U.S. patent application number 16/127638 was filed with the patent office on 2019-05-02 for targeting the steroidogenic pathway for treating and/or preventing allergic diseases.
The applicant listed for this patent is National Jewish Health. Invention is credited to Erwin W. Gelfand, Yi Jia, Meiqin Wang.
Application Number | 20190127740 16/127638 |
Document ID | / |
Family ID | 51208174 |
Filed Date | 2019-05-02 |
View All Diagrams
United States Patent
Application |
20190127740 |
Kind Code |
A1 |
Gelfand; Erwin W. ; et
al. |
May 2, 2019 |
Targeting the Steroidogenic Pathway For Treating and/or Preventing
Allergic Diseases
Abstract
The present invention relates to methods and compositions for
treating and/or preventing allergic diseases or conditions by
inhibiting one or more components of the steroidogenic pathway.
Inventors: |
Gelfand; Erwin W.; (Cherry
Hills Village, CO) ; Wang; Meiqin; (Glendale, CO)
; Jia; Yi; (Centennial, CO) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
National Jewish Health |
Denver |
CO |
US |
|
|
Family ID: |
51208174 |
Appl. No.: |
16/127638 |
Filed: |
September 11, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15348345 |
Nov 10, 2016 |
10100309 |
|
|
16127638 |
|
|
|
|
14160747 |
Jan 22, 2014 |
9534221 |
|
|
15348345 |
|
|
|
|
61755311 |
Jan 22, 2013 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 31/444 20130101;
C12N 2310/14 20130101; A61P 37/00 20180101; C12Y 114/15006
20130101; C12N 15/1137 20130101; A61K 31/451 20130101; C12N
2310/531 20130101; A61K 31/58 20130101; Y10S 514/826 20130101; A61K
31/7105 20130101; C12N 2310/11 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; A61K 31/451 20060101 A61K031/451; A61K 31/7105
20060101 A61K031/7105; A61K 31/444 20060101 A61K031/444; A61K 31/58
20060101 A61K031/58 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] This invention was made with Government support under grant
numbers P01 HL 036577, and RO1 AI-77609, awarded by the National
Institutes of Health. The Government of the United States has
certain rights in the invention.
Claims
1. A method of treating or preventing an allergic disease in a
subject who has, or is at risk of developing an allergic disease,
comprising administering to the subject a therapeutically effective
amount of a steroidogenic pathway inhibitor.
2. The method of claim 1, wherein the allergic disease is selected
from the group consisting of an allergic lung disease,
allergen-induced airway hyperresponsiveness, allergen-induced
inflammation, rhinitis, asthma, allergic rhinitis, food allergy,
eosinophilic esophagitis, chronic urticaria, atopic dermatitis,
occupational allergy, allergic conjunctivitis, hay fever, airborne
allergic sensitivities, stinging insect allergy, hypersensitivity
pneumonitis, eosinophilic lung diseases, inflammatory bowel
disease, ulcerative colitis, and Crohn's disease.
3. The method of claim 2, wherein the allergic disease is caused by
one or more proteinaceous allergens.
4. The method of claim 1, wherein the subject has been sensitized
to an allergen or is at risk of becoming exposed to an
allergen.
5. (canceled)
6. (canceled)
7. The method of claim 1, wherein the steroidogenic pathway
inhibitor is selected from the group consisting of an antibody, an
antisense molecule, an siRNA molecule, an shRNA molecule, a
receptor antagonist, a chemical entity, a nucleotide, a peptide,
and a protein.
8. The method of claim 7, wherein the steroidogenic pathway
inhibitor inhibits one or more enzymes, receptors or protein
by-products of the steroidogenic pathway.
9. The method of claim 8, wherein the steroidogenic pathway
inhibitor inhibits cytochrome P450 family 11 subfamily A
polypeptide 1 (Cyp11A1).
10. The method of claim 9, wherein the steroidogenic pathway
inhibitor is selected from the group consisting of
aminoglutethimide or a Cyp11A1 siRNA and a Cyp11A1 shRNA
molecule.
11. The method of claim 8, wherein the steroidogneic pathway
inhibitor inhibits 3.beta.HSD.
12. The method of claim 11, wherein the steroidogenic pathway
inhibitor is trilostane.
13. The method of claim 8, wherein the steroidogneic pathway
inhibitor inhibits cytochrome P450 family 11 subfamily .beta.
polypeptide 1 (Cyp11.beta.1).
14. The method of claim 13, wherein the steroidogenic pathway
inhibitor is metyrapone.
15. A method of inhibiting T-cell pro-allergic differentiation in a
subject comprising administering to the subject a therapeutically
effective amount of a steroidogenic pathway inhibitor.
16. The method of claim 15, wherein the T-cell pro-allergic
differentiation is CD4+ T-cells to Th2 and Th17 cell
differentiation.
17. The method of claim 15, wherein the T-cell pro-allergic
differentiation is CD8+ T-cells to Tc2 cell differentiation.
18. The method of claim 15, wherein the T-cell pro-allergic
differentiation is IL4-induced conversion of CD8+ T-cells into
IL-13 secreting cells.
19. The method of claim 15, wherein the T-cell pro-allergic
differentiation is IL-4 induced conversion of CD4+ T-cells into
IL-13 secreting cells.
20. The method of claim 15, wherein the subject has an allergic
disease selected from the group consisting of a allergic lung
disease, allergen-induced airway hyperresponsiveness,
allergen-induced inflammation, rhinitis, asthma, allergic rhinitis,
food allergy, eosinophilic esophagitis, chronic urticaria, atopic
dermatitis, occupational allergy, allergic conjunctivitis, hay
fever, airborne allergic sensitivities, stinging insect allergy,
hypersensitivity pneumonitis, eosinophilic lung diseases,
inflammatory bowel disease, ulcerative colitis, and Crohn's
disease.
21. (canceled)
22. (canceled)
23. (canceled)
24. The method of claim 15, wherein the steroidogenic pathway
inhibitor is selected from the group consisting of an antibody, an
antisense molecule, an siRNA molecule, a chemical entity, a
nucleotide, a peptide, and a protein.
25. The method of claim 24, wherein the steroidogenic pathway
inhibitor inhibits one or more enzymes or protein by-products of
the steroidogenic pathway selected from the group consisting of
Cyp11A1, 3.beta.HSD, and Cyp11.beta.1.
26-31. (canceled)
Description
CROSS REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation application of U.S.
application Ser. No. 15/348,345, filed Nov. 10, 2016, which is a
continuation application of U.S. application Ser. No. 14/160,747,
filed Jan. 22, 2014, now U.S. Pat. No. 9,534,221, which claims the
benefit of priority under 35 U.S.C. .sctn. 119(e) to U.S.
Provisional Patent Application Ser. No. 61/755,311, filed Jan. 22,
2013. U.S. application Ser. No. 15,348,345, U.S. application Ser.
No. 14/160,747 and U.S. Provisional Patent Application No.
61/755,311 are each incorporated herein by reference.
REFERENCE TO A SEQUENCE LISTING
[0003] This application contains a Sequence Listing submitted
electronically as a text file by EFS-Web. The text file, named
"Seq_Listing_2879-126_ST25", has a size in bytes of 1 KB, and was
recorded on Jan. 22, 2014. The information contained in the text
file is incorporated herein by reference in its entirety pursuant
to 37 CFR .sctn. 1.52(e)(5).
FIELD OF INVENTION
[0004] The present invention generally relates to methods and
compositions for treating and/or preventing allergic diseases or
conditions by inhibiting one or more components of the
steroidogenic pathway including but not limited to proteins,
enzymes, receptors, and protein by-products of the steroidogenic
pathway.
BACKGROUND OF THE INVENTION
[0005] Steroid hormones, including glucocorticoids (GCs), play an
important role in the regulation of the immune system (Chrousos, G.
P., N. Engl. J. Med. 332, 1351-1362 (1995)). Endogenous
glucocorticoid synthesis is controlled by the
hypothalamic-pituitary-adrenal axis (Chrousos, G. P., N. Engl. J.
Med. 332, 1351-1362 (1995); Rhen, T., & Cidlowski, J. A., N.
Engl. J. Med. 353, 1711-1723 (2005)) and is regulated by the
transcriptional control of steroidogenic enzymes of the cytochrome
P450 gene family (Mueller, M., et al. J. Exp. Med. 203, 2057-2062
(2006)). Corticosteroids have been used in treating allergic
diseases due to their anti-inflammatory activity (Barnes, P J. Br.
J. Pharmacol. 163:29-43 (2011)), but, somewhat paradoxically,
increasing evidence indicates that corticosteroids may also enhance
disease pathogenesis by activating and enhancing growth of CD4 T
cells and inhibiting Th1 cytokine production (Cima, I., Fuhrer, A.,
& Brunner, T. Immunol. Lett. 106, 99-102 (2006)).
Glucocorticoids amplified immune responses in steroid-insensitive
CD8.sup.+ T cells (Ohnishi, H., et al. J. Allergy Clin. Immunol.
121, 864-871 (2008)). As well, the corticosteroids themselves may
induce Th2 cytokine production while simultaneously suppressing the
production of Th1 cytokines (Koya, T. et al. J. Immunol. 179,
2787-2796 (2007)).
[0006] The inhibitory role of GCs on immune cells is well
characterized (De Bosscher, K., et al. Endocr. Rev. 24, 488-522
(2003); De Bosscher, K, & Haegeman, G. Mol. Endocrinol. 23,
281-291 (2009)). GCs reduce inflammation through inhibition of
NF-.kappa.B and by inducing the expression of anti-inflammatory
proteins including annexin 1 and MAPK phosphatase 1 (Chrousos, G.
P. N. Engl. J. Med. 332, 1351-1362 (1995)). GCs and other synthetic
derivatives have been used to treat a variety of diseases,
including inflammatory diseases of the intestine and asthma
(Barnes, P J. Br. J. Pharmacol. 163:29-43 (2011); Faubion, W. A.
Jr., et al. Gastroenterology 121, 255-260 (2001)). Although the
anti-inflammatory activity of GCs is well described, accumulating
evidence suggests that GCs can also enhance immune cell activation,
inducing gene transcription and promoting the pathogenesis of
allergic diseases (Cima, I., et al. J. Exp. Med. 200, 1635-1646
(2004); Ohnishi, H., et al. J. Allergy Clin. Immunol. 121, 864-871
(2008)). Steroid hormones are mainly produced in the adrenal
glands, but other tissues also produce GCs through the induction of
steroidogenic enzymes (Chrousos, G. P. N. Engl. J. Med. 332,
1351-1362 (1995); Payne, A. H. Biol. Reprod. 42, 399-404 (1990)).
The intestinal mucosa contains steroidogenic enzymes such as
cytochrome P450, family 11, subfamily A, polypeptide 1 (Cyp11a1)
and synthesizes potent GCs which exhibit both an inhibitory and a
co-stimulatory role on intestinal T cell activation (Cima, I., et
al. J. Exp. Med. 200, 1635-1646 (2004)).
[0007] Cyp11a1 (also known as P450scc) is a key regulator of
steroid biogenesis as the first and rate-limiting enzyme in the
steroidogenic pathway, converting cholesterol to pregnenolone
(Pazirandeh, A., et al. FASEB J. 13, 893-901 (1999)). Induction of
the Cyp11a1 promoter by epidermal growth factor involves a
ras/MEK1/AP-1-dependent pathway (Croft, M. et al. J. Exp. Med. 180,
1715-1728 (1994)). Cyp11a1 is expressed primarily in the cortex of
the adrenal gland, but testis, ovary, placenta, thymus, and
intestine also express Cyp11a1 (Cima, I., et al. J. Exp. Med. 200,
1635-1646 (2004); Pazirandeh, A., et al. FASEB J. 13, 893-901
(1999)). Activation of Cyp11a1 results in a spectrum of steroid
hormones, including glucocorticoids that are known to play a role
in T cell function (Mosmann, T. R., and Coffman, R. L. Annu. Rev.
Immunol. 7, 145-173 (1989); Seder, R. A. et al. J. Immunol. 148,
1652-1656 (1992)). Several of the gonadal steroids have been shown
to have important immune effects on T cells that express their
cognate receptors. T cells express receptors for androgen and
estrogen and receptor activation can impact cytokine gene
transcription. These studies have related gender bias to
differences in the response of CD4, CD8, and T regulatory cells (De
Bosscher, K., et al. Endocr. Rev. 24, 488-522 (2003); De Bosscher,
K, & Haegeman, Mol. Endocrinol. 23, 281-291 (2009)). T cells
also express many of the steroid metabolic enzymes (De Bosscher,
K., et al. Endocr. Rev. 24, 488-522 (2003)). Depletion of Cyp11a1
in mice or rabbits results in steroid deficiency, female external
genitalia, and death (Shih, M. C., et al. Mol. Cell. Endocrinol.
336, 80-84 (2011); Pang, S., et al. Endocrinology 131, 181-186
(1992); Yang, X., et al. Endocrinology 132, 1977-1982 (1993)). In
humans, mutations in the Cyp11a1 gene result in a steroid hormone
deficiency, causing a rare and potentially fatal form of lipoid
congenital adrenal hyperplasia (Kim, C. J., et al. J. Clin.
Endocrinol. Metab. 93, 696-702 (2008); Al Kandari, H., et al. J.
Clin. Endocrinol. Metab. 91, 2821-2826 (2006)). Patients with a
heterozygous or homozygous mutation of Cyp11a1 exhibit adrenal
insufficiency and sex reversal (Tajima, T., et al. J. Clin.
Endocrinol. Metab. 86, 3820-3825 (2001); Parajes, S., et al. J.
Clin. Endocrinol. Metab. 96, E1798-E1806 (2011)).
[0008] Transcription factors such as Steroidogenic Factor-1 (SF-1),
Activator Protein 2 (AP-2), and several tissue-specific GATA family
proteins enhance the transcription of Cyp11a1 through interactions
with AP-1, specificity Protein-1 (SP-1) and AP-2 (National Asthma
Education and Prevention Program (National Heart Lung and Blood
Institute) Third Expert Panel on the Management of Asthma. National
Center for Biotechnology Information (U.S.). Expert panel report 3
guidelines for the diagnosis and management of asthma. Bethesda,
Md.: National Institutes of Health National Heart Lung and Blood
Institute; 2007). In particular, the GATA protein family plays an
important role in the regulation of Cyp11a1 expression (Barnes, P
J. Br. J. Pharmacol. 163:29-43 (2011)). GATA binding elements have
been identified in the Cyp11a1 promoter and Cyp11a1 expression was
decreased in GATA3-deficient mice (Wei, G., et al. Immunity 35,
299-311 (2011)). GATA4 significantly upregulated Cyp11a1 expression
in granulosa cells (Sher, N., et al. Mol. Endocrinol. 21, 948-962
(2007)). These results identify important events in the
transcriptional regulation of Cyp11a1 that directly affect steroid
synthesis and release.
[0009] CD4 Th cells play a pivotal role in the induction and
control of allergic inflammation, including food allergy (Islam, S.
A., & Luster, A. D. Nature Med. 18, 705-715 (2012)). In a mouse
model of food allergy, allergen-specific CD4 T cells were activated
in the mesenteric lymph nodes and recruited to the small intestine,
resulting in increased levels of Th2 cytokines in the inflamed
small intestine (Knight, A. K., et al. Am. J. Physiol.
Gastrointest. Liver Physiol. 293, G1234-G1243 (2007)).
