists of 10 to 25 linked
nucleosides.
[0044] Embodiment 37: The method of any of embodiments 15-35,
wherein the antisense oligonucleotide consists of 12 to 22 linked
nucleosides.
[0045] Embodiment 38: The method of any of embodiments 15-35,
wherein the antisense oligonucleotide consists of 15 to 20 linked
nucleosides.
[0046] Embodiment 39: The method of any of embodiments 15-35,
wherein the antisense oligonucleotide consists of 18 linked
nucleosides.
[0047] Embodiment 40: The method of any of embodiments 15-39,
wherein the antisense compound comprises a conjugate group or
terminal group.
[0048] Embodiment 41: The method of any of embodiments 15-40,
wherein the antisense compound consists of the antisense
oligonucleotide.
[0049] Embodiment 42: The method of any of embodiments 15-41,
wherein the antisense compound is administered into the
cerebrospinal fluid.
[0050] Embodiment 43: The method of embodiment 42, wherein the
administration is into the intrathecal space.
[0051] Embodiment 44: The method of embodiment 42, wherein the
administration is into the cerebrospinal fluid in the brain.
[0052] Embodiment 45: The method of any of embodiments 15-44,
wherein the antisense compound is administered systemically.
[0053] Embodiment 46: Then method of embodiment 45, wherein the
systemic administration of the antisense compound is by intravenous
or intraperitoneal injection.
[0054] Embodiment 47: The method of embodiment 15-46, wherein the
antisense compound is administered into the cerebrospinal fluid and
by systemic administration at the same time.
[0055] Embodiment 48: The method of embodiment 15-47, wherein the
antisense compound is administered into the cerebrospinal fluid and
by systemic administration at different times.
[0056] Embodiment 49: The method of any of embodiments 1-48,
wherein the administration of the GF/IGF-1 axis modulator and/or
the antisense compound comprises a bolus injection.
[0057] Embodiment 50: The method of any of embodiments 1-49,
wherein the administration of the GF/IGF-1 axis modulator and/or
the antisense compound comprises infusion with a delivery pump.
[0058] Embodiment 51: The method of any of embodiments 15-50,
wherein at least one GF/IGF-1 axis modulator and at least one
antisense compound are administered at the same time.
[0059] Embodiment 52: The method of any of embodiments 15-51,
wherein at least one GF/IGF-1 axis modulator and at least one
antisense compound are administered at different times.
[0060] Embodiment 53: The method of any of embodiments 1-52,
wherein the subject has type I SMA
[0061] Embodiment 54: The method of any of embodiments 1-52,
wherein the subject has type II SMA.
[0062] Embodiment 55: The method of any of embodiments 1-52,
embodiments wherein the subject has type III SMA.
[0063] Embodiment 56: The method of any of embodiments 1-55,
wherein a first dose is administered in utero.
[0064] Embodiment 57: The method of any of embodiments 1-55,
wherein a first dose of GF/IGF-1 axis modulator is administered
within 1 week of birth of the subject.
[0065] Embodiment 58: The method of any of embodiments 1-55,
wherein a first dose of GF/IGF-1 axis modulator is administered
within 1 month of birth of the subject.
[0066] Embodiment 59: The method of any of embodiments 1-55,
wherein a first dose of GF/IGF-1 axis modulator is administered
within 3 months of birth of the subject.
[0067] Embodiment 60: The method of any of embodiments 1-55,
wherein a first dose of GF/IGF-1 axis modulator is administered
within 6 months of birth of the subject.
[0068] Embodiment 61: The method of any of embodiments 1-55,
wherein a first dose of GF/IGF-1 axis modulator is administered
when the subject is from 1 to 2 years of age.
[0069] Embodiment 62: The method of any of embodiments 1-55,
wherein a first dose of GF/IGF-1 axis modulator is administered
when the subject is from 1 to 15 years of age.
[0070] Embodiment 63: The method of any of embodiments 1-55,
wherein a first dose of GF/IGF-1 axis modulator is administered
when the subject is older than 15 years of age.
[0071] Embodiment 64: The method of any of embodiments 1-63,
wherein the subject is a mammal.
[0072] Embodiment 65: The method of embodiment 64, wherein the
subject is a human.
[0073] Embodiment 66: The method of any of embodiments 1-65
comprising identifying a subject having SMA.
[0074] Embodiment 67: The method of embodiment 66, wherein the
subject is identified by measuring electrical activity of one or
more muscles of the subject.
[0075] Embodiment 68: The method of embodiment 66 or 67, wherein
the subject is identified by a genetic test to determine whether
the subject has a mutation in the subject's SMN1 gene.
[0076] Embodiment 69: The method of any of embodiments 66-68,
wherein the subject is identified by muscle biopsy.
[0077] Embodiment 70: The method of any of embodiments 1-69,
wherein at least one symptom of SMA in the subject is
ameliorated.
[0078] In certain embodiments, the subject is treated with gene
therapy. In certain embodiments, the gene therapy is in the CSF. In
certain embodiments, gene therapy is systemic. In certain
embodiments, the gene therapy provides exon-7 retained SMN. In
certain embodiments, the gene therapy increases the GH/IGF-1
axis.
BRIEF DESCRIPTION OF THE FIGURES
[0079] FIG. 1 shows results from Experiments described in Examples
3 and 4. FIG. 1a shows Serum IGF-1 from heterozygous (normal
phenotype) mice, SMA mice, and SMA mice treated systemically with
antisense compound. FIGS. 1b-d show RT-PCR results from experiments
described in Example 4 in which liver RNA was assessed for mRNA
encoding IGF-1, IGFBP3 and IGFALS.
DETAILED DESCRIPTION OF THE INVENTION
[0080] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not restrictive of the invention, as
claimed. Herein, the use of the singular includes the plural unless
specifically stated otherwise. As used herein, the use of "or"
means "and/or" unless stated otherwise. Furthermore, the use of the
term "including" as well as other forms, such as "includes" and
"included", is not limiting. Also, terms such as "element" or
"component" encompass both elements and components comprising one
unit and elements and components that comprise more than one
subunit, unless specifically stated otherwise.
[0081] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described. All documents, or portions of documents, cited in
this application, including, but not limited to, patents, patent
applications, articles, books, and treatises, are hereby expressly
incorporated by reference in their entirety for any purpose.
Definitions
[0082] Unless specific definitions are provided, the nomenclature
used in connection with, and the procedures and techniques of,
analytical chemistry, synthetic organic chemistry, and medicinal
and pharmaceutical chemistry described herein are those well known
and commonly used in the art. Standard techniques may be used for
chemical synthesis, and chemical analysis. Certain such techniques
and procedures may be found for example in "Carbohydrate
Modifications in Antisense Research" Edited by Sangvi and Cook,
American Chemical Society, Washington D.C., 1994; "Remington's
Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa.,
21.sup.st edition, 2005; and "Antisense Drug Technology,
Principles, Strategies, and Applications" Edited by Stanley T.
Crooke, CRC Press, Boca Raton, Fla.; and Sambrook et al.,
"Molecular Cloning, A laboratory Manual," 2.sup.nd Edition, Cold
Spring Harbor Laboratory Press, 1989, which are hereby incorporated
by reference for any purpose. Where permitted, all patents,
applications, published applications and other publications and
other data referred to throughout in the disclosure are
incorporated by reference herein in their entirety.
[0083] Unless otherwise indicated, the following terms have the
following meanings:
[0084] As used herein, "nucleoside" means a compound comprising a
nucleobase moiety and a sugar moiety. Nucleosides include, but are
not limited to, naturally occurring nucleosides (as found in DNA
and RNA) and modified nucleosides. Nucleosides may be linked to a
phosphate moiety.
[0085] As used herein, "chemical modification" means a chemical
difference in a compound when compared to a naturally occurring
counterpart. In reference to an oligonucleotide, chemical
modification does not include differences only in nucleobase
sequence. Chemical modifications of oligonucleotides include
nucleoside modifications (including sugar moiety modifications and
nucleobase modifications) and internucleoside linkage
modifications.
[0086] As used herein, "furanosyl" means a structure comprising a
5-membered ring comprising four carbon atoms and one oxygen
atom.
[0087] As used herein, "naturally occurring sugar moiety" means a
ribofuranosyl as found in naturally occurring RNA or a
deoxyribofuranosyl as found in naturally occurring DNA.
[0088] As used herein, "sugar moiety" means a naturally occurring
sugar moiety or a modified sugar moiety of a nucleoside.
[0089] As used herein, "modified sugar moiety" means a substituted
sugar moiety, a bicyclic or tricyclic sugar moiety, or a sugar
surrogate.
[0090] As used herein, "substituted sugar moiety" means a furanosyl
comprising at least one substituent group that differs from that of
a naturally occurring sugar moiety. Substituted sugar moieties
include, but are not limited to furanosyls comprising substituents
at the 2'-position, the 3'-position, the 5'-position and/or the
4'-position.
[0091] As used herein, "2'-substituted sugar moiety" means a
furanosyl comprising a substituent at the 2'-position other than H
or OH. Unless otherwise indicated, a 2'-substituted sugar moiety is
not a bicyclic sugar moiety (i.e., the 2'-substituent of a
2'-substituted sugar moiety does not form a bridge to another atom
of the furanosyl ring.
[0092] As used herein, "MOE" means
--OCH.sub.2CH.sub.2OCH.sub.3.
[0093] As used herein, "bicyclic sugar moiety" means a modified
sugar moiety comprising a 4 to 7 membered ring (including but not
limited to a furanosyl) comprising a bridge connecting two atoms of
the 4 to 7 membered ring to form a second ring, resulting in a
bicyclic structure. In certain embodiments, the 4 to 7 membered
ring is a sugar ring. In certain embodiments the 4 to 7 membered
ring is a furanosyl. In certain such embodiments, the bridge
connects the 2'-carbon and the 4'-carbon of the furanosyl.
[0094] As used herein the term "sugar surrogate" means a structure
that does not comprise a furanosyl and that is capable of replacing
the naturally occurring sugar moiety of a nucleoside, such that the
resulting nucleoside is capable of (1) incorporation into an
oligonucleotide and (2) hybridization to a complementary
nucleoside. Such structures include rings comprising a different
number of atoms than furanosyl (e.g., 4, 6, or 7-membered rings);
replacement of the oxygen of a furanosyl with a non-oxygen atom
(e.g., carbon, sulfur, or nitrogen); or both a change in the number
of atoms and a replacement of the oxygen. Such structures may also
comprise substitutions corresponding to those described for
substituted sugar moieties (e.g., 6-membered carbocyclic bicyclic
sugar surrogates optionally comprising additional substituents).
Sugar surrogates also include more complex sugar replacements
(e.g., the non-ring systems of peptide nucleic acid). Sugar
surrogates include without limitation morpholino, modified
morpholinos, cyclohexenyls and cyclohexitols.
[0095] As used herein, "nucleotide" means a nucleoside further
comprising a phosphate linking group. As used herein, "linked
nucleosides" may or may not be linked by phosphate linkages and
thus includes, but is not limited to "linked nucleotides." As used
herein, "linked nucleosides" are nucleosides that are connected in
a continuous sequence (i.e. no additional nucleosides are present
between those that are linked).
[0096] As used herein, "nucleobase" means a group of atoms that can
be linked to a sugar moiety to create a nucleoside that is capable
of incorporation into an oligonucleotide, and wherein the group of
atoms is capable of bonding with a complementary naturally
occurring nucleobase of another oligonucleotide or nucleic acid.
Nucleobases may be naturally occurring or may be modified.
[0097] As used herein, "heterocyclic base" or "heterocyclic
nucleobase" means a nucleobase comprising a heterocyclic
structure.
[0098] As used herein the terms, "unmodified nucleobase" or
"naturally occurring nucleobase" means the naturally occurring
heterocyclic nucleobases of RNA or DNA: the purine bases adenine
(A) and guanine (G), and the pyrimidine bases thymine (T), cytosine
(C) (including 5-methyl C), and uracil (U).
[0099] As used herein, "modified nucleobase" means any nucleobase
that is not a naturally occurring nucleobase.
[0100] As used herein, "modified nucleoside" means a nucleoside
comprising at least one chemical modification compared to naturally
occurring RNA or DNA nucleosides. Modified nucleosides comprise a
modified sugar moiety and/or a modified nucleobase.
[0101] As used herein, "bicyclic nucleoside" or "BNA" means a
nucleoside comprising a bicyclic sugar moiety.
[0102] As used herein, "constrained ethyl nucleoside" or "cEt"
means a nucleoside comprising a bicyclic sugar moiety comprising a
4'--CH(CH.sub.3)--O-2'bridge.
