U.S. patent application number 16/176846 was filed with the patent office on 2019-06-06 for methods of treating or preventing zika virus infection.
The applicant listed for this patent is NUtech Ventures. Invention is credited to Nicholas Palermo, Aryamav Pattnaik, Asit K. Pattnaik, Shi-hua Xiang.
Application Number | 20190167670 16/176846 |
Document ID | / |
Family ID | 66658667 |
Filed Date | 2019-06-06 |
United States Patent
Application |
20190167670 |
Kind Code |
A1 |
Xiang; Shi-hua ; et
al. |
June 6, 2019 |
METHODS OF TREATING OR PREVENTING ZIKA VIRUS INFECTION
Abstract
This document relates to methods and materials for treating a
mammal having a Zika virus (ZIKV) infection. For example, a
composition including one or more non-nucleoside RNA polymerase
inhibitors can be administered to a mammal having, or at risk of
developing, a ZIKV infection to treat the mammal
Inventors: |
Xiang; Shi-hua; (Lincoln,
NE) ; Palermo; Nicholas; (Omaha, NE) ;
Pattnaik; Asit K.; (Lincoln, NE) ; Pattnaik;
Aryamav; (Lincoln, NE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
NUtech Ventures |
Lincoln |
NE |
US |
|
|
Family ID: |
66658667 |
Appl. No.: |
16/176846 |
Filed: |
October 31, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62579495 |
Oct 31, 2017 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 9/0019 20130101;
A61P 31/14 20180101; A61K 31/496 20130101 |
International
Class: |
A61K 31/496 20060101
A61K031/496; A61K 9/00 20060101 A61K009/00; A61P 31/14 20060101
A61P031/14 |
Claims
1. A method for treating a mammal having a Zika virus (ZIKV)
infection, said method comprising: administering to said mammal a
composition comprising a non-nucleoside RNA polymerase
inhibitor.
2. The method of claim 1, wherein said mammal is a human.
3. The method of claim 1, wherein said non-nucleoside RNA
polymerase inhibitor can bind to a catalytic active site of an
RNA-dependent RNA-polymerase (RdRp) of said ZIKV to inhibit ZIKV
replication.
4. The method of claim 1, wherein said non-nucleoside RNA
polymerase inhibitor is
3-chloro-N-[({4-[4-(2-thienylcarbonyl)-1-piperazinyl]phenyl}amino)carbono-
thioyl]-1-benzothiophene-2-carboxamide (TPB).
5. The method of claim 1, wherein said non-nucleoside RNA
polymerase inhibitor has an inhibitory concentration 50 (IC.sub.50)
of from about 10 nM to about 200 nM.
6. The method of claim 1, wherein said non-nucleoside RNA
polymerase inhibitor has a cytotoxicity concentration 50
(CC.sub.50) of from about 15 .mu.M to about 25 .mu.M.
7. The method of claim 1, wherein said non-nucleoside RNA
polymerase inhibitor has a selective index 50 (SI.sub.50) of about
206.
8. The method of claim 1, wherein said administering step is
performed prior to said ZIKV infection or after said ZIKV
infection.
9. The method of claim 1, wherein said administering step is
performed prior to said ZIKV infection and after infection said
ZIKV infection.
10. The method of claim 1, wherein said non-nucleoside RNA
polymerase inhibitor is administered intraperitoneally,
intravenously, intramuscularly, or subcutaneously.
11. A method of preventing microcephaly in a fetus said method
comprising: administering a composition comprising a non-nucleoside
RNA polymerase inhibitor to a mammal pregnant with said fetus,
wherein said mammal has a ZIKV infection.
12. The method of claim 11, wherein said mammal is a human.
13. The method of claim 11, wherein said non-nucleoside RNA
polymerase inhibitor is
3-chloro-N-[({4-[4-(2-thienylcarbonyl)-1-piperazinyl]phenyl}amino)carbono-
thioyl]-1-benzothiophene-2-carboxamide (TPB).
14. A method of treating an adult mammal having Guillain-Barre
syndrome said method comprising: administering to said mammal a
composition comprising a non-nucleoside RNA polymerase inhibitor,
wherein said mammal has a ZIKV infection.
15. The method of claim 14, wherein said mammal is a human.
16. The method of claim 14, wherein said non-nucleoside RNA
polymerase inhibitor is
3-chloro-N-[({4-[4-(2-thienylcarbonyl)-1-piperazinyl]phenyl}amino)carbono-
thioyl]-1-benzothiophene-2-carboxamide (TPB).
17. A composition for reducing Zika virus (ZIKV) viremia within a
mammal, said composition comprising a non-nucleoside RNA polymerase
inhibitor.
18. The composition of claim 17, wherein said non-nucleoside RNA
polymerase inhibitor is
3-chloro-N-[({4-[4-(2-thienylcarbonyl)-1-piperazinyl]phenyl}amino)carbono-
thioyl]-1-benzothiophene-2-carboxamide (TPB).
19. The composition of claim 17, wherein said non-nucleoside RNA
polymerase inhibitor can bind to a catalytic active site of an an
RNA-dependent RNA-polymerase (RdRp) of said ZIKV.
20. The method of claim 17, wherein said non-nucleoside RNA
polymerase inhibitor has an inhibitory concentration 50 (IC.sub.50)
of from about 10 nM to about 200 nM.
21. The method of claim 17, wherein said non-nucleoside RNA
polymerase inhibitor has a cytotoxicity concentration 50
(CC.sub.50) of from about 15 .mu.M to about 25 .mu.M.
22. The method of claim 17, wherein said non-nucleoside RNA
polymerase inhibitor has a selective index 50 (SI.sub.50) of about
206.
23. The composition of claim 17, further comprising a
pharmaceutically acceptable carrier.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Patent
Application Ser. No. 62/579,495, filed on Oct. 31, 2017. The
disclosure of the prior application is considered part of (and is
incorporated by reference in) the disclosure of this
application.
BACKGROUND
1. Technical Field
[0002] This document relates to methods and materials for treating
a mammal having a Zika virus (ZIKV) infection. For example, one or
more non-nucleoside RNA polymerase inhibitors can be administered
to a mammal having, or at risk of developing, a ZIKV infection to
treat the mammal.
2. Background Information
[0003] ZIKV, a mosquito-borne pathogen, was originally isolated in
Uganda in 1947 (Dick et al., 1952 Trans. Roy. Soc. Trop. Med. Hyg.
46:509-520) and only sporadic cases of virus outbreaks in humans
were reported in Africa and Asia in the next six decades (Mecharles
et al., 2016 Lancet 387:1481; Munoz et al., 2016 Semin. Reprod.
Med. 34:273-279). However, in the past ten years, it has rapidly
emerged and spread to the regions of Asia, Europe, and the Americas
(Aliota et al., 2017 Antivir. Res. 144:223-246; Chan et al., 2016
J. Infect. 72:507-524; Deseda, 2017 Curr. Opin. Pediatr. 29:97-101;
Weaver et al., 2016 Antivir. Res. 130:69-80). Although the majority
of infections in humans are asymptomatic, recent ZIKV infections
have been linked to a variety of congenital disorders including
microcephaly and fetal growth restriction (Carteaux et al., 2016 N.
Engl. J. Med. 374:1595-1596; Cauchemez et al., 2016 Lancet
387:2125-2132; Chan et al., 2016 J. Infect. 72:507-524; Coyne and
Lazear, 2016 Nat. Rev. Microbiol. 14:707-715; Cugola et al., 2016
Nature 534:267-271; Lazear and Diamond, 2016 J. Virol.
90:4864-4875; Miner and Diamond, 2017 Cell Host Microbe 21:134-142;
and Mlakar et al., 2016 N. Engl. J. Med. 374:951-958) as well as
Guillain-Barre syndrome in adults (Avelino-Silva and Martin, 2016
Lancet 387:2599; Nascimento et al., 2017 Neurology 88:2330-2332;
and Parra et al., 2016 N. Engl. J. Med. 375:1513-1523). These
severe consequences and the large-scale spreading of the virus have
imposed a significant threat to human health worldwide (Fauci and
Morens, 2016 N. Engl. J. Med. 374:601-604; Gulland, 2016 BMJ
352:i657; Roos, 2016 J. Neurol. 73:1395-1396). So far, no vaccine
or drug for preventing or treating this viral disease is available
(Shan et al., 2016 Adv. Infect. Dis. 2:170-172). Therefore, it is
urgent to develop countermeasures against this viral epidemic
(Rather et al., 2017 Front. Microbiol. 8:305; Salam et al., 2017
Ann. Intern. Med. 166:725-732).
SUMMARY
[0004] ZIKV has become a major human health concern globally due to
its association with congenital abnormalities and neurological
diseases.
[0005] This document provides methods and materials for treating a
mammal having, or at risk of developing, ZIKV in its bloodstream
(e.g., ZIKV viremia). In some cases, ZIKV viremia can lead to a
ZIKV infection. For example, one or more non-nucleoside RNA
polymerase inhibitors (e.g.,
3-chloro-N-[({4-[4-(2-thienylcarbonyl)-1-piperazinyl]phenyl}amino)carbono-
thioyl]-1-benzothiophene-2-carboxamide (TPB)) can be administered
to a mammal having, or at risk of developing, ZIKV viremia to treat
the mammal. In some cases, one or more non-nucleoside RNA
polymerase inhibitors can inhibit ZIKV replication (e.g., within in
a cell in a mammal). In some cases, one or more non-nucleoside RNA
polymerase inhibitors can reduce ZIKV viremia in a mammal.
