U.S. patent application number 16/170312 was filed with the patent office on 2019-05-16 for microrna compounds and methods for modulating mir-122.
This patent application is currently assigned to Regulus Therapeutics Inc.. The applicant listed for this patent is Regulus Therapeutics Inc.. Invention is credited to Balkrishen Bhat, Daniel Hogan.
Application Number | 20190144864 16/170312 |
Document ID | / |
Family ID | 50928262 |
Filed Date | 2019-05-16 |
View All Diagrams
United States Patent
Application |
20190144864 |
Kind Code |
A1 |
Bhat; Balkrishen ; et
al. |
May 16, 2019 |
MicroRNA Compounds and Methods for Modulating MIR-122
Abstract
Described herein are compositions and methods for the inhibition
of miR-122 activity. The compositions have certain nucleoside
modifications that yield potent inhibitors of miR-122 activity. The
compounds may comprise conjugates to facilitate delivery to the
liver. The compositions may be administered to subjects infected
with hepatitis C virus, as a treatment for hepatitis C virus and
related conditions.
Inventors: |
Bhat; Balkrishen;
(Cambridge, MA) ; Hogan; Daniel; (San Diego,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Regulus Therapeutics Inc. |
San Diego |
CA |
US |
|
|
Assignee: |
Regulus Therapeutics Inc.
San Diego
CA
|
Family ID: |
50928262 |
Appl. No.: |
16/170312 |
Filed: |
October 25, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15403672 |
Jan 11, 2017 |
10150967 |
|
|
16170312 |
|
|
|
|
15056534 |
Feb 29, 2016 |
9574194 |
|
|
15403672 |
|
|
|
|
14266136 |
Apr 30, 2014 |
9309513 |
|
|
15056534 |
|
|
|
|
61818432 |
May 1, 2013 |
|
|
|
61822112 |
May 10, 2013 |
|
|
|
61839550 |
Jun 26, 2013 |
|
|
|
61895784 |
Oct 25, 2013 |
|
|
|
61898704 |
Nov 1, 2013 |
|
|
|
61927897 |
Jan 15, 2014 |
|
|
|
Current U.S.
Class: |
424/85.7 ;
514/44R |
Current CPC
Class: |
A61K 47/544 20170801;
C12N 2320/31 20130101; A61K 31/4709 20130101; A61K 31/7072
20130101; A61K 47/62 20170801; C12N 2310/315 20130101; C12N 15/113
20130101; A61P 31/14 20180101; A61K 31/4184 20130101; C12N 2320/30
20130101; A61K 47/68 20170801; A61K 31/7125 20130101; C12N 2310/321
20130101; A61K 47/548 20170801; C12N 2310/3231 20130101; C12N
2310/141 20130101; C12N 2310/11 20130101; C12N 2310/351 20130101;
C12N 15/111 20130101; A61K 45/06 20130101; C12N 2310/113 20130101;
A61P 43/00 20180101; C12N 15/1131 20130101; A61K 47/543 20170801;
A61K 31/4178 20130101; A61K 47/549 20170801; A61P 1/16 20180101;
A61K 47/554 20170801; C12N 2310/3515 20130101; A61K 47/54
20170801 |
International
Class: |
C12N 15/113 20060101
C12N015/113; A61K 47/68 20060101 A61K047/68; C12N 15/11 20060101
C12N015/11; A61K 47/54 20060101 A61K047/54; A61K 47/62 20060101
A61K047/62; A61K 31/7125 20060101 A61K031/7125; A61K 31/4178
20060101 A61K031/4178; A61K 45/06 20060101 A61K045/06; A61K 31/7072
20060101 A61K031/7072; A61K 31/4709 20060101 A61K031/4709; A61K
31/4184 20060101 A61K031/4184 |
Claims
1-114. (canceled)
115. A conjugate having the structure: ##STR00039## wherein X is a
phosphodiester linkage; m is 1; N in N.sub.m is a
.beta.-D-deoxyriboadenosine; Y is a phosphodiester linkage; and MO
is a modified oligonucleotide consisting of less than 16 linked
nucleosides, wherein the nucleobase sequence of the modified
oligonucleotide comprises a nucleobase sequence that is
complementary to nucleobases 2 to 9 of miR-122 (SEQ ID NO: 1), and
wherein the modified oligonucleotide comprises at least 8
contiguous nucleosides of the following structure: TABLE-US-00031
(SEQ ID NO: 4)
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.E.sup.MeC.sub.EA.sub.ET.sub.ETGU-
.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S,,
wherein the superscript "Me" indicates 5-methylcytosine;
nucleosides not followed by a subscript are
.beta.-D-deoxyribonucleosides; nucleosides followed by a subscript
"E" are 2'-MOE nucleosides; nucleosides followed by a subscript "S"
are S-cEt nucleosides; and each internucleoside linkage is a
phosphorothioate internucleoside linkage; and wherein Y is linked
to the 3' terminus of the modified oligonucleotide.
116. A pharmaceutical composition comprising the conjugate of claim
115 and one or more pharmaceutically acceptable excipients.
117. The pharmaceutical composition of claim 116, which is a
sterile aqueous solution.
118. A method of treating an HCV infection comprising administering
to an HCV-infected human a therapeutically effective amount of the
pharmaceutical composition of claim 116.
119. The method of claim 118, wherein the administering reduces HCV
RNA level.
120. The method of claim 118, wherein the method achieves a
sustained virological response.
121. The method of claim 118, wherein the subject is infected with
one or more HCV genotypes selected from genotype 1, genotype 2,
genotype 3, genotype 4, genotype 5, and genotype 6.
122. The method of claim 121, wherein the HCV genotype is selected
from genotype 1a, genotype 1b, genotype 2a, genotype 2b, genotype
2c, genotype 2d, genotype 3a, genotype 3b, genotype 3c, genotype
3d, genotype 3e, genotype 3f, genotype 4a, genotype 4b, genotype
4c, genotype 4d, genotype 4e, genotype 4f, genotype 4g, genotype
4h, genotype 4i, genotype 4j, genotype 5a, and genotype 6a.
123. The method of claim 118, comprising administering at least one
additional therapeutic agent.
124. The method of claim 123, wherein the at least one therapeutic
agent is selected from a protease inhibitor, a polymerase
inhibitor, a cofactor inhibitor, an RNA polymerase inhibitor, a
structural protein inhibitor, a non-structural protein inhibitor, a
cyclophilin inhibitor, an entry inhibitor, a TLR.sub.7 agonist, and
an interferon.
125. The method of claim 123, wherein the at least one therapeutic
agent is selected from a protease inhibitor, an NS5A inhibitor, an
NS3/4A inhibitor, a nucleoside NS5B inhibitor, a nucleotide NS5B
inhibitor, a non-nucleoside NS5B inhibitor, a cyclophilin inhibitor
and an interferon.
126. The method of claim 123, wherein the at least one therapeutic
agent is selected from interferon alfa-2a, interferon alpha-2b,
interferon alfacon-1, peginterferon alpha-2b, peginterferon
alpha-2a, interferon-alpha-2b extended release, interferon lambda,
sofosbuvir, ledipasvir, ribavirin, telapravir, boceprevir,
vaniprevir, asunaprevir, ritonavir, setrobuvir, daclastavir,
simeprevir, alisporivir, mericitabine, tegobuvir, danoprevir,
sovaprevir, and neceprevir.
127. The method of claim 123, wherein the at least one therapeutic
agent is sofosbuvir.
128. The method of claim 123, wherein the at least one therapeutic
agent is sofosbuvir and ledipasvir.
129. The method of claim 123, wherein the at least one therapeutic
agent is daclatasvir.
130. The method of claim 123, wherein the at least one therapeutic
agent is simeprevir.
131. The method of claim 118, wherein the subject is a
direct-acting anti-viral non-responder.
132. The method of claim 118, wherein the subject has an
HCV-associated disease selected from cirrhosis, liver fibrosis,
steatohepatitis, steatosis, and hepatocellular carcinoma.
133. The method of claim 118, comprising administering the
pharmaceutical composition once per week, once per two weeks, once
per three weeks, once per month, once per two months, or once per
three months.
134. The method of claim 118, wherein the dose of the conjugate
administered to the HCV-infected human is less than or equal to 10
mg/kg, less than or equal to 7.5 mg/kg, less than or equal to 5
mg/kg per week, less than or equal to 4.5 mg/kg, less than or equal
to 4.0 mg/kg, less than or equal to 3.5 mg/kg, less than or equal
to 3.0 mg/kg, less than or equal to 2.5 mg/kg, less than or equal
to 2.0 mg/kg, less than or equal to 1.5 mg/kg, or less than or
equal to 1.0 mg/kg.
Description
[0001] This application is a divisional of U.S. application Ser.
No. 15/403,672, filed Jan. 11, 2017, which is a divisional of U.S.
application Ser. No. 15/056,534, filed Feb. 29, 2016, now U.S. Pat.
No. 9,574,194, which is a continuation of U.S. application Ser. No.
14/266,136, filed Apr. 30, 2014, now U.S. Pat. No. 9,309,513, which
claims the benefit of U.S. Provisional Application Nos. 61/818,432,
filed May 1, 2013; 61/822,112, filed May 10, 2013; 61/839,550,
filed Jun. 26, 2013; 61/895,784, filed Oct. 25, 2013; 61/898,704,
filed Nov. 1, 2013; and 61/927,897, filed Jan. 15, 2014; each of
which is incorporated by reference herein in its entirety for any
purpose.
FIELD OF INVENTION
[0002] Provided herein are compounds and methods for use in
modulating the activity of miR-122. Such methods comprise treatment
of diseases related to miR-122 activity, such HCV infection.
DESCRIPTION OF RELATED ART
[0003] MicroRNAs (microRNAs), also known as "mature microRNA" are
small (approximately 18-24 nucleotides in length), non-coding RNA
molecules encoded in the genomes of plants and animals. In certain
instances, highly conserved, endogenously expressed microRNAs
regulate the expression of genes by binding to the 3'-untranslated
regions (3'-UTR) of specific mRNAs. More than 1000 different
microRNAs have been identified in plants and animals. Certain
mature microRNAs appear to originate from long endogenous primary
microRNA transcripts (also known as pri-microRNAs, pri-mirs,
pri-miRs or pri-pre-microRNAs) that are often hundreds of
nucleotides in length (Lee, et al., EMBO J., 2002, 21(17),
4663-4670).
[0004] miR-122, a microRNA abundantly and specifically expressed in
the liver, is a critical host factor for hepatitis C virus
accumulation (Jopling et al., Science. 2005, 309(5740), 1577-81).
miR-122 interacts with HCV by binding to two closely spaced seed
sequence sites in the 5' non-coding region of the HCV genome,
resulting in stabilization of the HCV genome, supporting
replication and translation (Jangra et al., J Virol., 2010, 84:
6615-6625; Machlin, et al., 2011). Importantly, the miR-122 binding
sites are completely conserved in the HCV genome across all
genotypes and subtypes (Wilson et al., J. Virol., 2011, 85:
2342-2350). Inhibition of miR-122 with anti-miR results in reduced
total circulating cholesterol levels in mice and cynomolgus monkey,
as well as changes in the expression of genes involved in
cholesterol homeostasis, fatty acid, and lipid metabolism (Esau et
al., 2006, Cell Metabolism, 3: 87-98). In chronically HCV-infected
chimpanzees, weekly intravenous administration of anti-miR to
long-lasting and reversible suppression of HCV RNA levels and
reduced total serum cholesterol (Lanford et al., 2010, Science,
327:198-201). In chronic treatment naive HCV infected patients,
anti-miR-122 treatment led to a reduction in serum HCV RNA, thus
demonstrating clinical proof-of-concept.
[0005] Hepatitis C (HCV) is a hepatotropic RNA virus in the
Flaviviridae family and, addition to causing HCV infection, is a
major cause of chronic liver disease and hepatocellular carcinoma.
The current standard-of-care treatment, pegylated interferon in
combination with ribavirin, is poorly tolerated by many patients
and can have a response rate as low as 50% in some patients.
Several direct acting anti-viral NS3 protease inhibitors are
currently approved for use in HCV-infected patients, however the
emergence of resistance mutations in HCV requires treatment with
additional agents. Developing therapies include NS3/4A protease
inhibitors, NS5A protein inhibitors, nucleoside/tide NS5B
polymerase inhibitors and non-nucleoside NS5B inhibitors. However,
there remains a need for additional therapies to treat infected
individuals who do not respond to current treatments, who relapse
following successful treatment, or who have a low tolerability for
one or more currently used drugs. Resistance to antiviral therapy
is a major problem associated with a high mutation rate of HCV and
is seen even with combinations of drugs working through multiple
mechanisms. Accordingly, therapeutics that target conserved,
mutation-resistant viral host factors, such as miR-122, represent
an opportunity to effect higher and more durable cure rates.
SUMMARY OF INVENTION
[0006] Provided herein are compounds comprising a modified
oligonucleotide consisting of 16 to 22 linked nucleosides, wherein
the nucleobase sequence of the modified oligonucleotide is
complementary to miR-122 (SEQ ID NO: 1) and wherein the modified
oligonucleotide comprises at least 16 contiguous nucleosides of the
following nucleoside pattern I in the 5' to 3' orientation:
TABLE-US-00001
(R).sub.X-N.sup.Q-N.sup.Q-N.sup.B-N.sup.B-N.sup.Q-N.sup.B-N.sup.Q-N.sup.B-
-N.sup.Q-N.sup.B-N.sup.B-(N.sup.Z).sub.Y
[0007] wherein each R is, independently, a non-bicyclic nucleoside
or a bicyclic nucleoside; [0008] X is from 4 to 10; [0009] each
N.sup.B is, independently, a bicyclic nucleoside; [0010] each
N.sup.Q is, independently, a non-bicyclic nucleoside; [0011] Y is 0
or 1; and [0012] N.sup.Z is a modified nucleoside or an unmodified
nucleoside.
[0013] In certain embodiments, a compound provided herein comprises
a modified oligonucleotide comprising at least 16, at least 17, at
least 18, at least 19, at least 20, at least 21, or 22 contiguous
nucleosides of nucleoside pattern I.
[0014] In certain embodiments, each bicyclic nucleoside is
independently selected from an LNA nucleoside, a cEt nucleoside,
and an ENA nucleoside. In certain embodiments, at least two
bicyclic nucleosides are different from one another. In certain
embodiments, all bicyclic nucleosides have the same sugar moiety as
one another. In certain embodiments, each bicyclic nucleoside is a
cEt nucleoside. In certain embodiments, a cEt nucleoside is an
S-cEt nucleoside. In certain embodiments, a cEt nucleoside is an
R-cEt nucleoside. In certain embodiments, each bicyclic nucleoside
is an LNA nucleoside.
[0015] In certain embodiments, at least two non-bicyclic
nucleosides comprise sugar moieties that are different from one
another. In certain embodiments, each non-bicyclic nucleoside has
the same type of sugar moiety. In certain embodiments, each
non-bicyclic nucleoside is independently selected from a
.beta.-D-deoxyribonucleoside, a .beta.-D-ribonucleoside,
2'-O-methyl nucleoside, a 2'-O-methoxyethyl nucleoside, and a
2'-fluoronucleoside. In certain embodiments, each non-bicyclic
nucleoside is independently selected from a
.beta.-D-deoxyribonucleoside, and a 2'-O-methoxyethyl nucleoside.
In certain embodiments, each non-bicyclic nucleoside is a
.beta.-D-deoxyribonucleoside. In certain embodiments, each
non-bicyclic nucleoside is a 2'-MOE nucleoside. In certain
embodiments, no more than two non-bicyclic nucleosides are 2'-MOE
nucleosides, wherein each other non-bicyclic nucleoside is a
.beta.-D-deoxyribonucleoside. In certain embodiments, the 5'-most
and the 3'-most non-bicyclic nucleosides are 2'-MOE nucleosides and
each other non-bicyclic nucleoside is a
.beta.-D-deoxyribonucleoside. In certain embodiments, two
non-bicyclic nucleosides are 2'-MOE nucleosides and each other
non-bicyclic nucleoside is a .beta.-D-deoxyribonucleoside.
[0016] In certain embodiments, each R is a 2'-MOE nucleoside. In
certain embodiments, X is 4, 5, 6, 7, 8, 9, or 10. In certain
embodiments, Y is 0. In certain embodiments, Y is 1.
[0017] In certain embodiments, X is 7, each R is a
2'-O-methoxyethyl nucleoside, each N.sup.B is an S-cEt nucleoside,
each N.sup.Q is a .beta.-D-deoxyribonucleoside, and Y is 0.
[0018] In certain embodiments, X is 4; (R).sub.X is
N.sup.R1-N.sup.R2-N.sup.R3-N.sup.R4, wherein each of N.sup.R1 and
N.sup.R3 is a S-cEt nucleoside and each of N.sup.R2 and N.sup.R4 is
a .beta.-D-deoxyribonucleoside; each N.sup.B is an S-cEt
nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; Y is 1;
and N.sup.Z is a .beta.-D-deoxyribonucleoside.
[0019] In certain embodiments, X is 4; (R).sub.X is
N.sup.R1-N.sup.R2-N.sup.R3-N.sup.R4, wherein each of N.sup.R1 and
N.sup.R4 is a S-cEt nucleoside and each of N.sup.R2 and N.sup.R3 is
a .beta.-D-deoxyribonucleoside; each N.sup.B is an S-cEt
nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; Y is 1;
and N.sup.Z is a 2'-O-methoxyethyl nucleoside.
[0020] In certain embodiments, X is 7; (R).sub.X is
N.sup.R1-N.sup.R2-N.sup.R3-N.sup.R4-N.sup.R5-N.sup.R6-N.sup.R7,
wherein each of N.sup.R1, N.sup.R2, N.sup.R3, and N.sup.R4 and is a
2'-O-methoxyethyl nucleoside, each of N.sup.R5 and N.sup.R7 is a
.beta.-D-deoxyribonucleoside, and N.sup.R6 is S-cEt nucleoside;
each N.sup.B is an S-cEt nucleoside; each NQ is a
I3-D-deoxyribonucleoside; and Y is 0.
[0021] In certain embodiments, X is 7; (R).sub.X is
N.sup.R1-N.sup.R2-N.sup.R3-N.sup.R4-N.sup.R5-N.sup.R6-N.sup.R7,
wherein each of N.sup.R1, N.sup.R2, N.sup.R3, N.sup.R4, and
N.sup.R5 is a 2'-O-methoxyethyl nucleoside, N.sup.R6 is S-cEt
nucleoside, and N.sup.R7 is a .beta.-D-deoxyribonucleoside; each
N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; and Y is 0.
[0022] In certain embodiments, X is 7; (R).sub.X is
N.sup.R1-N.sup.R2-N.sup.R3-N.sup.R4-N.sup.R5-N.sup.R6-N.sup.R7,
wherein each of N.sup.R1, N.sup.R2, N.sup.R3, N.sup.R4, N.sup.R5,
and N.sup.R6 is 2'-O-methoxyethyl nucleoside, and N.sup.R7 is a
.beta.-D-deoxyribonucleoside; each N.sup.B is an S-cEt nucleoside;
each N.sup.Q is a .beta.-D-deoxyribonucleoside; and Y is 0.
[0023] In certain embodiments, X is 10; (R).sub.X is
N.sup.R1-N.sup.R2-N.sup.R3-N.sup.R4-N.sup.R5-N.sup.R6-N.sup.R7-N.sup.R7-N-
.sup.R8-N.sup.R9-N.sup.R10, wherein each of N.sup.R1, N.sup.R2,
N.sup.R3, N.sup.R4, N.sup.R5, and N.sup.R6 is 2'-O-methoxyethyl
nucleoside, each of N.sup.R7 and N.sup.R9 is a an S-cEt nucleoside;
each of N.sup.R8 and N.sup.R10 is a .beta.-D-deoxyribonucleoside;
each N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; and Y is 0.
[0024] In certain embodiments, X is 10; (R).sub.X is
N.sup.R1-N.sup.R2-N.sup.R3-N.sup.R4-N.sup.R5-N.sup.R6-N.sup.R7-N.sup.R8-N-
.sup.R9-N.sup.R10, wherein each of N.sup.R1, N.sup.R2, N.sup.R3,
N.sup.R4, N.sup.R5, and N.sup.R6 is 2'-O-methoxyethyl nucleoside,
each of N.sup.R7 and N.sup.R9 is a an S-cEt nucleoside; and each of
N.sup.R8 and N.sup.R10 is a .beta.-D-deoxyribonucleoside; each
N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; Y is 1 and N.sub.Z is a
2'-O-methoxyethyl nucleoside.
[0025] In certain embodiments, X is 4; (R).sub.X is
N.sup.R1-N.sup.R2-N.sup.R3-N.sup.R4, wherein each of N.sup.R1and
N.sup.R4 is an S-cEt nucleoside, and each of N.sup.R1 and N.sup.R3
is a .beta.-D-deoxyribonucleoside; each N.sup.B is an S-cEt
nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; Y is 1
and N.sup.Z is a .beta.-D-deoxyribonucleoside.
[0026] In certain embodiments, X is 4; (R).sub.X is
N.sup.R1-N.sup.R2-N.sup.R3-N.sup.R4, wherein N.sup.R1 is a
2'-O-methoxyethyl nucleoside, each of N.sup.R2 and N.sup.R4 is an
S-cEt nucleoside, and N.sup.R3 is a .beta.-D-deoxyribonucleoside;
each N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; Y is 1 and N.sup.Z is a
2'-O-methoxyethyl nucleoside.
[0027] In certain embodiments, the nucleobase sequence of the
modified oligonucleotide is at least 90%, at least 92%, at least
93%, at least 94%, at least 95%, at least 96%, at least 97%, at
least 98%, at least 99%, or 100% complementary to the nucleobase
sequence of miR-122 (SEQ ID NO: 1).
[0028] In certain embodiments, wherein at least one internucleoside
linkage is a modified internucleoside linkage, or wherein each
internucleoside linkage is a modified internucleoside linkage, and,
optionally, wherein the modified internucleoside linkage is a
phosphorothioate internucleoside linkage.
[0029] In certain embodiments, the nucleobase sequence of the
modified oligonucleotide is selected from SEQ ID NOs: 3 to 6,
wherein each T is independently selected from T and U.
[0030] In certain embodiments, the modified oligonucleotide has 0,
1, 2, or 3 mismatches with respect to the nucleobase sequence of
miR-122.
[0031] In certain embodiments a compound has the structure:
TABLE-US-00002 (SEQ ID NO: 4)
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.E.sup.MeC.sub.EA.sub.ET.sub.ETGU-
.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S; (SEQ ID NO: 3)
C.sub.SCA.sub.STTGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.SA;
(SEQ ID NO: 3)
.sup.MeC.sub.SCAT.sub.STGT.sub.S.sup.MeC.sub.SA.sup.MeC.sub.SA.sup.MeC.su-
b.ST.sup.MeC.sub.S.sup.MeC.sub.SA.sub.E; (SEQ ID NO: 4)
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.ECA.sub.STTGU.sub.SC.sub.SAC.sub-
.SAC.sub.STC.sub.SC.sub.S; (SEQ ID NO: 4)
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.E.sup.MeC.sub.EA.sub.STTGU.sub.S-
C.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S; (SEQ ID NO: 4)
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.E.sup.MeC.sub.EA.sub.ETTGU.sub.S-
C.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S; (SEQ ID NO: 5)
.sup.MeC.sub.EA.sub.EA.sub.EA.sub.E.sup.MeC.sub.EA.sub.EC.sub.SCA.sub.STT-
GU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S; (SEQ ID NO: 6)
.sup.MeC.sub.EA.sub.EA.sub.EA.sub.E.sup.MeC.sub.EA.sub.EC.sub.SCA.sub.STT-
GU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.ST.sub.E; (SEQ ID NO:
3)
C.sub.SCAU.sub.STGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.SA;
or (SEQ ID NO: 3)
.sup.MeC.sub.EC.sub.SAU.sub.STGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.su-
b.SA.sub.E;
wherein the superscript "Me" indicates 5-methylcytosine;
nucleosides not followed by a subscript are
.beta.-D-deoxyribonucleosides; nucleosides followed by a subscript
"E" are 2'-MOE nucleosides; nucleosides followed by a subscript "S"
are S-cEt nucleosides; and each internucleoside linkage is a
phosphorothioate internucleoside linkage.
[0032] In some embodiments, a compound has the structure:
TABLE-US-00003
U.sub.STGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.SA.sub.S; or
C.sub.SA.sub.SC.sub.SA.sub.SC.sub.SU.sub.SC.sub.SC.sub.S
wherein nucleosides not followed by a subscript are
.beta.-D-deoxyribonucleosides; nucleosides followed by a subscript
"S" are S-cEt nucleosides; and each internucleoside linkage is a
phosphorothioate internucleoside linkage. In some such embodiments,
the compound is compound 38591, 38633, 38998, or 38634.
[0033] Any of the compounds provided herein may comprise a
conjugate moiety linked to the 5' terminus or the 3' terminus of
the modified oligonucleotide. In certain embodiments, the compound
comprises a conjugate moiety linked to the 3' terminus of the
modified oligonucleotide. In certain embodiments, the compound
comprises a conjugate moiety linked to the 5' terminus of the
modified oligonucleotide. In certain embodiments, the compound
comprises a first conjugate moiety linked to the 3' terminus of the
modified oligonucleotide and a second conjugate moiety linked to
the 5' terminus of the modified oligonucleotide. In certain
embodiments, the conjugate moiety comprises at least one ligand
selected from a carbohydrate, cholesterol, a lipid, a phospholipid,
an antibody, a lipoprotein, a hormone, a peptide, a vitamin, a
steroid, and a cationic lipid.
[0034] In certain embodiments, a compound has the structure
L.sub.n-linker-MO, wherein each L is, independently, a ligand and n
is from 1 to 10; and MO is a modified oligonucleotide.
[0035] In certain embodiments, a compound has the structure
L.sub.n-linker-X--MO, wherein each L is, independently, a ligand
and n is from 1 to 10; X is a phosphodiester linkage or a
phosphorothioate linkage; and MO is a modified oligonucleotide.
[0036] In certain embodiments, a compound has the structure
L.sub.n-linker-X.sub.1-N.sub.m-X.sub.2--MO, wherein each L is,
independently, a ligand and n is from 1 to 10; each N is,
independently, a modified or unmodified nucleoside and m is from 1
to 5; X.sub.1 and X.sub.2 are each, independently, a phosphodiester
linkage or a phosphorothioate linkage; and MO is a modified
oligonucleotide.
[0037] In certain embodiments, a compound has the structure
L.sub.n-linker-X-N.sub.m-Y--MO, wherein each L is, independently, a
ligand and n is from 1 to 10; each N is, independently, a modified
or unmodified nucleoside and m is from 1 to 5; X is a
phosphodiester linkage or a phosphorothioate linkage; Y is a
phosphodiester linkage; and MO is a modified oligonucleotide.
[0038] In certain embodiments, a compound has the structure
L.sub.n-linker-Y-N.sub.m-Y-MO, wherein each L is, independently, a
ligand and n is from 1 to 10; each N is, independently, a modified
or unmodified nucleoside and m is from 1 to 5; each Y is a
phosphodiester linkage; and MO is a modified oligonucleotide.
[0039] Tn certain embodiments, if n is greater than 1,
L.sub.n-linker has the structure:
##STR00001##
wherein each L is, independently, a ligand; n is from 1 to 10; S is
a scaffold; and Q' and Q'' are, independently, linking groups.
[0040] In certain embodiments, Q' and Q'' are each independently
selected from a peptide, an ether, polyethylene glycol, an alkyl, a
C.sub.1-C.sub.20 alkyl, a substituted C.sub.1-C.sub.20 alkyl, a
C.sub.2-C.sub.2 alkenyl, a substituted C.sub.2-C.sub.20 alkenyl, a
C.sub.2-C.sub.2 alkynyl, a substituted C.sub.2-C.sub.20 alkynyl, a
C.sub.1-C.sub.20 alkoxy, a substituted C.sub.1-C.sub.20 alkoxy,
amino, amido, a pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO),
succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate, and
6-aminohexanoic acid.
[0041] In certain embodiments, a scaffold links 2, 3, 4, or 5
ligands to a modified oligonucleotide. In certain embodiments, a
scaffold links 3 ligands to a modified oligonucleotide.
[0042] A nonlimiting exemplary Structure E is Structure E(i):
##STR00002##
wherein L.sub.1, L.sub.2, and L.sub.3 are each, independently, a
ligand; Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q'' are each,
independently, a linking group; and R.sub.1, R.sub.2, R.sub.3, and
R.sub.4 are each, independently, selected from H, C.sub.1-C.sub.6
alkyl, and substituted C.sub.1-C.sub.6 alkyl.
[0043] In some embodiments, Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q''
are each, independently, selected from a peptide, an ether,
polyethylene glycol, an alkyl, a C.sub.1-C.sub.20 alkyl, a
substituted C.sub.1-C.sub.20 alkyl, a C.sub.2-C.sub.20 alkenyl, a
substituted C.sub.2-C.sub.20 alkenyl, a C.sub.2-C.sub.20 alkynyl, a
substituted C.sub.2-C.sub.20 alkynyl, a C.sub.1-C.sub.20 alkoxy, a
substituted C.sub.1-C.sub.20 alkoxy, amino, amido, a pyrrolidine,
8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl
4-(N-maleimidomethyl) cyclohexane-1-carboxylate, and
6-aminohexanoic acid. In some embodiments, R.sub.1, R.sub.2,
R.sub.3, and R.sub.4 are each, independently, selected from H,
methyl, ethyl, propyl, isopropyl, and butyl. In some embodiments,
R.sub.1, R.sub.2, R.sub.3, and R.sub.4 are each selected from H and
methyl.
[0044] A further nonlimiting exemplary Structure E is Structure
E(ii):
##STR00003##
wherein L.sub.1, L.sub.2, and L.sub.3 are each, independently, a
ligand; Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q'' are each,
independently, a linking group; and R.sub.1 is selected from H,
C.sub.1-C.sub.6 alkyl, and substituted C.sub.1-C.sub.6 alkyl.
[0045] In some embodiments, Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q''
are each, independently, selected from a peptide, an ether,
polyethylene glycol, an alkyl, a C.sub.1-C.sub.20 alkyl, a
substituted C.sub.1-C.sub.20 alkyl, a C.sub.2-C.sub.20 alkenyl, a
substituted C.sub.2-C.sub.20 alkenyl, a C.sub.2-C.sub.20 alkynyl, a
substituted C.sub.2-C.sub.20 alkynyl, a C.sub.1-C.sub.20 alkoxy, a
substituted C.sub.1-C.sub.20 alkoxy, amino, amido, a pyrrolidine,
8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl
4-(N-maleimidomethyl) cyclohexane-1-carboxylate, and
6-aminohexanoic acid. In some embodiments, R.sub.1 is selected from
H, methyl, ethyl, propyl, isopropyl, and butyl. In some
embodiments, R.sub.1 is H or methyl.
[0046] A further nonlimiting exemplary Structure E is Structure
E(iii):
##STR00004##
wherein L.sub.1, L.sub.2, and L.sub.3 are each, independently, a
ligand; Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q'' are each,
independently, a linking group; and R.sub.1, R.sub.2, R.sub.3,
R.sub.4, and R.sub.5 are each, independently, selected from H,
C.sub.1-C.sub.6 alkyl, and substituted C.sub.1-C.sub.6 alkyl.
[0047] In some embodiments, Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q''
are each, independently, selected from a peptide, an ether,
polyethylene glycol, an alkyl, a C.sub.1-C.sub.20 alkyl, a
substituted C.sub.1-C.sub.20 alkyl, a C.sub.2-C.sub.20 alkenyl, a
substituted C.sub.2-C.sub.20 alkenyl, a C.sub.2-C.sub.20 alkynyl, a
substituted C.sub.2-C.sub.20 alkynyl, a C.sub.1-C.sub.20 alkoxy, a
substituted C.sub.1-C.sub.20 alkoxy, amino, amido, a pyrrolidine,
8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl
4-(N-maleimidomethyl) cyclohexane-1-carboxylate, and
6-aminohexanoic acid. In some embodiments, R.sub.1, R.sub.2,
R.sub.3, R.sub.4, and R.sub.5 are each, independently, selected
from H, methyl, ethyl, propyl, isopropyl, and butyl. In some
embodiments R.sub.1, R.sub.2, R.sub.3, R.sub.4, and R.sub.5 are
each selected from H and methyl.
[0048] A further nonlimiting exemplary Structure E is Structure
E(iv):
##STR00005##
wherein L.sub.1 and L.sub.2 are each, independently, a ligand;
Q'.sub.1, Q'.sub.2, and Q'' are each, independently, a linking
group; and R.sub.1, R.sub.2, and R.sub.3 are each, independently,
selected from H, C.sub.1-C.sub.6 alkyl, and substituted
C.sub.1-C.sub.6 alkyl.