[0103] As used herein, "locked nucleic acid nucleoside" or "LNA"
means a nucleoside comprising a bicyclic sugar moiety comprising a
4'--CH.sub.2--O-2'bridge.
[0104] As used herein, "2'-substituted nucleoside" means a
nucleoside comprising a substituent at the 2'-position other than H
or OH. Unless otherwise indicated, a 2'-substituted nucleoside is
not a bicyclic nucleoside.
[0105] As used herein, "2'-deoxynucleoside" means a nucleoside
comprising 2'-H furanosyl sugar moiety, as found in naturally
occurring deoxyribonucleosides (DNA). In certain embodiments, a
2'-deoxynucleoside may comprise a modified nucleobase or may
comprise an RNA nucleobase (e.g., uracil).
[0106] As used herein, "oligonucleotide" means a compound
comprising a plurality of linked nucleosides. In certain
embodiments, an oligonucleotide comprises one or more unmodified
ribonucleosides (RNA) and/or unmodified deoxyribonucleosides (DNA)
and/or one or more modified nucleosides.
[0107] As used herein "oligonucleoside" means an oligonucleotide in
which none of the internucleoside linkages contains a phosphorus
atom. As used herein, oligonucleotides include
oligonucleosides.
[0108] As used herein, "modified oligonucleotide" means an
oligonucleotide comprising at least one modified nucleoside and/or
at least one modified internucleoside linkage.
[0109] As used herein "internucleoside linkage" means a covalent
linkage between adjacent nucleosides in an oligonucleotide.
[0110] As used herein "naturally occurring internucleoside linkage"
means a 3' to 5' phosphodiester linkage.
[0111] As used herein, "modified internucleoside linkage" means any
internucleoside linkage other than a naturally occurring
internucleoside linkage.
[0112] As used herein, "oligomeric compound" means a polymeric
structure comprising two or more sub-structures. In certain
embodiments, an oligomeric compound comprises an oligonucleotide.
In certain embodiments, an oligomeric compound comprises one or
more conjugate groups and/or terminal groups. In certain
embodiments, an oligomeric compound consists of an
oligonucleotide.
[0113] As used herein, "terminal group" means one or more atom
attached to either, or both, the 3' end or the 5' end of an
oligonucleotide. In certain embodiments a terminal group is a
conjugate group. In certain embodiments, a terminal group comprises
one or more terminal group nucleosides.
[0114] As used herein, "conjugate" means an atom or group of atoms
bound to an oligonucleotide or oligomeric compound. In general,
conjugate groups modify one or more properties of the compound to
which they are attached, including, but not limited to
pharmacodynamic, pharmacokinetic, binding, absorption, cellular
distribution, cellular uptake, charge and/or clearance
properties.
[0115] As used herein, "conjugate linking group" means any atom or
group of atoms used to attach a conjugate to an oligonucleotide or
oligomeric compound.
[0116] As used herein, "antisense compound" means a compound
comprising or consisting of an oligonucleotide at least a portion
of which is complementary to a target nucleic acid to which it is
capable of hybridizing, resulting in at least one antisense
activity.
[0117] As used herein, "antisense activity" means any detectable
and/or measurable change attributable to the hybridization of an
antisense compound to its target nucleic acid.
[0118] As used herein, "detecting" or "measuring" means that a test
or assay for detecting or measuring is performed. Such detection
and/or measuring may result in a value of zero. Thus, if a test for
detection or measuring results in a finding of no activity
(activity of zero), the step of detecting or measuring the activity
has nevertheless been performed.
[0119] As used herein, "detectable and/or measurable activity"
means a statistically significant activity that is not zero.
[0120] As used herein, "essentially unchanged" means little or no
change in a particular parameter, particularly relative to another
parameter which changes much more. In certain embodiments, a
parameter is essentially unchanged when it changes less than 5%. In
certain embodiments, a parameter is essentially unchanged if it
changes less than two-fold while another parameter changes at least
ten-fold. For example, in certain embodiments, an antisense
activity is a change in the amount of a target nucleic acid. In
certain such embodiments, the amount of a non-target nucleic acid
is essentially unchanged if it changes much less than the target
nucleic acid does, but the change need not be zero.
[0121] As used herein, "expression" means the process by which a
gene ultimately results in a protein. Expression includes, but is
not limited to, transcription, post-transcriptional modification
(e.g., splicing, polyadenlyation, addition of 5'-cap), and
translation.
[0122] As used herein, "target nucleic acid" means a nucleic acid
molecule to which an antisense compound hybridizes.
[0123] As used herein, "mRNA" means an RNA molecule that encodes a
protein.
[0124] As used herein, "pre-mRNA" means an RNA transcript that has
not been fully processed into mRNA. Pre-RNA includes one or more
intron.
[0125] As used herein, "transcript" means an RNA molecule
transcribed from DNA. Transcripts include, but are not limited to
non-coding RNA, mRNA, pre-mRNA, and partially processed RNA.
[0126] As used herein, "targeting" or "targeted to" means the
association of an antisense compound to a particular target nucleic
acid molecule or a particular region of a target nucleic acid
molecule. An antisense compound targets a target nucleic acid if it
is sufficiently complementary to the target nucleic acid to allow
hybridization under physiological conditions.
[0127] As used herein, "nucleobase sequence" means the order of
contiguous nucleobases, independent of any sugar, linkage, and/or
nucleobase modification.
[0128] As used herein, "nucleobase complementarity" or
"complementarity" when in reference to nucleobases means a
nucleobase that is capable of base pairing with another nucleobase.
For example, in DNA, adenine (A) is complementary to thymine (T).
For example, in RNA, adenine (A) is complementary to uracil (U). In
certain embodiments, complementary nucleobase means a nucleobase of
an antisense compound that is capable of base pairing with a
nucleobase of its target nucleic acid. For example, if a nucleobase
at a certain position of an antisense compound is capable of
hydrogen bonding with a nucleobase at a certain position of a
target nucleic acid, then the position of hydrogen bonding between
the oligonucleotide and the target nucleic acid is considered to be
complementary at that nucleobase pair. Nucleobases comprising
certain modifications may maintain the ability to pair with a
counterpart nucleobase and thus, are still capable of nucleobase
complementarity.
[0129] As used herein, "non-complementary" in reference to
nucleobases means a pair of nucleobases that do not form hydrogen
bonds with one another.
[0130] As used herein, "complementary" in reference to oligomeric
compounds (e.g., linked nucleosides, oligonucleotides, or nucleic
acids) means the capacity of such oligomeric compounds or regions
thereof to hybridize to another oligomeric compound or region
thereof through nucleobase complementarity under stringent
conditions. Complementary oligomeric compounds need not have
nucleobase complementarity at each nucleoside. Rather, some
mismatches are tolerated. In certain embodiments, complementary
oligomeric compounds or regions are complementary at 70% of the
nucleobases (70% complementary). In certain embodiments,
complementary oligomeric compounds or regions are 80%
complementary. In certain embodiments, complementary oligomeric
compounds or regions are 90% complementary. In certain embodiments,
complementary oligomeric compounds or regions are 95%
complementary. In certain embodiments, complementary oligomeric
compounds or regions are 100% complementary.
[0131] As used herein, "hybridization" means the pairing of
complementary oligomeric compounds (e.g., an antisense compound and
its target nucleic acid). While not limited to a particular
mechanism, the most common mechanism of pairing involves hydrogen
bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen
hydrogen bonding, between complementary nucleobases.
[0132] As used herein, "specifically hybridizes" means the ability
of an oligomeric compound to hybridize to one nucleic acid site
with greater affinity than it hybridizes to another nucleic acid
site. In certain embodiments, an antisense oligonucleotide
specifically hybridizes to more than one target site.
[0133] As used herein, "percent complementarity" means the
percentage of nucleobases of an oligomeric compound that are
complementary to an equal-length portion of a target nucleic acid.
Percent complementarity is calculated by dividing the number of
nucleobases of the oligomeric compound that are complementary to
nucleobases at corresponding positions in the target nucleic acid
by the total length of the oligomeric compound.
[0134] As used herein, "percent identity" means the number of
nucleobases in a first nucleic acid that are the same type
(independent of chemical modification) as nucleobases at
corresponding positions in a second nucleic acid, divided by the
total number of nucleobases in the first nucleic acid.
[0135] As used herein, "modulation" means a change of amount or
quality of a molecule, function, or activity when compared to the
amount or quality of a molecule, function, or activity prior to
modulation. For example, modulation includes the change, either an
increase (stimulation or induction) or a decrease (inhibition or
reduction) in gene expression. As a further example, modulation of
expression can include a change in splice site selection of
pre-mRNA processing, resulting in a change in the absolute or
relative amount of a particular splice-variant compared to the
amount in the absence of modulation.
[0136] As used herein, "motif" means a pattern of chemical
modifications in an oligomeric compound or a region thereof. Motifs
may be defined by modifications at certain nucleosides and/or at
certain linking groups of an oligomeric compound.
[0137] As used herein, "nucleoside motif" means a pattern of
nucleoside modifications in an oligomeric compound or a region
thereof. The linkages of such an oligomeric compound may be
modified or unmodified. Unless otherwise indicated, motifs herein
describing only nucleosides are intended to be nucleoside motifs.
Thus, in such instances, the linkages are not limited.
[0138] As used herein, "sugar motif" means a pattern of sugar
modifications in an oligomeric compound or a region thereof.
[0139] As used herein, "linkage motif" means a pattern of linkage
modifications in an oligomeric compound or region thereof. The
nucleosides of such an oligomeric compound may be modified or
unmodified. Unless otherwise indicated, motifs herein describing
only linkages are intended to be linkage motifs. Thus, in such
instances, the nucleosides are not limited.
[0140] As used herein, "nucleobase modification motif" means a
pattern of modifications to nucleobases along an oligonucleotide.
Unless otherwise indicated, a nucleobase modification motif is
independent of the nucleobase sequence.
[0141] As used herein, "sequence motif" means a pattern of
nucleobases arranged along an oligonucleotide or portion thereof.
Unless otherwise indicated, a sequence motif is independent of
chemical modifications and thus may have any combination of
chemical modifications, including no chemical modifications.
[0142] As used herein, "fully modified motif" means an
oligonucleotide or a portion thereof wherein each nucleobase, each
sugar, and/or each internucleoside linkage is modified.
[0143] As used herein, "uniformly modified motif" means an
oligonucleotide or a portion thereof wherein each nucleobase, each
sugar, and/or each internucleoside linkage has the same
modification throughout the modified oligonucleotide or portion
thereof.
[0144] As used herein, "alternating motif" means an oligonucleotide
or a portion thereof, having at least four separate regions of
modified nucleosides in a pattern (AB).sub.nA.sub.m where A
represents a region of nucleosides having a first type of
modification; B represent a region of nucleosides having a
different type of modification; n is 2-15; and m is 0 or 1. Thus,
in certain embodiments, alternating motifs include 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more
alternating regions. In certain embodiments, each A region and each
B region independently comprises 1-4 nucleosides.
[0145] As used herein, "type of modification" in reference to a
nucleoside or a nucleoside of a "type" means the chemical
modification of a nucleoside and includes modified and unmodified
nucleosides. Accordingly, unless otherwise indicated, a "nucleoside
having a modification of a first type" may be an unmodified
nucleoside.
[0146] As used herein, "differently modified" mean chemical
modifications or chemical substituents that are different from one
another, including absence of modifications. Thus, for example, a
MOE nucleoside and an unmodified DNA nucleoside are "differently
modified," even though the DNA nucleoside is unmodified. Likewise,
DNA and RNA are "differently modified," even though both are
naturally-occurring unmodified nucleosides. Nucleosides that are
the same but for comprising different nucleobases are not
differently modified. For example, a nucleoside comprising a 2'-OMe
modified sugar and an unmodified adenine nucleobase and a
nucleoside comprising a 2'-OMe modified sugar and an unmodified
thymine nucleobase are not differently modified.
[0147] As used herein, "the same type of modifications" refers to
modifications that are the same as one another, including absence
of modifications. Thus, for example, two unmodified DNA nucleoside
have "the same type of modification," even though the DNA
nucleoside is unmodified. Such nucleosides having the same type
modification may comprise different nucleobases.
[0148] As used herein, "pharmaceutically acceptable carrier or
diluent" means any substance suitable for use in administering to
an animal. In certain embodiments, a pharmaceutically acceptable
carrier or diluent is sterile saline. In certain embodiments, such
sterile saline is pharmaceutical grade saline.
[0149] As used herein, "animal" includes human and non-human
animals.
[0150] As used herein, "subject" means a human or non-human animal
selected for treatment or therapy.
