U.S. patent application number 16/193961 was filed with the patent office on 2019-05-16 for microorganisms for biosynthesis of limonene on gaseous substrates.
This patent application is currently assigned to Kiverdi, Inc.. The applicant listed for this patent is Kiverdi, Inc.. Invention is credited to Cody A. Marcus Carr, Christer Jansson, John S. Reed.
Application Number | 20190144891 16/193961 |
Document ID | / |
Family ID | 52484271 |
Filed Date | 2019-05-16 |
![](/patent/app/20190144891/US20190144891A1-20190516-D00001.png)
![](/patent/app/20190144891/US20190144891A1-20190516-D00002.png)
![](/patent/app/20190144891/US20190144891A1-20190516-D00003.png)
![](/patent/app/20190144891/US20190144891A1-20190516-D00004.png)
![](/patent/app/20190144891/US20190144891A1-20190516-D00005.png)
![](/patent/app/20190144891/US20190144891A1-20190516-D00006.png)
![](/patent/app/20190144891/US20190144891A1-20190516-D00007.png)
![](/patent/app/20190144891/US20190144891A1-20190516-D00008.png)
![](/patent/app/20190144891/US20190144891A1-20190516-D00009.png)
![](/patent/app/20190144891/US20190144891A1-20190516-D00010.png)
![](/patent/app/20190144891/US20190144891A1-20190516-D00011.png)
View All Diagrams
United States Patent
Application |
20190144891 |
Kind Code |
A1 |
Jansson; Christer ; et
al. |
May 16, 2019 |
Microorganisms for Biosynthesis of Limonene on Gaseous
Substrates
Abstract
Engineered microorganisms are provided that convert gaseous
substrates, such as producer gas, into limonene. In some
embodiments, limonene is pumped out of the cell via an efflux pump.
In some embodiments, limonene, produced as described herein, is
converted through catalytic dimerization into jet fuel. Producer
gas used in the processes described herein for production of
limonene may be derived from sources that include gasification of
waste feedstock and/or biomass residue, waste gas from industrial
processes, or natural gas, biogas, or landfill gas.
Inventors: |
Jansson; Christer; (Hayward,
CA) ; Carr; Cody A. Marcus; (Hayward, CA) ;
Reed; John S.; (Hayward, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Kiverdi, Inc. |
Hayward |
CA |
US |
|
|
Assignee: |
Kiverdi, Inc.
Hayward
CA
|
Family ID: |
52484271 |
Appl. No.: |
16/193961 |
Filed: |
November 16, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15298599 |
Oct 20, 2016 |
10179920 |
|
|
16193961 |
|
|
|
|
14706932 |
May 7, 2015 |
9506086 |
|
|
15298599 |
|
|
|
|
PCT/US2014/052386 |
Aug 22, 2014 |
|
|
|
14706932 |
|
|
|
|
61868582 |
Aug 22, 2013 |
|
|
|
61948441 |
Mar 5, 2014 |
|
|
|
Current U.S.
Class: |
435/167 ;
435/75 |
Current CPC
Class: |
C12P 5/002 20130101;
Y02E 50/343 20130101; C12P 7/44 20130101; C12P 5/007 20130101; C12N
9/88 20130101; C12Y 402/03 20130101; Y02P 20/52 20151101; C12P
15/00 20130101; C12Y 402/0302 20130101; C07K 14/195 20130101; C07K
14/245 20130101; Y02E 50/30 20130101 |
International
Class: |
C12P 5/00 20060101
C12P005/00; C07K 14/245 20060101 C07K014/245; C07K 14/195 20060101
C07K014/195; C12P 15/00 20060101 C12P015/00; C12N 9/88 20060101
C12N009/88; C12P 7/44 20060101 C12P007/44 |
Claims
1.-36. (canceled)
37. A composition comprising a non-naturally occurring
microorganism that is capable of growing on a gaseous substrate as
a carbon and energy source, and a culture medium in contact with a
gaseous substrate that comprises an inorganic gaseous electron
donor and an inorganic gaseous electron acceptor, wherein the
microorganism comprises at least one exogenous nucleic acid, and
wherein the gaseous substrate is utilized by the microorganism for
production of a terpene in the culture medium using a combination
of the electron donor and the electron acceptor as an energy
source.
38. The composition of claim 37, wherein the gaseous substrate
comprises CO.sub.2, CO, and/or CH.sub.4 as a carbon source.
39. The composition of claim 37, wherein the microorganism is a
knallgas microorganism.
40. The composition of claim 39, wherein the gaseous substrate
comprises CO.sub.2 as a carbon source, H.sub.2 as an electron
donor, and O.sub.2 as an electron acceptor.
41. The composition of claim 39, wherein the gaseous substrate
comprises H.sub.2 and O.sub.2 as an energy source.
42. The composition of claim 37, wherein the microorganism
comprises at least one exogenous nucleic acid encoding an efflux
pump and/or comprises the ability to overexpress a native efflux
pump.
43. The composition of claim 42, wherein the exogenous nucleic acid
encoding an efflux pump encodes an efflux pump from A. borkumensis
or E. coli AcrB protein.
44. The composition of claim 37, wherein the terpene comprises a
monoterpene.
45. The composition of claim 44, wherein the monoterpene comprises
limonene and/or pinene.
46. The composition of claim 37, wherein the terpene comprises a
triterpene.
47. The composition of claim 46, wherein the triterpene comprises
squalene.
48. The composition of claim 37, wherein the microorganism is a
Cupriavidus sp. or Ralstonia sp. or Hydrogenobacter sp.
49. A method for producing a terpene, comprising culturing the
non-naturally occurring microorganism of claim 37 in a bioreactor
that comprises the gaseous substrate and the culture medium,
wherein the culture medium comprises other nutrients for growth and
bioproduct production, under conditions that are suitable for
growth of the microorganism and production of the terpene, wherein
the microorganism produces the terpene.
50. The composition of claim 49, wherein the gaseous substrate
comprises CO.sub.2, CO, and/or CH.sub.4 as a carbon source.
51. The method of claim 49, wherein the gaseous substrate comprises
CO and O.sub.2; CO.sub.2, H.sub.2 and O.sub.2; CO, CO.sub.2,
H.sub.2, and O.sub.2; or CO, H.sub.2, and O.sub.2.
52. The method of claim 49, wherein the gaseous substrate is
producer gas or syngas.
53. The method of claim 49, wherein the microorganism is a knallgas
microorganism.
54. The method of claim 53, wherein the gaseous substrate comprises
CO.sub.2 as a carbon source, H.sub.2 as an electron donor, and
O.sub.2 as an electron acceptor.
55. The method of claim 53, wherein the gaseous substrate comprises
H.sub.2 and O.sub.2 as an energy source.
56. The method of claim 49, wherein the gaseous substrate is
derived from municipal solid waste, black liquor, agricultural
waste, wood waste, stranded natural gas, biogas, sour gas, methane
hydrates, tires, pet coke, sewage, manure, straw, lignocellulosic
energy crops, lignin, crop residues, bagasse, saw dust, forestry
residue, food waste, waste carpet, waste plastic, landfill gas,
and/or lignocellulosic biomass.
57. The method of claim 49, wherein the microorganism comprises at
least one exogenous nucleic acid encoding an efflux pump and/or
comprises the ability to overexpress a native efflux pump, and
wherein a greater amount of said terpene is transported out of the
microorganism and into the culture medium than an equivalent
microorganism that does not comprise the exogenous nucleic acid
encoding an efflux pump and/or the ability to overexpress a native
efflux pump.
58. The method of claim 49, wherein the terpene is recovered from
the surface of the culture medium at the interface between the
liquid and gas phases in the bioreactor.
59. The method of claim 49, wherein the culture medium is a
biphasic liquid medium that comprises an aqueous phase and an
organic phase, and wherein the terpene is recovered in the organic
phase.
60. The method of claim 49, wherein the microorganism produces the
terpene chemoautotrophically.
61. The method of claim 49, wherein the terpene comprises a
monoterpene.
62. The method of claim 61, wherein the monoterpene comprises
limonene and/or pinene.
63. The method of claim 62, wherein the monoterpene comprises
limonene, and the limonene is dimerized to produce jet fuel and/or
is converted to terephthalic acid.
64. The method of claim 49, wherein the terpene comprises a
triterpene.
65. The method of claim 64, wherein the triterpene comprises
squalene.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 15/298,599, filed on Oct. 20, 2016, which is a
continuation of U.S. patent application Ser. No. 14/706,932, filed
on May 7, 2015, which is a continuation under 35 U.S.C. .sctn.
365(c) of PCT Application No. PCT/US14/52386, filed on Aug. 22,
2014, which claims the benefit of U.S. Provisional Application No.
61/868,582, filed on Aug. 22, 2013, and 61/948,441, filed on Mar.
5, 2014, both of which are incorporated herein by reference in
their entireties.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on May 29, 2015, is named 164185.P002U2_SL.txt and is 3,858 bytes
in size.
FIELD OF THE INVENTION
[0003] The inventive subject matter relates to the biosynthetic
production of terpenes, such as limonene, in a microbial system,
using a gaseous substrate such as producer gas or H.sub.2 and
CO.sub.2 gas mixtures, as a carbon and energy source. The invention
also relates to the extraction of terpenes, such as limonene from
microbial cells, or the recovery of terpenes that are excreted from
microbial cells via active transport, for example, via efflux pumps
or via passive transport.
BACKGROUND
[0004] Limonene is a 10-carbon monoterpene with the formula
C.sub.10H.sub.16 that is an isomer of Tetrahydrodiclopentadiene,
also known as JP-10 jet fuel, a high energy density and expensive
fuel. When dimerized, limonene can be converted into a high energy
density (HED) jet fuel with similar properties to JP-10 jet
fuel.
[0005] Limonene is obtained as a byproduct of citrus processing
from rind of citrus fruits. The major barrier for widespread
application of limonene in a variety of products has largely been
the relatively high price, high pricing volatility, and supply side
uncertainty associated with citrus limonene, which is the largest
source of the compound. Intrinsically limonene is a very versatile
and useful intermediate chemical and fuel. However, in practice its
utilization has been limited due to its high per unit price and
limited availability. Due to limited volumetric availability of
terpenes such as limonene, which are mostly plant-derived and
produced in small quantities, the approach of using limonene and
other terpenes for producing significant volumes of jet fuel has
not been feasible and hence has not been pursued by the industry to
date.
[0006] The need remains for a way to produce high volumes of
terpenes, such as limonene, from feedstocks that are readily
available, abundant, and cheap.
[0007] There also is a need to break the bottleneck associated with
biologically producing economically competitive replacements for
petroleum derived fuels and chemicals on a very large scale. There
is a need for bioprocesses with compact, vertical scaling as
opposed to traditional biofuel operations that scale horizontally
and are land intensive. In this way, the food versus fuel question
and conflicts over land use and disruption of natural habitats can
be more readily avoided. There is a need for monoterpene sources
with predictably higher margins and greater supply security.
BRIEF SUMMARY OF THE INVENTION
[0008] In one aspect, an engineered microorganism is provided that
is capable of converting a gaseous substrate such as producer gas
or another gas mixture that contains H.sub.2 and CO.sub.2, and/or
CO, and/or CH4 into limonene. The gaseous substrate is used by the
microorganism as a carbon and/or energy source. In some
embodiments, microorganisms that are capable of growing on a
gaseous substrate are transformed with a polynucleotide that
encodes a gene that is required for biosynthesis of limonene, for
example, limonene synthase. In some embodiments, limonene is
recovered from the microbial cells or from a microbial growth
medium. In some embodiments limonene is then converted through
catalytic dimerization, for example, with Nafion SAC-13 or
MMKT-K10, into High Energy Density Jet Fuel. Producer gas, which
may be used in the microbial growth processes described herein, may
come from sources that include gasification of waste feedstock
and/or biomass residue feedstock, or waste gas from industrial
processes or steam reforming of natural gas or biogas.
[0009] In one aspect, a non-naturally occurring microorganism is
provided that is capable of growing on a gaseous substrate as a
carbon and/or energy source, and wherein the microorganism includes
at least one exogenous nucleic acid encoding a limonene synthase
enzyme. For example, the at least one exogenous nucleic acid may
encode a (4S) limonene synthase enzyme and/or a (4R) limonene
synthase enzyme. In some embodiments, the microorganism is a
bacterial cell. For example, in some embodiments, the bacterial
cell is a Cupriavidus sp. or Ralstonia sp., for example, but not
limited to, Cupriavidus necator.
[0010] In some embodiments, the gaseous substrate includes CO.sub.2
as a carbon source. In some embodiments, the gaseous substrate
includes H.sub.2 and/or O.sub.2 as an energy source. In some
embodiments, the gaseous substrate includes producer gas or syngas.
In some embodiments, the gaseous substrate includes a mixture of
gases, comprising H.sub.2 and/or CO.sub.2 and/or CO.
[0011] In some embodiments, the microorganism produces limonene
when cultured in the presence of the gas substrate under conditions
suitable for growth of the microorganism and production of
bioproducts.
[0012] In some embodiments, the microorganism includes one or more
exogenous nucleic acid encoding an efflux pump. In some
embodiments, the microorganism that expresses an exogenous efflux
pump produces limonene, wherein a greater amount of limonene is
transported out of the microorganism and into a growth medium in
which the microorganism is cultured than an equivalent
microorganism that does not express the efflux transport protein.
In some embodiments, the exogenous nucleic acid encoding an efflux
pump encodes A. borkumensis YP_692684 protein. In some embodiments,
the exogenous nucleic acid encoding an efflux pump encodes E. coli
AcrB protein.
[0013] In some embodiments, the microorganism has the ability to
overexpress one or more native efflux pump. In some embodiments,
the microorganism (for example, a Cupriavidus species, such as
Cupriavidus necator) overexpresses the native efflux pump
YP_004685497. In some embodiments, the microorganism (for example,
a Cupriavidus species, such as Cupriavidus necator) overexpresses
the native efflux pump YP_004687455. In some embodiments, the
microorganism (for example, a Cupriavidus species, such as
Cupriavidus necator) overexpresses the native efflux pump
YP_004687080. In some embodiments, the microorganism that
overexpresses a native efflux pump produces limonene, wherein a
greater amount of limonene is transported out of the microorganism
and into a growth medium in which the microorganism is cultured
than an equivalent microorganism that does not have the ability to
overexpress the native efflux pump.
[0014] In some embodiments, limonene synthase is encoded by a
coding sequence in the non-naturally occurring microorganism that
is carried on a broad-host-range plasmid. In some embodiments, the
limonene synthase coding sequence is under the control of a
non-native inducible promoter. In some embodiments, the inducible
promoter is derived from the E. coli ara operon.
[0015] In some embodiments, production of limonene by a
microorganism as described herein is accomplished by the addition
of a single-step reaction downstream of geranyl pyrophosphate (GPP)
in the MEP pathway, catalyzed by limonene synthase from Citrus
unshiu (Uniprot Q6F5H3). In some embodiments, the coding sequence
(CDS) of the limonene synthase (LS) gene from Citrus unshiu
(Uniprot Q6F5H3) is codon optimized for expression in a
microorganism of as described herein, for example, but not limited
to a Ralstonia or Cupriavidus species, for example, Cupriavidus
necator.
[0016] In another aspect, methods are provided for producing
limonene using an engineered microorganism as described herein that
is capable of growing on a gaseous substrate as a carbon and/or
energy source, and that includes at least one exogenous nucleic
acid encoding a limonene synthase enzyme. In some embodiments, a
non-naturally occurring microorganism as described herein is
cultured in a bioreactor that includes a gaseous substrate and a
culture medium (e.g., a liquid growth medium) that includes other
nutrients for growth and bioproduct production, under conditions
that are suitable for growth of the microorganism and production of
limonene, wherein the microorganism produces limonene.
[0017] In some embodiments, the gaseous substrate in the bioreactor
includes H.sub.2 and/or CO.sub.2. In some embodiments, the gaseous
substrate is producer gas or syngas. In some embodiments, the
gaseous substrate is derived from municipal solid waste, black
liquor, agricultural waste, wood waste, stranded natural gas,
biogas, sour gas, methane hydrates, tires, pet coke, sewage,
manure, straw, lignocellulosic energy crops, lignin, crop residues,
bagasse, saw dust, forestry residue, food waste, waste carpet,
waste plastic, landfill gas, and/or lignocellulosic biomass.
[0018] In some embodiments, limonene is recovered from the culture
medium. In some embodiments, limonene is recovered from the surface
of the culture medium at the interface between the liquid and gas
phases in the bioreactor. In some embodiments, the culture medium
is a biphasic liquid medium that includes an aqueous phase and an
organic phase, and limonene is recovered in the organic phase. In
some embodiments, the organic phase comprises dodecane.