[0049] In some embodiments, Q'.sub.1, Q'.sub.2, and Q'' are each,
independently, selected from a peptide, an ether, polyethylene
glycol, an alkyl, a C.sub.1-C.sub.20 alkyl, a substituted
C.sub.1-C.sub.20 alkyl, a C.sub.2-C.sub.20 alkenyl, a substituted
C.sub.2-C.sub.20 alkenyl, a C.sub.2-C.sub.20 alkynyl, a substituted
C.sub.2-C.sub.20 alkynyl, a C.sub.1-C.sub.20 alkoxy, a substituted
C.sub.1-C.sub.20 alkoxy, amino, amido, a pyrrolidine,
8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl
4-(N-maleimidomethyl) cyclohexane-1-carboxylate, and
6-aminohexanoic acid. In some embodiments, R.sub.1, R.sub.2, and
R.sub.3 are each, independently, selected from H, methyl, ethyl,
propyl, isopropyl, and butyl. In some embodiments R.sub.1, R.sub.2,
and R.sub.3 are each selected from H and methyl.
[0050] A further nonlimiting exemplary Structure E is Structure
E(v):
##STR00006##
wherein L.sub.1 and L.sub.2 are each, independently, a ligand;
Q'.sub.1, Q'.sub.2, and Q'' are each, independently, a linking
group; and R.sub.1, R.sub.2, and R.sub.3 are each, independently,
selected from H, C.sub.1-C.sub.6 alkyl, and substituted
C.sub.1-C.sub.6 alkyl.
[0051] In some embodiments, Q'.sub.1, Q'.sub.2, and Q'' are each,
independently, selected from a peptide, an ether, polyethylene
glycol, an alkyl, a C.sub.1-C.sub.20 alkyl, a substituted
C.sub.1-C.sub.20 alkyl, a C.sub.2-C.sub.20 alkenyl, a substituted
C.sub.2-C.sub.20 alkenyl, a C.sub.2-C.sub.20 alkynyl, a substituted
C.sub.2-C.sub.20 alkynyl, a Ci-C.sub.20 alkoxy, a substituted
C.sub.1-C.sub.20 alkoxy, amino, amido, a pyrrolidine,
8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl
4-(N-maleimidomethyl) cyclohexane-1-carboxylate, and
6-aminohexanoic acid. In some embodiments, R.sub.1, R.sub.2, and
R.sub.3 are each, independently, selected from H, methyl, ethyl,
propyl, isopropyl, and butyl. In some embodiments R.sub.1, R.sub.2,
and R.sub.3 are each selected from H and methyl.
[0052] A further nonlimiting exemplary Structure E is Structure
E(vi):
##STR00007##
wherein L.sub.1, L.sub.2, and L.sub.3 are each, independently, a
ligand; Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q'' are each,
independently, a linking group; and R.sub.1, R.sub.2, and R.sub.3
are each, independently, selected from H, C.sub.1-C.sub.6 alkyl,
and substituted C.sub.1-C.sub.6 alkyl.
[0053] In some embodiments, Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q''
are each, independently, selected from a peptide, an ether,
polyethylene glycol, an alkyl, a C.sub.1-C.sub.20 alkyl, a
substituted C.sub.1-C.sub.20 alkyl, a C.sub.2-C.sub.20 alkenyl, a
substituted C.sub.2-C.sub.20 alkenyl, a C.sub.2-C.sub.20 alkynyl, a
substituted C.sub.2-C.sub.20 alkynyl, a Ci-C.sub.20 alkoxy, a
substituted C.sub.1-C.sub.20 alkoxy, amino, amido, a pyrrolidine,
8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl
4-(N-maleimidomethyl) cyclohexane-1-carboxylate, and
6-aminohexanoic acid. In some embodiments, R.sub.1, R.sub.2, and
R.sub.3 are each, independently, selected from H, methyl, ethyl,
propyl, isopropyl, and butyl. In some embodiments R.sub.1, R.sub.2,
and R.sub.3 are each selected from H and methyl.
[0054] A further nonlimiting exemplary Structure E is Structure
E(vii):
##STR00008##
wherein L.sub.1, L.sub.2, and L.sub.3 are each, independently, a
ligand; Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q'' are each,
independently, a linking group; R.sub.1, R.sub.2, and R.sub.3 are
each, independently, selected from H, C.sub.1-C.sub.6 alkyl, and
substituted C.sub.1-C.sub.6 alkyl; and Z and Z' are each
independently selected from O and S.
[0055] In some embodiments, Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q''
are each, independently, selected from a peptide, an ether,
polyethylene glycol, an alkyl, a C.sub.1-C.sub.20 alkyl, a
substituted C.sub.1-C.sub.20 alkyl, a C.sub.2-C.sub.20 alkenyl, a
substituted C.sub.2-C.sub.20 alkenyl, a C.sub.2-C.sub.20 alkynyl, a
substituted C.sub.2-C.sub.20 alkynyl, a C.sub.1-C.sub.20 alkoxy, a
substituted C.sub.1-C.sub.20 alkoxy, amino, amido, a pyrrolidine,
8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl
4-(N-maleimidomethyl) cyclohexane-1-carboxylate, and
6-aminohexanoic acid. In some embodiments, R.sub.1, R.sub.2, and
R.sub.3 are each, independently, selected from H, methyl, ethyl,
propyl, isopropyl, and butyl. In some embodiments R.sub.1, R.sub.2,
and R.sub.3 are each selected from H and methyl. In some
embodiments, Z or Z' on at least one P atom is S, and the other Z
or Z' is O (i.e., a phosphorothioate linkage). In some embodiments,
each --OP(Z)(Z')O-- is a phosphorothioate linkage. In some
embodiments, Z and Z' are both O on at least one P atom (i.e., a
phosphodiester linkage). In some embodiments, each --OP(Z)(Z')O--
is a phosphodiester linkage.
[0056] A further nonlimiting exemplary Structure E is Structure
E(viii):
##STR00009##
wherein L.sub.1, L.sub.2, and L.sub.3 are each, independently, a
ligand; Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q'' are each,
independently, a linking group; and R.sub.1, R.sub.2, R.sub.3, and
R.sub.4 are each, independently, selected from H, C.sub.1-C.sub.6
alkyl, and substituted C.sub.1-C.sub.6 alkyl.
[0057] In some embodiments, Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q''
are each, independently, selected from a peptide, an ether,
polyethylene glycol, an alkyl, a C.sub.1-C.sub.20 alkyl, a
substituted C.sub.1-C.sub.20 alkyl, a C.sub.2-C.sub.20 alkenyl, a
substituted C.sub.2-C.sub.20 alkenyl, a C.sub.2-C.sub.20 alkynyl, a
substituted C.sub.2-C.sub.20 alkynyl, a Ci-C.sub.20 alkoxy, a
substituted C.sub.1-C.sub.20 alkoxy, amino, amido, a pyrrolidine,
8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl
4-(N-maleimidomethyl) cyclohexane-1-carboxylate, and
6-aminohexanoic acid. In some embodiments, R.sub.1, R.sub.2,
R.sub.3, and R.sub.4 are each, independently, selected from H,
methyl, ethyl, propyl, isopropyl, and butyl. In some embodiments
R.sub.1, R.sub.2, R.sub.3, and R.sub.4 are each selected from H and
methyl.
[0058] Nonlimiting exemplary scaffolds and/or linkers comprising
scaffolds, and synthesis thereof, are described, e.g., PCT
Publication No. WO 2013/033230, U.S. Pat. No. 8,106,022 B2, U.S.
Publication No. 2012/0157509 A1; U.S. Pat. No. 5,994,517; U.S. Pat.
No. 7,491,805 B2; U.S. Pat. No. 8,313,772 B2; Manoharan, M.,
Chapter 16, Antisense Drug Technology, Crooke, S. T., Marcel
Dekker, Inc., 2001, 391-469.
[0059] In certain embodiments, a compound has the structure:
##STR00010##
wherein: [0060] B is selected from --O--, --S--, --N(R.sup.N)--,
--Z--P(Z')(Z'')O--, --Z--P(Z')(Z'')O--N.sub.m--X--, and
--Z--P(Z')(Z'')O--N.sub.m--Y--; [0061] MO is a modified
oligonucleotide; [0062] R.sup.N is selected from H, methyl, ethyl,
propyl, isopropyl, butyl, and benzyl; [0063] Z, Z', and Z'' are
each independently selected from O and S; [0064] each N is,
independently, a modified or unmodified nucleoside; [0065] m is
from 1 to 5; [0066] X is selected from a phosphodiester linkage and
a phosphorothioate linkage; [0067] Y is a phosphodiester linkage;
and [0068] the wavy line indicates the connection to the rest of
the linker and ligand(s).
[0069] In certain embodiments, X is a phosphodiester linkage.
[0070] In certain embodiments, n is from 1 to 5, 1 to 4, 1 to 3, or
1 to 2. In certain embodiments, n is 3.
[0071] In certain embodiments, at least one ligand is a
carbohydrate.
[0072] In certain embodiments, at least one ligand is selected from
mannose, glucose, galactose, ribose, arabinose, fructose, fucose,
xylose, D-mannose, L-mannose, D-galactose, L-galactose, D-glucose,
L-glucose, D-ribose, L-ribose, D-arabinose, L-arabinose,
D-fructose, L-fructose, D-fucose, L-fucose, D-xylose, L-xylose,
alpha-D-mannofuranose, beta-D-mannofuranose, alpha-D-mannopyranose,
beta-D-mannopyranose, alpha-D-glucofuranose, Beta-D-glucofuranose,
alpha-D-glucopyranose, beta-D-glucopyranose,
alpha-D-galactofuranose, beta-D-galactofuranose,
alpha-D-galactopyranose, beta-D-galactopyranose,
alpha-D-ribofuranose, beta-D-ribofuranose, alpha-D-ribopyranose,
beta-D-ribopyranose, alpha-D-fructofuranose,
alpha-D-fructopyranose, glucosamine, galactosamine, sialic acid,
N-acetylgalactosamine
[0073] In certain embodiments, at least one ligand is selected from
N-acetylgalactosamine, galactose, galactosamine,
N-formylgalactosamine, N-propionyl-galactosamine,
N-n-butanoylgalactosamine, and N-iso-butanoyl-galactosamine.
[0074] In certain embodiments, each ligand is
N-acetylgalactosamine.
[0075] In certain embodiments, a compound has the structure:
##STR00011##
wherein each N is, independently, a modified or unmodified
nucleoside and m is from 1 to 5; X.sub.1 and X.sub.2 are each,
independently, a phosphodiester linkage or a phosphorothioate
linkage; and MO is a modified oligonucleotide.
[0076] In certain embodiments, a compound provided herein comprises
a modified nucleotide and a conjugate moiety, wherein the modified
oligonucleotide has the structure
C.sub.LCA.sub.LTTG.sub.LT.sub.LCAC.sub.LAC.sub.LTC.sub.LC.sub.L
(SEQ ID NO: 7), wherein the subscript "L" indicates an LNA and
nucleosides not followed by a subscript are
.beta.-D-deoxyribonucleosides, and each internucleoside linkage is
a phosphorothioate internucleoside linkage, and wherein the
conjugate moiety is linked to the 3' terminus of the modified
oligonucleotide and has the structure:
##STR00012##
wherein each N is, independently, a modified or unmodified
nucleoside and m is from 1 to 5; X.sub.1 and X.sub.2 are each,
independently, a phosphodiester linkage or a phosphorothioate
linkage; and MO is a modified oligonucleotide.
[0077] In certain embodiments, at least one of X.sub.1 and X.sub.2
is a phosphodiester linkage. In certain embodiments, each of
X.sub.1 and X.sub.2 is a phosphodiester linkage. In certain
embodiments, m is 1. In certain embodiments, m is 2, 3, 4, or
5.
[0078] In certain embodiments, N.sub.m is N'.sub.pN'', wherein each
N' is, independently, a modifid or unmodified nucleoside and p is
from 0 to 4; and N'' is a nucleoside comprising an unmodified sugar
moiety. In certain embodiments, p is 0. In certain embodiments, p
is 1, 2, 3, or 4.
[0079] In certain embodiments, each N' comprises an unmodified
sugar moiety. In certain embodiments, each unmodified sugar moiety
is, independently, a .beta.-D-ribose or a .beta.-D-deoxyribose. In
certain embodiments, N'' comprises a purine nucleobase. In certain
embodiments, N'' comprises a pyrimidine nucleobase. In certain
embodiments, at least one N' comprises a purine nucleobase. In
certain embodiments, each purine nucleobase is independently
selected from adenine, guanine, hypoxanthine, xanthine, and
7-methylguanine. In certain embodiments, N'' is a
.beta.-D-deoxyriboadenosine or a .beta.-D-deoxyriboguanosine. In
certain embodiments, at least one N' comprises a pyrimidine
nucleobase. In certain embodiments, each pyrimidine nucleobase is
independently selected from cytosine, 5-methylcytosine, thymine,
uracil, and 5,6-dihydrouracil.
[0080] In any of the embodiments described herein, the sugar moiety
of each N is independently selected from a .beta.-D-ribose, a
.beta.-D-deoxyribose, a 2'-O-methoxy sugar, a 2'-O-methyl sugar, a
2'-fluoro sugar, and a bicyclic sugar moiety. In certain
embodiments, each bicyclic sugar moiety is independently selected
from a cEt sugar moiety, an LNA sugar moiety, and an ENA sugar
moiety. In certain embodiments, a cEt sugar moiety is an S-cEt
sugar moiety. In certain embodiments, a cEt sugar moiety is an
R-cEt sugar moiety. In any embodiments described herein, the sugar
moiety of each N may be independently selected from
.beta.-D-ribose, a .beta.-D-deoxyribose, and a 2'-fluoro sugar.
[0081] Provided herein are compounds comprising a modified
nucleotide and a conjugate moiety, wherein the modified
oligonucleotide has the structure
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.E.sup.MeC.sub.EA.sub.E-
T.sub.ETGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S (SEQ ID NO:
4), wherein nucleosides not followed by a subscript are
.beta.-D-deoxyribonucleosides, nucleosides followed by a subscript
"E" are 2'-MOE nucleosides, nucleosides followed by a subscript "S"
are S-cEt nucleosides, and each internucleoside linkage is a
phosphorothioate internucleoside linkage; and wherein the conjugate
moiety is linked to the 3' terminus of the modified oligonucleotide
and has the structure:
##STR00013##
wherein X is a phosphodiester linkage; m is 1; N is a
.beta.-D-deoxyriboadenosine; Y is a phosphodiester linkage; and MO
is the modified oligonucleotide.
[0082] Provided herein are compounds comprising a modified
nucleotide and a conjugate moiety, wherein the modified
oligonucleotide has the structure
C.sub.LCA.sub.LTTG.sub.LT.sub.LCAC.sub.LAC.sub.LTC.sub.LC.sub.L
(SEQ ID NO: 7), wherein the subscript "L" indicates an LNA and
nucleosides not followed by a subscript are
.beta.-D-deoxyribonucleosides, and each internucleoside linkage is
a phosphorothioate internucleoside linkage, and wherein the
conjugate moiety is linked to the 3' terminus of the modified
oligonucleotide and has the structure:
##STR00014##
wherein X is a phosphodiester linkage; m is 1; N is a
.beta.-D-deoxyriboadenosine; Y is a phosphodiester linkage; and MO
is the modified oligonucleotide. In some embodiments, all of the
C.sub.L nucleosides are .sup.MeC.sub.L nucleosides, wherein the
superscript "Me" indicates 5-methylcytosine.
[0083] Provided herein are methods of inhibiting the activity of
miR-122 in a cell comprising contacting a cell with any compound
provided herein. In certain embodiments, the cell is cell is in
vivo. In certain embodiments, cell is in vitro.
[0084] Provided herein are methods of administering to an
HCV-infected subject any of the compouds provided herein. In
certain embodiments, the administering reduces the symptoms of HCV
infection. In certain embodiments, the administering prevents a
rebound in serum HCV RNA. In certain embodiments, the administering
delays a rebound in serum HCV RNA. In certain embodiments, a
subject having HCV infection is selected for treatment with a
compound provided herein. In certain embodiments, an HCV-infected
subject is infected with one or more HCV genotypes selected from
genotype 1, genotype 2, genotype 3, genotype 4, genotype 5, and
genotype 6. In certain embodiments, prior to administration of a
compound provided herein, the subject was determined to be infected
with one or more HCV genotypes selected from genotype 1, genotype
2, genotype 3, genotype 4, genotype 5, and genotype 6. In certain
embodiments, the HCV genotype is selected from genotype 1a,
genotype 1b, genotype 2a, genotype 2b, genotype 2c, genotype 2d,
genotype 3a, genotype 3b, genotype 3c, genotype 3d, genotype 3e,
genotype 3f, genotype 4a, genotype 4b, genotype 4c, genotype 4d,
genotype 4e, genotype 4f, genotype 4g, genotype 4h, genotype 4i,
genotype 4j, genotype 5a, and genotype 6a. In certain embodiments,
the HCV genotype is selected from genotype 1a, 1b, and 2.
[0085] Any of the methods provided here may comprise administering
at least one additional therapeutic agent. In certain embodiments,
the at least one therapeutic agent is selected from a protease
inhibitor, a polymerase inhibitor, a cofactor inhibitor, an RNA
polymerase inhibitor, a structural protein inhibitor, a
non-structural protein inhibitor, a cyclophilin inhibitor, an entry
inhibitor, a TLR7 agonist, and an interferon. In certain
embodiments, the at least one therapeutic agent is selected from a
protease inhibitor, an NS5A inhibitor, an NS3/4A inhibitor, a
nucleoside NS5B inhibitor, a nucleotide NS5B inhibitor, a
non-nucleoside NS5B inhibitor, a cyclophilin inhibitor and an
interferon. In certain embodiments, the at least one therapeutic
agent is selected from interferon alfa-2a, interferon alpha-2b,
interferon alfacon-1, peginterferon alpha-2b, peginterferon
alpha-2a, interferon-alpha-2b extended release, interferon lambda,
sofosbuvir, ribavirin, telapravir, boceprevir, vaniprevir,
asunaprevir, ritonavir, setrobuvir, daclastavir, simeprevir,
alisporivir, mericitabine, tegobuvir, danoprevir, sovaprevir, and
neceprevir. In certain embodiments, the at least one therapeutic
agent is selected from an interferon, ribavirin, and
telapravir.
[0086] In certain embodiments, a subject is infected with an HCV
variant that is resistant to at least one therapeutic agent. In
certain embodiments, a subject is infected with an HCV variant that
is resistant to a direct-acting anti-viral agent. In certain
embodiments, a subject is infected with an HCV variant that is
resistant to at least one therapeutic agent selected from a
protease inhibitor, a polymerase inhibitor, a cofactor inhibitor,
an RNA polymerase inhibitor, a structural protein inhibitor, a
non-structural protein inhibitor, and a cyclophilin inhibitor. In
certain embodiments, a subject is infected with an HCV variant that
is resistant to at least one therapeutic agent selected from a
protease inhibitor, an NS5A inhibitor, an NS3/4A inhibitor, a
nucleoside NS5B inhibitor, a nucleotide NS5B inhibitor, a
non-nucleoside NS5B inhibitor, and a cyclophilin inhibitor. In
certain embodiments, a subject is infected with an HCV variant that
is resistant to at least one therapeutic agent selected from
sofosbuvir, ribavirin, telapravir, boceprevir, vaniprevir,
asunaprevir, ritonavir, setrobuvir, daclastavir, simeprevir,
alisporivir, mericitabine, tegobuvir, danoprevir, sovaprevir, and
neceprevir.
[0087] In certain embodiments, an HCV-infected subject is a
non-responder to at least one therapeutic agent. In certain
embodiments, an HCV-infected subject is an interferon
non-responder. In certain embodiments, an HCV-infected subject is a
direct-acting anti-viral non-responder.
[0088] Any of the methods provided herein may comprise selecting a
subject having a HCV RNA level greater than 350,000 copies per
milliliter of serum. In certain embodiments, a subject has an HCV
RNA level between 350,000 and 3,500,000 copies per milliliter of
serum. In certain embodiments, a subject has an HCV RNA level
greater than 3,500,000 copies per milliliter of serum.
[0089] In certain embodiments, an HCV-infected subject has an
HCV-associated disease. In certain embodiments, an HCV-associated
disease is cirrhosis, liver fibrosis, steatohepatitis, steatosis,
or hepatocellular carcinoma.
[0090] In certain embodiments, an HCV-infected subject has one or
more diseases that are not HCV-associated diseases. In certain
embodiments, an HCV-infected subject is infected with one or more
viruses other than HCV. In certain embodiments, an HCV-infected
subject is infected with human immunodeficiency virus (HIV). In
certain embodiments, the methods provided herein comprise
administering an additional therapeutic agent is an anti-viral
agent used in the treatment of HIV infection. In certain
embodiments, an additional therapeutic agent is a non-nucleoside
reverse transcriptase inhibitors (NNRTIs). In certain embodiments,
an additional therapeutic agent is a nucleoside reverse
transcriptase inhibitors (NRTIs). In certain embodiments, an
additional therapeutic agent is a protease inhibitor. In certain
embodiments, an additional therapeutic agent is an entry inhibitor
or fusion inhibitor. In certain embodiments, an additional
therapeutic agent is an integrase inhibitor. In certain
embodiments, an additional therapeutic agent is selected from
efavirenz, etravirine, nevirapine, abacavir, emtricitabine,
tenofovir, lamivudine, zidovudine, atazanavir, darunavir,
fosamprenavir, ritonavir, enfuvirtide, maraviroc, and
raltegravir.
[0091] Any of the methods provided herein may comprise
administering a dose of the compound sufficient to reduce HCV RNA
level. In certain embodiments, the administered dose of the
compound reduces HCV RNA level below 40 copies per ml of serum. In
certain embodiments, the administered dose of the compound achieves
at least a 2-log reduction in HCV RNA level. In certain
embodiments, administering a compound provided herein achieves a
sustained virological response. In certain embodiments, the
administered dose of the compound is sufficient to achieve an HCV
RNA level reduction of at least 0.5 fold, at least 1.0 fold, at
least 1.5 fold, at least 2.0 fold, or at least 2.5 fold. In certain
embodiments, the HCV RNA level reduction is achieved after two
weeks, three weeks, four weeks, five weeks, or six weeks of a first
administration of the compound. In certain embodiments, a compound
provided herein is administered once per week, once per two weeks,
once per three weeks, once per four weeks, or once per month. In
certain embodiments, a compound provided herein is administered
once per two months or once per three months. In some embodiments,
a compound provided herein is administered once per four weeks.
[0092] In certain embodiments, the dose of the compound
administeredis less than or equal to 5 mg/kg per week, less than or
equal to 5 mg/kg, less than or equal to 4.5 mg/kg, less than or
equal to 4.0 mg/kg, less than or equal to 3.5 mg/kg, less than or
equal to 3.0 mg/kg, less than or equal to 2.5 mg/kg, less than or
equal to 2.0 mg/kg, less than or equal to 1.5 mg/kg, or less than
or equal to 1.0 mg/kg. In certain embodiments, the compound is
administered at a dose within a range of 1 to 5 mg/kg, or 1 to 4
mg/kg, or 2 to 5 mg/kg, or 2 to 4 mg/kg. In certain embodiments,
the dose of the compound administered is less than or equal to 10
mg/kg, less than or equal to 7.5 mg/kg, less than or equal to 10
mg/kg per week, or less than or equal to 7.5 mg/kg per week.
[0093] In certain embodiments, administration of a compound
provided herein normalizes liver enzyme levels, wherein the liver
enzyme is optionally alanine aminotransferase.
[0094] In any of the embodiments provided herein, the compound is
present in a pharmaceutical composition.
[0095] Provided herein are compounds for use in treating an
HCV-infected subject.
[0096] In certain embodiments, a subject is a human.
BRIEF DESCRIPTION OF DRAWINGS
[0097] FIGS. 1A and 1B. In vivo potency of anti-miR-122 modified
oligonucleotides. (A) Onset and duration of action of anti-miR-122,
following a single administration of compound at the indicated
doses. (B) De-repression of ALDOA seven days after a single dose of
anti-miR-122 compound at the indicated doses.
[0098] FIG. 2. Structure of a conjugate moiety comprising three
GalNAc ligands.
[0099] FIGS. 3A, 3B, and 3C. Conjugated modified oligonucleotide
structures.
[0100] FIGS. 4A, 4B, and 4C. In vivo potency of GalNAc-conjugated
anti-miR-122 modified oligonucleotides.
[0101] FIGS. 5A and 5B. Antisense inhibition of miR-122 reduces HCV
titer.
[0102] FIGS. 6A and 6B. In vivo potency of GalNAc-conjugated
anti-miR-122 modified oligonucleotides.
[0103] FIGS. 7A and 7B. In vivo potency of GalNAc-conjugated
anti-miR-122 modified oligonucleotides.
[0104] FIGS. 8A and 8B. In vivo potency of GalNAc-conjugated
anti-miR-122 modified oligonucleotides.
[0105] FIGS. 9A and 9B. Pharmacokinetics of anti-miR-122
compounds.
DETAILED DESCRIPTION
[0106] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as is commonly understood by one
of skill in the arts to which the invention belongs. Unless
specific definitions are provided, the nomenclature utilized in
connection with, and the procedures and techniques of, analytical
chemistry, synthetic organic chemistry, and medicinal and
pharmaceutical chemistry described herein are those well known and
commonly used in the art. In the event that there is a plurality of
definitions for terms herein, those in this section prevail.
Standard techniques may be used for chemical synthesis, chemical
analysis, pharmaceutical preparation, formulation and delivery, and
treatment of subjects. Certain such techniques and procedures may
be found for example in "Carbohydrate Modifications in Antisense
Research" Edited by Sangvi and Cook, American Chemical Society ,
Washington D.C., 1994; and "Remington's Pharmaceutical Sciences,"
Mack Publishing Co., Easton, Pa., 18th edition, 1990; and which is
hereby incorporated by reference for any purpose. Where permitted,
all patents, patent applications, published applications and
publications, GENBANK sequences, websites and other published
materials referred to throughout the entire disclosure herein,
unless noted otherwise, are incorporated by reference in their
entirety. Where reference is made to a URL or other such identifier
or address, it is understood that such identifiers can change and
particular information on the internet can change, but equivalent
information can be found by searching the internet. Reference
thereto evidences the availability and public dissemination of such
information.
[0107] Before the present compositions and methods are disclosed
and described, it is to be understood that the terminology used
herein is for the purpose of describing particular embodiments only
and is not intended to be limiting. It must be noted that, as used
in the specification and the appended claims, the singular forms
"a," "an" and "the" include plural referents unless the context
clearly dictates otherwise.
Definitions
[0108] "HCV infection" means infection with one or more genotypes
of the Hepatitis C Virus.
[0109] "HCV-infected subject" means a subject who has been infected
with one or more genotypes of the hepatitis C virus. An
HCV-infected subject may or may not exhibit symptoms of HCV
infection. HCV-infected subjects include subjects who have been
infected with one or more genotypes of HCV, but HCV RNA in the
blood of the subject is below detectable levels.
[0110] "HCV-associated disease" means a pathological process that
is mediated by HCV infection. HCV-associated diseases include, but
are not limited to, cirrhosis, liver fibrosis, steatoheptatitis,
and hepatocellular carcinoma.
[0111] "Blood HCV RNA" means hepatitis C virus RNA present in the
blood of an HCV-infected subject. Blood includes whole blood and
serum.
[0112] "Rebound in serum HCV RNA" means an increase in HCV RNA
level following a previous decrease in HCV RNA level.
[0113] "HCV RNA level" means the amount of HCV RNA in a given
volume of the blood of a subject. HCV RNA level may be expressed as
copies of RNA per milliliter "HCV RNA level" may also be called
"HCV viral load" or "HCV RNA titer."
[0114] "Sustained virological response" means undetectable
hepatitis C virus RNA in the blood of the subject at the end of an
entire course of treatment and after a further six months. In
certain embodiments, HCV RNA is considered undetectable below 40
copies per milliliter of blood.
[0115] "Non-responder" means a subject who has received treatment
but is not experiencing a clinically acceptable improvement in
disease markers or symptoms.
[0116] "Interferon non-responder" means an HCV-infected subject who
has received treatment with interferon, but is not experiencing a
clinically acceptable reduction in HCV RNA level.
[0117] "Direct-acting anti-viral agent" means a pharmaceutical
agent that inhibits the activity of an HCV enzyme.
[0118] "Direct-acting anti-viral non-responder" means an
HCV-infected subject who has received treatment with a
direct-acting anti-viral agent, but is not experiencing a
clinically acceptable reduction in HCV RNA level. In certain
embodiments, the virus has developed resistance to the
direct-acting anti-viral agent.
[0119] "miR-122-associated condition" means any disease, disorder
or condition that can be treated, prevented or ameliorated by
modulating miR-122. A miR-122-associated disease need not be
characterized by excess miR-122. miR-122-associated diseases
included, without limitation, HCV infection, elevated cholesterol,
and iron overload disorders.
[0120] "Iron overload disorder" means any disease, disorder or
condition characterized by excess iron in the body. "Subject" means
a human or non-human animal selected for treatment or therapy.
[0121] "Subject in need thereof" means a subject that is identified
as in need of a therapy or treatment.
[0122] "Subject suspected of having" means a subject exhibiting one
or more clinical indicators of a disease.
[0123] "Administering" means providing a pharmaceutical agent or
composition to a subject, and includes, but is not limited to,
administering by a medical professional and self-administering.
[0124] "Parenteral administration" means administration through
injection or infusion. Parenteral administration includes, but is
not limited to, subcutaneous administration, intravenous
administration, and intramuscular administration.
[0125] "Subcutaneous administration" means administration just
below the skin.
[0126] "Intravenous administration" means administration into a
vein.
[0127] "Administered concomitantly" refers to the co-administration
of two or more agents to a subject in any manner in which the
pharmacological effects of each agent are present in a subject.
Concomitant administration does not require that both agents be
administered in a single pharmaceutical composition, in the same
dosage form, or by the same route of administration. The effects of
both agents need not be present at the same time. The effects need
only be overlapping for a period of time and need not be
coextensive.
[0128] "Duration" means the period of time during which an activity
or event continues. In certain embodiments, the duration of
treatment is the period of time during which doses of a
pharmaceutical agent or pharmaceutical composition are
administered.
[0129] "Therapy" means a disease treatment method. In certain
embodiments, therapy includes, but is not limited to, chemotherapy,
radiation therapy, or administration of a pharmaceutical agent.
[0130] "Treatment" means the application of one or more specific
procedures used for the cure or amelioration of a disease. In
certain embodiments, the specific procedure is the administration
of one or more pharmaceutical agents.
[0131] "Amelioration" means a lessening of severity of at least one
indicator of a condition or disease. In certain embodiments,
amelioration includes a delay or slowing in the progression of one
or more indicators of a condition or disease. The severity of
indicators may be determined by subjective or objective measures
which are known to those skilled in the art.
[0132] "At risk for developing" means the state in which a subject
is predisposed to developing a condition or disease. In certain
embodiments, a subject at risk for developing a condition or
disease exhibits one or more symptoms of the condition or disease,
but does not exhibit a sufficient number of symptoms to be
diagnosed with the condition or disease. In certain embodiments, a
subject at risk for developing a condition or disease exhibits one
or more symptoms of the condition or disease, but to a lesser
extent required to be diagnosed with the condition or disease.
[0133] "Prevent the onset of" means to prevent the development of a
condition or disease in a subject who is at risk for developing the
disease or condition. In certain embodiments, a subject at risk for
developing the disease or condition receives treatment similar to
the treatment received by a subject who already has the disease or
condition.
[0134] "Delay the onset of" means to delay the development of a
condition or disease in a subject who is at risk for developing the
disease or condition. In certain embodiments, a subject at risk for
developing the disease or condition receives treatment similar to
the treatment received by a subject who already has the disease or
condition.
[0135] "Therapeutic agent" means a pharmaceutical agent used for
the cure, amelioration or prevention of a disease.
[0136] "Dose" means a specified quantity of a pharmaceutical agent
provided in a single administration. In certain embodiments, a dose
may be administered in two or more boluses, tablets, or injections.
For example, in certain embodiments, where subcutaneous
administration is desired, the desired dose requires a volume not
easily accommodated by a single injection. In such embodiments, two
or more injections may be used to achieve the desired dose. In
certain embodiments, a dose may be administered in two or more
injections to minimize injection site reaction in an individual. In
certain embodiments, a dose is administered as a slow infusion.