[0151] As used herein, "subject in need thereof" means a subject
identified as in need of a therapy or treatment. In such
embodiments, a subject has one or more indications of having or
developing SMA.
[0152] As used herein, "administering" means providing a
pharmaceutical agent or composition to a subject, and includes, but
is not limited to, administering by a medical professional and
self-administering.
[0153] As used herein, "parenteral administration," means
administration through injection or infusion. Parenteral
administration includes, but is not limited to, subcutaneous
administration, intravenous administration, or intramuscular
administration.
[0154] As used herein, "systemic administration" means
administration to an area other than the intended locus of
activity. Examples or systemic administration are subcutaneous
administration and intravenous administration, and intraperitoneal
administration.
[0155] As used herein, "subcutaneous administration" means
administration just below the skin.
[0156] As used herein, "intravenous administration" means
administration into a vein.
[0157] As used herein, "cerebrospinal fluid" or "CSF" means the
fluid filling the space around the brain and spinal cord.
[0158] As used herein, "administration into the cerebrospinal
fluid" means any administration that delivers a substance directly
into the CSF.
[0159] As used herein, "intracerebroventricular" or "ICV" mean
administration into the ventricular system of the brain.
[0160] As used herein, "intrathecal" or "IT" means administration
into the CSF under the arachnoid membrane which covers the brain
and spinal cord. IT injection is performed through the theca of the
spinal cord into the subarachnoid space, where a pharmaceutical
agent is injected into the sheath surrounding the spinal cord.
[0161] As used herein, "amelioration" means a lessening of severity
of at least one indicator of a condition or disease. In certain
embodiments, amelioration includes a delay or slowing in the
progression of one or more indicators of a condition or disease.
The severity of indicators may be determined by subjective or
objective measures which are known to those skilled in the art.
[0162] As used herein, "prevent the onset of" means to prevent the
development a condition or disease in a subject who is at risk for
developing the disease or condition. In certain embodiments, a
subject at risk for developing the disease or condition receives
treatment similar to the treatment received by a subject who
already has the disease or condition.
[0163] As used herein, "delay the onset of" means to delay the
development of a condition or disease in a subject who is at risk
for developing the disease or condition.
[0164] As used herein, "slow the progression of" means that the
severity of at least one symptom associated with a disease or
condition worsens less quickly. As used herein, "exon 7 amino
acids" means the portion of an SMN protein that correspond to exon
7 of the SMN RNA. Exon 7 amino acids are present in SMN protein
expressed from SMN RNA where exon 7 was not excluded during
splicing.
[0165] As used herein, "SMN protein" means normal full length
survival motor neuron protein. SMN may be expressed from either an
SMN1 gene or from an SMN2 gene, provided that exon 7 is present in
the mature mRNA and the exon 7 amino acids are present in the SMN
protein.
[0166] As used herein, "dose" means a specified quantity of a
pharmaceutical agent provided in a single administration or over a
specified amount of time. In certain embodiments, a dose may be
administered in two or more boluses, tablets, or injections. For
example, in certain embodiments, where subcutaneous or inrathecal
or ICV administration is desired, the desired dose requires a
volume not easily accommodated by a single injection. In such
embodiments, two or more injections may be used to achieve the
desired dose. In the setting of continuous infusion, dose may be
expressed as the quantity of a pharmaceutical agent delivered per
unit of time.
[0167] As used herein, "therapeutically effective amount" means an
amount of a pharmaceutical agent that provides a therapeutic
benefit to an animal.
[0168] As used herein, "growth hormone" or "GH" means a hormone
secreted by somatotropic cells under control of hypothalamic factor
in an animal and analogs thereof, whether produced naturally in an
animal, in cells or extracts, or chemically synthesized.
[0169] As used herein, "growth hormone/insulin-like growth factor 1
axis" or "GF/IGF-1 axis" means a system of biological molecules
("GF/IGF-1 axis molecules") that include growth hormone and
insulin-like growth factor 1 (IGF-1) and moleculest that modulate
and/or are modulated by growth hormone and or insulin-like growth
factor 1 (IGF-1). GF/IGF-1 axis molecules include but are not
limited to: growth hormone, insulin-like growth factor 1 (IGF-1),
insulin-like growth factor 2 (IGF-2); insulin-like growth factor 1
receptor (IGFR-1), insulin-like growth factor 2 receptor (IGFR-2),
insulin-like growth factor binding protein 1 (IGBP-1), insulin-like
growth factor binding protein 2 (IGBP-2), insulin-like growth
factor binding protein 3 (IGBP-3), insulin-like growth factor
binding protein 4 (IGBP-4), insulin-like growth factor binding
protein 5 (IGBP-5), insulin-like growth factor binding protein 6
(IGBP-6), IGF degrading proteins, and insulin-like growth factor
binding protein acid labile subunit (IGFALS).
[0170] As used herein, "GF/IGF-1 axis modulator" refers a molecule
that modulates the GF/IGF-1 axis in an animal other than an
antisense compound that alters splicing of SMN2. GF/IGF-1 axis
modulators include, but are not limited to natural molecules that
make up the GF/IGF-1 axis (GF/IGF-1 axis molecules) and analogs
thereof, whether produced in cells or chemically synthesized, as
well as other chemical or biologic molecules that modulate the
amount or activity of such GF/IGF-1 axis molecules. GF/IGF-1 axis
modulators typically affect the amount, activity, sensitivity,
and/or stability of one or more GF/IGF-1 axis molecule. In certain
embodiments, a GF/IGF-1 axis modulator affects the stability of one
or more GF/IGF-1 axis molecule. In certain embodiments, a GF/IGF-1
axis modulator affects the distribution or localization of one or
more GF/IGF-1 axis molecule in a subject.
[0171] As used herein, "substituent" and "substituent group," means
an atom or group that replaces the atom or group of a named parent
compound. For example a substituent of a modified nucleoside is any
atom or group that differs from the atom or group found in a
naturally occurring nucleoside (e.g., a modified 2'-substuent is
any atom or group at the 2'-position of a nucleoside other than H
or OH). Substituent groups can be protected or unprotected. In
certain embodiments, compounds of the present invention have
substituents at one or at more than one position of the parent
compound. Substituents may also be further substituted with other
substituent groups and may be attached directly or via a linking
group such as an alkyl or hydrocarbyl group to a parent
compound.
[0172] Likewise, as used herein, "substituent" in reference to a
chemical functional group means an atom or group of atoms differs
from the atom or a group of atoms normally present in the named
functional group. In certain embodiments, a substituent replaces a
hydrogen atom of the functional group (e.g., in certain
embodiments, the substituent of a substituted methyl group is an
atom or group other than hydrogen which replaces one of the
hydrogen atoms of an unsubstituted methyl group). Unless otherwise
indicated, groups amenable for use as substituents include without
limitation, halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl
(--C(O)R.sub.aa), carboxyl (--C(O)O--R.sub.aa), aliphatic groups,
alicyclic groups, alkoxy, substituted oxy (--O--R.sub.aa), aryl,
aralkyl, heterocyclic radical, heteroaryl, heteroarylalkyl, amino
(--N(R.sub.bb)(R.sub.cc)), imino(.dbd.NR.sub.bb), amido
(--C(O)N(R.sub.bb)(R.sub.cc) or --N(R.sub.bb)C(O)R.sub.aa), azido
(--N.sub.3), nitro (--NO.sub.2), cyano (--CN), carbamido
(--OC(O)N(R.sub.bb)(R.sub.cc) or --N(R.sub.bb)C(O)N(R.sub.aa),
ureido (--N(R.sub.bb)C(O)N(R.sub.bb)(R.sub.cc)), thioureido
(--N(R.sub.bb)C(S)N(R.sub.bb)--(R.sub.cc)), guanidinyl
(--N(R.sub.bb)C(.dbd.NR.sub.bb)N(R.sub.bb)(R.sub.cc)), amidinyl
(--C(.dbd.NR.sub.bb)N(R.sub.bb)(R.sub.cc) or
--N(R.sub.bb)C(.dbd.NR.sub.bb)(R.sub.aa)), thiol (--SR.sub.bb),
sulfinyl (--S(O)R.sub.bb), sulfonyl (--S(O).sub.2R.sub.bb) and
sulfonamidyl (--S(O).sub.2N(R.sub.bb)(R.sub.cc) or
--N(R.sub.bb)S--(O).sub.2R.sub.bb). Wherein each R.sub.aa, R.sub.bb
and R.sub.cc is, independently, H, an optionally linked chemical
functional group or a further substituent group with a preferred
list including without limitation, alkyl, alkenyl, alkynyl,
aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic,
heterocyclic and heteroarylalkyl. Selected substituents within the
compounds described herein are present to a recursive degree.
[0173] As used herein, "alkyl," as used herein, means a saturated
straight or branched hydrocarbon radical containing up to twenty
four carbon atoms. Examples of alkyl groups include without
limitation, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl,
octyl, decyl, dodecyl and the like. Alkyl groups typically include
from 1 to about 24 carbon atoms, more typically from 1 to about 12
carbon atoms (C.sub.1-C.sub.12 alkyl) with from 1 to about 6 carbon
atoms being more preferred.
[0174] As used herein, "alkenyl," means a straight or branched
hydrocarbon chain radical containing up to twenty four carbon atoms
and having at least one carbon-carbon double bond. Examples of
alkenyl groups include without limitation, ethenyl, propenyl,
butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadiene and
the like. Alkenyl groups typically include from 2 to about 24
carbon atoms, more typically from 2 to about 12 carbon atoms with
from 2 to about 6 carbon atoms being more preferred. Alkenyl groups
as used herein may optionally include one or more further
substituent groups.
[0175] As used herein, "alkynyl," means a straight or branched
hydrocarbon radical containing up to twenty four carbon atoms and
having at least one carbon-carbon triple bond. Examples of alkynyl
groups include, without limitation, ethynyl, 1-propynyl, 1-butynyl,
and the like. Alkynyl groups typically include from 2 to about 24
carbon atoms, more typically from 2 to about 12 carbon atoms with
from 2 to about 6 carbon atoms being more preferred. Alkynyl groups
as used herein may optionally include one or more further
substituent groups.
[0176] As used herein, "acyl," means a radical formed by removal of
a hydroxyl group from an organic acid and has the general Formula
--C(O)--X where X is typically aliphatic, alicyclic or aromatic.
Examples include aliphatic carbonyls, aromatic carbonyls, aliphatic
sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic
phosphates, aliphatic phosphates and the like. Acyl groups as used
herein may optionally include further substituent groups.
[0177] As used herein, "alicyclic" means a cyclic ring system
wherein the ring is aliphatic. The ring system can comprise one or
more rings wherein at least one ring is aliphatic. Preferred
alicyclics include rings having from about 5 to about 9 carbon
atoms in the ring. Alicyclic as used herein may optionally include
further substituent groups.
[0178] As used herein, "aliphatic" means a straight or branched
hydrocarbon radical containing up to twenty four carbon atoms
wherein the saturation between any two carbon atoms is a single,
double or triple bond. An aliphatic group preferably contains from
1 to about 24 carbon atoms, more typically from 1 to about 12
carbon atoms with from 1 to about 6 carbon atoms being more
preferred. The straight or branched chain of an aliphatic group may
be interrupted with one or more heteroatoms that include nitrogen,
oxygen, sulfur and phosphorus. Such aliphatic groups interrupted by
heteroatoms include without limitation, polyalkoxys, such as
polyalkylene glycols, polyamines, and polyimines. Aliphatic groups
as used herein may optionally include further substituent
groups.
[0179] As used herein, "alkoxy" means a radical formed between an
alkyl group and an oxygen atom wherein the oxygen atom is used to
attach the alkoxy group to a parent molecule. Examples of alkoxy
groups include without limitation, methoxy, ethoxy, propoxy,
isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy,
neopentoxy, n-hexoxy and the like. Alkoxy groups as used herein may
optionally include further substituent groups.
[0180] As used herein, "aminoalkyl" means an amino substituted
C.sub.1-C.sub.12 alkyl radical. The alkyl portion of the radical
forms a covalent bond with a parent molecule. The amino group can
be located at any position and the aminoalkyl group can be
substituted with a further substituent group at the alkyl and/or
amino portions.
[0181] As used herein, "aralkyl" and "arylalkyl" mean an aromatic
group that is covalently linked to a C.sub.1-C.sub.12 alkyl
radical. The alkyl radical portion of the resulting aralkyl (or
arylalkyl) group forms a covalent bond with a parent molecule.
Examples include without limitation, benzyl, phenethyl and the
like. Aralkyl groups as used herein may optionally include further
substituent groups attached to the alkyl, the aryl or both groups
that form the radical group.