[0010] In humans, allergen-specific Th2 CD4 T cells are essential
in the development and maintenance of both type I IgE-mediated and
non-IgE-mediated food allergic responses. In patients with
anaphylactic peanut allergy, increased numbers of peanut-specific
IL-5- and IL-4-producing Th2 cells are found in peripheral blood
(Prussin, C., et al. J. Allergy Clin. Immunol. 124, 1326-1332
(2009)). In addition, peanut-specific T cell lines from individuals
with peanut anaphylaxis primarily produce Th2 cytokines (IL-4,
IL-13) (DeLong, J. H., et al. J. Allergy Clin. Immunol. 127,
1211-1218 (2011)). Other food allergies were also characterized by
increased levels of Th2 cytokines; in patients with milk-induced
gastrointestinal diseases, milk-specific CD4 T cells derived from
the duodenal mucosa produce high levels of Th2 cytokines,
especially IL-13 (Beyer, K., et al. J. Allergy Clin. Immunol. 109,
707-713 (2002)).
[0011] Allergic asthma is a heterogeneous inflammatory disorder of
the airways characterized by chronic airway inflammation and airway
hyperresponsiveness (AHR) (Kim, H. Y., et al. Nat. Immunol. 11,
577-584 (2011); Holgate, S. T. Nat Med. 18, 673-683 (2012)).
Numbers of CD8.sup.+IL-13.sup.+T cells are increased in asthmatics
(Gelfand, E. W. and Dakhama, A. J. Allergy Clin. Immunol. 117,
577-582 (2006)) and during the development of experimental asthma
in mice (Hamelmann, E. et al. J. Exp. Med. 183, 1719-1729 (1996);
Miyahara, N. et al. J. Immunol. 172, 2549-2558 (2004); Miyahara, N.
et al. J. Immunol. 174, 4979-4984 (2005)). In an atopic environment
rich in IL-4, these CD8.sup.+ T cells mediate asthmatic responses
(Koya, T. et al. J. Immunol. 179, 2787-2796 (2007)). However, the
mechanisms regulating the conversion of CD8.sup.+ effector T cells
from IFN-.gamma. to pathogenic IL-13-producing effector cells have
not been defined.
[0012] Asthma has increased dramatically over the past 50 years and
now affects 5-10% of the population in many developed countries
(Kim, H. Y., et al. Nat. Immunol. 11, 577-584 (2011)). National and
international guidelines recommend the use of inhaled
corticosteroids as the first step in controlling airway
inflammation and symptoms in persistent asthma (Holgate, S. T. Nat
Med. 18, 673-683 (2012); Gelfand, E. W. and Dakhama, A. J. Allergy
Clin. Immunol. 117, 577-582 (2006)). However, it has been
demonstrated that 45% of steroid-naive asthmatic patients do not
respond to inhaled corticosteroids. Corticosteroid insensitivity
has been adopted as a principal criterion for characterizing asthma
severity (Hamelmann, E. et al. J. Exp. Med. 183, 1719-1729 (1996)).
Increased numbers of CD8.sup.+ T cells, which are more resistant
than CD4.sup.+ T cells to corticosteroids (Miyahara, N. et al. J.
Immunol. 172, 2549-2558 (2004); Miyahara, N. et al. J. Immunol.
174, 4979-4984 (2005)), have been detected in steroid-insensitive
asthmatics (Koya, T. et al. J. Immunol. 179, 2787-2796 (2007)) and
have correlated with lower lung function (LaVoie, H. A. and King,
S. R. Exp. Biol. Med. 234, 880-907 (2009)). The inventors and
others also found that numbers of CD8.sup.+IL-13.sup.+ cells were
increased in experimental asthma models in mice (Shih, M. C. et al.
Mol. Endocrinol. 22, 915-923 (2008); National Asthma Education and
Prevention Program (National Heart Lung and Blood Institute) Third
Expert Panel on the Management of Asthma. National Center for
Biotechnology Information (U.S.). Expert panel report 3 guidelines
for the diagnosis and management of asthma. Bethesda, Md.: National
Institutes of Health National Heart Lung and Blood Institute; 2007,
Guidelines for the diagnosis and management of asthma. Bethesda,
Md.: National Institutes of Health National Heart Lung and Blood
Institute; 2007) as a result of their activation by IL-4-producing
CD4.sup.+ T cells (Martin, R. J. et al. J. Allergy Clin. Immunol.
119, 73-80 (2007)). CD8.sup.+ T cells can be polarized to effector
subsets with cytokine profiles similar to those found in CD4.sup.+
T cells (Li, L. B. et al. Blood 110, 1570-1577 (2007); Payne, A. H.
Biol. Reprod. 42, 399-404 (1990); van Rensen, E. L. et al. Am. J.
Respir. Crit. Care Med. 172, 837-841 (2005)). Both in vivo and in
vitro, IL-4 is capable of triggering CD8.sup.+ T cell
differentiation from a predominant IFN-.gamma.-producing cell to
one producing IL-13. However, the mechanisms underlying this
conversion of CD8.sup.+ T cells is unknown.
[0013] Transcriptional profiling identified Cyp11a1 transcripts as
one of the most highly up-regulated during the differentiation of
CD8.sup.+ T lymphocytes to a Tc2 phenotype, that is, a CD8 T cell
capable of IL-13 production. This upregulation of Cyp11a1 in
CD8.sup.+ T cells is similar to the upregulation seen in CD4.sup.+
T cells in a peanut allergy model, suggesting that this enzyme is
essential in CD4.sup.+ and CD8.sup.+ T cells for pro-allergic
differentiation.
[0014] CD4.sup.+ T cell differentiation into Th2 cells with
production of IL-4, IL-5, IL-9, and IL-13 has been shown to be
critical for the development of altered airway responsiveness and
eosinophilic airway inflammation in experimental models of asthma
(Samy, T. S. et al. Endocrinology 142, 3519-3529 (2001); Pottratz,
S. T. et al. J. Clin. Invest. 93, 944-950 (1994)). In addition to
CD4.sup.+ T cells, CD8.sup.+ T cells can be polarized to effector
subsets with cytokine profiles similar to those found in CD4.sup.+
T cells (Payne, A. H. Biol. Reprod. 42, 399-404 (1990); van Rensen,
E. L. et al. Am. J. Respir. Crit. Care Med. 172, 837-841 (2005)).
It has been previously demonstrated that there is an important role
for type 2 (Tc2) CD8.sup.+ T cells in the development of
experimental asthma (Slominski, A. et al. FEBS J. 273, 2891-2901
(2006)) as a result of their activation by IL-4-producing CD4.sup.+
T cells (Martin, R. J. et al. J. Allergy Clin. Immunol. 119, 73-80
(2007)). Increased expression of BLT1 (leukotriene B4 receptor) on
the surface of CD8.sup.+ T cells leads to their increased
accumulation in the lungs (Guidelines for the diagnosis and
management of asthma. Bethesda, Md.: National Institutes of Health
National Heart Lung and Blood Institute; 2007). Both human
(Miyahara, N. et al. J. Immunol. 172, 2549-2558 (2004)) and mouse
(Miyahara, N. et al. J. Immunol. 174, 4979-4984 (2005)) CD8.sup.+ T
cells demonstrate an insensitivity to corticosteroids not seen in
CD4.sup.+ T cells, supporting the notion that CD8.sup.+ T cells are
at the root of the failure of asthmatics to respond to
corticosteroids and may be responsible for persistent AHR and
inflammation (Koya, T. et al. J. Immunol. 179, 2787-2796 (2007)).
In asthmatics, numbers of CD8.sup.+ T cells in the airways have
correlated with lower airway function (LaVoie, H. A. and King, S.
R. Exp. Biol. Med. 234, 880-907 (2009)).
[0015] Current therapies for allergic asthma have been fairly
restricted with few new drugs introduced into the clinic in the
last decade. Inhaled corticosteroids have remained the main
anti-inflammatory agent for asthma. Indeed, upwards of 40-50% of
asthmatics fail to respond to inhaled corticosteroids with changes
in FEV1 (Hamelmann, E. et al. J. Exp. Med. 183, 1719-1729 (1996)).
Moreover, corticosteroids may also enhance disease pathogenesis,
especially amplifying responses in the steroid-insensitive
population of CD8.sup.+ T cells (Miyahara, N. et al. Nature Med.
10, 865-869 (2004)). Corticosteroids may induce Th2 cytokine
production while suppressing the production of Th1 cytokines. A
combination of steroid insensitivity and plasticity of CD8.sup.+ T
cells may be major contributors to the failure of some patients to
respond to corticosteroids. CD8.sup.+BLT1.sup.+IL-13.sup.+
CD8.sup.+ T cells have been proposed to be a primary cause of the
airway inflammation and hyperresponsiveness seen in asthma
(National Asthma Education and Prevention Program (National Heart
Lung and Blood Institute) Third Expert Panel on the Management of
Asthma. National Center for Biotechnology Information (U.S.).
Expert panel report 3 guidelines for the diagnosis and management
of asthma. Bethesda, Md.: National Institutes of Health National
Heart Lung and Blood Institute; 2007, Guidelines for the diagnosis
and management of asthma. Bethesda, Md.: National Institutes of
Health National Heart Lung and Blood Institute; 2007). However, the
mechanism underlying the conversion of CD8.sup.+ T cells from
IFN-.gamma.-producing cells to IL-13 producing cells remains
unclear.
SUMMARY OF THE INVENTION
[0016] One embodiment of the invention relates to a method of
treating or preventing an allergic disease in a subject who has, or
is at risk of developing an allergic disease, comprising
administering a therapeutically effective amount of a steroidogenic
pathway inhibitor.
[0017] In one aspect, the allergic disease can be selected from an
allergic lung disease, allergen-induced airway hyperresponsiveness,
allergen-induced inflammation, rhinitis, asthma, allergic rhinitis,
food allergy, eosinophilic esophagitis, chronic urticaria, atopic
dermatitis, occupational allergy, allergic conjunctivitis, hay
fever, airborne allergic sensitivities, stinging insect allergy,
hypersensitivity pneumonitis, eosinophilic lung diseases,
inflammatory bowel disease, ulcerative colitis, and Crohn's
disease.
[0018] In one aspect, the allergic disease is caused by one or more
proteinaceous allergens.
[0019] In another aspect, the subject has been sensitized to an
allergen or is at risk of becoming exposed to an allergen.
[0020] In one aspect, the food allergy is peanut allergy.
[0021] In yet another aspect, the allergic disease is an allergic
lung disease.
[0022] The steroidogenic pathway inhibitor can be selected from an
antibody, an antisense molecule, an siRNA molecule, an shRNA
molecule, a receptor antagonist, a chemical entity, a nucleotide, a
peptide, and a protein. In one aspect, the steroidogenic pathway
inhibitor inhibits one or more enzymes, receptors or protein
by-products of the steroidogenic pathway. In another aspect, the
steroidogenic pathway inhibitor inhibits cytochrome P450 family 11
subfamily A polypeptide 1 (Cyp11A1). In still another aspect, the
steroidogenic pathway inhibitor is aminoglutethimide or a Cyp11A1
siRNA or shRNA molecule. In yet another aspect, the steroidogneic
pathway inhibitor inhibits 3.beta.HSD. In still yet another aspect,
the steroidogenic pathway inhibitor is trilostane. In another
aspect, the steroidogneic pathway inhibitor inhibits cytochrome
P450 family 11 subfamily .beta. polypeptide 1 (Cyp11.beta.1). In
yet another aspect, the steroidogenic pathway inhibitor is
metyrapone.
[0023] Another embodiment of the invention relates to a method of
inhibiting T-cell pro-allergic differentiation in a subject
comprising administering a therapeutically effective amount of a
steroidogenic pathway inhibitor. In one aspect, the T-cell
pro-allergic differentiation is CD4+ T-cells to Th2 and Th17 cell
differentiation. In yet another aspect, the T-cell pro-allergic
differentiation is CD8+ T-cells to Tc2 cell differentiation. In
still another aspect, the T-cell pro-allergic differentiation is
IL4-induced conversion of CD8+ T-cells into IL-13 secreting cells.
In another aspect, the T-cell pro-allergic differentiation is IL-4
induced conversion of CD4+ T-cells into IL-13 secreting cells.
[0024] Various embodiments of the invention are described below.
However, the invention is not limited to embodiments described in
this summary, as inventions described in the description that
follows are also expressly encompassed.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] FIGS. 1A-D show Cyp11a1 expression in CD8.sup.+ T cells
generated in the presence of IL-2 or IL-2+IL-4. (A) Protocol for
differentiation of CD8.sup.+ T cells in IL-2 or IL-2+IL-4 in vitro.
(B) Cyp11a1 mRNA expression as detected by quantitative RT-PCR in
CD8.sup.+ T cells differentiated in IL-2 or IL-2+IL-4. (C) Cyp11a1
protein levels as detected by immunoblot analysis and densitometry
of autoradiographs in CD8.sup.+ T cells differentiated in IL-2 or
IL-2+IL-4. (D) Immunohistochemical staining for Cyp11a1 in
CD8.sup.+ T cells differentiated in IL-2 or IL-2+IL-4 in vitro
(.times.200). Quantitative analysis was performed by counting
Cyp11a1-positive cells under the microscope. Data (mean.+-.SEM) are
from at least 3 independent experiments. **p<0.01 compared to
the IL-2 group.
[0026] FIGS. 2A-C show Cyp11a1 enzymatic activity regulates the
functional conversion of CD8.sup.+ T cells from IFN-.gamma.- to
IL-13-producing cells. (A) Pregnenolone levels determined by ELISA
in supernatants from CD8.sup.+ T cells differentiated in IL-2 or
IL-2+IL-4 in the presence or absence of AMG (500 .mu.M).
**p<0.01 compared to the IL-2 group. ##p<0.01 compared to the
IL-2+IL-4 group. (B) Cyp11a1 protein levels detected by immunoblot
analysis and densitometry of autoradiographs in CD8.sup.+ T cells
differentiated in IL-2 or IL-2+IL-4 with 500 .mu.M AMG. **p<0.01
compared to the IL-2 group. ##p<0.01 compared to the
IL-2+SIINFEKL group. (C) Flow cytometric analysis of cytokine
expression in CD8.sup.+ T cells differentiated in IL-2 or IL-2+IL-4
and treatment with different concentrations of AMG. Data are from
at least 7 independent experiments.
[0027] FIGS. 3A-B show that a short hairpin RNA (shRNA) specific
for Cyp11a1 prevents the conversion of CD8.sup.+ T cells from
IFN-.gamma.- to IL-13-producing cells. (A) Representative flow
cytometric analysis of Cyp11a1 expression after transfection with
plasmids encoding a Cyp11a1 shRNA or a scrambled control shRNA. For
quantitative analysis of Cyp11a1-positive cells, data are from at
least 4 independent experiments. **p<0.01 compared to scramble
shRNA group. (B) Representative flow cytometric analysis of
cytokine expression in CD8.sup.+ T cells after transfection. For
quantitative analysis of Cyp11a1-positive cells, data are from at
least 3 independent experiments. **p<0.01 compared to scramble
shRNA group.
[0028] FIG. 4 shows the lineage specific transcription factor
expression in CD8.sup.+ T cells. T-bet and GATA3 expression
detected by quantitative RT-PCR in CD8.sup.+ T cells differentiated
in IL-2 or IL-2+IL-4 with or without SIINFEKL in the presence or
absence of 500 .mu.M AMG. Data (mean.+-.SEM) are from at least 8
independent experiments. **p<0.01 compared to the IL-2 group.
##p<0.01 compared to the IL-2+SIINFEKL group.
