U.S. patent application number 16/237106 was filed with the patent office on 2019-05-30 for anti-t. cruzi antibodies and methods of use.
The applicant listed for this patent is Abbott Laboratories. Invention is credited to Susan E. Brophy, David J. Hawksworth, Dinesh O. Shah, Robert W. Siegel, Bryan C. Tieman, Bailin Tu, Joan D. Tyner, Robert N. Ziemann.
Application Number | 20190162726 16/237106 |
Document ID | / |
Family ID | 40671250 |
Filed Date | 2019-05-30 |
United States Patent
Application |
20190162726 |
Kind Code |
A1 |
Hawksworth; David J. ; et
al. |
May 30, 2019 |
ANTI-T. CRUZI ANTIBODIES AND METHODS OF USE
Abstract
The present disclosure is directed to reagents and methods of
using the reagents to detect epitopes of Trypanosoma cruzi.
Inventors: |
Hawksworth; David J.; (Lake
Villa, IL) ; Siegel; Robert W.; (Fountaintown,
IN) ; Tieman; Bryan C.; (Elmhurst, IL) ; Tu;
Bailin; (Libertyville, IL) ; Brophy; Susan E.;
(Lindenhurst, IL) ; Shah; Dinesh O.;
(Libertyville, IL) ; Tyner; Joan D.; (Beach Park,
IL) ; Ziemann; Robert N.; (Lindenhurst, IL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Abbott Laboratories |
Abbott Park |
IL |
US |
|
|
Family ID: |
40671250 |
Appl. No.: |
16/237106 |
Filed: |
December 31, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15287605 |
Oct 6, 2016 |
10215754 |
|
|
16237106 |
|
|
|
|
14686351 |
Apr 14, 2015 |
9482667 |
|
|
15287605 |
|
|
|
|
13353678 |
Jan 19, 2012 |
9073984 |
|
|
14686351 |
|
|
|
|
12342641 |
Dec 23, 2008 |
|
|
|
13353678 |
|
|
|
|
61017071 |
Dec 27, 2007 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
G01N 2496/00 20130101;
C07K 2317/92 20130101; C07K 2317/56 20130101; G01N 33/56905
20130101; G01N 2469/20 20130101; G01N 2333/44 20130101; C07K
2317/24 20130101; G01N 2469/10 20130101; C07K 16/20 20130101 |
International
Class: |
G01N 33/569 20060101
G01N033/569; C07K 16/20 20060101 C07K016/20 |
Claims
1.-42. (canceled)
43. An immunodiagnostic reagent comprising one or more antibodies
that specifically bind to a T. cruzi FRA polypeptide, wherein the
T. cruzi FRA polypeptide comprises an amino acid sequence of SEQ ID
NO: 8, and wherein each of the one or more antibodies comprises a
variable light chain region (V.sub.L) comprising an amino acid
sequence of SEQ ID NO: 26 and a variable heavy chain region
(V.sub.H) comprising an amino acid sequence of SEQ ID NO: 28.
44. The immunodiagnostic reagent according to claim 43, which
comprises two or more antibodies.
45. The immunodiagnostic reagent according to claim 43, wherein
each of the one or more antibodies comprises at least one binding
constant selected from: an association rate constant (k.sub.a)
between about 2.0.times.10.sup.5 M.sup.-1s.sup.-1 to about
6.0.times.10.sup.6 M.sup.-1s.sup.-1; a dissociation rate constant
(k.sub.d) between about 2.0.times.10.sup.-5 s.sup.-1 to about
8.0.times.10.sup.-4 s.sup.-1; and an equilibrium dissociation
constant (K.sub.D) between about 3.3.times.10.sup.-12 M to about
4.0.times.10.sup.-9 M.
46. The immunodiagnostic reagent according to claim 43, wherein the
one or more antibodies is a chimeric antibody.
47. The immunodiagnostic reagent of claim 43, wherein the one or
more antibodies is the antibody expressed by the cell line
deposited with the American Type Tissue Collection (ATCC) under
accession number PTA-8142.
48. The immunodiagnostic reagent of claim 43, which is a detection
reagent, a standardized reagent, or a positive control reagent.
49. An antibody that specifically binds to a T. cruzi FRA
polypeptide comprising the amino acid sequence of SEQ ID NO: 8,
wherein the antibody comprises a variable light chain region
(V.sub.L) comprising an amino acid sequence of SEQ ID NO: 26 and a
variable heavy chain region (V.sub.H) comprising an amino acid
sequence of SEQ ID NO: 28.
50. The antibody according to claim 49, which comprises at least
one binding constant selected from: an association rate constant
(k.sub.a) between about 2.0.times.10.sup.5 M.sup.-1s.sup.-1 to
about 6.0.times.10.sup.6 M.sup.-1s.sup.-1; a dissociation rate
constant (k.sub.d) between about 2.0.times.10.sup.-5 s.sup.-1 to
about 8.0.times.10.sup.-4 s.sup.-1; and an equilibrium dissociation
constant (K.sub.D) between about 3.3.times.10.sup.-12 M to about
4.0.times.10.sup.-9 M.
51. The antibody of claim 49, which is a chimeric antibody.
52. The antibody of claim 49, which is the antibody expressed by
the cell line deposited with the ATCC under accession number
PTA-8142.
53. A cell line deposited with the ATCC under accession number
PTA-8142.
54. A method of standardizing a T. cruzi detection assay comprising
using the immunodiagnostic reagent of claim 43 as a sensitivity
panel.
55. A method for detecting a T. cruzi FRA antigen comprising the
steps of: (a) contacting a test sample suspected of containing a T.
cruzi FRA antigen with the immunodiagnostic reagent of claim 43
under conditions that allow formation of chimeric antibody:antigen
complexes; and (b) detecting any chimeric antibody:antigen
complexes formed as indicating the presence of the T. cruzi FRA
antigen.
56. The method of claim 55, wherein the chimeric antibody comprises
a detectable label, or wherein the antibody:antigen complexes are
contacted with a detectably-labeled secondary antibody or fragment
thereof.
57. A method for detecting a T. cruzi FRA antibody comprising the
steps of: (a) contacting a test sample suspected of containing a T.
cruzi FRA antibody with one or more T. cruzi FRA antigens specific
for the T. cruzi antibody under conditions that allow formation of
antigen:antibody complexes; and (b) detecting any antigen:antibody
complexes formed as indicating the presence of a T. cruzi FRA
antibody, wherein the immunodiagnostic reagent of claim 43 is used
as a positive control or standardization reagent, and wherein the
T. cruzi FRA antigen comprises the amino acid sequence of SEQ ID
NO: 8.
58. A diagnostic kit for the detection of T. cruzi comprising the
immunodiagnostic reagent claim 43 and instructions for use.
59. An isolated polynucleotide encoding the V.sub.L region of the
antibody of claim 49, which comprises the nucleic acid sequence of
SEQ ID NO: 25.
60. An isolated polynucleotide encoding the V.sub.H region of the
antibody of claim 49, which comprises the nucleic acid sequence of
SEQ ID NO: 27.
61. A method of purifying a T. cruzi FRA antigen having at least
70% sequence identity to the amino acid sequence of SEQ ID NO: 8,
which method comprises: (a) contacting a sample suspected of
containing a T. cruzi FRA antigen with the immunodiagnostic reagent
of claim 43 under conditions that allow formation of
antibody:antigen complexes; (b) isolating the antibody:antigen
complexes formed; and (c) separating the FRA antigen from the
antibody.
Description
RELATED APPLICATION INFORMATION
[0001] This application is a continuation of U.S. Ser. No.
12/342,641 filed on Dec. 23, 2008, which claims the benefit of U.S.
Application No. 61/017,071 filed Dec. 27, 2007, the contents of
which are herein incorporated by reference.
TECHNICAL FIELD
[0002] The present disclosure relates to methods, assays and kits
for detecting or quantifying Trypanosoma (Schizotrypanum) cruzi
antigens.
BACKGROUND
[0003] The parasite Trypanosoma (Schizotrypanum) cruzi causes
Chagas' disease (American trypanosomiasis) and is endemic in
Central and South America, as well as in Mexico. After a mild acute
phase, most infected victims enter an indeterminate phase that is
characterized by a lack of symptoms, low parasite count, and low
titers of anti-T. cruzi antibodies. Approximately 10-30% of persons
with chronic T. cruzi infections, develop cardiac or
gastrointestinal dysfunction. Chemotherapy can cure a substantial
number of congenitally infected infants and children, but is
largely ineffective in adults who harbor chronic infections (Coura,
J., and S. de Castro. 2002. A critical review on Chagas disease
chemotherapy. Mem. Inst. Oswaldo Cruz. 97:3-24). Roughly 25,000 of
the estimated 12 million people in endemic countries who are
chronically infected with T. cruzi die of the illness each year,
due to cardiac rhythm disturbances or congestive heart failure
(Kirchhoff, L. V. 2006. American trypanosomiasis (Chagas' disease).
In Tropical Infectious Diseases: Principles, Pathogens and
Practice. Vol. R. Guerrant, D. Walker, and P. Weller, editors.
Churchill Livingstone, New York. 1082-1094).
[0004] Chagas was named after the Brazilian physician Carlos
Chagas, who first described it in 1909 (Chagas, C. 1909a. Neue
Trypanosomen. Vorlaufige Mitteilung. Arch. Schiff. Tropenhyg.
13:120-122; Redhead, S. A., et al. 2006. Pneumocystis and
Trypanosoma cruzi: nomenclature and typifications. J Eukaryot
Microbiol. 53:2-11). He discovered that the intestines of
Triatomidae harbored a flagellate protozoan, a new species of the
Trypanosoma genus, and was able to prove experimentally that the
parasite could be transmitted to marmoset monkeys that were bitten
by the infected bug. Chagas named the pathogenic parasite that
causes the disease Trypanosoma cruzi (Chagas, 1909a) and later that
year as Schizotrypanum cruzi (Chagas, C. 1909b. Nova tripanozomiase
humana: Estudos sobre a morfolojia e o ciclo evolutivo do
Schizotrypanum cruzi n. gen., n. sp., ajente etiolojico de nova
entidade morbida do homem. Mem. Inst. Oswaldo Cruz. 1:159-218),
both names honoring Oswaldo Cruz, a Brazilian physician and
epidemiologist who fought epidemics of yellow fever, smallpox, and
bubonic plague at the turn of the 20.sup.th century.
[0005] Charles Darwin might have suffered from this disease as a
result of a bite from the "Great Black Bug of the Pampas" he
received east of the Andes near Mendoza. Darwin reported the
episode in his diaries of the Voyage of the Beagle. Darwin was
young and in general good health, though six months previously he
had been ill for a month near Valparaiso, but in 1837, almost a
year after he returned to England, he began to suffer
intermittently from a strange group of symptoms, becoming
incapacitated for much of the rest of his life.
[0006] In endemic areas, T. cruzi is transmitted mainly by
blood-sucking triatomine insects. The disease can also be spread by
blood transfusion, intravenous drug use, congenital transmission,
by sexual activity, organ transplant or through breast milk
(Bittencourt, A. L. 1976. Congenital Chagas disease. Am J Dis
Child. 130:97-103; Cheng, K. Y., et al. 2007 Immunoblot assay using
recombinant antigens as a supplemental test to confirm the presence
of antibodies to Trypanosoma cruzi. Clin Vaccine Immunol.
14:355-61; Grant, I. H., et al. 1989. Transfusion-associated acute
Chagas disease acquired in the United States. Ann Intern Med.
111:849-51; Hoff, R., et al. 1978. Congenital Chagas's disease in
an urban population: investigation of infected twins. Trans R Soc
Trop Med Hyg. 72:247-50; Kirchhoff, L. V. 1989. Is Trypanosoma
cruzi a new threat to our blood supply? Ann Intern Med. 111:773-5;
Skolnick, A. 1989. Does influx from endemic areas mean more
transfusion-associated Chagas' disease? Jama. 262:1433). Currently,
there is no vaccine against T. cruzi.
[0007] Diagnosis of chronic T. cruzi infection reflects the
complexity of the parasite's life cycle. During periods of high
fever, diagnosis consists simply of identifying the parasites in
blood, cerebrospinal fluid, fixed tissue or lymph nodes; however,
during latency and chronic stages of infection, the bug is
difficult to detect. In xenodiagnosis, the intestinal contents of
insect vectors are examined for T. cruzi several weeks after these
parasites feed on the blood of a suspected patient. However, this
procedure is laborious, expensive and lacks sensitivity (Segura, E.
1987. Xenodiagnosis. In Chagas' Disease Vectors. Vol. R. R. Brenner
and A. M. Stoka, editors. CRC Press, Boca Raton, Fla. 41-45).
[0008] In contrast, serologic assays for antibodies to T. cruzi are
well suited for rapid and inexpensive diagnosis of the infection.
These methods include indirect immunofluorescence, indirect
hemagglutination, complement fixation and enzyme immunoassay
(Cheng, K. Y., et al. 2007 Immunoblot assay using recombinant
antigens as a supplemental test to confirm the presence of
antibodies to Trypanosoma cruzi. Clin Vaccine Immunol. 14:355-61).
A persistent problem with conventional assays has been the
occurrence of inconclusive and false-positive results (Almeida, I.
C., et al. 1997. A highly sensitive and specific chemiluminescent
enzyme-linked immunosorbent assay for diagnosis of active
Trypanosoma cruzi infection. Transfusion. 37:850-7; Kirchhoff et
al., 2006; Leiby, D. A., et al. 2000. Serologic testing for
Trypanosoma cruzi: comparison of radioimmunoprecipitation assay
with commercially available indirect immunofluorescence assay,
indirect hemagglutination assay, and enzyme-linked immunosorbent
assay kits. J Clin Microbiol. 38:639-42).
[0009] No assay has been uniformly accepted as the gold standard
serologic diagnosis of T. cruzi infection (Cheng et al., 2007).
Assays that are designed to detect T. cruzi DNA have been found to
be insensitive (Gomes, M. L., et al. 1999. Chagas' disease
diagnosis: comparative analysis of parasitologic, molecular, and
serologic methods. Am J Trop Med Hyg. 60:205-10). A radioimmune
precipitation assay (RIPA) that produces easily interpreted results
was developed nearly two decades ago and has been suggested for use
as a confirmatory test in the U.S. (Kirchhoff et al., 1989). Its
sensitivity and specificity, however, have not been systematically
validated. Moreover, the complexity of the RIPA render its
widespread use outside of research settings difficult (Leiby et
al., 2000).
[0010] Immunoassays designed to detect anti-T. cruzi antibodies
present in patient samples can provide fast and reliable
serological diagnostic methods. Typically, such diagnostic kits use
one or more specific antibodies to act as calibrators, positive
controls and/or panel members. Often, Chagas high-titer human
plasma and/or serum is screened and spiked into the negative
control reagent at specific quantities. Chagas quality control
reagents, such as positive controls, are human plasma or serum
samples screened for the presence of antibodies against specific
epitopes. However, using human serum and plasma samples has several
significant disadvantages. These include: (1) increasing regulatory
concerns, (2) difficulty in sourcing large volume with high titer
and specificity; (3) lot variability; (4) limitations regarding
characterization; and (5) cost.
[0011] Thus, there remains a need in the art for specific
antibodies to act as calibrators, positive controls and/or panel
members. The present disclosure optionally overcomes or obviates
some of the problems of current T. cruzi immunoassays (namely,
increasing regulatory concerns, difficulty in sourcing large volume
with high titer and specificity, lot variability, limitations
regarding characterization, and cost) by providing novel
antibodies, cell lines producing these antibodies, and methods of
making these antibodies.
SUMMARY
[0012] An object of the disclosure is to provide antibodies,
including, recombinant antibodies and chimeric antibodies, that
specifically bind Trypanosoma (Schizotrypanum) cruzi antigens and
uses thereof.
[0013] In accordance with one aspect of the present disclosure,
there is provided recombinant antibodies, including chimeric
antibodies, which are capable of specifically binding to a
diagnostically relevant region of a T. cruzi protein. The
antibodies, including chimeric and recombinant antibodies, selected
from the group consisting of an antibody specific for T. cruzi
polypeptides comprised by FP3, Pep2, FP10 and FRA.
[0014] In one aspect of the disclosure, the antibody is an said
antibody is selected from the group consisting of:
[0015] (a) an antibody that specifically binds to a diagnostically
relevant region of a T. cruzi polypeptide, wherein the T. cruzi
polypeptide is FRA and further wherein said antibody has at last
one binding constant selected from the group consisting of: an
association rate constant (k.sub.a) between about
7.0.times.10.sup.5M.sup.-1s.sup.-1 to about 7.0.times.10.sup.6
M.sup.-1s.sup.-1, an dissociation rate constant (k.sub.d) between
about 4.0.times.10.sup.-3 s.sup.-1 to about
3.0.times.10.sup.-1s.sup.-1 and an equilibrium dissociation
constant (K.sub.D) between about 5.7.times.10.sup.-10 M to about
4.3.times.10.sup.-7M;
[0016] (b) an antibody that specifically binds to a diagnostically
relevant region of a T. cruzi polypeptide, wherein the T. cruzi
polypeptide is Pep2 and further wherein said antibody has at least
one binding constant selected from the group consisting of: an
association rate constant (k.sub.a) between about
1.0.times.10.sup.6M.sup.-1s.sup.-1 to about
8.0.times.10.sup.6M.sup.-1s.sup.-1; an dissociation rate constant
(k.sub.d) between about 6.0.times.10.sup.-3s.sup.-1 to about
4.0.times.10.sup.-2s.sup.-1 and an equilibrium dissociation
constant (K.sub.D) between about 7.5.times.10.sup.-10 M to about
4.0.times.10.sup.-8 M;
[0017] (c) an antibody that specifically binds to a diagnostically
relevant region of a T. cruzi polypeptide, wherein the T. cruzi
polypeptide is FP10 and further wherein said antibody has at least
one binding constant selected from the group consisting of: (a) an
association rate constant (k.sub.a) between about
5.0.times.10.sup.4M.sup.-1s.sup.-1 to about
3.0.times.10.sup.5M.sup.-1s.sup.-1: (b) an dissociation rate
constant (k.sub.d) between about 1.0.times.10.sup.-4s.sup.-1 to
about 8.0.times.10.sup.-4 s.sup.-1; and (c) an equilibrium
dissociation constant (K.sub.D) between about 3.3.times.10.sup.-10
M to about 1.6.times.10.sup.-8 M;
[0018] (d) an antibody that specifically binds to a diagnostically
relevant region of a T. cruzi polypeptide, wherein the T. cruzi
polypeptide is FP3 and further wherein said antibody has at least
one binding constant selected from the group consisting of: an
association rate constant (k.sub.a) between about
2.0.times.10.sup.5M.sup.-1s.sup.-1 to about 6.0.times.10.sup.6
M.sup.-1s.sup.-1; an dissociation rate constant (k.sub.d) between
about 2.0.times.10.sup.-5s.sup.-1 to about
8.0.times.10.sup.-4s.sup.-1; and an equilibrium dissociation
constant (K.sub.D) between about 3.3.times.10.sup.-12M to about
4.0.times.10.sup.-9M; and
[0019] (e) any combinations of (a)-(d).
[0020] In another aspect of the disclosure, the antibody is a
chimeric antibody expressed by a cell line, wherein the cell line
selected from the group consisting of PTA-8136, PTA-8138 and
PTA-8140. Optionally, the antibody is expressed by a cell line
selected from the group consisting of PTA-8137, PTA-8139, PTA-8141,
and PTA-8142. The antibodies optionally are monoclonal antibodies,
humanized antibodies, single-chain Fv antibodies, affinity
maturated antibodies, single chain antibodies, single domain
antibodies, Fab fragments, F(ab') fragments, disulfide-linked Fv,
and anti-idiotypic antibodies, dual-variable domain immunoglobulins
(DVD-Ig.RTM.) or fragments thereof.
[0021] In another aspect of the disclosure, there is provided an
immunodiagnostic reagent that comprises one or more of these
antibodies, including chimeric and recombinant antibodies, which
are capable of specifically binding a diagnostically relevant
region of a T. cruzi protein, wherein the antibodies are selected
from the group consisting of FP3, Pep2, FP10 and FRA.
[0022] In accordance with another aspect of the disclosure, the
immunodiagnostic reagent comprises an antibody selected from the
group consisting of:
[0023] (a) an antibody that specifically binds to a diagnostically
relevant region of a T. cruzi polypeptide, wherein the T. cruzi
polypeptide is FRA and further wherein said antibody has at last
one binding constant selected from the group consisting of: an
association rate constant (k.sub.a) between about
7.0.times.10.sup.5M.sup.-1s.sup.-1 to about
7.0.times.10.sup.6M.sup.-1s.sup.-1, an dissociation rate constant
(k.sub.d) between about 4.0.times.10.sup.-3 s.sup.-1 to about
3.0.times.10.sup.-1s.sup.-1 and an equilibrium dissociation
constant (K.sub.D) between about 5.7.times.10.sup.-10 M to about
4.3.times.10.sup.-7M;
[0024] (b) an antibody that specifically binds to a diagnostically
relevant region of a T. cruzi polypeptide, wherein the T. cruzi
polypeptide is Pep2 and further wherein said antibody has at least
one binding constant selected from the group consisting of: an
association rate constant (k.sub.a) between about
1.0.times.10.sup.6M.sup.-1s.sup.-1 to about
8.0.times.10.sup.6M.sup.-1s.sup.-1; an dissociation rate constant
(k.sub.d) between about 6.0.times.10.sup.-3 s.sup.-1 to about
4.0.times.10.sup.-2s.sup.-1 and an equilibrium dissociation
constant (K.sub.D) between about 7.5.times.10.sup.-10 M to about
4.0.times.10.sup.-8 M;
[0025] (c) an antibody that specifically binds to a diagnostically
relevant region of a T. cruzi polypeptide, wherein the T. cruzi
polypeptide is FP10 and further wherein said antibody has at least
one binding constant selected from the group consisting of: (a) an
association rate constant (k.sub.a) between about
5.0.times.10.sup.4M.sup.-1s.sup.-1 to about
3.0.times.10.sup.5M.sup.-1s.sup.-1: (b) an dissociation rate
constant (k.sub.d) between about 1.0.times.10.sup.-4s.sup.-1 to
about 8.0.times.10.sup.-4 s.sup.-1; and (c) an equilibrium
dissociation constant (K.sub.D) between about 3.3.times.10.sup.-10
M to about 1.6.times.10.sup.-8 M;
[0026] (d) an antibody that specifically binds to a diagnostically
relevant region of a T. cruzi polypeptide, wherein the T. cruzi
polypeptide is FP3 and further wherein said antibody has at least
one binding constant selected from the group consisting of: an
association rate constant (k.sub.a) between about
2.0.times.10.sup.5 M.sup.-1s.sup.-1 to about
6.0.times.10.sup.6M.sup.-1s.sup.-1; an dissociation rate constant
(k.sub.d) between about 2.0.times.10.sup.-5 s.sup.-1 to about
8.0.times.10.sup.-4 s.sup.-1; and an equilibrium dissociation
constant (K.sub.D) between about 3.3.times.10.sup.-12M to about
4.0.times.10.sup.-9M; and
[0027] (e) any combinations of (a)-(d).
[0028] In accordance with another aspect of the disclosure, the
immunodiagnostic reagent is selected from the group consisting of a
detection reagent, a standardization reagent, and a positive
control reagent.
[0029] In accordance with another aspect of the disclosure, there
is provided antibodies, including chimeric and recombinant
antibodies, which are capable of specifically binding to a
diagnostically relevant region of a T. cruzi protein, the region
comprising an epitope comprised by an amino acid sequence selected
from the group consisting of an amino acid sequence having at least
80%, at least 90% and at least 95% sequence identity with an amino
acid sequence as set forth in SEQ ID NO.:2, SEQ ID NO.:4, SEQ ID
NO.:6 and SEQ ID NO.:8. In accordance with another aspect of the
disclosure, the immunodiagnostic reagent that specifically binds to
a diagnostically relevant region of a T. cruzi protein that
comprises a chimeric antibody, wherein the chimeric antibody
specifically binds to an epitope comprised by an amino acid
sequence selected from the group consisting of an amino acid
sequence substantially identical with an amino acid sequence as set
forth in SEQ ID NO.:2, SEQ ID NO.:4, SEQ ID NO.:6 and SEQ ID NO.:8.
The antibodies optionally are monoclonal antibodies, humanized
antibodies, single-chain Fv antibodies, affinity maturated
antibodies, single chain antibodies, single domain antibodies, Fab
fragments, F(ab') fragments, disulfide-linked Fv, and
anti-idiotypic antibodies, or fragments thereof. In accordance with
another aspect of the disclosure, there is provided an
immunodiagnositic reagent that comprises these antibodies.
[0030] In accordance with another aspect of the disclosure, there
is provided antibodies, including chimeric and recombinant
antibodies, and immunodiagnostic reagents comprising the
antibodies, wherein the antibodies comprise a V.sub.H region
selected from the group consisting of SEQ ID NO.:10, SEQ ID NO.:14,
SEQ ID NO.:18 and SEQ ID NO.:28.
[0031] In accordance with another aspect of the disclosure, there
is provided antibodies, including chimeric and recombinant
antibodies, and immunodiagnostic reagents comprising the
antibodies, wherein the antibodies comprise a V.sub.L region
selected from the group consisting of SEQ ID NO.:12, SEQ ID NO.:16,
SEQ ID NO.:20 and SEQ ID NO.:26.
[0032] In accordance with another aspect of the disclosure, there
is provided antibodies, including chimeric and recombinant
antibodies, and immunodiagnostic reagents comprising the
antibodies, wherein the antibodies are selected from the group
consisting of an antibody that comprises a V.sub.H region
substantially identical to the sequence as set forth in SEQ ID
NO.:10 and a V.sub.L region comprising an amino acid sequence
substantially identical to the sequence as set forth in SEQ ID
NO.:12; a V.sub.H region substantially identical to the sequence as
set forth in SEQ ID NO.:14 and a V.sub.L region comprising an amino
acid sequence substantially identical to the sequence as set forth
in SEQ ID NO.:16; a V.sub.H region substantially identical to the
sequence as set forth in SEQ ID NO.:18 and a V.sub.L region
comprising an amino acid sequence substantially identical to the
sequence as set forth in SEQ ID NO.:20; a V.sub.H region
substantially identical to the sequence as set forth in SEQ ID
NO.:28 and a V.sub.L region comprising an amino acid sequence
substantially identical to the sequence as set forth in SEQ ID
NO.:26. The antibodies optionally are monoclonal antibodies,
humanized antibodies, single-chain Fv antibodies, affinity
maturated antibodies, single chain antibodies, single domain
antibodies, Fab fragments, F(ab') fragments, disulfide-linked Fv,
and anti-idiotypic antibodies, or fragments thereof.
[0033] In accordance with another aspect of the disclosure, there
is provided a cell line capable of expressing a chimeric antibody
that specifically binds to a diagnostically relevant region of a T.
cruzi protein, wherein the cell line optionally is selected from
the group consisting of PTA-8136, PTA-8138 and PTA-8140. There is
also provided a cell line that is capable of expressing an antibody
that specifically binds to a diagnostically relevant region of a T.
cruzi protein, wherein the cell line optionally is selected from
the group consisting of PTA-8137, PTA-8139, PTA-8141 and
PTA-8142.
[0034] In accordance with another aspect of the present disclosure,
there is provided a method of standardizing a T. cruzi detection
assay comprising using as a sensitivity panel an immunodiagnostic
reagent optionally comprising one or more antibodies, including
chimeric and recombinant antibodies, that are capable of
specifically binding a diagnostically relevant region of a T. cruzi
protein. In such a panel, optionally the one or more antibodies are
selected from the group consisting of an antibody specific for FP3,
Pep2, FP10 and FRA.
[0035] In accordance with another aspect of the present disclosure,
there is provided a method for detecting the presence of T. cruzi
antigens comprising contacting a test sample, such as a sample
suspected of containing T. cruzi antigens, with an immunodiagnostic
reagent comprising one or more antibodies, including chimeric and
recombinant antibodies, which are capable of specifically binding a
T. cruzi antigen. Optionally the contacting is done under
conditions that allow formation of antibody:antigen complexes.
Further optionally, the method comprises detecting any
antibody:antigen complexes formed. The antibodies optionally are
monoclonal antibodies, humanized antibodies, single-chain Fv
antibodies, affinity maturated antibodies, single chain antibodies,
single domain antibodies, Fab fragments, F(ab') fragments,
disulfide-linked Fv, and anti-idiotypic antibodies, or fragments
thereof.
[0036] In accordance with another aspect of the present disclosure,
there is provided a method for detecting the presence of T. cruzi
antibodies comprising contacting a test sample, such as a sample
suspected of containing antibodies to T. cruzi, with one or more
antigens specific for the T. cruzi antibodies. Optionally this
contacting is done under conditions that allow formation of
antigen:antibody complexes, and further optionally the method
comprises detecting the antigen:antibody complexes. Still further,
the method optionally comprises using an immunodiagnostic reagent
comprising one or more antibodies, including chimeric and
recombinant antibodies, wherein each of the antibodies are capable
of specifically binding one of the antigens used in the method,
e.g., either as a positive control or standardization reagent.
[0037] In accordance with another aspect of the present disclosure,
there is provided a diagnostic kit for the detection of T. cruzi
comprising an immunodiagnostic reagent comprising one or more
antibodies, including recombinant and recombinant chimeric
antibodies, which are capable of specifically binding a
diagnostically relevant region of a T. cruzi protein. In such a
kit, the one or more antibodies optionally are selected from the
group consisting of an antibody, including chimeric and recombinant
antibodies, specific for FP3, Pep2, FP10 and FRA. The antibodies
optionally are monoclonal antibodies, humanized antibodies,
single-chain Fv antibodies, affinity maturated antibodies, single
chain antibodies, single domain antibodies, Fab fragments, F(ab')
fragments, disulfide-linked Fv, and anti-idiotypic antibodies, or
fragments thereof.
[0038] In accordance with yet another aspect of the present
disclosure, there is provided isolated polypeptides that comprise a
portion of a chimeric antibody that specifically binds to a
diagnostically relevant region of a T. cruzi polypeptide selected
from the group consisting of T. cruzi polypeptides comprised by
FP3, Pep2, FP10 or FRA polypeptides. The chimeric antibody
optionally is selected form the group consisting of a chimeric
antibody that specifically binds an epitope comprised by an amino
acid sequence selected from the group consisting of an amino acid
sequence substantially identical with an amino acid sequence as set
forth in SEQ ID NO.:2, SEQ ID NO.:4, SEQ ID NO.:6 and SEQ ID NO.:8.