[0182] As used herein, "aryl" and "aromatic" mean a mono- or
polycyclic carbocyclic ring system radicals having one or more
aromatic rings. Examples of aryl groups include without limitation,
phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like.
Preferred aryl ring systems have from about 5 to about 20 carbon
atoms in one or more rings. Aryl groups as used herein may
optionally include further substituent groups.
[0183] As used herein, "halo" and "halogen," mean an atom selected
from fluorine, chlorine, bromine and iodine.
[0184] As used herein, "heteroaryl," and "heteroaromatic," mean a
radical comprising a mono- or poly-cyclic aromatic ring, ring
system or fused ring system wherein at least one of the rings is
aromatic and includes one or more heteroatoms. Heteroaryl is also
meant to include fused ring systems including systems where one or
more of the fused rings contain no heteroatoms. Heteroaryl groups
typically include one ring atom selected from sulfur, nitrogen or
oxygen. Examples of heteroaryl groups include without limitation,
pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl,
thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl,
thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl,
benzooxazolyl, quinoxalinyl and the like. Heteroaryl radicals can
be attached to a parent molecule directly or through a linking
moiety such as an aliphatic group or hetero atom. Heteroaryl groups
as used herein may optionally include further substituent
groups.
Spinal Muscular Atrophy (SMA)
[0185] SMA is a genetic disorder characterized by degeneration of
spinal motor neurons. SMA is caused by the homozygous loss of both
functional copies of the SMN1 gene. However, the SMN2 gene has the
potential to code for the same protein as SMN1 and thus overcome
the genetic defect of SMA patients. SMN2 contains a translationally
silent mutation (C.fwdarw.T) at position +6 of exon 7, which
results in inefficient inclusion of exon 7 in SMN2 transcripts.
Therefore, the predominant form of SMN2 protein, one which lacks
exon 7 amino acids, is unstable and inactive. Therapeutic compounds
capable of modulating SMN2 splicing such that the percentage of
SMN2 transcripts containing exon 7 is increased, have been shown in
animal models to be useful for the treatment of SMA. See, e.g., WO
2010/148249, incorporated herein for any purpose. For example, an
antisense compound complementary to a portion of intron 7 alters
splicing of SMN2 to include exon 7, resulting in functional SMN
protein. Dramatic therapeutic benefit was observed when such
antisense compound was administered to the CSF of SMA mice.
[0186] Further, and surprisingly, systemic administration of such
compounds was also shown to provide therapeutic benefit, either
alone or in combination with administration to the CSF. Since
oligonucleotides do not cross the blood-brain barrier, such
systemic administration is expected result in reduced antisense
compound in neurons. While some evidence suggests that functional
SMN inside neurons is required for normal neuron function, the
consequence of reduced functional SMN in other cells and tissues
has not been well characterized.
The GH/IGF-1 Axis
[0187] Insulin-like growth factor-1 (IGF-1) is secreted principally
by the liver in response to growth hormone (GH). These molecules
(GH and IGF-1) and molecules involved in regulation of these
molecules are referred to as the GH/IGF-1 axis.
[0188] In certain instances, animals that have SMA, including SMA
mice, are smaller than animals that do not have SMA. Thus, it was
speculated that at least some of the observed therapeutic benefit
of systemic administration of antisense compounds that alter
splicing of SMN2 was attributable to the effect of reduced
functional SMN protein on the GH/IGF-1 axis.
[0189] Certain embodiments of the present invention flow from the
discovery that serum from SMA mice showed reduced IGF-1 compared to
normal mice or to SMA mice treated systemically with an antisense
compound the alters splicing of SMN2 to include exon 7. RT-PCR from
such mice showed that hepatic mRNA of IGF-1 was not reduced,
suggesting that the expression levels of IGF-1 are not altered.
However, mRNA of IGF-binding-protein acid labile subunit (IGFALS)
was reduced in SMA mice. IGFALS binds to IGF-1 and IGF-1 binding
protein 3 (IGFBP3) forming a stable complex which extends the half
life of IGF-1 from about 10 minutes to 12-15 hours. Thus, in
certain circumstances, reduced functional SMN results in reduced
IGFALS, which in turn results in decreased stability of IGF-1
(because it is not complexed with IGFALS) and ultimately reduced
IGF-1 levels. In certain embodiments, reduced IGF-1 has physiologic
consequences, including but not limited to cardiac defects, and
poor growth.
[0190] IGF-1 is also a potent neurotrophic factor. It enhances
growth-cone mobility, potentiates long-term neurite outgrowth,
inhibits neuronal apoptosis, and promotes neurogenesis and
synaptogenisis. Circulating IGF-1 crosses the blood-brain barrier.
Thus, reduced circulating IGF-1 levels in the setting of SMA likely
results in reduced IGF-1 in the CNS. Such reduced IGF-1 in the CNS
may contribute to SMA neuropathology. Thus, in certain embodiments,
restoration of normal HG/IGF-1 axis ameliorates symptoms in the CNS
as well as symptoms outside the CNS.
[0191] In certain embodiments, the present invention provides
methods of modulating the GH/IGF-1 axis in an animal having SMA. In
certain embodiments, the present invention provides methods of
increasing activity of the GH/IGF-1 axis in an animal having SMA.
In certain embodiments, the invention provides methods of
administering at least one GH/IGF-1 axis molecule (e.g., GH, IGF-1
or IGFALS). In certain embodiments, the invention provides
administration of at least one compound that modulates the
expression, activity and/or stability of at least one GH/IGF-1 axis
molecule. In certain embodiments, the invention provides
administration of at least one compound that increases the
expression, activity and/or stability of at least one GH/IGF-1 axis
molecule. In certain embodiments, the invention provides
administration of at least one compound that increases activity of
the GH/IGF-1 axis and one compound that alters splicing of SMN2 to
increase inclusion of exon 7 in an animal having SMA.
[0192] In certain embodiments the invention provides administration
of at least one GH/IGF-1 axis modulator to a subject with SMA. In
certain embodiments, the GH/IGF-1 axis modulator is a gene encoding
a GH/IGF-1 axis molecule. In certain embodiment, the GH/IGF-1 axis
modulator is a GH/IGF-1 axis molecule. In certain embodiments, the
GH/IGF-1 axis modulator is a compound that increases stability or
expression of at least one GH/IGF-1 axis molecule.
[0193] In certain embodiments, an antisense compound that modulates
splicing of SMN2 to increase the amount of exon 7 retained SMN
protein is also administered.
Oligomeric Compounds
[0194] In certain embodiments, the present invention provides
oligomeric compounds. In certain embodiments, such oligomeric
compounds comprise oligonucleotides optionally comprising one or
more conjugate groups. In certain embodiments, an oligomeric
compound consists of an oligonucleotide. In certain embodiments,
the oligonucleotides comprise one or more chemical modifications.
Such chemical modifications include modifications one or more
nucleoside (including modifications to the sugar moiety and/or the
nucleobase) and/or modifications to one or more internucleoside
linkage.
Certain Sugar Moieties
[0195] In certain embodiments, oligomeric compounds of the
invention comprise one or more modifed nucleosides comprising a
modifed sugar moiety. Such oligomeric compounds comprising one or
more sugar-modified nucleosides may have desirable properties, such
as enhanced nuclease stability or increased binding affinity with a
target nucleic acid relative to oligomeric compounds comprising
only nucleosides comprising naturally occurring sugar moieties. In
certain embodiments, modified sugar moieties are substituted sugar
moieties. In certain embodiments, modified sugar moieties are
bicyclic or tricyclic sugar moieties. In certain embodiments,
modified sugar moieties are sugar surrogates. Such sugar surogates
may comprise one or more substitutions corresponding to those of
substituted sugar moieties.
[0196] In certain embodiments, modified sugar moieties are
substituted sugar moieties comprising one or more substituent,
including but not limited to substituents at the 2' and/or 5'
positions. Examples of sugar substituents suitable for the
2'-position, include, but are not limited to: 2'-F, 2'-OCH3("OMe"
or "O-methyl"), and 2'-O(CH.sub.2).sub.2OCH.sub.3("MOE"). In
certain embodiments, sugar substituents at the 2' position is
selected from allyl, amino, azido, thio, O-allyl,
O--C.sub.1-C.sub.10 alkyl, O--C.sub.1-C.sub.10 substituted alkyl;
O--C.sub.1-C.sub.10 alkoxy; O--C.sub.1-C.sub.10 substituted alkoxy,
OCF.sub.3, O(CH.sub.2).sub.2SCH.sub.3,
O(CH.sub.2).sub.2--O--N(Rm)(Rn), and
O--CH.sub.2--C(.dbd.O)--N(Rm)(Rn), where each Rm and Rn is,
independently, H or substituted or unsubstituted C.sub.1-C.sub.10
alkyl. Examples of sugar substituents at the 5'-position, include,
but are not limited to: 5'-methyl (R or S); 5'-vinyl, and
5'-methoxy. In certain embodiments, substituted sugars comprise
more than one non-bridging sugar substituent, for example,
2'-F-5'-methyl sugar moieties (see, e.g., PCT International
Application WO 2008/101157, for additional 5', 2'-bis substituted
sugar moieties and nucleosides).
[0197] Nucleosides comprising 2'-substituted sugar moieties are
referred to as 2'-substituted nucleosides. In certain embodiments,
a 2'-substituted nucleoside comprises a 2'-substituent group
selected from halo, allyl, amino, azido, O--C.sub.1-C.sub.10
alkoxy; O--C.sub.1-C.sub.10 substituted alkoxy, SH, CN, OCN,
CF.sub.3, OCF.sub.3, O-alkyl, S-alkyl, N(R.sub.m)-alkyl; O-alkenyl,
S-alkenyl, or N(R.sub.m)-alkenyl; O-alkynyl, S-alkynyl,
N(R.sub.m)-alkynyl; O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl,
O-alkaryl, O-aralkyl, O(CH.sub.2).sub.2SCH.sub.3,
O-(CH.sub.2).sub.2-O--N(R.sub.m)(R.sub.n) or
O--CH.sub.2-C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H, an amino protecting group or
substituted or unsubstituted C.sub.1-C.sub.10 alkyl. These
2'-substituent groups can be further substituted with one or more
substituent groups independently selected from hydroxyl, amino,
alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol,
thioalkoxy (S-alkyl), halogen, alkyl, aryl, alkenyl and
alkynyl.
[0198] In certain embodiments, a 2'-substituted nucleoside
comprises a 2'-substituent group selected from F, NH.sub.2,
N.sub.3, OCF.sub.3, O--CH.sub.3, O(CH.sub.2).sub.3NH.sub.2,
CH2--CH.dbd.CH.sub.2, O--CH.sub.2--CH.dbd.CH.sub.2,
OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n),
O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and
N-substituted acetamide
(O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n) where each R.sub.m and
R.sub.n is, independently, H, an amino protecting group or
substituted or unsubstituted C.sub.1-C.sub.10 alkyl.
[0199] In certain embodiments, a 2'-substituted nucleoside
comprises a sugar moiety comprising a 2'-substituent group selected
from F, OCF.sub.3, O--CH.sub.3, OCH.sub.2CH.sub.2OCH.sub.3,
O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(CH.sub.3).sub.2,
--O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and
O--CH.sub.2--C(.dbd.O)--N(H)CH.sub.3.
[0200] In certain embodiments, a 2'-substituted nucleoside
comprises a sugar moiety comprising a 2'-substituent group selected
from F, O--CH.sub.3, and OCH.sub.2CH.sub.2OCH.sub.3.
[0201] Certain modifed sugar moieties comprise a bridging sugar
substituent that forms a second ring resulting in a bicyclic sugar
moiety. In certain such embodiments, the bicyclic sugar moiety
comprises a bridge between the 4' and the 2' furanose ring atoms.
Examples of such 4' to 2' sugar substituents, include, but are not
limited to: --[C(R.sub.a)(R.sub.b)].sub.n-,
--[C(R.sub.a)(R.sub.b)].sub.n--O--, --C(R.sub.aR.sub.b)--N(R)--O--
or, --C(R.sub.aR.sub.b)--O--N(R)--; 4'--CH.sub.2-2',
4'--(CH.sub.2).sub.2-2', 4'--(CH.sub.2).sub.3-2',
4'--(CH.sub.2)--O-2'(LNA); 4'--(CH.sub.2)--S-2;
4'-(CH.sub.2).sub.2--O- 2'(ENA); 4'--CH(CH.sub.3)---O-2'(cEt) and
4'13 CH(CH.sub.2OCH.sub.3)--O-2', and analogs thereof (see, e.g.,
U.S. Pat. No.7,399,845, issued on Jul. 15, 2008);
4'-C(CH.sub.3)(CH.sub.3)--O-2' and analogs thereof, (see, e.g.,
WO2009/006478, published Jan. 8, 2009);
4'--CH.sub.2--N(OCH.sub.3)-2' and analogs thereof (see, e.g.,
WO2008/150729, published Dec. 11, 2008);
4'--CH.sub.2--O--N(CH.sub.3)-2' (see, e.g., US2004/0171570,
published Sep. 2, 2004); 4'--CH.sub.2--O--N(R)-2', and
4'--CH.sub.2--N(R)--O--2'-, wherein each R is, independently, H, a
protecting group, or C.sub.1-C.sub.12 alkyl;
4'--CH.sub.2--N(R)--O---2', wherein R is H, C.sub.1-C.sub.12 alkyl,
or a protecting group (see, U.S. Pat. No. 7,427,672, issued on Sep.
