U.S. patent application number 16/329577 was filed with the patent office on 2019-06-27 for chimeric proteins for targeting dsrna.
The applicant listed for this patent is TARGIMMUNE THERAPEUTICS AG. Invention is credited to Yael LANGUT, Alexander LEVITZKI.
Application Number | 20190194282 16/329577 |
Document ID | / |
Family ID | 61300251 |
Filed Date | 2019-06-27 |
![](/patent/app/20190194282/US20190194282A1-20190627-D00000.png)
![](/patent/app/20190194282/US20190194282A1-20190627-D00001.png)
![](/patent/app/20190194282/US20190194282A1-20190627-D00002.png)
![](/patent/app/20190194282/US20190194282A1-20190627-D00003.png)
![](/patent/app/20190194282/US20190194282A1-20190627-D00004.png)
![](/patent/app/20190194282/US20190194282A1-20190627-D00005.png)
![](/patent/app/20190194282/US20190194282A1-20190627-D00006.png)
![](/patent/app/20190194282/US20190194282A1-20190627-D00007.png)
United States Patent
Application |
20190194282 |
Kind Code |
A1 |
LEVITZKI; Alexander ; et
al. |
June 27, 2019 |
CHIMERIC PROTEINS FOR TARGETING dsRNA
Abstract
Described herein are recombinant chimeric proteins comprising a
double stranded RNA (dsRNA) binding domain and a cancer-cell
targeting domain for targeting of dsRNA to cancer cells. Methods of
use of the described chimeric proteins are also provided
herein.
Inventors: |
LEVITZKI; Alexander;
(Jerusalem, IL) ; LANGUT; Yael; (Haifa,
IL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
TARGIMMUNE THERAPEUTICS AG |
Basel |
|
CH |
|
|
Family ID: |
61300251 |
Appl. No.: |
16/329577 |
Filed: |
December 15, 2016 |
PCT Filed: |
December 15, 2016 |
PCT NO: |
PCT/IL2016/051341 |
371 Date: |
February 28, 2019 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62383466 |
Sep 4, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 38/00 20130101;
C07K 16/3069 20130101; C07K 2319/85 20130101; C07K 2317/622
20130101; C12N 15/117 20130101; C12N 15/62 20130101; C12N 2310/17
20130101; C12N 2320/32 20130101; C07K 2319/60 20130101; C07K
2317/77 20130101; C07K 14/4748 20130101; A61P 35/00 20180101 |
International
Class: |
C07K 14/47 20060101
C07K014/47; A61P 35/00 20060101 A61P035/00; C07K 16/30 20060101
C07K016/30; C12N 15/62 20060101 C12N015/62; C12N 15/117 20060101
C12N015/117 |
Claims
1. A chimeric recombinant protein comprising: a double stranded RNA
(dsRNA) binding domain; and a target binding moiety that binds to
prostate surface membrane antigen (PSMA).
2. The chimeric recombinant protein of claim 1, further comprising
a spacer peptide between the dsRNA binding domain and the target
binding moiety.
3. The chimeric recombinant protein of claim 1 or claim 2, wherein
the dsRNA binding domain comprises at least one double-stranded
RNA-binding motif (dsRBM).
4. The chimeric recombinant protein of claim 3, wherein the at
least one dsRBM is selected from a dsRBM of dsRNA dependent protein
kinase (PKR), TRBP, PACT, Staufen, NFAR1, NFAR2, SPNR, RHA, and
NREBP.
5. The chimeric recombinant protein of claim 3, wherein the at
least one dsRBM comprises a polypeptide sequence at least 70%
identical to amino acids 1-197 of human PKR as set forth as SEQ ID
NO: 18.
6. The chimeric recombinant protein of any one of claims 1-5,
wherein the target binding moiety is a polypeptide, antibody,
antibody fragment, or antibody mimetic.
7. The chimeric recombinant protein of claim 2, wherein the spacer
peptide is selected from the group consisting of an oligopeptide
comprising a protease recognition sequence; a homo-oligopeptide of
a positively charged amino acids; and a combination thereof.
8. The chimeric recombinant protein of claim 7, wherein the spacer
peptide is a homo-oligopeptide of arginine.
9. The chimeric recombinant protein of any one of claims 2-8,
wherein the double stranded RNA (dsRNA) binding domain is at least
one dsRNA binding domain of human PKR as set forth in SEQ ID NO:
18, or a functional variant thereof, wherein the spacer peptide is
ARG9 as set forth in SEQ ID NO: 5, or a functional variant thereof,
and wherein the target binding moiety is a single chain anti-PSMA
antibody as set forth in SEQ ID NO: 20, or a functional variant
thereof.
10. The chimeric recombinant protein of claim 9, comprising a
polypeptide at least 70% identical to the sequence set forth as SEQ
ID NO: 3.
11. A complex comprising the chimeric recombinant protein of any
one of claims 1 to 10 and dsRNA.
12. The complex of claim 11, wherein the dsRNA comprises a
polyinosinic acid strand and a polycytidylic acid strand (poly
IC).
13. A nucleic acid comprising a nucleic acid sequence encoding the
recombinant protein of any one of claims 1 to 10.
14. The nucleic acid of claim 13, wherein the nucleic acid sequence
is optimized for expression in a bacterial or plant host cell.
15. The chimeric recombinant protein of any one of claims 1-10 or
the complex of claim 11 or claim 12 for use in treatment of
prostate cancer or inhibition of the development of tumor
neovasculature.
16. A method for treatment of prostate cancer or inhibition of
tumor neovasculature development comprising, administering to a
subject in need thereof a therapeutically effective amount of the
complex of claim 11 or claim 12, thereby treating the cancer or
inhibiting the development of the tumor neovasculature.
17. The method of claim 16, wherein the complex is administered
systemically or locally.
18. The method of claim 16 or claim 17, further comprising
administering to the subject a therapeutically effective amount of
peripheral blood mononuclear cells (PBMCs).
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] Benefit is claimed to U.S. Provisional Patent Application
No. 62/383,466, filed Sep. 4, 2016, the contents of which are
incorporated by reference herein in their entirety.
FIELD
[0002] Provided herein are recombinant chimeric proteins comprising
a double stranded RNA (dsRNA) binding domain and a cancer-cell
targeting domain for targeting of dsRNA to cancer cells. Methods of
use of the described chimeric proteins are also provided
herein.
BACKGROUND
[0003] Prostate cancer is the second most commonly diagnosed cancer
worldwide, accounting for over 25% of new cancer cases diagnosed
annually among men in the US (1). In the case of metastatic
prostate cancer, patients are mostly treated with androgen
deprivation therapy (ADT).
[0004] While this therapy generally achieves a short-term
remission, patients typically develop castration-resistant prostate
cancer (CRPC). There is a great demand for novel therapies for CRPC
patients, as these patients rarely respond to existing therapies
and demonstrate median survival of about 3 years (1-3).
[0005] Most targeted cancer therapies today delay but rarely
prevent tumor progression. As tumor cells are genomically unstable,
they eventually acquire mutations and genetic alterations that
allow them to evade the therapy and develop resistance. The rate of
killing that is elicited by targeted agents is too slow, providing
the tumors with sufficient time to adapt to the constant pressure
exerted on them by the therapy. Additionally, tumors are
heterogeneous and possess a number of different subpopulations.
Targeted therapies usually target only some of these subpopulations
and not others, and therefore cannot be expected to eradicate the
entire tumor.
[0006] Metastatic CRPC typically presents a unique cell surface
molecule that can be exploited for targeted therapy:
prostate-specific membrane antigen (PSMA). PSMA is over-expressed
at levels of up to 1000-fold at all Gleason scores (4), while
over-expression increases with tumor progression (5,6). Despite the
heterogeneous nature of the disease, primary tumors or metastases
that are completely PSMA-negative are rare (7). While the above
findings support the notion that PSMA is a highly promising
therapeutic target, no PSMA-targeted therapies are currently
approved for clinical use. However, few agents are in clinical
trials (8-11). Thus a continuing need exists for targeted therapy
for CPRC.
SUMMARY
[0007] Described herein is an improved approach to the targeting of
dsRNA to cancer cells, namely, the generation of a chimeric protein
molecule that can deliver dsRNA to PSMA over-expressing cells.
[0008] The present disclosure provides a chimeric recombinant
protein and encoding nucleic acids thereof which includes a double
stranded RNA (dsRNA) binding domain; and a target binding moiety
that binds to prostate surface membrane antigen (PSMA).
[0009] Additionally described is a complex that includes a
described chimeric recombinant protein and dsRNA. Also described
are uses of the described complexes in treatment of prostate cancer
or inhibition of the development of tumor neovasculature, and
corresponding methods of treatment of prostate cancer or inhibition
of tumor neovasculature that include administering to a subject in
need thereof a therapeutically effective amount of the described
complex.
[0010] The foregoing and other objects, features, and advantages
will become more apparent from the following detailed description,
which proceeds with reference to the accompanying figures.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] FIGS. 1A-1D: GFP-SCP binds and selectively internalizes into
PSMA over-expressing cells. FIG. 1A: Schematic representation of
GFP-SCP. FIG. 1B: LNCaP, PC3 and MCF7 cells were incubated with 25
nM GFP-SCP for 5 hr. The cells were fixed and stained with anti-GFP
antibody (Cy3) and 4, 6-diamidino-2-phenylindole and viewed by
laser scanning confocal microscopy. FIG. 1C: LNCaP and MCF7 cells
were incubated with GFP-SCP, then subjected to flow cytometric
analysis. FIG. 1D: Upper panel: LNCaP cells were monitored by laser
confocal imaging, 0 to 72 min after the addition of 200 nM GFP-SCP.
Sulforhodamine-B was added to the medium immediately before adding
the GFP-SCP, to mark the outside of the cells. Lower panel shows
GFP fluorescence inside the cell, as measured using ImageJ.
[0012] FIGS. 2A-2C: Design, expression and purification of
dsRB-SCP. FIG. 2A: Schematic representation of dsRB-SCP. FIG. 2B:
Expression and purification of dsRB-SCP: L: Cleared lysate, M:
Molecular weight marker, El: Eluate following IMAC (nickel
sepharose column), E2: Purified dsRB-SCP eluted from IEX (Ion
exchange column). Dashed lines indicate where the picture of the
gel was cut and reorganized. FIG. 2C: Binding of dsRB-SCP to dsRNA:
dsRB-SCP (0.5-3 .mu.g) was preincubated with 500 bp long dsRNA and
electrophoresed on a 2% agarose gel. M: 100 bp DNA molecular weight
marker.
[0013] FIGS. 3A-3C: dsRB-SCP/polyIC selectively induces apoptosis
of PSMA over-expressing cells. FIG. 3A: Cells were seeded in
triplicate, grown overnight, and treated as indicated for 100 hr.
Viability was quantified using the CellTiter-Glo Luminescent Cell
Viability Assay (Promega). FIG. 3B: Surviving cells remained
permanently arrested. Cells were seeded in triplicate, grown
overnight, and treated as indicated. Medium was replaced and
viability was quantified after 100/172/344 hr using CellTiter-Glo.
(Control cells were unable to proliferate beyond 2.5 doublings
because they had reached full confluence). FIG. 3C: LNCaP cells
were treated for the indicated times with dsRB-SCP/polyIC or polyIC
alone, lysed and subjected to western blot analysis to detect
full-length and cleaved Caspase-3 and PARP.
[0014] FIGS. 4A-4D: dsRB-SCP/polyIC leads to secretion of
pro-inflammatory cytokines and recruitment of PBMCs. FIGS. 4A and
4B: LNCaP cells were treated as indicated for 48 hr, after which
medium was collected and IP-10 and RANTES cytokines were measured
by ELISA assays. FIG. 4C: LNCaP cells were treated as indicated for
4 h and IFN-j3 transcription was measured by qRT-PCR. FIG. 4D:
dsRB-SCP/polyIC induces chemotaxis of PBMCs. LNCaP cells were grown
and treated as indicated. 48 hr after treatment, the cell medium
was transferred to the lower chamber of a Transwell chemotaxis
plate. PBMCs were added to the upper chamber, and the plates were
incubated for 3.5 hr. Then, medium was collected from the lower
chamber and lymphocytes that had migrated to the lower chamber were
quantified by FACS.
