Rapid Method Of Generating Live Attenuated Vaccines

Abstract

The present invention relates to a method of generating a live attenuated vaccine. The present invention also relates to a live attenuated vaccine produced according to the method of the invention.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority of Singapore application no. 10201602980W, filed on 14 Apr. 2016, the contents of it being hereby incorporated by reference in its entirety for all purposes.

FIELD OF THE INVENTION

[0002] The invention relates to a method of generating a live attenuated vaccine, in particular, a live attenuated viral vaccine.

BACKGROUND OF THE INVENTION

[0003] Live attenuated vaccines (LAVs) are vaccines that contain pathogens, including viruses that are viable but have reduced virulence. LAVs are typically more effective than inactivated vaccines and have been successful in preventing many viral diseases, including smallpox, chickenpox, measles, mumps, rubella and yellow fever.

[0004] Conventionally, LAV development has mostly relied on chance discovery of attenuated strains of pathogens upon serial passage in cell lines or animals. More recently, targeted site-directed mutagenesis has been employed to develop "attenuated" strains of pathogens although these candidates have yet to be translated into vaccines for use in humans. Consequently, identifying suitably attenuated strains of pathogens for further development into vaccines remains a lengthy process, typically involving years, with a hit or miss outcome. In addition to unreliable outcomes, current methods of vaccine development involve significant costs.

[0005] Therefore, there is a need to provide a rapid and reliable method to generate LAVs that overcome, or at least ameliorate the disadvantages described above.

SUMMARY OF THE INVENTION

[0006] In one aspect, there is provided a method of generating a live attenuated vaccine (LAV) comprising the steps of: [0007] a) modifying an original virus to generate at least one genetically distinct maladapted virus; [0008] b) infecting a host cell with said at least one maladapted virus; [0009] c) selecting a host cell that displays a preselected phenotype in response to said infection with said at least one maladapted virus and isolating the viral nucleic acid of said maladapted virus from the host cell; [0010] d) sequencing the isolated viral nucleic acid of said maladapted virus and comparing this to the nucleic acid sequence of the original virus; [0011] e) reconstructing the maladapted virus from the original virus to produce a candidate live attenuated vaccine; and [0012] f) screening said candidate live attenuated vaccine for a predetermined phenotype.

[0013] In another aspect, there is provided a live attenuated vaccine produced according to the method as described herein.

DEFINITIONS

[0014] The following words and terms used herein shall have the meaning indicated:

[0015] "Vaccine" refers to a biological preparation that provides acquired immunity to a particular disease. A vaccine comprises an agent that stimulates the immune response to give rise to acquired immunity. The agent in a vaccine may include but is not limited to one or more of an inactivated pathogen, an attenuated pathogen, an inactivated toxin (toxoid), a protein subunit or a conjugate of an antigen and a carrier.

[0016] "Live attenuated vaccine" or "LAV" refers to a vaccine that comprises an attenuated virus that is viable but has a reduced virulence.

[0017] The terms "modifying" and "modification" with respect to an original virus refer to the generation of one or more genetically distinct maladapted viruses from an original virus.

[0018] A maladapted virus is one which is maladapted to the intended host to prevent adaptation of the virus to the host's innate immunity. Modification also allows the generation of a population of genetically diverse viruses for selection of a variety of diverse viruses for downstream applications. Maladapted viruses may be generated by any means that introduces genetic changes into the genome of a virus.

[0019] "Host cell" refers to a cell that is to be, or is, infected with a virus of interest. Similarly, a "host organism" refers to an organism that is to be, or is, infected with a virus of interest.

[0020] "Inducible reporter" refers to a reporter gene whose expression is under the control of a promoter element. Activation of the promoter element by, for example a transcription factor, induces the expression of the reporter gene. Expression of the reporter gene can then be detected by suitable detection means.

[0021] "Innate immunity" will be generally understood to those skilled in the art to refer to the non-specific defense mechanism that is activated immediately or shortly after exposure to an antigen. Mechanisms involved in the innate immune response may include physical barriers such as epithelial surfaces, activation of inflammatory responses, phagocytosis, complement activation, activation of Toll-like receptors and secretion of cytokines such as interferons.

[0022] "Site directed mutagenesis" refers to the introduction of one or more specific mutations at one or more predetermined locations within a nucleic acid sequence.

[0023] "Reconstructed virus" refers to a virus that has been generated by altering the genome of an original virus to replicate the genome of a maladapted virus. In particular, the sequence of the original virus is altered to conform to the sequence of the maladapted virus.

[0024] Alteration of the genome of the original virus may be by mutagenesis, such as site directed mutagenesis, of one or more infectious clones generated from the virus and/or by excision or insertion of sections of nucleic acids. "Reconstructed virus" may also refer to a viral genome that has been synthesized chemically, in the absence of cells. Chemical synthesis of a viral genome may involve the chemical synthesis of short fragments of nucleic acids and assembly of the fragments together to form a synthetic viral genome. A reconstructed virus may also be replicated in a host cell to scale up production of the reconstructed virus for downstream applications.

[0025] "Infectious clone" refers to a plasmid comprising viral genetic material that has been introduced into the plasmid. Infectious clones may be generated using routine methods well known to those skilled in the art.

[0026] "Operably linked" or "operatively linked" refers to the relationship between two or more nucleotide sequences that interact physically or functionally. For example, a promoter or regulatory nucleotide sequence is said to be operably linked to a nucleotide sequence that codes for a RNA or a protein if the two sequences are situated such that the regulatory nucleotide sequence will affect the expression level of the coding or structural nucleotide sequence. A 5' portion of a gene is operatively or operably linked with a 3' portion of a gene if the two portions are situated to form a functional gene.

[0027] "Nucleic acid" means any single or double-stranded RNA or DNA molecule, such as mRNA, cDNA, genomic DNA and xeno DNA.

[0028] It will be generally understood that the term "growth rate" of a virus refers to the replication rate of the virus within a host cell or host organism. It will also be generally understood that a host cell or host organism may be infected with a virus for a predetermined period of time. Growth or replication rate of a virus may be determined by measuring the percentage of host cells infected with a specific viral nucleic acid or protein at predetermined time intervals.

[0029] "Virus" refers broadly to an infectious agent that replicates within the cells of other organisms. Viruses may be classified based on their nucleic acid (RNA or DNA), whether the nucleic acid is single stranded or double stranded, whether reverse transcriptase is utilized, and if their nucleic acid is single stranded RNA, whether it is sense (+) or antisense (-).

[0030] "Serotype" means an immunologically distinguishable variant of a virus antigen such that one serotype may be distinguished by an immune system from a different serotype. For example, dengue virus serotype 1 is immunologically distinguishable from dengue virus serotype 2.

[0031] "Virus strain" refers to a genetic variant or subtype of a virus species or serotype. It will be generally understood that strains may have similar or different phenotypes, including but not limited to virulence, rate of growth and infectivity.

[0032] "Dengue virus" refers to a small, enveloped, positive-stranded RNA virus that belongs to the Flavivirus genus of the Flaviviridae family. There are four dengue virus serotypes: dengue-1 (DENV-1 or D1), dengue-2 (DENV-2 or D2), dengue-3 (DENV-3 or D3), and dengue-4 (DENV-4 or D4). Each one of these subtypes forms an antigenically distinct subgroup within the flavivirus family.

[0033] "Zika virus" refers to a positive-stranded RNA virus that belongs to the Flavivirus genus of the Flaviviridae family. At present, one Zika virus (ZIKV) serotype has been identified. Strains of ZIKV can be grouped into two distinct genetic lineages, African and Asian.

[0034] It will be generally understood that the term "immunogenicity" of a virus refers to the propensity of a virus to trigger the immune response of a host cell or organism. Immunogenicity may be measured by the expression or upregulation of the expression of markers associated with the immune response.

[0035] It will be generally understood that the expression or upregulation of the expression markers may be determined by assays routine in the art, including but not limited to gene expression assays and protein assays. Gene expression assays include but are not limited to polymerase chain reaction (PCR) and microarray. It will be understood that PCR includes real time PCR, quantitative and semi-quantitative PCR. The expression or upregulation of the expression of markers may also be determined by protein assays including but not limited to Western blotting and ELISA.

[0036] It will be generally understood that "virus uptake" refers to the infectivity of a virus. Virus uptake may be determined by measuring the amount of viral specific nucleic acid sequences or protein within the host cell or host organism.

[0037] "Sterilizing immunity" refers to an immune status wherein infection of a host by a virus is prevented as a result of vaccination. Sterilizing immunity may be indicated by undetectable levels of viremia in a host.

[0038] "Subject" refers to an animal or plant. Examples of animals include but are not limited to a primate, a mouse, a rat, a guinea pig, a rabbit or a dog. In a preferred embodiment, the subject is a human.

[0039] The invention illustratively described herein may suitably be practised in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms "comprising", "including", "containing", etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the inventions embodied therein may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.

[0040] The invention has been described broadly and generically herein. Each of the narrower species and sub-generic groupings falling within the generic disclosure also form part of the invention.

[0041] Other embodiments are within the following claims and non-limiting examples. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.

BRIEF DESCRIPTION OF THE DRAWINGS

[0042] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings, in which:

[0043] FIG. 1 is a heat map of innate immune genes and antiviral proteins in cells infected with each DENV strain relative to uninfected cells and shows that DENV-2 PDK53 infection strongly up-regulates host immune response. Whole genome microarray analysis was performed on Human hepatoma-7 (HuH-7) cells infected with DENV-2 and DENV-3 vaccine and wild-type strains at 10 multiplicity of infection (MOI) for 24 hours. Additionally DENV-2 PDK53 infection was performed at 1 MOI for 24 hours. Expression levels of innate immune genes including cytokines, interferon and other related antiviral proteins, relative to cells infected with each DENV strain relative to uninfected cells, are shown.

[0044] FIG. 2 are bar graphs of gene expression levels of (A) IFN.alpha. and (B) IFN.beta. in Madin Darby Canine Kidney (MDCK) cells and shows that DENV-2 PDK53 but not DENV-3 PGMK30 blocks the antiviral response in each case. MDCK cells were stimulated with Polyinosinic-polycytidylic acid (poly (LC)) (10 .mu.g/ml) or infected with DENV-2 PDK53, DENV-2 16681, DENV-3 PGMK30 and DENV-3 16562 at 10 or 1 MOI and were evaluated for their expression levels of IFN.alpha. and IFN.beta. using real-time PCR. ** and NS denote p<0.01 and not significant, respectively.

[0045] FIG. 3 shows confocal images of cells that were uninfected and untreated (negative control), interferon-treated (positive control), surrounding YF-17D or DENV focus of infection and corresponding Mander's co-localisation coefficient measurements for STAT1 activation in baby hamster kidney BHK-21 cells. A) shows representative confocal microscopy images of cells--Top row shows single cell nucleus composite image of an uninfected cell, near the focus of infection; Second and Third rows show single-channel images of the same cell showing pSTAT1 or cell nucleus, respectively. (B) shows Mander's co-localisation coefficient measurements for nuclear-translocated pSTAT1 measured in uninfected cells in the periphery of viral foci. Levels of nuclear translocated pSTAT1 were similar for PDK53 and YF-17D, both of which were significantly higher compared to 16681, 16562 and PGMK30. P-values were calculated using a two-tailed t-test; ** indicates p<0.01.

[0046] FIG. 4 are the results of plaque assays on cells silenced of major transcription factors for interferon and inflammatory responses and shows that DENV-2 PDK53 infection prevents viral spreading through the induction of innate immune responses. DENV-2 and DENV-3 vaccine and wild-type strains plaque assays at 1 MOI were performed on IRF3-, STAT1-, NF-.kappa.B p65- and NF-.kappa.B p50-silenced BHK21 cells. (A) Shows photographs of representative plaque assays for each of the viruses and knockdowns. (B) Shows plaque counts (per well of a 24-well plate) for each of the viruses and knockdowns. (C) Shows plaque size distributions of the four virus strains for control and IRF3 knockdown, along with corresponding Bayesian Information Criterion (BIC) scores for unimodal or bimodal distribution. Lower BIC scores indicate better fit for a given type of distribution if the difference is greater than or equal to 10. None of the four control siRNA treatments yielded clear-bimodal plaque size distributions. Of the four IRF3 knockdowns, the best fit for bimodal distribution is shown by PDK53 plaques with IRF3 knockdown, while plaques of the other three viruses better fit a unimodal distribution or were neither clearly unimodal nor bimodal.

[0047] FIG. 5 are line graphs of the rate of viral uptake in Human hepatoma-7 (HuH-7) cells infected with various strains of dengue virus. (A) shows that DENV-2 PDK53 infection in HuH-7 cells has a higher rate of viral uptake compared to DENV-2 16681, while (B) shows no difference in viral uptake between DENV-3 16562 and DENV-3 PGMK30. All viruses were infected at 10 MOI, and DENV-2 PDK53 was infected at 10 MOI and at 10.times. dilution (1 MOI). Rate of viral replication at 10 or 1 MOI over 24 hours was determined by real-time PCR detection of DENV-specific cross-serotype sequences.

[0048] FIG. 6 are bar graphs of viral replication rate in HuH-7 cells infected with various dengue virus strains and shows that DENV-2 PDK53 infection in HuH-7 cells has a higher viral spreading compared to DENV-2 16681, DENV-3 16562 and DENV-3 PGMK30. A, B, HuH-7 cells were infected with (A) DENV-2 and (B) DENV-3 vaccine and wild-type strains, at 1 or 0.1 MOI as indicated, for 24 hours. Significant differences in percentage-infected cells were found between day 4 with DENV-2 16681 and DENV2-PDK53 and day 3 with DENV-3 16562 and DENV3 PGMK30. Viral spreading, as implied by the percentage of infection, was measured by detecting DENV E protein using flow cytometry. ** and NS denote p<0.01 and not significant, respectively.

[0049] FIG. 7 shows a schematic describing the workflow in the generation of a live attenuated vaccine in the proposed method.

[0050] FIG. 8 shows plaque assays for PF13/251013-18 and identified mutants. (A) shows that laboratory stock of PF13/251013-18 produces plaques of varied sizes on plaque assay. (B) shows sequencing results of plaque-purified variants and demonstrates that the consensus sequence changes in the laboratory stock were also identified in the small-plaque variants. (C) shows the plaque phenotypes of infectious clone-derived viruses that were constructed based on sequences of small-plaque variants and their corresponding sequence changes. DN-1, DN-2 and DN-4 display small-plaque phenotypes on plaque assay.

[0051] FIG. 9 shows in vivo safety results of the candidate LAV. Male A129 mice were injected intraperitoneally with 10.sup.3 pfu of DN-1 or H/PF/2013 (4 mice per group). (A) shows that whilst H/PF/2013 was lethal to A129 mice, all mice injected with DN-1 survived. (B) shows that this corresponds with about 2 logs lower viremia levels when infected with DN-1 as compared to the lethal H/PF/2013 strain. (C) shows that there was no significant weight change as compared to those that received PBS as mock immunization. At 21 days post-infection, mice that received immunization with DN-1 and PBS were challenged with 10.sup.4 pfu of H/PF/2013. (D) shows that animals that received DN-1 were fully protected whilst those that received PBS showed 60% mortality. DN-1 immunization also prevented (E) weight loss in recipient animals and (F) provided sterilizing immunity against the challenge infection whereby there was undetectable viremia.

[0052] FIG. 10 shows mutations identified for DV2-3295 and DV4-2270 after following proposed workflow. (A) shows the mutations identified from DV2-3295. Plaque assay with viruses recovered from infectious clones for DV2-3295, D2-A and D2-B demonstrated that D2-A and D2-B produce small plaques as compared to DV2-3295. (B) shows that four mutations were identified from DV4-2270.

DETAILED DESCRIPTION OF THE PRESENT INVENTION

[0053] In a first aspect the present invention refers to a method of generating a live attenuated vaccine (LAV) comprising the steps of: [0054] a) modifying an original virus to generate at least one genetically distinct maladapted virus; [0055] b) infecting a host cell with said at least one maladapted virus; [0056] c) selecting a host cell that displays a preselected phenotype in response to said infection with said at least one maladapted virus and isolating the viral nucleic acid of said maladapted virus from the host cell; [0057] d) sequencing the isolated viral nucleic acid of said maladapted virus and comparing this to the nucleic acid sequence of an original virus; [0058] e) reconstructing the maladapted virus from the original virus to produce a candidate live attenuated vaccine; and [0059] f) screening said candidate live attenuated vaccine for a predetermined phenotype.

[0060] A virus may be modified to generate one or more genetically distinct maladapted viruses by any means that introduces mutations in the genome of the virus. For example, modification of a virus may be achieved by passaging the virus at least once in a cell or cell line that is of a species distinct from the intended recipient of the LAV. Advantageously, passaging the virus in a cell that is of a species other than the intended host prevents the virus from adapting to the host's innate immunity.

[0061] A suitable cell that may be used to modify a virus may be one that is obtained from a primary cell culture or a continuous cell line. The cell culture may be an adherent cell culture or a suspension cell culture. The cell may be from a human, a bovine, a canine, a murine, a rat, a fish, an insect, a rabbit or monkey cell culture line, provided the cell is of a distinct species from the intended host.

[0062] Suitable examples of cells that may be used include but are not limited to the human hepatoma cell line HuH-7, the human embryonic kidney cell line HEK293T, human embryonic diploid cells (e.g. human lung fibroblast cells WI-38 and MRC5), C6/36 mosquito cell line, Vero cells, MDCK cells and primary green monkey kidney cells. In a preferred embodiment, the cell used to maladapt a virus for subsequent selection for human vaccine applications is a MDCK cell. In yet another embodiment, the cell used to modify a virus for subsequent selection for human vaccine applications is a primary monkey kidney cell. In a further preferred embodiment, the cell used to modify a virus for subsequent selection for human vaccine applications is a C6/36 mosquito cell. In a further preferred embodiment, the cell used to modify a virus for subsequent selection for human vaccine applications is a Vero mosquito cell.

[0063] Modification of a virus may also be achieved by culturing a cell or cell line that has been infected with the virus under sub-optimal conditions. It will generally be understood that sub-optimal conditions refer to conditions under which growth of a cell or cell line is hampered. Sub-optimal conditions may include culturing a cell or cell line at a temperature that is lower or higher than 37.degree. C., passaging the cell or cell line at a density that is too low, passaging the cell or cell line in the suboptimal cell culture medium or exposing the cell to a pH that is lower or higher than 7. In a preferred embodiment, modification of a virus may be achieved by culturing a cell infected with the virus at a temperature that is lower than 37.degree. C.

[0064] Another method of modification of a virus may also be achieved by exposure to a chemical compound. For example, the chemical compound may be a chemically derived mutagen, such as ribavirin and 5-fluorouracil. The virus may be exposed to the mutagen once or may be subjected to continuous or repeated exposure. It will generally be understood, and appreciated by those of skill in the art, that the chemical compound used as well as the length of exposure to the chemical compound in order to achieve modification would vary depending on the type of virus or virus strain.

[0065] Another possible method of modifying a virus may be by random mutation of the viral genome. Random mutagenesis may be achieved by error prone polymerase chain reaction (PCR). Error prone PCR may utilize low fidelity or error prone DNA polymerase that does not have proof-reading capability. Error prone PCR may also utilize variations in reaction conditions of the PCR to introduce errors. For example, the concentration and components within the PCR reaction buffer may be varied. Thermal cycling conditions may also be varied. An example of an error prone DNA polymerase is error prone Taq DNA polymerase which has an error rate of 2.2.times.10.sup.-5 errors per nucleotide per cycle.

[0066] Subsequent to error prone PCR, PCR products may be gel purified and assembled to obtain an infectious clone. In one embodiment, assembly of PCR products may be by Gibson assembly.

[0067] It will generally be understood that modification of a virus may take place via one or more of the methods described herein, either alone or in combination.

[0068] In one embodiment, the maladapted virus may be generated by exposure of cells, infected with a virus, to 5-fluorouracil during cell culture. In another embodiment, the maladapted virus may be generated by exposure of cells, infected with a virus, to ribavirin during cell culture. In yet another embodiment, the maladapted virus may be generated by exposure of cells, infected with a virus, to 5-fluorouracil and ribavirin during cell culture.

[0069] The concentration of mutagen used may range from about 10 .mu.M to about 10 mM, from about 50 .mu.M to about 5 mM, from about 100 .mu.M to about 3 mM, from about 100 .mu.M to about 2 mM, from about 100 .mu.M to about 1 mM, from about 200 .mu.M to about 900 .mu.M, from about 300 .mu.M to about 800 .mu.M, from about 400 .mu.M to about 700 .mu.M or from about 500 .mu.M to about 600 .mu.M. In a preferred embodiment, the concentration of 5-fluorouracil is about 100 .mu.M to about 1 mM.

[0070] Cells infected with a virus may also be exposed to one or more mutagens for at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days or at least 1 week. In a preferred embodiment, cells are exposed to one or more mutagens for 5 days.

[0071] The virus may be passaged one or more times in a cell either in the presence or absence of a chemical mutagen. For example, a cell infected with the virus may be passaged 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 times. In a preferred embodiment, a virus may be passaged in a cell no more than 10 times, or no more than 5 times. In a further preferred embodiment, a virus may be passaged in a cell no more than 5 times. In a preferred embodiment, the virus may be passaged once in the presence of a chemical mutagen. The cells may be exposed to a chemical mutagen at every passage. The cells may also be exposed to a chemical mutagen at every second passage. Variation in the exposure of cells to a chemical mutagen and/or number of passages performed will be understood to be routine in the art.

[0072] In one embodiment, the virus to be modified is derived from a clinical isolate. A clinical isolate may include but is not limited to blood, blood plasma, serum, buccal smear, amniotic fluid, prenatal tissue, sweat, nasal swab, urine, organs, tissues, fractions, and cells isolated from mammals including humans. Clinical isolates also may include sections of the biological sample including tissues (for example, sectional portions of an organ or tissue). Clinical isolates may also include extracts from a biological sample, for example, an antigen from a biological fluid (for example, blood or urine). In a preferred embodiment, a clinical isolate is a virus strain isolated from blood or serum.

[0073] In one embodiment, the maladapted virus generated as described herein is then isolated, using standard methods known in the art, and used to infect a host cell, at step b) of the method as described herein. Advantageously, this host cell may also be used to select for a specific maladapted virus that induces a preselected phenotype in the host cell. For example, the host cell may comprise an inducible reporter gene, operably linked to at least one promoter associated with innate immunity to at least one virus, and the host cell may then be used to select for a specific maladapted virus with a propensity to activate, for example, a type I interferon response. Typically, when using a host cell to select for a specific maladapted virus of interest, a host cell that is of the same species as the intended vaccinee is used. In one embodiment, the host cell used to select for a specific maladapted virus that induces a predetermined phenotype in the host cell is a cell of human origin. For example, a suitable host cell is a cell of a human hepatoma cell line or a human kidney cell line. In one embodiment, the host cell used to select for specific maladapted viruses that induce a predetermined phenotype in the host cell is a HEK293T cell. In a preferred embodiment, the host cell used to select for a specific virus that induces a predetermined phenotype in the host cell is a HuH-7 cell.

[0074] It will be appreciated that inducible reporter genes are well known in the art and are typically expressed under the control of a promoter. Suitable examples of reporter genes include but are not limited to green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), .beta.-galactosidase and luciferase. In a preferred embodiment, the inducible reporter is green fluorescent protein (GFP).

[0075] The promoter element of an inducible reporter gene may be activated by one or more markers. A marker may provide an indication of a physiological state, based on its presence or absence or based on its relative levels in a cell or organism. In some embodiments the one or more markers may comprise a nucleic acid, a protein or a chemical. In yet another embodiment, a marker may be a protein or a compound associated with a biochemical pathway or with the innate immune response. Suitable examples of markers associated with innate immunity include proteins and/or genes of, or associated with, the interferon and inflammatory response pathways, such as type I interferon; an interferon-stimulated gene (ISG); Signal Transducer and Activator of Transcription 1 (STAT1); interferon regulatory factors, for example IRF3, IRF7 or IRF9; and Nuclear Factor Kappa-Light Chain-Enhancer of Activated B cells (NF-.kappa.B). Type I interferons may include IFN-.alpha. (alpha), IFN-.beta. (beta), IFN-.kappa. (kappa), IFN-.delta. (delta), IFN-.epsilon. (epsilon), IFN-.tau. (tau), IFN-.omega. (omega), and IFN-.zeta. (zeta).

[0076] In one embodiment, the inducible reporter gene may be operably linked to at least one promoter associated with innate immunity; for example, an interferon stimulated response element (ISRE). In a preferred embodiment, the inducible reporter comprises an ISRE operably linked to a green fluorescent protein (GFP) gene. In a more preferred embodiment the ISRE is associated with an IRF3-mediated response.

[0077] Selection of host cells expressing a reporter gene may be done by flow cytometry, fluorescence activated cell sorting (FACS), magnetic activated cell sorting (MACS) or laser capture microdissection. In a preferred embodiment, the host cell may be selected and isolated by FACS.

[0078] In another example, a preselected phenotype may be plaque size in a plaque assay. Plaque assays are generally understood in the art to be used for purifying or isolating a clonal population of virus or to determine viral titer. Plaque sizes may be compared relative to another plaque within the same assay or within the same plate, or relative to another plaque in a separate assay or on a separate plate. A plaque of interest may then be selected by picking the plaque from the assay or plate for subsequent applications. In a preferred embodiment, the preselected phenotype may be small plaque size relative to a host cell that has been infected with the original virus. In another embodiment, the preselected phenotype may be small plaque size relative to another plaque within the same assay or plate.

[0079] The selected host cell is then treated with general methods well known in the art to isolate the nucleic acid of the maladapted virus from the host cell.

[0080] The isolated nucleic acid of the maladapted virus from step c) is then sequenced (step d). In one embodiment, sequencing may be by Sanger sequencing or Next-Generation Sequencing. It will be appreciated by those of skill in the art that Next-Generation Sequencing encompasses a wide variety of sequencing methods including, but not limited to, whole genome sequencing, transcriptome sequencing and epigenome sequencing. In one embodiment, the Next-Generation Sequencing platform used is Deep Sequencing.