[0006] As demonstrated herein, TPB inhibited ZIKV replication at
sub-micromolar concentrations (e.g., the half-maximal inhibitory
concentration (IC.sub.50) and the cytotoxicity concentration
(CC.sub.50) of TPB in Vero cells were 94 nM and 19.4 .mu.M,
respectively, yielding a high selective index 50 (SI.sub.50) of
206). Without being bound by theory, molecular docking analysis
suggested that TPB binds to the catalytic active site of the ZIKV
RNA-dependent RNA-polymerase (RdRp) and therefore likely blocks the
viral RNA synthesis by an allosteric effect. Also as demonstrated
herein, TPB reduced ZIKV viremia significantly in immunocompetent
mice. The ability to inhibit ZIKV replication can reduce ZIKV
viremia providing a unique and unrealized opportunity to treat
and/or prevent ZIKV infections. For example, TPB can be used to
treat and/or prevent ZIKV infections.
[0007] In general, one aspect of this document features methods for
treating mammals having a ZIKV infection. The methods can include,
or consist essentially of, administering to a composition including
a non-nucleoside RNA polymerase inhibitor to a mammal having a ZIKV
infection to treat the mammal. The mammal can be a human. The
non-nucleoside RNA polymerase inhibitor can bind to a catalytic
active site of an RdRp of a ZIKV to inhibit ZIKV replication. The
non-nucleoside RNA polymerase inhibitor can be TPB. The
non-nucleoside RNA polymerase inhibitor can have an IC.sub.50 of
from about 10 nM to about 200 nM. The non-nucleoside RNA polymerase
inhibitor can have a CC.sub.50 of from about 15 .mu.M to about 25
.mu.M. The non-nucleoside RNA polymerase inhibitor can have a
SI.sub.50 of about 206. The administering step can be performed
prior to the mammal being infected with the ZIKV or after the
mammal being infected with the ZIKV. The administering step can be
performed prior to the mammal being infected with the ZIKV and
after the mammal being infected with the ZIKV. The non-nucleoside
RNA polymerase inhibitor can be administered intraperitoneally,
intravenously, intramuscularly, or subcutaneously.
[0008] In another aspect, this document features methods for method
of preventing microcephaly in a fetus. The methods can include, or
consist essentially of, administering a composition including a
non-nucleoside RNA polymerase inhibitor to a mammal pregnant with a
fetus, where the pregnant mammal has a ZIKV infection. The mammal
can be a human. The non-nucleoside RNA polymerase inhibitor can
bind to a catalytic active site of an RdRp of a ZIKV to inhibit
ZIKV replication. The non-nucleoside RNA polymerase inhibitor can
be TPB. The non-nucleoside RNA polymerase inhibitor can have an
IC.sub.50 of from about 10 nM to about 200 nM. The non-nucleoside
RNA polymerase inhibitor can have a CC.sub.50 of from about 15
.mu.M to about 25 .mu.M. The non-nucleoside RNA polymerase
inhibitor can have a SI.sub.50 of about 206. The non-nucleoside RNA
polymerase inhibitor can be administered intraperitoneally,
intravenously, intramuscularly, or subcutaneously.
[0009] In another aspect, this document features methods for
treating adult mammals having Guillain-Barre syndrome. The methods
can include, or consist essentially of, administering a composition
including a non-nucleoside RNA polymerase inhibitor to a mammal
having a ZIKV infection and having Guillain-Barre syndrome to treat
the mammal. The mammal can be a human. The non-nucleoside RNA
polymerase inhibitor can bind to a catalytic active site of an RdRp
of a ZIKV to inhibit ZIKV replication. The non-nucleoside RNA
polymerase inhibitor can be TPB. The non-nucleoside RNA polymerase
inhibitor can have an IC.sub.50 of from about 10 nM to about 200
nM. The non-nucleoside RNA polymerase inhibitor can have a
CC.sub.50 of from about 15 .mu.M to about 25 .mu.M. The
non-nucleoside RNA polymerase inhibitor can have a SI.sub.50 of
about 206. The non-nucleoside RNA polymerase inhibitor can be
administered intraperitoneally, intravenously, intramuscularly, or
subcutaneously.
[0010] In another aspect, this document features compositions for
reducing ZIKV viremia within a mammal. The compositions include a
non-nucleoside RNA polymerase inhibitor. The non-nucleoside RNA
polymerase inhibitor can be TPB. The non-nucleoside RNA polymerase
inhibitor can bind to a catalytic active site of an an RdRp of a
ZIKV. The non-nucleoside RNA polymerase inhibitor can have an
IC.sub.50 of from about 10 nM to about 200 nM. The non-nucleoside
RNA polymerase inhibitor can have a CC.sub.50 of from about 15
.mu.M to about 25 .mu.M. The non-nucleoside RNA polymerase
inhibitor can have a SI.sub.50 of about 206. The composition also
can include a pharmaceutically acceptable carrier.
[0011] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention pertains.
Although methods and materials similar or equivalent to those
described herein can be used to practice the invention, suitable
methods and materials are described below. All publications, patent
applications, patents, and other references mentioned herein are
incorporated by reference in their entirety. In case of conflict,
the present specification, including definitions, will control. In
addition, the materials, methods, and examples are illustrative
only and not intended to be limiting.
[0012] The details of one or more embodiments of the invention are
set forth in the accompanying drawings and the description below.
Other features, objects, and advantages of the invention will be
apparent from the description and drawings, and from the
claims.
DESCRIPTION OF THE DRAWINGS
[0013] FIG. 1 shows a structure-based screening of inhibitors of
ZIKV targeting the viral RNA-dependent RNA-polymerase (RdRp). (A)
Structure of ZIKV RdRp generated by homology modeling. The three
subdomains are colored individually, Fingers (cyan), Thumb (blue)
and Palm (red). The catalytic active site and the priming loop are
labeled. Docking of TPB on the active site of RdRp and the contacts
with the two aspartic residues (D535 and D665) along with the three
hydrogen bonds are indicated. (B) The chemical structure of TPB
(molecular weight of 541.108). (C) A larger view of the boxed area
in A is shown for clarity. (D) The space-filing model of the boxed
area in A is shown along with the bound TPB. TPB binding at the
palm subdomain is shown.
[0014] FIG. 2 shows inhibition of ZIKV replication by the top 10
lead compounds. (A) Viral genome copies in the supernatants of
cells infected with PRVABC59 virus in the presence of 1 .mu.M
concentration of the ten compounds (c1-c10) or with vehicle (DMSO)
alone for 72 hours. The data are expressed as % of DMSO-treated
control. The experiment was done in triplicate and bars represent
.+-.SEM. (B) Infectious virus titers in the supernatant of cells
infected with the virus and incubated with 1 .mu.M concentration of
the compounds or with vehicle (DMSO) alone for 96 hours.
[0015] FIG. 3 shows validation of the antiviral effect of TPB in
the .mu.M range. (A) Cells infected with PRVABC59 virus were
incubated in the presence of various concentrations of TPB for 96
hours. Culture supernatants were titrated for viral genome copies
(A) and infectious virus (B). Data are from three independent
experiments with error bars showing .+-.SEM. Statistical analysis
was performed using unpaired two-tailed Student's t-test to
determine significance of difference. ****, p.ltoreq.0.001. (C)
Western blot analysis of E protein expression in virus-infected
cells in the presence of various concentrations of TPB. Relative
mobility of molecular mass markers are shown on the left.
[0016] FIG. 4 shows TPB inhibition of ZIKV is strain and cell-type
independent. (A) Inhibition of MR766 virus by TPB. The experiments
were conducted as in FIG. 3B and data from three independent
experiments are presented with error bars representing SEM.
PRVABC59 virus growth in HTR-8 (B) and NTERRA (C) cell lines in the
presence of TPB. Data from three independent experiments are
presented with error bars showing .+-.SEM. Statistical analysis was
performed using unpaired two-tailed Student's t-test to determine
significance of difference. ****, p.ltoreq.0.001.
[0017] FIG. 5 shows IC.sub.50 and CC.sub.50 of TBP. (A) Vero cells
in triplicate were infected with PRVABC59 virus and incubated with
various concentrations of TPB as shown. Infectious virus titers in
the supernatants of the cells at 96 hours post-infection were
determined by plaque assay and virus yield was expressed as % of
TPB-untreated control. Non-linear regression analysis was employed
to determine the IC.sub.50. (B) Vero cells in triplicate were
treated with TPB at various concentrations for four days and cell
viability was measured based on ATP assay. The luminescence signals
were measured at 420 nm using a Microplate Luminometer. Non-linear
regression analysis of the data was employed to determine the
CC.sub.50.
[0018] FIG. 6 shows a comparison of TPB inhibitory activity with
mycophenolic acid (MPA) and Ivermectin (IVM). Vero cells were
infected with PRVABC59 virus and incubated with TPB (1 .mu.M), MPA
(1 .mu.M) and IVM (10 .mu.M). Culture supernatants were collected
at 96 hours post-infection and assayed for infectious virus. Data
presented are from three independent experiments with error bars
showing .+-.SEM. Statistical analysis was performed using unpaired
two-tailed Student's t-test to determine significance of
difference. ***p.ltoreq.0.01; ****p.ltoreq.0.001.