The isolated polypeptides optionally comprise a V.sub.H region
selected from the group consisting of an amino acid sequence
substantially identical to the sequence as set forth in SEQ ID
NO.:10, SEQ ID NO.:14 SEQ ID NO.:18, and SEQ ID NO.:28. The
isolated polypeptides optionally comprise a V.sub.L region selected
from the group consisting of an amino acid sequence substantially
identical to the sequence as set forth in SEQ ID NO.:12, SEQ ID
NO.:16, SEQ ID NO.:20 and SEQ ID NO.:26. Further, the isolated
polypeptides comprise both a V.sub.H and V.sub.L region selected
from the group consisting of a V.sub.H region of SEQ ID NO.:10 and
a V.sub.L region of SEQ ID NO.:12; V.sub.H region of SEQ ID NO.:14
and a V.sub.L region of SEQ ID NO.:16; V.sub.H region of SEQ ID
NO.:18 and a V.sub.L region of SEQ ID NO.:20; and and V.sub.H
region of SEQ ID NO.:28 and a V.sub.L region of SEQ ID NO.:26.
[0039] In accordance with another aspect of the disclosure, there
is provided isolated polynucleotides that encode a portion of a
chimeric antibody that specifically binds to a diagnostically
relevant region of a T. cruzi polypeptide, the T. cruzi polypeptide
selected from the group consisting of T. cruzi polypeptides
comprised by FP3, Pep2, FP10 and FRA polypeptides. The chimeric
antibody optionally is selected form the group consisting of a
chimeric antibody that specifically binds an epitope comprised by
an amino acid sequence selected from the group consisting of an
amino acid sequence substantially identical with an amino acid
sequence as set forth in SEQ ID NO.:2, SEQ ID NO.:4, SEQ ID NO.:6
and SEQ ID NO.:8. The isolated polynucleotides optionally comprise
a region that encodes a V.sub.H region selected from the group
consisting of an amino acid sequence substantially identical to the
sequence as set forth in SEQ ID NO.:10, SEQ ID NO.:14, SEQ ID
NO.:18 and SEQ ID NO.:28. The isolated polynucleotides comprise a
region that encodes a V.sub.L region selected from the group
consisting of an amino acid sequence substantially identical to the
sequence as set forth in SEQ ID NO.:12, SEQ ID NO.:16,SEQ ID NO.:20
and SEQ ID NO.:26. Further, the isolated polynucleotides comprise a
region that encodes both a V.sub.H and V.sub.L region selected from
the group consisting of a V.sub.H region of SEQ ID NO.:10 and a
V.sub.L region of SEQ ID NO.:12; V.sub.H region of SEQ ID NO.:14
and a V.sub.L region of SEQ ID NO.:16; V.sub.H region of SEQ ID
NO.:18 and a V.sub.L region of SEQ ID NO.:20; and V.sub.H region of
SEQ ID NO.:28 and a V.sub.L region of SEQ ID NO.:26. In other
aspects, the polynucleotide is one selected from the group
consisting of SEQ ID NO.:9, SEQ ID NO.:11, SEQ ID NO.:13, SEQ ID
NO.:15, SEQ ID NO.:17,SEQ ID NO.:19, SEQ ID NO.:25 and SEQ ID
NO.:27.
[0040] In accordance with yet another aspect of the disclosure
there is provided methods of purifying an antigen comprising a T.
cruzi amino acid sequence comprised by the amino acid sequences as
set forth in SEQ ID NOs.:1, 3, 5 or 7, comprising contacting a
sample suspected of containing a T. cruzi polypeptide with an
immunodiagnostic reagent, the immunodiagnostic reagent comprising
one or more antibodies, including chimeric or recombinant
antibodies, that are capable of specifically binding to a T. cruzi
protein, under conditions that allow formation of antibody:antigen
complexes, isolating the formed antibody:antigen complexes and
separating the antigen from the antibody. Optionally, the antibody,
including chimeric and recombinant antibodies, binds to a T. cruzi
polypeptide selected form the group consisting of FP3, Pep2, FP10,
and FRA.
[0041] These and other features, aspects, objects, and embodiments
of the disclosure will become more apparent in the following
detailed description in which reference is made to the appended
drawings that are exemplary of such features, aspects, objects and
embodiments.
BRIEF DESCRIPTION OF THE DRAWINGS
[0042] FIG. 1 presents a diagrammatic structure of the chimeric
(mouse-human) anti-T. cruzi epitope antibodies of the
disclosure.
[0043] FIG. 2 depicts schematically the plasmid Chagas 12-392-150
Mu-Hu_pBJ, plasmid size: 9520 nucleotides. An ampicillin resistance
gene ORF is located at bases 60-917; an enhancer is located at
bases 1551-2021; a promoter is located at bases 2023-2744; a heavy
chain signal peptide is located at bases 2772-2828; a V.sub.H gene
is located at bases 2829-3194; a human constant hgG1, z, non-a is
located at bases 3195-4187; a SV40 Poly A is located at bases
4219-4413; a SV40 promoter is located at bases 4684-5229; a murine
DHFR is located at bases 5257-5820; a TK poly A is located at bases
5847-6213; an enhancer is located at bases 6241-6711; a promoter is
located at bases 6712-7433; a kappa signal peptide is located at
bases 7460-7525; a V.sub.L gene is located at bases 7526-7861; a
human constant kappa is located at bases 7862-8185; a SV40 Poly A
is located at bases 8198-8392; and a pUC origin is located at bases
8759-9432 (complementary).
[0044] FIGS. 3A-C depicts the annotated, double-stranded
polynucleotide sequence for VH and VL sequences (and flanking
regions) cloned into Chagas 12-392-150 Mu-Hu_pBJ. FIG. 3A-B depicts
the polynucleotide sequence (SEQ ID NOs.:21-22) for the Heavy chain
signal peptide located at bases 2772-2828, VH gene sequences
located at bases 2829-3194, and Human Constant IgG1, z, non-a
sequences located at bases 3195-4187. FIG. 3C depicts the
polynucleotide sequence (SEQ ID NOs.:23-24) for the Kappa signal
peptide located at bases 7460-7525, the VL gene sequences located
at bases 7526-7861, and the Human Constant kappa sequences located
at bases 7862-8185.
[0045] FIG. 4 depicts schematically the plasmid Chagas 9-638
Mu-Hu_pBJ, plasmid size: 9514 nucleotides. An ampicillin resistance
gene ORF is located at bases 60-917; an enhancer is located at
bases 1551-2021; a promoter is located at bases 2023-2744; a heavy
chain signal peptide is located at bases 2772-2828; a V.sub.H gene
is located at bases 2829-3188; a human constant hgG1, z, non-a is
located at bases 3189-4181; a SV40 poly A is located at bases
4213-4407; a SV40 promoter is located at bases 4678-5223; a murine
DHFR is located at bases 5251-5814; a TK poly A is located at bases
5841-6207; an enhancer is located at bases 6235-6705; a promoter is
located at bases 6706-7427; a kappa signal peptide is located at
bases 7454-7519; a V.sub.L gene is located at bases 7520-7858; a
human constant kappa is located at bases 7859-8179; a SV40 Poly A
is located at bases 8192-8386; and a pUC origin is located at bases
8753-9426 (complementary).
[0046] FIG. 5 depicts schematically the plasmid Chagas 10-745
Mu-Hu_pBJ, plasmid size: 9514 nucleotides. An ampicillin resistance
gene ORF is located at bases 60-917; an enhancer is located at
bases 1551-2021; a promoter is located at bases 2023-2744; a heavy
chain signal peptide is located at bases 2772-2828; a V.sub.H gene
is located at bases 2829-3188; a human constant IgG1, z, non-a is
located at bases 3189-4181; a SV40 Poly A is located at bases
4213-4407; a SV40 promoter is located at bases 4678-5223; a Murine
DHFR is located at bases 5251-5814; a TK poly A is located at bases
5841-6207; an enhancer is located at bases 6235-6705; a promoter is
located at bases 6706-7427; a kappa signal peptide is located at
bases 7454-7519; a V.sub.L gene is located at bases 7520-7855; a
human constant kappa is located at bases 7856-8179; a SV40 poly A
is located at bases 8192-8386; and a pUC origin bases 8753-9426
(complementary).
DETAILED DESCRIPTION
[0047] The present disclosure provides, among other things,
methods, assays and kits for detecting or quantifying Trypanosoma
(Schizotrypanum) cruzi antigens. In accordance with one embodiment
of the present disclosure, recombinant antibodies of the
disclosure, including chimeric antibodies, specifically bind to
diagnostically relevant regions of T. cruzi proteins and are thus
suitable for use, for example, as diagnostic reagents for the
detection of T. cruzi, and/or as standardization reagents or
positive control reagents in assays for the detection of T.
cruzi.
[0048] The present disclosure also thus provides for an
immunodiagnostic reagent comprising one or more recombinant
antibodies, including chimeric antibodies, wherein each antibody is
capable of specifically binding a diagnostically relevant region of
a T. cruzi protein. The recombinant antibodies can be, for example,
chimeric antibodies, humanized antibodies, antibody fragments, and
the like. In another embodiment, the immunodiagnostic reagent
comprises two or more recombinant antibodies, including chimeric
antibodies. Optionally the antibodies used in the immunodiagnostic
reagent are each specific for a different T. cruzi antigenic
protein, such that the immunodiagnostic reagent is capable of
detecting a plurality of T. cruzi antigens. Optionally, the
immunodiagnostic reagent comprises at least one or more, or at
least two or more, recombinant antibodies specific for T. cruzi
antigens selected from the group consisting of a recombinant
antibody specific for Chagas FP3 antigen, a recombinant antibody
specific for Chagas FP6 antigen, a recombinant antibody specific
for Chagas FP10 antigen, and a recombinant antibody specific for
Chagas FRA antigen. In yet another embodiment, the antibody or
antibodies of the immunodiagnostic reagent are novel monoclonal
antibodies produced by hybridoma cell lines and are specific for T.
cruzi antigens selected from the group consisting of a monoclonal
antibody specific for Chagas FP3 antigen, a monoclonal antibody
specific for Chagas FP6 antigen, a monoclonal antibody specific for
Chagas FP10 antigen, and a monoclonal antibody specific for Chagas
FRA antigen.
[0049] In one embodiment, the present disclosure provides for the
use of the immunodiagnostic reagent as a standardization reagent in
a T. cruzi detection assay, for instance, in place of human sera.
In this context, the immunodiagnostic reagent optionally can be
used, for example, to evaluate and standardize the performance of
current and future T. cruzi detection assays.
[0050] These and additional embodiments, features, aspects,
illustrations, and examples of the disclosure are further described
in the sections which follow. Unless defined otherwise herein, all
technical and scientific terms used herein have the same meaning as
commonly understood by one of ordinary skill in the art to which
this disclosure belongs.
A. Definitions
[0051] As used herein, the singular forms "a," "an" and "the"
include plural referents unless the context clearly dictates
otherwise. For the recitation of numeric ranges herein, each
intervening number there between with the same degree of precision
is explicitly contemplated. For example, for the range 6-9, the
numbers 7 and 8 are contemplated in addition to 6 and 9, and for
the range 6.0-7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6,
6.7, 6.8, 6.9 and 7.0 are explicitly contemplated.
[0052] a) About
[0053] As used herein, the term "about" refers to approximately a
+1-10% variation from the stated value. It is to be understood that
such a variation is always included in any given value provided
herein, whether or not it is specifically referred to.
[0054] b) Antibody
[0055] The term "antibody" (Ab) as used herein comprises single Abs
directed against a TCA (an anti-TCA Ab), anti-TCA Ab compositions
with poly-epitope specificity, single chain anti-TCA Abs, and
fragments of anti-TCA Abs. A "monoclonal antibody" (mAb) is
obtained from a population of substantially homogeneous Abs, i.e.,
the individual Abs comprising the population are identical except
for possible naturally-occurring mutations that can be present in
minor amounts. Exemplary Abs include polyclonal (pAb), monoclonal
(mAb), humanized, bi-specific (bsAb), heteroconjugate Abs and
dual-variable domain immunoglobulins (DVD-Ig.RTM.) and derivatives
of dual-variable domain immunoglobulins (such as triple variable
domains) (Dual-variable domain immunoglobulins and methods for
making them are described in Wu, C., et al., Nature Biotechnology,
25(11):1290-1297 (2007) and WO2001/058956; the contents of each of
which are herein incorporated by reference).
[0056] c) Antibody Fragment
[0057] The term "antibody fragment" or "antibody fragments," as
used herein, refers to a portion of an intact antibody comprising
the antigen binding site or variable region of the intact antibody,
wherein the portion is free of the constant heavy chain domains
(i.e., C.sub.H2, C.sub.H3, and C.sub.H4, depending on antibody
isotype) of the Fc region of the intact antibody. Examples of
antibody fragments include, but are not limited to, Fab fragments,
Fab' fragments, Fab'-SH fragments, F(ab').sub.2 fragments, Fv
fragments, diabodies, single-chain Fv (scFv) molecules, single
chain polypeptides containing only one light chain variable domain,
single chain polypeptides containing the three CDRs of the light
chain variable domain, single chain polypeptides containing only
one heavy chain variable region, and single chain polypeptides
containing the three CDRs of the heavy chain variable region.
[0058] d) Bifunctional Antibody
[0059] The term "bifunctional antibody," as used herein, refers to
an antibody that comprises a first arm having a specificity for one
antigenic site and a second arm having a specificity for a
different antigenic site, i.e., the bifunctional antibodies have a
dual specificity.
[0060] e) Biological Sample
[0061] The term "biological sample" includes tissues, cells and
biological fluids isolated from a subject, as well as tissues,
cells and fluids present within a subject. Biological samples from
a subject contain polypeptide molecules. Examples of biological
samples include whole blood, serum, plasma, interstitial fluid,
saliva, ocular lens fluid, cerebral spinal fluid, sweat, urine,
milk, ascites fluid, mucous, nasal fluid, sputum, synovial fluid,
peritoneal fluid, vaginal fluid, menses, amniotic fluid and semen.
Detection methods can be used to detect a TCA in a biological
sample in vitro as well as in vivo. In vitro techniques for
detection of a TCA include enzyme-linked immunosorbent assays
(ELISAs), Western blots, immunoprecipitations and
immunofluorescence. Furthermore, in vivo techniques for detecting a
TCA include introducing into a subject a labeled anti-TCA antibody.
For example, the antibody can be labeled with a radioactive marker
whose presence and location in a subject can be detected by
standard imaging techniques.
[0062] f) Binding Constants
[0063] The term "association rate constant", "k.sub.on" or
"k.sub.a" as used interchangeably herein, refers to the value
indicating the binding rate of an antibody to its target antigen or
the rate of complex formation between an antibody and antigen as
shown by the equation below:
Antibody ("Ab")+Antigen ("Ag").fwdarw.Ab-Ag.
[0064] The term "dissociation rate constant", "k.sub.off" or
"k.sub.d" as used interchangeably herein, refers to the value
indicating the dissociation rate of an antibody from its target
antigen or separation of Ab-Ag complex over time into free antibody
and antigen as shown by the equation below:
Ab+Ag.rarw.Ab-Ag.
[0065] Methods for determining association and dissociation rate
constants are well known in the art. Using fluorescence-based
techniques offers high sensitivity and the ability to examine
samples in physiological buffers at equilibrium. Other experimental
approaches and instruments such as a BIAcore.RTM. (biomolecular
interaction analysis) assay can be used (e.g., instrument available
from BIAcore International AB, a GE Healthcare company, Uppsala,
Sweden). Additionally, a KinExA.RTM. (Kinetic Exclusion Assay)
assay, available from Sapidyne Instruments (Boise, Id.) can also be
used.
[0066] The term "equilibrium dissociation constant" or "K.sub.D" as
used interchangeably, herein, refers to the value obtained by
dividing the dissociation rate (k.sub.off) by the association rate
(k.sub.on). The association rate, the dissociation rate and the
equilibrium dissociation constant are used to represent the binding
affinity of an antibody to an antigen.
[0067] g) Chimeric Antibody
[0068] The term "chimeric antibody" (or "cAb") as used herein,
refers to a polypeptide comprising all or a part of the heavy and
light chain variable regions of an antibody from one host species
linked to at least part of the antibody constant regions from
another host species.
[0069] h) Corresponding to or Corresponds to
[0070] The terms "corresponding to" or "corresponds to" indicate
that a nucleic acid sequence is identical to all or a portion of a
reference nucleic acid sequence. The term "complementary to" is
used herein to indicate that the nucleic acid sequence is identical
to all or a portion of the complementary strand of a reference
nucleic acid sequence. For illustration, the nucleic acid sequence
"TATAC" corresponds to a reference sequence "TATAC" and is
complementary to a reference sequence "GTATA."
[0071] Unless otherwise specified herein, all nucleic acid
sequences are written in a 5' to 3' direction, and all amino acid
sequences are written in an amino- to carboxy-terminus
direction.
[0072] i) Derivatized Antibody
[0073] The term "derivatized antibody" as used herein refers to an
antibody or antibody portion that is derivatized or linked to
another functional molecule. For example, an antibody or antibody
fragment can be functionally linked, by chemical coupling, genetic
fusion, or non-covalent association, etc., to one or more
molecules, such as another antibody, a detectable agent, a
cytotoxic agent, a pharmaceutical agent, and a polypeptide that can
mediate association of the antibody or antibody portion with
another molecule, such as a streptavidin core region or a
polyhistidine tag. One type of derivatized antibody is produced by
cross-linking two or more antibodies. Suitable cross-linkers
include those that are hetero-bifunctional (e.g.,
m-maleimidobenzoyl-N-hydroxysuccinimide ester) or homo-bifunctional
(e.g., disuccinimidyl suberate). Such linkers are available from
Pierce Chemical Company (Rockford, Ill.).
[0074] j) Detectable Label
[0075] The term, "detectable labels", as used herein, include
molecules or moieties that can be detected directly or indirectly.
Furthermore, these agents can be derivatized with antibodies and
include fluorescent compounds. Classes of labels include
fluorescent, luminescent, bioluminescent, and radioactive
materials, enzymes and prosthetic groups. Useful labels include
horseradish peroxidase, alkaline phosphatase, .beta.-galactosidase,
acetylcholinesterase, streptavidin/biotin, avidin/biotin,
umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride, phycoerythrin,
luminol, luciferase, luciferin, aequorin, and .sup.125I, .sup.131I,
.sup.35S or .sup.3H.
[0076] k) Diagnostically Relevant
[0077] The term "diagnostically relevant" as used herein with
reference to a region of a T. cruzi protein refers to a region of
the protein the detection of which, either alone or in combination
with other diagnostically relevant regions of Chagas, allows
detection of T. cruzi. Examples of diagnostically relevant regions
include immunodominant regions known in the art and regions such as
those described herein.
[0078] l) Epitope, Epitopes or Epitopes of Interest
[0079] As used herein, the term "epitope", "epitopes" or "epitopes
of interest" refer to a site(s) on any molecule that is recognized
and is capable of binding to a complementary site(s) on its
specific binding partner. The molecule and specific binding partner
are part of a specific binding pair. For example, an epitope can be
a polypeptide, protein, hapten, carbohydrate antigen (such as, but
not limited to, glycolipids, glycoproteins or lipopolysaccharides)
or polysaccharide and its specific binding partner, can be, but is
not limited to, an antibody. Typically an epitope is contained
within a larger antigenic fragment (i.e., region or fragment
capable of binding an antibody) and refers to the precise residues
known to contact the specific binding partner. It is possible for
an antigenic fragment to contain more than one epitope.
[0080] m) Humanized Antibody
[0081] The term "humanized antibody," as used herein, refers to a
polypeptide comprising a modified variable region of a human
antibody wherein a portion of the variable region has been
substituted by the corresponding sequence from a non-human species
and wherein the modified variable region is linked to at least part
of the constant region of a human antibody. In one embodiment, the
portion of the variable region is all or a part of the
complementarity determining regions (CDRs). The term also includes
hybrid antibodies produced by splicing a variable region or one or
more CDRs of a non-human antibody with a heterologous protein(s),
regardless of species of origin, type of protein, immunoglobulin
class or subclass designation, so long as the hybrid antibodies
exhibit the desired biological activity (i.e., the ability to
specifically bind a T. cruzi antigenic protein).
[0082] n) Isolated or Purified
[0083] The term "isolated" or "purified", when referring to a
molecule, refers to a molecule that has been identified and
separated and/or recovered from a component of its natural
environment. Contaminant components of its natural environment are
materials that interfere with diagnostic or therapeutic use. The
term "isolated" or "purified" polypeptide or biologically active
fragment (such as an Fab fragment) as used herein refers to a
polypeptide or biologically active fragment that is separated
and/or recovered from a component of its environment. Contaminant
components include materials that would typically interfere with
diagnostic uses for the polypeptide, and can include enzymes,
hormones, and other polypeptideaceous or non-polypeptideaceous
materials. To be substantially isolated, preparations having less
than about 30% by dry weight of contaminants (i.e., from about
0.01% to about 30%), usually less than about 20% (i.e., from about
0.01% to about 20%), less than about 10% (i.e., from about 0.01% to
about 10%), and more often, less than about 5% (i.e., from about
0.01% to about 5%) contaminants. An isolated,
recombinantly-produced TCA, V.sub.L or V.sub.H or biologically
active portion is desirably substantially free of culture medium,
i.e., culture medium represents less than about 20%, about 10%, or
about 5% of the volume of the TCA, V.sub.L or V.sub.H preparation.
Therefore, an "isolated antibody" as used herein refers to an
antibody that is substantially free of other antibodies having
different antigenic specificities. An isolated antibody that
specifically binds a T. cruzi epitope can, however, have
cross-reactivity to other T. cruzi antigens, such as, for example,
an antibody that bind the Pep2 epitope, found on the Chagas
polypeptides Tcf and FP6.
[0084] o) Quality Control Reagents
[0085] As described herein, immunoassays incorporate "quality
control reagents" that include but are not limited to, e.g.,
calibrators, controls, and sensitivity panels. A "calibrator" or
"standard" typically is used (e.g., one or more, or a plurality) in
order to establish calibration (standard) curves for interpolation
of antibody concentration. Optionally, a single calibrator can be
used near the positive/negative cutoff. Multiple calibrators (i.e.,
more than one calibrator or a varying amount of calibrator(s)) can
be used in conjunction so as to comprise a "sensitivity panel. A
"positive control" is used to establish assay performance
characteristics and is a useful indicator of the integrity of the
reagents (e.g., antigens).
[0086] p) Recombinant Antibody or Recombinant Antibodies
[0087] The term "recombinant antibody" or "recombinant antibodies,"
as used herein, refers to an antibody prepared by one or more steps
including cloning nucleic acid sequences encoding all or a part of
one or more monoclonal antibodies into an appropriate expression
vector by recombinant techniques and subsequently expressing the
antibody in an appropriate host cell. The term thus includes, but
is not limited to, recombinantly-produced antibodies that are
monoclonal antibodies, antibody fragments including fragments of
monoclonal antibodies, chimeric antibodies, humanized antibodies
(fully or partially humanized), multispecific or multivalent
structures formed from antibody fragments (including tetravalent
IgG-like molecules termed dual-variable-domain immunoglobulin,
DVD-Ig.RTM.), and bifunctional antibodies.
[0088] q) Specific or Specificity
[0089] As used herein, "specific" or "specificity" in the context
of an interaction between members of a specific binding pair (e.g.,
an antigen and antibody) refers to the selective reactivity of the
interaction. The phrase "specifically binds to" and analogous terms
thereof refer to the ability of antibodies to specifically bind to
a T. cruzi protein and not specifically bind to other entities.
Antibodies or antibody fragments that specifically bind to a T.
cruzi protein can be identified, for example, by diagnostic
immunoassays (e.g., radioimmunoassays ("RIA") and enzyme-linked
immunosorbent assays ("ELISAs") (See, for example, Paul, ed.,
Fundamental Immunology, 2nd ed., Raven Press, New York, pages
332-336 (1989)), BIAcore.RTM. (biomolecular interaction analysis,
instrument available from BIAcore International AB, Uppsala,
Sweden), KinExA.RTM. (Kinetic Exclusion Assay, available from
Sapidyne Instruments (Boise, Id.)) or other techniques known to
those of skill in the art.
[0090] r) Substantially Identical
[0091] The term "substantially identical," as used herein in
relation to a nucleic acid or amino acid sequence indicates that,
when optimally aligned, for example using the methods described
below, the nucleic acid or amino acid sequence shares at least
about 70% (e.g., from about 70% to about 100%), at least about 75%
(e.g., from about 75% to about 100%), at least about 80% (e.g.,
from about 80% to about 100%), at least about 85% (e.g., from about
85% to about 100%), at least about 90% (e.g., from about 90% to
about 100%), at least about 95% (e.g., from about 95% to about
100%), at least about 96% (e.g., from about 96% to about 100%), at
least about 97% (e.g., from about 97% to about 100%), at least
about 98% (e.g., from about 98% to about 100%), or at least about
99% (e.g., from about 99% to about 100%) sequence identity with a
defined second nucleic acid or amino acid sequence (or "reference
sequence"). "Substantial identity" can be used to refer to various
types and lengths of sequence, such as full-length sequence,
epitopes or immunogenic peptides, functional domains, coding and/or
regulatory sequences, exons, introns, promoters, and genomic
sequences. Percent identity between two amino acid or nucleic acid
sequences can be determined in various ways that are within the
skill of a worker in the art, for example, using publicly available
computer software such as Smith Waterman Alignment (Smith, T. F.
and M. S. Waterman (1981) J Mol Biol 147:195-7); "BestFit" (Smith
and Waterman, Advances in Applied Mathematics, 482-489 (1981)) as
incorporated into GeneMatcher Plus.TM. Schwarz and Dayhof (1979)
Atlas of Protein Sequence and Structure, Dayhof, M. O., Ed pp
353-358; BLAST program (Basic Local Alignment Search Tool
(Altschul, S. F., W. Gish, et al. (1990) J Mol Biol 215: 403-10),
and variations thereof including BLAST-2, BLAST-P, BLAST-N,
BLAST-X, WU-BLAST-2, ALIGN, ALIGN-2, CLUSTAL, and Megalign
(DNASTAR) software. In addition, those skilled in the art can
determine appropriate parameters for measuring alignment, including
algorithms needed to achieve maximal alignment over the length of
the sequences being compared. In general, for amino acid sequences,
the length of comparison sequences is at least about 10 amino
acids. One skilled in the art understands that the actual length
depends on the overall length of the sequences being compared and
can be at least about 20, at least about 30, at least about 40, at
least about 50, at least about 60, at least about 70, at least
about 80, at least about 90, at least about 100, at least about
110, at least about 120, at least about 130, at least about 140, at
least about 150, at least about 200, at least about 250, at least
about 300, or at least about 350 amino acids, or it can be the
full-length of the amino acid sequence. For nucleic acids, the
length of comparison sequences is generally at least about 25
nucleotides, but can be at least about 50, at least about 100, at
least about 125, at least about 150, at least about 200, at least
about 250, at least about 300, at least about 350, at least about
400, at least about 450, at least about 500, at least about 550, at
least about 600, at least about 650, at least about 700, at least
about 800, at least about 900, or at least about 1000 nucleotides,
or it can be the full-length of the nucleic acid sequence.
[0092] s) Surface Plasmon Resonance
[0093] The term "surface plasmon resonance" as used herein refers
to an optical phenomenon that allows for the analysis of real-time
biospecific interactions by detecting alterations in protein
concentrations within a biosensor matrix, for example using the
BIACORE.RTM. system (Biacore (GE Healthcare)) (Johnsson, B., et al.
1991. Immobilization of proteins to a carboxymethyldextran-modified
gold surface for biospecific interaction analysis in surface
plasmon resonance sensors. Anal Biochem. 198:268-77; Johnsson, B.,
et al. 1995. Comparison of methods for immobilization to
carboxymethyl dextran sensor surfaces by analysis of the specific
activity of monoclonal antibodies. J Mol Recognit. 8:125-31;
Jonsson, U., et al. 1993. Introducing a biosensor based technology
for real-time biospecific interaction analysis. Ann Biol Clin
(Paris). 51:19-26).
[0094] t) TCA
[0095] The abbreviation "TCA," as used herein, means "T. cruzi
antigen." FP3, Pep2, TcF, FP6, and FP10 refer to TCAs and are
further defined below. Other abbreviations are defined as they are
introduced.
[0096] The terminology used herein is for the purpose of describing
particular embodiments only and is not otherwise intended to be
limiting.
B. Anti-T. cruzi Antibodies and Cell Lines Producing Same
[0097] The present disclosure provides, among other things, novel
antibodies, cell lines producing these antibodies, and methods of
making these antibodies. These antibodies bind various T. cruzi
antigens (TCAs) and include those contained in the FP3, Pep2 (TcF,
FP6) and FP10 polypeptides, and can be used as mAbs, such as mouse
mAbs, dual-variable domain immunoglobulins (DVD-Ig.RTM.) or as
chimeric antibodies, such as mouse-human (Mu-Hu) chimeras. These
antibodies are useful as positive controls in immunoassays.
Furthermore, the antibodies can be used to purify T. cruzi
polypeptides that harbor the TCAs. Examples of antibodies and cell
lines of the present disclosure are presented below in Table 1.
TABLE-US-00001 TABLE 1 T. cruzi Antigens and antibody-producing
cell lines summary.sup.1 Antigen Hybridoma cell line CHO cell line
Antigen Cell Line ATCC Deposit* Cell Line ATCC Deposit* Name Name
Laboratory Name [Deposit Date] Name Laboratory Name [Deposit Date]
FP3 HBFP3 Chagas FP3 PTA-8139 CHOFP3 Chagas PTA-8136 12-392-150-110
[Jan. 24, 2007] FP3 12-392- [Jan. 24, 2007] 150CH02580-104 Pep2
HBPep2 Chagas PTA-8137 CHOPep2 Chagas Pep2 PTA-8138 (TcF, FP6)
9-638-132-115 [Jan. 24, 2007] 9-638-1928 [Jan. 24, 2007] FP10 HBF10
Chagas PTA-8141 CHOFP10 Chagas FP10 PTA-8140 10-745-140 [Jan. 24,
2007] 10-745-3796 [Jan. 24, 2007] .sup.1Another hybridoma cell
line, laboratory name Chagas 8-367-171 and producing a mAb that
binds recombinant FRA antigen, is deposited as PTA-8142 (also
deposited on Jan. 24, 2007). *All cell line deposits were made
under the Budapest Treaty on the International Recognition of the
Deposit of Microorganisms for the Purposes of Patent Procedure
(Budapest Treaty) of Apr. 28, 1977 and amended on Sep. 26, 1980.