[0137] "Dosage unit" means a form in which a pharmaceutical agent
is provided. In certain embodiments, a dosage unit is a vial
containing lyophilized oligonucleotide. In certain embodiments, a
dosage unit is a vial containing reconstituted oligonucleotide.
[0138] "Therapeutically effective amount" refers to an amount of a
pharmaceutical agent that provides a therapeutic benefit to an
animal.
[0139] "Pharmaceutical composition" means a mixture of substances
suitable for administering to an individual that includes a
pharmaceutical agent. For example, a pharmaceutical composition may
comprise a sterile aqueous solution.
[0140] "Pharmaceutical agent" means a substance that provides a
therapeutic effect when administered to a subject.
[0141] "Active pharmaceutical ingredient" means the substance in a
pharmaceutical composition that provides a desired effect.
[0142] "Improved organ function" means a change in organ function
toward normal limits. In certain embodiments, organ function is
assessed by measuring molecules found in a subject's blood or
urine. For example, in certain embodiments, improved liver function
is measured by a reduction in blood liver transaminase levels. In
certain embodiments, improved kidney function is measured by a
reduction in blood urea nitrogen, a reduction in proteinuria, a
reduction in albuminuria, etc.
[0143] "Acceptable safety profile" means a pattern of side effects
that is within clinically acceptable limits.
[0144] "Side effect" means a physiological response attributable to
a treatment other than desired effects. In certain embodiments,
side effects include, without limitation, injection site reactions,
liver function test abnormalities, renal function abnormalities,
liver toxicity, renal toxicity, central nervous system
abnormalities, and myopathies. Such side effects may be detected
directly or indirectly. For example, increased aminotransferase
levels in serum may indicate liver toxicity or liver function
abnormality For example, increased bilirubin may indicate liver
toxicity or liver function abnormality
[0145] "Injection site reaction" means inflammation or abnormal
redness of skin at a site of injection in an individual.
[0146] "Subject compliance" means adherence to a recommended or
prescribed therapy by a subject.
[0147] "Comply" means the adherence with a recommended therapy by a
subject.
[0148] "Recommended therapy" means a treatment recommended by a
medical professional to treat, ameliorate, delay, or prevent a
disease.
[0149] "miR-122" means a microRNA having the nucleobase
sequence
TABLE-US-00004 (SEQ ID NO: 1) UGGAGUGUGACAAUGGUGUUUG.
[0150] "miR-122 stem-loop" means the microRNA precursor having the
nucleobase sequence
TABLE-US-00005 (SEQ ID NO: 2)
CCUUAGCAGAGCUGUGGAGUGUGACAAUGGUGUUUGUGUCUAAACUAUCA
AACGCCAUUAUCACACUAAAUAGCUACUGCUAGGC.
[0151] "Anti-miR" means an oligonucleotide having a nucleobase
sequence complementary to a microRNA. In certain embodiments, an
anti-miR is a modified oligonucleotide.
[0152] "Anti-miR-122" means an oligonucleotide having a nucleobase
sequence complementary to miR-122. In certain embodiments, an
anti-miR-122 is fully complementary to miR-122 (i.e., 100%
complementary). In certain embodiments, an anti-miR-122 is at least
90%, at least 93%, at least 94%, at least 95%, or 100%
complementary. In certain embodiments, an anti-miR-122 is a
modified oligonucleotide.
[0153] "Target nucleic acid" means a nucleic acid to which an
oligomeric compound is designed to hybridize.
[0154] "Targeting" means the process of design and selection of
nucleobase sequence that will hybridize to a target nucleic
acid.
[0155] "Targeted to" means having a nucleobase sequence that will
allow hybridization to a target nucleic acid.
[0156] "Modulation" means a perturbation of function, amount, or
activity. In certain embodiments, modulation means an increase in
function, amount, or activity. In certain embodiments, modulation
means a decrease in function, amount, or activity.
[0157] "Expression" means any functions and steps by which a gene's
coded information is converted into structures present and
operating in a cell.
[0158] "5' target site" means the nucleobase of a target nucleic
acid which is complementary to the 3'-most nucleobase of a
particular oligonucleotide.
[0159] "3' target site" means the nucleobase of a target nucleic
acid which is complementary to the 5'-most nucleobase of a
particular oligonucleotide.
[0160] "Region" means a portion of linked nucleosides within a
nucleic acid. In certain embodiments, an oligonucleotide has a
nucleobase sequence that is complementary to a region of a target
nucleic acid. For example, in certain such embodiments an
oligonucleotide is complementary to a region of a microRNA
sequence. In certain such embodiments, an oligonucleotide is fully
complementary to a region of a microRNA.
[0161] "Segment" means a smaller or sub-portion of a region.
[0162] "Nucleobase sequence" means the order of contiguous
nucleobases in an oligomeric compound or nucleic acid, typically
listed in a 5' to 3' orientation, independent of any sugar,
linkage, and/or nucleobase modification.
[0163] "Contiguous nucleobases" means nucleobases immediately
adjacent to each other in a nucleic acid.
[0164] "Nucleobase complementarity" means the ability of two
nucleobases to pair non-covalently via hydrogen bonding.
[0165] "Complementary" means that one nucleic acid is capable of
hybridizing to another nucleic acid or oligonucleotide. In certain
embodiments, complementary refers to an oligonucleotide capable of
hybridizing to a target nucleic acid.
[0166] "Fully complementary" means each nucleobase of an
oligonucleotide is capable of pairing with a nucleobase at each
corresponding position in a target nucleic acid. In certain
embodiments, an oligonucleotide is fully complementary to a
microRNA, i.e. each nucleobase of the oligonucleotide is
complementary to a nucleobase at a corresponding position in the
microRNA. In certain embodiments, an oligonucleotide wherein each
nucleobase has complementarity to a nucleobase within a region of a
microRNA sequence is fully complementary to the microRNA
sequence.
[0167] "Percent complementarity" means the percentage of
nucleobases of an oligonucleotide that are complementary to an
equal-length portion of a target nucleic acid. Percent
complementarity is calculated by dividing the number of nucleobases
of the oligonucleotide that are complementary to nucleobases at
corresponding positions in the target nucleic acid by the total
number of nucleobases in the oligonucleotide.
[0168] "Percent identity" means the number of nucleobases in a
first nucleic acid that are identical to nucleobases at
corresponding positions in a second nucleic acid, divided by the
total number of nucleobases in the first nucleic acid. In certain
embodiments, the first nucleic acid is a microRNA and the second
nucleic acid is a microRNA. In certain embodiments, the first
nucleic acid is an oligonucleotide and the second nucleic acid is
an oligonucleotide.
[0169] "Hybridize" means the annealing of complementary nucleic
acids that occurs through nucleobase complementarity.
[0170] "Mismatch" means a nucleobase of a first nucleic acid that
is not capable of Watson-Crick pairing with a nucleobase at a
corresponding position of a second nucleic acid.
[0171] "Identical" in the context of nucleobase sequences, means
having the same nucleobase sequence, independent of sugar, linkage,
and/or nucleobase modifications and independent of the methyl state
of any pyrimidines present.
[0172] "MicroRNA" means an endogenous non-coding RNA between 18 and
25 nucleobases in length, which is the product of cleavage of a
pre-microRNA by the enzyme Dicer. Examples of mature microRNAs are
found in the microRNA database known as miRBase
(http://microrna.sanger.ac.uk/). In certain embodiments, microRNA
is abbreviated as "microRNA" or "miR."
[0173] "Pre-microRNA" or "pre-miR" means a non-coding RNA having a
hairpin structure, which is the product of cleavage of a pri-miR by
the double-stranded RNA-specific ribonuclease known as Drosha.
[0174] "Stem-loop sequence" means an RNA having a hairpin structure
and containing a mature microRNA sequence. Pre-microRNA sequences
and stem-loop sequences may overlap. Examples of stem-loop
sequences are found in the microRNA database known as miRBase
(http://microrna.sanger.ac.uk/).
[0175] "Pri-microRNA" or "pri-miR" means a non-coding RNA having a
hairpin structure that is a substrate for the double-stranded
RNA-specific ribonuclease Drosha.
[0176] "microRNA precursor" means a transcript that originates from
a genomic DNA and that comprises a non-coding, structured RNA
comprising one or more microRNA sequences. For example, in certain
embodiments a microRNA precursor is a pre-microRNA. In certain
embodiments, a microRNA precursor is a pri-microRNA.
[0177] "microRNA-regulated transcript" means a transcript that is
regulated by a microRNA.
[0178] "Monocistronic transcript" means a microRNA precursor
containing a single microRNA sequence.
[0179] "Polycistronic transcript" means a microRNA precursor
containing two or more microRNA sequences.
[0180] "Seed sequence" means a nucleobase sequence comprising from
6 to 8 contiguous nucleobases of nucleobases 1 to 9 of the 5'-end
of a mature microRNA sequence.
[0181] "Seed match sequence" means a nucleobase sequence that is
complementary to a seed sequence, and is the same length as the
seed sequence.
[0182] "Oligomeric compound" means a compound that comprises a
plurality of linked monomeric subunits. Oligomeric compounds
included oligonucleotides.
[0183] "Oligonucleotide" means a compound comprising a plurality of
linked nucleosides, each of which can be modified or unmodified,
independent from one another.
[0184] "Naturally occurring internucleoside linkage" means a 3' to
5' phosphodiester linkage between nucleosides.
[0185] "Natural sugar" means a sugar found in DNA (2'-H) or RNA
(2'-OH).
[0186] "Internucleoside linkage" means a covalent linkage between
adjacent nucleosides.
[0187] "Linked nucleosides" means nucleosides joined by a covalent
linkage.
[0188] "Nucleobase" means a heterocyclic moiety capable of
non-covalently pairing with another nucleobase.
[0189] "Nucleoside" means a nucleobase linked to a sugar
moiety.
[0190] "Nucleotide" means a nucleoside having a phosphate group
covalently linked to the sugar portion of a nucleoside.
[0191] "Compound comprising a modified oligonucleotide consisting
of" a number of linked nucleosides means a compound that includes a
modified oligonucleotide having the specified number of linked
nucleosides. Thus, the compound may include additional substituents
or conjugates. Unless otherwise indicated, the compound does not
include any additional nucleosides beyond those of the modified
oligonucleotide.
[0192] "Modified oligonucleotide" means an oligonucleotide having
one or more modifications relative to a naturally occurring
terminus, sugar, nucleobase, and/or internucleoside linkage. A
modified oligonucleotide may comprise unmodified nucleosides.
[0193] "Single-stranded modified oligonucleotide" means a modified
oligonucleotide which is not hybridized to a complementary
strand.
[0194] "Modified nucleoside" means a nucleoside having any change
from a naturally occurring nucleoside. A modified nucleoside may
have a modified sugar, and an unmodified nucleobase. A modified
nucleoside may have a modified sugar and a modified nucleobase. A
modified nucleoside may have a natural sugar and a modified
nucleobase. In certain embodiments, a modified nucleoside is a
bicyclic nucleoside. In certain embodiments, a modified nucleoside
is a non-bicyclic nucleoside.
[0195] "2'-modified nucleoside" means a nucleoside comprising a
sugar with any modification at the position equivalent to the 2'
position of the furanosyl ring as the positions are numbered in
2-deoxyribose or ribose. It is to be understood that 2'-modified
nucleosides include, without limitation, nucleosides comprising
bicyclic sugar moieties.
[0196] "Modified internucleoside linkage" means any change from a
naturally occurring internucleoside linkage.
[0197] "Phosphorothioate internucleoside linkage" means a linkage
between nucleosides where one of the non-bridging atoms is a sulfur
atom. A "phosphorothioate linkage" means a linkage between two
chemical moieties having the same structure as a phosphorothioate
internucleoside linkage, e.g., --OP(O)(S)O--.
[0198] A "phosphodiester linkage" means a linkage between two
chemical moieties having the same structure as a phosphodiester
internucleoside linkage, e.g., --OP(O).sub.2O--.
[0199] "Unmodified nucleobase" means the naturally occurring
heterocyclic bases of RNA or DNA: the purine bases adenine (A) and
guanine (G), and the pyrimidine bases thymine (T), cytosine (C)
(including 5-methylcytosine), and uracil (U).
[0200] "5-methylcytosine" means a cytosine comprising a methyl
group attached to the 5 position.
[0201] "Non-methylated cytosine" means a cytosine that does not
have a methyl group attached to the 5 position.
[0202] "Modified nucleobase" means any nucleobase that is not an
unmodified nucleobase.
[0203] "Furanosyl" means a structure comprising a 5-membered ring
consisting of four carbon atoms and one oxygen atom.
[0204] "Naturally occurring furanosyl" means a ribofuranosyl as
found in naturally occurring RNA or a deoxyribofuranosyl as found
in naturally occurring DNA.
[0205] "Sugar moiety" means a naturally occurring furanosyl or a
modified sugar moiety.
[0206] "Modified sugar moiety" means a substituted sugar moiety or
a sugar surrogate.
[0207] "Substituted sugar moiety" means a furanosyl that is not a
naturally occurring furanosyl. Substituted sugar moieties include,
but are not limited to sugar moieties comprising modifications at
the 2'-position, the 5'-position and/or the 4'-position of a
naturally occurring furanosyl. Certain substituted sugar moieties
are bicyclic sugar moieties.
[0208] "Sugar surrogate" means a structure that does not comprise a
furanosyl and that is capable of replacing the naturally occurring
furanosyl of a nucleoside, such that the resulting nucleoside is
capable of (1) incorporation into an oligonucleotide and (2)
hybridization to a complementary nucleoside. Such structures
include relatively simple changes to the furanosyl, such as rings
comprising a different number of atoms (e.g., 4, 6, or 7-membered
rings); replacement of the oxygen of the furanosyl with a
non-oxygen atom (e.g., carbon, sulfur, or nitrogen); or both a
change in the number of atoms and a replacement of the oxygen. Such
structures may also comprise substitutions corresponding with those
described for substituted sugar moieties (e.g., 6-membered
carbocyclic bicyclic sugar surrogates optionally comprising
additional substituents). Sugar surrogates also include more
complex sugar replacements (e.g., the non-ring systems of peptide
nucleic acid). Sugar surrogates include without limitation
morpholinos, cyclohexenyls and cyclohexitols.
[0209] ".beta.-D-deoxyribose" means a naturally occurring DNA sugar
moiety.
[0210] ".beta.-D-ribose" means a naturally occurring RNA sugar
moiety.
[0211] "2'-O-methyl sugar" or "2'-OMe sugar" means a sugar having a
O-methyl modification at the 2' position.
[0212] "2'-O-methoxyethyl sugar" or "2'-MOE sugar" means a sugar
having a O-methoxyethyl modification at the 2' position.
[0213] "2'-O-fluoro" or "2'-F" means a sugar having a fluoro
modification of the 2' position.
[0214] "Bicyclic sugar moiety" means a modified sugar moiety
comprising a 4 to 7 membered ring (including by not limited to a
furanosyl) comprising a bridge connecting two atoms of the 4 to 7
membered ring to form a second ring, resulting in a bicyclic
structure. In certain embodiments, the 4 to 7 membered ring is a
sugar ring. In certain embodiments the 4 to 7 membered ring is a
furanosyl. In certain such embodiments, the bridge connects the
2'-carbon and the 4'-carbon of the furanosyl. Nonlimiting exemplary
bicyclic sugar moieties include LNA, ENA, cEt, S-cEt, and
R-cEt.
[0215] "Locked nucleic acid (LNA) sugar moiety" means a substituted
sugar moiety comprising a (CH.sub.2)--O bridge between the 4' and
2' furanose ring atoms.
[0216] "ENA sugar moiety" means a substituted sugar moiety
comprising a (CH.sub.2).sub.2--O bridge between the 4' and 2'
furanose ring atoms.
[0217] "Constrained ethyl (cEt) sugar moiety" means a substituted
sugar moiety comprising a CH(CH.sub.3)--O bridge between the 4' and
the 2' furanose ring atoms. In certain embodiments, the
CH(CH.sub.3)--O bridge is constrained in the S orientation. In
certain embodiments, the CH(CH.sub.3)--O bridge is constrained in
the R orientation.
[0218] "S-cEt sugar moiety" means a substituted sugar moiety
comprising an S-constrained CH(CH.sub.3)--O bridge between the 4'
and the 2' furanose ring atoms.
[0219] "R-cEt sugar moiety" means a substituted sugar moiety
comprising an R-constrained CH(CH.sub.3)--O bridge between the 4'
and the 2' furanose ring atoms.
[0220] "2'-O-methyl nucleoside" means a modified nucleoside having
a 2'-O-methyl sugar modification.
[0221] "2'-O-methoxyethyl nucleoside" means a modified nucleoside
having a 2'-O-methoxyethyl sugar modification. A 2'-O-methoxyethyl
nucleoside may comprise a modified or unmodified nucleobase.
[0222] "2'-fluoro nucleoside" means a modified nucleoside having a
2'-fluoro sugar modification. A 2'-fluoro nucleoside may comprise a
modified or unmodified nucleobase.
[0223] "Bicyclic nucleoside" means a modified nucleoside having a
bicyclic sugar moiety. A bicyclic nucleoside may have a modified or
unmodified nucleobase.
[0224] "cEt nucleoside" means a nucleoside comprising a cEt sugar
moiety. A cEt nucleoside may comprise a modified or unmodified
nucleobase.
[0225] "S-cEt nucleoside" means a nucleoside comprising an S-cEt
sugar moiety.
[0226] "R-cEt nucleoside" means a nucleoside comprising an R-cEt
sugar moiety.
[0227] "Non-bicyclic nucleoside" means a nucleoside that has a
sugar other than a bicyclic sugar. In certain embodiments, a
non-bicyclic nucleoside comprises a naturally occurring sugar. In
certain embodiments, a non-bicyclic nucleoside comprises a modified
sugar. In certain embodiments, a non-bicyclic nucleoside is a
.beta.-D-deoxyribonucleoside. In certain embodiments, a
non-bicyclic nucleoside is a 2'-O-methoxyethyl nucleoside.
[0228] ".beta.-D-deoxyribonucleoside" means a naturally occurring
DNA nucleoside.
[0229] ".beta.-D-ribonucleoside" means a naturally occurring RNA
nucleoside.
[0230] "LNA nucleoside" means a nucleoside comprising a LNA sugar
moiety.
[0231] "ENA nucleoside" means a nucleoside comprising an ENA sugar
moiety.
[0232] "Motif" means a pattern of modified and/or unmodified
nucleobases, sugars, and/or internucleoside linkages in an
oligonucleotide. In certain embodiments, a motif is a nucleoside
pattern.
[0233] "Nucleoside pattern" means a pattern of nucleoside
modifications in a modified oligonucleotide or a region thereof. A
nucleoside pattern is a motif that describes the arrangement of
nucleoside modifications in an oligonucleotide.
[0234] "Fully modified oligonucleotide" means each nucleobase, each
sugar, and/or each internucleoside linkage is modified.
[0235] "Uniformly modified oligonucleotide" means each nucleobase,
each sugar, and/or each internucleoside linkage has the same
modification throughout the modified oligonucleotide.
[0236] "Stabilizing modification" means a modification to a
nucleoside that provides enhanced stability to a modified
oligonucleotide, in the presence of nucleases, relative to that
provided by 2'-deoxynucleosides linked by phosphodiester
internucleoside linkages. For example, in certain embodiments, a
stabilizing modification is a stabilizing nucleoside modification.
In certain embodiments, a stabilizing modification is an
internucleoside linkage modification.
[0237] "Stabilizing nucleoside" means a nucleoside modified to
provide enhanced nuclease stability to an oligonucleotide, relative
to that provided by a 2'-deoxynucleoside. In one embodiment, a
stabilizing nucleoside is a 2'-modified nucleoside.
[0238] "Stabilizing internucleoside linkage" means an
internucleoside linkage that provides improved nuclease stability
to an oligonucleotide relative to that provided by a phosphodiester
internucleoside linkage. In one embodiment, a stabilizing
internucleoside linkage is a phosphorothioate internucleoside
linkage.
[0239] A "linking group" as used herein refers to an atom or group
of atoms that attach a first chemical entity to a second chemical
entity via one or more covalent bonds.
[0240] A "linker" as used herein, refers to an atom or group of
atoms that attach one or more ligands to a modified or unmodified
nucleoside via one or more covalent bonds. The modified or
unmodified nucleoside may be part of a modified oligonucleotide as
described herein, or may be attached to a modified oligonucleotide
through a phosphodiester or phosphorothioate bond. In some
embodiments, the linker attaches one or more ligands to the 3' end
of a modified oligonucleotide. In some embodiments, the linker
attaches one or more ligands to the 5' end of a modified
oligonucleotide. In some embodiments, the linker attaches one or
more ligands to a modified or unmodified nucleoside that is
attached to the 3' end of a modified oligonucleotide. In some
embodiments, the linker attaches one or more ligands to a modified
or unmodified nucleoside that is attached to the 5' end of a
modified oligonucleotide. When the linker attaches one or more
ligands to the 3' end of a modified oligonucleotide or to a
modified or unmodified nucleoside attached to the 3' end of a
modified oligonucleotide, in some embodiments, the attachment point
for the linker may be the 3' carbon of a modified or unmodified
sugar moiety. When the linker attaches one or more ligands to the
5' end of a modified oligonucleotide or to a modified or unmodified
nucleoside attached to the 5' end of a modified oligonucleotide, in
some embodiments, the attachment point for the linker may be the 5'
carbon of a modified or unmodified sugar moiety.
Overview
[0241] To identify potent inhibitors of miR-122, numerous
anti-miR-122 compounds were designed and synthesized. The compounds
comprised modified oligonucleotides that varied in length, and in
the number, placement, and identity of bicyclic nucleosides and
non-bicyclic nucleosides. An initial series of compounds was tested
in an in vitro luciferase assay, which identified a subset of
compounds as in vitro active compounds. These in vitro active
compounds were then tested in in vivo assays to identify those
compounds that are potent inhibitors of miR-122 in vivo. From the
initial in vitro and in vivo screens, certain compounds were
selected as the basis for the design of additional compounds. The
experimentally observed correlations between structure and activity
(both in vitro and in vivo) were used to inform the design of these
additional compounds, with further variations in length and
selection and arrangement of bicyclic and non-bicyclic nucleosides.
The in vitro and in vivo screening assays were repeated for these
additional compounds. Certain compounds were also tested for other
properties, for example, susceptibility to exonuclease activity,
tissue accumulation, and tissue half-life.
[0242] Of over 400 compounds screened in vitro during this process,
approximately 150 were identified as active in an in vitro
luciferase assay. Approximately 70 of these compounds were further
evaluated for in vivo potency and safety. Through this iterative
process of designing and screening compounds, it was observed that
certain compounds, both unconjugated anti-miR-122 modified
oligonucleotides and conjugated anti-miR-122 modified
oligonucleotides, were potent inhibitors of miR-122 in vivo. As
such, these compounds are useful for the modulation of cellular
processes that are promoted by the activity of miR-122. Further,
such compounds are useful for treating, preventing, and/or delaying
the onset of diseases associated with miR-122. Such diseases
include, but are not limited to, HCV infection and HCV-related
complications, such as cirrhosis, liver fibrosis, steatohepatitis,
steatosis, and hepatocellular carcinoma.
Certain Anti-miR-122 Compounds
[0243] Provided herein are modified oligonucleotides having certain
patterns of bicyclic and non-bicyclic nucleosides. Modified
oligonucleotides having the patterns identified herein are
effective inhibitors of miR-122 activity.
[0244] Each of the nucleoside patterns illustrated herein is shown
in the 5' to 3' orientation.
[0245] In certain embodiments, provided herein are compounds
comprising a modified oligonucleotide consisting of from 16 to 22
linked nucleosides, wherein the nucleobase sequence of the modified
oligonucleotide is complementary to miR-122 (SEQ ID NO: 1) and
wherein the modified oligonucleotide comprises at least 16
contiguous nucleosides of the following nucleoside pattern I in the
5' to 3' orientation:
TABLE-US-00006
(R).sub.X-N.sup.Q-N.sup.Q-N.sup.B-N.sup.B-N.sup.Q-N.sup.B-N.sup.Q-N.sup.B-
-N.sup.Q-N.sup.B-N.sup.B-(N.sup.Z).sub.Y
[0246] wherein each R is, independently, a non-bicyclic nucleoside
or a bicyclic nucleoside; [0247] X is from 4 to 10; [0248] each
N.sup.B is, independently, a bicyclic nucleoside; [0249] each
N.sup.Q is, independently, a non-bicyclic nucleoside; [0250] Y is 0
or 1; and [0251] N.sup.Z is a modified nucleoside or an unmodified
nucleoside non-bicyclic nucleoside or a bicyclic nucleoside.
[0252] In certain embodiments, the modified oligonucleotide
comprises at least 16, at least 17, at least 18, at least 19, at
least 20, at least 21, or 22 contiguous nucleosides of nucleoside
pattern I.
[0253] In certain embodiments, each bicyclic nucleoside is
independently selected from an LNA nucleoside, a cEt nucleoside,
and an ENA nucleoside.
[0254] In certain embodiments, at least two bicyclic nucleosides
are different from one another.
[0255] In certain embodiments, all bicyclic nucleosides have the
same type of sugar moiety.
[0256] In certain embodiments, each bicyclic nucleoside is a cEt
nucleoside. In certain embodiments, the cEt nucleoside is an S-cEt
nucleoside. In certain embodiments, the cEt nucleoside is an R-cEt
nucleoside.
[0257] In certain embodiments, each bicyclic nucleoside is an LNA
nucleoside.
[0258] In certain embodiments, at least two non-bicyclic
nucleosides comprise sugar moieties that are different from one
another. In certain embodiments, each non-bicyclic nucleoside has
the same type of sugar moiety.
[0259] In certain embodiments, each non-bicyclic nucleoside is
independently selected from a .beta.-D-deoxyribonucleoside, a
.beta.-D-ribonucleoside, 2'-O-methyl nucleoside, a
2'-O-methoxyethyl nucleoside, and a 2'-fluoronucleoside. In certain
embodiments, each non-bicyclic nucleoside is independently selected
from a .beta.-D-deoxyribonucleoside, and a 2'-O-methoxyethyl
nucleoside. In certain embodiments, each non-bicyclic nucleoside is
a .beta.-D-deoxyribonucleoside. In certain embodiments, each
non-bicyclic nucleoside is a 2'-MOE nucleoside.
[0260] In certain embodiments, no more than two non-bicyclic
nucleosides are 2'-MOE nucleosides. In certain embodiments, no more
than two non-bicyclic nucleosides are 2'-MOE nucleosides, and each
other non-bicyclic nucleoside is a
.beta.-D-deoxyribonucleoside.
[0261] In certain embodiments, the 5'- terminal and the 3'-terminal
non-bicyclic nucleosides are 2'-MOE nucleosides and each other
non-bicyclic nucleoside is a .beta.-D-deoxyribonucleoside.
[0262] In certain embodiments, two non-bicyclic nucleosides are
2'-MOE nucleosides and each other non-bicyclic nucleoside is a
.beta.-D-deoxyribonucleoside.
[0263] In certain embodiments, each nucleoside of R is a 2'-MOE
nucleoside.
[0264] In certain embodiments, X is 4, 5, 6, 7, 8, 9, or 10.
[0265] In certain embodiments, Y is 0. In certain embodiments, Y is
1.
[0266] In certain embodiments, R consist of seven linked
nucleosides, wherein each nucleoside is a 2'-O-methoxyethyl
nucleoside; each N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; and Y is 0.
[0267] In certain embodiments, R consists of four linked
nucleosides N.sup.R1-N.sup.R2-N.sup.R3-N.sup.R4, wherein each of
N.sup.R1 and N.sup.R3 is a S-cEt nucleoside and each of N.sup.R2
and N.sup.R4 is a .beta.-D-deoxyribonucleoside; each N.sup.B is an
S-cEt nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; Y
is 1; and N.sup.Z is a .beta.-D-deoxyribonucleoside.
[0268] In certain embodiments, R consists of four linked
nucleosides N.sup.R1-N.sup.R2-N.sup.R3-N.sup.R4, wherein each of
N.sup.R1 and N.sup.R4 is a S-cEt nucleoside and each of N.sup.R2
and N.sup.R3 is a .beta.-D-deoxyribonucleoside; each N.sup.B is an
S-cEt nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; Y
is 1; and N.sup.Z is a 2'-O-methoxyethyl nucleoside.
[0269] In certain embodiments, R consists of seven linked
nucleosides
N.sup.R1-N.sup.R2-N.sup.R3-N.sup.R4-N.sup.R5-N.sup.R6-N.sup.R7,
wherein each of N.sup.R1, N.sup.R2, N.sup.R3, and N.sup.R4 is a
2'-O-methoxyethyl nucleoside, each of N.sup.R5 and N.sup.R7 is a
.beta.-D-deoxyribonucleoside, and N.sup.R6 is S-cEt nucleoside;
each N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; and Y is 0.
[0270] In certain embodiments, R consists of seven linked
nucleosides
N.sup.R1-N.sup.R2-N.sup.R3-N.sup.R4-N.sup.R5-N.sup.R6-N.sup.R7,
wherein each of N.sup.R1, N.sup.R2, N.sup.R3, N.sup.R4, and
2'-O-methoxyethyl nucleoside, N.sup.R6 is S-cEt nucleoside, and
N.sup.R7 is a .beta.-D-deoxyribonucleoside; each N.sup.B is an
S-cEt nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside;
and Y is 0.
[0271] In certain embodiments, R consists of seven linked
nucleosides
N.sup.R1-N.sup.R2-N.sup.R3-N.sup.R4-N.sup.R5-N.sup.R6-N.sup.R7,
wherein each of N.sup.R1, N.sup.R2, N.sup.R3, N.sup.R4, N.sup.R5,
and N.sup.R6 is 2'-O-methoxyethyl nucleoside, and N.sup.R7 is a
.beta.-D-deoxyribonucleoside; each N.sup.B is an S-cEt nucleoside;
each N.sup.Q is a .beta.-D-deoxyribonucleoside; and Y is 0.
[0272] In certain embodiments, R consists of ten linked nucleosides
N.sup.R1-N.sup.R2-N.sup.R3-N.sup.R4-N.sup.R5-N.sup.R6-N.sup.R7-N.sup.R8-N-
.sup.R9-N.sup.R10, wherein each of N.sup.R1, N.sup.R2, N.sup.R3,
N.sup.R4, N.sup.R5, and N.sup.R6 is 2'-O-methoxyethyl nucleoside,
each of N.sup.R7 and N.sup.R9 is a an S-cEt nucleoside; each of
N.sup.R8 and N.sup.R10 is a .beta.-D-deoxyribonucleoside; each
N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; and Y is 0.
[0273] In certain embodiments, R consists of ten linked nucleosides
N.sup.R1-N.sup.R2-N.sup.R3-N.sup.R4-N.sup.R5-N.sup.R6-N.sup.R7-N.sup.R8-N-
.sup.R9-N.sup.R10, wherein each of N.sup.R1, N.sup.R2, N.sup.R3,
N.sup.R4, N.sup.R5, and N.sup.R6 is 2'-O-methoxyethyl nucleoside,
each of N.sup.R7 and N.sup.R9 is a an S-cEt nucleoside; and each of
N.sup.R8 and N.sup.R10 is a .beta.-D-deoxyribonucleoside; each
N.sup.B is an S-cEt nucleoside; each N.sup.Q is a
.beta.-D-deoxyribonucleoside; Y is 1 and N.sub.Z is a
2'-O-methoxyethyl nucleoside.
[0274] In certain embodiments, R consists of four linked
nucleosides N.sup.R1-N.sup.R2-N.sup.R3-N.sup.R4, wherein each of
N.sup.R1and N.sup.R4 is an S-cEt nucleoside, and each of N.sup.R1
and N.sup.R3 is a .beta.-D-deoxyribonucleoside; each N.sup.B is an
S-cEt nucleoside; each N.sup.Q is a .beta.-D-deoxyribonucleoside; Y
is 1 and N.sup.Z is a .beta.-D-deoxyribonucleoside.
[0275] In certain embodiments, R consists of four linked
nucleosides N.sup.R1-N.sup.R2-N.sup.R3-N.sup.R4, wherein N.sup.R1
is a 2'-O-methoxyethyl nucleoside, each of N.sup.R2 and N.sup.R4 is
an S-cEt nucleoside, and N.sup.R3 is a
.beta.-D-deoxyribonucleoside; each N.sup.B is an S-cEt nucleoside;
each N.sup.Q is a .beta.-D-deoxyribonucleoside; Y is 1 and N.sup.Z
is a 2'-O-methoxyethyl nucleoside.
