U.S. patent application number 15/509258 was filed with the patent office on 2019-05-23 for rna-based logic circuits with rna binding proteins, aptamers and small molecules.
This patent application is currently assigned to Massachusetts Institute of Technology. The applicant listed for this patent is Jacob Becraft, Katie Bodner, Kei Endo, Maria Hottelet Foley, Darrell J. Irvine, Tasuku Kitada, Hirohide Saito, Velia Siciliano, Tyler Wagner, Ron Weiss, Liliana Wroblewska. Invention is credited to Jacob Becraft, Katie Bodner, Kei Endo, Maria Hottelet Foley, Darrell J. Irvine, Tasuku Kitada, Hirohide Saito, Velia Siciliano, Tyler Wagner, Ron Weiss, Liliana Wroblewska.
Application Number | 20190151474 15/509258 |
Document ID | / |
Family ID | 54186294 |
Filed Date | 2019-05-23 |
View All Diagrams
United States Patent
Application |
20190151474 |
Kind Code |
A2 |
Weiss; Ron ; et al. |
May 23, 2019 |
RNA-BASED LOGIC CIRCUITS WITH RNA BINDING PROTEINS, APTAMERS AND
SMALL MOLECULES
Abstract
Engineered synthetic RNA-based genetic circuits are provided
that are regulated exclusively at the post-transcriptional
level.
Inventors: |
Weiss; Ron; (Newton, MA)
; Wroblewska; Liliana; (Wilmington, MA) ;
Siciliano; Velia; (Cambridge, MA) ; Kitada;
Tasuku; (Ghent, BE) ; Hottelet Foley; Maria;
(Cambridge, MA) ; Bodner; Katie; (Stanford,
CA) ; Saito; Hirohide; (Kyoto, JP) ; Endo;
Kei; (Chiba, JP) ; Irvine; Darrell J.;
(Arlington, MA) ; Wagner; Tyler; (Bel Air, MD)
; Becraft; Jacob; (Boston, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Weiss; Ron
Wroblewska; Liliana
Siciliano; Velia
Kitada; Tasuku
Hottelet Foley; Maria
Bodner; Katie
Saito; Hirohide
Endo; Kei
Irvine; Darrell J.
Wagner; Tyler
Becraft; Jacob |
Newton
Wilmington
Cambridge
Ghent
Cambridge
Stanford
Kyoto
Chiba
Arlington
Bel Air
Boston |
MA
MA
MA
MA
CA
MA
MD
MA |
US
US
US
BE
US
US
JP
JP
US
US
US |
|
|
Assignee: |
Massachusetts Institute of
Technology
Cambridge
MA
Kyoto University
Kyoto
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20180296702 A1 |
October 18, 2018 |
|
|
Family ID: |
54186294 |
Appl. No.: |
15/509258 |
Filed: |
September 8, 2015 |
PCT Filed: |
September 8, 2015 |
PCT NO: |
PCT/US2015/049045 PCKC 00 |
371 Date: |
March 7, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62195747 |
Jul 22, 2015 |
|
|
|
62047137 |
Sep 8, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/63 20130101;
C12N 15/85 20130101; A61K 48/0066 20130101; C12N 2840/102 20130101;
C12N 15/10 20130101 |
International
Class: |
A61K 48/00 20060101
A61K048/00; C12N 15/85 20060101 C12N015/85 |
Claims
1. A synthetic RNA circuit comprising a first RNA molecule
comprising at least one sequence recognized by at least one first
microRNA that is/are specifically expressed in a first cell type,
and a sequence encoding a protein that specifically binds to a RNA
motif and inhibits protein production; and a second RNA molecule
comprising at least one sequence recognized by at least one second
microRNA that is/are not expressed in the first cell type or is
expressed at a low level relative to a second cell type, at least
one RNA motif and a sequence encoding an output molecule.
2. The synthetic RNA circuit of claim 1, wherein the output
molecule is a protein.
3. The synthetic RNA circuit of claim 2, wherein the protein is a
therapeutic protein, a cell death protein, a fluorescent protein,
an antigen, a selection protein, or an immunomodulator.
4.-13. (canceled)
14. The synthetic RNA circuit of claim 1, wherein the protein that
specifically binds to a RNA motif and inhibits protein production
is L7Ae or a fusion of MS2 protein and a protein that inhibits
protein production.
15.-21. (canceled)
22. The synthetic RNA circuit of claim 1, wherein in a cell that
expresses the at least one first microRNA but does not express the
at least one second microRNA, the at least one first microRNA
represses translation of or degrades the sequence encoding the
protein that specifically binds to a RNA motif and inhibits protein
production, thereby allowing expression of the output molecule.
23.-30. (canceled)
31. The synthetic RNA circuit of claim 1, wherein the first cell
type is a cancer cell.
32.-33. (canceled)
34. The synthetic RNA circuit of claim 1, further comprising a
sequence encoding Csy4 protein and a Csy4 recognition site.
35.-39. (canceled)
40. A method of treating cancer in a mammal comprising
administering to a mammal the synthetic RNA circuit of claim 1.
41. A method of inducing an immune response in a mammal comprising
administering to a mammal the synthetic RNA circuit of claim 1.
42. (canceled)
43. A synthetic RNA circuit comprising: (1) a first RNA molecule
comprising at least one sequence recognized by a first protein that
specifically binds to a RNA motif and inhibits protein production,
and a sequence encoding an output molecule; and/or a second RNA
molecule comprising at least one sequence recognized by a second
protein that specifically binds to a RNA motif and inhibits protein
production or a second RNA molecule comprising at least one
sequence recognized by an siRNA molecule or a microRNA molecule,
and a sequence encoding the first protein that specifically binds
to a RNA motif and inhibits protein production; and/or a third RNA
molecule comprising at least one sequence recognized by an siRNA
molecule or a microRNA molecule, and a sequence encoding the second
protein that specifically binds to a RNA motif and inhibits protein
production; or (2) an RNA molecule comprising a sequence encoding a
destabilization domain fused to an output protein, wherein the
destabilization domain facilitates degradation of the output
protein in the absence of a small molecule that binds to the
destabilization domain; or (3) an RNA molecule comprising a
sequence encoding a TetR protein and a sequence encoding an output
protein, and an aptamer sequence that is bound by the TetR protein
in the absence of tetracycline; wherein the aptamer sequence is
positioned relative to the sequence encoding the output protein so
that it suppresses translation of the output protein in the absence
of tetracycline.
44. The synthetic RNA circuit of claim 43, further comprising the
siRNA molecule or microRNA molecule that binds to the third RNA
molecule.
45. (canceled)
46. The synthetic RNA circuit of claim 43, wherein the output
molecule is a protein.
47. The synthetic RNA circuit of claim 41, wherein the output
molecule or output protein is a therapeutic protein, a cell death
protein, a fluorescent protein, an antigen, a selection protein, or
an immunomodulator.
48.-79. (canceled)
80. A method of treating cancer in a mammal comprising
administering to a mammal the synthetic RNA circuit of claim
43.
81. A method of inducing an immune response in a mammal comprising
administering to a mammal the synthetic RNA circuit of claim
43.
82.-122. (canceled)
123. A synthetic RNA circuit comprising: (1) a first RNA molecule
comprising at least one sequence recognized by a first protein that
specifically binds to a RNA motif and inhibits protein production,
a sequence encoding a second protein that specifically binds to a
RNA motif and inhibits protein production, and at least one
sequence recognized by a first siRNA molecule or microRNA molecule;
and a second RNA molecule comprising at least one sequence
recognized by the second protein that specifically binds to a RNA
motif and inhibits protein production, a sequence encoding the
first protein that specifically binds to a RNA motif and inhibits
protein production, and at least one sequence recognized by a
second siRNA molecule or microRNA molecule; or (2) a first RNA
molecule comprising a sequence encoding a destabilization domain
fused to a protein that specifically binds to a RNA motif and
inhibits protein production; and a second RNA molecule comprising
at least one sequence recognized by the protein that specifically
binds to a RNA motif and inhibits protein production, and a
sequence encoding an output molecule; wherein the destabilization
domain facilitates degradation of the protein that specifically
binds to a RNA motif and inhibits protein production in the absence
of a small molecule that binds to the destabilization domain
124.-204. (canceled)
205. The synthetic RNA circuit of claim 123, wherein the output
molecule is a protein.
206. The synthetic RNA circuit of claim 205, wherein the protein is
a therapeutic protein, a cell death protein, a fluorescent protein,
an antigen, a selection protein, or an immunomodulator.
207.-240. (canceled)
241. A method of treating cancer in a mammal comprising
administering to a mammal the synthetic RNA circuit of claim
123.
242. A method of inducing an immune response in a mammal comprising
administering to a mammal the synthetic RNA circuit of claim
123.
243.-279. (canceled)
Description
RELATED APPLICATIONS
[0001] This application is a national stage filing under 35 U.S.C.
.sctn. 371 of International Application No. PCT/US2015/049045,
filed Sep. 8, 2015, which claims the benefit under 35 U.S.C. .sctn.
119(e) of U.S. provisional application 62/047,137, entitled
"RNA-BASED LOGIC CIRCUITS WITH RNA BINDING PROTEINS, APTAMERS AND
SMALL MOLECULES, "filed Sep. 8, 2014 and of U.S. provisional
application 62/195,747, entitled "RNA-BASED LOGIC CIRCUITS WITH RNA
BINDING PROTEINS, APTAMERS AND SMALL MOLECULES," filed Jul. 22,
2015, the entire disclosures of each which are herein incorporated
by reference in their entireties.
FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with Government support under
Contract No. W911NF-11-2-0054 awarded by the Army Research Office.
The Government has certain rights in the invention.
FIELD OF INVENTION
[0003] Engineered synthetic RNA-based genetic circuits are provided
that are regulated exclusively at the post-transcriptional
level.
BACKGROUND OF INVENTION
[0004] Messenger RNA (mRNA) as a platform for gene transfer has
numerous advantages over plasmid DNA including the lack of
requirement for crossing the nuclear envelope, and importantly,
negligible risk of genomic integration (1-2). The recent progress
in development of chemical mRNA modifications made it possible to
use in vitro synthesized mRNA with high stability and low
immunogenicity as a powerful tool for gene therapy (3-6).
Self-replicating RNA is also gaining interest for biomedical
applications (7-8).
[0005] However, synthetic biology has remained DNA-centered and
genetic circuit design always relies exclusively or partially on
transcriptional regulation. The development of parts and devices
has also been focused primarily on promoter and transcription
factor libraries (9-10).
SUMMARY OF INVENTION
[0006] The promise of synthetic biology is that the engineered
genetic circuits will provide sophistication of output control that
can never be achieved with traditional pharmaceuticals. Encoding
the regulation exclusively at post-transcriptional level and RNA
delivery of desired logic circuits may enable the benefits of
synthetic biology tools while offering the safety of non-DNA
therapeutics. However, no control mechanisms have been developed to
regulate replicon-based expression. While there have been a number
of efforts to engineer post-transcriptional devices based on
microRNA, aptamers, or aptazymes (11), most are characterized by a
very low dynamic range and importantly, the devices are not
suitable for construction of scalable circuits.
[0007] Devices based on RNA-binding proteins (RBPs), however, can
be easily wired together to create synthetic circuits of various
complexities or to interconnect cellular and synthetic signaling
pathways.
[0008] According to one aspect, synthetic RNA circuits are
provided. The circuits include a first RNA molecule comprising at
least one sequence recognized by at least one first microRNA that
is/are specifically expressed in a first cell type, and a sequence
encoding a protein that specifically binds to a RNA motif and
inhibits protein production; and a second RNA molecule comprising
at least one sequence recognized by at least one second microRNA
that is/are not expressed in the first cell type or is expressed at
a low level relative to a second cell type, at least one RNA motif
and a sequence encoding an output molecule.
[0009] In some embodiments, in a cell that expresses the at least
one first microRNA but does not express the at least one second
microRNA, the at least one first microRNA represses translation of
or degrades the sequence encoding the protein that specifically
binds to a RNA motif and inhibits protein production, thereby
allowing expression of the output molecule.
[0010] In some embodiments, the output molecule is a protein. In
some embodiments, the protein is a therapeutic protein, a cell
death protein, a fluorescent protein, an antigen, a selection
protein, or an immunomodulator. In some embodiments, the
therapeutic protein is a protein for protein replacement therapy,
Myr-Akt, or follistatin. In some embodiments, the selection protein
is used for selection or purification of a cell in which it is
expressed. In some embodiments, the selection protein is a protein
that confers drug resistance to a cell. In some embodiments, the
fluorescent protein is EGFP, EYFP, or EBFP. In some embodiments,
immunomodulator protein is a cytokine. In some embodiments, the
cytokine is IL-12, IL-15 or IL-21. In some embodiments, the
immunomodulator protein is a immunosuppressant protein. In some
embodiments, the cell death protein is hBax.
[0011] In some embodiments, the RNA molecules encode more than one
output molecule.
[0012] In some embodiments, the output molecules comprise at least
one antigen, and optionally, one or more adjuvants.
[0013] In some embodiments, the protein that specifically binds to
a RNA motif and inhibits protein production is L7Ae or a fusion of
MS2 protein and a protein that inhibits protein production. In some
embodiments, the protein that specifically binds to a RNA motif and
inhibits protein production is L7Ae and the RNA motif is one or
more Box C/D, K-turn and/or K-loop motifs. In some embodiments, the
RNA motif is two K-turn motifs. In some embodiments, the one or
more Box C/D, K-turn and/or K-loop motifs are placed in the 5'
untranslated region (UTR) of the second RNA molecule.
[0014] In some embodiments, the protein that specifically binds to
a RNA motif and inhibits protein production is a fusion of MS2
protein and a protein that inhibits protein production and the RNA
motif is one or more MS2 coat protein binding sites. In some
embodiments, the RNA motif is eight MS2 coat protein binding sites.
In some embodiments, the one or more MS2 coat protein binding sites
are placed in the 3' untranslated region (UTR) of the second RNA
molecule. In some embodiments, the MS2 fusion protein is a fusion
of MS2 protein and CNOT7 protein (MS2-CNOT7) or Dm-POP2 protein
(MS2-Dm-POP2).
[0015] In some embodiments, the RNA molecules comprise modified
RNA. In some embodiments, the RNA molecules comprise
5-methylcytosine-triphosphate and/or
pseudouridine-triphosphate.
[0016] In some embodiments, the RNA molecules are encoded on one or
more RNA replicons. In some embodiments, the one or more RNA
replicons is/are one or more alphavirus derived replicons,
Venezuelan equine encephalitis virus derived replicons or Sindbis
derived virus replicons. In some embodiments, the RNA molecules are
expressed from one or more subgenomic promoters of the one or more
replicons, optionally wherein the one or more subgenomic promoters
are optimized for length or position in the RNA molecule. In some
embodiments, the one or more subgenomic promoters are regulated by
a small molecule. In some embodiments, the small molecule is
trimethoprim (TMP) or 4-hydroxytamoxifin (4-OHT).
[0017] In some embodiments, the RNA molecules are encoded on one or
more plasmids.
[0018] In some embodiments, the first cell type is a cancer cell.
In some embodiments, the at least one first microRNA is miR-21. In
some embodiments, the at least one second microRNA is selected from
the group consisting of miR-141, miR-142 and miR-146.
[0019] In some embodiments, the synthetic RNA circuit further
includes a sequence encoding Csy4 protein and a Csy4 recognition
site. In some embodiments, the Csy4 protein is a fusion of a
destabilization domain and Csy4. In some embodiments, the
destabilization domain is regulated by trimethoprim (TMP) or
4-hydroxytamoxifin (4-OHT).
[0020] In some embodiments, the synthetic RNA circuit further
includes one or more internal ribosomal entry sites (IRESs) for
improved polycystronic expression. In some embodiments, the
synthetic RNA circuit further includes one or more general
translation enhancers (GTEs). In some embodiments, the synthetic
RNA circuit is encoded on self-cleaving helper-defective
interfering RNA, optionally comprising Csy4, wherein Csy4 is
expressed from an internal ribosome entry site (IRES).
[0021] According to another aspect, methods of treating cancer in a
mammal are provided. The methods include administering to a mammal
the foregoing synthetic RNA circuits. In some embodiments, the
synthetic RNA circuit is administered as a first replicon, and
further administering a second replicon as ballast to control
expression of a protein encoded by the first replicon.
[0022] According to another aspect, methods of inducing an immune
response in a mammal are provided. The methods include
administering to a mammal the foregoing synthetic RNA circuits. In
some embodiments, the synthetic RNA circuit is administered as a
first replicon, and further administering a second replicon as
ballast to control expression of a protein encoded by the first
replicon.
[0023] According to another aspect, synthetic RNA circuits are
provided. The circuits include a first RNA molecule comprising at
least one sequence recognized by a protein that specifically binds
to a RNA motif and inhibits protein production, and a sequence
encoding an output molecule; a second RNA molecule comprising at
least one sequence recognized by a second protein that specifically
binds to a RNA motif and inhibits protein production, and a
sequence encoding the first protein that specifically binds to a
RNA motif and inhibits protein production; and a third RNA molecule
comprising at least one sequence recognized by an siRNA molecule or
a microRNA molecule, and a sequence encoding the second protein
that specifically binds to a RNA motif and inhibits protein
production. In some embodiments, the circuits further include the
siRNA molecule or microRNA molecule that binds to the third RNA
molecule. In some embodiments, the siRNA molecule is a synthetic
siRNA molecule, or wherein the microRNA molecule is an endogenously
expressed microRNA molecule.
[0024] In some embodiments, the output molecule is a protein. In
some embodiments, the protein is a therapeutic protein, a cell
death protein, a fluorescent protein, an antigen, a selection
protein, or an immunomodulator. In some embodiments, the
therapeutic protein is a protein for protein replacement therapy,
Myr-Akt, or follistatin. In some embodiments, the selection protein
is used for selection or purification of a cell in which it is
expressed. In some embodiments, the selection protein is a protein
that confers drug resistance to a cell. In some embodiments, the
fluorescent protein is EGFP, EYFP, or EBFP. In some embodiments,
immunomodulator protein is a cytokine. In some embodiments, the
cytokine is IL-12, IL-15 or IL-21. In some embodiments, the
immunomodulator protein is a immunosuppressant protein. In some
embodiments, the cell death protein is hBax.
[0025] In some embodiments, the RNA molecules encode more than one
output molecule.
[0026] In some embodiments, the output molecules comprise at least
one antigen, and optionally, one or more adjuvants.
[0027] In some embodiments, the protein that specifically binds to
a RNA motif and inhibits protein production is L7Ae or a fusion of
MS2 protein and a protein that inhibits protein production. In some
embodiments, the protein that specifically binds to a RNA motif and
inhibits protein production is L7Ae and the RNA motif is one or
more Box C/D, K-turn and/or K-loop motifs. In some embodiments, the
RNA motif is two K-turn motifs. In some embodiments, the one or
more Box C/D, K-turn and/or K-loop motifs are placed in the 5'
untranslated region (UTR) of the second RNA molecule.
[0028] In some embodiments, the protein that specifically binds to
a RNA motif and inhibits protein production is a fusion of MS2
protein and a protein that inhibits protein production and the RNA
motif is one or more MS2 coat protein binding sites. In some
embodiments, the RNA motif is eight MS2 coat protein binding sites.
In some embodiments, the one or more MS2 coat protein binding sites
are placed in the 3' untranslated region (UTR) of the second RNA
molecule. In some embodiments, the MS2 fusion protein is a fusion
of MS2 protein and CNOT7 protein (MS2-CNOT7) or Dm-POP2 protein
(MS2-Dm-POP2).
[0029] In some embodiments, the RNA molecules comprise modified
RNA. In some embodiments, the RNA molecules comprise
5-methylcytosine-triphosphate and/or
pseudouridine-triphosphate.
[0030] In some embodiments, the RNA molecules are encoded on one or
more RNA replicons. In some embodiments, the one or more RNA
replicons is/are one or more alphavirus derived replicons,
Venezuelan equine encephalitis virus derived replicons or Sindbis
derived virus replicons. In some embodiments, the RNA molecules are
expressed from one or more subgenomic promoters of the one or more
replicons, optionally wherein the one or more subgenomic promoters
are optimized for length or position in the RNA molecule. In some
embodiments, the one or more subgenomic promoters are regulated by
a small molecule. In some embodiments, the small molecule is
trimethoprim (TMP) or 4-hydroxytamoxifin (4-OHT).
[0031] In some embodiments, the RNA molecules are encoded on one or
more plasmids.
[0032] In some embodiments, the synthetic RNA circuit further
includes a sequence encoding Csy4 protein and a Csy4 recognition
site. In some embodiments, the Csy4 protein is a fusion of a
destabilization domain and Csy4. In some embodiments, the
destabilization domain is regulated by trimethoprim (TMP) or
4-hydroxytamoxifin (4-OHT).
[0033] In some embodiments, the synthetic RNA circuit further
includes one or more internal ribosomal entry sites (IRESs) for
improved polycystronic expression. In some embodiments, the
synthetic RNA circuit further includes one or more general
translation enhancers (GTEs). In some embodiments, the synthetic
RNA circuit is encoded on self-cleaving helper-defective
interfering RNA, optionally comprising Csy4, wherein Csy4 is
expressed from an internal ribosome entry site (IRES).
[0034] According to another aspect, methods of treating cancer in a
mammal are provided. The methods include administering to a mammal
the foregoing synthetic RNA circuits. In some embodiments, the
synthetic RNA circuit is administered as a first replicon, and
further administering a second replicon as ballast to control
expression of a protein encoded by the first replicon.
[0035] According to another aspect, methods of inducing an immune
response in a mammal are provided. The methods include
administering to a mammal the foregoing synthetic RNA circuits. In
some embodiments, the synthetic RNA circuit is administered as a
first replicon, and further administering a second replicon as
ballast to control expression of a protein encoded by the first
replicon.
[0036] According to another aspect, synthetic RNA circuits are
provided. The circuits include a first RNA molecule comprising at
least one sequence recognized by a first protein that specifically
binds to a RNA motif and inhibits protein production, and a
sequence encoding an output molecule; and a second RNA molecule
comprising at least one sequence recognized by an siRNA molecule or
a microRNA molecule, and a sequence encoding the first protein that
specifically binds to a RNA motif and inhibits protein production.
In some embodiments, the circuits further include the siRNA
molecule or microRNA molecule that binds to the second RNA
molecule. In some embodiments, the siRNA molecule is a synthetic
siRNA molecule, or wherein the microRNA molecule is an endogenously
expressed microRNA molecule.
[0037] In some embodiments, the output molecule is a protein. In
some embodiments, the protein is a therapeutic protein, a cell
death protein, a fluorescent protein, an antigen, a selection
protein, or an immunomodulator. In some embodiments, the
therapeutic protein is a protein for protein replacement therapy,
Myr-Akt, or follistatin. In some embodiments, the selection protein
is used for selection or purification of a cell in which it is
expressed. In some embodiments, the selection protein is a protein
that confers drug resistance to a cell. In some embodiments, the
fluorescent protein is EGFP, EYFP, or EBFP. In some embodiments,
immunomodulator protein is a cytokine. In some embodiments, the
cytokine is IL-12, IL-15 or IL-21. In some embodiments, the
immunomodulator protein is a immunosuppressant protein. In some
embodiments, the cell death protein is hBax.
[0038] In some embodiments, the RNA molecules encode more than one
output molecule.
[0039] In some embodiments, the output molecules comprise at least
one antigen, and optionally, one or more adjuvants.
[0040] In some embodiments, the protein that specifically binds to
a RNA motif and inhibits protein production is L7Ae or a fusion of
MS2 protein and a protein that inhibits protein production. In some
embodiments, the protein that specifically binds to a RNA motif and
inhibits protein production is L7Ae and the RNA motif is one or
more Box C/D, K-turn and/or K-loop motifs. In some embodiments, the
RNA motif is two K-turn motifs. In some embodiments, the one or
more Box C/D, K-turn and/or K-loop motifs are placed in the 5'
untranslated region (UTR) of the second RNA molecule.
[0041] In some embodiments, the protein that specifically binds to
a RNA motif and inhibits protein production is a fusion of MS2
protein and a protein that inhibits protein production and the RNA
motif is one or more MS2 coat protein binding sites. In some
embodiments, the RNA motif is eight MS2 coat protein binding sites.
In some embodiments, the one or more MS2 coat protein binding sites
are placed in the 3' untranslated region (UTR) of the second RNA
molecule. In some embodiments, the MS2 fusion protein is a fusion
of MS2 protein and CNOT7 protein (MS2-CNOT7) or Dm-POP2 protein
(MS2-Dm-POP2).
[0042] In some embodiments, the RNA molecules comprise modified
RNA. In some embodiments, the RNA molecules comprise
5-methylcytosine-triphosphate and/or
pseudouridine-triphosphate.
[0043] In some embodiments, the RNA molecules are encoded on one or
more RNA replicons. In some embodiments, the one or more RNA
replicons is/are one or more alphavirus derived replicons,
Venezuelan equine encephalitis virus derived replicons or Sindbis
derived virus replicons. In some embodiments, the RNA molecules are
expressed from one or more subgenomic promoters of the one or more
replicons, optionally wherein the one or more subgenomic promoters
are optimized for length or position in the RNA molecule. In some
embodiments, the one or more subgenomic promoters are regulated by
a small molecule. In some embodiments, the small molecule is
trimethoprim (TMP) or 4-hydroxytamoxifin (4-OHT).
[0044] In some embodiments, the RNA molecules are encoded on one or
more plasmids.
[0045] In some embodiments, the synthetic RNA circuit further
includes a sequence encoding Csy4 protein and a Csy4 recognition
site. In some embodiments, the Csy4 protein is a fusion of a
destabilization domain and Csy4. In some embodiments, the
destabilization domain is regulated by trimethoprim (TMP) or
4-hydroxytamoxifin (4-OHT).
[0046] In some embodiments, the synthetic RNA circuit further
includes one or more internal ribosomal entry sites (IRESs) for
improved polycystronic expression. In some embodiments, the
synthetic RNA circuit further includes one or more general
translation enhancers (GTEs).
[0047] In some embodiments, the synthetic RNA circuit is encoded on
self-cleaving helper-defective interfering RNA, optionally
comprising Csy4, wherein Csy4 is expressed from an internal
ribosome entry site (IRES).
[0048] According to another aspect, methods of treating cancer in a
mammal are provided. The methods include administering to a mammal
the foregoing synthetic RNA circuits. In some embodiments, the
synthetic RNA circuit is administered as a first replicon, and
further administering a second replicon as ballast to control
expression of a protein encoded by the first replicon.
[0049] According to another aspect, methods of inducing an immune
response in a mammal are provided. The methods include
administering to a mammal the foregoing synthetic RNA circuits. In
some embodiments, the synthetic RNA circuit is administered as a
first replicon, and further administering a second replicon as
ballast to control expression of a protein encoded by the first
replicon.
[0050] According to another aspect, synthetic RNA circuits are
provided. The circuits include a first RNA molecule comprising at
least one sequence recognized by a first protein that specifically
binds to a RNA motif and inhibits protein production, a sequence
encoding a second protein that specifically binds to a RNA motif
and inhibits protein production, and at least one sequence
recognized by a first siRNA molecule or microRNA molecule; and a
second RNA molecule comprising at least one sequence recognized by
the second protein that specifically binds to a RNA motif and
inhibits protein production, a sequence encoding the first protein
that specifically binds to a RNA motif and inhibits protein
production, and at least one sequence recognized by a second siRNA
molecule or microRNA molecule. In some embodiments, the circuits
further include the siRNA molecule or microRNA molecule that binds
to the third RNA molecule. In some embodiments, the siRNA molecule
is a synthetic siRNA molecule, or wherein the microRNA molecule is
an endogenously expressed microRNA molecule. In some embodiments,
the first RNA molecule and/or the second RNA molecule further
comprise a sequence encoding one or more output molecules that are
not a protein that specifically binds to a RNA motif and inhibits
protein production.
[0051] In some embodiments, the output molecule is a protein. In
some embodiments, the protein is a therapeutic protein, a cell
death protein, a fluorescent protein, an antigen, a selection
protein, or an immunomodulator. In some embodiments, the
therapeutic protein is a protein for protein replacement therapy,
Myr-Akt, or follistatin. In some embodiments, the selection protein
is used for selection or purification of a cell in which it is
expressed. In some embodiments, the selection protein is a protein
that confers drug resistance to a cell. In some embodiments, the
fluorescent protein is EGFP, EYFP, or EBFP. In some embodiments,
immunomodulator protein is a cytokine. In some embodiments, the
cytokine is IL-12, IL-15 or IL-21. In some embodiments, the
immunomodulator protein is a immunosuppressant protein. In some
embodiments, the cell death protein is hBax.
[0052] In some embodiments, the RNA molecules encode more than one
output molecule.
[0053] In some embodiments, the output molecules comprise at least
one antigen, and optionally, one or more adjuvants.
[0054] In some embodiments, the protein that specifically binds to
a RNA motif and inhibits protein production is L7Ae or a fusion of
MS2 protein and a protein that inhibits protein production. In some
embodiments, the protein that specifically binds to a RNA motif and
inhibits protein production is L7Ae and the RNA motif is one or
more Box C/D, K-turn and/or K-loop motifs. In some embodiments, the
RNA motif is two K-turn motifs. In some embodiments, the one or
more Box C/D, K-turn and/or K-loop motifs are placed in the 5'
untranslated region (UTR) of the second RNA molecule.
[0055] In some embodiments, the protein that specifically binds to
a RNA motif and inhibits protein production is a fusion of MS2
protein and a protein that inhibits protein production and the RNA
motif is one or more MS2 coat protein binding sites. In some
embodiments, the RNA motif is eight MS2 coat protein binding sites.
In some embodiments, the one or more MS2 coat protein binding sites
are placed in the 3' untranslated region (UTR) of the second RNA
molecule. In some embodiments, the MS2 fusion protein is a fusion
of MS2 protein and CNOT7 protein (MS2-CNOT7) or Dm-POP2 protein
(MS2-Dm-POP2).
[0056] In some embodiments, the RNA molecules comprise modified
RNA. In some embodiments, the RNA molecules comprise
5-methylcytosine-triphosphate and/or
pseudouridine-triphosphate.
[0057] In some embodiments, the RNA molecules are encoded on one or
more RNA replicons. In some embodiments, the one or more RNA
replicons is/are one or more alphavirus derived replicons,
Venezuelan equine encephalitis virus derived replicons or Sindbis
derived virus replicons. In some embodiments, the RNA molecules are
expressed from one or more subgenomic promoters of the one or more
replicons, optionally wherein the one or more subgenomic promoters
are optimized for length or position in the RNA molecule. In some
embodiments, the one or more subgenomic promoters are regulated by
a small molecule. In some embodiments, the small molecule is
trimethoprim (TMP) or 4-hydroxytamoxifin (4-OHT).
[0058] In some embodiments, the RNA molecules are encoded on one or
more plasmids.
[0059] In some embodiments, the synthetic RNA circuit further
includes a sequence encoding Csy4 protein and a Csy4 recognition
site. In some embodiments, the Csy4 protein is a fusion of a
destabilization domain and Csy4. In some embodiments, the
destabilization domain is regulated by trimethoprim (TMP) or
4-hydroxytamoxifin (4-OHT).
[0060] In some embodiments, the synthetic RNA circuit further
includes one or more internal ribosomal entry sites (IRESs) for
improved polycystronic expression. In some embodiments, the
synthetic RNA circuit further includes one or more general
translation enhancers (GTEs). In some embodiments, the synthetic
RNA circuit is encoded on self-cleaving helper-defective
interfering RNA, optionally comprising Csy4, wherein Csy4 is
expressed from an internal ribosome entry site (IRES).
[0061] According to another aspect, methods of treating cancer in a
mammal are provided. The methods include administering to a mammal
the foregoing synthetic RNA circuits. In some embodiments, the
synthetic RNA circuit is administered as a first replicon, and
further administering a second replicon as ballast to control
expression of a protein encoded by the first replicon.
[0062] According to another aspect, methods of inducing an immune
response in a mammal are provided. The methods include
administering to a mammal the foregoing synthetic RNA circuits. In
some embodiments, the synthetic RNA circuit is administered as a
first replicon, and further administering a second replicon as
ballast to control expression of a protein encoded by the first
replicon.
[0063] According to another aspect, synthetic RNA circuits are
provided. The circuits include an RNA molecule comprising a
sequence encoding a destabilization domain fused to an output
protein, wherein the destabilization domain facilitates degradation
of the output protein in the absence of a small molecule that binds
to the destabilization domain
[0064] In some embodiments, the protein is a therapeutic protein, a
cell death protein, a fluorescent protein, an antigen, a selection
protein, or an immunomodulator. In some embodiments, the
therapeutic protein is a protein for protein replacement therapy,
Myr-Akt, or follistatin. In some embodiments, the selection protein
is used for selection or purification of a cell in which it is
expressed. In some embodiments, the selection protein is a protein
that confers drug resistance to a cell. In some embodiments, the
fluorescent protein is EGFP, EYFP, or EBFP. In some embodiments,
immunomodulator protein is a cytokine. In some embodiments, the
cytokine is IL-12, IL-15 or IL-21. In some embodiments, the
immunomodulator protein is a immunosuppressant protein. In some
embodiments, the cell death protein is hBax.
[0065] In some embodiments, the RNA molecules encode more than one
output molecule.
[0066] In some embodiments, the output molecules comprise at least
one antigen, and optionally, one or more adjuvants.
[0067] In some embodiments, the protein that specifically binds to
a RNA motif and inhibits protein production is L7Ae or a fusion of
MS2 protein and a protein that inhibits protein production. In some
embodiments, the protein that specifically binds to a RNA motif and
inhibits protein production is L7Ae and the RNA motif is one or
more Box C/D, K-turn and/or K-loop motifs. In some embodiments, the
RNA motif is two K-turn motifs. In some embodiments, the one or
more Box C/D, K-turn and/or K-loop motifs are placed in the 5'
untranslated region (UTR) of the second RNA molecule.
[0068] In some embodiments, the protein that specifically binds to
a RNA motif and inhibits protein production is a fusion of MS2
protein and a protein that inhibits protein production and the RNA
motif is one or more MS2 coat protein binding sites. In some
embodiments, the RNA motif is eight MS2 coat protein binding sites.
In some embodiments, the one or more MS2 coat protein binding sites
are placed in the 3' untranslated region (UTR) of the second RNA
molecule. In some embodiments, the MS2 fusion protein is a fusion
of MS2 protein and CNOT7 protein (MS2-CNOT7) or Dm-POP2 protein
(MS2-Dm-POP2).
[0069] In some embodiments, the RNA molecules comprise modified
RNA. In some embodiments, the RNA molecules comprise
5-methylcytosine-triphosphate and/or
pseudouridine-triphosphate.
[0070] In some embodiments, the RNA molecules are encoded on one or
more RNA replicons. In some embodiments, the one or more RNA
replicons is/are one or more alphavirus derived replicons,
Venezuelan equine encephalitis virus derived replicons or Sindbis
derived virus replicons. In some embodiments, the RNA molecules are
expressed from one or more subgenomic promoters of the one or more
replicons, optionally wherein the one or more subgenomic promoters
are optimized for length or position in the RNA molecule. In some
embodiments, the one or more subgenomic promoters are regulated by
a small molecule. In some embodiments, the small molecule is
trimethoprim (TMP) or 4-hydroxytamoxifin (4-OHT).
[0071] In some embodiments, the RNA molecules are encoded on one or
more plasmids.
[0072] In some embodiments, the synthetic RNA circuit further
includes a sequence encoding Csy4 protein and a Csy4 recognition
site. In some embodiments, the Csy4 protein is a fusion of a
destabilization domain and Csy4. In some embodiments, the
destabilization domain is regulated by trimethoprim (TMP) or
4-hydroxytamoxifin (4-OHT).
[0073] In some embodiments, the synthetic RNA circuit further
includes one or more internal ribosomal entry sites (IRESs) for
improved polycystronic expression. In some embodiments, the
synthetic RNA circuit further includes one or more general
translation enhancers (GTEs). In some embodiments, the synthetic
RNA circuit is encoded on self-cleaving helper-defective
interfering RNA, optionally comprising Csy4, wherein Csy4 is
expressed from an internal ribosome entry site (IRES).
[0074] According to another aspect, methods of treating cancer in a
mammal are provided. The methods include administering to a mammal
the foregoing synthetic RNA circuits. In some embodiments, the
synthetic RNA circuit is administered as a first replicon, and
further administering a second replicon as ballast to control
expression of a protein encoded by the first replicon.
[0075] According to another aspect, methods of inducing an immune
response in a mammal are provided. The methods include
administering to a mammal the foregoing synthetic RNA circuits. In
some embodiments, the methods further include administering the
small molecule that binds to the destabilization domain to the
mammal In some embodiments, the small molecule that binds to the
destabilization domain is administered at different times for
expressing the antigen and/or the adjuvant at the different times.
In some embodiments, the small molecule that binds to the
destabilization domain is administered by oral administration,
intramuscular injection of lipid nanoparticles, or by implantation
of a polymeric implant for sustained release. In some embodiments,
the synthetic RNA circuit is administered as a first replicon, and
further administering a second replicon as ballast to control
expression of a protein encoded by the first replicon.
[0076] According to another aspect, synthetic RNA circuits are
provided. The circuits include a first RNA molecule comprising a
sequence encoding a destabilization domain fused to a protein that
specifically binds to a RNA motif and inhibits protein production;
and a second RNA molecule comprising at least one sequence
recognized by the protein that specifically binds to a RNA motif
and inhibits protein production, and a sequence encoding an output
molecule. The destabilization domain facilitates degradation of the
protein that specifically binds to a RNA motif and inhibits protein
production in the absence of a small molecule that binds to the
destabilization domain
[0077] In some embodiments, the output molecule is a protein. In
some embodiments, the protein is a therapeutic protein, a cell
death protein, a fluorescent protein, an antigen, a selection
protein, or an immunomodulator. In some embodiments, the
therapeutic protein is a protein for protein replacement therapy,
Myr-Akt, or follistatin. In some embodiments, the selection protein
is used for selection or purification of a cell in which it is
expressed. In some embodiments, the selection protein is a protein
that confers drug resistance to a cell. In some embodiments, the
fluorescent protein is EGFP, EYFP, or EBFP. In some embodiments,
immunomodulator protein is a cytokine. In some embodiments, the
cytokine is IL-12, IL-15 or IL-21. In some embodiments, the
immunomodulator protein is a immunosuppressant protein. In some
embodiments, the cell death protein is hBax.
[0078] In some embodiments, the RNA molecules encode more than one
output molecule.
[0079] In some embodiments, the output molecules comprise at least
one antigen, and optionally, one or more adjuvants.
[0080] In some embodiments, the protein that specifically binds to
a RNA motif and inhibits protein production is L7Ae or a fusion of
MS2 protein and a protein that inhibits protein production. In some
embodiments, the protein that specifically binds to a RNA motif and
inhibits protein production is L7Ae and the RNA motif is one or
more Box C/D, K-turn and/or K-loop motifs. In some embodiments, the
RNA motif is two K-turn motifs. In some embodiments, the one or
more Box C/D, K-turn and/or K-loop motifs are placed in the 5'
untranslated region (UTR) of the second RNA molecule.
[0081] In some embodiments, the protein that specifically binds to
a RNA motif and inhibits protein production is a fusion of MS2
protein and a protein that inhibits protein production and the RNA
motif is one or more MS2 coat protein binding sites. In some
embodiments, the RNA motif is eight MS2 coat protein binding sites.
In some embodiments, the one or more MS2 coat protein binding sites
are placed in the 3' untranslated region (UTR) of the second RNA
molecule. In some embodiments, the MS2 fusion protein is a fusion
of MS2 protein and CNOT7 protein (MS2-CNOT7) or Dm-POP2 protein
(MS2-Dm-POP2).
[0082] In some embodiments, the RNA molecules comprise modified
RNA. In some embodiments, the RNA molecules comprise
5-methylcytosine-triphosphate and/or
pseudouridine-triphosphate.
[0083] In some embodiments, the RNA molecules are encoded on one or
more RNA replicons. In some embodiments, the one or more RNA
replicons is/are one or more alphavirus derived replicons,
Venezuelan equine encephalitis virus derived replicons or Sindbis
derived virus replicons. In some embodiments, the RNA molecules are
expressed from one or more subgenomic promoters of the one or more
replicons, optionally wherein the one or more subgenomic promoters
are optimized for length or position in the RNA molecule. In some
embodiments, the one or more subgenomic promoters are regulated by
a small molecule. In some embodiments, the small molecule is
trimethoprim (TMP) or 4-hydroxytamoxifin (4-OHT).
[0084] In some embodiments, the RNA molecules are encoded on one or
more plasmids.
[0085] In some embodiments, the output molecule is a fusion of a
TetR protein and a second protein; and the RNA molecule(s) further
includes an aptamer sequence and a second output molecule. The
aptamer sequence is bound by the TetR protein in the absence of
tetracycline and the aptamer sequence is positioned relative to the
second output molecule so that it suppresses translation of the
second output molecule in the absence of tetracycline.
[0086] In some embodiments, the synthetic RNA circuit further
includes a sequence encoding Csy4 protein and a Csy4 recognition
site. In some embodiments, the Csy4 protein is a fusion of a
destabilization domain and Csy4. In some embodiments, the
destabilization domain is regulated by trimethoprim (TMP) or
4-hydroxytamoxifin (4-OHT).
[0087] In some embodiments, the synthetic RNA circuit further
includes one or more internal ribosomal entry sites (IRESs) for
improved polycystronic expression. In some embodiments, the
synthetic RNA circuit further includes one or more general
translation enhancers (GTEs). In some embodiments, the synthetic
RNA circuit is encoded on self-cleaving helper-defective
interfering RNA, optionally comprising Csy4, wherein Csy4 is
expressed from an internal ribosome entry site (IRES).
[0088] According to another aspect, methods of treating cancer in a
mammal are provided. The methods include administering to a mammal
the foregoing synthetic RNA circuits. In some embodiments, the
synthetic RNA circuit is administered as a first replicon, and
further administering a second replicon as ballast to control
expression of a protein encoded by the first replicon.
[0089] According to another aspect, methods of inducing an immune
response in a mammal are provided. The methods include
administering to a mammal the foregoing synthetic RNA circuits. In
some embodiments, the methods further include administering the
small molecule that binds to the destabilization domain to the
mammal In some embodiments, the small molecule that binds to the
destabilization domain is administered at different times for
expressing the antigen and/or the adjuvant at the different times.
In some embodiments, the small molecule that binds to the
destabilization domain is administered by oral administration,
intramuscular injection of lipid nanoparticles, or by implantation
of a polymeric implant for sustained release. In some embodiments,
the synthetic RNA circuit is administered as a first replicon, and
further administering a second replicon as ballast to control
expression of a protein encoded by the first replicon.
[0090] According to another aspect, synthetic RNA circuits are
provided. The circuits include an RNA molecule comprising a
sequence encoding a TetR protein and a sequence encoding an output
protein, and an aptamer sequence that is bound by the TetR protein
in the absence of tetracycline. The aptamer sequence is positioned
relative to the sequence encoding the output protein so that it
suppresses translation of the output protein in the absence of
tetracycline. In some embodiments, the aptamer is positioned in the
5' untranslated region (UTR) of the sequence encoding an output
protein.
[0091] In some embodiments, the output molecule is a protein. In
some embodiments, the protein is a therapeutic protein, a cell
death protein, a fluorescent protein, an antigen, a selection
protein, or an immunomodulator. In some embodiments, the
therapeutic protein is a protein for protein replacement therapy,
Myr-Akt, or follistatin. In some embodiments, the selection protein
is used for selection or purification of a cell in which it is
expressed. In some embodiments, the selection protein is a protein
that confers drug resistance to a cell. In some embodiments, the
fluorescent protein is EGFP, EYFP, or EBFP. In some embodiments,
immunomodulator protein is a cytokine. In some embodiments, the
cytokine is IL-12, IL-15 or IL-21. In some embodiments, the
immunomodulator protein is a immunosuppressant protein. In some
embodiments, the cell death protein is hBax.
[0092] In some embodiments, the RNA molecules encode more than one
output molecule.
[0093] In some embodiments, the output molecules comprise at least
one antigen, and optionally, one or more adjuvants.
[0094] In some embodiments, the protein that specifically binds to
a RNA motif and inhibits protein production is L7Ae or a fusion of
MS2 protein and a protein that inhibits protein production. In some
embodiments, the protein that specifically binds to a RNA motif and
inhibits protein production is L7Ae and the RNA motif is one or
more Box C/D, K-turn and/or K-loop motifs. In some embodiments, the
RNA motif is two K-turn motifs. In some embodiments, the one or
more Box C/D, K-turn and/or K-loop motifs are placed in the 5'
untranslated region (UTR) of the second RNA molecule.
[0095] In some embodiments, the protein that specifically binds to
a RNA motif and inhibits protein production is a fusion of MS2
protein and a protein that inhibits protein production and the RNA
motif is one or more MS2 coat protein binding sites. In some
embodiments, the RNA motif is eight MS2 coat protein binding sites.
In some embodiments, the one or more MS2 coat protein binding sites
are placed in the 3' untranslated region (UTR) of the second RNA
molecule. In some embodiments, the MS2 fusion protein is a fusion
of MS2 protein and CNOT7 protein (MS2-CNOT7) or Dm-POP2 protein
(MS2-Dm-POP2).
[0096] In some embodiments, the RNA molecules comprise modified
RNA. In some embodiments, the RNA molecules comprise
5-methylcytosine-triphosphate and/or
pseudouridine-triphosphate.
[0097] In some embodiments, the RNA molecules are encoded on one or
more RNA replicons. In some embodiments, the one or more RNA
replicons is/are one or more alphavirus derived replicons,
Venezuelan equine encephalitis virus derived replicons or Sindbis
derived virus replicons. In some embodiments, the RNA molecules are
expressed from one or more subgenomic promoters of the one or more
replicons, optionally wherein the one or more subgenomic promoters
are optimized for length or position in the RNA molecule. In some
embodiments, the one or more subgenomic promoters are regulated by
a small molecule. In some embodiments, the small molecule is
trimethoprim (TMP) or 4-hydroxytamoxifin (4-OHT).
[0098] In some embodiments, the RNA molecules are encoded on one or
more plasmids.
[0099] In some embodiments, the synthetic RNA circuit further
includes a sequence encoding Csy4 protein and a Csy4 recognition
site. In some embodiments, the Csy4 protein is a fusion of a
destabilization domain and Csy4. In some embodiments, the
destabilization domain is regulated by trimethoprim (TMP) or
4-hydroxytamoxifin (4-OHT).
[0100] In some embodiments, the synthetic RNA circuit further
includes one or more internal ribosomal entry sites (IRESs) for
improved polycystronic expression. In some embodiments, the
synthetic RNA circuit further includes one or more general
translation enhancers (GTEs). In some embodiments, the synthetic
RNA circuit is encoded on self-cleaving helper-defective
interfering RNA, optionally comprising Csy4, wherein Csy4 is
expressed from an internal ribosome entry site (IRES).
[0101] According to another aspect, methods of treating cancer in a
mammal are provided. The methods include administering to a mammal
the foregoing synthetic RNA circuits. In some embodiments, the
synthetic RNA circuit is administered as a first replicon, and
further administering a second replicon as ballast to control
expression of a protein encoded by the first replicon.
[0102] According to another aspect, methods of inducing an immune
response in a mammal are provided. The methods include
administering to a mammal the foregoing synthetic RNA circuits. In
some embodiments, the methods further include administering
tetracycline to the mammal In some embodiments, the tetracycline is
administered at different times for expressing the antigen and/or
the adjuvant at the different times. In some embodiments, the
tetracycline is administered by oral administration, intramuscular
injection of lipid nanoparticles, or by implantation of a polymeric
implant for sustained release. In some embodiments, the synthetic
RNA circuit is administered as a first replicon, and further
administering a second replicon as ballast to control expression of
a protein encoded by the first replicon.
[0103] The invention is not limited in its application to the
details of construction and the arrangement of components set forth
in the following description or illustrated in the drawings. The
invention is capable of other embodiments and of being practiced or
of being carried out in various ways. Each of the above embodiments
and aspects may be linked to any other embodiment or aspect. Also,
the phraseology and terminology used herein is for the purpose of
description and should not be regarded as limiting. The use of
"including," "comprising," or "having," "containing," "involving,"
and variations thereof herein, is meant to encompass the items
listed thereafter and equivalents thereof as well as additional
items.