American Type Culture Collection (ATCC); P.O. Box 1549; Manassas,
VA 20108; USA.
[0098] Further examples of antibodies of the present disclosure are
antibodies that: (a) that specifically binds to a diagnostically
relevant region of a T. cruzi polypeptide, wherein the T. cruzi
polypeptide is FRA and further wherein said antibody has at last
one binding constant selected from the group consisting of: an
association rate constant (k.sub.a) between about
7.0.times.10.sup.5M.sup.-1s.sup.-1 to about
7.0.times.10.sup.6M.sup.-1s.sup.-1, an dissociation rate constant
(k) between about 4.0.times.10.sup.-3 s.sup.-1 to about
3.0.times.10.sup.-1s.sup.-1 and an equilibrium dissociation
constant (K.sub.D) between about 5.7.times.10.sup.-10 M to about
4.3.times.10.sup.-7 M;
[0099] (b) that specifically binds to a diagnostically relevant
region of a T. cruzi polypeptide, wherein the T. cruzi polypeptide
is Pep2 and further wherein said antibody has at least one binding
constant selected from the group consisting of: an association rate
constant (k.sub.a) between about 1.0.times.10.sup.6M.sup.-1s.sup.-1
to about 8.0.times.10.sup.6M.sup.-1s.sup.-1; an dissociation rate
constant (k) between about 6.0.times.10.sup.-3 s.sup.-1 to about
4.0.times.10.sup.-2s.sup.-1 and an equilibrium dissociation
constant (K.sub.D) between about 7.5.times.10.sup.-10 M to about
4.0.times.10.sup.-8 M;
[0100] (c) that specifically binds to a diagnostically relevant
region of a T. cruzi polypeptide, wherein the T. cruzi polypeptide
is FP10 and further wherein said antibody has at least one binding
constant selected from the group consisting of: (a) an association
rate constant (k.sub.a) between about
5.0.times.10.sup.4M.sup.-1s.sup.-1 to about
3.0.times.10.sup.5M.sup.-1s.sup.-1: (b) an dissociation rate
constant (k.sub.d) between about 1.0.times.10.sup.-4s.sup.-1 to
about 8.0.times.10.sup.-4 s.sup.-1; and (c) an equilibrium
dissociation constant (K.sub.D) between about 3.3.times.10.sup.-10
M to about 1.6.times.10.sup.-8 M;
[0101] (d) that specifically binds to a diagnostically relevant
region of a T. cruzi polypeptide, wherein the T. cruzi polypeptide
is FP3 and further wherein said antibody has at least one binding
constant selected from the group consisting of: an association rate
constant (k.sub.a) between about 2.0.times.10.sup.5M.sup.-1s.sup.-1
to about 6.0.times.10.sup.6M.sup.-1s.sup.-1; an dissociation rate
constant (k) between about 2.0.times.10.sup.-5s.sup.-1 to about
8.0.times.10.sup.-4s.sup.-1; and an equilibrium dissociation
constant (K.sub.D) between about 3.3.times.10.sup.-12M to about
4.0.times.10.sup.-9 M; and
[0102] (e) any combinations of (a)-(d).
[0103] To make the anti-T. cruzi antibodies and cell lines
producing these antibodies as further described herein, generally a
two-step process was followed: (1) hybridoma cell lines were
developed that produced monoclonal antibodies that specifically
bound to the antigens of interest--the T. cruzi epitopes (TCAs);
and (2) chimeric antibodies were engineered using recombinant
technologies, and then mammalian expression cell lines were used to
produce the engineered antibodies. In this second part, after
identifying hybridoma cell lines that secreted the desired mAbs,
mRNA was isolated from these cells and the antibody gene sequences
were identified. The variable light (V.sub.L) and variable heavy
(V.sub.H) polynucleotide sequences were then cloned into pBOS
vectors (supplying the human antibody sequences) that were then
co-transfected in a transient expression system to confirm that the
resulting chimeric antibodies were functional. Upon confirmation,
the V.sub.L sequences were sub-cloned into the pJV plasmid, and the
V.sub.H sequences into the pBV plasmid; these vectors where then
used to construct a stable pBJ expression vector. CHO cells were
then transfected with pBJ, transfectants selected, and the secreted
antibodies tested again, allowing for industrial scale production.
Thus, the mouse V.sub.H and V.sub.L regions were combined with
human constant chain (CH) and constant light chain (CL) regions to
create exemplars of the chimeric antibodies of the disclosure.
Therefore, the chimeric antibodies retain the mouse mAb functional
specificity and affinity for the TCAs, but react in antibody assays
that are designed to detect human immunoglobulin (Ig). In one
embodiment, the disclosure is directed to monoclonal antibodies
(mAbs) that specifically bind the TCAs FP3, Pep2 (FP6/Tcf), FP10
and FRA. Mice are individually immunized with the FP3, Pep2, FP10
or FRA recombinant antigens, antibody-producing mice are identified
and euthanized, spleen cells are harvested and fused with myeloma
cells, and mAb producing hybridoma cell lines are isolated.
C. Immunodiagnostic Reagent
[0104] The immunodiagnostic reagent of the present disclosure
comprises one or more antibodies described herein (See, for
example, Sections B and E herein). For example the antibodies
comprising the immunodiagnostic reagent can include recombinant
antibodies, which also herein include recombinant chimeric
antibodies, that specifically bind to a diagnostically relevant
region of a T. cruzi protein. Therefore, in one embodiment, the
immunodiagnostic reagent provided by the present disclosure
comprises a single antibody capable of specifically binding a
diagnostically relevant region of a T. cruzi protein. In other
embodiments, the immunodiagnostic reagent provided by the present
disclosure comprises a single chimeric antibody capable of
specifically binding a diagnostically relevant region of a T. cruzi
protein. In other embodiments, the immunodiagnostic reagent
comprises a plurality of antibodies, which can include one or more
recombinant antibodies, such as a recombinant chimeric antibody,
each capable of specifically binding a diagnostically relevant
region of a T. cruzi protein (e.g., either the same region, or a
different region). One or more of the plurality of chimeric
antibodies can be capable of specifically binding a diagnostically
relevant region of the same T. cruzi protein. Alternatively, each
of the plurality of chimeric antibodies can specifically bind a
diagnostically relevant region of a different T. cruzi protein.
[0105] In one embodiment, of the present disclosure, the
immunodiagnostic reagent is capable of detecting a plurality of T.
cruzi antigens and optionally comprises two or more recombinant
antibodies, each capable of specifically binding a different T.
cruzi antigenic protein. In a further embodiment, the
immunodiagnostic reagent optionally comprises three or more
recombinant antibodies, each capable of specifically binding a
different T. cruzi antigenic protein. In another embodiment, the
immunodiagnostic reagent optionally comprises four or more
recombinant antibodies, each capable of specifically binding a
different T. cruzi antigenic protein.
[0106] The recombinant antibodies comprised by the immunodiagnostic
reagent can optionally be modified, for example, for detection
purposes, for immobilization onto a solid support, to improve
stability and/or to improve pharmacokinetic properties, or by other
means such as is known in the art.
D. T. cruzi Antigens
[0107] T. cruzi is a complex organism, with a complex life cycle.
However, important antigens have been identified that are useful
for the diagnostic detection of the parasite.
[0108] The FP3 antigen (Kirchhoff, L. V., and K. Otsu. U.S. Patent
Application Publication No. 2004/0132077. 2004) is a recombinant
protein the corresponds essentially to the combination of T. cruzi
Ag15 (Otsu, K., et al. 1993. Interruption of a Trypanosoma cruzi
gene encoding a protein containing 14-amino acid repeats by
targeted insertion of the neomycin phosphotransferase gene. Mol
Biochem Parasitol. 57:317-30) and T. cruzi Protein C, the latter
being a flagellar calcium binding protein (Gonzalez, A., et al.
1985. Apparent generation of a segmented mRNA from two separate
tandem gene families in Trypanosoma cruzi. Nucleic Acids Res.
13:5789-804). The polynucleotide sequence (SEQ ID NO.:1) and the
polypeptide sequence (SEQ ID NO.:2) are shown below in Tables 2 and
3, respectively. The amino acid sequences specific to T. cruzi
14-amino acid repeats are underlined in Table 3, those amino acids
corresponding to T. cruzi Protein A are in bold in Table 3, those
amino acids corresponding to Protein B are in italics in Table 3
and those amino acids corresponding to Protein C are twice
underscored in Table 3.
TABLE-US-00002 TABLE 2 FP3 polynucleotide sequence (SEQ ID NO.: 1)
ATGGCCCAGC TCCAACAGGC AGAAAATAAT ATCACTAATT CCAAAAAAGA AATGACAAAG
CTACGAGAAA AAGTGAAAAA GGCCGAGAAA GAAAAATTGG ACGCCATTAA CCGGGCAACC
AAGCTGGAAG AGGAACGAAA CCAAGCGTAC AAAGCAGCAC ACAAGGCAGA GGAGGAAAAG
GCTAAAACAT TTCAACGCCT TATAACATTT GAGTCGGAAA ATATTAACTT AAAGAAAAGG
CCAAATGACG CAGTTTCAAA TCGGGATAAG AAAAAAAATT CTGAAACCGC AAAAACTGAC
GAAGTAGAGA AACAGAGGGC GGCTGAGGCT GCCAAGGCCG TGGAGACGGA GAAGCAGAGG
GCAGCTGAGG CCACGAAGGT TGCCGAAGCG GAGAAGCGGA AGGCAGCTGA GGCCGCCAAG
GCCGTGGAGA CGGAGAAGCA GAGGGCAGCT GAAGCCACGA AGGTTGCCGA AGCGGAGAAG
CAGAAGGCAG CTGAGGCCGC CAAGGCCGTG GAGACGGAGA AGCAGAGGGC AGCTGAAGCC
ACGAAGGTTG CCGAAGCGGA GAAGCAGAGG GCAGCTGAAG CCATGAAGGT TGCCGAAGCG
GAGAAGCAGA AGGCAGCTGA GGCCGCCAAG GCCGTGGAGA CGGAGAAGCA GAGGGCAGCT
GAAGCCACGA AGGTTGCCGA AGCGGAGAAG CAGAAGGCAG CTGAGGCCGC CAAGGCCGTG
GAGACGGAGA AGCAGAGGGC AGCTGAAGCC ACGAAGGTTG CCGAAGCGGA GAAGCAGAAG
GCAGCTGAGG CCGCCAAGGC CGTGGAGACG GAGAAGCAGA GGGCAGCTGA AGCCACGAAG
GTTGCCGAAG CGGAGAAGGA TATCGATCCC ATGGGTGCTT GTGGGTCGAA GGACTCGACG
AGCGACAAGG GGTTGGCGAG CGATAAGGAC GGCAAGAACG CCAAGGACCG CAAGGAAGCG
TGGGAGCGCA TTCGCCAGGC GATTCCTCGT GAGAAGACCG CCGAGGCAAA ACAGCGCCGC
ATCGAGCTCT TCAAGAAGTT CGACAAGAAC GAGACCGGGA AGCTGTGCTA CGATGAGGTG
CACAGCGGCT GCCTCGAGGT GCTGAAGTTG GACGAGTTCA CGCCGCGAGT GCGCGACATC
ACGAAGCGTG CATTCGACAA GGCGAGGGCC CTGGGCAGCA AGCTGGAGAA CAAGGGCTCC
GAGGACTTTG TTGAATTTCT GGAGTTCCGT CTGATGCTGT GCTACATCTA CGACTTCTTC
GAGCTGACGG TGATGTTCGA CGAGATTGAC GCCTCCGGCA ACATGCTGGT TGACGAGGAG
GAGTTCAAGC GCGCCGTGCC CAGGCTTGAG GCGTGGGGCG CCAAGGTCGA GGATCCCGCG
GCGCTGTTCA AGGAGCTCGA TAAGAACGGC ACTGGGTCCG TGACGTTCGA CGAGTTTGCT
GCGTGGGCTT CTGCAGTCAA ACTGGACGCC GACGGCGACC CGGACAACGT GCCGGAGAGC
CCGAGACCGA TGGGAATC
TABLE-US-00003 TABLE 3 FP3 polypeptide sequence (SEQ ID NO.: 2)
MAQLQQAENN ITNSKKEMTK LREKVKKAEK EKLDAINRAT KLEEERNQAY KAAHKAEEEK
AKTFQRLITF ESENINLKKR PNDAVSNRDK KKNSETAKTD EV EKQRAAEAAKAVET
EKQRAAEATKVAEA EKRKAAEAAKAVET EKQRAAEATKVAEA EKQKAAEAAKAVET
EKQRAAEATKVAEA EKQRAAEAMKVAEA EKQKAAEAAKAVET EKQRAAEATKVAEA
EKQKAAEAAKAVET EKQRAAEATKVAEA EKQKAAEAAKAVET EKQRAAEATKVAEA
EKDIDPMGACGSKDST SDKGLASDKD GKNAKDRKEA WERIRQAIPR EKTAEAKQRR
IELFKKFDKN ETGKLCYDEV HSGCLEVLKL DEFTPRVRDI TKRAFDKARA LGSKLENKGS
EDFVEFLEFR LMLCYIYDFF ELTVMFDEID ASGNMLVDEE EFKRAVPRLE AWGAKVEDPA
ALFKELDKNG TGSVTFDEFA AWASAVKLDA DGDPDNVPES PRPMGI
[0109] The Pep2 antigen (Kirchhoff and Otsu, 2004) is a recombinant
protein of repeated sequences of T. cruzi. FP6 and Tcf, T. cruzi
polypeptides, both have the Pep2 antigen. The polynucleotide
sequence (SEQ ID NO.:3) and polypeptide sequence (SEQ ID NO.:4) is
shown in Tables 4 and 5, respectively.
TABLE-US-00004 TABLE 4 Pep2 polynucleotide sequence (SEQ ID NO.: 3)
GGTGACAAAC CATCACCATT TGGACAGGCC GCAGCAGGTG ACAAACCATC ACCATTTGGA
CAGGCC TABLE 5 Pep2 polypeptide sequence (SEQ ID NO.: 4) GDKPSPFGQA
AAGDKPSPFG QA
[0110] The FP10 antigen (Kirchhoff and Otsu, 2004) is another
recombinant protein of repeated sequences of T. cruzi. Its
polynucleotide (SEQ ID NO.:5) and polypeptide (SEQ ID NO.:6)
sequences are shown below in Tables 6 and 7, respectively. The
amino acid sequence of the I-domain is underlined in Table 7, the
amino acid sequence of the J-domain is in italics in Table 7, the
amino acid sequence of the K-domain is in bold in Table 7 and the
amino acid sequence of the L-domain are twice underscored in Table
7.
TABLE-US-00005 TABLE 6 FP10 polynucleotide sequence (SEQ ID NO.: 5)
GATCCAACGT ATCGTTTTGC AAACCACGCG TTCACGCTGG TGGCGTCGGT GACGATTCAC
GAGGTTCCGA GCGTCGCGAG TCCTTTGCTG GGTGCGAGCC TGGACTCTTC TGGTGGCAAA
AAACTCCTGG GGCTCTCGTA CGACGAGAAG CACCAGTGGC AGCCAATATA CGGATCAACG
CCGGTGACGC CGACCGGATC GTGGGAGATG GGTAAGAGGT ACCACGTGGT TCTTACGATG
GCGAATAAAA TTGGCTCCGT GTACATTGAT GGAGAACCTC TGGAGGGTTC AGGGCAGACC
GTTGTGCCAG ACGAGAGGAC GCCTGACATC TCCCACTTCT ACGTTGGCGG GTATGGAAGG
AGTGATATGC CAACCATAAG CCACGTGACG GTGAATAATG TTCTTCTTTA CAACCGTCAG
CTGAATGCCG AGGAGATCAG GACCTTGTTC TTGAGCCAGG ACCTGATTGG CACGGAAGCA
CACATGGGCA GCAGCAGCGG CAGCAGTGCC CACGGTACGC CCTCGATTCC CGTTGACAGC
AGTGCCCACG GTACACCCTC GACTCCCGTT GACAGCAGTG CCCACGGTAC GCCCTCGACT
CCCGTTGACA GCAGTGCCCA CGGTACACCC TCGACTCCCG TTGACAGCAG TGCCCACGGT
ACACCCTCGA CTCCCGTTGA CAGCAGTGCC CACGGTAAGC CCTCGACTCC CGCTGACAGC
AGTGCCCACA GTACGCCCTC GACTCCCGCT GACAGCAGTG CCCACAGTAC GCCCTCAATT
CCCGCTGACA GCAGTGCCCA CAGTACGCCC TCAGCTCCCG CTGACAACGG CGCCAATGGT
ACGGTTTTGA TTTTGTCGAC TCATGACGCG TACAGGCCCG TTGATCCCTC GGCGTACAAG
CGCGCCTTGC CGCAGGAAGA GCAAGAGGAT GTGGGGCCGC GCCACGTTGA TCCCGACCAC
TTCCGCTCGA CCTCGACGAC TCATGACGCG TACAGGCCCG TTGATCCCTC GGCGTACAAG
CGCGCCTTGC CGCAGGAAGA GCAAGAGGAT GTGGGGCCGC GCCACGTTGA TCCCGACCAC
TTCCGCTCGA CGACTCATGA CGCGTACAGG CCCGTTGATC CCTCGGCGTA CAAGCGCGCC
TTGCCGCAGG AAGAGCAAGA GGATGTGGGG CCGCGCCACG TTGATCCCGA CCACTTCCGC
TCGACCTCGA CGACTCATGA CGCGTACAGG CCCGTTGATC CCTCGGCGTA CAAGCGCGCC
TTGCCGCAGG AAGAGCAAGA GGATGTGGGG CCGCGCCACG TTGATCCCGA CCACTTCCGC
TCGACCTCGA CGACTCATGA CGCGTACAGG CCCGTTGATC CCTCGGCGTA CAAGCGCGCC
TTGCCGCAGG AAGAGCAAGA GGATGTGGGG CCGCGCCACG TTGATCCCGA CCACTTCCGC
TCGACGACTC ATGACGCGTA CAGGCCCGTT GATCCCTCGG CGTACAAGCG CGCCTTGCCG
CAGGAAGAGC AAGAGGATGT GGGGCCGCGC CACGTTGATC CCGACCACTT CCGCTCG
TABLE-US-00006 TABLE 7 FP10 polypeptide sequence (SEQ ID NO.: 6)
DPTYRFANHA FTLVASVTIH EVPSVASPLL GASLDSSGGK KLLGLSYDEK HQWQPIYGST
PVTPTGSWEM GKRYHVVLTM ANKIGSVYID GEPLEGSGQT VVPDERTPDI SHFYVGGYGR
SDMPTISHVT VNNVLLYNRQ LNAEEIRTLF LSQDLIGTEA HMGSSSG SSAHGTPSIPVD
SSAHGTPSTPVD SSAHGTPSTPVD SSAHGTPSTPVD SSAHGTPSTPVD SSAHGKPSTPAD
SSAHSTPSTPAD SSAHSTPSIPAD SSAHSTPSAPAD NGANGTV LILSTHDAYR
PVDPSAYKRA LPQEEQEDVG PRHVDPDHFR STSTTHDAYR PVDPSAYKRA LPQEEQEDVG
PRHVDPDHFR STTHDAYRPV DPSAYKRALP QEEQEDVGPR HVDPDHFRST STTHDAYRPV
DPSAYKRALP QEEQEDVGPR HVDPDHFRST STTHDAYRPV DPSAYKRALP QEEQEDVGPR
HVDPDHFRST THDAYRPVDP SAYKRALPQE EQEDVGPRHV DPDHFRS
[0111] The FRA antigen is a flagellar repetitive protein sequence
(Lafaille, J. J., etc. 1989. Structure and expression of two
Trypanosoma cruzi genes encoding antigenic proteins bearing
repetitive epitopes. Mol Biochem Parasitol. 35:127-36), GenBank
Accession J04015, is shown below in Table 8 (polynucleotide
sequence, SEQ ID NO.:7) and 9 (polypeptide sequence; SEQ ID
NO.:8).
TABLE-US-00007 TABLE 8 FRA polynucleotide sequence (SEQ ID NO.: 7)
ATGGAGTCAG GAGCGTCAGA TCAGCTGCTC GAGAAGGACC CGCGTCAGGA ACGCGAAGGA
GATTGCTGCG CTTGAGGAGA GTCATGAATG CCCGCGTCAT CAGGAGCTGG CGCGCGAGAA
GAAGCTTGCC GACCGCGCGT TCCTTGACTC AGAAGCCGGA GCGCGTGCCG CTGGCTGACG
TGCCGCTCGA CGACGATCAG CGACTTTGTT GCG
TABLE-US-00008 TABLE 9 FRA polypeptide sequence (SEQ ID NO.: 8)
MEQERRQLLE KDPRRNAKEI AALEESMNAR AQELAREKKL ADRAFLDQKP ERVPLADVPL
DDDSDFVA
[0112] The TCAs of SEQ ID NOs.:2, 4, 6 and 8 can be either
synthesized in vitro or expressed recombinantly from the
polynucleotide sequences, such as those substantially similar to
SEQ ID NOs.:1, 3, 5 and 7. Because of redundancy in the genetic
code and the ability for the polypeptides of SEQ ID NOs.:2, 4, 6
and 8 to tolerate substitutions, the sequences need not be
identical to practice the disclosure. Polynucleotide and
polypeptide sequence identities can range from about 70% to about
100% (especially from about from about 90% to about 97%), such as
about 70%, about 75%, about 80%, about 81%, about 82%, about 83%,
about 84%, about 85%, about 86%, about 87%, about 88%, about 89%,
about 90%, about 91%, about 92%, about 93%, about 94%, about 95%,
about 96%, about 97%, about 98%, about 99% and of course, about
100%.
[0113] The TCAs can be readily synthesized in vitro using
polypeptide chemistry. For example, polypeptide synthesis can be
carried out in a stepwise manner on a solid phase support using an
automated polypeptide synthesizer, such as a Rainin Symphony
Peptide Synthesizer, Advanced Chemtech Peptide Synthesizer,
Argonaut Parallel Synthesis System, or an Applied Biosystems
Peptide Synthesizer. The peptide synthesizer instrument combines
the Fmoc chemistry with HOBt/HBTU/DIEA activation to perform
solid-phase peptide synthesis.
[0114] Synthesis starts with the C-terminal amino acid, wherein the
carboxyl terminus is covalently linked to an insoluble polymer
support resin. Useful resins can load 0.1 mmol to 0.7 mmol of
C-terminal amino acid per gram of resin; display resistance to the
various solvents and chemicals used during a typical synthetic
cycle, such as dichloromethane (DCM), N,N-dimethylformamide (DMF),
N-methylpyrrolidone (NMP), N,N-dimethylamine (DMA),
1-Hydroxybenzotriazole (HOBt),
2-(1-H-Benzotriazol-1-yl)-1,1,3,3-tetramethyluronium
hexafluorophosphate (HBTU), N,N-di-isopropylethylamine (DIEA),
methanol (MeOH), or water; and be amenable to continuous flow or
batch synthesis applications. Examples of useful resins include
p-Benzyloxybenzyl Alcohol resin (HMP resin), PEG co-Merrifield
resin, NovaSyn TGA.RTM. resin (Novabiochem), 4-sulfamylbutyryl AM
resin, and CLEAR amide resin. Amino acid-coupled resins are
commercially available from a number of different sources, although
such coupled resins can also be prepared in the lab.
[0115] The N-terminus of the resin-coupled amino acid (or
polypeptide) is chemically-protected by a
9-flourenylmethloxycarbonyl (Fmoc) group that is removed prior to
the addition of the next N-terminal amino acid reactant. The Fmoc
group is a base labile protecting group that is easily removed by
concentrated solutions of amines, such as 20-55% piperidine, in a
suitable solvent, such as NMP or DMF. Other useful amines for Fmoc
deprotection include tris (2-aminoethyl) amine,
4-(aminomethyl)piperidine, tetrabutylammonium fluoride, and
1,8-diazabicyclo[5.4.0]undec-7-ene (DBU). Complete removal of the
Fmoc group from the N-terminus is important so that all
resin-coupled polypeptide chains effectively participate in each
coupling cycle; otherwise, polypeptide chains of heterogeneous
length and sequence will result. Following base-catalyzed removal
of the Fmoc group, the resin is extensively washed with a suitable
buffer to remove the base catalyst.
[0116] The side chains of many amino acids contain chemically
reactive groups, such as amines, alcohols, or thiols. These side
chains must be additionally protected to prevent undesired
side-reactions during the coupling step. Side chain protecting
groups that are base-stable, more preferably, both base-stabile and
acid-labile are most useful. Table 10 provides an exemplary set of
side chain protection groups for this category of amino acids.
TABLE-US-00009 TABLE 10 Side chain protection reagents Side chain
protection Amino acid t-butyl ether Ser, Thr, Tyr; t-butyl ester
Glu and Asp Trityl Cys, His, Asn, and Gln
2,2,5,7,8-pentamethylchromane-6- Arg sulfonyl butoxycarbonyl (tBoc)
Lys
[0117] The carboxylate group of the incoming Fmoc-protected amino
acid is activated in order to achieve efficient chemical coupling
to the N-terminus of the resin-bound polypeptide. Activation is
typically accomplished by reacting an Fmoc-protected amino acid
with a suitable reagent to yield a reactive ester. Examples of
activated esters include the pentafluorophenyl (OPfp) ester and the
3-hydroxy-2,3-dihydro-4-oxo-benzo-triazone (ODhbt) ester, OBt
ester, and the OAt ester derived from 1-hydroxy-7-azabenzotriazole
(HOAt). The coupling reactions can be done in situ using activating
reagents, such as DCC, BOP, BOP-Cl, TBTU, HBTU or
O-(7-azabenzotrizol-1-yl)-1,1,3,3, tetramethyluronium
hexafluorophosphate (HATU). Exemplary coupling reactions included a
mixture of HOBt and HBTU, or a mixture of HOBt, HBTU, and DIEA. For
N-methyl amino acids, coupling conditions can use
bromo-tris-pyrrolidino-phosphonium hexafluorophosphate (PyBroP) as
the only coupling reagent, and the coupling reaction is performed
manually in DCM with DIEA present under N.sub.2. The Fmoc-protected
amino acid is present in molar excess to the polypeptide coupled to
the resin. For coupling reactions that proceed with a slow rate,
the coupling reactions are repeated one or more times (double or
multiple coupling) to ensure that all resin-bound polypeptide has
undergone a successful addition reaction with the activated
Fmoc-amino acid. For incomplete coupling reactions, any un-reacted
N-terminal residues are capped using a suitable capping
reagent.
[0118] Following the coupling reaction, the resin support is washed
to remove the unreacted Fmoc-amino acids and coupling reagents. The
resin is then subjected to a new cycle of base-catalyzed removal of
the N-terminal Fmoc group to prepare the polypeptide for another
amino acid addition. After the desired polypeptide has been
synthesized, the resin is subjected to base-catalyzed removal of
the remaining Fmoc protection group. The polypeptide-coupled resin
is washed to remove the base and subsequently treated with acid to
remove any amino acid side chain protecting groups and to release
the polypeptide chain from the resin support. Useful acids are
strong acids, such as trifluoroacetic acid (TFA) in the presence of
suitable scavengers, such as reagent K
[TFA:thioanisole:ethanedithiol:phenol:water (82.5:5:2.5:5:5)].
[0119] The polypeptide is subsequently separated from the resin by
filtration and optionally washed repeatedly with a suitable
solvent, such as DCM/DMF. The polypeptide can be optionally
desalted through ultrafiltration using a membrane with a suitable
MW cutoff. The polypeptide can be precipitated from solution using
a suitable solvent, such as cold methyl t-butyl ether or
t-butylethylether, and the precipitate optionally washed with a
suitable solvent, such as cold ether and dried. The polypeptide can
be further purified using a suitable chromatographic means, such as
hydrophobic chromatography using a C18 resin and an appropriate
chromatographic buffer system, such as TFA/water/acetonitrile. The
purity of the peptide optionally can be analyzed by mass
spectrometry, such as MALDI-MS, analytical HPLC, amino acid
analysis or sequencing.
[0120] Alternatively, the TCAs of SEQ ID NOs.:2, 4, 6, and 8 can be
expressed recombinantly using the polynucleotide sequences of SEQ
ID NOs.:1, 3, 5 and 7 using, for example, expression vectors. In
expression vectors, the introduced DNA is operably-linked to
elements, such as promoters, that signal to the host cell to
transcribe the inserted DNA. Some promoters are exceptionally
useful, such as inducible promoters that control gene transcription
in response to specific factors. Examples of inducible promoters
include those that are tissue-specific, which relegate expression
to certain cell types, steroid-responsive (e.g., glucocorticoids
(Kaufman, R. J. 1990. Vectors used for expression in mammalian
cells. Methods Enzymol. 185:487-511) and tetracycline, or
heat-shock reactive. Some bacterial repression systems, such as the
lac operon, can be exploited in mammalian cells and transgenic
animals (Fieck, A., et al. 1992. Modifications of the E. coli lac
repressor for expression in eukaryotic cells: effects of nuclear
signal sequences on protein activity and nuclear accumulation.
Nucleic Acids Res. 20:1785-91; Wyborski, D. L., L. C. DuCoeur, and
J. M. Short. 1996). Parameters affecting the use of the lac
repressor system in eukaryotic cells and transgenic animals.
Environ Mol Mutagen. 28:447-58; Wyborski, D. L., and J. M. Short.
1991. Analysis of inducers of the E. coli lac repressor system in
mammalian cells and whole animals. Nucleic Acids Res. 19:4647-53).
Recombinant nucleic acid technologies, transfection into cells and
cellular and in vitro expression are discussed further below.
E. Recombinant Antibodies
[0121] The recombinant antibodies of the present disclosure
comprise antigen-binding regions derived from the V.sub.H and/or
V.sub.L domains of a native antibody capable of specifically
binding to a T. cruzi antigenic protein. The recombinant antibody
can be, for example, a recombinantly-produced monoclonal antibody,
a fragment of a monoclonal antibody, a chimeric antibody, a
humanized antibody, a multispecific, dual-variable domain
immunoglobulins (DVD-Ig.RTM.) or multivalent structure formed from
an antibody fragment, or a bifunctional antibody.