[0276] In certain embodiments, the nucleobase sequence of the
modified oligonucleotide is at least 90%, at least 93%, at least
94%, at least 95%, or 100% complementary to the nucleobase sequence
of miR-122 (SEQ ID NO: 1).
[0277] In certain embodiments, the nucleobase sequence of the
modified oligonucleotide is complementary to miR-122 such that
position 2 of SEQ ID NO: 1 is paired with the 3'-terminal
nucleobase of the oligonucleotide. For example:
TABLE-US-00007 5' -UGGAGUGUGACAAUGGUGUUUG-3' (miR-122; SEQ ID NO:
1) |||||||||||||||||| 3' - CCTCACACTGTTACCACA-5' (an anti-miR-122;
SEQ ID NO: 4)
[0278] In certain embodiments, the nucleobase sequence of the
modified oligonucleotide is complementary to miR-122 such that
position 1 of SEQ ID NO: 1 is paired with the 3'-terminal
nucleobase of the oligonucleotide. For example:
TABLE-US-00008 5'-UGGAGUGUGACAAUGGUGUUUG-3' (miR-122; SEQ ID NO: 1)
|||||||||||||||| 3'-ACCTCACACTGTTACC-5' (an anti-miR-122; SEQ ID
NO: 3); and 5'-UGGAGUGUGACAAUGGUGUUUG-3' (miR-122; SEQ ID NO: 1)
|||||||||||||||||||||| 3'-TCCTCACACTGTTACCACAAAC-5' (an
anti-miR-122; SEQ ID NO: 6)
[0279] In certain embodiments, at least one internucleoside linkage
is a modified internucleoside linkage. In certain embodiments, each
internucleoside linkage is a modified internucleoside linkage. In
certain embodiments, a modified internucleoside linkage is a
phosphorothioate internucleoside linkage.
[0280] In certain embodiments, at least one pyrimidine of the
modified oligonucleotide comprises a 5-methyl group. In certain
embodiments, at least one cytosine of the modified oligonucleotide
is a 5-methylcytosine. In certain embodiments, each cytosine of the
modified oligonucleotide is a 5-methylcytosine. In certain
embodiments, each modified nucleotide that comprises a cytosine
comprises a 5-methylcytosine. In certain embodiments, each
2'-O-methoxyethylnucleoside that comprises a cytosine comprises a
5-methylcytosine.
[0281] In certain embodiments, the nucleobase sequence of the
modified oligonucleotide is selected from SEQ ID NOs: 3 to 6,
wherein each T is independently selected from T and U.
[0282] In certain embodiments, the modified oligonucleotide has 0,
1, 2, or 3 mismatches with respect to the nucleobase sequence of
miR-122. In certain embodiments, the modified oligonucleotide has 0
mismatches with respect to the nucleobase sequence of miR-122. In
certain embodiments, the modified oligonucleotide has 1 mismatch
with respect to the nucleobase sequence of miR-122. In certain
embodiments, the modified oligonucleotide has 2 mismatches with
respect to the nucleobase sequence of miR-122.
[0283] In certain embodiments, a modified oligonucleotide consists
of greater than 22 linked nucleosides, and comprises at least 8
linked nucleosides of nucleoside pattern I. The nucleosides that
are present in addition to the nucleosides described by nucleoside
pattern I are either modified or unmodified.
[0284] In certain embodiments, a modified oligonucleotide consists
of less than 16 linked nucleosides, and comprises at least 8 linked
nucleosides of nucleoside pattern I.
[0285] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence and modifications as shown in Table 1.
Nucleosides and nucleobases are indicated as follows: the
superscript "Me" indicates 5-methylcytosine; nucleosides not
followed by a subscript are .beta.-D-deoxyribonucleosides;
nucleosides followed by a subscript "E" are 2'-MOE nucleosides;
nucleosides followed by a subscript "S" are S-cEt nucleosides; and
each internucleoside linkage is a phosphorothioate internucleoside
linkage.
TABLE-US-00009 TABLE 1 Anti-miR-122 Compounds Com- SEQ pound ID #
Sequence and Modifications NO 38649
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.E.sup.MeC.sub.EA.sub.ET.sub-
.ETGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S 4 38012
C.sub.SCA.sub.STTGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.SA 3
38016
.sup.MeC.sub.SCAT.sub.STGT.sub.S.sup.MeC.sub.SA.sup.MeC.sub.SA.sup.M-
eC.sub.ST.sup.MeC.sub.S.sup.MeC.sub.SA.sub.E 3 38646
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.ECA.sub.STTGU.sub.SC.sub.SA-
C.sub.SAC.sub.STC.sub.SC.sub.S 4 38647
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.E.sup.MeC.sub.EA.sub.STTGU.-
sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S 4 38648
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.E.sup.MeC.sub.EA.sub.ETTGU.-
sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S 4 38652
.sup.MeC.sub.EA.sub.EA.sub.EA.sub.E.sup.MeC.sub.EA.sub.EC.sub.SCA.su-
b.STTGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S 5 38659
C.sub.SCA.sub.STTGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.ST.sub-
.E 10 38660
.sup.MeC.sub.EA.sub.EA.sub.EA.sub.E.sup.MeC.sub.EA.sub.EC.sub.SCA.su-
b.STTGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.ST.sub.E 6 38872
C.sub.SCAU.sub.STGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.SA 3
38910
.sup.MeC.sub.EC.sub.SAU.sub.STGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.-
SC.sub.SA.sub.E 3
[0286] In some embodiments, a modified oligonucleotide has a
nucleobase sequence and modifications as shown below:
TABLE-US-00010 (SEQ ID NO: 8)
U.sub.STGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.SA.sub.S; or
(SEQ ID NO: 9)
C.sub.SA.sub.SC.sub.SA.sub.SC.sub.SU.sub.SC.sub.SC.sub.S;
wherein nucleosides not followed by a subscript are
.beta.-D-deoxyribonucleosides; nucleosides followed by a subscript
"S" are S-cEt nucleosides; and each internucleoside linkage is a
phosphorothioate internucleoside linkage. In some such embodiments,
a compound is 38591, 38633, 38998, or 38634.
Anti-miR-122 Compounds Comprising Conjugates
[0287] In certain embodiments, a compound provided herein comprises
a modified oligonucleotide conjugated to one or more moieties which
enhance the activity, cellular distribution and/or cellular uptake
of the oligonucleotide. For example, increased cellular uptake of
compounds may be achieved by utilizing conjugates that are ligands
for cell-surface receptors. The binding of a ligand conjugated to
an exogenous molecule (e.g., a drug) to its cell surface receptor
leads to the internalization of the conjugated molecule, thereby
enhancing transmembrane transport of the exogenous molecule. Any of
the anti-miR-122 modified oligonucleotides provided herein may be
linked to one or more moieties to form a compound comprising a
conjugated anti-miR-122 modified oligonucleotide.
[0288] In certain embodiments, a compound provided herein comprises
a conjugate moiety linked to the 5' terminus or the 3' terminus of
the modified oligonucleotide. In certain embodiments, the compound
comprises a conjugate moiety linked to the 3' terminus of the
modified oligonucleotide. In certain embodiments, the compound
comprises a conjugate moiety linked to the 5' terminus of the
modified oligonucleotide. In certain embodiments, the compound
comprises a first conjugate moiety linked to the 3' terminus of the
modified oligonucleotide and a second conjugate moiety linked to
the 5' terminus of the modified oligonucleotide.
[0289] In certain embodiments, a conjugate moiety comprises at
least one ligand selected from a carbohydrate, cholesterol, a
lipid, a phospholipid, an antibody, a lipoprotein, a hormone, a
peptide, a vitamin, a steroid, or a cationic lipid.
[0290] Ligands may be covalently attached to a modified
oligonucleotide by any suitable linker. Various linkers are known
in the art, and certain nonlimiting exemplary linkers are
described, e.g., in PCT Publication No. WO 2013/033230 and U.S.
Pat. No. 8,106,022 B2. In some embodiments, a linker may be
selected that is resistant to enzymatic cleavage in vivo. In some
embodiments, a linker may be selected that is resistant to
hydrolytic cleavage in vivo. In some embodiments, a linker may be
selected that will undergo enzymatic cleavage in vivo. In some
embodiments, a linker may be selected that will undergo hydrolytic
cleavage in vivo.
[0291] In certain embodiments, a compound comprising a conjugated
modified oligonucleotide described herein has the structure:
L--X.sub.1--N.sub.m--X.sub.2--MO;
wherein each L is a ligand; each N is, independently, a modified or
unmodified nucleoside and m is from 1 to 5; X.sub.1 and X.sub.2 are
each, independently, a phosphodiester linkage or a phosphorothioate
linkage; and MO is a modified oligonucleotide. In certain
embodiments, m is 1. In certain embodiments, m is 2. In certain
embodiments, m is 2, 3, 4, or 5. In certain embodiments, m is 3, 4,
or 5. In certain embodiments, when m is greater than 1, each
modified or unmodified nucleoside of N.sub.m may be connected to
adjacent modified or unmodified nucleosides of N.sub.m by a
phosphodiester internucleoside linkage or a phosphorothioate
internucleoside linkage. In certain embodiments, m is 1 and X.sub.1
and X.sub.2 are each phosphodiester.
[0292] In certain embodiments, a compound comprising a conjugated
modified oligonucleotide described herein has Structure A:
L.sub.n-linker-MO;
wherein each L is, independently, a ligand and n is from 1 to 10;
and MO is a modified oligonucleotide.
[0293] In certain embodiments, a compound comprising a conjugated
modified oligonucleotide described herein has Structure B:
L.sub.n-linker-X.sub.1--N.sub.m--X.sub.2--MO;
wherein each L is, independently, a ligand and n is from 1 to 10;
each N is, independently, a modified or unmodified nucleoside and m
is from 1 to 5; X.sub.1 and X.sub.2 are each, independently, a
phosphodiester linkage or a phosphorothioate linkage; and MO is a
modified oligonucleotide. In certain embodiments, m is 1. In
certain embodiments, m is 2. In certain embodiments, m is 2, 3, 4,
or 5. In certain embodiments, m is 3, 4, or 5. In certain
embodiments, when m is greater than 1, each modified or unmodified
nucleoside of N.sub.m may be connected to adjacent modified or
unmodified nucleosides of N.sub.m by a phosphodiester
internucleoside linkage or a phosphorothioate internucleoside
linkage.
[0294] In certain embodiments, a compound comprising a conjugated
modified oligonucleotide described herein has Structure C:
L.sub.n-linker-X--N.sub.m--Y--MO;
wherein each L is, independently, a ligand and n is from 1 to 10;
each N is, independently, a modified or unmodified nucleoside and m
is from 1 to 5; X is a phosphodiester linkage or a phosphorothioate
linkage; Y is a phosphodiester linkage; and MO is a modified
oligonucleotide. In certain embodiments, m is 1. In certain
embodiments, m is 2. In certain embodiments, m is 2, 3, 4, or 5. In
certain embodiments, m is 3, 4, or 5. In certain embodiments, when
m is greater than 1, each modified or unmodified nucleoside of
N.sub.m may be connected to adjacent modified or unmodified
nucleosides of N.sub.m by a phosphodiester internucleoside linkage
or phosphorothioate internucleoside linkage.
[0295] In certain embodiments, a compound comprising a conjugated
modified oligonucleotide described herein has Structure D:
L.sub.n-linker-Y--N.sub.m--Y--MO;
wherein each L is, independently, a ligand and n is from 1 to 10;
each N is, independently, a modified or unmodified nucleoside and m
is from 1 to 5; each Y is a phosphodiester linkage; and MO is a
modified oligonucleotide. In certain embodiments, m is 1. In some
embodiments, m is 2. In certain embodiments, m is 3, 4, or 5. In
certain embodiments, m is 2, 3, 4, or 5. In certain embodiments,
when m is greater than 1, each modified or unmodified nucleoside of
N.sub.m may be connected to adjacent modified or unmodified
nucleosides of N.sub.m by a phosphodiester internucleoside linkage
or phosphorothioate internucleoside linkage.
[0296] In certain embodiments, when n is greater than 1, the linker
comprises a scaffold capable of linking more than one L to the
remainder of the compound (i.e., to the modified oligonucleotide
(MO), to X.sub.1--N.sub.m--X.sub.2--MO, to X--N.sub.m--Y--MO,
etc.). In some such embodiments, the L.sub.n-linker portion of the
compound (such as a compound of Structure A, B, C, or D) comprises
Structure E:
##STR00015##
wherein each L is, independently, a ligand; n is from 1 to 10; S is
a scaffold; and Q' and Q'' are, independently, linking groups.
[0297] In certain embodiments, each Q' and Q'' is independently
selected from a peptide, an ether, polyethylene glycol, an alkyl, a
C.sub.1-C.sub.20 alkyl, a substituted C.sub.1-C.sub.20 alkyl, a
C.sub.2-C.sub.20 alkenyl, a substituted C.sub.2-C.sub.20 alkenyl, a
C.sub.2-C.sub.20 alkynyl, a substituted C.sub.2-C.sub.20 alkynyl, a
C.sub.1-C.sub.20 alkoxy, a substituted C.sub.1-C.sub.20 alkoxy,
amino, amido, a pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO),
succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate, and
6-aminohexanoic acid.
[0298] In certain embodiments, a scaffold links 2, 3, 4, or 5
ligands to a modified oligonucleotide. In certain embodiments, a
scaffold links 3 ligands to a modified oligonucleotide.
[0299] A nonlimiting exemplary Structure E is Structure E(i):
##STR00016##
wherein L.sub.1, L.sub.2, and L.sub.3 are each, independently, a
ligand; Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q'' are each,
independently, a linking group; and R.sub.1, R.sub.2, R.sub.3, and
R.sub.4 are each, independently, selected from H, C.sub.1-C.sub.6
alkyl, and substituted C.sub.1-C.sub.6 alkyl.
[0300] In some embodiments, Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q''
are each, independently, selected from a peptide, an ether,
polyethylene glycol, an alkyl, a C.sub.1-C.sub.20 alkyl, a
substituted C.sub.1-C.sub.20 alkyl, a C.sub.2-C.sub.20 alkenyl, a
substituted C.sub.2-C.sub.20 alkenyl, a C.sub.2-C.sub.20 alkynyl, a
substituted C.sub.2-C.sub.20 alkynyl, a Ci-C.sub.20 alkoxy, a
substituted C.sub.1-C.sub.20 alkoxy, amino, amido, a pyrrolidine,
8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl
4-(N-maleimidomethyl) cyclohexane-1-carboxylate, and
6-aminohexanoic acid. In some embodiments, R.sub.1, R.sub.2,
R.sub.3, and R.sub.4 are each, independently, selected from H,
methyl, ethyl, propyl, isopropyl, and butyl. In some embodiments,
R.sub.1, R.sub.2, R.sub.3, and R.sub.4 are each selected from H and
methyl.
[0301] A further nonlimiting exemplary Structure E is Structure
E(ii):
##STR00017##
wherein L.sub.1, L.sub.2, and L.sub.3 are each, independently, a
ligand; Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q'' are each,
independently, a linking group; and R.sub.1 is selected from H,
C.sub.1-C.sub.6 alkyl, and substituted C.sub.1-C.sub.6 alkyl.
[0302] In some embodiments, Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q''
are each, independently, selected from a peptide, an ether,
polyethylene glycol, an alkyl, a C.sub.1-C.sub.20 alkyl, a
substituted C.sub.1-C.sub.20 alkyl, a C.sub.2-C.sub.20 alkenyl, a
substituted C.sub.2-C.sub.20 alkenyl, a C.sub.2-C.sub.20 alkynyl, a
substituted C.sub.2-C.sub.20 alkynyl, a C.sub.1-C.sub.20 alkoxy, a
substituted C.sub.1-C.sub.20 alkoxy, amino, amido, a pyrrolidine,
8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl
4-(N-maleimidomethyl) cyclohexane-1-carboxylate, and
6-aminohexanoic acid. In some embodiments, R.sub.1 is selected from
H, methyl, ethyl, propyl, isopropyl, and butyl. In some
embodiments, R.sub.1 is H or methyl.
[0303] A further nonlimiting exemplary Structure E is Structure
E(iii):
##STR00018##
wherein L.sub.1, L.sub.2, and L.sub.3 are each, independently, a
ligand; Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q'' are each,
independently, a linking group; and R.sub.1, R.sub.2, R.sub.3,
R.sub.4, and R.sub.5 are each, independently, selected from H,
C.sub.1-C.sub.6 alkyl, and substituted C.sub.1-C.sub.6 alkyl.
[0304] In some embodiments, Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q''
are each, independently, selected from a peptide, an ether,
polyethylene glycol, an alkyl, a C.sub.1-C.sub.20 alkyl, a
substituted C.sub.1-C.sub.20 alkyl, a C.sub.2-C.sub.20 alkenyl, a
substituted C.sub.2-C.sub.20 alkenyl, a C.sub.2-C.sub.20 alkynyl, a
substituted C.sub.2-C.sub.20 alkynyl, a C.sub.1-C.sub.20 alkoxy, a
substituted C.sub.1-C.sub.20 alkoxy, amino, amido, a pyrrolidine,
8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl
4-(N-maleimidomethyl) cyclohexane-1-carboxylate, and
6-aminohexanoic acid. In some embodiments, R.sub.1, R.sub.2,
R.sub.3, R.sub.4, and R.sub.5 are each, independently, selected
from H, methyl, ethyl, propyl, isopropyl, and butyl. In some
embodiments R.sub.1, R.sub.2, R.sub.3, R.sub.4, and R.sub.5 are
each selected from H and methyl.
[0305] A further nonlimiting exemplary Structure E is Structure
E(iv):
##STR00019##
wherein L.sub.1 and L.sub.2 are each, independently, a ligand;
Q'.sub.1, Q'.sub.2, and Q'' are each, independently, a linking
group; and R.sub.1, R.sub.2, and R.sub.3 are each, independently,
selected from H, C.sub.1-C.sub.6 alkyl, and substituted
C.sub.1-C.sub.6 alkyl.
[0306] In some embodiments, Q'.sub.1, Q'.sub.2, and Q'' are each,
independently, selected from a peptide, an ether, polyethylene
glycol, an alkyl, a C.sub.1-C.sub.20 alkyl, a substituted
C.sub.1-C.sub.20 alkyl, a C.sub.2-C.sub.20 alkenyl, a substituted
C.sub.2-C.sub.20 alkenyl, a C.sub.2-C.sub.20 alkynyl, a substituted
C.sub.2-C.sub.20 alkynyl, a C.sub.1-C.sub.20 alkoxy, a substituted
C.sub.1-C.sub.20 alkoxy, amino, amido, a pyrrolidine,
8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl
4-(N-maleimidomethyl) cyclohexane-1-carboxylate, and
6-aminohexanoic acid. In some embodiments, R.sub.1, R.sub.2, and
R.sub.3 are each, independently, selected from H, methyl, ethyl,
propyl, isopropyl, and butyl. In some embodiments R.sub.1, R.sub.2,
and R.sub.3 are each selected from H and methyl.
[0307] A further nonlimiting exemplary Structure E is Structure
E(v):
##STR00020##
wherein L.sub.1 and L.sub.2 are each, independently, a ligand;
Q'.sub.1, Q'.sub.2, and Q'' are each, independently, a linking
group; and R.sub.1, R.sub.2, and R.sub.3 are each, independently,
selected from H, C.sub.1-C.sub.6 alkyl, and substituted
C.sub.1-C.sub.6 alkyl.
[0308] In some embodiments, Q'.sub.1, Q'.sub.2, and Q'' are each,
independently, selected from a peptide, an ether, polyethylene
glycol, an alkyl, a C.sub.1-C.sub.20 alkyl, a substituted
C.sub.1-C.sub.20 alkyl, a C.sub.2-C.sub.20 alkenyl, a substituted
C.sub.2-C.sub.20 alkenyl, a C.sub.2-C.sub.20 alkynyl, a substituted
C.sub.2-C.sub.20 alkynyl, a C.sub.1-C.sub.20 alkoxy, a substituted
C.sub.1-C.sub.20 alkoxy, amino, amido, a pyrrolidine,
8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl
4-(N-maleimidomethyl) cyclohexane-1-carboxylate, and
6-aminohexanoic acid. In some embodiments, R.sub.1, R.sub.2, and
R.sub.3 are each, independently, selected from H, methyl, ethyl,
propyl, isopropyl, and butyl. In some embodiments R.sub.1, R.sub.2,
and R.sub.3 are each selected from H and methyl.
[0309] A further nonlimiting exemplary Structure E is Structure
E(vi):
##STR00021##
wherein L.sub.1, L.sub.2, and L.sub.3 are each, independently, a
ligand; Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q'' are each,
independently, a linking group; and R.sub.1, R.sub.2, and R.sub.3
are each, independently, selected from H, C.sub.1-C.sub.6 alkyl,
and substituted C.sub.1-C.sub.6 alkyl.
[0310] In some embodiments, Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q''
are each, independently, selected from a peptide, an ether,
polyethylene glycol, an alkyl, a C.sub.1-C.sub.20 alkyl, a
substituted C.sub.1-C.sub.20 alkyl, a C.sub.2-C.sub.20 alkenyl, a
substituted C.sub.2-C.sub.20 alkenyl, a C.sub.2-C.sub.20 alkynyl, a
substituted C.sub.2-C.sub.20 alkynyl, a C.sub.1-C.sub.20 alkoxy, a
substituted C.sub.1-C.sub.20 alkoxy, amino, amido, a pyrrolidine,
8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl
4-(N-maleimidomethyl) cyclohexane-1-carboxylate, and
6-aminohexanoic acid. In some embodiments, R.sub.1, R.sub.2, and
R.sub.3 are each, independently, selected from H, methyl, ethyl,
propyl, isopropyl, and butyl. In some embodiments R.sub.1, R.sub.2,
and R.sub.3 are each selected from H and methyl.
[0311] A further nonlimiting exemplary Structure E is Structure
E(vii):
##STR00022##
wherein L.sub.1, L.sub.2, and L.sub.3 are each, independently, a
ligand; Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q'' are each,
independently, a linking group; R.sub.1, R.sub.2, and R.sub.3 are
each, independently, selected from H, C.sub.1-C.sub.6 alkyl, and
substituted C.sub.1-C.sub.6 alkyl; and Z and Z' are each
independently selected from O and S.
[0312] In some embodiments, Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q''
are each, independently, selected from a peptide, an ether,
polyethylene glycol, an alkyl, a C.sub.1-C.sub.20 alkyl, a
substituted C.sub.1-C.sub.20 alkyl, a C.sub.2-C.sub.20 alkenyl, a
substituted C.sub.2-C.sub.20 alkenyl, a C.sub.2-C.sub.20 alkynyl, a
substituted C.sub.2-C.sub.20 alkynyl, a Ci-C.sub.20 alkoxy, a
substituted alkoxy, amino, amido, a pyrrolidine,
8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl
4-(N-maleimidomethyl) cyclohexane-1-carboxylate, and
6-aminohexanoic acid. In some embodiments, R.sub.1, R.sub.2, and
R.sub.3 are each, independently, selected from H, methyl, ethyl,
propyl, isopropyl, and butyl. In some embodiments R.sub.1, R.sub.2,
and R.sub.3 are each selected from H and methyl. In some
embodiments, Z or Z' on at least one P atom is S, and the other Z
or Z' is O (i.e., a phosphorothioate linkage). In some embodiments,
each --OP(Z)(Z')O-- is a phosphorothioate linkage. In some
embodiments, Z and Z' are both O on at least one P atom (i.e., a
phosphodiester linkage). In some embodiments, each --OP(Z)(Z')O--
is a phosphodiester linkage.
[0313] A further nonlimiting exemplary Structure E is Structure
E(viii):
##STR00023##
wherein L.sub.1, L.sub.2, and L.sub.3 are each, independently, a
ligand; Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q'' are each,
independently, a linking group; and R.sub.1, R.sub.2, R.sub.3, and
R.sub.4 are each, independently, selected from H, C.sub.1-C.sub.6
alkyl, and substituted C.sub.1-C.sub.6 alkyl.
[0314] In some embodiments, Q'.sub.1, Q'.sub.2, Q'.sub.3, and Q''
are each, independently, selected from a peptide, an ether,
polyethylene glycol, an alkyl, a C.sub.1-C.sub.20 alkyl, a
substituted C.sub.1-C.sub.20 alkyl, a C.sub.2-C.sub.20 alkenyl, a
substituted C.sub.2-C.sub.20 alkenyl, a C.sub.2-C.sub.20 alkynyl, a
substituted C.sub.2-C.sub.20 alkynyl, a Ci-C.sub.2oalkoxy, a
substituted C.sub.1-C.sub.20 alkoxy, amino, amido, a pyrrolidine,
8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl
4-(N-maleimidomethyl) cyclohexane-1-carboxylate, and
6-aminohexanoic acid. In some embodiments, R.sub.1, R.sub.2,
R.sub.3, and R.sub.4 are each, independently, selected from H,
methyl, ethyl, propyl, isopropyl, and butyl. In some embodiments
R.sub.1, R.sub.2, R.sub.3, and R.sub.4 are each selected from H and
methyl.
[0315] Nonlimiting exemplary scaffolds and/or linkers comprising
scaffolds, and synthesis thereof, are described, e.g., PCT
Publication No. WO 2013/033230, U.S. Pat. No. 8,106,022 B2, U.S.
Publication No. 2012/0157509 A1; U.S. Pat. No. 5,994,517; U.S. Pat.
No. 7,491,805 B2; U.S. Pat. No. 8,313,772 B2; Manoharan, M.,
Chapter 16, Antisense Drug Technology, Crooke, S. T., Marcel
Dekker, Inc., 2001, 391-469.
[0316] In certain embodiments, the L.sub.n-linker portion of the
compound comprises Structure F:
##STR00024##
wherein: [0317] B is selected from --O--, --S--, --N(R.sup.N)--,
--Z--P(Z')(Z'')O--, --Z--P(Z')(Z'')O--N.sub.m--X--, and
--Z--P(Z')(Z'')O--N.sub.m--Y--; [0318] MO is a modified
oligonucleotide; [0319] R.sup.N is selected from H, methyl, ethyl,
propyl, isopropyl, butyl, and benzyl; [0320] Z, Z', and Z'' are
each independently selected from O and S; [0321] each N is,
independently, a modified or unmodified nucleoside; [0322] m is
from 1 to 5; [0323] X is selected from a phosphodiester linkage and
a phosphorothioate linkage; [0324] Y is a phosphodiester linkage;
and [0325] the wavy line indicates the connection to the rest of
the linker and ligand(s).
[0326] In certain embodiments, the wavy line indicates a connection
to Structure E, above.
[0327] In certain embodiments, n is from 1 to 5, 1 to 4, 1 to 3, or
1 to 2. In certain embodiments, n is 1. In certain embodiments, n
is 2. In certain embodiments, n is 3. In certain embodiments, n is
4. In certain embodiments, n is 5.
[0328] In certain embodiments, the L.sub.n-linker portion of the
compound comprises Structure G:
##STR00025##
wherein: [0329] B is selected from --O--, --S--, --N(R.sup.N)--,
--Z--P(Z')(Z'')O--, --Z--P(Z')(Z'')O--N.sub.m--X--, and
--Z--P(Z')(Z'')O--N.sub.m--Y--; [0330] MO is a modified
oligonucleotide; [0331] R.sup.N is selected from H, methyl, ethyl,
propyl, isopropyl, butyl, and benzyl; [0332] Z, Z', and Z'' are
each independently selected from O and S; [0333] each N is,
independently, a modified or unmodified nucleoside; [0334] m is
from 1 to 5; [0335] X is selected from a phosphodiester linkage and
a phosphorothioate linkage; [0336] Y is a phosphodiester linkage;
[0337] each L is, independently, a ligand; n is from 1 to 10; S is
a scaffold; and Q' and Q'' are, independently, linking groups.
[0338] In certain embodiments, each Q' and Q'' are independently
selected from a peptide, an ether, polyethylene glycol, an alkyl, a
C.sub.1-C.sub.20 alkyl, a substituted C.sub.1-C.sub.20 alkyl, a
C.sub.2-C.sub.20 alkenyl, a substituted C.sub.2-C.sub.20 alkenyl, a
C.sub.2-C.sub.20 alkynyl, a substituted C.sub.2-C.sub.20 alkynyl, a
Ci-C.sub.20 alkoxy, a substituted C.sub.1-C.sub.20 alkoxy, amino,
amido, a pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO),
succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate, and
6-aminohexanoic acid.
[0339] A nonlimiting exemplary L.sub.n-linker portion (e.g., of
Structure F or G) of a compound is shown in Structure H below:
##STR00026##
wherein the wavy line indicates attachment to the modified
oligonucleotide (MO), to X.sub.1, e.g. in Structure B, or to X or
Y, e.g., in Stucture C, or D.
[0340] In certain embodiments, each ligand is a carbohydrate. A
compound comprising a carbohydrate-conjugated modified
oligonucleotide, when recognized by a cell surface lectin, is
transported across the cell membrane into the cell. In certain
embodiments, a cell surface lectin is a C-type lectin. In certain
embodiments, the C-type lectin is present on a Kuppfer cell. In
certain embodiments, a C-type lectin is present on a macrophage. In
certain embodiments, a C-type lectin is present on an endothelial
cell. In certain embodiments, a C-type lectin is present on a
monocyte. In certain embodiments, a C-type lectin is present on a
leukocyte. In certain embodiments, a C-type lectin is present on a
dendritic cell. In certain embodiments, a C-type lectin is present
on a B cell. A conjugate may facilitate uptake of an anti-miR-122
compound into any cell type that expresses a C-type lectin.
[0341] In certain embodiments, a C-type lectin is the
asialoglycoprotein receptor (ASGPR). In certain embodiments, a
conjugate comprises one or more ligands having affinity for the
ASGPR, including but not limited to galactose or a galactose
derivative. In certain embodiments, a ligand having affinity for
the ASGPR is N-acetylgalactosamine, galactose, galactosamine,
N-formylgalactosamine, N-propionyl-galactosamine,
N-n-butanoylgalactosamine, or N-iso-butanoyl-galactosamine Such
conjugates facilitate the uptake of compounds into cells that
express the ASGPR, for example, hepatocytes and dendritic
cells.
[0342] In certain embodiments, a ligand is a carbohydrate selected
from mannose, glucose, galactose, ribose, arabinose, fructose,
fucose, xylose, D-mannose, L-mannose, D-galactose, L-galactose,
D-glucose, L-glucose, D-ribose, L-ribose, D-arabinose, L-arabinose,
D-fructose, L-fructose, D-fucose, L-fucose, D-xylose, L-xylose,
alpha-D-mannofuranose, beta-D-mannofuranose, alpha-D-mannopyranose,
beta-D-mannopyranose, alpha-D-glucofuranose, Beta-D-glucofuranose,
alpha-D-glucopyranose, beta-D-glucopyranose,
alpha-D-galactofuranose, beta-D-galactofuranose,
alpha-D-galactopyranose, beta-D-galactopyranose,
alpha-D-ribofuranose, beta-D-ribofuranose, alpha-D-ribopyranose,
beta-D-ribopyranose, alpha-D-fructofuranose,
alpha-D-fructopyranose, glucosamine, galactosamine, sialic acid,
and N-acetylgalactosamine.
[0343] In certain embodiments, a ligand is selected from
N-acetylgalactosamine, galactose, galactosamine,
N-formylgalactosamine, N-propionyl-galactosamine,
N-n-butanoylgalactosamine, and N-iso-butanoyl-galactosamine.
[0344] In certain embodiments, a ligand is
N-acetylgalactosamine.
[0345] In certain embodiments, a compound comprises the
structure:
##STR00027##
wherein each N is, independently, a modified or unmodified
nucleoside and m is from 1 to 5; X.sub.1 and X.sub.2 are each,
independently, a phosphodiester linkage or a phosphorothioate
linkage; and MO is a modified oligonucleotide. In certain
embodiments, m is 1. In certain embodiments, m is 2. In certain
embodiments, m is 3, 4, or 5. In certain embodiments, m is 2, 3, 4,
or 5. In certain embodiments, when m is greater than 1, each
modified or unmodified nucleoside of N.sub.m may be connected to
adjacent modified or unmodified nucleosides of N.sub.m by a
phosphodiester internucleoside linkage or phosphorothioate
internucleoside linkage.
[0346] In certain embodiments, a compound comprises the
structure:
##STR00028##
wherein X is a phosphodiester linkage or a phosphorothioate
linkage; each N is, independently, a modified or unmodified
nucleoside and m is from 1 to 5; Y is a phosphodiester linkage; and
MO is a modified oligonucleotide. In certain embodiments, m is 1.