[0019] In another aspect, limonene that is produced by an
engineered microorganism using a gaseous substrate as described
herein is dimerized to produce jet fuel. For example, Nafion SAC-13
and/or MMKT-K10 may be used for dimerization of limonene.
[0020] In another aspect, limonene that is produced by an
engineered microorganism using a gaseous substrate as described
herein is converted to terephthalic acid.
[0021] In another aspect, microorganisms and methods for producing
squalene are provided. In some embodiments, a non-naturally
occurring microorganism is provided that is capable of growing on a
gaseous substrate as a carbon and/or energy source, wherein the
microorganism includes at least one exogenous nucleic acid, and
wherein said microorganism biosynthesizes squalene. In some
embodiments, the non-naturally occurring microorganism is a
Cupriavidus sp. or Ralstonia sp. In some embodiments, the
microorganism is Cupriavidus necator. In some embodiments, a method
is provided for producing squalene in non-naturally occurring
microorganism as described herein that is capable of growing on a
gaseous substrate as a carbon and/or energy source, that includes
at least one exogenous nucleic acid, and that biosynthesizes
squalene, including culturing the non-naturally occurring
microorganism in a bioreactor that includes a gaseous substrate and
a culture medium (e.g., a liquid growth medium) that includes other
nutrients for growth and bioproduct production, under conditions
that are suitable for growth of the microorganism and production of
squalene, wherein the microorganism produces squalene.
[0022] Various objects, features, aspects, and advantages of the
present invention will become more apparent from the following
detailed description of preferred embodiments of the invention,
along with the accompanying drawings in which like numerals
represent like components
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] FIG. 1: The methyl-erythritol-4-phosphate (MEP) pathway as
it occurs in plant and algal chloroplasts and in cyanobacteria and
other bacteria. Monoterpenes are common in plants and algae but are
not usually produced in bacteria. Formation of limonene is
indicated. (Jansson (2012) Progress in Botany 73:81)
[0024] FIG. 2: In some embodiments the engineered strain carries
efflux pumps. Examples of efflux pumps that may be used in
non-limiting embodiments of the current invention include efflux
pumps with high homology to efflux pumps patented by the Joint
BioEnergy Institute (JBEI); U.S. patent Ser. No. 13/115,925 Dunlop
et al. Example homologies were calculated using NCBI BLAST
(Altschul S F et al (1997) Nucleic Acids Res 25: 3389-3402)
[0025] FIG. 3: Schematic of central metabolism in the strain in a
non-limiting embodiment of the current invention. Major pools of
reducing power (NADH, FADH.sub.2) and ATP recruited by the
Calvin-Benson cycle (CB) and non-CB anabolism are boxed. In
chemoautotrophic (lithoautotrophic) growth mode, the strain
utilizes H.sub.2 and/or CO as energy source(s) and electron
donor(s) and CO.sub.2 and/or CO as carbon source(s). Installation
of the Limonene synthase (LS) and efflux pump for biosynthesis and
facilitated export of limonene is shown. Pathways slated for
suppression in certain embodiments as a means to enhance carbon
flux toward limonene biosynthesis are indicated by bars.
[0026] FIG. 4: Pathways of knallgas microorganisms.
[0027] FIG. 5: Growth curve for Cupriavidus necator, as described
in Example 1.
[0028] FIG. 6: Decrease in gas pressure over time, as described in
Example 1.
[0029] FIG. 7: Change in headspace gas pressure over time with
growth, as described in Example 1.
[0030] FIG. 8: Cupriavidus necator cell mass produced per moles of
H.sub.2 consumed, as described in Example 1.
[0031] FIG. 9: Growth curve for Cupriavidus necator, as described
in Example 2.
[0032] FIG. 10: Plasmid used to express Citrus unshiu limonene
synthase, as described in Example 3. The gene coding sequence is
SEQ ID NO: 1, encoding Uniprot Q6F5H3).
[0033] FIG. 11: Detection of limonene as described in Example 3.
The x-axis is labeled with time (h), (transformant). (replicate).
(arabinose concentration).
[0034] FIG. 12: First replicate squalene GC peak at 28.338, as
described in Example 4.
[0035] FIG. 13: Second replicate squalene GC peak at 28.345, as
described in Example 4.
DETAILED DESCRIPTION
[0036] Provided herein are methods and systems for biosynthetic
production of terpenes, such as limonene. Engineered microorganisms
are provided that produce terpenes, such as limonene, on a gaseous
substrate, including, but not limited to producer gas, syngas, tail
gas, knallgas, and gas mixtures containing H2 and CO2, and/or CO
and/or CH4. The gaseous substrate may serve as a carbon and energy
source and a source of electron donors and/or electron acceptors
for growth of the microorganisms and biosynthesis of
bioproducts.
[0037] In some embodiments, the microorganisms disclosed herein are
recombinantly engineered to express one or more enzymes for
biosynthetic production of limonene, for example, limonene
synthase. In some embodiments, substrates or intermediates are
diverted to limonene synthesis in the microbial cells, for example,
Geranyl pyrophosphate (GPP). In some non-limiting embodiments some
fraction of carbon flux along the methyl-erythritol-4-phosphate
pathway is directed into the biosynthesis of limonene. In some
embodiments the action of limonene synthase (LS) in the production
of limonene is as illustrated in FIG. 1.
[0038] In some embodiments, the microorganisms are engineered to
express one or more transport protein(s) for secretion of terpenes,
e.g., limonene, out of the cells. In some non-limiting embodiments
the transport proteins include but are not limited to E. coli AcrB.
In some non-limiting embodiments the transport proteins include but
are not limited to the Ab pump encoded by the YP_692684 gene in
Alcanivorax borkumensis. In some embodiments the transport proteins
include but are not limited to those encoded by one or more of the
following Cupriavidus necator genes: YP_004685497, YP_004687455,
YP_004687080.
[0039] In some embodiments, the recombinant microorganisms herein
may be grown in a biphasic growth medium that includes an aqueous
growth medium and an organic solvent phase in which the terpene,
e.g., limonene, product is soluble. In some embodiments, the
solvent phase draws off the terpene, e.g., limonene, product,
keeping concentration low in the aqueous growth medium and reducing
product toxicity to the microorganisms.
[0040] Unless defined otherwise herein, all technical and
scientific terms used herein have the same meaning as commonly
understood by one of ordinary skill in the art to which this
invention belongs. Singleton, et al., Dictionary of Microbiology
and Molecular Biology, second ed., John Wiley and Sons, New York
(1994), and Hale & Markham, The Harper Collins Dictionary of
Biology, Harper Perennial, NY (1991) provide one of skill with a
general dictionary of many of the terms used in this invention. Any
methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention.
[0041] The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of molecular biology
(including recombinant techniques), microbiology, cell biology, and
biochemistry, which are within the skill of the art. Such
techniques are explained fully in the literature, for example,
Molecular Cloning: A Laboratory Manual, second edition (Sambrook et
al., 1989); Oligonucleotide Synthesis (M. J. Gait, ed., 1984;
Current Protocols in Molecular Biology (F. M. Ausubel et al., eds.,
1994); PCR: The Polymerase Chain Reaction (Mullis et al., eds.,
1994); and Gene Transfer and Expression: A Laboratory Manual
(Kriegler, 1990).
[0042] Numeric ranges provided herein are inclusive of the numbers
defining the range.
[0043] Unless otherwise indicated, nucleic acids are written left
to right in 5' to 3' orientation; amino acid sequences are written
left to right in amino to carboxy orientation, respectively.
Definitions
[0044] "A," "an" and "the" include plural references unless the
context clearly dictates
[0045] "Titer" refers to amount of a substance produced by a
microorganism per unit volume in a microbial fermentation process.
For example, limonene titer may be expressed as grams of limonene
produced per liter of solution.
[0046] "Yield" refers to amount of a product produced from a feed
material (for example, sugar) relative to the total amount that of
the substance that would be produced if all of the feed substance
were converted to product. For example, limonene yield may be
expressed as % of limonene produced relative to a theoretical yield
if 100% of the feed substance were converted to limonene.
[0047] "Productivity" refers to the amount of a substance produced
by a microorganism per unit volume per unit time in a microbial
fermentation process. For example, limonene productivity may be
expressed as grams of limonene produced per liter of solution per
hour.
[0048] "Wild-type" refers to a microorganism as it occurs in
nature.
[0049] As used herein, the term "polynucleotide" refers to a
polymeric form of nucleotides of any length and any
three-dimensional structure and single- or multi-stranded (e.g.,
single-stranded, double-stranded, triple-helical, etc.), which
contain deoxyribonucleotides, ribonucleotides, and/or analogs or
modified forms of deoxyribonucleotides or ribonucleotides,
including modified nucleotides or bases or their analogs. Because
the genetic code is degenerate, more than one codon may be used to
encode a particular amino acid, and the present invention
encompasses polynucleotides, which encode a particular amino acid
sequence. Any type of modified nucleotide or nucleotide analog may
be used, so long as the polynucleotide retains the desired
functionality under conditions of use, including modifications that
increase nuclease resistance (e.g., deoxy, 2'-O-Me,
phosphorothioates, etc.). Labels may also be incorporated for
purposes of detection or capture, for example, radioactive or
nonradioactive labels or anchors, e.g., biotin. The term
polynucleotide also includes peptide nucleic acids (PNA).
Polynucleotides may be naturally occurring or non-naturally
occurring. The terms "polynucleotide," "nucleic acid," and
"oligonucleotide" are used herein interchangeably. Polynucleotides
may contain RNA, DNA, or both, and/or modified forms and/or analogs
thereof. A sequence of nucleotides may be interrupted by
non-nucleotide components. One or more phosphodiester linkages may
be replaced by alternative linking groups. These alternative
linking groups include, but are not limited to, embodiments wherein
phosphate is replaced by P(O)S ("thioate"), P(S)S ("dithioate"),
(O)NR.sub.2 ("amidate"), P(O)R, P(O)OR', CO or CH.sub.2
("formacetal"), in which each R or R' is independently H or
substituted or unsubstituted alkyl (1-20 C) optionally containing
an ether (--O--) linkage, aryl, alkenyl, cycloalkyl, cycloalkenyl
or araldyl. Not all linkages in a polynucleotide need be identical.
Polynucleotides may be linear or circular or comprise a combination
of linear and circular portions.
[0050] As used herein, "polypeptide" refers to a composition
comprised of amino acids and recognized as a protein by those of
skill in the art. The conventional one-letter or three-letter code
for amino acid residues is used herein. The terms "polypeptide" and
"protein" are used interchangeably herein to refer to polymers of
amino acids of any length. The polymer may be linear or branched,
it may comprise modified amino acids, and it may be interrupted by
non-amino acids. The terms also encompass an amino acid polymer
that has been modified naturally or by intervention; for example,
disulfide bond formation, glycosylation, lipidation, acetylation,
phosphorylation, or any other manipulation or modification, such as
conjugation with a labeling component. Also included within the
definition are, for example, polypeptides containing one or more
analogs of an amino acid (including, for example, unnatural amino
acids, etc.), as well as other modifications known in the art.
[0051] As used herein, a "vector" refers to a polynucleotide
sequence designed to introduce nucleic acids into one or more cell
types. Vectors include cloning vectors, expression vectors, shuttle
vectors, plasmids, phage particles, cassettes and the like.
[0052] As used herein, the term "expression" refers to the process
by which a polypeptide is produced based on the nucleic acid
sequence of a gene. The process includes both transcription and
translation.
[0053] As used herein, "expression vector" refers to a DNA
construct containing a DNA coding sequence (e.g., gene sequence)
that is operably linked to one or more suitable control sequence(s)
capable of effecting expression of the coding sequence in a host.
Such control sequences include a promoter to effect transcription,
an optional operator sequence to control such transcription, a
sequence encoding suitable mRNA ribosome binding sites, and
sequences that control termination of transcription and
translation. The vector may be a plasmid, a phage particle, or
simply a potential genomic insert. Once transformed into a suitable
host, the vector may replicate and function independently of the
host genome, or may, in some instances, integrate into the genome
itself. The plasmid is the most commonly used form of expression
vector. However, the invention is intended to include such other
forms of expression vectors that serve equivalent functions and
which are, or become, known in the art.
[0054] A "promoter" refers to a regulatory sequence that is
involved in binding RNA polymerase to initiate transcription of a
gene. A promoter may be an inducible promoter or a constitutive
promoter. An "inducible promoter" is a promoter that is active
under environmental or developmental regulatory conditions.
[0055] The term "operably linked" refers to a juxtaposition or
arrangement of specified elements that allows them to perform in
concert to bring about an effect. For example, a promoter is
operably linked to a coding sequence if it controls the
transcription of the coding sequence.
[0056] "Under transcriptional control" is a term well understood in
the art that indicates that transcription of a polynucleotide
sequence depends on its being operably linked to an element that
contributes to the initiation of, or promotes transcription.
[0057] "Under translational control" is a term well understood in
the art that indicates a regulatory process that occurs after mRNA
has been formed.
[0058] A "gene" refers to a DNA segment that is involved in
producing a polypeptide and includes regions preceding and
following the coding regions as well as intervening sequences
(introns) between individual coding segments (exons).
[0059] As used herein, the term "host cell" refers to a cell or
cell line into which a recombinant expression vector for production
of a polypeptide may be transfected for expression of the
polypeptide. Host cells include progeny of a single host cell, and
the progeny may not necessarily be completely identical (in
morphology or in total genomic DNA complement) to the original
parent cell due to natural, accidental, or deliberate mutation. A
host cell includes cells transfected or transformed in vivo with an
expression vector.
[0060] The term "recombinant," refers to genetic material (i.e.,
nucleic acids, the polypeptides they encode, and vectors and cells
comprising such polynucleotides) that has been modified to alter
its sequence or expression characteristics, such as by mutating the
coding sequence to produce an altered polypeptide, fusing the
coding sequence to that of another gene, placing a gene under the
control of a different promoter, expressing a gene in a
heterologous organism, expressing a gene at a decreased or elevated
levels, expressing a gene conditionally or constitutively in manner
different from its natural expression profile, and the like.
Generally recombinant nucleic acids, polypeptides, and cells based
thereon, have been manipulated by man such that they are not
identical to related nucleic acids, polypeptides, and cells found
in nature.
[0061] A "signal sequence" refers to a sequence of amino acids
bound to the N-terminal portion of a protein, which facilitates the
secretion of the mature form of the protein from the cell. The
mature form of the extracellular protein lacks the signal sequence,
which is cleaved off during the secretion process.
[0062] The term "selective marker" or "selectable marker" refers to
a gene capable of expression in a host cell that allows for ease of
selection of those hosts containing an introduced nucleic acid or
vector. Examples of selectable markers include but are not limited
to antimicrobial substances (e.g., hygromycin, bleomycin, or
chloramphenicol) and/or genes that confer a metabolic advantage,
such as a nutritional advantage, on the host cell.
[0063] The term "derived from" encompasses the terms "originated
from," "obtained from," "obtainable from," "isolated from," and
"created from," and generally indicates that one specified material
finds its origin in another specified material or has features that
can be described with reference to the another specified
material.
[0064] The term "culturing" refers to growing a population of
cells, e.g., microbial cells, under suitable conditions for growth,
in a liquid or solid medium.
[0065] The term "heterologous," with reference to a polynucleotide
or protein, refers to a polynucleotide or protein that does not
naturally occur in a specified cell, e.g., a host cell. It is
intended that the term encompass proteins that are encoded by
naturally occurring genes, mutated genes, and/or synthetic genes.
In contrast, the term "homologous," with reference to a
polynucleotide or protein, refers to a polynucleotide or protein
that occurs naturally in the cell.
[0066] The term "introduced," in the context of inserting a nucleic
acid sequence into a cell, includes "transfection,"
"transformation," or "transduction" and refers to the incorporation
of a nucleic acid sequence into a eukaryotic or prokaryotic cell
wherein the nucleic acid sequence may be incorporated into the
genome of the cell (e.g., chromosome, plasmid, plastid, or
mitochondrial DNA), converted into an autonomous replicon, or
transiently expressed.
[0067] "Transfection" or "transformation" refers to the insertion
of an exogenous polynucleotide into a host cell. The exogenous
polynucleotide may be maintained as a non-integrated vector, for
example, a plasmid, or alternatively, may be integrated into the
host cell genome. The term "transfecting" or "transfection" is
intended to encompass all conventional techniques for introducing
nucleic acid into host cells. Examples of transfection techniques
include, but are not limited to, calcium phosphate precipitation,
DEAE-dextran-mediated transfection, lipofection, electroporation,
and microinjection.
[0068] As used herein, the terms "transformed," "stably
transformed," and "transgenic" refer to a cell that has a
non-native (e.g., heterologous) nucleic acid sequence integrated
into its genome or as an episomal plasmid that is maintained
through multiple generations.