BRIEF DESCRIPTION OF THE DRAWINGS
[0104] The accompanying drawings are not intended to be drawn to
scale. For purposes of clarity, not every component may be labeled
in every drawing.
[0105] FIGS. 1A-1D. RNA-only multi-input microRNA sensor is able to
differentiate between HeLa, HEK 293 and MCF7 cell lines as
demonstrated with transient DNA transfection. (A) Implementation of
the L7Ae-based miRNA sensor that specifically recognizes HeLa cells
based on specific miRNA profile (highly expressed miR21 and low
levels of 141, 142(3p) and 146a). (B) Expression scheme of the
sensor inputs, operator and output in HeLa cells. Operation of the
circuit results in high expression of the output only in HeLa
cells, but not other cell types. (C) Differential expression of the
output protein, EGFP, in HEK, MCF7 and HeLa cells. When output is
not regulated by endogenous microRNA the EGFP fluorescence is high
in all three cell types (set to 1, not shown). Control of the EGFP
expression by the sensor circuit results in over 9-fold higher
output in HeLa cells with respect to HEK cells and almost 11-fold
higher output as compared with MCF7 cells. (D) Specific induction
of apoptosis in HeLa cells by expression of circuit-controlled hBax
protein as determined with Annexin V staining and pDNA
transfection.
[0106] FIGS. 2A-2D. Experimental operation of the
post-transcriptional cascade demonstrated with transient
transfection of DNA (A-B) and the replicon RNA (C-D). (A) Design of
the plasmid encoded cascade with the output, EGFP, at level 0 being
repressed by MS2-CNOT7 (level 1), that in turn is repressed by L7Ae
(level 2) relieving EGFP production. At the last, level 3,
translation of L7Ae is repressed by a synthetic microRNA miRFF4
causing in effect repression of the final output. Red fluorescent
protein, mKate, was used as a transfection control. (C) Replicon
encoded two-stage cascade with the output, EYFP, at level 0 being
repressed by L7Ae (level 1), that in turn is repressed by a
synthetic siRNA-FF4 (level 2). siRNA knockdown results in
expression of the output EYFP. L7Ae was fused to red fluorescent
protein mKate, and both, EYFP and mKate-L7Ae were fused with a
degradation tag, PEST. (B,D) Normalized mean EGFP fluorescence for
the different layers of cascade encoded on plasmid DNA (B) or
alphaviral replicon (D).
[0107] FIGS. 3A-3E. Experimental operation of the
post-transcriptional switch demonstrated with transient DNA
transfection and electroporation of the replicon RNA. (A) Switch
design: L7Ae is co-translated with yellow fluorescent protein,
EYFP. MS2-CNOT7 is co-translated with blue fluorescent protein,
EBFP. The two proteins co-repress each other and addition of a
synthetic siRNA (siFF4 or siFF5) was used to set the state of the
switch. The logic takes place exclusively at post-transcriptional
level, mRNA in the case of DNA co-transfection experiment (boxed)
or alphaviral replicon including four non-structural proteins
(nsP1-4) and a subgenomic promoter (SGP). Red fluorescent protein,
mKate, was used as transfection marker for DNA transfection
experiments. (B-C) Mean fluorescence of the two reporters in the
different states of the switch encoded on plasmid DNA (B) or
alphaviral replicon (C). (D-E) Corresponding representative
fluorescent microscopy images and two-dimensional flow cytometry
plots for plasmid (D) and replicon (E) transfection. When the parts
are encoded on the alphaviral replicon bistability occurs, while in
the case of DNA delivery, bistability is not observed, likely due
to decoupled processes of mRNA production (transcription) and
repression (post-transcriptional).
[0108] FIGS. 4A-4C. Induction of expression from self-replicating
RNA using destabilization domains, DD. (A) The Sindbis replicon
consists of a DD-tagged mVenus in place of the Sindbis structural
proteins. The Shield protects mVenus from degradation by binding to
the destabilization domain (B) Microscopy images taken 24 hours
post-electroporation of BHK-21 cells with the replicon, +/- 2.5 uM
Shield. (C) Corresponding flow cytometry data showing over 16-fold
increase in fluorescence upon addition of shield.
[0109] FIGS. 5A-5C. OFF switch with Destabilization Domains (A) A
simple replicon circuit is modulated by an inducer, Guard, which
binds to the fusion protein. DD-L7Ae. Guard stabilizes the
repressor, which binds to a 2xK-turn motif and represses EYFP
expression. (B) Flow cytometry data collected 24 hours
post-electroporation of the replicon
SGP-DD-L7Ae-SGP-2xK-Turn-EYFP-PEST into BHK-21 cells. Addition of
10 uM Guard (19) results in a 24-fold decrease in mean
fluorescence. (C) Controls: cells electroporated without substrate
(negative control) and cells electroporated with only
SGP-2xK-Turn-EYFP-PEST (positive control).
[0110] FIGS. 6A-6B. (A) TetR translational control in a eukaryotic
cell (Adapted from Goldfless 2012 (20)). (B) Inducible RNA-protein
interaction system as booster for vaccination.
[0111] FIGS. 7A-7E. RNA-only multi-input microRNA classifier
circuit differentiates between HeLa, HEK 293 and MCF7 cells. (a) An
L7Ae-based multi-input microRNA classifier specifically recognizes
HeLa cells based on a unique microRNA profile (highly expressed
miR21 and low levels of miR141, 142(3p) and 146a). (b) Differential
expression of output protein EGFP in HeLa, HEK and MCF7 cells with
transient pDNA transfection. EGFP expression from the classifier
circuit results in 18-fold and 25-fold higher output in HeLa cells
in comparison to HEK and MCF7 cells, respectively (HEK fluorescence
was normalized to 1 and circuit-regulated EGFP fluorescence was
normalized to mKate expressed constitutively from the same
promoter, to account for different expression levels across cell
types). (c-d) Specific induction of apoptosis in HeLa cells by
expression of circuit-controlled hBax protein compared with
constitutive hBax expression: Annexin V positive cells in pDNA (c)
and modRNA (d) transfected cells. (e) Cell death assay in a mixed
HEK/HeLa-EBFP2 culture with modRNA delivery. The graphs indicate
percent of dead cells as measured with AADvanced staining, with HEK
and HeLa cells distinguished by EBFP fluorescence. EGFP-only
transfection was used as a control in all apoptotic/cell death
assays.
[0112] FIGS. 8A-8H. Post-transcriptional cascades and two-state
switch. (a) Cascade design for the pDNA and modRNA experiments. (b)
Normalized mean EGFP fluorescence for the indicated cascade stages
encoded either on pDNA or modRNA. Each stage n involves
co-transfection of constructs 0 to n. (c) Replicon encoded
two-stage cascade. L7Ae was fused to red fluorescent protein mKate.
Each replicon additionally encodes four non-structural proteins
(nsP1-4) and a subgenomic promoter (SGP) driving expression of
circuit components. (d) Normalized mean EGFP and mKate fluorescence
for cascade encoded on self-replicating RNA. (e) Switch design;
shaded: replicon components that include nsP1-4 and SGP. (f)
Corresponding representative two-dimensional flow cytometry plots
for pDNA and replicon transfections. (g,h) Normalized mean
fluorescence of the two reporters in the different states of the
switch encoded on pDNA (g) or replicon (h). Fluorescence was
normalized to the lowest level in each chart.
[0113] FIGS. 9A-9C. Schematic representation of the engineered
post-transcriptional logic circuits. (a) multi-input microRNA
sensor (cell type classifier), (b) post-transcriptional cascade
(information transmission), and (c) switch (feedback regulation). R
denotes post-transcriptional repressor.
[0114] FIGS. 10A-10E. Engineering and characterization of RNA
binding protein (RBP) regulatory parts. (a) L7Ae:K-turn system. (b)
MS2-tethered repressors (MS2-R). (c) Optimization of L7Ae:K-turn
repression: using two repeats of the L7Ae binding motif, K-turn, in
the 5'UTR of the reporter mRNA provides strong repression of the
reporter as shown in the representative flow cytometry histograms
(left) and by mean reporter fluorescence (right). K-turn MUT motif
contains two base pair mutations that inhibit L7Ae binding (36).
(d) Characterization of MS2-fusion repressors. Fold change for best
repressors indicated. (e) Dose response curves of the two best
repressors (with 50 ng of reporter pDNA). Optimization of parts was
performed with pDNA and results are calculated/shown only for
transfected cells (cells expressing transfection marker, mKate).
Fluorescence was normalized to the highest level per series in each
graph.
[0115] FIG. 11. MS2-CNOT7 repressor is also effective in HeLa
cells. The observed dynamic range was comparable to that observed
in HEK293 cells (pDNA as delivery method). Both reporter and
repressor were driven by pCMV promoters. 1x and 2xMS2-CNOT7
indicate 1:1 and 2:1 repressor (MS2-CNOT7) to reporter ratios,
respectively.
[0116] FIGS. 12A-12C. HeLa classifier circuit (pDNA as circuit
carrier), fluorescent assay (FIG. 7B) additional data. (a) two
dimensional flow cytometry plots; EGFP--circuit output,
mKate--transfection marker. "Negative" denotes non-transfected
cells (Hela, HEK293 and MCF7 as indicated). The negative population
was used to set gates for transfected cells. All mKate positive
cells (above horizontal bars) were used to calculate mean
fluorescence. (b,c): Differential expression of output protein EGFP
in HeLa, HEK293 and MCF7 cells with transient pDNA transfection.
(b) As in FIG. 7B, circuit-regulated EGFP fluorescence was
normalized to mKate expressed constitutively from the same
promoter, to account for different expression levels across cell
types. Additionally, HEK fluorescence was normalized to 1
(normalized EGFP expression from the classifier circuit results in
18-fold and 25-fold higher output in HeLa cells in comparison to
HEK and MCF7 cells, respectively). (c) Circuit-regulated EGFP
fluorescence without normalization to mKate (HEK fluorescence was
normalized to 1). EGFP expression from the classifier circuit
results in 8-fold and 34-fold higher output in HeLa cells in
comparison to HEK and MCF7 cells, respectively.
[0117] FIG. 13. HeLa classifier circuit (pDNA as circuit carrier),
fluorescent assay, single microRNA marker data. Reporter constructs
containing EGFP (circuit output) followed by four repeats of target
sites for the particular single marker microRNA were co-transfected
into HeLa, HEK293 and MCF7 cells together with mKate (transfection
marker) expressing constructs. The same pCMV promoter was used to
drive expression of both EGFP and mKate. Two dimensional flow
cytometry plots are shown and top row contains data for EGFP
without target sites (no Ts).
[0118] FIG. 14. Representative two-dimensional flow cytometry plots
for apoptotic assay in separate cultures of HEK 293 and HeLa cells
(pDNA as circuit carrier). HeLa classifier circuit, apoptotic assay
(FIG. 7C) additional data. AnnexinV staining and flow cytometry
were performed 24 h post-transfection. EGFP was used as a
transfection marker, as it has faster maturation time than mKate
and can be detected even in hBax expressing cells that undergo
apoptosis. The percentage of apoptotic cells in pDNA experiment is
much lower than in modified RNA experiments (FIGS. 7D-7E and FIGS.
15 and 16), most likely because of a delay in hBax production
related to transcription (crossing of nuclear envelope by pDNA,
transcription and transport to the cytoplasm; FIGS. 19A-19F and
20A-20F).
[0119] FIG. 15. Representative two-dimensional flow cytometry plots
for apoptotic and cell death assay in separate cultures of HEK 293
and HeLa cells (modRNA as circuit carrier). HeLa classifier
circuit, apoptotic and cell death assays (FIG. 7D) additional data:
AnnexinV (apoptosis marker) vs. AADvanced (cell death stain)
dotplots. HEK 293 or HeLa cells were cultured and transfected
separately. AnnexinV positive cells were counted as apoptotic
cells. In all modRNA cell classifier experiments (including FIGS.
7D-7E) L7Ae was additionally fused with Bcl-2 (L7Ae-Bcl-2) to
further inhibit apoptosis.
[0120] FIG. 16. Representative two-dimensional flow cytometry plots
for cell death assay with modRNA as circuit carrier in mixed cell
culture (HEK 293+HeLa-EBFP2 cells). HeLa classifier circuit cell
death assay (FIG. 7E) additional data. Q4: live HEK 293, Q3: live
HeLa-EBFP2, Q1: dead HEK 293, Q2: dead HeLa-EBFP2. AADvanced
staining and flow cytometry were performed 24 h post-transfection.
AnnexinV-Pacific Blue conjugate was not used in this case, as its
excitation/emission spectra (Ex: 410 nm, Em: 455 nm) overlap with
those of EBFP2 (Ex: 383 nm, Em: 448 nm).
[0121] FIGS. 17A-17D. Representative flow cytometry data for
cascade circuit. Raw flow cytometry data for cascade circuit (FIGS.
8A-8D) with all three modalities tested: pDNA (a), modRNA (b) and
replicon (c). Populations of live, single cell were first
determined based on forward and side scatter. Gates shown on the
plots were established based on negative control (non-transfected,
NT) cells (d) and cells transfected with EGFP or mKate only (not
shown). In the case of pDNA transfections, the transfection
efficiency, as determined by % of mKate transfection control cells,
was 60-65%. Before calculating average EGFP fluorescence, we gated
the populations on mKate positive cells (reported EGFP fluorescence
was calculated for cells from Q1 and Q2 gates). In the case of
modRNA and replicon transfections, the transfection efficiency was
very high (>90%), and therefore all live cells were used to
calculate average output (EGFP) fluorescence (cells from gates
Q1-Q4). Replicon experiments were performed using BHK21 cells, and
HEK 293FT cells were used in modRNA and pDNA transfections. The NT
populations (d) differ between pDNA and modRNA experiments, as the
two data sets were collected and analyzed with different flow
cytometers (see Methods for details).
[0122] FIGS. 18A-18C. Post-transcriptional cascade optimization and
additional data (pDNA as circuit carrier). (a) Cascade scheme.
mKate transfection marker is not shown. (b) Microscopy images for
pDNA experiment (optimized cascade) using 4.2nM siRNA-FF4 input.
Scale bars indicate 200 .mu.m. (c) Cascade dosage response with
various concentrations of the input (siRNA-FF4, from 0.04 to
8.33nM).
[0123] FIGS. 19A-19F. pDNA time-lapse flow cytometry and qPCR.
(a,b) pDNA-encoded EGFP or EGFP-PEST (41) were transfected into
293FT cells. EGFP fluorescence was measured by flow cytometry (a)
and mRNA level was measured by qRT-PCR (b). qRT-PCR results were
normalized to endogenous 18S rRNA level. Error bars indicate the
average .+-.standard deviation of triplicates. (c,d) Behavior of
L7Ae:2xK-turn system encoded with pDNA. 293FT cells transfected
with pDNA 2xKt-EGFP with or without L7Ae-expressing construct and
analyzed by flow cytometry (c) and qRT-PCR (d). (e,f) Cascade
circuit delivered with pDNA. Plasmids encoding the cascade circuit
stages 0-3 (FIG. 8A) were transfected into 293FT cells and analyzed
by flow cytometry (e) and qRT-PCR (f). Note that miR-FF4 expressed
from a plasmid was used here (Table 1). EGFP fluorescence was
measured at 3 h, 6 h, 12 h and days 1-8. qRT-PCR was performed for
samples harvested at 6 h, 12 h and days 1-5. In the case of the
cascade circuit, only the most crucial time points were followed
with qRT-PCR: 6 h and days 1-4. Mean EGFP fluorescence was
calculated for EGFP positive gate established based on
non-transfected cells (all above the background fluorescence).
FIGS. 20A-20F. modRNA time-lapse flow cytometry and qPCR. (a,b)
modRNAs encoding EGFP or EGFP-PEST(41) were transfected into 293FT
cells. EGFP fluorescence was measured by flow cytometry (a) and
modRNA level was measured by qRT-PCR (b) at 3 h, 6 h, 12 h, day 1,
day 2, day3, day 4 and day 5. qRT-PCR results were normalized to
endogenous 18S rRNA level, and relative levels of the modRNA to
that at 3 h after transfection were shown. Insets show respective
modRNA levels at the 3 h time point. Error bars indicate the
average.+-.standard deviation of triplicates. (c,d) Behavior of
L7Ae:K-turn system delivered by modRNAs. 293FT cells were
transfected with Kt-EGFP modRNA with or without L7Ae-expressing
modRNA and analyzed by flow cytometry (c) and qRT-PCR (d). qRT-PCR
was performed at following selected time points; 3 h, day 1, day 2,
and day 3. (e,f) Cascade circuit delivered by modRNAs. Sets of
modRNAs and siRNAs encoding the cascade circuit were transfected
into 293FT cells and analyzed by flow cytometry (e) and qRT-PCR (f)
at the same time points as in (c) and (d), respectively.
[0124] FIG. 21. Replicon life cycle. Replicon RNAs used in this
study contain a 7-methylguanosine cap, a 5'UTR, an RNA-dependent
RNA polymerase (RdRp) polyprotein P1234 (i.e. nonstructural
proteins [nsPs]), a subgenomic promoter element (SGP), a variable
region of interest from which a reporter protein or RNA binding
protein is expressed (GOI), a 3'UTR, and a poly(A) tail (+strand).
Once the replicon RNA (generated by in vitro transcription) is
transfected into a cell, the polyprotein P1234 is translated.
Alphaviral RNA synthesis occurs at the plasma membrane of a cell,
where the nsPs, together with alphaviral RNA, form membrane
invaginations (or "spherules" (42, 43)). These spherules contain
dsRNA created by replication of "+" strand viral genomic RNA into
"-" strand anti-genomic RNA. The "-" strand serves as a template
from which additional "+" strand genomic RNA (synthesized from the
5'UTR) or a shorter subsequence of the genomic RNA (termed
subgenomic RNA) is synthesized from the subgenomic promoter region
located near the end of the nonstructural protein ORF. The "+"
strand genomic RNA and the subgenomic RNA are exported out of the
spherules into the cytoplasm where they are translated by
endogenous ribosomes.
[0125] FIGS. 22A-22E. VEE replicon time-lapse flow cytometry and
qPCR. (a,b) Replicons encoding constitutive EGFP or EGFP-PEST (41)
were electroporated into BHK21 cells and EGFP fluorescence was
measured by flow cytometry at 3 h, 6 h, 12 h, day 1, day 2, day 3,
day 4, day 5, day 6, and day 7 (a [linear scale y-axis], b [log
scale y-axis]). (c) The percentage of EGFP positive cells at the
same time points as in (a) are plotted. (d,e) Replicon EGFP or
EGFP-PEST genomic RNA levels in (a) were measured by qRT-PCR (d
[linear scale y-axis], e [log scale y-axis]).
[0126] FIGS. 23A-23C. VEE replicon-based cascade time-lapse flow
cytometry and qPCR. (a) Replicon encoding 2xKt EGFP was
electroporated into BHK21 cells with or without replicon encoding
L7Ae, and EGFP fluorescence was measured by flow cytometry at 3 h,
6 h, 12 h, day 1, day 2, day 3, day 4, day 5, day 6, and day 7.
Cells co-electroporated with 2xKt EGFP and L7Ae were also
electroporated with either siRNA-FF4 (to knock down replicon L7Ae)
or siRNA-Ctrl. (b) mKate (L7Ae) fluorescence was measured by flow
cytometry at the same time points as in (a). (c) Replicon 2xKt EGFP
genomic RNA levels in (a) were measured by qRT-PCR. Arbitrary units
of EGFP or mKate fluorescence are plotted. qRT-PCR was normalized
to genomic RNA levels 3 h post-electroporation. The reduced cascade
performance over time may be attributed to potential competition
between replicons (FIGS. 24A-24B) that needs to be evaluated with
further studies (e.g. through creating multi-translation unit
circuits encoded on a single RNA replicon).
[0127] FIGS. 24A-24B. Expression kinetics of BHK21 cells
transfected with two VEE replicons. (a) Replicons encoding
constitutive EGFP and mKate were co-electroporated into BHK21
cells, and EGFP and mKate fluorescence levels were measured by flow
cytometry at 3 h, 6 h, 12 h, day 1, day 2, day 3, day 4, day 5, day
6, and day 7. (b) The percentage of EGFP/mKate double positive,
EGFP single positive, mKate single positive, and double negative
cells at the time points in (a) are plotted.
[0128] FIG. 25. Operation of the Sindbis replicon two-stage cascade
with or without a degradation domain (PEST) fused to the reporter
or repressor. PEST domains (41) reduce the half-life of a protein
by targeting the protein for ubiquitin and proteasome-mediated
degradation, providing means for additional tuning of the circuit
and potentially faster dynamics. Design of the Sindbis replicon
encoded two-stage cascade is as depicted in FIG. 8C. Variations of
the original construct in which the EGFP reporter and/or the
mKate-L7Ae repressor contained a C-terminal PEST domain fusion were
tested. Experiments were performed in BHK-21 cells. Arbitrary units
of EGFP fluorescence are plotted. Numbers inside or by the
individual bars within the chart indicate EGFP expression level
relative to each "Reporter only" construct (i.e. "Replicon 2xKt
EGFP" or "Replicon 2xKt EGFP-PEST").
[0129] FIGS. 26A-26C. Repression of plasmid DNA (pDNA) 2xK-turn
reporter by Sindbis replicon L7Ae and expression kinetics of the
electroporated pDNA reporter (mixed pDNA/replicon delivery). (a)
Replicon L7Ae was co-electroporated with pDNA 2xK-turn EGFP or pDNA
mutant 2xK-turn EGFP into BHK21 cells and fluorescence levels were
measured by flow cytometry. Arbitrary units of EGFP fluorescence
are plotted. Numbers inside the chart indicate EGFP expression
level relative to the "repressed state" (i.e. Replicon L7Ae+pDNA
2xK-turn EGFP). (b,c) Kinetics of EGFP expression from the
electorporated pDNA 2xK-turn reporter. Expression was measured 3 h,
6 h, 12 h, and 24 h after electroporation. Arbitrary units of EGFP
fluorescence are plotted using linear or log scales. L7Ae expressed
from a replicon can repress a reporter gene with K-turn motifs
expressed from pDNA upon replicon/pDNA co-electroporation (a),
however, the repression efficiency is lower than when both the
repressor and reporter are expressed from replicons (FIG. 8D, FIG.
25). This can be explained by the observation that a protein
regulated by an SGP is expressed only after a lag due to dynamics
of RNA replication, whereas a protein encoded on a plasmid is
expressed much more quickly following electroporation (b,c). Note,
that all other pDNA experiments in this study were carried out with
lipid-based transfection, which also results in a lag in expression
(FIGS. 19A-19F).
[0130] FIG. 27. Representative fluorescent microscopy images for
switch circuit (pDNA as the circuit carrier). Images correspond to
FIGS. 8E-8G (pDNA). Scale bars indicate 200 .mu.m.
[0131] FIG. 28. Representative flow cytometry data for switch
circuit. The graphs correspond to FIG. 8F, but additionally include
axes labels and sub-population statistics. Gates shown on the plots
were established based on negative (non-transfected) cells and
cells transfected with EYFP or EBFP only. In the case of pDNA, only
transfected cells (based on mKate transfection marker) were used to
calculate output mean fluorescence (for EYFP or EBFP2). Replicon
electroporations result in very high transfection efficiencies
(Table 1), and therefore all live cells were used for calculation
of the means in the replicon case and the grid lines are only
included for visual guidance.
[0132] FIGS. 29A-29D. Characterization of siRNA knock-down
efficiency of Sindbis replicons comprising the post-transcriptional
switch. Increasing concentrations of siRNA targeting the MS2-CNOT7
EBFP2 replicon (a [linear scale y-axis], b [log scale y-axis]:
siRNA-FF5) or replicon L7Ae EYFP (c [linear scale y-axis], d [log
scale y-axis]: siRNA-FF4) were co-electroporated with corresponding
target replicon into BHK21 cells. Fluorescence levels were measured
by flow cytometry and normalized to a replicon-only control
transfection without siRNA. Non-specific siRNA was used as a
negative control (siRNA-Ctrl).
[0133] FIGS. 30A-30C. Sindbis replicon genomic RNA levels in FACS
sorted populations from the post-transcriptional switch. Design of
the Sindbis replicon post-transcriptional switch is as in FIG. 8E.
BHK21 cells transfected with the switch circuit expressing low
EYFP/high EBFP2 (P6) or high EYFP/low EBFP2 (P7) were sorted by
FACS (a, right). Additionally, replicons lacking the aptamers that
enable translational repression (2xKt or MS2 binding site) were
co-transfected as a "no cross-repression" control and FACS sorted
for low EYFP/low EBFP2 (P5) or high EYFP/high EBFP2 (P4) (a, left).
RNA from each sorted population was extracted and qRT-PCR was
performed to measure the relative amounts of replicon genomic RNA
in each population (b,c). The level of each replicon (Replicon L7Ae
EYFP: b, Replicon MS2-CNOT7 EBFP2: c) was normalized to that in the
high EYFP/high EBFP2 population. MS2-CNOT7 results in degradation
of the targeted mRNA, thereby affecting replication (b, P6 in
replicon L7Ae EYFP). L7Ae, on the other hand, does not
significantly affect replication of replicon MS2-CNOT7 EBFP2 (c, P6
and P7).
[0134] FIGS. 31A-31B. Theoretical model diagrams. Diagrams of the
models for (a) pDNA and (b) replicon systems. The primary species,
pL/pC and rL/rC, represent the transfected pDNA or replicons
respectively. `L` pertains to L7Ae-related species and `C` to
MS2-CNOT7-related species (i.e. pL: pDNA L7Ae species). The pDNA
system is inert until the plasmids enter the nucleus upon cell
division, whereas for the replicon model, nonstructural proteins
transport cytoplasmic replicon RNA strands to the plasma membrane
(kTR) where they form spherules that act as replication factories
(`RF`) and become double-stranded. The pDNA in the nucleus and the
double-stranded RNA in the spherules both serve as templates for
mRNA (mL/mC) transcription (kTS). The mRNAs are translated (kTL)
into their respective RBPs, L7Ae or MS2-CNOT7. MS2-CNOT7 binds the
L7Ae transcript and increases its degradation rate while L7Ae binds
the MS2-CNOT7 transcript and blocks translation. Within the first
few hours of the replicon system, while transcribing mRNAs, the
spherules also transcribe more of the original genomic RNAs
(.epsilon.). Also, the RBPs not only interact with mRNA but with
the replicons themselves. MS2-CNOT7 binds the L7Ae replicon and
increases its degradation rate (arrow). We also considered the
possibility that binding of RBPs to the replicons can inhibit
replication complex formation (dashed lines, .beta.).
[0135] FIGS. 32A-32B. Theoretical model: Mutual Exclusivity (MEx)
metric. (a) The MEx score was calculated by fitting the
log-transform of the data to a line. The distribution is more
mutually exclusive if cells enter the extreme regions of the plot
(high L7Ae, low MS2-CNOT7 or low L7Ae, high MS2-CNOT7) and
therefore have a large variance along the line (V). Normalizing V
by the distance from the origin (M) gives higher scores to
distributions with high variance that approach the x and y axes.
The MEx score was thus calculated as V/M. Since cells with
generally low expression (low transcription rate or low copy
number) are close to the origin and receive artificially high
scores, we normalized the data to the starting copy number (PO or
RO) and transcription rate (kTS) before performing this analysis.
(b) Examples of cell distributions and their MEx scores. Insets
show the same data on a linear scale.
[0136] FIGS. 33A-33B. Theoretical model: comparison of long-term
behavior. Simulations of the long-term effects for both the pDNA
(a) system and replicon (b) system for the example parameters
listed in Table 6. Both simulations involve 288 cells. The pDNA and
replicon models were run for simulation times of 48 hours and 24
hours respectively to correspond to the experimental set-up of FIG.
8F (pDNA and replicon, siRNA Ctrl case).
[0137] FIG. 34. Theoretical model: pDNA system analysis of mutual
exclusivity. Parameter perturbations for starting copy number (P0),
transcription rate (kTS), protein degradation rate (degP), and the
starting copy number variance-to-mean ratio (P0 VMR). For each
parameter set, 3 simulations were run with 96 cells each. Error
bars are one standard deviation. Values from Table 6 were used for
parameters that are unperturbed.
[0138] FIGS. 35A-35B. Theoretical model: replicon system analysis
of mutual exclusivity. (a) MEx scores from distributions of 2000
simulated cell populations plotted for each parameter. Warmer
colors indicate higher point density. (b) Heat maps for the
identification of parameter interactions, with color intensity
indicating MEx score. kTR: transport rate, kTS: transcription rate,
RO: starting replicon copy number, c: positive feedback, (3:
replication inhibition.
[0139] FIGS. 36A-36B. EGFP expression profiles after delivery with
VEE replicon, modRNA or pDNA. (a) CV measured at 12, 24 and 48 h
after transfection (CVs were computed using Flowjo software for
EGFP positive cells), Flowjo:
www.flowjo.com/v9/html/statdefinitions.html; (b) corresponding
representative histograms of EGFP expression (indicated gate
contains EGFP positive cells). Replicon experiments were performed
using BHK21 cells and HEK 293FT cells were used in modRNA and pDNA
transfections.
[0140] FIGS. 37A-37G. Programmable RNA replicon-based vaccination
platform. (A) LNP-packaging of RNA replicons prolongs the duration
of fluc reporter expression. (B) SIV gag long peptide immunogen
encoded on LNP-packaged replicons elicits a potent immune response.
(C) Exponential prime/boost dosing drastically increases
antibody-titers. (D) Replicon toggle switch. (E) Replicon small
molecule-regulated ON switch. (F) Replicon small molecule-regulated
OFF switch. (G) Replicon small molecule-regulated cascade.
[0141] FIGS. 38A-38C. Engineering of optimal antigen/adjuvant
expression kinetics using a programmable RNA replicon vaccine
platform. (A) Delayed adjuvant expression using a replicon OFF
switch and nanoparticle-based slow release of small molecules. (B)
Exponential prime/boost expression of gag or gp120 using a replicon
OFF switch. (C) Sequential expression of gp120 antigens for the
induction of cross-reactive antibodies.
[0142] FIG. 39. LNP lipid nanoparticle delivery of replicons into
muscle substantially augments in vivo gene expression. Schematic:
Synthesis schematic of our custom PEGylated lipid nanoparticle
formulation. Image: Cryoelectron microscopy image of LNPs. Graph:
C57BL/6 mice were administered different doses of
luciferase-encoding replicon RNA either as naked RNA or formulated
in LNPs to opposite flanks of mice, and bioluminescence was
recorded over 1 week post administration.
[0143] FIGS. 40A-40C. Long-lived antigen-specific T-cell responses
elicited by prime-boost replicon vaccination. Groups of C57BL/6
mice were immunized with 6.mu.g replicon RNA encapsulated in lipid
nanoparticles encoding two different variant gag peptides
(miniSIVgag1, miniSIVgag2), luciferase (as a control), or were
injected with PBS alone (not immunized, NI). Animals received a
boost injection of the same formulations on day 28.
Antigen-specific CD8+T-cells in blood were traced over time by
peptide-MHC tetramer staining. Shown are (A) representative
tetramer staining flow cytometry plots, (B) mean tetramer+cells
over time, and (C) the phenotypes of the antigen-specific cells
tracked by flow cytometry.
[0144] FIG. 41. Simultaneous visualization of replicon expression
and tracking of immune response to a replicon-encoded antigen.
(Top) Schematic structure of replicon encoding a luciferase
(Fluc2)-ovalbumin peptide (SIINFLKL, SEQ ID NO: 25) fusion.
(Bottom) C57B1/6 mice (n=5/group) were immunized with 6 .mu.g
Fluc2-OVA replicons packaged in lipid nanoparticles i.m. Shown are
parallel longitudinal IVIS imaging of luciferase expression (left
axis) and tracking of OVA-specific T-cells by peptide-MHC tetramer
staining on peripheral blood T-cells (right axis).
[0145] FIG. 42. SlVgag and luciferase co-expressing replicons for
simultaneous tracking of antigen expression and immune response.
C57B1/6 mice were immunized i.m. with 6 .mu.g of lipid
NP-encapsulated VEE replicons encoding either a fusion of SlVgag
antigen and luciferase (miniSIVgag1-Fluc2) or gag antigen expressed
as a separate protein from Fluc via a 2A skip peptide
(miniSIVgag1-P2A-Fluc2). Shown are luciferase expression over time
(top graphs) and antigen-specific T-cell responses over time (lower
graph).
[0146] FIG. 43. Comparison of replicon expression and T-cell
priming by 3 routes of injection. Groups of albino C57B1/6 mice
were immunized with lipid NP-encapsulated miniSlVgag-Fluc2
replicons, and gene expression was followed by bioluminescence
imaging in tandem with tracking of antigen-specific CD8 T-cells in
blood by peptide-MHC tetramer staining.
[0147] FIGS. 44A-44C. Albino C57BL/6 mice were injected with either
empty or replicon-loaded LNPs at the indicated dose. Seven days
post injection half of the animals were sacrificed, muscles
digested and mononuclear cells isolated by enzymatic digestion.
Cells were further analyzed by flow cytometry (A). Luciferase
expression in vivo was measured every other day by IVIS (B), and
percentage of SIVgag specific T CD8+cells was evaluated at day 14
post injection by tetramer staining of blood cells (C). In a
separate experiment animals were injected via intramuscular with
6ug of either luciferase-expressing RNA replicon (pTK159)- or Poly
(I:C)-loaded LNPs, and expression of viperin (rsad2), a gene
downstream of type I interferon activation, was measured by
quantitative PCR (D).
[0148] FIG. 45A-45B Small-molecule-regulated gene expression from
RNA replicons in vivo. (A) Schematic structure of several
TMP-regulated "DD" replicon constructs generated. (B) In vivo
bioluminescence signal (total flux) measured vs. time in C57B1/6
mice (n=5/group) given 6 .mu.g of DD-Fluc2 luciferase replicon RNA
packaged in lipid nanoparticles on day 0, administered i.m. Animals
either received no TMP at any time (TMP-), constant TMP exposure in
drinking water (TMP+), or had TMP added (TMP- to TMP+) or withdrawn
(TMP+ to TMP-) on day 4.
[0149] FIGS. 46A-46C. DD-L7Ae circuits for indirect regulation of
antigen/reporter gene expression in vivo. (A) Schematic of L7Ae
circuit which shuts off antigen/reporter gene expression in the
presence of TMP. (B-C) C57B1/6 mice were immunized i.m. with 6.mu.g
of lipid NP-encapsulated L7Ae constructs encoding luciferase as the
output gene downstream of the 2xK-turn. Shown are results for two
different replicon promoter configurations in the presence (+TMP)
or absence of TMP administered ad libitum orally, demonstrating
reduced reporter gene expression in the presence of TMP.
[0150] FIGS. 47A-47B. (A) Mean expression of EGFP and mKate of a
co-transfected population. (B) Percent EGFP and mKate positive
cells.
[0151] FIG. 48. Top: Schematic of tandem SGP construct. The SGP2
was used to test the SGP library to prevent deleterious mutations
of nsP4. Bottom: Five SGPs representing the dynamic range of the
SGP library.
[0152] FIG. 49. Including additional 3'UTRs in between two
translational units increases expression of the first gene, while
only slightly decreasing expression from the second gene.
[0153] FIG. 50. Single SGP Optimization showed that the sequence
between the SGP and Kozak directly affected replicon expression. In
particular, the XbaI-attb1 sequence in our standard replicon
decreased expression and prevented us from achieving the dynamic
range observed in a tandem format.
[0154] FIG. 51. Schematic of MoClo-based assembly strategy for
multi-unit replicons.
[0155] FIGS. 52A-52B. (A) Two SGP constructs with all combinations
of SGP 5 (low (L)), 30 (midrange(M)), and 15 (high(H)) with and
without an additional 3'UTR. (B) Three SGP constructs with all
combinations of low, midrange, and high SGPs with and without
additional 3'UTRs. All fluorescent values are normalized to the
respective fluorescent positive controls.
[0156] FIG. 53. Flow diagram of destination vectors (Table 8).
[0157] FIG. 54. The full dynamic range of the SGP library could be
achieved using only plus side truncations, so the library was
portable to single SGP systems. The same hierarchy between SGPs was
observed, with an increased range of expression levels, reaching
22-fold.
[0158] FIGS. 55A-55B. (FIG. 55A) L7Ae is expressed in the first
position under SGP30, while the second SGP preceding a 2xK-turn
mVenus is varied. L7Ae shows strong repression compared to the same
construct with a dummy protein in place of L7Ae. The optimal
construct represses to baseline, or the negative control. (FIG.
55B) TetR is expressed from the second position under the strongest
SGP, with optimal repression of 7-fold compared to a mutant
Tet-aptamer control.
[0159] FIG. 56. Titration of DDd-Fluc2 with TMP and DDe-Fluc2 with
4-OHT resulted in 8.6- and 6.4-fold increases compared to
expression when no small molecule is present. This data is
normalized to Fluc2 constitutively expressed under the wild type
SGP30, revealing that both DDd and DDe decrease expression of the
protein to which they are fused.
[0160] FIGS. 57A-57C. DDd-L7Ae was tested in (FIG. 57A) BHK-21,
(FIG. 57B) C2C12, and (FIG. 57C) myotubes differentiated from C2C12
myotblasts. When TMP is present, L7Ae is stabilized and the output
is repressed. An EYFP reporter was used in BHK-21 cells, while
Fluc2 was used in C2C12 and myotubes. As shown, C16, a PKR
inhibitor was used in myotubes to increase expression and overall
fold change.
[0161] FIGS. 58A-58D. (FIG. 58A) Expression of mVenus over time for
various doses of Sindbis replicon, showing a rapid increase to
dose-independent level. Dose is indicated by hue, ranging
geometrically from 21 ng/ul to 2055 ng/ul. (FIG. 58B) The same data
shown for the first 11 hours. (FIG. 58C) Co-transfection of two
replicons at varying ratios and a constant combined dose produces a
linear relation between relative dose and fluorescence and (FIG.
58D) a constant total fluorescence. Expression units are MEFL:
Molecules of Equivalent FLuorescein.sup.2.
[0162] FIGS. 59A-59D. (FIG. 59A) DI RNA generation by deletion of
the parts of the nsPs (FIG. 59B) Validation that DI RNA containing
an A3 mutation results in higher DI RNA expression (FIG. 59C)
Helper RNA can be optimized to slightly increase DI RNA expression
by preventing subgenomic translation and increasing nsP production
from the helper (FIG. 59D) An optimal helper:DI-RNA ratio exists
for maximal DI RNA expression.
[0163] FIGS. 60A-60B. (FIG. 60A) Schematic of a helper-CRS-DI RNA
system. In preliminary experiments, Csy4 was expressed on a
co-transfected replicon, but in the future is expressed via an IRES
on the same replicon. This should allow Csy4 to be expressed before
or early during replication and result in higher cleavage
efficiency. (FIG. 60B) A minimal Csy4 recognition site (CRS) is
required to prevent a scar on the 5' of the DI RNA that
dramatically reduces replication. When using this minimal CRS,
increasing the amount of Csy4 has a positive effect on DI RNA
expression, presumably due to enhanced cleavage.
[0164] FIGS. 61A-61B. (FIG. 61A) Schematic of the 96 variants of a
TMP inducible switch with cascade topology. In this switch, L7Ae is
stabilized by TMP, represses TetR, allowing expression of the
output. (FIG. 61B) Fold changes between the OFF state (-TMP/-Dox)
and the ON state (+TMP/+Dox) in BHK-21 cells 48 hours
post-transfection.
[0165] FIG. 62. Schematic for screen of TetR-repression enhancer
fusions. Briefly, a library of Dox-inducible ON switches is
screened using FACS and RNA-seq to find repression enhancers that
promote higher ON/OFF fold changes when fused to TetR.
[0166] FIGS. 63A-63B. (FIG. 63A) Preliminary Csy4 cleavage-based
irreversible switch. Before Csy4 cleavage, mKate is expressed
slightly higher due to positional effect, while mVenus remains low.
When Csy4 is co-transfected, the second translational unit is
removed, allowing mVenus expression to increase. (FIG. 63B) To
optimize this circuit, the mKate ON state is increased using
stronger SGPs, include an inducible Csy4 on the replicon, and
introduce DDd-L7Ae to decrease mVenus expression in its OFF state,
as shown in the truth table.
[0167] FIG. 64. Schematic of helper DI high sensor. Csy4 is
expressed for an IRES and cleaves the helper-CRS-DI RNA. If miR-FF4
is absent, L7Ae from the DI RNA represses mVenus on the helper. If
miR-FF4 is added to the system, the DI RNA is degraded, no L7Ae is
present, and mVenus expresses.
[0168] FIG. 65. TMP inducible OFF switch. When TMP is present, L7Ae
is stabilized and the reporter is repressed. When TMP is removed,
L7Ae is degraded and the reporter is expressed.
[0169] FIG. 66. In vivo testing of the optimized small
molecule-inducible ON switch.
[0170] FIG. 67. Schematic of the circuit to identify the optimal
IRES for protein expression from an RNA replicon.
[0171] FIG. 68. Overview of the FACS/RNA-Seq-based in vitro screen
to identify general enhancers of translation in myoblasts which may
be used to improve circuit performance of the TetR-RE ON
switch.
[0172] FIG. 69. Overview of the FACS/RNA-Seq-based in vitro screen
to identify enhancers of TetR-RE-based replicon ON switch circuit
performance.
[0173] FIG. 70. Pulsing Fluc expression in vivo using the
DDd-L7Ae-based replicon "OFF switch" in mice.
[0174] FIG. 71. Pulsing RSV F expression in vivo using the
DDd-L7Ae-based replicon "OFF switch" in mice.
[0175] FIG. 72. Comparison of immune responses of homologous vs
heterologous prime/boost.
[0176] FIG. 73. Screen #1: SGP/UTR tuning (20140917 to 20141026)
500 ng RNA normalized to pXZ065.
[0177] FIG. 74. Screen #2: NxKt tuning 100 ng RNA normalized to
pXZ065.
[0178] FIG. 75. Screen #3: 2xDDd tuning (20150506) 100 ng RNA
normalized to pXZ065.
[0179] FIG. 76. Screen #4: sidebyside -/+IRES E3L 100 ng RNA
normalized to pXZ065.
[0180] FIG. 77. TetR repression from tandem replicon. TetR-fusion
multi SGP circuit diagram.
[0181] FIG. 78. TetR repression from tandem replicon. TetR fold
repression vs. mutant binding aptamer.
[0182] FIG. 79. Transferring TetR to modRNA presents some issues.
TetR does not repress very well or respond to Dox from a modRNA
platform.
[0183] FIG. 80. TetR-DDX6 modRNA. Fusing TetR to DDX6 allows it to
efficiently repress and respond to Dox induction.
[0184] FIGS. 81A-81C. TetR-DDX6 in replicon can replace the cascade
for small molecule "ON" switch (FIGS. 81A-81C).
DETAILED DESCRIPTION OF DISCLOSURE
[0185] Methods are described herein for safe, programmable control
of cell behavior, with minimal risk of harmful genomic integration,
through synthetic regulatory circuits encoded exclusively on RNA.
Towards the goal of a plug-and-play platform for RNA-encoded
regulation several post-transcriptional circuits were created by
wiring regulatory devices based on RNA binding proteins. The
circuit behavior can also be tuned/controlled via a small molecule
dependent aptamer or degradation domain As demonstrated herein, the
circuits function when encoded on self-amplifying RNA replicon,
providing means for long-term expression and a potential platform
for future therapeutic applications.
[0186] Synthetic regulatory circuits encoded on RNA rather than DNA
could provide a means to control cell behavior while avoiding
potentially harmful genomic integration in therapeutic
applications. Post-transcriptional circuits were created using
RNA-binding proteins, which can be wired in a plug-and-play fashion
to create networks of higher complexity. As demonstrated herein,
the circuits function in mammalian cells when encoded on modified
mRNA or self-replicating RNA.
[0187] In some embodiments, synthetic RNA circuits that are
multi-input microRNA-based cell classifiers are provided. Such
circuits can include a plurality of RNA molecules. A first RNA
molecule includes at least one sequence recognized by at least one
microRNA (first microRNA) that is/are specifically expressed in a
first cell type, and a sequence encoding a protein that
specifically binds to a RNA motif and inhibits protein production.
A second RNA molecule includes at least one sequence recognized by
at least one different (second) microRNA that is/are not expressed
in the first cell type or is expressed at a low level relative to a
second cell type, at least one RNA motif and a sequence encoding an
output molecule. By sensing the presence and/or absence of the
first and second microRNAs, each of which can be a single or a
plurality of different microRNAs, the circuit expresses the output
molecule only under specific conditions, which are indicative of a
particular cell type(s). For example, in a cell that expresses the
first microRNA(s) but not the second microRNA(s), the RNA molecule
encoding the protein that specifically binds to a RNA motif and
inhibits protein production is not translated or is degraded, which
then permits expression of the output molecule. If the second
microRNA(s) is present, then the RNA molecule that includes the
sequence encoding an output molecule is not translated or is
degraded. In the absence of the first microRNA(s), the first RNA
molecule expresses the protein that specifically binds to a RNA
motif and inhibits protein production, which binds to and represses
translation of or degrades the second RNA molecule that encodes the
output molecule. Thus, only in cells in which the first microRNA(s)
is present and the second microRNA(s) is absent is the output
molecule produced. This allows for specific control over the
expression of the output molecule.
[0188] For example, in some embodiments, expression is controlled
by the presence and absence of certain microRNAs in a cancer cell.
In one embodiment, a microRNA that is expressed in the cancer cell
is miR-21, and microRNAs that are not expressed in the cancer cell
are miR-141, miR-142 and/or miR-146.
[0189] In some embodiments, synthetic RNA circuits that are
post-transcriptional cascades are provided. Such circuits can
include a plurality of RNA molecules. A first RNA molecule includes
at least one sequence recognized by a protein that specifically
binds to a RNA motif and inhibits protein production, and a
sequence encoding an output molecule. A second RNA molecule
includes at least one sequence recognized by a second protein that
specifically binds to a RNA motif and inhibits protein production,
and a sequence encoding the first protein that specifically binds
to a RNA motif and inhibits protein production. A third RNA
molecule includes at least one sequence recognized by an siRNA
molecule or a microRNA molecule, and a sequence encoding the second
protein that specifically binds to a RNA motif and inhibits protein
production. The synthetic RNA circuit also can include the siRNA
molecule or microRNA molecule that binds to the third RNA molecule.
The siRNA molecule can be a synthetic siRNA molecule. The microRNA
molecule can be an endogenously expressed microRNA molecule.
[0190] Without the siRNA or microRNA, the second protein that
specifically binds to a RNA motif and inhibits protein production
is translated, and it represses translation of or degrades the
second RNA molecule. This means that the first protein that
specifically binds to a RNA motif and inhibits protein production,
which is encoded on the second RNA molecule, is not expressed. As a
result, the first RNA molecule can be translated, and this permits
production of the output molecule. If the siRNA or microRNA is
present, the second protein that specifically binds to a RNA motif
and inhibits protein production is not translated, and it cannot
repress translation of or degrade the second RNA molecule. This
means that the first protein that specifically binds to a RNA motif
and inhibits protein production, which is encoded on the second RNA
molecule, is expressed. As a result, translation of the first RNA
molecule is repressed (or the RNA is degraded), and the output
molecule is not translated.
[0191] In some embodiments, the synthetic RNA circuits include a
first RNA molecule that includes at least one sequence recognized
by a first protein that specifically binds to a RNA motif and
inhibits protein production, and a sequence encoding an output
molecule; and a second RNA molecule that includes at least one
sequence recognized by an siRNA molecule or a microRNA molecule,
and a sequence encoding the first protein that specifically binds
to a RNA motif and inhibits protein production. The synthetic RNA
circuit of can also include the siRNA molecule or microRNA molecule
that binds to the second RNA molecule. The siRNA molecule can be a
synthetic siRNA molecule. The microRNA molecule can be an
endogenously expressed microRNA molecule. In the presence of the
siRNA or microRNA, the first protein that specifically binds to a
RNA motif and inhibits protein production is not produced and the
output molecule is produced, whereas in the absence of the siRNA or
microRNA, the first protein that specifically binds to a RNA motif
and inhibits protein production is produced and the output molecule
is not produced.