[0029] FIGS. 5A-F show the treatment of CD8-deficient recipients
with CD8.sup.+ T cells differentiated in IL-2 and AMG (500 .mu.M)
fails to restore AHR and inflammation. (A) Experimental protocol.
(B) Changes in airway resistance (RL). (C) Cell composition in BAL
fluid. (D) Cytokine levels in BAL fluid. (E) Representative
photomicrographs of lung histology (.times.200). Quantitative
analysis of goblet cells was as described in Materials and Methods.
(F) Quantitation of Cyp11a1-positive cells in the lung. Data
(mean.+-.SEM) were from at least 6-10 mice. *p<0.05, **p<0.01
compared to secondary challenged CD8-deficient recipients.
#p<0.05, ##p<0.01 compared to secondary challenged
CD8-deficient recipients of 5.times.10.sup.6 IL-2-differentiated
CD8.sup.+ T cells.
[0030] FIGS. 6A-D show Cyp11a1 is expressed in mouse jejunum. (A)
Protocol for induction of peanut allergy. (B) Cyp11a1 mRNA
expression detected by quantitative RT-PCR in peanut sensitized and
challenged vs. sham sensitized and peanut challenged mice. (C)
Representative immunohistochemical staining for Cyp11a1
(.times.200). (D) Quantitation of mucosal Cyp11a1-expressing cells.
Results were from 3 independent experiments; each experiment
included 4 mice per group (n=12). *P<0.05, **P<0.01. PBS/PE,
sham sensitized and peanut challenged; PE/PE, peanut sensitized and
challenged.
[0031] FIGS. 7A-C show the inhibition of Cyp11a1 enzymatic activity
does not impact levels of Cyp11a1 protein and mRNA expression in
the mouse jejunum. (A) Pregnenolone levels were assessed in serum
of mice. (B) Cyp11a1 mRNA expression in jejunum of mice treated
with AMG or vehicle. (C) Quantitation of mucosal Cyp11a1-expressing
cells. Results were from 3 independent experiments; each experiment
included 4 mice per group (n=12). *P<0.05, **P<0.01, n.s. not
significant. PBS/PE, sham sensitized and peanut challenged; PE/PE,
peanut sensitized and challenged; PE/PE/AMG 20 mg/kg, peanut
sensitized and challenged and treated with AMG at dose of 20
mg/kg.
[0032] FIGS. 8A-E show the inhibition of Cyp11a1 enzymatic activity
in vivo reduces intestinal responses. (A) Kinetics of development
of diarrhea after treatment with AMG (Cyp11a1 inhibitor) vs.
vehicle. (B) Scores based on the severity of clinical signs were
assessed 30 minutes after oral challenge. (C-D) Quantitation of
mucosal mast cell and goblet cell numbers in jejunum. (E) Plasma
histamine levels were assessed within 30 minutes of the last oral
challenge. Results were from 3 independent experiments; each
experiment included 4 mice per group. *P<0.05, **P<0.01,
#P<0.001.
[0033] FIGS. 9A-B show the effects of Cyp11a1 inhibition on
cytokine and lineage-specific transcription factor expression in
the mouse jejunum. (A) IFNG, IL4, IL13, and IL17A mRNA expression
in jejunum of mice treated with AMG or vehicle. (B) Th1, Th2, and
Th17 transcription factors T-bet, GATA3, and ROR.gamma.t expression
in jejunum of mice treated with AMG or vehicle. Results were from 3
independent experiments (n=12). *P<0.05, **P<0.01, n.s. not
significant.
[0034] FIGS. 10A-F show the inhibition of Cyp11a1 enzymatic
activity suppresses the differentiation of naive CD4 T cells into
Th2 and Th17 cells without affecting lineage-specific transcription
factor and Cyp11a1 expression. (A). Relative Cyp11a1 expression in
naive CD4 T cells differentiated in vitro into Th1, Th2, and Th17
cells from spleen of naive TCR-transgenic mice (OT II mice)
determined by real time PCR. (B). Cyp11a1 mRNA expression in
polarized CD4 T cells in the presence of AMG or vehicle. (C).
Western blot analysis of Cyp11a1 protein in polarized Th1, Th2, or
Th17 cells treated with AMG or vehicle. (D). Pregnenolone levels
were assessed in supernatants of cultured CD4 T cells under Th1,
Th2, and Th17 polarizing conditions. (E) Cytokine levels in
supernatants of cultured CD4 T cells treated with inhibitor or
vehicle under Th1, Th2, and Th17 polarizing conditions. (F) Th1,
Th2, and Th17 cytokine and lineage-specific transcription factor
mRNA expression in polarized Th1, Th2, or Th17 cells treated with
the inhibitor or vehicle. The data shown are from 3 independent
experiments. *P<0.05, **P<0.01, #P<0.001, n.s. not
significant.
[0035] FIGS. 11A-D shows shRNA-mediated silencing of Cyp11a1
regulates levels of IL-13 without affecting levels of GATA3
transcripts in Th2 T cells. (A) Cyp11a1 mRNA expression in
shRNA-transduced Th2 cells. (B) Pregnenolone levels were assessed
in supernatants of cultured Th2 cells transduced with Cyp11a1 or
luc shRNA. (C) Levels of IL4, IL13, and GATA3 mRNA expression in
cultured Th2 cells transduced with Cyp11a1 or luc shRNA. (D) Levels
of IL-4 and IL-13 in supernatants of cultured Th2 cells transduced
with Cyp11a1 or luc shRNA. Results were from 3 independent
experiments. *P<0.05, **P<0.01.
[0036] FIGS. 12A-E shows the decreased mast cell infiltration in
the intestinal wall of PE/PE mice treated with AMG. Intestinal
mucosa mast cells were quantified in jejunum using chloroacetate
esterase staining. Representative sections of (A) PBS/PE/vehicle
mice; (B) PE/PE/vehicle mice; (C) PE/PE/AMG (5 mg/kg) mice; (D)
PE/PE/AMG (10 mg/kg) mice; and (E) PE/PE/AMG (20 mg/kg) mice.
Magnification .times.400.
[0037] FIG. 13A-E shows the decreased numbers of goblet cells in
intestinal epithelium of sensitized and challenged mice treated
with AMG. Goblet cells were identified by PAS staining 24 hrs after
the last challenge. Representative sections of (A) PBS/PE/vehicle
mice, (B) PE/PE/vehicle mice, (C) PE/PE/AMG (5 mg/kg) mice, (D)
PE/PE/AMG (10 mg/kg) mice, and (E) PE/PE/AMG (20 mg/kg) mice.
Magnification .times.200.
[0038] FIG. 14A-B shows the treatment with AMG had no effect on
serum immunoglobulin production in peanut sensitized and challenged
mice. Serum levels of peanut-specific IgE (FIG. 14A), IgG1 (FIG.
14B), and IgG2a (FIG. 14B) were assessed by ELISA 24 hrs after the
last challenge and expressed as optical density of diluted serum as
described in Methods. Results were obtained from 3 individual
experiments with 4 mice per group. #P<0.001, "n.s." indicates
"not significant".
[0039] FIG. 15 shows a schematic representation of the major
mammalian steroidogenic pathway(s) (from Simard et al., Endocrine
Rev, June 2005, 26(4):525-82).
[0040] FIG. 16 shows an overview of steroidogenesis.
[0041] FIG. 17 shows representative photomicrographs of
immunohistochemical staining for Cyp11a1-positive cells in the lung
(.times.200). The lungs were from secondary challenged
CD8-deficient recipients, secondary challenged CD8-deficient
recipients of 5.times.10.sup.6 IL-2-differentiated CD8+ T cells,
and secondary challenged CD8-deficient recipients of
5.times.10.sup.6 IL-2-AMG-differentiated CD8+ T cells.
DETAILED DESCRIPTION OF THE INVENTION
[0042] This invention generally relates to methods for the
prevention and/or treatment of an allergic disease or condition, as
well as methods of inhibiting T-cell pro-allergic differentiation
in subjects who have or are risk of developing an allergic disease
or condition. The invention includes administration of a
therapeutically effective amount of a steroidogenic pathway
inhibitor. The invention includes the use of a composition
comprising a steroidogenic pathway inhibitor as well as the
composition itself. The invention also includes kits that contain
one or more steroidogenic pathway inhibitors.
[0043] Steroid hormones play a critical role in the
differentiation, development, growth, and physiological function of
most vertebrate tissues. The major pathways of steroid hormone
synthesis are well established, and the sequence of the responsible
steroidogenic enzymes has been elucidated (Simard et al., Endocrine
Rev. June 2005, 26(4):525-82; see also FIGS. 15 and 16). Many of
the enzymes of the steroidogenic pathway are localized to the
smooth endoplasmic reticulum (ER) with the exceptions of P450scc
(i.e. P450 cholesterol side-chain cleavage; CYP11A1), P450c11
(CYP11B1), and aldosterone synthase (CYP11B2) (Simard et al.,
Endocrine Rev. June 2005, 26(4):525-82).
[0044] Many inhibitors of the various components of the
steroidogenic pathway are known including but not limited to
aminoglutethimide (inhibits Cyp11A1), trilostane (inhibits
.beta.3HSD--also known as 3-.beta.-HSD; or 3-.beta.-hydroxysteroid
dehydrogenase/.DELTA.-5-4 isomerase) and metyrapone (inhibits
Cyp11.beta.1).
[0045] In the present invention, the inventors demonstrate the role
of Cyp11a1 in controlling IL-4-mediated CD8.sup.+ T cell conversion
in vitro and in vivo. The inventors demonstrate that mRNA
transcript levels, protein levels, and the enzyme activity of
Cyp11a1 in CD8.sup.+ T cells are all increased surprisingly
following differentiation in the presence of IL-2+IL-4 compared to
IL-2 alone. Further, the Cyp11a1 enzyme inhibitor aminoglutethimide
(AMG) or knock-down of Cyp11a1 protein levels using a specific
shRNA (small or short hairpin RNA), blocked the functional
conversion of CD8.sup.+ T cells from IFN-.gamma.- to
IL-13-producing cells. Expression of the lineage-specific
transcription factors T-bet or GATA3 was not affected by inhibition
of Cyp11a1 activity, indicating that it was downstream of
expression of these master regulatory transcription factors.
Adoptive transfer of AMG-treated CD8.sup.+ T cells, in contrast to
untreated CD8.sup.+ T cells, failed to restore AHR and inflammation
in sensitized and challenged CD8-deficient mice. The inventors
demonstrate for the first time Cyp11a1 as a key regulator of
CD8.sup.+ pro-allergic Tc2 cell differentiation and plasticity.
[0046] CD8.sup.+ T cells have been primarily associated with
production of IFN-.gamma.; however, in the presence of IL-4,
CD8.sup.+ T cells were skewed to differentiate into IL-13-producing
cells. This differentiation was associated with increases in GATA3
and decreases in T-bet expression and was dependent on antigen
signaling through the T cell receptor. Although IL-4 triggered the
up-regulation of Cyp11a1 mRNA, protein, and enzymatic activity, the
function of Cyp11a1 enzymatic activation was downstream of GATA3
and T-bet transcriptional events as their expression levels were
unaffected by blocking Cyp11a1 activity with AMG. Since addition of
SIINFEKL (SEQ ID NO:1) was also required for IL-13 cytokine
production (FIG. 2C), it thus appeared that T-cell receptor
signaling and activation of Cyp11a1 enzymatic activity were both
required for the later stages in CD8 skewing to a Tc2 (IL-13)
phenotype.
[0047] Taken together, the data presented herein establish for the
first time that the steroidogenic enzyme Cyp11a1 plays a direct
role in the polarization of CD8.sup.+ T cells from an IFN-.gamma.-
to an IL-13-producing effector cell and, as a result, is a critical
regulator of the development of lung allergic responses. Cyp11a1
thus represents a pivotal enzyme linking steroidogenesis in T cells
to pro-allergic differentiation pathways.
[0048] The inventors also demonstrate that peanut sensitization and
challenge not only results in inflammatory and cytokine changes in
the small intestine but that mRNA, protein, and enzymatic activity
levels of the steroidogenic enzyme Cyp11a1 are also markedly
elevated. Administration of an inhibitor of Cyp11a1 enzymatic
activity, AMG, prevented development of allergic diarrhea and
accumulation of inflammatory cells in the small intestine in a
dose-dependent manner. Levels of serum pregnenolone were reduced in
parallel. AMG treatment decreased IL13 and IL17 mRNA expression in
the small intestine without impacting Cyp11a1 mRNA or protein
levels. In vitro, the inhibitor decreased levels of IL13 and IL17
mRNA in polarized Th2 and Th17 CD4 T cells, respectively, without
affecting levels of GATA3, ROR.gamma.t, or the polarization of Th1
cells, IFNG, and T-bet expression. The importance of Cyp11a1 was
further demonstrated using shRNA-mediated silencing of Cyp11a1 in
polarized Th2 CD4 T cells which resulted in significantly decreased
levels of IL-4 and IL-13 mRNA and protein. These data demonstrate
that Cyp11a1 played an important role in the development of peanut
allergy through its effects on steroidogenesis, a critical pathway
in CD4.sup.+T cell Th2 differentiation.
[0049] The inventors demonstrate for the first time that levels of
Cyp11a1 protein and mRNA are increased in the jejunum of sensitized
and challenged mice. In parallel, enzymatic activity is increased
as demonstrated by increased levels of pregnenolone in the serum of
sensitized and challenged mice. The inventors also demonstrate that
Cyp11a1 enzymatic activity is essential for induction of peanut
allergy using an inhibitor, AMG. Administration of this inhibitor
during the oral challenge phase, after sensitization, results in
significantly lower serum pregnenolone levels and reduces the
incidence and severity of diarrhea and intestinal inflammation
(mast cell accumulation and goblet cell metaplasia), accompanied by
decreases in IL13 and IL17A mRNA in the intestine. The inhibitor
did not alter the development of specific antibodies, including
peanut-specific IgE, likely because sensitization was completed
prior to treatment in the challenge phase. Although administration
of the inhibitor in vivo could not identify specific target cells,
these data demonstrated for the first time that Cyp11a1 functions
as a key regulator of the development of peanut-induced allergic
responses.
[0050] The data described in the Examples presented herein
demonstrate that inhibition of Cyp11a1 significantly reduces
CD4.sup.+ Th2 and Th17 cytokine production in vivo. Interestingly,
the inhibitor does not affect expression of the Th1, Th2, and Th17
lineage-specific transcription factors T-bet (Th1-specific T box
transcription factor), GATA3 (GATA-binding factor 3), or
ROR.gamma.t (RAR-related orphan receptor gamma t). The results
support that suppression of Th2 and Th17 cytokine production is not
mediated through effects on lineage-specific transcription factor
expression but on cytokine transcription. The primary action of
Cyp11a1 enzymatic activity manifests downstream of these
lineage-specific transcription factors.
[0051] Further, the function of Cyp11a1 in CD4 T cells, Th1, Th2,
and Th17 polarization was monitored in vitro in the presence of
AMG. The highest levels of Cyp11a1 protein and enzymatic activity
were detected in polarized Th2 cells, with significantly lower
levels in Th17 cells, and virtually no activity in Th1 cells. The
inhibitor decreased IL-13 cytokine production in polarized Th2
cells; however, IFN-.gamma. production was not affected by the
inhibitor in polarized Th1 cells. Similar to the in vivo data, the
inhibitor did not affect GATA3 mRNA expression in polarized Th2
cells nor levels of T-bet or ROR.gamma.t in polarized Th1 and Th17
cells, respectively. Thus, inhibition of Cyp11a1 enzymatic activity
impaired CD4 Th2 and Th17 cell differentiation, which in turn
decreased production of the Th2 cytokine (IL-13) and Th17 cytokine
(IL-17A) and these effects were mediated downstream of their
respective and essential lineage-specific transcription
factors.