[0069] The terms "recovered," "isolated," "purified," and
"separated" as used herein refer to a material (e.g., a protein,
nucleic acid, or cell) that is removed from at least one component
with which it is naturally associated. For example, these terms may
refer to a material that is substantially or essentially free from
components which normally accompany it as found in its native
state, such as, for example, an intact biological system.
[0070] A "signal sequence" (also termed "presequence," "signal
peptide," "leader sequence," or "leader peptide") refers to a
sequence of amino acids at the amino terminus of a nascent
polypeptide that targets the polypeptide to the secretory pathway
and is cleaved from the nascent polypeptide once it is translocated
in the endoplasmic reticulum membrane.
[0071] As used herein, "wild-type," "native," and
"naturally-occurring" proteins are those found in nature. The terms
"wild-type sequence" refers to an amino acid or nucleic acid
sequence that is found in nature or naturally occurring. In some
embodiments, a wild-type sequence is the starting point of a
protein engineering project, for example, production of variant
proteins.
[0072] The phrases "substantially similar" and "substantially
identical" in the context of at least two nucleic acids or
polypeptides typically means that a polynucleotide or polypeptide
comprises a sequence that has at least about 35%, 40%, 45%, 50%,
55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or even 99.5% sequence
identity, in comparison with a reference (e.g., wild-type)
polynucleotide or polypeptide. Sequence identity may be determined
using known programs such as BLAST, ALIGN, and CLUSTAL using
standard parameters. (See, e.g., Altshul et al. (1990) J. Mol.
Biol. 215:403-410; Henikoff et al. (1989) Proc. Natl. Acad. Sci.
89:10915; Karin et al. (1993) Proc. Natl. Acad. Sci. 90:5873; and
Higgins et al. (1988) Gene 73:237). Software for performing BLAST
analyses is publicly available through the National Center for
Biotechnology Information. Also, databases may be searched using
FASTA (Person et al. (1988) Proc. Natl. Acad. Sci. 85:2444-2448.)
In some embodiments, substantially identical polypeptides differ
only by one or more conservative amino acid substitutions. In some
embodiments, substantially identical polypeptides are
immunologically cross-reactive. In some embodiments, substantially
identical nucleic acid molecules hybridize to each other under
stringent conditions (e.g., within a range of medium to high
stringency).
[0073] "Chemoautotrophic" refers to organisms that obtain energy by
the oxidation of chemical electron donors by chemical electron
acceptors and synthesize all the organic compounds needed by the
organism to live and grow from carbon dioxide.
[0074] "Lithoautotrophic" refers to a specific type of
chemoautotrophy where the organism utilizes the oxidation of
inorganic chemical electron donors by inorganic chemical electron
acceptors as an energy source.
[0075] The term "knallgas" refers to the mixture of molecular
hydrogen and oxygen gas. A "knallgas microorganism" is a microbe
that can use hydrogen as an electron donor and oxygen as an
electron acceptor in the generation of intracellular energy
carriers such as Adenosine-5'-triphosphate (ATP). The terms
"oxyhydrogen" and "oxyhydrogen microorganism" can be used
synonymously with "knallgas" and "knallgas microorganism"
respectively.
[0076] "Heterotrophic" refers to organisms that cannot synthesize
all the organic compounds needed by the organism to live and grow
from carbon dioxide and which must utilize organic compounds for
growth.
[0077] "Sulfur-oxidizer" refers to microorganisms that utilize
reduced sulfur containing compounds including but not limited to
H.sub.2S as electron donors for the production of intracellular
reducing equivalents and/or in respiration.
[0078] "Hydrogen-oxidizer" refers to microorganisms that utilize
reduced H.sub.2 as an electron donor for the production of
intracellular reducing equivalents and/or in respiration.
[0079] "Iron-oxidizer" refers to microorganisms that utilize
reduced iron containing compounds including but not limited to
ferrous iron (Fe(II)) as electron donors for the production of
intracellular reducing equivalents and/or in respiration.
[0080] "Acetogen" refers to microorganisms that generate acetate
and/or other short chain organic acids up to C.sub.4 chain length
as a product of anaerobic respiration.
[0081] Methanogen" refers to a microorganism that generates methane
as a product of anaerobic respiration.
[0082] "Methylotroph" refers to microorganisms that can use reduced
one-carbon compounds, such as but not limited to methanol or
methane, as a carbon source and/or as an electron donor for their
growth.
[0083] "Extremophile" refers to microorganisms that thrive in
physically or geochemically extreme conditions (e.g. high or low
temperature, pH, or high salinity) compared to conditions on the
surface of the Earth or the ocean typically tolerated by most life
forms.
[0084] "Thermophile" refers to a type of extremophile that thrives
at relatively high temperatures for life, between 45 and
122.degree. C.
[0085] "Hyperthermophile" refers to a type of extremophile that
thrives in extremely hot environments for life, from 60.degree. C.
(140.degree. F.) upwards.
[0086] "Acidophile" refers to a type of extremophile that thrives
under highly acidic conditions (usually at pH 2.0 or below).
[0087] "Halophile" refers to a type of extremophile that thrives in
environments with very high concentrations of salt.
[0088] "Psychrophile" refers to a type of extremophile capable of
growth and reproduction in cold temperatures, ranging from
10.degree. C. and below.
[0089] "Producer gas" refers to gas mixture containing various
proportions of H.sub.2, CO, and CO.sub.2, and having heat value
typically ranging between one half and one tenth that of natural
gas per unit volume under standard conditions. Producer gas can be
generated various ways from a variety of feedstocks including
gasification, steam reforming, or autoreforming of carbon-based
feedstocks. In addition to H.sub.2, CO, and CO.sub.2, producer
gases can contain other constituents including but not limited to
methane, hydrogen sulfide, condensable gases, tars, and ash
depending upon the generation process and feedstock. The proportion
of N.sub.2 in the mixture can be high or low depending upon if air
is used as an oxidant in the reactor or not and if the heat for the
reaction is provided by direct combustion or through indirect heat
exchange.
[0090] "Syngas" or "Synthesis gas" refers to a type of gas mixture,
which like producer gas contains H.sub.2 and CO, but which has been
more specifically tailored in terms of H.sub.2 and CO content and
ratio and levels of impurities for the synthesis of a particular
type of chemical product, such as but not limited to methanol or
fischer-tropsch diesel.
[0091] "Carbon source" refers to the types of molecules from which
a microorganism derives the carbon needed for organic
biosynthesis.
[0092] "Energy source" refers to either the electron donor that is
oxidized by oxygen in aerobic respiration or the combination of
electron donor that is oxidized and electron acceptor that is
reduced in anaerobic respiration.
[0093] "Efflux pump" refers to cellular pumps involved in the
flowing out of a particular substance or particle from the
intracellular to the extracellular space.
[0094] "Biphasic growth environment" refers to a growth environment
containing two immiscible liquid phases.
[0095] The term "gasification" refers to a generally high
temperature process that converts carbon-based materials into a
mixture of gases including hydrogen, carbon monoxide, and carbon
dioxide called syngas or producer gas. The process generally
involves partial combustion and/or the application of externally
generated heat along with the controlled addition of oxygen and/or
steam such that insufficient oxygen is present for complete
combustion of the carbon-based material.
[0096] The term "hydrocarbon" refers to a molecule composed
exclusively of carbon and hydrogen atoms with the carbons bonded
covalently in a branched, cyclic, linear, or partially cyclic chain
and with hydrogen atoms covalently bonded to the carbons such that
the chemical octet rule for the carbons is generally satisfied. In
some hydrocarbons there may occur some number of double or triple
bonds between adjacent carbon atoms in the chain. Thus, the label
hydrocarbon subsumes branched, cyclic, linear, branched, or
partially cyclic alkanes (also called paraffins), alkenes (also
called olefins), and alkynes. The structure of hydrocarbon
molecules range from the smallest, methane (CH.sub.4), a primary
component of natural gas, to high molecular weight complex
molecules including asphaltenes present in bitumens crude oil, and
petroleum. Other examples include dodecane (C.sub.12), hexadecane
(C.sub.16), or octadecane (C.sub.18) etc. Hydrocarbons of the
present invention may be in gaseous, liquid, or solid phases,
either as singly or in multiply coexisting phases.
[0097] The term "hydrophobic" refers to matter that has low
solubility in water and greater solubility in a hydrophobic phase
than in an aqueous phase.
[0098] The terms "microorganism" and "microbe" mean microscopic
single celled life forms.
[0099] The term "molecule" means any distinct or distinguishable
structural unit of matter comprising one or more atoms, and
includes for example hydrocarbons, lipids, polypeptides and
polynucleotides.
[0100] The term "organic compound" refers to any gaseous, liquid,
or solid chemical compounds which contain carbon atoms with the
following exceptions that are considered inorganic: carbides,
carbonates, simple oxides of carbon, cyanides, and allotropes of
pure carbon such as diamond and graphite.
Limonene and Other Monoterpenes
[0101] Limonene is a 10-carbon monoterpene (FIG. 1) with high
energy density. Biologically produced limonene can serve as drop-in
bio-gasoline, while dimerization of the molecule will generate
jet-fuel and biological diesel products with excellent metrics of
combustion. The meritorious characteristics of limonene, and
monoterpenes more generally, as fuels are recognized, and include
for jet fuel, higher volumetric energy density than JP-8 or Jet-A,
rivaling the high price specialty jet fuel JP-10. (Engineering
microbial biofuel tolerance and export using efflux pumps Molecular
Systems Biology, Vol. 7, No. 1. (10 May 2011),
doi:10.1038/msb.2011.21 by Mary J. Dunlop, Zain Y. Dossani, Heather
L. Szmidt, et al.; High-Density Renewable Fuels Based on the
Selective Dimerization of Pinenes Energy Fuels, Vol. 24, No. 1. (13
Nov. 2009), pp. 267-273, doi:10.1021/ef900799c by Benjamin G.
Harvey, Michael E. Wright, Roxanne L. Quintana; Efficient
conversion of pure and mixed terpene feedstocks to high density
fuels Fuel, Vol. 97 (July 2012), pp. 560-568,
doi:10.10016j.fuel.2012.01.062 by Heather A. Meylemans, Roxanne L.
Quintana, Benjamin G. Harvey) Higher volumetric energy density
translates to increased flight range on a tank of fuel.
[0102] Limonene is a molecule with a number of meritorious
characteristics, in addition to its potential as a high energy
density liquid fuel, including: multiple current and potential uses
in specialty and commodity chemical applications, both as a
finished chemical and as a chemical feedstock; very low human
toxicity; and is a very environmentally benign type of
hydrocarbon.
[0103] Limonene is naturally found in essential oils of citrus, and
gives the fruit its scent. Current industrial production of
limonene is restricted due to its source--direct extraction of
dilute amounts contained in citrus peels. Consequently limonene
prices can be quite high due to its inefficient
production--recently prices have been around $7/kg--thus limiting
it current uses.
[0104] Monoterpenes are part of the largest and most diverse group
of naturally occurring organic compounds referred to as isoprenoids
or terpenoids. Limonene and monoterpenes generally have significant
commercial potential, as a fuel feedstock, and are useful in direct
applications similar to other hydrocarbons, e.g. in gasoline. In
addition, dimerization of limonene units may generate second-order
fuel molecules, suitable for use as supplements of jet fuel and
biodiesel. Physicochemical properties of limonene and its
derivatives are consistent with use of this molecule as renewable
fuel feedstock. (Chemical Dictionary Online,
http://www.chemicaldictionary.org/dic/D/D-Limonene_332.html;
Standard Thermodynamic Properties of Chemical Substances,
http://courses.chem.indiana.edu/c360/documents/thermodynamicdata.pdf.)
[0105] Limonene has an energy density of 37.8 MJ L.sup.-1 and thus
has an energy density well above ethanol (energy density
.gtoreq.26.8 MJ L.sup.-1) (14). With a melting point (Tm)=-74 C,
boiling point (T.sub.b)=+175.5 C, and a heat of combustion
(.DELTA.H.sub.c.degree.) equal to 6,167 kJ mol.sup.-1 limonene is
well suited for use as fuel in a variety of climatic
conditions.
[0106] In some embodiments the limonene produced in the present
invention is used as a replacement for gasoline fuel. In some
embodiments it is dimerized to produce a jet fuel or a diesel fuel.
In some embodiments limonene spontaneously separates from the cells
and accumulates as "floater molecules" on the surface of the liquid
medium, alleviating the need for costly and laborious culture
dewatering and product extraction. In some embodiments secretion of
the terpene molecules will physically and kinetically sequester the
molecules from cellular metabolism, continuously pushing the
synthesis reaction forward and preventing terpene products from
accumulating to toxicity levels in the cell.
[0107] There are two known isoprenoid pathways: the
methyl-erythritol-4-phosphate (MEP) pathway also known as the
non-mevalonate pathway and the Mevalonic acid pathway (MVA). In
both types of isoprenoid pathways geranyl pyrophosphate (GPP) is a
metabolic intermediate. In some embodiments of the present
invention either the MEP or MVA pathway for isoprenoid biosynthesis
is used for the production of limonene by adding a single-step
reaction downstream of GPP catalyzed by limonene synthase. In some
embodiments the limonene synthase is a (4S)-limonene synthase. In
some other embodiments the limonene synthase is a (4R)-limonene
synthase. In some embodiments the carbon flux towards limonene
biosynthesis is increased by removing anabolic reactions toward
glycogen and other storage compounds.
[0108] In certain non-limiting embodiments the terpene produced by
non-naturally occurring microorganisms as described herein is
Squalene. In certain non-limiting embodiments, gaseous feedstock is
converted to organic compounds including Squalene by microorganisms
as described herein. In certain non-limiting embodiments the
microorganism producing terpene compounds including Squalene is
Cupriavidus sp. or Ralstonia sp. In certain non-limiting
embodiments the microorganism producing organic terpene including
Squalene is Cupriavidus necator. In certain non-limiting
embodiments the microorganism producing terpene compounds including
Squalene is Cupriavidus necator DSM 531.
Production of Monoterpenes from Gaseous Energy and Carbon
Substrates
[0109] Engineered microorganisms are provided that are capable of
converting producer gas or a gas mixture containing H2 and/or CO
and/or CO2 and/or CH4 into limonene. In some embodiments the
limonene is then converted through catalytic dimerization with
Nafion SAC-13 or MMKT-K10 into High Energy Density Jet Fuel.
Producer gas used in the process may come from sources that include
gasification of waste feedstock and/or biomass residue feedstock,
or waste gas from industrial processes, or methane containing gases
including by not limited to natural gas, biogas, and/or landfill
gas. In some embodiment, methane may be converted to liquid fuel,
using engineered microorganisms and methods described herein.
[0110] In some embodiments, the inventive subject matter comprises
an engineered microorganism with one or more exogenous genes
including but not limited to limonene synthase. In some
embodiments, the microorganism of the inventive subject matter is
selected from the Ralstonia microorganisms. In some embodiments,
the microorganism is Ralstonia eutropha. In some embodiments, the
microorganism is selected from Cupriavidus microorganisms. In some
embodiments, the microorganism is Cupriavidus necator. In some
embodiments, the microorganism is Cupriavidus necator DSM531. In
some embodiments the microorganism is selected from the genus
Hydrogenobacter. In some embodiments the microorganism is
Hydrogenobacter thermophilus. In some embodiments the microorganism
contains the reverse tricarboxylic acid cycle (rTCA), also known as
the reverse citric acid cycle or the reverse Krebs cycle.