[0192] In some embodiments, synthetic RNA circuits that are
two-state switches are provided. Such circuits can include a
plurality of RNA molecules. A first RNA molecule includes at least
one sequence recognized by a first protein that specifically binds
to a RNA motif and inhibits protein production, a sequence encoding
a second protein that specifically binds to a RNA motif and
inhibits protein production, and at least one sequence recognized
by a first siRNA molecule or microRNA molecule. A second RNA
molecule includes at least one sequence recognized by the second
protein that specifically binds to a RNA motif and inhibits protein
production, a sequence encoding the first protein that specifically
binds to a RNA motif and inhibits protein production, and at least
one sequence recognized by a second siRNA molecule or microRNA
molecule. The synthetic RNA circuit of can also include the siRNA
molecule or microRNA molecule that binds to the second RNA
molecule. The siRNA molecule can be a synthetic siRNA molecule. The
microRNA molecule can be an endogenously expressed microRNA
molecule.
[0193] In some embodiments, the the first RNA molecule and/or the
second RNA molecule further comprise a sequence encoding one or
more output molecules that are not a protein that specifically
binds to a RNA motif and inhibits protein production. The presence
of the first siRNA molecule or microRNA molecule determines whether
the first or second protein that specifically binds to a RNA motif
and inhibits protein production is produced, and in some
embodiments, whether one or more output molecules are produced.
[0194] In some embodiments, synthetic RNA circuits that are ON or
OFF switches are provided. In some embodiments, a synthetic RNA
circuit is provided including an RNA molecule that includes a
sequence encoding a destabilization domain fused to an output
protein. The destabilization domain facilitates degradation of the
output protein in the absence of a small molecule that binds to the
destabilization domain In some embodiments, the destabilization
domain is, or is derived from, the E. coli DHFR protein (DDd).
[0195] In some embodiments, a synthetic RNA circuit is provided
including a plurality of RNA molecules. A first RNA molecule
includes a sequence encoding a destabilization domain fused to a
protein that specifically binds to a RNA motif and inhibits protein
production. A second RNA molecule includes at least one sequence
recognized by the protein that specifically binds to a RNA motif
and inhibits protein production, and a sequence encoding an output
molecule. The destabilization domain facilitates degradation of the
protein that specifically binds to a RNA motif and inhibits protein
production in the absence of a small molecule that binds to the
destabilization domain In some additional embodiments, the output
molecule is a fusion of a TetR protein and a second protein; and
the RNA molecule(s) further include an aptamer sequence and a
second output molecule. The aptamer sequence is bound by the TetR
protein in the absence of tetracycline. The aptamer sequence is
positioned relative to the second output molecule so that it
inhibits production of the second output molecule in the absence of
tetracycline.
[0196] In some embodiments, a synthetic RNA circuit is provided
that includes an RNA molecule comprising a sequence encoding a TetR
protein and a sequence encoding an output protein, and an aptamer
sequence that is bound by the TetR protein in the absence of
tetracycline. The aptamer sequence is positioned relative to the
sequence encoding the output protein so that it inhibits production
of the output protein in the absence of tetracycline. In some
embodiments, the aptamer is positioned in the 5' untranslated
region (UTR) of the sequence encoding an output protein. In other
embodiments the TetR protein is a fusion protein.
[0197] The output molecule typically is a protein. However, the
output molecule can be another type of molecule, such as a nucleic
acid molecule, for example an RNA molecule that is an input for a
strand displacement reaction. Protein output molecules include
therapeutic proteins, cell death proteins, fluorescent proteins,
antigen (and/or adjuvants), selection proteins, and
immunomodulators.
[0198] Therapeutic proteins can be any protein that is used in
therapy of disease. For example, a therapeutic protein can be a
protein used for protein replacement therapy, such as for metabolic
disorders; Myr-Akt for treating Duchenne muscular dystrophy; or
follistatin for treating Becker muscular dystrophy, Duchenne
muscular dystrophy, inclusion body myositis. Selection proteins can
be used for selection or purification of a cell in which the
selection protein is expressed. For example, the selection protein
can be a protein that confers drug resistance to a cell, or acts as
a marker for the cell type for separation from other cells by
separation techniques such as flow cytometry.
[0199] Fluorescent proteins include many different types of
proteins known in the art, such as enhanced green fluorescent
protein (EGFP), enhanced yellow fluorescent protein (EYFP),
enhanced blue fluorescent protein (EBFP), cyan fluorescent proteins
(e.g., AmCyan1), other green fluorescent proteins (e.g., AcGFP1,
and ZsGreen1), other yellow fluorescent proteins (e.g., ZsYellow1
and mBananna), orange fluorescent proteins (e.g., mOrange and
mOrange2), red fluorescent proteins (e.g., DsRed, tdTomato,
mStrawberry and mCherry), and far-red fluorescent proteins (e.g.,
mKate, HcRed1, mRaspberry and mPlum).
[0200] Antigens include proteins of infectious agents or cancer
antigens, of which many are known in the art. Protein adjuvants
also can be expressed, alone or in conjunction with antigen output
proteins.
[0201] Immunomodulator proteins include cytokines, for example,
IL-12, IL-15 or IL-21, or immunosuppressant proteins.
[0202] Cell death proteins include hBax.
[0203] In some embodiments, the synthetic RNA circuits described
herein include RNA molecules that encode more than one output
molecule.
[0204] Proteins that specifically bind to an RNA motif and inhibit
protein production by a variety of mechanisms including repression
of translation or degradation of RNA are included in many of the
embodiments of the synthetic RNA circuits described herein. Such
proteins may be referred to herein as a "protein that specifically
binds to an RNA motif and inhibits protein production" or an "RNA
binding protein" or the like. Such RNA binding proteins bind to a
specific RNA sequence (also referred to as a "RNA motif" herein)
and inhibit protein production by repressing translation of the RNA
molecule to which they bind. Repression of translation can occur
any of the several mechanisms known in the art for repression of
translation. Alternatively, such RNA binding proteins bind to a
specific RNA sequence (also referred to as a "RNA motif" herein)
and inhibit protein production by degradation of RNA.
[0205] One example of a protein that specifically binds to an RNA
motif and inhibits protein production is L7Ae. The L7Ae protein
binds to one or more Box C/D, K-turn and/or K-loop motifs in an RNA
molecule. In some embodiments more than one Box C/D, K-turn and/or
K-loop motifs (such as two K-turn motifs) are included in an RNA
molecule to confer better binding to the RNA molecule and
repression of RNA translation. In some embodiments, the one or more
Box C/D, K-turn and/or K-loop motifs are placed in the 5'
untranslated region (UTR) of the RNA molecule, i.e., upstream of a
sequence encoding an output molecule. In addition, other proteins
that bind specific RNA motifs and inhibit protein production can be
used in the same manner as described herein for L7Ae.
[0206] Another example of a protein that specifically binds to an
RNA motif and inhibits protein production is a fusion of MS2
protein and a protein degrades RNA. In some embodiments, MS2
protein can be fused to CNOT7 protein (to form MS2-CNOT7) or
Dm-POP2 protein (to form MS2-Dm-POP2), each of which are
deadenylases, but other proteins that degrade RNA also can be fused
or linked to MS2. In addition, other proteins that bind specific
RNA motifs but do not repress translation can be fused to a protein
that degrades RNA, and used in the same manner as described herein
for MS2-CNOT7.
[0207] MS2 protein binds to one or more MS2 coat protein binding
sites. In some embodiments more than one MS2 coat protein binding
sites (such as eight MS2 coat protein binding sites) are included
in an RNA molecule to confer better binding to the RNA molecule and
inhibition of protein production, e.g., by degradation of the RNA.
In some embodiments, the one or more MS2 coat protein binding sites
are placed in the 3' untranslated region (UTR) of the RNA molecule,
i.e., downstream of a sequence encoding an output molecule.
[0208] In some embodiments, the RNA molecule(s) of the synthetic
RNA circuit includes modified RNA. Such modified RNA molecules can
include, for example, 5-methylcytosine-triphosphate and/or
pseudouridine-triphosphate. Other modifications of RNA molecules
are known in the art, and may be useful, for example, to increase
stability or resistance to RNAses.
[0209] In some embodiments, the RNA molecule(s) of the synthetic
RNA circuit are encoded on one or more RNA replicons. RNA replicons
are known in the art and include alphavirus derived replicons,
Venezuelan equine encephalitis virus derived replicons or Sindbis
derived virus replicons. In such embodiments, the RNA molecule(s)
can be expressed from one or more subgenomic promoters of the one
or more replicons. In some embodiments, the one or more subgenomic
promoters are regulated by a small molecule, such as trimethoprim
(TMP).
[0210] In some embodiments, the RNA molecule(s) of the synthetic
RNA circuit are encoded on one or more plasmids.
[0211] Also provided are methods for treating disease using the
synthetic RNA circuits described herein. In some embodiments,
methods of treating cancer in a mammal are provided, in which a
synthetic RNA circuit is administered to a mammal. In some
embodiments, the synthetic RNA circuit produces an output protein
that treats the cancer, including but not limited to a cell death
protein such as hBax, or an immunomodulatory protein.
[0212] Also provided are methods for inducing an immune response in
a mammal using the synthetic RNA circuits described herein. In some
embodiments, the methods include administering to a mammal a
synthetic RNA circuit, which produces an output protein that
induces the immune response, or augments an immune response. Such
methods may be used in vaccination of a mammal, or for other uses
in which inducing an immune response is beneficial to the mammal
The output protein produced typically is one or more antigens, but
may also include one or more adjuvants, and/or other
immunomodulatory proteins. In addition, the methods include
controlling the expression of the output protein(s) by
administering molecules that control destabilization domains (e.g.,
trimethoprim) or that control binding of TetR protein to aptamers
(e.g., tetracycline). This enables administering the synthetic RNA
circuits described herein at one time and administering molecules
that control expression of the output protein(s) at a different
time, including at several times after the administration of the
synthetic RNA circuits. Such administration of the synthetic RNA
circuits described herein and the molecules that control expression
of the output protein(s) can be used to produce expression of
antigens and/or adjuvants at certain times relative to one another
in order to produce an improved immune response in the mammal The
molecules that control expression of the output protein(s) can be
administered by any suitable method, including by oral
administration, intramuscular injection of lipid nanoparticles, or
or by implantation of a polymeric implant for sustained
release.
[0213] The present invention is further illustrated by the
following Examples, which in no way should be construed as further
limiting. The entire contents of all of the references (including
literature references, issued patents, published patent
applications, and co-pending patent applications) cited throughout
this application are hereby expressly incorporated by reference, in
particular for the teachings that are referenced herein.
EXAMPLES
Example 1.
[0214] In our initial circuits, we use two translational
repressors, L7Ae (12) and a fusion protein MS2-CNOT7 (13). L7Ae is
an archeal protein that binds K-turn and K-loop motifs with high
affinity. When the motif is placed in the 3'UTR of the target mRNA,
L7Ae can strongly repress translation of the output gene by
blocking ribosome scanning. As has been shown, using multiple
repeats of the binding motif and placing the motif close to the
transcription start result in enhanced repression (14). We used two
repeats of the K-turn motif with an eighteen base pair spacer from
the transcription start and such configuration resulted in a very
strong repression even at low doses of L7Ae. MS2 is another RNA
binding protein, a coat protein from bacteriophage MS2. CNOT7 is a
human deadenylase that can efficiently repress translation of mRNA,
if directed to its 3'UTR (13). In our system, the reporter mRNA
contains eight repeats of the MS2 coat protein binding site in the
3'UTR and MS2 is fused with repression domain, CNOT7.
[0215] Towards the goal of creating a platform for future
applications through a plug-and-play post-transcriptional
regulation framework we engineered a set of diverse regulatory
circuits including a multi-input cell type classifier, a cascade
and a two-state switch. Additional capabilities, or further tuning
of the synthetic regulatory pathways can be achieved with the use
of small molecule dependent aptamers or degradation domains
Regulation with RNA-Binding Proteins (RBP)
[0216] To demonstrate that the RBP-based repressors can be utilized
to create variable functional circuits we engineered a multi-input
microRNA sensor, a cascade and a two-input switch. The microRNA
sensing circuit is a post-transcriptional only version of our
previously designed (15) HeLa cell classifier. The circuit
recognizes microRNA profile that is specific for HeLa cells (high
miR-21, low miR-141, miR-142(3p) and miR-146a, FIG. 1) and triggers
a response only if the profile is matched. As shown in FIG. 1, the
L7Ae-based classifier is able to distinguish HeLa cells from HEK
293 and MCF7 in a fluorescence assay. Moreover, when a
pro-apoptotic gene hBax is used as the output of the circuit, the
classifier selectively induces apoptosis in HeLa cells while not
affecting viability of HEK cells. The performance of our new
classifier is comparable to the DNA-based version reported earlier,
but the ability to deliver it purely with RNA provides means for
utilizing it in much broader spectrum of applications, including
selective stem cell reprogramming, or vaccination.
[0217] Our next circuit (FIG. 2), a three-layer cascade expresses
fluorescent protein, EGFP as the final output (level 0). The 3'UTR
of the EGFP contains eight repeats of the MS2 binding sites
allowing repression by MS2-CNOT7 (level 1). We placed two repeats
of the K-turn motif in the 5'UTR of the MS2-CNOT7 construct, which
in turn allows for repression by L7Ae (level 2) and restoration of
the output. Finally, L7Ae gene is followed by four repeats of
target sites (Ts) for synthetic microRNA miR-FF4 (level 3), which
permits further tuning of the cascade output. The synthetic
microRNA regulation can be replaced with endogenous one, linking
the cascade operation with cellular context. As shown in, the
optimized version of our cascade exhibits nearly perfect behavior
when tested with DNA transfection. The first layer repression
results in 13-fold difference in EGFP expression, followed by
15-fold output restoration at level 2, and finally 12-fold
repression at level 3, when all parts of the cascade are present.
Therefore the system utilizes the full dynamic range of the
MS2-CNOT7 repressor.
[0218] We next tested a two-layer version of the cascade encoded on
self-amplifying viral replicon for RNA-only delivery (FIGS. 2C-2D).
In this minimal circuit, that is also an essential component of the
microRNA sensor and the switch, the output gene (EYFP) was placed
under the subgenomic promoter with two repeats of the K-turn motif
in the 3'UTR. L7Ae expressed from a separate replicon was also
followed by four repeats of the FF4 target site. To allow tracking
of the L7Ae production, we fused it to a red fluorescent protein,
mKate. Both genes, EYFP and mKate-L7Ae contained degradation tags
for faster turnover. As shown in FIG. 2D, L7Ae repression results
in 20-fold repression of EYFP (level 1), and knockdown by the
synthetic siRNA-FF4 fully restores the output production (level
2).
[0219] Our third circuit is a two-state switch where two repressors
mutually regulate their expression (FIG. 3A). The state of the
system can be set with the use of a synthetic siRNA, synthetic or
endogenous miRNA, or other endogenous repressors. The components of
the switch include MS2-CNOT7 with two K-turn motifs in the 5'UTR
and L7Ae with eight repeats of the MS2 binding site in the 3'UTR.
For monitoring the behavior of the switch we additionally
co-expressed a blue fluorescent protein (EBFP) together with
MS2-CNOT7 and EYFP with L7Ae via 2A tags (from the same mRNA). To
set the states of the switch we used two artificial and orthogonal
siRNA (FF4 and FF5). When no specific siRNA is present, both
repressors and associated reporters remain at low levels (FIGS. 3B
and 3D), with pDNA transfection. siRNA FF4 sets the state to high
MS2-CNOT7 (as measured by EBFP fluorescence) resulting with over
4-fold higher expressions of the genes and complete silencing of
L7Ae (as measured by EYFP fluorescence). Conversely, siFF5S causes
over 3-fold upregulation of L7Ae/EYFP. Since most potential
applications of the switch would require longer-term expression, we
encoded the circuit on self-replicating RNA. Interestingly, in the
absence of specific siRNA, the circuit exhibits bi-stability: cells
randomly fall into one of the available states. Similarly as with
pDNA transfections, siRNA FF4 and FF5 set the state specifically
and permanently.
Small Molecule Regulation
[0220] Another form of regulation of RNA circuits, especially
useful in a clinical setting would be with the use of a small
molecule switch. Here, we have engineered an ON/OFF switch to
regulate expression from self-replicating RNA using an FDA-approved
small molecule and have achieved more than 20-fold induction. A
potential application of this method may include the regulated
delivery of antigens for safer programmable vaccines.
[0221] To build the ON/OFF switch, we used destabilization domains,
which mark proteins for degradation. Upon addition of a small
molecule ligand, the ligand binds the domain, and the protein is
stabilized and no longer degraded. To test destabilization domains
(DDs) as a control mechanism for the replicon, we fused the domain,
FKBP12 (16), to the N-terminus of a yellow fluorescent protein,
mVenus, electroporated into BHK-21 cells and induced with Shield
(17) to test the ON switch. See FIGS. 4A-4C.
[0222] Next, we created the OFF switch by fusing a destabilization
domain, ecDHFR (18), to the L7Ae repressor as shown in FIGS.
5A-5C.
Aptamer-Based Regulation
[0223] Tunable expression can also be achieved with an RNA based
circuit whose dynamics are governed by TetR/Dox, and by
TetR-homolog/small-molecule. Tet Repressor protein (TetR)-binding
RNA elements is placed in the 5'-untranslated region (5'-UTR) of
mRNA, such that translation of a downstream antigen coding sequence
is directly controlled by TetR and tetracycline analogs (20); see
FIGS. 6A-6B.
Advantages and Improvements over Existing Methods, Devices or
Materials
[0224] Proteins vary in solubility, are difficult to purify and
expensive to store. DNA vaccinations and therapy present potential
risks such as integration into the host genome or induction of
pathogenic anti-DNA antibodies.
[0225] Recently, RNA-based vaccines employing alphavirus replicons,
which undergo sustained self-replication of RNA sequences encoding
protein antigens within infected cells, have gained attention as a
potential strategy for safe and effective vaccination. Such
RNA-based vaccines are expected to be safer than DNA-based vectors
(lacking the potential for integration into the host genome), and
because their function requires delivery only to the cytosol (but
not the nucleus) of target cells, synthetic materials may be
capable of delivering RNA vaccines without the manufacturing and
safety issues of viral vectors. Self-replicating RNA and modified
RNA have gained much interest as potential therapeutic agents and
in stem cell reprogramming
[0226] No control mechanisms have been developed/used for
self-replicating or modified RNA. We propose multiple ways of such
control that would allow for e.g. tunable or delayed expression of
a therapeutic agent and switching between two different agents.
Example 2.
Mammalian Synthetic Circuits with RNA Binding Proteins Delivered by
RNA
Materials and Methods
[0227] Cell culture
[0228] HEK293FT and HEK293 (293-H) cell lines were purchased from
Invitrogen. HeLa (CCL.2) and MCF7 (HTB-22) cell lines were
originally obtained from ATCC. The performance of DNA-encoded miRNA
sensors in these cell lines had been characterized previously (15).
HEK293FT were freshly purchased from the supplier. HeLa, MCF7 and
BHK21, although not recently authenticated, were tested for
mycoplasma. All cell lines used in this study were maintained in
Dulbecco's modified Eagle medium (DMEM, Cellgro) supplemented with
10% FBS (Atlanta BIO), 1% penicillin/streptomycin/L-Glutamine
(Sigma-Aldrich) and 1% non-essential amino acids (HyClone) at
37.degree. C. and 5% CO2. In the case of MCF7 cells, DMEM without
phenol red was used. BHK21 cells were maintained in Eagle's Minimum
Essential Medium (EMEM, ATCC) supplemented with 10% FBS.
DNA Preparation and Transfection
[0229] All transfections were carried out in 24-well format.
Parallel transfections in HEK293, HeLa and MCF7 cells (4-input
sensor, FIGS. 7B and 7C, FIGS. 11, 12A-12C, FIGS. 13 and 14) were
performed with Lipofectamine LTX (Life Technologies) according to
manufacturer's protocol. Lipofectamine LTX was used as it provides
the best transfection efficiencies across the 3 cell lines among
tested reagents. Total of 400 ng DNA was mixed with Opti-MEM I
reduced serum medium (Life Technologies) to a final volume of 100
.mu.l followed by addition of 0.5 .mu.l PLUS reagent. After 5
minutes 1.5 .mu.l Lipofectamine LTX was added, the samples were
briefly vortexed and incubated for 30 min at room temperature.
During the incubation time, cells were harvested by trypsinization
and seeded in 500 .mu.l of complete culture medium in 24-well plate
(HEK: 2.times.10 5, HeLa: 1.2.times.10 5 and MCF7: 1.5.times.10 5
cells per well). Transfection complexes were added dropwise to the
freshly seeded cells followed by gentle mixing. Cells were
supplemented with 1 ml of fresh growth medium 5 hours post
transfection and analyzed by flow cytometry after 48 hours (after
24 hours for apoptosis assay). Plasmid DNA and siRNA
co-transfections (cascade and switch circuits, FIGS. 8B and 8G,
FIGS. 17A, 18A-18C, 27, and 28) were carried out with Lipofectamine
2000 according to the manufacturer's protocol. Lipofectamine 2000
was used as it provides the best DNA/siRNA co-transfection
efficiencies among tested reagents. A total of up to 300 ng DNA and
1-5 pmol siRNA were mixed with Opti-MEM I reduced serum medium
(Life Technologies) to a final volume of 50 .mu.l. Separately, 2
.mu.l of Lipofectamine 2000 was mixed with 50 .mu.l of Opti-MEM.
After 5 min incubation, lipofectamine and DNA/siRNA dilutions were
combined and briefly vortexed. Cells were prepared, transfected and
analyzed as described above. All the remaining transfections
(repressor optimization in FIGS. 10A-10E and time lapse in FIGS.
19A-19F) were carried out with Attractene (Qiagen). Up to 300 ng
total DNA was mixed with DMEM base medium (Cellgro) without
supplements to a final volume of 60 .mu.l. 1.5 .mu.l Attractene was
added to the dilutions and the samples were promptly vortexed to
mix. The complexes were incubated for 10-15 min and subsequently
added to cells prepared as described above. 500 .mu.l of fresh
medium was added to each well the next day (media change was not
necessary in the case of Attractene transfections). Transfection
details for each experiment are shown in Table 1. The list of all
plasmids used in this study is shown in Table 2.
TABLE-US-00001 TABLE 1 Transfection tables for all experiments in
this study. pDNA Transfection efficiency reported after 48 h,
except for apoptotic assay (FIG. 7C, FIG. 16), which was carried
out 24 h post transfection. FIG 7B, FIGs. 12A-12C Constitutive
untreated output Low sensors High sensor Circuit Efficiency pL-S3
200 ng 200 ng PL-S2 100 ng 100 ng pL-S1 100 ng 100 ng pL-A1 100 ng
100 ng 100 ng 100 ng PL-A2 400 ng 200 ng 200 ng 0 ng 0 ng
reagent/cells Opti-MEM 96 ul 96 ul 96 ul 96 ul 96 ul Plus-reagent
0.5 ul 0.5 ul 0.5 ul 0.5 ul 0.5 ul Lipofectamine- 1.5 ul 1.5 ul 1.5
ul 1.5 ul 1.5 ul LTX Hela 120,000 cells 120,000 cells 120,000 cells
120,000 cells 120,000 cells 45-60% HEK293 200,000 cells 200,000
cells 200,000 cells 200,000 cells 200,000 cells 35-50% MCF7 150,000
cells 150,000 cells 150,000 cells 150,000 cells 150,000 cells
12-20% FIG. 7C, FIG. 14 EGFP hBax Circuit Efficiency pL-S3 50 ng
pL-C3 pL-K3 50 ng pL-K4 50 ng pL-S4 50 ng 50 ng 50 ng pL-A2 350 ng
300 ng 250 ng reagent/cells Opti-MEM 96 ul 96 ul 96 ul Plus-reagent
0.5 ul 0.5 ul 0.5 ul Lipofectamine-LTX 1.5 ul 1.5 ul 1.5 ul HeLa
150,000 cells 150,000 cells 150,000 cells 35-40% HEK293 200,000
cells 200,000 cells 200,000 cells 35-40% FIG. 8B, FIG. 17A (Level 3
siRNA conditions shown in bold), FIGs. 18A-18C Level 0 Level 1
Level 2 Level 3 Efficiency pL-C1 50 ng 50 ng 50 ng 50 ng pL-C2 12.5
ng 12.5 ng 12.5 ng pL-C3 75 ng 75 ng pL-A1 50 ng 50 ng 50 ng 50 ng
pL-A2 87.5 ng 75 ng siRNA FF4 0 0 0 0.025, 0.05, 0.1, 0.25, 0.5, 1,
2.5, 5 pmol siRNA NS 5 pmol 5 pmol 5 pmol 49.75, 4.95, 4.9, 4.75,
4.5, 4, 2.5, 0 pmol reagent/cells Opti-MEM 96 ul 96 ul 96 ul 96 ul
Lipofectamine-2000 2 ul 2 ul 2 ul 2 ul HEK293FT 200,000 cells
200,000 cells 200,000 cells 200,000 cells 65-75% FIGs. 8F-8G, FIG.
27, and FIG. 28 siRNA FF55 siRNA FF4 siRNA Ctrl Efficiency pL-T1
100 ng 100 ng 100 ng pL-T2 100 ng 100 ng 100 ng pL-A3 100 ng 100 ng
100 ng siRNA 1 pmol, FF5 1 pmol, FF4 1 pmol, NS reagent/cells
Opti-MEM 96 ul 96 ul 96 ul Lipofectamine-2000 2 ul 2 ul 2 ul HEK
293FT 200,000cells 200,000cells 200,000cells 65-75% FIG. 10C
1xK-turn 2xK-turn 1xK-turnMUT -L7AE +L7Ae -L7AE +L7Ae -L7AE +L7Ae
Efficiency pL7Ae 100 ng 100 ng 100 ng P1xKt 50 ng 50 ng pL-S1 50 ng
50 ng pL-A6 pL-A1 50 ng 50 ng 50 ng 50 ng 50 ng 50 ng pL-A2 100 ng
100 ng 100 ng reagent/cells DMEM 98 ul 98 ul 98 ul 98 ul 98 ul 98
ul Attractene 1.5 ul 1.5 ul 1.5 ul 1.5 ul 1.5 ul 1.5 ul HEK 293FT
200,000 200,000 200,000 200,000 200,000 200,000 55-60% FIG 10D No
MS2- MS2-Dm- MS2-Dm- MS2-Hs- MS2-Hs- Repressor CNOT7 Pum-RD2 POP2
PUM1-3 PUM1-N Efficiency pL-R1 100 ng pL-R2 100 ng pL-R3 100 ng
pL-R4 100 ng pL-R5 100 ng pL-C1 50 ng 50 ng 50 ng 50 ng 50 ng 50 ng
pL-A1 50 ng 50 ng 50 ng 50 ng 50 ng 50 ng pL-A2 100 ng
reagent/cells DMEM 98 ul 98 ul 98 ul 98 ul 98 ul 98 ul Attractene
1.5 ul 1.5 ul 1.5 ul 1.5 ul 1.5 ul 1.5 ul HEK 293FT 200,000 200,000
200,000 200,000 200,000 200,000 55-62% FIG. 10E, L7Ae Efficiency
pL7Ae 0, 6.25, 12.5, 25, 50, 100, 150, 200 ng pL-S1 50 ng pL-A1 50
ng pL-A2 200, 193.75, 187.5, 175, 150, 100, 50, 0 ng reagent/cells
DMEM 97 ul Attractene 1.5 ul HEK 293FT 200,000 55-60% FIG. 10E,
MS2-CNOT7 Efficiency pL-R1 0, 6.25, 12.5, 25, 50, 100, 150, 200 ng
pL-C1 50 ng pL-A1 50 ng pL-A2 200, 193.75, 187.5, 175, 150, 100,
50, 0 ng reagent/cells DMEM 97 ul Attractene 1.5 ul HEK293FT
200,000 55-60% FIG 11 No 1x MS2- 2x MS2- Repressor CNOT7 CNOT7
Efficiency pL-C5 100 ng 200 ng pL-C1 100 ng 100 ng 100 ng pL-A1 100
ng 100 ng 100 ng pL-A2 200 ng 100 ng reagent/cells Opti-MEM 96 ul
96 ul 96 ul Plus-reagent 0.5 ul 0.5 ul 0.5 ul Lipofectamine-LTX 1.5
ul 1.5 ul 1.5 ul HeLa 150,000 cells 150,000 cells 150,000 cells 50%
FIG 13 No Ts 4xT21 4xT141 4xT1423-3p 4xT146a Efficiency pL-A6 100
ng pL-S28 100 ng pL-S29 100 ng pL-S30 100 ng pL-S31 100 ng pL-A1
100 ng 100 ng 100 ng 100 ng 100 ng pL-A2 200 ng 200 ng 200 ng 200
ng 200 ng reagent/cells Opti-MEM 96 ul 96 ul 96 ul 96 ul 96 ul
Plus-reagent 0.5 ul 0.5 ul 0.5 ul 0.5 ul 0.5 ul Lipofectamine- 1.5
ul 1.5 ul 1.5 ul 1.5 ul 1.5 ul LTX HeLa 120,000 cells 120,000 cells
120,000 cells 120,000 cells 120,000 cells 40-52% HEK 293 200,000
cells 200,000 cells 200,000 cells 200,000 cells 200,000 cells
45-55% MCF7 150,000 cells 150,000 cells 150,000 cells 150,000 cells
150,000 cells 20-28% FIGs. 19A-19B mock EGFP EGFP-PEST EGFP + mKate
Efficiency pL-A6 50 ng 50 ng pL-A7 50 ng pL-A1 50 ng pL-A2 50 ng
reagent/cells DMEM 59.5 ul 59.5 ul 59.5 ul 59 ul Attractene 1.5 ul
1.5 ul 1.5 ul 1.5 ul HEK 293FT 200,000 cells 200,000 cells 2000,000
cells 200,000 cells 65-75% FIGs. 19C-19D 2xKt-EGFP + 2xKt-EGFP +
mKate mKate + L7AE Efficiency pL-S1 50 ng 50 ng pL-A1 50 ng 50 ng
pL7Ae 100 ng pL-A2 100 ng reagent/cells DMEM 58 ul 58 ul Attractene
1.5 ul 1.5 ul HEK 293FT 200,000 cells 200,000 cells 70% FIGs.
19C-19D Level 0 Level 1 Level 2 Level 3 Efficiency pL-C1 50 ng 50
ng 50 ng 50 ng pL-C2 25 ng 25 ng 25 ng pL-C3 75 ng 75 ng pL-A1 50
ng 50 ng 50 ng 50 ng pL-A5 100 ng pL-A4 100 ng pL-A2 200 ng 175 ng
reagent/cells DMEM 57 ul 57 ul 57 ul 57 ul Attractene 1.5 ul 1.5 ul
1.5 ul 1.5 ul HEK 293FT 200,000 cells 200,000 cells 200,000 cells
200,000 cells 45-60% FIGs. 7D-7E, FIG. 15, and FIG. 16 hBax Circuit
-L7AeBc12 -4xT21 Efficiency hBax 350 ng Kt-hBax-4xT141- 350 ng 350
ng 350 ng L7Ae-2A-Bcl2-4xT21 17.5 ng L7Ae-2A-Bcl2 17.5 ng
TransIT-mRNA 1 uL 1 uL 1 uL 1 uL HeLa 50,000 50,000 50,000 50,000
97% HEK 293 100,000 100,000 100,000 100,000 86% HeLa-BFP cells +
50,000 50,000 50,000 50,000 HEK 293 cells 50,000 50,000 50,000
50,000 Mixed: 85% FIGs. 8B, FIG. 17B, and FIGs. 20E-20F level 0
level 1 level 2 level 3 Efficiency mKate 100 ng 100 ng 100 ng 100
ng EGFP-8xM2S 100 ng 100 ng 100 ng 100 ng MS2 100 ng Kt-MS2-CNOT7
100 ng 100 ng 100 ng L7Ae-4xFF4 30 ng 30 ng siRNA-control 1 pmol 1
pmol 1 pmol siRNA-FF4 1 pmol StemFect 1 uL 1 uL 1 uL 1 uL 293FT
cells 100,000 100,000 100,00 100,000 94% FIGs. 20A-20D EGFP- EGFP +
Kt-EGFP + EGFP PEST mKate Kt-EGFP L7Ae Efficiency EGFP 100 ng 100
ng EGFP-PEST 100 ng Kt-EGFP 100 ng 100 ng mKate 100 ng 100 ng 100
ng L7Ae 30 ng StemFect 1 uL 1 uL 1 uL 1 uL 1 uL 293FT cells 100,000
100,000 100,000 100,000 100,000 94% Replicon For replicon delivery,
electroporation was used instead of lipid-based transfection (no
transfection reagent) and all electroporations were carried out
using 100,000 BHK21 cells per sample
(as described in the Methods section). Transfection efficiency
reported after 24 h. FIG. 8D, FIG. 17C (no PEST domain), and FIG.
25 EGFP EGFP-PEST -- L7Ae L7Ae-PEST -- L7Ae L7AePEST -- Ctrl FF4
Ctrl FF4 -- Ctrl FF4 Ctrl FF4 Efficiency pTK295 2100 ng 96% pTK296
2100 ng (EGFP -- ) pTK297 700 ng 700 ng pTK298 700 ng 700 ng
siRNA-Ctrl 5 pmol 5 pmol 5 pmol 5 pmol siRNA-FF4 5 pmol 5 pmol 5
pmol 5 pmol FIG. 8F-8H, FIG. 28 siRNA-Ctrl siRNA-FF4 siRNA-FF5
Efficiency pTK095 2000 ng 2000 ng 2000 ng 89% (siRNA-FF5) pTK332
2000 ng 2000 ng 2000 ng siRNA-Ctrl 5 pmol siRNA-FF4 5 pmol
siRNA-FF5 5 pmol FIGs. 22A-22E EGFP EGFP-PEST Efficiency pTK312
1000 ng 99% (EGFP) pTK313 1000 ng FIGS. 23A-23C EGFP + L7Ae + EGFP
+ L7Ae + EGFP siRNA-Ctrl siRNA-FF4 Efficiency pTK317 1000 ng 1000
ng 1000 ng 98% (EGFP) pTK331 1000 ng 1000 ng siRNA-Ctrl 5 pmol
siRNA-FF4 5 pmol FIGs. 24A-24B EGFP + mKate Efficiency pTK312 2000
ng 99% pTK194 2000 ng FIGs. 26A-26C KtMUT Kt KtMUT Kt Kt Kt (1000
ng) (1000 ng) (250 ng) (250 ng) (1000 ng) (250 ng) panel a panel a
panel a panel a panel b, c panel b, c Efficiency pTK297 2500 ng
2500 ng 2500 ng 2500 ng pL-S4 1000 ng 250 ng pL-S1 1000 ng 250 ng
1000 ng 250 ng 91% (Kt (1000 ng) panel b, c) FIGs. 29A-29D EBFP2
EBFP2 EYFP EYFP siRNA-Ctrl siRNA-FF5 siRNA-Ctrl siRNA-FF4
Efficiency pTK095 1500 ng 1500 94% (EYFP siRNA-Ctrl 0 pmol) pTk332
1500 ng 1500 ng siRNA-Ctrl 0, 0, 0.00005, 0.00016, 0.00005,
0.00016, 0.0005, 0.0016, 0.0005, 0.0016, 0.005, 0.016, 0.005,
0.016, 0.05, 0.16, 0.05, 0.16, 0.5, 1.6, 0.5, 1.6, 5 pmol 5 pmol
siRNA- 0, FF4 0.00005, 0.00016, 0.0005, 0.0016, 0.005, 0.016, 0.05,
0.16, 0.5, 1.6, 5 pmol siRNA- 0, FF5 0.00005, 0.00016, 0.0005,
0.0016, 0.005, 0.016, 0.05, 0.16, 0.5, 1.6, 5 pmol FIGs. 30A-30C
Control Switch Efficiency pTK299 2000 ng 80% (Control) pTK333 2000
ng pTK095 2000 ng pTK332 2000 ng siRNA-Ctrl 5 pmol 5 pmol
TABLE-US-00002 TABLE 2 Plasmids used in this study: DNA and
sequence files for the main circuit components can be obtained from
Addgene (deposit number 71270). Short plasmid FIG. name Full
plasmid name Parts from pDNA 1 pL-R1 pT-GTW6-CMV-MS2-CNOT7 A. C.
Goldstrohm and C. Weidmann 1 pL-R2 pT-GTW6-CMV-MS2-Dm-Pum-RD2 A. C.
G. and C. W. 1 pL-R3 pT-GTW6-CMV-MS2-Dm-POP2 A. C. G. and C. W. 1
pL-R4 pT-GTW6-CMV-MS2-Hs-PUM1-3 C. Weidman et al..sup.13 1 pL-R5
pT-GTW6-CMV-MS2-Hs-PUM1-N C. Weidman et al..sup.13 1&3 pL-Cl
pBoxCDGCmut_KMet-EGFP-8xMS2-pA pL-A3 and C. Weidman et al..sup.13 1
pL7Ae pcDNA3_1_L7Ae_myc-His6 H. Saito et al..sup.12 1 pL-R6
pT-GTW6-CMV-L7Ae pL7Ae 1 PBoxCDGC_KMet_EGFP H. Saito et al..sup.12
1&2 pL-S1 pBoxCDGC_2xKMet_EGFP pBoxCDGC_KMet_EGFP ctrl pL-A3
pBoxCDGCmut_KMet_EGFP H. Saito et al..sup.12 2 pL-S2
PBoxCDGC_2xKMet_EGFP-4xT141-4xT142- pL-S1 and Xie et al..sup.15
3p-4xT146a 2 pL-S3 pT-GTW6-CMV-L7Ae-4xT21 pL7Ae and Xie et
al..sup.15 ctrl pL-S4 pBoxCDGCmut_2xKMet_EGFP pBoxCDGCmut_KMet_EGFP
2 pZ238 TRE-LacI-2A-Bcl2-T21x4-miR-FF4 Xie et al..sup.15 (Bcl2:
NM_000633.2) 2 pZ241 CAGOP-hBax-T141x4-T142-3px4-T146ax4- Xie et
al..sup.15 (hBax: FF4x3 Addgene #19741).sup.44 2 pL-K1
pT-GTW6-CMV-L7Ae-P2A-Bcl-2-4xT21 pL-S3 and pZ238 2 pL-K2
pT-GTW6-CMV-L7Ae-P2A-Bcl-2-4xFF4 pL-S3 and pZ238 2 pL-K3
pBoxCDGC_2xKMet_hBax-4xT141-4xT142-3p- pL-S1 and pZ241 4xT146a 2
pL-K4 pBoxCDGC_2xKMet_hBax pL-S1 and pZ241 3 pL-C2
pBoxCDGC-2xKMet-MS2-CNOT7 pL-S1 and pL-R1 3 pL-C3
pT-GTW6-CMV-L7Ae-4xFF4 pL7Ae 3 pL-C4
pT-GTW6-hEF1a-mKateExI-miRFF4-mKateExII pZ238, intron design:
courtesy of H. Chung 1 pL-C5 pT-GTW6-CMV-MS2-CNOT7-4xFF4 pL-R1 4
pL-T1 pT-GTW6-hEF1a-L7Ae-P2A-EYFP-4xFF4- EYFP: Addgene
#18722.sup.45 8xMS2pA 4 pL-T2 pBoxCDGC-2xKMet-MS2-CNOT7-P2A-EBFP2-
EBFP2: Addgene #14893.sup.46 4xFF5 S4 pL-A6 pCMV-EGFP
pBoxCDGCmut_KMet_EGFP S10 pL-A7 pCMV-EGFP-PEST pCMV-EGFP,
PEST.sup.41 S4 pL-S28 pCMV-EGFP-4xT21 pCMV-EGFP S4 pL-S29
pCMV-EGFP-4xT141 pCMV-EGFP S4 pL-S30 pCMV-EGFP-4xT142-3p pCMV-EGFP
S4 pL-S31 pCMV-EGFP-4x146a pCMV-EGFP ctrl pL-A1 pT-GTW6-CMV-mKate
mKate: Evrogen.sup.47 ctrl pL-A2 PDT007 Xie et al..sup.15 ctrl
pL-A3 pT-GTW6-hEF1a-mKate pL-A1 ctrl pL-A4 pT-GTW6-hEF1a-Bia ctrl
pL-A5 pT-GTW6-hEF1a-Bia-miRFF4
Modified RNA Preparation and mRNA Transfection
[0230] A template DNA for in vitro transcription was generated via
PCR, using a forward primer containing T7 promoter and a reverse
primer containing 120-nucleotide-long Poly(T) tract transcribed
into a Poly(A) tail. PCR products amplified from plasmids were
subjected to digestion by Dpn I restriction enzyme and purified.
Reactions of in vitro transcription were performed using MegaScript
T7 kit (Life Technologies) under a modified condition, in which
GTP, CTP and UTP was replaced by GTP mixed with Anti Reverse Cap
Analog (New England Biolabs) at the ratio of 1 to 4,
5-methylcytosine-triphosphate and pseudouridine-triphosphate
(TriLink BioTechnologies), respectively. Transcripts were treated
with Turbo DNase (Life Technologies) for 30 min at 37.degree. C.
and purified using RNeasy MiniElute Cleanup Kit (QIAGEN). Resulting
mRNAs were incubated with Antarctic Phosphatase (New England
Biolabs) for 30 min at 37.degree. C. and purified again. Modified
mRNAs were transfected into the cells using TransIT-mRNA
transfection kit (Mirus Bio) according to manufacturer's protocol.
StemFect (Stemgent) was used to perform co-transfections of
modified mRNAs with siRNAs, according to manufacturer's
instruction. The medium was exchanged 4 hours after the
transfection, and transfected cells were subjected to the analysis
after 24 hours. Transfection details for each experiment are shown
in Table 1. Detailed configurations for modified mRNA and sequences
of mRNA used in this study are shown in Tables 3 and 4.
TABLE-US-00003 TABLE 3 Preparation of modified mRNA by PCR and IVT.