[0081] The sequence of the isolated nucleic acid of the maladapted virus is then compared to the nucleic acid sequence of the original virus. In one embodiment, the viral nucleic acid sequence of one or more maladapted viruses is compared to the nucleic acid sequence of the original virus to identify mutations that occur in more than a threshold percentage of the isolated maladapted virus sequences; for example, one or more mutations that occur in, for example, over 50% of isolated sequences. In one embodiment, the threshold percentage is at least 10% of the viral nucleic acid sequences isolated from step c). In some embodiments, the threshold percentage is at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% of the viral nucleic acid sequences isolated from step c). It will be understood that a consensus nucleic acid sequence may be determined using the threshold percentage. For example, for a given nucleic acid position, if 40% of analyzed sequences have an adenine (A), 30% of analyzed sequences have a cytosine (C), and 30% of analyzed sequences have a guanine (G), the consensus nucleic acid at this given position would be adenine (A). A consensus nucleic acid sequence may be obtained by comparing the viral nucleic acid sequence of at least 2 maladapted viruses to the nucleic acid sequence of the original virus.

[0082] Comparison of the sequence of the isolated nucleic acid of the maladapted virus to the nucleic acid sequence of the original virus from which the maladapted virus is derived may include the use of bioinformatics tools to assemble and analyze the sequences of the isolated and original viral nucleic acid. For example, sequences may be aligned to a reference genome using Burrows-Wheeler Aligner (BWA) and its variants, for example, BWA-MEM; Clustal and its variants, for example, ClustalW; or MUSCLE. SAMtools may also be used to manage and convert alignment files. A consensus sequence may also be obtained with SAMtools. Variants in nucleic acid sequence from a reference genome can also be derived with SAMtools or other programs such as LoFreq, Geneious, Unipro UGENE and the like. It will be appreciated by those of skill in the art that one, or a combination, of the tools described herein may be utilized for purposes of analyzing sequencing results.

[0083] Accordingly, it will be generally understood that the nucleic acid sequence of the maladapted virus from step c) can be obtained by Sanger sequencing or Next-Generation Sequencing (e.g. Deep sequencing), by determining a consensus sequence using a threshold percentage, by using bioinformatics tools, or combinations thereof.

[0084] In some embodiments, the maladapted virus is mutated at one or more positions within a consensus nucleic acid sequence. In other embodiments, the maladapted virus sequence is mutated at one or more positions in the maladapted virus sequence with respect to the nucleic acid sequence of the original virus. In yet another embodiment, the maladapted virus is mutated at position 876 from thymine (T) to cytosine (C), or at position 2925 from adenine (A) to guanine (G) or both.

[0085] Using the results of the sequence comparison from step d), the maladapted virus may then be reconstructed from the original virus (step e). In one embodiment, reconstruction of the maladapted virus in step e) comprises performing site directed mutagenesis on the nucleic acid sequence of the original virus to conform said original viral nucleic acid sequence to the nucleic acid sequence of the maladapted virus.

[0086] It will generally be understood that reconstruction of the maladapted virus involves standard methods known in the art. Briefly, an infectious clone of the original virus is generated. Mutations that were identified in step d) that occur in more than a threshold percentage of the isolated maladapted virus sequences are introduced into the infectious clone either by site-directed mutagenesis and/or by excision or insertion of segments of nucleic acids to replicate the genetic changes identified in the maladapted virus. The reconstructed virus may then be packaged using methods known in the art to generate a candidate live attenuated vaccine.

[0087] It will be generally understood that vaccine candidates may be screened in vitro and/or in vivo for a predetermined phenotype. A predetermined phenotype may provide an indication of the suitability and safety of the vaccine.

[0088] In one embodiment, the screening in step f) may be performed in vitro and/or in vivo. In vitro and in vivo screening may be performed sequentially or simultaneously. In vitro screening may include, but is not limited to, analysis of the growth or replication rate of the candidate live attenuated vaccine; the infectivity or uptake of the candidate live attenuated vaccine; the ability of the candidate live attenuated vaccine to trigger or induce the innate immune response in the host cell and plaque size formation. In one embodiment, in vitro screening may involve measuring: one or more of increased growth rate, immunogenicity, generation of small plaques in plaque assays and increased rate of virus uptake, relative to at least one other candidate vaccine.

[0089] The growth or replication rate of a candidate live attenuated vaccine may be determined by measuring the levels of a specific nucleic acid in a host cell that has been infected. For example, the growth rate of the candidate live attenuated dengue vaccine may be measured using the specific viral DENV E protein or nucleic acid. Growth or replication rate may also be measured at predetermined time intervals, for example, at 6-hour, 12-hour, 24-hour and 36-hour intervals. In one embodiment, measurement of growth or replication rate may be determined at 24-hour intervals.

[0090] It will be understood that prior to measuring the growth rate of the candidate live attenuated vaccine, the host cell may be infected for a preselected period of time. For example, the host cell may be infected for 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 12 hours, 24 hours or 36 hours prior to the levels of a specific viral nucleic acid in a host cell being measured. In a preferred embodiment, the host cell is infected for 2 hours prior to measurement.

[0091] In addition to growth and replication rate of a candidate live attenuated vaccine, another factor that contributes to the suitability of a candidate as a live attenuated vaccine is its immunogenicity. Immunogenicity may be determined for example by measuring virus uptake in the host cell. Virus uptake may be determined by measuring the amount of viral-specific nucleic acid sequences or protein within the host cell or host organism. In one embodiment, the viral-specific nucleic acid is a DENV specific cross-serotype sequence. It will be generally understood that amounts of viral nucleic acids for all DENV serotypes can be determined by measuring the amounts or expression levels of nucleic acids using conserved sequences (i.e. cross-serotype/pan-serotype sequences) between the various serotypes.

[0092] In vivo screening may include, but is not limited to, exposing an animal to the candidate live attenuated vaccine and analyzing the safety and potency of the candidate. Suitable animals may include mouse or non-human primate animal models. In some embodiments, such models may be inoculated with a vaccine candidate and then infected with a virus, for example dengue virus or Zika virus, and monitored for viremia, disease, weight loss, sterilizing immunity or mortality.

[0093] It will be appreciated by those of skill in the art that the present invention applies to viruses in general. Examples of viruses include but are not limited to dengue virus, Zika virus, yellow fever virus, respiratory syncytial virus, cytomegalovirus, Kaposi's sarcoma-associated herpes virus, Epstein-Barr virus, Human papillomavirus and Japanese encephalitis virus. In one embodiment, the virus is a virus of the Flaviviridae family. In another embodiment, the virus is selected from a dengue virus, a yellow fever virus, human immunodeficiency virus (HIV), Zika virus or a Japanese encephalitis virus. In a preferred embodiment, the virus is selected from the Aedes mosquito-borne group of flaviviruses, in particular DENV-1, DENV-2. DENV-3, DENV-4 and Zika. In yet another preferred embodiment, the virus is DENV-2 or DENV-3.

[0094] Examples of virus strains include, but are not limited to, strains derived from a clinical isolate. For example, a virus strain may be a strain derived by exposure of a clinical isolate to a chemical mutagen and/or multiple passaging. In one embodiment, a virus strain is DENV-2 PDK53 or DENV-2 16681. In another embodiment, a virus strain is DENV-3 PGMK30 or DENV-3 16562. In another embodiment, a virus strain is a French Polynesian strain of Zika virus (ZIKV). In a preferred embodiment, the ZIKV strain is PF13/251013-18.

[0095] The vaccine disclosed in the present invention will be generally understood as being administered to a subject in need thereof either in a single dose or in multiple doses. In one embodiment, the vaccine may be administered in a single dose. In another embodiment, the vaccine may be administered in two or more doses. The vaccine disclosed in the present invention may be administered alone or in combination with a buffer. An example of a suitable buffer is phosphate buffered saline. The vaccine of the present invention may be in lyophilized or aqueous form, with or without stabilizers in the final formulation. It will generally be understood by one of skill in the art that a lyophilized vaccine must be reconstituted in a suitable medium prior to administration to a subject.

[0096] Suitable routes of administration of the pharmaceutical composition or vaccine described herein, to a subject, in particular to a human subject, may include, without limitation, oral, rectal, transmucosal or intestinal administration or intramuscular, subcutaneous, intramedullary, intrathecal, direct intraventricular, intravenous, intravitreal, intraperitoneal, intranasal, intradermal or intraocular injections. In a preferred embodiment, the route of administration is by intradermal or subcutaneous injection.

[0097] In another embodiment, there is provided a live attenuated vaccine produced according to the method as described herein.

Experimental Section

[0098] Background

[0099] DENV-2 PDK53 and DENV-3 PGMK30, which are two DENV LAVs that had been previously used in a clinical trial, were studied. DENV-2 PDK53 was generated from the wild-type strain DENV-2 16681 while DENV-3 PGMK30 was generated from the wild-type strain DENV-3 16562. In the trial, DENV-2 PDK53 was well tolerated and induced protective immune responses, whilst DENV-3 PGMK30 caused dengue-like syndrome in vaccinees. Both strains were developed using the same attenuation process, which involved serial passaging of clinical isolates in primary mammalian cells with periodic selection for viral clones that displayed small plaque phenotype. Until now, it has been believed that viruses which produce smaller plaques are less fit and are, hence, attenuated. Although the preparation of both attenuated strains was guided by the same selection guidelines, the disparate clinical results suggest a fundamental difference in the cellular events leading to the same outcome in this empirically defined criterion.

[0100] Accordingly, by studying the differences in the various attributes of DENV infection that are thought to influence plaque sizes, the present study investigated whether DENV-2 PDK53 and DENV-3 PGMK30 produced smaller plaques compared to their respective parental clinical isolates due to distinct mechanisms.

[0101] The present study also used a novel method for generating a candidate LAV.

[0102] Materials and Methods

[0103] General materials and methods used in the study are provided below.

[0104] Cells, Viruses and Reagents

[0105] Vero, HuH-7 and Raji cells stably expressing dendritic cell-specific intercellular adhesion molecule-3-grabbing non-integrin (DC-SIGN) receptor were cultured in Dulbecco's Modified Essential Medium (DMEM) while human monocytic cells THP-1, BHK21 cells and C6/36 cells were cultured in RPMI Medium 1640 (Gibco) supplemented with 10% foetal calf serum. Primary human monocytes were derived from blood obtained from a donor wherein whole blood was spun down in a Ficoll gradient to isolate peripheral blood mononuclear cells (PBMCs). The PBMCs were then allowed to adhere to plastic tissue culture flasks for 48 hours. Non-adherent cells were washed off with sterile PBS, leaving behind cells enriched for primary human monocytes. DENV strains of the original Mahidol stocks (DENV-2 16681, DENV-2 PDK53, DENV-3 16562 and DENV-3 PGMK30FRhL3) were obtained from Dr Claire Huang (Centres for Disease Control and Prevention, USA) and were passaged three times in C6/36 cells. To achieve sufficiently high titres for subsequent experiments, supernatant of PDK53 cultures were concentrated by high-speed centrifugation and reconstituted in 1/100 of its original culture volume. Viral genome sequences were uploaded to GenBank with the accession numbers listed in Table 1. Yellow fever YF-17D was commercially obtained (Sanofi Pasteur).

TABLE-US-00001 TABLE 1 Dengue and Zika genome sequences. Virus Strain GenBank Accession Number DENV-2 16681 KU725663 DENV-2 PDK53 KU725664 DENV-3 16562 KU725665 DENV-3 PGMK30FRhL3 KU725666

[0106] Random Mutagenesis by PCR

[0107] Six PCR products derived from DENV2 strain were generated by 6 sets of primer pairs that are routinely used in the laboratory for Gibson assembly (Table 7). For this PCR reaction, high fidelity Q5.RTM. High-Fidelity DNA polymerase (New England BioLabs) is used. To introduce random mutagenesis to each of these fragments, Taq DNA polymerase was used instead for PCR amplification of each fragments. The PCR products are gel purified and assembled by Gibson assembly to obtain infectious clone which will then be transfected into HEK293T cells. Supernatant was plagued to observe for different plaque size. Small plaque phenotype were individually picked and expanded for sequencing analysis.

TABLE-US-00002 TABLE 2 Primers used for Gibson assembly for ZIKV Fragment 1 (2137 bp) PF13 F1 Fwd AGAGCTCGTTTAGTGAACCGAGTTGTTGATCTG (SEQ ID NO: 1) PF13 F1 Rev GTGGATCAAGTTCCAGCATCATCTTAGAGTTCTCAGTGC (SEQ ID NO: 2) Fragment 2 (2316 bp) PF13 F2 Fwd GCACTGAGAACTCTAAGATGATGCTGGAACTTGATCCAC (SEQ ID NO: 3) PF13 F2 Rev CACCTGCTCTTTCAATGTACATGTCCACACTCTTTCCTGA (SEQ ID NO: 4) Fragment 3 (1832 bp) PF13 F3 Fwd TCAGGAAAGAGTGTGGACATGTACATTGAAAGAGCAGGTG (SEQ ID NO: 5) PF13 F3 Rev CTAAGCTTGAACTCTCCCTCAATGGCTGCTACTTTGTCG (SEQ ID NO: 6) Fragment 4 (2570 bp) PF13 F4 Fwd CGACAAAGTAGCAGCCATTGAGGGAGAGTTCAAGCTTAG (SEQ ID NO: 7) PF13 F4 Rev CATACGGTGTGGTGTCGGTCATGGCTATTCCTGTGACTCC (SEQ ID NO: 8) Fragment 5 (2145 bp) PF13 F5 Fwd GGAGTCACAGGAATAGCCATGACCGACACCACACCGTATG (SEQ ID NO: 9) PF13 F5 Rev ATGCCATGCCGACCCAGACCCATGGATTTCCCCACACCGG (SEQ ID NO: 10) Vector Amplification PF13 Vector TGGGGAAATCCATGGGTCTGGGTCGGCATGGCATCTCCAC Fwd (SEQ ID NO: 11) PF13 Vector CACAGATCAACAACTCGGTTCACTAAACGAGCTCTGCT Rev (SEQ ID NO: 12)

[0108] Plaque Purification

[0109] BHK-21 was seeded in a 6-well plate 2 days before it was infected with approximately 15 plaque-forming units of PF13/251013-18 per well. After 1-hour adsorption of inoculum at 37.degree. C., inoculum was removed and overlaid with maintenance media containing 0.9% agarose. Plaques that have big or small plaques were isolated for Sanger sequencing and also passaging in Vero for verification of plaque size by plaque assay.

[0110] Infectious Clone Generation

[0111] Genomic RNA of PF13/251013-18 and DV2-3295 were extracted using QIAamp Viral RNA Mini Kit (Qiagen) and cDNA synthesized using SuperScript III First-Strand Synthesis Kit (Invitrogen) before PCR amplification as 5 fragments for PF13/251013-18 and 6 fragments for DV2-3295 (primers in Tables 2 and 7 respectively) using Q5.RTM. High-Fidelity 2.times. Master Mix (New England BioLabs). TA cloning of these fragments into pGEMT.RTM. vector (Promega) was performed to generate individual plasmids for each fragment. Site-directed mutagenesis on relevant plasmids was performed to generate specific mutations identified for DN-1, DN-2, DN-3, DN-4, D2-A and D2-B using QuikChange II Site-Directed Mutagenesis Kit (Agilent). Infectious clones for the different mutant were generated using Gibson assembly with NEBuilder.RTM. HiFi DNA Assembly Master Mix (New England BioLabs) to assemble their genomes into a vector containing a constitutive CMV immediate-early promoter.

[0112] Mutant Virus Production

[0113] Assembled infectious clones of DN-1, DN-2, DN-3, DN-4, DV2-3295, D2-A and D2-B were transfected into HEK293T cells using Lipofectamine 2000 as per manufacturer's instructions and viruses produced from these cells were harvested 48 hours post-transfection. Virus progeny was amplified in Vero cells up to 2 passages to generate working viral stocks.

[0114] Infection of A129 Mice

[0115] Virus stocks for animal infection were diluted in sterile PBS and titers determined prior to injection. Male A129 mice between 11 to 14 weeks old were injected intraperitoneally with 200 .mu.L of inoculum corresponding to intended number of pfu per dose. Daily weight of mice was measured and serum samples for viremia studies were collected by submandibular bleeding on Days 1 to 4, 6, 8, 10, 12, 15 and 21 post-infection and/or post-challenge.

[0116] Quantification of Viral Load by Quantitative PCR (qPCR)

[0117] Serum viral RNA was extracted using QIAamp Viral RNA Mini Kit (Qiagen) according to manufacturer's instructions. qPCR was performed using qScript One-Step qRT-PCR kit (Quanta) using ZIKV 1086 and ZIKV 1162c primers and ZIKV 1107-FAM probe. In vitro transcribed RNA containing the target region for primer and probe set was used to generate a standard curve for quantification of serum viral RNA copy number (Table 3).

TABLE-US-00003 TABLE 3 Primers used for quantification of viral load Primer Sequence ZIKV 1086 YCGYTGCCCAACACAAG(SEQ ID NO: 13) ZIKV 1162c CCACTAAYGTTCTTTTGCAGACAT (SEQ ID NO: 14) ZIKV 1107-FAM AGCCTACCTTGACAAGCARTCAGACACTCAA (SEQ ID NO: 15)

[0118] Animal Models

[0119] C57BL/6 mice were purchased from InVivos (Singapore). The SingHealth Institutional Animal Care and Use Committee approved all mouse experiments. Mice were infected by injecting 100 .mu.L of 1.times.10.sup.6 pfu/mL DENV subcutaneously into the hind footpads. Draining popliteal lymph nodes were collected 24 hours post-infection, snap frozen in O.C.T. Compound (Tissue-Tek), then cryosectioned (10 .mu.m thick sections). Sections were fixed with acetone at 4.degree. C. then stained using J2 anti-dsRNA antibody (English and Scientific Consulting) and FITC-conjugated anti-mouse antibody (Jackson ImmunoResearch). Slides were imaged by confocal microscopy. Images were prepared using ImageJ (National Institutes of Health, USA).

EXAMPLE 1

[0120] Investigation of Factors Contributing to the Limitation of Plaque Sizes.

[0121] A major contributing factor to the limitation of plaque sizes is the antiviral response triggered by the innate immune function of host cells used in the assay. It is a cascade of cellular events initiated by infected cells, which releases cellular products such as cytokines that activate antiviral responses in surrounding uninfected cells to prevent infection.

[0122] To investigate the antiviral response triggered by the innate immune function of the host cells to each of the viral strains, HuH-7 cells seeded in a confluent monolayer were infected with 10 multiplicity of infection (MOI) of DENV-2 16681 or the DENV-3 strains; or 1MOI and 10MOI of DENV-2 PDK53. At 24 hours post-infection, total cellular RNA was extracted using the RNEasy Mini kit (Qiagen) and then analysed on the Illumina HumanHT-12 v4 Expression Beadchip (Illumina). Results were analysed using Partek Genomics Suite v6.6 .COPYRGT.2014 (Partek). Pathway analysis was done using Gene Set Enrichment Analysis (Broad Institute, USA).

[0123] The data in this study showed that DENV-2 PDK53 infection induced a significantly stronger innate immune response in host cells compared to its parental strain DENV-2 16681, while DENV-3 PGMK30 and its parental strain DENV-3 16562 were similarly weakly immunogenic (FIG. 1). Human hepatoma cell line, HuH-7, was infected with the DENV-2 and DENV-3 vaccine and parental strains for 24 h and subsequently subjected to genome-wide microarray screens. At equal amounts of virus inoculum, DENV-2 PDK53 induced stronger up-regulation of innate immune genes, such as inflammatory cytokines and interferons, compared to DENV-2 16681. This difference continued to be observed when DENV-2 PDK53 inoculum was one-tenth of DENV-2 16681 at 1 MOI, thus demonstrating the strong immunogenic property of the former. Conversely, both DENV-3 PGMK30 and DENV-3 16562 displayed weak up-regulation of innate genes compared to DENV-2 PDK53.

[0124] A possible explanation for this difference in the immunogenicity of DENV-2 PDK53 and DENV-3 PGMK30 in HuH-7 cells could be the difference in cell line through which the viruses were generated: primary dog kidney and primary green monkey kidney cells, respectively. As observed in FIG. 2, DENV-2 PDK53 is less immunogenic in MDCK cells compared to DENV-3 PGMK30 and DENV-3 16562, as indicated by the IFN.alpha. and IFN.beta. responses. It was reasoned that the generation of DENV-2 PDK53 from canine cells had conferred on it resistance to canine-specific host innate immune responses. For the same reason, DENV-3 PGMK30 is resistant to primate-specific innate immune responses in HuH-7 cells. Taken together, results here indicate that the successfully attenuated vaccine strain DENV-2 PDK53 had raised its immunogenicity in cells other than those of canine origins during the attenuation process.

EXAMPLE 2

[0125] Investigation of Effective Spreading of Antiviral Responses Due to Superior Immunogenic Properties as a Contributing Factor to the Formation of Smaller Plaques in DENV-2 PDK53.

[0126] Next, the possibility that effective spreading of antiviral responses due to superior immunogenic properties could be a contributing factor to the formation of smaller plaques in DENV-2 PDK53 was investigated. This was studied by detecting the migration of phosphorylated STAT1 (pSTAT1), which is a marker of STAT1 activation resulting from interferon activation, in uninfected cells surrounding infected foci.

[0127] BHK-21 cells in a confluent monolayer on glass coverslips were infected with 30 plaque-forming units (pfu) of virus and incubated for 72 hours at 37.degree. C. IFN.alpha. (Abcam) was used as a positive control. The cells were fixed and permeabilised with 3% paraformaldehyde and 0.1% saponin, then stained with anti-phospho-STAT1 (Y701) rabbit polyclonal IgG (R&D Systems), J2 anti-dsRNA mouse antibody, DAPI, AlexaFluor488 anti-rabbit, and AlexaFluor594 anti-mouse secondary antibodies (Invitrogen). Coverslips were affixed onto glass slides using Mowiol 4-88 (Sigma-Aldrich) and imaged using an LSM 710 confocal microscope (Carl Zeiss).

[0128] As expected, there were greater levels of STAT1 activation in cells surrounding foci of DENV-2 PDK53 infection compared to DENV-2 16681 (FIG. 3), while DENV-3 PGMK30 and DENV-3 16562 remained the same. This increase in STAT1 activation could prepare cells against viral invasion by increasing the expression of interferon-stimulated genes (ISGs), hence limiting the spread of infection and ultimately contain plaque sizes.

[0129] To confirm this observation, plaque assays were performed on BHK-21 cells silenced of major transcription factors for interferon and inflammatory responses; namely: IRF3, STAT1 and NF-kB (p65 and p50) (FIGS. 4A and 4B). To silence the transcription factors, BHK-21 cells seeded in a confluent monolayer were treated with the specified hamster-specific siRNA at 100nM final concentration complexed with Dharmafect 4 (GE Healthcare) for 48 hours. siRNA sequences used are listed in Table 4. Following siRNA knockdown, each well was infected with 30 pfu of virus, and cultures for plaque assays were incubated for 6 days at 37.degree. C., fixed with 20% formaldehyde and stained with 1% crystal violet (Sigma-Aldrich) to visualize plaques. Cultures for focus forming assay were incubated for 3 days at 37.degree. C., then fixed with 3% paraformaldehyde, permeabilised with 0.1% saponin, then stained with mouse 4G2 monoclonal antibody and anti-mouse horseradish peroxidase antibody. Viral foci were stained with 3-3'-diaminobenzidine (DAB Chromogen) (Dako) and enumerated visually. Resultant plaques were photographed using an EOS 5D digital SLR camera (Canon) at a fixed distance. Plaque sizes were measured in pixels using ImageJ.

[0130] Table 4: BHK21 siRNA Sequences (Mesocricetus auratus)

TABLE-US-00004 Gene Target siRNA Sequence IRF3 Sense: GGAACAAUGGGAGUUCGAAdTdT (SEQ ID NO: 16) Antisense: UUCGAACUCCCAUUGUUCCdTdT (SEQ ID NO: 17) STAT1 Sense: CCGUUUCCAUGACCUCCUUdTdT (SEQ ID NO: 18) Antisense: AAGGAGGUCAUGGAAACGGdTdT (SEQ ID NO: 19) NF-kB p65 Sense: GCAUCCAGACCAACAAUAAdTdT (SEQ ID NO: 20) Antisense: UUAUUGUUGGUCUGGAUGCdTdT (SEQ ID NO: 21) NF-kB p50 Sense: CCUCAUGUUCACCGCCUUUdTdT (SEQ ID NO: 22) Antisense: AAAGGCGGUGAACAUGAGGdTdT (SEQ ID NO: 23)

[0131] It was found that DENV-2 PDK53 formed greater number of plaques across all knocked-down (KD) cells, with differences in IRF3 being most significant (FIGS. 4A and 4B). DENV-2 16681, DENV-3 PGMK30 and DENV-3 16562 did not show an increase in plaque numbers for all the KD cells, only D316562 in the presence of NF-.kappa.B p50-siRNA showed any significant increase. Importantly, differences in the morphology of plaques induced by DENV-2 PDK53, but not other DENV strains, on IRF3 knockdown cells (FIG. 4C) were also observed. There was an increase in visually smaller atypical plaques such that, when analysis of the plaque size distribution was performed, DENV-2 PDK53 displayed a bimodal curve as opposed to a unimodal curve adopted by DENV-2 16681. This formation of smaller plaques demonstrates that the strong immunogenic property of the successfully attenuated virus does indeed influence plaque formation. In toto, results here indicate that the immunogenicity of the virus could be a contributing factor to the formation of small plaques for DENV-2 PDK53, but not DENV-3 PGMK30.

EXAMPLE 3

[0132] Investigation of Virus Infectivity as a Factor that Determines Plaque Size.

[0133] With the revelation that plaque formation is strongly influenced by the immunogenicity of the virus, the possibility that infectivity of the virus could be another factor that determines plaque sizes was investigated. The uptake of viruses into cells in vitro was determined by measuring the amounts of specific viral RNA sequences through real-time PCR.