[0111] In some embodiments the microorganism is Rhodococcus opacus
or Rhodococcus jostii or Rhodococcus sp. In some embodiments the
microorganism is Hydrogenovibrio marinus. In some embodiments the
microorganism is Rhodopseudomonas capsulata, Rhodopseudomonas
palustris, or Rhodobacter sphaeroides. In some embodiments the
microorganism is an oxyhydrogen or knallgas strain. In some
embodiments the microorganisms comprise one or more of the
following knallgas microorganisms: Aquifex pyrophilus and Aquifex
aeolicus or other Aquifex sp.; Cupriavidus necator or Cupriavidus
metallidurans or other Cupriavidus sp.; Corynebacterium
autotrophicum or other Corynebacterium sp.; Nocardia autotrophica
and Nocardia opaca and other Nocardia sp.; purple non-sulfur
photosynthetic bacteria including but not limited to
Rhodopseudomonas palustris, Rhodopseudomonas capsulata,
Rhodopseudomonas viridis, Rhodopseudomonas sulfoviridis,
Rhodopseudomonas blastica, Rhodopseudomonas spheroides,
Rhodopseudomonas acidophila and other Rhodopseudomonas sp.,
Rhodospirillum rubrum, and other Rhodospirillum sp.; Rhodococcus
opacus and other Rhodococcus sp.; Rhizobium japonicum and other
Rhizobium sp.; Thiocapsa roseopersicina and other Thiocapsa sp.;
Pseudomonas facilis and Pseudomonas flava and Pseudomonas putida
and Pseudomonas hydrogenovora, Pseudomonas hydrogenothermophila,
Pseudomonas palleronii and Pseudomonas pseudoflava and Pseudomonas
saccharophila and Pseudomonas thermophila and other Pseudomonas
sp.; Hydrogenomonas pantotropha, Hydrogenomonas eutropha,
Hydrogenomonas facilis, and other Hydrogenomonas sp.;
Hydrogenobacter thermophilus and Hydrogenobacter halophilus and
Hydrogenobacter hydrogenophilus and other Hydrogenobacter sp.;
Hydrogenophilus islandicus and other Hydrogenophilus sp.;
Hydrogenovibrio marinus and other Hydrogenovibrio sp.;
Hydrogenothermus marinus and other Hydrogenothermus sp.;
Helicobacter pylori and other Helicobacter sp.; Xanthobacter
autotrophicus and Xanthobacter flavus other Xanthobacter sp.;
Hydrogenophaga flava and Hydrogenophaga palleronii and
Hydrogenophaga pseudoflava and other Hydrogenophaga sp.;
Bradyrhizobium japonicum and other Bradyrhizobium sp.; Ralstonia
eutropha and other Ralstonia sp.; Alcaligenes eutrophus and
Alcaligenes facilis and Alcaligenes hydrogenophilus and Alcaligenes
latus and Alcaligenes paradoxus and Alcaligenes ruhlandii and other
Alcaligenes sp.; Amycolata sp.; Aquaspirillum autotrophicum and
other Aquaspirillum sp.; Arthrobacter strain 11/X and other
Arthrobacter sp.; Azospirillum lipoferum and other Azospirillum
sp.; Variovorax paradoxus, and other Variovorax sp.; Acidovorax
facilis, and other Acidovorax sp.; Bacillus schlegelii and Bacillus
tusciae and other Bacillus sp.; Calderobacterium hydrogenophilum
and other Calderobacterium sp.; Derxia gummosa and other Derxia
sp.; Flavobacterium autothermophilum and other Flavobacterium sp.;
Microcyclus aquaticus and other Microcyclus; Mycobacterium
gordoniae and other Mycobacterium sp.; Paracoccus denitrificans and
other Paracoccus sp.; Persephonella marina and Persephonella
guaymasensis and other Persephonella sp.; Renobacter vacuolatum and
other Renobacter sp.; Thermocrinis ruber and other Thermocrinis
sp.; Wautersia sp.; cyanobacteria including but not limited to
Anabaena oscillarioides, Anabaena spiroides, Anabaena cylindrica,
and other Anabaena sp.; green algae including but not limited to
Scenedesmus obliquus and other Scenedesmus sp., Chlamydomonas
reinhardii and other Chlamydomonas sp., Ankistrodesmus sp.,
Rhaphidium polymorphium and other Rhaphidium sp; as well as a
consortiums of microorganisms that include oxyhydrogen
microorganisms.
[0112] A number of different microorganisms have been characterized
that are capable of growing on carbon monoxide as an electron donor
and/or carbon source (i.e. carboxydotrophic microorganisms). In
some cases carboxydotrophic microorganisms can also use H2 as an
electron donor and/or grow mixotrophically. In some cases the
carboxydotrophic microorganisms are facultative
chemolithoautotrophs [Biology of the Prokaryotes, edited by J
Lengeler, G. Drews, H. Schlegel, John Wiley & Sons, Jul. 10,
2009]. In some embodiments the microorganisms comprise one or more
of the following carboxydotrophic microorganisms: Acinetobacter
sp.; Alcaligenes carboxydus and other Alcaligenes sp.; Arthrobacter
sp.; Azomonas sp.; Azotobacter sp.; Bacillus schlegelii and other
Bacillus sp.; Hydrogenophaga pseudoflava and other Hydrogenophaga
sp.; Pseudomonas carboxydohydrogena and Pseudomonas carboxydovorans
and Pseudomonas compransoris and Pseudomonas gazotropha and
Pseudomonas thermocarboxydovorans and other Pseudomonas sp.;
Rhizobium japonicum and other Rhizobium sp.; Streptomyces G26 and
other Streptomyces sp. In certain embodiments of the present
invention a carboxydotrophic microorganism is used. In certain
embodiments a carboxydotrophic microorganism that is capable of
chemolithoautotrophy is used. In certain embodiments a
carboxydotrophic microorganism that is able to use H2 as an
electron donor in respiration and/or biosynthesis is used.
[0113] In some embodiments the microorganisms comprise obligate
and/or facultative chemoautotrophic microorganisms including one or
more of the following: Acetoanaerobium sp.; Acetobacterium sp.;
Acetogenium sp.; Achromobacter sp.; Acidianus sp.; Acinetobacter
sp.; Actinomadura sp.; Aeromonas sp.; Alcaligenes sp.; Alcaliqenes
sp.; Arcobacter sp.; Aureobacterium sp.; Bacillus sp.; Beggiatoa
sp.; Butyribacterium sp.; Carboxydothermus sp.; Clostridium sp.;
Comamonas sp.; Dehalobacter sp., Dehalococcoide sp.;
Dehalospirillum sp.; Desulfobacterium sp.; Desulfomonile sp.;
Desulfotomaculum sp.; Desulfovibrio sp.; Desulfurosarcina sp.;
Ectothiorhodospira sp.; Enterobacter sp.; Eubacterium sp.;
Ferroplasma sp.; Halothibacillus sp.; Hydrogenobacter sp.;
Hydrogenomonas sp.; Leptospirillum sp.; Metallosphaera sp.;
Methanobacterium sp., Methanobrevibacter sp.; Methanococcus sp.;
Methanosarcina sp.; Micrococcus sp.; Nitrobacter sp.; Nitrosococcus
sp.; Nitrosolobus sp.; Nitrosomonas sp.; Nitrosospira sp.;
Nitrosovibrio sp.; Nitrospina sp.; Oleomonas sp.; Paracoccus sp.;
Peptostreptococcus sp.; Planctomycetes sp.; Pseudomonas sp.;
Ralstonia sp.; Rhodobacter sp.; Rhodococcus sp.; Rhodocyclus sp.;
Rhodomicrobium sp.; Rhodopseudomonas sp.; Rhodospirillum sp.;
Shewanella sp.; Streptomyces sp.; Sulfobacillus sp.; Sulfolobus
sp.; Thiobacillus sp.; Thiomicrospira sp.; Thioploca sp.;
Thiosphaera sp.; Thiothrix sp.; sulfur-oxidizers;
hydrogen-oxidizers; iron-oxidizers; acetogens; and methanogens;
consortiums of microorganisms that include chemoautotrophs;
chemoautotrophs native to at least one of hydrothermal vents,
geothermal vents, hot springs, cold seeps, underground aquifers,
salt lakes, saline formations, mines, acid mine drainage, mine
tailings, oil wells, refinery wastewater. coal seams, deep
sub-surface; waste water and sewage treatment plants; geothermal
power plants, sulfatara fields, and soils; and extremophiles
selected from one or more of thermophiles, hyperthermophiles,
acidophiles, halophiles, and psychrophiles.
[0114] In some embodiments the microorganism is a methanotroph. In
some embodiments the microorganism is in the genus Methylococcus.
In some embodiments the microorganism is Methylococcus capsulatus.
In some embodiments the microorganism is a methylotroph. In some
embodiments the microorganism is in the genus Methylobacterium. In
some embodiments the microorganism is drawn from one or more of the
following species: Methylobacterium zatmanii; Methylobacterium
extorquens; Methylobacterium chloromethanicum. In some embodiments
the microorganism is a methylotroph that naturally produces one or
more triterpenes. In some embodiments the microorganisms is a
methylotroph that naturally produces one or more of lupenone,
lupeol, or lupane-type triterpenoids.
[0115] In some embodiments, the inventive subject matter converts
producer gas including but not limited to syngas, biogas, tailgas,
fluegas, CO, CO.sub.2, H.sub.2, and mixtures thereof. In some
embodiments the heat content of the producer gas is at least 100
BTU per standard cubic foot (scf). In some embodiments of the
present invention, a bioreactor is used to contain and grow the
microorganisms, which is equipped with fine-bubble diffusers and/or
high-shear impellers for gas delivery.
[0116] In some embodiments oxygen is used as an electron acceptor
in the respiration of the microorganism used in the embodiment for
the biosynthesis of limonene and/or other monoterpenes. In some
embodiments strong electron acceptors including but not limited to
O.sub.2 are used to maximize efficiency and yield of products along
anabolic pathways such as the isoprenoid pathways used to produce
high energy density molecules such as limonene and/or other
monoterpenes. A key challenge with using O.sub.2 as an electron
acceptor is keeping O.sub.2 levels sufficiently adequate to allow
aerobic microbes to grow well and generate anabolic products while
also maintaining appropriate and safe levels of inflammable H.sub.2
and O.sub.2 mixtures in the bioreactor to minimize the risk of
explosion. In some embodiments custom or specialized reactor
designs are used to control O.sub.2 in the broth at a level that is
optimal for the microbes while avoiding dangerous gas mixes. In
some embodiments bioreactor designs are used that avoid dangerous
mixtures of H.sub.2 and O.sub.2 by exploiting the low solubility of
H.sub.2 and O.sub.2 in water, while providing the microorganisms
with necessary levels of these gases for cellular energy, carbon
fixation, and limonene and/or monoterpene product generation.
[0117] In some embodiments the inventive subject matter includes a
recombinant microorganism that converts methanol to limonene and/or
another monoterpenes.
[0118] In some embodiments the limonene or other monoterpene is
converted to a HED jet fuel that has 10% or higher volumetric
energy density than JP-8 jet fuel. In some embodiments a HED jet
fuel is produced from producer gas, or gas mixtures containing
H.sub.2 and CO.sub.2 and/or CO and/or CH.sub.4 at a lower cost than
an equivalent volume of JP-10 on an energy basis.
[0119] In some embodiments a CO.sub.2-to-monoterpene pathway is
enabled in a microorganism of the Ralstonia or Cupriavidus genus.
The non-mevalonate or methyl-erythritol-4-phosphate (MEP) pathway
for isoprenoid biosynthesis exists in Ralstonia and many other
knallgas microorganisms (FIG. 1). However, they lack enzymes for
biosynthesis of high-energy monoterpenes such as pinene, limonene,
which are all promising hydrocarbon fuel alternatives. In some
embodiments Ralstonia or Cupriavidus are engineered for the
production of limonene, and/or phellandrene. In some embodiments
the carbon flux in the cell is redirected from naturally occurring
cell products to limonene using methods known in the field of
metabolic engineering. In some embodiments the cell is a Ralstonia
or Cupriavidus microorganism. In some embodiments the production of
limonene by a cell of the present invention is accomplished by the
addition of a single-step reaction downstream of geranyl
pyrophospate (GPP) in the MEP pathway catalyzed by (4S)-limonene
synthase (LS; EC 4.2.3.16; FIG. 9). In some embodiments the
production of limonene by a cell of the present invention is
accomplished by the addition of a single-step reaction downstream
of geranyl pyrophospate (GPP) in the MEP pathway catalyzed by
(4R)-limonene synthase. In some embodiments the coding sequence
(CDS) of the LS gene from Mentha spicata (Spearmint; GenBank:
JX555975.1) is codon optimized for expression in a cell of the
present invention. In some embodiments that cell is Ralstonia or
Cupriavidus.
Efflux Pumps
[0120] In some embodiments the limonene yield is further enhanced
by the engineering of efflux pumps. Efflux pumps are a common
strategy used by bacteria to address small molecule toxicity.
(Poole K (2005) J Antimicrob Chemoth 56: 20-51) Cupriavidus necator
includes three such pumps with high homology to the E. coli and A.
borkumensis (Ab) proteins identified in the patent number U.S. Ser.
No. 13/115,925 Dunlop et al (FIG. 2). This includes high homology
in the periplasmic loops that select molecules to be exported. (Eda
S et al (2003) J Biol Chem 278: 2085-2088; Elkins C A, et al.
(2002) J Bacteriol 195: 6490-6498)
[0121] As the general mechanism for microbicide tolerance is
already present in Cupriavidus necator, AcrB and the Ab pump may be
transferred to the microbe. In some embodiments AcrB and the Ab
pumps are transferred into the microbe of the present invention. In
some embodiments the microbe is Cupriavidus necator. In some
embodiments overexpression of the native efflux pumps lead to
increase of limonene tolerance in the microorganism of the present
invention. In some embodiments the microorganism engineered for
overexpression of native efflux pumps is Cupriavidus necator.
[0122] In some embodiments secretion of the monoterpene molecules
will physically and kinetically sequester the monoterpene from
cellular metabolism, continuously pushing the synthesis reaction
forward and preventing monoterpene products from accumulating to
toxic levels in the cell.
[0123] In some embodiments the inventive subject matter comprises a
microbial organism having at least one exogenous nucleic acid
encoding a (4S)-limonene synthase enzyme. In some embodiments the
inventive subject matter comprises a microbial organism having at
least one exogenous nucleic acid encoding a (4R)-limonene synthase
enzyme. In some embodiments the microorganisms are selected from
engineered Cupriavidus sp. (also known as Ralstonia sp.). In some
embodiments the microbial organism is Cupriavidus necator (also
known as Ralstonia eutropha). In some embodiments the microorganism
is selected from the genus Hydrogenobacter. In some embodiments the
microorganism is Hydrogenobacter thermophilus. In some embodiments
the microorganism contains the reverse tricarboxylic acid cycle
(rTCA), also known as the reverse citric acid cycle or the reverse
Krebs cycle.
[0124] In some embodiments the microbial organism comprises an
exogenous nucleic acid encoding an A. borkumensis YP_692684
protein. In some embodiments the microbial organism further
comprises an E. coli AcrB protein.
[0125] In some embodiments the microbial organism comprises at
least one exogenous nucleic acid encoding E. coli AcrB protein.
[0126] In some embodiments the microbial organism of the inventive
subject matter comprises the ability to overexpress the native
efflux pump YP_004685497. In some embodiments the microbial
organism further comprises the ability to overexpress the native
efflux pump YP_004687455 and YP_004685497. In some embodiments the
microbial organism comprises the ability to overexpress the native
efflux pump YP_004687080 and YP_004685497.
[0127] In some embodiments the microbial organism of the inventive
subject matter comprises the ability to overexpress the native
efflux pump YP_004687455. In some embodiments the microbial
organism comprises the ability to overexpress the native efflux
pump YP_004687455 and YP_004687080.
[0128] In some embodiments the microbial organism of the inventive
subject matter comprises the ability to overexpress the native
efflux pump YP_004687080.
[0129] Limonene and the similar cyclic C10 monoterpene phellandrene
are both highly hydrophobic and in some embodiments, limonene
and/or phellandrene that is secreted from the cells may accumulate
as floater molecules on the surface layer of the medium (Metabolic
engineering of Escherichia coli for limonene and perillyl alcohol
production. Metabolic engineering, Vol. 19 (September 2013), pp.
33-41 by Jorge Alonso-Gutierrez, Rossana Chan, Tanveer S. Batth, et
al.; Paradigm of Monoterpene (.beta.-phellandrene) Hydrocarbons
Production via Photosynthesis in Cyanobacteria In BioEnergy
Research, Vol. 6, No. 3. (2013), pp. 917-929,
doi:10.1007/s12155-013-9325-4 by Fiona K Bentley, Jose Gines
Garcia-Cerdan, Hsu-Ching Chen, Anastasios Melis)
[0130] In some embodiments of this invention limonene is secreted
from the cell of the present invention. In some embodiments this
spontaneous separation of the limonene molecules from the cells
alleviates the toxic effects of limonene by keeping intracellular
levels low, preventing feedback inhibition of the biosynthetic
pathway, thereby promoting the forward reaction. In some
embodiments this reduces or eliminates the cost of cell harvesting
and fracturing. In some embodiments partitioning of limonene to the
medium is further facilitated by adding an organic phase such as
dodecane to the culture to trap the molecule. Using this approach,
and by continued metabolic engineering of the limonene biosynthetic
pathway, Keasling and colleagues recently reported production of
D-limonene in E. coli cultures at a titer of 435 mg L-1 without
cell-adverse adverse effects (Metabolic engineering of Escherichia
coli for limonene and perillyl alcohol production. Metabolic
engineering, Vol. 19 (September 2013), pp. 33-41 by Jorge
Alonso-Gutierrez, Rossana Chan, Tanveer S. Batth, et al.)