[0052] Additionally, Cyp11a1 mRNA was silenced in cultured Th2 CD4
T cells using a short hairpin RNA (shRNA) to demonstrate that the
results with AMG were specific to inhibition of Cyp11a1. During Th2
polarization, cells were transduced with retrovirus expressing
Cyp11a1-targeted shRNA or control (luc) shRNA and activated under
Th2 conditions. Cyp11a1 shRNA decreased the expression of Cyp11a1
mRNA levels by 58%.+-.5.2% and enzymatic activity of Cyp11a1,
monitoring pregnenolone levels, was reduced by 47%.+-.4.5%. Levels
of Th2 cytokine (IL4, IL3) mRNA and protein were decreased upon
transduction of Cyp11a1 shRNA. As we observed with Cyp11a1
inhibition in vivo and in vitro with AMG, levels of GATA3 mRNA
remained unaffected after silencing of Cyp11a1. These data
confirmed in vivo and in vitro AMG inhibition data, demonstrating
that Cyp11a1 critically regulates Th2 cell differentiation and
cytokine production.
[0053] These studies demonstrate for the first time that activation
of the steroidogenic enzyme Cyp11a1 plays a critical role in the
development of intestinal allergic responses through its effects on
CD4.sup.+ h2 polarization and IL-13 production. Cyp11a1 thus is a
novel target for the regulation and treatment of peanut-induced
allergy.
[0054] According to the present invention, allergic diseases and/or
conditions, include but are not limited to pulmonary conditions
such as allergic lung disease, allergic rhinitis, asthma, airway
hyperresponsiveness, allergen-induced airway hyperresponsiveness
and hay fever as well as other allergic conditions including but
not limited to a food allergy, allergen-induced inflammation,
eosinophilic esophagitis, chronic urticaria, atopic dermatitis,
occupational allergy, allergic conjunctivitis, airborne allergic
sensitivities, stinging insect allergy, hypersensitivity
pneumonitis, eosinophilic lung diseases, inflammatory bowel
disease, ulcerative colitis, Crohn's disease and drug allergies.
Symptoms of the allergies, including but not limited to diarrhea
and intestinal inflammation as well as asthma and airway
hyperresponsiveness, is apparently or obviously, directly or
indirectly triggered by an allergen to which a subject has
previously been sensitized. In one aspect, the allergic disease or
condition can be caused by one or more proteinaceous allergens.
Sensitization to an allergen refers to being previously exposed one
or more times to an allergen such that an immune response is
developed against the allergen. Responses associated with an
allergic reaction, including but not limited to histamine release,
edema, vasodilatation, bronchial constriction, airway inflammation,
airway hyperresponsiveness, asthma, allergic rhinitis (hay fever),
nasal congestion, sneezing, running nose, skin rash, diarrhea
including acute allergic diarrhea and intestinal inflammation),
typically do not occur when a naive subject is exposed to the
allergen for the first time, but once a cellular and humoral immune
response is produced against the allergen, the subject is
"sensitized" to the allergen. Allergic reactions then occur when
the sensitized individual is re-exposed to the same allergen (e.g.,
an allergen challenge). Once a subject is sensitized to an
allergen, the allergic reactions can become worse with each
subsequent exposure to the allergen, because each re-exposure not
only produces allergic symptoms, but further increases the level of
antibody produced against the allergen and the level of T cell
response against the allergen.
[0055] According to the present invention, inflammation is
characterized by the release of inflammatory mediators (e.g.,
cytokines or chemokines) which recruit cells involved in
inflammation to a tissue. A condition or disease associated with
allergic inflammation is a condition or disease in which the
elicitation of one type of immune response (e.g., a Th2-type immune
response) against a sensitizing agent, such as an allergen, can
result in the release of inflammatory mediators that recruit cells
involved in inflammation in a subject, the presence of which can
lead to tissue damage and sometimes death. A Th2-type immune
response is characterized in part by the release of cytokines which
include IL-4, IL-5, and IL-13. A TH17-type response is
characterized by the release of IL-17. The present invention is
particularly useful for treating allergen-induced food allergies
(such as peanut allegories) and airway hyperresponsiveness and
airway inflammation, including, allergen-induced asthma and
rhinitis.
[0056] Accordingly, various embodiments of the present invention
include treating a subject that has been sensitized to an allergen
and has been or is at risk of becoming exposed to the allergen. In
other embodiments, the present invention includes preventing an
allergic disease or condition in a subject at risk of becoming
exposed to the allergen. Such allergens can be related to a food, a
plant, a gas, a pathogen, a metal, a glue or a drug. Examples of
food allergens include but are not limited to groundnuts such as
peanuts; nuts from trees including Brazilian nuts, hazelnuts,
almonds, walnuts; fruit, milk, eggs, fish, shellfish, wheat, or
gluten. Examples of plant allergens include but are not limited to
pollen, trees, grass, weeds, ragweed, poison Oak or poison ivy.
Examples of gas allergens include but are not limited to
environmental tobacco smoke, and carbon monoxide. Examples of
pathogen allergens include but are not limited to mold, viruses or
bacteria. Examples of metal allergens include but are not limited
to lead, nickel, chromate, or cobalt. Examples of drug allergens
include but are not limited to penicillin, sulfur, or aspirin.
Additional allergens include but are not limited to latex, dust
mites, pet dander (skin flakes), droppings from cockroaches,
rodents and other pests or insects.
[0057] According to the present invention, "airway
hyperresponsiveness" or "AHR" refers to an abnormality of the
airways that allows them to narrow too easily and/or too much in
response to a stimulus capable of inducing airflow limitation. AHR
can be a functional alteration of the respiratory system resulting
from inflammation in the airways or airway remodeling (e.g., such
as by collagen deposition). Airflow limitation refers to narrowing
of airways that can be irreversible or reversible. Airflow
limitation or airway hyperresponsiveness can be caused by collagen
deposition, bronchospasm, airway smooth muscle hypertrophy, airway
smooth muscle contraction, mucous secretion, cellular deposits,
epithelial destruction, alteration to epithelial permeability,
alterations to smooth muscle function or sensitivity, abnormalities
of the lung parenchyma and infiltrative diseases in and around the
airways. Many of these causative factors can be associated with
inflammation. AHR can be triggered in a patient with a condition
associated with the above causative factors by exposure to a
provoking agent or stimulus. Such stimuli include, but are not
limited to, an allergen.
[0058] According to the present invention, treatment of a subject
having an allergic disease and/or condition can commence as soon as
it is recognized (i.e., immediately) by the subject or by a
clinician that the subject has been exposed or is about to be
exposed to an allergen. Additionally, preventing an allergic
disease or condition can commence prior to the subject being
exposed to an allergen. Treating the subject and/or preventing an
allergic disease or condition in the subject, can comprise
administering a composition including but not limited to a small
molecule inhibitor, an antibody, a chemical entity, a nucleotide, a
peptide, a protein, an antisense molecule, and siRNA molecule, and
shRNA molecule that inhibits one or more proteins, and/or
protein-by-products, enzymes, and/or receptors of the steroidogenic
pathway. Inhibiting a component of the sterodogenic pathway
includes both direct inhibition of the components as well as
inhibition of the expression of the one or more components of the
pathway. Inhibition of one or more components of the steroidogenic
pathway can be by any mechanism, including, without limitations,
decreasing activity of one or more components, increasing
inhibition of one or more of the components, degradation of one or
more of components, a reduction or elimination of expression of one
or more components and combinations thereof. Binding to one or more
component to prevent its wild-type enzymatic activity for example,
including competitive and noncompetitive inhibition, inhibiting
transcription, and regulating expression can also inhibit the
component. These inhibitors can also reduce expression of CD4.sup.+
and CD8.sup.+ T cell proliferation and have the ability to suppress
Th2 differentiation and/or Th17 differentiation.
[0059] The present invention also relates to a method of inhibiting
T-cell pro-allergic differentiation in a subject by administering
to the subject a therapeutically effective amount of a
steroidogenic pathway inhibitor. In one aspect, the T-cell
pro-allergic differentiation is CD4+T-cells to Th2 and Th17 cell
differentiation. In another aspect, the T-cell pro-allergic
differentiation is CD8+ T-cells to Tc2 cell differentiation. The
T-cell pro-allergic differentiation can be IL-4 induced conversion
of CD8+ T-cells into IL-13 secreting cells. In still another
aspect, the T-cell pro-allergic differentiation can be IL-4 induced
conversion of CD4+ T-cells into IL-13 secreting cells.
[0060] In accordance with the present invention, acceptable
protocols to administer a composition including the route of
administration and the effective amount of a composition to be
administered to a subject can be determined by those skilled in the
art. The composition of the present invention can be administered
in vivo or ex vivo. Suitable in vivo routes of administration can
include, but are not limited to, aerosol, oral, nasal, inhaled,
topical, intratracheal, transdermal, rectal, or parenteral routes.
Preferred parenteral routes can include, but are not limited to,
subcutaneous, intradermal, intravenous, intramuscular, or
intraperitoneal routes.
[0061] In one embodiment, the method of treating and/or preventing
an allergic disease and/or condition or inhibiting T-cell
pro-allergic differentiation can comprise administering a
therapeutically effective amount of a composition comprising a
compound that interacts with a regulator of a component of the
steroidogenic pathway including but not limited to Cyp11A1 mRNA
expression or Cyp11A1 protein expression. In one aspect, the
regulator is an inhibitor of the steroidogenic pathway, including
but not limited to an antibody, an antisense molecule, an siRNA
molecule, an shRNA molecule, a receptor antagonist, a chemical
entity, a nucleotide, a peptide and a protein. In one aspect, the
steroidogenic pathway inhibitor inhibits one or more enzymes,
receptors, or protein by-products of the steroidogenic pathway. In
a preferred embodiment, the steroidogenic pathway inhibitor
inhibits Cyp11A. This inhibitor can be aminoglutethimide, a Cyp11A
siRNA molecule or a Cyp11A shRNA molecule. In other aspect, the
steroidogenic pathway inhibitor inhibits 3.beta.HSD and can be
triostane. In still another aspect, the steroidogenic pathway
inhibitor inhibits Cyp11.beta.1 (cytochrome P450 family 11
subfamily .beta. polypeptide 1) and can be metyrapone.
[0062] According to the methods of the present invention, a
therapeutically effective amount of a steroidogenic pathway
inhibitor or a composition comprising a steroidogenic pathway
inhibitor that is administered to a subject, comprises an amount
that is capable of inhibiting expression and/or activity of one or
more components of the steroidogenic pathway (mRNA and/or protein)
without being toxic to the subject. An amount that is toxic to a
subject comprises any amount that causes damage to the structure or
function of a subject (i.e., poisonous).
[0063] The invention also includes kits that contain one or more
steroidogenic pathway inhibitors.
[0064] In addition, according to the present invention, the
composition as well as the kits of the present invention, can
comprise a pharmaceutically acceptable excipient. According to the
present invention, the composition, may be administered with a
pharmaceutically acceptable carrier, which includes
pharmaceutically acceptable excipients and/or delivery vehicles,
for delivering the agent to a subject (e.g., a liposome delivery
vehicle). As used herein, a pharmaceutically acceptable carrier
refers to any substance suitable for delivering a therapeutic
composition useful in the method of the present invention to a
suitable in vivo or ex vivo site. Preferred pharmaceutically
acceptable carriers are capable of maintaining the composition of
the present invention in a form that, upon arrival of the
composition to a target cell, the composition is capable of
entering the cell and inhibiting one or more components of the
steroidogenic pathway (mRNA and/or protein) in the cell. Suitable
excipients of the present invention include excipients or
formularies that transport or help transport, but do not
specifically target a nucleic acid molecule to a cell (also
referred to herein as non-targeting carriers). Examples of
pharmaceutically acceptable excipients include, but are not limited
to water, phosphate buffered saline, Ringer's solution, dextrose
solution, serum-containing solutions, Hank's solution, other
aqueous physiologically balanced solutions, oils, esters, glycols
and combinations thereof. Aqueous carriers can contain suitable
auxiliary substances required to approximate the physiological
conditions of the recipient, for example, by enhancing chemical
stability and isotonicity.
[0065] Suitable auxiliary substances include, for example, sodium
acetate, sodium chloride, sodium lactate, potassium chloride,
calcium chloride, and other substances used to produce phosphate
buffer, Tris buffer, and bicarbonate buffer. Auxiliary substances
can also include preservatives, such as thimerosal, m- or o-cresol,
formalin and benzol alcohol. Compositions of the present invention
can be sterilized by conventional methods and/or lyophilized.
[0066] According to the methods of the present invention, the
subject can be any animal subject, and particularly, in any
vertebrate mammal, including, but not limited to, primates,
rodents, livestock or domestic pets. Preferred mammals for the
methods of the present invention include humans.
[0067] The following examples are provided for illustrative
purposes, and are not intended to limit the scope of the invention
as claimed herein. Any variations which occur to the skilled
artisan are intended to fall within the scope of the present
invention. All references cited in the present application are
incorporated by reference herein to the extent that there is no
inconsistency with the present disclosure.
EXAMPLES
[0068] Examples 1-6 demonstrate the role of Cyp11a1 in controlling
IL-4-mediated CD8.sup.+ T cell conversion in vitro and in vivo.
Materials and Methods for Examples 1-6:
Animals
[0069] OT-1 TCR transgenic (OT-1) mice and homozygous CD8-deficient
mice were bred in the animal facility at National Jewish Health
(Denver, Colo.). OT-1 mice (C57BL/6 strain) express a transgenic
TCR specific for SIINFEKL peptide (ovalbumin (OVA).sub.257-264).
CD8-deficient mice were generated by targeting the CD8.sup.+-chain
gene in C57BL/6 mice (Oka, H. et al. Cell. Immunol. 206, 7-15
(2000); Sundrud, M. S. and Nolan, M. A. Curr. Opin. Immunol. 22,
286-292 (2010)). Animal experiments in this study were conducted
under a protocol approved by the Institutional Animal Care and Use
Committee of National Jewish Health.
CD8.sup.+T Cell Culture
[0070] CD8.sup.+ effector memory T cells were generated in vitro as
previously described (Miyahara, N. et al. J. Immunol. 172,
2549-2558 (2004); Miyahara, N. et al. J. Immunol. 174, 4979-4984
(2005)). In brief, mononuclear cells (MNCs) were processed from the
spleens of OT-1 mice followed by stimulation of 1 .mu.g/ml SIINFEKL
peptide (SEQ ID NO:1) was used to stimulate cells for 1.5 hours.
Two days after culture, living cells were re-isolated using
histopaque and cultured in complete RPMI 1640 medium that contained
recombinant mouse IL-2 (20 ng/ml) (R&D, Minneapolis, Minn.) or
IL-2+IL-4 (20 ng/ml) (Peprotech, Rocky Hill, N.J.). For some
experiments, AMG was added into the medium together with IL-2 or
IL-2+IL-4. Medium with cytokines was changed every day for a
further 4 days. The cells were then re-stimulated with 1 .mu.g/ml
SIINFEKL (SEQ ID NO:1) in medium containing 2 .mu.M monensin
(Calbiochem, La Jolla, Calif.) for 4 hours.