[0019] FIG. 7 shows inhibitory efficacy of TPB in mice. (A)
Pharmacokinetics (PK) analysis of TPB in mice using two different
doses as shown. (B) Genome copies at various days post-infection in
the plasma of individual mice treated without (continuous lines) or
with (discontinuous lines) TPB. (C) Data from the mice groups in
panel B. Error bars show .+-.SEM. Statistical analysis was
performed using unpaired two-tailed Student's t-test to determine
significance of difference. ****, p.ltoreq.0.001. (D) TPB mean
concentrations in mice plasma at various days post-infection. Error
bars show .+-.SEM.
[0020] FIG. 8 shows model of superimposed structures of ZIKV RdRp.
Cyan, RdRp structure derived from homology modeling; yellow,
crystal structure of RdRp (PDB: 5WZ3). Various domains are
identified.
[0021] FIG. 9 shows models of an alignment of compounds within the
target site of the ZIKV RdRp (A) and an enlarged view of the
positioning of the compounds (B) in the target site of the
RdRp.
[0022] FIG. 10 contains exemplary non-nucleoside RNA polymerase
inhibitors.
DETAILED DESCRIPTION
[0023] This document provides methods and materials for treating a
mammal having, or at risk of developing ZIKV viremia (e.g., a ZIKV
infection). In some cases, this document provides compositions
(e.g., pharmaceutical compositions such as vaccines) including one
or more non-nucleoside RNA polymerase inhibitors (e.g., TPB). In
some cases, this document provides methods for using one or more
non-nucleoside RNA polymerase inhibitors provided herein to treat a
mammal having, or at risk of having, a ZIKV infection. For example,
one or more non-nucleoside RNA polymerase inhibitors can be
administered to a mammal (e.g., a human) having, or at risk of
developing, a ZIKV infection to treat the mammal. In some cases,
one or more non-nucleoside RNA polymerase inhibitors can inhibit
ZIKV replication (e.g., within in a cell in a mammal). In some
cases, one or more non-nucleoside RNA polymerase inhibitors can
reduce ZIKV viremia in a mammal. One or more non-nucleoside RNA
polymerase inhibitors can be administered to a mammal to protect
the mammal from a ZIKV infection (e.g., prior to exposure to a
ZIKV) and/or to treat the mammal (e.g., after exposure to a
ZIKV).
[0024] Any appropriate mammal (e.g., a mammal having, or at risk of
developing, ZIKV viremia) can be treated as described herein. In
some cases, a mammal can have, or can be at risk of developing, a
ZIKV infection. In some cases, a mammal can carry ZIKV without
developing ZIKV infection. Examples of mammals that can be treated
as described herein (e.g., by administering one or more
non-nucleoside RNA polymerase inhibitors such as TPB to the mammal)
include, without limitation, humans, non-human primates (e.g.,
monkeys), dogs, cats, horses, cows, pigs, sheep, mice, rats,
horses, cows, carabaos (water buffaloes), goats, ducks, and bats.
For example, a human having, or at risk of developing, ZIKV viremia
can be treated by administering one or more non-nucleoside RNA
polymerase inhibitors (e.g., TPB) to that human. In some cases, a
mammal can be a pregnant mammal (e.g., pregnant human). When a
mammal is a pregnant human, the pregnant human can be in any stage
of pregnancy (e.g., first trimester, second trimester, or third
trimester).
[0025] When treating a mammal (e.g., a human) having, or at risk of
developing, ZIKV viremia (e.g., a ZIKV infection) as described
herein (e.g., by administering one or more non-nucleoside RNA
polymerase inhibitors such as TPB to the mammal), the mammal can be
any appropriate age. In some cases, a mammal can be an adult. For
example, when a mammal is a human, an adult human can be about 18
years of age or older (e.g., about 20 years of age, about 30 years
of age, about 40 years of age, about 50 years of age, about 60
years of age, about 65 years of age, about 70 years of age, or
about 75 years of age or older). For example, when a mammal is a
human, an adult human can be from about 18 years of age to about 80
years of age (e.g., from about 18 years of age to about 60 years of
age, from about 18 years of age to about 40 years of age, from
about 25 years of age to about 80 years of age, from about 40 years
of age to about 80 years of age, from about 60 years of age to
about 80 years of age, from about 20 years of age to about 60 years
of age, or from about 30 years of age to about 50 years of age). In
some cases, a mammal can be a juvenile. For example, when a mammal
is a human, a juvenile human can be no more than about 18 years
old. For example, a human adolescents can be from about 1 year of
age to about 18 years of age (e.g., from about 1 year of age to
about 15 years of age, from about 1 year of age to about 10 years
of age, from about 1 year of age to about 5 years of age, from
about 5 years of age to about 18 years of age, from about 10 years
of age to about 18 years of age, or from about 5 years of age to
about 15 years of age). In some cases, a mammal can be a newborn.
For example, when a mammal is a human, a newborn human from about
birth to about 1 year of age. In some cases, a mammal can be a
fetus. For example, when a mammal is a human, a fetus can be in
utero (e.g., being carried by a human pregnant with the fetus).
[0026] When treating a mammal (e.g., a human) having, or at risk of
developing, ZIKV viremia (e.g., a ZIKV infection) as described
herein (e.g., by administering one or more non-nucleoside RNA
polymerase inhibitors such as TPB to the mammal), the ZIKV can be
any type of ZIKV. A ZIKV can be from any lineage of ZIKV. A ZIKV
can be from any clade of ZIKV. A ZIKV can be any strain of ZIKV. In
some cases, a ZIKV can be a latent ZIKV. In some cases, a ZIKV can
be an infectious ZIKV. Examples of ZIKVs include, without
limitation, East African ZIKV, West African ZIKV, Asian ZIKV, and
South American ZIKV.
[0027] In some cases, methods described herein can include
identifying a mammal (e.g., a human) as having a ZIKV infection.
Any appropriate method can be used to identify a mammal having a
ZIKV infection. For example, the presence of a ZIKV in a sample
obtained from a mammal can be detected in a sample obtained from a
mammal, where the presence of a ZIKV can indicate that the mammal
has a ZIKV infection. In some cases, the presence of a ZIKV genome,
or a portion thereof, in a sample obtained from a mammal can be
used to identify that mammal (e.g., a human) as having a ZIKV
infection. In some cases, the presence of one or more ZIKV
polypeptides in a sample obtained from a mammal can be used to
identify that mammal (e.g., a human) as having a ZIKV infection.
Any appropriate sample can be assessed to detect the presence of a
ZIKV genome, or a portion thereof, and/or the presence of one or
more ZIKV polypeptides. For example, biological samples such as
fluid samples (e.g., blood (e.g., whole blood, plasma, and serum),
urine, breast milk, saliva, amniotic fluid, cerebral spinal fluid,
or semen) or tissue samples (e.g., placenta tissue samples) can be
obtained from a mammal and assessed for the presence the presence
of a ZIKV genome, or a portion thereof, and/or the presence of one
or more ZIKV polypeptides. Any appropriate method can be used to
detect the presence the presence of a ZIKV genome, or a portion
thereof. For example, polymerase chain reaction (PCR) techniques),
sequencing techniques, and/or Southern blotting can be used to
detect the presence of a ZIKV genome, or a portion thereof, in a
sample obtained from a mammal. Any appropriate method can be used
to detect the presence the presence of one or more ZIKV
polypeptides. For example, western blotting techniques,
enzyme-linked immunosorbent assays (ELISAs), and/or real-time PCR
can be used to detect the presence of one or more ZIKV polypeptides
in a sample obtained from a mammal.
[0028] In some cases, methods described herein can include
identifying a mammal (e.g., a human) as being at risk of developing
ZIKV viremia (e.g., a ZIKV infection). For example, a mammal
undergoing, or scheduled to undergo, exposure to one or more
mammals having ZIKV viremia can be at risk of developing ZIKV
viremia. In some cases, a mammal having physical contact (e.g.,
sexual contact) with one or more mammals having ZIKV viremia can be
at risk of developing ZIKV viremia (e.g., a ZIKV infection). In
some cases, a mammal living in or moving to an area where one or
more mammals having ZIKV viremia are present can be at risk of
developing ZIKV viremia (e.g., a ZIKV infection). In some cases, a
mammal scheduled to travel to an area where one or more mammals
having ZIKV viremia are present can be at risk of developing ZIKV
viremia (e.g., a ZIKV infection). In some cases, a mammal that has
been bitten, or is at risk of being bitten by an animal that
carries a ZIKV virus (e.g., a mosquito) can be at risk of
developing ZIKV viremia (e.g., a ZIKV infection). In some cases, a
fetus within a pregnant mammal with ZIKV viremia can be at risk of
developing ZIKV viremia (e.g., a ZIKV infection).