Forward Reverse additional Name Type templates Primer Primer oligos
hBax IVT template hBax_ORF, 5'UTR, 3'UTR T7pro1 A120
Kt-hBax-4xT141- IVT template hBax-4xT141-4xT142(3p)- T7pro2 A120
T7-Kt, 5'spacer 4xT142(3p)- 4xT146a 4xT146a L7Ae-2A-Bcl2- IVT
template L7Ae-2A-Bcl2_ORF, T7pro1 A120 4xT21 5'UTR, 4xT21
L7Ae-2A-Bcl2 IVT template L7Ae-2A-Bcl2_ORF, T7pro1 A120 5'UTR,
3'UTR mKate IVT template mKate_ORF, 5'UTR, T7pro1 A120 3'UTR
EGFP-8xMS2 IVT template EGFP-8xMS2_ORF, T7pro1 A120 5'UTR MS2 IVT
template MS2_ORF, 5'UTR, 3'UTR T7pro1 A120 Kt-MS2-CNOT7 IVT
template MS2-CNOT7_ORF, 3'UTR T7pro2 A120 T7-Kt, 5'spacer
L7Ae-4xFF4 IVT template L7Ae-4xFF4_ORF, 5'UTR T7pro1 A120 EGFP IVT
template EGFP_ORF, 5'UTR, 3'UTR T7pro1 A120 EGFP-PEST IVT template
d2EGFP_ORF, 5'UTR, T7pro1 A120 3'UTR Kt-EGFP IVT template
EGFP2_ORF, 3'UTR T7pro2 A120 T7-Kt, 5'spacer L7Ae IVT template
L7Ae_ORF, 5'UTR, 3'UTR T7pro1 A120 hBax_ORF ORF pZ241 hBax-F hBax-R
hBax-4xT141- ORF + UTR pZ241 hBax-F T141-UR 4xT142(3p)- 4xT146a
L7Ae-2A-Bcl2_ORF ORF pL-K1 L7Ae-F Bcl2-R mKate_ORF ORF pL-A1
mKate-F mKate-R EGFP-8xMS2_ORF ORF + UTR pL-C1 ORF-F MS2-UR MS2_ORF
ORF pMS2CP MS2-F MS2-R MS2-CNOT7_ORF ORF pL-C5 ORF-F CNOT7-R
L7Ae-4xFF4_ORF ORF + UTR pL-C3 L7Ae-F FF4-UR EGFP_ORF ORF
p413M-d2EGFP ORF-F EGFP-R d2EGFP_ORF ORF p413M-d2EGFP ORF-F
d2EGFP-R d2EGFP-rev1, d2EGFP-rev2 EGFP_ORF2 ORF pEGFP EGFP-F ORF-R
L7Ae_ORF ORF pL7Ae L7Ae-F2 ORF-R 5'UTR UTR 5UTR_temp T7pro1 5UTR-R
3'UTR UTR 3UTR_temp 3UTR-F 3UTR-R 4xT21 UTR p4xT21 3UTRmi-F
3UTRmi-R
TABLE-US-00004 TABLE 4 mRNA sequences used in this study. >hBax
(SEQ ID NO: 12)
GGGCGAAUUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACACCGGUCG
CCACCAUGGACGGGUCCGGGGAGCAGCCCAGAGGCGG
GGGGCCCACCAGCUCUGAGCAGAUCAUGAAGACAGGGGCCCUUUUGCUUC
AGGGUUUCAUCCAGGAUCGAGCAGGGCGAAUGGGGGGGG
AGGCACCCGAGCUGGCCCUGGACCCGGUGCCUCAGGAUGCGUCCACCAAG
AAGCUGAGCGAGUGUCUCAAGCGCAUCGGGGACGAACUG
GACAGUAACAUGGAGCUGCAGAGGAUGAUUGCCGCCGUGGACACAGACUC
CCCCCGAGAGGUCUUUUUCCGAGUGGCAGCUGACAUGUU
UUCUGACGGCAACUUCAACUGGGGCCGGGUUGUCGCCCUUUUCUACUUUGC
CAGCAAACUGGUGCUCAAGGCCCUGUGCACCAAGGUGC
CGGAACUGAUCAGAACCAUCAUGGGCUGGACAUUGGACUUCCUCCGGGAG
CGGCUGUUGGGCUGGAUCCAAGACCAGGGUGGUUGGGAC
GGCCUCCUCUCCUACUUUGGGACGCCCACGUGGCAGACCGUGACCAUCUUU
GUGGCGGGAGUGCUCACCGCCUCGCUCACCAUCUGGAA
GAAGAUGGGCUGACUCUAGACCUUCUGCGGGGCUUGCCUUCUGGCCAUGCCC
UUCUUCUCUCCCUUGCACCUGUACCUCUUGGUCUUUG
AAUAAAGCCUGAGUAGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
>Kt-hBax-4xT141-4xT142(3p)-4xT146a (SEQ ID NO: 13)
GGAUCCGUGAUCGGAAACGUGAGAUCCACCUCAGAUCCGCUAGGACACCCGCAG
AUCGAGAAGAAGGCGAAUUAAGAGAGAAAAGAAGA
GUAAGAAGAAAUAUAAGACACCGGUCGCCACCAUGGACGGGUCCGGGGAGC
AGCCCAGAGGCGGGGGGCCCACCAGCUCUGAGCAGAUC
AUGAAGACAGGGGCCCUUUUGCUUCAGGGUUUCAUCCAGGAUCGAGCAGG
GCGAAUGGGGGGGGAGGCACCCGAGCUGGCCCUGGACCC
GGUGCCUCAGGAUGCGUCCACCAAGAAGCUGAGCGAGUGUCUCAAGCGCA
UCGGGGACGAACUGGACAGUAACAUGGAGCUGCAGAGGA
UGAUUGCCGCCGUGGACACAGACUCCCCCCGAGAGGUCUUUUUCCGAGUG
GCAGCUGACAUGUUUUCUGACGGCAACUUCAACUGGGGC
CGGGUUGUCGCCCUUUUCUACUUUGCCAGCAAACUGGUGCUCAAGGCCCUG
UGCACCAAGGUGCCGGAACUGAUCAGAACCAUCAUGGG
CUGGACAUUGGACUUCCUCCGGGAGCGGCUGUUGGGCUGGAUCCAAGACC
AGGGUGGUUGGGACGGCCUCCUCUCCUACUUUGGGACGC
CCACGUGGCAGACCGUGACCAUCUUUGUGGCGGGAGUGCUCACCGCCUCG
CUCACCAUCUGGAAGAAGAUGGGCUGAGCGGCCGCUAAA A
UCGAUUCCAUAAAGUAGGAAACACUACAUCCAUAAAGUAGGAAACACUACAUC
CAUAAAGUAGGAAACACUACAUCCAUAAAGUAGGAA
ACACUACAAAGCUUAACCCAUGGAAUUCAGUUCUCAAACCCAUGGAAUUCAGUUC
UCAAACCCAUGGAAUUCAGUUCUCAAACCCAUGG
AAUUCAGUUCUCAGUCGAAGCUUCGAAUUCUGCAGUCGACUGAAUAAAGCCUG
AGUAGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA >L7Ae-2A-Bcl2-4xT21 (SEQ
ID NO: 14) GGGCGAAUUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACACCGGUCG
CCACCAUGUACGUGAGAUUUGAGGUUCCUGAGGACAU
GCAGAACGAAGCUCUGAGUCUGCUGGAGAAGGUUAGGGAGAGCGGUAAGG
UAAAGAAAGGUACCAACGAGACGACAAAGGCUGUGGAGA
GGGGACUGGCAAAGCUCGUUUACAUCGCAGAGGAUGUUGACCCGCCUGAG
AUCGUUGCUCAUCUGCCCCUCCUCUGCGAGGAGAAGAAU
GUGCCGUACAUUUACGUUAAAAGCAAGAACGACCUUGGAAGGGCUGUGGG
CAUUGAGGUGCCAUGCGCUUCGGCAGCGAUAAUCAACGA
GGGAGAGCUGAGAAAGGAGCUUGGAAGCCUUGUGGAGAAGAUUAAAGGCC UUCAGAAGGGAUCU
AUGGCGCACGCUGGGAGA ACGGGGUACGAUAACCGGGAGAUAGUGAUGAAGUAC
AUCCAUUAUAAGCUGUCGCAGAGGGGCUACGAGUGGGAUGCGGGAGAUGU
GGGCGCCGCGCCCCCGGGGGCCGCCCCCGCACCGGGCAU
CUUCUCCUCCCAGCCCGGGCACACGCCCCAUCCAGCCGCAUCCCGGGACCC
GGUCGCCAGGACCUCGCCGCUGCAGACCCCGGCUGCCC
CCGGCGCCGCCGCGGGGCCUGCGCUCAGCCCGGUGCCACCUGUGGUCCAC
CUGACCCUCCGCCAGGCCGGCGACGACUUCUCCCGCCGC
UACCGCCGCGACUUCGCCGAGAUGUCCAGCCAGCUGCACCUGACGCCCUUC
ACCGCGCGGGGACGCUUUGCCACGGUGGUGGAGGAGCU
CUUCAGGGACGGGGUGAACUGGGGGAGGAUUGUGGCCUUCUUUGAGUUCG
GUGGGGUCAUGUGUGUGGAGAGCGUCAACCGGGAGAUGU
CGCCCCUGGUGGACAACAUCGCCCUGUGGAUGACUGAGUACCUGAACCGG
CACCUGCACACCUGGAUCCAGGAUAACGGAGGCUGGGAU
GCCUUUGUGGAACUGUACGGCCCCAGCAUGCGGCCUCUGUUUGAUUUCUCC
UGGCUGUCUCUGAAGACUCUGCUCAGUUUGGCCCUGGU
GGGAGCUUGCAUCACCCUGGGUGCCUAUCUGGGCCACAAGUGAGUCUAGAC
CUUCUGCGGGGCGACGAGCUGUACAAGUAAUUCUAGAA
GAUCCCAAAUCAACAUCAGUCUGAUAAGCUAUCAACAUCAGUCUGAUAAGCUAUC
AACAUCAGUCUGAUAAGCUAUCAACAUCAGUCUG
AUAAGCUAAGAUCUCCCGGGCGUACAAGUAAAGCGUGAAUAAAGCCUGAGUAG
GAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA >L7Ae-2A-Bc12 (SEQ ID NO: 15)
GGGCGAAUUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACACCGGUCG
CCACCAUGUACGUGAGAUUUGAGGUUCCUGAGGACAU
GCAGAACGAAGCUCUGAGUCUGCUGGAGAAGGUUAGGGAGAGCGGUAAGG
UAAAGAAAGGUACCAACGAGACGACAAAGGCUGUGGAGA
GGGGACUGGCAAAGCUCGUUUACAUCGCAGAGGAUGUUGACCCGCCUGAG
AUCGUUGCUCAUCUGCCCCUCCUCUGCGAGGAGAAGAAU
GUGCCGUACAUUUACGUUAAAAGCAAGAACGACCUUGGAAGGGCUGUGGG
CAUUGAGGUGCCAUGCGCUUCGGCAGCGAUAAUCAACGA
GGGAGAGCUGAGAAAGGAGCUUGGAAGCCUUGUGGAGAAGAUUAAAGGCC UUCAGAAGGGAUCU
GGCCCAAUGGCGCACGCUGGGAG AACGGGGUACGAUAACCGGGAGAUAGUGAUGAAGUAC
AUCCAUUAUAAGCUGUCGCAGAGGGGCUACGAGUGGGAUGCGGGAGAUGU
GGGCGCCGCGCCCCCGGGGGCCGCCCCCGCACCGGGCAU
CUUCUCCUCCCAGCCCGGGCACACGCCCCAUCCAGCCGCAUCCCGGGACCC
GGUCGCCAGGACCUCGCCGCUGCAGACCCCGGCUGCCC
CCGGCGCCGCCGCGGGGCCUGCGCUCAGCCCGGUGCCACCUGUGGUCCAC
CUGACCCUCCGCCAGGCCGGCGACGACUUCUCCCGCCGC
UACCGCCGCGACUUCGCCGAGAUGUCCAGCCAGCUGCACCUGACGCCCUUC
ACCGCGCGGGGACGCUUUGCCACGGUGGUGGAGGAGCU
CUUCAGGGACGGGGUGAACUGGGGGAGGAUUGUGGCCUUCUUUGAGUUCG
GUGGGGUCAUGUGUGUGGAGAGCGUCAACCGGGAGAUGU
CGCCCCUGGUGGACAACAUCGCCCUGUGGAUGACUGAGUACCUGAACCGG
CACCUGCACACCUGGAUCCAGGAUAACGGAGGCUGGGAU
GCCUUUGUGGAACUGUACGGCCCCAGCAUGCGGCCUCUGUUUGAUUUCUCC
UGGCUGUCUCUGAAGACUCUGCUCAGUUUGGCCCUGGU
GGGAGCUUGCAUCACCCUGGGUGCCUAUCUGGGCCACAAGUGAGUCUAGAC
CUUCUGCGGGGCUUGCCUUCUGGCCAUGCCCUUCUUCU
CUCCCUUGCACCUGUACCUCUUGGUCUUUGAAUAAAGCCUGAGUAGGAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAA >mKate (SEQ ID NO: 16)
GGGCGAAUUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACACCGGUCG
CCACCAUGGUGUCUAAGGGCGAAGAGCUGAUUAAGGA
GAACAUGCACAUGAAGCUGUACAUGGAGGGCACCGUGAACAACCACCACUU
CAAGUGCACAUCCGAGGGCGAAGGCAAGCCCUACGAGG
GCACCCAGACCAUGAGAAUCAAGGUGGUCGAGGGCGGCCCUCUCCCCUUC
GCCUUCGACAUCCUGGCUACCAGCUUCAUGUACGGCAGC
AAAACCUUCAUCAACCACACCCAGGGCAUCCCCGACUUCUUUAAGCAGUCC
UUCCCUGAGGGCUUCACAUGGGAGAGAGUCACCACAUA
CGAAGACGGGGGCGUGCUGACCGCUACCCAGGACACCAGCCUCCAGGACG
GCUGCCUCAUCUACAACGUCAAGAUCAGAGGGGUGAACU
UCCCAUCCAACGGCCCUGUGAUGCAGAAGAAAACACUCGGCUGGGAGGCCU
CCACCGAGAUGCUGUACCCCGCUGACGGCGGCCUGGAA
GGCAGAAGCGACAUGGCCCUGAAGCUCGUGGGCGGGGGCCACCUGAUCUG
CAACUUGAAGACCACAUACAGAUCCAAGAAACCCGCUAA
GAACCUCAAGAUGCCCGGCGUCUACUAUGUGGACAGAAGACUGGAAAGAAU
CAAGGAGGCCGACAAAGAGACCUACGUCGAGCAGCACG
AGGUGGCUGUGGCCAGAUACUGCGACCUCCCUAGCAAACUGGGGCACAAA
CUUAAUUGAUUCUAGACCUUCUGCGGGGCUUGCCUUCUG
GCCAUGCCCUUCUUCUCUCCCUUGCACCUGUACCUCUUGGUCUUUGAAUAAAG
CCUGAGUAGGAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAA >EGFP-8xMS2 (SEQ ID
NO: 17) GGGCGAAUUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACACCGGUCG
CCACCAUGGUGAGCAAGGGCGAGGAGCUGUUCACCGG
GGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGU
UCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACG
GCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCU
GGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAG
UGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCC
GCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUU
CUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGG
GCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCG
ACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACA
ACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAG
AACGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGC
GUGCAGCUCGCCGACCACUACCAGCAGAACACCCCCAU
CGGCGACGGCCCCGUGCUGCUGCCCGACAACCACUACCUGAGCACCCAGUC
CGCCCUGAGCAAAGACCCCAACGAGAAGCGCGAUCACA
UGGUCCUGCUGGAGUUCGUGACCGCCGCCGGGAUCACUCUCGGCAUGGAC
GAGCUGUACAAGUAAUUCUAGGCGAUCGCUCGAAAAACA
UGAGGAUCACCCAUGUCUGCAGGUCGACUCUAGAAAACAUGAGGAUCACCCAUGU
CCUGCAGGUCGACUCUAGAAAACAUGAGGAUCAC
CCAUGUCUGCAGGUCGACUCUAGAAAACAUGAGGAUCACCCAUGUCCUCGAAAAA
CAUGAGGAUCACCCAUGUCUGCAGGUCGACUCUA
GAAAACAUGAGGAUCACCCAUGUCCUGCAGGUCGACUCUAGAAAACAUGAGGAUC
ACCCAUGUCUGCAGGUCGACUCUAGAAAACAUGA
GGAUCACCCAUGUCCUCGAGGUGUGCGGCCGCUGAAUAAAGCCUGAGUAGGAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA >M52 (SEQ ID NO: 18)
GGGCGAAUUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACACCGGUCG
CCACCAUGGGAUCCGCUUCUAACUUUACUCAGUUCGU
UCUCGUCGACAAUGGCGGAACUGGCGACGUGACUGUCGCCCCAAGCAACUU
CGCUAACGGGGUCGCUGAAUGGAUCAGCUCUAACUCGC
GAUCACAGGCUUACAAAGUAACCUGUAGCGUUCGUCAGAGCUCUGCGCAGA
AUCGCAAAUACACCAUCAAAGUCGAGGUGCCUAAAGGC
GCAUGGAGGUCUUACUUAAAUAUGGAACUAACCAUUCCAAUUUUCGCCACG
AAUUCCGACUGCGAGCUUAUUGUUAAGGCAAUGCAAGG
UCUCCUAAAAGAUGGAAACCCGAUUCCCUCGGCCAUCGCGGCCAACUCCGG
CAUCUACAGAUCUCAUAUGCAUCUCGAGUGAUAGUCUA
GACCUUCUGCGGGGCUUGCCUUCUGGCCAUGCCCUUCUUCUCUCCCUUGCACC
UGUACCUCUUGGUCUUUGAAUAAAGCCUGAGUAGGA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA >Kt-MS2-CNOT7 (SEQ ID NO: 19)
GGAUCCGUGAUCGGAAACGUGAGAUCCACCUCAGAUCCGCUAGGACACCCGCAG
AUCGAGAAGAAGGCGAAUUAAGAGAGAAAAGAAGA
GUAAGAAGAAAUAUAAGACACCGGUCGCCACCAUGGCUUCUAACUUUACUCA
GUUCGUUCUCGUCGACAAUGGCGGAACUGGCGACGUG
ACUGUCGCCCCAAGCAACUUCGCUAACGGGGUCGCUGAAUGGAUCAGCUCU
AACUCGCGUUCACAGGCUUACAAAGUAACCUGUAGCGU
UCGUCAGAGCUCUGCGCAGAAGCGCAAAUACACCAUCAAAGUCGAGGUGCC
UAAAGUGGCAACCCAGACUGUUGGUGGUGUAGAGCUUC
CUGUAGCCGCAUGGCGUUCGUACUUAAAUAUGGAACUAACCAUUCCAAUUU
UCGCCACGAAUUCCGACUGCGAGCUUAUUGUUAAGGCA
AUGCAAGGUCUCCUAAAAGAUGGAAACCCGAUUCCCUCGGCCAUCGCAGCA
AACUCCGGCAUCUACUCGAUCGCCAUGCCAGCGGCAAC
UGUAGAUCAUAGCCAAAGAAUUUGUGAAGUUUGGGCUUGCAACUUGGAUGA
AGAGAUGAAGAAAAUUCGUCAAGUUAUCCGAAAAUAUA
AUUACGUUGCUAUGGACACCGAGUUUCCAGGUGUGGUUGCAAGACCCAUUG
GAGAAUUCAGGAGCAAUGCUGACUAUCAAUACCAACUA
UUGCGGUGUAAUGUAGACUUGUUAAAGAUAAUUCAGCUAGGACUGACAUUU
AUGAAUGAGCAAGGAGAAUACCCUCCAGGAACUUCAAC
UUGGCAGUUUAAUUUUAAAUUUAAUUUGACGGAGGACAUGUAUGCCCAGGA
CUCUAUAGAGCUACUAACAACAUCUGGUAUCCAGUUUA
AAAAACAUGAGGAGGAAGGAAUUGAAACCCAGUACUUUGCAGAACUUCUUA
UGACUUCUGGAGUGGUCCUCUGUGAAGGGGUCAAAUGG
UUGUCAUUUCAUAGCGGUUACGACUUUGGCUACUUAAUCAAAAUCCUAACC
AACUCUAACUUGCCUGAAGAAGAACUUGACUUCUUUGA
GAUCCUUCGAUUGUUUUUUCCUGUCAUUUAUGAUGUGAAGUACCUCAUGAA
GAGCUGCAAAAAUCUCAAAGGUGGAUUACAGGAGGUGG
CAGAACAGUUAGAGCUGGAACGGAUAGGACCACAACAUCAGGCAGGAUCU
GAUUCAUUGCUCACAGGAAUGGCCUUUUUCAAAAUGAGA
GAAAUGUUCUUUGAAGAUCAUAUUGAUGAUGCCAAAUAUUGUGGUCAUUUG
UAUGGCCUUGGUUCUGGUUCAUCCUAUGUACAGAAUGG
CACAGGGAAUGCAUAUGAAGAGGAAGCCAACAAGCAGUCAGUUUAAAUCUA
GACCUUCUGCGGGGCUUGCCUUCUGGCCAUGCCCUUCU
UCUCUCCCUUGCACCUGUACCUCUUGGUCUUUGAAUAAAGCCUGAGUAGGAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAA >L7 Ae-4xFF4 (SEQ ID NO: 20)
GGGCGAAUUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACACCGGUCG
CCACCAUGUACGUGAGAUUUGAGGUUCCUGAGGACAU
GCAGAACGAAGCUCUGAGUCUGCUGGAGAAGGUUAGGGAGAGCGGUAAGG
UAAAGAAAGGUACCAACGAGACGACAAAGGCUGUGGAGA
GGGGACUGGCAAAGCUCGUUUACAUCGCAGAGGAUGUUGACCCGCCUGAG
AUCGUUGCUCAUCUGCCCCUCCUCUGCGAGGAGAAGAAU
GUGCCGUACAUUUACGUUAAAAGCAAGAACGACCUUGGAAGGGCUGUGGG
CAUUGAGGUGCCAUGCGCUUCGGCAGCGAUAAUCAACGA
GGGAGAGCUGAGAAAGGAGCUUGGAAGCCUUGUGGAGAAGAUUAAAGGCC
UUCAGAAGUAAGGCGCGCCCCGCUUGAAGUCUUUAAUUA
AACCGCUUGAAGUCUUUAAUUAAACCGCUUGAAGUCUUUAAUUAAACCGCUUGAA
GUCUUUAAUUAAAGCUAGUUACCCAGCUUUCUUG
UACAAAGUGAAUAAAGCCUGAGUAGGAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAA >EGFP (SEQ ID NO: 21)
GGGCGAAUUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACACCGGUCG
CCACCAUGGUGAGCAAGGGCGAGGAGCUGUUCACCGG
GGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGU
UCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACG
GCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCU
GGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAG
UGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCC
GCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUU
CUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGG
GCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCG
ACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACA
ACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAG
AACGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGC
GUGCAGCUCGCCGACCACUACCAGCAGAACACCCCCAU
CGGCGACGGCCCCGUGCUGCUGCCCGACAACCACUACCUGAGCACCCAGUC
CGCCCUGAGCAAAGACCCCAACGAGAAGCGCGAUCACA
UGGUCCUGCUGGAGUUCGUGACCGCCGCCGGGAUCACUCUCGGCAUGGAC
GAGCUGUACAAGUAGGUCUAGACCUUCUGCGGGGCUUGC
CUUCUGGCCAUGCCCUUCUUCUCUCCCUUGCACCUGUACCUCUUGGUCUUUGA
AUAAAGCCUGAGUAGGAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAA >EGFP-PEST
(SEQ ID NO: 22)
GGGCGAAUUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACACCGGUCG
CCACCAUGGUGAGCAAGGGCGAGGAGCUGUUCACCGG
GGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGU
UCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACG
GCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCU
GGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAG
UGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCC
GCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUU
CUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGG
GCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCG
ACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACA
ACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAG
AACGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGC
GUGCAGCUCGCCGACCACUACCAGCAGAACACCCCCAU
CGGCGACGGCCCCGUGCUGCUGCCCGACAACCACUACCUGAGCACCCAGUC
CGCCCUGAGCAAAGACCCCAACGAGAAGCGCGAUCACA
UGGUCCUGCUGGAGUUCGUGACCGCCGCCGGGAUCACUCUCGGCAUGGAC GAGCUGUACAAGAAG
UAGCUCUAGACCUUCUGCGGGGCUUGCCUUCUGGCCAUGCCCU
UCUUCUCUCCCUUGCACCUGUACCUCUUGGUCUUUG
AAUAAAGCCUGAGUAGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA >Kt-EGFP (SEQ
ID NO: 23) GGAUCCGUGAUCGGAAACGUGAGAUCCACCUCAGAUCCGCUAGGACACCCGCAG
AUCGAGAAGAAGGCGAAUUAAGAGAGAAAAGAAGA
GUAAGAAGAAAUAUAAGACACCGGUCGCCACCAUGGGAUCCGUGAGCAAGGG
CGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUC
GAGCUGGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGG
CGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUU
CAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCAC
CCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCG
ACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACG
UCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAAC
UACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCG
CAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAA
CAUCCUGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAU
CAUGGCCGACAAGCAGAAGAACGGCAUCAAGGUGAACU
UCAAGAUCCGCCACAACAUCGAGGACGGCAGCGUGCAGCUCGCCGACCACU
ACCAGCAGAACACCCCCAUCGGCGACGGCCCCGUGCUG
CUGCCCGACAACCACUACCUGAGCACCCAGUCCGCCCUGAGCAAAGACCCC
AACGAGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGU
GACCGCCGCCGGGAUCACUCUCGGCAUGGACGAGCUGUACAAGAGAUCUC
AUAUGCAUCUCGAGUGAUAGUCUAGACCUUCUGCGGGGC
UUGCCUUCUGGCCAUGCCCUUCUUCUCUCCCUUGCACCUGUACCUCUUGGUCU
UUGAAUAAAGCCUGAGUAGGAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAA >L7Ae (SEQ
ID NO: 24) GGGCGAAUUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACACCGGUCG
CCACCAUGUACGUGAGAUUUGAGGUUCCUGAGGACAU
GCAGAACGAAGCUCUGAGUCUGCUGGAGAAGGUUAGGGAGAGCGGUAAGG
UAAAGAAAGGUACCAACGAGACGACAAAGGCUGUGGAGA
GGGGACUGGCAAAGCUCGUUUACAUCGCAGAGGAUGUUGACCCGCCUGAG
AUCGUUGCUCAUCUGCCCCUCCUCUGCGAGGAGAAGAAU
GUGCCGUACAUUUACGUUAAAAGCAAGAACGACCUUGGAAGGGCUGUGGG
CAUUGAGGUGCCAUGCGCUUCGGCAGCGAUAAUCAACGA
GGGAGAGCUGAGAAAGGAGCUUGGAAGCCUUGUGGAGAAGAUUAAAGGCC
UUCAGAAGAGAUCUCAUAUGCAUCUCGAGUGAUAGUCUA
GACCUUCUGCGGGGCUUGCCUUCUGGCCAUGCCCUUCUUCUCUCCCUUGCACC
UGUACCUCUUGGUCUUUGAAUAAAGCCUGAGUAGGA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1. The 5' terminus of the mRNAs is
capped with 3'-O-Me-m.sup.7G. 2. The protein coding regions are
shown in bold letters. 3. The start and the stop codons are
underlined. 4. RNA motifs, peptide tags and miRNA target sites are
colored as indicated above each sequence.
Self-Replicating RNA Preparation and Electroporation
[0231] All replicon experiments were performed in BHK21 cells (a
kind gift from Dr. Odisse Azizgolshan(34)) using an alphaviral
replicon derived from the genome of the Sindbis virus TE12 strain
(35) containing a P726S mutation in nsP2 (36) as described
previously (37) or an alphaviral replicon derived from the
Venezuelan equine encephalitis (VEE) TC-83 strain containing a A3G
mutation in the 5'UTR and a Q739L mutation in nsP2 (38) constructed
in this study. Briefly, BHK21 cells cultured at 37 degrees C. and
5% CO2 in EMEM (ATCC) medium containing 10% FBS (PAA) were
electroporated using the Neon.RTM. Transfection System (Life
Technologies) per the manufacturer's instructions with .about.1-6
ug of replicon RNA per .about.100,000 cells and plated in 24 well
plates (Corning). Transfection details for all experiments are
provided in Table 1. Sindbis replicon RNA was produced by run-off
in vitro transcription (IVT) of SacI-HF (NEB)-digested replicon
plasmid DNA using the mMESSAGE mMACHINE.RTM. SP6 Kit (Life
Technologies) and purified using the RNeasy.RTM. Mini Kit (Qiagen).
VEE replicon RNA was produced by run-off in vitro transcription
(IVT) of I-SceI (NEB)-digested replicon plasmid DNA using the
MEGAscript.RTM. T7 Transcription Kit, followed by purification
using the RNeasy.RTM. Mini Kit (Qiagen), denaturation of the RNA at
65 degrees C., enzymatic (cap1) capping of the RNA using the
ScriptCap.TM. 2'-O-Methyltransferase Kit (Cellscript) and
ScriptCap.TM. m7G Capping System (Cellscript), and a final
purification using the RNeasy.RTM. Mini Kit (Qiagen) following the
manufacturers' protocols. siRNAs (IDT) were co-electroporated (0-10
nM final concentration) along with replicon RNA. Cells were
analyzed by flow cytometry 24 h post electroporation. Replicon
encoding plasmids used as templates for IVT are listed in Table
5.
TABLE-US-00005 TABLE 5 Replicon constructs used in this study:
sequences, GenBank files, and E. coli glycerol stocks for plasmids
used for replicon RNA synthesis can be obtained from Addgene
(deposit number 71270). Replicon pTK095 SIN SP6 P1234 (nsP2 P726S)
SGP(14) Kozak L7Ae-P2A-EYFP 4xFF4 8xMS2 pTK101 SIN SP6 P1234 (nsP2
P726S) SGP(14) mKate-G8-L7Ae-PEST 4xFF4 PTK105 SIN SP6 P1234 (nsP2
P726S) SGP(14) 2xK-turn EYFP-PEST pTK194 TC-83 I-SceI T7 5'UTR
(A3G) P1234 (nsP2 Q739L) SGP XbaI attB1 Kozak mKate opaI attB2 AscI
(truncated E1) 3'UTR Poly A I-SceI pTK295 SIN SP6 P1234 (nsP2
P726S) SGP(14) 2xK-turn Kozak EGFP pTK296 SIN SP6 P1234 (nsP2
P726S) SGP(14) 2xK-turn Kozak EGFP-PEST pTK297 SIN SP6 P1234 (nsP2
P726S) SGP(14) Kozak mKate-G8-L7Ae 4xFF4 pTK298 SIN SP6 P1234 (nsP2
P726S) SGP(14) Kozak mKate-G8-L7Ae-PEST 4xFF4 pTK299 SIN SP6 P1234
(nsP2 P726S) SGP(14) Kozak L7Ae-P2A-EYFP 4xFF4 pTK312 TC-83 I-SceI
T7 5'UTR (A3G) P1234 (nsP2 Q739L) SGP XbaI attB1 Kozak EGFP ochre
attB2 AscI (truncated E1) 3'UTR Poly A I-SceI pTK313 TC-83 I-SceI
T7 5'UTR (A3G) P1234 (nsP2 Q739L) SGP XbaI attB1 Kozak EGFP-PEST
ochre attB2 AscI (truncated E1) 3'UTR Poly A I-SceI pTK317 TC-83
I-SceI T7 5'UTR (A3G) P1234 (nsP2 Q739L) SGP(16) 2xK-turn Kozak
EGFP attB2 AscI (truncated E1) 3'UTR Poly A I-SceI pTK331 TC-83
I-SceI T7 5'UTR (A3G) P1234 (nsP2 Q739L) SGP(14) Kozak
mKate-G8-L7Ae-PEST 4xFF4 attB2 SGP2(98/30) XbaI attB1 EBFP2 ochre
attB2 (insert) AscI (truncated E1) 3'UTR Poly A I-SceI pTK332 SIN
SP6 P1234 (nsP2 P726S) SGP(14) 2xK-turn Kozak MS2-CNOT7 (SacI
mutated)-P2A- EBFP2-4xFF5 pTK333 SIN SP6 P1234 (nsP2 P726S) SGP(14)
Kozak MS2-CNOT7 (SacI mutated)-P2A-EBFP2 4xFF5
qRT-PCR
[0232] In the case of pDNA and modRNA, total RNA was reverse
transcribed with High-Capacity cDNA Reverse Transcription Kit (Life
Technologies). Resulting cDNA was subjected to qPCR on StepOnePlus
(Life Technologies) for modRNA using Power SYBR Green PCR Master
Mix (Life Technologies). Same Master Mix and Mastercycler ep
Realplex (Eppendorf) was used for pDNA experiments. For qRT-PCR of
RNA replicons, total RNA was purified from BHK21 cells using the
RNeasy.RTM. Mini Kit (Qiagen). RNA was reverse transcribed using
the QuantiTect Reverse Transcription Kit (Qiagen) and qPCR was
performed on a Mastercycler ep Realplex (Eppendorf) using the KAPA
SYBR.RTM. FAST Universal 2X qPCR Master Mix (Kapa Biosystems) or
the KAPA PROBE FAST Universal 2X qPCR Master Mix (Kapa Biosystems)
following the manufacturer's recommended protocol. Primers unique
to the genomic RNA regions were used to calculate the absolute copy
number of genomic and antigenomic RNA using a standard curve of
synthetic DNA. Subgenomic RNA copy numbers were calculated by
subtracting the copy numbers of genomic and antigenomic RNA from
the absolute copy numbers of all replicon RNA (i.e. genomic,
antigenomic, and subgenomic RNA) using primers spanning the regions
downstream of the SGP. Genomic and subgenomic RNA quantities were
then normalized to 18S rRNA (internal control) levels quantified
using QuantumRNA.TM. Universal 18S Internal Standard (Life
Technologies) or Eukaryotic 18S rRNA Endogenous Control
(FAM.TM./MGB probe, non-primer limited; Life Technologies).
Primer Sequences:
TABLE-US-00006 [0233] EGFP-qPCR-F (SEQ ID NO: 1)
AAGGGCATCGACTTCAAGG EGFP-qPCR-R (SEQ ID NO: 2)
TGCTTGTCGGCCATGATATAG VEE-nsP1-qPCR-F (SEQ ID NO: 3)
CTGACCTGGAAACTGAGACTATG VEE-nsP1-qPCR-R (SEQ ID NO: 4)
GGCGACTCTAACTCCCTTATTG VEE-nsP4-EGFP-qPCR-F (SEQ ID NO: 5)
CCCTATAACTCTCTACGGCTAAC VEE-nsP4-EGFP-qPCR-R (SEQ ID NO: 6)
AGAAGTCGTGCTGCTTCA SIN-nsP4-L7Ae-qPCR-F (SEQ ID NO: 7)
GGCGTGGTTTAGAGTAGGTATAA SIN-nsP4-L7Ae-qPCR-R (SEQ ID NO: 8)
TCGTCTCGTTGGTACCTTTC MS2-Taqman-F1 (SEQ ID NO: 9)
GCTGAATGGATCAGCTCTAACT MS2-Taqman-R1 (SEQ ID NO: 10)
CAGTCTGGGTTGCCACTTTA MS2-Taqman-P1-2 (SEQ ID NO: 11)
ACCTGTAGCGTTCGTCAGTCCTCT
Flow Cytometry and Data Analysis
[0234] Cells were analyzed with LSR Fortessa or FACSAria flow
cytometer, equipped with 405, 488 and 561 nm lasers (BD
Biosciences). We collected 30,000-100,000 events per sample and
fluorescence data were acquired with the following cytometer
settings: 488 nm laser and 530/30 nm bandpass filter for EYFP/EGFP,
561 nm laser and 610/20 nm filter for mKate, and 405 nm laser,
450/50 filter for EBFP. In detecting mKate by FACSAria, a 780/60 nm
bandpass filter was used. Data analysis was performed with FACSDiva
software (BD Biosciences) and FlowJo (www.flowjo.com). For all
fluorescence assays, populations containing live, single cells were
first determined based on forward and side scatter. Red fluorescent
protein (mKate) was used in all pDNA experiments as a transfection
marker. Reported fluorescence values of pDNA experiments present
normalized mean output fluorescence (EYFP, EGFP or EBFP) for all
mKate positive cells. Non-transfected cells were used to set the
gate determining mKate positive cells. For replicon
electroporations and modRNA transfections the efficiency of nucleic
acid delivery usually exceeds 90% and therefore all live, single
cells were taken into account for calculating mean output
fluorescence.
[0235] In FIG. 7B, output (EGFP) fluorescence level may depend both
on circuit function and overall expression in a particular cell
line (different promoter activities and transfection efficiencies).
To account for cell type specific expression we therefore applied
here normalization to mKate. Mean EGFP fluorescence for each sample
was divided by mean mKate fluorescence and the ratio was normalized
to the HEK293 level (HEK293 relative fluorescence set to 1).
Microscope Measurements and Image Processing
[0236] Fluorescence microscopy images of live cells were taken in
24-well plates using Zeiss Axiovert 200 microscope and
Plan-Neofluar 10.times./0.30 Ph1 objective. The filters used were
390/22 (excitation) and 460/50 (emission) for EBFP2, 500/20
(excitation) and 535/50 (emission) for EYFP and 565/30 (excitation)
and 620/60 (emission) for mKate. Data collection and processing
were performed using AxioVision software (Zeiss).
[0237] Apoptosis and Cell Death Assays
[0238] Sample cells including those in supernatant were collected
24 h post-transfection, washed with PBS and stained with Pacific
Blue conjugated 1 .mu.L of Annexin V (Life Technologies) or 0.5
.mu.L of SYTOX AADvanced (Life Technologies) in 50 .mu.L of binding
buffer for 30 min at room temperature. The cells were analyzed by
flow cytometry. Percentage of apoptosis induction was defined as
the percentage of Annexin V positive cells. In the case of HEK/HeLa
co-culture assay, HeLa cells were labeled with stable expression of
EBFP2 fluorescent protein (excitation/emission maxima of 383 nm and
448 nm) and therefore SYTOX AADvanced (excitation/emission maxima
of 546 nm and 647 nm) was used instead Pacific Blue Annexin V
(excitation/emission maxima of 415 nm and 455 nm). HEK293 and
HeLa-EBFP2 cells were mixed in 1:1 ratio, cultured together and the
cell mixture was transfected with modRNA-encoded circuit or
controls. Cells were stained with SYTOX AADvanced and analyzed by
flow cytometry 24 h post-transfection. % of cell death was
calculated as follows: (number of HEK (or HeLa) AAdvanced positive
cells/total number of HEK (or HeLa) cells) *100%.
Generation of HeLa-EBFP2 Cells for Co-Culture Cell Death Assay
[0239] HeLa-EBFP2 cells were generated through lentiviral infection
and antibiotic selection. First, HEK293FT packaging cells
(Invitrogen) were used for virus production. 2.times.10.sup.6 cells
were seeded in a 60 mm dish (to .about.80% confluency),
approximately 3 h later supplemented with 3 ml of fresh complete
medium and co-transfected with the following plasmids: [0240] 0.5
.mu.g pLV-hEF1a-EBFP2-P2A-Bla (hEF1a--human elongation factor
1alpha promoter, P2A--ribosomal skipping 2A sequence from porcine
teschovirus-1(39), Bla--blasticidin resistance gene) [0241] 1.1
.mu.g pCMV-dR8.2 dvpr helper plasmid (40) (Addgene plasmid 8455)
[0242] 0.55 .mu.g pCMV-VSV-G helper plasmid (40) (Addgene plasmid
8454)
[0243] Transfections were performed using attractene (Qiagen) and
standard manufacturer's protocol. Transfection complexes were added
dropwise to the adhered cells without additional media change. 2
days later, media from virus producing cells were collected into 3
ml syringe, and pressed through a low protein binding 0.45 .mu.m
sterile filter. 1 ml of the filtered virus containing media was
mixed with 4.times.10.sup.3 HeLa cells in 0.5 ml fresh culture
media and placed in a 12-well dish. Cells were supplemented with
fresh media the next day and 10 .mu.g/ml blasticidin (Invivogen)
was added to the media on days 3-8 post-infection. Selected cells
were over 99% BFP positive throughout the course of experiments as
determined by flow cytometry. We additionally performed a
fluorescent assay using our classifier circuit (as described in
FIG. 8B) with HEK293, HeLa and HeLa-EBFP2 cells and we verified
that the HeLa-EBFP2 cells behave as the parent cell line.
Computational Model
[0244] I. pDNA MODEL
Species:
[0245] pC nuclear MS2-CNOT7 plasmid [0246] pL nuclear L7Ae plasmid
[0247] mC MS2-CNOT7 mRNA [0248] mL L7Ae mRNA [0249] LmC L7Ae
protein bound to cytoplasmic MS2-CNOT7 mRNA [0250] CmL MS2-CNOT7
protein bound to cytoplasmic L7Ae mRNA [0251] L.sub.2mC L7Ae
protein doubly bound to cytoplasmic MS2-CNOT7 mRNA [0252] C.sub.2mL
MS2-CNOT7 protein doubly bound to cytoplasmic L7Ae mRNA [0253] C
MS2-CNOT7 protein [0254] L L7Ae protein
Reactions:
Transcription
[0255] Transcription is assumed to be first-order upon cell
division when the pDNA enters the cell nucleus.
TABLE-US-00007 pC .fwdarw. pC + mC k.sub.TS [1] pL .fwdarw. pL + mL
k.sub.TS [2]
Translation
[0256] Translation is assumed to be first-order. While MS2-CNOT7
binding does not have any steric effect on L7Ae translation, bound
L7Ae greatly inhibits translation. When one L7Ae protein is bound
to the RNA it inhibits translation by a factor, .sigma., and when
two copies of L7Ae are RNA-bound translation is inhibited twice as
much.
TABLE-US-00008 mC .fwdarw. mC + C k.sub.TL [3] LmC .fwdarw. LmC + C
k.sub.TL .sigma. [4] L2mC .fwdarw. L2mC + C k.sub.TL .sigma./2 [5]
mL .fwdarw. mL + L k.sub.TL [6] CmL .fwdarw. CmL + L k.sub.TL [7]
C2mL .fwdarw. C2mL + L k.sub.TL [8]
Repressor Binding/Unbinding
[0257] For simplicity, two binding sites were assumed for both
MS2-CNOT7 and L7Ae RNA. A second-order association rate is used and
first-order dissociation rate.
TABLE-US-00009 L + mC LmC 2 k.sub.ON,L, k.sub.OFF,L [9] C + mL CmL
2 k.sub.ON,C, k.sub.OFF,C [10] L + LmC L2mC k.sub.ON,L, 2
k.sub.OFF,L [11] C + CmL C2mL k.sub.ON,C, 2 k.sub.OFF,C [12]
Degradation
[0258] First-order degradation rates were assumed. When the
deadenylase MS2-CNOT7 is bound to L7Ae RNA it increases the RNA's
degradation rate by a factor, .alpha.: In addition to these
reactions, all species (including plasmids) are diluted by cell
division.
TABLE-US-00010 mC .fwdarw. 0 deg.sub.R [13] mL .fwdarw. 0 deg.sub.R
[14] LmC .fwdarw. L deg.sub.R [15] CmL .fwdarw. C deg.sub.R .alpha.
[16] LmC .fwdarw. mC deg.sub.P [17] CmL .fwdarw. mL deg.sub.P [18]
L2mC .fwdarw. 2 L deg.sub.R [19] C2mL .fwdarw. 2 C deg.sub.R 2
.alpha. [20] L2mC .fwdarw. LmC deg.sub.P [21] C2mL .fwdarw. CmL
deg.sub.P [22] C .fwdarw. 0 deg.sub.P [23] L .fwdarw. 0 deg.sub.P
[24]
II. REPLICON MODEL
Species:
[0259] rC cytoplasmic MS2-CNOT7 replicon (genomic) [0260] rL
cytoplasmic L7Ae replicon (genomic) [0261] rfC MS2-CNOT7 replicon
in spherule (replication factory) [0262] rfL L7Ae replicon in
spherule [0263] LrC L7Ae protein bound to cytoplasmic MS2-CNOT7
replicon [0264] CrL MS2-CNOT7 protein bound to cytoplasmic L7Ae
replicon [0265] L2rC L7Ae protein doubly bound to cytoplasmic
MS2-CNOT7 replicon [0266] C2rL MS2-CNOT7 protein bound to
cytoplasmic L7Ae replicon [0267] mC MS2-CNOT7 mRNA (subgenomic)
[0268] mL L7Ae mRNA (subgenomic) [0269] LmC L7Ae protein bound to
cytoplasmic MS2-CNOT7 mRNA [0270] CmL MS2-CNOT7 protein bound to
cytoplasmic L7Ae mRNA [0271] L2mC L7Ae protein doubly bound to
cytoplasmic MS2-CNOT7 mRNA [0272] C2mL MS2-CNOT7 protein doubly
bound to cytoplasmic L7Ae mRNA [0273] C MS2-CNOT7 protein [0274] L
L7Ae protein
Reactions:
Transport
[0275] In this simplified model, the transport of replicons to the
plasma membrane and the creation of spherules is assumed to be a
first-order process. The transport of replicons into spherules
depends on nonstructural proteins and other cellular factors and
occurs independently for each replicon. In the replicon case, we
also consider the inhibition of replicon transport through RBP
binding, where .beta. is a fraction (1=no inhibition, 0=complete
inhibition).
TABLE-US-00011 rC .fwdarw. rC + rfC k.sub.TR [1] rL .fwdarw. rL +
rfL k.sub.TR [2] LrC .fwdarw. LrC + rfC k.sub.TR .beta. [3] CrL
.fwdarw. CrL + rfL k.sub.TR .beta. [4] L2rC .fwdarw. L2rC + rfC
k.sub.TR .beta. [5] C2rL .fwdarw. C2rL + rfL k.sub.TR .beta.
[6]
Transcription
[0276] Transcription is assumed to be first-order upon the
formation of spherules (replication factories). Spherules can also
transcribe more genomic RNA (Equations 9 and 10). This positive
feedback is tuned by the fraction .epsilon..
TABLE-US-00012 rfC .fwdarw. rfC + mC k.sub.TS [7] rfL .fwdarw. rfL
+ mL k.sub.TS [8] rfC .fwdarw. rfC + rC k.sub.TS .epsilon. [9] rfL
.fwdarw. rfL + rL k.sub.TS .epsilon. [10]
Translation
[0277] Translation is assumed to be first-order as in the pDNA
case.
TABLE-US-00013 mC .fwdarw. mC + C k.sub.TL [11] LmC .fwdarw. LmC +
C k.sub.TL .sigma. [12] L2mC .fwdarw. L2mC + C k.sub.TL .sigma./2
[13] mL .fwdarw. mL + L k.sub.TL [14] CmL .fwdarw. CmL + L k.sub.TL
[15] C2mL .fwdarw. C2mL + L k.sub.TL [16]
Repressor Binding/Unbinding
[0278] Second-order association rates and first-order dissociation
rates were used as above. In the replicon system we assume RBPs can
also bind the genomic RNA with the same efficacy (Equations
17-20).
TABLE-US-00014 L + rC LrC 2 k.sub.ON,L, k.sub.OFF,L [17] C + rL CrL
2 k.sub.ON,C, k.sub.OFF,C [18] L + LrC L2rC k.sub.ON,L, 2
k.sub.OFF,L [19] C + CrL C2rL k.sub.ON,C, 2 k.sub.OFF,C [20] L + mC
LmC 2 k.sub.ON,L, k.sub.OFF,L [21] C + mL CmL 2 k.sub.ON,C,
k.sub.OFF,C [22] L + LmC L2mC k.sub.ON,L, 2 k.sub.OFF,L [23] C +
CmL C2mL k.sub.ON,C, 2 k.sub.OFF,C [24]
Degradation
[0279] First-order degradation rates were assumed as above. We
assume that the degradation factor for mRNAs bound by MS2-CNOT7
also applies to genomic replicon RNAs bound by MS2-CNOT7. Spherules
are assumed to be stable for the 4 hours simulated here and are
only diluted through cell division.
TABLE-US-00015 rC .fwdarw. 0 deg.sub.R [25] rL .fwdarw. 0 deg.sub.R
[26] LrC .fwdarw. L deg.sub.R [27] CrL .fwdarw. C deg.sub.R .alpha.
[28] LrC .fwdarw. rC deg.sub.P [29] CrL .fwdarw. rL deg.sub.P [30]
L2rC .fwdarw. 2 L deg.sub.R [31] C2rL .fwdarw. 2 C deg.sub.R 2
.alpha. [32] L2rC .fwdarw. LrC deg.sub.P [33] C2rL .fwdarw. CrL
deg.sub.P [34] mC .fwdarw. 0 deg.sub.R [35] mL .fwdarw. 0 deg.sub.R
[36] LmC .fwdarw. L deg.sub.R [37] CmL .fwdarw. C deg.sub.R .alpha.
[38] LmC .fwdarw. mC deg.sub.P [39] CmL .fwdarw. mL deg.sub.P [40]
L2mC .fwdarw. 2 L deg.sub.R [41] C2mL .fwdarw. 2 C deg.sub.R 2
.alpha. [42] L2mC .fwdarw. LmC deg.sub.P [43] C2mL .fwdarw. CmL
deg.sub.P [44] C .fwdarw. 0 deg.sub.P [45] L .fwdarw. 0 deg.sub.P
[46]
Introduction
[0280] Gene delivery using messenger RNA (mRNA) rather than plasmid
DNA (pDNA) may be safer owing to a reduced risk of genomic
integration (2). Advances in chemical mRNA modification technology
have made it possible to use stable in vitro synthesized mRNA with
low immunogenicity for gene therapy (21). Self-replicating RNAs
that couple RNA-only delivery with prolonged gene expression are of
interest for biomedical applications including vaccination and stem
cell reprogramming (21). Synthetic biology, however, has so far
relied exclusively or partially on transcriptional regulation,
which requires introduction of foreign DNA (9, 10). RNA-based
regulatory parts, such as aptamers or riboswitches (22-24) cannot
currently be interconnected to build complex RNA-encoded circuits.
RNA strand displacement reactions, used to date only in bacteria
(25, 26) could be combined into logic circuits (27). However, such
multi-layered RNA circuits have not yet been successfully
implemented. We propose that RNA-binding proteins (RBPs) (12) can
function as both the input and the output of RNA regulatory devices
and be wired to regulate production of each other towards the
construction of complex circuits. The synthetic circuits containing
RBPs reported to date have not shown that one RBP can regulate
another and have depended on both translational and transcriptional
regulation, requiring the use of pDNA for circuit delivery (24).
Additionally, general mechanisms to regulate expression from
synthetic mRNA or RNA replicons have not yet been implemented. In
this article we report that RBP regulatory devices can be wired
together and interconnected with cellular and synthetic signaling
pathways to build complex circuits that can be delivered to
mammalian cells as RNA. We characterize and optimize of a set of
RBP devices and then use them to engineer diverse regulatory
circuits including a multi-input cell type classifier, a cascade
and a switch (FIGS. 9A-9C). These circuits carry out signal
processing operations that detect intracellular biomarker levels,
transmit information between cascaded regulatory devices and
conserve circuit state through feedback regulation. We also show
that the classifier can be used for selective induction of
apoptosis in a targeted cell type (HeLa cancer cells) using
RNA-only delivery.
[0281] As a first step toward creating RNA-encoded circuits, we
optimized and characterized a set of RNA repressor devices
comprising RBPs and their binding motifs (FIGS. 10A-10E and FIG.
11). Of the tested devices, L7Ae:K-turn system (12) and
MS2-CNOT7:MS2 binding motif (29) were the most potent and used for
further circuit construction.
[0282] As a first step toward creating RNA-encoded circuits, we
improved the L7Ae:K-turn system (12). L7Ae is an archaeal protein
that binds a K-turn motif with high affinity. When the K-turn motif
is placed in the 5'UTR of target mRNA, L7Ae represses translation
of the output gene. We increased repression of this system by using
two repeats of the K-turn motif with a short 5'UTR (FIGS. 10A, 10C,
and 10E). In the optimized system the repressed sub-population
cannot be easily distinguished from the untransfected
sub-population, thus creating an overall apparent unimodal
response. Next, we characterized in mammalian cells the efficacy of
MS2 coat protein fusions with various repression domains4 (FIG.
10B), including N-terminal repression domains of PUF proteins as
well as human and Drosophila deadenylases CNOT7 and POP2 (FIG.
10D-10E, FIG. 11). The target/reporter mRNA contains eight repeats
of the MS2 binding site in the 3'UTR. MS2 RNA binding domain
localizes the fused repression domain to the reporter mRNA. The
repression mechanism of PUF proteins is not fully understood but
they cause degradation of the targeted mRNA by recruiting
deadenylases and also act in deadenylation-independent manner (29).
Of the tested set of repressors, MS2-CNOT7 and MS2-POP2 were the
most potent and MS2-CNOT7 was selected for further circuit
construction.
[0283] To show that these RBP-based repressors can be used as a
platform for composite RNA-encoded circuits, we engineered a
multi-input microRNA sensing circuit that is a simplified
post-transcriptional only version of our previously reported HeLa
cell classifier (15). The circuit recognizes whether the cell has a
microRNA expression profile indicative of HeLa cells (high miR-21,
low miR141, 142(3p) and 146a) and triggers a response only if the
profile is matched (FIG. 7, FIG. 9A). The circuit topology consists
of two basic sensory modules, one for specific microRNAs that are
highly expressed in the cancer phenotype (HeLa-high) and one for
the microRNAs that are expressed at low levels (HeLa-low).
HeLa-high microRNAs affect circuit output via double inversion by
repressing L7Ae, which allows expression of an output protein.