In certain embodiments, m is 2. In certain embodiments, m is 2, 3,
4, or 5. In certain embodiments, m is 3, 4, or 5. In certain
embodiments, when m is greater than 1, each modified or unmodified
nucleoside of N.sub.m may be connected to adjacent modified or
unmodified nucleosides of N.sub.m by a phosphodiester
internucleoside linkage or phosphorothioate internucleoside
linkage.
[0347] In certain embodiments, a compound comprises a modified
nucleotide and a conjugate moiety, wherein the modified
oligonucleotide has the structure
C.sub.LCA.sub.LTTG.sub.LT.sub.LCAC.sub.LAC.sub.LTC.sub.LC.sub.L
(SEQ ID NO: 7), wherein the subscript "L" indicates an LNA and
nucleosides not followed by a subscript are
.beta.-D-deoxyribonucleosides, and each internucleoside linkage is
a phosphorothioate internucleoside linkage, and wherein the
conjugate moiety is linked to the 3' terminus of the modified
oligonucleotide and has the structure:
##STR00029##
wherein each N is, independently, a modified or unmodified
nucleoside and m is from 1 to 5; X.sub.1 and X.sub.2 are each,
independently, a phosphodiester linkage or a phosphorothioate
linkage; and MO is a modified oligonucleotide. In some embodiments,
all of the C.sub.L nucleosides are .sup.MeC.sub.L nucleosides,
wherein the superscript "Me" indicates 5-methylcytosine.
[0348] In some embodiments, a compound has the structure:
##STR00030##
wherein each N is, independently, a modified or unmodified
nucleoside and m is from 1 to 5; X.sub.1 and X.sub.2 are each,
independently, a phosphodiester linkage or a phosphorothioate
linkage; and MO is a modified oligonucleotide.
[0349] In certain embodiments, at least one of X.sub.1 and X.sub.2
is a phosphodiester linkage. In certain embodiments, each of
X.sub.1 and X.sub.2 is a phosphodiester linkage.
[0350] In certain embodiments, m is 1. In certain embodiments, m is
2. In certain embodiments, m is 3, 4, or 5. In certain embodiments,
m is 2, 3, 4, or 5. In certain embodiments, when m is greater than
1, each modified or unmodified nucleoside of N.sub.m may be
connected to adjacent modified or unmodified nucleosides of N.sub.m
by a phosphodiester internucleoside linkage or a phosphorothioate
internucleoside linkage.
[0351] In any of the embodiments described herein, N.sub.m may be
N'.sub.pN'', where each N' is, independently, a modified or
unmodified nucleoside and p is from 0 to 4; and N'' is a nucleoside
comprising an unmodified sugar moiety.
[0352] In certain embodiments, p is 0. In certain embodiments, p is
1, 2, 3, or 4. In certain embodiments, when p is 1, 2, 3, or 4,
each N' comprises an unmodified sugar moiety.
[0353] In certain embodiments, an unmodified sugar moiety is a
.beta.-D-ribose or a .beta.-D-deoxyribose.
[0354] In certain embodiments, where p is 1, 2, 3, or 4, N'
comprises a purine nucleobase. In certain embodiments, N''
comprises a purine nucleobase. In certain embodiments, a purine
nucleobase is selected from adenine, guanine, hypoxanthine,
xanthine, and 7-methylguanine. In certain embodiments, N' is a
.beta.-D-deoxyriboadenosine or a .beta.-D-deoxyriboguanosine. In
certain embodiments, N'' is a .beta.-D-deoxyriboadenosine or a
.beta.-D-deoxyriboguanosine.
[0355] In certain embodiments, p is 1, N' and N'' are each a
.beta.-D-deoxyriboadenosine, and N' and N'' are linked by a
phosphodiester internucleoside linkage. In certain embodiments, p
is 1, N' and N'' are each a .beta.-D-deoxyriboadenosine, and N' and
N'' are linked by a phosphodiester internucleoside linkage. In
certain embodiments, p is 1, N' and N'' are each a
.beta.-D-deoxyriboadenosine, and N' and N'' are linked by a
phosphorothioate internucleoside linkage.
[0356] In certain embodiments, where p is 1, 2, 3, or 4, N'
comprises a pyrimidine nucleobase. In certain embodiments, N''
comprises a pyrimidine nucleobase. In certain embodiments, a
pyrimidine nucleobase is selected from cytosine, 5-methylcytosine,
thymine, uracil, and 5,6-dihydrouracil.
[0357] In certain embodiments, the sugar moiety of each N is
independently selected from a .beta.-D-ribose, a
.beta.-D-deoxyribose, a 2'-O-methoxy sugar, a 2'-O-methyl sugar, a
2'-fluoro sugar, and a bicyclic sugar moiety. In certain
embodiments, each bicyclic sugar moiety is independently selected
from a cEt sugar moiety, an LNA sugar moiety, and an ENA sugar
moiety. In certain embodiments, the cEt sugar moiety is an S-cEt
sugar moiety. In certain embodiments, the cEt sugar moiety is an
R-cEt sugar moiety.
[0358] In certain embodiments, a compound comprises the
structure:
##STR00031##
wherein X is a phosphodiester linkage; m is 1; N is a
.beta.-D-deoxyriboadenosine; Y is a phosphodiester linkage; and MO
is a modified oligonucleotide.
[0359] In certain embodiments, a compound comprises the
structure:
##STR00032##
wherein X is a phosphodiester linkage; m is 2; each N is a
.beta.-D-deoxyriboadenosine; the nucleosides of N are linked by a
phosphodiester internucleoside linkage; Y is a phosphodiester
linkage; and MO is a modified oligonucleotide.
[0360] In certain embodiments, a compound comprises a modified
nucleotide and a conjugate moiety, wherein the modified
oligonucleotide has the structure
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.E.sup.MeC.sub.EA.sub.E-
T.sub.ETGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S (SEQ ID NO:
4), where nucleosides not followed by a subscript are
.beta.-D-deoxyribonucleosides; nucleosides followed by a subscript
"E" are 2'-MOE nucleosides; nucleosides followed by a subscript "S"
are S-cEt nucleosides; and each internucleoside linkage is a
phosphorothioate internucleoside linkage; and wherein the conjugate
moiety is linked to the 3' terminus of the modified oligonucleotide
and has the structure:
##STR00033##
wherein X is a phosphodiester linkage; m is 1; N is a
.beta.-D-deoxyriboadenosine; Y is a phosphodiester linkage; and MO
is the modified oligonucleotide.
[0361] In certain embodiments, a compound comprises a modified
nucleotide and a conjugate moiety, wherein the modified
oligonucleotide has the structure
C.sub.LCA.sub.LTTG.sub.LT.sub.LCAC.sub.LAC.sub.LTC.sub.LC.sub.L
(SEQ ID NO: 7), wherein the subscript "L" indicates an LNA and
nucleosides not followed by a subscript are
.beta.-D-deoxyribonucleosides, and each internucleoside linkage is
a phosphorothioate internucleoside linkage, and wherein the
conjugate moiety is linked to the 3' terminus of the modified
oligonucleotide and has the structure:
##STR00034##
wherein X is a phosphodiester linkage; m is 1; N is a
.beta.-D-deoxyriboadenosine; Y is a phosphodiester linkage; and MO
is the modified oligonucleotide. In some embodiments, all of the
C.sub.L nucleosides are .sup.MeC.sub.L nucleosides, wherein the
superscript "Me" indicates 5-methylcytosine.
[0362] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence and modifications as shown in Table 2.
Nucleosides and nucleobases are indicated as follows: the
superscript "Me" indicates 5-methylcytosine; nucleosides not
followed by a subscript are .beta.-D-deoxyribonucleosides;
nucleosides followed by a subscript "E" are 2'-MOE nucleosides;
nucleosides followed by a subscript "S" are S-cEt nucleosides; and
each internucleoside linkage is a phosphorothioate internucleoside
linkage.
TABLE-US-00011 TABLE 2 Conjugated modified oligonucleotides SEQ ID
Cmpd # Sequence (5' to 3') and Modifications Linkage to GalNAc
structure NO 38368 A.sub.E .sup.MeC.sub.E A.sub.E .sup.MeC.sub.E
.sup.MeC.sub.E A.sub.E T.sub.E T G U.sub.S C.sub.S A C.sub.S A
C.sub.S T C.sub.S C.sub.S Structure III of FIG. 3C, 4 where X is a
phosphodiester linkage and MO is compound 38649 38371 A.sub.E
.sup.MeC.sub.E A.sub.E .sup.MeC.sub.E .sup.MeC.sub.E A.sub.E
T.sub.E T G U.sub.S C.sub.S A C.sub.S A C.sub.S T C.sub.S C.sub.S
Structure III of FIG. 3C, 4 where X is a phosphorothioate linkage
and MO is compound 38649 38458 A.sub.E .sup.MeC.sub.E A.sub.E
.sup.MeC.sub.E .sup.MeC.sub.E A.sub.E T.sub.E T G U.sub.S C.sub.S A
C.sub.S A C.sub.S T C.sub.S C.sub.S Structure I of FIG. 3C, where 4
X.sub.2 is a phophorothioate linkage, m is 1, N.sub.m is a
.beta.-D- deoxynucleoside (dA), X.sub.1 is a phosphorothioate
linkage, and MO is compound 38649 38459 A.sub.E .sup.MeC.sub.E
A.sub.E .sup.MeC.sub.E .sup.MeC.sub.E A.sub.E T.sub.E T G U.sub.S
C.sub.S A C.sub.S A C.sub.S T C.sub.S C.sub.S Structure I of FIG.
3C, where 4 X.sub.2 is a phophodiester linkage, m is 1, N.sub.m is
a .beta.-D- deoxynucleoside (dA), X.sub.1 is a phosphorothioate
linkage, and MO is compound 38649 38597 A.sub.E .sup.MeC.sub.E
A.sub.E .sup.MeC.sub.E .sup.MeC.sub.E A.sub.E T.sub.E T G U.sub.S
C.sub.S A C.sub.S A C.sub.S T C.sub.S C.sub.S Structure I of FIG.
3C, where 4 X.sub.2 is a phophorothioate linkage, m is 1, N.sub.m
is a 2'-O- methoxyethyl nucleoside, X.sub.1 is a phosphorothioate
linkage, and MO is compound 38649 38598 A.sub.E .sup.MeC.sub.E
A.sub.E .sup.MeC.sub.E .sup.MeC.sub.E A.sub.E T.sub.E T G U.sub.S
C.sub.S A C.sub.S A C.sub.S T C.sub.S C.sub.S Structure I of FIG.
3C, where 4 X.sub.2 is a phophorothioate linkage, m is 1, N.sub.m
is a X.sub.1 is a phosphorothioate linkage, and MO is compound
38649
[0363] In certain embodiments, a compound provided herein comprises
a modified nucleotide and a conjugate moiety, wherein the modified
oligonucleotide has the structure
C.sub.SA.sub.SC.sub.SA.sub.SC.sub.SU.sub.SC.sub.SC.sub.S (SEQ ID
NO: 9), wherein the subscript "S" indicates an S-cEt and
nucleosides not followed by a subscript are
.beta.-D-deoxyribonucleosides, and each internucleoside linkage is
a phosphorothioate internucleoside linkage, and wherein the
conjugate moiety is linked to the 3' terminus of the modified
oligonucleotide and has the structure:
##STR00035##
wherein X.sub.1 and X.sub.2 are phosphodiester linkages; m is 1; N
is a .beta.-D-deoxyriboadenosine; and MO is the modified
oligonucleotide.
[0364] Additional moieties for conjugation to a modified
oligonucleotide include phenazine, phenanthridine, anthraquinone,
acridine, fluoresceins, rhodamines, coumarins, and dyes. In certain
embodiments, a conjugate group is attached directly to a modified
oligonucleotide.
Certain Metabolic Products
[0365] Upon exposure to exonucleases and/or endonucleases in vitro
or in vivo, compounds may undergo cleavage at various positions
throughout the compound. The products of such cleavage may retain
some degree of the activity of the parent compound, and as such are
considered active metabolites. As such, a metabolic product of a
compound may be used in the methods described herein.
[0366] In certain embodiments, a modified oligonucleotide
(unconjugated or conjugated) undergoes cleavage at the 5' end
and/or the 3' end, resulting in a metabolic product that has 1, 2,
or 3 fewer nucleotides at the 5' end and/or the 3' end, relative to
the parent modified oligonucleotide. In certain embodiments, a
modified oligonucleotide undergoes cleavage at the 5' end,
releasing the 5'-terminal nucleotide and resulting in a metabolic
product that has 1 less nucleotide at the 5' end, relative to the
parent modified oligonucleotide. In certain embodiments, a modified
oligonucleotide undergoes cleavage at the 5' end, releasing two
5'-terminal nucleosides and resulting in a metabolic product that
has two fewer nucleotides at the 5' end, relative to the parent
modified oligonucleotide. In certain embodiments, a modified
oligonucleotide undergoes cleavage at the 3' end, releasing the
3'-termninal nucleotide and resulting in a metabolic product that
has one less nucleotide at the 3' end, relative to the parent
modified oligonucleotide. In certain embodiments, a modified
oligonucleotide undergoes cleavage at the 3' end, releasing two
3'-terminal nucleosides and resulting in a metabolic product that
has two fewer nucleotides at the 3' end, relative to the parent
modified oligonucleotide.
[0367] Compounds comprising modified oligonucleotide linked to a
conjugate moiety may also undergo cleavage at a site within the
linker between the modified oligonucleotide and the ligand. In
certain embodiments, cleavage yields the parent modified
oligonucleotide comprising a portion of the conjugate moiety. In
certain embodiments, cleavage yields the parent modified
oligonucleotide comprising one or more subunits of the linker
between the modified oligonucleotide and the ligand. For example,
where a compound has the structure L.sub.n-linker-N.sub.m-P--MO, in
some embodiments, cleavage yields the parent modified
oligonucleotide comprising one or more nucleotides of N.sub.m. In
some embodiments, cleavage of a conjugated modified oligonucleotide
yields the parent modified oligonucleotide. In some such
embodiments, for example, where a compound has the structure
L.sub.n-linker-N.sub.m-P--MO, in some embodiments, cleavage yields
the parent modified oligonucleotide without any of the nucleotides
of N.sub.m.
Certain Nucleobase Sequences
[0368] Nucleobase sequences of mature miR-122 and its corresponding
stem-loop sequence are found in miRBase, an online searchable
database of microRNA sequences and annotation, found at
microrna.sanger.ac.uk. Entries in the miRBase Sequence database
represent a predicted hairpin portion of a microRNA transcript (the
stem-loop), with information on the location and sequence of the
mature microRNA sequence. The microRNA stem-loop sequences in the
database are not strictly precursor microRNAs (pre-microRNAs), and
may in some instances include the pre-microRNA and some flanking
sequence from the presumed primary transcript. The microRNA
nucleobase sequences described herein encompass any version of the
microRNA, including the sequences described in Release 15.0 of the
miRBase sequence database and sequences described in any earlier
Release of the miRBase sequence database. A sequence database
release may result in the re-naming of certain microRNAs. The
present invention encompasses modified oligonucleotides that are
complementary to any nucleobase sequence version of the microRNAs
described herein.
[0369] In certain embodiments, each nucleobase of a modified
oligonucleotide targeted to miR-122 is capable of undergoing
base-pairing with a nucleobase at a corresponding position in the
nucleobase sequence of miR-122, or a precursor thereof. In certain
embodiments the nucleobase sequence of a modified oligonucleotide
may have one or more mismatched basepairs with respect to its
target microRNA or precursor sequence, and remains capable of
hybridizing to its target sequence.
[0370] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to the nucleobase
sequence of miR-122 precursor, such as miR-122 stem-loop sequence.
As miR-122 is contained within a miR-122 precursor sequence, a
modified oligonucleotide having a nucleobase sequence complementary
to miR-122 is also complementary to a region of a miR-122
precursor.
[0371] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to nucleobases 1 to 16, 1
to 17, 1 to 18, 1 to 19, 1 to 20, 1 to 21, or 1 to 22 of SEQ ID NO:
1.
[0372] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to nucleobases 2 to 16, 2
to 17, 2 to 18, 2 to 19, 2 to 20, 2 to 21, or 2 to 22 of SEQ ID NO:
1.
[0373] In certain embodiments, a modified oligonucleotide has a
nucleobase sequence that is complementary to nucleobases 3 to 17, 3
to 18, 3 to 19, 3 to 20, 3 to 21, or 3 to 22 of SEQ ID NO: 1.
[0374] In certain embodiments, the number of linked nucleosides of
a modified oligonucleotide is less than the length of the miR-122,
or a precursor thereof. In certain such embodiments, the
oligonucleotide has a nucleobase sequence that is complementary to
a region of miR-122, or a precursor thereof. A modified
oligonucleotide having a number of linked nucleosides that is less
than the length of miR-122, wherein each nucleobase of a modified
oligonucleotide is complementary to each nucleobase at a
corresponding position in a miR-122 nucleobase sequence, is
considered to be a modified oligonucleotide having a nucleobase
sequence that is fully complementary to miR-122. For example, a
modified oligonucleotide consisting of 19 linked nucleosides, where
the nucleobases of nucleosides 1 through 19 are each complementary
to a corresponding position of miR-122, where the miR-122 is 22
nucleobases in length, is fully complementary to 19 contiguous
nucleobases of miR-122. Such a modified oligonucleotide has a
nucleobase sequence that is 100% complementary to the nucleobase
sequence of miR-122.
[0375] In certain embodiments, the number of linked nucleosides of
a modified oligonucleotide is one less than the length of the
miR-122. In certain embodiments, a modified oligonucleotide has one
less nucleoside at the 5' terminus. In certain embodiments, a
modified oligonucleotide has one less nucleoside at the 3'
terminus. In certain embodiments, a modified oligonucleotide has
two fewer nucleosides at the 5' terminus. In certain embodiments, a
modified oligonucleotide has two fewer nucleosides at the 3'
terminus.
[0376] In certain embodiments, 15 contiguous nucleobases of a
modified oligonucleotide are each complementary to 15 contiguous
nucleobases of miR-122. In certain embodiments, 16 contiguous
nucleobases of a modified oligonucleotide are each complementary to
16 contiguous nucleobases of miR-122. In certain embodiments, 17
contiguous nucleobases of a modified oligonucleotide are each
complementary to 17 contiguous nucleobases of miR-122. In certain
embodiments, 18 contiguous nucleobases of a modified
oligonucleotide are each complementary to 18 contiguous nucleobases
of miR-122. In certain embodiments, 19 contiguous nucleobases of a
modified oligonucleotide are each complementary to 19 contiguous
nucleobases of miR-122. In certain embodiments, 20 contiguous
nucleobases of a modified oligonucleotide are each complementary to
20 contiguous nucleobases of miR-122. In certain embodiments, 21
contiguous nucleobases of a modified oligonucleotide are each
complementary to 21 contiguous nucleobases of miR-122. In certain
embodiments, 22 contiguous nucleobases of a modified
oligonucleotide are each complementary to 22 contiguous nucleobases
of miR-122.
[0377] In certain embodiments, a modified oligonucleotide comprises
a nucleobase sequence that is complementary to a seed sequence,
i.e. a modified oligonucleotide comprises a seed-match sequence. In
certain embodiments, a seed sequence is a hexamer seed sequence. In
certain such embodiments, a seed sequence is nucleobases 1-6 of
miR-122. In certain such embodiments, a seed sequence is
nucleobases 2-7 of miR-122. In certain such embodiments, a seed
sequence is nucleobases 3-8 of miR-122. In certain embodiments, a
seed sequence is a heptamer seed sequence. In certain such
embodiments, a heptamer seed sequence is nucleobases 1-7 of
miR-122. In certain such embodiments, a heptamer seed sequence is
nucleobases 2-8 of miR-122. In certain embodiments, the seed
sequence is an octamer seed sequence. In certain such embodiments,
an octamer seed sequence is nucleobases 1-8 of miR-122. In certain
embodiments, an octamer seed sequence is nucleobases 2-9 of
miR-122.
[0378] In certain embodiments, the number of linked nucleosides of
a modified oligonucleotide is greater than the length the miR-122
sequence. In certain such embodiments, the nucleobase of an
additional nucleoside is complementary to a nucleobase of miR-122
stem-loop sequence. In certain embodiments, the number of linked
nucleosides of a modified oligonucleotide is one greater than the
length of miR-122. In certain such embodiments, the additional
nucleoside is at the 5' terminus of a modified oligonucleotide. In
certain such embodiments, the additional nucleoside is at the 3'
terminus of a modified oligonucleotide. In certain embodiments, the
number of linked nucleosides of a modified oligonucleotide is two
greater than the length of miR-122. In certain such embodiments,
the two additional nucleosides are at the 5' terminus of a modified
oligonucleotide. In certain such embodiments, the two additional
nucleosides are at the 3' terminus of a modified oligonucleotide.
In certain such embodiments, one additional nucleoside is located
at the 5' terminus and one additional nucleoside is located at the
3' terminus of a modified oligonucleotide. In certain embodiments,
a region of the oligonucleotide may be fully complementary to the
nucleobase sequence of miR-122, but the entire modified
oligonucleotide is not fully complementary to miR-122. For example,
a modified oligonucleotide consisting of 23 linked nucleosides,
where the nucleobases of nucleosides 1 through 22 are each
complementary to a corresponding position of miR-122 that is 22
nucleobases in length, has a 22 nucleoside portion that is fully
complementary to the nucleobase sequence of miR-122.
[0379] In certain embodiments, a compound comprises a modified
oligonucleotide attached to a ligand through a linker comprising
one or more nucleosides. For the purposes of calculating percentage
complementarity, any additional nucleosides of the linker are
considered to be part of the linker and not part of the modified
oligonucleotide. Accordingly, the nucleobase sequence of the
modified oligonucleotide of a conjugated compound may still be 100%
complementary to miR-122, even where the linker comprises one or
more nucleosides that are not complementary to miR-122.
[0380] The miR-122 nucleobase sequences set forth herein, including
but not limited to those found in the examples and in the sequence
listing, are independent of any modification to the nucleic acid.
As such, nucleic acids defined by a SEQ ID NO may comprise,
independently, one or more modifications to one or more sugar
moieties, to one or more internucleoside linkages, and/or to one or
more nucleobases.
[0381] Although the sequence listing accompanying this filing
identifies each nucleobase sequence as either "RNA" or "DNA" as
required, in practice, those sequences may be modified with any
combination of chemical modifications. One of skill in the art will
readily appreciate that such designation as "RNA" or "DNA" to
describe modified oligonucleotides is somewhat arbitrary. For
example, a modified oligonucleotide comprising a nucleoside
comprising a 2'-OH sugar moiety and a thymine base could be
described as a DNA having a modified sugar (2'-OH for the natural
2'-H of DNA) or as an RNA having a modified base (thymine
(methylated uracil) for natural uracil of RNA).
[0382] Accordingly, nucleic acid sequences provided herein,
including, but not limited to, those in the sequence listing, are
intended to encompass nucleic acids containing any combination of
natural or modified RNA and/or DNA, including, but not limited to
such nucleic acids having modified nucleobases. By way of further
example and without limitation, a modified oligonucleotide having
the nucleobase sequence "ATCGATCG" encompasses any oligonucleotide
having such nucleobase sequence, whether modified or unmodified,
including, but not limited to, such compounds comprising RNA bases,
such as those having sequence "AUCGAUCG" and those having some DNA
bases and some RNA bases such as "AUCGATCG" and oligonucleotides
having other modified bases, such as "AT.sup.meCGAUCG," wherein
.sup.meC indicates a 5-methylcytosine. Similarly, a modified
oligonucleotide having the nucleobase sequence "AUCGAUCG"
encompasses any oligonucleotide having such nucleobase sequence,
whether modified or unmodified, including, but not limited to, such
compounds comprising DNA bases, such as those having sequence
"ATCGATCG" and those having some DNA bases and some RNA bases such
as "AUCGATCG" and oligonucleotides having other modified bases,
such as "AT.sup.meCGAUCG," wherein .sup.meC indicates a
5-methylcytosine.
Certain Uses of miR-122 Compositions
[0383] The microRNA miR-122 is a liver-expressed microRNA that is a
critical endogenous "host factor" for the replication of HCV, and
oligonucleotides targeting miR-122 block HCV replication (Jopling
et al. (2005) Science 309, 1577-81). Inhibition of miR-122 in
chimpanzees chronically infected with the Hepatitis C virus reduced
HCV RNA level. In HCV-infected patients, inhibition of miR-122
resulted in a mean 2 log reduction in HCV RNA level after 5 weekly
doses of anti-miR-122 compound. The compounds described herein are
potent inhibitors of miR-122 activity. Accordingly, provided here
are methods for the treatment of HCV infection, comprising a
compound provided herein to an HCV-infected subject.
[0384] Provided herein are methods for treating an HCV-infected
subject comprising administering to the subject a compound provided
herein. In certain embodiments, the methods provided herein
comprise selecting an HCV-infected subject. In certain embodiments,
the subject is a human
[0385] In certain embodiments, the administering reduces the
symptoms of HCV infection. Symptoms of HCV infection include,
without limitation, pain over the liver, jaundice, nausea, loss of
appetite, and fatigue.
[0386] Following an HCV treatment regimen, an HCV-infected subject
may experience a decrease in HCV RNA level, followed by an increase
in HCV RNA level, which subsequent increase is known as a rebound
in HCV RNA level. In certain embodiments, the compounds and methods
provided herein prevent a rebound in HCV RNA level. In certain
embodiments, the compounds and methods provided herein delay a
rebound in HCV RNA level.
[0387] HCV RNA level may be used to diagnose HCV infection, monitor
disease activity and monitor a subject's response to treatment. In
certain embodiments, administering a compound provided herein
reduces HCV RNA level. In certain embodiments, a compound herein is
administered at a dose that is sufficient to reduce HCV RNA level.
In certain embodiments, the methods provided herein comprise
selecting a subject having an HCV RNA level greater than 350,000
copies per milliliter of serum, between 350,000 and 3,500,000
copies per milliliter of serum, or greater than 3,500,000 copies
per milliliter of serum. In certain embodiments, the methods
provided herein comprise reducing HCV RNA level. In certain
embodiments, the methods provided herein comprise reducing HCV RNA
level to below 200 copies per milliliter of serum, to below 100
copies per milliliter of serum, or to below 40 copies per
milliliter of serum. HCV RNA level may be referred to as "viral
load" or "HCV RNA titer."
[0388] Changes to HCV RNA level may be described as log changes.
For example, a drop from 60,000 to 600 would be a 2-log drop in HCV
RNA level. In certain embodiments, the methods provided herein
achieve a HCV RNA level decrease greater than or equal to 2 logs.
In certain embodiments, the methods provided herein achieve an HCV
RNA level decrease of at least 0.5 fold, at least 1.0 fold, at
least 1.5 fold, at least 2.0 fold, or at least 2.5 fold.
[0389] In certain embodiments, the methods provided herein comprise
achieving a sustained virological response.
[0390] HCV-infected subjects may develop HCV-associated diseases.
The major hepatological consequence of HCV infection is cirrhosis
and complications thereof including hemorrhage, hepatic
insufficiency, and hepatocellular carcinoma. An additional
complication is fibrosis, which is the result of chronic
inflammation causing the deposition of extracellular matrix
component, which leads to distortion of the hepatic architecture
and blockage of the microcirculation and liver function. As
cirrhosis progresses and the fibrotic tissue builds up, severe
necroinflammatory activity ensues and steatosis begins. Steatosis
leads to extrahepatic pathologies including diabetes, protein
malnutrition, hypertension, cell toxins, obesity, and anoxia. As
fibrosis and steatosis becomes severe the liver will eventually
fail and require liver transplantation. HCV-infected subjects may
also develop hepatocellular carcinoma. In certain embodiments, an
HCV-infected subject has an HCV-associated disease. In certain
embodiments, the HCV-associated disease is cirrhosis, fibrosis,
steatohepatitis, steatosis, and/or hepatocellular carcinoma.
[0391] In certain embodiments, an HCV-infected subject has one or
more diseases. In certain embodiments, an HCV-infected subject is
infected with one or more viruses other than HCV. In certain
embodiments, an HCV-infected subject is infected with human
immunodeficiency virus (HIV). The compounds provided herein may be
concomitantly administered with one or more additional therapeutic
agents. In certain embodiments, the one or more additional
therapeutic agents comprises an immune therapy, an immunomodulator,
therapeutic vaccine, antifibrotic agent, anti-inflammatory agent,
bronchodilator, mucolytic agent, anti-muscarinic, anti-leukotriene,
inhibitor of cell adhesion, anti-oxidant, cytokine agonist,
cytokine antagonist, lung surfactant, antimicrobial, anti-viral
agent, anti-HCV agent, an anti-cancer agent, an anti-miR-122
compound, an RNAi agent or a cyclophilin inhibitor.
[0392] In certain embodiments, the one or more additional
therapeutic agents may be selected from a protease inhibitor, a
polymerase inhibitor, a cofactor inhibitor, an RNA polymerase
inhibitor, a structural protein inhibitor, a non-structural protein
inhibitor, a cyclophilin inhibitor, an entry inhibitor, a TLR.sub.7
agonist, and an interferon.
[0393] In certain embodiments, the additional therapeutic agent is
a modified oligonucleotide having the structure
C.sub.LCA.sub.LTTG.sub.LT.sub.LCAC.sub.LAC.sub.LTC.sub.LC.sub.L
(SEQ ID NO: 7), where nucleosides not followed by a subscript
indicate .beta.-D-deoxyribonucleosides; nucleosides followed by a
subscript "L" indicate LNA nucleosides; and each internucleoside
linkage is a phosphorothioate internucleoside linkage. In certain
embodiments, a therapeutic agent is a GalNAc-conjugated
C.sub.LCA.sub.LTTG.sub.LT.sub.LCAC.sub.LAC.sub.LTC.sub.LC.sub.L
(SEQ ID NO: 7). In some embodiments, all of the C.sub.L nucleosides
are .sup.MeC.sub.L nucleosides, wherein the superscript "Me"
indicates 5-methylcytosine.
[0394] In certain embodiments, the additional therapeutic agent is
selected from a protease inhibitor, an NS5A inhibitor, an NS3/4A
inhibitor, a nucleoside NS5B inhibitor, a nucleotide NS5B
inhibitor, a non-nucleoside NS5B inhibitor, a cyclophilin inhibitor
and an interferon.
[0395] In certain embodiments, the additional therapeutic agent is
selected from interferon alfa-2a, interferon alpha-2b, interferon
alfacon-1, peginterferon alpha-2b, peginterferon alpha-2a,
interferon-alpha-2b extensed release, interferon lambda,
sofosbuvir, ribavirin, telapravir, boceprevir, vaniprevir,
asunaprevir, ritonavir, setrobuvir, daclastavir, simeprevir,
alisporivir, mericitabine, tegobuvir, danoprevir, sovaprevir, and
neceprevir. In certain embodiments, the additional therapeutic
agent is selected from faldaprevir, ABT-450, MK-5172, mericitabine,
ledipasvir, ombitasvir, GS-5816, MK-8742, dasabuvir, BMS-791325,
and ABT-072.
[0396] In certain embodiments, the additional therapeutic agent is
selected from an interferon, ribavirin, and telapravir. In certain
embodiments, the interferon is selected from interferon alfa-2a,
interferon alpha-2b, interferon alfacon-1, peginterferon alpha-2b,
and peginterferon alpha-2a.
[0397] In certain embodiments, the additional therapeutic agent
includes peginterferon alpha-2b and ribavirin. For example, a
subject may receive a therapy that comprises a compound provided
herein, peginterferon alpha-2b and ribavirin. In certain
embodiments, the at least one additional therapeutic agent includes
peginterferon alpha-2a and ribavirin. For example, a subject may
receive a therapy that comprises a compound provided herein,
peginterferon alpha-2a and ribavirin. In certain embodiments, the
additional therapeutic agents are ombitasvir and ABT-450. In
certain embodiments, the additional therapeutic agents are
asunaprevir, daclatasvir, and BMS-791325. In certain embodiments,
the additional therapeutic agents are sofosbuvir and ledipasivr. In
certain embodiments, the additional therapeutic agents are MK-8742
and MK-5172.
[0398] Certain subjects receiving a certain therapy, for example
interferon or ribaviran therapy, may not experience a significant
or therapeutically beneficial reduction in HCV RNA level. Such
subjects may benefit from administration of one or more additional
therapeutic agents. In certain embodiments, a subject of the
methods provided herein is a non-responder. In certain embodiments,
a subject is an interferon non-responder. In certain embodiments, a
subject is a direct-acting anti-viral non-responder.