[0029] A mammal (e.g., a human) identified as having, or as being
at risk of developing, ZIKV viremia (e.g., a ZIKV infection), can
be administered, or instructed to self-administer, one or more
non-nucleoside RNA polymerase inhibitors. For example, one or more
non-nucleoside RNA polymerase inhibitors can be administered to a
mammal in need thereof (e.g., a mammal having, or at risk of
developing, ZIKV viremia). A non-nucleoside RNA polymerase
inhibitor can be any appropriate non-nucleoside RNA polymerase
inhibitor. A non-nucleoside RNA polymerase inhibitor can be a
chemically synthesized non-nucleoside RNA polymerase inhibitor. A
non-nucleoside RNA polymerase inhibitor can be a commercially
obtained non-nucleoside RNA polymerase inhibitor. Examples of
non-nucleoside RNA polymerase inhibitors that can be used as
described herein (e.g., to treat a mammal having, or at risk of
developing, ZIKV viremia) include, without limitation,
non-nucleoside RNA polymerase inhibitors shown in FIG. 10 (e.g.,
TPB, C1, C2, C3, C4, C5, C6, C7, C8, C9, and C10). In some cases, a
non-nucleoside RNA polymerase inhibitor can be TPB. In cases where
a non-nucleoside RNA polymerase inhibitor is TPB, the TPB can be a
derivative of TPB. As used herein, a derivative of a non-nucleoside
RNA polymerase can be any structurally derived compound that
maintains the ability to inhibit a non-nucleoside RNA polymerase.
For example, a mammal having, or at risk of developing, ZIKV
viremia can be administered or can self-administer TPB.
[0030] A non-nucleoside RNA polymerase inhibitor (e.g., TPB) can
inhibit ZIKV replication. In some cases, a non-nucleoside RNA
polymerase inhibitor can inhibit transcription of a ZIKV coding
sequence (e.g., coding sequence encoding a ZIKV polymerase such as
the RdRp polymerase gene). In some cases, a non-nucleoside RNA
polymerase inhibitor can inhibit function of a ZIKV polypeptide
(e.g., a ZIKV polymerase such as the RdRp polymerase). For example,
when a non-nucleoside RNA polymerase inhibitor is TPB, the TPB can
inhibit function of the RdRp polymerase. In some cases, TPB can
target (e.g., bind to) a catalytic active site of the RdRp
polymerase to inhibit ZIKV replication.
[0031] A non-nucleoside RNA polymerase inhibitor can be a potent
inhibitor (e.g., a potent ZIKV inhibitor). For example, when a
non-nucleoside RNA polymerase inhibitor is TPB, the TPB can inhibit
a ZIKV (e.g., inhibit ZIKV replication) at sub-micromolar
concentrations. In some cases, the inhibitory concentration 50
(IC.sub.50) of TPB can from about 10 nM to about 200 nM (e.g., from
about 10 nM to about 175 nM, from about 10 nM to about 150 nM, from
about 10 nM to about 125 nM, from about 10 nM to about 100 nM, from
about 10 nM to about 75 nM, from about 10 nM to about 60 nM, from
about 10 nM to about 50 nM, from about 10 nM to about 40 nM, from
about 10 nM to about 30 nM, from about 10 nM to about 20 nM, from
about 25 nM to about 200 nM, from about 50 nM to about 200 nM, from
about 70 nM to about 200 nM, from about 90 nM to about 200 nM, from
about 100 nM to about 200 nM, from about 125 nM to about 200 nM,
from about 150 nM to about 200 nM, from about 175 nM to about 200
nM, from about 25 nM to about 175 nM, from about 50 nM to about 150
nM, from about 75 nM to about 125 nM, from about 50 nM to about 100
nM, from about 100 nM to about 150 nM, from about 30 nM to about 80
nM, from about 50 nM to about 70 nM, or from about 85 nM to about
95 nM). For example, the IC.sub.50 of TPB can be about 94 nM.
[0032] A non-nucleoside RNA polymerase inhibitor can have low
toxicity (e.g., cellular toxicity or cytotoxicity). For example,
when a non-nucleoside RNA polymerase inhibitor is TPB, the TPB can
have sub-micromolar cytotoxicity concentrations. In some cases, the
cellular cytotoxicity concentration 50 (CC.sub.50) of TPB can be
from about 15 .mu.M to about 25 .mu.M. For example, the CC.sub.50
of TPB can be about 19.4 .mu.M.
[0033] A non-nucleoside RNA polymerase inhibitor can have high
selectivity (e.g., can be selective for a ZIKV). A selective index
50 (SI.sub.50) can be determined using the formula
CC.sub.50/IC.sub.50. For example, when a non-nucleoside RNA
polymerase inhibitor is TPB, the TPB can have a high SI.sub.50. In
some cases, the SI.sub.50 of TPB can be from about 150 to about
250. For example, the SI.sub.50 of TPB can be about 206.
[0034] When treating a mammal having, or at risk of developing,
ZIKV viremia (e.g., a ZIKV infection), one or more non-nucleoside
RNA polymerase inhibitors (e.g., TPB) can be administered to the
mammal at any appropriate time. For example, when a mammal has ZIKV
viremia, one or more non-nucleoside RNA polymerase inhibitors can
be administered before, during (e.g., concurrent with), and/or
after one or more symptoms of a ZIKV infection are producing or
showing (e.g., after a ZIKV infection has developed). In some
cases, when a mammal has ZIKV viremia, one or more non-nucleoside
RNA polymerase inhibitors can be administered before one or more
symptoms of a ZIKV infection producing or showing no symptoms
(e.g., when the mammal is asymptomatic and/or prior to a ZIKV
infection developing). For example, when a mammal at risk of
developing ZIKV viremia (e.g., a ZIKV infection) is undergoing, or
scheduled to undergo, exposure to one or more mammals having ZIKV
viremia (e.g., a ZIKV infection), one or more non-nucleoside RNA
polymerase inhibitors can be administered before, during (e.g.,
concurrent with), and/or after the exposure.
[0035] One or more non-nucleoside RNA polymerase inhibitors (e.g.,
TPB) can be administered to a mammal in need thereof (e.g., a
mammal having, or at risk of developing, ZIKV viremia) by any
appropriate route. Administration can be local or systemic.
Examples of routes of administration include, without limitation,
intraperitoneal, intravenous, intramuscular, subcutaneous, oral,
intranasal, inhalation, transdermal, and parenteral administration.
For example, one or more non-nucleoside RNA polymerase inhibitors
can be administered intraperitoneally to a mammal (e.g., a
human).
[0036] When treating a mammal having, or at risk of developing,
ZIKV viremia (e.g., a ZIKV infection), the treatment can include
the administration of a therapeutically effective amount of one or
more non-nucleoside RNA inhibitors. The terms "effective amount"
and "therapeutically effective amount" refer to that amount of one
or more non-nucleoside RNA inhibitors sufficient to result in a
therapeutic effect. For example, a therapeutic effect of treating a
mammal having, or at risk of developing, ZIKV viremia can include,
without limitation, inhibition of ZIKV replication, reduction or
elimination of ZIKV viremia, and/or amelioration (e.g., reduction
or elimination) of one or more symptoms of a ZIKV infection.
[0037] In some cases, treating a mammal having, or at risk of
developing, ZIKV viremia (e.g., a ZIKV infection) as described
herein (e.g., by administering one or more non-nucleoside RNA
polymerase inhibitors such as TPB to the mammal) can be effective
to inhibit ZIKV replication. For example, administering one or more
non-nucleoside RNA polymerase inhibitors to a mammal can be
effective to inhibit ZIKV replication within in one or more cells
in that mammal. Any appropriate method can be used to determine
whether or not ZIKV replication has been inhibited. For example,
quantitative RT-PCR (RT-qPCR) and/or ELISAs can be used to
determine whether or not ZIKV replication has been inhibited.
[0038] In some cases, treating a mammal having, or at risk of
developing, ZIKV viremia (e.g., a ZIKV infection) as described
herein (e.g., by administering one or more non-nucleoside RNA
polymerase inhibitors such as TPB to the mammal) can be effective
to reduce or eliminate ZIKV viremia. For example, administering one
or more non-nucleoside RNA polymerase inhibitors to a mammal can be
effective to reduce ZIKV viremia within that mammal.
[0039] In some cases, administering one or more non-nucleoside RNA
polymerase inhibitors to a mammal having ZIKV viremia can be
effective to reduce ZIKV viremia by from about 40-fold to about
1000-fold (e.g., from about 50-fold to about 1000-fold, from about
80-fold to about 1000-fold, from about 100-fold to about 1000-fold,
from about 300-fold to about 1000-fold, from about 500-fold to
about 1000-fold, from about 700-fold to about 1000-fold, from about
800-fold to about 1000-fold, from about 900-fold to about
1000-fold, from about 40-fold to about 900-fold, from about 40-fold
to about 700-fold, from about 40-fold to about 500-fold, from about
40-fold to about 200-fold, from about 40-fold to about 100-fold,
from about 50-fold to about 900-fold, from about 200-fold to about
800-fold, from about 500-fold to about 700-fold, from about
100-fold to about 400-fold, from about 300-fold to about 600-fold,
from about 400-fold to about 700-fold, from about 500-fold to about
800-fold, or from about 600-fold to about 900-fold) within that
mammal. In some cases, administering one or more non-nucleoside RNA
polymerase inhibitors to a mammal having ZIKV viremia can be
effective to reduce a ZIKV genome copy number within a mammal. In
some cases, administering one or more non-nucleoside RNA polymerase
inhibitors to a mammal having ZIKV viremia can be effective to
reduce PFU of ZIKV virus within a mammal.