RNA Preparation and Analysis
[0071] Total RNA was extracted from 5.times.10.sup.6 differentiated
CD8.sup.+ T cells using the RNeasy Mini kit (Qiagen, Valencia,
Calif.). 1 .mu.g of total RNA was converted into cDNA using iScript
cDNA Synthesis kit (Bio-Rad, Hercules, Calif.). Quantitative RT-PCR
was performed using Cyp11a1 primers and probe obtained from Applied
Biosystems (Cat:Mm00490735_m1). Fold-changes were determined using
the 2.sup.-.DELTA..DELTA.Ct method, with normalization to
expression of mouse GAPDH.
ELISA For Pregnenolone Measurements
[0072] CD8.sup.+ T cells generated in the presence of IL-2,
IL-2+IL-4, IL-2+AMG, or IL-2+IL-4+AMG were cultured in 6-well
plates at 5.times.10.sup.6/ml for 24 hours. Supernatants were
collected. Pregnenolone levels were measured using the Pregnenolone
ELISA kit (ALPCO Diagnostics, Salem, N.H.).
Immunoblot Analysis
[0073] CD8.sup.+ T cells (5.times.10.sup.6) were lysed with RIPA
buffer containing Halt.TM. protease and phosphatase inhibitor
cocktail (Thermo Scientific, Rockford, Ill.) on ice for 30 minutes.
Samples were run by sodium dodecyl sulfate polyacrylamide gel
electrophoresis (SDS-PAGE) and transferred to nitrocellulose
membranes. The membranes were blocked using buffer containing 2%
BSA and 0.5% sodium azide in TBST for 1 hour and incubated with
rabbit polyclonal Cyp11a1 antibody (Lifespan Biosciences, Seattle,
Wash.) overnight at 4.degree. C. Horseradish peroxidase-conjugated
anti-rabbit IgG (GE Healthcare, UK) was used to detect Cyp11a1
protein. Mouse monoclonal anti-.beta.-actin antibody (Sigma, St.
Louis, Mo.) was used as internal control. Immunoreactive bands of
Western blottings were quantified by densitometric quantification
of autoradiographs using Image J (NIMH, Bethesda, Md.), and
expressed as relative Cyp11a1 normalized by .beta.-actin.
CD8.sup.+T Cell Transfection
[0074] CD8.sup.+ T cells were transfected with a construct encoding
an shRNA specific for mouse Cyp11a1 in the pGFP-V-RS vector
(Origene, Rockville, Md.) using an Amaxa mouse T cell nucleofector
kit (Amaxa/Lonza, Cologne, Germany). A sequence encoding a
non-effective 29-mer scrambled shRNA in the GFP-V-RS vector was
used as control. Transfection was performed as directed by the
manufacturer (Amaxa/Lonza, Cologne, Germany) using 4 .mu.g of
plasmid and Nucleofector Program X-001. Twenty-four hours after
transfection, cells were harvested and stimulated with SIINFEKL (1
.mu.g/ml) (SEQ ID NO:1) in medium containing 2 .mu.M monensin for 4
hours and then harvested for flow cytometric analysis.
Flow Cytometric Analysis
[0075] For intracellular staining, 1.times.10.sup.6/ml cells were
washed twice with PBS containing 1% BSA, stimulated with 1 .mu.g/ml
SIINFEKL in the presence of 2 .mu.M monensin at 37.degree. C. for 4
hours. After fixation with 4% paraformaldehyde (Electron Microscopy
Sciences, Hatfield, Pa.) and permeabilization with 0.1% saponin
(Sigma, St. Louis, Mo.), cells were washed twice with PBS
containing 1% BSA, then incubated with anti-mouse CD16/CD32 (2.4G2)
(BD Bioscience, San Jose, Calif.) at 4.degree. C. for 5 minutes,
then stained with FITC labeled anti-mouse IFN-.gamma. (XMG 1.2)
(eBioscience, San Diego, Calif.) or PerCP-Cy5.5 labeled anti-mouse
IFN-.gamma. (XMG 1.2) (eBioscience) and PE-labeled anti-mouse IL-13
(eBio13A) (eBioscience). For some experiments, fixed cells were
stained with biotin labeled rabbit anti-Cyp11a1/p450cc polyclonal
antibody (Bioss, Woburn, Mass.) followed by PE-Cy5 labeled
streptavidin (PE-Cy5-SAv) (eBioscience). Cell staining was
monitored on a FACSCalibur (BD Bioscience) and analyzed using
Flowjo software (Tree Star, Inc, Ashland, Oreg.).
Secondary Allergen Challenge Model and Adoptive Transfer
[0076] The experimental protocol for sensitization and challenge to
OVA was as described previously (Oka, H. et al. Cell. Immunol. 206,
7-15 (2000); Sundrud, M. S. and Nolan, M. A. Curr. Opin. Immunol.
22, 286-292 (2010)), with some modification. CD8-deficient mice
were sensitized with 20 .mu.g of OVA (Calbiochem, La Jolla, Calif.)
emulsified in 2.25 mg of alum (AlumImuject; Pierce, Rockford, Ill.)
on days 0 and 14 by intraperitoneal injection. Mice were challenged
with 0.2% OVA for 20 minutes on days 21, 22, and 23 using an
ultrasonic nebulizer (model NE-U07; Omron Healthcare, Kyoto, JP).
To address the effect of Cyp11a1 inhibitor on CD8.sup.+ T
cell-mediated AHR, CD8.sup.+ T cells (5.times.10.sup.6) generated
in medium containing IL-2 or IL-2+AMG were injected into
OVA-sensitized CD8-deficient mice intravenously on day 37. Two
hours after transfer, mice were challenged (secondary) with 1% OVA
for 20 minutes. Airway function was measured and samples were
collected on day 38.
Assessment of Airway Function
[0077] Airway function was assessed as described previously (Oka,
H. et al. Cell. Immunol. 206, 7-15 (2000); Sundrud, M. S. and
Nolan, M. A. Curr. Opin. Immunol. 22, 286-292 (2010)) by measuring
changes in airway resistance (RL) in response to increasing doses
of inhaled methacholine (Sigma, St. Louis, Mo.). Data were
presented as percentage change from the baseline RL values after
saline inhalation. Baseline RL values were not significantly
different among the various groups.
BAL Analysis
[0078] After measurement of AHR, lungs were lavaged via the
tracheal tube with 1 ml of HBSS. The supernatants were collected
and IL-4, IL-5, and IL-13 (eBiosicence, San Diego, Calif.) levels
were measured by ELISA as described previously. Total leukocyte
numbers were counted and differentiated as described previously
(Oka, H. et al. Cell. Immunol. 206, 7-15 (2000); Sundrud, M. S. and
Nolan, M. A. Curr. Opin. Immunol. 22, 286-292 (2010)).
Immunohistochemistry Staining
[0079] CD8.sup.+ T cells generated in the presence of IL-2 or
IL-2+IL-4 were collected on slides. After fixing in 4%
paraformaldehyde, the slides were stained with anti-human Cyp11a1
antibody (Abeam, Cambridge, Mass.).
[0080] Mouse lungs were isolated and fixed in 10% formalin, then
embedded in paraffin and cut into 5-.mu.m thick tissue sections.
Sections were stained with periodic acid-Schiff (PAS) and
mucus-containing cells were quantitated as previously described
(Oka, H. et al. Cell. Immunol. 206, 7-15 (2000); Sundrud, M. S. and
Nolan, M. A. Curr. Opin. Immunol. 22, 286-292 (2010)). For some
experiments, lung tissue expression of Cyp11a1 was identified by
immunohistochemistry staining using anti-human Cyp11a1
antibody.
Statistical Analysis
[0081] All data were representative of at least 3 independent
experiments, 4 mice/group. Results were expressed as the
mean.+-.SEM. Student's two-tailed t test was used to determine the
level of difference between two groups. ANOVA was used to determine
the levels of difference among more than 3 groups. Nonparametric
analysis using the Mann-Whitney U test or Kruskal-Wallis test was
also used to confirm that the statistical differences remained
significant even if the underlying distribution was uncertain. The
p values for significance were set to 0.05 for all tests.
Example 1
[0082] This example demonstrates that Cyp11a1 mRNA, protein levels,
and enzymatic activity are increased in CD8+ T cells differentiated
in the presence of IL-2+IL-4.
[0083] CD8.sup.+ T cells were differentiated in vitro in the
presence of IL-2 or IL-2+IL-4 (FIG. 1A). Following culture for 6
days, total RNA was extracted, cDNA was prepared and quantitative
real-time PCR was performed. As illustrated in FIG. 1B, Cyp11a1
mRNA levels were significantly higher in cells differentiated in
the presence of IL-4. Similarly, Cyp11a1 protein levels were
elevated in these cells (FIG. 1C) as determined by densitometric
quantification of immunoreactive bands on autoradiographs. Cells
differentiated in IL-2 alone expressed little Cyp11a1 mRNA or
protein. Immunohistochemical analysis for Cyp11a1 also showed a
dramatic increase in the numbers of positively stained cells in
cultures treated with IL-2+IL-4 compared to IL-2 alone (FIG.
1D).
[0084] The enzymatic activity of Cyp11a1 was assessed using an
ELISA assay for detection of pregnenolone levels in cell culture
supernatants (Kim, C. J. et al. J. Clin. Endocrinol. Metab. 93,
696-702 (2008)). As shown in FIG. 2A, levels of pregnenolone were
increased in cultures of cells differentiated in IL-2 alone
(1.8.+-.0.5 pg/ml) to 424.8.+-.35.5 pg/ml in the cells
differentiated in IL-2+IL-4.
Example 2
[0085] This example demonstrates that aminoglutethimide (AMG)
inhibits the enzymatic activity of Cyp11a1 without affecting mRNA
or protein expression.
[0086] AMG is known to inhibit Cyp11a1 enzymatic activity at the
initial step of conversion of cholesterol to pregnenolone in
tissues such as the adrenals (Robel, P. et al. J. Steroid Biochem.
Molec. Biol. 53, 355-360 (1995); Slominski, A. et al. FEBS J. 273,
2891-2901 (2006)). In cells differentiated in IL-2+IL-4, addition
of AMG decreased pregnenolone levels in cell supernatants from
424.8.+-.35.5 pg/ml to 96.4.+-.35 pg/ml (FIG. 2A). In contrast, the
addition of AMG did not prevent IL-4-induced increases in Cyp11a1
protein levels (with or without re-stimulation with SIINFEKL
(OVA.sub.257-264) SEQ ID NO:1) as determined by immunoblot analysis
(FIG. 2B). In fact, levels of protein were increased in AMG-treated
cells. These data suggested that the changes in pregnenolone levels
were restricted to the regulation of Cyp11a1 enzymatic activity and
not due to changes in Cyp11a1 protein levels or cell toxicity.
Example 3
[0087] This example demonstrates that Cyp11a1 enzymatic activity is
essential for the functional conversion of CD8+ T cells from
IFN-.gamma. to IL-13 producing cells.
[0088] CD8.sup.+ T cells differentiated in IL-2 or IL-2+IL-4 were
re-stimulated with SIINFEKL (SEQ ID NO:1) and analyzed for cytokine
production by flow cytometry. CD8.sup.+ T cells differentiated in
IL-2 alone were predominantly IFN-.gamma.-producing with almost no
IL-13-producing cells. In contrast, CD8.sup.+ T cells
differentiated in IL-2+IL-4 were predominantly IL-13 producing,
with fewer cells producing IFN-.gamma. (FIG. 2C and Table 1). To
assess the importance of the enzymatic activity of Cyp11a1 in the
functional conversion of CD8.sup.+ T cells, the effect of addition
of the Cyp11a1 enzyme inhibitor AMG on these events was determined.
CD8.sup.+ T cells were differentiated in IL-2 or IL-2+IL-4 and
activated through the TCR with SIINFEKL (SEQ ID NO:1) in the
presence or absence of AMG. When CD8.sup.+ T cells were cultured
with SIINFEKL (SEQ ID NO:1) and IL-2+IL-4 in the presence of AMG,
there was a dramatic dose-dependent decrease in the percentage of
IL-13-positive cells and an increase in IFN-.gamma.-positive cells
(FIG. 2C). In the presence of 500 .mu.M AMG, the percentage of
IL-13-single-positive cells decreased from 35.7.+-.8.2% to
14.7.+-.8.9% and the percentage of IFN-.gamma.-single-positive
cells increased from 14.5.+-.5.8% to 42.4.+-.11.5%; the percentage
of IFN-.gamma.- and IL-13-double-positive cells increased slightly
from 8.8.+-.2.3% to 14.7.+-.5.5% (FIG. 2C and Table 1). The
increased numbers of IFN-.gamma.-positive cells in the cultures
indicated that the drug did not have an overall suppressive or
toxic effect and that Cyp11a1 enzymatic activity was indeed
required for the functional conversion of the cells to IL-13
production.
TABLE-US-00001 TABLE 1 IFN-.gamma. and IL-13 expression in CD8+ T
cells differentiated in IL-2 or IL-2 + IL-4 in the presence or
absence of AMG IL-2 + IL-2 + IL-2 + IL-2 + IL-4 + IL-2 + IL-2 + AMG
+ IL-2 + IL-4 + IL-4 + AMG + IL-2 AMG SIINFEKL SIINFEKL IL-4 AMG
SIINFEKL SIINFEKL INF-.gamma. single 0.2 +/- 0.1 0.2 +/- 0.1 85.6
+/- 3.8 78.3 +/- 8.3 0.6 +/- 0.2 0.9 +/- 0.5 14.5 +/- 5.8 42.4 +/-
11.5 positive ##STR00001## cells ** IL-13 single 0.2 +/- 0.1 0.4
+/- 0.2 0.5 +/- 0.5 0.1 +/- 0.1 3.4 +/- 1.4 2.3 +/- 1.5 35.7 +/-
8.2 14.7 +/- 8.9 positive ##STR00002## cells **
INF-.gamma..sup.+IL13.sup.+ 0 0 5.2 +/- 1.1 9.0 +/- 2.7 0 0.1 8.8
+/- 2.3 14.7 +/- 5.5 Double positive cells Intracellular staining
of IFN-.gamma. and IL-13 in CD8.sup.+ T cells with or without 1
.mu.g/ml SIINFEKL or 500 .mu.M AMG treatment. Data (mean +/- SEM)
showing % positive cells were from at least 4 independent
experiments. **p < 0.01 compard to the IL-2 + IL-4 + SIINFEKL
group.
Example 4
[0089] This example demonstrates that silencing of Cyp11a1 with an
shRNA can prevent conversion of CD8.sup.+ T cells from IFN-.gamma.
to IL-13-producing cells.
[0090] To further assess the requirement for Cyp11a1 activity,
CD8.sup.+ T cells differentiated in the presence of IL-2+IL-4 were
transfected with a green fluorescent protein (GFP)-encoding vector
containing an shRNA construct specific for mouse Cyp11a1. A
non-effective 29-mer scrambled shRNA in the vector was used as
control. Forty-eight hours after transfection, the cells were
stimulated with SIINFEKL (SEQ ID NO:1) for 4 hours. Flow cytometric
analysis for GFP indicated that there were 40.2.+-.0.7% and
43.6.+-.1.9% GFP-positive cells following transfection of
Cyp11a1-specific or scrambled shRNA, respectively. Among the
GFP-positive cells, 67.8.+-.2.8% of cells receiving the control
shRNA was positive for Cyp11a1 and this was significantly reduced
to 28.8.+-.1.2% by the Cyp11a1-specific shRNA (FIG. 3A). After
transfection of the plasmid encoding the Cyp11a1-specific shRNA,
the percentage of IFN-.gamma.-single-positive cells increased to
26.3.+-.1.7% compared to 13.+-.2.7% in cells transfected with the
scrambled shRNA; in parallel, the percentage of
IL-13-single-positive cells decreased from 33.7.+-.0.6% (scrambled
shRNA) to 18.7.+-.6.3% in cells transfected with the
Cyp11a1-specific shRNA. The percentage of IFN-.gamma.- and
IL-13-double-positive cells increased slightly from 5.9.+-.1.2% to
11.+-.0.1% (FIG. 3B). These results demonstrated that reduction of
Cyp11a1 in IL-2+IL-4 differentiated cells resulted in increased
IFN-.gamma. and decreased IL-13 expression.