[0399] In certain embodiments, an additional therapeutic agent is
an anti-viral agent used in the treatment of HIV infection. In
certain embodiments, an additional therapeutic agent is a
non-nucleoside reverse transcriptase inhibitors (NNRTIs). In
certain embodiments, an additional therapeutic agent is a
nucleoside reverse transcriptase inhibitors (NRTIs). In certain
embodiments, an additional therapeutic agent is a protease
inhibitor. In certain embodiments, an additional therapeutic agent
is an entry inhibitor or fusion inhibitor. In certain embodiments,
an additional therapeutic agent is an integrase inhibitor. In
certain embodiments, an additional therapeutic agent is selected
from efavirenz, etravirine, nevirapine, abacavir, emtricitabine,
tenofovir, lamivudine, zidovudine, atazanavir, darunavir,
fosamprenavir, ritonavir, enfuvirtide, maraviroc, and
raltegravir.
[0400] A subject infected with HCV may experience abnormal liver
function, which is assessed by measuring one or more of bilirubin,
albumin, and prothombin time. Measurement of the liver enzymes
alanine aminotransferase (ALT), and aspartate aminotransferase
(AST) is performed to assess liver inflammation. One or more
abnormal levels of these markers may indicate abnormal liver
function. In certain embodiments, the methods provided herein
comprise normalizing liver function. In certain embodiments, the
methods provided herein comprise normalizing liver enzyme
levels.
[0401] In any of the methods provided, herein, the compound may be
present in a pharmaceutical composition.
[0402] The compounds provided herein may be for use in therapy. In
certain embodiments, the compound is for use in treating an
HCV-infected subject. In certain embodiments, the subject is a
human. The compound for use in treating an HCV-infected subject
may, in certain embodiments, be for use in any method of treatment
described herein.
[0403] Provided herein are methods comprising administering a
compound provided herein to a subject having a miR-122-associated
condition. In certain embodiments, a miR-122-associated condition
is HCV infection.
[0404] In certain embodiments, a miR-122-associated condition is
elevated cholesterol. In certain embodiments, administration of an
anti-miR-122 compound to a subject results in reduced serum
cholesterol. Accordingly, in certain embodiments, provided herein
are methods of lowering cholesterol in a subject, comprising
administering to a subject a compound provided herein. In certain
embodiments, cholesterol levels may be used as a biomarker to
assess the activity of an anti-miR-122 compound provided herein,
alone or in addition to another indicator of efficacy, e.g.
reduction in HCV RNA levels. Accordingly, provided herein are
methods comprising administering a compound provided herein to a
subject, collecting a blood sample from the subject, and measuring
cholesterol in the blood sample from the subject. The level of
cholesterol may be used as an indicator of anti-miR-122 compound
activity in the subject.
[0405] In certain embodiments, a miR-122-associated condition is
steatosis. Accordingly, in certain embodiments, provided herein are
methods of reducing steatosis in a subject, comprising
administering to the subject a compound provided herein.
[0406] In certain embodiments, a miR-122-associated condition is an
iron overload disorder. An iron overload disorder may occur as a
result of a genetic mutation that causes the body to absorb excess
amounts of iron. An iron overload disorder may also have
non-genetic causes, including but not limited to chronic blood
transfusions, chronic hepatitis, or ingestion of an excess amount
of iron. In certain embodiments, an iron overload disorder is
selected from transfusional iron overload, dietary iron overload,
hereditary hemochromatosis, sickle cell disease, thalassemia,
X-linked sideroblastic anemia, pyruvate kinase deficiency, and
glucose-6-phosphate dehydrogenase deficiency. In certain
embodiments, an iron overload disorder is a hereditary
hemochromatosis selected from hemochromatosis type 1,
hemochromatosis type 2A, hemochromatosis type 2B, hemochromatosis
type 3, hemochromatosis type 4 (or ferroportin disease), African
hemochromatosis, neonatal hemochromatosis, aceruloplasminemia, and
atransferrinemia. In certain embodiments, administration of a
compound provided herein to a subject having an iron overload
disorder results in reduction of excess iron in the body of the
subject.
Certain Modifications
[0407] A modified oligonucleotide may comprise one or more
modifications to a nucleobase, sugar, and/or internucleoside
linkage. A modified nucleobase, sugar, and/or internucleoside
linkage may be selected over an unmodified form because of
desirable properties such as, for example, enhanced cellular
uptake, enhanced affinity for other oligonucleotides or nucleic
acid targets and increased stability in the presence of
nucleases.
[0408] In certain embodiments, a modified oligonucleotide comprises
one or more modified nucleosides. In certain embodiments, a
modified nucleoside is a stabilizing nucleoside. An example of a
stabilizing nucleoside is a 2'-modified nucleoside.
[0409] In certain embodiments, a modified nucleoside comprises a
modified sugar moiety. In certain embodiments, a modified
nucleoside comprising a modified sugar moiety comprises an
unmodified nucleobase. In certain embodiments, a modified sugar
comprises a modified nucleobase. In certain embodiments, a modified
nucleoside is a 2'-modified nucleoside.
[0410] In certain embodiments, a 2'-modified nucleoside comprises a
bicyclic sugar moiety. In certain such embodiments, the bicyclic
sugar moiety is a D sugar in the alpha configuration. In certain
such embodiments, the bicyclic sugar moiety is a D sugar in the
beta configuration. In certain such embodiments, the bicyclic sugar
moiety is an L sugar in the alpha configuration. In certain such
embodiments, the bicyclic sugar moiety is an L sugar in the beta
configuration.
[0411] In certain embodiments, the bicyclic sugar moiety comprises
a bridge group between the 2' and the 4'-carbon atoms. In certain
such embodiments, the bridge group comprises from 1 to 8 linked
biradical groups. In certain embodiments, the bicyclic sugar moiety
comprises from 1 to 4 linked biradical groups. In certain
embodiments, the bicyclic sugar moiety comprises 2 or 3 linked
biradical groups. In certain embodiments, the bicyclic sugar moiety
comprises 2 linked biradical groups. Examples of such 4' to 2'
sugar substituents, include, but are not limited to:
--[C(R.sub.a)(R.sub.b)].sub.n--,
--[C(R.sub.a)(R.sub.b)].sub.n--O--, --C(R.sub.aR.sub.b)--N(R)--O--
or, --C(R.sub.aR.sub.b)--O--N(R)--; 4'-CH.sub.2-2',
4'-(CH.sub.2).sub.2-2', 4'-(CH.sub.2).sub.3-2';
4'-(CH.sub.2)--O-2'(LNA); 4'-(CH.sub.2)--S-2';
4'-(CH.sub.2).sub.2-O-2'(ENA); 4'-CH(CH.sub.3)--O-2'(cEt) and
4'-CH(CH.sub.2OCH.sub.3)--O- 2', and analogs thereof (see, e.g.,
U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008);
4'-C(CH.sub.3)(CH.sub.3)--O-2' and analogs thereof, (see, e.g.,
WO2009/006478, published Jan. 8, 2009);
4'-CH.sub.2--N(OCH.sub.3)-2' and analogs thereof (see, e.g.,
WO2008/150729, published Dec. 11, 2008);
4'-CH.sub.2--O--N(CH.sub.3)-2' (see, e.g., US2004/0171570,
published Sep. 2, 2004); 4'-CH.sub.2--O--N(R)-2', and
4'-CH.sub.2--N(R)--O-2'--, wherein each R is, independently, H, a
protecting group, or C.sub.1-C.sub.12 alkyl;
4'-CH.sub.2--N(R)--O-2', wherein R is H, C.sub.1-C.sub.12 alkyl, or
a protecting group (see, U.S. Pat. No. 7,427,672, issued on Sep.
23, 2008); 4'-CH.sub.2--C(H)(CH.sub.3)-2' (see, e.g.,
Chattopadhyaya, et al., J. Org. Chem.,2009, 74, 118-134); and
4'-CH.sub.2--C(.dbd.CH.sub.2)-2' and analogs thereof (see,
published PCT International Application WO 2008/154401, published
on Dec. 8, 2008).
[0412] In certain embodiments, such 4' to 2' bridges independently
comprise 1 or from 2 to 4 linked groups independently selected from
--[C(R.sub.a)(R.sub.b)].sub.n--, --C(R.sub.a).dbd.C(R.sub.b)--,
--C(R.sub.a).dbd.N--, --C(.dbd.NR.sub.a)--, --C(.dbd.O)--,
--C(.dbd.S)--, --O--, --Si(R.sub.a).sub.2--, --S(.dbd.O).sub.x--,
and --N(R.sub.a)--; [0413] wherein: [0414] x is 0, 1, or 2; [0415]
n is 1, 2, 3, or 4; [0416] each R.sub.a and R.sub.b is,
independently, H, a protecting group, hydroxyl, C.sub.1-C.sub.12
alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12
alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12
alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20
aryl, substituted C.sub.5-C.sub.20 aryl, heterocycle radical,
substituted heterocycle radical, heteroaryl, substituted
heteroaryl, C.sub.5-C.sub.7 alicyclic radical, substituted
C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1,
NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl
(C(.dbd.O)--H), substituted acyl, CN, sulfonyl
(S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and
[0417] each J.sub.1 and J.sub.2 is, independently, H,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl
(C(.dbd.O)--H), substituted acyl, a heterocycle radical, a
substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl,
substituted C.sub.1-C.sub.12 aminoalkyl, or a protecting group.
[0418] Nucleosides comprising bicyclic sugar moieties are referred
to as bicyclic nucleosides or BNAs. In certain embodiments,
bicyclic nucleosides include, but are not limited to, (A)
.alpha.-L-Methyleneoxy (4'-CH2--O-2') BNA; (B)
.beta.-D-Methyleneoxy (4'-CH.sub.2--O-2') BNA; (C) Ethyleneoxy
(4'-(CH.sub.2).sub.2--O-2') BNA; (D) Aminooxy
(4'-CH.sub.2--O--N(R)-2') BNA; (E) Oxyamino
(4'-CH.sub.2--N(R)--O-2') BNA; (F) Methyl(methyleneoxy)
(4'-CH(CH.sub.3)--O-2') BNA (also referred to as constrained ethyl
or cEt); (G) methylene-thio (4'-CH.sub.2--S-2') BNA; (H)
methylene-amino (4'-CH2--N(R)-2') BNA; (I) methyl carbocyclic
(4'-CH2--CH(CH.sub.3)-2') BNA; (J) c-MOE (4'-CH.sub.2--OMe-2') BNA
and (K) propylene carbocyclic (4'-(CH.sub.2).sub.3-2') BNA as
depicted below.
##STR00036## ##STR00037##
wherein Bx is a nucleobase moiety and R is, independently, H, a
protecting group, or C.sub.1-C.sub.12 alkyl.
[0419] In certain embodiments, a 2'-modified nucleoside comprises a
2'-substituent group selected from halo, allyl, amino, azido, SH,
CN, OCN, CF.sub.3, OCF.sub.3, O--, S--, or N(R.sub.m)-alkyl; O--,
S--, or N(R.sub.m)-alkenyl; O--, S-- or N(R.sub.m)-alkynyl;
O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl,
O-aralkyl, O(CH.sub.2).sub.2SCH.sub.3,
O-(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n) or
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H, an amino protecting group or
substituted or unsubstituted C.sub.1-C.sub.10 alkyl. These
2'-substituent groups can be further substituted with one or more
substituent groups independently selected from hydroxyl, amino,
alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol,
thioalkoxy (S-alkyl), halogen, alkyl, aryl, alkenyl and
alkynyl.
[0420] In certain embodiments, a 2'-modified nucleoside comprises a
2'-substituent group selected from F, NH.sub.2, N.sub.3, OCF.sub.3,
O--CH.sub.3, O(CH.sub.2).sub.3NH.sub.2, CH.sub.2--CH.dbd.CH.sub.2,
O--CH.sub.2--CH.dbd.CH.sub.2, OCH.sub.2CH.sub.2OCH.sub.3,
O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n),
--O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and
N-substituted acetamide
(O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n) where each R.sub.m and
R.sub.n is, independently, H, an amino protecting group or
substituted or unsubstituted C.sub.1-C.sub.10 alkyl.
[0421] In certain embodiments, a 2'-modified nucleoside comprises a
2'-substituent group selected from F, OCF.sub.3, O--CH.sub.3,
OCH.sub.2CH.sub.2OCH.sub.3, 2'-O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(CH.sub.3).sub.2,
--O(CH.sub.2).sub.2O(CH.sub.2).sub.2N--(CH.sub.3).sub.2, and
O--CH.sub.2--C(.dbd.O)--N(H)CH.sub.3.
[0422] In certain embodiments, a 2'-modified nucleoside comprises a
2'-substituent group selected from F, O--CH.sub.3, and
OCH.sub.2CH.sub.2OCH.sub.3.
[0423] In certain embodiments, a 2'-modified nucleoside is a
4'-thio modified nucleoside. In certain embodiments, a 2'-modified
nucleoside is a 4'-thio-2'-modified nucleoside. A 4'-thio modified
nucleoside has a .beta.-D-ribonucleoside where the 4'-O replaced
with 4'-S. A 4'-thio-2'-modified nucleoside is a 4'-thio modified
nucleoside having the 2'--OH replaced with a 2'-substituent group.
Suitable 2'-substituent groups include 2'--OCH.sub.3,
2'--O--(CH.sub.2).sub.2--OCH.sub.3, and 2'--F.
[0424] In certain embodiments, a modified oligonucleotide comprises
one or more internucleoside modifications. In certain such
embodiments, each internucleoside linkage of a modified
oligonucleotide is a modified internucleoside linkage. In certain
embodiments, a modified internucleoside linkage comprises a
phosphorus atom.
[0425] In certain embodiments, a modified oligonucleotide comprises
at least one phosphorothioate internucleoside linkage. In certain
embodiments, each internucleoside linkage of a modified
oligonucleotide is a phosphorothioate internucleoside linkage.
[0426] In certain embodiments, a modified internucleoside linkage
does not comprise a phosphorus atom. In certain such embodiments,
an internucleoside linkage is formed by a short chain alkyl
internucleoside linkage. In certain such embodiments, an
internucleoside linkage is formed by a cycloalkyl internucleoside
linkages. In certain such embodiments, an internucleoside linkage
is formed by a mixed heteroatom and alkyl internucleoside linkage.
In certain such embodiments, an internucleoside linkage is formed
by a mixed heteroatom and cycloalkyl internucleoside linkages. In
certain such embodiments, an internucleoside linkage is formed by
one or more short chain heteroatomic internucleoside linkages. In
certain such embodiments, an internucleoside linkage is formed by
one or more heterocyclic internucleoside linkages. In certain such
embodiments, an internucleoside linkage has an amide backbone. In
certain such embodiments, an internucleoside linkage has mixed N,
O, S and CH.sub.2 component parts.
[0427] In certain embodiments, a modified oligonucleotide comprises
one or more modified nucleobases. In certain embodiments, a
modified nucleobase is selected from 7-deazaguanine,
7-deazaadenine, hypoxanthine, xanthine, 7-methylguanine,
2-aminopyridine and 2-pyridone. In certain embodiments, a modified
nucleobase is selected from 5-substituted pyrimidines,
6-azapyrimidines and N-2, N-6 and O-6 substituted purines,
including 2 aminopropyladenine, 5-propynyluracil and
5-propynylcytosine.
[0428] In certain embodiments, a modified nucleobase comprises a
polycyclic heterocycle. In certain embodiments, a modified
nucleobase comprises a tricyclic heterocycle. In certain
embodiments, a modified nucleobase comprises a phenoxazine
derivative. In certain embodiments, the phenoxazine can be further
modified to form a nucleobase known in the art as a G-clamp
[0429] In certain such embodiments, the compound comprises a
modified oligonucleotide having one or more stabilizing groups that
are attached to one or both termini of a modified oligonucleotide
to enhance properties such as, for example, nuclease stability.
Included in stabilizing groups are cap structures. These terminal
modifications protect a modified oligonucleotide from exonuclease
degradation, and can help in delivery and/or localization within a
cell. The cap can be present at the 5'-terminus (5'-cap), or at the
3'-terminus (3'-cap), or can be present on both termini. Cap
structures include, for example, inverted deoxy abasic caps.
[0430] Suitable cap structures include a 4',5'-methylene
nucleotide, a 1-(beta-D-erythrofuranosyl) nucleotide, a 4'-thio
nucleotide, a carbocyclic nucleotide, a 1,5-anhydrohexitol
nucleotide, an L-nucleotide, an alpha-nucleotide, a modified base
nucleotide, a phosphorodithioate linkage, a threo-pentofuranosyl
nucleotide, an acyclic 3',4'-seco nucleotide, an acyclic
3,4-dihydroxybutyl nucleotide, an acyclic 3,5-dihydroxypentyl
nucleotide, a 3'-3'-inverted nucleotide moiety, a 3'-3'-inverted
abasic moiety, a 3'-2'-inverted nucleotide moiety, a 3'-2'-inverted
abasic moiety, a 1,4-butanediol phosphate, a 3'-phosphoramidate, a
hexylphosphate, an aminohexyl phosphate, a 3'-phosphate, a
3'-phosphorothioate, a phosphorodithioate, a bridging
methylphosphonate moiety, and a non-bridging methylphosphonate
moiety 5'-amino-alkyl phosphate, a 1,3-diamino-2-propyl phosphate,
3-aminopropyl phosphate, a 6-aminohexyl phosphate, a
1,2-aminododecyl phosphate, a hydroxypropyl phosphate, a
5'-5'-inverted nucleotide moiety, a 5'-5'-inverted abasic moiety, a
5'-phosphoramidate, a 5'-phosphorothioate, a 5'-amino, a bridging
and/or non-bridging 5'-phosphoramidate, a phosphorothioate, and a
5'-mercapto moiety.
Certain Synthesis Methods
[0431] Modified oligonucleotides may be made with automated, solid
phase synthesis methods known in the art. During solid phase
synthesis, phosphoramidite monomers are sequentially coupled to a
nucleoside that is covalently linked to a solid support. This
nucleoside is the 3' terminal nucleoside of the modified
oligonucleotide. Typically, the coupling cycle comprises four
steps: detritylation (removal of a 5'-hydroxyl protecting group
with acid), coupling (attachment of an activated phosphoroamidite
to the support bound nucleoside or oligonucleotide), oxidation or
sulfurization (conversion of a newly formed phosphite trimester
with an oxidizing or sulfurizing agent), and capping (acetylation
of unreacted 5'-hydroxyl groups). After the final coupling cycle,
the solid support-bound oligonucleotide is subjected to a
detritylation step, followed by a cleavage and deprotection step
that simultaneously releases the oligonucleotide from the solid
support and removes the protecting groups from the bases. The solid
support is removed by filtration, the filtrate is concentrated and
the resulting solution is tested for identity and purity. The
oligonucleotide is then purified, for example using a column packed
with anion-exhange resin.
[0432] GalNAc-conjugated modified oligonucleotides may be made with
automated solid phase synthesis, similar to the solid phase
synthesis that produced unconjugated oligonucleotides. During the
synthesis of GalNAc-conjugated oligonucleotides, the
phosphoramidite monomers are sequentially coupled to a GalNAc
conjugate which is covalently linked to a solid support. The
synthesis of GalNAc conjugates and GalNAc conjugate solid support
is described, for example, in U.S. Pat. No. 8,106,022, and
International Application Publication No. WO 2013/033230, each of
which is herein incorporated by reference in its entiretly for the
description of the synthesis of carbohydrate-containing conjugates,
including conjugates comprising one or more GalNAc moieties, and of
the synthesis of conjugate covalently linked to solid support.
Certain Pharmaceutical Compositions
[0433] Any of the compounds provided herein may be prepared as a
pharmaceutical composition. In certain embodiments, a
pharmaceutical composition is administered in the form of a dosage
unit (e.g., tablet, capsule, bolus, etc.). In some embodiments, a
pharmaceutical composition comprises a compound provided herein at
a dose within a range selected from 25 mg to 800 mg, 25 mg to 700
mg, 25 mg to 600 mg, 25 mg to 500 mg, 25 mg to 400 mg, 25 mg to 300
mg, 25 mg to 200 mg, 25 mg to 100 mg, 100 mg to 800 mg, 200 mg to
800 mg, 300 mg to 800 mg, 400 mg to 800 mg, 500 mg to 800 mg, 600
mg to 800 mg, 100 mg to 700 mg, 150 mg to 650 mg, 200 mg to 600 mg,
250 mg to 550 mg, 300 mg to 500 mg, 300 mg to 400 mg, and 400 mg to
600 mg. In certain embodiments, such pharmaceutical compositions
comprise a compound provided herein present at a dose selected from
25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70
mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115
mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg,
160 mg, 165 mg, 170 mg, 175 mg, 180 mg, 185 mg, 190 mg, 195 mg, 200
mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg,
245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 270 mg, 280 mg, 285
mg, 290 mg, 295 mg, 300 mg, 305 mg, 310 mg, 315 mg, 320 mg, 325 mg,
330 mg, 335 mg, 340 mg, 345 mg, 350 mg, 355 mg, 360 mg, 365 mg, 370
mg, 375 mg, 380 mg, 385 mg, 390 mg, 395 mg, 400 mg, 405 mg, 410 mg,
415 mg, 420 mg, 425 mg, 430 mg, 435 mg, 440 mg, 445 mg, 450 mg, 455
mg, 460 mg, 465 mg, 470 mg, 475 mg, 480 mg, 485 mg, 490 mg, 495 mg,
500 mg, 505 mg, 510 mg, 515 mg, 520 mg, 525 mg, 530 mg, 535 mg, 540
mg, 545 mg, 550 mg, 555 mg, 560 mg, 565 mg, 570 mg, 575 mg, 580 mg,
585 mg, 590 mg, 595 mg, 600 mg, 605 mg, 610 mg, 615 mg, 620 mg, 625
mg, 630 mg, 635 mg, 640 mg, 645 mg, 650 mg, 655 mg, 660 mg, 665 mg,
670 mg, 675 mg, 680 mg, 685 mg, 690 mg, 695 mg, 700 mg, 705 mg, 710
mg, 715 mg, 720 mg, 725 mg, 730 mg, 735 mg, 740 mg, 745 mg, 750 mg,
755 mg, 760 mg, 765 mg, 770 mg, 775 mg, 780 mg, 785 mg, 790 mg, 795
mg, and 800 mg. In certain such embodiments, a pharmaceutical
composition of the comprises a dose compound provided herein
selected from 25 mg, 50 mg, 75 mg, 100 mg, 150 mg, 200 mg, 250 mg,
300 mg, 350 mg, 400 mg, 500 mg, 600 mg, 700 mg, and 800 mg.
[0434] In certain embodiments, a pharmaceutical composition
comprising a compound provided herein is administered at a dose of
10 mg/kg or less, 9 mg/kg or less, 8 mg/kg or less, 7.5 mg/kg or
less, 7 mg/kg or less, 6.5 mg/kg or less, 6 mg/kg or less, 5.5
mg/kg or less, 5 mg/kg or less, 4.5 mg/kg or less, 4 mg/kg or less,
3.5 mg/kg or less, 3 mg/kg or less, 2.5 mg/kg or less, 2 mg/kg or
les, 1.5 mg/kg or less, 1 mg/kg or less, 0.75 mg/kg or less, 0.5
mg/kg or less, or 0.25 mg/kg or less.
[0435] In certain embodiments, a pharmaceutical agent is sterile
lyophilized compound that is reconstituted with a suitable diluent,
e.g., sterile water for injection or sterile saline for injection.
The reconstituted product is administered as a subcutaneous
injection or as an intravenous infusion after dilution into saline.
The lyophilized drug product consists of a compound which has been
prepared in water for injection, or in saline for injection,
adjusted to pH 7.0-9.0 with acid or base during preparation, and
then lyophilized. The lyophilized compound may be 25-800 mg of an
oligonucleotide. It is understood that this encompasses 25, 50, 75,
100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 425,
450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750,
775, and 800 mg of modified lyophilized oligonucleotide. Further,
in some embodiments, the lyophilized compound is present in an
amount that ranges from 25 mg to 800 mg, 25 mg to 700 mg, 25 mg to
600 mg, 25 mg to 500 mg, 25 mg to 400 mg, 25 mg to 300 mg, 25 mg to
200 mg, 25 mg to 100 mg, 100 mg to 800 mg, 200 mg to 800 mg, 300 mg
to 800 mg, 400 mg to 800 mg, 500 mg to 800 mg, 600 mg to 800 mg,
100 mg to 700 mg, 150 mg to 650 mg, 200 mg to 600 mg, 250 mg to 550
mg, 300 mg to 500 mg, 300 mg to 400 mg, or 400 mg to 600 mg. The
lyophilized drug product may be packaged in a 2 mL Type I, clear
glass vial (ammonium sulfate-treated), stoppered with a bromobutyl
rubber closure and sealed with an aluminum FLIP-OFF.RTM.
overseal.
[0436] In certain embodiments, a pharmaceutical composition
provided herein comprises a compound in a therapeutically effective
amount. In certain embodiments, the therapeutically effective
amount is sufficient to prevent, alleviate or ameliorate symptoms
of a disease or to prolong the survival of the subject being
treated. Determination of a therapeutically effective amount is
well within the capability of those skilled in the art.
[0437] In certain embodiments, the pharmaceutical compositions
provided herein may additionally contain other adjunct components
conventionally found in pharmaceutical compositions, at their
art-established usage levels. Thus, for example, the compositions
may contain additional, compatible, pharmaceutically-active
materials such as, for example, antipruritics, astringents, local
anesthetics or anti-inflammatory agents, or may contain additional
materials useful in physically formulating various dosage forms of
the compositions of the present invention, such as dyes, flavoring
agents, preservatives, antioxidants, opacifiers, thickening agents
and stabilizers. However, such materials, when added, should not
unduly interfere with the biological activities of the components
of the compositions of the present invention. The formulations can
be sterilized and, if desired, mixed with auxiliary agents, e.g.,
lubricants, preservatives, stabilizers, wetting agents,
emulsifiers, salts for influencing osmotic pressure, buffers,
colorings, flavorings and/or aromatic substances and the like which
do not deleteriously interact with the oligonucleotide(s) of the
formulation.
[0438] Lipid moieties have been used in nucleic acid therapies in a
variety of methods. In one method, the nucleic acid is introduced
into preformed liposomes or lipoplexes made of mixtures of cationic
lipids and neutral lipids. In another method, DNA complexes with
mono- or poly-cationic lipids are formed without the presence of a
neutral lipid. In certain embodiments, a lipid moiety is selected
to increase distribution of a pharmaceutical agent to a particular
cell or tissue. In certain embodiments, a lipid moiety is selected
to increase distribution of a pharmaceutical agent to fat tissue.
In certain embodiments, a lipid moiety is selected to increase
distribution of a pharmaceutical agent to muscle tissue.
[0439] In certain embodiments, INTRALIPID is used to prepare a
pharmaceutical composition comprising an oligonucleotide.
Intralipid is fat emulsion prepared for intravenous administration.
It is made up of 10% soybean oil, 1.2% egg yolk phospholipids,
2.25% glycerin, and water for injection. In addition, sodium
hydroxide has been added to adjust the pH so that the final product
pH range is 6 to 8.9.
[0440] In certain embodiments, a pharmaceutical composition
provided herein comprises a polyamine compound or a lipid moiety
complexed with a nucleic acid. Such preparations are described in
PCT publication WO/2008/042973, which is herein incorporated by
reference in its entirety for the disclosure of lipid preparations.
Certain additional preparations are described in Akinc et al.,
Nature Biotechnology 26, 561-569 (1 May 2008), which is herein
incorporated by reference in its entirety for the disclosure of
lipid preparations.
[0441] In certain embodiments, pharmaceutical compositions provided
herein comprise one or more compounds and one or more excipients.
In certain such embodiments, excipients are selected from water,
salt solutions, alcohol, polyethylene glycols, gelatin, lactose,
amylase, magnesium stearate, talc, silicic acid, viscous paraffin,
hydroxymethylcellulose and polyvinylpyrrolidone.
[0442] In certain embodiments, a pharmaceutical composition
provided herein is prepared using known techniques, including, but
not limited to mixing, dissolving, granulating, dragee-making,
levigating, emulsifying, encapsulating, entrapping or tableting
processes.
[0443] In certain embodiments, a pharmaceutical composition
provided herein is a liquid (e.g., a suspension, elixir and/or
solution). In certain of such embodiments, a liquid pharmaceutical
composition is prepared using ingredients known in the art,
including, but not limited to, water, glycols, oils, alcohols,
flavoring agents, preservatives, and coloring agents.
[0444] In certain embodiments, a pharmaceutical composition
provided herein is a solid (e.g., a powder, tablet, and/or
capsule). In certain of such embodiments, a solid pharmaceutical
composition comprising one or more oligonucleotides is prepared
using ingredients known in the art, including, but not limited to,
starches, sugars, diluents, granulating agents, lubricants,
binders, and disintegrating agents.
[0445] In certain embodiments, a pharmaceutical composition
provided herein is formulated as a depot preparation. Certain such
depot preparations are typically longer acting than non-depot
preparations. In certain embodiments, such preparations are
administered by implantation (for example subcutaneously or
intramuscularly) or by intramuscular injection. In certain
embodiments, depot preparations are prepared using suitable
polymeric or hydrophobic materials (for example an emulsion in an
acceptable oil) or ion exchange resins, or as sparingly soluble
derivatives, for example, as a sparingly soluble salt.
[0446] In certain embodiments, a pharmaceutical composition
provided herein comprises a delivery system. Examples of delivery
systems include, but are not limited to, liposomes and emulsions.
Certain delivery systems are useful for preparing certain
pharmaceutical compositions including those comprising hydrophobic
compounds. In certain embodiments, certain organic solvents such as
dimethylsulfoxide are used.
[0447] In certain embodiments, a pharmaceutical composition
provided herein comprises one or more tissue-specific delivery
molecules designed to deliver the one or more compounds provided
herein to specific tissues or cell types. For example, in certain
embodiments, pharmaceutical compositions include liposomes coated
with a tissue-specific antibody.
[0448] In certain embodiments, a pharmaceutical composition
provided herein comprises a co-solvent system. Certain of such
co-solvent systems comprise, for example, benzyl alcohol, a
nonpolar surfactant, a water-miscible organic polymer, and an
aqueous phase. In certain embodiments, such co-solvent systems are
used for hydrophobic compounds. A non-limiting example of such a
co-solvent system is the VPD co-solvent system, which is a solution
of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the
nonpolar surfactant Polysorbate 80.TM. and 65% w/v polyethylene
glycol 300. The proportions of such co-solvent systems may be
varied considerably without significantly altering their solubility
and toxicity characteristics. Furthermore, the identity of
co-solvent components may be varied: for example, other surfactants
may be used instead of Polysorbate 80.TM.; the fraction size of
polyethylene glycol may be varied; other biocompatible polymers may
replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other
sugars or polysaccharides may substitute for dextrose.
[0449] In certain embodiments, a pharmaceutical composition
provided herein comprises a sustained-release system. A
non-limiting example of such a sustained-release system is a
semi-permeable matrix of solid hydrophobic polymers. In certain
embodiments, sustained-release systems may, depending on their
chemical nature, release pharmaceutical agents over a period of
hours, days, weeks or months.
[0450] In certain embodiments, a pharmaceutical composition
provided herein is prepared for oral administration. In certain of
such embodiments, a pharmaceutical composition is formulated by
combining one or more compounds comprising a modified
oligonucleotide with one or more pharmaceutically acceptable
carriers. Certain of such carriers enable pharmaceutical
compositions to be formulated as tablets, pills, dragees, capsules,
liquids, gels, syrups, slurries, suspensions and the like, for oral
ingestion by a subject. In certain embodiments, pharmaceutical
compositions for oral use are obtained by mixing oligonucleotide
and one or more solid excipient. Suitable excipients include, but
are not limited to, fillers, such as sugars, including lactose,
sucrose, mannitol, or sorbitol; cellulose preparations such as, for
example, maize starch, wheat starch, rice starch, potato starch,
gelatin, gum tragacanth, methyl cellulose,
hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose,
and/or polyvinylpyrrolidone (PVP). In certain embodiments, such a
mixture is optionally ground and auxiliaries are optionally added.
In certain embodiments, pharmaceutical compositions are formed to
obtain tablets or dragee cores. In certain embodiments,
disintegrating agents (e.g., cross-linked polyvinyl pyrrolidone,
agar, or alginic acid or a salt thereof, such as sodium alginate)
are added.
[0451] In certain embodiments, dragee cores are provided with
coatings. In certain such embodiments, concentrated sugar solutions
may be used, which may optionally contain gum arabic, talc,
polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or
titanium dioxide, lacquer solutions, and suitable organic solvents
or solvent mixtures. Dyestuffs or pigments may be added to tablets
or dragee coatings.