[0015] FIGS. 5A-5B: dsRB-SCP/polyIC induces direct and
PBMC-mediated bystander effects. FIG. 5A: LNCaP-Luc/GFP cells were
treated as indicated. After 24 hr, PBMC were added to the test
wells (black bars), and medium was added to control wells (gray
bars). Survival of LNCaP-Luc/GFP cells was measured using the
Luciferase Assay System (Promega). FIG. 5B: PC3-Luc/GFP+LNCaP:
LNCaP cells were treated as indicated. After 24 hr,
PC3-Luc/GFPcells were added to the culture. 6 hr later, PBMCs
(black bars) or medium were added to the culture (hatched bars).
PC3-Luc/GFP: LNCaP growth medium was treated as indicated. After 24
hr, PC3-Luc/GFP cells were added, and 6 hr later either PBMCs
(black bars) or medium (hatched bars) was added. Survival of
PC3-Luc/GFP cells was measured using the Luciferase Assay System
(Promega). T-test indicates high significance (* *
*P.ltoreq.0.001).
[0016] FIGS. 6A-6B: dsRB-SCP/polyIC treatment together with PBMCs
leads to the destruction of LNCaP spheroids. FIG. 6A: Spheroids of
R=300-400 .mu.m were treated as follows: (a) Untreated, (b) 400 nM
dsRB-SCP, (c) 2.5 g/ml polyIC, (d) 400 nM dsRB-SCP+2.5 .mu.g/ml
polyIC. Spheroids were treated four times, on days 1, 2, 4 and 5,
and then cultured for 10 additional days. Spheroid images were
captured by a laser scanning confocal microscopy at the indicated
times; one representative spheroid is shown per treatment. Note the
prominent shedding of cells from the treated spheroid (red arrows).
On Day 15, spheroids were labeled with Calcein AM (living cells;
green) and Propidium Iodide (dead cells; red). Maximum areas of
spheroids, measured using ImageJ, are shown in the graph (Mean and
standard deviation). FIG. 6B: Upper panel: LNCaP-Luc/GFP spheroids
treated as indicated. After 24 hr, 8*10.sup.4 PBMCs labeled with
CellTracker.TM. Violet BMQC (Molecular Probes-Life Technologies)
were added to the spheroids. Lower panel: PBMC medium without cells
was added to the spheroids. Spheroids in both panels were captured
by laser scanning confocal microscopy 0, 72, 96, 168 hr after
treatment initiation. Living cells were detected by their GFP
fluorescence. PI was added to the spheroids in the lower panel, to
highlight the dead cells. PI staining of upper panel is not shown,
as there is no way to distinguish between dead LNCaP-Luc/GFP cells
and dead PBMCs.
BRIEF DESCRIPTION OF THE DESCRIBED SEQUENCES
[0017] The nucleic and/or amino acid sequences provided herewith
are shown using standard letter abbreviations for nucleotide bases,
and three letter code for amino acids, as defined in 37 C.F.R.
1.822. Only one strand of each nucleic acid sequence is shown, but
the complementary strand is understood as included by any reference
to the displayed strand. The Sequence Listing is submitted as an
ASCII text file named SeqList_3152_1_2.txt created Dec. 12, 2016,
about 21 KB, which is incorporated by reference herein. In the
Sequence Listing:
[0018] SEQ ID NO: 1 is the amino acid sequence of the GFP-SCP
protein.
[0019] SEQ ID NO: 2 is a nucleic acid sequence encoding the GFP-SCP
protein.
[0020] SEQ ID NO: 3 is the amino acid sequence of the dsRB-SCP
protein.
[0021] SEQ ID NO: 4 is a nucleic acid sequence encoding the
dsRB-SCP protein.
[0022] SEQ ID NO: 5 is amino acid sequence of the the Arg9 linker
peptide.
[0023] SEQ ID NOs 6 and 7 are forward and reverse oligonucleotide
primers for IFN-3 quantification.
[0024] SEQ ID NOs 8 and 9 are forward and reverse oligonucleotide
primers for GAPDH quantification.
[0025] SEQ ID NO: 10 is the nucleic acid sequence of the SCP-N
primer.
[0026] SEQ ID NO: 11 is the nucleic acid sequence of the SCP-C
primer.
[0027] SEQ ID NO: 12 is the nucleic acid sequence of the GFP-N
primer.
[0028] SEQ ID NO: 13 is the nucleic acid sequence of the GFP-C
primer.
[0029] SEQ ID NO: 14 is the nucleic acid sequence of the dsRB-N
primer.
[0030] SEQ ID NO: 15 is the nucleic acid sequence of the dsRB-C
primer.
[0031] SEQ ID NO: 16 is the nucleic acid sequence of the 9ARG1
primer.
[0032] SEQ ID NO: 17 is the nucleic acid sequence of the 9ARG2
primer.
[0033] SEQ ID NO: 18 is the amino acid sequence of PKR dsRNA.
[0034] SEQ ID NO: 19 is the nucleic acid sequence of PKR dsRNA.
[0035] SEQ ID NO: 20 is the amino acid sequence of ScFvJ591.
[0036] SEQ ID NO: 21 is the nucleic acid sequence of ScFvJ591.
DETAILED DESCRIPTION
I. Terms
[0037] Unless otherwise noted, technical terms are used herein have
the same meaning as commonly understood by one of ordinary skill in
the art to which this disclosure belongs. The singular terms "a,"
"an," and "the" include plural referents unless context clearly
indicates otherwise. Similarly, the word "or" is intended to
include "and" unless the context clearly indicates otherwise. It is
further to be understood that all base sizes or amino acid sizes,
and all molecular weight or molecular mass values, given for
nucleic acids or polypeptides are approximate, and are provided for
description. Although methods and materials similar or equivalent
to those described herein can be used in the practice or testing of
this disclosure, suitable methods and materials are described
below. The term "comprises" means "includes." The abbreviation,
"e.g." is derived from the Latin exempli gratia, and is used herein
to indicate a non-limiting example. Thus, the abbreviation "e.g."
is synonymous with the term "for example."
[0038] In case of conflict, the present specification, including
explanations of terms, will control. In addition, all the
materials, methods, and examples are illustrative and not intended
to be limiting.
[0039] Administration: The introduction of a composition into a
subject by a chosen route. Administration of an active compound or
composition can be by any route known to one of skill in the art.
Administration can be local or systemic. Examples of local
administration include, but are not limited to, topical
administration, subcutaneous administration, intramuscular
administration, intrathecal administration, In addition, local
administration includes routes of administration typically used for
systemic administration, for example by directing intravascular
administration to the arterial supply for a particular organ. Thus,
in particular embodiments, local administration includes
intra-arterial administration and intravenous administration when
such administration is targeted to the vasculature supplying a
particular organ. Local administration also includes the
incorporation of active compounds and agents into implantable
devices or constructs, such as vascular stents or other reservoirs,
which release the active agents and compounds over extended time
intervals for sustained treatment effects.
[0040] Systemic administration includes any route of administration
designed to distribute an active compound or composition widely
throughout the body via the circulatory system. Thus, systemic
administration includes, but is not limited to intra-arterial and
intravenous administration. Systemic administration also includes,
but is not limited to, topical administration, subcutaneous
administration, intramuscular administration, or administration by
inhalation, when such administration is directed at absorption and
distribution throughout the body by the circulatory system.
[0041] Antibody: A polypeptide ligand comprising at least a light
chain or heavy chain immunoglobulin variable region, which
specifically recognizes and binds an epitope of an antigen, such as
PSMA. Antibodies are composed of a heavy and a light chain, each of
which has a variable region, termed the variable heavy (VH) region
and the variable light (VL) region. Together, the VH region and the
VL region are responsible for binding the antigen recognized by the
antibody. As used herein, "antibody" includes intact
immunoglobulins and the variants and portions of them well known in
the art, such as Fab' fragments, F(ab)'.sub.2 fragments, single
chain Fv proteins ("scFv"), and disulfide stabilized Fv proteins
("dsFv"). The term also includes recombinant forms such as chimeric
antibodies (for example, humanized murine antibodies),
heteroconjugate antibodies (such as, bispecific antibodies).
[0042] Chimera: A nucleic acid sequence, amino acid sequence, or
protein that comprises nucleic acid sequence, amino acid sequence,
or protein from two or more sources, for example amino acid
sequence from two or more different species. In general, chimeric
sequences are the result of genetic engineering.
[0043] Expression Control Sequences: Nucleic acid sequences that
regulate the expression of a heterologous nucleic acid sequence to
which it is operatively linked, for example the expression of a
nucleic acid encoding the chimeric recombinant proteins described
herein. Expression control sequences are operatively linked to a
nucleic acid sequence when the expression control sequences control
and regulate the transcription and, as appropriate, translation of
the nucleic acid sequence. Thus expression control sequences can
include appropriate promoters, enhancers, transcription
terminators, a start codon (ATG) in front of a protein-encoding
gene, splicing signal for introns, maintenance of the correct
reading frame of that gene to permit proper translation of mRNA,
and stop codons.
[0044] Functional fragments and variants of a polypeptide: Included
are those fragments and variants that maintain one or more
functions of the parent polypeptide. It is recognized that the gene
or cDNA encoding a polypeptide can be considerably mutated without
materially altering one or more the polypeptide's functions,
including variants of 60%-99% sequence identity to the wildtype or
parent polypeptide. First, the genetic code is well-known to be
degenerate, and thus different codons encode the same amino acids.
Second, even where an amino acid substitution is introduced, the
mutation can be conservative and have no material impact on the
essential functions of a protein. Third, part of a polypeptide
chain can be deleted without impairing or eliminating all of its
functions. Fourth, insertions or additions can be made in the
polypeptide chain for example, adding epitope tags, without
impairing or eliminating its functions. Functional fragments and
variants can be of varying length. For example, some fragments have
at least 10, 25, 50, 75, 100, or 200 amino acid residues.
Conservative amino acid substitution tables providing functionally
similar amino acids are well known to one of ordinary skill in the
art. The following six groups are examples of amino acids that are
considered to be conservative substitutions for one another:
[0045] 1) Alanine (A), Serine (S), Threonine (T);
[0046] 2) Aspartic acid (D), Glutamic acid (E);
[0047] 3) Asparagine (N), Glutamine (Q);
[0048] 4) Arginine (R), Lysine (K);
[0049] 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V);
and
[0050] 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).
[0051] Linker: One or more nucleotides or amino acids that serve as
a spacer between two molecules, such as between two nucleic acid
molecules or two peptides.
[0052] Mimetic: A mimetic is a molecule that mimics the activity of
another molecule, such as a biologically active molecule.
Biologically active molecules can include chemical structures that
mimic the biological activities of a compound.
[0053] Operably linked: A first nucleic acid sequence is operably
linked with a second nucleic acid sequence when the first nucleic
acid sequence is placed in a functional relationship with the
second nucleic acid sequence. For instance, a promoter is operably
linked to a coding sequence if the promoter affects the
transcription or expression of the coding sequence. Generally,
operably linked DNA sequences are contiguous and, where necessary
to join two protein-coding regions, in the same reading frame.
[0054] Pharmaceutically acceptable carriers: The pharmaceutically
acceptable carriers useful in this disclosure are conventional.
Remington's Pharmaceutical Sciences, by E. W. Martin, Mack
Publishing Co., Easton, Pa., 15th Edition (1975), describes
compositions and formulations suitable for pharmaceutical delivery
of the compounds herein disclosed.