Example 5
[0091] This example demonstrates that lineage-specific
transcription factor levels in CD8+ T cells are unaffected by AMG
treatment.
[0092] The major transcription factors regulating expression of
IFN-.gamma. and IL-13 in T cells are T-bet and GATA3, respectively
(Oka, H. et al. Cell. Immunol. 206, 7-15 (2000); Sundrud, M. S. and
Nolan, M. A. Curr. Opin. Immunol. 22, 286-292 (2010).). Since
Cyp11a1 appeared to play an important role in controlling
IFN-.gamma. and IL-13 production in CD8.sup.+ T cells, the
relationship of Cyp11a1 and lineage-specific transcription factor
expression was examined. In cells differentiated in IL-2+IL-4,
T-bet levels were decreased and GATA3 levels were increased
compared to cells differentiated in IL-2 alone (FIG. 4). However,
unlike cytokine levels, there were no significant differences
observed in cells untreated or treated with AMG. These data
suggested that Cyp11a1 enzymatic activity exhibited regulatory
activity downstream of the expression of these lineage-specific
transcription factors.
Example 6
[0093] This example demonstrates that adoptive transfer of
AMG-treated CD8+ cells fails to restore CD8+ T cell-mediated AHR
and inflammation in vivo.
[0094] The inventors have demonstrated that CD8-deficient mice
develop a low level of AHR and eosinophilic inflammation compared
to WT mice following sensitization and challenge, but that adoptive
transfer of primed CD8.sup.+ T cells differentiated in IL-2 can
restore AHR, eosinophilia, and goblet cell metaplasia, suggesting
in vivo conversion (Amsen, D. et al. Curr. Opin. Immunol. 21,
153-160 (2009); Miyahara, N. et al. Nature Med. 10, 865-869 (2004);
Ohnishi, H. et al. J. Allergy Clin. Immunol. 121, 864-871 (2008)).
This was confirmed following recovery of transferred CD8.sup.+ T
cells from the lung and demonstrating their ability to produce
IL-13 (National Asthma Education and Prevention Program (National
Heart Lung and Blood Institute) Third Expert Panel on the
Management of Asthma. National Center for Biotechnology Information
(U.S.). Expert panel report 3 guidelines for the diagnosis and
management of asthma. Bethesda, Md.: National Institutes of Health
National Heart Lung and Blood Institute; 2007). As shown in vitro,
the in vivo conversion of transferred CD8.sup.+ T cells was
dependent on IL-4 (Martin, R. J. et al. J. Allergy Clin. Immunol.
119, 73-80 (2007)).
[0095] Since AMG prevented IL-4-induced functional conversion of
CD8.sup.+ T cells from IFN-.gamma. to IL-13 producers in vitro, the
inventors determined if this treatment would attenuate restoration
of lung allergic responses in vivo. Initial studies determined that
the effects of AMG on CD8.sup.+ T cell conversion, as demonstrated
in FIG. 2C, could be detected for up to forty-eight hours before
the cells recovered. Therefore, to ensure that the time frame for
the in vivo experiments was consistent with the duration of
AMG-mediated inhibition of Cyp11a1 enzyme activity, a secondary
challenge model was used which shortens the time interval between
cell transfer and assay (FIG. 5A). Transfer of IL-2 differentiated
CD8.sup.+ T cells into sensitized and challenged CD8-deficient
recipients followed by secondary allergen challenge fully restored
all lung allergic responses (FIGS. 5B and 5C). In contrast,
transfer of CD8.sup.+ T cells differentiated in IL-2 in the
presence of AMG failed to restore AHR or airway inflammation (FIGS.
5B and 5C). Levels of IL-4, IL-5, and IL-13 were significantly
lower in the bronchoalveolar lavage (BAL) fluid of mice which
received AMG-treated CD8.sup.+ T cells compared to untreated cells
(FIG. 5D). Lung sections were processed for histology and analyzed
by PAS staining. The results showed that recipients of CD8.sup.+ T
cells pretreated with AMG had less inflammation and significantly
decreased numbers of PAS.sup.+ mucus-containing goblet cells
compared to those which received CD8.sup.+ T cells that had been
differentiated in the presence of IL-2 without the enzyme inhibitor
(FIG. 5E). Immunohistochemical analysis for Cyp11a1 protein
expression in the lung sections was also performed (FIG. 5F and
Supplemental FIG. 1). The number of positively-stained cells was
significantly increased after adoptive transfer of CD8.sup.+ T
cells differentiated in IL-2 into sensitized and challenged
recipients whereas few Cyp11a1-positive cells were detected in
recipients of AMG-treated cells, similar to numbers seen in
sensitized and challenged recipients that received no transferred
cells.
[0096] Examples 7-11 below demonstrate Cyp11a1 enzyme activity in
peanut-induced intestinal allergy. In addition, the inventors
demonstrate for the first time, the essential role of this enzyme
in the full development of intestinal allergic responses and that
the inhibition of the enzymatic activity of Cyp11a1 attenuates
CD4.sup.+ Th2 and Th17 differentiation and cytokine production.
Materials and Methods For Examples 7-11 Described Below:
Mice
[0097] Five- to 6-week-old female Balb/c wild-type (WT) mice were
purchased from the Harlan Laboratory (Indianapolis, Ind.). All
studies were conducted under a protocol approved by the
Institutional Animal Care and Use Committee of National Jewish
Health.
Preparation of Peanut Protein
[0098] Crude peanut extract (PE) was prepared from defatted raw
flours (Golden Peanut Company, Alpharetta, Ga.) as previously
described (E1). Briefly, the flour (1:10, wt/vol) was extracted in
10.times.PBS overnight at 4.degree. C. After centrifugation at
30,000 g for 60 minutes, the supernatant was filter-sterilized,
measured for protein concentration using the BCA method (Pierce,
Rockford, Ill.), and stored as aliquots at -20.degree. C. Endotoxin
levels in PE solutions were less than 0.1 EU/ml as assessed by a
Chromogenic LAL endotoxin assay kit (GeneScript, Piscataway,
N.J.).
Sensitization and Intragastric Challenge
[0099] The experimental protocol for sensitization and challenge to
peanut was previously described (Wang, M., et al. J. Allergy Clin.
Immunol. 126, 306-316 (2010).
Cyp11a1 Inhibitor Treatment In Vivo and In Vitro
[0100] Aminoglutethimide (AMG) was obtained from Sigma (St. Louis,
Mo.). PE sensitized and challenged mice received different doses
(0-20 mg/kg) of the inhibitor by average, based on doses previously
reported (Oka, H., et al. Cell. Immunol. 206, 7-15 (2000)) and are
described as follows.
[0101] AMG was dissolved in 1 M hydrogen chloride and diluted with
saline for in vivo studies or diluted with RPMI medium for in vitro
study. The final concentration of 1 M hydrogen chloride was less
than 1% and 0.05% for in vivo and in vitro, respectively. PE
sensitized and challenged mice received different doses (5, 10, 20
mg/kg) of the Cyp11a1 enzyme inhibitor (PE/PE/AMG) by means of
gavage using a 22-gauge feeding needle (Fisher Scientific) twice a
day during the peanut challenge phase. Controls included PE
sensitized and challenged but vehicle (saline) treated
(PE/PE/vehicle), or sham sensitized but PE challenged and
vehicle-treated (PBS/PE/vehicle) mice.
Assessment of Peanut Intestinal Sensitivity Reactions
[0102] Clinical symptoms were evaluated as previously reported
(Payne, A. H. Biol. Reprod. 42, 399-404 (1990)) and are described
in the paragraph below.
[0103] Anaphylactic symptoms were evaluated 30 minutes after the
oral challenge, as previously reported (Li, X. M., et al. J.
Allergy Clin. Immunol. 106:150-158 (2000)). Briefly, 0: no
symptoms; 1: scratching and rubbing around the nose and head; 2:
puffiness around the eyes and mouth, diarrhea, pilar erecti,
reduced activity, and/or decreased activity with increased
respiratory rate; 3: wheezing, labored respiration, and cyanosis
around the mouth and the tail; 4: no activity after prodding or
tremor and convulsion; and 5: death. Scoring of symptoms was
performed in a blinded manner by an independent observer.
Histology
[0104] The jejunum was processed and stained with periodic
acid-Schiff (PAS) and chloroacetate esterase for detection of
mucosal mucus-containing cells and mast cells respectively, as
previously described (Wang, M., et al. J. Allergy Clin. Immunol.
126, 306-316 (2010); Tomkinson, A., et al. Am. J. Respir. Crit.
Care Med. 163, 721-730 (2001)). Numbers of mucosal cells expressing
Cyp11a1 were identified by immunohistochemical (IHC) staining using
anti-human Cyp11a1 antibody (Abcam, Cambridge, Mass.).
Cytokines Levels in Cell Culture
[0105] Levels of IL-4, IL-13, IL-17A, and IFN-.gamma. in cell
culture supernatants were measured by ELISA (eBioscience, San
Diego, Calif.) as described by the manufacturer.
Measurement of Peanut-Specific Antibody
[0106] Serum peanut-specific IgE, IgG1, and IgG2a levels were
measured by ELISA, as described previously (Payne, A. H. Biol.
Reprod. 42, 399-404 (1990)).
Histamine Levels in Plasma
[0107] Levels of histamine in plasma were measured using an enzyme
immunoassay histamine kit (Beckman Coulter, Fullerton, Calif.), as
described by the manufacturer. The concentration of histamine was
calculated from a standard curve provided by the manufacturer.
Pregnenolone Levels in Serum and Cell Culture Supernatants
[0108] Pregnenolone levels in serum and cell culture supernatants
were measured by ELISA (ALPCO Diagnostics, Salem, N.H.), as
described by the manufacturer.
T-Cell Differentiation In Vitro
[0109] Differentiation of Th1, Th2, or Th17 cells was performed as
previously described (40, 41) and is described in the following
paragraph.
[0110] Differentiation of Th1, Th2, or Th17 cells was performed as
previously described with minor changes (Ashino, S., et al. Intl.
Immunol. 22:503-513 (2010)). CD4.sup.+CD45RB.sup.+ T cells were
isolated from naive TCR-transgenic mice (OT II mice) spleen using a
cell sorter (MoFlo XDP, Beckman Coulter). In the presence of
mitomycin-C-treated spleen cells, 5 .mu.g/ml OVA.sub.323-339
peptide, and the inhibitor AMG (400 .mu.m), isolated naive CD4 T
cells were cultured with rmIL-2 (10 ng/ml, R/D Systems), rmIL-12
(10 ng/ml, Peprotech), rmIFN-.gamma. (5 ng/ml, Peprotech), and
anti-IL-4 mAbs (10 .mu.g/ml, eBioscience) to induce Th1 cell
differentiation; with rmIL-2 (10 ng/ml, R/D Systems), rmIL-4 (5
ng/ml, Peprotech), and anti-IFN-.gamma. mAb (10 .mu.g/ml,
eBioscience) for differentiation of Th2 cells; and with rhIL-6 (50
ng/ml, Perotech), rhTGF-.beta. (2 ng/ml, Peprotech), rmIL-23 (10
ng/ml, Peprotech), anti-IL-4 mAb (10 .mu.g/ml, eBioscience), and
anti-IFN-.gamma. mAb (10 .mu.g/ml, eBioscience) for differentiation
of Th17 cells. After 6 days of culture, the cells were washed with
fresh medium and restimulated with anti-CD3/anti-CD28 for 24 hrs
for assay of cytokine production. The cells were collected for
quantitative RT-PCR and Western blot. In some experiments (for
transduction experiment), the cells were cultured under Th1, Th2,
and Th17 polarizing conditions for 5 days as described in
Methods.
Western Blot Analysis
[0111] Cell lysates were prepared from cultured CD4 T cells as
previously described (Ashino, S., et al. Intl. Immunol. 22:503-513
(2010)) and in the following paragraph.
[0112] Cultured cells were lysed as previously described (Ohnishi,
H., et al. J. Allergy Clin. Immunol. 121:864-871 (2008)). Lysates
were resolved by means of SDS-PAGE and transferred to
nitrocellulose membranes. Proteins were detected using antibodies
specific for Cyp11a1 (LifeSpan Biosciences. Seattle, Wash.)
followed by chemiluminescence detection (GE Healthcare, Little
Chalfont, UK).
Quantitative Real-Time PCR
[0113] Real-time PCR was performed as previously described (Wang,
M., et al. J. Allergy Clin. Immunol. 130, 932-944 (2012)) and in
the following paragraph.
[0114] RNA was extracted from jejunal tissue homogenates or from
CD4 T cells cultured in vitro using Trizol (Invitrogen). cDNA was
generated using the iScript cDNA synthesis kit (Bio-Rad
Laboratories, Hercules, Calif.). Quantitative real-time PCR was
performed on the ABI Prism 7300 sequence detection system (Applied
Biosystems, Foster City, Calif.). All primers and probes used were
purchased as Tagman Gene Expression Assays from Applied Biosystems.
Fold change was calculated using the Delta Delta cycle threshold
(.DELTA..DELTA.C.sub.T) method.
Expression Constructs
[0115] The Cyp11a1 shRNA sequence was generated using the Dharmacon
siDESIGN center (Thermo Scientific). Cyp11a1 sense
5'-TTCAATAAAGCTGATGAGTATTCAAGAGATACTCATCAGCTTTATTGATTTTTTC-3' (SEQ
ID NO:2) anti-sense
5'-TCGAGAAAAAATCAATAAAGCTGATGAGTATCTCTTGAATACTCATCAGCTTTATTGA A-3'
(SEQ ID NO:3). Control firefly luciferase (luc) shRNA was described
previously (Musselman, C. A., et al. Proc. Natl. Acad. Sci. USA
109, 787-792 (2012)). To construct the shRNA expression vectors,
PAGE-purified and phosphorylated oligonucleotides (Integrated DNA
Technologies, Coralville, Iowa) encoding Cyp11a1 shRNA were
annealed and ligated into a modified pQCXIP vector (Clontech,
Mountain View, Calif.) expressing cyan fluorescent protein (CFP)
(Musselman, C. A., et al. Proc. Natl. Acad. Sci. USA 109, 787-792
(2012)). Plasmid DNA encoding mouse Cyp11a1 and control firefly
luciferase were purified using endofree plasmid maxi kit (Qiagen,
Valencia, Calif.) and sequenced (Eton Bioscience, San Diego,
Calif.).
Retrovirus Production and Transduction
[0116] Retrovirus production was performed as previously described
(Maier, H., et al. Nucleic Acids Res. 31, 5483-5489 (2003)).