[0040] Any appropriate method can be used to determine the
presence, absence, or amount of ZIKV in a mammal. For example,
RT-qPCR can be used to determine the presence, absence, or amount
of ZIKV in a mammal.
[0041] In some cases, treating a mammal having, or at risk of
developing, ZIKV viremia (e.g., a ZIKV infection) as described
herein (e.g., by administering one or more non-nucleoside RNA
polymerase inhibitors such as TPB to the mammal) can be effective
to reduce the severity of the ZIKV infection and/or to reduce or
eliminate one or more symptoms of the ZIKV infection. In some
cases, when a mammal is a pregnant mammal (e.g., a pregnant human),
one or more symptoms can affect the mammal's fetus (e.g., in utero)
and/or can affect the mammal's child (e.g., after birth such as a
newborn child). Examples of symptoms of a ZIKV infection can
include, without limitation, fever, rash (e.g., maculopapular
rash), muscle pain, joint pain, conjunctivitis, vomiting, headache,
and congenital Zika syndrome (e.g., including, but not limited to,
microcephaly, decreased brain tissue, damage to the back of the eye
such as scarring and/or pigment changes, joints with limited range
of motion such as clubfoot, and/or too much muscle tone restricting
body movement soon after birth). In some cases, a symptom of ZIKV
infection can be as described elsewhere (see, e.g.,
www.cdc.gov/zika/symptoms/index.html). For example, treating a
pregnant mammal (e.g., a pregnant human), having, or at risk of
developing, ZIKV viremia (e.g., a ZIKV infection) as described
herein (e.g., by administering one or more non-nucleoside RNA
polymerase inhibitors such as TPB to the mammal) can be effective
to reduce or eliminate microcephaly in the mammal's fetus and/or
the mammal's child (e.g., after birth).
[0042] In some cases, one or more non-nucleoside RNA polymerase
inhibitors (e.g., TPB) can be administered to a mammal having, or
at risk of developing, ZIKV viremia (e.g., a ZIKV infection) in the
absence of any carriers (e.g., additives, fillers, vehicles, and/or
diluents).
[0043] In some cases, one or more non-nucleoside RNA polymerase
inhibitors (e.g., TPB) can be formulated into a composition (e.g.,
a pharmaceutically acceptable composition) for administration to a
mammal having, or at risk of developing, ZIKV viremia (e.g., a ZIKV
infection). For example, one or more non-nucleoside RNA polymerase
inhibitors can be formulated together with one or more
pharmaceutically acceptable carriers (e.g., additives, fillers,
vehicles, and/or diluents). In some cases, pharmaceutically
acceptable carrier can be non-naturally occurring. Pharmaceutically
acceptable carriers that can be used in a pharmaceutical
composition described herein include, without limitation, dextrose,
methanol, dimethyl sulfoxide (DMSO), ion exchangers, alumina,
aluminum stearate, lecithin, serum proteins, such as human serum
albumin, buffer substances such as phosphates, glycine, sorbic
acid, potassium sorbate, partial glyceride mixtures of saturated
vegetable fatty acids, water, salts or electrolytes, such as
protamine sulfate, disodium hydrogen phosphate, potassium hydrogen
phosphate, sodium chloride, zinc salts, colloidal silica, magnesium
trisilicate, polyvinyl pyrrolidone, cellulose-based substances,
polyethylene glycol, sodium carboxymethylcellulose, polyacrylates,
waxes, polyethylene-polyoxypropylene-block polymers, and wool
fat.
[0044] In some cases, a composition including one or more
non-nucleoside RNA polymerase inhibitors (e.g., TPB) to be
administered to a mammal (e.g., a human) in need thereof (e.g., a
mammal having, or at risk of developing, ZIKV viremia) can include
one or more non-nucleoside RNA polymerase inhibitors as the sole
active ingredient. For example, TPB can be administered to a mammal
having, or at risk of developing, ZIKV viremia (e.g., a ZIKV
infection) as the sole active ingredient used to treat the
mammal.
[0045] In some cases, a composition including one or more
non-nucleoside RNA polymerase inhibitors (e.g., TPB) to be
administered to a mammal (e.g., a human) in need thereof (e.g., a
mammal having, or at risk of developing, ZIKV viremia) can include
one or more non-nucleoside RNA polymerase inhibitors together with
one or more additional active ingredients (e.g., active ingredients
that can be used to treat a mammal having, or at risk of
developing, ZIKV viremia). Examples of additional active
ingredients that can be used to treat a mammal having, or at risk
of developing, ZIKV viremia (e.g., a ZIKV infection) that can be
used to treat a ZIKV infection include, without limitation,
anti-histamines (e.g., chlorphenamine), corticosteroids (e.g.,
hydrocortisone), fever reducers (e.g., acetaminophen),
immunosuppressants (e.g., mycophenolic acid), and anti-parasitics
(e.g., ivermectin).
[0046] A composition including one or more non-nucleoside RNA
polymerase inhibitors (e.g., TPB) can be designed for any route of
administration. For example, a composition including one or more
non-nucleoside RNA polymerase inhibitors can be designed for
parenteral (e.g., intraperitoneal) administration. Compositions
suitable for parenteral administration include, without limitation,
aqueous and non-aqueous sterile injection solutions that can
contain anti-oxidants, buffers, bacteriostats, and solutes that
render the formulation isotonic with the blood of the intended
recipient. For example, a composition including one or more
non-nucleoside RNA polymerase inhibitors can be designed for oral
administration. Compositions suitable for oral administration
include, without limitation, liquids, tablets, capsules, pills,
powders, gels, and granules. In some cases, a composition including
one or more non-nucleoside RNA polymerase inhibitors can be
formulated for oral administration.
[0047] A composition including one or more non-nucleoside RNA
polymerase inhibitors (e.g., TPB) can be designed for any type of
release (e.g., release of the one or more non-nucleoside RNA
polymerase inhibitors from the composition) into the mammal the
composition is administered to (e.g., a mammal having, or at risk
of developing, ZIKV viremia). For example, a composition including
one or more non-nucleoside RNA polymerase inhibitors can be
designed for immediate release, slow release, or extended
release.
[0048] A composition including one or more non-nucleoside RNA
polymerase inhibitors (e.g., TPB) can be administered to a mammal
(e.g., a human) in need thereof (e.g., a mammal having, or at risk
of developing, ZIKV viremia) in any appropriate dose(s). Effective
doses can vary depending on the level of ZIKV viremia, the risk of
developing ZIKV infection, the route of administration, the age and
general health condition of the mammal, excipient usage, the
possibility of co-usage with other therapeutic treatments such as
use of other agents, and the judgment of the treating physician.
For example, in cases where a composition includes TPB, the
composition can include from about 5 mg TPB per kilogram (kg) body
weight of the mammal being treated to about 25 mg TPB per kg body
weight of the mammal being treated (e.g., from about 7 mg/kg to
about 25 mg/kg, from about 10 mg/kg to about 25 mg/kg, from about
12 mg/kg to about 25 mg/kg, from about 15 mg/kg to about 25 mg/kg,
from about 18 mg/kg to about 25 mg/kg, from about 20 mg/kg to about
25 mg/kg, from about 22 mg/kg to about 25 mg/kg, from about 5 mg/kg
to about 23 mg/kg, from about 5 mg/kg to about 20 mg/kg, from about
5 mg/kg to about 17 mg/kg, from about 5 mg/kg to about 15 mg/kg,
from about 5 mg/kg to about 12 mg/kg, from about 5 mg/kg to about
10 mg/kg, from about 5 mg/kg to about 8 mg/kg, from about 8 mg/kg
to about 22 mg/kg, from about 10 mg/kg to about 20 mg/kg, from
about 12 mg/kg to about 17 mg/kg, from about 10 mg/kg to about 15
mg/kg, or from about 15 mg/kg to about 20 mg/kg TPB). In some
cases, a composition including TPB can include about 25 mg/kg TPB.
For example, in cases where a composition includes TPB, the
composition can be effective to achieve from about 100 ng of TPB
per milliliter (mL) plasma in the mammal being treated to about
1000 ng of TPB per mL plasma in the mammal being treated (e.g., a
plasma concentration of from about 200 ng/mL to about 1000 ng/mL,
from about 250 ng/mL to about 1000 ng/mL, from about 275 ng/mL to
about 1000 ng/mL, from about 300 ng/mL to about 1000 ng/mL, from
about 350 ng/mL to about 1000 ng/mL, from about 400 ng/mL to about
1000 ng/mL, from about 450 ng/mL to about 1000 ng/mL, from about
500 ng/mL to about 1000 ng/mL, from about 550 ng/mL to about 1000
ng/mL, from about 600 ng/mL to about 1000 ng/mL, from about 650
ng/mL to about 1000 ng/mL, from about 700 ng/mL to about 1000
ng/mL, from about 750 ng/mL to about 1000 ng/mL, from about 800
ng/mL to about 1000 ng/mL, from about 850 ng/mL to about 1000
ng/mL, from about 900 ng/mL to about 1000 ng/mL, from about 100
ng/mL to about 900 ng/mL, from about 100 ng/mL to about 800 ng/mL,
from about 100 ng/mL to about 700 ng/mL, from about 100 ng/mL to
about 600 ng/mL, from about 100 ng/mL to about 500 ng/mL, from
about 100 ng/mL to about 400 ng/mL, from about 100 ng/mL to about
300 ng/mL, from about 200 ng/mL to about 900 ng/mL, from about 300
ng/mL to about 800 ng/mL, from about 400 ng/mL to about 700 ng/mL,
from about 500 ng/mL to about 600 ng/mL, from about 200 ng/mL to
about 400 ng/mL, from about 400 ng/mL to about 600 ng/mL, or from
about 600 ng/mL to about 800 ng/mL TPB). In some cases, a
composition including TPB can achieve a plasma concentration of
greater than 500 ng/mL TPB (e.g., a plasma concentration of about
550 ng/mL, about 600 ng/mL, about 650 ng/mL, about 700 ng/mL, about
750 ng/mL, about 800 ng/mL, about 850 ng/mL, about 900 ng/mL, or
about 950 ng/mL TPB). An effective amount of a composition
including one or more non-nucleoside RNA polymerase inhibitors can
be any amount that reduces the severity and/or reduces or
eliminates one or more symptom of a ZIKV infection without
producing significant toxicity to the mammal. The effective amount
can remain constant or can be adjusted as a sliding scale or
variable dose depending on the mammal's response to treatment.