[0134] To measure total viral RNA, total cellular RNA was extracted using the RNEasy Mini kit (Qiagen), and complementary DNA synthesized using the iScript cDNA Synthesis kit (Bio-Rad). To measure total viral RNA, quantitative real-time PCR was done using a primer pair targeting a highly conserved region of the 3' UTR common to all four serotypes of dengue; inter-sample normalization was done using GAPDH as a control. Primer sequences are listed in Table 5. Pronase (Roche) was used at a concentration of 1 mg/mL and incubated with infected cells for five minutes on ice, before washing with ice cold PBS. Total cellular RNA was then extracted from the cell pellets in the manner described above.

TABLE-US-00005 TABLE 5 PCR primer sequences. Gene Target Primer Sequence DENV LYL 3'UTR Forward: TTGAGTAAACYRTGCTGCCTGTAGCTC (SEQ ID NO: 24) Reverse: GAGACAGCAGGATCTCTGGTCTYTC (SEQ ID NO: 25) GAPDH (Human) Forward: GAGTCAACGGATTTGGTCGT (SEQ ID NO: 26) Reverse: TTGATTTTGGAGGGATCTCG (SEQ ID NO: 27) CXCL10 (Human) Forward: GGTGAGAAGAGATGTCTGAATCC (SEQ ID NO: 28) Reverse: GTCCATCCTTGGAAGCACTGCA (SEQ ID NO: 29) ISG20 (Human) Forward: ACACGTCCACTGACAGGCTGTT (SEQ ID NO: 30) Reverse: ATCTTCCACCGAGCTGTGTCCA (SEQ ID NO: 31) IFIT2 (Human) Forward: GAAGAGGAAGATTTCTGAAG (SEQ ID NO: 32) Reverse: CATTTTAGTTGCCGTAGG (SEQ ID NO: 33) IFN.alpha. (Canine) Forward: GCTCTTGTGACCACTACACCA (SEQ ID NO: 34) Reverse: AAGACCTTCTGGGTCATCACG (SEQ ID NO: 35) IFN.beta. (Canine) Forward: GGATGGAATGAGACCACTGTCG (SEQ ID NO: 36) Reverse: ACGTCCTCCAGGATTATCTCCA (SEQ ID NO: 37)

[0135] The proportion of infected cells was assessed by flow cytometry. Cells were fixed and permeabilised with 3% paraformaldehyde and 0.1% saponin, respectively. DENV envelope (E) protein was stained with mouse monoclonal 4G2 antibody (ATCC) and AlexaFluor488 anti-mouse secondary antibody. Flow cytometry analysis was done on a BD FACS Canto II (BD Bioscience).

[0136] Unexpectedly, despite DENV-2 PDK53 inducing stronger antiviral immune responses, it had higher rates of uptake by HuH-7 cells compared to DENV-2 16681 (FIG. 5). This difference continued to be observed when DENV-2 PDK53 inoculum was reduced 10-fold. In contrast, DENV-3 PGMK30 and its parental strain DENV-3 16562 displayed the same rate of viral uptake in host cells. Furthermore, DENV-2 PDK53 showed a higher viral replication rate compared to DENV-2 16681. This was determined by measuring the percentage of cells that harbored DENV E-protein, detected using flow cytometry. DENV-2 PDK53 showed a higher percentage of infected cells compared to DENV-2 16681 at the same amount of MOI from Day 1 to 3 (FIG. 6). In contrast, DENV-3 PGMK30 showed a reverse trend and displayed lower percentage of infected cells compared to DENV-3 16562. Results here show that successfully attenuated vaccines, as exemplified by DENV-2 PDK53, have greater uptake and replication rate.

[0137] Results above demonstrate that the DENV-2 PDK53 and DENV-3 PGMK30 are polarized in their properties that influence plaque morphologies. While both attenuated strains were selected for their formation of smaller plaques compared to their parental strains, the factors leading to this outcome are different between the two.

[0138] Accordingly, this study has demonstrated that successfully attenuated vaccines, as exemplified by DENV-2 PDK53 in this study, form smaller plaques due to induction of strong innate immune responses, which is triggered by fast viral uptake and spread of infection. In contrast, DENV-3 PGMK30 form smaller plaques due to its slower uptake and growth in host cells, which inadvertently causes lower up-regulation of the innate immune response.

[0139] Based on the results presented in the foregoing Examples, the present invention provides a new strategy to prepare a LAV, which expedites the production process and ensures the generation of effectively attenuated viruses fit for vaccine use.

EXAMPLE 4

[0140] Strategy for Attenuating Viruses for Vaccine Applications

[0141] A description of the procedure and the amount of time required for each step is detailed in Table 6 below.

TABLE-US-00006 TABLE 6 Description of procedures and the estimated time required to achieve each of the steps in the proposed method of manufacturing attenuated vaccines. Estimated shortest time Steps required 1. Passaging of virus from clinical isolates in cultured 2 weeks cells distinct from intended host for no more than 5 passages, random mutagenesis, mutagenesis with a chemically-derived mutagen, culture at temperature lower than 37.degree. C., or a combination thereof 2. Infecting intended host cells, selecting a host cell 1 week displaying a preselected phenotype, isolating viral nucleic acid from the selected host cell 3. Sequencing of virus from single/pooled selected cells 2 weeks 4. Reconstruction of candidate live attenuated vaccines in 2-3 weeks infectious clones 5. Production of candidate live attenuated vaccines 1 week 6. In-vitro and/or in-vivo screening of candidate live 2 weeks attenuated vaccines for desired phenotypes

[0142] General Description of Steps in Table 6

[0143] The objective of step 1 is to generate a virus population with a diverse genetic makeup from clinical isolates. A cell or cell line from a species other than the intended vaccinee is infected so that there is no adaptation of the virus to the innate immunity of the intended host. Mutagenesis of the virus may occur through serial passaging of the infected cell no more than 5 times, culture of the infected cell under sub-optimal conditions (e.g. at a temperature lower than 37.degree. C.) or by random mutagenesis (e.g. error-prone PCR or using a mutagen). A chemically derived mutagen such as Ribavirin and 5-fluorouracil may be added to further enhance the mutagenesis of the virus. Alternatively, a chemically derived mutagen is used on its own to generate the population of genetically diverse virus. Generating a diverse population of viruses increases the chances of generating strains that fit the desired selection criteria (i.e.: fast growing and with strong immunogenic properties). After a short period of infection (e.g.: 24 hours), the virus is isolated and used in step 2.

[0144] The objective of step 2 is to select for specific viruses that induce a specific phenotype that may be indicative of viral infectivity and/or immunogenicity. A specific phenotype may be small plaque size relative to the original virus or the wild-type virus, or high ISRE responses, which is an indication of their propensity to activate type-I-interferon responses. Where the specific phenotype is plaque size, this is performed by infecting cells of the same species as the target vaccine with the viruses derived from step 1, collecting the supernatant and using the supernatant in a plaque assay. Plaques of interest are then selected and purified. Where the specific phenotype is the induction of ISRE response, this is performed by infecting cells of the same species as the target vaccinee that carry the ISRE-driven GFP reporter gene with the viruses derived from step 1. GFP expression in these cells indicates the activation of ISRE. Cells expressing high level of GFP fluorescence, which is indicative of high ISRE activation, are isolated through cell sorting by flow cytometry. Viruses extracted from these cells are therefore the specific ones that induce high ISRE responses and are assumed to exhibit the characteristics of fast viral entry and strong immunogenicity, which are the traits of successfully attenuated viruses.

[0145] The objective of step 3 is to characterize the virus that has been isolated from step 2, so that its genetic identity is known and a blueprint can therefore be created to make replicas of it. To characterize the virus, sequencing of its genetic make-up, through the use of various techniques such as Sanger sequencing or Next-Generation sequencing, is performed in conjunction with the use of other bioinformatics tools to assemble the whole viral genome.

[0146] The objective of step 4 is to reconstruct the identified virus after its genetic blue print from step 3 is obtained. To do this, mutagenesis of infectious clones that were generated from the initial input of clinical virus isolate is performed.

[0147] The objective of step 5 is the production of the reconstructed virus from step 4. Briefly, the infectious clone plasmids are linearized and in vitro transcribed to produce viral RNA, which is then introduced into host cells through electroporation or transfection. Replicas of these viruses are replicated and released from the host cells, which is harvested from the cell culture media. Alternatively, the infectious clone plasmids may contain a constitutive promoter that drives transcription of viral RNA. These infectious clone plasmids may be introduced into host cells through electroporation or transfection and the viral genome is transcribed to produce viral RNA, which serves as a template for viral protein synthesis and viral replication.

[0148] The objective of step 6 is to screen and assess if the resulting virus from step 5 is a fit candidate for live attenuated vaccine production. The virus may be assessed in vitro to determine if it possesses one or more of the desirable phenotypes displayed by successfully attenuated LAVs: rapid replication in host cells; ability to trigger robust host innate immune responses; and the generation of small plaques in plaque assays. With the completion of in vitro assessment of the LAV, in vivo assessment of protective efficacy on animal models, such as mice and macaques, may follow. Alternatively, the in vitro and in vivo screening steps may be performed independently or simultaneously.

EXAMPLE 5

[0149] Generation of a Zika Virus LAV

[0150] A French Polynesian strain of Zika virus (ZIKV), PF13/251013-18 (SEQ ID NO: 38), was passaged in Vero and C6/36. Following 4 rounds of passage in Vero and a single round passage in C6/36, next-generation sequencing (NGS) of PF13/251013-18 revealed 2 amino acid sequence changes as compared to its reference genome (GenBank ID KX369547). Furthermore, plaque assay of PF13/251013-18 also identified virus plaques of different sizes (FIG. 8A). Of interest, virus variants producing small plaques, which could serve as potential live attenuated vaccine (LAV) candidates were then plaque-purified, sequenced and confirmed to contain the 2 nucleic acid sequence changes that give rise to amino acid changes in the laboratory stocks of PF13/251013-18 (FIG. 8B). Infectious clones of PF13/251013-18 containing these mutations (hereafter referred to as DN-1) (SEQ ID NO: 39) and other mutations identified in the plaque-purified small plaque variants, DN-2 (SEQ ID NO: 40), DN-3 (SEQ ID NO: 41) and DN-4 (SEQ ID NO: 42) were generated using Gibson assembly. DN-1, DN-2 and DN-4 recovered from the infectious clones display small-plaque phenotypes on plaque assay (FIG. 8C).

[0151] DN-1 was tested in a Type I interferon receptor-deficient mouse model, A129. 10.sup.3 plaque-forming units (pfu) of DN-1 were injected through the intraperitoneal route into male A129 mice. As compared to another French Polynesian ZIKV strain, H/PF/2013, which was lethal in the A129 mouse model, mice that received DN-1 showed 100% survival rate in contrast to H/PF/2013 where the survival rate was 0% (FIG. 9A). The viremia of DN-1 was almost 2 logs lower than that of H/PF/2013 on day 3 post infection (FIG. 9B). There was also no significant weight loss compared to mice injected with PBS (FIG. 9C). The utility of DN-1 as a LAV candidate was next tested by challenging mice injected with DN-1 at 21 days post-immunization with 10.sup.4 pfu of H/PF/2013. DN-1 provided complete protection against the challenge virus while animals that received phosphate-buffered saline (PBS) mock immunization showed 60% mortality rate (FIG. 9D). Mice immunized with DN-1 not only showed no weight loss but also had undetectable viremia levels (FIG. 9E, 9F). These in vivo data demonstrate that DN-1 is an attractive LAV candidate that is able to elicit sterilizing immunity against a lethal dose of ZIKV in the A129 model, suggesting potential efficacy as a LAV for clinical development.

EXAMPLE 6

[0152] Generation of a Dengue Virus LAV

[0153] One strain each of DENV-2 (DV2-3295, GenBank ID: EU081177) and DENV-4 (DV4-2270, GenBank ID: GQ398256) were put through the workflow highlighted in FIG. 7. Briefly, 3.times.10.sup.6 cells per T25 flask were infected at MOI 10 with either DV2-3295 or DV4-2270. DV2-3295-infected cells were mutagenized for 4 hours with 600 .mu.M 5-fluorouracil (5-FU) before changing to maintenance media and virus supernatant was harvested at day 3. DV4-2270-infected cells were mutagenized with 600 .mu.M 5-FU for 3 days. The virus supernatants were used to infect IFN.beta.-promoter-driven GFP reporter HuH-7 cells seeded in 6-well plates. After 48 hours, the infected cells were trypsinized off the plates for FACS sorting on BD FACSAria.TM. (BD Biosciences) for GFP-positive cells. RNA was extracted from GFP-positive cells using RNeasy Micro Kit (QIAGEN). cDNA was synthesized using SuperScript III First-Strand Synthesis Kit (Invitrogen).

[0154] Sanger sequencing was then performed to identify mutations present in sorted cells and the mutations are shown in FIG. 10. Using the 2 mutations identified for DV2-3295, infectious clones for D2-A (SEQ ID NO: 57) and D2-B (SEQ ID NO: 58) were constructed using Gibson assembly and the primers in Table 7. Viruses were recovered as per the ZIKV mutants. Plaque assay demonstrated that they produce small plaques (FIG. 10A).

[0155] Four mutations were identified from the sorted GFP-positive cells infected with mutagenized DV4-2270 infection (FIG. 10B).

TABLE-US-00007 TABLE 7 Gibson Assembly Primers for DENV2 Primer Name Sequence Fragment 1 (2212 bp) D2-F1 AGAGCTCGTTTAGTGAACCGAGTTGTTAGTCTACGT GGACCGAC (SEQ ID NO: 43) D2-R1 GCTGTGTCACCTAAAATGGCCATTCTCTTC (SEQ ID NO: 44) Fragment 2 (1370 bp) D2-F2 GAAGAGAATGGCCATTTTAGGTGACACAGC (SEQ ID NO: 45) D2-R2 GGAACAATGCCATTCCCAAGACTCCTAGTG (SEQ ID NO: 46) Fragment 3 (1432 bp) D2-F3 CACTAGGAGTCTTGGGAATGGCATTGTTCC (SEQ ID NO: 47) D2-R3 GGAGATCCTGACGTTCCAGGAGAAAAGTCC (SEQ ID NO: 48) Fragment 4 (2098 bp) D2-F4 GGACTTTTCTCCTGGAACGTCAGGATCTCC (SEQ ID NO: 49) D2-R4 GGAATTTTCAATGCTATGTCTCAACATTGGTG (SEQ ID NO: 50) Fragment 5 (1632 bp) D2-F5 CACCAATGTTGAGACATAGCATTGAAAATTCC (SEQ ID NO: 51) D2-R5 CTGTCATTGCCATCTGTGTCACCATGGG (SEQ lD NO: 52) Fragment 6 (2165 bp) D2-F6 CCCATGGTGACACAGATGGCAATGACAG (SEQ ID NO: 53) D2-R6 GATGCCATGCCGACCCAGAACCTGTTGATTCAACAG CACC (SEQ ID NO: 54) Vector Amplification D2-F7 GGTGCTGTTGAATCAACAGGTTCTGGGTCGGCATGG CATCTCCAC (SEQ ID NO: 55) D2-R7 GTCGGTCCACGTAGACTAACAACTCGGTTCACTAAA CGAGCTCT (SEQ ID NO: 56)

[0156] The present invention is based on novel procedures that identify and select for a virus that exhibits susceptibility to a host defense mechanism in order to generate a live attenuated vaccine. Advantageously, mutations of the coding regions of the virus that confer virulence in order to weaken or attenuate the virus are not necessary.