.PHI.NX packaging cells were plated on poly-d-lysine-coated 100-mm
dishes and cultured overnight to reach 60 to 80% confluency. Cells
were co-transfected with the pCL-Eco viral packaging plasmid and
plasmid DNA encoding Cyp11a1, or control luc shRNA using
Lipofectamine 2000 (Invitrogen, Carlsbad, Calif.) according to the
manufacturer's instructions. Two days post-transfection, the
virus-containing supernatant was collected and used to transfect
cells.
[0117] Retroviral transduction of Th2 cells was performed as
previously described (Pham, D., et al. J. Immunol. 189, 832-840
(2012)). Sorted CD4.sup.+ T cells were cultured under Th2 cell
differentiation conditions as previously reported (Wang, M., et al.
J. Allergy Clin. Immunol. 130, 932-944 (2012)). Cells were
transduced with retroviruses (control luc shRNA or Cyp11a1 shRNA)
by centrifugation in the presence of 8 .mu.g/ml polybrene (Sigma).
Cells were expanded and analyzed on day 5.
Cell Sorting and Analysis of Gene Expression
[0118] Seventy-two hours after transduction, the cells were
collected and labeled with anti-mouse CD4 FITC (eBiosciences).
CFP.sup.+CD4.sup.+ cells were sorted using a Synergy cell sorter
(iCyt). Sorted cells were stimulated with 2 .mu.g/ml anti-CD3/CD28
for quantitative RT-PCR and ELISA. Quantitative RT-PCR and ELISA
were performed as described above.
Cell Viability and Growth
[0119] Cell viability was determined using the trypan blue dye
exclusion assay. Cell growth was determined by counting the number
of viable cells.
Statistical Analysis
[0120] ANOVA was used to determine the levels of difference between
all groups. Comparisons for all pairs utilized the Tukey-Kramer
highest significance difference test. P values for significance
were set at 0.05. All results were expressed as the
means.+-.SEM.
Example 7
[0121] This example demonstrates that the expression of Cyp11a1 is
increased in the small intestine of peanut sensitized and
challenged mice.
[0122] The expression of Cyp11a1 mRNA and protein in the jejunum of
WT Balb/c mice was examined. Following PE sensitization and
challenge (FIG. 6A), Cyp11a1 mRNA expression was increased 3-fold
in the jejunal homogenates (FIG. 6B). Immunohistochemical staining
of jejunal tissue with an antibody specific for Cyp11a1 protein was
mainly localized to the lamina propria of the small intestine (FIG.
6C). There were few Cyp11a1-positive cells in the mucosa of the
small intestine of sham sensitized mice whereas numbers of
Cyp11a1-positive cells were significantly increased in the PE
sensitized and challenged mice (FIG. 6D). Thus, Cyp11a1 expression
was induced following sensitization and challenge.
Example 8
[0123] This example demonstrates that the inhibition of Cyp11a1
attenuates PE-induced allergic responses in vivo.
[0124] The effects of inhibition of Cyp11a1 enzymatic activation on
the induction of peanut allergy using an inhibitor,
aminoglutethimide (AMG) was determined. AMG is known to block the
enzymatic activity of Cyp11a1, thus preventing conversion of
cholesterol to pregnenolone (Parajes, S., et al. J. Clin.
Endocrinol. Metab. 96, E1798-E1806 (2011)). To establish that AMG
inhibitory activity was limited to the enzymatic activity,
pregnenolone levels in serum were measured following PE
sensitization and challenge. As shown in FIG. 7A, levels of
pregnenolone were significantly increased in the serum of peanut
sensitized and challenged mice (4.69.+-.0.92 ng/ml) compared to
sham sensitized but PE challenged mice (1.99.+-.0.11 ng/ml). Levels
of pregnenolone were significantly decreased (2.98.+-.0.60 ng/ml)
in peanut sensitized and challenged mice following treatment with
AMG (20 mg/kg). While PE sensitization and challenge increased
Cyp11a1 mRNA and numbers of Cyp11a1-positive cells in the small
intestine treatment with AMG (20 mg/kg) did not affect these
results (FIGS. 7B, 7C). These data confirm that Cyp11a1 enzymatic
activity, in parallel to mRNA and protein expression is induced by
peanut sensitization and challenge and that AMG specifically
targets the enzymatic activity but not protein expression per
se.
[0125] Administration of the inhibitor to sensitized mice resulted
in a dose-dependent inhibitory effect on intestinal allergy
induction; 20 mg/kg of the inhibitor fully prevented development of
diarrhea and significantly diminished clinical symptom scores in PE
sensitized and challenged mice (FIGS. 8A, 8B). Lower doses of the
inhibitor (10 mg/kg) partially inhibited diarrhea and symptom
scores, whereas 5 mg/kg of the inhibitor had no observed inhibitory
effects on diarrhea occurrence or clinical symptoms.
[0126] Mast cells are involved in allergic responses (Wang, M., et
al. J. Allergy Clin. Immunol. 126, 306-316 (2010); Brandt, E. B.,
et al. J. Clin. Invest. 112, 1666-1677 (2003)) and the inventors
demonstrated increased numbers of mast cells and mucus-producing
goblet cells in the small intestine of PE sensitized and challenged
mice (FIGS. 8C, 8D and FIGS. 12 and 13). Mice treated with the
Cyp11a1 inhibitor at a dose of 20 mg/kg demonstrated markedly
reduced numbers of mast cells as well as mucus-producing goblet
cells in the mucosa of the small intestine. To detect mast cell
degranulation, plasma levels of histamine were measured within 30
minutes of the last antigen challenge. Challenge of sensitized mice
resulted in detection of increased levels of histamine in plasma;
following treatment with AMG (20 mg/kg), significantly lower levels
of plasma histamine were detected (FIG. 8E).
[0127] As the inhibitor was administered after sensitization,
levels of peanut-specific IgE, IgG1, and IgG2a were unaffected by
AMG administration (FIG. 14). Together, these results demonstrate
that AMG is a potent inhibitor of the enzymatic activity of Cyp11a1
in vivo without affecting mRNA expression or protein levels of the
enzyme. These data demonstrate Cyp11a1's involvement in the
triggering of allergic diarrhea and symptoms, intestinal
inflammation, and goblet cell metaplasia.
Example 9
[0128] This example demonstrates that the inhibition of Cyp11a1
enzymatic activity suppresses Th2 and Th17 cytokine production
without impacting the expression of lineage-specific transcription
factors in vivo.
[0129] Th2 and Th17 cells have been implicated in the development
of allergic disorders, including asthma and food allergy (Wang, M.,
et al. J. Allergy Clin. Immunol. 130, 932-944 (2012); Wills-Karp,
M., et al. Science 282, 2258-2261 (1998); Corren, J., et al. N.
Engl. J. Med. 365, 1088-1098 (2011); Kolls, J. K., & Linden, A.
Immunity 21, 467-476 (2004); Lajoie, S., et al. Nature Immunol. 11,
928-935 (2010)). PE sensitization and challenge increased IL4,
IL13, and IL17A but not IFNG mRNA expression in the small intestine
(FIG. 9A). In parallel, expression of the lineage-specific
transcription factors GATA3 and ROR.gamma.t mRNA were significantly
increased in sensitized and challenged mice while levels of T-bet
mRNA were not altered (FIG. 9B). After treatment with AMG (20
mg/kg), IL4, IL13, and IL17A mRNA expression were reduced to
baseline levels, but expression levels of T-bet, GATA3, or
ROR.gamma.t mRNA were not affected (FIG. 9B), indicating that the
effects on cytokine transcription were mediated downstream of these
transcription factors. Given that transcription factor expression
was still increased in AMG-treated animals, drug toxicity as an
explanation of the effects on cytokine expression was
eliminated.
Example 10
[0130] This example demonstrates that the inhibition of Cyp11a1
enzymatic activity suppresses Th2 and Th17 cell differentiation in
vitro without affecting lineage-specific transcription factor or
Cyp11a1 expression.
[0131] Naive Th cells differentiate into Th1, Th2, and Th17 cells
under the control of specific polarizing cytokines and master
transcription factors (Zhu, J., et al. Annu. Rev. Immunol. 28,
445-489 (2010)). The inventors demonstrate the effect of Cyp11a1
inhibition on Th cell differentiation in vitro. Isolated
CD4.sup.+CD45RB.sup.+ T cells from spleens of naive TCR transgenic
mice (OT II mice) were cultured under Th1, Th2, and Th17 polarizing
conditions in the presence or absence of the inhibitor AMG for 6
days and then stimulated with anti-CD3/anti-CD28.
[0132] Addition of AMG to cultured CD4 T cells under Th1, Th2, and
Th17 polarizing conditions had significant and distinct effects. In
polarized cells, Cyp11a1 mRNA expression was approximately 300-fold
higher in Th2 cells compared to Th1 cells and 10-fold higher in
Th17 cells compared to Th1 cells (FIG. 10A). The addition of AMG
(400 .mu.M) to the cell cultures did not suppress expression levels
of Cyp11a1 mRNA or protein in the polarized Th1, Th2, or Th17 cells
(FIGS. 10B, 10C). As shown in FIG. 10D, levels of pregnenolone were
highest in the culture supernates from polarized Th2 cells, with
lower levels released from Th17 cells, followed by release from Th1
cells. Addition of AMG (400 .mu.M) during the polarization of Th
cells in vitro significantly decreased levels of pregnenolone in
the culture supernates from Th2 cells but not in Th1 cells. Levels
in cultures of polarized Th17 cells were also reduced by AMG, but
the decreases did not reach statistical significance. These results
confirmed the findings that the inhibitory activity of AMG appeared
restricted to the enzymatic activity of Cyp11a1 without affecting
gene transcription or translation. Further, the data demonstrated
the highest levels of Cyp11a1 expression and enzymatic activity in
Th2 cells with little to no expression or activity in Th1
cells.
[0133] In the culture supernatants of polarized Th2 cell cultures,
levels of IL-13 were decreased in the presence of the inhibitor
(FIG. 10E); levels of IL-17A were decreased by the inhibitor in
polarized Th17 cell cultures, but levels of IFN-.gamma. were not
affected by the inhibitor in polarized Th1 cell cultures. In
parallel, the inhibitor decreased levels of IL13 and IL17A mRNA in
polarized Th2 and Th17 cells, respectively (FIG. 10F) but no
significant effects of the inhibitor were detected on IFNG mRNA
expression in Th1 cells. Consistent with results from the in vivo
studies, the inhibitor (400 .mu.M) did not have any effect on
lineage-specific transcription factor mRNA expression, T-bet,
GATA3, or ROR.gamma.t mRNA in polarized Th1, Th2, and Th17 cells,
respectively (FIG. 10F).
Example 11
[0134] This example demonstrates that shRNA-mediated silencing of
Cyp11a1 reduces Th2 cytokine expression.
[0135] To confirm the importance of Cyp11a1 in Th cell
differentiation, the inventors used snRNA-mediated silencing of
Cyp11a1 in polarized Th2 cells. Polarized Th2 CD4 T cells were
transduced with retroviruses co-expressing cyan fluorescent protein
(CFP) with control (luciferase) or Cyp11a1 shRNA. Seventy-two hours
after transduction, CFP.sup.+CD4.sup.+ cells were sorted and
stimulated with 2 .mu.g/ml anti-CD3/CD28 for 6 and 24 hours. To
confirm the effectiveness of Cyp11a1 gene silencing, the inventors
demonstrated reduced levels of Cyp11a1 mRNA in Th2 CD4 T cells
compared to silencing with the control shRNA (FIG. 11A). As a
result, levels of pregnenolone in supernates of cultured Th2 cells
transfected with Cyp11a1 shRNA were significantly reduced compared
to those transfected with control shRNA (FIG. 11B).
[0136] Levels of IL4 and IL13 mRNA were decreased in Th2 CD4 T
cells transfected with Cyp11a1 shRNA compared to those transfected
with control shRNA, without affecting levels of GATA3 mRNA (FIG.
11C). In parallel, levels of IL-4 and IL-13 were reduced in
supernatants of Th2 CD4 T cell cultures transfected with Cyp11a1
shRNA (FIG. 11D). These results demonstrate that silencing of
Cyp11a1 in polarized Th2 CD4 T cells resulted in decreased levels
of IL4 and IL-13 mRNA and protein without affecting GATA3
transcription. These results indicated that Cyp11a1 upregulation
and activation is downstream of GATA3.
[0137] All of the documents cited herein are incorporated herein by
reference.
[0138] While various embodiments of the present invention have been
described in detail, it is apparent that modifications and
adaptations of those embodiments will occur to those skilled in the
art. It is to be expressly understood, however, that such
modifications and adaptations are within the scope of the present
invention, as set forth in the following exemplary claims.
REFERENCES
[0139] 1. Kim, H. Y., et al. The many paths to asthma: phenotype
shaped by innate and adaptive immunity. Nat. Immunol. 11, 577-584
(2011). [0140] 2. Holgate, S. T. Innate and adaptive immune
responses in asthma. Nat Med. 18, 673-683 (2012). [0141] 3.
Gelfand, E. W. and Dakhama, A. CD8.sup.+ T lymphocytes and
leukotriene B4: Novel interactions in the persistence and
progression of asthma. J. Allergy Clin. Immunol. 117, 577-582
(2006). [0142] 4. Hamelmann, E. et al. Requirement for CD8.sup.+ T
cells in the development of airway hyperresponsiveness in a murine
model of airway sensitization. J. Exp. Med. 183, 1719-1729 (1996).
[0143] 5. Miyahara, N. et al. Contribution of antigen-primed CD8+ T
cells to the development of airway hyperresponsiveness and
inflammation is associated with IL-13. J. Immunol. 172, 2549-2558
(2004). [0144] 6. Miyahara, N. et al. Leukotriene B4 (BLT1) is
essential for allergen-mediated recruitment of CD8.sup.+ T cells
and airway hyperresponsiveness. J. Immunol. 174, 4979-4984 (2005).
[0145] 7. Koya, T. et al. CD8.sup.+ T cell-mediated airway
hyperresponsiveness and inflammation is dependent on
CD4.sup.+IL-4.sup.+ T cells. J. Immunol. 179, 2787-2796 (2007).
[0146] 8. LaVoie, H. A. and King, S. R. Transcriptional regulation
of steroidogenic genes: STARD1, CYP11A1 and HSD3B. Exp. Biol. Med.
234, 880-907 (2009). [0147] 9. Shih, M. C. et al. Mutation of mouse
Cyp11a1 promoter caused tissue-specific reduction of gene
expression and blunted stress response without affecting
reproduction. Mol. Endocrinol. 22, 915-923 (2008). [0148] 10.
National Asthma Education and Prevention Program (National Heart
Lung and Blood Institute) Third Expert Panel on the Management of
Asthma. National Center for Biotechnology Information (U.S.).
Expert panel report 3 guidelines for the diagnosis and management
of asthma. Bethesda, Md.: National Institutes of Health National
Heart Lung and Blood Institute; 2007. Available from:
www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=asthma3.TOC&depth=2.
[0149] 11. Guidelines for the diagnosis and management of asthma.
Bethesda, Md.: National Institutes of Health National Heart Lung
and Blood Institute; 2007. Available from:
www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=asthma3.TOC&depth=2.
[0150] 12. Martin, R. J. et al. The predicting response to inhaled
corticosteroid efficacy (price) trial. J. Allergy Clin. Immunol.
119, 73-80 (2007). [0151] 13. Li, L. B. et al. ATF2 impairs
glucocorticoid receptor-mediated transactivation in human CD8.sup.+
T cells. Blood 110, 1570-1577 (2007). [0152] 14. Payne, A. H.