[0055] In general, the nature of the carrier will depend on the
particular mode of administration being employed. For instance,
parenteral formulations usually comprise injectable fluids that
include pharmaceutically and physiologically acceptable fluids such
as water, physiological saline, balanced salt solutions, aqueous
dextrose, glycerol or the like as a vehicle. In addition to
biologically-neutral carriers, pharmaceutical compositions to be
administered can contain minor amounts of non-toxic auxiliary
substances, such as wetting or emulsifying agents, preservatives,
and pH buffering agents and the like, for example sodium acetate or
sorbitan monolaurate.
[0056] Sequence identity: The similarity between two nucleic acid
sequences, or two amino acid sequences, is expressed in terms of
the similarity between the sequences, otherwise referred to as
sequence identity. Sequence identity is frequently measured in
terms of percentage identity (or similarity or homology); the
higher the percentage, the more similar the two sequences are.
[0057] Subject: Living multi-cellular organisms, including
vertebrate organisms, a category that includes both human and
non-human mammals.
[0058] Therapeutically effective amount: A quantity of compound
sufficient to achieve a desired effect in a subject being treated.
An effective amount of a compound may be administered in a single
dose, or in several doses, for example daily, during a course of
treatment. However, the effective amount will be dependent on the
compound applied, the subject being treated, the severity and type
of the affliction, and the manner of administration of the
compound.
II. Overview of Several Embodiments
[0059] Described herein is a chimeric recombinant protein which
includes a double stranded RNA (dsRNA) binding domain; and a target
binding moiety that binds to prostate surface membrane antigen
(PSMA).
[0060] In particular embodiments, the chimeric recombinant protein
further includes a spacer peptide between the dsRNA binding domain
and the target binding moiety.
[0061] In some embodiments, dsRNA binding domain of the chimeric
recombinant protein includes at least one double-stranded
RNA-binding motif (dsRBM), such as a dsRBM of dsRNA dependent
protein kinase (PKR), TRBP, PACT, Staufen, NFAR1, NFAR2, SPNR, RHA,
or NREBP. In one example the at least one dsRBM includes a
polypeptide sequence at least 70% identical to amino acids 1-197 of
human PKR as set forth as SEQ ID NO: 18.
[0062] In particular embodiments of the chimeric recombinant
protein, the target binding moiety is a polypeptide, antibody,
antibody fragment, or antibody mimetic.
[0063] In other particular embodiments of the chimeric recombinant
protein, the spacer peptide is selected from an oligopeptide
comprising a protease recognition sequence; a homo-oligopeptide of
a positively charged amino acids; and a combination thereof. In one
examplea, the spacer peptide is a homo-oligopeptide of
arginine.
[0064] In a particular embodiment of the described chimeric
recombinant protein, the double stranded RNA (dsRNA) binding domain
is at least one dsRNA binding domain of human PKR as set forth in
SEQ ID NO: 18, or a functional variant thereof, the spacer peptide
is ARG9 as set forth in SEQ ID NO: 5, or a functional variant
thereof, and the target binding moiety is a single chain anti-PSMA
antibody as set forth in SEQ ID NO: 20, or a functional variant
thereof.
[0065] In another particular embodiment, the chimeric recombinant
protein includes a polypeptide at least 70% identical to the
sequence set forth as SEQ ID NO: 3.
[0066] Additionally described herein is a complex which includes
the described chimeric recombinant protein and dsRNA, such as a
dsDNA including a polyinosinic acid strand and a polycytidylic acid
strand (poly IC).
[0067] In particular embodiments, the described complexes are used
in treatment of prostate cancer or inhibition of the development of
tumor neovasculature, such as in methods of treatment for prostate
cancer or inhibition of tumor neovasculature which include
administering to a subject in need thereof a therapeutically
effective amount of the described complex thereby treating the
cancer or inhibiting growth of tumor neovasculature.
[0068] In some embodiments of the described methods, the complex is
administered systemically or locally. In other embodiments, the
methods further include administering to the subject a
therapeutically effective amount of peripheral blood mononuclear
cells (PBMCs).
[0069] Further described herein are nucleic acids that encode any
of the described chimeric recombinant proteins.
[0070] In particular embodiments, the described nucleic acid
sequences are optimized for expression in a bacterial or plant host
cell.
III. Chimeric Polypeptides for Targeting dsRNA to PSMA-Expressing
Cells
[0071] Described herein are chimeric recombinant polypeptides that
can be used to target dsRNA to a cell expressing prostate-specific
membrane antigen (PSMA). The described chimeric recombinant
polypeptides include at least a dsRNA binding domain and a domain
(also referred to herein as a moiety) that specifically targets
PSMA. In particular embodiments, the described polypeptides also
include a linker between the dsRNA binding domain and the target
binding domain. Functional variants of the chimeric recombinant
polypeptides are also described.
[0072] dsRNA-binding domains may readily be identified in a peptide
sequence using methods available to the average person skilled in
the art. The dsRNA binding domain of any one of the described
recombinant proteins may include one or more double-stranded
RNA-binding motif (dsRBM), such as an alpha-beta-beta-beta-alpha
fold.
[0073] In certain embodiments said one or more dsRBM is selected
from a dsRBM of dsRNA dependent protein kinase (PKR), TRBP, PACT,
Staufen, NFAR1, NFAR2, SPNR, RHA or NREBP. In particular, the dsRNA
binding domain may comprise two dsRBMs of a PKR, optionally
connected by a flexible linker.
[0074] In a particular embodiment, the dsRNA binding domain is the
dsRNA binding domain of human dsRNA dependent protein kinase (PKR),
or a functional variant thereof, including a polypeptide that
shares about 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% sequence
identity with the amino acid sequence set forth herein as SEQ ID
NO: 18.
[0075] In certain embodiments, the target-binding moiety of any one
of the recombinant proteins described herein includes (i) a ligand
to a cell surface receptor; (ii) an antibody, such as a humanized
antibody; a human antibody; a functional fragment of an antibody; a
single-domain antibody, such as a Nanobody; a recombinant antibody;
and a single chain variable fragment (ScFv); or (iii) an antibody
mimetic, such as an affibody molecule; an affilin; an affimer; an
affitin; an alphabody; an anticalin; an avimer; a DARPin; a
fynomer; a Kunitz domain peptide; and a monobody,
[0076] In certain embodiments, the target-binding moiety is a
prostate surface membrane antigen (PSMA) ligand, such as DUPA or an
analog thereof, an anti-PSMA antibody, such as an anti-PSMA scFv or
a humanized or human anti-PSMA antibody (e.g. the full length
antibody J591); or an anti-PSMA affibody.
[0077] In a particular embodiment, the PSMA targeting moiety is a
single chain antibody against PSMA, ScFvJ591, or a functional
variant thereof, including a polypeptide that shares about 60%,
70%, 75%, 80%, 85%, 90%, 95%, or 98% sequence identity with the
amino acid sequence set forth herein as SEQ ID NO: 19.
[0078] The described spacer peptide can be any oligopeptide known
in the art for connecting two functional domains of a polypeptide
chimera. In certain embodiments, the spacer peptide (linker)
includes an oligopeptide comprising a protease recognition
sequence; or a homo-oligopeptide of a positively charged amino acid
(at physiological pH), such as arginine.
[0079] In a particular embodiment, the linker (spacer peptide)
between the dsRNA binding domain and the target binding moiety is
the ARG9 peptide, or a functional variant thereof, including a
polypeptide that shares about 60%, 70%, 75%, 80%, 85%, 90%, 95%, or
98% sequence identity with the amino acid sequence set forth herein
as SEQ ID NO: 5.
[0080] In a particular embodiment, the chimeric recombinant
polypeptide is the polypeptide having the amino acid sequence set
forth herein as SEQ ID NO: 3, or a functional variant thereof,
including a peptide that shares about 60%, 70%, 75%, 80%, 85%, 90%,
95%, or 98% sequence identity with SEQ ID NO: 4.
[0081] In other embodiments the variation from the described
sequence can be conservative substitutions that one of skill will
not expect to significantly alter the shape or charge of the
polypeptide. The described polypeptides also include those
polypeptides that share 100% sequence identity to those indicated,
but which differ in post-translational modifications from the
native or natively-produced sequence.
[0082] In particular embodiments, the described recombinant
polypeptides are provided as a discrete biomolecules. In other
embodiments, the described polypeptides are a domain of a larger
polypeptide, such as an independently-folded structural domain, or
an environment-accessible functional domain.
[0083] Additionally described herein is a complex that includes any
one of the described recombinant proteins and dsRNA. In certain
embodiments, the dsRNA of the complex is PKR-activating dsRNA, such
as dsRNA comprising a polyinosinic acid strand and a polycytidylic
acid strand (poly IC). In certain embodiments, the poly IC includes
at least 22 ribonucleotides in each strand, for example, 85-300
ribonucleotides in each strand. In certain embodiments, the dsRNA
of the complex comprises at least one siRNA sequence directed
against a pro-oncogenic protein, such as, but not limited to,
Bcl-xl, Bcl-2, Mcl-1, Stat3, Pkb/Akt.
[0084] In particular embodiments, the described complexes are a
component of a pharmaceutical composition that includes a
pharmaceutically acceptable carrier as described above.
[0085] Also provided herein are nucleic acids encoding the
described chimeric recombinant polypeptides, such as the nucleic
acid set forth herein as SEQ ID NO: 4.
[0086] It will be appreciated that due to degeneracy of the genetic
code, the sequences of the described nucleic acids can vary
significantly from the sequence set forth herein as SEQ ID NO 4;
and without any change in the encoded polypeptide. Other and/or
additional mutations in the described polypeptides, such as
conservative amino acid mutations, can also be included without an
appreciable difference. Accordingly, in some embodiments, the
described nucleic acids share between 60%-100% sequence identity
with SEQ ID NO 4, such as 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%
sequence identity. In a particular example, the nucleic acid
sequence is adjusted to account for natural codon bias in a
particular organism such as a bacterial or plant cell. Such
adjustments are known to the art, and can be found (12)
[0087] In particular embodiments, the described nucleic acid
sequences are contained within a DNA cloning and/or expression
plasmid as are standard in the art. It will be appreciated that any
standard expression plasmid can be used to express one or more of
the described chimeric polypeptide-encoding nucleic acids. Such
plasmids will minimally contain an origin of replication, selection
sequence (such as, but not limited to an antibiotic resistance
gene), and expression control sequences operably linked to the
described nucleic acid. In particular embodiments, the expression
plasmids include post-translational sequences (e.g. signal
sequences to direct polypeptide processing and export) that are
encoded in-frame with the described nucleic acids. In particular
embodiments, the expression control sequences are those known to
the art for optimized expression control in a bacterial or plant
host.
[0088] Particular non-limiting examples of bacterial expression
plasmids include IPTG-inducible plasmids, arabinose-inducible
plasmids and the like. Other non-limiting examples of expression
induction include light induction, temperature induction,
nutrient-induction, and autoinduction, plant and mammalian-specific
DNA expression plasmids. Custom-made expression plasmids are
commercially available from suppliers such as New England Biolabs
(Ipswich, Mass.) and DNA 2.0 (Menlo Park, Calif.).
[0089] In particular embodiments, the described polypeptides can be
formulated for immediate release, whereby they are immediately
accessible to the surrounding environment, thereby providing an
effective amount of the active agent(s), upon administration to a
subject, and until the administered dose is metabolized by the
subject.
[0090] In yet another embodiment, the described polypeptides can be
formulated in a sustained release formulation or system. In such
formulations, the therapeutic agents are provided for an extended
duration of time, such as 1, 2, 3, 4 or more days, including 1-72
hours, 24-48 hours, 16-36 hours, 12-24 hours, and any length of
time in between. In particular embodiments, sustained release
formulations are immediately available upon administration, and
provide an effective dosage of the therapeutic composition, and
remain available at an effective dosage over an extended period of
time. In other embodiments, the sustained release formulation is
not immediately available within the subject and only becomes
available, providing a therapeutically effective amount of the
active compound(s), after the formulation is metabolized or
degraded so as to release the active compound(s) into the
surrounding environment.