Sequence CWU 1

1

58133DNAArtificial SequencePrimer sequence 1agagctcgtt tagtgaaccg agttgttgat ctg 33239DNAArtificial SequencePrimer sequence 2gtggatcaag ttccagcatc atcttagagt tctcagtgc 39339DNAArtificial SequencePrimer sequence 3gcactgagaa ctctaagatg atgctggaac ttgatccac 39440DNAArtificial SequencePrimer sequence 4cacctgctct ttcaatgtac atgtccacac tctttcctga 40540DNAArtificial SequencePrimer sequence 5tcaggaaaga gtgtggacat gtacattgaa agagcaggtg 40639DNAArtificial SequencePrimer sequence 6ctaagcttga actctccctc aatggctgct actttgtcg 39739DNAArtificial SequencePrimer sequence 7cgacaaagta gcagccattg agggagagtt caagcttag 39840DNAArtificial SequencePrimer sequence 8catacggtgt ggtgtcggtc atggctattc ctgtgactcc 40940DNAArtificial SequencePrimer sequence 9ggagtcacag gaatagccat gaccgacacc acaccgtatg 401040DNAArtificial SequencePrimer sequence 10atgccatgcc gacccagacc catggatttc cccacaccgg 401140DNAArtificial SequencePrimer sequence 11tggggaaatc catgggtctg ggtcggcatg gcatctccac 401238DNAArtificial SequencePrimer sequence 12cacagatcaa caactcggtt cactaaacga gctctgct 381317DNAArtificial SequencePrimer sequence 13ycgytgccca acacaag 171424DNAArtificial SequencePrimer sequence 14ccactaaygt tcttttgcag acat 241531DNAArtificial SequencePrimer sequence 15agcctacctt gacaagcart cagacactca a 311621DNAMesocricetus auratus 16ggaacaaugg gaguucgaat t 211721DNAMesocricetus auratus 17uucgaacucc cauuguucct t 211821DNAMesocricetus auratus 18ccguuuccau gaccuccuut t 211921DNAMesocricetus auratus 19aaggagguca uggaaacggt t 212021DNAMesocricetus auratus 20gcauccagac caacaauaat t 212121DNAMesocricetus auratus 21uuauuguugg ucuggaugct t 212221DNAMesocricetus auratus 22ccucauguuc accgccuuut t 212321DNAMesocricetus auratus 23aaaggcggug aacaugaggt t 212427DNAArtificial SequencePrimer sequence 24ttgagtaaac yrtgctgcct gtagctc 272525DNAArtificial SequencePrimer sequence 25gagacagcag gatctctggt ctytc 252620DNAArtificial SequencePrimer sequence 26gagtcaacgg atttggtcgt 202720DNAArtificial SequencePrimer sequence 27ttgattttgg agggatctcg 202823DNAArtificial SequencePrimer sequence 28ggtgagaaga gatgtctgaa tcc 232922DNAArtificial SequencePrimer sequence 29gtccatcctt ggaagcactg ca 223022DNAArtificial SequencePrimer sequence 30acacgtccac tgacaggctg tt 223122DNAArtificial SequencePrimer sequence 31atcttccacc gagctgtgtc ca 223220DNAArtificial SequencePrimer sequence 32gaagaggaag atttctgaag 203318DNAArtificial SequencePrimer sequence 33cattttagtt gccgtagg 183421DNAArtificial SequencePrimer sequence 34gctcttgtga ccactacacc a 213521DNAArtificial SequencePrimer sequence 35aagaccttct gggtcatcac g 213622DNAArtificial SequencePrimer sequence 36ggatggaatg agaccactgt cg 223722DNAArtificial SequencePrimer sequence 37acgtcctcca ggattatctc ca 223810769DNAFlavivirus FSME 38gaatcagact gcgacagttc gagtttgaag cgaaagctag caacagtatc aacaggtttt 60atttggattt ggaaacgaga gtttctggtc atgaaaaacc caaaaaagaa atccggagga 120ttccggattg tcaatatgct aaaacgcgga gtagcccgtg tgagcccctt tgggggcttg 180aagaggctgc cagccggact tctgctgggt catgggccca tcaggatggt cttggcgatt 240ctagcctttt tgagattcac ggcaatcaag ccatcactgg gtctcatcaa tagatggggt 300tcagtgggga aaaaagaggc tatggaaata ataaagaagt tcaagaaaga tctggctgcc 360atgctgagaa taatcaatgc taggaaggag aagaagagac gaggcgcaga tactagtgtc 420ggaattgttg gcctcctgct gaccacagct atggcagcgg aggtcactag acgtgggagt 480gcatactata tgtacttgga cagaaacgat gctggggagg ccatatcttt tccaaccaca 540ttggggatga ataagtgtta tatacagatc atggatcttg gacacatgtg tgatgccacc 600atgagctatg aatgccctat gctggatgag ggggtggaac cagatgacgt cgattgttgg 660tgcaacacga cgtcaacttg ggttgtgtac ggaacctgcc atcacaaaaa aggtgaagca 720cggagatcta gaagagctgt gacgctcccc tcccattcca ctagaaagct gcaaacgcgg 780tcgcaaacct ggttggaatc aagagaatac acaaagcact tgattagagt cgaaaattgg 840atattcagga accctggcct cgcgttagca gcagctgcca tcgcttggct tttgggaagc 900tcaacgagcc aaaaagtcat atacttggtc atgatactgc tgattgcccc ggcatacagc 960atcaggtgca taggagtcag caatagggac tttgtggaag gtatgtcagg tgggacttgg 1020gttgatgttg tcttggaaca tggaggttgt gtcaccgtaa tggcacagga caaaccgact 1080gtcgacatag agctggttac aacaacagtc agcaacatgg cggaggtaag atcctactgc 1140tatgaggcat caatatcaga catggcttcg gacagccgct gcccaacaca aggtgaagcc 1200taccttgaca agcaatcaga cactcaatat gtctgcaaaa gaacgttagt ggacagaggc 1260tggggaaatg gatgtggact ttttggcaaa gggagcctgg tgacatgcgc taagtttgca 1320tgctccaaga aaatgaccgg gaagagcatc cagccagaga atctggagta ccggataatg 1380ctgtcagttc atggctccca gcacagtggg atgatcgtta atgacacagg acatgaaact 1440gatgagaata gagcgaaggt tgagataacg cccaattcac caagagccga agccaccctg 1500gggggttttg gaagcctagg acttgattgt gaaccgagga caggccttga cttttcagat 1560ttgtattact tgactatgaa taacaagcac tggttggttc acaaggagtg gttccacgac 1620attccattac cttggcacgc tggggcagac accggaactc cacactggaa caacaaagaa 1680gcactggtag agttcaagga cgcacatgcc aaaaggcaaa ctgtcgtggt tctagggagt 1740caagaaggag cagttcacac ggcccttgct ggagctctgg aggctgagat ggatggtgca 1800aagggaaggc tgtcctctgg ccacttgaaa tgtcgcctga aaatggataa acttagattg 1860aagggcgtgt catactcctt gtgtaccgca gcgttcacat tcaccaagat cccggctgaa 1920acactgcacg ggacagtcac agtggaggta cagtacgcag ggacagatgg accttgcaag 1980gttccagctc agatggcggt ggacatgcaa actctgaccc cagttgggag gttgataacc 2040gctaaccccg taatcactga aagcactgag aactctaaga tgatgctgga acttgatcca 2100ccatttgggg actcttacat tgtcatagga gtcggggaga agaagatcac ccaccactgg 2160cacaggagtg gcagcaccat tggaaaagca tttgaagcca ctgtgagagg tgccaagaga 2220atggcagtct tgggagacac agcctgggac tttggatcag ttggaggcgc tctcaactca 2280ttgggcaagg gcatccatca aatttttgga gcagctttca aatcattgtt tggaggaatg 2340tcctggttct cacaaattct cattggaacg ttgctgatgt ggttgggtct gaacacaaag 2400aatggatcta tttcccttat gtgcttggcc ttagggggag tgttgatctt cttatccaca 2460gccgtctctg ctgatgtggg gtgctcggtg gacttctcaa agaaggagac gagatgcggt 2520acaggggtgt tcgtctataa cgacgttgaa gcctggaggg acaggtacaa gtaccatcct 2580gactcccccc gtagattggc agcagcagtc aagcaagcct gggaagatgg tatctgtggg 2640atctcctctg tttcaagaat ggaaaacatc atgtggagat cagtagaagg ggagctcaac 2700gcaatcctgg aagagaatgg agttcaactg acggtcgttg tgggatctgt aaaaaacccc 2760atgtggagag gtccacagag attgcccgtg cctgtgaacg agctgcccca cggctggaag 2820gcttggggga aatcgtactt cgtcagagca gcaaagacaa ataacagctt tgtcgtggat 2880ggtgacacac tgaaggaatg cccactcgaa catagagcat ggaacagctt tcttgtggag 2940gatcatgggt tcggggtatt tcacactagt gtctggctca aggttagaga agattattca 3000ttagagtgtg atccagccgt tattggaaca gctgttaagg gaaaggaggc tgtacacagt 3060gatctaggct actggattga gagtgagaag aatgacacat ggaggctgaa gagggcccat 3120ctgatcgaga tgaaaacatg tgaatggcca aagtcccaca cattgtggac agatggaata 3180gaagagagtg atctgatcat acccaagtct ttagctgggc cactcagcca tcacaatacc 3240agagagggct acaggaccca aatgaaaggg ccatggcaca gtgaagagct tgaaattcgg 3300tttgaggaat gcccaggcac taaggtccac gtggaggaaa catgtggaac aagaggacca 3360tctctgagat caaccactgc aagcggaagg gtgatcgagg aatggtgctg cagggagtgc 3420acaatgcccc cactgtcgtt ccgggctaaa gatggctgtt ggtatggaat ggagataagg 3480cccaggaaag aaccagaaag taacttagta aggtcaatgg tgactgcagg atcaactgat 3540cacatggatc acttctccct tggagtgctt gtgattctgc tcatggtgca ggaagggctg 3600aagaagagaa tgaccacaaa gatcatcata agcacatcaa tggcagtgct ggtagctatg 3660atcctgggag gattttcaat gagtgacctg gctaagcttg caattttgat gggtgccacc 3720ttcgcggaaa tgaacactgg aggagatgta gctcatctgg cgctgatagc ggcattcaaa 3780gtcagaccag cgttgctggt atctttcatc ttcagagcta attggacacc ccgtgaaagc 3840atgctgctgg ccttggcctc gtgtcttttg caaactgcga tctccgcctt ggaaggcgac 3900ctgatggttc tcatcaatgg ttttgctttg gcctggttgg caatacgagc gatggttgtt 3960ccacgcactg ataacatcac cttggcaatc ctggctgctc tgacaccact ggcccggggc 4020acactgcttg tggcgtggag agcaggcctt gctacttgcg gggggtttat gctcctctct 4080ctgaagggaa aaggcagtgt gaagaagaac ttaccatttg tcatggccct gggactaacc 4140gctgtgaggc tggtcgaccc catcaacgtg gtgggactgc tgttgctcac aaggagtggg 4200aagcggagct ggccccctag cgaagtactc acagctgttg gcctgatatg cgcattggct 4260ggagggttcg ccaaggcaga tatagagatg gctgggccca tggccgcggt cggtctgcta 4320attgtcagtt acgtggtctc aggaaagagt gtggacatgt acattgaaag agcaggtgac 4380atcacatggg aaaaagatgc ggaagtcact ggaaacagtc cccggctcga tgtggcgcta 4440gatgagagtg gtgatttctc cctggtggag gatgacggtc cccccatgag agagatcata 4500ctcaaggtgg tcctgatgac catctgtggc atgaacccaa tagccatacc ctttgcagct 4560ggagcgtggt acgtatacgt gaagactgga aaaaggagtg gtgctctatg ggatgtgcct 4620gctcccaagg aagtaaaaaa gggggagacc acagatggag tgtacagagt aatgactcgt 4680agactgctag gttcaacaca agttggagtg ggagttatgc aagagggggt ctttcacact 4740atgtggcacg tcacaaaagg atccgcgctg agaagcggtg aagggagact tgatccatac 4800tggggagatg tcaagcagga tctggtgtca tactgtggtc catggaagct agatgccgcc 4860tgggacgggc acagcgaggt gcagctcttg gccgtgcccc ccggagagag agcgaggaac 4920atccagactc tgcccggaat atttaagaca aaggatgggg acattggagc ggttgcgctg 4980gattacccag caggaacttc aggatctcca atcctagaca agtgtgggag agtgatagga 5040ctttatggca atggggtcgt gatcaaaaat gggagttatg ttagtgccat cacccaaggg 5100aggagggagg aagagactcc tgttgagtgc ttcgagcctt cgatgctgaa gaagaagcag 5160ctaactgtct tagacttgca tcctggagct gggaaaacca ggagagttct tcctgaaata 5220gtccgtgaag ccataaaaac aagactccgt actgtgatct tagctccaac cagggttgtc 5280gctgctgaaa tggaggaagc ccttagaggg cttccagtgc gttatatgac aacagcagtc 5340aatgtcaccc actctggaac agaaatcgtc gacttaatgt gccatgccac cttcacttca 5400cgtctactac agccaatcag agtccccaac tataatctgt atattatgga tgaggcccac 5460ttcacagatc cctcaagtat agcagcaaga ggatacattt caacaagggt tgagatgggc 5520gaggcggctg ccatcttcat gaccgccacg ccaccaggaa cccgtgacgc atttccggac 5580tccaactcac caattatgga caccgaagtg gaagtcccag agagagcctg gagctcaggc 5640tttgattggg tgacggatca ttctggaaaa acagtttggt ttgttccaag cgtgaggaac 5700ggcaatgaga tcgcagcttg tctgacaaag gctggaaaac gggtcataca gctcagcaga 5760aagacttttg agacagagtt ccagaaaaca aaacatcaag agtgggactt tgtcgtgaca 5820actgacattt cagagatggg cgccaacttt aaagctgacc gtgtcataga ttccaggaga 5880tgcctaaagc cggtcatact tgatggcgag agagtcattc tggctggacc catgcctgtc 5940acacatgcca gcgctgccca gaggaggggg cgcataggca ggaatcccaa caaacctgga 6000gatgagtatc tgtatggagg tgggtgcgca gagactgacg aagaccatgc acactggctt 6060gaagcaagaa tgctccttga caatatttac ctccaagatg gcctcatagc ctcgctctat 6120cgacctgagg ccgacaaagt agcagccatt gagggagagt tcaagcttag gacggagcaa 6180aggaagacct ttgtggaact catgaaaaga ggagatcttc ctgtttggct ggcctatcag 6240gttgcatctg ccggaataac ctacacagat agaagatggt gctttgatgg cacgaccaac 6300aacaccataa tggaagacag tgtgccggca gaggtgtgga ccagacacgg agagaaaaga 6360gtgctcaaac cgaggtggat ggacgccaga gtttgttcag atcatgcggc cctgaagtca 6420ttcaaggagt ttgccgctgg gaaaagagga gcggcttttg gagtgatgga agccctggga 6480acactgccag gacacatgac agagagattc caggaagcca ttgacaacct cgctgtgctc 6540atgcgggcag agactggaag caggccttac aaagccgcgg cggcccaatt gccggagacc 6600ctagagacca ttatgctttt ggggttgctg ggaacagtct cgctgggaat ctttttcgtc 6660ttgatgagga acaagggcat agggaagatg ggctttggaa tggtgactct tggggccagc 6720gcatggctca tgtggctctc ggaaattgag ccagccagaa ttgcatgtgt cctcattgtt 6780gtgttcctat tgctggtggt gctcatacct gagccagaaa agcaaagatc tccccaggac 6840aaccaaatgg caatcatcat catggtagca gtaggtcttc tgggcttgat taccgccaat 6900gaactcggat ggttggagag aacaaagagt gacctaagcc atctaatggg aaggagagag 6960gagggggcaa ccataggatt ctcaatggac attgacctgc ggccagcctc agcttgggcc 7020atctatgctg ccttgacaac tttcattacc ccagccgtcc aacatgcagt gaccacttca 7080tacaacaact actccttaat ggcgatggcc acgcaagctg gagtgttgtt tggtatgggc 7140aaagggatgc cattctacgc atgggacttt ggagtcccgc tgctaatgat aggttgctac 7200tcacaattaa cacccctgac cctaatagtg gccatcattt tgctcgtggc gcactacatg 7260tacttgatcc cagggctgca ggcagcagct gcgcgtgctg cccagaagag aacggcagct 7320ggcatcatga agaaccctgt tgtggatgga atagtggtga ctgacattga cacaatgaca 7380attgaccccc aagtggagaa aaagatggga caggtgctac tcatagcagt agccgtctcc 7440agcgccatac tgtcgcggac cgcctggggg tggggggagg ctggggccct gatcacagct 7500gcaacttcca ctttgtggga aggctctccg aacaagtact ggaactcctc tacagccact 7560tcactgtgta acatttttag gggaagttac ttggctggag cttctctaat ctacacagta 7620acaagaaacg ctggcttggt caagagacgt gggggtggaa caggagagac cctgggagag 7680aaatggaagg cccgcttgaa ccagatgtcg gccctggagt tctactccta caaaaagtca 7740ggcatcaccg aggtgtgcag agaagaggcc cgccgcgccc tcaaggacgg tgtggcaacg 7800ggaggccatg ctgtgtcccg aggaagtgca aagctgagat ggttggtgga gcggggatac 7860ctgcagccct atggaaaggt cattgatctt ggatgtggca gagggggctg gagttactac 7920gccgccacca tccgcaaagt tcaagaagtg aaaggataca caaaaggagg ccctggtcat 7980gaagaaccca tgttggtgca aagctatggg tggaacatag tccgtcttaa gagtggggtg 8040gacgtctttc atatggcggc tgagccgtgt gacacgttgc tgtgtgacat aggtgagtca 8100tcatctagtc ctgaagtgga agaagcacgg acgctcagag tcctctccat ggtgggggat 8160tggcttgaaa aaagaccagg agccttttgt ataaaagtgt tgtgcccata caccagcact 8220atgatggaaa ccctggagcg actgcagcgt aggtatgggg gaggactggt cagagtgcca 8280ctctcccgca actctacaca tgagatgtac tgggtctctg gagcgaaaag caacaccata 8340aaaagtgtgt ccaccacgag ccagctcctc ttggggcgca tggacgggcc caggaggcca 8400gtgaaatatg aggaggatgt gaatctcggc tctggcacgc gggctgtggt aagctgcgct 8460gaagctccca acatgaagat cattggtaac cgcattgaaa ggatccgcag tgagcacgcg 8520gaaacgtggt tctttgacga gaaccaccca tataggacat gggcttacca tggaagctat 8580gaggccccca cacaagggtc agcgtcctct ctaataaacg gggttgtcag gctcctgtca 8640aaaccctggg atgtggtgac tggagtcaca ggaatagcca tgaccgacac cacaccgtat 8700ggtcagcaaa gagttttcaa ggaaaaagtg gacactaggg tgccagaccc ccaagaaggc 8760actcgtcagg ttatgagcat ggtctcttcc tggttgtgga aagagctagg caaacacaaa 8820cggccacgag tctgtaccaa agaagagttc atcaacaagg ttcgtagcaa tgcagcatta 8880ggggcaatat ttgaagagga aaaagagtgg aagactgcag tggaagctgt gaacgatcca 8940aggttctggg ctctagtgga caaggaaaga gagcaccacc tgagaggaga gtgccagagt 9000tgtgtgtaca acatgatggg aaaaagagaa aagaaacaag gggaatttgg aaaggccaag 9060ggcagccgcg ccatctggta tatgtggcta ggggctagat ttctagagtt cgaagccctt 9120ggattcttga acgaggatca ctggatgggg agagagaact caggaggtgg tgttgaaggg 9180ctgggattac aaagactcgg atatgtccta gaagagatga gtcgcatacc aggaggaagg 9240atgtatgcag atgacactgc tggctgggac acccgcatca gcaggtttga tctggagaat 9300gaagctctaa tcaccaacca aatggagaaa gggcacaggg ccttggcatt ggccataatc 9360aagtacacat accaaaacaa agtggtaaag gtccttagac cagctgaaaa agggaagaca 9420gttatggaca ttatttcgag acaagaccaa agggggagcg gacaagttgt cacttacgct 9480cttaacacat ttaccaacct agtggtgcaa ctcattcgga atatggaggc tgaggaagtt 9540ctagagatgc aagacttgtg gctgctgcgg aggtcagaga aagtgaccaa ctggttgcag 9600agcaacggat gggataggct caaacgaatg gcagtcagtg gagatgattg cgttgtgaag 9660ccaattgatg ataggtttgc acatgccctc aggttcttga atgatatggg aaaagttagg 9720aaggacacac aagagtggaa accctcaact ggatgggaca actgggaaga agttccgttt 9780tgctcccacc acttcaacaa gctccatctc aaggacggga ggtccattgt ggttccctgc 9840cgccaccaag atgaactgat tggccgggcc cgcgtctctc caggggcggg atggagcatc 9900cgggagactg cttgcctagc aaaatcatat gcgcaaatgt ggcagctcct ttatttccac 9960agaagggacc tccgactgat ggccaatgcc atttgttcat ctgtgccagt tgactgggtt 10020ccaactggga gaactacctg gtcaatccat ggaaagggag aatggatgac cactgaagac 10080atgcttgtgg tgtggaacag agtgtggatt gaggagaacg accacatgga agacaagacc 10140ccagttacga aatggacaga cattccctat ttgggaaaaa gggaagactt gtggtgtgga 10200tctctcatag ggcacagacc gcgcaccacc tgggctgaga acattaaaaa cacagtcaac 10260atggtgcgca ggatcatagg tgatgaagaa aagtacatgg actacctatc cacccaagtt 10320cgctacttgg gtgaagaagg gtctacacct ggagtgctgt aagcaccaat cttagtgttg 10380tcaggcctgc tagtcagcca cagcttgggg aaagctgtgc agcctgtgac ccccccagga 10440gaagctggga aaccaagcct atagtcaggc cgagaacgcc atggcacgga agaagccatg 10500ctgcctgtga gcccctcaga ggacactgag tcaaaaaacc ccacgcgctt ggaggcgcag 10560gatgggaaaa gaaggtggcg accttcccca cccttcaatc tggggcctga actggagatc 10620agctgtggat ctccagaaga gggactagtg gttagaggag accccccgga aaacgcaaaa 10680cagcatattg acgctgggaa agaccagaga ctccatgagt ttccaccacg ctggccgcca 10740ggcacagatc gccgaatagc ggcggccgg 107693910807DNAFlavivirus FSME 39agttgttgat ctgtgtgaat cagactgcga cagttcgagt ttgaagcgaa agctagcaac 60agtatcaaca ggttttattt tggatttgga aacgagagtt tctggtcatg aaaaacccaa 120aaaagaaatc cggaggattc cggattgtca atatgctaaa acgcggagta gcccgtgtga 180gcccctttgg gggcttgaag aggctgccag ccggacttct gctgggtcat gggcccatca 240ggatggtctt ggcgattcta gcctttttga gattcacggc aatcaagcca tcactgggtc 300tcatcaatag atggggttca gtggggaaaa aagaggctat ggaaataata aagaagttca 360agaaagatct ggctgccatg ctgagaataa tcaatgctag gaaggagaag aagagacgag 420gcgcagatac tagtgtcgga attgttggcc tcctgctgac cacagctatg gcagcggagg 480tcactagacg tgggagtgca tactatatgt acttggacag aaacgatgct ggggaggcca 540tatcttttcc aaccacattg gggatgaata agtgttatat acagatcatg gatcttggac

600acatgtgtga tgccaccatg agctatgaat gccctatgct ggatgagggg gtggaaccag 660atgacgtcga ttgttggtgc aacacgacgt caacttgggt tgtgtacgga acctgccatc 720acaaaaaagg tgaagcacgg agatctagaa gagctgtgac gctcccctcc cattccacta 780gaaagctgca aacgcggtcg caaacctggt tggaatcaag agaatacaca aagcacttga 840ttagagtcga aaattggata ttcaggaacc ctggcttcgc gttagcagca gctgccatcg 900cttggctttt gggaagctca acgagccaaa aagtcatata cttggtcatg atactgctga 960ttgccccggc atacagcatc aggtgcatag gagtcagcaa tagggacttt gtggaaggta 1020tgtcaggtgg gacttgggtt gatgttgtct tggaacatgg aggttgtgtc accgtaatgg 1080cacaggacaa accgactgtc gacatagagc tggttacaac aacagtcagc aacatggcgg 1140aggtaagatc ctactgctat gaggcatcaa tatcagacat ggcttcggac agccgctgcc 1200caacacaagg tgaagcctac cttgacaagc aatcagacac tcaatatgtc tgcaaaagaa 1260cgttagtgga cagaggctgg ggaaatggat gtggactttt tggcaaaggg agcctggtga 1320catgcgctaa gtttgcatgc tccaagaaaa tgaccgggaa gagcatccag ccagagaatc 1380tggagtaccg gataatgctg tcagttcatg gctcccagca cagtgggatg atcgttaatg 1440acacaggaca tgaaactgat gagaatagag cgaaggttga gataacgccc aattcaccaa 1500gagccgaagc caccctgggg ggttttggaa gcctaggact tgattgtgaa ccgaggacag 1560gccttgactt ttcagatttg tattacttga ctatgaataa caagcactgg ttggttcaca 1620aggagtggtt ccacgacatt ccattacctt ggcacgctgg ggcagacacc ggaactccac 1680actggaacaa caaagaagca ctggtagagt tcaaggacgc acatgccaaa aggcaaactg 1740tcgtggttct agggagtcaa gaaggagcag ttcacacggc ccttgctgga gctctggagg 1800ctgagatgga tggtgcaaag ggaaggctgt cctctggcca cttgaaatgt cgcctgaaaa 1860tggataaact tagattgaag ggcgtgtcat actccttgtg taccgcagcg ttcacattca 1920ccaagatccc ggctgaaaca ctgcacggga cagtcacagt ggaggtacag tacgcaggga 1980cagatggacc ttgcaaggtt ccagctcaga tggcggtgga catgcaaact ctgaccccag 2040ttgggaggtt gataaccgct aaccccgtaa tcactgaaag cactgagaac tctaagatga 2100tgctggaact tgatccacca tttggggact cttacattgt cataggagtc ggggagaaga 2160agatcaccca ccactggcac aggagtggca gcaccattgg aaaagcattt gaagccactg 2220tgagaggtgc caagagaatg gcagtcttgg gagacacagc ctgggacttt ggatcagttg 2280gaggcgctct caactcattg ggcaagggca tccatcaaat ttttggagca gctttcaaat 2340cattgtttgg aggaatgtcc tggttctcac aaattctcat tggaacgttg ctgatgtggt 2400tgggtctgaa cacaaagaat ggatctattt cccttatgtg cttggcctta gggggagtgt 2460tgatcttctt atccacagcc gtctctgctg atgtggggtg ctcggtggac ttctcaaaga 2520aggagacgag atgcggtaca ggggtgttcg tctataacga cgttgaagcc tggagggaca 2580ggtacaagta ccatcctgac tccccccgta gattggcagc agcagtcaag caagcctggg 2640aagatggtat ctgtgggatc tcctctgttt caagaatgga aaacatcatg tggagatcag 2700tagaagggga gctcaacgca atcctggaag agaatggagt tcaactgacg gtcgttgtgg 2760gatctgtaaa aaaccccatg tggagaggtc cacagagatt gcccgtgcct gtgaacgagc 2820tgccccacgg ctggaaggct tgggggaaat cgtacttcgt cagagcagca aagacaaata 2880acagctttgt cgtggatggt gacacactga aggaatgccc actcaaacat agagcatgga 2940acagctttct tgtggaggat catgggttcg gggtatttca cactagtgtc tggctcaagg 3000ttagagaaga ttattcatta gagtgtgatc cagccgttat tggaacagct gttaagggaa 3060aggaggctgt acacagtgat ctaggctact ggattgagag tgagaagaat gacacatgga 3120ggctgaagag ggcccatctg atcgagatga aaacatgtga atggccaaag tcccacacat 3180tgtggacaga tggaatagaa gagagtgatc tgatcatacc caagtcttta gctgggccac 3240tcagccatca caataccaga gagggctaca ggacccaaat gaaagggcca tggcacagtg 3300aagagcttga aattcggttt gaggaatgcc caggcactaa ggtccacgtg gaggaaacat 3360gtggaacaag aggaccatct ctgagatcaa ccactgcaag cggaagggtg atcgaggaat 3420ggtgctgcag ggagtgcaca atgcccccac tgtcgttccg ggctaaagat ggctgttggt 3480atggaatgga gataaggccc aggaaagaac cagaaagtaa cttagtaagg tcaatggtga 3540ctgcaggatc aactgatcac atggatcact tctcccttgg agtgcttgtg attctgctca 3600tggtgcagga agggctgaag aagagaatga ccacaaagat catcataagc acatcaatgg 3660cagtgctggt agctatgatc ctgggaggat tttcaatgag tgacctggct aagcttgcaa 3720ttttgatggg tgccaccttc gcggaaatga acactggagg agatgtagct catctggcgc 3780tgatagcggc attcaaagtc agaccagcgt tgctggtatc tttcatcttc agagctaatt 3840ggacaccccg tgaaagcatg ctgctggcct tggcctcgtg tcttttgcaa actgcgatct 3900ccgccttgga aggcgacctg atggttctca tcaatggttt tgctttggcc tggttggcaa 3960tacgagcgat ggttgttcca cgcactgata acatcacctt ggcaatcctg gctgctctga 4020caccactggc ccggggcaca ctgcttgtgg cgtggagagc aggccttgct acttgcgggg 4080ggtttatgct cctctctctg aagggaaaag gcagtgtgaa gaagaactta ccatttgtca 4140tggccctggg actaaccgct gtgaggctgg tcgaccccat caacgtggtg ggactgctgt 4200tgctcacaag gagtgggaag cggagctggc cccctagcga agtactcaca gctgttggcc 4260tgatatgcgc attggctgga gggttcgcca aggcagatat agagatggct gggcccatgg 4320ccgcggtcgg tctgctaatt gtcagttacg tggtctcagg aaagagtgtg gacatgtaca 4380ttgaaagagc aggtgacatc acatgggaaa aagatgcgga agtcactgga aacagtcccc 4440ggctcgatgt ggcgctagat gagagtggtg atttctccct ggtggaggat gacggtcccc 4500ccatgagaga gatcatactc aaggtggtcc tgatgaccat ctgtggcatg aacccaatag 4560ccataccctt tgcagctgga gcgtggtacg tatacgtgaa gactggaaaa aggagtggtg 4620ctctatggga tgtgcctgct cccaaggaag taaaaaaggg ggagaccaca gatggagtgt 4680acagagtaat gactcgtaga ctgctaggtt caacacaagt tggagtggga gttatgcaag 4740agggggtctt tcacactatg tggcacgtca caaaaggatc cgcgctgaga agcggtgaag 4800ggagacttga tccatactgg ggagatgtca agcaggatct ggtgtcatac tgtggtccat 4860ggaagctaga tgccgcctgg gacgggcaca gcgaggtgca gctcttggcc gtgccccccg 4920gagagagagc gaggaacatc cagactctgc ccggaatatt taagacaaag gatggggaca 4980ttggagcggt tgcgctggat tacccagcag gaacttcagg atctccaatc ctagacaagt 5040gtgggagagt gataggactt tatggcaatg gggtcgtgat caaaaatggg agttatgtta 5100gtgccatcac ccaagggagg agggaggaag agactcctgt tgagtgcttc gagccttcga 5160tgctgaagaa gaagcagcta actgtcttag acttgcatcc tggagctggg aaaaccagga 5220gagttcttcc tgaaatagtc cgtgaagcca taaaaacaag actccgtact gtgatcttag 5280ctccaaccag ggttgtcgct gctgaaatgg aggaagccct tagagggctt ccagtgcgtt 5340atatgacaac agcagtcaat gtcacccact ctggaacaga aatcgtcgac ttaatgtgcc 5400atgccacctt cacttcacgt ctactacagc caatcagagt ccccaactat aatctgtata 5460ttatggatga ggcccacttc acagatccct caagtatagc agcaagagga tacatttcaa 5520caagggttga gatgggcgag gcggctgcca tcttcatgac cgccacgcca ccaggaaccc 5580gtgacgcatt tccggactcc aactcaccaa ttatggacac cgaagtggaa gtcccagaga 5640gagcctggag ctcaggcttt gattgggtga cggatcattc tggaaaaaca gtttggtttg 5700ttccaagcgt gaggaacggc aatgagatcg cagcttgtct gacaaaggct ggaaaacggg 5760tcatacagct cagcagaaag acttttgaga cagagttcca gaaaacaaaa catcaagagt 5820gggactttgt cgtgacaact gacatttcag agatgggcgc caactttaaa gctgaccgtg 5880tcatagattc caggagatgc ctaaagccgg tcatacttga tggcgagaga gtcattctgg 5940ctggacccat gcctgtcaca catgccagcg ctgcccagag gagggggcgc ataggcagga 6000atcccaacaa acctggagat gagtatctgt atggaggtgg gtgcgcagag actgacgaag 6060accatgcaca ctggcttgaa gcaagaatgc tccttgacaa tatttacctc caagatggcc 6120tcatagcctc gctctatcga cctgaggccg acaaagtagc agccattgag ggagagttca 6180agcttaggac ggagcaaagg aagacctttg tggaactcat gaaaagagga gatcttcctg 6240tttggctggc ctatcaggtt gcatctgccg gaataaccta cacagataga agatggtgct 6300ttgatggcac gaccaacaac accataatgg aagacagtgt gccggcagag gtgtggacca 6360gacacggaga gaaaagagtg ctcaaaccga ggtggatgga cgccagagtt tgttcagatc 6420atgcggccct gaagtcattc aaggagtttg ccgctgggaa aagaggagcg gcttttggag 6480tgatggaagc cctgggaaca ctgccaggac acatgacaga gagattccag gaagccattg 6540acaacctcgc tgtgctcatg cgggcagaga ctggaagcag gccttacaaa gccgcggcgg 6600cccaattgcc ggagacccta gagaccatta tgcttttggg gttgctggga acagtctcgc 6660tgggaatctt tttcgtcttg atgaggaaca agggcatagg gaagatgggc tttggaatgg 6720tgactcttgg ggccagcgca tggctcatgt ggctctcgga aattgagcca gccagaattg 6780catgtgtcct cattgttgtg ttcctattgc tggtggtgct catacctgag ccagaaaagc 6840aaagatctcc ccaggacaac caaatggcaa tcatcatcat ggtagcagta ggtcttctgg 6900gcttgattac cgccaatgaa ctcggatggt tggagagaac aaagagtgac ctaagccatc 6960taatgggaag gagagaggag ggggcaacca taggattctc aatggacatt gacctgcggc 7020cagcctcagc ttgggccatc tatgctgcct tgacaacttt cattacccca gccgtccaac 7080atgcagtgac cacttcatac aacaactact ccttaatggc gatggccacg caagctggag 7140tgttgtttgg tatgggcaaa gggatgccat tctacgcatg ggactttgga gtcccgctgc 7200taatgatagg ttgctactca caattaacac ccctgaccct aatagtggcc atcattttgc 7260tcgtggcgca ctacatgtac ttgatcccag ggctgcaggc agcagctgcg cgtgctgccc 7320agaagagaac ggcagctggc atcatgaaga accctgttgt ggatggaata gtggtgactg 7380acattgacac aatgacaatt gacccccaag tggagaaaaa gatgggacag gtgctactca 7440tagcagtagc cgtctccagc gccatactgt cgcggaccgc ctgggggtgg ggggaggctg 7500gggccctgat cacagctgca acttccactt tgtgggaagg ctctccgaac aagtactgga 7560actcctctac agccacttca ctgtgtaaca tttttagggg aagttacttg gctggagctt 7620ctctaatcta cacagtaaca agaaacgctg gcttggtcaa gagacgtggg ggtggaacag 7680gagagaccct gggagagaaa tggaaggccc gcttgaacca gatgtcggcc ctggagttct 7740actcctacaa aaagtcaggc atcaccgagg tgtgcagaga agaggcccgc cgcgccctca 7800aggacggtgt ggcaacggga ggccatgctg tgtcccgagg aagtgcaaag ctgagatggt 7860tggtggagcg gggatacctg cagccctatg gaaaggtcat tgatcttgga tgtggcagag 7920ggggctggag ttactacgcc gccaccatcc gcaaagttca agaagtgaaa ggatacacaa 7980aaggaggccc tggtcatgaa gaacccatgt tggtgcaaag ctatgggtgg aacatagtcc 8040gtcttaagag tggggtggac gtctttcata tggcggctga gccgtgtgac acgttgctgt 8100gtgacatagg tgagtcatca tctagtcctg aagtggaaga agcacggacg ctcagagtcc 8160tctccatggt gggggattgg cttgaaaaaa gaccaggagc cttttgtata aaagtgttgt 8220gcccatacac cagcactatg atggaaaccc tggagcgact gcagcgtagg tatgggggag 8280gactggtcag agtgccactc tcccgcaact ctacacatga gatgtactgg gtctctggag 8340cgaaaagcaa caccataaaa agtgtgtcca ccacgagcca gctcctcttg gggcgcatgg 8400acgggcccag gaggccagtg aaatatgagg aggatgtgaa tctcggctct ggcacgcggg 8460ctgtggtaag ctgcgctgaa gctcccaaca tgaagatcat tggtaaccgc attgaaagga 8520tccgcagtga gcacgcggaa acgtggttct ttgacgagaa ccacccatat aggacatggg 8580cttaccatgg aagctatgag gcccccacac aagggtcagc gtcctctcta ataaacgggg 8640ttgtcaggct cctgtcaaaa ccctgggatg tggtgactgg agtcacagga atagccatga 8700ccgacaccac accgtatggt cagcaaagag ttttcaagga aaaagtggac actagggtgc 8760cagaccccca agaaggcact cgtcaggtta tgagcatggt ctcttcctgg ttgtggaaag 8820agctaggcaa acacaaacgg ccacgagtct gtaccaaaga agagttcatc aacaaggttc 8880gtagcaatgc agcattaggg gcaatatttg aagaggaaaa agagtggaag actgcagtgg 8940aagctgtgaa cgatccaagg ttctgggctc tagtggacaa ggaaagagag caccacctga 9000gaggagagtg ccagagttgt gtgtacaaca tgatgggaaa aagagaaaag aaacaagggg 9060aatttggaaa ggccaagggc agccgcgcca tctggtatat gtggctaggg gctagatttc 9120tagagttcga agcccttgga ttcttgaacg aggatcactg gatggggaga gagaactcag 9180gaggtggtgt tgaagggctg ggattacaaa gactcggata tgtcctagaa gagatgagtc 9240gcataccagg aggaaggatg tatgcagatg acactgctgg ctgggacacc cgcatcagca 9300ggtttgatct ggagaatgaa gctctaatca ccaaccaaat ggagaaaggg cacagggcct 9360tggcattggc cataatcaag tacacatacc aaaacaaagt ggtaaaggtc cttagaccag 9420ctgaaaaagg gaagacagtt atggacatta tttcgagaca agaccaaagg gggagcggac 9480aagttgtcac ttacgctctt aacacattta ccaacctagt ggtgcaactc attcggaata 9540tggaggctga ggaagttcta gagatgcaag acttgtggct gctgcggagg tcagagaaag 9600tgaccaactg gttgcagagc aacggatggg ataggctcaa acgaatggca gtcagtggag 9660atgattgcgt tgtgaagcca attgatgata ggtttgcaca tgccctcagg ttcttgaatg 9720atatgggaaa agttaggaag gacacacaag agtggaaacc ctcaactgga tgggacaact 9780gggaagaagt tccgttttgc tcccaccact tcaacaagct ccatctcaag gacgggaggt 9840ccattgtggt tccctgccgc caccaagatg aactgattgg ccgggcccgc gtctctccag 9900gggcgggatg gagcatccgg gagactgctt gcctagcaaa atcatatgcg caaatgtggc 9960agctccttta tttccacaga agggacctcc gactgatggc caatgccatt tgttcatctg 10020tgccagttga ctgggttcca actgggagaa ctacctggtc aatccatgga aagggagaat 10080ggatgaccac tgaagacatg cttgtggtgt ggaacagagt gtggattgag gagaacgacc 10140acatggaaga caagacccca gttacgaaat ggacagacat tccctatttg ggaaaaaggg 10200aagacttgtg gtgtggatct ctcatagggc acagaccgcg caccacctgg gctgagaaca 10260ttaaaaacac agtcaacatg gtgcgcagga tcataggtga tgaagaaaag tacatggact 10320acctatccac ccaagttcgc tacttgggtg aagaagggtc tacacctgga gtgctgtaag 10380caccaatctt agtgttgtca ggcctgctag tcagccacag cttggggaaa gctgtgcagc 10440ctgtgacccc cccaggagaa gctgggaaac caagcctata gtcaggccga gaacgccatg 10500gcacggaaga agccatgctg cctgtgagcc cctcagagga cactgagtca aaaaacccca 10560cgcgcttgga ggcgcaggat gggaaaagaa ggtggcgacc ttccccaccc ttcaatctgg 10620ggcctgaact ggagatcagc tgtggatctc cagaagaggg actagtggtt agaggagacc 10680ccccggaaaa cgcaaaacag catattgacg ctgggaaaga ccagagactc catgagtttc 10740caccacgctg gccgccaggc acagatcgcc gaatagcggc ggccggtgtg gggaaatcca 10800tgggtct 108074010807DNAFlavivirus FSME 40agttgttgat ctgtgtgaat cagactgcga cagttcgagt ttgaagcgaa agctagcaac 60agtatcaaca ggttttattt tggatttgga aacgagagtt tctggtcatg aaaaacccaa 120aaaagaaatc cggaggattc cggattgtca atatgctaaa acgcggagta gcccgtgtga 180gcccctttgg gggcttgaag aggctgccag ccggacttct gctgggtcat gggcccatca 240ggatggtctt ggcgattcta gcctttttga gattcacggc aatcaagcca tcactgggtc 300tcatcaatag atggggttca gtggggaaaa aagaggctat ggaaataata aagaagttca 360agaaagatct ggctgccatg ctgagaataa tcaatgctag gaaggagaag aagagacgag 420gcgcagatac tagtgtcgga attgttggcc tcctgctgac cacagctatg gcagcggagg 480tcactagacg tgggagtgca tactatatgt acttggacag aaacgatgct ggggaggcca 540tatcttttcc aaccacattg gggatgaata agtgttatat acagatcatg gatcttggac 600acatgtgtga tgccaccatg agctatgaat gccctatgct ggatgagggg gtggaaccag 660atgacgtcga ttgttggtgc aacacgacgt caacttgggt tgtgtacgga acctgccatc 720acaaaaaagg tgaagcacgg agatctagaa gagctgtgac gctcccctcc cattccacta 780gaaagctgca aacgcggtcg caaacctggt tggaatcaag agaatacaca aagcacttga 840ttagagtcga aaattggata ttcaggaacc ctggcttcgc gttagcagca gctgccatcg 900cttggctttt gggaagctca acgagccaaa aagtcatata cttggtcgtg atactgctga 960ttgccccggc atacagcatc aggtgcatag gagtcagcaa tagggacttt gtggaaggta 1020tgtcaggtgg gacttgggtt gatgttgtct tggaacatgg aggttgtgtc accgtaatgg 1080cacaggacaa accgactgtc gacatagagc tggttacaac aacagtcagc aacatggcgg 1140aggtaagatc ctactgctat gaggcatcaa tatcagacat ggcttcggac agccgctgcc 1200caacacaagg tgaagcctac cttgacaagc aatcagacac tcaatatgtc tgcaaaagaa 1260cgttagtgga cagaggctgg ggaaatggat gtggactttt tggcaaaggg agcctggtga 1320catgcgctaa gtttgcatgc tccaagaaaa tgaccgggaa gagcatccag ccagagaatc 1380tggagtaccg gataatgctg tcagttcatg gctcccagca cagtgggatg atcgttaatg 1440acacaggaca tgaaactgat gagaatagag cgaaggttga gataacgccc aattcaccaa 1500gagccgaagc caccctgggg ggttttggaa gcctaggact tgattgtgaa ccgaggacag 1560gccttgactt ttcagatttg tattacttga ctatgaataa caagcactgg ttggttcaca 1620aggagtggtt ccacgacatt ccattacctt ggcacgctgg ggcagacacc ggaactccac 1680actggaacaa caaagaagca ctggtagagt tcaaggacgc acatgccaaa aggcaaactg 1740tcgtggttct agggagtcaa gaaggagcag ttcacacggc ccttgctgga gctctggagg 1800ctgagatgga tggtgcaaag ggaaggctgt cctctggcca cttgaaatgt cgcctgaaaa 1860tggataaact tagattgaag ggcgtgtcat actccttgtg taccgcagcg ttcacattca 1920ccaagatccc ggctgaaaca ctgcacggga cagtcacagt ggaggtacag tacgcaggga 1980cagatggacc ttgcaaggtt ccagctcaga tggcggtgga catgcaaact ctgaccccag 2040ttgggaggtt gataaccgct aaccccgtaa tcactgaaag cactgagaac tctaagatga 2100tgctggaact tgatccacca tttggggact cttacattgt cataggagtc ggggagaaga 2160agatcaccca ccactggcac aggagtggca gcaccattgg aaaagcattt gaagccactg 2220tgagaggtgc caagagaatg gcagtcttgg gagacacagc ctgggacttt ggatcagttg 2280gaggcgctct caactcattg ggcaagggca tccatcaaat ttttggagca gctttcaaat 2340cattgtttgg aggaatgtcc tggttctcac aaattctcat tggaacgttg ctgatgtggt 2400tgggtctgaa cacaaagaat ggatctattt cccttatgtg cttggcctta gggggagtgt 2460tgatcttctt atccacagcc gtctctgctg atgtggggtg ctcggtggac ttctcaaaga 2520aggagacgag atgcggtaca ggggtgttcg tctataacga cgttgaagcc tggagggaca 2580ggtacaagta ccatcctgac tccccccgta gattggcagc agcagtcaag caagcctggg 2640aagatggtat ctgtgggatc tcctctgttt caagaatgga aaacatcatg tggagatcag 2700tagaagggga gctcaacgca atcctggaag agaatggagt tcaactgacg gtcgttgtgg 2760gatctgtaaa aaaccccatg tggagaggtc cacagagatt gcccgtgcct gtgaacgagc 2820tgccccacgg ctggaaggct tgggggaaat cgtacttcgt cagagcagca aagacaaata 2880acagctttgt cgtggatggt gacacactga aggaatgccc actcaaacat agagcatgga 2940acagctttct tgtggaggat catgggttcg gggtatttca cactagtgtc tggctcaagg 3000ttagagaaga ttattcatta gagtgtgatc cagccgttat tggaacagct gttaagggaa 3060aggaggctgt acacagtgat ctaggctact ggattgagag tgagaagaat gacacatgga 3120ggctgaagag ggcccatctg atcgagatga aaacatgtga atggccaaag tcccacacat 3180tgtggacaga tggaatagaa gagagtgatc tgatcatacc caagtcttta gctgggccac 3240tcagccatca caataccaga gagggctaca ggacccaaat gaaagggcca tggcacagtg 3300aagagcttga aattcggttt gaggaatgcc caggcactaa ggtccacgtg gaggaaacat 3360gtggaacaag aggaccatct ctgagatcaa ccactgcaag cggaagggtg atcgaggaat 3420ggtgctgcag ggagtgcaca atgcccccac tgtcgttccg ggctaaagat ggctgttggt 3480atggaatgga gataaggccc aggaaagaac cagaaagtaa cttagtaagg tcaatggtga 3540ctgcaggatc aactgatcac atggatcact tctcccttgg agtgcttgtg attctgctca 3600tggtgcagga agggctgaag aagagaatga ccacaaagat catcataagc acatcaatgg 3660cagtgctggt agctatgatc ctgggaggat tttcaatgag tgacctggct aagcttgcaa 3720ttttgatggg tgccaccttc gcggaaatga acactggagg agatgtagct catctggcgc 3780tgatagcggc attcaaagtc agaccagcgt tgctggtatc tttcatcttc agagctaatt 3840ggacaccccg tgaaagcatg ctgctggcct tggcctcgtg tcttttgcaa actgcgatct 3900ccgccttgga aggcgacctg atggttctca tcaatggttt tgctttggcc tggttggcaa 3960tacgagcgat ggttgttcca cgcactgata acatcacctt ggcaatcctg gctgctctga 4020caccactggc ccggggcaca ctgcttgtgg cgtggagagc aggccttgct acttgcgggg 4080ggtttatgct cctctctctg aagggaaaag gcagtgtgaa gaagaactta ccatttgtca 4140tggccctggg actaaccgct gtgaggctgg tcgaccccat caacgtggtg ggactgctgt 4200tgctcacaag gagtgggaag cggagctggc cccctagcga agtactcaca gctgttggcc 4260tgatatgcgc attggctgga gggttcgcca aggcagatat agagatggct gggcccatgg 4320ccgcggtcgg tctgctaatt gtcagttacg tggtctcagg aaagagtgtg gacatgtaca 4380ttgaaagagc aggtgacatc acatgggaaa aagatgcgga agtcactgga aacagtcccc 4440ggctcgatgt ggcgctagat gagagtggtg atttctccct ggtggaggat gacggtcccc 4500ccatgagaga gatcatactc aaggtggtcc tgatgaccat ctgtggcatg aacccaatag 4560ccataccctt tgcagctgga gcgtggtacg tatacgtgaa gactggaaaa aggagtggtg 4620ctctatggga tgtgcctgct cccaaggaag taaaaaaggg ggagaccaca gatggagtgt 4680acagagtaat gactcgtaga ctgctaggtt caacacaagt tggagtggga gttatgcaag 4740agggggtctt tcacactatg tggcacgtca