23, 2008); 4'--CH.sub.2--C(H)(CH.sub.3)-2' (see, e.g.,
Chattopadhyaya, et al., J. Org. Chem., 2009, 74, 118-134); and
4'--CH.sub.2-C(.dbd.CH.sub.2)-2' and analogs thereof (see,
published PCT International Application WO 2008/154401, published
on Dec. 8, 2008).
[0202] In certain embodiments, such 4' to 2' bridges independently
comprise from 1 to 4 linked groups independently selected from
--[C(R.sub.a)(R.sub.b)].sub.n-, --C(R.sub.a).dbd.C(R.sub.b)--,
--C(R.sub.a).dbd.N--, --C(.dbd.NR.sub.a)--, --C(.dbd.O)--,
--C(.dbd.S)--, --O--, --Si(R.sub.a).sub.2-, --S(.dbd.O).sub.x-, and
--N(R.sub.a)--;
[0203] wherein:
[0204] x is 0, 1, or 2;
[0205] n is 1, 2, 3, or 4;
[0206] each R.sub.a and R.sub.b is, independently, H, a protecting
group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted
C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle
radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7
alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical,
halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1,
acyl (C(.dbd.O)--H), substituted acyl, CN, sulfonyl
(S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and
[0207] each J.sub.1 and J.sub.2 is, independently, H,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl
(C(.dbd.O)--H), substituted acyl, a heterocycle radical, a
substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl,
substituted C.sub.1-C.sub.12 aminoalkyl, or a protecting group.
[0208] Nucleosides comprising bicyclic sugar moieties are referred
to as bicyclic nucleosides or BNAs. Bicyclic nucleosides include,
but are not limited to, (A) .alpha.-L-Methyleneoxy
(4'--CH.sub.2--O-2') BNA, (B) .beta.-D-Methyleneoxy
(4'-CH.sub.2--O-2') BNA (also referred to as locked nucleic acid or
LNA), (C) Ethyleneoxy (4'--(CH.sub.2).sub.2--O-2') BNA, (D)
Aminooxy (4'-CH.sub.2--O--N(R)-2') BNA, (E) Oxyamino
(4'--CH.sub.2--N(R)--O-2') BNA, (F) Methyl(methyleneoxy)
(4'--CH(CH.sub.3)--O-2') BNA (also referred to as constrained ethyl
or cEt), (G) methylene-thio (4'--CH.sub.2--S-2') BNA, (H)
methylene-amino (4'--CH2--N(R)-2') BNA, (I) methyl carbocyclic
(4'--CH.sub.2--CH(CH.sub.3)-2') BNA, and (J) propylene carbocyclic
(4'--(CH.sub.2).sub.3-2') BNA as depicted below.
##STR00001## ##STR00002##
wherein Bx is a nucleobase moiety and R is, independently, H, a
protecting group, or C.sub.1-C.sub.12 alkyl.
[0209] Additional bicyclic sugar moieties are known in the art, for
example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et
al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc.
Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg.
Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem.,
1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc.,
129(26) 8362-8379 (Jul. 4, 2007); Elayadi et al., Curr. Opinion
Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001,
8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243;
U.S. Pat. Nos. 7,053,207, 6,268,490, 6,770,748, 6,794,499,
7,034,133, 6,525,191, 6,670,461, and 7,399,845; WO 2004/106356, WO
1994/14226, WO 2005/021570, and WO 2007/134181; U.S. Patent
Publication Nos. US2004/0171570, US2007/0287831, and
US2008/0039618; U.S. patent Ser. Nos. 12/129,154, 60/989,574,
61/026,995, 61/026,998, 61/056,564, 61/086,231, 61/097,787, and
61/099,844; and PCT International Applications Nos.
PCT/US2008/064591, PCT/US2008/066154, and PCT/US2008/068922.
[0210] In certain embodiments, bicyclic sugar moieties and
nucleosides incorporating such bicyclic sugar moieties are further
defined by isomeric configuration. For example, a nucleoside
comprising a 4'-2' methylene-oxy bridge, may be in the .alpha.-L
configuration or in the .beta.-D configuration. Previously,
.alpha.-L-methyleneoxy (4'--CH.sub.2--O-2') bicyclic nucleosides
have been incorporated into antisense oligonucleotides that showed
antisense activity (Frieden et al., Nucleic Acids Research, 2003,
21, 6365-6372).
[0211] In certain embodiments, substituted sugar moieties comprise
one or more non-bridging sugar substituent and one or more bridging
sugar substituent (e.g., 5'-substituted and 4'-2' bridged sugars).
(see, PCT International Application WO 2007/134181, published on
Nov. 22, 2007, wherein LNA is substituted with, for example, a
5'-methyl or a 5'-vinyl group).
[0212] In certain embodiments, modified sugar moieties are sugar
surrogates. In certain such embodiments, the oxygen atom of the
naturally occurring sugar is substituted, e.g., with a sulfer,
carbon or nitrogen atom. In certain such embodiments, such modified
sugar moiety also comprises bridging and/or non-bridging
substituents as described above. For example, certain sugar
surogates comprise a 4'-sulfer atom and a substitution at the
2'-position (see,e.g., published U.S. Patent Application
US2005/0130923, published on Jun. 16, 2005) and/or the 5' position.
By way of additional example, carbocyclic bicyclic nucleosides
having a 4'-2' bridge have been described (see, e.g., Freier et
al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et
al., J. Org. Chem., 2006, 71, 7731-7740).
[0213] In certain embodiments, sugar surrogates comprise rings
having other than 5-atoms. For example, in certain embodiments, a
sugar surrogate comprises a six-membered tetrahydropyran. Such
tetrahydropyrans may be further modified or substituted.
Nucleosides comprising such modified tetrahydropyrans include, but
are not limited to, hexitol nucleic acid (HNA), anitol nucleic acid
(ANA), manitol nucleic acid (MNA) (see Leumann, C J. Bioorg. &
Med. Chem. (2002) 10:841-854), fluoro HNA (F-HNA), and those
compounds having Formula VII:
##STR00003##
wherein independently for each of said at least one tetrahydropyran
nucleoside analog of Formula VII:
[0214] Bx is a nucleobase moiety;
[0215] T.sub.3 and T.sub.4 are each, independently, an
internucleoside linking group linking the tetrahydropyran
nucleoside analog to the antisense compound or one of T.sub.3 and
T.sub.4 is an internucleoside linking group linking the
tetrahydropyran nucleoside analog to the antisense compound and the
other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a
linked conjugate group, or a 5' or 3'-terminal group; q.sub.1,
q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each,
independently, H, C.sub.1-C.sub.6 alkyl, substituted
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or substituted
C.sub.2-C.sub.6 alkynyl; and
[0216] one of R.sub.1 and R.sub.2 is hydrogen and the other is
selected from halogen, substituted or unsubstituted alkoxy,
NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(.dbd.X)J.sub.1,
OC(.dbd.X)NJ.sub.1J.sub.2, NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2, and
CN, wherein X is O, S or NJ.sub.1, and each J.sub.1, J.sub.2, and
J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.
[0217] In certain embodiments, the modified THP nucleosides of
Formula VII are provided wherein q.sub.1, q.sub.2, q.sub.3,
q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each H. In certain
embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4,
q.sub.5, q.sub.6 and q.sub.7 is other than H. In certain
embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4,
q.sub.5, q.sub.6 and q.sub.7 is methyl. In certain embodiments, THP
nucleosides of Formula VII are provided wherein one of R.sub.1 and
R.sub.2 is F. In certain embodiments, R.sub.1 is fluoro and R.sub.2
is H, R.sub.1 is methoxy and R.sub.2 is H, and R.sub.1 is
methoxyethoxy and R.sub.2 is H.
[0218] Many other bicyclic and tricyclic sugar and sugar surrogate
ring systems are known in the art that can be used to modify
nucleosides (see, e.g., review article: Leumann, J. C, Bioorganic
& Medicinal Chemistry, 2002, 10, 841-854).
[0219] In certain embodiments, sugar surrogates comprise rings
having more than 5 atoms and more than one heteroatom. For example
nucleosides comprising morpholino sugar moieties and their use in
oligomeric compounds has been reported (see for example: Braasch et
al., Biochemistry, 2002, 41, 4503-4510; and U.S. Pat. Nos.
5,698,685; 5,166,315; 5,185,444; and 5,034,506). As used here, the
term "morpholino" means a sugar surrogate having the following
structure:
##STR00004##
In certain embodiments, morpholinos may be modified, for example by
adding or altering various substituent groups from the above
morpholino structure. Such sugar surrogates are referred to herein
as "modifed morpholinos."
[0220] Combinations of modifications are also provided without
limitation, such as 2'-F-5'-methyl substituted nucleosides (see PCT
International Application WO 2008/101157 Published on Aug. 21, 2008
for other disclosed 5', 2'-bis substituted nucleosides) and
replacement of the ribosyl ring oxygen atom with S and further
substitution at the 2'-position (see published U.S. Patent
Application US2005-0130923, published on Jun. 16, 2005) or
alternatively 5'-substitution of a bicyclic nucleic acid (see PCT
International Application WO 2007/134181, published on Nov. 22,
2007 wherein a 4'-CH.sub.2--O-2' bicyclic nucleoside is further
substituted at the 5' position with a 5'-methyl or a 5'-vinyl
group). The synthesis and preparation of carbocyclic bicyclic
nucleosides along with their oligomerization and biochemical
studies have also been described (see, e.g., Srivastava et al., J.
Am. Chem. Soc. 2007, 129(26), 8362-8379).
Certain Nucleobases
[0221] In certain embodiments, nucleosides of the present invention
comprise one or more unmodified nucleobases. In certain
embodiments, nucleosides of the present invention comprise one or
more modifed nucleobases.
[0222] In certain embodiments, modified nucleobases are selected
from: universal bases, hydrophobic bases, promiscuous bases,
size-expanded bases, and fluorinated bases as defined herein.
5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6
substituted purines, including 2-aminopropyladenine,
5-propynyluracil; 5-propynylcytosine; 5-hydroxymethyl cytosine,
xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl
derivatives of adenine and guanine, 2-propyl and other alkyl
derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and
2-thiocytosine, 5-halouracil and cytosine, 5-propynyl
(--C.ident.C--CH.sub.3) uracil and cytosine and other alkynyl
derivatives of pyrimidine bases, 6-azo uracil, cytosine and
thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino,
8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines
and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and
other 5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and
8-azaadenine, 7-deazaguanine and 7-deazaadenine, 3-deazaguanine and
3-deazaadenine, universal bases, hydrophobic bases, promiscuous
bases, size-expanded bases, and fluorinated bases as defined
herein. Further modified nucleobases include tricyclic pyrimidines
such as phenoxazine cytidine([5,4-b][1,4]benzoxazin-2(3H)-one),
phenothiazine cytidine
(1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a
substituted phenoxazine cytidine (e.g.
9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole
cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one).
Modified nucleobases may also include those in which the purine or
pyrimidine base is replaced with other heterocycles, for example
7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
Further nucleobases include those disclosed in U.S. Pat. No.
3,687,808, those disclosed in The Concise Encyclopedia Of Polymer
Science And Engineering, Kroschwitz, J. I., Ed., John Wiley &
Sons, 1990, 858-859; those disclosed by Englisch et al., Angewandte
Chemie, International Edition, 1991, 30, 613; and those disclosed
by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications,
Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288.