[0091] In one embodiment, a pump may be used. In another
embodiment, the sustained released formulations include polymeric
materials commonly used in the art, such as in implants, gels,
capsules, and the like.
[0092] Therapeutic preparations will contain a therapeutically
effective amount of at least one active ingredient, preferably in
purified form, together with a suitable amount of carrier so as to
provide proper administration to the patient. The formulation
should suit the mode of administration.
IV. Methods of Treatment of PSMA-Associated Diseases
[0093] PSMA expression is associated with cancerous cells,
particularly prostate cancer and tumor-associated neovasculature
(13). In yet a further aspect, the present disclosure provides a
method for treatment of cancer characterized by expression of a
PSMA, said method by administering to a subject in need thereof,
any one of the complexes or pharmaceutical composition described
herein.
[0094] In some embodiments, the described complex is administered
to the subject in combination with other pharmaceutical agents for
treatment of the cancer under treatment. For example, in particular
examples of cancer treatment, administration of the described can
be combined with surgery, cell therapy, chemotherapy and/or
radiation therapy. The one or more therapies in combination with
the described polypeptides can be administered to the subject in
sequence (prior to or following) or concurrently with the described
polypeptides. Where applicable, in particular embodiments,
combinations of active ingredients can be administered to a subject
in a single or multiple formulations, and by single or multiple
routes of administration. In particular embodiments, the methods of
treatment include the sequential or concurrent administration of
peripheral blood mononuclear cells (PBMCs).
[0095] The amount of each therapeutic agent for use in the
described methods, and that will be effective, will depend on the
nature of the cancer to be treated, as well its stage of the
disorder or condition. Therapeutically effective amounts can be
determined by standard clinical techniques. The precise dose to be
employed in the formulation will also depend on the route of
administration, and should be decided according to the judgment of
the health care practitioner and each patient's circumstances. The
specific dose level and frequency of dosage for any particular
subject may be varied and will depend upon a variety of factors,
including the activity of the specific compound, the metabolic
stability and length of action of that compound, the age, body
weight, general health, sex, diet, mode and time of administration,
rate of excretion, drug combination, and severity of the condition
of the host undergoing therapy.
[0096] The therapeutic compounds and compositions of the present
disclosure can be administered at about the same dose throughout a
treatment period, in an escalating dose regimen, or in a
loading-dose regime (e.g., in which the loading dose is about two
to five times the maintenance dose). In some embodiments, the dose
is varied during the course of a treatment based on the condition
of the subject being treated, the severity of the disease or
condition, the apparent response to the therapy, and/or other
factors as judged by one of ordinary skill in the art. In some
embodiments long-term treatment with the drug is contemplated.
[0097] The following examples are provided to illustrate certain
particular features and/or embodiments. These examples should not
be construed to limit the disclosure to the particular features or
embodiments described.
EXAMPLES
Example 1: Methods
[0098] Cloning of GFP-SCP and dsRB-SCP
[0099] Plasmids pGFP-SCP (encoding GFP linked via Arg9 to the
single chain antibody, ScFvJ591, against PSMA; 56 kDa) and psRB-SCP
(encoding dsRB of human PKR linked via Arg9 to ScFvJ591; 48 kDa)
(FIG. 1A) were constructed as follows:
[0100] SCP (single chain antibody against PSMA, ScFvJ591) was
amplified by PCR from plasmid SFG-Pzl (14), using primers SCP-N and
SCP-C. GFP was amplified by PCR from plasmid pEGFP-N3 (Clontech),
using primers GFP-N and GFP-C. dsRB was amplified by PCR from
plasmid DRBM-DT-EGF (15) using primers dsRB-N and dsRB-C. To
prepare the Arg9 linker (GSRRRRRRRRGRKA; SEQ ID NO: 5),
oligonucleotide 9ARG1 was annealed to its complementary
oligonucleotide 9ARG2. The oligonucleotides used are listed in
Table 1. GFP-SCP was constructed in stages in the bacterial
expression vector pET28a (Novagen): GFP was cloned after the His6
tag of plasmid pET28a, between the NdeI and BamHI restriction
sites, SCP was cloned between the HindIII and XhoI sites, and the
Arg9 linker was inserted between the BamH1 and HindIII sites, to
give the fusion His.sub.6-GFP-Arg.sub.9-SCP (FIG. 1A). For the
construction of dsRB-SCP, the GFP fragment was replaced with the
dsRB sequence using restriction sites NdeI and BamHI to give the
fusion His.sub.6-dsRB-Arg.sub.9-SCP (FIG. 2A). The expected
sequences were confirmed at The Center for Genomic Technologies at
The Hebrew University of Jerusalem (Supplementary).
TABLE-US-00001 TABLE 1 Oligonucleotides used for the construction
of pGFP-SCP and psRB-SCP. Name Sequence 5' to 3' SCP-N
TTTACTCGAGCGGAGGTGCAGCTGCAGC (SEQ ID NO: 10) SCP-C
TTTTGCTCAGCGCCGTTACAGGTCCAGCCATG (SEQ ID NO: 11) GFP-N
TTTTCATATGGTGAGCAAGGGCG (SEQ ID NO: 12) GFP-C
TAAGGATCCGCCACCGCCGCTTTTCTTGTACAGC (SEQ ID NO: 13) dsRB-N
TTTCATATGATGGCTGGTGATC (SEQ ID NO: 14) dsRB-C
TTAGGATCCGCCACCGCCGCTCTCCGATAAGATCTGCAG (SEQ ID NO: 15) 9ARG1
GATCCCGTCGTCGCCGTCGTCGCCGTCGCGGCCGCAA (SEQ ID NO: 16) 9ARG2
AGCTTTGCGGCCGCGACGGCGACGACGGCGACGACGG (SEQ ID NO: 17)
Expression of GFP-SCP and dsRB-SCP
[0101] The chimeric proteins were expressed in E. coli
BL21trxB(DE3) (Novagen) which had been transformed with plasmid
pRARE, which encodes tRNAs for rare codons. The bacteria were grown
at 37.degree. C., in 2.times.YT medium, supplemented with 25
.mu.g/ml chloramphenicol, 30 .mu.g/ml kanamycin, 100 .mu.g/ml
ampicillin, 1% glucose and 5% NPS buffer (1M KH.sub.2PO.sub.4, 1M
Na.sub.2HPO.sub.4, 0.5M (NH.sub.4).sub.2SO.sub.4). When the culture
reached OD.sub.600.about.0.3, 0.1% glycerol and 0.1 mM L-glutamic
acid were added, and the culture was moved to 42.degree. C., to
induce the expression of E. coli chaperones and enhance protein
solubility. When the culture reached O.D.sub.600.about.0.9, it was
cooled down on ice and transferred to 14.degree. C. After a 10 min
adjustment period, 0.5 mmol/L IPTG was added, followed by
incubation for 24 h. The bacteria were harvested and the pellet
stored at -80.degree. C. until purification.
Purification of GFP-SCP and dsRB-SCP
[0102] GFP-SCP: The pellet obtained from 1.2 L of E. coli
BL21trxB(DE3, pRARE, pGFP-SCP) was thawed on ice in 60 ml binding
buffer (Buffer A, 30 mM HEPES pH 8.3, 0.5M NaCl, 10% glycerol, 10
mM imidazole) supplemented with a protease inhibitor cocktail, 3
mg/ml lysozyme and DNase, and lysed using a LV1 microfluidizer
(Microfluidics). The extract was clarified by centrifugation for 30
min (15,000.times.g, 4.degree. C.), loaded onto an 8 ml nickel
sepharose FF IMAC column (GE Healthcare), and washed with 10 column
volumes (CV) of binding buffer, followed by 6 CV of 5% Buffer B (30
mM HEPES pH 8.3, 0.5M NaCl, 10% glycerol, 1M imidazole), 6 CV of
10% Buffer B and 1 CV of 15% Buffer B. The protein was eluted with
60% Buffer B. Fractions containing the chimera (8 ml total) were
loaded on a 500 ml sephacryl S-200 gel filtration column (GE
Healthcare) pre-equilibrated with GF buffer (30 mM HEPES pH 8.3,
0.5M NaCl, 10% glycerol). The fractions eluted after 0.5 CV were
pooled, concentrated using Vivaspin-20 (MWCO: 30000, GE Healthcare)
and loaded onto 350 ml superdex-75. The fractions eluted after 0.5
CV were subjected to SDS-PAGE and stained with InstantBlue
(Expedeon). The fractions that contained highly purified chimera
were pooled, concentrated using Vivaspin-20 (GE Healthcare), and
stored in aliquots at -80.degree. C.
[0103] dsRB-SCP: The pellet obtained from 6 L of E. coli
BL21trxB(DE3, pRARE, pdsRB-SCP) was thawed in 300 ml binding buffer
A supplemented with protease inhibitors, lysozyme and DNase, lysed
and clarified as above. To release bound host nucleic acids, the
cleared lysate was mixed 1:1 (vol:vol) with 8M urea. The mixture
was incubated at 4.degree. C. for 1.5 hr and then loaded onto 60 ml
nickel sepharose FF column pre-equilibrated with buffer C (Buffer A
supplemented with 0.5% Tween 80 and 4M urea), and washed with 12.4
CV Buffer C. To refold the protein, a slow linear gradient of
Buffer C to Buffer D (Buffer A supplemented with 0.5% Tween 80), 10
CV, 0.8 ml/min flow was applied. The column was washed with 3 CV of
10% and 3 CV of 25% Buffer E (30 mM HEPES pH 8.3, 0.5M NaCl, 10%
glycerol, 500 mM imidazole, 0.5% Tween 80), and the protein was
eluted with 100% buffer E. The fractions containing the chimera
were pooled and diluted 1:1 with dilution buffer (30 mM MES pH, 10%
Glycerol, 0.5% Tween). The diluted protein was clarified by
centrifugation for 30 min (15,000.times.g, 4.degree. C.) and loaded
onto a 66 ml Fracto-gel EMD SO3 IEX column (Merck). A manual step
gradient (7 CV) of Buffer F (30 mM MES pH, 100 mM NaCl, 10%
Glycerol, 0.001% Tween) and 25%, 27%, 30%, 37% and 38% Buffer G (30
mM HEPES pH 8.3, 2M NaCl, 10% glycerol, 0.001% Tween 80) was
applied. Samples of the eluted fractions were subjected to SDS-PAGE
and stained with InstantBlue (Expedeon). Fractions that contained
purified chimera were pooled, concentrated, and stored at
-80.degree. C. as above.
Cell Lines
[0104] LNCaP cells were cultured in RPMI 1640 medium supplemented
with 10 mM HEPES pH 7.4 and ImM sodium pyruvate. VCaP cells were
cultured in DMEM (Dulbecco's Modified Eagle Medium). PC3 and DU145
cells were cultured in MEM (Minimum Essential Medium) supplemented
with 1% non-essential amino acids, 1 mM sodium pyruvate, 10 mM
Hepes pH 7.4 and 1% MEM vitamin mixture. MCF7 cells were cultured
in RPMI 1640 medium. All tissue culture media were supplemented
with penicillin (100 U/ml), streptomycin (100 mg/1) and 10% FBS
(fetal bovine serum). All cell lines were purchased from the
American Type Culture Collection (ATCC), tested and shown to be
mycoplasma-free.
[0105] LNCaP-Luc/GFP and PC3-Luc/GFP were generated using
lentiviral vectors encoding the fusion gene luciferase-GFP
(Luc/GFP) as previously described (16). PBMCs were isolated from
fresh human peripheral blood by standard Ficoll density-gradient
centrifugation (17). All cells were incubated at 37.degree. C. with
5% CO2 in a humidified incubator. All cell culture reagents were
purchased from Biological Industries, Bet Ha'emek, and Israel.