[0131] This is 100 times higher than previously reported and
demonstrates the potential for high-yield limonene production in
bacteria. In some embodiments the rapid and efficient separation of
limonene from the culture medium is accomplished through two-phase
systems known in the art. In some embodiments solvent-free
non-lethal filtration and separation methods are used. In some
embodiments a gravity separation unit is used to extract floatable
product. In some embodiments the limonene containing broth flows
from a bioreactor to a separation unit having a retention time that
has been set to allow limonene to float to the top, and cell mass
to settle out. In some embodiments the cell mass separated from the
limonene is returned to the bioreactor for further production of
limonene. In some embodiments the limonene emerges as discrete
extracellular droplets, and gravity separation is used to promote
sedimentation of the biomass and floatation of the limonene
droplets. In some embodiments the separation vessel is sized on the
basis of the terminal velocity of the limonene droplets and
biomass. In some embodiments quiescent conditions are provided in
the settling tank through the use of baffles and/or weirs. In some
embodiments limonene and/or other monoterpenes does not separate
from the biomass. In such embodiments the limonene and/or other
monoterpenes are separated from the cell mass using methods known
in the art including but not limited to solvent extraction.
[0132] In some embodiments of the present invention the
biosynthesis of limonene and/or other monoterpenes that
spontaneously partitions from aqueous medium combined with low cost
gaseous feedstocks as input to the bioprocess such as producer gas,
or H.sub.2 and CO.sub.2, and/or CO, and/or CH.sub.4 containing gas
mixes improve the economic viability of monoterpene use as a
biofuel. In some embodiments of the present invention the low cost
of limonene product enabled by the invention totally disrupts the
current limonene production from citrus peels, which is a very
inefficient process. In some embodiments of the present invention
the low cost of monoterpene (e.g, limonene production enables much
wider use of monoterpenes (e.g., limonene), including as a fuel. In
some embodiments of the present invention the production of
limonene from a low cost, non-food based, highly scalable feedstock
like natural gas enables larger scale production of limonene than
from current sources. In some embodiments of the present invention,
the invention is utilized for the production of limonene and/or
other monoterpenes in regions where natural gas prices are lowest,
and where remote, and particularly "stranded" and flared natural
gas is known to occur such as in the U.S., Middle East, western
Africa, and Russia. In some embodiments limonene and/or other
monoterpenes are produced at a cost of less than $2 per gallon of
gasoline energy equivalent (GGE). (the price of limonene in 2013
was $7/kg, which corresponds to over $20 per GGE). In some
embodiments of the present invention the low cost of production of
limonene enabled by the present invention would open whole new
opportunities for the use of limonene that are at present
completely proven to be technically feasible, but which are not
economically viable due to the high cost of limonene using
incumbent production methods.
Engineering Microorganisms with Limonene Synthesis Pathways
[0133] The inventive subject matter comprises, in one embodiment,
an engineered knallgas microorganism capable of growing on syngas,
or H.sub.2 and CO.sub.2, and/or CO, and/or CO.sub.4, and/or other
waste gases and capable of producing terpenes including but not
limited to limonene.
[0134] Engineering of knallgas microorganisms is described in U.S.
patent application Ser. No. 13/623,089, filed Sep. 19, 2012, and
entitled "INDUSTRIAL FATTY ACID ENGINEERING GENERAL SYSTEM FOR
MODIFYING FATTY ACIDS." This application is incorporated herein by
reference in its entirety for all purposes.
[0135] Use of knallgas microorganisms for the conversion of syngas,
producer gas, or other H2 and CO2 and/or CO containing gas mixes in
high energy density molecules is described in a patent filed in the
United States Patent and Trademark Office on Oct. 26, 2012 under
Ser. No. 13/643,872, bearing Attorney Docket No. S1740.70001US01,
and entitled USE OF OXYHYDROGEN MICROORGANISMS FOR
NON-PHOTOSYNTHETIC CARBON CAPTURE AND CONVERSION OF INORGANIC
AND/OR Cl CARBON SOURCES INTO USEFUL ORGANIC COMPOUNDS. This
application is incorporated herein by reference in its entirety for
all purposes.
[0136] Use of chemotrophic microorganisms for the conversion of CO2
into useful organic chemicals is described in PCT international
application number PCT/US2010/001402, filed May 12, 2010 and
entitled BIOLOGICAL AND CHEMICAL PROCESS UTILIZING CHEMOAUTOTROPHIC
MICROORGANISMS FOR THE CHEMOSYTHETIC FIXATION OF CARBON DIOXIDE
AND/OR OTHER INORGANIC CARBON SOURCES INTO ORGANIC COMPOUNDS, AND
THE GENERATION OF ADDITIONAL USEFUL PRODUCTS. This application is
incorporated herein by reference in its entirety for all
purposes.
Products from Limonene and Applications of Use Thereof
[0137] Limonene is a chemical with a pathway-to-commercialization
that includes near-term small volume opportunities--because
limonene is already used in products and commands a high per unit
price--leading out to longer-term, high volume, low per unit prices
applications, specifically fuel applications, made possible by the
high energy density of limonene, as well as other beneficial
characteristics it has for fuel applications.
[0138] Limonene that is produced biologically from gaseous
substrates, using an engineered microorganism as described herein,
may be converted to other products for numerous downstream
uses.
Limonene to Jet Fuel
[0139] Limonene is readily dimerized with either Nafion SAC-13 or
MMT-K10. (Meylemans et al. (2012), Fuel 97:60-568) Dimerization of
limonene results in a HED Jet Fuel with similar properties to JP-10
as tested by the Naval Air Warfare Centre. The HED Jet Fuel has 10%
higher volumetric energy density than JP-8 at a fraction of the
cost of JP-10. In some embodiments limonene, produced in an
engineered microorganism that is grown on a gaseous substrate, as
described herein, is dimerized to produce HED jet fuel. In some
embodiments, the limonene is dimerized using either Nafion SAC-13
or MMT-K10.
Solvent Replacement
[0140] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein,) as a solvent replacement.
d-Limonene can directly replace components in existing solvent
blends. (D-LIMONENE USES AND INDUSTRIES. The Nottingham Company,
n.d. Web.
http://www.ppiatlanta.com/pdfs/DataSheets/D-Limonene-%20uses.pdf)
One example is the 1:1 substitution of d-Limonene in the place of
xylene or 1,1,1 tri-chlor in blends with other inexpensive solvents
to make up the balance (mineral spirits, isopropyl alcohol, butyl
cello solve, etc.)
[0141] As a straight solvent, d-Limonene can replace a wide variety
of products, including mineral spirits, methyl ethyl ketone,
acetone, toluene, glycol ethers, and of course fluorinated and
chlorinated organic solvents. ("What Is D-Limonene?" What Is
D-Limonene? Florida Chemical Company, Inc., n.d. Web. 3 Oct. 2013.
http://www.floridachemical.com/whatisd-limonene.htm) In some
embodiments limonene is used to replace one or more of these
organic solvents. As with most organic solvents, d-Limonene is not
water soluble, so it can be used in the typical water separation
units. In some embodiments limonene is used in a water separation
unit. With a KB value of 67, d-Limonene has solubility properties
close to that of CFC's, indicating that it is a much better solvent
than a typical mineral spirit. In some embodiments the superior
characteristics of limonene to typical mineral spirits are
exploited. Straight d-Limonene can be used as a wipe cleaner, in a
dip bath, or in spray systems as a direct substitute for most other
organic solvents. In some embodiments limonene produced through the
present invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) is used in one or more of these applications as a
direct substitute for another organic solvent.
General Purpose Cleaners
[0142] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) in general purpose cleaners. Aqueous
systems incorporating d-Limonene, surfactants, and water are
especially popular for economic and environmental benefits. Levels
of 3%-7% d-Limonene with surfactants (ethoxylated alcohols, glycol
ethers, ethoxylated amines) are common for all-purpose cleaners. In
some embodiments limonene produced through the present invention
(e.g., via microbial production of limonene in an engineered
microorganism that is grown on a gaseous substrate, as described
herein) is mixed with surfactants (ethoxylated alcohols, glycol
ethers, ethoxylated amines) for an all-purpose cleaner. Generally
these formulas take a 2:1 ratio to emulsify d-Limonene at these
levels (e.g. 10% d-Limonene, 5% surfactants, balance water). The
addition of EDTA (chelates) to tie up metals, and phosphates
(builders) such as STPP, TKPP, and metasilicates will contribute to
the balance of the emulsion and probably significantly improve the
overall effectiveness of the cleaner. These various ingredients can
be adjusted to raise the pH to the desired level and improve
chances of creating a stable "non-separating" formula. The 3%-7%
d-Limonene level is effective on medium weight grease, oil, carbon
and road film. It is an excellent whitewall tire cleaner in the
concentrate form.
[0143] By combining d-Limonene with a surfactant package, a water
diluting and rinsible solution can be made. In most cases these
products are used in the institutional and household settings in
place of caustic and other water based cleaners. A concentrated
solution of a d-Limonene/surfactant solution can be made to be
diluted before use, or pre-diluted solutions can be formed. The use
concentrations of d-Limonene in these situations are usually 5-15%.
In general these solutions are used as spray and wipe cleaners. The
water dilutable solutions can also be used in industrial settings
where a water rinse of the parts is desired to remove any residue
which may remain.
[0144] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "General purpose
cleaners".
Cleaner for Concrete
[0145] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) as a cleaner for concrete.
d-Limonene has been used as a maintenance cleaner for concrete
pads, parking complexes, and airport runways. The oils and greases
that drip from cars can be lifted off the concrete either with a
straight d-Limonene or a water diluted product. With straight
d-Limonene, the product is put on the oil spots, which lifts the
oil from the surface, and can be absorbed with a solid media such
as kitty litter or oil absorptive pads. When using a water diluted
product, the traditional mop- and -bucket method may be used. Some
d-Limonene/water products have also been used in small floor
scrubbers for removing oil and fork lift tire marks, and in larger
units for taking up tire marks on runways. d-Limonene will usually
clean graffiti (including effectively replacing xylene in graffiti
removers) off concrete because of its ability to remove paint. The
effectiveness of graffiti cleaning products can also be enhanced by
combining n-methyl pyrollidone (NMP) with d-Limonene in a
formulation. Strong enamels and epoxy paints will not usually be
removed. State highway departments use d-Limonene to remove asphalt
and tar from cement bridges.
[0146] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Cleaner for
concrete".
Release Agent for Asphalt
[0147] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) as a release agent. d-Limonene can
be used at various levels for a release agent that is sprayed on
the beds of asphalt trucks before picking up their loads to
facilitate easy unloading. In the release agent application,
d-Limonene may be a good replacement for diesel fuels commonly used
in this application that are less suited to be dumped on the
ground. Since d-Limonene will not readily freeze (-142.degree. F.
freezing point), the product lends itself to underground storage
through cold winters.
[0148] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Release agent for
asphalt".
Circuit Board Cleaner
[0149] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) as a circuit board cleaner replacing
chlorofluorocarbons (CFC's). Regular grades of d-Limonene can be
used alone for flux removal on circuit boards, but the d-Limonene
may leave a slight film and does not flash off quickly. It can be
used in combination with the other solvents to reduce CFC's or used
straight when followed by an acetone or isopropyl alcohol rinse.
High purity/low residue grades of d-Limonene are being introduced
for PCB applications with some success, though cost of this
material may be twice that of regular d-Limonene.
[0150] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Circuit board
cleaner".
Grease Trap Maintainer
[0151] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) as a grease trap maintainer.
d-Limonene helps dissolve grease (butter, cooking oils, meat fat,
etc.) and keeps foul odors down in restaurant grease traps.
Recommended formulations contain mostly d-Limonene with a small
percent nonionic surfactant for partial emulsification (e.g. 90%
d-Limonene and balance E-Z-Mulse.TM.). Since d-Limonene is an oil,
it will float on top of the water in the grease trap catch
basin.
[0152] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Grease trap
maintainer".
Commercial Parts Washer
[0153] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) as a parts washer and in dip baths.
In the typically parts washer founded in most truck and automobile
maintenance and repair facilities, straight d-Limonene can be used
as a replacement for petroleum derived products. Aside from the
health benefits to the workers from working with a much less toxic
solvent, d-Limonene has proven to be a more effective cleaner. As
with any organic solvent in this type of application, gloves should
be worn to protect against skin dryness and irritation. d-Limonene
concentrates (e.g. 95% d-Limonene and 5% emulsifier) work well in
closed automatic parts wash machines. The machines will dilute the
concentrate automatically according to the quantity of water used
in the wash cycle. Water-based concentrates do not work as well in
this application because of a tendency to generate too much foam.
Formulas should contain low foam or no foam surfactants (d-Limonene
by itself depresses foam).
[0154] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Commercial parts
washer".
Spot and Stain Remover
[0155] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) as a spot and stain remover. The
trick to successful spot and stain removal is to first evaluate the
type of stain and then select the correct cleaning agent.
d-Limonene concentrates (95% d-Limonene, 5% emulsifier) can
effectively remove ink, oil, grease, paint, tar, bubble gum, and
asphalt. After the spot has been wet with the cleaner, a water damp
rag should be used to rinse the product from the area.
[0156] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Spot and stain
remover".
Hand Cleaners
[0157] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) as a hand cleaner. D-Limonene is
very effective removing almost any soil including: ink, paint,
grease, and tar. Solvent based hand cleaners usually contain
approximately 30% solvent. At 10%, d-Limonene will out-perform most
other solvent hand cleaners. Also the 10% level keeps cost
competitive with traditional solvent-based systems at current
limonene prices. In some embodiment of the present invention a
lower cost limonene will be produced than current sources enabling
higher levels of limonene in cost-competitive solvent hand
cleaners. Generally, formulas require an equal percentage of
surfactants to produce stable gel or lotion products. The addition
of low levels of lanolin, jojoba oil, glycerin, or petrolatum
reduces skin irritation associated with prolonged skin contact with
d-Limonene. Many types of grit (gentle abrasives) besides pumice
are sometimes added to heavy duty d-Limonene hand cleaners,
including polyethylene beads and corn-cob grit.
[0158] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Hand
cleaners".
Cleaner for Printing Inks
[0159] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) as a cleaner for printing inks. This
is an area where d-Limonene is currently having mixed success. Even
though d-Limonene is excellent at cleaning and removing ink from
rollers and presses, it sometimes may not be cost effective against
straight cheap solvent systems, but if used properly and in the
right formulation it can be more effective and approach economic
equality with less expensive systems. In some embodiments of the
present invention a lower cost limonene product will enable cost
competitive cleaners with cheap solvent systems. For most oil and
solvent based inks, it is recommended that you use straight
d-Limonene. It will clean the ink from the rollers faster and with
less solvent use than with a petroleum product. Drying time and the
interval between cleaning and running are about the same. Some
inks, especially the water and soy based, can easily be cleaned
with a 20-25% solution of d-Limonene in water. Care must be taken
when formulating these types of products to ensure the surfactants
used for emulsification can be rinsed off the rollers. Generally, a
mixture of 20-25% d-Limonene, 5-7% emulsifier (like an ethoxylated
alcohol), and 4% of a rinsing agent such as Dowanol TPM works well.
It should be noted that most rubber rollers can swell when in
contact with d-Limonene for extended periods of time, so exposure
of the rollers to the cleaner should be kept to a minimum.
[0160] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Cleaner for
printing inks".
Aerosol Ingredient
[0161] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) as an aerosol ingredient. d-Limonene
can combine nicely with other aerosol dispenser propellants to
impart a pleasant citrus odor. d-Limonene in aerosols can directly
replace III tri-chlor, xylene, and other undesirable solvents
included in sprays for cleaning and degreasing. d-Limonene may
attack gaskets and valves of some conventional dispensers. Viton
and neoprene may be some of the best choices for aerosol stem
gaskets (better than butyl or buna). Valves and cans should have an
epon (epoxy) coating. Aerosol packagers and gasket suppliers should
be consulted on materials recommended for d-Limonene.
[0162] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Aerosol
ingredient".
Penetrating Oil
[0163] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) as a penetrating oil. d-Limonene can
be used as a spray on product to loosen bolts and nuts, much like
WD-40.TM.. d-Limonene has the ability to wick into tight joints and
dissolve hardened greases and oils to assist in the removal of
bound nuts and bolts.
[0164] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Penetrating
oil".
Adhesive Removal
[0165] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) as an adhesive removal. d-Limonene
is a very good solvent for removal of adhesives from various
substrates. Most contact adhesives will dissolve very quickly;
however, d-Limonene has almost no effect on epoxies which have
already cured.
[0166] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Adhesive
removal".