Various factors can influence the actual effective amount used for
a particular application. For example, the frequency of
administration, duration of treatment, use of multiple treatment
agents, route of administration, level of ZIKV viremia, severity of
the ZIKV infection, and risk of developing a ZIKV infection may
require an increase or decrease in the actual effective amount
administered.
[0049] A composition including one or more non-nucleoside RNA
polymerase inhibitors (e.g., TPB) can be administered to a mammal
(e.g., a human) in need thereof (e.g., a mammal having, or at risk
of developing, ZIKV viremia) in any appropriate frequency. The
frequency of administration can be any frequency that reduces the
severity of the ZIKV infection and/or reduces or eliminates one or
more symptoms of the ZIKV infection without producing significant
toxicity to the mammal. For example, the frequency of
administration can be from about once a day to about ten times a
day, from about three times a day to about eight times a day, or
from about four times a day to about six times a day. The frequency
of administration can remain constant or can be variable during the
duration of treatment. As with the effective amount, various
factors can influence the actual frequency of administration used
for a particular application. For example, the effective amount,
duration of treatment, use of multiple treatment agents, route of
administration, level of ZIKV viremia, severity of the ZIKV
infection, and risk of developing a ZIKV infection may require an
increase or decrease in administration frequency.
[0050] A composition including one or more non-nucleoside RNA
polymerase inhibitors (e.g., TPB) can be administered to a mammal
(e.g., a human) in need thereof (e.g., a mammal having, or at risk
of developing, ZIKV viremia) for any appropriate duration. An
effective duration for administering a composition including one or
more biguanides can be any duration that reduces the severity of
the ZIKV infection and/or reduces or eliminates one or more
symptoms of the ZIKV infection without producing significant
toxicity to the mammal. For example, the effective duration can
vary from several days to several months or years to a lifetime. In
some cases, the effective duration for the treatment of mammal in
need thereof can range in duration from about 2 days to about a
week. Multiple factors can influence the actual effective duration
used for a particular treatment. For example, an effective duration
can vary with the frequency of administration, effective amount,
use of multiple treatment agents, route of administration, level of
ZIKV viremia, severity of the ZIKV infection, and risk of
developing a ZIKV infection.
[0051] In some cases, methods described herein also can include
administering to a mammal in need thereof (e.g., a mammal having,
or at risk of developing, ZIKV viremia) one or more additional
treatments used to treat a mammal having, or at risk or developing,
ZIKV viremia (e.g., a ZIKV infection). The one or more additional
treatments used to treat a ZIKV infection can include any
appropriate treatment. In some cases, a ZIKV infection treatment
can include getting plenty of rest. In some cases, a ZIKV infection
treatment can include drinking fluids (e.g., to prevent
dehydration). In some cases, a ZIKV infection treatment can include
not taking aspirin and/or other non-steroidal anti-inflammatory
drugs (NSAIDS). In some cases, a ZIKV infection treatment can
include administration of one or more pharmacotherapies such as
antibiotics (e.g., metronidazole and dexamethasone),
anti-histamines (e.g., chlorphenamine), corticosteroids (e.g.,
hydrocortisone), and/or fever reducers (e.g., acetaminophen). For
example, a mammal having, or at risk of developing, ZIKV viremia
(e.g., a ZIKV infection) can be administered one or more
non-nucleoside RNA polymerase inhibitors (e.g., TPB) and can be
administered one or more additional treatments used to treat a ZIKV
infection. In cases where a mammal having, or at risk of
developing, ZIKV viremia (e.g., a ZIKV infection) is treated with
one or more non-nucleoside RNA polymerase inhibitors and is treated
with one or more additional agents used to treat a ZIKV infection,
the additional treatment used to treat a ZIKV infection can be
administered at the same time or independently. For example, when
administered independently, the one or more non-nucleoside RNA
polymerase inhibitors can be administered first, and the one or
more additional treatment used to treat a ZIKV infection can be
administered second, or vice versa.
[0052] In certain instances, a course of treatment and the severity
of one or more symptoms related to the condition being treated
(e.g., a ZIKV infection) can be monitored. Any appropriate method
can be used to determine whether or not the severity of one or more
symptoms is reduced or eliminated. For example, the severity of a
ZIKV infection can be assessed using any appropriate methods and/or
techniques, and can be assessed at different time points. For
example, physical examinations can be used to determine the
severity of one or more symptoms of a ZIKV infection.
[0053] In some cases, one or more non-nucleoside RNA polymerase
inhibitors (e.g., TPB) can be used to treat a mammal having a
disease or disorder associated with a ZIKV infection. Examples of
diseases and disorders associated with a ZIKV infection include,
without limitation, Guillain-Barre syndrome.
[0054] In some cases, one or more non-nucleoside RNA polymerase
inhibitors (e.g., TPB) can be used to treat a mammal having, or at
risk of developing, one or more additional infections caused by a
member of the Flaviviridae family, which includes Dengue viruses,
West Nile viruses, yellow fever viruses, and Japanese encephalitis
viruses.
[0055] This document also provides kits that can be used for a
variety of applications including, without limitation, diagnosing a
mammal as having, or as being at risk of developing, ZIKV viremia
(e.g., a ZIKV infection); treating a mammal having, or at risk of
developing, ZIKV viremia (e.g., a ZIKV infection); and/or preparing
a composition (e.g., by combining reagents) for use in diagnosing
and/or treating a mammal having, or at risk of developing, ZIKV
viremia (e.g., a ZIKV infection). In some cases, a kit provided
herein can include one or more non-nucleoside RNA inhibitors (e.g.,
TPB) as described herein. For example, a kit can include a
composition (e.g., a pharmaceutically acceptable composition)
including one or more non-nucleoside RNA inhibitors. For example, a
kit can include one or more non-nucleoside RNA inhibitors and one
or more pharmaceutically acceptable carriers (e.g., additives,
fillers, vehicles, and/or diluents) for preparing and/or
administering a composition (e.g., a vaccine composition). In some
cases, a kit provided herein can include reagents that can be used
to detect ZIKV infections. For example a kit provided herein can be
designed as a diagnostic kit. For example, a kit provided herein
can be designed as a kit to monitor treatment of a mammal having,
or at risk of developing, ZIKV viremia (e.g., a ZIKV infection).
For example, a kit provided herein can be designed to include
reagents that can be used to detect the presence of a ZIKV genome,
or a portion thereof, and/or the presence of one or more ZIKV
polypeptides in samples (e.g., fluid samples such as blood and
urine) obtained from a mammal. In some cases, a kit provided herein
also can include packaging. In some cases, a kit provided herein
also can include, instructions for use. For example, instructions
for use can be provided as a separate component within the kit
and/or printed directly on any packaging (e.g., packaging for the
kit or packaging for a component within the kit).
[0056] The invention will be further described in the following
examples, which do not limit the scope of the invention described
in the claims.
EXAMPLES
Example 1: Discovery of a Non-Nucleoside RNA Polymerase Inhibitor
for Blocking Zika Virus Replication Through in Silico Screening
Materials and Methods
Compounds
[0057] Ten lead compounds (Table 1) were purchased from Hit2Lead
Company (ChemBridge Corporation, San Diego, Calif.). Each compound
was dissolved in dimethyl sulfoxide (DMSO) to prepare stock
solutions of 10 mM and 1 mM and was stored at -20.degree. C. The
compound 1 (c1) used in this research is
3-chloro-N-[({4-[4-(2-thienylcarbonyl)-1-piperazinyl]phenyl}amino)carbono-
thioyl]-1-benzothiophene-2-carboxamide (TPB). Based on 1H NMR and
LC-MS (ELSD, DAD 200-400 nm, MSD APCI positive) analyses by the
provider, the compound is .gtoreq.95% pure. Mycophenolic acid (MPA)
and Ivermectin (IVM) were purchased from Sigma (St. Louis, Mo.) and
resuspended in DMSO to prepare stock solutions. All the compounds
used have .gtoreq.95% purity.
TABLE-US-00001 TABLE 1 Docking scores of the top 10 compounds.