Flow Cytometry
[0106] Cells were plated onto 12-well plates at a density of
1.times.10.sup.5 cells per well, grown for 40 hr and incubated with
GFP-SCP. After incubation cells were trypsinized, washed in PBS,
re-suspended in lml cold PBS and subjected to flow cytometry
analysis using BD FACS ARIAIII (BD Biosciences, USA) equipped with
488 nm laser. 10,000 cells were acquired for each treatment. The
cells were gated to include only live cells and the subpopulation
was analyzed for GFP levels. All data was analyzed using FlowJo
software (Becton Dickinson).
Immunocytochemistry
[0107] LNCaP, PC3 and MCF7 cells were grown for 48 hr and incubated
with 25 nM GFP-SCP for 5 hr at 37.degree. C. After incubation cells
were fixed with 4% Paraformaldehyde, washed twice with PBS,
permeabilized and stained with goat anti-GFP antibody (1:1000,
Abcam ab5450), followed by incubation with DyLight 488-conjugated
anti-goat secondary antibody (1:300, Jackson ImmunoResearch
Laboratories). 4, 6-diamidino-2-phenylindole (DAPI) was used to
stain DNA. Stained samples were observed with a confocal microscope
(FLUOVIEW FV-1000, Olympus, Japan).
Live Cell Imaging
[0108] GFP-SCP localization was observed in live LNCaP cells, using
time-lapse confocal microscopy (FLUOVIEW FV-1000, Olympus, Japan).
LNCaP cells were grown for 48 hr in 8-well .mu.-slides (Ibidi, cat
no 80826). After changing the medium, 200 nM GFP-SCP was added
directly to the chamber, the cells were immediately observed and
subsequent images were taken every 6 minutes, for 72 mins. The
images were analyzed using FLUOVIEW Viewer software (Ver.4.2).
dsRNA Electrophoretic Mobility Shift Assay (EMSA)
[0109] 500 bp long dsRNA transcribed from the control template of
the MEGAscript.RTM. RNAi Kit (AM1626) was labeled using the Label
IT.RTM. Nucleic Acid Labeling Reagents kit (Mirus). 1 .mu.g of
labeled dsRNA was incubated for 30 minutes with increasing amounts
of purified dsRB-SCP (0.5-3 .mu.g), and the mixture was
electrophoresed on a 2% agarose gel. The gel was visualized by
staining with ethidium bromide.
Preparation of dsRB-SCP/polyIC Complex
[0110] PolyIC used for all experiments was low molecular weight
(LMW) polyIC (InvivoGen). For all experiments, dsRB-SCP/polyIC,
polyIC alone or dsRB-SCP alone was prepared in binding buffer (30
mM HEPES pH 8.3, 0.5M NaCl, 10% glycerol) at the concentrations
indicated in the text, and pre-incubated for 45 minutes at room
temperature, before addition to the cells.
Survival Assay
[0111] LNCaP, VCaP, PC3 and MCF7 cells were seeded in 96-well
plates in triplicate (5000 cells/well) and grown overnight.
dsRB-SCP/polyIC, polyIC alone or dsRB-SCP was added to the cells,
which were then incubated for additional 100 hr. Survival was
measured using the CellTiter-Glo Luminescent Cell Viability Assay
(Promega).
[0112] For the rescue experiment, LNCaP cells were seeded (5000
cells/well) in three 96-well plates pre-coated with poly-lysine.
For each plate, treatments were repeated in triplicate wells and
the cells were grown overnight. The cells were then treated with
dsRB-SCP/polyIC, polyIC alone or dsRB-SCP alone. The first plate
was assayed for survival after 100 hr. The medium in the second
plate was changed after 100 hr and survival was assayed after 172
hr. The medium in the third plate was changed after 100 hr and
again after 172 hr and survival was assayed after 344 hr.
Immunoblots
[0113] LNCaP cells were seeded in 6-well plates (1.times.10.sup.6
cells/well), grown overnight and treated with dsRB-SCP/polyIC or
polyIC alone at the indicated concentrations. After 7, 16 or 24 hr
cells were lysed with boiling Laemmli sample buffer (10% glycerol,
50 mmol/L Tris-HCl, pH 6.8, 3% SDS, and 5% 2-mercaptoethanol) and
the lysates were then subjected to western blot analysis (18). The
cleavage of PARP and caspase-3 was monitored using anti-PARP
(cat#95425), anti-caspase3 (cat#96625) and anti-cleaved caspase-3
(cat#96615) (all from Cell Signaling Technology). As an internal
control to normalize the amount of protein applied in each lane the
blots were also incubated with anti-GAPDH (Santa Cruz,
sc-25778).
Detection of Secreted Chemokines (IP-10 and RANTES) by ELISA
[0114] LNCaP cells were seeded in 96-well plates in triplicate and
grown overnight (10,000 cells/well). Cells were then treated with
dsRB-SCP/polyIC or polyIC alone at the indicated concentrations.
After 48 hr the medium was collected and the concentrations of
IP-10 and RANTES were measured using commercial ELISA kits
(PeproTech).
RNA Isolation, cDNA Synthesis and Quantitative Real-Time PCR
[0115] LNCaP cells were seeded in 24-well plates (500,000 cells per
well) and grown overnight. Cells were then treated for 4 hr with
dsRB-SCP/polyIC, polyIC alone or dsRB-SCP alone at the indicated
concentrations. The cells were lysed and total RNA was extracted
using the EZ-10 DNA Away RNA-Miniprep Kit (Bio Basic).
Complementary DNA (cDNA) was synthesized using the High Capacity
cDNA Reverse Transcription Kit (Applied Biosystems). IFN-.beta.
gene expression levels were compared using quantitative real-time
PCR and normalized to GAPDH expression using the .DELTA..DELTA. CT
method. The primers used for IFN-.beta. quantification were:
forward: 5' ATGACCAACAAGTGTCTCCTCC 3' (SEQ ID NO: 6) and reverse:
5' GCTCATGGAAAGAGCTGTAGTG 3' (SEQ ID NO: 7). The primers for GAPDH
quantification were forward: 5' GAGCCACATCGCTCAGAC 3' (SEQ ID NO:
8) and reverse: 5' CTTCTCATGGTTCACACCC 3' (SEQ ID NO: 9).
Chemotaxis of PBMC
[0116] LNCaP cells were seeded in 24-well plates pre-coated with
poly-lysine (250,000 cells/well) and grown overnight. Then, the
medium was replaced by low-serum medium (0.15% FBS) and the cells
were treated with dsRB-SCP/polyIC at the indicated concentrations.
After 48 hr conditioned medium was collected from the cells and
placed in the bottom well of a 24-well Transwell system
(microporous polycarbonate membrane (0.5 m) Corning; Costar).
Freshly isolated PBMCs (1.times.10.sup.6) in low-serum medium
(0.15% FBS) were added to the upper chamber. After 3.5 hr, medium
from the lower chamber was collected and the migrated cells were
quantified by FACS analysis, scatter-gating on lymphocytes.
Analysis of Bystander Effects in Co-Culture Systems
[0117] In order to measure the viability of a single cell line in
co-culture with other cells, we generated cells that expressed
luciferase (either LNCaP-Luc/GFP or PC3-Luc/GFP).
[0118] The immune-cell-mediated bystander effect was analyzed using
LNCaP-Luc/GFP cells co-cultured with PBMCs: LNCaP-Luc/GFP cells
were seeded in triplicate in 96-well plates pre-coated with
poly-lysine (10,000 cells/well) and grown overnight. The cells were
then treated with dsRB-SCP/polyIC, polyIC alone or dsRB-SCP alone
at the indicated concentrations. After 24 hr, freshly isolated
PBMCs were added to the culture (1.times.10.sup.5 per well). 48 hr
later, the survival of LNCaP-Luc/GFP cells was measured based on
luciferase activity using the Luciferase Assay System
(Promega).
[0119] The combined direct and immune-cell-mediated bystander
effect was analyzed using LNCaP cells co-cultured with PC3-Luc/GFP
and PBMCs: LNCaP cells were seeded in triplicate in 96-well plates
pre-coated with poly-lysine (6,000 cells/well) and grown overnight,
and the cells were treated with dsRB-SCP/polyIC, polyIC alone or
dsRB-SCP alone. After 16 hr PC3-Luc/GFP cells (4,000 cells/well)
were added to the culture. 24 hr after treatment freshly isolated
PBMCs (1.times.10.sup.5/well) were added to the culture. 48 hr
later survival of the PC3-Luc/GFP cells was measured based on
luciferase activity, using the Luciferase Assay system
(Promega).
Tumor Spheroid Model
[0120] Tumor spheroids were generated using agar-coated plates.
96-well plates were coated with 50 .mu.l/well agar (1.5% (wt/vol)
dissolved in RPMI) according to ref (19). LNCaP or LNCaP-Luc/GFP
cells were seeded (2000 cells per well) and incubated. After 97 hr,
a single spherical spheroid of R=300-400 .mu.m had formed in each
well.
[0121] To measure LNCaP spheroids following treatment with
dsRB-SCP/polyIC, we transferred the spheroids individually to
96-well plate (1 spheroid/well) pre-coated with a very thin, even
layer of polyHEMA (120 mg/ml dissolved in 95% ethanol). To transfer
the spheroids, we first lifted each spheroid together with its 200
.mu.l of medium into a 96U-well plate (with U-shaped wells). The
plate was centrifuged for 10 minutes at 220 g and the medium was
replaced with 80 .mu.l of fresh medium. The spheroid was then
transferred, together with its 80 .mu.l of medium, to the
polyHEMA-coated plate. dsRB-SCP/polyIC, polyIC alone or dsRB-SCP
alone were added at the indicated concentrations. Treatment
continued for 5 days. On days 1, 2, 4 and 5, half of the medium in
each well was removed and replaced with fresh medium containing the
appropriate treatment. On Day 15, spheroids were stained with
calcein AM (1:1000, Molecular Probes c3099) and 0.5 .mu.g/ml
propidium iodide. Spheroids were monitored using confocal
microscopy and size was measured using ImageJ software.
[0122] To analyze the immune-cell-mediated bystander effects on
tumor spheroids, we treated LNCaP-Luc/GFP spheroids once, directly
on the agar plate, with dsRB-SCP/polyIC, polyIC alone or dsRB-SCP
alone at the indicated concentrations. After 24 hr fresh PBMCs were
labeled using 1 .mu.M CellTracker.TM. Violet BMQC (Molecular
Probes--Life Technologies) according to the manufacturer's
protocol. 8.times.10.sup.4 PBMCs were added to the spheroid
culture. The co-culture was monitored using confocal
microscopy.
Example 2: Construction and Assay of PSMA-Targeting Chimeric
Proteins
[0123] ScFvJ591 Selectively Targets PSMA Over-Expressing Prostate
Cancer Cells and Efficiently Delivers its Cargo into the Cells
[0124] We first tested whether the single chain antibody ScFvJ591
could be used as a homing ligand, as part of a chimeric protein. We
generated pGFP-Arg9-ScFvJ591, encoding GFP as a tracking marker
fused to the single chain antibody against PSMA, ScFvJ591, via a
linker comprising an endosomal escape sequence (FIG. 1A). The 56
kDa recombinant protein, GFP-SCP (GFP-Arg9-ScFvJ591), was expressed
in E. coli and purified in a 3-step purification process comprising
affinity purification followed by two steps of gel filtration (see
Methods).
[0125] We tested the selectivity of GFP-SCP using confocal
microscopy. We incubated the chimeric protein with LNCaP cells,
which over express PSMA, and analyzed binding after 5 hr. PC3 and
MCF7 cells, which do not express PSMA, served as negative controls.