[0452] In certain embodiments, pharmaceutical compositions for oral
administration are push-fit capsules made of gelatin. Certain of
such push-fit capsules comprise one or more pharmaceutical agents
of the present invention in admixture with one or more filler such
as lactose, binders such as starches, and/or lubricants such as
talc or magnesium stearate and, optionally, stabilizers. In certain
embodiments, pharmaceutical compositions for oral administration
are soft, sealed capsules made of gelatin and a plasticizer, such
as glycerol or sorbitol. In certain soft capsules, one or more
pharmaceutical agents of the present invention are be dissolved or
suspended in suitable liquids, such as fatty oils, liquid paraffin,
or liquid polyethylene glycols. In addition, stabilizers may be
added.
[0453] In certain embodiments, pharmaceutical compositions are
prepared for buccal administration. Certain of such pharmaceutical
compositions are tablets or lozenges formulated in conventional
manner.
[0454] In certain embodiments, a pharmaceutical composition is
prepared for administration by injection (e.g., intravenous,
subcutaneous, intramuscular, etc.). In certain of such embodiments,
a pharmaceutical composition comprises a carrier and is formulated
in aqueous solution, such as water or physiologically compatible
buffers such as Hanks's solution, Ringer's solution, or
physiological saline buffer. In certain embodiments, other
ingredients are included (e.g., ingredients that aid in solubility
or serve as preservatives). In certain embodiments, injectable
suspensions are prepared using appropriate liquid carriers,
suspending agents and the like. Certain pharmaceutical compositions
for injection are presented in unit dosage form, e.g., in ampoules
or in multi-dose containers. Certain pharmaceutical compositions
for injection are suspensions, solutions or emulsions in oily or
aqueous vehicles, and may contain formulatory agents such as
suspending, stabilizing and/or dispersing agents. Certain solvents
suitable for use in pharmaceutical compositions for injection
include, but are not limited to, lipophilic solvents and fatty
oils, such as sesame oil, synthetic fatty acid esters, such as
ethyl oleate or triglycerides, and liposomes. Aqueous injection
suspensions may contain substances that increase the viscosity of
the suspension, such as sodium carboxymethyl cellulose, sorbitol,
or dextran. Optionally, such suspensions may also contain suitable
stabilizers or agents that increase the solubility of the
pharmaceutical agents to allow for the preparation of highly
concentrated solutions.
[0455] In certain embodiments, a pharmaceutical composition is
prepared for transmucosal administration. In certain of such
embodiments penetrants appropriate to the barrier to be permeated
are used in the formulation. Such penetrants are generally known in
the art.
[0456] In certain embodiments, one or more modified
oligonucleotides provided herein is administered as a prodrug. In
certain embodiments, upon in vivo administration, a prodrug is
chemically or enzymatically converted to the biologically,
pharmaceutically or therapeutically more active form of an
oligonucleotide. In certain embodiments, prodrugs are useful
because they are easier to administer than the corresponding active
form. For example, in certain instances, a prodrug may be more
bioavailable (e.g., through oral administration) than is the
corresponding active form. In certain embodiments, prodrugs possess
superior transmittal across cell membranes. In certain embodiments,
a prodrug facilitates delivery of a modified oligonucleotide to the
desired cell type, tissue, or organ. In certain embodiments, a
prodrug is a compound comprising a conjugated modified
oligonucleotide. In certain instances, a prodrug may have improved
solubility compared to the corresponding active form. In certain
embodiments, prodrugs are less water soluble than the corresponding
active form. In certain embodiments, a prodrug is an ester. In
certain such embodiments, the ester is metabolically hydrolyzed to
carboxylic acid upon administration. In certain instances the
carboxylic acid containing compound is the corresponding active
form. In certain embodiments, a prodrug comprises a short peptide
(polyaminoacid) bound to an acid group. In certain of such
embodiments, the peptide is cleaved upon administration to form the
corresponding active form. In certain embodiments, a prodrug is
produced by modifying a pharmaceutically active compound such that
the active compound will be regenerated upon in vivo
administration. The prodrug can be designed to alter the metabolic
stability or the transport characteristics of a drug, to mask side
effects or toxicity, to improve the flavor of a drug or to alter
other characteristics or properties of a drug. By virtue of
knowledge of pharmacodynamic processes and drug metabolism in vivo,
those of skill in this art, once a pharmaceutically active compound
is known, can design prodrugs of the compound (see, e.g., Nogrady
(1985) Medicinal Chemistry A Biochemical Approach, Oxford
University Press, New York, pages 388-392).
Certain Routes of Administration
[0457] In certain embodiments, administering to a subject comprises
parenteral administration. In certain embodiments, administering to
a subject comprises intravenous administration. In certain
embodiments, administering to a subject comprises subcutaneous
administration.
[0458] In certain embodiments, administering to a subject comprises
intraarterial, pulmonary, oral, rectal, transmucosal, intestinal,
enteral, topical, transdermal, suppository, intrathecal,
intraventricular, intraperitoneal, intranasal, intraocular,
intramuscular, intramedullary, and intratumoral administration.
Certain miR-122 Kits
[0459] The present invention also provides kits. In some
embodiments, the kits comprise one or more compounds provided
herein. In some embodiments, a compound provided herein is present
within a vial. A plurality of vials, such as 10, can be present in,
for example, dispensing packs. In some embodiments, the vial is
manufactured so as to be accessible with a syringe. The kit can
also contain instructions for using the compounds provided
herein.
[0460] In some embodiments, the kits may be used for administration
of a compound provided herein to a subject. In such instances, in
addition to comprising at least one compound provided herein, the
kit can further comprise one or more of the following: syringe,
alcohol swab, cotton ball, and/or gauze pad. In some embodiments,
the compounds complementary to miR-122 can be present in a
pre-filled syringe (such as a single-dose syringes with, for
example, a 27 gauge, 1/2 inch needle with a needle guard), rather
than in a vial. A plurality of pre-filled syringes, such as 10, can
be present in, for example, dispensing packs. The kit can also
contain instructions for administering a compound provided
herein.
Certain Experimental Models
[0461] In certain embodiments, the present invention provides
methods of using and/or testing a compound provided herein in an
experimental model. Those having skill in the art are able to
select and modify the protocols for such experimental models to
evaluate a compound provided herein.
[0462] The effects of antisense inhibition of a microRNA following
the administration of anti-miR compounds may be assessed by a
variety of methods known in the art. In certain embodiments, these
methods are be used to quantitate microRNA levels in cells or
tissues in vitro or in vivo. In certain embodiments, changes in
microRNA levels are measured by microarray analysis. In certain
embodiments, changes in microRNA levels are measured by one of
several commercially available PCR assays, such as the TaqMan.RTM.
MicroRNA Assay (Applied Biosystems, a Life Technologies brand).
[0463] In vitro activity of anti-miR compounds may be assessed
using a luciferase cell culture assay. In this assay, a microRNA
luciferase sensor construct is engineered to contain one or more
binding sites of the microRNA of interest fused toa luciferase
gene. When the microRNA binds to its cognate site in the luciferase
sensor construct, luciferase expression is suppressed. When the
appropriate anti-miR is introduced into the cells, it binds to the
target microRNA and relieves suppression of luciferase expression.
Thus, in this assay anti-miRs that are effective inhibitors of the
microRNA of interest will cause an increase in luciferase
expression.
[0464] Activity of anti-miR compounds may be assessed by measuring
the mRNA and/or protein level of a target of a microRNA. A microRNA
binds to a complementary site within one or more target RNAs,
leading to suppression of a target RNA, thus inhibition of the
microRNA results in the increase in the level of mRNA and/or
protein of a target of the microRNA (i.e., derepression). The
derepression of one or more target RNAs may be measured in vivo or
in vitro. For example, a target of miR-122 is aldolase A (ALDOA).
Inhibition of miR-122 results in an increase in the level of ALDOA
mRNA, thus ALDOA mRNA levels may be used to evaluate the inhibitory
activity of an anti-miR-122 compound.
[0465] The effects of anti-miR-122 compounds on HCV replication may
be measured in an HCV replicon assay. In this assay, compounds are
introduced into a cell line (e.g., a human hepatoma cell line) that
contains a subgenomic replicon of HCV with a stable luciferase
reporter and three cell culture-adaptive mutations
(luc-ubi-neo/ET). The luciferase reporter is used as an indirect
measure of HCV replication. The replicon used may be a parent HCV
genotype or an HCV genotype with mutations that confer resistance
to anti-viral agents. Anti-miR-122 compounds may be evaluated alone
or in combination with other agents used in the treatment of
HCV-infection. In some embodiments, a modified oligonucleotide may
be tested in an in vivo or in vitro assay, and subsequently
conjugated to form a compound for use in the methods described
herein.
EXAMPLES
[0466] The following examples are presented in order to more fully
illustrate some embodiments of the invention. They should, in no
way be construed, however, as limiting the broad scope of the
invention.
[0467] Those of ordinary skill in the art will readily adopt the
underlying principles of this discovery to design various compounds
without departing from the spirit of the current invention.
Example 1
Design and Evaluation of Anti-miR-122 Compounds
[0468] To identify potent inhibitors of miR-122, numerous
anti-miR-122 modified oligonucleotides were designed and
synthesized. The modified oligonucleotides varied in length, and in
the number, placement, and identity of bicyclic nucleosides and
non-bicyclic nucleosides. The compounds were evaluated in a number
of assays, to identify anti-miRs that are suitable therapeutic
agents for the treatment of HCV infection. The evaluation of the
compounds was performed in an iterative manner, in which highly
active compounds were further optimized through design changes, and
the resultant compounds were then subjected to additional
screening. The compound evaluation process included assessment of
potency, safety, and physicochemical characteristics.
[0469] In total, over 400 anti-miR-122 modified oligonucleotides
were designed and tested in a first luciferase cell culture
activity assay. Following an additional luciferase assay and for
certain compounds measurement of metabolic stability, approximately
70 of these compounds were selected for further in vivo testing. Of
these 70 compounds approximately 10 compounds were identified as
having a suitable in vivo potency (e.g. an ED.sub.50 of less than 5
mg/kg). A subset of these compounds was identified as having a
certain safety profile in rodents and non-human primates. Thus, of
the hundreds of compounds screened, only a small subset of the
initial over 400 compounds met certain potency, safety and
physicochemical criteria.
[0470] Certain anti-miR-122 compounds are shown in Table A. The
"position on miR-122" is the position to which the nucleoside in
that column is complementary to SEQ ID NO: 1, counting from the 5'
end SEQ ID NO: 1.
TABLE-US-00012 TABLE A Certain Anti-miR-122 Compounds SEQUENCE (5'
to 3') and MODIFICATIONS SEQ Position on miR-122 ID Cmpd # 22 21 20
19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 NO 38011 C.sub.S C
A U.sub.S T G.sub.S U.sub.S C A C.sub.S A C.sub.S T C.sub.S C.sub.S
A 3 38012 C.sub.S C A.sub.S T T G U.sub.S C.sub.S A C.sub.S A
C.sub.S T C.sub.S C.sub.S A 3 38013 C.sub.S C A U.sub.S T G.sub.S T
C.sub.S A C.sub.S A C.sub.S T C.sub.S C.sub.S A 3 38014 C.sub.S C A
U.sub.S T G.sub.S U.sub.S C A C.sub.S A C.sub.S T C.sub.S C.sub.S
A.sub.E 3 38015 .sup.MeC.sub.S C A T.sub.S T G.sub.S T.sub.S C A
.sup.MeC.sub.S A .sup.MeC.sub.S T .sup.MeC.sub.S .sup.MeC.sub.S
A.sub.E 3 38016 .sup.MeC.sub.S C A T.sub.S T G T.sub.S
.sup.MeC.sub.S A .sup.MeC.sub.S A .sup.MeC.sub.S T .sup.MeC.sub.S
.sup.MeC.sub.S A.sub.E 3 38021 C.sub.L C A T.sub.L T G T.sub.L
C.sub.L A C.sub.L A C.sub.L T C.sub.L C.sub.L 4 38646 A.sub.E
.sup.MeC.sub.E A.sub.E .sup.MeC.sub.E C A.sub.S T T G U.sub.S
C.sub.S A C.sub.S A C.sub.S T C.sub.S C.sub.S 4 38647 A.sub.E
.sup.MeC.sub.E A.sub.E .sup.MeC.sub.E .sup.MeC.sub.E A.sub.S T T G
U.sub.S C.sub.S A C.sub.S A C.sub.S T C.sub.S C.sub.S 4 38648
A.sub.E .sup.MeC.sub.E A.sub.E .sup.MeC.sub.E .sup.MeC.sub.E
A.sub.E T T G U.sub.S C.sub.S A C.sub.S A C.sub.S T C.sub.S C.sub.S
4 38649 A.sub.E .sup.MeC.sub.E A.sub.E .sup.MeC.sub.E
.sup.MeC.sub.E A.sub.E T.sub.E T G U.sub.S C.sub.S A C.sub.S A
C.sub.S T C.sub.S C.sub.S 4 38650 A.sub.E .sup.MeC.sub.E A.sub.E
.sup.MeC.sub.E .sup.MeC.sub.E A.sub.E T.sub.E T.sub.E G U.sub.S
C.sub.S A C.sub.S A C.sub.S T C.sub.S C.sub.S 4 38651 A.sub.E
.sup.MeC.sub.E A.sub.E .sup.MeC.sub.E .sup.MeC.sub.E A.sub.E
T.sub.E T.sub.E G.sub.E U.sub.S C.sub.S A C.sub.S A C.sub.S T
C.sub.S C.sub.S 4 38652 .sup.MeC.sub.E A.sub.E A.sub.E A.sub.E
.sup.MeC.sub.E A.sub.E C.sub.S C A.sub.S T T G U.sub.S C.sub.S A
C.sub.S A C.sub.S T C.sub.S C.sub.S 5 38660 .sup.MeC.sub.E A.sub.E
A.sub.E A.sub.E .sup.MeC.sub.E A.sub.E C.sub.S C A.sub.S T T G
U.sub.S C.sub.S A C.sub.S A C.sub.S T C.sub.S C.sub.S T.sub.E 6
38872 C.sub.S C A U.sub.S T G U.sub.S C.sub.S A C.sub.S A C.sub.S T
C.sub.S C.sub.S A 3 38910 .sup.MeC.sub.E C.sub.S A U.sub.S T G
U.sub.S C.sub.S A C.sub.S A C.sub.S T C.sub.S C.sub.S A.sub.E 3
[0471] Sugar moieties are indicated as follows: nucleosides not
followed by a subscript indicate .beta.-D-deoxyribonucleosides;
nucleosides followed by a subscript "E" indicate 2'-MOE
nucleosides; nucleosides followed by a subscript "S" indicate S-cEt
nucleosides; nucleosides followed by a subscript "L" indicate LNA
nucleosides. Each internucleoside linkage is a phosphorothioate
internucleoside linkage. Superscript "Me" indicates a 5-methyl
group on the base of the nucleoside.
Potency
[0472] In vitro and in vivo Potency
[0473] An in vitro luciferase assay was used to measure the ability
of each compound to inhibit the activity of miR-122 in cell
culture. In this assay, a microRNA luciferase sensor construct was
engineered to contain multiple miR-122 binding sites fused to a
luciferase gene. When miR-122 binds to its targetsites in the
luciferase sensor construct, luciferase expression is suppressed.
When an active anti-miR-122 compound is introduced into the cells,
it binds to miR-122 and relieves suppression of luciferase
expression. Thus, in this assay anti-miR-122 compounds that are
effective inhibitors of the miR-122 will cause an increase in
luciferase expression.
[0474] The luciferase sensor construct, and a second construct
expressing miR-122, were introduced into Hela cells. Anti-miR-122
compounds were transfected into the cells at several different
concentrations. Compounds with an EC.sub.50 of less than 100 nM
were subjected to an additional luciferase assay, at a broader
range of anti-miR concentrations than in the initial luciferase
assay, to confirm activity. Compounds were tested in two separate
experiments, as indicated in Table B. The mean EC50 for each
compound is shown in Table B. The results demonstrate that
alterations to sugar moiety or nucleobase can impact in vitro
potency of an anti-miR-122 compound.
TABLE-US-00013 TABLE B Mean EC50 in the luciferase cell culture
assay Luciferase Compound SEQ ID Experiment Mean # Sequence and
Chemistry NO # EC.sub.50 38011
C.sub.SCAU.sub.STG.sub.SU.sub.SCAC.sub.SAC.sub.STC.sub.SC.sub.SA 3
1 38.45 38012
C.sub.SCA.sub.STTGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.SA 3
1 43.78 38013
C.sub.SCAU.sub.STG.sub.STC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.SA 3
1 53.27 38014
C.sub.SCAU.sub.STG.sub.SU.sub.SCAC.sub.SAC.sub.STC.sub.SC.sub.SA.sub-
.E 3 1 42.71 38015
.sup.MeC.sub.SCAT.sub.STG.sub.ST.sub.SCA.sup.MeC.sub.SA.sup.MeC.sub.-
ST.sup.MeC.sub.S.sup.MeC.sub.SA.sub.E 3 1 42.40 38016
.sup.MeC.sub.SCAT.sub.STGT.sub.S.sup.MeC.sub.SA.sup.MeC.sub.SA.sup.M-
eC.sub.ST.sup.MeC.sub.S.sup.MeC.sub.SA.sub.E 3 1 14.07 38021
.sup.MeC.sub.LCAT.sub.LTGT.sub.L.sup.MeC.sub.LAMeC.sub.LA.sup.MeC.su-
b.LT.sup.MeC.sub.L.sup.MeC.sub.LA.sub.E 3 1 11.18 38872
C.sub.SCAU.sub.STGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.SA 3
2 18.3 38910
.sup.MeCC.sub.SAU.sub.STGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub-
.SA.sub.E 3 Not tested 38646
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.ECA.sub.STTGU.sub.SC.sub.SA-
C.sub.SAC.sub.STC.sub.SC.sub.S 4 2 77.15 38647
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.E.sup.MeC.sub.EA.sub.STTGU.-
sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S 4 2 57.44 38648
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.E.sup.MeC.sub.EA.sub.ETTGU.-
sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S 4 2 97.68 38649
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.E.sup.MeC.sub.EA.sub.ET.sub-
.ETGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S 4 2 46.76 38650
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.E.sup.MeC.sub.EA.sub.ET.sub-
.ET.sub.EGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S 4 2 28.16
38651
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.E.sup.MeC.sub.EA.sub.ET.sub-
.ET.sub.EG.sub.EU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S 4 2
26.12 38652
.sup.MeC.sub.EA.sub.EA.sub.EA.sub.E.sup.MeC.sub.EA.sub.EC.sub.SCA.su-
b.STTGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S 5 2 31.86 38659
C.sub.SCA.sub.STTGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.ST.sub-
.E 10 2 130.01 38660
.sup.MeC.sub.EA.sub.EA.sub.EA.sub.E.sup.MeC.sub.EA.sub.EC.sub.SCA.su-
b.STTGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.ST.sub.E 6 2
17.02
[0475] To determine in vivo potency, certain compounds were
evaluated for their ability to de-repress the expression of liver
aldolase A (ALDOA), a gene that is normally suppressed by miR-122
activity. Inhibition of miR-122 leads to an increase in ALDOA
expression, thus ALDOA mRNA levels can be used to measure miR-122
inhibitory activity in vivo. Compounds were administered to mice in
a single dose at the amounts indicated in Table C, and after 7 days
the study was terminated, and ALDOA mRNA levels were measured, by
quantitative PCR, in RNA isolated from liver. Except for compound
38910, each compound in Table C was tested in the same study. The
fold change in ALDOA mRNA, relative to saline, was calculated to
determine in vivo potency ("ND" indicates "not determined).
TABLE-US-00014 TABLE C Comparison of anti-miR-122 compound
structure and potency Fold change in ALDOA relative to saline
Compound Sequence and Chemistry SEQ 1 3 10 # ID mg/kg mg/kg mg/kg
38011
C.sub.SCAU.sub.STG.sub.SU.sub.SCAC.sub.SAC.sub.STC.sub.SC.sub.SA 3
1.47 2.10 3.89 38012
C.sub.SCA.sub.STTGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.SA 3
1.79 4.69 4.57 38013
C.sub.SCAU.sub.STG.sub.STC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.SA 3
1.31 1.61 2.55 38014
C.sub.SCAU.sub.STG.sub.SU.sub.SCAC.sub.SAC.sub.STC.sub.SC.sub.SA.sub-
.E 3 1.16 1.82 2.94 38015
.sup.MeC.sub.SCAT.sub.STG.sub.ST.sub.SCA.sup.MeC.sub.SA.sup.MeC.sub.-
ST.sup.MeC.sub.S.sup.MeC.sub.SA.sub.E 3 1.43 1.64 1.82 38016
.sup.MeC.sub.SCAT.sub.STGT.sub.S.sup.MeC.sub.SA.sup.MeC.sub.SA.sup.M-
eC.sub.ST.sup.MeC.sub.S.sup.MeC.sub.SA.sub.E 3 1.43 2.34 4.18 38021
.sup.MeC.sub.LCAT.sub.LTGT.sub.L.sup.MeC.sub.LA.sup.MeC.sub.LA.sup.M-
eC.sub.LT.sup.MeC.sub.L.sup.MeC.sub.LA.sub.E 3 1.46 3.01 3.91 38872
C.sub.SCAU.sub.STGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.SA 3
1.80 4.04 4.89 38910
.sup.MeCC.sub.SAU.sub.STGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub-
.SA.sub.E 3 ND 2.35 3.26
[0476] As can be seen in Table C, single changes in the placement
of a sugar moiety or nucleobase can have an impact on in vivo
potency. For example, the only difference between 38872 and 38011
is the placement of a cEt sugar moiety, however the in vivo potency
of 0011 is significantly lower than that of 38872, with a
comparable level of ALDOA de-repression reached only at the higher
dose of 10 mg/kg of 38011 compared to the 3 mg/kg dose for compound
38872. Compound 38021, relative to 38016, has LNA in place of cEt
sugar moieties, and has a similar potency to 38016, thus this
difference did not impact potency. Of this group of compounds,
compounds 38012, 38016, 38021 and 38872 were identified as active
compounds.
[0477] Additional studies were performed to evaluate certain
additional anti-miR-122 compounds. The results of these studies are
shown in Table D. Compounds 38646, 38647, 38648, 38649, 38650,
38651, and 38652 were tested together in one in vivo study, and
compounds 38659 and 38660 were tested together in another in vivo
study.
TABLE-US-00015 TABLE D Comparison of anti-miR-122 compound
structure and potency Fold change in ALDOA relative to Luciferase
saline Compound SEQ mean 3 10 # Sequence and Structure ID EC.sub.50
mg/kg mg/kg 38646
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.ECA.sub.STTGU.sub.SC.sub.SA-
C.sub.SAC.sub.STC.sub.SC.sub.S-- 4 77.15 ND ND 38647
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.E.sup.MeC.sub.EA.sub.STTGU.-
sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S-- 4 57.44 2.61 4.81
38648
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.E.sup.MeC.sub.EA.sub.ETTGU.-
sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S-- 4 97.68 3.28 4.36
38649
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.E.sup.MeC.sub.EA.sub.ET.sub-
.ETGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S-- 4 46.76 2.84
4.46 38650
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.E.sup.MeC.sub.EA.sub.ET.sub-
.ET.sub.EGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S-- 4 28.16
1.51 2.03 38651
A.sub.E.sup.MeC.sub.EA.sub.E.sup.MeC.sub.E.sup.MeC.sub.EA.sub.ET.sub-
.ET.sub.EG.sub.EU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S-- 4
26.12 1.26 1.46 38652
.sup.MeC.sub.EA.sub.EA.sub.EA.sub.E.sup.MeC.sub.EA.sub.EC.sub.SCA.su-
b.STTGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.S-- 5 31.86 1.86
4.27 38659
C.sub.SCA.sub.STTGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.ST.sub-
.E 10 130.01 4.44 4.82 38660
.sup.MeC.sub.EA.sub.EA.sub.EA.sub.E.sup.MeC.sub.EA.sub.EC.sub.SCA.su-
b.STTGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.ST.sub.E 6 17.02
3.84 4.44
[0478] As above, these data illustrate that single changes to the
placement of a sugar moiety can have a substantial impact on in
vivo potency. Further, it is shown that in vitro and in vivo
potency are not necessarily correlated. For example, compound 38659
has a low in vitro potency, but is a very potent inhibitor of
miR-122 in vivo.
[0479] Comparisons of the anti-miR-122 compound structures and in
vivo potency revealed an 11 nucleoside core sequence common to a
group of active anti-miR-122. This core sequence, where B-D-deoxy
sugar moieties and bicyclic sugar moieties are in the same position
on the anti-miR-122 nucleotide sequence, is boxed in Table D-2. The
nucleobase sequence of the 11 nucleoside core is complementary to
nucleobases 2 to 12 of miR-122 (SEQ ID NO: 1).
[0480] These data illustrate the discovery of a certain core
nucleoside pattern that yields a potent inhibitor of miR-122 in
vivo.
HCV Replicon Studies
[0481] An HCV replicon assay was used to determine the ability of
an anti-miR-122 compound to inhibit the replication of HCV,
including parent HCV genotypes and HCV genotypes with mutations
that confer resistance to anti-viral agents. Compound 38649 was
tested in this assay, to determine its ability to inhibit the
replication of HCV sub-genomic replicons of genotype 1a (H77
strain), genotype 1b, and several variants of genotype 1b (A156T,
A156S, D168a, and V36M).
[0482] For this assay, the cell line used was the cell line ET, a
Huh7 human hepatoma cell line that contains a subgenomic replicon
of HCV with a stable luciferase reporter and three cell
culture-adaptive mutations (luc-ubi-neo/ET). The luciferase
reporter is used as an indirect measure of HCV replication. The HCV
replicon antiviral evaluation assay examined the effects of the
compound at six half-log concentrations of each compound. Human
interferon alpha-2b was included as a positive control compound.
Sub-confluent cultures of the ET line were plated into 96-well
plates and the next day anti-miR-122 compound was transfected into
the cells with cationic lipid. Cells were processed 72 hours later
when the cells were still sub-confluent. HCV replicon levels were
assessed as HCV RNA replicon-derived luciferase activity. The
EC.sub.50 (concentration at which 50% inhibition was observed) was
calculated for each HCV genotype, and is shown in Table E. The
selectivity index (SI.sub.50, a ratio of the EC.sub.50 for viral
replication to the EC.sub.50 for innate cytotoxicity) was also
calculated and is shown in Table E.
TABLE-US-00016 TABLE E Anti-Viral Activity of Compound 38649
Antiviral Selectivity Activity EC.sub.50 Index HCV Genotype (nM)
SI.sub.50 HCV Genotype 1b 57.8 nM 4.0 HCV Genotype 1b variant V36M
139.6 nM >2.0 HCV Mutant A156S 45.9 nM 5.7 HCV Mutant A156T 26.7
nM 10.0 HCV Mutant D168A 16.2 nM 12.0 HCV Genotype 1a (H77 strain)
14.1 nM 15.0
[0483] The results from the replicon assay demonstrate anti-viral
activity of compound 38649 against multiple HCV genotypes. The
anti-viral activity was sustained for the period of time for which
the assay was performed (18 days). The activity of compound 38649
is similarly robust against HCV replicons comprising mutations
known to be resistant to certain protease inhibitors prescribed to
treat HCV infection.
Single Dose Studies of Anti-miR-122
[0484] Compound 38649 was tested in a single dose study in mice, to
determine the onset of action, maximal target derepression, and
duration of action, at doses ranging from 0.3 mg/kg to 30 mk/kg. An
ED.sub.50 was also calculated from this study.
[0485] Anti-miR compound was administered intraperitoneally to
groups of 5 mice each, at doses of 0.3, 1.0, 3.0, 10, and 30 mg/kg.
For the 0.3 and 1.0 doses, groups of animals were sacrified at days
3, 7, and 28. For the 3.0, 10 and 30 mg/kg doses, groups of animals
were sacrified at days 3, 5, 7, 14, 21, and 2838649. ALDOA mRNA
levels in liver were measured by quantitative PCR, and compared to
ALDOA mRNA levels in liver of saline-treated mice, to calculate the
fold change in ALDOA expression.
[0486] As shown in FIG. 1A, ALDOA derepression was observed as
early as day 3 and maintained for more than 28 days after dosing of
compound 38649. Maximal target derepression was achieved at 10
mg/kg. An ED.sub.50 of 6.7 mg/kg was calculated from the day 7 data
(FIG. 1B).
Physicochemical Characteristics
[0487] Evaluation of physicochemical characteristics may include:
measurement of viscosity, to determine whether a solution of the
anti-miR is suitable for administration via certain types of
parenteral administration, for example subcutaneous administration;
calculation of anti-miR half life in liver, to estimate the
frequency at which the anti-miR-122 compound could be administered
in human subjects; and metabolic stability assay, to identify
compounds which may be susceptible to cleavage by nucleases.
[0488] Metabolic stability was evaluated by incubating anti-miR-122
compound with non-human primate liver lysate. Nuclease activity in
the liver tissue homogenate was confirmed by using reference
oligonucleotides, which included a compound with known resistance
to nuclease activity, a compound susceptible to 3'-exonuclease
activity, and a compound susceptible to endonuclease activity. An
internal standard compound was used to control for extraction
efficiency. At the 0 hour and 24 hour time points, each sample was
subjected to high-performance liquid chromatography time-of-flight
mass spectrometry (HPLC-TOF MS) to measure oligonucleotide lengths
and amounts. The percentage loss is determined by comparing the
amount of full-length compound at the 0 hour and 24 hour time
points. Compounds 38646, 38647, 38648, 38649, 38650, 38651, 38652,
38659, and 38660 exhibited a percentage loss of 10% or less at the
24 hour time point. Compound 38012 exhibited a percentage loss of
approximately 50% at the 24 hour time point.
[0489] An additional single dose study was performed in mice, to
estimate the half-life of compound 38649. The half-life in liver
was estimated to be at least two weeks.
Safety
[0490] To assess various safety parameters, an in vivo study in
rodents was performed for certain of the compounds described
herein, to evaluate the potential the compounds to trigger a
pro-inflammatory response. Parameters assessed included changes in
organ weights, such as spleen weight and liver weight, and the
expression of interferon-inducible genes, such as IFIT and OASL, in
the liver. Serum chemistries were also evaluated. Additionally, for
certain compounds, safety parameters were evaluated in non-human
primates and included hematological endpoints, serum chemistry,
organ weights, coagulation, complement activation,
cytokine/chemokine changes, and pro-inflammatory gene
expression.
[0491] While the tested compounds exhibited some variability
amongst the saftety parameters evaluated, several of the compounds,
including compound 38649, were found to have particularly suitable
safety profiles.
Example 2
Conjugated Anti-miR-122 Modified Oligonucleotides
[0492] Anti-miR-122 modified oligonucleotides were conjugated to a
GalNAc-containing moiety, to determine whether the conjugation
would improve the potency of the oligonucleotides.
[0493] GalNAc-containing compounds were formed by conjugating the
structure in FIG. 2 to the 3' end of the 38649 modified
oligonucleotide. The linkage between the GalNAc-containing moiety
and the 3'- end of 38649 varied, as shown in Table F-1. For
example, in compound 38368, the GalNAc-containing moiety is linked
directly to the 3'-terminal nucleoside of 38649 through a
phosphodiester linkage, as shown in FIG. 3C, where X is a
phosphodiester linkage and MO is compound 38649. In compound 38458,
the GalNAc-containing moiety is linked to the 3'-terminal
nucleoside of 38649 through a .beta.-D-deoxynucleoside, with a
phosphorothioate linkage between the 3'-terminal nucleoside of
38649 and a phosphodiester linkage between the
.beta.-D-deoxynucleoside and the GalNAc-containing moiety, as shown
in FIG. 3A, where X.sub.2 is a phosphorothioate linkage, m is 1,
N.sub.m is a .beta.-D-deoxynucleoside, X.sub.1 is a phosphodiester
linkage, and MO is compound 38649.
TABLE-US-00017 TABLE F-1 GalNAc-containing compounds Com- pound #
Compound structure 38368 Structure III of FIG. 3C, where X is a
phosphodiester linkage and MO is compound 38649 38371 Structure III
of FIG. 3C, where X is a phosphorothioate linkage and MO is
compound 38649 38458 Structure I of FIG. 3A, where X.sub.2 is a
phophorothioate linkage, m is 1, N.sub.m is a
.beta.-D-deoxynucleoside, X.sub.1 is a phosphodiester linkage, and
MO is compound 38649 38459 Structure I of FIG. 3A, where X.sub.2 is
a phophodiester linkage, m is 1, N.sub.m is a
.beta.-D-deoxynucleoside (dA), X.sub.1 is a phosphodiester linkage,
and MO is compound 38649 38597 Structure I of FIG. 3A, where
X.sub.2 is a phosphothioate linkage, m is 1, N.sub.m is a
2'-O-methoxyethyl nucleoside, X.sub.1 is a phosphodiester linkage,
and MO is compound 38649 38598 Structure I of FIG. 3A, where
X.sub.2 is a phophorothioate linkage, m is 1, N.sub.m is a X.sub.1
is a phosphodiester linkage, and MO is compound 38649
[0494] The GalNAc-conjugated modified oligonucleotides were
assessed for in vivo potency, release of unconjugated modified
oligonucleotide from the GalNAc-conjugated modified
oligonucleotide, and liver and tissue concentration.