caaaaggatc cgcgctgaga agcggtgaag 4800ggagacttga tccatactgg ggagatgtca agcaggatct ggtgtcatac tgtggtccat 4860ggaagctaga tgccgcctgg gacgggcaca gcgaggtgca gctcttggcc gtgccccccg 4920gagagagagc gaggaacatc cagactctgc ccggaatatt taagacaaag gatggggaca 4980ttggagcggt tgcgctggat tacccagcag gaacttcagg atctccaatc ctagacaagt 5040gtgggagagt gataggactt tatggcaatg gggtcgtgat caaaaatggg agttatgtta 5100gtgccatcac ccaagggagg agggaggaag agactcctgt tgagtgcttc gagccttcga 5160tgctgaagaa gaagcagcta actgtcttag acttgcatcc tggagctggg aaaaccagga 5220gagttcttcc tgaaatagtc cgtgaagcca taaaaacaag actccgtact gtgatcttag 5280ctccaaccag ggttgtcgct gctgaaatgg aggaagccct tagagggctt ccagtgcgtt 5340atatgacaac agcagtcaat gtcacccact ctggaacaga aatcgtcgac ttaatgtgcc 5400atgccacctt cacttcacgt ctactacagc caatcagagt ccccaactat aatctgtata 5460ttatggatga ggcccacttc acagatccct caagtatagc agcaagagga tacatttcaa 5520caagggttga gatgggcgag gcggctgcca tcttcatgac cgccacgcca ccaggaaccc 5580gtgacgcatt tccggactcc aactcaccaa ttatggacac cgaagtggaa gtcccagaga 5640gagcctggag ctcaggcttt gattgggtga cggatcattc tggaaaaaca gtttggtttg 5700ttccaagcgt gaggaacggc aatgagatcg cagcttgtct gacaaaggct ggaaaacggg 5760tcatacagct cagcagaaag acttttgaga cagagttcca gaaaacaaaa catcaagagt 5820gggactttgt cgtgacaact gacatttcag agatgggcgc caactttaaa gctgaccgtg 5880tcatagattc caggagatgc ctaaagccgg tcatacttga tggcgagaga gtcattctgg 5940ctggacccat gcctgtcaca catgccagcg ctgcccagag gagggggcgc ataggcagga 6000atcccaacaa acctggagat gagtatctgt atggaggtgg gtgcgcagag actgacgaag 6060accatgcaca ctggcttgaa gcaagaatgc tccttgacaa tatttacctc caagatggcc 6120tcatagcctc gctctatcga cctgaggccg acaaagtagc agccattgag ggagagttca 6180agcttaggac ggagcaaagg aagacctttg tggaactcat gaaaagagga gatcttcctg 6240tttggctggc ctatcaggtt gcatctgccg gaataaccta cacagataga agatggtgct 6300ttgatggcac gaccaacaac accataatgg aagacagtgt gccggcagag gtgtggacca 6360gacacggaga gaaaagagtg ctcaaaccga ggtggatgga cgccagagtt tgttcagatc 6420atgcggccct gaagtcattc aaggagtttg ccgctgggaa aagaggagcg gcttttggag 6480tgatggaagc cctgggaaca ctgccaggac acatgacaga gagattccag gaagccattg 6540acaacctcgc tgtgctcatg cgggcagaga ctggaagcag gccttacaaa gccgcggcgg 6600cccaattgcc ggagacccta gagaccatta tgcttttggg gttgctggga acagtctcgc 6660tgggaatctt tttcgtcttg atgaggaaca agggcatagg gaagatgggc tttggaatgg 6720tgactcttgg ggccagcgca tggctcatgt ggctctcgga aattgagcca gccagaattg 6780catgtgtcct cattgttgtg ttcctattgc tggtggtgct catacctgag ccagaaaagc 6840aaagatctcc ccaggacaac caaatggcaa tcatcatcat ggtagcagta ggtcttctgg 6900gcttgattac cgccaatgaa ctcggatggt tggagagaac aaagagtgac ctaagccatc 6960taatgggaag gagagaggag ggggcaacca taggattctc aatggacatt gacctgcggc 7020cagcctcagc ttgggccatc tatgctgcct tgacaacttt cattacccca gccgtccaac 7080atgcagtgac cacttcatac aacaactact ccttaatggc gatggccacg caagctggag 7140tgttgtttgg tatgggcaaa gggatgccat tctacgcatg ggactttgga gtcccgctgc 7200taatgatagg ttgctactca caattaacac ccctgaccct aatagtggcc atcattttgc 7260tcgtggcgca ctacatgtac ttgatcccag ggctgcaggc agcagctgcg cgtgctgccc 7320agaagagaac ggcagctggc atcatgaaga accctgttgt ggatggaata gtggtgactg 7380acattgacac aatgacaatt gacccccaag tggagaaaaa gatgggacag gtgctactca 7440tagcagtagc cgtctccagc gccatactgt cgcggaccgc ctgggggtgg ggggaggctg 7500gggccctgat cacagctgca acttccactt tgtgggaagg ctctccgaac aagtactgga 7560actcctctac agccacttca ctgtgtaaca tttttagggg aagttacttg gctggagctt 7620ctctaatcta cacagtaaca agaaacgctg gcttggtcaa gagacgtggg ggtggaacag 7680gagagaccct gggagagaaa tggaaggccc gcttgaacca gatgtcggcc ctggagttct 7740actcctacaa aaagtcaggc atcaccgagg tgtgcagaga agaggcccgc cgcgccctca 7800aggacggtgt ggcaacggga ggccatgctg tgtcccgagg aagtgcaaag ctgagatggt 7860tggtggagcg gggatacctg cagccctatg gaaaggtcat tgatcttgga tgtggcagag 7920ggggctggag ttactacgcc gccaccatcc gcaaagttca agaagtgaaa ggatacacaa 7980aaggaggccc tggtcatgaa gaacccatgt tggtgcaaag ctatgggtgg aacatagtcc 8040gtcttaagag tggggtggac gtctttcata tggcggctga gccgtgtgac acgttgctgt 8100gtgacatagg tgagtcatca tctagtcctg aagtggaaga agcacggacg ctcagagtcc 8160tctccatggt gggggattgg cttgaaaaaa gaccaggagc cttttgtata aaagtgttgt 8220gcccatacac cagcactatg atggaaaccc tggagcgact gcagcgtagg tatgggggag 8280gactggtcag agtgccactc tcccgcaact ctacacatga gatgtactgg gtctctggag 8340cgaaaagcaa caccataaaa agtgtgtcca ccacgagcca gctcctcttg gggcgcatgg 8400acgggcccag gaggccagtg aaatatgagg aggatgtgaa tctcggctct ggcacgcggg 8460ctgtggtaag ctgcgctgaa gctcccaaca tgaagatcat tggtaaccgc attgaaagga 8520tccgcagtga gcacgcggaa acgtggttct ttgacgagaa ccacccatat aggacatggg 8580cttaccatgg aagctatgag gcccccacac aagggtcagc gtcctctcta ataaacgggg 8640ttgtcaggct cctgtcaaaa ccctgggatg tggtgactgg agtcacagga atagccatga 8700ccgacaccac accgtatggt cagcaaagag ttttcaagga aaaagtggac actagggtgc 8760cagaccccca agaaggcact cgtcaggtta tgagcatggt ctcttcctgg ttgtggaaag 8820agctaggcaa acacaaacgg ccacgagtct gtaccaaaga agagttcatc aacaaggttc 8880gtagcaatgc agcattaggg gcaatatttg aagaggaaaa agagtggaag actgcagtgg 8940aagctgtgaa cgatccaagg ttctgggctc tagtggacaa ggaaagagag caccacctga 9000gaggagagtg ccagagttgt gtgtacaaca tgatgggaaa aagagaaaag aaacaagggg 9060aatttggaaa ggccaagggc agccgcgcca tctggtatat gtggctaggg gctagatttc 9120tagagttcga agcccttgga ttcttgaacg aggatcactg gatggggaga gagaactcag 9180gaggtggtgt tgaagggctg ggattacaaa gactcggata tgtcctagaa gagatgagtc 9240gcataccagg aggaaggatg tatgcagatg acactgctgg ctgggacacc cgcatcagca 9300ggtttgatct ggagaatgaa gctctaatca ccaaccaaat ggagaaaggg cacagggcct 9360tggcattggc cataatcaag tacacatacc aaaacaaagt ggtaaaggtc cttagaccag 9420ctgaaaaagg gaagacagtt atggacatta tttcgagaca agaccaaagg gggagcggac 9480aagttgtcac ttacgctctt aacacattta ccaacctagt ggtgcaactc attcggaata 9540tggaggctga ggaagttcta gagatgcaag acttgtggct gctgcggagg tcagagaaag 9600tgaccaactg gttgcagagc aacggatggg ataggctcaa acgaatggca gtcagtggag 9660atgattgcgt tgtgaagcca attgatgata ggtttgcaca tgccctcagg ttcttgaatg 9720atatgggaaa agttaggaag gacacacaag agtggaaacc ctcaactgga tgggacaact 9780gggaagaagt tccgttttgc tcccaccact tcaacaagct ccatctcaag gacgggaggt 9840ccattgtggt tccctgccgc caccaagatg aactgattgg ccgggcccgc gtctctccag 9900gggcgggatg gagcatccgg gagactgctt gcctagcaaa atcatatgcg caaatgtggc 9960agctccttta tttccacaga agggacctcc gactgatggc caatgccatt tgttcatctg 10020tgccagttga ctgggttcca actgggagaa ctacctggtc aatccatgga aagggagaat 10080ggatgaccac tgaagacatg cttgtggtgt ggaacagagt gtggattgag gagaacgacc 10140acatggaaga caagacccca gttacgaaat ggacagacat tccctatttg ggaaaaaggg 10200aagacttgtg gtgtggatct ctcatagggc acagaccgcg caccacctgg gctgagaaca 10260ttaaaaacac agtcaacatg gtgcgcagga tcataggtga tgaagaaaag tacatggact 10320acctatccac ccaagttcgc tacttgggtg aagaagggtc tacacctgga gtgctgtaag 10380caccaatctt agtgttgtca ggcctgctag tcagccacag cttggggaaa gctgtgcagc 10440ctgtgacccc cccaggagaa gctgggaaac caagcctata gtcaggccga gaacgccatg 10500gcacggaaga agccatgctg cctgtgagcc cctcagagga cactgagtca aaaaacccca 10560cgcgcttgga ggcgcaggat gggaaaagaa ggtggcgacc ttccccaccc ttcaatctgg 10620ggcctgaact ggagatcagc tgtggatctc cagaagaggg actagtggtt agaggagacc 10680ccccggaaaa cgcaaaacag catattgacg ctgggaaaga ccagagactc catgagtttc 10740caccacgctg gccgccaggc acagatcgcc gaatagcggc ggccggtgtg gggaaatcca 10800tgggtct 108074110807DNAFlavivirus FSME 41agttgttgat ctgtgtgaat cagactgcga cagttcgagt ttgaagcgaa agctagcaac 60agtatcaaca ggttttattt tggatttgga aacgagagtt tctggtcatg aaaaacccaa 120aaaagaaatc cggaggattc cggattgtca atatgctaaa acgcggagta gcccgtgtga 180gcccctttgg gggcttgaag aggctgccag ccggacttct gctgggtcat gggcccatca 240ggatggtctt ggcgattcta gcctttttga gattcacggc aatcaagcca tcactgggtc 300tcatcaatag atggggttca gtggggaaaa aagaggctat ggaaataata aagaagttca 360agaaagatct ggctgccatg ctgagaataa tcaatgctag gaaggagaag aagagacgag 420gcgcagatac tagtgtcgga attgttggcc tcctgctgac cacagctatg gcagcggagg 480tcactagacg tgggagtgca tactatatgt acttggacag aaacgatgct ggggaggcca 540tatcttttcc aaccacattg gggatgaata agtgttatat acagatcatg gatcttggac 600acatgtgtga tgccaccatg agctatgaat gccctatgct ggatgagggg gtggaaccag 660atgacgtcga ttgttggtgc aacacgacgt caacttgggt tgtgtacgga acctgccatc 720acaaaaaagg tgaagcacgg agatctagaa gagctgtgac gctcccctcc cattccacta 780gaaagctgca aacgcggtcg caaacctggt tggaatcaag agaatacaca aagcacttga 840ttagagtcga aaattggata ttcaggaacc ctggcttcgc gttagcagca gctgccatcg 900cttggctttt gggaagctca acgagccaaa aagtcatata cttggtcatg atactgctga 960ttgccccggc atacagcatc aggtgcatag gagtcagcaa tagggacttt gtggaaggta 1020tgtcaggtgg gacttgggtt gatgttgtct tggaacatgg aggttgtgtc accgtaatgg 1080cacaggacaa accgactgtc gacatagagc tggttacaac aacagtcagc aacatggcgg 1140aggtaagatc ctactgctat gaggcatcaa tatcagacat ggcttcggac agccgctgcc 1200caacacaagg tgaagcctac cttgacaagc aatcagacac tcaatatgtc tgcaaaagaa 1260cgttagtgga cagaggctgg ggaaatggat gtggactttt tggcaaaggg agcctggtga 1320catgcgctaa gtttgcatgc tccaagaaaa tgaccgggaa gagcatccag ccagagaatc 1380tggagtaccg gataatgctg tcagttcatg gctcccagca cagtgggatg atcgttaatg 1440acacaggaca tgaaactgat gagaatagag cgaaggttga gataacgccc aattcaccaa 1500gagccgaagc caccctgggg ggttttggaa gcctaggact tgattgtgaa ccgaggacag 1560gccttgactt ttcagatttg tattacttga ctatgaataa caagcactgg ttggttcaca 1620aggagtggtt ccacgacatt ccattacctt ggcacgctgg ggcagacacc ggaactccac 1680actggaacaa caaagaagca ctggtagagt tcaaggacgc acatgccaaa aggcaaactg 1740tcgtggttct agggagtcaa gaaggagcag ttcacacggc ccttgctgga gctctggagg 1800ctgagatgga tggtgcaaag ggaaggctgt cctctggcca cttgaaatgt cgcctgaaaa 1860tggataaact tagattgaag ggcgtgtcat actccttgtg taccgcagcg ttcacattca 1920ccaagatccc ggctgaaaca ctgcacggga cagtcacagt ggaggtacag tacgcaggga 1980cagatggacc ttgcaaggtt ccagctcaga tggcggtgga catgcaaact ctgaccccag 2040ttgggaggtt gataaccgct aaccccgtaa tcactgaaag cactgagaac tctaagatga 2100tgctggaact tgatccacca tttggggact cttacattgt cataggagtc ggggagaaga 2160agatcaccca ccactggcac aggagtggca gcaccattgg aaaagcattt gaagccactg 2220tgagaggtgc caagagaatg gcagtcttgg gagacacagc ctgggacttt ggatcagttg 2280gaggcgctct caactcattg ggcaagggca tccatcaaat ttttggagca gctttcaaat 2340cattgtttgg aggaatgtcc tggttctcac aaattctcat tggaacgttg ctgatgtggt 2400tgggtctgaa cacaaagaat ggatctattt cccttatgtg cttggcctta gggggagtgt 2460tgatcttctt atccacagcc gtctctgctg atgtggggtg ctcggtggac ttctcaaaga 2520aggagacgag atgcggtaca ggggtgttcg tctataacga cgttgaagcc tggagggaca 2580ggtacaagta ccatcctgac tccccccgta gattggcagc agcagtcaag caagcctggg 2640aagatggtat ctgtgggatc tcctctgttt caagaatgga aaacatcatg tggagatcag 2700tagaagggga gctcaacgca atcctggaag agaatggagt tcaactgacg gtcgttgtgg 2760gatctgtaaa aaaccccatg tggagaggtc cacagagatt gcccgtgcct gtgaacgagc 2820tgccccacgg ctggaaggct tgggggaaat cgtacttcgt cagagcagca aagacaaata 2880acagctttgt cgtggatggt gacacactga aggtatgccc actcaaacat agagcatgga 2940acagctttct tgtggaggat catgggttcg gggtatttca cactagtgtc tggctcaagg 3000ttagagaaga ttattcatta gagtgtgatc cagccgttat tggaacagct gttaagggaa 3060aggaggctgt acacagtgat ctaggctact ggattgagag tgagaagaat gacacatgga 3120ggctgaagag ggcccatctg atcgagatga aaacatgtga atggccaaag tcccacacat 3180tgtggacaga tggaatagaa gagagtgatc tgatcatacc caagtcttta gctgggccac 3240tcagccatca caataccaga gagggctaca ggacccaaat gaaagggcca tggcacagtg 3300aagagcttga aattcggttt gaggaatgcc caggcactaa ggtccacgtg gaggaaacat 3360gtggaacaag aggaccatct ctgagatcaa ccactgcaag cggaagggtg atcgaggaat 3420ggtgctgcag ggagtgcaca atgcccccac tgtcgttccg ggctaaagat ggctgttggt 3480atggaatgga gataaggccc aggaaagaac cagaaagtaa cttagtaagg tcaatggtga 3540ctgcaggatc aactgatcac atggatcact tctcccttgg agtgcttgtg attctgctca 3600tggtgcagga agggctgaag aagagaatga ccacaaagat catcataagc acatcaatgg 3660cagtgctggt agctatgatc ctgggaggat tttcaatgag tgacctggct aagcttgcaa 3720ttttgatggg tgccaccttc gcggaaatga acactggagg agatgtagct catctggcgc 3780tgatagcggc attcaaagtc agaccagcgt tgctggtatc tttcatcttc agagctaatt 3840ggacaccccg tgaaagcatg ctgctggcct tggcctcgtg tcttttgcaa actgcgatct 3900ccgccttgga aggcgacctg atggttctca tcaatggttt tgctttggcc tggttggcaa 3960tacgagcgat ggttgttcca cgcactgata acatcacctt ggcaatcctg gctgctctga 4020caccactggc ccggggcaca ctgcttgtgg cgtggagagc aggccttgct acttgcgggg 4080ggtttatgct cctctctctg aagggaaaag gcagtgtgaa gaagaactta ccatttgtca 4140tggccctggg actaaccgct gtgaggctgg tcgaccccat caacgtggtg ggactgctgt 4200tgctcacaag gagtgggaag cggagctggc cccctagcga agtactcaca gctgttggcc 4260tgatatgcgc attggctgga gggttcgcca aggcagatat agagatggct gggcccatgg 4320ccgcggtcgg tctgctaatt gtcagttacg tggtctcagg aaagagtgtg gacatgtaca 4380ttgaaagagc aggtgacatc acatgggaaa aagatgcgga agtcactgga aacagtcccc 4440ggctcgatgt ggcgctagat gagagtggtg atttctccct ggtggaggat gacggtcccc 4500ccatgagaga gatcatactc aaggtggtcc tgatgaccat ctgtggcatg aacccaatag 4560ccataccctt tgcagctgga gcgtggtacg tatacgtgaa gactggaaaa aggagtggtg 4620ctctatggga tgtgcctgct cccaaggaag taaaaaaggg ggagaccaca gatggagtgt 4680acagagtaat gactcgtaga ctgctaggtt caacacaagt tggagtggga gttatgcaag 4740agggggtctt tcacactatg tggcacgtca caaaaggatc cgcgctgaga agcggtgaag 4800ggagacttga tccatactgg ggagatgtca agcaggatct ggtgtcatac tgtggtccat 4860ggaagctaga tgccgcctgg gacgggcaca gcgaggtgca gctcttggcc gtgccccccg 4920gagagagagc gaggaacatc cagactctgc ccggaatatt taagacaaag gatggggaca 4980ttggagcggt tgcgctggat tacccagcag gaacttcagg atctccaatc ctagacaagt 5040gtgggagagt gataggactt tatggcaatg gggtcgtgat caaaaatggg agttatgtta 5100gtgccatcac ccaagggagg agggaggaag agactcctgt tgagtgcttc gagccttcga 5160tgctgaagaa gaagcagcta actgtcttag acttgcatcc tggagctggg aaaaccagga 5220gagttcttcc tgaaatagtc cgtgaagcca taaaaacaag actccgtact gtgatcttag 5280ctccaaccag ggttgtcgct gctgaaatgg aggaagccct tagagggctt ccagtgcgtt 5340atatgacaac agcagtcaat gtcacccact ctggaacaga aatcgtcgac ttaatgtgcc 5400atgccacctt cacttcacgt ctactacagc caatcagagt ccccaactat aatctgtata 5460ttatggatga ggcccacttc acagatccct caagtatagc agcaagagga tacatttcaa 5520caagggttga gatgggcgag gcggctgcca tcttcatgac cgccacgcca ccaggaaccc 5580gtgacgcatt tccggactcc aactcaccaa ttatggacac cgaagtggaa gtcccagaga 5640gagcctggag ctcaggcttt gattgggtga cggatcattc tggaaaaaca gtttggtttg 5700ttccaagcgt gaggaacggc aatgagatcg cagcttgtct gacaaaggct ggaaaacggg 5760tcatacagct cagcagaaag acttttgaga cagagttcca gaaaacaaaa catcaagagt 5820gggactttgt cgtgacaact gacatttcag agatgggcgc caactttaaa gctgaccgtg 5880tcatagattc caggagatgc ctaaagccgg tcatacttga tggcgagaga gtcattctgg 5940ctggacccat gcctgtcaca catgccagcg ctgcccagag gagggggcgc ataggcagga 6000atcccaacaa acctggagat gagtatctgt atggaggtgg gtgcgcagag actgacgaag 6060accatgcaca ctggcttgaa gcaagaatgc tccttgacaa tatttacctc caagatggcc 6120tcatagcctc gctctatcga cctgaggccg acaaagtagc agccattgag ggagagttca 6180agcttaggac ggagcaaagg aagacctttg tggaactcat gaaaagagga gatcttcctg 6240tttggctggc ctatcaggtt gcatctgccg gaataaccta cacagataga agatggtgct 6300ttgatggcac gaccaacaac accataatgg aagacagtgt gccggcagag gtgtggacca 6360gacacggaga gaaaagagtg ctcaaaccga ggtggatgga cgccagagtt tgttcagatc 6420atgcggccct gaagtcattc aaggagtttg ccgctgggaa aagaggagcg gcttttggag 6480tgatggaagc cctgggaaca ctgccaggac acatgacaga gagattccag gaagccattg 6540acaacctcgc tgtgctcatg cgggcagaga ctggaagcag gccttacaaa gccgcggcgg 6600cccaattgcc ggagacccta gagaccatta tgcttttggg gttgctggga acagtctcgc 6660tgggaatctt tttcgtcttg atgaggaaca agggcatagg gaagatgggc tttggaatgg 6720tgactcttgg ggccagcgca tggctcatgt ggctctcgga aattgagcca gccagaattg 6780catgtgtcct cattgttgtg ttcctattgc tggtggtgct catacctgag ccagaaaagc 6840aaagatctcc ccaggacaac caaatggcaa tcatcatcat ggtagcagta ggtcttctgg 6900gcttgattac cgccaatgaa ctcggatggt tggagagaac aaagagtgac ctaagccatc 6960taatgggaag gagagaggag ggggcaacca taggattctc aatggacatt gacctgcggc 7020cagcctcagc ttgggccatc tatgctgcct tgacaacttt cattacccca gccgtccaac 7080atgcagtgac cacttcatac aacaactact ccttaatggc gatggccacg caagctggag 7140tgttgtttgg tatgggcaaa gggatgccat tctacgcatg ggactttgga gtcccgctgc 7200taatgatagg ttgctactca caattaacac ccctgaccct aatagtggcc atcattttgc 7260tcgtggcgca ctacatgtac ttgatcccag ggctgcaggc agcagctgcg cgtgctgccc 7320agaagagaac ggcagctggc atcatgaaga accctgttgt ggatggaata gtggtgactg 7380acattgacac aatgacaatt gacccccaag tggagaaaaa gatgggacag gtgctactca 7440tagcagtagc cgtctccagc gccatactgt cgcggaccgc ctgggggtgg ggggaggctg 7500gggccctgat cacagctgca acttccactt tgtgggaagg ctctccgaac aagtactgga 7560actcctctac agccacttca ctgtgtaaca tttttagggg aagttacttg gctggagctt 7620ctctaatcta cacagtaaca agaaacgctg gcttggtcaa gagacgtggg ggtggaacag 7680gagagaccct gggagagaaa tggaaggccc gcttgaacca gatgtcggcc ctggagttct 7740actcctacaa aaagtcaggc atcaccgagg tgtgcagaga agaggcccgc cgcgccctca 7800aggacggtgt ggcaacggga ggccatgctg tgtcccgagg aagtgcaaag ctgagatggt 7860tggtggagcg gggatacctg cagccctatg gaaaggtcat tgatcttgga tgtggcagag 7920ggggctggag ttactacgcc gccaccatcc gcaaagttca agaagtgaaa ggatacacaa 7980aaggaggccc tggtcatgaa gaacccatgt tggtgcaaag ctatgggtgg aacatagtcc 8040gtcttaagag tggggtggac gtctttcata tggcggctga gccgtgtgac acgttgctgt 8100gtgacatagg tgagtcatca tctagtcctg aagtggaaga agcacggacg ctcagagtcc 8160tctccatggt gggggattgg cttgaaaaaa gaccaggagc cttttgtata aaagtgttgt 8220gcccatacac cagcactatg atggaaaccc tggagcgact gcagcgtagg tatgggggag 8280gactggtcag agtgccactc tcccgcaact ctacacatga gatgtactgg gtctctggag 8340cgaaaagcaa caccataaaa agtgtgtcca ccacgagcca gctcctcttg gggcgcatgg 8400acgggcccag gaggccagtg aaatatgagg aggatgtgaa tctcggctct ggcacgcggg 8460ctgtggtaag ctgcgctgaa gctcccaaca tgaagatcat tggtaaccgc attgaaagga 8520tccgcagtga gcacgcggaa acgtggttct ttgacgagaa ccacccatat aggacatggg 8580cttaccatgg aagctatgag gcccccacac aagggtcagc gtcctctcta ataaacgggg 8640ttgtcaggct cctgtcaaaa ccctgggatg tggtgactgg agtcacagga atagccatga 8700ccgacaccac accgtatggt cagcaaagag ttttcaagga aaaagtggac actagggtgc 8760cagaccccca agaaggcact cgtcaggtta tgagcatggt ctcttcctgg ttgtggaaag 8820agctaggcaa acacaaacgg ccacgagtct gtaccaaaga agagttcatc aacaaggttc 8880gtagcaatgc agcattaggg gcaatatttg aagaggaaaa agagtggaag actgcagtgg