[0122] In one embodiment, optionally, the recombinant antibody is
an antibody that:
[0123] (a) that specifically binds to a diagnostically relevant
region of a T. cruzi polypeptide, wherein the T. cruzi polypeptide
is FRA and further wherein said antibody has at last one binding
constant selected from the group consisting of: an association rate
constant (k.sub.a) between about 7.0.times.10.sup.5M.sup.-1s.sup.-1
to about 7.0.times.10.sup.6M.sup.-1s.sup.-1, an dissociation rate
constant (k.sub.d) between about 4.0.times.10.sup.-3 s.sup.-1 to
about 3.0.times.10.sup.-1s.sup.-1 and an equilibrium dissociation
constant (K.sub.D) between about 5.7.times.10.sup.-10 M to about
4.3.times.10.sup.-7 M;
[0124] (b) that specifically binds to a diagnostically relevant
region of a T. cruzi polypeptide, wherein the T. cruzi polypeptide
is Pep2 and further wherein said antibody has at least one binding
constant selected from the group consisting of: an association rate
constant (k.sub.a) between about 1.0.times.10.sup.6M.sup.-1s.sup.-1
to about 8.0.times.10.sup.6M.sup.-1s.sup.-1; an dissociation rate
constant (k.sub.d) between about 6.0.times.10.sup.-3 s.sup.-1 to
about 4.0.times.10.sup.-2s.sup.-1 and an equilibrium dissociation
constant (K.sub.D) between about 7.5.times.10.sup.-10 M to about
4.0.times.10.sup.-8 M;
[0125] (c) that specifically binds to a diagnostically relevant
region of a T. cruzi polypeptide, wherein the T. cruzi polypeptide
is FP10 and further wherein said antibody has at least one binding
constant selected from the group consisting of: (a) an association
rate constant (k.sub.a) between about 5.0.times.10.sup.4
M.sup.-1s.sup.-1 to about 3.0.times.10.sup.5M.sup.-1s.sup.-1: (b)
an dissociation rate constant (k.sub.d) between about
1.0.times.10.sup.-4s.sup.-1 to about 8.0.times.10.sup.-4 s.sup.-1;
and (c) an equilibrium dissociation constant (K.sub.D) between
about 3.3.times.10.sup.-10 M to about 1.6.times.10.sup.-8 M;
[0126] (d) that specifically binds to a diagnostically relevant
region of a T. cruzi polypeptide, wherein the T. cruzi polypeptide
is FP3 and further wherein said antibody has at least one binding
constant selected from the group consisting of: an association rate
constant (k.sub.a) between about 2.0.times.10.sup.5M.sup.-1s.sup.-1
to about 6.0.times.10.sup.6M.sup.-1s.sup.-1; an dissociation rate
constant (k.sub.d) between about 2.0.times.10.sup.-5s.sup.-1 to
about 8.0.times.10.sup.-4s.sup.-1; and an equilibrium dissociation
constant (K.sub.D) between about 3.3.times.10.sup.-12M to about
4.0.times.10.sup.-9 M; and
[0127] (e) any combinations of (a)-(d). In another embodiment,
optionally, the recombinant antibody is a chimeric antibody that
retains the mouse monoclonal antibody specificity and affinity and
reacts in an immunoassay format that measures human immunoglobulin.
Optionally, the mouse-human chimeric antibody is directed against
the FP3, FP6, FP10 or FRA antigen. Optionally, such a chimeric
antibody reacts in an existing immunoassay format including, but
not limited to, Abbott Laboratories' AxSYM.RTM., ARCHITECT.RTM. and
PRISM.RTM. platforms.
[0128] The antigen-binding region comprised by the recombinant
antibody can include the entire V.sub.H and/or V.sub.L sequence
from the native antibody, or it can comprise one or more portions
thereof, such as the CDRs, together with sequences derived from one
or more other antibodies. In one embodiment, the recombinant
antibody comprises the full-length V.sub.H and V.sub.L sequences of
the native antibody.
[0129] The native antibody from which the antigen-binding regions
are derived is generally a vertebrate antibody. For example, the
native antibody can be a rodent (e.g., mouse, hamster, rat)
antibody, a chicken antibody, a rabbit antibody, a canine antibody,
a feline antibody, a bovine antibody, an equine antibody, a porcine
antibody, an ape (e.g., chimpanzee) antibody, or a human antibody.
The source of the antibody is based primarily on convenience. In
one embodiment, the native antibody is a non-human antibody.
[0130] The recombinant antibody also can include one or more
constant regions, for example, the C.sub.L, C.sub.H1, hinge,
C.sub.H2, C.sub.H3, and/or C.sub.H4 regions, derived from the same
native antibody or from a different antibody. The constant
region(s) can be derived from an antibody from one of a number of
vertebrate species, including but not limited to, those listed
above. In one embodiment, of the present disclosure, the
recombinant antibody comprises at least one constant region. In
another embodiment, the recombinant antibody comprises one or more
constant regions that are derived from a human antibody. In a
specific embodiment of the present disclosure, the recombinant
antibody comprises the variable region of a non-human antibody
linked to the constant region of a human antibody.
[0131] The constant region(s) comprised the recombinant antibody
can be derived from one or more immunoglobulin classes or isotypes,
for example for constant regions derived from human
immunoglobulins, the constant region can be derived from one or
more of an IgM, IgD, IgG1, IgG2, IgG3, IgG4, IgA1, IgA2 or IgE
constant region. When the constant region comprises a region
derived from an IgG light chain, this can be derived from a kappa
chain or a lambda chain. The recombinant antibody can comprise
sequences from more than one class or isotype. Selection of
particular constant domains to optimize the desired function of the
recombinant antibody is within the ordinary skill in the art. In
one embodiment, of the present disclosure, the recombinant antibody
comprises one or more constant domains derived from an IgG. In
another embodiment, the recombinant antibody comprises regions from
both the heavy and light chains of an IgG constant domain.
[0132] In one embodiment, of the present disclosure, the
antigen-binding regions are derived from a native antibody that
specifically binds to an epitope within a diagnostically relevant
region of a T. cruzi antigenic protein.
[0133] In a specific embodiment of the present disclosure, the
antigen-binding regions of the recombinant antibody comprise an
amino acid sequence substantially identical to all or a portion of
the V.sub.H or V.sub.L sequence as set forth in any one of SEQ ID
NOs.:10, 12, 14, 16, 18, 20, 26 or 28 (See, Table 12 below; See,
Table 11 below for a summary of SEQ ID NO identifiers and the
corresponding sequence descriptions). In another embodiment, the
antigen-binding regions of the recombinant antibody comprise the
complementarity determining regions (CDRs; i.e., CDR1, CDR2 and
CDR3) of a V.sub.H or V.sub.L sequence.
TABLE-US-00010 TABLE 11 Summary of SEQ ID NOs.: for V.sub.L and
V.sub.H chains V.sub.L V.sub.L V.sub.H V.sub.H Poly- Poly- Poly-
Poly- Antigen Cell line nucleotide peptide nucleotide peptide FP3
HBFP3 9 10 11 12 FP6 HBPep2 13 14 15 16 (TcF/Pep2) FP10 HBFP10 17
18 19 20 FRA 8-367-171 25 26 27 28
TABLE-US-00011 TABLE 12 Exemplary V.sub.H and V.sub.L Polypeptide
Sequences SEQ ID V.sub.H or NO.: Sequence V.sub.L TCA 10 YIVMSQSPSS
LAVSAGEKVT MSCKSSQSLL NSRTRKNHLA V.sub.L FP3 WYQQKPGQSP KLLIYWASTR
ESGVPDRFTG SGSGTDFALT ISSVQAEDLA VYFCKQSYNL YTFGAGTKLE LK 12
DVQLVESGGG LVQPGGSRKL SCAASGFTFS VFGMHWVRQA V.sub.H FP3 PEKGLEWVAY
ISSGSTIIYY ADTVKGRFTI SRDNPKNTLF LQMTGLRSED TAMYYCARPL YYDYDDYAMD
YWGQGTSVTV SS 14 DIVMSQSPSS LAVSAGEQVT MSCKSSQSLF NSRTRKNYLA
V.sub.L FP6 WYQQKPGQSP KLLIYWASTR ESGVPDRFTG SGSGTDFILT ISSVQAEDLA
VYYCKQSYNL LTFGAGTKLE LK 16 QVQLQQPGAE LVRPGASVKL SCKASGYTFT
SYWMNWVKLR V.sub.H FP6 PGQGLEWIGM IDPSDSETYY DQVFKDKATL TVDKSSSTAY
MHLSSLTSED SAVYYCARWI TTDSYTMDYW GQGTSVTVSS 18 DVVMTQTPLS
LPVSLGDQAS ISCRSSQSLV HSNGNTYLHW V.sub.L FP10 YLQKPGQSPK LLIYKVSNRF
SGVPDRFSGS GSGTDFTLKI SRVEAEDLGV YFCSQSTHVP PTFGGGTKLE IK 20
QVQLQQPGAE LVKPGASVKM SCKASGYTFT SYWVHWVKQR V.sub.H FP10 PGQGLEWIGV
IDPSDSYTSY NQKFKGKATL TVDTSSSTAY MQLSSLTSED SAVYYCTRHY DFDSWYFDVW
GAGTIVIVSS 26 DIQMDQSPSS LSASLGDTIT ITCHASQNIN VWLSWYQQKP V.sub.L
FRA GNIPKLLIYK ASNLHTGVPS RFSGSGSGTG FTLTISSLQP EDIATYYCQQ
GQSYPLITGS GRKLEIK 28 EVQLQQSGAE LVKPGASVKL SCHASGENIK DTYMHWVKQR
V.sub.H FRA PEQGLEWIGR IDPANGNTKY DPKFQGKATI TTDTSSNTAY LQLSSLTSED
TAVYYCATSY YGNYVAYWGH GILVIVSA
[0134] In one embodiment, of the present disclosure, the
antigen-binding regions of the recombinant antibody comprise an
amino acid sequence substantially identical to all or a portion of
the amino acid sequence encoded by any one of SEQ ID NOs.:9, 11,
13, 15, 17, 19, 25 or 27 (See, Table 13, below). In another
embodiment, the antigen-binding regions of the recombinant antibody
comprise a nucleic acid sequence encoding the complementarity
determining regions (CDRs; i.e., CDR1, CDR2 and CDR3) of a V.sub.H
or V.sub.L sequence. In a specific embodiment, the antigen-binding
regions of the recombinant antibody comprise CDRs having an amino
acid sequence substantially identical to the amino acid sequences
encoded by one or more of SEQ ID NOs.:9 and 11; one or more of SEQ
ID NOs.:13 and 15; or one or more of SEQ ID NOs.:17 and 19; or one
or more of SEQ ID NOs.:25 or 27 (See, Table 13, below).
[0135] In another specific embodiment of the present disclosure,
the antigen-binding regions of the recombinant antibody comprise an
amino acid sequence encoded by a nucleic acid sequence
substantially identical to all or a portion of the sequence as set
forth in any one of SEQ ID NOs.:9, 11, 13, 15, 17, 19, 25 or
27.
TABLE-US-00012 TABLE 13 Exemplary Nucleic Acid Sequences Encoding
V.sub.H and V.sub.L Sequences SEQ ID V.sub.H or NO.: Sequence
V.sub.L TCA 9 TACATTGTGA TGTCACAGTC TCCATCCTCC CTGGCTGTGT VL FP3
CAGCAGGAGA GAAGGTCACT ATGAGCTGCA AATCCAGTCA GAGTCTGCTC AACAGTAGAA
CCCGAAAGAA CCACTTGGCT TGGTATCAGC AGAAACCAGG GCAGTCTCCT AAACTGCTGA
TCTACTGGGC ATCCACTAGG GAATCTGGGG TCCCTGATCG CTTCACAGGC AGTGGATCTG
GGACAGATTT CGCTCTCACC ATCAGCAGTG TGCAGGCTGA AGACCTGGCA GTTTATTTCT
GCAAGCAATC TTATAATCTG TACACATTCG GTGCTGGGAC CAAGCTGGAG CTGAAA 11
GATGTGCAGC TGGTGGAGTC TGGGGGAGGC TTAGTGCAGC V.sub.H FP3 CTGGAGGGTC
CCGGAAACTC TCCTGTGCAG CCTCTGGATT CACTTTCAGT GTCTTTGGAA TGCACTGGGT
TCGTCAGGCT CCAGAGAAGG GGCTGGAGTG GGTCGCATAC ATTAGTAGTG GCAGTACTAT
CATCTATTAT GCAGACACAG TGAAGGGCCG ATTCACCATC TCCAGAGACA ATCCCAAGAA
CACCCTGTTC CTGCAAATGA CCGGTCTAAG GTCTGAGGAC ACGGCCATGT ATTACTGTGC
AAGACCGCTC TACTATGATT ACGACGACTA TGCTATGGAC TACTGGGGTC AAGGAACCTC
AGTCACCGTC TCCTCA 13 GACATTGTGA TGTCACAGTC TCCATCCTCC CTGGCTGTGT
V.sub.L FP6 CAGCAGGAGA GCAGGTCACT ATGAGCTGCA AATCCAGTCA GAGTCTGTTC
AACAGTAGAA CCCGAAAGAA CTACTTGGCT TGGTACCAGC AGAAACCAGG GCAGTCTCCT
AAACTGCTGA TCTACTGGGC ATCCACTAGG GAATCTGGGG TCCCTGATCG CTTCACAGGC
AGTGGATCTG GGACAGATTT CACTCTCACC ATCAGCAGTG TGCAGGCTGA AGACCTGGCA
GTTTATTACT GCAAACAATC TTATAATCTG CTCACGTTCG GTGCTGGGAC CAAGCTGGAG
CTGAAA 15 CAGGTCCAAC TGCAGCAGCC TGGGGCTGAA CTGGTGAGGC V.sub.H FP6
CTGGGGCTTC AGTGAAACTGTCCTGCAAGG CTTCTGGCTA CACCTTCACC AGCTACTGGA
TGAACTGGGT GAAGTTGAGG CCTGGACAAG GCCTTGAATG GATTGGTATG ATTGATCCTT
CAGACAGTGA AACTTACTAC GATCAAGTAT TCAAGGACAA GGCCACATTG ACTGTTGACA
AATCCTCCAG CACAGCCTAC ATGCATCTCA GCAGCCTGAC ATCTGAGGAC TCTGCGGTCT
ATTACTGTGC AAGATGGATT ACGACTGATT CCTATACTAT GGACTACTGG GGTCAAGGAA
CCTCAGTCAC CGTCTCCTCA 17 GATGTTGTGA TGACCCAAAC TCCACTCTCC
CTGCCTGTCA V.sub.L FP10 GTCTTGGAGA TCAAGCCTCC ATCTCTTGCA GATCTAGTCA
GAGCCTTGTA CACAGTAATG GAAACCCTAT TTACATTGGT ACCTGCAGAA GCCAGGCCAG
TCTCCAAAGC TCCTGATCTA CAAAGTTTCC AACCGATTTT CTGGGGTCCC AGACAGGTTC
AGTGGCAGTG GATCAGGGAC AGATTTCACA CTCAAGATCA GCAGAGTGGA GGCTGAGGAT
CTGGGAGTTT ATTTCTGCTC TCAAAGTACA CATGTTCCTC CGACGTTCGG TGGAGGCACC
AAGCTGGAAA TCAAA 19 CAGGTCCAAC TGCAGCAGCC TGGGGCTGAG CTGGTGAAGC
V.sub.H FP10 CTGGGGCTTC AGTGAAGATG TCCTGCAAGG CTTCTGGCTA CACCTTCACC
AGCTACTGGG TGCACTGGGT GAAGCAGAGG CCTGGACAAG GCCTTGAGTG GATCGGAGTG
ATTGATCCTT CTGATAGTTA TACTAGCTAC AATCAAAAGT TCAAGGGCAA GGCCACATTA
CTGTAGACAC ATCCTCCAGC ACAGCCTACA TGCAGCTCAG CAGCCTGACA TCTGAGGACT
CTGCGGTCTA TTACTGTACA AGACACTATG ATTTCGACAG CTGGTACTTC GATGTCTGGG
GCGCAGGGAC CACGGTCACC GTCTCCTCA 25 gacatccaga tggaccagtc tccatccagt
ctgtctgcat V.sub.L FRA cccttggaga cacaattacc atcacttgcc atgccagtca
gaacattaat gtttggttaa gctggtacca gcagaaacca ggaaatattc ctaaactatt
gatctataag gcttccaact tgcacacagg cgtcccatca aggtttagtg gcagtggatc
tggaacaggt ttcacattaa ccatcagcag cctgcagcct gaagacattg ccacttacta
ctgtcaacag ggtcaaagtt atcctctcac gttcggctcg gggcgaaagt tggaaataaa a
27 gaggttcagc tgcagcagtc tggggcagag cttgtgaagc V.sub.H FRA
caggggcctc agtcaagttg tcctgcacag cttctggctt caacattaaa gacacctata
tgcactgggt gaagcagagg cctgaacagg gcctggagtg gattggaagg attgatcctg
cgaatggtaa tactaaatat gacccgaagt tccagggcaa ggccactata acaacagaca
catcctccaa cacagcctac ctgcagctca gcagcctgac atctgaggac actgccgtct
attactgtgc tacctcctac tatggtaact acgttgctta ctggggccac gggactctgg
tcactgtctc tgca
[0136] The amino acid sequence of recombinant antibody need not
correspond precisely to the parental sequences, i.e., it can be a
"variant sequence." For example, depending in the domains comprised
by the recombinant antibody, one or more of the V.sub.L, V.sub.H,
C.sub.L, C.sub.H1, hinge, C.sub.H2, C.sub.H3, and C.sub.H4, as
applicable, can be mutagenized by substitution, insertion or
deletion of one or more amino acid residues so that the residue at
that site does not correspond to either the parental (or reference)
sequence. One skilled in the art will appreciate, however, that
such mutations will not be extensive and will not significantly
affect binding of the recombinant antibody to its target TCA. In
accordance with the present disclosure, when a recombinant antibody
comprises a variant sequence, the variant sequence is at least
about 70% (e.g., from about 70% to about 100%) identical to the
reference sequence. In one embodiment, the variant sequence is at
least about 75% (e.g., from about 75% to about 100%) identical to
the reference sequence. In other embodiments, the variant sequence
is at least about 80% (e.g., from about 80% to about 100%), at
least about 85% (e.g., from about 85% to about 100%), or at least
about 90% (e.g., from about 90% to about 100%) identical to the
reference sequence. In a specific embodiment, the reference
sequence corresponds to a sequence as set forth in any one of SEQ
ID NOs.:10, 12, 14, 16, 18,20, 26 or 28.
[0137] Generally, when the recombinant antibody comprises a variant
sequence that contains one or more amino acid substitutions, they
are "conservative" substitutions. A conservative substitution
involves the replacement of one amino acid residue by another
residue having similar side chain properties. As is known in the
art, the twenty naturally occurring amino acids can be grouped
according to the physicochemical properties of their side chains.
Suitable groupings include alanine, valine, leucine, isoleucine,
proline, methionine, phenylalanine and tryptophan (hydrophobic side
chains); glycine, serine, threonine, cysteine, tyrosine,
asparagine, and glutamine (polar, uncharged side chains); aspartic
acid and glutamic acid (acidic side chains) and lysine, arginine
and histidine (basic side chains). Another grouping of amino acids
is phenylalanine, tryptophan, and tyrosine (aromatic side chains).
A conservative substitution involves the substitution of an amino
acid with another amino acid from the same group.
[0138] Thus, the present disclosure in other embodiments further
provides isolated polypeptides corresponding to novel recombinant
antibody sequences disclosed herein. Optionally the isolated
polypeptide comprises a portion of a recombinant (e.g., chimeric)
antibody that specifically binds to a diagnostically relevant
region of a TCA selected from the group consisting of FP3, FP6, and
FP10. In one embodiment, the polypeptide comprises a V.sub.H region
selected from the group consisting of a V.sub.H region comprising
an amino acid sequence substantially identical to the sequence as
set forth in any one or more of SEQ ID NOs.:12, 16,20 or 28. In
still another embodiment, the polypeptide comprises a V.sub.H
region comprising complementarity determining region sequences. In
another embodiment, the polypeptide comprises a V.sub.L region
comprising an amino acid sequence that is substantially identical
to the sequence as set forth in any one or more of SEQ ID NOS.:10,
14,18 or 26. In still another embodiment, the polypeptide comprises
a V.sub.L region comprising complementarity determining region
sequences.
[0139] In still another embodiment, the polypeptide comprises a
V.sub.H region selected from the group consisting of a V.sub.H
region comprising an amino acid sequence substantially identical to
the sequence encoded by any one or more of SEQ ID NOs.:11, 15,19 or
27. In another embodiment, the polypeptide comprises a V.sub.L
region selected from the group consisting of a V.sub.L region
comprising an amino acid sequence substantially identical to the
sequence encoded by any one or more of SEQ ID NOs.:9, 13,17 or
25.
[0140] Likewise, the nucleic acid sequence encoding the variable
region(s) need not correspond precisely to the parental reference
sequence but can vary by virtue of the degeneracy of the genetic
code and/or such that it encodes a variant amino acid sequence as
described above. In one embodiment, of the present disclosure,
therefore, the nucleic acid sequence encoding a variable region of
the recombinant antibody is at least about 70% (e.g., from about
70% to about 100%) identical to the reference sequence. In another
embodiment, the nucleic acid sequence encoding a variable region of
the recombinant antibody is at least about 75% (e.g., from about
75% to about 100%) identical to the reference sequence. In other
embodiments, the nucleic acid sequence encoding a variable region
of the recombinant antibody is at least about 80% (e.g., from about
80% to about 100%), at least about 85% (e.g., from about 85% to
about 100%), or at least about 90% (e.g., from about 90% to about
100%) identical to the reference sequence. In a specific
embodiment, the reference sequence corresponds to a sequence as set
forth in any one of SEQ ID NOs.:9, 11, 13, 15, 17,19 25 or 27.
[0141] Thus, the present disclosure in other embodiments further
provides isolated polynucleotides which encode novel recombinant
antibody sequences, including chimerical antibody sequences,
disclosed herein. Optionally, the isolated polynucleotide encodes a
portion of a recombinant (e.g., chimeric) antibody that
specifically binds to a diagnostically relevant region of a T.
cruzi protein selected from the group consisting of FP3, FP6 and
FP10 protein. In one embodiment, the polynucleotide encodes a
V.sub.H region selected from the group consisting of a V.sub.H
region comprising an amino acid sequence substantially identical to
the sequence as set forth in any one or more of SEQ ID NOs.:12, 16,
20 or 28. In another embodiment the polynucleotide encodes a
V.sub.L region comprising an amino acid sequence that is
substantially identical to the sequence as set forth in any one or
more of SEQ ID NOs.:10, 14,18 or 26. In still another embodiment,
the polynucleotide encodes a V.sub.L region comprising
complementarity determining region sequences.
[0142] In still another embodiment, the polynucleotide encodes a
V.sub.H region selected from the group consisting of a V.sub.H
region comprising an amino acid sequence substantially identical to
the sequence encoded by any one or more of SEQ ID NOs.:9, 13,17 or
27. In yet another embodiment, the polynucleotide encodes a V.sub.H
region comprising complementarity determining region sequences. In
another embodiment, the polynucleotide encodes a V.sub.L region
selected from the group consisting of a V.sub.L region comprising
an amino acid sequence substantially identical to the sequence
encoded by any one or more of SEQ ID NOs.:11, 15, 19 or 25. In
still yet another embodiment, the polynucleotide encodes a V.sub.L
region comprising complementarity determining region sequences.
[0143] In one embodiment, the antibodies can be further modified to
reduce the immunogenicity to a human relative to the native
antibody by mutating one or more amino acids in the non-human
portion of the antibody that are potential epitopes for human
T-cells in order to eliminate or reduce the immunogenicity of the
antibody when exposed to the human immune system. Suitable
mutations include, for example, substitutions, deletions and
insertions of one or more amino acids.
[0144] In one embodiment, the recombinant antibodies of the present
disclosure can be further modified for immobilization onto a
suitable solid phase Immobilization can be achieved through
covalent or non-covalent (for example, ionic, hydrophobic, or the
like) attachment to the solid phase. Suitable modifications are
known in the art and include the addition of a functional group or
chemical moiety to either the C-terminus or the N-terminus of one
of the amino acid sequences comprised by the recombinant antibody
to facilitate cross-linking or attachment of the recombinant
antibody to the solid support. Exemplary modifications include the
addition of functional groups such as S-acetylmercaptosuccinic
anhydride (SAMSA) or S-acetyl thioacetate (SATA), or addition of
one or more cysteine residues to the N- or C-terminus of the amino
acid sequence. Other cross-linking reagents are known in the art,
and many are commercially available (see, for example, catalogues
from Pierce Chemical Co. (Rockford, Ill., USA) and Sigma-Aldrich;
Saint Louis, Mo., USA). Examples include, but are not limited to,
diamines, such as 1,6-diaminohexane; dialdehydes, such as
glutaraldehyde; bis-N-hydroxysuccinimide esters, such as ethylene
glycol-bis(succinic acid N-hydroxysuccinimide ester),
disuccinimidyl glutarate, disuccinimidyl suberate, and ethylene
glycol-bis(succinimidylsuccinate); diisocyantes, such as
hexamethylenediisocyanate; bis oxiranes, such as 1,4 butanediyl
diglycidyl ether; dicarboxylic acids, such as succinyidisalicylate;
3-maleimidopropionic acid N-hydroxysuccinimide ester, and the
like.
[0145] Other modifications include the addition of one or more
amino acids at the N- or C-terminus, such as histidine residues to
allow binding to Ni.sup.2+ derivatized surfaces, or cysteine
residues to allow disulfide bridge formation or binding to
SULFOLINK.TM. agarose. Alternatively, the antibody can be modified
to include one or more chemical spacers at the N-terminus or
C-terminus in order to distance the recombinant antibody optimally
from the solid support. Spacers that can be used include, but are
not limited to, 6-aminohexanoic acid; 1,3-diamino propane;
1,3-diamino ethane; and short amino acid sequences, such as
polyglycine sequences, of 1 to 5 amino acids.
[0146] In an alternative embodiment, the recombinant antibodies
optionally can be conjugated to a carrier protein, such as bovine
serum albumin (BSA), casein, or thyroglobulin, in order to
immobilize them onto a solid phase.
[0147] In another embodiment, the present disclosure provides for
modification of the recombinant antibodies to incorporate a
detectable label. Detectable labels according to the disclosure
preferably are molecules or moieties which can be detected directly
or indirectly and are chosen such that conjugation of the
detectable label to the recombinant antibody preferably does not
interfere with the specific binding of the antibody to its target
T. cruzi protein. Methods of labeling antibodies are well-known in
the art and include, for example, the use of bifunctional
cross-linkers, such as SAMSA (S-acetylmercaptosuccinic anhydride),
to link the recombinant antibody to the detectable label. Other
cross-linking reagents such as are known in the art or which
similar to those described above likewise can be used.
[0148] Detectable labels for use with the recombinant antibodies of
the present disclosure include, for example, those that can be
directly detected, such as radioisotopes, fluorophores,
chemiluminophores, enzymes, colloidal particles, fluorescent
microparticles, and the like. The detectable label is either itself
detectable or can be reacted with one or more additional compounds
to generate a detectable product. Thus, one skilled in the art will
understand that directly detectable labels of the disclosure can
require additional components, such as substrates, triggering
reagents, light and the like to enable detection of the label.
Examples of detectable labels include, but are not limited to,
chromogens, radioisotopes (such as, e.g., .sup.125I, .sup.131I,
.sup.32P, .sup.3H, .sup.35S and .sup.14C), fluorescent compounds
(such as fluorescein, rhodamine, ruthenium tris bipyridyl and
lanthanide chelate derivatives), chemiluminescent compounds (such
as, e.g., acridinium and luminol), visible or fluorescent
particles, nucleic acids, complexing agents, or catalysts such as
enzymes (such as, e.g., alkaline phosphatase, acid phosphatase,
horseradish peroxidase, .beta.-galactosidase, .beta.-lactamase,
luciferase). In the case of enzyme use, addition of, for example, a
chromo-, fluoro-, or lumogenic substrate preferably results in
generation of a detectable signal. Other detection systems such as
time-resolved fluorescence, internal-reflection fluorescence, and
Raman spectroscopy are optionally also useful.
[0149] The present disclosure also provides for the use of labels
that are detected indirectly. Indirectly detectable labels
typically involve the use of an "affinity pair," i.e., two
different molecules, where a first member of the pair is coupled to
the recombinant antibody of the present disclosure, and the second
member of the pair specifically binds to the first member. Binding
between the two members of the pair is typically chemical or
physical in nature. Examples of such binding pairs include, but are
not limited to: antigens and antibodies; avidin/streptavidin and
biotin; haptens and antibodies specific for haptens; complementary
nucleotide sequences; enzyme cofactors/substrates and enzymes; and
the like.
F. Preparation of Antibodies
[0150] Polyclonal Abs can be raised in a mammalian host by one or
more injections of an immunogen and, if desired, an adjuvant.
Typically, the immunogen (and adjuvant) is injected in the mammal
by multiple subcutaneous or intraperitoneal injections. The
immunogen can include a TCA or a TCA-fusion polypeptide. Examples
of adjuvants include Freund's complete and monophosphoryl Lipid A
synthetic-trehalose dicorynomycolate (MPL-TDM). To improve the
immune response, an immunogen can be conjugated to a polypeptide
that is immunogenic in the host, such as keyhole limpet hemocyanin
(KLH), serum albumin, bovine thyroglobulin, and soybean trypsin
inhibitor. Protocols for antibody production are well-known
(Ausubel et al., 1987; Harlow, E., and D. Lane. 1988. Antibodies: A
laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor. 726 pp; Harlow, E., and D. Lane. 1999. Using antibodies: A
laboratory manual. Cold Spring Harbor Laboratory PRess, Cold Spring
Harbor, New York). Alternatively, pAbs can be made in chickens,
producing IgY molecules (Schade, R., et al. 1996. The production of
avian (egg yolk) antibodies: IgY. The report and recommendations of
ECVAM workshop. Alternatives to Laboratory Animals (ATLA).
24:925-934).