Certain Internucleoside Linkages
[0223] In certain embodiments, the present invention provides
oligomeric compounds comprising linked nucleosides. In such
embodiments, nucleosides may be linked together using any
internucleoside linkage. The two main classes of internucleoside
linking groups are defined by the presence or absence of a
phosphorus atom. Representative phosphorus containing
internucleoside linkages include, but are not limited to,
phosphodiesters (P.dbd.O), phosphotriesters, methylphosphonates,
phosphoramidate, and phosphorothioates (P.dbd.S). Representative
non-phosphorus containing internucleoside linking groups include,
but are not limited to, methylenemethylimino
(--CH.sub.2--N(CH.sub.3)--O--CH.sub.2--), thiodiester
(--O--C(O)--S--), thionocarbamate (--O--C(O)(NH)--S--); siloxane
(--O--Si(H).sub.2--O--); and N,N'-dimethylhydrazine
(--CH.sub.2-N(CH.sub.3)--N(CH.sub.3)--). Modified linkages,
compared to natural phosphodiester linkages, can be used to alter,
typically increase, nuclease resistance of the oligomeric compound.
In certain embodiments, internucleoside linkages having a chiral
atom can be prepared as a racemic mixture, or as separate
enantiomers. Representative chiral linkages include, but are not
limited to, alkylphosphonates and phosphorothioates. Methods of
preparation of phosphorous-containing and
non-phosphorous-containing internucleoside linkages are well known
to those skilled in the art.
Certain Motifs
[0224] In certain embodiments, the present invention provides
oligomeric compounds comprising oligonucleotides. In certain
embodiments, such oligonucleotides comprise one or more chemical
modification. In certain embodiments, chemically modified
oligonucleotides comprise one or more modified nucleosides. In
certain embodiments, chemically modified oligonucleotides comprise
one or more modified nucleosides comprising modified sugars. In
certain embodiments, chemically modified oligonucleotides comprise
one or more modified nucleosides comprising one or more modified
nucleobases. In certain embodiments, chemically modified
oligonucleotides comprise one or more modified internucleoside
linkages. In certain embodiments, the chemically modifications
(sugar modifications, nucleobase modifications, and/or linkage
modifications) define a pattern or motif. In certain embodiments,
the patterns of chemical modifications of sugar moieties,
internucleoside linkages, and nucleobases are each independent of
one another. Thus, an oligonucleotide may be described by its sugar
modification motif, internucleoside linkage motif and/or nucleobase
modification motif (as used herein, nucleobase modification motif
describes the chemical modifications to the nucleobases independent
of the sequence of nucleobases).
Certain Sugar Motifs
[0225] In certain embodiments, oligonucleotides comprise one or
more type of modified sugar moieties and/or naturally occurring
sugar moieties arranged along an oligonucleotide or region thereof
in a defined pattern or sugar modification motif. Such motifs may
include any of the sugar modifications discussed herein and/or
other known sugar modifications.
[0226] In certain embodiments, the oligonucleotides comprise or
consist of a region having a gapmer sugar modification motif, which
comprises two external regions or "wings" and an internal region or
"gap." The three regions of a gapmer motif (the 5'-wing, the gap,
and the 3'-wing) form a contiguous sequence of nucleosides wherein
at least some of the sugar moieties of the nucleosides of each of
the wings differ from at least some of the sugar moieties of the
nucleosides of the gap. Specifically, at least the sugar moieties
of the nucleosides of each wing that are closest to the gap (the
3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the
3'-wing) differ from the sugar moiety of the neighboring gap
nucleosides, thus defining the boundary between the wings and the
gap. In certain embodiments, the sugar moieties within the gap are
the same as one another. In certain embodiments, the gap includes
one or more nucleoside having a sugar moiety that differs from the
sugar moiety of one or more other nucleosides of the gap. In
certain embodiments, the sugar modification motifs of the two wings
are the same as one another (symmetric gapmer). In certain
embodiments, the sugar modification motifs of the 5'-wing differs
from the sugar modification motif of the 3'-wing (asymmetric
gapmer). In certain embodiments, oligonucleotides comprise 2'-MOE
modified nucleosides in the wings and 2'-F modified nucleosides in
the gap.
[0227] In certain embodiments, oligonucleotides are fully modified.
In certain such embodiments, oligonucleotides are uniformly
modified. In certain embodiments, oligonucleotides are uniform
2'-MOE. In certain embodiments, oligonucleotides are uniform 2'-F.
In certain embodiments, oligonucleotides are uniform morpholino. In
certain embodiments, oligonucleotides are uniform BNA. In certain
embodiments, oligonucleotides are uniform LNA. In certain
embodiments, oligonucleotides are uniform cEt.
[0228] In certain embodiments, oligonucleotides comprise a
uniformly modified region and additional nucleosides that are
unmodified or differently modified. In certain embodiments, the
uniformly modified region is at least 5, 10, 15, or 20 nucleosides
in length. In certain embodiments, the uniform region is a 2'-MOE
region. In certain embodiments, the uniform region is a 2'-F
region. In certain embodiments, the uniform region is a morpholino
region. In certain embodiments, the uniform region is a BNA region.
In certain embodiments, the uniform region is a LNA region. In
certain embodiments, the uniform region is a cEt region.
[0229] In certain embodiments, the oligonucleotide does not
comprise more than 4 contiguous unmodified 2'-deoxynucleosides. In
certain circumstances, antisesense oligonucleotides comprising more
than 4 contiguous 2'-deoxynucleosides activate RNase H, resulting
in cleavage of the target RNA. In certain embodiments, such
cleavage is avoided by not having more than 4 contiguous
2'-deoxynucleosides, for example, where alteration of splicing and
not cleavage of a target RNA is desired.
Certain Internucleoside Linkage Motifs
[0230] In certain embodiments, oligonucleotides comprise modified
internucleoside linkages arranged along the oligonucleotide or
region thereof in a defined pattern or modified internucleoside
linkage motif. In certain embodiments, internucleoside linkages are
arranged in a gapped motif, as described above for sugar
modification motif. In such embodiments, the internucleoside
linkages in each of two wing regions are different from the
internucleoside linkages in the gap region. In certain embodiments
the internucleoside linkages in the wings are phosphodiester and
the internucleoside linkages in the gap are phosphorothioate. The
sugar modification motif is independently selected, so such
oligonucleotides having a gapped internucleoside linkage motif may
or may not have a gapped sugar modification motif and if it does
have a gapped sugar motif, the wing and gap lengths may or may not
be the same.
[0231] In certain embodiments, oligonucleotides comprise a region
having an alternating internucleoside linkage motif In certain
embodiments, oligonucleotides of the present invention comprise a
region of uniformly modified internucleoside linkages. In certain
such embodiments, the oligonucleotide comprises a region that is
uniformly linked by phosphorothioate internucleoside linkages. In
certain embodiments, the oligonucleotide is uniformly linked by
phosphorothioate. In certain embodiments, each internucleoside
linkage of the oligonucleotide is selected from phosphodiester and
phosphorothioate. In certain embodiments, each internucleoside
linkage of the oligonucleotide is selected from phosphodiester and
phosphorothioate and at least one internucleoside linkage is
phosphorothioate.
[0232] In certain embodiments, the oligonucleotide comprises at
least 6 phosphorothioate internucleoside linkages. In certain
embodiments, the oligonucleotide comprises at least 8
phosphorothioate internucleoside linkages. In certain embodiments,
the oligonucleotide comprises at least 10 phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises at least one block of at least 6
consecutive phosphorothioate internucleoside linkages. In certain
embodiments, the oligonucleotide comprises at least one block of at
least 8 consecutive phosphorothioate internucleoside linkages. In
certain embodiments, the oligonucleotide comprises at least one
block of at least 10 consecutive phosphorothioate internucleoside
linkages. In certain embodiments, the oligonucleotide comprises at
least block of at least one 12 consecutive phosphorothioate
internucleoside linkages. In certain such embodiments, at least one
such block is located at the 3' end of the oligonucleotide. In
certain such embodiments, at least one such block is located within
3 nucleosides of the 3' end of the oligonucleotide.
Certain Nucleobase Modification Motifs
[0233] In certain embodiments, oligonucleotides comprise chemical
modifications to nucleobases arranged along the oligonucleotide or
region thereof in a defined pattern or nucleobases modification
motif. In certain such embodiments, nucleobase modifications are
arranged in a gapped motif. In certain embodiments, nucleobase
modifications are arranged in an alternating motif In certain
embodiments, each nucleobase is modified. In certain embodiments,
none of the nucleobases is chemically modified.
[0234] In certain embodiments, oligonucleotides comprise a block of
modified nucleobases. In certain such embodiments, the block is at
the 3'-end of the oligonucleotide. In certain embodiments the block
is within 3 nucleotides of the 3'-end of the oligonucleotide. In
certain such embodiments, the block is at the 5'-end of the
oligonucleotide. In certain embodiments the block is within 3
nucleotides of the 5'-end of the oligonucleotide.
[0235] In certain embodiments, nucleobase modifications are a
function of the natural base at a particular position of an
oligonucleotide. For example, in certain embodiments each purine or
each pyrimidine in an oligonucleotide is modified. In certain
embodiments, each adenine is modified. In certain embodiments, each
guanine is modified. In certain embodiments, each thymine is
modified. In certain embodiments, each cytosine is modified. In
certain embodiments, each uracil is modified.
[0236] In certain embodiments, some, all, or none of the cytosine
moieties in an oligonucleotide are 5-methyl cytosine moieties.
Herein, 5-methyl cytosine is not a "modified nucleobase."
Accordingly, unless otherwise indicated, unmodified nucleobases
include both cytosine residues having a 5-methyl and those lacking
a 5 methyl. In certain embodiments, the methylation state of all or
some cytosine nucleobases is specified.
Certain Overall Lengths
[0237] In certain embodiments, the present invention provides
oligomeric compounds including oligonucleotides of any of a variety
of ranges of lengths. In certain embodiments, the invention
provides oligomeric compounds or oligonucleotides consisting of X
to Y linked nucleosides, where X represents the fewest number of
nucleosides in the range and Y represents the largest number of
nucleosides in the range. In certain such embodiments, X and Y are
each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and
50; provided that X.ltoreq.Y. For example, in certain embodiments,
the invention provides oligomeric compounds which comprise
oligonucleotides consisting of 8 to 9, 8 to 10, 8 to 11, 8 to 12, 8
to 13, 8 to 14, 8 to 15, 8 to 16, 8 to 17, 8 to 18, 8 to 19, 8 to
20, 8 to 21, 8 to 22, 8 to 23, 8 to 24, 8 to 25, 8 to 26, 8 to 27,
8 to 28, 8 to 29, 8 to 30, 9 to 10, 9 to 11, 9 to 12, 9 to 13, 9 to
14, 9 to 15, 9 to 16, 9 to 17, 9 to 18, 9 to 19, 9 to 20, 9 to 21,
9 to 22, 9 to 23, 9 to 24, 9 to 25, 9 to 26, 9 to 27, 9 to 28, 9 to
29, 9 to 30, 10 to 11, 10 to 12, 10 to 13, 10 to 14, 10 to 15, 10
to 16, 10 to 17, 10 to 18, 10 to 19, 10 to 20, 10 to 21, 10 to 22,
10 to 23, 10 to 24, 10 to 25, 10 to 26, 10 to 27, 10 to 28, 10 to
29, 10 to 30, 11 to 12, 11 to 13, 11 to 14, 11 to 15, 11 to 16,11to
17,11to 18,11to 19,11to 20, 11 to 21,11to 22,11to 23,11to 24,11to
25, 11 to 26,11to 27, 11 to 28, 11 to 29, 11 to 30, 12 to 13, 12 to
14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12
to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27,
12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to
17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13
to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30,
14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to
21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14
to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19,
15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to
26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16
to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25,
16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to
19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17
to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20,
18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to
27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19
to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29,
19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to
26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21
to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30,
22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to
29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23
to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29,
24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to
27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28
to 29, 28 to 30, or 29 to 30 linked nucleosides. In embodiments
where the number of nucleosides of an oligomeric compound or
oligonucleotide is limited, whether to a range or to a specific
number, the oligomeric compound or oligonucleotide may, nonetheless
further comprise additional other substituents. For example, an
oligonucleotide comprising 8-30 nucleosides excludes
oligonucleotides having 31 nucleosides, but, unless otherwise
indicated, such an oligonucleotide may further comprise, for
example one or more conjugates, terminal groups, or other
substituents. In certain embodiments, a gapmer oligonucleotide has
any of the above lengths.
Certain Oligonucleotides
[0238] In certain embodiments, oligonucleotides of the present
invention are characterized by their sugar motif, internucleoside
linkage motif, nucleobase modification motif and overall length. In
certain embodiments, such parameters are each independent of one
another. Thus, each internucleoside linkage of an oligonucleotide
having a gapmer sugar motif may be modified or unmodified and may
or may not follow the gapmer modification pattern of the sugar
modifications. Thus, the internucleoside linkages within the wing
regions of a sugar-gapmer may be the same or different from one
another and may be the same or different from the internucleoside
linkages of the gap region. Likewise, such sugar-gapmer
oligonucleotides may comprise one or more modified nucleobase
independent of the gapmer pattern of the sugar modifications.