Marine Vessel Cleaning
[0167] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) as a marine vessel cleaning product.
d-Limonene applications include degreasing diesel engines and
bearings, removal of heavy carbon deposits, cleaning of slop hoses,
cleaning and recycling of oil filters for extended life, and
general-duty ship maintenance. d-Limonene should not interfere with
oil and water separator sensor systems and is effective in oil
water separators on large shipping vessels since d-Limonene and
water separate so quickly. Additionally, d-Limonene has
environmental advantages compared to other solvent-based systems. A
concentration of 20 to 25% d-Limonene, 15% miscellaneous
surfactants and other desired actives, and balance water. The full
strength concentrate can be employed in 24 hour dips to remove
heavy carbon deposits on engine parts and valves. The cleaner can
be reused for a number of applications. Various dilutions of the
concentrate can perform various other useful jobs:1:10 dilution to
clean oily water separator filters1:20 dilution for slop hoses (to
adequately clean slop hose so it can be reused) 1:50 dilution for
general purpose cleaning around the ship.
[0168] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Marine vessel
cleaning".
Solvent Carriers
[0169] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) as a solvent carrier. Most paint and
adhesive formulations use some sort of carrier solvent to disperse
the product over the intended area. In many cases d-Limonene can be
used as the carrier instead of mineral spirits or other petroleum
based compounds, often with a resulting reduction in the volume of
solvent used use. The drying times are generally not affected.
[0170] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Solvent
carriers".
Asphalt Grading
[0171] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) in asphalt grading. d-Limonene has
been approved as a solvent for use in asphalt grading. When asphalt
is being laid, every so many pounds must tested to insure that the
proper mix of aggregate sizes and oils are being used. d-Limonene
is very effective in the asphalt extraction methodology and has
been approved by most highway departments.
[0172] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Asphalt
grading".
Chemical Synthesis
[0173] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) for the synthesis of other
chemicals. d-Limonene is an interesting organic molecule to
synthesize other compounds. Current commercial applications include
production of tackifying terpene resins used in such diverse
applications as adhesives for disposable baby diapers and floor
coverings, and production of L-carvone, the imitation spearmint
flavor used in many brands of toothpaste.
[0174] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Chemical
synthesis".
Pesticide
[0175] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) as a pesticide. d-Limonene can
effectively kill ants, termites, and other insects on contact.
Several popular flea dips for dogs and cats incorporate d-Limonene.
d-Limonene can be an inert wetting agent in oil-based
pesticides.
[0176] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Pesticide".
Anti-Cancer Applications
[0177] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) in anti-cancer applications.
Researchers at the University of Wisconsin and other institutions
are studying the anti-cancer properties of d-Limonene, targeting
potential applications to fight breast cancer in humans.
[0178] Early research suggests that limonene may be a potential
anti-cancer ingredient and immune stimulant when consumed
orally.
[0179] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "anti-cancer
applications".
Odorant
[0180] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) as an odorant. d-Limonene has been
used by the petroleum industry for years to make mercaptans for
natural gas markers. The pleasant citrus aroma of d-Limonene can be
incorporated into room air-fresheners, automobile air-fresheners,
etc.
[0181] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Odorant".
Extender
[0182] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) as an extender. Flavor and fragrance
industry uses fairly large quantities of d-Limonene to extend other
more valuable natural oils.
[0183] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Extender".
Flavoring Food
[0184] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) to flavor food. D-Limonene is used
in food manufacturing for flavoring purposes to add a delicate
citrus taste. ("Limonene." Squidoo. N.p., n.d. Web. 3 Oct. 2013.
http://www.squidoo.com/limonene)
[0185] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Flavoring
food".
Beauty Products
[0186] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) in beauty products as a scent in
perfume and lotions, to clean skin, and to balance pH-levels of the
skin.
[0187] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Beauty
products".
Antioxidant
[0188] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) as an antioxidant. d-limonene is
known to boost immune function and protect cells, and has
traditionally been used for weight loss and to treat
bronchitis.
[0189] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Anti-oxidant".
Miscellaneous
[0190] In some embodiments the inventive subject matter further
comprises utilizing the limonene produced by the inventive process
in the following applications and/or in compositions for the
following applications in the appropriate proportions (Jones,
Clarence L., 1984, Process for producing blended d-Limonene and
uses of the blended product, U.S. patent Ser. No. 06/654,902):
Tar Remover--full strength; Chewing Gum Remover--full strength;
Degreaser--full strength; Cosmoline Remover--full strength; Wax
Remover--full strength; Rust Remover--full strength; Artist Oil
Remover--full strength; Typewriter Key Cleaner--full strength; PVC
Cleaner--full strength; Decarbonizer--full strength; Filter
Cleaner--full strength; Dead Paint Remover--full strength;
Carburetor Cleaner--full strength; White Sidewall Cleaner--full
strength; Paint Brush Cleaner--full strength; Disinfector--full
strength; Deodorizer--full strength or dilute with baby oil; Tennis
Shoe Cleaner--full strength or dilute with liquid soap; Laundry
additive--1/4 to 1/2 cup per washer load; Panel Cleaner--full
strength or dilute with liquid soap; Black Iron Pots and Pans--full
strength or dilute with liquid soap; Mildew Remover--full strength
or dilute with liquid soap; Oven, Stove, Pot Cleaner--full strength
or dilute with liquid soap; Tile Cleaner--full strength or dilute
with liquid soap; Crayon Remover--full strength; Carpet
spotter--full strength or dilute with shampoo; Porcelain
Cleaner--full strength or dilute with liquid soap; Stainless Steel
Cleaner--full strength or dilute with liquid soap; Silver and
Chrome Cleaner--full strength; Jewelry Cleaner--full strength or
add 25% ammonia; Animal Stain Remover--full strength or dilute with
liquid soap.
Petroleum Related Products
[0191] In some embodiments the inventive subject matter further
comprises utilizing the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) in petroleum related applications.
Because of is volatility and nature of composition, being basically
a turpentine, dipentine, isopropyl compound of high hydrogen and
carbon content, d-Limonene has a variety of petroleum related uses.
These petroleum related uses would be areas wherein the addition of
ammonia as a drying agent would be deleted from the process in
producing the final product. d-Limonene is useful as a reclamation
agent wherein it exhibits a remarkable ability to cleanse used
crankcase oil by a process of percolation wherein the oil is weeped
and percolated slowly through the d-Limonene liquid. In this
process, the used crankcase oil is slowly introduced into a
container containing the d-Limonene product and the oil is slowly
weeped through the d-Limonene liquid in a constant flow. As the oil
passes through the d-Limonene, it is preferably percolated to
remain in contact with the d-Limonene product. This results in a
process wherein the d-Limonene leaches out the high grade unbroken
oil by a molecular adhesion of the high grade oil with the
d-Limonene. This is a comingling action and allows the impurities
in the crankcase oil to drain to the bottom of the container where
they may be drained off. This mixture of high grade oil and
d-Limonene need not be separated due to the high hydrogen and
carbon content of the d-Limonene. This mixture is then a
serviceable oil. The preferred range of d-Limonene to oil is large
and is between 0.1% to 50%.
[0192] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Petroleum related
products".
Gasoline
[0193] In some embodiments the inventive subject matter further
comprises utilizing the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) as a fuel additive. d-Limonene may
be used as a fuel additive for diesel or gasoline where it is mixed
and coalesces with gasoline and diesel of all grade levels. In
spite of the carbon content in d-Limonene being dissimilar to
petroleum carbons, the mixture exhibits an upgraded flammability
due to the compatibility of d-Limonene with petroleum fuels. The
mixture thus burns clean and without visual emissions. It also
provides an excellent engine decarbonizer in that it has a tendency
to dissolve petroleum carbons deposited on the engine surfaces and
will not deposit its own carbons on engine surfaces under
compression combustion. The use as an additive also prevents resin
build-up in carburetors or injectors and is an aid in freeing stuck
or restricted valves. The removal of carbon and prevention of resin
build-up and freeing of stuck or restricted valves results in an
increase in mileage. The preferred ratio is that of approximately
one part d-Limonene to twenty parts diesel or gasoline.
[0194] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Gasoline".
Uses in the Drilling and Refining Segments of the Petroleum
Industry
[0195] In some embodiments the inventive subject matter further
comprises utilizing the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) in both the drilling and refining
segments of the petroleum industry. d-Limonene may be used to
dissolve and suspend all forms of paraffin in solution in a variety
of applications in the petroleum industry as indicated. The
preferred concentration of the d-Limonene in this application is
between sixty (60%) percent to one-hundred (100%) percent
d-Limonene.
[0196] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Uses in the
drilling and refining segments of the petroleum industry".
Crankcase Additive
[0197] In some embodiments the inventive subject matter further
comprises utilizing the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) as a crankcase additive. d-Limonene
is useful as a crankcase additive to prevent sludge and resin
formation in the lubricant supply section of an internal combustion
engine. The preferred range is one part of d-Limonene to every
thirty-two parts of lubricant.
[0198] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Crankcase
additive".
Additive in Petroleum Solvents
[0199] In some embodiments the inventive subject matter further
comprises utilizing the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) as an additive in petroleum
solvents. d-Limonene is useful as an additive in petroleum solvents
since it exhibits amazing performance in releasing rusted threads,
pistons and valves in frozen engines, pumps, compressors, etc. In
this use, the d-Limonene may be used at full strength or at a ratio
of a ninety (90%) percent d-Limonene to ten (10%) percent oil.
[0200] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Additive in
petroleum solvents".
Refining Agent for Crude or Partially Refined Petroleums
[0201] In some embodiments the inventive subject matter further
comprises utilizing the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) as a refining agent for crude or
partially refined petroleums. d-Limonene may be used as a refining
agent for all forms of crude or partially refined petroleums
whereby it separates the petroleum products from water and
separates the oil from undesirable particulates present. These
undesirable particulates are normally comprised of solidified
carbons, sulfur, etc. By the nature of the composition of
d-Limonene, the oil or petroleum product is upgraded by the
addition thereof due to its high compatibility with petroleum. This
results from the fine grade citrus oil in the d-Limonene
product.
[0202] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more compositions and/or
applications as described above in this section "Refining agent for
crude or partially refined petroleums".
Chemical Conversions
Production of Alkanes Through Hydrogenation
[0203] In some embodiments the inventive subject matter further
comprises hydrogenating the limonene produced by the inventive
process (e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein). During hydrogenation, hydrogen plus
a platinum catalyst is added to Limonene and breaks the double bond
in limonene, producing an alkane. (Burdett, Edith. "Limonene."
N.p., n.d. Web.
http://www.docstoc.com/docs/23885504/Limonene---PowerPoint)
[0204] In some embodiments limonene produced through the present
invention will be used in one or more applications as described
above in this section "Production of alkanes through
hydrogenation".
Production of Dihaloalkane by Halogenation
[0205] In some embodiments the inventive subject matter further
comprises halogenation of the limonene produced by the inventive
process (e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein). During halogenation a halogen such
as bromine, chlorine, or iodine breaks the double bond of limonene
and a dihaloalkane is produced.
[0206] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more applications as
described above in this section "Production of dihaloalkane by
halogenation".
Production of Haloalkane by Hydrohalogenation
[0207] In some embodiments the inventive subject matter further
comprises hydrohalogenation of the limonene produced by the
inventive process (e.g., production of limonene biologically in an
engineered microorganism that is capable of converting a gaseous
substrate to limonene, as described herein). During
hydrohalogenation hydrogen and a halogen break the double bond of
limonene forming a haloalkane.
[0208] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more applications as
described above in this section "Production of haloalkane by
hydrohalogenation".
Production of Alcohol by Hydration
[0209] In some embodiments the inventive subject matter further
comprises hydrating the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein). During the hydration reaction
H.sub.2O breaks the double bond of limonene producing an
alcohol.
[0210] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more applications as
described above in this section "Production of alcohol by
hydration".
Enzymatic Conversion
Production of Trans-Isopiperitenol and Menthol
[0211] In some embodiments the inventive subject matter further
comprises utilizing the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) to produce trans-Isopiperitenol
which is then converted into menthol. Limonene is converted into
trans-isopiperitenol and menthol either in a naturally occurring
organism or an organism that produces limonene and is capable of
being genetically engineered with the enzymes necessary to produce
menthol. ("Menthol." Wikipedia, 10 Feb. 2013. Web. 4 Oct. 2013.
https://en.wikipedia.org/wiki/Menthol) Limonene produced by the
inventive process would then be converted by the natural organism
or the genetically modified organism by the following pathway:
limonene would be converted by 4S-limonene-3-hydroxylase to produce
trans-Isopiperitenol. The enzyme trans-isopiperitenol dehydrogenase
would then convert trans-Isopiperitenol into Isopiperitenone. The
enzyme isopiperitenone reductase would then convert isopiperitenone
into cis-isopulegone. The enzyme cis-isopulegone isomerase would
then convert cis-isopulegone into Pulegone. The enzyme pulegone
reductase would then convert Pulegone into menthone. The enzyme
menthone reductase would then convert menthone into menthol.
Production of Trans-Carveol and Carvone
[0212] In some embodiments the inventive subject matter further
comprises using the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) to produce trans-carveol which is
then converted into carvone. Limonene is converted into
trans-carveol and carvone either in a naturally occurring organism
or an organism that produces limonene and is capable of being
genetically engineered with the enzymes necessary to produce
carveol or carvone. Limonene produced by the inventive process
would then be converted by the natural organism or the genetically
modified organism by the following pathway: limonene would be
converted by 4S-limonene-6-hydroxylase to produce trans-carveol.
Trans-carveol is then converted into carvone through a redox
reaction. ("EC 1.1.1.243--Carveol Dehydrogenase." N.p., n.d. Web. 4
Oct. 2013.
<http://www.brenda-enzymes.org/php/result_flat.php4?ecno=1.1.1.243>-
.)
Production of Para-Cymene, Terephthalic Acid, and Dimethyl
Terephthalate
[0213] In some embodiments the inventive subject matter further
comprises utilizing the limonene produced by the inventive process
(e.g., production of limonene biologically in an engineered
microorganism that is capable of converting a gaseous substrate to
limonene, as described herein) to produce para-cymene which can
then be converted into terephthalic acid which can then be
converted into dimethyl terephthalate. Limonene, produced by the
inventive process, is dehydrogenated with a catalyst, such as
ethylenediamine and anhydrous FeCb to produce para-cymene. (Berti
C, Binassi E, Colonna M, Fiorini M, Kannan G, Karanam S,
Mazzacurati M, Odeh I, Vannini M, Bio-based terephthalate
polyesters. European Patent EP 2370491 A2)
[0214] Dehydrogenation can be caused by a catalyst selected from
the group comprising of metal catalysts, amine catalysts, and
combinations thereof. Para-cymene can be produced at a yield of 70%
to 95% from limonene. Para-cymene can be further converted to
terephthalic acid in the presence of an oxidation catalyst, such as
potassium permanganate. Para-cymene can be converted to
terephthalic acid substantially in the absence of chromium oxide,
and substantially in the absence of chromium. Para-cymene can be
converted to terephthalic acid in a two-step oxidation comprising a
first step using a mineral acid, and a second step using a
transition metal oxidant, which can produce a total yield of
85%.
[0215] Terephthalic acid can be further converted with methanol
into dimethyl terephthalic acid.
[0216] Terephthalic acid can also be further converted through
dehydrogenation to produce 1,4-cyclohexane dimenthol.
[0217] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more applications as
described above in this section "Production of para-cymene,
terephthalic acid, and dimethyl terephthalate".
Production of poly(alkaline terephthalate)s, Also Known as
Polyesters
[0218] The terephthalic acid and dimethyl terephthalic acid derived
from the limonene produced by the inventive process (e.g.,
production of limonene biologically in an engineered microorganism
that is capable of converting a gaseous substrate to limonene, as
described herein) may be converted by methods known to those of
skilled in the art, such as a polycondensation reaction, or
transesterification, or other methods known to those of skill in
the art to produce a variety of poly(alkylene terephthalate)s, also
known as polyesters. The terephthalic acid and dimethyl
terephthalic acid derived from the limonene produced by the
inventive process may also be further converted by a reaction with
a diol (HO--R--OH) selected from the group consisting of alkyl,
cycloalkyl, and cycloakylene diakyl groups having from two to ten
carbons.
[0219] To produce poly(butylene terephthalate) (PBT) the
terephthalic acid and dimethyl terephthalic acid, derived from the
limonene produced by the inventive process, react with a diol
having a four carbon chain.
[0220] To produce poly(trim ethylene terephthalate) (PTT) the
terephthalic acid and dimethyl terephthalic acid, derived from the
limonene produced by the inventive process, react with a diol
having a three carbon chain.
[0221] To produce poly(ethylene terephthalate) (PET) the
terephthalic acid and dimethyl terephthalic acid, derived from the
limonene produced by the inventive process, react with a diol
having a two carbon chain.