[0151] Methods of raising monoclonal antibodies against a desired
antigen are well known in the art. For example, monoclonal
antibodies can be made using the hybridoma method first described
by Kohler et al., Nature, 256:495 (1975). In general in the
hybridoma method, a mouse or other appropriate host animal, such as
a hamster or macaque monkey, is immunized by multiple subcutaneous
or intraperitoneal injections of antigen and a carrier and/or
adjuvant at multiple sites. Two weeks later, the animals are
boosted, and about 7 to 14 days later animals are bled and the
serum is assayed for anti-antigen titer. Animals can be boosted
until titer plateaus.
[0152] The splenocytes of the mice are extracted and fused with
myeloma cells using a suitable fusing agent, such as polyethylene
glycol, to form a hybridoma cell (see, for example, Goding,
Monoclonal Antibodies: Principles and Practice, pp. 59-103
(Academic Press, 1986); Galfre et al., Nature, 266:550 (1977)).
Suitable myeloma cell lines are known in the art and include, but
are not limited to, murine myeloma lines, such as those derived
from MOP-21 and MC-11 mouse tumors (available from the Salk
Institute Cell Distribution Center, San Diego, Calif., USA), as
well as SP-2, SP2/0 and X63-Ag8-653 cells (available from the
American Type Culture Collection (ATCC), Manassas, Va., USA). Human
myeloma and mouse-human heteromyeloma cell lines also have been
described for the production of human monoclonal antibodies (see,
for example, Kozbor, J. Immunol., 133:3001 (1984); Brodeur et al.,
Monoclonal Antibody Production Techniques and Applications, pp.
51-63 (Marcel Dekker, Inc., New York, 1987)). The hybridoma cells
thus prepared can be seeded and grown in a suitable culture medium
that preferably contains one or more substances that inhibit the
growth or survival of the unfused, parental myeloma cells. For
example, if the parental myeloma cells lack the enzyme hypoxanthine
guanine phosphoribosyl transferase (HGPRT or HPRT), the culture
medium for the hybridomas typically will include hypoxanthine,
aminopterin, and thymidine (HAT medium), which substances prevent
the growth of HGPRT-deficient cells.
[0153] The hybridoma cells obtained through such a selection are
then assayed to identify clones which secrete antibodies capable of
binding the T. cruzi antigen used in the initial immunization, for
example, by immunoprecipitation or by an in vitro binding assay,
such as radioimmunoassay (RIA) or enzyme-immunoassay (EIA or
ELISA). The binding affinity of the monoclonal antibody can
optionally be determined, for example, by the Scatchard analysis of
Munson et al., Anal. Biochem., 107:220 (1980).
[0154] After hybridoma cells are identified that produce antibodies
of the desired specificity, the clones can be subcloned by limiting
dilution procedures, for example the procedure described by Wands
et al. (Gastroenterology 80:225-232 (1981)), and grown by standard
methods (see, for example, Goding, ibid.). Suitable culture media
for this purpose include, for example, D-MEM, IMDM or RPMI-1640
medium. Alternatively, the hybridoma cells can be grown in vivo as
ascites tumors in an animal.
[0155] The monoclonal antibodies secreted by the subclones
optionally can be isolated from the culture medium, ascites fluid,
or serum by conventional immunoglobulin purification procedures
such as, for example, protein A chromatography, hydroxylapatite
chromatography, gel electrophoresis, dialysis, or affinity
chromatography.
[0156] Examples 1-4 (See, the Example section) illustrate just one
approach to obtaining mAbs to the TCAs found in FP3, FP6, FP10 and
FRA polypeptides (e.g., the polypeptides represented by the amino
acid sequences of SEQ ID NOs.:2, 4, 6 and 8).
G. Preparation of Recombinant Antibodies
[0157] The recombinant antibodies of the present disclosure can
comprise antigen-binding domain sequences (for example, the V.sub.H
and/or V.sub.L sequences, or a portion thereof) derived from, for
example, a monoclonal antibody produced by a human or non-human
animal, such as a rodent, rabbit, canine, feline, bovine, equine,
porcine, ape or chicken. Alternatively, antigen-binding domains
with the desired binding activity can be selected through the use
of combinatorial libraries expressed in lambda phage, on the
surface of bacteriophage, bacteria or yeast, or screened by display
on other biological (for example, retrovirus or polysome) or
non-biological systems using standard techniques (See, for example,
Marks, J. D. et. al., J. Mol. Biol. 222:581-597 (1991); Barbas, C.
F. III et. al., Proc. Natl. Acad. Sci. USA 89:4457-4461 (1992)).
The libraries can be composed of native antigen-binding domains
isolated from an immunized or unimmunized host, synthetic or
semi-synthetic antigen-binding domains, or modified antigen-binding
domains.
[0158] 1. Recombinant Abs Generally
[0159] In one embodiment of the present disclosure, the recombinant
antibodies comprise antigen-binding domains derived from monoclonal
antibodies that bind to the T. cruzi protein of interest.
[0160] In one embodiment of the present disclosure, the recombinant
antibodies are derived from monoclonal antibodies raised to a T.
cruzi antigen derived from a diagnostically relevant region of a T.
cruzi protein. In another embodiment, the recombinant antibodies
are derived from monoclonal antibodies raised to a T. cruzi
antigen, such as FP3, FP6, or FP10. In another embodiment, the
recombinant antibodies are derived from monoclonal antibodies
raised to a T. cruzi antigen comprising all or a fragment (for
example, a fragment comprising one or more epitopes) of FP3, FP6 or
FP10. In a further embodiment, the recombinant antibodies are
derived from monoclonal antibodies raised to a T. cruzi antigen
comprising a sequence substantially identical to the sequence as
set forth in any one of SEQ ID NOs.:2, 4 or 6.
[0161] Optionally, the monoclonal antibody is expressed by a cell
line selected from the group consisting of HBFP3, HBPep2, and
HBFP10. In an alternative embodiment, the cell line is Chagas
8-367-171.
[0162] Once a monoclonal antibody has been prepared, DNA encoding
the monoclonal antibody or the variable regions thereof can readily
be isolated by standard techniques, for example by using
oligonucleotide probes that are capable of binding specifically to
genes encoding the heavy and light chains or the variable regions
of the monoclonal antibody, or by RT-PCR of the mRNA encoding the
monoclonal antibody using primers to conserved regions (for
example, the IgG primer sets available from Novagen (EMD
Biosciences, Inc.), San Diego, Calif., USA).
[0163] Once isolated, the DNA can be, for example, cloned into an
appropriate expression vector and introduced into a suitable host
cell, such as E. coli cells, yeast cells, simian COS cells, Chinese
hamster ovary (CHO) cells, human embryonic kidney (HEK) cells (for
example, HEK 293), or myeloma cells that do not otherwise produce
immunoglobulin protein, in order to produce recombinant monoclonal
antibodies. Optionally, in one embodiment, the anti-T. cruzi
mouse-human chimeric antibodies of the disclosure are produced in a
Chinese Hamster Ovary (CHO) cell line, which is advantageous in
that they can be produced in quantities sufficient for commercial
use. Preferably, the mammalian host cells are CHO cell lines and
HEK 293 cell lines. Another preferred host cell is the B3.2 cell
line (e.g., Abbott Laboratories, Abbott Bioresearch Center,
Worcester, Mass.), or another dihydrofolate reductase deficient
(DHFR-) CHO cell line (e.g., available from Invitrogen Corp.,
Carlsbad, Calif.).
[0164] Alternatively, the DNA encoding the monoclonal antibody or
the variable regions thereof can be used to produce chimeric
antibodies, humanized antibodies and antibody fragments by standard
methods known in the art.
[0165] For example, chimeric monoclonal antibodies can be produced
by cloning the DNA encoding the variable regions of the monoclonal
antibody into mammalian expression vector(s) containing antibody
heavy and light chain constant region genes derived from a
different host species. Many eukaryotic antibody expression vectors
that are either stably integrated or exist as extrachromosomal
elements have been described and are known to those of ordinary
skill in the art. In general, antibody expression vectors are
plasmids comprising the gene encoding the heavy chain constant
region and/or the gene encoding the light chain constant region, an
upstream enhancer element and a suitable promoter.
[0166] A wide variety of expression control sequences may be used
in the present disclosure. Such useful expression control sequences
include the expression control sequences associated with structural
genes of the foregoing expression vectors as well as any sequence
known to control the expression of genes of prokaryotic or
eukaryotic cells or their viruses, and various combinations
thereof. Examples of suitable control sequences for directing
transcription in mammalian cells include the early and late
promoters of SV40 and adenovirus, for example, the adenovirus major
late promoter, the MT-1 (metallothionein gene) promoter, the human
cytomegalovirus immediate-early gene promoter (CMV), the human
elongation factor 1.alpha. (EF-1.alpha.) promoter, the Drosophila
minimal heat shock protein 70 promoter, the Rous Sarcoma Virus
(RSV) promoter, the human ubiquitin C (UbC) promoter, the human
growth hormone terminator, SV40 or adenovirus E1b region
polyadenylation signals and the Kozak consensus sequence (Kozak, J
Mol Biol., 196:947-50 (1987)).
[0167] For example, for human constant regions, the antibody
expression vector can comprise the human IgG1 (human C.gamma.1) and
human kappa constant region (human C.kappa.) genes and the
immunoglobulin H chain enhancer element. The vector can also
contain a bacterial origin of replication and selection marker.
Optional inclusion of a selection marker, as is known in the art,
allows for selection and amplification under defined growth
conditions, for example the dihydrofolate reductase (DHFR) gene
provides for selection and amplification in mammalian cells with
methotrexate. Construction of a vector appropriate for antibody
expression starting from a commercial mammalian expression vector,
can be readily achieved by the skilled technician. As described
herein various vectors including pBV, NV, and pBOS vectors, as well
as variety of intermediary vectors and plasmids can be employed for
antibody production. pBV, NV, and pBOS vectors were acquired from
Abbott Bioresearch Center (Worcester, Mass.). Other similar
plasmids and vectors are commercially available and/or readily
constructed.
[0168] Introduction of the expression construct(s) into appropriate
host cells results in production of complete chimeric antibodies of
a defined specificity (see, for example, Morrison, S. L. et al.,
Proc. Natl. Acad. Sci. USA 81: 6851-6855 (1984)). The heavy and
light chain coding sequences can be introduced into the host cell
individually on separate plasmids or together on the same
vector.
[0169] Depending on the vector system used, many different
immortalized cell lines can serve as suitable hosts, these include,
but are not limited to, myeloma (for example, X63-Ag8.653),
hybridoma (for example, Sp2/0-Ag14), lymphoma, insect cells (for
example sf9 cells), human embryonic kidney cells (for example, HEK
293) and Chinese Hamster Ovary (CHO) cells. The expression
constructs can be introduced into the host cells using a variety of
techniques known in the art, including but not limited to, calcium
phosphate precipitation, protoplast fusion, lipofection,
retrovirus-derived shuttle vectors, and electroporation.
[0170] Chimeric antibodies and antibody fragments can also be
produced in other expression systems including, but not limited to,
baculovirus, yeast, bacteria (such as E. coli), and in vitro in
cell-free systems, such as rabbit reticulocyte lysate.
[0171] The recombinant antibody can be isolated from the host cells
by standard immunoglobulin purification procedures such as, for
example, cross-flow filtration, ammonium sulphate precipitation,
protein A chromatography, hydroxylapatite chromatography, gel
electrophoresis, dialysis, affinity chromatography, or combinations
thereof.
[0172] Alternatively, antibody fragments can be generated from a
purified antibody preparation by conventional enzymatic methods,
for example, F(ab').sub.2 fragments can be produced by pepsin
cleavage of the intact antibody, and Fab fragments can be produced
by briefly digesting the intact antibody with papain.
[0173] Recombinant bispecific and heteroconjugate antibody
fragments having specificities for at least two different antigens
can be prepared as full length antibodies or as antibody fragments
(such as F(ab').sub.2 bispecific antibody fragments). Antibody
fragments having more than two valencies (for example, trivalent or
higher valency antibody fragments) also are contemplated.
Bispecific antibodies, heteroconjugate antibodies, and multi-valent
antibodies can be prepared by standard methods known to those
skilled in the art.
[0174] 2. Monovalent Abs
[0175] Monovalent Abs do not cross-link each other. One method
involves recombinant expression of Ig light chain and modified
heavy chain. Heavy chain truncations generally at any point in the
Fc region prevents heavy chain cross-linking. Alternatively, the
relevant cysteine residues are substituted with another amino acid
residue or are deleted, preventing crosslinking by disulfide
binding. In vitro methods are also suitable for preparing
monovalent Abs. Abs can be digested to produce fragments, such as
Fab (Harlow and Lane, 1988, supra; Harlow and Lane, 1999,
supra).
[0176] 3. Humanized and Human Abs
[0177] Humanized forms of non-human Abs that bind a TCA are
chimeric Igs, Ig chains or fragments (such as Fv, Fab, Fab',
F(ab').sub.2 or other antigen-binding subsequences of Abs) that
contain minimal sequence derived from non-human Ig.
[0178] Generally, a humanized antibody has one or more amino acid
residues introduced from a non-human source. These non-human amino
acid residues are often referred to as "import" residues that are
typically taken from an "import" variable domain. Humanization is
accomplished by substituting rodent CDRs or CDR sequences for the
corresponding sequences of a human antibody (Jones, P. T., et al.
1986. Replacing the complementarity-determining regions in a human
antibody with those from a mouse. Nature. 321:522-5; Riechmann, L.,
et al. 1988. Reshaping human antibodies for therapy. Nature.
332:323-7; Verhoeyen, M., et al. 1988. Reshaping human antibodies:
grafting an antilysozyme activity. Science. 239:1534-6). Such
"humanized" Abs are chimeric Abs (Cabilly et al., 1989), wherein
substantially less than an intact human variable domain has been
substituted by the corresponding sequence from a non-human species.
In practice, humanized Abs are typically human Abs in which some
CDR residues and possibly some FR residues are substituted by
residues from analogous sites in rodent Abs. Humanized Abs include
human Igs (recipient antibody) in which residues from a
complementary determining region (CDR) of the recipient are
replaced by residues from a CDR of a non-human species (donor
antibody), such as mouse, rat or rabbit, having the desired
specificity, affinity and capacity. In some instances,
corresponding non-human residues replace Fv framework residues of
the human Ig. Humanized Abs can include residues that are found
neither in the recipient antibody nor in the imported CDR or
framework sequences. In general, the humanized antibody contains
substantially all of at least one, and typically two, variable
domains, in which most if not all of the CDR regions correspond to
those of a non-human Ig and most if not all of the FR regions are
those of a human Ig consensus sequence. The humanized antibody
optimally also comprises at least a portion of an Ig constant
region (Fc), typically that of a human Ig (Jones et al., 1986;
Presta, 1992; Riechmann et al., 1988).
[0179] Human Abs can also be produced using various techniques,
including phage display libraries (Hoogenboom, H. R., et al. 1991.
Multi-subunit proteins on the surface of filamentous phage:
methodologies for displaying antibody (Fab) heavy and light chains.
Nucleic Acids Res. 19:4133-7; Marks, J. D., et al. 1991. By-passing
immunization. Human antibodies from V-gene libraries displayed on
phage. J Mol Biol. 222:581-97) and human mAbs (Boerner, P., et al.
1991. Production of antigen-specific human monoclonal antibodies
from in vitro-primed human splenocytes. J Immunol. 147:86-95;
Reisfeld, R. A., and S. Sell. 1985. Monoclonal antibodies and
cancer therapy: Proceedings of the Roche-UCLA symposium held in
Park City, Utah, Jan. 26-Feb. 2, 1985. Alan R. Liss, New York. 609
pp). Introducing human Ig genes into transgenic animals in which
the endogenous Ig genes have been partially or completely
inactivated can be exploited to synthesize human Abs. Upon
challenge, human antibody production is observed, which closely
resembles that seen in humans in all respects, including gene
rearrangement, assembly, and antibody repertoire (Fishwild, D. M.,
et al. 1996. High-avidity human IgG kappa monoclonal antibodies
from a novel strain of minilocus transgenic mice. Nat Biotechnol.
14:845-51; Lonberg and Huszar, 1995; Lonberg et al., 1994; Marks et
al., 1992; Lonberg, N., and R. M. Kay. U.S. Pat. No. 5,569,825.
1996; Lonberg, N., and R. M. Kay. U.S. Pat. No. 5,633,425. 1997a;
Lonberg, N., and R. M. Kay. U.S. Pat. No. 5,661,016. 1997b;
Lonberg, N., and R. M. Kay. U.S. Pat. No. 5,625,126. 1997c; Surani,
A., et al. U.S. Pat. No. 5,545,807. 1996).
[0180] 3. Bi-Specific Abs
[0181] Bi-specific mAbs bind at least two different antigens. For
example, a binding specificity is a TCA; the other is for any
antigen of choice.
[0182] The recombinant production of bi-specific Abs is often
achieved by co-expressing two Ig heavy-chain/light-chain pairs,
each having different specificities. The random assortment of these
Ig heavy and light chains in the resulting hybridomas (quadromas)
produce a potential mixture of ten different antibody molecules, of
which only one has the desired bi-specific structure. The desired
antibody can be purified using affinity chromatography or other
techniques (Traunecker, A., et al. 1991. Myeloma based expression
system for production of large mammalian proteins. Trends
Biotechnol. 9:109-13; Wabl, M., J. Berg, and E. Lotscher. WO
93/08829. 1993).
[0183] To manufacture a bi-specific antibody, variable domains with
the desired antibody-antigen combining sites are fused to Ig
constant domain sequences (Suresh, M. R., A. C. Cuello, and C.
Milstein. 1986. Bispecific monoclonal antibodies from hybrid
hybridomas. Methods Enzymol. 121:210-28). The fusion is usually
with an Ig heavy-chain constant domain, comprising at least part of
the hinge, CH2, and CH3 regions. The first heavy-chain constant
region (CH1) containing the site necessary for light-chain binding
is in at least one of the fusions. DNAs encoding the Ig heavy-chain
fusions and, if desired, the Ig light chain, are inserted into
separate expression vectors and are co-transfected into a suitable
host organism.
[0184] The interface between a pair of antibody molecules can be
engineered to maximize the percentage of heterodimers that are
recovered from recombinant cell culture (Carter, P., L. et al. WO
96/27011. 1996). In this method, one or more small amino acid side
chains from the interface of the first antibody molecule are
replaced with larger side chains (e.g., tyrosine or tryptophan).
Compensatory "cavities" of identical or similar size to the large
side chain(s) are created on the interface of the second antibody
molecule by replacing large amino acid side chains with smaller
ones (e.g., alanine or threonine). This mechanism increases the
yield of the heterodimer over unwanted end products, such as
homodimers.
[0185] Bi-specific Abs can be prepared as full length Abs or
antibody fragments (e.g., Fab'.sub.2 bi-specific Abs). One
technique to generate bi-specific Abs exploits chemical linkage.
Intact Abs can be proteolytically cleaved to generate Fab'.sub.2
fragments (Brennan, M., et al. 1985. Preparation of bispecific
antibodies by chemical recombination of monoclonal immunoglobulin
G1 fragments. Science. 229:81-3). Fragments are reduced with a
dithiol complexing agent, such as sodium arsenite, to stabilize
vicinal dithiols and prevent intermolecular disulfide formation.
The generated Fab' fragments are then converted to
thionitrobenzoate (TNB) derivatives. One of the Fab'-TNB
derivatives is then reconverted to the Fab'-thiol by reduction with
mercaptoethylamine and is mixed with an equimolar amount of the
other Fab'-TNB derivative to form the bi-specific antibody.
[0186] Fab' fragments can be directly recovered from E. coli and
chemically coupled to form bi-specific Abs. For example, fully
humanized bi-specific Fab'.sub.2 Abs can be produced (Shalaby, M.
R., et al. 1992. Development of humanized bispecific antibodies
reactive with cytotoxic lymphocytes and tumor cells overexpressing
the HER2 protooncogene. J Exp Med. 175:217-25). Each Fab' fragment
is separately secreted from E. coli and directly coupled chemically
in vitro, forming the bi-specific antibody.
[0187] Various techniques for making and isolating bi-specific
antibody fragments directly from recombinant cell culture have also
been described. For example, leucine zipper motifs can be exploited
(Kostelny, S. A., et al. 1992. Formation of a bispecific antibody
by the use of leucine zippers. J Immunol. 148:1547-53). Peptides
from the Fos and Jun polypeptides are linked to the Fab' portions
of two different Abs by gene fusion. The antibody homodimers are
reduced at the hinge region to form monomers and then re-oxidized
to form antibody heterodimers. This method can also produce
antibody homodimers. "Diabody" technology provides an alternative
method to generate bi-specific antibody fragments (Holliger et al.,
1993). The fragments consist of a heavy-chain V.sub.H connected to
a light-chain V.sub.L by a linker that is too short to allow
pairing between the two domains on the same chain. The V.sub.H and
V.sub.L domains of one fragment are forced to pair with the
complementary V.sub.L and V.sub.H domains of another fragment,
forming two antigen-binding sites. Another strategy for making
bi-specific antibody fragments is the use of single-chain Fv (sFv)
dimers (Gruber, M., et al. 1994. Efficient tumor cell lysis
mediated by a bispecific single chain antibody expressed in
Escherichia coli. J Immunol. 152:5368-74). Abs with more than two
valencies can also be made, such as tri-specific Abs (Tutt, A., et
al. 1991. Trispecific F(ab')3 derivatives that use cooperative
signaling via the TCR/CD3 complex and CD2 to activate and redirect
resting cytotoxic T cells. J Immunol. 147:60-9). Exemplary
bi-specific Abs can bind to two different epitopes on a given
TCA.
H. Testing of Recombinant Antibodies
[0188] The ability of the recombinant antibody to specifically bind
to the target T. cruzi antigen can be assessed by standard
immunological techniques (see, for example, Current Protocols in
Immunology, Coligan, J. E., et al. (ed.), J. Wiley & Sons, New
York, N.Y.). For example, by radioimmunoassay (RIA) or enzyme
immunoassay (EIA or ELISA). In one embodiment of the present
disclosure, the recombinant antibody demonstrates substantially the
same specificity as the monoclonal antibody from which the
antigen-binding domains are derived.
[0189] The recombinant antibodies optionally can also be tested for
their binding affinity to the target T. cruzi antigen by measuring
the equilibrium dissociation constant (K.sub.D) by standard
techniques. In one embodiment of the present disclosure, the
recombinant antibodies (e.g., chimeric antibodies) have a K.sub.D
less than about 1 .mu.M. In another embodiment, the recombinant
antibodies (e.g., chimeric antibodies) have a K.sub.D less than
about 100 nM.
[0190] Other standard tests also can be done on the antibodies, for
example, the pI value of the antibodies can be obtained.
[0191] Optionally, the recombinant antibodies (e.g., chimeric
antibodies) are subjected to epitope mapping procedures to identify
the region of the target antigen to which they bind. A variety of
methods of epitope mapping are known in the art (see, for example,
Current Protocols in Immunology, Coligan, J. E., et al. (ed.), J.
Wiley & Sons, New York, N.Y.) and include, for example, phage
and yeast display methods. Phage and yeast display methods can also
be combined with random mutagenesis techniques in order to more
precisely map the residues of the target antigen involved in
antibody binding (see, for example, Chao, G., et al., J. Mol.
Biol., 10:539-50 (2004)).
[0192] In one embodiment of the present disclosure, the residues of
the target antigen to which the recombinant antibodies bind are
identified by a technique that combines scanning alanine
mutagenesis with yeast display. The technique generally involves
the preparation of a series of oligonucleotides encoding peptides
each representing the target region of the antigen and in which
each individual amino acid in this region was sequentially
substituted by alanine. The target region of the antigen is
determined either from the antigen used in the initial immunization
to prepare the parent monoclonal antibody, or from a preliminary
"low-resolution" screening using yeast or phage display. A wildtype
version of the antigen is used as a control. Each oligonucleotide
is cloned into an appropriate yeast display vector and each alanine
mutant transformed into a suitable host, such as E. coli. Plasmid
DNA is extracted and sequenced and clones are selected based on
sequencing. Yeast display vectors are known in the art and are
commercially available (for example, pYD1 available from Invitrogen
Corp., Carlsbad, Calif., USA).
[0193] The selected clones are then transformed into Saccharomyces
cerevesiae cells, for example, EBY100 cells (Invitrogen Corp.), and
individual yeast clones cultured and induced for peptide
expression. The induced yeast cells expressing the alanine mutants
on the cell surface are incubated with the recombinant antibody and
bound antibody is detected by conventional methods, for example
using a labeled secondary antibody. Key residues in the target
antigenic region can then be determined based on the identification
of alanine mutants unable to bind to the recombinant antibody. A
loss of antibody binding activity indicates that the mutant
includes an alanine residue at a position that forms part of the
epitope for the recombinant antibody.
I. Uses of Recombinant Antibodies
[0194] The recombinant antibodies of the present disclosure are
suitable for use, for example, as diagnostic reagents for the
detection of T. cruzi, and/or as standardization reagents, positive
control reagents or calibrator reagents in assays or kits for the
detection of T. cruzi antibodies in place of traditional plasma or
serum. Standardization reagents can be used, for example, to
establish standard curves for interpolation of antibody
concentration. Positive controls can be used to establish assay
performance characteristics and/or quantitate and monitor the
integrity of the antigen(s) used in the assay. The present
disclosure also provides for the use of a plurality of the
recombinant antibodies, each recombinant antibody capable of
specifically binding to a different T. cruzi antigen, as
standardized antibody sensitivity panels. Such sensitivity panels
can be used, for example, in place of traditional plasma or serum
for quality control of T. cruzi antibody detection kits, to
establish assay performance characteristics and/or quantitate and
monitor the integrity of the antigen(s) used in the assay. The
present disclosure also contemplates the use of the recombinant
antibodies in the treatment or prevention of a T. cruzi
infection.
[0195] One embodiment of the present disclosure thus provides for
an immunodiagnostic reagent comprising one or more recombinant
antibodies, each capable of specifically binding a diagnostically
relevant region of a T. cruzi protein.
[0196] In one embodiment of the present disclosure, the
immunodiagnostic reagent comprises a plurality of (for example, two
or more) recombinant antibodies each capable of detecting a
different T. cruzi antigen.
[0197] The immunodiagnostic reagent can be tailored for a specific
end use by appropriate selection of the recombinant antibodies it
comprises, thus making the immunodiagnostic reagent compatible with
a number of existing T. cruzi detection assay formats and kits.
Tailoring the immunodiagnostic reagent in this manner also allows
the reagent to be optimized for detection of certain stages of T.
cruzi infection.
[0198] The present disclosure further provides for a method of
standardizing T. cruzi antibody detection assays using an
immunodiagnostic reagent comprising a plurality of recombinant
antibodies, each capable of specifically binding to a different
TCA, as a sensitivity panel.
[0199] The present disclosure additionally provides for a method
for detecting the presence of TCAs which comprises contacting a
test sample suspected of containing TCAs with an immunodiagnostic
reagent comprising one or more recombinant antibodies, each capable
of specifically binding a TCA, under conditions that allow
formation of recombinant antibody:antigen complexes and detecting
any recombinant antibody:antigen complexes formed.
[0200] The present disclosure also encompasses a method for
detecting the presence of T. cruzi antibodies which comprises
contacting a test sample suspected of containing T. cruzi
antibodies with one or more antigens specific for the T. cruzi
antibodies, under conditions that allow formation of
antigen/antibody complexes, detecting the antigen:antibody
complexes, and using an immunodiagnostic reagent comprising one or
more recombinant antibodies, each capable of specifically binding
one of the antigens used in the method, as a positive control or
standardization reagent.
[0201] The immunodiagnostic reagents of the present disclosure are
suitable for use with assays and kits monitoring T. cruzi responses
in man as well as other vertebrate species susceptible to T. cruzi
infection and capable of generating an antibody response thereto.
The immunodiagnostic reagents thus have human medical as well as
veterinary applications.
[0202] The present disclosure also encompasses the use of the
recombinant antibodies and variable regions described herein in
directed molecular evolution technologies such as phage display
technologies, and bacterial and yeast cell surface display
technologies, in order to produce novel recombinant antibodies in
vitro (See, for example, Johnson et al., Current Opinion in
Structural Biology 3:564 (1993) and Clackson et al., Nature 352:624
(1991)).
[0203] Optionally the immunodiagnostic reagent of the disclosure,
e.g., the chimeric antibodies, can be used in commercial platform
immunoassays.
J. Kits Comprising Recombinant Antibodies
[0204] The present disclosure further provides for therapeutic,
diagnostic and quality control kits comprising one or more
recombinant antibodies of the disclosure.
[0205] One aspect of the present disclosure provides diagnostic
kits for the detection of T. cruzi. The kits comprise one or more
recombinant antibodies of the present disclosure. The recombinant
antibodies can be provided in the kit as detection reagents, either
for use to capture and/or detect T. cruzi antigens or for use as
secondary antibodies for the detection of antigen:antibody
complexes. Alternatively, the recombinant antibodies can be
provided in the kit as a positive control reagent, a
standardization reagent, calibration reagent or a sensitivity
panel. In various embodiments, the diagnostic kit can further
comprise reagents for detection of T. cruzi antigens or reagents
for the detection of T. cruzi antibodies. In one embodiment, the
present disclosure provides a diagnostic kit comprising reagents
for detection of T. cruzi antibodies, including one or more
antigens specific for the T. cruzi antibodies, and a positive
control or standardization reagent comprising one or more
recombinant antibodies of the disclosure, each capable of
specifically binding one of the one or more antigens included in
the kit.
[0206] Thus, the present disclosure further provides for diagnostic
and quality control kits comprising one or more antibodies of the
disclosure. Optionally the assays, kits and kit components of the
disclosure are optimized for use on commercial platforms (e.g.,
immunoassays on the Prism.RTM., AxSYM.RTM., ARCHITECT.RTM. and EIA
(Bead) platforms of Abbott Laboratories, Abbott Park, Ill., as well
as other commercial and/or in vitro diagnostic assays).
Additionally, the assays, kits and kit components can be employed
in other formats, for example, on electrochemical or other
hand-held or point-of-care assay systems. The present disclosure
is, for example, applicable to the commercial Abbott Point of Care
(i-STAT.RTM., Abbott Laboratories, Abbott Park, Ill.)
electrochemical immunoassay system that performs sandwich
immunoassays for several cardiac markers, including TnI, CKMB and
BNP Immunosensors and methods of operating them in single-use test
devices are described, for example, in US Patent Applications
20030170881, 20040018577, 20050054078 and 20060160164 which are
incorporated herein by reference. Additional background on the
manufacture of electrochemical and other types of immunosensors is
found in U.S. Pat. No. 5,063,081 which is also incorporated by
reference for its teachings regarding same.