HeLa-low microRNAs directly repress translation of the output. As
shown in FIG. 7B and FIG. 12A-12C, the L7Ae-based classifier is
able to distinguish HeLa cells from HEK 293 and MCF7 in a
fluorescence assay. While single microRNAs are often sufficient to
differentiate between pairs of cell types (FIG. 13) a multi-input
circuit is needed to distinguish HeLa cells from many other cell
types simultaneously (15). When a pro-apoptotic gene hBax is
incorporated as circuit output, the classifier selectively kills
HeLa cells and does not strongly affect viability of HEK cells
(FIGS. 7C-7D, FIGS. 14 and 15). Specific induction of apoptosis was
achieved using both pDNA and modified mRNA (modRNA) to deliver
circuits. Furthermore, the modRNA circuit specifically killed HeLa
cells in a mixed HeLa/HEK cell population (FIG. 8E, FIG. 16). The
performance of our new classifier coupled with the RNA-only
delivery provides a safer means for using such classifier synthetic
network for a range of applications, including selective stem cell
reprogramming or vaccination.
[0284] We next connected RBP devices to produce a scalable RNA-only
circuit design platform. To generate a one-way information
transmitter, we designed a post-transcriptional cascade with three
repression stages (FIG. 8A-8D, FIG. 9B). The input to the cascade
(FIG. 8A) is a synthetic siRNA-FF4 which modulates expression of
L7Ae through four repeats of the FF4 target site in the 3'UTR. L7Ae
then binds the K-turn motifs in the 5'UTR of RNA that encodes a
second repressor, MS2-CNOT7, which regulates expression of output
EGFP containing eight repeats of the MS2 binding site in its 3'UTR.
We tested the behavior of the circuit with pDNA and modRNA
transfections (FIG. 8B, FIGS. 17A-17D) and quantified cascade
operation for a range of input concentrations and times (FIGS.
18A-C, 19A-19F, and 20A-20F).
[0285] A two-stage version of the cascade was encoded on
self-replicating RNA derived from Sindbis virus (30) (FIGS. 8C-8D,
FIG. 17C). Replication is mediated by the viral RNA-dependent RNA
polymerase (RdRp; comprised of nonstructural proteins nsP1-nsP4)
and enables long-term gene expression (FIGS. 21, 22A-22E, 23A-23C,
and 24A-24B). Production of exogenous genes is driven by a
subgenomic promoter of the replicon (SGP). In our replicon-encoded
cascade circuit, siRNA-FF4 (input) regulates expression of L7Ae.
The repressor is under the control of the replicon SGP and
additionally contains four repeats of the FF4 target site in its
3'UTR. A separate co-transfected replicon encodes output EGFP with
two repeats of the K-turn motif in the 5'UTR. As shown in FIG. 8D
and FIG. 25, L7Ae expression results in 29-fold repression of EGFP
(stage 1), and knockdown of L7Ae by synthetic siRNA-FF4 fully
restores the output (stage 2). The cascade also functions with
combined replicon/pDNA co-electroporation, albeit with reduced
repression efficiency (FIGS. 26A-26C).
[0286] Plasmid DNA (pDNA). Plasmids have been widely used for
delivery and expression of foreign genes in mammalian cells. The
ease and cost efficiency of sequence modification and pDNA handling
make plasmids a popular modality for delivery in many types of
experiments. pDNA constructs are also relatively stable and less
prone to folding than RNA. While pDNA delivery leads mostly to
transient expression, the DNA can still randomly integrate into the
host genome, posing serious safety concerns. Additionally, the many
steps required between transiently transfected pDNA cell entry and
gene expression (nuclear transport of pDNA, transcription, mRNA
transport to the cytoplasm and translation) as well as cell-to-cell
variability in transfection amount make it a relatively noisy
method, which may be not desirable for certain applications.
[0287] Modified mRNA (modRNA). Instead of being produced from
delivered DNA, mRNAs synthesized in vitro have also been
transferred directly into target cells. The use of mRNAs is gaining
interest particularly in therapeutic applications due to its safety
profile (53). The 5' end of endogenous mRNAs in eukaryotic cells is
modified with a 7-methylguanosine cap structure, and their 3' ends
are polyadenylated. These end structures play an essential role in
post-transcriptional processes and facilitate protein production
(54). Modification of pyrimidine residues is also known to enhance
transgene expression from delivered mRNAs mostly because these
modifications to the RNA molecules result in lower stimulation of
the innate immune system of host cells (55). modRNAs used in this
study contain antireverse cap analog and 120-nt poly(A) tail. In
addition, all cytosine and uridine residues are replaced with
5-methylcytosine and pseudouridine.
[0288] Self-replicating RNA (replicon). RNA replicons used in this
study were derived from the single-strand positive-sense RNA
viruses, Sindbis (52) or Venezuelan equine encephalitis
(constructed here) viruses of the Alphavirus genus, Togaviridae
family (30). The entire lifecycle of a positive strand RNA virus
(and thus also the alphavirus) occurs in the cytoplasm of the cell
(30) (FIG. 21). Replicon RNAs used in this study contain a
7-methylguanosine cap, a 5'UTR, an RNA-dependent RNA polymerase
(RdRp) polyprotein P1234 (i.e. nonstructural proteins, nsPs), a
subgenomic promoter element, a variable region of interest from
which a reporter protein or RNA binding protein is expressed, a
3'UTR, and a poly(A) tail (+strand). Once the replicon RNA
(generated by in vitro transcription) is transfected into a cell,
the polyprotein P1234 is translated. Interestingly, P1234 contains
an opal (UGA) stop codon between P123 and nsP4 (the catalytic
subunit of the RdRp) so that .about.90% of the time, translation
terminates after synthesis of P12320. Read-through of the stop
codon and production of P1234 occurs at a frequency of .about.10%.
This regulates the stoichiometry of the components of the RdRp,
which in turn affects the kinetics of viral RNA replication (30).
P1234 is rapidly cleaved into P123 and nsP4 by autoproteolytic
activity originating from the nsP2 (proteinase) portion of the
polyprotein (30). Alphaviral RNA synthesis occurs at the plasma
membrane of a cell, where the nsPs, together with alphaviral RNA,
form membrane invaginations (or "spherules" (42, 43)). These
spherules contain dsRNA created by replication of "+" strand viral
genomic RNA into "- " strand anti-genomic RNA. The "-" strand
serves as a template from which additional "+" strand genomic RNA
(synthesized from the 5'UTR) or a shorter subsequence of the
genomic RNA (termed subgenomic RNA) is synthesized from the
subgenomic promoter region located near the end of the
nonstructural protein ORF. The "+" strand genomic RNA and the
subgenomic RNA are exported out of the spherules into the cytoplasm
where they are translated by endogenous ribosomes. The exported "+"
strand genomic RNA can associate with nsPs and form additional
spherules, thus resulting in exponential increase of replicon RNA.
Several hours following RNA entry into the cell, the rate of
genomic RNA replication drastically decreases as the catalytic
activity of the majority of the existing RdRp complexes changes so
that it is no longer able to synthesize "-" strand RNA (30).
However, "non-cytopathic" mutant replicons such as those used in
this study are capable of persistently replicating own RNA and
expressing proteins(36, 38). While the reason for this is unknown,
it is possible that nascent P1234 polyproteins produced during
later stages of the alphaviral replicon lifecycle can confer "-"
strand RNA synthesis activity to the cell.
[0289] Expression noise with pDNA, modRNA and replicon. Complex
regulatory networks are subject to gene expression noise, resulting
in cell populations exhibiting cell-to-cell variation in protein
levels (56, 57). It has been shown that regulatory motifs, such as
negative feedback loops, acting at transcriptional (58) or
post-transcriptional level (59) may reduce noise in gene
expression, thus conferring robustness to biological processes.
[0290] Since they avoid transcriptional bursting, which is often a
major source of intrinsic noise (57), RNA encoded circuits might
exhibit less variability in protein expression in comparison to
their pDNA counterpart. For this, we analyzed the coefficient of
variation (CV), that is the relative deviation of protein
expression in each cell compared with the population average, which
is used as a measure of noise (57, 59). We computed the CV for
cells where constitutive expression of EGFP was delivered with
pDNA, modRNA, or replicon. A smaller CV corresponds to a tight
distribution centered around the mean, therefore a smaller
cell-to-cell variability; a large CV corresponds to a wide
distribution, indicating larger cell-to-cell variability (59).
Indeed pDNA delivery shows higher CV than modRNA and replicon,
suggesting that RNA based circuits might provide in this
experimental setup more robust gene expression than DNA
counterparts (FIGS. 36A-36B).
[0291] Finally, we created an RNA-based switch circuit in which two
RBPs cross-repress each other to demonstrate two-way signal
transmission and feedback regulation (FIGS. 8E-8H, FIGS. 9C and
27). The general topology of our switch is similar to previously
described bacterial and mammalian transcriptional toggle switches
(31, 32). The switch components include MS2-CNOT7 with two 5'UTR
K-turn motifs and L7Ae with eight repeats of the MS2 binding site
in the 3'UTR. To monitor switch behavior we additionally co-express
(via 2A tags) a blue fluorescent protein (EBFP2) with MS2-CNOT7 and
EYFP with L7Ae. The state of the system can be set with transient
introduction of exogenous siRNA, or alternatively, endogenously
expressed miRNA. We use two artificial and orthogonal siRNAs (FF4
and FF5). For pDNA transfection, when no specific siRNA is present,
both repressors and associated reporters remain at intermediate
levels after 48 hours (FIGS. 8F-8G, FIG. 28). siRNA-FF4 sets the
state to high MS2-CNOT7 (EBFP2) and low L7Ae (EYFP), while
siRNA-FF5 transfection results in the opposite state. The ON/OFF
ratio between the two states is 56-fold for EBFP2 and 59-fold for
EYFP. Since many potential applications of the switch require
longer-term expression, we also encoded the circuit on
self-replicating RNA (FIGS. 8F, 8H, FIGS. 28, 29A-29D, and
30A-30C). Similar to pDNA, siRNA-FF4 and FF5 set the state
effectively, with ON/OFF ratios of 93-fold for EBFP2 and 1718-fold
for EYFP. In the absence of specific siRNA, the replicon-encoded
circuit had stronger bimodality than pDNA. We further explored this
observation using a computational model of the pDNA and
replicon-encoded switch circuits (FIGS. 31A-31B, 32A-32B, 33A-33B,
34, and 35A-35B). Based on literature (33) and our computational
model we hypothesize that in the absence of specific siRNA, initial
pDNA expression of the two switch branches (each encoding an RBP)
is simultaneous (multiple plasmids delivered to the nucleus at the
same time) and results in production of stable proteins. These
remain in the cell at relatively high levels for the duration of
the transfection experiment. In contrast, initial replicon RNA and
replicon-encoded RBP production is more stochastic as single
replicon species are rapidly amplified, typically leading to one of
the two possible states.
[0292] In the absence of siRNA FF4 or FF5, the replicon-based and
plasmid-based switch systems exhibit different behaviors (FIG. 8F).
The replicon-based system seems to fall into a more "mutually
exclusive" distribution fairly soon after transfection, whereas the
plasmid-based system appears to maintain a more unimodal population
at an intermediate state for at least 48 hours.
[0293] To investigate these observations, simple computational
models of the pDNA and replicon systems were implemented and
analyzed. Stochastic simulations using the Gillespie Algorithm were
performed in MATLAB27 using HTCondor queued computer cluster at MIT
Computer Science and Artificial Intelligence Laboratory. The
reaction equations and rates are reported below, and model
schematic diagrams are displayed in FIGS. 31A-31B. Unless otherwise
stated, 96 cell simulations were performed for each parameter set.
To assess the bimodality, or "mutual exclusivity", of the
population of cells that results from these simulations, a Mutual
Exclusivity (MEx) score was developed (FIGS. 32A-32B). As
demonstrated, this score provides useful information for the
analysis of the two systems. The pDNA and replicon systems were
simulated for 48 and 24 hours respectively with the parameter
values listed in Table 6. These simulations resulted in populations
that were qualitatively very similar to FIG. 8F (FIGS.
33A-33B).
TABLE-US-00016 TABLE 6 Theoretical model: reaction rates* Rate
Value or constant Description range Units Source k.sub.TS
Transcription rate 1 min.sup.-1 Schwanhausser et al..sup.48
k.sub.TL Translation rate 8 min.sup.-1 Schwanhausser et al..sup.48,
Mittal et al..sup.49 k.sub.ON,C MS2 binding rate 4e-6 molec.sup.-1
s.sup.-1 Assumed the same as L7Ae k.sub.ON,L L7Ae binding rate 4e-6
molec.sup.-1 s.sup.-1 Saito et al..sup.12 *a k.sub.OFF,C MS2
dissociation rate 0.1 min.sup.-1 Peabody.sup.50 *b k.sub.OFF,L L7Ae
dissociation rate 0.01 min.sup.-1 Saito et al..sup.12 degR RNA
degradation rate 0.002 min.sup.-1 Schwanhausser et al..sup.48 degP
Protein degradation rate 5e-4 min.sup.-1 Schwanhausser et
al..sup.48 CNOT7 degradation factor 400 This study (FIG. 10E) *c
L7Ae translational repression factor 3e-3 This study (FIG. 10C) *d
P0 Starting pDNA copy number (each) 100 molec Middleton et
al..sup.51 R0 Starting replicon copy number (each) .sup.
10.sup.1:10.sup.2.5 molec Beal et al..sup.52 k.sub.TR Replicon
transport and RF formation rate 10.sup.-2.5:10.sup.-1 min.sup.-1 *e
RF transport inhibition fraction .sup. 0:1 (1 = no blocking, 0 =
complete blocking) Genomic fraction of positive synthesized
10.sup.-3.5:10.sup.-2 This study (FIGS. 22A-22E)*f strands *For all
calculations involving molar to molecule conversions, the cell
volume is assumed to be 3e-12L. *a: K.sub.d of L7Ae binding is
~1e-9M.sup.5 and k.sub.on = k.sub.off/K.sub.d. *b: K.sub.d of MS2
binding is 1e-8M.sup.13 and k.sub.off = K.sub.d * k.sub.on. *c:
From FIG. 10E, we have an expression decrease of ~35 fold at
saturation. The degradation factor was tuned to achieve this fold
expression decrease. *d: From FIG. 10C, one L7Ae bound reduces
expression to ~0.3% *e: Lower and upper bounds were picked so that
fastest overall initial rates (k.sub.TR * R0) would be on the order
of seconds and the slowest would be on the order of hours *f: Upper
bound was calculated from qPCR data. The fraction of formation rate
of genomic strands to subgenomic + genomic was found from fitting
the qPCR curves after the point at which negative strand synthesis
ceases.
[0294] First, to better understand the nature of the unimodal state
achieved by the pDNA system, several of the parameter values were
varied. The resulting behavioral trends are shown in FIG. 34. When
either the starting copy number (P0) or the transcription rate
(kTS) is set to lower values, the system becomes more mutually
exclusive. This implies that this state might be due to a high and
simultaneous burst of expression from both the L7Ae and MS2-CNOT7
plasmids, which express stable proteins. To investigate this, the
variance-to-mean ratio (VMR), also known as the index of
dispersion, of the distribution from which the starting plasmid
copy number was selected was varied to allow for greater degree of
initial bias. Since PO follows a Poisson distribution with VMR=1,
this was achieved by selecting from a Poisson distribution with
mean=P0/VMR and then multiplying that value by the VMR. In this
way, the mean of the distribution stays the same but the variance
is increased. Increasing the VMR led to a higher degree of initial
bias, causing a large increase in bimodality even when the initial
copy number is kept high. In addition to the simultaneous burst of
expression, this seemingly unstable state can be maintained for
some time due to the slow switching rate, which is greatly
influenced by the degradation rate of the proteins. To demonstrate
this, we also increased the degradation rate, which causes an
increased MEx score.
[0295] The next question to investigate was why the replicon system
does not go through this high/high state. Based on the results from
the pDNA analysis, we hypothesized that the replicon system either
avoids the simultaneous burst of expression or it has a faster
switching time due to the feedback mechanisms involved in the first
few hours post-infection (ongoing negative strand synthesis). As
depicted in FIGS. 31A-31B, the computational model of the replicon
system essentially mirrors the pDNA system after the 4 hour time
point when negative strand synthesis ceases. Therefore, for
computational simplicity, we chose to simulate the replicon system
for just 4 hours post-infection in our analysis. Sample simulations
were also run for 24 hours to verify this simplification. In our
simulations, we carefully analyzed the parameters involved in both
of these hypotheses: the starting replicon copy number (R0), the
transport rate (kTR), the transcription rate (kTS), positive
feedback (.epsilon.), and replication inhibition (.beta.), and how
the system responds to changes in each of these parameters.
[0296] We performed global sensitivity analysis by randomly
sampling 2000 parameter sets from the log-transformed realistic
parameter space (Table 6). FIG. 35A shows the MEx scores when each
of the parameters is varied 1.5 decades within its realistic set of
values. Each point represents the distribution of 96 cell
simulations for one random parameter set. FIG. 35B shows heat maps
of the MEx scores for parameter pairs plotted together to identify
parameter interactions. From these results, it appears that the
stochasticity of replicon transport and spherule formation plays a
major role in the dynamics of the system. In fact, the feedback
mechanisms would not even be possible without the independent
nature of this process, which distinguishes it from the pDNA
system. However, FIG. 35B indicates that the system is fairly
insensitive to the strength of the feedback mechanisms (.beta. and
.epsilon.). Even at low kTR where replication inhibition (.beta.)
would have the most effect, we see no correlation with the MEx
score. This is consistent with our experiments where we also find
that L7Ae does not inhibit replication (FIGS. 30A-30C). To our
knowledge there is no evidence that the binding of RBPs such as
L7Ae to replicons affects formation of spherules. However,
MS2-CNOT7 degradation of genomic RNA is likely. The positive
feedback (.epsilon.) due to + genomic strand synthesis also has no
effect on the bimodality of the system in our simulations.
[0297] There is, however, a strong relationship between mutual
exclusivity and both R0 and kTR, the initial replicon copy number
and the transport rate. Both relate to the independent and
stochastic nature of spherule formation. Decreasing either R0 or
kTR leads to an increase in MEx score. This occurs because
stochasticity in the transport reaction increases, allowing an
initial bias in replication. As expected, their effects are also
correlated (FIG. 35B). These results are also biologically
relevant. The transport of replicons to the plasma membrane for
spherule formation and negative strand synthesis is carried out by
the nonstructural protein P1234, which is translated only when the
opal codon is read thru (about 10% of the time). This low level of
active protein could lead to initially slow and stochastic
transport events, especially when the number of transported species
is low. Additionally, our electroporation experiments indicate that
there is a delay in protein expression, when delivered gene is
encoded on replicon as compared to pDNA (assuming same delivery
method, FIGS. 26A-26C), which implies that spherule formation may
take a significant amount of time. Lastly, our qPCR results and a
related publication (52) suggest that the starting number of
replicons per cells in our electroporation experiments may be in
the low tens while literature indicates that transfected pDNA
copies are in the high tens to hundreds (61, 62). Additionally,
bimodality is further amplified by an increase in transcription
rate for the replicon system (which is in contrast to the pDNA case
where higher transcription rate decreases bimodality). Here,
however, increased transcription serves as an amplification of the
initial bias caused by transport delay. In general, alphaviruses
are able to replicate very quickly (30), so this computational
result is biologically realistic.
[0298] Overall, these results suggest that the individualized and
stochastic nature of spherule formation and transport results in an
initial bias in replication. The resulting bimodality can be
realized in the first four hours postinfection. The effects are
amplified by an increase in stochasticity through a decrease in
replicon copy number, and by a fast replication rate (kTS). These
differences in dynamics are likely to have important implications
when using replicons in synthetic biology circuits, especially when
the expression timing of various species is important to circuit
functionality.
[0299] To our knowledge no previous study has shown that complex
cellular logic can be encoded exclusively at the
post-transcriptional level in mammalian cells, offering potentially
signifficant benefits for in vivo applications. This is made
possible through the use of RBPs, which can act as both the input
and the output of a regulatory device, and are promising candidates
for creating scalable and modular control and information
processing circuits. Our engineered circuits are functional when
encoded either on modified mRNA (transient response) or
self-replicating RNA (prolonged circuit operation). The inherently
transient nature of RNA makes it an appealing platform for
applications where safety is a primary concern, as RNA circuits
could be programmed to act for a defined period of time and do not
leave a long-term genetic footprint. Additionally, the different
expression dynamics, lifetime (FIGS. 19A-19F, 20A-20F, 22A-22E,
23A-23C) and possibly noise properties (FIGS. 36A-36B) of modRNA
and replicon delivery provide further potential for circuit design.
Finally, the application of our RNA-only multi-input cell
classifier circuit for specific induction of apoptosis, potentially
concise formulation (two RNA species in case of the classifier) and
its safety characteristics (transient expression and no chromosomal
integration) make this a promising framework for future in vivo
applications.
REFERENCES FOR EXAMPLES 1 AND 2
[0300] 1. Van Tendeloo, V. F., Ponsaerts, P. & Berneman, Z. N.
mRNA-based gene transfer as a tool for gene and cell therapy.
Current opinion in molecular therapeutics 9, 423-431 (2007). [0301]
2. Tavernier, G. et al. mRNA as gene therapeutic: how to control
protein expression. Journal of controlled release: official journal
of the Controlled Release Society 150, 238-247 (2011). [0302] 3.
Wang, Y. et al. Systemic delivery of modified mRNA encoding herpes
simplex virus 1thymidine kinase for targeted cancer gene therapy.
Molecular therapy: the journal of the American Society of Gene
Therapy 21, 358-367 (2013). [0303] 4. Warren, L. et al. Highly
efficient reprogramming to pluripotency and directed
differentiation of human cells with synthetic modified mRNA. Cell
stem cell 1, 618-630 (2010). [0304] 5. Kormann, M. S. et al.
Expression of therapeutic proteins after delivery of chemically
modified mRNA in mice. Nature biotechnology 29, 154-157 (2011).
[0305] 6. Kramps, T. & Probst, J. Messenger RNA-based vaccines:
progress, challenges, applications. Wiley interdisciplinary
reviews. RNA (2013). [0306] 7. Yoshioka, N. et al. Efficient
generation of human iPSCs by a synthetic self-replicative RNA. Cell
stem cell 13, 246-254 (2013). [0307] 8. Geall, A. J., Mandi, C. W.
& Ulmer, J. B. RNA: The new revolution in nucleic acid
vaccines. Seminars in immunology 25, 152-159 (2013). [0308] 9.
Khalil, A. S. & Collins, J. J. Synthetic biology: applications
come of age. Nature reviews. Genetics 11, 367-379 (2010). [0309]
10. Aubel, D. & Fussenegger, M. Mammalian synthetic
biology--from tools to therapies. BioEssays: news and reviews in
molecular, cellular and developmental biology 32,332-345 (2010).
[0310] 11. Benenson, Y. Synthetic biology with RNA: progress
report. Current opinion in chemical biology 16, 278-284 (2012).
[0311] 12. Saito, H. et al. Synthetic translational regulation by
an L7Ae-kink-turn RNP switch. Nature chemical biology 6, 71-78
(2010). [0312] 13. Weidmann, C. A. & Goldstrohm, A. C.
Drosophila Pumilio protein contains multiple autonomous repression
domains that regulate mRNAs independently of Nanos and brain tumor.
Molecular and cellular biology 32, 527-540 (2012). [0313] 14. Endo,
K., Stapleton, J. A., Hayashi, K., Saito, H. & Inoue, T.
Quantitative and simultaneous translational control of distinct
mammalian mRNAs. Nucleic acids research 41, e135 (2013). [0314] 15.
Xie, Z., Wroblewska, L., Prochazka, L., Weiss, R. & Benenson,
Y. Multi-input RNAi-based logic circuit for identification of
specific cancer cells. Science 333, 1307-1311 (2011). [0315] 16.
DD-Shield Domain Sequence Mammalian Codon Optimized and Adapted
from: L A Banaszynski, et al. "A Rapid, Reversible, and Tunable
Method to Regulate Protein Function in Living Cells Using Synthetic
Small Molecules." Cell, 2006, 126, 995-1004. [0316] 17. Shield
ligand (Clontech): www.clontech.com /US/Products /Inducible
Systems/Inducible Prote in Stabilization/Shield1 Guard 1 [0317] 18.
DD-Guard Domain sequence: M Iwamoto et al. "A general chemical
method to regulate protein stability in the mammalian central
nervous system." Chemistry & Biology 2010, 17, 981-988. [0318]
19. Guard ligand (Trimethoprim) (Sigma Aldrich):
www.sigmaaldrich.com/catalog/product/sigma
/t7883?lang=en®ion=US [0319] 20. Goldfless S. J., et al.
Direct and specific chemical control of eukaryotic translation with
a synthetic RNA-protein interaction. Nucl. Acids Res. (2012)
Vol.40, No 9. [0320] 21. Sahin, U., Kariko, K. & Tureci, O.
mRNA-based therapeutics--developing a new class of drugs. Nat Rev
Drug Discov 13, 759-780 (2014). [0321] 22. An, C. I. Artificial
control of gene expression in mammalian cells by modulating RNA
interference through aptamer-small molecule interaction. RNA 12,
710-716 (2006). [0322] 23. Culler, S. J., Hoff, K. G. & Smolke,
C. D. Reprogramming cellular behavior with RNA controllers
responsive to endogenous proteins. Science 330, 1251-1255 (2010).
[0323] 24. Auslander, S. et al. A general design strategy for
protein-responsive riboswitches in mammalian cells. Nature Methods
11, 1154-1160 (2014). [0324] 25. Rodrigo, G., Landrain, T. E. &
Jaramillo, A. De novo automated design of small RNA circuits for
engineering synthetic riboregulation in living cells. Proc. Natl.
Acad. Sci. U.S.A. 109, 15271-15276 (2012). [0325] 26. Green, A. A.,
Silver, P. A., Collins, J. J. & Yin, P. Toehold switches:
de-novo-designed regulators of gene expression. Cell 159, 925-939
(2014). [0326] 27. Qian, L. & Winfree, E. Scaling up digital
circuit computation with DNA strand displacement cascades. Science
332, 1196-1201 (2011). [0327] 28. Auslander, S., Auslander, D.,
Muller, M., Wieland, M. & Fussenegger, M. Programmable
single-cell mammalian biocomputers. Nature 487, 123-127 (2012).
[0328] 29. Van Etten, J. et al. Human Pumilio proteins recruit
multiple deadenylases to efficiently repress messenger RNAs. J.
Biol. Chem. 287, 36370-36383 (2012). [0329] 30. Strauss, J. H.
& Strauss, E. G. The alphaviruses: gene expression,
replication, and evolution. Microbiol Rev 58, 491-562 (1994).
[0330] 31. Gardner, T. S., Cantor, C. R. & Collins, J. J.
Construction of a genetic toggle switch in Escherichia coli. Nature
403, 339-342 (2000). [0331] 32. Kramer, B. P. et al. An engineered
epigenetic transgene switch in mammalian cells. Nat Biotechnol 22,
867-870 (2004). [0332] 33. Mortimer, I. et al. Cationic
lipid-mediated transfection of cells in culture requires mitotic
activity. Gene Ther. 6, 403-411 (1999). [0333] 34. Azizgolshani,
O., Garmann, R. F., Cadena-Nava, R., Knobler, C. M. & Gelbart,
W. M. Reconstituted plant viral capsids can release genes to
mammalian cells. Virology 441, 12-17 (2013). [0334] 35. Lustig, S.
et al. Molecular basis of Sindbis virus neurovirulence in mice. J.
Virol. 62, 2329-2336 (1988). [0335] 36. Frolov, I. et al. Selection
of RNA replicons capable of persistent noncytopathic replication in
mammalian cells. J. Virol. 73,3854-3865 (1999). [0336] 37. Beal, J.
et al. Model-driven engineering of gene expression from RNA
replicons. ACS Synth Biol 4, 48-56 (2015). [0337] 38. Petrakova, O.
et al. Noncytopathic replication of Venezuelan equine encephalitis
virus and eastern equine encephalitis virus replicons in Mammalian
cells. J. Virol. 79, 7597-7608 (2005). [0338] 39. Szymczak, A. L.
et al. Correction of multi-gene deficiency in vivo using a single
`self-cleaving` 2A peptide-based retroviral vector. Nat Biotechnol
22, 589-594 (2004). [0339] 40. Stewart, S. A. et al.
Lentivirus-delivered stable gene silencing by RNAi in primary
cells. RNA 9, 493-501 (2003). [0340] 41. Rechsteiner, M. &
Rogers, S. W. PEST sequences and regulation by proteolysis. Trends
in Biochemical Sciences 21,267-271 (1996). [0341] 42. Frolova, E.
I., Gorchakov, R., Pereboeva, L., Atasheva, S. & Frolov, I.
Functional Sindbis virus replicative complexes are formed at the
plasma membrane. J. Virol. 84, 11679-11695 (2010). [0342] 43.
Kallio, K. et al. Template RNA length determines the size of
replication complex spherules for Semliki Forest virus. J. Virol.
87,9125-9134 (2013). [0343] 44. Nechushtan, A., Smith, C. L., Hsu,
Y. T. & Youle, R. J. Conformation of the Bax C-terminus
regulates subcellular location and cell death. EMBO J. 18,2330-2341
(1999). [0344] 45. Livet, J. et al. Transgenic strategies for
combinatorial expression of fluorescent proteins in the nervous
system. Nature 450,56-62 (2007). [0345] 46. Ai, H.-W., Shaner, N.
C., Cheng, Z., Tsien, R. Y. & Campbell, R. E. Exploration of
new chromophore structures leads to the identification of improved
blue fluorescent proteins. Biochemistry 46,5904-5910 (2007). [0346]
47. Shcherbo, D. et al. Bright far-red fluorescent protein for
whole-body imaging. Nature Methods 4,741-746 (2007). [0347] 48.
Schwanhausser, B. et al. Global quantification of mammalian gene
expression control. Nature 473,337-342 (2011). [0348] 49. Mittal,
N., Roy, N., Babu, M. M. & Janga, S. C. Dissecting the
expression dynamics of RNA-binding proteins in posttranscriptional
regulatory networks. Proc. Natl. Acad. Sci. U.S.A. 106,20300-20305
(2009). [0349] 50. Peabody, D. S. The RNA binding site of
bacteriophage MS2 coat protein. EMBO J. 12,595-600 (1993). [0350]
51. Middleton, T. & Sugden, B. Retention of plasmid DNA in
mammalian cells is enhanced by binding of the Epstein-Barr virus
replication protein EBNA1. J. Virol. 68, 4067-4071 (1994). [0351]
52. Beal, J. et al. Model-driven engineering of gene expression
from RNA replicons. ACS Synth Biol 4, 48-56 (2015). [0352] 53.
Pascolo, S. Vaccination with messenger RNA. DNA Vaccines, Methods
Mol Med. 127, 23-40 (2006). [0353] 54. Gallie, D. R. The cap and
poly(A) tail function synergistically to regulate mRNA
translational efficiency. Genes Dev. 5, 2108-2116 (1991). [0354]
55. Anderson, B. R. et al. Incorporation of pseudouridine into mRNA
enhances translation by diminishing PKR activation. Nucleic Acids
Research 38, 5884-5892 (2010). [0355] 56. Pedraza, J. M. & van
Oudenaarden, A. Noise propagation in gene networks. Science 307,
1965-1969 (2005). [0356] 57. Chalancon, G. et al. Interplay between
gene expression noise and regulatory network architecture. Trends
Genet. 28, 221-232 (2012). [0357] 58. Shimoga, V., White, J. T.,
Li, Y., Sontag, E. & Bleris, L. Synthetic mammalian transgene
negative autoregulation. Molecular Systems Biology 9, 670 (2013).
[0358] 59. Siciliano, V. et al. MiRNAs confer phenotypic robustness
to gene networks by suppressing biological noise. Nat Commun 4,
2364 (2013). [0359] 60. MATLAB and Statistics Toolbox Release
2013b, The MathWorks, Inc., Natick, Mass., United States. [0360]
61. Cohen, R. N., van der Aa, M. A. E. M., Macaraeg, N., Lee, A. P.
& Szoka, F. C. Quantification of plasmid DNA copies in the
nucleus after lipoplex and polyplex transfection. Journal of
controlled release 135, 166-174 (2009). [0361] 62. Bleris, L. et
al. Synthetic incoherent feedforward circuits show adaptation to
the amount of their genetic template. Molecular Systems Biology 7,
1-12 (2011).
Example 3
Synthetic RNA Circuits as a Vaccination Platform
[0362] The creation of a safe and cost-effective
prophylactic/therapeutic vaccine which can induce potent
broadly-neutralizing antibody (bNAb) and cytotoxic T lymphocyte
(CTL) responses is urgently needed to end the global HIV/AIDS
epidemic. Here we hypothesize that a programmable RNA
replicon-based vaccination platform developed through a
collaboration between the Weiss and Irvine groups may be used to
effectively support this goal by precisely engineering and
optimizing the kinetics of antigen/adjuvant expression.
Rationale and Preliminary Data
[0363] In vitro transcribed RNA as a vaccine platform is cheaper
and easier to manufacture than recombinant proteins and safer than
DNA to administer to patients due to the low risk of potentially
harmful integration of the vector into the genome (Sahin et al.
2014). Furthermore, vaccination can be readily scaled-up to humans
using synthetic lipid nanoparticle (LNP)-based delivery systems
(Sahin et al. 2014). Previously, we demonstrated that the
expression of a firefly luciferase (fluc) reporter gene from our
Venezuelen Equine Encephalitis (VEE) Virus-based self-replicating
RNA replicon vector can be prolonged by packaging it into a
cationic LNP (FIG. 37A). Strikingly, we found that the sole
injection of an LNP-packaged RNA replicon encoding a "long peptide"
antigen derived from SIV gag elicited a strong CTL response in
mice, likely due to the extended translational capability and
"self-adjuvanting" properties of the replicon (FIG. 37B). Thus, our
replicon platform is ideally suited to inducing cellular immune
responses against rationally engineered peptide epitopes based on
regions of HIV Gag in which mutations impose a high fitness cost
according to "quantitative viral fitness landscape" models
(Ferguson et al. 2013, Dahirel et al. 2011).
[0364] The quality and durability of immune responses elicited by
vaccination can be dramatically impacted by the kinetics with which
the immune system is exposed to antigen and adjuvant cues, yet
vaccine kinetics are not typically engineered by immunization. For
example, it had been previously shown that the augmentation of
humoral responses against HIV-1 gp120 by expression of a cytokine
(IL-2/Ig) requires the cytokine vector to be injected two to five
days after injection of the antigen expressing vector and not
before or coincident with the antigen vector (Barouch et al. 1998).
Furthermore, we and others have shown that CTL and antibody
responses can be drastically improved by exponential dosing and
exposure of antigens to the immune system (Johansen et al. 2008 and
unpublished results; FIG. 37C). Finally, it had been recently shown
that sequential (as opposed to simultaneous) exposure of variant
gp120 antigens to the immune system can prevent frustration of
affinity maturation and induce cross-reactive HIV antibodies (Wang
et al. 2015). One practical way to implement an actual vaccination
scheme with such optimized antigen/adjuvant exposure patterns may
be to program these behaviors onto an RNA replicon using our RNA
binding protein (RBP)-based composable synthetic gene circuit
platform. Using this platform, we previously created various
synthetic gene circuits including toggle switches and small
molecule-regulatable ON/OFF switches and cascades in vitro and/or
in vivo (Wroblewska et al. in press and unpublished results; FIGS.
37D-37G). These results serve as the foundation for the engineering
of programmable vaccines that may drastically improve the
humoral/cellular immune response against HIV and provide protection
against the virus as proposed below.
Engineering Delayed Expression of Adjuvants for Immune Response
Augmentation
[0365] The expression of cytokines such as IL-2/Ig, IL-12/Ig,
IL-15/Ig can be used to significantly enhance an immune response
against an antigen, however, the timing of cytokine expression in
relation to antigen expression must be carefully tuned. Here, we
propose to program the optimal adjuvant expression kinetics
(expression of adjuvant two to seven days after antigen expression)
into our replicon vaccine using the small molecule-regulated OFF
switch shown in FIG. 37F. Translation of the adjuvant is inhibited
by binding of an RBP (L7Ae) to an RNA motif (K-turn) positioned in
the 5'UTR of the adjuvant. A destabilizing domain (DDd), which
confers instability to the protein of interest that it is fused to,
is attached to L7Ae to target it for proteasome-mediated
degradation. Degradation of L7Ae can be prevented by binding of
trimethoprim (TMP), an FDA-approved small molecule drug, to DDd.
Sustained local release of TMP is achieved by encapsulating TMP in
PEG-b-PLGA, a surfactant-like amphiphilic block copolymer. TMP
release kinetics can be tuned by adjusting the size of the
PEG-b-PLGA nanoparticle by modifying the chain length and
composition of the polymer. A schematic of the proposed programmed
delayed adjuvant vaccine experiment is shown in FIG. 38A.
Engineering Exponential Prime/Boost Expression of Antigens for an
Improved Immune Response
[0366] Our programmable RNA replicon platform presents a practical
means to provide the ideal (exponential) exposure pattern of an
antigen (FIG. 37C) to the immune system of a patient. Using the
TMP-regulated OFF switch described above (FIG. 37F), the prime and
boost expression patterns of gag sequences which focus on
"vulnerable regions" of the virus as described above (Ferguson et
al. 2013, Dahirel et al. 2011) are modulated and CD4 binding
site-presenting gp120 antigens are modeled by administering TMP
through the drinking water of mice as show in FIG. 38B. T-cell and
antibody responses are monitored over time. Promising results from
this experiment as well as the nanoparticle-mediated TMP release
experiment above justify future investment in the development of
more sophisticated TMP release strategies to enable fully automated
programmed exponential prime/boost expression of the gag peptide
antigen.
Engineering Sequential Expression of Antigens for Induction of
Cross-Reactive Antibodies
[0367] In order to test whether it is possible to program the
sequential expression of rationally designed gp120 immunogens to
guide the immune system to induce cross-reactive antibodies focused
on the conserved CD4 binding site, a "stripped core" gp120
immunogen and a variant gp120 immunogen containing mutations
outside of the CD4 binding site (Wang et al. 2015) are encoded on
the small molecule-regulated replicon cascade shown in FIG. 37G.
This cascade involves two small molecule-regulatable RBPs: DDd-L7Ae
described above and the TetR protein designed to bind the TetR RNA
aptamer sequence to repress translation. TetR binding to the
aptamer can be derepressed using doxycycline (Dox). Therefore,
administration of TMP and Dox first induces the expression of the
stripped core gp120 immunogen and subsequent withdrawal of the two
small molecules represses the translation of the stripped core and
inducse the expression of the variant gp120 immunogen as described
in FIG. 38C. The successful implementation of this strategy leads
to engineering more sophisticated replicon circuits that enable
fully automated sequential expression of more gp120 variants to
further expand the breadth of antibody cross-reactivity.
Example 4
High-Throughput Assembly Platform for Fine-Tuned Expression of
Multiple Genes from RNA Replicons using Multiple Subgenomic
Promoters
General Purpose
[0368] Self-amplifying RNA replicons are an attractive alternative
to traditional nucleic acid based expression platforms, providing
relatively high, sustained expression compared to non-replicating
RNA, without the risk of genomic integration associated with
DNA-based therapies. When expressing multiple genes, encoding these
genes on a single replicon is an attractive alternative to
co-transfection. Here, we propose a comprehensive strategy for the
assembly and characterization of multi-gene replicon. In order to
control expression of multiple genes from a single Venezuelan
Equine Encephalitis (VEE) replicon, we created a library of
subgenomic promoters (SGPs) of varying strengths, both higher and
lower than the wild type VEE SGP. We found that introducing
additional 3'-UTR sequences between translational units also
significantly increased expression. Finally, we adapted a Modular
Cloning (MoClo) assembly strategy for VEE replicons, demonstrating
controlled expression from one hundred and forty different two and
three SGP variants expressing fluorescent proteins.
Technical Description
[0369] Interest has been growing in RNA replicons as an alternative
to standard DNA-based gene delivery methods.sup.1 Replicons are not
only self-amplifying, but are also regarded as safer than competing
gene delivery technologies, making replicons attractive for medical
applications such as vaccine delivery, gene therapy, and cellular
reprogramming..sup.2-4 Because they are self-amplifying, replicons
can generate higher expression of a gene from a relatively low
initial dose, compared to non-replicating RNA. Moreover, with
regard to safety, replicons remain in the cytoplasm of the cell, so
the risk of undesired integration into the genome is
minimal..sup.5-6
[0370] We have previously demonstrated that expression of multiple
genes from co-transfected replicons can be modeled and predicted
with a high degree of precision..sup.7 However, there are
disadvantages associated with the use of multiple replicons for
gene delivery. First, a cell must contain at least one copy of each
replicon if more than one gene is required for a given therapy or
any type of regulation. In addition, we have found that after three
days, in those cells that are co-transfected with two replicons,
there is a gradual decrease in the number of double positive cells,
preventing sustained regulation using multiple replicons, as shown
in FIGS. 47A-47B.
[0371] In order to have controlled expression of multiple genes
from a single replicon, we needed to independently affect
translation of each gene. At the RNA level, this was achieved
creating a library of Venezuelan Equine Encephalitis (VEE).sup.8
subgenomic promoters (SGPs) of varying strengths, both higher and
lower than the wild type VEE SGP. We also experimented with other
means, such as introducing additional 3'-UTR sequences between
translational units, which had a significant effect on expression.
To truly characterize multi-gene replicons and understand how these
components affect expression, we adapted a Modular Cloning (MoClo)
assembly strategy for VEE replicons and generated all combinations
of two and three SGP constructs expressing fluorescent proteins,
using low, midrange, and high strength SGPs with and without
3'UTRs.
Controlling Expression using Subgenomic Promoters and Additional
3'UTRs
[0372] A subgenomic promoter library was created for VEE replicon
by truncating the full length SGP from either the plus or minus
side. The SGP library was tested in a tandem format, depicted in
FIG. 48, to prevent any deletions to nsP4, as the base pairs
comprising the minus side of the SGP are located in the coding
region of the nsP4 protein. The first SGP, governing expression of
the fluorescent protein mVenus, was held constant at the
full-length, -241/+30 SGP..sup.8 Our library of 27 truncated SGPs
was placed before the second translational unit expressing mKate.
As shown in FIG. 48 and enumerated in Table 7, modulation of the
SGP can result in a 15-fold dynamic range in protein expression
ranging from -241/+4 (weakest) to -241/+15 (strongest). The
experiment was repeated using mKate under control of the first SGP
and mVenus under control of the second, which gave the same outcome
(data not shown), proving these results were not protein dependent.
There are a few things to note regarding this data. First, some of
our newly generated SGPs express higher than the wild type SGP.
Second, a wide range of expressions can be gathered using only plus
side deletions, meaning that these SGPs may also be used for single
SGP constructs, as they would not interfere with nsP4 function.
Finally SGP -241/+1 showed expression only two-fold above
background, and was not considered when calculating the dynamic
range of our library.
TABLE-US-00017 TABLE 7 mKate Fluorescence Levels using SGP Library
SGP mKate 241-1 0.01 241-4 0.09 241-2 0.13 241-3 0.15 241-14 0.32
241-5 0.34 19-30 0.34 241-13 0.35 241-6 0.38 241-11 0.43 25-30 0.47
241-12 0.60 31-30 0.60 241-20 0.62 41-30 0.71 51-30 0.72 241-26
0.76 241-17 0.83 121-30 0.87 241-21 0.87 61-30 0.89 241-30 0.90
181-30 0.92 241-19 0.95 mKate 1.00 Ctrl 241-18 1.02 241-16 1.14
241-15 1.48
[0373] Another particularly important finding from this experiment
was the effect of position on expression, i.e. expression from the
second unit is 8 times stronger than expression from the first unit
when using two full-length -241/+30 SGPs. As a first attempt to
overcome this disparity, an additional 3'UTR was inserted in
between the translational units because it is known to play a role
in minus strand RNA synthesis..sup.9 As shown in FIG. 49,
expression from the first translational unit increased 8-fold,
demonstrating that additional 3'UTRs could be another means of
controlling expression.
[0374] Because the SGP library could be generated by mutating only
the positive side of the SGP, we next set out to validate the
results from the tandem library in a single SGP setting. We chose
three SGPs with 5, 30, and 15 base pairs on the positive side,
representing low, midrange, and high SGPs, respectively. However,
our initial round of experiments did not show the same expression
pattern as we observed in a tandem format. Specifically, SGPS,
which was the weakest of the three in tandem, was now the
strongest, as shown on the left side of FIG. 50. We hypothesized
that the XbaI and attb1 sites, which were present for cloning
purposes and immediately downstream of the SGP, were affecting
expression. To test this hypothesis, we also designed two
additional single SGP constructs. First, we added a 6 base pair
AscI scar, a remnant from the tandem SGP library cloning process,
upstream of the SGP. We also created a construct in which the SGP
was followed immediately by the Kozak sequence. As shown in FIG.
48, both of these constructs showed a similar expression pattern to
that observed using a tandem format, proving that the XbaI-attb1
sequence was directly influencing expression. The following MoClo
assembly strategy allows our SGP library to be followed immediately
by a Kozak, an orientation that gave us the largest dynamic range,
and potentially limits variability.
MoClo Assembly of VEE Replicons
[0375] We have demonstrated that expression of multiple genes from
a replicon can be modulated using SGPs, additional 3'UTRs, and
position. However, to more comprehensively characterize expression
of two or more genes launched from a single replicon, a more
efficient, preferably scarless, assembly strategy was necessary. As
shown in FIG. 51, a MoClo assembly method was adapted that divided
each translational unit into three parts: a sub-genomic promoter
(SGP), open reading frame (ORF), and 3'-untranslated region
(3'UTR). Each of the parts was placed in a Level 0 vector and
flanked by BsaI recognition sites. BsaI is a Type IIS restriction
enzyme, so it recognizes a sequence but cleaves downstream of the
recognition site, allowing for scarless assembly. The Level 0's are
combined into a Level 1 vector to form a single translational unit,
using conserved sequences in between the SGP, ORF, and 3'UTR.
Finally, Level 1's are combined into the replicon backbone using a
second Type IIS enzyme, SapI, to form the final Level 2 product, a
functional multi-unit replicon.
[0376] The following is a sequence level description of the
Replicon MoClo Assembly, beginning with the various Level 0
destination vectors. These Level 0 destination vectors were made
for use with either of the following Type IIS enzymes: SapI or
BbsI. SapI has a 7-base pair (bp) recognition site and a 3-bp
overhang while BbsI has a 6-bp recognition site and a 4-bp
overhang. Typically, we mutate BsaI and SapI sites within any new
ORFs to make the Level 0.fwdarw.1 and Level 1.fwdarw.2 reactions
more efficient, respectively, but this is not required if a final
ligation step is added to the MoClo reaction. Our SGP library and
the VEE 3'UTR do not contain recognition sites for either of these
enzymes, so this problem most commonly arises with ORFs, although
introduction of aptamer sequences or modified 3'UTRs should also be
considered. The Level 0 destination vectors contain Ampicillin
resistance, with the BsaI site in the AmpR gene mutated to
facilitate a more efficient Level 0.fwdarw.1 reaction. In addition,
we have mutated the BsaI site in the ccdB gene, allowing us to also
create Level 0's via a digest/ligation reaction with BsaI, which is
very efficient because the ccdB gene kills the cells that do not
receive the insert.
[0377] Each Level 0 destination vector is shown below, along with
an example of how to insert a given unit (SGP, ORF, or UTR).
[0378] Once a library of SGPs, ORFs, and UTRs is established, one
can combine Level 0's to make Level 1's, which are individual
translational units. However, as we have shown, position on the
replicon has a significant effect on expression, so the Level 1
destination vectors must also contain information on the
translational unit's position in the final construct. In addition,
some units have 3'UTR sequences while others do not. Finally, we
have previously established (data not shown) that a truncated El
structural protein is essential for replication, so the final
(3'-most) translational unit must end with an E1-3'UTR sequence.