[0495] Potency studies were conducted according to the protocol
used to evaluate the unconjugated modified oligonucleotides,
described above. Compound was injected into mice, and in vivo
potency was assessed at day 7 by measuring the de-repression of
ALDOA. The dosages of conjugated compounds indicate the dosage of
modified oligonucleotide administered.
[0496] As shown in FIG. 4, each of the three GalNAc-conjugated
modified oligonucleotides tested was more potent than the
unconjugated modified oligonucleotide. Compounds 38368 and 38371
exhibited an increase in potency of approximately 3-fold, relative
to unconjugated 38649 (FIG. 4A). Compounds 38458 and 38459, each of
which has a .beta.-D-deoxyribonucleoside linking group, exhibited
at least a 10-fold increase in potency (FIG. 4B). Compounds 38597
and 38598, each of which has a 2'-sugar modified linking group,
also exhibited at least a 10-fold increase in potency (FIG. 4C). In
additional studies, potency increases of up to 20-fold have been
observed for compounds 38459, 38458, 38597, and 38598.
[0497] An additional experiment was conducted to include a wider
range of doses of compound 38459. Compound 38459 (n=6) or compound
38649 (n=3) was administered to mice, and ALDOA levels in liver and
cholesterol levels in blood were measured seven days later. Average
ALDOA and cholesterol levels were calculated and are shown in Table
F-2. As shown in Table F-2, a single, subcutaneous dose of compound
38459 exhibited increased potency relative to unconjugated compound
38649, with respect to increasing ALDOA levels and lowering
cholesterol levels. In this experiment, the calculated ED.sub.50
for compound 38459 was 0.19 mg/kg, and the calculated ED.sub.50 for
compound 38649 was 3.5 mg/kg (an 18-fold difference in
potency).
TABLE-US-00018 TABLE F-2 Increased potency of conjugated
anti-miR-122 compound ALDOA Cholesterol Compound Dose Fold change
mg/dL 38649 1.0 mg/kg 1.2 100.2 (unconjugated) 3.0 mg/kg 2.2 81.2
10 mg/kg 3.3 73.4 38459 0.03 mg/kg 1.1 95.4 (GalNAc- 0.1 mg/kg 1.7
84.4 conjugated) 0.3 mg/kg 2.8 74 1 mg/kg 3.5 59.2 3 mg/kg 3.8 61.8
10 mg/kg 3.8 61.4
[0498] Also measured was the amount of unconjugated modified
oligonucleotide in the liver and kidney tissue 7 days following a
single subcutaneous dose of compounds 38368 and 38371 at doses of 1
mg/kg and 3 mg/kg, and compounds 38458 and 38459 at doses of 0.3
mg/kg, 1 mg/kg, and 3 mg/kg. Each sample was subjected to
high-performance liquid chromatography time-of-flight mass
spectrometry (HPLC-TOF MS) to measure oligonucleotide lengths and
amounts. The lower limit of quantitation (LLOQ) by this method is
0.2-1.0 .mu.g/g.
[0499] The GalNAc-conjugated modified oligonucleotides were found
to have varying rates of formation of unconjugated modified
oligonucleotide. For example, following administration of compound
38368, less than 10% of compound 38649 (an unconjugated modified
oligonucleotide) is detected in the liver. Following administration
of compound 38371, compound 38649 was not detected in the liver at
either dose of compound 38371. Conversely, seven days following
subcutaneous administration of compound 38459, the only
unconjugated modified oligonucleotide species detected was
unconjugated 38649; the parent compound 38459 was not detected.
Following administration of compound 38458, unconjugated modified
oligonucleotide was detected in two forms: 38649, as well as
38649-PO-A (a metabolite of compound 38458). This metabolite was
was detected at higher levels than unconjugated 38649.
[0500] Also measured was the amount of unconjugated modified
oligonucleotide in the liver 24 hours following a single
subcutaneous dose of compounds 38458 and 38459 at doses of 0.3
mg/kg, 1 mg/kg, and 3 mg/kg. Anti-miR levels were measured by
LC-TOF. The lower limit of quantitation (LLOQ) by this method is
0.2-1.0 .mu.g/g. It was observed that following administration of
compound 38459, 90% of the total compound present in the liver was
unconjugated compound 38649. Following administration of 38458,
approximately 46% of total compound present in the liver was
unconjugated compound 38649. Thus, unconjugated compound 38649 is
released more rapidly from compound 38459 than from compound 38458.
These data suggest that the metabolism of the conjugated compound
is influenced by the attachment between the linker and the modified
oligonucleotide.
[0501] Oligonucleotides generally accumulate to the highest levels
in kidney tissue, followed by liver tissue. To determine whether
the GalNAc conjugate altered the accumulation of compound in liver
tissue compared to kidney tissue, relative to unconjugated
compound, the amount of unconjugated 38649 was also measured in the
kidney tissue. As described above, following administration of
compound 38459, 100% of the total compound found in the liver is
unconjuated 38649, indicating complete release of 38649 from the
GalNAc-conjugated compound 38459. Following administration of
compound 38459, compound 38649 accumulated less in the kidney
compared to the liver, (i.e. exhibited a lower kidney:liver ratio),
relative to accumulation of compound 38649 following administration
of compound 38649. Thus, compound 38459 can preferentially deliver
compound 38649 to the liver, while minimizing delivery to the
kidney, as compared to unconjugated 38649.
[0502] The onset and duration of action for compound 38459 was
evaluated in an in vivo study. Groups of mice were given a single,
subcutaneous (SC) dose of compound 38459 at 0.1 mg/kg, 0.3 mg/kg, 1
mg/kg, and 3 mg/kg. An additional group of mice was administered
compound 38649 at a dose of 10 mg/kg. A group of animals from each
treatment was sacrificed on each of days 1, 2, 3, 4, 5, 6, 14, 21,
28, and 56. RNA was isolated from liver and ALDOA mRNA levels were
measured by real-time PCR. The mean ALDOA level for each group was
calculated. The fold change relative to the control group
(PBS-treated) is shown in Table G.
TABLE-US-00019 TABLE G Onset and duration of action of compound
38459 Days following Fold change in ALDOA single 38459 38459 38459
38459 38649 SC dose 3 mg/kg 1 mg/kg 0.3 mg/kg 0.1 mg/kg 10 mg/kg 1
4.9 3.6 1.7 1.4 2.2 2 4.2 3.2 2.4 1.4 4.7 3 4.4 4.6 3.5 1.6 3.4 4
5.1 4.9 3.3 2.2 4.6 5 5.9 4.9 3.9 2.1 4.5 6 5.1 4.5 3.2 2.2 3.6 14
4.8 4.3 3.4 1.7 3.1 21 5.9 4.9 4.0 2.2 3.6 28 4.8 4.7 2.9 2.0 4.2
56 5.6 4.6 2.6 1.7 3.2
[0503] The data in Table G demonstrate that compound 38459, as well
as compound 38649, has a rapid onset of action, as evidenced by
ALDOA derepression as early as 1 day following a single dose of
compound. Further, ALDOA derepression is maintained for at least 8
weeks following a single dose of compound.
[0504] These data demonstrate that the GalNAc-conjugated compound
38459, which is at least 10-fold more potent than the unconjugated
38649 compound, achieves this potency at significantly lower liver
tissue concentrations, with preferential delivery to the liver
tissue. Additionally, compound 38459 exhibits a rapid onset of
action, and a duration of action of at least 8 weeks.
[0505] Also tested were LNA-containing unconjugated and conjugated
modified oligonucleotides, shown in Table H.
TABLE-US-00020 TABLE H LNA-containing compounds SEQ ID Compound #
Sequence (5' to 3') and Modifications Structure NO 36848
C.sub.LCA.sub.LTTG.sub.LT.sub.LCAC.sub.LAC.sub.LTC.sub.LC.sub.L,
Unconjugated 7 36852
C.sub.LCA.sub.LTTG.sub.LT.sub.LCAC.sub.LAC.sub.LTC.sub.LC.sub.L
Conjugated as in 7 Structure III of FIG. 3C, where X is PO and MO
is 36848 36632
C.sub.LCA.sub.LTTG.sub.LT.sub.LCAC.sub.LAC.sub.LTC.sub.LC.sub.L
Conjugated as in 7 Structure I of FIG. 3A, where X.sub.2 is a
phophodiester linkage, m is 1, N.sub.m is a .beta.-D-
deoxynucleoside (dA), X.sub.1 is a phosphodiester linkage, and MO
is compound 36848
[0506] Sugar and linkage moietes are indicated as follows: where
nucleosides not followed by a subscript indicate
.beta.-D-deoxyribonucleosides; nucleosides followed by a subscript
"L" indicate LNA nucleosides; and each internucleoside linkage is a
phosphorothioate internucleoside linkage.
[0507] Compounds 36848 and 36852 were tested for in vivo potency
according to the same protocol as described above, to evaluate the
ability of the compounds to inhibit miR-122 activity and increase
ALDOA expression. While each compound was a potent inhibitor of
miR-122, the GalNAc-conjugated compound 36852 exhibited greater
potency than unconjugated compound 36848 (approximately 3-fold
greater).
[0508] Compound 36632 was also tested for in vivo potency in a
single dose administration study, following a similar protocol as
described above, at doses of 0.03 mg/kg, 0.1 mg/kg, 0.3 mg/kg, 1.0
mg/kg, 3.0 mg/kg, and 10.0 mg/kg. Compound 36632 demonstrated fold
increases in ALDOA expression of 1.6, 2.7, 3.7, 4.3, 4.7, 6.0,
respectively, relative to PBS-treated control. Compound 36848, at
doses of 1.0 mg/kg, 3.0 mg/kg, and 10 mg/kg resulted in fold
increases in ALDOA expression of 1.6, 2.5, and 5.3, respectively. A
comparison of compound 36632 to compound 36848 revealed an increase
in potency of approximately 30-fold for the conjugated compound,
relative to the unconjugated compound.
Example 3
Mouse Model of HCV Infection
[0509] Due to host-pathogen specificity, HCV can only infect humans
and chimpanzees. As such, smaller species, such as mice, that are
typically used for experimental in vivo studies cannot be infected
with HCV for testing of candidate agents for the treatment of HCV
infection. To address this problem, human liver chimeric mouse
models may be utilized (see, e.g., Bissig et al., Proc Natl Acad
Sci USA, 2007, 104:20507-20511; Bissig et al., J Clin Invest.,
2010, 120: 924-930). In this model, the livers of immunodeficient
mice are repopulated with human hepatocytes, resulting in a
chimeric liver in which most of the hepatocytes are human
hepatocytes. The mice are then infected with HCV and treated with
anti-HCV agents. This mouse model is commercially available from,
for example, PhoenixBio.
[0510] Anti-miR-122 compounds are tested in mice with human
chimeric livers that have been infected with HCV. Groups of animals
(n=5-10) receive one or more doses of anti-miR-122 compound, e.g.,
at a dose identified from the treatment regimen study. For
pharmacokinetic analyses and measurement of HCV RNA levels, plasma
is collected at various timepoints. Liver tissue is collected when
the study is terminated.
[0511] In some embodiments, inhibition of miR-122 is confirmed by
measuring human ALDOA mRNA levels. It is expected that
administration of an anti-miR-122 compound reduces HCV RNA levels
in the serum of the mouse.
Example 4
HCV RNA Level Reduction in Response to miR-122 Inhibition
[0512] A human chimeric mouse liver model was used to evaluate the
effects of miR-122 inhibition on miR-122 target gene expression and
HCV viral titer.
Human Chimeric Liver Mice
[0513] The effects of miR-122 inhibition on target gene expression
were evaluated in human chimeric liver mice without HCV infection.
Groups of mice (n=6) were treated with a single dose of PBS, 0.3
mg/kg, 1.0 mg/kg, 3.0 mg/kg, or 10 mg/kg of compound 38459. Seven
days following treatment, the study was terminated and liver tissue
was collected for measurement of ALDOA expression and compound
tissue concentration. ALDOA mRNA levels were increased relative to
ALDOA mRNA levels in PBS-treated mice, however the derepression of
ALDOA expression was 3-fold to 5-fold less than that observed in
wild-type mice. Compound 38459 levels were approximately 3-fold
lower in chimeric liver mice, relative to concentrations in
wild-type mice. These observations are consistent with the reduced
expression of the asialoglycoprotein receptor (ASGPR) in the human
chimeric liver mice, relative to wild-type mice. As the
accumulation of compound in the liver cell is dependent upon uptake
by the ASGPR, a reduced expression of ASGPR would be expected to
result in reduced accumulation of GalNAc-conjugated modified
oligonucleotide, and consequently reduced sensitivity to the
ability of compound 38459 to de-repress endogenous targets of
miR-122, such as ALDOA. Accordingly, the human chimeric liver mouse
model may underpredict the activity of compound 38459 in a subject
where ASGPR expression is maintained. Preliminary data suggest that
ASGPR expression is maintained at similar levels in livers of
HCV-infected patients relative to livers of non-HCV infected
subjects.
Treatment of HCV-Infected Human Chimeric Liver Mice
[0514] Anti-miR-122 compounds were tested in a human chimeric liver
mouse model of HCV infection.
[0515] The livers of immunodeficient mice were repopulated with
human hepatocytes, resulting in a chimeric liver in which most of
the hepatocytes are human hepatocytes. Approximately 3.5 weeks
following inoculation with HCV genotype 1a, mice with an HCV RNA
level of >1.times.10.sup.6 copies/ml were selected for inclusion
in this study (Day -7).
[0516] For a single week study, a group of 3 animals was treated
with a single 10 mg/kg dose of 38459 on Day 0. Blood was collected
on Day -7, 0, 3, and 7. The study was terminated on day 7, when in
addition to blood, liver tissue and kidney tissue were collected.
In this study, HCV RNA levels were reduced at Days 3 and 7.
[0517] For a multiple week study, groups of 5 animals each were
treated as follows: PBS (n=5); 3 mg/kg 38459 (n=5); 10 mg/kg 38459
(n=4-5); or 30 mg/kg 38459 (n=4-5). An additional group of animals
was treated with 10 mg/kg unconjugated compound 36848 (n=5).
Treatment was administered as a single, subcutaneous injection on
Day 0. Blood was collected on Days -7, 0, 3, 7, 10, 14, 17, 21, 24,
28, and 35. HCV RNA levels in blood were measured by real-time PCR
according to routine methods, and are shown in Table I. Unless
otherwise indicated, each treatment group contained 5 animals As
shown in Table I, HCV RNA levels were signficantly reduced as early
as Day 3 in the groups treated with 10 mg/kg or 30 mg/kg of
compound 38459, which reduction was sustained through at least Day
35. Statistical significance was calculated by 2 way ANOVA analysis
of mean HCV RNA levels in compound-treated animals, normalized to
mean HCV RNA levels in PBS-treated animals In this study,
unconjugated compound 36848 did not reduce HCV RNA levels. These
results are also illustrated in graphic form in FIG. 5A.
TABLE-US-00021 TABLE I GalNAc-conjugated anti-miR-122 reduces HCV
titer PBS 36848 38459 38459 38459 Day Average 10 mg/kg 3 mg/kg 10
mg/kg 30 mg/kg -7 2.66E+08 2.90E+08 2.54E+08 2.76E+08 2.60E+08 0
2.08E+08 2.92E+08 3.26E+08 2.38E+08 2.70E+08 3 1.97E+08 3.20E+08
2.90E+08 8.10E+07* 4.76E+07**** 7 1.65E+08 3.26E+08 1.76E+08
3.16E+07**** 1.22E+07**** 10 1.59E+08 2.74E+08 1.21E+08
2.70E+07**** 7.52E+06**** 14 1.19E+08 2.02E+08 9.34E+07
2.37E+07**** 4.82E+06**** 17 1.67E+08 2.10E+08 9.68E+07
2.94E+07**** 4.89E+06**** 21 1.49E+08 2.36E+08 9.72E+07
3.06E+07**** 7.65E+06**** (n = 4) 24 1.43E+08 2.14E+08 8.46E+07
3.35E+07**** 7.95E+06**** (n = 4) 28 1.43E+08 1.63E+08 8.48E+07
4.16E+07*** 1.13E+07**** (n = 4) 31 1.37E+08 1.99E+08 9.22E+07
5.18E+07* 1.98E+07**** (n = 4) (n = 4) 35 1.44E+08 1.88E+08
1.03E+08 5.80E+07* 2.35E+07**** (n = 4) (n = 4) ****p < .0001;
***p < 0.0005; *p < 0.05
[0518] These results demonstrate that, following a single
administration of GalNAc-conjugated modified oligonucleotide 38459,
HCV viral titer was significantly reduced in HCV-infected animals,
with an early onset and sustained duration of action.
[0519] An additional study was performed to evaluate the effects of
compound 38459 in the human chimeric liver mouse model of HCV
infection, where the mice are infected with HCV genotype 3a. Groups
of 5 animals each were treated as follows: PBS (n=4); 10 mg/kg
38459 (n=5); or 30 mg/kg 38459 (n=5). Mice were inoculated with HCV
genotype 3a. Seven days prior to treatment, blood was collected
from mice for measurement of viral titer. Treatment was
administered as a single, subcutaneous injection on Day 0. Blood
was collected on Days 0, 3, 7, 10, 14, 17, 21, 24, and 28 following
treatment. HCV RNA levels in blood were measured by real-time PCR
according to routine methods. As shown in FIG. 5B, HCV RNA levels
were signficantly reduced early as Day 3 in the groups treated with
10 mg/kg or 30 mg/kg of compound 38459, and this reduction was
sustained through at least Day 28.
[0520] Also observed was a substantial reduction in steatosis in
the livers of the mice treated with compound 38459. The reduced
steatosis was observed in mice infected with HCV, and in uninfected
mice, suggesting that inhibition of miR-122 can reduce steatosis
both in the presence and absence of HCV infection.
Example 5
Conjugated Shorter Modified Oligonucleotides
[0521] GalNAc-containing compounds were formed by conjugating a
structure in FIG. 3 to the 3' end of the modified oligonucleotides
shown in Table J. Sugar moieties, internucleoside linkages, and
nucleobases are indicated as follows: nucleosides not followed by a
subscript are .beta.-D-deoxyribonucleosides; nucleosides followed
by a subscript "S" are S-cEt nucleosides; and each internucleoside
linkage is a phosphorothioate internucleoside linkage.
TABLE-US-00022 TABLE J Unconjugated and Conjugated Modified
Oligonucleotides SEQ ID Sequence and Modifications Structure NO
38591 U.sub.STGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.SA.sub.S
Unconjugated 8 38633
U.sub.STGU.sub.SC.sub.SAC.sub.SAC.sub.STC.sub.SC.sub.SA.sub.S
Structure I of FIG. 3A, where X.sub.2 is a 8 phophodiester linkage,
m is 1, N.sub.m is a .beta.-D- deoxynucleoside (dA), X.sub.1 is a
phosphodiester linkage 38998
C.sub.SA.sub.SC.sub.SA.sub.SC.sub.SU.sub.SC.sub.SC.sub.S
Unconjugated 9 38634
C.sub.SA.sub.SC.sub.SA.sub.SC.sub.SU.sub.SC.sub.SC.sub.S Structure
I of FIG. 3A, where X.sub.2 is a 9 phophodiester linkage, m is 1,
N.sub.m is a .beta.-D- deoxynucleoside (dA), X.sub.1 is a
phosphodiester linkage
[0522] To determine in vivo potency, the compounds were evaluated
for their ability to de-repress the expression of liver aldolase A
(ALDOA). Compounds were administered to mice, and ALDOA mRNA levels
were measured, by quantitative PCR, in RNA isolated from liver. The
fold change in ALDOA mRNA, relative to saline, was calculated to
determine in vivo potency (FIGS. 6A and 6B and 7A and 7B). The ED50
(concentration of compound at which ALDOA derepression is 50% of
maximum) and ED90 (concentration of compound at which ALDOA
deprepression is 90% of maximum) calculated from the results of
those experiments are shown in Table K and L.
TABLE-US-00023 TABLE K In vivo potency of conjugated and
unconjugated anti-miR-122 compounds ED50 Fold ED90 Fold Compound
(mg/kg) change (mg/kg) change Experiment 1 (FIG. 6A) 38634 0.03 456
0.3 212 38998 13.7 63.8 Experiment 2 (FIG. 6B) 38634 0.04 290 0.43
99.3 38998 11.6 42.7
TABLE-US-00024 TABLE L In vivo potency of conjugated and
unconjugated anti-miR-122 compounds ED50 Fold ED90 Fold Compound
(mg/kg) change (mg/kg) change Experiment 1 (FIG. 7A) 38633 0.08 27
0.25 26 38591 2.2 6.62 Experiment 2 (FIG. 7B) 38633 0.15 20 0.94 10
38591 3.0 8.9
[0523] As shown in Table K, GalNAc conjugation according to the
present invention improved the ED.sub.50 and ED.sub.90 of an 8-mer
anti-miR-122 compound by at least 100-fold. As shown in Table L,
GalNAc conjugation according to the present invention improved the
ED.sub.50 and ED.sub.90 of a 13-mer anti-miR-122 compound by at
least 10-fold.
[0524] Derepression of another miR-122 target gene, CD320, was also
determined for compounds 38634 and 38998. The results were similar
to the results obtained for ALDOA shown in Table K: GalNAc
conjugation according to the present invention improved the
ED.sub.50 by 343-fold and 272-fold in experiments 1 and 2,
respectively, and improved the ED.sub.90 by 492-fold and 545-fold
in experiments 1 and 2, respectively.
[0525] GalNAc conjugation described herein also improved
cholesterol-lowering potency was also observed for the compounds
comprising GalNAc. Exemplary results from experiment 1 are shown in
FIGS. 8A and 8B. Compounds 38633 and 38634, which are GalNAc
conjugates, were more potent than compounds 38591 and 38998, which
lack GalNAc Similar results were obtained for experiment 2 (data
not shown).
Example 6
Pharmacodynamic Activity of Anti-miR-122 Compounds in Non-Human
Primates
[0526] Anti-miR-122 compounds were tested in normal non-human
primates (cynomolgus monkeys). A single dose of GalNAc-conjugated
compound 38459 or unconjugated compound 38649 was administered
subcutaneously (n=3 for each compound). PBS was administered as a
control treatment (n=5). On day 4 and day 8 following
administration of compound, liver tissue was collected, and RNA was
isolated for measurement of ALDOA levels. Total cholesterol in
blood was measured on day 8. As shown in Table L, ALDOA
derepression is observed at day 4 and day 8, at each dose of
compound 38459, including the lowest dose of 1 mg/kg. Cholesterol
lowering was also observed with the lowest dose of compound 38459.
Thus, GalNAc-conjugated compound 38459 is significantly more potent
in non-human primates, relative to unconjugated compound 38649.
Additionally, both compounds have a duration of action of at least
one week following a single dose in non-human primates.
TABLE-US-00025 TABLE L Inhibition of miR-122 in non-human primates
ALDOA ALDOA Cholesterol (Day 4) (Day 8) (Day 8) Treatment fold
change fold change mg/dL PBS 1.0 95.3 38649, 100 mg/kg 3.4 4.0 67.0
38459, 1 mg/kg 5.0 3.9 64.3 38459, 10 mg/kg 3.0 3.6 66.7 38459, 100
mg/kg 4.0 4.1 65.3
Example 7
Pharmacokinetic Activity of Conjugated Anti-miR-122 Compounds
[0527] The plasma and tissue pharmacokinetics of anti-miR-122
compounds were evaluated in mice and non-human primates.
[0528] A single, subcutaneous dose of compound 38649 or
GalNAc-conjugated compound 38459 was administered to CD-1 mice.
Blood was collected a multiple time points over a 24 hour period
following administration, and the total amount of compound in the
blood was measured by hybridization-based ELISA.
[0529] A single, subcutaneous dose of compound 38649 or
GalNAc-conjugated compound 38459 was administered to non-human
primates. Blood was collected at multiple time points over a 24
hour period following administration, and the total amount of
compound in the blood was measured by LC-MS.
[0530] As shown in FIG. 9, in mouse (FIG. 9A) and non-human
primates (FIG. 9B), GalNAc-conjugated compound 38459 is cleared
more rapidly from plasma, compared to unconjugated compound 38649.
Following administration of GalNAc-conjugated compound 38459,
unconjugated compound 38649 is not detected, indicating that
conjugated compound 38459 is not metabolized in the blood (data not
shown)
[0531] In this study, tissue levels of compounds were also measured
in the liver and kidney of mice (Table M) and non-human primates
(Table N).
TABLE-US-00026 TABLE M Compound tissue levels in mice 24 hours
after single dose Compound Administered: 38459 (+GalNAc) 38649
Tissue: Com- Kidney Liver Kidney Liver pound Mean Mean K/L Mean
Mean K/L Dose detected (.mu.g/g) (.mu.g/g) Ratio (.mu.g/g)
(.mu.g/g) Ratio 1 mg/kg 38649 1.1 5.7 0.19 18.4 4 4.6 Total 1.1 7.4
0.15 compound 3 mg/kg 38649 8.2 15.8 0.52 83.9 10.8 7.6 Total 16.8
27.7 0.61 compound
TABLE-US-00027 TABLE N Compound tissue levels in non-human primates
72 hours after single close Compound Administered: 38459 (+GalNAc)
38649 Tissue: Liver Com- Kidney Liver Kidney Mean pound Mean Mean
K/L Mean (.mu.g/ K/L Dose detected (.mu.g/g) (.mu.g/g) Ratio
(.mu.g/g) g) Ratio 1 mg/kg 38649 5.6 27.2 0.21 Total 31.3 34 0.92
compound 10 mg/kg 38649 124 148 0.84 283.3 61.2 4.6 Total 513.5
186.3 2.7 compound 100 mg/kg 38649 374.1 418.8 0.89 1430 242.3 5.9
Total 2129.1 547.2 3.9 compound
[0532] Following administration, compound 38459 is rapidly
metabolized to unconjugated compound 38649 in liver and kidney.
Additionally, consistent with the data from the mouse study
described above, the kidney to liver ratio of compound 38459 is
significantly lower than that of compound 38649.
[0533] Based on the concentration of compound in the liver 24 hours
following administration, it was estimated that approximately 6
.mu.g/g of GalNAc-conjugated compound 38459 and approximately 30
.mu.g/g of unconjugated compound 38459 results in 90% maximal
potency at day 7 (as measured by ALDOA derepression). Thus,
compound 38459 results in greater potency at a lower liver tissue
concentration, relative to unconjugated compound 38649.
[0534] These data demonstrate that in non-human primates and mice,
conjugation to a GalNAc-containing moiety results in significantly
enhanced delivery of modified oligonucleotide to the liver.
Further, a low ED.sub.50 coupled with a lower kidney to liver ratio
suggests that GalNAc-conjugated compound 38459 may have a high
therapeutic index.
Example 8
Toxicology and Safety Studies of Anti-miR-122 Compounds
[0535] Multiple studies were conducted in mice, rodents and
non-human primates, to evaluate the safety and tolerability of
GalNAc-conjugated compound 38459.
[0536] For example, compound 38459 was evaluated in a
pro-inflammatory study in rats. Male Sprague Dawley rats were
administered a single, subcutaneous dose of compound 38459. At day
14 following administration, expression of ALDOA and CXCL13 (an
interferon-inducible gene) was measured in liver.
[0537] As shown in Table O, no increase in CXCL13 expression was
detected at a dose as high as 100 mg/kg, while ALDOA levels were
elevated starting at the 1 mg/kg dose. A known inflammatory
anti-miR-122 compound was also tested, and resulted in increases of
CXCL13 levels of 2- to 2.5-fold at the 10, 30 and 100 mg/kg
doses.
TABLE-US-00028 TABLE O Compound 38459 does not increase
pro-inflammatory gene expression Dose of compound ALDOA CXCL13
38459 Fold-change Fold-change 0.1 mg/kg 1.2 1.4 0.3 mg/kg 1.6 1.6 1
mg/kg 2.5 1.5 3 mg/kg 2.9 0.8 10 mg/kg 2.8 0.6 30 mg/kg 3.2 0.8 100
mg/kg 3.4 0.7
[0538] Additional toxicology studies were conducted in mice and
non-human primates (cynomolgus monkeys), and no significant adverse
effects were observed at therapeutically relevant doses.
Example 9
Conjugated Shorter Modified Oligonucleotides
[0539] Cholesterol-containing compounds were formed by conjugating
cholesterol to the 3' end of the modified oligonucleotides shown in
Table P. Sugar moieties, internucleoside linkages, and nucleobases
are indicated as follows: nucleosides not followed by a subscript
are .beta.-D-deoxyribonucleosides; nucleosides followed by a
subscript "S" are S-cEt nucleosides; and each internucleoside
linkage is a phosphorothioate internucleoside linkage, except the
internucleoside linkages indicated by subscript (O), which are
phosphodiester linkages.
TABLE-US-00029 TABLE P Unconjugated and Conjugated Modified
Oligonucleotides Sequence and SEQ ID Modifications Structure NO
38998 C.sub.SA.sub.SC.sub.SA.sub.SC.sub.SU.sub.SC.sub.SC.sub.S
Unconjugated 9 38070
C.sub.SA.sub.SC.sub.SA.sub.SC.sub.SU.sub.SC.sub.SC.sub.S
##STR00038## 9 MO is
C.sub.SA.sub.SC.sub.SA.sub.SC.sub.SU.sub.SC.sub.SC.sub.S
[0540] To determine in vivo potency, the compounds were evaluated
for their ability to de-repress the expression of liver aldolase A
(ALDOA). Compounds were administered to mice, and ALDOA mRNA levels
were measured, by quantitative PCR, in RNA isolated from liver. The
fold change in ALDOA mRNA, relative to saline, was calculated to
determine in vivo potency. The ED50 (concentration of compound at
which ALDOA derepression is 50% of maximum) and ED90 (concentration
of compound at which ALDOA deprepression is 90% of maximum)
calculated from the results of those experiments are shown in Table
Q.
TABLE-US-00030 TABLE Q In vivo potency of conjugated and
unconjugated anti-miR-122 compounds ED50 Fold ED90 Fold Compound
(mg/kg) change (mg/kg) change 38070 0.08 78.8 1.27 31.6 38998 6.3
40.1
[0541] As shown in Table Q, cholesterol conjugation according to
the present invention improved the ED.sub.50 and ED.sub.90 of an
8-mer anti-miR-122 compound by at least 30-fold.
[0542] Derepression of another miR-122 target gene, CD320, was also
determined for compounds 38070 and 38998. The results were similar
to the results obtained for ALDOA (data not shown).
[0543] Cholesterol conjugation described herein also improved
cholesterol-lowering potency. At most concentrations tested,
compound 38070 reduced cholesterol to a greater extent than the
same concentration of compound 38998 (data not shown).
[0544] Various modifications of the invention, in addition to those
described herein, will be apparent to those skilled in the art from
the foregoing description. Such modifications are also intended to
fall within the scope of the appended claims. Each reference
(including, but not limited to, journal articles, U.S. and non-U.S.
patents, patent application publications, international patent
application publications, GENBANK.RTM. accession numbers, and the
like) cited in the present application is specifically incorporated
herein by reference in its entirety.
Sequence CWU 1
1
10122RNAHomo sapiens 1uggaguguga caaugguguu ug 22285RNAHomo sapiens
2ccuuagcaga gcuguggagu gugacaaugg uguuuguguc uaaacuauca aacgccauua
60ucacacuaaa uagcuacugc uaggc 85316DNAArtificial sequenceSynthetic
3ccattgtcac actcca 16418DNAArtificial sequenceSynthetic 4acaccattgt
cacactcc 18521DNAArtificial sequenceSynthetic 5caaacaccat
tgtcacactc c 21622DNAArtificial sequenceSynthetic 6caaacaccat
tgtcacactc ct 22715DNAArtificial sequenceSynthetic 7ccattgtcac
actcc 15813DNAArtificial sequenceSynthetic 8ttgtcacact cca
1398DNAArtificial sequenceSynthetic 9cacactcc 8 1016DNAArtificial
sequenceSynthetic 10ccattgtcac actcct 16
* * * * *
References