[0207] Optionally the kits include quality control reagents (e.g.,
sensitivity panels, calibrators, and positive controls).
Preparation of quality control reagents is well known in the art,
and is described, e.g., on a variety of immunodiagnostic product
insert sheets. Sensitivity panel members optionally can be prepared
in varying amounts containing, e.g., known quantities of antibody
ranging from "low" to "high", e.g., by spiking known quantities of
the antibodies according to the disclosure into an appropriate
assay buffer (e.g., a phosphate buffer). These sensitivity panel
members optionally are used to establish assay performance
characteristics, and further optionally are useful indicators of
the integrity of the immunoassay kit reagents, and the
standardization of assays.
[0208] The antibodies provided in the kit can incorporate a
detectable label, such as a fluorophore, radioactive moiety,
enzyme, biotin/avidin label, chromophore, chemiluminescent label,
or the like, or the kit may include reagents for labeling the
antibodies or reagents for detecting the antibodies (e.g.,
detection antibodies) and/or for labeling the antigens or reagents
for detecting the antigen. The antibodies, calibrators and/or
controls can be provided in separate containers or pre-dispensed
into an appropriate assay format, for example, into microtiter
plates.
[0209] The kits can optionally include other reagents required to
conduct a diagnostic assay or facilitate quality control
evaluations, such as buffers, salts, enzymes, enzyme co-factors,
substrates, detection reagents, and the like. Other components,
such as buffers and solutions for the isolation and/or treatment of
a test sample (e.g., pretreatment reagents), may also be included
in the kit. The kit may additionally include one or more other
controls. One or more of the components of the kit may be
lyophilized and the kit may further comprise reagents suitable for
the reconstitution of the lyophilized components.
[0210] The various components of the kit optionally are provided in
suitable containers. As indicated above, one or more of the
containers may be a microtiter plate. The kit further can include
containers for holding or storing a sample (e.g., a container or
cartridge for a blood or urine sample). Where appropriate, the kit
may also optionally contain reaction vessels, mixing vessels and
other components that facilitate the preparation of reagents or the
test sample. The kit may also include one or more instruments for
assisting with obtaining a test sample, such as a syringe, pipette,
forceps, measured spoon, or the like.
[0211] The kit further can optionally include instructions for use,
which may be provided in paper form or in computer-readable form,
such as a disc, CD, DVD or the like.
K. Adaptation of Kits
[0212] The kit (or components thereof), as well as the method of
determining the detecting the presence or concentration of T. cruzi
antigens in a test sample by an assay using the components and
methods described herein, can be adapted for use in a variety of
automated and semi-automated systems (including those wherein the
solid phase comprises a microparticle), as described, e.g., in U.S.
Pat. Nos. 5,089,424 and 5,006,309, and as commercially marketed,
e.g., by Abbott Laboratories (Abbott Park, Ill.) as
ARCHITECT.RTM..
[0213] Some of the differences between an automated or
semi-automated system as compared to a non-automated system (e.g.,
ELISA) include the substrate to which the first specific binding
partner (e.g., T. cruzi capture antibody) is attached (which can
impact sandwich formation and analyte reactivity), and the length
and timing of the capture, detection and/or any optional wash
steps. Whereas a non-automated format such as an ELISA may require
a relatively longer incubation time with sample and capture reagent
(e.g., about 2 hours) an automated or semi-automated format (e.g.,
ARCHITECT.RTM., Abbott Laboratories) may have a relatively shorter
incubation time (e.g., approximately 18 minutes for
ARCHITECT.RTM.). Similarly, whereas a non-automated format such as
an ELISA may incubate a detection antibody such as the conjugate
reagent for a relatively longer incubation time (e.g., about 2
hours), an automated or semi-automated format (e.g.,
ARCHITECT.RTM.) may have a relatively shorter incubation time
(e.g., approximately 4 minutes for the ARCHITECT.RTM.).
[0214] Other platforms available from Abbott Laboratories include,
but are not limited to, AxSYM.RTM., IMx.RTM. (see, e.g., U.S. Pat.
No. 5,294,404, which is hereby incorporated by reference in its
entirety), PRISM.RTM., EIA (bead), and Quantum.TM. II, as well as
other platforms. Additionally, the assays, kits and kit components
can be employed in other formats, for example, on electrochemical
or other hand-held or point-of-care assay systems. The present
disclosure is, for example, applicable to the commercial Abbott
Point of Care (i-STAT.RTM., Abbott Laboratories) electrochemical
immunoassay system that performs sandwich immunoassays
Immunosensors and their methods of manufacture and operation in
single-use test devices are described, for example in, U.S. Pat.
No. 5,063,081, U.S. Pat. App. Pub. No. 2003/0170881, U.S. Pat. App.
Pub. No. 2004/0018577, U.S. Pat. App. Pub. No. 2005/0054078, and
U.S. Pat. App. Pub. No. 2006/0160164, which are incorporated in
their entireties by reference for their teachings regarding
same.
[0215] In particular, with regard to the adaptation of a T. cruzi
antigen assay to the I-STAT.RTM. system, the following
configuration is preferred. A microfabricated silicon chip is
manufactured with a pair of gold amperometric working electrodes
and a silver-silver chloride reference electrode. On one of the
working electrodes, polystyrene beads (0.2 mm diameter) with
immobilized capture antibody are adhered to a polymer coating of
patterned polyvinyl alcohol over the electrode. This chip is
assembled into an I-STAT.RTM. cartridge with a fluidics format
suitable for immunoassay. On a portion of the wall of the
sample-holding chamber of the cartridge there is a layer comprising
the second detection antibody labeled with alkaline phosphatase (or
other label). Within the fluid pouch of the cartridge is an aqueous
reagent that includes p-aminophenol phosphate.
[0216] In operation, a sample suspected of containing a T. cruzi
antigen is added to the holding chamber of the test cartridge and
the cartridge is inserted into the I-STAT.RTM. reader. After the
second antibody (detection antibody) has dissolved into the sample,
a pump element within the cartridge forces the sample into a
conduit containing the chip. Here it is oscillated to promote
formation of the sandwich between the T. cruzi antigen, T. cruzi
capture antibody, and the labeled detection antibody. In the
penultimate step of the assay, fluid is forced out of the pouch and
into the conduit to wash the sample off the chip and into a waste
chamber. In the final step of the assay, the alkaline phosphatase
label reacts with p-aminophenol phosphate to cleave the phosphate
group and permit the liberated p-aminophenol to be
electrochemically oxidized at the working electrode. Based on the
measured current, the reader is able to calculate the amount of T.
cruzi antigen in the sample by means of an embedded algorithm and
factory-determined calibration curve.
[0217] It further goes without saying that the methods and kits as
described herein necessarily encompass other reagents and methods
for carrying out the immunoassay. For instance, encompassed are
various buffers such as are known in the art and/or which can be
readily prepared or optimized to be employed, e.g., for washing, as
a conjugate diluent, and/or as a calibrator diluent. An exemplary
conjugate diluent is ARCHITECT.RTM. conjugate diluent employed in
certain kits (Abbott Laboratories, Abbott Park, Ill.) and
containing 2-(N-morpholino)ethanesulfonic acid (MES), a salt, a
protein blocker, an antimicrobial agent, and a detergent. An
exemplary calibrator diluent is ARCHITECT.RTM. human calibrator
diluent employed in certain kits (Abbott Laboratories, Abbott Park,
Ill.), which comprises a buffer containing MES, other salt, a
protein blocker, and an antimicrobial agent.
[0218] To gain a better understanding of the disclosure described
herein, the following examples are set forth. It will be understood
that these examples are intended to describe illustrative
embodiments of the disclosure and are not intended to limit the
scope of the disclosure in any way.
EXAMPLES
Example 1: Cell Lines Producing Antibodies Against T. cruzi Antigen
FP3 (Chagas FP3 12-392-150-110)
[0219] In this example, a hybridoma cell line that produces mAbs
that recognize and bind Chagas FP3 recombinant antigen was
produced. Mice were immunized with the FP3 recombinant antigen (SEQ
ID NO.:2), the anti-FP3 antibody-producing mice euthanized, spleen
cells harvested and fused with myeloma cells, and mAb anti-FP3
hybridoma cell lines were isolated. The resulting cell line HBFP3
was produced.
[0220] Immunogen Preparation
[0221] The Chagas FP3 antigen cell line was provided by Dr. Louis
Kirchoff s laboratory of the University of Iowa, for a seed bank in
Lake County, Ill. The cDNA sequence encoding this antigen (SEQ ID
NO.:1) was cloned into the pET expression vectors under the control
of T7 promoter and expressed in suitable E. coli host cells
[BLR(DE3)pLysS or BL21(DE3)]. The T7 RNA polymerase was encoded by
the lambda DE3 lysogen inserted into the host bacterial genome and
under the control of the lacUV5 promoter. Isopropyl
.beta.-D-thiogalactopyranoside (IPTG) was added to the cells to
induce T7 RNA polymerase expression, which in turn bound to the T7
promoter and resulted in the expression of the cloned gene. Plates
of the transformed cells were streaked to isolate a single colony
and cell banks were prepared. Subsequently, the E. coli was grown,
and a cell paste was prepared for purification.
[0222] First, the recombinant FP3 antigen was purified from
clarified supernatant by recirculating the clarified supernatant
during loading. Second, spuriously bound contaminants where removed
from the Immobilized Metal Affinity Chromatography (IMAC) column by
washing the affinity column with a high salt buffer. Third, the
His-tagged (amino end) recombinant FP3 polypeptide was eluted from
the column by competitively removing His-tagged antigen with
imidazole. Subsequently, the eluted proteins were fractioned and
analyzed by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE). Fractions that contained the
recombinant FP3 antigen without significant contamination were
pooled and concentrated. After concentration, the FP3 antigen was
further purified by size exclusion chromatography using a 2000 ml
Sephacryl S-300 sizing column, analyzed by SDS-PAGE and
concentrated.
[0223] Animal Immunization
[0224] RBf/dnJ female mice (all mice were obtained from Jackson
Laboratories; Bar Harbor, Me.) were immunized twice with purified
Chagas FP4 recombinant antigen (containing the target FP3 sequence)
and once with purified Chagas FP3 recombinant antigen, using the
Freunds Adjuvant System, prior to checking the antisera for
sufficient titer. The inoculum was prepared by diluting the antigen
in 0.9% sodium chloride and emulsifying with an equal volume of
adjuvant. At weeks 0 and 3, a 20 .mu.g boost of FP4 (containing the
target FP3 sequence) was administered to the mice. At week 6, a 10
.mu.g boost of FP3 was administered to the mice. Freunds Complete
Adjuvant was used for the primary boost delivered subcutaneously,
and Freunds Incomplete Adjuvant was used for the next 2 intradermal
boosts. Two weeks after the third boost, a sera sample was taken
for a specific anti-T. cruzi titer test, which resulted in the
selection of mouse #241 for the fusion experiment. Three days prior
to the fusion, mouse #241 was administered a pre-fusion boost of 5
.mu.g of the FP3 recombinant antigen.
[0225] Hybridoma Creation (Cell Fusion Experiment)
[0226] Hybridomas were developed using the polyethylene glycol
(PEG)-mediated fusion technique described in Galfre et al. (Galfre,
G., et al. 1977. Antibodies to major histocompatibility antigens
produced by hybrid cell lines. Nature. 266:550-2). The RBf/dnJ
mouse #241 was euthanized three days after the pre-fusion boost,
and the spleen was harvested. The B-cells were perfused from the
spleen, washed and re-suspended in an equal number of SP2/0 myeloma
cells (ATTC deposit CRL-1581). The total cells were pelleted, and
the fusion was performed with 1 ml of polyethylene glycol (PEG) and
cultured at 37.degree. C. in HAT-supplemented GIBCO.RTM. Hybridoma
Serum Free Medium (H-SFM; Invitrogen Corp., Carlsbad, Calif.) with
10% fetal bovine serum (FBS; Hyclone; Logan, Utah). Cells were
plated into 96-well tissue culture plates and incubated in a
humidified 37.degree. C. incubator. The hybrids were tested 10-14
days later for anti-T. cruzi FP3 reactivity in a microtiter enzyme
immunoassay (EIA). The results indicated hybrid 12-392 secreted
anti-FP3 specific antibody.
[0227] Hybridoma Cloning and Subcloning
[0228] Hybridoma 12-392 was selected for limiting dilution cloning.
The cells were suspended and then serially diluted 10.sup.4,
10.sup.5 and 10.sup.6 into 20 ml of H-SFM with 10% FBS. Each
dilution was plated into a 96-well tissue culture plate with 0.2 ml
cell suspension per well. The plates were incubated for 10-14 days
at 37.degree. C. in a humidified incubator. As growth became
apparent, the supernates were tested in an anti-FP3 microtiter EIA
that resulted in the selection of clone 12-392-150.
[0229] Clone 12-392-150 was selected for subcloning using
fluorescence activated cell sorting (FACS). A cell suspension was
stained with goat anti-mouse-Alexa Fluor 488 (Invitrogen Corp.,
Carlsbad, Calif.). Single cell isolates from the top 5-8% of this
stained cell population were deposited in a 96-well tissue culture
plate with 0.2 ml of H-SFM with 10% FBS. The plates were incubated
for 10-14 days at 37.degree. C. in a humidified incubator. As
growth became apparent, the supernates were tested in an anti-FP3
microtiter EIA that resulted in the selection of clone
12-392-150-110 (HBFP3).
[0230] HBFP3 was expanded in tissue culture to a 850 cm.sup.2
roller bottle, cell passage 5, in H-SFM with 10% FBS. The pass 5
cell suspension was pelleted, re-suspended in freeze medium and
dispensed into cryovials. The vials were stored in liquid nitrogen
storage tanks.
Example 2: Cell Lines Producing Antibodies Against Chagas TcF
Recombinant Antigen (Chagas 9-638-132-115)
[0231] Immunogen Source
[0232] The purified TcF recombinant antigen (containing the PEP2
sequence) used for animal immunizations was obtained from Corixa
Corporation (Seattle, Wash.).
[0233] Animal Immunization
[0234] RBf/dnJ female mice were immunized three times with purified
Chagas TcF recombinant antigen, using the Freunds Adjuvant System,
prior to checking the antisera for sufficient titer. The inoculum
was prepared by diluting the antigen in 0.9% sodium chloride and
emulsifying with an equal volume of adjuvant. At weeks 0, 6, and
12, a 20 .mu.g boost of TcF was administered to the mice. Freunds
Complete Adjuvant was used for the primary boost delivered
subcutaneously and Freunds Incomplete Adjuvant was used for the
next 2 intradermal boosts. Two weeks after the 3rd boost, a sera
sample was taken for a specific anti-T. cruzi titer test, which
resulted in the selection of mouse #115 for the fusion experiment.
Three days prior to the fusion, mouse #115 was administered a
pre-fusion boost of 10 .mu.g of the TcF recombinant antigen and 10
.mu.g of the TcF Pep2 peptide.
[0235] Hybridoma Creation
[0236] Hybridomas were developed using PEG-mediated fusion
technique described in Galfre et al. (Galfre et al., 1977). The
RBf/dnJ mouse #115 was euthanized three days after the pre-fusion
boost, and the spleen was harvested. The B-cells were perfused from
the spleen, washed and re-suspended in an equal number of SP2/0
myeloma cells (ATTC deposit CRL-1581). The total cells were
pelleted, and the fusion was performed with 1 ml of PEG and
cultured at 37.degree. C. in HAT-supplemented GIBCO.RTM. H-SFM
(Invitrogen Corp., Carlsbad, Calif.) with 10% FBS (Hyclone, Logan,
Utah). Cells were plated into 96-well tissue culture plates and
incubated in a humidified 37.degree. C. incubator. The hybrids were
tested 10-14 days later for anti-T. cruzi Pep2 reactivity in a
microtiter EIA. The results indicated hybrid 9-638 secreted
anti-Pep2 specific antibody.
[0237] Hybridoma Cloning and Subcloning
[0238] Hybridoma 9-638 was selected for limiting dilution cloning.
The cells were suspended and then serially diluted 10.sup.4,
10.sup.5 and 10.sup.6 into 20 ml of H-SFM with 10% FBS. Each
dilution was plated into a 96-well tissue culture plate with 0.2 ml
cell suspension per well. The plates were incubated for 10-14 days
at 37.degree. C. in a humidified incubator. As growth became
apparent, the supernates were tested in an anti-Pep2 microtiter
EIA, and clone 9-638-132 was selected.
[0239] Clone 9-638-132 was selected for subcloning using FACS. A
cell suspension was stained with goat anti-mouse-Alexa Fluor 488.
Single cell isolates from the top 1% of this stained cell
population were deposited in a 96-well tissue culture plate with
0.2 ml of H-SFM with 10% FBS. The plates were incubated for 10-14
days at 37.degree. C. in a humidified incubator. As growth became
apparent, the supernates were tested in an anti-Pep2 microtiter
EIA, and clone 9-638-132-115 was selected.
[0240] Clone 9-638-132-115 was expanded in tissue culture to a 850
cm.sup.2 roller bottle, cell passage 6, in H-SFM with 10% FBS. The
pass 5 cell suspension was pelleted. The pellet was then
re-suspended in freeze medium and dispensed into cryovials. The
vials were stored in liquid nitrogen storage
Example 3: Cell Lines Producing Antibodies Against Chagas FP10
Recombinant Antigen (Chagas 10-745-140)
[0241] Immunogen Source
[0242] The Chagas FP10 antigen (SEQ ID NO.:6) cell line was
obtained from the laboratory of Dr. Louis Kirchoff, University of
Iowa, for a seed bank in Lake County. The cDNA sequence (SEQ ID
NO.:5) encoding this antigen was cloned into the pET expression
vectors, and the cells were processed and recombinant antigen
purified as outlined in Example 1.
[0243] Animal Immunization
[0244] RBf/dnJ female mice were immunized three times with purified
Chagas FP10 recombinant antigen using the Freunds Adjuvant System
prior to checking the antisera for sufficient titer. The inoculum
was prepared by diluting the antigen in 0.9% sodium chloride and
emulsifying with an equal volume of adjuvant. At weeks 0, 3, and 6,
a 20 .mu.g boost was administered to the mice. Freunds Complete
Adjuvant was used for the primary boost delivered subcutaneously,
and Freunds Incomplete Adjuvant was used for the next 2 intradermal
boosts. Two weeks after the 3rd boost, a sera sample was taken for
a specific anti-T. cruzi titer test, and mouse #230 was selected
for the fusion experiment. Three days prior to the fusion, mouse
#230 was administered a pre-fusion boost consisting of 25 .mu.g of
the FP10 recombinant antigen and 25 .mu.g of a 14 amino acid
synthetic peptide representing the L-domain of the FP10 recombinant
antigen.
[0245] Hybridoma Creation
[0246] Hybridomas were developed using PEG-mediated fusion
technique described in Galfre et al. (Galfre et al., 1977). The
RBf/dnJ mouse #230 was euthanized three days after the pre-fusion
boost, and the spleen was harvested. The B-cells were perfused from
the spleen, washed and re-suspended in an equal number of SP2/0
myeloma cells (ATTC deposit CRL-1581). The total cells were
pelleted, and the fusion was performed with 1 ml of PEG and
cultured at 37.degree. C. in HAT-supplemented GIBCO.RTM. H-SFM
(Invitrogen Corp., Carlsbad, Calif.) with 10% FBS (Hyclone, Logan,
Utah). Cells were plated into 96-well tissue culture plates and
incubated in a humidified 37.degree. C. incubator. The resulting
hybridomas were tested 10-14 days later for anti-T. cruzi FP10
reactivity in an EIA. A hybridoma secreting anti-T. cruzi FP10 mAb
known as 10-745 was selected.
[0247] Hybridoma Cloning
[0248] Hybrid 10-745 was selected for a limiting dilution cloning.
The cells were suspended and then serially diluted 10.sup.4,
10.sup.5 and 10.sup.6 into 20 ml of H-SFM with 10% FBS. Each
dilution was plated into a 96-well tissue culture plate with 0.2 ml
cell suspension per well. The plates were incubated for 10-14 days
at 37.degree. C. in a humidified incubator. As growth became
apparent, the supernates were tested in an anti-FP10 microtiter EIA
that resulted in the selection of clone 10-745-140.
[0249] Clone 10-745-140 was expanded in tissue culture to a
T75-flask, cell passage 2, in IMDM with 10% FBS. The pass 2 cell
suspension was pelleted by centrifugation. The pellet was then
resuspended in freeze medium and dispensed into appropriately
labeled cryovials. The vials were stored in liquid nitrogen storage
tanks.
Example 4: Cell Lines Producing Antibodies Against Chagas FRA
Recombinant Antigen (Chagas FRA 8-367-171)
[0250] Immunogen Source
[0251] The T. cruzi antigen cell line containing the FRA region
(SEQ ID NO.:8) comprised in the FP6 polypeptide, was obtained from
the laboratory of Dr. Louis Kirchoff, University of Iowa, for a
seed bank in Lake County. The cDNA sequence encoding this antigen
(SEQ ID NO.:7) was cloned into the pET expression vectors, and the
cells were processed and recombinant antigen purified as outlined
in Example 1.
[0252] Animal Immunizations
[0253] BALB/c female mice were immunized three times with purified
Chagas recombinant antigen FP6 using the Freunds Adjuvant System
prior to checking the antisera for sufficient titer. The inoculum
was prepared by diluting the antigen in 0.9% sodium chloride and
emulsifying with an equal volume of adjuvant. At weeks 0, 4, and
10, a 10 .mu.g boost was administered to the mice. Freunds Complete
Adjuvant was used for the primary boost delivered subcutaneously
and Freunds Incomplete Adjuvant was used for the next 2 intradermal
boosts. Two weeks after the 3rd boost, a sera sample was taken for
a specific anti-T. cruzi titer test, and mouse #1907 was selected
for the fusion experiment. Three days prior to fusion, mouse #1907
was administered a pre-fusion boost consisting of 25 .mu.g of the
recombinant antigen and 25 .mu.g of a synthetic peptide
representing the FRA-domain of the recombinant antigen.
[0254] Hybridoma Creation
[0255] Hybridomas were developed using PEG-mediated fusion
technique described in Galfre et al. (Galfre et al., 1977). The
BALB/c mouse #1907 was euthanized three days after the pre-fusion
boost, and the spleen was harvested. The B-cells were perfused from
the spleen, washed and re-suspended in an equal number of SP2/0
myeloma cells (ATTC deposit CRL-1581). The total cells were
pelleted, and the fusion was performed with 1 ml of PEG and
cultured at 37.degree. C. in HAT-supplemented GIBCO.RTM. H-SFM
(Invitrogen Corp., Carlsbad, Calif.) with 10% FBS (Hyclone, Logan,
Utah). Cells were plated into 96-well tissue culture plates and
incubated in a humidified 37.degree. C. incubator. The resulting
hybridomas were tested 10-14 days later for anti-T. cruzi
FRA-domain reactivity in an EIA. A hybridoma secreting anti-T.
cruzi FRA-domain mAb known as 8-367 was selected.
[0256] Hybridoma Cloning
[0257] Hybrid 8-367 was selected for a limiting dilution cloning.
The cells were suspended and then serially diluted 10.sup.4,
10.sup.5 and 10.sup.6 dilutions into 20 ml of H-SFM with 10% FBS.
Each dilution was plated into a 96-well tissue culture plate with
0.2 ml cell suspension per well. The plates were incubated for
10-14 days at 37.degree. C. in a humidified incubator. As growth
became apparent, the supernates were tested in an anti-FRA
microtiter EIA, and clone 8-367-171 was selected.
[0258] Clone 8-367-171 was expanded in tissue culture to a
T75-flask, cell passage 3, in IMDM with 10% FBS. The pass 2 cell
suspension was pelleted, re-suspended in freeze medium and
dispensed into cryovials. The vials were stored in liquid nitrogen
storage tanks.
Example 5: Cell Lines Producing Chimeric Anti-T. cruzi FP3 mAbs
(Chagas FP3 12-392-150CH02580-104)
[0259] In this and the subsequent examples directed towards the
creation of mammalian cell lines that express mouse-human chimeric
monoclonal antibodies, the following overall approach was taken.
After identifying hybridoma cells lines that secreted the desired
mAbs (such as the hybridomas of Examples 1-4), mRNA was isolated
from these cells and the antibody gene sequences identified. The
V.sub.L and V.sub.H sequences were then cloned into pBOS vectors,
which supplied the human antibody constant sequences (Mizushima S,
Nagata S., "pEF-BOS, a powerful mammalian expression vector."
Nucleic Acids Res. 1990 Sep. 11; 18(17):5322 and US 2005/0227289
(incorporated by reference for its teachings regarding the use of
these vectors and the vectors themselves)), which were then
co-transfected in a transient expression system to confirm that the
resulting chimeric antibodies were functional. Upon confirmation,
the V.sub.L sequences were sub-cloned into pJV, and the V.sub.H
sequences into pBV; these vectors where then used to construct a
stable pBJ expression vector. The pJV plasmid was obtained from
Abbott Laboratories (Abbott Bioresearch Center, Worcester, Mass.)
and comprises a SV40 promoter, a murine DHFR gene, an enhancer, a
promoter, and a lambda stuffer. The pBV plasmid (also obtained from
Abbott Laboratories, Abbott Bioresearch Center, Worcester, Mass.)
comprises an enhancer, a promoter, and a lambda stuffer. Chinese
Hamster Ovary (CHO) cells were then transfected with pBJ, stable
transfectants selected, and the secreted antibodies tested again.
FIG. 1 shows a schematic summary of the chimeric antibodies, where
the murine variable region genes (antigen binding portion) are
transferred into vectors where the human constant region genes are
appended.
[0260] Identification of Mouse V.sub.H and V.sub.L Sequences
[0261] Hybridoma cell line HBFP3 (Example 1) was cultured in H-SFM
to obtain .about.5.times.10.sup.6 cells for mRNA purification
according to standard mRNA extraction protocols. The purified mRNA
was used as a template with a mouse Ig primer set (Novagen (EMD
Biosciences, Inc.); Madison, Wis.) in an RT-PCR reaction. Positive
PCR products were observed from the heavy chain (H) primers B and C
(HB and HC clones) and from the light chain (L) primers A, B, C,
and G (LA, LB, LC, and LG clones). All positive PCR products were
gel-purified and cloned into pCR TOPO 2.1 TA vector (Invitrogen
Corp., Carlsbad, Calif.). The plasmid DNA was purified from
transformed bacterial cells and the V.sub.H or V.sub.L inserts were
confirmed by EcoRI digestion for each RT-PCR reaction that
generated appropriately sized products. The correct V.sub.H or
V.sub.L gene sequence was selected after sequence alignments
confirmed a consensus sequence among the clones. Chagas TOPO-TA
clone HB1 contained the correct V.sub.H gene sequence, and Chagas
TOPO-TA clone LG3 contained the correct V.sub.L gene sequence.
[0262] Cloning Murine V.sub.H and V.sub.L Genes into pBOS
Vectors
[0263] A pair of PCR primers containing a partial Kappa signal
sequence with an Nru I site on the 5'-primer, and a BsiW I site on
the 3'-primer was used to amplify the mouse V.sub.L gene from TOPO
clone LG3. Additionally, a pair of primers containing a partial
heavy chain signal sequence and an Nru I site on the 5'-primer, and
Sal I site on 3'-primer was used to amplify the mouse V.sub.H gene
from TOPO clone HB1. The V.sub.L PCR product was digested with Nru
I and BsiW I restriction enzymes and ligated into pBOS-hCk vector
digested with the same enzymes. The V.sub.H PCR product was
digested with Nru I and Sal I restriction enzymes and ligated into
pBOS-hCg1 vector digested with the same enzymes. Plasmids from a
number of transformed bacterial colonies were sequenced to confirm
the presence of either the Chagas V.sub.H or V.sub.L gene in their
respective vectors. Chagas 12-392-150 V.sub.H.sub._pBOS-H clone 4
and Chagas 12-392-150 V.sub.L.sub._pBOS-L clone 5 were deemed
correct.
[0264] Chimeric mAb Production and Functional Confirmation
[0265] Endotoxin-free plasmid preparations of Chagas 12-392-150
V.sub.H.sub._pBOS-H clone 1 and Chagas 12-392-150
V.sub.L.sub._pBOS-L clone 4 were used for transient transfection
into COS 7L cells by electroporation (GENE PULSER.RTM., Bio-Rad;
Hercules, Calif.). The transfected cells were incubated at
37.degree. C. in a 5% CO.sub.2 incubator for three days. The
chimeric antibody produced by the COS 7L cells were harvested by
centrifugation at 4000 rpm for 20 minutes and then purified using a
protein A affinity column (POROS A; Applied Biosystems; Foster
City, Calif.). To confirm activity, the harvested antibody was
assayed using surface plasmon resonance on a BIACORE.RTM.
instrument (Biacore (GE Healthcare); Piscataway, N.J.).
[0266] CHO Cell Line Stable Expression Vector Cloning
[0267] Chagas 12-392-150 V.sub.H.sub._pBOS-H clone 1 and Chagas
12-392-150 V.sub.L.sub._pBOS-L clone 4 were used to construct a
plasmid to generate a stable, transfected CHO cell line. First, Srf
I and Not I were used to isolate the V.sub.H-CH and V.sub.L-CL
genes from the pBOS vectors; these fragments were then cloned into
pBV or pJV vectors, respectively. Both vectors were acquired from
Abbott Bioresearch Center (Worcester, Mass.) and contained
regulatory sequences needed for the expression of the antibody
genes. The resulting pBV and pJV clones were analyzed by Srf I/Not
I restriction enzyme digestion and sequenced to determine Chagas
10-745 V.sub.H.sub._pBV clone 4 and Chagas 12-392-150 pJV clone 1
were correct. Second, the correct pBV or pJV clones were both
digested with Pac I and Asc I, and the resulting V.sub.H-CH and
V.sub.L-CL-containing DNA fragments were ligated to form a single
pBJ plasmid that contained both heavy and light chain genes. The
pBJ clones were screened by Srf I/Not I digestion to confirm the
presence of both antibody genes. The plasmid map for Chagas
12-392-150 Mu-Hu_pBJ clone 4 is shown in FIG. 2; the
double-stranded polynucleotide sequences of VH gene and VL gene
containing regions (and flanking sequences) are shown in FIGS.