These constraints leave us with the following seven Level 1
destination vectors (Table 8, FIG. 53):
TABLE-US-00018 TABLE 8 Level 1 destination vectors. Position Type
of Level 2 3'UTR (Y/N) Destination Vector P1 Tandem or Triple SGP
Yes TW322 P1 Tandem or Triple SGP No TW323 P1 Single SGP Yes TW324
P2 Triple Yes TW325 P2 Triple No TW326 P2 Tandem Yes TW327 P3
Triple Yes TW328
[0379] Notice that for a single translation unit, this strategy is
cumbersome, requiring two rounds of reactions: first combining SGP,
ORF, and E1-3'UTR into a Level 1 and then inserting this single
translational unit into a Level 2. To speed up cloning for single
gene replicon, we have also created Level 0S, as shown below. These
Level 0S can be combined directly into a Level 2 to test the
function of a specific ORF before more in depth characterization.
After such characterization, the Level 0S can easily be transferred
to Level 0 (using SapI) for use with the MoClo strategy above. Note
that Level 0S have Kanamycin resistance similar to Level 1
vectors.
Characterization Strategy for Multi-Gene Expression
[0380] Using this MoClo-based assembly strategy, were able to
construct over 250 different multi-unit replicons in under a month.
Over 75% of the created constructs sequenced correctly from a
single colony, with 100% correct after picking 3 colonies. One
hundred and forty of these constructs, a fraction of which are
shown in FIG. 52, were created to characterize constitutive
expression from two and three subgenomic promoter systems. From
this data, we see that physical position on the replicon is perhaps
the most important consideration with regard to expression level,
but expression can also be controlled via SGP strength and
additional 3'UTR sequences. However, modulating SGP strength and
introducing additional 3'UTR sequences can be used to control
expression only to a certain extent. Presumably, as more SGPs are
added, expression from the 5'-most translational units continues to
decline.
Advantages and Improvements of Existing Methods, Devices, or
Materials
[0381] We have demonstrated that we are able to modulate expression
of multiple genes from a single replicon using position, a novel
SGP library, and through incorporation of additional 3'UTR
sequences. Coupled with our MoClo assembly strategy we are able to
efficiently construct and characterize large libraries of
construct. There has recently been a large amount of interest in
self-replicating RNA, but such characterization has yet to occur
for VEE or any other alphavirus replicon. Using this
characterization, prediction and rational design of multi-gene
replicons based upon the desired expression is provided.
REFERENCES FOR EXAMPLE 4
[0382] (1) Lundstrom, K. (2009) Alphaviruses in Gene Therapy.
Viruses 1, 13-25. [0383] (2) (2012) Alphavirus Vectors in Vaccine
Development. J Vaccines Vaccin 3. [0384] (3) (2000) Evaluation of
recombinant alphaviruses as vectors in gene therapy. Publ. Online
07 Mar. 2000 Doi101038sjgt3301122 7. [0385] (4) Yoshioka, N., Gros,
E., Li, H.-R., Kumar, S., Deacon, D. C., Maron, C., Muotri, A. R.,
Chi, N. C., Fu, X.-D., Yu, B. D., and Dowdy, S. F. (2013) Efficient
Generation of Human iPSCs by a Synthetic Self-Replicative RNA. Cell
Stem Cell 13, 246-254. [0386] (5) Robertson, J. S. (1994) Safety
considerations for nucleic acid vaccines. Vaccine 12, 1526-1528.
[0387] (6) Klinman, D. M., Takeno, M., Ichino, M., Gu, M.,
Yamshchikov, G., Mor, G., and Conover, J. (1997) DNA vaccines:
safety and efficacy issues. Springer Semin. Immunopathol. 19,
245-256. [0388] (7) Beal, J., Wagner, T. E., Kitada, T.,
Azizgolshani, O., Parker, J. M., Densmore, D., and Weiss, R. (2015)
Model-Driven Engineering of Gene Expression from RNA Replicons. ACS
Synthetic Biology 4, 48-56. [0389] (8) Kulasegaran-Shylini, R.,
Thiviyanathan, V., Gorenstein, D. G., and Frolov, I. (2009) The
5?UTR-specific mutation in VEEV TC-83 genome has a strong effect on
RNA replication and subgenomic RNA synthesis, but not on
translation of the encoded proteins. Virology 387, 211-221. [0390]
(9) Frolov, I., Hardy, R., and Rice, C. M. (2001) Cis-acting RNA
elements at the 5' end of Sindbis virus genome RNA regulate minus-
and plus-strand RNA synthesis. RNA 7,1638-1651.
Example 5
Engineering Synthetic Self-Amplifying RNA Circuits for Therapeutic
Applications
[0391] Nucleic acids have shown promise as an alternative to
protein therapeutics for many applications, including vaccination,
cancer immunotherapy, genetic reprogramming, and
protein-replacement therapies.sup.3-5. While tremendous strides
have been made in protein engineering since the approval of
recombinant human insulin, the cost of production, due to protein
modification and purification, can discourage its use for some
applications. Nucleic acid therapies avoid this cost by producing
the desired protein within the target cells, allowing for correct
folding and protein modifications, as well as longer exposure to
the therapeutic protein.sup.6. In both cases, tissue-specific
delivery and clearance rate are of great importance, leading to
increased research in those areas. However, while targeted protein
delivery is primarily extracellular via modified liposomes,
nanoparticles or protein-protein interactions, nucleic acids have
the ability to determine cell specificity inside the cell using
genetic parts, such as tissue-specific promoters or microRNA
(miRNA) target sites.sup.7-9. This intracellular control, which can
be coupled with extracellular modes of targeted delivery, is one of
the key benefits of nucleic acid therapies, but is still very much
in its infancy in a clinical setting.
[0392] DNA, the primary delivery platform for nucleic acid
therapies, is generally introduced as either a viral vector or
plasmid DNA (pDNA). Non-replicating RNA has recently emerged as a
potential therapeutic platform, in part, due to the development of
novel modifications that decrease immunogenicity and increase RNA
half-life.sup.6,14,22. Unmodified mRNA has been shown to express in
vivo as long as a week, but results in a significant innate immune
response.sup.23,24. By incorporating modified bases, such as
pseudouridine and 5-methylcytidine, into the mRNA, expression has
been observed up to 4 weeks with a diminished innate immune
response.sup.25-29. Additional optimization of the 5' cap,
untranslated regions (UTRs), poly-A tail length, and open reading
frame (ORF) have also been shown to affect mRNA stability and
expression.sup.6. Unlike transcription of pDNA, translation of RNA
occurs in the cytoplasm, making it possible in both dividing and
non-dividing cells. However, because it cannot replicate, dilution
becomes an issue in rapidly dividing cells. Additionally, modified
RNA generally has lower expression levels than self-replicating
RNA. Nonetheless, many of the genetic parts created for replicons
can also be used with modified mRNA, and for some applications a
much lower immune signature may be preferable.
[0393] Replicons are self-amplifying RNA, capable of producing high
amounts of protein expression up to 7 weeks after administration in
vivo, from relatively low initial doses compared to pDNA and
non-replicating RNA.sup.30. Of the numerous replicon systems
developed, two replicons derived from the alphavirus genus, Sindbis
virus (SIN) and Venezuelan Equine Encephalitis virus (VEE) are used
for the studies described herein. The invention is not limited to
these examples. Replicons from both of these viruses are
well-characterized and variants with reduced cytopathicity have
been established.sup.35-37. Alphaviruses are a group of
positive-strand RNA viruses with genomes between 11-12 kilobases.
The genome is divided into two parts: the 5' two-thirds encodes
four non-structural proteins used in RNA replication and the 3'
one-third, or subgenomic RNA, encodes the structural
proteins.sup.38. The genome is preceded by a 5'-7-methylguanosine
cap and ends with a 3'-poly-A tail, mimicking cellular mRNA to
facilitate translation of the non-structural proteins using host
cell machinery.
[0394] As self-replicating RNA, replicons offer several advantages
over other nucleic acid delivery systems. Because replication
occurs outside of the nucleus and replicons do not reverse
transcribe, there is minimal risk of integration, a major concern
with viral particles. In addition, replicons have shown low vector
immunity, expanding its applications to those requiring multiple
doses. Replicons are also able to persist in both dividing and
quiescent cells, presumably with lower dilution rates in rapidly
dividing cells than non-replicating RNA. A high dose of a
therapeutic protein can also be produced from as little as one
replicon entering a target cell, minimizing the impact of delivery
efficiency compared to pDNA and mRNA.
[0395] Self-amplifying nature of a replicon presents a major hurdle
with respect to dosing. The majority of replicon-based technologies
constitutively express a therapeutic protein without any
regulation. It is demonstrated herein that protein production
cannot be controlled by initial dose alone, as it can for pDNA and
mRNA, but requires intracellular control of replicon expression.
Control devices that not only govern output of the desired protein,
but also determine tissue specificity using miRNA sensing, in a
manner similar to tissue-specific promoters used in pDNA are
described herein and provided as aspects of the invention. The
external input for many of the genetic parts described herein are
small molecules, as they are the simplest means to establish
tunable and dose-dependent control after a replicon is inside a
cell. However, other external inputs are also encompassed within
the invention. Because it may not be optional for these drugs to be
continuously administered to patients over long periods of time, we
have focused the genetic circuits of the invention include ON/OFF
switching in response to brief pulses of small molecule or other
external inputs.
[0396] Many genetic parts for RNA have already been generated,
including RNA binding proteins (RBPs), endoribonucleases,
riboswitches, and RNA sensors. The examples described herein
utilize two RBPs for the majority of the circuits, L7Ae and TetR.
L7Ae is a ribosomal protein from Archaeoglobus fulgidus that has
been shown to bind RNA motifs called kink-turns (K-turns) with high
affinity, as well as K-loops to a lesser degree. The Tet repressor
(TetR) protein derived from Escherichia coli is traditionally used
for regulation of pDNA genetic circuits. However, using systematic
evolution of ligands by exponential enrichment (SELEX), RNA
aptamers were found to which TetR bound tightly. Placing either
K-turns or TetR aptamers in the 5'UTR upstream of an ORF has been
shown to repress expression of the output protein. In the case of
TetR, this repression is relieved by the addition of a tetracycline
derivative, such as doxycycline, showing small molecule regulation
from RNA is possible. Another useful genetic part, Csy4, is a
CRISPR-associated endoribonuclease found in Pseudomonas aeruginosa.
The Csy4 protein recognizes a 28-nucleotide RNA repeat and cleaves
between nucleotides 20 and 2146. Due to the inherent cytotoxicity
of the replicon, a Csy4 site-specific "kill switch" is a very
useful genetic part of the constructs described herein.
Surprisingly, while L7Ae and TetR function in both replicon and
modified RNA contexts, we have observed that Csy4 is unable to
cleave modified RNA, presumably due to structural changes caused by
the modified bases.
[0397] Single replicon circuits require multiple proteins to be
expressed from a given RNA. Because these proteins must be
independently regulated for predictable circuit design, and
subgenomic promoter strength had been shown to be sequence
dependent in Sindbis virus.sup.59, we generated a subgenomic
promoter library for VEE by truncating the full-length SGP from
either the plus or minus side (FIG. 48). The SGP library was first
tested in a tandem format to prevent any deletions to nsP4, as the
base pairs comprising the minus side of the SGP are located in the
coding region of the nsP4 protein. The first translational unit,
expressing the fluorescent protein, mVenus, was held constant under
the full-length -241/+30 SGP.sup.60,61. Our library of twenty-six
truncated SGPs was placed before the second translational unit
expressing mKate. FIG. 48 demonstrates that modulation of the SGP
can result in a ten-fold dynamic range in protein expression
ranging from -241/+3 (weakest) to -241/+15 (strongest). The
experiment was repeated using mKate under control of the first SGP
and mVenus under control of the second, and gave the same outcome,
showing these results were not protein dependent.
[0398] Because a ten-fold range in expression was attainable by
truncating only the plus side of the SGP, we were able to validate
the results of our tandem experiment in a single SGP setting
without risking mutations in nsP4. We chose three SGPs,
representing low (SGP5), midrange (SGP30), and high (SGP15)
expression in a tandem format, and placed them upstream of an
mVenus reporter. These three SGPs exhibited the same pattern of
expression strengths in a single SGP format, with a 22-fold range
of expression (FIG. 54). From these results using one and two SGPs,
we concluded that although the absolute strength of expression is
context dependent, depending on the number of SGPs and position,
the hierarchy of SGP strength remains unchanged.
[0399] During this experiment, we also found that cloning scars can
have a profound impact on the range of expression of the SGP
library. While cloning for the tandem SGP library left a minimal
scar, initial cloning for the single SGP experiment was performed
using standard Gateway.RTM. cloning (Life Technologies) techniques,
resulting in a recombination scar that appeared to buffer
expression and exhibited a low dynamic range. The maximal range of
22-fold was observed when the SGP was followed immediately by a
Kozak sequence.
[0400] After establishing control of expression using an SGP
library, additional 3'UTRs, and position on the replicon, a more in
depth characterization of two and three SGP constructs was pursued.
As we began testing the scalability of our approach in a three SGP
format, it quickly became apparent that a large collection of SGP
combinations, with and without additional 3'UTRs, would need to be
tested to adequately characterize the system and understand
positional effects. Due to the large number of combinatorial
assemblies, as well as the need for scarless assembly, we adapted a
Modular Cloning (MoClo).sup.63 assembly strategy for replicons,
which was used to generate all two and three SGP constructs
discussed hereafter.
RNA Binding Proteins, Destabilization Domains, and
Endoribonucleases
[0401] A subset of RNA binding proteins (RBPs) can serve as
translational repressors, recognizing specific RNA structures and
blocking ribosome initiation. Many RBPs have been characterized,
but for the following replicon circuits, we have chosen to focus on
two RBPs with varying repressive capabilities, L7Ae and TetR. The
archaeal protein L7Ae binds the kink-turn (K-turn) motif,
repressing expression very strongly. We have enhanced this
repression further by including multiple K-turn repeats (e.g.
2xK-turn). As shown in FIG. 54A, in BHK-21 cells, expression of
L7Ae from the first translational unit of a replicon offers between
15- and 20,000-fold repression compared to the same construct with
a dummy protein inserted in place of L7Ae. TetR, on the other hand,
provided a weaker repression in the tested circuit, showing only
7-fold repression compared to the same construct with a mutant
aptamer, even after increasing TetR expression by changing its
position and placing it under the strongest SGP (FIG. 55B).
[0402] After characterizing these translational regulators, an
input signal, either applied externally or in response to
intracellular cues, was necessary to create a responsive replicon
circuit. In has been demonstrated that destabilization domains
(DDs) fused to proteins can promote reversible, dose-dependent
small molecule regulation. These domains signal rapid degradation
of the fusion protein unless the small molecule is present. We
began by testing two orthogonal DDs engineered from E. coli
dihydrofolate reductase (DDd) and human estrogen receptor ligand
binding domain (DDe), which respond to trimethoprim (TMP) and
4-hydroxytamoxifin (4-OHT), respectively. The dose-response curves
were produced by fusing each DD to a firefly luciferase (Fluc2)
reporter and observing expression in C2C12 mouse myoblast cells
(FIG. 56). These values were normalized to positive controls
containing Fluc2 expressed under a wild type SGP30, revealing that
the DDs decrease expression of the fusion protein even when the
small molecule is present. This prevents the use of DDs directly
fused to therapeutic proteins if large amounts of protein are
required. Both N- and C-terminal fusions were explored, but in
general, N-terminal fusions resulted in greater fold changes for
both luciferase and RBP fusions.
[0403] After independently demonstrating the efficacy of both RBPs
and DDs, we began to study DD-RBP fusions. It was observed in the
previous experiment that DDs decrease protein expression, so focus
was primarily on DD-L7Ae fusions, as weakening TetR would further
decrease its fold repression. In these experiments, a 2xK-turn
sequence was placed upstream of the reporter. If the small molecule
was absent, DD-L7Ae would be degraded and the reporter would
express. Alternatively, if the small molecule was present, DD-L7Ae
would be stabilized and repress the output. Because L7Ae is such a
strong repressor, initial experiments conducted in both BHK-21 and
C2C12 cell lines used a relatively weak SGP driving DDd-L7Ae, and
resulted in 18-fold and 22.5-fold repression, respectively, upon
addition of TMP (FIGS. 57A-57B). These fold changes are higher than
those attained by simply fusing the DD to Fluc2, providing evidence
that DD-RBP circuits can be used to increase performance The system
was also transfected into mouse myotubes. Significant optimization
was utilized to achieve comparable fold changes in myotubes,
highlighting the need for an efficient assembly workflow. By
shuffling SGPs, varying the number of K-turn repeats, and
introducing protein kinase R (PKR) inhibitors to limit the
interferon response, we achieved a 15-fold decrease in expression
after addition of TMP (FIG. 57C). Because of the success of these
small molecule induced "OFF" switches in vitro, this line of
research is continued in vivo, specifically aiming to develop a
"one-shot" prime/boost circuit for Respiratory Syncytial Virus
(RSV) vaccination.
[0404] Another genetic part with potential for irreversible
switching, Csy4 acts as a site-specific endoribonuclease. The
28-base pair Csy4 recognition site is relatively short, and a
single recognition site inserted downstream of a reporter was able
to decrease expression 23-fold. Because Csy4 can be used to cleave
the poly-A tail off of a replicon, it has tremendous potential as a
"kill-switch" and could be used to limit the immune response caused
by the replicon over time. In order for this application to be
feasible, DD-Csy4 fusions are designed to enable timed control of
expression. Four constructs are co-transfected with a replicon
containing mVenus and a Csy4 recognition site. Unlike TetR and
L7Ae, Csy4 is irreversible, so a small amount of leaky expression
would prevent proper circuit function. To prevent leaky expression,
Csy4 expression is lowered by incorporating a second DDe or a PEST
sequence, which decreases protein half-life.sup.64. These fusions
are tested under a weak (SGP5) and wild type (SGP30) subgenomic
promoter in both BHK-21 and C2C12 cell lines.
Characterize Replicon-Based Platforms for Expression of Multiple
Genes
[0405] Co-Transfection of Multiple Replicons
[0406] Before the SGP library was generated or destabilization
domains were fused to RBPs, the most straightforward way to control
the level of expression of a given protein was co-transfection with
a second replicon species. As shown in FIGS. 58A-58B, while
expression is dose-dependent for the first 12 hours using Sindbis
replicons in BHK-21 cells, by 16 hours, protein expression
converges and is independent of initial dose, precluding its use as
a potential circuit input. Instead, the use of a "ballast" replicon
can be used to predictably decrease expression of the desired
protein. While the total fluorescence from two co-transfected
replicons remains constant, a change in the initial ratio of the
two transfected species results in a linear change in expression
(FIGS. 58C-58D). These results indicate that a second "ballast"
replicon can be added to a system to decrease the expression of a
desired protein, in a linear, competition-dependent manner In
addition, we have proposed a mathematical model for the prediction
of expression levels in multi-replicon systems for Sindbis
replicons, and have also reparametrized this model to make it
applicable for VEE replicons.
[0407] While co-transfection can be useful for the transfection of
independent, constitutively expressed proteins, it presents some
hurdles with regard to genetic circuits. As previously
demonstrated, after three days the percentage of double positive
BHK-21 cells transfected with VEE replicon gradually decreased,
with one of the two replicon species gaining prominence. This
behavior would pose problems for circuit design and functionality,
as regulatory devices could be out-competed. Furthermore, with
co-transfection, it can be difficult to ensure that each component
of a genetic circuit or therapy is transfected into a given cell,
which affects circuit performance or therapeutic efficacy. To avoid
these drawbacks, we began to pursue single replicon platforms that
could be used to express multiple genes.
Multi-SGP Replicons
[0408] After determining the elements governing expression from
multi-SGP systems, namely position, SGP strength, and the presence
of additional 3'UTR sequences, we planned to characterize
constitutive expression from two and three SGP replicons using
fluorescent reporters. It became clear that such characterization
could not be completed without a high-throughput workflow, so a
Modular Cloning (MoClo) assembly strategy was adapted for VEE
replicons. As shown in FIG. 11, each translational unit was divided
into three parts: a sub-genomic promoter (SGP), open reading frame
(ORF), and 3'-untranslated region (3'UTR). Each of the parts was
placed in a Level 0 vector and flanked by BsaI recognition sites.
BsaI, a Type IIS restriction enzyme, recognizes a sequence and
cleaves downstream of it recognition site, allowing for scarless
assembly. The Level 0's are combined into a Level 1 vector to form
a single translational unit, using conserved sequences in between
the SGP, ORF, and 3'UTR. Finally, Level 1's are combined into the
replicon backbone using a second Type IIs enzyme, SapI, to form the
final Level 2 product, a functional multi-unit replicon. This
assembly strategy is extremely efficient, with respect to both
reaction time (.about.1.25 hours for each step) and percentage of
correct clones (.about.75% correct by picking one colony,
.about.100% correct by picking 3 colonies), and was used to
generate the majority of the multi-SGP replicons.
[0409] Using this MoClo-based cloning strategy, we were able to
generate all combinations of two and three SGP constructs
containing low (SGP5), midrange (SGP30), and high (SGP15)
subgenomic promoter strengths, with and without additional 3'UTRs.
FIG. 52A shows the results for the two SGP configuration in BHK-21
cells, with mVenus expressed under the first SGP and mKate
expressed under the second SGP. If the SGPs are identical and there
is not an additional 3'UTR in between the translational units, then
expression from the second translational unit is between 5- and
10-fold higher than the first. As shown, this difference in
expression can be mitigated by strengthening the first SGP,
weakening the second SGP, and by inserting an additional 3'UTR.
[0410] These results also indicate an additional parameter with a
lesser impact on expression: SGP length. The results for mVenus
expression from the first SGP behave as expected, with a systematic
increase in expression from the weak SGP5 to the strong SGP15, and
slightly higher expression of each after including another 3'UTR.
While mKate expression shows this same general increase from SGP5
to SGP15 under the second SGP, notice that the first SGP in front
of mVenus also affects mKate expression, but not in a
strength-dependent manner We expect that higher mVenus expression
may take resources away, leading to slightly lower mKate
expression. However, when holding the second SGP constant, mKate
expression is inversely correlated to the length of the first SGP.
Replicon position, additional 3'UTRs, and SGP choice are most
important when determining expression level (in that order).
[0411] Constructs with three SGPs were created to validate the
results observed with two SGPs (FIG. 52B). Fluorescence was
normalized against single SGP controls expressing each fluorescent
protein under the wild type subgenomic promoter. As expected, the
third translational unit dominates expression. Modulating SGP
strength and introducing additional 3'UTR sequences can be used to
control expression only to a certain extent. The influence of the
first SGP length on subsequent SGPs becomes inconsequential.
Presumably, as more SGPs are added, expression from the 5'-most
translational units continues to decline, limiting the scalability
of this approach, depending on the necessary expression levels
required for circuit function.
Helper-Defective Interfering (DI) RNA Expression
[0412] Another platform that was explored along with
co-transfection of replicons was expression from a defective
interfering (DI) RNA using a helper replicon. A defective
interfering viral genome is produced when large portions of the
genome are deleted due to recombination, leaving the remaining
fragment defective and incapable of replication on its own.
Instead, the DI genome must be complemented by a "helper" virus in
order to replicate, interfering with the helper's own replication
through competitive inhibition.
[0413] A VEE DI RNA was adopted for this study.sup.60. As shown in
FIG. 59A, to create this DI RNA, deletions were made to remove the
3' portion of nsP1, the entirety of nsP2 and nsP3, and the 5'
portion of nsP4. In this way, the structural cloverleaf element
formed by the 5' of nsP1, which is involved in replication, remains
intact, as well as the SGP located in the 3' of nsP4. This system
was chosen because of the lack of full-length non-structural
proteins, particularly nsP2 which has been reported to be involved
in negative feedback of the replication, would increase DI RNA
expression while limiting the host cell immune response.
[0414] We have validated results reported by Kulasegaran-Shylini et
al. that a G3.fwdarw.A mutation significantly increased DI RNA
expression, even though this mutation increases the ratio of
genomic to subgenomic RNA in a full-length replicon (FIG.
59B).sup.60. We were also able to increase DI RNA expression
ourselves by optimizing the helper. As shown in FIG. 59C, an
optimal configuration for DI RNA expression is achieved by removing
the positive side of the SGP and the entire ORF to prevent
subgenomic translation, while introducing a G3.fwdarw.A mutation to
generate more genomic RNA and thus more non-structural proteins. In
addition, we were able to validate that the truncated E 1
structural protein, though not functional, is necessary for high
expression, most likely due to the RNA secondary structure involved
in the interaction between the 5' and 3' ends of the genome during
replication.sup.62.
[0415] We next verified that the SGP library carried over into this
new platform and that co-transfection of a helper with multiple DI
species behaved in a predictable manner. As with co-transfected
replicons, we observed constant total expression, with a linear
response in expression based upon the initial ratio of the two DI
species. Finally, we changed the ratio of helper to DI RNA, as
multiple regimes of DI RNA interference have been reported against
wild type viruses based on the amount of DI RNA present. Here, we
see that while helper expression drops with decreasing initial
dose, DI RNA expression does have a maximum in the tested system
that is dependent on the helper-DI RNA ratio (FIG. 59D).
[0416] The helper-DI system may not experience the gradual decrease
of double positive cells observed with co-transfection of multiple
replicons. If the DI RNA begins to out-compete the helper, then the
decrease in helper could lead to a decrease in non-structural
proteins, and a subsequent decrease in DI RNA. If the helper begins
to out-compete the DI RNA, then more non-structural proteins are
produced, and more DI RNA is replicated. A helper-DI RNA time
course is performed to determine if equilibrium exists in this
system, preventing the domination of one species and averting one
of the major obstacles of circuit function using co-transfection.
In addition, because DI RNA replication is dependent on the
presence of the helper, by encoding the circuit output on DI RNA
and regulatory elements on a helper, it is possible to ensure that
the output is always be regulated, even using co-transfection.
There are three possible cases: (i) the DI RNA enters the cell
alone, is not replicated, and the protein is not be expressed, (ii)
the helper enters the cell alone, replicates, but does not contain
the output protein, and (iii) both the helper and DI RNA are
co-delivered, replicates, and permits desired circuit function.
Using this format, a reversible and irreversible small molecule
inducible OFF switch is created using DD-L7Ae and DD-Csy4,
respectively.
[0417] To circumvent any co-delivery issues, we have proposed a
novel self-cleaving helper-DI RNA platform (FIG. 60A). In this
system the helper and DI RNA are delivered on a single strand of
RNA. Csy4 is expressed from an internal ribosome entry site (IRES)
shortly after the RNA enters the cell, preferably before RNA
replication begins. Using a minimal Csy4 recognition site (CRS)
located in between the helper and DI RNA, the two species are
cleaved inside the cell. Because DI RNA is relatively short
(-1.7kb), this approach could be expanded to contain multiple DI
RNAs. We expect this self-cleaving helper-CRS-DI RNA system to
overcome limitations associated with transfection of multiple
replicons, as well as those associated with multi-SGP replicons,
such as uneven expression due to positional effects.
[0418] To test the validity of this approach, helper-CRS-DI RNA
lacking an IRES-Csy4 was co-transfected with a replicon expressing
either active or dead Csy4 (FIG. 60B). Replication was dramatically
affected by additional base pairs on the 5' end of replicons, and
we presumed this observation also applied to DI RNA, so both wild
type CRS and a minimal 3' CRS were tested. The minimal 3' CRS
limits the cleavage scar to a single cytosine, which we
hypothesized would not dramatically reduce expression, as a guanine
is added to the replicon during in vitro transcription (IVT) to
facilitate m7G capping.
[0419] As shown, using dead Csy4 to prevent cleavage results in low
helper and DI RNA expression. Expression still exists at low levels
because the helper-CRS-DI RNA acts as a modified two SGP replicon.
When active Csy4 is added, cleavage occurs, resulting in higher
expression of mKate from the helper because it no longer
experiences a positional effect. Here, we also observe the effect
of the scar left by the full-length CRS compared to the minimal 3'
CRS. The scar left by the full-length CRS makes DI RNA replication
very inefficient, leading to low mVenus expression from the DI RNA.
On the other hand, using the minimal 3' CRS results in substantial
DI RNA expression. As a rapid test of the amount of Csy4 necessary,
we also tested Csy4 expressed from a wild type VEE replicon. The
wild type replicon produces higher levels of Csy4, enhancing
cleavage and thus DI RNA expression, approaching levels comparable
to the positive control of co-transfected helper-DI RNA.
[0420] As a next step, helper-CRS-DI RNA constructs containing Csy4
driven by an IRES from encephalomyocarditis virus (EMCV) is
compared to co-transfection of a replicon expressing Csy4. These
results indicate that optimization of the IRES sequence may produce
higher expression of Csy4. Finally, we introduce ON/OFF switches
that employ RNA degradation based regulation that would not be
possible using a multi-SGP replicon.
Develop RNA-Only Circuits, with Emphasis on Small Molecule
Inducible ON/OFF Switches Inducible Single Replicon Switch with
Cascade Topology
[0421] After characterizing our parts and expression platforms, we
created a functional genetic circuit housed on a single replicon.
While testing DDs fused to L7Ae, we effectively created an OFF
switch, in which the addition of a small molecule stabilized L7Ae
and repressed the output. Because we have not characterized any
RBPs that act as translational activators, to create a single
replicon ON switch required optimization of a three SGP system,
containing a cascade of repressors (FIG. 61A). This circuit could
have been created numerous ways using the available parts, so
design constraints were necessary. Placing the reporter under the
first or second SGP would prevent high expression during the ON
state, so to allow the maximum range of output expression, our
reporter was placed under the third SGP. Next, we had shown that
L7Ae was the stronger of our two repressors, with higher fold
changes when fused to DDs, and thus would be the first repressor in
our cascade. Correspondingly, in this format the weaker repression
exhibited by TetR would be conducive to switching the output from
the OFF to the ON state. A range of expression levels were tested
using position, SGP choice, and additional 3'UTRs.
[0422] In the circuit topology shown, if no TMP is present,
DDd-L7Ae is destabilized, allowing TetR to repress mVenus-PEST.
Alternatively, if TMP is present, DDd-L7Ae is stabilized, represses
TetR, and mVenus-PEST is expressed. The PEST sequence shortens the
half-life of mVenus. This rapid turnover would allow for more
sensitive studies of circuit dynamics in the future. Doxycycline
(Dox) was added in conjunction with TMP to further decrease TetR
binding and increase expression of the ON state. The 96 variants
shown were constructed using the replicon MoClo assembly system and
tested in BHK-21 cells. Flow cytometry was performed 48 hours
post-transfection and the optimal construct resulted in an OFF
(-TMP/-Dox) to ON (+TMP/+Dox) fold-change of 10.75-fold (FIG.
61B).
[0423] Surprisingly, the eight constructs with the highest fold
changes all had TetR expressed under the first SGP and DDd-L7Ae
expressed under the second SGP (Orientation 2). This result was
unexpected because it was thought that not enough TetR would be
translated under the first SGP to provide sufficient repression.
However, expression of TetR in either the first or second position
appears to result in similar OFF states. Therefore, the high fold
changes observed are a product of high ON states, caused by
increased amounts of DDd-L7Ae translated from the second SGP. While
this switch functions, the OFF state has leaky expression due to
incomplete repression by TetR.
[0424] To further decrease the OFF state of this circuit,
repression enhancers fused to TetR using fluorescence activated
cell sorting (FACS) are screened in conjunction with next
generation RNA sequencing (RNA-seq). A library of 513 Dox-inducible
TetR ON switches, testing multiple SGPs and 57 different repression
enhancers, are constructed in a one-pot batch reaction using
replicon MoClo assembly (FIG. 62). The entire library is
transfected into C2C12 myoblasts at a low transfection efficiency,
to ensure that the majority of cells receive only one variant of
the circuit. Half of the transfected cells are plated with Dox,
while the other half is not. After 24 hours, FACS is performed
using mVenus as a transfection marker. Expression of mKate is
grouped into 8 bins for both the +Dox and -Dox conditions. RNA-seq
of extracted RNA reveals the circuit configurations present in each
bin. Using this data, coupled with the mean fluorescence of each
bin, fold-changes are calculated for each configuration.
Irreversible Switch using Csy4
[0425] While the aforementioned switches are reversible by the
addition or removal of small molecule, we have also devised an
irreversible switch using Csy4 (FIG. 63A). This switch first takes
advantage of positional effects, with low mVenus-PEST expression
under the first SGP and higher mKate expression under the second
SGP. When Csy4 is added, mKate is cleaved off, resulting in a
single SGP replicon and higher mVenus expression. An additional
E1-3'UTR sequence and poly-A tail were inserted in between the ORFs
to facilitate continued replication and prevent degradation after
cleavage occurs. The addition of the poly-A tail lowers mKate
expression without active Csy4, so strong SGPs are used to
counteract this effect. DDd-L7Ae is used to further decrease the
OFF state of mVenus. Finally, DDe-Csy4 is incorporated onto the
replicon, making the system a single replicon, small molecule
inducible switch.
[0426] In State 1, to produce low mVenus and high mKate, TMP is
added to stabilize DDd-L7Ae. Expression of mVenus should already be
very low, as it is in the first position of a three SGP replicon,
but the stabilized DDd-L7Ae should reduce expression further. No
4-OHT is present, so DDe-Csy4 is degraded, but also is repressed by
DDd-L7Ae to prevent leaky expression and premature cleavage. In
State 2, TMP is removed and 4-OHT is added. This combination of
small molecules eliminates DDd-L7Ae repression and induce DDe-Csy4
cleavage, resulting in a single replicon with high mVenus
expression.
Helper-CRS-DI miRNA High Sensor
[0427] RNA degradation-based regulation has remained elusive in a
single replicon format because any degradation affects the entire
replicon, and thus the entire circuit. However, using Csy4 to
intracellularly split a single RNA into independently replicating
components allows us to overcome this barrier. A microRNA (miRNA)
high sensor, termed as such because when the target miRNA is
present, the output has high expression is created (FIG. 64). In
the circuit shown, the input is synthetic miR-FF4 and the output is
mVenus. When miR-FF4 is absent, the DI RNA is not degraded and L7Ae
is present to repress mVenus. However, when miR-FF4 is added to the
system, the DI RNA degrades and mVenus freely expresses. In
addition, because the DI RNA is no longer competing with the helper
for replication machinery, mVenus expression could increase further
using this helper-DI RNA configuration. It is crucial that Csy4 is
expressed from an IRES to facilitate cleavage as early as possible.
If miR-FF4 is present and the circuit is not cleaved, the entire
helper-CRS-DI RNA strand is degraded.
Use of Replicon Circuits for Treating Duchenne Muscular Dystrophy
(DMD.
Muscular Dystrophy Treatment
[0428] Unlike competing nucleic acid technologies, the replicon
circuits of the invention utilize small molecule regulation rather
than relying on integration or repeat administration of nucleic
acids. Here, we propose a treatment for Duchenne muscular dystrophy
(DMD) using a replicon switch to initially convert human dermal
fibroblasts to a myogenic lineage to facilitate fusion, followed by
expression of a therapeutic protein, follistatin.
[0429] DMD is a recessive X-linked disease characterized by
continual degeneration and regeneration of muscle fibers. It is
caused by a mutation in the dystrophin gene, which plays an
important role in muscle stability by interacting with a
dystrophin-glycoprotein complex at the muscle cell membrane. Over
time the muscle tissue wastes away and is replaced by fibrotic and
adipose tissue, leading to eventual paralysis and death. One in
3,500 males is born with DMD and those with the disease have a life
expectancy of 25 years.sup.65.
[0430] Because DMD is recessive and female carriers of the DMD
allele retain muscle stability.sup.66, initial therapies for DMD
attempted to restore dystrophin to muscle tissue by implanting
healthy donor myoblasts into dystrophic fibers. However, paternal
biopsies used in clinical trials resulted in low engraftment
efficiency and thus low dystrophin expression.sup.67. Additionally,
using cells from a donor can lead to immune rejection of the
implanted cells. Next, cell therapies were pursued to engineer a
patient's own cells to express the therapeutic gene, follistatin.
Unfortunately, a patient's preexisting myogenic cells would have
already undergone many cycles of degeneration and regeneration,
making them difficult to expand.sup.68. Dermal fibroblasts are one
of the most abundant and easily accessible cell types. They are
also capable of myogenic conversion and fusion into myotubes using
transient expression of MyoD, a transcription factor involved in
skeletal muscle differentiation.sup.69,70. Initially, it was
believed that MyoD alone can facilitate fibroblasts' conversion
into myotubes. However, recent studies suggest that while MyoD is
essential to initiate differentiation, Myogenin (MyoG) is required
later to retain this fate.sup.71.
[0431] A replicon circuit similar to that shown in FIG. 63 is used
to sequentially express MyoD, followed by MyoG, in healthy human
dermal fibroblasts. Myogenic conversion and fusion is detected by
staining for myosin heavy chain (MHC). This task alone is
therapeutically relevant, as these myotubes could then be implanted
into dystrophic muscle, providing strength and stability. However,
follistatin is also expressed, a secreted protein shown to improve
muscle strength that is currently in clinical trials for Becker
muscular dystrophy, also caused by a mutation in
dystrophin.sup.72.
Methods
RNA Preparation
[0432] Sindbis replicon plasmids were linearized using SacI-HF
(NEB) prior to run-off in vitro transcription (IVT) using the
mMESSAGE mMachine.RTM. SP6 Kit (Life Technologies). For experiments
conducted in BHK-21 cells, VEE replicon plasmids were linearized
using I-SceI (NEB) prior to in vitro transcription using the
mMESSAGE mMachine.RTM. T7 Kit (Life Technologies). Following IVT,
the resulting RNA was purified using the RNeasy.RTM. Mini Kit
(Qiagen) and the concentration was measured using the NanoDrop.TM.
2000. For experiments conducted in C2C12 myoblasts or myotubes, IVT
was performed using the MEGAscript.RTM. T7 Transcription Kit (Life
Technologies), followed by purification using the RNeasy.RTM. Mini
Kit (Qiagen). The resulting RNA was denatured at 65.degree. C. and
enzymatic capping was performed using the ScriptCap
2'-O-mehtyltrasnferase Kit (Cellscript) and ScriptCap m7G Capping
System (Cellscript). A final purification step using the
RNeasy.RTM. Mini Kit (Qiagen) was performed prior to
transfection.
Transfection
[0433] BHK-21 cells (a kind gift from Dr. James H. Strauss) were
cultured in EMEM (ATCC) supplemented with 10% FBS (PAA) at
37.degree. C. and 5% CO.sub.2. BHK-21 cells at approximately 70%
confluence were electroporated using the Neon.TM. Transfection
System (Life Technologies) following optimization, according to the
manufacturers' instructions. In general, for a single well of a
24-well plate (Corning), approximately 100,000 cells were
electroporated with 1,000 ng of RNA, unless otherwise stated.
[0434] C2C12 cells were cultured on gelatin coated plated in DMEM
(ATCC) supplemented with 10% FBS (PAA) at 37.degree. C. and 5%
CO.sub.2. The Neon.TM. Transfection System (Life Technologies) was
independently optimized for C2C12 cells, following the
manufacturer's instructions. In general, for a single well of a
24-well plate (Corning), approximately 50,000 cells were
electroporated with 100 ng of RNA, unless otherwise stated.
[0435] To differentiate C2C12 cells into myotubes, 150,000 cells
were plated per well in a 24-well plate and allowed to grow for one
day in DMEM supplemented with 10% FBS. Once the cell population was
confluent, the media was changed to DMEM supplemented with 2% horse
serum (Thermo SH30074). The media was replaced each day for 4-5
days. After this time, the media was changed back to DMEM
supplemented with 10% FBS and transfections were performed with
Lipofectamine.TM. MessengerMAX.TM. Reagent (Life Technologies)
using 100 ng of RNA.
Data Collection
[0436] For fluorescent reporters, cells for each time point were
washed with 1.times.PBS, trypsinized, and resuspended in
1.times.PBS. Flow cytometry was performed using the BD
LSRFortessa.TM. Flow Cytometer System (BD Biosciences), equipped
with 405, 488, and 561 nm lasers. 20,000-40,000 events were
collected per sample. FACSDiva software (BD Biosciences) was used
for initial data collection and FlowJo was used for subsequent data
analysis. For luciferase assays, 250 .mu.L of Glo Lysis Buffer
(Promega) was added to each well of a 24-well plate. 25 .mu.L of
lysate was mixed with 25 .mu.L of Steady-Glo.RTM. reagent (Promega)
in black 96-well clear bottom plates (Coming) and incubated at room
temperature for 5 minutes. Luminescence was measured using a Tecan
Safire.sup.2 plate reader.
REFERENCES FOR EXAMPLE 5
[0437] 1. Wolff, J. A. et al. Direct gene transfer into mouse
muscle in vivo. Science 247, 1465-1468 (1990). [0438] 2. Beal, J.
et al. Model-Driven Engineering of Gene Expression from RNA
Replicons. ACS Synth. Biol. 4, 48-56 (2015). [0439] 3. Opalinska,
J. B. & Gewirtz, A. M. Nucleic-acid therapeutics: basic
principles and recent applications. Nat. Rev. Drug Discov. 1,
503-514 (2002). [0440] 4. Kay, M. A. State-of-the-art gene-based
therapies: the road ahead. Nat. Rev. Genet. 12, 316-328 (2011).
[0441] 5. Yin, H. et al. Non-viral vectors for gene-based therapy.
Nat. Rev. Genet. 15, 541-555 (2014). [0442] 6. Sahin, U., Kariko,
K. & Tureci, O. mRNA-based therapeutics--developing a new class
of drugs. Nat. Rev. Drug Discov. 13, 759-780 (2014). [0443] 7.
Wooddell, C. I., Reppen, T., Wolff, J. A. & Herweijer, H.
Sustained liver-specific transgene expression from the albumin
promoter in mice following hydrodynamic plasmid DNA delivery. J.
Gene Med. 10, 551-563 (2008). [0444] 8. Haase, R. et al. Generation
of a tumor- and tissue-specific episomal non-viral vector system.
BMC BiotechnoL 13, 49 (2013). [0445] 9. Xie, Z., Wroblewska, L.,
Prochazka, L., Weiss, R. & Benenson, Y. Multi-input RNAi-based
logic circuit for identification of specific cancer cells. Science
333, 1307-1311 (2011). [0446] 10. Bessis, N., GarciaCozar, F. J.
& Boissier, M.-C. Immune responses to gene therapy vectors:
influence on vector function and effector mechanisms. Gene Ther. 11
Suppl 1, S10-17 (2004). [0447] 11. Thomas, C. E., Ehrhardt, A.
& Kay, M. A. Progress and problems with the use of viral
vectors for gene therapy. Nat. Rev. Genet. 4, 346-358 (2003).
[0448] 12. Inagaki, K., Piao, C., Kotchey, N. M., Wu, X. &
Nakai, H. Frequency and spectrum of genomic integration of
recombinant adeno-associated virus serotype 8 vector in neonatal
mouse liver. J. ViroL 82, 9513-9524 (2008). [0449] 13. Rapti, K. et
al. Neutralizing Antibodies Against AAV Serotypes 1,2,6, and 9 in
Sera of Commonly Used Animal Models. Mol. Ther. 20, 73-83 (2012).
[0450] 14. Geall, A. J., Mandl, C. W. & Ulmer, J. B. RNA: the
new revolution in nucleic acid vaccines. Semin. Immunol. 25,
152-159 (2013). [0451] 15. Bouard, D., Alazard-Dany, N. &
Cosset, F.-L. Viral vectors: from virology to transgene expression.
Br. J. Pharmacol. 157, 153-165 (2009). [0452] 16. Miller, A. M.
& Dean, D. A. Tissue-specific and transcription factor-mediated
nuclear entry of DNA. Adv. Drug Deliv. Rev. 61, 603-613 (2009).
[0453] 17. Jafari, M., Soltani, M., Naahidi, S., Karunaratne, D. N.
& Chen, P. Nonviral approach for targeted nucleic acid
delivery. Curr. Med. Chem. 19, 197-208 (2012). [0454] 18. Chen,
Z.-Y., Riu, E., He, C.-Y., Xu, H. & Kay, M. A. Silencing of
Episomal Transgene Expression in Liver by Plasmid Bacterial
Backbone DNA Is Independent of CpG Methylation. Mol. Ther. 16,
548-556 (2008). [0455] 19. Chen, Z. Y., He, C. Y., Meuse, L. &
Kay, M. A. Silencing of episomal transgene expression by plasmid
bacterial DNA elements in vivo. Gene Ther. 11, 856-864 (2004).
[0456] 20. Cohen, R. N., van der Aa, M. A. E. M., Macaraeg, N.,
Lee, A. P. & Szoka, F. C. Quantification of Plasmid DNA Copies
in the Nucleus after Lipoplex and Polyplex Transfection. J.
Control. Release Off. J. Control. Release Soc. 135, 166-174 (2009).
[0457] 21. Glover, D. J., Leyton, D. L., Moseley, G. W. & Jans,
D. A. The efficiency of nuclear plasmid DNA delivery is a critical
determinant of transgene expression at the single cell level. J.
Gene Med. 12, 77-85 (2010). [0458] 22. Andries, O., Kitada, T.,
Bodner, K., Sanders, N. N. & Weiss, R. Synthetic biology
devices and circuits for RNA-based `smart vaccines`: a
propositional review. Expert Rev. Vaccines 14, 313-331 (2015).
[0459] 23. Pascolo, S. Vaccination with messenger RNA. Methods Mol.
Med. 127, 23-40 (2006). [0460] 24. Pollard, C., De Koker, S.,
Saelens, X., Vanham, G. & Grooten, J. Challenges and advances
towards the rational design of mRNA vaccines. Trends Mol. Med. 19,
705-713 (2013). [0461] 25. Kariko, K., Buckstein, M., Ni, H. &
Weissman, D. Suppression of RNA recognition by Toll-like receptors:
the impact of nucleoside modification and the evolutionary origin
of RNA. Immunity 23, 165-175 (2005). [0462] 26. Kariko, K. et al.
Incorporation of pseudouridine into mRNA yields superior
nonimmunogenic vector with increased translational capacity and
biological stability. Mol. Ther. J. Am. Soc. Gene Ther. 16,
1833-1840 (2008). [0463] 27. Anderson, B. R. et al. Incorporation
of pseudouridine into mRNA enhances translation by diminishing PKR
activation. Nucleic Acids Res. 38, 5884-5892 (2010). [0464] 28.
Anderson, B. R. et al. Nucleoside modifications in RNA limit
activation of 2'-5'-oligoadenylate synthetase and increase
resistance to cleavage by RNase L. Nucleic Acids Res. 39, 9329-9338
(2011). [0465] 29. Kormann, M. S. D. et al. Expression of
therapeutic proteins after delivery of chemically modified mRNA in
mice. Nat. BiotechnoL 29, 154-157 (2011). [0466] 30. Geall, A. J.
et al. Nonviral delivery of self-amplifying RNA vaccines. Proc.
Natl. Acad. Sci. U. S. A. 109, 14604-14609 (2012). [0467] 31.
Strauss, J. H. & Strauss, E. G. The alphaviruses: gene
expression, replication, and evolution. Microbiol. Rev. 58, 491-562
(1994). [0468] 32. Wahlfors, J. J., Zullo, S. A., Loimas, S.,
Nelson, D. M. & Morgan, R. A. Evaluation of recombinant
alphaviruses as vectors in gene therapy. Gene Ther. 7, 472-480
(2000). [0469] 33. Lundstrom, K. Alphaviruses in Gene Therapy.
Viruses 1, 13-25 (2009). [0470] 34. Lundstrom, K. Alphavirus-Based
Vaccines. Viruses 6, 2392-2415 (2014). [0471] 35. Frolov, I. et al.
Selection of RNA replicons capable of persistent noncytopathic
replication in mammalian cells. J. ViroL 73, 3854-3865 (1999).
[0472] 36. Lustig, S. et al. Molecular basis of Sindbis virus
neurovirulence in mice. J. Virol. 62, 2329-2336 (1988). [0473] 37.
Petrakova, O. et al. Noncytopathic Replication of Venezuelan Equine
Encephalitis Virus and Eastern Equine Encephalitis Virus Replicons
in Mammalian Cells. J. Virol. 79, 7597-7608 (2005). [0474] 38.
Jose, J., Snyder, J. E. & Kuhn, R. J. A structural and
functional perspective of alphavirus replication and assembly.