Compound Molecular Weight Score 1 541.108 -118.794 2 455.528
-118.36 3 525.572 -118.258 4 516.638 -118.097 5 476.480 -117.319 6
539.618 -116.087 7 484.618 -115.823 8 471.592 -115.789 9 471.574
-115.724 10 462.443 -114.333
Cells and Viruses
[0058] Vero (Cercopithecus aethiops, CCL-81), HTR-8/SVneo human
trophoblast (CRL-3271), and NTERA-2 human embryonal carcinoma
(CRL-1973) cells were obtained from ATCC. The cells were grown and
maintained in Dulbecco's modified Eagle's medium (DMEM) containing
10% heat-inactivated fetal bovine serum (FBS) and
penicillin/streptomycin (PS) in humidified chamber with 5% CO2 at
37.degree. C. Zika virus strain PRVABC59 and MR766 were obtained
from Barbara Johnson and Brandy Russell at the Centers for Disease
Control and Prevention, Fort Collins, Colo., USA. The viruses were
passaged once in Vero cells to prepare stocks and were stored at
-80.degree. C. in small aliquots. Titers of the stock viruses were
determined by plaque assay using Vero cells as described elsewhere
(see, e.g., Annamalai et al., 2017 J. Virol. 91:e01348-17).
Molecular Modeling and in Silico Screening
[0059] The ZIKV RdRp structure was modeled based on sequence
homology using Modeller 9 program (Webb and Sali, 2014). The DENV-3
RdRp structure (PDB: 2J7U) was used as the template. In silico
screening was performed using Molegro Virtual Docker (MVD) (Molegro
ApS, Aarhus, Denmark). The docking site was defined using a
ray-tracing algorithm. This resulted in a cavity with a volume of
approximately 1034 cubic .ANG.. A receptor grid was built within
this cavity with a resolution of 0.2 .ANG. and a radius of 13 .ANG.
from the geometric center of the cavity in the ZIKV RdRp model. A
100,000 compound library from ChemBridge (Chembridge DIVERSet.TM.
Chemical Library, ChemBridge Corporation, San Diego, Calif.) was
used for this virtual screening. All structural analysis were
conducted in the Discovery Studio 4.0 (Biovia, San Diego,
Calif.).
Inhibition Assays
[0060] Vero cells were seeded in a 96-well plate with the density
of 6000 cells per well. In the initial screening study, the
compound (1 .mu.M)-virus (0.1 PFU/cell) mixture in virus growth
medium (VGM) [DMEM containing 2% FBS, PS, 20 mM hydroxyethyl
piperazine ethane sulfonic acid (HEPES), 1 mM sodium pyruvate, and
non-essential amino acids] was added to the cells and incubated for
72 h. In a separate experiment conducted using 12-well plates, the
cells were first infected with the virus at 0.1 PFU/cell and
following adsorption, the cells were washed twice in PBS and
incubated in VGM containing 1 .mu.M concentrations of the drugs.
The cell culture media were collected at 72-96 h post-infection and
assayed for infectious virus by plaque assay and viral genome
copies by quantitative RT-PCR (RT-qPCR). In all subsequent studies,
cells in 12-well plates were infected with ZIKV at MOI of 0.1
PFU/cell and following virus adsorption for 1 h at 37.degree. C.,
VGM containing various concentrations TPB was added to the cells
and incubated as above. Clarified supernatants from the infected
cells were then used to determine infectious virus or genome copies
as above.
ATP-Based Cell Viability Assay
[0061] A modified ATP based cytopathic effect (CPE) assay was used
for this study based on the CPE method for anti-DENV drug
development described elsewhere (see, e.g., Che et al., 2009 Int.
J. Clin. Exp. Med. 2:363-373). Vero cells (approximately 30,000 per
well) were seeded in a black 96-well plate for 24 hours before the
experiment. Cell monolayers were treated with various
concentrations of the drugs for 4 days at 37.degree. C. The ATP
concentration was measured following manufacturer's recommendations
using CellTiter-Glo kit from Promega (Madison, Wis.). Luminescence
was recorded using a Veritas Microplate Luminometer at 420 nm. The
50% cytotoxic concentration (CC.sub.50) was calculated by a
non-linear regression analysis of the dose-response curves.
Quantitative Real Time RT-PCR
[0062] ZIKV viral RNA was detected using RT-qPCR on a C100 Thermal
Cycler and the CFX96 Real-Time system (Bio-Rad). Viral RNA (vRNA)
was extracted from culture supernatant using a QIAamp Viral RNA
Mini kit (Qiagen) and TaqMan Fast Virus 1-Step Master Mix (Life
technologies). ZIKV primers and probe (ZIKF: CCGCTGCCCAACACAAG (SEQ
ID NO:1); ZIK-R:CCACTAACGTTCTTTTGCAGACAT (SEQ ID NO:2); PCR Probe:
ZIK-P: AGCCTACCTTGACAAGCAATCAGACACTCAA (SEQ ID NO:3)) were used for
quantitative RT-PCR (RT-qPCR) with the following parameters:
50.degree. C. 30 min, 95.degree. C. 5 min, (95.degree. C. 30 S,
58.degree. C. 1 min).times.40 cycles. RNA standard concentrations
were determined based on the back calculation with OD values and
molecular weights and were generated through serial dilution with
R.sup.2>0.95.
Pharmacokinetic (PK) Study Design
[0063] For PK studies, groups of Balb/C mice (n=3) were injected
intraperitoneally with doses of 5 mg/kg or 25 mg/kg of body weight
of TPB in 5% dextrose, plasma was collected from the animals at
various times post-injection and stored at -80.degree. C. until
analysis by LC-MS/MS for TPB concentrations. Plasma drug levels
were subjected to noncompartmental analysis (WinNonlin ver. 6.4
Certera Inc., Princeton, N.J.). The predicted steady-state levels
>500 ng/ml were estimated using a twelve h dosing of 25 mg/kg
dose of the compound in mice.
Determination of Drug Concentration in Plasma
[0064] TPB was dissolved in DMSO at 1 mg/ml. Working standard
solutions were then prepared in 50% methanol in water from the
stock solution. Standards (an eight-point calibration curve) and
quality controls (at three levels) were prepared by spiking the
working standard solutions to blank mouse plasma. One hundred .mu.l
aliquot of plasma was mixed with 25 .mu.l of internal standard
spiking solution (rilpivirine 1000 ng/ml in 50% acetonitrile in
water), 1.5 ml ethyl acetate was added and vortexed vigorously for
15 min. The tubes were centrifuged at 1700.times.g for 5 min and
1.3 ml supernatant was evaporated to dryness under a stream of
nitrogen at 40.degree. C. The dried extract was reconstituted with
0.1 ml of 50% acetonitrile in water and 5 .mu.l was injected into
the LCMS/MS instrument. The dynamic range of the method was 25-4000
ng/ml.
[0065] An Agilent 1200 HPLC system (Agilent Technologies, CA, USA)
coupled with AB Sciex API 3200 Q Trap with an electrospray
ionization source (Applied Biosystems, Foster City, Calif., USA)
was used. The mass transitions m/z 541.2.fwdarw.330.2 and
541.2.fwdarw.212.2 for analyte and m/z 367.2.fwdarw.195.2 for
internal standard were monitored. Chromatographic separation was
carried out on Phenomenex Synergi Polar-RP (150.times.2.0 mm,
4.mu.) column with isocratic mobile phase consisting of 0.1% formic
acid in water (A) and 0.1% formic acid in acetonitrile (B) (20:80
v/v) at a flow rate of 0.5 ml/min. The retention times of analyte
and internal standard were 2 and 1.2 min respectively.
Viral Inhibition Test in Mice
[0066] Balb/C mice were obtained from the Jackson Laboratory (Bar
Harbor, Me., USA). After acclimatization for four days, groups of
animals (n=6 per group) were injected intraperitoneally with 25
mg/kg body weight dose of TPB diluted in saline or saline alone (no
drug control). Following three injections at 12 h intervals, 500
PFU of PRVABC59 virus diluted in PBS was inoculated into each mouse
by the subcutaneous (SC) route. Blood was collected by
retro-orbital bleeding under anesthesia at days 2, 3, 4, 5, and 6
post-infection. Viral genome copies in the plasma were determined
by RT-qPCR.
Statistical Analysis
[0067] Data were analyzed using GraphPad Prism software version
6.0. Unpaired two-tailed Student's t-test for pairwise comparison
between the groups to determine significant differences in viral
loads (RNA levels and infectious titer) was performed. Data were
represented as means (.+-.SEM).
Results
In Silico Screening of a Compound Library Against ZIKV Polymerase
(RdRp) Loops
[0068] Since the crystal structure of ZIKV RdRp was not available
when this project was initiated, we generated a three-dimensional
model of ZIKV RdRp through structural modeling based on the analog
of DENV-3 RdRp structure (PDB: 2J7U). The choice of the DENV-3 RdRP
structure as the template was due to its high level of protein
sequence homology (65% identity and 78% similarity) and the high
resolution (1.8 .ANG.) of the structure. The predicted ZIKV RdRp
structure superimposed closely with a recently solved crystal
structure (see, e.g., Duan et al., 2017 EMBO J. 36:919-933) of ZIKV
RdRp (FIG. 8) with C-alpha atom RMSD of 2.519. The target site
appears to fit well and the relative larger RMSD value should be
mainly from the flexible loops and the outer layers of the three
domains. Like RdRp structures in other flaviviruses, the ZIKV RdRp
structure model showed a very similar right-handed architecture
with fingers, palm and thumb subdomains (FIG. 1A). Subsequently, we
conducted in silico screening of a library of 100,000 small
molecule compounds against the catalytic active site on the ZIKV
RdRp molecule. The active site is in the palm subdomain which is
critical for de novo RNA synthesis performed by ZIKV RdRp. Based on
the in silico screening data, the top 10 compounds with highest
docking scores are shown in Table 1. The molecular weights of these
compounds are also similar (around 500 Da) which are in the
appropriate range of druggable compounds.