8940aagctgtgaa cgatccaagg ttctgggctc tagtggacaa ggaaagagag caccacctga 9000gaggagagtg ccagagttgt gtgtacaaca tgatgggaaa aagagaaaag aaacaagggg 9060aatttggaaa ggccaagggc agccgcgcca tctggtatat gtggctaggg gctagatttc 9120tagagttcga agcccttgga ttcttgaacg aggatcactg gatggggaga gagaactcag 9180gaggtggtgt tgaagggctg ggattacaaa gactcggata tgtcctagaa gagatgagtc 9240gcataccagg aggaaggatg tatgcagatg acactgctgg ctgggacacc cgcatcagca 9300ggtttgatct ggagaatgaa gctctaatca ccaaccaaat ggagaaaggg cacagggcct 9360tggcattggc cataatcaag tacacatacc aaaacaaagt ggtaaaggtc cttagaccag 9420ctgaaaaagg gaagacagtt atggacatta tttcgagaca agaccaaagg gggagcggac 9480aagttgtcac ttacgctctt aacacattta ccaacctagt ggtgcaactc attcggaata 9540tggaggctga ggaagttcta gagatgcaag acttgtggct gctgcggagg tcagagaaag 9600tgaccaactg gttgcagagc aacggatggg ataggctcaa acgaatggca gtcagtggag 9660atgattgcgt tgtgaagcca attgatgata ggtttgcaca tgccctcagg ttcttgaatg 9720atatgggaaa agttaggaag gacacacaag agtggaaacc ctcaactgga tgggacaact 9780gggaagaagt tccgttttgc tcccaccact tcaacaagct ccatctcaag gacgggaggt 9840ccattgtggt tccctgccgc caccaagatg aactgattgg ccgggcccgc gtctctccag 9900gggcgggatg gagcatccgg gagactgctt gcctagcaaa atcatatgcg caaatgtggc 9960agctccttta tttccacaga agggacctcc gactgatggc caatgccatt tgttcatctg 10020tgccagttga ctgggttcca actgggagaa ctacctggtc aatccatgga aagggagaat 10080ggatgaccac tgaagacatg cttgtggtgt ggaacagagt gtggattgag gagaacgacc 10140acatggaaga caagacccca gttacgaaat ggacagacat tccctatttg ggaaaaaggg 10200aagacttgtg gtgtggatct ctcatagggc acagaccgcg caccacctgg gctgagaaca 10260ttaaaaacac agtcaacatg gtgcgcagga tcataggtga tgaagaaaag tacatggact 10320acctatccac ccaagttcgc tacttgggtg aagaagggtc tacacctgga gtgctgtaag 10380caccaatctt agtgttgtca ggcctgctag tcagccacag cttggggaaa gctgtgcagc 10440ctgtgacccc cccaggagaa gctgggaaac caagcctata gtcaggccga gaacgccatg 10500gcacggaaga agccatgctg cctgtgagcc cctcagagga cactgagtca aaaaacccca 10560cgcgcttgga ggcgcaggat gggaaaagaa ggtggcgacc ttccccaccc ttcaatctgg 10620ggcctgaact ggagatcagc tgtggatctc cagaagaggg actagtggtt agaggagacc 10680ccccggaaaa cgcaaaacag catattgacg ctgggaaaga ccagagactc catgagtttc 10740caccacgctg gccgccaggc acagatcgcc gaatagcggc ggccggtgtg gggaaatcca 10800tgggtct 108074210807DNAFlavivirus FSME 42agttgttgat ctgtgtgaat cagactgcga cagttcgagt ttgaagcgaa agctagcaac 60agtatcaaca ggttttattt tggatttgga aacgagagtt tctggtcatg aaaaacccaa 120aaaagaaatc cggaggattc cggattgtca atatgctaaa acgcggagta gcccgtgtga 180gcccctttgg gggcttgaag aggctgccag ccggacttct gctgggtcat gggcccatca 240ggatggtctt ggcgattcta gcctttttga gattcacggc aatcaagcca tcactgggtc 300tcatcaatag atggggttca gtggggaaaa aagaggctat ggaaataata aagaagttca 360agaaagatct ggctgccatg ctgagaataa tcaatgctag gaaggagaag aagagacgag 420gcgcagatac tagtgtcgga attgttggcc tcctgctgac cacagctatg gcagcggagg 480tcactagacg tgggagtgca tactatatgt acttggacag aaacgatgct ggggaggcca 540tatcttttcc aaccacattg gggatgaata agtgttatat acagatcatg gatcttggac 600acatgtgtga tgccaccatg agctatgaat gccctatgct ggatgagggg gtggaaccag 660atgacgtcga ttgttggtgc aacacgacgt caacttgggt tgtgtacgga acctgccatc 720acaaaaaagg tgaagcacgg agatctagaa gagctgtgac gctcccctcc cattccacta 780gaaagctgca aacgcggtcg caaacctggt tggaatcaag agaatacaca aagcacttga 840ttagagtcga aaattggata ttcaggaacc ctggcttcgc gttagcagca gctgccatcg 900cttggctttt gggaagctca acgagccaaa aagtcatata cttggtcgtg atactgctga 960ttgccccggc atacagcatc aggtgcatag gagtcagcaa tagggacttt gtggaaggta 1020tgtcaggtgg gacttgggtt gatgttgtct tggaacatgg aggttgtgtc accgtaatgg 1080cacaggacaa accgactgtc gacatagagc tggttacaac aacagtcagc aacatggcgg 1140aggtaagatc ctactgctat gaggcatcaa tatcagacat ggcttcggac agccgctgcc 1200caacacaagg tgaagcctac cttgacaagc aatcagacac tcaatatgtc tgcaaaagaa 1260cgttagtgga cagaggctgg ggaaatggat gtggactttt tggcaaaggg agcctggtga 1320catgcgctaa gtttgcatgc tccaagaaaa tgaccgggaa gagcatccag ccagagaatc 1380tggagtaccg gataatgctg tcagttcatg gctcccagca cagtgggatg atcgttaatg 1440acacaggaca tgaaactgat gagaatagag cgaaggttga gataacgccc aattcaccaa 1500gagccgaagc caccctgggg ggttttggaa gcctaggact tgattgtgaa ccgaggacag 1560gccttgactt ttcagatttg tattacttga ctatgaataa caagcactgg ttggttcaca 1620aggagtggtt ccacgacatt ccattacctt ggcacgctgg ggcagacacc ggaactccac 1680actggaacaa caaagaagca ctggtagagt tcaaggacgc acatgccaaa aggcaaactg 1740tcgtggttct agggagtcaa gaaggagcag ttcacacggc ccttgctgga gctctggagg 1800ctgagatgga tggtgcaaag ggaaggctgt cctctggcca cttgaaatgt cgcctgaaaa 1860tggataaact tagattgaag ggcgtgtcat actccttgtg taccgcagcg ttcacattca 1920ccaagatccc ggctgaaaca ctgcacggga cagtcacagt ggaggtacag tacgcaggga 1980cagatggacc ttgcaaggtt ccagctcaga tggcggtgga catgcaaact ctgaccccag 2040ttgggaggtt gataaccgct aaccccgtaa tcactgaaag cactgagaac tctaagatga 2100tgctggaact tgatccacca tttggggact cttacattgt cataggagtc ggggagaaga 2160agatcaccca ccactggcac aggagtggca gcaccattgg aaaagcattt gaagccactg 2220tgagaggtgc caagagaatg gcagtcttgg gagacacagc ctgggacttt ggatcagttg 2280gaggcgctct caactcattg ggcaagggca tccatcaaat ttttggagca gctttcaaat 2340cattgtttgg aggaatgtcc tggttctcac aaattctcat tggaacgttg ctgatgtggt 2400tgggtctgaa cacaaagaat ggatctattt cccttatgtg cttggcctta gggggagtgt 2460tgatcttctt atccacagcc gtctctgctg atgtggggtg ctcggtggac ttctcaaaga 2520aggagacgag atgcggtaca ggggtgttcg tctataacga cgttgaagcc tggagggaca 2580ggtacaagta ccatcctgac tccccccgta gattggcagc agcagtcaag caagcctggg 2640aagatggtat ctgtgggatc tcctctgttt caagaatgga aaacatcatg tggagatcag 2700tagaagggga gctcaacgca atcctggaag agaatggagt tcaactgacg gtcgttgtgg 2760gatctgtaaa aaaccccatg tggagaggtc cacagagatt gcccgtgcct gtgaacgagc 2820tgccccacgg ctggaaggct tgggggaaat cgtacttcgt cagagcagca aagacaaata 2880acagctttgt cgtggatggt gacacactga aggtatgccc actcaaacat agagcatgga 2940acagctttct tgtggaggat catgggttcg gggtatttca cactagtgtc tggctcaagg 3000ttagagaaga ttattcatta gagtgtgatc cagccgttat tggaacagct gttaagggaa 3060aggaggctgt acacagtgat ctaggctact ggattgagag tgagaagaat gacacatgga 3120ggctgaagag ggcccatctg atcgagatga aaacatgtga atggccaaag tcccacacat 3180tgtggacaga tggaatagaa gagagtgatc tgatcatacc caagtcttta gctgggccac 3240tcagccatca caataccaga gagggctaca ggacccaaat gaaagggcca tggcacagtg 3300aagagcttga aattcggttt gaggaatgcc caggcactaa ggtccacgtg gaggaaacat 3360gtggaacaag aggaccatct ctgagatcaa ccactgcaag cggaagggtg atcgaggaat 3420ggtgctgcag ggagtgcaca atgcccccac tgtcgttccg ggctaaagat ggctgttggt 3480atggaatgga gataaggccc aggaaagaac cagaaagtaa cttagtaagg tcaatggtga 3540ctgcaggatc aactgatcac atggatcact tctcccttgg agtgcttgtg attctgctca 3600tggtgcagga agggctgaag aagagaatga ccacaaagat catcataagc acatcaatgg 3660cagtgctggt agctatgatc ctgggaggat tttcaatgag tgacctggct aagcttgcaa 3720ttttgatggg tgccaccttc gcggaaatga acactggagg agatgtagct catctggcgc 3780tgatagcggc attcaaagtc agaccagcgt tgctggtatc tttcatcttc agagctaatt 3840ggacaccccg tgaaagcatg ctgctggcct tggcctcgtg tcttttgcaa actgcgatct 3900ccgccttgga aggcgacctg atggttctca tcaatggttt tgctttggcc tggttggcaa 3960tacgagcgat ggttgttcca cgcactgata acatcacctt ggcaatcctg gctgctctga 4020caccactggc ccggggcaca ctgcttgtgg cgtggagagc aggccttgct acttgcgggg 4080ggtttatgct cctctctctg aagggaaaag gcagtgtgaa gaagaactta ccatttgtca 4140tggccctggg actaaccgct gtgaggctgg tcgaccccat caacgtggtg ggactgctgt 4200tgctcacaag gagtgggaag cggagctggc cccctagcga agtactcaca gctgttggcc 4260tgatatgcgc attggctgga gggttcgcca aggcagatat agagatggct gggcccatgg 4320ccgcggtcgg tctgctaatt gtcagttacg tggtctcagg aaagagtgtg gacatgtaca 4380ttgaaagagc aggtgacatc acatgggaaa aagatgcgga agtcactgga aacagtcccc 4440ggctcgatgt ggcgctagat gagagtggtg atttctccct ggtggaggat gacggtcccc 4500ccatgagaga gatcatactc aaggtggtcc tgatgaccat ctgtggcatg aacccaatag 4560ccataccctt tgcagctgga gcgtggtacg tatacgtgaa gactggaaaa aggagtggtg 4620ctctatggga tgtgcctgct cccaaggaag taaaaaaggg ggagaccaca gatggagtgt 4680acagagtaat gactcgtaga ctgctaggtt caacacaagt tggagtggga gttatgcaag 4740agggggtctt tcacactatg tggcacgtca caaaaggatc cgcgctgaga agcggtgaag 4800ggagacttga tccatactgg ggagatgtca agcaggatct ggtgtcatac tgtggtccat 4860ggaagctaga tgccgcctgg gacgggcaca gcgaggtgca gctcttggcc gtgccccccg 4920gagagagagc gaggaacatc cagactctgc ccggaatatt taagacaaag gatggggaca 4980ttggagcggt tgcgctggat tacccagcag gaacttcagg atctccaatc ctagacaagt 5040gtgggagagt gataggactt tatggcaatg gggtcgtgat caaaaatggg agttatgtta 5100gtgccatcac ccaagggagg agggaggaag agactcctgt tgagtgcttc gagccttcga 5160tgctgaagaa gaagcagcta actgtcttag acttgcatcc tggagctggg aaaaccagga 5220gagttcttcc tgaaatagtc cgtgaagcca taaaaacaag actccgtact gtgatcttag 5280ctccaaccag ggttgtcgct gctgaaatgg aggaagccct tagagggctt ccagtgcgtt 5340atatgacaac agcagtcaat gtcacccact ctggaacaga aatcgtcgac ttaatgtgcc 5400atgccacctt cacttcacgt ctactacagc caatcagagt ccccaactat aatctgtata 5460ttatggatga ggcccacttc acagatccct caagtatagc agcaagagga tacatttcaa 5520caagggttga gatgggcgag gcggctgcca tcttcatgac cgccacgcca ccaggaaccc 5580gtgacgcatt tccggactcc aactcaccaa ttatggacac cgaagtggaa gtcccagaga 5640gagcctggag ctcaggcttt gattgggtga cggatcattc tggaaaaaca gtttggtttg 5700ttccaagcgt gaggaacggc aatgagatcg cagcttgtct gacaaaggct ggaaaacggg 5760tcatacagct cagcagaaag acttttgaga cagagttcca gaaaacaaaa catcaagagt 5820gggactttgt cgtgacaact gacatttcag agatgggcgc caactttaaa gctgaccgtg 5880tcatagattc caggagatgc ctaaagccgg tcatacttga tggcgagaga gtcattctgg 5940ctggacccat gcctgtcaca catgccagcg ctgcccagag gagggggcgc ataggcagga 6000atcccaacaa acctggagat gagtatctgt atggaggtgg gtgcgcagag actgacgaag 6060accatgcaca ctggcttgaa gcaagaatgc tccttgacaa tatttacctc caagatggcc 6120tcatagcctc gctctatcga cctgaggccg acaaagtagc agccattgag ggagagttca 6180agcttaggac ggagcaaagg aagacctttg tggaactcat gaaaagagga gatcttcctg 6240tttggctggc ctatcaggtt gcatctgccg gaataaccta cacagataga agatggtgct 6300ttgatggcac gaccaacaac accataatgg aagacagtgt gccggcagag gtgtggacca 6360gacacggaga gaaaagagtg ctcaaaccga ggtggatgga cgccagagtt tgttcagatc 6420atgcggccct gaagtcattc aaggagtttg ccgctgggaa aagaggagcg gcttttggag 6480tgatggaagc cctgggaaca ctgccaggac acatgacaga gagattccag gaagccattg 6540acaacctcgc tgtgctcatg cgggcagaga ctggaagcag gccttacaaa gccgcggcgg 6600cccaattgcc ggagacccta gagaccatta tgcttttggg gttgctggga acagtctcgc 6660tgggaatctt tttcgtcttg atgaggaaca agggcatagg gaagatgggc tttggaatgg 6720tgactcttgg ggccagcgca tggctcatgt ggctctcgga aattgagcca gccagaattg 6780catgtgtcct cattgttgtg ttcctattgc tggtggtgct catacctgag ccagaaaagc 6840aaagatctcc ccaggacaac caaatggcaa tcatcatcat ggtagcagta ggtcttctgg 6900gcttgattac cgccaatgaa ctcggatggt tggagagaac aaagagtgac ctaagccatc 6960taatgggaag gagagaggag ggggcaacca taggattctc aatggacatt gacctgcggc 7020cagcctcagc ttgggccatc tatgctgcct tgacaacttt cattacccca gccgtccaac 7080atgcagtgac cacttcatac aacaactact ccttaatggc gatggccacg caagctggag 7140tgttgtttgg tatgggcaaa gggatgccat tctacgcatg ggactttgga gtcccgctgc 7200taatgatagg ttgctactca caattaacac ccctgaccct aatagtggcc atcattttgc 7260tcgtggcgca ctacatgtac ttgatcccag ggctgcaggc agcagctgcg cgtgctgccc 7320agaagagaac ggcagctggc atcatgaaga accctgttgt ggatggaata gtggtgactg 7380acattgacac aatgacaatt gacccccaag tggagaaaaa gatgggacag gtgctactca 7440tagcagtagc cgtctccagc gccatactgt cgcggaccgc ctgggggtgg ggggaggctg 7500gggccctgat cacagctgca acttccactt tgtgggaagg ctctccgaac aagtactgga 7560actcctctac agccacttca ctgtgtaaca tttttagggg aagttacttg gctggagctt 7620ctctaatcta cacagtaaca agaaacgctg gcttggtcaa gagacgtggg ggtggaacag 7680gagagaccct gggagagaaa tggaaggccc gcttgaacca gatgtcggcc ctggagttct 7740actcctacaa aaagtcaggc atcaccgagg tgtgcagaga agaggcccgc cgcgccctca 7800aggacggtgt ggcaacggga ggccatgctg tgtcccgagg aagtgcaaag ctgagatggt 7860tggtggagcg gggatacctg cagccctatg gaaaggtcat tgatcttgga tgtggcagag 7920ggggctggag ttactacgcc gccaccatcc gcaaagttca agaagtgaaa ggatacacaa 7980aaggaggccc tggtcatgaa gaacccatgt tggtgcaaag ctatgggtgg aacatagtcc 8040gtcttaagag tggggtggac gtctttcata tggcggctga gccgtgtgac acgttgctgt 8100gtgacatagg tgagtcatca tctagtcctg aagtggaaga agcacggacg ctcagagtcc 8160tctccatggt gggggattgg cttgaaaaaa gaccaggagc cttttgtata aaagtgttgt 8220gcccatacac cagcactatg atggaaaccc tggagcgact gcagcgtagg tatgggggag 8280gactggtcag agtgccactc tcccgcaact ctacacatga gatgtactgg gtctctggag 8340cgaaaagcaa caccataaaa agtgtgtcca ccacgagcca gctcctcttg gggcgcatgg 8400acgggcccag gaggccagtg aaatatgagg aggatgtgaa tctcggctct ggcacgcggg 8460ctgtggtaag ctgcgctgaa gctcccaaca tgaagatcat tggtaaccgc attgaaagga 8520tccgcagtga gcacgcggaa acgtggttct ttgacgagaa ccacccatat aggacatggg 8580cttaccatgg aagctatgag gcccccacac aagggtcagc gtcctctcta ataaacgggg 8640ttgtcaggct cctgtcaaaa ccctgggatg tggtgactgg agtcacagga atagccatga 8700ccgacaccac accgtatggt cagcaaagag ttttcaagga aaaagtggac actagggtgc 8760cagaccccca agaaggcact cgtcaggtta tgagcatggt ctcttcctgg ttgtggaaag 8820agctaggcaa acacaaacgg ccacgagtct gtaccaaaga agagttcatc aacaaggttc 8880gtagcaatgc agcattaggg gcaatatttg aagaggaaaa agagtggaag actgcagtgg 8940aagctgtgaa cgatccaagg ttctgggctc tagtggacaa ggaaagagag caccacctga 9000gaggagagtg ccagagttgt gtgtacaaca tgatgggaaa aagagaaaag aaacaagggg 9060aatttggaaa ggccaagggc agccgcgcca tctggtatat gtggctaggg gctagatttc 9120tagagttcga agcccttgga ttcttgaacg aggatcactg gatggggaga gagaactcag 9180gaggtggtgt tgaagggctg ggattacaaa gactcggata tgtcctagaa gagatgagtc 9240gcataccagg aggaaggatg tatgcagatg acactgctgg ctgggacacc cgcatcagca 9300ggtttgatct ggagaatgaa gctctaatca ccaaccaaat ggagaaaggg cacagggcct 9360tggcattggc cataatcaag tacacatacc aaaacaaagt ggtaaaggtc cttagaccag 9420ctgaaaaagg gaagacagtt atggacatta tttcgagaca agaccaaagg gggagcggac 9480aagttgtcac ttacgctctt aacacattta ccaacctagt ggtgcaactc attcggaata 9540tggaggctga ggaagttcta gagatgcaag acttgtggct gctgcggagg tcagagaaag 9600tgaccaactg gttgcagagc aacggatggg ataggctcaa acgaatggca gtcagtggag 9660atgattgcgt tgtgaagcca attgatgata ggtttgcaca tgccctcagg ttcttgaatg 9720atatgggaaa agttaggaag gacacacaag agtggaaacc ctcaactgga tgggacaact 9780gggaagaagt tccgttttgc tcccaccact tcaacaagct ccatctcaag gacgggaggt 9840ccattgtggt tccctgccgc caccaagatg aactgattgg ccgggcccgc gtctctccag 9900gggcgggatg gagcatccgg gagactgctt gcctagcaaa atcatatgcg caaatgtggc 9960agctccttta tttccacaga agggacctcc gactgatggc caatgccatt tgttcatctg 10020tgccagttga ctgggttcca actgggagaa ctacctggtc aatccatgga aagggagaat 10080ggatgaccac tgaagacatg cttgtggtgt ggaacagagt gtggattgag gagaacgacc 10140acatggaaga caagacccca gttacgaaat ggacagacat tccctatttg ggaaaaaggg 10200aagacttgtg gtgtggatct ctcatagggc acagaccgcg caccacctgg gctgagaaca 10260ttaaaaacac agtcaacatg gtgcgcagga tcataggtga tgaagaaaag tacatggact 10320acctatccac ccaagttcgc tacttgggtg aagaagggtc tacacctgga gtgctgtaag 10380caccaatctt agtgttgtca ggcctgctag tcagccacag cttggggaaa gctgtgcagc 10440ctgtgacccc cccaggagaa gctgggaaac caagcctata gtcaggccga gaacgccatg 10500gcacggaaga agccatgctg cctgtgagcc cctcagagga cactgagtca aaaaacccca 10560cgcgcttgga ggcgcaggat gggaaaagaa ggtggcgacc ttccccaccc ttcaatctgg 10620ggcctgaact ggagatcagc tgtggatctc cagaagaggg actagtggtt agaggagacc 10680ccccggaaaa cgcaaaacag catattgacg ctgggaaaga ccagagactc catgagtttc 10740caccacgctg gccgccaggc acagatcgcc gaatagcggc ggccggtgtg gggaaatcca 10800tgggtct 108074344DNAArtificial SequencePrimer sequence 43agagctcgtt tagtgaaccg agttgttagt ctacgtggac cgac 444430DNAArtificial SequencePrimer sequence 44gctgtgtcac ctaaaatggc cattctcttc 304530DNAArtificial SequencePrimer sequence 45gaagagaatg gccattttag gtgacacagc 304630DNAArtificial SequencePrimer sequence 46ggaacaatgc cattcccaag actcctagtg 304730DNAArtificial SequencePrimer sequence 47cactaggagt cttgggaatg gcattgttcc 304830DNAArtificial SequencePrimer sequence 48ggagatcctg acgttccagg agaaaagtcc 304930DNAArtificial SequencePrimer sequence 49ggacttttct cctggaacgt caggatctcc 305032DNAArtificial SequencePrimer sequence 50ggaattttca atgctatgtc tcaacattgg tg 325132DNAArtificial SequencePrimer sequence 51caccaatgtt gagacatagc attgaaaatt cc 325228DNAArtificial SequencePrimer sequence 52ctgtcattgc catctgtgtc accatggg 285328DNAArtificial SequencePrimer sequence 53cccatggtga cacagatggc aatgacag 285440DNAArtificial SequencePrimer sequence 54gatgccatgc cgacccagaa cctgttgatt caacagcacc 405545DNAArtificial SequencePrimer sequence 55ggtgctgttg aatcaacagg ttctgggtcg gcatggcatc tccac 455644DNAArtificial SequencePrimer sequence 56gtcggtccac gtagactaac aactcggttc actaaacgag ctct 445710723DNADengue virus 57agttgttagt ctacgtggac cgacaaagac agattctttg aggaagctaa gcttaacgta 60gttctaacag ttttttaatt agagagcaga tctctgatga ataaccaacg gaaaaaggcg 120agaaatacgc ctttcaatat gctgaaacgc gagagaaacc gcgtgtcaac tgtgcagcag 180ctgacaaaga gattctcact tggaatgcta cagggacgag gaccattgaa actgttcatg 240gccctggtgg catttcttcg tttcctaaca atcccgccaa cagcagggat attaaaaaga 300tggggaacaa tcaaaaaatc aaaggctatc aatgtcttga gagggttcag gaaagagatt 360ggaaggatgc tgaacatctt gaacaggaga cgcagaaccg caggtataat tattatgatg 420attccaacag tgatggcgtt ccatttaacc acacgcaacg gagaaccaca catgatcgtc 480agtagacaag agaaaggaaa aagtcttctg tttaaaacag agaacggtgt gaacatgtgc 540accctcatgg ccatggacct tggtgaactg tgtgaagaca caatcactta taattgtcct 600cttctcaagc agaatgaacc agaagacata gactgttggt gcaactctac gtctacatgg 660gtaacttatg ggacatgcac cgccacagga gaacacagaa gggaaaaaag atcagtggca 720ctcgttccac atgtgggaat gggactggag acacgaactg aaacatggat gtcatcagaa 780ggggcctgga aacacgccca gagaattgaa acttgggtct