Future Microbiol. 4, 837-856 (2009). [0475] 39. Ljungberg, K. &
Liljestrom, P. Self-replicating alphavirus RNA vaccines. Expert
Rev. Vaccines 14, 177-194 (2015). [0476] 40. Berglund, P., Fleeton,
M. N., Smerdou, C. & Liljestrom, P Immunization with
recombinant Semliki Forest virus induces protection against
influenza challenge in mice. Vaccine 17, 497-507 (1999). [0477] 41.
Uematsu, Y. et al. Lack of Interference with Immunogenicity of a
Chimeric Alphavirus Replicon Particle-Based Influenza Vaccine by
Preexisting Antivector Immunity. Clin. Vaccine Immunol. CVI 19,
991-998 (2012). [0478] 42. Dubensky, T. W., Liu, M. A. & Ulmer,
J. B. Delivery systems for gene-based vaccines. Mol. Med. Camb.
Mass 6, 723-732 (2000). [0479] 43. Yoshioka, N. et al. Efficient
generation of human iPSCs by a synthetic self-replicative RNA. Cell
Stem Cell 13, 246-254 (2013). [0480] 44. Saito, H. et al. Synthetic
translational regulation by an L7Ae-kink-turn RNP switch. Nat.
Chem. Biol. 6, 71-78 (2010). [0481] 45. Belmont, B. J. & Niles,
J. C. Engineering a direct and inducible protein-RNA interaction to
regulate RNA biology. ACS Chem. Biol. 5, 851-861 (2010). [0482] 46.
Haurwitz, R. E., Jinek, M., Wiedenheft, B., Zhou, K. & Doudna,
J. A. Sequence- and structure-specific RNA processing by a CRISPR
endonuclease. Science 329, 1355-1358 (2010). [0483] 47. Haurwitz,
R. E., Sternberg, S. H. & Doudna, J. A. Csy4 relies on an
unusual catalytic dyad to position and cleave CRISPR RNA. EMBO J.
31, 2824-2832 (2012). [0484] 48. Iwamoto, M., Bjorklund, T.,
Lundberg, C., Kirik, D. & Wandless, T. J. A general chemical
method to regulate protein stability in the mammalian central
nervous system. Chem. Biol. 17, 981-988 (2010). [0485] 49.
Miyazaki, Y., Imoto, H., Chen, L. & Wandless, T. J.
Destabilizing Domains Derived from the Human Estrogen Receptor. J.
Am. Chem. Soc. 134, 3942-3945 (2012). [0486] 50. Hahn, C. S., Hahn,
Y. S., Braciale, T. J. & Rice, C. M. Infectious Sindbis virus
transient expression vectors for studying antigen processing and
presentation. Proc. Natl. Acad. Sci. U. S. A. 89, 2679-2683 (1992).
[0487] 51. Frolov, I. et al. Alphavirus-based expression vectors:
strategies and applications. Proc. Natl. Acad. Sci. U. S. A. 93,
11371-11377 (1996). [0488] 52. Petrakova, O. et al. Noncytopathic
replication of Venezuelan equine encephalitis virus and eastern
equine encephalitis virus replicons in Mammalian cells. J. Virol.
79, 7597-7608 (2005). [0489] 53. Wiley, M. R., Roberts, L. O.,
Adelman, Z. N. & Myles, K. M. Double subgenomic alphaviruses
expressing multiple fluorescent proteins using a Rhopalosiphum padi
virus internal ribosome entry site element. PloS One 5, e13924
(2010). [0490] 54. Sanz, M. A., Castello, A., Ventoso, I.,
Berlanga, J. J. & Carrasco, L. Dual mechanism for the
translation of subgenomic mRNA from Sindbis virus in infected and
uninfected cells. PloS One 4, e4772 (2009). [0491] 55. Firth, A. E.
& Brierley, I. Non-canonical translation in RNA viruses. J.
Gen. Virol. 93, 1385-1409 (2012). [0492] 56. Donnelly, M. L. et al.
Analysis of the aphthovirus 2A/2B polyprotein `cleavage` mechanism
indicates not a proteolytic reaction, but a novel translational
effect: a putative ribosomal `skip`. J. Gen. Virol. 82, 1013-1025
(2001). [0493] 57. Thomas, J. M., Klimstra, W. B., Ryman, K. D.
& Heidner, H. W. Sindbis virus vectors designed to express a
foreign protein as a cleavable component of the viral structural
polyprotein. J. Virol. 77, 5598-5606 (2003). [0494] 58. Kim, J. H.
et al. High cleavage efficiency of a 2A peptide derived from
porcine teschovirus-1 in human cell lines, zebrafish and mice. PloS
One 6, e18556 (2011). [0495] 59. Wielgosz, M. M., Raju, R. &
Huang, H. V. Sequence Requirements for Sindbis Virus Subgenomic
mRNA Promoter Function in Cultured Cells. J. Virol. 75, 3509-3519
(2001). [0496] 60. Kulasegaran-Shylini, R., Thiviyanathan, V.,
Gorenstein, D. G. & Frolov, I. The 5'UTR-specific mutation in
VEEV TC-83 genome has a strong effect on RNA replication and
subgenomic RNA synthesis, but not on translation of the encoded
proteins. Virology 387, 211-221 (2009). [0497] 61. Petrakova, O. et
al. Noncytopathic Replication of Venezuelan Equine Encephalitis
Virus and Eastern Equine Encephalitis Virus Replicons in Mammalian
Cells. J. Virol. 79, 7597-7608 (2005). [0498] 62. Frolov, I.,
Hardy, R. & Rice, C. M. Cis-acting RNA elements at the 5' end
of Sindbis virus genome RNA regulate minus- and plus-strand RNA
synthesis. RNA 7, 1638-1651 (2001). [0499] 63. Weber, E., Engler,
C., Gruetzner, R., Werner, S. & Marillonnet, S. A Modular
Cloning System for Standardized Assembly of Multigene Constructs.
PLoS ONE 6, e16765 (2011). [0500] 64. Rechsteiner, M. & Rogers,
S. W. PEST sequences and regulation by proteolysis. Trends Biochem.
Sci. 21, 267-271 (1996). [0501] 65. Nowak, K. J. & Davies, K.
E. Duchenne muscular dystrophy and dystrophin: pathogenesis and
opportunities for treatment. EMBO Rep. 5, 872-876 (2004). [0502]
66. Pegoraro, E. et al. Genetic and biochemical normalization in
female carriers of Duchenne muscular dystrophy: evidence for
failure of dystrophin production in dystrophin-competent myonuclei.
Neurology 45, 677-690 (1995). [0503] 67. Karpati, G. et al.
Myoblast transfer in Duchenne muscular dystrophy. Ann. Neurol. 34,
8-17 (1993). [0504] 68. Webster, C. & Blau, H. M. Accelerated
age-related decline in replicative life-span of Duchenne muscular
dystrophy myoblasts: implications for cell and gene therapy. Somat.
Cell Mol. Genet. 16, 557-565 (1990). [0505] 69. Lattanzi, L. et al.
High efficiency myogenic conversion of human fibroblasts by
adenoviral vector-mediated MyoD gene transfer. An alternative
strategy for ex vivo gene therapy of primary myopathies. J. Clin.
Invest. 101, 2119-2128 (1998). [0506] 70. Gibson, A. J. et al.
Dermal fibroblasts convert to a myogenic lineage in mdx mouse
muscle. J. Cell Sci. 108 (Pt 1), 207-214 (1995). [0507] 71. Liu,
Z., Fan, H., Li, Y. & Zheng, S. G. Experimental Studies on the
Differentiation of Fibroblasts into Myoblasts induced by MyoD Genes
in vitro. Int. J. Biomed. Sci. IJBS 4, 14-19 (2008). [0508] 72.
Mendell, J. R. et al. A phase 1/2a follistatin gene therapy trial
for becker muscular dystrophy. Mol. Ther. J. Am. Soc. Gene Ther.
23, 192-201 (2015).
Example 6
Self-Replicating RNA Prime/Boost Circuit Vaccine for Respiratory
Syncytial Virus (RSV)
[0509] Comparison of Luciferase Expression Levels from Different
RNA Platforms and Delivery Formats in Wild-Type and SCID Mice
[0510] To obtain a general understanding of the relative
performances (translational capacity and duration) of different
mRNA (RNA replicon and modified mRNA [modRNA]) platforms for
intramuscular (i.m.) delivery into mice using various non-viral
delivery methods (lipid nanoparticles (LNP) and electroporation
(e.p.)) is performed.
[0511] To this end, Venezuelan equine encephalitis (VEE) replicon
RNA and modRNA encoding firefly luciferase (Fluc) is produced by in
vitro transcription (IVT) using bacteriophage T7 RNA polymerase.
DNA templates for run-off IVT of the VEE replicons (wildtype (WT)
and non-cytopathic nsP2Q739L replicon (NCP)) and modRNA (containing
the 5' and 3' UTRs of the VEE subgenomic RNA (sgRNA)) are prepared
by plasmid linearization followed by removal of the 3' overhang by
Klenow fragment. For modRNA IVT, N1-methylpseudouridine (m1Y) is
incorporated into the RNA instead of uridine. Both mRNAs (replicon
and modRNA) are capped co-transcriptionally using cap analogues
(e.g. anti-reverse cap analogue (ARCA)) and subsequently treated
with phosphatase to remove 5' triphosphates from uncapped RNA.
ModRNA is purified by high performance liquid chromatography (HPLC)
and RNA replicon is purified by denaturing urea polyacrylamide gel
electrophoresis combined with electroelution to remove
contaminating dsRNA or RNA/DNA hybrids from the sample. Quality
control (QC) of the RNAs is performed by denaturing gel
electrophoresis or capillary electrophoresis using an Agilent
Bioanalyzer to quantify the amount of full length RNA in the
sample. Furthermore, dot blot is performed using a dsRNA specific
antibody to quantify the levels of contaminating dsRNA in the
sample, if any. The RNAs are subsequently transfected into mouse
myotubes using Lipofectamine MessengerMAX (Life Technologies).
Myotubes are differentiated from a mouse myoblast cell line (C2C12)
using differentiation medium containing donor equine serum.
[0512] The RNAs that pass the QC test, are used for bilateral
injection (6 ug) into the gastrocnemius muscles of WT (Balb/c) or
severe combined immunodeficiency (SCID) mice. The levels of Fluc
reporter proteins expressed from the various RNAs are monitored in
vivo by bioluminescence imaging (BLI) over the course of 77 days.
Admisinitration occurs at day 0, (bilateral, i.m.) and assays of in
vivo bioluminescence occurs at days 2, 4, 7, 10, 14, 21, 28, 35,
42, 49, 56, 63, 70, and 77. After the last BLI measurement, the
mice are sacrificed and quantitative reverse transcription PCR
(qRT-PCR) analysis is performed on RNA extracted from the
gastrocnemius muscle to detect the levels of replicon RNA in the
tissue. I.m. delivery of RNA is accomplished by packaging the RNAs
into LNPs or by naked injection followed by e.p. using a Harvard
Apparatus BTX ECM830 electroporator (100V, 3 pulses, 60 ms
duration/100 ms delay). Experimental groups are summarized in Table
9. LNP packaging of the RNAs is performed using the ethanol
dilution method by complexing RNA with a cationic lipid and
fusogenic lipids via electrostatic interactions and subsequently
grafting with DSPE-PEG. QC of LNP-packaged RNA is performed by
measuring the zeta-potential and size of the particles using
dynamic light scattering (DLS) and by checking the RNA packaging
efficiency using a RiboGreen.RTM. (Life Technologies) assay. The
formulated RNAs are transfected in vitro into C2C12 myotubes to
measure protein expression. The RNA and LNP QC procedures described
are used to verify the quality of the IVT RNA and LNP-packaged RNA
for all subsequent tasks.
TABLE-US-00019 TABLE 9 Comparison of luciferase expression levels
from different RNA platforms and delivery formats in wild-type and
SCID mice. Dose Delivery per limb Group RNA type (i.m.) (ug) Mice 1
Mock (lacZ) LNP 6 Balb/c (n = 2) 2 WT replicon SCID (n = 2) 3 Fluc
LNP 6 Balb/c (n = 8) 4 modRNA SCID (n = 8) 5 Fluc WT LNP 6 Balb/c
(n = 8) 6 replicon SCID (n = 8) 7 Fluc NCP LNP 6 Balb/c (n = 8) 8
replicon SCID (n = 8) 9 Mock (lacZ) e.p. 6 Balb/c (n = 2) WT
replicon 10 Fluc e.p. 6 Balb/c (n = 8) modRNA 11 Fluc WT e.p. 6
Balb/c (n = 8) 12 replicon SCID (n = 8) 13 Fluc NCP e.p. 6 Balb/c
(n = 8) Replicon
Comparison of Immune Responses by Homologous Prime/Boost using
Different RNA Platforms and Delivery Formats
[0513] The capabilities of the various RNA expression platforms
(replicon and modRNA) to induce an immune response against the RSV
F antigen by homologous prime/boost when delivered i.m. using LNPs
or by e.p. as described above are compared.
[0514] To this end, two doses (1.5 and 6 ug) of WT or NCP VEE
replicon or m1Y modRNA encoding the RSV F antigen are unilaterally
injected and delivered into the gastrocnemius muscles of Balb/c
mice by e.p. or using LNPs (prime; day 0). Three weeks after this
prime injection, the mice receive a unilateral i.m. booster shot of
the same amount/type of RNA using the same delivery method (boost;
day 21). An aluminum-adjuvanted RSV protein prime/boost group
following the same injection schedule as the RNA groups is included
as a benchmark for the immune response against RSV F protein.
Prime-only groups of the above are also included as a control. At
Day 0, prime unilaterial, i.m. is delivered, at day 21 a boost is
administered, and on day 35, the mice are sacrificed, immune
response is measured, and qRT-PCT is performed. See Table 10.
[0515] The immune responses against the RSV F antigen on day 35
(two weeks after the boost injection or five weeks after the prime
injection for prime-only groups) for each experimental group is
determined by measuring 1) the serum antibody (Ab) titers against
RSV F, 2) serum virus-neutralizaing Ab (VNA) titers against RSV,
and 3) antigen specific activation and cytokine secretion
(interferon (IFN)-.gamma.) of spleen CD4+ and CD8+ T cells upon RSV
F peptide stimulation (quantified by an Enzyme-Linked ImmunoSpot
(ELISpot) assay.
[0516] Furthermore, the immunogenicity of the VEE replicase
proteins are evaluated by measuring the serum Ab levels against the
replicase proteins as well as the replicase specific immune
response of splenocytes by IFN-.gamma. ELISPOT. Systemic toxicity
induced by the different RNA platforms and delivery methods is
determined by measuring blood markers of liver toxicity (including
aspartate aminotransferase (AST), alanine aminotransferase (ALT),
and alkaline phosphatase) as well as pro-inflammatory cytokines
(using cytometric bead array (CBA) assays).
[0517] Finally, after sacrificing the mice, qRT-PCR analysis is
performed on RNA extracted from the gastrocnemius muscle to detect
the levels of replicon RNA in the tissue.
TABLE-US-00020 TABLE 10 Comparison of immune responses by
homologous prime/boost using different RNA platforms and delivery
formats. Delivery Dose per Group Payload Type (i.m.) injection (ug)
Mice Prime/boost 1 -- LNP -- Balb/c(n = 8) 2 RSV F modRNA LNP 1.5
Balb/c(n = 8) 3 6 Balb/c(n = 8) 4 RSV F WT LNP 1.5 Balb/c(n = 8) 5
replicon 6 Balb/c(n = 8) 6 RSV F NCP LNP 1.5 Balb/c(n = 8) 7
replicon 6 Balb/c(n = 8) 8 -- e.p. -- Balb/c(n = 8) 9 RSV F modRNA
e.p. 1.5 Balb/c(n = 8) 10 6 Balb/c(n = 8) 11 RSV F WT e.p. 1.5
Balb/c(n = 8) 12 replicon 6 Balb/c(n = 8) 13 RSV F NCP e.p. 1.5
Balb/c(n = 8) 14 replicon 6 Balb/c(n = 8) 15 RSV F -- 0.5 Balb/c(n
= 8) protein + Alum Prime only 16 RSV F modRNA LNP 1.5 Balb/c(n =
8) 17 6 Balb/c(n = 8) 18 RSV F WT LNP 1.5 Balb/c(n = 8) 19 replicon
6 Balb/c(n = 8) 20 RSV F NCP LNP 1.5 Balb/c(n = 8) 21 replicon 6
Balb/c(n = 8) 22 RSV F modRNA e.p. 1.5 Balb/c(n = 8) 23 6 Balb/c(n
= 8) 24 RSV F WT e.p. 1.5 Balb/c(n = 8) 25 replicon 6 Balb/c(n = 8)
26 RSV F NCP e.p. 1.5 Balb/c(n = 8) 27 replicon 6 Balb/c(n = 8) 28
RSV F -- 0.5 Balb/c(n = 8) protein + Alum Assays: 1. Serum RSV F Ab
titers (Crucell) 2. Serum RSV VNA titers (Crucell) 3. Immune
response against RSV F by splenocyte (CD4+, CD8+ T cell) cytokine
(IFN-.gamma.) ELISpot (MIT) 4. Immune response against VEE
replicase by serumAb titers and splenocyte (CD4+, CD8+ T cell)
cytokine (IFN-.gamma.) ELISpot (MIT) 5. Liver toxicity markers and
pro-inflammatory cytokine measurements from the blood (MIT) 6.
qRT-PCR of replicon RNA from muscle (MIT)
Comparison of Immune Responses of Homologous vs Heterologous
Prime/Boost
[0518] The magnitude and quality of the immune responses against
RSV F following homologous (RNA-prime/RNA-boost or
protein-prime/protein-boost) or heterologous
(RNA-prime(RNA-boost)/protein boost) prime/boosting of the antigen
is compared.
[0519] Based on the results of the above, the optimal RNA platform,
delivery method, and two RNA doses to express the RSV F antigen are
determined. For the homologous RNA prime/boost, using this optimal
setup, RNA are unilaterally injected into the gastrocnemius muscles
of Balb/c mice (prime; day 0). Three and six weeks after this prime
injection, the mice receive a unilateral i.m. booster shot (boost;
days 21, 42). As a homologous protein prime/boost control,
aluminum-adjuvanted RSV F protein prime-only or prime (day 0)/boost
(day 21) injections is performed. These RNA or protein homologous
prime/boost groups are compared with heterologous prime/boost
injection groups in which an aluminum-adjuvanted RSV F protein
booster injection is administered following a single RNA prime
injection (day 0) or RNA prime (day 0)/boost (day 21) injections.
Prime-only groups for replicon (1.5 ug) as well as
aluminum-adjuvanted protein are also included as a control
(experimental groups and injection schedules are summarized in FIG.
72).
[0520] The immune responses against the RSV F antigen on days 14,
and/or 35, and/or 56 depending on the experimental group (as
described in FIG. 72) are assessed by measuring the serum Ab
titers, serum VNA titers, and antigen specific T cell activation
levels as described above. For the prime-only groups serum is drawn
every 14 days to follow the antibody responses against RSV F. For
these groups, the mice are sacrificed 56 days after the prime and
humoral and cellular immune responses are measured.
Small Molecule-Regulatable RNA Replicons for "One Shot" Prime/boost
Vaccination
[0521] The magnitude and quality of an immune response against an
antigen is established and may be improved by modulating the in
vivo quantity of the antigen expressed from an RNA replicon.
[0522] To this end, we first establish whether it is possible to
regulate the expression levels of a Fluc reporter protein in a
manner that would be meaningful for the purpose of modulating the
adaptive immune response. Regulation of target protein expression
is done by adapting the L7Ae/K-turn translational repression
system. The L7Ae repressor is fused to a destabilizing domain
derived from the E. coli DHFR protein (DDd). When fused to a
protein of interest, DDd targets the protein to the proteasome for
degradation. However, targeting of the protein to the proteasome
can be blocked by binding of the small molecule trimethoprim (TMP)
to DDd. A set of configurations to identify an optimal TMP
regulatable RNA replicon is screened (Circuit 1; "OFF switch") with
tandem subgenomic promoters (SGPs). The first SGP expresses a
(2x)DDd-L7Ae fusion protein and the second SGP expresses a Fluc
reporter whose translation can be controlled by binding of DDd-L7Ae
to K-turn motifs as follows:
SGP1(15) (2x)DDd-L7Ae SGP2(X) NxKt Fluc (IRES E3) (X=16, 30; N=2,
3, 4) (+TMP: DDd-L7Ae binding to motif.fwdarw.Fluc OFF; -TMP:
DDd-L7Ae degradation and no binding to motif.fwdarw.Fluc ON)
Circuit 1
[0523] The ON/OFF ratio (circuit performance) of each replicon in
the Circuit 1 library is first evaluated in C2C12 myotubes. The
most promising member (high ON/OFF ratio and low OFF state
expression) is subsequently tested in vivo. For this, two doses (1
and 6 ug) of the optimal Circuit 1 replicon is packaged with LNPs
and bilaterally injected into the gastrocnemius muscles of Balb/c
mice. TMP is added to the drinking water of the mice in the
following periodic pattern: (1 week-TMP [Fluc ON], 2 weeks+TMP
[Fluc OFF]).times.3 to see whether it would be possible to induce
three pulses of Fluc expression in vivo in mice. "No TMP" and
"constant TMP" groups as well as a constitutively repressed
replicon group expressing L7Ae are used as controls (experimental
groups and BLI schedules are summarized in FIG. 70).
[0524] Based on the in vivo performance of the injected replicon
circuit, up to two more attempts are made to reconfigure the
replicon and improve the performance of the circuit (if
necessary).
[0525] Once it has been established that it is possible to provide
sequential pulses of the Fluc reporter using the DD-L7Ae TMP OFF
switch in vivo, next, we regulate the expression of the RSV F
antigen using a replicon with the optimal circuit topology
identified above but encoding the antigen instead of Fluc (Circuit
2). The optimal dose (1 or 6 ug depending on the results of the
optimization experiment above) of Circuit 2 are packaged with LNPs
and unilaterally injected into the gastrocnemius muscles of Balb/c
mice (day 0). TMP is added to the drinking water of the mice in the
following pattern: (1 week-TMP [RSV F ON], 2 weeks +TMP [RSV F
OFF]).times.3 in order to modulate the expression of RSV F in vivo.
"No TMP" and "constant TMP" groups as well as a constitutively
repressed L7Ae replicon group are included as controls. The immune
responses against the RSV F antigen on days 21, 42, and 63 are
assessed by measuring the serum Ab titers, serum VNA titers, and
antigen specific T cell activation levels. Experimental groups and
assay schedules are summarized in FIG. 71.
[0526] If the optimal TMP-based RSV F antigen OFF switch (Circuit
2) contains IRES E3, control groups using a replicon identical to
Circuit 2 except in which the E3 protein is replaced with a "dummy"
protein (e.g. mVenus) are included to make sure that the E3 innate
immune inhibitor protein does not negatively affect the adaptive
immune response elicited against the RSV F antigen.
Materials:
In Vitro Reagents
[0527] DNA synthesis (IDT, GenScript), oligonucleotides (IDT),
restriction enzymes (NEB), PCR reagents (Agilent), T4 DNA ligase
(Promega), VEE replicon DNA template (manuscript in press), plasmid
DNA purification columns (Qiagen), DNA sequencing services
(Quintara), IVT kit (Life Technologies), modified NTPs (TriLink),
ARCA (TriLink), phosphatase (epicentre), RNA purification columns
(Qiagen), in vitro lipid transfection reagents (Life Technologies),
dsRNA-specific monoclonal Ab J2 (English & Scientific
Consulting), C2C12 myoblasts (kind gift from Dr. Barbara J. Wold,
Caltech), cell culture media (Life Technologies, ATCC), fetal
bovine serum (Thermo Fisher Scientific), donor equine serum (Thermo
Fisher Scientific), phosphate buffered saline (Corning), trypsin
(Corning), pipette tips, plastic ware other basic reagents and
supplies (VWR, Fisher, Westnet).
In vivo reagents
[0528] Anesthesia machine fee (Koch Institute), IVIS machine fee
(Koch Institute), flow cytometry facility fee (Koch Institute), CBA
assay FACS panel (BD Biosciences), dialysis device (Life
Technologies), liver and kidney toxicity enzyme detection kit
(Millipore), ELISpot reagents/plates (Millipore), ELISpot Abs
(MAbTech), RiboGreen.RTM. kit (Life Technologies), lipids (Avanti
Lipids), ACK lysis buffer (Sigma), isoflurane (MIT DCM Pharmacy),
Balb/c mice (The Jackson laboratory), NOD.SCID mice (The Jackson
laboratory), mouse facility charges (Koch Institute), pipette tips,
buffers, syringes, needles, other basic reagents and supplies (VWR,
Fisher, Westnet).
Equipment
[0529] Elutrap electroelution system (Whatmann), Qubit.RTM. 3.0
Fluorometer (Life Technologies), C18 HPLC column (Transgenomic),
AKTA pure (GE Healthcare), Agilent 2100 Bioanalyzer, ELISpot reader
(Zeiss)
Small Molecule-Inducible RNA Replicon Translational "ON Switch"
Respiratory Syncytial Virus (RSV) Vaccination
[0530] Replicons have recently received attention as vaccine
delivery vectors. Replicons can produce large quantities of an
antigen with sustained expression over many weeks. Additionally,
replicons have inherent adjuvant-like properties, stemming from
their viral origin. However, constitutive expression of an antigen
is often not enough to mount a sustained immune response. Most
vaccination strategies require prime-boosting, or delivery of two
different doses of antigen usually separated by several weeks.
Prime-boosting results in increased humoral and cell-mediated
immunity compared to a single dose of an antigen. Because replicons
have been shown to persist up to seven weeks in vivo,
replicon-encoded circuits may be used to create a single injection
prime-boost vaccination platform. Such a platform would be
extremely beneficial in areas of the world where it is difficult to
make repeat visits to a clinic. Instead of receiving a second
injection, the antigen could be regulated by a small molecule,
taken orally by the patient at the correct time.
[0531] As previously mentioned, the optimal prime-boost circuit
would be an ON switch, requiring two doses of a small molecule to
turn on antigen production during the prime and boost phases.
However, as we have shown, replicon-based ON switches are more
complex and require multiple regulatory elements. On the other
hand, OFF switches require only one DD-fused repressor, as shown in
FIG. 65. In this circuit, the luciferase reporter, Fluc, is
expressed in the absence of small molecule. This simpler OFF
circuit would require patients to take the small molecule for an
extended duration in between the prime and boost phases, but is an
ample proof of concept as we plan to move in vivo. To this end,
optimal configurations of this circuit are screened in myotubes
differentiated from C2C12 mouse myoblasts. SGP strength and K-turn
number are tested. How fold change is affected by the presence of
vaccinia virus E3, a viral inhibitor of the protein kinase R (PKR)
response is examined. The most promising configuration is then be
packaged into lipid nanoparticles (LNPs) and tested in vivo. The
LNPs are injected into the gastrocnemius muscles of Balb/c mice and
TMP is added or removed via the drinking water. If adequate fold
changes in luciferase are observed, RSV F antigen is substituted
into the circuit, and the immune response is determined by
measuring serum Ab titers and specific T cell activation
levels.
[0532] An RNA replicon-encoded small molecule regulatable "ON
switch" which functions robustly when injected i.m. into mice is
developed. An RNA replicon is created with tandem SGPs expressing a
TetR fusion protein (TetR-RE; RE=repression enhancer, to be
identified using the screen described below) from the first SGP and
a Fluc reporter whose translation can be controlled by binding of
TetR-RE to TetR aptamers (TetR-Apt) from the second SGP in the
following manner:
SGP1(15) TetR-RE SGP2(X) NxTetR-Apt Fluc (RE=member of Table RE;
X=5, 15, 30; N=2, 3, 4) (+Doxycycline [Dox]: No TetR-RE binding to
Apt 4 Fluc ON; -Dox: TetR-RE binding to Apt43 Fluc OFF) Circuit
3
[0533] RNA (1 or 6 ug) for the optimal Circuit 3 (optimized as
described below) is injected bilaterally into the gastrocnemius
muscles of Balb/c mice. The mice injected with Circuit 3 receive
either Dox or do not receive Dox in the drinking water and Fluc
expression is monitored by BLI for two weeks. As a negative
control, RNA identical to Circuit 3 except with TetR-RE replaced by
a mock repressor (mVenus-RE) that does not bind TetR-Apt is
injected into a different group of mice. Experimental groups are
summarized in FIG. 66.
[0534] The optimal Circuit 3 to be tested in the in vivo experiment
in FIG. 66 is determined by performing a fluorescence activated
cell sorting (FACS)/next generation RNA sequencing (RNA-Seq)-based
in vitro screen to identify a potent TetR-RE and an optimal circuit
configuration. To this end, we assemble a library of circuits with
each containing a unique "configuration barcodes" to facilitate
subsequent identification (total theoretical library size=57
[RE].times.3 [SGP2 variants].times.3 [TetR-Apt repeat
variants]=513) in the following format using the MoClo method (each
step being a "one-pot" assembly reaction):
SGP1(15) mVenus-2A-TetR-RE (configuration barcode) SGP2(X)
NxTetR-Apt mKate (RE=member of Table RE; X=5, 15, 30; N=2, 3, 4)
(+Doxycycline [Dox]: No TetR-RE binding to Apt 4 Fluc ON; -Dox:
TetR-RE binding to Apt 4 Fluc OFF) Circuit 4
[0535] Candidate REs to be screened and their functions related to
translational regulation are described in Table RE.
[0536] In order to enhance the throughput and reduce the cost of
the screen, cloning, DNA preparation, and IVT is performed in batch
(in one-pot reactions) for the entire library. The entire Circuit 4
library is then transfected into C2C12 myoblasts at a predetermined
low transfection efficiency by e.p. to ensure that the majority of
the transfected cells received one RNA circuit from the Circuit 4
library. The transfected cells are then divided into two: one group
is cultured in media containing Dox and the other group without
Dox. 24 h later, each group is separately processed by FACS. For
either group, cells that are mVenus negative are not collected as
those cells do not contain replicons from the Circuit 4 library.
The mVenus positive cells are then be sorted into eight different
bins by FACS based on their mKate expression levels using
predetermined cell standards (e.g. negative cells, cells harboring
SGP(5) mKate, SGP(15) mKate, SGP(30) mKate, etc.) as guides for
partitioning of the experimental sample. The RNA from each bin
(2[+/-Dox].times.8[expression levels]=16 total bins) are then
extracted and barcoded in batch (per bin). Subsequently, the
barcoded samples are pooled and processed for RNA-Seq to read the
configuration barcodes and determine the identities of TetR-RE,
SGP2(X), NxTetR-Apt, and the mKate expression level bin that the
replicon originated from (each mKate expression level bin is
assigned an intensity score of 1-8). For each unique replicon, the
geometric mean of the associated mKate intensity scores are
calculated (separately for +Dox and -Dox conditions). The strategy
of this screen is summarized in FIG. 62.
[0537] Members of the library with the largest differences in the
geometic means of the mKate scores under the two conditions
(+/-Dox) are tested for follow-up transfection and evaluation in
differentiated C2C12 myotubes. Promising TetR-RE and circuit
configurations identified from the Circuit 4 library are used to
construct Circuit 3 replicons for testing in vivo as described in
FIG. 66.
[0538] We discovered that enhancers of general translation such as
protein kinase R (PKR) inhibitors can increase the dynamic range of
small molecule-based regulation of replicon circuits in C2C12
myotubes. Therefore, to further improve the performance of the best
performing member of the Circuit 4 library, a screen to identify
general translation enhancers (GTEs) including but not limited to
IFN response antagonist proteins that may further boost the
performance of the optimal member of the Circuit 4 library when
expressed from an internal ribosomal entry site (IRES) sequence is
performed. Since it has been shown that certain IRES sequences may
be more resistant to PKR-induced translational inhibition than
others, we first identify the optimal IRES sequence to use for
cap-independent expression from VEE replicons. To this end, we test
the ability of known viral and synthetic IRES sequences
(benchmarked against the EMCV IRES) to drive the expression of a
Fluc reporter protein. Furthermore, we determine whether the
magnitude of the intracellular antiviral innate immune response
triggered by each IRES sequence is different by looking at the
expression of IFN-.beta., PKR, and IL-6 by quantitative
reverse-transcription PCR (qRT-PCR). Various IRES sequences (28
total) are tested in the following format initially in myotubes and
then in vivo in mice for promising candidates (FIG. 67):
SGP1(15) TetR SGP2(30) 2xTetR-Apt mKate IRES Fluc (IRES=member of
Table IRES) Circuit 5
[0539] IRES candidates to be screened and their origins are
described in Table IRES.
[0540] Once an optimal IRES sequence is determined above (Circuit
5), that IRES is used to express candidate GTEs to enhance the
performance of Circuit 4. To this end, a library of circuits (216
total) is constructed in the following format and screen by
FACS/RNA-seq as described below:
SGP1(15) mVenus SGP2(30) 2xTetR-Apt mKate IRES GTE (GTE=member of
Table GTE) Circuit 6
[0541] Candidate GTEs to be used in this screen and their
biological functions are described in Table GTE.
[0542] The workflow of this screen is similar to that of the screen
for Circuit 4 in FIG. 62. Cloning, DNA preparation, IVT, and
transfection into C2C12 cells for the GTE screen is performed in
batch for the entire Circuit 6 library. The transfected
(mVenus/mKate double positive) cells is sorted into eight different
bins (or more bins if mVenus/mKate 2D sorting is to be performed)
by FACS, the RNA is extracted, barcoded, sequenced and individual
replicons are scored based on their mKate expression levels as
described above. Alternatively, to identify potential synergistic
GTE combinations, single cells from the most highly expressed bin
(Bin 8) are cultured and GTEs being co-expressed in those cells are
identified by RNA extraction, barcoding and sequencing. The
strategy of this screen is summarized in FIG. 68.
[0543] Replicons of the Circuit 6 library containing the top GTE
candidates (i.e. with the highest mKate scores) are evaluated
further in C2C12 myotubes. The most promising GTEs are subsequently
expressed from an IRES off of the best Circuit 4 replicon and
tested for improved circuit performance in C2C12 myotubes. Secreted
GTEs that are expected to have paracrine effects are not included
in the FACS screen above but are individually cloned and tested
directly in myotubes. Once improvement is confirmed, the specific
circuit configuration is used to build a replicon in the Circuit 3
format for in vivo testing as described in FIG. 66.
[0544] A library of replicons (216 total) is constructed in the
following format:
SGP1(15) mVenus-2A-TetR-RE SGP2(X) NxTetR-Apt mKate IRES GTE (X=5,
15, 30; N=2, 3, 4; GTE=member of Table GTE) Circuit 7
[0545] The workflow of this screen is similar to that of the screen
for Circuit 4 in FIG. 62: cloning, DNA preparation, IVT, and
transfection into C2C12 cells for the screen are performed in batch
for the entire Circuit 7 library. The transfected (mVenus positive)
cells for each condition (+/-Dox) are separately sorted into eight
different bins by FACS based on their mKate expression levels. The
RNA for each condition/bin is extracted, barcoded, sequenced and
individual replicons are scored based on their mKate expression
levels for each condition as described above. The strategy of this
screen is summarized in FIG. 69.
[0546] Members of the Circuit 7 library with the largest
differences in the mKate scores under the two conditions (+/-Dox)
are tested for follow-up transfection/evaluation in differentiated
C2C12 myotubes. Promising circuit configurations identified from
the Circuit 7 library are used to construct Circuit 3 replicons
tested in vivo as described in FIG. 66.
[0547] Circuit optimization screens are found in FIGS. 73-76.
TABLE-US-00021 TABLE RE RE protein candidates to screen to identify
enhancers of TetR-mediated translational repression. Function in
translational Origin RE candidate regulation 1 African swine fever
g5R m7G decapping virus (ASFV) 2 Coxsackievirus B3 2A protease
eIF4G cleavage (CVB3) 3 CVB3 3C protease Cleavage of eIF5B 4
Encephalomyocarditis 2A protein (without Binds eIF4E virus (EMCV)
NLS) 5 EMCV 3C protease Dephosphorylation of eIF4E and 4E-BP1 6
Feline calicivirus 3C-like protease PABP cleavage (FCV) 7
Foot-and-mouth 3C protease eIF4A, PABP cleavage disease virus
(FMDV) 8 FMDV L protease eIF4G cleavage 9 Group A rotavirus NSP3
Competes with Pab1p for eIF4G (RVA) binding 10 Hantavirus (HV) N
Endonuclease that cleaves RNA 11 Human adenovirus 5 100K Binds
eIF4G and prevents Mnk1 (Ad5) recruitment/phosphorylation of eIF4E
12 Human Protease eIF4G, PABP cleavage immunodeficiency virus 1
(HIV-1) 13 HIV-1 Protease Cleavage of eIF4GI 14 Human rhinovirus 2A
protease eIF4G cleavage (HRV) 15 HRV 3C protease Cleavage of eIF5B
16 Human herpesvirus 1 vhs mRNA degradation (HSV) 17 Human T-cell
Protease Cleavage of eIF4GI leukemia virus (HTLV-1) 18 Influenza A
virus Pol Binds m7G cap and cleaves RNA (FluAV) 19 Human
herpesvirus 8 SOX RNA cleavage (KSHV) 20 MD145-12 3C-like protease
PABP cleavage 21 Measles virus (MV) N Interacts with eIF3 and
blocks translation 22 Poliovirus (PV) 2A protease eIF4G cleavage 23
PV 3C protease Cleavage of eIF5B, dephosphorylation of eIF4E and
4E-BP1 24 Moloney murine Protease 3C Cleavage of eIF4GI and eIF4GII
leukemia virus (MMLV) 25 Rabies virus (RV) M Interacts with eIF3
and blocks translation 26 SARS-CoV (SARS- Nsp1 Binds 40S ribosomal
subunit and CoV) degrades RNA 27 SARS-CoV S Inhibits eIF3f 28
SARS-CoV Spike Interacts with eIF3 and blocks translation 29 Simian
virus 40 Small T antigen 4E-BP1 dephosphorylation (SV40) 30
Vaccinia virus (VV) D10 m7G decapping 31 VV D9 m7G decapping 32
Mouse 4E-BP1 (constitutive Binds eIF4E and blocks initiation
active) 33 Mouse 4E-BP2 (constitutive Binds eIF4E and blocks
initiation active) 34 Mouse 4E-BP3 (constitutive Binds eIF4E and
blocks initiation active) 35 Mouse 4EHP Competes with eIF4E for cap
binding 36 Mouse Ago1 Component of the RNA-induced silencing
complex 37 Mouse Ago2 Component of the RNA-induced silencing
complex 38 Mouse Ago3 Component of the RNA-induced silencing
complex 39 Mouse Ago4 Component of the RNA-induced silencing
complex 40 Mouse CPEB2 Stalls elongation (can be recruited to 5'
and/or 3') 41 Mouse DDX6 CNOT complex interaction, P-body component
42 Mouse eIF4E Dominant negative (cap binding only) 43 Mouse eIF4E
(S209A) Dominant negative (cap binding only) 44 Mouse eIF4E (S209D)
Dominant negative (cap binding only) 45 Mouse eIF4E (S209E)
Dominant negative (cap binding only) 46 Mouse eIF4G (N-term)
Dominant negative (eIF4E interaction only) 47 Mouse FMRP Stalls
elongation (can be recruited to 5' and/or 3') 48 Mouse GW182 CNOT
complex recruitment 49 Mouse p54 ISG that inhibits eIF3 activity 50
Mouse p56 ISG that inhibits eIF3 activity 51 Mouse p60 ISG that
inhibits eIF3 activity 52 Mouse PABP (eIF4G binding Dominant
negative PABP domain) 53 Mouse PDCD4 Blocks eIF4A interaction with
eIF4G 54 Mouse RNase L (N.DELTA.385: constitutive active) 55 Mouse
Upf1 (constitutive RNA degradation active) 56 Mouse Me31B CNOT
complex interaction, P-body component 57 -- EBFP2 None (negative
control)
TABLE-US-00022 TABLE IRES IRES sequences for testing for optimal
protein expression from an RNA replicon. IRES viral family IRES
viral genus IRES (viral) species IRES group 1 Flaviviridae
Hepacivirus Hepatitis C virus (HCV) IRES Group II 2 Flaviviridae
Pestivirus Bovine diarrhea virus IRES Group II (BVDV) 3
Flaviviridae Pestivirus Classical swine fever IRES Group II virus
(CSFV) 4 Flaviviridae Pegivirus Hepatitis GB virus B IRES Group II
(GBV-B) 5 Flaviviridae Pegivirus Hepatitis GB virus A
(Uncategorized) (GBV-A) 6 Flaviviridae Pegivirus Hepatitis GB virus
C (Uncategorized) (GBV-C) 7 Picornaviridae Tremovirus Avian IRES
Group II Encephalomyelitis Virus (AEV) 8 Picornaviridae Cardiovirus
EMCV IRES Group III Theiler's Murine 9 Picornaviridae Cardiovirus
Encephalomyelitis Virus IRES Group III (TMEV) 10 Picornaviridae
Aphthovirus FMDV IRES Group III 11 Picornaviridae Aphthovirus
Equine rhinitis A virus IRES Group III (ERAV) 12 Picornaviridae
Erbovirus Equine rhinitis B virus IRES Group III (ERBV) 13
Picornaviridae Enterovirus PV IRES Group IV 14 Picornaviridae
Enterovirus CVB3 IRES Group IV 15 Picornaviridae Enterovirus Human
enterovirus 71 IRES Group IV (EV71) 16 Picornaviridae Enterovirus
Human rhinovirus-2 IRES Group IV (HRV-2) 17 Picornaviridae
Hepatovirus Hepatitis A virus (HAV) IRES Group IV 18 Potyviridae
Potyvirus Tobacco etch virus (Uncategorized) (TEV) 19
Polyomaviridae Polyomavirus SV40 (Uncategorized) 20 Retroviridae
Alpharetrovirus Rous sarcoma virus (Uncategorized) 21 Retroviridae
Betaretrovirus Mouse mammary (Uncategorized) tumor virus (MMTV) 22
Retroviridae Gammaretrovirus Murine leukemia virus (Uncategorized)
(MLV) 23 Retroviridae Gammaretrovirus Feline leukemia virus
(Uncategorized) (FLV) 24 Retroviridae Gammaretrovirus Avian
(Uncategorized) reticuloendotheliosis virus type A (REV-A) 25
Retroviridae Deltaretrovirus HTLV-4 (Uncategorized) 26 Retroviridae
Lentivirus HIV-1 (Uncategorized) 27 -- -- Homo sapiens c-Src
(Cellular IRES) 28 -- -- (Gtx.sub.133-141).sub.10(SI).sub.9.beta.