Herein if a description of an oligonucleotide or oligomeric
compound is silent with respect to one or more parameter, such
parameter is not limited. Thus, an oligomeric compound described
only as having a gapmer sugar motif without further description may
have any length, internucleoside linkage motif, and nucleobase
modification motif. Unless otherwise indicated, all chemical
modifications are independent of nucleobase sequence.
Certain Conjugate Groups
[0239] In certain embodiments, oligomeric compounds comprise
oligonucleotides modified by attachment of one or more conjugate
groups. In general, conjugate groups modify one or more properties
of the attached oligomeric compound including but not limited to
pharmacodynamics, pharmacokinetics, stability, binding, absorption,
cellular distribution, cellular uptake, charge and clearance.
Conjugate groups are routinely used in the chemical arts and are
linked directly or via an optional conjugate linking moiety or
conjugate linking group to a parent compound such as an oligomeric
compound, such as an oligonucleotide. Conjugate groups includes
without limitation, intercalators, reporter molecules, polyamines,
polyamides, polyethylene glycols, thioethers, polyethers,
cholesterols, thiocholesterols, cholic acid moieties, folate,
lipids, phospholipids, biotin, phenazine, phenanthridine,
anthraquinone, adamantane, acridine, fluoresceins, rhodamines,
coumarins and dyes.
[0240] In certain embodiments, conjugate groups are directly
attached to oligonucleotides in oligomeric compounds. In certain
embodiments, conjugate groups are attached to oligonucleotides by a
conjugate linking group. In certain such embodiments, conjugate
linking groups, including, but not limited to, bifunctional linking
moieties such as those known in the art are amenable to the
compounds provided herein. Conjugate linking groups are useful for
attachment of conjugate groups, such as chemical stabilizing
groups, functional groups, reporter groups and other groups to
selective sites in a parent compound such as for example an
oligomeric compound. In general a bifunctional linking moiety
comprises a hydrocarbyl moiety having two functional groups. One of
the functional groups is selected to bind to a parent molecule or
compound of interest and the other is selected to bind essentially
any selected group such as chemical functional group or a conjugate
group. In some embodiments, the conjugate linker comprises a chain
structure or an oligomer of repeating units such as ethylene glycol
or amino acid units. Examples of functional groups that are
routinely used in a bifunctional linking moiety include, but are
not limited to, electrophiles for reacting with nucleophilic groups
and nucleophiles for reacting with electrophilic groups. In some
embodiments, bifunctional linking moieties include amino, hydroxyl,
carboxylic acid, thiol, unsaturations (e.g., double or triple
bonds), and the like.
[0241] In certain embodiments, conjugate groups are at the 3'-end
of an oligonucleotide of an oligomeric compound. In certain
embodiments, conjugate groups are near the 3'-end. In certain
embodiments, conjugates are attached at the 3'end of an oligomeric
compound, but before one or more terminal group nucleosides. In
certain embodiments, conjugate groups are placed within a terminal
group. In certain embodiments, the present invention provides
oligomeric compounds. In certain embodiments, oligomeric compounds
comprise an oligonucleotide. In certain embodiments, an oligomeric
compound comprises an oligonucleotide and one or more conjugate
and/or terminal groups. Such conjugate and/or terminal groups may
be added to oligonucleotides having any of the chemical motifs
discussed above. Thus, for example, an oligomeric compound
comprising an oligonucleotide having region of alternating
nucleosides may comprise a terminal group.
Antisense Compounds
[0242] In certain embodiments, oligomeric compounds of the present
invention are antisense compounds. Such antisense compounds are
capable of hybridizing to a target nucleic acid, resulting in at
least one antisense activity. In certain embodiments, antisense
compounds specifically hybridize to one or more target nucleic
acid. In certain embodiments, a specifically hybridizing antisense
compound has a nucleobase sequence comprising a region having
sufficient complementarity to a target nucleic acid to allow
hybridization and result in antisense activity and insufficient
complementarity to any non-target so as to avoid non-specific
hybridization to any non-target nucleic acid sequences under
conditions in which specific hybridization is desired (e.g., under
physiological conditions for in vivo or therapeutic uses, and under
conditions in which assays are performed in the case of in vitro
assays).
[0243] In certain embodiments, the present invention provides
antisense compounds comprising oligonucleotides that are fully
complementary to the target nucleic acid over the entire length of
the oligonucleotide. In certain embodiments, oligonucleotides are
99% complementary to the target nucleic acid. In certain
embodiments, oligonucleotides are 95% complementary to the target
nucleic acid. In certain embodiments, such oligonucleotides are 90%
complementary to the target nucleic acid.
[0244] In certain embodiments, such oligonucleotides are 85%
complementary to the target nucleic acid. In certain embodiments,
such oligonucleotides are 80% complementary to the target nucleic
acid. In certain embodiments, an antisense compound comprises a
region that is fully complementary to a target nucleic acid and is
at least 80% complementary to the target nucleic acid over the
entire length of the oligonucleotide. In certain such embodiments,
the region of full complementarity is from 6 to 14 nucleobases in
length.
[0245] In certain embodiments, oligomeric compounds having any
motif described herein have a nucleobase sequence complementary to
intron 7 of SMN2. Certain such nucleobase sequences are exemplified
in the non-limiting table below.
TABLE-US-00001 Sequence Length SEQ ID TGCTGGCAGACTTAC 15 3
CATAATGCTGGCAGA 15 4 TCATAATGCTGGCAG 15 5 TTCATAATGCTGGCA 15 6
TTTCATAATGCTGGC 15 2 ATTCACTTTCATAATGCTGG 20 7 TCACTTTCATAATGCTGG
18 1 CTTTCATAATGCTGG 15 8 TCATAATGCTGG 12 9 ACTTTCATAATGCTG 15 10
TTCATAATGCTG 12 11 CACTTTCATAATGCT 15 12 TTTCATAATGCT 12 13
TCACTTTCATAATGC 15 14 CTTTCATAATGC 12 15 TTCACTTTCATAATG 15 16
ACTTTCATAATG 12 17 ATTCACTTTCATAAT 15 18 CACTTTCATAAT 12 19
GATTCACTTTCATAA 15 20 TCACTTTCATAA 12 21 TTCACTTTCATA 12 22
ATTCACTTTCAT 12 23 AGTAAGATTCACTTT 15 24
[0246] Antisense compounds for use in the present invention can be
used to modulate the expression of SMN2 in a subject, such as a
human. In certain embodiments, the subject has spinal muscular
atrophy. In certain such subjects, the SMN1 gene is absent or
otherwise fails to produce sufficient amounts of functional SMN
protein. In certain embodiments, the antisense compounds of the
present invention effectively modulate splicing of SMN2, resulting
in an increase in exon 7 inclusion in SMN2 mRNA and ultimately in
SMN2 protein that includes the amino acids corresponding to exon 7.
Such alternate SMN2 protein resembles wild-type SMN protein.
Antisense compounds for use in the present invention that
effectively modulate expression of SMN2 mRNA or protein products of
expression are active antisense compounds.
Pharmaceutical Compositions
[0247] In certain embodiments, the present invention provides
pharmaceutical compositions comprising one or more antisense
compound. In certain embodiments, such pharmaceutical composition
comprises a sterile saline solution and one or more antisense
compound. In certain embodiments, such pharmaceutical composition
consists of a sterile saline solution and one or more antisense
compound.
[0248] In certain embodiments, antisense compounds may be admixed
with pharmaceutically acceptable active and/or inert substances for
the preparation of pharmaceutical compositions or formulations.
Compositions and methods for the formulation of pharmaceutical
compositions depend on a number of criteria, including, but not
limited to, route of administration, extent of disease, or dose to
be administered.
[0249] In certain embodiments antisense compounds, can be utilized
in pharmaceutical compositions by combining such oligomeric
compounds with a suitable pharmaceutically acceptable diluent or
carrier. A pharmaceutically acceptable diluent includes
phosphate-buffered saline (PBS). PBS is a diluent suitable for use
in compositions to be delivered parenterally. Accordingly, in
certain embodiments, employed in the methods described herein is a
pharmaceutical composition comprising an antisense compound and a
pharmaceutically acceptable diluent. In certain embodiments, the
pharmaceutically acceptable diluent is PBS.
[0250] Pharmaceutical compositions comprising antisense compounds
encompass any pharmaceutically acceptable salts, esters, or salts
of such esters. In certain embodiments, pharmaceutical compositions
comprising antisense compounds comprise one or more oligonucleotide
which, upon administration to an animal, including a human, is
capable of providing (directly or indirectly) the biologically
active metabolite or residue thereof. Accordingly, for example, the
disclosure is also drawn to pharmaceutically acceptable salts of
antisense compounds, prodrugs, pharmaceutically acceptable salts of
such prodrugs, and other bioequivalents. Suitable pharmaceutically
acceptable salts include, but are not limited to, sodium and
potassium salts.
Certain Subjects
[0251] In certain embodiments, a subject has one or more indicator
of SMA. In certain embodiments, the subject has reduced electrical
activity of one or more muscles. In certain embodiments, the
subject has a mutant SMN1 gene. In certain embodiment, the
subject's SMN1 gene is absent or incapable of producing functional
SMN protein. In certain embodiments, the subject is diagnosed by a
genetic test. In certain embodiments, the subject is identified by
muscle biopsy. In certain embodiments, a subject is unable to sit
upright. In certain embodiments, a subject is unable to stand or
walk. In certain embodiments, a subject requires assistance to
breathe and/or eat. In certain embodiment, a subject is identified
by electrophysiological measurement of muscle and/or muscle
biopsy.
[0252] In certain embodiments, the subject has SMA type I. In
certain embodiments, the subject has SMA type II. In certain
embodiments, the subject has SMA type III. In certain embodiments,
the subject is diagnosed as having SMA in utero. In certain
embodiments, the subject is diagnosed as having SMA within one week
after birth. In certain embodiments, the subject is diagnosed as
having SMA within one month of birth. In certain embodiments, the
subject is diagnosed as having SMA by 3 months of age. In certain
embodiments, the subject is diagnosed as having SMA by 6 months of
age. In certain embodiments, the subject is diagnosed as having SMA
by 1 year of age. In certain embodiments, the subject is diagnosed
as having SMA between 1 and 2 years of age. In certain embodiments,
the subject is diagnosed as having SMA between 1 and 15 years of
age. In certain embodiments, the subject is diagnosed as having SMA
when the subject is older than 15 years of age.
Certain Treatment Methods
[0253] In certain embodiments, a subject having SMA is administered
a GF/IGF axis modulator. In certain embodiments, a subject having
SMA is administered a GF/IGF axis molecule. In certain embodiments,
a subject having SMA is administered a GF/IGF axis modulator and an
antisense compound that modulates splicing of SMN2. In certain
embodiments, a subject having SMA is administered a GF/IGF axis
molecule and an antisense compound that modulates splicing of
SMN2.
[0254] In certain embodiments, the first dose of at least one
GF/IGF axis modulator is administered in utero. In certain such
embodiments, the first dose is administered before complete
development of the blood-brain-barrier. In certain embodiments, the
first dose is administered in utero after formation of the
blood-brain-barrier. In certain embodiments, the first dose is
administered to the subject in utero systemically. In certain
embodiments, the first dose is administered to the CSF.
[0255] In certain embodiments, the first dose of at least one
GF/IGF axis modulator is administered when the subject is less than
one week old. In certain embodiments, the first dose of at least
one GF/IGF axis modulator is administered when the subject is less
than one month old. In certain embodiments, the first dose at least
one GF/IGF axis modulator is administered when the subject is less
than 3 months old. In certain embodiments, the first dose of at
least one GF/IGF axis modulator is administered when the subject is
less than 6 months old. In certain embodiments, the first dose of
at least one GF/IGF axis modulator is administered when the subject
is less than one year old. In certain embodiments, the first dose
of at least one GF/IGF axis modulator is administered when the
subject is less than 2 years old. In certain embodiments, the first
dose at least one GF/IGF axis modulator is administered when the
subject is less than 15 years old. In certain embodiments, the
first dose of at least one GF/IGF axis modulator is administered
when the subject is older than 15 years old.
[0256] Certain methods of administration are exemplified in the
following non-limiting table.