The confocal images demonstrated that GFP-SCP bound to LNCaP cells
and was selectively internalized, while no binding was evident in
PC3 or MCF7 cells (FIG. 1B). We next compared uptake of GFP-SCP to
LNCaP and MCF7 cells using flow cytometry. We used two doses of
GFP-SCP (200 nM, 400 nM) over two time periods (30 min, 60 min).
The accumulation of GFP-SCP was measured by the resulting
fluorescence shift. As expected, the observed fluorescence levels
were correlated with the concentration of GFP-SCP and incubation
period (FIG. 1C). These results suggest time-dependent and
dose-dependent internalization of GFP-SCP. In contrast, in MCF7
cells, which lack PSMA, no accumulation of GFP-SCP was observed
(FIG. 1C). To monitor the localization of GFP-SCP, we incubated
LNCaP cells with GFP-SCP and observed them using live-cell confocal
microscopy. Initially, GFP-SCP fluorescence was confined to the
cell surface and no free diffusion was observed (FIG. 1D). Minutes
later, GFP-SCP entered the cell via endocytosis, as indicated by
the appearance of small intracellular punctate structures (FIG.
1D). Over time, these structures increased in number. In addition,
increased intracellular diffused powdery fluorescence was observed
(FIG. 1D), indicating that the GFP had escaped from the endosome
and diffused to the cytosol. The accumulation of the GFP inside the
cell increased linearly over the first 40 min after binding (FIG.
1D).
Design, Expression and Purification of a Chimeric Protein that can
Carry and Internalize polyIC Selectively into PSMA Over-Expressing
Prostate Cancer Cells
[0126] Based on the structure of the GFP-SCP chimera, we designed a
chimeric protein that would specifically deliver polyIC into PSMA
over-expressing cells. We replaced the GFP moiety with the
dsRNA-binding domains of PKR (dsRBDs) (FIG. 2A). The chimeric 48
kDa protein, dsRB-SCP (dsRB-9Arg-ScFvJ591), was expressed in E.
coli. and purified using unfolding and refolding steps (FIG. 2B) as
described in Example 1. The binding of the purified protein to
dsRNA was evaluated. dsRB-SCP was incubated with dsRNA of defined
length (500 bp) and the mixture was electrophoresed on an agarose
gel (FIG. 2C). The naked dsRNA control ran at the expected position
in the gel (FIG. 2C). The electrophoresis of dsRNA that had been
incubated with dsRB-SCP was retarded in a dose-dependent manner
(FIG. 2C), confirming that the chimeric protein bound the
dsRNA.
dsRB-SCP Complexed with polyIC Selectively Kills PSMA
Over-Expressing Cells by Inducing Apoptosis
[0127] We evaluated the killing effect of the dsRB-SCP/polyIC
complex using four cell lines: LNCaP and VCaP, which over-express
PSMA, and MCF7 and PC3, which do not express PSMA. dsRB-SCP
selectively delivered polyIC into the PSMA-over-expressing cells
(LNCaP and VCaP), killing up to 80% of the cells (FIG. 3A). Cells
which do not express PSMA (MCF7 and PC3), were not killed by the
treatment (FIG. 3A). The remaining 20% of LNCaP cells were deemed
permanently arrested, as no regrowth was observed 250 hr after
washing out the chimera (350 hr after treatment) (FIG. 3B).
dsRB-SCP/polyIC induced cell death by activating apoptotic
pathways, as indicated by the cleavage of caspase-3 and PARP (FIG.
3C). In cells treated with polyIC alone no cleavage of caspase-3 or
of PARP was detected (FIG. 3C). dsRB-SCP/polyIC treatment induces
cytokine secretion and chemotaxis of immune cells The presence of
dsRNA inside the cell activates the production of
anti-proliferative and pro-apoptotic cytokines and chemokines (20).
To determine whether dsRB-SCP/polyIC can trigger similar effects we
analyzed the production of three main cytokines in the cell: IP-10
and RANTES, both involved in the chemo-attraction of immune cells
and IFN-3, which plays a key role in the differentiation of immune
cells (21). The secretion of IP-10 and RANTES into the medium, as
measured by ELISA, was partially induced by polyIC alone, as
reported previously (22). Treatment with dsRB-SCP/polyIC led to a
further 2-fold increase in IP-10 and RANTES secretion (FIG. 4A-B).
IFN-(3 expression was not affected by polyIC or dsRB-SCP alone, but
treatment with dsRB-SCP/polyIC led to very strong induction of
IFN-3 expression, as measured by qRT-PCR (FIG. 4C).
[0128] To study whether the secreted cytokines attract immune
cells, we examined whether the medium from dsRB-SCP/polyIC-treated
LNCaP cells induced the chemotaxis of freshly isolated PBMCs. FIG.
4D shows that an increased number of PBMCs migrated towards
conditioned medium from cells that were treated with
dsRB-SCP/polyIC compared to medium from untreated cells.
Bystander Effects Induced by dsRB-SCP/polyIC
[0129] We next tested whether the recruited immune cells could
evoke an immune-cell-mediated bystander effect. We treated
LNCaP-Luc/GFP cells, which stably express luciferase, with a low
dose of dsRB-SCP/polyIC, followed by co-incubation with PBMCs. We
used luciferase activity as a measure for the survival of the
LNCaP-Luc/GFP cells. Results showed eradication of the
LNCaP-Luc/GFP cells (FIG. 5A). In contrast, in the absence of
PBMCs, luciferase level was barely affected. These results suggest
that dsRB-SCP/polyIC induces a powerful immune-cell-mediated
bystander effect.
[0130] To evaluate whether dsRB-SCP/polyIC also induces a direct
bystander effect, LNCaP cells were co-incubated with PC3-Luc/GFP
cells, which do not express PSMA. dsRB-SCP/polyIC treatment
resulted in the killing of up to 60% of the PC3-Luc/GFP cells (FIG.
5B). Since PC3-Luc/GFP cells are not targeted by dsRB-SCP/polyIC
(FIG. 5B), we infer that the death of these cells is a result of a
direct bystander effect elicited by the dsRB-SCP/polyIC-targeted
LNCaP cells. Addition of human PBMCs to this co-culture system led
to a significant increase in the killing rate of the PC3-Luc/GFP
cells (FIG. 5B), indicating the additional involvement of an
immune-cell-mediated bystander effect under these conditions.
dsRB-SCP/polyIC Destroys Tumor Spheroids
[0131] We next evaluated the efficacy of dsRB-SCP/polyIC in a 3D
tumor spheroid model. In vitro 3D models closely resemble the
architecture of human tumors (23) and feature high-resistance to
anti-cancer drugs (24). LNCaP spheroids were generated and allowed
to reach a diameter of 300-400 .mu.m. The spheroids were then
transferred to a polyHEMA plate and treated repeatedly with
dsRB-SCP/polyIC (400 nM dsRB-SCP, 2.5 .mu.g/ml polyIC) over the
course of 5 days. By day 5, the spheroids that were treated with
dsRB-SCP/polyIC began to shrink and shed dead cells, while the
untreated spheroids increased in size (FIG. 6A). On day 15, the
spheroids were stained with calcein AM and propidium iodide to
monitor viability (FIG. 6A). The dsRB-SCP/polyIC-treated spheroids
demonstrated significant structural damage and contained large
numbers of dead cells (FIG. 6A). In contrast, the untreated
spheroids and spheroids treated with only polyIC or only dsRB-SCP,
maintained a typical intact structure (11), where the cells at the
surface were alive and the cells at the core were necrotic (FIG.
6A).
[0132] To more closely mimic in vivo conditions and test the
immune-cell-mediated bystander 5 effect on the spheroids, we added
PBMCs to treated spheroids. LNCaP-Luc/GFP spheroids were treated
once with dsRB-SCP/polyIC, and 24 hr later freshly isolated PBMCs
were added to the culture. Even at the lowest dose of
dsRB-SCP/polyIC, spheroid disassembly was already evident 72 hr
after the initiation of the treatment or 48 hr after PBMCs addition
(FIG. 6B). At higher doses, complete spheroid destruction was
observed 96 hr after the initiation of the treatment. After
additional 72 hr, only dead cells were evident with no GFP
fluorescence (FIG. 6B). As a control, the same treatment was
performed in absence of PBMCs. At the end point (168 hr), the
treatment resulted in visible cell death and disassembly of the
spheroid (FIG. 6B lower panel) but the effect was weaker compared
to the levels observed in the presence of PBMCs. Thus,
dsRB-SCP/polyIC has a potent effect on spheroids, and this effect
is greatly magnified by the addition of immune cells.
REFERENCES
[0133] 1. Luo, J., Beer, T. M., and Graff, J. N. (2016) Treatment
of Nonmetastatic Castration-Resistant Prostate Cancer, Oncology
(Williston Park) 30, 336-344, [0134] 2. Attard, G., Sarker, D.,
Reid, A., Molife, R., Parker, C., and de Bono, J. S. (2006)
Improving the outcome of patients with castration-resistant
prostate cancer through rational drug development, British journal
of cancer 95, 767-774, 10.1038/sj.bjc.6603223 [0135] 3. Javidan,
J., Deitch, A. D., Shi, X. B., and de Vere White, R. W. (2005) The
androgen receptor and mechanisms for androgen independence in
prostate cancer, Cancer investigation 23, 520-528,
10.1080/07357900500202721 [0136] 4. Akhtar, N. H., Pail, O., Saran,
A., Tyrell, L., and Tagawa, S. T. (2012) Prostate-specific membrane
antigen-based therapeutics, Advances in urology 2012, 973820,
10.1155/2012/973820 [0137] 5. Sweat, S. D., Pacelli, A., Murphy, G.
P., and Bostwick, D. G. (1998) Prostate-specific membrane antigen
expression is greatest in prostate adenocarcinoma and lymph node
metastases, Urology 52, 637-640, [0138] 6. Wright, G. L., Jr.,
Grob, B. M., Haley, C., Grossman, K., Newhall, K., Petrylak, D.,
Troyer, J., Konchuba, A., Schellhammer, P. F., and Moriarty, R.
(1996) Upregulation of prostate-specific membrane antigen after
androgen-deprivation therapy, Urology 48, 326-334, [0139] 7.
Mannweiler, S., Amersdorfer, P., Trajanoski, S., Terrett, J. A.,
King, D., and Mehes, G. (2009) Heterogeneity of prostate-specific
membrane antigen (PSMA) expression in prostate carcinoma with
distant metastasis, Pathology oncology research: POR 15, 167-172,
10.1007/s12253-008-9104-2 [0140] 8. Tagawa, S. T., Milowsky, M. I.,
Morris, M., Vallabhajosula, S., Christos, P., Akhtar, N. H.,
Osborne, J., Goldsmith, S. J., Larson, S., Taskar, N. P., Scher, H.
I., Bander, N. H., and Nanus, D. M. (2013) Phase II study of
Lutetium-177-labeled anti-prostate-specific membrane antigen
monoclonal antibody J591 for metastatic castration-resistant
prostate cancer, Clinical cancer research: an official journal of
the American Association for Cancer Research 19, 5182-5191,
10.1158/1078-0432.CCR-13-0231 [0141] 9. Galsky, M. D., Eisenberger,
M., Moore-Cooper, S., Kelly, W. K., Slovin, S. F., DeLaCruz, A.,
Lee, Y., Webb, I. J., and Scher, H. I. (2008) Phase I trial of the
prostate-specific membrane antigen-directed immunoconjugate MLN2704
in patients with progressive metastatic castration-resistant
prostate cancer, Journal of clinical oncology: official journal of
the American Society of Clinical Oncology 26, 2147-2154,
10.1200/JCO.2007.15.0532 [0142] 10. van Leeuwen, P. J., Stricker,
P., Hruby, G., Kneebone, A., Ting, F., Thompson, B., Nguyen, Q.,
Ho, B., and Emmett, L. (2016) (68) Ga-PSMA has a high detection
rate of prostate cancer recurrence outside the prostatic fossa in
patients being considered for salvage radiation treatment, BJU
international 117, 732-739, 10.1111/bju.13397 [0143] 11. Phung, Y.