3A-C.
[0268] CHO cell line B3.2 acquired from the Abbott Bioresearch
Center containing a deficient dihydrofolate reductase (DHFR) gene
was used for transfection and stable antibody expression. CHO B3.2
cells were transfected with Chagas 12-392-150 Mu-Hu pBJ clone 1
using calcium phosphate-mediated transfection. The transfected CHO
cells were cultured for several weeks with media lacking thymidine
to select for those cells that had incorporated the functional DHFR
gene present in the pBJ plasmid. Fluorescence-activated cell
sorting (FACS) was used to sort individual cells from the
transfected pool into 96-well plates. An antigen-specific EIA was
used to rank antibody production among the clones, and the highest
producers were expanded and re-assayed. Clones were then weaned
into serum-free media. The growth characteristics, antibody
production and clonality of the clones were monitored. Chagas FP3
clone 12-392-150 CHO 2580-104 was sub-cloned by sorting individual
cells into 96-well plates and then expanded to produce purified
antibody.
Example 6: Cell Lines Producing Chimeric Anti-T. cruzi Pep2 Epitope
(Anti-TcF and Anti-FP6) mAbs (Chagas Pep2 Clone 9-638-1928)
[0269] Identification of Mouse V.sub.H and V.sub.L Sequences
[0270] Hybridoma cell line HBPep2 (Example 2) was cultured in H-SFM
to obtain .about.5.times.10.sup.6 cells for mRNA purification
according to standard mRNA extraction protocols. The purified mRNA
was used as a template with a mouse Ig primer set (Novagen (EMD
Biosciences, Inc.)) for a RT-PCR reaction. Positive PCR products
were observed from the heavy chain (H) primers B and E (HB and HE
clones) and from the light chain (L) primers B, C, D, E, F and G
(LB, LC, LD, LE, LF and LG clones). All positive PCR products were
gel-purified and cloned into pCR TOPO 2.1 TA vector (Invitrogen
Corp., Carlsbad, Calif.). The plasmid DNA was purified from
transformed bacterial cells and the V.sub.H or V.sub.L inserts were
confirmed by EcoRI digestion for each RT-PCR reaction that
generated appropriately sized products. The correct V.sub.H or
V.sub.L gene sequence was selected after sequence alignments
confirmed a consensus sequence among the clones. Chagas TOPO-TA
clone HE2 contained the correct V.sub.H gene sequence, and Chagas
TOPO-TA clone LG1 contained the correct V.sub.L gene sequence.
[0271] Cloning Murine V.sub.H and V.sub.L Genes into pBOS
Vectors
[0272] A pair of PCR primers containing a partial Kappa signal
sequence and an Nru I site on the 5'-primer, and a BsiW I site on
the 3'-primer was used to amplify the mouse V.sub.L gene from TOPO
clone LG1. Additionally, a pair of primers containing a partial
heavy chain signal sequence and an Nru I site on the 5'-primer, and
Sal I site on 3'-primer was used to amplify the mouse V.sub.H gene
from TOPO clone HE2. The V.sub.L PCR product was digested with Nru
I and BsiW I restriction enzymes and ligated into pBOS-hCk vector
digested with the same enzymes. The V.sub.H PCR product was
digested with Nru I and Sal I restriction enzymes and ligated into
pBOS-hCg1vector digested with the same enzymes. Plasmids from a
number of transformed bacterial colonies were sequenced to confirm
the presence of either the Chagas V.sub.H or V.sub.L gene in their
respective vectors. Chagas 9-638 V.sub.H.sub._pBOS-H clone A2 and
Chagas 9-638 V.sub.L.sub._pBOS-L clone B6 were deemed correct.
[0273] Chimeric mAb Production and Functional Confirmation
[0274] Endotoxin-free plasmid preparations of Chagas 9-638
V.sub.H.sub._pBOS-H clone A2 and Chagas 9-638 V.sub.L.sub._pBOS-L
clone B6 were used for transient transfection into COS 7L cells by
electroporation (GENE PULSER.RTM., Bio-Rad, Hercules, Calif.). The
transfected cells were incubated at 37.degree. C. in a 5% CO.sub.2
incubator for three days. The chimeric antibody produced by the COS
7L cells were harvested by centrifugation at 4000 rpm for 20
minutes and then purified using a protein A affinity column (POROS
A; Applied Biosystems). To confirm activity, the harvested antibody
was assayed using surface plasmon resonance on a BIACORE.RTM.
instrument (Biacore (GE Healthcare); Piscataway, N.J.). Affinity
was approximately 2.6 nM.
[0275] CHO Cell Line Stable Expression Vector Cloning
[0276] Chagas 9-638 V.sub.H.sub._pBOS-H clone A2 and Chagas 9-638
V.sub.L.sub._pBOS-L clone B6 were used to construct a plasmid to
generate a stable, transfected CHO cell line. First, Srf I and Not
I were used to isolate the V.sub.H-CH and V.sub.L-CL genes from the
pBOS vectors; these fragments were then cloned into pBV or pJV
vectors, respectively. The resulting pBV and pJV clones were
analyzed by Srf I/Not I restriction enzyme digestion and sequenced
to determine Chagas 9-638 V.sub.H pBV clone 10 and Chagas 9-638 pJV
clone 10 were correct. Second, the correct pBV or pJV clones were
both digested with Pac I and Asc I, and the resulting V.sub.H-CH
and V.sub.L-CL-containing DNA fragments were ligated to form a
single pBJ plasmid that contains both heavy and light chain genes.
The pBJ clones were screened by Srf I/Not I digestion to confirm
the presence of both antibody genes. The plasmid map for Chagas
9-638 Mu-Hu_pBJ clone 2 is shown in FIG. 4.
[0277] CHO cell line B3.2 acquired from the Abbott Bioresearch
Center containing a deficient DHFR gene was used for transfection
and stable antibody expression. CHO B3.2 cells were transfected
with Chagas 9-638 Mu-Hu_pBJ clone 2 using calcium
phosphate-mediated transfection. The transfected CHO cells were
cultured for several weeks with media lacking thymidine to select
for those cells that had incorporated the functional DHFR gene
present in the pBJ plasmid. FACS was used to sort individual cells
from the transfected pool into 96-well plates. An antigen-specific
EIA was used to rank antibody production among the clones, and the
highest producers were expanded and re-assayed. Clones were then
weaned into serum-free media. The growth characteristics, antibody
production and clonality of the clones were monitored. Chagas Pep2
clone 9-638-1145 was chosen and re-subcloned by sorting individual
cells into 96-well plates, and then Chagas Pep2 clone 9-638-1928
expanded to produce purified antibody.
Example 7: Cell Lines Producing Chimeric Anti-T. cruzi FP10 mAbs
(Chagas FP10 10-745-3796)
[0278] Identification of Mouse V.sub.H and V.sub.L Sequences
[0279] Hybridoma cell line HBFP10 (Example 3) was cultured in H-SFM
to obtain .about.5.times.10.sup.6 cells for mRNA purification
according to standard mRNA extraction protocols. The purified mRNA
was used as a template with a mouse Ig primer set (Novagen (EMD
Biosciences, Inc.)) for a RT-PCR reaction. Positive PCR products
were observed from the heavy chain (H) primers B (HB clones) and
from the light chain (L) primers B, C, and G (LB, LC and LG
clones). All positive PCR products were gel-purified and cloned
into pCR TOPO 2.1 TA vector (Invitrogen Corp., Carlsbad, Calif.).
The plasmid DNA was purified from transformed bacterial cells and
the V.sub.H or V.sub.L inserts were confirmed by EcoRI digestion
for each RT-PCR reaction that generated appropriately sized
products. The correct V.sub.H or V.sub.L gene sequence was selected
after sequence alignments confirmed a consensus sequence among the
clones. Chagas TOPO-TA clone HB3 contained the correct V.sub.H gene
sequence, and Chagas TOPO-TA clone LG1 contained the correct
V.sub.L gene sequence.
[0280] Cloning Murine V.sub.H and V.sub.L Genes into pBOS
Vectors
[0281] A pair of PCR primers containing a partial Kappa signal
sequence and an Nru I site on the 5'-primer, and a BsiW I site on
the 3'-primer was used to amplify the mouse V.sub.L gene from TOPO
clone LG1. Additionally, a pair of primers containing a partial
heavy chain signal sequence and an Nru I site on the 5'-primer, and
Sal I site on 3'-primer was used to amplify the mouse V.sub.H gene
from TOPO clone HB3. The V.sub.L PCR product was digested with Nru
I and BsiW I restriction enzymes and ligated into pBOS-hCk vector
digested with the same enzymes. The V.sub.H PCR product was
digested with Nru I and Sal I restriction enzymes and ligated into
pBOS-hCg1vector digested with the same enzymes. Plasmids from a
number of transformed bacterial colonies were sequenced to confirm
the presence of either the Chagas V.sub.H or V.sub.L gene in their
respective vectors. Chagas 10-745 V.sub.H.sub._pBOS-H clone 4 and
Chagas 10-745 V.sub.L.sub._pBOS-L clone 5 were deemed correct.
[0282] Chimeric mAb Production and Functional Confirmation
[0283] Endotoxin-free plasmid preparations of Chagas 10-745
V.sub.H.sub._pBOS-H clone 4 and Chagas 10-745 V.sub.L.sub._pBOS-L
clone 5 were used for transient transfection into COS 7L cells by
electroporation (GENE PULSER.RTM., Bio-Rad). The transfected cells
were incubated at 37.degree. C. in a 5% CO.sub.2 incubator for
three days. The chimeric antibody produced by the COS 7L cells were
harvested by centrifugation at 4000 rpm for 20 minutes and then
purified using a protein A affinity column (POROS A; Applied
Biosystems). To confirm activity, the harvested antibody was
assayed using surface plasmon resonance on a BIACORE.RTM.
instrument (Biacore (GE Healthcare)).
[0284] CHO Cell Line Stable Expression Vector Cloning
[0285] Chagas 10-745 V.sub.H.sub._pBOS-H clone 4 and Chagas 10-745
V.sub.L.sub._pBOS-L clone 5 were used to construct a plasmid to
generate a stable, transfected CHO cell line. First, Srf I and Not
I were used to isolate the V.sub.H-CH and V.sub.L-CL genes from the
pBOS vectors; these fragments were then cloned into pBV or pJV
vectors, respectively. The resulting pBV and pJV clones were
analyzed by Srf I/Not I restriction enzyme digestion and sequenced
to determine Chagas 10-745 V.sub.H pBV clone 1 and Chagas 10-745
pJV clone 1 were correct. Second, the correct pBV or pJV clones
were both digested with Pac I and Asc I, and the resulting
V.sub.H-CH and V.sub.L-CL-containing DNA fragments were ligated to
form a single pBJ plasmid that contains both heavy and light chain
genes. The pBJ clones were screened by Srf I/Not I digestion to
confirm the presence of both antibody genes. The plasmid map for
Chagas 10-745 Mu-Hu_pBJ clone 1 is shown in FIG. 5.
[0286] CHO cell line B3.2 acquired from the Abbott Bioresearch
Center containing a deficient DHFR gene was used for transfection
and stable antibody expression. CHO B3.2 cells were transfected
with Chagas 10-745 Mu-Hu_pBJ clone 1 using calcium
phosphate-mediated transfection. The transfected CHO cells were
cultured for several weeks with media lacking thymidine to select
for those cells that had incorporated the functional DHFR gene
present in the pBJ plasmid. FACS was used to sort individual cells
from the transfected pool into 96-well plates. An antigen-specific
EIA was used to rank antibody production among the clones, and the
highest producers were expanded and re-assayed. Clones were then
weaned into serum-free media. The growth characteristics, antibody
production and clonality of the clones were monitored. Chagas FP10
clone 10-745-3649 was sub-cloned by sorting individual cells into
96-well plates and then expanded to produce purified antibody.
Example 8: Cell Lines Producing Chimeric Anti-T. cruzi FRA mAbs
(Prophetic Example)
[0287] Identification of Mouse V.sub.H and V.sub.L Sequences
[0288] Hybridoma cell line HBFRA (Example 4) is cultured in H-SFM
to obtain .about.5.times.10.sup.6 cells for mRNA purification
according to standard mRNA extraction protocols. The purified mRNA
is used as a template with a mouse Ig primer set (Novagen (EMD
Biosciences, Inc.)) for a RT-PCR reaction. Positive PCR products
are observed from the heavy chain (H) primers and from the light
chain (L) primers. All positive PCR products are gel-purified and
cloned into pCR TOPO 2.1 TA vector (Invitrogen Corp., Carlsbad,
Calif.). The plasmid DNA is purified from transformed bacterial
cells and the V.sub.H or V.sub.L inserts are confirmed by EcoRI
digestion for each RT-PCR reaction that generated appropriately
sized products. The correct V.sub.H or V.sub.L gene sequence is
selected after sequence alignments confirm a consensus sequence
among the clones.
[0289] Cloning Murine V.sub.H and V.sub.L Genes into pBOS
Vectors
[0290] A pair of PCR primers containing a partial Kappa signal
sequence and an Nru I site on the 5'-primer, and a BsiW I site on
the 3'-primer is used to amplify the mouse V.sub.L gene from TOPO.
Additionally, a pair of primers containing a partial heavy chain
signal sequence and an Nru I site on the 5'-primer, and Sal I site
on 3'-primer is used to amplify the mouse V.sub.H gene from TOPO
clone. The V.sub.L PCR product is digested with Nru I and BsiW I
restriction enzymes and ligated into pBOS-hCk vector digested with
the same enzymes. The V.sub.H PCR product is digested with Nru I
and Sal I restriction enzymes and ligated into pBOS-hCg1vector
digested with the same enzymes. Plasmids from a number of
transformed bacterial colonies are sequenced to confirm the
presence of either the Chagas V.sub.H or V.sub.L gene in their
respective vectors (Chagas V.sub.H.sub._pBOS-H and Chagas
V.sub.L.sub._pBOS-L).
[0291] Chimeric mAb Production and Functional Confirmation
[0292] Endotoxin-free plasmid preparations of Chagas
V.sub.H.sub._pBOS-H and Chagas V.sub.L.sub._pBOS-L are used for
transient transfection into COS 7L cells by electroporation (GENE
PULSER.RTM., Bio-Rad) or other transfection method. The transfected
cells are incubated at 37.degree. C. in a 5% CO.sub.2 incubator for
about three days. The chimeric antibody produced by the COS 7L
cells is harvested by centrifugation at 4000 rpm for 20 minutes and
then purified using a protein A affinity column (POROS A; Applied
Biosystems; Foster City, Calif.). To confirm activity, the
harvested antibody is assayed by, for example using surface plasmon
resonance on a BIACORE.RTM. instrument (Biacore (GE
Healthcare)).
[0293] CHO Cell Line Stable Expression Vector Cloning
[0294] Chagas V.sub.H.sub._pBOS-H and Chagas V.sub.L.sub._pBOS-L
are used to construct a plasmid to generate a stable, transfected
CHO cell line. First, Srf I and Not I are used to isolate the
V.sub.H-CH and V.sub.L-CL genes from the pBOS vectors; these
fragments are then cloned into pBV or pJV vectors, respectively.
The resulting pBV and pJV clones are analyzed by Srf I/Not I
restriction enzyme digestion and sequenced to determine that the
clones are correct. Second, the correct pBV or pJV clones are both
digested with Pac I and Asc I, and the resulting V.sub.H-CH and
V.sub.L-CL-containing DNA fragments are ligated to form a single
pBJ plasmid that contains both heavy and light chain genes. The pBJ
clones are screened by Srf I/Not I digestion to confirm the
presence of both antibody genes, resulting in Chagas Mu-Hu_pBJ.
[0295] A CHO cell line, such as CHO B3.2, containing a deficient
DHFR gene is used for transfection and stable antibody expression.
CHO B3.2 cells are transfected with Chagas Mu-Hu_pBJ using calcium
phosphate-mediated transfection or other transfection protocol. The
transfected CHO cells are cultured for several weeks with media
lacking thymidine to select for those cells that incorporate the
functional DHFR gene present in the pBJ plasmid. FACS can be used
to sort individual cells from the transfected pool into 96-well
plates. An antigen-specific EIA can be used to rank antibody
production among the clones, and the highest producers are expanded
and re-assayed. Clones are then weaned into serum-free media. The
growth characteristics, antibody production and clonality of the
clones are monitored. If desired, cell line clones can be
sub-cloned by sorting individual cells into 96-well plates and then
expanded to produce purified antibody.
Example 9: Kinetics/Affinity Determination of Recombinant Chimeric
Chagas Antibody for Chagas Antigen TcF
[0296] The kinetics/affinity were determined using a high density,
goat anti-human IgG Fc capture biosensor on a BIAcore 2000. The
flow cells were first equilibrated with a running buffer composed
of HBS-EP spiked with 6 g/L of Carboxymethyl-Dextran (hereinafter
referred to as a "Running Buffer") (Fluka) and 6 g/L BSA for 5
minutes at flow rate of 10 .mu.L/minutes. Next, recombinant
chimeric anti-Chagas monoclonal antibody, namely, 9-638-132 (Pep2
epitope in TcF and FP6), 10-745-140 (FP10) and 12-392-150 (FP3),
each diluted into Running Buffer, were injected over individual
flow cells and captured by the biosensor with one flow cell left
blank as a reference flow cell. The buffer flow rate was increased
to 100 .mu.L/minute and the flow cells were washed for 10 minutes
prior to a 150 .mu.L injection of the antigen at various
concentrations from 0 to 100 nM in Running Buffer followed by
Running Buffer alone for 60 to 360 seconds. The anti-human IgG
capture biosensor was then regenerated with three 33 .mu.L
injections of 100 mM H.sub.3PO.sub.4 and the steps above were
repeated until all concentrations of each Chagas antigen were
tested in duplicate. The binding kinetics, association (k.sub.a)
and dissociation (k.sub.d), were monitored for each antigen
injection by sensorgrams and the kinetics/affinity were determined
by Scrubber 2.0 software (BioLogic Software Pty Ltd., Australia).
The interactions between the recombinant chimeric anti-Chagas
monoclonal antibodies with the Pep2 epitope within the Chagas TcF
antigen are shown below in Table 14.
TABLE-US-00013 TABLE 14 Chimeric Chagas Ab k.sub.a
(M.sup.-1s.sup.-1) k.sub.d (s.sup.-1) K.sub.D (M) 9-638-132 4.0
.times. 10.sup.6 1.7 .times. 10.sup.-2 4.1 .times. 10.sup.-9
10-745-140 No binding was observed. 12-392-150
Example 10: Kinetics/Affinity Determination of Recombinant Chimeric
Chagas Antibody for Chagas Antigens FP3 and FP10
[0297] The kinetics/affinity were determined using a high density,
anti-His.sub.4 capture biosensor on a BIAcore 2000. The flow cells
were first equilibrated with a Running Buffer (as defined above in
Example 9) composed of HBS-EP buffer spiked with 1% BSA and 1%
Tween 20 for 5 minutes at a flow rate 50 .mu.L/minute. Next, Chagas
antigens (each antigen contains a His.sub.6 tag), namely FP10 and
FP3, were each diluted into Running Buffer, injected over
individual flow cells, and captured by the biosensor with one flow
cell left blank as a reference flow cell. The buffer flow rate was
increased to 100 .mu.L/minute and the flow cells were washed for 5
minutes prior to a 150 .mu.L injection of each of the recombinant
Chimeric anti-Chagas monoclonal antibodies, namely, 9-638-132 (Pep2
epitope in TcF and FP6), 10-745-140 (FP10) and 12-392-150 (FP3), at
various concentrations from 0 to 300 nM in Running Buffer followed
by Running Buffer alone for 60 to 360 seconds. The anti-His.sub.4
capture biosensor was then regenerated with two 35 .mu.L injections
of Gentle Ab/Ag Elution Buffer (Pierce) spiked with 2.5 mM
H.sub.3PO.sub.4 and two 25 .mu.L injections of 5 mM H.sub.3PO.sub.4
and the steps above were repeated until all concentrations of each
Chimeric anti-Chagas antibody were tested in duplicate. The binding
kinetics, association (k.sub.a) and dissociation (k.sub.d) were
monitored for each antibody injection by sensorgrams and the
kinetics/affinity were determined by Scrubber 2.0 software
(BioLogic Software Pty Ltd., Australia). The interactions between
the recombinant chimeric anti-Chagas monoclonal antibodies with the
Chagas FP10 antigen are shown below in Table 15. The interactions
between the recombinant chimeric anti-Chagas monoclonal antibodies
with the Chagas FP3 antigen are shown below in Table 16.
TABLE-US-00014 TABLE 15 Chimeric Chagas Ab k.sub.a
(M.sup.-1s.sup.-1) k.sub.d (s.sup.-1) K.sub.D (M) 9-638-132 No
binding was observed. 10-745-140 1.2 .times. 10.sup.5 3.6 .times.
10.sup.-4 2.9 .times. 10.sup.-9 12-392-150 No binding was
observed.
TABLE-US-00015 TABLE 16 Chimeric Chagas Ab k.sub.a
(M.sup.-1s.sup.-1) k.sub.d (s.sup.-1) K.sub.D (M) 9-638-132 No
binding was observed. 10-745-140 12-392-150 2.7 .times. 10.sup.6
3.8 .times. 10.sup.-4 1.4 .times. 10.sup.-10
Example 11: Kinetics/Affinity Determination of Murine Chagas
Antibody for Chagas Antigens
[0298] The kinetics/affinity were determined using a high density,
rabbit anti-mouse IgG capture biosensor on a BIAcore 2000. The flow
cells were first equilibrated with a Running Buffer composed of
HBS-EP buffer spiked with 1% BSA, 1% Carboxymethyl-Dextran
("Running Buffer") (Fluka), and 0.1% Tween 20 at 5 .mu.L/minute for
5 minutes. Next, each murine anti-Chagas antibody (namely,
monoclonal antibodies (mAbs) 8-367-171 (FRA), 9-638-132 (Pep2
epitope in TcF and FP6), 10-745-140 (FP10) and 12-392-150 (FP3)
diluted into Running Buffer, was injected over individual flow
cells and captured by the biosensor. The buffer flow rate was
increased to 60 .mu.l/min and the flow cells were washed for 5
minutes prior to a 150 .mu.L injection of Chagas antigen at various
concentrations from 0 to 200 nM in Running Buffer followed by
Running Buffer alone for 60 to 360 seconds. The flow rate was then
changed to 10 .mu.L/minute and the anti-mouse IgG capture biosensor
was then regenerated with one 30 .mu.L injection of 10 mM Glycine
pH 1.7 and the steps above were repeated until all concentrations
of each Chagas antigen were tested in duplicate. The binding
kinetics, association (k.sub.a) and dissociation (k.sub.d) were
monitored for each antigen injection by sensorgrams and the
kinetics/affinity were determined by Scrubber 2.0 software
(BioLogic Software Pty Ltd., Australia).
[0299] For Chagas antigens FRA, FP6, TcF, and FP3, the flow cell
containing anti-Chagas mAb 10-745-140 was used as the reference
flow cell. The flow cell containing anti-Chagas mAb 9-638-132 was
used as the reference flow cell for Chagas antigen FP10. The
interaction between the monoclonal anti-Chagas antibodies with the
Chagas FRA antigen itself is shown below in Table 17. The
interaction between the monoclonal anti-Chagas antibodies with the
FRA and the Chagas PEP2 epitope of the Chagas FP6 antigen is shown
below in Table 18. The interaction between the monoclonal
anti-Chagas antibodies with the Chagas PEP2 epitope of the Chagas
TcF antigen is shown below in Table 19. The interaction between the
monoclonal anti-Chagas antibodies with the Chagas FP10 antigen is
shown below in Table 20. The interaction between the monoclonal
anti-Chagas antibodies with the Chagas FP3 antigen is shown below
in Table 21.
TABLE-US-00016 TABLE 17 Murine Chagas Ab k.sub.a (M.sup.-1s.sup.-1)
k.sub.d (s.sup.-1) K.sub.D (M) 8-367-171 3.6 .times. 10.sup.6 1.3
.times. 10.sup.-1 3.7 .times. 10.sup.-8 9-638-132 No binding was
observed 10-745-140 12-392-150
TABLE-US-00017 TABLE 18 Murine Chagas Ab k.sub.a (M.sup.-1s.sup.-1)
k.sub.d (s.sup.-1) K.sub.D (M) 8-367-171 1.5 .times. 10.sup.6 7.9
.times. 10.sup.-3 5.2 .times. 10.sup.-9 9-638-132 Binding was
observed, but could not be fit to 1:1 model 10-745-140 No binding
was observed 12-392-150
TABLE-US-00018 TABLE 19 Murine Chagas Ab k.sub.a (M.sup.-1s.sup.-1)
k.sub.d (s.sup.-1) K.sub.D (M) 8-367-171 No binding was observed
9-638-132 2.1 .times. 10.sup.6 1.2 .times. 10.sup.-2 5.7 .times.
10.sup.-9 10-745-140 No binding was observed 12-392-150
TABLE-US-00019 TABLE 20 Murine Chagas Ab k.sub.a (M.sup.-1s.sup.-1)
k.sub.d (s.sup.-1) K.sub.D (M) 8-367-171 No binding was observed
9-638-132 10-745-140 1.1 .times. 10.sup.5 2.2 .times. 10.sup.-4 1.9
.times. 10.sup.-9 12-392-150 No binding was observed
TABLE-US-00020 TABLE 21 Murine Chagas Ab k.sub.a (M.sup.-1s.sup.-1)
k.sub.d (s.sup.-1) K.sub.D (M) 8-367-171 No binding was observed
9-638-132 10-745-140 12-392-150 5.6 .times. 10.sup.5 5 .times.
10.sup.-5 8 .times. 10.sup.-11
[0300] One skilled in the art would readily appreciate that the
present disclosure is well adapted to carry out the objects and
obtain the ends and advantages mentioned, as well as those inherent
therein. The molecular complexes and the methods, procedures,
treatments, molecules, specific compounds described herein are
presently representative of preferred embodiments, are exemplary,
and are not intended as limitations on the scope of the disclosure.
It will be readily apparent to one skilled in the art that varying
substitutions and modifications may be made to the disclosure
disclosed herein without departing from the scope and spirit of the
disclosure.
[0301] All patents and publications mentioned in the specification
are indicative of the levels of those skilled in the art to which
the disclosure pertains. All patents and publications are herein
incorporated by reference to the same extent as if each individual
publication was specifically and individually indicated to be
incorporated by reference.