[0222] PET produced from derivatives of the inventive process can
further be polymerized to produce longer molecular chains.
("Plastic Bottle Manufacturing." N.p., n.d. Web. 4 Oct. 2013.
http://www.thomasnet.com/articles/materials-handling/plastic-bottle-manuf-
acturing) This longer chain PET can then be heated and molded to
produce bottles, carpet, film, or other plastic containers or
consumer goods. One example of a process to produce plastic bottles
is to heat the PET and place the PET in a mold assuming the shape
of a long thin tube. The tube of PET, now called a parison, is then
transferred into a second, bottle-shaped mold. A thin steel rod,
called a mandrel is slid inside the parison where it fills the
parison with highly pressurized air, and stretch blow molding
begins: as a result of the pressurized air, heat and pressure, the
parison is blown and stretched into the mold, assuming a bottle
shape. To ensure the bottom of the bottle is consistently flat, a
separate component of plastic is simultaneously joined to the
bottle during blow molding. The mold must be cooled quickly for the
bottle to set properly. The bottle can be cooled either directly or
indirectly. Water can be coursed through pipes surrounding the
mold, which indirectly cools the mold and plastic. Direct methods
include using pressurized air or carbon dioxide directly on the
mold and plastic. Once the bottle has been cooled and sets, it is
removed from the mold. If a continuous molding process has been
used, the plastic between the bottles will need to be trimmed to
separate the bottles. Excess plastic in non-continuous processes
may also need to be trimmed.
[0223] One example of a process to produce carpet from PET is
through melt spinning. In melt spinning, the PET substance is
melted for extrusion through a spinneret. ("Manufacturing: Fiber
Formation Technology." N.p., n.d. Web. 8 Oct. 2013.
http://www.fibersource.com/f-tutor/techpag.htm) A spinneret is a
multi-pored device through which a plastic polymer melt is extruded
to form fibers. (Spinneret (polymers). (2013, Aug. 23). In
Wikipedia, The Free Encyclopedia. Retrieved 22:27, Oct. 8, 2013,
from
http://en.wikipedia.org/w/index.php?title=Spinneret_(polymers)&oldid=5699-
17656) After going through the spinneret, the PET is directly
solidified by cooling. The melt spun fibers can be extruded from
the spinneret in different cross-sectional shapes including but not
limited to round, trilobal, pentagonal, and octagonal.
Pentagonal-shaped and hollow fibers, when used in carpet, show less
soil and dirt. Octagonal-shaped fibers offer glitter-free effects.
Hollow fibers trap air, creating insulation and provide loft
characteristics equal to, or better than, down.
[0224] One example of a process to produce film from PET begins
with a film of molten PET being extruded onto a chill roll, which
quenches it into the amorphous state. (BoPET. (2013, Oct. 3). In
Wikipedia, The Free Encyclopedia. Retrieved 23:12, Oct. 8, 2013,
from
http://en.wikipedia.org/w/index.php?title=BoPET&oldid=575532373)
It is then biaxially oriented by drawing. The most common way of
doing this is the sequential process, in which the film is first
drawn in the machine direction using heated rollers and
subsequently drawn in the transverse direction, i.e. orthogonally
to the direction of travel, in a heated oven. It is also possible
to draw the film in both directions simultaneously, although the
equipment required for this is somewhat more elaborate. Draw ratios
are typically around 3 to 4 in each direction. Once the drawing is
completed, the film is "heat set" or crystallized under tension in
the oven at temperatures typically above 200 degrees Celsius. The
heat setting step prevents the film from shrinking back to its
original unstretched shape and locks in the molecular orientation
in the film plane. The orientation of the polymer chains is
responsible for the high strength and stiffness of biaxially
oriented PET film, which has a typical Young's modulus of about 4
GPa. Another important consequence of the molecular orientation is
that it induces the formation of many crystal nuclei. The
crystallites that grow rapidly reach the boundary of the
neighboring crystallite and remains smaller than the wavelength of
visible light. As a result, biaxially oriented PET film has
excellent clarity, despite its semicrystalline structure. To make
handling possible, microscopic inert inorganic particles are
usually embedded in the PET to roughen the surface of the film.
Biaxially oriented PET film can be metallized by vapor deposition
of a thin film of evaporated aluminum, gold, or other metal onto
it. The result is much less permeable to gasses (important in food
packaging) and reflects up to 99% of light, including much of the
infrared spectrum. For some applications like food packaging, the
aluminized boPET film can be laminated with a layer of
polyethylene, which provides sealability and improves puncture
resistance. The polyethylene side of such a laminate appears dull
and the PET side shiny. Other coatings, such as conductive indium
tin oxide, can be applied to PET film by sputter deposition. Uses
of PET films include but are not limited to: flexible packaging and
food contact applications; covering over paper; insulating
material; solar, marine, and aviation applications; electronic and
acoustic applications; and graphic arts.
[0225] To produce poly(cyclohexylene dimethyl terephthalate) (PCT)
the terephthalic acid and dimethyl terephthalic acid, derived from
the limonene produced by the inventive process, react with
1,4-cyclohexanedimethanol.
[0226] In some embodiments limonene produced through the present
invention (e.g., via microbial production of limonene in an
engineered microorganism that is grown on a gaseous substrate, as
described herein) will be used in one or more applications as
described above in this section "Production of poly(alkaline
terephthalate)s also known as polyesters".
[0227] The following examples are intended to illustrate, but not
limit, the invention.
EXAMPLES
Example 1
[0228] Cupriavidus necator strain DSM 531 was grown on a mixture of
H.sub.2 and CO.sub.2 and O.sub.2 gases as the sole source of energy
and carbon for growth.
[0229] The following protocol was followed for experiments
performed using a mixture of gases in gas tight serum bottles.
[0230] Experimental inoculum: 5% by volume, taken from another
H.sub.2 grown serum bottle culture.
[0231] The initial H.sub.2 grown serum bottle culture was given 5%
inoculation from a Lysogeny broth (LB) grown Cupriavidus necator
inoculum and grown -72 hours on H.sub.2/CO.sub.2/O.sub.2 gas mix
following inoculation from original LB grown culture. Original LB
grown inoculum was recovered from glycerol stock stored at
-80.degree. C.
[0232] Serum bottle growth on gas was performed in 160-ml stoppered
and sealed Wheaton glass serum bottles (VWR product number
16171-385). Volume of liquid media was 20 ml. The bottles were
plugged with a rubber stopper (VWR #100483-774) and aluminum seal
(VWR #89047-008) using Wheaton Hand-Operated Crimper (VWR
#80078-996). 20 ml working volume included 19 ml Minimal Salts
Medium (MSM), as described in Thermophilic Bacteria, CRC Press,
Boca Raton, Fla., Jacob K. Kristjansson, ed., 1992, p. 87, Table
4+1 ml inoculum (i.e., 5% inoculum).
[0233] The MSM was dispensed in the bottles and gaseous compounds
were added as follows: Sterile MSM was transferred into bottles
under sterile conditions. 5% gas cultured inoculum was inoculated
into the bottles under sterile conditions, and the bottles were
plugged with rubber stoppers and sealed. A gas mixture was added at
15 psig to the bottles through a manifold. After the gas mix was
added, the seal was crimped with aluminum to seal the serum
bottles. The bottles were then placed in a shake flask
incubator.
[0234] The following experimental results were obtained from 16
serum bottles (14 experimental replicates, 2 controls) incubated at
30.degree. C., 250 RPM. All 16 serum bottles were purged
simultaneously with a 67% H.sub.2, 24% air (4.8% O.sub.2), 9%
CO.sub.2 gas mix using a manifold as described above. The gas
composition run through the manifold was confirmed using gas
chromatography (GC) before connecting the serum bottles. Bottles
were sacrificed for analysis at 7 time points. The two negative
controls were sacrificed at T.sub.0 and the last time point
respectively. Negative control bottles had identical preparation as
experimental bottles minus the inoculum, and were used to detect
any contamination and/or abiotic loss or leakage of gas from the
bottle headspace. Gas headspace pressure readings samples were
taken on negative controls to observe any abiotic CO.sub.2 &
H.sub.2 sorption into the liquid medium and/or gas loss due to
leakage.
Sampling and Analytical Procedures
[0235] All samples were taken under sterile conditions using
syringes and needles for bottle experiments. The optical density
(OD) was measured using a Beckman Coulter DU720 UV/Vis
spectrophotometer at 650 nm using 100 ul samples.
[0236] At each time point one to three experimental replicate
bottles were sacrificed for analysis. Gaseous consumption within
the serum bottles was measured using a pressure gauge connected to
a needle. The headspace gas pressure was measured for each
sacrificed bottle, and a sample of headspace gas was taken by gas
tight syringe for gas chromatography (GC) analysis. Analysis of gas
headspace samples by GC used a 100-uL sample of headspace gas
injected into the GC via gas tight syringe. Gas headspace content
of H.sub.2, CO.sub.2, O.sub.2, and N.sub.2 in the serum bottles was
quantified at each time point. For sampling the broth, the septum
of serum bottle was wiped with EtOH and the entire liquid contents
of bottle withdrawn into a 30 mL syringe, using bottle pressure.
100 uL of sample was pipetted out for OD measurement at 650 nm.
Samples were centrifuged at 12000 G for 15 min at 4.degree. C.
Pellets were resuspended in 10 mL sterile PBS, vortexed, and vacuum
filtered through pre-weighed 0.45 um filters. The filters were
dried and filter+biomass retentate weighed to determine biomass dry
weight. Dry weights were determined for cells collected on membrane
filters (0.45 um) by drying at 60.degree. C. for 24 hours and
cooling to room temperature in a desiccator and weighing. This
cycle of drying and re-weighing was continued until the weight
remained constant. A correlation was developed between OD and
biomass density (dry cell weight per volume).
[0237] The correlation between OD and biomass density is shown in
FIG. 5. The growth curve for this experiment is shown in FIG. 6.
The OD measured for individual experimental replicates is
represented by the diamond symbols, and the average OD is
represented by the solid line. Logarithmic growth occurred between
9 and 30 hours (FIG. 6). Change in headspace gas pressure over time
is shown in FIG. 7.
[0238] Assuming the ideal gas law (PV=nRT) for the headspace gases,
the total moles of gases were calculated, accounting for
temperature variation in sample points. The proportion of each
respective gas in the headspace of each bottle was determined by
GC. Using the gas headspace results and the measured dry weights,
the proportionality of cell weight to moles of H.sub.2 consumed was
determined. FIG. 8 shows the measured dry biomass for each bottle
sacrificed, plotted against the moles of H.sub.2 consumed, as
determined by headspace pressure measurement and GC analysis for
each respective bottle. These results indicated that between 6.7 to
7.2 grams of dry cell mass were synthesized per mole of H.sub.2
consumed, or 3.3-3.6 grams cell mass per gram of H.sub.2.
Example 2
[0239] Cupriavidus necator strain DSM 531 was grown to 38 grams per
liter dry cell density on a mixture of H.sub.2, CO.sub.2, and
O.sub.2 gases as the sole source of energy and carbon for
growth.
[0240] The following protocol was followed for experiments
performed using a mixture of gases including H.sub.2, CO.sub.2, and
O.sub.2 in a stirred-tank bioreactor.
[0241] Apparatus: Culture was grown in batch, using a
custom-manufactured 500 mL glass fermenter with PEEK headplate.
Temperature and pH were controlled and monitored with a commercial
controller (Electrolab, Fermac 360, United Kingdom). A combination
of magnetic stir bars and continuous recycle at 280 mL/min were
used for mixing. Recycle could be either withdrawn from the bottom
liquid section of the reactor and returned to the headspace through
sprayers to control foaming or run in reverse to recycle the
headspace gas into the bottom of the broth. Gas supply was from
compressed H.sub.2, compressed CO.sub.2 and house air, each
regulated to 20 psi. H.sub.2 and air were delivered to a flow
proportioner (Matheson G2-4D151-E401/E401, 20 psi), which set the
relative fraction of the gases. The H.sub.2/air gas mix was then
delivered to each fermenter through a variable area flow meter; the
flow rate to each fermenter of the same H.sub.2/air composition
could be adjusted by the needle valve of the flow meter. CO.sub.2
gas was split and delivered to individual variable area flow meters
at each fermenter. The CO.sub.2 and H.sub.2/air lines tee into a
single line delivered to the fermenter. A pressure gauge was used
to monitor the gas delivery pressure to the fermenter. Gas was
mixed into the fermenter broth via four 2-micron diffusion stones
(p/n KEG592,
http://morebeer.com/products/diffusion-stone-2-micron-oxygen.html),
and vented from the reactor via a condenser to a foam-overflow
bottle, then to an exhaust system.
[0242] Medium: The medium used for this experiment is described in
Example 1. pH control was performed with 2N NH.sub.4OH or 2N NaOH.
2N NH.sub.4OH was prepared from 5 M NH.sub.4OH, Fluke 318612 (kept
at 4.degree. C.) (120 mL)+autoclaved milliQ-H2O (180 mL).
[0243] Autotrophic inoculum: Cupriavidus necator DSM 531 inoculum
was taken from H.sub.2/CO.sub.2/O.sub.2 grown serum bottle culture.
Inoculum was prepared from preserved 0.5 mL glycerol stocks stored
at -80 C for the DSMZ 531 strain. Revival cultures were started on
H.sub.2/CO.sub.2/O.sub.2 gas mix per the serum bottle protocol
described in Example 1, with 0.5 mL glycerol stock added to 20 mL
minimal salts medium (MSM) in a gas tight serum bottle. This
initial serum bottle was then subcultured, 1 mL to 20 mL fresh MSM,
into 2 serum bottles under the standard H.sub.2/CO.sub.2/O.sub.2
gas headspace. These serum bottles were incubated at 30.degree. C.,
250 RPM. The initial revival from the glycerol stock on gas took 2
days and the subculture took another day to grow. The two serum
bottle cultures were provided as inoculum for the bioreactor.
Optical density (OD) of inoculum was taken as well as a sample for
DNA analysis. The gas grown inoculum had an OD .about.1. The
fermenter was inoculated to give an initial OD .about.0.1. In other
words, the serum bottle broth was diluted in the bioreactor at a
1:10 ratio. Inoculum was transferred from serum bottles to the
bioreactor using a 60 mL syringe. After inoculation, a T.sub.0 OD
was taken. Generally all OD measurements were performed with a
Beckman Coulter DU720 UV/Vis spectrophotometer.
[0244] Fermenter Operation:
Base Addition--
[0245] pH was controlled with 2N NH.sub.4OH
Foam Control--
[0246] If foaming filled more than 1/2 headspace, and was not
controlled by headspace spraying or recirculation, then anti-foam
was used. (A8011, Sigma Antifoam C Emulsion,
http://www.sigmaaldrich.com/catalog/product/sigma/a8011?lang=en®ion=US-
)
Nutrient Amendment--
[0247] In addition to nitrogen nutrient provided by base addition
of NH.sub.4OH, other mineral nutrients were added during the run so
as to prolong growth and prevent any mineral nutrient limitations
from occurring.
[0248] FIG. 9 gives an example of a growth curve for the knallgas
microorganism Cupriavidus necator grown on H.sub.2/CO.sub.2/O.sub.2
gas substrate according to this protocol. The final OD measured at
650 nm was 132 and the final dry biomass density was 38 grams/liter
from growth on H.sub.2/CO.sub.2/O.sub.2 gas substrate. Log growth
lasted the first day and a half, however the biomass was still
accumulating at a linear rate at the termination of the run during
day five.
Example 3
[0249] Experiments were performed to express a limonene synthase
gene in a microbial strain that is capable of growing on gas
substrates as a source of energy and carbon for growth and
bioproduct production. Limonene synthase was transformed into
Cupriavidus necator (DSM531) in pBADTcalRBS under the control of
the ara promoter.
[0250] Limonene synthase from Citrus unshiu (Uniprot Q6F5H3) was
codon optimized (LS_Cu, SEQ ID NO: 1) for expression in Cupriavidus
necator (DSM531). The protein sequence was amplified for Golden
Gate assembly (Engler, C. & Marillonnet, S. Golden Gate
cloning. Methods Mol. Biol. 1116, 119-131 (2014)) with Q5 DNA
polymerase (New England Biolabs) using forward and reverse primers
SEQ ID NO:2 and SEQ ID NO:3, respectively. The vector pBADTcalRBS
(Bi, C. et al. Development of a broad-host synthetic biology
toolbox for Ralstonia eutropha and its application to engineering
hydrocarbon biofuel production. Microb. Cell Fact. 12, 107 (2013))
was similarly amplified using the primers pBADTcalRBS-GG2-F (SEQ ID
NO:4) and pBADTcalRBS-GG2-R (SEQ ID NO:5) as the forward and
reverse primers, respectively, which exclude the red fluorescent
protein coding sequence.