T., Barbone, D., Broaddus, V. C., and Ho, M. (2011) Rapid
generation of in vitro multicellular spheroids for the study of
monoclonal antibody therapy, Journal of Cancer 2, 507-514, [0144]
12. Puigbo, P., Guzman, E., Romeu, A., and Garcia-Vallve, S. (2007)
OPTIMIZER: a web server for optimizing the codon usage of DNA
sequences, Nucleic acids research 35, W126-131, 10.1093/nar/gkm219
[0145] 13. Rajasekaran, A. K., Anilkumar, G., and Christiansen, J.
J. (2005) Is prostate-specific membrane antigen a multifunctional
protein? American journal of physiology. Cell physiology 288,
C975-981, 10.1152/aj pcell.00506.2004 [0146] 14. Gong, M. C.,
Latouche, J. B., Krause, A., Heston, W. D., Bander, N. H., and
Sadelain, M. (1999) Cancer patient T cells genetically targeted to
prostate-specific membrane antigen specifically lyse prostate
cancer cells and release cytokines in response to prostate-specific
membrane antigen, Neoplasia 1, 123-127, [0147] 15. Edinger, N.,
Lebendiker, M., Klein, S., Zigler, M., Langut, Y., and Levitzki, A.
(2016) Targeting polyIC to EGFR over-expressing cells using a dsRNA
binding protein domain tethered to EGF, PloS one 11, e0162321,
10.1371/journal.pone.0162321 [0148] 16. Zigler, M., Shir, A.,
Joubran, S., Sagalov, A., Klein, S., Edinger, N., Lau, J., Yu, S.
F., Mizraji, G., Globerson Levin, A., Sliwkowski, M. X., and
Levitzki, A. (2016) HER2-Targeted Polyinosine/Polycytosine Therapy
Inhibits Tumor Growth and Modulates the Tumor Immune
Microenvironment, Cancer immunology research
10.1158/2326-6066.CIR-15-0203 [0149] 17. Shir, A., Ogris, M.,
Roedl, W., Wagner, E., and Levitzki, A. (2011) EGFR-homing dsRNA
activates cancer-targeted immune response and eliminates
disseminated EGFR-overexpressing tumors in mice, Clinical cancer
research: an official journal of the American Association for
Cancer Research 17, 1033-1043, 10.1158/1078-0432.CCR-10-1140 [0150]
18. Mizrachy-Schwartz, S., Cohen, N., Klein, S.,
Kravchenko-Balasha, N., and Levitzki, A. (2011) Up-regulation of
AMP-activated protein kinase in cancer cell lines is mediated
through c-Src activation, The Journal of biological chemistry 286,
15268-15277, 10.1074/jbc.M110.211813 [0151] 19. Friedrich, J.,
Seidel, C., Ebner, R., and Kunz-Schughart, L. A. (2009)
Spheroid-based drug screen: considerations and practical approach,
Nature protocols 4, 309-324, 10.1038/nprot.2008.226 [0152] 20. Der,
S. D., and Lau, A. S. (1995) Involvement of the
double-stranded-RNA-dependent kinase PKR in interferon expression
and interferon-mediated antiviral activity, Proceedings of the
National Academy of Sciences of the United States of America 92,
8841-8845, [0153] 21. Kumar, A., Zhang, J., and Yu, F. S. (2006)
Toll-like receptor 3 agonist poly(I:C)-induced antiviral response
in human corneal epithelial cells, Immunology 117, 11-21,
10.1111/j.1365-2567.2005.02258.x [0154] 22. Galli, R., Starace, D.,
Busa, R., Angelini, D. F., Paone, A., De Cesaris, P., Filippini,
A., Sette, C., Battistini, L., Ziparo, E., and Riccioli, A. (2010)
TLR stimulation of prostate tumor cells induces chemokine-mediated
recruitment of specific immune cell types, J Immunol 184,
6658-6669, 10.4049/jimmunol.0902401 [0155] 23. Kim, J. B. (2005)
Three-dimensional tissue culture models in cancer biology, Seminars
in cancer biology 15, 365-377, 10.1016/j.semcancer.2005.05.002
[0156] 24. Takagi, A., Watanabe, M., Ishii, Y., Morita, J.,
Hirokawa, Y., Matsuzaki, T., and Shiraishi, T. (2007)
Three-dimensional cellular spheroid formation provides human
prostate tumor cells with tissue-like features, Anticancer research
27, 45-53,
[0157] In view of the many possible embodiments to which the
principles of the disclosed invention may be applied, it should be
recognized that the illustrated embodiments are only preferred
examples of the invention and should not be taken as limiting the
scope of the invention. Rather, the scope of the invention is
defined by the following claims. We therefore claim as our
invention all that comes within the scope and spirit of these
claims.
Sequence CWU 1
1
211517PRTArtificial SequenceRecombinant polypeptide 1Met Gly Ser
Ser His His His His His His Ser Ser Gly Leu Val Pro1 5 10 15Arg Gly
Ser His Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val 20 25 30Val
Pro Ile Leu Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe 35 40
45Ser Val Ser Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr
50 55 60Leu Lys Phe Ile Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro
Thr65 70 75 80Leu Val Thr Thr Leu Thr Tyr Gly Val Gln Cys Phe Ser
Arg Tyr Pro 85 90 95Asp His Met Lys Gln His Asp Phe Phe Lys Ser Ala
Met Pro Glu Gly 100 105 110Tyr Val Gln Glu Arg Thr Ile Phe Phe Lys
Asp Asp Gly Asn Tyr Lys 115 120 125Thr Arg Ala Glu Val Lys Phe Glu
Gly Asp Thr Leu Val Asn Arg Ile 130 135 140Glu Leu Lys Gly Ile Asp
Phe Lys Glu Asp Gly Asn Ile Leu Gly His145 150 155 160Lys Leu Glu
Tyr Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp 165 170 175Lys
Gln Lys Asn Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile 180 185
190Glu Asp Gly Ser Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro
195 200 205Ile Gly Asp Gly Pro Val Leu Leu Pro Asp Asn His Tyr Leu
Ser Thr 210 215 220Gln Ser Ala Leu Ser Lys Asp Pro Asn Glu Lys Arg
Asp His Met Val225 230 235 240Leu Leu Glu Phe Val Thr Ala Ala Gly
Ile Thr Leu Gly Met Asp Glu 245 250 255Leu Tyr Lys Lys Ser Gly Gly
Gly Gly Ser Arg Arg Arg Arg Arg Arg 260 265 270Arg Arg Gly Arg Lys
Ala Ser Ala Glu Val Gln Leu Gln Gln Ser Gly 275 280 285Pro Glu Leu
Val Lys Pro Gly Thr Ser Val Arg Ile Ser Cys Lys Thr 290 295 300Ser
Gly Tyr Thr Phe Thr Glu Tyr Thr Ile His Trp Val Lys Gln Ser305 310
315 320His Gly Lys Ser Leu Glu Trp Ile Gly Asn Ile Asn Pro Asn Asn
Gly 325 330 335Gly Thr Thr Tyr Asn Gln Lys Phe Glu Asp Lys Ala Thr
Leu Thr Val 340 345 350Asp Lys Ser Ser Ser Thr Ala Tyr Met Glu Leu
Arg Ser Leu Thr Ser 355 360 365Glu Asp Ser Ala Val Tyr Tyr Cys Ala
Ala Gly Trp Asn Phe Asp Tyr 370 375 380Trp Gly Gln Gly Thr Thr Val
Thr Val Ser Ser Gly Gly Gly Gly Ser385 390 395 400Gly Gly Gly Gly
Ser Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln 405 410 415Ser His
Lys Phe Met Ser Thr Ser Val Gly Asp Arg Val Ser Ile Ile 420 425
430Cys Lys Ala Ser Gln Asp Val Gly Thr Ala Val Asp Trp Tyr Gln Gln
435 440 445Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile Tyr Trp Ala Ser
Thr Arg 450 455 460His Thr Gly Val Pro Asp Arg Phe Thr Gly Ser Gly
Ser Gly Thr Asp465 470 475 480Phe Thr Leu Thr Ile Thr Asn Val Gln
Ser Glu Asp Leu Ala Asp Tyr 485 490 495Phe Cys Gln Gln Tyr Asn Ser
Tyr Pro Leu Thr Phe Gly Ala Gly Thr 500 505 510Met Leu Asp Leu Lys
51521554DNAArtificial SequenceRecombinant polynucleotide
2atgggcagca gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat
60atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac
120ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga
tgccacctac 180ggcaagctga ccctgaagtt catctgcacc accggcaagc
tgcccgtgcc ctggcccacc 240ctcgtgacca ccctgaccta cggcgtgcag
tgcttcagcc gctaccccga ccacatgaag 300cagcacgact tcttcaagtc
cgccatgccc gaaggctacg tccaggagcg caccatcttc 360ttcaaggacg
acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg
420gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat
cctggggcac 480aagctggagt acaactacaa cagccacaac gtctatatca
tggccgacaa gcagaagaac 540ggcatcaagg tgaacttcaa gatccgccac
aacatcgagg acggcagcgt gcagctcgcc 600gaccactacc agcagaacac
ccccatcggc gacggccccg tgctgctgcc cgacaaccac 660tacctgagca
cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc
720ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct
gtacaagaaa 780agcggcggtg gcggatcccg tcgtcgccgt cgtcgccgtc
gcggccgcaa agcttccgca 840gaggtgcagc tgcagcagtc aggacctgaa
ctggtgaagc ctgggacttc agtgaggata 900tcctgcaaga cttctggata
cacattcact gaatatacca tacactgggt gaagcagagc 960catggaaaga
gccttgagtg gattggaaac atcaatccta acaatggtgg taccacctac
1020aatcagaagt tcgaggacaa ggccacattg actgtagaca agtcctccag
tacagcctac 1080atggagctcc gcagcctaac atctgaggat tctgcagtct
attattgtgc agctggttgg 1140aactttgact actggggcca agggaccacg
gtcaccgtct cctcaggtgg aggtggatca 1200ggtggaggtg gatctggtgg
aggtggatct gacattgtga tgacccagtc tcacaaattc 1260atgtccacat
cagtaggaga cagggtcagc atcatctgta aggccagtca agatgtgggt
1320actgctgtag actggtatca acagaaacca ggacaatctc ctaaactact
gatttattgg 1380gcatccactc ggcacactgg agtccctgat cgcttcacag
gcagtggatc tgggacagac 1440ttcactctca ccattactaa tgttcagtct
gaagacttgg cagattattt ctgtcagcaa 1500tataacagct atcccctcac