tgagacatcc aggcttcacc 840gtaatggcag caatcctggc atacaccata ggaacgacat atttccaaag agtcctgatt 900ttcatcttgc tgacagctgt cgctccttca atgacaatgc gttgtatagg aatatcaaat 960agagactttg tggaaggggt ttcaggagga agctgggttg acatagtctt ggaacatgga 1020agctgtgtga cgacgatggc gaagaataaa ccaacattgg attttgaact gataaaaaca 1080gaagccaaac atcccgccac tctaaggaag tattgtatag aggcaaagct gaccaacaca 1140acaacagcat ctcgctgccc aacacaagga gaacctagcc taaatgaaga acaggacaaa 1200agatttgtct gcaaacactc catggtagac agaggatggg gaaatggatg cggattattt 1260ggaaaaggag gcatcgtgac ctgtgcaatg ttcacatgta aaaagaacat ggaaggaaaa 1320gtcgtgcaac cagaaaattt ggagtacacc attgtgataa cacctcactc aggggaagag 1380aatgcagtcg gaaatgacac aggaaaacac ggcaaggaaa ttaaagtaac accacagagt 1440tccatcacag aagcagaact aacaggctat ggcactgtca cgatggaatg ctctccgaga 1500acgggtctcg acttcaatga gatggtgttg ctgcaaatgg aaaacaaagc ttggctggtg 1560cacaggcaat ggttcttaga cctgccgtta ccatggctgc ccggagcaga cacacaagga 1620tcaaactgga tacagaagga gacattggtc actttcaaaa atccccatgc aaagaaacag 1680gatgttgttg ttttaggatc ccaagaaggg gctatgcata cagcactcac aggggccacg 1740gaaatccaga tgtcgtcagg aaacttactg ttcacaggac atcttaagtg caggttgaga 1800atggacaaac tacagctcaa aggaatgtca tattccatgt gtacaggaaa gtttaaagtt 1860gtgaaggaaa tagcagaaac acaacatgga acaatagtta tcagagtaca atatgaaggg 1920gacggttctc cgtgcaagat cccttttgaa ataatggact tggaaaaaag acatgtctta 1980ggtcgcctga ttacagtcaa cccaattgtc acagaaaaag acagcccagt caacatagaa 2040gcagaacctc cattcggaga cagctatatc attataggag tagaaccggg acaactgaag 2100ctcagctggt ttaagaaagg aagttctatt ggccaaatgt ttgagacaac aatgagagga 2160gcgaagagaa tggccatttt aggtgacaca gcttgggatt ttggatccct gggaggagtg 2220ttcacatcta taggaaaggc cctccaccaa gtctttggag caatctatgg ggctgccttc 2280agtggggttt catggactat gaaaatcctc ataggagtcg tcatcacatg gataggaatg 2340aattcacgta gcacctcact gtctgtgtca ttagtattag tgggggtcgt gacactgtat 2400ttgggagtta tggtgcaggc cgatagtggt tgtgttgtga gttggaaaaa caaagaactg 2460aaatgtggca gtgggatttt tattacagac aacgtgcaca catggacaga acaatacaaa 2520ttccaaccag aatccccttc aaagctggct tcagctattc agaaggctca tgaagaaggc 2580atttgtggaa tccgctcagt aacaagactg gagaatctga tgtggaaaca aataacacca 2640gaactgaatc acattctatc agaaaatgag gtaaagatga ctatcatgac aggagacatt 2700aaaggaatta tgcaggcagg aaaacgatcc ctgcggcctc aacccactga gctgaagtac 2760tcttggaaag catggggcaa agcgaaaatg ctctccacag aacttcataa ccacaccttt 2820ctcattgatg gccccgaaac agcagaatgt cccaacacaa acagagcttg gaactcacta 2880gaagttgaag actatggctt tggagtattc accactaaca tatggctgaa attgaaagaa 2940aggcaggatg tatcttgtga ctcaaaactc atgtcagcag ccataaagga caacagagcc 3000gtccacgccg acatgggtta ttggatagaa agcgcactca atgacacatg gaagattgag 3060aaagcctctt tcattgaagt taaaagctgc cactggccaa agtcacacac cctctggagt 3120aatggagtgc tagaaagtga gatgataatt ccaaagaatt ttgcaggacc agtatcacaa 3180cacaattata gaccaggcta tcatacacaa acggcaggac cctggcatct aggtaggctt 3240gagatggact ttgatttctg cgaaggaacc acagtggtgg tgactgagga ctgtggaaat 3300agaggaccct ctttaagaac aaccactgct tctggaaaac tcataacaga gtggtgctgc 3360cgatcttgca cattaccacc actaaggtac agaggtgagg atggatgctg gtatggaatg 3420gaaatcagac cattgaaaga gaaagaagag aacttggtca actctttggt cacagccgga 3480catggacaga ttgacaactt ctcactagga gtcttgggaa tggcattgtt cctggaagag 3540atgctcagga cccgagtagg aacgaaacat gcaatattac tagttgcagt ttctttcgtg 3600acattgatca cagggaacat gtcctttcga gatttgggga gagtgatggt catggtgggc 3660gctaccatga cggatgacat aggcatgggc gtgacttatc ttgccctatt agcagccttc 3720aaagtcagac caacttttgc agctggacta ctcttaagaa agctgacctc caaggaattg 3780atgatgacca ccataggaat cgtactcctc tcccagagca ccataccaga gactatactt 3840gaactgactg acgcgttggc tttagggatg atggttctta aagtagtgag aaacatggaa 3900aagtaccaac tagcagtgac tatcatggcc atcttgtgcg tcccaaatgc agtgatatta 3960caaaacgcat ggaaagtgag ctgcacaaca ctggcagtgg tgtccgtttc cccactgctt 4020ttaacatcct cacagcagaa agcggattgg ataccactgg cgttgacgat caaaggcctc 4080aatccaacag ccattttctt aacaaccctc tcaagaacta gcaagaaaag gagctggcca 4140ctaaacgagg ctattatggc agtcgggatg gtgagcattt tagccagttc tctcttaaaa 4200aatgatattc ccatgacagg accattagtg gctggagggc ttctcactgt gtgttacgtg 4260ctcactggaa gatcggctga tttggaactg gagagagctg ctgacgtaag atgggaagaa 4320caagcagaga tatcaggaag tagtccaatt ctgtcgataa caatatcgga agatggtagc 4380atgtcgataa aaaatgaaga agaagaacaa acactgacca tactcattag aacaggactg 4440ctggtgatat caggactttt tcccgtgtca ataccaatca cggcagctgc atggtacctg 4500tgggaagtga aaaaacaacg agcaggagta ttgtgggatg tcccttcacc cccacctgtg 4560ggaaaggctg aactggaaga tggagcctat agaatcaagc agaaagggat tctaggatac 4620tcgcagatcg gagccggagt ttacaaagaa ggaacattcc acacaatgtg gcatgtcaca 4680cgtggtgctg tcctaatgca taaagggaag agaattgaac catcatgggc ggacgtcaag 4740aaagacctaa tatcgtatgg aggaggctgg aagctagaag gagaatggaa ggaaggagaa 4800gaagtccagg tcctggcatt agagcctgga aagaatccaa gagccgtcca aacaaaaccc 4860ggtcttttta aaactaacac tggaaccata ggcgccgtgt ctctggactt ttctcctgga 4920acgtcaggat ctccaatcgt cgacaaaaaa ggaaaagttg tgggccttta tggtaacggt 4980gtcgtcacaa ggagtggaac atatgtgagt gccatagccc agactgaaaa aagcatcgaa 5040gacaatccag agattgaaga tgacatcttt cgaaagaaaa gattgaccat catggacctt 5100cacccaggag caggaaaaac aaagagatac cttccagcaa tagtcagaga agccataaaa 5160cgaggcttga gaacactaat cctggccccc actagagttg tggcggctga aatggaagaa 5220gctctcagag gacttccaat aagataccaa accccagcta tcagagctga gcacactggg 5280cgggagattg tggatctaat gtgtcacgcc acatttacca tgaggctact atcaccaatt 5340agagtgccaa attacaacct gattatcatg gatgaagccc atttcacaga cccagcaagc 5400atagcagcta gaggatacat ttcaactcga gtagagatgg gtgaagcagc tgggattttt 5460atgacagcta cccccccagg aagcagagac ccatttcctc agagcaatgc accaatcatg 5520gatgaagaaa gggaaatccc tgagcgttcg tggaactctg gacatgagtg ggtcacggat 5580tttaaaggga agactgtttg gtttgttcca agtataaaag cagggaatga tatagcagct 5640tgcctgagaa agaatggaaa gaaagtgata caactcagca ggaagacctt tgattctgaa 5700tatatcaaga ctaggaccaa tgattgggac tttgtggtca cgacagacat ttcagaaatg 5760ggtgctaact tcaaggccga gagggttata gaccccagac gctgcatgaa accagtaata 5820ctaacagatg gtgaagagcg ggtaatcttg gcaggaccca tgccagtgac ccactctagt 5880gcagcacaaa gaagagggag agtaggaaga aatccaaaaa atgaaagtga ccagtacata 5940tacatggggg aacctctgga aaatgatgaa gactgtgcac actggaaaga agctaagatg 6000cttctagata acatcaacac gcctgaagga atcattccca gcatgttcga accagagcgt 6060gaaaaggtgg acgccattga tggtgaatac cgcttgagag gagaagcgag gaaaactttc 6120gtggacctaa tgagaagagg agacctacca gtctggctag cctacagagt ggcagctgaa 6180ggtatcaact acgcagacag aaggtggtgc tttgatggag tcaagaacaa ccaaatcttg 6240gaagaaaatg tggaagtgga aatttggaca aaagaaggag aaaggaagaa attaaaaccc 6300agatggttgg atgctaggat ctattctgac ccactggcgc tcaaagaatt caaggaattc 6360gcagctggaa gaaagtccct gaccctgaat ctaatcacag agatgggtag gctcccaacc 6420ttcatgaccc agaaagcaag gaatgcactg gacaacttag cagtcttgca cacggctgaa 6480gcaggcggaa gggcgtacaa tcatgctctt agtgaactgc cggagactct ggagacattg 6540cttttactga cacttttggc cacagtcacg ggcggaatct tcctgttctt gatgagcgga 6600aagggtatag ggaagatgac cctgggaatg tgttgcataa tcacggccag tattctccta 6660tggtatgcac aaatacagcc acactggata gcagcttcaa taatactgga gttttttctc 6720atagtcttgc tcattccaga accagaaaag cagagaacac cccaagataa ccaattaact 6780tatgttgtca tagccatcct tacagtggta gctgcaacca tggcaaacga gatgggtttc 6840ctggaaaaaa caaagaaaga ttttggattg ggaagcagta caacccagca acatgagagc 6900aacatcctgg acatagatct acgtcctgca tcagcttgga ctctatatgc cgtggcaaca 6960actttcatca caccaatgtt gagacatagc attgaaaatt cctcagtgaa tgtgtctcta 7020acagccattg ccaaccaagc cacagtgtta atgggtcttg ggaaaggatg gccattgtca 7080aaaatggaca tcggagttcc ccttctcgcc atcgggtgct attcacaagt caaccccata 7140actctcacag cagcccttct ctcattggta gcacattatg ccatcatagg gccaggactc 7200caagcgaaag caactagaga ggctcagaaa agagcagcag cgggcatcat gaaaaaccca 7260actgtggatg gaataacagt gattgaccta gatccaatac cctatgatcc aaagtttgaa 7320aagcagctgg gacaagtaat gctcttagtc ctctgcgtga ctcaagtgtt gatgatgagg 7380actacatggg ctttatgtga agctctaacc ttagcaaccg ggcccatctc tacactgtgg 7440gaaggaaatc cagggagatt ttggaataca actattgcag tgtcaatggc taacattttt 7500agagggagtt acctggccgg agccggactt ctcttctcta tcatgaagaa cacggccaac 7560acaagaaggg gaactggcaa cacaggagag acgcttggag agaaatggaa aaaccggttg 7620aatgcattgg ggaagagtga attccagatc tataagaaaa gtggaatcca ggaagtggat 7680agaaccttag caaaagaagg catcaaaaga ggagaaacgg accatcacgc tgtgtcgcga 7740ggctcggcga aactgagatg gttcgtcgag agaaacctgg tcacaccaga agggaaagta 7800gtggaccttg gctgcggcag ggggggctgg tcatactatt gtgggggact aaagaatgta 7860aaagaagtca aaggcctaac aaaaggagga ccaggacacg aagaacctat tcccatgtca 7920acatacggtt ggaatctggt gcgtcttcaa agtggagttg atgttttttt tactccgcca 7980gaaaagtgtg acacattgct gtgtgacata ggggagtcat caccaaaccc cacggttgag 8040gcaggaagaa cactcagagt tctaaactta gtggaaaatt ggctgaacaa caacacccaa 8100ttttgcataa aggttctcaa cccatatatg ccctcagtta tagaaaaaat ggaagcgcta 8160caaaggaaat acggaggagc tttggtgaga aatccactct cacgaaattc cacacacgag 8220atgtactggg tatccaatgc ttccgggaac atagtgtcat cagtgaacat gatttcaaga 8280atgttaatta acagattcac aatgagacac aagaaggcca catacgagcc agatgttgac 8340ctcggaagtg gaactcgcaa tatcggaatt gaaagtgaga caccaaattt agacataatt 8400gggaaaagaa tagaaaaaat aaaacaagag catgaaacat catggcacta tgaccaagac 8460cacccataca aaacgtgggc ctaccatggc agctacgaaa caaaacagac tggatcagca 8520tcatccatgg tgaacggagt ggttaggctg ctaacaaaac cttgggatgt catccccatg 8580gtgacacaga tggcaatgac agacacgact ccatttggac aacagcgcgt tttcaaagag 8640aaggtggaca cgagaaccca agaaccgaaa gaaggcacga aaaagctaat gaaaatcacg 8700gcagaatggc tctggaaaga actaggaaag aaaaagacac ctaggatgtg caccagagaa 8760gaattcacaa gaaaggtgag aagcaatgca gccttaggtg ccatattcac tgatgagaac 8820aagtggaagt cggcacgtga ggctgttgaa gacagtggat tttgggagtt ggttgacaag 8880gaaaggaatc tccatcttga aggaaagtgt gagacatgtg tgtacaacat gatgggaaag 8940agagagaaga agctagggga gttcggcaaa gcaaaaggca gcagagccat atggtacatg 9000tggcttggag cacgcttctt agagtttgaa gccctaggat tcttgaatga agatcactgg 9060ttttccagag agaactccct gagtggagtg gaaggagaag ggctgcacaa actaggctac 9120attttaagag acgtgagtaa gaaagaagga ggagcaatgt acgccgatga caccgcagga 9180tgggacacaa gaatcacact agaggactta aaaaatgaag aaatggtgac aaaccacatg 9240gaaggagaac acaagaaact tgctgaagcc attttcaaat taacgtacca aaacaaggtg 9300gtgcgtgtac aaagaccaac accaagaggc acagtaatgg acattatatc gagaagagac 9360caaagaggta gtggacaagt cgtcacttat ggcctcaata ctttcaccaa catggaagcc 9420caactgatca gacagatgga gggagaagga gtcttcaaaa gcatccagca actgacagcc 9480acagaagaaa ttgcagtgaa aaactggtta gtaagagtgg ggcgtgagag gttatcaaga 9540atggccatca gtggagatga ttgtgttgtg aaacccttag atgacaggtt tgcaagcgct 9600ctaacagctc taaatgacat gggaaaggtt aggaaagaca tacagcaatg ggaaccttca 9660agaggatgga acgattggac acaagtgccc ttttgttcac accatttcca tgagttaatc 9720atgaaggacg gtcgtgtact cgtagttcca tgcagaaacc aagatgaact gattggtagg 9780gcccgaattt cccagggagc cgggtggtcc ttgcgggaaa cagcctgttt ggggaagtct 9840tacgcccaaa tgtggagcct gatgtacttc cacagacgcg atcttaggct ggcggcaaat 9900gccatttgct cggcagtccc atcacactgg gttccaacaa gtcgaacaac ctggtccata 9960cacgccacac atgagtggat gacaacagaa gacatgctga cagtctggaa cagggtgtgg 10020atccaagaaa acccatggat ggaagacaag actccagtag aatcatggga ggaaatcccg 10080tatttgggga aaagagaaga ccaatggtgc ggctcattga ttgggctaac aagcagggcc 10140acctgggcaa agaacatcca aacagcaata aatcaagtta gatccctaat aggcaatgag 10200gaatacacag actacatgcc atccatgaaa agatttagaa gagaagagga agaggcagga 10260gtcttgtggt agaaagcaga aacatcatga gacaaagtca gaagtcaggt cggattaagc 10320catagtacgg aaaaaactgt gctacctgtg agccccgtcc aaggacgtta aaagaggtca 10380ggccactaca agtgccatag cttgagtaaa ctgtgcagcc tgtagctcca cctgagaagg 10440tgtaaaaaat ctgggaggcc acaaaccatg gaagctgtac gcatggcgta gtggactagc 10500ggttagagga gacccctccc ttacaaatcg cagcaacaat gggggcccaa ggtgagatga 10560agctgtagtc tcactgaaag gactagaggt tagaggagac ccccccgaaa taaaaaacag 10620catattgacg ctgggaaaga ccagagatcc tgctgtctcc tcagcatcat tccaggcaca 10680gaacgccaga aaatggaatg gtgctgttga atcaacaggt tct 107235810723DNADengue virus 58agttgttagt ctacgtggac cgacaaagac agattctttg aggaagctaa gcttaacgta 60gttctaacag ttttttaatt agagagcaga tctctgatga ataaccaacg gaaaaaggcg 120agaaatacgc ctttcaatat gctgaaacgc gagagaaacc gcgtgtcaac tgtgcagcag 180ctgacaaaga gattctcact tggaatgcta cagggacgag gaccattgaa actgttcatg 240gccctggtgg catttcttcg tttcctaaca atcccgccaa cagcagggat attaaaaaga 300tggggaacaa tcaaaaaatc aaaggctatc aatgtcttga gagggttcag gaaagagatt 360ggaaggatgc tgaacatctt gaacaggaga cgcagaaccg caggtataat tattatgatg 420attccaacag tgatggcgtt ccatttaacc acacgcaacg gagaaccaca catgatcgtc 480agtagacaag agaaaggaaa aagtcttctg tttaaaacag agaacggtgt gaacatgtgc 540accctcatgg ccatggacct tggtgaactg tgtgaagaca caatcactta taattgtcct 600cttctcaagc agaatgaacc agaagacata gactgttggt gcaactctac gtctacatgg 660gtaacttatg ggacatgcac cgccacagga gaacacagaa gggaaaaaag atcagtggca 720ctcgttccac atgtgggaat gggactggag acacgaactg aaacatggat gtcatcagaa 780ggggcctgga aacacgccca gagaattgaa acttgggtct tgagacatcc aggcttcacc 840gtaatggcag caatcctggc atacaccata ggaacgacat atttccaaag agtcctgatt 900ttcatcttgc tgacagctgt cgctccttca atgacaatgc gttgtatagg aatatcaaat 960agagactttg tggaaggggt ttcaggagga agctgggttg acatagtctt ggaacatgga 1020agctgtgtga cgacgatggc gaagaataaa ccaacattgg attttgaact gataaaaaca 1080gaagccaaac atcccgccac tctaaggaag tattgtatag aggcaaagct gaccaacaca 1140acaacagcat ctcgctgccc aacacaagga gaacctagcc taaatgaaga acaggacaaa 1200agatttgtct gcaaacactc catggtagac agaggatggg gaaatggatg cggattattt 1260ggaaaaggag gcatcgtgac ctgtgcaatg ttcacatgta aaaagaacat ggaaggaaaa 1320gtcgtgcaac cagaaaattt ggagtacacc attgtgataa cacctcactc aggggaagag 1380aatgcagtcg gaaatgacac aggaaaacac ggcaaggaaa ttaaagtaac accacagagt 1440tccatcacag aagcagaact aacaggctat ggcactgtca cgatggaatg ctctccgaga 1500acgggtctcg acttcaatga gatggtgttg ctgcaaatgg aaaacaaagc ttggctggtg 1560cacaggcaat ggttcttaga cctgccgtta ccatggctgc ccggagcaga cacacaagga 1620tcaaactgga tacagaagga gacattggtc actttcaaaa atccccatgc aaagaaacag 1680gatgttgttg ttttaggatc ccaagaaggg gctatgcata cagcactcac aggggccacg 1740gaaatccaga tgtcgtcagg aaacttactg ttcacaggac atcttaagtg caggttgaga 1800atggacaaac tacagctcaa aggaatgtca tattccatgt gtacaggaaa gtttaaagtt 1860gtgaaggaaa tagcagaaac acaacatgga acaatagtta tcagagtaca atatgaaggg 1920gacggttctc cgtgcaagat cccttttgaa ataatggact tggaaaaaag acatgtctta 1980ggtcgcctga ttacagtcaa cccaattgtc acagaaaaag acagcccagt caacatagaa 2040gcagaacctc cattcggaga cagctatatc attataggag tagaaccggg acaactgaag 2100ctcagctggt ttaagaaagg aagttctatt ggccaaatgt ttgagacaac aatgagagga 2160gcgaagagaa tggccatttt aggtgacaca gcttgggatt ttggatccct gggaggagtg 2220ttcacatcta taggaaaggc cctccaccaa gtctttggag caatctatgg ggctgccttc 2280agtggggttt catggactat gaaaatcctc ataggagtcg tcatcacatg gataggaatg 2340aattcacgta gcacctcact gtctgtgtca ttagtattag tgggggtcgt gacactgtat 2400ttgggagtta tggtgcaggc cgatagtggt tgtgttgtga gttggaaaaa caaagaactg 2460aaatgtggca gtgggatttt tattacagac aacgtgcaca catggacaga acaatacaaa 2520ttccaaccag aatccccttc aaagctggct tcagctattc agaaggctca tgaagaaggc 2580atttgtggaa tccgctcagt aacaagactg gagaatctga tgtggaaaca aataacacca 2640gaactgaatc acattctatc agaaaatgag gtaaagatga ctatcatgac aggagacatt 2700aaaggaatta tgcaggcagg aaaacgatcc ctgcggcctc aacccactga gctgaagtac 2760tcttggaaag catggggcaa agcgaaaatg ctctccacag aacttcataa ccacaccttt 2820ctcattgatg gccccgaaac agcagaatgt cccaacacaa acagagcttg gaactcacta 2880gaagttgaag actatggctt tggagtattc accactaaca tatggctgaa attgaaagaa 2940aggcaggatg tatcttgtga ctcaaaactc atgtcagcag ccataaagga caacagagcc 3000gtccacgccg acatgggtta ttggatagaa agcgcactca atgacacatg gaagattgag 3060aaagcctctt tcattgaagt taaaagctgc cactggccaa agtcacacac cctctggagt 3120aatggagtgc tagaaagtga gatgataatt ccaaagaatt ttgcaggacc agtatcacaa 3180cacaattata gaccaggcta tcatacacaa acggcaggac cctggcatct aggtaggctt 3240gagatggact ttgatttctg cgaaggaacc acagtggtgg tgactgagga ctgtggaaat 3300agaggaccct ctttaagaac aaccactgct tctggaaaac tcataacaga gtggtgctgc 3360cgatcttgca cattaccacc actaaggtac agaggtgagg atggatgctg gtatggaatg 3420gaaatcagac cattgaaaga gaaagaagag aacttggtca actctttggt cacagccgga 3480catggacaga ttgacaactt ctcactagga gtcttgggaa tggcattgtt cctggaagag 3540atgctcagga cccgagtagg aacgaaacat gcaatattac tagttgcagt ttctttcgtg 3600acattgatca cagggaacat gtcctttcga gatttgggga gagtgatggt catggtgggc 3660gctaccatga cggatgacat aggcatgggc gtgacttatc ttgccctatt agcagccttc 3720aaagtcagac caacttttgc agctggacta ctcttaagaa agctgacctc caaggaattg 3780atgatgacca ccataggaat cgtactcctc tcccagagca ccataccaga gactatactt 3840gaactgactg acgcgttggc tttagggatg atggttctta aagtagtgag aaacatggaa 3900aagtaccaac tagcagtgac tatcatggcc atcttgtgcg tcccaaatgc agtgatatta 3960caaaacgcat ggaaagtgag ctgcacaaca ctggcagtgg tgtccgtttc cccactgctt 4020ttaacatcct cacagcagaa agcggattgg ataccactgg cgttgacgat caaaggcctc 4080aatccaacag ccattttctt aacaaccctc tcaagaacta gcaagaaaag gagctggcca 4140ctaaacgagg ctattatggc agtcgggatg gtgagcattt tagccagttc tctcttaaaa 4200aatgatattc ccatgacagg accattagtg gctggagggc ttctcactgt gtgttacgtg 4260ctcactggaa gatcggctga tttggaactg gagagagctg ctgacgtaag atgggaagaa 4320caagcagaga tatcaggaag tagtccaatt ctgtcgataa caatatcgga agatggtagc 4380atgtcgataa aaaatgaaga agaagaacaa acactgacca tactcattag aacaggactg 4440ctggtgatat caggactttt tcccgtgtca acaccaatca cggcagctgc atggtacctg 4500tgggaagtga aaaaacaacg agcaggagta ttgtgggatg tcccttcacc cccacctgtg 4560ggaaaggctg aactggaaga tggagcctat agaatcaagc agaaagggat tctaggatac 4620tcgcagatcg gagccggagt ttacaaagaa ggaacattcc acacaatgtg gcatgtcaca 4680cgtggtgctg tcctaatgca taaagggaag agaattgaac catcatgggc ggacgtcaag 4740aaagacctaa tatcgtatgg aggaggctgg aagctagaag gagaatggaa ggaaggagaa 4800gaagtccagg tcctggcatt agagcctgga aagaatccaa gagccgtcca aacaaaaccc 4860ggtcttttta aaactaacac tggaaccata ggcgccgtgt ctctggactt ttctcctgga 4920acgtcaggat ctccaatcgt cgacaaaaaa ggaaaagttg tgggccttta tggtaacggt 4980gtcgtcacaa ggagtggaac atatgtgagt gccatagccc agactgaaaa aagcatcgaa 5040gacaatccag agattgaaga tgacatcttt cgaaagaaaa gattgaccat catggacctt 5100cacccaggag