Hormonal regulation of cytochrome P450 enzymes, cholesterol
side-chain cleavage and 17 alpha-hydroxylase/C17-20 lyase in Leydig
cells. Biol. Reprod. 42, 399-404 (1990). [0153] 15. van Rensen, E.
L. et al. Bronchial CD8 cell infiltrate and lung function decline
in asthma. Am. J. Respir. Crit. Care Med. 172, 837-841 (2005).
[0154] 16. Mosmann, T. R., and Coffman, R. L. TH1 and TH2 cells:
different patterns of lymphokine secretion lead to different
functional properties. Annu. Rev. Immunol. 7, 145-173 (1989).
[0155] 17. Seder, R. A. et al. D8.sup.+ T cells can be primed in
vitro to produce IL-4. J. Immunol. 148, 1652-1656 (1992). [0156]
18. Croft, M. et al. Generation of polarized antigen-specific CD8
effector populations:
[0157] reciprocal action of interleukin (IL)-4 and IL-12 in
promoting type 2 versus type 1 cytokine profiles. J. Exp. Med. 180,
1715-1728 (1994). [0158] 19. Pestell, R. G. et al. Stimulation of
the P-450 side chain cleavage enzyme (CYP11A1) promoter through
ras- and Ets-2-signaling pathways. Mol. Endocrinol. 10, 1084-1094
(1996). [0159] 20. Al Kandari, H. et al. Homozygous mutation of
P450 side-chain cleavage enzyme gene (CYP11A1) in 46,XY patient
with adrenal insufficiency, complete sex reversal, and agenesis of
corpus callosum. J. Clin. Endocr. Metab. 91, 2821-2826 (2006).
[0160] 21. Kim, C. J. et al. Severe combined adrenal and gonadal
deficiency caused by novel mutations in the cholesterol side-chain
cleavage enzyme, P450scc. J. Clin. Endocrinol. Metab. 93, 696-702
(2008). [0161] 22. Robel, P. et al. Biosynthesis and assay of
neurosteroids in rats and mice. J. Steroid Biochem. Molec. Biol.
53, 355-360 (1995). [0162] 23. Slominski, A. et al. An alternative
pathway of vitamin D metabolism. Cytochrome P450scc
(CYP11A1)-mediated conversion to 20-hydroxyvitamin D2 and 17,
20-dihydroxyvitamin D2. FEBS J. 273, 2891-2901 (2006). [0163] 24.
Oka, H. et al. Breakdown of Th cell immune responses and
steroidogenic CYP11A1 expression in CD4.sup.+ T cells in a murine
model implanted with B16 melanoma. Cell. Immunol. 206, 7-15 (2000).
[0164] 25. Sundrud, M. S. and Nolan, M. A. Synergistic and
combinatorial control of T cell activation and differentiation by
transcription factors. Curr. Opin. Immunol. 22, 286-292 (2010).
[0165] 26. Amsen, D. et al. How are T(H)1 and T(H)2 effector cells
made? Curr. Opin. Immunol. 21, 153-160 (2009). [0166] 27. Miyahara,
N. et al. Effector memory CD8+ T cells mediate airway
hyperresponsiveness, inflammation and remodeling. Nature Med. 10,
865-869 (2004). [0167] 28. Ohnishi, H. et al. Corticosteroids
enhance CD8+ T cell-mediated airway hyperresponsiveness and
allergic inflammation by upregulating leukotriene B4 receptor 1. J.
Allergy Clin. Immunol. 121, 864-871 (2008). [0168] 29. Samy, T. S.
et al. Divergent immune responses in male and female mice after
trauma-hemorrhage: Dimorphic alterations in T lymphocyte
steroidogenic enzyme activities. Endocrinology 142, 3519-3529
(2001). [0169] 30. Pottratz, S. T. et al. 17.quadrature.-Estradiol
inhibits expression of human interleukin-6 promoter-receptor
constructs by a receptor-dependent mechanism. J. Clin. Invest. 93,
944-950 (1994). [0170] 31. De Bosscher, K., Vanden Berghe, W.,
& Haegeman, G. The interplay between the glucocorticoid
receptor and nuclear factor-kappaB or activator protein-1:
molecular mechanisms for gene repression. Endocr. Rev. 24, 488-522
(2003). [0171] 32. De Bosscher, K, & Haegeman, G. Minireview:
latest perspectives on antiinflammatory actions of glucocorticoids.
Mol. Endocrinol. 23, 281-291 (2009). [0172] 33. Chrousos, G. P. The
hypothalamic-pituitary-adrenal axis and immune-mediated
inflammation. N. Engl. J. Med. 332, 1351-1362 (1995). [0173] 34.
Barnes, P J. Glucocorticosteroids: current and future directions.
Br. J. Pharmacol. 163:29-43 (2011). [0174] 35. Faubion, W. A. Jr.,
Loftus, E. V. Jr., Harmsen, W. S., Zinsmeister, A. R., &
Sandborn, W. J. The natural history of corticosteroid therapy for
inflammatory bowel disease: a population-based study.
Gastroenterology 121, 255-260 (2001). [0175] 36. Cima, I., et al.
Intestinal epithelial cells synthesize glucocorticoids and regulate
T cell activation. J. Exp. Med. 200, 1635-1646 (2004). [0176] 37.
Ohnishi, H., et al. Corticosteroids enhance CD8+ T cell-mediated
airway hyperresponsiveness and allergic inflammation by
upregulating leukotriene B4 receptor 1. J. Allergy Clin. Immunol.
121, 864-871 (2008). [0177] 38. Payne, A. H. Hormonal regulation of
cytochrome P450 enzymes, cholesterol side-chain cleavage and 17
alpha-hydroxylase/C17-20 lyase in Leydig cells. Biol. Reprod. 42,
399-404 (1990). [0178] 39. Pazirandeh, A., et al. Paracrine
glucocorticoid activity produced by mouse thymic epithelial cells.
FASEB J. 13, 893-901 (1999). [0179] 40. Shih, M. C., Chiu, Y. N.,
Hu, M. C., Guo, I. C., & Chung, B. C. Regulation of steroid
production: analysis of Cyp11a1 promoter. Mol. Cell. Endocrinol.
336, 80-84 (2011). [0180] 41. Pang, S., et al. Inherited congenital
adrenal hyperplasia in the rabbit: absent cholesterol side-chain
cleavage cytochrome P450 gene expression. Endocrinology 131,
181-186 (1992). [0181] 42. Yang, X., et al. Inherited congenital
adrenal hyperplasia in the rabbit is caused by a deletion in the
gene encoding cytochrome P450 cholesterol side-chain cleavage
enzyme. Endocrinology 132, 1977-1982 (1993). [0182] 43. Kim, C. J.,
et al. Severe combined adrenal and gonadal deficiency caused by
novel mutations in the cholesterol side chain cleavage enzyme,
P450scc. J. Clin. Endocrinol. Metab. 93, 696-702 (2008). [0183] 44.
Al Kandari, H., Katsumata, N., Alexander, S., & Rasoul, M. A.
Homozygous mutation of P450 side-chain cleavage enzyme gene
(CYP11A1) in 46,XY patient with adrenal insufficiency, complete sex
reversal, and agenesis of corpus callosum. J. Clin. Endocrinol.
Metab. 91, 2821-2826 (2006). [0184] 45. Tajima, T., Fujieda, K.,
Kouda, N., Nakae, J., & Miller, W. L. Heterozygous mutation in
the cholesterol side chain cleavage enzyme (p450scc) gene in a
patient with 46,XY sex reversal and adrenal insufficiency. J. Clin.
Endocrinol. Metab. 86, 3820-3825 (2001). [0185] 46. Parajes, S., et
al. A novel entity of clinically isolated adrenal insufficiency
caused by a partially inactivating mutation of the gene encoding
for P450 side chain cleavage enzyme (CYP11A1). J. Clin. Endocrinol.
Metab. 96, E1798-E1806 (2011). [0186] 47. Dexter, R. N., Fishman,
L. M., Ney, R. L., & Liddle, G. W. Inhibition of adrenal
corticosteroid synthesis by aminoglutethimide: studies of the
mechanism of action. J. Clin. Endocrinol. Metab. 27, 473-480
(1967). [0187] 48. Wang, M., et al. Peanut-induced intestinal
allergy is mediated through a mast cell-IgE-FcepsilonRI-IL-13
pathway. J. Allergy Clin. Immunol. 126, 306-316 (2010). [0188] 49.
Brandt, E. B., et al. Mast cells are required for experimental oral
allergen-induced diarrhea. J. Clin. Invest. 112, 1666-1677 (2003).
[0189] 50. Wang, M., et al. Inhibition of Pim1 kinase prevents
peanut allergy by enhancing Runx3 expression and suppressing T(H)2
and T(H)17 T-cell differentiation. J. Allergy Clin. Immunol. 130,
932-944 (2012). [0190] 51. Wills-Karp, M., et al. Interleukin-13:
central mediator of allergic asthma. Science 282, 2258-2261 (1998).
[0191] 52. Corren, J., et al. Lebrikizumab treatment in adults with
asthma. N. Engl. J. Med. 365, 1088-1098 (2011). [0192] 53. Kolls,
J. K., & Linden, A. Interleukin-17 family members and
inflammation. Immunity 21, 467-476 (2004). [0193] 54. Lajoie, S.,
et al. Complement-mediated regulation of the IL-17A axis is a
central genetic determinant of the severity of experimental
allergic asthma. Nature Immunol. 11, 928-935 (2010). [0194] 55.
Zhu, J., Yamane, H., & Paul, W. E. Differentiation of effector
CD4 T cell populations. Annu. Rev. Immunol. 28, 445-489 (2010).
[0195] 56. Islam, S. A., & Luster, A. D. T cell homing to
epithelial barriers in allergic disease. Nature Med. 18, 705-715
(2012). [0196] 57. Knight, A. K., et al. CD4 T cells activated in
the mesenteric lymph node mediate gastrointestinal food allergy in
mice. Am. J. Physiol. Gastrointest. Liver Physiol. 293, G1234-G1243
(2007). [0197] 58. Prussin, C., Lee, J., & Foster, B.
Eosinophilic gastrointestinal disease and peanut allergy are
alternatively associated with IL-5+ and IL-5--TH2 responses. J.
Allergy Clin. Immunol. 124, 1326-1332 (2009). [0198] 59. DeLong, J.
H., et al. Ara h 1-reactive T cells in individuals with peanut
allergy. J. Allergy Clin. Immunol. 127, 1211-1218 (2011). [0199]
60. Beyer, K., et al. Human milk-specific mucosal lymphocytes of
the gastrointestinal tract display a TH2 cytokine profile. J.
Allergy Clin. Immunol. 109, 707-713 (2002). [0200] 61. Rhen, T.,
& Cidlowski, J. A. Antiinflammatory action of
glucocorticoids-new mechanisms for old drugs. N. Engl. J. Med. 353,
1711-1723 (2005). [0201] 62. Mueller, M., et al. The nuclear
receptor LRH-1 critically regulates extra-adrenal glucocorticoid
synthesis in the intestine. J. Exp. Med. 203, 2057-2062 (2006).
[0202] 63. Cima, I., Fuhrer, A., & Brunner, T. Antagonistic and
synergistic effects of glucocorticoids and IL-7 on CD4+ T cell
activation. Immunol. Lett. 106, 99-102 (2006). [0203] 64. LaVoie,
H. A., & King, S. R. Transcriptional regulation of
steroidogenic genes: STARD1, CYP11A1 and HSD3B. Exp. Biol. Med.
234, 880-907 (2009). [0204] 65. Wei, G., et al. Genome-wide
analyses of transcription factor GATA3-mediated gene regulation in
distinct T cell types. Immunity 35, 299-311 (2011). [0205] 66.
Sher, N., Yivgi-Ohana, N., & Orly, J. Transcriptional
regulation of the cholesterol side chain cleavage cytochrome P450
gene (CYP11A1) revisited: binding of GATA, cyclic adenosine
3',5'-monophosphate response element-binding protein and activating
protein (AP)-1 proteins to a distal novel cluster of cis-regulatory
elements potentiates AP-2 and steroidogenic factor-1-dependent gene
expression in the rodent placenta and ovary. Mol. Endocrinol. 21,
948-962 (2007). [0206] 67. Oka, H., Emori, Y, Hayashi, Y, &
Nomoto, K. Breakdown of Th cell immune responses and steroidogenic
CYP11A1 expression in CD4+ T cells in a murine model implanted with
B16 melanoma. Cell. Immunol. 206, 7-15 (2000). [0207] 68. Li, X.
M., et al. A murine model of peanut anaphylaxis: T- and B-cell
responses to a major peanut allergen mimic human responses. J.
Allergy Clin. Immunol. 106, 150-158 (2000). [0208] 69. Tomkinson,
A., et al. Temporal association between airway hyperresponsiveness
and airway eosinophilia in ovalbumin-sensitized mice. Am. J.
Respir. Crit. Care Med. 163, 721-730 (2001). [0209] 70. Komine, O.,
et al. The Runx1 transcription factor inhibits the differentiation
of naive CD4+ T cells into the Th2 lineage by repressing GATA3
expression. J. Exp. Med. 198, 51-61 (2003). [0210] 71. Ashino, S.,
et al. A T(h)17-polarized cell population that has infiltrated the
lung requires cells that convert to IFN-{gamma} production in order
to induce airway hyperresponsiveness. Intl. Immunol. 22, 503-513
(2010). [0211] 72. Musselman, C. A., et al. Bivalent recognition of
nucleosomes by the tandem PHD fingers of the CHD4 ATPase is
required for CHD4-mediated repression. Proc. Natl. Acad. Sci. USA
109, 787-792 (2012). [0212] 73. Maier, H., et al. Requirements for
selective recruitment of Ets proteins and activation of
mb-1/Ig-alpha gene transcription by Pax-5 (BSAP). Nucleic Acids
Res. 31, 5483-5489 (2003). [0213] 74. Pham, D., Vincentz, J. W.,
Firulli, A. B., & Kaplan, M. H. Twist1 regulates
IFN.quadrature. expression in Th1 cells by interfering with Runx3
function. J. Immunol. 189, 832-840 (2012). [0214] 75. Wang, M., et
al. Peanut-induced intestinal allergy is mediated through a mast
cell-IgE-FcepsilonRI-IL-13 pathway. J. Allergy Clin. Immunol.
126:306-316 (2010). [0215] 76. Li, X. M., et al. A murine model of
peanut anaphylaxis: T- and B-cell responses to a major peanut
allergen mimic human responses. J. Allergy Clin. Immunol.
106:150-158 (2000). [0216] 77. Ashino, S., et al. A
T(h)17-polarized cell population that has infiltrated the lung
requires cells that convert to IFN-{gamma} production in order to
induce airway hyperresponsiveness. Intl. Immunol. 22:503-513
(2010). [0217] 78. Ohnishi, H., et al. Corticosteroids enhance CD8+
T cell-mediated airway hyperresponsiveness and allergic
inflammation by upregulating leukotriene B4 receptor 1. J. Allergy
Clin. Immunol. 121:864-871 (2008).
Sequence CWU 1
1
318PRTArtificial SequenceSynthetic peptide 1Ser Ile Ile Asn Phe Glu
Lys Leu1 5255DNAArtificial SequenceSynthetic primer 2ttcaataaag
ctgatgagta ttcaagagat actcatcagc tttattgatt ttttc
55359DNAArtificial SequenceSynthetic primer 3tcgagaaaaa atcaataaag
ctgatgagta tctcttgaat actcatcagc tttattgaa 59
* * * * *
References