Cell-Based Inhibition Test of the Lead Compounds Against ZIKV
Infection
[0069] Examination of PRVABC59 ZIKV growth in Vero cells in the
presence of 1 .mu.M concentrations of the compounds (c1-c10) showed
that c1,
3-chloro-N-[({4-[4-(2-thienylcarbonyl)-1-piperazinyl]phenyl}amino)carbono-
thioyl]-1-benzothiophene-2-carboxamide (TPB, FIG. 1B), exhibited
the highest inhibitory activity among the 10 lead compounds tested.
While the ZIKV growth was inhibited (as determined by genome copies
in the culture supernatants) by >99% in cells treated with TPB
compared to the vehicle-only treated cells (FIG. 2A), c6 and c10
also inhibited virus growth by nearly 70-80%. Infectious virus
yield was inhibited by at least 1000-fold in the presence of 1
.mu.M c1 (FIG. 2B) whereas c6 and c10 inhibited the yield by nearly
10-fold at the same concentrations. Although the majority of the
compounds could be readily seen bound to the target site, c1, c6,
and c10 appeared to have made additional contacts with the priming
loop as well as other regions in the RdRp target site (FIG. 9).
From molecular docking analysis, it appears that c1 interacts with
residues in the target site of the viral RdRp (FIG. 1C-D). Three
hydrogen bonds of TPB are in direct contact with two aspartic acid
residues (D535 in motif A and D665 in motif C) in RdRp (FIG. 1C).
Since these two aspartic acid residues as well as D665 are highly
conserved residues in the target and active site of all RdRps of
flaviviruses and play critical roles in coordinating divalent metal
ions (Mg++), TPB could potentially be a highly promising anti-ZIKV
as well as anti-flavivirus drug candidate. So, from the initial
cursory screening studies, TPB was shown to inhibit ZIKV
replication significantly.
[0070] We then tested the inhibitory activity of TPB in a
dose-dependent manner in the .mu.M range. The results show that
even at 0.5 .mu.M concentration of TPB, significant inhibitory
activity against ZIKV replication was observed. Both genome copy
numbers (FIG. 3A) and infectious virus (FIG. 3B) in the
supernatants were reduced by over 100-fold at this concentration of
TPB. Although TPB at 1 .mu.M reduced virus growth by over
1000-fold, further increase in TPB concentration did not result in
further inhibition (FIG. 3A-B). Viral E protein synthesis in
infected cells was also significantly inhibited at 0.5 .mu.M TPB
and was undetectable at higher concentrations (FIG. 3C). These
results suggest that TPB is a potent inhibitor of ZIKV
replication.
ZIKV Growth Inhibition of by TPB
[0071] Since we used the contemporary isolate of ZIKV (PRVABC59,
isolated from a patient in Puerto Rico in 2015) in our initial
studies, we wanted to determine if TBP also has antiviral activity
against the historical isolate of the virus. Our results suggest
that the MR766 Ugandan isolate was also sensitive to inhibition by
TPB at the concentrations tested (FIG. 4A). The extent of MR766
virus growth inhibition appeared to be similar to that of the
PRVABC59 virus (FIGS. 3 and 4A). Overall, it appears that maximal
ZIKV growth inhibition by TPB could be achieved at 1 or 2 .mu.M
concentrations and further increase had no significant inhibitory
effect, indicating that the TPB inhibitory target is saturable at
these concentrations. In addition, not only TPB inhibited ZIKV
growth in Vero cells (FIG. 3), but also it inhibited the virus
growth in other cells such as human trophoblast cell line HTR-8
(FIG. 4B) as well as the human testicular cell line NTERRA (FIG.
4C) that are known to be the targets of ZIKV infection in humans.
Overall, these studies suggest that TBP inhibits both the
contemporary and historical isolates of the virus and that the
inhibition is not cell-type dependent.
Characterization of TPB Antiviral Activity In Vitro: IC50 and
CC50
[0072] Inhibitory Concentration 50 (IC50) Determination.
[0073] To characterize the anti-ZIKV potency of TPB, we conducted
studies to determine the inhibitory concentration 50 (IC50). We
used serial 2-fold dilutions of TPB and treated the Vero cells
infected with PRVABC59. The culture supernatants were assayed for
infectious virus by plaque assay and expressed as % virus yield
relative to the virus yield without TPB. The data were
statistically analyzed and the IC50 concentration was determined to
be about 94 nM (FIG. 5A). The IC50 value of TPB in the 10-100 nM
range also suggests that TPB is a strong inhibitor of ZIKV and a
potential drug candidate for further development.
[0074] Cellular Cytotoxicity 50 (CC50) Determination.
[0075] Low level of cellular cytotoxicity is an essential criterion
for drug development. It also suggests whether the drug's
inhibitory effect is independent of cellular cytotoxicity due to
the presence of the drug. Therefore, we conducted cell viability
assay to determine the cellular cytotoxicity 50 (CC50)
concentration of TPB. Our results show that CC50 of TPB is 19.4
.mu.M (FIG. 5B). The selectivity index 50 (SI50, CC50/IC50) is
calculated to be 206. This high SI50 also suggests that TBP is not
only a potent inhibitor of ZIKV at sub-micromolar concentrations
but is also nontoxic to the cells.
[0076] Comparison of TPB Inhibition with Other Known Inhibitors of
ZIKV.
[0077] To further compare the potency of TPB relative to other
identified ZIKV inhibitors, two inhibitors were examined that have
been recently shown to inhibit ZIKV replication. Mycophenolic acid
(MPA) is an immunosuppressant drug used to prevent rejection in
organ transplantation and was shown to inhibit DENV RNA replication
(see, e.g., Diamond et al., 2002 Virology 304:211-221). In a screen
of FDA-approved drugs for inhibition of ZIKV infection, MPA at 1
.mu.M was found to inhibit infection of cells in vitro by ZIKV by
over 99% (see, e.g., Barrows et al., 2016 Cell Host Microbe
20:259-270). Likewise, Ivermectin (IVM), an anti-parasitic drug was
found to inhibit ZIKV infection strongly at 10 .mu.M (see, e.g.,
Barrows et al., 2016 Cell Host Microbe 20:259-270). A side-by-side
comparison of the inhibitory potency of TPB with MPA and IVM shows
that while TPB inhibited ZIKV yield by over 1000-fold, MPA and IVM
inhibited virus yield by approximately 10- to 20-fold (FIG. 6).
These results suggest that TPB is more potent in inhibiting ZIKV as
compared to MPA or IVM.
Antiviral Activity of TPB In Vivo Since TPB was found to be a
potent inhibitor of ZIKV replication in vitro, we wanted to examine
if it also inhibits virus replication and viremia in an
immunocompetent mouse model. Therefore, a pharmacokinetics (PK)
analysis of TPB in immunocompetent Balb/C mice was conducted to
examine the stability and in vivo retention of the drug. The
results of PK studies suggest that TPB is retained in the mouse
plasma at approximately 100 ng/ml level 10-12 h post-injection at
the two doses tested (FIG. 7A). Based on non-compartment analysis
of the data, it was estimated that steady-state levels >500
ng/ml of TPB (.about.1 .mu.M) could be achieved using a twelve hour
dosing at 25 mg/kg dose of the compound in mice. To examine the
effect of the drug on ZIKV growth in mice, groups of mice (n=6)
were injected with the drug at 25 mg/kg dose and subsequently
infected with 500 PFU of ZIKV. Virus load in the plasma of the
animals at 24 hour intervals was determined. Results of virus
growth (genome copies) in individual animals (FIG. 7B) show that
these immunocompetent mice supported transient ZIKV growth and the
level of viral RNA detected on day 4 post-infection was nearly
40-fold lower in mice injected with the drug as compared to the
group injected with the vehicle (5% dextrose) alone (FIG. 7C). The
level of TPB in the plasma on average reached nearly 270 ng/ml by 2
days post-infection (FIG. 7D). Although this level of TPB was not
optimal for maximal virus growth inhibition as observed under in
vitro conditions, the results suggest that TPB exerts significant
growth inhibition of ZIKV in vivo.
Other Embodiments
[0078] It is to be understood that while the invention has been
described in conjunction with the detailed description thereof, the
foregoing description is intended to illustrate and not limit the
scope of the invention, which is defined by the scope of the
appended claims. Other aspects, advantages, and modifications are
within the scope of the following claims.
Sequence CWU 1
1
3117DNAArtificial Sequencesynthetic primer 1ccgctgccca acacaag
17224DNAArtificial Sequencesynthetic primer 2ccactaacgt tcttttgcag
acat 24331DNAArtificial Sequencesynthetic probe 3agcctacctt
gacaagcaat cagacactca a 31
* * * * *
References