gttcggtgct gggaccatgc tggacctgaa ataa 15543446PRTArtificial
SequenceRecombinant polypeptide 3Met Gly Ser Ser His His His His
His His Ser Ser Gly Leu Val Pro1 5 10 15Arg Gly Ser His Met Met Ala
Gly Asp Leu Ser Ala Gly Phe Phe Met 20 25 30Glu Glu Leu Asn Thr Tyr
Arg Gln Lys Gln Gly Val Val Leu Lys Tyr 35 40 45Gln Glu Leu Pro Asn
Ser Gly Pro Pro His Asp Arg Arg Phe Thr Phe 50 55 60Gln Val Ile Ile
Asp Gly Arg Glu Phe Pro Glu Gly Glu Gly Arg Ser65 70 75 80Lys Lys
Glu Ala Lys Asn Ala Ala Ala Lys Leu Ala Val Glu Ile Leu 85 90 95Asn
Lys Glu Lys Lys Ala Val Ser Pro Leu Leu Leu Thr Thr Thr Asn 100 105
110Ser Ser Glu Gly Leu Ser Met Gly Asn Tyr Ile Gly Leu Ile Asn Arg
115 120 125Ile Ala Gln Lys Lys Arg Leu Thr Val Asn Tyr Glu Gln Cys
Ala Ser 130 135 140Gly Val His Gly Pro Glu Gly Phe His Tyr Lys Cys
Lys Met Gly Gln145 150 155 160Lys Glu Tyr Ser Ile Gly Thr Gly Ser
Thr Lys Gln Glu Ala Lys Gln 165 170 175Leu Ala Ala Lys Leu Ala Tyr
Leu Gln Ile Leu Ser Glu Ser Gly Gly 180 185 190Gly Gly Ser Arg Arg
Arg Arg Arg Arg Arg Arg Gly Arg Lys Ala Ser 195 200 205Ala Glu Val
Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly 210 215 220Thr
Ser Val Arg Ile Ser Cys Lys Thr Ser Gly Tyr Thr Phe Thr Glu225 230
235 240Tyr Thr Ile His Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu
Trp 245 250 255Ile Gly Asn Ile Asn Pro Asn Asn Gly Gly Thr Thr Tyr
Asn Gln Lys 260 265 270Phe Glu Asp Lys Ala Thr Leu Thr Val Asp Lys
Ser Ser Ser Thr Ala 275 280 285Tyr Met Glu Leu Arg Ser Leu Thr Ser
Glu Asp Ser Ala Val Tyr Tyr 290 295 300Cys Ala Ala Gly Trp Asn Phe
Asp Tyr Trp Gly Gln Gly Thr Thr Val305 310 315 320Thr Val Ser Ser
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 325 330 335Gly Gly
Ser Asp Ile Val Met Thr Gln Ser His Lys Phe Met Ser Thr 340 345
350Ser Val Gly Asp Arg Val Ser Ile Ile Cys Lys Ala Ser Gln Asp Val
355 360 365Gly Thr Ala Val Asp Trp Tyr Gln Gln Lys Pro Gly Gln Ser
Pro Lys 370 375 380Leu Leu Ile Tyr Trp Ala Ser Thr Arg His Thr Gly
Val Pro Asp Arg385 390 395 400Phe Thr Gly Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Thr Asn 405 410 415Val Gln Ser Glu Asp Leu Ala
Asp Tyr Phe Cys Gln Gln Tyr Asn Ser 420 425 430Tyr Pro Leu Thr Phe
Gly Ala Gly Thr Met Leu Asp Leu Lys 435 440 44541338DNAArtificial
SequenceRecombinant polynucleotide 4atgggcagca gccatcatca
tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60atgatggctg gtgatctttc
agcaggtttc ttcatggagg aacttaatac ataccgtcag 120aagcagggag
tagtacttaa atatcaagaa ctgcctaatt caggacctcc acatgatagg
180aggtttacat ttcaagttat aatagatgga agagaatttc cagaaggtga
aggtagatca 240aagaaggaag caaaaaatgc cgcagccaaa ttagctgttg
agatacttaa taaggaaaag 300aaggcagtta gtcctttatt attgacaaca
acgaattctt cagaaggatt atccatgggg 360aattacatag gccttatcaa
tagaattgcc cagaagaaaa gactaactgt aaattatgaa 420cagtgtgcat
cgggggtgca tgggccagaa ggatttcatt ataaatgcaa aatgggacag
480aaagaatata gtattggtac aggttctact aaacaggaag caaaacaatt
ggcggccaaa 540ctggcctatc tgcagatctt atcggagagc ggcggtggcg
gatcccgtcg tcgccgtcgt 600cgccgtcgcg gccgcaaagc ttccgcagag
gtgcagctgc agcagtcagg acctgaactg 660gtgaagcctg ggacttcagt
gaggatatcc tgcaagactt ctggatacac attcactgaa 720tataccatac
actgggtgaa gcagagccat ggaaagagcc ttgagtggat tggaaacatc
780aatcctaaca atggtggtac cacctacaat cagaagttcg aggacaaggc
cacattgact 840gtagacaagt cctccagtac agcctacatg gagctccgca
gcctaacatc tgaggattct 900gcagtctatt attgtgcagc tggttggaac
tttgactact ggggccaagg gaccacggtc 960accgtctcct caggtggagg
tggatcaggt ggaggtggat ctggtggagg tggatctgac 1020attgtgatga
cccagtctca caaattcatg tccacatcag taggagacag ggtcagcatc
1080atctgtaagg ccagtcaaga tgtgggtact gctgtagact ggtatcaaca
gaaaccagga 1140caatctccta aactactgat ttattgggca tccactcggc
acactggagt ccctgatcgc 1200ttcacaggca gtggatctgg gacagacttc
actctcacca ttactaatgt tcagtctgaa 1260gacttggcag attatttctg
tcagcaatat aacagctatc ccctcacgtt cggtgctggg 1320accatgctgg acctgaaa
1338514PRTArtificial SequenceSynthetic oligopeptide 5Gly Ser Arg
Arg Arg Arg Arg Arg Arg Arg Gly Arg Lys Ala1 5 10622DNAArtificial
SequenceSynthetic oligonucleotide 6atgaccaaca agtgtctcct cc
22722DNAArtificial SequenceSynthetic oligonucleotide 7gctcatggaa
agagctgtag tg 22818DNAArtificial SequenceSynthetic oligonucleotide
8gagccacatc gctcagac 18919DNAArtificial SequenceSynthetic
oligonucleotide 9cttctcatgg ttcacaccc 191028DNAArtificial
SequenceSynthetic oligonucleotide 10tttactcgag cggaggtgca gctgcagc
281132DNAArtificial SequenceSynthetic oligonucleotide 11ttttgctcag
cgccgttaca ggtccagcca tg 321223DNAArtificial SequenceSynthetic
oligonucleotide 12ttttcatatg gtgagcaagg gcg 231334DNAArtificial
SequenceSynthetic oligonucleotide 13taaggatccg ccaccgccgc
ttttcttgta cagc 341422DNAArtificial SequenceSynthetic
oligonucleotide 14tttcatatga tggctggtga tc 221539DNAArtificial
SequenceSynthetic oligonucleotide 15ttaggatccg ccaccgccgc
tctccgataa gatctgcag 391637DNAArtificial SequenceSynthetic
oligonucleotide 16gatcccgtcg tcgccgtcgt cgccgtcgcg gccgcaa
371737DNAArtificial SequenceSynthetic oligonucleotide 17agctttgcgg
ccgcgacggc gacgacggcg acgacgg 3718169PRTHomo sapiens 18Met Met Ala
Gly Asp Leu Ser Ala Gly Phe Phe Met Glu Glu Leu Asn1 5 10 15Thr Tyr
Arg Gln Lys Gln Gly Val Val Leu Lys Tyr Gln Glu Leu Pro 20 25 30Asn
Ser Gly Pro Pro His Asp Arg Arg Phe Thr Phe Gln Val Ile Ile 35 40
45Asp Gly Arg Glu Phe Pro Glu Gly Glu Gly Arg Ser Lys Lys Glu Ala
50 55 60Lys Asn Ala Ala Ala Lys Leu Ala Val Glu Ile Leu Asn Lys Glu
Lys65 70 75 80Lys Ala Val Ser Pro Leu Leu Leu Thr Thr Thr Asn Ser
Ser Glu Gly 85 90 95Leu Ser Met Gly Asn Tyr Ile Gly Leu Ile Asn Arg
Ile Ala Gln Lys 100 105 110Lys Arg Leu Thr Val Asn Tyr Glu Gln Cys
Ala Ser Gly Val His Gly 115 120 125Pro Glu Gly Phe His Tyr Lys Cys
Lys Met Gly Gln Lys Glu Tyr Ser 130 135 140Ile Gly Thr Gly Ser Thr
Lys Gln Glu Ala Lys Gln Leu Ala Ala Lys145 150 155 160Leu Ala Tyr
Leu Gln Ile Leu Ser Glu 16519507DNAHomo sapiens 19atgatggctg
gtgatctttc agcaggtttc ttcatggagg aacttaatac ataccgtcag 60aagcagggag
tagtacttaa atatcaagaa ctgcctaatt caggacctcc acatgatagg
120aggtttacat ttcaagttat aatagatgga agagaatttc cagaaggtga
aggtagatca 180aagaaggaag caaaaaatgc cgcagccaaa ttagctgttg
agatacttaa taaggaaaag 240aaggcagtta gtcctttatt attgacaaca
acgaattctt cagaaggatt atccatgggg 300aattacatag gccttatcaa
tagaattgcc cagaagaaaa gactaactgt aaattatgaa 360cagtgtgcat
cgggggtgca tgggccagaa ggatttcatt ataaatgcaa aatgggacag
420aaagaatata gtattggtac aggttctact aaacaggaag caaaacaatt
ggcggccaaa 480ctggcctatc tgcagatctt atcggag 50720237PRTArtificial
SequenceSynthetic polypeptide 20Glu Val Gln Leu Gln Gln Ser Gly Pro
Glu Leu Val Lys Pro Gly Thr1 5 10 15Ser Val Arg Ile Ser Cys Lys Thr
Ser Gly Tyr Thr Phe Thr Glu Tyr 20 25 30Thr Ile His Trp Val Lys Gln
Ser His Gly Lys Ser Leu Glu Trp Ile 35 40 45Gly Asn Ile Asn Pro Asn
Asn Gly Gly Thr Thr Tyr Asn Gln Lys Phe 50 55 60Glu Asp Lys Ala Thr
Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr65 70 75 80Met Glu Leu
Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95Ala Ala
Gly Trp Asn Phe Asp Tyr Trp Gly Gln Gly Thr Thr Val Thr 100 105
110Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly
115 120 125Gly Ser Asp Ile Val Met Thr Gln Ser His Lys Phe Met Ser
Thr Ser 130 135 140Val Gly Asp Arg Val Ser Ile Ile Cys Lys Ala Ser
Gln Asp Val Gly145 150 155 160Thr Ala Val Asp Trp Tyr Gln Gln Lys
Pro Gly Gln Ser Pro Lys Leu 165 170 175Leu Ile Tyr Trp Ala Ser Thr
Arg His Thr Gly Val Pro Asp Arg Phe 180 185 190Thr Gly Ser Gly Ser
Gly Thr Asp Phe Thr Leu Thr Ile Thr Asn Val 195 200 205Gln Ser Glu
Asp Leu Ala Asp Tyr Phe Cys Gln Gln Tyr Asn Ser Tyr 210 215 220Pro
Leu Thr Phe Gly Ala Gly Thr Met Leu Asp Leu Lys225 230
23521711DNAArtificial SequenceSynthetic polynucleotide 21gaggtgcagc
tgcagcagtc aggacctgaa ctggtgaagc ctgggacttc agtgaggata 60tcctgcaaga
cttctggata cacattcact gaatatacca tacactgggt gaagcagagc
120catggaaaga gccttgagtg gattggaaac atcaatccta acaatggtgg
taccacctac 180aatcagaagt tcgaggacaa ggccacattg actgtagaca
agtcctccag tacagcctac 240atggagctcc gcagcctaac atctgaggat
tctgcagtct attattgtgc agctggttgg 300aactttgact actggggcca
agggaccacg gtcaccgtct cctcaggtgg aggtggatca 360ggtggaggtg
gatctggtgg aggtggatct gacattgtga tgacccagtc tcacaaattc
420atgtccacat cagtaggaga cagggtcagc atcatctgta aggccagtca
agatgtgggt 480actgctgtag actggtatca acagaaacca ggacaatctc
ctaaactact gatttattgg 540gcatccactc ggcacactgg agtccctgat
cgcttcacag gcagtggatc tgggacagac 600ttcactctca ccattactaa
tgttcagtct gaagacttgg cagattattt ctgtcagcaa 660tataacagct
atcccctcac gttcggtgct gggaccatgc tggacctgaa a 711
* * * * *