caggaaaaac aaagagatac cttccagcaa tagtcagaga agccataaaa 5160cgaggcttga gaacactaat cctggccccc actagagttg tggcggctga aatggaagaa 5220gctctcagag gacttccaat aagataccaa accccagcta tcagagctga gcacactggg 5280cgggagattg tggatctaat gtgtcacgcc acatttacca tgaggctact atcaccaatt 5340agagtgccaa attacaacct gattatcatg gatgaagccc atttcacaga cccagcaagc 5400atagcagcta gaggatacat ttcaactcga gtagagatgg gtgaagcagc tgggattttt 5460atgacagcta cccccccagg aagcagagac ccatttcctc agagcaatgc accaatcatg 5520gatgaagaaa gggaaatccc tgagcgttcg tggaactctg gacatgagtg ggtcacggat 5580tttaaaggga agactgtttg gtttgttcca agtataaaag cagggaatga tatagcagct 5640tgcctgagaa agaatggaaa gaaagtgata caactcagca ggaagacctt tgattctgaa 5700tatatcaaga ctaggaccaa tgattgggac tttgtggtca cgacagacat ttcagaaatg 5760ggtgctaact tcaaggccga gagggttata gaccccagac gctgcatgaa accagtaata 5820ctaacagatg gtgaagagcg ggtaatcttg gcaggaccca tgccagtgac ccactctagt 5880gcagcacaaa gaagagggag agtaggaaga aatccaaaaa atgaaagtga ccagtacata 5940tacatggggg aacctctgga aaatgatgaa gactgtgcac actggaaaga agctaagatg 6000cttctagata acatcaacac gcctgaagga atcattccca gcatgttcga accagagcgt 6060gaaaaggtgg acgccattga tggtgaatac cgcttgagag gagaagcgag gaaaactttc 6120gtggacctaa tgagaagagg agacctacca gtctggctag cctacagagt ggcagctgaa 6180ggtatcaact acgcagacag aaggtggtgc tttgatggag tcaagaacaa ccaaatcttg 6240gaagaaaatg tggaagtgga aatttggaca aaagaaggag aaaggaagaa attaaaaccc 6300agatggttgg atgctaggat ctattctgac ccactggcgc tcaaagaatt caaggaattc 6360gcagctggaa gaaagtccct gaccctgaat ctaatcacag agatgggtag gctcccaacc 6420ttcatgaccc agaaagcaag gaatgcactg gacaacttag cagtcttgca cacggctgaa 6480gcaggcggaa gggcgtacaa tcatgctctt agtgaactgc cggagactct ggagacattg 6540cttttactga cacttttggc cacagtcacg ggcggaatct tcctgttctt gatgagcgga 6600aagggtatag ggaagatgac cctgggaatg tgttgcataa tcacggccag tattctccta 6660tggtatgcac aaatacagcc acactggata gcagcttcaa taatactgga gttttttctc 6720atagtcttgc tcattccaga accagaaaag cagagaacac cccaagataa ccaattaact 6780tatgttgtca tagccatcct tacagtggta gctgcaacca tggcaaacga gatgggtttc 6840ctggaaaaaa caaagaaaga ttttggattg ggaagcagta caacccagca acatgagagc 6900aacatcctgg acatagatct acgtcctgca tcagcttgga ctctatatgc cgtggcaaca 6960actttcatca caccaatgtt gagacatagc attgaaaatt cctcagtgaa tgtgtctcta 7020acagccattg ccaaccaagc cacagtgtta atgggtcttg ggaaaggatg gccattgtca 7080aaaatggaca tcggagttcc ccttctcgcc atcgggtgct attcacaagt caaccccata 7140actctcacag cagcccttct ctcattggta gcacattatg ccatcatagg gccaggactc 7200caagcgaaag caactagaga ggctcagaaa agagcagcag cgggcatcat gaaaaaccca 7260actgtggatg gaataacagt gattgaccta gatccaatac cctatgatcc aaagtttgaa 7320aagcagctgg gacaagtaat gctcttagtc ctctgcgtga ctcaagtgtt gatgatgagg 7380actacatggg ctttatgtga agctctaacc ttagcaaccg ggcccatctc tacactgtgg 7440gaaggaaatc cagggagatt ttggaataca actattgcag tgtcaatggc taacattttt 7500agagggagtt acctggccgg agccggactt ctcttctcta tcatgaagaa cacggccaac 7560acaagaaggg gaactggcaa cacaggagag acgcttggag agaaatggaa aaaccggttg 7620aatgcattgg ggaagagtga attccagatc tataagaaaa gtggaatcca ggaagtggat 7680agaaccttag caaaagaagg catcaaaaga ggagaaacgg accatcacgc tgtgtcgcga 7740ggctcggcga aactgagatg gttcgtcgag agaaacctgg tcacaccaga agggaaagta 7800gtggaccttg gctgcggcag ggggggctgg tcatactatt gtgggggact aaagaatgta 7860aaagaagtca aaggcctaac aaaaggagga ccaggacacg aagaacctat tcccatgtca 7920acatacggtt ggaatctggt gcgtcttcaa agtggagttg atgttttttt tactccgcca 7980gaaaagtgtg acacattgct gtgtgacata ggggagtcat caccaaaccc cacggttgag 8040gcaggaagaa cactcagagt tctaaactta gtggaaaatt ggctgaacaa caacacccaa 8100ttttgcataa aggttctcaa cccatatatg ccctcagtta tagaaaaaat ggaagcgcta 8160caaaggaaat acggaggagc tttggtgaga aatccactct cacgaaattc cacacacgag 8220atgtactggg tatccaatgc ttccgggaac atagtgtcat cagtgaacat gatttcaaga 8280atgttaatta acagattcac aatgagacac aagaaggcca catacgagcc agatgttgac 8340ctcggaagtg gaactcgcaa tatcggaatt gaaagtgaga caccaaattt agacataatt 8400gggaaaagaa tagaaaaaat aaaacaagag catgaaacat catggcacta tgaccaagac 8460cacccataca aaacgtgggc ctaccatggc agctacgaaa caaaacagac tggatcagca 8520tcatccatgg tgaacggagt ggttaggctg ctaacaaaac cttgggatgt catccccatg 8580gtgacacaga tggcaatgac agacacgact ccatttggac aacagcgcgt tttcaaagag 8640aaggtggaca cgagaaccca agaaccgaaa gaaggcacga aaaagctaat gaaaatcacg 8700gcagaatggc tctggaaaga actaggaaag aaaaagacac ctaggatgtg caccagagaa 8760gaattcacaa gaaaggtgag aagcaatgca gccttaggtg ccatattcac tgatgagaac 8820aagtggaagt cggcacgtga ggctgttgaa gacagtggat tttgggagtt ggttgacaag 8880gaaaggaatc tccatcttga aggaaagtgt gagacatgtg tgtacaacat gatgggaaag 8940agagagaaga agctagggga gttcggcaaa gcaaaaggca gcagagccat atggtacatg 9000tggcttggag cacgcttctt agagtttgaa gccctaggat tcttgaatga agatcactgg 9060ttttccagag agaactccct gagtggagtg gaaggagaag ggctgcacaa actaggctac 9120attttaagag acgtgagtaa gaaagaagga ggagcaatgt acgccgatga caccgcagga 9180tgggacacaa gaatcacact agaggactta aaaaatgaag aaatggtgac aaaccacatg 9240gaaggagaac acaagaaact tgctgaagcc attttcaaat taacgtacca aaacaaggtg 9300gtgcgtgtac aaagaccaac accaagaggc acagtaatgg acattatatc gagaagagac 9360caaagaggta gtggacaagt cgtcacttat ggcctcaata ctttcaccaa catggaagcc 9420caactgatca gacagatgga gggagaagga gtcttcaaaa gcatccagca actgacagcc 9480acagaagaaa ttgcagtgaa aaactggtta gtaagagtgg ggcgtgagag gttatcaaga 9540atggccatca gtggagatga ttgtgttgtg aaacccttag atgacaggtt tgcaagcgct 9600ctaacagctc taaatgacat gggaaaggtt aggaaagaca tacagcaatg ggaaccttca 9660agaggatgga acgattggac acaagtgccc ttttgttcac accatttcca tgagttaatc 9720atgaaggacg gtcgtgtact cgtagttcca tgcagaaacc aagatgaact gattggtagg 9780gcccgaattt cccagggagc cgggtggtcc ttgcgggaaa cagcctgttt ggggaagtct 9840tacgcccaaa tgtggagcct gatgtacttc cacagacgcg atcttaggct ggcggcaaat 9900gccatttgct cggcagtccc atcacactgg gttccaacaa gtcgaacaac ctggtccata 9960cacgccacac atgagtggat gacaacagaa gacatgctga cagtctggaa cagggtgtgg 10020atccaagaaa acccatggat ggaagacaag actccagtag aatcatggga ggaaatcccg 10080tatttgggga aaagagaaga ccaatggtgc ggctcattga ttgggctaac aagcagggcc 10140acctgggcaa agaacatcca aacagcaata aatcaagtta gatccctaat aggcaatgag 10200gaatacacag actacatgcc atccatgaaa agatttagaa gagaagagga agaggcagga 10260gtcttgtggt agaaagcaga aacatcatga gacaaagtca gaagtcaggt cggattaagc 10320catagtacgg aaaaaactgt gctacctgtg agccccgtcc aaggacgtta aaagaggtca 10380ggccactaca agtgccatag cttgagtaaa ctgtgcagcc tgtagctcca cctgagaagg 10440tgtaaaaaat ctgggaggcc acaaaccatg gaagctgtac gcatggcgta gtggactagc 10500ggttagagga gacccctccc ttacaaatcg cagcaacaat gggggcccaa ggtgagatga 10560agctgtagtc tcactgaaag gactagaggt tagaggagac ccccccgaaa taaaaaacag 10620catattgacg ctgggaaaga ccagagatcc tgctgtctcc tcagcatcat tccaggcaca 10680gaacgccaga aaatggaatg gtgctgttga atcaacaggt tct 10723

Claims

1. A method of generating a live attenuated vaccine (LAV) comprising the steps of: a) modifying an original virus to generate at least one genetically distinct maladapted virus; b) infecting a host cell with said at least one maladapted virus; c) selecting a host cell that displays a preselected phenotype in response to said infection with said at least one maladapted virus and isolating the viral nucleic acid of said maladapted virus from the host cell; d) sequencing the isolated viral nucleic acid of said maladapted virus and comparing this to the nucleic acid sequence of the original virus; e) reconstructing the maladapted virus from the original virus to produce a candidate live attenuated vaccine; and f) screening said candidate live attenuated vaccine for a predetermined phenotype.

2. The method of claim 1, wherein the modification of a virus in step a) is by passaging the virus at least once in a cell that is of a species distinct from the intended recipient of the LAV, or by exposure to a chemical compound, or by culture at a temperature lower than 37.degree. C., or by random mutagenesis, or a combination thereof.

3. The method of claim 2, wherein the chemical compound is ribavirin or 5-fluorouracil (5-FU).

4. The method of claim 2, wherein the random mutagenesis is error prone polymerase chain reaction (PCR).

5. The method of claim 1, wherein the original virus to be modified in step a) is derived from a clinical isolate.

6. The method of claim 1, wherein the host cell of step b) is a cell of human origin.

7. The method of claim 6, wherein the host cell is HuH-7 or HEK293T.

8. The method of claim 6, wherein the host cell comprises an inducible reporter gene operably linked to at least one promoter associated with innate immunity.

9. The method of claim 8, wherein the inducible reporter comprises an ISRE operably linked to a green fluorescent protein (GFP) gene.

10. The method of claim 9, wherein the ISRE is associated with an IRF3-mediated response.

11. The method of claim 1, wherein the preselected phenotype in step c) is plaque size in a plaque assay or expression of a reporter gene.

12. The method of claim 11, wherein the preselected phenotype is small plaque size relative to a host cell that has been infected with the original virus.

13. The method of claim 11, wherein the selection of the host cell that expresses the reporter gene in step c) is by fluorescence-activated cell sorting (FACS) or magnetic activated cell sorting (MACS) or plaque pickup.

14. The method of claim 1, wherein sequencing of the isolated viral nucleic acid in step d) is by Sanger sequencing or Next-Generation Sequencing.

15. The method of claim 1, wherein reconstruction of the maladapted virus in step e) comprises performing site directed mutagenesis on the nucleic acid sequence of the original virus to conform said original viral nucleic acid sequence to the nucleic acid sequence of the maladapted virus.

16. The method of claim 1, wherein screening in step f) is performed in vitro and/or in vivo.

17. The method of claim 1, wherein the predetermined phenotype of step f) comprises one or more of increased replication rate, immunogenicity, generation of small plaques in plaque assays and increased rate of virus uptake, decreased viremia levels in an animal model, increased survival rate in an animal model, decreased weight loss in an animal model, sterilizing immunity rate relative to at least one other candidate vaccine.

18. The method of claim 1, wherein the virus is selected from the group consisting of dengue virus, yellow fever virus, respiratory syncytial virus, cytomegalovirus, Kaposi's sarcoma-associated herpes virus, Epstein-Barr virus, Human papillomavirus, Japanese encephalitis virus, human immunodeficiency virus (HIV) and Zika virus.

19. The method of claim 1, wherein the maladapted virus sequence is mutated at one or more positions in the maladapted virus sequence with respect to the nucleic acid sequence of the original virus.

20. The method of claim 1, wherein the maladapted virus is mutated at 876T>C, or 2925A>G, or both.

21. A live attenuated vaccine produced according to the method of claim 1.

Images