(Synthetic IRES)
TABLE-US-00023 TABLE GTE GTE protein candidates for screening to
identify enhancers of translation in myoblasts which may improve
TetR-mediated translational repression. GTE Origin candidate
Cellular target Function in translational 1 Guanarito virus Z RIG-I
Binds RIG-I; prevents (GTOV) association with MAVS 2 Junin virus
(JUNV) NP IFN induction Prevents IRF3 translocation or (general)
upstream event 3 JUNV Z RIG-I Binds RIG-I; prevents association
with MAVS 4 Lymphocytic NP IFN induction Prevents IRF3
translocation or choriomeningitis (general) upstream event virus
(LCMV) 5 Lassa virus (LV) NP IFN induction Prevents IRF3
translocation or (general) upstream event 6 Machupo virus NP IFN
induction Prevents IRF3 translocation or (MACV) (general) upstream
event 7 MACV Z RIG-I Binds RIG-I and prevents association with MAVS
8 Pichinde virus NP IFN induction Prevents IRF3 translocation or
(PINV) (general) upstream event 9 Sabia virus Z RIG-I Binds RIG-I
and prevents (SABV) association with MAVS 10 Whitewater NP IFN
induction Prevents IRF3 translocation or Arroyo virus (general)
upstream event (WWAV) 11 Borna disease P TBK1 Inhibition of TBK1
activity virus (BDV) (possible decoy substrate) 12 Andes virus M
STAT1, STAT2 Not determined (ANDV) 13 ANDV Gn TRAF3 Binds TRAF3;
prevents interaction with TBK1 14 Crimean-Congo L (OTU) ISG15
Catalytic deconjugation from hemorrhagic fever targets virus
(CCHFV) 15 La Crosse virus NSs IFN induction Not determined (LACV)
(LACV) (general) 16 Prospect Hill virus M STAT1, STAT2 STAT
phosphorylation and (PHV) translocation 17 Punta Toro virus NSs IFN
induction Not determined (PTV) (general) 18 Ebola virus VP24 STAT1
Binds karyopherin .alpha.1/5/6; (EBOV) prevents STAT1 translocation
19 EBOV VP35 dsRNA, IKK.epsilon., PKR, dsRNA binding; functions
IRF7 proximal of IRF3; binds IKK.epsilon. and inhibits function;
prevents PKR activation; prevents PACT activation; binds and
mediates SUMOylation 20 Marburgvirus VP40 JAK1 Prevents
phosphorylation of (MARV) JAK1 21 FluAV NS1 PKR, OAS, mRNA Binding
dsRNA; PKR inhibition; processing and PACT inhibition; binding
transport, mRNA prevents activation of OAS; export, TRIM25, binds
CPSF30 and PABII; binds JAK-STAT pathway mRNA export machinery;
binding prevents RIG-I ubiquitination; sOCS-1 and -3 upregulation
22 Influenza B virus NS1 PKR, ISG15, IFN Binding dsRNA-PKR complex;
(FluBV) transcription sequesters human ISG15; inhibits RIG-I
signaling 23 Bovine V MDA5 Not determined parinfluenzavirus 3
(bPIV3) 24 Bovine repiratory NS1 TRAF3/IKK.epsilon. Reduces protein
levels syncytial virus (bRSV) 25 bRSV NS2 TRAF3 Reduces protein
levels 26 Hendra virus V STAT1, STAT2, Change sub-cellular
localization (HendraV) MDA5 by complex formation; prevents MDA5
homodimerization 27 Human G RIG-I Binds RIG-I and inhibits
metapneumovirus activation (hMPV) 28 Human V STAT1, MDA5 Prevents
phosphorylation parainfluenza virus 2 (hPIV2) 29 Menangle virus V
MDA5 Prevents MDA5 (MENV) homodimerization 30 Mapuera virus V
ISGF3, MDA5 Inhibits ISGF3 formation; (MPRV) prevents MDA5
homodimerization 31 Mumps virus V STAT1, STAT1, Formation of
V/RACK-1/STAT1 (MuV) STAT3, MDA5 complex; proteasomal degradation
32 MV C IFN induction Complex formation IFNAR1; (general), JAK-STAT
RACK1 and STAT1 pathway 33 MV P JAK-STAT pathway STAT1
phosphorylation and cytoplasmic retention 34 MV V MDA5, STAT1,
Cytoplasmic sequestering and STAT2, JAK-STAT inhibition
phosphorylation; pathway complex formation IFNAR1; RACK1 and STAT1
35 Nipah virus P STAT1 Cytoplasmic sequestering (NipahV) 36 NipahV
V STAT1 Cytoplasmic sequestering 37 NipahV W STAT1 Nuclear
sequestering 38 Rinder pest virus C IFN induction Not determined
(RPV) (general) 39 RPV P STAT1, STAT2 Not determined 40 RPV V
STAT1, STAT2 Not determined 41 Salem virus V MDA5 Prevents MDA5
(SALV) homodimerization 42 Sendai virus C IFN induction Prevents
IRF3 phosphorylation (SeV) (general), STAT1, (or earlier);
proteasomal STAT2, STAT1 degradation; complex formation 43 SeV V
IFN induction Prevents IRF3 phosphorylation (general) (or earlier)
44 SeV V MDA5 Prevents MDA5 homodimerization 45 SeV Y1 IFN
induction Prevents IRF3 phosphorylation (general) (or earlier) 46
SeV Y2 IFN induction Prevents IRF3 phosphorylation (general),
JAK-STAT (or earlier) pathway 47 Simian P IFN induction Prevents
IRF3 dimerization (or parainfluenza (general) earlier) virus 5
(SV5) 48 SV5 V IFN induction Prevents IRF3 translocation (or
(general), STAT1, earlier); proteasomal MDA5 degradation; prevents
MDA5 homodimerization 49 RV N IFN induction Not determined
(general) 50 RV P STAT1, IRF3, PML Prevents nuclear STAT1
accumulation and DNA binding; interferes with TBK1 activity; binds
to PML; retains it in the cytoplasm 51 Equine arteritis Nsp2 ISG15
Catalytic deconjugation from virus (EAV) targets 52 Porcine Nsp1a
IFN induction Not determined reproductive and (general) respiratory
syndrome virus (PRRSV) 53 PRRSV Nsp1b IFN induction Interference
with MAVS (general), JAK-STAT pathway 54 PRRSV nsP11 RLR evasion
Ribonuclease 55 Murine hepatitis N IFN induction Not determined
virus (MHV) (general), RNaseL 56 MHV ns2 OAS
2',5'-phosphodiesterase 57 MHV Nsp3 (Plpro) IRF3 Deubiquitinates
IRF3 and prevents activation 58 Middle east ORF-4a RIG-I/MDA5 PACT
inhibition respiratory signaling syndrome coronavirus (MERS-CoV) 59
MERS-CoV ORF-4b IFN induction Not determined 60 MERS-CoV
Papain-like ISG15 DeISGylation protein (PLP) 61 SARS-CoV M
TBK1/IKK.epsilon. Sequesters TRAF3/TANK/TBK1/IKK.epsilon. 62
SARS-CoV N IFN induction Prevents activity; prevents (general)
RIG-I, MDA5 activation; possibly masks dsRNA 63 SARS-CoV nsP3
(Plpro) IFN induction Deconjugation of ISG15 from (general), ISG15,
targets; binding to IRF3; IRF3 prevents STING, RLR-mediated
activation of MAVS; TRAF3; prevents STAT1 signaling 64 SARS-CoV
nsP14 RLR evasion 3' to 5' exonuclease 65 SARS-CoV ORF3a IFNAR1
Degradation 66 SARS-CoV ORF3b IFN induction Possibly prevents RLR
(general) mediated MAVS signaling 67 SARS-CoV ORF6 STAT1 Prevents
STAT1 nuclear import (karyopherin .alpha.2 binding); possibly
prevents RLR mediated MAVS signaling 68 BVDV Erns dsRNA dsRNA
binding and cleavage 69 BVDV Npro IRF3 Proteasomal degradation 70
CSFV Erns IFN induction dsRNA binding (general) 71 CSFV Npro IRF3,
I.kappa.B.alpha. Proteasomal degradation; binds 72 Dengue virus NS5
STAT2 Proteasomal degradation; binds (DENV) (proteolytically- and
prevents processed) phosphorylation/degradation 73 DENV NS2A STAT1
Prevents translocation 74 DENV NS2B/3 STING, IRF3 Cleaves STING,
prevents protease translocation of IRF3 75 DENV NS4A STAT1 Prevents
translocation 76 DENV NS4B STAT1 Not determined 77 GBV-B NS3/4a
MAVS Cleavage 78 HCV Core JAK-STAT pathway SOCS-3 activation;
prevents IRF3 activation; inhibits STAT1 activation 79 HCV E2 PKR
PKR binding 80 HCV NS2 IRF3 Prevents IRF3 activation 81 HCV NS3
TBK1 Binding to TBK1 prevents association with IRF3 82 HCV NS3/4A
MAVS, TRIF Cleavage 83 HCV NS4B JAK-STAT pathway Inhibits signaling
through STING 84 HCV NS5A IRF1, PKR, RNaseL, IL-8 induction;
Karyopherin .beta.3; IFN induction myD88 binding prevents IRAK1
(general), TLR association; binding prevents signalling, STAT1
phosphorylation 85 Japanese E JAK-STAT pathway Not determined
encephalitis virus (JEV) 86 JEV NS2A PKR Binds PKR and blocks
activation 87 JEV NS4A DDX42/IFN Interaction with DDX42 signaling
88 JEV NS5 STAT1, TYK2 Activates phosphatase and prevents
phosphorylation 89 Langat virus NS5 JAK1, TYK2 Complex formation
IFNAR1; (LGTV) complex formation IFNAR1 90 Tick-borne NS5 JAK-STAT
pathway Binds PDZ protein scribble and encephalitis virus blocks
STAT1 phosphorylation (TBEV) 91 West Nile virus NS1 IRF3,
NF-.kappa.B Inhibits translocation (WNV) 92 WNV NS2A JAK1, TYK2
Prevents phosphorylation 93 WNV NS2B JAK1, TYK2 Prevents
phosphorylation 94 WNV NS3 JAK1, TYK2 Prevents phosphorylation 95
WNV NS4A JAK1, TYK2 Prevents phosphorylation 96 WNV NS4B JAK1, TYK2
Prevents phosphorylation 97 WNV NS5 JAK-STAT pathway Not determined
98 Yellow fever virus NS4B STING Cleavage (YFV) 99 ECMV Leader
protein IRF3 Prevents dimerization 100 Hepatitis A virus 3ABC MAVS
Protealytic cleavage (HAV) precursor 101 Human rhinovirus 2A MAVS
Cleavage (HRV) 102 HRV 3C protease MAVS Cleavage 103 PV RNaseL
ciRNA RNaseL Competetively inhibits RNaseL (3C) 104 TMEV Leader
protein IRF3 Nucleo-cytoplasmic trafficking 105 Human E1A CBP/p300,
STAT1 Association cellular CBP/p300; adenovirus 5 binding STAT1;
prevents (Ad 5) phosphorylation (or earlier) 106 Ad5 E4-ORF1 PI3K
Activation 107 Ad5 E4 ORF3 JAK-STAT pathway, Redistrubution NBs;
disruption PML/Daxx nuclear bodies 108 Ad5 E4-ORF4 mTORC1
Activation 109 Ad5 VAI RNA PKR, ADAR Binding 110 ASFV A238L
I.kappa.B Competitive non-functional I.kappa.B homologue 111 ASFV
DP17L eIF2.alpha. Dephosphorylation by PP2A
recruitment 112 A. californica PK2 PKR Inhibition of PKR action
multiply- embedded nuclear polyhedrosis virus (AcMNPV) 113 Bovine
herpes ICP0 IRF7, IRF3 Binds and prevents trans- virus 1 (BoHV-1)
activation of promoter; mediates proteasomal degradation 114
Epstein-Barr virus BZLF-1 IFN transcription Not determined (EBV)
115 EBV EBER-1 RNA PKR Binding 116 EBV EBER-2 RNA PKR Binding 117
EBV LF2 IRF7 Binding prevents dimerization 118 EBV LMP-1 TYK2,
STAT2 Prevents phosphorylation; prevents phosphorylation 119 EBV
LMP2A mTORC1 Upregulation of mTORC1 signaling 120 EBV SM PKR dsRNA
binding; PKR binding 121 Human IE1 disassemble NBs, Alter SUMO-1
modification; cytomegalovirus STAT2 sequestration of STAT2 (HCMV)
122 HCMV IRS1 PKR Binds dsRNA and prevents PKR activation 123 HCMV
IE86 NF-.kappa.B Prevents NF-.kappa.B mediated transcription 124
HCMV M27 STAT2 Not determined 125 HCMV TRS1 PKR Binds dsRNA and
prevents PKR activation 126 HCMV UL38 TSC2/mTORC1 TSC2 inactivation
and downstream mTORC1 activation 127 HCMV UL69 eIF4E Binds
eIF4A/PABP and releases 4E-BP1 from eIF4E 128 Human IE1 IRF3
Prevents IFN promoter binding herpesvirus 6 (HHV-6) 129 HSV
.gamma.34.5 protein eIF2.alpha. Binds GADD34 (MyD116), recuits
protein phosphatase 1 (PP1) and prevents phosphorylation 130 HSV gB
PERK Binding 131 HSV ICP0 IRF3 translocation, Recruitment IRF3 and
PML, disassemble CBP/p300 to nuclear NBs structures; proteasomal
degradation PML; alter SUMO-1 modification 132 HSV ICP6 eIF4E
Facilitates eIF4E/eIF4G interaction during stress 133 HSV ICP27
mRNA synthesis ICP27 induces soluble inhibitor and splicing, JAK-
of signaling STAT pathway 134 HSV UL13 JAK-STAT pathway SOCS3
upregulation 135 HSV UL41 JAK-STAT pathway SOCS3 upregulation 136
HSV US3 Akt substrates Ser/thr kinase (Akt mimic) phorphoryaltes
Akt substrates 137 HSV US11 PKR, 2'5'-OAS dsRNA binding 138 Human
ORF45 IRF7 Prevents phosphorylation herpesvirus 8 (KSHV) 139 KSHV
RIF (ORF 10) IFNAR/JAK1/TYK2/ Sequesters signaling molecules STAT2
in complex 140 KSHV vGPCR mTORC1 Upregulation of mTORC1 signaling
141 KSHV vIL-6 TYK-2 Activation cellular gp130 reduces
phosphorylation 142 KSHV vIRF1 (K9) IRF1 mediated IFN Interference
w/cellular IRFs; transcription, p300 Association cellular CBP/p300
143 KSHV vIRF2 IRF1/2/3 reg. Interference w/cellular IRFs;
transcription, IRF3, enhances caspase-3 mediated p300, PKR
inactivation; association cellular CBP/p300; binding to PKR 144
KSHV vIRF3 IRF3, IRF5, IRF7 Associates with IRFs and prevents DNA
binding 145 KSHV LANA2 eIF2.alpha. Inhibitis eIF2.alpha.
phosphorylation 146 Human IE63 eIF2.alpha. (or earlier) Prevents
phosphorylation herpesvirus 3 (Varicella-Zoster) (VZV) 147 VZV
ORF66 prot JAK-STAT (or Not determined earlier) 148 Human papilloma
E6 IRF3 activation, Binding to IRF3; virus 16 (HPV-16) STAT1,
STAT2, binding/prevent TYK2, eIF2.alpha. phosphorylation;
dephosphorylation 149 HPV-16 E7 IRF1 Binding to IRF1 prevents
association with IFNb promoter 150 Merkel cell Small T mTORC1
Activation polyomavirus antigen (MCPyV) 151 Murine Large T
polyomavirus antigen JAK1 Binding (MPyV) 152 Monkeypox virus B16
Secreted IFN .alpha./.beta. Soluble receptor decoy (MPXV) 153
Myxoma virus M-T5 Akt Activation (MYXV) 154 Variola virus B17
Secreted IFN .alpha./.beta. Soluble receptor decoy (VARV) 155 VARV
H1 STAT1 Dephosphorylation STAT1 156 VV A46R TRIF Decoy MyD88 and
TRIF-like adaptors 157 VV A46R MyD88 Decoy MyD88 and TRIF-like
adaptors 158 VV A52R MyD88 Decoy MyD88 and TRIF-like adaptors 159
VV B18R Secreted IFN.alpha./.beta. Soluble receptor decoy 160 VV
B8R Secreted IFN.gamma. Soluble receptor decoy 161 VV BRLF1 IFN
induction Not determined (general) 162 VV C7L Anti-viral effectors
Not determined 163 VV E3L IFN induction dsRNA binding; sequesters
(general), PKR, ISG15 ISG15 164 VV H1 STAT1 Dephosphorylation STAT1
165 VV K1L Anti-viral effectors Not determined 166 VV K3L PKR
eIF2.alpha. decoy 167 VV N1L TBK1/IKK complex Physical interaction
with TBK1; iKK.alpha./.beta./.epsilon. and TANK 168 VV VH1 STAT1
VH1 phosphatase reverts STAT1 phosphorylation 169 Yaba-like disease
Y136 Type I and III IFN Binding to type I and III IFNs virus (YLDV)
receptor sign. 170 Hepatitis B virus C IFN induction IFN
transcription (or earlier (HBV) (general), MxA steps); interaction
core with MxA promoter region 171 HBV HBsAg/HBeAg IFN induction Not
determined (general) 172 HBV Polymerase TBK1/IKK.epsilon.
Interferes with IRF3 activation complex, STAT1 by
TBK1/IKK.epsilon.; binds STAT1 and blocks transcriptional activity
173 RVA VP3 OAS 2',5'-phosphodiesterase 174 Porcine rotavirus NSP1
IRF3, IRF5, IRF7, Proteasomal degradation; (pRotaV) NF-.kappa.B
proteasomal degradation; proteasomal degradation; proteasomal
degradation of .beta.- TrCP 175 pRotaV NSP3 PKR dsRNA binding 176
Avian reovirus M1, S2, L2 IFN induction Not determined (ReoV)
(general) 177 ReoV .mu.2 IRF9 Modulates interaction IRF9 and STATs
178 ReoV .sigma.3 PKR dsRNA binding 179 ReoV .sigma.A PKR dsRNA
binding 180 HIV-1 Vif APOBEC3G Mediates APOBEC3G proteasomal
degradation 181 HIV-1 gp120 TLR9 Not determined 182 HIV-1 TAR RNA
PKR Not determined 183 HIV-1 Tat PKR competition with eIF2.alpha.
184 HIV-1 Vpr IFN induction Not determined (general) 185 HIV-1 Vpu
IRF3 Degradation 186 HTLV-1 Tax CBP/p300 Binding competion with
STAT-2 187 Torque Teno virus ORF2 NF-.kappa.B Inhibits I.kappa.B
degradation and (TTV) physical interaction with IKK.alpha. and
IKK.beta. 188 Mouse USP18 IFN signaling DeISGylation 189 Mouse TAR
RNA PKR Inhibits PKR binding protein (TRBP) 190 Mouse p58IPK PKR
Prevents PKR dimerization/activation 191 Mouse p67 eIF2.alpha.
Inhibits phosphorylation 192 Mouse Nucleophosmin PKR Binds PKR and
inhibits eIF2.alpha. phosphorylation 193 Mouse IDO1 Not determined
Tryptophan-catabolizing enzyme 194 Mouse APOBEC3A Not determined
Cytidine deaminase 195 Mouse SOCS-1 JAK/STAT1 Inhibition 196 Mouse
SOCS-3 JAK/STAT1 Inhibition 197 Mouse Hsp27 eIF4F Facilitates eIF4F
formation during stress 198 Mouse Polyadenylate- PABP Activation of
translation binding protein- interacting protein 1 (Paip1) 199
Mouse Ligatin (eIF2D) Met-tRNAi GTP independent delivery of
Met-tRNAi to P site of ribosome 200 Mouse eIF2.alpha. eIF2.alpha.
Increased translation (constitutive active) 201 Mouse
eIF2B.delta./.epsilon. eIF2B.delta./E Increased translation
(constitutive active) 202 Mouse eIF4E eIF4E Increased translation
(constitutive active) 203 Mouse GADD34 + PP1 eIF2.alpha.
eIF2.alpha. dephosphorylation 204 Mouse CReP + PP1 eIF2.alpha.
eIF2.alpha. dephosphorylation 205 Mouse Siglec-G RIG-I Degradation
206 Mouse PI3K 4EBP, eIF4B Phosphorylation 207 Mouse Myr-Akt 4EBP,
eIF4B Phosphorylation 208 Mouse mTOR 4EBP, eIF4B Phosphorylation
209 Mouse Follistatin 4EBP, eIF4B Phosphorylation 210 Mouse
Dominant PKR Inhibition negative PKR 211 Mouse Dominant RIG-I
Inhibition negative RIG-I 212 Mouse Dominant MDA5 Inhibition
negative MDA5 213 Mouse Dominant TLR3 Inhibition negative TLR3 214
Mouse Dominant TLR7 Inhibition negative TLR7 215 Mouse Dominant
TLR8 Inhibition negative TLR8 216 -- EBFP2 -- None (negative
control)
[0548] While several inventive embodiments have been described and
illustrated herein, those of ordinary skill in the art will readily
envision a variety of other means and/or structures for performing
the function and/or obtaining the results and/or one or more of the
advantages described herein, and each of such variations and/or
modifications is deemed to be within the scope of the inventive
embodiments described herein. More generally, those skilled in the
art will readily appreciate that all parameters, dimensions,
materials, and configurations described herein are meant to be
exemplary and that the actual parameters, dimensions, materials,
and/or configurations will depend upon the specific application or
applications for which the inventive teachings is/are used. Those
skilled in the art will recognize, or be able to ascertain using no
more than routine experimentation, many equivalents to the specific
inventive embodiments described herein. It is, therefore, to be
understood that the foregoing embodiments are presented by way of
example only and that, within the scope of the appended claims and
equivalents thereto, inventive embodiments may be practiced
otherwise than as specifically described and claimed. Inventive
embodiments of the present disclosure are directed to each
individual feature, system, article, material, kit, and/or method
described herein. In addition, any combination of two or more such
features, systems, articles, materials, kits, and/or methods, if
such features, systems, articles, materials, kits, and/or methods
are not mutually inconsistent, is included within the inventive
scope of the present disclosure.
[0549] All definitions, as defined and used herein, should be
understood to control over dictionary definitions, definitions in
documents incorporated by reference, and/or ordinary meanings of
the defined terms.
[0550] All references, patents and patent applications disclosed
herein are incorporated by reference with respect to the subject
matter for which each is cited, which in some cases may encompass
the entirety of the document.
[0551] The indefinite articles "a" and "an," as used herein in the
specification and in the claims, unless clearly indicated to the
contrary, should be understood to mean "at least one."
[0552] The phrase "and/or," as used herein in the specification and
in the claims, should be understood to mean "either or both" of the
elements so conjoined, i.e., elements that are conjunctively
present in some cases and disjunctively present in other cases.
Multiple elements listed with "and/or" should be construed in the
same fashion, i.e., "one or more" of the elements so conjoined.
Other elements may optionally be present other than the elements
specifically identified by the "and/or" clause, whether related or
unrelated to those elements specifically identified. Thus, as a
non-limiting example, a reference to "A and/or B", when used in
conjunction with open-ended language such as "comprising" can
refer, in one embodiment, to A only (optionally including elements
other than B); in another embodiment, to B only (optionally
including elements other than A); in yet another embodiment, to
both A and B (optionally including other elements); etc.
[0553] As used herein in the specification and in the claims, the
phrase "at least one," in reference to a list of one or more
elements, should be understood to mean at least one element
selected from any one or more of the elements in the list of
elements, but not necessarily including at least one of each and
every element specifically listed within the list of elements and
not excluding any combinations of elements in the list of elements.
This definition also allows that elements may optionally be present
other than the elements specifically identified within the list of
elements to which the phrase "at least one" refers, whether related
or unrelated to those elements specifically identified. Thus, as a
non-limiting example, "at least one of A and B" (or, equivalently,
"at least one of A or B," or, equivalently "at least one of A
and/or B") can refer, in one embodiment, to at least one,
optionally including more than one, A, with no B present (and
optionally including elements other than B); in another embodiment,
to at least one, optionally including more than one, B, with no A
present (and optionally including elements other than A); in yet
another embodiment, to at least one, optionally including more than
one, A, and at least one, optionally including more than one, B
(and optionally including other elements); etc.
[0554] It should also be understood that, unless clearly indicated
to the contrary, in any methods claimed herein that include more
than one step or act, the order of the steps or acts of the method
is not necessarily limited to the order in which the steps or acts
of the method are recited.
[0555] In the claims, as well as in the specification above, all
transitional phrases such as "comprising," "including," "carrying,"
"having," "containing," "involving," "holding," "composed of," and
the like are to be understood to be open-ended, i.e., to mean
including but not limited to. Only the transitional phrases
"consisting of" and "consisting essentially of" shall be closed or
semi-closed transitional phrases, respectively, as set forth in the
United States Patent Office Manual of Patent Examining Procedures,
Section 2111.03.
Sequence CWU 1
1
56119DNAArtificial SequenceSynthetic Polynucleotide 1aagggcatcg
acttcaagg 19221DNAArtificial SequenceSynthetic Polynucleotide
2tgcttgtcgg ccatgatata g 21323DNAArtificial SequenceSynthetic
Polynucleotide 3ctgacctgga aactgagact atg 23422DNAArtificial
SequenceSynthetic Polynucleotide 4ggcgactcta actcccttat tg
22523DNAArtificial SequenceSynthetic Polynucleotide 5ccctataact
ctctacggct aac 23618DNAArtificial SequenceSynthetic Polynucleotide
6agaagtcgtg ctgcttca 18723DNAArtificial SequenceSynthetic
Polynucleotide 7ggcgtggttt agagtaggta taa 23820DNAArtificial
SequenceSynthetic Polynucleotide 8tcgtctcgtt ggtacctttc
20922DNAArtificial SequenceSynthetic Polynucleotide 9gctgaatgga
tcagctctaa ct 221020DNAArtificial SequenceSynthetic Polynucleotide
10cagtctgggt tgccacttta 201124DNAArtificial SequenceSynthetic
Polynucleotide 11acctgtagcg ttcgtcagtc ctct 2412849RNAArtificial
SequenceSynthetic Polynucleotide 12gggcgaauua agagagaaaa gaagaguaag
aagaaauaua agacaccggu cgccaccaug 60gacggguccg gggagcagcc cagaggcggg
gggcccacca gcucugagca gaucaugaag 120acaggggccc uuuugcuuca
ggguuucauc caggaucgag cagggcgaau ggggggggag 180gcacccgagc
uggcccugga cccggugccu caggaugcgu ccaccaagaa gcugagcgag
240ugucucaagc gcaucgggga cgaacuggac aguaacaugg agcugcagag
gaugauugcc 300gccguggaca cagacucccc ccgagagguc uuuuuccgag
uggcagcuga cauguuuucu 360gacggcaacu ucaacugggg ccggguuguc
gcccuuuucu acuuugccag caaacuggug 420cucaaggccc ugugcaccaa
ggugccggaa cugaucagaa ccaucauggg cuggacauug 480gacuuccucc
gggagcggcu guugggcugg auccaagacc agggugguug ggacggccuc
540cucuccuacu uugggacgcc cacguggcag accgugacca ucuuuguggc
gggagugcuc 600accgccucgc ucaccaucug gaagaagaug ggcugacucu
agaccuucug cggggcuugc 660cuucuggcca ugcccuucuu cucucccuug
caccuguacc ucuuggucuu ugaauaaagc 720cugaguagga aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 780aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 840aaaaaaaaa
849131158RNAArtificial SequenceSynthetic Polynucleotide
13ggauccguga ucggaaacgu gagauccacc ucagauccgc uaggacaccc gcagaucgag
60aagaaggcga auuaagagag aaaagaagag uaagaagaaa uauaagacac cggucgccac
120cauggacggg uccggggagc agcccagagg cggggggccc accagcucug
agcagaucau 180gaagacaggg gcccuuuugc uucaggguuu cauccaggau
cgagcagggc gaaugggggg 240ggaggcaccc gagcuggccc uggacccggu
gccucaggau gcguccacca agaagcugag 300cgagugucuc aagcgcaucg
gggacgaacu ggacaguaac auggagcugc agaggaugau 360ugccgccgug
gacacagacu ccccccgaga ggucuuuuuc cgaguggcag cugacauguu
420uucugacggc aacuucaacu ggggccgggu ugucgcccuu uucuacuuug
ccagcaaacu 480ggugcucaag gcccugugca ccaaggugcc ggaacugauc
agaaccauca ugggcuggac 540auuggacuuc cuccgggagc ggcuguuggg
cuggauccaa gaccagggug guugggacgg 600ccuccucucc uacuuuggga
cgcccacgug gcagaccgug accaucuuug uggcgggagu 660gcucaccgcc
ucgcucacca ucuggaagaa gaugggcuga gcggccgcua aaccaucuuu
720accagacagu guuaccaucu uuaccagaca guguuaccau cuuuaccaga
caguguuacc 780aucuuuacca gacaguguua aucgauucca uaaaguagga
aacacuacau ccauaaagua 840ggaaacacua cauccauaaa guaggaaaca
cuacauccau aaaguaggaa acacuacaaa 900gcuuaaccca uggaauucag
uucucaaacc cauggaauuc aguucucaaa cccauggaau 960ucaguucuca
aacccaugga auucaguucu cagucgaagc uucgaauucu gcagucgacu
1020gaauaaagcc ugaguaggaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa 1080aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa 1140aaaaaaaaaa aaaaaaaa
1158141509RNAArtificial SequenceSynthetic Polynucleotide
14gggcgaauua agagagaaaa gaagaguaag aagaaauaua agacaccggu cgccaccaug
60uacgugagau uugagguucc ugaggacaug cagaacgaag cucugagucu gcuggagaag
120guuagggaga gcgguaaggu aaagaaaggu accaacgaga cgacaaaggc
uguggagagg 180ggacuggcaa agcucguuua caucgcagag gauguugacc
cgccugagau cguugcucau 240cugccccucc ucugcgagga gaagaaugug
ccguacauuu acguuaaaag caagaacgac 300cuuggaaggg cugugggcau
ugaggugcca ugcgcuucgg cagcgauaau caacgaggga 360gagcugagaa
aggagcuugg aagccuugug gagaagauua aaggccuuca gaagggaucu
420ggcgccacca acuucucucu gcugaagcag gccggcgacg uggaggagaa
cccaggccca 480auggcgcacg cugggagaac gggguacgau aaccgggaga
uagugaugaa guacauccau 540uauaagcugu cgcagagggg cuacgagugg
gaugcgggag augugggcgc cgcgcccccg 600ggggccgccc ccgcaccggg
caucuucucc ucccagcccg ggcacacgcc ccauccagcc 660gcaucccggg
acccggucgc caggaccucg ccgcugcaga ccccggcugc ccccggcgcc
720gccgcggggc cugcgcucag cccggugcca ccuguggucc accugacccu
ccgccaggcc 780ggcgacgacu ucucccgccg cuaccgccgc gacuucgccg
agauguccag ccagcugcac 840cugacgcccu ucaccgcgcg gggacgcuuu
gccacggugg uggaggagcu cuucagggac 900ggggugaacu gggggaggau
uguggccuuc uuugaguucg guggggucau guguguggag 960agcgucaacc
gggagauguc gccccuggug gacaacaucg cccuguggau gacugaguac
1020cugaaccggc accugcacac cuggauccag gauaacggag gcugggaugc
cuuuguggaa 1080cuguacggcc ccagcaugcg gccucuguuu gauuucuccu
ggcugucucu gaagacucug 1140cucaguuugg cccugguggg agcuugcauc
acccugggug ccuaucuggg ccacaaguga 1200gucuagaccu ucugcggggc
gacgagcugu acaaguaauu cuagaagauc ccaaaucaac 1260aucagucuga
uaagcuauca acaucagucu gauaagcuau caacaucagu cugauaagcu
1320aucaacauca gucugauaag cuaagaucuc ccgggcguac aaguaaagcg
ugaauaaagc 1380cugaguagga aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa 1440aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1500aaaaaaaaa
1509151413RNAArtificial SequenceSynthetic Polynucleotide
15gggcgaauua agagagaaaa gaagaguaag aagaaauaua agacaccggu cgccaccaug
60uacgugagau uugagguucc ugaggacaug cagaacgaag cucugagucu gcuggagaag
120guuagggaga gcgguaaggu aaagaaaggu accaacgaga cgacaaaggc
uguggagagg 180ggacuggcaa agcucguuua caucgcagag gauguugacc
cgccugagau cguugcucau 240cugccccucc ucugcgagga gaagaaugug
ccguacauuu acguuaaaag caagaacgac 300cuuggaaggg cugugggcau
ugaggugcca ugcgcuucgg cagcgauaau caacgaggga 360gagcugagaa
aggagcuugg aagccuugug gagaagauua aaggccuuca gaagggaucu
420ggcgccacca acuucucucu gcugaagcag gccggcgacg uggaggagaa
cccaggccca 480auggcgcacg cugggagaac gggguacgau aaccgggaga
uagugaugaa guacauccau 540uauaagcugu cgcagagggg cuacgagugg
gaugcgggag augugggcgc cgcgcccccg 600ggggccgccc ccgcaccggg
caucuucucc ucccagcccg ggcacacgcc ccauccagcc 660gcaucccggg
acccggucgc caggaccucg ccgcugcaga ccccggcugc ccccggcgcc
720gccgcggggc cugcgcucag cccggugcca ccuguggucc accugacccu
ccgccaggcc 780ggcgacgacu ucucccgccg cuaccgccgc gacuucgccg
agauguccag ccagcugcac 840cugacgcccu ucaccgcgcg gggacgcuuu
gccacggugg uggaggagcu cuucagggac 900ggggugaacu gggggaggau
uguggccuuc uuugaguucg guggggucau guguguggag 960agcgucaacc
gggagauguc gccccuggug gacaacaucg cccuguggau gacugaguac
1020cugaaccggc accugcacac cuggauccag gauaacggag gcugggaugc
cuuuguggaa 1080cuguacggcc ccagcaugcg gccucuguuu gauuucuccu
ggcugucucu gaagacucug 1140cucaguuugg cccugguggg agcuugcauc
acccugggug ccuaucuggg ccacaaguga 1200gucuagaccu ucugcggggc
uugccuucug gccaugcccu ucuucucucc cuugcaccug 1260uaccucuugg
ucuuugaaua aagccugagu aggaaaaaaa aaaaaaaaaa aaaaaaaaaa
1320aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa 1380aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaa
141316984RNAArtificial SequenceSynthetic Polynucleotide
16gggcgaauua agagagaaaa gaagaguaag aagaaauaua agacaccggu cgccaccaug
60gugucuaagg gcgaagagcu gauuaaggag aacaugcaca ugaagcugua cauggagggc
120accgugaaca accaccacuu caagugcaca uccgagggcg aaggcaagcc
cuacgagggc 180acccagacca ugagaaucaa gguggucgag ggcggcccuc
uccccuucgc cuucgacauc 240cuggcuacca gcuucaugua cggcagcaaa
accuucauca accacaccca gggcaucccc 300gacuucuuua agcaguccuu
cccugagggc uucacauggg agagagucac cacauacgaa 360gacgggggcg
ugcugaccgc uacccaggac accagccucc aggacggcug ccucaucuac
420aacgucaaga ucagaggggu gaacuuccca uccaacggcc cugugaugca
gaagaaaaca 480cucggcuggg aggccuccac cgagaugcug uaccccgcug
acggcggccu ggaaggcaga 540agcgacaugg cccugaagcu cgugggcggg
ggccaccuga ucugcaacuu gaagaccaca 600uacagaucca agaaacccgc
uaagaaccuc aagaugcccg gcgucuacua uguggacaga 660agacuggaaa
gaaucaagga ggccgacaaa gagaccuacg ucgagcagca cgagguggcu
720guggccagau acugcgaccu cccuagcaaa cuggggcaca aacuuaauug
auucuagacc 780uucugcgggg cuugccuucu ggccaugccc uucuucucuc
ccuugcaccu guaccucuug 840gucuuugaau aaagccugag uaggaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 900aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 960aaaaaaaaaa
aaaaaaaaaa aaaa 984171239RNAArtificial SequenceSynthetic
Polynucleotide 17gggcgaauua agagagaaaa gaagaguaag aagaaauaua
agacaccggu cgccaccaug 60gugagcaagg gcgaggagcu guucaccggg guggugccca
uccuggucga gcuggacggc 120gacguaaacg gccacaaguu cagcgugucc
ggcgagggcg agggcgaugc caccuacggc 180aagcugaccc ugaaguucau
cugcaccacc ggcaagcugc ccgugcccug gcccacccuc 240gugaccaccc
ugaccuacgg cgugcagugc uucagccgcu accccgacca caugaagcag
300cacgacuucu ucaaguccgc caugcccgaa ggcuacgucc aggagcgcac
caucuucuuc 360aaggacgacg gcaacuacaa gacccgcgcc gaggugaagu
ucgagggcga cacccuggug 420aaccgcaucg agcugaaggg caucgacuuc
aaggaggacg gcaacauccu ggggcacaag 480cuggaguaca acuacaacag
ccacaacguc uauaucaugg ccgacaagca gaagaacggc 540aucaagguga
acuucaagau ccgccacaac aucgaggacg gcagcgugca gcucgccgac
600cacuaccagc agaacacccc caucggcgac ggccccgugc ugcugcccga
caaccacuac 660cugagcaccc aguccgcccu gagcaaagac cccaacgaga
agcgcgauca caugguccug 720cuggaguucg ugaccgccgc cgggaucacu
cucggcaugg acgagcugua caaguaauuc 780uaggcgaucg cucgaaaaac
augaggauca cccaugucug caggucgacu cuagaaaaca 840ugaggaucac
ccauguccug caggucgacu cuagaaaaca ugaggaucac ccaugucugc
900aggucgacuc uagaaaacau gaggaucacc cauguccucg aaaaacauga
ggaucaccca 960ugucugcagg ucgacucuag aaaacaugag gaucacccau
guccugcagg ucgacucuag 1020aaaacaugag gaucacccau gucugcaggu
cgacucuaga aaacaugagg aucacccaug 1080uccucgaggu gugcggccgc
ugaauaaagc cugaguagga aaaaaaaaaa aaaaaaaaaa 1140aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
1200aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaa
123918653RNAArtificial SequenceSynthetic Polynucleotide
18gggcgaauua agagagaaaa gaagaguaag aagaaauaua agacaccggu cgccaccaug
60ggauccgcuu cuaacuuuac ucaguucguu cucgucgaca auggcggaac uggcgacgug
120acugucgccc caagcaacuu cgcuaacggg gucgcugaau ggaucagcuc
uaacucgcga 180ucacaggcuu acaaaguaac cuguagcguu cgucagagcu
cugcgcagaa ucgcaaauac 240accaucaaag ucgaggugcc uaaaggcgca
uggaggucuu acuuaaauau ggaacuaacc 300auuccaauuu ucgccacgaa
uuccgacugc gagcuuauug uuaaggcaau gcaaggucuc 360cuaaaagaug
gaaacccgau ucccucggcc aucgcggcca acuccggcau cuacagaucu
420cauaugcauc ucgagugaua gucuagaccu ucugcggggc uugccuucug
gccaugcccu 480ucuucucucc cuugcaccug uaccucuugg ucuuugaaua
aagccugagu aggaaaaaaa 540aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 600aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaa 653191594RNAArtificial
SequenceSynthetic Polynucleotide 19ggauccguga ucggaaacgu gagauccacc
ucagauccgc uaggacaccc gcagaucgag 60aagaaggcga auuaagagag aaaagaagag
uaagaagaaa uauaagacac cggucgccac 120cauggcuucu aacuuuacuc
aguucguucu cgucgacaau ggcggaacug gcgacgugac 180ugucgcccca
agcaacuucg cuaacggggu cgcugaaugg aucagcucua acucgcguuc
240acaggcuuac aaaguaaccu guagcguucg ucagagcucu gcgcagaagc
gcaaauacac 300caucaaaguc gaggugccua aaguggcaac ccagacuguu
ggugguguag agcuuccugu 360agccgcaugg cguucguacu uaaauaugga
acuaaccauu ccaauuuucg ccacgaauuc 420cgacugcgag cuuauuguua
aggcaaugca aggucuccua aaagauggaa acccgauucc 480cucggccauc
gcagcaaacu ccggcaucua cucgaucgcc augccagcgg caacuguaga
540ucauagccaa agaauuugug aaguuugggc uugcaacuug gaugaagaga
ugaagaaaau 600ucgucaaguu auccgaaaau auaauuacgu ugcuauggac
accgaguuuc cagguguggu 660ugcaagaccc auuggagaau ucaggagcaa
ugcugacuau caauaccaac uauugcggug 720uaauguagac uuguuaaaga
uaauucagcu aggacugaca uuuaugaaug agcaaggaga 780auacccucca
ggaacuucaa cuuggcaguu uaauuuuaaa uuuaauuuga cggaggacau
840guaugcccag gacucuauag agcuacuaac aacaucuggu auccaguuua
aaaaacauga 900ggaggaagga auugaaaccc aguacuuugc agaacuucuu
augacuucug gagugguccu 960cugugaaggg gucaaauggu ugucauuuca
uagcgguuac gacuuuggcu acuuaaucaa 1020aauccuaacc aacucuaacu
ugccugaaga agaacuugac uucuuugaga uccuucgauu 1080guuuuuuccu
gucauuuaug augugaagua ccucaugaag agcugcaaaa aucucaaagg
1140uggauuacag gagguggcag aacaguuaga gcuggaacgg auaggaccac
aacaucaggc 1200aggaucugau ucauugcuca caggaauggc cuuuuucaaa
augagagaaa uguucuuuga 1260agaucauauu gaugaugcca aauauugugg
ucauuuguau ggccuugguu cugguucauc 1320cuauguacag aauggcacag
ggaaugcaua ugaagaggaa gccaacaagc agucaguuua 1380aaucuagacc
uucugcgggg cuugccuucu ggccaugccc uucuucucuc ccuugcaccu
1440guaccucuug gucuuugaau aaagccugag uaggaaaaaa aaaaaaaaaa
aaaaaaaaaa 1500aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa 1560aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaa
159420680RNAArtificial SequenceSynthetic Polynucleotide
20gggcgaauua agagagaaaa gaagaguaag aagaaauaua agacaccggu cgccaccaug
60uacgugagau uugagguucc ugaggacaug cagaacgaag cucugagucu gcuggagaag
120guuagggaga gcgguaaggu aaagaaaggu accaacgaga cgacaaaggc
uguggagagg 180ggacuggcaa agcucguuua caucgcagag gauguugacc
cgccugagau cguugcucau 240cugccccucc ucugcgagga gaagaaugug
ccguacauuu acguuaaaag caagaacgac 300cuuggaaggg cugugggcau
ugaggugcca ugcgcuucgg cagcgauaau caacgaggga 360gagcugagaa
aggagcuugg aagccuugug gagaagauua aaggccuuca gaaguaaggc
420gcgccccgcu ugaagucuuu aauuaaaccg cuugaagucu uuaauuaaac
cgcuugaagu 480cuuuaauuaa accgcuugaa gucuuuaauu aaagcuaguu
acccagcuuu cuuguacaaa 540gugaauaaag ccugaguagg aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 600aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 660aaaaaaaaaa
aaaaaaaaaa 68021990RNAArtificial SequenceSynthetic Polynucleotide
21gggcgaauua agagagaaaa gaagaguaag aagaaauaua agacaccggu cgccaccaug
60gugagcaagg gcgaggagcu guucaccggg guggugccca uccuggucga gcuggacggc
120gacguaaacg gccacaaguu cagcgugucc ggcgagggcg agggcgaugc
caccuacggc 180aagcugaccc ugaaguucau cugcaccacc ggcaagcugc
ccgugcccug gcccacccuc 240gugaccaccc ugaccuacgg cgugcagugc
uucagccgcu accccgacca caugaagcag 300cacgacuucu ucaaguccgc
caugcccgaa ggcuacgucc aggagcgcac caucuucuuc 360aaggacgacg
gcaacuacaa gacccgcgcc gaggugaagu ucgagggcga cacccuggug
420aaccgcaucg agcugaaggg caucgacuuc aaggaggacg gcaacauccu
ggggcacaag 480cuggaguaca acuacaacag ccacaacguc uauaucaugg
ccgacaagca gaagaacggc 540aucaagguga acuucaagau ccgccacaac
aucgaggacg gcagcgugca gcucgccgac 600cacuaccagc agaacacccc
caucggcgac ggccccgugc ugcugcccga caaccacuac 660cugagcaccc
aguccgcccu gagcaaagac cccaacgaga agcgcgauca caugguccug
720cuggaguucg ugaccgccgc cgggaucacu cucggcaugg acgagcugua
caaguagguc 780uagaccuucu gcggggcuug ccuucuggcc augcccuucu
ucucucccuu gcaccuguac 840cucuuggucu uugaauaaag ccugaguagg
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 900aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 960aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa 990221116RNAArtificial SequenceSynthetic
Polynucleotide 22gggcgaauua agagagaaaa gaagaguaag aagaaauaua
agacaccggu cgccaccaug 60gugagcaagg gcgaggagcu guucaccggg guggugccca
uccuggucga gcuggacggc 120gacguaaacg gccacaaguu cagcgugucc
ggcgagggcg agggcgaugc caccuacggc 180aagcugaccc ugaaguucau
cugcaccacc ggcaagcugc ccgugcccug gcccacccuc 240gugaccaccc
ugaccuacgg cgugcagugc uucagccgcu accccgacca caugaagcag
300cacgacuucu ucaaguccgc caugcccgaa ggcuacgucc aggagcgcac
caucuucuuc 360aaggacgacg gcaacuacaa gacccgcgcc gaggugaagu
ucgagggcga cacccuggug 420aaccgcaucg agcugaaggg caucgacuuc
aaggaggacg gcaacauccu ggggcacaag 480cuggaguaca acuacaacag
ccacaacguc uauaucaugg ccgacaagca gaagaacggc 540aucaagguga
acuucaagau ccgccacaac aucgaggacg gcagcgugca gcucgccgac
600cacuaccagc agaacacccc caucggcgac ggccccgugc ugcugcccga
caaccacuac 660cugagcaccc aguccgcccu gagcaaagac cccaacgaga
agcgcgauca caugguccug 720cuggaguucg ugaccgccgc cgggaucacu
cucggcaugg acgagcugua caagaagcuu 780agccauggcu ucccgccgga
gguggaggag caggaugaug gcacgcugcc caugucuugu 840gcccaggaga
gcgggaugga ccgucacccu gcagccugug cuucugcuag gaucaaugug
900uagcucuaga ccuucugcgg ggcuugccuu cuggccaugc ccuucuucuc
ucccuugcac 960cuguaccucu uggucuuuga auaaagccug aguaggaaaa
aaaaaaaaaa aaaaaaaaaa 1020aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1080aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaa 1116231083RNAArtificial SequenceSynthetic
Polynucleotide 23ggauccguga ucggaaacgu gagauccacc ucagauccgc
uaggacaccc gcagaucgag 60aagaaggcga auuaagagag aaaagaagag uaagaagaaa
uauaagacac cggucgccac 120caugggaucc gugagcaagg gcgaggagcu
guucaccggg guggugccca uccuggucga 180gcuggacggc gacguaaacg
gccacaaguu cagcgugucc ggcgagggcg agggcgaugc 240caccuacggc
aagcugaccc ugaaguucau cugcaccacc ggcaagcugc ccgugcccug
300gcccacccuc gugaccaccc ugaccuacgg cgugcagugc uucagccgcu
accccgacca 360caugaagcag cacgacuucu ucaaguccgc caugcccgaa
ggcuacgucc aggagcgcac 420caucuucuuc aaggacgacg gcaacuacaa
gacccgcgcc gaggugaagu ucgagggcga 480cacccuggug aaccgcaucg
agcugaaggg caucgacuuc aaggaggacg gcaacauccu 540ggggcacaag
cuggaguaca acuacaacag ccacaacguc uauaucaugg ccgacaagca
600gaagaacggc
aucaagguga acuucaagau ccgccacaac aucgaggacg gcagcgugca
660gcucgccgac cacuaccagc agaacacccc caucggcgac ggccccgugc
ugcugcccga 720caaccacuac cugagcaccc aguccgcccu gagcaaagac
cccaacgaga agcgcgauca 780caugguccug cuggaguucg ugaccgccgc
cgggaucacu cucggcaugg acgagcugua 840caagagaucu cauaugcauc
ucgagugaua gucuagaccu ucugcggggc uugccuucug 900gccaugcccu
ucuucucucc cuugcaccug uaccucuugg ucuuugaaua aagccugagu
960aggaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa 1020aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa 1080aaa 108324653RNAArtificial
SequenceSynthetic Polynucleotide 24gggcgaauua agagagaaaa gaagaguaag
aagaaauaua agacaccggu cgccaccaug 60uacgugagau uugagguucc ugaggacaug
cagaacgaag cucugagucu gcuggagaag 120guuagggaga gcgguaaggu
aaagaaaggu accaacgaga cgacaaaggc uguggagagg 180ggacuggcaa
agcucguuua caucgcagag gauguugacc cgccugagau cguugcucau
240cugccccucc ucugcgagga gaagaaugug ccguacauuu acguuaaaag
caagaacgac 300cuuggaaggg cugugggcau ugaggugcca ugcgcuucgg
cagcgauaau caacgaggga 360gagcugagaa aggagcuugg aagccuugug
gagaagauua aaggccuuca gaagagaucu 420cauaugcauc ucgagugaua
gucuagaccu ucugcggggc uugccuucug gccaugcccu 480ucuucucucc
cuugcaccug uaccucuugg ucuuugaaua aagccugagu aggaaaaaaa
540aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa 600aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaa 653258PRTArtificial SequenceSynthetic Polypeptide
25Ser Ile Ile Asn Phe Glu Lys Leu1 52619DNAArtificial
SequenceSynthetic Polynucleotide 26ggtctccgac tagaagagc
192719DNAArtificial SequenceSynthetic Polynucleotide 27gctcttcaca
cctgagacc 192818DNAArtificial SequenceSynthetic Polynucleotide
28ggtctcacac cgaagagc 182919DNAArtificial SequenceSynthetic
Polynucleotide 29gctcttcaat aatgagacc 193018DNAArtificial
SequenceSynthetic Polynucleotide 30ggtctccata agaagagc
183118DNAArtificial SequenceSynthetic Polynucleotide 31gctcttcttc
atgagacc 183219DNAArtificial SequenceSynthetic Polynucleotide
32ggtctccgac taagtcttc 193319DNAArtificial SequenceSynthetic
Polynucleotide 33gaagacttca cctgagacc 193419DNAArtificial
SequenceSynthetic Polynucleotide 34ggtctcacac caagtcttc
193519DNAArtificial SequenceSynthetic Polynucleotide 35gaagacttat
aatgagacc 193619DNAArtificial SequenceSynthetic Polynucleotide
36ggtctccata aaagtcttc 193719DNAArtificial SequenceSynthetic
Polynucleotide 37gaagactttt catgagacc 193811DNAArtificial
SequenceSynthetic Polynucleotidemisc_feature(8)..(8)n is a, c, g,
or t 38gctcttcnac t 113911DNAArtificial SequenceSynthetic
Polynucleotidemisc_feature(4)..(4)n is a, c, g, or t 39cacngaagag c
114011DNAArtificial SequenceSynthetic
Polynucleotidemisc_feature(7)..(7)n is a, c, g, or t 40ggtctcngac t
114111DNAArtificial SequenceSynthetic
Polynucleotidemisc_feature(5)..(5)n is a, c, g, or t 41caccngagac c
114212DNAArtificial SequenceSynthetic
Polynucleotidemisc_feature(7)..(8)n is a, c, g, or t 42gaagacnnga
ct 124312DNAArtificial SequenceSynthetic
Polynucleotidemisc_feature(5)..(6)n is a, c, g, or t 43caccnngtct
tc 124412DNAArtificial SequenceSynthetic
Polynucleotidemisc_feature(8)..(8)n is a, c, g, or t 44gctcttcnca
cc 124511DNAArtificial SequenceSynthetic Polynucleotide
45ataagaagag c 114611DNAArtificial SequenceSynthetic
Polynucleotidemisc_feature(7)..(7)n is a, c, g, or t 46ggtctcncac c
114711DNAArtificial SequenceSynthetic
Polynucleotidemisc_feature(5)..(5)n is a, c, g, or t 47ataangagac c
114812DNAArtificial SequenceSynthetic
Polynucleotidemisc_feature(7)..(8)n is a, c, g, or t 48gaagacnnca
cc 124912DNAArtificial SequenceSynthetic
Polynucleotidemisc_feature(5)..(6)n is a, c, g, or t 49ataanngtct
tc 125011DNAArtificial SequenceSynthetic
Polynucleotidemisc_feature(8)..(8)n is a, c, g, or t 50gctcttcnat a
115112DNAArtificial SequenceSynthetic Polynucleotide 51ttcaagaaga
gc 125219DNAArtificial SequenceSynthetic Polynucleotide
52ggtctcaata aaagtcttc 195311DNAArtificial SequenceSynthetic
Polynucleotidemisc_feature(7)..(7)n is a, c, g, or t 53ggtctcnata a
115411DNAArtificial SequenceSynthetic
Polynucleotidemisc_feature(5)..(5)n is a, c, g, or t 54ttcangagac c
115512DNAArtificial SequenceSynthetic
Polynucleotidemisc_feature(7)..(8)n is a, c, g, or t 55gaagacnnat
aa 125612DNAArtificial SequenceSynthetic
Polynucleotidemisc_feature(5)..(6)n is a, c, g, or t 56ttcanngtct
tc 12
* * * * *
References