TABLE-US-00002 GF/IGF axis modulator Antisense compound Identity
Route Identity Route IGFALS Systemic Uniform MOE ASO IT IGFALS
Systemic Uniform MOE ASO Systemic and IT IGFALS Systemic None NA
IGFALS Systemic Uniform MOE ASO Systemic and IT and IT IGFALS
Systemic Uniform MOE ASO Systemic gene and IT IGFALS Systemic
Uniform MOE ASO Systemic gene and IT and IT IGFALS Systemic Uniform
morpholino ASO IT IGFALS Systemic Uniform morpholino ASO Systemic
and IT IGF-1 Systemic Full MOE ASO IT and IT IGF-1 Systemic Full
MOE ASO Systemic and IT
The above table is non-limiting and solely to illustrate how the
components of the present invention may be independently
manipulated. Moreover, in certain embodiments, the antisense
compound may be substituted with other strategies for increasing
SMN protein, such as gene therapy encoding SMN1.
[0257] Since IGF-1 is an important factor in neurons, the present
invention also provides methods of treating neurodegenerative
conditions other than SMA. For example, in certain embodiments, the
subject has Alzheimer's disease or amyotrophic lateral
sclerosis.
Co-Administration
[0258] In certain embodiments, at least one GF/IGF axis modulator
(with or without an antisense compound or gene therapy for
increasing SMN protein systemically and/or in the CNS) is
co-administered with at least one other pharmaceutical composition
for treating SMA and/or for treating one or more symptom associated
with SMA. In certain embodiments, such other pharmaceutical
composition is selected from trichostatin-A, valproic acid,
riluzole, hydroxyurea, and a butyrate or butyrate derivative. In
certain embodiments, pharmaceutical compositions of the present
invention are co-administered with trichostatin A. In certain
embodiments, pharmaceutical compositions of the present invention
are co-administered with a derivative of quinazoline, for example
as described in Thurmond, et al., J. Med Chem. 2008, 51, 449-469.
In certain embodiments, a pharmaceutical composition of the present
invention and at least one other pharmaceutical composition are
co-administered at the same time. In certain embodiments, a
pharmaceutical composition of the present invention and at least
one other pharmaceutical composition are co-administered at
different times.
[0259] In certain embodiments, pharmaceutical compositions of the
present invention are co-administered with a gene therapy agent. In
certain such embodiments, the gene therapy agent is administered to
the CSF and the pharmaceutical composition of the present invention
is administered systemically. In certain such embodiments, the gene
therapy agent is administered to the CSF and the pharmaceutical
composition of the present invention is administered to the CSF and
systemically. In certain embodiments, a pharmaceutical composition
of the present invention and a gene therapy agent are
co-administered at the same time. In certain embodiments, a
pharmaceutical composition of the present invention and a gene
therapy agent are co-administered at different times. Certain gene
therapy approaches to SMA treatment have been reported (e.g., Coady
et al., PLoS ONE 2008 3(10): e3468; Passini et al., J Clin Invest
2010 Apr. 1, 120(4): 1253-64).
[0260] In certain embodiments, pharmaceutical compositions of the
present invention are co-administered with at least one other
therapy for SMA. In certain embodiments, such other therapy for SMA
is surgery. In certain embodiments, such other therapy is physical
therapy, including, but not limited to exercises designed to
strengthen muscles necessary for breathing, such as cough therapy.
In certain embodiments, other therapy is a physical intervention,
such as a feeding tube or device for assisted breathing.
[0261] In certain embodiments, pharmaceutical compositions of the
present invention are co-administered with one or more other
pharmaceutical compositions that reduce an undesired side-effect of
the pharmaceutical compositions of the present invention.
Nonlimiting Disclosure and Incorporation by Reference
[0262] While certain compounds, compositions and methods described
herein have been described with specificity in accordance with
certain embodiments, the following examples serve only to
illustrate the compounds described herein and are not intended to
limit the same. Each of the references, GenBank accession numbers,
and the like recited herein is hereby incorporated by reference in
its entirety.
[0263] Although the sequence listing accompanying this filing
identifies each sequence as either "RNA" or "DNA" as required, in
reality, those sequences may be modified with any combination of
chemical modifications. One of skill in the art will readily
appreciate that such designation as "RNA" or "DNA" to describe
modified oligonucleotides is, in certain instances, arbitrary. For
example, an oligonucleotide comprising a nucleoside comprising a
2'-OH sugar moiety and a thymine base could be described as a DNA
having a modified sugar (2'-OH for the natural 2'-H of DNA) or as
an RNA having a modified base (thymine (methylated uracil) for
natural uracil of RNA).
[0264] Accordingly, nucleic acid sequences provided herein,
including, but not limited to those in the sequence listing, are
intended to encompass nucleic acids containing any combination of
natural or modified RNA and/or DNA, including, but not limited to
such nucleic acids having modified nucleobases. By way of further
example and without limitation, an oligomeric compound having the
nucleobase sequence "ATCGATCG" encompasses any oligomeric compounds
having such nucleobase sequence, whether modified or unmodified,
including, but not limited to, such compounds comprising RNA bases,
such as those having sequence "AUCGAUCG" and those having some DNA
bases and some RNA bases such as "AUCGATCG" and oligomeric
compounds having other modified bases, such as "AT.sup.meCGAUCG,"
wherein .sup.meC indicates a cytosine base comprising a methyl
group at the 5-position.
EXAMPLE 1
Antisense Compounds Targeting SMN2
[0265] The following oligonucleotide was synthesized using standard
techniques previously reported.
TABLE-US-00003 Reference # Sequence Length Chemistry SEQ ID
ISIS396443 TCACTTTCATAATGCTGG 18 Full 2'-MOE; full PS 1 PS =
phosphorothioate intemucleoside linkages
EXAMPLE 2
Smn-/-SMN Transgenic Mice
[0266] Experiments were performed in a SMA type III mouse model
described previously. Riessland, M. et al., SAHA ameliortates the
SMA phenotype in two mouse models for spinal muscular atropy. Hum
Mol Genet 19, 1492-1506 (2010).
EXAMPLE 3
Administration of ISIS 396443
[0267] ISIS-396443 was administered to SMA mice as summarized in
the table below. Median survival is reported in days or months.
Abbreviation: d, days; m, months (>13 months survival indicates
that mice were still alive at the time of this filing); SMA, SMA
mice; Het, heterozygous mice.
TABLE-US-00004 SC at P0-P3 SC at P5-P7 ICV at (2 shots) (2 shots)
Median Mean Mice alive Group Name Mice n P1 P0-P1 P2-P3 P5 P7
survival survival n age Comparison of ICV to systemic
administration SMA-ICV SMA 14 20 .mu.g 16 d 17 + 5 d 0 SMA-ICV-Con
SMA 18 0 .mu.g 10 d 10 + 2 d 0 Het-ICV Het 15 20 .mu.g >14 m
>14 m SMA-SC SMA 12 50 .mu.g/g 50 .mu.g/g 108 d 1 13 m
SMA-ICV-SC SMA 18 20 .mu.g 50 .mu.g/g 50 .mu.g/g 173 d 2 15 m
SMA-SC-SC SMA 14 50 .mu.g/g 50 .mu.g/g 50 .mu.g/g 50 .mu.g/g 137 d
2 14 m SMA-SC-Con SMA 26 0 .mu.g 0 .mu.g 9 d 10 + 2 d ICV-SC-Con
SMA 15 0 .mu.g 0 .mu.g 0 .mu.g 10 d 10 + 2 d 0 Het-SC Het 12 50
.mu.g/g 50 .mu.g/g >14 m >14 m Het-ICV-SC Het 13 20 .mu.g 50
.mu.g/g 50 .mu.g/g >14 m >14 m Dose-response study SC40 SMA
26 40 .mu.g/g 40 .mu.g/g 84 d 1 13 m SC80 SMA 18 80 .mu.g/g 80
.mu.g/g 170 d 2 13 m SC160 SMA 14 160 .mu.g/g 160 .mu.g/g 248 d 3
13 m SC-Saline SMA 23 0 .mu.g/g 0 .mu.g/g 10 d 10 + 2 d 0 SC160-Het
Het 18 160 .mu.g/g 160 .mu.g/g >13 m >13 m SC-Sal-Het Het 18
0 .mu.g/g 0 .mu.g/g >13 m >13 m Late rescue SC-late SMA 17
100 .mu.g/g 100 .mu.g/g 16 d 24 + 28 d 0 Late-Con SMA 15 0 .mu.g 0
.mu.g 11 d 11 + 2 d 0 IP injection instead of SC injection IP80*
SMA 16 80 .mu.g/g 80 .mu.g/g 118 d 5 11 m IP-Saline SMA 12 0
.mu.g/g 0 .mu.g/g 11 d 10 + 2 d 0 IP-Het Het 14 80 .mu.g/g 80
.mu.g/g >11 m >11 m Other treatments ICV-E-0** SMA 12 0 .mu.g
11 d 10 + 2 d 0 ICV-E-5** SMA 16 5 .mu.g 10 d 10 + 2 d 0 ICV-E-20**
SMA 26 20 .mu.g 12 d 14 + 10 d 0 ICV-5 SMA 16 5 .mu.g 10 d 10 + 2 d
0 ICV-10 SMA 15 10 .mu.g 11 d 12 + 3 d 0 ICV- SMA 13 20 .mu.g 10 d
10 + 2 d 0 Mismatch.sup..DELTA. SC-Mismatch.sup..DELTA. SMA 17 160
.mu.g/g 160 .mu.g/g 10 d 10 + 2 d 0 *IP injection in P0-P3 neonates
(IP80) sometimes causes peritoneal fluid including ASO, to leak
out, which might explain reduced median survival compared to group
SC80. **ICV injection of ASP-10-27 at embryonic dat 15-16 instead
of P1. .sup..DELTA.ICV or SC injection of a mismatch control
ASO11.
EXAMPLE 3
Evaluation of Circulating IGF-1
[0268] Samples from mice in Example 2 were evaluated for IGF-1 by
ELISA assay. Serum samples from day P6-P9 from heterozygous mice
(normal phenotype) and SMA mice treated with ISIS-396443 at day 0
had serum levels>60 ng/ml. Serum IGF-1 levels from untreated SMA
mice were less than 20 ng/ml. Results are summarized in the graph
at FIG. 1a.
EXAMPLE 4
Evaluation of GH/IGF-1 Axis RNA
[0269] Liver tissue from the SMA mice and heterozygous mice was
collected and RNA was extracted using standard techniques. RT-PCR
showed that mRNA encoding IGF-1 and IGFBP3 were not reduced in the
SMA mice, but mRNA encoding IGFALS was reduced in the SMA mice.
This experiment was repeated, adding an ASO treated group. ASO
treatment results in normal IGFALS levels. These results are shown
in FIGS. 1b-d.
Sequence CWU 1
1
24118DNAArtificial sequenceSynthetic oligonucleotide 1tcactttcat
aatgctgg 18215DNAArtificial sequenceSynthetic oligonucleotide
2tttcataatg ctggc 15315DNAArtificial sequenceSynthetic
oligonucleotide 3tgctggcaga cttac 15415DNAArtificial
sequenceSynthetic oligonucleotide 4cataatgctg gcaga
15515DNAArtificial sequenceSynthetic oligonucleotide 5tcataatgct
ggcag 15615DNAArtificial sequenceSynthetic oligonucleotide
6ttcataatgc tggca 15720DNAArtificial sequenceSynthetic
oligonucleotide 7attcactttc ataatgctgg 20815DNAArtificial
sequenceSynthetic oligonucleotide 8ctttcataat gctgg
15912DNAArtificial sequenceSynthetic oligonucleotide 9tcataatgct gg
121015DNAArtificial sequenceSynthetic oligonucleotide 10actttcataa
tgctg 151112DNAArtificial sequenceSynthetic oligonucleotide
11ttcataatgc tg 121215DNAArtificial sequenceSynthetic
oligonucleotide 12cactttcata atgct 151312DNAArtificial
sequenceSynthetic oligonucleotide 13tttcataatg ct
121415DNAArtificial sequenceSynthetic oligonucleotide 14tcactttcat
aatgc 151512DNAArtificial sequenceSynthetic oligonucleotide
15ctttcataat gc 121615DNAArtificial sequenceSynthetic
oligonucleotide 16ttcactttca taatg 151712DNAArtificial
sequenceSynthetic oligonucleotide 17actttcataa tg
121815DNAArtificial sequenceSynthetic oligonucleotide 18attcactttc
ataat 151912DNAArtificial sequenceSynthetic oligonucleotide
19cactttcata at 122015DNAArtificial sequenceSynthetic
oligonucleotide 20gattcacttt cataa 152112DNAArtificial
sequenceSynthetic oligonucleotide 21tcactttcat aa
122212DNAArtificial sequenceSynthetic oligonucleotide 22ttcactttca
ta 122312DNAArtificial sequenceSynthetic oligonucleotide
23attcactttc at 122415DNAArtificial sequenceSynthetic
oligonucleotide 24agtaagattc acttt 15
* * * * *