[0251] The amplified gene and vector with Golden Gate assembly
extensions were assembled using BsaI and T4 DNA ligase (New England
Biolabs) and the standard protocol (Engler, C., Gruetzner, R.,
Kandzia, R. & Marillonnet, S. Golden gate shuffling: a one-pot
DNA shuffling method based on type IIs restriction enzymes. PLoS
One 4, e5553 (2009)). The assembled plasmid was transformed into E.
coli for propagation. Correct ligation was confirmed by Sanger
sequencing (Quintarabio, Berkeley, Calif.). Plasmid
pBADTcalRBS-LS_Cu is depicted in FIG. 10.
[0252] C. necator competent cells were prepared by incubating a
single colony in 3 mL of NR medium (10 g/L polypeptone, 10 g/L
yeast extract, 5 g/L beef extract, 5 g/L ammonium sulfate; pH 7.0)
at 30.degree. C. overnight. Aliquots of cells (10 .mu.L) were used
to inoculate each 1 mL of NR media. The cultures were incubated for
six hours. Cells were collected by centrifugation at 14,000 rpm for
1 min and washed 3 times with 1 mL (each) of sterile ice-cold
ddH.sub.2O. The collected cells were re-suspended in 100 .mu.L of
20% (v/v) sterile glycerol in sterile ice-cold ddH.sub.2O and
stored at -80.degree. C.
[0253] For electroporation, the competent cells were thawed on ice,
transferred into a 0.1-cm-wide electroporation cuvette and gently
mixed with 1 .mu.g of plasmid DNA. Cells were electroporated using
a single-pulse electroporation (11.5 kV/cm, 25 .mu.F and 3-5 ms
pulse time). The pulsed cells were transferred into 1 mL of fresh
NR medium and incubated for 2 h at 30.degree. C. with shaking.
Transformants were selected after cultivation for 48 h at
30.degree. C. on LB-agar plate containing kanamycin (200 .mu.g/ml).
Individual colonies were selected and patched onto an LB-agar plate
containing kanamycin (200 .mu.g/mL). Transformation was confirmed
by isolating plasmid DNA from a 3-mL overnight LB culture
containing 200 .mu.g/mL kanamycin and sequencing the isolated
plasmid. Untransformed C. necator (DSM531) cells did not grow under
those conditions.
[0254] Cultures of two C. necator transformants with
pBADTcalRBS-LS_Cu were grown as follows: A small amount of cells
from the patch plate were used to inoculate 3 mL of LB media
containing 200 .mu.g/mL kanamycin. The culture was incubated
overnight at 30.degree. C. A 50-.mu.L aliquot of the overnight
culture was used to inoculate 5 mL of LB containing 200 .mu.g/mL
kanamycin in a glass culture tube. The media was overlaid with 500
.mu.L of dodecane and incubated at 30.degree. C. with shaking (250
rpm). After six hours of incubation, arabinose was added to 0.1%
(w/v) or 0.5% (w/v). A 100-.mu.L aliquot of dodecane was removed at
0, 24, 72, and 144 hours post-induction. After the 144 h timepoint
was collected, 200 .mu.L of fresh dodecane were added to the
culture. At 192 hours post-induction, a final aliquot of 100 .mu.L
was collected.
[0255] Samples were prepared for analysis by diluting 50 .mu.L of
the dodecane layer removed from cultures in 300 .mu.L of ethyl
acetate. Limonene was detected on an Agilent 6890N GC/MS with a
5975C MS detector (Santa Clara, Calif.). Column used was a Cyclosil
B (J&W Scientific, 30 m.times.320 .mu.m), injection temperature
250.degree. C. operating in splitless mode. Column flow rate was 1
ml/min, initial temperature 60.degree. C., ramp 10.degree. C./min
to 135, and ramp 30.degree. C./min to 200. Data acquisition was in
SIM mode, ions monitored were 68 and 93. Quantification was
accomplished by running known standards of D-Limonene (Sigma).
Limonene produced by the cultures is shown in FIG. 11.
TABLE-US-00001 >LS_Citrus_unshiu_optimized 1821 bp Limonene
synthase derived from Satsuma mandarin optimized for expression in
R. eutropha SEQ ID NO: 1
ATGAGCTCGTGCATCAATCCCAGCACCCTGGTGACCTCGGTGAATGGCTTCAAGTGCCTG
CCCCTGGCCACCAACAAGGCGGCGATCCGCATCATGGCGAAGAATAAGCCCGTGCAGTGC
CTGGTGTCCGCCAAGTACGATAACCTGACCGTGGATCGCCGCTCCGCCAATTACCAGCCG
TCGATCTGGGACCACGACTTCCTCCAGAGCCTGAACTCCAACTACACCGACGAAACGTAC
AAGCGCCGCGAGGAGGAACTGAAAGGCAAGGTCATGACCACCATCAAGGACGTGACGGAG
CCGCTGAACCAGCTGGAACTGATCGACTCGCTCCAGCGCCTGGGCCTGGCGTACCACTTT
GAAACCGAGATTCGCAACATCCTCCATGACATCTACAACAGCAACAACGACTACGTCTGG
CGGAAGGAAAACCTGTACGCAACGAGCCTGGAGTTTCGGCTGCTCCGCCAGCATGGCTAT
CCGGTGTCGCAAGAAGTGTTCAACGGCTTCAAGGACGACCAAGGCGGCTTCATCTGCGAC
GACTTCAAGGGCGTCCTGTCCCTGCACGAGGCCAGCTACTTCTCGCTGGAGGGCGAATCG
ATCATGGAGGAGGCATGGCAGTTCACCTCGAAGCATCTGAAGGAAGTCATGATCTCGAAG
TCCAAGCAGGGCGACGTGTTCGTGGCCGAGCAGGCCAAGCGGGGCCTGGAGCTGCCGCTG
CACTGGAAGGTGCCGATGCTGGAAGCCCGCTGGTTCATCGACGTGTACGAGAAGCGCGAG
GACAAGAATCACCTGCTGCTGGAGCTGGCCAAACTGGAGTTCAACGTGCTCCAGGCGATC
TATCAAGAGGAACTGAAGGATGTCTCGCGCTGGTGGAAGGATATTGGCCTGGGCGAGAAG
CTGTCGTTTGCCCGCGACAGCCTGGTGGCGTCCTTCGTCTGGTCGATGGGCATCGTGTTC
GAGCCCCAGTTCGCCTATTGTCGCCGCATCCTCACCATCACCTTCGCGCTGATCTCGGTG
ATCGACGACATCTACGACGTCTATGGCACGCTGGATGAACTGGAGCTGTTCGCCGATGCC
GTGGAGCGCTGGGATATCAACTACGCCCTGAATCACCTGCCGGACTATATGAAAATCTGC
TTTCTGGCCCTGTACAACCTGGTCAACGAATTTACGTACTATGTCCTGAAGCAGCAGGAC
TTCGACATCCTGCGCTCGATTAAGAACGCGTGGCTGCGCAACATCCAGGCGTACCTGGTC
GAAGCGAAGTGGTACCATGGGAAGTATACGCCGACCCTGGGCGAGTTCCTGGAAAACGGC
CTGGTGAGCATCGGCGGCCCGATGGTGACGATGACGGCCTACCTCAGCGGGACCAACCCG
ATCATCGAAAAGGAGCTGGAGTTTCTGGAAAGCAATCAGGATATCAGCCACTGGTCGTTC
AAAATCCTGCGCCTCCAGGACGACCTGGGCACCAGCTCGGACGAGATTCGCCGGGGCGAC
GTCCCCAAGAGCATCCAGTGCTACATGCACGAAACGGGCGCATCGGAGGAGGTGGCGCGC
GAGCACATCAAGGACATGATGCGCCAGATGTGGAAGAAGGTGAACGCGTATCGCGCGGAC
AAGGATTTCCCGCTGTCGCAGACCACGGTGGAGTTCATCCTGAACGTGGTGCGGGTGAGC
CACTTCATGTACCTGCATGGGGATGGGCATGGCGCCCAGAACCAGGAAACCATGGACGTC
GTGTTCACCCTGCTGTTCCAGCCGATCCCGCTCGACGACAAGCACATCGTGGCCACCTCC
TCGCCGGTCACCAAGGGCTAA >LS_Cu Golden Gate forward primer SEQ ID
NO: 2 CACACCAGGTCTCACTAAATGAGCTCGTGCATCAATCC >LS_Cu Golden Gate
reverse primer SEQ ID NO: 3 CACACCAGGTCTCACATTTTAGCCCTTGGTGACCG
>pBADTcalRBS Golden Gate forward primer (pBADTcalRBS-GG2-F) As
described in DNA Cloning and Assembly Methods, Methods in Molecular
Biology Volume 1116, 2014, pp 119-131, Date: 10 Dec. 2013 SEQ ID
NO: 4 CACACCAGGTCTCATTAGATTGTGTACTCCTTCTTCTGTTCC >pBADTcalRBS
Golden Gate reverse primer (pBADTcalRBS-GG2-R) As described in DNA
Cloning and Assembly Methods, Methods in Molecular Biology Volume
1116, 2014, pp 119-131, Date: 10 Dec. 2013 SEQ ID NO: 5
CACACCAGGTCTCAAATGTGAAGGTCGTCACTCCAC
Example 4
[0256] Cupriavidus necator DSM 531 was transformed with the plasmid
pBBR1MCS-2 described in Kovach et al. (1995 Gene 166 (1): 175-176),
which conferred antibiotic resistance. The Cupriavidus necator was
grown on LB medium and a Kanamycin concentration of 400 .mu.g/mL.
The plasmid contains the IncQ like replication gene, Mob gene that
is mobilized when the RK2 transfer functions are provided in trans,
kanamycin resistance gene, LacZ operon and the multiple cloning
sites.
[0257] The incoculation volume was 100 .mu.L each replicate from
glycerol stock stored at -80.degree. C. of Cupriavidus necator DSM
531 transformed with plasmid pBBR1MCS-2 into 50 mL of LB plus
kanamycin at 400 .mu.g/mL in 250 mL Erlenmeyer flasks. The flasks
were incubated for 30 hours, at 30.degree. C., 250 rpm. Cultures
were harvested, OD measured, and then centrifuged. The two
replicates grew to OD600 of 2.6 and 3.2.
[0258] The cell mass was separated from the supernatant of the
culture broth by centrifugation. After centrifuging the wet pellet
weights were 0.79 and 0.77 grams for the replicates with OD 2.6 and
3.2 respectively. This corresponds to approximately 0.20 and 0.19
grams dry cell weight respectively.
[0259] The supernatant was split into two fractions, one was
extracted with 2.times.5 mL chloroform and the other 2.times.5 mL
hexane. The solvent was added, the mixture vortexed for 1 minute
and centrifuged for 15 minutes at 2500 rpm. The solvent layer was
removed, dried under nitrogen at 37.degree. C., and stored at
-20.degree. C. until analysis. An aliquot of the wet pellet was
extracted with 10:5:4 mixture of methanol:chloroform:water. Lipids
were applied to Silica-60 columns, and different lipid groups were
separated and eluted from the column with organic solvents
including chloroform and methanol. Separated aliquots were dried
under nitrogen at 37.degree. C. and stored at -20.degree. C. until
analysis.
[0260] Gas Chromatography and Mass Spectrometry (GC/MS) analysis:
compounds were detected on an Agilent 6890N GC/MS (Agilent, Santa
Clara, Calif.) on a HP1 60 m column.times.0.25 mm ID. Samples were
placed in GC vial inserts with a final volume in chloroform of 50
uL. Samples were injected using an automatic injector, the injector
temperature was 250.degree. C. and was run in split mote (8:1) with
an initial GC temperature of 100.degree. C., ramp at 10.degree.
C./min to a final temp of 150.degree. C., then a ramp of 3.degree.
C./min to 250.degree. C., finally a 10.degree. C./min ramp to
312.degree. C. which is held for 7 min. Peak ID was accomplished
through a NIST08 library and quantification through a standard
curve prepared with hexadecane.
[0261] The triterpene squalene was detected by GC/MS in the lipid
extract from the wet pellet of cell mass generated by each
experimental replicate. Squalene was not detected in the
supernatant. For the first and second replicates the squalene peak
was at a retention time of 28.338 and 28.345 in the first and
second replicates shown in FIGS. 12 and 13, respectively. In both
replicates Squalene comprised the majority of the hydrocarbons
detected.
[0262] Although the foregoing invention has been described in some
detail by way of illustration and examples for purposes of clarity
of understanding, it will be apparent to those skilled in the art
that certain changes and modifications may be practiced without
departing from the spirit and scope of the invention. Therefore,
the description should not be construed as limiting the scope of
the invention.
[0263] All publications, patents, and patent applications cited
herein are hereby incorporated by reference in their entireties for
all purposes and to the same extent as if each individual
publication, patent, or patent application were specifically and
individually indicated to be so incorporated by reference.
Sequence CWU 1
1
511821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 1atgagctcgt gcatcaatcc cagcaccctg
gtgacctcgg tgaatggctt caagtgcctg 60cccctggcca ccaacaaggc ggcgatccgc
atcatggcga agaataagcc cgtgcagtgc 120ctggtgtccg ccaagtacga
taacctgacc gtggatcgcc gctccgccaa ttaccagccg 180tcgatctggg
accacgactt cctccagagc ctgaactcca actacaccga cgaaacgtac
240aagcgccgcg aggaggaact gaaaggcaag gtcatgacca ccatcaagga
cgtgacggag 300ccgctgaacc agctggaact gatcgactcg ctccagcgcc
tgggcctggc gtaccacttt 360gaaaccgaga ttcgcaacat cctccatgac
atctacaaca gcaacaacga ctacgtctgg 420cggaaggaaa acctgtacgc
aacgagcctg gagtttcggc tgctccgcca gcatggctat 480ccggtgtcgc
aagaagtgtt caacggcttc aaggacgacc aaggcggctt catctgcgac
540gacttcaagg gcgtcctgtc cctgcacgag gccagctact tctcgctgga
gggcgaatcg 600atcatggagg aggcatggca gttcacctcg aagcatctga
aggaagtcat gatctcgaag 660tccaagcagg gcgacgtgtt cgtggccgag
caggccaagc ggggcctgga gctgccgctg 720cactggaagg tgccgatgct
ggaagcccgc tggttcatcg acgtgtacga gaagcgcgag 780gacaagaatc
acctgctgct ggagctggcc aaactggagt tcaacgtgct ccaggcgatc
840tatcaagagg aactgaagga tgtctcgcgc tggtggaagg atattggcct
gggcgagaag 900ctgtcgtttg cccgcgacag cctggtggcg tccttcgtct
ggtcgatggg catcgtgttc 960gagccccagt tcgcctattg tcgccgcatc
ctcaccatca ccttcgcgct gatctcggtg 1020atcgacgaca tctacgacgt
ctatggcacg ctggatgaac tggagctgtt cgccgatgcc 1080gtggagcgct
gggatatcaa ctacgccctg aatcacctgc cggactatat gaaaatctgc
1140tttctggccc tgtacaacct ggtcaacgaa tttacgtact atgtcctgaa
gcagcaggac 1200ttcgacatcc tgcgctcgat taagaacgcg tggctgcgca
acatccaggc gtacctggtc 1260gaagcgaagt ggtaccatgg gaagtatacg
ccgaccctgg gcgagttcct ggaaaacggc 1320ctggtgagca tcggcggccc
gatggtgacg atgacggcct acctcagcgg gaccaacccg 1380atcatcgaaa
aggagctgga gtttctggaa agcaatcagg atatcagcca ctggtcgttc
1440aaaatcctgc gcctccagga cgacctgggc accagctcgg acgagattcg
ccggggcgac 1500gtccccaaga gcatccagtg ctacatgcac gaaacgggcg
catcggagga ggtggcgcgc 1560gagcacatca aggacatgat gcgccagatg
tggaagaagg tgaacgcgta tcgcgcggac 1620aaggatttcc cgctgtcgca
gaccacggtg gagttcatcc tgaacgtggt gcgggtgagc 1680cacttcatgt
acctgcatgg ggatgggcat ggcgcccaga accaggaaac catggacgtc
1740gtgttcaccc tgctgttcca gccgatcccg ctcgacgaca agcacatcgt
ggccacctcc 1800tcgccggtca ccaagggcta a 1821238DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
2cacaccaggt ctcactaaat gagctcgtgc atcaatcc 38335DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
3cacaccaggt ctcacatttt agcccttggt gaccg 35442DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
4cacaccaggt ctcattagat tgtgtactcc ttcttctgtt cc 42536DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
5cacaccaggt ctcaaatgtg aaggtcgtca ctccac 36
* * * * *
References