Sequence CWU 1
1
2811518DNAArtificial Sequencesynthetic 1atggcccagc tccaacaggc
agaaaataat atcactaatt ccaaaaaaga aatgacaaag 60ctacgagaaa aagtgaaaaa
ggccgagaaa gaaaaattgg acgccattaa ccgggcaacc 120aagctggaag
aggaacgaaa ccaagcgtac aaagcagcac acaaggcaga ggaggaaaag
180gctaaaacat ttcaacgcct tataacattt gagtcggaaa atattaactt
aaagaaaagg 240ccaaatgacg cagtttcaaa tcgggataag aaaaaaaatt
ctgaaaccgc aaaaactgac 300gaagtagaga aacagagggc ggctgaggct
gccaaggccg tggagacgga gaagcagagg 360gcagctgagg ccacgaaggt
tgccgaagcg gagaagcgga aggcagctga ggccgccaag 420gccgtggaga
cggagaagca gagggcagct gaagccacga aggttgccga agcggagaag
480cagaaggcag ctgaggccgc caaggccgtg gagacggaga agcagagggc
agctgaagcc 540acgaaggttg ccgaagcgga gaagcagagg gcagctgaag
ccatgaaggt tgccgaagcg 600gagaagcaga aggcagctga ggccgccaag
gccgtggaga cggagaagca gagggcagct 660gaagccacga aggttgccga
agcggagaag cagaaggcag ctgaggccgc caaggccgtg 720gagacggaga
agcagagggc agctgaagcc acgaaggttg ccgaagcgga gaagcagaag
780gcagctgagg ccgccaaggc cgtggagacg gagaagcaga gggcagctga
agccacgaag 840gttgccgaag cggagaagga tatcgatccc atgggtgctt
gtgggtcgaa ggactcgacg 900agcgacaagg ggttggcgag cgataaggac
ggcaagaacg ccaaggaccg caaggaagcg 960tgggagcgca ttcgccaggc
gattcctcgt gagaagaccg ccgaggcaaa acagcgccgc 1020atcgagctct
tcaagaagtt cgacaagaac gagaccggga agctgtgcta cgatgaggtg
1080cacagcggct gcctcgaggt gctgaagttg gacgagttca cgccgcgagt
gcgcgacatc 1140acgaagcgtg cattcgacaa ggcgagggcc ctgggcagca
agctggagaa caagggctcc 1200gaggactttg ttgaatttct ggagttccgt
ctgatgctgt gctacatcta cgacttcttc 1260gagctgacgg tgatgttcga
cgagattgac gcctccggca acatgctggt tgacgaggag 1320gagttcaagc
gcgccgtgcc caggcttgag gcgtggggcg ccaaggtcga ggatcccgcg
1380gcgctgttca aggagctcga taagaacggc actgggtccg tgacgttcga
cgagtttgct 1440gcgtgggctt ctgcagtcaa actggacgcc gacggcgacc
cggacaacgt gccggagagc 1500ccgagaccga tgggaatc 15182506PRTArtificial
Sequencesynthetic 2Met Ala Gln Leu Gln Gln Ala Glu Asn Asn Ile Thr
Asn Ser Lys Lys1 5 10 15Glu Met Thr Lys Leu Arg Glu Lys Val Lys Lys
Ala Glu Lys Glu Lys 20 25 30Leu Asp Ala Ile Asn Arg Ala Thr Lys Leu
Glu Glu Glu Arg Asn Gln 35 40 45Ala Tyr Lys Ala Ala His Lys Ala Glu
Glu Glu Lys Ala Lys Thr Phe 50 55 60Gln Arg Leu Ile Thr Phe Glu Ser
Glu Asn Ile Asn Leu Lys Lys Arg65 70 75 80Pro Asn Asp Ala Val Ser
Asn Arg Asp Lys Lys Lys Asn Ser Glu Thr 85 90 95Ala Lys Thr Asp Glu
Val Glu Lys Gln Arg Ala Ala Glu Ala Ala Lys 100 105 110Ala Val Glu
Thr Glu Lys Gln Arg Ala Ala Glu Ala Thr Lys Val Ala 115 120 125Glu
Ala Glu Lys Arg Lys Ala Ala Glu Ala Ala Lys Ala Val Glu Thr 130 135
140Glu Lys Gln Arg Ala Ala Glu Ala Thr Lys Val Ala Glu Ala Glu
Lys145 150 155 160Gln Lys Ala Ala Glu Ala Ala Lys Ala Val Glu Thr
Glu Lys Gln Arg 165 170 175Ala Ala Glu Ala Thr Lys Val Ala Glu Ala
Glu Lys Gln Arg Ala Ala 180 185 190Glu Ala Met Lys Val Ala Glu Ala
Glu Lys Gln Lys Ala Ala Glu Ala 195 200 205Ala Lys Ala Val Glu Thr
Glu Lys Gln Arg Ala Ala Glu Ala Thr Lys 210 215 220Val Ala Glu Ala
Glu Lys Gln Lys Ala Ala Glu Ala Ala Lys Ala Val225 230 235 240Glu
Thr Glu Lys Gln Arg Ala Ala Glu Ala Thr Lys Val Ala Glu Ala 245 250
255Glu Lys Gln Lys Ala Ala Glu Ala Ala Lys Ala Val Glu Thr Glu Lys
260 265 270Gln Arg Ala Ala Glu Ala Thr Lys Val Ala Glu Ala Glu Lys
Asp Ile 275 280 285Asp Pro Met Gly Ala Cys Gly Ser Lys Asp Ser Thr
Ser Asp Lys Gly 290 295 300Leu Ala Ser Asp Lys Asp Gly Lys Asn Ala
Lys Asp Arg Lys Glu Ala305 310 315 320Trp Glu Arg Ile Arg Gln Ala
Ile Pro Arg Glu Lys Thr Ala Glu Ala 325 330 335Lys Gln Arg Arg Ile
Glu Leu Phe Lys Lys Phe Asp Lys Asn Glu Thr 340 345 350Gly Lys Leu
Cys Tyr Asp Glu Val His Ser Gly Cys Leu Glu Val Leu 355 360 365Lys
Leu Asp Glu Phe Thr Pro Arg Val Arg Asp Ile Thr Lys Arg Ala 370 375
380Phe Asp Lys Ala Arg Ala Leu Gly Ser Lys Leu Glu Asn Lys Gly
Ser385 390 395 400Glu Asp Phe Val Glu Phe Leu Glu Phe Arg Leu Met
Leu Cys Tyr Ile 405 410 415Tyr Asp Phe Phe Glu Leu Thr Val Met Phe
Asp Glu Ile Asp Ala Ser 420 425 430Gly Asn Met Leu Val Asp Glu Glu
Glu Phe Lys Arg Ala Val Pro Arg 435 440 445Leu Glu Ala Trp Gly Ala
Lys Val Glu Asp Pro Ala Ala Leu Phe Lys 450 455 460Glu Leu Asp Lys
Asn Gly Thr Gly Ser Val Thr Phe Asp Glu Phe Ala465 470 475 480Ala
Trp Ala Ser Ala Val Lys Leu Asp Ala Asp Gly Asp Pro Asp Asn 485 490
495Val Pro Glu Ser Pro Arg Pro Met Gly Ile 500 505366DNAArtificial
Sequencesynthetic 3ggtgacaaac catcaccatt tggacaggcc gcagcaggtg
acaaaccatc accatttgga 60caggcc 66422PRTArtificial Sequencesynthetic
4Gly Asp Lys Pro Ser Pro Phe Gly Gln Ala Ala Ala Gly Asp Lys Pro1 5
10 15Ser Pro Phe Gly Gln Ala 2051557DNAArtificial Sequencesynthetic
5gatccaacgt atcgttttgc aaaccacgcg ttcacgctgg tggcgtcggt gacgattcac
60gaggttccga gcgtcgcgag tcctttgctg ggtgcgagcc tggactcttc tggtggcaaa
120aaactcctgg ggctctcgta cgacgagaag caccagtggc agccaatata
cggatcaacg 180ccggtgacgc cgaccggatc gtgggagatg ggtaagaggt
accacgtggt tcttacgatg 240gcgaataaaa ttggctccgt gtacattgat
ggagaacctc tggagggttc agggcagacc 300gttgtgccag acgagaggac
gcctgacatc tcccacttct acgttggcgg gtatggaagg 360agtgatatgc
caaccataag ccacgtgacg gtgaataatg ttcttcttta caaccgtcag
420ctgaatgccg aggagatcag gaccttgttc ttgagccagg acctgattgg
cacggaagca 480cacatgggca gcagcagcgg cagcagtgcc cacggtacgc
cctcgattcc cgttgacagc 540agtgcccacg gtacaccctc gactcccgtt
gacagcagtg cccacggtac gccctcgact 600cccgttgaca gcagtgccca
cggtacaccc tcgactcccg ttgacagcag tgcccacggt 660acaccctcga
ctcccgttga cagcagtgcc cacggtaagc cctcgactcc cgctgacagc
720agtgcccaca gtacgccctc gactcccgct gacagcagtg cccacagtac
gccctcaatt 780cccgctgaca gcagtgccca cagtacgccc tcagctcccg
ctgacaacgg cgccaatggt 840acggttttga ttttgtcgac tcatgacgcg
tacaggcccg ttgatccctc ggcgtacaag 900cgcgccttgc cgcaggaaga
gcaagaggat gtggggccgc gccacgttga tcccgaccac 960ttccgctcga
cctcgacgac tcatgacgcg tacaggcccg ttgatccctc ggcgtacaag
1020cgcgccttgc cgcaggaaga gcaagaggat gtggggccgc gccacgttga
tcccgaccac 1080ttccgctcga cgactcatga cgcgtacagg cccgttgatc
cctcggcgta caagcgcgcc 1140ttgccgcagg aagagcaaga ggatgtgggg
ccgcgccacg ttgatcccga ccacttccgc 1200tcgacctcga cgactcatga
cgcgtacagg cccgttgatc cctcggcgta caagcgcgcc 1260ttgccgcagg
aagagcaaga ggatgtgggg ccgcgccacg ttgatcccga ccacttccgc
1320tcgacctcga cgactcatga cgcgtacagg cccgttgatc cctcggcgta
caagcgcgcc 1380ttgccgcagg aagagcaaga ggatgtgggg ccgcgccacg
ttgatcccga ccacttccgc 1440tcgacgactc atgacgcgta caggcccgtt
gatccctcgg cgtacaagcg cgccttgccg 1500caggaagagc aagaggatgt
ggggccgcgc cacgttgatc ccgaccactt ccgctcg 15576519PRTArtificial
Sequencesynthetic 6Asp Pro Thr Tyr Arg Phe Ala Asn His Ala Phe Thr
Leu Val Ala Ser1 5 10 15Val Thr Ile His Glu Val Pro Ser Val Ala Ser
Pro Leu Leu Gly Ala 20 25 30Ser Leu Asp Ser Ser Gly Gly Lys Lys Leu
Leu Gly Leu Ser Tyr Asp 35 40 45Glu Lys His Gln Trp Gln Pro Ile Tyr
Gly Ser Thr Pro Val Thr Pro 50 55 60Thr Gly Ser Trp Glu Met Gly Lys
Arg Tyr His Val Val Leu Thr Met65 70 75 80Ala Asn Lys Ile Gly Ser
Val Tyr Ile Asp Gly Glu Pro Leu Glu Gly 85 90 95Ser Gly Gln Thr Val
Val Pro Asp Glu Arg Thr Pro Asp Ile Ser His 100 105 110Phe Tyr Val
Gly Gly Tyr Gly Arg Ser Asp Met Pro Thr Ile Ser His 115 120 125Val
Thr Val Asn Asn Val Leu Leu Tyr Asn Arg Gln Leu Asn Ala Glu 130 135
140Glu Ile Arg Thr Leu Phe Leu Ser Gln Asp Leu Ile Gly Thr Glu
Ala145 150 155 160His Met Gly Ser Ser Ser Gly Ser Ser Ala His Gly
Thr Pro Ser Ile 165 170 175Pro Val Asp Ser Ser Ala His Gly Thr Pro
Ser Thr Pro Val Asp Ser 180 185 190Ser Ala His Gly Thr Pro Ser Thr
Pro Val Asp Ser Ser Ala His Gly 195 200 205Thr Pro Ser Thr Pro Val
Asp Ser Ser Ala His Gly Thr Pro Ser Thr 210 215 220Pro Val Asp Ser
Ser Ala His Gly Lys Pro Ser Thr Pro Ala Asp Ser225 230 235 240Ser
Ala His Ser Thr Pro Ser Thr Pro Ala Asp Ser Ser Ala His Ser 245 250
255Thr Pro Ser Ile Pro Ala Asp Ser Ser Ala His Ser Thr Pro Ser Ala
260 265 270Pro Ala Asp Asn Gly Ala Asn Gly Thr Val Leu Ile Leu Ser
Thr His 275 280 285Asp Ala Tyr Arg Pro Val Asp Pro Ser Ala Tyr Lys
Arg Ala Leu Pro 290 295 300Gln Glu Glu Gln Glu Asp Val Gly Pro Arg
His Val Asp Pro Asp His305 310 315 320Phe Arg Ser Thr Ser Thr Thr
His Asp Ala Tyr Arg Pro Val Asp Pro 325 330 335Ser Ala Tyr Lys Arg
Ala Leu Pro Gln Glu Glu Gln Glu Asp Val Gly 340 345 350Pro Arg His
Val Asp Pro Asp His Phe Arg Ser Thr Thr His Asp Ala 355 360 365Tyr
Arg Pro Val Asp Pro Ser Ala Tyr Lys Arg Ala Leu Pro Gln Glu 370 375
380Glu Gln Glu Asp Val Gly Pro Arg His Val Asp Pro Asp His Phe
Arg385 390 395 400Ser Thr Ser Thr Thr His Asp Ala Tyr Arg Pro Val
Asp Pro Ser Ala 405 410 415Tyr Lys Arg Ala Leu Pro Gln Glu Glu Gln
Glu Asp Val Gly Pro Arg 420 425 430His Val Asp Pro Asp His Phe Arg
Ser Thr Ser Thr Thr His Asp Ala 435 440 445Tyr Arg Pro Val Asp Pro
Ser Ala Tyr Lys Arg Ala Leu Pro Gln Glu 450 455 460Glu Gln Glu Asp
Val Gly Pro Arg His Val Asp Pro Asp His Phe Arg465 470 475 480Ser
Thr Thr His Asp Ala Tyr Arg Pro Val Asp Pro Ser Ala Tyr Lys 485 490
495Arg Ala Leu Pro Gln Glu Glu Gln Glu Asp Val Gly Pro Arg His Val
500 505 510Asp Pro Asp His Phe Arg Ser 5157213DNAArtificial
Sequencesynthetic 7atggagtcag gagcgtcaga tcagctgctc gagaaggacc
cgcgtcagga acgcgaagga 60gattgctgcg cttgaggaga gtcatgaatg cccgcgtcat
caggagctgg cgcgcgagaa 120gaagcttgcc gaccgcgcgt tccttgactc
agaagccgga gcgcgtgccg ctggctgacg 180tgccgctcga cgacgatcag
cgactttgtt gcg 213868PRTArtificial Sequencesynthetic 8Met Glu Gln
Glu Arg Arg Gln Leu Leu Glu Lys Asp Pro Arg Arg Asn1 5 10 15Ala Lys
Glu Ile Ala Ala Leu Glu Glu Ser Met Asn Ala Arg Ala Gln 20 25 30Glu
Leu Ala Arg Glu Lys Lys Leu Ala Asp Arg Ala Phe Leu Asp Gln 35 40
45Lys Pro Glu Arg Val Pro Leu Ala Asp Val Pro Leu Asp Asp Asp Ser
50 55 60Asp Phe Val Ala659336DNAArtificial Sequencesynthetic
9tacattgtga tgtcacagtc tccatcctcc ctggctgtgt cagcaggaga gaaggtcact
60atgagctgca aatccagtca gagtctgctc aacagtagaa cccgaaagaa ccacttggct
120tggtatcagc agaaaccagg gcagtctcct aaactgctga tctactgggc
atccactagg 180gaatctgggg tccctgatcg cttcacaggc agtggatctg
ggacagattt cgctctcacc 240atcagcagtg tgcaggctga agacctggca
gtttatttct gcaagcaatc ttataatctg 300tacacattcg gtgctgggac
caagctggag ctgaaa 33610112PRTArtificial Sequencesynthetic 10Tyr Ile
Val Met Ser Gln Ser Pro Ser Ser Leu Ala Val Ser Ala Gly1 5 10 15Glu
Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Asn Ser 20 25
30Arg Thr Arg Lys Asn His Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln
35 40 45Ser Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly
Val 50 55 60Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Ala
Leu Thr65 70 75 80Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr
Phe Cys Lys Gln 85 90 95Ser Tyr Asn Leu Tyr Thr Phe Gly Ala Gly Thr
Lys Leu Glu Leu Lys 100 105 11011366DNAArtificial Sequencesynthetic
11gatgtgcagc tggtggagtc tgggggaggc ttagtgcagc ctggagggtc ccggaaactc
60tcctgtgcag cctctggatt cactttcagt gtctttggaa tgcactgggt tcgtcaggct
120ccagagaagg ggctggagtg ggtcgcatac attagtagtg gcagtactat
catctattat 180gcagacacag tgaagggccg attcaccatc tccagagaca
atcccaagaa caccctgttc 240ctgcaaatga ccggtctaag gtctgaggac
acggccatgt attactgtgc aagaccgctc 300tactatgatt acgacgacta
tgctatggac tactggggtc aaggaacctc agtcaccgtc 360tcctca
36612122PRTArtificial Sequencesynthetic 12Asp Val Gln Leu Val Glu
Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Arg Lys Leu Ser
Cys Ala Ala Ser Gly Phe Thr Phe Ser Val Phe 20 25 30Gly Met His Trp
Val Arg Gln Ala Pro Glu Lys Gly Leu Glu Trp Val 35 40 45Ala Tyr Ile
Ser Ser Gly Ser Thr Ile Ile Tyr Tyr Ala Asp Thr Val 50 55 60Lys Gly
Arg Phe Thr Ile Ser Arg Asp Asn Pro Lys Asn Thr Leu Phe65 70 75
80Leu Gln Met Thr Gly Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys
85 90 95Ala Arg Pro Leu Tyr Tyr Asp Tyr Asp Asp Tyr Ala Met Asp Tyr
Trp 100 105 110Gly Gln Gly Thr Ser Val Thr Val Ser Ser 115
12013336DNAArtificial Sequencesynthetic 13gacattgtga tgtcacagtc
tccatcctcc ctggctgtgt cagcaggaga gcaggtcact 60atgagctgca aatccagtca
gagtctgttc aacagtagaa cccgaaagaa ctacttggct 120tggtaccagc
agaaaccagg gcagtctcct aaactgctga tctactgggc atccactagg
180gaatctgggg tccctgatcg cttcacaggc agtggatctg ggacagattt
cactctcacc 240atcagcagtg tgcaggctga agacctggca gtttattact
gcaaacaatc ttataatctg 300ctcacgttcg gtgctgggac caagctggag ctgaaa
33614112PRTArtificial Sequencesynthetic 14Asp Ile Val Met Ser Gln
Ser Pro Ser Ser Leu Ala Val Ser Ala Gly1 5 10 15Glu Gln Val Thr Met
Ser Cys Lys Ser Ser Gln Ser Leu Phe Asn Ser 20 25 30Arg Thr Arg Lys
Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45Ser Pro Lys
Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60Pro Asp
Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr65 70 75
80Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Lys Gln
85 90 95Ser Tyr Asn Leu Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu
Lys 100 105 11015360DNAArtificial Sequencesynthetic 15caggtccaac
tgcagcagcc tggggctgaa ctggtgaggc ctggggcttc agtgaaactg 60tcctgcaagg
cttctggcta caccttcacc agctactgga tgaactgggt gaagttgagg
120cctggacaag gccttgaatg gattggtatg attgatcctt cagacagtga
aacttactac 180gatcaagtat tcaaggacaa ggccacattg actgttgaca
aatcctccag cacagcctac 240atgcatctca gcagcctgac atctgaggac
tctgcggtct attactgtgc aagatggatt 300acgactgatt cctatactat
ggactactgg ggtcaaggaa cctcagtcac cgtctcctca 36016120PRTArtificial
Sequencesynthetic 16Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val
Arg Pro Gly Ala1 5 10 15Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr
Thr Phe Thr Ser Tyr 20 25 30Trp Met Asn Trp Val Lys Leu Arg Pro Gly
Gln Gly Leu Glu Trp Ile 35 40 45Gly Met Ile Asp Pro Ser Asp Ser Glu
Thr Tyr Tyr Asp Gln Val Phe 50 55 60Lys Asp Lys Ala Thr Leu Thr Val
Asp Lys Ser Ser Ser Thr Ala Tyr65 70 75 80Met His Leu Ser Ser Leu
Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95Ala Arg Trp Ile Thr
Thr Asp Ser Tyr Thr Met Asp Tyr Trp Gly Gln 100
105 110Gly Thr Ser Val Thr Val Ser Ser 115 12017335DNAArtificial
Sequencesynthetic 17gatgttgtga tgacccaaac tccactctcc ctgcctgtca
gtcttggaga tcaagcctcc 60atctcttgca gatctagtca gagccttgta cacagtaatg
gaaaccctat ttacattggt 120acctgcagaa gccaggccag tctccaaagc
tcctgatcta caaagtttcc aaccgatttt 180ctggggtccc agacaggttc
agtggcagtg gatcagggac agatttcaca ctcaagatca 240gcagagtgga
ggctgaggat ctgggagttt atttctgctc tcaaagtaca catgttcctc
300cgacgttcgg tggaggcacc aagctggaaa tcaaa 33518112PRTArtificial
Sequencesynthetic 18Asp Val Val Met Thr Gln Thr Pro Leu Ser Leu Pro
Val Ser Leu Gly1 5 10 15Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln
Ser Leu Val His Ser 20 25 30Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu
Gln Lys Pro Gly Gln Ser 35 40 45Pro Lys Leu Leu Ile Tyr Lys Val Ser
Asn Arg Phe Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser
Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu
Asp Leu Gly Val Tyr Phe Cys Ser Gln Ser 85 90 95Thr His Val Pro Pro
Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105
11019359DNAArtificial Sequencesynthetic 19caggtccaac tgcagcagcc
tggggctgag ctggtgaagc ctggggcttc agtgaagatg 60tcctgcaagg cttctggcta
caccttcacc agctactggg tgcactgggt gaagcagagg 120cctggacaag
gccttgagtg gatcggagtg attgatcctt ctgatagtta tactagctac
180aatcaaaagt tcaagggcaa ggccacatta ctgtagacac atcctccagc
acagcctaca 240tgcagctcag cagcctgaca tctgaggact ctgcggtcta
ttactgtaca agacactatg 300atttcgacag ctggtacttc gatgtctggg
gcgcagggac cacggtcacc gtctcctca 35920120PRTArtificial
Sequencesynthetic 20Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val
Lys Pro Gly Ala1 5 10 15Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr
Thr Phe Thr Ser Tyr 20 25 30Trp Val His Trp Val Lys Gln Arg Pro Gly
Gln Gly Leu Glu Trp Ile 35 40 45Gly Val Ile Asp Pro Ser Asp Ser Tyr
Thr Ser Tyr Asn Gln Lys Phe 50 55 60Lys Gly Lys Ala Thr Leu Thr Val
Asp Thr Ser Ser Ser Thr Ala Tyr65 70 75 80Met Gln Leu Ser Ser Leu
Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95Thr Arg His Tyr Asp
Phe Asp Ser Trp Tyr Phe Asp Val Trp Gly Ala 100 105 110Gly Thr Thr
Val Thr Val Ser Ser 115 120211415DNAArtificial Sequencesynthetic
21tggagtttgg gctgagctgg ctttttcttg tcgcgatttt aaaaggtgtc cagtgcgatg
60tgcagctggt ggagtctggg ggaggcttag tgcagcctgg agggtcccgg aaactctcct
120gtgcagcctc tggattcact ttcagtgtct ttggaatgca ctgggttcgt
caggctccag 180agaaggggct ggagtgggtc gcatacatta gtagtggcag
tactatcatc tattatgcag 240acacagtgaa gggccgattc accatctcca
gagacaatcc caagaacacc ctgttcctgc 300aaatgaccgg tctaaggtct
gaggacacgg ccatgtatta ctgtgcaaga ccgctctact 360atgattacga
cgactatgct atggactact ggggtcaagg aacctcagtc accgtctcct
420cagcgtcgac caagggccca tcggtcttcc ccctggcacc ctcctccaag
agcacctctg 480ggggcacagc ggccctgggc tgcctggtca aggactactt
ccccgaaccg gtgacggtgt 540cgtggaactc aggcgccctg accagcggcg
tgcacacctt cccggctgtc ctacagtcct 600caggactcta ctccctcagc
agcgtggtga ccgtgccctc cagcagcttg ggcacccaga 660cctacatctg
caacgtgaat cacaagccca gcaacaccaa ggtggacaag aaagttgagc
720ccaaatcttg tgacaaaact cacacatgcc caccgtgccc agcacctgaa
ctcctggggg 780gaccgtcagt cttcctcttc cccccaaaac ccaaggacac
cctcatgatc tcccggaccc 840ctgaggtcac atgcgtggtg gtggacgtga
gccacgaaga ccctgaggtc aagttcaact 900ggtacgtgga cggcgtggag
gtgcataatg ccaagacaaa gccgcgggag gagcagtaca 960acagcacgta
ccgtgtggtc agcgtcctca ccgtcctgca ccaggactgg ctgaatggca
1020aggagtacaa gtgcaaggtc tccaacaaag ccctcccagc ccccatcgag
aaaaccatct 1080ccaaagccaa agggcagccc cgagaaccac aggtgtacac
cctgccccca tcccgcgagg 1140agatgaccaa gaaccaggtc agcctgacct
gcctggtcaa aggcttctat cccagcgaca 1200tcgccgtgga gtgggagagc
aatgggcagc cggagaacaa ctacaagacc acgcctcccg 1260tgctggactc
cgacggctcc ttcttcctct acagcaagct caccgtggac aagagcaggt
1320ggcagcaggg gaacgtcttc tcatgctccg tgatgcatga ggctctgcac
aaccactaca 1380cgcagaagag cctctccctg tctccgggta aatga
1415221415DNAArtificial Sequencesynthetic 22tcatttaccc ggagacaggg
agaggctctt ctgcgtgtag tggttgtgca gagcctcatg 60catcacggag catgagaaga
cgttcccctg ctgccacctg ctcttgtcca cggtgagctt 120gctgtagagg
aagaaggagc cgtcggagtc cagcacggga ggcgtggtct tgtagttgtt
180ctccggctgc ccattgctct cccactccac ggcgatgtcg ctgggataga
agcctttgac 240caggcaggtc aggctgacct ggttcttggt catctcctcg
cgggatgggg gcagggtgta 300cacctgtggt tctcggggct gccctttggc
tttggagatg gttttctcga tgggggctgg 360gagggctttg ttggagacct
tgcacttgta ctccttgcca ttcagccagt cctggtgcag 420gacggtgagg
acgctgacca cacggtacgt gctgttgtac tgctcctccc gcggctttgt
480cttggcatta tgcacctcca cgccgtccac gtaccagttg aacttgacct
cagggtcttc 540gtggctcacg tccaccacca cgcatgtgac ctcaggggtc
cgggagatca tgagggtgtc 600cttgggtttt ggggggaaga ggaagactga
cggtcccccc aggagttcag gtgctgggca 660cggtgggcat gtgtgagttt
tgtcacaaga tttgggctca actttcttgt ccaccttggt 720gttgctgggc
ttgtgattca cgttgcagat gtaggtctgg gtgcccaagc tgctggaggg
780cacggtcacc acgctgctga gggagtagag tcctgaggac tgtaggacag
ccgggaaggt 840gtgcacgccg ctggtcaggg cgcctgagtt ccacgacacc
gtcaccggtt cggggaagta 900gtccttgacc aggcagccca gggccgctgt
gcccccagag gtgctcttgg aggagggtgc 960cagggggaag accgatgggc
ccttggtcga cgctgaggag acggtgactg aggttccttg 1020accccagtag
tccatagcat agtcgtcgta atcatagtag agcggtcttg cacagtaata
1080catggccgtg tcctcagacc ttagaccggt catttgcagg aacagggtgt
tcttgggatt 1140gtctctggag atggtgaatc ggcccttcac tgtgtctgca
taatagatga tagtactgcc 1200actactaatg tatgcgaccc actccagccc
cttctctgga gcctgacgaa cccagtgcat 1260tccaaagaca ctgaaagtga
atccagaggc tgcacaggag agtttccggg accctccagg 1320ctgcactaag
cctcccccag actccaccag ctgcacatcg cactggacac cttttaaaat
1380cgcgacaaga aaaagccagc tcagcccaaa ctcca 141523725DNAArtificial
Sequencesynthetic 23tggacatgcg cgtgcccgcc cagctgctgg gcctgctgct
gctgtggttc cccggctcgc 60gatgctacat tgtgatgtca cagtctccat cctccctggc
tgtgtcagca ggagagaagg 120tcactatgag ctgcaaatcc agtcagagtc
tgctcaacag tagaacccga aagaaccact 180tggcttggta tcagcagaaa
ccagggcagt ctcctaaact gctgatctac tgggcatcca 240ctagggaatc
tggggtccct gatcgcttca caggcagtgg atctgggaca gatttcgctc
300tcaccatcag cagtgtgcag gctgaagacc tggcagttta tttctgcaag
caatcttata 360atctgtacac attcggtgct gggaccaagc tggagctgaa
acgtacggtg gctgcaccat 420ctgtcttcat cttcccgcca tctgatgagc
agttgaaatc tggaactgcc tctgttgtgt 480gcctgctgaa taacttctat
cccagagagg ccaaagtaca gtggaaggtg gataacgccc 540tccaatcggg
taactcccag gagagtgtca cagagcagga cagcaaggac agcacctaca
600gcctcagcag caccctgacg ctgagcaaag cagactacga gaaacacaaa
gtctacgcct 660gcgaagtcac ccatcagggc ctgagctcgc ccgtcacaaa
gagcttcaac aggggagagt 720gttga 72524725DNAArtificial
Sequencesynthetic 24tcaacactct cccctgttga agctctttgt gacgggcgag
ctcaggccct gatgggtgac 60ttcgcaggcg tagactttgt gtttctcgta gtctgctttg
ctcagcgtca gggtgctgct 120gaggctgtag gtgctgtcct tgctgtcctg
ctctgtgaca ctctcctggg agttacccga 180ttggagggcg ttatccacct
tccactgtac tttggcctct ctgggataga agttattcag 240caggcacaca
acagaggcag ttccagattt caactgctca tcagatggcg ggaagatgaa
300gacagatggt gcagccaccg tacgtttcag ctccagcttg gtcccagcac
cgaatgtgta 360cagattataa gattgcttgc agaaataaac tgccaggtct
tcagcctgca cactgctgat 420ggtgagagcg aaatctgtcc cagatccact
gcctgtgaag cgatcaggga ccccagattc 480cctagtggat gcccagtaga
tcagcagttt aggagactgc cctggtttct gctgatacca 540agccaagtgg
ttctttcggg ttctactgtt gagcagactc tgactggatt tgcagctcat
600agtgaccttc tctcctgctg acacagccag ggaggatgga gactgtgaca
tcacaatgta 660gcatcgcgag ccggggaacc acagcagcag caggcccagc
agctgggcgg gcacgcgcat 720gtcca 72525321DNAArtificial
sequencesynthetic 25gacatccaga tggaccagtc tccatccagt ctgtctgcat
cccttggaga cacaattacc 60atcacttgcc atgccagtca gaacattaat gtttggttaa
gctggtacca gcagaaacca 120ggaaatattc ctaaactatt gatctataag
gcttccaact tgcacacagg cgtcccatca 180aggtttagtg gcagtggatc
tggaacaggt ttcacattaa ccatcagcag cctgcagcct 240gaagacattg
ccacttacta ctgtcaacag ggtcaaagtt atcctctcac gttcggctcg
300gggcgaaagt tggaaataaa a 32126107PRTArtificial sequencesynthetic
26Asp Ile Gln Met Asp Gln Ser Pro Ser Ser Leu Ser Ala Ser Leu Gly1
5 10 15Asp Thr Ile Thr Ile Thr Cys His Ala Ser Gln Asn Ile Asn Val
Trp 20 25 30Leu Ser Trp Tyr Gln Gln Lys Pro Gly Asn Ile Pro Lys Leu
Leu Ile 35 40 45Tyr Lys Ala Ser Asn Leu His Thr Gly Val Pro Ser Arg
Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Gly Phe Thr Leu Thr Ile Ser
Ser Leu Gln Pro65 70 75 80Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln
Gly Gln Ser Tyr Pro Leu 85 90 95Thr Phe Gly Ser Gly Arg Lys Leu Glu
Ile Lys 100 10527354DNAArtificial sequencesynthetic 27gaggttcagc
tgcagcagtc tggggcagag cttgtgaagc caggggcctc agtcaagttg 60tcctgcacag
cttctggctt caacattaaa gacacctata tgcactgggt gaagcagagg
120cctgaacagg gcctggagtg gattggaagg attgatcctg cgaatggtaa
tactaaatat 180gacccgaagt tccagggcaa ggccactata acaacagaca
catcctccaa cacagcctac 240ctgcagctca gcagcctgac atctgaggac
actgccgtct attactgtgc tacctcctac 300tatggtaact acgttgctta
ctggggccac gggactctgg tcactgtctc tgca 35428118PRTArtificial
sequencesynthetic 28Glu Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Val
Lys Pro Gly Ala1 5 10 15Ser Val Lys Leu Ser Cys Thr Ala Ser Gly Phe
Asn Ile Lys Asp Thr 20 25 30Tyr Met His Trp Val Lys Gln Arg Pro Glu
Gln Gly Leu Glu Trp Ile 35 40 45Gly Arg Ile Asp Pro Ala Asn Gly Asn
Thr Lys Tyr Asp Pro Lys Phe 50 55 60Gln Gly Lys Ala Thr Ile Thr Thr
Asp Thr Ser Ser Asn Thr Ala Tyr65 70 75 80Leu Gln Leu Ser Ser Leu
Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Thr Ser Tyr Tyr
Gly Asn Tyr Val Ala Tyr Trp Gly His Gly Thr 100 105 110Leu Val Thr
Val Ser Ala 115
* * * * *